article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "Endoscopic injection of botulinum toxin is a common method to treat esophageal dysmotility and achalasia. Patients undergoing this procedure who subsequently present with abdominal or back pain and constitutional symptoms should be evaluated for possible complications of the procedure, including occult esophageal perforation, mediastinitis, and mycotic aneurysm of the thoracic aorta. The case described herein illustrates the importance of serial imaging in a patient with persistent symptoms after botulinum toxin injection to identify and to treat occult aortic inoculation leading to mycotic aneurysm before sepsis and aortic rupture ensue with their attendant morbidity and mortality risks.",
"affiliations": "Vascular and Endovascular Surgery, Pima Heart and Vascular, Tucson, Ariz.;Vascular and Endovascular Surgery, Pima Heart and Vascular, Tucson, Ariz.",
"authors": "Berman|Scott S|SS|;Sabat|Joseph S|JS|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.jvscit.2020.04.005",
"fulltext": "\n==== Front\nJ Vasc Surg Cases Innov Tech\nJ Vasc Surg Cases Innov Tech\nJournal of Vascular Surgery Cases and Innovative Techniques\n2468-4287 Elsevier \n\nS2468-4287(20)30059-9\n10.1016/j.jvscit.2020.04.005\nCase report\nMycotic aneurysm of the distal thoracic aorta after botulinum toxin injection for esophageal dysmotility\nBerman Scott S. MD, MHA, FACS, DFSVSbermanaz@gmail.com∗ Sabat Joseph S. MD, PhD Vascular and Endovascular Surgery, Pima Heart and Vascular, Tucson, Ariz\n∗ Correspondence: Scott S. Berman, MD, MHA, FACS, DFSVS, Vascular and Endovascular Surgery, Pima Heart and Vascular, 1815 W St Mary's Rd, Tucson, AZ 85745 bermanaz@gmail.com\n08 5 2020 \n9 2020 \n08 5 2020 \n6 3 388 391\n25 3 2020 17 4 2020 © 2020 The Author(s)2020This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Endoscopic injection of botulinum toxin is a common method to treat esophageal dysmotility and achalasia. Patients undergoing this procedure who subsequently present with abdominal or back pain and constitutional symptoms should be evaluated for possible complications of the procedure, including occult esophageal perforation, mediastinitis, and mycotic aneurysm of the thoracic aorta. The case described herein illustrates the importance of serial imaging in a patient with persistent symptoms after botulinum toxin injection to identify and to treat occult aortic inoculation leading to mycotic aneurysm before sepsis and aortic rupture ensue with their attendant morbidity and mortality risks.\n\nKeywords\nMycotic thoracic aneurysmBotulinum toxin complications\n==== Body\nEndoscopic injection of the esophagus with botulinum toxin (BTX) is an accepted treatment of achalasia or distal esophageal spasm. It is considered an effective and relatively low risk procedure with a low risk of major complications. We report the unusual case of mycotic aneurysm of the distal thoracic aorta after BTX injection in a patient with esophageal dysmotility. The patient has provided consent to publish the case details and images.\n\nCase report\nThe patient is a 73-year-old Hispanic woman who was being treated for hiatal hernia and esophageal dysmotility. She had previously undergone esophagogastroduodenoscopy for dysphagia and was diagnosed with achalasia. She was advised to undergo esophageal manometry and possible myotomy but never followed through on that evaluation because of transportation issues. Six weeks before admission, she presented again to her gastroenterologist with recurrent dysphagia, underwent repeated esophagogastroduodenoscopy, and was noted to have a dilated esophagus with retained food material. At that procedure, she underwent endoscopic removal of the debris and 100 units of BTX injection. Two weeks later, she presented to her community hospital emergency department with abdominal pain and underwent computed tomography (CT) scan of her abdomen and pelvis with no significant pathologic change noted to explain her symptoms. The only finding of significance was a dilated, patulous distal esophagus with small hiatal hernia and some layering fluid in the visualized distal esophagus.\n\nOne month later, she underwent a high-resolution esophageal motility study demonstrating ineffective esophageal motility. She presented again to the same rural community hospital emergency department 4 days after the motility study with complaints of abdominal pain and fever. She again had CT of the abdomen and pelvis, with the only finding noted by the radiologist “debris in the patulous distal esophagus with hiatal hernia. This places the patient at risk for aspiration. Correlate for achalasia.” No mention was made of the new dilation of the midthoracic aorta seen in Fig 1, A that was not present on the scan from 1 month earlier (Fig 1, B). She was again discharged from the emergency department only to present again 2 days later to our emergency department in Tucson with ongoing complaints of fever and abdominal pain. Repeated CT scanning was obtained of the abdomen and pelvis, identifying the pathologic change in her thoracic aorta. She was subsequently admitted with the presumptive diagnosis of mycotic aneurysm and started on antibiotics, and vascular surgery consultation was requested. Her C-reactive protein level and erythrocyte sedimentation rate were elevated, although she had no leukocytosis. A meglumine diatrizoate (Gastrografin) upper gastrointestinal series was ordered, but this imaging failed to show evidence of esophageal perforation. The thoracic aorta was incompletely imaged on the initial CT scan performed in the emergency department, so 2 days after admission, CT angiography of the thoracic aorta was performed. This scan not only confirmed the aortic disease but documented an interval increase in size of the aneurysm by 1.6 cm compared with the scan 2 days earlier (Figs 2 and 3).Fig 1 Computed tomography (CT) scans of abdomen and pelvis demonstrating new aortic dilation in the mid to distal thoracic aorta (A,arrow) not present on similar scan done 1 month previously (B).\n\nFig 2 Computed tomography (CT) scan obtained 7 weeks after botulinum toxin (BTX) injection into the esophagus showing increasing size of aortic aneurysm in the mid to distal thoracic aorta.\n\nFig 3 A, Axial computed tomography (CT) scan on admission demonstrating mycotic aneurysm of 3.5 cm. B, Repeated axial CT scan 48 hours later demonstrating enlargement of mycotic aneurysm to 4.8 cm.\n\n\n\nA cryopreserved aortic homograft was ordered for the patient, which arrived 21 hours later. Immediately on arrival of the graft, the patient underwent repair of the aneurysm through a sixth interspace left thoracotomy with the cryopreserved aortic homograft by a clamp-and-sew technique (Fig 4). Intraoperatively, there was minimal inflammation of the mediastinal pleura and tissue overlying the thoracic aorta in the area of concern. The aorta immediately proximal and distal to the area of concern was normal in size and caliber (Fig 4). Culture specimens of the pleural fluid and the ulcerated segment inside the aneurysm were obtained. Segments of the aneurysm wall involving the ulcer were sent for culture and pathologic examination. No attempt was made to débride or to mobilize the medial wall of the aneurysm from the mediastinum, and no gross evidence of purulence or fistula track was revealed. Pathologic examination showed an adventitial abscess in the resected aorta, although all cultures were negative. The patient's postoperative course was unremarkable, and she was discharged home on postoperative day 7. The infectious disease service recommended 6 weeks of intravenous administration of ertapenem to cover esophageal flora.Fig 4 Intraoperative photograph of mycotic thoracic aneurysm repair showing cryopreserved human aortic homograft interposition through a sixth interspace left thoracotomy.\n\n\n\nDiscussion\nEndoscopic injection of BTX is widely accepted for treatment of achalasia and distal esophageal spasm, with a reported low risk of major complications. In a review of 386 patients undergoing 661 BTX injections, van Hoeij et al1 reported 52 (7.9%) mild complications according to the Clavien-Dindo classification2 occurring in 48 patients. The most common complications were heartburn, chest pain, and epigastric pain. One patient in their series died of mediastinitis. To date, there have been only two cases reported in the literature of thoracic aortic disease related to endoscopic BTX injection. In 2015, Chao et al3 reported a single case of mediastinitis and pseudoaneurysm formation after endoscopic BTX injection. In 2016, Tan et al4 published a case report of an 89-year-old woman who had undergone regular BTX injections for achalasia. Mediastinitis and a small pseudoaneurysm of the thoracic aorta developed. Because of her advanced age and comorbidities, the decision was made to treat her expectantly with antibiotics. She later suffered a cardiac arrest, and after being resuscitated, CT scanning demonstrated enlargement and rupture of the aortic pseudoaneurysm, of which she ultimately died.\n\nSimilar to the two cases reported in the literature, this case demonstrates a somewhat indolent presentation after BTX injection, although our case did not demonstrate significant mediastinitis. The presumed mechanism in the case of mycotic aneurysm after endoscopic BTX injection is by inoculation of upper gastrointestinal flora into the aortic wall by penetration of the injection needle through the attenuated, dilated esophageal wall. This patient had persistent symptoms of pain within days of her treatment, although initial CT scanning at that time was devoid of significant findings. Her persistent pain and the development of fever and chills precipitated repeated evaluation, wherein the aortic disease was missed by the radiologist. Thankfully our patient pursued further evaluation within days of the missed diagnosis because of her persistent symptoms. The pathologic process was identified and was able to be managed before aortic rupture ensued in the setting of rapidly enlarging aortic aneurysm.\n\nSurgical débridement of infected tissues and reconstruction combined with antibiotics are the mainstays of therapy. In this case, the patient was admitted and prescribed antibiotics while a homograft was acquired. Several alternative options exist for the surgical management of mycotic aneurysms, particularly when aortic homografts are unavailable or emergent intervention is needed. Rifampin-soaked or rifampin-bonded Dacron grafts may be used during open repair.5, 6, 7 Femoropopliteal vein autograft is another option for in situ reconstruction.8 An extra-anatomic “exclusion bypass” may be performed, followed by a staged approach through a separate incision for débridement and exclusion of the infected thoracic segment of aorta.9\n\nEndovascular stent grafts, especially those that can be pretreated with rifampin, offer a feasible alternative to open repair.10 The endovascular approach offers the advantages of being less invasive and represents an attractive option particularly in the setting of active hemorrhage or an unstable patient. Stent graft exclusion may be considered either definitive therapy or potentially a bridge to open repair.\n\nConclusions\nAlthough an uncommon complication, persistent pain with other constitutional symptoms after BTX injection for esophageal dysmotility syndromes should warrant initial CT imaging to exclude mediastinitis and aortic disease. Serial investigations during a few weeks are suggested if symptoms fail to resolve predicated on this case report and similar publications.\n\nAuthor conflict of interest: none.\n\nThe editors and reviewers of this article have no relevant financial relationships to disclose per the Journal policy that requires reviewers to decline review of any manuscript for which they may have a conflict of interest.\n==== Refs\nReferences\n1 van Hoeij F.B. Tack J.F. Pandolfino J.E. Sternbach J.M. Roman S. Smout A.J. Complications of botulinum toxin injections for treatment of esophageal motility disorders Dis Esophagus 30 2017 1 5 \n2 Clavien P.A. Barkun J. De Oliveira M.L. Vauthey J.N. Dindo D. Schulick R.D. The Clavien-Dindo classification of surgical complications: five-year experience Ann Surg 250 2009 187 196 19638912 \n3 Chao C.Y. Raj A. Saad N. Hourigan L. Holtmann G. Esophageal perforation, inflammatory mediastinitis and pseudoaneurysm of the thoracic aorta as potential complications of botulinum toxin injection for achalasia Dig Endosc 27 2015 618 621 25329507 \n4 Tan M.Z. Whitgift J. Warren H. Mediastinitis, pseudo-aneurysm formation, aortic bleed, and death from endoscopic botulinum toxin injection Endoscopy 48 Suppl 1 2016 E186 E187 27213973 \n5 Oderich G.S. Panneton J.M. Bower T.C. Cherry K.J. Jr. Rowland C.M. Noel A.A. Infected aortic aneurysms: aggressive presentation, complicated early outcome, but durable results J Vasc Surg 34 2001 900 908 11700493 \n6 Ewing M.J. Houck P.D. Drake G.B. Zehr K.J. Mycotic pseudoaneurysm of the aortic arch with purulent pericardial effusion Ann Thorac Surg 93 2012 1301 1303 22450083 \n7 Uchida N. Katayama A. Tamura K. Miwa S. Masatsugu K. Sueda T. In situ replacement for mycotic aneurysms on the thoracic and abdominal aorta using rifampicin-bonded grafting and omental pedicle grafting Ann Thorac Surg 93 2012 438 442 22054654 \n8 Kieffer E. Petitjean C. Richard T. Godet G. Dhobb M. Ruotolo C. Exclusion-bypass for aneurysms of the descending thoracic and thoracoabdominal aorta Ann Vasc Surg 1 1986 182 195 3504328 \n9 Heneghan R.E. Singh N. Starnes B.W. Successful emergent endovascular repair of a ruptured mycotic thoracic aortic aneurysm Ann Vasc Surg 29 2015 843.e1 843.e6 \n10 Clagett G.P. Valentine R.J. Hagino R.T. Autogenous aortoiliac/femoral reconstruction from superficial femoral-popliteal veins: feasibility and durability J Vasc Surg 25 1997 255 270 9052560\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2468-4287",
"issue": "6(3)",
"journal": "Journal of vascular surgery cases and innovative techniques",
"keywords": "Botulinum toxin complications; Mycotic thoracic aneurysm",
"medline_ta": "J Vasc Surg Cases Innov Tech",
"mesh_terms": null,
"nlm_unique_id": "101701125",
"other_id": null,
"pages": "388-391",
"pmc": null,
"pmid": "32715176",
"pubdate": "2020-09",
"publication_types": "D002363:Case Reports",
"references": "3504328;22054654;22450083;27213973;9052560;11700493;19638912;27337985;25329507;25733223",
"title": "Mycotic aneurysm of the distal thoracic aorta after botulinum toxin injection for esophageal dysmotility.",
"title_normalized": "mycotic aneurysm of the distal thoracic aorta after botulinum toxin injection for esophageal dysmotility"
} | [
{
"companynumb": "US-IPSEN BIOPHARMACEUTICALS, INC.-2020-13548",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BOTULINUM TOXIN TYPE A"
},
... |
{
"abstract": "Proton pump inhibitors (PPIs) are frequently prescribed antiulcer agents in hospitals and are shown to be safer than H-2 blockers. We present a case report of PPI-induced delirium, regarding which not much has been written in the literature.\nWe present a case of a 93-year-old woman with no known past psychiatric history, who was hospitalized for syncope workup and who developed delirium after a double dose of pantoprazole.\nVery few reports of PPI-induced delirium exist in the literature. In this case report, we attempt to highlight the mechanism of PPI induced delirium which in our case was most likely due to the primary effects of PPI and drug-drug interactions. Given the paucity of literature on this topic, we encourage further research into relationship between PPI and delirium and urge caution while using PPIs in geriatric population.",
"affiliations": "SUNY Downstate Medical Center, Brooklyn, NY, USA.;SUNY Downstate Medical Center, Brooklyn, NY, USA.;SUNY Downstate Medical Center, Brooklyn, NY, USA.",
"authors": "Razdan|Anupriya|A|0000-0001-9533-4940;Viswanathan|Ramaswamy|R|;Tusher|Alan|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2018/1232535",
"fulltext": "\n==== Front\nCase Rep PsychiatryCase Rep PsychiatryCRIPSCase Reports in Psychiatry2090-682X2090-6838Hindawi 10.1155/2018/1232535Case ReportPantoprazole-Induced Delirium: Review of a Case and Associated Literature http://orcid.org/0000-0001-9533-4940Razdan Anupriya anupriyarazdan@gmail.comViswanathan Ramaswamy Tusher Alan SUNY Downstate Medical Center, Brooklyn, NY, USAAcademic Editor: Toshiya Inada\n\n2018 4 2 2018 2018 123253526 6 2017 28 11 2017 Copyright © 2018 Anupriya Razdan et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background\n Proton pump inhibitors (PPIs) are frequently prescribed antiulcer agents in hospitals and are shown to be safer than H-2 blockers. We present a case report of PPI-induced delirium, regarding which not much has been written in the literature.\n\n Case Report\n We present a case of a 93-year-old woman with no known past psychiatric history, who was hospitalized for syncope workup and who developed delirium after a double dose of pantoprazole.\n\n Discussion\n Very few reports of PPI-induced delirium exist in the literature. In this case report, we attempt to highlight the mechanism of PPI induced delirium which in our case was most likely due to the primary effects of PPI and drug-drug interactions. Given the paucity of literature on this topic, we encourage further research into relationship between PPI and delirium and urge caution while using PPIs in geriatric population.\n==== Body\n1. Case Report Introduction\nProton pump inhibitors (PPIs) are frequently prescribed antiulcer agents in the hospital. One of the most commonly used PPIs is pantoprazole. PPIs are generally considered safer and more efficacious than H2 blockers as antiulcer agents [1, 2]. A study showed reduced incidence of antiulcer drug associated delirium when medications were switched from H-2 blockers to proton pump inhibitors [3]. While there is plenty of literature supporting the use of pantoprazole as an effective antiulcer agent, only one case of delirium associated with PPIs, omeprazole, has been reported [4]. There are three reports of central nervous system dysregulation reported on omeprazole [5]. There is no reported case of pantoprazole associated delirium in the literature. In our report, we present a case of a 93-year-old woman with no known past psychiatric history and medical history of hypertension and arthritis, who developed symptoms of delirium including visual hallucinations while on pantoprazole.\n\n2. Method\nliterature search was done using keywords like pantoprazole, delirium, proton pump inhibitors, and the central nervous system using search engines like PubMed and PsycINFO.\n\n3. Case Report\nMs. X was a 93-year-old woman with no known past psychiatric history and medical history of essential hypertension and arthritis. She was admitted to our hospital's medical unit for syncope workup following a fall due to syncope.\n\nOn day 1 of her admission, the patient was alert and oriented to time, place, person, and situation.\n\nLaboratory workup done on admission was within normal limits except for low vitamin D level of 25.68.\n\nChest X-ray done was normal. CT head showed evidence of atrophy of brain and microvascular disease.\n\nMRI of the cervical spine showed moderate spondylosis and mild subluxation on a degenerative basis. Moderate central canal stenosis and cord compression C2-T1 with edema and cervical cord compression were noted at C3 and C6 level.\n\nThe patient was evaluated by a neurosurgeon who recommended 6–8 weeks of cervical collar and treatment with dexamethasone along with proton pump inhibitor (PPI) for ulcer prophylaxis. No additional workup was recommended.\n\nThe patient was started on her home medications, which consisted off amlodipine 10 mg daily and oxybutynin 5 mg daily. She was started on dexamethasone 2 mg IV q 12 hrs.\n\nOn day 2 of admission, the patient received two doses of pantoprazole over a period of 5 hours to a total dose of 80 mg on day 2.\n\nOn day 3, the patient was observed to be confused, with acute changes noted in her behavior by staff and family. The patient reported auditory and visual hallucinations and was observed to be internally preoccupied. She was observed to be resisting evaluation and refusing her medications. Diurnal variation in her symptoms was noted with worsening of symptoms during evening and night. The patient did not receive pantoprazole that day as she refused her medications. Dexamethasone was stopped in the evening by the primary team as it was believed to be causing the hallucinations.\n\nOn day 4, the patient continued to be confused and alert but not oriented to time, place, person, or situation. She was aggressive with staff at times and was noted to be talking to herself, internally preoccupied, and refusing her medications. Psychiatry consult team was called to evaluate the patient for these sudden behavioral changes. During the interview with the psychiatrist, she was alert but not oriented to time, place, or person. She was seen to be talking to an imaginary person in the room who was “sitting on the roof,” asking him not to “pull” her hair, and told the writer that she has met her 8 years back in New York (not true). The family denied the patient having any past psychiatric history or history of hallucinations. It was noted that patient had been living alone and had a fair level of premorbid functioning. It was recommended that pantoprazole be stopped and switched to H-2 blockers.\n\nOn day 5, pantoprazole was stopped and the patient was started on ranitidine. She continued to be confused at times but no hallucinations were reported by the nurses. The patient showed an improvement in her behavioral symptoms. Dexamethasone was restarted this day with decreased dose of 2 mg IV daily. Due to a gradual improvement in symptoms, the need for an EEG was not felt necessary.\n\nOn day 6, the patient was alert and oriented to time, place, person, and situation. As per family and primary team, she appeared to be at her baseline functioning, behaviorally.\n\nDexamethasone along with her other medications was continued throughout the hospital course. The patient was in the hospital for 16 days for treatment with dexamethasone with no relapse in her delirious symptoms.\n\n4. Discussion\nDelirium is defined as a disturbance in cognition and attention, developing over a short period of an alternating course. The exact pathophysiology of delirium is not fully understood. However, few hypothesis has been proposed to explain the neurobiology behind it. As per the neurotransmitter hypothesis, abnormalities in various neurotransmitters like decreased cholinergic function, an excess of dopamine, norepinephrine and glutamate release, and both decrease and increase in serotonergic and GABA may be associated with cerebral dysfunction and consequently decreased oxidative metabolism leading to the symptoms of delirium. Another theory supports the role of inflammation and release of cytokines in the causation of delirium due to increased permeability of membranes and influx of cytokines causing disruption of neurotransmitter system. Increased cortisol release during stress may also act on the serotonergic (5-HT1A) receptor in the hippocampus and contribute to the symptoms of delirium [6].\n\nThe elderly are especially sensitive for the development of delirious symptoms while in the hospital due to multiple comorbid conditions and risk factors. Literature shows that delirium itself is known to be an independent predictor of adverse outcomes in elderly hospitalized patients.\n\nProton pump inhibitors inhibit the final step in gastric acid production by irreversibly binding with gastric H+/K+-ATPase (proton pump) and preventing acid release [6].\n\nThe exact mechanism responsible for delirium in our patient is not clear but could have been the result of multiple factors acting in concert. Drug-drug interactions (DDI) were less likely as no significant DDI was noted amongst the patient's medications [7].\n\nPantoprazole is a relatively safe drug but package insert for the drug mentions reports of rare psychiatric side effects like hallucination, confusion, insomnia, and somnolence in the postmarketing period [8].\n\nDexamethasone is a short-acting and potent steroid commonly associated with psychiatric side effects ranging from euphoria, insomnia, mood swings, personality changes, and severe depression to frank psychotic manifestations [9].\n\nIn our case, Ms. X did have some factors in her history that made her more vulnerable to developing delirium like increased age, medical comorbidity, use of high potency steroids, and multiple medications uses. Her timeline for onset of her delirious symptoms and concomitant use of a double dose of pantoprazole and starting dexamethasone made it difficult to determine the cause of her symptoms. Pantoprazole and dexamethasone both were stopped and her symptoms resolved. However, once her symptoms resolved, dexamethasone was restarted with no rebound of her delirious symptoms. This made us think that pantoprazole was the most likely causative agent of her delirium and not dexamethasone. However, dexamethasone cannot be fully ruled out as a causative agent.\n\n5. Conclusion\nDelirium is an important medical condition that is easy to miss or overlook in the medical setting. However, it is important to diagnose it early and address the factors causing it and ensure that the patient and staff are safe. Educating the primary team and the family about the condition and its presentation is important to avoid any biases amongst caregivers and to ensure that the patient gets the best care possible. Patient and family need to be reassured that the behavioral manifestations of delirium will resolve with the condition. Due to the limited literature on this subject, we encourage clinicians to report any such cases found in their practice to build a database for such rare but treatable side effects of the medication.\n\nDisclosure\nPlease note that, at the time of the case report, the primary author, Anupriya Razdan, was a SUNY Downstate affiliate. This paper was published as an abstract at American Psychiatric Association meeting\n\nConflicts of Interest\nThe authors have no conflicts of interest.\n==== Refs\n1 Gisbert J. P. González L. Calvet X. Roqué M. Gabriel R. Pajares J. M. Proton pump inhibitors versus H2-antagonists: a meta-analysis of their efficacy in treating bleeding peptic ulcer Alimentary Pharmacology & Therapeutics 2001 15 7 917 926 10.1046/j.1365-2036.2001.01012.x 2-s2.0-0034954707 11421865 \n2 Zhu L.-L. Zhou Q. The association between gastric acid inhibitors and delirium in geriatric inpatients: implications for clinical practice and research Clinical Interventions in Aging 2016 11 797 799 10.2147/CIA.S111202 2-s2.0-84975217599 27366056 \n3 Fujii S. Tanimukai H. Kashiwagi Y. Comparison and analysis of delirium induced by histamine H 2 receptor antagonists and proton pump inhibitors in cancer patients Case Reports in Oncology 2012 5 2 409 412 10.1159/000341873 2-s2.0-84866853250 22949902 \n4 Heckmann J. G. Birklein F. Neundorfer B. Omeprazole-induced delirium Journal of Neurology 2000 247 1 56 57 2-s2.0-0034067818 10.1007/s004150050011 10701899 \n5 Fireman Z. Kopelman Y. Sternberg A. Central nervous system side effects after proton pump inhibitor treatment Journal of Clinical Gastroenterology 1997 25 4 p. 718 10.1097/00004836-199712000-00047 2-s2.0-18144447000 \n6 Inouye S. K. Delirium in older persons The New England Journal of Medicine 2006 354 11 1157 1165 10.1056/nejmra052321 2-s2.0-33644988306 16540616 \n7 Wedemeyer R.-S. Blume H. Pharmacokinetic drug interaction profiles of proton pump inhibitors: an update Drug Safety 2014 37 4 201 211 10.1007/s40264-014-0144-0 2-s2.0-84899064750 24550106 \n8 Protonix FDA package insert \n9 Decadron package insert, 2012, http://bidocs.boehinger-ingelheim.com/BIWebAccess/viewservlet.ser?docBase=renetnt&folderpath=/prescribing+Information/PIs/Roxane/Dexamethasone/Dexamethasone+Tablets+solution+and+Intensol.pdf\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6838",
"issue": "2018()",
"journal": "Case reports in psychiatry",
"keywords": null,
"medline_ta": "Case Rep Psychiatry",
"mesh_terms": null,
"nlm_unique_id": "101583308",
"other_id": null,
"pages": "1232535",
"pmc": null,
"pmid": "29535880",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "22949902;10701899;11421865;16540616;24550106;9451708;27366056",
"title": "Pantoprazole-Induced Delirium: Review of a Case and Associated Literature.",
"title_normalized": "pantoprazole induced delirium review of a case and associated literature"
} | [
{
"companynumb": "US-PFIZER INC-2018119951",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PANTOPRAZOLE"
},
"drugadditional": "1",
... |
{
"abstract": "The purpose of this study was to investigate the risk of rhabdomyolysis in subjects initiating statin therapy for primary prevention of cardiovascular disease, focusing on the type of statin, dose and time since initiation.\n\n\n\nA nationwide cohort study using French hospital discharge and claims databases was performed, studying subjects from the general population 40-75 years in 2009, with no history of cardiovascular disease and no lipid-lowering drugs during the preceding three-year period, followed for up to seven years. The primary outcome was hospitalization for rhabdomyolysis. Event-free survival analysis and case-time-control analysis were both performed, separately by gender. The cohort included 8,236,667 subjects, 969,460 of whom initiated a lipid-lowering drug for cardiovascular disease primary prevention. During 18,407,391 person-months exposed to statins, 168 events were observed, corresponding to an incidence of rhabdomyolysis of 1.10 per 10,000 person-years (1.54 in men vs 0.81 in women); 10/168 cases were fatal, and 18/168 and 57/168 cases occurred during the first month and first trimester of treatment, respectively. Survival analysis did not reveal any increased overall risk (hazard ratio = 1.02 (0.83-1.25) in men and 0.76 (0.60-0.96) in women). However, exposure to high-potency statins was associated with an increased risk in men (hazard ratio = 1.93 (1.27-2.94)). Rosuvastatin 20 mg (in men and women) and simvastatin 40 mg (in men) were associated with hazard ratios > 5. Case-time-control analyses showed similar patterns of risk. Drug interactions did not appear to significantly contribute to rhabdomyolysis events in this study.\n\n\n\nAlthough the overall risk of statin-associated rhabdomyolysis in the context of primary prevention was not increased, the first months of treatment and the use of high-potency statins represent at-risk situations, which require appropriate monitoring, especially in men.",
"affiliations": "1 Department of Public Health Studies, French National Health Insurance Fund (CNAM), France.;1 Department of Public Health Studies, French National Health Insurance Fund (CNAM), France.;2 Department of Epidemiology of Health Products, French National Agency for Medicines and Health Products Safety (ANSM), France.;4 Department of Internal Medicine, Hôpital Européen Georges Pompidou, France.;2 Department of Epidemiology of Health Products, French National Agency for Medicines and Health Products Safety (ANSM), France.;5 Cardiovascular Prevention Unit, Hôpital de la Pitié, France.;2 Department of Epidemiology of Health Products, French National Agency for Medicines and Health Products Safety (ANSM), France.",
"authors": "Coste|Joël|J|;Billionnet|Cécile|C|;Rudnichi|Annie|A|;Pouchot|Jacques|J|;Dray-Spira|Rosemary|R|;Giral|Philippe|P|;Zureik|Mahmoud|M|",
"chemical_list": "D019161:Hydroxymethylglutaryl-CoA Reductase Inhibitors",
"country": "England",
"delete": false,
"doi": "10.1177/2047487318776831",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2047-4873",
"issue": "26(5)",
"journal": "European journal of preventive cardiology",
"keywords": "Statins; primary prevention; rhabdomyolysis",
"medline_ta": "Eur J Prev Cardiol",
"mesh_terms": "D000328:Adult; D000368:Aged; D002318:Cardiovascular Diseases; D016208:Databases, Factual; D005260:Female; D005602:France; D006801:Humans; D019161:Hydroxymethylglutaryl-CoA Reductase Inhibitors; D015994:Incidence; D008297:Male; D008875:Middle Aged; D011322:Primary Prevention; D000077982:Progression-Free Survival; D012189:Retrospective Studies; D012206:Rhabdomyolysis; D018570:Risk Assessment; D012307:Risk Factors; D012737:Sex Factors; D013997:Time Factors",
"nlm_unique_id": "101564430",
"other_id": null,
"pages": "512-521",
"pmc": null,
"pmid": "29799296",
"pubdate": "2019-03",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Statins for primary prevention and rhabdomyolysis: A nationwide cohort study in France.",
"title_normalized": "statins for primary prevention and rhabdomyolysis a nationwide cohort study in france"
} | [
{
"companynumb": "PHHY2018FR062407",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PRAVASTATIN SODIUM"
},
"drugadditional": "3",
... |
{
"abstract": "To determine the frequency of Th2-mediated allergic diseases (AD) in mainly Th1-driven juvenile idiopathic arthritis (JIA) subtypes.\nNinety-nine JIA patients and 128 control subjects were enrolled in a prospective case-control study. All subjects were assessed with standard allergy questionnaire, complete blood cell count, and total serum immunoglobulin (sIg) E. sIgs G, A, M, Juvenile Arthritis Disease Activity Score-27 (JADAS27), and serum acute phase reactants (sAPR) were obtained in JIA. In the presence of allergic symptoms, skin prick (SPT) and pulmonary function tests (PFT) were performed.\nDespite similar allergy risk factors, the frequencies of asthma and allergic rhinitis were lower in JIA group (all p ≤ .02). Allergic patients with JIA performed lower FEV1/FVC ratio, PEF, and FEF25-75 compared to the control group (all p ≤ .04). JADAS27 and sAPR were similar among JIA patients with and without AD. Two JIA patients were found to have hypogammaglobulinemia.\nThe frequencies of AD, asthma, and allergic rhinitis may decrease in Th1-mediated JIA subtypes although the coexistence does not appear to affect the severity of arthritis whereas allergic symptoms may resolve after immunosuppressive treatment. PFTs should be obtained periodically in JIA. JIA patients may have an underlying primary immunodeficiency (ID) or immunosuppressive drugs may cause secondary ID.KEY POINTSCompared to the population, the frequency of Th2-mediated allergic diseases is lower in oligoarthritis and RF-negative polyarthritis that are primarily driven by a Th1 activity.The coexistence of allergic diseases in juvenile idiopathic arthritis does not affect the severity of arthritis.Pulmonary function tests can be thought to be obtained periodically in juvenile idiopathic arthritis.Immunological workup should be considered in atypically or severely presented patients with juvenile idiopathic arthritis before the initiation of immunosuppressive therapy to differentiate primary and secondary immunodeficiency.",
"affiliations": "Department of Pediatric Rheumatology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Allergy and Immunology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Rheumatology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Rheumatology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Rheumatology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Allergy and Immunology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.;Department of Pediatric Rheumatology, Cerrahpasa Faculty of Medicine, Istanbul University-Cerrahpasa, Istanbul, Turkey.",
"authors": "Avar-Aydin|Pinar Ozge|PO|https://orcid.org/0000-0002-7469-109X;Nepesov|Serdar|S|https://orcid.org/0000-0002-4551-5433;Barut|Kenan|K|https://orcid.org/0000-0001-8459-2872;Sahin|Sezgin|S|https://orcid.org/0000-0002-5365-3457;Adrovic|Amra|A|https://orcid.org/0000-0002-2400-6955;Cokugras|Haluk Cezmi|HC|https://orcid.org/0000-0002-0086-3936;Kasapcopur|Ozgur|O|https://orcid.org/0000-0002-1125-7720",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/14397595.2020.1812820",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1439-7595",
"issue": "31(3)",
"journal": "Modern rheumatology",
"keywords": "Allergic disease; allergic rhinitis; asthma; immunodeficiency disorders; juvenile idiopathic arthritis",
"medline_ta": "Mod Rheumatol",
"mesh_terms": "D000293:Adolescent; D001171:Arthritis, Juvenile; D016022:Case-Control Studies; D002648:Child; D005260:Female; D006801:Humans; D006967:Hypersensitivity; D008297:Male; D012129:Respiratory Function Tests; D012307:Risk Factors; D011795:Surveys and Questionnaires",
"nlm_unique_id": "100959226",
"other_id": null,
"pages": "697-703",
"pmc": null,
"pmid": "32815440",
"pubdate": "2021-05",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Decreased frequency of allergy in juvenile idiopathic arthritis: Results of a case-control study.",
"title_normalized": "decreased frequency of allergy in juvenile idiopathic arthritis results of a case control study"
} | [
{
"companynumb": "TR-PFIZER INC-2021668455",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TOCILIZUMAB"
},
"drugadditional": null,
... |
{
"abstract": "The 8p11 eosinophilic myeloproliferative syndrome (EMS) is an aggressive neoplasm driven by translocation of the fibroblast growth factor receptor 1 and often transforms to leukemias and lymphomas that are refractory to treatment. The first case was identified in 1983, and to date over 70 cases have been reported in the literature. Despite those reports, no consensus exists on management of this condition, and inconsistency in treatment regimens is even more pronounced in the pediatric literature. We report a case of a male infant with the 8p11 EMS, review the published pediatric experience with EMS, and discuss treatment strategies for this enigmatic hematological disorder.",
"affiliations": "Children's Mercy Hospitals and Clinics, Kansas City, Missouri 64113.;Children's Mercy Hospitals and Clinics, Kansas City, Missouri 64113.;Children's Mercy Hospitals and Clinics, Kansas City, Missouri 64113.;Children's Mercy Hospitals and Clinics, Kansas City, Missouri 64113.",
"authors": "Sarthy|Jay F|JF|;Reddivalla|Naresh|N|;Radhi|Mohamed|M|;Chastain|Katherine|K|",
"chemical_list": "D000998:Antiviral Agents; C496348:FGFR1 protein, human; D051496:Receptor, Fibroblast Growth Factor, Type 1; D015774:Ganciclovir",
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.26310",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "64(5)",
"journal": "Pediatric blood & cancer",
"keywords": "FGFR translocation; eosinophilia; myeloproliferative neoplasm",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000998:Antiviral Agents; D016026:Bone Marrow Transplantation; D002648:Child; D002675:Child, Preschool; D002898:Chromosomes, Human, Pair 8; D004802:Eosinophilia; D005260:Female; D015774:Ganciclovir; D015654:Herpesvirus 6, Human; D006801:Humans; D007223:Infant; D008297:Male; D009196:Myeloproliferative Disorders; D051496:Receptor, Fibroblast Growth Factor, Type 1; D019349:Roseolovirus Infections; D055815:Young Adult",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "27808462",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Pediatric 8p11 eosinophilic myeloproliferative syndrome (EMS): A case report and review of the literature.",
"title_normalized": "pediatric 8p11 eosinophilic myeloproliferative syndrome ems a case report and review of the literature"
} | [
{
"companynumb": "US-BAYER-2017-074723",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FLUCONAZOLE"
},
"drugadditional": null,
... |
{
"abstract": "Recreational nitrous oxide (N2O) is commonly used among young people partly due to its low cost and accessibility, and awareness of its potential adverse effects is poor in this group. One such adverse effect is degeneration of the spinal cord due to its disruption of DNA synthesis by inactivating cobalamin (B12).A 19-year-old man presented to the emergency department with a 4-week history of worsening paraesthesia in his fingers and lower limbs, and weakness in the hands and lower limbs for 2 weeks. On examination, he had an ataxic gait, reduced power of grip strength and ankle movements, and impaired sensation in the lower limbs. An MRI brain and spine revealed myelopathy of the cervical and thoracic cord.On further questioning, he reported recreational N2O inhalation. His symptoms improved after stopping this and he was treated with supplementation of B vitamins. Education strategies regarding the risks of N2O misuse are indicated.",
"affiliations": "Emergency Medicine, Imperial College Healthcare NHS Trust, London, UK yorissap5@gmail.com.;Emergency Medicine, Imperial College Healthcare NHS Trust, London, UK.;Emergency Medicine, Imperial College Healthcare NHS Trust, London, UK.",
"authors": "Padayachee|Yorissa|Y|;Richards|Chris|C|;Morgan|Owen|O|",
"chemical_list": "D010087:Oxides; D009609:Nitrous Oxide; D014805:Vitamin B 12",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-240447",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(3)",
"journal": "BMJ case reports",
"keywords": "drug misuse (including addiction); drugs misuse (including addiction); spinal cord; vitamins and supplements",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D009609:Nitrous Oxide; D010087:Oxides; D013118:Spinal Cord Diseases; D052879:Subacute Combined Degeneration; D014805:Vitamin B 12; D014806:Vitamin B 12 Deficiency; D055815:Young Adult",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33722915",
"pubdate": "2021-03-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Inhaled nitrous oxide-induced functional B12 deficiency.",
"title_normalized": "inhaled nitrous oxide induced functional b12 deficiency"
} | [
{
"companynumb": "GB-ALSI-2021000108",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "NITROUS OXIDE"
},
"drugadditional": null,
... |
{
"abstract": "Nephrotic syndrome (NS) in children is associated with spontaneous bacterial infections, including peritonitis as well as cellulitis secondary to chronic third-spacing of intracellular fluid. Typical pathogens that cause cellulitis in these patients are gram-positive bacteria whereas gram-negative organisms are uncommon. We report a case of Escherichia coli bacteremia with associated rapidly progressive cellulitis in an 11-year-old child with newly diagnosed NS, who had only recently started steroid therapy. Our case highlights the multifactorial effects of NS on the immune system that result in a predisposition towards infection. It also underscores the importance of a broad approach to neuro-atypical children with common clinical complaints.",
"affiliations": "Department of Pediatrics, Hasbro Children's Hospital, United States of America, Warren Alpert School of Medicine, Brown University, 593 Eddy St, Providence, RI, 02903, United States.;Department of Pediatrics, Hasbro Children's Hospital, United States of America, Warren Alpert School of Medicine, Brown University, 593 Eddy St, Providence, RI, 02903, United States.;Department of Pediatrics, Hasbro Children's Hospital, United States of America, Warren Alpert School of Medicine, Brown University, 593 Eddy St, Providence, RI, 02903, United States.",
"authors": "Alcorta|Cristina E|CE|;Kronish|Adam R|AR|;Lorenz|Matthew L|ML|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.idcr.2021.e01218",
"fulltext": "\n==== Front\nIDCases\nIDCases\nIDCases\n2214-2509\nElsevier\n\nS2214-2509(21)00174-8\n10.1016/j.idcr.2021.e01218\ne01218\nCase Report\nEscherichia Coli bacteremia and rapidly progressive cellulitis in a child with newly diagnosed nephrotic syndrome\nAlcorta Cristina E. calcorta@lifespan.org\n\nKronish Adam R. Adam_kronish@brown.edu\n⁎\nLorenz Matthew L. matthew.lorenz@lifespan.org\n\nDepartment of Pediatrics, Hasbro Children’s Hospital, United States of America, Warren Alpert School of Medicine, Brown University, 593 Eddy St, Providence, RI, 02903, United States\n⁎ Corresponding author. Adam_kronish@brown.edu\n07 7 2021\n2021\n07 7 2021\n25 e0121816 6 2021\n4 7 2021\n© 2021 The Author(s)\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nNephrotic syndrome (NS) in children is associated with spontaneous bacterial infections, including peritonitis as well as cellulitis secondary to chronic third-spacing of intracellular fluid. Typical pathogens that cause cellulitis in these patients are gram-positive bacteria whereas gram-negative organisms are uncommon. We report a case of Escherichia coli bacteremia with associated rapidly progressive cellulitis in an 11-year-old child with newly diagnosed NS, who had only recently started steroid therapy. Our case highlights the multifactorial effects of NS on the immune system that result in a predisposition towards infection. It also underscores the importance of a broad approach to neuro-atypical children with common clinical complaints.\n\nKeywords\n\nNephrotic syndrome\nCellulitis\nE.Coli\n==== Body\nIntroduction\n\nNephrotic syndrome (NS) is a clinical syndrome characterized by proteinuria, hypoalbuminemia, edema and hyperlipidemia. NS results from multiple underlying etiologies, which influence patients’ responsiveness to treatment. Children with NS are at risk for complications, particularly infection because of the pathophysiology of NS and the use of immunosuppression therapy in its treatment [1]. The case presented demonstrates an atypical microbiological etiology of a common pediatric diagnosis, and highlights how the underlying disease process in conjunction with initiation of therapy may have contributed to infection.\n\nCase report\n\nAn 11-year-old boy with a past history of nonverbal autism spectrum disorder (ASD), epilepsy, and congenital ventriculomegaly presented to his pediatrician with one week of abdominal and lower extremity swelling. Work-up was consistent with NS, for which he was referred to pediatric nephrology and then started on oral prednisolone 30 mg twice/day (approximately 1.2 mg/kg/day). His other home medications included lamotrigine, levetiracetam, vitamin D, and famotidine.\n\nOne week later, he presented to the emergency department after having a seizure lasting several minutes that required intervention with rectal diazepam; his prior seizures had always been brief and never required benzodiazepines. After a brief post-ictal period, he appeared to have a new-onset wide-based gait. Vital signs were within normal limits for age. Examination revealed a rash at the anterior proximal aspect of his left thigh. The rash was targetoid in appearance with an intense, non-blanching erythematous outline and satellite petechiae (Fig.1). There was also symmetric pitting edema in the lower extremities extending to the hips with prominent scrotal edema.Fig. 1 Evolution of cellulitis. 1A Targetoid erythematous skin lesion with scrotal and abdominal edema present 1B. Extension of cellulitis less than 24 h from initial blood culture.\n\nFig. 1\n\nInitial laboratory data was notable for WBC count of 13.4 × 109/L (81 % neutrophils), albumin 1.4 g/dL, calcium 7.0 mg/dL (9.1 when corrected for albumin), and CRP of 130 mg/L; urinalysis with protein of 100 mg/dL, 1 WBC/hpf, negative leukocyte esterase, and negative nitrites; and a urine protein-to-creatinine ratio >3.85. Creatinine was 0.3 mg/dL, which was unchanged from the week prior.\n\nWithin several hours of admission, confluent erythema and warmth extended superiorly to the abdomen and distally down the left lower extremity, eventually reaching the ankle. Given the rapidly progressive nature of the rash and evolving cellulitic appearance, blood cultures were drawn and the patient was started on intravenous cefazolin while discontinuing prednisolone because of the concern for active infection.\n\nThe blood culture began growing gram-negative rods within 16 h, for which therapy was changed from cefazolin to piperacillin-tazobactam. Speciation later revealed Escherichia coli with sensitivity to all tested antibiotics, including ampicillin, ceftriaxone, cefepime, fluoroquinolones, trimethoprim-sulfamethoxazole, and carbapenems. He transitioned to ceftriaxone and later, with ongoing clinical improvement, was discharged home on cefdinir to complete a total 2-week course of antibiotics for treatment of bacteremia and cellulitis.\n\nAdditional work-up during his hospitalization included a venous ultrasound of the left leg, ordered because of the association of NS with hypercoagulation [1], which showed no evidence of deep venous thrombosis. An abdominal ultrasound showed no abnormalities or focal sources of enteric bacteremia, such as an abscess or enteritis.\n\nThe patient returned to the hospital two weeks later with tender erythema and swelling again at the proximal aspect of the left thigh. MRI revealed myositis and fasciitis of the left hemipelvis with small non-drainable fluid collections interposed between the left obturator internus muscle and the left ischium. Blood cultures had no growth. His symptoms improved on cefazolin, after which he transitioned to cephalexin. A renal biopsy was suggestive of minimal change disease as the etiology of his NS, which was later determined to be steroid-resistant.\n\nDiscussion\n\nChildren with NS are at risk for infection in part secondary to the disease process itself and in part due to therapeutic use of immunocompromising agents [1]. A study of 370 hospitalized children with NS found that infection was present in 40 % of patients, most often peritonitis and bacteremia, and less often cellulitis [2].\n\nThere are few case reports of E. coli cellulitis in children with NS apart from our own [3,4]. Unlike prior cases, which featured children with relapsed NS, our patient had a new diagnosis of NS with development of cellulitis occurring within 5 days of starting steroid therapy. Interestingly, E. coli cellulitis occurred in the proximal lower extremities in each of these cases.\n\nTraditional teaching holds that most cases of cellulitis are due to beta-hemolytic streptococci and Staphylococcus aureus; however, a definitive bacteriologic etiology is often difficult to determine, and most patients are treated empirically [5]. Gram-negative rods, including E. coli, are an uncommon cause of cellulitis, more often seen in immunocompromised patients. Of note, a systematic review of bacteremia in the presence of cellulitis found that gram-negative isolates occurred more frequently than S. aureus, although the data was not sufficient to determine how many cases occurred in the setting of immunocompromise [6].\n\nImmune system dysfunction in NS is multifactorial. First, NS is defined by significant proteinuria, which includes loss of immunoglobulins and proteins essential to the complement system. There is evidence that loss of proteins, such as serum factor B, leads to impairment of the alternative complement pathway, which in turn may increase susceptibility to infection by encapsulated or gram-negative organisms, including E. coli [7]. Corticosteroids may also contribute to the immune system dysfunction seen in NS. Glucocorticoids may cause immune dysfunction via inhibition of neutrophil-endothelial adhesion, reduced phagocytosis of opsonized bacteria by the reticular-endothelial system, and slight reductions in IgA and IgG levels. Of note, the time course of immune system dysfunction appears to be variable with neutrophils being affected within hours and immunoglobulin reduction within 2–3 weeks [8]. This study also demonstrated a lack of antibody response in steroid-resistant NS. Nevertheless, the relative amount that steroids versus proteinuria contributes to immune system dysfunction in patients with NS is unclear. Our case suggests that the effects of both the underlying pathophysiology of NS and corticosteroid treatment may be additive or synergistic in their suppression of the body’s immune response to bacteria.\n\nLast, our case highlights the diagnostic challenges inherent in evaluating and treating nonverbal children with ASD. Our patient’s initial chief concerns were seizure and gait disturbance, which in isolation might suggest central nervous system pathology; however, a thorough examination revealed an underlying rash, leading to an infectious work-up. An acute change in behavior from baseline in these patients should always prompt the physician to perform a comprehensive history and examination, and to consider additional work-up for conditions such as constipation, dental caries, urinary tract infections, non-accidental trauma, and dermatologic conditions, among others [9,10].\n\nConclusion\n\nIn conclusion, we present a case of a medically complex child with new-onset NS who presented with E. coli bacteremia and cellulitis within days of initiation of systemic steroids. This case demonstrates how NS may predispose patients to bacterial infections of atypical etiologies because of the immunosuppressive effects of NS itself and its empiric treatment with corticosteroids. Additionally, we highlight the diagnostic challenges of evaluation and management of a nonverbal patient with ASD whose chief concern was not necessarily suggestive of his underlying problem.\n\nFunding\n\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nInformed consent\n\nWritten informed consent was obtained from the patient’s legal guardian for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.\n\nAuthor contribution\n\nCristina E. Alcorta, MD – writing, review, and editing\n\nAdam R. Kronish, MD – writing, review, and editing\n\nMatthew L. Lorenz, MD – writing, review, and editing\n\nDeclaration of Competing Interest\n\nThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\n==== Refs\nReferences\n\n1 Park S.J. Shin J.I. Complications of nephrotic syndrome Korean J Pediatr 54 August (8) 2011 322 328 22087198\n2 Carpenter S.L. Goldman J. Sherman A.K. Selewski D.T. Kallash M. Tran C.L. Association of infections and venous thromboembolism in hospitalized children with nephrotic syndrome Pediatr Nephrol 34 February(2) 2019 261 267 30194664\n3 Sleiman J.N. D’Angelo A. Hammerschlag M.R. Spontaneous Escherichia coli cellulitis in a child with nephrotic syndrome Pediatr Infect Dis J 26 March (3) 2007 266 267 17484229\n4 Asmar B.I. Bashour B.N. Fleischmann L.E. Escherichia coli cellulitis in children with idiopathic nephrotic syndrome Clin Pediatr (Phila) 26 November (11) 1987 592 594 3311534\n5 Stevens D.L. Bisno A.L. Chambers H.F. Dellinger E.P. Goldstein E.J. Gorbach S.L. Practice guidelines for the diagnosis and management of skin and soft tissue infections: 2014 update by the Infectious Diseases Society of America Clin Infect Dis 59 July 15 (2) 2014 e10 52 24973422\n6 Gunderson C.G. Martinello R.A. A systematic review of bacteremias in cellulitis and erysipelas J Infect 64 February (2) 2012 148 155 22101078\n7 Anderson D.C. York T.L. Rose G. Smith C.W. Assessment of serum factor B, serum opsonins, granulocyte chemotaxis, and infection in nephrotic syndrome of children J Infect Dis 140 July (1) 1979 1 11 379244\n8 Settipane G.A. Pudupakkam R.K. McGowan J.H. Corticosteroid effect on immunoglobulins J Allergy Clin Immunol 62 September (3) 1978 162 166 681628\n9 Schweitzer J. James C. Jenkins W. Reiff M.I. Stein M.T. Acute agitation and self-injury in a 5-year old with autism J Dev Behav Pediatr 38 February/March Suppl 1 2017 S63 S65 28141725\n10 Owley T.B. Treatment of individuals with autism spectrum disorders in the emergency department: special considerations Clin Pediatr Emerg Med 5 2004 187 192\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2214-2509",
"issue": "25()",
"journal": "IDCases",
"keywords": "Cellulitis; E.Coli; Nephrotic syndrome",
"medline_ta": "IDCases",
"mesh_terms": null,
"nlm_unique_id": "101634540",
"other_id": null,
"pages": "e01218",
"pmc": null,
"pmid": "34277354",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "22101078;28141725;3311534;24973422;22087198;379244;17484229;30194664;681628",
"title": "Escherichia Coli bacteremia and rapidly progressive cellulitis in a child with newly diagnosed nephrotic syndrome.",
"title_normalized": "escherichia coli bacteremia and rapidly progressive cellulitis in a child with newly diagnosed nephrotic syndrome"
} | [
{
"companynumb": "US-TEVA-2021-US-1961051",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "1",
... |
{
"abstract": "Psychiatric side effects secondary to corticosteroids have been described for a long time. Some reactions are severe, occurring in approximately 5% of patients. These side effects are more difficult to evaluate when corticosteroids are assumed without medical supervision, practicing self-medication influenced by some cultural factors. We here report the case of a young woman with acute corticosteroid-induced psychotic episode. The patient had assumed corticosteroids in an attempt to gain weight. We here highlight the role of diagnostic tests and early management of patients as well as of an effective multidisciplinary strategy, in particular when cultural involvement of patients occurs, as in the case of our patient.",
"affiliations": "Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc.;Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc.;Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc.;Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc.;Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc.",
"authors": "Laffinti|Mahmoud Amine|MA|;Ouadoudi|Jalal El|JE|;Hassani|Hicham Guennouni|HG|;Najib|Rachid|R|;Benali|Abdeslam|A|",
"chemical_list": "D005938:Glucocorticoids",
"country": "Uganda",
"delete": false,
"doi": "10.11604/pamj.2019.33.25.18207",
"fulltext": "\n==== Front\nPan Afr Med JPan Afr Med JPAMJThe Pan African Medical Journal1937-8688The African Field Epidemiology Network PAMJ-33-2510.11604/pamj.2019.33.25.18207Case ReportCorticoïdes et culture: un cas d'épisode psychotique aigu cortico-induit Corticosteroids and culture: a case of acute cortico-induced psychotic episode Laffinti Mahmoud Amine 12&Ouadoudi Jalal El 12Hassani Hicham Guennouni 12Najib Rachid 12Benali Abdeslam 121 Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc2 Faculté de Médecine et de Pharmacie, Université Cadi Ayyad, Marrakech, Maroc& Auteur correspondant: Mahmoud Amine Laffinti, Service de Psychiatrie, Hôpital Militaire Avicenne, Marrakech, Maroc15 5 2019 2019 33 2519 1 2019 02 5 2019 © Mahmoud Amine Laffinti et al.2019The Pan African Medical Journal - ISSN 1937-8688. This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Les effets secondaires psychiatriques des corticoïdes sont décrits depuis longtemps. Certaines réactions sont sévères et concernent environ 5% des patients. Ces effets secondaires sont plus difficiles à évaluer lorsque le recours aux corticoïdes sort du cadre thérapeutique habituel et s'intègre dans une automédication en lien avec certaines influences culturelles. Nous rapportons le cas d'une jeune femme ayant présenté un épisode psychotique aigu dans les suites d'une auto-prise de corticoïdes dans un but de gain de poids. Nous discutons l'intérêt d'un diagnostique et d'une prise en charge précoce ainsi que l'importance du volet préventif multidisciplinaire, en particulier devant l'implication de l'aspect culturel dans l'observation présentée.\n\nPsychiatric side effects secondary to corticosteroids have been described for a long time. Some reactions are severe, occurring in approximately 5% of patients. These side effects are more difficult to evaluate when corticosteroids are assumed without medical supervision, practicing self-medication influenced by some cultural factors. We here report the case of a young woman with acute corticosteroid-induced psychotic episode. The patient had assumed corticosteroids in an attempt to gain weight. We here highlight the role of diagnostic tests and early management of patients as well as of an effective multidisciplinary strategy, in particular when cultural involvement of patients occurs, as in the case of our patient.\n\nCorticoïdescultureeffets secondaires psychiatriquesCorticosteroidsculturepsychiatric secondary effects\n==== Body\nIntroduction\nDepuis leur utilisation dans les années 1950, les corticostéroïdes ont vu leur prescription s'élargir dans différentes disciplines médicales. Leurs effets thérapeutiques dans de multiples pathologies sont, cependant, obtenus au prix d'effets secondaires tout aussi variés. À côté des effets indésirables systémiques (métaboliques, endocriniens, dermatologiques, immunologiques etc.), les corticoïdes ont une action pharmacologique cérébrale pouvant intéresser la régulation veille-sommeil, la mémoire et l'humeur [1]. La prévalence des troubles psychiatriques liés aux corticoïdes varie entre 1,8% et 57% en fonction des études [1]. Ils restent sous-estimés car peu dépistés en clinique, et les études les concernant sont peu disponibles dans la littérature [2,3]. L'estimation de cette prévalence s'avère encore plus difficile lorsque la prise des corticoïdes sort de son cadre thérapeutique habituel et s'intègre dans une dimension d'auto médication ne bénéficiant d'aucun suivi ni contrôle médical. Cette auto médication aux corticoïdes concerne une population de femmes de certaines régions du Maroc et se fait essentiellement dans un but de prise de poids. En effet, dans ces régions, la rondeur est considérée comme un critère de beauté féminine et la surcharge pondérale est un phénomène culturellement admis. Malheureusement ce mésusage des médicaments corticoïdes n'est pas sans risques sanitaires parfois sérieux. Nous proposons l'observation d'une jeune femme insatisfaite de son image corporelle et qui, sous l'influence de ses collègues, va avoir recours à la consommation de produits corticoïdes afin de gagner du poids.\n\nPatient et observation\nMlle I, âgée de 21 ans, célibataire, vit avec sa mère et sa sœur dans une ville du sud marocain. Elle travaille en tant qu'ouvrière et n'a aucun antécédents médicaux ni chirurgicaux ni neuropsychiatriques notoires. Mlle I est admise le matin au service d'accueil des urgences de l'hôpital militaire, amenée par sa famille. La présentation clinique à son arrivée est faite d'une agitation psychomotrice, associée à un syndrome délirant polymorphe, dominé par une thématique de persécution, des hallucinations auditives et un trouble de l'orientation temporo-spaciale. La perturbation de l'humeur se traduit par une élation thymique et une logorrhée alternant avec des propos de menaces auto agressives. Ce tableau clinique a débuté trois jours auparavant par une irritabilité, une anxiété et une insomnie avec quelques éléments délirants. Le diagnostic d'un accès psychotique aigu a été retenu. Les données anamnestiques fournies par la famille nous informent que, depuis une semaine, Mlle I est sous une automédication par un produit proposé par certaines collègues pour « grossir ». Il s'agissait d'un médicament à base de dexaméthasone connu des femmes de la région « pour ses vertus oréxigènes et de gain de poids », et son usage est largement répandu entre elles. Les examens réalisés chez Mlle I comprenant: bilans sanguins, sérologies, une recherche de toxiques dans les urines, une TDM cérébrale, se sont révélés normaux. L'hypothèse de l'origine iatrogène aux corticoïdes de cet accès semblait ainsi très probable. La patiente est hospitalisée dans le service de psychiatrie et a bénéficié d'un traitement antipsychotique à base de risperidone à la posologie progressive jusqu'à 4mg/j associé à un traitement anxiolytique les premiers jours. Ce traitement était bien toléré et a permis un amendement rapide de la symptomatologie psychiatrique au bout d'une semaine. L'antipsychotique a été maintenu, en suivi ambulatoire régulier, à la même posologie pendant six semaines puis réduit à la dose de 2mg/j. Il a été couplé d'une intervention psychothérapeutique et psycho-éducative. L'arrêt du traitement est décidé au bout de six mois. La patiente a pu reprendre son activité professionnelle et les contrôles en consultation jusqu'à 18 mois étaient satisfaisants. Cette présentation clinique illustre le tableau d'un accès psychotique aigu caractérisé. Sa survenue interroge le rôle de la corticothérapie. L'installation rapide après la prise du corticoïde, la résolution précoce des symptômes psychotiques ainsi que l'absence d'antécédents psychiatriques ni de notion d'intoxication par une autre substance sont autant d'éléments pouvant être en faveur d'un lien direct entre la survenue de cet épisode et l'introduction du corticostéroïde.\n\nDiscussion\nLes troubles psychiatriques cortico-induits sont très variés et peuvent balayer un champ très large de la pathologie psychiatrique [4]. Insomnie, anxiété, troubles cognitifs, troubles de l'humeur, idées suicidaires, agitation, état confusionnels [2,5,6]. Ces manifestations psychiatriques ont été décrites depuis plus d'une soixantaine d'années par Rome et Braceland [7] et classées en quatre différents stades: 1) le premier se traduit par une certaine euphorie, une baisse du sentiment de fatigue avec une impression de facilité intellectuelle qui peuvent passer inaperçues; 2) au second stade les signes psychiques deviennent plus marqués avec une excitation et une insomnie. Ces deux premiers stades concernent près de deux tiers des patients; 3) le troisième stade correspond à des tableaux psychiatriques caractérisés de troubles anxieux et de variations thymiques franches; 4) le quatrième stade se caractérise par des réactions psychiatriques plus spectaculaires réalisant des épisodes psychotiques aigus ou confusionnels. Ces réactions sévères sont observées en moyenne chez 5,7% des patients [3,5,8]. Le délai d'apparition des manifestations psychiatriques iatrogènes aux corticoïdes est variable. Généralement il est court, en moins d'une semaine [5,8], notamment pour les symptômes maniaques. La symptomatologie dépressive et anxieuse est observée, plus volontiers, lors d'une corticothérapie plus prolongée [2,5,9,10]. Notre observation illustre parfaitement le type de réaction psychiatrique sévère, installée rapidement après introduction du corticostéroïde. Certains facteurs de risques d'apparition de troubles psychiatriques liés à la corticothérapie ont été proposés. La dose du corticoïde administrée semble être le facteur de risque le plus déterminant: le Boston Collaborative Drug Surveillance Program [11] rapporte dans son étude, que les troubles psychiatriques ont été observés chez: a) 1,3% des patients traités par moins de 40 mg/j de prednisone; b) 4,6% des patients recevant entre 40 et 80 mg/j; c) 18,4% des patients recevant plus de 80 mg/j. La dose du corticoïde ne permet, cependant, pas de prédire de la nature de la réaction psychiatrique ni de sa sévérité ou sa durée [8]. Le type de la molécule corticoïde ne semble pas être déterminant [12]. Le sexe féminin parait également un facteur prédisposant [4,5]. Barrami et al. [2], dans leur étude, soulignent cette prédominance féminine. Les femmes présenteraient plus des épisodes dépressifs, les hommes des épisodes maniaques [5].\n\nDans notre observation, il était difficile de préciser la dose du corticoïde ingérée ni, d'ailleurs, les interactions médicamenteuses qui auraient pu se produire dans cette préparation artisanale. La quête intense de gain pondéral rapide décrit chez Mlle I ainsi que la sévérité du trouble présenté laissent supposer le recours à des doses importantes du corticoïde. Le sexe féminin de notre patiente pourrait avoir favorisé l'apparition des symptômes, mais il ne s'agit que d'un seul cas pour en déduire de telle conclusion. De plus, ce phénomène culturel d'automédication par les corticoïdes ne concernait que les femmes et, par conséquent, le facteur sexe ne peut ici être pris en considération. Les mécanismes physiopathologiques de l'apparition d'effets secondaires iatrogènes aux corticoïdes restent mal établis. Certaines hypothèses considères l'effet des corticostéroïdes sur les systèmes dopaminergique et cholinergique centraux, ou suggèrent une baisse de la sécrétion de la sérotonine qui est largement impliquée dans la régulation de l'humeur et le comportement [3,4,9,13,14]. D'autres hypothèses postulent un effet neurotoxique sur l'hippocampe avec réduction de son volume [15]. L'étude de Brown et al. [16] portant sur 17 patients retrouve, en effet, une baisse du volume hippocampal chez les patients sous corticothérapie par rapport au groupe contrôle. La prise en charge des troubles psychiatriques cortico-induits n'est pas codifiée. En général elle passe d'abord par la réduction progressive de la posologie du corticoïde jusqu'à une dose minimale efficace, voire l'arrêt complet de la corticothérapie. Cette attitude peut permettre, à elle seule, de faire disparaitre la symptomatologie psychiatrique. Or cette réduction n'est pas toujours possible à cause de la pathologie sous-jacente cortico-traitée, comme elle peut s'avérer insuffisante en raison de l'intensité ou la persistance des troubles. Cela justifie d'une prescription d'un traitement spécifique. Le choix de la molécule varie significativement en fonction des études. Il semble dépendre essentiellement de l'expérience des praticiens, en l'absence de recommandations claires de prise en charge [3,13]. Certaines publications montraient l'efficacité des neuroleptiques classiques type haloperidol ou chlorpromazine surtout pour des symptômes maniaques [17,18]. Parmi les antipsychotiques de seconde génération, l'olanzapine reste la molécule la plus documentée avec une efficacité sur la symptomatologie maniaque ou mixte. La risperidone semble aussi efficace pour des symptômes psychotique comme le délire, les hallucinations mais également des symptômes hypomaniaques [8]. L'amélioration clinique se voit en quelques jours à quelques semaines pour les deux molécules. Le recours à d'autres antipsychotiques tel que la quétiapine, l'aripiprazole a également été rapporté [13].\n\nPar ailleurs, certains auteurs ont proposé l'utilisation de molécules thymorégulatrices comme la lamotrigine, le valproate de sodium ou la phenïtoine [8]. Pour Falk et al. [19], la prescription du lithium conjointement pendant la corticothérapie préviendrait l'apparition d'effets secondaires psychiatriques cortico-induits. Concernant les antidépresseurs, il semble que les ISRS, IRSNA: sertraline, fluoxetine, venlafaxine auraient un effet bénéfique sur les symptômes dépressifs [8]. Cette symptomatologie serait, cependant, aggravée sous antidépresseurs tricycliques [20]. Dans le cas clinique que nous avons présenté, la décision d'arrêt du corticoïde ne posait pas de problème puisque cette corticothérapie ne s'intégrait pas dans un cadre thérapeutique. L'intensité du trouble présenté a, toutefois, nécessité le recours à un antipsychotique, la risperidone, associé au départ à un anxiolytique. Cette attitude thérapeutique s'est avérée efficace et a permis un amendement des symptômes en une semaine. Ceci rejoint les résultats décrits dans la littérature. Au-delà des écueils de dépistage et de prise en charge, les troubles psychiatriques iatrogènes aux corticoïdes interrogent une autre dimension aussi importante, celle de la prévention. S'il n'existe pas à ce jour de recommandations claires quant à des mesures préventives particulières, il parait évident que cette prévention pourrait s'appuyer sur une information bien fournie. En effet, les médecins somaticiens doivent toujours, tenir compte de ces effets secondaires psychiatriques et informer leurs patients, cortico-traités, sur les risques de leur survenue ainsi que sur les différents signes cliniques prodromiques. Ceci permettrait un dépistage précoce et par conséquent, une intervention rapide afin d'éviter des réactions plus sévères [20]. Ce rôle des médecins peut être complété par celui des pharmaciens qui peuvent être un acteur intéressant dans cette information du fait de leur contact plus régulier avec les patients et leurs familles [13].\n\nConclusion\nLes troubles psychiatriques cortico-induits sont très variés et intéressent une proportion très large de patients sous corticothérapie. Certaines réactions sont sévères avec un potentiel de gravité imposant des actions thérapeutiques multidisciplinaires associant psychiatres et somaticiens. L'information des équipes soignantes, des patients et de leurs familles sur la possibilité de ces effets secondaires psychiatriques liés aux corticostéroïdes permettrait un dépistage et une prise en charge précoces et éviterait la survenue de troubles graves. Dans le cas particulier de notre observation, le recours clandestin aux corticoïdes sous tendu par des dimensions culturelles, impose des mesures beaucoup plus sérieuses qui doivent intégrer, outre les professionnels de santé, les travailleurs sociaux ainsi que les médias dans le but d'éclairer la population sur les risques, aussi bien somatiques que psychiatriques de cette automédication. Des enquêtes plus larges sont alors nécessaires pour pouvoir mesurer l'ampleur de ce phénomène culturel et mettre en place des mesures adaptées.\n\nConflits d’intérêts\nLes auteurs ne déclarent aucun conflit d'intérêts.\n\nContributions des auteurs\nTous les auteurs ont participé à la réalisation de ce travail. Mahmoud Amine Laffinti a rédigé le manuscrit, Jalal EL Ouadoudi, Hicham Guennouni Hassani, et Rachid Najib ont participé dans la recherche bibliographique, Abdeslam Benali a supervisé et corrigé le travail. Tous ont lu et approuvé la version finale du manuscrit.\n==== Refs\nRéférences\n1 Fietta P Fietta P Glucocorticoids and brain functions Riv Biol 2007 Sep-Déc 100 3 403 18 18278739 \n2 Barrimi M Aalouane R Aarab C Hafidi H Baybay H Soughi M Corticothérapie prolongée et troubles anxieux et dépressifs: étude longitudinale sur 12 mois L'Encéphale 2013 Febr 39 1 59 65 \n3 Carle G Abgrall-Barbry G Conduites suicidaires et corticothérapie?: à propos d'un cas L'Encéphale 2016 6 42 3 272 6 \n4 Warrington TP Bostwick JM Psychiatric adverse effects of corticosteroids Mayo Clinic Proceedings 2006 10 81 10 1361 7 17036562 \n5 Kenna HA Poon AW de los Angeles CP Koran LM Psychiatric complications of treatment with corticosteroids: review with case report: corticosteroid psychiatric complications Psychiatry and Clinical Neurosciences 2011 10 65 6 549 60 22003987 \n6 Morrow SA Barr J Rosehart H Ulch S Depression and hypomania symptoms are associated with high dose corticosteroids treatment for MS relapses Journal of Affective Disorders 2015 11 187 142 6 26334182 \n7 Rome HP Braceland FJ The psychological response to ACTH, cortisone, hydrocortisone, and related steroid substances Am J Psychiatry 1952 Mars 108 9 641 51 14903192 \n8 Muzyk AJ Holt S Gagliardi JP Corticosteroid psychosis: stop therapy or add psychotropics'o Off-label antipsychotics, mood stabilizers, and anticonvulsants could help Current Psychiatry 2010 Janv 9 1 61 \n9 Iskandar JW Wood RL Ali R Alemu F Panic attack induced by a single dose of prednisone Ann Pharmacother 2011 11 45 11 1456 7 22009994 \n10 Sirois F Steroid psychosis: a review Gen Hosp Psychiatry 2003 Févr 25 1 27 33 12583925 \n11 Naber D Sand P Heigl B Acute adverse reactions to prednisone in relation to dosage Clin Pharmacol Ther 1972 10 13 5 694 8 5053810 \n12 Ricoux A Guitteny-Collas M Sauvaget A Delvot P Pottier P Hamidou M Troubles psychiatriques induits par la corticothérapie orale: mise au point sur la nature, l'incidence, les facteurs de risque et le traitement La Revue de Médecine Interne 2013 Mai 34 5 293 302 23374903 \n13 Kusljic S Manias E Gogos A Corticosteroid-induced psychiatric disturbances: it is time for pharmacists to take notice Research in Social and Administrative Pharmacy 2016 Mars 12 2 355 60 26104680 \n14 Vázquez DM Neal CR Patel PD Kaciroti N López JF Regulation of corticoid and serotonin receptor brain system following early life exposure of glucocorticoids: long term implications for the neurobiology of mood Psychoneuroendocrinology 2012 Mars 37 3 421 37 21855221 \n15 Preda A Fazeli A McKay BG Bowers MB Mazure CM Lamotrigine as prophylaxis against steroid-induced mania J Clin Psychiatry 1999 10 60 10 708 9 \n16 Brown ES Woolston DJ Frol A Bobadilla L Khan DA Hanczyc M Hippocampal volume, spectroscopy, cognition, and mood in patients receiving corticosteroid therapy Biol Psychiatry 2004 Mars 1 55 5 538 45 15023583 \n17 Wada K Yamada N Sato T Suzuki H Miki M Lee Y Corticosteroid-Induced Psychotic and Mood Disorders: Diagnosis Defined by DSM-IV and Clinical Pictures Psychosomatics 2001 11 42 6 461 6 11815680 \n18 Bloch M Gur E Shalev A Chlorpromazine prophylaxis of steroid-induced psychosis Gen Hosp Psychiatry 1994 Janv 16 1 42 4 8039683 \n19 Falk WE Mahnke MW Poskanzer DC Lithium prophylaxis of corticotropin-induced psychosis JAMA 1979 Mars 9 241 10 1011 2 216818 \n20 Airagnes G Rouge-Maillart C Garre J-B Gohier B Homicide et épisode psychotique aigu cortico-induit?: à propos d'un cas L'Encéphale 2012 10 38 5 440 4\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "33()",
"journal": "The Pan African medical journal",
"keywords": "Corticosteroids; culture; psychiatric secondary effects",
"medline_ta": "Pan Afr Med J",
"mesh_terms": "D003469:Culture; D005260:Female; D005938:Glucocorticoids; D006801:Humans; D011605:Psychoses, Substance-Induced; D012651:Self Medication; D055815:Young Adult",
"nlm_unique_id": "101517926",
"other_id": null,
"pages": "25",
"pmc": null,
"pmid": "31384340",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "10549692;11815680;12583925;14903192;15023583;17036562;18278739;216818;21855221;22003987;22009994;23062459;23095587;23374903;26104680;26334182;26923998;5053810;8039683",
"title": "Corticosteroids and culture: a case of acute cortico-induced psychotic episode.",
"title_normalized": "corticosteroids and culture a case of acute cortico induced psychotic episode"
} | [
{
"companynumb": "MA-MYLANLABS-2019M1095189",
"fulfillexpeditecriteria": "1",
"occurcountry": "MA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nTenofovir (TDF) can cause kidney injury through tubular dysfunction, with or without drop of estimated glomerular filtration rate (eGFR). Whether mild eGFR reductions during treatment should be considered a reason for prompt TDF discontinuation, however, remains unclear.\n\n\nMETHODS\nPatients with normal pre-TDF eGFR levels, who had developed mild renal impairment (i.e., two consecutive eGFR results between 89-60 ml/min) on TDF, were observed until onset of chronic kidney disease (CKD), defined as two eGFR<60 ml/min 3 to 6 months apart. Multivariable Poisson regression analysis was used to investigate whether outcome was associated with current and cumulative use of TDF (modeled as time-varying covariates).\n\n\nRESULTS\n2023 (29%) out of 6984 patients developed mild renal impairment on TDF. Among them, 191 progressed to CKD. The incidence of CKD did not significantly differ during TDF treatment (2.6 per 100 PYFU; 95%CI 2.2-3.2) or after its discontinuation (2.2 per 100 PYFU; 95%CI 1.8-2.6). However, the rate of CKD was significantly higher among patients continuing with TDF treatment compared to those who had discontinued it within 6 months of occurrence of mild renal impairment (aIRR 4, 95%CI 2.4-6.8). In contrast, among patients who had maintained TDF >6 months despite mild renal impairment, current TDF use was not associated with a significantly higher rate of CKD. Other significant predictors of CKD were older age, intravenous drug use, diabetes, hypertension, lower pre-TDF eGFR, higher eGFR drop since TDF introduction and longer exposure to TDF.\n\n\nCONCLUSIONS\nPrompt discontinuation of TDF among patients developing mild renal impairment may prevent further progression of renal damage.",
"affiliations": "\"San Gerardo\" Hospital, Monza, Italy.;University of Milano-Bicocca, Milan, Italy.;University of Brescia, Brescia, Italy.;Papa Giovanni XXIII Hospital, Bergamo, Italy.;Università Cattolica del Sacro Cuore, Rome, Italy.;Ospedale S. Maria Annunziata, Florence, Italy.;Ospedale Policlinico, Bari, Italy.;Ospedale Sant'Anna, Ferrara, Italy.;Istituti Ospitalieri, Cremona, Italy.;\"San Gerardo\" Hospital, Monza, Italy.;\"San Gerardo\" Hospital, Monza, Italy.;University of Brescia, Brescia, Italy.;Università Cattolica del Sacro Cuore, Rome, Italy.;\"San Gerardo\" Hospital, Monza, Italy.;University of Milano-Bicocca, Milan, Italy.;University \"Magna Graecia\", Catanzaro, Italy.;\"San Gerardo\" Hospital, Monza, Italy.",
"authors": "Lapadula|Giuseppe|G|http://orcid.org/0000-0002-9976-8102;Bernasconi|Davide Paolo|DP|;Casari|Salvatore|S|;Maggiolo|Franco|F|;Cauda|Roberto|R|;Di Pietro|Massimo|M|;Ladisa|Nicoletta|N|;Sighinolfi|Laura|L|;Dal Zoppo|Sarah|S|;Sabbatini|Francesca|F|;Soria|Alessandro|A|;Pezzoli|Chiara|C|;Mondi|Annalisa|A|;Costarelli|Silvia|S|;Valsecchi|Maria Grazia|MG|;Torti|Carlo|C|;Gori|Andrea|A|;|||",
"chemical_list": "D019380:Anti-HIV Agents; D000068698:Tenofovir",
"country": "United States",
"delete": false,
"doi": "10.1371/journal.pone.0162320",
"fulltext": "\n==== Front\nPLoS OnePLoS ONEplosplosonePLoS ONE1932-6203Public Library of Science San Francisco, CA USA 2763236910.1371/journal.pone.0162320PONE-D-16-20273Research ArticleMedicine and Health SciencesNephrologyChronic Kidney DiseaseMedicine and Health SciencesPharmacologyDrugsAntimicrobialsAntiviralsAntiretroviralsBiology and Life SciencesMicrobiologyMicrobial ControlAntimicrobialsAntiviralsAntiretroviralsBiology and Life SciencesMicrobiologyVirologyAntiviralsAntiretroviralsBiology and Life SciencesPhysiologyRenal PhysiologyGlomerular Filtration RateMedicine and Health SciencesPhysiologyRenal PhysiologyGlomerular Filtration RateMedicine and Health SciencesEndocrinologyEndocrine DisordersDiabetes MellitusMedicine and Health SciencesMetabolic DisordersDiabetes MellitusMedicine and Health SciencesVascular MedicineBlood PressureHypertensionBiology and Life SciencesAnatomyRenal SystemKidneysMedicine and Health SciencesAnatomyRenal SystemKidneysBiology and Life SciencesAnatomyRenal SystemMedicine and Health SciencesAnatomyRenal SystemBiology and Life SciencesMicrobiologyMedical MicrobiologyMicrobial PathogensViral PathogensImmunodeficiency VirusesHIVMedicine and Health SciencesPathology and Laboratory MedicinePathogensMicrobial PathogensViral PathogensImmunodeficiency VirusesHIVBiology and Life SciencesOrganismsVirusesViral PathogensImmunodeficiency VirusesHIVBiology and Life SciencesOrganismsVirusesImmunodeficiency VirusesHIVBiology and life sciencesOrganismsVirusesRNA virusesRetrovirusesLentivirusHIVBiology and Life SciencesMicrobiologyMedical MicrobiologyMicrobial PathogensViral PathogensRetrovirusesLentivirusHIVMedicine and Health SciencesPathology and Laboratory MedicinePathogensMicrobial PathogensViral PathogensRetrovirusesLentivirusHIVBiology and Life SciencesOrganismsVirusesViral PathogensRetrovirusesLentivirusHIVRisk of Chronic Kidney Disease among Patients Developing Mild Renal Impairment during Tenofovir-Containing Antiretroviral Treatment Chronic Kidney Disease during Tenofovirhttp://orcid.org/0000-0002-9976-8102Lapadula Giuseppe 1*Bernasconi Davide Paolo 2Casari Salvatore 3Maggiolo Franco 4Cauda Roberto 5Di Pietro Massimo 6Ladisa Nicoletta 7Sighinolfi Laura 8Dal Zoppo Sarah 9Sabbatini Francesca 1Soria Alessandro 1Pezzoli Chiara 3Mondi Annalisa 5Costarelli Silvia 1Valsecchi Maria Grazia 2Torti Carlo 10Gori Andrea 12for the Italian MASTER cohort ¶1 \n“San Gerardo” Hospital, Monza, Italy2 \nUniversity of Milano-Bicocca, Milan, Italy3 \nUniversity of Brescia, Brescia, Italy4 \nPapa Giovanni XXIII Hospital, Bergamo, Italy5 \nUniversità Cattolica del Sacro Cuore, Rome, Italy6 \nOspedale S. Maria Annunziata, Florence, Italy7 \nOspedale Policlinico, Bari, Italy8 \nOspedale Sant’Anna, Ferrara, Italy9 \nIstituti Ospitalieri, Cremona, Italy10 \nUniversity “Magna Graecia”, Catanzaro, ItalyDatta Prasun K EditorTemple University, UNITED STATESCompeting Interests: GL received speaker or consultancy grants from Janssen-Cilag, Gilead and Bristol-Myers Squibb and travel grants from Bristol-Myers Squibb, ViiV and Gilead. FM has served as a consultant on advisory boards for Boehringer Ingelheim, Bristol-Myers Squibb, Gilead, GlaxoSmithKline, Tibotec; he has received lecture fees from Bristol-Myers Squibb, Gilead, GlaxoSmithKline, Merck Sharp and Dome, and has received research and educational grants from Boehringer Ingelheim, Bristol-Myers Squibb, GlaxoSmithKline, Jansen-Cilag and Roche. RC served as advisor for Gilead and Janssen-Cilag, received speakers’ honoraria from ViiV, Bristol-Myers Squibb, Merck Sharp and Dohme and Janssen-Cilag. NL is member of the advisory board of Abbvie. MdP is member of the advisory boards of Abbvie and Gilead and received speaker grants from Abbvie, Bristol-Myers Squibb and ViiV. SC has been an employee of Gilead between 2012 and 2013, received speaker or consultancy grants from BMS, Abbvie, Gilead and Merck and travel grants from Bristol-Myers Squibb and ViiV. CT is member of the advisory boards of Gilead and ViiV, received research grants from Gilead, speakers grants from Bristol-Myers Squibb, Gilead and ViiV and travel grants from Gilead. AG is member of the advisory boards of Gilead, ViiV, Bristol-Myers Squibb, Janssen-Cilag, Merck Sharp-Dome and Abbvie, received speaker grants from Gilead and travel grants from Gilead, ViiV, Bristol-Myers Squibb, Janssen-Cilag and Merck Sharp-Dome. This does not alter our adherence to PLOS ONE policies on sharing data and materials.\n\nConceptualization: GL.\n\nFormal analysis: DPB.\n\nMethodology: DPB MGV.\n\nProject administration: CT.\n\nResources: GL S. Casari FM RC MDP NL LS SDZ AS CP AM S. Costarelli.\n\nSupervision: AG RC.\n\nWriting – original draft: GL.\n\nWriting – review & editing: GL DPB CT MGV AG FS AS.\n\n\n\n¶ Membership of the Italian MASTER Cohort is provided in the Acknowledgments.\n\n* E-mail: giuseppe.lapadula@gmail.com15 9 2016 2016 11 9 e016232019 5 2016 19 8 2016 © 2016 Lapadula et al2016Lapadula et alThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Background\nTenofovir (TDF) can cause kidney injury through tubular dysfunction, with or without drop of estimated glomerular filtration rate (eGFR). Whether mild eGFR reductions during treatment should be considered a reason for prompt TDF discontinuation, however, remains unclear.\n\nMethods\nPatients with normal pre-TDF eGFR levels, who had developed mild renal impairment (i.e., two consecutive eGFR results between 89–60 ml/min) on TDF, were observed until onset of chronic kidney disease (CKD), defined as two eGFR<60 ml/min 3 to 6 months apart. Multivariable Poisson regression analysis was used to investigate whether outcome was associated with current and cumulative use of TDF (modeled as time-varying covariates).\n\nResults\n2023 (29%) out of 6984 patients developed mild renal impairment on TDF. Among them, 191 progressed to CKD. The incidence of CKD did not significantly differ during TDF treatment (2.6 per 100 PYFU; 95%CI 2.2–3.2) or after its discontinuation (2.2 per 100 PYFU; 95%CI 1.8–2.6). However, the rate of CKD was significantly higher among patients continuing with TDF treatment compared to those who had discontinued it within 6 months of occurrence of mild renal impairment (aIRR 4, 95%CI 2.4–6.8). In contrast, among patients who had maintained TDF >6 months despite mild renal impairment, current TDF use was not associated with a significantly higher rate of CKD. Other significant predictors of CKD were older age, intravenous drug use, diabetes, hypertension, lower pre-TDF eGFR, higher eGFR drop since TDF introduction and longer exposure to TDF.\n\nConclusions\nPrompt discontinuation of TDF among patients developing mild renal impairment may prevent further progression of renal damage.\n\nThe Italian MASTER cohort is sponsored by the Infectious Diseases and International Health (MISI) Foundation, Brescia, Italy (www.fondazionemisi.it). No specific funding was received for the present article. Data AvailabilityThe raw data is available upon request to qualified interested researchers. Requests can be sent to giuseppe.lapadula@gmail.com.Data Availability\nThe raw data is available upon request to qualified interested researchers. Requests can be sent to giuseppe.lapadula@gmail.com.\n==== Body\nBackground\nTenofovir disoproxil fumarate (TDF) is widely used as a component of combination antiretroviral treatment (cART). The main adverse event associated with the use of TDF is nephrotoxicity with tubular dysfunction, with or without the reduction of glomerular filtration rate (GFR). Because TDF is excreted mainly in unchanged form by the kidneys, its clearance is significantly reduced in patients with moderate or severe renal impairment. In such patients, TDF use is preferentially avoided.[1] However, few studies have explored the safety of TDF in patients experiencing mild GFR reduction (i.e., between 89 and 60 ml/min). Whether, under these circumstances, TDF should be discontinued, remains a topic of debate. Previous observational studies have yielded conflicting results about the risk of progressive renal damage owing to prolonged exposure to TDF. Some studies have demonstrated an association between cumulative exposure to TDF and risk of chronic kidney disease (CKD), even among patients with normal renal function before TDF introduction.[2–4], Other studies, however, have suggested that loss in kidney function occurs mostly during the first year of TDF exposure and that risk of progression is relatively mild in the long term.[5,6] Adding to the uncertainty, a reduction in risk of kidney disease events after TDF discontinuation was found in some studies, but not in others. [3,4]\n\nHence, the best course to take in treating patients who develop mild renal impairment whilse on TDF has yet to be determined. As a consequence, the decision of whether to replace or suspend TDF often is up to the personal judgment of the physician.\n\nAims of our study were to evaluate the incidence of chronic kidney disease among patients who developed mild renal impairment during TDF treatment, to assess the risk of evolution to CKD while continuing TDF treatment compared versus discontinuing it and, lastly, to identify factors associated with the evolution to CKD.\n\nMethods\nPatients were recruited from the observational Italian MASTER database cohort.\n\nThe MASTER cohort study was approved by the Ethics Committee of each participating center (Comitato Etico Provinciale della Provincia di Brescia, Comitato Etico della Provincia di Bergamo, Comitato Etico dell'Azienda Ospedaliera Policlinico Consorziale di Bari, Comitato Etico per la sperimentazione clinica dei medicinali dell'azienda sanitaria di Firenze, Comitato Etico della Provincia di Ferrara, Comitato Etico della Provincia Monza Brianza, Comitato Etico dell'Azienda Ospedaliera Istituti Ospitalieri di Cremona, Comitato Etico dell'Università del Sacro Cuore—Policlinico Universitario Agostino Gemelli di Roma). Written informed consent is obtained from the participants to the cohort upon enrollment. No specific consent was obtained for the present analysis.\n\nDetailed description of the MASTER cohort is contained elsewhere.[7] Briefly, it is an ongoing prospective multicentre cohort which includes all patients in care for HIV infection in selected Italian clinical centers who have provided written informed consent to include their clinical and biological data in the MASTER database for scientific purposes. Patients are routinely seen every 3–4 months, and demographic, laboratory, clinical and treatment information are collected during each visit. Data are collected using a common electronic database, utilized by each participating centre for clinical purposes, and data is centralized, merged and checked for consistency on a 6-month basis. The database used for the present analysis was frozen in November 2014 and includes data from 8 clinical centers: Bari, Brescia, Bergamo, Cremona, Ferrara, Florence, Monza and Rome.HIV-1 infected patients who, between 2002 and 2013 had begun TDF treatment for the first time as part of an antiretroviral regimen were selected from the cohort if:\n\nestimated GFR (eGFR) before TDF introduction was >90 ml/min and\n\nthey had developed mild renal impairment, defined as two consecutive eGFR between 89 and 60 ml/min, during TDF.\n\nEstimated GFR was calculated using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula.[8]\n\nIncidence rates of CKD, defined as two eGFR <60 ml/min measured 3 to 6 months apart, was calculated as events per 100 patient-years of follow-up (PYFU), together with relative 95% confidence intervals, based on an exact Poisson distribution. A Poisson regression model was fitted to estimate the association between current TDF use and incidence of CKD. Follow-up accrued from the second of the two consecutive eGFR defining mild renal impairment (study baseline) up to the development of CKD, or to the last available eGFR measurement. A multivariable analysis was carried out adjusting for several time-fixed factors: age, gender, country of birth, risk factor for HIV transmission, hepatitis C virus (HCV) co-infection (defined as serum reactivity for HCV-RNA or HCV-antibody positivity with unknown HCV-RNA), hepatitis B virus (HBV) surface antigen positivity, diagnosis of diabetes or hypertension, history of exposure to antiretroviral drugs prior to TDF introduction, use of boosted protease inhibitors, CD4+ T-cell count and eGFR preceding TDF introduction, eGFR drop between TDF introduction and occurrence of mild renal impairment, and cumulative exposure to TDF at the time of occurrence of mild renal impairment. Additionally, in order to investigate whether the effects of TDF current use might vary in relation to cumulative exposure to TDF since onset of mild renal impairment, we included an interaction term between these two time-dependent variables. The latter of these two variables was divided into four categories (<6 months, 6–12 months, 1–2 years, >2 years)\n\nAn additional analysis was carried out, in order to assess the impact of TDF discontinuation on yearly decline of eGFR. A multivariate linear model was fitted, using Generalized Estimating Equations method, to account for the clustered structure of data, i.e. time-dependent eGFR measurement within patients. This model was adjusted for the same time-fixed covariates listed above.\n\nAll statistical analyses were performed using R software version 3.2.2.\n\nResults\nA total of 8,862 patients enrolled in the MASTER cohort initiated TDF for the first time, between January 1st 2002 and December 31st 2013. We excluded 1,575 patients whose eGFR before TDF was <90 ml/min, 229 who lacked eGFR determinations prior to TDF, and an additional 74 who lacked creatinine follow-up after TDF initiation. Among the 6,984 patients who had initiated cART regimens which included TDF when their eGFR was >90 ml/min, 2,023 (29%) developed mild renal impairment (i.e., two consecutive eGFR between 89 and 60 ml/min). These patients were therefore selected for all subsequent analyses. Most patients were male and Caucasians, with a mean age of 44 years (range 18–75). Their mean eGFR had dropped, after TDF introduction, from 104 to 80 ml/min. In about a quarter of the cases (494/2,023 = 24.4%), mild renal impairment was diagnosed within 6 months of TDF treatment. Table 1 illustrates, in detail, these occurences, as well as other characteristics at the time of the diagnosis of mild renal impairment. Subsequent to study inclusion, the median number of eGFR measurements per patient was 15 [inter-quartile range (IQR) 7–25], with a median gap of 3 months (IQR 2–4) between measurements. The median time between consecutive eGFR measurements did not differ significantly during TDF treatment and after its discontinuation (3 vs 2.9 months, P>0.05). MInimal correlation between average (within-patients) eGFR values and the frequency of eGFR measurements was observed (spearman rho = 0.24).\n\n10.1371/journal.pone.0162320.t001Table 1 Characteristics of patients developing mild renal impairment under TDF.\n Characteristic\t\t\nGender, male—N (%)\t1396 (69.0)\t\nAge, years—mean (sd)\t44.1 (8.4)\t\nPlace of birth, N (%)\t\t\n Europe/North America\t1930 (95.4)\t\n Africa\t50 (2.5)\t\n Other\t43 (2.1)\t\nHIV transmission route, N (%)\t\t\n Heterosexual intercourse\t781 (44.0)\t\n Homosexual intercourse\t186 (10.5)\t\n Intravenous Drug use\t618 (34.8)\t\n Other/unreported\t192 (10.8)\t\nHistory of AIDS defining events, N (%)\t522 (25.8%)\t\nTime since inclusion in the cohort, years–mean (sd)\t8.9 (7.2)\t\nHBsAg positivity, N (%)\t243 (12.0)\t\nHCVAb/HCV-RNA positivity, N (%)\t559 (27.6)\t\nDiabetes, N (%)\t194 (9.6)\t\nHypertension, N (%)\t527 (26.1)\t\nPreviously naïve to antiretroviral treatment, N (%)\t656 (32.4)\t\nBoosted-PI co-administration, N (%)\t1529 (75.6)\t\nCD4+ T-cell count, cells/μl–mean (sd)\t341 (239)\t\nNadir CD4+ T-cell count, cells/μl–mean (sd)\t180 (136)\t\nHIV-RNA at TDF introduction, N (%\t\t\n <50 copies/ml\t686 (33.9)\t\n 51–1,000 copies/ml\t196 (9.7)\t\n 1,001–10,000 copies/ml\t206 (10.2)\t\n 10,001–100,000 copies/ml\t474 (23.4)\t\n >100,000 copies/ml\t400 (19.8)\t\nWeight, kg–mean (sd)\t68.7 (13.6)\t\neGFR before TDF introduction, ml/min–mean (sd)\t104.2 (9.2)\t\neGFR drop since TDF introduction, ml/min–mean (sd)\t24 (13.7)\t\nTime on TDF, years\t3.6 (2.5)\t\neGFR was calculated using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula.[8] Mild renal impairment was defined as two consecutive eGFR between 89 and 60 ml/min during TDF treatment. Abbreviations: eGFR, estimated glomerular filtration rate; HBsAg, Hepatitis B surface antigen; HCV-Ab, Hepatitis C virus antibodies; HCV-RNA, Hepatitis C ribonucleic acid; N, number; PI, protease inhibitor, sd, standard deviation, TDF, tenofovir disoproxil fumarate.\n\nOne hundred ninety-one out of 8,006 PYFU at risk subsequently developed CKD, accounting for an incidence of 2.39 events per 100 PYFU (95%CI 2.07–2.74). Of these, 101 developed CKD during TDF-containing cART, whilst 90, developed CKD after TDF, had already been discontinued, accounting for an incidence of 2.63 (95%CI 2.17–3.19) and 2.16 (95%CI 1.76–2.65) per 100 PYFU, respectively (Fig 1).\n\n10.1371/journal.pone.0162320.g001Fig 1 Incidence of chronic kidney disease among patients who developed mild renal impairment during tenofovir-containing antiretroviral treatment.\neGFR was calculated using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula.[8] Mild renal impairment was defined as two consecutive eGFR between 89 and 60 ml/min during TDF treatment. Chronic Kidney Disease was defined as two eGFR <60 ml/min measured 3–6 months apart. Abbreviations: Pt-yrs, patient-years; TDF, tenofovir disoproxil fumarate.\n\nOverall, no statistically significant difference was observed when comparing the incidence rate of CKD during TDF with respect to the rate found after its discontinuation (incidence rate ratio [IRR]: 1.22; 95%CI 0.91–1.61). This result was confirmed using a multivariable analysis (adjusted IRR [aIRR] 1.12; 95%CI 0.79–1.59), adjusted for age, gender, country of birth, HIV risk factor, HCV and HBV coinfection, presence of diabetes or hypertension, baseline and pre-TDF eGFR, CD4+ cell count, previous ARV experience, use of boosted-PI and calendar year. Nonetheless, current use of TDF was associated with CKD when groups homogeneous for TDF exposure after onset of mild renal impairment were compared to each other. As shown in Fig 2, the rate of CKD was significantly higher among patients on TDF treatment regimens, compared to those who had discontinued it within 6 months since the diagnosis of mild renal impairment (aIRR 4.02, 95%CI 2.38–6.78). In contrast, current TDF use was not associated with a significantly higher risk of CKD among those patients who had stayed on TDF for more than 6 months after diagnosis of mild renal impairment, (aIRR 0.71 [95%CI 0.19–2.62], 0.51 [95%CI 0.22–1.18] and 0.84 [95%CI 0.5–1.42] among patients who had maintained TDF for 6–12 months, 1–2 years and >2 years after the diagnosis mild renal impairment, respectively).\n\n10.1371/journal.pone.0162320.g002Fig 2 Association between current TDF use and CKD, based on cumulative exposure to TDF after mild renal impairment occurrence.\neGFR was calculated using Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula.[8] Chronic Kidney Disease was defined as two eGFR <60 ml/min measured 3–6 months apart. Abbreviations: CI, confidence interval; CKD, chronic kidney disease; TDF, tenofovir disoproxil fumarate.\n\nUsing multivariable analysis, the following factors were also significantly and independently associated with higher rate of CKD: older age (per 1 year increase, aIRR 1.06, 95%CI 1.03–1.09), intravenous drug use as risk factor for HIV acquisition (versus heterosexual risk factor, aIRR 2.27, 95%CI 1.38–3.73), diabetes (aIRR 1.58, 95%CI 1.02–2.44), hypertension (aIRR 1.61, 95%CI 1.11–2.31), higher eGFR drop between TDF introduction and study baseline (per ml/min lost, aIRR 1.07, 95%CI 1.06–1.09), and longer TDF exposure prior to onset of mild renal impairment (per year increase, aIRR 1.19, 95%CI 1.06–1.34). In contrast, higher eGFR before TDF introduction was associated with a significantly lower incidence of progression to CKD (per 1 ml/min increase, aIRR 0.94, 95%CI 0.92–0.97). No statistically significant effect was exerted by gender, country of origin, calendar year, hepatitis co-infection, co-administration of boosted-PI, previous ARV exposure and CD4+ count.\n\nAs illustrated in Table 2, the estimated annual rate of eGFR decline after TDF discontinuation was 2.6 (95%CI -0.91 to -4.3) ml/min/year. Patients stayng on TDF experienced an additional eGFR decline of 2.15 (95%CI -0.98 to -3.42) ml/min/year, corresponding to a mean eGFR reduction of 4.7 ml/min per year. Progression of renal impairment was seen to be at a lower rate in older patients with respect to their younger counterparts (eGFR per 1 year older: +0.15 [95%CI 0.07–0.23] ml/min/year), as well as in those patients who were taking TDF as part of their first cART, compared to those with previous exposure to antiretrovirals (+2.0 [95%CI 0.33–3.72] ml/min/year).\n\n10.1371/journal.pone.0162320.t002Table 2 Mean eGFR annual change (ml/min) among patients developing mild renal impairment during treatment with tenofovir.\nResults from the GEE multivariate linear model.\n\n\tAdjusted estimate\tLower 95% CI\tUpper 95% CI\tP\t\nIntercept*\t-2.6\t-4.29\t-0.91\t0.003\t\nMale gender\t0.95\t-0.51\t2.4\t0.202\t\nAge, per year\t0.15\t0.07\t0.23\t<0.001\t\nNon-European heritage\t-0.29\t-3.94\t3.35\t0.874\t\nRisk factor for HIV acquisition\t\t\t\t\t\n Heterosexual\tRef.\t\t\t\t\n Homosexual\t0.66\t-1.77\t3.10\t0.593\t\n Intravenous drug abuse\t0.75\t-1.05\t2.55\t0.416\t\n Other\t0.86\t-0.74\t2.46\t0.292\t\nCurrent TDF use (versus discontinued)\t-2.16\t-3.42\t-0.90\t<0.001\t\nPre-TDF eGFR, per mL/min\t-0.06\t-0.17\t0.05\t0.277\t\nCalendar year at TDF introduction\t\t\t\t\t\n Before 2005\tRef.\t\t\t\t\n 2005–2006\t-1.71\t-3.18\t-0.24\t0.022\t\n After 2006\t-1.95\t-3.62\t-0.28\t0.022\t\nHBsAg positivity\t0.041\t-1.84\t1.92\t0.966\t\nHCVAb/HCV-RNA positivity\t0.31\t-1.39\t2.01\t0.72\t\nDiabetes\t0.58\t-1.28\t2.45\t0.539\t\nHypertension\t1.00\t-0.42\t2.43\t0.167\t\nNaïve to ARV (vs experienced)\t2.02\t0.33\t3.72\t0.019\t\nCD4+ before TDF introduction, per 10 cell/mm3\t0.02\t-0.003\t0.05\t0.082\t\nBoosted-PI coadministration\t-0.05\t-1.28\t1.19\t0.943\t\n* Mean eGFR annual change (ml/min) for the reference patient (with average age, Pre-TDF eGFR and CD4+ before TDF introduction).\n\nA multivariable Poisson regression model, aimed at assessing discontinuation rates of TDF, showed that higher eGFR (per ml/min increase, aIRR 0.99, 95% CI 0.984–0.996) and older age (per 1 year increase, aIRR 0.99, 95% CI 0.979–0.999) were significantly and independently associated with a lower risk of TDF discontinuation. No statistically significant association was found between discontinuation rate of TDF and the other explored covariates, including HIV risk factor, hepatitis co-infection, diabetes, hypertension and eGFR before TDF initiation (data not shown).\n\nAmong the 101 patients who had developed CKD whilst on TDF treatment, 62 subsequently discontinued TDF. After TDF discontinuation, eGFR improved to >60 ml/min in 37 cases, and remained at 30–60 ml/min or <30 ml/min in 20 and 5 cases, respectively. Follow-up after CKD development was available for only 52/90 patients who had developed CKD after TDF discontinuation. Among these, the last available eGFR was >60 ml/min, 30–60 ml/min and <30 ml/min in 19, 28 and 5 cases, respectively.\n\nDiscussion\nIn this observational study of patients with previously normal eGFR, almost one third of the patients developed mild renal impairment during TDF-containing treatment. Further progression to CKD was, however, relatively rare, occurring in <3 cases per 100 patient-years of follow-up, despite the presence of established mild renal impairment. Previous randomized controlled trials of TDF reported very low prevalence of renal toxicity and, although small differences in glomerular filtration rate over time were noted, eGFR decline associated with TDF use was not considered to be clinically relevant.[9–11] Similarly, a systematic review and meta-analysis suggested that TDF-containing regimens were associated with a significantly greater loss of eGFR than regimens not containing TDF, although the magnitude of the effect was modest in clinical terms.[12] Nonetheless, several observational studies have demonstrated an association between TDF use and an increased risk of CKD, even among patients with normal renal function prior to cART initiation. [2–4,13] Whether initial mild kidney-function deterioration during TDF treatment are likely to worsen or stay relatively stable over time is unknown. Certain studies have suggested that prolonged TDF exposure increases risk of eGFR decline. [2,4,14] In other studies the loss in eGFR attributable to TDF was observed mainly during the first 6–12 months of exposure, and remained relatively constant afterwards.[5,15] The significance of subtle eGFR changes during TDF is, therefore, difficult to interpret in the clinical setting; hence the need to discontinue TDF when mild eGFR reduction is observed remains unknown.\n\nIn our cohort, switching away from TDF was associated with a lower risk of further progression of renal damage to CKD, but only if the switch occurred within 6 months from onset of mild renal impairment. In other words, among patients who were kept on TDF for more than 6 months despite the presence of mild renal impairment, a delayed TDF discontinuation did not apparently affect subsequent eGFR decline. Tenofovir toxicity is principally exerted on the proximal tubule, where it can accumulate and cause progressive mitochondrial DNA depletion and oxidative respiratory chain dysfunctions, ultimately leading to degenerative changes and cell apoptosis.[16,17] Among patients with mild renal impairment, initial modest eGFR reductions are likely to reflect, at least in part, impairment of active creatinine secretion across the tubule, rather than a reduction of glomerular filtration.[15] One possible explanation of our findings is that these tubule alterations are more likely to regress if the insult is withdrawn on a timely basis. However, if the discontinuation of the drug is delayed, progressive tubule loss and tissue scarring, and eventual damage to other renal structures (e.g. the glomeruli), can occur, turning a transient damage into a permanent impairment. Once irreversible damage is established, belated treatment switches may fail to significantly reduce the risk of CKD. Consistent with this hypothesis, previous reports have showed that a significant proportion of patients suffering from acute renal failure associated with TDF fail to acheive incomplete recovery of eGFR after TDF discontinuation.[18–20] Moreover, a more prolonged duration of TDF treatment prior to discontinuation has been associated with lower chances of renal function recovery.[18,20–22]. Of note, prolonged use of TDF at low eGFR is associated with higher levels of exposure to tenofovir, which leads to a more rapid progression of kidney function decline.[23,24] Early treatment switches to alternative drugs could prevent such a self-perpetrating mechanism of injury.\n\nA second possible explanation for our findings is that drug-related reductions of eGFR progress more rapidly than those secondary to other common renal insults, such as hypertension or diabetes. Therefore, TDF discontinuation could be effective to prevent the damage directly related to the drug itself only if the treatment is changed in a timely manner. Conversely, a less rapid or relatively stable reduction of eGFR, despite prolonged TDF exposure, is more likely to be due to other causes and is hence less influenced by changes in the antiretroviral regimen. We cannot exclude, however, that higher rates of TDF discontinuation in patients with higher risk of CKD and/or a steeper eGFR decline, may have diluted the effects of TDF, thereby justifying the lack of association found between TDF use and CKD in patients exposed to TDF for >6 months. Previous large observational studies have failed to demonstrate that TDF exposure is an independent predictor of confirmed eGFR <60 ml/min among patients with normal pre-TDF eGFR, mainly because proactive switches away from TDF were observed when eGFR declined below 70 ml/min. [3] For similar reasons, no significant association between TDF use and end-stage renal disease was demonstrated.[25] In our cohort, an independent association between current eGFR and the rate of TDF discontinuation before CKD was observed. This could have led to underestimation of the risk associated with TDF use.\n\nIn any case, observance of mild renal impairment during treatment with TDF should prompt an intensive and rapid work-up, and, if other amendable causes of renal damage can be excluded, a rapid discontinuation of TDF should be effected. A timely TDF withdrawal may, in fact, reduce the risk of progression to CKD.\n\nOur study does have some limitations that need to be acknowledged. First, our database lacked data on urine analysis, proteinuria, serum phosphate or other markers of tubular damage. Hence, renal damage evaluation was based solely on eGFR, which may not be the best marker of TDF-induced kidney toxicity. In addition, we were unable to adjust our analysis for co-administration of other nephrotoxic drugs, presence of acute comorbid conditions or family history of renal diseases. These factors may have acted as unmeasured confounders. Similarly, we could not control for genetic factors which may result in increased susceptibility to tenofovir-induced renal damage.[26,27] As previously mentioned, switches from TDF did not occur at random, but were clinician-driven; this may have led to underestimation of the risk of CKD among patients who were kept on TDF despite mild renal impairment, as these patients could have been perceived to be at lower risk of CKD. Finally, the majority of patients in our cohort were Caucasian; hence,our findings may not be directly transferable to cohorts with individuals of other heritage. Nonetheless, the large number of patients with previously normal eGFR who developed mild renal impairment under TDF is a strength of our study, as is the prolonged follow-up duration.\n\nIn conclusion, our study provides evidence that timely discontinuation of TDF (i.e., within 6 months of commencement) minimizes the risk of CKD among patients who have experienced mild eGFR reduction during treatment. Given the availability of alternative treatment options, a cautious approach in individuals with declining eGFR levels is therefore recommended.\n\nThe Italian MASTER Cohort includes the following collaborators: F. Castelli, G. Carosi, E. Quiros, P. Nasta, Institute of Infectious and Tropical Diseases, University of Brescia, Brescia, Italy; C. Torti, Clinic of Infectious Diseases, Policlinico Universitario \"Mater Domini\", Catanzaro, Italy; R. Cauda S. Di Giambenedetto, Catholic University of Sacred Heart, Rome, Italy; F. Maggiolo Ospedali Riuniti, Bergamo, Italy; A. Scalzini, F. Castelnuovo, Spedali Civili di Brescia, Brescia, Italy; F. Mazzotta, M. Di Pietro “S. Maria Annunziata” Hospital, Florence, Italy; L. Sighinolfi, “S. Anna” Hospital, Ferrara, Italy; G. Angarano, N. Ladisa, L. Monno, A. Saracino, Policlinico di Bari, Bari, Italy; A. Pan, S. Lorenzotti Istituti Ospitalieri, Cremona, Italy; A. Gori, S. Costarelli Ospedale S. Gerardo, Monza, Italy.\n\nA preliminary version of this work has been presented at the “15th European AIDS Conference”, Barcelona, Spain, 21–24 October 2012 (Abstract PS11/1).\n==== Refs\nReferences\n1 Kearney BP , Yale K , Shah J , Zhong L , Flaherty JF (2006 ) Pharmacokinetics and dosing recommendations of tenofovir disoproxil fumarate in hepatic or renal impairment . Clin Pharmacokinet \n45 : 1115 –1124 . 17048975 \n2 Mocroft A , Kirk O , Reiss P , de Wit S , Sedlacek D , Beniowski M \net al (2010 ) Estimated glomerular filtration rate, chronic kidney disease and antiretroviral drug use in HIV-positive patients . AIDS \n24 : 1667 –1678 . 10.1097/QAD.0b013e328339fe53 \n20523203 \n3 Ryom L , Mocroft A , Kirk O , Worm SW , Kamara DA , Reiss P \net al (2013 ) Association between antiretroviral exposure and renal impairment among HIV-positive persons with normal baseline renal function: the D:A:D study . J Infect Dis \n207 : 1359 –1369 . 10.1093/infdis/jit043 \n23382571 \n4 Scherzer R , Estrella M , Li Y , Choi AI , Deeks SG , Grunfeld C \net al (2012 ) Association of tenofovir exposure with kidney disease risk in HIV infection . AIDS \n26 : 867 –875 . 10.1097/QAD.0b013e328351f68f \n22313955 \n5 Laprise C , Baril JG , Dufresne S , Trottier H (2013 ) Association between tenofovir exposure and reduced kidney function in a cohort of HIV-positive patients: results from 10 years of follow-up . Clin Infect Dis \n56 : 567 –575 . 10.1093/cid/cis937 \n23143096 \n6 Izzedine H , Isnard-Bagnis C , Hulot JS , Vittecoq D , Cheng A , Jais CK \net al (2004 ) Renal safety of tenofovir in HIV treatment-experienced patients . AIDS \n18 : 1074 –1076 . 15096814 \n7 Torti C , Raffetti E , Donato F , Castelli F , Maggiolo F , Angarano G \net al (2015 ) Cohort Profile: Standardized Management of Antiretroviral Therapy Cohort (MASTER Cohort) . Int J Epidemiol .\n8 Levey AS , Stevens LA , Schmid CH , Zhang YL , Castro AF III, Feldman HI \net al (2009 ) A new equation to estimate glomerular filtration rate . Ann Intern Med \n150 : 604 –612 . 19414839 \n9 Gallant JE , Winston JA , DeJesus E , Pozniak AL , Chen SS , Cheng AK \net al (2008 ) The 3-year renal safety of a tenofovir disoproxil fumarate vs. a thymidine analogue-containing regimen in antiretroviral-naive patients . AIDS \n22 : 2155 –2163 . 10.1097/QAD.0b013e3283112b8e \n18832879 \n10 Izzedine H , Hulot JS , Vittecoq D , Gallant JE , Staszewski S , Launay-Vacher V \net al (2005 ) Long-term renal safety of tenofovir disoproxil fumarate in antiretroviral-naive HIV-1-infected patients. Data from a double-blind randomized active-controlled multicentre study . Nephrol Dial Transplant \n20 : 743 –746 . 15741212 \n11 Squires K , Pozniak AL , Pierone G Jr, Steinhart CR , Berger D , Bellos NC \net al (2003 ) Tenofovir disoproxil fumarate in nucleoside-resistant HIV-1 infection: a randomized trial . Ann Intern Med \n139 : 313 –320 . 12965939 \n12 Cooper RD , Wiebe N , Smith N , Keiser P , Naicker S , Tonelli M (2010 ) Systematic review and meta-analysis: renal safety of tenofovir disoproxil fumarate in HIV-infected patients . Clin Infect Dis \n51 : 496 –505 . 10.1086/655681 \n20673002 \n13 Kalayjian RC , Lau B , Mechekano RN , Crane HM , Rodriguez B , Salata RA \net al (2012 ) Risk factors for chronic kidney disease in a large cohort of HIV-1 infected individuals initiating antiretroviral therapy in routine care . AIDS \n26 : 1907 –1915 . 22824630 \n14 Horberg M , Tang B , Towner W , Silverberg M , Bersoff-Matcha S , Hurley L \net al (2010 ) Impact of tenofovir on renal function in HIV-infected, antiretroviral-naive patients . J Acquir Immune Defic Syndr \n53 : 62 –69 . 10.1097/QAI.0b013e3181be6be2 \n19838127 \n15 Vrouenraets SM , Fux CA , Wit FW , Garcia EF , Furrer H , Brinkman K \net al (2011 ) Persistent decline in estimated but not measured glomerular filtration rate on tenofovir may reflect tubular rather than glomerular toxicity . AIDS \n25 : 2149 –2155 . 10.1097/QAD.0b013e32834bba87 \n21857491 \n16 Cote HC , Magil AB , Harris M , Scarth BJ , Gadawski I , Wang N \net al (2006 ) Exploring mitochondrial nephrotoxicity as a potential mechanism of kidney dysfunction among HIV-infected patients on highly active antiretroviral therapy . Antivir Ther \n11 : 79 –86 . 16518963 \n17 Herlitz LC , Mohan S , Stokes MB , Radhakrishnan J , D'Agati VD , Markowitz GS (2010 ) Tenofovir nephrotoxicity: acute tubular necrosis with distinctive clinical, pathological, and mitochondrial abnormalities . Kidney Int \n78 : 1171 –1177 . 10.1038/ki.2010.318 \n20811330 \n18 Wever K , van Agtmael MA , Carr A (2010 ) Incomplete reversibility of tenofovir-related renal toxicity in HIV-infected men . J Acquir Immune Defic Syndr \n55 : 78 –81 . 10.1097/QAI.0b013e3181d05579 \n20173649 \n19 Zimmermann AE , Pizzoferrato T , Bedford J , Morris A , Hoffman R , Braden G (2006 ) Tenofovir-associated acute and chronic kidney disease: a case of multiple drug interactions . Clin Infect Dis \n42 : 283 –290 . 16355343 \n20 Jose S , Hamzah L , Campbell LJ , Hill T , Fisher M , Leen C \net al (2014 ) Incomplete reversibility of estimated glomerular filtration rate decline following tenofovir disoproxil fumarate exposure . J Infect Dis \n210 : 363 –373 . 10.1093/infdis/jiu107 \n24585896 \n21 Gupta SK , Anderson AM , Ebrahimi R , Fralich T , Graham H , Scharen-Guivel V \net al (2014 ) Fanconi syndrome accompanied by renal function decline with tenofovir disoproxil fumarate: a prospective, case-control study of predictors and resolution in HIV-infected patients . PLoS One \n9 : e92717 \n10.1371/journal.pone.0092717 \n24651857 \n22 Yoshino M , Yagura H , Kushida H , Yonemoto H , Bando H , Ogawa Y \net al (2012 ) Assessing recovery of renal function after tenofovir disoproxil fumarate discontinuation . J Infect Chemother \n18 : 169 –174 . 10.1007/s10156-011-0310-6 \n21968965 \n23 Baxi SM , Greenblatt RM , Bacchetti P , Scherzer R , Minkoff H , Huang Y \net al (2014 ) Common clinical conditions—age, low BMI, ritonavir use, mild renal impairment—affect tenofovir pharmacokinetics in a large cohort of HIV-infected women . AIDS \n28 : 59 –66 . 10.1097/QAD.0000000000000033 \n24275255 \n24 Baxi SM , Scherzer R , Greenblatt RM , Minkoff H , Sharma A , Cohen M \net al (2016 ) Higher tenofovir exposure is associated with longitudinal declines in kidney function in women living with HIV . AIDS \n30 : 609 –618 . 10.1097/QAD.0000000000000958 \n26558723 \n25 Ryom L , Mocroft A , Kirk O , Ross M , Reiss P , Fux CA \net al (2014 ) Predictors of advanced chronic kidney disease and end-stage renal disease in HIV-positive persons . AIDS \n28 : 187 –199 . 10.1097/QAD.0000000000000042 \n24361680 \n26 Rodriguez-Novoa S , Labarga P , Soriano V , Egan D , Albalater M , Morello J \net al (2009 ) Predictors of kidney tubular dysfunction in HIV-infected patients treated with tenofovir: a pharmacogenetic study . Clin Infect Dis \n48 : e108 –e116 . 10.1086/598507 \n19400747 \n27 Rodriguez-Novoa S , Labarga P , D'avolio A , Barreiro P , Albalate M , Vispo E \net al (2010 ) Impairment in kidney tubular function in patients receiving tenofovir is associated with higher tenofovir plasma concentrations . AIDS \n24 : 1064 –1066 . 10.1097/QAD.0b013e32833202e2 \n20299966\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1932-6203",
"issue": "11(9)",
"journal": "PloS one",
"keywords": null,
"medline_ta": "PLoS One",
"mesh_terms": "D000328:Adult; D019380:Anti-HIV Agents; D005260:Female; D005919:Glomerular Filtration Rate; D015658:HIV Infections; D006801:Humans; D007676:Kidney Failure, Chronic; D008297:Male; D008875:Middle Aged; D000068698:Tenofovir",
"nlm_unique_id": "101285081",
"other_id": null,
"pages": "e0162320",
"pmc": null,
"pmid": "27632369",
"pubdate": "2016",
"publication_types": "D016428:Journal Article",
"references": "21968965;20299966;15741212;16355343;19838127;26445966;24651857;22824630;26558723;20673002;17048975;19400747;19414839;24585896;12965939;20811330;23382571;15096814;23143096;22313955;24361680;20173649;18832879;20523203;24275255;21857491;16518963",
"title": "Risk of Chronic Kidney Disease among Patients Developing Mild Renal Impairment during Tenofovir-Containing Antiretroviral Treatment.",
"title_normalized": "risk of chronic kidney disease among patients developing mild renal impairment during tenofovir containing antiretroviral treatment"
} | [
{
"companynumb": "IT-GILEAD-2016-0236345",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TENOFOVIR DISOPROXIL FUMARATE"
},
"drugadditiona... |
{
"abstract": "BACKGROUND Leclercia adecarboxylata is a gram-negative rod, which is normally found in water and food. It is an emerging pathogen that affects immunocompromised patients, including patients with hematological malignancies or those receiving chemotherapy. Generally, L. adecarboxylata is considered a low-virulence pathogen with an excellent susceptibility profile, but some strains may be resistant to multiple antibiotics, such as b-lactams. Moreover, L. adecarboxylata is usually isolated as a part of polymicrobial cultures in immunocompetent individuals, but there have been cases where it was the only isolate. CASE REPORT A 74-year-old woman who was non-immunosuppressed and had multiple comorbidities was admitted with acute decompensated heart failure due to pneumonia. She was treated with multiple courses of antibiotics including amoxicillin-clavulanate and ciprofloxacin for pneumonia, but her infection worsened, and she had cardiopulmonary arrest. After resuscitation, she was stable for several days but suddenly became confused and hypotensive. The septic screen showed L. adecarboxylata bacteremia without a clear source, which was treated successfully with meropenem for 14 days. After the meropenem course, the patient developed diarrhea and was found to have severe Clostridium difficile infection. She did not respond to oral vancomycin and intravenous metronidazole and died. CONCLUSIONS This case illustrated an infection in a non-immunosuppressed individual by an organism that is considered an opportunistic pathogen, mainly affecting immunocompromised patients. The patient's blood culture grew L. adecarboxylata, which was sensitive to all antibiotics but resolved with meropenem treatment. Owing to increasing L. adecarboxylata infections, we recommend further studies to understand the organism's pathogenesis, risk factors, and resistance pattern.",
"affiliations": "Department of Internal Medicine, National Guard Hospital, Jeddah, Saudi Arabia.;Department of Internal Medicine, National Guard Hospital, Jeddah, Saudi Arabia.;Department of Internal Medicine, National Guard Hospital, Jeddah, Saudi Arabia.;College of Medicine, King Saud bin Abdulaziz University for Health Sciences, Jeddah, Saudi Arabia.;College of Medicine, King Saud bin Abdulaziz University for Health Sciences, Jeddah, Saudi Arabia.;College of Medicine, King Saud bin Abdulaziz University for Health Sciences, Jeddah, Saudi Arabia.",
"authors": "Shaikhain|Talal|T|;Al-Husayni|Faisal|F|;Al-Fawaz|Sarah|S|;Alghamdi|Erada M|EM|;Al-Amri|Abdulfattah|A|;Alfares|Mona|M|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "United States",
"delete": false,
"doi": "10.12659/AJCR.929537",
"fulltext": "\n==== Front\nAm J Case Rep\nAm J Case Rep\namjcaserep\nThe American Journal of Case Reports\n1941-5923\nInternational Scientific Literature, Inc.\n\n33782375\n10.12659/AJCR.929537\n929537\nArticles\nLeclercia adecarboxylata Bacteremia without a Focus in a Non-Immunosuppressed Patient\nShaikhain Talal E1\nAl-Husayni Faisal F12\nAl-Fawaz Sarah ABCDEFG1\nAlghamdi Erada M. EF3\nAl-Amri Abdulfattah BD345\nAlfares Mona AE367\n1 Department of Internal Medicine, National Guard Hospital, Jeddah, Saudi Arabia\n2 Department of Internal Medicine, King Abdullah International Medical Research Center, Jeddah, Saudi Arabia\n3 College of Medicine, King Saud bin Abdulaziz University for Health Sciences, Jeddah, Saudi Arabia\n4 Department of Microbiology, National Guard Hospital, Jeddah, Saudi Arabia\n5 Department of Microbiology, King Abdullah International Medical Research Center, Jeddah, Saudi Arabia\n6 Department of Infectious Diseases, King Abdulaziz University Hospital, Jeddah, Saudi Arabia\n7 Department of Infectious Diseases, National Guard Hospital, Jeddah, Saudi Arabia\nCorresponding Author: Mona Alfares, e-mail: alfaresmo@hotmail.com\nAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\n2021\n30 3 2021\n22 e929537-1e929537-6\n30 10 2020\n16 2 2021\n23 2 2021\n© Am J Case Rep, 2021\n2021\nThis work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)\nPatient: Female, 74-year-old\n\nFinal Diagnosis: Leclercia adecarboxylata bacteremia\n\nSymptoms: Cough • fever • shock • shortness of breath\n\nMedication: —\n\nClinical Procedure: —\n\nSpecialty: Infectious Diseases • Microbiology and Virology\n\nObjective:\n\nRare disease\n\nBackground:\n\nLeclercia adecarboxylata is a gram-negative rod, which is normally found in water and food. It is an emerging pathogen that affects immunocompromised patients, including patients with hematological malignancies or those receiving chemotherapy. Generally, L. adecarboxylata is considered a low-virulence pathogen with an excellent susceptibility profile, but some strains may be resistant to multiple antibiotics, such as β-lactams. Moreover, L. adecarboxylata is usually isolated as a part of polymicrobial cultures in immunocompetent individuals, but there have been cases where it was the only isolate.\n\nCase Report:\n\nA 74-year-old woman who was non-immunosuppressed and had multiple comorbidities was admitted with acute decompensated heart failure due to pneumonia. She was treated with multiple courses of antibiotics including amoxicillin-clavulanate and ciprofloxacin for pneumonia, but her infection worsened, and she had cardiopulmonary arrest. After resuscitation, she was stable for several days but suddenly became confused and hypotensive. The septic screen showed L. adecarboxylata bacteremia without a clear source, which was treated successfully with meropenem for 14 days. After the meropenem course, the patient developed diarrhea and was found to have severe Clostridium difficile infection. She did not respond to oral vancomycin and intravenous metronidazole and died.\n\nConclusions:\n\nThis case illustrated an infection in a non-immunosuppressed individual by an organism that is considered an opportunistic pathogen, mainly affecting immunocompromised patients. The patient’s blood culture grew L. adecarboxylata, which was sensitive to all antibiotics but resolved with meropenem treatment. Owing to increasing L. adecarboxylata infections, we recommend further studies to understand the organism’s pathogenesis, risk factors, and resistance pattern.\n\nKeywords:\n\nBacteremia\nBacterial Infections\nCarbapenems\nClostridium difficile\nImmunocompetence\n==== Body\nBackground\n\nLeclercia adecarboxylata is a motile, gram-negative rod, which was formerly known as Escherichia adecarboxylata [1]. However, deoxyribonucleic acid homology studies led to reclassifying the organism in a new group, and it was named L. adecarboxylata [2]. Most commonly, L. adecarboxylata is found in water and soil [3]. Generally, L. adecarboxylata is sensitive to most antibiotics; however, antibiotic resistance has been reported [4,5].\n\nL. adecarboxylata infections are most often nonfatal owing to its low virulence and good antibiotic susceptibility [6]. The most identifiable risk factor for infection is immunosuppression; however, it was found that L. adecarboxylata could be part of polymicrobial infections in immunocompetent patients [7], particularly when the culture is taken from a wound [8]. Conversely, L. adecarboxylata has been reported as a sole isolate from blood, sputum, urine, and peritoneal fluid [9–12]. L. adecarboxylata might be disregarded in the context of poly-microbial infection because of its low virulence and ubiquity.\n\nThere are a wide variety of treatment options for L. adecarboxylata. However, its resistance to fosfomycin is commonly reported [4]. Resistance to other antibiotics such as trim-ethoprim-sulfamethoxazole, aminoglycosides, penicillin, and cephalosporins have also been reported [7]. Almost all cases of L. adecarboxylata infection are sensitive to carbapenems, amikacin, tetracycline, and tigecycline [7].\n\nHere, we are reporting a case of isolated L. adecarboxylata bacteremia in a non-immunosuppressed patient. The aim of this study is to narrate the course, management, and outcome of such cases.\n\nCase Report\n\nA 74-year-old woman presented to the emergency department with progressive shortness of breath and productive cough for 1 week, along with increasing abdominal distention. She had a history of diabetes mellitus (with latest A1C 7.1%), hyper-tension, chronic kidney disease, heart failure with preserved ejection fraction, coronary artery bypass graft, peripheral vascular disease, and right above-knee amputation.\n\nThe patient had progressive dyspnea, associated with orthopnea, paroxysmal nocturnal dyspnea, and lower-extremity swelling. Her cough was productive with yellowish sputum, but she had no fever. The patient had recurrent abdominal as-cites secondary to heart failure (serum ascites albumin gradient of 1.5 g/L and ascitic protein of 26 g/L) for 6 months prior to presentation, which required weekly abdominal paracentesis. She was conscious and oriented, and her vital signs were stable. The examination did not show any stigmata of chronic liver disease. A cardiac examination revealed a pansystolic murmur in the left lower sternal border, while the lung examination showed fine bilateral lung crepitations. She had generalized abdominal tenderness, with tense ascites and bilateral lower-extremity pitting edema. The patient also had a stage 2 sacral ulcer, which was not infected.\n\nThe initial laboratory test results showed a normal white blood cell (WBC) count of 5.9×109 g/L. The chest X-ray at admission showed bilateral perihilar and right basilar airspace opacities, with right pleural effusion. She was admitted for acute decompensated heart failure secondary to pneumonia.\n\nThe patient was admitted to the cardiac care unit and was administered furosemide 40 mg IV twice per day and amoxicillinclavulanate. Six days after admission, the patient had a temperature of 38.9°C, with diffuse abdominal pain. Blood laboratory results showed an elevated WBC count of 13.7×109 g/L (reference range, 4.0–11.0×109), neutrophil count of 11.0×109 (reference range, 2.0–7.5×109), lymph count of 0.96×109 (reference range, 1.5–4.0×109), C-reactive protein level of 31.3 mg/L (reference range, 0.0–5.0 mg/L), and procalcitonin level of 0.42 ug/L (reference range, <0.25 ug/L). The patient was still febrile and not responding to amoxicillin-clavulanate, and was therefore switched to IV ciprofloxacin to treat the sepsis. A few hours later, the patient went into cardiac arrest. Cardiopulmonary resuscitation was performed for 3 minutes, a peripherally inserted central catheter (PICC) was inserted, and the patient was intubated.\n\nAfter 3 days, the patient was extubated and paracentesis was performed. Ascitic fluid culture results were negative but had a cell count of 196 leukocytes/µL. Two days later, the patient became confused and hypotensive and a laboratory examination showed that the inflammatory markers were elevated. A full septic screen was done and exhibited no organisms in the urine, sputum, or cerebrospinal fluid; however, a superficial swab from the sacral ulcer, which did not show signs of infection (Figure 1), grew Escherichia coli and Klebsiella pneumoniae, which were considered contaminants. A blood culture was taken using aerobic and anaerobic BACT/ALERT blood culture bottles (BioMérieux, Marcy l’Étoile, France) and was incubated in the BACT/ALERT3D blood culture machine. The culture was detected as positive after 18 h of incubation. A Gram stain from blood culture demonstrated gram-negative rods (Figure 2). The blood was subcultured on blood, MacConkey, and chocolate agar, and incubated at 37°C overnight. The agar plate showed grey, large mucoid colonies with weak lactulose fermentation (Figure 3). The organism was identified as L. adecarboxylata using the Vitek-MS microbial identification system (BioMérieux, France), and sensitivity was performed on the Vitek-2 sensitivity machine (BioMérieux, France) following the manufacturer’s instructions (Table 1). The abdominal pigtail catheter and PICC line were removed after the blood culture results were obtained, and ciprofloxacin was changed to meropenem, as the patient was not improving.\n\nAfter 48 h of meropenem, her fever abated, inflammatory markers improved, and L. adecarboxylata bacteremia cleared. The patient completed 14 days of meropenem, and blood cultures were negative for organisms at the end of treatment. Five days before finishing the course of meropenem, the patient developed watery diarrhea, and Clostridium difficile was detected. The patient was administered oral vancomycin, and later IV metronidazole was added. Her diarrhea did not improve, her WBC count reached 49.7×109 g/L, and she required inotropic support to maintain her blood pressure. An abdominal computed tomography (CT) scan showed a circumferential thickening involving the distal transverse colon to the rectum, indicating colitis (Figure 4). The patient’s condition worsened over the following days (22 days after detecting C. difficile) until she died due to severe colitis.\n\nDiscussion\n\nL. adecarboxylata is a flora of the gastrointestinal tract [13]. Initial isolates by Leclerc were from water, but later, L. adecarboxylata was commonly reported in the environment, especially in food and water [14–16].\n\nIn case reports and series, L. adecarboxylata was isolated from a large variety of specimens, including wounds, feces, urine, gallbladder, peritonsillar and periovarian abscesses, synovial fluid, peritoneal fluid in peritoneal dialysis, nosocomial pneumonia, and bacteremia [17–19]. L. adecarboxylata is an uncommon pathogen and is usually isolated as a part of poly-microbial wound cultures; it is postulated that it needs other bacteria to facilitate infection [13,17,20]. It might be the only isolate in immunocompromised patients, as Hess et al reported in patients with cirrhosis and hematological malignancies, and in those receiving chemotherapy [13].\n\nBacteremia caused by L. adecarboxylata is usually associated with immunosuppression and the presence of central lines. Monomicrobial bacteremia in the case of our patient was puzzling because her controlled diabetes and other comorbid conditions were not consistent with the pattern of immunosuppression found in the literature. Although diabetes may affect the body’s immunity, that usually occurs in the context of poor glycemic control [21]. In the literature, patients with L. adecarboxylata infection usually also have severe immunosuppression, for example, through the use of immunomodulators or chemotherapy [7,22,23]. On the other hand, few cases with diabetes as the only risk factor had skin and soft tissue infection [24,25]. Our patient had a PICC line for a few days, which could have been the source; however, only a peripheral blood culture was positive, contradicting this theory. Another possible source could have been iatrogenic peritonitis; however, all patients reported to have L. adecarboxylata peritonitis had peritoneal dialysis catheters, which our patient did not have. Although, skin commensals are much more likely to present in this setting. The third possibility is translocation from the gut, secondary to the patient’s C. difficile infection, which became symptomatic after the positive culture. The source of bacteremia in a 51-year-old woman who presented with nausea and vomiting and had small bowel thickening on an abdominal CT was presumed to be the gastrointestinal tract. That patient, however, had end-stage renal disease and was on hemodialysis [26]. Nonetheless, a lack of focus has been described in cases of L. adecarboxylata bacteremia [27] L. adecarboxylata isolates are reported to have a good sensitivity profile, and, in general, its resistance pattern is similar to that of other Enterobacteriaceae. However, fosfomycin resistance is more common with L. adecarboxylata. There are reports of resistant isolates exhibiting SHV-12 β-lactamase production; thus, they are behaving like an extended-spectrum β-lactamase organism [5]. Another study looked at hospital staff hand hygiene compliance and isolated VIM-1 Metallo-β-Lactamase producers [28]. The isolates were resistant to β-lactams, including carbapenems, and were susceptible to aztreonam. However, these were not clinical samples from patients.\n\nThere are no guidelines discussing treatment, but good response to β-lactams and fluoroquinolones was observed in multiple reports [7,12]. Our patient cleared her bacteremia with a brief course of meropenem, suggesting this antibiotic might be a good option to treat L. adecarboxylata infection. Nonetheless, the lack of identifiable source of the bacteremia can be considered as a limitation of the presented case.\n\nConclusions\n\nL. adecarboxylata infection is not exclusive to immunocompromised patients. We reported a case of L. adecarboxylata bacteremia in a non-immunosuppressed patient. The organism was detected in the blood despite the patient being on multiple antibiotics, to which the organism was sensitive. Meropenem showed good activity against L. adecarboxylata. Further studies to understand the pathogenesis, risk factors, and resistance pattern of L. adecarboxylata are recommended, as it has become an emerging pathogen in the last decade.\n\nFigure 1. Stage 2 sacral ulcer without signs of an infection.\n\nFigure 2. Gram stain: Gram-negative rods.\n\nFigure 3. (A) Chocolate and (B) blood agar: mucoid, grey large colonies. (C) MacConkey agar: weak lactose fermentation.\n\nFigure 4. Abdominal and pelvis computed tomography scans showing circumferential wall thickening of the colon and rectum, prominent in the left transverse colon, and abdominopelvic free fluid with no free air.\n\nTable 1. Antibiotics sensitivity to Leclercia adecarboxylata in the blood culture.\n\nAntibiotics\tSensitivity\tMIC\t\nAmpicillin\tSensitive\t≤2\t\nCiprofloxacin\tSensitive\t≤0.25\t\nGentamicin\tSensitive\t≤1\t\nMeropenem\tSensitive\t≤0.25\t\nTrimethoprim/sulfamethoxazole\tSensitive\t≤20\t\nMIC – minimum inhibitory concentration.\n\nConflicts of Interest\n\nNone.\n==== Refs\nReferences:\n\n1. Armentrout R Brown R Molecular cloning of genes for cellobiose utilization and their expression in Escherichia coli Appl Environ Microbiol 1981 41 1355 62 6787983\n2. Tamura K Sakazaki R Kosako Y Yoshizaki E Leclercia adecarboxylata Gen. Nov., Comb. Nov., formerly known as Escherichia adecarboxylata Curr Microbiol 1986 13 179 98\n3. Sarma P Bhattacharya D Krishnan S Lal B Degradation of polycyclic aromatic hydrocarbons by a newly discovered Enteric bacterium, Leclercia adecarboxylata Appl Environ Microbiol 2004 70 3163 66 15128584\n4. Stock I Burak S Wiedemann B Natural antimicrobial susceptibility patterns and biochemical profiles of Leclercia adecarboxylata strains Clin Microbiol Infect Dis 2004 10 724 33\n5. Mazzariol A Zuliani J Fontana R Cornaglia G Isolation from blood culture of a Leclercia adecarboxylata strain producing an SHV-12 extended-spectrum beta-lactamase J Clin Microbiol 2003 41 1738 39 12682173\n6. Alosaimi R Muhmmed Kaaki M Catheter-related ESBL-producing Leclercia adecarboxylata septicemia in hemodialysis patient: An emerging pathogen? Case Rep Infect Dis 2020 2020 7403152 32089912\n7. Spiegelhauer M Andersen P Frandsen T Leclercia adecarboxylata: A case report and literature review of 74 cases demonstrating its pathogenicity in immunocompromised patients Infect Dis 2018 51 179 88\n8. Temesgen Z Toal D Cockerill F III Leclercia adecarboxylata infections: Case report and review Clin Infect Dis 1997 25 79 81 9243038\n9. Forrester J Adams J Sawyer R Leclercia adecarboxylata bacteremia in a trauma patient: Case report and review of the literature Surg Infect (Larchmt) 2012 13 63 66 22217232\n10. Rodriguez J Sanchez F Gutierrez N Garcia J Garcia-Rodriguez J Bacterial peritonitis due to Leclercia adecarboxylata in a patient under-going peritoneal dialysis Enferm Infecc Microbiol Clin 2001 19 237 38 11446916\n11. Sawamura H Kawamura Y Yasuda M [A clinical isolate of Leclercia adecarboxylata from a patient of pyelonephritis.] Kansenshogaku Zasshi 2005 79 831 35 [in Japanese] 16296332\n12. Kim H Chon C Ahn S Fatal spontaneous bacterial peritonitis by Leclercia adecarboxylata in a patient with hepatocellular carcinoma Int J Clin Pract 2008 68 1294 98\n13. Hess B Burchett A Huntington M Leclercia adecarboxylata in an immuno-competent patient J Med Microbiol 2008 57 7 896 98 18566150\n14. Yehia H Antimicrobial resistance patterns of Enterobacteriaceae and non-Enterobacteriaceae isolated from poultry intestinal Life Sci J 2013 10 3438 46\n15. Al-Holy M Osaili T El-Sayed S Microbiological quality of leafy green vegetables sold in the local market of Saudi Arabia Ital J Food Sci 2013 25 446 52\n16. Osaili T Alaboudi A Al-Quran H Al-Nabulsi A Decontamination and survival of Enterobacteriaceae on shredded iceberg lettuce during storage Food Microbiol 2018 73 129 36 29526198\n17. Anuradha M Leclercia adecarboxylata isolation: Case reports and review J Clin Diagn Res 2014 8 12 DD03 4\n18. Fattal O Deville J Leclercia adecarboxylata peritonitis in a child receiving chronic peritoneal dialysis PediatrNephrol 2014 15 3–4 186 87\n19. Ghosh R Misra R Prasad K Prasad N Peritonitis by Leclercia adecarboxylata in a patient with continuous ambulatory peritoneal dialysis: The first case report from India Int J Res Med Sci 2016 4 4 1254 56\n20. Adapa S Konala V Nawaz F Peritonitis from Leclercia adecarboxylata: An emerging pathogen Clin Case Rep 2019 7 829 31 30997095\n21. Rayfield E Ault M Keusch G Infection and diabetes: The case for glucose control Am J Med 1982 72 3 439 50 7036735\n22. Lee N Ki C Kang W Hickman catheter-associated bacteremia by Leclercia adecarboxylata and Escherichia hermannii: A case report Korean J Infect Dis 1999 31 167 70\n23. De La Obra P Domingo D Casaseca R Bacteremia due to Leclercia adecarboxylata in a patient with multiple myeloma Clin Microbiol Newsl 1999 21 142 43\n24. Botero-Garcia C Gomez C Bravo J Leclercia adecarboxylata, a rare cause of soft tissue infections in immunocompromised patients, case report and review of the literature Infect 2018 22 223 26\n25. Beltran A Vicente A Capilla S [Isolation of Leclercia adecarboxylata from wound exudate of a diabetic patient.] Med Clin (Barc) 2004 122 159 [in Spanish] 14967103\n26. Ando A Majewski L Kajioka E Leclercia adecarboxylata bacteremia: A case report and literature review of cases Open Forum Infect Dis 2016 3 Suppl.1 1096\n27. de Baere T Wauters G Huylenbroeck A Isolations of Leclercia adecarboxylata from a patient with a chronically inflamed gallbladder and from a patient with sepsis without focus J Clin Microbiol 2001 39 4 1674 75 11283116\n28. Papagiannitsis C Studentová V Hrabák J Isolation from a nonclinical sample of Leclercia adecarboxylata producing a VIM-1 metallo-β-lactamase Antimicrob Agents Chemother 2013 57 6 2896 97 23529733\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1941-5923",
"issue": "22()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000368:Aged; D000900:Anti-Bacterial Agents; D016470:Bacteremia; D004755:Enterobacteriaceae; D004756:Enterobacteriaceae Infections; D005260:Female; D006801:Humans; D016867:Immunocompromised Host",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "e929537",
"pmc": null,
"pmid": "33782375",
"pubdate": "2021-03-30",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "18566150;14967103;16296332;12682173;23529733;11283116;15301675;22217232;18705825;29526198;30488747;7036735;25653951;15128584;9243038;32089912;6787983;11149108;11446916;30997095",
"title": "Leclercia adecarboxylata Bacteremia without a Focus in a Non-Immunosuppressed Patient.",
"title_normalized": "leclercia adecarboxylata bacteremia without a focus in a non immunosuppressed patient"
} | [
{
"companynumb": "SA-INNOGENIX, LLC-2114511",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "MEROPENEM"
},
"drugadditional": null,
... |
{
"abstract": "Despite advances in the field, a clear treatment algorithm for most peripheral T-cell lymphoma (PTCL) subtypes remains to be defined. Generating reliable randomized data for this type of pathology remains a challenge because of the relative rarity of the disease and the heterogeneity of subtypes. Newer agents, such as the class-I selective histone deacetylase inhibitor romidepsin, have demonstrated efficacy and manageable toxicity in the relapsed and refractory setting. Whether novel agents should be used in conjunction with more conventional cytotoxic therapies or in sequence with a transplant strategy is unknown at this time. Here we report the successful use of romidepsin monotherapy as a bridge to allogeneic stem cell transplantation in a patient who had previously relapsed after several lines of conventional cytotoxic therapy for PTCL. Romidepsin provided the patient with sufficient disease control to proceed to transplantation while remaining in complete remission.",
"affiliations": "Dr. Léon-Richard Oncology Centre, 37 Providence Street, Moncton, NB, Canada E1C 8X3.;CHU de Québec, Hôpital Enfant-Jésus, 1401 18e Rue, Quebec, QC, Canada G1J 1Z4.",
"authors": "Finn|Nicholas|N|0000-0002-4908-6824;Larouche|Jean-Francois|JF|0000-0002-9645-2815",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2014/404078",
"fulltext": "\n==== Front\nCase Rep HematolCase Rep HematolCRIHEMCase Reports in Hematology2090-65602090-6579Hindawi Publishing Corporation 10.1155/2014/404078Case ReportRomidepsin Used as Monotherapy in Sequence with Allogeneic Stem Cell Transplant in a Patient with Peripheral T-Cell Lymphoma http://orcid.org/0000-0002-4908-6824Finn Nicholas \n1\n*http://orcid.org/0000-0002-9645-2815Larouche Jean-Francois \n2\n1Dr. Léon-Richard Oncology Centre, 37 Providence Street, Moncton, NB, Canada E1C 8X32CHU de Québec, Hôpital Enfant-Jésus, 1401 18e Rue, Quebec, QC, Canada G1J 1Z4*Nicholas Finn: nicholas.finn@vitalitenb.caAcademic Editor: Takashi Sonoki\n\n2014 7 7 2014 2014 40407829 4 2014 23 6 2014 23 6 2014 Copyright © 2014 N. Finn and J.-F. Larouche.2014This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Despite advances in the field, a clear treatment algorithm for most peripheral T-cell lymphoma (PTCL) subtypes remains to be defined. Generating reliable randomized data for this type of pathology remains a challenge because of the relative rarity of the disease and the heterogeneity of subtypes. Newer agents, such as the class-I selective histone deacetylase inhibitor romidepsin, have demonstrated efficacy and manageable toxicity in the relapsed and refractory setting. Whether novel agents should be used in conjunction with more conventional cytotoxic therapies or in sequence with a transplant strategy is unknown at this time. Here we report the successful use of romidepsin monotherapy as a bridge to allogeneic stem cell transplantation in a patient who had previously relapsed after several lines of conventional cytotoxic therapy for PTCL. Romidepsin provided the patient with sufficient disease control to proceed to transplantation while remaining in complete remission.\n==== Body\n1. Introduction\nCoiffier et al. reported a 25% overall response rate, including 15% complete response/unconfirmed complete response, in 130 patients receiving romidepsin for relapsed/refractory PTCL in a phase 2 clinical trial [1]. Other investigators have also reported similar response rates (overall response rate, 38%; complete response/unconfirmed complete response, 18%) in a smaller phase 2 trial involving a heavily pretreated population, 38% of whom had already undergone stem cell transplantation [2]. Responses were durable with this agent, as demonstrated by a median duration of response of 28+ months (median follow-up, 22.3 months) in the pivotal trial [3]. On the basis of these data, romidepsin was approved by the Food and Drug Administration in the United States for the treatment of PTCL in patients who have received at least one prior therapy. Because the role of allogeneic stem cell transplantation (alloSCT) in PTCL is still controversial [4–6], little has been published concerning the use of romidepsin as a bridge to this more definitive type of therapy.\n\n2. Case Presentation\nWe report the case of a 44-year-old woman who presented in April 2011 with a 2-month history of significant cervical lymph nodes. Written informed consent was obtained from the patient for publication of this case report. She had associated B-symptoms in the form of weight loss and night sweats. Examination showed that the patient had an Eastern Cooperative Oncology Group status of 1 and no other palpable lymph nodes or spleen enlargement. Results of a surgical lymph node biopsy were compatible with PTCL not otherwise specified; the T-cell infiltrate was positive for CD45, CD3, CD5, CD4, and CD30 and negative for CD20, CD15, and ALK-1. The Ki-67 index was determined to be 30%. Computed tomography (CT) imaging and bone marrow examination indicated stage IIIB disease. Lactate dehydrogenase was 4 times the upper limit of normal, and the complete blood count (CBC) results were as follows: white blood cell count, 16.1 × 109/L (absolute neutrophil count, 8.7 × 109/L); hemoglobin, 110 g/L; and platelets, 43 × 109/L.\n\nThe patient was given 8 cycles of CHOP-21 therapy (cyclophosphamide, doxorubicin, vincristine, and prednisone given over 21-day cycles). At the end of treatment, positron emission tomography–CT scanning showed remaining doubtful fluorodeoxyglucose uptake above baseline in 2 cm bilateral lymph nodes in the inguinal regions, and the CBC was normal. Within 3 months of the end of CHOP-21 therapy, the patient experienced disease progression complete with pancytopenia from bone marrow invasion, circulating atypical lymphocytes, hypercalcemia, low-grade renal insufficiency, and B-symptoms. We thought that she might be a good candidate for autologous stem cell transplantation if she proved to be chemotherapy-sensitive. She was given 2 cycles of DHAP (dexamethasone, cytarabine, and cisplatin) that were complicated by an episode of moderate-grade renal insufficiency as well as palpable purpura. Renal biopsies showed a nonspecific lymphoid infiltrate, and skin biopsies showed the presence of nonspecific intravascular thrombi. The patient's kidney failure resolved with corticosteroid treatment, and she was able to complete a third and final cycle of DHAP (with cisplatin substituted by carboplatin) without further kidney compromise. Repeated CT imagery demonstrated a complete response at this point.\n\nWithin 3 weeks of the end of second-line therapy, the patient developed a febrile state. Early relapse of disease was determined by CT imagery, which was evidence of progressive pancytopenia with bone marrow invasion and splenomegaly. After 2 nonsustained responses to chemotherapy, nonconventional agents were considered as treatment options; we attempted to subcutaneously administer alemtuzumab at a test dose of 3 mg after prophylactic medication; however, 3 attempts were aborted because of severe allergic reactions.\n\nThe patient maintained an adequate performance status throughout the disease course and was discharged to her home for 1 month while attempts were made to obtain romidepsin. Romidepsin, not yet approved by Health Canada, was obtained as monotherapy through a special access program. The first dose of the medication was given on August 23, 2012, following prophylactic antiemetic treatment. Because of preexisting thrombocytopenia, romidepsin was initiated at a reduced dose of 10 mg/m2 given on days 1, 8, and 15 of a 28-day cycle. The patient's baseline electrocardiogram was normal, including the QTc. The baseline CBC showed the following: white blood cell count, 3.6 × 109/L; absolute neutrophil count, 1.4 × 109/L; hemoglobin, 67 g/L with red blood cell transfusion dependence; and platelets, 62 × 109/L. Dose intensity was maintained despite some aggravation of the thrombocytopenia midcycle (platelet nadir, 27 × 109/L on day 8 of cycle 1), which recovered prior to the next cycle.\n\nOn romidepsin, the patient progressively regained her energy level. She became transfusion-independent, and her spleen became nonpalpable. At cycle 3, the dose of romidepsin was increased to the standard 14 mg/m2 because day 1 platelets had improved to 101 × 109/L. The patient no longer had circulating atypical lymphocytes, and her neutropenia was resolving. She required occasional intravenous magnesium supplements on the days of romidepsin therapy to keep electrolytes within the normal range, but she remained in outpatient care. After 4 cycles of romidepsin therapy, restaging with CT imagery and bone marrow sampling demonstrated no evidence of disease.\n\nBecause of prior short-duration responses with conventional cytotoxic agents, a transplant team evaluation was requested. The patient was known to have a fully matching sibling donor; therefore, it was thought that her best curative option would be familial alloSCT. A reduced-intensity conditioning regimen was selected due to comorbidities, including diabetes and renal failure with creatinine clearance of 70 mL/min. In preparation for transplant, romidepsin was continued for a total of 8 cycles; the last dose was given 10 days prior to her induction regimen of intravenous fludarabine 30 mg/m2× 5 days and intravenous cyclophosphamide 300 mg/m2× 5 days. The patient was also given cyclosporin and mycophenolate mofetil for graft-versus-host disease (GVHD) prophylaxis. She proceeded to transplant in late March of 2013 and has been monitored since. Engraftment occurred rapidly, with complete conversion to donor chimerism at day 29. She experienced no acute GVHD and limited chronic GVHD (of the mouth). There were no posttransplant complications, including infection or venooclusive disease. As of 14 months after transplant, the patient remains in remission with no evidence of relapse. Although graft-versus-lymphoma (GVL) effect is controversial, we believe it may have been involved in her sustained remission. Romidepsin was a successful bridge to alloSCT, but there was no evidence that it played a role in GVHD or a potential GVL effect in this patient.\n\n3. Discussion/Conclusion\nCases of durable complete remissions with single-agent romidepsin have been well documented in phase 2 clinical trials of patients with relapsed/refractory PTCL [1–3]. Some patients from these trials have gone on to receive SCT; however, the outcomes of these patients have not been reported. To our knowledge, this was the first documented report of romidepsin use in sequence with a nonmyeloablative alloSCT strategy. Although alloSCT is supported by some groups [4, 6], its exact role and timing in PTCL remain to be defined and are actively being investigated by others [5, 6]. We believe that, on a case-by-case basis, newer therapies such as this may be considered in the treatment algorithm of relapsed/refractory PTCL for patients seeking eventual curative options such as alloSCT.\n\nAcknowledgments\nThe authors take full responsibility for the content of this paper but thank Stacey Rose, Ph.D. (MediTech Media), for providing medical editorial assistance. Financial support for medical editorial assistance was provided by Celgene Corporation.\n\nConflict of Interests\nThe authors have no conflicts of interests to declare.\n==== Refs\n1 Coiffier B Pro B Prince HM Results from a pivotal, open-label, phase II study of romidepsin in relapsed or refractory peripheral T-cell lymphoma after prior systemic therapy Journal of Clinical Oncology 2012 30 6 631 636 2-s2.0-84857522968 22271479 \n2 Piekarz RL Frye R Prince HM Phase 2 trial of romidepsin in patients with peripheral T-cell lymphoma Blood 2011 117 22 5827 5834 2-s2.0-79952977561 21355097 \n3 Coiffier B Pro B Prince M Romidepsin for the treatment of relapsed/refractory peripheral T-cell lymphoma: pivotal study update demonstrates durable responses Journal of Hematology & Oncology 2014 7 1, article 11 \n4 Lunning MA Horwitz S Treatment of peripheral T-cell lymphoma: are we data driven or driving the data? Current Treatment Options in Oncology 2013 14 2 212 223 2-s2.0-84877782370 23568456 \n5 Reimer P Impact of autologous and allogeneic stem cell transplantation in peripheral T-cell lymphomas Advances in Hematology 2010 2010 12 pages 320624 2-s2.0-79952229727 \n6 Schmitz N Wu HS Glass B Allogeneic transplantation in T-cell lymphomas Seminars in Hematology 2014 51 1 67 72 24468318\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6579",
"issue": "2014()",
"journal": "Case reports in hematology",
"keywords": null,
"medline_ta": "Case Rep Hematol",
"mesh_terms": null,
"nlm_unique_id": "101576456",
"other_id": null,
"pages": "404078",
"pmc": null,
"pmid": "25105035",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": "21355097;23568456;24468318;22271479;21253465;24456586",
"title": "Romidepsin used as monotherapy in sequence with allogeneic stem cell transplant in a patient with peripheral T-cell lymphoma.",
"title_normalized": "romidepsin used as monotherapy in sequence with allogeneic stem cell transplant in a patient with peripheral t cell lymphoma"
} | [
{
"companynumb": "CA-CELGENEUS-028-22393-14083842",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOSPORINE"
},
"drugadditional": nul... |
{
"abstract": "Cytomegalovirus (CMV) colitis usually occurs in patients with advanced immunosuppression when the CD4 count is <50 cells/μL. We reported a case of recurrent CMV colitis in a patient with HIV who presented with profuse lower gastrointestinal bleed. This was a case of immune reconstitution inflammatory syndrome (IRIS) manifesting as CMV colitis and has been reported only once in the literature previously. This patient had a CD4 count of 157 cells/μL and undetectable viral load after being on antiretroviral therapy (ART) for 5 months, which was consistent with IRIS. The diagnosis of CMV was confirmed by a colonoscopy and a biopsy. This case highlights the fact that CMV colitis can manifest despite a moderately preserved CD4 count and the clinicians must have a high index suspicion for IRIS syndrome especially when someone was recently started on ART. Since effective treatment is available, it is important not to miss the diagnosis of CMV colitis.",
"affiliations": "Department of Internal Medicine, Mercy Fitzgerald Hospital, Darby, Pennsylvania, USA.;Department of Surgery, Mercy Fitzgerald Hospital, Darby, Pennsylvania, USA.;Department of Internal Medicine, Mercy Fitzgerald Hospital, Darby, Pennsylvania, USA.;Department of Internal Medicine-Infectious Disease, Mercy Fitzgerald Hospital, Darby, Pennsylvania, USA.",
"authors": "Alukal|Joseph|J|;Asif|Mohammed|M|;Mundada|Rachana|R|;McNamee|William B|WB|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-221121",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "Hiv / Aids; endoscopy; gastroenterology; infection (gastroenterology); ulcer",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D003092:Colitis; D003587:Cytomegalovirus; D003586:Cytomegalovirus Infections; D005260:Female; D006471:Gastrointestinal Hemorrhage; D015658:HIV Infections; D006801:Humans; D054019:Immune Reconstitution Inflammatory Syndrome; D008875:Middle Aged; D012008:Recurrence",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29301795",
"pubdate": "2018-01-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "1848619;16392092;28003231;27243020;10225382;20808452;15282241;18199043",
"title": "Recurrent cytomegalovirus colitis: a rare case of immune reconstitution inflammatory syndrome.",
"title_normalized": "recurrent cytomegalovirus colitis a rare case of immune reconstitution inflammatory syndrome"
} | [
{
"companynumb": "US-JNJFOC-20180115117",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RIVAROXABAN"
},
"drugadditional": "1",
... |
{
"abstract": "Prostate cancer (PCa) is the most common malignancy among men and one of the most common neoplasms affecting renal transplant recipients (RTRs). The available treatments for localized PCa among the general population (GP), surgery and external beam radiotherapy, carry a risk of damage to the transplanted kidney, the ureters, and the bladder and therefore tend to be avoided by most groups. The objective of this study was to assess the efficacy and feasibility of low-dose-rate brachytherapy (LDR-BT) for PCa in RTRs.\n\n\n\nWe carried out a retrospective review on all RTRs diagnosed of PCa who had undergone LDR-BT at our institution between 2000 and 2015. Nine patients met these criteria, but 1 did not fulfill the followup. Hence, we analyzed 8 patients. We reviewed all clinical data for PCa and graft function in these patients and compared the results with the GP.\n\n\n\nMean baseline prostate-specific antigen was 6.8 ± 1.9 ng/mL. All PCa had a Gleason score of 6 and were classified as low risk according the Europe Association of Urology guidelines. Mean followup after seed implantation was 48 ± 12.8 months. All 8 patients remain free of prostate-specific antigen failure. Five-year progression-free survival, cancer-specific survival, and overall survival rates were 100%, 100%, and 62.5%. There was no specific toxicity associated with LDR-BT, and there were no acute adverse events affecting the graft.\n\n\n\nLDR-BT is a feasible and acceptable treatment for localized PCa in RTRs. Oncological outcomes are similar to the GP, and there is minimal toxicity to the renal graft.",
"affiliations": "Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain. Electronic address: ines.rivero.belenchon@gmail.com.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.;Radiation Oncology Department, University Hospital Virgen del Rocío, Seville, Spain.;Radiation Oncology Department, University Hospital Virgen del Rocío, Seville, Spain.;Radiophysics Department, University Hospital Virgen del Rocío, Seville, Spain.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.;Radiation Oncology Department, University Hospital Virgen del Rocío, Seville, Spain.;Urology and Nephrology Department, University Hospital Virgen del Rocío, Biomedical Institute of Seville (IBiS)/University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain.",
"authors": "Rivero-Belenchón|I|I|;Osmán-García|I|I|;Congregado-Ruíz|C B|CB|;Cabrera-Roldán|P|P|;Jiménez-Torres|M J|MJ|;Baeza-Trujillo|M|M|;Lendínez-Cano|G|G|;Conde-Sánchez|J M|JM|;Argüelles-Salido|E|E|;Ortiz-Gordilo|M J|MJ|;Medina-López|R A|RA|",
"chemical_list": "D017430:Prostate-Specific Antigen",
"country": "United States",
"delete": false,
"doi": "10.1016/j.brachy.2018.06.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1538-4721",
"issue": "17(5)",
"journal": "Brachytherapy",
"keywords": "Brachytherapy; Prostate cancer; Renal transplant",
"medline_ta": "Brachytherapy",
"mesh_terms": "D001918:Brachytherapy; D006801:Humans; D007676:Kidney Failure, Chronic; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D017430:Prostate-Specific Antigen; D011471:Prostatic Neoplasms; D011879:Radiotherapy Dosage; D012189:Retrospective Studies; D013030:Spain; D015996:Survival Rate",
"nlm_unique_id": "101137600",
"other_id": null,
"pages": "808-815",
"pmc": null,
"pmid": "29970298",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Low-dose-rate brachytherapy for prostate cancer in renal transplant recipients.",
"title_normalized": "low dose rate brachytherapy for prostate cancer in renal transplant recipients"
} | [
{
"companynumb": "ES-ALKEM LABORATORIES LIMITED-ES-ALKEM-2018-07606",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"druga... |
{
"abstract": "An observational, prospective, cohort study was performed to assess changes in insulin sensitivity and serum leptin level after a switch from a ritonavir-boosted PI (PI/r) to raltegravir or dolutegravir in HIV-infected adults on stable combination ART (cART).\n\n\n\nNon-diabetic HIV-infected patients receiving suppressive cART including tenofovir disoproxil fumarate/emtricitabine plus one PI/r, who underwent a switch from the PI/r to raltegravir (group A) or dolutegravir (group B), were enrolled in the study. Serum levels of insulin, leptin and the homeostasis model assessment of insulin resistance (HOMA) index were evaluated during a 12 month follow-up.\n\n\n\nOverall, 86 patients were enrolled: 45 patients were included in group A and 41 were included in group B. The mean age was 45.7 years and 74 (86%) patients were male. After 12 months of follow-up, a significant reduction in the mean concentration of leptin and insulin was reported both in group A [-0.61 ng/mL (P < 0.001) and -2.5 mIU/L (P = 0.008), respectively] and in group B [-0.54 ng/mL (P = 0.005) and -2.1 mIU/L (P = 0.017), respectively], without a significant difference between the groups. A significant and comparable reduction in the mean HOMA index was reported both in group A [-0.55 (P = 0.004)] and in group B [-0.49 (P < 0.001)], as well as a significant decrease in lipid levels.\n\n\n\nIn HIV-positive subjects on suppressive cART, the switch from a PI/r to raltegravir or dolutegravir led to a significant and comparable reduction in both HOMA index and serum leptin level, reflecting a similar and significant improvement in insulin sensitivity.",
"affiliations": "Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.;Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.;Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.;Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.;Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.;Department of Specialistic, Diagnostic and Experimental Medicine, Unit of Microbiology, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 9, Bologna, Italy.;Department of Specialistic, Diagnostic and Experimental Medicine, Unit of Microbiology, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 9, Bologna, Italy.;Department of Medical and Surgical Sciences, Unit of Infectious Diseases, 'Alma Mater Studiorum' University of Bologna, S. Orsola-Malpighi Hospital, via Massarenti 11, Bologna, Italy.",
"authors": "Calza|Leonardo|L|;Colangeli|Vincenzo|V|;Borderi|Marco|M|;Coladonato|Simona|S|;Tazza|Beatrice|B|;Bon|Isabella|I|;Re|Maria Carla|MC|;Viale|Pierluigi|P|",
"chemical_list": "D015415:Biomarkers; D006575:Heterocyclic Compounds, 3-Ring; D020738:Leptin; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; D000068898:Raltegravir Potassium; C562325:dolutegravir; D019438:Ritonavir",
"country": "England",
"delete": false,
"doi": "10.1093/jac/dky507",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0305-7453",
"issue": "74(3)",
"journal": "The Journal of antimicrobial chemotherapy",
"keywords": null,
"medline_ta": "J Antimicrob Chemother",
"mesh_terms": "D000328:Adult; D023241:Antiretroviral Therapy, Highly Active; D015415:Biomarkers; D060085:Coinfection; D057915:Drug Substitution; D005260:Female; D015658:HIV Infections; D006575:Heterocyclic Compounds, 3-Ring; D006801:Humans; D007333:Insulin Resistance; D020738:Leptin; D008297:Male; D008875:Middle Aged; D010078:Oxazines; D010879:Piperazines; D011446:Prospective Studies; D011728:Pyridones; D000068898:Raltegravir Potassium; D012307:Risk Factors; D019438:Ritonavir; D016896:Treatment Outcome; D019562:Viral Load",
"nlm_unique_id": "7513617",
"other_id": null,
"pages": "731-738",
"pmc": null,
"pmid": "30541118",
"pubdate": "2019-03-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Improvement in insulin sensitivity and serum leptin concentration after the switch from a ritonavir-boosted PI to raltegravir or dolutegravir in non-diabetic HIV-infected patients.",
"title_normalized": "improvement in insulin sensitivity and serum leptin concentration after the switch from a ritonavir boosted pi to raltegravir or dolutegravir in non diabetic hiv infected patients"
} | [
{
"companynumb": "IT-MYLANLABS-2019M1056145",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "EMTRICITABINE\\TENOFOVIR DISOPROXIL FUMARATE"
},
... |
{
"abstract": "In March 2019, the sedative in the therapeutic hypothermia protocol at Bellevue Hospital Center and NYU Langone Health changed from morphine to dexmedetomidine. This study evaluated the impact of this change on efficacy and safety parameters.\n\n\n\nThis was a retrospective, observational cohort study including neonates with HIE undergoing therapeutic hypothermia (N = 70) at two regional perinatal medical centers.\n\n\n\nBaseline demographics, pain scores, hemodynamics, and time to enteral feeds were similar between dexmedetomidine (N = 34) and morphine (N = 36) patients. Dexmedetomidine patients received more breakthrough morphine (0.13 ± 0.13 vs 0.04 ± 0.09 mg/kg, p = 0.001), but less cumulative morphine (0.13 ± 0.13 vs 1.79 ± 0.23 mg/kg, p < 0.0001). Morphine patients on invasive ventilation required increased support (0 vs 31.58%, p = 0.02).\n\n\n\nDexmedetomidine is effective and safe for sedation and analgesia during therapeutic hypothermia. It reduced total opioid usage, with no increased incidence of adverse events.",
"affiliations": "Department of Pharmacy, Bellevue Hospital Center, New York, NY, USA. annacosnahan2@gmail.com.;Department of Pediatrics, NYU Grossman School of Medicine, New York, NY, USA.;Department of Pediatrics, NYU Grossman School of Medicine, New York, NY, USA.;Department of Pediatrics, NYU Grossman School of Medicine, New York, NY, USA.",
"authors": "Cosnahan|Anna S|AS|0000-0002-3267-4398;Angert|Robert M|RM|0000-0003-3088-0769;Jano|Eni|E|;Wachtel|Elena V|EV|",
"chemical_list": "D020927:Dexmedetomidine; D009020:Morphine",
"country": "United States",
"delete": false,
"doi": "10.1038/s41372-021-00998-8",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0743-8346",
"issue": "41(9)",
"journal": "Journal of perinatology : official journal of the California Perinatal Association",
"keywords": null,
"medline_ta": "J Perinatol",
"mesh_terms": "D001927:Brain Diseases; D015331:Cohort Studies; D020927:Dexmedetomidine; D006801:Humans; D007036:Hypothermia, Induced; D007231:Infant, Newborn; D009020:Morphine",
"nlm_unique_id": "8501884",
"other_id": null,
"pages": "2284-2291",
"pmc": null,
"pmid": "33649447",
"pubdate": "2021-09",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Dexmedetomidine versus intermittent morphine for sedation of neonates with encephalopathy undergoing therapeutic hypothermia.",
"title_normalized": "dexmedetomidine versus intermittent morphine for sedation of neonates with encephalopathy undergoing therapeutic hypothermia"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2022SP005692",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MORPHINE SULFATE"
},
"drugaddit... |
{
"abstract": "BACKGROUND\nSofosbuvir is the keystone of direct antiviral agents for the chronic hepatitis C (CHC). The safety of sofosbuvir in patients with stage 4-5 chronic kidney disease (CKD) needs further observation in real world.\n\n\nMETHODS\nThirty-three patients with stage 5 CKD and hepatitis C virus (HCV) infection from 2 hemodialysis centers accepted sofosbuvir based treatment as we reported previously. Serum potassium concentrations were tested every 4 weeks or on demand. Ten of 33 patients showed recurrence of hyperkalemia. We summarized the characteristics of hyperkalemia occurrence in these 10 patients. Overall, 24 episodes of hyperkalemia were observed in these 10 patients, 21 were under treatment and 3 were after treatment. Patients with or without hyperkalemia before sofosbuvir treatment didn't show significantly differences in the median frequencies of hyperkalemia episodes during the observation period (3.5 vs. 2, p = 0.264).\n\n\nCONCLUSIONS\nPatients with stage 5 CKD and HCV infection treated with sofosbuvir based regimens, even halved sofosbuvir, should be taken caution and closely monitoring serum potassium and renal function is necessary.",
"affiliations": "Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Department of Infectious Diseases, Xijing Hospital of the Air Force Medical University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Department of Internal Medicine, Zhen'An County Hospital, Zhen'An, China.;Department of Haemodialysis, Zhen'An County Hospital, Zhen'An, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China. zhaoyingren@mail.xitu.edu.cn.;Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi'an Jiaotong University, Xi'an City, China. heyingli2000@mail.xjtu.edu.cn.",
"authors": "Yan|Taotao|T|;Wang|Jiuping|J|;Li|Juan|J|;Fu|Shan|S|;Chen|Yi|Y|;Hu|Chunhua|C|;Zhang|Rou|R|;Tian|Zhen|Z|;Zhao|Fahui|F|;Dong|Jun|J|;Liu|Jinfeng|J|;Yang|Yuan|Y|;Chen|Tianyan|T|;Zhao|Yingren|Y|;He|Yingli|Y|",
"chemical_list": "D000998:Antiviral Agents; D000069474:Sofosbuvir",
"country": "England",
"delete": false,
"doi": "10.1186/s12879-019-4117-x",
"fulltext": "\n==== Front\nBMC Infect DisBMC Infect. DisBMC Infectious Diseases1471-2334BioMed Central London 411710.1186/s12879-019-4117-xCase ReportRecurrent hyperkalemia in patients with chronic kidney disease and hepatitis C treated with direct antiviral agents Yan Taotao 12Wang Jiuping 3Li Juan 12Fu Shan 12Chen Yi 12Hu Chunhua 12Zhang Rou 12Tian Zhen 12Zhao Fahui 4Dong Jun 5Liu Jinfeng 12Yang Yuan 12Chen Tianyan 12Zhao Yingren +86-135-0918-7086zhaoyingren@mail.xitu.edu.cn 12He Yingli +86-189-9123-2863heyingli2000@mail.xjtu.edu.cn 121 0000 0001 0599 1243grid.43169.39Institution of Hepatology, First Affiliated Teaching Hospital, SOM, Xi’an Jiaotong University, Xi’an City, China 2 0000 0001 0599 1243grid.43169.39Department of Infectious Diseases, First Affiliated Teaching Hospital, SOM, Xi’an Jiaotong University, No. 277 Yanta Road(w), Xi’an City, Shaanxi Province China 3 Department of Infectious Diseases, Xijing Hospital of the Air Force Medical University, Xi’an City, China 4 Department of Internal Medicine, Zhen’An County Hospital, Zhen’An, China 5 Department of Haemodialysis, Zhen’An County Hospital, Zhen’An, China 21 6 2019 21 6 2019 2019 19 55019 2 2019 21 5 2019 © The Author(s). 2019Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSofosbuvir is the keystone of direct antiviral agents for the chronic hepatitis C (CHC). The safety of sofosbuvir in patients with stage 4–5 chronic kidney disease (CKD) needs further observation in real world.\n\nCase presentation\nThirty-three patients with stage 5 CKD and hepatitis C virus (HCV) infection from 2 hemodialysis centers accepted sofosbuvir based treatment as we reported previously. Serum potassium concentrations were tested every 4 weeks or on demand. Ten of 33 patients showed recurrence of hyperkalemia. We summarized the characteristics of hyperkalemia occurrence in these 10 patients. Overall, 24 episodes of hyperkalemia were observed in these 10 patients, 21 were under treatment and 3 were after treatment. Patients with or without hyperkalemia before sofosbuvir treatment didn’t show significantly differences in the median frequencies of hyperkalemia episodes during the observation period (3.5 vs. 2, p = 0.264).\n\nConclusions\nPatients with stage 5 CKD and HCV infection treated with sofosbuvir based regimens, even halved sofosbuvir, should be taken caution and closely monitoring serum potassium and renal function is necessary.\n\nKeywords\nChronic kidney diseaseSofosbuvirHyperkalemiahttp://dx.doi.org/10.13039/501100001809National Natural Science Foundation of China815705288177031729He Yingli issue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nHepatitis C virus (HCV) infection is a leading cause of chronic liver disease, cirrhosis, and hepatocellular carcinoma. Patients with chronic kidney disease (CKD), especially those with end-stage renal disease (ESRD) on hemodialysis, present high prevalence of HCV serum positivity. Currently, since the high efficacy and well tolerance to direct antiviral agents (DAAs), antiviral treatment is recommended for all patients infected with HCV, including those with stage 4–5 CKD on hemodialysis and waiting for renal transplantation [1].\n\nStudies showed that sofosbuvir based regimens were highly efficacy and well tolerance in patients with HCV and stage 4–5 CKD [2, 3]. However, the safety of sofosbuvir, mainly sofosbuvir-derived metabolites in patients with CKD remains an opening question. In the safety pharmacology studies of sofosbuvir, high dose of GS-9851 (the parent of sofosbuvir) inhibited potassium current by approximately 13% at 159 μg/mL [4]. Patients with CKD are more prone to imbalance of homeostasis, such as metabolic acidosis, hyperkalemia. Based on our knowledge, up to now, serum potassium in patients with CKD treated with sofosbuvir has not been reported.\n\nPreviously, we reported a nosocomial HCV outbreak in Zhen’an County Hospital, Shaanxi Province, China, in January 2016 [5]. Thirty-three patients with hepatitis C and stage 5 CKD on hemodialysis were treated with half dose of sofosbuvir (200 mg) and full dose of daclatasvir (60 mg). All patients completed 24-week treatment and additional 12-week follow-up. This special population provided a unique opportunity for us to observe the serum potassium concentration during sofosbuvir treatment. Serum potassium concentrations were regular tested every 4 week or on demand during the treatment course and post-treatment up to 12 weeks. The levels of serum potassium 3 months prior to treatment were retrieved from the medical record database of the hospitals. Hyperkalemia was defined as serum potassium concentration higher than 5.5 mmol/L. Ten out of 33 were reported recurrence of hyperkalemia. We report hyperkalemia occurrences of these 10 patients with CKD and HCV infection who received sofosbuvir-based regimens.\n\nCase presentation\nBaseline characteristics\nGeneral information, treatment regimens, comorbidity, dialysis history, co-medication and adverse effects (AEs) were retrieved form electronic medical record. Means were used to describe quantitative variables and medians were used to describe the number of hyperkalemia episodes. All statistical analyses were performed using SPSS 16.0. Patients’ demographics were presented in Table 1. There were 7 males and the average age was 49.2 ± 14.5 years old. The average dialysis period was 2.85 ± 1.17 years. Drug-drug interaction was searched in HEP Drug Interactions database reserved by the University of Liverpool (data from the website: http://www.hep-druginteractions.org). The medicines combined with DAAs in these 10 patients do not present clinically significant interaction with sofosbuvir. Seven patients took DAAs in combination with at least one of the following medicines, nifedipine, carvedilol and amlodipine, which is reported potential interaction with daclatasvir. Carvedilol is contraindicated in patients with severe liver impairment. All of the patients were mild liver damage and the liver function returned normal during the antiviral treatment.Table 1 Demographics of the 10 patients at baseline\n\nPatient\tGender (F/M)\tAge (Years)\tUnderlying Diseases\t#Dialysis History\tCo-medication\t\nNo. 1\tM\t72\tDiabetes, Hypertension\t3 years\tatorvastatin, nifedipine, metoprolol tartrate, caltrate, insulin\t\nNo. 2\tM\t56\tDiabetes, Hypertension, Nephrolithiasis, Coronary heart disease\t4 years\tnifedipine, carvedilol, novolin 30R\t\nNo. 3\tF\t56\tDiabetes, Hypertension\t4 years\tnifedipine, metoprolol tartrate, carvedilol, novolin 30R\t\nNo. 4\tM\t57\tNephritis, Hypertension\t4 years\tnifedipine, metoprolol tartrate, carvedilol, amlodipine\t\nNo. 5\tF\t54\tNephritis, Hypertension\t4 years\tnifedipine, metoprolol tartrate, carvedilol\t\nNo. 6\tM\t57\tObstructive Nephropathy, Hydronephrosis, Chronic hepatitis B\t1.5 years\tNone\t\nNo. 7\tM\t45\tHydronephrosis\t2 years\tmetoprolol tartrate, vitamin B12, folic acid\t\nNo. 8\tM\t43\tNephritis; Hypertension\t1 years\tnifedipine, metoprolol tartrate, carvedilol\t\nNo. 9\tF\t27\tDiabetes, Hypertension\t3 years\tnifedipine, amlodipine, metoprolol tartrate, caltrate, calcitriol, vitamin B12, folic acid, polysaccharide-iron complex\t\nNo. 10\tM\t25\tNephritis, Hypertension\n\nCoronary heart disease, Chronic Hepatitis B\n\n\t2 years\tnifedipine, metoprolol tartrate, caltrate\t\nThe antiviral therapy was half dose of sofosbuvir (200 mg) daily or post-dialysis and full dose of daclatasvir (60 mg)\n\n# Dialysis scheme was 5 times per 2 weeks for these patients with stage 5 chronic kidney disease\n\n\n\nOccurrence of hyperkalemia\nFigure 1 showed the detailed hyperkalemia occurrences of the 10 patients. Overall, 24 episodes of hyperkalemia were observed in these 10 patients. Of 24 episodes of hyperkalemia, 21 were observed during treatment and 3 were observed after the end of treatment. There were 2, 5, 5, 2, 4, 3 episodes of hyperkalemia in 0–4, 5–8, 9–12, 13–16, 17–20, 21–24 weeks, respectively. Three episodes of hyperkalemia were observed post-treatment at week 1, 2 and 3 post-treatment. In summary, hyperkalemia could occur at any time of the observational period from on-treatment to post-treatment.Fig. 1 The detailed hyperkalemia of 10 patients. a-j present the hyperkalemia in patients No. 1-10, respectively\n\n\n\nOf the 10 patients, 2 showed history of hyperkalemia before antiviral treatment. Then, we tested if the history of hyperkalemia before treatment could increase the possibility of hyperkalemia on treatment. A total of 7 episodes of hyperkalemia were observed in the 2 patients with hyperkalemia history, while 17 episodes of hyperkalemia were observed in the rest of 8 patients without hyperkalemia history. Non-parametric test was used to compare hyperkalemia episodes between the patients with and without hyperkalemia history pre-treatment. The median frequencies of hyperkalemia episodes in patients with and without hyperkalemia history pre-treatment were 3.5 and 2, respectively. No significant differences between the patients with and without hyperkalemia history pre-treatment (p = 0.264).\n\nDiscussion and conclusion\nThis is the first time to report recurrent hyperkalemia in patients with CKD and HCV infection treated with half-dose of sofosbuvir based regimen, although bradycardia, changed intracellular Ca2+ and acute interstitial nephritis have been reported potentially associated with sofosbuvir.\n\nThe recurrence of hyperkalemia was highly related to the administration of sofosbuvir. Patients with CKD especially in uremia period are at high risk of hyperkalemia, while regular dialysis aims to replace the function of kidney and could maintain the balance of electrolyte. In our case serials, we cannot attribute recurrence of hyperkalemia to insufficiently dialysis, for the dialysis scheme was unchanged before, during and after antiviral treatment. The dialysis therapy was sufficient for these 10 patients; because the serum creatinine levels remained stable and majority (8/10) of the patients were not observed hyperkalemia prior to sofosbuvir based treatment. Furthermore, other electrolytes, such as serum sodium or serum calcium disorder was not observed, and acid-base kept in homeostasis, supporting the adequacy of hemodialysis. Moreover, after the end of treatment, 8 out of the 10 patients did not present hyperkalemia, and along with the time extension of drug cessation, no hyperkalemia was observed. The temporal consistency between the DAAs usage and hyperkalemia occurrence highly supported the association between DAAs and hyperkalemia. Based on the HEP Drug Interactions database, no clinically significant interaction was showed between the co-medicines. Collectively, the raising levels of serum potassium were highly suspected in association to the usage of sofosbuvir.\n\nThe mechanism of the observed hyperkalemia in patient with CKD and HCV infection treated with sofosbuvir based regimens was unclear. As mentioned above, the recurrence of hyperkalemia could not be attributed to the insufficiency dialysis. Previously, case serials of bradycardia resulted from the co-administration of sofosbuvir and amiodarone were reported [6]. Regan CP et al. and Millard DC et al. demonstrated that co-administration of sofosbuvir and amiodarone produced dysfunction of the sinoatrial node automaticity and atrioventricular node conduction, decrease in cardiomyocyte mechanical activity and intracellular Ca2+ transients [7, 8]. Acute interstitial nephritis revealed by renal biopsy was reported potentially related to sofosbuvir, we assume that potassium exchange between inside and outside of cells may be an important factor of hyperkalemia [9, 10]. Actually, although no literature reports the impact on potassium channel by sofosbuvir, high dose of GS-9851 (the parent of sofosbuvir) did inhibit hERG-mediated potassium current in HEK293 cells expressing cloned hERG channels [4]. Integrating these evidences together, sofosbuvir do induce the dysfunction of ion channel, and such impact is more prominent in those cases with CKD and co-administered with drugs acting on an ion channel. In current report, calcium-channel blockers (CCBs) were administered in 7 patients. The drug-drug interaction could not be neglected in patients with stage 5 CKD co-administered with sofosbuvir and CCBs, since the metabolic pathway of CCBs have an intersection with that of sofosbuvir.\n\nThis is a retrospective report, the occurrence of hyperkalemia may be underestimated especially in patients with stage 5 CKD. However, the observation of this report could still provide a clue for clinicians to strengthen the monitoring for serum potassium when treating HCV infection with sofosbuvir, even its dose is halved, based regimens in patients with CKD.\n\nAbbreviations\nAEsAdverse effects\n\nCCBsCalcium-channel blockers\n\nCKDChronic kidney disease\n\nDAAsDirect antiviral agents\n\nESRDEnd-stage renal disease\n\nHCVHepatitis C virus\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nTaotao Yan and Jiuping Wang contributed equally to this work.\n\nWe all express our gratitude to the patients, who kindly gave consent for the cases to be presented in this paper.\n\nAuthors’ contributions\nTTY, JPW and YLH planned and designed the study and wrote the protocol. YLH, YRZ, TYC and JPW were responsible for the treatment of those patients. TTY, ZT, FHZ, JD, JFL, and YY participated in the study monitoring and management. JL, SF, YC, CHH and RZ were biostatisticians and participated in the data analysis and writing of the report. All authors read and approved the final version of the report.\n\nFunding\nThis work was supported by the National Natural Science Foundation of China (Grant/Award Number: 81570528, 8177031729) and the grants from the Fundamental Research Funds for the Central Universities.\n\nAvailability of data and materials\nThe datasets used during the current study are available from the corresponding author on reasonable request.\n\nEthics approval and consent to participate\nThe study protocol was performed to conform with the Declaration of Helsinki and was approved by the Ethics Committee of the First Affiliated Teaching Hospital, SOM, Xi’an Jiaotong University. Written informed consent was obtained from all the patients and/or their relatives.\n\nConsent for publication\nWritten informed consent was obtained from the patients and/or relatives for publication of this case report.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. European Association for the Study of the Liver Electronic address eee, European Association for the Study of the L: EASL recommendations on treatment of hepatitis C 2018 J Hepatol 2018 69 2 461 511 10.1016/j.jhep.2018.03.026 29650333 \n2. Bhamidimarri KR Czul F Peyton A Levy C Hernandez M Jeffers L Roth D Schiff E O'Brien C Martin P Safety, efficacy and tolerability of half-dose sofosbuvir plus simeprevir in treatment of hepatitis C in patients with end stage renal disease J Hepatol 2015 63 3 763 765 10.1016/j.jhep.2015.06.004 26095179 \n3. Desnoyer A Pospai D Le MP Gervais A Heurgue-Berlot A Laradi A Harent S Pinto A Salmon D Hillaire S Pharmacokinetics, safety and efficacy of a full dose sofosbuvir-based regimen given daily in hemodialysis patients with chronic hepatitis C J Hepatol 2016 65 1 40 47 10.1016/j.jhep.2016.02.044 26952005 \n4. Gilead Sciences I. Pharmacology review(s), Sofosbuvir (GS-7977), 204671Orig1s000. 2013. https://www.accessdata.fda.gov/drugsatfda_docs/nda/2013/204671Orig1s000PharmR.pdf.\n5. He YL Yang SJ Hu CH Dong J Gao H Yan TT Liu JF Yang Y Ren DF Zhu L Safety and efficacy of sofosbuvir-based treatment of acute hepatitis C in end-stage renal disease patients undergoing haemodialysis Aliment Pharmacol Ther 2018 47 4 526 532 10.1111/apt.14429 29250808 \n6. Administration USFaD. FDA Drug Safety Communication: FDA warns of serious slowing of the heart rate when antiarrhythmic drug amiodarone is used with hepatitis C treatments containing sofosbuvir Harvoni or Sovaldi in combination with another direct acting antiviral drug. https://www.fda.gov/drugs/drug-safety-and-availability/fda-drug-safety-communication-fda-warns-serious-slowing-heart-rate-when-antiarrhythmic-drug.\n7. Millard DC Strock CJ Carlson CB Aoyama N Juhasz K Goetze TA Stoelzle-Feix S Becker N Fertig N January CT Identification of Drug-Drug interactions in vitro: a case study evaluating the effects of Sofosbuvir and amiodarone on hiPSC-derived cardiomyocytes Toxicol Sci 2016 154 1 174 182 10.1093/toxsci/kfw153 27503387 \n8. Regan CP Morissette P Regan HK Travis JJ Gerenser P Wen JZ Fitzgerald K Gruver S DeGeorge JJ Sannajust FJ Assessment of the clinical cardiac drug-drug interaction associated with the combination of hepatitis C virus nucleotide inhibitors and amiodarone in Guinea pigs and rhesus monkeys Hepatology 2016 64 5 1430 1441 10.1002/hep.28752 27474787 \n9. Wanchoo R Thakkar J Schwartz D Jhaveri KD Harvoni (Ledipasvir with Sofosbuvir)-induced renal injury Am J Gastroenterol 2016 111 1 148 149 10.1038/ajg.2015.391 26785666 \n10. Ashraf T Majoni W Acute interstitial nephritis associated with Sofosbuvir and Daclatasvir ACG Case Rep J 2017 4 e84 10.14309/crj.2017.84 28706960\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2334",
"issue": "19(1)",
"journal": "BMC infectious diseases",
"keywords": "Chronic kidney disease; Hyperkalemia; Sofosbuvir",
"medline_ta": "BMC Infect Dis",
"mesh_terms": "D000328:Adult; D000368:Aged; D000998:Antiviral Agents; D015331:Cohort Studies; D004359:Drug Therapy, Combination; D005260:Female; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D006947:Hyperkalemia; D008297:Male; D008875:Middle Aged; D012008:Recurrence; D051436:Renal Insufficiency, Chronic; D000069474:Sofosbuvir; D000072230:Sustained Virologic Response",
"nlm_unique_id": "100968551",
"other_id": null,
"pages": "550",
"pmc": null,
"pmid": "31226947",
"pubdate": "2019-06-21",
"publication_types": "D016428:Journal Article",
"references": "26095179;26785666;26952005;27474787;27503387;28706960;29250808;29650333",
"title": "Recurrent hyperkalemia in patients with chronic kidney disease and hepatitis C treated with direct antiviral agents.",
"title_normalized": "recurrent hyperkalemia in patients with chronic kidney disease and hepatitis c treated with direct antiviral agents"
} | [
{
"companynumb": "CN-GILEAD-2019-0415492",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FOLIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nMycoplasma genitalium (MG) is a common cause of sexually transmitted infection, however no prevalence data is available for Wales. MG was detected by qPCR (quantitative) as well as two separate SpeeDx commercial assays, and related to clinical symptoms, age, gender and sample type.\n\n\nMETHODS\nCervical swabs, urethral swabs and/or urine were collected from 1000 patients at walk-in sexual health clinics at 3 Welsh health centres from October 2017-October 2018. Extracted DNA was investigated to determine concordance between an in-house quantitative PCR, SpeeDx ResistancePlus® MG and the SpeeDx MG + parC (beta 2) assays; mutations in parC were substantiated by Sanger sequencing.\n\n\nRESULTS\nMG was detected in 17/600 female patients (2.7%) and 13/400 (3.5%) male patients, with a 100% concordance between in-house qPCR and both SpeeDx assays. Macrolide resistance was low (relative to other studies), but more common in males (4/13; 30.8%) than females (2/17; 11.8%) and the only fluoroquinolone resistant sample (3.4% overall) was also macrolide resistant and detected from an MSM. Vaginitis was clinically apparent in 12/17 MG-positive females (2 with additional cervicitis, 1 with additional pelvic inflammatory disease), while 7 MG-positive males were asymptomatic. MG bacterial load did not correlate to clinical symptoms and females (4559 ± 1646/ml) had significantly lower MG load than males (84,714 ± 41,813/ml; p = 0.0429).\n\n\nCONCLUSIONS\nMG prevalence and antibiotic resistance in Welsh sexual health clinics is low. MG bacterial load did not correlate to clinical presentation, men have higher MG load/ml in urine than women, genders have different age bias for MG prevalence and urine and swabs are equivalent for detecting MG.",
"affiliations": "Cardiff University, School of Medicine, Division of Infection and Immunity, Department of Medical Microbiology, University Hospital of Wales, Cardiff, CF14 4XN, United Kingdom. Electronic address: spillerb@cardiff.ac.uk.;Cardiff University, School of Medicine, Division of Infection and Immunity, Department of Medical Microbiology, University Hospital of Wales, Cardiff, CF14 4XN, United Kingdom.;Cardiff University, School of Medicine, Division of Infection and Immunity, Department of Medical Microbiology, University Hospital of Wales, Cardiff, CF14 4XN, United Kingdom.;Department of Integrated Sexual Health, Dewi Sant Hospital, Cwm Taf Morgannwg University Health Board, Pontypridd, CF37 1LB, United Kingdom.;Cardiff University, School of Medicine, Division of Infection and Immunity, Department of Medical Microbiology, University Hospital of Wales, Cardiff, CF14 4XN, United Kingdom; Department of Integrated Sexual Health, Dewi Sant Hospital, Cwm Taf Morgannwg University Health Board, Pontypridd, CF37 1LB, United Kingdom.",
"authors": "Spiller|Owen B|OB|;Rees|Christopher L|CL|;Morris|Daniel J|DJ|;Davies|Rebecca L|RL|;Jones|Lucy C|LC|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.micpath.2019.103872",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0882-4010",
"issue": "139()",
"journal": "Microbial pathogenesis",
"keywords": null,
"medline_ta": "Microb Pathog",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D058491:Bacterial Load; D024881:Drug Resistance, Bacterial; D005260:Female; D005798:Genes, Bacterial; D006801:Humans; D008297:Male; D008875:Middle Aged; D009154:Mutation; D009175:Mycoplasma Infections; D045704:Mycoplasma genitalium; D015995:Prevalence; D062486:Public Health Surveillance; D000074384:Sexual Health; D063189:Symptom Assessment; D055815:Young Adult",
"nlm_unique_id": "8606191",
"other_id": null,
"pages": "103872",
"pmc": null,
"pmid": "31756372",
"pubdate": "2020-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Mycoplasma genitalium prevalence in Welsh sexual health patients: Low antimicrobial resistance markers and no association of symptoms to bacterial load.",
"title_normalized": "mycoplasma genitalium prevalence in welsh sexual health patients low antimicrobial resistance markers and no association of symptoms to bacterial load"
} | [
{
"companynumb": "GB-MYLANLABS-2020M1003386",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXYCYCLINE"
},
"drugadditional": null,
... |
{
"abstract": "Malignant pleural mesothelioma (MPM) is associated with a poor prognosis. The combination of cisplatin and pemetrexed has been established as a standard chemotherapy that confers a survival benefit. Because the regimen is sometimes hampered by the renal toxicity of cisplatin and no second-line chemotherapy has yet been established, the strategy of administering a higher total dose of pemetrexed to optimize the regimen could be promising. We herein describe the case of a 69-year-old man with MPM who underwent five cycles of cisplatin plus pemetrexed and exhibited a partial response. Because his serum creatinine increased, pemetrexed maintenance therapy (PMT) was adopted, and 18 cycles were successfully delivered and the patient achieved a complete response. This case suggests that PMT could thus be useful for treating MPM.",
"affiliations": "Division of Respiratory Medicine, Department of Internal Medicine, Uji Tokushukai Medical Center, Japan.",
"authors": "Takeda|Takayuki|T|;Itano|Hideki|H|;Fukita|Shinichi|S|;Saitoh|Masahiko|M|;Takeda|Sorou|S|",
"chemical_list": "D005971:Glutamates; D000068437:Pemetrexed; D006147:Guanine; D002945:Cisplatin",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.53.2094",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0918-2918",
"issue": "53(20)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D002945:Cisplatin; D018572:Disease-Free Survival; D005971:Glutamates; D006147:Guanine; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D008654:Mesothelioma; D000086002:Mesothelioma, Malignant; D000068437:Pemetrexed; D010997:Pleural Neoplasms; D012074:Remission Induction",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "2347-51",
"pmc": null,
"pmid": "25318801",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Long progression-free survival by pemetrexed continuation maintenance therapy following cisplatin-based chemotherapy in malignant pleural mesothelioma.",
"title_normalized": "long progression free survival by pemetrexed continuation maintenance therapy following cisplatin based chemotherapy in malignant pleural mesothelioma"
} | [
{
"companynumb": "JP-MYLANLABS-2014M1010968",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Although pseudomembranous colitis is relatively common following antibiotic exposure, there have been few reported cases of pseudomembrane formation involving the small intestine. Herein we report a case of pseudomembranous enteritis of the small and large intestine that occurred after antibiotic exposure. The etiologic organism appears to be Clostridium difficile, as evidenced by the characteristic pseudomembranous lesions and a positive ELISA for toxin A in an ileal tissue specimen.",
"affiliations": "Pharmacy Service, Veterans Affairs Medical Center, Palo Alto, California 94304.",
"authors": "Tsutaoka|B|B|;Hansen|J|J|;Johnson|D|D|;Holodniy|M|M|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "United States",
"delete": false,
"doi": "10.1093/clinids/18.6.982",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1058-4838",
"issue": "18(6)",
"journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America",
"keywords": null,
"medline_ta": "Clin Infect Dis",
"mesh_terms": "D000368:Aged; D000900:Anti-Bacterial Agents; D004761:Enterocolitis, Pseudomembranous; D006801:Humans; D007082:Ileum; D008297:Male",
"nlm_unique_id": "9203213",
"other_id": null,
"pages": "982-4",
"pmc": null,
"pmid": "8086563",
"pubdate": "1994-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Antibiotic-associated pseudomembranous enteritis due to Clostridium difficile.",
"title_normalized": "antibiotic associated pseudomembranous enteritis due to clostridium difficile"
} | [
{
"companynumb": "US-PFIZER INC-2019195161",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Peribulbar anesthesia (PB) is known to be safer than retrobulbar (RB) anesthesia. To our knowledge, no amaurosis has been described after PB. We report here the cases of two patients who underwent PB before membrane peeling. The injections were administered with a 25-gauge, 22-mm bevel disposable needle. The anesthetic used was ropivacaine 1% with a volume of 8 ml and 75 µg of clonidine as an adjuvant (7.5 µg/ml). Given that complete akinesia was not achieved, a second injection of 2 ml was administered in the supero-medial injection site. Thirty minutes after the PB, the first patient experienced amaurosis with no light perception (LP). The ophthalmic examination was normal. Visual acuity recovered after 1 day. Regarding the second patient, the loss of VA was observed 20 min after the PB. IOP was 20 mmHg. The anterior segment and fundus exam were normal. Rubin found the PB technique to be as effective and safer than RB injection, as the needles are not supposed to enter the RB space and Davis and Mandel found no amaurosis after PB. PB is administered via the extraconal injection of an anesthetic agent. These amaurosis might be explained by the fact that some anesthetic may have penetrated the RB space. In cases where two PB injections are administered, the anatomy is expected to change due to the volume effect of the first injection. The second injection is higher risk as it is administered closer to the optic nerve.",
"affiliations": "Department of Ophthalmology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon 1, Lyon, France.;Department of Anesthesiology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon, Lyon, France.;Department of Ophthalmology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon 1, Lyon, France.;Department of Anesthesiology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon, Lyon, France.;Department of Ophthalmology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon 1, Lyon, France.;Department of Ophthalmology, Croix-Rousse University Hospital, Hospices Civils de Lyon, University of Lyon 1, Lyon, France.",
"authors": "Rezkallah|Amina|A|https://orcid.org/0000-0001-6110-2113;Gargori|Nezar|N|;Denis|Philippe|P|;Waldmann|Véronique|V|;Mathis|Thibaud|T|https://orcid.org/0000-0002-1418-1872;Kodjikian|Laurent|L|https://orcid.org/0000-0002-3908-6716",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/1120672120984399",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1120-6721",
"issue": null,
"journal": "European journal of ophthalmology",
"keywords": "Peribulbar block; amaurosis; vitreoretinal surgery",
"medline_ta": "Eur J Ophthalmol",
"mesh_terms": null,
"nlm_unique_id": "9110772",
"other_id": null,
"pages": "1120672120984399",
"pmc": null,
"pmid": "33356868",
"pubdate": "2020-12-24",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Unexpected amaurosis occurring after peribulbar anesthesia: Exploring the causes in two cases.",
"title_normalized": "unexpected amaurosis occurring after peribulbar anesthesia exploring the causes in two cases"
} | [
{
"companynumb": "FR-UNICHEM PHARMACEUTICALS (USA) INC-UCM202101-000028",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ALFENTANIL"
},
"... |
{
"abstract": "Lupus nephritis (LN) affects up to 50% of patients with Systemic Lupus Erythematosus (SLE) and is associated with a worse prognosis. LN usually develops within the first 5 years of the onset of the disease. We report three patients with very delayed LN (DLN) diagnosed after 15 or more years after SLE diagnosis. The three patients were non-Caucasian women with adolescent or adult-onset SLE. Each had antinuclear, anti-dsDNA and anti-Ro antibodies. Hydroxychloroquine was prescribed for each. Their disease courses were characterised by sporadic non-renal flares controlled by steroids and, in two cases, by one cycle of rituximab. Unexpectedly, they developed proteinuria, haematuria and lowering of estimated glomerular filtration rate with clinical signs of renal disease. LN was confirmed by renal biopsy. Reviewing them, each showed serological signs of increasing disease activity (rising levels of anti-dsDNA antibodies and fall in C3) that predated clinical or laboratory signs of LN by 1-3 years. Reviewing the literature, we found a lack of knowledge about DLN starting more than 15 years after SLE diagnosis. With the increasing life expectancy of patients with SLE it is likely that more cases of very DLN will emerge.",
"affiliations": "Department of Internal and Intensive Medicine, Hospital da Luz, Lisboa, Portugal.;Autoimmune Diseases Unit, Internal Medicine 7.2 Department, Hospital Curry Cabral, Centro Hospitalar Lisboa Central, Lisbon, Portugal.;Centre for Rheumatology, University College London, London, UK.",
"authors": "Alexandre|André R|AR|0000-0001-7435-634X;Carreira|Pedro L|PL|;Isenberg|David A|DA|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/lupus-2017-000241",
"fulltext": "\n==== Front\nLupus Sci MedLupus Sci MedlupusscimedlupusLupus Science & Medicine2053-8790BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR lupus-2017-00024110.1136/lupus-2017-000241Review1506Very delayed lupus nephritis: a report of three cases and literature review http://orcid.org/0000-0001-7435-634XAlexandre André R 1Carreira Pedro L 2Isenberg David A 31 Department of Internal and Intensive Medicine, Hospital da Luz, Lisboa, Portugal2 Autoimmune Diseases Unit, Internal Medicine 7.2 Department, Hospital Curry Cabral, Centro Hospitalar Lisboa Central, Lisbon, Portugal3 Centre for Rheumatology, University College London, London, UKCorrespondence to Dr David A Isenberg; D.Isenberg@ucl.ac.uk2018 12 1 2018 5 1 e00024120 9 2017 23 11 2017 27 11 2017 © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.2018This is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/Lupus nephritis (LN) affects up to 50% of patients with Systemic Lupus Erythematosus (SLE) and is associated with a worse prognosis. LN usually develops within the first 5 years of the onset of the disease. We report three patients with very delayed LN (DLN) diagnosed after 15 or more years after SLE diagnosis. The three patients were non-Caucasian women with adolescent or adult-onset SLE. Each had antinuclear, anti-dsDNA and anti-Ro antibodies. Hydroxychloroquine was prescribed for each. Their disease courses were characterised by sporadic non-renal flares controlled by steroids and, in two cases, by one cycle of rituximab. Unexpectedly, they developed proteinuria, haematuria and lowering of estimated glomerular filtration rate with clinical signs of renal disease. LN was confirmed by renal biopsy. Reviewing them, each showed serological signs of increasing disease activity (rising levels of anti-dsDNA antibodies and fall in C3) that predated clinical or laboratory signs of LN by 1–3 years. Reviewing the literature, we found a lack of knowledge about DLN starting more than 15 years after SLE diagnosis. With the increasing life expectancy of patients with SLE it is likely that more cases of very DLN will emerge.\n\nlupus nephritissystemic lupus erythematosusrenal diseasespecial-featureunlocked\n==== Body\nIntroduction\nClinically evident lupus nephritis (LN) is a frequent form of organ involvement in up to 50% of patients with SLE and carries a worse prognosis than non-renal disease.1 2 As reported recently from our own SLE cohort, 34.6% of 673 patients followed up between 1978 and 2015 developed overt renal disease (biopsy proven in 90%).3\n\nThe vast majority of patients who develop LN do so within 5 years of SLE diagnosis, few do so subsequently (5%–15%).1 4 Delayed LN (DLN) may carry a worse prognosis than LN presenting sooner,5 although the data are conflicting.4 6 DLN can affect any age and must be differentiated from late-onset LN (LLN), a form of LN occurring in patients diagnosed with SLE after 50 years of age. LLN seems to have a slightly better renal outcome when compared with early-onset LN.7\n\nAlthough a very small percentage of our patients have developed their renal disease after 7 years of SLE diagnosis2 interestingly, and unexpectedly, in the past few years three patients have developed biopsy-proven LN 15 years or more (figure 1) after meeting the revised American College of Rheumatology criteria for the classification of SLE.8 We now report these three unusual cases trying to identify any abnormal features they might share and reviewed the literature about very DLN.\n\nFigure 1 Lupus nephritis cumulative free survival time in years of our SLE cohort.\n\nCase reports\nCase 1\nA 28-year-old African woman first presented to our clinic with a malar rash, polyarthritis, serositis and Coombs positive haemolytic anaemia. She had a high ANA titre (>1:320) with a diffuse pattern and anti-Ro and anti-dsDNA antibodies. Antibodies to other extractable nuclear antigens and phospholipids were all negative. Her C3 complement level was low (0.69 g/L (NR=0.9–1.8)). This presentation led to her SLE diagnosis, and treatment was initiated with steroids and hydroxychloroquine. Her disease was kept under control for 9 years apart from intermittent mild tiredness and arthralgia. Secondary Sjögren syndrome (SS) was also diagnosed.\n\nFrom the ninth year after SLE diagnosis onwards, she began to have multiple episodes of arthritis flares requiring a maintenance dose of oral steroids. At age 41, she had a first trimester miscarriage without changes in her antiphospholipid antibody profile.\n\nDuring her 16th year of disease she had a serious episode of pleurisy and myocarditis requiring hospitalisation for intravenous steroid therapy. Subsequently, she was started on rituximab. She had to be hospitalised again 1 year later due to Escherichia coli renal abscesses. Rituximab was stopped and she was switched to mycophenolate mofetil (MMF) and then to azathioprine after her recovery. She developed hypertension during the following year and was started on amlodipine and ramipril.\n\nDuring the 19th year of her disease, age 47, she began to experience increasing tiredness with peripheral oedema and worsening hypertension. Her urinary tests showed de novo haematuria and proteinuria with a urinary protein/creatinine ratio (UPCR) of 438 mg/mmol (NR<15). Her estimated glomerular filtration rate (eGFR) (by Modification of Diet in Renal Disease study equation) fell to 30 mL/min/1.73 m2 (previously >90 mL/min/1.73 m2) in 3 months. A kidney biopsy showed a class IV LN (WHO classification) with very active diffuse proliferative changes.\n\nHer C3 level had always been low reaching a nadir 2 years before the LN diagnosis, recovering with the introduction of azathioprine, but slowly falling (0.49 g/L) for about a year until the renal biopsy. In contrast, her anti-dsDNA antibody levels were normal until her 15th year of disease when they started to rise predating the pleurisy and myocarditis flare. They fluctuated subsequently never returning to normal. During the year before the renal biopsy they rose steeply to a maximum (3171 IU/mL (NR<50)). Both markers returned to normal after the LN treatment (figure 2).\n\nFigure 2 Anti-dsDNA antibodies and C3 level profile during SLE course of the three patients. Red markers indicate the moment of kidney biopsy.\n\nShe was treated with 2 g/day of MMF and 1 mg/kg of prednisolone followed by a decreasing dose of steroids achieving a complete remission (proteinuria ≤0.33 g/day and serum creatinine ≤1.4 mg/dL) in 6 months’ time. Hydroxychloroquine was maintained during her entire illness.\n\nThe patient experienced a LN flare a year after induction treatment (UPCR=127 mg/mmol). Increasing the dose of MMF to 2.5 g/day led to a partial remission (50% reduction in baseline proteinuria to ≤1.5 g/day and ≤25% increase in baseline creatinine) and chronic kidney disease.\n\nShe is now in her 24th year of disease, without apparent SLE activity, controlled with MMF 1.5 g/day, prednisolone 5 mg/day and hydroxychloroquine 400 mg/day.\n\nCase 2\nA 15-year-old Indian woman was diagnosed with SLE after she presented with an inflammatory polyarthritis, headaches, fatigue, malar rash and alopecia. She had a positive ANA (>1:320), anti-Ro and anti-dsDNA antibodies with normal C3 levels. She was treated with hydroxychloroquine and afterwards with azathioprine and prednisolone for a period of 2 years. Subsequently, she was maintained only on hydroxychloroquine.\n\nSeven years after diagnosis she developed a flare consisting of vasculitis of her fingers and toes, arthritis, facial rash and alopecia, dyspnoea and mouth ulcers. Steroid therapy was not effective and she was treated with one cycle of cyclophosphamide and two infusions of rituximab to achieve disease control. She had subsequent mild flares of arthritis and vasculitis well controlled with steroids despite shingles and chest infections.\n\nImmunologically, she usually had a normal anti-dsDNA antibody level, a low C3 level and mainly normal values of erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP). In the last 2 years, her anti-dsDNA antibody levels increased with worsening low C3, despite being asymptomatic.\n\nAfter 17 years of SLE, age 32, she developed proteinuria for the first time with a UPCR of 148 mg/mmol. Her inflammatory markers were low, C3 and anti-dsDNA levels stable. A urine sample was repeated to confirm the proteinuria which was negative.\n\nAbout 5 months after, she had another flare with dyspnoea, arthritis, malar rash and mouth ulcers. She was again found to have proteinuria, this time with mild hypertension and oedema. The UPCR was now 986 mg/mmol and the eGFR fell to 69 mL/min/1.73 m2. Inflammatory markers were only slightly elevated (ESR=28 mm/hour; CRP=3.6 mg/L) but there was evidence of SLE serological activity (anti-dsDNA=1847 IU/mL; C3=0.38 g/L). She underwent a kidney biopsy which confirmed the LN diagnosis consistent with WHO active class IV+V with patchy background parenchymal oedema without chronic damage. She was started on MMF 2 g/day with prednisolone 1 mg/kg (followed by a decreasing dose until reaching 20 mg/day) and hydroxychloroquine 400 mg/day. Later, two infusions of rituximab (1 g each) were given due to incomplete response. She is currently stable in complete remission. Her levels of anti-dsDNA and C3 normalised.\n\nCase 3\nA 32-year-old Asian woman was diagnosed with SLE after she developed an inflammatory polyarthritis and fatigue. Serologically, she had ANA, anti-dsDNA and anti-Ro antibodies positive with normal C3 levels but with leucopenia. She was treated with hydroxychloroquine 400 mg/day.\n\nThree years after the diagnosis, she had a flare characterised by discoid lupus on her neck and arthritis in hands and knees. It was controlled with intramuscular prednisolone. During the disease course, she had occasional arthritis flares well controlled with steroids. She also had an episode of Raynaud’s phenomena and alopecia.\n\nDuring the 12th year of disease, she had three bouts of pneumonia. During the investigation, pulmonary cysts and calcified nodules were found. No cause for them was found.\n\nImmunologically, she usually had raised anti-dsDNA antibodies and low C3 levels (figure 2) but with normal values of ESR and CRP. In the last 3 years, her anti-dsDNA antibody levels increased with an additional fall in C3 levels without clinical signs or symptoms.\n\nFinally, after 15 years of SLE, age 47, she presented with worsening arthritis that responded adequately to rapidly tapering steroids cycle. Her anti-dsDNA antibodies and C3 levels were little changed and no proteinuria was found. However, 2 months later she got a viral infection, the arthritis returned (steroids were started again) and for the first time she had proteinuria and haematuria. Her UPCR was 273 mg/mmol and the eGFR fell to 59 mL/min/1.73 m2. Inflammatory markers were elevated (ESR=20 mm/hour; CRP=24.1 mg/L), anti-dsDNA antibody level reached 2749 IU/mL and C3 was 0.58 g/L. No hypertension or oedema was present.\n\nTo confirm LN, she underwent a kidney biopsy, which was consistent with WHO active class IV without significant chronic damage. She was started on MMF 2 g/day with prednisolone 1 mg/kg (followed by a decreasing dose until reaching 20 mg/day) and hydroxychloroquine 400 mg/day for 2 months with slight response. She is about to be treated with rituximab cycle as her disease is not yet in remission.\n\nDiscussion\nDeveloping LN more than 15 years after SLE diagnosis is extremely rare and very little is known about this very delayed form of LN. Developing DLN after 34 years of SLE diagnosis is the longest interval reported, as far as we know.9 We were unable to find any other single case report or specific case series on this subject. However, we found a few cases included in reported LN cohorts investigated for other reasons with no specific analysis of these patients.5 10–14\n\nWe have described three cases of very DLN (table 1). Interestingly, all three were non-Caucasian women. One patient had been diagnosed with SLE during adolescence and the other two during adulthood, but none had late-onset SLE (after 50). The patient reported by Adelman et al9 was also a woman with adult-onset SLE but her LN became apparent only when she was 55 years old.\n\nTable 1 Clinical and laboratory profile of the three patients\n\n\tPatient A\tPatient B\tPatient C\t\nAge of SLE diagnosis\t28\t14\t32\t\nEthnicity\tAfrican\tIndian\tAsian\t\nFeatures at SLE diagnosis \n Cutaneous \n Arthritis \n Serositis \n Neurologic \n Haemolytic anaemia \n Leucopenia \n Thrombocytopenia\t+ \n+ \n+ \n− \n+ \n− \n−\t+ \n+ \n+ \n– \n– \n– \n–\t– \n+ \n– \n– \n– \n+ \n–\t\nInitial serology \n ANA \n Pattern \n Anti-dsDNA \n Anti-Ro \n C3 (g/L) \n Anticardiolipin \n IgM \n IgG \n DRVVT\t>1:320 \nDiffuse \n+ \n+ \n0.69 \n– \n– \n–\t>1:320 \nSpeckled+diffuse \n+ \n+ \n1.21 \n– \n– \n–\t>1:320 \nNucleolar+diffuse \n+ \n+ \n1.11 \n– \n– \n–\t\nProgress of SLE \n(non-renal)\tMultiple arthritis flares (2003–2010) \nFirst trimester miscarriage (2007) \nPleurisy (2009) \nMyocarditis (2009) \nRenal abscesses (2010) \nPyelonephritis (2010)\tMultiple arthritis and rash flares (2006–2017) \nVasculitis in fingers and toes (2007/2012) \nAlopecia (2007) \nDyspnoea, mouth ulcers and headaches (2008) \nShingles and chest infection (2008) \nAcute liver injury secondary to NSAIDs (costochondritis) (2016)\tMultiple arthritis flares (2005–2017) \nDiscoid lupus (2005) \nRaynaud (2008) \nPneumonia (2014) \nPulmonary cysts and calcified nodules (2015) \nRash (2017)\t\nInitial renal tests \n Serum creatinine (µmol/L) \n eGFR (mL/min/1.73 m2) \n Proteinuria \n Haematuria \n Urinary protein/creatinine ratio (mg/mmol)\t75 \n97 \n– \n– \n5 \t70 \n95 \n– \n– \n8 \t63 \n95 \n– \n– \n3 \t\nFeatures suggesting renal involvement \n Hypertension \n Proteinuria \n Haematuria \n Serum creatinine (µmol/L) \n eGFR (mL/min/1.73 m2) \n Urinary protein/creatinine ratio (mg/mmol) \n Oedemas\t+ \n+++ \n++ \n190 \n30 \n438 \n+\t+ \n++++ \n+++ \n83 \n69 \n986 \n+\t– \n+++ \n++ \n89 \n59 \n273 \n–\t\nBiopsy findings\tVery active diffuse proliferative changes\tPatchy background parenchymal oedema. No chronic damage. Mix pattern immune complex glomerulopathy. Endocapillary and extracapillary active proliferation and membranous change\tVery active diffuse proliferative changes\t\nWHO LN class\tIV\tIV+V\tIV\t\nTime of LN diagnosis in years after SLE diagnosis\t19\t17\t15\t\nTherapeutic for LN \n Prednisolone \n Cyclophosphamide \n Mycophenolate mofetil \n Rituximab\t+ \n– \n+ \n–\t+ \n– \n+ \n+\t+ \n– \n+ \n+\t\nOutcome of LN \nDuration of follow-up\tPartial remission with evolution to chronic kidney disease \n5 years\tComplete remission \n4 months\tActive \n2 months\t\nDRVVT, dilute Russell viper venom time; eGFR, estimated glomerular filtration rate; LN, lupus nephritis; NSAID, non-steroidal anti-inflammatory drug.\n\nAt SLE diagnosis, all three patients had arthritis and two had serositis and rash. Their serological profile shared a high ANA titre with diffuse pattern and anti-dsDNA and anti-Ro antibodies (the latter is known to be an independent risk factor for frequent hospitalisations15). Despite the previously reported increased risk to develop DLN in patients with SS,16 only one of our patients had this. We found a low C3 at SLE onset in just one patient. None of them had antiphospholipid syndrome, which has also been reported to be a risk factor for DLN.16\n\nAll patients had multiple SLE flares during the course of disease before LN onset. Hydroxychloroquine, known to prevent renal disease and flares in SLE,17 was prescribed for most of the disease duration in all patients although we cannot be certain about their compliance. Two of them were treated successfully with rituximab for SLE flares long before LN onset.\n\nThe three patients’ serum creatinine, eGFR and UPCR were within normal range and there was no detectable proteinuria or haematuria on dipstick from SLE diagnosis until the onset of DLN (these tests were done every time the patients were evaluated at the SLE clinic, 3–4 times a year). Proteinuria and haematuria were present at DLN presentation and two patients developed peripheral oedema and hypertension. The eGFR fell below 70 mL/min/1.73 m2 in each case. Interestingly, like the patient reported by Adelman et al,9 our patients also had a WHO class IV LN on biopsy. The biopsies of our patients did not show any chronic component associated with DLN, as opposed to the findings of increased chronicity index found by Xu et al in LLN.7 Previous data suggest that high levels of anti-dsDNA are associated with WHO class IV LN.18\n\nImportantly, the three patients had serological evidence of increasing disease activity long before LN was clinically obvious, with rising anti-dsDNA antibody levels accompanying falling C3 values. C3 <0.65 mg/dL has been suggested to be a marker of silent LN,19 and all our patients were below this threshold from 1 to 3 years before the LN became overt. We acknowledge that silent LN could have been present during this period, becoming clinically evident as the systemic disease went out of control. However, the lack of chronic damage seen in the biopsies after extensive active SLE without LN argues against this form of long-standing subclinical kidney inflammation.Low complement levels for more than 6 months seem to be an independent risk factor for the development of LN.18 This serological pattern antedated any change in urine analysis or kidney function results and may be used in similar patients to raise awareness about the possibility of LN.\n\nEach of the three patients was treated with MMF and steroids, but two needed rituximab to deal with the LN. We used rituximab as an alternative therapy like that suggested by European League Against Rheumatism recommendations for the treatment of refractory LN.20 One patient who had a renal flare after achieving complete remission was managed with MMF but evolved to chronic kidney disease with partial remission. This last patient has a follow-up after biopsy of 5 years, but the others started treatment for LN only 2 and 4 months ago (one achieved complete remission and the other still has active LN). This short follow-up limits further conclusions about outcome.\n\nThere is a lack of knowledge about DLN starting more than 15 years after SLE diagnosis. This is explained mainly by its rarity (three patients out of almost 700 in our SLE cohort over 40 years), and also by its delayed presentation confirming the importance of long follow-up of patients with SLE. With the increasing life expectancy of patients with SLE,21 it is likely that more cases of very DLN will emerge. The persistent deterioration in C3 and anti-dsDNA antibody levels seen in apparently non-renal patients with very long established disease warrants consideration of the possible onset of kidney involvement. Renal biopsy to search for silent LN or SLE therapy optimisation to prevent renal damage might be reasonable management options.\n\nThe authors thank Dr John Connolly and Dr Ruth Pepper for help in managing the patients.\n\nARA and PLC contributed equally.\n\nContributors: The patients have been under the care of DAI who suggested to ARA and PLC that it would be of interest to write them up collectively. The primary writing was undertaken by ARA with subsequent help from PLC and DAI.\n\nCompeting interests: None declared.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n\nData sharing statement: No additional data are available.\n==== Refs\nReferences\n1. Galindo-Izquierdo M , Rodriguez-Almaraz E , Pego-Reigosa JM , et al \nCharacterization of patients with lupus nephritis included in a large cohort from the spanish society of rheumatology registry of patients with systemic lupus erythematosus (RELESSER) . Medicine \n2016 ;95 :e2891 –11 . doi:10.1097/MD.000000000000289126945378 \n2. Croca SC , Rodrigues T , Isenberg DA \nAssessment of a lupus nephritis cohort over a 30-year period . Rheumatology \n2011 ;50 :1424 –30 . doi:10.1093/rheumatology/ker10121415024 \n3. Tello B , Jones A , Raine C , et al \nSystemic lupus erythematosus: Detailed anatomy of a cohort (follow-up for more than 35 years) . Arthritis Rheumatol \n2016 ;68 :2283 .27273903 \n4. Imran TF , Yick F , Verma S , et al \nLupus nephritis: an update . Clin Exp Nephrol \n2016 ;20 :1 –13 . doi:10.1007/s10157-015-1179-y26471017 \n5. Takahashi Y , Mizoue T , Suzuki A , et al \nTime of initial appearance of renal symptoms in the course of systemic lupus erythematosus as a prognostic factor for lupus nephritis . Mod Rheumatol \n2009 ;19 :293 –301 . doi:10.3109/s10165-009-0154-419277827 \n6. Anaya JM , Cañas C , Mantilla RD , et al \nLupus nephritis in Colombians: contrasts and comparisons with other populations . Clin Rev Allergy Immunol \n2011 ;40 :199 –207 . doi:10.1007/s12016-010-8249-421287296 \n7. Xu YX , Tan Y , Yu F , et al \nLate onset lupus nephritis in Chinese patients: classified by the 2003 international society of nephrology and renal pathology society system . Lupus \n2011 ;20 :801 –8 . doi:10.1177/096120331039756321543512 \n8. Petri M \nReview of classification criteria for systemic lupus erythematosus . Rheum Dis Clin North Am \n2005 ;31 :245 –54 . doi:10.1016/j.rdc.2005.01.00915922144 \n9. Adelman DC , Wallace DJ , Klinenberg JR \nThirty-four-year delayed-onset lupus nephritis: a case report . Arthritis Rheum \n1987 ;30 :479 –80 . doi:10.1002/art.17803004233580016 \n10. Hui M , Garner R , Rees F , et al \nLupus nephritis: a 15-year multi-centre experience in the UK . Lupus \n2013 ;22 :328 –32 . doi:10.1177/096120331247408423386411 \n11. Seligman VA , Lum RF , Olson JL , et al \nDemographic differences in the development of lupus nephritis: a retrospective analysis . Am J Med \n2002 ;112 :726 –9 . doi:10.1016/S0002-9343(02)01118-X12079714 \n12. Cortés-Hernández J , Ordi-Ros J , Labrador M , et al \nAntihistone and anti-double-stranded deoxyribonucleic acid antibodies are associated with renal disease in systemic lupus erythematosus . Am J Med \n2004 ;116 :165 –73 . doi:10.1016/j.amjmed.2003.08.03414749160 \n13. Kon T , Yamaji K , Sugimoto K , et al \nInvestigation of pathological and clinical features of lupus nephritis in 73 autopsied cases with systemic lupus erythematosus . Mod Rheumatol \n2010 ;20 :168 –77 . doi:10.3109/s10165-009-0260-320039187 \n14. Wallace DJ , Podell TE , Weiner JM , et al \nLupus nephritis. Experience with 230 patients in a private practice from 1950 to 1980 . Am J Med \n1982 ;72 :209 –20 .7058833 \n15. Lee JW , Park DJ , Kang JH , et al \nThe rate of and risk factors for frequent hospitalization in systemic lupus erythematosus: results from the Korean lupus network registry . Lupus \n2016 ;25 :1412 –9 . doi:10.1177/096120331664091627000153 \n16. Varela DC , Quintana G , Somers EC , et al \nDelayed lupus nephritis . Ann Rheum Dis \n2008 ;67 :1044 –6 . doi:10.1136/ard.2008.08874018413438 \n17. Ruiz-Irastorza G , Ramos-Casals M , Brito-Zeron P , et al \nClinical efficacy and side effects of antimalarials in systemic lupus erythematosus: a systematic review . Ann Rheum Dis \n2010 ;69 :20 –8 . doi:10.1136/ard.2008.10176619103632 \n18. Burling F , Ng J , Thein H , et al \nEthnic, clinical and immunological factors in systemic lupus erythematosus and the development of lupus nephritis: results from a multi-ethnic New Zealand cohort . Lupus \n2007 ;16 :830 –7 . doi:10.1177/096120330708022517895308 \n19. Ishizaki J , Saito K , Nawata M , et al \nLow complements and high titre of anti-Sm antibody as predictors of histopathologically proven silent lupus nephritis without abnormal urinalysis in patients with systemic lupus erythematosus . Rheumatology \n2015 ;54 :405 –12 . doi:10.1093/rheumatology/keu34325183834 \n20. Bertsias GK , Tektonidou M , Amoura Z , et al \nJoint European League Against Rheumatism and European Renal Association-European Dialysis and Transplant Association (EULAR/ERA-EDTA) recommendations for the management of adult and paediatric lupus nephritis . Ann Rheum Dis \n2012 ;71 :1771 –82 . doi:10.1136/annrheumdis-2012-20194022851469 \n21. Cervera R , Khamashta MA , Hughes GR \nThe Euro-lupus project: epidemiology of systemic lupus erythematosus in Europe . Lupus \n2009 ;18 :869 –74 . doi:10.1177/096120330910683119671784\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2053-8790",
"issue": "5(1)",
"journal": "Lupus science & medicine",
"keywords": "lupus nephritis; renal disease; systemic lupus erythematosus",
"medline_ta": "Lupus Sci Med",
"mesh_terms": null,
"nlm_unique_id": "101633705",
"other_id": null,
"pages": "e000241",
"pmc": null,
"pmid": "29387436",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "18413438;19277827;27000153;14749160;20039187;26945378;21543512;22851469;12079714;7058833;19103632;21415024;17895308;15922144;26471017;3580016;19671784;23386411;21287296;25183834",
"title": "Very delayed lupus nephritis: a report of three cases and literature review.",
"title_normalized": "very delayed lupus nephritis a report of three cases and literature review"
} | [
{
"companynumb": "GB-BAUSCH-BL-2018-034744",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HYDROXYCHLOROQUINE SULFATE"
},
"drugadditional... |
{
"abstract": "The failure rate of both filtration surgery and of aqueous shunt implantation is higher for iridocorneal endothelial syndrome than in other scenarios, due to the continuous proliferation of abnormal endothelial cells over the trabecular meshwork and the filtration area and also due to the more pronounced cicatrizing response shown by these young patients. We present the first case ever described in the literature of a pregnant patient with iridocorneal endothelial syndrome and uncontrolled ocular hypertension who was implanted an Ex-PRESS mini-shunt.\nA 35-year-old female presented with diminution of vision in the left eye for 2 months. She was 20 weeks pregnant. Her visual acuity was 20/20 in right eye and 20/25 in left eye, and intraocular pressure was 11 mmHg in right eye and 34 mmHg in left eye. Slit lamp biomicroscopic examination revealed no alterations in right eye, whereas left eye showed corectopia and uveal ectropion, stroma of iris' sectoral atrophy and moderate corneal epithelial edema. Gonioscopy showed some anterior iris synechiae in left eye. Fundus evaluation was normal. Based on clinical features and examination, the diagnosis of left eye iridocorneal endothelial syndrome with decompensated intraocular pressure was made. She was prescribed topical timolol (0.5%) and dorzolamide. As a result of uncontrolled intraocular pressure and the impossibility to prescribe other hypotensive treatment available due to her being pregnant, it was decided to perform surgery in left eye using an Ex-PRESS mini-shunt and Ologen®; 6 months post surgery, intraocular pressure was 9 mmHg with no need for hypotensive treatment. The cornea was transparent, and the patient maintained her left eye visual acuity.\nEx-PRESS mini-shunt can be considered a surgical option for iridocorneal endothelial syndrome. Its composition allows the ostium to remain open and the device triggers a milder postoperative inflammatory response. In our particular case, taking into account that the subject was a young, phakic, pregnant woman, whose intraocular pressure had to be closely controlled and we had to ensure that her postoperative care included as few drugs and as few reoperations as possible, we thought that using this device was the most appropriate option.",
"affiliations": "Ophthalmology Department, Tajo Hospital, Aranjuez, Spain.;Ophthalmology Department, Tajo Hospital, Aranjuez, Spain.",
"authors": "Colás-Tomás|Teresa|T|;López Tizón|Elena|E|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/1120672118820508",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1120-6721",
"issue": "30(1)",
"journal": "European journal of ophthalmology",
"keywords": "Ex-PRESS mini-shunt; Iridocorneal endothelial syndrome; glaucoma surgery in pregnancy",
"medline_ta": "Eur J Ophthalmol",
"mesh_terms": "D000328:Adult; D005260:Female; D020327:Glaucoma Drainage Implants; D006068:Gonioscopy; D006801:Humans; D007429:Intraocular Pressure; D057129:Iridocorneal Endothelial Syndrome; D009798:Ocular Hypertension; D011247:Pregnancy; D019919:Prosthesis Implantation; D011681:Pupil Disorders; D014065:Tonometry, Ocular; D014792:Visual Acuity",
"nlm_unique_id": "9110772",
"other_id": null,
"pages": "NP25-NP28",
"pmc": null,
"pmid": "30618278",
"pubdate": "2020-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ex-PRESS mini-shunt implanted in a pregnant patient with iridocorneal endothelial syndrome.",
"title_normalized": "ex press mini shunt implanted in a pregnant patient with iridocorneal endothelial syndrome"
} | [
{
"companynumb": "ES-009507513-1902ESP000351",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TIMOLOL MALEATE"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nPatients with Long QT syndrome (LQTS) P may present with torsades de pointes, ventricular tachycardia (VT), or ventricular fibrillation (VF) and are at risk of sudden cardiac death.\n\n\nMETHODS\nA 38 y/o female patient with uterus myoma developed VF during laparoscopic assisted vaginal hysterectomy surgery. Defibrillation was delivered and the electrocardiogram (ECG) returned to sinus rhythm after CPR.\n\n\nRESULTS\nPatient survived and implantable cardioverter-defibrillator was implanted and received beta-blocker therapy. ECG obtained in out-patient clinic still showed QT interval prolongation, but revealed no prolongation few months after persistent beta-blocker therapy. LQTS type 8 (CACNA1C E768del mutation) was identified by genetic DNA sequencing study.\n\n\nCONCLUSIONS\nPatients with concealed LQTS may have normal QT interval unless exposing to stress or specific stimuli. Unexpected ventricular arrhythmia may happen during any medical management. We should avoid triggers of QT prolongation, and get familiar with management of the episode.",
"affiliations": "Department of Anesthesiology, Fu Jen Catholic University Hospital, No.69, Guizi Rd., Taishan Dist., New Taipei City 243, Taiwan. Electronic address: alanstxd@gmail.com.;Department of Anesthesiology, National Taiwan University Hospital Hsin-Chu Branch, No.25, Ln. 442, Sec. 1, Jingguo Rd., East Dist., Hsinchu City 300, Taiwan. Electronic address: H00203@hch.gov.tw.;Department of Anesthesiology, Chung Shan Medical University, Taichung City, Taiwan; Department of Anesthesiology, Chung Shan Medical University Hospital, Taichung City, Taiwan. Electronic address: cshy029@csh.org.tw.;Department of Anesthesiology, Chung Shan Medical University, Taichung City, Taiwan; Department of Anesthesiology, Chung Shan Medical University Hospital, Taichung City, Taiwan. Electronic address: clk0619@ntu.edu.tw.",
"authors": "Chang|Shih-Lun|SL|;Chang|Ching-Tao|CT|;Hung|Wei-Te|WT|;Chen|Li-Kuei|LK|",
"chemical_list": null,
"country": "China (Republic : 1949- )",
"delete": false,
"doi": "10.1016/j.tjog.2019.05.031",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1028-4559",
"issue": "58(4)",
"journal": "Taiwanese journal of obstetrics & gynecology",
"keywords": "Beta-blockade; Gene CACNA1C; Long QT syndrome; Ventricular fibrillation",
"medline_ta": "Taiwan J Obstet Gynecol",
"mesh_terms": "D000328:Adult; D000768:Anesthesia, General; D016887:Cardiopulmonary Resuscitation; D016757:Death, Sudden, Cardiac; D017147:Defibrillators, Implantable; D004554:Electric Countershock; D004562:Electrocardiography; D005260:Female; D006801:Humans; D007044:Hysterectomy; D010535:Laparoscopy; D007889:Leiomyoma; D008133:Long QT Syndrome; D011379:Prognosis; D018570:Risk Assessment; D012720:Severity of Illness Index; D017180:Tachycardia, Ventricular; D016896:Treatment Outcome; D014594:Uterine Neoplasms",
"nlm_unique_id": "101213819",
"other_id": null,
"pages": "552-556",
"pmc": null,
"pmid": "31307750",
"pubdate": "2019-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A case of congenital long QT syndrome, type 8, undergoing laparoscopic hysterectomy with general anesthesia.",
"title_normalized": "a case of congenital long qt syndrome type 8 undergoing laparoscopic hysterectomy with general anesthesia"
} | [
{
"companynumb": "TW-FRESENIUS KABI-FK201908481",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FENTANYL"
},
"drugadditional": null,
... |
{
"abstract": "Lymphoblastic lymphoma, seen primarily in children or young adults, is a type of non-Hodgkin lymphoma that originates from B or T lymphocyte precursors and rarely occurs in the oral cavity. A case of systemic precursor T-cell lymphoblastic lymphoma mimicking periodontitis of a lower second molar in a 20-year-old adult is currently presented. The case was initially misdiagnosed as periodontal disease and treated with tooth extraction by a dentist. Re-evaluation of the patient due to worsening of symptoms lead to cone beam computed tomography scanning that thoroughly revealed an extended osteolytic lesion of the right mandible. Afterward, a biopsy was performed, thus reaching the diagnosis of precursor T-cell lymphoblastic lymphoma. This report discusses differences in epidemiology of T-cell and B-cell lymphoblastic lymphomas, as well as their various intraoral manifestations that are mimicking a large family of oral pathology. It also focuses on conventional imaging findings that imply malignancy, which are often neglected during routine radiology interpretation.",
"affiliations": "Department of Oral and Maxillofacial Surgery, Dental School, National and Kapodistrian University of Athens, Athens, Greece.;Evangelismos General Hospital of Athens, Athens, Greece.;Evangelismos General Hospital of Athens, Athens, Greece.;Department of Oral Pathology, Dental School, National and Kapodistrian University of Athens, Athens, Greece.;Department of Oral and Maxillofacial Surgery, Evangelismos General Hospital of Athens, Athens, Greece.",
"authors": "Goutzanis|Lampros|L|https://orcid.org/0000-0002-1308-6806;Apostolidis|John|J|;Giatra|Chara|C|;Chrysomali|Evanthia|E|;Deskos|Dimitrios|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/2050313X20927961",
"fulltext": "\n==== Front\nSAGE Open Med Case Rep\nSAGE Open Med Case Rep\nSCO\nspsco\nSAGE Open Medical Case Reports\n2050-313X SAGE Publications Sage UK: London, England \n\n10.1177/2050313X20927961\n10.1177_2050313X20927961\nCase Report\nA case of systemic precursor T-cell lymphoblastic lymphoma presenting with\nsingle tooth mobility\nhttps://orcid.org/0000-0002-1308-6806Goutzanis Lampros 1 Apostolidis John 2 Giatra Chara 2 Chrysomali Evanthia 3 Deskos Dimitrios 4 1 Department of Oral and Maxillofacial Surgery,\nDental School, National and Kapodistrian University of Athens, Athens, Greece\n2 Evangelismos General Hospital of Athens,\nAthens, Greece\n3 Department of Oral Pathology, Dental School,\nNational and Kapodistrian University of Athens, Athens, Greece\n4 Department of Oral and Maxillofacial Surgery,\nEvangelismos General Hospital of Athens, Athens, Greece\nLampros Goutzanis, Department of Oral and\nMaxillofacial Surgery, Dental School, National and Kapodistrian University of Athens,\nDimitrakopoulou 54-56 & Kountouriotou, Athens 18120, Greece. Email:\nlgoutzan@yahoo.gr\n3 6 2020 \n2020 \n8 2050313X2092796130 1 2020 29 4 2020 © The Author(s) 20202020SAGE PublicationsThis article is distributed under the terms of the Creative Commons\nAttribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits\nnon-commercial use, reproduction and distribution of the work without further permission\nprovided the original work is attributed as specified on the SAGE and Open Access pages\n(https://us.sagepub.com/en-us/nam/open-access-at-sage).Lymphoblastic lymphoma, seen primarily in children or young adults, is a type of\nnon-Hodgkin lymphoma that originates from B or T lymphocyte precursors and rarely occurs\nin the oral cavity. A case of systemic precursor T-cell lymphoblastic lymphoma mimicking\nperiodontitis of a lower second molar in a 20-year-old adult is currently presented. The\ncase was initially misdiagnosed as periodontal disease and treated with tooth extraction\nby a dentist. Re-evaluation of the patient due to worsening of symptoms lead to cone beam\ncomputed tomography scanning that thoroughly revealed an extended osteolytic lesion of the\nright mandible. Afterward, a biopsy was performed, thus reaching the diagnosis of\nprecursor T-cell lymphoblastic lymphoma. This report discusses differences in epidemiology\nof T-cell and B-cell lymphoblastic lymphomas, as well as their various intraoral\nmanifestations that are mimicking a large family of oral pathology. It also focuses on\nconventional imaging findings that imply malignancy, which are often neglected during\nroutine radiology interpretation.\n\nT-cell lymphomanon-Hodgkin lymphomatooth mobilitypanoramic radiograph interpretationcover-dateJanuary-December 2020typesetterts1\n==== Body\nIntroduction\nAlthough lymphomas constitute only 3.5% of all intraoral malignancies, they still are the\nsecond most common neoplasms of head and neck, second to squamous cell carcinoma.1,2 In fact, almost half of all lymphomas occur\nin the head and neck region, involving mainly the tonsil and the parotid gland.1\n\nLymphoblastic lymphomas (LBLs) are an uncommon and aggressive type of non-Hodgkin lymphoma\n(NHL), associated with immature lymphocytes of B-cell (B-LBL) or T-cell lineage (T-LBL).3 Traditionally, the term lymphoblastic lymphoma has been used to describe\npredominantly lymph-node based disease compared to acute lymphoblastic leukemia (ALL) that\nis associated with more bone marrow involvement (at least 20% lymphoblasts in marrow).4 However, since 2008 World Health Organization (WHO) unified LBL and ALL under the\nterm precursor B-cell and T-cell lymphoblastic leukemia/lymphoma based on new immunogenetic,\nmorphological, and molecular characteristics.4,5\n\nPrecursor T-cell LBL is most common in teens or young adults compared to precursor B-cell\nLBL which is more common in children or young adults.6 In general, LBLs predominantly affect males with an overall male-to-female incidence\nratio of 2.5:1.4,6 In 50%–65% of the cases,\nT-cell LBL presents with a mediastinal mass which may cause dyspnea and chest pain.6 In comparison, 75% of precursor B-cell LBL cases develop lesions in extranodal organs\nincluding skin, breasts, liver, and bone, as well as the lymph nodes.5,6 Apart from bone marrow, LBLs have also a\npredilection for central nervous system.5 Precursor T-cell LBL has a poorer prognosis compared to precursor B-cell LBL, with an\noverall 5-year survival rate as low as 26%.6\n\nSince 1970, when the first case report on this topic was published, the most frequently\nreported lymphoma type in head and neck is diffuse large B-cell lymphoma, associated mainly\nwith older males (in their seventh decade of life).1,2,7,8 The most common site for NHL\nin the head and neck region is Waldeyer’s ring.8,9 Other sites are the orbit, nasal cavity, paranasal sinuses, oral cavity\n(palate, gingiva, and tongue), salivary glands, mandible, and thyroid.5,8,9 There have also been reports of “double-hit” NHLs that arise in more\nthan one intraoral site and are associated with poorer prognosis.10\n\nIn this article, we describe an interesting case of systemic precursor T-cell lymphoma that\nwas initially presented with single tooth mobility and a panoramic X-ray that failed to\nreveal the extent of mandibular bone destruction.\n\nCase report\nA 20-year old male presented with chief complaint of mobile right lower second molar to his\nprivate dentist. The patient had no family or medical history of hematological malignancies,\nweight loss, or malaise.\n\nUpon clinical examination, no swelling of soft tissues was noticed and no clinical signs of\nlymphadenopathy were apparent. Panoramic radiograph was taken, and the diagnosis of\nperiodontal disease was made (Figure\n1(a)). The tooth was subsequently extracted with careful curettage of the\nextraction socket, and post-extraction antibiotic treatment was prescribed.\n\nFigure 1. (a) Patient’s panoramic radiograph: this radiograph was initially considered\nnon-suggestive of bone destruction in the right mandibular body and ramus. However, a\nmore careful observation would have revealed ill-defined radiolucency of the ascending\nramus of the mandible (right side), loss of lamina dura of the second right molar (#47)\nand loss of the right mandibular canal wall, implying a possible malignancy. (b) CBCT\nrevealed an osteolytic lesion of the right mandibular retromolar area, extending to the\ninferior alveolar canal and the tooth #46.\n\nDuring re-evaluation of the case after 2 weeks, swelling of soft tissues at the extraction\nsite was apparent with unilateral cervical lymph nodes positive in palpation. The patient\nwas immediately referred to an oral and maxillofacial surgeon and underwent cone beam\ncomputed tomography (CBCT) that revealed an extensive osteolytic lesion of the right\nmandibular retromolar region (Figure\n1(b)). The right alveolar nerve was included in the lesion, although there were no\nsigns of neurological defect.\n\nSubsequently, a biopsy of the intraoral lesion was performed. Histopathological examination\nshowed a diffuse proliferation of small-to-intermediate-sized lymphoid cells that\ninfiltrated the sub-mucosal connective tissue stroma (Figure 2(a)). The tumor cells exhibited hyperchromatic\nnuclei, a high nuclear cytoplasmic ratio, and irregular nuclear contours, while mitotic\nfigures were also seen (Figure\n2(b)). The histopathological findings were consistent with the diagnosis of malignant\nlymphoid neoplasm. On immunohistochemical analysis, tumor cells expressed the LCA, CD2, CD3,\nCD4, CD8, CD43, CD99, and terminal deoxynucleotidyl transferase (TdΤ). Tumor cells were\nnegative for CD20, CD79a, CD30, CD15, CD56, ALK-1, TCL-1, CD1a, and TIA-1. The Ki67\nproliferative index was approximately 70%. Based on histopathologic findings and\nimmunohistochemical staining results, the final diagnosis of precursor T-cell lymphoblastic\nlymphoma was rendered.\n\nFigure 2. (a) Histopathological photomicrograph of the oral lesion illustrating lymphocytic\ninfiltration of the sub mucosal connective tissue. H and E stained section 250×. (b)\nHigher power showing a monotonous population of numerous atypical lymphocytes with\nhyperchromatic irregular nuclei with inconspicuous nucleoli. Isolated mitotic figures of\nthe tumor cells are also seen. H and E stained section 400×.\n\nAs a result, the patient was immediately referred to the hospital. According to the chest\nX-ray, there was large left pleural effusion, and the trachea was deviated to the normal\nhemithorax. To this end, a chest tube was placed, and 3 L of pleural fluid was drained from\nthe pleural cavity. Pleural effusion was exudative and a concentration of 5% of pathological\ncells was reported. The parameters of the full blood count were as follows: Ht = 40.9%, red\nblood cell (RBC) = 5.36 × 103/μL, white blood cell\n(WBC) = 6.37 × 103/μL (neutrophils 69%, lymphocytes 29%, monocytes 2%), platelet\n(PLT) = 307 × 103/μL, and lactate dehydrogenase (LDH) = 419 IU/L. The patient\nwas also tested HIV seronegative.\n\nAfter performing neck, chest, upper, and lower abdomen computed tomography scans, a\nmediastinal lymph node enlargement was revealed. The largest lymph node was 9 cm in\ndiameter. The mediastinal mass constituted another systemic manifestation of the disease,\napart from the osteolytic lesion in the right mandibular retromolar region.\n\nBone marrow aspirate and trephine biopsy from right posterior superior iliac spine, as well\nas flow cytometry, were negative for bone marrow infiltration (if there was infiltration of\nthe bone marrow with >20% leukemic cells, it would have been considered T-lymphoblastic\nleukemia). As such, this was characterized as a case of systemic stage IV T-cell\nlymphoblastic lymphoma (mediastinal lymph node involvement with extranodal osseous disease\nand no evidence of bone marrow infiltration).\n\nThe patient received chemotherapy treatment according to a German Multicenter ALL (GMALL)\nprotocol and he also underwent intrathecal infusion of methotrexate. During the\nchemotherapy-induced leukopenia phase, he acquired a nosocomial bacterial infection that\nprogressed to septic shock. He was intubated and died the next day.\n\nDiscussion\nOral manifestations of lymphomas account for only 3% of all lymphoma cases and 4% of\nlymphomas in patients with AIDS, mimicking a large family of oral pathology like periodontal\ndisease (tooth mobility or displacement), pericoronitis, osteomyelitis, lock jaw,\nparesthesia, swelling, facial asymmetry, and various malignancies of the oral\ncavity.7,11 Almost half (40.52%) of\nall lymphoma cases with oral manifestations are initially misdiagnosed and are treated with\ntooth extractions, or with periodontal and antibiotic treatments.7\n\nThe panoramic X-ray of the present case was initially considered non-suggestive for bone\ndestruction. However, a more careful observation would have revealed the following findings:\nill-defined radiolucency of the ascending ramus of the mandible (right side), loss of lamina\ndura of the second right molar (#47), and loss of the right mandibular canal wall. These\nfindings are all suggestive of malignancy, but they may not be perceptible to the untrained\neye. Other findings that have also been reported which may not be taken into consideration\nwhen interpreting a conventional image are widening of periodontal ligament, teeth\ndisplacement, and widening of the mandibular canal and mental foramen.9\n\nConcerning conventional imaging, a recent report on panoramic X-ray findings among four\ncases of diffuse large B-cell lymphoma (NHL) involving the mandible concluded that an\napparent radiolucent lesion was present in only 50% of the cases.9 An ill-defined bone destruction may not be a common panoramic finding for NHL\ninvolving the mandible, especially at an early stage and prior to any tooth extraction that\nmay accelerate bone destruction.9 NHL involving the mandible tends to show slight or mild cortical bone destruction\nrelative to the extent of the tumor involvement, thus making apparent radiolucency often\nimperceptible on panoramic images.9\n\nT-LBL and T-cell ALL are considered to be the same disease with different clinical presentations.4 T-LBL frequently presents with a large mediastinal mass, as in the present case.\nT-LBL is arbitrarily defined by the presence of enlarged lymph nodes and <20%\nlymphoblasts in the bone marrow, contrasting with >20% blasts in ALL.4 Our patient had no evidence of bone marrow infiltration. Treatment with conventional\nregimens for aggressive lymphomas results in short disease-free survival and is not recommended.12 Therefore, T-LBL is treated with intensified ALL-like regimens.12 In the case under discussion, the GMALL 07/2003 protocol was initiated, a protocol of\n12 month duration with alternating blocks of intensified chemotherapy, used for the\ntreatment of young patients with ALL.12 Unfortunately, patient did not survive due to complications.\n\nConclusion\nDespite the rarity of this case, two learning points can be deducted. First, tooth mobility\nin a young person, without history of juvenile periodontitis and with excellent oral\nhygiene, should raise high suspicion of an underlying systemic disease, thus avoiding dental\ntreatment in favor of obtaining a detailed medical record. Under this notion, hematological\nevaluation along with an HIV test (when indicated) seems to be a critical step in patient\nmanagement and should not be avoided. Second, imaging has a key role for patient management.\nFor example, it is obvious that an intraosseous lesion appearing with unilocular\nradiolucency with or without tooth resorption in a periapical or panoramic X-ray should\nraise high concerns for CBCT and biopsy. However, even in cases like the one presented here,\nwhere initial clinical examination and radiological findings were not considered suggestive\nof an underlying pathology, a CBCT should have been performed to definitely exclude bone\nimplication in tooth mobility. The clinician should always keep in mind that a more careful\ninterpretation of conventional imaging may reveal findings that imply malignancy which are\noften neglected during routine radiology interpretation.\n\nDeclaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the research,\nauthorship, and/or publication of this article.\n\nEthics approval: Our institution does not require ethical approval for reporting individual cases or case\nseries.\n\nFunding: The author(s) received no financial support for the research, authorship, and/or\npublication of this article.\n\nInformed consent: Written informed consent was obtained from a legally authorized representative for\nanonymized patient information to be published in this article\n\nORCID iD: Lampros Goutzanis \nhttps://orcid.org/0000-0002-1308-6806\n==== Refs\nReferences\n1. \nEpstein JB Epstein JD Le ND , et al\nCharacteristics of oral and paraoral\nmalignant lymphoma: a population-based review of 361 cases\n. Oral\nSurg Oral Med Oral Pathol Oral Radiol Endod \n2001 ; 92 (5 ):\n519 –525\n.11709688 \n2. \nKelly J Ho M Suida I. \nOral cancer: B-cell lymphoma\n. Br Dent J \n2018 ; 224 (5 ):\n285 –286\n.29521376 \n3. \nCortelazzo S Ponzoni M Ferreri AJ , et al\nLymphoblastic\nlymphoma\n. Crit Rev Oncol Hematol \n2011 ; 79 :\n330 –343\n.21273093 \n4. \nAmerican Cancer Society . Types of T-cell\nlymphoma\n, https://www.cancer.org/cancer/non-hodgkin-lymphoma/about/t-cell-lymphoma.html\n(2018 , accessed 21 January 2020 ).\n5. \nGalway N Johnston R Cairns C , et al\nPrecursor B cell lymphoblastic\nlymphoma presenting as periorbital swelling\n. BMJ Case\nRep \n2016 ; 2016 : 215679 .\n6. \nLee WJ Moon HR Won CH , et al\nPrecursor B- or T-lymphoblastic\nlymphoma presenting with cutaneous involvement: a series of 13 cases including 7 cases\nof cutaneous T-lymphoblastic lymphoma\n. J Am Acad\nDermatol \n2014 ; 70 :\n318 –325\n.24314877 \n7. \nSilva TDB Ferreira CBT Leite GB , et al\nOral manifestations of lymphoma: a\nsystematic review\n. Ecancermedicalscience \n2016 ; 10 : 665 .27594910 \n8. \nEtemad-Moghadam S Tirgary F Keshavarz S , et al\nHead and neck non-Hodgkin’s lymphoma:\na 20-year demographic study of 381 cases\n. Int J Oral Maxillofac\nSurg \n2010 ; 39 (9 ):\n869 –872\n.20538427 \n9. \nImaizumi A Kuribayashi A Watanabe H , et al\nNon-Hodgkin lymphoma involving the\nmandible: imaging findings\n. Oral Surg Oral Med Oral Pathol Oral\nRadiol \n2012 ; 113 (5 ):\ne33 –e39\n.22668637 \n10. \nFrei M Dubach P Reichart PA , et al\nDiffuse swelling of the buccal mucosa\nand palate as first and only manifestation of an extranodal non-Hodgkin “double-hit”\nlymphoma: report of a case\n. Oral Maxillofac Surg \n2012 ; 16 (1 ):\n69 –74\n.20981461 \n11. \nTriantafillidou K Dimitrakopoulos J Iordanidis F , et al\nExtranodal non-Hodgkin lymphomas of\nthe oral cavity and maxillofacial region: a clinical study of 58 cases and review of the\nliterature\n. J Oral Maxillofac Surg \n2012 ; 70 (12 ):\n2776 –2785\n.22494508 \n12. \nMarks DI Rowntree C. \nManagement of adults with T-cell lymphoblastic leukemia\n.\nBlood \n2017 ; 129 (9 ):\n1134 –1142\n.28115371\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2050-313X",
"issue": "8()",
"journal": "SAGE open medical case reports",
"keywords": "T-cell lymphoma; non-Hodgkin lymphoma; panoramic radiograph interpretation; tooth mobility",
"medline_ta": "SAGE Open Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101638686",
"other_id": null,
"pages": "2050313X20927961",
"pmc": null,
"pmid": "32547763",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "20538427;20981461;22668637;28115371;29521376;11709688;21273093;27594910;22494508;27166006;24314877",
"title": "A case of systemic precursor T-cell lymphoblastic lymphoma presenting with single tooth mobility.",
"title_normalized": "a case of systemic precursor t cell lymphoblastic lymphoma presenting with single tooth mobility"
} | [
{
"companynumb": "GR-TEVA-2020-GR-1805830",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN"
},
"drugadditional": null,
... |
{
"abstract": "Brachial neuritis has previously been described as a rare occurrence in patients receiving botulinum toxin for cervical or writing/focal arm dystonia.\nWe report four cases of patients with a long history of cervical dystonia treated with botulinum toxin injections.\nAll patients developed pain and muscular weakness around the shoulder, with EMG studies suggesting brachial neuritis.\nIn the context of these observations, we discuss the question of an association between brachial neuritis and botulinum toxin treatment.",
"affiliations": "IRCCS Istituto delle Scienze Neurologiche di Bologna Bologna BO Italy.;Department of Clinical and Movement Neurosciences UCL Queen Square Institute of Neurology London United Kingdom.;Department of Clinical and Movement Neurosciences UCL Queen Square Institute of Neurology London United Kingdom.;Department of Clinical and Movement Neurosciences UCL Queen Square Institute of Neurology London United Kingdom.;Department of Clinical and Movement Neurosciences UCL Queen Square Institute of Neurology London United Kingdom.",
"authors": "Cani|Ilaria|I|;Latorre|Anna|A|;Cordivari|Carla|C|;Balint|Bettina|B|;Bhatia|Kailash P|KP|https://orcid.org/0000-0001-8185-286X",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/mdc3.12710",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2330-1619",
"issue": "6(2)",
"journal": "Movement disorders clinical practice",
"keywords": "Parsonage‐Turner syndrome; botulinum toxin injections; brachial neuritis; neuralgic amyotrophy",
"medline_ta": "Mov Disord Clin Pract",
"mesh_terms": null,
"nlm_unique_id": "101630279",
"other_id": null,
"pages": "160-165",
"pmc": null,
"pmid": "30838316",
"pubdate": "2019-02",
"publication_types": "D002363:Case Reports",
"references": "10733998;16371410;19815448;20843162;2162501;25098693;26016482;26086358;26662794;28044362;2996415;30713909;7603232;8257306;8382272;8614534;9339718;9452341",
"title": "Brachial Neuritis After Botulinum Toxin Injections for Cervical Dystonia: A Need for a Reappraisal?",
"title_normalized": "brachial neuritis after botulinum toxin injections for cervical dystonia a need for a reappraisal"
} | [
{
"companynumb": "IT-IPSEN BIOPHARMACEUTICALS, INC.-2019-04837",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "BOTULINUM TOXIN TYPE A"
},
... |
{
"abstract": "Hemophagocytic lymphohistiocytosis (HLH) is an immune-mediated disorder resulting in hyper-activation of inflammatory cytokines. If left untreated, the uncontrolled inflammatory response can lead to significant tissue injury and potentially life-threatening multi-organ dysfunction. Conventional immunosuppressive agents are available for the management of HLH, including dexamethasone, cyclosporine, and etoposide; however, patients may not respond to these therapies. Clinicians may turn toward alternative pharmacologic agents that likely have less clinical evidence. We describe a case of secondary HLH that did not respond favorably to conventional treatments. Serum inflammatory markers continued to rise significantly with clinical deterioration and worsening pancytopenia. The severe thrombocytopenia and neutropenia were deemed to have contributed to a spontaneous subdural hematoma and candidemia, respectively. Ruxolitinib, a Janus kinase (JAK) 1/2 inhibitor, was then utilized as a novel salvage therapy based on available in vivo murine data at the time. Following initiation, there was improvement seen in several disease markers, including serum ferritin, lactate dehydrogenase, fibrinogen, and liver function tests. However, the pancytopenia did not show signs of recovery. The patient ultimately expired after 7days of ruxolitinib treatment. It is unclear if the improvement in disease markers was attributed to JAK inhibition alone. However, this experience combined with the positive in vivo murine data suggests that ruxolitinib may serve as a potential treatment option for HLH, pending the release of more robust data. To our knowledge, this is the first human case report describing the use of ruxolitinib for HLH. Future studies are warranted to determine the role of ruxolitinib in this setting.",
"affiliations": "Department of Pharmacy, Massachusetts General Hospital, Boston, MA, USA. Electronic address: JSin@mgh.harvard.edu.;Department of Pharmacy, Massachusetts General Hospital, Boston, MA, USA.",
"authors": "Sin|Jonathan H|JH|;Zangardi|Mark L|ML|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D015415:Biomarkers; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D009570:Nitriles; D047428:Protein Kinase Inhibitors; D011720:Pyrazoles; D011743:Pyrimidines; D005047:Etoposide; D003907:Dexamethasone; C540383:ruxolitinib; D053613:Janus Kinase 1; D053614:Janus Kinase 2",
"country": "England",
"delete": false,
"doi": "10.1016/j.hemonc.2017.07.002",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "12(3)",
"journal": "Hematology/oncology and stem cell therapy",
"keywords": "Cytokines; Epstein–Barr virus infections; Hemophagocytic lymphohistiocytosis; Janus kinase; Ruxolitinib; Unlabeled indication",
"medline_ta": "Hematol Oncol Stem Cell Ther",
"mesh_terms": "D000893:Anti-Inflammatory Agents; D015415:Biomarkers; D003907:Dexamethasone; D005047:Etoposide; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D053613:Janus Kinase 1; D053614:Janus Kinase 2; D051359:Lymphohistiocytosis, Hemophagocytic; D008875:Middle Aged; D009570:Nitriles; D047428:Protein Kinase Inhibitors; D011720:Pyrazoles; D011743:Pyrimidines",
"nlm_unique_id": "101468532",
"other_id": null,
"pages": "166-170",
"pmc": null,
"pmid": "28834694",
"pubdate": "2019-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ruxolitinib for secondary hemophagocytic lymphohistiocytosis: First case report.",
"title_normalized": "ruxolitinib for secondary hemophagocytic lymphohistiocytosis first case report"
} | [
{
"companynumb": "US-009507513-1709USA001877",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "Background: Delayed cerebral thrombosis has been described as a potential cause of cerebrovascular complications in patients with bacterial meningitis. We report a case of delayed cerebral thrombosis in a 63-year-old woman admitted for pneumococcal meningitis. Initially, there was a good clinical evolution under treatment with steroids and antibiotics. On day 8 after admission, she was found with a decreased level of consciousness. Her neurological condition gradually worsened. Repeated brain imaging showed extensive ischemic lesions. Despite treatment with high-dose corticosteroids, the patient died.Methods: A literature search was conducted. Data on patient characteristics, diagnosis, treatment and outcome were collected.Results: To date, 28 cases with delayed cerebral thrombosis following bacterial meningitis have been reported. Streptococcus pneumoniae was the pathogen in 89% of cases. Clinical deterioration occurred in all patients, with a duration varying from 5 to 40 days between admission and deterioration. Most common symptom was altered consciousness (83%), followed by hemiparesis (52%). Brain imaging typically shows new infarctions (96%). Fifty-six percent of patients were treated with corticosteroids after deterioration. Outcome was poor with mortality rate of 46%.Conclusion: Delayed cerebral thrombosis presents as a clinical deterioration, typically a sudden decline in consciousness, more than 5 days after meningitis onset. Brain imaging shows new widespread ischemic lesions. Diagnosis should be made carefully, based on clinical findings and brain imaging, after excluding endocarditis. The underlying etiology remains unknown. When delayed cerebral thrombosis is suspected, high-dose corticosteroids should be started empirically. The prognosis remains poor with high mortality rates.",
"affiliations": "Department of Neurology, University Hospitals Leuven, Leuven, Belgium.;Department of Neurology, University Hospitals Ghent, Ghent, Belgium.;Department of Neurology, AZ Sint Blasius Dendermonde, Dendermonde, Belgium.;Department of Neurology, AZ Sint Blasius Dendermonde, Dendermonde, Belgium.;Department of Neurology, AZ Sint Blasius Dendermonde, Dendermonde, Belgium.;Department of Neurology, University Hospitals Ghent, Ghent, Belgium.",
"authors": "Depoortere|Sofie|S|https://orcid.org/0000-0001-5509-0048;Toeback|Jonas|J|;Lunskens|Sophie|S|;Van Buggenhout|Erwig|E|;Oedit|Regilio|R|;Hemelsoet|Dimitri|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/17843286.2021.1873583",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1784-3286",
"issue": null,
"journal": "Acta clinica Belgica",
"keywords": "Bacterial meningitis; cerebrovascular complication; corticosteroids; delayed cerebral thrombosis",
"medline_ta": "Acta Clin Belg",
"mesh_terms": null,
"nlm_unique_id": "0370306",
"other_id": null,
"pages": "1-8",
"pmc": null,
"pmid": "33455561",
"pubdate": "2021-01-17",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Delayed cerebral thrombosis complicating bacterial meningitis.",
"title_normalized": "delayed cerebral thrombosis complicating bacterial meningitis"
} | [
{
"companynumb": "BE-Fresenius Kabi-FK202204325",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "3",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,... |
{
"abstract": "Brentuximab vedotin is used for relapsed classical Hodgkin's lymphoma and mature T-cell lymphomas. We present a unique case of severe hypertriglyceridemia after one dose of single-agent brentuximab therapy. A Middle-Eastern male with a history of primary progressive cutaneous gamma/delta T-cell lymphoma was started on single-agent brentuximab vedotin therapy. Two weeks after single dose brentuximab therapy, he complained of severe epigastric pain, nausea, vomiting and was admitted to the intensive care unit with acute pancreatitis. Physical examination revealed an acutely ill patient with abdominal tenderness and laboratory data showed triglyceride levels of 3175 mg/dL, glycated hemoglobin (HbA1C) 9%, lipase 145 U/L and glucose 594 mg/dL. Computed tomography scan of the abdomen and pelvis confirmed acute interstitial pancreatitis. With medical management patient triglyceride levels decreased and the patient improved. This is the first case report in literature depicting, brentuximab induced hypertriglyceridemia leading to acute pancreatitis. It is a serious complication and can be lethal. Therefore, it is critical to maintain a high index of suspicion for hypertriglyceridemia induced pancreatitis after single dose brentuximab therapy.",
"affiliations": "Internal Medicine, St. Vincent Hospital, Worcester, USA.;Internal Medicine, St. Vincent Hospital, Worcester, USA.;Internal Medicine, St. Vincent Hospital, Worcester, USA.;Internal Medicine, St. Vincent Hospital, Worcester, USA.;Hematology and Oncology, St. Vincent Hospital, Worcester, USA.",
"authors": "Maradana|Sandhya|S|;Akella|Padmastuti|P|;Nalluru|Swarna S|SS|;Jindal|Vishal|V|;Siddiqui|Ahmad D|AD|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.5138",
"fulltext": "\n==== Front\nCureusCureus2168-8184Cureus2168-8184Cureus Palo Alto (CA) 10.7759/cureus.5138Endocrinology/Diabetes/MetabolismAllergy/ImmunologyOncologyHypertriglyceridemia Induced Pancreatitis Due to Brentuximab Therapy: First Case Report Muacevic Alexander Adler John R Maradana Sandhya 1Akella Padmastuti 1Nalluru Swarna S 1Jindal Vishal 1Siddiqui Ahmad D 2\n1 \nInternal Medicine, St. Vincent Hospital, Worcester, USA \n2 \nHematology and Oncology, St. Vincent Hospital, Worcester, USA \nPadmastuti Akella padmastuti.akella@stvincenthospital.com15 7 2019 7 2019 11 7 e513826 6 2019 14 7 2019 Copyright © 2019, Maradana et al.2019Maradana et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/21275-hypertriglyceridemia-induced-pancreatitis-due-to-brentuximab-therapy-first-case-reportBrentuximab vedotin is used for relapsed classical Hodgkin’s lymphoma and mature T-cell lymphomas. We present a unique case of severe hypertriglyceridemia after one dose of single-agent brentuximab therapy. A Middle-Eastern male with a history of primary progressive cutaneous gamma/delta T-cell lymphoma was started on single-agent brentuximab vedotin therapy. Two weeks after single dose brentuximab therapy, he complained of severe epigastric pain, nausea, vomiting and was admitted to the intensive care unit with acute pancreatitis. Physical examination revealed an acutely ill patient with abdominal tenderness and laboratory data showed triglyceride levels of 3175 mg/dL, glycated hemoglobin (HbA1C) 9%, lipase 145 U/L and glucose 594 mg/dL. Computed tomography scan of the abdomen and pelvis confirmed acute interstitial pancreatitis. With medical management patient triglyceride levels decreased and the patient improved. This is the first case report in literature depicting, brentuximab induced hypertriglyceridemia leading to acute pancreatitis. It is a serious complication and can be lethal. Therefore, it is critical to maintain a high index of suspicion for hypertriglyceridemia induced pancreatitis after single dose brentuximab therapy.\n\nbrentuximabacute pancreatitishypertriglyceridemiat cell lymphomalipid disordersadverse drug reactionsThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nBrentuximab vedotin (Adcetris® Seattle Genetics Inc., Bothell, US) is an antibody-drug conjugate (ADC) comprising of a CD30-directed antibody conjugated to a microtubule-disrupting agent, monomethyl auristatin E (MMAE) via a protease cleavable linker [1,2]. Studies have shown that single-agent brentuximab vedotin (BV) treatment can induce an objective response in relapsed T-cell lymphoma with CD30 expression [3]. Effects of BV are dose-dependent and mostly include peripheral neuropathy and neutropenia [2]. Only nine cases of acute pancreatitis have been reported with this drug in literature [4,5]. No reports of brentuximab induced dyslipidemia/hypertriglyceridemia causing acute pancreatitis have been reported. We aim to establish an important adverse effect of this single-agent therapy to raise awareness regarding the clinical safety of brentuximab single-agent therapy.\n\nCase presentation\nA 38-year-old male with a history of gastroesophageal reflux disease, attention deficit disorder and depression was diagnosed with primary progressive cutaneous gamma/delta T-cell lymphoma after he underwent an excisional biopsy of a subcutaneous nodule in his abdomen. His positron emission tomography (PET) scan at the time of diagnosis showed involvement of numerous subcutaneous soft tissue densities in the neck, abdomen, bilateral upper and lower extremities. Additional lesions were also seen along the abdomen, flanks and the gluteal region. Inguinal and common femoral lymphadenopathy was also described at the time of diagnosis. He is a former smoker, denies alcohol consumption and has a family history of hypertension. His only home medications are omeprazole and methylphenidate. For the first three months after diagnosis, he received three cycles of CHOEP (cyclophosphamide, doxorubicin, vincristine, etoposide, prednisone). Due to the progression of the disease, he was treated with four cycles of gemcitabine, oxaliplatin and high-dose dexamethasone therapy for the next three months. He did not pursue follow-up for one year. He returned in one year with fevers, night sweats, marked fatigue and worsening abdominal pain from subcutaneous nodules. His re-staging PET scan showed interval increase in the number and the metabolic activity of innumerable cutaneous lesions in the chest, abdomen, pelvis and a new nodule in the submental region. Given his progression of the disease, he went on to receive six cycles of romidepsin. Being refractory to three lines of therapy thus far and continuing to express CD30+ on a portion of his tumor cells, he began single-agent brentuximab therapy in late last year, with the aim to undergo non-myeloablative allogeneic stem transplant once disease control was achieved.\n\nTwo weeks after single-agent brentuximab vedotin therapy, he complained of severe epigastric pain, nausea, vomiting and was admitted to our intensive care unit with acute pancreatitis. Physical examination revealed an acutely ill, dehydrated patient. On presentation, his body temperature was 97.5°F, heart rate was 89 beats per min, blood pressure was 140/97mmHg, and the patient was saturating at 96% on room air. Pink conjunctiva, bilateral adequate breath sounds, soft however mild right upper quadrant and left upper quadrant abdominal tenderness with normal active bowel sounds were noted. His laboratory data of peripheral blood showed a leukocyte count of 5,300/mm3, hemoglobin 13.3 g/dL and platelet count 115000/mm3. His creatinine 0.85mg/dL, total bilirubin 0.2mg/dL and ceruloplasmin levels were 20.6mg/dL. At the time of admission, triglyceride levels were 3175 mg/dL (Figure 1), glycated hemoglobin (HbA1C) 9%, lipase 145 U/L, aspartate aminotransferase 43 U/L, alanine aminotransferase 158 U/L, alkaline phosphatase 138 U/L, lactic acid 3.0 mmol/L, glucose 594 mg/dL, immunoglobulin G 602 mg/dL, immunoglobulin G1 166 mg/dL, immunoglobulin G2 202 mg/dL, immunoglobulin G3 29 mg/dL, and immunoglobulin G4 25 mg/dL. In addition, his anti-smooth muscle antibody, hepatitis C antibody and fourth-generation HIV screen were negative. Patient’s Ranson’s Criteria score on admission was one point. Computed tomography (CT) scan of the abdomen and pelvis showed acute interstitial pancreatitis and hepatic steatosis with no gallstones (Figure 2). He received aggressive fluid resuscitation, pain control with morphine, and was started on intravenous insulin. As his abdominal symptoms improved, he was started on gemfibrozil 600 milligrams twice daily along with fish oil capsule 2000 milligrams twice daily. Triglycerides down trended to 610 mg/dL within five days and lipase normalized within three days. He was resumed on his next cycle of brentuximab at the same dose but was delayed by a week due to the hospitalization. Repeat triglyceride levels after two further doses of brentuximab with the above-mentioned fibrate therapy and dietary changes showed stable triglyceride levels.\n\nFigure 1 Triglyceride trend with brentuximab\nTriglyceride trend prior to the start of brentuximab therapy, during the acute intensive care hospitalization, levels after beginning fibrate therapy and restarting single-agent brentuximab therapy.\n\nFigure 2 Abdominal computed tomographic (CT) images of acute interstitial pancreatitis\nAbdominal computed tomography without contrast showing diffuse swelling (arrows, top left) of the pancreas with fat stranding and an 8.2mm fluid collection within the pancreatic head likely pseudocyst (arrow, top right). Coronal sections (arrows, bottom right and left) consistent with acute interstitial pancreatitis but no pancreatic duct stone or ductal dilatation. Duodenal thickening is seen around the head of the pancreas (bottom right).\n\nDiscussion\nCutaneous gamma delta T-cell lymphoma is a rare form of the T-cell lymphoproliferative disease that represents <1% of primary cutaneous lymphomas and typically exhibits an aggressive phenotype. Brentuximab vedotin is an anti-CD30 monoclonal antibody, which combined with cytotoxic agent monomethyl auristatin E (MMAE) has become a standard and effective therapy for patients with relapsed or refractory CD30+ T-cell lymphomas [6]. As previously seen, abdominal pain has been reported in up to 18% of patients treated with brentuximab [5]. The ALCANZA trial (Trial of Brentuximab Vedotin (SGN-35) Versus Physician's Choice (Methotrexate or Bexarotene) in Patients With CD30-Positive Cutaneous T-Cell Lymphoma) reported a two-percent incidence of hypertriglyceridemia of any grade with brentuximab but no grade 3 or 4 events were reported [7]. It also reported that brentuximab can cause nausea (36%), fatigue (29%), vomiting (17%) and diarrhea (29%) in patients. Pancreatitis was a previously unidentified severe adverse effect in phase 3 ALCANZA trial but there have been several cases of pancreatitis reported subsequently [7]. In all the nonfatal cases, of previously reported pancreatitis with this drug, no patient had a prior exposure to alcohol, biliary pathology diagnosed during their hospital course or had a prior history of hypertriglyceridemia [5]. Our patient denied any alcohol consumption and has no previous biliary pathology of note. Furthermore, given our patient’s immunoglobulin G4 levels and the criteria for AIP (autoimmune pancreatitis), IgG4 autoimmune pancreatitis was also ruled out. Our patient presented two weeks after his first dose of brentuximab and the median time to presentation was previously reported as approximately two weeks from the first exposure to brentuximab, with all cases occurring by the third cycle of therapy [5]. Our patient went on to receive further doses of brentuximab without recurrent pancreatitis episodes or worsening in triglyceride levels.\n\nThe exact mechanisms involved in hypertriglyceridemia-induced pancreatitis have been previously postulated however still remain to be elucidated. Chylomicrons are believed to cause pancreatic inflammation when triglyceride levels are elevated as they precipitate into the circulation. This impairs capillary bed circulation, causing edema and ischemia to the pancreatic cells, disturbing the pancreatic acinar structure [8-10]. It has been posited that the low levels of CD30 expression in pancreatic cells might be a cause for acute pancreatitis after brentuximab therapy [2]. Our patient developed very severe hypertriglyceridemia after one dose of brentuximab and presented with acute pancreatitis [11,12]. Hence, it is imminent that physicians maintain a high index of suspicion for a rare however life-threatening adverse event with single dose brentuximab therapy to institute emergent and appropriate care for acute pancreatitis.\n\nConclusions\nBrentuximab vedotin is an antibody-drug conjugate recently approved for the treatment of adult patients with relapsed or refractory Hodgkin lymphoma. An extensive review of the literature does not reveal any other cases of brentuximab-induced hypertriglyceridemia. As the number of clinical studies introducing newer monoclonal antibody therapies increases, it is pertinent for hematologists to be alert about the possibility of such adverse drug reactions and institute immediate medical management.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Brentuximab vedotin for treatment of non-Hodgkin lymphomas: A systematic review Crit Rev Oncol Hematol Berger GK McBride A Lawson S 42 50 109 2017 28010897 \n2 Brentuximab vedotin (SGN-35) for relapsed CD30-positive lymphomas N Engl J Med Younes A Bartlett NL Leonard JP Kennedy DA Lynch CM Sievers EL Forero-Torres A 1812 1821 363 2010 21047225 \n3 Objective responses in relapsed T-cell lymphomas with single-agent brentuximab vedotin Blood Horwitz SM Advani RH Bartlett NL 3095 3100 123 2014 24652992 \n4 Acute pancreatitis following brentuximab vedotin therapy for refractory Hodgkin lymphoma: a case report Drugs R D Urru SA Mariotti E Carta P 9 11 14 2014 24493291 \n5 Pancreatitis in patients treated with brentuximab vedotin: a previously unrecognized serious adverse event Blood Gandhi MD Evens AM Fenske TS 2895 2897 123 2014 24786458 \n6 Brentuximab Vedotin: A Review in CD30-Positive Hodgkin Lymphoma Drugs Scott LJ 435 445 77 2017 28190142 \n7 Brentuximab vedotin or physician's choice in CD30-positive cutaneous T-cell lymphoma (ALCANZA): an international, open-label, randomised, phase 3, multicentre trial Lancet Prince HM Kim YH Horwitz SM 555 566 390 2017 28600132 \n8 Hypertriglyceridemia-induced pancreatitis: A case-based review World J Gastroenterol Gan SI Edwards AL Symonds CJ Beck PL 7197 7202 12 2006 https://www.ncbi.nlm.nih.gov/pubmed/17131487 17131487 \n9 Pathogenesis, differentiation and management of hypertriglyceridemia Adv Intern Med Havel RJ 117 154 15 1969 https://www.ncbi.nlm.nih.gov/pubmed/4908616 4908616 \n10 Acute pancreatitis with hyperlipemia: studies with an isolated perfused canine pancreas Surgery Saharia P Margolis S Zuidema GD Cameron JL 60 67 82 1977 https://www.ncbi.nlm.nih.gov/pubmed/877857 877857 \n11 WHO-EORTC classification for cutaneous lymphomas Blood Willemze R Jaffe ES Burg G 3768 3785 105 2005 15692063 \n12 Targeting Mevalonate Pathway in Cancer Treatment: Repurposing of Statins Recent Pat Anticancer Drug Discov Iannelli F Lombardi R Milone MR Pucci B De Rienzo S Budillon A Bruzzese F 184 200 13 2018 29189178\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "11(7)",
"journal": "Cureus",
"keywords": "acute pancreatitis; adverse drug reactions; brentuximab; hypertriglyceridemia; lipid disorders; t cell lymphoma",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e5138",
"pmc": null,
"pmid": "31523567",
"pubdate": "2019-07-15",
"publication_types": "D002363:Case Reports",
"references": "15692063;17131487;21047225;24493291;24652992;24786458;28010897;28190142;28600132;29189178;4908616;877857",
"title": "Hypertriglyceridemia Induced Pancreatitis Due to Brentuximab Therapy: First Case Report.",
"title_normalized": "hypertriglyceridemia induced pancreatitis due to brentuximab therapy first case report"
} | [
{
"companynumb": "US-SEATTLE GENETICS-2019SGN03392",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHYLPHENIDATE"
},
"drugadditional":... |
{
"abstract": "Lymphomatoid granulomatosis (LYG) is an extremely rare angio-centric and angio-destructive B-cell lymphoproliferative disease. Driven by Epstein-Barr virus (EBV), LYG predominantly involves the bilateral lungs. Commonly presenting as multiple nodules in the lung, pulmonary LYG can masquerade as various infectious diseases, vasculitis, lung cancer, or other metastatic neoplasm. It is difficult to be diagnosed and is always neglected by clinicians. No standardized therapeutic regimens for LYG has been established yet now. Hemophagocytic lymphohistiocytosis (HLH), a life-threatening condition caused by abnormal activation of macrophages and T-cells, is characterized by fever, hepatosplenomegaly, pancytopenia, hypercytokinemia, and the presence of hemophagocytosis within the bone marrow, liver, spleen, or other lymphatic tissue. We herein report a 55-year-old man with recurrent fever, severe jaundice, and multiple high-density opacities and nodules in both lungs, who was finally diagnosed with pulmonary LYG (Grade 3) manifested with secondary HLH. Administration of HLH-1994 protocol led to the rapid control of the symptoms caused by HLH. Rituximab-based combination therapy was useful yet LYG (Grade 3) progressed rapidly. This case demonstrates that tissue biopsy is essential for early pathological diagnosis and effective treatment of LYG.",
"affiliations": "Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.;Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.;Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.;Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.;Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, China.",
"authors": "Xu|Li|L|;Zhang|Xuan|X|;Lu|Ying-Juan|YJ|;Zheng|Yan-Hua|YH|;Gao|Guang-Xun|GX|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fonc.2020.00034",
"fulltext": "\n==== Front\nFront OncolFront OncolFront. Oncol.Frontiers in Oncology2234-943XFrontiers Media S.A. 10.3389/fonc.2020.00034OncologyCase ReportPulmonary Lymphomatoid Granulomatosis With Hemophagocytic Lymphohistiocytosis as the Initial Manifestation Xu Li Zhang Xuan Lu Ying-Juan Zheng Yan-Hua *†Gao Guang-Xun *Department of Hematology, Xijing Hospital, Fourth Military Medical University, Xi'an, ChinaEdited by: Adam Finn Binder, Thomas Jefferson University, United States\n\nReviewed by: Ranganatha R. Somasagara, North Carolina Central University, United States; Onder Alpdogan, Thomas Jefferson University, United States\n\n*Correspondence: Yan-Hua Zheng zhyanhua315@sina.comGuang-Xun Gao gaoguangxun@fmmu.edu.cnThis article was submitted to Hematologic Malignancies, a section of the journal Frontiers in Oncology\n\n†ORCID: Yan-Hua Zheng orcid.org/0000-0002-7527-8248\n\n29 1 2020 2020 10 3410 7 2019 09 1 2020 Copyright © 2020 Xu, Zhang, Lu, Zheng and Gao.2020Xu, Zhang, Lu, Zheng and GaoThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Lymphomatoid granulomatosis (LYG) is an extremely rare angio-centric and angio-destructive B-cell lymphoproliferative disease. Driven by Epstein-Barr virus (EBV), LYG predominantly involves the bilateral lungs. Commonly presenting as multiple nodules in the lung, pulmonary LYG can masquerade as various infectious diseases, vasculitis, lung cancer, or other metastatic neoplasm. It is difficult to be diagnosed and is always neglected by clinicians. No standardized therapeutic regimens for LYG has been established yet now. Hemophagocytic lymphohistiocytosis (HLH), a life-threatening condition caused by abnormal activation of macrophages and T-cells, is characterized by fever, hepatosplenomegaly, pancytopenia, hypercytokinemia, and the presence of hemophagocytosis within the bone marrow, liver, spleen, or other lymphatic tissue. We herein report a 55-year-old man with recurrent fever, severe jaundice, and multiple high-density opacities and nodules in both lungs, who was finally diagnosed with pulmonary LYG (Grade 3) manifested with secondary HLH. Administration of HLH-1994 protocol led to the rapid control of the symptoms caused by HLH. Rituximab-based combination therapy was useful yet LYG (Grade 3) progressed rapidly. This case demonstrates that tissue biopsy is essential for early pathological diagnosis and effective treatment of LYG.\n\nlymphomatiod granulomatosishemophagocytic lymphohistiocytosispathologyrare lymphomaEpstein-Barr virus\n==== Body\nIntroduction\nLymphomatoid granulomatosis (LYG), an extremely rare B-cell lymphoproliferative disease, predominantly involves the bilateral lungs but can also affect skin, central nervous system, kidney, liver, spleen, and other organs. Epstein-Barr virus (EBV) infection plays a pivotal role in the initiation and pathological progression of LYG (1). It is an angio-centric and angio-destructive disorder characterized by abundant reactive T-cells admixed with atypical EBV-infected B cells in a polymorphous inflammatory background (2).\n\nHemophagocytic lymphohistiocytosis (HLH), a life-threatening condition caused by abnormal activation of macrophages and T-cells, is characterized by fever, hepatosplenomegaly, pancytopenia, hypercytokinemia, and the presence of hemophagocytosis within the bone marrow, liver, spleen, or other lymphatic tissue (3). HLH is divided into two broad categories according to underlying etiologies: primary and secondary. Primary or familial HLH, a rare genetic disease with autosomal recessive inheritance, is caused by pathological mutations in PRF1, UNC13D, STX11, STXBP2, LYST, RAB27A, SH2D1A, BIRC4(XIAP), ITK, AP3β1, MAGT1, and CD27, thus leading to the anergy of nature killer (NK) cells or cytotoxic T-lymphocytes(CTLs) to target cells effectively (4–6). Secondary or acquired HLH may be closely correlated with and triggered by various infection, autoimmune disease and malignancies, among which lymphoma-related HLH and EBV infection-associated HLH (EBV-HLH) are the most common (7–9).\n\nDue to the rarity of LYG, it is often neglected in the differential diagnoses of pulmonary nodules or lesions. Herein, we report a rare case of pulmonary LYG initially manifested with secondary HLH.\n\nCase Presentation\nA 55-year-old man was referred to department of hematology with a 5 month history of recurrent fever, severe jaundice, and fatigue. Thoracic computed tomography (CT) scans in another hospital revealed multiple high-density opacities and nodules in both lungs. Despite the empirical use of cefoperazone and levofloxacin for a suspected pulmonary infection, no significant improvements were achieved both clinically and radiologically. A repeat thoracic CT scan showed exacerbated lung opacities and nodules in both lungs without any cavitations, suggesting the high clinical suspicion for pulmonary tuberculosis. However, antituberculosis medication did not mitigate his symptoms and then discontinued due to the lack of evidence supporting tuberculosis. He denied history of chronic obstructive pulmonary disease, autoimmune disease, hepatitis, and AIDS.\n\nOn physical examination, the patient had severe anemic appearance with noticeable jaundice and sporadic petechia and ecchymosis. His temperature was 38.9°C with no enlarged superficial lymph nodes in the cervical, axillary, or inguinal regions. Both the liver and spleen were unpalpable. The rest of the physical examination, including respiratory system, was unremarkable.\n\nThe patient's laboratory results indicated bicytopenia (leukocytes 6.93 × 109/L, hemoglobin 53 g/L, and platelets 13 × 109/L) and markedly increased levels of serum ferritin (5,350 μg/L) and β2-microglobulin (13.1 mg/L). Other laboratory tests revealed triglycerides (TG) of 7.95 mmol/L (normal range: 0.56–1.70 mmol/L), fibrinogen 1.13 g/L, lactate dehydrogenase (LDH) 475 U/L, total bilirubin 118 μmol/L (normal range: 3.4–20.5 μmol/L), direct bilirubin 89.4 μmol/L (normal range: 0.0–6.8 μmol/L), albumin 22.8 g/L, alanine aminotransferase (ALT) 120 U/L, aspartate transaminase (AST) 176 U/L, procalcitonin (PCT) 3.48 ng/ml, serum creatinine (Scr) 149 μmol/L (normal range: 57–97 μmol/L). Blood cultures (for aerobic bacteria, anaerobic bacteria and fungi), T-spot test (1–3)-Beta-D-Glucan assay (G test), and galactomannan assay (GM test), and cytomegalovirus (CMV) DNA serological tests were all negative. Serological tests for EBV-related antibody showed that EBV-capsid antigen-IgG (EBV-CA-IgG) and EBV nuclear antigen (EBNA)-antibody were positive, while the copy level of EBV-DNA was normal. The absolute count of CD4+T cell was 0.31 × 109/L and the ratio of CD4+T cell to CD8+T cell was 0.76. Autoantibody profile indicated no abnormity. Chest CT scans demonstrated scattered patch-like opacities with a little bilateral pleural effusion and multiple enlarged mediastinal lymph nodes. On transabdominal ultrasound, he had moderate splenomegaly with the spleen 16 cm in length and 5.7 cm in thickness.\n\n18F-fluorodeoxyglucose (FDG) positron emission tomography (PET) demonstrated irregularly-shaped hypermetabolic nodular lesions in the anterior segment of superior lobe of right lung with a maximum standard uptake value (SUV) of 5.8 g/ml, suggesting highly clinical suspicions for lung cancer. On FDG-PET CT scan, multiple hypermetabolic nodular lesions with a maximum SUV of 4.7 g/ml were also observed in the anterior segment of superior lobe of right lung, middle lobe of right lung, apico-posterior segment of superior lobe of left lung, bilateral pleura, and the liver (Figure 1). Intense FDG uptake was shown in the lymph nodes of posterior region of left sternocleidomastoid muscle, right internal mammary region, hilums of both lungs and mediastinum. Multiple bone lesions with hypermetabolic FDG uptake (maximum SUV of 5.6 g/ml) were observed in skull, maxillae, bilateral humerus, bilateral clavicle, bilateral scapula, sternum, some vertebrae, some ribs, bilateral femurs, and the pelvis. In a nutshell, the results of PET-CT examination raised highly clinical suspicion for malignant tumor with multiple metastatic sites.\n\nFigure 1 Multiple hypermetabolic nodular lesions in the anterior segment of superior lobe of right lung, middle lobe of right lung, apico-posterior segment of superior lobe of left lung, bilateral pleura, liver, multiple bone lesions in skull, maxillae, bilateral humerus, bilateral clavicle, bilateral scapula, sternum, some vertebrae, some ribs, bilateral femurs, and the pelvis on FDG-PET CT scan.\n\nBone marrow aspirate smears showed that frequently-observed reticulocytes and macrophages were engulfing and phagocytizing nucleated red blood cells and platelets. Bone marrow biopsy revealed an obvious proliferation of lymphoid histiocytes. Only 42.84% TET2 mutations were detected through next generation sequence of bone marrow aspirate, while other gene aberrance associated with hematological malignancies were not detected. Flow cytometry analysis indicated that cells positively expressed CD10, CD20, CD3, CD7, and CD56, dimly expressed CD38 and CD4, and were negative for TCRαβ, TCRγδ, CD33, CD13, lambda, and kappa. Flow cytometry also revealed abnormal lymphocyte subpopulations on which B-lymphocyte antigens were predominantly expressed. The decreased number of CD4+T and the increased number of CD8+T indicated the immunosuppressive state.\n\nBased upon the patient's clinical presentation and laboratory tests, the diagnosis of secondary HLH was made after fulfilling six out of eight diagnostic criteria for HLH-2004 (10), including fever, splenomegaly, bilineage cytopenia, elevated triglyceride (>3 mmol/L), and/or hypofibrinogenemia (<1.5 g/L), elevated serum ferritin (≥500 μg/L), and the presence of phagocytic macrophages and erythrophagocytosis (multiple red blood cells inside the phagocytic macrophage) within the bone marrow. Other supportive evidence for diagnosis of HLH consisted of elevated transaminases, bilirubin, and LDH. But decreased or absent NK cells activity (defective function of NK cells) and soluble interleukin-2 receptor (sCD 25, sIL-2R) levels could not be determined in our hospital. Besides, no HLH-related genetic mutations were detected in this patient.\n\nThe patient was started on empirical prescription of meropenem for the treatment of pulmonary infection. After combinative treatment with etoposide and oral dexamethasone (HLH-1994 protocol) (11), the fever soon subsided, jaundice receded, and then the blood cell count, raised triglycerides, liver function, renal function, and coagulation dysfunction gradually recovered to normal levels. However, serum ferritin and β2-microglobulin remained still elevated far above the normal levels. After 1 month of HLH treatment, a repeat PET-CT examination demonstrated that the previous multiple hypermetabolic lesions dramatically shrank with decreased SUV.\n\nConsidering the suspicion for malignant tumor with multiple metastatic sites indicated by PET-CT scan, fiberoptic bronchoscopic lung biopsy was performed to differentiate the diagnosis of tuberculosis, infection, or cancer. Histopathologic examination of lung biopsy specimen demonstrated proliferation of fibrous tissue and infiltration of chronic inflammatory cells interspersed with atypical large B-lymphocytes. Immunohistochemistry results showed that the large atypical lymphocytes stained strongly positive for CD20, LCA, Ki67, Pax-5, latent membrane protein 1 (LMP1), while completely negative for AE1/AE3, ALK1, CD3, CK7, P40, P63, TTF, CD15, CD4, CD8, EBNA2. In situ hybridization for EBV encoded small RNA (EBER) was strongly positive in numerous large atypical lymphocytes (>50/high power field) (Figure 2). Ultrasound-guided percutaneous needle aspiration and biopsy of liver showed active liver damage and extramedullary hematopoiesis without evidence of malignancy. Bone marrow biopsy revealed EBER negativity and there was no involvement of cancer cells in the bone marrow. Based on the above histopathologic characteristics, we reached the final diagnosis of pulmonary LYG (Grade 3) with secondary HLH.\n\nFigure 2 Histopathologic examination and Immunohistochemical staining results of lung biopsy specimen(×400). (A) Hematoxylin-eosin (HE) staining, (B) AE1/AE3(–), (C) ALK1(–), (D) CD3(–), (E) CK7(–), (F) P40(–), (G) P63(–), (H) TTF(–), (I) CD4(–), (J) CD8(–), (K) CD30(–), (L) CD20(+), (M) Pax-5(+), (N) Ki67(+), (O) LCA(+), (P) EBER(ISH:EBER-positive cells > 50/HPF), (Q) LMP1(+), (R) EBNA2(–).\n\nThe patient was administered with three cycles of R-CDOPE regimen (rituximab in combination with cyclophosphamide, liposomal doxorubicin, vincristine, predisone, and etoposide) and his body temperature eventually decreased to the normal level. After one cycle of R2 regimen (rituximab in combination with lenalidomide) was initiated, clinical symptoms lessened and a follow-up chest CT scans revealed noticeable amelioration of multiple nodular opacities in the lung. And then oral lenalidomide was prescribed as the maintenance therapy. The disease remained stable for 3 months with gradual resolution of lung nodules on chest imaging. However, the patient developed pancytopenia and unfortunately died of disease progression 16 months later after initial presentation.\n\nDiscussion\nPrimary HLH, secondary HLH induced by infection and autoimmune disease develop predominantly in children and adolescents. While, secondary HLH triggered by malignancy, especially lymphoma, most occurs in adults and the elderly. The prognosis of primary HLH is much worse than secondary HLH (12, 13). Both primary and secondary HLH are characterized by severe cytokine release storm and excessive inflammation (4). The mechanisms of HLH can be summarized as follows. NK cells function by releasing the granules which contain perforin and granzymes. Perforin adheres to the membrane of target cell and drills pores through which granzyme floods into the cell and facilitates the degradation of proteins, thus resulting in the cell apoptosis and suspension of inflammatory cascade (14). Therefore, the granules and perforin released by NK cells play a pivotal role in mediating cytotoxicity and maintaining the homoeostasis of antigen presentation (14, 15). Diminished or absent activity of NK cells and CTLs leads to a decrease in granule release, thus triggering the uncontrolled stimulation of macrophages, sustained inflammatory response and cytokine storm. The hypersecretion of proinflammatory cytokines exacerbate the tissue damage and organ failure (16, 17).\n\nTherapeutic strategies of HLH involve short-term regimen which is oriented to instant control of excessive inflammatory response and long-term regimen which aims at coping with the underlying etiologies while giving the supportive treatment (18, 19). HLH-94 protocol consisted of etoposide and dexamethasone (EP reginmen) for eight cycles of induction therapy followed by allogeneic hematopoietic stem cell transplantation (Allo-HSCT) (11). Etoposide, a topoisomerase II inhibitor, constitutes the mainstay of HLH treatment by inducing apoptosis of activated immune cells, inducing errors in DNA replication and retarding the biosynthesis of EBV nuclear antigen (20, 21). HLH-2004 treatment protocol was a revised version of HLH-94, adding cyclosporine A (CsA) to the EP regimen with the aim of inhibiting hypercytokinemia and undue activation of immune cells (10). However, there exists no evidence to confirm that patients would gain more benefits after initiation of HLH-2004 protocol. Therefore, HLH-2004 protocol is not highly recommended during induction therapy especially when the underlying causes are unknown or the possibility of malignancy-triggered HLH cannot be excluded. That is to say, HLH-94 remains still a reliable and preferred regimen for induction therapy (22).\n\nDespite the advancements with wide application of HLH-94 protocol, ~30% of HLH patients show no response and the disease becomes refractory. Wang et al. initiated a prospective clinical trial which was aimed to explore the efficacy of DEP regimen (liposomal doxorubicin in combination with etoposide and methylprednisolone) as a salvage therapy in adult patients with refractory HLH. The DEP regimen yielded an encouraging overall response rate of 76.2% and was well-tolerated. Their study also indicated that DEP regimen could not only lead to prolongation of patient survival but also bridge the gap from induction therapy to treatment of underlying etiologies (23).\n\nAllogenic hematopoietic stem cell transplantation (allo-HSCT) currently represents the only final solution for both primary HLH and refractory secondary HLH. Despite being recommended in the HLH-94 and HLH-2004 protocol, myeloablative conditioning (MAC) regimens which consisted of etoposide, busulfan, and cyclophosphamide had a close correlation with high transplantation-related mortality and morbidity. Although reduced-intensity conditioning (RIC) regimen was reported of increased survival rate and decreased toxicity compared to MAC, the high incidence of mixed chimerism was inevitable (24). Recently, some studies had suggested that RIC might be more reasonable than MAC for HLH patients (22). Autologous HSCT (auto-HSCT) was regarded more applicable to lymphoma-induced HLH (9). Ironically, transplantation-induced HLH or post-HSCT HLH is a specific entity of secondary HLH and infections, especially EBV or cytomegalovirus infections, are the potential trigger of post-HSCT HLH, the risk of which could be reduced by etoposide-based conditioning regimen (25).\n\nOn chest CT, pulmonary LYG generally presents with multiple nodules with irregular, but well-defined margins, which can masquerade as pulmonary infections (especially tuberculosis and pneumonia), interstitial lung disease, vasculitides (Wegener's granulomatosis), sarcoidosis, lung cancer, or metastatic malignancies (26, 27). Nodules or masses with lymphatic distribution represent the lymphoproliferative nature of pulmonary LYG. The nodules distributed along the bronchovascular bundles or interlobular septa are correlated with angioninvasiveness which can be manifested in central low attenuation, ground-glass halo, and peripheral enhancement of the nodules (28).\n\nOwing to the fact that bronchoscopic or percutaneous needle biopsy may sometimes be positive in a small proportion of the patients, tissue specimen obtained by open lung biopsy or video-assisted thoracoscopic surgery (VATS) is required for the definitive diagnosis and differential diagnosis. Polymorphic lymphocytic infiltrate, vasculitis, and granulomatosis with central necrosis are the definitive criteria for pathological diagnosis of LYG, which can be subcategorized into three grades according to the number of EBV-positive large B-cell counted per high-power field (HPF). EBV-positive B cells are infrequently identified in grade 1 LYG, with <5 EBV-positive B cells per HPF while grade 2 reveals 5–20 cells per HPF. Grade 3 shows abundant EBV-positive B cells by in situ hybridization of EBER, numbering more than 50 cells per HPF (26). Therefore, the final diagnosis of this patient corresponded to pulmonary LYG, grade 3.\n\nBoth primary and secondary Immunocompromised individuals with chronic or latent EBV infection are predisposed to develop LYG or other lymphoproliferative diseases probably because defects in cellular immunity can severely retard EBV eradication and cannot inhibit the proliferation of EBV-infected B-cells (29, 30). It has been reported that patients with EBV infection are likely to have abnormal T lymphocyte subpopulation, indicating the state of immune-disregulation. LYG may occur accompanied by various kinds of autoimmune diseases, such as Sjogren syndrome and rheumatoid arthritis (31, 32).\n\nNeither standard regimen nor consensus for LYG treatment has been established up till now. Based upon the number of EBV-infected B cells by ISH, therapeutic strategies have varied from “watch and wait” or steroids alone to intense immunochemotherapy. Grade 1 and 2 LYG may be treated with steroids alone, interferon-α2b and rituximab (33, 34). Grade 3 LYG, characterized by rapid progression, bears a striking resemblance to diffuse large B cell lymphoma (DLBCL) both clinically and pathologically. To some extent, grade 3 LYG is considered a rare subtype of DLBCL and should be treated in the same manner with aggressive chemotherapy (26). Considering the histological diagnosis of this patient, treatment was initiated with rituximab-based combination therapy. It was reported that a patient with refractory pulmonary LYG was successfully treated by auto-HSCT (35). Despite various therapeutic approaches, LYG has a bleak prognosis with a median survival of <2 years and 5-year mortality of 60–90% (1).\n\nConclusion\nThis case demonstrates that LYG in the lung can mimic many common pulmonary lesions including tuberculosis both clinically and radiographically, which poses a great challenge for clinicians. When a patient does not respond well to empirical therapy, we should come up with this rare lymphoma and high priority should be given to pathological diagnosis through tissue biopsy. The patients with LYG can present HLH as an initial manifestation. Especially, LYG patients who have fever, hepatosplenomegaly, pancytopenia, abnormal liver function should be evaluated for HLH. Early diagnosis and effective treatment according to precise stratification may extend the patient's survival.\n\nData Availability Statement\nThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.\n\nEthics Statement\nThe studies involving human participants were reviewed and approved by the Ethics Committee of Xijing Hospital affiliated to Fourth Military Medical University. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.\n\nAuthor Contributions\nY-HZ and LX gathered the clinical information and drafted the manuscript. G-XG and Y-HZ approved the final diagnosis and formulated the therapeutic strategies. G-XG and XZ acquired and interpreted the radiographic results. Y-JL and XZ performed the tissue biopsy and described the pathological findings. All authors critically revised and gave the final approval of the manuscript.\n\nConflict of Interest\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nFunding. This study was funded by the Innovative Chain (Group) in Key Industry of Shaan'xi Province of China (grant number: 2019ZDLSF02-02).\n==== Refs\nReferences\n1. Katzenstein AL Doxtader E Narendra S . Lymphomatoid granulomatosis: insights gained over 4 decades . Am J Surg Pathol. (2010 ) 34 :e35 –48 . 10.1097/PAS.0b013e3181fd8781 21107080 \n2. Jaffe ES Wilson WH . Lymphomatoid granulomatosis: pathogenesis, pathology and clinical implications . Cancer Surv. (1997 ) 30 :233 –48 .9547995 \n3. Ramos-Casals M Brito-Zeron P Lopez-Guillermo A Khamashta MA Bosch X . Adult haemophagocytic syndrome . Lancet. (2014 ) 383 :1503 –16 . 10.1016/S0140-6736(13)61048-X 24290661 \n4. Brisse E Wouters CH Matthys P . Advances in the pathogenesis of primary and secondary haemophagocytic lymphohistiocytosis: differences and similarities . Br J Haematol. (2016 ) 174 :203 –17 . 10.1111/bjh.14147 27264204 \n5. Sepulveda FE Debeurme F Menasche G Kurowska M Cote M Pachlopnik Schmid J . Distinct severity of HLH in both human and murine mutants with complete loss of cytotoxic effector PRF1, RAB27A, and STX11 . Blood. (2013 ) 121 :595 –603 . 10.1182/blood-2012-07-440339 23160464 \n6. Zhang K Chandrakasan S Chapman H Valencia CA Husami A Kissell D . Synergistic defects of different molecules in the cytotoxic pathway lead to clinical familial hemophagocytic lymphohistiocytosis . Blood. (2014 ) 124 :1331 –4 . 10.1182/blood-2014-05-573105 24916509 \n7. Rouphael NG Talati NJ Vaughan C Cunningham K Moreira R Gould C . Infections associated with haemophagocytic syndrome . Lancet Infect Dis. (2007 ) 7 :814 –22 . 10.1016/S1473-3099(07)70290-6 18045564 \n8. Lehmberg K Sprekels B Nichols KE Woessmann W Muller I Suttorp M . Malignancy-associated haemophagocytic lymphohistiocytosis in children and adolescents . Br J Haematol. (2015 ) 170 :539 –49 . 10.1111/bjh.13462 25940575 \n9. Lehmberg K Nichols KE Henter JI Girschikofsky M Greenwood T Jordan M . Consensus recommendations for the diagnosis and management of hemophagocytic lymphohistiocytosis associated with malignancies . Haematologica. (2015 ) 100 :997 –1004 . 10.3324/haematol.2015.123562 26314082 \n10. Henter JI Horne A Arico M Egeler RM Filipovich AH Imashuku S . HLH-2004: diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis . Pediatr Blood Cancer. (2007 ) 48 :124 –31 . 10.1002/pbc.21039 16937360 \n11. Henter JI Arico M Egeler RM Elinder G Favara BE Filipovich AH . HLH-94: a treatment protocol for hemophagocytic lymphohistiocytosis. HLH study Group of the Histiocyte Society . Med Pediatr Oncol. (1997 ) 28 :342 –7 . 10.1002/(SICI)1096-911X(199705)28:5<342::AID-MPO3>3.0.CO;2-H 9121398 \n12. Ishii E Ohga S Imashuku S Yasukawa M Tsuda H Miura I . Nationwide survey of hemophagocytic lymphohistiocytosis in Japan . Int J Hematol. (2007 ) 86 :58 –65 . 10.1532/IJH97.07012 17675268 \n13. Cetica V Sieni E Pende D Danesino C De Fusco C Locatelli F . Genetic predisposition to hemophagocytic lymphohistiocytosis: report on 500 patients from the Italian registry . J Allergy Clin Immunol. (2016 ) 137 :188 –96 .e4. 10.1016/j.jaci.2015.06.048 26342526 \n14. Chen M Felix K Wang J . Critical role for perforin and Fas-dependent killing of dendritic cells in the control of inflammation . Blood. (2012 ) 119 :127 –36 . 10.1182/blood-2011-06-363994 22042696 \n15. Lykens JE Terrell CE Zoller EE Risma K Jordan MB . Perforin is a critical physiologic regulator of T-cell activation . Blood. (2011 ) 118 :618 –26 . 10.1182/blood-2010-12-324533 21606480 \n16. Usmani GN Woda BA Newburger PE . Advances in understanding the pathogenesis of HLH . Br J Haematol. (2013 ) 161 :609 –22 . 10.1111/bjh.12293 23577835 \n17. Milner JD Orekov T Ward JM Cheng L Torres-Velez F Junttila I . Sustained IL-4 exposure leads to a novel pathway for hemophagocytosis, inflammation, and tissue macrophage accumulation . Blood. (2010 ) 116 :2476 –83 . 10.1182/blood-2009-11-255174 20570861 \n18. La Rosee P Horne A Hines M von Bahr Greenwood T Machowicz R Berliner N . Recommendations for the management of hemophagocytic lymphohistiocytosis in adults . Blood. (2019 ) 133 :2465 –77 . 10.1182/blood.2018894618 30992265 \n19. Brisse E Matthys P Wouters CH . Understanding the spectrum of haemophagocytic lymphohistiocytosis: update on diagnostic challenges and therapeutic options . Br J Haematol. (2016 ) 174 :175 –87 . 10.1111/bjh.14144 27292929 \n20. Ehl S Astigarraga I von Bahr Greenwood T Hines M Horne A Ishii E . Recommendations for the use of etoposide-based therapy and bone marrow transplantation for the treatment of HLH: Consensus Statements by the HLH Steering Committee of the Histiocyte Society . J Allergy Clin Immunol Pract. (2018 ) 6 :1508 –17 . 10.1016/j.jaip.2018.05.031 30201097 \n21. Johnson TS Terrell CE Millen SH Katz JD Hildeman DA Jordan MB . Etoposide selectively ablates activated T cells to control the immunoregulatory disorder hemophagocytic lymphohistiocytosis . J Immunol. (2014 ) 192 :84 –91 . 10.4049/jimmunol.1302282 24259502 \n22. Wang Y Wang Z . Treatment of hemophagocytic lymphohistiocytosis . Curr Opin Hematol. (2017 ) 24 :54 –8 . 10.1097/MOH.0000000000000302 27755125 \n23. Wang Y Huang W Hu L Cen X Li L Wang J . Multicenter study of combination DEP regimen as a salvage therapy for adult refractory hemophagocytic lymphohistiocytosis . Blood. (2015 ) 126 :2186 –92 . 10.1182/blood-2015-05-644914 26289641 \n24. Janka GE Lehmberg K \nHemophagocytic syndromes–an update . Blood Rev. (2014 ) 28 :135 –42 . 10.1016/j.blre.2014.03.002 24792320 \n25. Kobayashi R Tanaka J Hashino S Ota S Torimoto Y Kakinoki Y . Etoposide-containing conditioning regimen reduces the occurrence of hemophagocytic lymphohistiocytosis after SCT . Bone Marrow Transplant. (2014 ) 49 :254 –7 . 10.1038/bmt.2013.145 24037021 \n26. Roschewski M Wilson WH . Lymphomatoid granulomatosis . Cancer J. (2012 ) 18 :469 –74 . 10.1097/PPO.0b013e31826c5e19 23006954 \n27. Ammannagari N Srivali N Price C Ungprasert P Leonardo J . Lymphomatoid granulomatosis masquerading as pneumonia . Ann Hematol. (2013 ) 92 :981 –3 . 10.1007/s00277-012-1643-7 23224246 \n28. Chung JH Wu CC Gilman MD Palmer EL Hasserjian RP Shepard JA . Lymphomatoid granulomatosis: CT and FDG-PET findings . Korean J Radiol. (2011 ) 12 :671 –8 . 10.3348/kjr.2011.12.6.671 22043148 \n29. Dunleavy K Roschewski M Wilson WH . Lymphomatoid granulomatosis and other Epstein-Barr virus associated lymphoproliferative processes . Curr Hematol Malig Rep. (2012 ) 7 :208 –15 . 10.1007/s11899-012-0132-3 22814713 \n30. Parvaneh N Filipovich AH Borkhardt A . Primary immunodeficiencies predisposed to Epstein-Barr virus-driven haematological diseases . Br J Haematol. (2013 ) 162 :573 –86 . 10.1111/bjh.12422 23758097 \n31. Sordillo PP Epremian B Koziner B Lacher M Lieberman P . Lymphomatoid granulomatosis: an analysis of clinical and immunologic characteristics . Cancer. (1982 ) 49 :2070 –6 . 10.1002/1097-0142(19820515)49:10<2070::aid-cncr2820491019>3.0.co;2-s 6978760 \n32. Latour S Winter S . Inherited immunodeficiencies with high predisposition to Epstein-Barr Virus-driven lymphoproliferative diseases . Front Immunol. (2018 ) 9 :1103 . 10.3389/fimmu.2018.01103 29942301 \n33. Jordan K Grothey A Grothe W Kegel T Wolf HH Schmoll HJ . Successful treatment of mediastinal lymphomatoid granulomatosis with rituximab monotherapy . Eur J Haematol. (2005 ) 74 :263 –6 . 10.1111/j.1600-0609.2004.00367.x 15693798 \n34. Wilson WH Kingma DW Raffeld M Wittes RE Jaffe ES . Association of lymphomatoid granulomatosis with Epstein-Barr viral infection of B lymphocytes and response to interferon-alpha 2b . Blood. (1996 ) 87 :4531 –7 . 10.1182/blood.V87.11.4531.bloodjournal87114531 8639820 \n35. Lemieux J Bernier V Martel N Delage R . Autologous hematopoietic stem cell transplantation for refractory lymphomatoid granulomatosis . Hematology. (2002 ) 7 :355 –8 . 10.1080/1024533021000053407 12475740\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2234-943X",
"issue": "10()",
"journal": "Frontiers in oncology",
"keywords": "Epstein-Barr virus; hemophagocytic lymphohistiocytosis; lymphomatiod granulomatosis; pathology; rare lymphoma",
"medline_ta": "Front Oncol",
"mesh_terms": null,
"nlm_unique_id": "101568867",
"other_id": null,
"pages": "34",
"pmc": null,
"pmid": "32064234",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "23224246;18045564;6978760;16937360;21107080;24290661;22814713;23006954;9547995;30992265;23577835;21606480;29942301;20570861;24037021;24792320;17675268;27292929;30201097;23758097;22042696;8639820;27755125;22043148;26314082;12475740;23160464;26342526;24259502;26289641;9121398;15693798;27264204;25940575;24916509",
"title": "Pulmonary Lymphomatoid Granulomatosis With Hemophagocytic Lymphohistiocytosis as the Initial Manifestation.",
"title_normalized": "pulmonary lymphomatoid granulomatosis with hemophagocytic lymphohistiocytosis as the initial manifestation"
} | [
{
"companynumb": "CN-PFIZER INC-2020181581",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CEFOPERAZONE SODIUM"
},
"drugadditional": null... |
{
"abstract": "BACKGROUND\nThe role of thalidomide in induction and long-term maintenance therapy in patients with multiple myeloma not eligible for stem cell transplantation remains unclear. The aim of the present study was to evaluate the effect of low-dose thalidomide as induction therapy and as maintenance therapy for 24 months in patients with a complete remission after the induction chemotherapy and to monitor the survival and relapse rates.\n\n\nMETHODS\nBetween October 2005 and September 2013, 50 patients with multiple myeloma received six courses of Cyclophosphamide-Vincristine Adriamycin and Dexamethazone (c-VAD) and pamidronate, and thalidomide 100 mg daily during induction, then thalidomide 100 mg daily for 24 months as maintenance. The effects of thalidomide were assessed objectively and subjectively. Whenever necessary, electromyography and nerve capacity volume were performed monthly for 6 months, then once every 3 months until the end of treatment.\n\n\nRESULTS\nPrimary response was 96% (CR or very good PR in 48/50 patients). Fifteen out of the remaining 48 patients relapsed during the follow-up period. Nine out of the 15 patients who relapsed showed very good partial response to treatment and four patients showed partial response. Survival rate was 81% in these patients. The primary outcome measures showed a mean and median progression-free survival of 33 and 27 months, respectively, and a mean and median overall survival of 43 and 39 months, respectively.\n\n\nCONCLUSIONS\nLow-dose thalidomide during induction therapy combined with conventional chemotherapy and a 2-year maintenance may be effective in preventing the relapse and improving the overall survival.",
"affiliations": "Internal Medicine Department, Talaghani Hospital, Kermanshah University of Medical Science, Kermanshah, Iran.;Department of Biostatistics, Social Development and Health Promotion Research Center, Public Health College, Kermanshah University of Medical Sciences, Kermanshah, Iran.;Internal Medicine Department, Talaghani Hospital, Kermanshah University of Medical Science, Kermanshah, Iran.;Internal Medicine Department, Talaghani Hospital, Kermanshah University of Medical Science, Kermanshah, Iran.",
"authors": "Aznab|Mozaffar|M|;Rezaei|Mansour|M|;Navabi|Jafar|J|;Moieni|Ali|A|",
"chemical_list": "D007166:Immunosuppressive Agents; D013792:Thalidomide",
"country": "Australia",
"delete": false,
"doi": "10.1111/ajco.12418",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1743-7555",
"issue": "13(2)",
"journal": "Asia-Pacific journal of clinical oncology",
"keywords": "C-VAD; induction; maintenance; multiple myeloma; thalidomide",
"medline_ta": "Asia Pac J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D060828:Induction Chemotherapy; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D015996:Survival Rate; D013792:Thalidomide; D016896:Treatment Outcome",
"nlm_unique_id": "101241430",
"other_id": null,
"pages": "e138-e143",
"pmc": null,
"pmid": "26531225",
"pubdate": "2017-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Evaluation of low-dose thalidomide as induction and maintenance therapy in patients with multiple myeloma not eligible for stem cell transplantation.",
"title_normalized": "evaluation of low dose thalidomide as induction and maintenance therapy in patients with multiple myeloma not eligible for stem cell transplantation"
} | [
{
"companynumb": "IR-CELGENE-IRN-2015114742",
"fulfillexpeditecriteria": "1",
"occurcountry": "IR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "THALIDOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "Tacrolimus-induced immune thrombocytopenia (ITP) is a rare entity that can occur years after initiation of tacrolimus therapy following solid organ transplantation, and platelet recovery can be substantially delayed following discontinuation of tacrolimus. Romiplostim, a thrombopoietin receptor agonist approved by the FDA in 2018 for the treatment of chronic ITP in children, may be a useful therapy to hasten platelet recovery in the acute ITP setting in place of immunomodulating agents. We present a case of tacrolimus-induced ITP successfully treated with romiplostim in a child following cardiac transplantation.",
"affiliations": "Department of Pediatrics.;Department of Pediatrics.;Department of Pathology, Immunology, and Laboratory Medicine, University of Florida College of Medicine, Gainesville, FL.;Department of Pediatrics.",
"authors": "Gipson|Daniel R|DR|;Larkin|Trisha|T|;Seifert|Robert|R|;Black|L Vandy|LV|",
"chemical_list": "D007166:Immunosuppressive Agents; D011961:Receptors, Fc; D011993:Recombinant Fusion Proteins; D013926:Thrombopoietin; C488777:romiplostim; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1097/MPH.0000000000001994",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1077-4114",
"issue": "43(6)",
"journal": "Journal of pediatric hematology/oncology",
"keywords": null,
"medline_ta": "J Pediatr Hematol Oncol",
"mesh_terms": "D002648:Child; D016027:Heart Transplantation; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D016553:Purpura, Thrombocytopenic, Idiopathic; D011961:Receptors, Fc; D011993:Recombinant Fusion Proteins; D016559:Tacrolimus; D013926:Thrombopoietin",
"nlm_unique_id": "9505928",
"other_id": null,
"pages": "e777-e779",
"pmc": null,
"pmid": "33181586",
"pubdate": "2021-08-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Romiplostim as a Therapeutic Intervention for Tacrolimus-induced Immune Thrombocytopenia in a Pediatric Cardiac Transplant Patient.",
"title_normalized": "romiplostim as a therapeutic intervention for tacrolimus induced immune thrombocytopenia in a pediatric cardiac transplant patient"
} | [
{
"companynumb": "US-GLENMARK PHARMACEUTICALS-2020GMK050725",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditiona... |
{
"abstract": "Tacrolimus, also known as FK-506, is a potent immunosuppressant agent with a host of drug-drug and food-drug interactions. We present the first case of a probable food-drug interaction between the herb turmeric and tacrolimus leading to acute calcineurin inhibitor nephrotoxicity. A 56-year-old man with a history of orthotopic liver transplantation presented to the emergency department from the clinic with worsening edema in the setting of an elevated creatinine level of 4.2 mg/dL. Before the current presentation, the patient had been recently discharged on a previously tolerated low-dose regimen of tacrolimus with a whole-blood tacrolimus level within the desired range. Tacrolimus level on the day of re-hospitalization was elevated to 29.9 ng/mL in the absence of any changes to the patient's medication regimen. On further prompting, the patient identified recent high-dose intake of turmeric with his food. Tacrolimus was held from the patient's medication regimen, and he was discharged on hospital day 4 with objective evidence of improving renal function. Our report builds on the previous studies that described the effects of turmeric or its active ingredient on the pharmacokinetics of tacrolimus. The appropriate reconciliation of herbal agents such as turmeric can be worthwhile in patients with unexplained changes in tacrolimus levels.",
"affiliations": "Department of Medicine, University of California, Los Angeles, California. Electronic address: Anayeri@mednet.ucla.edu.;Department of Medicine, University of California, Los Angeles, California.;Department of Medicine, University of California, Los Angeles, California.;Department of Medicine, University of California, Los Angeles, California.;Department of Medicine, University of California, Los Angeles, California.;Department of Medicine, University of California, Los Angeles, California.;Department of Medicine, University of California, Los Angeles, California.",
"authors": "Nayeri|A|A|;Wu|S|S|;Adams|E|E|;Tanner|C|C|;Meshman|J|J|;Saini|I|I|;Reid|W|W|",
"chemical_list": "D065095:Calcineurin Inhibitors; D003404:Creatinine; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2016.11.029",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "49(1)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000208:Acute Disease; D065095:Calcineurin Inhibitors; D003404:Creatinine; D030024:Curcuma; D004487:Edema; D018565:Food-Drug Interactions; D006801:Humans; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D016559:Tacrolimus",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "198-200",
"pmc": null,
"pmid": "28104136",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acute Calcineurin Inhibitor Nephrotoxicity Secondary to Turmeric Intake: A Case Report.",
"title_normalized": "acute calcineurin inhibitor nephrotoxicity secondary to turmeric intake a case report"
} | [
{
"companynumb": "US-PFIZER INC-2017038607",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nXEN® gel stent (Allergan, Dublin/Republic of Ireland) is a relatively new microinvasive glaucoma device providing an ab-interno approach to the subconjunctival space for aqueous drainage and reduction of intraocular pressure. It is thought to be less invasive, reduce surgical time and post-operative infection rates compared with traditional glaucoma procedures. Little information however, has been published regarding complications and subsequent management.\n\n\nMETHODS\nThe authors highlight five complicated cases of XEN® stent insertion, how they were managed and key learning points. Cases include: entire stent found at the bottom of the anterior chamber several months after uncomplicated insertion, stent broke into multiple pieces during manipulation within subconjunctiva, XEN45 stent migrated into the anterior chamber 7 months post-operatively and a case of limbal-based conjunctival dissection during open revision which lead to additional scarring around the stent and subsequent raised intraocular pressure.\n\n\nCONCLUSIONS\nWe present some new and interesting complications of XEN implant as well as potential management options. This can assist clinical decision-making and enable better pre-operative discussions with patients regarding risks of surgery.",
"affiliations": "Stanley Eye Unit, Abergele Hospital, Llanfair Road Abergel Conwy, Abergele, Wales, LL22 8DP.;Stanley Eye Unit, Abergele Hospital, Llanfair Road Abergel Conwy, Abergele, Wales, LL22 8DP. div_mat29@yahoo.co.uk.",
"authors": "Gupta|Chandni|C|;Mathews|Divya|D|http://orcid.org/0000-0003-0036-8860",
"chemical_list": "D000477:Alkylating Agents; D016685:Mitomycin",
"country": "England",
"delete": false,
"doi": "10.1186/s12886-019-1267-y",
"fulltext": "\n==== Front\nBMC OphthalmolBMC OphthalmolBMC Ophthalmology1471-2415BioMed Central London 126710.1186/s12886-019-1267-yCase ReportXEN® stent complications: a case series Gupta Chandni gupta@doctors.org.uk http://orcid.org/0000-0003-0036-8860Mathews Divya div_mat29@yahoo.co.uk Stanley Eye Unit, Abergele Hospital, Llanfair Road Abergel Conwy, Abergele, Wales LL22 8DP 12 12 2019 12 12 2019 2019 19 25311 7 2019 4 12 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nXEN® gel stent (Allergan, Dublin/Republic of Ireland) is a relatively new microinvasive glaucoma device providing an ab-interno approach to the subconjunctival space for aqueous drainage and reduction of intraocular pressure. It is thought to be less invasive, reduce surgical time and post-operative infection rates compared with traditional glaucoma procedures. Little information however, has been published regarding complications and subsequent management.\n\nCase presentation\nThe authors highlight five complicated cases of XEN® stent insertion, how they were managed and key learning points. Cases include: entire stent found at the bottom of the anterior chamber several months after uncomplicated insertion, stent broke into multiple pieces during manipulation within subconjunctiva, XEN45 stent migrated into the anterior chamber 7 months post-operatively and a case of limbal-based conjunctival dissection during open revision which lead to additional scarring around the stent and subsequent raised intraocular pressure.\n\nConclusions\nWe present some new and interesting complications of XEN implant as well as potential management options. This can assist clinical decision-making and enable better pre-operative discussions with patients regarding risks of surgery.\n\nKeywords\nXENGlaucomaMIGShttp://dx.doi.org/10.13039/100013483Betsi Cadwaladr University Health BoardTC00521957issue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nThe XEN45® (XEN) stent is a 6 mm long implant made from porcine gelatine, manufactured by Allergan (Dublin/Republic of Ireland). It is classed under the umbrella term Minimally Invasive Glaucoma Surgery (MIGS) as it is thought to be less invasive, reduce surgical time and post-operative infection rates compared with traditional glaucoma procedures [1–3]. The stent is designed to drain aqueous fluid from the anterior chamber to the subconjunctival space, thereby reducing intraocular pressure (IOP) [4]. It is injected via an ab-interno approach; and although the conjunctival surface does not require dissection with the added advantage of reduced likelihood of infection, the procedure benefits from the use of Mitomycin C (MMC) to prevent scarring.\n\nClinical experience with XEN stents is still within its infancy and therefore also is the knowledge of its subsequent safety and efficacy profile [5, 6]. In our unit we have carried out over 50 XEN stent insertions. In this article we highlight some of the interesting complications encountered, and subsequent post-operative measures taken.\n\nXEN implantation procedure\nIn our unit, XEN stent insertion is carried out under subtenons anaesthetic block with 3-5mls of 2% Lidocaine and Hyaluronidase. Following adequate anaesthesia 0.01% in 0.1 ml of MMC is injected posteriorly within the subconjunctival space and massaged forwards, towards the desired area for implantation (usually superonasal quadrant). The conjunctiva is then marked 3 mm from the limbus superonasally; where the tip of the stent is expected to exit from the scleral tunnel created. An inferotemporal clear corneal incision is made and Healon GV® (Abbott Medical Optics Inc., California/United States) is injected to fill the anterior chamber (AC). Additionally a paracentesis wound is created three clock hours away from the main incision. This site is used to manipulate the eye into the correct position via a second instrument. A pre-loaded 27 gauge needle is used to insert the XEN implant ab-interno, via the inferotemporal clear corneal incision, and advanced to the superonasal part of the AC under gonioscopic view. The stent is delivered anteriorly to the trabecular meshwork and into the subconjunctival space. The viscoelastic is then aspirated from the AC and the patient is given stat 0.1mls intracemeral Cefuroxime (3 mg in 0.3mls) and 1 ml subconjunctival Dexamethasone (3.3 mg in 1 ml). All patients in this unit routinely receive Gutte Prednisolone acetate 1% four times/day and Gutte Chloramphenicol 0.5% four times/day post-operatively for 4 weeks.\n\nIdeally the 6 mm stent should have 3 mm within the subconjunctival space, 2 mm within the scleral tunnel and 1 mm in the AC. If combined with cataract surgery, XEN stent insertion is performed after completion of cataract surgery and constriction of the pupil with Miochol®-E (Bausch & Lomb Inc., New York/United States) [2].\n\nCase presentation\nCase 1\nA 60 year old gentleman with advanced primary open-angle glaucoma (POAG) underwent uncomplicated right eye XEN stent insertion with MMC. His pre-operative vision was 0.24 LogMAR, and IOP 13 mmHg on three IOP-lowering eye drops. Two weeks following surgery the IOP had risen to 38 mmHg and tenons tissue was noted to be blocking the subconjuctival stent tip. Needling with 5FU was performed in clinic. Although the IOP reduced to 32 mmHg this was inadequate, hence the patient underwent further open revision with 5FU in theatre through a 3–4 mm incision a week later. A limbal-based conjunctival approach was used to dissect the stent from the tenons; as it was deeply embedded, and was successful.\n\nOne day post-operatively the IOP had reduced to 10 mmHg, with a well formed anterior chamber. The bleb however, was noted to be shallow. The patient continued with his routine post-operative drops and was seen again a week later when it was noticed that the subconjunctival end of the stent was exposed through a gape in the conjunctiva from the revision site (Fig. 1). The patient was again taken to theatre where the conjunctiva was closed with 8/0 vicryl. Despite this, the overlying conjunctiva continued to breakdown and re-expose the stent. As a final measure, the tip of the exposed stent was purposefully broken in clinic so that the remainder could slide under the conjunctiva and enable healing. Since this manoeuvre, the conjunctiva has healed well and the stent is no longer exposed. The patient continues to be monitored however, is now also on two pressure-reducing drops to the affected eye and maintaining an IOP of 17 mmHg.\nFig. 1 Distal end of XEN stent exposed in right eye\n\n\n\nLearning Point: Consider a fornix-based conjunctival dissection, rather than a limbal, as this reduces the risk of scarring directly around the stent. In addition, do not consider repeating the use of anti-metabolites so soon after initial stent insertion as this can impair necessary tissue healing after the procedure.\n\nCase 2\nA 64 year old gentleman with poor baseline vision (RE: count fingers, LE: 1.34 LogMAR); due to advanced glaucoma as well as longstanding chorioretinal scarring, had combined phacoemulsification and XEN stent with MMC to the left eye. His pre-operative intraocular pressure was 13 mmHg on four IOP-lowering medications.\n\nDuring the surgery the initial stent could not be seen within the subconjunctival space or the AC. It was thought that perhaps the entirety of the stent had entered the supraciliary space or had become intrascleral therefore a second stent was inserted. One day post-operatively the vision improved (1.06 LogMAR) and the IOP remained well controlled at 13 mmHg, without any glaucoma medications. When seen again 5 weeks post-operatively his vision had reverted back to that of pre-surgery and his IOP had risen to 23 mmHg. Querying whether he was a steroid responder, Gutte Prednisolone acetate 1% was stopped. Three weeks later the pressure had lowered back to 12 mmHg, and the stent was noted to be insitu.\n\nRoughly 7 months later when seen at routine follow-up, slit lamp biomicroscopy revealed the initial ‘lost’ stent had migrated back into the anterior chamber (Figs. 2 and 3). At this stage the vision was stable and there were no concerns with regards to IOP. The patient was listed for removal of stent due to risk of corneal decompensation secondary to the stent coming into contact with the corneal endothelium. The second stent has remained insitu with no adverse effects.\nFig. 2 XEN stent migrating into the anterior chamber of the right eye\n\n\nFig. 3 Gonioscopic examination showing migrated XEN stent\n\n\n\nLearning Point: XEN stents can migrate from their initial insertion point therefore it is important to perform gonioscopic examination on a regular basis at follow-up appointments. Additionally, if the displaced stent is likely to come into contact with the cornea, consider removal.\n\nCase 3\nA 77 year old male with primary open angle glaucoma had left eye combined cataract and XEN stent surgery with MMC. Listing best corrected visual acuity was 0.32LogMAR, and the IOP 12 mmHg on two pressure-reducing eye drops. Intra-operatively the stent had to be re-sited due to suboptimal positioning during initial placement. This was followed by moderate haemorrhage into the anterior chamber and subconjunctival space, which later lead to post-operative scarring around the implant. Multiple needling attempts with 5FU were carried out in clinic but failed. This was due to recurrent tenons tissue encapsulating the stent, leading to blockage.\n\nAlmost 6 months after the initial procedure the IOP had risen to 18 mmHg. It was noted that the bleb was flat and the stent not visible, so the patient was listed for bleb revision. During surgery, whilst dissecting the tenons tissue from the stent, the implant broke and therefore a new XEN stent was inserted.\n\nLearning Point: In cases where bleeding into the AC and/or subconjunctival space has occurred, one must be mindful of the potential of early scarring. It may be more appropriate in these circumstances to perform needling with 5FU in theatre as these cases will have more tenons tissue encapsulating the stent. When severe encapsulation is encountered, one must bear in mind the possibility of needing to insert a new stent if the original breaks during manipulation. It might be advisable to obtain consent and council patients for this complication prior to surgery.\n\nCase 4\nA 79 year old gentleman had routine left eye combined cataract and XEN stent insertion with MMC. His pre-operative visual acuity was 0.24LogMAR and IOP 20 mmHg on 3 pressure-reducing medications. His post-operative intraocular pressures were maintained between 13 and 14 mmHg until roughly 11 months when topical medications had to be reinstated. Despite this however, his IOP gradually continued to rise. It was queried whether his implant was working therefore an attempt was made to straighten the stent and free some tenons tissue from the tip during a clinic visit. This resulted in a 3 mmHg drop in intraocular pressure. His IOP continued to be stable and implant well positioned at subsequent visit 6 weeks later.\n\nWhen seen during a follow-up visit 3 months later the entire XEN stent was found lying at the bottom of the anterior chamber (Fig. 4). A good bleb was seen superonasally, indicating that the channel from the AC to the subconjunctival space had been maintained. As the implant is inert and not likely to come into contact with the cornea it was deemed safe to leave the implant in the angle.\nFig. 4 Gonioscopic view showing the entirety of the XEN stent lying at the bottom of the anterior chamber\n\n\n\nThe patient later explained that due to his hayfever, he had been rubbing his eyes quite vigorously for the last few weeks.\n\nLearning Point: Patients must be counselled against ‘strenuous rubbing’ of eyes as this can displace the implant; even several months following insertion.\n\nIf the entire XEN stent dislocates there is a possibility that the channel between the AC and subconjunctiva will be maintained and therefore, continued control of IOP may be achieved as in this case.\n\nCase 5\nAn 82 year old gentleman had combined right eye cataract surgery with XEN stent insertion and MMC for advanced primary open angle glaucoma. His pre-operative visual acuity was − 0.08 LogMAR and IOP 20 mmHg on 4 pressure-reducing eye drops. He had already had left eye combined cataract surgery with viscocanalostomy in the left eye, and was not using any topical medication.\n\nAt the time of stent insertion it was queried whether the subconjunctival end of the stent was too short however, due to a good bleb being achieved on the table; indicating good drainage, it was decided not to reposition the stent. One day post-operatively it was noted that the tip was tenting beneath the bleb therefore the stent was pulled from the subconjunctival end in clinic. Several attempts were made to position the implant correctly and achieve a 3 mm length subconjunctivally. However during manipulation, it was noted that the implant had fragmented into multiple pieces within the subconjunctiva space. The patient was listed for further XEN stent and MMC, which was inserted adjacent to the initial implant, with no complications (Fig. 5). The fragmented pieces were not removed.\nFig. 5 XEN stent fragments within subconjunctival space; sitting adjacent to newly inserted stent\n\n\n\nAlmost 2 years since the second stent surgery the patient remains on no glaucoma medications and has maintained his vision at − 0.06 LogMAR and IOP at 12 mmHg.\n\nLearning Point: If during the procedure there is any doubt regarding positioning of the XEN, it is best to re-position at the same sitting. The stent is very fragile therefore manipulation can result in breakage. This should be bourne in mind during the procedure.\n\nDiscussion and conclusion\nWhilst intraoperative complications and the subtleties regarding stent insertion are becoming better understood, information on the long term performance and behaviour of these stents is still lacking. Although several papers discuss the complication statistics associated with XEN stent insertion, few discuss the subsequent real-world surgical practicalities regarding their management [2, 5, 7]. This small case series aims to highlight some interesting complications, as well as possible management options. We discuss some of the learning points below.\n\nMMC is used routinely as part of the XEN stent insertion procedure however should be used cautiously; even where there is initial scarring. It must be noted that there are currently no randomised-control trials assessing the long term efficacy or safety profile when MMC is used as opposed to when it is not during XEN stent insertion, although it has been stated for other ophthalmic procedures [6]. There is also no study looking into whether this procedure results in the presence of MMC in the anterior chamber and the effect of this. The above may be something to consider given that the amount and concentration of MMC used during XEN stent implantation differs slightly among ophthalmic units [4, 5, 7].\n\nHaemorrhage into the AC or subconjunctival space can also lead to unwanted scarring and tenons encapsulation of the stent. Our authors would recommend performing needling only if the stent can be visualised beneath the conjunctiva. If this is not possible then we would consider other options such as bleb revision. The aim of needling is to free the stent from the tenons tissue so that it is mobile, with a surrounding low and diffuse bleb [8].\n\nEnsure patients with allergic eye disease are treated appropriately prior to surgery to ensure minimal rubbing of eyes and thus prevent stent migration and subsequent sequelae. Although we are not sure whether rubbing of the eye was the primary trigger factor for this complication it is likely to have contributed to stent migration. A similar case was reported by Denervis et al. who suggested a change in XEN stent design to prevent dislocation; such as progressively increasing the lumen width [9].\n\nShould there be any concern with regards to the positioning of the stent intra-operatively it is suggested to re-position, or insert a new stent, at the same sitting. XEN stents are delicate and manipulations can lead to breakage. To prevent re-listing the patient back and therefore utilising valuable theatre time we would suggest managing the situation immediately. A recent case report by Lapira et al. discussed extrusion and breakage of XEN stent, culminating in endophthalmitis [10].\n\nIn our unit we have carried out over 50 XEN stent implantations and have progressively changed our insertion technique and post-operative management based upon our experiences. The above learning points are to be used to complement formal XEN stent training, and help in counselling patients fully with regards to operative complications.\n\nAbbreviations\n5FUFluorouracil\n\nACAnterior Chamber\n\nBCVABest Corrected Visual Acuity\n\nIOPIntraocular Pressure\n\nMIGSMinimally Invasive Glaucoma Surgery\n\nMMCMitomycin C\n\nPOAGPrimary Open-Angle Glaucoma\n\nXENXEN45® (Allergan, Dublin/Republic of Ireland)\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nCG: Was involved in the preparation and writing of the paper.\n\nDM: Critically reviewed the paper. Both authors read and approved the final manuscript.\n\nFunding\nNo external funding was provided.\n\nAvailability of data and materials\nNot applicable.\n\nEthics approval and consent to participate\nNot applicable.\n\nConsent for publication\nInformed written consent for the publication of this case series and any additional related information was taken from the patients involved in the study.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Gazzard G. Minimally invasive Glaucoma surgery: MIGS [Royal College of ophthalmologists focus articles website]. Spring. 2016; Available at: https://www.rcophth.ac.uk/wp-content/uploads/2016/05/CN-Focus-Spring-2016.pdf. Accessed 26 June 2018.\n2. Pérez-Torregrosa VT Olate-Pérez Á Cerdà-Ibáñez M Combined phacoemulsification and XEN45 surgery from a temporal approach and 2 incisions Arch Soc Esp Oftalmol 2016 91 9 415 421 10.1016/j.oftal.2016.02.006 26995503 \n3. Lewis RA Ab interno approach to the subconjunctival space using a collagen glaucoma stent J cataract Refrat Surg 2014 40 1301 1306 10.1016/j.jcrs.2014.01.032 \n4. Hillman L. MIGS roundup XEN gel stent: when to use and how to implant [ASCRS EyeWorld website]. 2017. Available at: https://www.eyeworld.org/xen-gel-stent-when-use-and-how-implant. Accessed 26 June 2018.\n5. Galal A Bilgic A Eltanamly R XEN Glaucoma Implant with Mitomycin C 1-Year Follow-Up: Result and Complications J Ophthalmol 2017 5457246 5 \n6. Wilkins M Indar A Wormald R Intra-operative Mitomycin C for glaucoma surgery Cochrane Database Syst Rev 2005 4 CD002897 \n7. Tan SZ Walkden A Au L One-year result of XEN45 implant for glaucoma: efficacy, safety, and postoperative management Eye (Lond) 2018 32 2 324 332 10.1038/eye.2017.162 28862254 \n8. Vera V Sheybani A Lindfield D Stalmans I Ahmed IIK Recommendations for the management of elevated intraocular pressure due to bleb fibrosis after XEN gel stent implantation Clin Ophthalmol 2019 13 685 694 10.2147/OPTH.S195457 31114145 \n9. Dervenis N Mikropoulou AM Dervenis P Lewis A Dislocation of a previously successful XEN glaucoma implant into the anterior chamber: a case report BMC Ophthalmol 2017 17 148 10.1186/s12886-017-0540-1 28830369 \n10. Lapira M Cronbach N Shaikh A Extrusion and breakage of XEN gel stent resulting in Endophthalmitis J Glaucoma 2018 27 10 934 935 30113510\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2415",
"issue": "19(1)",
"journal": "BMC ophthalmology",
"keywords": "Glaucoma; MIGS; XEN",
"medline_ta": "BMC Ophthalmol",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000477:Alkylating Agents; D000869:Anterior Eye Segment; D001082:Aqueous Humor; D020327:Glaucoma Drainage Implants; D005902:Glaucoma, Open-Angle; D006801:Humans; D007429:Intraocular Pressure; D008297:Male; D008875:Middle Aged; D016685:Mitomycin; D013508:Ophthalmologic Surgical Procedures; D019919:Prosthesis Implantation; D015607:Stents; D014065:Tonometry, Ocular",
"nlm_unique_id": "100967802",
"other_id": null,
"pages": "253",
"pmc": null,
"pmid": "31830935",
"pubdate": "2019-12-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "28862254;30113510;26995503;31114145;28830369;24943904;16235305;28348884",
"title": "XEN® stent complications: a case series.",
"title_normalized": "xen stent complications a case series"
} | [
{
"companynumb": "GB-BAUSCH-BL-2020-012865",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CEFUROXIME"
},
"drugadditional": null,
... |
{
"abstract": "Catatonia is a neuropsychiatric syndrome characterized by diverse psychomotor abnormalities, including motor dysregulation and behavioral and affective disturbances. Once thought to occur primarily in the context of schizophrenia, recent data suggest most cases of catatonia develop in individuals with depressive or bipolar disorders. Moreover, catatonia may ensue in general medical and neurological conditions, as well as due to a variety of pharmaceuticals, drugs of abuse, and toxic agents. At one time considered rare in pediatric patients, evidence now suggests catatonia is both underrecognized and undertreated in this population, where it carries an elevated risk of morbidity and mortality. Here we present the case of a child with steroid-resistant nephrotic syndrome who developed catatonia due to cyclosporine A-related neurotoxicity.\n\n\n\nA 9-year-old African-American boy with no psychiatric history and a 9-month history of nephrotic syndrome due to focal segmental glomerulosclerosis was admitted to the local children's hospital for management of mutism, posturing, insomnia, gait abnormalities, and somatic delusions. Seven days prior to admission, his cyclosporine plasma concentration was elevated at 1224 ng/mL (therapeutic range: 100-200 ng/mL). Upon admission, cyclosporine was discontinued and psychiatry was consulted, diagnosing catatonia. The patient subsequently received propofol 80 mg IV resulting in a transient lysis of catatonia. Over a lengthy hospitalization, the patient's catatonia was initially treated with lorazepam, quetiapine being added later to target psychosis. All signs and symptoms of catatonia resolved, and the patient was eventually tapered off both lorazepam and quetiapine with no return of symptoms more than 6 months later.\n\n\n\nTo our knowledge, this case represents the first reported instance of cyclosporine A-induced catatonia in a patient with steroid-resistant nephrotic syndrome. It illustrates the importance of maintaining vigilance for signs and symptoms of cyclosporine A-related neurotoxicity (including catatonia) in patients with steroid-resistant nephrotic syndrome. In addition, it highlights the challenges faced by clinicians in jurisdictions that prohibit the use of electroconvulsive therapy in pediatric patients.",
"affiliations": "Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, TX, USA. richard.heekin@bcm.edu.;University of Texas Health Science Center at Houston, Houston, TX, USA.;Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, TX, USA.",
"authors": "Heekin|R David|RD|;Bradshaw|Kalonda|K|;Calarge|Chadi A|CA|",
"chemical_list": "D000935:Antifungal Agents; D013256:Steroids; D016572:Cyclosporine",
"country": "England",
"delete": false,
"doi": "10.1186/s12888-019-2107-6",
"fulltext": "\n==== Front\nBMC PsychiatryBMC PsychiatryBMC Psychiatry1471-244XBioMed Central London 210710.1186/s12888-019-2107-6Case ReportFirst known case of catatonia due to cyclosporine A-related neurotoxicity in a pediatric patient with steroid-resistant nephrotic syndrome Heekin R. David richard.heekin@bcm.edu 1Bradshaw Kalonda kalonda.bradshaw@uth.tmc.edu 2Calarge Chadi A. chadi.calarge@bcm.edu 11 0000 0001 2160 926Xgrid.39382.33Department of Psychiatry and Behavioral Sciences, Baylor College of Medicine, Houston, TX USA 2 0000 0000 9206 2401grid.267308.8University of Texas Health Science Center at Houston, Houston, TX USA 24 4 2019 24 4 2019 2019 19 1231 7 2018 8 4 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nCatatonia is a neuropsychiatric syndrome characterized by diverse psychomotor abnormalities, including motor dysregulation and behavioral and affective disturbances. Once thought to occur primarily in the context of schizophrenia, recent data suggest most cases of catatonia develop in individuals with depressive or bipolar disorders. Moreover, catatonia may ensue in general medical and neurological conditions, as well as due to a variety of pharmaceuticals, drugs of abuse, and toxic agents. At one time considered rare in pediatric patients, evidence now suggests catatonia is both underrecognized and undertreated in this population, where it carries an elevated risk of morbidity and mortality. Here we present the case of a child with steroid-resistant nephrotic syndrome who developed catatonia due to cyclosporine A-related neurotoxicity.\n\nCase presentation\nA 9-year-old African-American boy with no psychiatric history and a 9-month history of nephrotic syndrome due to focal segmental glomerulosclerosis was admitted to the local children’s hospital for management of mutism, posturing, insomnia, gait abnormalities, and somatic delusions. Seven days prior to admission, his cyclosporine plasma concentration was elevated at 1224 ng/mL (therapeutic range: 100–200 ng/mL). Upon admission, cyclosporine was discontinued and psychiatry was consulted, diagnosing catatonia. The patient subsequently received propofol 80 mg IV resulting in a transient lysis of catatonia. Over a lengthy hospitalization, the patient’s catatonia was initially treated with lorazepam, quetiapine being added later to target psychosis. All signs and symptoms of catatonia resolved, and the patient was eventually tapered off both lorazepam and quetiapine with no return of symptoms more than 6 months later.\n\nConclusions\nTo our knowledge, this case represents the first reported instance of cyclosporine A-induced catatonia in a patient with steroid-resistant nephrotic syndrome. It illustrates the importance of maintaining vigilance for signs and symptoms of cyclosporine A-related neurotoxicity (including catatonia) in patients with steroid-resistant nephrotic syndrome. In addition, it highlights the challenges faced by clinicians in jurisdictions that prohibit the use of electroconvulsive therapy in pediatric patients.\n\nKeywords\nCatatoniaNephrotic syndromeCyclosporineNeurotoxicityPropofolissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nCatatonia is a neuropsychiatric syndrome characterized by diverse psychomotor abnormalities, including motor dysregulation and behavioral and affective disturbances. For much of the twentieth century, catatonia was believed to occur primarily in the context of schizophrenia. However, recent data suggest catatonia develops more commonly in individuals with depressive or bipolar disorders [1]. Moreover, it is now well established that catatonia may ensue in the context of general medical and neurological conditions, as well as due to a variety of pharmaceuticals, drugs of abuse, and toxic agents [2–4].\n\nOnce thought to be rare in pediatric patients, evidence now suggests catatonia is both underrecognized and undertreated in this age group [5]. In fact, catatonia is more likely to be associated with developmental disorders and general medical conditions in children compared to adults [5]. Significantly, catatonia carries an elevated risk of morbidity and mortality, partly attributed to failure of timely recognition and initiation of appropriate treatment [6]. Here we present the case of a child with steroid-resistant nephrotic syndrome (SRNS) who developed catatonia likely secondary to cyclosporine A (CsA)-related neurotoxicity.\n\nCase presentation\nThe patient is a 9-year-old obese African-American boy with a 9-month history of nephrotic syndrome due to focal segmental glomerulosclerosis (FSGS), diagnosed by renal biopsy. He had no prior psychiatric history, although two maternal great aunts had been diagnosed with schizophrenia. His home medications included CsA 125 mg QAM and 100 mg QHS, prednisolone 60 mg daily, amlodipine 5 mg BID, and lisinopril 5 mg daily. He was admitted to the local children’s hospital for management of prolonged staring, mutism, unusual arm posturing, insomnia, and abnormal gait. Significantly, 7 days prior to presenting to our facility, his CsA plasma concentration was 1224 ng/mL (therapeutic range: 100–200 ng/mL) on routine testing. Around this time, according to his parents, the patient had become increasingly anxious. They noted he repeatedly expressed concerns about having “a hole in my neck” and that, when he swallowed, it felt “like it’s only going down one side.” His parents brought him to an outside ED where a rapid strep test was positive and a computed tomography (CT) scan of the head was unremarkable. He was treated with penicillin G and discharged home.\n\nUpon presentation to our facility, the child was alert and grossly oriented. Physical exam was significant for signs of generalized volume overload, with 2+ lower extremity pitting edema. He displayed significant negativism, keeping his eyes closed when the examiner attempted to open them, refusing to open his mouth to command or prying, and biting down hard on a tongue depressor. Vital signs were within normal limits. Initial laboratory exam including blood chemistry, CBC, blood culture, HSV PCR, urine toxicology, and thyroid function tests was remarkable only for hypoalbuminemia. Plasma CsA level was 64 ng/mL. Serum autoimmune encephalitis panel was obtained, returning negative one week later. Chest x-ray was unremarkable. Head CT scan and a magnetic resonance imaging (MRI) scan of the brain with and without contrast were remarkable only for mild-to-moderate prominence of cerebrospinal fluid (CSF) spaces and mild thinning of the corpus callosum without focal abnormalities. At that time, the patient’s home CsA was discontinued due to concern for potential neurotoxicity, and intravenous (IV) methylprednisolone 48 mg daily was substituted for oral (PO) prednisolone as the patient refused to swallow, repeatedly spitting out his medications. He was started on empiric acyclovir, vancomycin, and ceftriaxone for possible meningitis. The initial differential diagnosis was broad and included toxic/iatrogenic causes of psychosis and altered mental status (especially corticosteroids and CsA), primary psychiatric disorders, infectious and autoimmune causes of encephalitis, seizures, vitamin deficiency (e.g. B6, B12, or thiamine deficiency, which may be associated with nephrotic syndrome), or malignancy.\n\nOver the first 24 h of admission, the patient displayed further mental status changes, sleep disturbance, and episodic agitation and confusion. He appeared to be responding to internal stimuli, sitting up in bed suddenly, crying, kicking, and punching indiscriminately. During these times, he would not follow commands, while at times displaying echolalia and verbigeration. He became progressively more agitated, pulling out his IV line, biting off his identification bracelet, and yelling profanity at his mother. This behavior was in stark contrast to the patient’s usually shy and reserved demeanor. During the next 24 h, he exhibited Cotard delusion, telling his parents he had died from “a bomb in my neck” and that he was now a “zombie.” Throughout that day, he displayed increasing mutism and odd mannerisms, raising his hands above his head and out to his sides as if meditating. Psychiatry was consulted and diagnosed catatonia, recommending treatment with lorazepam. However, the patient’s primary team elected to defer this treatment.\n\nOn hospital day 3, the patient received propofol 80 mg IV in preparation for a lumbar puncture for further work-up. Within seconds, he became alert and sat up in bed saying, “I feel better now.” He followed commands and was oriented to person, age, place, and year. He recognized his nephrologist by name and was able to recall discussions between his medical team and his parents from earlier in the admission. This drastic change in mental status lasted only a few minutes but led the team to abort the lumbar puncture, ascribing a “behavioral” cause to his presentation and deeming an infectious or autoimmune process unlikely. Factors thought to support this contention included absence of fever, normal laboratory tests, and a months-long corticosteroid treatment (felt to be protective against an autoimmune process).\n\nOur psychiatry consult/liaison team was brought back on board and performed a lorazepam challenge test with 2 mg IV, resulting in temporary resolution of catatonic symptoms and markedly improved mental status. Lorazepam was continued at 2 mg IV 3 times/day (TID). Catatonic symptoms returned on hospital day 4, with the patient displaying alternating mutism, excitement, immobility, stereotypic movements, echolalia, verbigeration, odd mannerisms, negativism, and mild rigidity. His Bush-Francis Catatonia Rating Scale (BFCRS) score was 26. At this point he began to show autonomic instability with a temperature of 37.9 °C, systolic blood pressure ranging from 95 to 147 mmHg over a period of 1 h, and heart rate fluctuating between approximately 60 and 160 bpm over 2 to 3 min despite lying supine and motionless. Lorazepam was increased to 3 mg IV TID with resolution of autonomic instability. On hospital day 5, with close consultation between the primary general pediatrics team, nephrology, and psychiatry, mycophenolate mofetil 500 mg IV BID was started as an alternative to the patient’s home CsA for SRNS, given CsA’s known neurotoxicity risk [7]. Mycophenolate mofetil was subsequently switched to oral (PO) formulation and titrated to 1000 mg PO BID over the following 10 days.\n\nBy hospital day 7, the BFCRS score was 11. Over the following 3 weeks lorazepam, was switched to PO formulation and increased to a maximum dose of 3.75 mg PO TID. Despite the increase, the patient continued to show only partial resolution of catatonic symptoms, with continued negativism, slowed movements, somatic delusions, and periodic visual illusions (mistaking wrinkles in his bedsheets for snakes). Due to psychomotor slowing and sedation, lorazepam was decreased to 3 mg PO TID. Due to concern about corticosteroids also potentially causing catatonia and psychosis [8], methylprednisolone was gradually decreased from 48 mg daily to 20 mg daily, then switched to prednisone 25 mg PO daily on day 20. Additionally, mycophenolate mofetil was held for 5 days between days 20–24 as the patient’s parents reported the patient’s mental status seemed to deteriorate when he was given this medication; however this hiatus did not result in any clinical improvement.\n\nAfter several family and multidisciplinary treatment team meetings, prompted by parents’ concerns about adverse drug effects and potential for inducing neuroleptic malignant syndrome (NMS) in catatonic patients, quetiapine 12.5 mg QHS was started as an adjunctive treatment for catatonia and psychosis on hospital day 28. Over the following 3 weeks, quetiapine was switched to extended-release formulation and titrated up to 300 mg at bedtime, with lorazepam continued at 3 mg PO TID. The patient demonstrated gradual improvement in catatonic signs/symptoms, and by hospital day 39 he was increasingly interactive (although with continued paucity of speech and increased speech latency), no longer exhibiting somatic delusions or sensory misperceptions. By hospital day 68 all signs/symptoms of catatonia had resolved, and the patient’s parents felt he was at his mental status baseline. He was discharged home on day 78, having remained as an inpatient to manage volume overload due to nephrotic syndrome. Psychotropic medications at discharge were lorazepam 3 mg TID and quetiapine extended-release 250 mg QHS. Over the following 3 months the patient was tapered off both medications, with no recurrence of symptoms six months later (Table 1).Table 1 Summary of clinical course\n\nHospital day\tClinical summary/therapeutic interventions\t\n1\tPatient admitted due to staring, mutism, posturing, insomnia, gait abnormalities, and somatic delusions. Home CsA discontinued due to concern for neurotoxicity. Methylprednisolone 48 mg IV daily substituted for home prednisolone 60 mg PO daily. Empiric acyclovir, vancomycin, and ceftriaxone given for possible meningitis.\t\n3\tTemporary lysis of catatonia achieved with propofol 80 mg IV. Lorazepam challenge test (2 mg IV one-time dose) later resulted in temporary resolution of catatonic symptoms. Lorazepam 2 mg IV TID started.\t\n4\tDue to concern for malignant catatonia, lorazepam increased to 3 mg IV TID with resolution of autonomic instability.\t\n5\tMycophenolate mofetil 500 mg IV BID started as alternative to home CsA for steroid-resistant nephrotic syndrome.\t\n10\tLorazepam 3 mg IV TID switched to 3 mg PO TID.\t\n12\tMycophenolate mofetil 500 mg IV BID switched to 750 mg PO BID.\t\n14\tMethylprednisolone decreased to 30 mg IV daily.\t\n15\tMycophenolate mofetil increased to 1000 mg PO BID.\t\n18\tLorazepam increased to 3.75 mg PO TID. Methylprednisolone decreased to 20 mg IV daily.\t\n20\tMethylprednisolone 20 mg IV daily switched to prednisone 25 mg PO daily. Mycophenolate mofetil held due to continued altered mental status.\t\n24\tLorazepam decreased to 3 mg PO TID due to concern for psychomotor slowing and sedation.\t\n25\tMycophenolate mofetil 1000 mg PO BID restarted due to no improvement in mental status while off this medication.\t\n28\tQuetiapine 12.5 mg PO QHS started as adjunctive treatment for catatonia and psychosis. Quetiapine titrated to 25 mg QAM + 50 mg QHS over the following 7 days.\t\n36\tQuetiapine switched to quetiapine XR 100 mg PO QHS. Quetiapine XR titrated to 300 mg PO QHS over the following 12 days.\t\n39\tPatient was increasingly interactive and no longer exhibited somatic delusions or sensory misperceptions. Psychotropic meds were lorazepam 3 mg PO TID and quetiapine XR 150 mg PO QHS.\t\n68\tCatatonic symptoms noted to have resolved. Parents believed patient was at his mental status baseline. Psychotropic meds were lorazepam 3 mg PO TID and quetiapine XR 300 mg QHS.\t\n78\tPatient was discharged home on psychotropic meds lorazepam 3 mg PO TID and quetiapine XR 250 mg PO QHS (both tapered and discontinued over the following 3 months).\t\nBID: 2 times per day, CsA: cyclosporine A, IV: intravenous, PO: oral, QAM: every morning, QHS: every night, TID: 3 times per day, XR: extended release\n\n\n\nDiscussion\nWe report the first known case of catatonia due to CsA-related neurotoxicity in a patient with SRNS, though we recognize other patients with similar symptoms may have been diagnosed with delirium or psychosis. CsA is the most frequently used immunosuppressive agent for the treatment of SRNS in childhood [9]. CsA-related central neurotoxicity has been extensively documented in both adult and pediatric bone marrow and solid organ transplant recipients (with an incidence of 0.5 to 35%) [10]. In SRNS, however, CsA-related neurotoxicity has been less often described, with posterior reversible encephalopathy syndrome (PRES) appearing to be the most common presentation [11, 12]. In contrast, only a handful of cases of non-PRES CsA-related neurotoxicity in patients with SRNS have been reported. The neurologic signs and symptoms in these cases have included headache, anxiety, tremor, confusion, seizures, coma, and hallucinations (Table 2).Table 2 Reported cases of CsA-related neurotoxicity (excluding PRES) in patients with SRNS\n\nReference\tAge (years)/ Gender\tRenal diagnosis\tCsA plasma level at time of episode (ng/mL)\tOther medications at time of episode\tNeurologic signs/symptoms\tEEG findings\tCT/MRI findings\t\n[9]\t4/F\tSRNS MesPGN\t132\tNot reported\tAltered conciousness, seizures, cortical blindness\tn/a\tMRI: Increased T2 intensity and restricted diffusion on DWI/ADC in P, O, W, G\t\n[9]\t11/M\tSRNS FSGS\t141\tNot reported\tAltered conciousness, seizures\tn/a\tMRI: Increased T2 intensity and restricted diffusion on DWI/ADC in P, Fr, W\t\n[9]\t15/F\tSRNS IgA nephropathy\t263\tNot reported\tAltered conciousness, seizures\tn/a\tCT: hypodense zones in P, O\t\n[10]\t6.5/F\tSRNS MCD\t172\tPrednisolone (35 mg/day) Sodium valproate (1 mg/kg IV per hour) Phenobarbital (10 mg/kg IV)\tHeadache, confusion, hallucinations, seizures, coma\tFocus of slow paroxysmal activity in posterior right leads\tCT: normal MRI: contrast enhancement in corticosubcortical areas of P and Fr bilaterally (resolved at 3 month comparison study)\t\n[10]\t12/F\tSRNS MesPGN\t203\tPrednisolone (60 mg every other day)\tHeadache, confusion, seizures, status epilepticus\tSlow activity (consistent with therapeutic coma) with left occipital spikes\tCT: normal MRI: Increased T2 intensity in cortex and cortico-subcortical junction of medial left P and bilateral Fr\t\n[13]\t10/M\tSRNS FSGS\t85.55\tPrednisone (2 mg/mg/day)\tAnxiety, tremor, headache, neck pain\tNormal\tCT: “small widening sulcus on brain surface”\t\nCsA: cyclosporine A, PRES: posterior reversible encephalopathy syndrome, SRNS: steroid-resistant nephrotic syndrome, EEG: electroencephalogram, CT: comptuted tomography, MRI: magnetic resonance imaging, MesPGN: mesangial proliferative glomerulonephritis, T2: T2-weighted imaging, DWI: diffusion-weighted imaging, ADC: apparent diffusion coefficient mapping, P: parietal region, O: occipital region, W: white matter, G: gray matter, FSGS: focal segmental glomerulosclerosis, Fr: frontal region, MCD: minimal change disease, IV: intravenous\n\n\n\nThe onset of neurotoxic symptoms ranges from 1 day to 3 years following the initiation of CsA; however, most adverse effects are noted in the first month and one-third within the first week [14]. Risk factors include hepatic or renal dysfunction, hypomagnesemia, hypocholesterolemia, high-dose glucocorticoid therapy, arterial hypertension, cancer chemotherapy, cerebral ischemia or hemorrhage, and opportunistic infection [14]. Neuroimaging may reveal cerebral white matter hypodensity on CT, corresponding to areas of increased signal on MRI T2 sequence [10].\n\nThe exact pathogenesis of CsA neurotoxicity is unclear, with proposed mechanisms including damage to endothelial cells leading to release of vasoactive agents, resulting in vasospasm and microvascular damage [9]. Direct toxicity of CsA has also been proposed; however neurotoxic symptoms do not appear to be dose-dependent, potentially occurring even when CsA plasma concentrations are within the therapeutic range [9]. Among organ-transplant recipients, a wide range of neurological signs and symptoms have been reported. Minor side effects include headache, anxiety, tremor, and insomnia. More serious findings include confusion, delirium, aphasia, dystonia, hallucinations, visual disturbances, akinetic mutism, parkinsonism, peripheral neuropathies, seizures, coma, intracranial hemorrhage, PRES, and cortical blindness [7].\n\nAs for catatonia, this has been reported previously in a 54-year-old female bone marrow transplant recipient on CsA [15]. Additionally, in a case series describing three liver transplant patients treated with CsA, multiple signs consistent with catatonia (e.g. immobility, mutism, rigidity, staring, grimacing, and posturing) were reported but attributed to akinetic mutism [16]. Another case report described a patient taking CsA for resistant atopic dermatitis who developed features consistent with catatonia but ultimately was diagnosed with irreversible abulia [17]. To our knowledge, however, catatonia has never been reported in a patient receiving CsA for SRNS, like our patient. Of course, it is possible other causes may have contributed to the development of his catatonia, chief among them being corticosteroids. However, the patient had been maintained on a stable dose of corticosteroids for months prior to developing catatonic symptoms, and he was continued on steroid treatment throughout his care. Nevertheless, given that corticosteroid-induced psychiatric symptoms can emerge at any time during treatment, this cannot be ruled out as a contributing factor in our patient’s presentation [8]. Autoimmune encephalitis, including anti-N-methyl-D-aspartate (NMDA) receptor encephalitis, is another possibility, given the relatively high incidence of catatonia in this condition [18, 19]. While our patient did test negative for autoimmune/paraneoplastic autoantibodies on serum evaluation, CSF testing for anti-NMDA receptor IgG autoantibodies (which our patient did not undergo) is both more sensitive and specific than serum testing [20]. Nevertheless, serum immunohistochemistry-testing for anti-NMDA receptor antibodies is highly sensitive [21]. Arguing in favor of CsA treatment as the likely cause of catatonia in our patient is the fact that he manifested prodromal symptoms of CsA-related neurotoxicity (i.e. heightened anxiety) in close temporal proximity to having elevated CsA plasma concentration on routine testing.\n\nCatatonia may develop due to treatment with a variety of pharmaceutical agents, including fluoroquinolones, cephalosporins, dopamine antagonists (e.g. antiemetics and antipsychotics), corticosteroids, disulfiram, baclofen, tacrolimus, and cyclosporine [5]. In addition, catatonia has been observed in patients withdrawing from GABA-ergic drugs such as benzodiazepines, zolpidem, and gabapentin, as well as with discontinuation of dopamine agonists including bromocriptine and levodopa/carbidopa [5]. Such medication-related presentations, together with catatonia due to general medical and neurological conditions or toxic agents (e.g. carbon monoxide poisoning), are classified under the ICD-10 diagnosis “organic catatonic disorder” (F06.1), which excludes presentations due to alcohol or drugs of abuse [22]. As DSM-5 does not contain a “substance/medication-induced” diagnostic classification for catatonia, our patient’s case was diagnosed as the less-descriptive “other medication-induced movement disorder” [23]. Treatment of “organic catatonia” under its various names involves removing suspected offending agents and/or treating the underlying medical condition and/or drug withdrawal. Otherwise, treatment follows the same approach as for catatonia due to psychiatric illness, including use of benzodiazepines, augmentation with agents such as memantine or amantadine, and electroconvulsive therapy (ECT) [5].\n\nLysis of catatonia by propofol has previously been reported in a 58-year-old bone-marrow transplant recipient, with catatonia likely precipitated by adenovirus limbic encephalitis in the context of benzodiazepine withdrawal [24]. Propofol (2,6-diisopropylphenol) is a short-acting IV anesthetic approved by the United States Food and Drug Administration (FDA) for the maintenance of anesthesia in children ≥2 months of age and for induction of anesthesia in children ≥3 years of age [25]. It is also frequently used off-label by anesthesiologists and critical care physicians for sedation for procedures and imaging in pediatric patients [26]. Propofol’s mechanism of action involves positive modulation of the inhibitory function of γ-aminobutyric acid (GABA) through binding at GABAA receptors [27]. In addition, propofol inhibits the N-methyl-d-aspartate (NMDA) glutamate receptor and reduces calcium influx through slow calcium-ion channels [28]. Given its rapid onset and brief duration of action, future research should investigate propofol’s utility as an alternative challenge for catatonia. The use of ECT in combination with propofol anesthesia as a means of increasing efficacy in catatonic patients should also be examined.\n\nSeveral historical circumstances have combined to obscure the recognition of catatonia as a discrete pathological entity, including most notably its incorporation by Emil Kraepelin into the concept of dementia praecox in the 1890s (later termed “schizophrenia” by Eugen Bleuler) as well as the later deinstitutionalization shift within the field [19, 29]. Given its mercurial status as a diagnostic entity, it is hardly surprising that many patients with catatonia go all too often unrecognized by clinicians [30]. This challenge manifests even more acutely in pediatric cases, where catatonic symptoms may be misdiagnosed as selective mutism, autism spectrum disorder, somatic symptom disorder, or malingering once schizophrenia has been ruled out. A retrospective chart review of 101 inpatients at an academic pediatric psychiatric facility found evidence of 3 or more catatonic signs in 18 patients (17%), while treating clinicians diagnosed catatonia in only two cases [31]. In the case of our patient being treated at a large academic tertiary referral hospital, the question put to the psychiatry consult service was whether his observed abnormalities (e.g. mutism, negativism, echolalia, stereotypies) might be “behavioral” in nature, after his dramatic and paradoxical response to propofol infusion. This likely reflects the poorly understood nature of catatonia among clinicians. This situation might be remedied by more collaborative efforts in medical education to promote knowledge of catatonia and the importance of early specific treatment, as delays in treatment are associated with increased morbidity and mortality—a circumstance even more unfortunate as the initial recommended treatment, lorazepam, carries minimal risk [4]. As consult-liaison psychiatrists establish a more widespread presence in hospital settings, they could play a key role in promoting increased awareness of catatonia across medical specialties.\n\nOur patient achieved only partial remission with lorazepam, whose dose could not be increased further due to sedation. Quetiapine subsequently was used as an adjunctive treatment to target both catatonia and psychosis. While both first and second-generation antipsychotics (including clozapine) have been associated with development of catatonia and malignant catatonia/NMS, second-generation antipsychotics also have been used to treat catatonia [5]. Several case reports have documented successful treatment of catatonia with olanzapine, either as the primary agent or combined with more standard treatments such as ECT, benzodiazepines, or amantadine [5, 32–42]. This has led to olanzapine being recommended as a preferred antipsychotic to use in catatonia, if necessary [5]. After discussion of risks and benefits we chose quetiapine, which has been used successfully to treat catatonia, in part due to its less problematic cardiometabolic risk profile for our obese patient [43]. We also speculated quetiapine might be less likely to induce NMS/malignant catatonia than antipsychotics with stronger dopamine D2 receptor antagonist properties.\n\nFinally, when evidence of autonomic instability emerged, the use of ECT in a prepubescent child with potential malignant catatonia was considered. In the state of Texas, however, the use of ECT in children under 16 years of age is prohibited, even in life-threatening circumstances (similar restrictions exist in California and Colorado) [44]. Such laws have the potential to deprive patients and their families of established life-saving treatments, as in malignant catatonia, which carries a 10–20% mortality rate when untreated [45]. Moreover, without recourse to ECT, which may produce more rapid response and remission of catatonia, patients might be exposed to complications associated with unnecessarily prolonged treatment courses. A comprehensive review of the pediatric ECT literature showed an 80% efficacy rate in catatonia, which may underestimate its true efficacy in malignant catatonia as adult studies have found higher success rates in these cases [46, 47]. ECT is a remarkably safe procedure, with a mortality rate of up to 4 deaths per 100,000 treatments [48]. Since much of the morbidity and mortality associated with ECT derives from cardiac events in elderly patients, it is reasonable to suspect the procedure is even safer in younger individuals [49]. Multiple longitudinal studies in adults have found no evidence of structural, histopathological, or neurocognitive damage from ECT, even with maintenance treatments lasting several years [50–54]. In fact, use of ECT for treatment-resistant depression has been associated with increases in cortical thickness as well as increased volume of hippocampal subfields and amygdala nuclei implicated in the pathophysiology of depression [55]. More limited studies in adolescents show no differences in cognitive testing, social functioning, or school performance between ECT-treated patients and matched controls at follow-up ranging from 2 to 9 years [56, 57]. While more investigation of the long-term effects of ECT in child and adolescent patients is needed, both evidence-based clinical decision-making and a rational legal policy would balance the risks of ECT in this population against the predictable harm of foregoing a well-established and potentially lifesaving treatment of proven efficacy.\n\nConclusions\nWe have presented the first known case of catatonia due to CsA-related neurotoxicity in a pediatric patient with SRNS. This case illustrates the importance of maintaining vigilance for signs and symptoms of CsA-related neurotoxicity (including catatonia) in patients on CsA treatment for SRNS. Moreover, it highlights the challenges faced by clinicians in jurisdictions where the use of ECT in pediatric patients is prohibited.\n\nAbbreviations\nBFCRSBush-Francis Catatonia Rating Scale\n\nBID2 times per day\n\nbpmBeats per minute\n\nCBCComplete blood count\n\nCsACyclosporine A\n\nCSFCerebrospinal fluid\n\nCTComputed tomography\n\nECTElectroconvulsive therapy\n\nEDEmergency department\n\nFSGSFocal segmental glomerulosclerosis\n\nGABAγ-aminobutyric acid\n\nHSVHerpes simplex virus\n\nIVIntravenous\n\nMRIMagnetic resonance imaging\n\nNMDAN-methyl-D-aspartate\n\nNMSNeuroleptic malignant syndrome\n\nPCRPolymerase chain reaction\n\nPOOral\n\nPRESPosterior reversible encephalopathy syndrome\n\nQAMEvery morning\n\nQHSEvery night\n\nSRNSSteroid-resistant nephrotic syndrome\n\nTID3 times per day\n\nWBCWhite blood cell\n\nAcknowledgements\nThe authors would like to thank the patient and his parents for their participation and collaboration.\n\nFunding\nNo funding was obtained to report this case.\n\nAvailability of data and materials\nThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\n\nAuthors’ contributions\nKB, CC, and RH treated the patient. RH wrote the paper. CC and KB critically reviewed the manuscript and provided revisions. All authors read and approved the final version of the manuscript.\n\nEthics approval and consent to participate\nEthics approval to report this case was not required.\n\nConsent for publication\nWritten informed consent for publication of this case report was obtained from the patient’s parents. A copy of the signed written consent to publish is available for review by the editor of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Diagnostic and statistical manual of mental disorders. 5th ed. Arlington, VA: American Psychiatric Association; 2013. p. 119–121.\n2. Carroll B Goforth H Caroff S Mann S Francis A Fricchione G Medical catatonia Catatonia: from psychopathology to neurobiology 2004 Washington, DC American Psychiatric Publishing 121 127 \n3. Gelenberg AJ The catatonic syndrome Lancet 1976 1 1339 1341 10.1016/S0140-6736(76)92669-6 58326 \n4. Ahuja N Organic catatonia: a review Indian J Psychiatry 2000 42 327 346 21407969 \n5. Denysenko L, Freudenreich O, Philbrick K, Penders T, Zimbrean P, Nejad S, et al. Catatonia in medically ill patients: an evidence-based medicine (EBM) monograph for psychosomatic medicine practice. The guidelines and evidence-based medicine Subcommittee of the Academy of psychosomatic medicine (APM) and the European Association of Psychosomatic Medicine (EAPM). 2015. https://www.eapm.eu.com/wp-content/uploads/2018/06/Catatonia_APM-EAPM_2015-04-17.pdf. Accessed 27 May 2018.\n6. Cornic F Consoli A Tanguy M Bonnot O Périsse D Tordjman S Laurent C Cohen D Association of adolescent catatonia with increased mortality and morbidity: evidence from a prospective follow-up study Schizophr Res 2009 113 233 240 10.1016/j.schres.2009.04.021 19443182 \n7. Gijtenbeek J van den Bent M Vecht C Cyclosporine neurotoxicity: a review J Neurol 1999 246 339 346 10.1007/s004150050360 10399863 \n8. Russo E Ciriaco M Ventrice P Russo G Scicchitano M Mazzitello G Scicchitano F Corticosteroid-related central nervous system side effects J Pharmacol Pharmacother 2013 4 94 10.4103/0976-500X.120975 \n9. Batinić D Milošević D Filipović-Grčić B Topalović-Grković M Barišić N Turudić D Neurotoxicity of cyclosporine a in children with steroid-resistant nephrotic syndrome: is cytotoxic edema really an unfavorable predictor of permanent neurological damage? Wien Klin Wochenschr 2017 129 579 582 10.1007/s00508-017-1221-z 28600697 \n10. Taque S Peudenier S Gie S Rambeau M Gandemer V Bridoux L Bétrémieux P De Parscau L Le Gall E Central neurotoxicity of cyclosporine in two children with nephrotic syndrome Pediatr Nephrol 2004 19 276 280 10.1007/s00467-003-1347-2 14758527 \n11. Zhou J Zheng H Zhong X Wu D Wang M Tang X Li Q Reversible posterior encephalopathy syndrome in children with nephrotic syndrome Nephrology. 2015 20 849 854 10.1111/nep.12518 26014660 \n12. Ishikura K Ikeda M Hamasaki Y Hataya H Nishimura G Hiramoto R Honda M Nephrotic state as a risk factor for developing posterior reversible encephalopathy syndrome in paediatric patients with nephrotic syndrome Nephrol Dial Transplant 2008 23 2531 2536 10.1093/ndt/gfn013 18258739 \n13. Kwinta-Rybicka J Ogarek I Sancewicz-Pach K Neurotoxicity of cyclosporine a in therapy of steroid resistant nephrotic syndrome in a 10-year old boy Przegl Lek 1996 53 369 370 8711194 \n14. Hauben M Cyclosporine neurotoxicity Pharmacotherapy. 1996 16 576 583 8840363 \n15. Bernstein L Levin R Catatonia responsive to intravenous lorazepam in a patient with cyclosporine neurotoxicity and hypomagnesemia Psychosomatics. 1993 34 102 103 10.1016/S0033-3182(93)71938-6 8426885 \n16. Bird G Meadows J Goka J Polson R Williams R Cyclosporin-associated akinetic mutism and extrapyramidal syndrome after liver transplantation J Neurol Neurosurg Psychiatry 1990 53 1068 1071 10.1136/jnnp.53.12.1068 2292700 \n17. Nishie M Kurahashi K Ogawa M Yoshida Y Midorikawa H Posterior encephalopathy subsequent to cyclosporin a presenting as irreversible abulia Intern Med 2003 42 750 755 10.2169/internalmedicine.42.750 12924507 \n18. Dalmau J Gleichman A Hughes E Rossi J Peng X Lai M Dessain S Rosenfeld M Balice-Gordon R Lynch D Anti-NMDA-receptor encephalitis: case series and analysis of the effects of antibodies Lancet Neurol. 2008 7 1091 1098 10.1016/S1474-4422(08)70224-2 18851928 \n19. Fink M Taylor M The catatonia syndrome: forgotten but not gone Arch Gen Psychiatry 2009 66 1173 10.1001/archgenpsychiatry.2009.141 19884605 \n20. Dalmau J Lancaster E Martinez-Hernandez E Rosenfeld M Balice-Gordon R Clinical experience and laboratory investigations in patients with anti-NMDAR encephalitis Lancet Neurol 2011 10 63 74 10.1016/S1474-4422(10)70253-2 21163445 \n21. Gresa-Arribas N Titulaer M Torrents A Aguilar E McCracken L Leypoldt F Gleichman A Balice-Gordon R Rosenfeld M Lynch D Graus F Dalmau J Antibody titres at diagnosis and during follow-up of anti-NMDA-receptor encephalitis: a retrospective study Lancet Neurol. 2014 13 167 177 10.1016/S1474-4422(13)70282-5 24360484 \n22. F06.1 Organic catatonic disorder. In: The ICD-10 classification of mental and behavioural disorders: clinical descriptions and diagnostic guidelines. World Health Organization. 1992. https://www.who.int/classifications/icd/en/bluebook.pdf. Accessed 1 Feb 2019.\n23. Schizophrenia Spectrum and Other Psychotic Disorders. In: Diagnostic and statistical manual of mental disorders. 5th ed. Arlington: American Psychiatric Association; 2013. 10.1176/appi.books.9780890425596.dsm02. Accessed 1 Feb 2019.\n24. Alfson E Awosika O Singhal T Fricchione G Lysis of catatonic withdrawal by propofol in a bone-marrow transplant recipient with adenovirus limbic encephalitis Psychosomatics. 2013 54 192 195 10.1016/j.psym.2012.03.003 22705183 \n25. Smith MC Williamson J Yaster M Boyd GJ Heitmiller ES Off-label use of medications in children undergoing sedation and anesthesia Anesth Analg 2012 115 1148 1154 10.1213/ANE.0b013e3182501b04 22451593 \n26. Wheeler DS Vaux KK Ponaman ML Poss BW The safe and effective use of propofol sedation in children undergoing diagnostic and therapeutic procedures: experience in a pediatric ICU and a review of the literature Pediatr Emerg Care 2003 19 385 392 10.1097/01.pec.0000101578.65509.71 14676486 \n27. Trapani G Altomare C Sanna E Biggio G Liso G Propofol in anesthesia: mechanism of action, structure-activity relationships, and drug delivery Curr Med Chem 2000 7 249 271 10.2174/0929867003375335 10637364 \n28. Kotani Y Shimazawa M Yoshimura S Iwama T Hara H The experimental and clinical pharmacology of propofol, an anesthetic agent with neuroprotective properties CNS Neurosci Ther 2008 14 95 106 10.1111/j.1527-3458.2008.00043.x 18482023 \n29. Fink M Rediscovering catatonia: the biography of a treatable syndrome Acta Psychiatr Scand 2012 127 1 47 10.1111/acps.12038 \n30. Van der Heijden F Tuinier S Arts N Hoogendoorn M Kahn R Verhoeven W Catatonia: disappeared or under-diagnosed? Psychopathology. 2005 38 3 8 10.1159/000083964 15714008 \n31. Ghaziuddin N Dhossche D Marcotte K Retrospective chart review of catatonia in child and adolescent psychiatric patients Acta Psychiatr Scand 2011 125 33 38 10.1111/j.1600-0447.2011.01778.x 22040029 \n32. Cassidy EM O'Brien M Osman MF Finucane J O'Keane V Lethal catatonia responding to high-dose olanzapine therapy J Psychopharmacol 2001 15 302 304 10.1177/026988110101500412 11769826 \n33. Nicolato R Romano-Silva MA Correa H dos Santos RR Teixeira AL Stuporous catatonia in an elderly bipolar patient: response to olanzapine Aust N Z J Psychiatry 2006 40 498 10.1111/j.1440-1614.2006.01828.x \n34. Tan QR Wang W Wang HH Zhang RG Guo L Zhang YH Treatment of catatonic stupor with combination of modified electroconvulsive treatment and olanzapine: a case report Clin Neuropharmacol 2006 29 154 156 10.1097/01.WNF.0000220816.86478.84 16772815 \n35. Babington PW Spiegel DR Treatment of catatonia with olanzapine and amantadine Psychosomatics. 2007 48 534 536 10.1176/appi.psy.48.6.534 18071103 \n36. Guzman CS Myung VH Wang YP Treatment of periodic catatonia with atypical antipsychotic, olanzapine Psychiatry Clin Neurosci 2008 62 482 10.1111/j.1440-1819.2008.01819.x 18778449 \n37. Chang CH Hsiao YL Hsu CY Chen ST Treatment of catatonia with olanzapine: a case report Prog Neuro-Psychopharmacol Biol Psychiatry 2009 33 1559 1560 10.1016/j.pnpbp.2009.08.018 \n38. Suzuki Hayato Fukushima Takao Makino Kunihiko Kuwabara Takeo A patient with encephalitis presenting with olanzapine-responsive malignant catatonia Rinsho Shinkeigaku 2010 50 5 329 331 10.5692/clinicalneurol.50.329 20535983 \n39. Ceylan MF Kul M Kultur SE Kilincaslan A Major depression with catatonic features in a child remitted with olanzapine J Child Adolesc Psychopharmacol 2010 20 225 227 10.1089/cap.2009.0046 20578937 \n40. Jauhar S Blackett A Srireddy P McKenna PJ Pernicious anaemia presenting as catatonia without signs of anaemia or macrocytosis Br J Psychiatry 2010 197 244 245 10.1192/bjp.bp.108.054072 20807971 \n41. Ueda S Takeuchi J Okubo Y Successful use of olanzapine for catatonia following delirium Psychiatry Clin Neurosci 2012 66 465 10.1111/j.1440-1819.2012.02368.x 22834674 \n42. Kusztal M Piotrowski P Mazanowska O Misiak B Kantorska-Janiec M Boratyńska M Klinger M Kiejna A Catatonic episode after kidney transplantation Gen Hosp Psychiatry 2014 36 360.e3 360.e5 10.1016/j.genhosppsych.2014.01.001 \n43. Yoshimura B Hirota T Takaki M Kishi Y Is quetiapine suitable for treatment of acute schizophrenia with catatonic stupor? A case series of 39 patients Neuropsychiatr Dis Treat 2013 9 1565 1571 10.2147/NDT.S52311 24143105 \n44. Sachs M, Madaan V. Electroconvulsive therapy in children and adolescents: brief overview and ethical issues. Am Acad Child Adolescent Psychiatry Ethics Committee. 2012; http://www.aacap.org/app_themes/aacap/docs/member_resources/ethics/in_workplace/sachs_maadan_electroconvulsive_therapy_in_children_and_adolescents.pdf. Accessed 1 February 2019.\n45. Fink M Taylor M Catatonia: a clinician's guide to diagnosis and treatment 2002 Cambridge Cambridge University Press \n46. Rey J Walter G Half a century of ECT use in young people Am J Psychiatr 1997 154 595 602 10.1176/ajp.154.5.595 9137112 \n47. Luchini F Medda P Mariani M Mauri M Toni C Perugi G Electroconvulsive therapy in catatonic patients: efficacy and predictors of response World J Psychiatry 2015 5 182 10.5498/wjp.v5.i2.182 26110120 \n48. Abrams R The mortality rate with ECT Convuls Ther 1997 13 125 127 9342128 \n49. Wachtel L Dhossche D Kellner C When is electroconvulsive therapy appropriate for children and adolescents? Med Hypotheses 2011 76 395 399 10.1016/j.mehy.2010.11.001 21129852 \n50. Coffey C Figiel G Djang W Sullivan D Herfkens R Weiner R Effects of ECT on brain structure: a pilot prospective magnetic resonance imaging study Am J Psychiatr 1988 145 701 706 10.1176/ajp.145.9.1181-c 3369556 \n51. Scalia J Lisanby S Dwork A Johnson J Bernhardt E Arango V McCall W Neuropathologic examination after 91 ECT treatments in a 92-year-old woman with late-onset depression J ECT 2007 23 96 98 10.1097/YCT.0b013e31804bb99d 17548979 \n52. Hay A Scott A Electroconvulsive therapy and brain damage Br J Psychiatry 1994 165 120 121 10.1192/bjp.165.1.120 7953018 \n53. Kirov G Creaby M Khalid N Atkins M Four years of successful maintenance electroconvulsive therapy J ECT. 2009 25 219 220 10.1097/YCT.0b013e3181937f3d 19730029 \n54. Wijkstra J Nolen W Successful maintenance electroconvulsive therapy for more than seven years J ECT. 2005 21 171 173 10.1097/01.yct.0000176018.63613.d0 16127307 \n55. Gryglewski G, Baldinger-Melich P, Seiger R, Godbersen GM, Michenthaler P, Klöbl M, et al. Structural changes in amygdala nuclei, hippocampal subfields and cortical thickness following electroconvulsive therapy in treatment-resistant depression: longitudinal analysis. Br J Psychiatry. 2018:1–9.\n56. Cohen D Absence of cognitive impairment at long-term follow-up in adolescents treated with ECT for severe mood disorder Am J Psychiatr 2000 157 460 462 10.1176/appi.ajp.157.3.460 10698827 \n57. Taieb O Flament M Chevret S Jeammet P Allilaire J Mazet P Cohen D Clinical relevance of electroconvulsive therapy (ECT) in adolescents with severe mood disorder: evidence from a follow-up study Eur Psychiatry 2002 17 206 212 10.1016/S0924-9338(02)00668-5 12231266\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-244X",
"issue": "19(1)",
"journal": "BMC psychiatry",
"keywords": "Catatonia; Cyclosporine; Nephrotic syndrome; Neurotoxicity; Propofol",
"medline_ta": "BMC Psychiatry",
"mesh_terms": "D000935:Antifungal Agents; D002389:Catatonia; D002648:Child; D016572:Cyclosporine; D004351:Drug Resistance; D006801:Humans; D008297:Male; D009404:Nephrotic Syndrome; D013256:Steroids",
"nlm_unique_id": "100968559",
"other_id": null,
"pages": "123",
"pmc": null,
"pmid": "31014303",
"pubdate": "2019-04-24",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "10637364;21129852;18778449;22834674;16683979;7953018;9137112;21407969;15714008;8426885;19884605;3369556;18071103;22451593;24347992;26014660;10399863;20807971;24559791;21163445;18482023;16772815;2292700;17548979;28600697;30442205;19443182;11769826;8840363;12231266;18258739;19735689;22705183;58326;14676486;14758527;22040029;26110120;24143105;18851928;23215963;10698827;16127307;19730029;8711194;12924507;9342128;20535983;20578937;24360484",
"title": "First known case of catatonia due to cyclosporine A-related neurotoxicity in a pediatric patient with steroid-resistant nephrotic syndrome.",
"title_normalized": "first known case of catatonia due to cyclosporine a related neurotoxicity in a pediatric patient with steroid resistant nephrotic syndrome"
} | [
{
"companynumb": "US-MYLANLABS-2019M1047899",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nIntravenous immunoglobulin (IVIG) is the treatment of choice for humoral primary immunodeficiency diseases (PIDs). A third of the patients who receive intravenous immunoglobulin have adverse reactions, such as osmotic nephrosis.\n\n\nOBJECTIVE\nTo assess the presence of kidney disease in adults with humoral PIDs, in treatment with intravenous immunoglobulin.\n\n\nMETHODS\nA cross-sectional, descriptive, and observational study of patients who belong to the PID Clinic of the Specialties Hospital of the National Medical Center \"Siglo XXI\", Mexico City, who receive treatment with intravenous immunoglobulin. A questionnaire with demographic information, 24h urine creatinine clearance, serum creatinine, urea, and BUN (Blood Urea Nitrogen) was applied.\n\n\nRESULTS\n35 patients were surveyed; 65.7 % were women; the average age was 34 years; 51.4 % of the patients presented kidney damage. Those with > 5 years of treatment with intravenous immunoglobulin presented chronic kidney disease (CKD) with more frequency (55.6 %) according to the KDOQI scale.\n\n\nCONCLUSIONS\nChronic kidney disease occurs in 51 % of adult patients with PID who have been treated with intravenous immunoglobulin for more than 5 years; which is why these patients require periodic evaluations of their kidney function, and the use of sugar-free immunoglobulin in order to reduce the risk.",
"affiliations": "Instituto Mexicano del Seguro Social, Centro Médico Nacional Siglo XXI, Hospital de Especialidades, Servicio de Alergia e Inmunología Clínica, Ciudad de México, México. patyfritzenwalden@hotmail.com.",
"authors": "O'Farrill-Romanillos|Patricia María|PM|;Luna-Mújica|Ramón Fabricio|RF|;Contreras-García|Carlos Eduardo|CE|;Anda|Juan Carlos|JC|",
"chemical_list": "D016756:Immunoglobulins, Intravenous",
"country": "Mexico",
"delete": false,
"doi": "10.29262/ram.v67i1.707",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-5151",
"issue": "67(1)",
"journal": "Revista alergia Mexico (Tecamachalco, Puebla, Mexico : 1993)",
"keywords": "Chronic renal failure; Common variable immunodeficiencies; Humoral immune response; Intravenous immunoglobulin",
"medline_ta": "Rev Alerg Mex",
"mesh_terms": "D000328:Adult; D003430:Cross-Sectional Studies; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D008297:Male; D008875:Middle Aged; D000081207:Primary Immunodeficiency Diseases; D051436:Renal Insufficiency, Chronic; D055815:Young Adult",
"nlm_unique_id": "9438824",
"other_id": null,
"pages": "25-33",
"pmc": null,
"pmid": "32447865",
"pubdate": "2020",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Chronic kidney disease in adults with primary immunodeficiency diseases in treatment with intravenous immunoglobulin.",
"title_normalized": "chronic kidney disease in adults with primary immunodeficiency diseases in treatment with intravenous immunoglobulin"
} | [
{
"companynumb": "MX-BEH-2020119058",
"fulfillexpeditecriteria": "1",
"occurcountry": "MX",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": null,
... |
{
"abstract": "The mainstay of the management of opioid use disorder in pregnancy is with methadone or buprenorphine medication-assisted treatment. Methadone and buprenorphine are opioid agonist drugs. Naltrexone, an opioid antagonist, is also a medication-assisted treatment option; however, to date, only a few retrospective studies have reported its use in pregnancy.\n\n\n\nOur study objective was to evaluate prospectively obstetric and newborn outcomes and the maternal/fetal effects of the use of naltrexone as a medication-assisted treatment in pregnant patients with opioid use disorder.\n\n\n\nWe performed a prospective cohort study collecting data on all pregnant women who were treated with naltrexone medication-assisted treatment compared with pregnant women who were treated with methadone or buprenorphine medication-assisted treatment. Based on a sample size calculation, it was determined that for a power of 90, a minimum of 160 study participants (80 in each group) was needed with an alpha of .01 and an expected 60% rate of newborn infants who were treated for neonatal abstinence syndrome in the methadone or buprenorphine medication-assisted treatment group compared with a 30% rate in the naltrexone medication-assisted treatment group. In a random subset of 20 maternal/newborn dyads, blood levels for naltrexone and 6-beta-naltrexol (an active metabolite) were analyzed at delivery.\n\n\n\nA total of 230 patients were studied: 121 patients with naltrexone medication-assisted treatment compared with 109 patients with methadone or buprenorphine medication-assisted treatment. No differences between groups were seen regarding demographics, the use of comedications/drugs, or obstetric outcomes. For newborn outcomes, the rate of neonatal abstinence syndrome in neonates >34 weeks gestation was significantly lower in the naltrexone medication-assisted treatment group (10/119 [8.4%] vs 79/105 [75.2%]; P<.0001). Multivariate analysis demonstrated that the only significant factor for the rate of neonatal abstinence syndrome was the form of medication-assisted treatment. Of 87 patients who received naltrexone up to delivery, no neonates experienced symptoms of neonatal abstinence syndrome. No maternal relapses occurred in the 7-day no-treatment window before the initiation of naltrexone therapy. No cases of spontaneous abortion or stillbirth occurred in either group. In 64 patients who started naltrexone therapy at ≥24 weeks gestation, no changes were seen in the fetal heart monitor tracing with drug initiation. The incidence of birth anomalies was no different between the groups. Umbilical cord blood and maternal levels for naltrexone and 6-beta-naltrexol matched; no levels were elevated, and values were undetected if naltrexone was discontinued >60 hours before delivery.\n\n\n\nThese study data demonstrate that, in pregnant women who choose to completely detoxify off opioid drugs during gestation, naltrexone, as a continued form of medication-assisted treatment, is a viable option for some pregnant patients who experience opioid use disorder. Naltrexone crosses the placenta, and maternal and fetal levels are concordant. Because naltrexone clears quickly from the maternal circulation, this rapid clearance needs to be addressed with patients. This is important because maternal relapse could occur in a short time-period if the oral drug is discontinued without the knowledge of their healthcare providers. Nonetheless, the drug is well-tolerated by both mother and fetus, and newborn infants do not experience symptoms of neonatal abstinence syndrome if naltrexone medication-assisted treatment is maintained to delivery.",
"affiliations": "Department of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine, University of Tennessee Medical Center, Knoxville, TN. Electronic address: ctowers@utmck.edu.;Department of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine, University of Tennessee Medical Center, Knoxville, TN.;Department of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine, University of Tennessee Medical Center, Knoxville, TN.;Department of Obstetrics and Gynecology, Division of Maternal-Fetal Medicine, University of Tennessee Medical Center, Knoxville, TN.",
"authors": "Towers|Craig V|CV|;Katz|Emily|E|;Weitz|Beth|B|;Visconti|Kevin|K|",
"chemical_list": "D000701:Analgesics, Opioid; D009292:Narcotic Antagonists; D002047:Buprenorphine; C010410:6 beta-hydroxynaltrexone; D009271:Naltrexone; D008691:Methadone",
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajog.2019.07.037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9378",
"issue": "222(1)",
"journal": "American journal of obstetrics and gynecology",
"keywords": "buprenorphine; drug; methadone; neonatal abstinence syndrome; opioid use disorder; overdose",
"medline_ta": "Am J Obstet Gynecol",
"mesh_terms": "D000022:Abortion, Spontaneous; D000328:Adult; D000701:Analgesics, Opioid; D002047:Buprenorphine; D016022:Case-Control Studies; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D008691:Methadone; D009271:Naltrexone; D009292:Narcotic Antagonists; D009357:Neonatal Abstinence Syndrome; D058850:Opiate Substitution Treatment; D009293:Opioid-Related Disorders; D011247:Pregnancy; D011248:Pregnancy Complications; D011446:Prospective Studies; D050497:Stillbirth; D055815:Young Adult",
"nlm_unique_id": "0370476",
"other_id": null,
"pages": "83.e1-83.e8",
"pmc": null,
"pmid": "31376396",
"pubdate": "2020-01",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Use of naltrexone in treating opioid use disorder in pregnancy.",
"title_normalized": "use of naltrexone in treating opioid use disorder in pregnancy"
} | [
{
"companynumb": "US-APOTEX-2019AP022626",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NALTREXONE"
},
"drugadditional": null,
... |
{
"abstract": "Purpose Adjuvant carboplatin is one of three management strategies that may follow inguinal orchiectomy in clinical stage I seminoma. However, little is known about the outcome of patients who experience a relapse after such treatment. Patients and Methods Data from 185 patients who relapsed after adjuvant carboplatin between January 1987 and August 2013 at 31 centers/groups from 20 countries were collected and retrospectively analyzed. Primary outcomes were disease-free survival and overall survival. Secondary outcomes were time to, stage at, and treatment of relapse as well as rate of subsequent relapses. Results With a median follow-up of 53 months (95% CI, 48 to 60 months) the 5-year disease-free survival was 82% (95% CI, 77% to 89%), and the 5-year overall survival was 98% (95% CI, 95% to 100%). The median time from orchiectomy to relapse was 19 months (95% CI, 17 to 23 months); 15% (95% CI, 10% to 21%) of relapses occurred > 3 years after treatment. The majority of relapses were detected by computed tomography scan during routine follow-up, 98% in the International Germ Cell Cancer Collaborative Group good prognosis group. Chemotherapy was administered to 92% of patients, mostly as standard first-line treatment corresponding to stage; 8% of patients had additional local treatments. Only 28 patients experienced a second relapse. At last follow-up, 174 (94%) of 185 patients were alive without disease, and four patients with disease. Seven patients died, three of whom due to progressive disease. Conclusion Within the limitations of a retrospective analysis, the results suggest that the majority of patients who experience a relapse after adjuvant carboplatin for clinical stage I seminoma can be successfully treated with a cisplatin-based chemotherapy regimen adequate for stage. Because 15% of the relapses occurred > 3 years after adjuvant treatment, a minimum of 5 years follow-up is recommended.",
"affiliations": "Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.;Stefanie Fischer and Silke Gillessen, Cantonal Hospital St Gallen, St Gallen; Dirk Klingbiel, SAKK Coordinating Center, Bern; Jörg Beyer, Universitätsspital Zürich, Zürich, Switzerland; Torgrim Tandstad, St Olavs University Hospital, Trondheim, Norway; Matthew Wheater, Caroline Chau, and Edurne Arriola, University Hospital Southampton, Southampton; Emilio Porfiri, Kalena Marti, and Paul Hutton, Birmingham University Hospital, Birmingham; Jonathan Shamash, St Bartholomew's Hospital, London, United Kingdom; Aude Fléchon, Centre Léon Bérard, Lyon; Brigitte Laguerre, Centre Eugène Marquis, Rennes, France; Jorge Aparicio, Hospital Universitari i Politècnic La Fe, Valencia; Pablo Maroto, Hospital Sant Pau, Barcelona, Spain; Breda Skrbinc, Institute of Oncology, Ljubljana, Slovenia; Umberto Basso, Istituto di Ricovero e Cura a Carattere Scientifico, Padova, Italy; Anja Lorch, Universitätsklinikum Düsseldorf, Düsseldorf; Klaus-Peter Dieckmann, Klinik für Urologie, Hamburg, Germany; Gabriella Cohn-Cedermark, Karolinska Institute; Gabriella Cohn-Cedermark, Karolinska University Hospital, Stockholm; and Olof Ståhl, Skane University Hospital, Lund, Sweden.",
"authors": "Fischer|Stefanie|S|;Tandstad|Torgrim|T|;Wheater|Matthew|M|;Porfiri|Emilio|E|;Fléchon|Aude|A|;Aparicio|Jorge|J|;Klingbiel|Dirk|D|;Skrbinc|Breda|B|;Basso|Umberto|U|;Shamash|Jonathan|J|;Lorch|Anja|A|;Dieckmann|Klaus-Peter|KP|;Cohn-Cedermark|Gabriella|G|;Ståhl|Olof|O|;Chau|Caroline|C|;Arriola|Edurne|E|;Marti|Kalena|K|;Hutton|Paul|P|;Laguerre|Brigitte|B|;Maroto|Pablo|P|;Beyer|Jörg|J|;Gillessen|Silke|S|",
"chemical_list": "D016190:Carboplatin",
"country": "United States",
"delete": false,
"doi": "10.1200/JCO.2016.69.0958",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0732-183X",
"issue": "35(2)",
"journal": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"keywords": null,
"medline_ta": "J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D016190:Carboplatin; D017024:Chemotherapy, Adjuvant; D003131:Combined Modality Therapy; D006801:Humans; D008297:Male; D008875:Middle Aged; D009367:Neoplasm Staging; D009919:Orchiectomy; D012008:Recurrence; D018239:Seminoma; D013736:Testicular Neoplasms; D016896:Treatment Outcome",
"nlm_unique_id": "8309333",
"other_id": null,
"pages": "194-200",
"pmc": null,
"pmid": "27893332",
"pubdate": "2017-01-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Outcome of Men With Relapse After Adjuvant Carboplatin for Clinical Stage I Seminoma.",
"title_normalized": "outcome of men with relapse after adjuvant carboplatin for clinical stage i seminoma"
} | [
{
"companynumb": "CH-MYLANLABS-2017M1015653",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
... |
{
"abstract": "Severe cases of itraconazole-induced hepatotoxicity have been reported; however, these events are thought to occur very rarely. The available literature is comprised largely of individual case reports and small series that do not report the itraconazole serum concentration at the time of the severe adverse event or apply an objective scale to assess probability of the event being related to drug exposure. We report a case of severe hepatotoxicity after 6 months of itraconazole therapy for histoplasmosis, resulting in acute hepatic failure (aspartate transaminase >20× and alanine transaminase >15× upper limit normal), in the setting of therapeutic serum concentrations (5 mg/mL). Both the Naranjo probability scale and the Roussel Uclaf causality assessment method were used to assess the probability of a causality relationship showing a \"probable\" and \"highly probable\" association with itraconazole exposure, respectively. The available literature describing severe hepatotoxicity resulting in hepatic failure associated with itraconazole is also reviewed.",
"affiliations": "1Department of Pharmacy Services, The University of Chicago Medicine, Chicago, IL; and 2Department of Medicine, Section of Infectious Diseases and Global Health, The University of Chicago, Chicago, IL.",
"authors": "Pettit|Natasha N|NN|;Pisano|Jennifer|J|;Weber|Stephen|S|;Ridgway|Jessica|J|",
"chemical_list": "D000935:Antifungal Agents; D017964:Itraconazole",
"country": "United States",
"delete": false,
"doi": "10.1097/MJT.0000000000000313",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1075-2765",
"issue": "23(5)",
"journal": "American journal of therapeutics",
"keywords": null,
"medline_ta": "Am J Ther",
"mesh_terms": "D000368:Aged; D000935:Antifungal Agents; D056486:Chemical and Drug Induced Liver Injury; D005260:Female; D006660:Histoplasmosis; D006801:Humans; D017964:Itraconazole; D017114:Liver Failure, Acute; D008172:Lung Diseases, Fungal; D012720:Severity of Illness Index",
"nlm_unique_id": "9441347",
"other_id": null,
"pages": "e1215-21",
"pmc": null,
"pmid": "26291595",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Hepatic Failure in a Patient Receiving Itraconazole for Pulmonary Histoplasmosis-Case Report and Literature Review.",
"title_normalized": "hepatic failure in a patient receiving itraconazole for pulmonary histoplasmosis case report and literature review"
} | [
{
"companynumb": "US-JNJFOC-20160913701",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE"
},
"drugadditional": "3",
... |
{
"abstract": "A case of pheochromocytoma producing vasoactive intestinal peptide (VIP) and left ventricular thrombus in the absence of cardiomyopathy or wall motion abnormalities on echocardiogram is presented along with a review of the relevant literature. A 30-year-old female of Afghani descent with past medical history of panic attacks presented with fever, cough, sore throat, vomiting, and was found to have an 11 cm adrenal mass consistent with primary adrenocortical adenoma versus carcinoma. Her tumor elicited catechols and vasoactive intestinal peptide. Her hospitalization was complicated by left ventricular thrombosis leading to an embolic injury to her right kidney, respiratory failure, need for transient dialysis and urinary tract infections. She developed a profuse secretory diarrhea and decision was made to treat with empiric octreotide infusion and imodium with improvement in symptoms. She underwent coil and particle embolization followed by resection. Followup PET gallium scan showed no evidence of residual disease or metastasis. VIP producing pheochromocytoma associated with intracardiac thrombosis is rare. Outcomes depend on prompt diagnosis of the pheochromocytoma and multidisciplinary approach to management.",
"affiliations": "Cardiology, Scripps Health, San Diego, CA, USA.;Pulmonology/Critical Care, Scripps Health, San Diego, CA, USA.;Surgical Oncology, Scripps Health, San Diego, CA, USA.;Surgical Oncology, Scripps Health, San Diego, CA, USA.;Cardiology, Scripps Health, San Diego, CA, USA.",
"authors": "Hermel|Melody|M|https://orcid.org/0000-0002-4840-4990;Jones|Daniel|D|;Olson|Cheryl|C|;Sherman|Mark|M|;Srivastava|Ajay|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/20363613211007792",
"fulltext": "\n==== Front\nRare Tumors\nRare Tumors\nRTU\nsprtu\nRare Tumors\n2036-3605\n2036-3613\nSAGE Publications Sage UK: London, England\n\n10.1177/20363613211007792\n10.1177_20363613211007792\nCase Report\nVasoactive intestinal peptide producing pheochromocytoma and intracardiac thrombosis\nhttps://orcid.org/0000-0002-4840-4990\nHermel Melody 1\nJones Daniel 2\nOlson Cheryl 3\nSherman Mark 3\nSrivastava Ajay 1\n1 Cardiology, Scripps Health, San Diego, CA, USA\n2 Pulmonology/Critical Care, Scripps Health, San Diego, CA, USA\n3 Surgical Oncology, Scripps Health, San Diego, CA, USA\nAjay Srivastava, Cardiology, Scripps Health, 9898 Genesee Avenue, AMP 400, San Diego, CA 92121-1513, USA. Email: Srivastava.ajay@scrippshealth.org\n9 4 2021\n2021\n13 2036361321100779226 1 2021\n15 3 2021\n© The Author(s) 2021\n2021\nSAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons Licenses\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nA case of pheochromocytoma producing vasoactive intestinal peptide (VIP) and left ventricular thrombus in the absence of cardiomyopathy or wall motion abnormalities on echocardiogram is presented along with a review of the relevant literature. A 30-year-old female of Afghani descent with past medical history of panic attacks presented with fever, cough, sore throat, vomiting, and was found to have an 11 cm adrenal mass consistent with primary adrenocortical adenoma versus carcinoma. Her tumor elicited catechols and vasoactive intestinal peptide. Her hospitalization was complicated by left ventricular thrombosis leading to an embolic injury to her right kidney, respiratory failure, need for transient dialysis and urinary tract infections. She developed a profuse secretory diarrhea and decision was made to treat with empiric octreotide infusion and imodium with improvement in symptoms. She underwent coil and particle embolization followed by resection. Followup PET gallium scan showed no evidence of residual disease or metastasis. VIP producing pheochromocytoma associated with intracardiac thrombosis is rare. Outcomes depend on prompt diagnosis of the pheochromocytoma and multidisciplinary approach to management.\n\nThrombus\npheochromocytoma\nhypercoagulability\nvasoactive intestinal peptide\ncover-dateJanuary-December 2021\ntypesetterts1\n==== Body\nIntroduction\n\nPheochromocytoma is a rare tumor associated with episodic hypertension, palpitations, headaches, and panic disorder due to abnormal catecholamine production.1,2 Securing the diagnosis poses a significant clinical challenge and is often overlooked for many years even with the most classical presentation. Prevalence estimates for pheochromocytoma vary from 0.01% to 0.1% of the hypertensive population.3 Germline mutations in five genes have been identified to be responsible for familial pheochromocytoma:the von Hippel-Lindau gene, which causes von Hippel-Lindau syndrome, the RET gene leading to multiple endocrine neoplasia type 2, the neurofibromatosis type 1 gene, which is associated with von Recklinghausen’s disease and the genes encoding the B and D subunits of mitochondrial succinate dehydrogenase, which are associated with familial paragangliomas and pheochromocytomas.4 Watery diarrhea, hypokalemia, and achlorhydria (WDHA) syndrome caused by vasoactive intestinal polypeptide (VIP) produced by pheochromocytoma is exceedingly rare.5–11 Moreover, thrombotic events have been reported rarely in patients with pheochromocytoma.1,12–18 with intracardiac thrombus even rarer. A case of a patient with pheochromocytoma producing VIP and left ventricular thrombus in the absence of cardiomyopathy or wall motion abnormalities on echocardiogram is presented along with a review of the relevant literature.\n\nCase presentation\n\nA 30-year-old female of Afghani descent with past medical history of intermittent severe headaches, palpitations, anxiety, along with episodes of shaking, tremors, photophobia associated with increase in blood pressure who had previously been diagnosed with panic attacks presented with fever, cough, sore throat, and vomiting. Social history was unremarkable and family history of an aunt with thyroid disease. She was found to be tachycardic and hypertensive with elevated troponin, leukocytosis, elevated procalcitonin, and sinus tachycardia. She was started on empiric antibiotics which were continued throughout her course. Studies included CT abdomen pelvis which revealed an 11 cm heterogeneous adrenal mass consistent with primary adrenocortical adenoma versus carcinoma.\n\nHer 24-h urine metanephrine and normetanephrine levels were significantly elevated at >72,500 μg/d (normal range:36–229 μg/d), and 26,610 μg/d (normal range:95–650 μg/d) respectively. Her serum epinephrine level was >75,000 pg/mL (normal range:10–200 pg/mL), norepinephrine was 67,391 pg/mL (normal range:80–520 pg/mL), and dopamine 1458 pg/mL (normal range:0–20 pg/mL). Her 24-h urine vanillylmandelic acid (VMA) to creatinine ratio was also elevated at 279 mg/gCR (normal range:0–6 mg/gCR). She was started on aggressive alpha blockade.\n\nTransthoracic echocardiogram revealed a large left ventricular thrombus, ejection fraction 50%. She was started on heparin drip given concern for myocardial infarction. The patient experienced bilateral lower extremity paresthesias, numbness, and discomfort concerning for acute limb ischemia and there was difficulty obtaining a pulse in her lower extremities with doppler. A stat arterial duplex revealed severe bilateral lower extremity arterial insufficiency. Imaging and examination revealed extensive thrombotic occlusion of the distal aorta, bilateral common iliac arteries, and the left distal superficial femoral artery. She underwent bilateral groin cutdowns with thrombectomies and was continued on heparin infusion. Repeat echocardiography revealed significant reduction in the amount of left ventricular clot burden, likely due to cardioembolic disease but with residual clot present. Hypercoagulability workup was unremarkable including negative heparin induced thrombocytopenia (HIT) antibody, lupus anticoagulant, antiphospholipid antibody panel, and no MTHFR mutation. Her novel coronavirus (COVID19) Immunoglobulin G (IgG) was negative. Her disseminated intravascular coagulation (DIC) panel was positive with the pheochromocytoma suspected as the culprit. The patient developed an ileus prompting consideration of bowel ischemia related to embolic phenomenon, however an attempted colonoscopy was aborted due to hemodynamic instability. She did not develop evidence of gastrointestinal hemorrhage despite heparin and lactate remaining normal, which was felt to make ischemic colitis less likely. Her GI distension and concern for possible intestinal embolic events severely limited the ability for standard alpha blockade. Despite persistent colonic dilation, she developed the new onset of a profuse secretory diarrhea up to 6 L per day, which partially responded to empiric octreotide infusion and imodium. Her vasoactive intestinal peptide levels were found to be markedly elevated at 3230 pg/mL (normal range <75 pg/mL).\n\nCourse further complicated by shock liver and acute oliguric kidney injury requiring dialysis secondary to multiple factors including bilateral renal artery thromboembolism, multiple contrast exposures, dehydration, and pheochromocytoma. The patient developed acute pulmonary edema due to fluid overload from renal failure necessitating intubation. She underwent thrombectomy of the right main and inferior renal artery branches and thrombolysis with restored blood flow to the right kidney. She developed significant anemia necessitating transfusion without evidence of bleeding. She was persistently tachycardic with heart rates up to the 130s and was treated with esmolol infusion for beta blockade. Patient was successfully extubated however required reintubation for recurrent respiratory failure in the setting of significant tachycardia, hypertension likely resulting in acute pulmonary edema, metabolic acidosis with significant work of breathing for respiratory compensation, as well as a new left lower lobe pneumonia. Blood cultures and bronchoscopy with bronchoalveolar lavage was performed but all cultures remained negative. She was started on ivabradine for persistent sinus tachycardia. She had very labile hemodynamics related to infection, pain, agitation, and underlying pheochromocytoma.\n\nGiven her prolonged course and difficult to optimize clinical status, the decision was made to begin metyrosine prior to surgery as well as to pursue embolization of her mass prior to surgery. She underwent successful coil and particle embolization and the following day underwent successful laparoscopic converted to open (given size and challenging accessibility) right adrenal tumor resection (see Figures 1 and 2). Surgical pathology was consistent with adrenal pheochromocytoma with thrombi present within the tumor, accompanied by regions of necrosis. Post operatively she was initially hypotensive requiring vasopressin, neosynephrine at maximum dosing, and norepinephrine most likely due to iatrogenic catecholamine deficiency and blockade. Doxazosin, esmolol, ivabradine, and metyrosine were discontinued. Her diarrhea resolved and octreotide infusion and imodium were discontinued. Given gross hematuria thought to be from renal ischemia reperfusion injury, her anticoagulation was limited to 40 mg of lovenox nightly.\n\nFigure 1. Intraoperative photograph of pheochromocytoma.\n\nFigure 2. Intraoperative photograph of pheochromocytoma.\n\nHer post-operative course was complicated by urinary tract infection secondary to pseudomonas. Renal function improved and dialysis was able to be discontinued. She developed a pseudoaneurysm of the right femoral artery necessitating surgical repair. At her last office follow-up her symptoms had significantly improved. She was ambulating without difficulty, recovering well from being significantly deconditioned. Her kidney function was approaching baseline. She is to remain on anticoagulation for 6 months given her thromboembolic disease. Followup PET gallium scan showed no evidence of residual disease or metastasis.\n\nDiscussion\n\nHere we have presented a case of pheochromocytoma producing vasoactive intestinal peptide and associated with intracardiac thrombosis in the absence of left ventricular dysfunction or wall motion abnormalities. Pheochromocytoma producing vasoactive intestinal peptide (VIP) is exceedingly rare.5–11 Similarly, thrombosis occurring in patients with pheochromocytoma has been reported previously in only a few cases.1,12–18 We have reviewed the existing literature on these rare presentations and include two tables with recent notable cases here for reference (see Tables 1 and 2).\n\nTable 1. Cases of pheochromocytoma associated with VIP hormone production.\n\nAuthor/year\tCase presentation\toutcome\t\nSmith et al.5/2002\tPheochromocytoma producing VIP\tTreated initially with cholestyramine and Octreotide and then surgery with relief of symptoms\t\nOnozawa et al.6/2005\tGanglioneuroma-pheochromocytoma producing VIP in neurofibromatosis type 1\tSurgery with resolution of clinical and biochemical abnormalities\t\nIkuta7/2007\tPheochromocytoma producing VIP\tSurgery with resolution of clinical and biochemical abnormalities\t\nØzbay8/2008\tPheochromocytoma producing VIP and masking hypertension\tSurgery with resolution of clinical and biochemical abnormalities\t\nHu et al.9/2018\tPheochromocytoma produced VIP and persistent shock\tOctreotide reversed shock and resolved all symptoms, surgery completed thereafter\t\nJiang et al.10/2014\tPheochromocytoma produced VIP\tSurgery with resolution of clinical and biochemical abnormalities\t\nLebowitz-Amit et al.11/2014\tMalignant Pheochromocytoma producing VIP\tSurgery with resolution of symptoms. Three years later metastatic disease with exquisite clinical response to sunitinib\t\n\nTable 2. Cases of pheochromocytoma associated with intracardiac thrombus in the absence of cardiomyopathy.\n\nAuthor/year\tCase presentation\tOutcome\t\nYebra Yebra18/2005\tAcute myocardial ischemia and ventricular thrombus associated with pheochromocytoma\tComplicated by embolic stroke. Treated with surgery and anticoagulation.\t\nPishdad13/2000\tMultiple endocrine neoplasia type 2 medullary, thyroid cancer, and adrenal pheochromocytoma developed a left ventricular thrombus\tTreated surgically\t\nHou1/2011\tPheochromocytoma presenting with arterial and intracardiac thrombus\tSurgery with resolution of symptoms, anticoagulation with resolution of thrombus\t\n\nTypically VIP is produced in association with a neuroendocrine tumor, most commonly pancreatic in origin. This amino acid peptide causes secretory diarrhea by stimulating adenylate cyclase production which in turn causes intestinal secretion of water and electrolytes and leads to the syndrome of watery diarrhea associated with hypokalemia and achlorhydria (WDHA).5 In 1975 the first pheochromocytoma associated with WDHA syndrome was reported and only a handful of nonpancreatic tumors associated with the WDHA syndrome have been reported since5–11 (see Table 1). For instance, ganglioneuroma-pheochromocytoma producing VIP in Neurofibromatosis type I has been reported.6 Additionally, there has been report of malignant pheochromocytoma producing VIP.11 No pancreatic mass was seen on our patient’s CT and her diarrhea improved with the use of intravenous octreotide and Imodium. Octreotide is a somatostatin synthetic analogue which acts as an inhibitory hormone throughout the body and specifically in the case of VIP producing tumors improves diarrhea by inhibiting VIP hormone production.19,20 Our patient’s diarrhea resolved after resection of her pheochromocytoma was resected, so her VIP elevation was thought to be primarily from her pheochromocytoma.\n\nThe other unusual association our patient’s case was her cardiac thrombus. Intracardiac thrombus is typically identified in the setting of reduced ventricular contraction with a history of myocardial infarction or in the setting of a hypercoagulable state such as in the late presentation of carcinomas.21 Cardiac thrombosis associated with pheochromocytoma has only been reported in a handful of cases.1,12–18 (see Table 2). In one case, a patient with medullary thyroid cancer and adrenal pheochromocytoma developed an intracardiac thrombus and, similar to our patient, there was no evidence of ventricular wall contraction abnormalities.13 One case described a patient with a large left ventricular thrombus and a 7 cm pheochromocytoma in which the patient developed systemic embolization leading to kidney infarction and lower extremity infarction requiring bilateral below-the-knee amputation.17 While pro-coagulant factors secreted by the pheochromocytoma are postulated to be contributing factors, definite underlying coagulation defects have rarely been identified.1 It is likely that catecholamines and other hormones, cytokine or factors secreted by the pheochromocytoma may play an important role in the pathogenesis of thrombosis in the absence of a predisposing coagulation disorder.1 The thrombosis in our patient is likely related to her pheochromocytoma especially given her unrevealing hypercoagulability workup.\n\nConclusion\n\nDevastating consequences can occur if pheochromocytomas are not recognized and treated appropriately. VIP producing pheochromocytoma is a rare entity. Moreover, concomitant thrombosis with pheochromocytoma is rare and the exact mechanism of thrombosis is not well understood. We report a case of VIP producing pheochromocytoma associated with left ventricular thrombus. This case highlights the association of pheochromocytoma with VIP hormone production and treatment with octreotide infusion in addition to pheochromocytoma associated with LV thrombus and embolic complications. As with other case reports, we aim to remind clinicians of the possibility for VIP hormone production by pheochromocytomas5–11 and the pro-thrombotic state in patients with pheochomocytoma.1,12–18 As with our case, octreotide infusion may be helpful in managing the secretory diarrhea associated with VIP hormone production, and anticoagulation should be initiated early on to avoid cardioembolic events. With prompt vigilant management, morbidity and mortality may be significantly reduced.\n\nPatient perspective\n\nBefore being diagnosed with a pheochromocytoma, I spent almost ten years with doctors who brushed off my symptoms as stress-induced. I went to therapy and was diagnosed as having panic disorder, but with only the physical symptoms. The episodes became worse overtime to where I was experiencing them almost every day at varying degrees of severity, sometimes leaving me bedridden. Since the surgery I have not experienced any episodes and can live without the fear of another crippling “panic attack”. Although there were many complications and there is still numbness from the surgery, I am extremely happy with how everything turned out.\n\nAuthor Contributions: Dr. Hermel wrote the first draft of the manuscript. All authors reviewed and edited the manuscript and approved the final version of the manuscript.\n\nDeclaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nFunding: The author(s) received no financial support for the research, authorship, and/or publication of this article.\n\nEthical approval: Scripps Clinic does not require ethical approval for reporting individual cases.\n\nInformed Consent: Written informed consent was obtained from the patient for publication of this anonymised case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nORCID iD: Melody Hermel https://orcid.org/0000-0002-4840-4990\n==== Refs\nReferences\n\n1. Hou R Leathersich AM Ruud BT. Pheochromocytoma presenting with arterial and intracardiac thrombus in a 47-year-old woman: a case report. J Med Case Rep 2011; 5 : 310.21752274\n2. Pacak K Linehan WM Eisenhofer G , et al . Recent advances in genetics, diagnosis, localization, and treatment of pheochromocytoma. In: Annals of internal medicine. vol. 134 . American College of Physicians, 2001, pp.315–329.11182843\n3. Štrauch B Zelinka T Hampf M , et al . Prevalence of primary hyperaldosteronism in moderate to severe hypertension in the Central Europe region. J Hum Hypertens 2003; 17 (5 ): 349–352.12756408\n4. Widimský J. Recent advances in the diagnosis and treatment of pheochromocytoma. Kidney Blood Press Res 2006; 29 (5 ): 321–326.17119341\n5. Smith SL Slappy ALJ Fox TP , et al . Pheochromocytoma producing vasoactive intestinal peptide. Mayo Clin Proc 2002; 77 (1 ): 97–100.11795252\n6. Onozawa M Fukuhara T Minoguchi M , et al . Hypokalemic rhabdomyolysis due to WDHA syndrome caused by VIP-producing composite pheochromocytoma: a case in neurofibromatosis type 1. Jpn J Clin Oncol 2005; 35 (9 ): 559–563.16027147\n7. Ikuta S. Watery diarrhea, hypokalemia and achlorhydria syndrome due to an adrenal pheochromocytoma. World J Gastroenterol 2007; 13 (34 ): 4649.17729424\n8. Øzbay L Obukhau A Buhl L , et al . Adrenal pheochromocytoma producing vasoactive intestinal peptide and masking hypertension. Horm Res 2008; 70 : 188–192.18663320\n9. Hu X Cao W Zhao M. Octreotide reverses shock due to vasoactive intestinal peptide-secreting adrenal pheochromocytoma: a case report and review of literature. World J Clin Cases 2018; 6 (14 ): 862–868.30510956\n10. Jiang J Zhang L Wu Z , et al . A rare case of watery diarrhea, hypokalemia and achlorhydria syndrome caused by pheochromocytoma. BMC Cancer 2014; 14 : 553.25081061\n11. Leibowitz-Amit R Lebowitz-Amit R Mete O , et al . Malignant pheochromocytoma secreting vasoactive intestinal peptide and response to sunitinib: a case report and literature review. Endocr Pract 2014; 20 (8 ): e145–e150.24936559\n12. Heindel SW Maslow AD Steriti J , et al . A patient with intracardiac masses and an undiagnosed pheochromocytoma. J Cardiothorac Vasc Anesth 2002; 16 (3 ): 338–343.12073207\n13. Pishdad GR. Ventricular thrombosis in Sipple’s syndrome. South Med J 2009; 93 (11 ): 1093–1095.\n14. Shulkin BL Shapiro B Sisson JC. Pheochromocytoma, polycythemia and venous thrombosis. Am J Med 1987; 83 (4 ): 773–776.3674065\n15. Paola Stella Giancarlo Bignotti Simona Zerbi , et al . Concurrent pheochromocytoma, diabetes insipidus and cerebral venous thrombosis—a possible unique pathophysiological mechanism. Nephrol Dial Transplant 2000; 15 (5 ): 717–718.10809818\n16. Stevenson S Ramani V Nasim A. Extra-adrenal pheochromocytoma: an unusual cause of deep vein thrombosis. J Vasc Surg 2005; 42 (3 ): 570–572.16171610\n17. Zhou W Ding SF. Concurrent pheochromocytoma, ventricular tachycardia, left ventricular thrombus, and systemic embolization. Intern Med 2009; 48 (12 ): 1015–1019.19525590\n18. Yebra Yebra M Martín Asenjo R Arrue I , et al . Isquemia miocárdica aguda y trombosis ventricular asociadas a feocromocitoma [Acute myocardial ischemia and ventricular thrombus associated with pheochromocytoma]. Rev Esp Cardiol 2005; 58 (5 ): 598–600.15899204\n19. Murphy E Prommer EE Mihalyo M , et al . Octreotide. J Pain Symptom Manage 2010; 40 (1 ): 142–148.21634046\n20. Katz MD Erstad BL. Octreotide, a new somatostatin analogue. Clin Pharm 1989; 8 (4 ): 255–273.2653711\n21. Zwicker JI Furie BC Furie B. Cancer-associated thrombosis. Crit Rev Oncol Hematol 2007; 62 (2 ): 126–136.17293122\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2036-3605",
"issue": "13()",
"journal": "Rare tumors",
"keywords": "Thrombus; hypercoagulability; pheochromocytoma; vasoactive intestinal peptide",
"medline_ta": "Rare Tumors",
"mesh_terms": null,
"nlm_unique_id": "101526926",
"other_id": null,
"pages": "20363613211007792",
"pmc": null,
"pmid": "33889374",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "17729424;16027147;21752274;25081061;11182843;11095560;12073207;3674065;30510956;12756408;17119341;16171610;10809818;2653711;11795252;21634046;18663320;15899204;17293122;24936559;19525590",
"title": "Vasoactive intestinal peptide producing pheochromocytoma and intracardiac thrombosis.",
"title_normalized": "vasoactive intestinal peptide producing pheochromocytoma and intracardiac thrombosis"
} | [
{
"companynumb": "US-AMGEN-USASP2021149227",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IVABRADINE"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nTo assess the frequency and types of adverse events (AEs) related to intrathecal baclofen (ITB) therapy in adults, and associated risk factors.\n\n\nMETHODS\nA prospective, observational cohort study of adults followed up from January 1 to December 31, 2010.\n\n\nMETHODS\nA neurologic rehabilitation department in a university hospital.\n\n\nMETHODS\nAll consecutive adult subjects (N=158) receiving ITB via a pump, either implanted or followed up during the study period.\n\n\nMETHODS\nNot applicable.\n\n\nMETHODS\nFrequency and type of AEs.\n\n\nRESULTS\nIn 2010, 158 subjects were followed up for ITB therapy, of whom 128 were implanted before 2010 (nonsurgical subjects), and 30 underwent implantation in 2010 (surgical subjects). Of these 30 subjects, 20 were \"newly implanted\" and 10 were \"replacements.\" The most frequent pathologic disorders were spinal cord injury (42%) and multiple sclerosis (28%). Twenty-eight subjects (18%) experienced a total of 38 AEs. The rate of AEs was .023 per month of ITB treatment. AEs were related to the surgical procedure in 53% of cases, to the device in 29% (predominantly catheter dysfunctions), and to adverse effects of baclofen in 18%. AEs related to the surgical incision (scar complications and collections) were more frequent in replacement than newly implanted subjects (P=.009). No significant association between occurrence of an AE and subject characteristics (age, gait capacity, spinal vs cerebral spasticity, duration of ITB therapy follow-up) was found. Nearly half of the AEs were serious, extending admission time by a mean of 16 days. No AE induced long-term morbidity or death.\n\n\nCONCLUSIONS\nThe AE rate was relatively low in this cohort. This has to be balanced against the clinical, functional, and quality-of-life improvements, which are expected from ITB therapy.",
"affiliations": "Department of Physical Medicine and Rehabilitation, Raymond Poincaré Hospital, Garches, France; Department of Physical Medicine and Rehabilitation, Percy Military Hospital, Clamart, France. Electronic address: leoborrini@yahoo.fr.;Department of Physical Medicine and Rehabilitation, Raymond Poincaré Hospital, Garches, France; Versailles Saint Quentin en Yvelines University, Versailles, France.;Department of Neurosurgery, Fondation Rothschild Hospital, Paris, France.;Department of Physical Medicine and Rehabilitation, Raymond Poincaré Hospital, Garches, France.;Department of Physical Medicine and Rehabilitation, Raymond Poincaré Hospital, Garches, France.;Department of Physical Medicine and Rehabilitation, Raymond Poincaré Hospital, Garches, France; Versailles Saint Quentin en Yvelines University, Versailles, France.",
"authors": "Borrini|Léo|L|;Bensmail|Djamel|D|;Thiebaut|Jean-Baptiste|JB|;Hugeron|Caroline|C|;Rech|Célia|C|;Jourdan|Claire|C|",
"chemical_list": "D009125:Muscle Relaxants, Central; D001418:Baclofen",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-9993",
"issue": "95(6)",
"journal": "Archives of physical medicine and rehabilitation",
"keywords": "Adverse drug event; Baclofen; Infusion pumps, implantable; Muscle spasticity; Rehabilitation",
"medline_ta": "Arch Phys Med Rehabil",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D017677:Age Distribution; D000368:Aged; D001418:Baclofen; D002547:Cerebral Palsy; D004305:Dose-Response Relationship, Drug; D004334:Drug Administration Schedule; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D015994:Incidence; D015918:Infusion Pumps, Implantable; D007278:Injections, Spinal; D008134:Long-Term Care; D008297:Male; D008875:Middle Aged; D009103:Multiple Sclerosis; D009125:Muscle Relaxants, Central; D009128:Muscle Spasticity; D011446:Prospective Studies; D012720:Severity of Illness Index; D017678:Sex Distribution; D013119:Spinal Cord Injuries; D018709:Statistics, Nonparametric; D013997:Time Factors; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "2985158R",
"other_id": null,
"pages": "1032-8",
"pmc": null,
"pmid": "24407102",
"pubdate": "2014-06",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Occurrence of adverse events in long-term intrathecal baclofen infusion: a 1-year follow-up study of 158 adults.",
"title_normalized": "occurrence of adverse events in long term intrathecal baclofen infusion a 1 year follow up study of 158 adults"
} | [
{
"companynumb": "FR-MYLANLABS-2015M1020744",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "BACLOFEN"
},
"drugadditional": null,
... |
{
"abstract": "Oral mucositis is a debilitating manifestation in children undergoing chemotherapy and radiotherapy. Children with mucositis should be properly managed in order to prevent further exacerbation and adverse complications. We hereby present the first report of a severe chemotherapy-induced mucositis, plausibly aggravated by improper dental hygiene leading to shedding of the ventral part of the tongue in a child with pre-B acute lymphoblastic leukemia (ALL). The patient steadily and gradually recovered her oral maneuvers and ability to speak several months later. Her tongue underwent hypertrophy as a compensatory mechanism. We recommend that critical and regular assessment of the oral mucosa and proper dental care and oral hygiene be emphasized in all pediatric patients receiving chemotherapy. Families of affected children need to be educated about the benefits and modes of optimal oral hygiene for their children and the need to seek immediate care for mouth pain and or lesions. Optimal treatment for mucositis needs to be instituted without delay in this high risk pediatric population. Such a preventive and therapeutic approach may prevent associated life threatening oral and systemic complications, promote rapid and complete mucosal healing, alleviate pain and improve quality of life in children with cancer.",
"affiliations": "School of Medicine, Lebanese American University, Byblos, Lebanon ; Division of Pediatric Hematology Oncology, Rafic Hariri University Hospital, Beirut, Lebanon.;Division of Pediatric Hematology Oncology, Rafic Hariri University Hospital, Beirut, Lebanon.;Faculty of Medicine, American University of Beirut, Beirut, Lebanon.",
"authors": "Inati|Adlette|A|;Akouri|Grace|G|;Abbas|Hussein A|HA|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.12688/f1000research.2-196.v1",
"fulltext": "\n==== Front\nF1000ResF1000ResF1000ResearchF1000Research2046-1402F1000Research London, UK 10.12688/f1000research.2-196.v1Case ReportArticlesPediatric OncologyPreventive MedicineA rare aggravation of severe mucositis post chemotherapy in a child with acute lymphoblastic leukemia v1; ref status: indexed\n\nInati Adlette a12Akouri Grace 2Abbas Hussein A 31 School of Medicine, Lebanese American University, Byblos, Lebanon2 Division of Pediatric Hematology Oncology, Rafic Hariri University Hospital, Beirut, Lebanon3 Faculty of Medicine, American University of Beirut, Beirut, Lebanona adlette.inati@lau.edu.lbDr. Inati and Dr. Akouri diagnosed, followed up the patient and reviewed the manuscript. Dr. Abbas followed up on the case and wrote the manuscript.\n\n\nCompeting interests: No competing interests were disclosed.\n\n24 9 2013 2013 2 19616 9 2013 Copyright: © 2013 Inati A et al.2013This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Data associated with the article are available under the terms of the Creative Commons Zero \"No rights reserved\" data waiver (CC0 1.0 Public domain dedication).Oral mucositis is a debilitating manifestation in children undergoing chemotherapy and radiotherapy. Children with mucositis should be properly managed in order to prevent further exacerbation and adverse complications. We hereby present the first report of a severe chemotherapy-induced mucositis, plausibly aggravated by improper dental hygiene leading to shedding of the ventral part of the tongue in a child with pre-B acute lymphoblastic leukemia (ALL). The patient steadily and gradually recovered her oral maneuvers and ability to speak several months later. Her tongue underwent hypertrophy as a compensatory mechanism. We recommend that critical and regular assessment of the oral mucosa and proper dental care and oral hygiene be emphasized in all pediatric patients receiving chemotherapy. Families of affected children need to be educated about the benefits and modes of optimal oral hygiene for their children and the need to seek immediate care for mouth pain and or lesions. Optimal treatment for mucositis needs to be instituted without delay in this high risk pediatric population. Such a preventive and therapeutic approach may prevent associated life threatening oral and systemic complications, promote rapid and complete mucosal healing, alleviate pain and improve quality of life in children with cancer.\n\nThe author(s) declared that no grants were involved in supporting this work.\n==== Body\nCase report\nWe report a 5-year old female with average risk (AR1) pre-B acute lymphoblastic leukemia (ALL) who presented with severe oral mucosal pain and fever of 38.7\noC on day 22 induction (EORTC Children’s Leukemia Group protocol AR1 shown in\nTable 1).\n\nTable 1. EORTC Children’s Leukemia Group Protocol AR1.\n\nDrugs\n\t\nDose\n\t\nRoute\n\t\nNumber of days/doses\n\t\nDays\n\t\n\nMethotrexate\n\t12 mgs\tIT\t1\t1\t\n\nPrednisone\n\t60 mg/m2/day\tPO\t28\t1 to 28\t\n\nVincristine\n\t1.5 mg/m2\tIV\t4\t8,15,22 and 29\t\n\nDaunorubicin\n\t30 mg/m2\tIV\t4\t8,15,22 and 29\t\n\nL-Asparaginase\n\t10,000 U/m2\tIM\t8\t12,15,18,22,25,29,32 and 35\t\n\nMethotrexate\n\n\nHydrocortisone\n\n\nCytosine Arabinoside\n\t12 mg\n\n15 mg\n\n30 mg\tIT\n\nIT\n\nIT\t2\n\n2\n\n2\t8,22\n\n8,22\n\n8,22\t\nOn physical exam, the patient was sick-looking, lethargic and moderately pale. Her vital signs were: temperature = 38.7\noC, HR = 120/min, RR = 24/min and BP = 90/60 mm Hg. Her weight was 12.2 kg (<3\nrd % for her age) and her height was 110 cm (75% for her age). Her conjunctivae were mildly injected and her sclerae were non icteric. The oral cavity showed diffuse dental caries, severe mucosal erythema with whitish membranes and multiple necrotic and hemorrhagic lesions in the tongue, buccal mucosa and lower lip (\nFigure 1). She was unable to drink fluids or eat solid food (WHO mucositis stage IV)\n1. Her heart sounds were regular; a GII/VI systolic hemic murmur was heard all over the precordium. Lungs were clear and resonant. Abdomen was soft, non-tender with no hepatosplenomegaly or masses or ascites. There was no pathologic lymphadenopathy. Femoral pulses were symmetrical bilaterally and there was no peripheral edema. Neurologic exam, fundoscopy and skeletal exams were all normal. Laboratory tests upon admission showed severe neutropenia with moderate anemia and thrombocytopenia, increased prothrombin time (PT), partial thromboplastin time (PTT) and low fibrinogen (\nTable 2).\n\nTable 2. Laboratory results at presentation with fever and severe oral pain.\n\nLab test\n\t\nLab results\n\t\nNormal values\n\t\nWhite blood cell count\t0.8 x 10\n9/L\t4-11 x 10\n9/L\t\nHemoglobin\t7.8 g/dl\t11.5–12.5 g/dL\t\nPlatelets\t28 x 10\n9/L\t150–400 x 10\n9/L\t\nProthrombin time\t55.5 sec\t9.8–12.7 sec\t\nINR\t1.43\t0.85–1.2\t\nPartial thromboplastin time\t54.2 sec\t30–40 sec\t\nFibrinogen\t<0.5 g/L\t1.8–3.5 g/L\t\nD-DIMER\t158 µg/L\t63.8–246.4 µg/L\t\nGlucose\t80,87 mg/dL\t60–100 mg/dL\t\nSodium\t129 mmol/L\t135–145 mmol/L\t\nPotassium\t3.58 mmol/L\t3.5–5.1 mmol/L\t\nCalcium\t7.92 mg/dL\t8.5–10.5 mg/dL\t\nPhosphorus\t1.45 mg/dL\t4–7 mg/dL\t\nMagnesium\t1.81 m/dL\t1.71–2.29 mg/dL\t\nSGOT\t39.6 IU/L\t0–50 IU/L\t\nSGPT\t37.2 IU/L\t0–50 IU/L\t\nGGT\t30.2 IU/L\t7–64 IU/L\t\nAlbumin/total protein\t26.85 g/L/43.3 g/L\t38–54g/L/60–80 g/L\t\nINR = International normalized ratio\n\nSGOT = serum glutamic oxaloacetic transaminase\n\nSGPT = serum glutamic-pyruvic transaminase\n\nGGT =\ngamma-glutamyl transpeptidase\n\n\nFigure 1. Patient’s oral mucosa showing erythema and necrosis at time of presentation with oral mucosal pain and fever.\nThe patient was started on intravenous cefepime (150 mg/Kg/d), vancomycin (60 mg/Kg/d), fluconazole (12 mg/Kg/d on day 1 followed by 6 mgs/Kg/d afterwards), topical mycostatin, 0.12% chlorhexidine mouthwash, adequate hydration and IV analgesia (perfelgan 15 mg/Kg given q6 hours). She also received vitamin K, platelet transfusion and fresh frozen plasma. On hospitalization day 3, the patient was still febrile with progressive mucositis and no oral intake. Micafungin 2.5 mg/Kg/day was started and fluconazole was discontinued. Total parenteral nutrition (TPN) was also initiated and packed red blood cell and platelet transfusions were continued as needed. On day 4, admission cultures of the lesions of the tongue and buccal mucosa grew\nCandida albicans and coagulase-negative staphylococci while blood culture was negative.\n\nThe patient was steadily but slowly improving when on hospitalization day 6, she had an unexpected spontaneous shedding of the ventral part of her tongue (\nFigure 2). Pathological analysis of the detached tongue confirmed necrosis and bacterial and fungal cultures were negative. Her speech and feeding were further impeded by this trauma. The patient was continued on IV imipenem (100 mg/Kg/d), vancomycin (60 mg/Kg/d), amikacin (20 mg/Kg/d) and fluconazole (12 mg/Kg/day day 1 followed by 6 mgs/Kg/day afterwards) antimicrobials and TPN. A psychology consultation was offered to the parents and the patient. On hospitalization day 13, her mucositis resolved and her oral food and fluid intake gradually recovered. Chemotherapy was initiated on hospitalization day 17 with no complications and the patient was discharged on day 22 in good condition. The family was instructed to adhere to the recommended daily oral care regimen consisting of topical mycostatin (100,000 unit/g applied BID), 0.12% chlorhexidine mouthwash, gentle tooth brushing and adequate oral hydration.\n\nFigure 2. Shedding off the ventral part of the tongue.\nEight months after the incident, the patient recovered her ability to undergo oral maneuvers and her articulation steadily and progressively improved. Her tongue underwent compensatory hypertrophy (\nFigure 3). She continues, though, to have slightly unintelligible speech at times. Currently, the patient is in complete remission and receiving her maintenance chemotherapy.\n\nFigure 3. Tongue recovery 8 months after management.\nDiscussion\nLeukemia and its treatment can adversely affect oral health. Leukemic cells are capable of infiltrating the gingiva and the deeper periodontal tissues resulting in local ulceration and infection. Mucosal cells are susceptible to chemotherapy due to their high mitotic rate\n2. Oral mucositis is the most frequent and debilitating complication of chemotherapy in children with cancer and can be associated with serious morbidities and increased risk of infection\n2–\n4.\n\nThe decreased salivary flow rate, salivary pH and total salivary antioxidant levels in leukemic children compared to controls can lead to further deterioration in their oral health status, gingival status and increased dental caries\n3,\n4. Our patient suffered from poor dental hygiene and severe dental caries when diagnosed with pre-B ALL (\nFigure 4). Oxidative stress per se may result in the onset of inflammatory oral pathologies. Saliva constitutes the first line of defense against free radical-mediated oxidative stress\n4. The biological manifestations of mucositis include a surge in lipopolysaccharides or endotoxins which activate macrophages and other mononuclear cells leading to production of nitric oxide, tumor necrosis factor (TNF), interleukin-6 (IL-6) and other cytokines\n5,\n6.\n\nFigure 4. Dental caries at time of acute lymphoblastic leukemia diagnosis.\nTo our knowledge, this is the first report of very severe chemotherapy-induced mucositis leading to shedding of a part of the tongue. We hypothesize other factors in this patient may have led to this fulminant and unique clinical presentation. The poor oral hygiene and the advanced dental caries the patient had at the time of ALL diagnosis could have contributed to the flare up of chemotherapy induced mucositis and to the shedding of part of the tongue. This hypothesis conforms to the previously reported association of exacerbated oral mucositis with trauma from the teeth\n4. The degree of severity leading to tongue shedding in this patient was, however, remarkable. Notably, the tongue recovery and hypertrophic sublingual tissue seen in this patient 8 months after the incident are not unexpected and are a result of intrinsic tissue compensatory mechanisms which aided the patient in using her tongue for eating and speaking.\n\nChildren receiving chemotherapy should have critical and regular assessment of their oral mucosa before, during and after treatment. There are several oral assessment rating scales that can be used in cancer patients receiving chemotherapy such as the Oral Assessment Guide (OAG), Oral Mucositis Index (OMI) and Oral Mucositis Assessment Scale (OMAS)\n7. While OAG addresses the oral functionality and tissue keratinization, the OMAS and OMI focus on the degree of tissue abrogation\n7.\n\nCareful oral management of children with cancer is critical and aims at preventing and treating mucositis and secondary infections as well as relieving pain and improving quality of life. An oral care protocol consisting of daily mouth rinsing with 0.12% chlorhexidine and tooth-brushing has been found to significantly decrease the incidence of ulcerative lesions, severity of oral mucositis and the related pain intensity compared to controls in pediatric cancer patients\n8. In infants and very young children who are unable to rinse, care-givers need to use the chlorhexidine or its equivalent as an oral swab.\n\nConclusion\nThis case represents a very severe chemotherapy-induced mucositis leading to a unique and previously unreported complication in a child with leukemia. It illustrates the fact that critical and regular assessment of the oral mucosa and proper dental care and oral hygiene are mandatory in all pediatric patients receiving chemotherapy. Physicians caring for children with cancer need to be aware of this rare complication and educate families about the benefits and modalities of optimal oral hygiene and the need to immediately report to their child’s health provider for mouth pain and or lesions. Additionally, vigilant treatment of mucositis needs to be instituted without delay in this high risk patient population. Such a preventive and therapeutic approach may prevent life threatening oral and systemic complications, promote mucosal healing and potentiate the hypertrophic compensatory action of linguinal cells thereby ensuring rapid and complete recovery.\n\nConsent\nWritten informed consent for publication of clinical details and clinical images was obtained from the patient’s legal guardian.\n\nReferee response for version 1 Stary Jan 1Referee1 Department of Pediatric Hematology and Oncology, University Hospital Motol, Prague, Czech Republic\nCompeting interests: No competing interests were disclosed.\n\n25 9 2013 Version 1recommendationapproveThe authors present the unusually severe complication of mucositis developed during the induction treatment of acute lymphoblastic leukemia. They stress the need for education of family and patients about the importance of oral hygiene during the intensive chemotherapy. The paper is well written and documented.\n\nI have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.\n\nReferee response for version 1 Razzouk Bassem 1Referee1 Children's Center for Cancer and Blood Diseases, Peyton Manning Children's Hospital, Indianapolis, Indiana, USA\nCompeting interests: No competing interests were disclosed.\n\n24 9 2013 Version 1recommendationapproveThis is a very well written case report about severe oral mucositis in a patient with ALL receiving induction therapy. The existing severe dental caries present at the diagnosis of ALL most likely contributed to the severity of the condition, which was managed appropriately and aggressively.\n\nI have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.\n==== Refs\n1 WHO: Handbook for reporting results of cancer treatment. Geneva, Switzerland: World Health Organization .1979 ;45 \nReference Source\n2 Schwab M Zanger UM Marx C :\nRole of genetic and nongenetic factors for fluorouracil treatment-related severe toxicity: a prospective clinical trial by the German 5–FU Toxicity Study Group. J Clin Oncol. 2008 ;26 (13 ):2131 –2138 \n10.1200/JCO.2006.10.4182 18299612 \n3 Hegde AM Joshi S Rai K :\nEvaluation of oral hygiene status, salivary characteristics and dental caries experience in acute lymphoblastic leukemic (ALL) children. J Clin Pediatr Dent. 2011 ;35 (3 ):319 –323 \n21678678 \n4 Raber-Durlacher JE Elad S Barasch A :\nOral mucositis. Oral Oncol. 2010 ;46 (6 ):452 –456 \n10.1016/j.oraloncology.2010.03.012 20403721 \n5 Gifford GE Lohmann-Matthes ML :\nGamma interferon priming of mouse and human macrophages for induction of tumor necrosis factor production by bacterial lipopolysaccharide. J Natl Cancer Inst. 1987 ;78 (1 ):121 –124 \n3099049 \n6 Sonis ST :\nMucositis as a biological process: a new hypothesis for the development of chemotherapy-induced stomatotoxicity. Oral Oncol. 1998 ;34 (1 ):39 –43 \n10.1016/S1368-8375(97)00053-5 9659518 \n7 Eilers J Million R :\nPrevention and management of oral mucositis in patients with cancer. Semin Oncol Nurs. 2007 ;23 (3 ):201 –212 \n10.1016/j.soncn.2007.05.005 17693347 \n8 Cheng KK Molassiotis A Chang AM :\nEvaluation of an oral care protocol intervention in the prevention of chemotherapy-induced oral mucositis in paediatric cancer patients. Eur J Cancer. 2001 ;37 (16 ):2056 –2063 \n10.1016/S0959-8049(01)00098-3 11597384\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2046-1402",
"issue": "2()",
"journal": "F1000Research",
"keywords": null,
"medline_ta": "F1000Res",
"mesh_terms": null,
"nlm_unique_id": "101594320",
"other_id": null,
"pages": "196",
"pmc": null,
"pmid": "24555093",
"pubdate": "2013",
"publication_types": "D016428:Journal Article",
"references": "20403721;18299612;9659518;11597384;17693347;3099049;21678678",
"title": "A rare aggravation of severe mucositis post chemotherapy in a child with acute lymphoblastic leukemia.",
"title_normalized": "a rare aggravation of severe mucositis post chemotherapy in a child with acute lymphoblastic leukemia"
} | [
{
"companynumb": "LB-RANBAXY-2013R1-76230",
"fulfillexpeditecriteria": "1",
"occurcountry": "LB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "Strong cytochrome P450 (CYP) 3A4 inhibitors may induce Cushing syndrome and subsequent adrenal insufficiency when administered concurrently with corticosteroids. This drug-drug interaction has been well described with HIV protease inhibitors. A similar drug-drug interaction with corticosteroids and other strong CYP 3A4 inhibitors (antifungals [imidazoles]) has recently been reported but remains less well known. To our knowledge, we report the first case of probable drug-induced Cushing syndrome with subsequent adrenal insufficiency as a result of concomitant oral voriconazole with intranasal mometasone and inhaled fluticasone administration as well as a review of the current literature supporting this drug-drug interaction.",
"affiliations": "1 Department of Pharmacy, Medical College of Virginia Hospitals, Virginia Commonwealth University Health System, Richmond, VA, USA.;2 Department of Pharmacy, Division of Infectious Diseases, Medical College of Virginia Hospitals, Virginia Commonwealth University Health System, Richmond, VA, USA.",
"authors": "Duman|Amanda K|AK|;Fulco|Patricia Pecora|PP|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D000935:Antifungal Agents; D065692:Cytochrome P-450 CYP3A Inhibitors; D065819:Voriconazole",
"country": "United States",
"delete": false,
"doi": "10.1177/0897190016646510",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0897-1900",
"issue": "30(4)",
"journal": "Journal of pharmacy practice",
"keywords": "Cushing syndrome; adrenal insufficiency; fluticasone; mometasone; voriconazole",
"medline_ta": "J Pharm Pract",
"mesh_terms": "D000280:Administration, Inhalation; D000305:Adrenal Cortex Hormones; D000309:Adrenal Insufficiency; D000935:Antifungal Agents; D003480:Cushing Syndrome; D065692:Cytochrome P-450 CYP3A Inhibitors; D004347:Drug Interactions; D005260:Female; D006801:Humans; D008875:Middle Aged; D065819:Voriconazole",
"nlm_unique_id": "8900945",
"other_id": null,
"pages": "459-463",
"pmc": null,
"pmid": "27147607",
"pubdate": "2017-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review; D000078182:Systematic Review",
"references": null,
"title": "Adrenal Insufficiency With Voriconazole and Inhaled/Intranasal Corticosteroids: Case Report and Systematic Review.",
"title_normalized": "adrenal insufficiency with voriconazole and inhaled intranasal corticosteroids case report and systematic review"
} | [
{
"companynumb": "US-AKORN PHARMACEUTICALS-2018AKN00613",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "VORICONAZOLE"
},
"drugadditional"... |
{
"abstract": "The authors report two unusual cases of Bickerstaff encephalitis that presented with encephalopathy and severe agitation. Management with neuroleptics typically used for management of delirium was not effective and worsened agitation. Valproic acid was effective in treatment of agitation and well tolerated.",
"affiliations": null,
"authors": "Alam|Abdulkader|A|;Puri|Neil V|NV|",
"chemical_list": "D014150:Antipsychotic Agents",
"country": "United States",
"delete": false,
"doi": "10.1176/appi.neuropsych.13040078",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0895-0172",
"issue": "26(2)",
"journal": "The Journal of neuropsychiatry and clinical neurosciences",
"keywords": null,
"medline_ta": "J Neuropsychiatry Clin Neurosci",
"mesh_terms": "D014150:Antipsychotic Agents; D001933:Brain Stem; D003693:Delirium; D004569:Electroencephalography; D004660:Encephalitis; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D011595:Psychomotor Agitation",
"nlm_unique_id": "8911344",
"other_id": null,
"pages": "176-8",
"pmc": null,
"pmid": "24763765",
"pubdate": "2014-04-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Inefficacy of antipsychotics in treatment of delirium and agitation in two cases of bickerstaff brainstem encephalitis.",
"title_normalized": "inefficacy of antipsychotics in treatment of delirium and agitation in two cases of bickerstaff brainstem encephalitis"
} | [
{
"companynumb": "US-JNJFOC-20140613430",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "HALOPERIDOL"
},
"drugadditional": null,
... |
{
"abstract": "Ustekinumab, a monoclonal antibody that binds to the shared p40 subunit of interleukin (IL)-12 and IL-23, is approved in the USA and Europe for moderate to severe plaque psoriasis. There are concerns that biologic treatments like ustekinumab may lead to an increased rate of infections. We report a 77-year-old woman who developed varicella zoster virus meningitis 8 weeks after initiation of ustekinumab therapy because of plaque psoriasis. She presented clinically with sudden onset of fatigue, vertigo, nausea and epileptic seizures. Investigations of the cerebrospinal fluid revealed 522/3 cells, lactate 2.9 mmol/L, protein 232 mg/dL and 2.4 × 103 varicella zoster virus. After 3 weeks of therapy with acyclovir she recovered. We conclude that infection by varicella zoster virus has to be considered as a differential diagnosis in patients with newly developing neurological or psychiatric abnormalities under immunosuppressive therapy.",
"affiliations": "Krankenanstalt Rudolfstiftung, Wien, Austria.;Krankenanstalt Rudolfstiftung, Wien, Austria.",
"authors": "Stöllberger|Claudia|C|;Finsterer|Josef|J|",
"chemical_list": "D003879:Dermatologic Agents; D000069549:Ustekinumab",
"country": "England",
"delete": false,
"doi": "10.1111/1346-8138.13755",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-2407",
"issue": "44(6)",
"journal": "The Journal of dermatology",
"keywords": "immunosuppression; meningitis; seizure; ustekinumab; varicella zoster virus",
"medline_ta": "J Dermatol",
"mesh_terms": "D000368:Aged; D003879:Dermatologic Agents; D005260:Female; D006801:Humans; D007165:Immunosuppression Therapy; D008587:Meningitis, Viral; D011565:Psoriasis; D000069549:Ustekinumab; D000073618:Varicella Zoster Virus Infection",
"nlm_unique_id": "7600545",
"other_id": null,
"pages": "703-705",
"pmc": null,
"pmid": "28150333",
"pubdate": "2017-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Varicella zoster virus meningitis under ustekinumab because of plaque psoriasis.",
"title_normalized": "varicella zoster virus meningitis under ustekinumab because of plaque psoriasis"
} | [
{
"companynumb": "AT-JNJFOC-20170214115",
"fulfillexpeditecriteria": "1",
"occurcountry": "AT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "USTEKINUMAB"
},
"drugadditional": "1",
... |
{
"abstract": "Hydroxychloroquine is used in the long-term therapy of systemic lupus erythematosus (SLE). Although considered to be a safe treatment, side effects have been documented. An uncommon side effect is thrombocytopenia. In order to establish the diagnosis of thrombocytopenia secondary to Hydroxychloroquine, non-pharmacological causes must be ruled out and it is necessary to determine a recurrence after re-exposure to the drug. We present one case of severe thrombocytopenia occurring in a patient with SLE undergoing treatment with Hydroxychloroquine.",
"affiliations": "Servicio de Medicina Interna, Hospital Moisès Broggi, Sant Joan Despí Barcelona, Barcelona, España. Electronic address: vanesa.anton.v@gmail.com.;Servicio de Medicina Interna, Hospital Moisès Broggi, Sant Joan Despí Barcelona, Barcelona, España.;Servicio de Reumatología, Hospital Moisès Broggi, Sant Joan Despí, Barcelona, España.;Servicio de Nefrología, Hospital Moisès Broggi, Sant Joan Despí, Barcelona, España.",
"authors": "Antón Vázquez|Vanesa|V|;Pascual|Luis|L|;Corominas|Héctor|H|;Giménez Torrecilla|Isabel|I|",
"chemical_list": "D018501:Antirheumatic Agents; D006886:Hydroxychloroquine",
"country": "Spain",
"delete": false,
"doi": "10.1016/j.reuma.2016.04.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1699-258X",
"issue": "13(5)",
"journal": "Reumatologia clinica",
"keywords": "Hidroxicloroquina; Hydroxychloroquine; Lupus eritematoso sistémico; Systemic lupus erythematosus; Thrombocytopenia; Trombocitopenia",
"medline_ta": "Reumatol Clin",
"mesh_terms": "D000328:Adult; D018501:Antirheumatic Agents; D006801:Humans; D006886:Hydroxychloroquine; D008180:Lupus Erythematosus, Systemic; D008297:Male; D012008:Recurrence; D013921:Thrombocytopenia",
"nlm_unique_id": "101293923",
"other_id": null,
"pages": "294-296",
"pmc": null,
"pmid": "27263963",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Relapsed hydroxychloroquine induced thrombocytopenia in a systemic lupus erythematosus patient.",
"title_normalized": "relapsed hydroxychloroquine induced thrombocytopenia in a systemic lupus erythematosus patient"
} | [
{
"companynumb": "PHHY2017ES134576",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "MYCOPHENOLIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "Thrombocytopenia absent radius (TAR) syndrome is a rare congenital disorder that is consistently associated with skeletal abnormality and thrombocytopenic haemorrhage. This is a case of a neonate with bilateral absent radius and thrombocytopenia. The rarity of this case prompted this report.",
"affiliations": "Department of Radiology, Lautech Teaching Hospital Osogbo, Osun State, Nigeria.;Department of Haematology, University College Hospital Ibadan, Oyo State, Nigeria.;Department of Radiology, Lautech Teaching Hospital Osogbo, Osun State, Nigeria.;Department of Radiology, Lautech Teaching Hospital Osogbo, Osun State, Nigeria.",
"authors": "Alagbe|Olayemi Atinuke|OA|;Alagbe|Adekunle Emmanuel|AE|;Onifade|Emmanuel Olugbenga|EO|;Bello|Temitope Olugbenga|TO|",
"chemical_list": null,
"country": "Uganda",
"delete": false,
"doi": "10.11604/pamj.2019.33.181.13928",
"fulltext": "\n==== Front\nPan Afr Med JPan Afr Med JPAMJThe Pan African Medical Journal1937-8688The African Field Epidemiology Network PAMJ-33-18110.11604/pamj.2019.33.181.13928Case ReportThrombocytopenia with absent radii (TAR) syndrome in a female neonate: a case report Alagbe Olayemi Atinuke 1&Alagbe Adekunle Emmanuel 2Onifade Emmanuel Olugbenga 1Bello Temitope Olugbenga 11 Department of Radiology, Lautech Teaching Hospital Osogbo, Osun State, Nigeria2 Department of Haematology, University College Hospital Ibadan, Oyo State, Nigeria& Corresponding author: Olayemi Atinuke Alagbe, Department of Radiology, Lautech Teaching Hospital Osogbo, Osun State, Nigeria09 7 2019 2019 33 18120 9 2017 22 6 2019 © Olayemi Atinuke Alagbe et al.2019The Pan African Medical Journal - ISSN 1937-8688. This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Thrombocytopenia absent radius (TAR) syndrome is a rare congenital disorder that is consistently associated with skeletal abnormality and thrombocytopenic haemorrhage. This is a case of a neonate with bilateral absent radius and thrombocytopenia. The rarity of this case prompted this report.\n\nThrombocytopeniacongenitalhaemorrhage\n==== Body\nIntroduction\nThrombocytopenia with absent radius (TAR) syndrome is a rare autosomal recessive congenital disorder characterised by bilateral absence of radius bone and a reduced platelet count [1]. It has an incidence of 0.42/100,000 live birth and was first discovered in 1951 [2]. TAR syndrome has no gender, ethnic or racial predilection. TARS could be associated with other gastrointestinal, skeletal, hematologic, and cardiac anomalies [3]. Haemorrhage, a major cause of death, occurs commonly in the first 14 months of life. This is a rare case of TAR syndrome with typical presentation.\n\nPatient and observation\nA 6-hour old female neonate referred to the radiology department for X-ray of both upper limbs on account of bilateral upper limb deformity from birth. No history of birth trauma, birth asphyxia, family history of similar or other congenital limb deformity. There was attempted termination of pregnancy with the use of a hormonal contraceptive pills (levonorgestrel, dose unknown) and herbal concoctions in the first trimester of pregnancy. She was delivered via spontaneous vaginal delivery at term by a 25-year-old unmarried primigravida. Patient had a birth weight of 2.6 kg, occipitofrontal head circumference (OFC) was 33cm, small anterior frontanelle-1 cm and closed posterior fontanelle. Musculoskeletal system revealed increased tone in the upper limbs compared to lower limbs. No other abnormality was detected in other systems. Plain radiograph of both upper limbs reveals bilateral absent radii, shortening and bowing of the ulna, abnormal flexion and radial deviation of both hands (Figure 1). Other bones of the upper limbs are present and demonstrate no abnormality. No deformity is seen in other parts of the body. Abdominal ultrasound revealed normal abdominal organs. Complete blood count on the first day of life revealed haematocrit 47%, leucocytes of 9600/mm3with neutrophils 74%, lymphocytes 26% and thrombocytopenia of 70,000/mm3. A repeat blood count on the 14th day of life showed a declining haematocrit of 35% and thrombocytopenia of 65000/mm3 and leucocytes remained normal 7000/mm3.\n\nFigure 1 Radiograph of both upperlimbs showing absence of radius bilaterally and ulnar deviation of the hand\n\nDiscussion\nTAR syndrome is a rare autosomal recessive disorder. It is an inherited syndromic thrombocytopenia that is consistently associated with skeletal abnormality and thrombocytopenic haemorrhage. It has no gender preference but some studies have reported female's predilection [1]. Like in the index case, 2 previous reports of TAR syndrome by Musa et al. and Alao et al. from different regions in Nigeria were in females [4,5]. The cause of the thrombocytopenia is still unclear. However, several theories have been proposed. The widely acceptable theory is the failure in production of humoral or cellular stimulators of megakaryocytopoiesis. Alterations of the RBM8A gene involving a microdeletion on chromosome 1q21.1. has been associated as the molecular basis of this syndrome [6,7]. This was however, not assessed in the index case for paucity of facility for molecular studies. Conspicuous in this report is the use of levonogestrel and herbal concoctions content of which was not known. Though ‘morning after’ pills are reported to be safe for both mother and fetus even if the pregnancy is not aborted, an association cannot be ignored, more so, concomitant use of herbal concoction is also implicated. This case report buttresses the teratogenic effect of drugs and chemicals especially during the first trimester as in this case.\n\nThe platelet count is frequently less than 50,000 with normal platelet morphology peripheral blood film examination. Other associated haematological features are eosinophilia, leukocytosis with a left shift. The WBC count in this case was normal. Thrombocytopenic episodes are most frequently during the first 2 years of life; this explains why incidence of hemorrhage is common in the first 14 months of life and is the major cause of mortality [8]. Even though hemorrhagic episodes are the most common cause of mortality as reported by Hedberg et al. this patient had no thrombocytopenic bleed [8]. This may be due to mild thrombocytopenia in this patient. Spontaneous bleeding is rare with mild thrombocytopenia except with surgery, trauma or associated thrombocythopathy. However, serial monitoring of the blood counts has been recommended for prompt intervention. About 50% of affected infants are symptomatic in the first week of life and 90% are symptomatic by the age of 4 months. Thrombocytopenia can fluctuate over time [7]. Therefore, with strong suspicion TAR syndrome despite initially normal platelet count, serial platelet count monitoring has been recommended. The platelet count in this case showed reduction in platelet count from 70000 to 65000 at 2 weeks interval. With advancing age, the recurrence of thrombocytopenic episodes reduces. There is need for counselling of parents to avoid trauma and intramuscular injections so as to prevent haemorrhage in the patient. With continuous reduction of platelet count, patient may benefit from transfusion with platelet concentrate, packed cells and or stem cell transplantation later in life. As part of management, physiotherapy would be required. Mental retardation is associated with about 7% of all cases of TAR syndrome. This is probably sequel to complications from intracranial hemorrhage caused by thrombocytopenia [9]. Structural defects that predispose the patient to mental retardation and other neuropsychiatric disorders (psychosis) have been proposed [10]. This index patient has closed posterior fontanelle and small anterior fontanelle. Only patients with TAR syndrome consistently have bilateral absence of the radii with the presence of thumbs and 4 digits. Upper-extremity function is usually good if radial aplasia is the only skeletal abnormality of the upper extremities.\n\nConclusion\nBilateral absence of radii and thrombocytopenia with or without other congenital malformations are the major criteria for the diagnosis of TAR syndrome. The thrombocytopenia fluctuates and the presence of haematological complications depend on the severity of the thrombocytopenia. The aetiology, though unknown, is traceable to drugs and medications taken by the mother during first trimester. Serial monitoring of the platelet count is essential in the management of patients, even in cases with initially normal platelet count.\n\nCompeting interests\nThe authors declare no competing interests.\n\nAuthors’ contributions\nOlayemi Atinuke Alagbe reported the patient's radiograph and drafted this article. Adekunle Emmanuel Alagbe did a critical review of this article. Emmanuel Olugbenga Onifade got the patient's history and followed up the patient. Temitope Olugbenga Bello reviewed the patient's radiograph and also did a critical review of this article.\n==== Refs\nReferences\n1 Greenhalgh KL Howell RT Bottani A Ancliff PJ Brunner HG Verschuuren-Bemelmans CC Thrombocytopenia-absent radius syndrome: a clinical genetic study J Med Genet 2002 39 12 876 881 12471199 \n2 Boute O Depret-Mosser S Vinatier D Manouvrier S Martin de Lassale E Farriaux JP Prenatal diagnosis of thrombocytopenia absent radius syndrome Fetal Diagn Ther 1996 11 3 224 230 8739592 \n3 Elmakky A Stanghellini I Landi A Percesepe A Role of Genetic Factors in the Pathogenesis of Radial Deficiencies in Humans Curr Genomics 2015 16 4 264 278 26962299 \n4 Alao O Aremu A Adetiloye V Ayoola O Asaleye O Oyedeji Thrombocytopenia and absent radius (TAR Syndrome): a rare case presenting in a nine-day old The Internet Journal of Radiology 2006 5 2 1 4 \n5 Danfulani M Musa A Ma'aji SM Saidu SA Musa MA Thrombocytopenia absent radii syndrome in a twenty five day old female neonate: a case report Int J Sci Rep 2016 3 1 10 12 \n6 Ballmaier M Schulze H Strauss G Cherkaoui K Wittner N Lynen S Thrombopoietin in patients with congenital thrombocytopenia and absent radii: elevated serum levels, normal receptor expression, but defective reactivity to thrombopoietin Blood 1997 90 2 612 619 9226161 \n7 Sekine I Hagiwara T Miyazaki H Hirayama K Dobashi H Kogawa K Thrombocytopenia with absent radii syndrome: studies on serum thrombopoietin levels and megakaryopoiesis in vitro J Pediatr Hematol Oncol 1998 20 1 74 78 9482417 \n8 Hedberg VA Lipton JM Thrombocytopenia with absent radii: a review of 100 cases Am J Pediatr Hematol Oncol 1988 Spring 10 1 51 64 3056062 \n9 Azemi M Kolgeci S Grajçevci-Uka V Berisha M Ismaili-Jaha V Spahiu L Thrombocytopenia Absent Radius (TAR) Syndrome Med Arh 2011 65 3 178 181 21776884 \n10 Sachdev P Brief psychosis in thrombocytopenia-absent radius syndrome: a case report Aust N Z J Psychiatry 2005 39 9 841 842 16168045\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "33()",
"journal": "The Pan African medical journal",
"keywords": "Thrombocytopenia; congenital; haemorrhage",
"medline_ta": "Pan Afr Med J",
"mesh_terms": "D000080984:Congenital Bone Marrow Failure Syndromes; D005260:Female; D006470:Hemorrhage; D006801:Humans; D007231:Infant, Newborn; D011884:Radius; D013921:Thrombocytopenia; D038062:Upper Extremity Deformities, Congenital",
"nlm_unique_id": "101517926",
"other_id": null,
"pages": "181",
"pmc": null,
"pmid": "31579100",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "3056062;21776884;12471199;26962299;9482417;9226161;16168045;8739592",
"title": "Thrombocytopenia with absent radii (TAR) syndrome in a female neonate: a case report.",
"title_normalized": "thrombocytopenia with absent radii tar syndrome in a female neonate a case report"
} | [
{
"companynumb": null,
"fulfillexpeditecriteria": "1",
"occurcountry": "NG",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LEVONORGESTREL"
},
"drugadditional": "4",
"drugadministrat... |
{
"abstract": "BACKGROUND\nChronic noncancer pain (CNCP) and prescription opioid use is a highly complex and growing health care issue in Canada. Many quantitative research studies have investigated the effectiveness of opioids for chronic pain; however, gaps remain in the literature regarding the personal experience of using opioids and their impact on those experiencing CNCP.\n\n\nOBJECTIVE\nTo explore the lived experience of adults using prescription opioids to manage CNCP, focusing on how opioid medication affected their daily lives.\n\n\nMETHODS\nIn-depth qualitative interviews were conducted with nine adults between 40 and 68 years of age who were using prescription opioids daily for CNCP. Interviews were audiorecorded and transcribed, and subsequently analyzed using interpretive phenomenological analysis.\n\n\nRESULTS\nSix major themes identified positive and negative aspects of opioid use associated with social, physical, emotional and psychological dimensions of pain management. These themes included the process of decision making, and physical and psychosocial consequences of using opioids including pharmacological side effects, feeling stigmatized, guilt, fears, ambivalence, self-protection and acceptance.\n\n\nCONCLUSIONS\nAlthough there were many negative aspects to using opioids daily, the positive effects outweighed the negative for most participants and most of the negative aspects were socioculturally induced rather than caused by the drug itself. The present study highlighted the complexities involved in using prescription opioids daily for management of CNCP for individuals living with pain.",
"affiliations": null,
"authors": "Brooks|Erica A|EA|;Unruh|Anita|A|;Lynch|Mary E|ME|",
"chemical_list": "D000701:Analgesics, Opioid",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": "\n==== Front\nPain Res ManagPain Res ManagPGIPain Research & Management : The Journal of the Canadian Pain Society1203-67651918-1523Pulsus Group Inc 25562838prm-20-15Original ArticleExploring the lived experience of adults using prescription opioids to manage chronic noncancer pain Brooks Erica A BPHE MA1Unruh Anita BSc(OT) MSW PhD1Lynch Mary E MD FRCPC21 School of Health and Human Performance, Dalhousie University, Halifax, Nova Scotia2 Departments of Anesthesia and Psychiatry, Dalhousie University, Halifax, Nova ScotiaCorrespondence: Dr Mary E Lynch, Pain Management Unit, Queen Elizabeth II Health Sciences Centre, 4th Floor, Dickson Centre, Room 4086, Halifax, Nova Scotia B3H 1V7. Telephone 902-473-6428, fax 902-473-4126, e-mail mary.lynch@dal.caJan-Feb 2015 20 1 15 22 © 2015, Pulsus Group Inc. All rights reserved2015This open-access article is distributed under the terms of the Creative Commons Attribution Non-Commercial License (CC BY-NC) (http://creativecommons.org/licenses/by-nc/4.0/), which permits reuse, distribution and reproduction of the article, provided that the original work is properly cited and the reuse is restricted to noncommercial purposes. For commercial reuse, contact support@pulsus.comTreatment with opioids is known to be beneficial for some individuals with chronic pain conditions, and occasionally long-term opioid therapy is used to reduce patients’ chronic pain. This qualitative interview-based study includes interviews with nine patients with chronic pain who were taking or had taken opioids on a long-term basis. The interpretation of their interviews resulted in the generation of six themes, including both positive and negative aspects of these patients’ experiences with long-term opioid treatment.\n\nBACKGROUND:\nChronic noncancer pain (CNCP) and prescription opioid use is a highly complex and growing health care issue in Canada. Many quantitative research studies have investigated the effectiveness of opioids for chronic pain; however, gaps remain in the literature regarding the personal experience of using opioids and their impact on those experiencing CNCP.\n\nOBJECTIVE:\nTo explore the lived experience of adults using prescription opioids to manage CNCP, focusing on how opioid medication affected their daily lives.\n\nMETHODS:\nIn-depth qualitative interviews were conducted with nine adults between 40 and 68 years of age who were using prescription opioids daily for CNCP. Interviews were audiorecorded and transcribed, and subsequently analyzed using interpretive phenomenological analysis.\n\nRESULTS:\nSix major themes identified positive and negative aspects of opioid use associated with social, physical, emotional and psychological dimensions of pain management. These themes included the process of decision making, and physical and psychosocial consequences of using opioids including pharmacological side effects, feeling stigmatized, guilt, fears, ambivalence, self-protection and acceptance.\n\nCONCLUSION:\nAlthough there were many negative aspects to using opioids daily, the positive effects outweighed the negative for most participants and most of the negative aspects were socioculturally induced rather than caused by the drug itself. The present study highlighted the complexities involved in using prescription opioids daily for management of CNCP for individuals living with pain.\n\nHISTORIQUE :\nLa douleur non cancéreuse chronique (DNCC) et l’utilisation d’opioïdes sur ordonnance sont un problème de santé croissant et très complexe au Canada. De nombreuses recherches quantitatives ont porté sur l’efficacité des opioïdes pour soulager la douleur chronique. Cependant, il reste des lacunes dans les publications au sujet de l’expérience personnelle des opioïdes et de leurs répercussions sur ceux qui souffrent de DNCC.\n\nOBJECTIF :\nExplorer l’expérience vécue par des adultes qui utilisent des opioïdes sur ordonnance pour gérer leur DNCC, en s’attardant sur les effets des opioïdes dans leur vie quotidienne.\n\nMÉTHODOLOGIE :\nLes chercheurs ont réalisé des entrevues qualitatives approfondies auprès de neuf adultes de 40 à 68 ans qui prenaient quotidiennement des opioïdes sur ordonnance pour soulager leurs DNCC. Ils ont procédé à l’enregistrement sonore des entrevues, qu’ils ont transcrites, puis examinées par analyse phénoménologique interprétative.\n\nRÉSULTATS :\nSix grands thèmes répertoriaient les aspects positifs et négatifs de l’utilisation des opioïdes dans les dimensions sociales, physiques, émotives et psychologiques de la gestion de la douleur. Ces thèmes incluaient le processus de prise de décision et les conséquences physiques et psychosociales découlant de l’utilisation d’opioïdes, y compris les effets secondaires pharmacologiques, le sentiment d’être réprouvé, la culpabilité, les peurs, l’ambivalence, l’autoprotection et l’acceptation.\n\nCONCLUSION :\nMême si de nombreux aspects négatifs entouraient l’utilisation quotidienne d’opioïdes, les effets positifs l’emportaient sur les effets négatifs pour la plupart des participants. Par ailleurs, la plupart des aspects négatifs étaient attribuables à des problèmes socioculturels plutôt qu’à la médication. La présente étude faisait ressortir la complexité de l’utilisation quotidienne d’opioïdes sur ordonnance pour aider les personnes qui vivent avec la douleur à gérer leur DNCC.\n\nChronic noncancer painLived experienceOpioidsPain management\n==== Body\nChronic pain is one of the most common reasons that individuals access the health care system (1,2) yet the management and treatment of it continues to be a challenge for the individual with pain and for health care providers (3). Chronic noncancer pain (CNCP) is a non-cancer-related pain that has been present for ≥3 months or lasts longer than would be expected to heal tissue or resolve the underlying disease (4). Some of the more common types of CNCP include osteoarthritis, rheumatoid arthritis, low back pain, shoulder and neck pain, headache, myofascial pain syndromes, chronic regional pain syndromes, phantom limb pain, neuropathic pain, diabetic neuropathy, temporomandibular joint disorder, angina pectoris and chronic visceral pain syndromes (5). CNCP has physical consequences (eg, decreased mobility, anxiety, lack of sleep, fatigue) and, over time, often psychological, emotional, social, occupational and recreational consequences (eg, impaired activities, including walking or being active, shopping, dressing, and maintenance of relationships and sexual activity, as well depression and an overall decreased quality of life) (6). In 2002, persistent pain affected approximately 29% of Canadians (7). A more recent telephone survey revealed that 38.4% of Canada’s general population reported experiencing pain on a daily or near-daily basis (8). Not only is chronic pain a significant burden that negatively affects an individual’s wellbeing (2,9), it is a major public health problem globally (10).\n\nA variety of coping mechanisms and treatment strategies are typically needed to reduce pain and regain psychological and physical well-being (11,12). Treatment of severe pain often involves pharmacological approaches including opioids. The goal of long-term opioid therapy for CNCP is to reduce pain to regain function and improve the quality of life for the individual (13). A growing body of quantitative evidence provides some support for the use of opioids as a management strategy for CNCP because they have been shown to decrease the physical pain and improve function for the individual (14–20). Little is known about the emotional, social and psychological impacts of long-term opioid use from the standpoint of the lived experience of the individual who uses them to manage CNCP (19).\n\nThere has been growing concern in Canada regarding an increase in the rate of prescription opioid misuse in Canada (22–25), along with increasing concern regarding an increase in prescription opioid-related deaths and harms (3,19,20,26,27). Other authors have pointed out that CNCP is a complex issue requiring solutions that do not cause further harm to individuals living with pain (28). The media’s portrayal of opioid use for pain has focused on the negative effects, such as stigma and misuse, rather than the positive benefits of increased pain relief and improved quality of life (29–31). Due to the negative connotation that opioids receive, patients may feel stigmatized or may be viewed by others as drug addicts (16,32–34), although the estimated risk of addiction is approximately 4% (35). Patients may also fear that the adverse publicity may encourage doctors to stop prescribing opioids altogether (36). Many health care professionals are reluctant to prescribe opioids due to their own negative perceptions, fears of diversion and addiction risks, as well as fear of scrutiny by regulatory bodies (16,36–40). Physical dependence and tolerance to opioids are often misunderstood as evidence of addiction; however, addiction involves drug-seeking behaviour to obtain a psychological high from these drugs (12,41). The undertreatment of chronic pain conditions continues to be a major concern within our health care system (42), leading to needless physical and emotional distress, increased burden to the health care system, economic costs and strain on relationships (5,43).\n\nUnderstanding the perspective of the person living with CNCP involves “getting inside the experience of such (chronic) illness” (44). Few studies have addressed the patient’s perspective of using opioids to manage chronic pain. Vallerand and Nowak (2) used a qualitative approach to explore the impact of opioids on the quality of life of individuals living with chronic pain. This study revealed that opioids improved quality of life and overall functioning, but were also associated with many struggles resulting from stigma and barriers related to opioid use.\n\nThe purpose of the present study was to examine individuals’ lived experience of using prescription opioids to manage CNCP and their effect on the psychological, emotional, social and physical aspects of living with CNCP. When individuals experience major change in their lives, they begin to reflect on the significance of this change to manage its impact. Exploring this experience allows the researcher to engage in these reflections and examine how people come to terms with major events or transitions (45).\n\nMETHODS\nParticipants for the present study were recruited from an outpatient pain clinic in a teaching hospital located in Nova Scotia. From 2011 to 2012, there were 1843 clinic visits for CNCP at this pain clinic. A generic recruitment letter, along with contact information, was given to approximately 100 patients at the pain clinic by staff during clinic appointments occurring during the recruitment period. Participants contacted the first author if they decided to participate in the study. As a secondary recruitment strategy, posters advertising the study were displayed in both the treatment rooms and the waiting area of the clinic to enhance recruitment. Inclusion criteria were: current use of prescription opioids, age ≥18 years, currently a patient of the pain clinic and willingness to take part in two interviews. Twelve individuals contacted the researcher to participate in the study. Two individuals failed to attend scheduled interviews and another did not meet the inclusion criteria. Nine participants (four men and five women) between 40 and 68 years of age participated in the present study. All were currently using or had recently used opioids to manage their CNCP. Following completion of informed consent, a demographic and medical data form providing information about age, sex, marital status, occupation, origin or cause of pain, number of years in pain, type and amount of opioid currently using, and duration of daily opioid use was completed by each participant before beginning the interviews. Informed consent was obtained and interviews were conducted by the first author, who was not a staff member of the facility.\n\nA semistructured interview guide using open-ended questions with probes and prompts was used to facilitate the interview. The guide was developed with guidance from the literature regarding interpretive phenomenological analysis (IPA) examining lived experience (2,45), as well as consultation with other members involved in the current research.\n\nThe data from the interviews were audiorecorded and transcribed verbatim for analysis. All data were made anonymous before being made available to team members. Ethics approval for the present study was obtained from the Ethics Review Board of the institution in which the pain clinic is located.\n\nIPA was used to analyze and interpret the data (45). IPA is a qualitative framework for examining the unique experiences of individuals in the context of their lives through in-depth interviews. Approaching the topic of opioid use through an interpretive phenomenological lens sheds light on how patients are experiencing their everyday lives with the use of opioids to manage their chronic pain conditions. Often, the experiences of individuals who are experiencing a certain debilitating condition or who are from a marginalized population are neglected or suffer needlessly due to their social context. Giving individuals who experience chronic pain an opportunity to tell their story reveals not only the lived experiences they face daily, but also empowers participants whose voice may rarely have been heard. In IPA, the researcher seeks to understand how the participant’s lived experience has influenced the choices they make, specifically with opioid use, and takes into account the various contexts that may influence these decisions. To fully gain an understanding of each participant’s lived experience, IPA recommends a smaller sample, no larger than 10 participants, to focus attention on each case individually and to then explore themes shared among cases. A six-step thematic analytical process is then used in IPA to analyze the data (45). As applied to the present study, step 1 involved listening to the audiotaped interview and reading through the transcript to ensure transcription was accurate. Rereading interview texts immersed the researcher in the data. In step 2, initial notes were made of the ways in which the participant talked about, understood and thought about their personal experiences and concerns related to CNCP and opioid use. A line-by-line content analysis was conducted alongside the data to facilitate coding, categorization, and synthesis of the data. Step 3 focused on examining the interrelationships, connections and patterns among exploratory notes in individual transcripts to develop emergent themes. Step 4 considered the connections across emergent themes within the transcript to identify the participant’s meanings and connections and cluster themes. Once the analysis of one transcript was completed, the next step (step 5) involved moving to the next participant’s transcript and repeating the process. In IPA, each transcript is analyzed separately to ensuring accurate interpretation, completeness of data and to reduce bias in interpretation from one transcript to another. A notebook was kept during the analysis process to record and set aside the researcher’s own thoughts and emotions about the data. Step 6 identified patterns and connecting themes across the participants and connecting themes. This process assisted with working toward revealing both the individual’s experience, and the common experiences and shared meanings of using prescription opioids to manage CNCP. Data analysis was an ongoing process through the data collection stage, with interview summaries prepared for a second interview with each participant (45).\n\nRESULTS\nFinding balance was the overarching theme revealed in these interviews. Participants in the present study sought to balance pain with function in daily life. Similarly, they struggled to balance the negative effects of the opioids with the relief from pain that opioids provided. Often, other strategies were added or removed in this process of balancing positive and adverse effects. Finding balance also meant achieving better stability in daily function along with use of pain management strategies to achieve optimal pain relief (preferably a cure) and a better quality of life. The challenge in finding balance is illustrated by participant 3 and typifies the experience of other participants:\nThere were a lot of plates. Like the guy in the circus running around you’re trying the acupuncture, the massage, in the pool, seeing the psychologist, taking some pharmacology, and where are we going? Because as a pain sufferer, we’d love not to be in pain! And we try anything and exhaust almost all our finances to try to find that cure.\n\n\n\nFinding balance acted as a pivotal point for interpretation of the lived experience of prescription opioid use in the context of managing chronic pain. Eight themes in these interviews reflected participants’ efforts to finding balance in managing CNCP.\n\nTheme 1: Process of decision making regarding opioid use\nDeciding to use opioids was not a straightforward process, and not typically initiated by the participants. Some participants were offered prescription opioids fairly quickly before the pain was diagnosed as a chronic problem; others were offered opioids as a last resort after all other management techniques were exhausted. Most participants began using opioids because their physicians suggested it. At the time of the present study, eight of the nine participants were using prescription opioids such as morphine, oxycodone, hydromorphone, fentanyl and methadone daily to manage CNCP, and four of the eight also used cannabis. One participant used only cannabis after previous unsuccessful trials with opioids. Although it took several attempts with various opioids before finding adequate relief, eight participants decided to continue using opioids despite the adverse side effects (eg, sweating, constipation, sedation, dizziness, nausea) they experienced. Participant 2 summarizes the desperation participants felt to find pain relief along with their hesitancy to use opioids:\nThis was the first time I was given drugs to use on a regular basis. I was a little concerned about that but realized that I was…(pause), I don’t want to use the word ‘helpless’ but I was really unable to function very well because of the pain. And I was concerned that if I started these drugs, where would it end? I was becoming aware that I had a condition that was not going to go away and there was not a treatment that was going to relieve it. It was a matter of dealing with it in the best way possible and that was up for grabs at this point.\n\n\n\nMaking the decision to use opioids exposed participants to the benefits and the side effects of their use.\n\nTheme 2: Benefits and side effects of opioid use\nOverall, prescription opioids had a very positive effect on the participants’ physical pain; however, many participants also reported negative effects. With the use of opioids, most participants regained a quality of life that had been lost. Often, this quality of life meant living with more comfort and regaining the ability to do routine tasks of daily life such as mowing the lawn, going to appointments or cleaning the house:\nI have to say that these drugs give me a quality of life that I did not think I would ever have again. It allows me to live my life to the fullest I can, to take part in things…and be as active as I can. I can’t picture doing it without the drugs now.\n\n(Participant 2)\n\nTypically, opioids did not relieve all pain, and did not cure pain. Participant 7 spoke about the pain relief from opioids but focused more on this disappointment of not being pain free:\nIt helps. I mean I shouldn’t say it doesn’t do anything. To tell you the truth, I probably wouldn’t be here right now if I wasn’t taking it. I probably wouldn’t be able to walk or get out of bed cause the times that I do let my dose go or don’t take it, it just, I can tell right away and umm so if it wasn’t for that [opioids] I would have no quality of life.\n\n\n\nThe daily use of opioids came with many negative effects for the participants including nausea, vomiting, itching, constipation, drowsiness, mood changes, sweating, changes in sexual functioning, feelings of fatigue, sluggishness and, sometimes, reduced motivation to do things. Participant 7 described the problem of sweating and mood changes:\nIt comes with consequences and side effects for sure. It’s, you know, I wish it didn’t have but, the sweating alone is just ah, it just, it’s so uncomfortable to wake up and your pillow is just soaked with sweat and your bed. And I know that mostly, it’s gotta be from the morphine and it makes you moody and cranky and everything.\n\n\n\nSweating and changes in sexual function due to opioids affected sexual activity and intimate relationships, as illustrated by these participants:\nWhen I was first on opiates I couldn’t, couldn’t have an erection. And once I got used to the medicine I could have the erection but I couldn’t have an orgasm or anything like that. So it affected the relationship in a manner that I wasn’t ready for because the woman I was living with at the time thought she was inadequate.\n\n(Participant 9)\nMy sex life, it hasn’t been there lately. Because we are both in chronic pain all the time, you know. He has the sweats all the time. I’ve got the sweats all the time.\n\n(Participant 6; both partners had chronic pain)\n\nTo offset side effects and provide additional pain relief, participants used other pharmaceutical agents with their opioids. Five participants included cannabis (with government-issued licenses) on the advice of their physician. One participant used cannabis for pain following initial recreational use. Cannabis was reported to be helpful for many opioid side effects:\nI’m very embarrassed to go into grocery store, to go anywhere, to do anything, cause I’m soaked all the time. So a lot of the times in the afternoon, I’ll have to lie down and get a blanket and I have to take marijuana and that will usually, within a minute, the sweats are gone. Like that. And I’m feeling a little bit back to normal again.\n\n(Participant 6)\n…that [cannabis] helps me some days, believe it or not. I would say almost as much as the morphine does. It helps with my appetite which I don’t have any of, usually, because of the medication...general stress from being in pain I think all the time. So it does help with my energy, and it helps with my anxiety. It helps with my sweating.\n\n(Participant 7)\nWell the marijuana is only for the nausea cause with methadone…the nausea is unbelievable and that’s never stopped. The pain is under control to a degree with the methadone, but, the nausea, the vomiting. I had that the whole 10 years, that’s still there.\n\n(Participant 8)\n\nCannabis was described to alleviate some side effect of daily opioid use such as nausea, sweating and increasing appetite. Chronic pain often involves several different mechanisms (eg, tissue damage or nociceptive pain, neuropathic pain, inflammatory pain) and, in this case, opioids alone are often inadequate to provide adequate relief (46). Often other agents need to be added such as antidepressant or anticonvulsant analgesics, or other medications to assist with side effects such as constipation or sweating (46). These may include medicinal cannabis.\n\nOne of the unexpected side effects of opioids was the negative social impact.\n\nTheme 3: Feeling stigmatized\nMedia reports contributed to participants feeling stigmatized. Such reports typically emphasized potential harms associated with prescription opioids, with a strong focus on addiction, without presenting a balanced perspective that included the benefits of opioids for an individual living with CNCP and the limited risk for addiction when using opioids as prescribed. Participant 1 expressed the anger an individual living with pain may feel in response to such negative publicity:\nI get mad when I see the articles in the paper about people, and oh everybody in pain is addicted. And the stats, I always say only one to four percent of people in chronic pain ever get addicted to the medicine and that happens for a number of reasons. And you know what? I wouldn’t give a shit if I was addicted to the medicine. Like, at this point, 30 years of this who the hell cares?\n\n\n\nFor participant 1, even addiction would be acceptable as a consequence of opioid use if there was relief from chronic pain.\n\nSadly, in addition to the stigmatization of opioid use in media reports, all of the participants felt stigmatized at times by health professionals, as illustrated by these comments:\nI frequently have difficulty with the residents (doctors in training) explaining why these drugs, this many drugs…Finally Dr. [family physician] wrote a note in my file – stop harassing [participant’s name]. This is what she gets and why she gets it. And they did stop but it was inconvenient. For instance, they would not prescribe me three months at a time. I would be dispensed one month at a time. And for someone who had been taking the same drugs for 10 years I found that condescending.\n\n(Participant 4)\nThey [ER staff] said, “Well we know that you’re on a lot of pain medicine, so we can’t give you any.” I said, “I didn’t ask you for any. I just want to know what’s wrong with me.” So I almost felt like, I felt like I was being treated like a junkie in the emergency room when I was in an accident because they found out I was on pain medicine. They automatically assume that I was coming in to try to sneak an extra prescription or something.\n\n(Participant 9 attended the emergency room after a fall).\nApparently there is a book, they write your name down if you’re, if you come there [emergency room] too much… but god, what if I had to, what if I had to come there every week until this thing settled down. Do you know what? I wouldn’t. That was so stressful in itself, cause I never knew how I would be treated.\n\n(Participant 1)\n\nAs a result, participants often felt judged rather than supported by a health professional who was not their pain specialist. Participants feared that their family physician might also be affected by negative media reports:\nI think she’s [prescribing doctor] just freaked out about all the shit in the news and a couple bad apples are making it hard for people who legitimately need pain medication…but other than that she’s supportive and she sent me to the pain clinic here and all that.\n\n(Participant 7)\n\nExposure to such stigma caused some participants to be ambivalent about their own use of an opioid medication for pain as illustrated by the comments of participants 8 and 9, both of whom were prescribed methadone:\n…when you get methadone you definitely, you know, what do you call those people? What do they call those people? When you’re on methadone… junkies! [people say] “She was a heroin addict and is now on methadone trying to get off of it.” I’ve had that said to me in the city, at the hospitals, that you know, the reason I was taking that, you know, I have a problem. And as an RN, that’s a big problem right? And I said, “My god! What are you talking about?” I said, “I don’t do that, I have chronic pain.”\n\n(Participant 8)\n…at one time they were talking about putting me on methadone pills. And I was like wait a minute. Dr. [name of pain specialist] wanted that and he said it’s a better and longer lasting pain medicine. Right then and there I said, “Oh methadone! People are going to think I’m a heroin addict, or coke addict, or something like that.” So that’s when I started thinking, well wait a minute, what are people really saying or really thinking and that’s when I started thinking how am I going to be viewed by people?\n\n(Participant 9)\n\nUnfortunately, feeling stigmatized and fearing being wrongly labelled as addicted, increased participants’ uncertainty about opioid use and added feelings of guilt for using opioids.\n\nTheme 4: Guilt\nFeeling stigmatized was a strong component to feeling guilty about using opioids and sometimes other medications to manage pain, but personal contexts compounded feelings of guilt.\n\nTwo participants feared that their pain was not sufficiently severe enough to warrant such medications. One participant diminished the severity of her pain by comparing it to the cancer-related pain experienced by her mother in the last months of her mother’s life:\nMy biggest hang-up was me. I guess I could relate to my mother. I guess I would say my pain is nowhere near what my mother’s did, what my mother went through. And she had to take the narcotics cause she had a terrible bout with breast cancer…and I saw all the medication she was on and I kept saying to myself, I don’t have cancer, it’s just back pain, you should be able to do this without taking those drugs. Well that didn’t last long.\n\n\n\nParticipant 6 was stressed and anxious about taking prescription opioids for pain, relating it to feelings of self-worth:\nIt’s a big deal for me to have to go on these medications because I felt very bad. You know you hear all this stuff about narcotics and stuff so I felt like I was a bad person for a long time actually.\n\n\n\nThis participant sought out psychological intervention to work through these feelings.\n\nParticipant 9 felt guilty not about taking opioid medication but because he resisted family pressure to give some of his opioid medication to a nephew who was experiencing daily pain:\nHe’s asked me for some pain medicine when his Percocet don’t work and I say “I’m not allowed to give that to you. I’m sorry. I can’t. It’s against the law. I can go to jail…” And then I get in trouble for not helping out. And what I mean by getting in trouble is I get flack from my sister-in-law because they know I can help him with the pain but they also know I shouldn’t…\n\n\n\nUsing cannabis to provide pain relief and manage opioid side effects added other concerns about its side effects, and guilt about needing to hide it and using a drug that might be viewed as illegal by others:\n…it [cannabis] is very, very hard on the body. Smoking and hacking and coughing and being a criminal cause I have to hide around the side of the house and hide it [cannabis] from everybody. And this is my pain relief and it’s really sad when you think that you have to go that route to get some relief and then you get the odour that comes from it and then you get the stigmatism that comes from it.\n\n\n\nThe stigma and guilt associated with opioid and cannabis use were often coupled with a level of fear of not only using these substances but also of being in possession of them.\n\nTheme 5: Fears\nStudy participants had fears about two issues. One fear related to addiction and the other to victimization.\nI was afraid of getting hooked on the drugs. I was afraid of becoming dependent. And I knew that my condition was not going to get better and I realized that if I got on these drugs, I could be in for a series of problems with them. I knew about addiction and I knew of people who have been caught in this web and I was just really leery of it.\n\n(Participant 2)\nYou know I have to be careful on how I take this ‘cause I’ve seen a lot of good people get addicted to pain medicine. I’ve seen a lot of lives destroyed because of it. And a good buddy of mine died because of it, buying pills off the street.\n\n(Participant 9)\n\nFears of addiction were compounded by the fears of significant others. The former partner of participant 9 had concerns about his opioid use and acted on them:\nThe woman I was living with is a [name of occupation], and she knows how addictive these pills were and she actually took them from me. She was giving them to me, but wasn’t giving them to me, to the point where I actually needed them ‘cause I was in significant pain for three years because she didn’t want me to become addicted to them.\n\n\n\nThe experience of participant 9 illustrates the potential for the fears of others to cause real harm for someone who is using opioid medications to manage pain. Other fears concerned the impact of the street value of opioids.\n\nSeveral participants had concerns about becoming victims of criminal activity because of their opioid use. The daughter of a participant 4 witnessed a robbery outside a pharmacy causing additional concern for family and others:\n… I became a little bit anxious and felt a bit vulnerable because we pick these drugs up and, you know, my kids pick them up, my husband picks them up, I pick them up, my homecare worker. I spoke to my pharmacist about this and he suggested maybe I just get them delivered. And he said, “Oh but then they will know where you live” which was a little anxious making.\n\n\n\nThis participant was also concerned about the lack of privacy and confidentiality about her opioid medications in this pharmacy:\nThe pharmacist spoke loudly and in the presence of others how my MS-Contin prescription was not complete and that I would be getting the balance later but here is what you’ll need for the next two weeks. And I did feel vulnerable because there were people around watching me fill out the form and knowing what the drug I was taking.\n\n\n\nParticipant 9 was victimized: “One time we came home and the house was broken into and ah, basically my pain medicine was gone. So someone knew…” This person felt directly targeted because of his possession of opioids within his home. Such experiences compounded the stress of living with pain:\nWe’ve really had a hard time as a pain community to get access to medications due to the fact of the legalities and misuse of property from outsiders. So that’s the start of the bad name. But if you are fortunate to get it, then it’s like oh geez, we have to worry about someone else trying to steal this stuff. And I’ve heard stories of people. Someone scooped their meds or watched them get their meds [from the pharmacy] and when they came out, scooped them out of their hand. And who pays the price? And it’s the pain person.\n\n(Participant 3)\n\nStigma, guilt and fear resulted in participants becoming vigilant and developing protective strategies to shield themselves from needless additional anxiety.\n\nTheme 6: Self-protection\nParticipants in the present study became selective in their communication about opioid use with others, sometimes even with family members. Participant one gave this explanation:\nI do it for my own protection by not telling them because I see how they react by reading something in the paper…and it’s just their ignorance. And I don’t have time. Well they know what’s going on but they don’t get it to this day. So you have to pick your battles. They’re not one of them and if they don’t get it now they are never going to get it.\n\n\n\nUnfortunately, not being open caused this participant to feel increasingly isolated:\nSo it was hard to always be secretive and then I started to isolate myself from people and I didn’t like that.\n\n\n\nSome participants felt they were ‘wearing a mask’ when they acted in ways that differed from how they felt, but doing so was an effort to avoid being in more pain or distress. Participant 1 approached the emergency department with extra care:\n…I’m thinking ok, there may be those addicts and they may slip by you but everyone that’s coming to the ER is not a friggin’ addict, what’s wrong with you guy, you know? But of course I would never be grumpy or grouchy. You’re always like, “Oh thank you dear”, you know, trying to be sweet and I have to act, put on a show, when dealing with this horrible issue and trying to be nice to them cause I may not be treated well.\n\n\n\nSide effects, stigma, guilt, fear and self-protective strategies contributed to an overall ambivalence for some about using opioids for pain management.\n\nTheme 7: Ambivalence\nThe realization that opioids would not resolve pain, that they may be needed indefinitely and that they caused other problems generated an ongoing internal conflict for some participants about using opioids at all to manage the pain. One participant stopped and turned to cannabis exclusively, although this did not change this person’s feelings of secrecy. Others waited until the pain was intolerable before using their opioids:\nI think it’s more of a power struggle, to see who’s stronger. Whether it’s me or the [pain], and not only that but I just hate that I have to take something to get through the day. I have to put this patch on every couple days just to get through or I’d be in the ground right now, you know, so yah, it’s hard, it’s very hard. … I still fight with myself, like I still let it go to the very, as long as I can, there is always that fight, like I’m stronger than you sort of thing. And I never win though.”\n\n(Participant 6)\nIt’s always a fighting game; you know how long can I go without having to increase it [opioids] or even taking my medication. I normally don’t take it till five or six o’clock, my second dose at night, but sometimes I try to take it as late as I can so I’ll sleep a little bit longer but it’s always a fighting game with the pain right?\n\n(Participant 7)\n\nParticipant 2 commented about the natural hesitation of people living with pain to use opioids:\nThey don’t want to get into the drug scene so they hold back not realizing they aren’t helping themselves.\n\n\n\nNevertheless, most participants in the present study, while remaining hopeful that their pain might eventually end, came to a place of acceptance of pain and the necessary continued opioid use to manage pain.\n\nTheme 8: Acceptance\nSearching for pain relief was described as exhausting and frustrating. The journey in seeking relief was full of trial and error with pharmacological, physical and alternative therapies. Individuals in the present study often expressed their desire for a ‘cure’. As the pain persisted, it became essential to them to move toward acceptance to be open to long-term pain management strategies and improve function. Participant 3 illustrates this process toward acceptance:\nI still hope that one day there is something out there for me, but I have to accept the part that I can’t do what I used to do. I have to accept those limitations on me. Though, until I accepted it, a lot of things didn’t change.\n\n\n\nParticipant 8 was thankful to have opioid medication to help cope with his pain:\nBut opiates, that’s my way of life. There would be no life if I didn’t have this. And I thank God for them because without them I’d be…well I wouldn’t be. I just couldn’t go on. I would have committed suicide a long time ago. And I say that truthfully cause you could not live like that, with that constant, constant pain. But, with the opiates it’s made it possible to be able to have a part of a life, you know.\n\n\n\nParticipant 9 reconciled the positive and negative aspect of opioid use and accepted that, overall, they were helpful to manage his pain:\nFor me, personally there are benefits and well I can say the pros outweigh the cons in this case. Umm because I wouldn’t be able to do anything without them and I know that and my doctors know that too.\n\n\n\nFor most participants, the realization that they will live with some degree of pain occurred despite earlier expectation that opioids would eliminate the pain. Participant 1 stated:\nI’m happy with my decision, with opioids. I finally got over the fact that it’s not a cure-all and I have to do other things besides medication…\n\n\n\nFor these participants, acceptance of pain and the persistent negative consequences of opioid use led to a continuous cycle of appraisal and reappraisal of the stress of living with pain in the hope of finding balance in pain relief to achieve adequate function and quality of life.\n\nDISCUSSION\nThe findings of the present study revealed some of the complexities of using prescription opioids for the management of CNCP from the perspective of the individual who lives with it. Living with CNCP was a stressful life experience that had a major impact on participants’ quality of life and interfered with their ability to function. In this group of individuals using chronic opioids (in one case, a cannabinoid only at the time of the study), opioids assisted with participants gaining sufficient relief to move toward acceptance of pain despite incomplete pain relief, negative pharmacological side effects, stigmatization, guilt and fear. To do this, participants were engaged in a cyclical process of appraisal and reappraisal of pain as they attempted to balance pain, opioid use and its sequelae toward a lifestyle that could be managed. Lazarus and Folkman (47) first described this appraisal-reappraisal process as a transactional theory of stress. Negative appraisals of a stressful life event focus on the harm or loss associated with the stress and efforts to manage it, resulting in a perceived threat (48). The negative pharmacological side effects of opioid use along with stigma, guilt and fear heightened the worry associated with opioid use and led to self-protective strategies to reduce these effects. These issues led some participants to feel ambivalent about using opioids and uncertain as to whether they could find a tolerable quality of life again. Ambivalence about opioid medication and resulting underutilization was also reported by McCracken and Vowels (49). Despite ambivalence, most participants in our study did, over time, develop a set of strategies such as exercising, meditating, limiting or adapting their activities, creating healthy boundaries to decrease stress, and finding social support through loved ones and support groups that balanced their need for pain relief, and thus enabled a sufficient quality of life that led to acceptance through a process of appraisal and reappraisal as various strategies were attempted, modified, continued or dropped.\n\nParticipants described living with CNCP as almost impossible without accepting new limitations and finding a level of pain that may be tolerable in daily life. Not all individuals with CNCP are able to accept that there may be no cure for chronic pain (6,50). Vallerand (19) described acceptance as essential to continued functioning in daily activities. Although acceptance benefits overall well-being, little is known about how individuals arrive at a state of acceptance, although time is likely to be a contributing factor (50,51).\n\nIn our study, acceptance occurred as participants challenged their beliefs about opioid or cannabis use, and found ways to manage the physical, emotional and social consequences of using opioids. Most participants described acceptance of their new life in chronic pain and using opioids as being the only way to move forward. Other participants remained ambivalent and were searching for a cure. The participants who have been using opioids for CNCP for many years often compared their life with pain before and after using opioids for pain management. Their previous life represented a very dark time of isolation, depression and uncertainty. Some participants described previous suicidal thinking. Without the assistance of opioid medication, they would not have been able to carry on. Their present life gave them a sense of hope, freedom and a new found purpose in life. These findings are similar to the findings reported by Vallerand and Nowaks (2), in which participants described being thankful for their opioid therapy regimen because it allowed them to regain their quality of life. In Vallerand and Nowak (2) and in our study, participants spoke about the need to change their focus from constant pain and seeking a cure to finding purpose and living their life again less focused on pain. Similarly, Risdon et al (52) described acceptance by their participants as due to acknowledging one’s limitations, realizing that there was more to life than pain, and relinquishing the fight against battles that cannot be won. For our participants, sufficient pain relief, often with opioids, sometimes with the addition of cannabis, and in one instance eventually cannabis alone, was a catalyst toward acceptance, not sufficient on its own but not possible without it.\n\nFinding balance is essential to maintaining stability and achieving a quality of life that is tolerable (9). Vallerand and Nowak (2) described finding balance as achieving equilibrium between pain management and level of functioning in life domains. Some of our participants discussed a ‘failed expectation’ of opioids. They were shocked that opioids were insufficient to relieve all pain and caused further problems. Finding balance through active coping strategies was a very lengthy yet important process for participants because unmanaged pain is so destructive. This process enabled participants to regain control of their own sense of well-being.\n\nIMPLICATIONS FOR CLINICAL SETTINGS AND FUTURE RESEARCH\nTo date, there have been remarkable advances in our understanding of pain; however, the management of CNCP remains a significant problem (20,53–55). A comprehensive and multidimensional approach is essential to achieve management of CNCP and to reduce the adverse social consequences associated with opioid use (16,34,56). One of the most reported barriers to adequate pain management for those with CNCP is lack of guidance and education related to the use of prescription opioids for chronic pain (2,14,26,30,57–60). The current system for training physicians and other health care professionals is limited and inadequate (61). Currently, student veterinarians receive five times more education about pain assessment and treatment than medical doctors in Canada (61). This gap in pain education results in many health care professionals feeling underqualified to assess and treat CNCP, and compromises patient safety (34,62). These issues likely contribute not only to the undertreatment of pain but to misunderstandings about pain, which may, in turn, lead to professional behaviours and attitudes that contribute to the stigma and guilt experienced by individuals living with CNCP and needing opioid pain management.\n\nAlthough the benefits of opioids for pain are well documented (2,16,20,63,64), when an individual requires an opioid as part of their management program, there is an additional layer of negative judgement and consequence that they experience from medical health professionals and society at large that contributes to the overall problem and level of suffering (32). A better understanding of the magnitude and characteristics of opioid use for CNCP can contribute to improved pain management programs, and enable both health care professionals and individuals who are using opioids for CNCP to better understand the needs and supports required to reach an optimal state of health.\n\nA limitation of the present study was the lack of follow-up by participants to provide a second interview for further elaboration or clarification of themes from their first interview. All participants committed to participating in two interviews but only four did so, despite repeated efforts to contact the other five.\n\nFurther research is needed to understand the lived experience of individuals who use opioids to manage CNCP. The present study revealed details of the lived experience of these participants in a particular social and health care context. Replicating the present study in other settings and with more diverse populations would provide a broader understanding of the experience of using opioids to manage CNCP, particularly with regard to issues of stigma, guilt and fear that may be exacerbated by sex, age, poverty and ethnicity. This research would assist health care providers in understanding not only the benefits and physical side effects opioids may have on pain, but also the physical, social and psychological stress with which it is associated. Future research should also focus on examining ways to alleviate barriers and disparities within the health care system for those seeking support and treatment of chronic noncancer pain.\n\nUsing opioids to manage CNCP is a challenging experience for people who live with CNCP. The potential negative side effects are well understood, although not always easily managed. The social and emotional consequences that these participants reported are particularly troubling because they present additional burdens and barriers to optimal pain management. The solution must include a comprehensive educational initiative within a national strategy for pain (64), as a call to action for educators and clinicians alike. The overall goal of pain management is no longer simply to decrease one’s pain, but to recognize the need for improving psychological and emotional functioning as well. As demonstrated in the present study, opioids cannot be the only mode of treatment for individuals with chronic pain, but can be used as a tool to reduce pain. This reduction in pain then enables individuals to better cope with their physical and psychological pain through a variety of other modalities in conjunction with opioids.\n\nThe authors acknowledge the following financial support: Erica Brooks was supported by the Nova Scotia Health Research Foundation, Student Research Award. Mary Lynch acknowledges the support of the Department of Anesthesia, Pain Medicine and Perioperative Care, Dalhousie University.\n==== Refs\nREFERENCES\n1. Boulanger A Clarke AJ Squire P Cui E Horbay GL Chronic pain in Canada: Have we improved our management of chronic non-cancer pain? Pain Res Manag 2007 12 39 47 17372633 \n2. Vallerand A Nowak L Chronic opioid therapy for nonmalignant pain: The patient’s perspective. Part 1 – Life before and after opioid therapy Pain Manag Nurs 2009 10 165 72 19706354 \n3. Gallagher RM Primary care and pain medicine: A community solution to a public health problem of chronic pain Med Clin North Am 1999 83 555 83 10386115 \n4. Merskey H Bogduk N Classification of Chronic Pain Definitions of Chronic Pain Syndromes and Definition of Pain Terms 2nd ed Seattle International Association for the Study of Pain 1994 \n5. Henry J The need for knowledge translation in chronic pain Pain Res Manag 2008 1 465 76 19225603 \n6. Clarke KA Iphofen R Accepting pain management or seeking pain cure: An exploration of patients’ attitudes to chronic pain Pain Manag Nurs 2007 8 102 10 17544130 \n7. Moulin DE Clarke AJ Speechley M Morley-Forster PK Chronic pain in Canada – Prevalence, treatment, impact and role of opioid analgesia Pain Res Manag 2002 7 179 84 12518174 \n8. Toth C Lander J Wiebe S The prevalence and impact of chronic pain with neuropathic pain symptoms in the general population Pain Med 2009 10 918 29 19594844 \n9. Gerstle DS All AC Wallance DC Quality of life and chronic non-malignant pain Pain Manag Nurs 2001 2 98 109 11710091 \n10. Smith JA Osborn M Pain as an assault on the self: An interpretative phenomenological analysis of the psychological impact of chronic benign low back pain Psych Health 2007 22 517 34 \n11. Unruh AM Henriksson C Psychological, environmental and behavioural dimensions of the pain experience Strong J Unruh AM Wright A Baxter DG Pain: A Textbook for Therapists Edinburgh Churchill Livingstone 2002 \n12. Unruh AM Harman K Generic principles of practice Strong J Unruh AM Wright A Baxter DG Pain: A Textbook for Therapists Edinburg Churchill Livingstone 2002 \n13. Canadian Pain Society Use of opioid analgesics for the treatment of chronic noncancer pain – A consensus statement and guidelines from the Canadian Pain Society Pain Res Manag 1998 3 197 208 \n14. Chou R Ballantyne JC Fanciullo GJ Fine PG Miaskowski C Research gaps of use of opioids for chronic noncancer pain: Findings from a review of the evidence for an American Pain Society and American Academy of Pain Medicine Clinical Practice guidelines Pain 2009 10 147 59 \n15. Lynch ME Watson PN The pharmacotherapy of chronic pain: A review Pain Res Manag 2006 11 11 33 16511612 \n16. Katz WA Opioids for nonmalignant pain Rheum Dis Clin North Am 2008 34 387 413 18638683 \n17. Noble M Treadwell JR Tregear SJ Long term opioid management of chronic noncancer pain The Cochrane Collaboration 2010 1 1 70 \n18. Passik SD Issues in long term opioid therapy: Unmet needs, risks, and solutions Mayo Clin Proc 2009 84 593 601 19567713 \n19. Silversides A Regulatory colleges to set painkiller guidelines CMAJ 2009 181 464 7 19770252 \n20. Vallerand AH The use of long-acting opioids in chronic pain management Nurs Clin North Am 2003 38 435 45 14567201 \n21. Veillette Y Dion D Altier N Choinere M The treatment of chronic pain in Québec: A study of hospital-based services offered within anesthesia departments Can J Anaesth 2005 52 600 6 15983145 \n22. Fischer B Rehm J Ratra J Firestone Cruz M Changes in illicit opioid use profiles across Canada CMAJ 2006 175 1385 7 17116905 \n23. Dhalla IA Mamdani MM Sivilotti ML Kopp A Juurlink DN Prescribing of opioid analgesics and related mortality before and after the introduction of long-acting oxycodone CMAJ 2009 181 891 6 19969578 \n24. Dhalla IA Mamdani MM Gomes T Juurlink DN Clustering of opioid prescribing and opioid related mortality among family physicians in Ontario Can Fam Physician 2001 57 e92 e96 21402956 \n25. Gomes T Juurlink DN Dhalla IA Mailis-Gagnon A Paterson MJ Mamdani MM Trends in opioid use and dosing among socio-economically disadvantaged patients Open Med 2001 5 213 22 \n26. Glajchen M Chronic pain: Treatment barriers and strategies for clinical practice J Am Board Fam Pract 2001 14 211 18 11355054 \n27. Gunnardsdottir S Donovan H Ward S Interventions to overcome clinician and patient-related barriers to pain management Nurs Clin North Am 2003 38 419 34 14567200 \n28. Lynch ME Fischer B Prescription opioid abuse: What is the real problem and how do we fix it? Can Fam Physician 2011 57 1241 2 22084451 \n29. Peppin JF The marginalization of chronic pain patients on chronic opioid therapy Pain Physician 2009 12 493 8 19461818 \n30. Wilsey BL Fishman SM Crandall M Casamalhuapa C Bertakis KD A qualitative study of the barriers to chronic pain management in the ED Am J Emerg Med 2008 26 255 63 18358933 \n31. Whalen E Ashbridge M Haydt S Representation of OxyContin in North American newspapers and medical journals Pain Res Manag 2001 16 252 8 \n32. Fornili K Weaver M Pain and addiction: Policy and advocacy J Am Nurs 2008 19 213 6 \n33. Holloway I Sofaer-Bennett B Walker J The stigmatisation of people with chronic back pain Disabil Rehabil 2007 29 1456 64 17729093 \n34. Slade CS Molloy E Keating JL Stigma experienced by people with nonspecific chronic low back pain: A qualitative study Pain Med 2009 10 143 54 19222775 \n35. Butchart A Kerr EA Heisler M Piette JD Krein SL Experience and management of chronic pain among patients with other complex chronic conditions Clin J Pain 2009 25 293 8 19590477 \n36. Broekmans S Dobbels F Milisen K Morlion B Vanderschueren S Medication adherence in patients with chronic non-malignant pain: Is there a problem? Eur J Pain 2009 13 115 23 18467138 \n37. Gallagher RM Opioids in chronic pain management: Navigating the clinical and regulatory challenges J Fam Pract 2004 53 S23 32 15469762 \n38. Gardner JR Sandhu G The stigma and enigma of chronic non-malignant back pain (CNMBP) treated with long term opioids (LTO) Contemp Nurse 1997 6 61 6 9306789 \n39. Hutchinson K Moreland AME Williams A Weinman J Horne R Exploring beliefs and practice of opioid prescribing for persistent non-cancer pain by general practitioners Eur J Pain 2007 11 93 8 16487734 \n40. Manchikanit L Siram A Trescot A Giodano J Monitoring opioid adherence in chronic pain patients: Tools, techniques and utility Pain Physician 2008 11 S155 80 18443638 \n41. O’Brien C Addiction and dependence in DSM-V Addiction 2011 106 866 7 21477226 \n42. Lynch ME The need for a Canadian pain strategy Pain Res Manag 2011 16 77 80 21499581 \n43. Barkin RL Lubenow TR Bruehl S Husfeldt B Ivankovich O Barkin SJ Management of chronic pain. Part II Disease-a-Month 1996 42 457 507 8757198 \n44. Price B Illness careers. The chronic illness experience J Adv Nurs 1996 24 275 9 8858430 \n45. Smith J Flowers P Larkin M Interpretive Phenomenological Analysis: Theory, Method and Research Thousand Oaks Sage 2009 \n46. Lynch ME Introduction to management Lynch M Craig K Peng P Clinical Pain Management: A Practical Guide United Kingdom Wiley-Blackwell 2011 91 5 \n47. Lazarus RS Folkman S Stress, Appraisal and Coping New York Springer 1984 \n48. Park CL Folkman S Meaning in the context of stress and coping Rev Gen Psychol 1997 1 115 44 \n49. McCracken LM Vowles KE Acceptance of chronic pain Cur Pain Head Rep 2006 10 90 4 \n50. LaChapelle DL Lavoie S Boudreau A The meaning and process of pain acceptance. Perceptions of women living with arthritis/fibromyalgia Pain Res Manag 2008 13 201 10 18592056 \n51. McCracken LM Vowles KE Zhao-O’Brien J Further development of an instrument to assess psychological flexibility in people with chronic pain J Behav Med 2010 33 346 54 20502955 \n52. Risdon A Eccleston C Crombez G McCracken L How can we learn to live with pain? A Q-methodological analysis of the diverse understandings of acceptance of chronic pain Soc Sci Med 2003 56 375 86 12473322 \n53. Goldberg DS McGee SJ Pain as a global public health priority BMC Public Health 2011 11 770 5 21978149 \n54. Ives TJ Chelminski PR Hammet-Stabler CA Predictors of opioid misue in patients with chronic pain: A prospective cohort study Health Sci Res 2006 6 1 10 \n55. McCracken L Learning to live with the pain: Acceptance of pain predicts adjustment inpersons with chronic pain Pain 1998 74 21 2 9514556 \n56. Barr VJ Robinson S Marin-Link B The expanded chronic care model: An integration of concepts and strategies from population health promotion and the chronic care model Hosp Q 2003 7 73 82 14674182 \n57. Gunnarsdottir S Donovan HS Ward S Interventions to overcome clinician- and patient-related barriers to pain management Nurs Clin North Am 2003 38 419 34 14567200 \n58. Katz PN Adams EH Benneyan JC Foundations of opioids risk management Clin J Pain 2007 23 103 18 17237659 \n59. Rathmell JP Jamison RN Opioid therapy for chronic non-cancer pain Cur Opin Anesth 1996 9 436 42 \n60. Sessle BJ Unrelieved pain: A crisis Pain Res Manag 2011 16 416 42 22184550 \n61. Watt-Watson J McGillion M Hunter J A survey of pre-licensure pain curricula in health science faculties in Canadian universities Pain Res Manag 2009 14 439 44 20011714 \n62. American Academy of Pain Medicine Facts on Pain <www.painmed.org/patient/facts.html > (Accessed October 20, 2010). \n63. Eriksen J Sjogren P Bruera E Ekholm O Rasmussen NK Critical issues on opioids in chronic non-cancer pain: An epidemiological study Pain 2006 125 172 9 16842922 \n64. Gardner-Nix J Principles of opioid use in chronic noncancer pain CMAJ 2003 169 38 43 12847039\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1203-6765",
"issue": "20(1)",
"journal": "Pain research & management",
"keywords": null,
"medline_ta": "Pain Res Manag",
"mesh_terms": "D000328:Adult; D000701:Analgesics, Opioid; D002170:Canada; D005260:Female; D006801:Humans; D007407:Interviews as Topic; D008297:Male; D008875:Middle Aged; D010146:Pain",
"nlm_unique_id": "9612504",
"other_id": null,
"pages": "15-22",
"pmc": null,
"pmid": "25562838",
"pubdate": "2015",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "14685304;17729093;22184550;21499581;21978149;22046214;11355054;11710091;12473322;12518174;12847039;14567200;14567201;14674182;18358933;18443638;18592056;18638683;18467138;19187891;19222775;19225603;19461818;19567713;19590477;19594844;19706354;19770252;19969578;20011714;20502955;10386115;22059195;22084451;21477226;15469762;8757198;8858430;9306789;9514556;15983145;16511612;16539860;16842922;16487734;17116905;17237659;17372633;17544130;21402956",
"title": "Exploring the lived experience of adults using prescription opioids to manage chronic noncancer pain.",
"title_normalized": "exploring the lived experience of adults using prescription opioids to manage chronic noncancer pain"
} | [
{
"companynumb": "CA-ROXANE LABORATORIES, INC.-2015-RO-00517RO",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MORPHINE"
},
"drugaddition... |
{
"abstract": "Sugammadex is a modified cyclodextrin that is being increasingly used in anesthetic practice worldwide for the reversal of the aminosteroid neuromuscular blockers rocuronium and vecuronium. Its safety profile, however, is incompletely understood. One such aspect is the incidence of anaphylactic reactions that occur after its administration. While several case reports exist in the literature, there is a paucity of information on the actual incidence of anaphylactic reactions.\n\n\n\nA single-center retrospective chart review identified patients who experienced anaphylaxis to sugammadex in the institutional electronic medical record system. These charts were then reviewed to determine whether the etiology of anaphylaxis was sugammadex administration.\n\n\n\nTwo patients experienced anaphylaxis to sugammadex, which occurred in a single institution cohort of 19,821 patients who received 23,446 total doses. This rate is markedly lower than the 1/300 that the manufacturer's package insert states and also lower than the 1/2500 that the only other large cohort study performed has reported.\n\n\n\nThe incidence of anaphylaxis to sugammadex in this cohort of patients was 2 of 19,821 patients, who received a total of 23,446 doses.",
"affiliations": "From the Department of Anesthesiology, Perioperative and Pain Medicine, Stanford University School of Medicine, Stanford, California.",
"authors": "Burbridge|Mark A|MA|",
"chemical_list": "D003473:Neuromuscular Nondepolarizing Agents; D000077122:Sugammadex; D000077123:Rocuronium",
"country": "United States",
"delete": false,
"doi": "10.1213/ANE.0000000000004752",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-2999",
"issue": "132(1)",
"journal": "Anesthesia and analgesia",
"keywords": null,
"medline_ta": "Anesth Analg",
"mesh_terms": "D000369:Aged, 80 and over; D000707:Anaphylaxis; D015331:Cohort Studies; D005260:Female; D006801:Humans; D015994:Incidence; D008297:Male; D008875:Middle Aged; D003473:Neuromuscular Nondepolarizing Agents; D012189:Retrospective Studies; D000077123:Rocuronium; D000077122:Sugammadex",
"nlm_unique_id": "1310650",
"other_id": null,
"pages": "93-97",
"pmc": null,
"pmid": "32243295",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Incidence of Anaphylaxis to Sugammadex in a Single-Center Cohort of 19,821 Patients.",
"title_normalized": "incidence of anaphylaxis to sugammadex in a single center cohort of 19 821 patients"
} | [
{
"companynumb": "US-009507513-2004USA003313",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PROPOFOL"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nTopical minoxidil solution (TMS) is widely used for androgenetic alopecia (AGA), and this is the first report of a large safety trial.\n\n\nOBJECTIVE\nThe aim of the study was to evaluate the safety profile of TMS by comparing hospitalization and death rates among subjects using TMS with controls. Cardiovascular safety and pregnancy outcomes were evaluated, and usage patterns were described.\n\n\nMETHODS\nAll subjects were followed at baseline, 3, 6, 9, and 12 months. Usage patterns, pregnancy status, overnight hospital stays, and cardiovascular risk factors were evaluated. Subjects rated effectiveness of TMS in the treatment of AGA. Statistical analyses were conducted to determine if TMS was associated with an increased risk of death or hospitalization.\n\n\nRESULTS\nTMS is a safe and effective treatment for AGA. There were no increases in cardiovascular events and no apparent increased risk for adverse pregnancy outcomes.\n\n\nCONCLUSIONS\nThis large, prospective study demonstrated the overall safety of TMS in the treatment of AGA.",
"affiliations": "Division of Dermatology, Department of Medicine, The University of British Columbia, Vancouver, British Columbia, Canada. shapiro@interchange.ubc.ca",
"authors": "Shapiro|Jerry|J|",
"chemical_list": "D012996:Solutions; D014665:Vasodilator Agents; D008914:Minoxidil",
"country": "United States",
"delete": false,
"doi": "10.1007/s10227-002-0121-6",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1203-4754",
"issue": "7(4)",
"journal": "Journal of cutaneous medicine and surgery",
"keywords": null,
"medline_ta": "J Cutan Med Surg",
"mesh_terms": "D000287:Administration, Topical; D000293:Adolescent; D000328:Adult; D000368:Aged; D000505:Alopecia; D002318:Cardiovascular Diseases; D005260:Female; D006760:Hospitalization; D006801:Humans; D008297:Male; D008875:Middle Aged; D008914:Minoxidil; D011247:Pregnancy; D011256:Pregnancy Outcome; D011446:Prospective Studies; D012996:Solutions; D016896:Treatment Outcome; D014665:Vasodilator Agents",
"nlm_unique_id": "9614685",
"other_id": null,
"pages": "322-9",
"pmc": null,
"pmid": "14735400",
"pubdate": "2003",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Safety of topical minoxidil solution: a one-year, prospective, observational study.",
"title_normalized": "safety of topical minoxidil solution a one year prospective observational study"
} | [
{
"companynumb": "CA-PFIZER INC-2017419277",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MINOXIDIL"
},
"drugadditional": "3",
... |
{
"abstract": "METHODS\nFemale, 30 FINAL DIAGNOSIS: Nocardiosis Symptoms: Cardiac tamponade • cough • dyspnea • hoarseness • mediastinal mass • pericardial effusion • short of breath\n\n\nMETHODS\n- Clinical Procedure: - Specialty: Transplantology.\n\n\nOBJECTIVE\nRare disease.\n\n\nBACKGROUND\nNocardia infections can complicate solid organ transplantation. The usual clinical presentations include pulmonary infiltrates with or without cavitation and subcutaneous and brain abscesses. We report an unusual case of nocardia infection in a kidney transplant recipient that presented as mediastinal mass and was associated with pericardial tamponade.\n\n\nMETHODS\nA 30 year old African American renal transplant recipient presented with cough, hoarseness and shortness of breath nine months after kidney transplantation. She received basiliximab perioperatively and her maintenance immunosuppression included tacrolimus, mycophenolate mofetil and prednisone. Computed tomography (CT) showed a large mediastinal mass with a large pericardial effusion. An echocardiogram revealed collapse of the right ventricle consistent with tamponade. We performed emergent pericardiocentesis to treat the tamponade. A mediastinoscopic biopsy of the mediastinal mass was done to establish a diagnosis. The mediastinal biopsy confirmed the growth of Nocardia. After 2 weeks of imipenem and 6 weeks of linezolid, there was marked radiographic improvement in the size of the mediastinal mass.\n\n\nCONCLUSIONS\nWe report a rare case of a large mediastinal mass associated with pericardial tamponade from nocardia infection in a renal transplant recipient. An invasive approach may be necessary to obtain tissue diagnosis to direct treatment in these cases. Prompt and appropriate medical therapy leads to marked radiographic improvement.",
"affiliations": "Medical University of South Carolina, Department of Medicine, Division of Nephrology, Charleston, SC, U.S.A.",
"authors": "Salazar|Maria Nieva|MN|;Wray|Dannah|D|;Denlinger|Chadrick|C|;Srinivas|Titte|T|;Thomas|Beje|B|;Posadas|Aurora|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12659/AJCR.889383",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1941-5923",
"issue": "14()",
"journal": "The American journal of case reports",
"keywords": "kidney transplantation; mediastinal mass; nocardia; pericardial tamponade",
"medline_ta": "Am J Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "295-9",
"pmc": null,
"pmid": "23940824",
"pubdate": "2013",
"publication_types": "D016428:Journal Article",
"references": "8783685;9725785;23250348;17727619;22469352;16101725;19508699;22844621;22200027;17443467;21309966;21785288;23224088;16614249;20353380;22215305;22089782;21839216",
"title": "Mediastinal mass and pericardial tamponade in a renal transplant recipient: A rare case of nocardia infection.",
"title_normalized": "mediastinal mass and pericardial tamponade in a renal transplant recipient a rare case of nocardia infection"
} | [
{
"companynumb": "US-APOTEX-2017AP023864",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PENTAMIDINE"
},
"drugadditional": "1",
... |
{
"abstract": "Psychiatric and behavioral side effects (PBSEs) are a major cause of antiepileptic drug (AED) withdrawal. Levetiracetam (LEV) is a recognized first-line AED with good seizure outcomes but recognized with PBSEs. Eslicarbazepine (ESL) is considered to function similarly to an active metabolite of the commonly used carbamazepine (CBZ). Carbamazepine is used as psychotropic medication to assist in various psychiatric illnesses such as mood disorders, aggression, and anxiety.\n\n\n\nThe aim was to evaluate the psychiatric profile of ESL in people who had LEV withdrawn due to PBSEs in routine clinical practice to see if ESL can be used as a possible alternative to LEV.\n\n\n\nA retrospective observational review was conducted in two UK epilepsy centers looking at all cases exposed to ESL since its licensing in 2010. The ESL group was all patients with treatment-resistant epilepsy who developed intolerable PBSEs to LEV, subsequently trialed on ESL. The ESL group was matched to a group who tolerated LEV without intolerable PBSEs. Psychiatric disorders were identified from case notes. The Hamilton Depression Scale (HAM-D) was used to outcome change in mood. Clinical diagnoses of a mental disorder were compared between groups using the Fisher's exact test. Group differences in HAM-D scores were assessed using the independent samples t-test (alpha=0.05).\n\n\n\nThe total number of people with active epilepsy in the two centers was 2142 of whom 46 had been exposed to ESL. Twenty-six had previous exposure to LEV and had intolerable PBSEs who were matched to a person tolerating LEV. There was no statistical differences in the two groups for mental disorders including mood as measured by HAM-D (Chi-square test: p=0.28).\n\n\n\nThe ESL was well tolerated and did not produce significant PBSEs in those who had PBSEs with LEV leading to withdrawal of the drug. Though numbers were small, the findings suggest that ESL could be a treatment option in those who develop PBSEs with LEV and possibly other AEDs.",
"affiliations": "Ramaiah Medical College and Hospitals, Bengaluru, Karnataka 560054, India.;Cornwall Partnership NHS Foundation Trust, Threemilestone Industrial Estate, Truro TR4 9LD, UK; Exeter Medical School, Knowledge Spa, Royal Cornwall Hospital, Truro, Cornwall TR1 3HD, UK. Electronic address: Rohit.shankar@nhs.net.;Exeter Medical School, Knowledge Spa, Royal Cornwall Hospital, Truro, Cornwall TR1 3HD, UK.;Royal Cornwall Hospital, Truro, Cornwall TR1 3LJ, UK.;Royal Wolverhampton NHS Trust, UK.;Royal Cornwall Hospital, Truro, Cornwall TR1 3LJ, UK.;Bial Pharma Ltd., Admiral House, Windsor SL4 3BL, UK.;NIHR University College London Hospitals Biomedical Research Centre, UCL Institute of Neurology, Queen Square, London WC1N 3BG, UK; Chalfont Centre for Epilepsy, Chalfont St Peter, Buckinghamshire SL9 0RJ, UK; Stichting Epilepsie Instellingen Nederland (SEIN), Achterweg 5, 2103 SW Heemstede, Netherlands.",
"authors": "Jalihal|Virupakshi|V|;Shankar|Rohit|R|;Henley|William|W|;Parrett|Mary|M|;Tittensor|Phil|P|;McLean|Brendan N|BN|;Ahmed|Ammad|A|;Sander|Josemir W|JW|",
"chemical_list": "D000927:Anticonvulsants; D003984:Dibenzazepines; D061567:Voltage-Gated Sodium Channel Blockers; D000077287:Levetiracetam; C416835:eslicarbazepine acetate",
"country": "United States",
"delete": false,
"doi": "10.1016/j.yebeh.2018.01.020",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1525-5050",
"issue": "80()",
"journal": "Epilepsy & behavior : E&B",
"keywords": "Behavior; Eslicarbazepine; Levetiracetam; Psychiatric side effects",
"medline_ta": "Epilepsy Behav",
"mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D003984:Dibenzazepines; D057915:Drug Substitution; D064420:Drug-Related Side Effects and Adverse Reactions; D004827:Epilepsy; D005260:Female; D006801:Humans; D000077287:Levetiracetam; D008297:Male; D001523:Mental Disorders; D008875:Middle Aged; D011569:Psychiatric Status Rating Scales; D012189:Retrospective Studies; D012640:Seizures; D013375:Substance Withdrawal Syndrome; D016896:Treatment Outcome; D061567:Voltage-Gated Sodium Channel Blockers",
"nlm_unique_id": "100892858",
"other_id": null,
"pages": "365-369",
"pmc": null,
"pmid": "29415871",
"pubdate": "2018-03",
"publication_types": "D016428:Journal Article; D064888:Observational Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Eslicarbazepine acetate as a replacement for levetiracetam in people with epilepsy developing behavioral adverse events.",
"title_normalized": "eslicarbazepine acetate as a replacement for levetiracetam in people with epilepsy developing behavioral adverse events"
} | [
{
"companynumb": "IN-UCBSA-2018007324",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": null,
... |
{
"abstract": "Kounis syndrome is the coincidental occurrence of acute coronary syndromes with allergic or hypersensitivity reactions. Clinicians should be aware that various mediators of allergy can cause coronary spasm and even plaque rupture and thrombus formation, thereby causing a serious impact on the course, prognosis and management of the allergic reaction. We report a case of a 20 year old female who developed acute coronary syndrome after anaphylactic reaction to ibuprofen.",
"affiliations": null,
"authors": "Kumar|Anil|A|;Berko|Netanel S|NS|;Gothwal|Ritu|R|;Tamarin|Frank|F|;Jesmajian|Stephen S|SS|",
"chemical_list": "D000894:Anti-Inflammatory Agents, Non-Steroidal; D007052:Ibuprofen",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.ijcard.2009.04.049",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0167-5273",
"issue": "137(3)",
"journal": "International journal of cardiology",
"keywords": null,
"medline_ta": "Int J Cardiol",
"mesh_terms": "D054058:Acute Coronary Syndrome; D000707:Anaphylaxis; D000894:Anti-Inflammatory Agents, Non-Steroidal; D004342:Drug Hypersensitivity; D004562:Electrocardiography; D005260:Female; D006801:Humans; D007052:Ibuprofen; D011644:Puerperal Disorders; D055815:Young Adult",
"nlm_unique_id": "8200291",
"other_id": null,
"pages": "e79-80",
"pmc": null,
"pmid": "19482364",
"pubdate": "2009-11-12",
"publication_types": "D002363:Case Reports; D016422:Letter",
"references": null,
"title": "Kounis syndrome secondary to ibuprofen use.",
"title_normalized": "kounis syndrome secondary to ibuprofen use"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2016SP018137",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional":... |
{
"abstract": "A 76-year-old man presented to the emergency department complaining of acute urinary retention (AUR) and severe constipation. His recent medical history included 4 days of treatment in the community for gluteal herpes zoster with famciclovir. A transurethral catheter was passed and the patient completed a full course of famciclovir with resolution of constipation. The patient's catheter was successfully removed 3 weeks after his presentation. We report on the clinical presentation and management of an unusual case of AUR and constipation caused by a zoster viral infection of the S2-S4 dermatome.",
"affiliations": "Department of Urology, Galway University Hospitals, Galway, Ireland.;Department of Urology, Galway University Hospitals, Galway, Ireland.;Department of Urology, Galway University Hospitals, Galway, Ireland.",
"authors": "MacCraith|Eoin|E|http://orcid.org/0000-0002-5814-0722;Davis|Niall F|NF|;Walsh|Kilian|K|",
"chemical_list": "D000998:Antiviral Agents; D015075:2-Aminopurine; D000077595:Famciclovir",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-220068",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2017()",
"journal": "BMJ case reports",
"keywords": "Catheterisation / catheter care; Dermatology; Urinary and genital tract disorders",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D015075:2-Aminopurine; D000368:Aged; D000998:Antiviral Agents; D003248:Constipation; D003937:Diagnosis, Differential; D000077595:Famciclovir; D006562:Herpes Zoster; D006801:Humans; D008297:Male; D016055:Urinary Retention",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "28500125",
"pubdate": "2017-05-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12422336;13383174;18528318;5372022;8218686;8375446;8425796;9829425",
"title": "Acute urinary retention and constipation precipitated by herpes zoster infection.",
"title_normalized": "acute urinary retention and constipation precipitated by herpes zoster infection"
} | [
{
"companynumb": "IE-CIPLA LTD.-2017IE09474",
"fulfillexpeditecriteria": "1",
"occurcountry": "IE",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "FAMCICLOVIR"
},
"drugadditional": null,
... |
{
"abstract": "A higher risk of suicidal attempt after subthalamic nucleus deep brain stimulation (STN-DBS) for Parkinson's disease (PD) has been consistently reported. We retrospectively analyzed 3 PD patients with suicide attempts after STN-DBS. All patients had normal pre- and immediate postoperative psychopathological and cognitive evaluations, with STN-DBS yielding a good motor benefit. Levodopa medication was markedly reduced. Albeit there was a significant reduction in dopaminergic medication, there was also a considerable time lag to suicide attempt. Impulsive behavior could have played a higher role, going unnoticed in punctual psychopathological examinations. STN-DBS patients need a closer postoperative psychiatric and behavioral follow-up.",
"affiliations": "Faculdade de Medicina da Universidade do Porto, Porto, Portugal.",
"authors": "Rodrigues|Ana M|AM|;Rosas|Maria J|MJ|;Gago|Miguel F|MF|;Sousa|Cláudia|C|;Fonseca|Rosália|R|;Linhares|Paulo|P|;Basto|Margarida A|MA|;Sousa|Graça|G|;Garrett|Carolina|C|;Vaz|Rui|R|",
"chemical_list": "D000978:Antiparkinson Agents; D007980:Levodopa",
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000289097",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0014-3022",
"issue": "63(3)",
"journal": "European neurology",
"keywords": null,
"medline_ta": "Eur Neurol",
"mesh_terms": "D000978:Antiparkinson Agents; D046690:Deep Brain Stimulation; D005260:Female; D006801:Humans; D007980:Levodopa; D008297:Male; D008875:Middle Aged; D010300:Parkinson Disease; D020531:Subthalamic Nucleus; D013405:Suicide",
"nlm_unique_id": "0150760",
"other_id": null,
"pages": "176-9",
"pmc": null,
"pmid": "20197662",
"pubdate": "2010",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Suicide attempts after subthalamic nucleus stimulation for Parkinson's disease.",
"title_normalized": "suicide attempts after subthalamic nucleus stimulation for parkinson s disease"
} | [
{
"companynumb": "PT-BAUSCH-BL-2017-021169",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DILTIAZEM HYDROCHLORIDE"
},
"drugadditional": ... |
{
"abstract": "Multifocal lymphangioendotheliomatosis with thrombocytopenia is a rare disease characterized by multiple cutaneous and gastrointestinal (GI) vascular lesions and thrombocytopenia refractory to platelet and blood cell transfusions. GI bleeding can become life-threatening in this condition. We report a case of multifocal lymphangioendotheliomatosis with thrombocytopenia in a male infant with isolated GI involvement, diagnosed when he was 3 months old. The patient was managed with daily aminocaproic acid, octreotide drip, and corticosteroids for 13 months after diagnosis; he had complete resolution of symptoms by 2 years of age and showed adequate height and gain by 5 years of age. This case adds to the paucity of data in the literature pertaining to the disease's phenotypic variability, long-term clinical course, and management of GI bleeding.",
"affiliations": "Departments of Pediatrics, Division of Pediatric, Gastroenterology, Hepatology, and Nutrition.;Pathology, Section of Pediatric Pathology, University of Oklahoma, Oklahoma City, OK.;Departments of Pediatrics, Division of Pediatric, Gastroenterology, Hepatology, and Nutrition.",
"authors": "Shakir|Asiya K|AK|;Yu|Zhongxin|Z|;Altaf|Muhammad Adnan|MA|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D015282:Octreotide; D015119:Aminocaproic Acid",
"country": "United States",
"delete": false,
"doi": "10.1097/MPH.0000000000001324",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1077-4114",
"issue": "41(8)",
"journal": "Journal of pediatric hematology/oncology",
"keywords": null,
"medline_ta": "J Pediatr Hematol Oncol",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D015119:Aminocaproic Acid; D006471:Gastrointestinal Hemorrhage; D006801:Humans; D007223:Infant; D008202:Lymphangioma; D008297:Male; D015282:Octreotide; D013921:Thrombocytopenia",
"nlm_unique_id": "9505928",
"other_id": null,
"pages": "e534-e537",
"pmc": null,
"pmid": "30334900",
"pubdate": "2019-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Long-term Complications and Management of Gastrointestinal Bleeding in Multifocal Lymphangioendotheliomatosis.",
"title_normalized": "long term complications and management of gastrointestinal bleeding in multifocal lymphangioendotheliomatosis"
} | [
{
"companynumb": "US-MYLANLABS-2019M1120185",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "1",
... |
{
"abstract": "Spinal epidural hematoma is a rare but serious complication of epidural anaesthesia and neurological impairment. Epidural hematoma usually becomes evident within a few hours of the procedure. Delayed clinical presentation of spinal epidural hematoma is even rarer and insidious.\n\n\n\nWe reported a case of a 44-year-old woman who underwent a caesarean section for a twin pregnancy during which a delayed dorsal spinal epidural hematoma occurred. Symptoms were reported 5 days after surgery and 72 h after removal of the epidural catheter. An MRI scan showed a dorsal epidural hematoma. The patient was moved to the Neurosurgical Department and underwent decompression surgery.\n\n\n\nThe possibility of the delayed onset of a spinal epidural hematoma in a pregnant woman who undergoes epidural anaesthesia in labour must always be taken into consideration. In order to achieve the best clinical result, we stress the importance of a timely diagnosis and prompt surgical treatment.",
"affiliations": "Department of Obstetrics and Gynecology, Massa Carrara General Hospital, Via Enrico Mattei, 54100, Massa Carrara, Italy. alessandrosvelato@virgilio.it.;Department of Anaesthesia, Massa Carrara General Hospital, Massa Carrara, Italy.;Department of Anaesthesia, Massa Carrara General Hospital, Massa Carrara, Italy.;Department of Neurosurgery, S. Chiara Hospital, Pisa, Italy.;Department of Obstetrics and Gynecology, Imperia General Hospital, Imperia, Italy.;Department of Obstetrics and Gynecology, Massa Carrara General Hospital, Via Enrico Mattei, 54100, Massa Carrara, Italy.",
"authors": "Svelato|Alessandro|A|0000-0003-4713-9539;Rutili|Alberto|A|;Bertelloni|Caterina|C|;Foti|Domenico|D|;Capizzi|Angela|A|;Ragusa|Antonio|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12871-019-0721-y",
"fulltext": "\n==== Front\nBMC AnesthesiolBMC AnesthesiolBMC Anesthesiology1471-2253BioMed Central London 72110.1186/s12871-019-0721-yCase ReportCase report: difficulty in diagnosis of delayed spinal epidural hematoma in puerperal women after combined spinal epidural anaesthesia http://orcid.org/0000-0003-4713-9539Svelato Alessandro +39 349 1272580alessandrosvelato@virgilio.it 1Rutili Alberto a.rutili@inwind.it 2Bertelloni Caterina caterinabertelloni@gmal.com 2Foti Domenico domenfoti@gmail.com 3Capizzi Angela angela.capizzi@hotmail.con 4Ragusa Antonio antonio.ragusa@gmail.com 11 Department of Obstetrics and Gynecology, Massa Carrara General Hospital, Via Enrico Mattei, 54100 Massa Carrara, Italy 2 Department of Anaesthesia, Massa Carrara General Hospital, Massa Carrara, Italy 3 0000 0004 1756 8209grid.144189.1Department of Neurosurgery, S. Chiara Hospital, Pisa, Italy 4 Department of Obstetrics and Gynecology, Imperia General Hospital, Imperia, Italy 11 4 2019 11 4 2019 2019 19 5418 11 2018 28 3 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nSpinal epidural hematoma is a rare but serious complication of epidural anaesthesia and neurological impairment. Epidural hematoma usually becomes evident within a few hours of the procedure. Delayed clinical presentation of spinal epidural hematoma is even rarer and insidious.\n\nCase presentation\nWe reported a case of a 44-year-old woman who underwent a caesarean section for a twin pregnancy during which a delayed dorsal spinal epidural hematoma occurred. Symptoms were reported 5 days after surgery and 72 h after removal of the epidural catheter. An MRI scan showed a dorsal epidural hematoma. The patient was moved to the Neurosurgical Department and underwent decompression surgery.\n\nConclusion\nThe possibility of the delayed onset of a spinal epidural hematoma in a pregnant woman who undergoes epidural anaesthesia in labour must always be taken into consideration. In order to achieve the best clinical result, we stress the importance of a timely diagnosis and prompt surgical treatment.\n\nKeywords\nSpinal epidural hematomaObstetricLabourEpiduralDiagnosisCase reportissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nSpinal Epidural Hematoma (SEH), a rare but potentially devastating complication, is a symptomatic bleeding within the spine where blood accumulates outside the dura, mostly caused by traumatic or iatrogenic (spinal surgeries, obstetrical birth trauma, lumbar puncture, spinal manipulations, and epidural procedures) events [1]. SEH can cause rare but potentially catastrophic compression of neural tissue by direct injury or ischemia, with an incidence ranging from 1:2600 to 1:220.000 [2–6]. Parturients can also be predisposed to the development of an epidural hematoma, due to a decreased number or function of platelets (i.e., with pre-eclampsia or hemolysis, elevated liver enzymes, low platelet count [HELLP] syndrome) or anticoagulant use, even if pregnancy is a prothrombotic, hypercoagulable state [2].\n\nIn this manuscript we report a case of difficult diagnosis concerning a delayed epidural hematoma, due to combined spinal epidural (CSE) anaesthesia in a caesarean delivery.\n\nCase presentation\nA 44 year-old pregnant nulliparous, weight 70 Kg, height 172 cm, BMI 23.7, at 34 weeks of a twin gestation, obtained by “in vitro” fertilization, was admitted to the General Hospital of Massa, complaining spreading pricking and lower limb edema. The patient suffered from unstable insulin-dependent type I diabetes and sciatica. Considering 4 days of immobilization in bed, low molecular weight heparin (Dalteparin© 2500 UI one per day) was administered [7]. The patient underwent a planned caesarean section under double-space CSE anaesthesia, using a 25-gauge atraumatic spinal needle at level L3-L4 and an 18-gauge Thuoy needle at T12-L1 (B. Braun Perifix® epidural set), placed during a single attempt. Preoperative coagulation parameters were within normal range (Platelet count 120.000 per microliter of blood; Prothrombin time 12 s, Partial thromboplastin time 30 s, fibrinogen 540 mg/dL, INR 0.90). Renal function was normal. The operation was carried out routinely and multimodal pain therapy was started (Patient Controlled Epidural Anaesthesia - PCEA - with chirocaine 0,15% plus sufentanil 0,5 mcg/ml, 4 ml/h; i.v. ketorolac 30 mg/day and oral tramadol 30 mg plus acetaminophen 1000 mg/3 times/day). Four hours after the operation, the urinary catheter was removed, the patient began to stand up and to take care of the newborns. Dalteparin 2500 U/die was continued. PCEA was discontinued 2 days after the operation and the epidural catheter was removed on the 3rd day, 12 h after the last Dalteparin administration. Pain control was optimal. The following day, the patient remained hospitalized without any complications and the two babies were admitted in neonatology.\n\nAt 06.00 a.m. of the 6th post-operative day, more than 70 h after the removal of the epidural catheter, the patient complained of acute and severe low-back pain, radiating to the right inferior limb, and paresthesia; there was no motor impairment and she was treated with analgesic drugs without any improvement. After an abdominal ultrasound, urinary retention was observed and a bladder catheter was inserted (residual volume: 1100 ml). A right lower limb motor deficit was observed at 11:50 a.m. and methylprednisolone was administered. Since no improvement in the patient’s clinical picture was seen, urgent neurological consultation was requested 8 h after the onset of symptoms (02.00 p.m.). A dorsal MRI scan showed the presence of a T12-L1 posterior SEH, predominantly on the right side, with significant mass-effect and spinal cord signal alteration in the conus medullaris region (Figs. 1 and 2). The patient was transferred to the Neurosurgical Department for decompression laminectomy and removal of the hematoma and the operation began at 07.00 p.m.. Immediately after surgery, the patient partially recovered her sensory disorder and motor functions. Five days after surgery she began intensive rehabilitation.Fig. 1 Sagittal T2-weighted MRI shows hyperintense collection in the posterior spinal epidural space at level D12-L1 and spinal cord signal alteration\n\nFig. 2 Axial T2-weighted MRI shows hematoma compressing spinal cord from the right side\n\n\n\nIn the last follow-up examination (36 months later), while mostly improved, motor, sensory and sphincter deficits persisted in varying degrees. The last MRI confirmed signs of permanent ischemic injury at level T12-L1.\n\nDiscussion and conclusion\nNeuraxial techniques are used to provide analgesia for labour [8, 9] and anaesthesia for surgical delivery. Therefore, complications associated with neuraxial techniques are sometimes seen even in pregnant patients.\n\nWe have described a case of SEH, one of the more severe complications.\n\nIn our case, the acute and severe low-back pain, radiating to the right inferior limb, and paresthesia were the first signs reported by the patient. The physicians focused their attention only on the medical history of the patient’s sciatica, without first ruling out the more dangerous possible diagnosis, even if less frequent. Moreover, they also ignored the risk factors present. There are many risk factors for SEH, but is know that the most important are spinal/epidural procedures in combination with anticoagulant use [2, 3]. We used a double-space CSE anaesthesia, because a caesarean section is a major surgery, along with the concerns of potential surgical complications and longer operating time. If an epidural catheter is available, our protocol for postoperative pain management considers the possibility to prolong epidural analgesia for 48 h, in line with SIAARTI guidelines [10–12]. Moreover, our hospital is a Baby Friendly Hospital, which means that is at the forefront in the promotion of breastfeeding. In this view, postoperative pain control is of primary importance, with the aim of promoting skin to skin contact and the start of breastfeeding. Anticoagulation is also a risk factor for SEH, however the doses of drugs with effects on coagulation that we used, were very low (Deltaparina 2500 UI once daily and ketorolac 30 mg/die for 2 days) in consideration of the patient’s weight (70 Kg) [7].\n\nA delay in diagnostic imaging can lead to devastating outcomes, and is an error, since neurological symptoms and back pain can be attributed to epidural infusion and a prolonged effect of the local anaesthetic, or to a musculoskeletal origin [13].\n\nAnother element that made the diagnosis difficult was the appearance of the symptoms 3 days after the removal of the epidural catheter. This lag time is possible [14].\n\nThe second sign was urinary retention, followed by motor impairment. This case evolution is typical of a SEH [1]. In 30% of cases there is an acute onset of complete paralysis with bowel or bladder disturbances, while in 16% of cases, as well as in our case, the onset is less typical with incomplete paralysis [1, 3]. The presence of motor deficit is an indication for surgery [15]. In the case of sensory symptoms without motor deficit, surgery does not seem to improve outcomes and a wait-and-see approach, with meticulous follow up, seems to be the best option [15]. In the case of motor deficit, as well as in our case, decompression laminectomy within 12 h results in the best surgical outcome [3, 15, 16]. Nevertheless, literature reports cases of good outcome also in the case of surgery performed after 24 h from the onset of symptoms [15].\n\nIn conclusion, we should always suspect a delayed onset of SEH in a patient who undergoes epidural anaesthesia or other similar neuraxial procedures. We stress the importance of an early diagnosis of this serious complication and of prompt surgical treatment to maximize neurological improvement. Table 1 lists the most common “red flags” to notice and pitfalls to avoid for a prompt diagnosis.Table 1 Red flags and pitfalls in the diagnosis of spinal epidural hematoma\n\nRed flags in the diagnosis of spinal epidural hematoma\t\n 1) Considering only the most frequent diagnosis, without excluding serious but infrequent diagnoses\t\n 2) Persistent motor block\t\n 3) Bowel/bladder dysfunction\t\n 4) Other symptom (usually back or leg pain)\t\nPitfalls in the diagnosis of spinal epidural hematoma\t\n 1) Ignoring the risk factors\t\n 2) Administering treatment before making the diagnosis\t\n 3) Not performing surgery only because too much time has passed since the appearance of the symptoms (> 12 h)\t\n\n\nAfter this case we performed an audit that involved all staff members and we have introduced some actions of improvement. For example, we have changed the number of patient evaluation from 1 per day to 2 per day. We have organized a review day about SEH with the aim to inform all staff members about the onset of symptoms and early diagnosis of this condition.\n\nThe most important lesson to be learned from our case is thinking that SEH exists and is a potential complication of epidural anaesthesia, so we must always take this complication into consideration in the case of neurological symptoms appearance.\n\nSignificant back pain and/or lower limb pain, even if nonspecific symptoms, and in the absence of motor impairment, should alert all staff members to request an urgent neurological, neuroradiological and neurosurgical consultation, even in the late stages of patient hospitalization.\n\nAbbreviations\nCSECombined spinal epidural\n\nPCEAPatient Controlled Epidural Anaesthesia\n\nSEHSpinal Epidural Hematoma\n\nAcknowledgements\nNot applicable.\n\nFunding\nThere was no funding in this manuscript.\n\nAvailability of data and materials\nAll data and material described in the manuscript will be freely available to any scientist wishing to use them for non-commercial purposes. Raw data is not available as it is in the patient electronic medical record. Please consider the edited data in the case report.\n\nAuthors’ contributions\nAS, AC and AR contributed to writing and reviewing this manuscript. AR and CB contributed to performing anaesthesia. DF contributed to performing the neurosurgical operation. AS, AR and AC contributed to the collection of data. AS, AR, CB, DF and AR contributed to reviewing the manuscript. All authors have read and approved the final manuscript.\n\nEthics approval and consent to participate\nNot applicable.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this Case report. A copy of the written consent is available for review by the Editor of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Shaban A Moritani T Al Kasab S Sheharyar A Limaye KS Adams HP Jr Spinal cord hemorrhage J Stroke Cerebrovasc Dis 2018 27 6 1435 1446 10.1016/j.jstrokecerebrovasdis.2018.02.014 29555403 \n2. Hoefnagel A Yu A Kaminski A Anesthetic complications in pregnancy Crit Care Clin 2016 32 1 1 28 10.1016/j.ccc.2015.08.009 26600441 \n3. Kreppel D Antoniadis G Seeling W Spinal hematoma: a literature survey with meta-analysis of 613 patients Neurosurg Rev 2003 26 1 1 49 10.1007/s10143-002-0224-y 12520314 \n4. Bateman BT Mhyre JM Ehrenfeld J Kheterpal S Abbey KR Argalious M Berman MF Jacques PS Levy W Loeb RG Paganelli W Smith KW Wethington KL Wax D Pace NL Tremper K Sandberg WS The risk and outcome of epidural hematomas after perioperative and obstetric epidural catheterization: a report from the multicenter perioperative outcomes group research consortium Anesth Analg 2013 116 6 1380 1385 10.1213/ANE.0b013e318251daed 22504213 \n5. D’Angelo R Smiley RM Riley ET Segal S Serious complications related to obstetric anesthesia: the serious complication repository project of the Society for Obstetric Anesthesia and Perinatology Anesthesiology 2014 120 6 1505 1512 10.1097/ALN.0000000000000253 24845921 \n6. Ruppen W Derry S McQuay H Moore RA Incidence of epidural hematoma, infection, and neurologic injury in obstetric patients with epidural analgesia/anesthesia Anesthesiology 2006 105 2 394 399 10.1097/00000542-200608000-00023 16871074 \n7. Leffert Lisa Butwick Alexander Carvalho Brendan Arendt Katherine Bates Shannon M. Friedman Alex Horlocker Terese Houle Timothy Landau Ruth Dubois Heloise Fernando Roshan Houle Tim Kopp Sandra Montgomery Douglas Pellegrini Joseph Smiley Richard Toledo Paloma The Society for Obstetric Anesthesia and Perinatology Consensus Statement on the Anesthetic Management of Pregnant and Postpartum Women Receiving Thromboprophylaxis or Higher Dose Anticoagulants Anesthesia & Analgesia 2018 126 3 928 944 10.1213/ANE.0000000000002530 29099429 \n8. Ragusa Antonio Gizzo Salvatore Noventa Marco Ferrazzi Enrico Deiana Sara Svelato Alessandro Prevention of primary caesarean delivery: comprehensive management of dystocia in nulliparous patients at term Archives of Gynecology and Obstetrics 2016 294 4 753 761 10.1007/s00404-016-4046-5 26924640 \n9. Svelato A Di Tommaso M Spinoso R Ragusa A The reduction of first cesarean sections: a cultural issue Acta Obstet Gynecol Scand 2016 95 11 1319 10.1111/aogs.12962 27517646 \n10. Gogarten W Vandermeulen E Van Aken H Kozek S Llau JV Samama CM Regional anaesthesia and antithrombotic agents: recommendations of the European Society of Anaesthesiology Eur J Anaesthesiol 2010 27 12 999 1015 10.1097/EJA.0b013e32833f6f6f 20890208 \n11. Bertini L Savoia G De Nicola A Ivani G Gravino E Albani A Alemanno F Barbati A Borghi B Borrometi F Casati A Celleno D Ciaschi A Corcione A De Negri P Di Benedetto P Evangelista M Fanelli G Grossi P Loreto M Margaria E Mastronardi P Mattia C Nicosia F Nolli M Rutili A Santangelo E Sucre J Tagariello V Varrassi G Paoletti F Tufano R SIAARTI. SIAARTI guidelines for safety in locoregional anaesthesia Minerva Anestesiol 2006 72 9 689 722 16871153 \n12. Savoia G Alampi D Amantea B Ambrosio F Arcioni R Berti M Bettelli G Bertini L Bosco M Casati A Castelletti I Carassiti M Coluzzi F Costantini A Danelli G Evangelista M Finco G Gatti A Gravino E Launo C Loreto M Mediati R Mokini Z Mondello E Palermo S Paoletti F Paolicchi A Petrini F Piacevoli Q Rizza A Sabato AF Santangelo E Troglio E Mattia C SIAARTI study group. Postoperative pain treatment SIAARTI recommendations 2010. Short version Minerva Anestesiol 2010 76 8 657 667 20661210 \n13. Maddali P Moisi M Page J Chamiraju P Fisahn C Oskouian R Tubbs RS Anatomical complications of epidural anesthesia: a comprehensive review Clin Anat 2017 30 3 342 346 10.1002/ca.22831 28165638 \n14. Guffey PJ McKay WR McKay RE Case report: epidural hematoma nine days after removal of a labor epidural catheter Anesth Analg 2010 111 4 992 995 20675412 \n15. Lagerkranser M Lindquist C Neuraxial blocks and spinal haematoma: review of 166 cases published 1994 - 2015. Part 2: diagnosis, treatment, and outcome Scand J Pain 2017 15 130 136 10.1016/j.sjpain.2016.11.009 28850336 \n16. Lawton MT Porter RW Heiserman JE Jacobowitz R Sonntag VKH Dickman CA Surgical management of spinal epidural hematoma: relationship between surgical timing and neurological outcome J Neurosurg 1995 83 1 1 7 10.3171/jns.1995.83.1.0001 7782824\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2253",
"issue": "19(1)",
"journal": "BMC anesthesiology",
"keywords": "Case report; Diagnosis; Epidural; Labour; Obstetric; Spinal epidural hematoma",
"medline_ta": "BMC Anesthesiol",
"mesh_terms": "D000328:Adult; D000767:Anesthesia, Epidural; D000775:Anesthesia, Spinal; D002585:Cesarean Section; D003937:Diagnosis, Differential; D004359:Drug Therapy, Combination; D005260:Female; D046748:Hematoma, Epidural, Spinal; D006801:Humans; D049590:Postpartum Period; D011247:Pregnancy; D011644:Puerperal Disorders",
"nlm_unique_id": "100968535",
"other_id": null,
"pages": "54",
"pmc": null,
"pmid": "30975081",
"pubdate": "2019-04-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "20675412;29099429;16871153;28165638;26600441;22504213;20661210;28850336;27517646;7782824;20890208;29555403;12520314;24845921;26924640;16871074",
"title": "Case report: difficulty in diagnosis of delayed spinal epidural hematoma in puerperal women after combined spinal epidural anaesthesia.",
"title_normalized": "case report difficulty in diagnosis of delayed spinal epidural hematoma in puerperal women after combined spinal epidural anaesthesia"
} | [
{
"companynumb": "IT-ABBVIE-20K-083-3339777-00",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": null,
... |
{
"abstract": "Pancreatic cancer has a poor prognosis, and it is traditionally treated with chemotherapy. Fortunately, immunotherapy has rapidly changed the landscape of solid tumor treatment, and improving the survival of cancer patients. However, pancreatic cancer is non-immunogenic, and single agent immunotherapies are unfavorable to its prognosis.\nHere, we report a case of stage IV pancreatic cancer in a patient with TSC2 and SMAD4 mutations treated with immunotherapy when the disease progressed after multi-line chemotherapy. Next generation sequencing (NGS) confirmed the presence of TSC2 and SMAD4 mutations and microsatellite stability (MSS). When the disease progressed after chemotherapy, a combination strategy was devised consisting of chemotherapy (S-1) and sintilimab. The patient had a partial response to therapy with this regimen, the lesions were significantly reduced and nearly disappeared. In metastatic pancreatic cancer, responses of this magnitude are rarely seen.\nThis outcome reveals that this combination can be effective in treating metastatic pancreatic cancer, especially in pancreatic cancer patients with SMAD4 and TSC2 mutations. This may help increase the use of this therapy in large-scale clinical research.",
"affiliations": "The Fourth School of Clinical Medicine, Zhejiang Chinese Medical University, Hangzhou, China.;Department of Oncology, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou, China.",
"authors": "Ye|Yanghui|Y|;Zheng|Song|S|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fimmu.2021.785400",
"fulltext": "\n==== Front\nFront Immunol\nFront Immunol\nFront. Immunol.\nFrontiers in Immunology\n1664-3224\nFrontiers Media S.A.\n\n10.3389/fimmu.2021.785400\nImmunology\nCase Report\nSuccessful Immunotherapy for Pancreatic Cancer in a Patient With TSC2 and SMAD4 Mutations: A Case Report\nYe Yanghui 1 2\n\nZheng Song 2 3 4 *\n1 The Fourth School of Clinical Medicine, Zhejiang Chinese Medical University, Hangzhou, China\n2 Department of Oncology, Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine, Hangzhou, China\n3 Department of Oncology, Affiliated Hangzhou Cancer Hospital, Zhejiang University School of Medicine, Hangzhou, China\n4 Laboratory of Clinical Cancer Pharmacology and Toxicology Research of Zhejiang Province, Hangzhou, China\nEdited by: Liangrong Shi, Central South University, China\n\nReviewed by: Sid P. Kerkar, EXUMA Biotech, United States; Philippe Rochigneux, Institut Paoli-Calmettes (IPC), France\n\n*Correspondence: Song Zheng, tztree@126.com\nThis article was submitted to Cancer Immunity and Immunotherapy, a section of the journal Frontiers in Immunology\n\n22 11 2021\n2021\n12 78540029 9 2021\n01 11 2021\nCopyright © 2021 Ye and Zheng\n2021\nYe and Zheng\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nBackground\n\nPancreatic cancer has a poor prognosis, and it is traditionally treated with chemotherapy. Fortunately, immunotherapy has rapidly changed the landscape of solid tumor treatment, and improving the survival of cancer patients. However, pancreatic cancer is non-immunogenic, and single agent immunotherapies are unfavorable to its prognosis.\n\nCase Presentation\n\nHere, we report a case of stage IV pancreatic cancer in a patient with TSC2 and SMAD4 mutations treated with immunotherapy when the disease progressed after multi-line chemotherapy. Next generation sequencing (NGS) confirmed the presence of TSC2 and SMAD4 mutations and microsatellite stability (MSS). When the disease progressed after chemotherapy, a combination strategy was devised consisting of chemotherapy (S-1) and sintilimab. The patient had a partial response to therapy with this regimen, the lesions were significantly reduced and nearly disappeared. In metastatic pancreatic cancer, responses of this magnitude are rarely seen.\n\nConclusions\n\nThis outcome reveals that this combination can be effective in treating metastatic pancreatic cancer, especially in pancreatic cancer patients with SMAD4 and TSC2 mutations. This may help increase the use of this therapy in large-scale clinical research.\n\npancreatic cancer\nimmunotherapy\nchemotherapy\nnext generation sequencing (NGS)\nSMAD4\nTSC2\n==== Body\npmcIntroduction\n\nPancreatic cancer has a high incidence and mortality, and its special structure can protect pancreatic cancer cells from chemotherapeutic agents (1, 2). However, pancreatic cancer is non-immunogenic and single agent immunotherapies are unfavorable to the prognosis of patients. Several clinical trials showed that single agent immunotherapies are ineffective for the treatment of advanced pancreatic cancer (3–5). Moreover, there was a clinical trial confirmed that objective response rate (ORR) was 0 for patients receiving single agent immunotherapies (5).\n\nHowever, the effect of combination therapy is also not optimistic. As for chemotherapy plus immunotherapy, some clinical trials confirmed that the safety profile of combination therapy at standard doses in advanced pancreatic cancer was manageable (6, 7), but there was no significant improvement in progression-free survival (PFS) and overall survival (OS) (6, 8).\n\nThough, the pancreatic cancer has little response rate to immunotherapy, it may be effective for specific patient. For example, several gene mutations can improve the effective of immunotherapy (9), including high levels of microsatellite instability (MSI-H), POLE, POLD1, et al.\n\nCase Presentation\n\nWe present the case of a 56-year-old Chinese man who had been smoking and drinking for decades. He was hospitalized for six months with abdominal pain. In September 2019, magnetic resonance imaging (MRI) of the upper abdomen identified a pancreatic head mass, multiple retroperitoneal enlarged lymph nodes, and abnormal enhancement near the inferior vena cava in right lobe of the liver. Ultrasound guided biopsy of the pancreas was performed. Pathology diagnosis was pancreatic ductal adenocarcinoma (stage IV) ( Figures 1A, B ). Next generation sequencing (NGS) confirmed the tumor was microsatellite stability (MSS), and a total of 6 gene mutations, TSC2, CREBBP, HIST1H3I, MAP2K4, SMAD4, and STK11 were detected. Additionally, frame shift mutation occurred in exon 17 of TSC2 gene (32.13%); missense mutation occurred in exon 9 (7.47%) and nonsense mutation occurred in exon 5 (9.49%) of SMAD4 gene. The NGS confirmed that there were no targeted drug-related gene mutations and the tumor mutational burden (TMB) was 7.1 mut/Mb.\n\nFigure 1 (A, B) pancreatic ductal adenocarcinoma. (A) 200X, (B) 400X. The pancreatic head puncture smear showed significant atypical epithelial mass, irregular nuclei, which was consistent with the changes of adenocarcinoma. (C–F) PET/CT images in April 2020. (C) showed a 6.0cm *6.0 cm mass in pancreatic head (arrow); (D) confirmed enlarged lymph nodes in pancreatic head (arrow), and low-density shadows in liver (within cycle); panels (E, F) revealed enlarged multiple lymph nodes in different sizes in retroperitoneum (arrow).\n\nIn October 2019, the patient’s primary oncologist started him on AG (gemcitabine and nab-paclitaxel). The gemcitabine (1000mg/m² over 30 minutes, weekly for 2 weeks, every 21 days) and nab-paclitaxel (125mg/m², weekly for 2 weeks, every 21 days) were administered intravenously. However, in the first three cycles and the fifth cycle of chemotherapy, for several reasons (such as COVID-19), he only received chemotherapeutic agents (AG) on the first day. In March 2020, the repeated MRI showed progressive disease. In late March 2020, the patient developed back pain and underwent endoscopic retrograde cholangiopancreatography (ERCP) and endoscopic metal biliary endoprosthesis (EMBE) due to obstructive jaundice. In April 2020, positron emission tomography/computed tomography (PET/CT) revealed a 6.0 cm × 6.0 cm mass in pancreatic head, multiple enlarged lymph nodes in different sizes were found in pancreatic head and retroperitoneum, and multiple low-density shadows in the liver ( Figures 1C–F ).\n\nBased on these findings, the patient was treated with FOLFIRINOX (oxaliplatin, Irinotecan, calcium folinate and 5-Fluorouracil). However, considering that the patient had just undergone surgery, the patient was asked by his doctor to eat S-1 for 14 days (from April 2, 2020 to April 16, 2020) before he received FOLFIRINOX treatment on April 25, 2020. In June 2020, after 4 cycles of chemotherapy, upper-abdomen enhanced CT revealed that the size of pancreatic head lesion was significantly decreased to 2.3 cm × 2.5 cm ( Figure 2A ), more that 50% decrease, and multiple low-density shadows in the liver. The patient was repeated CT about every two months ( Figures 2B, C ). Until October 2020, the CT only revealed a mass in the pancreatic head, and the lesion was slightly low density with peripheral lymph node metastasis.\n\nFigure 2 Enhanced CT images. The pancreatic mass indicated by the arrow on upper-abdomen enhanced CT took in June 2020 (A), in August 2020 (B), in October 2020 (C) and in November 2020 (D). The pancreatic cancer was responded to chemotherapy initially, but the disease was still progressed at later time. After sintilimab combined with S-1 treatment, the pancreatic lesion was significantly reduced in, and nearly disappeared in June 2021 (E). The hepatic metastases indicated by the arrows on upper-abdomen enhanced CT took in October 2020 (F), and in June 2021 (G). The hepatic metastasis was significantly reduced (G).\n\nIn October 2020, the patient underwent one cycle of Olaparib by himself, although he did not have the targeted drug-related gene mutation. On October 16, his abdomen enhanced CT scan revealed multiple liver metastases ( Figure 2F ), and the largest measured 2.3 cm. We changed the chemotherapy regimen to AG again (gemcitabine and nab-paclitaxel). In November 2020, the abdomen enhanced CT scan revealed progressive disease ( Figure 2D ), and the size of the pancreatic head lesion was 6.4 cm.\n\nThe patient has undergone multi-line chemotherapy, chemotherapy alone could not inhibit the progression of the disease, and there was no standard treatment after two or more lines of systemic chemotherapy. In addition, his Eastern Cooperative Oncology Group Performance Status (ECOG-PS) was 2, he suffered from severe cancer pain all over the body (OxyContin 30mg, every 12 hours) and weight loss, the aspartate transaminase and alanine transaminase were at normal level, and alkaline phosphatase increased slightly (not higher than 2 times the normal value). Thus, we decided to use chemotherapy (S-1) combined with immunotherapy (sintilimab). Considering the economic status of patient, we decided to choose sintilimab (more economical). The sintilimab is a fully human IgG4 monoclonal antibody; it can bind to PD-1, block the interaction of PD-1 with its ligands, and help recover the anti-tumor response of T-cells, and it has been approved to treat relapsed or refractory classical Hodgkin lymphoma, advanced non-small cell lung cancer and metastatic hepatocellular carcinoma. The anti-tumor effect of sintilimab is similar to that of other anti-PD-1/PD-L1 antibodies (10). Sintilimab was administered intravenously (200mg, every 3 weeks); and S-1was orally (40mg, twice a day orally for 2 weeks, every 21 days). The patient started to receive S-1 on November 24, 2020, and sintilimab on November 27, 2020.\n\nThe patient did not come to our hospital again until June 2021 ( Figure 3 ). He said he was treated at a local hospital during these seven months, and received a total of 10 cycles of sintilimab combined with S-1. The performance status was better than before (his PS improved to ECOG-PS 1); his severe cancer pain was well controlled (OxyContin 10mg, every 12 hours). The abdomen enhanced CT scan showed that the intrahepatic metastases ( Figure 2G ) and pancreatic head lesion ( Figure 2E ) were significantly reduced (the size of the pancreatic head lesion was 1 cm). By standard Response Evaluation Criteria in Solid Tumors (RECIST) criteria, version 1.1, the patient had a partial response (more than 80% decrease) to therapy with this regimen. Moreover, throughout his treatment, the CA 19-9 level was always normal.\n\nFigure 3 Timeline of the treament. The patient was diagnosed with pancreatic cancer in September 2019, and received chemotherapy (AG) in October 2019. Before receiving immunotherapy in November 2020, the patient had undergone multi-line chemotherapy (including AG, FOLFIRINOX, AG). And until August 2021 (the latest follow-up), the patient was still receiving immunotherapy combined with chemotherapy.\n\nAt the latest follow-up (August 2021), the patient still had a partial response to this regimen (S-1 combined with sintilimab), and the duration of partial response was 8 months.\n\nDiscussion\n\nChemotherapy has been the mainstay of treatment for many malignant tumors, including pancreatic cancer. Due to the lack of effective screening tools, most patients lose the opportunity to undergo surgery, which makes chemotherapy the standard treatment. However, chemotherapy has a poor therapeutic effect on pancreatic cancer due to its aggressive nature. Pancreatic cancer is composed of malignant cells and desmoplastic stroma (1). Desmoplastic stoma serves as a physical barrier that protects pancreatic cancer cells and prevent the effective delivery of chemotherapeutic agents (2).\n\nIn this case, the chemotherapy was effective for this patient at first. Additionally, after the disease progressed, the immunotherapy combined with chemotherapy had a significant effect. In the past 5 years, immunotherapy has rapidly changed the landscape of solid tumor treatment. What is more, tumor testing can help patients to get a better treatment. The results of a tumor testing making a patient eligible for treatment with immunotherapy, whose disease (advanced pancreatic cancer) progressed after neoadjuvant chemotherapy and adjuvant chemotherapy (11). Recent studies have identified several positive predictive markers for immune checkpoint inhibitors (ICIs), such as high levels of MSI-H, PD-L1 overexpression, high TMB, and gene mutations (9).\n\nTSC2 is a tumor suppressor gene; it negatively regulates the cellular signaling networks that control cellular growth and proliferation (12). The TSC2 protein forms a complex and functions as a tumor suppressor by inhibiting mTORC1 kinase (13). It has been shown that, in TSC2-deficient tumors, the single-agent PD-1 or CTLA-4 blockade, or a combination of them, can inhibit the growth of tumors (14). Additionally, the combination of PD-1 and CTLA-4 antibody treatment or single-agent treatment can increase CD8+ T-cell infiltration in TSC2-deficient human tumors (14), and the level of infiltration is correlated with the degree of response to therapy.\n\nTransforming growth factor beta (TGF-β) is an immune regulator; it can suppress the immune response via many different mechanisms (15). Moreover, it can inhibit tumor growth at the early stages of disease and promote tumor development at the later stages (16). However, the tumor-suppressive role of TGF-β is only effective when the TGF-β signaling pathway is not defective (17). SMAD4 serves as the central mediator of the TGF-β signaling pathway (18), and it is the only common mediator. The TGF-β/SMAD4 signaling pathway plays a tumor suppressive role in early stages of disease, mainly by inducing cell cycle arrest and apoptosis. TGF-β can stimulate regulatory T-cells, which inhibit the function of other lymphocytes (19). PD-1 is highly expressed on tumor infiltrating lymphocytes; it has been shown that human PD-1 expression may under direct transcriptional control by TGF-β, and TGF-β can enhance the expression of PD-1, suppressing anti-tumor immunity (20). TGF-β inhibits CD8+ T-cell effector function through TGF-β signaling pathway (21). Pancreatic cancer cells have lost their tumor-suppressive roles, but they possess tumor-promoting effects induced by increased TGF-β (22). In a tumor microenvironment, TGF-β expression is very high.\n\nIn pancreatic cancer, alterations of TGF-β signaling occur through the mutation of the genes involved in the pathway (including SMAD4); this activity is present in 47% of pancreatic cancer patients (23). The loss of SMAD4 will abrogate the canonical TGF-β/SMAD4 signaling pathway (24), and it may make pancreatic cancer more aggressive (25). It has been shown that SMAD4-deleted pancreatic ductal adenocarcinoma cells are sensitive to agents modulating the cell cycle (26). The loss of SMAD4 counteracted TGF-β-induced cell cycle arrest and apoptosis (27). Furthermore, it has been reported that the loss of SMAD4 expression is significantly associated with better survival after resection (28). The inhibition of TGF-β has been reported to have a variety of antitumor effects (29). A TGF-β blockade can reverse the suppressive effects of apoptotic cells on inflammation and adaptive immunity (30). In T-cell excluded mouse models, immune checkpoint-resistant MSS colorectal cancers and liver tumors were rendered susceptible to anti-PD-1/PD-L1 therapy with a TGF-β blockade (31).\n\nBlockade of immune checkpoints by anti-CTLA-4 or anti-PD-1/anti-PD-L1 agents leads to T-cell activation, and it provides an effective approach for tumor immunotherapy (32). And the high PD-L1 expression may have a better clinical benefit. There was a case report showed that blocking the PD-L1 pathway combined with chemotherapy was effective for pancreatic squamous cell carcinoma patients with high PD-L1 expression (33).\n\nPancreatic cancer is intrinsically non-immunogenic (34). Single agent immunotherapies are unlikely to be successful in treating this type of cancer (35), but immunotherapy combined with chemotherapy has a synergistic effect (36). Chemotherapeutic agents could promote the release of tumor antigens from the cancer cells and reactivate an anti-cancer immune response to suppress tumor growth (37). Besides, according to several ongoing clinical trials, there are other regimens of combination therapy for the treatment of pancreatic cancer, such as BL-8040 (chemokine receptor type 4 inhibitors) and pembrolizumab combined with chemotherapy (NCT02826486), olaparib plus pembrolizumab (NCT04666740 and NCT04548752), olaparib or selumetinib plus durvalumab (NCT04348045). Additionally, the COMBAT/KEYNOTE-202 Trial (NCT02826486) revealed that the ORR was 21.1%, and the triple combination of BL-8040, pembrolizumab, and chemotherapy was safe and well tolerated, but no significant improvement in PFS and OS (38).\n\nOther ICIs can also improve the effect of therapy. TMB is the total number of mutations per coding area of a tumor gene, which can increase the sensitivity to immunotherapy (39). Generally, we defined TMB ≥ 20 mutations/Mb as high TMB, TMB ≤ 10 mutations/Mb as low TMB. Patients with a high TMB also have a better prognosis with immunotherapy. For example, a higher TMB was associated with better response in non-small cell lung cancer patients receiving pembrolizumab (40). A higher TMB had a clinical benefit in malignant melanoma patients receiving either ipilimumab or tremelimumab (41). Additionally, a case report revealed that combined antiangiogenic therapy and immunotherapy is effective for pancreatic cancer with high TMB (42). However, patients with pancreatic cancer generally have a low TMB in comparison to patients with other malignancies (43). Moreover, pancreatic cancer is a tumor with low immunogenicity, which is attributed to low TMB (36).\n\nConclusion\n\nIn this case, the effect of immunotherapy combined with chemotherapy seems to be very effective. We also established a hypothesis that the SMAD4 and TSC2 mutations improved the efficacy of immunotherapy, prolonging the survival of patients. However, very few studies have investigated the relationship between SMAD4 mutation and immunotherapy in pancreatic cancer. Thus, more studies and clinical trials are needed.\n\nData Availability Statement\n\nThe original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.\n\nAuthor Contributions\n\nSZ is the guarantor. YY wrote the manuscript. All authors read, provided feedback, and approved the final version.\n\nFunding\n\nThe National Natural Science Foundation of China (81372660), Zhejiang Province Public Welfare Technology Application Research Project (2017C33200), and Laboratory of Clinical Cancer Pharmacology and Toxicology Research of Zhejiang Province.\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nPublisher’s Note\n\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.\n\nAbbreviations\n\nMRI, magnetic resonance imaging; PET, positron emission tomography; CT, computed tomography; NGS, next generation sequencing; TGF-β, transforming growth factor beta; TMB, tumor mutational burden; MSS, microsatellite stable; MSI, microsatellite instability; MSI-H, high levels of microsatellite instability; ICI, immune checkpoint inhibitor; ORR, objective response rate; PFS, progression-free survival; OS, overall survival.\n==== Refs\nReferences\n\n1 Neesse A Algül H Tuveson DA Gress TM . Stromal Biology and Therapy in Pancreatic Cancer: A Changing Paradigm. Gut (2015) 64 (9 ):1476–84. doi: 10.1136/gutjnl-2015-309304\n2 Torphy RJ Zhu Y Schulick RD . Immunotherapy for Pancreatic Cancer: Barriers and Breakthroughs. Ann Gastroenterol Surg (2018) 2 (4 ):274–81. doi: 10.1002/ags3.12176\n3 Royal RE Levy C Turner K Mathur A Hughes M Kammula US . Phase 2 Trial of Single Agent Ipilimumab (Anti-CTLA-4) for Locally Advanced or Metastatic Pancreatic Adenocarcinoma. J Immunother (2010) 33 (8 ):828–33. doi: 10.1097/CJI.0b013e3181eec14c\n4 Brahmer JR Tykodi SS Chow LQ Hwu WJ Topalian SL Hwu P . Safety and Activity of Anti-PD-L1 Antibody in Patients With Advanced Cancer. N Engl J Med (2012) 366 (26 ):2455–65. doi: 10.1056/NEJMoa1200694\n5 O’Reilly EM Oh DY Dhani N Renouf DJ Lee MA Sun W . Durvalumab With or Without Tremelimumab for Patients With Metastatic Pancreatic Ductal Adenocarcinoma: A Phase 2 Randomized Clinical Trial. JAMA Oncol (2019) 5 (10 ):1431–8. doi: 10.1001/jamaoncol.2019.1588\n6 Wainberg ZA Hochster HS Kim EJ George B Kaylan A Chiorean EG . Open-Label, Phase I Study of Nivolumab Combined With Nab-Paclitaxel Plus Gemcitabine in Advanced Pancreatic Cancer. Clin Cancer Res (2020) 26 (18 ):4814–22. doi: 10.1158/1078-0432.CCR-20-0099\n7 O’Hara MH O’Reilly EM Varadhachary G Wolff RA Wainberg ZA Ko AH . CD40 Agonistic Monoclonal Antibody APX005M (Sotigalimab) and Chemotherapy, With or Without Nivolumab, for the Treatment of Metastatic Pancreatic Adenocarcinoma: An Open-Label, Multicentre, Phase 1b Study. Lancet Oncol (2021) 22 (1 ):118–31. doi: 10.1016/S1470-2045(20)30532-5\n8 Renouf DJ Knox JJ Kavan P Jonker D Welch S Couture F . The Canadian Cancer Trials Group PA.7 Trial: Results of a Randomized Phase II Study of Gemcitabine (GEM) and Nab-Paclitaxel (Nab-P) vs. GEM, Nab-P, Durvalumb (D) and Tremelimumab (T) as First Line Therapy in Metastatic Pancreatic Ductal Adenocarcinoma (Mpdac) [Conference Presentation]. ESMO 2020 Virtual (2020) 31 (Supplement 4 ):S1195. doi: 10.1016/j.annonc.2020.08.2300\n9 Samstein RM Lee CH Shoushtari AN Hellmann MD Shen R Janjigian Y . Tumor Mutational Load Predicts Survival After Immunotherapy Across Multiple Cancer Types. Nat Genet (2019) 51 (2 ):202–6. doi: 10.1038/s41588-018-0312-8\n10 Zhang L Mai W Jiang W Geng Q . Sintilimab: A Promising Anti-Tumor Pd-1 Antibody. Front Oncol (2020) 10 :594558. doi: 10.3389/fonc.2020.594558 33324564\n11 Ngo P Shanshal M Rojan A . Immunotherapy in Pancreatic Cancer and the Importance of Tumour Testing. BMJ Case Rep (2020) 13 (7 ):e235774. doi: 10.1136/bcr-2020-235774\n12 Dang HX White BS Foltz SM Miller CA Luo J Fields RC . Clonevol: Clonal Ordering and Visualization in Cancer Sequencing. Ann Oncol (2017) 28 (12 ):3076–82. doi: 10.1093/annonc/mdx517\n13 Cingarlini S Bonomi M Corbo V Scarpa A Tortora G . Profiling Mtor Pathway in Neuroendocrine Tumors. Target Oncol (2012) 7 (3 ):183–8. doi: 10.1007/s11523-012-0226-9\n14 Liu HJ Lizotte PH Du H Speranza MC Lam HC Vaughan S . TSC2-Deficient Tumors Have Evidence of T Cell Exhaustion and Respond to Anti-PD-1/Anti-CTLA-4 Immunotherapy. JCI Insight (2018) 3 (8 ):e98674. doi: 10.1172/jci.insight.98674\n15 Shull MM Ormsby I Kier AB Pawlowski S Diebold RJ Yin M . Targeted Disruption of the Mouse Transforming Growth Factor-Beta 1 Gene Results in Multifocal Inflammatory Disease. Nature (1992) 359 (6397 ):693–9. doi: 10.1038/359693a0\n16 Wang Y Chu J Yi P Dong W Saultz J Wang Y . SMAD4 Promotes TGF-β-Independent NK Cell Homeostasis and Maturation and Antitumor Immunity. J Clin Invest (2018) 128 (11 ):5123–36. doi: 10.1172/JCI121227\n17 Principe DR Doll JA Bauer J Jung B Munshi HG Bartholin L . Tgf-β: Duality of Function Between Tumor Prevention and Carcinogenesis. J Natl Cancer Inst (2014) 106 (2 ):djt369. doi: 10.1093/jnci/djt369 24511106\n18 Massagué J . How Cells Read TGF-Beta Signals. Nat Rev Mol Cell Biol (2000) 1 (3 ):169–78. doi: 10.1038/35043051\n19 Dardare J Witz A Merlin JL Gilson P Harlé A . SMAD4 and the Tgfβ Pathway in Patients With Pancreatic Ductal Adenocarcinoma. Int J Mol Sci (2020) 21 (10 ):3534. doi: 10.3390/ijms21103534\n20 Park BV Freeman ZT Ghasemzadeh A Chattergoon MA Rutebemberwa A Steigner J . Tgfβ1-Mediated SMAD3 Enhances PD-1 Expression on Antigen-Specific T Cells in Cancer. Cancer Discov (2016) 6 (12 ):1366–81. doi: 10.1158/2159-8290.CD-15-1347\n21 Thomas DA Massagué J . TGF-Beta Directly Targets Cytotoxic T Cell Functions During Tumor Evasion of Immune Surveillance. Cancer Cell (2005) 8 (5 ):369–80. doi: 10.1016/j.ccr.2005.10.012\n22 Wagner M Kleeff J Lopez ME Bockman I Massaqué J Korc M . Transfection of the Type I TGF-Beta Receptor Restores TGF-Beta Responsiveness in Pancreatic Cancer. Int J Cancer (1998) 78 (2 ):255–60. doi: 10.1002/(sici)1097-0215(19981005)78:2<255::aid-ijc21>3.0.co;2-8\n23 Bailey P Chang DK Nones K Johns AL Patch AM Gingras MC . Genomic Analyses Identify Molecular Subtypes of Pancreatic Cancer. Nature (2016) 531 (7592 ):47–52. doi: 10.1038/nature16965 26909576\n24 Derynck R Jarrett JA Chen EY Eaton DH Bell JR Assoian RK . Human Transforming Growth Factor-Beta Complementary DNA Sequence and Expression in Normal and Transformed Cells. Nature (1985) 316 (6030 ):701–5. doi: 10.1038/316701a0\n25 Yamada S Fujii T Shimoyama Y Kanda M Nakayama G Sugimoto H . SMAD4 Expression Predicts Local Spread and Treatment Failure in Resected Pancreatic Cancer. Pancreas (2015) 44 (4 ):660–4. doi: 10.1097/MPA.0000000000000315\n26 Hsieh YY Liu TP Chou CJ Chen HY Lee KH Yang PM . Integration of Bioinformatics Resources Reveals the Therapeutic Benefits of Gemcitabine and Cell Cycle Intervention in SMAD4-Deleted Pancreatic Ductal Adenocarcinoma. Genes (Basel) (2019) 10 (10 ):766. doi: 10.3390/genes10100766\n27 Duda DG Sunamura M Lefter LP Furukawa T Yokoyama T Yatsuoka T . Restoration of SMAD4 by Gene Therapy Reverses the Invasive Phenotype in Pancreatic Adenocarcinoma Cells. Oncogene (2003) 22 (44 ):6857–64. doi: 10.1038/sj.onc.1206751\n28 Biankin AV Morey AL Lee CS Kench JG Biankin SA Hook HC . DPC4/Smad4 Expression and Outcome in Pancreatic Ductal Adenocarcinoma. J Clin Oncol (2002) 20 (23 ):4531–42. doi: 10.1200/JCO.2002.12.063\n29 Ungefroren H . Blockade of TGF-β Signaling: A Potential Target for Cancer Immunotherapy? Expert Opin Ther Targets (2019) 23 (8 ):679–93. doi: 10.1080/14728222.2019.1636034\n30 Larson C Oronsky B Carter CA Oronsky A Knox SJ Sher D . TGF-Beta: A Master Immune Regulator. Expert Opin Ther Targets (2020) 24 (5 ):427–38. doi: 10.1080/14728222.2020.1744568\n31 Tauriello DVF Palomo-Ponce S Stork D Berenguer-Llergo A Badia-Ramentol J Iglesias M . Tgfβ Drives Immune Evasion in Genetically Reconstituted Colon Cancer Metastasis. Nature (2018) 554 (7693 ):538–43. doi: 10.1038/nature25492\n32 Iwai Y Ishida M Tanaka Y Okazaki T Honjo T Minato N . Involvement of PD-L1 on Tumor Cells in the Escape From Host Immune System and Tumor Immunotherapy by PD-L1 Blockade. Proc Natl Acad Sci U S A (2002) 99 (19 ):12293–7. doi: 10.1073/pnas.192461099\n33 Yang B Ren H Yu G . Case Report: Squamous Cell Carcinoma of Pancreas With High PD-L1 Expression: A Rare Presentation. Front Oncol (2021) 11 :680398. doi: 10.3389/fonc.2021.680398 34277425\n34 Pico de Coaña Y Choudhury A Kiessling R . Checkpoint Blockade for Cancer Therapy: Revitalizing a Suppressed Immune System. Trends Mol Med (2015) 21 (8 ):482–91. doi: 10.1016/j.molmed.2015.05.005\n35 Sideras K Braat H Kwekkeboom J van Eijck CH Peppelenbosch MP Sleijfer S . Role of the Immune System in Pancreatic Cancer Progression and Immune Modulating Treatment Strategies. Cancer Treat Rev (2014) 40 (4 ):513–22. doi: 10.1016/j.ctrv.2013.11.005\n36 Schizas D Charalampakis N Kole C Economopoulou P Koustas E Gkotsis E . Immunotherapy for Pancreatic Cancer: A 2020 Update. Cancer Treat Rev (2020) 86 :102016. doi: 10.1016/j.ctrv.2020.102016 32247999\n37 Zitvogel L Galluzzi L Smyth MJ Kroemer G . Mechanism of Action of Conventional and Targeted Anticancer Therapies: Reinstating Immunosurveillance. Immunity (2013) 39 (1 ):74–88. doi: 10.1016/j.immuni.2013.06.014 23890065\n38 Bockorny B Macarulla T Semenisty V Borazanci E Feliu J Ponz-Sarvise M . Motixafortide and Pembrolizumab Combined to Nanoliposomal Irinotecan, Fluorouracil, and Folinic Acid in Metastatic Pancreatic Cancer: The COMBAT/KEYNOTE-202 Trial. Clin Cancer Res (2021) 27 (18 ):5020–7. doi: 10.1158/1078-0432.CCR-21-0929\n39 Champiat S Ferté C Lebel-Binay S Eggermont A Soria JC . Exomics and Immunogenics: Bridging Mutational Load and Immune Checkpoints Efficacy. Oncoimmunology (2014) 3 (1 ):e27817. doi: 10.4161/onci.27817 24605269\n40 Rizvi NA Hellmann MD Snyder A Kvistborg P Makarov V Havel JJ . Cancer Immunology. Mutational Landscape Determines Sensitivity to PD-1 Blockade in Non-Small Cell Lung Cancer. Science (2015) 348 (6230 ):124–8. doi: 10.1126/science.aaa1348\n41 Snyder A Makarov V Merghoub T Yuan J Zaretsky JM Desrichard A . Genetic Basis for Clinical Response to CTLA-4 Blockade in Melanoma. N Engl J Med (2014) 371 (23 ):2189–99. doi: 10.1056/NEJMoa1406498\n42 Chen M Yang S Fan L Wu L Chen R Chang J . Combined Antiangiogenic Therapy and Immunotherapy Is Effective for Pancreatic Cancer With Mismatch Repair Proficiency But High Tumor Mutation Burden: A Case Report. Pancreas (2019) 48 (9 ):1232–6. doi: 10.1097/MPA.0000000000001398\n43 Chalmers ZR Connelly CF Fabrizio D Gay L Ali SM Ennis R . Analysis of 100,000 Human Cancer Genomes Reveals the Landscape of Tumor Mutational Burden. Genome Med (2017) 9 (1 ):34. doi: 10.1186/s13073-017-0424-2 28420421\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1664-3224",
"issue": "12()",
"journal": "Frontiers in immunology",
"keywords": "SMAD4; TSC2; chemotherapy; immunotherapy; next generation sequencing (NGS); pancreatic cancer",
"medline_ta": "Front Immunol",
"mesh_terms": null,
"nlm_unique_id": "101560960",
"other_id": null,
"pages": "785400",
"pmc": null,
"pmid": "34880877",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "31318392;31609933;12454109;23890065;14534532;29443964;32554514;32228232;20842054;22890559;28950321;25994217;30183689;33387490;25409260;9754660;25760429;34253578;25765070;22658128;34277425;32247999;11252892;32675128;12218188;16286245;24511106;1436033;29669930;26091825;31569425;27683557;28420421;26909576;31232607;24605269;24315741;30003190;30643254;3861940;32429474;33324564",
"title": "Successful Immunotherapy for Pancreatic Cancer in a Patient With TSC2 and SMAD4 Mutations: A Case Report.",
"title_normalized": "successful immunotherapy for pancreatic cancer in a patient with tsc2 and smad4 mutations a case report"
} | [
{
"companynumb": "CN-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-322419",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GEMCITABINE"
},
"dru... |
{
"abstract": "Stevens-Johnson syndrome (SJS) is a severe, episodic, acute mucocutaneous reaction that is most often elicited by drugs and occasionally by infections. The drugs commonly implicated as the cause of SJS are anticonvulsants, sulfonamides, non-steroidal anti-inflammatory drugs and antibiotics. Carbamazepine (CBZ) has been commonly implicated in SJS. Neuroleptic malignant syndrome (NMS) is a rare, life-threatening but potentially treatable condition. Among the neuroleptics, haloperidol (parenteral) is implicated as a most common drug for NMS. Though rare, association of NMS with CBZ and association of NMS with toxic epidermal necrolysis (TEN) in a single patient after administration of neuroleptics has been reported in the literature before. However, a combination of NMS and SJS in a single patient after administration of CBZ has not been reported so far. We present a patient with seizure who developed SJS and NMS following administration of CBZ.",
"affiliations": "Department of Neurology, SMS Medical College Hospital, Jaipur, Rajasthan, India. sharmadrbhawna@gmail.com",
"authors": "Sharma|Bhawna|B|;Sannegowda|Raghavendra Bakki|RB|;Gandhi|Pankaj|P|;Dubey|Parul|P|;Panagariya|Ashok|A|",
"chemical_list": "D002220:Carbamazepine",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2013()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000293:Adolescent; D002220:Carbamazepine; D006801:Humans; D008297:Male; D013262:Stevens-Johnson Syndrome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "23761563",
"pubdate": "2013-06-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "9513741;22322005;16394438;21358399;1677067;21120111;2993525;16394456;6110195;3290944;10928001;20696799;1948228;9807653;10941349;12165215;22953086;22014021;20001755;2134982;17558126;8101521;2102674",
"title": "Combination of Steven-Johnson syndrome and neuroleptic malignant syndrome following carbamazepine therapy: a rare occurrence.",
"title_normalized": "combination of steven johnson syndrome and neuroleptic malignant syndrome following carbamazepine therapy a rare occurrence"
} | [
{
"companynumb": "IN-ACTAVIS-2014-24156",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CARBAMAZEPINE"
},
"drugadditional": null,
... |
{
"abstract": "A 75-year-old male who with type 3 gastric cardia cancer with multiple liver metastases was initially treated with S-1 in July of 2005. After 4 courses of the treatment, the liver metastases became undetectable on abdominal CT scan, with reduction in size of the primary tumor of the stomach. After 7 months of S-1 treatment, however, the progression of the primary lesion was endoscopically detected, and irinotecan was administered, demonstrating primary tumor regression. When re-growth of the primary tumor was observed, 3 courses of paclitaxel treatment showed little effect and was replaced by docetaxel treatment for 5 months, which had a grade 3 adverse effect. The next 10 courses of 5-FU combined with methotrexate were applied for one year until the primary tumor showed enlargement. Then 12 courses of CDDP with S-1 were administered until now, and the size of the primary carcinoma is under control. The patient is being followed on an outpatient basis without any surgical treatment, while the liver metastases have not relapsed on abdominal imaging.",
"affiliations": "Division of Biological Regulation and Oncology, Tohoku University.",
"authors": "Ando|Toshinori|T|;Suzuki|Yoshiro|Y|;Kanno|Shinichi|S|;Miyashita|Eishi|E|;Tanaka|Naoki|N|;Ikezawa|Fumie|F|;Shibata|Chikashi|C|;Sasaki|Iwao|I|;Yoshioka|Takashi|T|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-0684",
"issue": "37(5)",
"journal": "Gan to kagaku ryoho. Cancer & chemotherapy",
"keywords": null,
"medline_ta": "Gan To Kagaku Ryoho",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D005773:Gastroscopy; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D009367:Neoplasm Staging; D011788:Quality of Life; D013274:Stomach Neoplasms; D013997:Time Factors; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "7810034",
"other_id": null,
"pages": "891-4",
"pmc": null,
"pmid": "20495322",
"pubdate": "2010-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A case of stage IV gastric cancer with multiple liver metastases surviving for more than 4 years by treatment with chemotherapies without surgery.",
"title_normalized": "a case of stage iv gastric cancer with multiple liver metastases surviving for more than 4 years by treatment with chemotherapies without surgery"
} | [
{
"companynumb": "JP-SUN PHARMACEUTICAL INDUSTRIES LTD-2016R1-124243",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drug... |
{
"abstract": "A 5-year-old girl with T-cell acute lymphoblastic leukemia (T-ALL) developed a progressive eruption of crusted papules and ulcerative plaques involving 80% of her body surface area with histopathology consistent with febrile ulceronecrotic Mucha-Habermann disease (FUMHD), although multiple specimens also contained clonal leukemic cells. Her skin disease was refractory to many classic treatments for FUMHD, including methotrexate, and became so severe that concern about superinfection prevented intensification of chemotherapy for her malignancy. The addition of basiliximab promoted gradual improvement of the skin, allowing for chemotherapy intensification and subsequent bone marrow transplantation, after which the eruption resolved completely. This report describes a severe case of FUMHD-like eruption associated with clonal leukemic cells that improved with basiliximab, suggesting anti-CD25 therapy as a novel treatment for ulceronecrotic skin disease in the setting of high interleukin-2 levels.",
"affiliations": "Department of Dermatology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania.;Division of Dermatology, Department of Medicine, School of Medicine, Washington University in St. Louis, St. Louis, Missouri.;Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Department of Pathology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Division of Dermatology, Department of Pediatrics, Seattle Children's Hospital, Seattle, Washington.;Department of Pathology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Section of Pediatric Dermatology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Division of Oncology, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.",
"authors": "Orenstein|Lauren A V|LAV|http://orcid.org/0000-0003-0534-2854;Coughlin|Carrie C|CC|http://orcid.org/0000-0002-2760-1725;Flynn|Andrea T|AT|;Pillai|Vinodh|V|;Boos|Markus D|MD|http://orcid.org/0000-0002-7179-5168;Wertheim|Gerald B|GB|;Treat|James R|JR|;Teachey|David T|DT|",
"chemical_list": "D000911:Antibodies, Monoclonal; D007166:Immunosuppressive Agents; D011993:Recombinant Fusion Proteins; D000077552:Basiliximab",
"country": "United States",
"delete": false,
"doi": "10.1111/pde.13235",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0736-8046",
"issue": "34(5)",
"journal": "Pediatric dermatology",
"keywords": null,
"medline_ta": "Pediatr Dermatol",
"mesh_terms": "D000911:Antibodies, Monoclonal; D000971:Antineoplastic Combined Chemotherapy Protocols; D000077552:Basiliximab; D002675:Child, Preschool; D005260:Female; D006561:Herpes Simplex; D006801:Humans; D007166:Immunosuppressive Agents; D017514:Pityriasis Lichenoides; D054218:Precursor T-Cell Lymphoblastic Leukemia-Lymphoma; D011993:Recombinant Fusion Proteins; D012867:Skin; D033581:Stem Cell Transplantation",
"nlm_unique_id": "8406799",
"other_id": null,
"pages": "e265-e270",
"pmc": null,
"pmid": "28884915",
"pubdate": "2017-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe Mucha-Habermann-Like Ulceronecrotic Skin Disease in T-Cell Acute Lymphoblastic Leukemia Responsive to Basiliximab and Stem Cell Transplant.",
"title_normalized": "severe mucha habermann like ulceronecrotic skin disease in t cell acute lymphoblastic leukemia responsive to basiliximab and stem cell transplant"
} | [
{
"companynumb": "US-RECORDATI RARE DISEASES-US-R13005-17-00222",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugaddi... |
{
"abstract": "To describe the presentation, clinical course and management of a patient with bilateral maculopathy associated with sertraline.\nWe report a rare case of bilateral cystoid macular edema and subretinal fluid in a 78-year-old Asian Indian female who was on chronic sertraline therapy. The patient was initially misdiagnosed as intermediate uveitis and started on oral corticosteroids. However, multimodal imaging with fluorescein angiography and optical coherence tomography ruled out ocular inflammation. There was symmetrical bilateral macular involvement and changes on macular electroretinography, which provided clues to the diagnosis of toxic maculopathy. After cessation of sertraline therapy, the retinal pathology reversed with improvement in visual acuity.\nDevelopment of cystoid macular edema due to sertraline is a very rare adverse event and must be considered by psychiatrists and ophthalmologists. Our case demonstrates this rare toxicity along with its imaging features, and reversal on cessation of sertraline therapy.",
"affiliations": "Advanced Eye Center, Department of Ophthalmology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Advanced Eye Center, Department of Ophthalmology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Advanced Eye Center, Department of Ophthalmology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Advanced Eye Center, Department of Ophthalmology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.",
"authors": "Agarwal|Aniruddha|A|;Aggarwal|Kanika|K|;Kumar|Aman|A|;Gupta|Vishali|V|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajoc.2018.06.021",
"fulltext": "\n==== Front\nAm J Ophthalmol Case RepAm J Ophthalmol Case RepAmerican Journal of Ophthalmology Case Reports2451-9936Elsevier S2451-9936(18)30048-310.1016/j.ajoc.2018.06.021Case reportBilateral cystoid macular edema misdiagnosed as pars planitis in a patient on sertraline therapy Agarwal Aniruddha 1Aggarwal Kanika 1Kumar Aman Gupta Vishali vishalisara@yahoo.co.invishalisara@gmail.com∗Advanced Eye Center, Department of Ophthalmology, Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India∗ Corresponding author. Advanced Eye Center, Post Graduate Institute of Medical Education and Research (PGIMER), Sector 12, Chandigarh, 160012, India. vishalisara@yahoo.co.invishalisara@gmail.com1 The two authors have contributed equally to the manuscript and share the first authorship.\n\n28 6 2018 9 2018 28 6 2018 11 135 138 7 2 2018 25 6 2018 © 2018 The Authors. Published by Elsevier Inc.2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Purpose\nTo describe the presentation, clinical course and management of a patient with bilateral maculopathy associated with sertraline.\n\nObservations\nWe report a rare case of bilateral cystoid macular edema and subretinal fluid in a 78-year-old Asian Indian female who was on chronic sertraline therapy. The patient was initially misdiagnosed as intermediate uveitis and started on oral corticosteroids. However, multimodal imaging with fluorescein angiography and optical coherence tomography ruled out ocular inflammation. There was symmetrical bilateral macular involvement and changes on macular electroretinography, which provided clues to the diagnosis of toxic maculopathy. After cessation of sertraline therapy, the retinal pathology reversed with improvement in visual acuity.\n\nConclusions and Importance\nDevelopment of cystoid macular edema due to sertraline is a very rare adverse event and must be considered by psychiatrists and ophthalmologists. Our case demonstrates this rare toxicity along with its imaging features, and reversal on cessation of sertraline therapy.\n\nKeywords\nSertralineMaculopathyMacular edemaDrug-induced retinopathyBull's eye maculopathy\n==== Body\n1 Introduction\nSertraline hydrochloride is one of the most commonly used, first-line selective serotonin reuptake inhibitor (SSRI) used in the management of several psychiatric conditions such as major depression, obsessive-compulsive disorder, panic attacks, post-traumatic stress disorder and anxiety disorders.1,2 Since this drug obtained the United States Food and Drug Administration (US FDA) approval in 1991, it has become one of the most widely prescribed psychiatric medications for management of depression worldwide.3 Due to its affinity for various receptors, including serotonin transporter, dopamine transporter, and sigma α1 receptor, it may be associated with a number of undesirable systemic side effects such as extrapyramidal features of rigidity, resting tremor, dyskinesia, dysgraphia, weight gain and dry mouth.4,5\n\nThe ocular side effects of sertraline are very rarely reported. Some of the rare manifestations of sertraline toxicity include acute angle closure glaucoma6 and optic neuropathy.7 In the literature, two cases presumed sertraline maculopathy and a single case of bull's eye maculopathy related to sertraline use have been previously published.8, 9, 10 In this case report, we have described the course of bilateral maculopathy and its reversal in a lady with psychotic depression who was started on sertraline therapy a few months ago.\n\n2 Case report\nA 78-year-old Asian Indian lady presented with complaints of gradual progressive diminuition of vision in both the eyes (OU) for the past 1 month. The patient had been evaluated elsewhere and a diagnosis of intermediate uveitis with bilateral cystoid macular edema (CME) was made. She underwent detailed laboratory work-up for uveitis including tuberculin skin test, treponema pallidum hemagglutination assay (TPHA), and chest radiography to rule out infectious etiology, and antinuclear antibodies (ANA), anti-double-stranded DNA (DsDNA), and anti-neutrophilic cytoplasmic antibody (ANCA) to rule out autoimmune etiology. All her laboratory tests were within normal limits. With the diagnosis of pars planitis with bilateral CME, her treating ophthalmologist initiated her on oral corticosteroids (30 mg/day prednisone) for 2 weeks, which were subsequently tapered to a dose of 20 mg/day.\n\nThe patient presented to the ophthalmology department at our institution for a second opinion. At the time of presentation, her best-corrected visual acuity (BCVA) was 6/18 in the right eye (OD) and 6/12 in the left eye (OS). Anterior segment examination was unremarkable with a clear cornea, no anterior chamber inflammation and bilateral pseudophakia. Posterior segment examination revealed a clear media, with no vitreous cells or haze. The foveal reflex was blunted in both the eyes (Fig. 1, Fig. 2). Fluorescein angiography (FA) and indocyanine green angiography (ICGA) did not reveal any evidence of posterior segment inflammation or optic disc hyperfluorescence/leakage. There was presence of a symmetrical macular hyperfluorescence (due to leakage of small deep vessels especially those seen temporal to the fovea in the left eye) suggestive of accumulation of fluid. Fundus autofluorescence imaging (FAF) showed a subtle central macular hypo-autofluorescence due to the presence of overlying fluid above the retinal pigment epithelium (RPE). Swept-source optical coherence tomography (SS-OCT) revealed presence of bilateral intraretinal and subretinal fluid suggestive of macular edema (Fig. 3). Since there was no clinical or imaging feature suggestive of intraocular inflammation/uveitis, the diagnosis of pars planitis was considered unlikely. Multifocal electroretinography showed unevenly distributed, moderately reduced and abnormal waveforms especially in the inner two rings in both the eyes signifying cone-mediated functional loss of the posterior pole (Fig. 4). A detailed drug history revealed that the patient had been started on sertraline 50 mg/day after the diagnosis of psychotic depression was established 7 months ago. Review of her previous ocular examination records (prior to initiation of sertraline) showed a visual acuity of 6/6 in OU, without any positive fundus findings. Therefore, sertraline-induced maculopathy was suspected and patient was advised to seek psychiatrist consultation in order to consider an alternative medication. Simultaneously, her oral corticosteroids were tapered and stopped over the next 2 weeks.Fig. 1 Fig. 1 shows multimodal imaging of the right eye of the patient diagnosed with sertraline maculopathy. Fundus photography shows clear media and a blunted foveal reflex (A). Fundus autofluorescence imaging shows subtle increase in the macular hypo-autofluorescence (B). The early frames of combined fluorescein angiography (FA) and indocyanine green angiography (ICGA) (C) do not show significant disc or vascular leakage. There is subtle early hyperfluorescence of the macula in the right eye in the late phase (D). ICGA does not reveal any abnormality of the right eye in the late phase.\n\nFig. 1Fig. 2 Fig. 2 shows multimodal imaging of the left eye. Similar to the right eye in Fig. 1, fundus of the left eye also showed clear media and blunted foveal reflex (A). There was subtle increase in hypo-autofluorescence of the macula on autofluorescence imaging (B). Early and late frames of fluorescein angiography (C and D) showed presence of hyperfluorescence in the macula suggestive of macular edema. There were no abnormalities noted on indocyanine green angiography imaging.\n\nFig. 2Fig. 3 Serial swept-source optical coherence tomography (SS-OCT) of right (A, C and E) and left eyes (B, D and F). At baseline, SS-OCT of both eyes revealed subretinal fluid with elevation of the retinal pigment epithelium (RPE) (A and B for the right and left eyes, respectively). Left eye also showed intraretinal cystoid spaces in the line scan shown. At 2 week follow-up after cessation of sertraline, there was an interval decrease in the subretinal fluid in both the eyes and improvement in visual acuity (C and D). At 12 week follow-up visit, there was complete resolution of subretinal fluid in both the eyes (E and F). The left eye showed residual intraretinal cystoid spaces.\n\nFig. 3Fig. 4 Multifocal electroretinography of the right (A) and left eyes (B) shows abnormal responses in both the eyes. Both eyes shows responses that are unevenly distributed across the tested field with predominantly unformed averaged waveforms (especially in the central fields of the right eye; A). The responses are moderate-to-severely reduced without significant changes in the implicit times. In summary, the multifocal electroretinography shows severely abnormal cone-mediated function of the posterior pole in both the eyes.\n\nFig. 4\n\nFour weeks after the initial visit, the patient was symptomatically better and her BCVA improved to 6/12 in OD and 6/9 in OS. There was interval reduction in the CME in OU (Fig. 3). Sertraline was stopped and replaced with quetiapine (an atypical anti-psychotic). At 3-month follow-up, her BCVA further improved to 6/9 in OD and OS. The OCT scan showed a near complete resolution of CME with only few residual cystoid spaces in OS (Fig. 3). The subretinal fluid had completely resolved in both the eyes. The patient was tolerating quetiapine well and maintains a regular follow-up with the psychiatrist.\n\n3 Discussion\nSertraline is an extensively used SSRI in the management of various psychiatric conditions including psychotic depression. Ocular adverse events are rare with sertraline and among the reported cases, reports of rise in intraocular pressure,6 optic neuropathy,7 and scotomas have been more commonly described. Macular involvement of sertraline is not well known, with only three cases in published literature.8, 9, 10 The National Registry of Drug-Induced Ocular Side Effects also does not provided detailed description of maculopathy associated with sertraline in the current edition. Previous reports have described distinct features of sertraline maculopathy either in the form of well circumscribed yellowish hypopigmented areas of RPE atrophy involving the macula with a few surrounding satellite lesions consisting of RPE atrophy, or Bull's eye maculopathy. However, the OCT features of these lesions have not been described previously. In addition, there is paucity of information on the reversal of toxic manifestations after withdrawal of sertraline therapy.\n\nIn our case, the abrupt onset and rapid progression of signs and symptoms with the intake of sertraline therapy, the mfERG changes, and bilateral CME were observed. This is a new finding which has not been previously reported. Although a diagnosis of intermediate uveitis was considered elsewhere, a thorough clinical examination and fundus imaging ruled out ocular inflammation in this case.\n\nThe exact mechanism leading to the development of macular changes in sertraline toxicity is not clear. Researchers at the Oxford University have greatly helped in advancing the knowledge regarding the role of serotonin in the mammalian eye.11, 12, 13, 14 Sertraline, by inhibiting the neuronal uptake of serotonin, increases the levels of serotonin in the central and peripheral nervous system, including the eye (cornea, sclera, iris, ciliary body, RPE and choroid).13, 14, 15, 16 Despite low levels of serotonin in the mammalian retina, a number of serotonin receptors exist in the photoreceptors and RPE.17,18 Apart from its role in visual processing, serotonin is linked to ganglion cell apoptosis. In the RPE, serotonin potentially modulates several functions using a messenger system of cyclic adenosine monophosphate (cAMP).19 Therefore, by adversely affecting the macular RPE function, sertraline may be responsible for development of maculopathy as a rare adverse event. Additional research on serotonin receptors and its effect on RPE will shed more light on this subject and the possible mechanisms of sertraline toxicity.\n\nThe goal of this index case report and previously published cases in the literature is to determine the possible association of sertraline with bilateral maculopathy. Since sertraline is a very commonly used drug, additional cases developing CME must be studied so that a real association can be established. It is imperative to sensitize physicians and patients to the possibility of these adverse effects with sertraline use. When examining patients with macular edema, a note must be made of the history of its intake. Further research into the mechanisms of ocular adverse events resulting from sertraline are may help in highlighting this association.\n\nPatient consent\nThe consent to publish has been obtained from the participant in writing to report individual patient data.\n\nFunding\nNone.\n\nConflicts of interest\nThe following authors have no financial disclosures: AA, KA, AM, VG.\n\nAuthorship\nAll authors attest that they meet the current ICMJE criteria for Authorship.\n\nAppendix A Supplementary data\nThe following is the supplementary data related to this article:Application\nApplication \n\nAcknowledgements\nThe authors would like to thank Mr. Arun Kapil, Mr. Sushil Bhat, and Mr. Nitin Gautam for their help in acquiring high-quality images.\n\nAppendix A Supplementary data related to this article can be found at https://doi.org/10.1016/j.ajoc.2018.06.021.\n==== Refs\nReferences\n1 Cipriani A. La Ferla T. Furukawa T.A. Sertraline versus other antidepressive agents for depression Cochrane Database Syst Rev 4 2010 Cd006117 \n2 Cipriani A. Furukawa T.A. Geddes J.R. Does randomized evidence support sertraline as first-line antidepressant for adults with acute major depression? A systematic review and meta-analysis J Clin Psychiatr 69 11 2008 1732 1742 \n3 FDA approved labeling for Zoloft® https://www.fda.gov/ohrms/dockets/ac/04/briefing/4006b1_06_zoloft-label.pdf 2002 \n4 van Harten J. Clinical pharmacokinetics of selective serotonin reuptake inhibitors Clin Pharmacokinet 24 3 1993 203 220 8384945 \n5 Hiemke C. Hartter S. Pharmacokinetics of selective serotonin reuptake inhibitors Pharmacol Therapeut 85 1 2000 11 28 \n6 Ho H.Y. Kam K.W. Young A.L. Chan L.K. Yu E.C. Acute angle closure glaucoma after sertraline Gen Hosp Psychiatr 35 5 2013 575 e571-572 \n7 Lehman N.L. Johnson L.N. Toxic optic neuropathy after concomitant use of melatonin, zoloft, and a high-protein diet J Neuro Ophthalmol: Off J North Am Neuro Ophthalmol Soc 19 4 1999 232 234 \n8 Mason J.O. 3rd Patel S.A. Bull'S eye maculopathy in a patient taking sertraline Retin Cases Brief Rep 9 2 2015 131 133 25401995 \n9 Ewe S.Y. Abell R.G. Vote B.J. Bilateral maculopathy associated with sertraline Australasian Psychiatr: Bull Roy Aust N Z Coll Psychiatrists 22 6 2014 573 575 \n10 Sener E.C. Kiratli H. Presumed sertraline maculopathy Acta Ophthalmol Scand 79 4 2001 428 430 11453869 \n11 Costagliola C. Parmeggiani F. Semeraro F. Sebastiani A. Selective serotonin reuptake inhibitors: a review of its effects on intraocular pressure Curr Neuropharmacol 6 4 2008 293 310 19587851 \n12 Barnett N.L. Osborne N.N. The presence of serotonin (5-HT1) receptors negatively coupled to adenylate cyclase in rabbit and human iris-ciliary processes Exp Eye Res 57 2 1993 209 216 8405187 \n13 Chidlow G. Le Corre S. Osborne N.N. Localization of 5-hydroxytryptamine1A and 5-hydroxytryptamine7 receptors in rabbit ocular and brain tissues Neuroscience 87 3 1998 675 689 9758233 \n14 Nash M. Flanigan T. Leslie R. Osborne N. Serotonin-2A receptor mRNA expression in rat retinal pigment epithelial cells Ophthalmic Res 31 1 1999 1 4 9831816 \n15 Sharif N.A. Senchyna M. Serotonin receptor subtype mRNA expression in human ocular tissues, determined by RT-PCR Mol Vis 12 2006 1040 1047 16971896 \n16 Uusitalo H. Lehtosalo J. Laakso J. Harkonen M. Palkama A. Immunohistochemical and biochemical evidence for 5-hydroxytryptamine containing nerves in the anterior part of the eye Exp Eye Res 35 6 1982 671 675 6759146 \n17 Pootanakit K. Prior K.J. Hunter D.D. Brunken W.J. 5-HT2a receptors in the rabbit retina: potential presynaptic modulators Vis Neurosci 16 2 1999 221 230 10367957 \n18 Pootanakit K. Brunken W.J. Identification of 5-HT(3A) and 5-HT(3B) receptor subunits in mammalian retinae: potential pre-synaptic modulators of photoreceptors Brain Res 896 1–2 2001 77 85 11277976 \n19 Nash M.S. Wood J.P. Osborne N.N. Protein kinase C activation by serotonin potentiates agonist-induced stimulation of cAMP production in cultured rat retinal pigment epithelial cells Exp Eye Res 64 2 1997 249 255 9176059\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2451-9936",
"issue": "11()",
"journal": "American journal of ophthalmology case reports",
"keywords": "Bull's eye maculopathy; Drug-induced retinopathy; Macular edema; Maculopathy; Sertraline",
"medline_ta": "Am J Ophthalmol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101679941",
"other_id": null,
"pages": "135-138",
"pmc": null,
"pmid": "29984334",
"pubdate": "2018-09",
"publication_types": "D002363:Case Reports",
"references": "11277976;23040863;25358654;9831816;9758233;19026250;10674711;19587851;25401995;8405187;10608673;16971896;20393946;10367957;6759146;8384945;11453869;9176059",
"title": "Bilateral cystoid macular edema misdiagnosed as pars planitis in a patient on sertraline therapy.",
"title_normalized": "bilateral cystoid macular edema misdiagnosed as pars planitis in a patient on sertraline therapy"
} | [
{
"companynumb": "IN-OXFORD PHARMACEUTICALS, LLC-2018OXF01593",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SERTRALINE HYDROCHLORIDE"
},
... |
{
"abstract": "Delayed parkinsonism and dystonia are recognized phenomena in osmotic demyelinating syndrome (ODS). Dopamine receptor agonists and levodopa have been reported to benefit select patients.\n\n\n\nWe report a patient with ODS with severe pseudobulbar deficits, parkinsonism and dystonia, poorly responsive to levodopa, who experienced a remarkable improvement with pramipexole.\n\n\n\nA marked response to pramipexole with lack of response to levodopa suggests a pre-synaptic source for his deficits coupled with injuries to non-nigral compensatory structures.\n\n\n\nThis case highlights a dramatic response of osmotic demyelination-induced parkinsonism/dystonia to pramipexole. A lack of response to levodopa suggests deficits in the pre-synaptic nigral as well as non-nigral compensatory structures.",
"affiliations": "Department of Neurology, NYU Grossman School of Medicine, US.;Department of Neurology, New York-Presbyterian Hospital/Columbia University, US.;Department of Neurology, NYU Grossman School of Medicine, US.",
"authors": "Han|Steve C|SC|;Katus|Linn|L|;Frucht|Steven|S|",
"chemical_list": "D000978:Antiparkinson Agents; D006490:Hemostatics; D013764:Tetrahydronaphthalenes; D013876:Thiophenes; D007980:Levodopa; D000077487:Pramipexole; C047508:rotigotine; D003894:Deamino Arginine Vasopressin",
"country": "England",
"delete": false,
"doi": "10.5334/tohm.66",
"fulltext": "\n==== Front\nTremor Other Hyperkinet Mov (N Y)\nTremor Other Hyperkinet Mov (N Y)\n2160-8288\nTremor and Other Hyperkinetic Movements\n2160-8288 Ubiquity Press \n\n10.5334/tohm.66\nCase Report\nDramatic Response to Pramipexole in Delayed-Onset Parkinsonism from Osmotic Demyelinating Syndrome\nHan Steve C. MDsteve.han2@nyulangone.org1 Katus Linn DO2 Frucht Steven MD1 1 Department of Neurology, NYU Grossman School of Medicine, US\n2 Department of Neurology, New York-Presbyterian Hospital/Columbia University, US\nCorresponding author: Steve C. Han, MD (steve.han2@nyulangone.org)\n16 6 2020 \n2020 \n10 902 1 2020 15 4 2020 Copyright: © 2020 The Author(s)2020This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License (CC-BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. See http://creativecommons.org/licenses/by/4.0/.Background:\nDelayed parkinsonism and dystonia are recognized phenomena in osmotic demyelinating syndrome (ODS). Dopamine receptor agonists and levodopa have been reported to benefit select patients.\n\nCase report:\nWe report a patient with ODS with severe pseudobulbar deficits, parkinsonism and dystonia, poorly responsive to levodopa, who experienced a remarkable improvement with pramipexole.\n\nDiscussion:\nA marked response to pramipexole with lack of response to levodopa suggests a pre-synaptic source for his deficits coupled with injuries to non-nigral compensatory structures.\n\nHighlights:\nThis case highlights a dramatic response of osmotic demyelination-induced parkinsonism/dystonia to pramipexole. A lack of response to levodopa suggests deficits in the pre-synaptic nigral as well as non-nigral compensatory structures.\n\nParkinsonismextrapyramidal symptomsosmotic demyelinating syndrome\n==== Body\nIntroduction\nOsmotic demyelinating syndrome (ODS) occurs as a result of overly rapid correction of hyponatremia [1]. Depending on the locations of the lesion and clinical manifestations, ODS may be separated into two categories: central pontine myelinolysis (CPM) and extrapontine myelinolysis (EPM). CPM is typically associated with severe quadriparesis, bulbar palsy, coma or locked-in state. It may also be associated with dysarthria, dysphagia, ophthalmoplegia or facial paresis [1]. EPM is characterized by altered consciousness, confusion, emotional lability, ataxia, tremor, myoclonus, akinetic mutism, catatonia, dysautonomia, quadriparesis, dystonia, choreoathetosis or parkinsonism [1].\n\nWhile magnetic resonance imaging (MRI) is helpful in evaluating suspected ODS, the findings may take several weeks to become apparent [1]. Typical brain MRI findings include T2 and FLAIR hyperintensities as well as T1 hypointensities without contrast enhancement [1]. It is important to note that the extent of MRI signal intensity does not necessarily correlate with clinical outcome [23]. In addition, these signal changes may eventually resolve, which make MRI less reliable overtime [2].\n\nThis case report presents a patient presenting with pseudobulbar deficits, parkinsonism and dystonia from ODS, whose symptoms were resistant to levodopa but markedly responsive to pramipexole.\n\nCase Description\nA 42-year-old man with history of von Willebrand disease type 1 was prescribed desmopressin after a recent nasal septoplasty in the setting of epistaxis post-surgery. Within days of discharge, patient presented to the hospital with a seizure. His sodium at the time of presentation was 122 mEq/L which was corrected to 132 mEq/L within a period of 24 hours. After transfer to our institution, ODS was confirmed on MRI which showed T2 hyperintense lesion at the central pons as well as T1 hypointensities at the bilateral lentiform nuclei (Figures 1, 2). Hospital course was complicated by a seizure, locked-in syndrome for approximately 3 weeks, dysphagia, dysarthria and difficulty with bilateral hand coordination. He was eventually discharged to rehabilitation with some improvement of these symptoms but did not return to his baseline.\n\nFigure 1 Neuroimaging in ODS. (A) Axial T2-weighted brain MRI of the patient showing hyperintensity of the central pons (solid arrow) and (B) Axial T1-weighted brain MRI of the patient showing hypointensity of the central pons (dotted arrow).\n\nFigure 2 Neuroimaging in ODS. Axial T1-weighted brain MRI of the patient showing hypointensities of the bilateral lentiform nuclei (red arrows).\n\nApproximately 11 months after his first admission, he was re-admitted for worsening dysphagia, dysarthria and bilateral hand discoordination. The severity of the dysphagia progressed to the point where he required a PEG placement for sustenance. The patient could not speak and required a cellular device in order to communicate. In addition to inability to swallow, he could not use his hands to write, hold a cup, type on a keyboard or write. Patient also showed bradykinesia, dystonia of bilateral hands and rigidity.\n\nDue to these aforementioned neurological symptoms, the patient was initiated on carbidopa-levodopa 25/100 mg one tablet three times daily, subsequently increased to 1.5 tablets three times daily, without improvement. Due to worsening depression in the setting of his deteriorating health, patient attempted suicide by ingesting 20–30 tablets of carbidopa-levodopa. Despite the overdose, the patient did not subjectively notice any improvement in his neurological symptoms.\n\nA neurological evaluation performed 1.5 years after the initial diagnosis of ODS showed mild cranial masking with facial dystonia and a risus sardonicus (Video 1). He was severely dysarthric and almost completely unintelligible. Evaluation also revealed mild square wave jerks and mild dystonic flexion posturing of the left metacarpophalangeal joints. No resting, postural or kinetic tremor was noted. Finger tapping was moderately impaired bilaterally with breakdown in the amplitude and cadence. There was mild bradykinesia of overall movements, moderately bradykinetic finger movements, and moderate bilateral cogwheeling. He had no difficulty sitting up from the chair with arms crossed and demonstrated ability to walk with good stride length but with reduced left arm swing. Pull test was negative.\n\nVideo 1 Before initiation of pramipexole (only on carbidopa-levodopa). Risus sardonicus with significant dysarthria, bradykinetic movement (low amplitude on finger tapping) and dystonia involving the hands are observed.\n\nIn the following months, amantadine 100 mg twice daily was added. The patient showed minimal benefit and was started on trihexyphenidyl 2 mg thrice daily as well as pramipexole 0.5 mg thrice daily (later titrated to 1 mg thrice daily). He showed gradual response on this regimen with improvement in his pseudobulbar palsy and facial masking. When the dose of pramipexole was increased to 1 mg three times daily there was a dramatic improvement in speech and movements. He was able to speak clearly in long sentences though the volume of speech was observed to be reduced. Facial masking and voluntary movements were markedly improved (Video 2).\n\nVideo 2 On pramipexole 3 mg/day. Significant improvement of dysarthria and risus sardonicus with greater facial expressivity are observed.\n\nDespite the aforementioned improvement, he developed compulsive shopping behavior and sexual disinhibition three months after starting on pramipexole, leading to the discontinuation of pramipexole. Neurological examination after the discontinuation of pramipexole revealed worsening of dysarthria and parkinsonian symptoms. For treatment of these compulsive behavior, he was initially started on valproic acid and eventually transitioned to lamotrigine for mood stabilization with good effect. Transdermal rotigotine (2 mg daily) was added without significant benefit. Due to the lack of efficacy with prior regimen, pramipexole was re-introduced and he responded again to modest dose (1.5 mg daily) (Video 3).\n\nVideo 3 Upon discontinuation of pramipexole. Rotigotine was added as limited benefit with increase in other medications including levodopa, trihexyphenidyl and amantadine. Patient without noticeable improvement of dysarthria with rotigotine. Rotigotine was subsequently stopped and pramipexole was restarted and titrated up slowly on 12/2015 to 1.5 mg per day. Patient experienced improvement of dysarthria subsequently.\n\nDiscussion\nThe pathophysiology of ODS is complex. Briefly, the cerebral adaptation to serum hyponatremia occurs via multiple mechanisms. The serum hypotonicity from the initial hyponatremia causes water to flow across the blood-brain barrier, increasing the brain water content as well as the intracellular water content [4]. Astrocytes lose intracellular osmolytes in response to serum hypotonicity. This allows these cells to maintain isotonicity with the serum while limiting a significant increase in intracellular water [4]. Following this cerebral adaption, the rate of correction of hyponatremia is the critical inciting factor in injury. The intracellular osmolytes in the astrocytes cannot be quickly replaced when the brain volume begins to decrease in response to a rapid correction of hyponatremia [4]. Consequently, it is surmised that the loss of intracellular water as well as the movement of potassium and sodium back into these cells cause injury and demyelination [4].\n\nTreatment of ODS remains largely symptomatic and supportive. Treatment with thyrotropin releasing hormone, plasma exchange, methylprednisolone and intravenous immunoglobulin has not shown clear evidence of efficacy [1]. Symptomatic treatments include therapies involving the dopaminergic system with the two main classes of medications being levodopa and dopamine receptor agonists.\n\nLevodopa supplementation allows the presynaptic neurons to release more dopamine into the synapse, resulting in greater stimulation of the dopamine receptors. In contrast, dopamine receptor agonists directly stimulate the dopamine receptors, bypassing the process of presynaptic storage and release of the neurotransmitter [567].\n\nReview of multiple cases of movement disorder associated with ODS reveals a variable response to levodopa (Table 1). It should be noted, however, that delayed-onset parkinsonian symptoms appear to be more persistent or less responsive to therapy. Cases of parkinsonism with onset within days after diagnosis of ODS have been shown to generally respond to supportive care or levodopa (Table 1). When a few of these cases were followed up at a later time point, there were either residual parkinsonian symptoms or symptoms resistant to treatment (Table 1: Toft et al., Seah et al., Schwarz et al.). This variability in and resistance to clinical response in the delayed-onset variant may be explained by the poor reorganization and repair of neural structures over time after the initial injury [1].\n\nTable 1 Review of cases of ODS presenting with extrapyramidal symptoms.\n\nStudy\tYear\tCase\tApproximate time of symptom onset\tProminent clinical signs\tTreatment\tOutcome\t\n\t\nHalimet al. [12]\t2018\tCase 1\t4 days after presentation\tRigidity, bradykinesia, tremor, impairment of horizontal and vertical gaze\tLevodopa/benserazide, trihexyphenidyl, IVIG*, dexamethasone\tImprovement of symptoms\t\nRizviet al. [13]\t2012\tCase 1\t4 days after presentation\tTremor, gait difficulty, bradykinesia, dysarthria, cogwheel rigidity\tLevodopa-carbidopa\tImprovement of symptoms\t\nImamet al. [14]\t2012\tCase 1\t9 days after presentation\tBradykinesia, dysphagia, hypomimia, rigidity, spasticity\tLevodopa-carbidopa\tModerate improvement of symptoms\t\nKwonet al. [15]\t2011\tCase 1\t5 days after presentation\tRigidity, tremor, bradykinesia, postural instability, hypophonia, pseudobulbar palsy, autonomic dysfunction\tLevodopa, anticholinergic medications, benzodiazepine\tNo improvement in symptoms (death from cardiac arrest 10 days after presentation)\t\nToftet al. [16]\t2011\tCase 1\t28 days after presentation\tDysarthria, bradykinesia, ataxia, gait instability, dystonia\tNone\tPersistence of symptoms\t\n\t\tCase 1\t6 years after presentation\tTremor, cogwheel rigidity after 6 years\tLevodopa, apomorphine, ropinirole\tImprovement of symptoms except for mild bradykinesia of left side\t\nPostet al. [17]\t2009\tCase 1\t15 days after presentation\tDysarthria, bradykinesia, masked face, hypophonia, cogwheel ridigity\tNone\tSpontaneous recovery but with mild masked face\t\nSajithet al. [18]\t2006\tCase 1\t1 week after presentation\tDysarthria, ataxia, cogwheel rigidity, tremor, decreased oro-bucco-lingual movements\tLevodopa-carbidopa, baclofen\tImprovement of symptoms\t\nSeahet al. [19]\t2002\tCase 1\t9 days after presentation\tTremor, rigidity, myoclonic jerks\tSupportive care\tSlowly resolved except for spasticity and rigidity\t\n\t\tCase 1\t1 month after presentation\tTremor, bradykinesia, rigidity, gait instability, dystonia, dyskinesia, choreoathetosis\tLevodopa/bensarazide, trihexyphenidyl, baclofen\tNo improvement of movement disorder symptoms even after >1 year of follow up, with severe rigidity, bradykinesia and generalized dystonia\t\nKim et al. [20]\t2003\tCase 1\t2 weeks after correction of hyponatremia\tMasked face, dysarthria, bradykinesia, tremor, cogwheel rigidity, gait ataxia\tLevodopa-carbidopa\tImprovement of symptoms\t\nNagamitsuet al. [21]\t1999\tCase 1\t2 weeks after correction of hyponatremia\tMasked face, bradykinesia, dysarthria, gait disturbance, dysphagia, sialism, glossal palsy, tremor, cogwheel rigidity\tLevodopa-carbidopa, amantadine\tNo initial improvement with amantadine but with marked improvement with levodopa\t\nSchwarzet al. [22]\t1998\tCase 1\t6 days after presentation\tBradykinesia, cogwheel rigidity, facial hypomimia, monotonous speech, parkinsonian gait with retropulsion\tLevodopa/benserazide\tInitial resolution of parkinsonian signs with levodopa/benserazide but with return of mentioned symptoms\t\n\t\tCase 1\t4 months after presentation\tDystonia, dysphagia, spasmodic dysphonia\tTiapride, perphenazine\tImprovement of dysphagia, retrocollis, oromandibular dystonia but persistent focal dystonia of the right arm and spasmodic dysphonia even after 20 months\t\nMaraganore et al. [23]\t1992\tCase 1\t5 months after presentation\tDystonia, dysarthria, adductor spastic dysphonia\tTrihexyphenidyl, baclofen\tNo improvement in symptoms, exhibited movement disorder symptoms for at least 1 year\t\n\t\tCase 2\t6 months after presentation\tTremor, forward stooped gait, dysarthria, decreased arm swing, supranuclear left horizontal conjugate gaze palsy, pseudobulbar affect\tNone\tNo improvement in symptoms, exhibited movement disorder symptoms for at least 1 year\t\n\t\tCase 3\t5 weeks after presentation\tDystonia, masked face\tNone\tDystonia worsened over the next month, lost to follow up\t\nTisonet al. [24]\t1991\tCase 1\t41 days after admission\tTremor, cogwheel rigidity, gait difficulty, dystonia with choreoathetosis\tTrihexyphenidyl, tiapride\tImprovement of symptoms\t\n* IVIG: Intravenous immunoglobulin.\n\nOur patient responded minimally to levodopa but showed a marked dose-dependent improvement with pramipexole. The worsening of his symptoms upon discontinuation of pramipexole and subsequent modest improvement upon re-initiation support its therapeutic effect. Another case report has also demonstrated the efficacy of pramipexole in extrapontine myelinolysis that presented in the setting of adrenal failure [8]. In this report, the patient had developed parkinsonian symptoms (diffuse rigidity with bradykinesia, hypomimia, resting tremor, festinant gait) that significantly improved with pramipexole; however, no other therapy including levodopa or other dopamine agonists were tried in this case.\n\nThe etiology of the dichotomous response in our case warrants further discussion. One explanation may be that the patient had such significant destruction of the presynaptic neurons from ODS that the amount of converted dopamine in the remaining few neurons could not result in clinically significant activation of postsynaptic dopamine receptors. Alternatively, because the postsynaptic dopamine receptors are intact, direct postsynaptic dopamine receptor agonists, such as pramipexole, could still achieve good clinical response as it bypasses the aforementioned presynaptic problem. In addition, direct dopamine agonists, with their longer half-lives than levodopa, may maintain a sustained activation of the postsynaptic dopamine receptors and result in a clinically significant response [6]. Levodopa, however, continues to show efficacy in advanced idiopathic Parkinson’s disease (PD), in which there are substantial destruction of the pre-synaptic nigral neuronal [9]. In our case, levodopa may have been less effective in treating EPS in ODS compared to idiopathic PD because ODS may have injured the basal ganglia or non-basal ganglia neurons and their pathways involved in compensatory mechanisms in idiopathic PD [10].\n\nThe lack of response to rotigotine compared to pramipexole should be discussed as both are nonergot dopamine agonists. While the mechanism is not completely understood, these dopamine agonists have different selectivity for different dopamine receptors [11]. Rotigotine shows high affinity and potency for D1, D2 and D3 receptors. Pramipexole shows high affinity and potency at D2 and D3 but preferentially stimulates D3 receptors compared to D2 receptors. While the clear role of specific receptor agonism is unclear, the differences in the receptor binding of the two agents may explain the dichotomous clinical response in this particular patient.\n\nAcknowledgements\nWe thank the patient and his family for their cooperation.\n\nEthics and Consent\nInformed consent was obtained from patient via paper form.\n\nCompeting Interests\nThe authors have no competing interests to declare.\n==== Refs\n1 de Souza \nA . Movement disorders and the osmotic demyelination syndrome\n. Parkinsonism & Related Disorders . 2013 ; 19 (8 ): 709 –16\n. DOI: 10.1016/j.parkreldis.2013.04.005 23660544 \n2 Alleman \nAM . Osmotic demyelination syndrome: Central pontine myelinolysis and extrapontine myelinolysis\n. Semin Ultrasound CT MR . 2014 ; 35 (2 ): 153 –9\n. DOI: 10.1053/j.sult.2013.09.009 24745890 \n3 Graff-Radford \nJ , Kaufmann \nJE , Mandrekar \nTJ , Rabinstein \nJN , Rabinstein \nAA . Clinical and Radiologic Correlations of Central Pontine Myelinolysis Syndrome\n. Mayo Clinic Proceedings . 2011 ; 86 (11 ): 1063 –7\n. DOI: 10.4065/mcp.2011.0239 21997578 \n4 King \nJD , Rosner \nMH . Osmotic demyelination syndrome\n. Am J Med Sci . 2010 ; 339 (6 ): 561 –7\n. DOI: 10.1097/MAJ.0b013e3181d3cd78 20453633 \n5 Watts \nRL . The role of dopamine agonists in early Parkinson’s disease\n. Neurology . 1997 ; 49 : S34 –S8\n. DOI: 10.1212/WNL.49.1_Suppl_1.S34 9222273 \n6 Hisahara \nS , Shimohama \nS . Dopamine receptors and Parkinson’s disease\n. Int J Med Chem ; 2011 DOI: 10.1155/2011/403039 \n7 Radad \nKG , Gille \nG , Rausch , W . Short review on dopamine agonists: Insight into clinical and research studies relevant to Parkinson’s disease\n. Pharmacological Reports . 2005 ; 57 : 701 –12\n.16382188 \n8 Gujjar , AA-M , Al-Mamari \nA , Jacob , PC , Jain \nR , Balkhair \nA , Al-Asmi \nA . Extrapontine myelinolysis as presenting manifestation of adrenal failure: A case report\n. Journal of the Neurological Sciences . 2010 ; 290 : 169 –71\n. DOI: 10.1016/j.jns.2009.11.012 20022023 \n9 Slevin \nJT , Fernandez \nHH , Zadikoff \nC , Hall \nC , Eaton \nS , Dubow \nJ , Chatamra \nK , Benesh \nJ . Long-Term Safety and Maintenance of Efficacy of Levodopa-Carbidopa Intestinal Gel: An Open Label Extension of the Double-Blind Pivotal Study in Advanced Parkinson’s Disease Patients\n. Journal of Parkinson’s Disease . 2015 ; 5 : 165 –74\n. DOI: 10.3233/JPD-140456 \n10 Bezard \nE , Gross \nCE , Brotchie \nJM . Presymptomatic compensation in Parkinson’s disease is not dopamine-mediated\n. TRENDS in Neurosciences . 2003 ; 26 (4 ): 215 –21\n. DOI: 10.1016/S0166-2236(03)00038-9 12689773 \n11 Wood \nM , Dubois \nV , Scheller \nD , Gillard \nM . Rotigotine is a potent agonist at dopamine D1 receptors as well as at dopamine D2 and D3 receptors\n. British Journal of Pharmacology . 2015 ; 172 : 1124 –35\n. DOI: 10.1111/bph.12988 25339241 \n12 Abdul Halim \nS , Mohd Amin \nNA . Treatment response in osmotic demyelination syndrome presenting as severe parkinsonism, ptosis and gaze palsy\n. BMJ Case Rep . 2018 ; 2018. DOI: 10.1136/bcr-2018-225751 \n13 Rizvi \nI , Ahmad \nM , Gupta \nA , Zaidi \nN . Isolated extra pontine myelinolysis presenting as acute onset parkinsonism\n. BMJ Case Rep . 2012 ; 2012. DOI: 10.1136/bcr-2012-007140 \n14 Imam \nYZ , Saqqur \nM , Alhail \nH , Deleu \nD . Extrapontine myelinolysis-induced parkinsonism in a patient with adrenal crisis\n. Case Rep Neurol Med . 2012 ; 2012 : 327058 DOI: 10.1155/2012/327058 23346434 \n15 Kwon \nDY , Seo \nWK , Park \nMH , Kang \nYS , Koh \nSB , Cha \nDR , et al. Rapidly deteriorating parkinsonism and dysautonomia in patient with central pontine and extrapontine myelinolysis\n. Clin Neurol Neurosurg . 2011 ; 113 (6 ): 513 –4\n. DOI: 10.1016/j.clineuro.2011.02.002 21353739 \n16 Toft \nM , Dietrichs \nE . Levodopa-responsive parkinsonism in probable extrapontine myelinolysis of the mesencephalon\n. Mov Disord . 2011 ; 26 (12 ): 2180 –1\n. DOI: 10.1002/mds.23876 22021157 \n17 Post \nB , van Gool \nWA , Tijssen \nMA . Transient Parkinsonism in isolated extrapontine myelinolysis\n. Neurol Sci . 2009 ; 30 (4 ): 325 –8\n. DOI: 10.1007/s10072-009-0088-9 19444382 \n18 Sajith \nJ , Ditchfield \nA , Katifi \nHA . Extrapontine myelinolysis presenting as acute parkinsonism\n. BMC Neurol . 2006 ; 6 : 33 DOI: 10.1186/1471-2377-6-33 16961933 \n19 Seah \nABH , Chan \nLL , Wong \nMC , Tan \nEK . Evolving spectrum of movement disorders in extrapontine and central pontine myelinolysis\n. Parkinsonism & Related Disorders . 2002 ; 9 : 117 –9\n. DOI: 10.1016/S1353-8020(02)00002-0 12473403 \n20 Kim \nJS , Lee \nKS , Han \nSR , Chung \nYA . Decreased Striatal Dopamine Transporter Binding in a Patietn with Extrapontine Myelinolysis\n. Movement Disorders . 2003 ; 18 (3 ): 342 –5\n. DOI: 10.1002/mds.10331 12621642 \n21 Nagamitsu \nS , Matsuishi \nT , Yamashita \nY , Yamada \nS , Kato \nH . Extrapontine myelinolysis with parkinsonism after rapid correction of hyponatremia: high cerebrospinal fluid level of homovanillic acid and successful dopaminergic treatment\n. Journal of Neural Transmission . 1999 ; 106 : 949 –53\n. DOI: 10.1007/s007020050215 10599877 \n22 Schwarz \nAS , Aichinger-Steiner \nMM , Funk \nG , Schnider \nP , Brainin \nM . Parkinsonism and dystonia in central pointine and extrapontine myelinolysis\n. Journal of Neurology, Neurosurgery & Psychiatry . 1998 ; 65 : 119 –21\n. DOI: 10.1136/jnnp.65.1.119 \n23 Maraganore \nDM , Folger \nWN , Swanson \nJW , Ahlskog \nJE . Movement Disorders as Sequelae of Central Pontine Myelinolysis: Report of Three Cases\n. Movement Disorders . 1992 ; 7 (2 ): 142 –8\n. DOI: 10.1002/mds.870070208 1584236 \n24 Tison \nFX , Ferre \nX , Julien \nJ . Delayed Onset Movement Disorders as a Complication of Central Pontine Myelinolysis\n. Movement Disorders . 1991 ; 6 (2 ): 171 –3\n. DOI: 10.1002/mds.870060215 2057010\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2160-8288",
"issue": "10()",
"journal": "Tremor and other hyperkinetic movements (New York, N.Y.)",
"keywords": "Parkinsonism; extrapyramidal symptoms; osmotic demyelinating syndrome",
"medline_ta": "Tremor Other Hyperkinet Mov (N Y)",
"mesh_terms": "D000328:Adult; D000978:Antiparkinson Agents; D003894:Deamino Arginine Vasopressin; D003711:Demyelinating Diseases; D004421:Dystonia; D004844:Epistaxis; D006490:Hemostatics; D006801:Humans; D007010:Hyponatremia; D007980:Levodopa; D000080422:Locked-In Syndrome; D008297:Male; D017590:Myelinolysis, Central Pontine; D009997:Osmotic Pressure; D020734:Parkinsonian Disorders; D019106:Postoperative Hemorrhage; D000077487:Pramipexole; D020828:Pseudobulbar Palsy; D012225:Rhinoplasty; D013764:Tetrahydronaphthalenes; D013876:Thiophenes; D017211:Treatment Failure; D016896:Treatment Outcome; D056725:von Willebrand Disease, Type 1",
"nlm_unique_id": "101569493",
"other_id": null,
"pages": "9",
"pmc": null,
"pmid": "32775023",
"pubdate": "2020-06-16",
"publication_types": "D002363:Case Reports; D059040:Video-Audio Media",
"references": "12473403;21353739;23660544;23076704;30344146;22021157;9222273;19444382;24745890;10599877;23346434;25588353;2057010;16382188;9667573;20453633;12689773;1584236;25954517;16961933;21997578;25339241;20022023;12621642",
"title": "Dramatic Response to Pramipexole in Delayed-Onset Parkinsonism from Osmotic Demyelinating Syndrome.",
"title_normalized": "dramatic response to pramipexole in delayed onset parkinsonism from osmotic demyelinating syndrome"
} | [
{
"companynumb": "US-009507513-2008USA013037",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CARBIDOPA\\LEVODOPA"
},
"drugadditional": nu... |
{
"abstract": "Treatment-induced neuropathy (TIN) in diabetes is an acute and painful yet completely reversible small fiber neuropathy precipitated by a rapid improvement in glycemic control. TIN is rare in children. A 16-year-old girl developed symmetrical painful neuropathy of the foot, autonomic neuropathy, and retinopathy 5 weeks after the diagnosis of type 1 diabetes. All causative workups were negative except for a drop-in hemoglobin A1c (HbA1c) from 17.4% to 7%, which fit with a diagnosis of TIN. Following symptomatic management, her neuropathy and retinopathy completely resolved in 2 months. Currently, she is 18 years old and doing well (HbA1c, 7.4%) without any recurrence of TIN. TIN should be suspected in any child presenting with recent-onset type 1 diabetes and acute onset neuropathy. Our case represents an unreported scenario of the rapid progression in TIN. Awareness among clinicians about this rare but completely reversible condition is necessary to ensure proper management and adherence to glycemic control.",
"affiliations": "Sri Ramachandra Medical College, Chennai, India.;Division of Paediatric Endocrinology, Department of Pediatrics, Sri Ramachandra Medical College, Chennai, India.;Department of Pediatrics, Sri Ramachandra Medical College, Chennai, India.;Department of Pediatrics, Sri Ramachandra Medical College, Chennai, India.;Department of Pediatrics, Sri Ramachandra Medical College, Chennai, India.",
"authors": "Varadharaju|Niranjana|N|;Jeevarathnam|Dhivyalakshmi|D|;Rajan|Mahalakshmi|M|;Ponnurangam Nagarajan|Vinoth|V|;James|Saji|S|",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.6065/apem.2019.24.3.203",
"fulltext": "\n==== Front\nAnn Pediatr Endocrinol MetabAnn Pediatr Endocrinol MetabAPEMAnnals of Pediatric Endocrinology & Metabolism2287-10122287-1292Korean Society of Pediatric Endocrinology 10.6065/apem.2019.24.3.203apem-2019-24-3-203Case ReportA case of treatment-induced neuropathy in an adolescent with type 1 diabetes Varadharaju Niranjana MBBSMD1http://orcid.org/0000-0003-1138-564XJeevarathnam Dhivyalakshmi MD2Rajan Mahalakshmi MD3Ponnurangam Nagarajan Vinoth MD3James Saji MD3\n1 Sri Ramachandra Medical College, Chennai, India\n2 Division of Paediatric Endocrinology, Department of Pediatrics, Sri Ramachandra Medical College, Chennai, India\n3 Department of Pediatrics, Sri Ramachandra Medical College, Chennai, IndiaAddress for correspondence: Dhivyalakshmi Jeevarathnam, MD Department of Pediatrics, Division of Pediatric Endocrinology, G-block, 4th floor (link room), Sri Ramachandra Medical College and Hospital, Porur, Chennai-600116, India Tel: +91-44-24330846 Fax: +91-44-24767008 E-mail: laksdhivya@gmail.com9 2019 30 9 2019 24 3 203 206 28 9 2018 22 11 2018 22 12 2018 © 2019 Annals of Pediatric Endocrinology & Metabolism2019This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Treatment-induced neuropathy (TIN) in diabetes is an acute and painful yet completely reversible small fiber neuropathy precipitated by a rapid improvement in glycemic control. TIN is rare in children. A 16-year-old girl developed symmetrical painful neuropathy of the foot, autonomic neuropathy, and retinopathy 5 weeks after the diagnosis of type 1 diabetes. All causative workups were negative except for a drop-in hemoglobin A1c (HbA1c) from 17.4% to 7%, which fit with a diagnosis of TIN. Following symptomatic management, her neuropathy and retinopathy completely resolved in 2 months. Currently, she is 18 years old and doing well (HbA1c, 7.4%) without any recurrence of TIN. TIN should be suspected in any child presenting with recent-onset type 1 diabetes and acute onset neuropathy. Our case represents an unreported scenario of the rapid progression in TIN. Awareness among clinicians about this rare but completely reversible condition is necessary to ensure proper management and adherence to glycemic control.\n\nPainful neuropathyAutonomic neuropathyType 1 diabetes mellitusChildGlycemic control\n==== Body\nIntroduction\nAcute painful diabetic neuropathy (APDN) is a rare peripheral neuropathy seen in type 1 as well as in type 2 diabetes. In APDN, neuropathic pain mostly occurs within 8 weeks of glycemic control in contrast to the rather insidious onset of diabetic distal polyneuropathy. Treatment-induced neuropathy (TIN) is a type of APDN. The criteria for TIN are acute onset of neuropathic pain and/or autonomic symptoms occurring within 8 weeks of documented glycemic control (a drop-in hemoglobin A1c [HbA1c] by more than 2% over 3 months). There are many reports of TIN in adults with type 1 and type 2 diabetes, but not in children. TIN is observed with insulin therapy as well as treatment with oral hypoglycemic agents [1].\n\nCase report\nA 16-year-old girl weighing 40 kg presented to the Emergency Department with a history of vomiting and excessive fatigability for the past week. She had a history of polyuria, polydipsia, and polyphagia for the past 1.5 years. She had taken some native medical treatment and reportedly experienced partial relief of her symptoms. Upon physical examination, she was conscious and alert and had tachycardia (heart rate, 120 beats/min) and tachypnea (respiratory rate, 20 breaths/min). Her blood pressure was 100/70 mmHg, and peripheral pulses were palpable. She was diagnosed with diabetic ketoacidosis (DKA) with a random blood glucose level of 560 mg/dL, blood pH of 7.12, and urine ketones 3+. As per standard treatment protocol, she was treated with a normal saline bolus (10 mL/kg over 1 hour) followed by normal saline maintenance infused at 155 mL/kg/hr for 48 hours while accounting for 10% dehydration correction. An insulin infusion was started at 0.1 U/kg/hr. The DKA resolved by 48 hours, and she was treated with regular (short-acting) and glargine insulin (regular insulin [Actrapid] was given at 12 U - 16 U - 12 U subcutaneously half an hour before food intake and glargine was administered at 10 units subcutaneously at 9:00 PM). Her HbA1c was 17.4%. C-peptide was 0.05 ng/mL, and a glutamic acid decarboxylase antibody test was positive (14.8 U/mL; the normal range is <10 U/mL). She was screened for complications like retinopathy and nephropathy, which were found to be negative. Her thyroid profile (thyroid stimulating hormone, 3.2 μU/mL; free thyroxine, 0.92 ng/dL) was within normal limits. She was discharged a week after the diagnosis following symptomatic improvement, and her blood sugars ranged between 150–200 mg/dL.\n\nFive weeks following her diagnosis, the patient presented to the Outpatient Department with a painful burning sensation in both feet and soles for the past 10 days, which left her unable to walk and caused sleep disturbances. There was no change in her appetite or weight. Upon evaluation, her blood pressure was 100/70 mmHg, and she had normal superficial and deep tendon reflexes of the lower limbs. Her sensory system examination revealed no abnormalities for pain, temperature, vibration, position, or crude and fine touch sensations in both lower limbs. There were no motor or sensory deficits in either upper limb. She had vitamin D insufficiency (15.7 ng/mL) and a normal vitamin B12 level (240 pg/mL). However, her pain had not subsided with nonsteroidal anti-inflammatory drugs along with vitamin B12 and cholecalciferol supplements. Her blood glucose records showed blood sugars around 100–150 mg/dL. Since the pain had not subsided after 2 weeks of outpatient treatment, she was admitted for diabetic peripheral neuropathy for further evaluation. At admission, she had normal motor reflexes of all 4 limbs. Her sensory system examination revealed reduced fine touch sensation in both feet and soles. There were no abnormalities in pain, temperature, vibration, and position sensations. There was hypertension (blood pressure, 150/100 mmHg) and resting tachycardia (122 beats/min). A hypertension work-up showed normal serum electrolytes and serum creatinine and an absence of microalbuminuria. Her computed tomography angiogram of the renal vessels, echocardiogram, vanillylmandelic acid, and metanephrine levels were normal. A vasculitis work-up (antinuclear antibodies, dsDNA, and antineutrophil cytoplasmic antibodies) was also negative. A pediatric cardiologist's opinion was obtained; the possibility of autonomic neuropathy was suggested, and antihypertensives (atenolol and nifedipine) were started.\n\nA nerve conduction study revealed preserved compound muscle action potentials and normal distal latency and conduction velocities in both lower limb motor nerves (tibial and common peroneal nerve), whereas there was a significant reduction in sensory nerve action potentials with mildly prolonged distal latency and mildly reduced conduction velocities in both superficial peroneal and sural nerves in the lower limbs suggestive of severe bilateral lower limb axonal predominant sensory polyneuropathy. Upper limb nerve conduction studies were normal.\n\nDuring her course of treatment, the patient complained of the sudden onset of blurring of her vision, and her ophthalmologic examination revealed features suggestive of diabetic and hypertensive retinopathy. Fundus fluorescein angiography showed areas of capillary nonperfusion of both eyes with macular ischemia and cystoid macular edema suggestive of diabetic and hypertensive retinopathy. She was started on amitriptyline, pregabalin, and gabapentin for peripheral neuropathy.\n\nAided by electronic discussions in an International Society for Pediatric and Adolescent Diabetes (ISPAD) forum along with a thorough literature search, the cause of the neuropathy was diagnosed to be TIN. The patient's HbA1c had dropped from 17.4% to 7% in 2 months, which fit the diagnosis of TIN [1].\n\nFollowing the diagnosis of TIN, the patient’s glycemic targets were slightly relaxed. She was discharged with antihypertensives and peripheral neuropathy medications on withdrawing doses. At the follow-up visit around 2 months later, the neuropathy (peripheral and autonomic) and retinopathy had both gradually resolved. All medications were stopped, and her HbA1c was 8.6%. Her glycemic control targets were gradually changed back to the recommended levels according to the ISPAD 2014 guidelines [2]. Currently, she is 18 years old, and her HbA1c was 7.4% without any recurrence of TIN. She is currently on regular insulin (Actrapid 10 U - 16 U - 12 U subcutaneously half an hour before food intake and glargine insulin 11 units subcutaneously at 9:00 PM).\n\nDiscussion\nAPDN is a rare peripheral neuropathy seen in type 1 as well as in type 2 diabetes. It was initially reported in 1933 by Caravati [3] as insulin neuritis. The incidence of APDN is not known or is likely grossly underestimated and is probably less than 1 in 1,000 diabetic patients. APDN can manifest as either treatment-induced neuropathy (TIN) and diabetic neuropathic cachexia (DNC) [1,3].\n\nIn TIN, neuropathic pain and/or autonomic symptoms typically occur within 8 weeks of documented glycemic control (a drop-in HbA1c ≥ 2% over 3 months). Several weeks after the onset, more classical length-dependent axonal and demyelinating sensory and motor neuropathy can occur [1,4]. A retrospective study by Gibbons and Freeman [4] observed the incidence of TIN to be 10.9% among 954 patients referred for diabetic neuropathy. TIN can occur with insulin and/or oral hypoglycemic agent therapy. To the best of our knowledge, there are only 7 case reports of TIN in children with diabetes, which highlights the rarity of this clinical entity [5-10]. TIN completely resolves in about 12–24 months; however, in our patient, the early onset of neuropathy with a quick progression to autonomic neuropathy and retinopathy and its resolution within weeks was quite unusual compared to previously published reports. The proposed diagnostic criteria for TIN are listed in Table 1.\n\nTIN is caused due to epineural arteriovenous shunting triggered by rapid glycemic control that precipitates endoneural hypoxia in small nerve fibers (the steal effect). DNC is a painful sensorimotor polyneuropathy with autonomic dysfunction that follows a recent diabetes onset, but a history of an eating disorder along with profound weight loss (>10% of body weight) is always present [1,11,12].\n\nThe most common differential diagnoses for TIN as well as the required laboratory tests are shown in Table 1. The gold standard test for diagnosing small fiber neuropathy is skin biopsy with intraepidermal nerve fiber density (IENFD) determination [13,14]. Due to logistic reasons, we could not carry out protein electrophoresis, light chain serum levels, and IENFD, but all the other investigations were normal for our patient.\n\nTreatment options involve good glycemic control, foot care, and pharmacological management. It may be safe to achieve glycemic control slowly and gradually if there is no risk of hyperglycemic emergencies in these patients [1]. According to the ISPAD 2014 guidelines for optimal blood sugar control, an HbA1c <7.5% is recommended as soon as it can be achieved [2]. However, a study by Gibbons and Freeman [4] has shown that a decrease in HbA1c by 2%–3% over 3 months has a 20% absolute risk, while a fall in HbA1c by >4% over 3 months exceeds 80% of the absolute risk for developing TIN [4]. Therefore, in the recommended setting of early achievement of good glycemic control, awareness about TIN and its management among clinicians is necessary to ensure adequate treatment.\n\nPharmacological treatment for neuropathic pain includes anticonvulsants (pregabalin, gabapentin), antidepressants (duloxetine, amitriptyline), and opioids (tramadol, tapentadol). Pharmacological agents are started with a single drug (mostly pregabalin) in incremental doses until the maximum dose is reached. If neuropathic pain persists, switching to another drug or combined therapy (with antidepressants) can be tried. If the pain still persists, opioids can be added [15].\n\nIn conclusion, clinicians should suspect TIN in any diabetic child, especially with neuropathy presenting too early in the course along with good glycemic control. Our case represents the unreported scenario of rapid progression to TIN. Awareness among clinicians about this rare and completely reversible condition is necessary to ensure proper treatment and adherence to glycemic control, especially in the recommended setting of the rapid achievement of glycemic control (HbA1c <8%). Instead of rapid improvement in glycemic control, a slow and gradual achievement of glycemic control may be a better option for these patients.\n\nEthical statement\n\nAs per the Institution’s ethics committee policy, Institutional Review Board approval is not necessary for case reports. Informed consent has been obtained from the patient for publication purposes.\n\nConflicts of interest\n\nNo potential conflict of interest relevant to this article was reported.\n\nWe thank Dr. Ragnar Hanas, past president of ISPAD, for the excellent guidance provided in the diagnosis and management of this patient.\n\nTable 1. Proposed diagnostic criteria for treatment-induced neuropathy*\n\n\tTreatment-induced neuropathy\t\nHistory\tImproved glycemic control (type 1 or type 2 diabetes) with insulin or oral hypoglycemic agents\t\nAnd\t\n• Onset of neuropathic pain within 6 months of treatment\t\n• Autonomic symptoms\t\n• History of eating disorder in type 1 diabetes\t\nClinical examination\tPainful paresthesia and symptoms of autonomic neuropathy\t\nNerve conduction studies\tSensorimotor polyneuropathy\t\nAutonomic testing\tParasympathetic and sympathetic dysfunction\t\nLaboratory tests\tBaseline HbA1c >10%\t\nAnd\t\nHbA1c after treatment <9% or drop of HbA1c >2% within 3 months\t\nAnd\t\nNormal values of TSH, ANA, ESR, vitamin B12, vitamin B1, Serum protein electrophoresis and light chain analysis\t\nDifferential diagnosis excluded\tOther polyneuropathies (Guillain-Barré variant, acute steroid-responsive small fibre sensory neuropathy and nonsystemic nerve vasculitis)\t\nHbA1c, glycated hemoglobin; TSH, thyroid stimulating hormone; ANA, antinuclear antibody; ESR, erythrocyte sedimentation rate.\n\n* Modified from Tran C, et al. Swiss Med Wkly 2015;145:w14131. [1]\n==== Refs\nReferences\n1 Tran C Philippe J Ochsner F Kuntzer T Truffert A Acute painful diabetic neuropathy: an uncommon, remittent type of acute distal small fibre neuropathy Swiss Med Wkly 2015 145 w14131 25941879 \n2 Rewers MJ Pillay K de Beaufort C Craig ME Hanas R Acerini CL ISPAD Clinical Practice Consensus Guidelines 2014 Assessment and monitoring of glycemic control in children and adolescents with diabetes. Pediatr Diabetes 2014 15 Suppl 20 102 14 25182311 \n3 Caravati CM Insulin neuritis: a case report Va Med Mon 1933 59 745 6 \n4 Gibbons CH Freeman R Treatment-induced neuropathy of diabetes: an acute, iatrogenic complication of diabetes Brain 2015 138 Pt 1 43 52 25392197 \n5 Archer AG Watkins PJ Thomas PK Sharma AK Payan J The natural history of acute painful neuropathy in diabetes mellitus J Neurol Neurosurg Psychiatry 1983 46 491 9 6875582 \n6 Wilson JL Sokol DK Smith LH Snook RJ Waguespack SG Kincaid JC Acute painful neuropathy (insulin neuritis) in a boy following rapid glycemic control for type 1 diabetes mellitus J Child Neurol 2003 18 365 7 12822825 \n7 Llewelyn JG Thomas PK Fonseca V King RH Dandona P Acute painful diabetic neuropathy precipitated by strict glycaemic control Acta Neuropathol 1986 72 157 63 3825515 \n8 Mathews C Rayman G Buck J Wadham C Perkins E Acute treatment induced diabetic neuropathy in a 15-yearold boy Proceedings of the 45th Meeting of the British Society for Paediatric Endocrinology and Diabetes 2017 Nov 22-24 Newcastle. Bristol British Society for Paediatric Endocrinology and Diabetes 1979 \n9 Dayal D Jayaraman D Sankhyan N Singhi P Acute painful neuropathy in a girl with type 1 diabetes: long term followup J Clin Diagn Res 2016 10 SD01 2 \n10 Rangel MA Baptista C Santos F Real MV Campos RA Leite AL Acute mononeuropathy in a child with newly diagnosed type 1 diabetes mellitus J Pediatr Endocrinol Metab 2015 28 341 4 25153576 \n11 Tesfaye S Malik R Harris N Jakubowski JJ Mody C Rennie IG Arterio-venous shunting and proliferating new vessels in acute painful neuropathy of rapid glycaemic control (insulin neuritis) Diabetologia 1996 39 329 35 8721779 \n12 Leow MK Wyckoff J Under-recognised paradox of neuropathy from rapid glycaemic control Postgrad Med J 2005 81 103 7 15701742 \n13 England JD Gronseth GS Franklin G Carter GT Kinsella LJ Cohen JA Practice Parameter: evaluation of distal symmetric polyneuropathy: role of laboratory and genetic testing (an evidence-based review). Report of the American Academy of Neurology, American Association of Neuromuscular and Electrodiagnostic Medicine, and American Academy of Physical Medicine and Rehabilitation Neurology 2009 72 185 92 19056666 \n14 Devigili G Tugnoli V Penza P Camozzi F Lombardi R Melli G The diagnostic criteria for small fibre neuropathy: from symptoms to neuropathology Brain 2008 131 Pt 7 1912 25 18524793 \n15 Pop-Busui R Boulton AJ Feldman EL Bril V Freeman R Malik RA Diabetic neuropathy: a position statement by the American Diabetes Association Diabetes Care 2017 40 136 54 27999003\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2287-1012",
"issue": "24(3)",
"journal": "Annals of pediatric endocrinology & metabolism",
"keywords": " Autonomic neuropathy; Child; Glycemic control; Type 1 diabetes mellitus; Painful neuropathy",
"medline_ta": "Ann Pediatr Endocrinol Metab",
"mesh_terms": null,
"nlm_unique_id": "101588279",
"other_id": null,
"pages": "203-206",
"pmc": null,
"pmid": "31607115",
"pubdate": "2019-09",
"publication_types": "D002363:Case Reports",
"references": "25153576;8721779;3825515;12822825;19056666;25941879;6875582;27999003;15701742;18524793;25182311;25392197;27437321",
"title": "A case of treatment-induced neuropathy in an adolescent with type 1 diabetes.",
"title_normalized": "a case of treatment induced neuropathy in an adolescent with type 1 diabetes"
} | [
{
"companynumb": "IN-NOVOPROD-696480",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INSULIN HUMAN"
},
"drugadditional": "3",
"... |
{
"abstract": "BACKGROUND\nImproved responsiveness to erythropoiesis stimulating agents (ESAs) in patients on on-line post-dilution hemodiafiltration (Post-HDF) compared with conventional hemodialysis (HD) was reported by some authors but challenged by others. This prospective, cross-over randomized study tested the hypothesis that an alternative infusion modality of HDF, mixed-dilution HDF (Mixed HDF), could further reduce ESAs requirement in dialysis patients compared to the traditional Post-HDF.\n\n\nMETHODS\nOne-hundred-twenty prevalent patients from 6 Dialysis Centers were randomly assigned to two six-months treatment sequences: A-B and B-A (A, Mixed HDF; B, Post-HDF). Primary outcome was comparative evaluation of ESA (darbepoetin alfa) requirement and ESA resistance. Treatments efficiency, iron and vitamins status, inflammation and nutrition parameters were monitored.\n\n\nRESULTS\nIn sequence A, darbepoetin requirement decreased during Mixed HDF from 29.5 to 23.7 µg/month and increased significantly during Post-HDF (32.3 µg/month at 6th month) while, in sequence B, it increased during Post-HDF from 38.2 to 43.7 µg/month and decreased during Mixed HDF (23.9 µg/month at 6th month). Overall, EPO doses at 6 months on Mixed and Post-HDF were 23.8 and 38.4 µg/month, respectively, P < 0.01. A multiple linear model confirmed that Mixed HDF vs Post-HDF reduced significantly ESA requirement and ESA resistance (P < 0.0001), by a mean of 29% (CI 23-35%) in the last three months of the observation periods.\n\n\nCONCLUSIONS\nMixed HDF decreased darbepoetin-alfa requirement in dialysis patients. This might help preventing the untoward side effects of high ESA doses, besides having a remarkable economic impact. Additional evidence is needed to confirm this potential benefit of Mixed-HDF.",
"affiliations": "Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy. Luciano.pedrini@fmc-ag.com.;Department of Brain and Behavioural Sciences, University of Pavia, Pavia, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Nephrology and Dialysis Unit, NephroCare, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Biochemistry Unit, ASST Bergamo-Est, Bolognini Hospital, Seriate, Italy.;Medical Coordination NephroCare, Naples, Italy.;Fresenius Medical Care, Clinical and Therapeutical Governance, Bad Homburg, Germany.",
"authors": "Pedrini|Luciano A|LA|;Comelli|Mario|M|;Ruggiero|Pio|P|;Feliciani|Annalisa|A|;Manfrini|Vania|V|;Cozzi|Giorgio|G|;Castellano|Angelo|A|;Pezzotta|Mauro|M|;Gatti|Guido|G|;Arazzi|Marta|M|;Auriemma|Laura|L|;di Benedetto|Attilio|A|;Stuard|Stefano|S|",
"chemical_list": "D006397:Hematinics; D006454:Hemoglobins",
"country": "Italy",
"delete": false,
"doi": "10.1007/s40620-020-00709-0",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1121-8428",
"issue": "33(5)",
"journal": "Journal of nephrology",
"keywords": "Anemia; ESA resistance; Erythropoietin; Hemodiafiltration; Mixed hemodiafiltration",
"medline_ta": "J Nephrol",
"mesh_terms": "D006397:Hematinics; D017583:Hemodiafiltration; D006454:Hemoglobins; D006801:Humans; D011446:Prospective Studies; D006435:Renal Dialysis",
"nlm_unique_id": "9012268",
"other_id": null,
"pages": "1037-1048",
"pmc": null,
"pmid": "32036610",
"pubdate": "2020-10",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": "30794672;11798154;28222499;45288",
"title": "Mixed hemodiafiltration reduces erythropoiesis stimulating agents requirement in dialysis patients: a prospective randomized study.",
"title_normalized": "mixed hemodiafiltration reduces erythropoiesis stimulating agents requirement in dialysis patients a prospective randomized study"
} | [
{
"companynumb": "IT-AMGEN-ITASP2020030885",
"fulfillexpeditecriteria": "2",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DARBEPOETIN ALFA"
},
"drugadditional": null,
... |
{
"abstract": "We describe a case of a 54-year-old man with a 2-month history of biliary colic associated with a common bile duct stone. He underwent laparoscopic cholecystectomy and developed postoperative acute kidney injury stage 3. A renal biopsy was performed and demonstrated myoglobin in the renal tubules. Retrospective creatine kinase analysis was suggestive of rhabdomyolysis. It is thought this was precipitated by simvastatin accumulation in the context of a period of hepatic impairment and elevated liver enzymes.",
"affiliations": "Renal Unit, Royal Derby Hospital, Derby, UK.;Renal Unit, Royal Derby Hospital, Derby, UK.;Department of Histopathology, Nottingham University Hospitals NHS Trust, Nottingham, UK.",
"authors": "Kolhe|Nitin|N|;Lewis|Jeremy|J|;McCulloch|Thomas Alasdair|TA|",
"chemical_list": "D000924:Anticholesteremic Agents; D019821:Simvastatin; D003404:Creatinine; D000469:Alkaline Phosphatase",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2014()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D058186:Acute Kidney Injury; D000469:Alkaline Phosphatase; D000924:Anticholesteremic Agents; D017081:Cholecystectomy, Laparoscopic; D003404:Creatinine; D003937:Diagnosis, Differential; D005500:Follow-Up Studies; D042882:Gallstones; D006801:Humans; D008297:Male; D008875:Middle Aged; D012206:Rhabdomyolysis; D012307:Risk Factors; D019821:Simvastatin",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "25213784",
"pubdate": "2014-09-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "10906171;11277825;21317651;16581337;15007110;16803418;16651050",
"title": "Risk of statin-induced rhabdomyolysis in patients with hepatic impairment.",
"title_normalized": "risk of statin induced rhabdomyolysis in patients with hepatic impairment"
} | [
{
"companynumb": "GB-LUPIN PHARMACEUTICALS INC.-2014-01745",
"fulfillexpeditecriteria": "2",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SIMVASTATIN"
},
"drugadditiona... |
{
"abstract": "Drug-induced diffuse alveolar hemorrhage (DAH) has been associated with the administration of various medications, among which levonorgestrel (LN) has not been reported until now.\nThis case study describes a 42-year-old woman who presented with hemoptysis, hypoxemia, and radiological depiction of ground glass opacities, 3 days after she had received emergency contraceptive medication containing levonorgestrel. Emergent bronchoscopy was performed, and BAL was diagnostic of diffuse alveolar hemorrhage (DAH). A thorough diagnostic approach was followed, in order to detect the underlying pathological condition that induced DAH. The absence of other identifiable pathological conditions in this patient raised suspicion of LN's potential causative role.\nDAH has not been reported as an adverse effect of LN until now. However, LN has been found to exert immunomodulatory effects and to present potential for manifestations of vasculitis as well as severe hypersensitivity reactions. These mechanisms may have been implicated in the development of DAH in our patient, who presented no other pathological conditions.",
"affiliations": "Pulmonary Department of NHS, General Hospital \"George Papanikolaou,\" Thessaloniki, Greece.;Pulmonary Department of NHS, General Hospital \"George Papanikolaou,\" Thessaloniki, Greece.;Pulmonary Department of NHS, General Hospital \"George Papanikolaou,\" Thessaloniki, Greece.;Primary Health Center, N. Madytos, Greece.;Primary Health Center, N. Madytos, Greece.;Primary Health Center, N. Madytos, Greece.;Pulmonary Department of NHS, General Hospital \"George Papanikolaou,\" Thessaloniki, Greece.",
"authors": "Georgopoulou|Athina|A|;Papadopoulou|Efthymia|E|;Moyseos|Marianna|M|;Zagalioti|Sofia-Chrysovalantou|SC|https://orcid.org/0000-0002-6371-1251;Hatzis|Christos|C|;Karanasios|Dimitrios|D|;Tryfon|Stavros|S|https://orcid.org/0000-0001-5102-0480",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/11795476211005821",
"fulltext": "\n==== Front\nClin Med Insights Case Rep\nClin Med Insights Case Rep\nICR\nspicr\nClinical Medicine Insights. Case Reports\n1179-5476\nSAGE Publications Sage UK: London, England\n\n10.1177/11795476211005821\n10.1177_11795476211005821\nCase Report\nDiffuse Alveolar Hemorrhage after Receiving Oral Levonorgerstrel for Emergency Contraception: A Case Report\nGeorgopoulou Athina 1\nPapadopoulou Efthymia 1\nMoyseos Marianna 1\nhttps://orcid.org/0000-0002-6371-1251\nZagalioti Sofia-Chrysovalantou 2\nHatzis Christos 2\nKaranasios Dimitrios 2\nhttps://orcid.org/0000-0001-5102-0480\nTryfon Stavros 1\n1 Pulmonary Department of NHS, General Hospital “George Papanikolaou,” Thessaloniki, Greece\n2 Primary Health Center, N. Madytos, Greece\nStavros Tryfon, Pulmonary Department of NHS, General Hospital “George Papanikolaou,” Thessaloniki, Greece. Email: stavrostryfon@yahoo.gr\n27 3 2021\n2021\n14 1179547621100582119 11 2020\n9 3 2021\n© The Author(s) 2021\n2021\nSAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons Licenses\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nIntroduction:\n\nDrug-induced diffuse alveolar hemorrhage (DAH) has been associated with the administration of various medications, among which levonorgestrel (LN) has not been reported until now.\n\nCase Presentation:\n\nThis case study describes a 42-year-old woman who presented with hemoptysis, hypoxemia, and radiological depiction of ground glass opacities, 3 days after she had received emergency contraceptive medication containing levonorgestrel. Emergent bronchoscopy was performed, and BAL was diagnostic of diffuse alveolar hemorrhage (DAH). A thorough diagnostic approach was followed, in order to detect the underlying pathological condition that induced DAH. The absence of other identifiable pathological conditions in this patient raised suspicion of LN’s potential causative role.\n\nConclusion:\n\nDAH has not been reported as an adverse effect of LN until now. However, LN has been found to exert immunomodulatory effects and to present potential for manifestations of vasculitis as well as severe hypersensitivity reactions. These mechanisms may have been implicated in the development of DAH in our patient, who presented no other pathological conditions.\n\nDiffuse alveolar hemorrhage (DAH)\nlevonorgestrel\nprogesterone derivative\nemergency contraception\nprogestogen\ncover-dateJanuary-December 2021\ntypesetterts1\n==== Body\nIntroduction\n\nThis case study describes a 42-year-old woman who presented with hemoptysis, hypoxemia, and radiological depiction of ground glass opacities, 3 days after she had received emergency contraceptive medication containing levonorgestrel (LN). Emergent bronchoscopy was performed, and BAL was diagnostic of diffuse alveolar hemorrhage (DAH). The development of DAH has not been reported among LN’s side effects until now. Nevertheless, the absence of other identifiable pathological conditions in this patient, along with LN’s potential for severe adverse reactions, raised strong suspicion of a causative association.\n\nCase Presentation\n\nA 42-year-old female presented to the Emergency Department with episodes of hemoptysis amounting to approximately 50 ml of bright-red blood, which occurred along with coughing a few hours ago. The patient was an otherwise healthy woman with no previous episodes of hemoptysis, no history of smoking, and no remarkable family history. Upon further questioning, she disclosed having received, first time in her life, oral emergency contraceptive medication, containing levonorgestrel (1.5 mg), 3 days prior to the episodes of hemoptysis, with the intention of preventing unwanted pregnancy. The patient denied having received contraceptive medication, levonorgestrel, or progestogens in the past. On physical examination she was found to be hemodynamically stable and afebrile. No apparent bleeding diathesis was detected. She had mild hypoxemia with SpO2 at 93% on room air, but neither respiratory failure nor remarkable abnormal breath sounds were noted. Ear, nose and throat (ENT) examination excluded pathological lesions and active bleeding from the upper respiratory tract.\n\nChest X-ray (Figure 1) depicted no pathological findings, whereas laboratory tests (Table 1) revealed neutrophilic leukocytosis [WBC = 13.4 K/μL (normal range: 3.8-10.5 K/μL) – neutrophils = 79.6% (normal range 45%-75%)]. Erythrocytes, platelets, and coagulation study showed no deviation from normal values. Furthermore, mild anemia with decrease in Ht was documented. Urine analysis presented normal results with no detectable hemoglobinuria. Computed Tomography (CT) scan of the thorax (Figure 2) revealed multiple bilateral ground glass opacities compatible with alveolar hemorrhage. An incidental finding of an aneurysm, with a maximum diameter of 4cm, was also depicted in the ascending aorta, without clinical denotation.\n\nFigure 1. Chest X-ray depicted no pathological findings–despite the patient’s symptoms of cough and hemoptysis.\n\nTable 1. Blood laboratory findings revealed leukocytosis and mild anemia.\n\n\tOn admission\tOn discharge, 7 d later\tNormal values\t\nWBC (/μL)\t13,400\t11,520\t3800-10,500/μL\t\nNeutrophils (/μL)\t79.6% 10,700\t87% 10,000\t45-75% 1600-6500/μL\t\nLymphocytes (/μL)\t18.9% 2500\t7.2% 830\t20-51% 1500-3600/μL\t\nRBC (Μ/μL)\t4.37\t3.78\t3.80-5.30 Μ/μL\t\nHb (g/dL)\t12.7\t11.8\t12-16 g/dL\t\nHt\t35.9%\t35%\t37-47%\t\nMCV (fL)\t92.6\t89.9\t80-99 fL\t\nMCH (pg)\t31.2\t31.4\t27-32 pg\t\nMCHC (g/dL)\t33.7\t34.9\t32-35 g/dL\t\nFe-serum (μg/dL)\t\t33\t13-150 μg/dL\t\nFerritin (ng/mL)\t\t83\t37-145 ng/mL\t\nPLT (/μL)\t259,000\t248,000\t150,000-450,000/μL\t\nPT (s)\t12.6\t11.1\t10-14 s\t\nPTT (s)\t20\t26\t25-35 s\t\nINR (s)\t1.08\t1.03\t0.8-1.1 s\t\nAbbreviations: Hb: hemoglobin; Hct: hematocrit; INR: international normalized ratio; MCH: mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration; MCV: mean corpuscular volume; PLT: platelets; PT: prothrombin time; PTT: partial thromboplastin time; RBC: red blood cells; WBC: white blood cells.\n\nFigure 2. CT scan of the thorax revealed multiple confluent ground glass and botryoid nodules throughout the right lung, but also to a lesser extent in the left lung. There is a thickening of the wall of the central bronchi of the right lower lobe as well. Based on the reported history, the imaging findings are primarily in favor of diffuse alveolar haemorrhage. An incidental finding of an aneurysm, maximum diameter 4 cm, was also depicted in the ascending aorta, without clinical denotation.\n\nThe patient underwent emergent bronchoscopy, that showed extensive hemorrhagic areas in the submucosa throughout the bronchial tree and endobronchial serpentines of clots at the right middle as well as lower lobe. Bronchoalveolar lavage (BAL) was highly indicative of alveolar hemorrhage, as it presented the characteristic progressively more hemorrhagic fluid in sequential aliquots from B8 secondary lobar bronchus. Blood and BAL samples were collected for immunological, cytological as well as microbiological analysis. BAL culture presented no pathological findings, whereas cytological examination (Table 2) revealed numerous red blood cells, many alveolar hemosiderin-laden macrophages, several inflammatory cells, and few bronchial epithelial cells, without elements of malignancy. The BAL findings confirmed diffuse alveolar hemorrhage (DAH) in our patient. Possible differential diagnosis of DAH included antineutrophilic cytoplasmic antibody associated vasculitis, systemic lupus erythematosus, Goodpasture syndrome, collagen vascular diseases, inhaled toxic gasses, celiac disease, and cytotoxic drug therapy. Serologic biochemical and immunological findings were normal (Table 3), thus excluding all the above-mentioned disorders. As the principal “risk therapy” for alveolar hemorrhage, pulses of methylprednisolone 500 mg per day were administered for 3 days. The patient was also put under antibiotic therapy with ampicillin-sulbactam. During hospitalization period, she received tranexamic acid as a means to ensure the abatement of hemoptysis. Her clinical condition remained stable and no further episodes of hemoptysis occurred. On the 4th hospitalization day, corticosteroid therapy was tapered to 32 mg of oral methylprednisolone and 7 days later the patient was discharged from the hospital as shown in timeline (Figure 3). At follow-up, one month later, while methylprednisolone had been tapered to 8 mg per second day, the patient was in good physical condition with normal oxygen saturation. Her chest X-ray revealed no pathological entities and both blood laboratory findings and pulmonary function tests were within normal values. High resolution chest tomography (HRCT) was performed (Figure 4), which revealed resolution of the ground glass opacities that had been depicted 1 month ago. The dimensions of the ascending aorta were measured the same. Urine analysis at follow-up was normal, without signs of hemoglobinuria, or proteinuria.\n\nTable 2. BAL cytological analysis revealed a neutrophilic predominance.\n\nBAL cell type\t\tNormal values\t\nHemosiderin-laden macrophages\t32%\t0\t\nLymphocytes\t12%\t5-15%\t\nNeutrophils\t56%\t1-4%\t\nOther/eosinophils\t\t<1%\t\nAbbreviations: BAL: bronchoalveolar lavage; DAH: diffuse alveolar hemorrhage.\n\nHemosiderin-laden macrophages were pathognomonic of DAH.\n\nTable 3. Serum immunological findings were normal, both on admission and at follow-up 1 mo later.\n\n\tOn admission\tAt follow-up (1 mo later)\tNormal values\t\nANA\tNegative\tNegative\tNegative\t\nAnti-ds DNA\tNegative\tNegative\tNegative\t\nAnti-SS-A(Ro)\t4.29 U/mL\tNegative\t<12 U/mL\t\nAnti-SS-B(La)\t1.14 U/mL\tNegative\t<12 U/mL\t\nAnti-Sm\t1.79 U/mL\tN/A\t<12 U/mL\t\nAnti-RNP\t0.98 U/mL\tN/A\t<12 U/mL\t\nAnti-Jo-1\t1.05 U/mL\tN/A\t<12 U/mL\t\nAnti-Scl 70\t6.81 U/mL\tN/A\t<12 U/mL\t\nAMA\tNegative\tN/A\tNegative\t\nASMA\tNegative\tN/A\tNegative\t\nP-ANCA (MPO) IgG\t4.19 AU/mL\tNegative\t<20 AU/mL\t\nC-ANCA (PR-3) IgG\t0.90 AU/mL\tNegative\t<20 AU/mL\t\nAnti-GBM\t\t2.2 U/mL\t<20 U/mL\t\nRF\t<20.0 IU/mL\t10.8\t<20 IU/mL\t\nCRP\t0.16 mg/dL\t<0.3\t<0.8 mg/dL\t\nC3-complex\t83 mg/dL\tN/A\t79-152 mg/dL\t\nC4-complex\t17 mg/dL\tN/A\t16-38 mg/dL\t\nANA: antinuclear antibodies; Anti-ds DNA: anti-double stranded DNA antibodies; Anti-GBM: anti–glomerular basement membrane antibodies; Anti-SS-A(Ro): anti–Sjögren’s-syndrome type A autoantibodies; Anti-SS-B(La): Anti-Sjögren’s syndrome type B (Lupus La protein) antibodies; Anti-Sm: Anti-Smith antibodies; Anti-RNP: anti-ribonucleoprotein antibodies; Anti-Jo-1: anti-nuclear antibody Anti-Jo1; Anti-Scl 70: anti-scleroderma 70 kD fragment antibodies; AMA: anti-mitochondrial antibodies; ASMA: anti-smooth muscle antibodies; C-ANCA (PR-3): cytoplasmic anti-neutrophil cytoplasmic antibodies (proteinase 3); CRP: C-reactive protein; C3: complement component 3; C4: complement component 4; N/A: non applicable; P-ANCA (MPO): perinuclear anti-neutrophil cytoplasmic antibodies (myeloperoxidase); RF: rheumatoid factor.\n\nFigure 3. CT scan of the thorax 1 month later revealed resolution of the ground glass opacities that had been depicted 1 month ago. The dimensions of the ascending aorta were measured the same.\n\nFigure 4. Symptoms and signs, diagnostic approach, therapeutic intervention, and follow-up shown in timeline schedule.\n\nDiscussion\n\nWe present a case of mild hemoptysis, hypoxemia, and radiological depiction of bilateral ground glass opacities in a female patient who had received oral emergency contraceptive medication containing levonorgestrel 3 days prior to the episode of hemoptysis. Emergent bronchoalveolar lavage (BAL) was diagnostic of diffuse alveolar hemorrhage (DAH) and intravenous corticosteroid therapy was administered, followed by improvement in the patient’s clinical condition and radiological findings. Interestingly, our patient presented no other causative factors for hemoptysis, but had received levonorgestrel (LN), thereby raising suspicion of a potential adverse reaction leading to the development of DAH.\n\nDAH, which was first described by Osler in 1904, 1 constitutes a life-threatening medical emergency resulting from the disruption of the pulmonary microcirculation which leads to blood accumulation within the alveoli. 2 In patients presenting with dyspnea, hemoptysis, cough, and anemia, along with radiological depiction of diffuse alveolar infiltrates, DAH should be taken into consideration and prompt diagnostic as well as therapeutical approach should be followed, in order to ensure a favorable outcome. 3 Bronchoscopy with BAL confirms the diagnosis, as BAL becomes progressively more hemorrhagic in sequential aliquots, a finding indicative of the alveolar origin of blood. BAL cytology examination with numerous red blood cells, as well as hemosiderin-laden macrophages, amounting to >20% of all cells, is pathognomonic of DAH. 4 However, this type of cells is usually detectable 48 hours after hemorrhage. 5 Among the underlying pathological conditions for the development of DAH, numerous medications have been incriminated. Drug-induced DAH involves various pathophysiologic processes leading to vasculitis, hypersensitivity reactions, direct toxicity with subsequent epithelial injury and damage to the alveolar capillary basement membrane. 6\n\nLevonorgestrel (LN), also known as 17α-ethynyl-18-methyl-19-nortestosterone or as 17α-ethynyl-18-methylestr-4-en-17β-ol-3-one, is an active progesterone derivative, which was first utilized as a combined oral contraceptive with ethinylestradiol in 1970, 7 and then assessed as a form of emergency contraception in 1973. 8 Since then, its medical utilization has expanded in the field of hormone replacement therapy as a combined oral tablet with estradiol valerate and as a combined transdermal patch with estradiol. 9 LN-releasing intrauterine devices, as well as subcutaneous implants, have also been introduced as contraceptive methods. 10 LN activates progesterone and androgen receptors, impeding the secretion of gonadotropin-releasing hormone from the hypothalamus, and thus inhibiting the luteinizing hormone surge that normally occurs at the pre-ovulation stage. 11 Regarding its distribution, 98% of the circulating molecules is bound to serum proteins, namely to albumin (33%) and to sex hormone binding globulin (SHBG-65%), whereas the remaining 1.5% exerts its effects in the form of free steroid. 12 LN is characterized by a mean half-life of approximately 26 hours. 12 After hydroxylation by liver enzymes, mainly by CYP3A4, and glucuronidation by liver glucuronidase enzymes, LN’s metabolites are excreted with urine and faeces.\n\nCommonly reported side effects of LN include fatigue, headache, dizziness, nausea, irritability, decrease in libido, fluid accumulation, acne, menstrual disorders, abnormal uterine bleeding, hirsutism, hair loss, as well as breast tenderness.13,14 Bleeding as an adverse reaction of LN has been reported only for the gynecological system until now at a percentage of 31%. 15 Even more severe adverse effects, as well as susceptibility to the development of serious diseases, have also been documented, albeit rarely. According to Conz et al., 16 a higher risk of breast cancer has been associated with utilization of levonorgestrel as a contraceptive intrauterine device. The pivot of the acute adverse reactions has been associated with LN’s initially highly elevated plasma concentration, which may amount to significantly higher levels than the therapeutic range of the drug (4-6 ng/mL), thereby presenting potential for even fatal complications. 12 To date, based on the reports of the international databases (PubMed, VigiBase, Pneumotox, EudraVigilance), no cases of DAH associated with LN have been observed. Nevertheless, according to the Adverse Drug Reaction Probability Scale, this case highlights a probable causal association between LN and DAH, with a total score amounting to 6. 17 LN’s potentiality to induce immunomodulatory effects, vasculitis, susceptibility to infections, as well as hypersensitivity reactions, has been amply documented and may reflect possible pathophysiologic explanations for the development of DAH in our patient, who presented no other etiologic factors.\n\nLN’s immunomodulatory effects\n\nThrough the extensive distribution of their receptors, sex steroids exert various potent effects on the body, among which modulation of the immune system has been thoroughly studied.18,19 Progestins’ immunomodulatory impact has been proven to directly affect T cells and T cell subsets. 20 Furthermore, contraceptives’ effects on the immune system are also exerted through the suppression of pituitary gonadotropins, that have been implicated in additional immunomodulatory effects. 21 In particular, the gonadotropin releasing hormone (GnRH) and its receptor are found in immune cell subsets and GnRH has been implicated in programing the immune system. 22 Thus, administration of either combined estrogen-progestin contraceptives or progestin-only contraceptives presents immunomodulatory effects and may influence susceptibility to autoimmune diseases. 20\n\nIndeed, an elevated risk for manifestations of rheumatism, arhropathies, rheumatoid arthritis, eczema, contact dermatitis, urticaria, and pruritis has been found to be associated with utilization of progesterone-only contraceptives. 23 Accordingly, the prescribing information for LN implants has included, albeit indirectly, potentiality for autoimmune diseases such as scleroderma, lupus erythematosus disseminatus, and rheumatoid arthritis. 24 Another T-cell autoimmune entity, namely lichenoid drug eruption, in which inflammatory cells attack a protein of keratinocytes, has been shown to relate not only to oral contraceptives,25,26 but also to LN-releasing intrauterine devices. 27 Moreover, progesterone-only contraceptives may trigger or aggravate the emergence of autoimmune progesterone dermatitis. Even the risk of developing multiple sclerosis has been postulated to increase with utilization of combined hormonal contraceptives. 28 Our patient presented neither clinical symptoms nor serum immunological markers indicative of an autoimmune reaction or disorder.\n\nLN-induced hypersensitivity reactions\n\nSevere hypersensitivity reactions to LN have been abundantly reported. Cases29,30 of a rare syndrome called “progestogen hypersensitivity,” which may be induced either by endogenous progesterone during the luteal phase of the menstrual cycle and during pregnancy, or by exogenous progestogens, have been found to be associated with LN administration. Symptoms are heterogeneous and include manifestations of cyclic dermatitis, urticaria, angioedema, asthma, multiple organ involvement, and anaphylaxis.31-35 The underlying pathophysiologic mechanism pivots on type I or type IV hypersensitivity reaction mediated by lymphocytes Th2. 36 Positive results in a skin prick and intradermal skin testing to progesterone may be found in such cases. 31 Immediate treatment with administration of corticosteroids and antihistaminics is initiated in such cases. 37\n\nAtypical neutrophilic reactions resembling Sweet’s syndrome in patients who are otherwise well and receive the oral contraceptive, have also been reported. 38\n\nAgain, our patient was devoid of clinical symptoms as well as immunological markers suggestive of an underlying allergic or hypersensitivity reaction.\n\nLN-induced vasculitis\n\nAllergic vasculitis with manifestations of severe renal complications, fixed pigmented erythema, urticaria, and lichenoid eruptions, has been observed in several cases. 24 Associations between markers of allergy (eosinophils, IgE, atopy) and hormonal-dependent conditions in women (premenstrual asthma, menopause, and oral contraceptive use) have been noted. 39 Combined steroid contraceptives have been found to impede antibody formation, to cause a decrease in complement levels, and to exert an immunosuppressive effect on lymphocyte activation by nonspecific mitogens “in vitro.” In vivo, the immunosuppressive effect on lymphocytes has also been observed. 40 We noted no evidence of a specific type of vasculitis in our patient.\n\nHypersensitivity reactions with allergic angiitis as an ultimate manifestation, as well as forms of vasculitis resembling Wegener’s granulomatosis, polyarteritis nodosa, or Churg-Strauss syndrome have been reported. A reaction of cell-mediated immunity has been proposed as the underlying mechanism. 38 Patients may develop only cutaneous involvement or life-threatening systemic involvement, with severe and even fatal deterioration. Oral contraceptives have been postulated to induce principally mild vasculitis; however, a rare case of vasculitis manifesting with cutaneous necrosis in a woman who received oral contraceptive containing levonorgestrel 0.15 μg and ethinylestradiol 0.03 mg has been observed. 41 As this entity presents a variable clinical picture and a multitarget pathological involvement, it seems as the most apposite pathophysiologic mechanism explaining the development of DAH syndrome in our patient.\n\nConclusion\n\nA substantial risk for the development of autoimmune disorders, as well as severe hypersensitivity reactions, has been associated with the utilization of levonorgestrel (LN). Taking into consideration the fact that LN is a commonly used progestin worldwide given its use in oral, implantable, and intrauterine contraceptives without previous reports of diffuse alveolar hemorrhage as a complication, this would be the first report documenting the rarity of this occurrence with a probable cause-effect relationship.\n\nFunding: The author(s) received no financial support for the research, authorship, and/or publication of this article.\n\nDeclaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nORCID iDs: Sofia-Chrysovalantou Zagalioti https://orcid.org/0000-0002-6371-1251\n\nStavros Tryfon https://orcid.org/0000-0001-5102-0480\n==== Refs\nReferences\n\n1 Zamora MR Warner ML Tuder R Schwarz MI . Diffuse alveolar hemorrhage, and systemic lupus erythematosus. Clinical presentation, histology, survival, and outcome. Medicine (Baltimore). 1997;76 :192-202.9193454\n2 Lara AR Schwarz MI . Diffuse alveolar hemorrhage. Chest. 2010;137 :1164-1171.20442117\n3 Specks U . Diffuse alveolar hemorrhage syndromes. Curr Opin Rheumatol. 2001;13 :12-17.11148710\n4 Alexandre AT Vale A Gomes T . Diffuse alveolar hemorrhage: how relevant is etiology? Sarcoidosis Vasc Diffuse Lung Dis. 2019;36 :47-52.32476936\n5 Pérez-Arellano JL Losa García JE García Macías MC Gómez Gómez F Jiménez López A de Castro S . Hemosiderin-laden macrophages in bronchoalveolar lavage fluid. Acta Cytol. 1992;36 :26-30.1546509\n6 Schwarz MI Fontenot AP . Drug-induced diffuse alveolar hemorrhage syndromes and vasculitis. Clin Chest Med. 2004;25 :133-140.15062605\n7 Roth K . Chemische Leckerbissen. Weinheim Wiley-VCH; 2014 :77.\n8 Kesserü E Larrañaga A Parada J . Postcoital contraception with D-norgestrel. Contraception. 1973;7 :367-379.\n9 Kubíková D . Menopausal symptoms and hormone replacement therapy. Praktické Lékárenství. 2014;10 :68-73.\n10 Friend DR . Development of controlled release systems over the past 50years in the area of contraception. J Control Release. 2016;240 :235-241.26732558\n11 Kahlenborn C Peck R Severs WB . Mechanism of action of levonorgestrel emergency contraception. Linacre Q. 2015;82 :18-33.25698840\n12 Shahiwala A Misra A . Pulmonary absorption of liposomal levonorgestrel. AAPS Pharm Sci Tech. 2004;5 :E13.\n13 Jatlaoui TC Riley H Curtis KM . Safety data for levonorgestrel, ulipristal acetate and Yuzpe regimens for emergency contraception. Contraception. 2016;93 :93-112.26546020\n14 Brache V Faundes A Alvarex F Cochon L . No menstrual adverse events during use of implantable contraceptives for women: data from clinical trials. Contraception. 2002;65 :63-74.11861056\n15 Leelakanok N Methaneethorn J . A systematic review and meta-analysis of the adverse effects of levonorgestrel emergency oral contraceptive. Clin Drug Investig. 2020;40 :395-420.\n16 Conz L Mota BS Bahamondes L , et al . Levonorgestrel-releasing intrauterine system and breast cancer risk: a systematic review and meta-analysis. Acta Obstet Gynecol Scand. 2020;99 :970-982.31990981\n17 Naranjo CA Busto U Sellers EM Sandor P , et al . A method for estimating the probability of adverse drug reactions. Clin Pharmacol Ther. 1981;30 :239-245.7249508\n18 Schuurs AH Verheul HA . Effects of gender and sex steroids on immune response. J Steroid Biochem Mol Biol. 1990;35 :157-172.\n19 Mann D Ansari AA Akinbami MA Wallen K Gould KG McClure HM . Neonatal treatment with lutenizing hormone-releasing hormone analogs alters peripheral lymphocyte subsets and cellular and humorally mediated immune responses in juvenile and adult male monkeys. J Clin Endocrinol Metab. 1994; 78 : 292-298.8106614\n20 Tan IJ Peeva E Zandman-Goddard G . Hormonal modulation of the immune system-a spotlight on the role of progestogens. Autoimmun Rev. 2015;14 :536-542.25697984\n21 Athreya BH Rettig P Williams WV . Hypophyseal-pituitary-adrenal axis in autoimmune and rheumatic diseases. Immunol Res. 1998;18 :93-102.9844828\n22 Tanriverdi F Silveira LF MacColl GS Bouloux PM . The hypothalamic-pituitary-gonadal axis: immune function and autoimmunity. J Endocrinol. 2003;176 :293-304.12630914\n23 Farley TMM Sivin I ; International Collaborative Post-Marketing Surveillance of Norplant. Post-marketing surveillance of norplant contraceptive implants: II. Non-reproductive health. Contraception. 2001;63 :187-120.\n24 Cutolo M Straub RH . Sex steroids and autoimmune rheumatic diseases: state of the art. Nat Rev Rheumatol. 2020;16 :628-644.33009519\n25 Coskey RJ . Eruptions due to oral contraceptives. Arch Dermatol. 1977;113 :333-334.843100\n26 Thomas P Dalle E Revillon B Delecour M Devarenne-nicolle, Pagniez I . Cutaneous effects in hormonal contraception [in French]. NPN Med. 1985;5 :19-24.12281276\n27 Jones JA Shuler MJ Zlotoff BJ . Levonorgestrel-releasing intrauterine system causes a lichenoid drug eruption. Cutis. 2015;96 :E13-E15.\n28 Williams WV . Hormonal contraception and the development of autoimmunity: a review of the literature. Linacre Q. 2017;84 :275-295.28912620\n29 Chen X Wu X Zhu H . Acute urticaria as a side effect of the Mirena® (levonorgestrel-releasing intrauterine system): a case report. BMC Res Notes. 2014;7 :209.24708811\n30 Pereira A Coker A . Hypersensitivity to Mirena–a rare complication. J Obstet Gynaecol. 2003;23 :81.\n31 Foer D Buchkeit KM Gargiulo AR , et al . Progesteron hypersensitivity in 24 cases: diagnosis, management and proposed renaming and classification. J Allergy Clin Immunol Pract. 2016;4 :723-729.27090357\n32 Li RC Buchheit KM Bernstein JA . Progestogen hypersensitivity. Curr Allergy Asthma Rep. 2018;18 :1.29349660\n33 HartR. Autoimmune progesterone dermatitis. Arch Dermatol. 1977;113 :426-30.\n34 Maguire T . Autoimmune progesterone dermatitis. Dermatol Nurs. 2009;21 :190-192.19691230\n35 George R Badawy SZ . Autoimmune progesterone dermatitis: a case report. Case Rep Obstet Gynecol. 2012;2012 :757854.\n36 Cristaudo A Bordignon V Palamara F De Rocco M Pietravalle M Picardo M . Progesterone sensitive interferon-gamma producing cells detected by ELISpot assay in autoimmune progesterone dermatitis. Clin Exp Dermatol. 2007;32 :439-441.17362239\n37 Nguyen T Razzague A . Autoimmune progesterone dermatitis: update and insights. Autoimmun Rev. 2016;15 :191-197.26554933\n38 Tefany FJ Georgouras K . A neutrophilic reaction of Sweet’s syndrome type associated with the oral contraceptive. Australas J Dermatol. 1991;32 :55-59.1834046\n39 Siroux V Oryszczyn MP Varraso R , et al . Environmental factors for asthma severity and allergy results from the EGEA study. Rev Mal Respir. 2007;24 :599-608.17519811\n40 Sabatini R Cagiano R Rabe T . Adverse effects of hormonal contraception. J Reproduktionsmed Endokrinol. 2011;8 :130-156.\n41 Mosovich B Biton A Avinoach I . Vasculitis with cutaneous necrosis induced by oral contraceptive. Harefuah. 1991;120 :451-453.1885102\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1179-5476",
"issue": "14()",
"journal": "Clinical medicine insights. Case reports",
"keywords": "Diffuse alveolar hemorrhage (DAH); emergency contraception; levonorgestrel; progesterone derivative; progestogen",
"medline_ta": "Clin Med Insights Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101531893",
"other_id": null,
"pages": "11795476211005821",
"pmc": null,
"pmid": "34211306",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "11861056;33009519;26732558;24708811;192155;25697984;1885102;32162237;843100;12281276;28912620;9844828;19691230;27090357;15062605;7249508;11376647;11148710;8106614;22924142;29349660;15198534;26554933;9193454;12647710;1546509;32476936;12630914;26546020;17519811;25698840;1834046;17362239;31990981;26244359;2407902;20442117",
"title": "Diffuse Alveolar Hemorrhage after Receiving Oral Levonorgerstrel for Emergency Contraception: A Case Report.",
"title_normalized": "diffuse alveolar hemorrhage after receiving oral levonorgerstrel for emergency contraception a case report"
} | [
{
"companynumb": "GR-PERRIGO-21GR006727",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LEVONORGESTREL"
},
"drugadditional": "4",
... |
{
"abstract": "Serotonin syndrome is a rare but potentially fatal complication of drugs that have effects on central nervous system serotonin. It is characterized by sudden onset of altered mental status, increased neuromuscular activity and autonomic instability. The author reports a child with suprasellar region tumor who presented with depression and obsessive-compulsive disorder and received a combination of sertaline (selective serotonin reuptake inhibitor) and clomipramine (tricyclic antidepressant). Symptoms of serotonin syndrome occurred within 24 hours after increasing the dose of sertaline. The patient's symptoms resolved rapidly with discontinuation of the offending drugs and supportive care.",
"affiliations": "Department of Pediatrics, Faculty of Medicine, Chiang Mai University, Chiang Mai, Bangkok, Thailand. sisli@mahidol.ac.th",
"authors": "Likasitwattanakul|Surachai|S|",
"chemical_list": "D017367:Serotonin Uptake Inhibitors; D020280:Sertraline",
"country": "Thailand",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0125-2208",
"issue": "88(7)",
"journal": "Journal of the Medical Association of Thailand = Chotmaihet thangphaet",
"keywords": null,
"medline_ta": "J Med Assoc Thai",
"mesh_terms": "D002648:Child; D003866:Depressive Disorder; D006801:Humans; D008297:Male; D009771:Obsessive-Compulsive Disorder; D020230:Serotonin Syndrome; D017367:Serotonin Uptake Inhibitors; D020280:Sertraline",
"nlm_unique_id": "7507216",
"other_id": null,
"pages": "993-6",
"pmc": null,
"pmid": "16241032",
"pubdate": "2005-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Serotonin syndrome: a case report.",
"title_normalized": "serotonin syndrome a case report"
} | [
{
"companynumb": "PT-BAUSCH-BL-2018-007042",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VENLAFAXINE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "Objective: The outcomes of alternative donor hematopoietic stem cell transplantation (HSCT) with unmanipulated grafts for Inherited bone marrow failure syndromes (IBMFS) are discouraging. Our study is to demonstrate that IBMFS with disease-specific characteristics requires a tailored conditioning regimens to enhance engraftment and reduce regimen related toxicities. Methods: We retrospectively analyzed 42 patients diagnosed with IBMFS and transplanted with an alternative donor graft at our center from November 2012 to August 2018. Twenty-seven patients had Fanconi anemia (FA), 7 had dyskeratosis congenita (DC), and 8 had severe congenital neutropenia (SCN). Patients received ex-vivo unmanipulated alternative donor grafts from a matched unrelated donor (MUD) (n = 22), haploidentical donor (HID) (n = 17) and unrelated cord blood donor (UCBD) (n = 3). FA and DC patient subgroups received reduce intensified conditioning (RIC), while SCN patients received a myeloablative conditioning (MAC) regimen. Results: The median follow-up time for the surviving patients was 38 months (range: 9-63 months). The failure-free survival (FFS) for entire cohort was 76.1%, and was 72.4%, 100% and 56.2% for patients with FA, DC and SCN, respectively. There were no primary graft failures. The cumulative incidence of aGVHD at day 100 was 48.1%. The cumulative incidence of cGVHD at 1 and 3 years was 35.0% and 69.3%, respectively. Conclusion: HSCT using alternative donors with unmanipulated grafts and disease-specific conditioning regimens for IBMFS patients shows promising survival.",
"affiliations": "Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.;Department of Bone Marrow Transplantation, Hebei Yanda Lu Daopei Hospital, Langfang, People's Republic of China.",
"authors": "Lu|Yue|Y|https://orcid.org/0000-0001-6827-8146;Xiong|Min|M|;Sun|Rui-Juan|RJ|;Zhao|Yan-Li|YL|;Zhang|Jian-Ping|JP|;Cao|Xing-Yu|XY|;Liu|De-Yan|DY|;Wei|Zhi-Jie|ZJ|;Zhou|Jia-Rui|JR|;Lu|Dao-Pei|DP|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/16078454.2021.1876393",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1024-5332",
"issue": "26(1)",
"journal": "Hematology (Amsterdam, Netherlands)",
"keywords": "Alternative donor; disease-specific conditioning regimen; hematopoietic stem cell transplantation; inherited bone marrow failure syndrome; unmanipulated grafts",
"medline_ta": "Hematology",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D002648:Child; D002675:Child, Preschool; D000080984:Congenital Bone Marrow Failure Syndromes; D005260:Female; D005500:Follow-Up Studies; D006085:Graft Survival; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008297:Male; D016019:Survival Analysis; D019172:Transplantation Conditioning; D061349:Unrelated Donors; D055815:Young Adult",
"nlm_unique_id": "9708388",
"other_id": null,
"pages": "134-143",
"pmc": null,
"pmid": "33491597",
"pubdate": "2021-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Hematopoietic stem cell transplantation for inherited bone marrow failure syndromes: alternative donor and disease-specific conditioning regimen with unmanipulated grafts.",
"title_normalized": "hematopoietic stem cell transplantation for inherited bone marrow failure syndromes alternative donor and disease specific conditioning regimen with unmanipulated grafts"
} | [
{
"companynumb": "CN-OTSUKA-2021_005805",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BUSULFAN"
},
"drugadditional": null,
"d... |
{
"abstract": "A 56-year-old man receiving rituximab who had months of neurologic symptoms was found to have Jamestown Canyon virus in cerebrospinal fluid by clinical metagenomic sequencing. The patient died, and postmortem examination revealed extensive neuropathologic abnormalities. Deep sequencing enabled detailed characterization of viral genomes from the cerebrospinal fluid, cerebellum, and cerebral cortex.",
"affiliations": null,
"authors": "Solomon|Isaac H|IH|;Ganesh|Vijay S|VS|;Yu|Guixia|G|;Deng|Xian Ding|XD|;Wilson|Michael R|MR|;Miller|Steve|S|;Milligan|Tracey A|TA|;Mukerji|Shibani S|SS|;Mathewson|Abigail|A|;Linxweiler|Justin|J|;Morse|Darlene|D|;Ritter|Jana M|JM|;Staples|J Erin|JE|;Hughes|Holly|H|;Gould|Carolyn V|CV|;Sabeti|Pardis C|PC|;Chiu|Charles Y|CY|;Piantadosi|Anne|A|",
"chemical_list": "D000914:Antibodies, Viral; D000069283:Rituximab",
"country": "United States",
"delete": false,
"doi": "10.3201/eid2701.203448",
"fulltext": "\n==== Front\nEmerg Infect Dis\nEmerg Infect Dis\nEID\nEmerging Infectious Diseases\n1080-6040\n1080-6059\nCenters for Disease Control and Prevention\n\n33261720\n20-3448\n10.3201/eid2701.203448\nDispatch\nDispatch\nFatal Case of Chronic Jamestown Canyon Virus Encephalitis Diagnosed by Metagenomic Sequencing in a Patient Receiving Rituximab\nFatal Case of Chronic Jamestown Canyon Virus Encephalitis Diagnosed by Metagenomic Sequencing in Patient Receiving Rituximab\nChronic Jamestown Canyon Virus Encephalitis\nSolomon Isaac H. 1\nGanesh Vijay S. 1\nYu Guixia\nDeng Xian Ding\nWilson Michael R.\nMiller Steve\nMilligan Tracey A.\nMukerji Shibani S.\nMathewson Abigail\nLinxweiler Justin\nMorse Darlene\nRitter Jana M.\nStaples J. Erin\nHughes Holly\nGould Carolyn V.\nSabeti Pardis C. 2\nChiu Charles Y. 2\nPiantadosi Anne 23\nBrigham and Women’s Hospital, Boston, Massachusetts, USA (I.H. Solomon, V.S. Ganesh, T.A. Milligan);\nHarvard Medical School, Boston (I.H. Solomon, V.S. Ganesh, T.A. Milligan, S.S. Mukerji, A. Piantadosi);\nBroad Institute, Cambridge, Massachusetts, USA (V.S. Ganesh, P.C. Sabeti, A. Piantadosi);\nUniversity of California–San Francisco, San Francisco, California, USA (G. Yu, X.D. Deng, M.R. Wilson, S. Miller, C.Y. Chiu);\nMassachusetts General Hospital, Boston (S.S. Mukerji, A. Piantadosi);\nNew Hampshire Division of Public Health Services, Concord, New Hampshire, USA (A. Mathewson, J. Linxweiler, D. Morse);\nCenters for Disease Control and Prevention, Atlanta, Georgia, USA (J.M. Ritter);\nCenters for Disease Control and Prevention, Fort Collins, Colorado, USA (J.E. Staples, H. Hughes, C.V. Gould);\nHarvard University, Cambridge (P.C. Sabeti);\nHarvard T.H. Chan School of Public Health, Boston (P.C. Sabeti);\nHoward Hughes Medical Institute, Chevy Chase, Maryland, USA (P.C. Sabeti)\nAddress for correspondence: Isaac H. Solomon, Department of Pathology, Brigham and Women’s Hospital, 75 Francis St, Boston, MA 02115, USA; email: ihsolomon@bwh.harvard.edu\n1 2021\n27 1 238242\nA 56-year-old man receiving rituximab who had months of neurologic symptoms was found to have Jamestown Canyon virus in cerebrospinal fluid by clinical metagenomic sequencing. The patient died, and postmortem examination revealed extensive neuropathologic abnormalities. Deep sequencing enabled detailed characterization of viral genomes from the cerebrospinal fluid, cerebellum, and cerebral cortex.\n\nKeywords:\n\northobunyavirus\narbovirus\nJamestown Canyon virus\nencephalitis\nrituximab\nmetagenomic next-generation sequencing\nviruses\nvector-borne infections\nmonoclonal antibody\n==== Body\nJamestown Canyon orthobunyavirus (JCV) is a negative-sense RNA virus in the California serogroup. Its tripartite genome comprises small (nucleocapsid), medium (glycoprotein), and large (polymerase) segments. JCV is distributed throughout the United States and Canada and has been isolated from multiple mammals and mosquitoes (1,2). Most infections occur in adults, during the summer, and are asymptomatic, but manifestations can include fever and acute meningoencephalitis (2). Cerebrospinal fluid (CSF) typically shows a lymphocytic pleocytosis with elevated protein and normal glucose. Diagnosis is made by detection of JCV IgM in serum or CSF and confirmed by plaque-reduction neutralization testing to rule out cross-reactivity with other California serogroup viruses (3). Detection of viral RNA in human CSF has rarely been described, with viremia presumed to be of short duration, so reverse transcription PCR (RT-PCR) is not routinely used for diagnosis (3–5). No specific treatments are available, although intravenous ribavirin has been reported to improve seizures (6). Because of the limited number of cases described, the full range of findings associated with JCV infection is unknown. No fatal cases were reported to the Centers for Disease Control and Prevention (CDC) before 2017, and no autopsy reports have been published (7).\n\nThe Case-Patient\n\nA 56-year-old man from New England with a history of mantle cell lymphoma in remission, receiving maintenance rituximab since 2014, had fatigue, arthralgias, and weight loss in summer 2017. He was empirically treated for Lyme disease without improvement, had progressive insomnia and inattention, and was eventually admitted for workup of rapidly progressive dementia in April 2018. On examination, he had impaired arousal and attention (Montreal Cognitive Assessment score 6 of 30). Cranial nerve, tone, strength, sensory, and reflex examinations were normal. Gait was wide-based and slow without ataxia or parkinsonism. Magnetic resonance imaging of the brain showed mild ventriculomegaly attributed to atrophy but was otherwise unremarkable, without contrast enhancement, cortical diffusion restriction, mass lesions, hemorrhage, or infarction (Figure 1). Electroencephalography showed moderate bihemispheric slowing without epileptiform features. CSF from multiple lumbar punctures showed mild lymphocytic pleocytosis (0–22 leukocytes/μL, 83%–98% lymphocytes), elevated total protein (40–116 mg/dL; reference 10–44 mg/dL), and unremarkable glucose (65–78 mg/dL; reference 40–80 mg/dL) (Appendix Table 1). An extensive infectious, autoimmune, and neurodegenerative disease workup was normal (Appendix Table 2).\n\nFigure 1 Brain imaging and autopsy findings in a case of chronic Jamestown Canyon virus (JCV) meningoencephalitis in a patient receiving rituximab, Boston, Massachusetts, USA. A) Brain magnetic resonance imaging T2-weighted fluid-attenuated inversion recovery showed mild atrophy with secondary ventriculomegaly but was otherwise unremarkable. B) Brain positron emission tomography with 2-deoxy-2-[fluorine-18] fluoro-D-glucose integrated with computed tomography showed global hypometabolism. Color scale ranges from blue-green (hypometabolic) to orange-white (hypermetabolic). C, D) Hematoxylin and eosin stained section of cerebral cortex at low magnification shows loss of neurons and perivascular chronic inflammation (C), compared with a JCV-negative control with a normal complement of cortical neurons (D). E, F) Higher-power magnification of cerebral cortex (E) and hippocampus (F) show microgliosis, microglial nodules, and neuronophagia (arrow). G, H) Severe Purkinje cell loss, Bergmann gliois (arrows), and microgliosis (arrowheads) of the molecular layer are present in the cerebellum (G), compared with a JCV-negative control with normal complement of Purkinje cells (H). I, J) Immunohistochemistry shows abundant perivascular, parenchymal, and leptomeningeal CD3+ T cells (I) and is negative for B-cell lineage–specific activator protein positive B cells (J). Panels C, D, I, and J, original magnification ×100; panels E, F, G, and H, original magnification ×200.\n\nA CSF sample collected in April 2018 underwent clinical metagenomic next-generation sequencing (mNGS) testing at the University of California–San Francisco (8) and was positive for California encephalitis virus most closely matching JCV, with reads mapping to 2 of the 3 viral genome segments (Appendix Figure 1). Another CSF sample, obtained approximately 3 weeks later in May, was negative for JCV by RT-PCR performed by CDC’s Arboviral Diseases Branch (Division of Vector-Borne Diseases, National Center for Emerging and Zoonotic Infectious Diseases; Fort Collins, CO, USA); however, concurrent serum JCV RT-PCR was positive. Results of JCV IgM and neutralizing antibody testing were negative for CSF and blood from the samples obtained in May. Concurrent samples had 0% CD20+ circulating lymphocytes (reference 3%–20% lymphocytes), attributed to rituximab treatment, last administered in December 2017.\n\nThe patient was treated with intravenous immunoglobulin (total 2 g/kg), followed by a 2-week course of favipiravir, an experimental inhibitor of viral RNA polymerase, without improvement. His mental status deteriorated to a comatose state. He was transitioned to comfort care and died in June 2018, ≈1 year after suspected symptom onset.\n\nAt autopsy, the unfixed brain weighed 1,240 g and appeared grossly normal, with no masses, hemorrhage, infarctions, or herniation. Histologic abnormalities were most prominent in the cerebral cortex (particularly frontal and temporal lobes), cerebellum, and hippocampus; milder changes in basal ganglia, thalamus, and brainstem were observed, including severe loss of neurons, diffuse microgliosis with microglial nodules and neuronophagia, and perivascular and parenchymal chronic inflammation (Figure 1). Leptomeninges showed numerous chronic inflammatory cells. No viral inclusions were identified. There was no evidence of lymphoma. Immunohistochemical staining highlighted abundant perivascular, parenchymal, and leptomeningeal T cells with a complete lack of B cells. Formalin-fixed paraffin-embedded brain tissue was positive for JCV by RT-PCR (performed by CDC’s Arboviral Diagnostic and Reference Laboratory); results were negative for immunohistochemistry for flaviviruses and enteroviruses (performed by CDC’s Infectious Diseases Pathology Branch [Division of High-Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases; Atlanta, GA, USA]).\n\nComplete or near-complete JCV genomes were recovered from premortem CSF and postmortem cerebellum and cortex tissue (both frozen and formalin-fixed paraffin-embedded) (Table; Appendix Supplementary Methods, Figure 2). Phylogenetic analysis of the small (nucleocapsid) segment showed that sequences from this patient were most closely related to JCV from mosquitoes in Connecticut (Figure 2, panel A) (9). Comparison of JCV genomes between this patient’s CSF, cerebellum, and cortex revealed 27 high-confidence within-patient single-nucleotide polymorphisms (SNPs) (Figure 2, panel B; Appendix Tables 3, 4). For 13 SNPs, the variant present in CSF was different from that in cerebellum and cortex, suggesting evolution over time. For another 4 SNPs, the variant present in cerebellum was different from that in cortex, suggesting compartmentalization. The remaining 10 SNPs could represent either compartmentalization or evolution over time, because only 1 brain tissue (cerebellum or cortex) was sequenced to sufficient depth. Variability was greater in the small segment (nucleocapsid) and medium segment (glycoprotein) than the large segment (polymerase).\n\nTable Results of JCV sequencing across samples from an immunocompromised patient with encephalitis, Boston, Massachusetts, USA*\n\nSpecimen\tMethod\tTotal reads†\tUnique JCV reads‡\t% Genome assembled, by segment§\t\tMean depth, by genome segment§\t\nSmall\tMedium\tLarge\tSmall\tMedium\tLarge\t\nCSF\tmNGS, MSSPE\t1,917,836,676\t894\t100\t80\t90\t\t14.3\t3.7\t5.3\t\nCerebellum, frozen\tmNGS, MSSPE\t1,031,252,808\t558\t98\t66\t100\t\t9.4\t1.3\t6.1\t\nCerebellum, FFPE\tmNGS, hybrid capture\t38,974,996\t294\t70\t56\t90\t\t7.1\t1.2\t3.1\t\nCortex, frozen\tmNGS, MSSPE\t729,867,496\t3,652\t100\t100\t100\t\t61.6\t15.2\t40.2\t\nCortex, FFPE\tmNGS, hybrid capture\t101,331,284\t518\t100\t72\t91\t\t20.1\t2.1\t4.5\t\n*Methods detailed in Appendix. CSF, cerebrospinal fluid; FFPE, formalin-fixed, paraffin-embedded; JCV, Jamestown Canyon virus; mNGS, metagenomic next-generation sequencing; MSSPE, metagenomic sequencing with spiked primer enrichment.\n†Total reads reflect the number of raw reads that were generated from each sample.\n‡Unique JCV reads reflects removal of PCR duplicates and mapping to JCV reference sequences.\n§Small, 989 nt; Medium, 4,509 nt; Large, 6,960 nt.\n\nFigure 2 JCV genome analyses in a case of chronic JCV meningoencephalitis in a patient on rituximab, Boston, Massachusetts, USA. A) Maximum-likelihood phylogenetic tree of the coding region of the JCV small segment (nucleocapsid). Sequences from the patient (bold) were most closely related to a JCV strain isolated from Simsbury, Connecticut, USA (GenBank accession no. EF681842), with ≈70% bootstrap support. Clades A, B1, and B2 are as previously reported (9). B) Single-nucleotide polymorphisms (SNPs) observed between samples from patient in this study. The consensus genome derived from each sample was aligned to a mosquito-derived JCV sequence (GenBank accession nos. HM007356 [S segment], HM007357 [M segment], and HM007358 [L segment], all represented in the figure as HM00735X). For each sample in this study, the light gray bar indicates positions for which there was coverage of >3 reads. Using the sequence derived from CSF as the reference, positions with a SNP are marked with a star; black indicates a synonymous change, and red indicates a nonsynonymous change. Only high-confidence (confirmed) SNPs are shown in this figure; all SNPs observed are shown in Appendix Tables 3, 4. Sequence data is available under National Center for Biotechnology Information BioProject no. PRJNA662969 (GenBank accession nos. MW072986–MW073000). CSF, cerebrospinal fluid; FFPE, formalin-fixed, paraffin-embedded; JCV, Jamestown Canyon virus; L, large; M, medium; S, small.\n\nConclusions\n\nWe describe an unusual fatal case of chronic JCV encephalitis in a patient who was being treated with rituximab. In contrast to this case, previously described patients with JCV have had acute illness, and JCV infection is rarely fatal (7,10). The neuropathologic findings in this patient, although nonspecific, are similar to those of a cerebellar biopsy from a patient with JCV encephalitis that showed severe loss of Purkinje and granule cells, diffuse microgliosis of the molecular layer, and leptomeningeal inflammation (5).\n\nThe lack of distinguishing clinical, radiographic, and pathologic features of JCV underscores the diagnostic utility of clinical mNGS (8). Attributable in part to low incidence and lack of commercially available targeted testing, JCV is often not considered a priori, especially in the setting of chronic progressive neurologic illness. As a further complication, standard clinical testing by serology can be negative in the setting of B-cell–depleting therapy; our patient had negative JCV serologic tests and lack of B lymphocytes by immunohistochemical staining. Similar phenomena have been reported in rituximab-treated patients with other arboviral infections (e.g., Cache Valley orthobunyavirus, Powassan virus, and West Nile virus) who lack detectable antibodies but remain viremic longer than immunocompetent patients, highlighting the importance of nucleic acid–based testing methods (11–13).\n\nIn addition to diagnosis, mNGS also provides valuable information about pathogen genomics. We report the unique assembly of a JCV genome from human clinical samples, an important advance in the study of JVC pathogenesis, virus evolution, and differences between the enzootic transmission cycle and human infection (14). The functional importance of the identified SNPs could not be evaluated from the genomic data alone; however, none were associated with alterations of potential N-linked glycosylation sites, cysteine bonds, or the conserved fusion domain (15). One SNP that arose between CSF and brain (small segment gA397G; aT109A) also varied between JCV strains with different neurovirulence in mice, although the functional importance is unknown (4).\n\nAlthough treatment options for JCV infection are largely unexplored, response to antiviral drugs probably depends on initiating treatment early in the disease course and reaching therapeutic levels in the CSF before extensive neuronal loss. Thus, broad-spectrum molecular assays such as mNGS could potentially lead to earlier treatment with improved outcomes (8).\n\nAppendix\n\nAdditional information about a fatal case of chronic Jamestown Canyon virus encephalitis diagnosed by metagenomic sequencing in a patient receiving rituximab.\n\nAcknowledgments\n\nWe thank the patient’s family for granting permission to publish this information. We also wish to acknowledge contributions by Asmeeta Achari, Sarah Reagan-Steiner, and the molecular pathology and immunohistochemistry teams at CDC’s Infectious Disease Pathology Branch.\n\nThis study was supported by the National Institutes of Health (grant no. U19AI110818 awarded to P.C.S, grant no. KL2 TR001100 awarded to A.P., and grant no. R33AI129455 awarded to C.Y.C.), the Charles and Helen Schwab Foundation (grant awarded to C.Y.C.), and a Broadnext10 gift from the Broad Institute (awarded to P.C.S.).\n\nDr. Solomon is a neuropathologist at Brigham and Women’s Hospital and Harvard Medical School, in Boston, Massachusetts. His primary research interests include viral infections of the central nervous system.\n\nSuggested citation for this article: Solomon IH, Ganesh VS, Yu G, Deng XD, Wilson MR, Miller S, et al. Fatal case of chronic Jamestown Canyon virus encephalitis diagnosed by metagenomic sequencing in a patient receiving rituximab. Emerg Infect Dis. 2021 Jan [date cited]. https://doi.org/10.3201/eid2701.203448\n\n1 These authors contributed equally to this article.\n\n2 These senior authors contributed equally to this article.\n\n3 Current affiliation: Emory University, Atlanta, Georgia, USA.\n==== Refs\nReferences\n\n1. Matkovic E, Hoang Johnson DK, Staples JE, Mora-Pinzon MC, Elbadawi LI, Osborn RA, et al. Enhanced arboviral surveillance to increase detection of Jamestown Canyon virus infections, Wisconsin, 2011–2016. Am J Trop Med Hyg. 2019;100 :445–51. 10.4269/ajtmh.18-0575 30526745\n2. Patriquin G, Drebot M, Cole T, Lindsay R, Schleihauf E, Johnston BL, et al. High seroprevalence of Jamestown Canyon virus among deer and humans, Nova Scotia, Canada. Emerg Infect Dis. 2018;24 :118–21. 10.3201/eid2401.170484 29260667\n3. Pastula DM, Hoang Johnson DK, White JL, Dupuis AP II, Fischer M, Staples JE. Jamestown Canyon virus disease in the United States—2000–2013. Am J Trop Med Hyg. 2015;93 :384–9. 10.4269/ajtmh.15-0196 26033022\n4. Bennett RS, Nelson JT, Gresko AK, Murphy BR, Whitehead SS. The full genome sequence of three strains of Jamestown Canyon virus and their pathogenesis in mice or monkeys. Virol J. 2011;8 :136. 10.1186/1743-422X-8-136 21435230\n5. Huang C, Campbell W, Grady L, Kirouac I, LaForce FM. Diagnosis of Jamestown Canyon encephalitis by polymerase chain reaction. Clin Infect Dis. 1999;28 :1294–7. 10.1086/514789 10451169\n6. Savard M, Paradis A, Francoeur CL. Jamestown Canyon encephalitis with NORSE and electrographic response to ribavirin: a case report. Epilepsia Open. 2018;3 :286–9. 10.1002/epi4.12113 29881809\n7. Curren EJ, Lehman J, Kolsin J, Walker WL, Martin SW, Staples JE, et al. West Nile virus and other nationally notifiable arboviral diseases—United States, 2017. MMWR Morb Mortal Wkly Rep. 2018;67 :1137–42. 10.15585/mmwr.mm6741a1 30335737\n8. Wilson MR, Sample HA, Zorn KC, Arevalo S, Yu G, Neuhaus J, et al. Clinical metagenomic sequencing for diagnosis of meningitis and encephalitis. N Engl J Med. 2019;380 :2327–40. 10.1056/NEJMoa1803396 31189036\n9. Armstrong PM, Andreadis TG. Genetic relationships of Jamestown Canyon virus strains infecting mosquitoes collected in Connecticut. Am J Trop Med Hyg. 2007;77 :1157–62. 10.4269/ajtmh.2007.77.1157 18165540\n10. Kinsella CM, Paras ML, Smole S, Mehta S, Ganesh V, Chen LH, et al. Jamestown Canyon virus in Massachusetts: clinical case series and vector screening. Emerg Microbes Infect. 2020;9 :903–12. 10.1080/22221751.2020.1756697 32302268\n11. Solomon IH, Spera KM, Ryan SL, Helgager J, Andrici J, Zaki SR, et al. Fatal Powassan encephalitis (deer tick virus, lineage II) in a patient with fever and orchitis receiving rituximab. JAMA Neurol. 2018;75 :746–50. 10.1001/jamaneurol.2018.0132 29554185\n12. Levi ME, Quan D, Ho JT, Kleinschmidt-Demasters BK, Tyler KL, Grazia TJ. Impact of rituximab-associated B-cell defects on West Nile virus meningoencephalitis in solid organ transplant recipients. Clin Transplant. 2010;24 :223–8. 10.1111/j.1399-0012.2009.01044.x 19659514\n13. Yang Y, Qiu J, Snyder-Keller A, Wu Y, Sun S, Sui H, et al. Fatal Cache Valley virus meningoencephalitis associated with rituximab maintenance therapy. Am J Hematol. 2018;93 :590–4. 10.1002/ajh.25024 29282755\n14. Elliott RM. Orthobunyaviruses: recent genetic and structural insights. Nat Rev Microbiol. 2014;12 :673–85. 10.1038/nrmicro3332 25198140\n15. Garry CE, Garry RF. Proteomics computational analyses suggest that the antennavirus glycoprotein complex includes a class I viral fusion protein (α-penetrene) with an internal zinc-binding domain and a stable signal peptide. Viruses. 2019;11 :E750. 10.3390/v11080750 31416162\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1080-6040",
"issue": "27(1)",
"journal": "Emerging infectious diseases",
"keywords": "Jamestown Canyon virus; arbovirus; encephalitis; metagenomic next-generation sequencing; monoclonal antibody; orthobunyavirus; rituximab; vector-borne infections; viruses",
"medline_ta": "Emerg Infect Dis",
"mesh_terms": "D000914:Antibodies, Viral; D002141:Encephalitis Virus, California; D004670:Encephalitis, California; D006801:Humans; D008297:Male; D054892:Metagenome; D056186:Metagenomics; D008875:Middle Aged; D000069283:Rituximab",
"nlm_unique_id": "9508155",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33261720",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "25198140;31416162;31189036;30335737;32302268;29260667;29282755;18165540;30526745;29554185;21435230;29881809;19659514;26033022;10451169",
"title": "Fatal Case of Chronic Jamestown Canyon Virus Encephalitis Diagnosed by Metagenomic Sequencing in Patient Receiving Rituximab.",
"title_normalized": "fatal case of chronic jamestown canyon virus encephalitis diagnosed by metagenomic sequencing in patient receiving rituximab"
} | [
{
"companynumb": "US-BEH-2021129391",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "We present the case of a 73-year-old male patient who was hospitalised with infective endocarditis, and report an elevation in his blood creatine phosphokinase (CPK) after receiving daptomycin and rosuvastatin therapy concomitantly. His previous home-scheduled medications included apixaban, ivabradine, metformin, rosuvastatin 20 mg, ginkgo biloba and trimetazidine, and he continued to receive these medications at the hospital. After three sets of blood cultures were taken, empirical treatment was started with vancomycin and gentamicin. On the eighth day of treatment, daptomycin and ampicillin-sulbactam were initiated due to ampicillin-resistant Enterococcus faecalis growth in the patient's blood culture. Daptomycin and rosuvastatin were discontinued on the 23rd day of treatment because of blood CPK elevation (2416 U/L) and linezolid was started instead of daptomycin. Six days after discontinuation of daptomycin and rosuvastatin, the CPK concentrations returned to normal range.",
"affiliations": "Clinical pharmacy, Inonu University, Malatya, Turkey.;Clinical pharmacy, Inonu University, Malatya, Turkey omerfb92@hotmail.com.;Clinical pharmacy, Inonu University, Malatya, Turkey.",
"authors": "Durmuş|Mefküre|M|;Bahçecioğlu|Ömer Faruk|ÖF|http://orcid.org/0000-0002-4045-4555;Gök|Selim|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/ejhpharm-2020-002218",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2047-9956",
"issue": "28(4)",
"journal": "European journal of hospital pharmacy : science and practice",
"keywords": "cardiology; case report; clinical pharmacy; infection control; side effects of drugs",
"medline_ta": "Eur J Hosp Pharm",
"mesh_terms": null,
"nlm_unique_id": "101578294",
"other_id": null,
"pages": "234-236",
"pmc": null,
"pmid": "34162676",
"pubdate": "2021-07",
"publication_types": "D016428:Journal Article",
"references": "23314530;15262879;19159124;19149497;19500039;23712701;29668884;15911706;16651050;22160888;18402982;16914701;25245515;25022580;19584384",
"title": "Daptomycin in combination with rosuvastatin induced blood creatine phosphokinase elevation.",
"title_normalized": "daptomycin in combination with rosuvastatin induced blood creatine phosphokinase elevation"
} | [
{
"companynumb": "TR-ALS-000651",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "METFORMIN HYDROCHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "Clofazimine has demonstrated in vitro activity against many nontuberculous mycobacteria. We present the case of a woman with cystic fibrosis who developed disseminated macrolide-resistant Mycobacterium avium infection following lung transplantation treated in part with clofazimine. We describe the novel administration of clofazimine via gastrostomy tube.",
"affiliations": "Division of Allergy & Infectious Diseases, Department of Medicine, University of Washington School of Medicine, Seattle, Washington, USA.;Division of Allergy & Infectious Diseases, Department of Medicine, University of Washington School of Medicine, Seattle, Washington, USA.;Division of Allergy & Infectious Diseases, Department of Medicine, University of Washington School of Medicine, Seattle, Washington, USA.;Division of Allergy & Infectious Diseases, Department of Medicine, University of Washington School of Medicine, Seattle, Washington, USA.",
"authors": "Valinetz|Ethan|E|0000-0003-1717-3795;Stankiewicz Karita|Helen|H|;Pottinger|Paul S|PS|;Jain|Rupali|R|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1093/ofid/ofaa183",
"fulltext": "\n==== Front\nOpen Forum Infect Dis\nOpen Forum Infect Dis\nofid\nOpen Forum Infectious Diseases\n2328-8957 Oxford University Press US \n\n10.1093/ofid/ofaa183\nofaa183\nBrief Report\nAcademicSubjects/MED00290\nNovel Administration of Clofazimine for the Treatment of Mycobacterium avium Infection\nhttp://orcid.org/0000-0003-1717-3795Valinetz Ethan 1 Stankiewicz Karita Helen 1 Pottinger Paul S 1 Jain Rupali 12 1 \nDivision of Allergy & Infectious Diseases, Department of Medicine, University of Washington School of Medicine, Seattle, Washington, USA\n2 \nDepartment of Pharmacy, University of Washington, Seattle, Washington, USA\nCorrespondence: Ethan Valinetz, MD, University of Washington, Box 356423, 1959 NE Pacific Street, Seattle, WA 98195 (edval89@gmail.com).\n6 2020 \n25 5 2020 \n25 5 2020 \n7 6 ofaa18307 2 2020 12 5 2020 20 5 2020 10 6 2020 © The Author(s) 2020. Published by Oxford University Press on behalf of Infectious Diseases Society of America.2020This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reproduction and distribution of the work, in any medium, provided the original work is not altered or transformed in any way, and that the work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nClofazimine has demonstrated in vitro activity against many nontuberculous mycobacteria. We present the case of a woman with cystic fibrosis who developed disseminated macrolide-resistant Mycobacterium avium infection following lung transplantation treated in part with clofazimine. We describe the novel administration of clofazimine via gastrostomy tube.\n\nclofaziminegastrostomy tubelung transplantMycobacterium aviumUniversity of Washington Host Defense Research TrainingT32AI007044University of Washington Sexually Transmitted Infections Cooperative Research CenterU19AI11317National Institutes of Health10.13039/100000002R01 CA213130-S\n==== Body\nClofazimine is a lipophilic r-iminophenazine antimicrobial originally studied for the treatment of tuberculosis that is currently Food and Drug Administration (FDA)–approved for the treatment of Mycobacterium leprae [1]. Clofazimine has demonstrated in vitro activity against other nontuberculous mycobacteria, including Mycobacterium avium complex (MAC) [2, 3]. The off-label use of clofazimine has been described in patients with MAC infection, including patients with HIV, cystic fibrosis, and those requiring solid organ transplantation [2, 4–6]. It is currently available via the Emergency Use Investigator-Initiated New Drug Application from Novartis. Clofazimine is supplied in capsule form for oral administration. According to the manufacturer, capsules should be swallowed whole and not opened or crushed [1]. Due to the numerous adverse effects associated with prolonged administration of oral clofazimine (eg, skin discoloration, depression, gastrointestinal intolerance), inhalational administration of clofazimine for pulmonary nontuberculous mycobacteria treatment is currently under investigation [7–10]. No recommendations are available for the administration of clofazimine in patients who are unable to take medications by mouth. We report the successful administration of clofazimine via gastrostomy tube to a post–lung transplant recipient with disseminated MAC infection.\n\nCASE PRESENTATION\nA 36-year-old woman with a history of cystic fibrosis and fibrocavitary pulmonary disease due to MAC underwent successful bilateral lung transplantation. Her MAC isolate was resistant to macrolides and amikacin. She had received ethambutol, rifampin, azithromycin, and clofazimine pretransplant. The early postoperative course was complicated by severe hypoxia requiring transient extracorporeal membrane oxygenation support and ultimately required tracheostomy placement due to persistent respiratory failure. Her tenuous respiratory status precluded any attempt to administer medications by mouth. During this period, she was continued on ethambutol via gastrostomy tube [11] and intravenous azithromycin and rifampin. The clofazimine was held, as there were no available guidelines for drug administration through a nonoral route. One week post-transplant, blood and bronchoalveolar lavage (BAL) cultures were obtained for evaluation of fever; MAC was isolated from both cultures after 4 weeks of incubation (Figure 1). Given disseminated MAC infection in the setting of her highly immunosuppressed state, we initiated off-label dosing of clofazimine via gastrostomy tube to optimize her MAC treatment regimen. In consultation with our investigational drug pharmacy team, a protocol for melted clofazimine administration via gastrostomy tube was developed (Figure 2). The clofazimine hard gelatin capsules were placed in a cup with 15 mL of hot water from an instant hot water tap (~120°F). A hemostat was used to macerate capsules into a small particle suspension. Through a syringe, the clofazimine suspension was administered via gastrostomy tube followed by water to decrease the risk of clogging. Enteral nutrition was held during medication administration and restarted afterwards. Because this administration method had not been previously evaluated, we initiated clofazimine at 300 mg daily instead of the 100-mg daily dose previously prescribed for treatment of her pulmonary MAC infection. To ensure drug absorption, clofazimine serum concentrations were measured by the National Jewish Health Mycobacteriology Laboratory. Five days after clofazimine initiation, serum concentrations were 0.5 mcg/mL at 2 hours postadministration (published reference range, 0.5–2 mcg/mL) [12] and 0.47 mcg/mL after 6 hours. Drug levels were reported after 17 days of therapy on clofazimine; because these levels were within reference range before steady state had been reached, the clofazimine dose was decreased to the standard 100 mg daily. Repeat drug concentration levels obtained 1 day before reducing clofazimine dose were subsequently reported at 0.62 mcg/mL at 2 hours and 0.79 mcg/mL at 6 hours postadministration. A clofazimine trough level was obtained 54 days after decreasing the dose to 100 mg daily in order to verify that the patient was not reaching potentially toxic levels, and the trough concentration was 0.52 mcg/mL. In addition to clofazimine, azithromycin, rifabutin, and ethambutol, the patient was started on bedaquiline and tedizolid. As the patient was on multiple QTc-prolonging medications, weekly electrocardiograms were obtained and her QTc interval remained normal. Weekly hepatic function tests were normal while on the higher dose of clofazimine. The patient had already developed clofazimine-induced skin pigmentation before this hospitalization; skin discoloration remained stable despite higher doses of clofazimine. During her hospitalization, a new BAL culture obtained at 8 weeks post-transplant revealed persistent MAC pulmonary infection. Additionally, pleural fluid samples obtained at weeks 12 and 15 were acid fast bacilli smear positive but culture negative. All subsequent blood cultures were negative for MAC. Ultimately, due to improved respiratory status, she was transitioned to oral clofazimine after 86 days of receiving this medication via gastrostomy tube. Despite several other complications during her prolonged hospitalization, her condition improved, and she was discharged to a rehabilitation facility.\n\nFigure 1. Summary of clinical course. Figure 1 shows a summary of the patient’s clinical course with relevant microbiologic data and clofazimine start dates, dosing, and serum concentration levels. Abbreviations: AFB, acid fast bacilli; BAL, bronchoalveolar lavage; MAC, Mycobacterium avium complex; PEG, percutaneous endoscopic gastrostomy; PO, per os (oral).\n\nFigure 2. Preparation and administration of clofazimine suspension. Figure 2 demonstrates the preparation (top panels) and administration (lower panels) of clofazimine suspension. For preparation, fill the dose cup with 15 mL of hot water from an instant hot water dispenser (120°F) and add clofazimine capsules. Macerate with hemostat to form a slurry. Draw up slurry for administration. Put on gloves before administration to prevent staining. Flush feeding tube with water before administration. Administer the clofazimine slurry and flush with water after administration to prevent clogging. Resume enteral nutrition afterwards. Do not administer with other medications. Administration may stain the feeding tube.\n\nDiscussion\nIn this report, we present our experience with a critically ill lung transplant recipient with disseminated MAC infection treated with clofazimine via gastrostomy tube. Nontuberculous mycobacterial infections are a significant cause of morbidity and mortality, particularly in immunocompromised patients such as solid organ transplant recipients [13, 14]. Treatment regimens can be complex, and antimicrobials can be difficult to tolerate [15, 16]. Oral clofazimine has made a significant contribution to the treatment of MAC infections despite limited data supporting its use, but there is no official guidance for alternative route of administration for persons who cannot take medications by mouth [13, 16, 17].\n\nClofazimine is a highly lipophilic drug with extensive tissue distribution through accumulation in macrophages and adipose cells. Absorption after oral administration of clofazimine is variable (45%–62%) and may be increased through concomitant food intake [18, 19]. Although the pharmacokinetics of clofazimine have only been partially elucidated, the reported half-life elimination of clofazimine is ~70 days, and steady state concentration is achieved at 1 month [2, 20]. In the United States, clofazimine is available via Investigational New Drug Application to the FDA, with medication supplied by the manufacturer Novartis. As indicated in the medication package insert, clofazimine is only approved for oral use. Although disintegration upon exposure to gastrointestinal fluid is a fundamental step for drug bioavailability of capsule formulations, it is unknown if changes in the physical property of clofazimine formulations can alter the drug pharmacokinetics.\n\nIn the present case, clofazimine was initiated via gastrostomy tube to augment the treatment regimen of her MAC infection. The optimal dose of oral clofazimine in immunosuppressed patients has not been established. In an observational study evaluating the use of oral clofazimine for pediatric and adults with pulmonary and extrapulmonary nontuberculous mycobacterial infections as part of a multidrug regimen, most persons received clofazimine 100 mg daily. Dose-adjusted treatment also included reduction of daily clofazimine to 50 mg and dose increase to 150 mg daily [5]. In this immunosuppressed patient with mycobacteremia and unclear dose delivery and absorption, we opted to initiate clofazimine at a dose of 300 mg daily (5.4 mg/kg/d). Although the dose was considerably higher than recommended in the package insert, it was also unclear how much of the clofazimine would be delivered and absorbed and whether the medication may adhere to the feeding tube itself. In a pharmacokinetics study conducted by van Ingen et al., 17 patients taking a mean daily clofazimine dose of 1.62 mg/kg were found to have a mean Cmax of 0.43 mcg/mL and mean final concentration of 0.44 mcg/mL [12]. To optimize clofazimine use while minimizing toxicity, we measured serum concentrations to ensure that clofazimine was absorbed before reducing the dose to 100 mg daily (1.79 mg/kg/d). After 54 days of therapy, we measured her trough level to ensure that her serum concentration was not significantly elevated as she was closer to a steady state at that point. Although therapeutic drug monitoring can be used for dose adjustment for some antimicrobials, the role and clinical usefulness of therapeutic clofazimine drug monitoring are uncertain. However, in our patient, clofazimine drug monitoring provided reassuring information regarding systemic absorption.\n\nThere are multiple novel formulations of clofazimine currently under investigation [7–9, 21–23]. For instance, clofazimine can be processed to a dry powder for inhaled administration [8]. Inhaled clofazimine has been shown to reduce colony counts of Mycobacterium tuberculosis in the lungs more significantly than oral clofazimine administration [9, 10]. Not surprisingly, inhaled clofazimine was inferior to systemic clofazimine at clearing nontuberculous mycobacterial infections in the liver and spleen in 1 study [10]. Another clofazimine formulation can be prepared in a lipid-based solution via flash nanoprecipitation technology, although this formulation has not been tested in vivo [21]. Lastly, various groups have evaluated the possibility of parenteral administration of clofazimine. Peters et al. demonstrated reduced MAC burden in the liver, spleen, and lungs of mice treated with intravenous clofazimine [23]. Murashov et al. synthesized clofazimine hydrochloride microcrystals for parenteral administration and tested it in mice, showing that intravenous administration led to accumulation of clofazimine in macrophages [22]. These studies are encouraging for the future use of alternative routes of clofazimine for the treatment of nontuberculous mycobacterial infections.\n\nIn summary, this novel approach of melting clofazimine into a suspension for percutaneous gastrostomy tube administration should be considered for patients who are unable to take medications by mouth. Although therapeutic drug monitoring of clofazimine has not been established to improve clinical outcomes, drug levels could be helpful in persons with potentially altered gastrointestinal absorption. With this approach, we obtained therapeutic serum clofazimine levels and did observe clinical improvement in our patient, although this was likely multifactorial.\n\nAcknowledgments\nA special thanks to Janice Yamauchi, PharmD, Investigational Drug Services, and Charles Daley, MD, Chief of the Division of Mycobacterial & Respiratory Infections at National Jewish Health.\n\n\nFinancial support. This work was supported by the University of Washington Host Defense Research Training Grant (T32AI007044, E.D.V.), the Developmental Award from University of Washington Sexually Transmitted Infections Cooperative Research Center (U19AI11317, H.S.K.), and Research Supplement to Promote Diversity in Health-Related Research Program, National Cancer Institute at the National Institutes of Health (R01 CA213130-S, H.S.K.).\n\n\nPotential conflicts of interest. None to disclose. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.\n==== Refs\nReferences\n1. \nLamprene (clofazimine). Package insert . Novartis Pharmaceuticals Corporation; 1986 .\n2. \nMcGuffin SA , Pottinger PS , Harnisch JP \nClofazimine in nontuberculous mycobacterial infections: a growing niche\n. Open Forum Infect Dis 2017 ; 4 :XXX–XX .\n3. \nLuo J , Yu X , Jiang G , et al. \nIn vitro activity of clofazimine against nontuberculous mycobacteria isolated in Beijing, China\n. Antimicrob Agents Chemother 2018 ; 62:e00072-18.\n4. \nCariello PF , Kwak EJ , Abdel-Massih RC , Silveira FP \nSafety and tolerability of clofazimine as salvage therapy for atypical mycobacterial infection in solid organ transplant recipients\n. Transpl Infect Dis 2015 ; 17 :111 –8\n.25620390 \n5. \nMartiniano SL , Wagner BD , Levin A , et al. \nSafety and effectiveness of clofazimine for primary and refractory nontuberculous mycobacterial infection\n. Chest 2017 ; 152 :800 –9\n.28483608 \n6. \nAnjan S , Morris MI \nNontuberculous mycobacteria in solid organ transplant\n. Curr Opin Organ Transplant 2019 ; 24 :476 –82\n.31145153 \n7. \nBanaschewski B , Hofmann T \nInhaled antibiotics for mycobacterial lung disease\n. Pharmaceutics 2019 ; 11 :352 .\n8. \nBrunaugh AD , Jan SU , Ferrati S , Smyth HDC \nExcipient-free pulmonary delivery and macrophage targeting of clofazimine via air jet micronization\n. Mol Pharm 2017 ; 14 :4019 –31\n.29047275 \n9. \nVerma RK , Germishuizen WA , Motheo MP , et al. \nInhaled microparticles containing clofazimine are efficacious in treatment of experimental tuberculosis in mice\n. Antimicrob Agents Chemother 2013 ; 57 :1050 –2\n.23183441 \n10. \nBanaschewski B , Verma D , Pennings LJ , et al. \nClofazimine inhalation suspension for the aerosol treatment of pulmonary nontuberculous mycobacterial infections\n. J Cyst Fibros 2019 ; 18 :714 –20\n.31138497 \n11. \nKoegelenberg CF , Nortje A , Lalla U , et al. \nThe pharmacokinetics of enteral antituberculosis drugs in patients requiring intensive care\n. S Afr Med J 2013 ; 103 :394 –8\n.23725959 \n12. \nvan Ingen J , Egelund EF , Levin A , et al. \nThe pharmacokinetics and pharmacodynamics of pulmonary Mycobacterium avium complex disease treatment\n. Am J Respir Crit Care Med 2012 ; 186 :559 –65\n.22744719 \n13. \nDaley CL \nMycobacterium avium complex disease\n. Microbiol Spectr 2017 ; 5 .\n14. \nDaley CL \nNontuberculous mycobacterial disease in transplant recipients: early diagnosis and treatment\n. Curr Opin Organ Transplant 2009 ; 14 :619 –24\n.19745733 \n15. \nGriffith DE , Aksamit T , Brown-Elliott BA , et al ; ATS Mycobacterial Diseases Subcommittee; American Thoracic Society; Infectious Disease Society of America \nAn official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases\n. Am J Respir Crit Care Med 2007 ; 175 :367 –416\n.17277290 \n16. \nJarand J , Davis JP , Cowie RL , et al. \nLong-term follow-up of Mycobacterium avium complex lung disease in patients treated with regimens including clofazimine and/or rifampin\n. Chest 2016 ; 149 :1285 –93\n.26513209 \n17. \nHarrington JS , Zappetti D \nTreatment of Mycobacterium avium complex lung disease with clofazimine\n. Clin Pulm Med 2016 ; 23 :237 –238\n.\n18. \nNix DE , Adam RD , Auclair B , et al. \nPharmacokinetics and relative bioavailability of clofazimine in relation to food, orange juice and antacid\n. Tuberculosis (Edinb) 2004 ; 84 :365 –73\n.15525560 \n19. \nCholo MC , Mothiba MT , Fourie B , Anderson R \nMechanisms of action and therapeutic efficacies of the lipophilic antimycobacterial agents clofazimine and bedaquiline\n. J Antimicrob Chemother 2017 ; 72 :338 –53\n.27798208 \n20. \nGopal M , Padayatchi N , Metcalfe JZ , O’Donnell MR \nSystematic review of clofazimine for the treatment of drug-resistant tuberculosis\n. Int J Tuberc Lung Dis 2013 ; 17 :1001 –7\n.23541151 \n21. \nSalim M , Ramirez G , Clulow AJ , et al. \nSolid-state behavior and solubilization of flash nanoprecipitated clofazimine particles during the dispersion and digestion of milk-based formulations\n. Mol Pharm 2019 ; 16 :2755 –65\n.31038976 \n22. \nMurashov MD , Diaz-Espinosa J , Lalone V , et al. \nSynthesis and characterization of a biomimetic formulation of clofazimine hydrochloride microcrystals for parenteral administration\n. Pharmaceutics 2018 ; 10 :238 .\n23. \nPeters K , Leitzke S , Diederichs JE , et al. \nPreparation of a clofazimine nanosuspension for intravenous use and evaluation of its therapeutic efficacy in murine Mycobacterium avium infection\n. J Antimicrob Chemother 2000 ; 45 :77 –83\n.10629016\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2328-8957",
"issue": "7(6)",
"journal": "Open forum infectious diseases",
"keywords": "Mycobacterium avium; clofazimine; gastrostomy tube; lung transplant",
"medline_ta": "Open Forum Infect Dis",
"mesh_terms": null,
"nlm_unique_id": "101637045",
"other_id": null,
"pages": "ofaa183",
"pmc": null,
"pmid": "32548205",
"pubdate": "2020-06",
"publication_types": "D016428:Journal Article",
"references": "28483608;27798208;25620390;31038976;10629016;29047275;23725959;23541151;31331119;29760127;23183441;17277290;19745733;22744719;26513209;31145153;30453628;31138497;15525560;30202770;28429679",
"title": "Novel Administration of Clofazimine for the Treatment of Mycobacterium avium Infection.",
"title_normalized": "novel administration of clofazimine for the treatment of mycobacterium avium infection"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2020R1-264598",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RIFAMPIN"
},
"drugad... |
{
"abstract": "BACKGROUND\nChronic immunosuppression is associated with unwanted adverse effects and increased morbidities. Long-term acceptance of transplanted organs without the requirement for immunosuppression, or operational tolerance, remains an important goal in clinical transplantation.\n\n\nMETHODS\nWe reviewed the characteristics of recipients who achieved spontaneous operational tolerance after liver transplantation (OLT) among a consecutive series of 1014 adult recipients in a single center.\n\n\nRESULTS\nWe observed 5 cases (0.5%) of operational tolerance. All cases were men who underwent transplantations for hepatitis B virus-related liver cirrhosis. The mean time from OLT to achievement of spontaneous operational tolerance was 83.1 ± 62.9 months (range, 21.3-156.2). Characteristics common to all tolerant recipients were superior graft quality and good pretransplant recipient condition: specifically, high graft-recipient weight ratio (median, 1.18; range, 1.15-2.69), low hepatic macrosteatosis (median, 3; range, 0-15), low score of model for end-stage liver disease (median, 13; range, 7-21), and no history of preoperative intensive care.",
"affiliations": "Department of Surgery, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.",
"authors": "Shin|M|M|;Song|S|S|;Moon|H H|HH|;Lee|S|S|;Kim|T S|TS|;Kim|J M|JM|;Park|J B|JB|;Kwon|C H D|CH|;Kim|S-J|SJ|;Lee|S-K|SK|;Joh|J-W|JW|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "45(8)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000222:Adaptation, Physiological; D000328:Adult; D000368:Aged; D006801:Humans; D016031:Liver Transplantation; D008297:Male",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "3024-7",
"pmc": null,
"pmid": "24157027",
"pubdate": "2013-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Characteristics of recipients who achieved spontaneous operational tolerance in adult liver transplantation.",
"title_normalized": "characteristics of recipients who achieved spontaneous operational tolerance in adult liver transplantation"
} | [
{
"companynumb": "PHHY2015KR050214",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": null,
... |
{
"abstract": "We present a case of oropharyngeal squamous cell carcinoma (SCC) of the tongue base incidentally detected on F-fluciclovine PET/CT. A 79-year-old man with history of locally advanced prostate cancer (Gleason score 4 + 5 = 9; cT2cN1M0) previously treated with androgen deprivation therapy (luprolide + bicalutamide) presented with a slowly rising serum prostate-specific antigen over 3 years, concerning for recurrent disease. F-fluciclovine PET/CT, obtained to identify potential sites of recurrence, demonstrated prostate bed uptake with possible left seminal vesicle involvement. Additionally, an exophytic, tracer-avid right tongue base mass was incidentally noted and later confirmed to be p16+ SCC on biopsy.",
"affiliations": "From the Division of Nuclear Medicine, Department of Radiology and Biomedical Imaging.;Department of Pathology.;Division of Hematology/Oncology, Department of Medicine, and.;Division of Head and Neck Surgical Oncology, Department of Otolaryngology - Head and Neck Surgery, University of California San Francisco, San Francisco, CA.;From the Division of Nuclear Medicine, Department of Radiology and Biomedical Imaging.",
"authors": "Raghavan|Kesav|K|;Wen|Kwun Wah|KW|;Small|Eric J|EJ|;Ha|Patrick|P|;Flavell|Robert R|RR|",
"chemical_list": "D002264:Carboxylic Acids; D003503:Cyclobutanes; D019275:Radiopharmaceuticals; D019788:Fluorodeoxyglucose F18; C117460:fluciclovine F-18",
"country": "United States",
"delete": false,
"doi": "10.1097/RLU.0000000000002507",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0363-9762",
"issue": "44(5)",
"journal": "Clinical nuclear medicine",
"keywords": null,
"medline_ta": "Clin Nucl Med",
"mesh_terms": "D000368:Aged; D002264:Carboxylic Acids; D002294:Carcinoma, Squamous Cell; D003503:Cyclobutanes; D019788:Fluorodeoxyglucose F18; D006801:Humans; D033162:Incidental Findings; D008297:Male; D009959:Oropharyngeal Neoplasms; D000072078:Positron Emission Tomography Computed Tomography; D019275:Radiopharmaceuticals",
"nlm_unique_id": "7611109",
"other_id": null,
"pages": "e367-e369",
"pmc": null,
"pmid": "30829856",
"pubdate": "2019-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Incidentally Detected Oropharyngeal Squamous Cell Carcinoma on 18F-Fluciclovine PET/CT.",
"title_normalized": "incidentally detected oropharyngeal squamous cell carcinoma on 18f fluciclovine pet ct"
} | [
{
"companynumb": "US-BLUE EARTH DIAGNOSTICS LIMITED-BED-000018-2019",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUCICLOVINE F-18"
},
... |
{
"abstract": "Pulmonary hypertension (PH) is a known complication of Gaucher disease (GD) and splenectomy. Although it resembles World Health Organization (WHO) group 1 pulmonary arterial hypertension (PAH), PH due to GD or splenectomy is part of WHO group 5. There are no clinical trials testing therapies in PH due to GD or splenectomy. Several reports suggest that PAH-specific therapies are beneficial in patients with PH due to GD, although data are insufficient to formulate a treatment algorithm for these patients. The tyrosine kinase inhibitor imatinib has been investigated in the treatment of severe PAH, but not in PH WHO group 5. We report a patient with GD and splenectomy who developed PH that progressed while on conventional PAH-specific therapy and improved once imatinib was added to her treatment regimen. This is the first report, to our knowledge, describing significant subjective and objective improvements in response to imatinib in a patient with WHO group 5 PH.",
"affiliations": "Department of Medicine, Pulmonary, Critical Care and Sleep Division, Tufts Medical Center, Boston, MA.;Department of Medicine, Pulmonary, Critical Care and Sleep Division, Tufts Medical Center, Boston, MA.;Department of Medicine, Pulmonary, Critical Care and Sleep Division, Tufts Medical Center, Boston, MA.;Department of Medicine, Pulmonary, Critical Care and Sleep Division, Tufts Medical Center, Boston, MA. Electronic address: ipreston@tuftsmedicalcenter.org.",
"authors": "Al-Naamani|Nadine|N|;Roberts|Kari E|KE|;Hill|Nicholas S|NS|;Preston|Ioana R|IR|",
"chemical_list": "D001549:Benzamides; D010879:Piperazines; D047428:Protein Kinase Inhibitors; D011743:Pyrimidines; D000068877:Imatinib Mesylate",
"country": "United States",
"delete": false,
"doi": "10.1378/chest.13-2795",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-3692",
"issue": "146(3)",
"journal": "Chest",
"keywords": null,
"medline_ta": "Chest",
"mesh_terms": "D000328:Adult; D001549:Benzamides; D005260:Female; D005776:Gaucher Disease; D006439:Hemodynamics; D006801:Humans; D006976:Hypertension, Pulmonary; D000068877:Imatinib Mesylate; D010879:Piperazines; D047428:Protein Kinase Inhibitors; D011743:Pyrimidines; D013156:Splenectomy; D013997:Time Factors; D016896:Treatment Outcome; D014944:World Health Organization",
"nlm_unique_id": "0231335",
"other_id": null,
"pages": "e81-e83",
"pmc": null,
"pmid": "25180747",
"pubdate": "2014-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Imatinib as rescue therapy in a patient with pulmonary hypertension associated with Gaucher disease.",
"title_normalized": "imatinib as rescue therapy in a patient with pulmonary hypertension associated with gaucher disease"
} | [
{
"companynumb": "PHHY2014US135927",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMBRISENTAN"
},
"drugadditional": null,
"dru... |
{
"abstract": "BACKGROUND\nAcquired factor XIII (FXIII) inhibitor is a rare but possibly underdiagnosed bleeding disorder. To date, less than one hundred cases have been reported, but the number has increased rapidly in recent years, especially in Japan. Because of the rarity of this disorder, no treatment guidelines are available. In some reports, physicians treated the bleeding with cryoprecipitate or factor XIII concentrate and eradicated the inhibitor with various immune suppressants.\n\n\nMETHODS\nFrom January 2015 to December 2018, we collected consecutive patients diagnosed as having acquired FXIII inhibitor. FXIII activity and inhibitor were measured by a fluorescent factor XIII assay using isopeptidase reaction catalyzed by activated factor XIII and the Bethesda method, respectively. Factor XIII antigen was measured by latex-enhanced immunoassay.\n\n\nRESULTS\nWe found five adult patients with detectable FXIII inhibitor. Four of them were older than 70. Two had systemic lupus erythematosus. All the patients presented with ecchymosis and intramuscular hematoma. No life-threatening bleeding was observed. Delayed diagnosis was common with varied time periods needed to achieve a correct diagnosis. All bleedings were treated and improved by cryoprecipitate. Steroids were given to all patients and cyclophosphamide, rituximab, and other immune suppressants were also used. FXIII inhibitor was totally resolved in three, partially resolved in one, and persisted in one patient.\n\n\nCONCLUSIONS\nWe documented five patients with acquired FXIII inhibitor, found over 4 years. The most common presentations were ecchymosis and intramuscular hematomas. Cryoprecipitate was effective in controlling most bleeds. Steroid, cyclophosphamide and rituximab were effective in eradicating inhibitor in some patients.",
"affiliations": "Department of Internal Medicine, Division of Hematology, National Taiwan University Hospital, Taipei, Taiwan. Electronic address: choushengchieh@ntuh.gov.tw.;Division of Hematology and Oncology, Changhua Christian Hospital, Changhua County, Taiwan. Electronic address: 151925@cch.org.tw.;Department of Clinical Laboratory Sciences and Medical Biotechnology, National Taiwan University, Taipei, Taiwan. Electronic address: gstring301@gmail.com.;Division of Hematology and Oncology, Changhua Christian Hospital, Changhua County, Taiwan. Electronic address: 140660@cch.org.tw.;Division of Hematology and Oncology, Changhua Christian Hospital, Changhua County, Taiwan. Electronic address: 181550@cch.org.tw.;Department of Internal Medicine, National Taiwan University Hospital, Taipei, Taiwan. Electronic address: dtmed170@gmail.com.;Department of Clinical Laboratory Sciences and Medical Biotechnology, National Taiwan University, Taipei, Taiwan. Electronic address: mtshuwha@ntu.edu.tw.;Department of Internal Medicine, Division of Hematology, National Taiwan University Hospital, Taipei, Taiwan; Division of Hematology and Oncology, Changhua Christian Hospital, Changhua County, Taiwan. Electronic address: 111710@cch.org.tw.",
"authors": "Chou|Sheng-Chieh|SC|;Lin|Ching-Yeh|CY|;Yen|Ching-Tzu|CT|;Hsieh|Han-Ni|HN|;Huang|Ying-Chih|YC|;Li|Ko-Jen|KJ|;Lin|Shu-Wha|SW|;Shen|Ming-Ching|MC|",
"chemical_list": "D005176:Factor XIII",
"country": "Singapore",
"delete": false,
"doi": "10.1016/j.jfma.2020.05.032",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0929-6646",
"issue": "120(1 Pt 2)",
"journal": "Journal of the Formosan Medical Association = Taiwan yi zhi",
"keywords": "Acquired inhibitor; Anti-factor XIII; Case series; Taiwan",
"medline_ta": "J Formos Med Assoc",
"mesh_terms": "D005176:Factor XIII; D005177:Factor XIII Deficiency; D006801:Humans; D007564:Japan; D013624:Taiwan; D016896:Treatment Outcome",
"nlm_unique_id": "9214933",
"other_id": null,
"pages": "411-414",
"pmc": null,
"pmid": "32513506",
"pubdate": "2021-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Acquired FXIII inhibitor: Patient characteristics and treatment outcome, a case series in Taiwan.",
"title_normalized": "acquired fxiii inhibitor patient characteristics and treatment outcome a case series in taiwan"
} | [
{
"companynumb": "TW-TEVA-2021-TW-1904332",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": nul... |
{
"abstract": "Ectopic soft tissue calcification (ESTC), a rare clinical condition, causes tissue and organ damage. It is associated with chronic renal failure, hyperparathyroidism, and malignant neoplasms, including multiple myeloma, and it is reportedly resistant to treatment. Here, we present the case of a 71-year-old male with multiple myeloma who had rapid ESTC in the lung. He had developed hypoparathyroidism secondary to thyroidectomy. During the course of our observation, he rapidly developed ectopic pulmonary calcification approximately 2 weeks after acquiring an infection. There was no evidence of further progression of multiple myeloma after the onset of ESTC, and treatment with ferric citrate hydrate and precipitated calcium resulted in immediate improvement of his pulmonary signs. We recommend cautious monitoring for patients with multiple myeloma and hypoparathyroidism to detect the onset of ectopic calcification. In addition, low blood phosphorus levels should be effectively treated.",
"affiliations": "Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Second Department of Internal Medicine, Nagasaki University Hospital.;Second Department of Internal Medicine, Nagasaki University Hospital.;Department of Pathology, Nagasaki University Graduate School of Biomedical Sciences.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Department of Hematology, Nagasaki University Hospital.;Second Department of Internal Medicine, Nagasaki University Hospital.;Department of Pathology, Nagasaki University Graduate School of Biomedical Sciences.;Division of Endocrinology and Metabolism, Third Department of Medicine, Teikyo University Chiba Medical Center.;Department of Hematology, Nagasaki University Hospital.",
"authors": "Ando|Koji|K|;Imaizumi|Yoshitaka|Y|;Yamamoto|Kazuko|K|;Tanaka|Moe|M|;Zaizen|Yoshiaki|Y|;Taguchi|Masataka|M|;Sakaki|Chika|C|;Ichinose|Masahiro|M|;Furumoto|Takafumi|T|;Hashimoto|Miki|M|;Fujioka|Machiko|M|;Sakamoto|Hikaru|H|;Hourai|Makiko|M|;Itonaga|Hidehiro|H|;Sato|Shinya|S|;Sawayama|Yasushi|Y|;Hata|Tomoko|T|;Mukae|Hiroshi|H|;Fukuoka|Junya|J|;Inoue|Daisuke|D|;Miyazaki|Yasushi|Y|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.11406/rinketsu.60.785",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0485-1439",
"issue": "60(7)",
"journal": "[Rinsho ketsueki] The Japanese journal of clinical hematology",
"keywords": "Blood phosphorus; Ectopic calcification; Hyperparathyroidism; Multiple myeloma",
"medline_ta": "Rinsho Ketsueki",
"mesh_terms": "D000368:Aged; D002114:Calcinosis; D006801:Humans; D008297:Male; D009101:Multiple Myeloma; D016105:Parathyroidectomy",
"nlm_unique_id": "2984782R",
"other_id": null,
"pages": "785-790",
"pmc": null,
"pmid": "31391367",
"pubdate": "2019",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ectopic pulmonary calcification after parathyroidectomy in multiple myeloma.",
"title_normalized": "ectopic pulmonary calcification after parathyroidectomy in multiple myeloma"
} | [
{
"companynumb": "JP-PFIZER INC-2019363555",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": null,
"drugadditional": null,
"drugadministrationroute": null,
"drugautho... |
{
"abstract": "Antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis is a group of rare diseases of systemic necrotizing vasculitis affecting small and medium-sized vessels and may be associated with the presence of anti- neutrophil cytoplasmic antibody. Vessels in different organs and systems are involved, leading to various clinical manifestations of the disease. We present 3 cases of microscopic polyangiitis which have been diagnosed and treated in one medical department for over 4 years. The first patient presented with a clinical picture resembling idiopathic pulmonary fibrosis (IPF) and the diagnosis of microscopic polyangiitis (MPA) was established only when acute renal failure appeared. With appropriate therapy, the renal function normalized but her respiratory status deteriorated and she died due to pulmonary infection. The second case presented with constitutional symptoms such as general weakness, weight loss, leg edema and elevated CRP. During the investigation, mononeuritis multiplex and then MPA were diagnosed. She was successfully treated. The third patient diagnosed with MPA presented as end stage renal failure and was treated by cyclophosphamide and rituximab. He did not receive cotrimoxazole that was recommended and was hospitalized for pneumocystis jirovecii pneumonia. Despite intensive therapy in the ICU by various antibiotics and mechanical ventilation, his condition deteriorated and the patient died.",
"affiliations": "Internal Medicine Department B, Wolfson Medical Center, Israel.;Internal Medicine Department B, Wolfson Medical Center, Israel.;Internal Medicine Department B, Wolfson Medical Center, Israel.;Nephrology Department, Wolfson Medical Center, Israel.;Neurology Department, Wolfson Medical Center, Israel.;Internal Medicine Department B, Wolfson Medical Center, Israel.",
"authors": "Karlinskaya|Maria|M|;Vaysman|Lyudmila|L|;Lerner|Emma|E|;Cernes|Relu|R|;Finkelshtein|Vitaly|V|;Orbach|Hedi|H|",
"chemical_list": "D019268:Antibodies, Antineutrophil Cytoplasmic; D000069283:Rituximab; D003520:Cyclophosphamide",
"country": "Israel",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0017-7768",
"issue": "159(11)",
"journal": "Harefuah",
"keywords": null,
"medline_ta": "Harefuah",
"mesh_terms": "D019268:Antibodies, Antineutrophil Cytoplasmic; D003520:Cyclophosphamide; D005260:Female; D006801:Humans; D007676:Kidney Failure, Chronic; D008297:Male; D055953:Microscopic Polyangiitis; D000069283:Rituximab",
"nlm_unique_id": "0034351",
"other_id": null,
"pages": "783-788",
"pmc": null,
"pmid": "33210846",
"pubdate": "2020-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "MICROSCOPIC POLYANGIITIS WITH VARIABLE PRESENTATION.",
"title_normalized": "microscopic polyangiitis with variable presentation"
} | [
{
"companynumb": "IL-CELLTRION INC.-2021IL001771",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drug... |
{
"abstract": "We present the case of a herpes simplex virus-1 [HSV-1] sepsis with severe herpes hepatitis in a young female treated with triple immunosuppressive therapy [adalimumab, azathioprine, prednisolone] for refractory Crohn's disease [CD]. The patient presented with high fever, generalised abdominal tenderness, strongly elevated transaminases, coagulopathy, and pancytopenia. Comprehensive diagnostics including blood HSV-1 polymerase chain reaction [PCR], liver biopsy, and immunohistochemistry revealed the diagnosis of fulminant herpes hepatitis. HSV-1 positivity of cutaneous lesions proved the disseminated nature of the infection. Early treatment with intravenous acyclovir led to a rapid improvement of the patient's condition and resulted in a full recovery of her liver function. This is the first reported case of HSV-sepsis in a patient with CD. Physicians treating inflammatory bowel disease [IBD] patients with combined immunosuppressive therapy should be aware of the possibility of herpes hepatitis, and early empirical antiviral therapy should be considered in immunosuppressed patients presenting with fever and severe anicteric hepatitis.",
"affiliations": "Medical Department 1, Charité Universitätsmedizin Berlin, Berlin lea-maxie.haag@charite.de.;Institute of Virology, Campus Charité Mitte, Charité Universitätsmedizin Berlin, Berlin.;Medical Department 1, Charité Universitätsmedizin Berlin, Berlin.;Medical Department 1, Charité Universitätsmedizin Berlin, Berlin.;Medical Department 1, Charité Universitätsmedizin Berlin, Berlin.;Institute of Pathology, Campus Charité Mitte, Charité Universitätsmedizin Berlin, Berlin.;Gastroenterologie am Bayerischen Platz, Berlin.;Medical Department 1, Charité Universitätsmedizin Berlin, Berlin.;Medical Department 1, Charité Universitätsmedizin Berlin, Berlin.",
"authors": "Haag|Lea-Maxie|LM|;Hofmann|Jörg|J|;Kredel|Lea Isabell|LI|;Holzem|Christina|C|;Kühl|Anja A|AA|;Taube|Eliane T|ET|;Schubert|Stefan|S|;Siegmund|Britta|B|;Epple|Hans-Jörg|HJ|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "England",
"delete": false,
"doi": "10.1093/ecco-jcc/jjv149",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1873-9946",
"issue": "9(12)",
"journal": "Journal of Crohn's & colitis",
"keywords": "Crohn’s disease; herpes simplex virus; inflammatory bowel disease",
"medline_ta": "J Crohns Colitis",
"mesh_terms": "D003424:Crohn Disease; D004359:Drug Therapy, Combination; D005260:Female; D006525:Hepatitis, Viral, Human; D006561:Herpes Simplex; D018259:Herpesvirus 1, Human; D006801:Humans; D016867:Immunocompromised Host; D007166:Immunosuppressive Agents; D018805:Sepsis; D055815:Young Adult",
"nlm_unique_id": "101318676",
"other_id": null,
"pages": "1169-73",
"pmc": null,
"pmid": "26351382",
"pubdate": "2015-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Herpes Simplex Virus Sepsis in a Young Woman with Crohn's Disease.",
"title_normalized": "herpes simplex virus sepsis in a young woman with crohn s disease"
} | [
{
"companynumb": "DE-CONCORDIA PHARMACEUTICALS INC.-E2B_00008485",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugad... |
{
"abstract": "OBJECTIVE\nWe report the clinical findings and retinal function of a patient who presented retinal toxicity signs after cefuroxime use for a phacoemulsification surgery.\n\n\nMETHODS\nA 64-year-old man underwent a technically uneventful left eye cataract surgery. A standard intracameral dose of cefuroxime (0.1 mL of 10.0 mg/mL solution) was administered at the end of the surgery.\n\n\nRESULTS\nAt review 2 days later, he complained about left eye visual loss. Fundus examination revealed a diffuse retinal pallor with small intraretinal cysts. Optical coherence tomography scans showed a large retinal serous detachment with a schisis-like appearance of the outer nuclear layer. A slight global retinal dysfunction was recorded on ISCEV full-field electroretinogram. Fast clinical recovery was observed. Optical coherence tomography scans were back to normal within less than a week. Two months later, full-field electroretinogram showed no longer abnormalities.\n\n\nCONCLUSIONS\nIt is the first report to our knowledge of a case of retinal toxicity with a standard dose. Kinetics and studies about cefuroxime toxicity are reviewed and discussed.",
"affiliations": "Fondation Ophtalmologique Adolphe de Rothschild, 25 rue Manin, 75019, Paris, France, celinefaureoph@gmail.com.",
"authors": "Faure|Céline|C|;Perreira|Daniel|D|;Audo|Isabelle|I|",
"chemical_list": "D000900:Anti-Bacterial Agents; D002444:Cefuroxime",
"country": "Netherlands",
"delete": false,
"doi": "10.1007/s10633-014-9465-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-4486",
"issue": "130(1)",
"journal": "Documenta ophthalmologica. Advances in ophthalmology",
"keywords": null,
"medline_ta": "Doc Ophthalmol",
"mesh_terms": "D000867:Anterior Chamber; D000900:Anti-Bacterial Agents; D002444:Cefuroxime; D004596:Electroretinography; D009877:Endophthalmitis; D005451:Fluorescein Angiography; D006801:Humans; D008297:Male; D008875:Middle Aged; D018918:Phacoemulsification; D012160:Retina; D012164:Retinal Diseases; D041623:Tomography, Optical Coherence",
"nlm_unique_id": "0370667",
"other_id": null,
"pages": "57-63",
"pmc": null,
"pmid": "25319990",
"pubdate": "2015-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "19030905;21596262;3231439;21191447;8353431;16631047;7880795;8594637;12788145;16698453;16767207;20152612;23531349;8594638;21241909;22371414;3174043;21470387;11923264;4743805;22159021;19027573;20796261;12036640;16039491;19882526",
"title": "Retinal toxicity after intracameral use of a standard dose of cefuroxime during cataract surgery.",
"title_normalized": "retinal toxicity after intracameral use of a standard dose of cefuroxime during cataract surgery"
} | [
{
"companynumb": "FR-TEVA-552933ISR",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PHENYLEPHRINE\\PHENYLEPHRINE HYDROCHLORIDE"
},
"druga... |
{
"abstract": "A 64-year-old Japanese man with multiple myeloma was admitted to our institute due to fever and hypotension. He had received multiple courses of chemotherapy just before his febrile episode. Blood culturing detected Morganella morganii. At the time of the diagnosis, his laboratory findings revealed massive rhabdomyolysis with a significantly increased creatinine kinase level (CK; 3,582 U/L); 98.8% of which corresponded to the CK-MB isotype. We diagnosed the patient with sepsis caused by M. morganii, complicated with severe rhabdomyolysis. He died of multi-organ failure 2 days later. Clinicians should closely observe patients with possible systemic infection-associated rhabdomyolysis.",
"affiliations": "Division of Hematology and Stem Cell Transplantation, Department of Internal Medicine, Faculty of Medicine, Kagawa University, Japan.",
"authors": "Imataki|Osamu|O|;Uemura|Makiko|M|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.56.7252",
"fulltext": "\n==== Front\nIntern MedIntern. Med10.2169/internalmedicine.56.7252Internal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 28154285Case ReportFatal Rhabdomyolysis Caused by Morganella morganii in a Patient with Multiple Myeloma Imataki Osamu 1Uemura Makiko 11 Division of Hematology and Stem Cell Transplantation, Department of Internal Medicine, Faculty of Medicine, Kagawa University, JapanCorrespondence to Dr. Osamu Imataki, oima@med.kagawa-u.ac.jp\n\n1 2 2017 56 3 369 371 9 2 2016 20 5 2016 The Internal Medicine is an Open Access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).A 64-year-old Japanese man with multiple myeloma was admitted to our institute due to fever and hypotension. He had received multiple courses of chemotherapy just before his febrile episode. Blood culturing detected Morganella morganii. At the time of the diagnosis, his laboratory findings revealed massive rhabdomyolysis with a significantly increased creatinine kinase level (CK; 3,582 U/L); 98.8% of which corresponded to the CK-MB isotype. We diagnosed the patient with sepsis caused by M. morganii, complicated with severe rhabdomyolysis. He died of multi-organ failure 2 days later. Clinicians should closely observe patients with possible systemic infection-associated rhabdomyolysis. \n\nrhabdomyolysisimmunocompromisedMorganella morganiigram-negative bacillusmultiple myeloma\n==== Body\nIntroduction\nBacterial infections affecting skeletal muscle can be categorized into several types. Pyomyositis affects the massive skeletal muscles and is most frequently caused by Staphylococcus bacteria (1). Pyomyositis generally presents as one or more localized necrotic lesions. Necrotizing fasciitis is a localized spread of infection that follows events such as trauma or surgery (2), and which is commonly affected by Group A Streptococcus.\n\nRhabdomyolysis is a completely different clinical entity from pyomyositis and necrotizing faciitis. Rhabdomyolysis comprehensively affects the skeletal muscle and, like pyomyositis and necrotizing faciitis, shows serum creatinine kinase elevation; however, rhabdomyolysis occurs as a systemic disease and is not associated with the focal manifestation of abscesses (3). Rhabdomyolysis is sometimes complicated by a systemic infection (3). The pathogenesis of infectious rhabdomyolysis is thought to be associated with the systemic or local metabolic changes related to a systemic or local infection (4); however, the mechanisms underlying its pathogenesis have not been established. In addition, gram-negative bacillus rhabdomyolysis is rare, and its microbiological pathology remains to be elucidated.\n\nCase Report\nWe diagnosed the patient, a 64-year-old Japanese man with multiple myeloma, with bacteremia caused by Morganella morganii. He was admitted to our institute due to septic shock at the sudden onset of a febrile episode. He had lumargia due to an old L1-2 compression fracture. His vital signs at admission were as follows: blood pressure, 82/60 mmHg; heart rate, 78/min; body temperature, 39.1℃; respiration rate, 20/min; and SpO2, 95% (room air). A physical examination revealed no clear focus of infection. He did not complain of muscular pain throughout his clinical course. The laboratory findings at the time of his diagnosis showed massive myolysis and a significantly elevated level of creatinine kinase (CK; 3,582 U/L); thereafter, an isotype analysis of the patient's CK confirmed that the elevated CK was derived from the patient's skeletal muscle (98.8%).\n\nThe status of the patient's multiple myeloma, which had been diagnosed 5 years earlier, was stage IIIA, IgG λ type. He had undergone treatment with a variety of chemotherapies: melphalan (MP; 12 mg/day for 4 days + prednisolone 60 mg/day for 6 days, repeated triweekly), VAD (vincristine 0.4 mg/m2 for 4 days as a continuous infusion + doxorubicin 10 mg/m2 for 4 days as a continuous infusion + dexamethasone 40 mg/day, days 1-4, 9-12, and 17-20, repeated monthly), BD (bortezomib 1.3 mg/m2 on days 1, 4, 8, and 11 + dexamethasone 40 mg/day for 4 days, repeated monthly), and thalidomide (100 mg/day). His last treatments were lenalidomide 20 mg/day, and IgG gradually increased 6 months before the current infectious episode.\n\nAfter the patient's admission for sepsis caused by M. morganii, rehydration was immediately performed via central venous catheterization and a catecholamine infusion (dopamine 3 mg/kg/h) was administered; at the same time, antimicrobial treatment with meropenem (0.5 g three times a day) was initiated. Cervical to pelvis computed tomography (CT) was performed on the day of admission, but there were no clear findings explaining the patient's massive myolysis.\n\nOn day 2 of the patient's hospitalization, the patient's laboratory data revealed hypotension and oliguria manifested and renal impairment. The patient's vital sign were as follows: blood pressure, 61/45 mmHg; heart rate, 87/min; and body temperature, 36.8℃. We started hemodialysis combined with endotoxin absorption the same day. However, respiratory failure occurred, necessitating mechanical ventilation, on the night of day 2. The patient died of multi-organ failure two days after undergoing intubation. Before his death, rhabdomyolysis developed day-by-day and was reflected in the remarkable elevation of the patient's CK level. The final CK value was 19,790 U/L (normal range: 40-200 U/L) (Figure). We found that the M. morganii was sensitive to all of the broad spectrum beta-lactams, including carbapenems and cephalosporins, but only resistant to cefotiam, minomycin, and ciprofloxacin.\n\nFigure. The patient’s clinical course. His muscle damage manifested as with elevated levels of CK, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) after the onset of the disease (day 1), with increasing leukocytes and C-reactive protein (CRP). The days in the x-axis indicate the days after the patient’s admission. The patient visited our outpatient clinic for a routine follow-up examination 6 days before his admission. IVIg: intravenous immunoglobulin\n\nDiscussion\nInfectious rhabdomyolysis is caused by various pathogens including viruses, bacteria and fungi (3). The clinical entity of infectious rhabdomyolysis was established in 1982 (5), and a review (3) identified the predisposing risk factors for rhabdomyolysis: alcohol ingestion, compression injury, and generalized seizures. Regardless of the pathogen that causes infectious rhabdomyolysis, the underlying mechanism of the disease is metabolic. The most frequent differential diagnosis is necrotizing fasciitis, which occurs when the infection spreads into the deep fascial layers (2). Necrotizing fasciitis is generally caused by infection, and the initial entry site is sometimes trivial. In contrast, rhabdomyolysis is caused by the following two critical conditions: (1) physical distress (for example, distress due to or involving excessive exercise, seizure, muscle compression, hyperthermia, or hypothermia); and (2) systemic metabolic disorders (for example disorders due to hypoxia, acidemia, drug abuse, infection, or inflammation). Thus, rhabdomyolysis is a systemic illness. The localization of a soft-tissue infection can be distinguished by systemic imaging, especially by sensitive MRI (6). In the reported cases of rhabdomyolysis, the local radiological findings are faint. In the present case, CT imaging could not detect necrotizing rhabdomyolysis.\n\nOur evaluation of the present case raised an important question: what is the microbiological mechanism underlying the development of rhabdomyolysis accompanied by systemic infection (3,7)? Bacterial rhabdomyolysis and fungal rhabdomyolysis usually develop in immunocompromised hosts. Viral myositis induces diffuse myolysis, resulting not only in rhabdomyolysis but also myocarditis. In addition, bacillus-associated myolysis can cause rhabdomyolysis. Thus, rhabdomyolysis is relatively common among patients with miscellaneous bacterial infections including, but not limited to, Legionella (4), Pneumococcal (8), and Salmonella (7). We underscore that patients these types of infectious rhabdomyolysis share the following common findings: 1) the patients were immunocompromised due to malignancy or a severe wound; 2) precedent or concomitant acute renal failure were observed in the patient's clinical course; and 3) metabolic abnormalities such as dehydration or acidemia due to single/multi-organ failure existed as the underlying pathogenesis. Thus, ischemia or hypoxia caused by systemic infection are considered to be involved in the mechanism underlying the development of rhabdomyolysis. M. morganii is rarely pathogenic in humans, but it sometimes develops into an opportunistic infection in a compromised host. Although there are no reported cases of infectious rhabdomyolysis caused by M. morganii, Arranz-Caso et al. published the first anecdotal case of pyomyositis caused by M. morganii (9). The authors noted that gram-negative bacterial pyomyositis can occur in an immunocompromised case followed by enteric organism translocation. Our case differs from this case of pyomyositis caused by M. morganii. Gram-negative bacterial infection does not favor pyomyositis, which is usually raised by gram-positive bacteria. Our case suggests that infectious rhabdomyolysis may be underdiagnosed as a comorbidity of gram-negative bacterial infections, even if the causative organism is an opportunistic pathogen such as M. morganii.\n\nRegarding myolysis/rhabdomyolysis complicated with a systemic bacterial infection and the accumulation of muscle damage is associated with both bacteremic and non-bacteremic mechanisms (7,10). The bacteremic mechanism involves direct bacterial invasion and a direct endotoxin effect. The non-bacteremic mechanism includes alterations of systemic metabolism (i.e., hypoxia, acidosis) and an intracellular metabolism in situ (e.g., disturbances of glycolysis and oxidation in muscle cells) (7). The non-bacteremic mechanism of rhabdomyolysis accompanied by systemic infection is similar, regardless of the pathogen that is involved (3,7). The common mechanisms underlying muscle damage arise from a combination of hypoxia, dehydration, and acidemia in the tissue (4).\n\nIn general, rhabdomyolysis develops during the course of systemic infection in up to 5% of bacterial and viral cases (7). Rhabdomyolysis is a specific term describing the excess leakage of enzymes derived from muscular tissue, which can result in multi-organ failure. In our patient, the apparent infection focus was not identified by repeated systemic CT. This negative finding caused a delay in our differentiation of the cause of the patient's rhabdomyolysis. We treated the patient with meropenem, to which the causative pathogen, M. morganii, is sensitive; however, an adequate antimicrobial therapy cannot always rescue a patient from advanced multiple-organ deterioration. Rhabdomyolysis should thus be recognized as a more aggressive clinical situation than local myolysis, and one that requires intensive care. Furthermore, non-specific myolysis/rhabdomyolysis can occur due to any pathogen (7); thus, it may be underdiagnosed during the infection. Myalgia and scant laboratory signs of myolysis/rhabdomyolysis (usually appearing as liver damage in laboratory data) can be misdiagnosed in patients with the overlapping leakage of transaminases due to various etiologies. Clinicians should keep in mind that abnormal liver function test results may be linked to a muscular problem.\n\nClinicians should be aware of the possibility of systemic infection-associated myolysis/rhabdomyolysis and closely observe immunocompromised patients. This is the first report of lethal rhabdomyolysis caused by M. morganii as a complication in a non-HIV patient.\n\nShort description: Fatal rhabdomyolysis caused by M. morganii can occur in a multiple myeloma patient without HIV. (94/100 characters)\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. Christin L , Sarosi GA \nPyomyositis in North America: case reports and review . Clin Infect Dis \n15 : 668 -677 , 1992 .1420680 \n2. Johansson L , Thulin P , Low DE , Norrby-Teglund A \nGetting under the skin: the immunopathogenesis of Streptococcus pyogenes deep tissue infections . Clin Infect Dis \n51 : 58 -65 , 2010 .20491545 \n3. Singh U , Scheld WM \nInfectious etiologies of rhabdomyolysis: three case reports and review . Clin Infect Dis \n22 : 642 -649 , 1996 .8729203 \n4. el-Nahas AM , Farrington K , Quyyumi S , Moorhead JF , Sweny P \nRhabdomyolysis and systemic infection . Br Med J (Clin Res Ed) \n286 : 349 -350 , 1983 .\n5. Gabow PA , Kaehny WD , Kelleher SP \nThe spectrum of rhabdomyolysis . Medicine (Baltimore) \n61 : 141 -152 , 1982 .7078398 \n6. Yu JS , Habib P \nMR imaging of urgent inflammatory and infectious conditions affecting the soft tissues of the musculoskeletal system . Emerg Radiol \n16 : 267 -276 , 2009 .19132424 \n7. Neau D , Delmas Y , Merville P , et al \nRhabdomyolysis and Salmonella enteritidis infection . Eur J Clin Microbiol Infect Dis \n19 : 973 -975 , 2000 .11205642 \n8. Marino PL , Nahass GT , Novick W \nBacteremic pneumococcal pneumonia and myoglobinuric renal failure . Am J Med \n80 : 521 -522 , 1986 .3953629 \n9. Arranz-Caso JA , Cuadrado-Gomez LM , Romanik-Cabrera J , García-Tena J \nPyomyositis caused by Morganella morganii in a patient with AIDS . Clin Infect Dis \n22 : 372 -373 , 1996 .8838200 \n10. Brncic N , Viskovic I , Sasso A , Kraus I , Zamolo G \nSalmonella infection-associated acute rhabdomyolysis . Some pathogenic considerations. Arch Med Res \n33 : 313 -315 , 2002 .12031641\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "56(3)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D004756:Enterobacteriaceae Infections; D017809:Fatal Outcome; D005334:Fever; D006801:Humans; D008297:Male; D008875:Middle Aged; D020613:Morganella morganii; D009101:Multiple Myeloma; D012206:Rhabdomyolysis; D018805:Sepsis",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "369-371",
"pmc": null,
"pmid": "28154285",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12031641;6402094;8838200;7078398;1420680;3953629;11205642;20491545;19132424;8729203",
"title": "Fatal Rhabdomyolysis Caused by Morganella morganii in a Patient with Multiple Myeloma.",
"title_normalized": "fatal rhabdomyolysis caused by morganella morganii in a patient with multiple myeloma"
} | [
{
"companynumb": "JP-CELGENEUS-JPN-2017027979",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LENALIDOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "A capillary hemangioma is a vascular tumor with small capillary sized vascular channel. Multiple capillary hemangioma in relation with drugs have been rarely reported. Here in, we report a case of multiple capillary hemangioma in patient diagnosed with chronic myeloid leukemia who received tyrosine kinase inhibitors (TKIs). Histopathological findings have shown capillary proliferation in the upper dermis, which is consistent with capillary hemangioma. Since TKIs can paradoxically activate the MEK/ERK pathway which is required for angiogenesis, we presumed that the lesions as the cutaneous side effects of TKIs.",
"affiliations": "Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.;Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.",
"authors": "Byun|Hyun Jeong|HJ|https://orcid.org/0000-0002-4354-5655;Jang|Donghwi|D|https://orcid.org/0000-0002-3495-4772;Lee|Jongeun|J|https://orcid.org/0000-0002-1999-9948;Oh|Se Jin|SJ|https://orcid.org/0000-0001-7525-4740;Lim|Youngkyoung|Y|https://orcid.org/0000-0002-6409-2704;Park|Ji-Hye|JH|https://orcid.org/0000-0002-6699-5202;Lee|Jong Hee|JH|https://orcid.org/0000-0001-8536-1179;Lee|Dong-Youn|DY|https://orcid.org/0000-0003-0765-9812",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.5021/ad.2021.33.3.278",
"fulltext": "\n==== Front\nAnn Dermatol\nAnn Dermatol\nAD\nAnnals of Dermatology\n1013-9087\n2005-3894\nThe Korean Dermatological Association; The Korean Society for Investigative Dermatology\n\n10.5021/ad.2021.33.3.278\nCase Report\nA Case Report of Multiple Capillary Hemangioma in a Chronic Myeloid Leukemia Patient Taking Tyrosine Kinase Inhibitors\nhttps://orcid.org/0000-0002-4354-5655\nByun Hyun Jeong\nhttps://orcid.org/0000-0002-3495-4772\nJang Donghwi\nhttps://orcid.org/0000-0002-1999-9948\nLee Jongeun\nhttps://orcid.org/0000-0001-7525-4740\nOh Se Jin\nhttps://orcid.org/0000-0002-6409-2704\nLim Youngkyoung\nhttps://orcid.org/0000-0002-6699-5202\nPark Ji-Hye\nhttps://orcid.org/0000-0001-8536-1179\nLee Jong Hee\nhttps://orcid.org/0000-0003-0765-9812\nLee Dong-Youn\nDepartment of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.\nCorresponding author: Ji-Hye Park, Department of Dermatology, Samsung Medical Center, Sungkyunkwan University School of Medicine, 81 Irwon-ro, Gangnam-gu, Seoul 06351, Korea. Tel: 82-2-3410-6578, Fax: 82-2-3410-3869, jh1204.park@samsung.com\n6 2021\n04 5 2021\n33 3 278280\n22 11 2019\n07 1 2020\n01 2 2020\nCopyright © 2021 The Korean Dermatological Association and The Korean Society for Investigative Dermatology\n2021\nThe Korean Dermatological Association and The Korean Society for Investigative Dermatology\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.\nA capillary hemangioma is a vascular tumor with small capillary sized vascular channel. Multiple capillary hemangioma in relation with drugs have been rarely reported. Here in, we report a case of multiple capillary hemangioma in patient diagnosed with chronic myeloid leukemia who received tyrosine kinase inhibitors (TKIs). Histopathological findings have shown capillary proliferation in the upper dermis, which is consistent with capillary hemangioma. Since TKIs can paradoxically activate the MEK/ERK pathway which is required for angiogenesis, we presumed that the lesions as the cutaneous side effects of TKIs.\n\nCapillary hemangioma\nChronic myeloid leukemia\nDasatinib\nImatinib\nNilotinib\n==== Body\nINTRODUCTION\n\nHemangioma is a benign blood containing vascular tumor that shows proliferation of the endothelial cells1. Depending on the size of the vascular channel, a tumor with small capillary sized vascular channel is classified as a capillary hemangioma1. A capillary hemangioma is primarily papular or nodular in shape, and multiple capillary hemangioma in relation with drugs have rarely been reported2. In the present case, we report multiple capillary hemangioma developed after taking bcr-abl tyrosine kinase inhibitors (TKIs).\n\nCASE REPORT\n\nA 57-year-old male presented with multiple erythematous papules and plaques on the trunk, which developed two months ago. Ten months ago, he was diagnosed with bcr-abl positive chronic myeloid leukemia (CML) and was treated with nilotinib (300 mg twice daily for 7 weeks), a bcr-abl TKI. Seven weeks later, nilotinib was changed to dasatinib, an inhibitor of bcr-abl kinase and SrC family kinase, due to the exfoliative skin rash. Dasatinib was administered 50 mg once daily for 10 weeks. Dasatinib treatment was then interrupted because of neutropenia for a month, and then treatment was restarted with imatinib mesylate, which binds to an ATP-binding site on bcr-abl, KIT, and platelet-derived growth factor receptors3. Imatinib mesylate was administered 100 mg once daily for two weeks. Multiple erythematous papules and plaques were found by the time around the start of imatinib treatment. Physical examination revealed approximately 75 erythematous to violaceous round or rod-shaped papules or plaques mainly on the anterior and lateral trunk (Fig. 1). We received the patient's consent form about publishing all photographic materials. According to the patient, the lesions grew bigger over time, with no specific symptoms. The lesions were not in the typical nodular shape, but rather rod like, and that made us suspect the lesions as scars. However, the fact that multiple lesions developed without trauma was inconsistent with the clinical manifestations of scars. Therefore, biopsy was performed for accurate diagnosis. Skin biopsy was done for the erythematous plaque on the chest. The biopsy revealed capillary proliferation in the upper dermis, which is consistent with capillary hemangioma (Fig. 2). No other capillary hemangioma were found in the abdomen and pelvic computed tomography scan. The cutaneous lesions were gradually improved without any special treatment.\n\nDISCUSSION\n\nThe cutaneous side effects of TKIs include superficial edema, maculopapular eruptions, and pigmentary changes etc4. Also, few cases of capillary proliferative lesions caused by these drugs have been reported. A case of scrotal hemangioma developed after taking sunitinib5, and a case of periungual pyogenic granuloma following imatinib administration6 had been reported. In the present case, multiple capillary hemangioma, which had never occurred before, developed after taking TKIs. As the lesions began to develop after taking TKIs, cutaneous side effects of the drugs were suspected. We suspect that the TKIs caused paradoxical angiogenesis. Nilotinib, dasatinib, and imatinib are all drugs with anti-angiogenic effect, which are usually used as a treatment for angiogenic CML cells78. They are known to reduce angiogenic factors such as vascular endothelial growth factor in CML patients7. However, it is reported that TKIs can paradoxically activate the MEK/ERK pathway, which is required for angiogeneseis9. In an experiment that studied whether various protein kinase inhibitors affected MEK/ERK pathways, the authors found that imatinib, nilotinib, dasatinib paradoxically stimulated MEK/ERK phosphorylation10. Since Raf-MEK-ERK signal transduction pathway is required for angiogenesis11, we could consider the possibility that such mechanism have induced paradoxic angiogenesis, causing multiple capillary hemangioma. As a similar case, previous literature has reported an occurrence of Kaposi sarcoma following an imatinib mesylate administration in a CML patient12. The mechanism underlying the development of Kaposi sarcoma was not clear. However, according to the adverse drug reaction probability scale, the score estimated that the development of Kaposi sarcoma was probably associated with the imatinib treatment12. In the present case, Kaposi sarcoma could be excluded, because only the capillary proliferation in the upper dermis was observed in the biopsy, and no tissue findings that would suspect Kaposi sarcoma such as slit like vascular space, and proliferating spindle cells were found. In addition to TKIs, factors that may have caused hemangioma in this case include history of exfoliative dermatitis and leukemia. We cannot exclude these factors, because there was a case report of multiple hemangioma in relation with exfoliative dermatitis, and another report with underlying leukemia1314. These reports however, did not clarify the mechanism of development of hemangioma by the underlying diseases. The lesions developed after the administration of TKIs, and they gradually improved after drug discontinuation. Considering this temporal relationship, it is reasonable to consider the possibility that the secondary neoplasms were caused by TKIs. To the best of our knowledge, this is the first case to report of multiple hemangioma occurred after the use of TKIs. It is meaningful that we added possible cutaneous side effects of TKIs.\n\nDATA SHARING STATEMENT\n\nResearch data are not shared.\n\nFig. 1 (A, B) Multiple round or rod-shaped erythematous papules and plaques on the trunk.\n\nFig. 2 (A) Diffuse capillary proliferation in the upper dermis, and vascular dilatation involving middermis (H&E, ×40). (B) Capillary proliferation involving the upper dermis (H&E, ×200).\n\nCONFLICTS OF INTEREST: The authors have nothing to disclose.\n\nFUNDING SOURCE: None.\n==== Refs\n1 George A Mani V Noufal A Update on the classification of hemangioma J Oral Maxillofac Pathol 2014 18 Suppl 1 S117 S120 25364160\n2 Usui S Kogame T Shibuya M Okamoto N Toichi E Case of multiple disseminated cutaneous lobular capillary hemangioma that developed while taking oral contraceptive pills J Dermatol 2019 46 e202 e203 30628110\n3 Ciarcia R Damiano S Puzio MV Montagnaro S Pagnini F Pacilio C Comparison of dasatinib, nilotinib, and imatinib in the treatment of chronic myeloid leukemia J Cell Physiol 2016 231 680 687 26235483\n4 Lee WJ Lee JH Won CH Chang SE Choi JH Moon KC Clinical and histopathologic analysis of 46 cases of cutaneous adverse reactions to imatinib Int J Dermatol 2016 55 e268 e274 26680344\n5 Tonini G Intagliata S Cagli B Segreto F Perrone G Onetti Muda A Recurrent scrotal hemangiomas during treatment with sunitinib J Clin Oncol 2010 28 e737 e738 20823408\n6 Dika E Barisani A Vaccari S Fanti PA Ismaili A Patrizi A Periungual pyogenic granuloma following imatinib therapy in a patient with chronic myelogenous leukemia J Drugs Dermatol 2013 12 512 513 23652942\n7 Yıldırım R Sincan G Pala Ç Düdükcü M Kaynar L Urlu SM Effects of Imatinib, Nilotinib, Dasatinib on VEGF and VEGFR-1 levels in patients with chronic myelogenous leukemia Eur J Gen Med 2016 13 111 115\n8 Pandey N Yadav G Kushwaha R Verma SP Singh US Kumar A Effect of imatinib on bone marrow morphology and angiogenesis in chronic myeloid leukemia Adv Hematol 2019 2019 1835091 30713559\n9 Greuber EK Smith-Pearson P Wang J Pendergast AM Role of ABL family kinases in cancer: from leukaemia to solid tumours Nat Rev Cancer 2013 13 559 571 23842646\n10 Packer LM Rana S Hayward R O'Hare T Eide CA Rebocho A Nilotinib and MEK inhibitors induce synthetic lethality through paradoxical activation of RAF in drug-resistant chronic myeloid leukemia Cancer Cell 2011 20 715 727 22169110\n11 Murphy DA Makonnen S Lassoued W Feldman MD Carter C Lee WM Inhibition of tumor endothelial ERK activation, angiogenesis, and tumor growth by sorafenib (BAY43-9006) Am J Pathol 2006 169 1875 1885 17071608\n12 Campione E Diluvio L Paternò EJ Di Marcantonio D Francesconi A Terrinoni A Kaposi's sarcoma in a patient treated with imatinib mesylate for chronic myeloid leukemia Clin Ther 2009 31 2565 2569 20110001\n13 Torres JE Sánchez JL Disseminated pyogenic granuloma developing after an exfoliative dermatitis J Am Acad Dermatol 1995 32 2 Pt 1 280 282 7829717\n14 Pembroke AC Grice K Levantine AV Warin AP Eruptive angiomata in malignant disease Clin Exp Dermatol 1978 3 147 156 699367\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1013-9087",
"issue": "33(3)",
"journal": "Annals of dermatology",
"keywords": "Capillary hemangioma; Chronic myeloid leukemia; Dasatinib; Imatinib; Nilotinib",
"medline_ta": "Ann Dermatol",
"mesh_terms": null,
"nlm_unique_id": "8916577",
"other_id": null,
"pages": "278-280",
"pmc": null,
"pmid": "34079189",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports",
"references": "22169110;17071608;23842646;23652942;699367;20110001;25364160;26680344;20823408;7829717;30713559;26235483;30628110",
"title": "A Case Report of Multiple Capillary Hemangioma in a Chronic Myeloid Leukemia Patient Taking Tyrosine Kinase Inhibitors.",
"title_normalized": "a case report of multiple capillary hemangioma in a chronic myeloid leukemia patient taking tyrosine kinase inhibitors"
} | [
{
"companynumb": "KR-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-314627",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DASATINIB"
},
"druga... |
{
"abstract": "BACKGROUND\nLarge-cell neuroendocrine carcinoma (LCNEC) of the lung is a rare tumor with an aggressive clinical course. However, there is limited knowledge of its treatment strategy. This retrospective study aimed to assess the efficacy and safety of anti-programed death-1 (PD-1) blockade monotherapy in previously treated advanced LCNEC.\n\n\nMETHODS\nEleven patients with previously treated advanced LCNEC who received immune checkpoint inhibitor monotherapy between January 2015 and November 2020 were retrospectively analyzed for efficacy and safety.\n\n\nRESULTS\nOf a total of 11 patients (median [range] age, 66 [37-79] years; 8 men [73%] and 3 women [27%]), 8 patients had performance status (PS) 0-1 [73%] and 3 patients had PS 2 [27%]; 9 patients received 1 prior chemotherapy [82%] and 2 patients received 2 prior chemotherapies [18%]. The median follow-up duration was 4.6 months. Although PD-1 blockade was administered at median cycles of 3 (range, 1-12), overall response rate, median progression-free survival, and median overall survival were 9.1%, 2.7 months, and 4.6 months, respectively. Any adverse events were observed in 9 patients (82%), including 1 patient with grade 3 pneumonitis as a serious adverse event.\n\n\nCONCLUSIONS\nAnti-PD-1 blockade monotherapy as a subsequent line for previously treated advanced LCNEC exhibited usefulness and tolerability and was identified as a valid treatment option.",
"affiliations": "Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.;Division of Respiratory Medicine, Gunma Prefectural Cancer Center, Ota, Japan.;Department of Respiratory Medicine, Comprehensive Cancer Center, Saitama Medical University International Medical Center, Kawagoe, Japan.",
"authors": "Naganuma|Ken|K|;Imai|Hisao|H|;Yamaguchi|Ou|O|;Hashimoto|Kosuke|K|;Akagami|Tomoe|T|;Shinomiya|Shun|S|;Miura|Yu|Y|;Shiono|Ayako|A|;Mouri|Atsuto|A|;Kaira|Kyoichi|K|;Kobayashi|Kunihiko|K|;Minato|Koichi|K|;Kagamu|Hiroshi|H|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C105992:PDCD1 protein, human; D061026:Programmed Cell Death 1 Receptor",
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000514841",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0009-3157",
"issue": "66(3)",
"journal": "Chemotherapy",
"keywords": "Efficacy; Immune checkpoint inhibitor; Large-cell neuroendocrine carcinoma; PD-1 blockade; Safety",
"medline_ta": "Chemotherapy",
"mesh_terms": "D000328:Adult; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D018287:Carcinoma, Large Cell; D018278:Carcinoma, Neuroendocrine; D005260:Female; D006801:Humans; D053208:Kaplan-Meier Estimate; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D011014:Pneumonia; D061026:Programmed Cell Death 1 Receptor; D000077982:Progression-Free Survival; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "0144731",
"other_id": null,
"pages": "65-71",
"pmc": null,
"pmid": "33827084",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Efficacy and Safety of Anti-Programed Death-1 Blockade in Previously Treated Large-Cell Neuroendocrine Carcinoma.",
"title_normalized": "efficacy and safety of anti programed death 1 blockade in previously treated large cell neuroendocrine carcinoma"
} | [
{
"companynumb": "JP-ROCHE-2942483",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ATEZOLIZUMAB"
},
"drugadditional": "3",
"dru... |
{
"abstract": "OBJECTIVE\nTo describe a case of extranodal marginal zone B-cell lymphoma (EMZL) \"mucosa associated lymphoid tissue (MALT)\" of the orbit that presented with stage IV disease in a patient with sarcoidosis.\n\n\nMETHODS\nClinicopathologic case report.\n\n\nMETHODS\nBiopsies of the lesion were performed in the operating room and the samples were submitted for pathology processing. Pathology analysis identified the lesion as an extranodal marginal zone B-cell lymphoma \"mucosa associated lymphoid tissue (MALT)\" via flow cytometry, histopathology, cytogenetics, and immunohistochemical staining and fluorescent in situ hybridization (FISH). The institutional review board of Howard University Hospital waived the need for IRB approval for this intraoperative finding.\n\n\nRESULTS\nA 70-year-old Black woman with biopsy-proven sarcoidosis presented complaining of foreign body sensation, redness, swelling of her left upper eyelid and tearing. The patient was found to have an orbital lymphoproliferative malignancy.\n\n\nCONCLUSIONS\nIt is still unclear if the presence of immunosuppression or an autoimmune disease increases the risk of lymphoproliferative malignancies {6}. Malignancy should always be suspected and investigated.",
"affiliations": "Howard University Hospital - Department of Ophthalmology 2041 Georgia Ave., N.W. nrichards101521@gmail.com.",
"authors": "Richards|Nikisha Q|NQ|;Kidwell|Earl D R|ED|;Ramadan|Ali M|AM|;Naab|Tammey J|TJ|",
"chemical_list": "D014408:Biomarkers, Tumor; D007166:Immunosuppressive Agents",
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1124-0490",
"issue": "31(3)",
"journal": "Sarcoidosis, vasculitis, and diffuse lung diseases : official journal of WASOG",
"keywords": null,
"medline_ta": "Sarcoidosis Vasc Diffuse Lung Dis",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D001706:Biopsy; D005260:Female; D006801:Humans; D007150:Immunohistochemistry; D007166:Immunosuppressive Agents; D018442:Lymphoma, B-Cell, Marginal Zone; D009367:Neoplasm Staging; D009918:Orbital Neoplasms; D012507:Sarcoidosis; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "9610928",
"other_id": null,
"pages": "252-5",
"pmc": null,
"pmid": "25363228",
"pubdate": "2014-10-20",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Extranodal marginal zone B cell lymphoma of the orbit in a patient with sarcoidosis: a case report.",
"title_normalized": "extranodal marginal zone b cell lymphoma of the orbit in a patient with sarcoidosis a case report"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2015US-109169",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drug... |
{
"abstract": "BACKGROUND\nManagement of generalized granuloma annulare (GGA) poses challenges for both patients and dermatologists. Currently, there are no established first-line therapies for GGA and the available therapeutic modalities are based on individual case reports and a few small case series. Further, there are limited publications assessing the efficacy of methotrexate in treating GGA.\n\n\nOBJECTIVE\nTo evaluate the efficacy and adverse effects associated with methotrexate treatment of GGA.\n\n\nMETHODS\nDescriptive retrospective case series of 11 patients with GGA receiving methotrexate.\n\n\nRESULTS\nSixty four percent of patients receiving methotrexate noted improvement of their skin disease, of which 43% achieved complete clearance and 57% partial clearance. Initial dose of methotrexate ranged from 12.5 to 15 mg weekly, administered either orally or subcutaneously. The majority of patients tolerated the treatment well. However, 18% of patients experienced the adverse effects of either GI upset or hair loss.\n\n\nCONCLUSIONS\nThis case series lacks a control group and therefore has low internal validity. The lack of a disease severity and therapy responsiveness measurement tool made quantifying disease improvement inexact.\n\n\nCONCLUSIONS\nMethotrexate can be a successful and well-tolerated treatment option for patients with generalized GA.",
"affiliations": "a University of Connecticut School of Medicine , Farmington , CT , USA.;b UConn Health Department of Dermatology , Farmington , CT , USA.",
"authors": "Naka|Fludiona|F|;Strober|Bruce E|BE|",
"chemical_list": "D008727:Methotrexate",
"country": "England",
"delete": false,
"doi": "10.1080/09546634.2018.1447075",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0954-6634",
"issue": "29(7)",
"journal": "The Journal of dermatological treatment",
"keywords": "Methotrexate; case series; generalized granuloma annulare; treatment-refractory",
"medline_ta": "J Dermatolog Treat",
"mesh_terms": "D000368:Aged; D000505:Alopecia; D003924:Diabetes Mellitus, Type 2; D005260:Female; D005767:Gastrointestinal Diseases; D016460:Granuloma Annulare; D006801:Humans; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D012189:Retrospective Studies; D013959:Thyroid Diseases; D016896:Treatment Outcome",
"nlm_unique_id": "8918133",
"other_id": null,
"pages": "720-724",
"pmc": null,
"pmid": "29488435",
"pubdate": "2018-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Methotrexate treatment of generalized granuloma annulare: a retrospective case series.",
"title_normalized": "methotrexate treatment of generalized granuloma annulare a retrospective case series"
} | [
{
"companynumb": "US-TEVA-2018-US-966615",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "Acute myeloid leukemia (AML) in older patients presents a notable therapeutic challenge to the clinical hematologist. The clinical biology of AML among patients is highly heterogeneous. Interpatient variations are relevant for prognosis and treatment choice. Outcome of treatment for patients of advanced age is often compromised by comorbid conditions and an enhanced susceptibility to toxicities from therapy. Here we present selected clinical vignettes that highlight distinct representative situations derived from clinical practice. The vignettes are specifically discussed in light of the perspective of treating older patients with leukemia. We review the clinical significance of various cytogenetic and molecular features of the disease, and we examine the various currently available treatment options as well as the emerging prognostic algorithms that may offer guidance in regard to personalized therapy recommendations. The dilemmas in tailoring treatment selection in this category of patients with AML are the central theme in this discussion.",
"affiliations": "Department of Hematology, VU University Medical Center, Amsterdam and Department of Hematology, Erasmus University Medical Center, Rotterdam, The Netherlands.;Department of Hematology, VU University Medical Center, Amsterdam and Department of Hematology, Erasmus University Medical Center, Rotterdam, The Netherlands.",
"authors": "Ossenkoppele|Gert|G|;Löwenberg|Bob|B|",
"chemical_list": "D000077209:Decitabine; D001374:Azacitidine",
"country": "United States",
"delete": false,
"doi": "10.1182/blood-2014-08-551499",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0006-4971",
"issue": "125(5)",
"journal": "Blood",
"keywords": null,
"medline_ta": "Blood",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001374:Azacitidine; D002986:Clinical Trials as Topic; D020732:Cytogenetic Analysis; D000077209:Decitabine; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D008297:Male; D058990:Molecular Targeted Therapy; D057285:Precision Medicine; D011379:Prognosis; D016019:Survival Analysis; D016896:Treatment Outcome",
"nlm_unique_id": "7603509",
"other_id": null,
"pages": "767-74",
"pmc": null,
"pmid": "25515963",
"pubdate": "2015-01-29",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "How I treat the older patient with acute myeloid leukemia.",
"title_normalized": "how i treat the older patient with acute myeloid leukemia"
} | [
{
"companynumb": "NL-CELGENE-NLD-2015024701",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AZACITIDINE"
},
"drugadditional": null,
... |
{
"abstract": "Dabigatran is a non-vitamin K antagonist oral anticoagulant that has been approved for atrial fibrillation and prevention of venous thromboembolism. Its use has been increasing in the USA since serum drug levels do not need monitoring. To date, no significant skin side effects have been reported other than 4 cases of non-specific skin lesion and 2 cases of leukocytoclastic vasculitis (LCV), which is a small vessel inflammatory disease that presents as palpable purpura in lower extremities. We present a man aged 57 years with chronic deep vein thrombosis who developed palpable purpura, petechiae, swelling in lower extremities, torso and distal upper extremities on the third day after dabigatran initiation. The present case highlights the potential risk for LCV with dabigatran use and provides insight into its management.",
"affiliations": "Department of Internal Medicine, University of Iowa Hospitals and Clinics, Iowa City, Iowa, USA.;Department of Internal Medicine, University of Iowa Hospitals and Clinics, Iowa City, Iowa, USA.;Department of Dermatology, University of Iowa Hospitals and Clinics, Iowa City, Iowa, USA.;Department of Internal Medicine, University of Iowa Hospitals and Clinics, Iowa City, Iowa, USA.",
"authors": "An|Josiah|J|;Garje|Rohan|R|;Wanat|Karolyn A|KA|;Leone|José Pablo|JP|",
"chemical_list": "D000991:Antithrombins; D000069604:Dabigatran",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2016-217423",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2017()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000991:Antithrombins; D000069604:Dabigatran; D003937:Diagnosis, Differential; D006801:Humans; D008297:Male; D008875:Middle Aged; D018366:Vasculitis, Leukocytoclastic, Cutaneous; D020246:Venous Thrombosis",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "28052946",
"pubdate": "2017-01-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12637912;134676;19696042;21817079;21817082;21881034;21946939;23400964;2390119;25317789;26843867;27274551;9810883",
"title": "Dabigatran-related leukocytoclastic vasculitis.",
"title_normalized": "dabigatran related leukocytoclastic vasculitis"
} | [
{
"companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-001512",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "OBJECTIVE\nTo retrospectively evaluate the efficacy and safety of rituximab (Rtx) treatment in patients with anti-synthetase syndrome (ASS) and severe interstitial lung disease (ILD).\n\n\nMETHODS\nPatients with severe ILD and >12 months follow-up post-Rtx were identified from the Oslo University Hospital ASS cohort (n = 112). Clinical data, including pulmonary function tests (PFTs), were retrospectively collected from medical reports. Extent of ILD pre-, and post-Rtx was scored on thin-section high-resolution CT (HRCT) images and expressed as a percentage of total lung volume. Muscle strength was evaluated by manual muscle testing of eight muscle groups (MMT8).\n\n\nRESULTS\nAltogether, 34/112 ASS patients had received Rtx; 24/34 had severe ILD and >12 months follow-up post-Rtx (median 52 months). In these 24 patients, the median percentage of predicted forced vital capacity, forced expiratory volume in 1 s (FEV1) and diffusing capacity of the lungs for carbon monoxide (DLCO) increased by 24%, 22% and 17%, respectively, post-Rtx. Seven patients (all with disease duration <12 months and/or acute onset/exacerbation of ILD) had >30% improvement in all three PFTs. HRCT analysis showed a median 34% reduction in ILD extent post-Rtx. MMT8 score increased post-Rtx. During follow-up, 7/34 (21%) Rtx-treated ASS patients died; 6/7 deaths were related to infections. The mortality rate in the Rtx-treated group was comparable to that of the remaining ASS cohort (25/78 deceased; 32%).\n\n\nCONCLUSIONS\nThis study, which included 24 Rtx-treated ASS patients with severe ILD, reports improved PFTs after a median 52 months follow-up post-Rtx. The best outcome was observed in patients with a disease duration <12 months and/or acute onset/exacerbation of ILD. The study indicates that Rtx could be a treatment option for selected ASS patients, but infections should be given attention.",
"affiliations": "Institute of Clinical Medicine, Department of Rheumatology, helena.andersson@medisin.uio.no.;Department of Rheumatology.;Department of Respiratory Medicine.;Department of Radiology and.;Department of Radiology and.;Department of Orthopaedic Surgery, Oslo University Hospital, Oslo, Norway.;Department of Rheumatology.;Institute of Clinical Medicine, Department of Rheumatology.",
"authors": "Andersson|Helena|H|;Sem|Marthe|M|;Lund|May Brit|MB|;Aaløkken|Trond Mogens|TM|;Günther|Anne|A|;Walle-Hansen|Ragnhild|R|;Garen|Torhild|T|;Molberg|Øyvind|Ø|",
"chemical_list": "D058846:Antibodies, Monoclonal, Murine-Derived; D018501:Antirheumatic Agents; D000069283:Rituximab",
"country": "England",
"delete": false,
"doi": "10.1093/rheumatology/kev004",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1462-0324",
"issue": "54(8)",
"journal": "Rheumatology (Oxford, England)",
"keywords": "anti-Jo1; anti-aminoacyl tRNA synthetase; anti-synthetase syndrome; interstitial lung disease; myositis; rituximab",
"medline_ta": "Rheumatology (Oxford)",
"mesh_terms": "D000328:Adult; D000368:Aged; D058846:Antibodies, Monoclonal, Murine-Derived; D018501:Antirheumatic Agents; D015331:Cohort Studies; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D008137:Longitudinal Studies; D008168:Lung; D017563:Lung Diseases, Interstitial; D008297:Male; D008875:Middle Aged; D053580:Muscle Strength; D009220:Myositis; D012129:Respiratory Function Tests; D012189:Retrospective Studies; D000069283:Rituximab; D012720:Severity of Illness Index; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome",
"nlm_unique_id": "100883501",
"other_id": null,
"pages": "1420-8",
"pmc": null,
"pmid": "25740830",
"pubdate": "2015-08",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Long-term experience with rituximab in anti-synthetase syndrome-related interstitial lung disease.",
"title_normalized": "long term experience with rituximab in anti synthetase syndrome related interstitial lung disease"
} | [
{
"companynumb": "NO-ACCORD-033830",
"fulfillexpeditecriteria": "1",
"occurcountry": "NO",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND Primary neuroendocrine tumors (NETs) in the retroperitoneal space are extremely rare. We report the case of a patient diagnosed with primary presacral NET in the retroperitoneum that was initially suspected to be hepatic metastasis, who was followed up for more than 8 years. CASE REPORT A 78-year-old man was referred to our hospital for the treatment of a hepatic mass. Following resection, the patient was diagnosed with a grade 2 well-differentiated NET. A thorough evaluation to identify the primary tumor detected small well-demarcated presacral nodules on In-111 octreotide single-photon emission tomography/computed tomography (SPECT/CT). Metastases to other locations were not observed. Presacral nodules were difficult to remove using the surgical approach; therefore, we decided to follow up closely. After 4 years, the patient was diagnosed with recurrent hepatic metastasis and peritoneal seeding. Although combination therapy of everolimus and octreotide long-acting repeatable was administered, it was discontinued owing to disease progression. Baseline Ga-68 DOTATOC positron emission tomography-computed tomography revealed adequate avidity for the lesions observed on SPECT/CT; therefore, 5 cycles of peptide receptor radionuclide therapy (PRRT) were administered, after which stable disease was maintained. CONCLUSIONS We identified an extremely rare primary retroperitoneal NET on In-111 octreotide SPECT/CT. During long-term follow-up, although the patient presented with recurrent hepatic metastases and peritoneal seeding, PRRT was successful in stabilizing the disease.",
"affiliations": "Department of Otorhinolaryngology - Head and Neck Surgery, Haeundae Paik Hospital, Inje University College of Medicine, Busan, South Korea.;Department of Nuclear Medicine, Haeundae Paik Hospital, Inje University College of Medicine, Busan, South Korea.",
"authors": "Kim|Mi Ra|MR|;Shim|Hye-Kyung|HK|",
"chemical_list": "D019275:Radiopharmaceuticals; C094279:indium-111-octreotide; D015282:Octreotide",
"country": "United States",
"delete": false,
"doi": "10.12659/AJCR.921439",
"fulltext": "\n==== Front\nAm J Case RepAm J Case RepamjcaserepThe American Journal of Case Reports1941-5923International Scientific Literature, Inc. 3188904610.12659/AJCR.921439921439ArticlesLong-Term Follow-Up of a Patient with Primary Presacral Neuroendocrine Tumor: A Case Report with Literature Review Kim Mi Ra ABCDEF1Shim Hye-kyung ABCDEF2\n1 Department of Otorhinolaryngology – Head and Neck Surgery, Haeundae Paik Hospital, Inje University College of Medicine, Busan, South Korea\n2 Department of Nuclear Medicine, Haeundae Paik Hospital, Inje University College of Medicine, Busan, South KoreaAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\nCorresponding Author: Hye-kyung Shim, e-mail: shimhk80@naver.com2019 31 12 2019 20 1969 1975 15 11 2019 12 12 2019 © Am J Case Rep, 20192019This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Patient: Male, 78-year-old\n\nFinal Diagnosis: Presacral neuroendocrine tumors\n\nSymptoms: Asymptomatic\n\nMedication: —\n\nClinical Procedure: Peptide receptor radionuclide therapy\n\nSpecialty: Nuclear Medicine\n\nObjective:\nRare disease\n\nBackground:\nPrimary neuroendocrine tumors (NETs) in the retroperitoneal space are extremely rare. We report the case of a patient diagnosed with primary presacral NET in the retroperitoneum that was initially suspected to be hepatic metastasis, who was followed up for more than 8 years.\n\nCase Report:\nA 78-year-old man was referred to our hospital for the treatment of a hepatic mass. Following resection, the patient was diagnosed with a grade 2 well-differentiated NET. A thorough evaluation to identify the primary tumor detected small well-demarcated presacral nodules on In-111 octreotide single-photon emission tomography/computed tomography (SPECT/CT). Metastases to other locations were not observed. Presacral nodules were difficult to remove using the surgical approach; therefore, we decided to follow up closely. After 4 years, the patient was diagnosed with recurrent hepatic metastasis and peritoneal seeding. Although combination therapy of everolimus and octreotide long-acting repeatable was administered, it was discontinued owing to disease progression. Baseline Ga-68 DOTATOC positron emission tomography-computed tomography revealed adequate avidity for the lesions observed on SPECT/CT; therefore, 5 cycles of peptide receptor radionuclide therapy (PRRT) were administered, after which stable disease was maintained.\n\nConclusions:\nWe identified an extremely rare primary retroperitoneal NET on In-111 octreotide SPECT/CT. During long-term follow-up, although the patient presented with recurrent hepatic metastases and peritoneal seeding, PRRT was successful in stabilizing the disease.\n\nMeSH Keywords:\nDiagnostic Techniques, RadioisotopeNeuroendocrine TumorsPositron-Emission TomographyRadionuclide ImagingRetroperitoneal NeoplasmsTomography, Emission-Computed, Single-Photon\n==== Body\nBackground\nNeuroendocrine tumors (NETs) are a heterogeneous group of malignant tumors arising from enterochromaffin cells, with varying clinical manifestations. NETs can occur in almost any organ, but are mainly observed in the gastroenteropancreatic system (70%), respiratory system (25%), and other primary sites (5%) [1]. As primary NETs in the retroperitoneal space are extremely rare, preoperative diagnosis is very difficult because of the indolent tumor characteristics and complex anatomy of the location in which the tumors occur [2]. Presacral well-differentiated NETs (WDNETs) in the retroperitoneum can occur directly or owing to metastasis from rectal carcinoids [2] or from primary presacral neoplasms. Small primary NETs are known to cause large hepatic metastases [3,4]. However, metastatic NETs are often observed in the liver, because the entire systemic blood supply passes through the liver, making it a prime target for metastatic disease [5].\n\nThe 2017 World Health Organization (WHO) classification divides neuroendocrine neoplasms (NENs) into 2 different groups: well-differentiated, low-proliferating NENs such as NETs or carcinoids); and poorly differentiated, highly proliferating NENs such as small- or large-cell neuroendocrine carcinomas (NECs) [1,6]. This classification, which is critical for assessing the tumor grade and the possible disease prognosis [7], is based on the histologic grade of the tumor considering the mitotic count and Ki-67 labeling index. When the Ki-67 index is low (<3%) and the mitotic count is <2 per 10 high-power fields (HPFs), the tumor is classified as a G1 NET. For G2 NETs, the Ki-67 index is 3–20% and the mitotic count is 2–20 per 10 HPFs. G3 NETs have a Ki-67 index >20% and a mitotic count of >20 per 10 HPFs [6]. The staging system for NENs has not yet been well-established. Herein, on the basis of this classification, we report a case of a G2 WDNET with hepatic metastasis arising from the presacral space, along with a literature review.\n\nCase Report\nA 78-year-old man was referred to our hospital for treatment of a left liver mass that was suspected to be a carcinoma, mostly hepatocellular carcinoma, after histological examination at another hospital. He was undergoing treatment for diabetes, which was well controlled, and had no history of smoking or consumption of alcohol. He also had no history of liver disease, including hepatitis and cirrhosis. Physical examination findings were unremarkable. The results of laboratory tests were within normal limits, including the levels of tumor markers such as alpha-fetoprotein, carbohydrate antigen 19-9, protein induced by vitamin K absence or antagonist II, and carcinoembryonic antigen. Abdominopelvic computed tomography (APCT) and gadolinium-enhanced magnetic resonance (MRI) scans revealed a round heterogeneous mass measuring 3 cm in the left lobe of the liver. The patient underwent laparoscopic left lateral sectionectomy. On histopathologic examination, tumor cells with abundant cytoplasm and vesicular nuclei chromatin were observed in a trabecular pattern. Immunohistochemical (IHC) staining and molecular studies of tumor cells revealed focal positivity for chromogranin, synaptophysin, and CD56. The mitotic count was 8 per 10 HPFs and the Ki-67 index was 6.6%. Thus, according to the 2017 WHO classification, the tumor was diagnosed as a G2 WDNET. Comprehensive tests were then performed to determine the primary site and the differential diagnosis of metastatic NETs. IHC staining revealed negative results for cytokeratin 7 (CK-7), thyroid transcription factor-1 (TTF-1), and CDX2. Chest CT, F-18 fludeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT), gastroduodenoendoscopy, and colonoscopy were unable to determine the primary tumor site; however, In-111 octreotide scans revealed 2 octreotide-avid nodules in the left side of the presacral retroperitoneum (Figure 1A, 1B). Corresponding heterogeneously enhanced nodules measuring 2.1×1.7 cm and 1.0×0.9 cm were observed in the presacral area on APCT (Figure 1C). No other metastases were found, and the presacral nodules were difficult to consider for surgery; hence, we decided to follow up closely. Approximately 4 years later, there was no significant change in the presacral lesions, but multiple new lesions were observed in the liver (Figure 2A, 2B). Ultrasound-guided biopsy was performed for the new lesions in the liver, which were subsequently diagnosed as G2 WDNETs. Peritoneal seeding was confirmed on the follow-up In-111 octreotide scan (Figure 2C). Metastatic NETs including hepatic and peritoneal seeding worsened and were accompanied by intractable diarrhea. The advanced and metastatic NETs were treated using a combination therapy of octreotide long-acting repeatable (LAR) repeatedly administered intramuscularly at a dose of 20 mg and everolimus 10 mg/day, which is an oral mammalian target of rapamycin (mTOR) inhibitor. Everolimus was administered for 6 weeks, but treatment was discontinued owing to the occurrence of grade 3 stomatitis. Although a transient treatment response was observed after octreotide LAR treatment for 10 months and everolimus re-treatment for 8 weeks, the presacral mass and metastatic lesions in the liver and peritoneum showed progression on radiologic examinations. Therefore, NETs were considered to be refractory to the combination treatment with octreotide LAR and everolimus, and the treatment was discontinued. Owing to the failure of other systemic treatments, the progressive NETs were treated with pazopanib (800 mg/day, an oral multi-kinase inhibitor). Baseline Ga-68 DOTATOC PET-CT was performed before the scheduled peptide receptor radionuclide therapy (PRRT) at another hospital because PRRT is not approved in Korea (Figure 3). After 5 cycles of 8.0 GBq PRRT, Lu-177 DOTATATE performed after an 8-week interval revealed that the presacral and metastatic lesions showed no significant changes (Figure 4A, 4B). The patient was then closely followed up.\n\nDiscussion\nThis is a report of a rare primary retroperitoneal NET that initially presented as a hepatic mass that was otherwise missed on conventional imaging modalities. The presacral region in the retroperitoneum is usually a potential space and is clinically important; it is composed of complex anatomical structures, such as the axial muscles, lumbosacral nerve trunk, sacral plexus, iliac vessels, and pelvic soft tissues, as well as multiple embryological remnants [8].\n\nThe diagnosis and identification of primary hepatic NETs are difficult and controversial because of the following reasons. (1) The liver does not contain neuroendocrine cells. (2) Metastasis to the liver is the most common, irrespective of the NET grade and it is synchronous with other metastases in 45–95% of cases [7]; in addition, small primary NETs are known to cause large metastases in the liver [5]. (3) There have been no morphologic or IHC markers to definitely rule out the extra-hepatic origin [5]. (4) A thorough examination of other suspected primary sites is needed to confirm the primary site of metastases to the liver. Histopathological examinations including IHC (e.g., chromogranin A, synaptophysin, and CD56) are important for diagnosing NETs. In our case, IHC staining was performed to identify primary sites, and hepatic metastatic NETs were negative for TTF-1 (a marker for a differentiated meta-static tumor originating from the foregut NET), CK-7 (a marker for cholangiocarcinoma), and CDX2 (a highly sensitive and specific marker for adenocarcinomas of intestinal origin) [8]. No lesions were suspected to be primary NET from the stomach to the rectum on endoscopic evaluation.\n\nImaging studies play an essential role in the detection and localization of primary and/or metastatic NETs [9]. CT and/or MRI have excellent sensitivity and detection rates, both of which are approximately 80% (76–100% for CT and 67–100% for MRI), because primary and metastatic NETs are usually well enhanced after the intravenous injection of contrast agents [9]. In addition, CT is useful for the detection of primary site tumors when the location of the primary NETs is unknown, and MRI easily reveals hepatic metastasis of NETs and primary pancreatic NETs [9]. Our patient also showed no abnormal lesions on APCT and no definite space-occupying lesion in the pancreas on abdominal MRI scan. F-18 FDG PET/CT is used to detect malignant tumors among many different tumor types. Unfortunately, low-to-intermediate grade NETs are relatively metabolically inactive, while high-grade NETs demonstrate FDG avidity. The present case was a G2 WDNET; therefore, all the hepatic and retroperitoneal lesions found in our patient showed isometabolic activity, while FDG avidity was not definitely observed in the small peritoneal seedings [10].\n\nSomatostatin is an endogenous peptide secreted by neuroendocrine cells [10]. The surfaces of WDNETs show high expression of somatostatin receptors (SSRs), and the interactions between radiolabeled somatostatin analogues (SSAs) and SSRs on tumor cells make them targets for treatment and imaging [10,11]. There are 2 types of SSR-based imaging available: In-111 octreotide scan and Ga-68 DOTATOC imaging. In-111 octreotide is the first-line scintigraphic agent and is the most widely studied agent; In-111 octreotide imaging is often used in combination with SPECT/CT [10,12]. In-111 octreotide scanning has a sensitivity of less than 60%, although it has excellent specificity among functional imaging studies [11]. Nevertheless, the ability of In-111 octreotide scan to detect the primary tumor is determined by the tumor size and not the expression of SSRs [10]. Since the development of Ga-68 SSAs for PET/CT, molecular imaging studies for the detection of NET have evolved rapidly over the last 15 years [11]. The sensitivity of Ga-68 SSA PET-CT is above 90% and the specificity is 92–98%, which is better than those of CT, MRI, and In-111 octreotide scanning. Therefore, In-111 octreotide scanning is useful to detect small tumors in the lymph nodes or bones, as well as unknown primary NETs [11,13,14]. The indications for SSR-based imaging include the detection of primary NETs and their metastases, tumor staging, surveillance for recurrence, and the selection of patients for PRRT. Our patient had liver and peritoneal metastases with presacral nodules on pre-treatment Ga-68 DOTATOC PET/CT before PRRT. Using this imaging modality, the most likely primary tumor location was the presacral space based on the results of IHC staining, In-111 octreotide scan, and other conventional imaging studies. However, the primary tumor location had not been confirmed on histological examination because the possible primary NETs in the presacral area could not be excised owing to the difficulty in using the surgical approach. The tumor in the present case could not be ruled out as metastasis from a missed small primary tumor at another location. Neither biochemical nor radiologic investigations, which are commonly used for the evaluation of metastatic NETs, were useful in ruling out this possibility.\n\nPresacral NETs are usually asymptomatic and cause symptoms associated with their mass effect, such as low back pain and constipation [8]. Presacral NETs usually do not cause symptoms of carcinoid syndrome, such as flushing, sweating, and hypertension; however, in the current case, the patient developed intractable diarrhea, which indicates carcinoid syndrome, usually observed in patients with advanced and metastatic NETs. The first-line systemic treatment for patients with advanced or metastatic NETs is usually a combination of SSAs for controlling the tumor growth and hormonal secretion, and everolimus [15–17]. The combination therapy of SSAs and mTOR inhibitors can improve the progression-free survival (PFS) but not the overall survival [15]. Pazopanib is an oral multi-kinase inhibitor that is a treatment option for advanced and meta-static NETs because it increases the PFS of patients who did not respond to other systemic treatments including mTOR inhibitors and other multitargeted agents [18].\n\nPRRT is another treatment modality that includes the use of radiolabeled SSAs for patients with advanced or metastatic NETs refractory to octreotide LAR treatment. It is associated with markedly longer PFS and better clinical outcomes [16,17]. Lu-177 is a β-emitter that has a higher range and energy than other radionuclides as well as higher emission of γ-rays, thereby making it useful for monitoring tumor response. Lu-177 DOTATATE results in a significantly higher response rate and an improvement in the quality of life, with a 79% reduction in the risk of progression or death [11,17]. In our patient, stable disease was maintained after administering 5 cycles of PRRT.\n\nConclusions\nClinicians and radiologists need to consider the diagnostic difficulty associated with small and asymptomatic primary presacral NETs, as well as its rarity. Our patient initially presented with a hepatic mass; however, using In-111 octreotide SPECT/CT, we successfully diagnosed small primary presacral NETs, which was otherwise missed on conventional imaging modalities. During the long-term follow-up, although the disease progressed with recurrent hepatic metastases and peritoneal seeding refractory to the systemic treatment, stable disease was maintained through PRRT. As shown in this case, the long-term progressive clinical course of presacral NETs could help understand these rare diseases.\n\nEthics approval\n\nThis study was conducted in compliance with the Institutional Review Board (IRB) regulations (approval ID: HPIRB 2019-09-003) and the Declaration of Helsinki.\n\nConflict of interest\n\nNone.\n\nFigure 1. (A) Axial In-111 octreotide SPECT/CT findings. There were 2 well-demarcated small round nodules with In-111 octreotide uptake in the presacral area on 24-h In-111 octreotide scans. (B) Anterior-posterior whole-body In-111 octreotide scan findings. There were no other abnormal In-111 octreotide-avid lesions in the rest of the body. Normal physiologic uptake was noted in the liver, spleen, kidneys, bowels, and bladder. (C) Coronal abdominopelvic enhanced computed tomography findings: Heterogeneously enhanced nodules of 2.1×1.7 cm and 1.0×0.9 cm (solid black arrow) were noted abutting the left internal iliac vessels and presacral fascia (white dotted arrow).\n\nFigure 2. (A, B) Anterior-posterior whole-body In-111 octreotide scan findings and coronal In-111 octreotide SPECT/CT findings. Multiple intense In-111 octreotide-avid hepatic masses recurred in the rest of the liver. Presacral nodules were also visualized, with no significant interval change compared with that observed on the In-111 octreotide scan 4 years previously (black arrow in (A)). (C) Axial In-111 octreotide SPECT/CT findings. Newly developed peritoneal seeding nodules with In-111 octreotide uptake were also noted (white arrow).\n\nFigure 3. (A, B) Maximal intensive projection/axial Ga-68 DOTATOC PET/CT. Multiple nodules with Ga-68 DOTATOC uptake were noted in the residual liver. A presacral Ga-68 DOTATOC-avid nodule was also noted (white dotted arrow); however, there was no Ga-68 DOTATOC uptake in the smaller presacral nodule. Multiple peritoneal nodules with Ga-68 DOTATOC uptake (white arrow) were also observed in the corresponded area on the In-111 octreotide scan.\n\nFigure 4. (A, B) Anterior-posterior whole-body scan findings after the first and third cycles of Lu-177 DOTATATE. After the first and third cycles of 8.0 GBq Lu-177 DOTATATE therapies, whole-body scans were obtained after 24 h. There was no significant interval change in the multiple nodules that showed Lu-177 DOTATATE uptake in the retroperitoneum, liver, and peritoneum.\n==== Refs\nReferences:\n1. Klöppel G Neuroendocrine neoplasms: Dichotomy, origin and classifications Visc Med 2017 33 5 324 30 29177160 \n2. La Rosa S Boni L Finzi G Ghrelin-producing well-differentiated neuroendocrine tumor (carcinoid) of tailgut cyst. Morphological, immunohistochemical, ultrastructural, and RT-PCR study of a case and review of the literature Endocr Pathol 2010 21 3 190 98 20532674 \n3. Howell DL O’Dorisio MS Management of neuroendocrine tumors in children, adolescents, and young adults J Pediatr Hematol Oncol 2012 34 S64 68 22525409 \n4. Hubalewska-Dydejczyk A Trofimiuk M Sowa-Staszczak A Neuroendocrine tumours of rare location Endokrynol Pol 2010 61 3 322 27 20602309 \n5. Pastrian LG Ruz-Caracuel I Gonzalez RS Giant primary neuroendocrine neoplasms of the liver: Report of 2 cases with molecular characterization Int J Surg Pathol 2019 [Epub ahead of print] \n6. Bosman FT Carneiro F Hruban RH Theise ND WHO classification of tumours of the digestive system World Health Organization 2010 \n7. Silveira F Basile ML Kuga FS Neuroendocrine tumors: An epidemiological study of 250 cases at a tertiary hospital Rev Assoc Med Bras (1992) 2017 63 10 856 61 29267486 \n8. Kim JM Lee NK Kim S Primary presacral neuroendocrine tumor: A case report and review of MRI Findings J Korean Soc Radiol 2017 77 3 187 91 \n9. Dehal A Kim S Ali A Walbolt T Primary epithelial neuroendocrine tumors of the retroperitoneum Perm J 2015 19 4 71 75 26517438 \n10. Maxwell JE Howe JR Imaging in neuroendocrine tumors: An update for the clinician Int J Endocr Oncol 2015 2 2 159 68 26257863 \n11. Maqsood MH Tameez Ud Din A Khan AH Neuroendocrine tumor therapy with Lutetium-177: A literature review Cureus 2019 11 1 e3986 30972265 \n12. Smit Duijzentkunst DA Kwekkeboom DJ Bodei L Somatostatin receptor 2-targeting compounds J Nucl Med 2017 58 Suppl. 2 54S 60S 28864613 \n13. Ambrosini V Campana D Nanni C Is (6)(8)Ga-DOTA-NOC PET/CT indicated in patients with clinical, biochemical or radiological suspicion of neuroendocrine tumour? Eur J Nucl Med Mol Imaging 2012 39 8 1278 83 22584487 \n14. Fanti S Ambrosini V Tomassetti P Evaluation of unusual neuroendocrine tumours by means of 68Ga-DOTA-NOC PET Biomed Pharmacother 2008 62 10 667 71 18358680 \n15. Yau H Kinaan M Quinn SL Moraitis AG Octreotide long-acting repeatable in the treatment of neuroendocrine tumors: patient selection and perspectives Biologics 2017 11 115 22 29255345 \n16. Al Khaldi M Mesbah A Dube P Neuroendocrine carcinoma arising in a tailgut cyst Int J Surg Case Rep 2018 49 91 95 29966957 \n17. Strosberg J El-Haddad G Wolin E Phase 3 trial of (177)Lu-dotatate for midgut neuroendocrine tumors N Engl J Med 2017 376 2 125 35 28076709 \n18. Grande E Capdevila J Castellano D Pazopanib in pretreated advanced neuroendocrine tumors: A phase II, open-label trial of the Spanish Task Force Group for Neuroendocrine Tumors (GETNE) Ann Oncol 2015 26 9 1987 93 26063633\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1941-5923",
"issue": "20()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000368:Aged; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D009364:Neoplasm Recurrence, Local; D018358:Neuroendocrine Tumors; D015282:Octreotide; D019275:Radiopharmaceuticals; D035583:Rare Diseases; D012186:Retroperitoneal Neoplasms; D000072098:Single Photon Emission Computed Tomography Computed Tomography; D057832:Watchful Waiting",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "1969-1975",
"pmc": null,
"pmid": "31889046",
"pubdate": "2019-12-31",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "29255345;22525409;30972265;18358680;28076709;29177160;26257863;29267486;20602309;31189424;28864613;29966957;26063633;20532674;22584487;26517438",
"title": "Long-Term Follow-Up of a Patient with Primary Presacral Neuroendocrine Tumor: A Case Report with Literature Review.",
"title_normalized": "long term follow up of a patient with primary presacral neuroendocrine tumor a case report with literature review"
} | [
{
"companynumb": "KR-SUN PHARMACEUTICAL INDUSTRIES LTD-2020RR-240528",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "OCTREOTIDE"
},
"drug... |
{
"abstract": "OBJECTIVE\nPeri-procedural thromboembolic (TE) and hemorrhagic events are complications of major concern for patients undergoing cryoballoon (CB) ablation for atrial fibrillation (AF). While peri-procedural anticoagulation management could decrease the incidence of these complications, data on CB ablation are scarce. The role of novel oral anticoagulants (NOACs) has not been thoroughly tested in this population.\n\n\nMETHODS\nIn the present study, we sought to assess acute peri-procedural complications in patients undergoing CB ablation for AF under different anticoagulation regimens; anticoagulation administration was performed according to the CHA2DS2-VASc score guidelines. To the best of our knowledge, this is the first study that compares 1) uninterrupted warfarin, 2) bridging therapy with low molecular weight heparin (LMWH), 3) aspirin and 4) NOACs in this subgroup of patients.\n\n\nRESULTS\nNOACs were as effective as uninterrupted warfarin in terms of bleeding complications and TE events. Surprisingly, the aspirin group had more hemorrhagic complications than both the warfarin and NOACs groups.\n\n\nCONCLUSIONS\nIn the current study, the use of NOACs was an effective and safe approach in CB ablation.",
"affiliations": "Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium. Electronic address: yannibalt@hotmail.com.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.;Heart Rhythm Management Center, UZ Brussel-VUB, Brussels, Belgium.",
"authors": "Baltogiannis|Giannis|G|;Chierchia|Gian-Battista|GB|;Conte|Giulio|G|;Sieira|Juan|J|;Di Giovanni|Giacomo|G|;Ciconte|Giuseppe|G|;de Asmundis|Carlo|C|;Saitoh|Yukio|Y|;Wauters|Kristel|K|;Irfan|Ghazala|G|;Brugada|Pedro|P|",
"chemical_list": "D000925:Anticoagulants; D006495:Heparin, Low-Molecular-Weight; D014859:Warfarin",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.hjc.2016.11.003",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1109-9666",
"issue": "57(5)",
"journal": "Hellenic journal of cardiology : HJC = Hellenike kardiologike epitheorese",
"keywords": "Atrial fibrillation; Cryoballoon ablation; Novel oral anticoagulants",
"medline_ta": "Hellenic J Cardiol",
"mesh_terms": "D000284:Administration, Oral; D000368:Aged; D000925:Anticoagulants; D001281:Atrial Fibrillation; D017115:Catheter Ablation; D003452:Cryosurgery; D004359:Drug Therapy, Combination; D005260:Female; D006495:Heparin, Low-Molecular-Weight; D006801:Humans; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D016896:Treatment Outcome; D014859:Warfarin",
"nlm_unique_id": "101257381",
"other_id": null,
"pages": "331-337",
"pmc": null,
"pmid": "28087311",
"pubdate": "2016",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "'The role of novel oral anticoagulants in patients undergoing cryoballoon ablation for atrial fibrillation'.",
"title_normalized": "the role of novel oral anticoagulants in patients undergoing cryoballoon ablation for atrial fibrillation"
} | [
{
"companynumb": "BE-IPCA LABORATORIES LIMITED-IPC-2017-BE-000208",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "WARFARIN SODIUM"
},
"dr... |
{
"abstract": "OBJECTIVE\nNanoparticle albumin-bound paclitaxel (nab-PTX) is a solvent-free paclitaxel coupled to human albumin without an associated increase in toxicity. The neoadjuvant study of primary breast cancer was planned to evaluate tumor response and safety of triweekly nanoparticle albumin-bound paclitaxel.\n\n\nMETHODS\nPatients with Stage II/III HER2-negative primary breast cancer received four courses of nanoparticle albumin-bound paclitaxel 260 mg/m(2) every 3 weeks (q3w), followed by four courses of epirubicin 90 mg/m(2) plus cyclophosphamide 600 mg/m(2) q3w. Tumor response after nanoparticle albumin-bound paclitaxel was histologically evaluated. In addition, the clinical response, breast-conserving rate and safety of this treatment were monitored.\n\n\nRESULTS\nAmong 53 patients who received nanoparticle albumin-bound paclitaxel followed by epirubicin and cyclophosphamide neoadjuvant chemotherapy, pathological complete response and near-pathological complete response were confirmed in 3 (5.7%) and 7 (13.2%) patients who had surgery, respectively. The overall objective response rate was 71.7% after completion of chemotherapy. Based on Positron Emission Tomography Response Criteria in Solid Tumors using (18)F-fluorodeoxyglucose, complete metabolic response and partial metabolic response after 2-3 courses of nanoparticle albumin-bound paclitaxel were 15.1 and 52.8%, respectively. The most common significant toxicities of q3w nanoparticle albumin-bound paclitaxel were Grade 3 muscle pain, neuropathy and febrile neutropenia, each in 1 (1.9%) patient. There were no incidences of anaphylaxis or Grade 4/5 adverse events.\n\n\nCONCLUSIONS\nNeoadjuvant chemotherapy using q3w nanoparticle albumin-bound paclitaxel followed by epirubicin and cyclophosphamide was feasible in breast cancer patients with acceptable clinical response and drug tolerance, but conferred a low rate of pathological complete response. Monotherapy with q3w nanoparticle albumin-bound paclitaxel could be an appropriate substitute for solvent-based taxane in terms of therapeutic and safety management.",
"affiliations": "Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama tsaeki@saitama-med.ac.jp.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Breast Oncology, Saitama Medical University, Iruma, Saitama.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Palliative Care, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Digestive and Breast Surgery, Hiroshima Prefectural Hospital, Hiroshima-shi, Hiroshima.;Department of Nuclear Medicine, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Nuclear Medicine, International Medical Center, Saitama Medical University, Hidaka, Saitama.;Department of Pathology, International Medical Center, Saitama Medical University, Hidaka, Saitama, Japan.;Department of Breast Oncology, International Medical Center, Saitama Medical University, Hidaka, Saitama.",
"authors": "Shimada|Hiroko|H|;Ueda|Shigeto|S|;Saeki|Toshiaki|T|;Shigekawa|Takashi|T|;Takeuchi|Hideki|H|;Hirokawa|Eiko|E|;Sugitani|Ikuko|I|;Sugiyama|Michiko|M|;Takahashi|Takao|T|;Matsuura|Kazuo|K|;Yamane|Tomohiko|T|;Kuji|Ichiei|I|;Hasebe|Takahiro|T|;Osaki|Akihiko|A|",
"chemical_list": "C520255:130-nm albumin-bound paclitaxel; D000418:Albumins; D014408:Biomarkers, Tumor; D019275:Radiopharmaceuticals; D043823:Taxoids; D019788:Fluorodeoxyglucose F18; D000077143:Docetaxel; D015251:Epirubicin; D003520:Cyclophosphamide; D017239:Paclitaxel",
"country": "England",
"delete": false,
"doi": "10.1093/jjco/hyv055",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0368-2811",
"issue": "45(7)",
"journal": "Japanese journal of clinical oncology",
"keywords": "HER2-negative breast cancer; nab-paclitaxel; neoadjuvant chemotherapy",
"medline_ta": "Jpn J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000418:Albumins; D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D001943:Breast Neoplasms; D003520:Cyclophosphamide; D000077143:Docetaxel; D004334:Drug Administration Schedule; D015251:Epirubicin; D005260:Female; D019788:Fluorodeoxyglucose F18; D006801:Humans; D007262:Infusions, Intravenous; D053208:Kaplan-Meier Estimate; D008875:Middle Aged; D053758:Nanoparticles; D020360:Neoadjuvant Therapy; D009367:Neoplasm Staging; D017239:Paclitaxel; D049268:Positron-Emission Tomography; D019275:Radiopharmaceuticals; D043823:Taxoids; D016896:Treatment Outcome",
"nlm_unique_id": "0313225",
"other_id": null,
"pages": "642-9",
"pmc": null,
"pmid": "25989989",
"pubdate": "2015-07",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Neoadjuvant triweekly nanoparticle albumin-bound paclitaxel followed by epirubicin and cyclophosphamide for Stage II/III HER2-negative breast cancer: evaluation of efficacy and safety.",
"title_normalized": "neoadjuvant triweekly nanoparticle albumin bound paclitaxel followed by epirubicin and cyclophosphamide for stage ii iii her2 negative breast cancer evaluation of efficacy and safety"
} | [
{
"companynumb": "JP-CIPLA LTD.-2015JP04122",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": null,
... |
{
"abstract": "Metastasis in axillary and supraclavicular lymph nodes has been frequently observed in patients with breast cancer. The clinical staging and therapeutic principle determined according to the situation of lymph node metastasis are clear. One patient with infiltrating ductal carcinoma of the left breast was reported to undergo modified radical mastectomy. One and a half years later, lymphadenectasis was observed in area II, III, IV, V and VI of the left neck; therefore, cervical lymphadenectomy was performed under cervical plexus anesthesia, indicating lymph node metastatic adenocarcinoma (21/26). The patient took 10 mg tamoxifen twice per day for five years after lymphadenectomy and the review showed negative results in liver, lungs, mediastinum, neck and contralateral breast. This suggested that although breast cancer complicated with retrograde cervical lymph node metastases is rare, timely surgery is required even if the patient is in a good general condition, to avoid \"delayed therapy\" due to misjudgment of illness simply according to disease staging.",
"affiliations": "Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.;Department of General Surgery, the 309 Hospital of PLA, Beijing, PR China.",
"authors": "Qin|Rong|R|;Zhang|Qiaoyu|Q|;Weng|Jianfeng|J|;Liu|Weiping|W|;Zhang|Bo|B|;Lv|Gang|G|;Wang|Yi|Y|;Wu|Youjun|Y|;Pu|Yongdong|Y|",
"chemical_list": null,
"country": "Poland",
"delete": false,
"doi": "10.5114/wo.2014.45307",
"fulltext": "\n==== Front\nContemp Oncol (Pozn)Contemp Oncol (Pozn)WOContemporary Oncology1428-25261897-4309Termedia Publishing House 2353610.5114/wo.2014.45307Case ReportTreatment and prognosis for retrograde cervical lymph node metastases in breast cancer Qin Rong *Zhang Qiaoyu *Weng Jianfeng Liu Weiping Zhang Bo Lv Gang Wang Yi Wu Youjun Pu Yongdong Department of General Surgery, the 309th Hospital of PLA, Beijing, PR ChinaAddress for correspondence: Yongdong Pu, Department of General Surgery, The 309th Hospital of PLA, No. Jia17 Heishanhu Haidian District, Beijing 100091, China. tel. +86-10-66775914, fax +86-10-66775914. e-mail: yongdongpu@yeah.net* Dr. Rong Qin and Qiaoyu Zhang contributed equally; they are co-first authors\n\n13 5 2015 2015 19 2 154 156 28 1 2013 07 3 2013 27 5 2013 Copyright © 2015 Termedia2015This is an Open Access article distributed under the terms of the Creative Commons Attribution-Noncommercial 3.0 Unported License, permitting all non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Metastasis in axillary and supraclavicular lymph nodes has been frequently observed in patients with breast cancer. The clinical staging and therapeutic principle determined according to the situation of lymph node metastasis are clear. One patient with infiltrating ductal carcinoma of the left breast was reported to undergo modified radical mastectomy. One and a half years later, lymphadenectasis was observed in area II, III, IV, V and VI of the left neck; therefore, cervical lymphadenectomy was performed under cervical plexus anesthesia, indicating lymph node metastatic adenocarcinoma (21/26). The patient took 10 mg tamoxifen twice per day for five years after lymphadenectomy and the review showed negative results in liver, lungs, mediastinum, neck and contralateral breast. This suggested that although breast cancer complicated with retrograde cervical lymph node metastases is rare, timely surgery is required even if the patient is in a good general condition, to avoid „delayed therapy” due to misjudgment of illness simply according to disease staging.\n\nbreast cancercervical lymph node metastases\n==== Body\nIntroduction\nMetastasis in axillary and supraclavicular lymph nodes has been frequently observed in patients with breast cancer. The clinical staging and therapeutic principle determined according to the situation of lymph node metastasis are clear. However, retrograde cervical lymph node metastases in area II, III, IV, V and VI of the neck are relatively rare; thus thorough reports regarding its clinical staging and therapeutic principle are missing. In this study, a patient with retrograde cervical lymph node metastasis after modified radical mastectomy in breast cancer was treated with the second cervical lymph node dissection. After surgery, endocrine therapy was performed. There was no disease recurrence in follow-up of 5 years, with good prognosis. The case report is as follows.\n\nCase report\nThe female patient was 36 years old with left breast masses. Physical examination showed a hard and moveable lump in the size of 4 × 4 cm located at three o ‚clock direction in the upper quadrant outside the left breast with a distance of 3 cm to the nipple, complicated with multiple moveable, unfused and enlarged lymph nodes with maximum size of 1 × 1 cm in the left axilla. B ultrasound revealed a lump of 1.8 × 6.0 cm. Low echoes with strong punctate echoes were detected. Therefore, the patient was diagnosed with breast cancer. The lump was first excised under general anesthesia and confirmed as malignant cancer, and then modified radical mastectomy of the left breast was conducted. During the surgery, a number of enlarged axillary lymph nodes in group I and II were removed; the pectoralis major was opened at two finger widths below the collarbone to cut off one lymph node in group III for detection. Postoperative pathological report: infiltrating ductal carcinoma of the left breast, axillary lymph node metastasis 31/38, subclavian lymph node metastasis. Cancer emboli were found in vessels under the nipple; immunohistochemistry (IHC) showed: ER(+), PR(+), Her-2(+/–). Pathological staging was T2N2M0. The patient received one cycle of postoperative CMF (cyclophosphamide, methotrexate, fluorouracil) chemotherapy and radiotherapy was applied to the chest wall + left clavicle ueno, DT 50 Gy/25f, followed by another five cycles of CMF chemotherapy. One and a half years after the surgery, lymphadenectasis was observed in the left neck of the patient. Physical examination: enlargement of lymph nodes was discovered along with left sternocleidomastoid shallow surface, deep surface and supraclavicular fossa; the enlarged lymph nodes were hard, partly fused but still with boundaries. B ultrasound detected low echo-nodules with varying sizes in subcutaneous tissue, which closely correlated with internal jugular veins; their borders were clear but the cortical-medulla boundary and lymphatic door were not clear; blood flow in the artery was with low resistance. Lymph node biopsy strongly suggested metastatic adenocarcinoma. Therefore, cervical lymphadenectomy was performed under cervical plexus anesthesia. Lymph nodes with maximum size of 2 × 2.5 cm were removed from shallow and deep layers in area II, III, IV, V and VI. It was reported as lymph node metastatic adenocarcinoma (21/26) after surgery, and cancer emboli were found in vessels. Due to funding difficulties, a 10 mg oral citric acid hydrochloric acid tamoxifen tablet was taken twice per day for more five years. Now the patient lives a normal life without positive results in the examinations of neck ultrasound, chest CT and liver CT.\n\nDiscussion\nThis case of left breast cancer was discovered with lymph node metastasis in area II, III, IV, V and VI of the left neck, which is very rare. In addition, the patient survived well after cervical lymphadenectomy, indicating that the neck lymph node dissection was timely and effective for cervical lymph node metastases in breast cancer.\n\nBreast cancer patients with supraclavicular lymph node metastasis account for 8% when they are diagnosed, which has been reported previously [1], while 3–8.7% of patients complicated with axillary lymph node metastasis develop supraclavicular lymph node metastases within five years after surgery [2–4]. Most first relapses occurred in the supraclavicular fossa, followed by the regions beside the sternum, among the pectorals and in the axilla. The survival rate of patients with supraclavicular lymph node metastasis at five years was approximately 20–33.6% [5, 6]. Others reported that patients without supraclavicular lymph node metastasis underwent resection, among whom 13% of patients were found with recessive metastasis, demonstrating that supraclavicular lymph node metastasis frequently occurred in breast cancer and operative relapse, but its occurrence is a sign of advanced stage. Previously swelling of the supraclavicular lymph nodes was considered as retrograde metastasis, because supraclavicular lymph nodes belong to the deep cervical group, and additionally their lymphatic output tubes and subclavian lymphatic output tubes converge into thoracic or right lymphatic ducts which flow into veins. Recently it has been discovered that output tubes of internal mammary lymph nodes and subclavian lymph nodes as well as upper lymph vessels in the breast converge into the supraclavicular lymph nodes; therefore, the lymph node metastasis has been identified as N3 instead of distant metastasis, but it belongs to the late clinical stage [5, 7].\n\nThe patient in this case was not only characterized by swelling of supraclavicular lymph nodes, but also showed enlarged lymph nodes and metastasis in area II, III, IV, V and VI of the left neck, which is very rare. Retrograde metastasis of cervical lymph nodes should be first taken into account to analyze its occurrence. From the consideration of time, one metastatic supraclavicular lymph node was found during the first surgery, suggesting that further lymph nodes beyond this one might be affected; until the surgery, the tumor retrograded to the neck only along with lymphatic vessels instead of the thoracic duct or other place within more than one year. In consideration of cause, we could not exclude the possibility that postoperative radiotherapy led to retrograde metastasis along with lymphatic vessels. Although the evidence was missing, radiotherapy might result in the blockage of lymph vessels that export into the thoracic duct. Therefore, performing postoperative radiotherapy timely in the surgical and clavicle area plays a significant role in preventing systemic metastasis in breast cancer.\n\nFrom the view of tumor treatment, the patient had already developed cervical lymph node metastasis. Although the stage of lymph node metastasis remained unclear, it was certainly out of the range of N3; whether it could be defined as M1 was not determined [7]. The prognosis was worrying, but the cervical lymphadenectomy under cervical plexus anesthesia led to a surprising result. The patient did not receive any chemotherapy, but only took 10 mg tamoxifen twice per day for five years after lymphadenectomy and the review showed negative results in liver, lungs, mediastinum, neck and contralateral breast. This is probably because the patient only spent limited money on surgery due to her financial problem. This case demonstrated that even though the patient with breast cancer developed rare cervical lymph node metastasis, she still could benefit from lymphadenectomy if there was no metastasis in liver, lung, bone, mediastinum and brain. Considering the treatment experience of this case, we proposed to classify the retrograde cervical lymph node metastasis in breast cancer as locally advanced cancer, which was similar to supraclavicular lymph node metastasis. So the lymph node dissection should be performed as soon as possible, to avoid the hematogenous metastasis of tumor cells through the thoracic duct or right lymphatic duct and loss of optimal surgical opportunity. In this study, further radiotherapy and chemotherapy after lymph node dissection were not conducted, which was due to economic reasons, and not from our original intention. It was believed that only single lymph node dissection could not guarantee complete elimination of tumor cells. So the treatment experience of axillary and supraclavicular lymph node metastasis should be referred, and the second standardized chemotherapy and local radiotherapy must be performed, with endocrine therapy for estrogen receptor positive cases in immunohistochemistry [8, 9] and monoclonal antibody therapy with trastuzumab for Her-2 positive cases. Only a comprehensive therapy strategy can minimize the tumor recurrence risk to the lowest level. This case also indicated that although breast cancer complicated with cervical lymph node metastasis is rare in the late stage, it requires further clarification of stages and research into mechanisms. Surgery should be performed timely even if the patient is in a good general condition, to avoid „delayed therapy” due to misjudgment of illness simply according to disease staging.\n\n\nThe authors declare no conflict of interest.\n==== Refs\nReferences\n1 Kocic B Filipovic S Petrovic B Mijalkovic D Rancic N Poultsidi A Clinical and biological characteristics of breast cancer J BUON 2010 15 660 7 21229626 \n2 Yu JI Park W Huh SJ Choi DH Lim YH Ahn JS Yang JH Nam SJ Determining which patients require irradiation of the supraclavicular nodal area after surgery for N1 breast cancer Int J Radiat Oncol Biol Phys 2010 78 1135 41 20231065 \n3 Hamamoto Y Kataoka M Semba T Supraclavicular failure after breast-conserving therapy in patients with four or more positive axillary lymph nodes when prophylactic supraclavicular irradiation is omitted Jpn J Radiol 2009 27 213 7 19554414 \n4 Livi L Scotti V Saieva C Outcome after conservative surgery and breast irradiation in 5,717 patients with breast cancer: implications for supraclavicular nodal irradiation Int J Radiat Oncol Biol Phys 2010 76 978 83 19540052 \n5 Chen SC Chang HK Lin YC Prognosis of breast cancer after supraclavicular lymph node metastasis: not a distant metastasis Ann Surg Oncol 2006 13 1457 65 16960682 \n6 Pergolizzi S Adamo V Russi E Prospective multicenter study of combined treatment with chemotherapy and radiotherapy in breast cancer women with the rare clinical scenario of ipsilateral supraclavicular node recurrence without distant metastases Int J Radiat Oncol Biol Phys 2006 65 25 32 16446058 \n7 Sesterhenn AM Albert US Barth PJ Wagner U Werner JA The status of neck node metastases in breast cancer – loco-regional or distant? Breast 2006 15 181 6 16061381 \n8 Waters EA McNeel TS Stevens WM Use of tamoxifen and raloxifene for breast cancer chemoprevention in 2010 Breast Cancer Res Treat 2012 134 875 80 22622807 \n9 Sobstyl M Tkaczuk-Włach J Sobstyl J Side effects of tamoxifen and raloxifene therapy Menopause Review 2012 3 250 253\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1428-2526",
"issue": "19(2)",
"journal": "Contemporary oncology (Poznan, Poland)",
"keywords": "breast cancer; cervical lymph node metastases",
"medline_ta": "Contemp Oncol (Pozn)",
"mesh_terms": null,
"nlm_unique_id": "101233223",
"other_id": null,
"pages": "154-6",
"pmc": null,
"pmid": "26034395",
"pubdate": "2015",
"publication_types": "D002363:Case Reports",
"references": "19554414;21229626;22622807;20231065;16960682;19540052;16061381;16446058",
"title": "Treatment and prognosis for retrograde cervical lymph node metastases in breast cancer.",
"title_normalized": "treatment and prognosis for retrograde cervical lymph node metastases in breast cancer"
} | [
{
"companynumb": "CN-BAXTER-2015BAX034657",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": null,
... |
{
"abstract": "METHODS\nRetrospective case-control study.\n\n\nOBJECTIVE\nTo compare the incidence, management, and outcome of incidental durotomy in revision microdiscectomy with open and minimal-access surgery.\n\n\nBACKGROUND\nIncidental durotomy occurs with a variable incidence of 3%-27% in spine surgery. The highest rate occurs in revision microdiscectomy. The intraoperative and postoperative management of dural tears varies in the literature and the definite impact on clinical outcome has to be clarified.\n\n\nMETHODS\nThis is a retrospective study of medical records of 135 patients who underwent revision microdiscectomy, divided into 2 subgroups: OPEN (n=82) versus minimal-access surgery (MINI, n=53). Occurrence of intraoperative dural tears, intraoperative and postoperative management of durotomy, and clinical outcomes, according to MacNab criteria, were retrospectively examined. Statistical comparisons for categorical values between groups were accomplished using the 2-tailed Fisher exact test. P-values <0.05 were considered to be statistically significant.\n\n\nRESULTS\nThe incidence of durotomy in group OPEN was 19.5% (n=16/82) and in group MINI 17.0% (n=9/53) (P=0.822). The majority of durotomies (23/25) were repaired with an absorbable fibrin sealant patch alone. Postoperative cerebrospinal fluid fistula occurred only in 1 case of the OPEN group and was treated with lumbar drainage without the need for a reoperation. Patients with durotomy of the MINI group tended to have better outcome compared with those of the OPEN group without being statistically significant.\n\n\nCONCLUSIONS\nThe incidence of durotomy and postoperative cerebrospinal fluid fistula in lumbar revision microdiscectomy does not significantly differ between minimal-access and standard open procedures. The application of a fibrin sealant patch alone is an effective strategy for dural repair in revision lumbar microdiscectomy.",
"affiliations": "Department of Neurosurgery, University Medical Center Freiburg, Freiburg, Germany.",
"authors": "Kogias|Evangelos|E|;Klingler|Jan-Helge|JH|;Franco Jimenez|Pamela|P|;Vasilikos|Ioannis|I|;Sircar|Ronen|R|;Scholz|Christoph|C|;Hubbe|Ulrich|U|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/BSD.0000000000000279",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2380-0186",
"issue": "30(10)",
"journal": "Clinical spine surgery",
"keywords": null,
"medline_ta": "Clin Spine Surg",
"mesh_terms": "D000328:Adult; D000368:Aged; D016022:Case-Control Studies; D004388:Dura Mater; D005260:Female; D006801:Humans; D015994:Incidence; D007431:Intraoperative Complications; D008159:Lumbar Vertebrae; D008297:Male; D042282:Microdissection; D008875:Middle Aged; D019060:Minimally Invasive Surgical Procedures; D011183:Postoperative Complications; D012086:Reoperation; D012189:Retrospective Studies; D013118:Spinal Cord Diseases; D016896:Treatment Outcome",
"nlm_unique_id": "101675083",
"other_id": null,
"pages": "E1333-E1337",
"pmc": null,
"pmid": "29176490",
"pubdate": "2017-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Incidental Durotomy in Open Versus Tubular Revision Microdiscectomy: A Retrospective Controlled Study on Incidence, Management, and Outcome.",
"title_normalized": "incidental durotomy in open versus tubular revision microdiscectomy a retrospective controlled study on incidence management and outcome"
} | [
{
"companynumb": "DE-JNJFOC-20180828320",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FIBRINOGEN HUMAN\\THROMBIN HUMAN"
},
"drugadditio... |
{
"abstract": "BACKGROUND\nThe management of brain metastases in patients with germ cell tumors remains controversial. The authors assessed the outcome in this patient group after the introduction of GAMEC chemotherapy (14-day cisplatin, high-dose methotrexate, etoposide, and actinomycin-D with filgrastim support) and cessation of the routine use of cranial irradiation.\n\n\nMETHODS\nData were recorded prospectively from 39 patients with germ cell tumors and concurrent brain metastases who received treatment before and after the advent of GAMEC after they relapsed on conventional cisplatin-based chemotherapy. Neurosurgery was offered to selected patients. Radiotherapy generally was used only as a salvage therapy after chemotherapy failure. The primary outcome measure was overall survival and was depicted using a Kaplan-Meier plot.\n\n\nRESULTS\nThe 3-year overall survival rates were 38% for the whole cohort, 69% for those who presented with brain metastases at diagnosis (group 1), and 21% and 0% for those who developed metastases after initial chemotherapy (group 2) and while receiving chemotherapy (group 3), respectively. For the whole cohort, the median overall survival was 10.6 months (range, 5.5 months to not evaluable); and, for groups 1, 2, and 3 individually, the overall survival was not yet reached (range, from 7.4 months to not evaluable), 6.2 months (range, 2.1-15.3 months), and 2.7 months (range, from 0.6 months to not evaluable), respectively. The 3-year survival rate for those who received GAMEC chemotherapy was 56% compared with 27% for those who received chemotherapy pre-GAMEC.\n\n\nCONCLUSIONS\nThe prognosis for patients with germ cell tumors and brain metastases seems less bleak than previously thought. It is possible to achieve long-term survival with chemotherapy alone.",
"affiliations": "The Barts Cancer Center, St. Bartholomew's Hospital, Gloucester House, West Smithfield, London, United Kingdom.",
"authors": "Hardt|Anna|A|;Krell|Jonathan|J|;Wilson|Peter D|PD|;Harding|Victoria|V|;Chowdhury|Simon|S|;Mazhar|Danish|D|;Berney|Dan|D|;Stebbing|Justin|J|;Shamash|Jonathan|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/cncr.28629",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0008-543X",
"issue": "120(11)",
"journal": "Cancer",
"keywords": "GAMEC; brain; germ cell tumors; high-dose; metastases; methotrexate",
"medline_ta": "Cancer",
"mesh_terms": "D000328:Adult; D001932:Brain Neoplasms; D005260:Female; D006801:Humans; D008875:Middle Aged; D009373:Neoplasms, Germ Cell and Embryonal; D011446:Prospective Studies",
"nlm_unique_id": "0374236",
"other_id": null,
"pages": "1639-46",
"pmc": null,
"pmid": "24668504",
"pubdate": "2014-06-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Brain metastases associated with germ cell tumors may be treated with chemotherapy alone.",
"title_normalized": "brain metastases associated with germ cell tumors may be treated with chemotherapy alone"
} | [
{
"companynumb": "GB-AMGEN-GBRSP2021175357",
"fulfillexpeditecriteria": "2",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FILGRASTIM"
},
"drugadditional": "4",
... |
{
"abstract": "Hypothyroidism is a significant cause of pericardial effusion. However, large pericardial effusions due to hypothyroidism are extremely rare. Hormone replacement therapy is the cornerstone of treatment for hypothyroidism and regular follow-up of patients after initiation of the therapy is indicated. Herein, the case of a 70-year-old woman with a massive pericardial effusion due to Hashimoto's disease is presented.\n\n\n\nA 70-year-old female from a rural village on the island of Crete, Greece, was admitted to our hospital due to a urinary tract infection. She was under hormone replacement therapy with levothyroxine 100 µg once a day for Hashimoto's disease. Two years previously, the patient had had an episode of pericarditis due to hypothyroidism and had undergone a computed tomography-guided pericardiocentesis. The patient did not have regular follow-up and did not take the hormone replacement therapy properly. On admission, the patient's chest X-ray incidentally showed a possible pericardial effusion. The patient was referred for echocardiography, which revealed a massive pericardial effusion. Beck's triad was absent. Thyroid hormones were consistent with subclinical hypothyroidism: thyroid-stimulating hormone (TSH) 30.25 mIU/mL (normal limits: 0.25-3.43); free thyroxin 4 0.81 ng/dL (normal limits: 0.7-1.94). The patient had a score of 5 on the scale outlined by the European Society of Cardiology (ESC) position statement on triage strategy for cardiac tamponade and, despite the absence of cardiac tamponade, a pericardiocentesis was performed after 48 hours. The patient was treated with 125 µg levothyroxine orally once daily.\n\n\n\nThis was a rare case of an elderly female patient from a rural village with chronic massive pericardial effusion due to subclinical hypothyroidism without cardiac tamponade. Hypothyroidism should be included in the differential diagnosis of pericardial effusion, especially in a case of unexplained pericardial fluid. Initiation of hormone replacement therapy should be personalised in elderly patients. TSH levels >10 mU/L usually require therapy with levothyroxine in order to prevent adverse events. Rural patients usually do not have regular follow-up after the initiation of hormone replacement therapy. Pericardial effusions due to hypothyroidism grow slowly and subclinical hypothyroidism rarely shows signs and symptoms and can be underdiagnosed. The ESC position statement on triage strategy for pericardial diseases is a valuable clinical tool to estimate the necessity for pericardial drainage in such cases.",
"affiliations": "Department of Internal Medicine, University Hospital of Heraklion, Heraklion, Crete, Greece pantelispapakon@gmail.com.;Department of Internal Medicine, University Hospital of Heraklion, Heraklion, Crete, Greece gournie9@gmail.com.;Department of Radiology, University Hospital of Heraklion, Heraklion, Crete, Greece skiadaschristos@gmail.com.;Department of Cardiology, University Hospital of Heraklion, Heraklion, Crete, Greece apatrianakos@yahoo.gr.;Department of Internal Medicine, University Hospital of Heraklion, Heraklion, Crete, Greece gikas.achilles@uoc.gr.",
"authors": "Papakonstantinou|Panteleimon E|PE|;Gourniezakis|Nikolaos|N|;Skiadas|Christos|C|;Patrianakos|Alexandros|A|;Gikas|Achilleas|A|",
"chemical_list": "D013974:Thyroxine",
"country": "Australia",
"delete": false,
"doi": "10.22605/RRH4384",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1445-6354",
"issue": "18(2)",
"journal": "Rural and remote health",
"keywords": " Hashimoto’s disease; pericardial effusion; subclinical hypothyroidism; cardiac tamponade",
"medline_ta": "Rural Remote Health",
"mesh_terms": "D000368:Aged; D002305:Cardiac Tamponade; D005260:Female; D050031:Hashimoto Disease; D006801:Humans; D010490:Pericardial Effusion; D013974:Thyroxine",
"nlm_unique_id": "101174860",
"other_id": null,
"pages": "4384",
"pmc": null,
"pmid": "29778090",
"pubdate": "2018-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Massive pericardial effusion without cardiac tamponade due to subclinical hypothyroidism (Hashimoto's disease).",
"title_normalized": "massive pericardial effusion without cardiac tamponade due to subclinical hypothyroidism hashimoto s disease"
} | [
{
"companynumb": "GR-PFIZER INC-2019031259",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE"
},
"drugadditional": null,
... |
{
"abstract": "Whether the non-inferior efficacy and safety results of switching virologically suppressed HIV-1-infected patients from nevirapine immediate-release (NVP-IR) to NVP extended-release (NVP-XR) demonstrated in the TRANxITION study conducted in Europe and North America are also applicable to virologically suppressed HIV-infected Taiwanese patients remains unknown. We evaluated the comparative safety and efficacy of continuing NVP-IR versus switching to NVP-XR in virologically suppressed HIV-infected Taiwanese adults receiving combined antiretroviral therapy (cART) regimens.\n\n\n\nWe conducted a retrospective cohort study at Kaohsiung Veterans General Hospital from April 1, 2013, to March 31, 2015. Eighty-four virologically suppressed HIV-infected adults receiving NVP-IR cART were split into two groups: those continuing with NVP-IR (n = 49) and those being switched to NVP-XR (n = 35). Demographic characteristics, clinical variables, and laboratory findings were compared. Therapeutic drug monitoring of steady-state plasma NVP concentrations and genotype analysis of CYP2B6 516 were also performed in 22 participants. The primary endpoint was continued virological suppression at the end of the study. Secondary endpoints were time to loss of virological response and adverse events.\n\n\n\nDuring a mean follow-up of 18.4 months, the NVP-XR group demonstrated similar success at maintaining virological response compared with the NVP-IR group (82.9% vs. 85.7%; P = 0.72). Cox regression analysis indicated that there were no significant differences between NVP regimens for time to loss of virological response (hazard ratio: 0.940; P = 0.754). Furthermore, there were no significant differences in adverse events between these two groups. In the 22 participants, there was a non-significantly lower level of steady-state plasma NVP concentrations in the NVP-XR group than in NVP-IR recipients (5145.0 ng/mL vs. 6775.0 ng/mL; P = 0.267). The prevalence of CYP2B6 516 GT was 86.6%, and there was no significant difference in the distribution of CYP2B6 516 between these two groups.\n\n\n\nWe found that switching from NVP-IR to NVP-XR appeared to have similar safety and efficacy compared with continuing NVP-IR among virologically suppressed, HIV-infected Taiwanese patients. Our finding of higher Ctrough levels in both groups compared with other studies conducted in Caucasian populations and the high prevalence of CYP2B6 516 GT requires further investigation in a larger Taiwanese cohort.",
"affiliations": "Division of Infectious Diseases, Department of Internal Medicine, Kaohsiung Medical University, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan.;Department of Pharmacy, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan.;Department of Internal Medicine, Ohio State University, Columbus, OH, USA.;Division of Infectious Diseases, Department of Medicine, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan.;Division of Infectious Diseases, Department of Medicine, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan.;Division of Infectious Diseases, Department of Medicine, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan. hctsai1011@yahoo.com.tw.",
"authors": "Lee|Chun-Yuan|CY|;Chang|Hui-Min|HM|;Kunin|Calvin M|CM|;Lee|Susan Shin-Jung|SS|;Chen|Yao-Shen|YS|;Tsai|Hung-Chin|HC|",
"chemical_list": "D019380:Anti-HIV Agents; D003692:Delayed-Action Preparations; D019829:Nevirapine",
"country": "England",
"delete": false,
"doi": "10.1186/s12879-017-2371-3",
"fulltext": "\n==== Front\nBMC Infect DisBMC Infect. DisBMC Infectious Diseases1471-2334BioMed Central London 237110.1186/s12879-017-2371-3Research ArticleEfficacy and safety of switching from nevirapine immediate-release twice daily to nevirapine extended-release once daily in virologically suppressed HIV-infected patients: a retrospective cohort study in Taiwan Lee Chun-Yuan leecy8801131@gmail.com 123Chang Hui-Min kliber18@gmail.com 4Kunin Calvin M ckunin@columbus.rr.com 56Lee Susan Shin-Jung ssjlee@vghks.gov.tw 78Chen Yao-Shen yschen@vghks.gov.tw 789Tsai Hung-Chin hctsai1011@yahoo.com.tw 781 Division of Infectious Diseases, Department of Internal Medicine, Kaohsiung Medical University, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan 2 grid.412019.fCenter for Infectious Disease and Cancer Research (CICAR), Kaohsiung Medical University, Kaohsiung, Taiwan 3 grid.412019.fGraduate Institute of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan 4 grid.415011.0Department of Pharmacy, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan 5 grid.261331.4Department of Internal Medicine, Ohio State University, Columbus, OH USA 6 grid.134563.6Department of Internal Medicine, University of Arizona, Tucson, AZ USA 7 grid.415011.0Division of Infectious Diseases, Department of Medicine, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan 8 grid.260770.4Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan 9 grid.412076.6Graduate Institute of Science Education and Environmental Education, National Kaohsiung Normal University, Kaohsiung, Taiwan 11 4 2017 11 4 2017 2017 17 2615 9 2016 30 3 2017 © The Author(s). 2017\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nWhether the non-inferior efficacy and safety results of switching virologically suppressed HIV-1-infected patients from nevirapine immediate-release (NVP-IR) to NVP extended-release (NVP-XR) demonstrated in the TRANxITION study conducted in Europe and North America are also applicable to virologically suppressed HIV-infected Taiwanese patients remains unknown. We evaluated the comparative safety and efficacy of continuing NVP-IR versus switching to NVP-XR in virologically suppressed HIV-infected Taiwanese adults receiving combined antiretroviral therapy (cART) regimens.\n\nMethods\nWe conducted a retrospective cohort study at Kaohsiung Veterans General Hospital from April 1, 2013, to March 31, 2015. Eighty-four virologically suppressed HIV-infected adults receiving NVP-IR cART were split into two groups: those continuing with NVP-IR (n = 49) and those being switched to NVP-XR (n = 35). Demographic characteristics, clinical variables, and laboratory findings were compared. Therapeutic drug monitoring of steady-state plasma NVP concentrations and genotype analysis of CYP2B6 516 were also performed in 22 participants. The primary endpoint was continued virological suppression at the end of the study. Secondary endpoints were time to loss of virological response and adverse events.\n\nResults\nDuring a mean follow-up of 18.4 months, the NVP-XR group demonstrated similar success at maintaining virological response compared with the NVP-IR group (82.9% vs. 85.7%; P = 0.72). Cox regression analysis indicated that there were no significant differences between NVP regimens for time to loss of virological response (hazard ratio: 0.940; P = 0.754). Furthermore, there were no significant differences in adverse events between these two groups. In the 22 participants, there was a non-significantly lower level of steady-state plasma NVP concentrations in the NVP-XR group than in NVP-IR recipients (5145.0 ng/mL vs. 6775.0 ng/mL; P = 0.267). The prevalence of CYP2B6 516 GT was 86.6%, and there was no significant difference in the distribution of CYP2B6 516 between these two groups.\n\nConclusions\nWe found that switching from NVP-IR to NVP-XR appeared to have similar safety and efficacy compared with continuing NVP-IR among virologically suppressed, HIV-infected Taiwanese patients. Our finding of higher Ctrough levels in both groups compared with other studies conducted in Caucasian populations and the high prevalence of CYP2B6 516 GT requires further investigation in a larger Taiwanese cohort.\n\nElectronic supplementary material\nThe online version of this article (doi:10.1186/s12879-017-2371-3) contains supplementary material, which is available to authorized users.\n\nKeywords\nAntiretroviral therapyHuman immunodeficiency virusNevirapineissue-copyright-statement© The Author(s) 2017\n==== Body\nBackground\nNevirapine immediate-release (NVP-IR) has been used with a high level of efficacy and safety since its introduction in 1996 in the United States and 1998 in Europe as a potent non-nucleoside reverse transcriptase inhibitor (nNRTI) used in combined antiretroviral therapy (cART) [1–3]. However, efforts to simplify the regimens in terms of pill counts and frequency have continued to improve adherence to HAART [4, 5]. Therefore, although the licensed dosage for NVP-IR is 200 mg twice daily after a 200 mg daily lead-in period, an off-label maintenance dose of 400 mg (2 × 200 mg) NVP-IR has been adopted to improve compliance [6]. Clinical trials comparing a single daily dose of 400 mg NVP-IR versus 200 mg twice daily demonstrated non-inferior efficacy for the new treatment [6–8]. To further simplify treatment regimens, a new extended-release (XR) formulation was developed [9, 10]. In phase III clinical trials, 400 mg NVP-XR once daily was found not inferior to 200 mg NVP-IR twice daily in terms of virological suppression in treatment-naïve patients (VERxVE study) [11] and in virologically suppressed patients who were switched from NVP-IR to NVP-XR (TRANxITION study) [12].\n\nNevirapine is pharmacologically characterized by a strong relationship between NVP trough plasma concentrations and virological response, [13, 14] and a target therapeutic trough concentration of 3.0 mg/L has been proposed as a minimum effective concentration [15] because the risk of virological failure increases 5-fold (relative risk 5.0, 95% CI 1.8–13.7) with NVP Ctrough ≤ 3 mg/mL compared with patients who had higher trough concentrations [13, 14].\n\nHowever, in routine clinical practice, optimal plasma concentrations of NVP are reached in only 27.8% patients [16]. The significant inter-individual variability in plasma concentrations of nNRTI could be partially explained by differences in ethnicity, polymorphisms in enzymes, drug–drug interactions, and body weight [17–19]. Polymorphisms of CYP2B6 may influence the metabolism of NVP, with the variant CYP2B6 516 GT polymorphism resulting in reduced clearance of NVP compared with CYP2B6 516 GG [20]. In a 2NN pharmacokinetic (PK) substudy, NVP clearance was reduced by 19.4% in patients from Thailand and South Africa compared with Caucasian and Hispanic patients [20]. This difference has been related to CYP2B6 516 GT polymorphisms, resulting in a 15.3% reduced clearance of NVP compared with patients with CYP2B6 516 GG [20]. However, a recent study of 171 HIV-infected patients in northern Taiwan showed a predominance of homozygous 516 GG alleles (66.1%), [21] which may lead to reduced NVP Ctrough compared with patients with CYP2B6 516 GT. Furthermore, a recent prospective study of 227 HIV-infected, treatment-naïve patients conducted in China recommends a higher target therapeutic Ctrough (3.9 μg/mL) of NVP for Chinese patients than the currently recommended level (3.0 μg/mL), which is predominately from the results of studies among Caucasian and African American patients [22].\n\nIn addition, previous PK studies of NVP have demonstrated a lower Ctrough with 400 mg NVP-XR once daily compared with 200 mg NVP-IR twice daily [11, 12, 23]. Therefore, the question remains whether the non-inferior efficacy and safety results of switching virologically suppressed HIV-1-infected patients from NVP-IR to NVP-XR demonstrated in the TRANxITION study conducted in Europe and North America [12] are also applicable to virologically suppressed HIV-infected patients in Taiwan.\n\nThe current study, conducted at a large teaching medical center in southern Taiwan, was designed to evaluate the efficacy and safety of switching virologically suppressed Taiwanese patients from 200 mg NVP-IR twice daily to 400 mg NVP-XR once daily. Therapeutic drug monitoring of plasma NVP concentrations and genotype analysis of CYP2B6 516 were also performed in some participants.\n\nMethods\nStudy design and patients\nThis study is composed of two parts: a retrospective analysis of the efficacy and safety of switching virologically suppressed patients from 200 mg NVP-IR twice daily to 400 mg NVP-XR once daily, and a prospective analysis of the impact of CYP450 polymorphisms on plasma concentrations of nNRTI. In the first part of the study, we retrospectively examined data collected from April 1, 2013, to March 31, 2015, at Kaohsiung Veterans General Hospital (KVGH), a 1200-bed, general and tertiary care hospital located in southern Taiwan. Prior to April 2013, only NVP-IR was available at KVGH. Once NVP-XR became available at KVGH in April 2013, all patients receiving NVP-IR were queried by their physician regarding their willingness to switch to NVP-XR. Because HIV-infected patients regularly visit our infectious diseases department every 1–3 months, we retrospectively screened all HIV-infected patients who were receiving NVP-IR-containing cART during the period from April 1, 2013 to June 30, 2013. Inclusion criteria for virological suppression were patients who were receiving NVP-IR plus two nucleos(t)ide reverse-transcriptase inhibitors, for a preceding minimum of 18 weeks, with undetectable (<50 HIV-1 RNA copies/mL) HIV-1 viral load (VL) in the previous 1–4 months [12]. Exclusion criteria were age < 18 years, pregnancy, or patients whose regimen included 400 mg NVP-IR once daily/switching from NVP-IR to NVP-XR/change of the NRTI backbone of combination regimens between July 1, 2013, and March 31, 2015. Enrolled patients were further subdivided into those continuing NVP-IR twice daily and those switching to NVP-XR once daily.\n\nFor the second part of the study, we evaluated the impact of CYP450 polymorphisms on plasma concentrations of nNRTI by high-performance liquid chromatography (HPLC) in HIV-infected patients, beginning in January 1, 2014. Inclusion criteria were patients who were receiving the same nNRTI-containing cART for at least 14 days. We excluded patients who were also receiving medications other than antiretroviral agents, those who were aged <20 years, and those who did not adhere to cART. For patients who were eligible and agreed to participate, a steady-state plasma sample was obtained before administration of the next dose of nNRTI. Finally, we matched those patients enrolled in the prospective part of our study to those in the retrospective analysis.\n\nThe two parts of this study were approved by the KVGH ethics committee (VGHKS14-CT7–22 and VGHKS14-CT2–13) and adhered to the principles of the Declaration of Helsinki. Informed consent was obtained from participants who underwent therapeutic drug monitoring of plasma nNRTI concentrations and genotype analysis of CYP450 polymorphisms.\n\nData collection\nFor each enrolled patient, the following information was extracted for analysis from computerized hospital records and chart reviews: demographic characteristics, risk factors for HIV infection, comorbidities, and cART regimen. Laboratory testing included hemograms, biochemical profiles, plasma viral load, and CD4+ T cell counts at baseline and at each follow-up visit. Viral load was determined using the Roche COBAS Amplicor assay prior to 2008 and the Roche COBAS TaqMan assay subsequently. Adverse events (AE) were also recorded. Liver function abnormalities were graded according to definitions of the Division of Acquired Immunodeficiency Syndrome (DAIDS).\n\nDefinitions\nVirological suppression was defined as HIV RNA ≤50 copies/mL. A virological blip was defined as an isolated detectable HIV RNA signal after a period of suppression, followed by a return to virological suppression [24]. Virological failure was defined as two consecutive HIV-1 RNA measurements >50 copies/mL at least 2 weeks apart (also called a “double blip”) [12]. Baseline data were defined as the most recent available test result within 3 months prior to entering the study. The date of entering the study was defined as April 1, 2013 for the NVP-IR group and as the date of switching for the NVP-XR group. The duration of patient follow-up was defined as the time from entering the study to treatment failure or to the last VL measurement within the observation period. The duration of continued virological suppression before entering the study was from the first VL measurement of ≤50 copies/mL to the date of entering the study.\n\nStudy end points\nThe primary end point was the proportion of patients with continued virological response with VL <50 HIV-1 RNA copies/mL at the end of the study. Patients were classified as treatment failures at the first occurrence of virological failure or a change in NVP regimen because of AEs or other reasons, death, or loss to follow-up (LTFU), [12] which was defined as no follow-up visits within 3 months prior to the end of the study. Secondary end points were time to loss of virological response (TLOVR) and AEs.\n\nTherapeutic drug monitoring of steady-state plasma NVP concentrations\nA steady-state plasma sample was obtained from all participants before administration of the next dose of NVP. Blood samples were centrifuged immediately after collection, and plasma was removed and stored at −20 °C until analysis. We used an HPLC technique with UV detection for analysis of NVP concentrations, as previously described [25]. For each calibration curve, six standards with concentrations ranging from 0.1 to 25 μg/mL were used. The lower limit of quantification of the assay was 0.1 μg/mL. Intra- and interassay variabilities were <5%. Data were recorded and analyzed using HPLC 2D Chem Station software (Agilent Technologies, Santa Clara, CA, USA).\n\nGenotype analysis of CYP2B6 516\nGenomic DNA was isolated from peripheral blood using the PureLink Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA). Exon 4 of the CYP2B6 gene was amplified by polymerase chain reaction (PCR). The primers 5′ CTTGACCTGCTGCTTCTTCC 3′ and 5′ TCCCTCTCCGTCTCCCTG 3′ were used to amplify a 204-bp fragment. PCR products were digested with BsrI restriction enzyme (New England Biolabs, Inc., Beverley, MA, USA). Digestion products were then loaded on a 2% agarose gel and separated by gel electrophoresis [26, 27].\n\nStatistical analyses\nAll statistical analyses were performed using IBM SPSS software, version 22.0 (IBM Corp., Armonk, NY, USA). Categorical variables were compared between the two groups using the χ2 or Fisher’s exact tests, and continuous variables were compared using the independent t-test or Mann–Whitney U test. All tests were two-tailed, and P < 0.05 was considered significant. The TLOVR of these two groups was analyzed using a Kaplan–Meier survival curve, and the influence of the NVP regimen (NVP-IR twice daily vs. NVP-XR once daily) on the TLOVR was investigated using Cox regression that was adjusted for age, sex, history of AIDS, cART regimen, and duration of virological suppression.\n\nResults\nDemographic characteristics and comorbidities of study participants\nWe retrospectively screened the records of 170 patients who were receiving NVP-IR during the period April 1 to June 30, 2013. Ninety met the inclusion criteria for virological suppression. Overall, six of these patients were excluded because they were <18 years old (n = 1), receiving a regimen that contained 400 mg NVP-IR once daily (n = 2), switching from NVP-IR to NVP-XR (n = 2), or had a change of the NRTI backbone (n = 1) between July 1, 2013, and March 31, 2015 (Fig. 1). Of the 84 patients enrolled in this study, 49 (59%) continued a regimen of NVP-IR twice daily and 35 (41%) were switched to an NVP-XR once daily regimen during the period from April 1 to June 30, 2013.Fig. 1 Study design\n\n\n\n\nThe baseline demographic characteristics and comorbidities of the two participant groups are shown in Table 1. The median age was 41 years (SD ± 13 years); 72 participants (85.7%) were male. There were no statistically significant differences between the NVP-IR and NVP-XR groups with respect to age, sex, risk factors for HIV, comorbidities, duration of continued virological suppression, history of a virologic blip, baseline CD4+ counts, or patient follow-up. However, the two groups differed significantly in the NRTI backbone of combination regimens at baseline. Most patients in the NVP-IR group were treated with lamivudine and zidovudine (Combivir®) (NVP-IR vs. NVP-XR: 55.1% vs. 0%; P < 0.001) whereas most patients in the NVP-XR group received abacavir and lamivudine (Kivexa®) (NVP-XR vs. NVP-IR: 77.1% vs. 32.7%; P < 0.001). Regarding the third drug of cART before entering the study, 24 of 35 patients (68.6%) in the NVP-XR group received an off-label regimen with 400 mg NVP-IR once daily, and all 49 patients in the NVP-IR group received 200 mg NVP-IR twice daily.Table 1 Demographic characteristics and co-morbidities for the 84 virologically suppressed, HIV-infected patients entered in this study\n\n\tAll\tNVP-XR\tNVP-IR\t\nP\n\t\n\nN = 84\t\nN = 35\t\nN = 49\t\nAge, mean years (± SD)\t41 (13)\t43 (12)\t40 (14)\t0.38\t\nGender, Male (%)\t72 (85.7)\t30 (85.7)\t42 (85.7)\t1.0\t\nBody weight, kg (± SD)\t66.3 (12.3)\t67.1 (13.1)\t65.7 (11.8)\t0.62\t\nRisk factor\t\n MSM, n (%)\t64 (82.1)\t29 (82.8)\t35 (71.4)\t0.22\t\n Heterosexual, n (%)\t10 (11.9)\t3 (8.6)\t7 (14.3)\t0.51\t\n IVDU, n (%)\t9 (10.7)\t3 (8.6)\t6 (12.2)\t0.73\t\n Vertical transmission, n (%)\t1 (1.1)\t0 (0)\t1 (2.0)\t1.0\t\nUnderlying disease\t\n Diabetes mellitus, n (%)\t3 (3.6)\t0 (0.0)\t3 (6.1)\t0.26\t\n CKD, n (%)\t0 (0.0)\t0 (0.0)\t0 (0.0)\t\t\n Autoimmune disease, n (%)\t0 (0.0)\t0 (0.0)\t0 (0.0)\t\t\n Chronic hepatitis B infection, n (%)\t8 (9.5)\t4 (11.4)\t4 (8.2)\t0.71\t\n Chronic hepatitis C infection, n (%)\t6 (7.1)\t1 (2.9)\t5 (10.2)\t0.39\t\nBackbone of cART\t\t\t\t<0.001\t\n Kivexa, n (%)\t43 (51.2)\t27 (77.1)\t16 (32.7)\t<0.001\t\n Combivir, n (%)\t27 (32.1)\t0 (0.0)\t27 (55.1)\t<0.001\t\n TDF+ 3TC, n (%)\t8 (9.5)\t4 (11.4)\t4 (8.1)\t0.71\t\n DDI + 3TC, n (%)\t5 (6.0)\t4 (11.4)\t1 (2.0)\t0.16\t\n Kaletra, n (%)\t1 (1.2)\t0 (0.0)\t1 (2.0)\t1.0\t\nThird drug of cARTa\n\t\n NVP-IR 200 mg twice daily, n (%)\t60 (71.4)\t11 (31.4)\t49 (100)\t<0.001\t\n NVP-IR 400 mg once daily, n (%)\t24 (28.6%)\t24 (68.6)\t0 (0.0)\t<0.001\t\nDuration of continued virological suppression at entering this study, mean days (±SD)\t993 (758)\t1042 (565)\t959 (875)\t0.60\t\nHistory of virological blip before entering this study, n (%)\t10 (11.9)\t3 (8.6)\t7 (14.3)\t0.51\t\nBaseline CD4, mean cells/mm3 (±SD)\t489 (244)\t463 (193)\t508 (276)\t0.41\t\nPatient follow-up, days (±SD)\t552 (170)\t555 (172)\t549 (170)\t0.86\t\n\nMSM men who have sex with men, CKD chronic kidney disease, DDI didanosine, IVDU intravenous drug user, NVP nevirapine, SD standard deviation, TDF tenofovir, 3TC lamivudine\n\n\naIn the NVP-XR group, this means the nNRTIs prescribed prior to switching to NVP-XR-containing HAART\n\n\n\n\nOutcomes of primary and secondary study end points\nCompared with those in the NVP-IR group, virologically suppressed HIV-infected participants in the NVP-XR group demonstrated more or less similar success at maintaining virological response during the mean follow-up time of 18.4 months (NVP-XR vs. NVP-IR: 82.9% vs. 85.7%; P = 0.72) (Table 2). No patients in either group died during the observation period. In the NVP-XR group, one patient developed virological failure, which may have been as a result of poor compliance with cART, according to the chart review. Two patients were withdrawn from NVP-XR: one was suspected of having a hypersensitivity reaction to NVP-XR, and the other was owing to an insufficient supply of the drug. Three patients in the NVP-XR group were lost to follow-up for unknown reasons. In the NVP-IR group, one patient suffered from virological failure. Two patients were withdrawn from NVP-IR because they had NVP-induced hepatitis (one with DAIDS grade 2 and the other, grade 3). Four patients in the NVP-IR group were lost to follow-up. During the observation period, six patients (7.1%) experienced isolated viral blips after entering the study (NVP-XR vs. NVP-IR: 11.4% vs. 4.1%; P = 0.23). There were no differences in CD4+ count changes between the two groups (NVP-XR vs. NVP-IR: 23 cells/mm3 vs. 76 cells/mm3; P = 0.32).Table 2 Outcomes for the 84 virologically suppressed HIV-infected patients entered in this study\n\n\tAll\tNVP-XR\tNVP-IR\t\nP\n\t\n\nN = 84\t\nN = 35\t\nN = 49\t\nAbility to maintain a virological response, n (%)\t71 (84.5)\t29 (82.9)\t42 (85.7)\t0.72\t\nReason for treatment failure\t\n Death, n (%)\t0 (0.0)\t0 (0.0)\t0 (0.0)\t\t\n Switch to other cART due to adverse effect or other cause, n (%)\t4 (4.8)\t2 (5.7) a\n\t2 (4.1)\t1.00\t\n Virological failure, n (%)\t2 (2.4)\t1 (2.9)\t1 (2.0)\t1.00\t\n Loss to follow-up, n (%)\t6 (7.1)\t3 (8.6)\t4 (8.1)\t1.00\t\nVirological blip, n (%)\t6 (7.1)\t4 (11.4)\t2 (4.1)\t0.23\t\nChange from baseline in CD4 T-cells, mean cells/mm3 (± SD)\t14 (122)\t23 (171)\t76 (127)\t0.33\t\n\ncART combined antiretroviral therapy, NVP nevirapine, SD standard deviation\n\n\naOne patient in the NVP-XR group discontinued NVP-XR because of insufficient supply of the drug\n\n\n\n\nThe TLOVR for the two groups is shown in Fig. 2. There were no differences between these groups by log-rank test (P = 0.75). A Cox model adjusted for age, sex, history of AIDS, cART regimen, and duration of virological suppression demonstrated a non-significant difference between the NVP regimens with respect to hazard ratios (HR) for TLOVR (NVP-XR vs. NVP-IR: HR 0.940, 95% CI 0.254–3.484; P = 0.926) (Additional file 1).Fig. 2 Kaplan–Meier survival curves, time to loss of virological response in NVP-XR and NVP-IR groups. No significant difference was detected between the two treatment groups by log-rank test (P = 0.75)\n\n\n\n\nAdverse events among study participants\nThere were no significant differences in AEs between the NVP-XR and NVP-IR groups (Table 3). Observed AEs included gastrointestinal complaints, skin rashes, and liver function abnormalities. One patient in the NVP-XR group found remnants of NVP-XR tablets in his stool. Three of 84 patients (3.6%) discontinued their NVP regimen owing to AEs (Table 2). One patient taking NVP-XR experienced impaired liver function (DAIDS grade 1), low-grade fever, and skin rash 2 weeks after switching, suggesting a hypersensitivity reaction; two patients taking NVP-IR experienced NVP-induced hepatitis (DAIDS grade 2 and grade 3) that improved after switching to atazanavir. The majority of liver function abnormalities were mild (DAIDS grade 1). Higher grade liver function abnormalities (DAIDS grade ≥ 2) were infrequent (NVP-XR vs. NVP-IR: 2.9% vs. 4.1%; P = 1.0). There was one case (2.9%) of grade 4 aspartate transaminase/alanine transaminase levels in the NVP-XR group.Table 3 Adverse effects and liver function abnormality tests of the 84 virologically suppressed HIV-infected patients entered in this study\n\na Comparison of adverse effects between NVP-XR and NVP-IR\t\n\tAll N = 84\tNVP-XR N = 35\tNVP-IR N = 49\t\nP\n\t\nSkin rash, n (%)\t1 (1.2)\t1 (2.9)\t0 (0.0)\t0.42\t\nGastrointestinal disorders, n (%)\t2 (2.4)\t1 (2.9)\t1 (2.0)\t1.0\t\nTablet remnants in stools, n (%)\t1 (2.4)\t1 (2.9)\t0 (0.0)\t0.42\t\nb Comparison of liver function abnormalities between NVP-XR and NVP-IR\t\n\tNVP-XR 400 mg qd (N = 35)\tNVP-IR 200 mg bid (N = 49)\t\nP\n\t\nAST elevation, n (%)\t6 (17.1)\t12 (24.5)\t0.42\t\n\tGrade I\tGrade II\tGrade III\tGrade IV\tGrade I\tGrade II\tGrade III\tGrade IV\t\t\nn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\t\n5 (14.3)\t0 (0)\t0 (0)\t1 (2.9)\t10 (22.4)\t1 (2.0)\t1 (2.0)\t0 (0)\t0.28\t\nALT elevation, n (%)\t9 (25.7)\t16 (32.7)\t0.49\t\n\tGrade I\tGrade II\tGrade III\tGrade IV\tGrade I\tGrade II\tGrade III\tGrade IV\t\t\nn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\t\t\n8 (22.9)\t0 (0)\t0 (0)\t1 (2.9)\t13 (28.6)\t2 (4.1)\t1 (2.0)\t0 (0)\t\t\nBilirubin, n (%)\t1 (2.9)\t0 (0)\t0.42\t\n\tGrade I\tGrade II\tGrade III\tGrade IV\tGrade I\tGrade II\tGrade III\tGrade IV\t\t\nn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\tn (%)\t\t\n1 (2.9)\t0 (0)\t0 (0)\t0 (0)\t0 (0)\t0 (0)\t0 (0)\t0 (0)\t\t\n\nAST aspartate aminotransferase, ALT alanine aminotransferase\n\n(a) Comparison of adverse effects between NVP-XR (n = 35) and NVP-IR (n = 49). (b) Comparison of liver function abnormalities between NVP-XR (n = 35) and NVP-IR (n = 49)\n\n\n\n\nTherapeutic drug monitoring of steady-state plasma NVP concentration: Comparison between NVP-XR and NVP-IR groups\nA total of 48 patients at KVGH were enrolled, to evaluate the impact of CYP2B6 516 polymorphisms on plasma concentrations of NVP from January 1, 2014 to December 31, 2014. A total of 22 patients (22/48, 45.83%, Additional file 2) were matched to patients enrolled in the retrospective part of the current study (22/84, 26.19%), eight patients from the NVP-IR group and 14 from the NVP-XR group. There were no significant differences between these groups in age, sex, height, or weight (Additional file 3). Steady-state plasma NVP concentrations were lower in the NVP-XR group, but this difference did not reach statistical significance (NVP concentration (interquartile range): NVP-XR vs. NVP-IR, 5145.0 ng/mL (4070.0–5740.0 ng/mL) vs. 6775.0 ng/mL (4925.0–8380.0 ng/mL); P = 0.267) (Additional file 3).\n\nGenotype analysis of CYP2B6 516: Comparison between NVP-XR and NVP-IR groups\nAmong the 22 patients participating in monitoring of steady-state plasma NVP concentrations, genotype analysis of CYP2B6 516 was conducted in 15 (15/22, 68.2%) (Additional file 4); genotype analysis was not performed in the remaining seven patients owing to samples with insufficient residual volume. The prevalence of CYP2B6 516 GT was 86.6% (13/15). There was no significant difference in the distribution of CYP2B6 516 between these two groups (Additional file 3).\n\nDiscussion\nTo the best of our knowledge, this small retrospective cohort is the first to investigate the safety and efficacy of switching to NVP-XR from NVP-IR among virologically suppressed HIV-infected patients in Taiwan. Although the TRANxITION study demonstrated non-inferior efficacy and safety of switching virologically suppressed HIV-1-infected patients from NVP-IR to NVP-XR, the results were derived mainly from a Caucasian population. In this retrospective cohort study of virologically suppressed HIV-infected Taiwanese patients, we found that the NVP-XR group was similar to the NVP-IR group with respect to maintaining a virological response. The difference may not have been significant because the numbers of patients were relatively small and the study lacked the power to demonstrate a statistically significant difference. Despite methodological differences, the results of our comparative analyses of virological response indicated worse results compared with those of the TRANxITION study [12]. During NVP-IR therapy, 85.7% and 92.6% of patients in the current and TRANxITION study, respectively, were virologically suppressed. During NVP-XR therapy, 82.9 and 93.6% of patients in the current and TRANxITION studies, respectively, were virologically suppressed. The lower rate of virological response in our study may result from a longer follow-up period, as the mean follow-up times for the current and TRANxITION studies were respectively 18.4 and 6 months. Furthermore, the current study was conducted outside a well-controlled trial setting. Therefore, the efficacy of NVP-IR and NVP-XR in maintaining virological response may be underestimated here owing to a relatively high proportion of LTFU treatment failures in both groups (NVP-IR vs. NVP XR: 50% (3/6) vs. 57% (4/7)), which is inherent to retrospective studies.\n\nBecause previous studies have demonstrated a significant relationship between NVP trough plasma concentrations and virological response, [13, 28] we further investigated the NVP trough concentrations in both NVP-IR and NVP-XR groups. The median of trough plasma concentrations was 6775.0 ng/mL for NVP-IR and 5145.0 ng/mL for NVP-XR in our study (Additional file 3). The plasma concentrations of NVP in both groups are higher than the Ctrough of 3.0 mg/L recommended in most guidelines [15] or Ctrough of 3.9 μg/mL for Chinese patients in a recent study [22]. The non-significant difference of NVP trough concentrations between these two groups may be owing to the small sample size in each group. This finding is compatible with previous studies, which demonstrated a lower Ctrough with NVP-XR therapy compared with 200 mg NVP-IR twice daily [11, 23].\n\nWe believe that there was no obvious selection bias between patients receiving NVP-XR and NVP-IR who also underwent therapeutic drug monitoring of steady-state plasma NVP concentration in the current study. Compliance, drug–drug interactions, and differences in pharmacokinetics are critical factors that influence the plasma concentrations of antiretroviral drugs [29]. Our patient population was assumed to be reasonably compliant because they had maintained a stable virological response to NVP-containing cART prior to entering the study, and all participants remained virologically suppressed for at least 1–4 months (duration of continued virological suppression at entering this study, days (±SD): NVP-XR vs. NVP-IR, 1042 (565) vs. 959 (875); P = 0.60). Additionally, these patients only received antiretroviral agents and did not take any other prescribed medicine concomitantly. Finally, genotype analysis of CYP2B6 516 in 15 patients also revealed no significant difference in CYP2B6 516 polymorphisms between these two groups.\n\nSurprisingly, however, our study demonstrated higher Ctrough levels in both groups compared with other studies conducted in the Netherlands, [30] Germany, [31] and Canada [32]. This difference may result from a higher prevalence of CYP2B6 516 GT in our study population (86.6%) compared with other reports of Han Chinese, [33] Caucasians, [29] and Taiwanese in northern Taiwan [21]. Our finding of a high prevalence of CYP2B6 516 GT in the current study requires further verification in a larger Taiwanese population.\n\nMaximal and durable suppression of plasma HIV viral load has now been established as the primary aim of antiretroviral treatment for both treatment-naïve and treatment-experienced patients [24]. However, viral replication is still not fully controlled in all patients at all times, and transient viremia, often between 50 and 400 copies/mL (a virological blip) has been frequently reported [34]. However, the impact of HIV RNA blips on virological failure remains controversial [35, 36]. In the ACTG 343 and Merck 035 trials, treatment-experienced patients who had virological blips did not have an increased risk of virological failure compared with patients with continuing virological suppression [35]. However, the Swiss HIV Cohort and Frankfurt HIV Clinic Cohort studies showed a slightly increased risk of virological failure for patients with one or more virological blips compared with viral suppression (HR 2.01, 95% CI 1.51–2.91; P < 0.0001) [36]. In our cohort study, six of 84 patients (7.1%) experienced a virologic blip during the 18.4-month follow-up. In Cox regressions adjusted for age, sex, history of AIDS, cART regimen, and history of virological suppression, the HR of viral blips was 1.023 (P = 1.00) for the NVP-XR group compared with the NVP-IR group. The relationship between viral blip and virological failure in Taiwanese patients requires further investigation in a larger population.\n\nThe current study has several limitations and biases inherent to retrospective cohort studies, the first being selection bias. Second, there were significant differences in cART backbone drugs between the NVP-XR and NVP-IR groups. However, the CNA30024 study comparing the durability of viral effect and the safety profile of triple therapy with either abacavir or zidovudine, combined with lamivudine and efavirenz, demonstrated similar virological suppression (HIV RNA ≤ 50 copies/mL) in treatment-naïve patients at week 48 (abacavir group vs. zidovudine group: 70% vs. 69%) [37]. Third, it is difficult to determine patient compliance with medications from retrospective chart reviews. This is important because adherence to treatment is closely related to sustained viral suppression [38]. As mentioned above, we believe that our patient population was reasonably compliant because only patients with virological suppression for at least 1–4 months were included. Finally, the frequency of adverse reactions to NVP in both groups may be underestimated. Although the frequency of moderate to severe liver function abnormalities is similar to that of the TRANxITION study, it is likely that we missed some low-grade skin rashes and gastrointestinal disorders that did not require modification of the antiretroviral regimen.\n\nConclusions\nIn this retrospective study, we found that switching from cART regimens with twice-daily doses of 200 mg NVP-IR to a once-daily dose of 400 mg NVP-XR appeared nearly as safe and effective as continuing NVP-IR in virologically suppressed HIV-infected Taiwanese patients. Our findings of higher Ctrough levels in both groups compared with other studies conducted among Caucasian populations may be due to the high prevalence of CYP2B6 516 intermediate/low metabolizers in the present study.\n\nAdditional files\n\nAdditional file 1: Multivariate analysis of treatment failure in 84 virologically suppressed HIV-infected patients. In Cox regression, the hazard ratios for TLOVR between NVP regimen (NVP-XR vs. NVP-IR) was 0.940 (95% CI, 0.254–3.484; P = 0.926). (DOCX 14 kb)\n\n \nAdditional file 2: Comparison of demographic characteristics, steady-state plasma concentration of NVP, and genotype analysis of CYP2B6 516 in 48 HIV-infected patients enrolled in KVGH from January 1, 2014 to December 31, 2014, by patients enrolled or not enrolled in the retrospective part of the current study. The 22 patients enrolled in the retrospective analysis of the current study were older (37 vs. 27.5, P < 0.001) and heavier (74.5 kg vs. 64.8 kg, P = 0.021) than the 26 patients not enrolled in the retrospective analysis of the current study. There were no significant differences between these two groups in sex, height, the steady-state plasma NVP concentration, and genotype analysis of CYP2B6 516. (DOCX 15 kb)\n\n \nAdditional file 3: Demographic characteristics, steady-state plasma concentration of NVP, and genotype analysis of CYP2B6 516 of 22 virologically suppressed, HIV-infected patients enrolled in this study, by NVP regimens. There were no significant differences between NVP-XR and NPV-IR in age, sex, height, weight, steady-state plasma NVP concentrations, and genotype analysis of CYP2B6 516. (DOCX 15 kb)\n\n \nAdditional file 4: PCR-restriction fragment length polymorphism analysis of CYP2B6 516. Three cases (A, B, C) participating in genotype analysis of CYP2B6 516 in the current study are shown. Lane M represents a size marker. After digestion with BsrI restriction enzyme, wild-type GG (case B) is visible as one band of 152 base pair. Heterozygous GT (case C) is visible as two bands (152 base pair and 204 base pair); homozygous mutant TT (case A) is visible as one band of 204 base pair. (PPTX 122 kb)\n\n \n\n\nAbbreviations\nAEAdverse events\n\ncARTCombined antiretroviral therapy\n\nDAIDSDivision of Acquired Immunodeficiency Syndrome\n\nHAARTHighly active antiretroviral therapy\n\nHPLCHigh-performance liquid chromatography\n\nHRHazard ratio\n\nKVGHKaohsiung Veterans General Hospital\n\nLTFUlost to follow-up\n\nNRTINucleoside reverse transcriptase inhibitor\n\nNVP-IRNevirapine immediate-release\n\nNVP-XRNevirapine extended-release\n\nPCRPolymerase chain reaction\n\nPKPharmacokinetic\n\nTLOVRTime to loss of virological response\n\nVLViral load\n\nAcknowledgements\nNot applicable.\n\nFunding\nThis study was funded by Veterans General Hospitals and University System of Taiwan Joint Research Programme grant.\n\nAvailability of data and materials\nThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\n\nAuthors’ contributions\nC-YL and H-MC conceived and designed the study, and drafted the manuscript. CMK, S S-JL, and Y-SC analyzed and interpreted the data. H-CT analyzed and interpreted the data, and critically revised the manuscript. All authors read and approved the final manuscript.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nConsent for publication\nNot applicable.\n\nEthics approval and consent to participate\nThis study was approved by the KVGH ethics committee (VGHKS14-CT7–22 and VGHKS14-CT2–13) and adhered to the principles of the Declaration of Helsinki. Informed consent was obtained from participants who received therapeutic drug monitoring of plasma nNRTI concentrations and genotype analysis of CYP450 polymorphisms.\n\nPublisher’s note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and Institutional affiliations.\n==== Refs\nReferences\n1. Lockman S Hughes M Sawe F Zheng Y McIntyre J Chipato T Nevirapine- versus lopinavir/ritonavir-based initial therapy for HIV-1 infection among women in Africa: a randomized trial PLoS Med 2012 9 10.1371/journal.pmed.1001236 22719231 \n2. Soriano V Arasteh K Migrone H Lutz T Opravil M Andrade-Villanueva J Nevirapine versus atazanavir/ritonavir, each combined with tenofovir disoproxil fumarate/emtricitabine, in antiretroviral-naive HIV-1 patients: the ARTEN trial AntivirTher 2011 16 339 348 \n3. Waters L John L Nelson M Non-nucleoside reverse transcriptase inhibitors: a review Int J Clin Pract 2007 61 105 118 10.1111/j.1742-1241.2006.01146.x 17229185 \n4. Stone VE Jordan J Tolson J Miller R Pilon T Perspectives on adherence and simplicity for HIV-infected patients on antiretroviral therapy: self-report of the relative importance of multiple attributes of highly active antiretroviral therapy (HAART) regimens in predicting adherence J Acquir Immune Defic Syndr 2004 36 808 816 10.1097/00126334-200407010-00007 15213564 \n5. Gallant JE DeJesus E Arribas JR Pozniak AL Gazzard B Campo RE Tenofovir DF, emtricitabine, and efavirenz vs. zidovudine, lamivudine, and efavirenz for HIV N Engl J Med 2006 354 251 260 10.1056/NEJMoa051871 16421366 \n6. Calmy A Vallier N Nguyen A Lange JM Battegay M de Wolf F Safety and efficacy of once-daily nevirapine dosing: a multicohort study Antivir Ther 2009 14 931 938 10.3851/IMP1418 19918097 \n7. van Leth F Phanuphak P Ruxrungtham K Baraldi E Miller S Gazzard B Comparison of first-line antiretroviral therapy with regimens including nevirapine, efavirenz, or both drugs, plus stavudine and lamivudine: a randomised open-label trial, the 2NN study Lancet 2004 363 1253 1263 10.1016/S0140-6736(04)15997-7 15094269 \n8. Podzamczer D Olmo M Sanz J Boix V Negredo E Knobel H Safety of switching Nevirapine twice daily to Nevirapine once daily in Virologically suppressed patients J Acquir Immune Defic Syndr 2009 50 390 396 10.1097/QAI.0b013e318198a0cc 19214120 \n9. Macha S Yong CL Darrington T Davis MS MacGregor TR Castles M In vitro–in vivo correlation for nevirapine extended release tablets Biopharm Drug Dispos 2009 30 542 550 10.1002/bdd.691 19876936 \n10. Quinson A Arasteh K Plettenberg A Bogner J Boue F Livrozet JM Steady state evaluation of two extended release (XR) nevirapine (NVP) tablets 400 mg QD compared with immediate release (IR) NVP tablets 200 mg BID in HIV-1 infected patients; 49th Interscience conference of antimicrobial agents and chemotherapy 2009 \n11. Gathe J Andrade-Villanueva J Santiago S Horban A Nelson M Cahn P Efficacy and safety of nevirapine extended-release once daily versus nevirapine immediate-release twice-daily in treatment-naive HIV-1-infected patients Antivir Ther 2011 16 759 769 10.3851/IMP1803 21817198 \n12. Arasteh K Ward D Plettenberg A Livrozet JM Orkin C Cordes C Twenty-four-week efficacy and safety of switching virologically suppressed HIV-1-infected patients from nevirapine immediate release 200 mg twice daily to nevirapine extended release 400 mg once daily (TRANxITION) HIV Med 2012 13 236 244 22136068 \n13. de Vries-Sluijs TE Dieleman JP Arts D Huitema AD Beijnen JH Schutten M Low nevirapine plasma concentrations predict virological failure in an unselected HIV-1-infected population Clin Pharmacokinet 2003 42 599 605 10.2165/00003088-200342060-00009 12793844 \n14. Veldkamp AI Weverling GJ Lange JM Montaner JS Reiss P Cooper DA High exposure to nevirapine in plasma is associated with an improved virological response in HIV-1-infected individuals AIDS 2001 15 1089 1095 10.1097/00002030-200106150-00003 11416710 \n15. Higgins N Tseng A Sheehan NL la Porte CJ Antiretroviral therapeutic drug monitoring in Canada: current status and recommendations for clinical practice Can J Hosp Pharm 2009 62 500 509 22478939 \n16. Moltó J Blanco A Miranda C Miranda J Puig J Valle M Variability in non-nucleoside reverse transcriptase and protease inhibitors concentrations among HIV-infected adults in routine clinical practice Br J Clin Pharmacol 2007 63 715 721 10.1111/j.1365-2125.2006.02834.x 17223856 \n17. Chou M, Bertrand J, Segeral O, Verstuyft C, Borand L, Comets E, et al. Population pharmacokinetic-pharmacogenetic study of nevirapine in HIV-infected Cambodian patients. Antimicrob Agents Chemother. 2010;54:4432–9.\n18. Stohr W Back D Dunn D Sabin C Winston A Gilson R Factors influencing efavirenz and nevirapine plasma concentration: effect of ethnicity, weight and co-medication Antivir Ther 2008 13 675 685 18771051 \n19. Schipani A Wyen C Mahungu T Hendra H Egan D Siccardi M Integration of population pharmacokinetics and pharmacogenetics: an aid to optimal nevirapine dose selection in HIV-infected individuals J Antimicrob Chemother 2011 66 1332 1339 10.1093/jac/dkr087 21441248 \n20. Lehr T Yuan J Hall D Zimdahl-Gelling H Schaefer HG Staab A Integration of absorption, distribution, metabolism, and elimination genotyping data into a population pharmacokinetic analysis of nevirapine Pharmacogenet Genomics 2011 21 721 730 10.1097/FPC.0b013e32834a522e 21860339 \n21. Lee K-Y Lin S-W Sun H-Y Kuo CH Tsai MS Wu BR Therapeutic drug monitoring and pharmacogenetic study of HIV-infected ethnic Chinese receiving efavirenz-containing antiretroviral therapy with or without rifampicin-based anti-tuberculous therapy PLoS One 2014 9 10.1371/journal.pone.0088497 24551111 \n22. Wang J Kou H Fu Q Han Y Qiu Z Zuo L Nevirapine plasma concentrations are associated with virologic response and hepatotoxicity in Chinese patients with HIV infection PLoS One 2011 6 10.1371/journal.pone.0026739 22066007 \n23. Lepik KJ, Yip B, McGovern RA, Ding E, Nohpal A, Watson BE, et al. Post-marketing experience with nevirapine extended release (XR) tablets: effectiveness and tolerability in a population-based cohort in British Columbia, Canada. Antivir Ther. 2015;20:721-730.\n24. Department of Health and Human Services Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents 2017 1 288 \n25. Rezk NL Tidwell RR Kashuba AD Simultaneous determination of six HIV nucleoside analogue reverse transcriptase inhibitors and nevirapine by liquid chromatography with ultraviolet absorbance detection J Chromatogr B Analyt Technol Biomed Life Sci 2003 791 137 147 10.1016/S1570-0232(03)00224-1 12798174 \n26. Ariyoshi N Miyazaki M Toide K Yi S Kamataki T A single nucleotide polymorphism of CYP2B6 found in Japanese enhances catalytic activity by autoactivation Biochem Biophys Res Commun 2001 281 1256 1260 10.1006/bbrc.2001.4524 11243870 \n27. Ramachandran G Kumar AH Rajasekaran S Kumar P Ramesh K Anitha S CYP2B6 G516T polymorphism but not rifampin coadministration influences steady-state pharmacokinetics of efavirenz in human immunodeficiency virus-infected patients in South India Antimicrob Agents Chemother 2009 53 863 868 10.1128/AAC.00899-08 19124658 \n28. Duong M Buisson M Peytavin G Kohli E Piroth L Martha B Low trough plasma concentrations of nevirapine associated with virologic rebounds in HIV-infected patients who switched from protease inhibitors Ann Pharmacother 2005 39 603 609 10.1345/aph.1E563 15713788 \n29. Russo G Paganotti GM Soeria-Atmadja S Haverkamp M Ramogola-Masire D Vullo V Pharmacogenetics of non-nucleoside reverse transcriptase inhibitors (NNRTIs) in resource-limited settings: influence on antiretroviral therapy response and concomitant anti-tubercular, antimalarial and contraceptive treatments Infect Genet Evol 2016 37 192 207 10.1016/j.meegid.2015.11.014 26602158 \n30. van Heeswijk RP Veldkamp AI Mulder JW Meenhorst PL Wit FW Lange JM The steady-state pharmacokinetics of nevirapine during once daily and twice daily dosing in HIV-1-infected individuals AIDS 2000 14 F77 F82 10.1097/00002030-200005260-00001 10853971 \n31. Von Hentig N Carlebach A Gute P Knecht G Klauke S Rohrbacher M A comparison of the steady-state pharmacokinetics of nevirapine in men, nonpregnant women and women in late pregnancy Br J Clin Pharmacol 2006 62 552 559 10.1111/j.1365-2125.2006.02664.x 17061962 \n32. Lepik KJ Yip B McGovern RA Ding E Nohpal A Watson BE Post-marketing experience with nevirapine extended release (XR) tablets: effectiveness and tolerability in a population-based cohort in British Columbia Canada. Antivir Ther. 2015 20 721 30 10.3851/IMP2908 25960569 \n33. Guan S, Huang M, Chan E, Chen X, Duan W, Zhou SF. Genetic polymorphisms of cytochrome P450 2B6 gene in Han Chinese. Eur J Pharm Sci. 2006;29:14–21.\n34. Pozniak A Gupta RK Pillay D Arribas J Hill A Causes and consequences of incomplete HIV RNA suppression in clinical trials HIV Clin Trials. 2009 10 289 98 10.1310/hct1005-289 19906623 \n35. Havlir DV, Bassett R, Levitan D, Gilbert P, Tebas P, Collier AC, et al. Prevalence and predictive value of intermittent viremia with combination hiv therapy. JAMA. 2001;286:171–9.\n36. Greub G Cozzi-Lepri A Ledergerber B Staszewski S Perrin L Miller V Intermittent and sustained low-level HIV viral rebound in patients receiving potent antiretroviral therapy AIDS. 2002 16 1967 9 10.1097/00002030-200209270-00017 12351960 \n37. DeJesus E Herrera G Teofilo E Gerstoft J Buendia CB Brand JD Abacavir versus zidovudine combined with lamivudine and efavirenz, for the treatment of antiretroviral-naive HIV-infected adults Clin Infect Dis. 2004 39 1038 46 10.1086/424009 15472858 \n38 Oette M, Kroidl A, Gobels K, Stabbert A, Menge M, Sagir A, et al. Predictors of short-term success of antiretroviral therapy in HIV infection. J Antimicrob Chemother. 2006;58:147–53.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2334",
"issue": "17(1)",
"journal": "BMC infectious diseases",
"keywords": "Antiretroviral therapy; Human immunodeficiency virus; Nevirapine",
"medline_ta": "BMC Infect Dis",
"mesh_terms": "D000328:Adult; D019380:Anti-HIV Agents; D003692:Delayed-Action Preparations; D004334:Drug Administration Schedule; D016903:Drug Monitoring; D005060:Europe; D005260:Female; D015658:HIV Infections; D015497:HIV-1; D006801:Humans; D008297:Male; D008875:Middle Aged; D019829:Nevirapine; D012189:Retrospective Studies; D013624:Taiwan",
"nlm_unique_id": "100968551",
"other_id": null,
"pages": "261",
"pmc": null,
"pmid": "28399808",
"pubdate": "2017-04-11",
"publication_types": "D016428:Journal Article",
"references": "12798174;21860339;20696882;25960569;18771051;26602158;15213564;19214120;16815693;22136068;19906623;22719231;17229185;10853971;19876936;11243870;17061962;21555816;15094269;19124658;24551111;17223856;21817198;22478939;11416710;16421366;15713788;11448280;21441248;16687458;15472858;12351960;22066007;12793844;19918097",
"title": "Efficacy and safety of switching from nevirapine immediate-release twice daily to nevirapine extended-release once daily in virologically suppressed HIV-infected patients: a retrospective cohort study in Taiwan.",
"title_normalized": "efficacy and safety of switching from nevirapine immediate release twice daily to nevirapine extended release once daily in virologically suppressed hiv infected patients a retrospective cohort study in taiwan"
} | [
{
"companynumb": "TW-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-025957",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NEVIRAPINE"
},
"... |
{
"abstract": "Anti-programmed cell death 1 (anti-PD1) antibodies such as pembrolizumab have shown improved progression-free and overall survival in patients with advanced melanoma. Of 124 patients reviewed in Westmead Hospital from May 2012 to November 2015, treated with pembrolizumab for advanced melanoma, we encountered three cases of bullous pemphigoid (BP). We have previously reported a case of BP. In two recent cases, BP was diagnosed early and treated promptly with potent topical or oral steroid. Patients on anti-PD1 antibodies are at a higher risk of developing cutaneous immune-related adverse events such as lichenoid reactions, eczema and vitiligo. No cases of BP were encountered in the previously published cohort of 260 melanoma patients treated with BRAF inhibitors; as such, it appears that BP is associated with anti-PD1 treatment rather than metastatic melanoma. BP appears to be another immune-related adverse event, and clinicians should have a low threshold for performing cutaneous biopsies and immunofluorescence studies in patients on anti-PD1 therapies.",
"affiliations": "Departments of aDermatology bTissue Pathology and Diagnostic Oncology cCrown Princess Mary Cancer Centre, Westmead Hospital dSydney Medical School, The University of Sydney eMelanoma Institute Australia, Sydney, New South Wales, Australia.",
"authors": "Hwang|Shelley J E|SJ|;Carlos|Giuliana|G|;Chou|Shaun|S|;Wakade|Deepal|D|;Carlino|Matteo S|MS|;Fernandez-Penas|Pablo|P|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C105992:PDCD1 protein, human; D061026:Programmed Cell Death 1 Receptor; C582435:pembrolizumab",
"country": "England",
"delete": false,
"doi": "10.1097/CMR.0000000000000260",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0960-8931",
"issue": "26(4)",
"journal": "Melanoma research",
"keywords": null,
"medline_ta": "Melanoma Res",
"mesh_terms": "D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D018572:Disease-Free Survival; D006801:Humans; D008297:Male; D008545:Melanoma; D010391:Pemphigoid, Bullous; D061026:Programmed Cell Death 1 Receptor; D012878:Skin Neoplasms",
"nlm_unique_id": "9109623",
"other_id": null,
"pages": "413-6",
"pmc": null,
"pmid": "27031539",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bullous pemphigoid, an autoantibody-mediated disease, is a novel immune-related adverse event in patients treated with anti-programmed cell death 1 antibodies.",
"title_normalized": "bullous pemphigoid an autoantibody mediated disease is a novel immune related adverse event in patients treated with anti programmed cell death 1 antibodies"
} | [
{
"companynumb": "AU-PFIZER INC-2016381749",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "IPILIMUMAB"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nStevens-Johnson syndrome is one of the manifestations of mucocutaneous adverse drug reactions. Although antimicrobials are responsible for greater than 50% of these adverse drug reactions, there is no documented case implicating ivermectin as the culprit. A 38 year old adult Cameroonian male presented to our health facility with facial rash, painful oral sores, black eschars on lips and red tearing eyes 3 days following ingestion of ivermectin received during a nationwide anti-filarial campaign. He had no known chronic illness, no known allergies and was not on any medications prior to the campaign. Physical examination revealed discharging erythematous eyes, crusted and blister-like lesions with cracks on his lips and oral mucosa. His laboratory tests were unremarkable but for a positive Human Immunodeficiency Virus (HIV) test. A diagnosis of Ivermectin induced Stevens-Johnson syndrome in a newly diagnosed HIV patient was made. The patient was managed with supportive therapy and the evolution thereafter was favourable.\n\n\nCONCLUSIONS\nStevens-Johnson syndrome is a potential side effect of ivermectin and susceptibility to this adverse effect may be increased in HIV infection.",
"affiliations": "Nkwen Baptist Health Center, Bamenda, Cameroon. arokedess@hotmail.com.;Health and Human Development (2HD) Research Group, Douala, Cameroon.;Mboppi Baptist Hospital, Douala, Cameroon.;Universite Libre Brussels, Brussels, Belgium.;Bali Kumbat Sub-Divisional Hospital, Bali Kumbat, Cameroon.;Presbyterian General Hospital Acha-Tugi, Acha, Cameroon.",
"authors": "Aroke|Desmond|D|http://orcid.org/0000-0001-7557-7777;Tchouakam|Diego Nitcheu|DN|;Awungia|Alexis Tazinya|AT|;Mapoh|Sylvester Yari|SY|;Ngassa|Stewart Ndutard|SN|;Kadia|Benjamin Momo|BM|",
"chemical_list": "D000977:Antiparasitic Agents; D007559:Ivermectin",
"country": "England",
"delete": false,
"doi": "10.1186/s13104-017-2500-5",
"fulltext": "\n==== Front\nBMC Res NotesBMC Res NotesBMC Research Notes1756-0500BioMed Central London 250010.1186/s13104-017-2500-5Case ReportIvermectin induced Steven–Johnsons syndrome: case report http://orcid.org/0000-0001-7557-7777Aroke Desmond arokedess@hotmail.com 12Tchouakam Diego Nitcheu tchouakam2004@yahoo.co.uk 23Awungia Alexis Tazinya aawung@yahoo.com 4Mapoh Sylvester Yari mapoh2007@yahoo.com 5Ngassa Stewart Ndutard stewart.ndutard3@gmail.com 6Kadia Benjamin Momo benjaminmomokadia@yahoo.com 71 Nkwen Baptist Health Center, Bamenda, Cameroon 2 Health and Human Development (2HD) Research Group, Douala, Cameroon 3 Roua District Hospital, Roua, Cameroon 4 Mboppi Baptist Hospital, Douala, Cameroon 5 Universite Libre Brussels, Brussels, Belgium 6 Bali Kumbat Sub-Divisional Hospital, Bali Kumbat, Cameroon 7 Presbyterian General Hospital Acha-Tugi, Acha, Cameroon 8 5 2017 8 5 2017 2017 10 17926 1 2017 27 4 2017 © The Author(s) 2017\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nStevens–Johnson syndrome is one of the manifestations of mucocutaneous adverse drug reactions. Although antimicrobials are responsible for greater than 50% of these adverse drug reactions, there is no documented case implicating ivermectin as the culprit.\n\nCase summary\nA 38 year old adult Cameroonian male presented to our health facility with facial rash, painful oral sores, black eschars on lips and red tearing eyes 3 days following ingestion of ivermectin received during a nationwide anti-filarial campaign. He had no known chronic illness, no known allergies and was not on any medications prior to the campaign. Physical examination revealed discharging erythematous eyes, crusted and blister-like lesions with cracks on his lips and oral mucosa. His laboratory tests were unremarkable but for a positive Human Immunodeficiency Virus (HIV) test. A diagnosis of Ivermectin induced Stevens–Johnson syndrome in a newly diagnosed HIV patient was made. The patient was managed with supportive therapy and the evolution thereafter was favourable.\n\nConclusion\nStevens–Johnson syndrome is a potential side effect of ivermectin and susceptibility to this adverse effect may be increased in HIV infection.\n\nKeywords\nIvermectinStevens–Johnson syndrome (SJS)Human immunodeficiency virus (HIV)issue-copyright-statement© The Author(s) 2017\n==== Body\nBackground\nStevens-Johnson syndrome (SJS), a form of mucocutaneous adverse reaction affecting <10% of body surface area is almost always drug related [1–3]. Antimicrobials are thought to be the most common cause of SJS. The antimicrobials often implicated are sulphonamides, penicillins, anti-tuberculoses drugs and anti-retrovirals [4, 5]. Cases of SJS have been reported with other antimicrobials such as fluconazole and streptomycin, not known to be typical causes of SJS [6, 7]. Furthermore, ingestion of paracetamol is implicated in very few cases of SJS [8]. However, to the best of our knowledge, no case of ivermectin induced SJS has been previously described in literature. Studies have also shown that there is an increase occurrence of cutaneous drug reactions seen in patients with human immunodeficiency virus (HIV) infection [9].\n\nWe herein report the case of a patient who presented with SJS following ingestion of ivermectin and subsequently tested human immunodeficiency virus (HIV) positive.\n\nCase presentation\nA 38 year old Cameroonian married male, presented to our health service with facial rash, oral mucosa sores and discharging eyes of 2 days duration.\n\nHe reported being apparently well till 3 days prior to presentation when he ingested ivermectin 12 mg per os single dose served during a nationwide anti-filarial campaign. A day later (2 days prior to presentation), he noticed blisters on his lips which later extended to involve his oral mucosa. This was associated with pains on chewing and soreness of his entire oral mucosa which impaired feeding. Rashes developed on his face simultaneously. The rashes were itchy, scaly and extending towards the hairline. A day prior to consultation, his eyes became reddish and discharged clear fluid. The eyes were itchy and painful. The patient did not have fever and there were no other associated symptoms. Inability to feed well and his disfigured face prompted consultation in our health facility.\n\nOn reviewing his past medical history, he denied taking other medications including paracetamol prior to the onset of the symptoms. He however admitted taking a similar dose of ivermectin 1 year earlier during a similar campaign with no reactions. His wife was HIV positive and on highly active antiretroviral therapy. He reported that he was last tested for HIV 6 months prior to presentation and the test was negative. He did not provide any record of the test results. He had no known chronic illness and denied having any known drug or food allergies.\n\nOn examination he was ill looking and in painful distress. There was a scarf around his face covering the oral lesions. The conjunctivae and sclerae were reddish and there was no cervical lymphadenopathy. His vital signs were within normal limits; blood pressure was 118/70 mmHg, heart rate; 84 beats/min, respiratory rate; 20 breaths/min, temperature; 37.2 °C, O2 saturation; 98% and weight 64 kg. There were desquamating hyper-pigmented rashes on his face with whitish plaques. The rashes were on the nasal bridge and extended to the malar area, sparing the nostrils. There were black eschars and erythematous erosions on the lips with sores and blisters in the oral mucosa (Figs. 1, 2). His eyes were erythematous, tearing and had sticky secretions that made his eyelids difficult to separate. There were no other skin lesions and the rest of his examination was normal.Fig. 1 Photo of lesions on the lips\n\n\nFig. 2 Photo of facial rash\n\n\n\n\nBased on the clinical picture, a diagnosis of SJS was made with a differential of Lyell’s syndrome. Patient was counselled and tested for HIV. His test result was positive. A repeat 1st line test and second line test confirmed HIV seropositivity. Following HIV seropositivity, a CD4 count done to evaluate his immunological status was 568 cells/mm3. Other baseline tests revealed normal full blood count, liver enzymes and kidney function tests.\n\nHis management was mainly supportive: steroids (Dexamethasone 4 mg intramuscular route single dose, then prednisone 5 mg tablet: 4 tablets twice daily for 7 days then 2 tablets twice daily for 5 days and 1 tablet twice daily for 3 days), oral antihistamines (chlorpheniramine 4 mg tablets: 1 tablet twice daily for 10 days), antibiotic eye drops (ciprofloxacine eye drop: 1 drop on both eyes twice daily for 10 days), oral hygiene and nutritional support. He was reviewed a week later with much improved lesions and on week 3, most of the lesions had resolved.\n\nDiscussion\nAdverse drug reactions (ADRs) are on the rise, being responsible for about 6% of hospital admissions [10]. Cutaneous adverse drug reactions (CADRs) such as skin rashes, itches, urticaria, exfoliative dermatitis, Stevens–Johnson syndrome and Lyell’s syndrome are the most common manifestations of ADRs [11, 12]. SJS which is defined by an involvement of less than 10% of the epidermis, is a rare but potentially fatal form of CADR with a mortality of 5–15% [1, 11, 13]. Though SJS is thought to have varied causes, medications are most commonly implicated [2, 14]. Amongst medications, antimicrobials are most commonly associated with SJS [4].\n\nSeveral antimicrobials have been implicated in SJS, with varying severities. Those with strong associations include sulphonamides (sulphadoxine, sulphadiazine, sulphasalazine and cotrimoxazole) and aminopenicillins (amoxicillin and ampicillin). While those which are less frequently associated SJS are: cephalosporins, floroquinolones, vancomicin, and antituberculose drugs (rifampicin and ethambutol) [11]. Cases of SJS have been reported with other antimicrobials not known to be typical causes of SJS such as fluconazole and streptomycin [6, 7]. A recent survey on the 25 year clinical use of ivermectin confirmed ivermectin to have a high margin of safety [15]. More so, a pubmed, google scholar, AJOL and HINARI search with keywords; ivermectin, SJS, side effects and case report showed that there was no preliminary report on ivermectin-induced SJS.\n\nThe mechanisms involved in the pathogenesis of SJS are still unclear, though reactive drug metabolites and immunological mechanisms have been suggested [16]. Reports suggest that metabolisms involved in the pathogenesis of CADRs involve interplay between activation and detoxification mechanisms. This imbalance may be as a result of inherited or acquired deficiency in enzymes required for detoxification. Also CADRs may result from increased levels of isoforms of cytochrome P450 responsible for obtaining drug metabolites from associated drugs. Increased level of substances serving as possible immunogens or cytotoxic agents may thus result from these metabolic discrepancies [17].\n\nUnderlying diseases, especially those that impair immunity such as infection with HIV, may also have an inducing role in the development of SJS [2, 18]. HIV seropositive patients have a higher incidence of SJS [14]. Several mechanisms have been proposed to explain the high incidence of CADRs in patients with HIV amongst which is glutathione deficiency, as glutathione conjugation of reactive metabolites and subsequent excretion is impaired [17]. Accumulated levels of these metabolites may therefore account for the higher occurrence of CADRs in HIV patients.\n\nIvermectin an extract of the fungus streptomyces avermitilis, is a semi-synthetic macrolide antibiotic of the class avermectin. It acts by attaching to glutamate-activated chloride channels, leading to increased influx of chloride [19]. Ivermectin is recommended for the treatment of onchocerciasis, cutaneous larva migrans and strongyloidosis [20]. It has also been shown to be efficacious in the management of scabies and myiasis [21, 22]. Onchocerciasis still remains a major problem in African countries [23, 24]. The Cameroon government in line with the world health organization’s African Programme for Onchocerciasis Control recommendations [25], intermittently provides ivermectin to its citizens as a mean of controlling and eliminating onchocerciasis. Ivermectin is metabolized by cytochrome P450 enzymes particularly the isozymes CYP3A4 and less so by the isozymes CYP2D6 and CYP2E1 [26]. We could therefore assume that cytochrome P450 metabolic idiosyncracies and/or deficiency of glutathione secondary to HIV infection are the main mechanisms responsible for this CADR.\n\nTo the best of our knowledge ivermectin has not been implicated as a cause of SJS in medical literature. That notwithstanding, clarithromycin another macrocyclic lactone (macrolide) though not of the avermectin family has been reported as a cause of CADRs [5]. Table 1 compares our patient to the patient with clarithromycin induced CADRs.Table 1 Comparison of clinical profile and outcome in patients with macrolide induced CADRs\n\nCharacteristics\tIvermectin (our patient)\tClarithromycin [5]\t\nAge\t38 years\t20 years\t\nGender\tMale\tFemale\t\nType of reaction\tSJS\tLyell’s syndrome\t\nHIV status\tPositive\tNegative\t\nComplication\tNone\tSeptic shock\t\nOutcome\tLesions resolved and patient alive\tLesions persisted and patient died\t\n\n\n\nThough controversial clinical profiles and outcomes, SJS is a possible side effect of macrolides, avermectins being inclusive.\n\nThe patient in this report had previously ingested ivermectin at same dose with no reaction. He however developed CADRs only following present intake. This may suggest that SJS here is idiosyncratic (dose independent) [27]. A year earlier during previous ingestion of ivermectin the patient was HIV negative (HIV negative test 6 months prior to consultation, though undocumented). He however developed SJS during subsequent ingestion of the drug following which he had seropositivity of HIV. There might thus be a link between HIV infection and ivermectin induced SJS.\n\nConclusion\nThe case presented suggests that ivermectin is a possible cause of SJS which is a potentially life threatening complication of CADRs. Even though HIV increases risk of SJS, it remains unclear whether SJS in this patient was solely caused by ivermectin or by ivermectin influenced by concomitant HIV infection. The general population and in particular HIV infected individuals should be informed of this potentially fatal complication prior to and during such mass campaigns. Health workers should remain vigilant during such events.\n\nAbbreviations\nSJSStevens–Johnson syndrome\n\nCADRscutaneous adverse drug reactions\n\nHIVhuman immunodeficiency virus\n\nAuthors’ contributions\nDA participated in the management of the patient and wrote the manuscript. DNT, ATA, SYM and SNN read and edited the manuscript. BMK made a critical review of the manuscript. All authors read and approved the final manuscript.\n\nAcknowledgements\nWe acknowledge and thank the patient who accepted publication of his case.\n\nThe 2HD which is a research group supported by a Cruddas Link Fellowship to Pr S.P. Choukem (Harris Manchester College, University of Oxford, UK).\n\nCompeting interests\nAll authors declare that they have no competing interests.\n\nConsent for publication\nThe patient gave written informed consent for the publication of this case report and any accompanying images.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Paulmann M Mockenhaupt M Severe drug-induced skin reactions: clinical features, diagnosis, etiology, and therapy J Dtsch Dermatol Ges 2015 13 7 625 645 26110722 \n2. Tiwari P Panik R Bhattacharya A Ahirwar D Chandy A Toxic epidermal necrolysis : an update Asian Pac J Trop Dis 2013 3 2 85 92 10.1016/S2222-1808(13)60051-1 \n3. Tyagi S Kumar S Kumar A Singla M Singh A Stevens–Johnson syndrome—a life threatening skin disorder: a review J Chem Pharm Res 2010 2 2 618 626 \n4. Barvaliya M Sanmukhani J Patel T Paliwal N Shah H Tripathi C Drug-induced Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and SJS-TEN overlap: a multicentric retrospective study J Postgr Med 2011 57 2 115 119 10.4103/0022-3859.81865 \n5. Bhounsule SA Bandodkar LV Samuel LJ Retrospective analysis of deaths due to drug- induced Stevens–Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) in inpatients admitted in the dermatology unit of a tertiary care hospital J Pharm Biol Sci 2015 10 4 96 99 \n6. Ofoma UR Chapnick EK Fluconazole induced toxic epidermal necrolysis: a case report Cases J 2009 2 9071 10.1186/1757-1626-2-9071 20062708 \n7. Adinma E Ezeama NN Umeokonkwo CD Streptomycin-induced Steven–Johnson syndrome in a HIV sero-positive patient with tuberculosis: a case report Int J Clin Med 2011 2 481 483 10.4236/ijcm.2011.24082 \n8. Rajput R Sagari S Durgavanshi AKA Paracetamol induced Steven–Johnson syndrome. A rare case report Contemp Clin Dent 2015 6 Suppl 1 S278 S281 10.4103/0976-237X.166838 26604588 \n9. Coopman SA Johnson RA PR and SRS. Cutaneous disease and drug reactions in HIV infection N Engl J Med 1993 328 1670 1674 10.1056/NEJM199306103282304 8487826 \n10. Patel KJ Kedia MS Bajpai D Mehta SS Kshirsagar NAGN Evaluation of the prevalence and economic burden of adverse drug reactions presenting to the medical emergency department of a tertiary referral centre: a prospective study BMC Clin Pharmacol 2007 7 8 10.1186/1472-6904-7-8 17662147 \n11. Sharma VK Sethuraman GKB Cutaneous adverse drug reactions: clinical pattern and causative agents—a 6 year series from Chandigarh, India J Postgr Med 2001 47 95 99 \n12. Sharma VK Sethuraman G Adverse cutaneous reactions to drugs: an overview J Postgr Med 1996 42 15 22 \n13. Patel RM Marfatia YS Clinical study of cutaneous drug eruptions in 200 patients Indian J Dermatol Venereol Leprol 2008 74 4 430 10.4103/0378-6323.42883 18810845 \n14. Lehloenya R Management of Stevens–Johnson syndrome and toxic epidermal necrolysis Curr Allergy Clin Immunol 2007 20 3 124 128 \n15. Kircik LH Del Rosso JQ Layton AMSJ Over 25 years of clinical experience with ivermectin: an overview of safety for an increasing number of indications J Drugs Dermatol 2016 15 3 325 332 26954318 \n16. Nirken MH. Stevens–Johnson syndrome and toxic epidermal necrolysis in adults. http://uptodateonline.com/patients/content/topic.do?topicKey=~KMM0KgcQUwSCr8z. Accessed 5 Jan 2017\n17. Paquet P Pierard GEQP Novel treatments for drug-induced toxic epidermal necrolysis (Lyell’s syndrome) Int Arch Allergy Immunol 2005 136 205 216 10.1159/000083947 15713983 \n18. Roujeau JC Chosidow O Saiag PGJ Toxic epidermal necrolysis (Lyell syndrome) J Am Acad Dermatol 1990 23 1039 1058 10.1016/0190-9622(90)70333-D 2273103 \n19. Praag EV. Ivermectin. In: Drugs for rabbits. 2009. p. 2–5. http://www.medirabbit.com/Safe_medication/Anti_parasitics/ivermectin.PDF\n20. Richard F, Michelle A. Clark LXC. Lippincott’s illustrated reviews: pharmacology, 4th ed. In: Richard A, Harvey PCC, editors. Philadelphia: Lippincott Williams & Wilkins; 2009.\n21. Shinohara EH Martini MZ Gomes H Neto DO Oral myiasis treated with ivermectin: case report Braz Dent J 2004 15 1 79 81 10.1590/S0103-64402004000100015 15322651 \n22. Catherine D Susana F Elisabeth G Martine M Christian S Encephalopathy due to prolonged misuse of ivermectin (Stromectol® ) after scabies infection Clin Toxicol 2014 160 1 1 \n23. Udall DN Recent updates on onchocerciasis: diagnosis and treatment CID 2007 44 1 53 60 10.1086/509325 \n24. WHO African programme for onchocerciasis control: progress report, 2013–2014 Wkly Epidemiol Rec 2014 374 49 545 560 \n25. WHO. Prevention, control and elimination of onchocerciasis; 2015. http://www.who.int/onchocerciasis/control/en/. Accessed 5 Jan 2017\n26. MSD BV. Stromectol (Ivermectin) tablets; 2009. p. 1–6. http://www.medsafe.govt.nz/profs/Datasheet/s/Stromectoltab.pdf. Accessed 5 Jan 2017\n27. U.S. Food and Drug Administration Medwatch. What is a serious adverse event? http://www.fda.gov/medwatch/report/DESK/advevnt.htm. Accessed 5 Jan 2017\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1756-0500",
"issue": "10(1)",
"journal": "BMC research notes",
"keywords": "Human immunodeficiency virus (HIV); Ivermectin; Stevens–Johnson syndrome (SJS)",
"medline_ta": "BMC Res Notes",
"mesh_terms": "D000328:Adult; D000977:Antiparasitic Agents; D002163:Cameroon; D005368:Filariasis; D015658:HIV Infections; D006801:Humans; D007559:Ivermectin; D008297:Male; D013262:Stevens-Johnson Syndrome",
"nlm_unique_id": "101462768",
"other_id": null,
"pages": "179",
"pmc": null,
"pmid": "28482929",
"pubdate": "2017-05-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "2273103;9715291;17662147;26110722;26604588;26954318;18810845;21654132;20062708;15322651;15713983;17143815;8487826;11832597",
"title": "Ivermectin induced Steven-Johnsons syndrome: case report.",
"title_normalized": "ivermectin induced steven johnsons syndrome case report"
} | [
{
"companynumb": "CM-ARBOR PHARMACEUTICALS, LLC-CM-2018ARB000488",
"fulfillexpeditecriteria": "1",
"occurcountry": "CM",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IVERMECTIN"
},
"drugaddi... |
{
"abstract": "Topical corticosteroids are an emerging cause of allergic contact dermatitis in children that may often be missed. It is important to consider patch testing with corticosteroids to detect allergic contact dermatitis in patients with persistent or worsening of dermatitis despite topical corticoseroid treatment. However, delayed reactions (>7 days) to topical corticosteroids may occur, leading to false-negative reactions and misdiagnosis. Herein, we report a case of an 8-year-old girl who developed a positive reaction to budesonide on day 12 of patch testing.",
"affiliations": "Tufts University School of Medicine, Boston, MA, USA.;Department of Dermatology, Massachusetts General Hospital, Boston, MA, USA.",
"authors": "Tam|Idy|I|https://orcid.org/0000-0002-6936-3905;Yu|JiaDe|J|https://orcid.org/0000-0002-0874-3170",
"chemical_list": "D000305:Adrenal Cortex Hormones; D019819:Budesonide",
"country": "United States",
"delete": false,
"doi": "10.1111/pde.14168",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0736-8046",
"issue": "37(4)",
"journal": "Pediatric dermatology",
"keywords": "allergic contact dermatitis; corticosteroids; delayed patch testing reaction; late patch test reading",
"medline_ta": "Pediatr Dermatol",
"mesh_terms": "D000287:Administration, Topical; D000305:Adrenal Cortex Hormones; D019819:Budesonide; D002648:Child; D017449:Dermatitis, Allergic Contact; D005260:Female; D006801:Humans; D010328:Patch Tests",
"nlm_unique_id": "8406799",
"other_id": null,
"pages": "690-691",
"pmc": null,
"pmid": "32301528",
"pubdate": "2020-07",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Delayed patch test reaction to budesonide in an 8-year-old.",
"title_normalized": "delayed patch test reaction to budesonide in an 8 year old"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2020SP010045",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TRIAMCINOLONE ACETONIDE"
},
"d... |
{
"abstract": "Left ventricular assist devices (LVADs) are used in patients with advanced heart failure. Infections are common complications following device placement; however, the efficacy of chronic antimicrobial suppression therapy for deep-seated infections is not well characterized. We report the case of a 49-year-old male with a HeartMate II LVAD who presented with a methicillin-sensitive Staphylococcus aureus pump pocket infection that was subsequently treated with antibiotics and HeartMate III pump exchange. A vancomycin-resistant Enterococcus faecium (VRE) pump pocket infection then developed and responded to surgical drainage followed by long-term suppression with daptomycin then linezolid for over 870 days. A second pump exchange was not required. To our knowledge, this represents the longest reported use of daptomycin (341 days) without symptomatic adverse events. Managing infections caused by multidrug-resistant pathogens presents a clinical challenge. This case demonstrates the potential for antimicrobial suppression therapy to allow for successful retention of a VRE-infected LVAD.",
"affiliations": "Yale School of Medicine, New Haven, Connecticut.;Yale School of Medicine, New Haven, Connecticut.",
"authors": "Radcliffe|Christopher|C|http://orcid.org/0000-0001-8352-1482;Grant|Matthew|M|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000069349:Linezolid; D017576:Daptomycin",
"country": "United States",
"delete": false,
"doi": "10.1111/jocs.14690",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0886-0440",
"issue": "35(7)",
"journal": "Journal of cardiac surgery",
"keywords": "transplant",
"medline_ta": "J Card Surg",
"mesh_terms": "D000900:Anti-Bacterial Agents; D017576:Daptomycin; D004359:Drug Therapy, Combination; D016984:Enterococcus faecium; D016908:Gram-Positive Bacterial Infections; D006352:Heart Ventricles; D006353:Heart-Assist Devices; D006801:Humans; D000069349:Linezolid; D008297:Male; D008875:Middle Aged; D011475:Prosthesis Failure; D016459:Prosthesis-Related Infections; D013997:Time Factors; D016896:Treatment Outcome; D020713:Vancomycin Resistance",
"nlm_unique_id": "8908809",
"other_id": null,
"pages": "1746-1748",
"pmc": null,
"pmid": "32557822",
"pubdate": "2020-07",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Over 870 days of successful antibiotic suppression therapy for VRE-infected left ventricular assist device.",
"title_normalized": "over 870 days of successful antibiotic suppression therapy for vre infected left ventricular assist device"
} | [
{
"companynumb": "US-009507513-2007USA001774",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DAPTOMYCIN"
},
"drugadditional": null,
... |
{
"abstract": "Ehlers-Danlos syndrome is a group of connective tissue disorders that most commonly causes joint hypermobility, skin hyperextensibility, and tissue fragility. Patients diagnosed with Ehlers-Danlos syndrome (EDS) frequently suffer from chronic pain and other comorbid conditions. In addition, there is an increased incidence of psychiatry conditions in this patient population, such as anxiety, depression, and personality disorders. We present the case of a 25-year-old female who presented to a community hospital with frequent thoughts of suicide and major depression. She was previously diagnosed with Ehlers-Danlos syndrome, borderline personality disorder, and major depressive disorder. The patient was treated with a selective serotonin reuptake inhibitor (SSRI) and gabapentin for pain associated with EDS. However, she was still suicidal and was admitted upon evaluation. Subsequently, she was prescribed lithium in order to augment the effects of the SSRI and reduce her risk of suicide. In addition to pharmacotherapy, patients with these conditions should consider enrolling in some type of therapy.",
"affiliations": "Psychiatry, Frederick Memorial Hospital, Frederick, USA.;Psychiatry, West Virginia School of Osteopathic Medicine, Lewisburg, USA.;Internal Medicine, West Virginia School of Osteopathic Medicine, Lewisburg, USA.",
"authors": "Espiridion|Eduardo D|ED|;Daniel|Allison|A|;Van Allen|Joshua R|JR|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.3760",
"fulltext": "\n==== Front\nCureusCureus2168-8184Cureus2168-8184Cureus Palo Alto (CA) 10.7759/cureus.3760GeneticsPsychiatryRecurrent Depression and Borderline Personality Disorder in a Patient with Ehlers-Danlos Syndrome Muacevic Alexander Adler John R Espiridion Eduardo D 1Daniel Allison 2Van Allen Joshua R 3\n1 \nPsychiatry, Frederick Memorial Hospital, Frederick, USA \n2 \nPsychiatry, West Virginia School of Osteopathic Medicine, Lewisburg, USA \n3 \nInternal Medicine, West Virginia School of Osteopathic Medicine, Lewisburg, USA \nAllison Daniel adaniel@osteo.wvsom.edu21 12 2018 12 2018 10 12 e376021 11 2018 21 12 2018 Copyright © 2018, Espiridion et al.2018Espiridion et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/15780-recurrent-depression-and-borderline-personality-disorder-in-a-patient-with-ehlers-danlos-syndromeEhlers-Danlos syndrome is a group of connective tissue disorders that most commonly causes joint hypermobility, skin hyperextensibility, and tissue fragility. Patients diagnosed with Ehlers-Danlos syndrome (EDS) frequently suffer from chronic pain and other comorbid conditions. In addition, there is an increased incidence of psychiatry conditions in this patient population, such as anxiety, depression, and personality disorders. We present the case of a 25-year-old female who presented to a community hospital with frequent thoughts of suicide and major depression. She was previously diagnosed with Ehlers-Danlos syndrome, borderline personality disorder, and major depressive disorder. The patient was treated with a selective serotonin reuptake inhibitor (SSRI) and gabapentin for pain associated with EDS. However, she was still suicidal and was admitted upon evaluation. Subsequently, she was prescribed lithium in order to augment the effects of the SSRI and reduce her risk of suicide. In addition to pharmacotherapy, patients with these conditions should consider enrolling in some type of therapy. \n\nborderline personality disordermajor depressive disorderehlers-danlos syndrome (eds)The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nEhlers-Danlos syndrome (EDS) is a heterogeneous group of rare, heritable connective tissue disorders occurring in approximately one out of every 5,000 people [1]. These disorders are most commonly characterized by joint hypermobility, skin hyperextensibility, and tissue fragility that can affect multiple organ systems [1]. Chronic widespread pain is a common complaint among these patients that can prove to be both physically and psychologically debilitating. Many patients with an EDS diagnosis have associated psychiatric comorbidities. These conditions include, but are not limited to, major depressive disorder, generalized anxiety disorder, and autism spectrum disorder [2]. A recent study found that patients with EDS are at an increased risk of being diagnosed with depression with a risk ratio (RR) of 3.4 and a 95% confidence interval (CI) of 2.9 - 4.1 [3]. These patients may also be at an increased risk of being diagnosed with a borderline personality disorder (BPD). This disorder is characterized by varying patterns of moods and behaviors [4]. Patients frequently exhibit \"splitting\", where things are either all good or all bad [3]. Poor impulse control is also a core characteristic of patients with BPD [5]. There is an increase in the number and seriousness of suicide attempts in this patient population [6]. We present a complicated case of a patient with Ehlers-Danlos syndrome with associated major depressive disorder and borderline personality disorder. \n\nCase presentation\nA 25-year-old female was admitted into a partial psychiatric hospital program after a short stay in the behavioral health unit of a community hospital. She initially presented to the emergency department due to recurrent depression, mood swings, anxiety, and suicidal thoughts/intent. Upon initial evaluation, she reported suicidal thoughts, sad mood, a low energy level, anhedonia, and feelings of worthlessness, helplessness, and hopelessness. She also admitted poor sleep, poor appetite, poor concentration, and recurrent episodes of self-harm. She denied any symptoms of hypomania or mania. However, she did admit to a history of mood swings and anxiety. She had several superficial lacerations on her forearms in multiple stages of healing consistent with self-mutilation. She told staff that she had been “cutting” since she was a teenager and had also tried to intentionally overdose as a teen. The patient had a long history of psychiatric conditions and had multiple prior psychiatric hospitalizations. She denied any history of physical or sexual abuse. She reported a family history of substance abuse, bipolar disorder, and borderline personality disorder. The patient was also diagnosed with Ehlers-Danlos syndrome with symptoms beginning in early childhood.\n\nDiscussion\nStudies show that patients diagnosed with Ehlers-Danlos syndrome are at an increased risk of being diagnosed with psychiatric comorbidities [7-8]. A recent study found that patients with joint hypermobility syndrome and EDS had a 4.3 higher risk of being affected by a psychiatric condition [7]. There was also a high prevalence of personality disorders (21%) and Diagnostic and Statistical Manual of Mental Disorders, 5th ed. (DSM-5) Axis-I disorders (38%) in these patients [9]. In addition, these patients are frequently diagnosed with anxiety and depression [2, 8].\n\nA borderline personality disorder is diagnosed by the following criteria from the DSM-5 [9] (a pervasive pattern of instability of interpersonal relationships, self-image and affects, and marked impulsivity beginning by early adulthood and present in a variety of contexts), as indicated by five (or more) of the following:\n\n1. Frantic effort to avoid real or imagined abandonment\n\n2. A pattern of unstable and intense interpersonal relationships characterized by alternating between extremes of ideation and devaluation.\n\n3. Identity disturbance: marked and persistently unstable self-image or sense of self\n\n4. Impulsivity in at least two areas that are potentially self-damaging (e.g., spending, sex, substance abuse, reckless driving, binge eating)\n\n5. Recurrent suicidal behavior, gestures or threats, or self-mutilating behavior\n\n6. Affective instability due to a marked reactivity of mood (e.g., intense episodic dysphoria, irritability, or anxiety usually lasting a few hours and only rarely more than a few days)\n\n7. Chronic feelings of emptiness\n\n8. Inappropriate, intense anger or difficulty controlling anger (e.g., frequent displays of temper, constant anger, recurrent physical fights)\n\n9. Transient, stress-related paranoid ideation or severe disassociate symptoms\n\nThe gold standard for treatment of patients with major depressive disorder without psychotic features is pharmacotherapy with depression-focused psychotherapy [10]. The majority of patients are successfully treated with a selective serotonin reuptake inhibitor (SSRI), serotonin-norepinephrine reuptake inhibitor (SNRI), or an atypical anti-depressant [10]. After an initial evaluation, our patient was started on sertraline, 150 mg once daily. However, she did not return to baseline and was still showing characteristic behaviors of BPD. She was also started on gabapentin, 600 mg twice daily, for neuropathic pain associated with EDS. In August 2017, she was started on lithium, 300 mg twice daily, in order to augment the effects of sertraline. BPD is associated with an increased risk of suicide attempts and successes. A recent study has shown that the rate of suicide in patients with BPD is between 8% - 10%, which is greater than the general population [11]. This study also showed that 60% - 70% of patients diagnosed with BPD have already or will make a suicide attempt at some point in their lives [10]. Evidence shows that treating BPD with lithium reduces the patient's risk of suicide and psychopathological features of BPD, such as irritation, anger, and self-harming behavior [12]. The risk of suicide may be reduced by almost 77% [13]. It is not clear whether this decreased risk of suicide is due to a specific “anti-suicidal” property or lithium’s mood stabilization properties [13-14].\n\nDespite treatment, this patient presented to the emergency department due to recurrent depression, anxiety, and suicidal ideations/intent. She had a past history of cutting behavior and an unsuccessful suicide attempt. She was referred to an intensive outpatient therapy program to follow her progress. A promising treatment option for this patient, and many others like her, is dialectical behavior therapy (DBT). DBT is described as an intensive outpatient treatment that focuses on skills training groups, individual psychotherapy, telephone consults, and a therapist consultation team [15]. Patients with BPD enrolled in a DBT have shown a significant decrease in the risk of suicide attempts, psychiatric inpatient hospital treatment, and mood swings [15-16]. DBT for patients with BPD is also useful for decreasing suicide attempts and depression, along with increasing control of anger [17].\n\nConclusions\nThis case demonstrates the importance of managing potential comorbid psychiatric conditions in patients with Ehlers-Danlos syndrome. While managing the chronic widespread pain in these patients is essential, identifying associated psychiatric conditions can easily be overlooked. Recent research has shown that patients with EDS have a higher prevalence of anxiety, depression, and personality disorders. This particular patient’s recurrent depression, borderline personality disorder, and past suicidal behavior made treating these conditions paramount in the management of this patient to preclude potential calamitous complications. Identifying and treating comorbid psychiatric conditions in those with EDS can help these patients with symptoms beyond the quintessential EDS presentation, while subsequently increasing their quality of life.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Ehlers-Danlos syndrome 10 2018 2018 http://ghr.nlm.nih.gov/condition/ehlers-danlos-syndrome \n2 Anxiety and joint hypermobility: an unexpected association Curr Psychiatry 12 2018 Bulbena-Cabré A Bulbena A 15 21 17 2018 http://www.mdedge.com/psychiatry/article/161887/anxiety-disorders/anxiety-and-joint-hypermobility-unexpected-association \n3 Nationwide population-based cohort study of psychiatric disorders in individuals with Ehlers-Danlos syndrome or hypermobility syndrome and their siblings BMC Psychiatry 10 2018 Cederlöf M Larsson H Lichtenstein P Almqvist C Serlachius E Ludvigsson JF 207 16 2016 http://bmcpsychiatry.biomedcentral.com/articles/10.1186/s12888-016-0922-6 27377649 \n4 Borderline personality disorder 10 2018 2017 http://www.nimh.nih.gov/health/topics/borderline-personality-disorder/index.shtml \n5 Impulsivity and cluster B personality disorders Curr Psychiatry Rep 11 2018 Turner D Sebastian A Tüscher O 15 19 2017 http://link.springer.com/article/10.1007%2Fs11920-017-0768-8 28251591 \n6 Characteristics of suicide attempts of patients with major depressive episode and borderline personality disorder: a comparative study Am J Psychiatry 10 2018 Soloff PH Lynch KG Kelly TM Malone KM Mann JJ 601 608 157 2000 http://pdfs.semanticscholar.org/3af2/139936a4b37090aa62d96eaf076d675cca62.pdf 10739420 \n7 Unexpected association between joint hypermobility syndrome/Ehlers-Danlos syndrome hypermobility type and obsessive-compulsive personality disorder Rheumatol Int 10 2018 Pasquini M Celletti C Berardelli I 631 636 34 2014 https://www.ncbi.nlm.nih.gov/pubmed/24272065 24272065 \n8 Psychiatric disorders in Ehlers-Danlos syndrome are frequent, diverse, and strongly associated with pain Rheumatol Int 10 2018 Hershenfeld SA Wasim S McNiven V Parikh M Majewski P Faghfoury H So J 341 348 36 2016 https://www.ncbi.nlm.nih.gov/pubmed/26433894 26433894 \n9 Diagnostic and Statistical Manual of Mental Disorders, 5th ed. American Psychiatric Association Arlington, VA American Psychiatric Association Publishing 2013 http://books.google.com/books?id=-JivBAAAQBAJ&printsec=frontcover&dq=DSM+5&hl=en&sa=X&ved=0ahUKEwimss_o3KrfAhXM-lQKHSNOCmYQ6AEILzAB#v=onepage&q=DSM%205&f=false \n10 Treating major depressive disorder: a quick reference guide American Psychiatric Association 10 2018 1 28 2010 http://psychiatryonline.org/pb/assets/raw/sitewide/practice_guidelines/guidelines/mdd-guide.pdf \n11 Borderline personality disorder and suicidality Am J Psychiatry 10 2018 Oldham J 20 26 163 2006 http://ajp.psychiatryonline.org/doi/full/10.1176/appi.ajp.163.1.20 16390884 \n12 Borderline personality disorder: bipolarity, mood stabilizers and atypical antipsychotics in treatment J Clin Med Res 10 2018 Belli H Ural C Akbudak M 301 308 4 2012 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3449426/ 23024731 \n13 Lithium therapy and suicide risk J Clin Psychiatry 10 2018 Nilsson A 85 88 60 1999 http://www.psychiatrist.com/jcp/article/Pages/1999/v60s02/v60s0217.aspx 10073393 \n14 The suicide prevention effect of lithium: more than 20 years of evidence—a narrative review Int J Bipolar Disord 10 2018 Lewitzka U Severus E Bauer R Ritter P Müller-Oerlinghausen B Bauer M 15 3 2015 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4504869/ \n15 Dialectical behavior therapy as treatment for borderline personality disorder Ment Health Clin 10 2018 May JM Richardi TM Barth KS 62 67 6 2016 http://mhc.cpnp.org/doi/full/10.9740/mhc.2016.03.62 29955449 \n16 Dialectical behavior therapy for borderline personality disorder Annu Rev Clin Psychol 10 2018 Lynch TR Trost WT Salsman N Linehan MM 181 205 3 2007 https://www.researchgate.net/profile/Marsha_Linehan/publication/6124095_Dialectical_Behavior_Therapy_for_Borderline_Personality_Disorder/links/599ce0290f7e9b892bb003d9/Dialectical-Behavior-Therapy-for-Borderline-Personality-Disorder.pdf 17716053 \n17 Dialectical behavior therapy skills use as a mediator and outcome of treatment for borderline personality disorder Behav Res Ther 10 2018 Neacsiu AD Rizvi SL Linehan MM 832 839 48 2010 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2914145/ 20579633\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "10(12)",
"journal": "Cureus",
"keywords": "borderline personality disorder; ehlers-danlos syndrome (eds); major depressive disorder",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e3760",
"pmc": null,
"pmid": "30820380",
"pubdate": "2018-12-21",
"publication_types": "D002363:Case Reports",
"references": "10073393;10739420;16390884;17716053;20579633;23024731;24272065;26183461;26433894;27377649;28251591;29955449",
"title": "Recurrent Depression and Borderline Personality Disorder in a Patient with Ehlers-Danlos Syndrome.",
"title_normalized": "recurrent depression and borderline personality disorder in a patient with ehlers danlos syndrome"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2019SP011014",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "GABAPENTIN"
},
"drugadditional... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.