article
dict
reports
listlengths
1
3.97k
{ "abstract": "Eosinophilic with polyangiitis (EGPA, formerly known as Churg-Strauss syndrome) is a rare systemic disease characterized by a small-vessel necrotizing vasculitis. Cardiac manifestations are broad-ranging and are associated with a poor prognosis. Coronary vasospasm is uncommon.Here, we report a case of an acute coronary vasospasm in a patient with EGPA after corticosteroids withdrawal and nonsteroidal antiinflammatory drug (NSAID) introduction. This patient was initially misdiagnosed as bradykinin-mediated angioedema. A 30-year-old man presented with recurrence of abdominal pain and acute dyspnea. NSAID administration for pain during a flare was followed by coronary vasospasms leading to cardiac arrest. Corticosteroid treatment was recently interrupted by the patient.This case reports a rare cardiac complication of EGPA. NSAID might contribute to coronary vasospasm by eosinophilic degranulation in EGPA. Moreover, corticosteroid compliance must be emphasized among patients who display EGPA with high cardiac risk to prevent fatal issues.", "affiliations": "Internal Medicine, Angers University Hospital, Angers, France.", "authors": "Benallegue|Naïl|N|;Lozach|Pierre|P|;Belizna|Cristina|C|;Lavigne|Christian|C|;Urbanski|Geoffrey|G|", "chemical_list": "D000305:Adrenal Cortex Hormones; D000894:Anti-Inflammatory Agents, Non-Steroidal", "country": "United States", "delete": false, "doi": "10.1097/MD.0000000000005259", "fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 27893661MD-D-15-0432010.1097/MD.0000000000005259052596900Research ArticleClinical Case ReportAcute coronary vasospasm in a patient with eosinophilic granulomatosis with polyangiitis following NSAID administration A case reportBenallegue Naïl MSc, MDLozach Pierre MSc, MDBelizna Cristina MDLavigne Christian MDUrbanski Geoffrey MD∗Sayed. Mazen El Internal Medicine, Angers University Hospital, Angers, France.∗ Correspondence: Geoffrey Urbanski, Centre Hospitalier Universitaire d’Angers, Angers, France (e-mail: geoffrey.urbanski@chu-angers.fr).11 2016 28 11 2016 95 47 e525917 10 2015 26 9 2016 30 9 2016 Copyright © 2016 the Author(s). Published by Wolters Kluwer Health, Inc. All rights reserved.2016This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0Abstract\nEosinophilic with polyangiitis (EGPA, formerly known as Churg-Strauss syndrome) is a rare systemic disease characterized by a small-vessel necrotizing vasculitis. Cardiac manifestations are broad-ranging and are associated with a poor prognosis. Coronary vasospasm is uncommon.\n\nHere, we report a case of an acute coronary vasospasm in a patient with EGPA after corticosteroids withdrawal and nonsteroidal antiinflammatory drug (NSAID) introduction. This patient was initially misdiagnosed as bradykinin-mediated angioedema. A 30-year-old man presented with recurrence of abdominal pain and acute dyspnea. NSAID administration for pain during a flare was followed by coronary vasospasms leading to cardiac arrest. Corticosteroid treatment was recently interrupted by the patient.\n\nThis case reports a rare cardiac complication of EGPA. NSAID might contribute to coronary vasospasm by eosinophilic degranulation in EGPA. Moreover, corticosteroid compliance must be emphasized among patients who display EGPA with high cardiac risk to prevent fatal issues.\n\nKeywords\nANCAcoronary vasospasmeosinophilic granulomatosis with polyangiitisNSAIDOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nEosinophilic granulomatosis with polyangiitis (EGPA) is a rare systemic small-vessel necrotizing vasculitis. Its most frequent manifestations are late-onset asthma, chronic rhinitis, and sinus polyposis associated with eosinophilia. Cardiac involvement is the main cause of mortality.[1] Cardiac manifestations are very diverse but coronary vasospasm is uncommon. Here, we report a case of an acute coronary vasospasm in a patient with EGPA after corticosteroids withdrawal and nonsteroidal antiinflammatory drug (NSAID) introduction. This patient was initially misdiagnosed as bradykinin-mediated angioedema. Few coronary vasospasms have been reported in patients with symptomatic EGPA during both active and passive phases of the disease. To our knowledge, this is the first case describing acute coronary vasospasm leading to cardiac arrest during corticosteroid interruption and following NSAID administration in EGPA.\n\n2 Case report\nA 30-year-old man without significant medical history presented with a 5-month history of recurrent abdominal pain and dyspnea. A trigeminal neuralgia was diagnosed 7 months earlier because of left hemifacial paroxysmal pain. The patient used NSAID occasionally in the early symptom phase as pain killers without adverse effect.\n\nFrom April to August 2013, he suffered from intense crisis of acute abdominal pain localized on the upper and lower left quadrants, followed by hypoxemic acute dyspnea with cough and sometimes wheezing. Nasofibroscopy revealed no laryngeal cause but noticed nasal polyps. CT-scan revealed peribronchial infiltrates and submucosal edema of the esophagus and the stomach with a small peritoneal effusion. Moderate hypereosinophilia was found (1.29 × 109/L). Antihistaminic drugs were ineffective. The recurrence of abdominal pain, mucosal edema, and atypical dyspnea with laryngeal component suggested a diagnosis of nonhistaminergic angioedema. Quantitative and functional assay of C1-inhibitor and complement assay were normal. Thus, bradykinin-mediated angioedema was suspected. Oral tranexamic acid and prophylactic treatment with human C1-esterase inhibitor twice a week was initiated as it seemed to be effective on abdominal symptoms. Icatibant was administered during attacks as a rescue medication. C1-esterase inhibitor treatment was stopped 1 month later after another abdominal attack. Moreover, assay of kinin metabolism was normal thus dismissing the diagnosis of bradykinin-mediated angioedema. Asthma was diagnosed as the patient sometimes experienced wheezing and inhaled salbutamol was slightly effective on symptoms. Oral corticosteroid therapy was initiated as the diagnosis of vasculitis was suspected. On September 2013, the patient was admitted to the Emergency department with localized abdominal pain. Corticosteroid therapy was stopped 12 days before as the patient was out of medication. One hour after NSAID (ketoprofen) administration, he presented with angina pectoris followed by ventricular fibrillation and cardiac arrest. One defibrillation biphasic shock of 150 J enabled to restore sinusal cardiac activity. Active-life support lasted about one minute. Electrocardiogram (ECG) displayed significant antero-septo-lateral ST elevation with an inferior mirror image (Fig. 1). Troponin was initially elevated at 2.33 μg/L (N < 0.1 μg/L). Eosinophils were 1.34 × 109/L. Coronary angiography revealed a tight spasm of the anterior interventricular branch of the left anterior descending artery and of the right coronary artery (Fig. 2). Spasms were reversed after intracoronary injection of glycerin trinitrate. Nine days after cardiac arrest, cardiac MRI disclosed a small-scale anteromedial cardiac infarction without any ventricular dysfunction or without vasculitis, myocarditis, and pericarditis. Repetitive anti-neutrophil cytoplasmic antibodies (ANCA) measurements were negative and complement assay was normal. Serum tryptase levels and screening for parasites were normal. Neither FIP1L1-PDGFRA myeloid mutant nor lymphoid clone was found. Histological analysis of esophagus, stomach, colon tissue, and temporal artery did not show evidence of vasculitis. Nasal mucosa biopsy of polyps revealed eosinophilic infiltrates. The patient met 4 of the 6 American College of Rheumatology diagnostic criteria required for EGPA: asthma, parasinusal abnormalities, neuropathy, extravascular eosinophils. Blood eosinophilia could not be taken in consideration as it was below the threshold of 10% of total white blood cell count. An implantable cardioverter defibrillator was implanted 15 days after cardiac arrest. High dose intravenous corticosteroids (1 mg/kg/day) and immunosuppressive therapy by intravenous cyclophosphamide (600 mg/m2 monthly during 3 months, then 700 mg/m2) were initiated. After 6 months, cyclophosphamide was switched to azathioprine (2.5 mg/kg). General symptoms markedly improved. Daily oral prednisone (10 mg) and azathioprine therapy was pursued 30 months without relapse. The patient fully recovered neurologically after cardiac arrest. He was discharged 23 days after entering the hospital.\n\nFigure 1 Twelve leads ECG during angina pectoris attack before cardiac arrest. Typical ST elevation in leads aVL, I, V1, V2, V5, V6 and mirror ST depression in leads II, III, aVF.\n\nFigure 2 Emergency coronary arteriogram following sudden cardiac arrest. Very tight spasms of the left anterior descending artery (70–90%, 10–20 mm length) (A) and right coronary artery (50%, 10–20 mm length) with a distal spasm (B) are observed (showed with arrows). Both spasms are progressively reversed after intracoronary injection of trinitrine (from left to right).\n\n3 Discussion\nMost patients with cardiac involvement of EGPA do not display any circulating ANCA.[1] Existence of ANCA-negative EGPA hypothesizes the role of eosinophilic infiltrates in some organ-specific symptoms, such as cardiac, gastrointestinal, and pulmonary manifestations, associated with a low frequency of vasculitis histology as compared to ANCA positive patients.[1] Indeed, we only found eosinophilic infiltrates in nasal mucosa. Previous episode of left trigeminal neuralgia could have been the first manifestation of EGPA in our patient.[1]\n\nTo date the pathophysiology of coronary vasospasm in EGPA has not been elucidated. Eosinophilic infiltration of the arterial wall is suspected to drive a segmental vasoconstriction through the release of chemokines and eicosanoid inflammatory mediators.[2] Human coronary arteries express several subtypes of leukotriene receptors, mostly BLT1 which binds Leukotriene B4 (LTB4) but also cysteinyl leukotriene (CysLT) receptor 1.[3] CysLT receptor 1 and BLT1 are upregulated in smooth-muscle cell by proinflammatory stimuli diseases.[3] In a vasculitis like EGPA, we could consider CysLT and leukotriene B4 (LTB4) to be responsible of vessel smooth muscle cells constriction through eosinophil chemoattraction and local inflammation. Besides, local eosinophil accumulation has been reported to be enhanced with leukotriene through paracrine activation.[4] Thus, NSAID might exacerbate this segmental eosinophilic-mediated vasoconstriction process.\n\nNSAID do not directly increase the synthesis of CysLT and LTB4. Nevertheless they decrease the synthesis of prostaglandin E2 which inhibits the production and the release of CysLT and LTB4 by eosinophils and mast cells.[5,6] By analogy, In aspirin-exacerbated respiratory disease, basal low expression level of COX-2 make subjects very sensitive to non selective COX inhibitors. Indeed, the removal of constitutive COX-1 activity by drugs permits eosinophil activation which leads to bronchospasm.[5] Such a mechanism could be considered for EGPA.\n\nIn addition, discontinuation of systemic corticosteroids has been presumed to trigger EGPA flare.[7]\n\nIn spite of nasal polyps and asthma, the diagnosis of aspirin-induced asthma was dismissed as attacks occurred without any use of aspirin or NSAID. Kounis syndrome is defined as allergic reactions accompanied by cardiac symptomatology.[8] In our case, the patient used ketoprofen and ibuprofen a few times as self-medication when he experienced acute trigeminal neuralgia pain at the beginning of the medical history but he stopped because of their ineffectiveness. He had never suffered from chest pain or dyspnea when he used NSAID which was not in favor of a Kounis syndrome. Moreover, he had not experienced other symptom than angina pectoris after ketoprofen administration before cardiac arrest.\n\nIn summary, NSAID could precipitate coronary vasospasm by eosinophilic degranulation in EGPA. Moreover, corticosteroid compliance must be emphasized among patients who display EGPA with high cardiac risk to prevent fatal issues.\n\nAbbreviations: COX-1 or COX2 = cyclooxygenase type 1 or 2, CysLT = cysteinyl leukotriene, ECG = electrocardiogram, EGPA = eosinophilic granulomatosis with polyangiitis, LTB4 = leukotriene B4, NSAID = nonsteroidal antiinflammatory drug.\n\nPatient consent was obtained.\n\nThe authors have no conflicts of interest to disclose.\n==== Refs\nReferences\n[1] Comarmond C Pagnoux C Khellaf M \nEosinophilic granulomatosis with polyangiitis (Churg-Strauss): clinical characteristics and long-term followup of the 383 patients enrolled in the French vasculitis study group cohort . Arthritis Rheum \n2013 ;65 :270 –81 .23044708 \n[2] Takagi S Goto Y Hirose E \nSuccessful treatment of refractory vasospastic angina with corticosteroids: coronary arterial hyperactivity caused by local inflammation? \nCirc J \n2004 ;68 :17 –22 .14695460 \n[3] Bäck M \nLeukotriene receptors: crucial components in vascular inflammation . ScientificWorldJournal \n2007 ;7 :1422 –39 .17767359 \n[4] Patnode ML Bando JK Krummel MF \nLeukotriene b4 amplifies eosinophil accumulation in response to nematodes . J Exp Med \n2014 ;211 :1281 –8 .24889202 \n[5] Steinke JW Borish L \nFactors driving the aspirin exacerbated respiratory disease phenotype . Am J Rhinol Allergy \n2015 ;29 :35 –40 .25590316 \n[6] Brune K \nSafety of anti-inflammatory treatment—new ways of thinking . Rheumatology (Oxford) \n2004 ;43 suppl 1 :i16 –20 .14752171 \n[7] Guillevin L Cohen P Gayraud M \nChurg-Strauss syndrome. Clinical study and long-term follow-up of 96 patients . Medicine (Baltimore) \n1999 ;78 :26 –37 .9990352 \n[8] Kounis NG \nCoronary hypersensitivity disorder: the Kounis syndrome . Clin Ther \n2013 ;35 :563 –71 .23490289\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0025-7974", "issue": "95(47)", "journal": "Medicine", "keywords": null, "medline_ta": "Medicine (Baltimore)", "mesh_terms": "D000208:Acute Disease; D000305:Adrenal Cortex Hormones; D000328:Adult; D000894:Anti-Inflammatory Agents, Non-Steroidal; D015267:Churg-Strauss Syndrome; D003329:Coronary Vasospasm; D004562:Electrocardiography; D006801:Humans; D008297:Male", "nlm_unique_id": "2985248R", "other_id": null, "pages": "e5259", "pmc": null, "pmid": "27893661", "pubdate": "2016-11", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "25590316;23490289;23044708;14752171;14695460;24889202;9990352;17767359", "title": "Acute coronary vasospasm in a patient with eosinophilic granulomatosis with polyangiitis following NSAID administration: A case report.", "title_normalized": "acute coronary vasospasm in a patient with eosinophilic granulomatosis with polyangiitis following nsaid administration a case report" }
[ { "companynumb": "FR-MYLANLABS-2017M1000205", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "KETOPROFEN" }, "drugadditional": "3", ...
{ "abstract": "A case report of a successful treatment of neuropathic pain after a plexus brachialis injury is presented. On basis of experience from nerve-injured rat models 5 mg donepezil was added to an already instituted gabapentin therapy of 800 mg x 3 daily. This allowed halving the gapentin dose with fully contained pain alleviation but with a drastic reduction of gabapentin's side effects: ataxia and somnolence. Thus, without adding any new side effects life quality was improved and an increased working capacity was observed together with a weight loss of 9 kg over six months.", "affiliations": "Gartnerkrogen 59, 3500 Værløse. ojb@farma.ku.dk.", "authors": "Bjerrum|Ole J|OJ|;Bjerrum|Hans J|HJ|", "chemical_list": "D000700:Analgesics; D007189:Indans; D010880:Piperidines; D000077265:Donepezil", "country": "Denmark", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0041-5782", "issue": "175(42)", "journal": "Ugeskrift for laeger", "keywords": null, "medline_ta": "Ugeskr Laeger", "mesh_terms": "D000368:Aged; D000700:Analgesics; D000077265:Donepezil; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D007189:Indans; D009437:Neuralgia; D010880:Piperidines; D020069:Shoulder Pain; D016896:Treatment Outcome", "nlm_unique_id": "0141730", "other_id": null, "pages": "2493-4", "pmc": null, "pmid": "24629118", "pubdate": "2013-10-14", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Donepezil therapy by neuropathic pain.", "title_normalized": "donepezil therapy by neuropathic pain" }
[ { "companynumb": "DK-DEPOMED, INC.-DK-2016DEP010242", "fulfillexpeditecriteria": "1", "occurcountry": "DK", "patient": { "drug": [ { "actiondrug": "2", "activesubstance": { "activesubstancename": "ACETAMINOPHEN" }, "drugadditional": "...
{ "abstract": "Graft rejection is the most common factor that limits graft survival after transplantation. During infancy, the humoral immune system is partially suppressed and humoral rejection of a cardiac allograft has not been reported in the absence of risk factors such as prior transplantation, blood transfusions, ventricular assist devices, and elevation of panel reactive antibodies. We present a case of an infant with dilated cardiomyopathy who developed multiple episodes of acute humoral rejection after heart transplantation in the absence of risk factors.", "affiliations": "Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Pathology and Immunology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.;Congenital Heart Surgery and Pediatric Cardiology, Texas Children's Hospital-Baylor College of Medicine, Houston, Texas.", "authors": "Binsalamah|Ziyad M|ZM|http://orcid.org/0000-0001-9767-7007;Marcano|Juan|J|;Zea-Vera|Rodrigo|R|;Tunuguntla|Hari|H|;Kearney|Debra L|DL|;Heinle|Jeffrey S|JS|;Fraser|Charles D|CD|;Mery|Carlos M|CM|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1111/jocs.13532", "fulltext": null, "fulltext_license": null, "issn_linking": "0886-0440", "issue": "33(2)", "journal": "Journal of cardiac surgery", "keywords": "dilated cardiomyopathy; heart transplantation; humoral rejection", "medline_ta": "J Card Surg", "mesh_terms": "D000208:Acute Disease; D002311:Cardiomyopathy, Dilated; D006084:Graft Rejection; D016027:Heart Transplantation; D006801:Humans; D056724:Immunity, Humoral; D007223:Infant; D008297:Male; D012307:Risk Factors; D014184:Transplantation, Homologous", "nlm_unique_id": "8908809", "other_id": null, "pages": "126-128", "pmc": null, "pmid": "29399877", "pubdate": "2018-02", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Acute humoral rejection in an infant without risk factors after heart transplantation.", "title_normalized": "acute humoral rejection in an infant without risk factors after heart transplantation" }
[ { "companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2018-01615", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TACROLIMUS" }, "druga...
{ "abstract": "Sex hormones have been proposed as a possible risk factor for the development and growth of meningiomas. Hormonal therapy plays a fundamental role in the treatment of male-to-female transgenders and needs to be continued after sex reassignment surgery. Usually, this treatment leads to no adverse events; however, its impact on hormone-related tumours such as meningiomas has not yet been investigated thoroughly. We searched our cohort of 2810 male-to-female transgender persons, who have been treated between 1975 and 2010, for patients with meningiomas. Additionally, we conducted a literature search in PubMed and EMBASE. We found three patients who developed a meningioma in male-to-female transgenders in addition to five other who have been described in the literature. These findings support the role of female sex hormones in the development and growth of meningiomas. This might be an underrepresentation, because there is no standard protocol for screening for meningiomas in this population and meningiomas can remain asymptomatic for several years. We observed regression of multiple meningiomas in one of these three cases after discontinuation of hormonal treatment. The decision to stop or continue cross-sex hormone therapy in these particular patients should be carefully reconsidered individually.", "affiliations": "Neurosurgical Center Amsterdam, VU University Medical Center, Amsterdam, The Netherlands.;Neurosurgical Center Amsterdam, VU University Medical Center, Amsterdam, The Netherlands.;Department of Endocrinology, Center of Expertise on Gender Dysphoria, VU University Medical Center, Amsterdam, The Netherlands.;Department of Endocrinology, Center of Expertise on Gender Dysphoria, VU University Medical Center, Amsterdam, The Netherlands.;Neurosurgical Center Amsterdam, VU University Medical Center, Amsterdam, The Netherlands.", "authors": "Ter Wengel|P V|PV|;Martin|E|E|;Gooren|L|L|;Den Heijer|M|M|;Peerdeman|S M|SM|", "chemical_list": "D004967:Estrogens; D011372:Progestins", "country": "Germany", "delete": false, "doi": "10.1111/and.12550", "fulltext": null, "fulltext_license": null, "issn_linking": "0303-4569", "issue": "48(10)", "journal": "Andrologia", "keywords": "Follow-up; meningioma; oestrogens/progestogens; sex hormones; transgenders", "medline_ta": "Andrologia", "mesh_terms": "D000368:Aged; D004967:Estrogens; D005260:Female; D006801:Humans; D008297:Male; D008577:Meningeal Neoplasms; D008579:Meningioma; D008875:Middle Aged; D011372:Progestins; D063106:Transgender Persons", "nlm_unique_id": "0423506", "other_id": null, "pages": "1130-1137", "pmc": null, "pmid": "26888610", "pubdate": "2016-12", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Meningiomas in three male-to-female transgender subjects using oestrogens/progestogens and review of the literature.", "title_normalized": "meningiomas in three male to female transgender subjects using oestrogens progestogens and review of the literature" }
[ { "companynumb": "NL-NOVAST LABORATORIES, LTD-DE-2017NOV000025", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CYPROTERONE ACETATE" }, "d...
{ "abstract": "Disseminated intravascular coagulation (DIC)-positive kidneys have historically been turned down for fear of poor outcomes. Higher severity injuries, which are prone to DIC, are typically seen in younger, otherwise healthy potential donors. The continued kidney allograft shortage has generated interest in the use of these DIC-positive grafts. There have been some reports of acceptable outcomes of renal transplantation using kidneys from donors with DIC. There are multiple clinical series demonstrating good outcomes from DIC-positive kidneys when the extent of glomeruli containing fibrin thrombi is less than 50% and donor renal function is preserved. These grafts are frequently associated with a period of delayed graft function.\n\n\n\nWe report 2 transplants with kidneys from brain dead donors with known DIC.\n\n\n\nBoth donors had renal failure and pretransplant renal biopsies showing 100% of the glomeruli containing fibrin thrombi. The recipients experienced delayed graft function requiring hemodialysis which was discontinued on postoperative days 18 and 39 for cases 1 and 2, respectively. Both patients are now over 14 months posttransplant with stable allograft function.\n\n\n\nUntil clearer organ selection criteria are established, caution should be exercised when considering the use of kidneys with a similar phenotype and allocation decisions made by a multidisciplinary transplant team on a case-by-case basis.", "affiliations": "1 Department of Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD. 2 Department of Pathology, The Johns Hopkins University School of Medicine, Baltimore, MD. 3 Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD.", "authors": "Soares|Kevin C|KC|;Arend|Lois J|LJ|;Lonze|Bonnie E|BE|;Desai|Niraj M|NM|;Alachkar|Nada|N|;Naqvi|Fizza|F|;Montgomery|Robert A|RA|", "chemical_list": "D015415:Biomarkers; D005337:Fibrin", "country": "United States", "delete": false, "doi": "10.1097/TP.0000000000001386", "fulltext": null, "fulltext_license": null, "issn_linking": "0041-1337", "issue": "101(6)", "journal": "Transplantation", "keywords": null, "medline_ta": "Transplantation", "mesh_terms": "D058186:Acute Kidney Injury; D000368:Aged; D064591:Allografts; D015415:Biomarkers; D001706:Biopsy; D051799:Delayed Graft Function; D004211:Disseminated Intravascular Coagulation; D046148:Donor Selection; D005260:Female; D005337:Fibrin; D006801:Humans; D007678:Kidney Glomerulus; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D011237:Predictive Value of Tests; D006435:Renal Dialysis; D018570:Risk Assessment; D012307:Risk Factors; D013997:Time Factors; D014019:Tissue Donors; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "0132144", "other_id": null, "pages": "1134-1138", "pmc": null, "pmid": "27490412", "pubdate": "2017-06", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Successful Renal Transplantation of Deceased Donor Kidneys With 100% Glomerular Fibrin Thrombi and Acute Renal Failure Due to Disseminated Intravascular Coagulation.", "title_normalized": "successful renal transplantation of deceased donor kidneys with 100 glomerular fibrin thrombi and acute renal failure due to disseminated intravascular coagulation" }
[ { "companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-20-01357", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, ...
{ "abstract": "Infratentorial oligodendrogliomas, a rare pathological entity, are generally considered metastatic lesions from supratentorial primary tumors. Here, we report the case of a 23-year-old man presenting with a histopathologically confirmed right precentral gyrus grade 2 oligodendroglioma and a concurrent pontine grade 3 oligodendroglioma. The pontine lesion was biopsied approximately a year after the biopsy of the precentral lesion due to disease progression despite 4 cycles of procarbazine-CCNU-vincristine (PCV) chemotherapy and stable supratentorial disease. Histology and genetic analysis of the pontine biopsy were consistent with grade 3 oligodendroglioma, and comparison of the two lesions demonstrated common 1p/19q co-deletions and TERT promoter mutations but distinct IDH1 mutations, with a non-canonical IDH1 R132G mutation identified in the infratentorial lesion and a R132H mutation identified in the cortical lesion. Initiation of Temozolomide led to complete response of the supratentorial lesion and durable disease control, while Temozolomide with subsequent radiation therapy of 54 Gy in 30 fractions resulted in partial response of the pontine lesion. This case report supports possible distinct molecular pathogenesis in supratentorial and infratentorial oligodendrogliomas and raises questions about the role of different IDH1 mutant isoforms in explaining treatment resistance to different chemotherapy regimens. Importantly, this case suggests that biopsies of all radiographic lesions, when feasible and safe, should be considered in order to adequately guide management in multicentric oligodendrogliomas.", "affiliations": "Columbia University Vagelos College of Physicians and Surgeons, New York, USA. aha2152@cumc.columbia.edu.;Department of Neurosurgery, Columbia University Irving Medical Center, New York, USA.;Department of Pathology and Cell Biology, Columbia University Irving Medical Center, New York, USA.;Columbia University Vagelos College of Physicians and Surgeons, New York, USA.;Department of Pathology and Cell Biology, Columbia University Irving Medical Center, New York, USA.;Department of Pathology and Cell Biology, Columbia University Irving Medical Center, New York, USA.;Department of Radiation Oncology, Columbia University Irving Medical Center, New York, USA.;Department of Neurosurgery, Columbia University Irving Medical Center, New York, USA.;Department of Neuro-Oncology, Columbia University Irving Medical Center, New York, USA.;Department of Neurosurgery, Columbia University Irving Medical Center, New York, USA.", "authors": "Agopyan-Miu|Alexander H C W|AHCW|0000-0003-1914-7857;Banu|Matei A|MA|;Miller|Michael L|ML|;Troy|Christopher|C|;Hargus|Gunnar|G|;Canoll|Peter|P|;Wang|Tony J C|TJC|;Feldstein|Neil|N|;Haggiagi|Aya|A|;McKhann|Guy M|GM|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s40478-021-01265-9", "fulltext": "\n==== Front\nActa Neuropathol Commun\nActa Neuropathol Commun\nActa Neuropathologica Communications\n2051-5960\nBioMed Central London\n\n1265\n10.1186/s40478-021-01265-9\nCase Report\nSynchronous supratentorial and infratentorial oligodendrogliomas with incongruous IDH1 mutations, a case report\nhttp://orcid.org/0000-0003-1914-7857\nAgopyan-Miu Alexander H. C. W. aha2152@cumc.columbia.edu\n\n1\nBanu Matei A. mab2315@cumc.columbia.edu\n\n2\nMiller Michael L. mlm2326@cumc.columbia.edu\n\n3\nTroy Christopher cmt2197@cumc.columbia.edu\n\n1\nHargus Gunnar gh2374@cumc.columbia.edu\n\n3\nCanoll Peter pc561@cumc.columbia.edu\n\n3\nWang Tony J. C. tjw2117@cumc.columbia.edu\n\n4\nFeldstein Neil naf6@cumc.columbia.edu\n\n2\nHaggiagi Aya amh2237@cumc.columbia.edu\n\n5\nMcKhann Guy M. II gm317@cumc.columbia.edu\n\n2\n1 grid.21729.3f 0000000419368729 Columbia University Vagelos College of Physicians and Surgeons, New York, USA\n2 grid.21729.3f 0000000419368729 Department of Neurosurgery, Columbia University Irving Medical Center, New York, USA\n3 grid.21729.3f 0000000419368729 Department of Pathology and Cell Biology, Columbia University Irving Medical Center, New York, USA\n4 grid.21729.3f 0000000419368729 Department of Radiation Oncology, Columbia University Irving Medical Center, New York, USA\n5 grid.21729.3f 0000000419368729 Department of Neuro-Oncology, Columbia University Irving Medical Center, New York, USA\n29 9 2021\n29 9 2021\n2021\n9 16017 8 2021\n16 9 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nInfratentorial oligodendrogliomas, a rare pathological entity, are generally considered metastatic lesions from supratentorial primary tumors. Here, we report the case of a 23-year-old man presenting with a histopathologically confirmed right precentral gyrus grade 2 oligodendroglioma and a concurrent pontine grade 3 oligodendroglioma. The pontine lesion was biopsied approximately a year after the biopsy of the precentral lesion due to disease progression despite 4 cycles of procarbazine-CCNU-vincristine (PCV) chemotherapy and stable supratentorial disease. Histology and genetic analysis of the pontine biopsy were consistent with grade 3 oligodendroglioma, and comparison of the two lesions demonstrated common 1p/19q co-deletions and TERT promoter mutations but distinct IDH1 mutations, with a non-canonical IDH1 R132G mutation identified in the infratentorial lesion and a R132H mutation identified in the cortical lesion. Initiation of Temozolomide led to complete response of the supratentorial lesion and durable disease control, while Temozolomide with subsequent radiation therapy of 54 Gy in 30 fractions resulted in partial response of the pontine lesion. This case report supports possible distinct molecular pathogenesis in supratentorial and infratentorial oligodendrogliomas and raises questions about the role of different IDH1 mutant isoforms in explaining treatment resistance to different chemotherapy regimens. Importantly, this case suggests that biopsies of all radiographic lesions, when feasible and safe, should be considered in order to adequately guide management in multicentric oligodendrogliomas.\n\nKeywords\n\nMultifocal\nLow-Grade Glioma\nIDH mutant\nSupratentorial\nInfratentorial\nissue-copyright-statement© The Author(s) 2021\n==== Body\npmcIntroduction\n\nOligodendrogliomas represent approximately 5% of all glial tumors in the US adult population [13]. Those arising in the infratentorial compartment are rare as most arise in the cerebrum. Thus far, only a few isolated case studies have reported genetically confirmed, IDH mutant and 1p/19q-codeleted, infratentorial oligodendrogliomas [3, 4, 6, 10, 13]. High-grade gliomas in adolescents and young adults (AYA, 15–25 years old) have been recently shown to harbor distinct molecular features compared to both the pediatric and adult population. In this particular age group, WHO grade may have limited utility whereas molecular subtypes have a major prognostic impact [19]. Interestingly, noncanonical IDH1 mutations have been identified with a higher frequency in AYA gliomas compared to the adult patient population [19]. The role of distinct molecular features in selecting management strategies, however, remains unclear.\n\nThe simultaneous presence of multiple lesions, especially lesions with supratentorial and infratentorial components, is a rare occurrence in gliomas of all type [20]. Concurrent lesions are classified as either multifocal or multicentric based on radiographic and/or pathologic features. Multifocal lesions are those that either demonstrate a path of contiguous hyperintensity on T2 MR images, or if the pattern of dissemination can be explained by spread along white matter tracts, CSF, or local spread from satellite lesions [14]. Multicentric lesions, on the other hand, cannot be described by the previous features and includes those lesions separated by time, termed metachronous lesions [14]. Given the rarity of synchronous lesions, little is known about their underlying molecular/genetic relationships. Some studies proposed independent gliomagenesis events. For example, Lee et al. [12] suggest that multifocal/multicentric tumors are seeded from geographically segregated, distinct tumor clones given the few shared genetic alterations they observed between multifocal/multicentric tumors. On the other hand, multicentric or multifocal lesions might represent intracranial metastasis of a primary focus, with a common clonal precursor [2, 15]. Several recent studies have suggested potential mechanisms through early divergence and parallel evolution eventually leading to genetically distinct lesions [1, 9]. Subclonal drivers with late occurrence rather than founder events were believed to drive the evolution of such lesions [1]. In this regard, the role of early events during gliomagenesis, such as IDH1 mutations, in driving multicentric gliomas remains elusive. The clinical utility of classifying multiple concurrent gliomas as either multifocal or multicentric remains unclear. In the absence of specific guidelines, management largely resembles that of solitary lesions despite the worse prognosis associated with multifocal/multicentric gliomas [8, 14].\n\nHere, we present a rare case of a 23-year-old man with synchronous, genetically confirmed right precentral grade 2 and pontine grade 3 oligodendroglioma. The two lesions harbored similar 1p/19q-codeletions and TERT mutations but have different IDH1 mutations: a canonical IDH1 R132H was identified in the precentral lesion while a noncanonical IDH1 R132G mutation was identified in the pontine lesion. Importantly, the two lesions differed in their response to four cycles of procarbazine-CCNU-vincristine (PCV) chemotherapy. The case illustrates one possible pathogenesis of multifocal/multicentric oligodendrogliomas, via early subclonal divergence and parallel evolution, and suggests the possible importance of performing biopsies of all radiographically visible lesions, when safe and technically feasible, as it may impact subsequent treatment decisions.\n\nCase presentation\n\nThe patient, a previously healthy 23-year-old man, first presented to an outside hospital with complaints of intermittent diplopia, tinnitus and occipital pain. Due to persistent headache, he underwent an MRI scan which revealed synchronous, non-enhancing, T2/FLAIR hyperintense lesions in the right precentral gyrus and pons as well as increased signal along the right 8th cranial nerve. Initial serial scans were stable and the patient remained in stable condition during that time but eventually presented to our institution 8 months later for a second opinion. By this time, he developed headaches, mild photophobia, left-sided weakness, and left facial numbness. Initial in-house imaging at the time demonstrated a 3.9 × 3.1 × 4.4 cm heterogenous, but primarily T1 hypointense, T2 hyperintense, infiltrating, and mildly expansile pontine lesion with minimal patchy contrast enhancement and diffusion restriction that was larger in size compared to imaging obtained from the outside hospital. Extension into the floor of the fourth ventricle, compression of the prepontine cistern, and obstructive hydrocephalus was noted. Extension into the middle cerebellar peduncles and encasement of the basilar artery was also noted. MR spectroscopy revealed elevated choline peak and reversal of the choline/NAA ratio, and was overall consistent with a glial tumor. A second infiltrating and expansile, non-enhancing lesion, measuring 2.7 × 2.2 × 1.5 cm, in the right precentral gyrus with similar imaging characteristics to the pontine lesion was also seen and noted to have increased in size compared to imaging studies obtained from the outside hospital (Fig. 1). MR perfusion demonstrated low relative cerebral blood volume and flow values, suggestive of a low-grade glioma.Fig. 1 MRI of multifocal lesions on presentation. A Axial T2-FLAIR demonstrating a hyperintense round lesion, measuring 2.7 × 2.2 × 1.5 cm (CC × AP × transverse), in the precentral gyrus. Initial measurements prior to presentation at our institution: 2.2 × 1.7 × 1.5 cm. B Left greater than right hyperintensity in the cerebral peduncles on axial T2-FLAIR. C Axial T2-FLAIR demonstrates a heterogenous, hyperintense lesion in the pons, measuring 3.9 × 3.1 × 4.4 cm, with extension into bilateral cerebellopontine cisterns and middle cerebellar peduncles. Encasement of the basilar artery is also present with no obstruction of flow. Initial measurements prior to presentation at our institution: 3.5 × 3.1 × 4.3 cm. D Axial T1 post-contrast image of the pontine lesion demonstrating subtle patchy contrast enhancement. E Sagittal T2 image of the precentral lesion with compression of the central sulcus. F Large heterogenous, T1 hypointense pontine lesion extending from the floor the fourth ventricle to the prepontine cistern ventrally. G Pontine lesion as described with heterogenous hyperintensity on this sagittal T2 slice. H Subtle patchy enhancement is again appreciated within the pontine lesion on this T1 post-contrast sagittal slice\n\nA ventriculoperitoneal shunt was placed to treat the patient’s hydrocephalus. He subsequently underwent an awake craniotomy with sensorimotor mapping for an excisional biopsy of the right peri-rolandic lesion. A subtotal resection was carried out, to avoid inducing a left-hand sensory deficit.\n\nFinal pathological analysis of the biopsied right peri-rolandic lesion demonstrated a low grade diffusely infiltrating glial neoplasm with no microvascular proliferation, necrosis, or mitotic activity. The Ki-67 proliferation index was modestly increased, labeling up to approximately 1.5% of tumor cells. The cells were positive for GFAP, SOX2, IDH1 R132H, and PDGFR-A by immunohistochemistry (Fig. 2), and ATRX staining was preserved. Rare cells showed weak p53 staining, and immunostains for H3 K27M and EGFR were negative. Targeted next generation sequencing panel (FoundationOne CDx, Foundation Medicine, Boston, MA) revealed the presence of a TERT promoter mutation (variant allele fraction, VAF, of 23%) and confirmed the IDH1 R132H mutation (VAF of 19%), while consistent with immunostain result, no mutation in H3F3A was seen (Table 1) Further studies confirmed the presence of 1p/19q-codeletion via fluorescence in situ hybridization (FISH) and an unmethylated MGMT promoter by bisulfite-treatment PCR and melting curve analysis. Based on these findings, the final diagnosis was oligodendroglioma, IDH-mutant and 1p/19q-codeleted, WHO Grade 2.Fig. 2 Genetically divergent multifocal glioma involving cerebrum and brainstem. A–D Biopsies of the cortical mass revealed a diffusely infiltrating glial neoplasm with perineuronal satelitosis and perinuclear clearing (A, 4×; B, 400×). The neoplastic cells expressed SOX2 (brown chromogen) and GFAP (red chromogen) (B inset, 200×), and harbored the IDH1 R132H onco-protein (C, 200×) with retained nuclear expression of ATRX (D, 200×). E–I Biopsies of the pontine mass revealed a diffusely infiltrating glial neoplasm with increased cellularity and prominent mini-gemistocytic cytomorphology (E, 200×; F, 400×). As opposed to the cortical mass, the pontine mass lacked the IDH1 R132H onco-protein (G, 200×) however nuclear expression of ATRX was similarly retained (H, 200×). Ki-67 index was increased in the pontine biopsy – a representative image is provided (I, 200×). (Scale bar = 50 um.)\n\nTable 1 Comparison of genetic findings between the precentral and pontine lesion\n\nPrecentral\tPontine\t\nIDH1 R132H by IHC and next gen sequencing\tIDH1 R132G by next gen sequencing\t\n1p/19q-codeleted by FISH\t1p/19q-codeleted by FISH\t\nTERT promoter mutation 146 C > T by next gen sequencing\tTERT promoter mutation 146 C > T by next gen sequencing\t\nATRX preserved by IHC\tATRX preserved by IHC\t\nUnmethylated MGMT by MGMT methylation promoter assay\tPartial MGMT methylation by a MGMT methylation promoter assay\t\nPDGFR-A positive\tH3 K27M negative by IHC and next gen sequencing\t\nH3 K27M negative by IHC and next gen sequencing\t\t\n\nImaging a month later demonstrated a decrease in size of the ventricular system, a stable peri-rolandic lesion, and stable faint patchy enhancement within the pontine lesion that again demonstrated an interval increase in size compared to the initial scan obtained at the outside hospital. Despite these changes the pontine lesion was considered to likely be an oligodendroglioma given the pathology of the peri-rolandic lesion, albeit with features concerning for a grade 3 lesion on imaging. After a comprehensive multidisciplinary tumor board discussion considering the risks associated with biopsy of the brainstem lesion and the patient’s treatment preference, the decision was made to proceed with a standard PCV chemotherapy regimen alone. During chemotherapy, the patient’s course was complicated by mild peripheral neuropathy and asymptomatic thrombocytopenia necessitating a 25% dose reduction for the third cycle, and a further 25% dose reduction at the start of the fourth cycle in light of recurring thrombocytopenia. Overall, his clinical picture improved, with resolution of headaches, improvement in diplopia, and interval MRI scans up to 8 months out showed stable disease.\n\nImaging at 9 months after initiation of chemotherapy demonstrated new small foci of enhancement in the brainstem lesion, herniation of the cerebellar tonsils, and a stable cortical lesion (Fig. 3). The patient had now developed progressive suboccipital headaches. The decision was made to proceed with surgery for suboccipital decompression of the acquired Chiari malformation together with biopsy of the pontine lesion to guide further management.Fig. 3 Follow up MRI following four cycles of PCV. A Hyperintense lesion of similar size and appearance in the precentral gyrus on axial T2-FLAIR. B Homogenous hyperintense lesions in the left and right cerebral peduncles on axial T2-FLAIR. C Large, primarily hypointense pontine lesion on sagittal T1 measuring 6.1 × 4.8 × 3.9 cm. Note herniation of the cerebellar tonsil. D Axial T2-FLAIR demonstrating new hyperintense foci along the left anterior base of the lesion that extends into the cerebellopontine cistern and internal auditory canal. Again, encasement of the basilar artery is noted but flow is patent\n\nThree small cores of tissue were obtained from the enhancing portion of the pontine lesion. Final pathological analysis of the biopsied brainstem lesion revealed a glial neoplasm of increased cellularity, nuclear pleomorphism, and proliferative activity with up to 3 mitotic figures in this small biopsy and a Ki-67 labeling index of nearly 10%. No tumor necrosis or microvascular proliferation was appreciated. Similar to the supratentorial tumor cells, these tumor cells were positive for GFAP, SOX2, and ATRX. However, IDH1 R132H was unexpectedly negative by immunohistochemistry. FISH confirmed the presence of 1p/19q-codeletion. Targeted next generation sequencing panel revealed a TERT promoter mutation (VAF 55%) identical to the peri-rolandic lesion and an IDH1 R132G mutation (VAF 46%) not seen in the patient’s supratentorial tumor. No other mutations were identified on this laboratory-developed platform which includes assessment of IDH1, IDH2, H3F3A and HIST1H3B (Columbia Solid Tumor Panel, Personalized Genomic Medicine at Columbia University, New York, NY). The MGMT promoter was partially methylated (Table 1). Based on the overall findings, the final diagnosis was anaplastic oligodendroglioma, IDH-mutant and 1p/19q-codeleted, WHO Grade 3.\n\nThe patient tolerated the procedure well and experienced complete resolution of his headaches. Post-operatively he underwent radiation therapy to the brainstem lesion, 54 Gy in 30 fractions, concurrently with systemic Temozolomide chemotherapy for 6 weeks followed by adjuvant Temozolomide, which he continues to this date. He continues to improve clinically, with a KPS of 80 and is able to ambulate independently at the time of this report. He initially developed diplopia which has remained stable since initiation of chemoradiotherapy. He has been off steroids. The most recent MRI at the time of this report, at 27 months post diagnosis, revealed decrease in size of the pontine lesion with near complete resolution of the peri-rolandic lesion and no new supratentorial lesions. Notably, the peri-rolandic lesion showed radiographic response prior to initiation of Temozolomide suggesting PCV chemotherapy benefit.\n\nDiscussion\n\nOligodendrogliomas are relatively rare, well-differentiated neuroepithelial tumors that more commonly occur in the cerebral hemispheres compared to the infratentorial space [10]. We present here a unique case of synchronous supratentorial and infratentorial oligodendrogliomas in a young adult patient with no known predisposing germline mutations. The stark difference in response to four cycles of PCV between the cortical and pontine lesions necessitated the biopsy of the latter and provided the opportunity to compare genetic and histopathologic characteristics. Such studies can provide insight into the origin of distinct tumors and the evolutionary trajectories of IDH-mutant oligodendrogliomas. The most striking finding from the pontine biopsy was the presence of a non-canonical IDH1 R132G mutation that differed from the canonical IDH1 R132H mutation encountered in the supratentorial lesion. This finding suggests two possible avenues of pathogenesis.\n\nOne hypothesis is the presence of two distinct, multicentric tumors that evolved synchronously and independently of each other. Greater rates of non-canonical IDH1 mutations have been reported in infratentorial gliomas compared to supratentorial gliomas, and in lower grade gliomas overall [5, 16, 18, 23]. Given that both canonical and non-canonical IDH1 mutations likely represent early clonal mutations that may even precede 1p/19q-codeletions [11, 23–25], the divergent IDH1 mutations may suggest the synchronous development of two independent low grade gliomas whose distribution is consistent with the reported anatomic distribution and prevalence of mutant IDH1 isoforms thus far.\n\nAn alternative hypothesis is that the infratentorial lesion is in fact a metastatic lesion originating from the supratentorial tumor. In this case, the distinct IDH1 mutations may indicate an evolutionary trajectory that led to a more aggressive subclone, capable of metastatic spread. Therefore, the IDH1 R132G mutation may mark a unique subclone with increased ability to metastasize via corticospinal tract fibers or CSF. Furthermore, it is important to note that the biopsies were separated in time and therefore may in fact capture the temporal evolution of different subclones. The IDH1 R132G mutant cells may have had increased chemoresistance at baseline and may have become the predominant population after PCV chemotherapy secondary to a subclonal selection process.\n\nIn future studies of multicentric gliomas, synchronous longitudinal biopsies coupled with in-depth genetic sequencing could help us infer the timing of clonal separation between the R132G and R132H populations during tumorigenesis. In this case, we are unable to definitively draw conclusions about the pathogenesis of these spatially distributed oligodendrogliomas but provide a roadmap for future studies. Furthermore, we provide evidence that distinct lesions with distinct mutations may have different sensitivities to various chemotherapy and radiation regimens, therefore having important clinical implications.\n\nThe role of IDH1 mutations in predicting response to chemotherapy for oligodendrogliomas has been difficult to establish, in contrast to the well-established predictive value of 1p/19q-codeletions in predicting sensitivity to PCV. The presence of IDH1 mutations in conjunction with 1p/19q-codeletions may indicate a positive prognosis in oligodendroglioma patients treated with adjuvant PCV following radiation therapy [7, 21, 22, 26]. However, it is unclear how many patients in these studies had infratentorial lesions or non-canonical IDH1 mutations. Furthermore, there are few studies comparing the predictive and prognostic value of non-canonical IDH1 mutations to the canonical IDH1 R132H mutation. Enzyme kinetics have been shown to differ between mutant isoforms, and isoforms that produce greater amounts of D-2-hydroxyglutarate, like the R132G isoform, are disadvantaged by the toxicity associated with the metabolite’s buildup [17]. This mechanism may underlie the proposed favorable prognostic associations with non-canonical mutations in oligodendrogliomas [23]. Thus, determining whether the divergent IDH1 mutations played a role in the differential treatment response is difficult. It is also important to note that, after discussion of available treatment options, a chemotherapy only as opposed to radiotherapy plus adjuvant chemotherapy treatment plan was chosen to respect patient preferences. The addition of radiation later in the course with subsequent improved control may indicate the need for more aggressive multimodality approaches in such lesions.\n\nWith respect to overall management, we believe that this case highlights the importance of (1) performing biopsies on all radiographically visible lesions if safe to do so, (2) performing biopsies of treatment resistant lesions, even later in the treatment course and (3) sequencing the IDH1 exon if initial immunohistochemical staining is negative. Even if one subscribes to a multicentric or multifocal theory of pathogenesis, this case shows that there can be notable heterogeneity between foci, and this heterogeneity may impact treatment response [12]. Further, Visani et al. [23] note that a significant proportion of low-grade gliomas in their case series would have been misclassified by WHO 2016 criteria if an investigation only for the canonical R132H mutation was performed. While there is little evidence to suggest a difference in prognostic or predictive value between canonical and non-canonical IDH1 mutations at present, knowing the precise genetic makeup of multicentric or multifocal lesions can guide treatment decisions as more data is uncovered.\n\nConclusion\n\nWe present here a rare case of multifocal high grade oligodendroglioma with supratentorial and infratentorial lesions, distinct IDH1 mutations, and differential response to PCV chemotherapy. This case illustrates one potential evolutionary trajectory of multicentric oligodendrogliomas and provides insight into best management practices for these rare tumors. We speculate that the infratentorial lesion may be a metastatic, higher grade lesion arising from the supratentorial mass, and that the non-canonical IDH1 mutation marked sub-clones with increased tumor invasiveness and/or chemoresistance which diverged early on in tumorigenesis. Alternatively, the supratentorial and infratentorial oligodendrogliomas may represent completely separate, synchronous lesions with distinct genetic alterations. Irrespective of time course in gliomagenesis, this case report highlights the importance of performing individual biopsies of all radiographic lesions, both for therapeutic decisions and for prognostication. Overall, infratentorial low-grade oligodendrogliomas remain a rare and poorly understood pathological entity. Further studies are needed to gain more insight into gliomagenesis and best management practices.\n\nAbbreviations\n\nPCV Procarbazine-CCNU-Vincristine\n\nAYA Adolescent and Young Adult\n\nIDH Isocitrate Dehydrogenase\n\nAcknowledgements\n\nNot applicable.\n\nAuthors' contributions\n\nAHCWAM, MB, and CT collated case information for the report and contributed to the writing of the manuscript. MLM, GH, and PC performed histological examinations of brain tissue and provided editorial feedback on the manuscript. MLM also contributed to the figures for the case report and reviewed the manuscript. TW, AH, NF, and GMM were involved with patient care and provided guidance on the writing of the manuscript. PC, AH, and GMM also provided editorial feedback on the manuscript. All authors read and approved the final manuscript.\n\nFunding\n\nNot applicable.\n\nAvailability of data and materials\n\nData sharing is not applicable to this article as no datasets were generated or analyzed during the current study.\n\nDeclarations\n\nEthics approval and consent to participate\n\nNot applicable.\n\nConsent for publication\n\nThe patient has consented to the use of their information for the purposes of this case report. A signed consent form is available for review upon request.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAlexander H. C. W. Agopyan-Miu and Matei A. Banu these authors contributed equally to this work\n==== Refs\nReferences\n\n1. Abou-El-Ardat K Seifert M Becker K Eisenreich S Lehmann M Hackmann K Rump A Meijer G Carvalho B Temme A Comprehensive molecular characterization of multifocal glioblastoma proves its monoclonal origin and reveals novel insights into clonal evolution and heterogeneity of glioblastomas Neuro Oncol 2017 19 546 557 10.1093/neuonc/now231 28201779\n2. Akimoto J Sasaki H Haraoka R Nakajima N Fukami S Kohno M Case of radiologically multicentric but genetically identical multiple glioblastomas Brain Tumor Pathol 2014 31 113 117 10.1007/s10014-013-0157-x 23934332\n3. Banan R Stichel D Bleck A Hong B Lehmann U Suwala A Reinhardt A Schrimpf D Buslei R Stadelmann C Infratentorial IDH-mutant astrocytoma is a distinct subtype Acta Neuropathol 2020 140 569 581 10.1007/s00401-020-02194-y 32776277\n4. Buckner JC Shaw EG Pugh SL Chakravarti A Gilbert MR Barger GR Coons S Ricci P Bullard D Brown PD Radiation plus procarbazine, CCNU, and vincristine in low-grade glioma N Engl J Med 2016 374 1344 1355 10.1056/NEJMoa1500925 27050206\n5. Ellezam B Theeler BJ Walbert T Mammoser AG Horbinski C Kleinschmidt-DeMasters BK Perry A Puduvalli V Fuller GN Bruner JM Low rate of R132H IDH1 mutation in infratentorial and spinal cord grade II and III diffuse gliomas Acta Neuropathol 2012 124 449 451 10.1007/s00401-012-1011-7 22772980\n6. Erdogan O Sakar M Bozkurt S Bayrakli F Low grade oligodendroglioma seeding around the 4th ventricle Br J Neurosurg 2019 10.1080/02688697.2019.1594692 31007092\n7. Hafazalla K Sahgal A Jaja B Perry JR Das S Procarbazine, CCNU and vincristine (PCV) versus temozolomide chemotherapy for patients with low-grade glioma: a systematic review Oncotarget 2018 9 33623 33633 10.18632/oncotarget.25890 30263090\n8. Hassaneen W Levine NB Suki D Salaskar AL de Moura LA McCutcheon IE Prabhu SS Lang FF DeMonte F Rao G Multiple craniotomies in the management of multifocal and multicentric glioblastoma. Clinical article J Neurosurg 2011 114 576 584 10.3171/2010.6.JNS091326 20690813\n9. Hayes J Yu Y Jalbert LE Mazor T Jones LE Wood MD Walsh KM Bengtsson H Hong C Oberndorfer S Genomic analysis of the origins and evolution of multicentric diffuse lower-grade gliomas Neuro Oncol 2018 20 632 641 10.1093/neuonc/nox205 29077933\n10. Hewer E Beck J Vassella E Vajtai I Anaplastic oligodendroglioma arising from the brain stem and featuring 1p/19q co-deletion Neuropathology 2014 34 32 38 10.1111/neup.12043 23711170\n11. Lass U Numann A von Eckardstein K Kiwit J Stockhammer F Horaczek JA Veelken J Herold-Mende C Jeuken J von Deimling A Clonal analysis in recurrent astrocytic, oligoastrocytic and oligodendroglial tumors implicates IDH1-mutation as common tumor initiating event PLoS ONE 2012 7 e41298 10.1371/journal.pone.0041298 22844452\n12. Lee JK Wang J Sa JK Ladewig E Lee HO Lee IH Kang HJ Rosenbloom DS Camara PG Liu Z Spatiotemporal genomic architecture informs precision oncology in glioblastoma Nat Genet 2017 49 594 599 10.1038/ng.3806 28263318\n13. Ostrom QT Gittleman H Fulop J Liu M Blanda R Kromer C Wolinsky Y Kruchko C Barnholtz-Sloan JS CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2008–2012 Neuro Oncol 2015 17 Suppl 4 iv1 iv62 10.1093/neuonc/nov189 26511214\n14. Patil CG Eboli P Hu J Management of multifocal and multicentric gliomas Neurosurg Clin N Am 2012 23 343 350 10.1016/j.nec.2012.01.012 22440877\n15. Picart T Le Corre M Chan-Seng E Cochereau J Duffau H The enigma of multicentric glioblastoma: physiopathogenic hypothesis and discussion about two cases Br J Neurosurg 2018 32 610 613 10.1080/02688697.2018.1501465 30136593\n16. Poetsch L Bronnimann C Loiseau H Frenel JS Siegfried A Seizeur R Gauchotte G Cappellen D Carpentier C Figarella-Branger D Characteristics of IDH-mutant gliomas with non-canonical IDH mutation J Neurooncol 2021 151 279 286 10.1007/s11060-020-03662-x 33205355\n17. Pusch S Schweizer L Beck AC Lehmler JM Weissert S Balss J Miller AK von Deimling A D-2-Hydroxyglutarate producing neo-enzymatic activity inversely correlates with frequency of the type of isocitrate dehydrogenase 1 mutations found in glioma Acta Neuropathol Commun 2014 2 19 10.1186/2051-5960-2-19 24529257\n18. Reyes-Botero G Giry M Mokhtari K Labussiere M Idbaih A Delattre JY Laigle-Donadey F Sanson M Molecular analysis of diffuse intrinsic brainstem gliomas in adults J Neurooncol 2014 116 405 411 10.1007/s11060-013-1312-2 24242757\n19. Roux A Pallud J Saffroy R Edjlali-Goujon M Debily MA Boddaert N Sanson M Puget S Knafo S Adam C High-grade gliomas in adolescents and young adults highlight histomolecular differences from their adult and pediatric counterparts Neuro Oncol 2020 22 1190 1202 10.1093/neuonc/noaa024 32025728\n20. Terakawa Y Yordanova YN Tate MC Duffau H Surgical management of multicentric diffuse low-grade gliomas: functional and oncological outcomes: clinical article J Neurosurg 2013 118 1169 1175 10.3171/2013.2.JNS121747 23495876\n21. van den Bent MJ Brandes AA Taphoorn MJ Kros JM Kouwenhoven MC Delattre JY Bernsen HJ Frenay M Tijssen CC Grisold W Adjuvant procarbazine, lomustine, and vincristine chemotherapy in newly diagnosed anaplastic oligodendroglioma: long-term follow-up of EORTC brain tumor group study 26951 J Clin Oncol 2013 31 344 350 10.1200/JCO.2012.43.2229 23071237\n22. van den Bent MJ Dubbink HJ Marie Y Brandes AA Taphoorn MJ Wesseling P Frenay M Tijssen CC Lacombe D Idbaih A IDH1 and IDH2 mutations are prognostic but not predictive for outcome in anaplastic oligodendroglial tumors: a report of the European Organization for Research and Treatment of Cancer Brain Tumor Group Clin Cancer Res 2010 16 1597 1604 10.1158/1078-0432.CCR-09-2902 20160062\n23. Visani M Acquaviva G Marucci G Paccapelo A Mura A Franceschi E Grifoni D Pession A Tallini G Brandes AA Non-canonical IDH1 and IDH2 mutations: a clonal and relevant event in an Italian cohort of gliomas classified according to the 2016 World Health Organization (WHO) criteria J Neurooncol 2017 135 245 254 10.1007/s11060-017-2571-0 28748342\n24. Watanabe T Nobusawa S Kleihues P Ohgaki H IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas Am J Pathol 2009 174 1149 1153 10.2353/ajpath.2009.080958 19246647\n25. Wesseling P van den Bent M Perry A Oligodendroglioma: pathology, molecular mechanisms and markers Acta Neuropathol 2015 129 809 827 10.1007/s00401-015-1424-1 25943885\n26. Wick W Hartmann C Engel C Stoffels M Felsberg J Stockhammer F Sabel MC Koeppen S Ketter R Meyermann R NOA-04 randomized phase III trial of sequential radiochemotherapy of anaplastic glioma with procarbazine, lomustine, and vincristine or temozolomide J Clin Oncol 2009 27 5874 5880 10.1200/JCO.2009.23.6497 19901110\n\n", "fulltext_license": "CC BY", "issn_linking": "2051-5960", "issue": "9(1)", "journal": "Acta neuropathologica communications", "keywords": "IDH mutant; Infratentorial; Low-Grade Glioma; Multifocal; Supratentorial", "medline_ta": "Acta Neuropathol Commun", "mesh_terms": null, "nlm_unique_id": "101610673", "other_id": null, "pages": "160", "pmc": null, "pmid": "34587990", "pubdate": "2021-09-29", "publication_types": "D016428:Journal Article", "references": "28201779;27050206;25943885;24529257;28748342;19246647;23495876;33205355;24242757;29077933;31007092;22844452;20160062;23071237;19901110;32025728;23934332;32776277;22772980;22440877;20690813;30136593;30263090;28263318;23711170;26511214", "title": "Synchronous supratentorial and infratentorial oligodendrogliomas with incongruous IDH1 mutations, a case report.", "title_normalized": "synchronous supratentorial and infratentorial oligodendrogliomas with incongruous idh1 mutations a case report" }
[ { "companynumb": "US-009507513-2110USA008084", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TEMOZOLOMIDE" }, "drugadditional": "4", ...
{ "abstract": "We sought to evaluate COVID-19 clinical course in patients with IBD treated with different medication classes and combinations.\n\n\n\nSurveillance Epidemiology of Coronavirus Under Research Exclusion for Inflammatory Bowel Disease (SECURE-IBD) is a large, international registry created to monitor outcomes of IBD patients with confirmed COVID-19. We used multivariable regression with a generalised estimating equation accounting for country as a random effect to analyse the association of different medication classes with severe COVID-19, defined as intensive care unit admission, ventilator use and/or death.\n\n\n\n1439 cases from 47 countries were included (mean age 44.1 years, 51.4% men) of whom 112 patients (7.8%) had severe COVID-19. Compared with tumour necrosis factor (TNF) antagonist monotherapy, thiopurine monotherapy (adjusted OR (aOR) 4.08, 95% CI 1.73 to 9.61) and combination therapy with TNF antagonist and thiopurine (aOR 4.01, 95% CI 1.65 to 9.78) were associated with an increased risk of severe COVID-19. Any mesalamine/sulfasalazine compared with no mesalamine/sulfasalazine use was associated with an increased risk (aOR 1.70, 95% CI 1.26 to 2.29). This risk estimate increased when using TNF antagonist monotherapy as a reference group (aOR 3.52, 95% CI 1.93 to 6.45). Interleukin-12/23 and integrin antagonists were not associated with significantly different risk than TNF antagonist monotherapy (aOR 0.98, 95% CI 0.12 to 8.06 and aOR 2.42, 95% CI 0.59 to 9.96, respectively).\n\n\n\nCombination therapy and thiopurines may be associated with an increased risk of severe COVID-19. No significant differences were observed when comparing classes of biologicals. These findings warrant confirmation in large population-based cohorts.MKH should be changed to MDK for co-last author line.", "affiliations": "The Henry D Janowitz Division of Gastroenterology, Icahn School of Medicine at Mount Sinai, New York, New York, USA ryan.ungaro@mssm.edu.;University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA.;Department of Medicine, University of Otago, Christchurch, New Zealand.;Departments of Medicine and Community Health Sciences, University of Calgary, Calgary, Alberta, Canada.;The Henry D Janowitz Division of Gastroenterology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;Division of Gastroenterology, Hospital of the University of Pennsylvania, Philadelphia, Pennsylvania, USA.;Department of Medicine and Therapeutics, Institute of Digestive Disease, State Key Laboratory of Digestive Disease, Li Ka Shing Institute of Health Science, Chinese University of Hong Kong, Shatin, NT, Hong Kong.;Department of Gastroenterology, Université Catholique de Louvain, Yvoir, Belgium.;Department of Medicine IV, Medical University Vienna, Vienna, Austria.;Department of Gastroenterology, Hospital Israelita Albert Einstein, Sao Paulo, Brazil.;Departments of Medicine and Community Health Sciences, University of Calgary, Calgary, Alberta, Canada.;University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA.;The Henry D Janowitz Division of Gastroenterology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.;University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA.", "authors": "Ungaro|Ryan C|RC|0000-0001-8687-3758;Brenner|Erica J|EJ|;Gearry|Richard B|RB|;Kaplan|Gilaad G|GG|0000-0003-2719-0556;Kissous-Hunt|Michele|M|;Lewis|James D|JD|;Ng|Siew C|SC|0000-0002-6850-4454;Rahier|Jean-Francois|JF|;Reinisch|Walter|W|0000-0002-2088-091X;Steinwurz|Flávio|F|;Underwood|Fox E|FE|;Zhang|Xian|X|;Colombel|Jean-Frederic|JF|;Kappelman|Michael D|MD|", "chemical_list": "D000893:Anti-Inflammatory Agents; D000079424:Tumor Necrosis Factor Inhibitors; D015122:Mercaptopurine; D001379:Azathioprine", "country": "England", "delete": false, "doi": "10.1136/gutjnl-2020-322539", "fulltext": null, "fulltext_license": null, "issn_linking": "0017-5749", "issue": "70(4)", "journal": "Gut", "keywords": "infectious disease; inflammatory bowel disease", "medline_ta": "Gut", "mesh_terms": "D000328:Adult; D000893:Anti-Inflammatory Agents; D001379:Azathioprine; D000086382:COVID-19; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D015212:Inflammatory Bowel Diseases; D007391:International Cooperation; D008297:Male; D015122:Mercaptopurine; D012042:Registries; D020379:Risk Adjustment; D000086402:SARS-CoV-2; D012720:Severity of Illness Index; D000079424:Tumor Necrosis Factor Inhibitors", "nlm_unique_id": "2985108R", "other_id": null, "pages": "725-732", "pmc": null, "pmid": "33082265", "pubdate": "2021-04", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": "32091533;32409499;29925913;29655835;32247631;32247642;32240123;30840605;32576548;32203977;32173574;32167524;29050646;32101660;27914657;14283879;32109013;32278362;25800216;24300857;30020478;30420398;32425234;24613021;32247212;27914655;32043983;23295276;32839624;29610508", "title": "Effect of IBD medications on COVID-19 outcomes: results from an international registry.", "title_normalized": "effect of ibd medications on covid 19 outcomes results from an international registry" }
[ { "companynumb": "US-UCBSA-2021016296", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CERTOLIZUMAB PEGOL" }, "drugadditional": "3", ...
{ "abstract": "We compared the rates of medical closure of patent ductus arteriosus (PDA) and complications (renal dysfunction, necrotizing enterocolitis, spontaneous intestinal perforation, and intraventricular hemorrhage) between infants treated with indomethacin and infants treated with ibuprofen. We performed a retrospective comparative cohort study of infants treated with indomethacin or ibuprofen for symptomatic PDA at Duke University Medical Center between November 2005 and November 2007. We identified 65 infants who received indomethacin and 57 who received ibuprofen. The rate of survival without surgical ductal ligation was 62% (40/65) in the indomethacin group and 58% (33/57) in the ibuprofen group (p = 0.71). The rate of the composite of complications (death, necrotizing enterocolitis, or intestinal perforation) was 40% (26/65) in the indomethacin group and 32% (18/57) in the ibuprofen group (p = 0.35). There was no significant difference between groups in elevation of serum creatinine during treatment. In clinical practice, ibuprofen appears to be as effective as indomethacin for closure of patent ductus arteriosus with similar complication rates. The decision to use one agent over the other should be based on dose schedule preference and the currently published clinical trials until more safety and effectiveness data are available.", "affiliations": "Department of Pediatrics, Duke University Medical Center, Durham, North Carolina, USA.", "authors": "Katakam|Lakshmi I|LI|;Cotten|C Michael|CM|;Goldberg|Ronald N|RN|;Dang|Chi N|CN|;Smith|P Brian|PB|", "chemical_list": "D007052:Ibuprofen; D007213:Indomethacin", "country": "United States", "delete": false, "doi": "10.1055/s-0029-1243371", "fulltext": null, "fulltext_license": null, "issn_linking": "0735-1631", "issue": "27(5)", "journal": "American journal of perinatology", "keywords": null, "medline_ta": "Am J Perinatol", "mesh_terms": "D004374:Ductus Arteriosus, Patent; D005260:Female; D006801:Humans; D007052:Ibuprofen; D007213:Indomethacin; D007231:Infant, Newborn; D008297:Male; D012189:Retrospective Studies; D016896:Treatment Outcome", "nlm_unique_id": "8405212", "other_id": null, "pages": "425-9", "pmc": null, "pmid": "20013605", "pubdate": "2010-05", "publication_types": "D003160:Comparative Study; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": "19067286;17768157;16219273;17437233;12014386;10974130;16813969;17545388;15574629;18446180;17256050;9175948;19255990;18254020", "title": "Safety and effectiveness of indomethacin versus ibuprofen for treatment of patent ductus arteriosus.", "title_normalized": "safety and effectiveness of indomethacin versus ibuprofen for treatment of patent ductus arteriosus" }
[ { "companynumb": "US-JNJFOC-20150219044", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "IBUPROFEN" }, "drugadditional": null, "...
{ "abstract": "Both invasive fungal infection with Aspergillus fumigatus and blood stream infection with methicillin-susceptible Staphylococcus aureus (MSSA) have a significant incidence in the critically ill. Voriconazole and, more recently, isavuconazole and high dose flucloxacillin are the standard first line treatments for these respective serious infections. However, an underestimated risk of a significant interaction needs to be taken into consideration, when both co-occur. We wish to highlight this important issue in the management of these patients through two case reports and to point to the inconsistency between different validated databases regarding this significant interaction as well the importance of a strict protocol for readily available therapeutic drug monitoring.", "affiliations": "Departments of Clinical Pharmacy AZ Delta, Deltalaan 1, B-8800, Roeselare, Belgium. tine.vangheluwe@azdelta.be.;Department of Laboratory Medicine, Sint Andries Hospital, Bruggestraat 84, B-8700, Tielt, Belgium.;Department of Intensive Care AZ Delta, Deltalaan 1, B-8800, Roeselare, Belgium.;Department of Infectious Diseases AZ Delta, Deltalaan 1, B-8800, Roeselare, Belgium.", "authors": "Vangheluwe|Tine|T|;Van Hoecke|Frederik|F|;Dumoulin|Alexander|A|;Vogelaers|Dirk|D|", "chemical_list": null, "country": "Germany", "delete": false, "doi": "10.1007/s10096-021-04333-z", "fulltext": null, "fulltext_license": null, "issn_linking": "0934-9723", "issue": null, "journal": "European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology", "keywords": "Flucloxacillin; Interaction; Isavuconazole; Voriconazole", "medline_ta": "Eur J Clin Microbiol Infect Dis", "mesh_terms": null, "nlm_unique_id": "8804297", "other_id": null, "pages": null, "pmc": null, "pmid": "34494173", "pubdate": "2021-09-07", "publication_types": "D016428:Journal Article", "references": "25777322;27365388;28717040", "title": "Broad-spectrum azoles and flucloxacillin: a dangerous match.", "title_normalized": "broad spectrum azoles and flucloxacillin a dangerous match" }
[ { "companynumb": "BE-TEVA-2022-BE-2011634", "fulfillexpeditecriteria": "1", "occurcountry": "BE", "patient": { "drug": [ { "actiondrug": "3", "activesubstance": { "activesubstancename": "VORICONAZOLE" }, "drugadditional": null, ...
{ "abstract": "Percutaneous left atrial appendage (LAA) occlusion has been developed as a viable option for stroke and thromboembolism prevention in patients with non-valvular atrial fibrillation (NVAF) and at high risk for cerebral cardioembolic events. Data on device implantation and long-term follow-up from large cohorts are limited.\n\n\n\n110 consecutive patients with NVAF and contraindications to oral anticoagulants (OACs) underwent LAA occlusion procedures and achieved a longer than 1 year follow-up. All patients were enrolled in a prospective registry. Procedures were performed using the Amplatzer Cardiac Plug or Amulet guided by fluoroscopy and intracardiac echocardiography.\n\n\n\nMean age of the population was 77±6 years old; 68 were men. Atrial fibrillation was paroxysmal in 20%, persistent in 15.5% and permanent in 64.5% of cases, respectively. Mean CHA2DS2-VASc and HAS-BLED scores were 4.3±1.3 and 3.4±1, respectively. Technical success (successful deployment and implantation of device) was achieved in 100% of procedures. Procedural success (technical success without major procedure-related complications) was achieved in 96.4%, with a 3.6% rate of major procedural complications (three cases of pericardial tamponade requiring drainage and one case of major bleeding). Mean follow-up was 30±12 months (264 patient-years). Annual rates for ischaemic stroke and for other thromboembolic events were respectively 2.2% and 0%, and annual rate for major bleeding was 1.1%.\n\n\n\nOur data suggest LAA occlusion in high-risk patients with NVAF not suitable for OACs is feasible and associated with low complication rates as well as low rates of stroke and major bleeding at long-term follow-up.", "affiliations": "Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.;Fondazione Toscana G. Monasterio-Ospedale del Cuore G. Pasquinucci, Massa, Italy.", "authors": "Berti|Sergio|S|;Pastormerlo|Luigi Emilio|LE|;Rezzaghi|Marco|M|;Trianni|Giuseppe|G|;Paradossi|Umberto|U|;Cerone|Elisa|E|;Ravani|Marcello|M|;De Caterina|Alberto Ranieri|AR|;Rizza|Antonio|A|;Palmieri|Cataldo|C|", "chemical_list": "D000925:Anticoagulants", "country": "England", "delete": false, "doi": "10.1136/heartjnl-2015-309150", "fulltext": null, "fulltext_license": null, "issn_linking": "1355-6037", "issue": "102(24)", "journal": "Heart (British Cardiac Society)", "keywords": "Stroke", "medline_ta": "Heart", "mesh_terms": "D000284:Administration, Oral; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D020517:Atrial Appendage; D001281:Atrial Fibrillation; D006328:Cardiac Catheterization; D000075202:Contraindications; D004452:Echocardiography; D005260:Female; D005471:Fluoroscopy; D005500:Follow-Up Studies; D006470:Hemorrhage; D006801:Humans; D053208:Kaplan-Meier Estimate; D008297:Male; D018579:Patient Selection; D011446:Prospective Studies; D015641:Radiography, Interventional; D012042:Registries; D018570:Risk Assessment; D012307:Risk Factors; D020521:Stroke; D013997:Time Factors; D016896:Treatment Outcome; D018084:Ultrasonography, Interventional", "nlm_unique_id": "9602087", "other_id": null, "pages": "1969-1973", "pmc": null, "pmid": "27492943", "pubdate": "2016-12-15", "publication_types": "D016428:Journal Article", "references": null, "title": "Left atrial appendage occlusion in high-risk patients with non-valvular atrial fibrillation.", "title_normalized": "left atrial appendage occlusion in high risk patients with non valvular atrial fibrillation" }
[ { "companynumb": "IT-BAYER-2017-019492", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "TICLOPIDINE" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nInfantile cephalic and facial hemangiomas (IHs) are common and histologically benign vascular lesions in infants. This study investigates the clinical effect of using large doses of Propranolol for the treatment of IHs.\n\n\nMETHODS\nThis study contains 38 patients with IHs. All patients received general screening before the treatment. The dosage of Propranolol was increased over the course of treatment, which initiated three days. 1mg/kg on the first day, then increased by 0.5 mg/kg each day. The daily dose was divided into two smaller doses, administered every 12 hours, half an hour after feeding. Patients were hospitalized for six days. In the absence of side effects, treatment was continued at home and patients were reevaluated every month. Generally, one course of treatment lasted six months.\n\n\nRESULTS\nWith the treatment, the entire group had significant improvement. 6 of them had excellent results. 22 had a good response with considerable lesion reduction. Side effects were limited during or after the treatment.\n\n\nCONCLUSIONS\nLarge doses of oral Propranolol to treat severe IHs patients had great clinical results. The treatment can shorten the natural course of IHs, making it a possible first choice for treatment.", "affiliations": null, "authors": "Jianguo|Ke|K|;Xichun|Wang|W|;Mingkun|Zhan|Z|;Qiaoling|Cai|C|;Wenjin|Li|L|", "chemical_list": "D000970:Antineoplastic Agents; D001786:Blood Glucose; D011433:Propranolol", "country": "United States", "delete": false, "doi": "10.17796/1053-4628-39.3.268", "fulltext": null, "fulltext_license": null, "issn_linking": "1053-4628", "issue": "39(3)", "journal": "The Journal of clinical pediatric dentistry", "keywords": "Infantile hemangiomas; Propranolol", "medline_ta": "J Clin Pediatr Dent", "mesh_terms": "D000970:Antineoplastic Agents; D001786:Blood Glucose; D001794:Blood Pressure; D004334:Drug Administration Schedule; D005153:Facial Neoplasms; D005260:Female; D005500:Follow-Up Studies; D006258:Head and Neck Neoplasms; D006339:Heart Rate; D006391:Hemangioma; D006801:Humans; D007223:Infant; D008297:Male; D011433:Propranolol; D012074:Remission Induction; D012881:Skin Temperature; D016896:Treatment Outcome", "nlm_unique_id": "9100079", "other_id": null, "pages": "268-71", "pmc": null, "pmid": "26208073", "pubdate": "2015", "publication_types": "D016428:Journal Article", "references": null, "title": "Large Doses of Propranolol for the Treatment of Infantile Cephalic and Facial Hemangiomas: A Clinical Report of 38 Cases.", "title_normalized": "large doses of propranolol for the treatment of infantile cephalic and facial hemangiomas a clinical report of 38 cases" }
[ { "companynumb": "CN-MYLANLABS-2015M1031902", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "PROPRANOLOL\\PROPRANOLOL HYDROCHLORIDE" }, "d...
{ "abstract": "BACKGROUND\nDermatologic toxicity is a very common immune-related adverse event (irAE) for patients with melanoma who are receiving immune checkpoint inhibitor therapy (ICI). Concurrent skin infection, such as in the case of pityriasis versicolor reported here, can mimic and/or exacerbate dermatologic toxicity from irAE.\n\n\nMETHODS\nA 58-year-old Caucasian man with a history of pityriasis versicolor infection and metastatic melanoma received ICI therapy. He developed progressively worsening pruritic maculopapular lesions 22 weeks into his treatment that ultimately covered 40% of his body. He was diagnosed with dermatologic toxicity due to ICI therapy with concurrent pityriasis versicolor. He was initially started on topical steroid and topical antifungal cream but achieved minimum improvement. His treatment was then escalated to oral prednisone, but it only achieved modest control of his dermatitis. All subsequent attempts to wean him from oral prednisone resulted in worsening of his dermatitis. Eventually he was started on oral fluconazole in combination with prednisone, which led to rapid resolution of his dermatitis.\n\n\nCONCLUSIONS\nWe report a case of dermatological toxicity due to an irAE with concurrent pityriasis versicolor. The steroid treatment for irAE was likely exacerbating the underlying fungal infection, and the fungal infection was in term mimicking the symptoms of irAE. This patient's severe dermatitis was only brought under control after receiving a more potent antifungal therapy in combination with a steroid. It is vital to look beyond the irAE when managing dermatitis in patients receiving ICI therapy.", "affiliations": "Division of Hospital Medicine, The Ohio State University Comprehensive Cancer Center, Starling Loving Hall, 320 W. 10th Ave, Columbus, Ohio, 43210, USA. mingjia.li@osumc.edu.;Division of Dermatology, The Ohio State University Comprehensive Cancer Center, 395 W 12th Ave, Columbus, Ohio, 43210, USA.;Division of Medical Oncology, The Ohio State University Comprehensive Cancer Center, Lincoln Tower 1300, 1800 Cannon Dr, Columbus, Ohio, 43210, USA.;Division of Medical Oncology, The Ohio State University Comprehensive Cancer Center, Lincoln Tower 1300, 1800 Cannon Dr, Columbus, Ohio, 43210, USA.;Division of Medical Oncology, The Ohio State University Comprehensive Cancer Center, Lincoln Tower 1300, 1800 Cannon Dr, Columbus, Ohio, 43210, USA.", "authors": "Li|Mingjia|M|http://orcid.org/0000-0002-3910-4179;Spaccarelli|Natalie|N|;Kendra|Kari|K|;Wu|Richard C|RC|;Verschraegen|Claire|C|", "chemical_list": "D000935:Antifungal Agents", "country": "England", "delete": false, "doi": "10.1186/s13256-021-02818-1", "fulltext": "\n==== Front\nJ Med Case Rep\nJ Med Case Rep\nJournal of Medical Case Reports\n1752-1947\nBioMed Central London\n\n2818\n10.1186/s13256-021-02818-1\nCase Report\nRefractory dermatitis contributed by pityriasis versicolor: a case report\nhttp://orcid.org/0000-0002-3910-4179\nLi Mingjia mingjia.li@osumc.edu\n\n1\nSpaccarelli Natalie natalie.spaccarelli@osumc.edu\n\n2\nKendra Kari kari.kendra@osumc.edu\n\n3\nWu Richard C. richard.wu@osumc.edu\n\n3\nVerschraegen Claire claire.verschraegen@osumc.edu\n\n3\n1 grid.261331.4 0000 0001 2285 7943 Division of Hospital Medicine, The Ohio State University Comprehensive Cancer Center, Starling Loving Hall, 320 W. 10th Ave, Columbus, Ohio 43210 USA\n2 grid.261331.4 0000 0001 2285 7943 Division of Dermatology, The Ohio State University Comprehensive Cancer Center, 395 W 12th Ave, Columbus, Ohio 43210 USA\n3 grid.261331.4 0000 0001 2285 7943 Division of Medical Oncology, The Ohio State University Comprehensive Cancer Center, Lincoln Tower 1300, 1800 Cannon Dr, Columbus, Ohio 43210 USA\n23 4 2021\n23 4 2021\n2021\n15 21210 8 2020\n23 3 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nDermatologic toxicity is a very common immune-related adverse event (irAE) for patients with melanoma who are receiving immune checkpoint inhibitor therapy (ICI). Concurrent skin infection, such as in the case of pityriasis versicolor reported here, can mimic and/or exacerbate dermatologic toxicity from irAE.\n\nCase presentation\n\nA 58-year-old Caucasian man with a history of pityriasis versicolor infection and metastatic melanoma received ICI therapy. He developed progressively worsening pruritic maculopapular lesions 22 weeks into his treatment that ultimately covered 40% of his body. He was diagnosed with dermatologic toxicity due to ICI therapy with concurrent pityriasis versicolor. He was initially started on topical steroid and topical antifungal cream but achieved minimum improvement. His treatment was then escalated to oral prednisone, but it only achieved modest control of his dermatitis. All subsequent attempts to wean him from oral prednisone resulted in worsening of his dermatitis. Eventually he was started on oral fluconazole in combination with prednisone, which led to rapid resolution of his dermatitis.\n\nConclusion\n\nWe report a case of dermatological toxicity due to an irAE with concurrent pityriasis versicolor. The steroid treatment for irAE was likely exacerbating the underlying fungal infection, and the fungal infection was in term mimicking the symptoms of irAE. This patient’s severe dermatitis was only brought under control after receiving a more potent antifungal therapy in combination with a steroid. It is vital to look beyond the irAE when managing dermatitis in patients receiving ICI therapy.\n\nKeywords\n\nImmune-related adverse event\nSkin infection\nDermatitis\nPityriasis versicolor\nissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\n\nImmune checkpoint inhibitors (ICI) have led to a remarkable improvement in the long-term survival of patients with melanoma and other types of cancer [1, 2]. However, the prevalence of ICI usage has led to a surge in a number of dermatologic toxicities due to immune-related adverse events (irAEs) [3]. For some patients, these irAEs have caused a considerable amount of morbidity and mortality [3]. Aside from frequent dermatologic toxicities, patients with irAEs frequently require treatment with immunosuppressive agents that can increase their risk for opportunistic skin infections [4]. Here we report a case of refractory dermatitis due to an irAE with associated underlying pityriasis versicolor.\n\nCase presentation\n\nA 58-year-old Caucasian man with a history of pityriasis versicolor and metastatic melanoma was started on pembrolizumab 200 mg every 21 days. He developed pruritic maculopapular rashes throughout his body 22 weeks into the treatment course. In some areas, the maculopapular lesions coalesced into patches and plaques. Many of these lesions were scaly in appearance and resembled his prior pityriasis versicolor infection. The skin eruptions were mainly in the abdomen, back, and extremities (Figs. 1, 2). He was started on topical betamethasone diproprionate 0.05% and miconazole nitrate 2% cream for the dermatitis due to the irAE with associated underlying pityriasis versicolor. The skin lesions improved with these topical therapies.Fig. 1 Time-line showing the severity of the dermatitis (top, red bars) over time, and treatment with prednisone in milligrams (bottom, black bars) and other treatments (green bars).\n\nFig. 2 Initial presentation of dermatitis involving the back(a), lower extremity (b), hands (c), and right lateral torso (d)\n\nBy 25 weeks after starting pembrolizumab, his melanoma then progressed and the immunotherapy regimen was switched to ipilimumab 3 mg/kg every 21 days. Five weeks later, he had a worsening of the dermatitis with severe pruritus. The dermatitis covered approximately 40% of his body surface area and involved his torso, bilateral hands, and lower extremities (Fig. 3). A second course of topical betamethasone diproprionate 0.05% cream, daily cetirizine 10 mg tablet, and miconazole nitrate 2% cream was administered to the patient, without improvement. Oral prednisone 50 mg (0.5 mg/kg) daily was then prescribed, and the extent of his rashes from dermatitis improved.Fig. 3 Worsening of dermatitis after his initial presentation in the lower extremities (a) and torso (b)\n\nSubsequent multiple attempts to wean him from the prednisone resulted in rapid worsening of his skin condition. His melanoma disease burden continued to worsen and ipilimumab was discontinued, although the dermatitis did not abate. His diffuse rashes were only moderately controlled with prednisone and topical antifungal cream. Due to the persistent refractory dermatitis, which resembled his prior pityriasis versicolor eruptions, the decision was taken to treat the dermatitis with a stronger oral antifungal therapy for pityriasis versicolor while continuing prednisone for the dermatologic toxicity due to the irAE. He was started on fluconazole 200 mg daily on day 1 followed by 100 mg daily for 6 additional days while continuing with a prednisone taper at 15 mg daily. A skin biopsy of the flank torso was also performed on the day of starting fluconazole and showed superficial middle dermal perivascular dermatitis with associated spongiosis. The pathology was compatible with hypersensitivity from either medication or other potential allergens. The rashes resolved within days after starting fluconazole without any reported intolerability to the treatment, and the patient came off the prednisone shortly without the need of any further escalation.\n\nHis performance status remained optimal, and his treatment was switched to temozolomide 5 weeks later given optimal performance status. Unfortunately his cancer progressed further, and he was rechallenged with nivolumab 1 year later. No significant dermatological toxicity was noted.\n\nDiscussion\n\nAs the indications for ICI are expanding at a rapid pace, we are seeing an increasing number of patients with moderate to severe irAEs. Approximately 30–40% of patients who are treated with programmed cell death protein 1 (PD-1) blockers, such as nivolumab or pembrolizumab, develop dermatologic complications [3, 5]. More severe dermatological incidents are seen in patients treated with cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitors, such as ipilimumab, and significantly worse irAEs are often seen with the combination of PD-1/CTLA-4 inhibitors [3].\n\nMany oncologists have adapted the grading system of the Common Terminology Criteria for Adverse Events Version 5 (CTCAE v5) to quantify the severity of irAEs, and a myriad of organizations have designed protocols in an attempt to streamline the diagnosis and treatment of dermatologic irAEs [6, 7]. Current guidelines recommend a thorough diagnostic workup to rule out other potential etiologies, such as infections, reactions from another medications, and systemic diseases [7]. A consultation with an experienced dermatologist familiar in managing dermatologic irAEs is highly recommended for CTCAE grade 3 or higher skin toxicity before resuming ICI [6, 7].\n\nIn addition to the dermatologic toxicity due to the irAE, this patient had an underlying pityriasis versicolor. Pityriasis versicolor is a very common fungal infection in tropical climates and a less frequently occurring one in other climate zones. It is caused by Malassezia species, which is a skin flora saprophyte [8]. The exact mechanism of pathogenesis is unknown, but the immunosuppressed patients have an increased risk of developing pityriasis versicolor [4]. The skin lesions can appear in multiple forms, ranging from mildly erythematous to hypopigmented forms, and sometimes hyperpigmented ones. In the advanced form, these small lesions can become confluent [8]. Most patients with pityriasis versicolor are asymptomatic and only experience cosmetic changes of their skin [8]. However, in patients who are receiving oral corticosteroid or who are immunocompromised, these infections can be severe [8]. Patients with pityriasis versicolor are usually diagnosed by physical examation. Light microscopy observation of a potassium hydroxide preparation can be used for confirmation [8]. Skin infection due to pityriasis versicolor generally responds well to topical antifungal agents [9]. The typical duration of treatment ranges from 1 to 4 weeks [9]. Oral antifungal agents, such ketoconazole, itraconazole, or fluconazole, are reserved for florid infection or recurrent disease [9].\n\nOur patient had dermatitis due to an irAE from pembrolizumab and ipilimumab. In addition, he had pityriasis versicolor that predated the immunotherapy and which was exacerbated by the treatment for the irAE. His underlying fungal infection was mimicking features of the dermatologic toxicity due to the irAE. Although the pityriasis versicolor was diagnosed based on the clinical features and no yeast or hyphae were seen on biopsy, the rapid resolution of his dermatitis after a short course of intensified antifungal therapy indirectly confirmed our diagnosis. We suspected that the chronic topical antifungal and steroid cream might have contributed to a false negative biopsy result. Given that his rash was already resolved, we did not perform any additional fungal testing. Furthermore, no significant skin toxicity was noted when he was rechallenged with nivolumab.\n\nIn this case, it is possible that fluconazole, a CYP3A4 inhibitor, could potentially have increased the serum concentration of prednisone due to drug–drug interactions [10]. However, our patient was only receiving a very low dose of prednisone when the treatment with the low dose of fluconazole was started. The complete resolution of his skin condition could not be adequately explained by a small to moderate increase in steroid concentration alone. In addition, he did not require any additional escalation of steroid dose after completing the 7-day course of fluconazole. His overall response to treatment was consistent with the dermatologic toxicity due to an irAE with an associated underlying fungal infection.\n\nConclusion\n\nImmunotherapy is standard of care for many cancers. Although treated patients frequently develop dermatitis as a part of irAEs, one must remain vigilant and consider other potential differential diagnoses other than irAEs when managing ICI-related dermatologic complications.\n\nAbbreviations\n\nCTLA-4 Cytotoxic T-lymphocyte-associated protein 4\n\nICI Immune checkpoint inhibitors\n\nirAEs Immune-related adverse events\n\nPD-1 Programmed cell death protein 1\n\nAcknowledgements\n\nNot applicable.\n\nAuthors' contributions\n\nAll authors have made substantial contributions to the conception of this case report, acquisition and interpretation of the data, drafting and revisions of the manuscript, and the final approval manuscript. All authors read and approved the final manuscript.\n\nFunding\n\nThe funding for the publication of this case report is supported by the division of hospital medicine at the Ohio State University Wexner Medical Center.\n\nAvailability of data and materials\n\nIn accordance with local and/or U.S. Government laws and regulations, any materials and de-identified data that are reasonably requested by others will be made available in a timely fashion.\n\nDeclarations\n\nEthics approval and consent to participate\n\nNot applicable\n\nConsent for publication\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\n\nThe authors have no financial or nonfinancial competing interests to declare.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Hamid O Robert C Daud A Hodi FS Hwu WJ Kefford R Five-year survival outcomes for patients with advanced melanoma treated with pembrolizumab in KEYNOTE-001 Ann Oncol 2019 30 4 582 588 10.1093/annonc/mdz011 30715153\n2. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Five-year survival and correlates among patients with advanced melanoma, renal cell carcinoma, or non-small cell lung cancer treated with nivolumab. JAMA Oncol. 2019.\n3. Sibaud V Dermatologic reactions to immune checkpoint inhibitors : skin toxicities and immunotherapy Am J Clin Dermatol. 2018 19 3 345 361 10.1007/s40257-017-0336-3 29256113\n4. Gulec AT Demirbilek M Seckin D Can F Saray Y Sarifakioglu E Superficial fungal infections in 102 renal transplant recipients: a case-control study J Am Acad Dermatol. 2003 49 2 187 192 10.1067/S0190-9622(03)00861-2 12894063\n5. Naidoo J Page DB Li BT Connell LC Schindler K Lacouture ME Toxicities of the anti-PD-1 and anti-PD-L1 immune checkpoint antibodies Ann Oncol 2015 26 12 2375 2391 10.1093/annonc/mdv383 26371282\n6. U.S. Department of Health and Human Services. Common terminology criteria for adverse events (CTCAE) version 5.0. 2017. https://ctep.cancer.gov/protocoldevelopment/electronic_applications/docs/ctcae_v5_quick_reference_5x7.pdf.\n7. Brahmer JR Lacchetti C Schneider BJ Atkins MB Brassil KJ Caterino JM Management of immune-related adverse events in patients treated with immune checkpoint inhibitor therapy: american society of clinical oncology clinical practice guideline J Clin Oncol 2018 36 17 1714 1768 10.1200/JCO.2017.77.6385 29442540\n8. Gupta AK Bluhm R Summerbell R Pityriasis versicolor J Eur Acad Dermatol Venereol. 2002 16 1 19 33 10.1046/j.1468-3083.2002.00378.x 11952286\n9. Hu SW Bigby M Pityriasis versicolor: a systematic review of interventions Arch Dermatol. 2010 146 10 1132 1140 10.1001/archdermatol.2010.259 20956647\n10. Van Matre ET Satyanarayana G Page RL 2nd Levi ME Lindenfeld J Mueller SW Pharmacokinetic drug-drug interactions between immunosuppressant and anti-infective agents: antimetabolites and corticosteroids Ann Transplant. 2018 23 66 74 10.12659/AOT.906164 29358572\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "15(1)", "journal": "Journal of medical case reports", "keywords": "Dermatitis; Immune-related adverse event; Pityriasis versicolor; Skin infection", "medline_ta": "J Med Case Rep", "mesh_terms": "D000935:Antifungal Agents; D003872:Dermatitis; D006801:Humans; D008297:Male; D008545:Melanoma; D008875:Middle Aged; D014010:Tinea Versicolor", "nlm_unique_id": "101293382", "other_id": null, "pages": "212", "pmc": null, "pmid": "33888150", "pubdate": "2021-04-23", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "29442540;29256113;26371282;31343665;29358572;11952286;20956647;30715153;12894063", "title": "Refractory dermatitis contributed by pityriasis versicolor: a case report.", "title_normalized": "refractory dermatitis contributed by pityriasis versicolor a case report" }
[ { "companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-21-02787", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "MICONAZOLE NITRATE" }, ...
{ "abstract": "Tianeptine (Stablon, Coaxil) abuse and dependence has become increasingly prominent worldwide with recent presence in the United States.\n\n\n\nIn this article, we add a case to the growing literature on tianeptine dependence, the first of which is concerning for the presence of an adulterant, and present a comprehensive literature review.\n\n\n\nA literature search was conducted on July 2, 2018 on PubMed for articles using the keywords \"tianeptine abuse\" and \"tianeptine dependence.\"\n\n\n\nLiterature search resulted in 25 articles and encompassed 65 patients. A majority of patients were male and age ranged from 19 to 67. Routes of intake included oral, intravenous, and insufflation. In the 15 cases of overdose, 8 combined ingestion with at least one other substance, of which 3 resulted in death. Six additional deaths are reported involving tianeptine (9 total).\n\n\n\nTianeptine abuse and dependence has become a cause for concern in approved markets with recent emergence in the United States. Psychiatrists should be aware of a potentially fatal opiate-like withdrawal in the absence of positive urine drug screens or cases where withdrawal does not follow expected patterns. Tianeptine users should be educated regarding risk associated with this drug. Without further intervention, additional cases should be anticipated.", "affiliations": "University of California, San Diego (UCSD) Department of Psychiatry, La Jolla, CA; VA San Diego Healthcare System, San Diego, CA.;University of California, San Diego (UCSD) Department of Psychiatry, La Jolla, CA; VA San Diego Healthcare System, San Diego, CA.;University of California, San Diego (UCSD) Department of Psychiatry, La Jolla, CA; VA San Diego Healthcare System, San Diego, CA.;University of California, San Diego (UCSD) Department of Psychiatry, La Jolla, CA; VA San Diego Healthcare System, San Diego, CA.", "authors": "Lauhan|Rahul|R|;Hsu|Alan|A|;Alam|Al|A|;Beizai|Kristin|K|", "chemical_list": "D014151:Anti-Anxiety Agents; D000929:Antidepressive Agents, Tricyclic; D013841:Thiazepines; C050504:tianeptine; D000077206:Gabapentin; D000078785:Mirtazapine; D003975:Diazepam", "country": "England", "delete": false, "doi": "10.1016/j.psym.2018.07.006", "fulltext": null, "fulltext_license": null, "issn_linking": "0033-3182", "issue": "59(6)", "journal": "Psychosomatics", "keywords": "abuse; addiction; dependence; management; tianeptine", "medline_ta": "Psychosomatics", "mesh_terms": "D000328:Adult; D000368:Aged; D014151:Anti-Anxiety Agents; D000929:Antidepressive Agents, Tricyclic; D003975:Diazepam; D005260:Female; D000077206:Gabapentin; D006801:Humans; D008297:Male; D008875:Middle Aged; D000078785:Mirtazapine; D019966:Substance-Related Disorders; D013841:Thiazepines; D055815:Young Adult", "nlm_unique_id": "0376506", "other_id": null, "pages": "547-553", "pmc": null, "pmid": "30149933", "pubdate": "2018-11", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Tianeptine Abuse and Dependence: Case Report and Literature Review.", "title_normalized": "tianeptine abuse and dependence case report and literature review" }
[ { "companynumb": "US-009507513-1901USA000496", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "MIRTAZAPINE" }, "drugadditional": null, ...
{ "abstract": "Oral anticoagulant therapy (OAT) is a mainstay of atrial fibrillation (AF) pharmacological treatment. Left atrial appendage closure is a possible treatment, when feasible, in patients with intracerebral hemorrhage during OAT. We report a case of right atrial appendage thrombosis in a patient with chronic AF admitted for syncope due to diuretic-induced orthostatic hypotension. Two years previously, he had undergone left atrial appendage closure with the Amplatzer Cardiac Plug device because of intracerebral hemorrhage during OAT. After neurological consult, OAT was resumed with apixaban 5 mg twice daily, and transesophageal echocardiography performed two months later showed complete resolution of the right atrial appendage thrombosis. This particular case underlines the importance of searching for a possible right atrial appendage thrombosis in patients affected by AF, and suggests that left atrial appendage closure in AF patients not suitable for OAT does not fully eliminate the risk of thromboembolism.", "affiliations": "S.C. Cardiologia, Ospedale San Bassiano, Bassano del Grappa (VI).;S.C. Cardiologia, Ospedale San Bassiano, Bassano del Grappa (VI).;S.C. Radiologia, Ospedale San Bassiano, Bassano del Grappa (VI).;S.C. Pronto Soccorso, Ospedale San Bassiano, Bassano del Grappa (VI).;S.C. Cardiologia, Ospedale San Bassiano, Bassano del Grappa (VI).", "authors": "Barbati|Giovanni|G|;De Domenico|Renato|R|;Rossi|Stefania|S|;Vecchiato|Elena|E|;Zeppellini|Roberto|R|", "chemical_list": null, "country": "Italy", "delete": false, "doi": "10.1714/2674.27402", "fulltext": null, "fulltext_license": null, "issn_linking": "1827-6806", "issue": "18(3)", "journal": "Giornale italiano di cardiologia (2006)", "keywords": null, "medline_ta": "G Ital Cardiol (Rome)", "mesh_terms": "D020517:Atrial Appendage; D001281:Atrial Fibrillation; D006801:Humans; D008297:Male; D008875:Middle Aged; D013927:Thrombosis", "nlm_unique_id": "101263411", "other_id": null, "pages": "247-250", "pmc": null, "pmid": "28398383", "pubdate": "2017-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Right atrial appendage thrombosis during atrial fibrillation: an element to look for.", "title_normalized": "right atrial appendage thrombosis during atrial fibrillation an element to look for" }
[ { "companynumb": "IT-ACCORD-053331", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FUROSEMIDE" }, "drugadditional": "3", "druga...
{ "abstract": "Ceftaroline is often used in durations greater than that studied in clinical trials. Several retrospective, non-comparative studies have suggested a higher than anticipated incidence of neutropenia in patients receiving prolonged treatment with ceftaroline. We sought to determine if ceftaroline was associated with neutropenia by comparing the incidence with ceftaroline treatment with treatment with several comparative antibiotics.\n\n\n\nPatients receiving 14 or more consecutive days of treatment with ceftaroline were compared with patients receiving cefazolin, daptomycin, linezolid, nafcillin or vancomycin (control group). The primary outcome was the development of neutropenia. Multivariate logistic regression and propensity score weighting using inverse probability weights with regression adjustment were used to control for confounding variables.\n\n\n\nA total of 753 patients were included (53 that received ceftaroline and 700 that received a comparative antibiotic). Ceftaroline was associated with a greater incidence of neutropenia as compared with the control group (17.0% versus 3.9%, P < 0.001). Several covariates were also associated with neutropenia and included younger age, lower baseline absolute neutrophil count, liver disease and bone and joint infections. After controlling for these confounders, receipt of ceftaroline continued to be associated with the development of neutropenia (adjusted OR 3.97, P = 0.003). Analysis after propensity score weighting confirmed this finding.\n\n\n\nThe results of this study suggest that prolonged treatment with ceftaroline is associated with a greater incidence of neutropenia as compared with other antibiotics that are often used for treatment of staphylococcal infections. Careful monitoring of absolute neutrophil count is recommended in patients receiving >14 days of ceftaroline.", "affiliations": "School of Pharmacy, Pacific University, 222 SE 8th Ave Suite 451, Hillsboro, OR, USA.;School of Pharmacy, Pacific University, 222 SE 8th Ave Suite 451, Hillsboro, OR, USA.;School of Pharmacy, Pacific University, 222 SE 8th Ave Suite 451, Hillsboro, OR, USA.;Department of Medicine, Legacy Health, 2801 N Gantenbein Ave, Portland, OR, USA.;Department of Medicine, Legacy Health, 2801 N Gantenbein Ave, Portland, OR, USA.;Department of Pharmacy, Legacy Health, 2801 N Gantenbein Ave, Portland, OR, USA.;School of Pharmacy, Pacific University, 222 SE 8th Ave Suite 451, Hillsboro, OR, USA.", "authors": "Turner|R Brigg|RB|;Wilson|D Erin|DE|;Saedi-Kwon|Henry|H|;Chang|Eric|E|;Won|Regina|R|;Chan|Dominic|D|;Schwartz|Jacqueline|J|", "chemical_list": "D000900:Anti-Bacterial Agents; D002511:Cephalosporins; C490727:T 91825; D014640:Vancomycin; D002437:Cefazolin; D017576:Daptomycin", "country": "England", "delete": false, "doi": "10.1093/jac/dkx452", "fulltext": null, "fulltext_license": null, "issn_linking": "0305-7453", "issue": "73(3)", "journal": "The Journal of antimicrobial chemotherapy", "keywords": null, "medline_ta": "J Antimicrob Chemother", "mesh_terms": "D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D002437:Cefazolin; D002511:Cephalosporins; D017576:Daptomycin; D005260:Female; D006801:Humans; D015994:Incidence; D007958:Leukocyte Count; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D008875:Middle Aged; D009503:Neutropenia; D012189:Retrospective Studies; D013203:Staphylococcal Infections; D014640:Vancomycin", "nlm_unique_id": "7513617", "other_id": null, "pages": "772-778", "pmc": null, "pmid": "29237024", "pubdate": "2018-03-01", "publication_types": "D003160:Comparative Study; D016428:Journal Article", "references": null, "title": "Comparative analysis of neutropenia in patients receiving prolonged treatment with ceftaroline.", "title_normalized": "comparative analysis of neutropenia in patients receiving prolonged treatment with ceftaroline" }
[ { "companynumb": "ES-ALKEM LABORATORIES LIMITED-ES-ALKEM-2019-05779", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "LINEZOLID" }, "drugad...
{ "abstract": "A patient who was given metoclopramide for vomiting and diarrhoea developed circulatory collapse with his blood pressure dropping to 50/20 mm Hg. A gastrinoma was diagnosed histologically. The extent of the tumour was defined by octreotide scanning and magnetic resonance imaging. Metoclopramide was again given for colicky abdominal pain and the patient developed circulatory collapse a second time. A laparotomy involving extensive resection of the tumour was performed. The MEN1 mutation was not detected in blood or tumour tissue. Follow-up octreotide scanning did not show any residual tumour. Possible causes for the circulatory collapse are discussed. Our case is probably the first patient with gastrinoma to develop circulatory collapse after being given metoclopramide.", "affiliations": "Department of Medicine and Geriatrics, Princess Margaret Hospital, Laichikok, Hong Kong. dominickklau@hotmail.com", "authors": "Lau|K K|KK|;Chan|K W|KW|;Lok|C M|CM|;Lam|Angus W S|AW|;Lee|Hencher H C|HH|;Luk|W F|WF|;Mak|Chloe M|CM|;Ching|C K|CK|;Lo|Joyce|J|;Li|S M|SM|;Chan|Albert Y W|AY|", "chemical_list": "D018492:Dopamine Antagonists; D008787:Metoclopramide", "country": "China", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1024-2708", "issue": "15(6)", "journal": "Hong Kong medical journal = Xianggang yi xue za zhi", "keywords": null, "medline_ta": "Hong Kong Med J", "mesh_terms": "D000293:Adolescent; D018492:Dopamine Antagonists; D015408:Gastrinoma; D006801:Humans; D008297:Male; D008787:Metoclopramide; D009325:Nausea; D010190:Pancreatic Neoplasms; D012769:Shock; D014839:Vomiting", "nlm_unique_id": "9512509", "other_id": null, "pages": "478-81", "pmc": null, "pmid": "19966355", "pubdate": "2009-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Circulatory collapse in a patient with gastrinoma after metoclopramide administration.", "title_normalized": "circulatory collapse in a patient with gastrinoma after metoclopramide administration" }
[ { "companynumb": "HK-VISTAPHARM, INC.-VER201808-000808", "fulfillexpeditecriteria": "1", "occurcountry": "HK", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "OMEPRAZOLE" }, "drugadditional": ...
{ "abstract": "A 46-year-old African American man presented with a 3- to 4-day history of a new painful lesion on his left lower extremity. Other reported symptoms included a productive cough and chest pain; the patient denied fever and chills. His medical history was significant for a heart transplant 4 months prior to presentation followed by transplant rejection 2 weeks after the transplant. Medications included an antirejection/immunosuppressive regimen consisting of prednisone, tacrolimus, mycophenolate mofetil, and prophylaxis treatment with valganciclovir and trimethoprim-sulfamethoxazole.", "affiliations": "NorthShore University HealthSystem.;Section of Dermatology, University of Chicago Pritzker School of Medicine, Chicago, IL.;Section of Dermatology, University of Chicago Pritzker School of Medicine, Chicago, IL.;Section of Dermatology, University of Chicago Pritzker School of Medicine, Chicago, IL.;Section of Dermatology, University of Chicago Pritzker School of Medicine, Chicago, IL; tsoukasm@uic.edu.", "authors": "Kaminska|Edidiong C N|EC|;Pei|Susan|S|;Kenkare|Sonya|S|;Petronic-Rosic|Vesna|V|;Tsoukas|Maria M|MM|", "chemical_list": "D007166:Immunosuppressive Agents", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1540-9740", "issue": "13(4)", "journal": "Skinmed", "keywords": null, "medline_ta": "Skinmed", "mesh_terms": "D001228:Aspergillosis; D016027:Heart Transplantation; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D008875:Middle Aged; D009336:Necrosis; D009894:Opportunistic Infections; D012867:Skin", "nlm_unique_id": "101168327", "other_id": null, "pages": "329-30", "pmc": null, "pmid": "26861437", "pubdate": "2015", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Cutaneous Necrotic Papule as Invasive Aspergillosis in a Heart Transplant Patient.", "title_normalized": "cutaneous necrotic papule as invasive aspergillosis in a heart transplant patient" }
[ { "companynumb": "US-CONCORDIA PHARMACEUTICALS INC.-E2B_00008323", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TACROLIMUS" }, "drugaddi...
{ "abstract": "This case report describes a death attributed to the intake of the pyrethroid insecticides, alpha-cypermethrin and deltamethrin, and the antidepressant mirtazapine. The autopsy findings showed absence of external traumatic injuries and internal generalized visceral congestion, edema and cyanosis. The toxicological results revealed the presence of a toxic concentration of mirtazapine (12.5mg/L and 10.7mg/L in blood and urine, respectively) and high concentrations of pyrethroids (2.46mg/L alpha-cypermethrin and 2.40mg/L deltamethrin in blood, and 0.41mg/L alpha-cypermethrin and 0.46mg/L deltamethrin in urine, respectively). Blood ethanol concentration was 0.75g/L. All the evidence - from autopsy, police investigation and toxicology - was consistent with the intentional self-harm of the deceased. The current case was determined and recorded as a poisoning suicide. Cause of death of the deceased was reported as the synergistic toxicity of the ingested pyrethroids and mirtazapine. The presence of a significant blood ethanol concentration was considered a secondary contributory factor to the fatal outcome. The case presented herein is the first death attributed to poisoning from ingestion of pyrethroids in combination with mirtazapine, with the intention of the victim to cause self-harm, with corresponding toxicology results.", "affiliations": "Laboratory of Forensic Medicine & Toxicology, Faculty of Medicine, School of Health Sciences, University of Ioannina, 45110 Ioannina, Greece. Electronic address: vboumba@uoi.gr.;Laboratory of Forensic Medicine & Toxicology, Faculty of Medicine, School of Health Sciences, University of Ioannina, 45110 Ioannina, Greece.;Laboratory of Forensic Medicine & Toxicology, Faculty of Medicine, School of Health Sciences, University of Ioannina, 45110 Ioannina, Greece.", "authors": "Boumba|Vassiliki A|VA|;Rallis|Georgios N|GN|;Vougiouklakis|Theodore|T|", "chemical_list": "D000928:Antidepressive Agents; D002492:Central Nervous System Depressants; D007306:Insecticides; D009570:Nitriles; D011722:Pyrethrins; C017160:cypermethrin; D008803:Mianserin; C017180:decamethrin; D000431:Ethanol; D000078785:Mirtazapine", "country": "Ireland", "delete": false, "doi": "10.1016/j.forsciint.2016.11.023", "fulltext": null, "fulltext_license": null, "issn_linking": "0379-0738", "issue": "274()", "journal": "Forensic science international", "keywords": "Alcohol; Antidepressants; Mirtazapine; Poisoning; Pyrethroids; Suicide", "medline_ta": "Forensic Sci Int", "mesh_terms": "D000928:Antidepressive Agents; D002492:Central Nervous System Depressants; D000431:Ethanol; D006801:Humans; D007306:Insecticides; D008297:Male; D008803:Mianserin; D008875:Middle Aged; D000078785:Mirtazapine; D009570:Nitriles; D011722:Pyrethrins; D013405:Suicide", "nlm_unique_id": "7902034", "other_id": null, "pages": "75-78", "pmc": null, "pmid": "27899216", "pubdate": "2017-05", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Poisoning suicide with ingestion of the pyrethroids alpha-cypermethrin and deltamethrin and the antidepressant mirtazapine: A case report.", "title_normalized": "poisoning suicide with ingestion of the pyrethroids alpha cypermethrin and deltamethrin and the antidepressant mirtazapine a case report" }
[ { "companynumb": "GR-MYLANLABS-2017M1027519", "fulfillexpeditecriteria": "1", "occurcountry": "GR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "MIRTAZAPINE" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nCalciphylaxis is a serious complication in patients with chronic kidney disease associated mineral and bone disorder. It can occur in conditions with low and high bone turnover. So far, there are no definite diagnostic and therapeutic guidelines which may prevent the devastating outcome in many calciphylaxis patients. We report a case which clearly illustrates that knowledge of the underlying bone disorder is essential for a directed treatment. Based on this experience we discuss a systematic diagnostic and therapeutic approach in patients with calciphylaxis.\n\n\nMETHODS\nWe report a patient with severe calciphylaxis. Initial evaluation showed an elevated serum parathormone concentration and a bone-specific alkaline phosphatase activity in the upper normal range; however, the bone biopsy clearly showed adynamic bone disease. Extended dialysis with low calcium dialysate concentration and citrate anticoagulation, and administration of teriparatide led to a further increase in bone-specific alkaline phosphatase activity and most importantly, resulted in an activated bone turnover as confirmed by a second bone biopsy 11 weeks later.\n\n\nCONCLUSIONS\nThis case illustrates that laboratory tests cannot reliably differentiate between high and low bone turnover in calciphylaxis patients. More importantly, this case highlights the fact that specific therapies that alter bone metabolism cannot be applied without knowledge of the bone status. On this background, we suggest that bone biopsies should be an integral part in the diagnosis and therapeutic decision in these patients and should be evaluated in further studies.", "affiliations": "Department of Nephrology and Hypertension, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany. patecki.margret@mh-hannover.de.;Division of Rheumatology/Osteology, Department of Internal Medicine III, Friedrich-Schiller-University of Jena, Erlanger Allee 101, 07747, Jena, Germany.;Institute of Pathology, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.;Institute of Pathology, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.;Department of Nephrology and Hypertension, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.;Institute for Diagnostic and Interventional Radiology, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.;Department of Nephrology and Hypertension, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.;Department of Nephrology and Hypertension, Hannover Medical School, Carl-Neuberg-Straße 1, 30635, Hannover, Germany.", "authors": "Patecki|Margret|M|;Lehmann|Gabriele|G|;Bräsen|Jan Hinrich|JH|;Schmitz|Jessica|J|;Bertram|Anna|A|;Berthold|Lars Daniel|LD|;Haller|Hermann|H|;Gwinner|Wilfried|W|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1186/s12882-017-0556-z", "fulltext": "\n==== Front\nBMC NephrolBMC NephrolBMC Nephrology1471-2369BioMed Central London 55610.1186/s12882-017-0556-zCase ReportA case report of severe calciphylaxis – suggested approach for diagnosis and treatment Patecki Margret +49-0-511-532-6319patecki.margret@mh-hannover.de 1Lehmann Gabriele Gabriele.Lehmann@med.uni-jena.de 2Bräsen Jan Hinrich braesen.jan@mh-hannover.de 3Schmitz Jessica schmitz.jessica@mh-hannover.de 3Bertram Anna bertram.anna@mh-hannover.de 1Berthold Lars Daniel berthold.daniel@mh-hannover.de 4Haller Hermann haller.hermann@mh-hannover.de 1Gwinner Wilfried gwinner.wilfried@mh-hannover.de 11 0000 0000 9529 9877grid.10423.34Department of Nephrology and Hypertension, Hannover Medical School, Carl-Neuberg-Straße 1, 30635 Hannover, Germany 2 0000 0001 1939 2794grid.9613.dDivision of Rheumatology/Osteology, Department of Internal Medicine III, Friedrich-Schiller-University of Jena, Erlanger Allee 101, 07747 Jena, Germany 3 0000 0000 9529 9877grid.10423.34Institute of Pathology, Hannover Medical School, Carl-Neuberg-Straße 1, 30635 Hannover, Germany 4 0000 0000 9529 9877grid.10423.34Institute for Diagnostic and Interventional Radiology, Hannover Medical School, Carl-Neuberg-Straße 1, 30635 Hannover, Germany 21 4 2017 21 4 2017 2017 18 13718 9 2016 13 4 2017 © The Author(s). 2017\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nCalciphylaxis is a serious complication in patients with chronic kidney disease associated mineral and bone disorder. It can occur in conditions with low and high bone turnover. So far, there are no definite diagnostic and therapeutic guidelines which may prevent the devastating outcome in many calciphylaxis patients. We report a case which clearly illustrates that knowledge of the underlying bone disorder is essential for a directed treatment. Based on this experience we discuss a systematic diagnostic and therapeutic approach in patients with calciphylaxis.\n\nCase presentation\nWe report a patient with severe calciphylaxis. Initial evaluation showed an elevated serum parathormone concentration and a bone-specific alkaline phosphatase activity in the upper normal range; however, the bone biopsy clearly showed adynamic bone disease. Extended dialysis with low calcium dialysate concentration and citrate anticoagulation, and administration of teriparatide led to a further increase in bone-specific alkaline phosphatase activity and most importantly, resulted in an activated bone turnover as confirmed by a second bone biopsy 11 weeks later.\n\nConclusions\nThis case illustrates that laboratory tests cannot reliably differentiate between high and low bone turnover in calciphylaxis patients. More importantly, this case highlights the fact that specific therapies that alter bone metabolism cannot be applied without knowledge of the bone status. On this background, we suggest that bone biopsies should be an integral part in the diagnosis and therapeutic decision in these patients and should be evaluated in further studies.\n\nKeywords\nCase reportMineral metabolism and bone diseaseCKD complicationsCalciphylaxisBone biopsyAdynamic bone diseaseissue-copyright-statement© The Author(s) 2017\n==== Body\nBackground\nCalciphylaxis is a life-threatening complication in patients with kidney disease. It is also called “calcific uremic arteriolopathy”, reflecting the main findings of medial calcification and intimal hyperplasia in skin biopsies of calciphylaxis patients. The lesions are usually very painful and ulcerations and necrosis can develop [1]. Besides the involvement of skin, visceral and muscle arteries can be affected. Complications, particularly septic episodes are common and explain the high mortality rate of about 45–80% [2]. The diagnosis is based on the clinical features in combination with known risk factors, i.e. renal insufficiency, obesity, female gender, hyperparathyroidism and disturbed bone metabolism, therapy with vitamin K antagonists, inflammatory states, and diabetes mellitus [2, 3]. A skin biopsy can prove presence of calciphylaxis; however, it is usually dispensable and even can set a new nidus for calciphylaxis [4]. Imaging studies can strengthen the diagnosis of calciphylaxis and help to assess the extent of muscular and inner organ involvement [5, 6]. The pathophysiology of calciphylaxis is largely unknown. A disturbed calcium-phosphate homeostasis in association with an altered bone metabolism (either high or low turnover) is probably one of the important factors [7–9].\n\nCurrent treatment recommendations rely on weak evidence and therapy failures are common [8]. Supportive wound management, antibiotic therapy, and analgesics are certainly an important part of the therapy [10]. Cessation of calcium supplements and medication that increases serum calcium levels such as thiazide diuretics and active vitamin D compounds is generally recommended [2, 8, 11]. Avoiding vitamin K antagonists or even supplementation of vitamin K has been suggested based on the role of vitamin K in the γ-carboxylation of proteins that regulate local calcium crystal deposition [12]. The broad array of suggested treatment options is probably a reflection of the uncertain efficacy: sodium thiosulfate, bisphosphonates, cinacalcet, emergency parathyroidectomy, plasma exchange and optimization of the dialysis treatment [2, 8, 11, 13]. Moreover, some of these therapies are powerful effectors of the bone metabolism, particularly bisphosphonates, cinacalcet, and parathyroidectomy which can drastically reduce bone turnover [14, 15]. For thiosulfate, no direct effects on bone turnover have been reported so far [16]. With our case, we want to highlight an important, but so far less considered aspect for an individual treatment strategy: the assessment of the underlying bone metabolism by a bone biopsy to adjust the treatment strategy accordingly.\n\nCase presentation\nA 54-years old obese female patient was hospitalized in July 2015 with severe cutaneous calciphylaxis. She suffered from congenital cystic kidney disease and had been undergoing hemodialysis since 1996. She received her first kidney transplant in 1999, which failed in 2004 because of acute rejection. A second allograft transplanted in 2009 had a complicated course with acute T cell- and antibody-mediated rejections and despite treatment, development of chronic antibody-mediated rejection. Allograft function never exceeded a GFR (cystatin C) of 27 mL/min. First symptoms of cutaneous calciphylaxis began after failure of the first allograft. At this time, intact parathormone (iPTH) level was 510 pg/mL, serum calcium 2.25 mmol/L, serum phosphate 1.71 mmol/L, and alkaline phosphatase activity 69 units/L. Gluteal regions, lower limbs, abdomen, and mammae were affected, requiring surgery and skin transplantation. Bone pain or fractures had never occurred. Subtotal parathyroidectomy in 2006 and total parathyroidectomy in 2009 were not successful to control hyperparathyroidism. Therefore, cinacalcet was administered from 2009 until March 2015. The iPTH ranged between 265 and 463 pg/mL, the alkaline phosphatase activity between 61 and 110 units/L, and serum calcium between 2.0 and 2.3 mmol/L during this treatment. Nevertheless, smouldering calciphylaxis symptoms remained.\n\nAt admission, the medication included tacrolimus, mycophenolate mofetil, prednisolone, cholecalciferol, alphacalcidol, calcium acetate, sevelamer, a thiazide diuretic, three antihypertensive drugs, bicarbonate, pantoprazole, simvastatin, and insulin for type II diabetes which had been present since 2012. Coumadin had been given for deep vein thrombosis, but was discontinued 3 months prior admission. Body weight was 96.6 kg at a height of 162 cm. Painful cutaneous lesions were present at multiple sites of the lower trunk, not restricted to the locations of insulin injection. CT imaging additionally showed severe calcifications of the abdominal arteries (Fig. 1). Initial laboratory evaluation indicated inflammation, with a C-reactive protein of 259 mg/L (normal < 9 mg/L) and leukocytosis of 13.5/nL (normal range 3.9–10.2/nL). Hemoglobin was 7.7 g/dL (normal ≥ 12.0 g/dL). Serum protein was 52 g/L (normal ≥ 65 g/L). Renal function was marginal but unchanged to previous values (serum creatinine 374 μmol/L, cystatin C eGFR 11 mL/min). The cholecalciferol level was 4.5 ng/mL (normal 20–50 ng/mL). Initial and subsequent levels of ionized calcium, phosphate, iPTH, and bone-specific alkaline phosphatase activity (BAP) as well as subsequent specific treatments are shown in Fig. 2.Fig. 1 Extraosseous calcifications detected by CT imaging. Left: Unenhanced thoracic computed tomography with severe subcutaneous calcifications of both mammae, pronounced on the right side (grey arrows), bronchial calcifications and nearly circular aortosclerosis (white arrow). Right: Precontrast abdominal computed tomography with disseminated subcutaneous calcifications in the abdominal wall (grey arrows) and in smaller pelvic arteries (white arrows)\n\n\nFig. 2 Laboratory results and treatment. Time course of ionized serum calcium (pink line; normal range: 1.14–1.27 mmol/L) and serum phosphate (blue line; normal range: 0.83–1.67 mmol/L) during the 14 weeks of hospital treatment. Septic episodes are indicated on the abscissa (light red). ‘Bx‘indicates the time point of bone biopsy and ‘rhPTH, daily injections‘the duration of teriparatide treatment (20 μg per day). Intact parathormone (iPTH; dark green boxes; normal range: 10–65 pg/mL, suggested range for CKD 5D: 2–9 times the upper normal range [21]) and bone alkaline phosphatase (BAP; light blue boxes; normal range: 5–27 μg/L) are shown in the upper part at the corresponding time points. Dialysis frequency and sodium thiosulfate administration (25 g per infusion) are shown in the bottom part of the graph (dark grey lines indicate use of a dialysate calcium of 1.25 mmol/L and heparin anticoagulation, light grey lines a dialysate calcium of 1.0 mmol/L and citrate anticoagulation)\n\n\n\n\nAt first, calcium-containing drugs, vitamin D compounds, and the thiazide were discontinued. A low-calcium diet and vitamin K supplementation were prescribed. Infusion of sodium thiosulfate was begun, and because of worsening metabolic acidosis during this treatment, hemodialysis was initiated. To achieve better control of calcium and phosphate levels and to intensify sodium thiosulfate therapy, dialysis sessions were extended (≥6 h, 5–7 times/week). Furthermore, four plasma exchanges were performed with fresh frozen plasma according to recent suggestions [13]. Supportive therapy included antibiotic prophylaxis with clindamycin, opioide analgesics and interdisciplinary wound care. The course was further complicated by recurrent septic episodes of unknown origin and an atraumatic bowel perforation, a rare complication in systemic calciphylaxis [17].\n\nTo evaluate the bone metabolism after prolonged cinacalcet treatment, a bone biopsy (without prior tetracycline labelling) had been performed shortly after admission. When the histology results were obtained and showed adynamic bone disease (Fig. 3a), the treatment was adapted to stimulate bone metabolism by inducing a negative calcium balance. For this, dialysate calcium was reduced to 1.0 mmol/L, citrate anticoagulation was used, and extended daily dialyses sessions were maintained. After 7 weeks, increased iPTH and BAP suggested an activated bone metabolism. Dependence on daily dialysis and temporary dialysis access problems led us to explore an additional therapeutic option, recombinant human PTH (teriparatide). Teriparatide induces bone turnover [18] and is indicated for low turnover osteoporosis [19, 20]. No increase in serum calcium was observed during daily treatment with 20 μg teriparatide and the patient reported improvement of pain. Notably, the duration of dialysis sessions could be reduced to 4 hours without impairment of calcium levels. Unfortunately, the patient died from septic shock a few weeks later. We obtained permission to take a postmortem bone biopsy. The biopsy revealed resorption lacunae at multiple sites, several lining cells and osteoid deposition, indicative of an activated bone turnover (Fig. 3b).Fig. 3 Bone histology from the iliac crest at admission (a) and after treatment with intensified dialysis and rhPTH (b). a Missing osseous remodeling and cellular paucity is present. Empty resorption lacunae [white arrow] indicate former osteoclast activity. Masson-Goldner stain (magnification × 200). b The trabecular surface is covered with lining cells (blue arrow heads), intratrabecular and endosteal osteoid layers (grey arrows), indicative of an activated bone turnover. Masson-Goldner stain (magnification × 400). Standard histomorphometric parameters of both biopsies are shown in the table\n\n\n\n\nDiscussion and Conclusions\nWe present a patient with a complex history of calciphylaxis. The underlying bone disease was certainly the result of long term end stage renal failure and of two poorly functioning kidney allografts. Hyperparathyroidism had been present for more than 10 years and despite cinacalcet therapy and achieving calcium, phosphate, and iPTH serum levels within the recommended ranges [21], the patient continuously had flares of calciphylaxis.\n\nOur patient had several predisposing factors for calciphylaxis [2], such as hyperparathyroidism, obesity, and diabetes that had been present for a long time. Nevertheless, the immediate trigger for the acute worsening of calciphylaxis is unknown: There was no sudden drop in renal allograft function as GFR was consistently below 20 mL/min after an anti-rejection therapy 3 months prior to the crisis. Moreover, coumadin therapy had been stopped several months before and dosage of vitamin D and calcium-based phosphate binders had not been changed recently.\n\nInitial therapeutic interventions were in accordance with the general recommendations [2, 8, 11], including normalization of serum calcium and phosphate levels by dialysis, cessation of calcium-containing phosphate binders, vitamin D, and thiazide diuretics, substitution of vitamin K, and sodium thiosulfate treatment dose-adjusted to the renal function. The patient also received a trial of plasmapheresis, without clinical improvement.\n\nAccording to the current guidelines [21] a bone biopsy should be considered in conditions with unclear mineral and bone disturbances, e.g. fractures or unexplained hypercalcemia. We decided to take a bone biopsy shortly after admission for several reasons: (i) calciphylaxis may occur in both, high and low turnover bone disease [9], (ii) our patient had a prolonged therapy with cinacalcet which can suppress bone turnover [15], and (iii) we were uncertain whether laboratory parameters such as BAP and iPTH are sufficiently informative in this situation.\n\nThe initial histomorphometric analysis revealed low turnover osteopathy, an unexpected result in view of the moderately high iPTH and a BAP in the upper normal range. Consequently, daily dialysis with low calcium and citrate anticoagulation was initiated to induce hypocalcemia and hypophosphatemia, with the aim to minimize extraosseous calcium crystal deposition and to stimulate bone turnover by hypocalcemia-triggered PTH synthesis. After 7 weeks of this intensified treatment an increased iPTH and BAP was observed.\n\nOur subsequent trial with teriparide was well tolerated, resulted in a reduction of pain, and was not associated with increases in serum calcium despite reduced dialysis intensity. At the end, bone turnover was significantly activated as illustrated by a sustained increase of BAP and the histologic findings in the post-mortem bone biopsy. It is certainly difficult to conclude which of the treatments (intensified dialysis or teriparatide) was the major contributor to the improved bone metabolism. Increases in iPTH and BAP were already observed with intensified dialysis alone. It remains speculative whether bone activation by teriparatide helped to maintain stable calcium levels. Because of the short observation time after initiation of teriparatide we were unable to evaluate the long-term evolution of BAP under this treatment. Also, we could not determine whether alternative treatment schedules (i.e. once per week; [22]) would have been more beneficial. It should be noted that occurrence of calciphylaxis has been reported during teriparatide treatment [23]; yet it is unknown if reduced or increased bone turnover was present in these patients. Of course, high turnover bone disease would be a contraindication for teriparatide. Also, reliable control of serum calcium and awareness of potential deterioration of calciphylaxis is mandatory in any patient receiving this treatment.\n\nSimilar to observations from Sugimto et al., iPTH levels dropped shortly after teriparatide administration [24]. This probably reflects a negative feedback of endogenous PTH generation in response to teriparatide administration. Teriparatide (rhPTH 1–34) in turn, is not detected by the iPTH laboratory test. We can only speculate why an endogenous PTH level of greater than 300 pg/mL at admission was associated with adynamic bone metabolism and in turn, why application of teriparatide should be efficient in this situation. First, endogenous PTH can be oxidized in uremia which is associated with decreased biological activity [25]. Further, administration of teriparatide leads to a considerable increase in 1–34 PTH levels up to 10fold above the upper normal physiologic PTH concentrations [26].\n\nOur case demonstrates that identification of the underlying bone metabolism is of crucial importance for an appropriate and specific treatment of calciphylaxis. Laboratory results cannot sufficiently reflect the status of bone turnover which has been reported before [27]. In our case, initial iPTH and BAP analyses were suggestive of normal or high turnover but the bone biopsy clearly showed adynamic bone disease. Therefore, we believe that in most cases with calciphylaxis a bone biopsy should be considered to avoid erroneous and potentially harmful treatments. For example, in our patient parathyroidectomy, treatment with bisphosphonates or cinacalcet would have aggravated adynamic bone disease and thus, probably impaired the calciphylaxis.\n\nOur suggestion therefore is a gradual approach that should be evaluated in further studies (Fig. 4). Initially, general actions should include stopping of medication that can precipitate hypercalcemia, normalization of high serum calcium and phosphate levels, administration of sodium thiosulfate [2, 8, 11, 13]. Plasma exchange might be considered but procedural risks including infections should be balanced against potential benefits. As early as possible, a bone biopsy should be considered to determine the type of bone disorder. Ideally, assessment of bone metabolism includes tetracycline labelling. However, the labelling procedure delays early diagnosis and directed treatment and thus, should be decided individually. Once the bone disorder is characterized bone metabolism can be corrected – either by reducing or increasing bone turnover – to prevent further deterioration of calciphylaxis.Fig. 4 Suggested procedures for patients with calciphylaxis. This flow chart shows a possible treatment path for calciphylaxis patients which has to be evaluated in further studies. In addition to the general recommended interventions, a bone biopsy should be performed initially to determine the underlying real bone disease (grey boxes). Once a diagnosis of high or low bone turnover has been established specific procedures (blue boxes) can be initiated. Supportive care (green box) should be provided at any time. Recommendations for general procedures, high turnover bone disease and supportive care were adopted from [2, 8, 11]\n\n\n\n\nAbbreviations\n(e) GFR(estimated) glomerular filtration rate\n\nBAPBone-specific alkaline phosphatase activity\n\niPTHIntact parathormone\n\nrhPTHRecombinant human parathormone\n\nAcknowledgements\nUta Erdbrügger, M.D., University of Virginia Health System, Charlottesville, Virginia 22908 for manuscript editing.\n\nFunding\nNone.\n\nAvailability of data and material\nAll data generated or analysed for this case report are included in this published article.\n\nAuthors’ contributions\nM.P., W.G., and H.H. analysed the patient data, developed the standardised diagnostic approach and did the writing. A.B. prepared the clinical data from the dialysis sessions. L.G., J.B., and J.S. prepared and described the histological data. L.B. prepared and described the radiologic data. All authors as part of the medical staff treating the patient were involved in generating the data for this case report; they all read and approved the final manuscript.\n\nAuthors’ information\nNone.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nConsent for publication\nThe husband of the patient gave his written consent for publication.\n\nEthics approval and consent to participate\nNot applicable.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Sprague SM Painful skin ulcers in a hemodialysis patient Clin J Am Soc Nephrol 2014 9 1 166 73 10.2215/CJN.00320113 24202137 \n2. Nigwekar SU Kroshinsky D Nazarian RM Goverman J Malhotra R Jackson VA Kamdar MM Steele DJ Thadhani RI Calciphylaxis: risk factors, diagnosis, and treatment Am J Kidney Dis 2015 66 1 133 46 10.1053/j.ajkd.2015.01.034 25960299 \n3. Nigwekar SU Zhao S Wenger J Hymes JL Maddux FW Thadhani RI Chan KE A Nationally Representative Study of Calcific Uremic Arteriolopathy Risk Factors J Am Soc Nephrol 2016 27080977 \n4. Latus J Kimmel M Ott G Ting E Alscher MD Braun N Early stages of calciphylaxis: are skin biopsies the answer? Case Rep Dermatol 2011 3 3 201 5 10.1159/000333007 22110432 \n5. Shmidt E Murthy NS Knudsen JM Weenig RH Jacobs MA Starnes AM Davis MD Net-like pattern of calcification on plain soft-tissue radiographs in patients with calciphylaxis J Am Acad Dermatol 2012 67 6 1296 301 10.1016/j.jaad.2012.05.037 22841657 \n6. Bonchak JG Park KK Vethanayagamony T Sheikh MM Winterfield LS Calciphylaxis: a case series and the role of radiology in diagnosis Int J Dermatol 2016 55 5 e275 9 10.1111/ijd.13043 26518613 \n7. Brandenburg VM Sinha S Specht P Ketteler M Calcific uraemic arteriolopathy: a rare disease with a potentially high impact on chronic kidney disease-mineral and bone disorder Pediatr Nephrol 2014 29 2289 98 10.1007/s00467-013-2746-7 24474577 \n8. Brandenburg V Adragao T Van Dam B Evenepoel P Frazão JM Ketteler M Blueprint for a european calciphylaxis registry initiative: the European Calciphylaxis Network (EuCalNet) Clin Kidney J 2015 8 5 567 71 10.1093/ckj/sfv056 26413282 \n9. Mawad HW Sawaya BP Sarin R Malluche HH Calcific uremic ateriolopathy in association with low turnover uremic bone disease Clin Nephrol 1999 52 3 160 6 10499311 \n10. Russo D Capuano A Cozzolino M Napolitano P Mosella F Russo L Saviano C Zoccali C Multimodal treatment of calcific uraemic arteriolopathy [calciphylaxis]: a case series Clin Kidney J 2016 9 1 108 12 10.1093/ckj/sfv120 26798470 \n11. Ross EA Evolution of treatment strategies for calciphylaxis Am J Nephrol 2011 34 460 7 10.1159/000332221 21986387 \n12. Brandenburg VM Kramann R Rothe H Kaesler N Korbiel J Specht P Calcific uraemic arteriolopathy (calciphylaxis): data from a large nationwide registry Nephrol Dial Transplant 2016 \n13. Cai MM Smith ER Brumby C McMahon LP Holt SG Fetuin-A-containing calciprotein particle levels can be reduced by dialysis, sodium thiosulfate and plasma exchange. Potential therapeutic implications for calciphylaxis? Nephrology 2013 18 724 7 10.1111/nep.12137 24571743 \n14. Ceijka D Renale osteodystrophie Wien Med Wochenschr 2013 163 17–18 403 8 10.1007/s10354-013-0195-3 23657637 \n15. Behets GJ Spasovski G Sterling LR Goodman WG Spiegel DM De Broe ME D’Haese PC Bone histomorphometry before and after long-term treatment with cinacalcet in dialysis patients with secondary hyperparathyroidism Kidney Int 2015 87 846 56 10.1038/ki.2014.349 25337774 \n16. Schlieper G Brandenburg V Ketteler M Floege J Sodium thiosulfate in the treatment of calcific uremic arteriolopathy Nat Rev Nephrol 2009 5 539 43 10.1038/nrneph.2009.99 19701230 \n17. Oliveira TM Frazao JM Calciphylaxis: from the disease to the diseased Journal of Nephrology 2015 28 5 531 40 10.1007/s40620-015-0192-2 25835730 \n18. Blick SK Dhillon S Keam SJ Teriparatide: a systemic review of its use in osteoporosis Drugs 2008 68 18 2709 37 10.2165/0003495-200868180-00012 19093708 \n19. Palcu P Dion N Ste-Marie LG Teriparatide and bone turnover and formation in a hemodialysis patient with low-turnover bone disease: a case report Am J Kidney Dis 2015 65 6 933 6 10.1053/j.ajkd.2015.01.025 25843705 \n20. Cejka D Kodras K Bader T Haas M Treatment of hemodialysis-associated adynamic bone disease with teriparatide (PTH1–34): a pilot study Kidney Blood Press Res 2010 33 221 6 10.1159/000316708 20588059 \n21. Kidney Disease: Improving Global Outcomes (KDIGO) CKD–MBD Work Group. KDIGO clinical practice guideline for the diagnosis, evaluation, prevention, and treatment of chronic kidney disease–mineral and bone disorder (CKD–MBD). Kidney International. 2009;76(Suppl 113):S1–S130.\n22. Sumida K Ubara Y Hoshino J Mise K Hayami N Suwabe T Kawada M Once weekly teriparatide in hemodialysis patients with hypoparathyreoidism and low bone mass: a prospective study Osteoporos Int 2016 27 4 1441 50 10.1007/s00198-015-3377-6 26525045 \n23. Monegal A Peris P Alsina M Colmenero J Guanabens N Development of multiorganic calciphylaxis during teriparatide, vitamin D, and calcium treatment Osteoporos Int 2016 27 8 2631 4 10.1007/s00198-016-3571-1 27010647 \n24. Sugimoto T Nakamura T Nakamura Y Isogai Y Shiraki M Profile of changes in bone turnover markers during once-weekly teriparatide administration for 24 weeks in postmenopausal women with osteoporosis Osteoporos Int 2014 25 1173 80 10.1007/s00198-013-2516-1 24108429 \n25. Hocher B Oberthür D Slowinski T Querfeld U Schaefer F Doyon A Tepel M Roth HJ Grön HJ Reichetzeder C Betzel C Armbruster FP Model of oxidized PTH (oxPTH) and non-oxidized PTH (n-oxPTH) receptor binding and releationship of oxidized to non-oxidized PTH in children with chronic renal failure, adult patients on hemodialysis and kidney transplant recipients Kidney Blood Press Res 2013 37 240 51 10.1159/000350149 23868100 \n26. Lindsay R Nieves J Henneman E Shen V Cosman F Subcutaneous administration of the amino-terminal fragment of human parathyreoid hormone-(1–34): kinetics and biochemical response in estrogenized osteoporotic patients J Clin Endocrinol Metab 1993 77 6 1535 9 8263137 \n27. Sprague SM Bellorin-Font E Jorgetti V Carvalho AB Malluche HH Ferreira A D’Haese PC Drüeke TB Du H Manley T Rojas E Moe SM Diagnostic accuracy of bone turnover markers and bone histology in patients with CKD treated by dialysis Am J Kidney Dis 2016 67 4 559 66 10.1053/j.ajkd.2015.06.023 26321176\n\n", "fulltext_license": "CC BY", "issn_linking": "1471-2369", "issue": "18(1)", "journal": "BMC nephrology", "keywords": "Adynamic bone disease; Bone biopsy; CKD complications; Calciphylaxis; Case report; Mineral metabolism and bone disease", "medline_ta": "BMC Nephrol", "mesh_terms": "D001851:Bone Diseases, Metabolic; D002115:Calciphylaxis; D003937:Diagnosis, Differential; D005260:Female; D006801:Humans; D008875:Middle Aged; D051436:Renal Insufficiency, Chronic; D063189:Symptom Assessment", "nlm_unique_id": "100967793", "other_id": null, "pages": "137", "pmc": null, "pmid": "28431568", "pubdate": "2017-04-21", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "26798470;20588059;23657637;26525045;21986387;27080977;24474577;19093708;23868100;25843705;24202137;25337774;24108429;25960299;24571743;25835730;22841657;26908770;22110432;26413282;19644521;8263137;19701230;27010647;10499311;26518613;26321176", "title": "A case report of severe calciphylaxis - suggested approach for diagnosis and treatment.", "title_normalized": "a case report of severe calciphylaxis suggested approach for diagnosis and treatment" }
[ { "companynumb": "DE-AMGEN-DEUSP2017080977", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PANTOPRAZOLE" }, "drugadditional": null, ...
{ "abstract": "The METTEN study assessed the efficacy, tolerability, and safety of adding metformin to neoadjuvant chemotherapy plus trastuzumab in early HER2-positive breast cancer (BC). Women with primary, non-metastatic HER2-positive BC were randomized (1:1) to receive metformin (850 mg twice-daily) for 24 weeks concurrently with 12 cycles of weekly paclitaxel plus trastuzumab, followed by four cycles of 3-weekly FE75C plus trastuzumab (arm A), or equivalent regimen without metformin (arm B), followed by surgery. Primary endpoint was the rate of pathological complete response (pCR) in the per-protocol efficacy population. pCR rate was numerically higher in the metformin-containing arm A (19 of 29 patients [65.5%, 95% CI: 47.3-80.1]) than in arm B (17 of 29 patients [58.6%, 95% CI: 40.7-74.5]; OR 1.34 [95% CI: 0.46-3.89], P = 0.589). The rate of breast-conserving surgery was 79.3% and 58.6% in arm A and B (P = 0.089), respectively. Blood metformin concentrations (6.2 μmol/L, 95% CI: 3.6-8.8) were within the therapeutic range. Seventy-six percent of patients completed the metformin-containing regimen; 13% of patients in arm A dropped out because of metformin-related gastrointestinal symptoms. The most common adverse events (AEs) of grade ≥3 were neutropenia in both arms and diarrhea in arm A. None of the serious AEs was deemed to be metformin-related. Addition of anti-diabetic doses of metformin to a complex neoadjuvant regimen was well tolerated and safe. Because the study was underpowered relative to its primary endpoint, the efficacy data should be interpreted with caution.", "affiliations": "Unit of Clinical Research, Catalan Institute of Oncology, Girona, Spain.;Department of Medical Oncology, Breast Unit, Catalan Institute of Oncology-Hospital Universitari de Bellvitge-Bellvitge Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain.;Medical Oncology, Catalan Institute of Oncology, Girona, Spain.;Medical Oncology Service, Hospital Universitario Donostia, Donostia-San Sebastián, Spain.;Medical Oncology Department, Hospital de Mataró, Mataró, Barcelona, Spain.;Baselga Institute of Oncology (IOB), Hospital Quirón, Barcelona, Spain.;Medical Oncology Service, Hospital Universitario de Canarias, La Laguna, Tenerife, Spain.;Medical Oncology Service, Hospital Universitario de Salamanca, Salamanca, Spain.;Medical Oncology, Hospital Universitari Sant Joan, Reus, Spain.;Medical Oncology Service, Hospital Universitario Araba, Vitoria-Gasteiz, Spain.;Department of Medical Oncology, Hospital Universitario Central de Asturias, Oviedo, Spain.;Department of Medical Oncology, Breast Unit, Catalan Institute of Oncology-Hospital Universitari de Bellvitge-Bellvitge Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain.;Department of Medical Oncology, Breast Unit, Catalan Institute of Oncology-Hospital Universitari de Bellvitge-Bellvitge Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain.;Medical Oncology, Catalan Institute of Oncology, Girona, Spain.;Department of Medical Oncology, Ramón y Cajal University Hospital, Madrid, Spain.;Metabolism and Cancer Group, Girona Biomedical Research Institute, Girona, Spain.;Metabolism and Cancer Group, Girona Biomedical Research Institute, Girona, Spain.;Department of Analytical Chemistry, University of Granada, Granada, Spain.;Unitat de Recerca Biomèdica, Hospital Universitari Sant Joan, Institut d'Investigació Sanitària Pere Virgili, Universitat Rovira i Virgili, Reus, Spain.;Department of Analytical Chemistry, University of Granada, Granada, Spain.;Unitat de Recerca Biomèdica, Hospital Universitari Sant Joan, Institut d'Investigació Sanitària Pere Virgili, Universitat Rovira i Virgili, Reus, Spain.;Department of Radiology-IDI, Dr. Josep Trueta Hospital of Girona, Girona, Spain.;Unit of Clinical Research, Catalan Institute of Oncology, Girona, Spain.;Clinical Research Unit, Catalan Institute of Oncology, L'Hospitalet de Llobregat, Barcelona, Spain.;Department of Anatomical Pathology, Dr. Josep Trueta Hospital of Girona, Girona, Spain.;Unit of Clinical Research, Catalan Institute of Oncology, Girona, Spain.;Girona Biomedical Research Institute (IDIBGI), Girona, Spain.;Department of Medical Oncology, Ramón y Cajal University Hospital, Madrid, Spain.", "authors": "Martin-Castillo|Begoña|B|;Pernas|Sonia|S|;Dorca|Joan|J|;Álvarez|Isabel|I|;Martínez|Susana|S|;Pérez-Garcia|Jose Manuel|JM|;Batista-López|Norberto|N|;Rodríguez-Sánchez|César A|CA|;Amillano|Kepa|K|;Domínguez|Severina|S|;Luque|Maria|M|;Stradella|Agostina|A|;Morilla|Idoia|I|;Viñas|Gemma|G|;Cortés|Javier|J|;Cuyàs|Elisabet|E|;Verdura|Sara|S|;Fernández-Ochoa|Álvaro|Á|;Fernández-Arroyo|Salvador|S|;Segura-Carretero|Antonio|A|;Joven|Jorge|J|;Pérez|Elsa|E|;Bosch|Neus|N|;Garcia|Margarita|M|;López-Bonet|Eugeni|E|;Saidani|Samiha|S|;Buxó|Maria|M|;Menendez|Javier A|JA|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.18632/oncotarget.26286", "fulltext": "\n==== Front\nOncotargetOncotargetOncotargetImpactJOncotarget1949-2553Impact Journals LLC 2628610.18632/oncotarget.26286Research PaperA phase 2 trial of neoadjuvant metformin in combination with trastuzumab and chemotherapy in women with early HER2-positive breast cancer: the METTEN study Martin-Castillo Begoña 1Pernas Sonia 2Dorca Joan 3Álvarez Isabel 45Martínez Susana 6Pérez-Garcia Jose Manuel 7Batista-López Norberto 8Rodríguez-Sánchez César A. 910Amillano Kepa 11Domínguez Severina 12Luque Maria 13Stradella Agostina 2Morilla Idoia 2Viñas Gemma 3Cortés Javier 14Cuyàs Elisabet 15Verdura Sara 15Fernández-Ochoa Álvaro 1617Fernández-Arroyo Salvador 18Segura-Carretero Antonio 1617Joven Jorge 18Pérez Elsa 19Bosch Neus 120Garcia Margarita 21López-Bonet Eugeni 22Saidani Samiha 120Buxó Maria 20Menendez Javier A. 14231 Unit of Clinical Research, Catalan Institute of Oncology, Girona, Spain2 Department of Medical Oncology, Breast Unit, Catalan Institute of Oncology-Hospital Universitari de Bellvitge-Bellvitge Research Institute (IDIBELL), L'Hospitalet de Llobregat, Barcelona, Spain3 Medical Oncology, Catalan Institute of Oncology, Girona, Spain4 Medical Oncology Service, Hospital Universitario Donostia, Donostia-San Sebastián, Spain5 Biodonostia Health Research Institute, Donostia-San Sebastián, Spain6 Medical Oncology Department, Hospital de Mataró, Mataró, Barcelona, Spain7 Baselga Institute of Oncology (IOB), Hospital Quirón, Barcelona, Spain8 Medical Oncology Service, Hospital Universitario de Canarias, La Laguna, Tenerife, Spain9 Medical Oncology Service, Hospital Universitario de Salamanca, Salamanca, Spain10 Instituto de Investigación Biomédica de Salamanca (IBSAL), Salamanca, Spain11 Medical Oncology, Hospital Universitari Sant Joan, Reus, Spain12 Medical Oncology Service, Hospital Universitario Araba, Vitoria-Gasteiz, Spain13 Department of Medical Oncology, Hospital Universitario Central de Asturias, Oviedo, Spain14 Department of Medical Oncology, Ramón y Cajal University Hospital, Madrid, Spain15 Metabolism and Cancer Group, Girona Biomedical Research Institute, Girona, Spain16 Department of Analytical Chemistry, University of Granada, Granada, Spain17 Research and Development of Functional Food Centre (CIDAF), Health Science Technological Park, Granada, Spain18 Unitat de Recerca Biomèdica, Hospital Universitari Sant Joan, Institut d'Investigació Sanitària Pere Virgili, Universitat Rovira i Virgili, Reus, Spain19 Department of Radiology-IDI, Dr. Josep Trueta Hospital of Girona, Girona, Spain20 Girona Biomedical Research Institute (IDIBGI), Girona, Spain21 Clinical Research Unit, Catalan Institute of Oncology, L'Hospitalet de Llobregat, Barcelona, Spain22 Department of Anatomical Pathology, Dr. Josep Trueta Hospital of Girona, Girona, Spain23 Program Against Cancer Therapeutic Resistance (ProCURE), Metabolism and Cancer Group, Catalan Institute of Oncology, Girona, SpainCorrespondence to:Begoña Martin-Castillo,bmartin@iconcologia.netJavier A. Menendez,jmenendez@iconcologia.net, jmenendez@idibgi.org2 11 2018 2 11 2018 9 86 35687 35704 29 8 2018 21 10 2018 Copyright: © 2018 Martin-Castillo et al.2018This article is distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use and redistribution provided that the original author and source are credited.The METTEN study assessed the efficacy, tolerability, and safety of adding metformin to neoadjuvant chemotherapy plus trastuzumab in early HER2-positive breast cancer (BC). Women with primary, non-metastatic HER2-positive BC were randomized (1:1) to receive metformin (850 mg twice-daily) for 24 weeks concurrently with 12 cycles of weekly paclitaxel plus trastuzumab, followed by four cycles of 3-weekly FE75C plus trastuzumab (arm A), or equivalent regimen without metformin (arm B), followed by surgery. Primary endpoint was the rate of pathological complete response (pCR) in the per-protocol efficacy population. pCR rate was numerically higher in the metformin-containing arm A (19 of 29 patients [65.5%, 95% CI: 47.3–80.1]) than in arm B (17 of 29 patients [58.6%, 95% CI: 40.7–74.5]; OR 1.34 [95% CI: 0.46–3.89], P = 0.589). The rate of breast-conserving surgery was 79.3% and 58.6% in arm A and B (P = 0.089), respectively. Blood metformin concentrations (6.2 μmol/L, 95% CI: 3.6–8.8) were within the therapeutic range. Seventy-six percent of patients completed the metformin-containing regimen; 13% of patients in arm A dropped out because of metformin-related gastrointestinal symptoms. The most common adverse events (AEs) of grade ≥3 were neutropenia in both arms and diarrhea in arm A. None of the serious AEs was deemed to be metformin-related. Addition of anti-diabetic doses of metformin to a complex neoadjuvant regimen was well tolerated and safe. Because the study was underpowered relative to its primary endpoint, the efficacy data should be interpreted with caution.\n\nmetforminbreast cancerHER2trastuzumab\n==== Body\nINTRODUCTION\nMetformin, a biguanide derivative that reduces insulin levels, has long been a cornerstone in the treatment of type 2 diabetes (T2D). There is now compelling evidence to incorporate metformin into the armamentarium against cancer, particularly breast cancer (BC). Notwithstanding the limitations of observational studies, many have consistently indicated that metformin can reduce the incidence, outcome, and mortality of BC in patients with T2D [1–3]. Moreover, preclinical studies have described a variety of molecular mechanisms through which metformin indirectly or directly inhibits the growth of BC cells in vitro and in vivo [4–6].\n\nThe extensive clinical experience accumulated from patients with T2D prescribed metformin, together with its well characterized and modest toxicity profile [7, 8], has significantly shortened the clinical evaluation path of metformin in cancer prevention and treatment [9–11]. Accordingly, many clinical studies, including proof-of-principle studies in the prevention setting and phase 2 trials in the adjuvant and metastatic settings, have been planned and/or are currently under way to test the causal nature of the suggested correlation between metformin and clinical benefit in cancer.\n\nTo avoid overestimation of the potential effects of metformin in unselected populations of nondiabetic BC patients, preoperative translational studies are important to define specific BC subgroups more likely to benefit from metformin-based regimens. The neoadjuvant (preoperative) approach is known to maximize the capacity to test the benefits of drug combinations in the context of carefully designed clinical trials of early BC [12–15]. In this regard, a landmark retrospective study revealed that patients with T2D and BC who received metformin and neoadjuvant chemotherapy appeared to have a higher pCR rate than did those not receiving metformin [16], a hypothesis-generating finding that warrants prospective evaluation.\n\nMetformin has been shown to suppress both the tyrosine kinase activity and the expression of the human epidermal growth factor receptor 2 (HER2) protein in in vitro models of HER2-overexpressing BC cells [17–20], in addition to prolonging survival in HER2-overexpressing transgenic BC mouse models [21]. Metformin treatment leads also to lower levels of circulating insulin and insulin-like growth factor (IGF-I), and to cell-autonomous inhibition of the mTOR pathway [22–25]. Such a multi-faceted capacity of metformin to target not only HER2 itself but also central mechanisms implicated in refractoriness to HER2-targeted therapies including both the IGF-I/mTOR signaling pathway and the self-renewal/proliferation of tumor-initiating cancer stem cells [26–30] provides strong experimental support to translate these pre-clinical findings into new metformin-based clinical management strategies that may benefit HER2-positive BC patients. However, most of the in-vitro models showing anti-HER2 activity of metformin used drug concentrations in the millimolar range, far higher than reported plasma metformin concentrations seen in diabetic patients treated with metformin [27, 31, 32], thereby leaving unanswered the question of whether metformin would have a clinical effect in patients suffering from HER2-positive BC.\n\nThe open-label, multicenter, phase II randomized METTEN study [33] (EudraCT number 2011-000490-30) evaluated the clinical activity, tolerability, and safety of adding metformin to neoadjuvant chemotherapy plus trastuzumab in operable, locally advanced, or inflammatory HER2-positive BC.\n\nRESULTS\nPatient characteristics and disposition\nBetween June 1, 2012 and March 17, 2016, 98 patients at 10 centers in Spain were recruited into the METTEN study. Due to slow accrual, the study closed prematurely with a reduced sample size after 84 of 244 planned patients were randomly assigned: 41 enrolled patients were allocated to the metformin group (arm A) and 43 patients to the non-metformin group (arm B).\n\nFigure 1 shows the CONSORT diagram summarizing disposition of patients. Fourteen patients did not meet inclusion criteria and were not enrolled at the time of randomization. Nine patients in arm A and four patients in arm B failed to receive their allocated treatment, either due to treatment-related toxicity (eight patients in arm A and three in arm B) or they refused further follow-up or treatment (one in each arm) (Supplementary Table 2). Five patients were excluded from safety analyses because of informed consent withdrawal (two patients in arm A, one patient in arm B) or major protocol violation (one in each arm). The trial profile and treatment schedule is shown in Figure 2.\n\nFigure 1 METTEN trial profile\nCONSORT diagram summarizing disposition of patients in the METTEN study. (mITT: modified intention-to-treat; PP: per-protocol).\n\nFigure 2 METTEN study design\nStratification factors: age, extent of disease (cT2 cN0-1 vs ≥ cT3 or ≥ cN2), and hormone receptor (HR) status. Primary endpoint: pCR in breast and axilla. (HER2, human epidermal growth factor receptor; LVEF, left ventricular ejection fraction; pCR, pathological complete response).\n\nPatients and tumor characteristics of the modified ITT (mITT) population are summarized in Table 1. The baseline characteristics of the PP population (Supplementary Table 1) were similar to those of the mITT population. Most patients had T2 tumors (66% and 59% in arms A and B, respectively) and lymph node involvement (72% in arms A and B) at diagnosis. Within each stratum, no imbalances in terms of patient characteristics were observed across the two arms. Patients were stratified by age, extent of disease, and HR status.\n\nTable 1 Baseline patient demographic and tumor characteristics for the mITT population\n\tArm A (N = 38)\tArm B (N = 41)\tP value\t\nAge (years)\t\t\t0.780\t\n <50\t22 (57.9%)\t25 (61.0%)\t\t\n ≥50\t16 (42.1%)\t16 (39.0%)\t\t\n Mean ± SD (range)\t47.2 ± 10.6 (26–75)\t48.0 ± 11.5 (23–72)\t0.754\t\nMenopausal status\t\t\t0.818\t\n Post\t14 (36.8%)\t17 (41.5%)\t\t\n Pre\t24 (63.2%)\t24 (58.8%)\t\t\nBody weight (kg)\t\t\t\t\n Mean ± SD (range)\t64.6 ± 8.7 (45.3–89.0)\t65.2 ± 9.4 (48.0–83.0)\t0.289\t\nBody mass index (BMI)\t\t\t0.564\t\n <25\t21 (55.3%)\t20 (48.8%)\t\t\n ≥25 (overweight)\t17 (44.7%)\t21 (51.2%)\t\t\nClinical tumor status\t\t\t0.681\t\n cT2\t25 (65.8%)\t26 (63.4%)\t\t\n cT3\t12 (31.6%)\t10 (24.4%)\t\t\n cT4a\t0 (0.0%)\t1 (2.4%)\t\t\n cT4b\t1 (2.6%)\t3 (7.3%)\t\t\n cT4d\t0 (0.0%)\t1 (2.4%)\t\t\nClinical nodal Stage\t\t\t0.445\t\n cN0\t9 (23.7%)\t13 (31.7%)\t\t\n cN1\t24 (63.2%)\t20 (48.8%)\t\t\n cN2\t1 (2.6%)\t4 (9.7%)\t\t\n cN3\t4 (10.5%)\t4 (9.7%)\t\t\nHormone receptor status\t\t\t0.477\t\n ER and/or PgR positive\t19 (50.0%)\t24 (58.5%)\t\t\n ER and PR negative\t19 (50.0%)\t17 (41.5%)\t\t\nTumor grade\t\t\t0.272\t\n G1\t2 (7.1%)\t0 (0.0%)\t\t\n G2\t12 (42.9%)\t18 (54.5%)\t\t\n G3\t14 (50.0%)\t15 (45.5%)\t\t\n Unknown\t10\t8\t\t\nBaseline LVEF (%)\t\t\t0.755\t\n [50–55]\t3 (10.3%)\t2 (6.3%)\t\t\n [55–60]\t7 (24.1%)\t6 (18.8%)\t\t\n [60–65]\t8 (27.6%)\t13 (40.6%)\t\t\n [65–70]\t11 (37.9%)\t11 (34.4%)\t\t\n ≥70\t9\t9\t\t\nType of programmed surgery\t\t\t0.171\t\n Breast-conserving\t26 (76.5%)\t24 (61.5%)\t\t\n Mastectomy\t8 (23.5%)\t15 (38.5%)\t\t\n Unknown\t4\t2\t\t\nLVEF: Left Ventricular Ejection Fraction.\n\nResponses and surgery\nThe primary endpoint was the rate of pCR in breast and axilla in the efficacy analyzable PP population (twenty-nine patients in each arm). In arm A, 19/29 PP patients (65.5%, 95% CI: 47.3–80.1%) had a pCR versus 17/29 PP patients (58.6%, 95% CI: 40.7–74.5%) in arm B. The minimum clinically important difference that could be detectable considering the available PP population size (27.7%; α = 0.15, β = 0.20) was included in the upper limit (31.8%) of the confidence interval of the difference of pCR rates between the metformin-containing and the standard reference arm. The combined rates of pCR (ypT0/is, ypN0) and near-pCR, the latter defined as presence of infiltrating residual disease of less than 5 mm and node negativity (ypT1aN0), were 79.3% (95% CI: 61.6–90.2%) in arm A and 72.4% (95% CI: 54.3–85.3%) in arm B (Table 2).\n\nTable 2 Surgery and pathologic response in the PP efficacy population\n\tArm A (N = 29)\tArm B (N = 29)\tP value\t\nType of surgery\t\t\t\t\n  Mastectomy\t6 (20.7%)\t12 (41.4%)\t0.089\t\n  Breast-conserving surgery\t23 (79.3%)\t17 (58.6%)\t\t\nResponse\t\t\t\t\n  pCR\t\t\t0.588\t\n     No\t10 (34.5%)\t12 (41.4%)\t\t\n     Yes\t19 (65.5%)\t17 (58.6%)\t\t\n  pCR + near pCR\t\t\t0.539\t\n     No\t6 (20.7%)\t8 (27.6%)\t\t\n     Yes\t23 (79.3%)\t21 (72.4%)\t\t\nType of surgery & response\t\t\t\t\n  Mastectomy (N = 18)\t\t\t\t\n    pCR\t\t\t0.620\t\n     No\t4 (66.7%)\t5 (41.7%)\t\t\n     Yes\t2 (33.3%)\t7 (58.3%)\t\t\n    pCR + near pCR\t\t\t0.321\t\n     No\t4 (66.7%\t4 (33.3%)\t\t\n     Yes\t2 (33.3%)\t8 (66.7%)\t\t\n  Breast-conserving surgery (N = 40)\t\t\t\t\n    pCR\t\t\t0.314\t\n     No\t6 (26.1%)\t7 (41.2%)\t\t\n     Yes\t17 (73.9%)\t10 (58.8%)\t\t\n    pCR + near pCR\t\t\t0.373\t\n     No\t2 (8.7%)\t4 (23.5%)\t\t\n     Yes\t21 (91.3%)\t13 (76.5%)\t\t\nBreast-conserving surgery (BCS) was possible in 79.3% of patients in arm A, which was apparently superior to the 58.6% achieved in arm B (P = 0.089, Table 2). Among patients undergoing BCS, 91.3% achieved a pCR/nearpCR in the metformin arm versus 76.5% in the reference arm (Table 2).\n\nSupplementary Table 3 summarizes the pCR and surgery analyses performed for the mITT population. In Arm A, 19/38 mITT patients (50%, 95% CI: 34.8–65.1%) had a pCR versus 23/41 mITT patients (56.1%, 95% CI: 41.0–70.1%) in arm B. BCS was possible in 78.4% of mITT patients in arm A, which was superior to the 61.0% achieved in arm B (P = 0.096).\n\nPrediction of response\nAlthough the study was underpowered (42%) because of a small number of patients evaluable for the primary endpoint, we performed an exploratory analysis to describe the distribution of pCR rates between arms in the analyzable PP efficacy population. Such exploratory analysis showed no differences between the two arms (odds ratio [OR] 1.34 [95% CI: 0.46–3.89], P = 0.589; Table 3). The analysis performed in the mITT population similarly showed no differences between the two arms (OR 0.78 [95% CI: 0.32–1.90], P = 0.588; Supplementary Table 4).\n\nTable 3 Univariable analysis of factors associated with a pCR in the PP efficacy population\nCategory\tNo pCR N (%)\tpCR N (%)\tOR (95% CI)\tP value\t\nArm\t\t\t\t\t\n B\t12 (41.4%)\t17 (58.6%)\t1\t\t\n A\t10 (34.5%)\t19 (65.5%)\t1.34 (0.46–3.89)\t0.589\t\nAge (years)\t\t\t\t\t\n <50\t16 (47.1%)\t18 (52.9%)\t\t\t\n ≥50\t6 (25.0%)\t18 (75.0%)\t2.67 (0.85–8.37)\t0.093\t\nClinical tumor stage\t\t\t\t\t\n ≥T3\t12 (52.2%)\t11 (47.8%)\t1\t\t\n T2\t10 (28.6%)\t25 (71.4%)\t3.12 (1.02–9.48)\t0.073\t\nClinical nodal status\t\t\t\t\t\n N ≥ 2\t4 (40.0%)\t6 (60.0%)\t1\t\t\n N0–1\t18 (37.5%)\t30 (62.5%)\t1.11 (0.28–4.48)\t0.882\t\nER\t\t\t\t\t\n Positive\t13 (43.3%)\t17 (56.7%)\t1\t\t\n Negative\t9 (32.1%)\t19 (67.9%)\t1.61 (0.55–4.72)\t0.381\t\nPgR\t\t\t\t\t\n Positive\t13 (56.5%)\t10 (43.5%)\t1\t\t\n Negative\t9 (25.7%)\t26 (74.3%)\t3.76 (1.23–11.51)\t0.021\t\nHR status\t\t\t\t\t\n Positive\t14 (45.2%)\t17 (54.8%)\t1\t\t\n Negative\t8 (29.6%)\t19 (79.4%)\t1.96 (0.66–5.80)\t0.227\t\nOR, odds ratio.\n\nIn univariable analysis for predetermined factors predicting a pCR in the two arms, solely T2 and PgR negativity (P = 0.021) appeared to associate with the probability of achieving pCR (OR 3.12 [95% CI: 1.02–9.48] and 3.76 [95% CI: 1.23–11.51], respectively) in the efficacy analyzable PP population (Table 3). In bivariate analysis, PgR negativity seemed to show predictive capacity irrespective of the arm in which the patients were randomized (Supplementary Table 5). In the mITT population, a similar association appeared to occur between PgR negativity and the probability of achieving pCR in uni- and bivariate analysis (Supplementary Tables 4 and 6, respectively).\n\nIn multivariable analysis, PgR negativity no longer associated with the probability of achieving a pCR (data not shown). Supplementary Tables 7 and 8 summarizes how the pCR rates in both arms appeared to remain unchanged according to hormonal receptor status in the PP and mITT populations, respectively.\n\nCirculating metformin\nWe assessed serum concentrations of metformin in a subgroup of twenty-two patients using HPLC-ESI-QTOF-MS (Figure 3). Inadequate blood samples were drawn in two patients and were excluded from the analysis. The mean concentration was determined to be 6.2 μmol/L (95% CI: 3.6–8.8) with a range from 0.1 μmol/L to 21.1 μmol/L. We detected slightly higher levels of circulating metformin in patients achieving pCR (mean 7.1 μmol/L; 95% CI: 3.0–11.1) than in those belonging to the non-responders group (mean 4.7 μmol/L; 95% CI: 2.7–6.7; P = 0.757). Supplementary Figure 1 shows the distribution of serum metformin through concentrations as a function of the time of blood sampling/metformin intake.\n\nFigure 3 Circulating serum metformin\nBox plots indicating median (black lines within the boxes), interquartile ranges, whiskers and ranges for post-treatment levels of circulating serum metformin (μmol/L; N = 20). (pCR: pathological complete response).\n\nCompliance with treatment and toxicity\nThe most frequently occurring AEs (290 in arm A and 306 in arm B) were fatigue, diarrhea, nausea, alopecia, sensory neuropathy, mucositis, neutropenia, and elevated AST/ALT (Table 4, Supplementary Table 9). Most AEs were of grades 1 and 2 (92.1% in arm A and 95.8% in arm B; Table 4, Supplementary Table 9). The majority of the most frequent AEs were deemed possibly related to study treatment. The overall incidence of AEs of grade ≥3 ranged from 7.9% (23/290 events) in arm A to 4.3% (13/306 events) in arm B; the most common of which were neutropenia (7/38 patients in arm A and 5/41 patients in arm B) and diarrhea (5 and 0, respectively; Table 4).\n\nTable 4 Cardiac and most common adverse events reported as possibly, probably, or definitely related to treatment in the mITT population\n\tArm A (N = 38)\tArm B (N = 41)\t\n\tGrade 1\tGrade 2\tGrade 3\tGrade 4\tGrade 1\tGrade 2\tGrade 3\tGrade 4\t\nHematological toxicity\t\t\t\t\t\t\t\t\t\n Anemia\t3 (7.9%)\t3 (7.9%)\t2 (5.3%)\t0 (0.0%)\t2 (4.9%)\t4 (9.8%)\t0 (0.0%)\t0 (0.0%)\t\n Thrombocytopenia\t0 (0.0%)\t0 (0.0%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Leukopenia\t3 (7.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t3 (7.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Neutropenia\t2 (5.3%)\t4 (10.5%)\t5 (13.2%)\t2 (5.3%)\t4 (9.8%)\t2 (4.9%)\t4 (9.8%)\t1 (2.4%)\t\n Febrile Neutropenia\t0 (0.0%)\t0 (0.0%)\t1 (2.6%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t0 (0.0%)\t\nGastrointestinal disorders\t\t\t\t\t\t\t\t\t\n Diarrhea\t18 (47.4%)\t5 (13.2%)\t5 (13.2%)\t0 (0.0%)\t12 (29.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Constipation\t4 (10.5%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\n Nausea\t14 (36.8%)\t4 (10.5%)\t1 (2.6%)\t0 (0.0%)\t12 (29.3%)\t4 (9.8%)\t1 (2.4%)\t0 (0.0%)\t\n Vomiting\t12 (31.6%)\t5 (13.2%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t1 (2.4%)\t1 (2.4%)\t0 (0.0%)\t\n Mucositis\t13 (34.2%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t12 (29.3%)\t5 (12.2%)\t0 (0.0%)\t0 (0.0%)\t\n Dyspepsia\t2 (5.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Pyrosis\t3 (7.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t6 (14.6%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\n Epigastric Pain\t6 (15.8%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t5 (12.2%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nGeneral disorders\t\t\t\t\t\t\t\t\t\n Fatigue\t22 (57.9%)\t8 (21.1%)\t1 (2.6%)\t0 (0.0%)\t23 (56.1%)\t11 (26.8%)\t0 (0.0%)\t0 (0.0%)\t\n Headache\t2 (5.3%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\n Fever\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nVascular disorders\t\t\t\t\t\t\t\t\t\n Edema\t2 (5.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Hypertension\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nSkin disorders\t\t\t\t\t\t\t\t\t\n Alopecia\t5 (13.2%)\t12 (31.6)\t0 (0.0%)\t0 (0.0%)\t9 (22.0%)\t9 (22.0%)\t0 (0.0%)\t0 (0.0%)\t\n Rash\t7 (18.4%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\n Erythema\t2 (5.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t0 (0.0%)\t1 (2.4%)\t0 (0.0%)\t\n Pruritus\t4 (10.5%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Nail changes\t3 (7.9%)\t2 (5.3%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\n Toxicodermic reaction to chemotherapy\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t0 (0.0%)\t\n Rosacea\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t0 (0.0%)\t\n Skin toxicity\t2 (5.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t3 (7.3%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\nMetabolism disorders\t\t\t\t\t\t\t\t\t\n Anorexia\t4 (10.5%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t2 (4.9%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\n Hypercalcemia\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Hypercholesterolemia\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\n Hypertriglyceridemia\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nMetabolism disorders\t\t\t\t\t\t\t\t\t\n AST/ALT increased\t8 (21.1%)\t3 (7.9%)\t2 (5.3%)\t0 (0.0%)\t7 (17.1%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\nMusculoskeletal disorders\t\t\t\t\t\t\t\t\t\n Arthralgia\t3 (7.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t6 (14.6%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\n Myalgia\t8 (21.1%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t7 (17.1%)\t2 (4.9%)\t0 (0.0%)\t0 (0.0%)\t\n Septic arthritis\t0 (0.0%)\t0 (0.0%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nNervous system disorders\t\t\t\t\t\t\t\t\t\n Sensory Neuropathy\t10 (26.3%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t19 (46.3%)\t5 (12.2%)\t0 (0.0%)\t0 (0.0%)\t\n Dizziness\t1 (2.6%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\n Dysgeusia\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t4 (9.8%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nRespiratory disorders\t\t\t\t\t\t\t\t\t\n Epistaxis\t3 (7.9%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t9 (22.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\n Dyspnea\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t3 (7.3%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nReproductive system\t\t\t\t\t\t\t\t\t\n Amenorrhea\t1 (2.6%)\t3 (7.9%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t0 (0.0%)\t0 (0.0%)\t\nCardiac disorders\t\t\t\t\t\t\t\t\t\n Left ventricular systolic dysfunction\t0 (0.0%)\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t1 (2.4%)\t1 (2.4%)\t0 (0.0%)\t\n Dilated aortic root\t1 (2.6%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t0 (0.0%)\t\nData are N (%).\n\nThe number of serious AEs requiring hospitalization was three in arm A and two in arm B (details are summarized in the Supplementary Table 10). No treatment-related deaths occurred.\n\nCardiac tolerability\nTable 5 shows baseline LVEF values and changes during neoadjuvant treatment in the two study arms. LVEF dropped below baseline during the treatment period in both arms; however, mean and median decreases were no more than 5% (Supplementary Table 11). Although the profiles of LVEF changes over time were similar between arms (Figure 4), only one (2.9%) patient in arm A and six (15%) in arm B exhibited asymptomatic decreases in LVEF below the institutional lower limit (50%) and >10% from baseline at week 12 (P = 0.032; Table 5). At the treatment end, none (0%) of the patients in arm A and three (8.1%) in arm B presented decreases in LVEF (P = 0.409; Table 5). Only one patient (2.7%) in arm B experienced symptomatic heart failure.\n\nTable 5 Left ventricular ejection fraction (LVEF) in the mITT population\n\tArm A\tArm B\t\t\nAt baseline\tN = 38\tN = 41\t\t\nMedian (IQR)\t65.0% (58.0 to 69.3)\t64.0% (61.0 to 68.5)\t\t\nWeek 12\tN = 34\tN = 40\t\t\n Median change from baseline (IQR)\t–1.5% (–6.6 to 1.2)\t–1.0% (–6.8 to 4.0)\t\t\n LVEF measurement (N, %)\t\t\tP = 0.032\t\n  No decrease or decrease <10%, still above LLN\t32 (94.1%)\t33 (82.5%)\t\t\n  Decrease <10%, below LLN\t1 (2.9%)\t1 (2.5%)\t\t\n  Decrease 10–15%, still above LLN\t0 (0.0%)\t6 (15.0%)\t\t\n  Decrease 10–15%, below LLN\t0 (0.0%)\t0 (0.0%)\t\t\n  Decrease >15%, still above LLN\t1 (2.9%)\t0 (0.0%)\t\t\n  Decrease >15%, below LLN\t0 (0.0%)\t0 (0.0%)\t\t\nEnd of treatment\tN = 32\tN = 37\t\t\n Median change from baseline (IQR)\t–4.0% (–6.0 to –1.8)\t–5.0% (–7.5 to –1.0)\t\t\n LVEF measurement (N, %)\t\t\t\t\n  No decrease or decrease <10%, still above LLN\t27 (84.4%)\t30 (81.1%)\tP = 0.409\t\n  Decrease <10%, below LLN\t1 (3.1%)\t0 (0.0%)\t\t\n  Decrease 10–15%, still above LLN\t2 (6.3%)\t3 (8.1%)\t\t\n  Decrease 10–15%, below LLN\t0 (0.0%)\t3 (8.1%)\t\t\n  Decrease >15%, still above LLN\t2 (6.3%)\t1 (2.7%)\t\t\n  Decrease >15%, below LLN\t0 (0.0%)\t0 (0.0%)\t\t\nData are median (IQR) or N (%) unless stated otherwise.\n\nLLN, lower limit of institutional normal; LVEF, left ventricular ejection fraction.\n\nFigure 4 Left ventricular ejection fraction (LVEF) per treatment arm\nBox plots indicating median (black lines within the boxes), interquartile ranges, whiskers and ranges for LVEF at baseline, after 12–13 weeks, and at the end of therapy.\n\nDISCUSSION\nThe METTEN study compared conventional chemotherapy plus trastuzumab with the combination of metformin and chemotherapy plus trastuzumab in the neoadjuvant setting for treatment of early HER2-positive BC.\n\nAssessment of pCR using the definition ypT0/is, ypN0 showed that the two treatment regimens were highly active, with pCR rates ranging from 58.6% in the reference arm to 65.5% in the metformin arm. Such high pCR rates in the small sample size of the METTEN study were consistent with those originally reported in the MD Anderson Cancer Center trial (55–65%) [34, 35] and with our previous experience (61.4%) of concurrent trastuzumab plus weekly paclitaxel-FEC as primary therapy for HER2-positive BC in everyday clinical practice [36]. Although the pCR rates in our study were numerically higher than those generally found in larger randomized phase III trials such as the NOAH [37], the GeparQuattro [38], the HannaH [39], or the Cortazar meta-analysis of neoadjuvant BC trials [13], which reported pCR rates up to 40%, such differences were most likely due to differences in study populations.\n\nThe numerically higher pCR rate observed in the PP population receiving the neoadjuvant metformin did not reach statistical significance in our study. However, it should be acknowledged that the trial was closed before the first scheduled interim analysis due to slow recruitment. As a result, a formal statistical comparison of treatment arms in the reported efficacy/PP population was statistically underpowered, and the efficacy analysis should be considered purely exploratory. Evaluation of long-term outcome data such as 5-year DFS together with correlative biological studies evaluating proliferation markers (e.g., Ki-67) and selected predictive factors of response to neoadjuvant treatment in HER2-positive BC (e.g., EGFR and PTEN) are currently underway in our laboratory to adequately appraise whether those patients who received neoadjuvant metformin might gain an additional survival benefit and the mechanisms involved [35, 40–44]. Although a higher BCS rate was observed in patients receiving additional metformin, breast conservation is known to depend on multiple parameters including breast size, tumor location, presence of DCIS, the multifocality of the lesion, or patient willingness [45], thus making it challenging to attribute such differences to a true clinico-molecular benefit in those patients receiving neoadjuvant metformin.\n\nData from the Asian Medical Center Breast Cancer Database concluded that diabetic patients receiving metformin when BC is diagnosed show a better prognosis only if they had HR-positive, HER2-positive tumors [46]. Moreover, an analysis of the ALTTO Phase III randomized trial, which assigned patients with HER2-positive BC to receive 1 year of trastuzumab alone, lapatinib alone, their sequence, or their combination, found that metformin exerted a statistically-significant beneficial effect in those patients with diabetes who had primary HER2-positive and HR-positive BC [47]. Neoadjuvant trials with anti-HER2 therapy have demonstrated a HR status-related prognostic value after achieving a pCR, with a higher survival effect in the HR-negative group than in the HR-positive group [48]. In the METTEN study, a higher percentage of PgR-negative patients achieved a pCR in both arms, thus confirming the notion that the likelihood of response according to HR status is an intrinsic characteristic of HER2-positive tumors [49, 50]. However, we failed to clarify the actual predictive value of pCR in the metformin-containing arm according to HR status.\n\nAfter hepatic uptake, the plasma concentration of metformin is reduced to 5–20 μmol/L after oral doses of 0.5–1.5 g metformin in humans with a mean plasma half-life of about 20 h [6, 31, 51]. Our analytical determination of serum metformin confirmed that treatment of non-diabetic HER2+ BC patients with oral metformin (850 mg twice-daily) for 24 weeks produced blood levels of circulating metformin (approx. 7 μmol/L) equivalent to those generally achieved in diabetic patients at the usual clinical doses and schedules [27, 31, 32]. Although systemic exposure of metformin seemed more elevated in those patients achieving a pCR than in non-responder patients, two outliers within the responder group appeared to drive such trend that failed to reach statistical significance. Moreover, we measured circulating concentrations of metformin in blood samples that were not strictly timed in terms of hours since preceding oral dose [51] and, therefore, our data need to be viewed cautiously in terms of any association between achieved serum concentration and probability of pCR.\n\nOne major concern regarding the utility of metformin is its known ability to induce gastrointestinal upset and diarrhea, which might limit patient compliance, particularly when combined with cytotoxic chemotherapy [52]. The METTEN study confirms that metformin is likely a tolerable and safe addition to current therapy regimens [53, 54]. From the perspective of tolerability, it should be noted that the dropout rate in the metformin arm was much lower than the expected 25%; only 13% (5 out of 38) of patients withdrew because of metformin-related gastrointestinal upset and diarrhea, whereas more than 75% (29 out of 38) patients completed the 6-month intervention with metformin as part of a complex neoadjuvant combination. The safety of the triple regimen of metformin, chemotherapy, and trastuzumab was similar to that of chemotherapy and trastuzumab. None of the three serious AEs in arm A was deemed to be exclusively metformin-related. Because residual disease after neoadjuvant therapy is a poor prognostic factor [55], it would be relevant to evaluate whether upregulated mitochondrial oxidative phosphorylation (OXPHOS) –a primary target of metformin- is part of the metabolic shifts that drive tumor recurrence in residual BC [56], thereby allowing metformin to be considered as a safe candidate to treat OXPHOS-dependent residual BC disease.\n\nWhen we evaluated the cardiac tolerability of metformin given in the triple regimen, metformin did not increase the baseline rate of cardiac dysfunction observed in the reference arm. Moreover, by assessing the trajectories of LVEF decline over time, we observed a small trend towards a lower number of asymptomatic cardiac events in the metformin-containing arm. HER2 signaling is involved in myocardial homeostasis and its inhibition may explain the increased incidence of cardiomyopathy associated with the treatment with trastuzumab, particularly in those patients exposed to cardiotoxic chemotherapies such as anthracyclines [57, 58]. Trastuzumab-induced cardiomyopathy relates, at least in part, to its inability to activate pro-survival catabolic pathways through AMP-activated protein kinase (AMPK) in cardiac cells [59, 60]. Because metformin treatment has been shown to improve cardiovascular function and reduce cardiovascular risk in diabetic patients through the activation of AMPK [61]–a cell-autonomous mechanism that also underlies the activity of metformin as an anticancer drug [4–6]– larger and longer-term studies evaluating biomarkers of cardiotoxicity in trastuzumab-exposed oncologic populations will be needed to clarify whether metformin induces AMPK (and downstream catabolic) signaling upon trastuzumabinduced metabolic dysregulation in cardiomyocytes [20, 62].\n\nDuring recruitment, the findings of the phase II NeoSphere [49] and TRYPHAENA trials [63], together with the impressive survival benefits for women with HER2-positive metastatic BC receiving pertuzumab along with trastuzumab in the phase III CLEOPATRA study [64], led to the accelerated approval of pertuzumab by the FDA in September 2013 and the European Medicines Agency in July 2015 for use in combination with trastuzumab plus chemotherapy for neoadjuvant treatment of patients with HER2-positive locally advanced, inflammatory, or early-stage BC. Consequently, ethical issues arose during the METTEN study trial based on the recommended standard of care supported by national and international guidelines with a neoadjuvant combination of taxane-containing chemotherapy and a dual blockade of trastuzumab and pertuzumab. Moreover, we cannot exclude the possibility that a rejection bias might exist against the repurposing of generic non-cancer metformin as oncological treatment when confronted to commercially developed anti-cancer drugs [65].\n\nTwo previous randomized phase II trials have shown that metformin in combination with systemic therapy fails to significantly improve outcomes in patients with advanced/metastatic pancreatic cancer [66, 67]. These studies by Kordes [66] and Reni [67] intended very ambitious clinical targets in terms of overall survival (from 50% to 75% at 6 months) and progression-free survival (from 50% to 70% at 6 months), respectively. Because the METTEN trial failed to identify also a large difference, i.e., a 25% increase over an expected pCR of 60% with chemotherapy plus trastuzumab before a phase 3 trial could be justified, it might be tempting to suggest that testing against high bars of clinical outcome endpoints instead of using a priori non-inferiority trial designs should be cautiously considered before concluding that studies using metformin for treating cancer should be abandoned. Moreover, negative results of first-generation cancer trials using metformin at the same dose and route of administration that in diabetic patients would not rule out the clinical utility of biguanides other than metformin (e.g., phenformin) or non-conventional routes for administering biguanides if previously optimized for oncology indications [68–71]. However, as we did not achieve the target number of patients to power the study, we cannot be certain whether the lack of significant difference between the two arms of the METTEN trial is a type II error or reflects a true lack of efficacy for the metformin-based neoadjuvant strategy in early HER2-positive BC. Beyond general considerations such as the need to consolidate prognostic, predictive, and pharmacodynamic factors of the metabolic response to metformin for selecting subsets of patients most likely to benefit from metformin treatment, mature results from large, randomized studies, such as the NCIC CTG MA.32, the most advanced adjuvant trial investigating the effects of metformin versus placebo on invasive DFS and other outcomes on early BC in 3,649 women [10], will be of great interest to confirm or reject [72] the causal nature of the suggested correlation between metformin use and survival benefit in BC patients.\n\nMATERIALS AND METHODS\nStudy design and objectives\nPatients were randomly assigned to receive daily metformin (850 mg twice-daily) for 24 weeks concurrently with 12 cycles of weekly paclitaxel plus trastuzumab followed by four cycles of 3-weekly fluorouracil, epirubicin, cyclophosphamide plus trastuzumab (arm A) or equivalent sequential chemotherapy plus trastuzumab without metformin (arm B), followed by surgery.\n\nThe primary end point was pCR, defined as absence of invasive tumor cells on hematoxylin and eosin evaluation of the complete resected breast specimen (and all sample regional lymph nodes if lymphadenectomy was performed) following the completion of neoadjuvant systemic therapy. Residual ductal carcinoma in situ (DCIS) only was included in the definition of pCR (ypT0/is, ypN0). Secondary aims included the tolerability and safety profile of the metformin-based neoadjuvant combination including cardiac toxicity, the rate of breast conservation, 5-year disease-free survival (DFS), the inhibition of tumor tissue biomarkers (including proliferative, mTOR/AMPK- and HER2-related pathways), and changes in circulating levels of insulin and metabolites. Studies of disease free survival rates and correlative biological markers are ongoing and will be reported separately. Independent institutional review boards approved the study protocol and any amendments. Written informed consent was obtained from each participant. The study was registered with the EU Clinical Trials Register and is available online (https://www.clinicaltrialsregister.eu/ctr-search/trial/2011-000490-30/ES).\n\nPatient selection\nPatients were eligible if they met the following criteria: previously untreated, operable, locally advanced, or inflammatory BC >2.0 cm in largest clinical diameter, and confirmed HER2 positivity (either immunohistochemistry 3+ or 2+ and positive for fluorescent or chromogenic in situ hybridization). Patients were excluded from this study if they had impaired cardiac function (e.g., uncontrolled or symptomatic angina, clinically significant arrhythmias, congestive heart failure, transmural myocardial infarction), uncontrolled hypertension, concurrent treatment with therapies that can alter insulin levels (including chronic treatment with oral corticoids), metabolic disease (e.g., diabetes mellitus type I or II, obesity [BMI >30], impaired glucose tolerance [>128 mg/dL], hypercholesterolemia or hypertriglyceridemia of grade ≥3 according to CTC-NCIC version 4.0). See Supplementary Materials for additional inclusion and exclusion criteria.\n\nTreatment\nChemotherapy consisted of weekly paclitaxel (80 mg/m2) for 12 weeks, concomitant trastuzumab (4 mg/kg loading dose followed by 2 mg/kg weekly for 12 weeks), followed by four courses of fluorouracil (600 mg/m2), epirubicin (75 mg/m2), and cyclophosphamide (600 mg/m2) (FE75C), administered every 3 weeks with concomitant trastuzumab (6 mg/kg). Corticosteroids and histamine-receptor blockers were administered before paclitaxel. Patients on arm A received concomitant metformin (850 mg twice-daily) for 24 weeks, which was given in divided doses with meals, with gradual dose escalation to reduce gastrointestinal side effects. The starting dose was 425 mg (one-half of a tablet) daily with dinner; dosage increase was carried out in increments of 425 mg every week to a total of 850 mg twice-daily after 4 weeks. Patients had surgery within 4–5 weeks of the last cycle of neoadjuvant treatment. Post-surgery, patients received 3-weekly trastuzumab to complete 1 year of neoadjuvant-adjuvant therapy. Radiotherapy and endocrine therapy were according to local guidelines.\n\nRandomization and masking\nPatients were randomly assigned (1:1 ratio) to arm A or arm B with a dynamic randomized block design and a minimization technique. Stratification factors were: age (<50 years vs ≥50 years); clinical tumor size (T2 [2–5 cm diameter] vs ≥T3 [>5 cm diameter]); clinical involvement of axillary lymph nodes (N0-1 vs ≥2); and hormone receptor (HR) status (estrogen receptor or progesterone-receptor [PgR] positive; or both, vs estrogen-receptor and PgR negative). Two hundred and fifty-six randomization codes were generated with a block size of 16 patients (8 per arm) per combined strata. On verification of patients' eligibility, investigators were immediately notified of the allocated treatment.\n\nAssessments\nGrading of all adverse events (AEs) was made using National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CTCAE) version 4.0, and reported as cumulative incidence. Cardiac safety was monitored via incidence of significant asymptomatic left ventricular systolic dysfunction (LVSD), which was defined as ≥10% decline in left ventricular ejection fraction (LVEF) from baseline to <50% over the course of neoadjuvant treatment. LVEF was evaluated before study, after 12 weeks, and at the completion of treatment. Symptomatic LVSD was reported as a serious AE. Ink marks or surgical clips were used to mark the tumor bed before beginning neoadjuvant therapy, to facilitate surgical procedures and pathology. The Oracle Clinical® software tool was employed to assist with data management, data entry, and data validation.\n\nAnalytical determination of circulating metformin in serum\nSerum was collected at the end of the 24-week intervention and stored at −80°C until assayed. Metformin concentrations were determined using high-performance liquid chromatography coupled to electrospray ionization and quadrupole time-of-flight mass spectrometry (HPLC-ESI-QTOF-MS). See Supplementary Materials for a detailed description of the analytical method.\n\nSample size and statistical analysis\nA Jung's two-stage design for randomized phase II trials with a prospective control [73] was used to estimate the sample size. To keep the sample size small and the study period short, we employed a relatively large type I error (α = 15%) and a short-term outcome variable, the percentage of pCR as primary endpoint, which allowed for early termination of the study if the metformin containing arm failed to show efficacy at the interim analysis. The combination metformin plus chemotherapy/trastuzumab was considered worthwhile if a pCR ≥75% was obtained. By setting an α level of 0.15, a power of 0.80, a balanced allocation (1:1), and an expected drop-out rate of 25%, the sample size was 47 patients for arms A and B to ensure a per-protocol (PP) assessment of pCR in 37 patients in each arm at the first stage. Only if at least two more patients achieved a pCR in the metformin-containing arm than in the reference arm, and provided no safety issues were identified, would the clinical trial proceed to the second stage. In such case, an additional recruitment of 65 patients for arms A and B (to ensure a PP assessment of pCR in 52 patients in each arm), will proceed. The metformin-containing arm was considered effective if 5 or more additional patients achieved a pCR in comparison with the reference arm at the end of the study (N = 224 patients at the planned final sample size).\n\nThe modified intention-to-treat (mITT)/safety population included all randomly assigned patients who received at least one dose of study medication. The PP/efficacy population included all participants in the mITT population who had not violated any inclusion or exclusion criteria or deviated from the protocol in a way that could affect their efficacy assessments including sufficient treatment duration.\n\nSafety and efficacy parameters were evaluated descriptively. Categorical parameters are presented as frequencies (N, %) and were compared using a chi-squared test (or Fisher's exact test, when appropriate). Continuous variables are presented as mean ± standard deviation or median (1st/3rd quartile) and were compared using Student's unpaired t-test or the Mann–Whitney U test when data were not normally distributed. Data normality before statistical analyses was assessed with the Kolmogorov-Smirnov test. Binary logistic regression was used to assess the prognostic effect of baseline characteristics on pCR. Unadjusted and adjusted odds ratios (ORs) with their relative 95% confidence intervals (CIs) were reported as a measure of association. After 84 of 224 planned patients were randomized, the trial was closed early due to slow recruitment, which left the study underpowered relative to its primary endpoint (i.e., pCR). Therefore, the analyses presented here are considered exploratory and P values should not be used for drawing conclusions about the impact on pCR when adding neoadjuvant metformin to trastuzumab and chemotherapy.\n\nStatistical analyses were carried out using SPSS (IBM Corp. released 2016. IBM SPSS Statistics for Windows, Version 24.0; Armonk, NY) and STATA (StataCorp. 2013. Stata Statistical Software: Release 13; StataCorp LP, College Station, TX).\n\nCONCLUSIONS\nLarger studies are needed to determine if the similar high percentages of pCR observed in both treatment arms in the METTEN study reflects true lack of clinical efficacy of metformin or whether the study was underpowered for drawing conclusions about metformin effectiveness. Nevertheless, the METTEN study provides useful information, revealing that the addition of a conventional anti-diabetic dose of metformin to complex neoadjuvant regimens involving anthracycline/taxane-based chemotherapy and targeted therapies such as trastuzumab is well tolerated and safe.\n\nSUPPLEMENTARY MATERIALS FIGURE AND TABLES\n The METTEN study was conceived and designed by Begoña Martin-Castillo and Javier A. Menendez. The METTEN study was sponsored by the Consortium for the Support of Biomedical Research Network (CAIBER) and the Catalan Institute of Oncology (ICO). The funding sources and sponsors did not have a role in either data analysis or in writing of the report. The Unit of Clinical Research at the ICO in Girona and the Unit for Statistical and Methodological Assessment at the Girona Biomedical Research Institute (IDIBGI) were responsible for central data gathering and analysis. All authors had responsibility for the decision to submit for publication. Work in the Javier A. Menendez laboratory is supported by the Ministerio de Ciencia e Innovación (Grant SAF2016-80639-P), Plan Nacional de l+D+I, Spain. The authors would like to thank Dr. Kenneth McCreath for editorial support.\n\nAuthor contributions\n\nConception and design: B Martin-Castillo, JA Menendez; Study coordination: B Martin-Castillo; Acquisition of data (e.g., acquired and managed patients, performed analytical determinations): S. Pernas, J. Dorca, I. Álvarez, S. Martínez, JM Pérez-Garcia, N. Batista-López, CA Rodríguez-Sánchez, K. Amillano, S. Domínguez, M. Luque, A. Stradella, I. Morilla, G. Viñas, J. Cortés, E. Cuyàs, S. Verdura, Á. Fernández-Ochoa, S. Fernández-Arroyo, A. Segura-Carretero, J. Joven, E. Pérez, E. López-Bonet; Analysis and data interpretation (e.g., development of methodology, statistical analysis, biostatistics): M Buxó, B Martin-Castillo, JA Menendez; Administrative and technical support (e.g., reporting or organizing data, constructing databases): N. Bosch, M. Garcia, M Buxó, S. Saidani. Writing, review, and/or revision of the manuscript: JA Menendez, B Martin-Castillo. All authors read and approved the final manuscript for submission.\n\nEthics statement\n\nThe hospital (Dr. Josep Trueta Hospital, Girona, Spain) ethics committee (Clinical Investigation Ethic Committee, CIEC) and independent institutional review boards at each site participating in the METTEN study approved the protocol and any amendments. All procedures were in accordance with the ethical standards of the institutional research committees and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in the study.\n\nAvailability of data and material\n\nThe study was registered with the EU Clinical Trials Register and is available online (https://www.clinicaltrialsregister.eu/ctr-search/trial/2011-000490-30/ES).\n\nCONFLICTS OF INTEREST\n\nThe authors declared that they have no competing interests.\n\nFUNDING\n\nThis work was supported by grants from the Ministerio de Sanidad, Servicios Sociales e Igualdad (EC10-125, Ayudas para el Fomento de la Investigación Clínica Independiente to Begoña Martin-Castillo).\n\nAbbreviations\nMETTENMetformin and Trastuzumab in Neoadjuvancy (METformina y Trastuzumab En Neoadyuvancia Spanish)\n\nBCBreast Cancer\n\npCRpathological Complete Response\n\nAEsAdverse effects\n\nFE75CFluorouracil, Epirubicin (75 mg/m2)\n\nT2DType 2 diabetes\n\nHRHormone Receptor\n\nEREstrogen Receptor\n\nPgRProgesterone receptor\n\nLEVFLeft Ventricular Ejection Fraction\n\nPPPer-Protocol\n\nITTIntention-to-treat\n\nHPLC-ESI-QTOF-MSHigh-performance liquid chromatography coupled to electrospray ionization and quadrupole time-of-flight mass spectrometry\n\nOXPHOSOxidative Phosphorylation\n\nORsOdds Ratios\n==== Refs\nREFERENCES\n1 Decensi A Puntoni M Goodwin P Cazzaniga M Gennari A Bonanni B Gandini S Metformin and cancer risk in diabetic patients: a systematic review and meta-analysis Cancer Prev Res (Phila) 2010 3 1451 1461 20947488 \n2 Col NF Ochs L Springmann V Aragaki AK Chlebowski RT Metformin and breast cancer risk: a meta-analysis and critical literature review Breast Cancer Res Treat 2012 135 639 646 22847511 \n3 Gandini S Puntoni M Heckman-Stoddard BM Dunn BK Ford L DeCensi A Szabo E Metformin and cancer risk and mortality: a systematic review and meta-analysis taking into account biases and confounders Cancer Prev Res (Phila) 2014 7 867 885 24985407 \n4 Del Barco S Vazquez-Martin A Cutí S Oliveras-Ferraros C Bosch-Barrera J Joven J Martin-Castillo B Menendez JA Metformin: multi-faceted protection against cancer Oncotarget 2011 2 896 917 10.18632/oncotarget.387 22203527 \n5 Pollak M Potential applications for biguanides in oncology J Clin Invest 2013 123 3693 3700 23999444 \n6 Foretz M Guigas B Bertrand L Pollak M Viollet B Metformin: from mechanisms of action to therapies Cell Metab 2014 20 953 966 25456737 \n7 Bodmer M Meier C Krahenbühl S Jick SS Meier CR Metformin, sulfonylureas, or other antidiabetes drugs and the risk of lactic acidosis or hypoglycemia: a nested case-control analysis Diabetes Care 2008 31 2086 2091 18782901 \n8 Salpeter SR Greyber E Pasternak GA Salpeter EE Risk of fatal and nonfatal lactic acidosis with metformin use in type 2 diabetes mellitus Cochrane Database Syst Rev 2010 4 CD002967 \n9 Goodwin PJ Stambolic V Lemieux J Chen BE Parulekar WR Gelmon KA Hershman DL Hobday TJ Ligibel JA Mayer IA Pritchard KI Whelan TJ Rastogi P Evaluation of metformin in early breast cancer: a modification of the traditional paradigm far clinical testing of anti-cancer agents Breast Cancer Res Treat 2011 126 215 220 20976543 \n10 Goodwin PJ Parulekar WR Gelmon KA Shepherd LE Ligibel JA Hershman DL Rastogi P Mayer IA Hobday TJ Lemieux J Thompson AM Pritchard KI Whelan TJ Effect of metformin vs placebo on and metabolic factors in NCIC CTG MA.32 J Natl Cancer Inst 2015 107 djv006 25740979 \n11 Pollak MN Investigating metformin for cancer prevention and treatment: the end of the beginning Cancer Discov 2012 2 778 790 22926251 \n12 Esserman LJ Berry DA DeMichele A Carey L Davis SE Buxton M Hudis C Gray JW Perou C Yau C Livasy C Krontiras H Montgomery L Pathologic complete response predicts recurrence-free survival more effectively by cancer subset: results from the I-SPY 1 TRIAL—CALGB 150007/150012, ACRIN 6657 J Clin Oncol 2012 30 3242 3249 22649152 \n13 Cortazar P Zhang L Untch M Mehta K Costantino JP Wolmark N Bonnefoi H Cameron D Gianni L Valagussa P Swain SM Prowell T Loibl S Pathological complete response and long-term clinical benefit in breast cancer: the CTNeoBC pooled analysis Lancet 2014 384 164 172 24529560 \n14 Berry DA Hudis CA Neoadjuvant Therapy in Breast Cancer as a Basis for Drug Approval JAMA Oncol 2015 1 875 876 26181139 \n15 DeMichele A Yee D Berry DA Albain KS Benz CC Boughey J Buxton M Chia SK Chien AJ Chui SY Clark A Edmiston K Elias AD The Neoadjuvant Model Is Still the Future for Drug Development in Breast Cancer Clin Cancer Res 2015 21 2911 2915 25712686 \n16 Jiralerspong S Palla SL Giordano SH Meric-Bernstam F Liedtke C Barnett CM Hsu L Hung MC Hortobagyi GN Gonzalez-Angulo AM Metformin and pathologic complete responses to neoadjuvant chemotherapy in diabetic patients with breast cancer J Clin Oncol 2009 27 3297 3302 19487376 \n17 Kim J Lee J Kim C Choi J Kim A Anti-cancer effect of metformin by suppressing signaling pathway of HER2 and HER3 in tamoxifen-resistant breast cancer cells Tumour Biol 2016 37 5811 5819 26581908 \n18 Vazquez-Martin A Oliveras-Ferraros C Menendez JA The antidiabetic drug metformin suppresses HER2 (erbB-2) oncoprotein overexpression via inhibition of the mTOR effector p70S6K1 in human breast carcinoma cells Cell Cycle 2009 8 88 96 19106626 \n19 Vázquez-Martín A Oliveras-Ferraros C del Barco S Martín-Castillo B Menéndez JA mTOR inhibitors and the anti-diabetic biguanide metformin: new insights into the molecular management of breast cancer resistance to the HER2 tyrosine kinase inhibitor lapatinib (Tykerb) Clin Transl Oncol 2009 11 455 459 19574203 \n20 Vazquez-Martin A Oliveras-Ferraros C del Barco S Martin-Castillo B Menéndez JA The antidiabetic drug metformin: a pharmaceutical AMPK activator to overcome breast cancer resistance to HER2 inhibitors while decreasing risk of cardiomyopathy Ann Oncol 2009 20 592 595 19153119 \n21 Anisimov VN Egarmin PA Piskunova TS Popovich IG Tyndyk ML Yurova MN Zabezhinski MA Anikin IV Karkach AS Romanyukha AA Metformin extends lite span of HER-2/neu transgenic mice and in combination with melatonin inhibits growth of transplantable tumors in vivo Cell Cycle 2010 9 188 197 20016287 \n22 Ben Sahra I Le Marchand-Brustel Y Tanti JF Bost F Metformin in cancer therapy: a new perspective for an old antidiabetic drug? Mol Cancer Ther 2010 9 1092 1099 20442309 \n23 Goodwin PJ Pritchard KI Ennis M Clemons M Graham M Fantus IG Insulinlowering effects of metformin in women with early breast cancer Clin Breast Cancer 2008 8 501 505 19073504 \n24 Jalving M Gietema JA Lefrandt JD de Jong S Reyners AK Gans RO de Vries EG Metformin: taking away the candy for cancer? Eur J Cancer 2010 46 2369 2380 20656475 \n25 Pollak M Insulin and insulin-like growth factor signalling in neoplasia Nat Rev Cancer 2008 8 915 928 19029956 \n26 Feng YH Velazquez-Torres G Gully C Chen J Lee MH Yeung SC The impact of type 2 diabetes and antidiabetic drugs on cancer cell growth J Cell Mol Med 2011 15 825 836 20455996 \n27 He L Wondisford FE Metformin action: concentrations matter Cell Metab 2015 21 159 162 25651170 \n28 Nahta R O'Regan RM Evolving strategies for overcoming resistance to HER2- directed therapy: targeting the Pl3K/Akt/mTOR pathway Clin Breast Cancer 2010 10 S72 S78 21115425 \n29 Vazquez-Martin A Oliveras-Ferraros C Del Barco S Martin-Castillo B Menendez JA The anti-diabetic drug metformin suppresses self-renewal and proliferation of trastuzumab-resistant tumor-initiating breast cancer stem cells Breast Cancer Res Treat 2011 126 355 364 20458531 \n30 Zhu P Davis M Blackwelder AJ Bachman N Liu B Edgerton S Williams LL Thor AD Yang X Metformin selectively targets tumor-initiating cells in ErbB2-overexpressing breast cancer models Cancer Prev Res (Phila) 2014 7 199 210 24322659 \n31 Tucker GT Casey C Phillips PJ Connor H Ward JD Woods HF Metformin kinetics in healthy subjects and in patients with diabetes mellitus Br J Clin Pharmacol 1981 12 235 246 7306436 \n32 Christensen MM Brasch-Andersen C Green H Nielsen F Damkier P Beck-Nielsen H Brosen K The pharmacogenetics of metformin and its impact on plasma metformin steady-state levels and glycosylated hemoglobin A1c Pharmacogenet Genomics 2011 21 837 850 21989078 \n33 Martin-Castillo B Dorca J Vazquez-Martin A Oliveras-Ferraros C Lopez-Bonet E Garcia M Del Barco S Menendez JA Incorporating the antidiabetic drug metformin in HER2-positive breast cancer treated with neo-adjuvant chemotherapy and trastuzumab: an ongoing clinical-translational research experience at the Catalan Institute of Oncology Ann Oncol 2010 21 187 189 19884247 \n34 Buzdar AU Ibrahim NK Francis D Booser DJ Thomas ES Theriault RL Pusztai L Green MC Arun BK Giordano SH Cristofanilli M Frye DK Smith TL Significantly higher pathologic complete remission rate after neoadjuvant therapy with trastuzumab, paclitaxel, and epirubicin chemotherapy: results of a randomized trial in human epidermal growth factor receptor 2- positive operable breast cancer J Clin Oncol 2005 23 3676 3685 15738535 \n35 Buzdar AU Suman VJ Meric-Bernstam F Leitch AM Ellis MJ Boughey JC Unzeitig G Royce M McCall LM Ewer MS Hunt KK American College of Surgeons Oncology Group investigators Fluorouracil, epirubicin, and cyclophosphamide (FEC-75) followed by paclitaxel plus trastuzumab versus paclitaxel plus trastuzumab followed by FEC-75 plus trastuzumab as neoadjuvant treatment for patients with HER2-positive breast cancer (Z1041): a randomised, controlled, phase 3 trial Lancet Oncol 2013 14 1317 1325 24239210 \n36 Pernas S Gil-Gil M de Olza MO Gumà A Climent F Petit A Pla MJ García-Tejedor A López-Ojeda A Falo C Fernandez-Otega A Mesia C Pérez-Martin FJ Efficacy and safety of concurrent trastuzumab plus weekly paclitaxel-FEC as primary therapy for HER2-positive breast cancer in everyday clinical practice Breast Cancer Res Treat 2012 134 1161 1168 22772380 \n37 Gianni L Eiermann W Semiglazov V Manikhas A Lluch A Tjulandin S Zambetti M Vazquez F Byakhow M Lichinitser M Climent MA Ciruelos E Ojeda B Neoadjuvant chemotherapy with trastuzumab followed by adjuvant trastuzumab versus neoadjuvant chemotherapy alone, in patients with HER2-positive locally advanced breast cancer (the NOAH trial): a randomised controlled superiority trial with a parallel HER2-negative cohort Lancet 2010 375 377 384 20113825 \n38 Untch M Loibl S Bischoff J Eidtmann H Kaufmann M Blohmer JU Hilfrich J Strumberg D Fasching PA Kreienberg R Tesch H Hanusch C Gerber B Lapatinib versus trastuzumab in combination with neoadjuvant anthracycline-taxane-based chemotherapy (GeparQuinto, GBG 44): a randomised phase 3 trial Lancet Oncol 2012 13 135 144 22257523 \n39 Ismael G Hegg R Muehlbauer S Heinzmann D Lum B Kim SB Pienkowski T Lichinitser M Semiglazov V Melichar B Jackisch C Subcutaneous versus intravenous administration of (neo)adjuvant trastuzumab in patients with HER2- positive, clinical stage 1–111 breast cancer (HannaH study): a phase 3, open label, multicentre, randomised trial Lancet Oncol 2012 13 869 878 22884505 \n40 Rastogi P Anderson SJ Bear HD Geyer CE Kahlenberg MS Robidoux A Margolese RG Hoehn JL Vogel VG Dakhil SR Tamkus D King KM Pajon ER Preoperative chemotherapy: updates of National Surgical Adjuvant Breast and Bowel Project Protocols B-18 and B-27 J Clin Oncol 2008 26 778 785 18258986 \n41 He X Esteva FJ Ensor J Hortobagyi GN Lee MH Yeung SC Metformin and thiazolidinediones are associated with improved breast cancer-specific survival of diabetic women with HER2+ breast cancer Ann Oncol 2012 23 1771 1780 22112968 \n42 Guiu S Mouret Reynier MA Toure M Coudert B Predictive Factors of Response in HER2-Positive Breast Cancer Treated by Neoadjuvant Therapy J Oncol 2013 2013 854121 23737784 \n43 Pernas Simon S Neoadjuvant therapy of early stage human epidermal growth factor receptor 2 positive breast cancer: latest evidence and clinical implications Ther Adv Med Oncol 2014 6 210 221 25342988 \n44 Zhang B Hurvitz S Long-term outcomes of neoadjuvant treatment of HER2- positive breast cancer Clin Adv Hematol Oncol 2016 14 520 530 27379947 \n45 Guarneri V Frassoldati A Bottini A Cagossi K Bisagni G Sarti S Ravaioli A Cavanna L Giardina G Musolino A Untch M Orlando L Artioli F Boni C Preoperative chemotherapy plus trastuzumab, lapatinib, or both in human epidermal growth factor receptor 2-positive operable breast cancer: results of the randomized phase 11 CHER-LOB study J Clin Oncol 2012 30 1989 1995 22493419 \n46 Kim HJ Kwon H Lee JW Kim HJ Lee SB Park HS Sohn G Lee Y Koh BS Yu JH Son BH Ahn SH Metformin increases survival in hormone receptor-positive, HER2-positive breast cancer patients with diabetes Breast Cancer Res 2015 17 64 25935404 \n47 Sonnenblick A Agbor-Tarh D Bradbury I Di Cosimo S Azim HA Jr Fumagalli D Sarp S Wolff AC Andersson M Kroep J Cufer T Simon SD Salman P Impact of Diabetes, lnsulin, and Metformin Use on the Outcome of Patients With Human Epidermal Growth Factor Receptor 2-Positive Primary Breast Cancer: Analysis From the ALTTO Phase 111 Randomized Trial J Clin Oncol 2017 35 1421 1429 28375706 \n48 von Minckwitz G Untch M Blohmer JU Costa SD Eidtmann H Fasching PA Gerber B Eiermann W Hilfrich J Huober J Jackisch C Kaufmann M Konecny GE Definition and impact of pathologic complete response on prognosis after neoadjuvant chemotherapy in various intrinsic breast cancer subtypes J Clin Oncol 2012 30 1796 1804 22508812 \n49 Gianni L Pienkowski T Im YH Roman L Tseng LM Liu MC Lluch A Staroslawska E de la Haba-Rodríguez J Im SA Pedrini JL Poirier B Morandi P Efficacy and safety of neoadjuvant pertuzumab and trastuzumab in women with locally advanced, inflammatory, or early HER2- positive breast cancer (NeoSphere): a randomised multicentre, open-label, phase 2 trial Lancet Oncol 2012 13 25 32 22153890 \n50 Wuerstlein R Harbeck N Neoadjuvant therapy for HER2-positive breast cancer Rev Recent Clin Trials 2017 12 81 92 28164759 \n51 Robert F Fendri S Hary L Lacroix C Andréjak M Lalau JD Kinetics of plasma and erythrocyte metformin after acute administration in healthy subjects Diabetes Metab 2003 29 279 283 12909816 \n52 Chae YK Arya A Malecek MK Shin DS Carneiro B Chandra S Kaplan J Kalyan A Altman JK Platanias L Giles F Repurposing metformin for cancer treatment: current clinical studies Oncotarget 2016 7 40767 40780 10.18632/oncotarget.8194 27004404 \n53 MacKenzie MJ Ernst S Johnson C Winquist E A phase I study of temsirolimus and metformin in advanced solid tumours Invest New Drugs 2012 30 647 652 20978924 \n54 Kritharis A Caplain J Rajagopal S Grimm E Tsichlis PN Martell R Saif WM A phase I study of metformin and chemotherapy in salid tumors J Clin Oncol 2014 32 5 24190110 \n55 Penault-Llorca F Radosevic-Robin N Biomarkers of residual disease after neoadjuvant therapy for breast cancer Nat Rev Clin Oncol 2016 13 487 503 26856744 \n56 Havas KM Milchevskaya V Radic K Alladin A Kafkia E Garcia M Stolte J Klaus B Rotmensz N Gibson TJ Burwinkel B Schneeweiss A Pruneri G Metabolic shifts in residual breast cancer drive tumor recurrence J Clin Invest 2017 127 2091 2105 28504653 \n57 Seidman A Hudis C Pierri MK Shak S Paton V Ashby M Murphy M Stewart SJ Keefe D Cardiac dysfunction in the trastuzumab clinical trials experience J Clin Oncol 2002 20 1215 1221 11870163 \n58 Force T Krause DS Van Etten RA Molecular mechanisms of cardiotoxicity of tyrosine kinase inhibition Nat Rev Cancer 2007 7 332 344 17457301 \n59 Spector NL Yarden Y Smith B Lyass L Trusk P Pry K Hill JE Xia W Seger R Bacus SS Activation of AMP-activated protein kinase by human EGF receptor 2/EGF receptor tyrosine kinase inhibitor protects cardiac cells Proc Natl Acad Sci U S A 2007 104 10607 10612 17556544 \n60 Shell SA Lyass L Trusk PB Pry KJ Wappel RL Bacus SS Activation of AMPK is necessary for killing cancer cells and sparing cardiac cells Cell Cycle 2008 7 1769 1775 18594201 \n61 Zhang L He H Balschi JA Metformin and phenformin activate AMP-activated protein kinase in the heart by increasing cytosolic AMP concentration Am J Physiol Heart Circ Physiol 2007 293 H457 H466 17369473 \n62 Necela BM Axenfeld BC Serie DJ Kachergus JM Perez EA Thompson EA Norton N The antineoplastic drug, trastuzumab, dysregulates metabolites in iPSC-derived cardiomyocytes Clin Transl Med 2017 6 5 28101782 \n63 Schneeweiss A Chia S Hickish T Harvey V Eniu A Hegg R Tausch C Seo JH Tsai YF Ratnayake J McNally V Ross G Cortés J Pertuzumab plus trastuzumab in combination with standard neoadjuvant anthracycline-containing and anthracycline-free chemotherapy regimens in patients with HER2-positive early breast cancer: a randomized phase II cardiac safety study (TRYPHAENA) Ann Oncol 2013 24 2278 2284 23704196 \n64 Swain SM Baselga J Kim SB Ro J Semiglazov V Campone M Ciruelos E Ferrero JM Schneeweiss A Heeson S Clark E Ross G Benyunes MC Pertuzumab, trastuzumab, and docetaxel in HER2-positive metastatic breast cancer N Engl J Med 2015 372 724 734 25693012 \n65 Gyawali B Pantziarka P Crispino S Bouche G Does the oncology community have a rejection bias when it comes to repurposed drugs? Ecancermedicalscience 2018 12 ed76 29456622 \n66 Kordes S Pollak MN Zwinderman AH Mathôt RA Weterman MJ Beeker A Punt CJ Richel DJ Wilmink JW Metformin in patients with advanced pancreatic cancer: a double-blind, randomised, placebo-controlled phase 2 trial Lancet Oncol 2015 16 839 847 26067687 \n67 Reni M Dugnani E Cereda S Belli C Balzano G Nicoletti R Liberati D Pasquale V Scavini M Maggiora P Sordi V Lampasona V Ceraulo D (Ir)relevance of Metformin Treatment in Patients with Metastatic Pancreatic Cancer: An Open-Label, Randomized Phase II Trial Clin Cancer Res 2016 22 1076 1085 26459175 \n68 Menendez JA Quirantes-Piné R Rodríguez-Gallego E Cufí S Corominas-Faja B Cuyàs E Bosch-Barrera J Martin-Castillo B Segura-Carretero A Joven J Oncobiguanides: Paracelsus' law and nonconventional routes for administering diabetobiguanides for cancer treatment Oncotarget 2014 5 2344 2348 10.18632/oncotarget.1965 24909934 \n69 Menendez JA Martin-Castillo B Joven J Metformin and cancer: Quo vadis et cui bono? Oncotarget 2016 7 54096 54101 10.18632/oncotarget.10262 27356748 \n70 Pollak M Overcoming Drug Development Bottlenecks With Repurposing: Repurposing biguanides to target energy metabolism for cancer treatment Nat Med 2014 20 591 593 24901568 \n71 Berstein LM Metformin: not only per os Expert Rev Endocrinol Metab 2018 13 63 65 30058860 \n72 Suissa S Metformin to Treat Cancer: Misstep in Translational Research from Observational Studies Epidemiology 2017 28 455 458 28166103 \n73 Jung SH Randomized phase II trials with a prospective control Stat Med 2008 27 568 583 17573688\n\n", "fulltext_license": "CC BY", "issn_linking": "1949-2553", "issue": "9(86)", "journal": "Oncotarget", "keywords": "HER2; breast cancer; metformin; trastuzumab", "medline_ta": "Oncotarget", "mesh_terms": null, "nlm_unique_id": "101532965", "other_id": null, "pages": "35687-35704", "pmc": null, "pmid": "30479698", "pubdate": "2018-11-02", "publication_types": "D016428:Journal Article", "references": "19073504;25456737;23999444;18782901;20393934;17556544;25935404;22257523;19487376;28166103;27004404;22926251;19884247;20113825;11870163;7306436;29456622;21115425;22153890;27379947;24909934;20016287;27356748;20978924;18594201;26581908;25342988;28375706;21989078;22203527;24985407;22112968;20947488;22649152;19153119;26856744;24529560;15738535;20442309;23704196;24322659;22772380;19029956;20458531;26459175;28164759;24901568;17573688;24239210;25740979;20455996;23737784;19574203;19106626;22508812;28101782;28504653;22884505;12909816;20976543;26181139;26067687;25651170;22493419;18258986;20656475;30058860;22847511;17457301;25712686;25693012;17369473", "title": "A phase 2 trial of neoadjuvant metformin in combination with trastuzumab and chemotherapy in women with early HER2-positive breast cancer: the METTEN study.", "title_normalized": "a phase 2 trial of neoadjuvant metformin in combination with trastuzumab and chemotherapy in women with early her2 positive breast cancer the metten study" }
[ { "companynumb": "ES-PFIZER INC-2018482576", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "TRASTUZUMAB" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nEsophageal hemorrhage may occasionally develop subsequent to esophagitis and stasis ulcer, but potentially fatal esophageal bleeding is very uncommon in primary achalasia.\nWe describe a case of a 64-year-old man with long-standing achalasia and megaesophagus who presented acute episodes of life-threatening upper gastrointestinal bleeding.\nFive esophagogastroduodenoscopies (EGD) were conducted and during each large amount of static food, bloody material, and clots should be removed from the esophagus because of impaired esophageal transit. Eventually, diffuse multiple irregular ulcers were observed in the middle and lower portions of the esophagus that were presumed to have been caused by aspirin stasis based on considerations of previous drug use. EGD also revealed a 2.0 × 2.5 cm flat nodular lesion with central ulceration at the mid-to-lower esophagus and adherent blood clots suggestive of bleeding stigma. The biopsy specimen demonstrated esophageal cancer. Accordingly, a diagnosis of massive esophageal hemorrhage in long-standing achalasia complicated by squamous cell carcinoma, possibly triggered by acute mucosal irritation and ulcer caused by aspirin stasis, was made. The patient then successfully underwent the Ivor-Lewis operation. Resultantly, the tumor was diagnosed as moderately differentiated squamous cell carcinoma stage IIA (T2N0M0).\n\n\nRESULTS\nThe patient's postoperative course was uneventful, and no evidence of tumor recurrence or metastasis has been found during the 6 months of follow-up examination. He was tolerating normal food with only minimal reflux symptoms.\n\n\nCONCLUSIONS\nAlthough, fortunately in the described case, esophageal cancer was diagnosed at a relatively early stage because it is the acute presentation of life-threatening upper gastrointestinal bleeding, this report cautions that when symptoms of dysphagia are aggravated, taking drugs capable of acting as local irritants, such as aspirin, could cause fatal esophageal hemorrhage in achalasia.", "affiliations": "Division of Gastroenterology and Hepatology, Department of Internal Medicine, Yeungnam University College of Medicine, Daegu, Republic of Korea.", "authors": "Cho|Joon Hyun|JH|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/MD.0000000000016519", "fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 31348265MD-D-19-0068810.1097/MD.0000000000016519165194500Research ArticleClinical Case ReportMassive esophageal bleeding in long-standing achalasia complicated by esophageal carcinoma and aspirin-induced stasis ulcer Case reportCho Joon Hyun MD, PhD∗NA. Division of Gastroenterology and Hepatology, Department of Internal Medicine, Yeungnam University College of Medicine, Daegu, Republic of Korea.∗ Correspondence: Joon Hyun Cho, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Yeungnam University College of Medicine, 170 Hyeonchung-ro, Nam-gu, Daegu 42415, South Korea (e-mail: ygowgo96@yu.ac.kr).7 2019 26 7 2019 98 30 e1651924 1 2019 19 5 2019 25 6 2019 Copyright © 2019 the Author(s). Published by Wolters Kluwer Health, Inc.2019This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0Abstract\nRationale:\nEsophageal hemorrhage may occasionally develop subsequent to esophagitis and stasis ulcer, but potentially fatal esophageal bleeding is very uncommon in primary achalasia.\n\nPatient concerns:\nWe describe a case of a 64-year-old man with long-standing achalasia and megaesophagus who presented acute episodes of life-threatening upper gastrointestinal bleeding.\n\nDiagnoses and interventions:\nFive esophagogastroduodenoscopies (EGD) were conducted and during each large amount of static food, bloody material, and clots should be removed from the esophagus because of impaired esophageal transit. Eventually, diffuse multiple irregular ulcers were observed in the middle and lower portions of the esophagus that were presumed to have been caused by aspirin stasis based on considerations of previous drug use. EGD also revealed a 2.0 × 2.5 cm flat nodular lesion with central ulceration at the mid-to-lower esophagus and adherent blood clots suggestive of bleeding stigma. The biopsy specimen demonstrated esophageal cancer. Accordingly, a diagnosis of massive esophageal hemorrhage in long-standing achalasia complicated by squamous cell carcinoma, possibly triggered by acute mucosal irritation and ulcer caused by aspirin stasis, was made. The patient then successfully underwent the Ivor-Lewis operation. Resultantly, the tumor was diagnosed as moderately differentiated squamous cell carcinoma stage IIA (T2N0M0).\n\nOutcomes:\nThe patient's postoperative course was uneventful, and no evidence of tumor recurrence or metastasis has been found during the 6 months of follow-up examination. He was tolerating normal food with only minimal reflux symptoms.\n\nLessons:\nAlthough, fortunately in the described case, esophageal cancer was diagnosed at a relatively early stage because it is the acute presentation of life-threatening upper gastrointestinal bleeding, this report cautions that when symptoms of dysphagia are aggravated, taking drugs capable of acting as local irritants, such as aspirin, could cause fatal esophageal hemorrhage in achalasia.\n\nKeywords\nachalasiaesophageal canceresophageal hemorrhagestasis ulcerupper gastrointestinal bleedingOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nAchalasia is an idiopathic primary esophageal motor disorder with an estimated incidence of 1 in 100,000 and a prevalence of 1 in 10,000.[1] It is characterized by the absence of esophageal peristalsis and failure of the lower esophageal sphincter (LES) to relax on swallowing, which leads to an accumulation of food debris and fluid in a dilated esophagus. The etiology of achalasia has not been elucidated, and by nature the disease is progressive. Therefore, its treatment is substantially palliative and aims to relieve symptoms by lowering LES pressure, principally via pneumatic dilation or Heller myotomy, and thus, improving passive esophageal transit.[2]\n\nIf left untreated or treated improperly, achalasia causes progressive esophageal dilation, elongation, tortuosity, and loss of functionality and eventually leads to characteristic “sigmoidolichomegaesophagus.”[3] Important morbidities afflict patients with end-stage disease, such as pulmonary complications, malnutrition, disabling dysphagia, infections, esophagitis, esophageal-tracheal fistula, esophageal diverticula, and rarely, esophageal squamous cell carcinoma.[4] Furthermore, although it is infrequent, the development of esophageal hemorrhage subsequent to stasis and chronic mucosal irritation is possible.[5] However, fatal esophageal bleeding is extremely rare in primary achalasia. Here, we describe a case of life-threatening bleeding in a patient with “megaesophagus” in long-standing achalasia complicated by esophageal carcinoma and aspirin-induced stasis ulcer.\n\n2 Case presentation\nA 64-year-old man was admitted to our institution with an acute episode of hematemesis and melena. He had been diagnosed with achalasia 20 years previously at our institution, but had declined any treatment except intermittent irregular endoscopic follow-up. Although he experienced intermittent discomfort due to dysphagia for solids and liquids and regurgitation of retained food, he had tolerated these symptoms and had been able to live a relatively normal life. However, his dysphagia worsened recently, and for several days before visiting our emergency room, he had taken a 100 mg aspirin tablet daily in the belief that it might be good for his health. He had no notable medical history, other than achalasia, was a nonsmoker and nonalcohol drinker, and had no history of gastrointestinal bleeding.\n\nOn arrival at our emergency room, the patient was hypotensive and appeared acutely sick. His initial vital signs were temperature 37.1°C, blood pressure 90/60 mm Hg, heart rate 117 beats/min, respiratory rate 19/min, and oxygen saturation in room air 97%. A physical examination showed pale conjunctiva and nail beds due to anemia. An initial routine laboratory study showed anemia (red blood cell count 2.80 M/μL, hemoglobin 8.5 g/dL), acute renal impairment (creatinine 1.98 mg/dl, ureic nitrogen 38 mg/dl), hypoalbuminemia (serum albumin 3.1 g/dL), and neutrophilic leukocytosis (white blood cells 14.2 k/mL, neutrophils 84.1%). Other laboratory findings included platelets 336 k/mL and normal coagulation screening results. Chest X-ray showed an extremely enlarged esophagus occupying almost the entire right hemithorax with a proximal isolated air-fluid level and a food content like density. Thoracoabdominal computerized tomography confirmed the presence of marked esophageal dilatation with distal narrowing compatible with achalasia and also demonstrated a large amount of clotted blood in esophageal lumen and active extravasation at the mid-to-lower esophagus (Fig. 1). After immediate large volume resuscitation with vigorous intravenous fluids and packed red blood cells (RBCs), and nasogastric aspiration, the patient underwent emergent esophagogastroduodenoscopy (EGD). EGD revealed a large, twisted megaesophagus, and active oozing bleeding, large amounts of fresh blood clots, and food in the esophagus, which prevented visualization of the bleeding focus (Fig. 2A). Accordingly, an emergent surgical opinion was sought. However, the patient subsequently vomited large amounts of fresh blood and clots repeatedly and complained of dyspnea, and soon after that, cardiac arrest occurred about 11 hours after admission, despite intensive care in our emergency room. Endotracheal intubation, ventilation by Ambu bagging, and cardiac massage with intravenous vasopressors and inotropes were performed immediately and continued for 10 minutes, after which he was successfully resuscitated.\n\nFigure 1 Thoracic CT images. Initial axial (A) and coronal (B) CT images obtained at presentation showing marked esophageal dilatation compatible with achalasia, a large amount blood clots in esophageal lumen, and active extravasation at the mid-to-lower esophagus. CT = computed tomography.\n\nFigure 2 Endoscopy images. (A) Initial endoscopy image obtained at presentation showing active bleeding with large amounts of fresh blood and blood clots in a markedly dilated esophagus; (B) Endoscopy image obtained on hospital day 3 showing diffuse multiple irregular ulcers in the middle and lower portions of the esophagus; (C) Endoscopy image obtained on hospital day 5 showing a flat nodular lesion with central ulceration and adherent blood clots at the mid-to-lower esophagus; (D) Endoscopy image obtained on hospital day 13 showing a 2.0 × 2.5 cm sized, poorly demarcated, flat nodular lesion with central ulceration accompanied by surrounding reddish mucosal irregularity at the mid-to-lower esophagus (30–33 cm from upper incisors) on white light images (D-1) and narrow band images (D-2).\n\nOn hospital day 2, the patient presented ongoing melena and repeat EGD was performed. However, we failed to locate the bleeding focus and perform endoscopic hemostasis due to large amounts of blood, blood clots, and food material. On hospital day 3, repeat EGD still showed large amounts of fresh blood and clots, but after removing them as much as possible by endoscopic suction and using a snare, we were able to identify diffuse multiple irregular ulcers in the middle and lower portions of the esophagus (Fig. 2B). However, it was difficult to define the bleeding focus because the endoscopic visual field was limited by the large amount of blood and blood clots present. Intensive supportive care involving vigorous intravenous fluid resuscitation, packed RBC transfusion, intravenous high-dose proton-pump inhibitors, nil-per-os, and total parenteral nutrition was continued. Thereafter, the amount of melena reduced and vital signs stabilized.\n\nOn hospital day 5, after removing as much stagnant material and blood as possible, follow-up EGD revealed diffuse, multiple, shallow healing stage ulcers with exudate in the middle and lower portions of the esophagus and a flat nodular lesion with central ulceration at mid-to-lower esophagus (30–33 cm from upper incisor teeth) (Fig. 2C). Adherent red blood clots on a flat nodular lesion suggested bleeding stigma, but no active bleeding was observed. Endoscopic biopsy was deferred due to bleeding concerns. The next day, he was successfully weaned off mechanical ventilation and the endotracheal tube was removed. Thereafter, he presented intermittent small amounts of melena and laboratory studies showed only a slight fall in serum hemoglobin.\n\nOn hospital day 13, after blood clot removal, follow-up EGD revealed an approximately 2.0 × 2.5 cm sized, poorly demarcated, flat nodular lesion with central ulceration accompanied by surrounding reddish mucosal irregularity at the mid-to-lower esophagus (Fig. 2D). No specific abnormalities except chronic superficial gastritis in stomach (including cardia) were observed. Endoscopic biopsy specimens showed moderately differentiated squamous cell carcinoma. Subsequent positron emission tomography/computed axial tomography demonstrated mild FDG uptake in the mid-to-lower esophagus and no other hypermetabolic lesion (Fig. 3).\n\nFigure 3 Position emission tomography/computed axial tomography image. The image shows mild FDG uptake at the mid-to-lower esophagus.\n\nRadical esophagectomy was planned to treat the esophageal malignancy, and the patient underwent an Ivor–Lewis operation successfully. Histopathologic examination of the resected esophagus revealed moderately differentiated squamous cell carcinoma with keratin pearl formation that invaded the proper muscle layer (Fig. 4). The tumor was diagnosed as stage IIA (T2, N0, M0) according to the tumor node metastasis classification for esophageal cancer,[6] and was of histopathological grade G2 (moderately differentiated). The patient's postoperative course was uneventful, and he was discharged 10 days after surgery. He has since been followed up for 6 months at our outpatient department without any evidence of tumor recurrence or metastasis. He was tolerating normal food with only minimal reflux symptoms.\n\nFigure 4 Histology of the surgically-resected esophagus. (A) H&E staining showed the tumor invaded proper muscle layer (original magnification ×10), and (B) moderately differentiated squamous cell carcinoma with keratin pearl formation (original magnification ×200).\n\n3 Discussion\nAchalasia is a relatively rare disorder of unknown etiology characterized by failure of LES relaxation and loss of peristalsis along the esophageal body.[7] Its predominant symptoms include dysphagia for solids and liquids, alimentary regurgitation, and bad breath. Even adequate treatment with sufficient symptom control may not prevent persistent esophageal distension with food and fluid retention, bacterial overgrowth, and impaired clearance of regurgitated acidic gastric contents. Furthermore, these phenomena can lead to chronic inflammation of esophageal mucosa, which potentially increases epithelial susceptibility to carcinogens produced by bacteria[8–10] and the risks of hyperplasia, dysplasia, and squamous cell carcinoma.[11] In addition, treatment modalities that lower LES pressure on aperistaltic esophagi with poor acid clearance can aggravate gastroesophageal acid reflux and lead to Barrett's metaplasia[12] and adenocarcinoma.[13,14] However, despite these proposed mechanisms, the precise risk of esophageal cancer development in patients with achalasia remain unclear. Several recent well-designed studies have shown the risk of cancer appears to be 10 to 50 times higher than in the general population.[15,16] The co-occurrence of achalasia and esophageal cancer was first noted by Fagge in 1872.[17] Achalasia has frequently been reported to predispose the development of esophageal squamous cell carcinoma, to the extent that the relation between achalasia and esophageal squamous cell carcinoma appears to be well-established.[7,18–20]\n\nThe problem of detecting esophageal cancer in patients with achalasia may be that the dilated esophagus readily compensates for partial obstruction of the lumen by a tumor. Furthermore, patients usually adapt to dysphagia to some extent, and consequently, if endoscopic surveillance is not properly performed, esophageal cancer is often diagnosed at an advanced stage. Thus, the prognosis of “achalasia-carcinoma” is considered poor.[9] However, fortunately in the described case, esophageal cancer was diagnosed at a relatively early stage in end-stage achalasia because it is unexpected acute presentation of life-threatening upper gastrointestinal bleeding.\n\nAlthough the development of esophageal bleeding subsequent to stasis and chronic mucosal irritation is possible,[5] the presentation of life-threatening hemorrhage in primary achalasia is very uncommon. Few cases of massive bleeding have been reported in patients with esophageal involvement by an underlying disease, such as esophagitis due to cytomegalovirus colonization[21] or esophageal varix.[22] Other reports of massive bleeding in achalasia have involved bleeding from an esophagopulmonary fistula as a complication of stasis ulcer[23] and bleeding in non-Hodgkin's esophageal lymphoma.[24] Thus, the described case of massive bleeding associated with esophageal cancer and acute mucosal irritation and ulcer caused by drug stasis in achalasia is very rare.\n\nCauses of ulceration in achalasia include stasis ulcer, pill esophagitis, and malignancies.[25] In the described case, the patient had adapted to intermittent discomfort by dysphagia, refused treatment, and was not regularly followed-up. Furthermore, when his symptoms worsened, he had self-administered aspirin for several days before he initially presented with hematemesis. It would appear that retained aspirin and stasis over an atonic esophagus may have caused acute mucosal irritation on already vulnerable, hypertrophic, and hypervascular esophageal mucosa, and that this had led to mucosal ulceration and bleeding. The development of neoplasms may, of course, facilitate bleeding over tumoral mucosa, which is usually more friable and atrophic, but massive bleeding from a tumor as was observed in the described case remains exceptional.\n\n4 Conclusion\nThis report describes a case of massive esophageal hemorrhage in a patient with long-standing achalasia complicated by squamous cell carcinoma, possibly triggered by acute mucosal irritation and ulcer caused by aspirin stasis. Although achalasia is progressive in nature and even adequate treatment may not prevent persistent esophageal distension, relieving symptoms by improving passive esophageal transit by lowering LES pressure (eg, by pneumatic dilation) might reduce acute mucosal irritation and ulcer development by drug stasis such as aspirin or nonsteroidal anti-inflammatory drugs. Although, fortunately in the described case, esophageal cancer was diagnosed at a relatively early stage because it is the acute presentation of life-threatening upper gastrointestinal bleeding, this case cautions that when symptoms of dysphagia are aggravated in patients with achalasia, taking a drug that could act as a local irritant, such as aspirin, increases the risk of fatal esophageal hemorrhage.\n\nAuthor contributions\nConceptualization: Joon Hyun Cho.\n\nData curation: Joon Hyun Cho.\n\nInvestigation: Joon Hyun Cho.\n\nResources: Joon Hyun Cho.\n\nWriting – original draft: Joon Hyun Cho.\n\nWriting – review and editing: Joon Hyun Cho.\n\nJoon Hyun Cho orcid: 0000-0002-3584-6300.\n\nAbbreviation: EGD = esophagogastroduodenoscopy.\n\nInformed written consent was obtained from the patient for publication of this case report and accompanying images.\n\nThis work was supported by a Yeungnam University Research Grant (2019).\n\nThe authors have no conflicts of interest to disclose.\n==== Refs\nReferences\n[1] Birgisson S Richter JE \nAchalasia in Iceland, 1952-2002: an epidemiologic study . Dig Dis Sci \n2007 ;52 :1855–60 .17420933 \n[2] Richter JE \nOesophageal motility disorders . Lancet \n2001 ;358 :823–8 .11564508 \n[3] Ellis FG \nThe natural history of achalasia of the cardia . Proc R Soc Med \n1960 ;53 :663–6 .13820027 \n[4] Eckardt VF Hoischen T Bernhard G \nLife expectancy, complications, and causes of death in patients with achalasia: results of a 33-year follow-up investigation . Eur J Gastroenterol Hepatol \n2008 ;20 :956–60 .18787460 \n[5] Dietrich BL Stein HJ Bartels H \nAchalasia and esophageal cancer: incidence, prevalence and prognosis . World J Surg \n2001 ;25 :745–9 .11376410 \n[6] Rice TW Ishwaran H Ferguson MK \nCancer of the esophagus and esophagogastric junction: an eighth edition staging primer . J Thorac Oncol \n2017 ;12 :36–42 .27810391 \n[7] Streitz JM JrEllis FH JrGibb SP \nAchalasia and squamous cell carcinoma of the esophagus: analysis of 241 patients . Ann Thorac Surg \n1995 ;59 :1604–9 .7771859 \n[8] Aggestrup S Holm JC Soresen HR \nDoes achalasia predispose to cancer of the esophagus? \nChest \n1992 ;102 :1013–6 .1395735 \n[9] Ribeiro U JrPosner MC Safatle-Ribeiro AV \nRisk factors for squamous cell carcinoma of the oesophagus . Br J Surg \n1996 ;83 :1174–85 .8983603 \n[10] Minami H Yamaguchi N Matsushima K \nImprovement of endocytoscopic findings after per oral endoscopic myotomy (POEM) in esophageal achalasia; does POEM reduce the risk of developing esophageal carcinoma? Per oral endoscopic myotomy, endocytoscopy and carcinogenesis . BMC Gastroenterol \n2013 ;13 :22.23363448 \n[11] Loviscek LF Cenoz MC Badaloni AE \nEarly cancer in achalasia . Dis Esophagus \n1998 ;11 :239–47 .10071806 \n[12] Csendes A Braghetto I Burdiles P \nVery late results of esophagomyotomy for patients with achalasia: clinical, endoscopic, histologic, manometric, and acid reflux studies in 67 patients for a mean follow-up of 190 months . Ann Surg \n2006 ;243 :196–203 .16432352 \n[13] Guo JP Gilman PB Thomas RM \nBarrett's esophagus and achalasia . J Clin Gastroenterol \n2002 ;34 :439–43 .11907357 \n[14] Ellis FH JrGibb SP Balogh K \nEsophageal achalasia and adenocarcinoma in Barret's esophagus: a report of two cases and a review of the literature . Dis Esophagus \n1997 ;10 :55–60 .9079276 \n[15] Leeuwenburgh I Scholten P Alderliesten J \nLong-term esophageal cancer risk in patients with primary achalasia: a prospective study . Am J Gastroenterol \n2010 ;105 :2144–9 .20588263 \n[16] Zaninotto G Rizzetto C Zambon P \nLong-term outcome and risk of oesophageal cancer after surgery for achalasia . Br J Surg \n2008 ;95 :1488–94 .18991316 \n[17] Fagge CH \nA case of simple stenosis of the oesophagus, followed by epithelioma . Guy's Hosp Rep \n1872 ;17 :413.\n[18] Brucher BL Stein HJ Bartels H \nAchalasia and esophageal cancer: incidence, prevalence, and prognosis . World J Surg \n2001 ;25 :745–9 .11376410 \n[19] Meijssen MA Tilanus HW van Blankenstein M \nAchalasia complicated by oesophageal squamous cell carcinoma: a prospective study in 195 patients . Gut \n1992 ;33 :155–8 .1541408 \n[20] Sandler RS Nyren O Ekbom A \nThe risk of esophageal cancer in patients with achalasia. A population-based study . JAMA \n1995 ;274 :1359–62 .7563560 \n[21] Featherstone RJ Camero LG Khatib R \nMassive esophageal bleeding in achalasia complicated by cytomegalovirus esophagitis . Ann Thorac Surg \n1995 ;59 :1021–2 .7695381 \n[22] Kraft AR Frank HA Glotzer DJ \nAchalasia of the esophagus complicated by varices and massive hemorrhage . N Engl J Med \n1973 ;288 :405–6 .4539687 \n[23] Tan JT Dudi-Venkata NN Neelankavil SI \nA bleeding esophagopulmonary fistula: rare complication of stasis ulcer in refractory achalasia . Surg Laparosc Endosc Percutan Tech \n2014 ;24 :e77–9 .24686369 \n[24] del Pozo Garcia AJ García Buey L Llorca I \nRelapsing upper bleeding in non-Hodgkin's oesophageal lymphoma associated with achalasia . Eur J Gastroenterol Hepatol \n2003 ;15 :1127–30 .14501623 \n[25] Kikendall JW \nPill esophagitis . J Clin Gastroenterol \n1999 ;28 :298–305 .10372925\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0025-7974", "issue": "98(30)", "journal": "Medicine", "keywords": null, "medline_ta": "Medicine (Baltimore)", "mesh_terms": "D016145:Endoscopy, Digestive System; D004931:Esophageal Achalasia; D004938:Esophageal Neoplasms; D006471:Gastrointestinal Hemorrhage; D006801:Humans; D008297:Male; D008875:Middle Aged", "nlm_unique_id": "2985248R", "other_id": null, "pages": "e16519", "pmc": null, "pmid": "31348265", "pubdate": "2019-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Massive esophageal bleeding in long-standing achalasia complicated by esophageal carcinoma and aspirin-induced stasis ulcer: Case report.", "title_normalized": "massive esophageal bleeding in long standing achalasia complicated by esophageal carcinoma and aspirin induced stasis ulcer case report" }
[ { "companynumb": "KR-SUN PHARMACEUTICAL INDUSTRIES LTD-2019RR-220078", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadd...
{ "abstract": "A 21-year-old man developed idiopathic trigeminal neuralgia, and was admitted to our hospital. Although neuralgia was promptly resolved after oral carbamazepine (CBZ) administration, he developed arterial hypertension (from 110/60 mmHg to 170/126 mmHg) followed by consciousness disturbance several days after the initiation of carbamazepine. MRI T2-weighted, FLAIR and ADC images demonstrated transient hyperintense lesions of the bilateral fronto-parieto-occipital subcortical white matter. These lesions showed isointensity on diffusion-weighted images. Since these alterations suggested the presence of vasogenic edema induced by hypertension, we diagnosed him as having reversible posterior leukoencephalopathy syndrome (RPLS) induced by hypertension. Persistent hypertension despite the administration of various anti-hypertension drugs finally improved after oral CBZ therapy was discontinued. Therefore, we considered that hypertension was induced by oral CBZ therapy. This is a rare case in which high blood pressure was caused by CBZ. There is no previous report of RPLS induced by CBZ administration. Further investigation to determine whether CBZ is capable of causing arterial hypertension is warranted.", "affiliations": "Department of Neurology, Gunma University Graduate School of Medicine.", "authors": "Furuta|Natsumi|N|;Fujita|Yukio|Y|;Sekine|Akiko|A|;Ikeda|Masaki|M|;Okamoto|Koichi|K|", "chemical_list": "D000927:Anticonvulsants; D002220:Carbamazepine", "country": "Japan", "delete": false, "doi": "10.5692/clinicalneurol.49.191", "fulltext": null, "fulltext_license": null, "issn_linking": "0009-918X", "issue": "49(4)", "journal": "Rinsho shinkeigaku = Clinical neurology", "keywords": null, "medline_ta": "Rinsho Shinkeigaku", "mesh_terms": "D000927:Anticonvulsants; D002220:Carbamazepine; D006801:Humans; D006973:Hypertension; D008279:Magnetic Resonance Imaging; D008297:Male; D054038:Posterior Leukoencephalopathy Syndrome; D014277:Trigeminal Neuralgia; D055815:Young Adult", "nlm_unique_id": "0417466", "other_id": null, "pages": "191-3", "pmc": null, "pmid": "19462818", "pubdate": "2009-04", "publication_types": "D004740:English Abstract; D016428:Journal Article", "references": null, "title": "Reversible posterior leukoencephalopathy syndrome associated with carbamazepine-induced hypertension.", "title_normalized": "reversible posterior leukoencephalopathy syndrome associated with carbamazepine induced hypertension" }
[ { "companynumb": "JP-WOCKHARDT BIO AG-2022WBA000061", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CARBAMAZEPINE" }, "drugadditional": "...
{ "abstract": "Fever of unknown origin and the clinical picture of thrombotic microangiopathy (TMA) are diagnostic challenges in the early period after kidney transplantation. Here, we report a case of human monocytic ehrlichiosis in a renal allograft recipient who presented with fever and clinical picture of TMA in the first month post-kidney transplant. Despite broad coverage with multiple antimicrobial agents, fever and hematological abnormalities persisted for several days. A history of contact exposure and living in an endemic area raised clinical suspicion for human monocytic ehrlichiosis (HME), and empiric treatment with doxycycline was initiated. Definitive diagnosis of HME was confirmed by polymerase chain reaction (PCR) for Ehrlichia chaffeensis. Human ehrlichiosis should be considered within the differential diagnosis in kidney transplant recipients with the clinical picture of TMA and fever of unknown origin. Furthermore, early treatment with doxycycline enhances rapid resolution of clinical and laboratory recovery.", "affiliations": "Division of Nephrology, Department of Medicine, University of Tennessee Health Science Center, Memphis, TN, USA.;James D. Eason Transplant Institute, Methodist University Hospital, Memphis, TN, USA.;James D. Eason Transplant Institute, Methodist University Hospital, Memphis, TN, USA.;Division of Nephrology, Department of Medicine, University of Tennessee Health Science Center, Memphis, TN, USA.", "authors": "Hassan|Waleed|W|;Talwar|Manish|M|;Balaraman|Vasanthi|V|;Molnar|Miklos Z|MZ|https://orcid.org/0000-0002-9665-330X", "chemical_list": "D004318:Doxycycline", "country": "Denmark", "delete": false, "doi": "10.1111/tid.13305", "fulltext": null, "fulltext_license": null, "issn_linking": "1398-2273", "issue": "22(5)", "journal": "Transplant infectious disease : an official journal of the Transplantation Society", "keywords": "ehrlichiosis; kidney transplant", "medline_ta": "Transpl Infect Dis", "mesh_terms": "D003937:Diagnosis, Differential; D004318:Doxycycline; D018469:Ehrlichia chaffeensis; D016873:Ehrlichiosis; D006801:Humans; D016030:Kidney Transplantation; D057049:Thrombotic Microangiopathies", "nlm_unique_id": "100883688", "other_id": null, "pages": "e13305", "pmc": null, "pmid": "32358827", "pubdate": "2020-10", "publication_types": "D002363:Case Reports", "references": null, "title": "Ehrlichiosis infection mimicking thrombotic microangiopathy syndrome early after kidney transplantation.", "title_normalized": "ehrlichiosis infection mimicking thrombotic microangiopathy syndrome early after kidney transplantation" }
[ { "companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-20-52963", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PRAMIPEXOLE" }, "d...
{ "abstract": "BACKGROUND\nIn autologous stem cell transplant (ASCT)-eligible myeloma patients, prolonged induction does not necessarily improve the depth of response.\n\n\nMETHODS\nWe analyzed 1222 ASCT patients who were classified based on (a) the interval between induction and stem cell collection, (b) the type of induction regimen: BID (Bortezomib, IMiDs, and Dexamethasone), Bortezomib-based, or CTD (Cyclophosphamide, Thalidomide, and Dexamethasone), and (c) the time to best response (Early ie, best response within 4 or 5 months, depending on the regimen vs Late; Good ie, VGPR or better vs Poor).\n\n\nRESULTS\nThe length of induction treatment required to achieve a Good response did not affect PFS (P = .65) or OS (P = .61) post-ASCT. The three types of regimen resulted in similar outcomes: median PFS 31, 27.7 and 30.8 months (P = .31), and median OS 81.7, 92.7, and 77.4 months, respectively (P = .83). On multivariate analysis, neither the type nor the duration of the induction regimen affected OS and PFS, except for Early Good Responders who had a better PFS compared to Early Poor Responders (HR = 1.21, P-value = .02). However, achieving a Good response at induction was associated with a better response (≥VGPR) post-transplant.\n\n\nCONCLUSIONS\nThe kinetics of response did not affect outcomes.", "affiliations": "Sorbonne Université, INSERM, UMR_S 938, Centre de Recherche Saint-Antoine- Team Proliferation and Differentiation of Stem Cells, Assistance Publique-Hôpitaux de Paris, Hôpital Pitié Salpêtrière, Service d'Hématologie, Paris, France.;Department of Biology, Tor Vergata University, Rome.;Department of Biology, Tor Vergata University, Rome.;Institut Paoli Calmettes, Marseilles, France.;Hucknall Road, Nothinghall, UK.;Dél-pesti Centrumkórház - Országos Hematológiai és Infektológiai Intézet, Budapest, Hungary.;Centre for Haematology, Imperial College, London, UK.;CHU Nantes, Nantes, France.;Umea University Hospital, Umea, Sweden.;Hope Directorate St James's Hospital, Dublin, Ireland.;University Hospital Brno, Brno, Czech Republic.;Skanes University Hospital, Lund, Sweden.;Hospital Universitario Central de Asturias, Oviedo, Spain.;ICO-Hospital Duran I Reynals, Barcelona, Spain.;The Medical University of Warsaw, Warsaw, Poland.;Cliniques Universitaires St Luc, Brussels, Belgium.;Charles University Hospital, Prague, Czech Republic.;Chaim Sheba Medical Center, Tel-Hashomer, Israel.;C.R.O IRCCS Aviano, Aviano, Italy.;Fundeni Clinical Institute, Bucarest, Romania.;EBMT Data Office, Leiden, Netherlands.;Department of Haematology, Trinity College Dublin, St. James's Hospital, Dublin 8, Ireland.;Ankara University Faculty of Medicine, Ankara, Turkey.;Medical Department V, University Hospital Heidelberg, Heidelberg, Germany.;University Hospital of Lille, Inserm, CHU Lille, INSERM, Infinite, Lille, France.", "authors": "Garderet|Laurent|L|https://orcid.org/0000-0002-6138-8112;Sbianchi|Giulia|G|;Iacobelli|Simona|S|;Blaise|Didier|D|;Byrne|Jenny L|JL|;Remenyi|Peter|P|;Apperley|Jane F|JF|;Touzeau|Cyrille|C|;Isaksson|Cecilia|C|;Browne|Paul|P|;Mayer|Jiri|J|;Lenhoff|Stig|S|;Gonzalez Muniz|Soledad|S|;Parody Porras|Rocio|R|;Basak|Grzegorz|G|;Poire|Xavier|X|https://orcid.org/0000-0003-1897-0227;Trneny|Marek|M|;Nagler|Arnon|A|;Michieli|Mariagrazia|M|;Tanase|Alina|A|https://orcid.org/0000-0003-3075-499X;Koster|Linda|L|;Hayden|Patrick J|PJ|https://orcid.org/0000-0003-1374-4503;Beksac|Meral|M|;Schönland|Stefan|S|;Yakoub-Agha|Ibrahim|I|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1111/ejh.13602", "fulltext": null, "fulltext_license": null, "issn_linking": "0902-4441", "issue": "106(5)", "journal": "European journal of haematology", "keywords": "autologous transplantation; induction regimen; kinetics of response; multiple myeloma", "medline_ta": "Eur J Haematol", "mesh_terms": null, "nlm_unique_id": "8703985", "other_id": null, "pages": "708-715", "pmc": null, "pmid": "33580608", "pubdate": "2021-05", "publication_types": "D016428:Journal Article", "references": null, "title": "Prognostic impact of early-versus-late responses to different induction regimens in patients with myeloma undergoing autologous hematopoietic cell transplantation: Results from the CALM study by the CMWP of the EBMT.", "title_normalized": "prognostic impact of early versus late responses to different induction regimens in patients with myeloma undergoing autologous hematopoietic cell transplantation results from the calm study by the cmwp of the ebmt" }
[ { "companynumb": "FR-TAKEDA-2021TUS045648", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "THALIDOMIDE" }, "drugadditional": "3", ...
{ "abstract": "To examine the nature and frequency of ocular side effects due to systemic target therapy with BRAF and MEK inhibitors as well as immunotherapy with cytotoxic T-lymphocyte antigen 4 (CTLA-4) and programmed cell death 1 (PD-1) monoclonal antibodies used in the treatment of cutaneous malignant melanoma (CMM).\nWhile proven effective in cancer treatment, target therapy and immunotherapy have been associated with ocular side effects likely due to their ability to alter the immune privilege of the eye. We conducted a retrospective chart review of patients undergoing target and immunotherapy for CMM and documented all associated eye findings.\nWe reviewed the records of 34 patients receiving target and immunotherapy for CMM who were examined in the academic ophthalmology clinic between 2012 and 2017.\nOcular side effects were present in 41.1% of patients in this study with 14.7% presenting with uveitis. Patients undergoing therapy with either vemurafenib only or dabrafenib/trametinib combination therapies comprised 70.5% of the study cohort. Ocular side effects occurred in 45.5% and 46.1% of patients on vemurafenib and dabrafenib/trametinib combination therapy, respectively. About 47.5% of males presented with ocular side effects compared to 30.5% of females. Notably, 13/14 patients with ocular symptoms recovered.\nThis study highlights the frequency of ocular side effects in patients treated with target therapy and immunotherapy for CMM and shows that symptom resolution can be effectively achieved with proper ophthalmic care. Further research is required to answer whether cessation of these therapies is mandatory during ophthalmic treatment.", "affiliations": "Department of Ophthalmology, Eugene and Marilyn Glick Eye Institute, Indiana University School of Medicine, Indianapolis, IN, USA.;Department of Ophthalmology, Icahn School of Medicine at Mount Sinai Hospital, New York, NY, USA.;Department of Ophthalmology, Eugene and Marilyn Glick Eye Institute, Indiana University School of Medicine, Indianapolis, IN, USA.;Department of Ophthalmology, Eugene and Marilyn Glick Eye Institute, Indiana University School of Medicine, Indianapolis, IN, USA.;Department of Ophthalmology, Eugene and Marilyn Glick Eye Institute, Indiana University School of Medicine, Indianapolis, IN, USA.;Department of Ophthalmology, Icahn School of Medicine at Mount Sinai Hospital, New York, NY, USA.;Department of Ophthalmology, Icahn School of Medicine at Mount Sinai Hospital, New York, NY, USA.", "authors": "Eikenberry|Jennifer|J|https://orcid.org/0000-0002-1787-6645;Harris|Alon|A|;Torabi|Rana|R|;Lang|Matthew|M|;Denney|Derek|D|;Verticchio Vercellin|Alice|A|;Siesky|Brent|B|", "chemical_list": "D048493:Proto-Oncogene Proteins B-raf", "country": "United States", "delete": false, "doi": "10.1177/1120672120930688", "fulltext": null, "fulltext_license": null, "issn_linking": "1120-6721", "issue": "31(3)", "journal": "European journal of ophthalmology", "keywords": "Tumors; diseases of ocular surface; immunology; uvea; uveitis", "medline_ta": "Eur J Ophthalmol", "mesh_terms": "D005260:Female; D006801:Humans; D007167:Immunotherapy; D008297:Male; D008545:Melanoma; D048493:Proto-Oncogene Proteins B-raf; D012189:Retrospective Studies; D012878:Skin Neoplasms", "nlm_unique_id": "9110772", "other_id": null, "pages": "1391-1398", "pmc": null, "pmid": "32476450", "pubdate": "2021-05", "publication_types": "D016428:Journal Article", "references": null, "title": "Ocular side effects of target therapy and immunotherapy in patients with cutaneous malignant melanoma.", "title_normalized": "ocular side effects of target therapy and immunotherapy in patients with cutaneous malignant melanoma" }
[ { "companynumb": "US-009507513-2111USA000058", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PEMBROLIZUMAB" }, "drugadditional": "3", ...
{ "abstract": "Few cases of programmed death-ligand 1 inhibitor-induced scleroderma have been reported and their clinical features remain unpublished. Optimal management is, therefore, unknown and an autoantibody association has yet to be identified. We present the case of a female in her 60s who developed skin thickening after starting atezolizumab for metastatic non-small cell lung cancer. Skin biopsy 7 months after symptom onset showed histological changes consistent with scleroderma. Anti-PM/SCL-75 antibody was positive. Atezolizumab was discontinued and treatment was started with mycophenolate mofetil. After 5 months, she experienced mild improvement in skin thickening. Earlier identification of this complication may limit morbidity in this disease process, which otherwise has limited treatment options. In suspected cases, obtaining scleroderma-associated autoantibodies may help with earlier diagnosis.", "affiliations": "Department of Rheumatology, Allegheny Health Network, Pittsburgh, Pennsylvania, USA.;Department of Internal Medicine, Allegheny Health Network, Pittsburgh, Pennsylvania, USA varun.chalasani@ahn.org.;Department of Pathology, Allegheny Health Network, Pittsburgh, Pennsylvania, USA.;Department of Rheumatology, Allegheny Health Network, Pittsburgh, Pennsylvania, USA.", "authors": "Grant|Christon|C|;Chalasani|Varun|V|;Uchin|Jeffrey M|JM|;Dore|Adam|A|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C000594389:atezolizumab", "country": "England", "delete": false, "doi": "10.1136/bcr-2021-244968", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "14(11)", "journal": "BMJ case reports", "keywords": "chemotherapy; connective tissue disease; lung cancer (oncology); oncology; rheumatology", "medline_ta": "BMJ Case Rep", "mesh_terms": "D061067:Antibodies, Monoclonal, Humanized; D002289:Carcinoma, Non-Small-Cell Lung; D005260:Female; D006801:Humans; D008175:Lung Neoplasms; D012594:Scleroderma, Localized", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "34764112", "pubdate": "2021-11-11", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Atezolizumab-induced scleroderma: a rare complication.", "title_normalized": "atezolizumab induced scleroderma a rare complication" }
[ { "companynumb": "US-ROCHE-2959753", "fulfillexpeditecriteria": "1", "occurcountry": null, "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ATEZOLIZUMAB" }, "drugadditional": "1", "dru...
{ "abstract": "Drug-associated thrombocytopenia is often unrecognized. We report a 76-year-old female with lymphoma who presented with easy bruising and oral bleeding. She had undergone screening for hepatitis B virus (HBV) prior to starting rituximab and was found to have hepatitis B core serum antibody (IgG anti-HBc). She was therefore treated with prophylactic entecavir 0.5 mg daily to prevent reactivation of HBV. Her initial platelet count was 136,000/mm3. Five days after starting entecavir, she presented with bruising and oral bleeding and was found to have a platelet count of 7,000/mm3. A coagulation profile and the rest of the blood parameters (RBC and WBC counts) were normal. Entecavir was stopped, and she was given 3 units of apheresed platelets followed by intravenous immunoglobulin (1 g/kg) for 5 consecutive days. Her platelet counts improved and normalized in one week. She was diagnosed with entecavir-induced thrombocytopenia based on the temporal relationship and after carefully excluding alternate causes of thrombocytopenia. This case highlights the importance of recognizing drug-induced thrombocytopenia (DITP) as a reversible cause of thrombocytopenia.", "affiliations": "Department of Internal Medicine, Texas Health Presbyterian Hospital, Dallas, Texas 75231, USA.;Department of Internal Medicine, Division of Hematology and Oncology, Texas Health Presbyterian Hospital, Dallas, Texas 75231, USA.;Department of Internal Medicine, Texas Health Presbyterian Hospital, Dallas, Texas 75231, USA.", "authors": "Yohannan|Binoy|B|0000-0003-0207-329X;Luu|Dai Chu N|DCN|;Feldman|Mark|M|0000-0003-4448-3991", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2019/4319148", "fulltext": "\n==== Front\nCase Rep HematolCase Rep HematolCRIHEMCase Reports in Hematology2090-65602090-6579Hindawi 10.1155/2019/4319148Case ReportEntecavir-Associated Thrombocytopenia: A Case Report and Review of the Pathophysiology, Diagnosis, and Treatment of a Rare but Reversible Cause of Thrombocytopenia http://orcid.org/0000-0003-0207-329XYohannan Binoy \n1\nLuu Dai Chu N. \n2\nhttp://orcid.org/0000-0003-4448-3991Feldman Mark markfeldman@texashealth.org\n1\n\n1Department of Internal Medicine, Texas Health Presbyterian Hospital, Dallas, Texas 75231, USA\n2Department of Internal Medicine, Division of Hematology and Oncology, Texas Health Presbyterian Hospital, Dallas, Texas 75231, USAAcademic Editor: Marie-Christine Kyrtsonis\n\n2019 12 3 2019 2019 43191486 11 2018 19 2 2019 Copyright © 2019 Binoy Yohannan et al.2019This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Drug-associated thrombocytopenia is often unrecognized. We report a 76-year-old female with lymphoma who presented with easy bruising and oral bleeding. She had undergone screening for hepatitis B virus (HBV) prior to starting rituximab and was found to have hepatitis B core serum antibody (IgG anti-HBc). She was therefore treated with prophylactic entecavir 0.5 mg daily to prevent reactivation of HBV. Her initial platelet count was 136,000/mm3. Five days after starting entecavir, she presented with bruising and oral bleeding and was found to have a platelet count of 7,000/mm3. A coagulation profile and the rest of the blood parameters (RBC and WBC counts) were normal. Entecavir was stopped, and she was given 3 units of apheresed platelets followed by intravenous immunoglobulin (1 g/kg) for 5 consecutive days. Her platelet counts improved and normalized in one week. She was diagnosed with entecavir-induced thrombocytopenia based on the temporal relationship and after carefully excluding alternate causes of thrombocytopenia. This case highlights the importance of recognizing drug-induced thrombocytopenia (DITP) as a reversible cause of thrombocytopenia.\n==== Body\n1. Introduction\nThe most common side effects of entecavir therapy for hepatitis B virus (HBV) include headache, fatigue, dizziness, nausea, and vomiting. Very rarely, patients can develop lactic acidosis and hepatic steatosis. Although other nucleoside analogues with activity against HBV such as lamivudine [1] and adefovir [2] have been associated with drug-induced thrombocytopenia, the incidence is very low with entecavir. Here, we report a case of an elderly female with serological evidence of past HBV infection who developed severe thrombocytopenia with bleeding after she had received entecavir for 5 days. This is the second case report of entecavir-induced thrombocytopenia.\n\n2. Case Presentation\nA 76-year-old female presented with a 2-day history of easy bruising and bleeding from her mouth. She denied epistaxis, melena, hematochezia, hematuria, or other bleeding manifestations. She had estrogen receptor positive stage 1 breast cancer 24 years ago for which she underwent lumpectomy followed by tamoxifen for 5 years. She has had regular mammograms since then, and there has been no evidence of local disease recurrence. Fourteen years ago, she was diagnosed with Waldenstrom's macroglobulinemia for which she was treated with chlorambucil and prednisone for 3 months with significant improvement. Her plasma cell dyscrasia has been quiescent. M-spike on serum protein electrophoresis was minimal. She had intermittent hospitalizations for pneumonia, thought to be related to functional immunoglobulin deficiency. She was on intravenous immunoglobulin replacement for 6 months, but it was discontinued later. Three years ago, she presented with pleural and pericardial effusions, and pleural biopsy showed activated B-cell (ABC) diffuse large B-cell lymphoma (DLBCL). A PET scan showed uptake in the pleural space with no lymphadenopathy. A bone marrow biopsy showed no evidence of DLBCL, and she was treated with rituximab and bendamustine for 3 months and remained in remission for the next three years. Four weeks prior to the current admission, she presented with fatigue, night sweats, and 10-pound weight loss and was found to have retroperitoneal lymphadenopathy. She underwent CT-guided core biopsy of the retroperitoneal nodes that confirmed recurrence of her DLBCL. A repeat bone marrow biopsy showed normocellular bone marrow with progressive trilineage hematopoiesis, but no evidence of DLBCL. She was scheduled to start salvage therapy for DLBCL with rituximab and lenalidomide. Viral hepatitis serologies were performed prior to initiation of rituximab, showing evidence of prior hepatitis B infection (IgG anti-HBc antibody). She was therefore started on prophylactic entecavir 0.5 mg daily 5 days prior to the current admission. Other medical problems included diabetes mellitus, hypertension, atrial fibrillation, gout, hypothyroidism, hyperlipidemia, and osteoporosis. Her other medications besides entecavir included allopurinol, amiodarone, rosuvastatin, diltiazem, pantoprazole, dabigatran, ramipril, and levothyroxine. No recent change in these medications had occurred.\n\nOn physical examination, her temperature was 98.3°F with blood pressure 100/68 mmHg, pulse 90 beats per min, and respiratory rate 18 per minute. She looked tired but had no pallor, icterus, or generalized lymphadenopathy. The anterior nares were clear without epistaxis. Mucous membranes were moist, and the oropharynx revealed two scabs in the buccal mucosa with dried blood. She had normal S1 and S2 without any rubs, murmurs or gallops, and normal vesicular breath sounds. Her abdomen was soft and nontender without hepatosplenomegaly or ascites. Skin was warm and dry without petechia, purpura, or ecchymosis. The rest of the physical exam was unremarkable. Complete blood count showed thrombocytopenia with a platelet count of 7000/mm3. Peripheral blood smear showed no evidence of platelet clumping. The hemoglobin and white blood cell counts were normal. Thyroid function tests and a coagulation profile were essentially normal. Her last recorded platelet count 10 days prior to starting entecavir was 136,000/mm3. Her baseline platelet count range is between 120,000 and 150,000/mm3. Entecavir was discontinued, but her other drugs were continued. She received 3 units of platelets followed by intravenous immunoglobulin (1 g/kg) for 5 consecutive days. Her platelet counts improved and normalized in one week (Figure 1). She then received lenalidomide and rituximab for her DLBCL, but did not receive any HBV prophylaxis as it was considered unsafe to expose her to any of the other nucleoside analogues.\n\n3. Discussion\nPatients with chronic hepatitis B or serological evidence of past infection are at risk for viral reactivation when treated with immunosuppressive therapy. B-cell depleting agents such as rituximab have the highest risk of HBV reactivation [3, 4]. The nucleos(t)ide analogues such as entecavir (ETV) and tenofovir can be used for HBV prophylactic therapy, and it should be continued for at least 12 months for those receiving B-cell depleting agents [5]. ETV, a guanine nucleoside analogue, has been associated with thrombocytopenia in only one case report in which an elderly female with hepatitis B cirrhosis suffered from severe thrombocytopenia after she received ETV therapy; and this was successfully treated by discontinuation of entecavir and intravenous immunoglobulin [6]. Clinicians should consider drug-induced thrombocytopenia (DITP) in the differential diagnosis of a patient on ETV therapy presenting with unexplained isolated thrombocytopenia. DITP can mimic primary immune thrombocytopenia (ITP); however, differentiating these syndromes is important to avoid unnecessary immunosuppressive treatments and to avoid future exposure to the sensitizing drug. Hence, it is important for clinicians to be aware of this adverse drug event and have a general understanding of the common drugs associated with thrombocytopenia. Drugs commonly implicated as triggers of DITP include heparin, quinine, glycoprotein IIb IIIa inhibitors, gold salts, antibiotics (e.g., linezolid, rifampin, sulfonamides, and vancomycin), antiepileptics (e.g., carbamazepine, phenytoin, and valproic acid), analgesics (e.g., acetaminophen, diclofenac, and naproxen), diuretics (e.g., hydrochlorothiazide and chlorothiazide), and chemotherapeutic agents including proteasome inhibitors [7, 8]. DITP can be either nonimmune or immune-mediated. Nonimmune DITP can be secondary to bone marrow suppression (e.g., cytotoxic chemotherapy and linezolid) or inhibition of proplatelet formation in megakaryocytes (proteasome inhibitors) [9]. Immune-mediated thrombocytopenia in the presence of certain drugs can be explained by the following mechanisms: (a) classic drug-dependent platelet antibodies (quinine-type); (b) hapten-induced platelet antibodies (e.g., penicillin); (c) fiban-dependent antibodies (e.g., tirofiban); (d) fragments antigen binding monoclonal antibodies (e.g., abciximab); and (e) drug-induced autoantibody formation (e.g., gold). Drug-induced autoantibodies can either attach firmly to the epitopes on the platelet surface and cause accelerated destruction or target the megakaryocyte causing immune-mediated suppression of platelet production [10–12]. These autoantibodies can also affect the other cell lines including neutrophils and red blood cells causing neutropenia and immune hemolytic anemia, respectively [13].\n\nClinicians should elicit a detailed drug exposure history to establish the diagnosis of DITP, specifically enquiring about prescription drugs, over the counterdrugs, herbal preparations, certain foods, and beverages [7]. There is no definitive diagnostic test for DITP, but instead DITP is usually diagnosed by the temporal association of exposure to a suspected drug with an acute, severe thrombocytopenia, with the nadir platelet counts often less than 20,000/mm3 [11, 14]. Patients are often exposed to the sensitizing drug for about 5–7 days, but DITP can also occur following intermittent use of a drug over a long time period. Glycoprotein IIb IIIa inhibitors such as abciximab can cause severe thrombocytopenia within 1 or 2 days, even with the first exposure to the drug [15]. George et al. [8] proposed 4 clinical criteria and level of evidence to help establish the likelihood that a specific drug is responsible for thrombocytopenia (Table 1). Our patient met 3 of these criteria and thus probably had DITP. Furthermore, she had had a bone marrow biopsy ten days prior to the presentation, the megakaryocyte morphology was normal, and she had no evidence of malignant marrow infiltration. Autoimmune thrombocytopenia is a common hematologic complication of B-cell lymphomas and could potentially confound thrombocytopenia in this patient, but the temporal association with entecavir exposure and quick resolution after discontinuation of the drug favors DITP. Except for heparin, testing for drug-induced autoantibodies is not widely available and hence not helpful in clinical decision-making. Drug metabolites produced in vivo can act as a sensitizing agent, and thus, even in cases of typical DITP, antibody testing against the parent drug can be negative [16]. If the clinical suspicion is strong for DITP, reexposure to the suspected drug can be considered to document drug sensitivity. However, in sensitized individuals, a conventional dose can cause severe thrombocytopenia and bleeding. Therefore, if rechallenge is considered, one should start with a very low dose and closely monitor platelet counts and clinical status [17]. In cases of DITP, once the offending drug is discontinued, symptoms usually resolve quickly, and the platelet count returns to normal in less than a week. Prolonged thrombocytopenia after discontinuation of the suspected drug is evidence against a causal role for that drug.\n\nThe clinical presentation of DITP can vary from asymptomatic thrombocytopenia to life-threatening hemorrhage. Patients may have epistaxis, gum bleeding, oral mucous membrane blood blisters, melena, hematochezia, and hematuria when the platelet count drops below 20,000/mm3, and deaths from bleeding have been reported [14]. Most patients with mild to moderate DITP can be managed conservatively with discontinuation of the offending drugs and closely monitoring the platelet count. When there is uncertainty about the causative drug, all medications should be discontinued [7]. Patients with severe thrombocytopenia and bleeding manifestations are at high risk for life-threatening hemorrhage and should be managed aggressively with platelet transfusions [12]. The role of glucocorticoids in patients with DITP is controversial, and there is no evidence that it improves clinical outcomes. Nevertheless, glucocorticoids are often used in unexplained isolated thrombocytopenia, since ITP cannot be easily excluded. When DITP is strongly suspected, it is appropriate to stop glucocorticoid therapy abruptly after the platelet count returns to normal. In DITP, plasma exchange [18] and intravenous immune globulins [19] have been used in patients with severe thrombocytopenia and bleeding manifestations, but the benefit of these treatments is uncertain [12].\n\nOnce drug sensitivity is documented, autoantibodies persist for life, and patients should be advised to avoid the drug in future, and this should be documented in their medical records as a serious “allergy.”\n\n4. Conclusion\nEntecavir-induced thrombocytopenia is a reversible cause of thrombocytopenia potentially mediated via numerous immune and nonimmune mechanisms. Clinicians should maintain a high index of clinical suspicion for DITP in the patient presenting with severe thrombocytopenia soon after starting entecavir and quick resolution after discontinuing the drug. Early recognition and prompt discontinuation of entecavir is critical to avoid life-threatening hemorrhage.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nFigure 1 Course of drug-induced immune thrombocytopenia in a patient treated with entecavir. Entecavir was prescribed for prophylaxis to prevent HBV reactivation before initiating rituximab therapy. Starting from day 5 of treatment, the patient reported having easy bruising and bleeding from the oral cavity. She came to the office on day 7, and her platelet count was 7000 per cubic millimeter. Entecavir was discontinued immediately, and 3 units of apheresed platelets and IV immunoglobulin were given (days 7–11). The platelet counts improved and normalized in a week.\n\nTable 1 Clinical criteria and levels of evidence for evaluation of patients with suspected drug-induced thrombocytopenia.\n\n\nClinical criteria\n\t\n(1) Drug administration preceded thrombocytopenia; complete and sustained recovery from thrombocytopenia is noted after drug discontinuation\t\n(2) Other drugs administered prior to thrombocytopenia were continued or reintroduced after discontinuation of the suspected drug\t\n(3) Other etiologies of thrombocytopenia excluded\t\n(4) Reexposure to the drug resulted in recurrent thrombocytopenia\t\n\n\n\t\n\nLevels of evidence\n\t\n(1) Definite: all 4 criteria met\t\n(2) Probable: criteria 1–3 met\t\n(3) Possible: criterion 1 met\t\n(4) Unlikely: criterion 1 not met\t\nAdapted from http://www.ouhsc.edu/platelets and Reference [6].\n==== Refs\n1 Lebensztejn D. Kaczmarski M. Lamivudine-associated thrombocytopenia American Journal of Gastroenterology 2002 97 10 2687 2688 10.1016/s0002-9270(02)04421-0 2-s2.0-0036790638 12385471 \n2 Stornaiuolo G. Amato A. Gaeta G. Adefovir dipivoxil-associated thrombocytopenia in a patient with chronic hepatitis B Digestive and Liver Disease 2006 38 3 211 212 10.1016/j.dld.2005.05.015 2-s2.0-33746065359 16464651 \n3 Huang Y. H. Hsiao L. T. Hong Y. C. Randomized controlled trial of entecavir prophylaxis for rituximab-associated hepatitis B virus reactivation in patients with lymphoma and resolved hepatitis B Journal of Clinical Oncology 2013 31 22 2765 2772 10.1200/jco.2012.48.5938 2-s2.0-84884755581 23775967 \n4 Yeo W. Chan T. C. Leung N. W. Y. Hepatitis B virus reactivation in lymphoma patients with prior resolved hepatitis B undergoing anticancer therapy with or without rituximab Journal of Clinical Oncology 2009 27 4 605 611 10.1200/jco.2008.18.0182 2-s2.0-59149085061 19075267 \n5 Seto W. K. Chan T. S. Y. Hwang Y. Y. Hepatitis B reactivation in patients with previous hepatitis B virus exposure undergoing rituximab-containing chemotherapy for lymphoma: a prospective study Journal of Clinical Oncology 2014 32 33 3736 3743 10.1200/jco.2014.56.7081 2-s2.0-84911424291 25287829 \n6 Fan X. Chen L. Yang J. Feng P. Entecavir-associated thrombocytopenia in a decompensated cirrhotic patient Medicine 2016 95 12 p. e3103 10.1097/md.0000000000003103 2-s2.0-84962142306 \n7 Aster R. H. Bougie D. W. Drug-induced immune thrombocytopenia New England Journal of Medicine 2007 357 6 580 587 10.1056/NEJMra066469 2-s2.0-34547789273 17687133 \n8 George J. N. Raskob G. E. Shah S. R. Drug-induced thrombocytopenia Annals of Internal Medicine 1998 129 11 886 90 10.7326/0003-4819-129-11_part_1-199812010-00009 9867731 \n9 Murali K. Kowata S. Bortezomib induces thrombocytopenia by the inhibition of proplatelet formation of megakaryocytes European Journal of Haematology 2014 93 4 290 296 10.1111/ejh.12342 2-s2.0-84908491869 24750292 \n10 Freiman J. P. Fatal quinine-induced thrombocytopenia Annals of Internal Medicine 1990 112 4 308 309 10.7326/0003-4819-112-4-308 2-s2.0-0025099105 2297210 \n11 Aster R. H. Curtis B. R. McFarland J. G. Bougie D. W. Drug-induced immune thrombocytopenia: pathogenesis, diagnosis, and management Journal of Thrombosis and Haemostasis 2009 7 6 911 918 10.1111/j.1538-7836.2009.03360.x 2-s2.0-65849492850 19344362 \n12 Aster R. Michelson A. D. Drug-induced thrombocytopenia Platelets 2007 New York, NY, USA Academic Press \n13 Arndt P. A. Garratty G. The changing spectrum of drug-induced immune hemolytic anemia Seminars in Hematology 2005 42 3 137 144 10.1053/j.seminhematol.2005.04.004 2-s2.0-22544464411 16041663 \n14 Curtis B. R. Drug-induced immune thrombocytopenia: incidence, clinical features, laboratory testing, and pathogenic mechanisms Immunohematology 2014 30 2 55 65 25247620 \n15 Aster R. H. Immune thrombocytopenia caused by glycoprotein IIb/IIIa inhibitors Chest 2005 127 2 53S 59S 10.1378/chest.127.2_suppl.53s 2-s2.0-13544250803 15706031 \n16 Bougie D. Aster R. Immune thrombocytopenia resulting from sensitivity to metabolites of naproxen and acetaminophen Blood 2001 97 12 3846 3850 10.1182/blood.v97.12.3846 2-s2.0-0035877976 11389025 \n17 Shulman N. R. Immunoreactions involving platelets: IV. Studies on the pathogenesis of thrombocytopenia in drug purpura using test doses of quinidine in sensitized individuals; their implications in idiopathic thrombocytopenic purpura Journal of Experimental Medicine 1958 107 5 711 729 10.1084/jem.107.5.711 2-s2.0-0003159902 13525581 \n18 Pourrat O. Treatment of drug-related diseases by plasma exchanges Annales de Médecine Interne (Paris) 1994 145 357 60 \n19 Ray J. B. Brereton W. F. Nullet F. R. Intravenous immune globulin for the treatment of presumed quinidine-induced thrombocytopenia DICP 1990 24 7-8 693 695 10.1177/106002809002400706 2-s2.0-0025331161 1695793\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-6579", "issue": "2019()", "journal": "Case reports in hematology", "keywords": null, "medline_ta": "Case Rep Hematol", "mesh_terms": null, "nlm_unique_id": "101576456", "other_id": null, "pages": "4319148", "pmc": null, "pmid": "30993023", "pubdate": "2019", "publication_types": "D002363:Case Reports", "references": "11389025;12385471;13525581;15706031;16041663;16464651;1695793;17687133;19075267;19344362;2297210;23775967;24750292;25247620;25287829;27015182;7985949;9867731", "title": "Entecavir-Associated Thrombocytopenia: A Case Report and Review of the Pathophysiology, Diagnosis, and Treatment of a Rare but Reversible Cause of Thrombocytopenia.", "title_normalized": "entecavir associated thrombocytopenia a case report and review of the pathophysiology diagnosis and treatment of a rare but reversible cause of thrombocytopenia" }
[ { "companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2019-041982", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ROSUVASTATIN" }, "druga...
{ "abstract": "We present the case of a 71-year-old man with history of smoking, pulmonary emphysema, hypertension, multivessel coronary artery disease and prior coronary artery bypass graft surgery who presented with spontaneous right-sided pneumothorax associated with phasic changes of the QRS amplitude on the electrocardiogram. While several case reports have described QRS amplitude changes associated with left-sided pneumothorax, reports of phasic ECG changes in right-sided pneumothorax are exceedingly rare. Such changes, when present in a patient with sudden onset chest pain and dyspnea, should prompt a diagnostic workup for possible pneumothorax.", "affiliations": "Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.;Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.;Faculty of Medicine, University of Medicine and Pharmacy \"Iuliu Hatieganu\", 400000 Cluj-Napoca, Romania.;Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.;Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.;\"Leon Daniello\" Clinical Hospital of Pulmonology, 400020 Cluj-Napoca, Romania.;Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.;Faculty of Medicine, University of Medicine and Pharmacy \"Iuliu Hatieganu\", 400000 Cluj-Napoca, Romania.;Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania.", "authors": "Florescu|Lavinia Maria|LM|;Țentea|Călina-Patricia|CP|;Eötvös|Csilla-Andrea|CA|;Lazar|Roxana-Daiana|RD|;Zehan|Iulia-Georgiana|IG|;Sabha|Wissam|W|;Pop|Sorin|S|;Todea|Doina Adina|DA|0000-0003-1306-2350;Blendea|Dan|D|0000-0002-4137-8582", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3390/diagnostics11061069", "fulltext": "\n==== Front\nDiagnostics (Basel)\nDiagnostics (Basel)\ndiagnostics\nDiagnostics\n2075-4418\nMDPI\n\n34200664\n10.3390/diagnostics11061069\ndiagnostics-11-01069\nCase Report\nUsefulness of the Electrocardiogram in a Patient Presenting with Right-Sided Pneumothorax and Presyncope\nFlorescu Lavinia Maria 12\nȚentea Călina-Patricia 12\nEötvös Csilla-Andrea 23\nLazar Roxana-Daiana 12\nZehan Iulia-Georgiana 12\nSabha Wissam 4\nPop Sorin 1\nhttps://orcid.org/0000-0003-1306-2350\nTodea Doina Adina 24†\nhttps://orcid.org/0000-0002-4137-8582\nBlendea Dan 12*†\nAnnoni Andrea D. Academic Editor\n1 Cluj County Emergency Hospital, 400020 Cluj-Napoca, Romania; lavinia.florescu94@yahoo.ro (L.M.F.); tenteapatricia@yahoo.it (C.-P.Ț.); daiana.pocol@yahoo.com (R.-D.L.); iuliazehan@gmail.com (I.-G.Z.); popsorin98@gmail.com (S.P.)\n2 Faculty of Medicine, University of Medicine and Pharmacy “Iuliu Hatieganu”, 400000 Cluj-Napoca, Romania; csilla.andrea18@gmail.com (C.-A.E.); doina_adina@yahoo.com (D.A.T.)\n3 “Niculae Stancioiu” Heart Institute, 400020 Cluj-Napoca, Romania\n4 “Leon Daniello” Clinical Hospital of Pulmonology, 400020 Cluj-Napoca, Romania; wisssiii@gmail.com\n* Correspondence: dblendea1@gmail.com; Fax: +40-1-860-812-2109\n† D.A.T. and D.B. have contributed equally to this work.\n\n10 6 2021\n6 2021\n11 6 106912 5 2021\n07 6 2021\n© 2021 by the authors.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).\nWe present the case of a 71-year-old man with history of smoking, pulmonary emphysema, hypertension, multivessel coronary artery disease and prior coronary artery bypass graft surgery who presented with spontaneous right-sided pneumothorax associated with phasic changes of the QRS amplitude on the electrocardiogram. While several case reports have described QRS amplitude changes associated with left-sided pneumothorax, reports of phasic ECG changes in right-sided pneumothorax are exceedingly rare. Such changes, when present in a patient with sudden onset chest pain and dyspnea, should prompt a diagnostic workup for possible pneumothorax.\n\nelectrocardiogram\npneumothorax\nsyncope\ncase report\n==== Body\n1. Introduction\n\nPneumothorax (PTX) has been estimated to occur spontaneously with an incidence of 14/100,000 in men and 3/100,000 in women [1,2]. Risk factors include smoking, previous PTX, and male sex [2,3]. Iatrogenic PTX can occur in approximately 1.9% of percutaneous thoracic needle biopsies and 1.3% of cardiac implantable device procedures [4,5].\n\nPresenting symptoms are usually sudden onset chest pain and dyspnea, and the diagnosis can be confirmed by chest X-ray, lung ultrasound, or computed tomography, all of which can accurately detect the presence of air in the pleural cavity [6]. However, in a significant number of cases, the presentation is nonspecific and some of these tests may be delayed or not performed at all. Irrespective of the specificity of the clinical presentation, most patients with chest pain will have an electrocardiogram (ECG) upon presentation. Therefore, it is worth exploring the different ECG patterns that occur in patients with PTX, like the one we are presenting.\n\nECG abnormalities in PTX have rarely been reported. Most of these reports referred to patients with large, left-sided PTX and the ECG findings were relatively nonspecific and included low voltage QRS complexes, PR segment shifts, ST segment shifts, inverted T waves, loss of R waves in the precordial leads, and right axis deviation. Another ECG change, which seems more specific to PTX, is represented by phasic ECG changes in QRS amplitude [7,8,9,10,11,12,13,14].\n\nReports in the literature of ECG changes in right-sided pneumothoraces like the one we are presenting are exceedingly rare [15].\n\n2. Case Presentation\n\n2.1. Patient Information and Timeline\n\nA 71-year-old man with a history of smoking, severe pulmonary emphysema, hypertension, multivessel coronary artery disease, prior coronary artery bypass graft surgery was admitted to the hospital for an episode of right-sided chest pain, dyspnea, and presyncope. The episode occurred in the morning when the patient, while standing up from the bed and having a rightward rotation of the torso, experienced suddenly an intense right-sided chest pain perceived like “an explosion” and followed by moderate dyspnea at rest. Subsequently, while having intense chest pain, the patient became diaphoretic, severely lightheaded, then presyncopal and fell back into the bed. The chest pain persisted, worsened with the slightest movement, and was radiating from the right side to the left side of the chest.\n\nHis home medications included aspirin, valsartan, clonidine, furosemide and spironolactone combination (dose recently increased), bisoprolol, atorvastatin, and sublingual nitroglycerin.\n\n2.2. Clinical Findings\n\nUpon presentation to the emergency department the blood pressure was 140/90 mmHg, which dropped to 110/70 mmHg with orthostasis, and the pulse rate was 90 beats/min. His oxygen saturation was 86% in room air and 90% on 3 L/min of supplemental O2 via nasal cannula. On physical examination, jugular venous pressure was 5 cm H2O, breath sounds were diminished bilaterally especially on the right, with no rales. The heart sounds were regular, with no murmurs, rubs or gallops. His peripheral pulses were palpable with no peripheral edema.\n\n2.3. Diagnostic Assessment and Therapeutic Intervention\n\nHis laboratory workup revealed no elevation in serum troponin I or d-dimers, normal values of serum electrolytes, renal function tests, and blood count. Arterial blood gases on three liters per minute of oxygen via nasal canula were: pO2 64.7 mmHg, pCO2 33.3 mmHg, and pH 7.41. The electrocardiogram (ECG) showed sinus rhythm 96 beats/min, frontal plane QRS axis of 12°, PR 140 ms, QRS 92 ms, QTc 362 ms. There were marked phasic QRS voltage changes observed especially in lead V2 and lead III, with lower frequency modulation, which appeared to be timed with respiratory movements. The electrocardiogram also revealed isolated very low QRS voltage (<0.3 mV) in lead III (Figure 1 green arrow) [16].\n\nThere were no acute ST-T abnormalities. While having recurrences of chest pain the patient experienced other episodes of lightheadedness and presyncope. The corresponding rhythm on the ECG monitor was sinus rhythm with no arrhythmia noted. Given the sudden onset chest pain and dyspnea, the patient underwent chest computed tomography, which revealed a large right-sided PTX, measuring 8 cm at the level of the hilum (Figure 2A). In addition, the structure of the lungs was abnormal, with bullous emphysema noted bilaterally (Figure 2B). Thoracic surgery was consulted urgently. A chest tube was inserted in the right chest under local anesthesia, and it was placed to suction. The patient experienced immediate symptomatic improvement. Phasic changes in the QRS amplitude noted on the initial electrocardiogram were significantly diminished after the chest tube was placed (Figure 3). To note also that the isolated very low voltage QRS complexes were present constantly in lead III. An echocardiogram revealed mild mitral regurgitation and left atrial enlargement, paradoxical septal motion consistent with prior coronary artery bypass surgery, and a left ventricular ejection fraction of 55%.\n\nOver the following days, however, there was poor lung expansion confirmed on subsequent chest X-rays (Figure 4).\n\nThe patient underwent open thoracic surgery. Intraoperatively, a perforated bulla was found at the right middle lobe and was thought to be the source of the PTX. Given this finding, bullectomy and talc pleurodesis was performed (Figure 5) [17]. Repeat imaging showed resolution of the PTX, and the patient was discharged home after several days of recovery.\n\n2.4. Final Diagnosis\n\nGiven this presentation our diagnosis was: large right PTX caused by spontaneous rupture of an emphysematous bulla, and presyncope probably due to a vasovagal reflex.\n\n3. Discussion\n\nThis is a case that displayed two unexpected ECG changes in a patient presenting with chest pain and presyncope.\n\n3.1. Phasic Variations in the QRS Complex Amplitude\n\nPrevious cases of ECG alterations involving left-sided spontaneous PTX have been reported, encompassing different types of ECG changes: phasic voltage alternation of the QRS complex, low voltage QRS complexes, PR segment shifts, ST segment shifts, inverted T waves, loss of R waves in the precordial leads, and right axis deviation [7,8,9,10,11,12,13,14]. Among these changes the most consistently reported were the phasic QRS voltage changes in relationship with the respiratory movements. While most reports have described ECG changes in patients with left-sided PTX, there are a few reports of ECG alterations associated with right-sided PTX as well [15,18]. One possible mechanism behind the voltage alternation of the QRS complexes is the change in the position of the heart within the thoracic cavity with respiration [3]. This could lead to the registration of QRS complexes of variable voltage, reflecting the variable distance between the heart and the thoracic surface generated by the intrathoracic pressure alterations secondary to the PTX. Another possible hypothesis involves the interposition of the newly formed air cavity between the heart and the precordial electrodes from surface that could diminish the electrical conductance of the generated electrical potentials during inhalation, resulting a fixed pattern of QRS amplitude oscillation according to the breathing phases.\n\nWe have displayed in Figure 6 a hypothesis regarding the mechanism behind the phasic QRS amplitude changes in our patient. The heart had a relatively midline position, with a counterclockwise rotation, as displayed on the initial ECG, with a transition zone between V1 and V2. The large right-sided PTX caused significant atelectasis of the right lung. As a consequence of the atelectatic right lung, during inspiration, there was more air entering the left lung, displaced the heart towards the right, bringing the septum and apex of the heart more towards lead V1 with an increase in QRS amplitude during inspiration. Given the relatively midline positioned septum and apex in this counterclockwise rotated heart, the opposite was happening in lead V2, with a decrease of the QRS amplitude during the inspiratory effort. During expiration, due to the leftward shift of the apex and septum towards V2, the QRS voltage was decreasing in lead V1 and increasing in lead V2.\n\nPTX can occur spontaneously or can be a complication of different procedures including electrophysiologic procedures like implantation of cardiac implantable electronic devices. The decision to place a chest tube is usually made based on symptoms and signs like dyspnea, hypotension, diminished breath sounds on the affected side distended neck veins, in conjunction with other variables like respiratory rate and oxygen saturation [19]. The presence of phasic variations in QRS amplitude, which has only reported cases with a large PTX, could have additional value when making the decision to place a chest tube.\n\n3.2. Isolated Very Low Amplitude QRS Complex in Frontal Leads\n\nThe exact mechanism of the presyncopal episode in our patient is not known. However, given the onset during intense pain, the association with diaphoresis, occurrence in a patient with a degree of intravascular volume depletion in the setting of diuretic therapy suggests a reflex mechanism. A degree of reduction of the venous return secondary to the compression caused by the PTX might have played a role as well. An ECG finding recently found to occur in patients with reflex syncope, and to be associated with positivity of tilt table testing as well as risk of syncope recurrence is the presence of isolated very low voltage in the frontal leads [16,20,21]. Our patient has isolated very low amplitude (<0.3 mV) QRS complexes in lead III before and after chest tube placement (Figure 1 and Figure 3).\n\n3.3. Limitations\n\nGiven that the rarity of case reports and the lack of original research studies on ECG changes in right-sided pneumothorax it is difficult to assess the diagnostic accuracy of these ECG abnormalities.\n\n3.4. Summary and Future Perspectives\n\nReports of ECG changes in PTX, like the one presented here, are extremely rare. This may be due to the rarity of such occurrence, or, more likely is related to the lack of awareness about ECG abnormalities in such patients. This case presentation could represent a stimulus for more research in this field.\n\n4. Conclusions\n\nWe have described a case of a right-sided pneumothorax associated with presyncope presenting with phasic changes in the QRS amplitude in the precordial leads. Such changes, when present in a patient with sudden onset chest pain and dyspnea, should prompt a diagnostic workup for possible pneumothorax. The workup for PTX needs to be done urgently since the ECG changes seem to be associated with large air collections with potential for hemodynamic deterioration\n\nAuthor Contributions\n\nConceptualization, L.M.F., D.A.T., S.P. and D.B.; methodology, L.M.F., I.-G.Z., S.P., and D.B.; data collection, L.M.F., C.-P.Ț., C.-A.E., R.-D.L., I.-G.Z., W.S., S.P. and D.B.; writing—original draft preparation, L.M.F., R.-D.L., W.S., S.P., D.A.T. and D.B.; writing—review and editing, L.M.F., C.-P.Ț., C.-A.E., R.-D.L., I.-G.Z., W.S., S.P., D.A.T. and D.B.; supervision, W.S., S.P., D.A.T. and D.B. All authors have read and agreed to the published version of the manuscript.\n\nFunding\n\nThis research received no external funding.\n\nInstitutional Review Board Statement\n\nNot applicable.\n\nInformed Consent Statement\n\nWritten informed consent has been obtained from the patient to publish this paper.\n\nData Availability Statement\n\nNot applicable.\n\nConflicts of Interest\n\nThe authors declare no conflict of interest.\n\nFigure 1 The electrocardiogram on admission. Voltage expressed in millivolts is displayed under each QRS complex. Phasic variations of the QRS amplitude seen in lead V2 with the minimum voltage (blue arrow) during inspiration and maximum voltage (red arrow) during expiration. Isolated low QRS voltage is seen in lead III (green arrow).\n\nFigure 2 Transverse unenhanced chest CT scan revealing a large right-sided pneumothorax (green arrow) with compressive atelectasis of the right lung and emphysematous changes in both lungs (A); multiple bullae due to the underlying emphysema were noted in the left (red arrows) as well as the right lung in addition to the right-sided pneumothorax (B).\n\nFigure 3 A 12-lead electrocardiogram recorded after chest tube placement. Isolated very low voltage is still seen in lead III (green arrow).\n\nFigure 4 Posteroanterior chest X-ray showing limited expansion of the right lung day 4 after placement of the chest tube.\n\nFigure 5 Intraoperatively a perforated bulla (green arrow) was found at the right middle lobe and was treated with bullectomy and talc pleurodesis.\n\nFigure 6 Possible mechanism for the phasic changes in QRS complex voltage noted on lead V1 and V2 on the initial 12-lead electrocardiogram. QRS voltages expressed in millivolts are shown under each beat. Both direction and magnitude of change of the QRS voltage are displayed. Red arrows point to an increase in voltage, while blue arrows depict a decrease in voltage. The complex with maximum and minimum voltage is depicted with “Max” and “Min” labels, respectively. The magnitude of change measured as percent change between the complex with minimum voltage and maximum voltage is shown on the right side of the tracing on a yellow label (A); A mechanistic hypothesis that could explain the phasic QRS complex changes. As a consequence of the atelectatic right lung, during inspiration (light blue arrows), the expansion of the left lung displaces the heart towards the right, bringing the septum and apex of the heart more towards lead V1 with an increase in QRS amplitude. During expiration the heart moves in the opposite direction (dark blue arrows). V1–V6 electrocardiographic leads across the precordium (B).\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Melton L.J. 3rd Hepper N.G. Offord K.P. Incidence of spontaneous pneumothorax in Olmsted County, Minnesota: 1950 to 1974 Am. Rev. Respir. Dis. 1979 120 1379 1382 10.1164/arrd.1979.120.6.1379 517861\n2. Bense L. Eklund G. Wiman L.G. Smoking and the increased risk of contracting spontaneous pneumothorax Chest 1987 92 1009 1012 10.1378/chest.92.6.1009 3677805\n3. Schmidt D.C. Andersson C. Schultz H.H. ECG with alternating electric axis in relation to left-sided tension pneumothorax: A case report and review of the literature Eur. Clin. Respir. J. 2018 5 1495982 10.1080/20018525.2018.1495982 30013727\n4. Ogunbayo G.O. Charnigo R. Darrat Y. Morales G. Kotter J. Olorunfemi O. Elbadawi A. Sorrell V.L. Smyth S.S. Elayi C.S. Incidence, predictors, and outcomes associated with pneumothorax during cardiac electronic device implantation: A 16-year review in over 3.7 million patients Heart Rhythm 2017 14 1764 1770 10.1016/j.hrthm.2017.07.024 28735733\n5. Burgard C. Stahl R. de Figueiredo G.N. Dinkel J. Liebig T. Cioni D. Neri E. Trumm C.G. Percutaneous CT Fluoroscopy-Guided Core Needle Biopsy of Mediastinal Masses: Technical Outcome and Complications of 155 Procedures during a 10-Year Period Diagnostics 2021 11 781 10.3390/diagnostics11050781 33926046\n6. Aramini B. Ruggiero C. Stefani A. Morandi U. Giant bulla or pneumothorax: How to distinguish Int. J. Surg. Case Rep. 2019 62 21 23 10.1016/j.ijscr.2019.08.003 31415941\n7. Huang S.C. Lin G.M. Li Y.H. Lin C.S. Kao H.W. Han C.L. Abnormal Changes of a 12-Lead Electrocardiogram in Male Patients with Left Primary Spontaneous Pneumothorax Acta Cardiol. Sin. 2014 30 157 164 27122783\n8. Strizik B. Forman R. New ECG changes associated with a tension pneumothorax: A case report Chest 1999 115 1742 1744 10.1378/chest.115.6.1742 10378578\n9. Fei J. Marill K.A. ECG phasic voltage changes associated with spontaneous pneumothorax in a patient with vanishing lung syndrome BMJ Case Rep. 2015 2015 10.1136/bcr-2014-207498 25618882\n10. Barcos J.C. Tello Santacruz I.A. Monie C.C. Fernandez Recalde M.L. Humphreys J.D. Brugada phenocopy induced by severe pneumothorax J. Electrocardiol. 2018 51 343 345 10.1016/j.jelectrocard.2017.10.016 29242054\n11. Goldstein L.N. Wells M. So S.K. Abnormal P and QRS Axes in a Young Male With a Stab Wound to the Chest Ann. Emerg. Med. 2018 71 477 479 10.1016/j.annemergmed.2017.08.066 29566891\n12. Lee W. Lee Y. Kim C. Choi H.J. Kang B. Lim T.H. Oh J. Kang H. Shin J. Changes in electrocardiographic findings after closed thoracostomy in patients with spontaneous pneumothorax Clin. Exp. Emerg. Med. 2017 4 38 47 10.15441/ceem.16.154 28435901\n13. Arao K. Mase T. Nakai M. Sekiguchi H. Abe Y. Kuroudu N. Oobayashi O. Concomitant Spontaneous Tension Pneumothorax and Acute Myocardial Infarction Intern. Med. 2019 58 1131 1135 10.2169/internalmedicine.1422-18 30626814\n14. Liu P.Y. Lin Y.P. Li Y.H. Su Z.W. Han C.L. Huang S.C. Lin C.S. Meng F.C. Wu H.T. Lin G.M. Electrocardiographic characteristics in young male patients with left primary spontaneous pneumothorax estimated by the collins equation Indian Heart J. 2017 69 720 724 10.1016/j.ihj.2017.05.005 29174248\n15. Yamamoto H. Satomi K. Aizawa Y. Electrocardiographic manifestations in a large right-sided pneumothorax BMC Pulm. Med. 2021 21 101 10.1186/s12890-021-01470-1 33757495\n16. Blendea D. McPherson C.A. Pop S. Anton F.P. Crisan S. Ruskin J.N. Isolated very low QRS voltage predicts response to tilt-table testing in patients with neurally mediated syncope Pacing Clin. Electrophysiol. 2019 42 1558 1565 10.1111/pace.13815 31589336\n17. Hallifax R.J. Yousuf A. Jones H.E. Corcoran J.P. Psallidas I. Rahman N.M. Effectiveness of chemical pleurodesis in spontaneous pneumothorax recurrence prevention: A systematic review Thorax 2017 72 1121 1131 10.1136/thoraxjnl-2015-207967 27803156\n18. Alikhan M. Biddison J.H. Electrocardiographic changes with right-sided pneumothorax South. Med. J. 1998 91 677 680 10.1097/00007611-199807000-00016 9671844\n19. Hallifax R.J. McKeown E. Sivakumar P. Fairbairn I. Peter C. Leitch A. Knight M. Stanton A. Ijaz A. Marciniak S. Ambulatory management of primary spontaneous pneumothorax: An open-label, randomised controlled trial Lancet 2020 396 39 49 10.1016/S0140-6736(20)31043-6 32622394\n20. Blendea D. McPherson C.A. Pop S. Ruskin J.N. Isolated very low QRS voltage in the frontal leads predicts recurrence of neurally mediated syncope Heart Rhythm 2019 16 1862 1869 10.1016/j.hrthm.2019.06.006 31201963\n21. Tentea C.-P. Chiorescu R. Crisan S. Pop S. Ruskin J.N. Blendea D. A Risk Score That Predicts Recurrence of Neurally Mediated Syncope Using Electrocardiographic and Vectorcardiographic Parameters Circulation 2020 142 A16337 10.1161/circ.142.suppl_3.16337\n\n", "fulltext_license": "CC BY", "issn_linking": "2075-4418", "issue": "11(6)", "journal": "Diagnostics (Basel, Switzerland)", "keywords": "case report; electrocardiogram; pneumothorax; syncope", "medline_ta": "Diagnostics (Basel)", "mesh_terms": null, "nlm_unique_id": "101658402", "other_id": null, "pages": null, "pmc": null, "pmid": "34200664", "pubdate": "2021-06-10", "publication_types": "D002363:Case Reports", "references": "30013727;28435901;3677805;25618882;10378578;29174248;28735733;32622394;31201963;33926046;27122783;517861;29566891;33757495;31415941;29242054;31589336;30626814;9671844;27803156", "title": "Usefulness of the Electrocardiogram in a Patient Presenting with Right-Sided Pneumothorax and Presyncope.", "title_normalized": "usefulness of the electrocardiogram in a patient presenting with right sided pneumothorax and presyncope" }
[ { "companynumb": "RO-VALIDUS PHARMACEUTICALS LLC-RO-VDP-2021-004581", "fulfillexpeditecriteria": "1", "occurcountry": "RO", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FUROSEMIDE" }, "druga...
{ "abstract": "The Food and Drug Administration Adverse Event Reporting System (FAERS) remains the primary source for post-marketing pharmacovigilance. The system is largely un-curated, unstandardized, and lacks a method for linking drugs to the chemical structures of their active ingredients, increasing noise and artefactual trends. To address these problems, we mapped drugs to their ingredients and used natural language processing to classify and correlate drug events. Our analysis exposed key idiosyncrasies in FAERS, for example reports of thalidomide causing a deadly ADR when used against myeloma, a likely result of the disease itself; multiplications of the same report, unjustifiably increasing its importance; correlation of reported ADRs with public events, regulatory announcements, and with publications. Comparing the pharmacological, pharmacokinetic, and clinical ADR profiles of methylphenidate, aripiprazole, and risperidone, and of kinase drugs targeting the VEGF receptor, demonstrates how underlying molecular mechanisms can emerge from ADR co-analysis. The precautions and methods we describe may enable investigators to avoid confounding chemistry-based associations and reporting biases in FAERS, and illustrate how comparative analysis of ADRs can reveal underlying mechanisms.", "affiliations": "Novartis Institutes for Biomedical Research, Cambridge, United States.;Novartis Institutes for Biomedical Research, Cambridge, United States.;Novartis Institutes for Biomedical Research, Cambridge, United States.;Novartis Institutes for Biomedical Research, Basel, Switzerland.;Oracle Health Sciences, Oracle Health Sciences, Burlington, United States.;University of California, San Francisco, United States.;Novartis Institutes for Biomedical Research, Cambridge, United States.", "authors": "Maciejewski|Mateusz|M|0000-0003-1147-4941;Lounkine|Eugen|E|0000-0002-6487-2946;Whitebread|Steven|S|;Farmer|Pierre|P|;DuMouchel|William|W|;Shoichet|Brian K|BK|;Urban|Laszlo|L|0000-0002-1275-0293", "chemical_list": null, "country": "England", "delete": false, "doi": null, "fulltext": "\n==== Front\neLifeElifeeLifeeLifeeLife2050-084XeLife Sciences Publications, Ltd 2581810.7554/eLife.25818Research ArticleHuman Biology and MedicineReverse translation of adverse event reports paves the way for de-risking preclinical off-targets Maciejewski Mateusz http://orcid.org/0000-0003-1147-49411*†Lounkine Eugen http://orcid.org/0000-0002-6487-29461Whitebread Steven 1Farmer Pierre 2DuMouchel William 3Shoichet Brian K 4*Urban Laszlo http://orcid.org/0000-0002-1275-02931*1 Novartis Institutes for Biomedical Research, Cambridge, United States2 Novartis Institutes for Biomedical Research, Basel, Switzerland3 Oracle Health Sciences, Oracle Health Sciences, Burlington, United States4 University of California, San Francisco, United StatesWatt Fiona M Reviewing editorKing's College London, United Kingdommatt@mattmaciejewski.com (MM);bshoichet@gmail.com (BKS);laszlo.urban@novartis.com (LU)† Pfizer, Inc., Cambridge, United States.\n\n08 8 2017 2017 6 e2581810 2 2017 04 7 2017 © 2017, Maciejewski et al2017Maciejewski et alThis article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.The Food and Drug Administration Adverse Event Reporting System (FAERS) remains the primary source for post-marketing pharmacovigilance. The system is largely un-curated, unstandardized, and lacks a method for linking drugs to the chemical structures of their active ingredients, increasing noise and artefactual trends. To address these problems, we mapped drugs to their ingredients and used natural language processing to classify and correlate drug events. Our analysis exposed key idiosyncrasies in FAERS, for example reports of thalidomide causing a deadly ADR when used against myeloma, a likely result of the disease itself; multiplications of the same report, unjustifiably increasing its importance; correlation of reported ADRs with public events, regulatory announcements, and with publications. Comparing the pharmacological, pharmacokinetic, and clinical ADR profiles of methylphenidate, aripiprazole, and risperidone, and of kinase drugs targeting the VEGF receptor, demonstrates how underlying molecular mechanisms can emerge from ADR co-analysis. The precautions and methods we describe may enable investigators to avoid confounding chemistry-based associations and reporting biases in FAERS, and illustrate how comparative analysis of ADRs can reveal underlying mechanisms.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.001\n\neLife digest\nNew treatments are tested in clinical trials before they are licensed for use in patients, but until the drugs are available for prescribing it’s not always possible to identify every side effect. When the drugs enter the clinic, they might be prescribed to patients with multiple medical conditions, or combined with other treatments. The drugs may also be taken for longer periods of time than tested in trials. It is therefore common for new adverse reactions to emerge after a drug is in widespread use.\n\nThe FDA Adverse Event Reporting System (FAERS) is a surveillance system used in the United States for reporting drug side effects after new treatments have been licensed. Healthcare professionals and patients can submit reports to the database, logging the adverse drug reactions that they have experienced.\n\nFAERS currently contains over 8.5 million entries, and is growing all the time. However, Maciejewski et al. show that the database has several shortcomings that are reducing its usefulness. For instance, on average any given drug will have 16 different names in the system; this makes it challenging to group all of the reported side effects so that trends and patterns can be correctly seen.\n\nTo address this first problem, Maciejewski et al. grouped together drugs according to their active ingredients, rather than their name. This made it much easier to account for subsequent, and more crucial conflating factors such as multiple reports for the same adverse event and patient, or cases where adverse reactions were confused with the diseases that the drugs are trying to treat. For example, diabetes was listed as a side effect for drugs used to treat diabetes.\n\nBuilding on this cleaned-up dataset, Maciejewski et al. monitored how adverse event signals evolve over time and uncovered biases that were hard to see otherwise. For example, side-effects were reported more often when drugs were in the news. More strikingly, this bias affected not only the drug in question, but also other drugs that acted in the same way or on the same molecular target.\n\nThe computational method developed by Maciejewski et al. allows the data in FAERS to be combined and corrected, making easier to evaluate the safety of different medicines. The link between adverse side effects and the molecular targets of the drug, via the ingredient’s chemical structure, furthermore makes it possible to analyze such clinical data reliably by using chemical and genetic information. In the future, this method could also help to identify previously unknown side effects and the biological mechanisms behind them. This could help researchers to develop new drugs with improved side effect profiles.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.002\n\nAuthor Keywords\nadverse drug reactionsFAERSbig datadata analysisResearch Organism\nHumanhttp://dx.doi.org/10.13039/100004336NovartisMaciejewski Mateusz Lounkine Eugen Whitebread Steven Farmer Pierre DuMouchel William Urban Laszlo http://dx.doi.org/10.13039/100000002National Institutes of HealthShoichet Brian K. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.elife-xml-version2.5Author impact statementCareful analysis of adverse drug reaction reports reveals noise and biases embedded in this data and allows for systematic mitigation of these effects to produce much more robust understanding of side effects of marketed drugs.eLife Digest2.5\n==== Body\nIntroduction\nSafety assessment of drug candidates is crucial for drug discovery, enabling the development of medicines that achieve the desired therapeutic effects with the least risk of adverse side effects. Preclinical regulatory investigations and clinical trials are designed to address safety of drug candidates and eliminate those that do not meet risk-benefit expectations (Cook et al., 2014). However, limited access to large, diverse patient populations in clinical trials, untested drug co-administrations, as often occurs, especially with elderly patients on multiple medications, and development of ADRs associated with chronic treatment, often results in post-marketing labeling and occasional withdrawals (Wysowski and Swartz, 2005; Lasser et al., 2002; Friedman et al., 1999; Downing et al., 2017). Thus, postmarketing pharmacovigilance is essential to track ADRs and ultimately reduce over 1 million serious drug-related side effects that occur each year in the USA. Between 5% and 10% of these ADRs are fatal (Lazarou et al., 1998), and many others cause patient suffering, hospitalization, and increased health system burden (Moore et al., 1998). Indeed, the fatality rate attributed to ADRs puts them among the top causes of death in the USA (over 40,000 in 2011), similar to suicide-related mortality (Hoyert and Xu, 2012).\n\nDeterminant tools in post-marketing pharmacovigilance are databases that aggregate ADR reports. Foremost among these is the FDA Adverse Event Reporting System (FAERS), which is perhaps the most extensive, and among the most widely accessible of these databases, currently containing over 8.5 million reports and rapidly growing (U.S. Food and Drug Administration, 2016). FAERS and related databases, such as those of the EMEA and of Health Canada, can provide specific ADR phenotypes typical for either individual drug classes or specific indications and can be accessed either directly (U.S. Food and Drug Administration, 2016) or by APIs (RELX Intellectual Properties SA, 2016; U.S. Food and Drug Administration, 2016). These large-scale adverse event databases enable analysis to relate clinical phenotypes and compounds (Tatonetti et al., 2012), and they have been widely used by the clinical community with much impact (O'Connell et al., 2006; Elashoff et al., 2011; Lawrence et al., 2006; Mackey et al., 2007).\n\nIt is an attractive proposition to exploit the sheer scale of FAERS to detect drug-ADR associations that would otherwise be missed. A challenge in doing so has been the heterogeneous data sources and data conflation in the database.\n\nFAERS, while providing a solid frame for reporting, contains redundancies, biases, and conflations that affect its analysis and interpretation (McAdams et al., 2008). Our ability to even correlate drugs with their effects is obscured by something as simple as the tangle of drug synonyms in FAERS - on average 16 different names for medicines containing each active drug ingredient - which can obscure associations.\n\nHere, we investigate the effects that these data conflations, inflations, and inaccuracies can have on ADR and mechanistic inference from FAERS, and methods to address them. We begin by mapping drug identifiers in FAERS to normalized chemical structures of their ingredients, which brings together observations over the ‘full drug’, not just particular drug names and synonyms, which remain incomplete. Mapped to unique chemical structures, we could compute time-resolved profiles of drug-ADR associations, which revealed intriguing comorbidities and similarities of ADRs between drugs, and of their time evolution. We then turned to the origins of and controls for reporting biases in FAERS, considering stimulated reporting and the several different, often non-medical communities that can contribute to FAERS. This was facilitated by a time-evolution analysis of ADR reports, and its correlation with contemporary news events. We illustrate how these biases can ramify with in-depth analysis of FAERS content on two COX-2 inhibitors, rofecoxib and celecoxib, and with two PPAR-γ agonists, rosiglitazone and pioglitazone. As examples of how these analyses can link ADRs to specific targets, we consider the differential ADR profiles of drugs used for the treatment of attention deficit hyperactivity disorder (ADHD), and how their distinct ADRs may be explained partly by molecular targets - a logic that is often used - combined with pharmacokinetic exposure - which is often overlooked. Similarly, we investigate the differentiation of the hypertensive side effects of VEGF-Receptor (VEGF-R2) inhibitors based on their potency and pharmacokinetic (PK) profiles. The precautions and methods we describe, may enable investigators to use FAERS with increased confidence and avoid confounding chemistry-based associations and reporting biases. This study also illustrates how comparative analysis of ADRs can reveal underlying mechanisms and highlight the reverse translation value in the drug discovery process.\n\nResults\nAnalysis of content: unexpected trends in FAERS reporting\nThe FAERS database holds over 8.5 million reports and is steadily growing (over 1,320,000 reports added in 2015; Figure 1A. We extracted 8,749,375 FAERS reports, mapped to 7,095,566 individual cases. Often a patient’s condition is monitored over a span of multiple reports, which must be considered when investigating the incidence of a particular drug-ADR association (U.S. Food and Drug Administration, 2016).10.7554/eLife.25818.003Figure 1. General information of the FDA Adverse Event Reporting System (FAERS) content (1997–2015).\n(A) The cumulative number of reports in FAERS is shown in the top panel; the bottom panel shows the number of new reports per quarter. (B) Distribution of reporter identities. Data are based on reports submitted between Q2 2002 (identification of reporting individuals started at this time) and Q4 2015. (C) Distribution of reports by the 7 ADR outcomes defined in FAERS.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.003\n\n\n\nInflation of reports by multiplication can increase the apparent significance of a drug – adverse effect association, particularly when the total number of reports is low. To systematically identify the most similar cases, we compared all pairs of reports using demographic and prescription data. Almost 1% of the reports in FAERS (61,780 cases) represent multiple entry cases with identical drugs, identical ADRs, event dates, patient age and gender (Supplementary file 1). Intriguingly, only half of the reports in FAERS were submitted by healthcare professionals (Figure 1B). Over one-third of them (3.2 million) were initiated by the patients themselves and 9% were labeled ‘non-specified’. Lawyers reported 3% of all FAERS cases (Figure 1B).\n\nFAERS uses seven descriptors of report outcomes: ‘Death’, ‘Life-Threatening’, ‘Disability’, ‘Congenital Anomaly’, ‘Required Intervention to Prevent Permanent Impairment/Damage’, ‘Hospitalization – Initial or Prolonged’, and ‘Other’. Among these, only ‘Other’ is used to report relatively benign outcomes. Unexpectedly, only around 40% of the outcomes were identified as ‘benign’, whereas almost 15% of reported cases result in death (Figure 1C). It is a feature of reporting in an open submission database like FAERS that this ratio does not reflect the true balance between fatal and relatively benign drug ADRs, but rather the ratio of the ADRs that are thought to merit reporting.\n\nAmong the 945,526 reports where death is the outcome of the ADR, 42,526 were linked to cardiac arrest and 50,155 to suicide. Top molecular ingredients of drugs that were primary suspects in death reports were rosiglitazone: 17,165 (indication type II diabetes), rofecoxib: 11,386 (primary indications: arthritis, pain; withdrawn from the clinic), reteplase: 11,386 (indication of acute myocardial infarction (MI)), and thalidomide: 17,104 (indication of myeloma multiplex; additionally, 26,429 cases of death have been attributed to lenalidomide, a derivative of thalidomide also prescribed for myeloma). For drugs like rofecoxib or rosiglitazone, which are prescribed for manageable and non-life threatening diseases, the inference that the ADR has led to death can be reasonably made. Similarly, a comparison of celecoxib (reported number of deaths: 4,066; Standardized Mortality Ratio [SMR] [Everitt and Skrondal, 2010]: 1.3) and rofecoxib, which are prescribed for the same indication, highlights the significantly higher SMR of patients taking the latter drug (SMR: 5) (Rostom et al., 2007). However, the attribution of death as an ADR of thalidomide when it is used to treat myeloma multiplex, a life-threatening, malignant disease (Singhal et al., 1999) may be hard to support; it seems likely that the ‘ADR’ here reflects the cancer that the drug is meant to treat. Similarly, the acute myocardial infarction that reteplase is used to treat (Wooster and Luzier, 1999) may well be the cause of many of the death ADRs with which the drug is tarred, not the drug itself. When a drug is used to treat a life-threatening disease, care is warranted in interpreting death as an ADR of that drug.\n\nMapping drugs to their molecular ingredients improves signal retrieval\nIn most FAERS studies, drugs are identified using RxNorm (Wang et al., 2013; Nelson et al., 2011), a set of drug synonyms supplied by the National Library of Medicine. This mapping is sufficient for the questions that may be asked of FAERS by a clinical professional, such as the safety signals for a particular drug formulation. However, products that have different identities in resources such as RxNorm share common molecular ingredients and are highly similar in their activities on molecular targets. To investigate the ADRs associated with fluoxetine, for instance, one must aggregate its 378 different synonyms. Without such aggregation, well-known fluoxetine side effects such as sexual dysfunction become statistically insignificant (four cases when only the fluoxetine drug synonym Prozac is considered; Relative Reporting Ratio [RRR] = 1.75; q-value = 1), whereas once aggregated, these ADRs stand out clearly (87 cases; RRR = 6.67; q-value = 2.56·10−96). Conversely, in its non-aggregated form, Prozac appears to have statistical significant associations with sex chromosome abnormality (one case; RRR = 2.96; q-value = 2·10−3). Aggregated, however, this association becomes insignificant (one case; RRR = 2.78; q-value = 1). For those interested in the molecular basis of drug actions and side effects, a simple way to interrogate the drugs as molecules is critical.\n\nAccordingly, we mapped the active drug ingredients in over 98% of the reports using a combination of natural language processing and multiple databases of synonyms (see Materials and methods). Not only does this value compare favorably to the 81% recognition achieved using only the synonyms alone in RxNorm, but it allowed us to look for associations drawing on standard cheminformatics-based searches. Surprisingly, of the 2729 unique ingredients identified, only 1892 were annotated as a primary suspect in at least one report; said a different way, 837 active drug ingredients had no reported ADRs whatsoever. A plot of the ingredients that were associated with ADRs shows that an exponentially decaying distribution, with 90% of the ADRs attributed to 40% of the drug ingredients (Figure 2). After correction of distribution for ADRs with q-values better than 0.05, 90% may be attributed to 46% of the investigated drugs. This ingredient mapping was used throughout subsequent analyses (see Materials and methods and Supplementary Material).10.7554/eLife.25818.004Figure 2. Histograms showing the distribution of the number of ADRs that were attributed to unique ingredients.\n(A) All observed ingredient – ADR pairs. (B) Pairs observed below the q-value cutoff of 0.05.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.004\n\n\n\nAs expected, mapping drugs to their active ingredients, and not simply relying on synonym aggregation, reinforced the strength of the drug-ADR signals. For example, the non-steroidal anti-inflammatory drug (NSAID) indomethacin is used to treat chronic pain and fever (MedicinesComplete, 2014). When we assessed indomethacin as an ingredient, a strong signal linked it with gastric ulcer (RRR = 10.40; q-value = 3.65·10−72), and gastric ulcer hemorrhage (RRR = 7.99; q-value = 6.78·10−18). These adverse events are known from the labels of indomethacin-containing drugs, also confirmed in World Drug Index (WDI) (Thomson Scientific, 2016). However, when we searched the trade names of the drugs in which indomethacin is used (RxNorm synonym matching), these signals were dissipated in the noise: the strongest signal for gastric ulcer decreased to RRR = 1.79, q-value = 1.00; the strongest signal for gastric ulcer hemorrhage dropped to RRR = 2.42, q-value = 1.00.\n\nBias in ADR reporting by indication, changes in regulatory, clinical, social and legal environment\nSometimes, ADRs are conflated with indications, and vice versa. An example is a report of rosiglitazone being prescribed for type two diabetes mellitus, with the ADR in the report being also diabetes mellitus (Table 1). In another report, rosiglitazone was identified as the primary suspect for congestive heart failure, as well as a therapeutic agent that was prescribed for the very same condition (Table 1). We quantified this indication bias both globally and over time. Approximately 5% of all reports for any drug describe the drug’s indication as an adverse event. The number of reports in which the same ADR and indication was reported increased linearly with the increasing number of yearly reports until 2011, followed by a sudden drop (Figure 3). We could trace an FDA advisory ‘refresher’ presentation on guidelines of ADR reporting for clinical trials to an effective date of March 28, 2011 (Devine, 2016). This document provides clear instructions for submitters to distinguish between pre-existing conditions and ADRs and indeed may have had a significant effect on reporting quality.10.7554/eLife.25818.005Figure 3. Reports with wrongly identified indications or ADRs.\n(A) Total number of reports in a given year where the same indication and ADR were reported. (B) Number of reports in a given year where diabetes was stated as the adverse reaction caused by rosiglitazone.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.005\n\n10.7554/eLife.25818.006Table 1. Confusion of ADRs with indications. Report and case numbers identify two FAERS reports where the ADR is confused with the indication.\n\nFor the first case, rosiglitazone prescribed for diabetes (Indication) is identified as the primary suspect (PS) for causing diabetes mellitus as an ADR as well. In the second case, ‘cardiac failure congestive’ is given as the indication for rosiglitazone with the reported ADR of ‘cardiac failure congestive’. The third case exemplifies correct reporting, where both the ADR and the indication of rosiglitazone are reported correctly.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.006\n\nReport\tCase\tADR\tDrug / Role / Indication\t\n 6545021\t179039\tDiabetes mellitus\tRosiglitazone/PS/Diabetes mellitus\t\n 5521616\t162007\tCardiac failure congestive\tRosiglitazone/PS/Cardiac failure congestive\t\n 6380841\t7085373\tCardiac failure congestive\tRosiglitazone/PS/Diabetes mellitus\t\n\n\nWe took a closer look at the reports of rosiglitazone, where occurrence of diabetes as a side effect was attributed to the usage of this drug relatively frequently until 2004 (this obviously erroneous association is significant if considered in the reporting window of rosiglitazone (until 2011), with an RRR = 1.57 and a q-value <10−5). After 2004, this association decreased, as did the overall prescriptions and reporting of this drug, owing to its widely-reported cardiovascular side effects (Mannucci et al., 2010; Nissen and Wolski, 2007). In general, a simple comparison of indications and reported ADRs reduces the bias of verbatim repetition.\n\nWe applied these methods to investigate how reports for individual drugs change over time. In particular, we monitored the total number of reports filed and the incidence of adverse events preferentially reported at different time points. When reports are sorted by event dates in FAERS, ‘spikes’ occur on the first day of each month, and even larger spikes on the first day of each year. Importantly, drug-serious ADR signals show a time-dependent increase (see Figures 4A, 5A, 6A, and Figure 7A). The changes in drug-ADR associations over time can, of course, reflect new populations to which the drug is exposed.10.7554/eLife.25818.007Figure 4. Submission pattern and time evolution of rofecoxib FAERS reports.\n(A) Number of reports (per day) where rofecoxib was reported as primary suspect. Red dots represent events with a major impact on the FAERS reporting pattern of rofecoxib. (B) Relative percent participation of all ‘preferred term’ (PT)-level ADRs observed for rofecoxib. Each ADR is represented by a separate color. Characteristic time periods on the timeline of this drug are demarked by lines (associated with definitive events), and numbered. Monthly ADR fractions shown here are also reported in Supplementary file 1. (C) Identities of those reporting rofecoxib ADRs at the various reporting periods, marked to correspond with the Roman numeral annotations in panel B. (D) Enrichment-based clusters of ADRs (cerebrovascular accident and myocardial infarction) observed in rofecoxib reports between 1997 and 2006.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.007\n\n10.7554/eLife.25818.008Figure 5. History of FAERS reports on celecoxib.\n(A) Number of FAERS reports (per day) where celecoxib was reported as primary suspect. (B) Relative percent participation of all PT-level ADRs observed for celecoxib. Each ADR is represented by a separate color. Characteristic time periods on the timeline of this drug are marked by lines, and numbered. Monthly ADR fractions shown here are also reported in Supplementary file 1. (C) Per-month number of reports where celecoxib was primary suspect; each line corresponds to a separate PT-level ADR. The top plot describes all reports with celecoxib as primary suspect. In the plot on the bottom the reports in which rofecoxib was also present were omitted. Colors are matched with those used in panel B. (D) Enrichment-based clusters of most frequently reported ADRs (cerebrovascular accident and myocardial infarction) observed in ccoxib reports. Colors match those in B and C. Note, that this plot will not exactly correspond to panel B, because enrichments presented here show the ratio of the number of observed events in a given year compared to what one would expect at random, while the traces in B show a proportion of a given ADR compared to other ADRs during a given period of time. (E) Identities of those reporting celecoxib ADRs at various reporting periods, marked to correspond with the Roman numeral annotations in panel B.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.008\n\n10.7554/eLife.25818.009Figure 6. Rosiglitazone reports.\n(A) Number of FAERS reports (per day) where rosiglitazone was reported as primary suspect. (B) Per-month percent participation of all PT-level ADRs observed for rosiglitazone. Each ADR is represented by a separate color. Characteristic time periods on the timeline of this drug are demarked by lines, and numbered. Monthly ADR fractions shown here are also reported in Supplementary file 1. (C) Identities of those reporting rosiglitazone ADRs at various reporting periods, marked to correspond with the Roman numeral annotations in panel B. (D) Enrichment-based clusters of ADRs observed in rosiglitazone reports.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.009\n\n10.7554/eLife.25818.010Figure 7. The landscape of pioglitazone reports.\n(A) Number of FAERS reports (per day) where pioglitazone was reported as primary suspect. (B) Per-month percent participation of all PT-level ADRs was observed for pioglitazone. Each ADR is represented by a separate color. Characteristic time periods on the timeline of this drug are marked by lines and numbered. The monthly ADR fractions shown here are also reported in Supplementary file 1. (C) Per-month number of reports where pioglitazone was primary suspect; each line corresponds to a separate PT-level ADR. The plot on the top of the panel shows number of times individual ADRs have been reported, and the bottom the corresponding per-month enrichments. The traces for cardiac failure have been distinguished by the blue color. (D) Enrichment-based clusters of cancer-related ADRs observed in pioglitazone reports. (E) Identities of those reporting pioglitazone ADRs at various reporting periods, marked to correspond with the Roman numeral annotations in panel B. (F) Structure of rosiglitazone and pioglitazone.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.010\n\n\n\nWe assessed the time evolution of reports of rofecoxib, a nonsteroidal anti-inflammatory drug (NSAID) that relieves pain through COX-2 inhibition (Figure 4). Several important events occurred over the clinical life of rofecoxib since its approval by the FDA in 1999: (1) A clinical study by Bombardier et al. published in November 2000 concluded that rofecoxib increased the risk of cardiovascular events (Bombardier et al., 2000). (2) Introduction of warnings for cardiovascular events on the labels of Vioxx (a brand name of rofecoxib) in April 2002. (3) Withdrawal of rofecoxib from the market on September 30th 2004.\n\nMyocardial infarction (RRR = 17.85; q-value <10−5) and cerebrovascular accident (RRR = 17.69; q-value <10−5) accounted for a large proportion of the ADRs reported for rofecoxib from its introduction in 1999 (Figure 4B and D). Before the study by Bombardier et al. (2000), most reports were filed by physicians. Between the Bombardier publication and the introduction of the label warning, these physician reports remained constant, while the number of reports by lawyers grew substantially. After the introduction of the label warning, the number of reports from physicians slightly decreased, but the trend to attribute myocardial infarction and cerebrovascular accident to administration of rofecoxib was further cemented by submitters who identified themselves as lawyers (see Figure 4C).\n\nWe also inspected the time evolution of another COX-2 inhibiting NSAID, celecoxib, approved by the FDA in December 1998, just shortly before Vioxx (Figure 5). Inspection of the timeline of celecoxib reports shows a slight increase in the number of reports around September 2004, reflecting the increase in use associated with the withdrawal of rofecoxib (Figure 5A). Until December 2004, the pattern of ADR in celecoxib reports is dominated by cerebrovascular accident (per-month RRR up to ~35) and myocardial infarction (per-month RRR up to ~45) in a similar fashion as in rofecoxib reports (Figure 5B and Figure 5D). The increase of the overall number of reports around September 2004 coincided with concerns about the safety of celecoxib, likely reflecting a report of increased risk of cardiovascular events in patients who used celecoxib systematically over prolonged periods of time (Solomon et al., 2005). We checked whether the trends in reporting of side effects of celecoxib was affected by co-administration of rofecoxib, but the distribution of ADRs was almost identical after excluding the 8% of reports in which rofecoxib was present as a concomitant drug (Figure 5C). Closer examination of this pattern revealed that the reports during this period of time were largely submitted by lawyers and ‘unidentified’ individuals, while the contribution of health professionals remained steady much below the level of reports for rofecoxib (Figure 5E). These trends were confirmed by logistic regression modeling (see Materials and methods and Supplementary file 2), which showed that reports of myocardial infarction were significantly correlated with reports of celecoxib filed by lawyers before 2005 (Model four in Supplementary file 2). We also considered the Pfizer moratorium on direct-to-consumer advertising in 2004 as a significant event on sales and consequently ADR reporting (Consumers Union and Consumer Reports Best Buy Drugs, 2005). After the Vioxx case, the FDA issued new labeling for not just COX-2 selective but for all NSAIDs which set new safety standards for the anti-inflammatory arena (U.S. Food and Drug Administration, 2016). While Vioxx was removed from the clinic, Celebrex enjoyed a revival after 2004, in particular as the only COX-2 selective NSAID in the clinic and because of the updated labels for other NSAIDs. Pfizer resumed careful advertising with clear reference to side effects that helped the recovery of clinical celecoxib use. While we examined these stimulating effects, we also recognized that the sales volume was likely to grow but we were not able to determine the volume because of coincidental price increase interference (Schondelmeyer and Purvis, 2014). This case clearly demonstrates the complexity of the performance of drugs in the post-marketing environment where ADR reporting could be significantly modified by multiple factors, including regulatory and social aspects.\n\nDrugs with similar chemical structure and modes of action may display distinct clinical ADR phenotypes\nIt is generally expected that compounds with similar structures and modes of action will have similar ADR profiles; for instance, several selective serotonin reuptake inhibitors (SSRIs) are associated with suicidal behavior in young adults (U.S. Food and Drug Administration, 2016; Muller et al., 2015). However, this is not always the case. The post-marketing ADR reports of the structural analogs rosiglitazone (Greene, 1999) and pioglitazone, which act on the same primary target peroxisome proliferator activated receptor γ (PPAR-γ) and are structurally related, are notably different (compare Figures 6B and 7B).\n\nFor rosiglitazone, many heart-related reports have been filed since its FDA approval in May 1999 (Figure 6A, Figure 6B). Whereas the absolute number of reports have varied over time, and has been affected by the clinical trial and scientific reports in much the same way as rofecoxib, the predominance of heart effects, such as congestive cardiac failure (RRR = 31.99; q-value <10−5), coronary artery disease (RRR = 26.32; q-value <10−5), cerebrovascular accident (RRR = 11.72; q-value <10−5), and myocardial infarction (RRR = 20.73; q-value <10−5), relative to other events, has been unperturbed throughout the lifetime of this drug (Figure 6B and D).\n\nThe other hypoglycemic drug, pioglitazone, has triggered fewer reports of heart effects relative to the clinical ADR profile of rosiglitazone since its approval in July 1999 (Figure 7A). Although analysis of FAERS reports does support a statistically significant signal between pioglitazone and cardiac failure (RRR = 5.09; q-value <10−5), the time evolution of this signal reveals that the major contribution to its statistical strength comes from a single peak that subsides by the year 2002, and coincides with the increased scrutiny of rosiglitazone (Figure 7C). Unlike rosiglitazone, the ADR landscape of pioglitazone is dominated by bladder cancer (RRR = 305.69; q-value <10−5), with a substantial increase in reports from 2009 onward (Figure 7B). Conversely, this signal is significantly underrepresented in the rosiglitazone reports (RRR = 0.12; q-value <10−5). There is evidence that non-selective PPAR agonists (α + γ) such as pioglitazone could contribute to carcinogenesis (Oleksiewicz et al., 2008; Piccinni et al., 2011), and a recent study linked bladder cancer to the development of chronic kidney disease as an effect of long-term use of pioglitazone (Lee et al., 2014). This observation was not confirmed with short-term use of pioglitazone (Lewis et al., 2011), and it is important to note that the increase in incidence of bladder cancer is linked to pioglitazone treatment that is ongoing for more than 2 years. Aside from the scientific evidence, it is clear from the submitter population (mostly lawyers and consumers; see Figure 7) that bladder cancer reporting has a significant stimulated component in FAERS. As there is no clear etiology for the high incidence of this ADR, further investigation is needed to explore the effect of concomitant therapies such as glucocorticoids which might influence the side effect profile of pioglitazone. Still, the mechanisms linking the less selective pioglitazone but not the selective PPAR-γ agonist rosiglitazone to bladder cancer are unclear, and this association must remain tentative.\n\nUsing monthly report counts to de-bias stimulated reporting\nThe trends and biases in ADR reporting can hamper the division and reliability of drug-ADR associations. The statistically significant association that we found between pioglitazone and cardiac failure stems mostly from the reports from before 2004, which may reflect the popular view that hypoglycemic thiazolidinediones cause cardiovascular side effects (Nissen and Wolski, 2007). Whereas we cannot discount that this reflects genuine events, a time-resolved statistical analysis tilts against this. In a month-resolved statistical analysis of the significance of the pioglitazone – cardiac failure association, most dates indicated that there was no statistically significant association between this drug-ADR pair (top panel in Figure 8). Conversely, the association of rosiglitazone and myocardial infarction was statistically significant in nearly every time period (bottom panel in Figure 8). The periods where the pioglitazone - cardiac failure association is statistically significant are restricted to a couple of sparse spikes (Figure 8), and so we suggest this association to be stimulated, and most likely artefactual. Such month-resolved statistical analysis for drug-ADR associations may be broadly helpful in detecting biased reporting trends. Continuing observation of changes in reporting patterns and correlative studies can reveal further aspects of the potential discrepancies between the clinical profiles of structurally similar drugs. Published data on the favorable effects of pioglitazone on lipids, primarily on triglycerides, over rosiglitazone also supports our observations (Nissen and Wolski, 2007; Goldberg et al., 2005; Lincoff et al., 2007).10.7554/eLife.25818.011Figure 8. Statistical significance of association between pioglitazone and cardiac failure (top panel), and rosiglitazone and myocardial infarction (lower panel) over time.\nThe horizontal line demarks the critical q-value cutoff of 0.05, below which the association becomes statistically significant. On dates when the association crosses this threshold, its q-value is indicated by a filled circle; otherwise, it is indicated by an empty circle. The extreme q-values below 1·10−300 are not shown.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.011\n\n\n\nCombining pharmacokinetics and FAERS to investigate mechanism and for reverse translation\nThere is a great interest in using pharmacovigilance for target identification and to illuminate therapeutic and ADR mechanism of action (Muller et al., 2015; Nguyen and Lewis, 2014; Rothman et al., 2000; Shively et al., 1999; Urban et al., 2014). By matching to in vitro activity, one may hope to associate an ADR that emerges in FAERS with the targets responsible for the physiology, making the linkage: drug → known target → ADR. Whereas we ourselves have championed the role of in vitro pharmacology for anticipating possible toxicology (Lounkine et al., 2012; Bowes et al., 2012; Bender et al., 2007), doing this reliably depends on knowing the exposure of the drug to the implicated target. Without considering drug pharmacokinetics, FAERS-based inference of drug → target → ADR associations can mislead (Muller and Milton, 2012).\n\nAn illustrative example is the hypertension associated with inhibition of the vascular endothelial growth factor or its receptor (VEGF, VEGF-R2; see Materials and methods). The relevance of such inhibition to hypertension is supported by the high-incidence of this ADR with the VEGF-R2-specific humanized antibody, bevacizumab (Figure 9B) (Zhu et al., 2007). Correspondingly, several small molecule kinase inhibitors that inhibit VEGF-R2 with relevant in vivo pharmacokinetics (Figure 9B) also share the hypertension side effect. However, other kinase inhibitors with VEGF-R2 inhibition do not appear to increase reports of hypertension (Figure 9). High incidence is reported only with those drugs in this class that have exposure margins (EM) less than 13 for this target (biochemical IC50/Cmax; Figure 9). We considered several caveats in this analysis: (1) human exposures could range 5–10 fold, (2) many of the clinically approved kinase inhibitors are promiscuous with a few targets which might affect blood pressure, and (3) in some instances, the clinical sample size is relatively small. While all these factors could influence the incidence of hypertension associated with VEGF-R inhibition, it is possible to recommend an exposure margin around 10 for clinical candidates in preclinical development to avoid this side effect in the clinic (Figure 9A). Thus, using such an EM cutoff in the FAERS analysis, the signal for this ADR over random will separate drugs with true adverse event from those that lack it (Figure 9).10.7554/eLife.25818.012Figure 9. Hypertension associated with VEGF-R2 inhibition depends on the exposure margin of small molecule anti-VEGF-R2 drugs (VEGF-R2 IC50/Cmax).\n(A) Suggested exposure margin for marketed VEGF-R inhibitors based on post-marketing incidence of hypertension in correlation with plasma exposure (VEGF-R IC50/free Cmax). The proposed 10 times margin represents clear separation of VEGF-R inhibitors with and without significant increase in hypertension with the only exception of nintedanib. (B) FAERS reports of small molecule kinase inhibitors with VEGF-R2 inhibition show an increased incidence of hypertension reports only in case their exposure margin is less than 13. The label of drugs with high incidence of hypertension in FAERS lists this side effect, while none of those drugs that have low incidence carry the label. *p-value of association between drug and hypertension <0.001. Counts (N), expected counts (E), and an often-used disproportionality measure (EB05) based on the FDA’s FAERS database of spontaneous reports of suspected drug adverse drug reactions are provided. The values of E are the expected number of patients reporting vascular hypertensive disorder after taking each drug if the drug reports and the reports of the event were independent within the database, conditional on the patients age and gender. The ratio N/E is a measure of disproportionality of report counts of each particular drug-event combination. The value EB05 (empirical Bayes 5% lower bound of a 90% credible interval) is a conservative estimate of the true reporting disproportionality that uses estimated overall prevalence of drug-ADR associations throughout the database. The value of EB05 is less than N/E and has the effect of correcting the simple ratio for sampling variance and multiple comparisons bias. See literature (DuMouchel, 1999; DuMouchel and Pregibon, 2001; Szarfman et al., 2002; Almenoff et al., 2007) for details and discussion of the FAERS database and the use of disproportionality analyses within spontaneous report databases. The values of EB05 for the first three drugs indicate 95% confidence that reports of those three drug-event combinations are reported about three or four times as often as would be expected if they were independent, while the values of EB05 <1 in the final three drugs in the table indicate no evidence for higher than expected reporting rates. More detailed results from Bayesian analysis are available in Supplementary file 3. †Significant increase.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.012\n\n\n\nA more complex case emerges through the investigation of methylphenidate and the atypical antipsychotics, risperidone/paliperidone (Corena-McLeod, 2015) and aripiprazole, drugs prescribed for the treatment of attention deficit hyperactivity disorder (ADHD) (Correia Filho et al., 2005; Ercan et al., 2012; Fernández-Mayoralas et al., 2012). FAERS analysis indicates that treatment with risperidone/paliperidone, the latter of which is the main active metabolite of risperidone, increases the frequency of gynecomastia and galactorrhea, while methylphenidate has a low incidence of these ADRs, as do other atypical antipsychotics, such as aripiprazole (Figure 10) (RELX Intellectual Properties SA, 2016). For example, between 2007 and 2013, there were 5073 and 123 cases in FAERS, respectively, where risperidone and paliperidone are the primary suspect of gynecomastia (Figure 10, RRR = 113.82, q-value <10−5; RRR = 7.53, q-value <10−5). For aripiprazole (RRR = 0.85) and methylphenidate (RRR = 1.39), however, the q-values were close to 1, indicating no significant associations with this ADR (Figure 10B). Thus, the FAERS data clearly separates the profile of risperidone/paliperidone from both methylphenidate, with which it overlaps for treatment of ADHD, and from other atypical antipsychotics, like aripiprazole. The inference would be that the target responsible for the gynecomastia and galactorrhea for risperidone/paliperidone is not modulated by either methylphenidate or any other atypical antipsychotics. Although this is correct for methylphenidate, it is incorrect for the atypical antipsychotics. The clinical profile of atypical antipsychotic drugs depends on their pattern of engagement with central nervous system targets largely receptors and transporters (Richelson, 1996).10.7554/eLife.25818.013Figure 10. Integration of pharmacodynamic and pharmacokinetic data is necessary to interpret FAERS information.\n(A) FAERS analysis of the reporting pattern of gynecomastia in patients treated with risperidone between 2002–2015. (B) Summary table of the in vitro pharmacological profile, FAERS entries (total number of reports, and reports of gynecomastia, hyperprolactinemia and cardiac valve disease where the listed drugs were the primary suspects) and calculation of exposure margin of aripiprazole, risperidone/paliperidone and methylphenidate. The prominent effects of risperidone/paliperidone at the D2 dopamine receptor in conjunction of the narrow TI differentiates these compound(s) from the rest. Assays were performed at the Novartis Institutes for BioMedical Research, Cambridge. *Asterisks denote functional assays. ant: antagonism.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.013\n\n\n\nBoth aripiprazole and risperidone/paliperidone are atypical antipsychotics with high affinity to dopaminergic, serotonergic, adrenergic, and histaminergic receptors (Figure 10B [Lounkine et al., 2012; Roth et al., 2000]). It is well established that inhibition of the D2 dopamine but not 5-HT2C receptors are linked to hyperprolactinemia, which is the underlying mechanism of gynecomastia and galactorrhea (Calarge et al., 2009; Alladi et al., 2017). Regardless of their similar potency at the D2 dopamine receptor the difference between the ADR profile of aripiprazole and risperidone/paliperidone is explained by their mechanism of action (risperidone is a full antagonist and aripiprazole is a partial agonist) and particularly by their PK profile, which reveals that the exposure margin (EM [Muller and Milton, 2012]) for D2 is large for aripiprazole and so this ADR did not manifest. For risperidone, the EM is less than one which explains the high incidence of gynecomastia (Figure 10). Methylphenidate does not affect the D2 receptor at all, and accordingly this ADR was not observed.\n\nWhile paliperidone is known to cause hyperprolactinemia (Bostwick et al., 2009) which is confirmed by the FAERS data, it remains to be explained why it has a significantly lower reporting rate than its parent, risperidone, with similar activity at the D2 receptor (Arakawa et al., 2008).\n\nDiscussion\nFour key observations emerge from this study. First, much of the potential signal in FAERS and related databases is obscured by chemical name redundancy. This introduces false associations that would fall to insignificance on synonym aggregation, and this hides associations that would be significant on aggregation. This may be addressed by representing active ingredients by their unique chemical structures in a readily searchable form as we do here (Supplementary file 1). Second, FAERS reports tilt toward serious outcomes, partly owing to a confusion of ADRs and outcomes. Third, FAERS suffers from several forms of conflation: multiple entries, indications with ADRs, newsworthiness, and scientific and legal influences. These may be detected by statistical analyses, including comparing reports over time. Fourth, and perhaps more generatively, once these biases and conflations are corrected, the molecular mechanism of previously hidden ADRs can be revealed; an example explored here is the association of urinary bladder cancer with mixed PPAR-α and PPAR-γ agonists.\n\nA major reason for FAERS’s bias toward serious outcomes is the conflation of ADRs and outcomes. This may stem from an issue as simple as confusion on whether ‘death’ is listed as an ADR – associated with the drug only – or an outcome – associated with the disease itself. This is the case with the attribution of the side effect ‘death’ to thalidomide’s use in complex myeloma multiplex, when this reflects the high mortality rate of the disease itself (Greene, 1999). Naturally, there are some cases where use of a drug can increase death rate, even in treating life-threatening diseases, such as the case of milrinone for acute heart failure syndromes (AHFS) (Bayram et al., 2005) or severe chronic heart failure (Packer et al., 1991). Matters can be improved when a drug is used in different indications with distinct symptoms and outcomes, enabling differentiation between disease- and drug-related outcomes. FAERS could be further developed to automatically alert the investigator to common indication biases, such as high death rate in malignancies, or baseline metabolic anomalies in diabetes. Careful statistical analysis is needed in these cases to differentiate between the outcomes associated with the disease or with the suspect drug. For now the category ‘outcome’ should be used cautiously for ADR analysis, especially in large-scale studies that aggregate data from several drugs.\n\nIn principle, submission of FAERS reports requires medical knowledge, as they include specific indications for which drugs were prescribed, identification of the primary suspect of ADRs, and structured description of ADRs by MedDRA terms. Nevertheless, a third of the reports are contributed by customers, and a half by submitters who do not identify themselves as medical professionals, including lawyers. This contributes to the high redundancy and error in FAERS, and to the ‘stimulated reporting’ from which it suffers (Hoffman et al., 2014). This appears to have been the case with celecoxib, whose association with cerebro- and cardiovascular events in FAERS reports was driven primarily by reports from legal professionals (Figure 5E). After rofecoxib was withdrawn, the proportion of these events for celecoxib returned to background. For cases like these, a temporal analysis of ADR-drug associations is essential as it can pinpoint spurious associations. Interrogation of FAERS and related databases to illuminate the molecular mechanisms of ADRs, and indeed the shared target profiles of drugs, has been an area of much recent interest (Center for Drug Evaluation and Research, 2015). Here, too, we find that the disambiguation of ADRs, indications, reporting and indication biases can reveal previously obscured associations. An example is the association of bladder cancer with the mixed PPAR-α and PPAR-γ agonist pioglitazone. FAERS analysis is instrumental here, providing information on a large patient population and enabling the comparison with the selective PPAR-γ agonist rosiglitazone, which is not associated with bladder cancer (Figure 6) (Smith, 2001).\n\nImprovement of statistical methods for signal detection is an area of active research (Wysowski and Swartz, 2005; Lasser et al., 2002; Friedman et al., 1999; Moore et al., 1998; Harpaz et al., 2013a) and much attention is paid to advanced statistical methods such as (Bayesian) information components (Harpaz et al., 2013a), Empirical Bayes statistics (Harpaz et al., 2013b), and hierarchical methods (Harpaz et al., 2013b). As with all machine learning and statistical approaches, these methods assume clean input data – the biases and noise they address is of statistical nature. We have used a well-known disproportionality approach, relative reporting ratio (RRR) with χ2 test statistic for disproportionality. The RRR has its limitations and may underperform compared to more advanced methods (Harpaz et al., 2013a). The focus of our study was how proper preparation of the input data – cleaning drug ingredient mapping, and estimating multiple reporting – boosts signal detection performance, even with a simple method such as the RRR. We believe that applying the procedures and precautions we described here together with more advanced statistical methods will boost their performance even further.\n\nA key caution is that simple associations such as drug-ADR or drug-target do not yield clinical relevance without pharmacokinetic information, which ensures that the implicated target is exposed to the drug at effective concentrations. This is illustrated by the comparison of the ADHD drugs risperidone and aripiprazole and gynecomastia. Both drugs affect the D2 dopamine receptor that underlies the ADR, but only risperidone reaches a sufficient exposure to trigger it. The VEGF-R2 inhibitor example suggests that this type of evaluation is the only way one can objectively detect ADR-target pairs and explain the underlying mechanisms of their manifestation. Relying only on a ADR → drug → in vitro target schema can be insufficient to understand shared targets or molecular mechanisms; as Goodman long ago suggested, pharmacokinetic exposure remains crucial (Goodman and Gilman, 1985).\n\nFAERS, an already valuable asset for clinicians and pharmaceutical scientists, could be improved in several ways to improve post-marketing pharmacovigilance. First, we recommend introducing automatic mapping of drugs and synonyms to ingredients, as discussed in this paper. Alerts could be issued for indications where serious outcomes are common and hard to distinguish from ADRs. Definitive drug-ADR associations would require information on exposure. Here, the availability of applied dose and associated PK data are essential. At present, no dose is provided and PK data can be obtained only from different sources. One of such sources is PharmaPendium (RELX Intellectual Properties SA, 2016), which contains both FAERS data and PK information, but even here the data are not linked directly, and this resource is only commercially and not publicly available. Public databases to which FAERS could link include DailyMed or drugs.com, which would potentially provide information on pharmacokinetics, drug labels, formulations, and approved indications.\n\nThere are several weaknesses of the present approach, which seems to be more or less general for mining efforts of FAERS. We encountered difficulties in differentiating drug-ADR associations when several drugs were co-administered, particularly when combinations contain drugs with possible synergistic or antagonistic effects. Also, different formulations of the same active drug ingredient could contribute to differences of the drug’s profile, which is difficult to capture with the present approach.\n\nFinally, the introduction of reporting automation into FAERS would serve the dual purpose of reducing errors, such misclassifying ADRs and indications, and making the tool more interactive and rewarding for health professionals. One can imagine submitters receiving feedback on similar entries, including cases on the same suspect drug, indication, patient population and most common or problematic treatment regimens. The tool could also help to define the ‘suspect drug’ in treatment scenarios, independent from the submitters’ intention, among other advantages. While this development would need investment, one could imagine undertaking it as part of a public-private partnership from which all would benefit.\n\nConclusions\nThe challenges and opportunities in FAERS and indeed from related databases flow from its ambitions. It publishes multiple reports - physicians, patients, other medical professionals, attorneys - on multiple drugs, named in multiple ways and taken in multiple contexts. FAERS does not represent a strictly reviewed and carefully channeled source of observations about drugs, as a clinical trial does - there is no placebo arm in FAERS, nor are there reports of cases when a given drug was prescribed and caused no side effects. It contains uncontrolled, volunteered information on a large scale. This may be seen as a feature of FAERS - a database designed with hypothesis generation rather than hypothesis testing in mind. Still, the hypotheses that FAERS suggests depend critically on the ability to disentangle its data. Tools like those described here are crucial to control for the often conflated and contradictory observations in FAERS reports, where serious outcomes are over-reported, reported death is often linked to submission by the patients themselves, a single event is reported multiple times, true associations between drugs and adverse events are missed because a single agent is named in multiple ways, or a mechanistically related disease occurs in different system organ categories. Once its data are disentangled, FAERS represents unprecedented opportunities to track drug outcomes in large patient populations, revealing new associations. The power of such analysis is that it may be applied systematically and comprehensively across a massive number of observations.\n\nWe recognize that a fully automated method, such as that described here, cannot replace expert knowledge. What such a method can do is identify, prioritize and sometimes deprioritize drug-adverse event associations, and sometimes even mechanistic inference, for detailed expert identification. This approach should be useful to the growing community of regulators, payers, physicians, and patients that work with and depend upon trends emerging in FAERS to improve drug use and health outcomes. By making several of these tools available to the community, we hope to enable future interrogation of FAERS by other investigators.\n\nMaterials and methods\nFAERS data source\nFAERS reports were downloaded on May 24th 2016 from the FEARS database (U.S. Food and Drug Administration, 2016) for the years between fourth quarter of 1997 and fourth quarter of 2015, inclusive. ADR, indication, drug role (primary suspect, secondary suspect, concomitant), and outcome data was mapped using ISR report identifiers to the individual reports. Drugs were identified by the reported drug name in FAERS.\n\nMapping drugs to ingredients\nWe assembled a list of synonyms of drugs, using public and licensed databases including Thompson Reuters Integrity (Thomson Reuters, 2016), GVK (GVK Biosciences, 2014), Drugbank (Law et al., 2014), ChEMBL (Gaulton et al., 2012), and RxNorm (Nelson et al., 2011). These synonyms were matched with drug products, and constituent molecular ingredient structures, encoded using as InChIKeys (International Union of Pure and Applied Chemistry, 2016). We read in all the drug names from all the FAERS reports, and all the synonyms that had been assembled. Non-alphabetical characters (except numbers), capitalization, and terms that carried little information regarding the identity of the drugs (such as articles, or often occurring words like ‘acid’) were removed from the FAERS drug names and synonym names, and the remaining parts of the names were tokenized. Each tokenized FAERS drug was then compared to each tokenized synonym, and the overlap of tokens was recorded for each pair using the Tanimoto similarity coefficient tc. The synonym with the highest tc value was picked for a given drug, as long as the tc was ≥0.2; for any drug, if a synonym with tc of 0.99 or higher was found, it was considered to be an exact match, and used to identify the drug in question without comparison to further synonyms. For the most frequent (among the top 500) drug names in FAERS, we manually mapped those drug names to InChIKeys that could not be mapped. Since InChIKeys are not typically calculated for large macromolecules, we used the non-proprietary name in lieu of the InChIKey in these cases.\n\nAdverse drug reaction terms\nThe majority of ADRs in FAERS are reported using the Medical Dictionary for Regulatory Activities (MedDRA) (Brown et al., 1999). Some older reports contained terms that are not part of the newer MedDRA that is used currently. To normalize and annotate the ADR terms extracted from reports we used a Levenshtein algorithm that compared the FAERS ADR terms to the MedDRA terminology. We set the minimal Levenshtein score at which a given MedDRA term was considered a perfect match to 0.95, and the minimal acceptable score to 0.90 at above which the highest scoring term was picked to standardize a given ADR. Additional 32 ADR terms were standardized manually, leaving less than 0.5% ADR terms unmatched.\n\nEstablishing ingredient - ADR and ingredient - indication associations\nWe used the well-established Relative reporting ratio (RRR) together with a χ2 statistic for disproportionality signal detection (Harpaz et al., 2013a). We constructed ingredient-ADR contingency tables and calculated the expected number of occurrences, the RRR, and Yates-corrected χ2 p-values (Yates, 1934) for these contingency tables, as implemented in SciPy (Jones et al., 2001). False discovery rate (FDR) was controlled (Jones et al., 2001) using the Holm procedure (Holm, 1979), yielding q-values. Associations were selected if they: (a) were reported at least five times in FAERS; (b) had a q-value <0.05; and (c) had an RRR >1. These ingredient - ADR pairs are shown in Supplementary file 1.\n\nCalculating ingredient – ADR associations on monthly basis\nWith FAERS data annotated with dates of ADRs, for every ingredient – ADR pair we calculated co-occurrence frequencies, RRR-values, and χ2-based p-values for every month between January 1997 and December 2015. In these calculations, we used the numbers of drugs, ADRs, and total reports from the relevant month only. False discovery rate (FDR) was controlled using the Holm procedure (for each month separately), yielding q-values. In Supplementary file 1 for every statistically significant (in aggregate) ingredient – ADR association, we reported the numbers of months where q-values were lower than 0.05 and where q-values were higher than or equal to 0.05.\n\nGeneral aspects of statistics used for post-marketing pharmacovigilance\nSince spontaneous reports are not rigorously sampled from a population of patients with known exposure to the drugs of interest, incidence rates or relative risks cannot be computed. Instead, ratios of drug-event counts to intuitively plausible exposure measures, called disproportionality ratios, are commonly computed. Databases of prescription counts seem natural to use, as discussed in literature (Strom et al., 2013); however, these lead to difficulties in integrating two separate databases as well as ambiguities in the meaning of prescriptions, such as measuring number of months’ supply, geographic region of manufacture and dispensing, patient consumption, and so forth. Both FDA (Duggirala et al., 2016) and EMA (Eudravigilance Expert Working Group, 2006) guidance documents for analysis of spontaneous report databases by two of the world’s most prominent pharmaceutical regulatory bodies, focus on the use of disproportionality measures that can be computed from within a single database of spontaneous reports. PRR (Duggirala et al., 2016) and the closely related RRR defined above are straightforward measures computable from the simple 2 × 2 table of report counts classified by drug mentioned and event mentioned, while a slightly more complex (Mantel and Haenszel, 1959) computation can first stratify by possibly confounding variables such as patient gender and age, and calendar year of report, and then sum across strata to get an expected count to be compared to the observed count. The FDA report (Duggirala et al., 2016) also discusses the concept of Bayesian ‘shrinkage’ estimates (DuMouchel, 1999), which attempt to reduce the effects of variance in small samples by fitting the entire array of drug-event disproportionalities to a prior distribution and then using that to compute a posterior distribution for each individual disproportionality, resulting in a central estimate denoted EBGM (empirical Bayes geometric mean) as well as a 90% posterior range (EB05, EB95). In this paper, we use the simple measure RRR for several global computations across the FAERS database, and in some places present the presumably more reliable Bayesian measures when focusing on particular drug-events of interest.\n\nClustering of ADR by time evolution\nWe considered the numbers of reports in each month (time evolutions) for individual ADRs observed across FAERS for four drugs: rofecoxib, celecoxib, rosiglitazone, and pioglitazone. With knowledge of numbers of each of the considered drugs, ADRs, and the number of total reports in FAERS in each month, we calculated month-resolved RRR-values for the drug-ADR pairs. The time evolutions of the RRR-values were clustered for each drug using the partitioning method for maximum dissimilarity, as implemented in R (R Core Team, 2013) scored by the similarity (Pearson correlation coefficient) of time evolutions of RRR.\n\nLogistic regression models of myocardial infarction dependence on the use of celecoxib\nFor every FAERS report, we noted whether a) celecoxib was reported as the primary suspect drug, b) whether myocardial infarction was reported, c) the occupation of the person filing the report, and d) whether the reported event took place before 2005 (when rofecoxib was still on the market). Using this data and R’s implementation of binomial logistic regression (via the glm() function), we prepared four models (with the logit link function) (R Core Team, 2013) to investigate if myocardial infarction is associated with the use of celecoxib, the occupation of the person filing the report, and the report being filed before 2005. In each model, reporting myocardial infarction served as the output variable, and combinations of the remaining variables were used as input variables. Resulting models are summarized and described in more detail in Supplementary file 2.\n\nAnalysis of association between VEGF-R2 inhibition and hypertension\nApart from analysis described in this work, additional Bayesian data mining and statistical analysis of VEGF-R2 inhibition-related hypertension was based on the methods described in detail by DuMouchel (DuMouchel, 1999), DuMouchel and Pregibon (DuMouchel and Pregibon, 2001), Szarfman et al. (Szarfman et al., 2002), and Almenoff et al. (Almenoff et al., 2007).\n\nFunding Information\nThis paper was supported by the following grants:\n\nhttp://dx.doi.org/10.13039/100004336Novartis to Mateusz Maciejewski, Eugen Lounkine, Steven Whitebread, Pierre Farmer, William DuMouchel, Laszlo Urban.\n\nhttp://dx.doi.org/10.13039/100000002National Institutes of Health to Brian K. Shoichet.\n\nAcknowledgements\nMM was supported in the initial stage of this work by the NIBR Presidential Postdoctoral Fellowship co-mentored by LU and BKS. The work of BKS was supported by US National Institutes of Health Grant R01 GM71896 and by R35 GM122481. We thank Dr Duncan Armstrong for his comments and advice on the manuscript.\n\nAdditional information\nCompeting interests\nMM: Mateusz Maciejewski is an employee of Pfizer Inc.\n\nEL: Eugen Lounkine is an employee of Novartis Institutes for BioMedical Research.\n\nSW: Steven Whitebread is an employee of Novartis Institutes for BioMedical Research.\n\nPF: Pierre Farmer is an employee of Novartis Institutes for BioMedical Research.\n\nWD: Bill DuMouchel is an employee of Oracle Health Sciences.\n\nBKS: Brian K. Shoichet has previously consulted for Novartis.\n\nLU: Laszlo Urban is an employee of Novartis Institutes for BioMedical Research.\n\nAuthor contributions\nMM, Conceptualization, Data curation, Software, Formal analysis, Validation, Visualization, Methodology, Writing—original draft, Writing—review and editing.\n\nEL, Conceptualization, Software, Supervision, Validation, Writing—original draft, Writing—review and editing.\n\nSW, Validation, Methodology, Writing—original draft, Writing—review and editing.\n\nPF, Validation, Writing—review and editing.\n\nWD, Software, Validation, Methodology.\n\nBKS, Supervision, Validation, Methodology, Writing—original draft, Writing—review and editing.\n\nLU, Conceptualization, Formal analysis, Supervision, Validation, Methodology, Writing—original draft, Writing—review and editing.\n\nAdditional files\n10.7554/eLife.25818.014Supplementary file 1. A document containing multiple sheets with reported data: groups of case_ids of reports that were found to likely correspond to the same event; monthly fractions of reported ADRs in rofecoxib reports; monthly fractions of reported ADRs in celecoxib reports; monthly fractions of reported ADRs in rosiglitazone reports; monthly fractions of reported ADRs in pioglitazone reports; ingredient – ADR associations stemming from analysis of all reports; aggregation of ingredient – ADR associations resolved by month.\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.014\n\n 10.7554/eLife.25818.015Supplementary file 2. Summary of logistic regression models inspecting the dependence of reporting myocardial infarction on the use of celecoxib (Model 1: the following formula was used in R’s glm() function: has_adr~has_celecoxib), occupation of the party reporting celecoxib to cause myocardial infarction (Model 2: has_adr~has_celecoxib*occupation–occupation), time a celecoxib – myocardial infarction report was filed (Model 3: has_adr~has_celecoxib*before_2005–before_2005), and a combination of occupation and time (Model 4:has_adr~has_celecoxib*occupation*before_2005–occupation*before_2005).\n‘Physician’ was used as the reference level in Models 2 and 4 for the variables involving the occupation of the reporting party. Significance codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘‘1. The ‘:’ symbol separating two variable names denotes a variable representing an interaction between these two variables.\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.015\n\n 10.7554/eLife.25818.016Supplementary file 3. The Bayesian calculations used the program Empirica Signal and the version of FAERS offered commercially by Oracle Health Sciences.\nThe Oracle algorithms for detection of duplicate reports and determination of generic drug names yield slightly different counts than does the data preparation method described in the present paper, although computed adverse event rates are virtually identical. The columns for N, E, and EB05 shown in the table are as calculated by the Oracle program. Columns represent: Drug (Generic name) PT (MedDRA Preferred Term) N (Number of reports including both Drug and PT, 1997–2015, in the Oracle Health Sciences curation of FAERS) E (Expected value of N if Drug and PT are independent within each stratum, where strata are defined by all combinations of gender, age group and year of report) RR (Relative Reporting Rate = N/E) EBGM (Empirical Bayes Geometric Mean of estimated disproportionality) EB05 (Lower limit of Bayesian 90% confidence interval of true disproportionality) EB95 (Upper limit of Bayesian 90% confidence interval of true disproportionality)\n\nDOI:\nhttp://dx.doi.org/10.7554/eLife.25818.016\n\n 10.7554/eLife.25818.017Decision letter Watt Fiona M Reviewing editorKing's College London, United KingdomIn the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.\n\nThank you for submitting your article \"Reverse Translation of Adverse Event Reports Paves the Way for De-risking Preclinical Off-Targets\" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by Fiona Watt as the Reviewing and Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Ellen Berg (Reviewer #1); Keith Houck (Reviewer #2).\n\nThe reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.\n\nSummary:\n\nThis manuscript is a welcome in-depth study that investigates reports from the FDA's Adverse Event Reporting System (FAERS). In this era of big data, a large database such as FAERS, developed for post-marketing pharmacovigilance and containing more than 8.5 million reports, is enticing to mine for potential connections between drugs or drug classes and specific adverse events.\n\nThe authors have a successful track record of leveraging large databases of secondary pharmacology assay data to identify novel target-ADR connections, so this is an obvious extension of this work. There are critical differences, however. Secondary pharmacology assays are run under standardized conditions typically under the control of sponsor organizations. Data completeness and quality are substantially higher.\n\nThe authors recognize these differences and provide a quite thoughtful and useful investigation of issues related to the use of FAERS data. The issues cover: (1) drug naming and synonym aggregation; (2) errors in data entry; (3) diversity and patterns in the data depending on the report submitters (patients and lawyers in addition to health care professionals); and (4) reporting influences, such as news events and changes in prescription guidelines over time.\n\nMaciejewski et al. walk through these issues with detailed analysis on overall reports, as well as ADR reports for specific drugs including drug pairs and relevant comparators. Case studies include: COX-2 inhibitors, celecoxib versus rofecoxib; thiazolidinones, rosiglitazone versus pioglitazone; VEGFR2 inhibitors; and anti-psychotics. Overall the findings are well-supported and of interest to researchers in the field.\n\nEssential revisions:\n\nDiscussion. In the Discussion, it would be helpful to include specific recommendations for improving FAERS to facilitate this type of research, such as better classifications; improving reporting automation (to reduce misclassifying ADRs versus indications); curation; mapping drugs and synonyms to ingredients, etc. A more explicit discussion of the limitations of the approach such as the lack of prescription (exposure) information is required.\n\nMethods and materials. The authors use RRR as a metric, which reflects the relative reporting of one type of ADR among all of the ADRs reported for that drug. The authors should discuss other metrics such as normalizing reports to the number of prescriptions (if this is possible or not, advantages, disadvantages, etc.).\n\n10.7554/eLife.25818.018Author response Essential revisions:\n\n\n\nDiscussion. In the Discussion, it would be helpful to include specific recommendations for improving FAERS to facilitate this type of research, such as better classifications; improving reporting automation (to reduce misclassifying ADRs versus indications); curation; mapping drugs and synonyms to ingredients, etc. A more explicit discussion of the limitations of the approach such as the lack of prescription (exposure) information is required.\n\n\nThe suggestions about how to improve FAERS are well-taken (“…it would be helpful to include specific recommendations for improving FAERS…”). To address this critique, we have added several extensive passages to the Discussion section:\n\n“Matters can be improved when a drug is used in different indications with distinct symptoms and outcomes, enabling differentiation between disease- and drug-related outcomes. […] For now, the category “outcome” should be used cautiously for ADR analysis, especially in large-scale studies that aggregate data from several drugs.”\n\nWe also extended the Discussion section with the following additions based on the reviewers’ recommendations:\n\n“FAERS, an already valuable asset for clinicians and pharmaceutical scientists, could be improved in several ways to improve post-marketing pharmacovigilance. […]While this development would need investment, one could imagine undertaking it as part of a public-private partnership from which all would benefit.”\n\nMethods and materials. The authors use RRR as a metric, which reflects the relative reporting of one type of ADR among all of the ADRs reported for that drug. The authors should discuss other metrics such as normalizing reports to the number of prescriptions (if this is possible or not, advantages, disadvantages, etc.).\n\nA paragraph (including References) has been added that reviews the various types of disproportionality measures applied to drug-event combinations within spontaneous report databases. As stated we use a simple to compute and interpret measure RRR for many of our globally computed overviews, and more advanced Bayesian measures in a table focusing on particular combinations of interest:\n\nSince spontaneous reports are not rigorously sampled from a population of patients with known exposure to the drugs of interest, incidence rates or relative risks cannot be computed. Instead, ratios of drug-event counts to intuitively plausible exposure measures, called disproportionality ratios, are commonly computed. […] In this paper, we use the simple measure RRR for several global computations across the FAERS database, and in some places present the presumably more reliable Bayesian measures when focusing on particular drug-events of interest.\n==== Refs\nReferences\nAlladi CG Mohan A Shewade DG Rajkumar RP Adithan S Subramanian K 2017 Risperidone-Induced adverse drug reactions and role of DRD2 (-141 C ins/Del) and 5htr2c (-759 C>T) Genetic polymorphisms in patients with Schizophrenia Journal of Pharmacology & Pharmacotherapeutics 8 28 32 10.4103/jpp.JPP_197_16 28405133 \nAlmenoff JS Pattishall EN Gibbs TG DuMouchel W Evans SJ Yuen N 2007 Novel statistical tools for monitoring the safety of marketed drugs Clinical Pharmacology & Therapeutics 82 157 166 10.1038/sj.clpt.6100258 17538548 \nArakawa R Ito H Takano A Takahashi H Morimoto T Sassa T Ohta K Kato M Okubo Y Suhara T 2008 Dose-finding study of paliperidone ER based on striatal and extrastriatal dopamine D2 receptor occupancy in patients with schizophrenia Psychopharmacology 197 229 235 10.1007/s00213-007-1029-z 18058087 \nBayram M De Luca L Massie MB Gheorghiade M 2005 Reassessment of dobutamine, dopamine, and milrinone in the management of acute heart failure syndromes The American Journal of Cardiology 96 47 58 10.1016/j.amjcard.2005.07.021 16181823 \nBender A Scheiber J Glick M Davies JW Azzaoui K Hamon J Urban L Whitebread S Jenkins JL 2007 Analysis of pharmacology data and the prediction of adverse drug reactions and off-target effects from chemical structure ChemMedChem 2 861 873 10.1002/cmdc.200700026 17477341 \nBombardier C Laine L Reicin A Shapiro D Burgos-Vargas R Davis B Day R Ferraz MB Hawkey CJ Hochberg MC Kvien TK Schnitzer TJ VIGOR Study Group 2000 Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with rheumatoid arthritis. VIGOR Study Group New England Journal of Medicine 343 1520 1528 10.1056/NEJM200011233432103 11087881 \nBostwick JR Guthrie SK Ellingrod VL 2009 Antipsychotic-induced hyperprolactinemia Pharmacotherapy 29 64 73 10.1592/phco.29.1.64 19113797 \nBowes J Brown AJ Hamon J Jarolimek W Sridhar A Waldron G Whitebread S 2012 Reducing safety-related drug attrition: the use of in vitro pharmacological profiling Nature Reviews Drug Discovery 11 909 922 10.1038/nrd3845 23197038 \nBrown EG Wood L Wood S 1999 The medical dictionary for regulatory activities (MedDRA) Drug Safety 20 109 117 10.2165/00002018-199920020-00002 10082069 \nCalarge CA Ellingrod VL Acion L Miller DD Moline J Tansey MJ Schlechte JA 2009 Variants of the dopamine D2 receptor gene and risperidone-induced hyperprolactinemia in children and adolescents Pharmacogenetics and Genomics 19 373 382 10.1097/FPC.0b013e328329a60f 19339912 \nCenter for Drug Evaluation and Research 2015 Drug Safety and Availability - FDA Drug Safety Communication: FDA warns that DPP-4 inhibitors for type 2 diabetes may cause severe joint pain http://www.fda.gov/Drugs/DrugSafety/ucm459579.htm May, 25 2016 \nConsumers Union Consumer Reports Best Buy Drugs 2005 The NSAID drugs: prescriptions and prices http://consumersunion.org/pub/NSAIDsAnalysisFINAL.pdf May, 24 2016 \nCook D Brown D Alexander R March R Morgan P Satterthwaite G Pangalos MN 2014 Lessons learned from the fate of AstraZeneca's drug pipeline: a five-dimensional framework Nature Reviews Drug Discovery 13 419 431 10.1038/nrd4309 24833294 \nCorena-McLeod M 2015 Comparative Pharmacology of Risperidone and Paliperidone Drugs in R&D 15 163 174 10.1007/s40268-015-0092-x 25943458 \nCorreia Filho AG Bodanese R Silva TL Alvares JP Aman M Rohde LA 2005 Comparison of risperidone and methylphenidate for reducing ADHD symptoms in children and adolescents with moderate mental retardation Journal of the American Academy of Child & Adolescent Psychiatry 44 748 755 10.1097/01.chi.0000166986.30592.67 16034276 \nDevine M 2016 Adverse events: Refresher and updates http://www.snm.org/docs/mwm12/presentations/friday/adverse%20events%20refresher%20and%20updates-clinical%20trialsnetwork.pdf May, 24 2016 \nDowning NS Shah ND Aminawung JA Pease AM Zeitoun JD Krumholz HM Ross JS 2017 Postmarket Safety events among novel therapeutics approved by the US Food and Drug Administration between 2001 and 2010 JAMA 317 1854 1863 10.1001/jama.2017.5150 28492899 \nDuggirala HJ Tonning JM Smith E Bright RA Baker JD Ball R Bell C Bouri K Bright-Ponte SJ Botsis T Boyer M Burkhart K Condrey GS Chen JJ Chirtel S Filice RW Francis H Jiang H Levine J Martin D Oladipo T O’Neill R Palmer LAM Paredes A Rochester G Sholtes D Wong HL XU Z Szarfman A Kass-Hout T 2016 Data mining at FDA https://www.fda.gov/downloads/ScienceResearch/DataMiningatFDA/UCM443675.pdf April, 23 2016 \nDuMouchel W Pregibon D 2001 Empirical Bayes Screening for Multi-Item Associations ACM Press 67 76 \nDuMouchel W 1999 Bayesian Data Mining in Large Frequency Tables, with an Application to the FDA Spontaneous Reporting System The American Statistician 53 177 190 10.1080/00031305.1999.10474456 \nElashoff M Matveyenko AV Gier B Elashoff R Butler PC 2011 Pancreatitis, pancreatic, and thyroid Cancer with glucagon-like peptide-1-based therapies Gastroenterology 141 150 156 10.1053/j.gastro.2011.02.018 21334333 \nErcan ES Uysal T Ercan E Akyol Ardic U Ardıc UA 2012 Aripiprazole in children and adolescents with conduct disorder: a single-center, open-label study Pharmacopsychiatry 45 13 19 10.1055/s-0031-1286348 21993869 \nEudravigilance Expert Working Group 2006 Guideline on the use of statistical signal detection methods in the EudraVigilance data analysis system http://www.ema.europa.eu/docs/en_GB/document_library/Regulatory_and_procedural_guideline/2009/11/WC500011437.pdf May, 24 2016 \nEveritt B Skrondal A 2010 Standardized Mortality Rate (SMR) The Cambridge Dictionary of Statistics 409 New York Cambridge University Press \nFernández-Mayoralas DM Fernández-Jaén A Muñoz-Jareño N Calleja-Pérez B Fernández-Perrone AL Arribas SL 2012 Treatment with paliperidone in children with behavior disorders previously treated with risperidone: an open-label trial Clinical Neuropharmacology 35 227 230 10.1097/WNF.0b013e31826818cd 22935606 \nFriedman MA Woodcock J Lumpkin MM Shuren JE Hass AE Thompson LJ 1999 The safety of newly approved medicines: do recent market removals mean there is a problem? JAMA 281 1728 1734 10328074 \nGaulton A Bellis LJ Bento AP Chambers J Davies M Hersey A Light Y McGlinchey S Michalovich D Al-Lazikani B Overington JP 2012 ChEMBL: a large-scale bioactivity database for drug discovery Nucleic Acids Research 40 D1100 D1107 10.1093/nar/gkr777 21948594 \nGoldberg RB Kendall DM Deeg MA Buse JB Zagar AJ Pinaire JA Tan MH Khan MA Perez AT Jacober SJ GLAI Study Investigators 2005 A comparison of lipid and glycemic effects of pioglitazone and rosiglitazone in patients with type 2 diabetes and dyslipidemia Diabetes Care 28 1547 1554 10.2337/diacare.28.7.1547 15983299 \nGoodman LS Gilman A 1985 Goodman and Gilman’s the Pharmacological Basis of Therapeutics MacMillan USA \nGreene DA 1999 Rosiglitazone: a new therapy for type 2 diabetes Expert Opinion on Investigational Drugs 8 1709 1719 10.1517/13543784.8.10.1709 11139821 \nGVK Biosciences 2014 GVK Biosciences http://www.gvkbio.com/ 26th June 2014 \nHarpaz R DuMouchel W LePendu P Bauer-Mehren A Ryan P Shah NH 2013a Performance of pharmacovigilance signal-detection algorithms for the FDA adverse event reporting system Clinical Pharmacology & Therapeutics 93 539 546 10.1038/clpt.2013.24 23571771 \nHarpaz R DuMouchel W LePendu P Shah NH 2013b Empirical Bayes model to combine signals of adverse drug reactions Proceedings of the 19th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining ACM 1339 1347 \nHoffman KB Demakas AR Dimbil M Tatonetti NP Erdman CB 2014 Stimulated reporting: the impact of US food and drug administration-issued alerts on the adverse event reporting system (FAERS) Drug Safety 37 971 980 10.1007/s40264-014-0225-0 25255848 \nHolm SA 1979 simple sequentially rejective multiple test procedure Scandinavian Journal of Statistics 6 65 70 \nHoyert DL Xu J others 2012 Deaths: preliminary data for 2011 National Vital Statistics Reports : From the Centers for Disease Control and Prevention, National Center for Health Statistics, National Vital Statistics System 61 1 51 24984457 \nInternational Union of Pure and Applied Chemistry 2016 The IUPAC International Chemical Identifier (InChI) http://www.iupac.org/home/publications/e-resources/inchi.html May, 24 2016 \nJones E Oliphant T Peterson P 2001 SciPy: open Source Scientific Tools for Python http://www.scipy.org/ \nLasser KE Allen PD Woolhandler SJ Himmelstein DU Wolfe SM Bor DH 2002 Timing of new black box warnings and withdrawals for prescription medications JAMA 287 2215 2220 10.1001/jama.287.17.2215 11980521 \nLaw V Knox C Djoumbou Y Jewison T Guo AC Liu Y Maciejewski A Arndt D Wilson M Neveu V Tang A Gabriel G Ly C Adamjee S Dame ZT Han B Zhou Y Wishart DS 2014 DrugBank 4.0: shedding new light on drug metabolism Nucleic Acids Research 42 D1091 D1097 10.1093/nar/gkt1068 24203711 \nLawrence KR Adra M Gillman PK 2006 Serotonin toxicity associated with the use of linezolid: a review of postmarketing data Clinical Infectious Diseases 42 1578 1583 10.1086/503839 16652315 \nLazarou J Pomeranz BH Corey PN 1998 Incidence of adverse drug reactions in hospitalized patients: a meta-analysis of prospective studies JAMA 279 1200 1205 9555760 \nLee MY Hsiao PJ Yang YH Lin KD Shin SJ 2014 The association of pioglitazone and urinary tract disease in type 2 diabetic taiwanese: bladder Cancer and chronic kidney disease PLoS One 9 e85479 10.1371/journal.pone.0085479 24427312 \nLewis JD Ferrara A Peng T Hedderson M Bilker WB Quesenberry CP Vaughn DJ Nessel L Selby J Strom BL 2011 Risk of bladder Cancer among diabetic patients treated with pioglitazone: interim report of a longitudinal cohort study Diabetes Care 34 916 922 10.2337/dc10-1068 21447663 \nLincoff AM Wolski K Nicholls SJ Nissen SE 2007 Pioglitazone and risk of cardiovascular events in patients with type 2 diabetes mellitus: a meta-analysis of randomized trials JAMA 298 1180 1188 10.1001/jama.298.10.1180 17848652 \nLounkine E Keiser MJ Whitebread S Mikhailov D Hamon J Jenkins JL Lavan P Weber E Doak AK Côté S Shoichet BK Urban L 2012 Large-scale prediction and testing of drug activity on side-effect targets Nature 486 361 367 10.1038/nature11159 22722194 \nMackey AC Green L Liang LC Dinndorf P Avigan M 2007 Hepatosplenic T cell lymphoma associated with infliximab use in young patients treated for inflammatory bowel disease Journal of Pediatric Gastroenterology and Nutrition 44 265 267 10.1097/MPG.0b013e31802f6424 17255842 \nMannucci E Monami M Di Bari M Lamanna C Gori F Gensini GF Marchionni N 2010 Cardiac safety profile of rosiglitazone International Journal of Cardiology 143 135 140 10.1016/j.ijcard.2009.01.064 19328563 \nMantel N Haenszel W 1959 Statistical aspects of the analysis of data from retrospective studies of disease Journal of the National Cancer Institute 22 719 748 13655060 \nMcAdams M Staffa J Dal Pan G 2008 Estimating the extent of reporting to FDA: a case study of statin-associated rhabdomyolysis Pharmacoepidemiology and Drug Safety 17 229 239 10.1002/pds.1535 18175291 \nMedicinesComplete 2014 Indometacin: Martindale: The Complete Drug Reference https://www.medicinescomplete.com/mc/martindale/current/ms-2658-m.htm May, 24 2016 \nMoore N Lecointre D Noblet C Mabille M 1998 Frequency and cost of serious adverse drug reactions in a department of general medicine British Journal of Clinical Pharmacology 45 301 308 10.1046/j.1365-2125.1998.00667.x 9517375 \nMuller PY Dambach D Gemzik B Hartmann A Ratcliffe S Trendelenburg C Urban L 2015 Integrated risk assessment of suicidal ideation and behavior in drug development Drug Discovery Today 20 1135 1142 10.1016/j.drudis.2015.05.010 26022402 \nMuller PY Milton MN 2012 The determination and interpretation of the therapeutic index in drug development Nature Reviews Drug Discovery 11 751 761 10.1038/nrd3801 22935759 \nNelson SJ Zeng K Kilbourne J Powell T Moore R 2011 Normalized names for clinical drugs: rxnorm at 6 years Journal of the American Medical Informatics Association 18 441 448 10.1136/amiajnl-2011-000116 21515544 \nNguyen TQ Lewis JH 2014 Sumatriptan-associated ischemic colitis: case report and review of the literature and FAERS Drug Safety 37 109 121 10.1007/s40264-013-0134-7 24442762 \nNissen SE Wolski K 2007 Effect of rosiglitazone on the risk of myocardial infarction and death from cardiovascular causes New England Journal of Medicine 356 2457 2471 10.1056/NEJMoa072761 17517853 \nO'Connell KA Wood JJ Wise RP Lozier JN Braun MM 2006 Thromboembolic adverse events after use of recombinant human coagulation factor VIIa JAMA 295 293 298 10.1001/jama.295.3.293 16418464 \nOleksiewicz MB Southgate J Iversen L Egerod FL 2008 Rat Urinary Bladder Carcinogenesis by Dual-Acting PPARα+γAgonists PPAR Research 2008 1 14 10.1155/2008/103167 \nPacker M Carver JR Rodeheffer RJ Ivanhoe RJ DiBianco R Zeldis SM Hendrix GH Bommer WJ Elkayam U Kukin ML 1991 Effect of oral milrinone on mortality in severe chronic heart failure. the PROMISE Study Research Group The New England Journal of Medicine 325 1468 1475 10.1056/NEJM199111213252103 1944425 \nPiccinni C Motola D Marchesini G Poluzzi E 2011 Assessing the association of pioglitazone use and bladder Cancer through drug adverse event reporting Diabetes Care 34 1369 1371 10.2337/dc10-2412 21515844 \nR Core Team 2013 R: A language and environment for statistical computing http://www.R-project.org/ \nRELX Intellectual Properties SA 2016 PharmaPendium https://www.pharmapendium.com May, 24 2016 \nRichelson E 1996 Synaptic effects of antidepressants Journal of Clinical Psychopharmacology 16 1S 7 10.1097/00004714-199606002-00001 8784643 \nRostom A Dubé C Lewin G Tsertsvadze A Barrowman N Code C Sampson M Moher D U.S. Preventive Services Task Force 2007 Nonsteroidal anti-inflammatory drugs and cyclooxygenase-2 inhibitors for primary prevention of colorectal Cancer: a systematic review prepared for the U.S. Preventive Services Task Force Annals of Internal Medicine 146 376 389 10.7326/0003-4819-146-5-200703060-00010 17339623 \nRothman RB Baumann MH Savage JE Rauser L McBride A Hufeisen SJ Roth BL 2000 Evidence for possible involvement of 5-HT(2B) receptors in the cardiac valvulopathy associated with fenfluramine and other serotonergic medications Circulation 102 2836 2841 10.1161/01.CIR.102.23.2836 11104741 \nSchondelmeyer SW Purvis L 2014 Rx Price Watch Report http://www.aarp.org/content/dam/aarp/ppi/2014-11/rx-price-watch-report-AARP-ppi-health.pdf May, 24 2016 \nShively BK Roldan CA Gill EA Najarian T Loar SB 1999 Prevalence and determinants of valvulopathy in patients treated with dexfenfluramine Circulation 100 2161 2167 10.1161/01.CIR.100.21.2161 10571975 \nSinghal S Mehta J Desikan R Ayers D Roberson P Eddlemon P Munshi N Anaissie E Wilson C Dhodapkar M Zeddis J Barlogie B 1999 Antitumor activity of thalidomide in refractory multiple myeloma New England Journal of Medicine 341 1565 1571 10.1056/NEJM199911183412102 10564685 \nSmith U 2001 Pioglitazone: mechanism of action International Journal of Clinical Practice. Supplement 13 18 11594239 \nSolomon SD McMurray JJ Pfeffer MA Wittes J Fowler R Finn P Anderson WF Zauber A Hawk E Bertagnolli M Adenoma Prevention with Celecoxib (APC) Study Investigators 2005 Cardiovascular risk associated with celecoxib in a clinical trial for colorectal adenoma prevention New England Journal of Medicine 352 1071 1080 10.1056/NEJMoa050405 15713944 \nStrom BL Kimmel SE Hennessy S 2013 Textbook of Pharmacoepidemiology Wiley-Blackwell \nSzarfman A Machado SG O'Neill RT 2002 Use of screening algorithms and computer systems to efficiently signal higher-than-expected combinations of drugs and events in the US FDA's spontaneous reports database Drug Safety 25 381 392 10.2165/00002018-200225060-00001 12071774 \nTatonetti NP Ye PP Daneshjou R Altman RB 2012 Data-driven prediction of drug effects and interactions Science Translational Medicine 4 125 125 ra31 10.1126/scitranslmed.3003377 22422992 \nThomson Reuters 2016 Thomson Reuters Integrity http://thomsonreuters.com/integrity/ May, 24 2016 \nThomson Scientific 2016 World Drug Index http://thomsonreuters.com/world-drug-index/ May, 24 2016 \nU.S. Food and Drug Administration 2016 Antidepressant Use in Children, Adolescents, and Adults http://www.fda.gov/Drugs/DrugSafety/InformationbyDrugClass/ucm096273.htm May, 24 2016 \nU.S. Food and Drug Administration 2016 COX-2 Selective (includes Bextra, Celebrex, and Vioxx) and Non-Selective Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) https://www.fda.gov/Drugs/DrugSafety/PostmarketDrugSafetyInformationforPatientsandProviders/ucm429364.htm May, 24 2016 \nU.S. Food and Drug Administration 2016 openFDA https://open.fda.gov/ May, 24 2016 \nU.S. Food and Drug Administration 2016 Questions and Answers on FDA's Adverse Event Reporting System (FAERS) http://www.fda.gov/Drugs/GuidanceComplianceRegulatoryInformation/Surveillance/AdverseDrugEffects/ May, 24 2016 \nRoth BL Lopez E Patel S Kroeze WK 2000 The Multiplicity of Serotonin Receptors: Uselessly Diverse Molecules or an Embarrassment of Riches? The Neuroscientist 6 252 262 10.1177/107385840000600408 \nUrban L Maciejewski M Lounkine E Whitebread S Jenkins JL Hamon J Fekete A Muller PY 2014 Translation of off-target effects: prediction of ADRs by integrated experimental and computational approach Toxicol. Res. 3 433 444 10.1039/C4TX00077C \nWang L Jiang G Li D Liu H 2013 Standardizing drug adverse event reporting data Studies in Health Technology and Informatics 192 1101 23920875 \nWooster MB Luzier AB 1999 Reteplase: a new thrombolytic for the treatment of acute myocardial infarction Annals of Pharmacotherapy 33 318 324 10.1345/aph.18006 10200858 \nWysowski DK Swartz L 2005 Adverse drug event surveillance and drug withdrawals in the United States, 1969-2002: the importance of reporting suspected reactions Archives of Internal Medicine 165 1363 1369 10.1001/archinte.165.12.1363 15983284 \nYates F 1934 Contingency tables involving small numbers and the χ 2 test Supplement to the Journal of the Royal Statistical Society 1 217 235 10.2307/2983604 \nZhu X Wu S Dahut WL Parikh CR 2007 Risks of proteinuria and hypertension with bevacizumab, an antibody against vascular endothelial growth factor: systematic review and meta-analysis American Journal of Kidney Diseases 49 186 193 10.1053/j.ajkd.2006.11.039 17261421\n\n", "fulltext_license": "CC BY", "issn_linking": "2050-084X", "issue": "6()", "journal": "eLife", "keywords": "FAERS; adverse drug reactions; big data; data analysis; human; human biology; medicine", "medline_ta": "Elife", "mesh_terms": "D016907:Adverse Drug Reaction Reporting Systems; D006801:Humans; D000069437:Pharmacological Phenomena; D011358:Product Surveillance, Postmarketing; D014481:United States; D014486:United States Food and Drug Administration", "nlm_unique_id": "101579614", "other_id": null, "pages": null, "pmc": null, "pmid": "28786378", "pubdate": "2017-08-08", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D052061:Research Support, N.I.H., Extramural", "references": "22422992;17261421;9517375;16418464;17477341;10571975;17339623;11980521;18175291;16652315;17255842;17538548;18058087;23571771;25255848;22935759;10200858;21447663;24427312;19339912;22935606;11594239;24833294;1944425;24442762;19197366;21993869;10564685;11139821;15983284;28405133;16034276;24984457;10082069;21515844;13655060;25943458;8784643;21948594;26209436;12071774;22722194;26022402;21515544;16181823;9555760;15983299;28492899;19328563;17848652;17517853;24203711;23197038;11104741;19113797;15713944;11087881;23920875;21334333;10328074", "title": "Reverse translation of adverse event reports paves the way for de-risking preclinical off-targets.", "title_normalized": "reverse translation of adverse event reports paves the way for de risking preclinical off targets" }
[ { "companynumb": "US-CELGENEUS-USA-20170805208", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LENALIDOMIDE" }, "drugadditional": "3", ...
{ "abstract": "T-cell large granular lymphocytic leukaemia (T-LGLL) is an incurable leukaemia characterised by clonal proliferation of abnormal cytotoxic T cells that can result in severe neutropenia, transfusion-dependent anaemia and pancytopenia requiring treatment. The most commonly used agents, methotrexate (MTX), cyclophosphamide (Cy) and cyclosporine primarily produce partial remissions (PRs), with few complete responses (CRs). We evaluated the clinical course and treatment response of 60 consecutive patients with T-LGLL to evaluate clinical outcomes and future potential treatment directions. Impaired overall survival was noted among male patients, patients with elevated lactate dehydrogenase, and those without rheumatoid arthritis. Cy was the most efficacious second-line agent, with a 70% overall response rate (ORR; three CR, four PR). All patients who failed frontline MTX responded to second-line Cy. In the relapsed or Cy-refractory setting, alemtuzumab (n = 4) and pentostatin (n = 3) had an ORR of 50% and 66%, respectively, while duvelisib induced a long-term response in one patient. In this large, retrospective analysis, our results suggest Cy is a highly effective therapy for second-line treatment in T-LGLL and should be considered a strong candidate for up-front therapy in select high-risk patients. Prospective studies evaluating pentostatin, alemtuzumab and novel agents, such as duvelisib, are needed for patients with relapsed/refractory T-LGLL.", "affiliations": "Department of Internal Medicine, The Ohio State University, Columbus, OH, USA.;Division of Hematologic Malignancies and Hematopoietic Stem Cell Transplantation, Department of Medical Oncology and Department of Cancer Biology, Sydney Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA, USA.;Division of Nursing, James Comprehensive Cancer Center, The Ohio State University, Columbus, OH, USA.;Department of Pathology, James Comprehensive Cancer Center, The Ohio State University, Columbus, OH, USA.;Division of Hematologic Malignancies and Hematopoietic Stem Cell Transplantation, Department of Medical Oncology, Sydney Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA, USA.;Division of Hematology, Department of Internal Medicine, James Comprehensive Cancer Center, The Ohio State University, Columbus, OH, USA.", "authors": "Braunstein|Zachary|Z|0000-0003-2517-9943;Mishra|Anjali|A|;Staub|Annette|A|;Freud|Aharon G|AG|;Porcu|Pierluigi|P|;Brammer|Jonathan E|JE|", "chemical_list": "D000970:Antineoplastic Agents; D015649:Pentostatin; D000074323:Alemtuzumab; D016572:Cyclosporine; D003520:Cyclophosphamide; D008727:Methotrexate", "country": "England", "delete": false, "doi": "10.1111/bjh.16808", "fulltext": null, "fulltext_license": null, "issn_linking": "0007-1048", "issue": "192(3)", "journal": "British journal of haematology", "keywords": "T cell; T-cell large granular lymphocytic leukaemia; leukaemia; overall response rate; therapeutics", "medline_ta": "Br J Haematol", "mesh_terms": "D000368:Aged; D000074323:Alemtuzumab; D000970:Antineoplastic Agents; D003520:Cyclophosphamide; D016572:Cyclosporine; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D054066:Leukemia, Large Granular Lymphocytic; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D015649:Pentostatin; D011379:Prognosis; D012189:Retrospective Studies", "nlm_unique_id": "0372544", "other_id": null, "pages": "484-493", "pmc": null, "pmid": "32519348", "pubdate": "2021-02", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": null, "title": "Clinical outcomes in T-cell large granular lymphocytic leukaemia: prognostic factors and treatment response.", "title_normalized": "clinical outcomes in t cell large granular lymphocytic leukaemia prognostic factors and treatment response" }
[ { "companynumb": "US-PFIZER INC-2020235586", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHOTREXATE SODIUM" }, "drugadditional": "3",...
{ "abstract": "Hand-foot syndrome (HFS) is a relatively frequent adverse reaction to certain anticancer drugs. HFS is a type of dermatitis which has been most commonly described with 5-fluorouracil and capecitabine. However, HFS with paclitaxel is rare and has been reported sparingly in the literature. A 52-year-old male patient with recurrent carcinoma of the buccal mucosa was started on palliative chemotherapy regimen, injection paclitaxel (175 mg/m2) in combination with injection carboplatin. On post-chemotherapy day 13, the patient started developing pain, dysesthesia followed by bullae formation, and desquamation over palms and soles. Clinically, the patient had Grade 3 HFS characterized by symmetrical, tender skin lesions over the dorsal aspect of palms, and soles with desquamation necessitating interruption of treatment. Therefore, this case has been presented to be cognizant with this rare form of side effect with one of the most commonly used drug in oncology.", "affiliations": "Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India.;Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India.;Department of Medical Oncology, GCRI, Ahmedabad, Gujarat, India.;Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India.;Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India.;Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India.", "authors": "Kataria|Pritam S|PS|;Kendre|Pradip P|PP|;Patel|Apurva A|AA|;Tahiliani|Nahush|N|;Bhargav|Vijay|V|;Parekh|Honey|H|", "chemical_list": "D000972:Antineoplastic Agents, Phytogenic; D017239:Paclitaxel", "country": "India", "delete": false, "doi": "10.4103/ijp.IJP_547_17", "fulltext": "\n==== Front\nIndian J PharmacolIndian J PharmacolIJPharmIndian Journal of Pharmacology0253-76131998-3751Medknow Publications & Media Pvt Ltd India IJPharm-50-28410.4103/ijp.IJP_547_17Drug WatchRare occurrence of hand-foot syndrome due to paclitaxel: A rare case report Kataria Pritam S. Kendre Pradip P. Patel Apurva A. 1Tahiliani Nahush Bhargav Vijay Parekh Honey Department of Medical and Paediatric Oncology, GCRI, Ahmedabad, Gujarat, India1 Department of Medical Oncology, GCRI, Ahmedabad, Gujarat, IndiaAddress for correspondence: Dr. Apurva Ashok Patel, Department of Medical Oncology, GCRI, Ahmedabad - 380 016, Gujarat, India. E-mail: shrutavpatel@rediffmail.comSep-Oct 2018 50 5 284 286 07 11 2017 04 12 2018 Copyright: © 2018 Indian Journal of Pharmacology2018This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.Hand-foot syndrome (HFS) is a relatively frequent adverse reaction to certain anticancer drugs. HFS is a type of dermatitis which has been most commonly described with 5-fluorouracil and capecitabine. However, HFS with paclitaxel is rare and has been reported sparingly in the literature. A 52-year-old male patient with recurrent carcinoma of the buccal mucosa was started on palliative chemotherapy regimen, injection paclitaxel (175 mg/m2) in combination with injection carboplatin. On post-chemotherapy day 13, the patient started developing pain, dysesthesia followed by bullae formation, and desquamation over palms and soles. Clinically, the patient had Grade 3 HFS characterized by symmetrical, tender skin lesions over the dorsal aspect of palms, and soles with desquamation necessitating interruption of treatment. Therefore, this case has been presented to be cognizant with this rare form of side effect with one of the most commonly used drug in oncology.\n\nKeywords:\nHand-foot syndromepaclitaxelpyridoxine\n==== Body\nIntroduction\nHand-foot syndrome (HFS) is a relatively frequent adverse reaction to certain anticancer chemotherapies. The syndrome can present initially as erythema, dysesthesias, and swelling of palms and soles, and can further progress to the stage of blisters formation and rarely ulceration.[1] This sequence of events can limit daily functions and may affect the quality of life. The most commonly implicated drug is 5-fluorouracil or its prodrug or oral capecitabine. Treatment of this syndrome is generally supportive. Paclitaxel-induced HFS is rare, with few case reports in the literature.\n\nCase Report\nA 52-year-old gentleman, known case of carcinoma buccal mucosa on palliative chemotherapy, presented to us with complaints of pain, erythema, and desquamation over dorsal aspect of the hand and soles 7 days before presentation (Grade 3). On further enquiry, the patient had taken the first cycle of injectable chemotherapy, i.e., injection paclitaxel (260 mg) in combination with carboplatin (500 mg) 20 days prior. On examination, the dorsal aspect of the bilateral hands and feet showed the presence of erythema and desquamation [Figures 1–3]. On taking the drug history, as per the literature review, injection paclitaxel is known to cause hand-foot-mouth syndrome albeit rarely with only few case reports addressing the same. As per the Naranjo Scale, the causality score was 7, and as per the scale, the causality is “probable.” The other drug, i.e., carboplatin which formed the chemotherapy doublet in our case, has never been mentioned in the literature to cause to cause HFS. Hence, as per the literature review and causality score on Naranjo Scale, paclitaxel-induced hand-foot-mouth syndrome was kept as the tentative diagnosis. The patient was given supportive care, topical emollients, tablet pyridoxine (Vitamin B6). After 10 days, there was gradual resolution of the signs and symptoms. From the subsequent cycles, chemotherapy regimen was changed to methotrexate + 5-fluorouracil weekly as patient treatment intent was palliative and we did not re-challenge the patient with the paclitaxel.\n\nFigure 1 Bilateral feet showing erythema with desquamation\n\nFigure 2 Bilateral dorsum of hand showing erythema with desquamation\n\nFigure 3 Bilateral feet showing erythema with desquamation\n\nDiscussion\nHFS, also known as palmar-plantar erythrodysesthesia, acral erythema, or Burgdorf reaction, was described in 1974 in a patient receiving mitotane (Lysodren).[2] Since then, various drugs causing HFS has been described, for example, infusional 5-fluorouracil, capecitabine,[3] vinorelbine, liposomal doxorubicin, hydroxyurea, mercaptopurine, intravenous cyclosporine, methotrexate, cyclophosphamide, cytosine arabinoside, sunitinib, and sorafenib.\n\nSymptoms of HFS can occur as early as 24 h after treatment initiation or as late as 10 months after treatment continuation.[24]\n\nVarious mechanisms explaining the occurrence of HFS are as follows:\n\n\nChemotherapy drug leak out of the capillaries into the hands and feet damaging the surrounding tissues[5]\n\nHigh proliferation rate of epidermal basal cells in the palms making them more sensitive to the local action of cytotoxic drugs[6]\n\nConcentration of drugs within eccrine sweat glands of palms and soles[7]\n\nRepeated friction and pressure over palms, soles, and fingertips increases the predisposition to this syndrome.[6]\n\n\n\n\nThe symptoms usually start as a localized numbness, tingling, dysesthesia or paresthesia, and erythema over the palms and soles. They can be accompanied by swelling and discomfort. In severe cases, blistering, ulceration, desquamation, and incapacitating pain occur.\n\nGrading of HFS is done according to the National Cancer Institute and the World Health Organization scale.[8]\n\nThree major histologic features central to the HFS are dyskeratotic keratinocytes at various stages of necrosis, basal layer vacuolar degeneration, and mild perivascular or lichenoid lymphocyte-predominant infiltrate.[49]\n\nOnly recommendation available with respect to the management of HFS includes drug discontinuation or modification. Some measures that have been suggested for the alleviation of symptoms include cold compresses, application of emollients, and avoidance of mechanical stress on the affected areas. Other supportive measures include tablet pyridoxine[10] and analgesics if pain is present. Paclitaxel-induced HFS is rare and is being reported sparingly in the literature.[10111213] Hence, in this case, paclitaxel-induced HFS was a tentative diagnosis based on the literature review, Naranjo scale causality score. In our case, paclitaxel was discontinued as the intent of the treatment was palliative; however, in other case report by Assi et al.,[13] paclitaxel was continued safely without any further resurgence of the HFS manifestation. This case has been presented to earmark rarer side effect of paclitaxel so that one must be aware of it because they can be easily confused with bacterial or fungal infections, leading to florid presentation if dose modification or change of therapy is not done and supportive therapy is not given.\n\nLearning points\n\nHFS though rare with paclitaxel, this rare side effect must be borne in mind\n\nIn case of paclitaxel, careful adjustment of dose may be required.\n\n\n\n\nDeclaration of patient consent\nThe authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\nReferences\n1 Lassere Y Hoff P Management of hand-foot syndrome in patients treated with capecitabine (Xeloda) Eur J Oncol Nurs 2004 8 Suppl 1 S31 40 15341880 \n2 Scheithauer W Blum J Coming to grips with hand-foot syndrome. Insights from clinical trials evaluating capecitabine Oncology (Williston Park) 2004 18 1161 8, 1173 15471200 \n3 Surjushe A Vasani R Medhekar S Thakre M Saple DG Hand-foot syndrome due to capecitabine Indian J Dermatol 2009 54 301 2 20161873 \n4 Lipworth AD Robert C Zhu AX Hand-foot syndrome (hand-foot skin reaction, palmar-plantar erythrodysesthesia): Focus on sorafenib and sunitinib Oncology 2009 77 257 71 19923864 \n5 Akash S Bhounsule AS Oral capecitabine – Can it cause the hand-foot syndrome? J Clin Diagn Res 2011 5 376 786 \n6 Milano G Etienne-Grimaldi MC Mari M Lassalle S Formento JL Francoual M Candidate mechanisms for capecitabine-related hand-foot syndrome Br J Clin Pharmacol 2008 66 88 95 18341672 \n7 Clark AS Vahdat LT Chemotherapy-induced palmar-plantar erythrodysesthesia syndrome: Etiology and emerging therapies Support Cancer Ther 2004 1 213 8 18628145 \n8 Nagore E Insa A Sanmartín O Antineoplastic therapy-induced palmar plantar erythrodysesthesia ('hand-foot') syndrome. Incidence, recognition and management Am J Clin Dermatol 2000 1 225 34 11702367 \n9 Bardia A Loprinzi CL Goetz MP Hand-foot syndrome after dose-dense adjuvant chemotherapy for breast cancer: A case series J Clin Oncol 2006 24 e18 9 16648492 \n10 Farr KP Safwat A Palmar-plantar erythrodysesthesia associated with chemotherapy and its treatment Case Rep Oncol 2011 4 229 35 21537373 \n11 Lal HS Hand and foot syndrome secondary to capecitabine Indian J Dermatol Venereol Leprol 2014 80 427 30 25201844 \n12 Dow E Piccolo J Segal E Charlson J Drug induced periarticular thenar erythema with onycholysis related to nano-albumin bound paclitaxel therapy Cancer Treat Res Commun 2016 4 162 4 \n13 Assi HA Ayoub ZA Jaber SM Sibai HA El Saghir NS Management of paclitaxel-induced hand-foot syndrome Breast Care (Basel) 2013 8 215 7 24415973\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "0253-7613", "issue": "50(5)", "journal": "Indian journal of pharmacology", "keywords": "Hand-foot syndrome; paclitaxel; pyridoxine", "medline_ta": "Indian J Pharmacol", "mesh_terms": "D000972:Antineoplastic Agents, Phytogenic; D060831:Hand-Foot Syndrome; D006801:Humans; D008297:Male; D008875:Middle Aged; D009061:Mouth Mucosa; D009062:Mouth Neoplasms; D017239:Paclitaxel", "nlm_unique_id": "7902477", "other_id": null, "pages": "284-286", "pmc": null, "pmid": "30636833", "pubdate": "2018", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "11702367;15341880;15471200;16648492;18341672;18628145;19923864;20161873;21537373;24415973;25201844", "title": "Rare occurrence of hand-foot syndrome due to paclitaxel: A rare case report.", "title_normalized": "rare occurrence of hand foot syndrome due to paclitaxel a rare case report" }
[ { "companynumb": "IN-ACCORD-103229", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CARBOPLATIN" }, "drugadditional": "3", "drug...
{ "abstract": "Pseudallescheria boydii is a fungal organism known to affect immunocompromised patients. This organism is known to cause, in severe cases, invasive infection of various organs such as the central nervous, cardiovascular, and respiratory systems. We report an unusual case of pulmonary P. boydii pneumonia in an immunocompromised critically ill patient with a co-infection of Aspergillus fumigatus and Aspergillus terreus with ARDS. This case highlights the importance of a high index of suspicion for superimposed fungal infections in patients who are critically ill and immunocompromised. Uncommon fungal pathogens should be considered in the differential diagnosis of respiratory failure, especially if diagnostic markers such as galactomannan (from BAL and serum) or 1,3-beta-D-glucan are elevated. Further diagnostic interventions are warranted when insufficient clinical improvement is observed to prevent treatment failure and adverse outcomes.", "affiliations": "II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany. Tobias.Lahmer@mri.tum.de.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.;II. Medizinische Klinik und Poliklinik, Klinikum rechts der Isar der Technischen Universität München, Ismaninger Str. 22, 81675, Munich, Germany.", "authors": "Lahmer|Tobias|T|;Messer|Marlena|M|;Ehmer|Ursula|U|;Eser|Stefan|S|;Beitz|Analena|A|;Fekecs|Lisa|L|;Schmid|Roland M|RM|;Huber|Wolfgang|W|", "chemical_list": "D000935:Antifungal Agents; D008351:Mannans; D013845:Thienamycins; D047071:beta-Glucans; C012990:galactomannan; D000666:Amphotericin B; C033363:beta-1,3-glucan; D000077731:Meropenem; D017291:Clarithromycin; D000069349:Linezolid; D065819:Voriconazole; D005690:Galactose", "country": "Netherlands", "delete": false, "doi": "10.1007/s11046-015-9952-8", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-486X", "issue": "181(3-4)", "journal": "Mycopathologia", "keywords": "Aspergillus fumigatus; Aspergillus terreus; Critically ill; Pseudallescheria boydii", "medline_ta": "Mycopathologia", "mesh_terms": "D000368:Aged; D000666:Amphotericin B; D000935:Antifungal Agents; D001228:Aspergillosis; D001232:Aspergillus fumigatus; D017291:Clarithromycin; D060085:Coinfection; D016638:Critical Illness; D015199:Extracorporeal Membrane Oxygenation; D005690:Galactose; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D016867:Immunocompromised Host; D000069349:Linezolid; D008297:Male; D008351:Mannans; D000077731:Meropenem; D011014:Pneumonia; D011541:Pseudallescheria; D045169:Severe Acute Respiratory Syndrome; D013845:Thienamycins; D066027:Transplant Recipients; D065819:Voriconazole; D047071:beta-Glucans", "nlm_unique_id": "7505689", "other_id": null, "pages": "267-71", "pmc": null, "pmid": "26455910", "pubdate": "2016-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "21367728;18845830;1323256;17605752;16088460;24740084;20147646;21482725;17624561;11751112;16268926;8389611;17607669;1534693;20618330;22198786;16333082;17714363;19403905;19886801;17578780;19158282", "title": "Pseudallescheria boydii with Aspergillus fumigatus and Aspergillus terreus in a Critically Ill Hematopoietic Stem Cell Recipient with ARDS.", "title_normalized": "pseudallescheria boydii with aspergillus fumigatus and aspergillus terreus in a critically ill hematopoietic stem cell recipient with ards" }
[ { "companynumb": "DE-MYLANLABS-2017M1015309", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "MELPHALAN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nExtracorporeal shock wave lithotripsy (ESWL) is a noninvasive modality to treat urolithiasis, with complications including tissue damage and hematoma of kidney parenchyma. Anti-glomerular basement membrane (GBM) disease is suggested to be a rare complication of ESWL since it was reported in several cases to occur after ESWL. However, the clinical and immunological features of the ESWL-associated anti-GBM disease have not been fully investigated so far.\n\n\nMETHODS\nHere, we present the clinical, pathological, and immunological characteristics of three patients with the post-ESWL anti-GBM disease in our hospital. Anti-GBM disease occurred within a median of 22 months after ESWL treatment. It presented with similar clinical features to the classic anti-GBM disease, including fever, gross hematuria, and rapidly progressive glomerulonephritis (RPGN) with poor renal prognosis. Sera from all patients recognized the α3(IV)NC1 in GBM, but with IgG2 and IgG4 as the dominant IgG subclasses.\n\n\nCONCLUSIONS\nAlthough further exploration is required to prove the causal relationship in this rare condition, our study reminds physicians that patients developing acute renal insufficiency after ESWL should lead to the suspicion of anti-GBM disease and in-time diagnosis and treatment.", "affiliations": "Renal Division, Peking University First Hospital, Beijing, China.;Renal Division, Peking University First Hospital, Beijing, China.;Renal Division, Peking University First Hospital, Beijing, China.;Renal Division, Peking University First Hospital, Beijing, China.;Renal Division, Peking University First Hospital, Beijing, China.", "authors": "Wang|Beining|B|;Xiaoyu|Jia|J|;Yu|Xiaojuan|X|;Cui|Zhao|Z|;Zhao|Minghui|M|", "chemical_list": "D001324:Autoantigens; D024141:Collagen Type IV; D007074:Immunoglobulin G; C057112:type IV collagen alpha3 chain", "country": "England", "delete": false, "doi": "10.1080/0886022X.2020.1869042", "fulltext": "\n==== Front\nRen Fail\nRen Fail\nRenal Failure\n0886-022X\n1525-6049\nTaylor & Francis\n\n33435789\n10.1080/0886022X.2020.1869042\n1869042\nVersion of Record\nReport\nBrief Report\nThe clinical and immunological features of the post-extracorporeal shock wave lithotripsy anti-glomerular basement membrane disease\nB. Wang et al.\nWang Beining abcde\nXiaoyu Jia abcde\nYu Xiaojuan abcde\nCui Zhao abcde\nZhao Minghui abcdef\na Renal Division, Peking University First Hospital, Beijing, China\nb Institute of Nephrology, Peking University, Beijing, China\nc Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, China\nd Key Laboratory of CKD Prevention and Treatment, Ministry of Education of China, Beijing, China\ne Research Units of Diagnosis and Treatment of Immune-mediated Kidney Diseases, Chinese Academy of Medical Sciences, Beijing, China\nf Peking-Tsinghua Center for Life Sciences, Beijing, China\nSupplemental data for this article can be accessed here.\n\nCONTACT Minghui Zhao mhzhao@bjmu.edu.cnRenal Division, Peking University First Hospital, No. 8 Xishiku Street, Xicheng District, 100034Beijing, China\n12 1 2021\n2021\n43 1 149155\n© 2021 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.\n2021\nThe Author(s)\nhttps://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nIntroduction\n\nExtracorporeal shock wave lithotripsy (ESWL) is a noninvasive modality to treat urolithiasis, with complications including tissue damage and hematoma of kidney parenchyma. Anti-glomerular basement membrane (GBM) disease is suggested to be a rare complication of ESWL since it was reported in several cases to occur after ESWL. However, the clinical and immunological features of the ESWL-associated anti-GBM disease have not been fully investigated so far.\n\nCase Presentation\n\nHere, we present the clinical, pathological, and immunological characteristics of three patients with the post-ESWL anti-GBM disease in our hospital. Anti-GBM disease occurred within a median of 22 months after ESWL treatment. It presented with similar clinical features to the classic anti-GBM disease, including fever, gross hematuria, and rapidly progressive glomerulonephritis (RPGN) with poor renal prognosis. Sera from all patients recognized the α3(IV)NC1 in GBM, but with IgG2 and IgG4 as the dominant IgG subclasses.\n\nConclusion\n\nAlthough further exploration is required to prove the causal relationship in this rare condition, our study reminds physicians that patients developing acute renal insufficiency after ESWL should lead to the suspicion of anti-GBM disease and in-time diagnosis and treatment.\n\nKeywords\n\nESWL\nlithotripsy\nanti-glomerular basement membrane disease\nantigen\nThis work was supported by the National Natural Science Foundation of China [grant number 81870482] and CAMS Innovation Fund for Medical Sciences [grant number 2019-I2M-5-046].\n==== Body\nIntroduction\n\nAnti-glomerular basement membrane (GBM) disease or Goodpasture (GP) disease is a rare but fulminant and fatal disorder. It is widely accepted as a prototypical autoimmune disease induced by autoantibodies targeting the glomerular and alveolar basement membrane [1,2]. The well-defined autoantigen is localized to the non-collagen domain (NC1) of the α3 chain of type IV collagen [α3(IV)NC1] in GBM [3]. In addition, the autoantibodies have been proven to recognize the other 4 α chains (α1, 2, 4, and 5) within type IV collagen [4,5]. Two conformational epitopes, EA and EB, were mapped inside α3(IV)NC1 [6] and sequestered within the GBM in healthy individuals [7]. It is still unknown how the immune tolerance would be breached and epitopes exposed. One of the accepted mechanisms is that factors such as smoking [8], hydrocarbon exposure [9], infection [10], or preceding glomerular diseases [11–13] would damage the basement membrane and unmask the epitopes [14]. Rare cases have been reported about anti-GBM diseases associated with urinary obstruction [15–18] or nephrectomy [19].\n\nExtracorporeal shock wave lithotripsy (ESWL) is a common and noninvasive modality to treat urolithiasis, disintegrating stones by shock waves. Although generally safe [20], it could cause short-term complications as renal colic or obstruction by stone fragments, tissue damage or hematoma, and even temporary reduction of glomerular filtration rate [21]. Renal histopathological findings of human and animal models shortly after ESWL included focal damage to vascular endothelium, nephron, renal tubules, and interstitia [20,22–24]. In 1990, Guerin et al. first reported a 67-year-old male with rapidly progressive renal disfunction 7 months after ESWL. His serum anti-GBM antibody was positive, while the serum before ESWL was not [25]. Since then, there have been several case reports about the post-ESWL anti-GBM disease, proposing anti-GBM disease as a rare complication of ESWL [26–29]. However, the causal relationship between the two has not been elucidated yet, nor the antigen spectrum or IgG subclasses of the autoantibodies in this rare entity.\n\nIn this study, we identified three patients with the post-ESWL anti-GBM disease after retrospectively reviewing 166 consecutive patients diagnosed with the anti-GBM disease in Peking University First Hospital from January 1, 2010 to January 31, 2020. We analyzed their clinical, pathological, and immunological features and reviewed five previously reported cases, aiming to draw a more comprehensive picture and bring insight into possible etiologies of this rare condition.\n\nCase report\n\nCase 1\n\nA 36-year-old male was otherwise healthy except for undergoing one session of ESWL for kidney stones 24 months ago. Kidney function (represented as serum creatinine) was normal. Twenty-four months later, he presented with fever, cough, and hemoptysis for 5 days. He was anemic with hemoglobin 75 g/L and serum creatinine was 691 μmol/L (eGFR, 8 mL/min/1.73m2). Two days later, he developed gross hematuria and serum creatinine rose to 884 μmol/L (eGFR, 6 mL/min/1.73m2), at which time he was referred to our hospital. He was a long-term cigarette smoker and had gasoline exposure 15 days ago.\n\nOn admission, he was pale and febrile with no lymphadenopathy. Breath sounds were weak in both lungs on auscultation. Serum creatinine rapidly increased to 1279 μmol/L (eGFR, 4 mL/min/1.73m2) with oliguria and hemoglobin decreased to 49 g/L. Chest radiography suggested bilateral pulmonary hemorrhage. The circulating anti-GBM antibody was positive, with the titer >200 RU/mL (Euroimmune ELISA kit, normal range <20 RU/mL), while the serum anti-neutrophil cytoplasmic antibody (ANCA) was undetected (Table 1).\n\nTable 1. Clinical, pathological, and immunological features of patients with post-ESWL anti-GBM disease in our hospital.\n\n \tPatient 1\tPatient 2\tPatient 3\t\nSex/age, y\tM/36\tM/50\tF/74\t\nHydrocarbon exposure (Y/N)\tY\tN\tN\t\nSmoking (Y/N)\tY\tY\tN\t\nProdromal infection (Y/N)\tY\tN\tY\t\nFever (Y/N)\tY\tY\tY\t\nPulmonary hemorrhage (Y/N)\tY\tN\tN\t\nGross hematuria (Y/N)\tY\tY\tY\t\nOliguria/Anuria (Y/N)\tY\tN\tY\t\nHemoglobin on diagnosis, g/L\t49.0\t102.0\t63.0\t\nSerum albumin, g/L\t30.0\t27.1\t29.0\t\nUrinary protein, g/24h\t2.0\t1.6\t0.6\t\nNephrotic syndrome (Y/N)\tN\tN\tN\t\nSerum creatinine on diagnosis, μmol/L\t1279\t364\t1066\t\neGFR on diagnosis, mL/min/1.73m2\t4.0\t15.0\t3.0\t\nAnti-GBM antibodies on diagnosis, RU/mL\t>200\t183\t196\t\nPositive ANCA (Y/N)\tN\tN\tN\t\nTreatment\tPE/MP/Pred/CTX\tPE/MP/Pred\tMP/Pred/CTX\t\nAnti-GBM antibody on discharge, RU/mL\t33\t51\t102\t\nSerum creatinine on discharge, μmol/L\t425\t353\t618\t\neGFR on discharge, mL/min/1.73 m2\t14.0\t16.3\t5.3\t\nDialysis-dependent on discharge (Y/N)\tN\tY\tY\t\nDuration of follow-up, m\t3\t60\t48\t\nDialysis-dependent at last follow-up (Y/N)\tN\tY (PD)\tY (HD)\t\nDeath at last follow-up (Y/N) (cause of death)\tN\tN\tY (Esophagus cancer)\t\nStone location\tkidney\tureter\tkidney\t\nTotal ESWL number\t1\t1\t1\t\nESWL-to-onset interval, m\t24\t22\t10\t\nAnti-α1(IV)NC1 antibody (ref range, <0.04)\t0.06\t0.89\t0.33\t\nAnti-α2(IV)NC1 antibody (ref range, <0.05)\t0.01\t0.83\t0.12\t\nAnti-α3(IV)NC1 antibody (ref range, <0.06)\t2.11\t2.08\t2.15\t\nAnti-α4(IV)NC1 antibody (ref range, <0.58)\t0.27\t1.43\t0.70\t\nAnti-α5(IV)NC1 antibody (ref range, <0.02)\t0.00\t0.48\t0.10\t\nAnti-α3EA antibody (ref range, <0.07)\t1.39\t1.67\t1.61\t\nAnti-α3EB antibody (ref range, <0.15)\t0.59\t1.54\t1.35\t\nAnti-α3(IV)NC1 IgG1 (ref range, <0.02)\t0.68\t0.57\t0.73\t\nAnti-α3(IV)NC1 IgG2 (ref range, <0.07)\t1.51\t1.32\t1.25\t\nAnti-α3(IV)NC1 IgG3 (ref range, <0.01)\t0.53\t0.49\t0.63\t\nAnti-α3(IV)NC1 IgG4 (ref range, <0.01)\t2.34\t0.56\t0.43\t\nM: male; F: female; eGFR: estimated glomerular filtration rate; GBM: glomerular basement membrane; ANCA: anti-neutrophil cytoplasmic antibody; PE: plasma exchange; MP: methylprednisolone pulse; Pred: prednisone; CTX: cyclophosphamide; PD: peritoneal dialysis; HD: hemodialysis; ESWL: extracorporeal shock wave lithotripsy; IgG: immunoglobulin G; ref: reference; Y: yes; N: no.\n\nAnti-GBM disease was diagnosed based on the renal-pulmonary involvement and positive serum anti-GBM antibody. The patient was prompted to plasma exchange, intravenous methylprednisolone pulse treatment, cyclophosphamide, and hemodialysis. After 17 sessions of plasma exchange, he became afebrile without hemoptysis. His serum anti-GBM antibody decreased to 33 RU/ml and serum creatine to 425 μmol/L (eGFR, 14 mL/min/1.73m2). Repeated chest radiography indicated the absorption of his hemorrhage. He was dialysis-independent on discharge and a 3-month follow-up.\n\nSera from this patient were tested for antigen spectrum using recombinant human α1–5(IV)NC1 chains and chimeric proteins containing epitopes EA and EB on α3(IV)NC1 (Supplementary materials and methods). The patient's serum recognized α1 and α3(IV)NC1 domains, and both epitopes EA and EB of α3(IV)NC1. The immunoglobulin G (IgG) subclass distribution against α3(IV)NC1 was also tested for the sera. All 4 subclasses of IgG were detected, with the dominance of IgG2 and IgG4 (Table 1; Figure S1).\n\nFigure 1. Renal pathology of patient 3 with post-extracorporeal shock wave lithotripsy (ESWL) anti-GBM disease showed cellular crescent formation in a glomerulus by periodic acid-silver methenamine and Masson trichrome stain on light microscopy (400×).\n\nCase 2\n\nA 50-year-old male undertook one session of ESWL for ureter stones with normal kidney function 22 months ago. He was a 20-year cigarette smoker but had quit smoking for 10 years. Twenty-two months later he was referred to our hospital for fever, gross hematuria, and rapidly progressive renal dysfunction. He had suffered from intermittent fever for 2 months without other indicating symptoms and it could not be resolved by antibiotics. Fifteen days prior to admission, he developed gross hematuria and the serum creatinine progressed from 160 μmol/L (eGFR, 40 mL/min/1.73m2) to 504 μmol/L (eGFR, 11 mL/min/1.73m2). No stones were found by renal ultrasound.\n\nAfter admission, he was diagnosed with anti-GBM disease due to positive serum anti-GBM antibody (183 RU/mL). His serum ANCA was tested negative. He received 7 sessions of plasma exchange, intravenous methylprednisolone pulse treatment, and hemodialysis. His condition improved and hematuria disappeared afterward. Serum creatinine decreased to 353 μmol/L (eGFR, 16 mL/min/1.73m2) and anti-GBM antibody titer to 51 RU/mL on discharge. The patient was dialysis-dependent during a 60-month follow-up (Table 1).\n\nThe patient's sera reacted with all five α chains and both EA and EB epitopes of α3(IV)NC1. All 4 IgG subclasses to α3(IV)NC1 were detected with the dominance of IgG2 (Table 1; Figure S1).\n\nCase 3\n\nA 74-year-old female received one session of ESWL for kidney stones 10 months ago when the renal function was normal. Ten months after ESWL, she complained of fever and gross hematuria with urinary irritation symptoms for 2 weeks. No leukocytosis was found, but her urinalysis revealed white and red blood cells. Initial workups showed elevated C-reactive protein (96 mg/L) and normal serum creatinine (87 μmol/L; eGFR, 55 mL/min/1.73m2). Renal ultrasound showed no stones. She was diagnosed with urinary tract infection and treated by intravenous antibiotics, after which she reported no symptom improvement but developed oliguria and bilateral edema of lower extremities. Her serum creatinine deteriorated to 1066 μmol/L (eGFR, 3 mL/min/1.73m2) within 9 days. Then she was referred to our hospital.\n\nOn admission, physical examination revealed a sick and pale woman with no rales on auscultation. Serum anti-GBM antibody was positive (196 RU/mL) while the serum ANCA was not. Renal biopsy revealed severe necrosis of glomerular capillary walls and cellular/cellular-fibrous crescents in all 32 glomeruli on light microscopy (Figure 1), with no electron-dense deposits on electron microscopy. The immunofluorescence microscopy was negative on a sclerotic glomerulus. She was treated by methylprednisolone pulse and cyclophosphamide. Plasma exchange was not performed, given the poor prognosis based on renal biopsy. Her renal function did not recover and she remained dialysis-dependent. The patient died of esophagus cancer 2 years after discharge.\n\nThe patient's sera recognized all five α chains and both EA and EB epitopes of α3(IV)NC1. As for circulating IgG to α3(IV)NC1, all four subclasses were detected with the dominance of IgG2 (Table 1; Figure S1).\n\nDiscussion\n\nIn this study, we described three patients with anti-GBM disease occurring within 2 years after ESWL. The incidence of such cases among all anti-GBM patients from our hospital in the past 10 years was 1.81% (3/166). Their clinical manifestations, pathological features, and antigen spectrum were similar to the classic anti-GBM disease. All three patients presented with fever, gross hematuria, and rapidly progressive glomerulonephritis (RPGN) with poor renal prognosis. One of them suffered from pulmonary hemorrhage. The one available renal biopsy revealed 100% crescent formation in the glomeruli. All three patients recognized a3(IV)NC1 and EA/EB epitopes. None were positive for anti-neutrophil cytoplasmic antibody (ANCA).\n\nPost-ESWL anti-GBM disease has been rarely reported. After searching in PubMed using keywords ‘anti-GBM’, ‘Goodpasture’, ‘ESWL’, and ‘lithotripsy’, we found five previous cases of the post-ESWL anti-GBM disease with full text in English, reviewed in Table 2. Among the five patients, three of them were male and two were female, with a median age of 67 years old (range, 32–72 years). Human leukocyte antigen (HLA) phenotyping was performed in all five patients, with four of them expressing susceptible serotypes for anti-GBM disease [30]. All previous cases presented with shorter ESWL-to-onset intervals (1 week to 7 months) than ours, possibly due to more ESWL treatment numbers. Renal damage by ESWL appears to be cumulative in animal experiments and human, proportional to the application frequency and the number of treatments [31–33]. Their clinical manifestations, renal pathologies, and prognosis were similar to ours. Specifically, fever occurred in all previous reports and ours. However, only a few of them (3/8, 37.5%) were reported to bear prodromal infections and none in either group were positive for ANCA. Fever was a common feature in anti-GBM disease patients, as shown in our previous study in a 140-patient cohort, and 78.7% of febrile patients had infections [34]. The infection rate in post-ESWL anti-GBM disease patients seemed to be lower, which might indicate distinct disease triggers other than prodromal infections in these patients.\n\nTable 2. Clinical and pathological data of previously reported post-ESWL anti-GBM disease cases.\n\n \t1\t2\t3\t4\t5\t\nAuthors\tCranfield et al.\tSellin et al.\tXenocostas et al.\tIwamoto et al.\tGuerin et al.\t\nPublication year\t2015\t2005\t1999\t1998\t1990\t\nSex/age, y\tF/67\tM/32\tM/72\tF/37\tM/67\t\nHydrocarbon exposure (Y/N)\tNA\tNA\tNA\tNA\tNA\t\nSmoking (Y/N)\tNA\tNA\tNA\tNA\tY\t\nProdromal infection (Y/N)\tN\tN\tY\tN\tN\t\nFever (Y/N)\tY\tY\tY\tY\tY\t\nPulmonary hemorrhage(Y/N)\tY\tN\tN\tN\tN\t\nGross hematuria (Y/N)\tNA\tY\tN\tY\tNA\t\nSerum creatinine on diagnosis, μmol/L\t1179\t919\tNA\t1114\t1074\t\nPositive anti-GBM antibody(Y/N)\tY\tY\tY\tY\tY\t\nPositive ANCA (Y/N)\tN\tNA\tN\tN\tN\t\nHLA phenotype\tDR4, DQ6\tDRB1*11 & 13\tDR15\tDR2\tDR2\t\nTreatment\tPE/MP/Pred/CTX\tPred/CTX\tNA\tPE/MP/Pred/CTX\tNA\t\nDialysis-dependent (Y/N)\tY\tY\tY\tY\tY\t\nRenal biopsy (Y/N)\tNA\tY\tY\tY\tY\t\nImmunofluorescence\tNA\tLinear IgG deposits along GBM\tLinear IgG deposits along GBM\tLinear IgG and C3 deposits along GBM\tLinear IgG and C3 deposits along GBM\t\nLight microscopy\tNA\tCrescent formation in 23/25 glomeruli\tCrescent formation in nearly all glomeruli\tCellular crescents in all glomeruli\tCellular crescents in all glomeruli\t\nElectron-dense deposits on electron microscopy\tNA\tNA\tN\tN\tNA\t\nStone location\tNA\tInfundibulum\tLeft renal pelvis\tRight kidney\tLeft kidney\t\nStone component\tNA\tCalcium oxalate\tNA\tNA\tNA\t\nTotal ESWL number\t2 within 4 weeks\t3 within 4 months\t1\tNA\t2 within 10 days\t\nESWL-to-onset interval\t1 week\t5 months\t3 months\t3 months\t7 months\t\nShock number\t3200\tNA\t4000\t1000\tNA\t\nEnergy data\t75 kPa\tNA\tNA\t17 kV\tNA\t\nRenal function at last ESWL\tNA\tNA\tNormal\tNormal\tNormal\t\nAnti-GBM antibody before ESWL\tNA\tNA\tNA\tNegative\tNegative\t\nF: female; M: male; GBM: glomerular basement membrane; ANCA: anti-neutrophil cytoplasmic antibody; HLA: human leukocyte antigen; PE: plasma exchange; MP: methylprednisolone pulse; Pred: prednisone; CTX: cyclophosphamide; IgG: immunoglobulin G; C3: complement 3; ESWL: extracorporeal shock wave lithotripsy; ref: reference; Y: yes; N: no; NA: not available.\n\nFurther studies are still needed to elucidate the effect of ESWL on the initiation of anti-GBM disease. However, there has been evidence about the collagen cleaving effect of ultrasound since early 1980s when researchers tried to isolate and define the components of GBM by physical methods. Glomeruli were sequestered and sonicated to separate the GBM, which then released split products of collagen with antigenicity [35], indicating ultrasound could cause local damage of the GBM. There was also evidence of transient nephrotic-range proteinuria immediately after ESWL in a patient cohort [36] and mesangial proliferative glomerulopathy after ESWL in experimental animal models of pig [37]. Moreover, shock wave lithotripsy is utilized in pancreatic and large common bile duct stones or sialolithiasis, but no cases of anti-GBM disease have been reported in either of these conditions yet, suggesting ESWL for urinary stones may affect kidneys more directly. Therefore, ESWL could possibly damage and expose the antigen inside the GBM via direct damage by shock waves or secondary damage by immune-complex induced by ESWL debris [37].\n\nAnti-GBM IgG subclass distribution is associated with disease severity [38]. The IgG1 and IgG3 dominated the IgG subclasses in patients with severe renal impairment, while IgG2 and IgG4 were associated with milder renal damage [38]. In post-ESWL anti-GBM disease patients from this study, the IgG2 and IgG4 were the dominant subclasses against α3(IV)NC1. However, these patients presented with severe renal damage and poor prognosis. The IgG subclass switching after B cell activation follows the sequence of IgG3→IgG1→IgG2→IgG4. It has been suggested that IgG4 production results from chronic or repetitive antigenic stimulation [39,40]. Moreover, low-level natural anti-GBM autoantibodies existed in healthy human sera, predominantly of IgG2 and IgG4 [41]. We speculated that ESWL might expose GBM autoantigens and induce IgG autoantibodies chronically during the ESWL-to-onset interval, allowing them to complete subclass switching. The autoantibodies may accumulate beyond a threshold to disturb the immune tolerance in healthy individuals and provoke the pathogenic autoimmunity.\n\nAnti-GBM diseases were also reported scarcely to associate with obstructive uropathy due to urinary malignancy, neurogenic bladder, or ureteral stenosis [15–18]. The anti-GBM antibody level and renal function seemed to be parallel with treatment efficacy of hydronephrosis [18]. Intact NC1 hexamer could be detected in the serum and be secreted in the urine of healthy individuals [17,42]. Rabbits immunized with their own urinary concentrate developed anti-GBM glomerulonephritis [43]. It was suggested that urinary α3(IV)NC1 under urinary obstruction might enter the renal interstitia, dissociate under acidic pH changed by inflammatory infiltrate (such as infection) and act as an immunogen [17]. These studies provide another theory for the induction of anti-GBM disease associated with urinary stones, including patients treated by ESWL.\n\nThe limitations of our study lay in at least two points. Firstly, the number of cases is too small to draw the causal relationship between ESWL and anti-GBM disease. Moreover, we cannot rule out the possibility that individuals with anti-GBM disease or with susceptible HLA phenotypes may bear a higher risk of urinary obstructions, which lead to the production of anti-GBM antibodies. A prospective cohort study in patients undergoing ESWL might be required to further elucidate the relationship between the procedure and anti-GBM disease. Secondly, not all patients had detailed ESWL information (stone component, shock wave frequency, and energy), kidney biopsy, and HLA phenotypes for us to draw a full picture.\n\nIn summary, the anti-GBM disease could happen within weeks to months after ESWL treatment and present with similar clinical features, antigen spectrum, and prognosis to classic anti-GBM disease. IgG2 and IgG4 were the two dominant subclasses against α3(IV)NC1. Although the causal relationship between ESWL and anti-GBM disease still needs further exploration, our study here may act as a reminder for physicians that patients developing acute renal insufficiency after ESWL should lead to the suspicion of anti-GBM disease and in-time diagnosis and treatment.\n\nSupplementary Material\n\nSupplemental Material\n\nClick here for additional data file.\n\nGeolocation information\n\nCity: Beijing, Latitude: 39.9289, Longitude: 116.3883.\n\nEthical policy and institutional review board statement\n\nWritten informed consents were obtained from the patients for publication of the three cases and any accompanying images. The experiments in this study complied with the Declaration of Helsinki and were approved by the ethics committee of Peking University First Hospital.\n\nDisclosure statement\n\nNo potential conflict of interest was reported by the author(s).\n==== Refs\nReferences\n\n1 McAdoo SP, Pusey CD. Anti-glomerular basement membrane disease. Clin J Am Soc Nephrol. 2017;12 (7 ):1162–1172.28515156\n2 Cashman SJ, Pusey CD, Evans DJ. Extraglomerular distribution of immunoreactive Goodpasture antigen. J Pathol. 1988;155 (1 ):61–70.3288737\n3 Saus J, Wieslander J, Langeveld JPM, et al. Identification of the Goodpasture antigen as the α3(IV) chain of collagen IV. J Biol Chem. 1988;263 (26 ):13374–13380.3417661\n4 Hellmark T, Johansson C, Wieslander J. Characterization of anti-GBM antibodies involved in Goodpasture's syndrome. Kidney Int. 1994;46 (3 ):823–829.7527877\n5 Yang R, Hellmark T, Zhao J, et al. Antigen and epitope specificity of anti-glomerular basement membrane antibodies in patients with goodpasture disease with or without anti-neutrophil cytoplasmic antibodies. JASN. 2007;18 (4 ):1338–1343.17329569\n6 Netzer KO, Leinonen A, Boutaud A, et al. The goodpasture autoantigen. Mapping the major conformational epitope(s) of alpha3(IV) collagen to residues 17-31 and 127-141 of the NC1 domain. J Biol Chem. 1999;274 (16 ):11267–11274.10196215\n7 Hudson BG, Tryggvason K, Sundaramoorthy M, et al. Alport's syndrome, Goodpasture's syndrome, and type IV collagen. N Engl J Med. 2003;348 (25 ):2543–2556.12815141\n8 Donaghy M, Rees A. Cigarette smoking and lung haemorrhage in glomerulonephritis caused by autoantibodies to glomerular basement membrane. Lancet. 1983;322 (8364 ):1390–1393.\n9 Stevenson A, Yaqoob M, Mason H, et al. Biochemical markers of basement membrane disturbances and occupational exposure to hydrocarbons and mixed solvents. QJM. 1995;88 (1 ):23–28.7534597\n10 Couser WG, Johnson RJ. The etiology of glomerulonephritis: roles of infection and autoimmunity. Kidney Int. 2014;86 (5 ):905–914.24621918\n11 Olson SW, Arbogast CB, Baker TP, et al. Asymptomatic autoantibodies associate with future anti-glomerular basement membrane disease. JASN. 2011;22 (10 ):1946–1952.21868497\n12 Basford AW, Lewis J, Dwyer JP, et al. Membranous nephropathy with crescents. J Am Soc Nephrol. 2011;22 (10 ):1804–1808.21903992\n13 Jia XY, Hu SY, Chen JL, et al. The clinical and immunological features of patients with combined anti-glomerular basement membrane disease and membranous nephropathy. Kidney Int. 2014;85 (4 ):945–952.24048374\n14 Pedchenko V, Bondar O, Fogo AB, et al. Molecular architecture of the Goodpasture autoantigen in anti-GBM nephritis. N Engl J Med. 2010;363 (4 ):343–354.20660402\n15 Bazari H, Mauiyyedi S. Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 4-2002. A 75-year-old man with acute renal failure five months after cystoprostatectomy and urethrectomy for carcinoma. N Engl J Med. 2002;346 (5 ):353–360.11821513\n16 Blas A, 3rd, McGill R, Sandroni S. Case 4-2002: cancer-associated obstruction and glomerular damage. N Engl J Med. 2002;346 (22 ):1751–1752.\n17 Weber M, Pullig O, Boesken WH. Anti-glomerular basement membrane disease after renal obstruction. The Lancet. 1990;336 (8713 ):512–513.\n18 Takeuchi Y, Takeuchi E, Kamata K. A possible clue for the production of anti-glomerular basement membrane antibody associated with ureteral obstruction and hydronephrosis. Case Rep Nephrol Dial. 2015;5 (1 ):87–95.25960997\n19 O'Hagan E, Mallett T, Convery M, et al. Anti-GBM disease after nephrectomy for xanthogranulomatous pyelonephritis in a patient expressing HLA DR15 major histocompatibility antigens: a case report. Clin Nephrol Case Stud. 2015;3 :25–30.29043130\n20 Türk C, Petřík A, Sarica K, et al. EAU guidelines on interventional treatment for urolithiasis. Eur Urol. 2016;69 (3 ):475–482.26344917\n21 Skolarikos A, Alivizatos G, de la Rosette J. Extracorporeal shock wave lithotripsy 25 years later: complications and their prevention. Eur Urol. 2006;50 (5 ):981–990; discussion 90.16481097\n22 Karlsen SJ, Smevik B, Hovig T. Acute morphological changes in canine kidneys after exposure to extracorporeal shock waves. A light and electron microscopic study. Urol Res. 1991;19 (2 ):105–115.1853513\n23 Recker F, Hofmann W, Bex A, et al. Quantitative determination of urinary marker proteins: a model to detect intrarenal bioeffects after extracorporeal lithotripsy. Journal of Urology. 1992;148 (3 Part 2 ):1000–1006.\n24 Delvecchio F, Auge BK, Munver R, et al. Shock wave lithotripsy causes ipsilateral renal injury remote from the focal point: the role of regional vasoconstriction. J Urol. 2003;169 (4 ):1526–1529.12629408\n25 Guerin V, Rabian C, Droz D, et al. Anti-glomerular-basement-membrane disease after lithotripsy. Lancet. 1990;335 (8693 ):856–857.\n26 Iwamoto I, Yonekawa S, Takeda T, et al. Anti-glomerular basement membrane nephritis after extracorporeal shock wave lithotripsy. Am J Nephrol. 1998;18 (6 ):534–537.9845831\n27 Xenocostas A, Jothy S, Collins B, et al. Anti-glomerular basement membrane glomerulonephritis after extracorporeal shock wave lithotripsy. Am J Kidney Dis. 1999;33 (1 ):128–132.9915278\n28 Sellin L, Quack I, Weiner SM, et al. Nephrolithiasis and hematuria-sometimes a stony road to diagnosis. Clin Nephrol. 2005;64 (2 ):151–154.16114792\n29 Cranfield A, Mathavakkannan S. Goodpasture's disease following extracorporeal shock wave lithotripsy: a case report & literature review. Clin Case Rep. 2015;3 (3 ):160–164.25838905\n30 Fisher M, Pusey CD, Vaughan RW, et al. Susceptibility to anti-glomerular basement membrane disease is strongly associated with HLA-DRB1 genes. Kidney Int. 1997;51 (1 ):222–229.8995737\n31 Koga H, Matsuoka K, Noda S, et al. Cumulative renal damage in dogs by repeated treatment with extracorporeal shock waves. Int J Urol. 1996;3 (2 ):134–140.8689508\n32 Kang DH, Cho KS, Ham WS, et al. Comparison of high, intermediate, and low frequency shock wave lithotripsy for urinary tract stone disease: systematic review and network meta-analysis. PLoS One. 2016;11 (7 ):e0158661 27387279\n33 Chung JM, Park BK, Kim JH, et al. Impact of repeated extracorporeal shock wave lithotripsy on prepubertal rat kidney. Urolithiasis. 2018;46 (6 ):549–558.29119224\n34 Gu QH, Xie LJ, Jia XY, et al. Fever and prodromal infections in anti-glomerular basement membrane disease. Nephrology (Carlton.). 2018;23 (5 ):476–482.28261931\n35 Lubec G. Anti-glomerular basement membrane disease after lithotripsy. Lancet. 1990;335 (8702 ):1405.\n36 Gilbert BR, Riehle RA, Vaughan ED. Extracorporeal shock wave lithotripsy and its effect on renal function. J Urol. 1988;139 (3 ):482–485.3343731\n37 Banner B, Ziesmer D, Collins LA. Proliferative glomerulopathy following extracorporeal shock wave lithotripsy in the pig. Journal of Urology. 1991;146 (5 ):1425–1428.\n38 Zhao J, Yan Y, Cui Z, et al. The immunoglobulin G subclass distribution of anti-GBM autoantibodies against rHalpha3(IV)NC1 is associated with disease severity. Hum Immunol. 2009;70 (6 ):425–429.19364515\n39 Magnusson CG, Cesbron JY, Djurup R, et al. Raised serum IgG4 levels in patients with atopy and filariasis: application of an automated particle-counting immunoassay using monoclonal antibody. Int Arch Allergy Appl Immunol. 1986;81 (3 ):238–244.3533790\n40 Ljungstrom I, Hammarstrom L, Kociecka W, et al. The sequential appearance of IgG subclasses and IgE during the course of Trichinella spiralis infection. Clin Exp Immunol. 1988;74 (2 ):230–235.3224442\n41 Cui Z, Wang HY, Zhao MH. Natural autoantibodies against glomerular basement membrane exist in normal human sera. Kidney Int. 2006;69 (5 ):894–899.16518348\n42 Schuppan D, Besser M, Schwarting R, et al. Radioimmunoassay for the carboxy-terminal cross-linking domain of type IV (basement membrane) procollagen in body fluids. Characterization and application to collagen type IV metabolism in fibrotic liver disease. J Clin Invest. 1986;78 (1 ):241–248.3722378\n43 Lerner RA, Dixon FJ. The induction of acute glomerulonephritis in rabbits with soluble antigens isolated from normal homologous and autologous urine. J Immunol. 1968;100 (6 ):1277–1287.4177027\n\n", "fulltext_license": "CC BY", "issn_linking": "0886-022X", "issue": "43(1)", "journal": "Renal failure", "keywords": "ESWL; anti-glomerular basement membrane disease; antigen; lithotripsy", "medline_ta": "Ren Fail", "mesh_terms": "D058186:Acute Kidney Injury; D000328:Adult; D000368:Aged; D019867:Anti-Glomerular Basement Membrane Disease; D001324:Autoantigens; D024141:Collagen Type IV; D005260:Female; D005921:Glomerulonephritis; D006801:Humans; D007074:Immunoglobulin G; D007668:Kidney; D007669:Kidney Calculi; D008096:Lithotripsy; D008297:Male; D008875:Middle Aged", "nlm_unique_id": "8701128", "other_id": null, "pages": "149-155", "pmc": null, "pmid": "33435789", "pubdate": "2021-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "6140495;21903992;1975024;1853513;7534597;3417661;21868497;1942314;27387279;28515156;17329569;1969580;19364515;3288737;24621918;3722378;11821513;12629408;12815141;9845831;20660402;16518348;28261931;1971687;29043130;16481097;26344917;8689508;10196215;7527877;16114792;4177027;12037161;3533790;29119224;3224442;9915278;8995737;24048374;3343731;1507316;25838905;25960997", "title": "The clinical and immunological features of the post-extracorporeal shock wave lithotripsy anti-glomerular basement membrane disease.", "title_normalized": "the clinical and immunological features of the post extracorporeal shock wave lithotripsy anti glomerular basement membrane disease" }
[ { "companynumb": "CN-LUPIN PHARMACEUTICALS INC.-2021-21531", "fulfillexpeditecriteria": "2", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "METHYLPREDNISOLONE" }, "drugad...
{ "abstract": "A case of tardive dyskinesia presenting with severe dysphagia as the predominant feature is described. Diagnosis was delayed because clinically apparent orofacial dyskinetic movements were minimal. The symptoms resolved following the cessation of neuroleptic medication.", "affiliations": "National Hospital for Neurology and Neurosurgery, London, UK.", "authors": "Gregory|R P|RP|;Smith|P T|PT|;Rudge|P|P|", "chemical_list": "D005475:Flupenthixol; D002746:Chlorpromazine", "country": "England", "delete": false, "doi": "10.1136/jnnp.55.12.1203", "fulltext": null, "fulltext_license": null, "issn_linking": "0022-3050", "issue": "55(12)", "journal": "Journal of neurology, neurosurgery, and psychiatry", "keywords": null, "medline_ta": "J Neurol Neurosurg Psychiatry", "mesh_terms": "D001714:Bipolar Disorder; D002746:Chlorpromazine; D003680:Deglutition Disorders; D004409:Dyskinesia, Drug-Induced; D005260:Female; D005475:Flupenthixol; D006801:Humans; D008875:Middle Aged; D009460:Neurologic Examination; D013375:Substance Withdrawal Syndrome", "nlm_unique_id": "2985191R", "other_id": null, "pages": "1203-4", "pmc": null, "pmid": "1479401", "pubdate": "1992-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "1783912;3400500;5806804;6614762;7332858;2964174;3155611;5366522;6121548;1998879", "title": "Tardive dyskinesia presenting as severe dysphagia.", "title_normalized": "tardive dyskinesia presenting as severe dysphagia" }
[ { "companynumb": "GB-MYLANLABS-2018M1027714", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TRIHEXYPHENIDYL" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nTo investigate the incidence and analyze the factors related to bone loss after renal transplantation, in order to guide the intervention of it.\n\n\nMETHODS\nWe picked up 263 cases of renal transplantation outpatients with well graft function from February to May 2014 according to random number table. Bone mineral density (BMD) were examined by quantitative ultrasound and other demographic information and clinical data were collected. According to the diagnostic criteria of the osteoporosis established by WHO, the selected patients were divided into osteoporosis group (n = 62) and normal group (n = 63), univariate analysis and Logistic regression analysis were used to determine related factors responsible for bone loss after renal transplantation.\n\n\nRESULTS\nThe percentage of bone loss in renal transplant recipients was 76. 05% (200/263). Logistic regression analysis revealed the risk factors of osteoporosis in renal transplant recipients were age older than 50 years old (P = 0. 01), parent fractured hip history (P = 0. 00), high dose of corticosteroid (P = 0. 02). Compared with those not being treated with calcitriol, patients intake calcitriol see 8. 80% decreased incidence of bone loss.\n\n\nCONCLUSIONS\nA high incidence of bone loss is found in renal transplant recipients. Age, parent fractured hip history, corticosteroid dose are related factors of osteoporosis in renal transplant recipients. Calcitriol is effective in preventing and treating bone loss in renal transplant recipients.", "affiliations": null, "authors": "Zhang|Qiang|Q|;Cao|Kai|K|;Hu|Xiaopeng|X|;Li|Hang|H|;Wang|Wei|W|;Li|Han|H|;Xue|Wenrui|W|;Xu|Yue|Y|;Wang|Wei|W|;Zhang|Xiaodong|X|", "chemical_list": "D002117:Calcitriol", "country": "China", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0376-2491", "issue": "95(26)", "journal": "Zhonghua yi xue za zhi", "keywords": null, "medline_ta": "Zhonghua Yi Xue Za Zhi", "mesh_terms": "D015519:Bone Density; D001851:Bone Diseases, Metabolic; D002117:Calcitriol; D006801:Humans; D016030:Kidney Transplantation; D012307:Risk Factors; D066027:Transplant Recipients", "nlm_unique_id": "7511141", "other_id": null, "pages": "2062-5", "pmc": null, "pmid": "26710866", "pubdate": "2015-07-14", "publication_types": "D016428:Journal Article", "references": null, "title": "Investigation of bone loss and its related factors in renal transplant recipients.", "title_normalized": "investigation of bone loss and its related factors in renal transplant recipients" }
[ { "companynumb": "CN-VALIDUS PHARMACEUTICALS LLC-CN-2020VAL000771", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, ...
{ "abstract": "We present the case of a 49-year-old man who developed pulmonary abscess as a complication of transbronchial lung cryobiopsy. He had been receiving prednisone therapy, but otherwise had no specific risk factors for lung abscess. Cryobiopsy is a novel technique for obtaining peripheral lung parenchymal tissue for the evaluation of diffuse parenchymal lung diseases. Cryobiopsy is being increasingly proposed as an alternative to surgical lung biopsy or conventional bronchoscopic transbronchial forceps biopsy, but the safety profile of the procedure has not been fully appreciated. Pulmonary abscess has been rarely reported as a complication of other bronchoscopic procedures such as endobronchial ultrasound-guided needle biopsy, however, to our knowledge this is the first reported case of pulmonary abscess complicating peripheral lung cryobiopsy.", "affiliations": "Division of Pulmonary and Critical Care Medicine, Mayo Clinic, Rochester, MN.", "authors": "Skalski|Joseph H|JH|;Kern|Ryan M|RM|;Midthun|David E|DE|;Edell|Eric S|ES|;Maldonado|Fabien|F|", "chemical_list": "D000900:Anti-Bacterial Agents; D008795:Metronidazole; D064704:Levofloxacin", "country": "United States", "delete": false, "doi": "10.1097/LBR.0000000000000182", "fulltext": null, "fulltext_license": null, "issn_linking": "1948-8270", "issue": "23(1)", "journal": "Journal of bronchology & interventional pulmonology", "keywords": null, "medline_ta": "J Bronchology Interv Pulmonol", "mesh_terms": "D000900:Anti-Bacterial Agents; D001706:Biopsy; D001999:Bronchoscopy; D006801:Humans; D064704:Levofloxacin; D008168:Lung; D008169:Lung Abscess; D008171:Lung Diseases; D008297:Male; D008795:Metronidazole; D008875:Middle Aged; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "101496866", "other_id": null, "pages": "63-6", "pmc": null, "pmid": "26705015", "pubdate": "2016-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Pulmonary Abscess as a Complication of Transbronchial Lung Cryobiopsy.", "title_normalized": "pulmonary abscess as a complication of transbronchial lung cryobiopsy" }
[ { "companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2016US-117152", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "2", "activesubstance": { "activesubstancename": "PREDNISONE" }, "drug...
{ "abstract": "A 45-year-old man presented with acute sinusitis. He was treated with a 10-day course of trimethoprim/sulfamethoxazole, and a subsequent 14-day course of amoxicillin-clavulanate with no improvement in symptoms. Culture of purulent nasal secretions revealed the rare enterobacter Cedecea lapagei The patient had complete resolution of his symptoms after a 14-day course of gentamicin/dexamethasone nasal rinses. Emerging pathogens have been a timeless concern for physicians, as witnessed by the current SARS-CoV-2 outbreak. C. lapagei has been reported to cause human infection only a dozen times since its discovery, all in severely compromised patients. This is the first documented case of sinusitis reported with C. lapagei and may portend a rising prevalence of disease burden in the general population. This case demonstrates the necessity of obtaining cultures when standard antibiotics result in treatment failure.", "affiliations": "Independent Researcher, Tucson, Arizona, USA meduperret@gmail.com.", "authors": "Duperret|Michael E|ME|", "chemical_list": "D000900:Anti-Bacterial Agents; D005839:Gentamicins; D019980:Amoxicillin-Potassium Clavulanate Combination; D003907:Dexamethasone; D015662:Trimethoprim, Sulfamethoxazole Drug Combination", "country": "England", "delete": false, "doi": "10.1136/bcr-2020-235331", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "13(7)", "journal": "BMJ case reports", "keywords": "ear, nose and throat/otolaryngology; global health; infectious diseases", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000208:Acute Disease; D019980:Amoxicillin-Potassium Clavulanate Combination; D000900:Anti-Bacterial Agents; D000073640:Betacoronavirus; D000086382:COVID-19; D018352:Coronavirus Infections; D003907:Dexamethasone; D004359:Drug Therapy, Combination; D004755:Enterobacteriaceae; D004756:Enterobacteriaceae Infections; D005839:Gentamicins; D006801:Humans; D008297:Male; D008875:Middle Aged; D058873:Pandemics; D011024:Pneumonia, Viral; D000086402:SARS-CoV-2; D012852:Sinusitis; D016896:Treatment Outcome; D015662:Trimethoprim, Sulfamethoxazole Drug Combination", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "32690571", "pubdate": "2020-07-20", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Sinusitis caused by a rare organism, Cedecea lapagei.", "title_normalized": "sinusitis caused by a rare organism cedecea lapagei" }
[ { "companynumb": "US-BAYER-2020-173697", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CIPROFLOXACIN HYDROCHLORIDE" }, "drugadditional":...
{ "abstract": "Though the presence of platelets-derived microparticles (MPs) have previously been described in heparin-induced thrombocytopenia (HIT), the mechanism of thrombosis in HIT remains poorly understood. We aimed to assess the presence and origin of MPs in patients with HIT and their possible contribution to HIT with thrombosis (HITT).\n\n\n\nForty-five patients with HIT and 45 matched hospitalized patients with not confirmed HIT (HIT-negative) were enrolled. Twelve HIT patients (27%) developed HITT. MPs expressing phosphatidylserine (Annexin V-MP), activated platelet-derived (P-Selectin+), activated leukocyte-derived (L-Selectin+), PF4-bearing and tissue factor-bearing (TF+) MPs were measured by flow-cytometry.\n\n\n\nHIT patients showed significantly higher median levels of P-Selectin+, L-Selectin+, PF4-bearing, L-Selectin+/TF + MPs than HIT-negative; PF4-bearing MP showed the highest statistical difference. As compared to HIT patients, HITT patients showed a trend of higher median levels of all MP subtypes considered but the differences were not statistically significant. Only levels of activated-leukocyte/TF + MPs (L-Selectin + CD142+) were significantly higher (P = 0.015). Sensitive analyses showed that HIT patients with activated-leukocyte/TF + MPs above the cut-off (52 MP/µL) had an odds ratio (OR) for thrombosis of 3.78 (95%CI, 0.98-14.5, P = 0.045). The combination of activated-leukocyte/TF + MPs and PF4-bearing-MPs above the cut-off (1416 MP/uL) resulted in a higher risk of HITT (OR 4.49 (95% CI, 1.17-8.05, P = 0.014).\n\n\n\nWe showed for the first time the presence of circulating PF4-bearing MPs derived from activated platelets in patients with HIT; activated leukocyte/TF + MPs are associated with an increased thrombotic risk. Our findings confirm that HIT antibodies complexes may determine a TF-driven prothrombotic state through the activation of platelets and leukocytes. © 2017 International Clinical Cytometry Society.", "affiliations": "Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.;Department of Medicine, University of Padua, Padua, Italy.", "authors": "Campello|Elena|E|;Radu|Claudia M|CM|;Duner|Elena|E|;Lombardi|Anna M|AM|;Spiezia|Luca|L|;Bendo|Raffaele|R|;Ferrari|Silvia|S|;Simioni|Paolo|P|;Fabris|Fabrizio|F|", "chemical_list": "D010718:Phosphatidylserines; D006493:Heparin; D013925:Thromboplastin", "country": "United States", "delete": false, "doi": "10.1002/cyto.b.21507", "fulltext": null, "fulltext_license": null, "issn_linking": "1552-4949", "issue": "94(2)", "journal": "Cytometry. Part B, Clinical cytometry", "keywords": "cell activation; flow cytometry; hematology; microparticles; platelet", "medline_ta": "Cytometry B Clin Cytom", "mesh_terms": "D000328:Adult; D000368:Aged; D001777:Blood Coagulation; D001792:Blood Platelets; D055252:Cell-Derived Microparticles; D005260:Female; D005434:Flow Cytometry; D006493:Heparin; D006801:Humans; D007962:Leukocytes; D008297:Male; D008875:Middle Aged; D010718:Phosphatidylserines; D015539:Platelet Activation; D012306:Risk; D013921:Thrombocytopenia; D013925:Thromboplastin; D013927:Thrombosis", "nlm_unique_id": "101235690", "other_id": null, "pages": "334-341", "pmc": null, "pmid": "28052584", "pubdate": "2018-03", "publication_types": "D016428:Journal Article", "references": null, "title": "Activated Platelet-Derived and Leukocyte-Derived Circulating Microparticles and the Risk of Thrombosis in Heparin-Induced Thrombocytopenia: A Role for PF4-Bearing Microparticles?", "title_normalized": "activated platelet derived and leukocyte derived circulating microparticles and the risk of thrombosis in heparin induced thrombocytopenia a role for pf4 bearing microparticles" }
[ { "companynumb": "IT-MYLANLABS-2018M1058054", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, "drugadditional": "3", ...
{ "abstract": "Levocetirizine is a second-generation nonsedative antihistaminic agent that has been demonstrated to be safe and effective for treating allergic disease. There was only one case report of levocetirizine-induced liver toxicity, but a liver biopsy was not performed. In this article, we present the first case of levocetirizine-induced liver injury with histologic findings. A 48-year-old man was hospitalized with jaundice and generalized pruritus that had developed after 2 months of therapy with levocetirizine for prurigo nodularis. Laboratory findings revealed acute hepatitis with cholestasis. A liver biopsy demonstrated portal inflammation and hepatitis with apoptotic hepatocytes. The patient fully recovered 3 weeks after withdrawing levocetirizine. Although levocetirizine is safe and effective, physicians should be aware of its potential hepatotoxicity.", "affiliations": "Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Pathology, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.;Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea.", "authors": "Jung|Moon Chan|MC|;Kim|Ja Kyung|JK|;Cho|Jae Yeon|JY|;Song|Jae Won|JW|;Lee|Bohyun|B|;Park|Ji Won|JW|;Seo|Jinwon|J|;Kim|Sung Eun|SE|", "chemical_list": "D039563:Histamine H1 Antagonists, Non-Sedating; C472067:levocetirizine; D017332:Cetirizine", "country": "Korea (South)", "delete": false, "doi": "10.3350/cmh.2016.0023", "fulltext": "\n==== Front\nClin Mol HepatolClin Mol HepatolCMHClinical and Molecular Hepatology2287-27282287-285XThe Korean Association for the Study of the Liver 2808158610.3350/cmh.2016.0023cmh-2016-0023Case ReportA case of levocetirizine-induced liver injury Jung Moon Chan 1Kim Ja Kyung 12Cho Jae Yeon 1Song Jae Won 1Lee Bohyun 1Park Ji Won 12Seo Jinwon 3Kim Sung Eun 121 Department of Internal Medicine, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea2 Division of Gastroenterology, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, Korea3 Department of Pathology, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang, KoreaCorresponding author : Sung Eun Kim Department of Internal Medicine, Hallym University Sacred Heart Hostpital, University of Hallym College of Medicine, 22 Gwanpyeong-ro 170beon-gil, Dongan-gu, Anyang 14068, Korea Tel: +82-31-380-3705, Fax: +82-31-386-2269 E-mail: sekim@hallym.or.kr12 2016 25 12 2016 22 4 495 498 25 4 2016 8 6 2016 9 6 2016 Copyright © 2016 by The Korean Association for the Study of the Liver2016This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Levocetirizine is a second-generation nonsedative antihistaminic agent that has been demonstrated to be safe and effective for treating allergic disease. There was only one case report of levocetirizine-induced liver toxicity, but a liver biopsy was not performed. In this article, we present the first case of levocetirizine-induced liver injury with histologic findings. A 48-year-old man was hospitalized with jaundice and generalized pruritus that had developed after 2 months of therapy with levocetirizine for prurigo nodularis. Laboratory findings revealed acute hepatitis with cholestasis. A liver biopsy demonstrated portal inflammation and hepatitis with apoptotic hepatocytes. The patient fully recovered 3 weeks after withdrawing levocetirizine. Although levocetirizine is safe and effective, physicians should be aware of its potential hepatotoxicity.\n\nHepatotoxicityLevocetirizineCholestasis\n==== Body\nINTRODUCTION\nLevocetirizine (LCZ), an active enantiomer of cetirizine, is a second-generation antihistamine that was approved by the US Food and Drug Administration in 2008 for the relief of symptoms associated with allergic diseases in adults and children [1-3]. Although it has some side effects—such as sleepiness, headache, dry mouth, vision problems, palpitation, and fatigue—it is considered to be effective and safe treating allergic disease [4]. Only one case of LCZinduced liver injury has been reported [5].\n\nHere, we present the first report of LCZ-induced liver injury with histologic confirmation in a 48-year-old man without a history of hepatobiliary disease.\n\nCASE REPORT\nA 48-year-old man without significant medical history was referred from the dermatology department due to jaundice and generalized pruritus. The patient did not report any fatigue, anorexia, nausea, abdominal discomfort, fever, rash, myalgia, muscle weakness, swelling, and recent illness. He had no previous history of hepatobiliary disease. The patient’s medical history was only notable for prurigo nodularis. Medication in recent use included LCZ 5 mg daily for 2 months, and the patient had been taking bepotastine besilate 10 mg daily until 2 months ago. He did not report taking any other medications including statins, over-the-counter medications, herbal medications including red ginseng or any extract or nutritional supplements. Specific history of exposure to hepatotoxic chemicals or familial history of liver disease was not identified. He also had no travel history. Alcohol consumption was limited to regular ethanol consumption of 57 g/week.\n\nInitial blood pressure was 110/70 mmHg, pulse rate 88/min, respiratory rate 18/min, and body temperature 36.7°C. Physical examination revealed a jaundice with icteric sclera. He had a soft abdomen without tenderness. He had no hepatomegaly, splenomegaly, and stigmata of chronic liver disease.\n\nLaboratory findings revealed prothrombin time 11.8 s, international normalized ratio 0.88, aspartate aminotransferase (AST) 1,208 IU/L, alanine aminotransferase (ALT) 2,043 IU/L, total bilirubin 8.68 mg/dL, direct bilirubin 7.23 mg/dL, alkaline phosphatase 184 U/L, lactate dehydrogenase 463 IU/L, gamma-glutamyl transpeptidase 253 IU/L, protein 5.9 g/dL, albumin 3.9 g/dL, and creatine phosphokinase 21 IU/L. Serologic viral marker evaluations revealed hepatitis B surface antigen negative, antibody to hepatitis B surface antigen positive, antibody to hepatitis B core antigen negative, anti-hepatitis C virus negative and anti-human immunodeficiency virus negative. Serum anti-mitochondrial antibody, anti-smooth muscle antibody, anti-nuclear antibody, anti-dsDNA antibody, anti-neutrophil cytoplasm antibody, and anti-liver kidney microsome antibody were negative. Serum ceruloplasmin and copper levels were within normal ranges. His abdominal X-ray showed no specific findings. An abdominal sonography revealed no evidence of extrahepatic obstruction, biliary ductal disease, cholelithiasis, or hepatic parenchymal abnormalities. The size, shape, and echotexture of the liver were normal. For histologic evaluation, a percutaneous ultrasonography-guided liver biopsy was performed without complications. The liver biopsy showed portal inflammation and hepatitis with apoptotic hepatocytes. There was an increased amount of connective tissue extending from the portal area and inflammation around apoptotic hepatocytes (Fig. 1).\n\nThe patient stopped taking LCZ immediately after evaluation and all kinds of liver enzymes were normalized within 3 weeks after discontinuation (Fig. 2). The patient visited the outpatient department several times after discharge and has maintained normal liver function.\n\nDISCUSSION\nDrug-induced liver injury (DILI) is a rare but potentially life-threatening adverse drug reaction. A large number of drugs have deleterious effects on the liver, and DILI is a major cause of acute liver injury and liver transplantation [6]. DILI is responsible for ~10% of all adverse drug reactions in the United States [7]. In Korea, the annual extrapolated incidence of DILI in hospitalized patients at a university hospital was 12/100,000 persons/year [8]. The mechanism of DILI is unknown, but it is not associated with medication dose, particularly idiosyncratic DILI. Because of its low incidence, idiosyncratic DILI cannot be detected in preclinical testing or clinical trials [9].\n\nLCZ—the R-enantiomer of cetirizine dihydrochloride, which has favorable pharmacodynamic and pharmacokinetic characteristics—has been demonstrated to be safe and effective for the treatment of allergic diseases, as evidenced by the low number of adverse effects in clinical trials [10,11]. A similar number of patients reported treatment-emergent adverse events with LCZ and placebo. The most common treatment-emergent adverse events are headache (4.6%), fatigue (1.8%), and dry throat (1.4%). One patient in the LCZ group showed cellulitis (0.4%) as a serious adverse event [12]. A previous report of LCZ-induced hepatitis showed less severe hepatic inflammation compared with our case (AST 113 IU/mL and ALT 115 IU/mL vs. AST 1,208 IU/mL and ALT 2,043 IU/mL, respectively) [5]. This difference of severity was originated in which the previous case was detected by routine liver function test after using LCZ only for 2 weeks, but our patient exhibited jaundice after taking LCZ for 2 months. Because hepatotoxicity is not included in the LCZ prescribing information and only one case of LCZ-induced liver injury has been reported, hepatotoxicity was not monitored in our case.\n\nThe main mechanism of DILI is an idiosyncratic reaction. Therefore, any drug could cause DILI. Patients with DILI can present with symptoms similar to those of patients with hepatobiliary disease of other causes, and therefore it is important to maintain a high index of clinical suspicion in determining the diagnosis [7,13]. The clinical presentations of DILI are acute hepatitis and/or cholestasis, although idiosyncratic reactions frequently occur in a background of higher incidence rates of mild asymptomatic liver injury. Our patient did not have a specific past medical history, nor show serologic or radiologic findings. Based on the timing of LCZ administration and the clinical course, we could suspect LCZ-induced liver injury. Because the patient conducted liver biopsy and recovered after withdrawal of LCZ, we were able to confirm the LCZ-induced liver injury. This case of liver injury was considered an idiosyncratic drug reaction.\n\nNumerous drugs have been reported to cause liver injury, but only one case of LCZ-induced liver injury, which lacked histologic confirmation, has been described. Furthermore, unlike the previous case of LCZ-induced liver injury, our patient showed >20-fold elevation of serum AST and ALT levels. To our knowledge, this is the first reported case of LCZ-induced liver injury confirmed by liver biopsy.\n\nLCZ is generally well tolerated and widely used, and it has consistently demonstrated high response rates and a favorable side-effect profile. Although its hepatotoxicity is not established, LCZ could be associated with acute liver injury. In conclusion, LCZ is an effective and well-tolerated drug for the treatment of allergic diseases; however, clinicians should be aware of its potential hepatotoxicity.\n\nConflicts of Interest: The authors have no conflicts to disclose.\n\nAbbreviations\nALTalanine aminotransferase\n\nASTaspartate aminotransferase\n\nDILIdrug-induced liver injury\n\nLCZlevocetirizine\n\nFigure 1. (A) Liver biopsy tissue (H&E, ×200) showing patchy portal inflammation and hepatocyte dropout. Portal and periportal inflammation is evident. (B) The hepatic parenchyme also shows multifocal hepatocellular dropouts with apoptotic hepatocytes.\n\nFigure 2. Changes in laboratory parameters over time: (A) total bilirubin (TB) and direct bilirubin (DB), (B) aspartate aminotransferase (AST) and alanine aminotransferase (ALT), (C) alkaline phosphatase (ALP), and (D) prothrombin time (PT).\n==== Refs\nREFERENCES\n1 Gillard M Christophe B Wels B Peck M Massingham R Chatelain P H1 antagonists: receptor affinity versus selectivity Inflamm Res 2003 52 Suppl 1 S49 S50 12755407 \n2 Grant JA Riethuisen JM Moulaert B DeVos C A double-blind, randomized, single-dose, crossover comparison of levocetirizine with ebastine, fexofenadine, loratadine, mizolastine, and placebo: suppression of histamine-induced wheal-and-flare response during 24 hours in healthy male subjects Ann Allergy Asthma Immunol 2002 88 190 197 11868924 \n3 Xyzal (levocetirizine dihydrochloride) [package insert] UCB Pharma Inc Smyrna, Ga 2008 \n4 Maiti R Rahman J Jaida J Allala U Palani A Rupatadine and levocetirizine for seasonal allergic rhinitis: a comparative study of efficacy and safety Arch Otolaryngol Head Neck Surg 2010 136 796 800 20713756 \n5 Ekiz F Yuksel I Ekiz O Coban S Basar O Yüksel O Levocetirizine-induced hepatotoxicity in a patient with chronic urticaria Ann Hepatol 2011 10 237 238 21502689 \n6 Lee WM Acute liver failure in the United States Semin Liver Dis 2003 23 217 226 14523675 \n7 Lewis JH Drug-induced liver disease Med Clin North Am 2000 84 1275 1311 11026929 \n8 Suk KT Kim DJ Kim CH Park SH Yoon JH Kim YS A prospective nationwide study of drug-induced liver injury in Korea Am J Gastroenterol 2012 107 1380 1387 22733303 \n9 Kim SH Naisbitt DJ Update on advances in research on idiosyncratic drug-induced liver injury Allergy Asthma Immunol Res 2016 8 3 11 26540496 \n10 Holgate S Powell R Jenkins M Ali O A treatment for allergic rhinitis: a view on the role of levocetirizine Curr Med Res Opin 2005 21 1099 1106 16004679 \n11 Hair PI Scott LJ Levocetirizine: a review of its use in the management of allergic rhinitis and skin allergies Drugs 2006 66 973 996 16740020 \n12 Segall N Gawchik S Georges G Haeusler JM Efficacy and safety of levocetirizine in improving symptoms and health-related quality of life in US adults with seasonal allergic rhinitis: a randomized, placebo-controlled study Ann Allergy Asthma Immunol 2010 104 259 267 20377116 \n13 Suk KT Kim DJ Drug-induced liver injury: present and future Clin Mol Hepatol 2012 18 249 257 23091804\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2287-2728", "issue": "22(4)", "journal": "Clinical and molecular hepatology", "keywords": "Cholestasis; Hepatotoxicity; Levocetirizine", "medline_ta": "Clin Mol Hepatol", "mesh_terms": "D017332:Cetirizine; D056486:Chemical and Drug Induced Liver Injury; D039563:Histamine H1 Antagonists, Non-Sedating; D006801:Humans; D006967:Hypersensitivity; D007565:Jaundice; D008099:Liver; D008297:Male; D008875:Middle Aged; D011537:Pruritus", "nlm_unique_id": "101586730", "other_id": null, "pages": "495-498", "pmc": null, "pmid": "28081586", "pubdate": "2016-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "16004679;20377116;14523675;26540496;20713756;23091804;11026929;12755407;22733303;21502689;16740020;11868924", "title": "A case of levocetirizine-induced liver injury.", "title_normalized": "a case of levocetirizine induced liver injury" }
[ { "companynumb": "KR-UCBSA-2017005733", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "LEVOCETIRIZINE DIHYDROCHLORIDE" }, "drugadditional"...
{ "abstract": "Of all brain metastases, the most common primary lesion is derived from the lung. These types of metastases enlarge aggressively with unfavorable prognoses. We report the case of a 75-year-old male patient who had a history of pulmonary resection for Stage IA non-small cell lung cancer(NSCLC), and received chemotherapy. One year after NSCLC surgery, he experienced a cardiogenic cerebral infarction, and anticoagulant therapy was initiated. Mass lesions with hemorrhage were detected bilaterally in the frontal lobes through magnetic resonance imaging three years after the NSCLC surgery. The lesions slowly enlarged during follow-up. However, there were no clinical symptoms. There was no finding indicating a local recurrence or metastasis through positron emission tomography(PET). Two and a half years after the detection of the lesion, left hemiplegia was observed. Massive hemorrhage from the right frontal lobe lesion was observed on computed tomography(CT). Craniotomy and evacuation of the hematoma were performed. The histopathological findings showed adenocarcinoma and the diagnosis was brain metastasis of the lung cancer. This case reveals brain metastasis of lung cancer that progressed without extracranial metastases for three years. The brain tumor enlarged, accompanied by hemorrhage, extremely slowly without any symptoms. It was difficult to differentiate between metastasis and cavernous hemangioma, considering the extremely slow progress and image analyses. Of the reported prognostic factors associated with postoperative brain metastasis from surgically resected NSCLC, three factors were applicable to this case:adenocarcinoma, a small number of brain metastases, and the absence of extracranial metastases at the diagnosis of brain metastasis. We should consider the possibility of a metastatic brain tumor secondary to lung cancer even long after thoracic surgery.", "affiliations": "Sixth grade student of Nagasaki University School of Medicine.", "authors": "Matsufuji|Hiroshi|H|;Shiozaki|Eri|E|;Nakatake|Yasutaka|Y|;Yoshida|Koichi|K|;Kamada|Kensaku|K|;Matsuo|Takayuki|T|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.11477/mf.1436203506", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-2603", "issue": "45(4)", "journal": "No shinkei geka. Neurological surgery", "keywords": null, "medline_ta": "No Shinkei Geka", "mesh_terms": "D001932:Brain Neoplasms; D002289:Carcinoma, Non-Small-Cell Lung; D003399:Craniotomy; D006470:Hemorrhage; D006801:Humans; D008175:Lung Neoplasms; D008279:Magnetic Resonance Imaging; D009364:Neoplasm Recurrence, Local; D049268:Positron-Emission Tomography; D011379:Prognosis", "nlm_unique_id": "0377015", "other_id": null, "pages": "339-344", "pmc": null, "pmid": "28415059", "pubdate": "2017-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "A Case of Slowly Progressive Brain Metastasis with Minor Bleeding after Removal of and Chemotherapy for Non-Small Cell Lung Cancer.", "title_normalized": "a case of slowly progressive brain metastasis with minor bleeding after removal of and chemotherapy for non small cell lung cancer" }
[ { "companynumb": "JP-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-NB-002603", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "APIXABAN" }, "dr...
{ "abstract": "The purpose of this trial was to evaluate the efficacy of 2-year consolidation therapy with nilotinib, at a dose of 300 mg twice daily, for achieving treatment-free remission in chronic myeloid leukemia patients with a deep molecular response (BCR-ABL1 ≤0.0032%). Successful treatment-free remission was defined as no confirmed loss of deep molecular response. We recruited 96 Japanese patients, of whom 78 sustained a deep molecular response during the consolidation phase and were therefore eligible to discontinue nilotinib in the treatment-free remission phase; of these, 53 patients (67.9%; 95% confidence interval: 56.4-78.1%) remained free from molecular recurrence in the first 12 months. The estimated 3-year treatment-free survival was 62.8%. Nilotinib was readministered to all patients (n=29) who experienced a molecular recurrence during the treatment-free remission phase. After restarting treatment, rapid deep molecular response returned in 25 patients (86.2%), with 50% of patients achieving a deep molecular response within 3.5 months. Tyrosine kinase inhibitor withdrawal syndrome was reported in 11/78 patients during the early treatment-free remission phase. The treatment-free survival curve was significantly better in patients with undetectable molecular residual disease than in patients without (3-year treatment-free survival, 75.6 versus 48.6%, respectively; P=0.0126 by the log-rank test). There were no significant differences in treatment-free survival between subgroups based on tyrosine kinase inhibitor treatment before the nilotinib consolidation phase, tyrosine kinase inhibitor-withdrawal syndrome, or absolute number of natural killer cells. The results of this study indicate that it is safe and feasible to stop tyrosine kinase inhibitor therapy in patients with chronic myeloid leukemia who have achieved a sustained deep molecular response with 2 years of treatment with nilotinib. This study was registered with UMIN-CTR (UMIN000005904).", "affiliations": "Department of Hematology, Nephrology and Rheumatology, Akita University Graduate School of Medicine naotot@doc.med.akita-u.ac.jp.;Department of Oncology and Hematology, Jikei University Kashiwa Hospital.;Department of Hematology, International University of Health and Welfare School of Medicine, Narita.;Department of Hematology and Oncology, Japanese Red Cross Narita Hospital.;Department of Oncology and Hematology, Jikei University Kashiwa Hospital.;Department of Hematology, Chiba University Hospital.;Department of Internal Medicine, Yuri General Hospital, Yurihonjo.;Department of Hematology, Northern Fukushima Medical Center, Date.;Department of Hematology, Saitama Medical Center, Saitama Medical University, Kawagoe.;Department of Hematology and Oncology, Dokkyo Medical University, Tochigi.;Department of Hematology, Chibaken Saiseikai Narashino Hospital.;Department of Hematology, Tokyo Medical University Hachioji Medical Center.;Transfusion Medicine and Cell Therapy, Mie University Hospital, Tsu.;Division of Hematology, National Defense Medical College, Tokorozawa.;Department of Hematology, Tokyo Medical and Dental University Hospital.;Department of Hematology, The Fraternity Memorial Hospital, Tokyo.;Clinical Research Promotion and Support Center, Akita University Hospital.;Clinical Research Promotion and Support Center, Akita University Hospital.;Division of Cancer Immunology, Research Institute / Exploratory Oncology Research & Clinical Trial Center, National Cancer Center, Tokyo/Kashiwa.;Department of Hematology and Oncology, Japanese Red Cross Narita Hospital.", "authors": "Takahashi|Naoto|N|;Nishiwaki|Kaichi|K|;Nakaseko|Chiaki|C|;Aotsuka|Nobuyuki|N|;Sano|Koji|K|;Ohwada|Chikako|C|;Kuroki|Jun|J|;Kimura|Hideo|H|;Tokuhira|Michihide|M|;Mitani|Kinuko|K|;Fujikawa|Kazuhisa|K|;Iwase|Osamu|O|;Ohishi|Kohshi|K|;Kimura|Fumihiko|F|;Fukuda|Tetsuya|T|;Tanosaki|Sakae|S|;Takahashi|Saori|S|;Kameoka|Yoshihiro|Y|;Nishikawa|Hiroyoshi|H|;Wakita|Hisashi|H|;|||", "chemical_list": "C498826:4-methyl-N-(3-(4-methylimidazol-1-yl)-5-(trifluoromethyl)phenyl)-3-((4-pyridin-3-ylpyrimidin-2-yl)amino)benzamide; D011743:Pyrimidines", "country": "Italy", "delete": false, "doi": "10.3324/haematol.2018.194894", "fulltext": "\n==== Front\nHaematologicaHaematologicahaematolHaematologicaHaematologica0390-60781592-8721Ferrata Storti Foundation 2997673410.3324/haematol.2018.1948941031835ArticleChronic Myeloid LeukemiaTreatment-free remission after two-year consolidation therapy with nilotinib in patients with chronic myeloid leukemia: STAT2 trial in Japan Takahashi Naoto 1Nishiwaki Kaichi 2Nakaseko Chiaki 34Aotsuka Nobuyuki 5Sano Koji 2Ohwada Chikako 4Kuroki Jun 6Kimura Hideo 7Tokuhira Michihide 8Mitani Kinuko 9Fujikawa Kazuhisa 10Iwase Osamu 11Ohishi Kohshi 12Kimura Fumihiko 13Fukuda Tetsuya 1415Tanosaki Sakae 16Takahashi Saori 17Kameoka Yoshihiro 17Nishikawa Hiroyoshi 18Wakita Hisashi 519the STAT study group\n1 Department of Hematology, Nephrology and Rheumatology, Akita University Graduate School of Medicine\n2 Department of Oncology and Hematology, Jikei University Kashiwa Hospital\n3 Department of Hematology, International University of Health and Welfare School of Medicine, Narita\n4 Department of Hematology, Chiba University Hospital\n5 Department of Hematology and Oncology, Japanese Red Cross Narita Hospital\n6 Department of Internal Medicine, Yuri General Hospital, Yurihonjo\n7 Department of Hematology, Northern Fukushima Medical Center, Date\n8 Department of Hematology, Saitama Medical Center, Saitama Medical University, Kawagoe\n9 Department of Hematology and Oncology, Dokkyo Medical University, Tochigi\n10 Department of Hematology, Chibaken Saiseikai Narashino Hospital\n11 Department of Hematology, Tokyo Medical University Hachioji Medical Center\n12 Transfusion Medicine and Cell Therapy, Mie University Hospital, Tsu\n13 Division of Hematology, National Defense Medical College, Tokorozawa\n14 Department of Hematology, Tokyo Medical and Dental University Hospital\n15 Department of Hematology, Tottori University Hospital, Yonago\n16 Department of Hematology, The Fraternity Memorial Hospital, Tokyo\n17 Clinical Research Promotion and Support Center, Akita University Hospital\n18 Division of Cancer Immunology, Research Institute / Exploratory Oncology Research & Clinical Trial Center, National Cancer Center, Tokyo/Kashiwa\n19 Japanese Red Cross Chiba Blood Center, Funabashi, JapanCorrespondence:naotot@doc.med.akita-u.ac.jp11 2018 05 7 2018 103 11 1835 1842 04 4 2018 28 6 2018 Copyright© 2018 Ferrata Storti Foundation2018Material published in Haematologica is covered by copyright. All rights are reserved to the Ferrata Storti Foundation. Use of published material is allowed under the following terms and conditions:https://creativecommons.org/licenses/by-nc/4.0/legalcode. Copies of published material are allowed for personal or internal use. Sharing published material for non-commercial purposes is subject to the following conditions:https://creativecommons.org/licenses/by-nc/4.0/legalcode, sect. 3. Reproducing and sharing published material for commercial purposes is not allowed without permission in writing from the publisher.The purpose of this trial was to evaluate the efficacy of 2-year consolidation therapy with nilotinib, at a dose of 300 mg twice daily, for achieving treatment-free remission in chronic myeloid leukemia patients with a deep molecular response (BCR-ABL1IS ≤0.0032%). Successful treatment-free remission was defined as no confirmed loss of deep molecular response. We recruited 96 Japanese patients, of whom 78 sustained a deep molecular response during the consolidation phase and were therefore eligible to discontinue nilotinib in the treatment-free remission phase; of these, 53 patients (67.9%; 95% confidence interval: 56.4–78.1%) remained free from molecular recurrence in the first 12 months. The estimated 3-year treatment-free survival was 62.8%. Nilotinib was readministered to all patients (n=29) who experienced a molecular recurrence during the treatment-free remission phase. After restarting treatment, rapid deep molecular response returned in 25 patients (86.2%), with 50% of patients achieving a deep molecular response within 3.5 months. Tyrosine kinase inhibitor withdrawal syndrome was reported in 11/78 patients during the early treatment-free remission phase. The treatment-free survival curve was significantly better in patients with undetectable molecular residual disease than in patients without (3-year treatment-free survival, 75.6 versus 48.6%, respectively; P=0.0126 by the log-rank test). There were no significant differences in treatment-free survival between subgroups based on tyrosine kinase inhibitor treatment before the nilotinib consolidation phase, tyrosine kinase inhibitor-withdrawal syndrome, or absolute number of natural killer cells. The results of this study indicate that it is safe and feasible to stop tyrosine kinase inhibitor therapy in patients with chronic myeloid leukemia who have achieved a sustained deep molecular response with 2 years of treatment with nilotinib. This study was registered with UMIN-CTR (UMIN000005904).\n==== Body\nIntroduction\nNilotinib is a second-generation tyrosine kinase inhibitor (TKI) that has been shown to be highly efficacious as a first- or second-line treatment for patients with Philadelphia chromosome-positive chronic myeloid leukemia (CML) in chronic phase. In patients newly diagnosed with CML in chronic phase superior rates of deep molecular response (DMR) were achieved with nilotinib in comparison with imatinib, which is a first-generation TKI currently used as the standard treatment for this disease.1–3 In addition, switching to nilotinib after a minimum of 2 years on imatinib led to increased DMR rates compared to remaining on imatinib.4\n\nRecently, treatment-free remission (TFR) has been proposed as a goal for CML treatment.5–7 Indeed, prospective trials have indicated that imatinib therapy can be successfully discontinued in CML patients who have maintained a DMR for at least 2 years.8–10 In these prospective trials, the TFR rate was 43% [95% confidence interval (CI): 33–52%] at 6 months9 and 41% (95% CI: 29–52%) at 12 months in the STIM1 trial,8 while the TWISTER study revealed a TFR rate of 47.1% (95% CI: 31.5–62.7%) at 24 months.10 Moreover, the first TFR study of second-generation TKI, the DADI trial reported by Imagawa et al., showed that second-generation TKI therapy can be successfully discontinued.11 In this trial, all patients received dasatinib consolidation therapy for at least 1 year. The estimated TFR rate was 49% (95% CI: 36–61%) at 6 months.11 On the other hand, the ENESTfreedom study, which is a TFR study following frontline nilotinib treatment, required that all patients sustained DMR during the consolidation phase with nilotinib for 1 year. The TFR rate at 48 weeks was 51.6% (95% CI: 44.2–58.9%).12 Although the DMR in the consolidation phase with a second-generation TKI was sustained in both the DADI trial and the ENESTfreedom study, the TFR rate was not superior to those in the previously reported imatinib TFR studies.8–10 Most relapses occurred within 6 months of discontinuing second-generation TKI or imatinib therapy, and there was no disease progression in patients with molecular relapse after discontinuation.8–12 All patients who relapsed remained sensitive to TKI re-treatment in these TFR studies.8–12\n\nCompared to imatinib, nilotinib may enable a greater proportion of patients with CML in chronic phase to achieve successful TFR if they receive nilotinib consolidation therapy for 2 years to sustain DMR; this is the same length of time required to achieve TFR in imatinib studies.8,9 The aim of this STAT2 trial (Stop Tasigna® Trial) was to evaluate the efficacy of 2-year consolidation treatment with nilotinib for achieving successful TFR in patients with chronic phase CML.\n\nMethods\nPatients and study design\nThe eligibility criteria for this multicenter, phase II, single-treatment arm, open-label clinical trial included: patients with CML in chronic phase, age ≥16 years, an Eastern Cooperative Oncology Group performance status of 0–2, and no severe primary organ dysfunction. Patients who had accelerated phase or blast crisis CML, a T315I mutation, or who had received allogeneic hematopoietic stem-cell transplantation were excluded from this study. Patients with a DMR (BCR-ABL1IS ≤0.0032% or a molecular response, MR4.5, defined as a 4.5-log reduction in BCR-ABL1 transcripts according to the international scale], assessed by real-time quantitative polymerase chain reaction (RQ-PCR), under treatment with imatinib or a second-generation TKI following imatinib were eligible for the STAT2 trial. Nilotinib (300 mg) was administered twice daily (600 mg/day) for 2 years in the consolidation phase. Patients who maintained a MR4.5 during the 2-year consolidation phase were eligible to enter the TFR phase and cease nilotinib treatment. Molecular recurrence was defined as the loss of a major molecular response (MMR: BCR-ABL1IS ≤0.1%) or confirmed loss of MR4.5 (at two consecutive assessments within 4 weeks) after discontinuing nilotinib, based on criteria used both in the STIM1 trial8 and the TWISTER study.9 Patients with molecular recurrence during the TFR phase restarted nilotinib 300 mg twice daily, thus entering the re-treatment phase.\n\nEndpoints and assessments\nThe primary endpoint of the STAT2 trial was the 12-month TFR rate after discontinuing nilotinib treatment; secondary endpoints were the 24-month TFR rate after discontinuing nilotinib treatment, the 3-year treatment-free survival, and the MR4.5 rate and time to MR4.5 achieved by nilotinib in the re-treatment phase. Safety profiles, especially vascular adverse events in the consolidation phase or symptoms related to TKI withdrawal syndrome in the TFR phase, were evaluated. Adverse events were assessed according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.03.\n\nMR was evaluated by BCR-ABL1IS RQ-PCR analysis upon study entry and every 3 months thereafter in the consolidation phase. After discontinuing nilotinib in the TFR phase, molecular recurrence was monitored by monthly BCR-ABL1IS RQ-PCR testing in the first year, bi-monthly testing in the second year, then every 3 months thereafter. In the re-treatment phase, BCR-ABL1IS was monitored by monthly RQ-PCR testing. The study protocol was terminated when MR4.5 was re-achieved, or when BCR-ABL1IS increased twice consecutively in the re-treatment phase.\n\nBCR-ABL1IS RQ-PCR was performed using a Molecular MD One-Step qRT-PCR BCR-ABL kit (BML Inc., Kawagoe, Japan). To validate BCR-ABL1 amplification, ABL1 was used as an internal control. A MMR was defined as a 3-log reduction in the BCR-ABL1 transcript according to the international scale (BCR-ABL1IS ≤0.1%), MR4.5 was defined as a 4.5-log reduction in the BCR-ABL1 transcript (BCR-ABL1IS ≤0.0032%), and MR5 was defined as a 5-log reduction in the BCR-ABL1 transcript (BCR-ABL1IS ≤0.001%), as described above. Undetectable molecular residual disease was defined as undetectable BCR-ABL1 transcript with MR5 (UMRD with MR5). At least 100,000 control genes (ABL1) were required for a sample to be considered as adequate.\n\nEthics\nForty-six institutions participated in this study. The study was conducted in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained from each par ticipant before enrollment. The study was approved by the Ethics Committee of Akita University (N. 786) and by all institutional ethic committees that participated in this study. The study was registered with UMIN-CTR (UMIN000005904).\n\nResults\nPatients and treatment\nBetween July 2011 and December 2012, 96 patients who achieved MR4.5 were enrolled in the STAT2 trial. These patients started treatment in the consolidation phase and were defined as the safety analysis set. Seventy-eight patients entered the TFR phase and were analyzed as the full analysis set for TFR. The baseline demographics of the safety and full analysis sets are shown in Table 1.\n\nTable 1. Baseline demographics of all patients included in the study.\n\nThe median age in the safety analysis set was 55.5 years (range, 20–83). Thirty-six (37.5%) patients were female and 16 (16.7%) patients had been administered interferon α before TKI treatment. Based on TKI therapy prior to entry into the current study, patients were classified into three groups: 50 patients (52.1%) who had received only imatinib (‘imatinib only’), 40 patients (41.7%) who had received nilotinib following imatinib (‘nilotinib following imatinib’, including patients from the STAT1 study), and six patients (6.3%) who had received other therapy (‘other’). The STAT1 study (Switch to Tasigna® Trial) is a clinical trial to evaluate the efficacy of 2-year consolidation treatment with nilotinib for achieving DMR in chronic phase CML patients with MMR, recently reported by our study group.13 Among 40 patients in STAT2 treated by nilotinib following imatinib, 21 patients joined this study from STAT1 since they achieved MR4.5 in the STAT1 study. The reasons for switching from imatinib to nilotinib in the 40 patients included imatinib resistance in 7.5%, imatinib intolerance in 20.0%, and upon patients’ request in 72.5% (Online Supplementary Table S1). The median duration of imatinib or nilotinib treatment was 73.6 months (range, 11–126) or 7.7 months (range, 0–35), respectively. All patients showed MR4.5 at the time of entry into the study, and the median time to MR4.5 on TKI therapy was 48.1 months (range, 6–128). Among 96 patients in the safety analysis set, 70 (73.7%) achieved the MR4.5 by prior imatinib treatment and 25 (26.3%) by prior nilotinib treatment. Comparing patients in different subgroups based on prior TKI therapy (‘imatinib only’ versus ‘nilotinib following imatinib’), there were no significant differences except in the duration of imatinib therapy and time to MR4.5 (Online Supplementary Table S1). Of these, 40 patients in the ‘imatinib only’ group, 33 patients in the ‘nilotinib following imatinib’ group, and five patients in the ‘other’ group entered the TFR phase.\n\nNilotinib was taken twice daily (600 mg/day) for 2 years in the consolidation phase (median dose intensity, 600 mg/day). Patients’ outcomes at the end of the consolidation phase at 24 months are summarized in Table 2. Among the 96 patients in the safety analysis set, 18 (18.8%) discontinued the study treatment. The most frequent reason for discontinuation was adverse events; disease progression was not observed in any of the patients.\n\nTable 2. Patients’ outcomes and dose intensity at the end of the 2-year nilotinib consolidation phase.\n\nTreatment-free remission after nilotinib discontinuation\nAmong the 96 patients in the safety analysis set, 78 with sustained MR4.5 during the consolidation phase were eligible for nilotinib discontinuation in the TFR phase. The median follow-up of patients in the TFR phase was 35.4 months (range, 1.8–44.2). Among the 78 patients, 53 remained in the TFR phase without a confirmed loss of MR4.5 in the first 12 months; the 12-month TFR primary endpoint was 67.9% (95% CI: 56.4–78.1%), exceeding the targeted 40% success rate. The 24-month TFR rate was 62.8% (95% CI: 51.1–73.5%). The Kaplan-Meier curve for treatment-free survival is shown in Figure 1A. The estimated 3-year treatment-free survival was 62.8%. Among patients with a confirmed loss of MR4.5, 25 patients lost the MR4.5 within the first 6 months after discontinuing nilotinib (median, 3.4 months; range, 1.8–5.8 months), and the remaining four patients lost the MR4.5 between 16 and 20 months within the TFR phase (Figure 1B).\n\nFigure 1. Treatment-free remission after 2-year consolidation with nilotinib. (A) Kaplan-Meier estimates of treatment-free survival after discontinuation of nilotinib (n=78). (B) The kinetics of BCR-ABL1 transcripts in the treatment-free remission (TFR) phase. Twenty-five patients lost MR4.5 within 12 months and eight patients showed fluctuations in the amounts of BCR-ABL1 transcript around the MR4.5 level. Among the eight patients with fluctuations, four lost MR4.5 after 16, 16, 17, and 20 months. (C) Kaplan-Meier estimates of treatment-free survival after discontinuation of nilotinib according to the molecular response [molecular residual disease (MRD) positive or undetectable MRD (UMRD with MR5)] at enrollment in the TFR phase. UMRD with MR5 was defined as undetectable BCR-ABL1 transcripts by IS-PCR in which at least 100,000 control genes (ABL1) were required for the sensitivity of MR5. (D) Cumulative incidence of MR4.5 in patients who lost MR4.5 during the TFR phase and were subsequently readministered nilotinib (n=29). (E) Cumulative incidence of reacquisition of major molecular response (MMR) in patients who lost MMR and were readministered nilotinib (n=16).\n\nIn a subanalysis of groups based on prior TKI before entry into the STAT2 trial, the 12-month TFR rate was 62.5% (95% CI: 45.8–77.3%) in the ‘imatinib only’ group and 69.7% (95% CI: 51.3–84.4%) in the ‘nilotinib following imatinib’ group. In another subanalysis based on positivity of molecular residual disease (MRD) before the TFR phase, the 12-month TFR rate was 56.8% (95% CI: 39.5–72.9%) in the MRD group and 78.0% (95% CI: 62.4–89.4%) in the UMRD with MR5 group; the corresponding 24-month TFR rates were 48.6% (95% CI: 31.9–65.6%) and 75.6% (95% CI: 59.7–87.6%).\n\nAn analysis of baseline factors as predictors of TFR at 12 months was conducted. With the exception of detectable MRD before entering the TFR phase (odds ratio, 0.369; 95% CI: 0.138–0.988; P=0.0473), there were no significant predictors in the univariate logistic regression analysis, including the absolute number of natural killer cells and natural killer cell cytotoxicity (Table 3). Multivariate analysis was not, therefore, performed. On the other hand, the treatment-free survival curve was significantly better in the UMRD with MR5 group than in the MRD group (estimated 3-year treatment-free survival, 75.6 versus 48.6%; P=0.0126 by the log-rank test) (Figure 1C). There were no significant differences in the treatment-free survival curves between subgroups based on TKI treatment prior to the consolidation phase by nilotinib (‘imatinib only’ versus ‘nilotinib following imatinib’ group, P=0.9508 by the log-rank test), presence of TKI withdrawal syndrome (P=0.4096 by the log-rank test), or absolute number of natural killer cells (≥ median versus < median, P=0.4527 by the log-rank test).\n\nTable 3. Univariate analysis of predictive factors for treatment-free remission at 12 months.\n\nResponse to nilotinib treatment re-initiation\nNilotinib was readministered to all 29 patients with a molecular recurrence during the TFR phase. After recommencing treatment, MR4.5 rapidly returned in 25 patients (86.2%), with 50% of patients achieving MR4.5 within 3.5 months (Figure 1D). Four out of 29 patients discontinued treatment: one patient discontinued at 1 month because of a nilotinib-associated rash, one at 2.5 months following the patient’s request, and two at 10 and 11 months because of increasing BCR-ABL1IS. Despite discontinuation of the study, all patients, including the two patients with increasing BCR-ABL1IS during the re-treatment phase, achieved DMR. The clinical course details of these four patients are shown in Online Supplementary Figure S1. Among 29 patients with a molecular recurrence, 16 had lost their MMR at the first or second assessment of BCR-ABL1IS using RQ-PCR during the TFR phase. After starting treatment again, a MMR rapidly returned in all 16 patients (100%) in 3 months and 50% of patients achieved the MMR within 2 months (Figure 1E).\n\nSafety, vascular adverse events, and tyrosine kinase inhibitor withdrawal syndrome\nNo patients progressed to accelerated phase or blast crisis CML, or died during this study. Adverse events (all grades) were reported in 55 patients (57.3%) in the safety analysis set in the consolidation phase, and 30 patients (38.7%) in the full analysis set in the TFR phase; the incidence of grade 3/4 adverse events was 14.6%, and 2.6% in the safety analysis set and full analysis set, respectively (Online Supplementary Table S2).\n\nVascular adverse events of any grade were reported in six patients (6.2%) during the nilotinib consolidation phase (Table 4). Ischemic heart disease (acute coronary syndrome or angina pectoris) was reported in three patients and cerebral infarctions in three patients, but peripheral arterial occlusive disease was not reported in any patient. Among the six patients with vascular adverse events, four had at least one traditional risk factor for such events (e.g., hypertension, hyperlipidemia, diabetes mellitus, smoking, or chronic kidney disease). Percutaneous intervention was performed in three patients with ischemic heart disease. All patients, except one, with vascular adverse events recovered or improved. Although three patients with vascular adverse events stopped nilotinib treatment and switched to another TKI, three patients continued the study treatment and entered the TFR phase, eventually achieving successful TFR. No patients developed new vascular adverse events during the TFR phase.\n\nTable 4. Treatment-related vascular adverse events in the consolidation phase.\n\nArthralgia was reported only in the TFR phase (Online Supplementary Table S2). Eleven patients reported musculoskeletal pain events during the early phase of the TFR; these events were categorized as TKI withdrawal syndrome. The characteristics of the patients with TKI withdrawal syndrome are described in Table 5. The median time of onset of the TKI withdrawal syndrome in the TFR phase was 1 month (range, 0–6). All patients recovered completely with or without treatment. Of the 11 patients with the syndrome, eight (73%) maintained TFR at 12 months and remained in remission throughout the 36-month follow-up period. There were no significant differences in the TFR survival curves between subgroups based on TKI withdrawal syndrome.\n\nTable 5. Tyrosine kinase inhibitor withdrawal syndrome in the treatment-free remission phase.\n\nDiscussion\nThe design of the STAT2 trial resembled that of the STIM18,9 and TWISTER trials,10 with the aim of administering a TKI during a 2-year consolidation phase to obtain a sustained DMR before TKI discontinuation. In this trial, in contrast to the aforementioned studies, imatinib was replaced with nilotinib as the consolidation TKI therapy. However, the assessment of BCR-ABL1 and the definition of molecular recurrence in this trial are identical to those in the aforementioned studies.8–10 Nilotinib was administered instead of imatinib because previous studies had indicated that nilotinib could induce DMR in a greater number of patients than imatinib,1–3 thereby potentially increasing the number of patients who achieve successful TFR. The 2-year period of consolidation therapy in this study was selected as the STIM18,9 and TWISTER10 trials required 2 years of sustained DMR before stopping imatinib therapy. Additionally, our retrospective study revealed that a DMR duration of at least 2 years was a significant predictive factor for successful TFR in Japanese CML patients.14 Therefore, the treatment duration for this trial involved a consolidation phase of 2 years, and sustained DMR without loss of MR4.5 was confirmed by regular BCR-ABL1IS RQ-PCR testing for 2 years.\n\nAmong 78 patients who entered the TFR phase, 53 remained in TFR in the first 12 months; the 12-month TFR primary endpoint was, therefore, 67.9% (95% CI: 56.4–78.1%). Although the TFR rate is higher than that in the STIM1 trial (41%; 95% CI: 29–52%), it is difficult to compare this result with those in other TFR studies with varying designs. Among 29 patients with a molecular recurrence, MR4.5 was rapidly regained in 25 patients who were readministered nilotinib, and no patients progressed to accelerated phase or blast crisis CML in this study. Thus, our findings suggest that nilotinib therapy may allow the majority of patients to achieve successful TFR after discontinuation of nilotinib; this result is comparable to those of previous TFR studies with imatinib.8–10\n\nIn this study, the identified predictive factor for successful 12-month TFR was UMRD with MR5 before discontinuation of nilotinib. In the EURO-SKI trial, there were no differences in MMR status at 6 months after treatment stop between depths of molecular response (MR4.5\nversus no MR4.5).15 However, our finding suggests that a deeper MR favors successful achievement of TFR in CML patients, which is consistent with data from previous studies.16,17 Among four patients without TFR in the late TFR phase, in whom MR4.5 loss occurred at 16, 16, 17, and 20 months, three patients had MRD before entering the TFR phase. It is difficult to determine the quantity of BCR-ABL1 mRNA below MR4.5/MR5 because of the sensitivity of IS-RQ-PCR.18 However, UMRD with MR5 before TFR is one of the minimum requirements for TFR and the sustained duration of DMR might be a surrogate marker for the magnitude of the MR or the eradication of MRD during TKI treatment.19,20 Meanwhile, 1-year consolidation with either dasatinib or nilotinib, which are both second-generation TKI, was proposed in the DADI trial11 and the ENEStop study,21 respectively. Although the 1-year consolidation enabled identification of enrolled patients who had sustained MR4.5 and were eligible to stop treatment,21 it is still unknown whether 1 year of consolidation with a second-generation TKI is sufficient to achieve DMR/UMRD below MR4.5/MR5 for TFR.\n\nOf the 96 patients in the safety analysis set, 78 achieved a sustained MR4.5 on nilotinib consolidation and entered the TFR phase, including 33 patients (42.3%) who were treated with nilotinib following imatinib prior to enrollment in STAT2. Most patients (n=29, 72.5%) were switched from imatinib to nilotinib at the patients’ request prior to the trial, primarily to obtain a deeper and more sustained MR, despite not having imatinib resistance or intolerance. Similarly, the ENESTcmr study showed that a significant minority of patients who continued with imatinib therapy did later achieve DMR.4 In the subanalysis evaluating prior TKI exposure, the 12-month TFR was almost identical between patients treated with only imatinib (62.5%) and those treated with nilotinib following imatinib (69.7%). This suggests that, regardless of the specific TKI, DMR is the first step for achieving successful TFR in patients with CML.\n\nThe proportion of natural killer cells in peripheral blood has been reported as a predictive marker, which might be related to a previously reported immuno-oncological effect.22,23 However, it was beyond the remit of this trial to identify the significance of either the activity or the proportion or natural killer cells in peripheral blood.\n\nTKI withdrawal syndrome is the most common musculoskeletal pain-related adverse event in imatinib TFR studies, being first reported in the EURO-SKI trial.24 TKI withdrawal syndrome was detected in 11 patients in the TFR phase in this study. Rousselot et al. suggested that prolonged inhibition of c-Kit signaling by imatinib may modulate nociceptive sensitivity, and that the sudden discontinuation of imatinib may reverse this phenomenon.25 As nilotinib targets the same tyrosine kinases as imatinib, including BCR-ABL kinase and c-Kit, albeit with differing potencies, nilotinib may also result in TKI withdrawal syndrome via the same mechanisms. Although TKI withdrawal syndrome was reported as an independent predictive factor for successful TFR by a Korean group,26 there was no significant relationship between TKI withdrawal syndrome and TFR identified in this nilotinib TFR study. However, because of the limited number of events during the TFR phase, univariate analysis is definitely limited in identifying a significant relationship between TKI withdrawal syndrome and TFR. Further examination with larger numbers of patients will be necessary to identify biomarkers for successful TFR.\n\nAlthough the safety of nilotinib is generally regarded as being acceptable, vascular adverse events are an important concern in nilotinib therapy. The frequency of such events in this study was similar to the frequency in the nilotinib 300 mg twice daily arm in the ENESTnd trial.3 The incidence of vascular adverse events in patients treated with nilotinib 300 mg twice daily was estimated to be 2.8 per 100 patient-years in a meta-analysis.27 In the STAT2 trial, all patients with vascular adverse events, except one, either recovered or improved with intervention or supportive care after nilotinib discontinuation. Moreover, three patients achieved TFR after the occurrence of vascular adverse events during the TFR phase of STAT2. Since four of the six patients had at least one traditional risk factor for vascular adverse events, patients should be carefully screened for risk factors prior to nilotinib administration, with appropriate treatment or supportive care of comorbidities to avoid the development of vascular adverse events. After considering the risk of vascular adverse events in patients given consolidation with nilotinib, we conclude that this therapeutic agent can be safely administered to achieve a successful TFR in CML patients.\n\nIn conclusion, although previous evidence regarding TFR after discontinuation of second-line nilotinib therapy is limited, our study suggests that a 2-year consolidation period of nilotinib therapy can safely induce higher TFR rates in patients with MR4.5. Thus, 2-year consolidation therapy with this agent may be an effective strategy for achieving TFR in large numbers of CML patients.\n\nSupplementary Material\nTakahashi et al. Supplementary Appendix\n Disclosures and Contributions\n Acknowledgments\nThis study was supported by research funding from Novartis Pharmaceuticals to NT. The authors would like to thank all study participants and their families, and the study investigators at participating study sites. We also thank Professor Takuhiro Yamaguchi for some advice as a biostatician, the STAT data center (EPS, Co.) for monitoring the clinical trial, and Dr. Toshihiro Miyamoto, Dr. Yosuke Minami, and Dr. Hidetaka Niitsu for their cooperation as members of the data and safety monitoring committee.\n\nCheck the online version for the most updated information on this article, online supplements, and information on authorship & disclosures: www.haematologica.org/content/103/11/1835\n==== Refs\nReferences\n1. Kantarjian HM Hochhaus A Saglio G \nNilotinib versus imatinib for the treatment of patients with newly diagnosed chronic phase, Philadelphia chromosome-positive, chronic myeloid leukaemia: 24-month minimum follow-up of the phase 3 randomised ENESTnd trial . Lancet Oncol . 2011 ;12 (9 ):841 –851 .21856226 \n2. Larson RA Hochhaus A Hughes TP \nNilotinib vs imatinib in patients with newly diagnosed Philadelphia chromosome-positive chronic myeloid leukemia in chronic phase: ENESTnd 3-year follow-up . Leukemia . 2012 ;26 (10 ):2197 –2203 .22699418 \n3. Hochhaus A Saglio G Hughes TP \nLong-term benefits and risks of frontline nilotinib vs imatinib for chronic myeloid leukemia in chronic phase: 5-year update of the randomized ENESTnd trial . Leukemia . 2016 ;30 (5 ):1044 –1054 .26837842 \n4. Hughes TP Lipton JH Spector N \nDeep molecular responses achieved in patients with CML-CP who are switched to nilotinib after long-term imatinib . Blood . 2014 ;124 (5 ):729 –736 .24948656 \n5. Hughes TP Ross DM \nMoving treatment-free remission into mainstream clinical practice in CML . Blood . 2016 ;128 (1 ):17 –23 .27013442 \n6. Dulucq S Mahon FX \nDeep molecular responses for treatment-free remission in chronic myeloid leukemia . Cancer Med . 2016 ;5 (9 ):2398 –2411 .27367039 \n7. Rea D Cayuela JM \nTreatment-free remission in patients with chronic myeloid leukemia . Int J Hematol \n2017 \n7 \n8 \n[Epub ahead of print] \n8. Mahon FX Rea D Guilhot J \nDiscontinuation of imatinib in patients with chronic myeloid leukaemia who have maintained complete molecular remission for at least 2 years: the prospective, multicentre Stop Imatinib (STIM) trial . Lancet Oncol . 2010 ;11 (11 ):1029 –1035 .20965785 \n9. Ross DM Branford S Seymour JF \nSafety and efficacy of imatinib cessation for CML patients with stable undetectable minimal residual disease: results from the TWISTER study . Blood . 2013 ;122 :515 –522 .23704092 \n10. Etienne G Guilhot J Rea D \nLong-term follow-up of the French Stop Imatinib (STIM1) study in patients with chronic myeloid leukemia . J Clin Oncol . 2017 ; 35 (3 ):298 –305 .28095277 \n11. Imagawa J Tanaka H Okada M \nDiscontinuation of dasatinib in patients with chronic myeloid leukaemia who have maintained deep molecular response for longer than 1 year (DADI trial): a multicentre phase 2 trial . Lancet Haematol . 2015 ;2 (12 ):e528 –535 .26686407 \n12. Hochhaus A Masszi T Giles FJ \nTreatment-free remission following frontline nilotinib in patients with chronic myeloid leukemia in chronic phase: results from the ENESTfreedom study . Leukemia . 2017 ;31 (7 ):1525 –1531 .28218239 \n13. Noguchi S Nakaseko C Nishiwaki K \nSwitching to nilotinib is associated with deeper molecular responses in chronic myeloid leukemia chronic phase with major molecular responses to imatinib: STAT1 trial in Japan . Int J Hematol . 2018 ;108 (2 ):176 –183 .29713954 \n14. Takahashi N Kyo T Maeda Y \nDiscontinuation of imatinib in Japanese patients with chronic myeloid leukemia . Haematologica . 2012 ;97 (6 ):903 –906 .22180435 \n15. Mahon F Richter J Guilhot J \nCessation of tyrosine kinase inhibitors treatment in chronic myeloid leukemia patients with deep molecular response: results of the Euro-Ski trial . Blood . 2016 ;128 (22 ):787 .\n16. Mori S Vegge E le Coutre P \nAge and dPCR can predict relapse in CML patients who discontinued imatinib: the ISAV study . Am J Hematol . 2015 ;90 (10 ):910 –914 .26178642 \n17. Takahashi N Tauchi T Kitamura K \nDeeper molecular response is a predictive factor for treatment-free remission after imatinib discontinuation in patients with chronic phase chronic myeloid leukemia: the JALSG-STIM213 study . Int J Hematol . 2018 ;107 (2 ):185 –193 .28929332 \n18. Deininger M \nHematology: curing CML with imatinib–a dream come true¿ \nNat Rev Clin Oncol . 2011 ;8 (3 ):127 –128 .21283128 \n19. Takahashi N \nPredictive factors of successful treatment-free remission for patients with chronic myeloid leukemia . Rinsho Ketsueki . 2014 ;55 (5 ):489 –496 .24881913 \n20. Saussele S Richter J Hochhaus A Mahon FX \nThe concept of treatment-free remission in chronic myeloid leukemia . Leukemia . 2016 ;30 (8 ):1638 –1647 .27133824 \n21. Mahon FX Boquimpani C Kim DW \nTreatment-free remission after second-line nilotinib treatment in patients with chronic myeloid leukemia in chronic phase: results from a single-group, phase 2, open-label study . Ann Intern Med . 2018 ;168 (7 ):461 –470 .29459949 \n22. Mizoguchi I Yoshimoto T Katagiri S \nSustained upregulation of effector natural killer cells in chronic myeloid leukemia after discontinuation of imatinib . Cancer Sci . 2013 ;104 (9 ):1146 –1153 .23758044 \n23. Ilander M Olsson-Strömberg U Schlums H \nIncreased proportion of mature NK cells is associated with successful imatinib discontinuation in chronic myeloid leukemia . Leukemia . 2017 ;31 (5 ):1108 –1116 .27890936 \n24. Richter J Soderlund S Lubking A \nMusculoskeletal pain in patients with chronic myeloid leukemia after discontinuation of imatinib: a tyrosine kinase inhibitor withdrawal syndrome? \nJ Clin Oncol . 2014 ;32 (25 ):2821 –2823 .25071107 \n25. Rousselot P Charbonnier A Cony-Makhoul P \nReply to J. Richter et al . J Clin Oncol . 2014 ;32 (25 ):2823 –2825 .25071119 \n26. Lee SE Choi SY Song HY \nImatinib withdrawal syndrome and longer duration of imatinib have a close association with a lower molecular relapse after treatment discontinuation: the KID study . Haematologica . 2016 ;101 (6 ):717 –723 .26888022 \n27. Chai-Adisaksopha C Lam W Hillis C \nMajor arterial events in patients with chronic myeloid leukemia treated with tyrosine kinase inhibitors: a meta-analysis . Leuk Lymphoma . 2016 ;57 (6 ):1300 –1310 .26373533\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "0390-6078", "issue": "103(11)", "journal": "Haematologica", "keywords": null, "medline_ta": "Haematologica", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D060830:Consolidation Chemotherapy; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D007564:Japan; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D008297:Male; D008875:Middle Aged; D011743:Pyrimidines; D012074:Remission Induction; D015996:Survival Rate", "nlm_unique_id": "0417435", "other_id": null, "pages": "1835-1842", "pmc": null, "pmid": "29976734", "pubdate": "2018-11", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't", "references": "21283128;28929332;26888022;28095277;29713954;20965785;28689264;29459949;26178642;26686407;26837842;27133824;24948656;27367039;26373533;24881913;21856226;25071119;23758044;22180435;28218239;22699418;27890936;23704092;27013442;25071107", "title": "Treatment-free remission after two-year consolidation therapy with nilotinib in patients with chronic myeloid leukemia: STAT2 trial in Japan.", "title_normalized": "treatment free remission after two year consolidation therapy with nilotinib in patients with chronic myeloid leukemia stat2 trial in japan" }
[ { "companynumb": "PHHY2013JP085868", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CANDESARTAN CILEXETIL" }, "drugadditional": "3", ...
{ "abstract": "Peripheral neuropathies should be recognized as the adverse effects of biological agents, especially anti-TNF agents. However, no solid clinical databases for biological agent-associated peripheral neuropathies (BAPN) have been established in Japan. Here we report two cases of peripheral neuropathy associated with anti-TNF agents. One was peroneal motor neuropathy. The other case was chronic inflammatory demyelinating polyradiculoneuropathy. In addition, we summarize the previous reports on BAPN and discuss their prevalence rate, pathogenesis and management.", "affiliations": "a Department of Clinical Immunology and Rheumatology , The Tazuke-Kofukai Medical Research Institute, Kitano Hospital , Osaka , Japan.;b Department of Neurology , Kansai Electric Power Hospital , Osaka , Japan.;a Department of Clinical Immunology and Rheumatology , The Tazuke-Kofukai Medical Research Institute, Kitano Hospital , Osaka , Japan.;c Department of Dermatology , University of California Davis School of Medicine , Sacramento , CA , USA.", "authors": "Yagita|Masato|M|;Hamano|Toshiaki|T|;Hatachi|Saori|S|;Fujita|Masaaki|M|", "chemical_list": "D018501:Antirheumatic Agents; D014409:Tumor Necrosis Factor-alpha; D000069285:Infliximab", "country": "England", "delete": false, "doi": "10.3109/14397595.2013.859770", "fulltext": null, "fulltext_license": null, "issn_linking": "1439-7595", "issue": "26(2)", "journal": "Modern rheumatology", "keywords": "Biological agents; Peripheral neuropathy", "medline_ta": "Mod Rheumatol", "mesh_terms": "D000328:Adult; D018501:Antirheumatic Agents; D005260:Female; D006801:Humans; D000069285:Infliximab; D007564:Japan; D008297:Male; D008875:Middle Aged; D010523:Peripheral Nervous System Diseases; D020277:Polyradiculoneuropathy, Chronic Inflammatory Demyelinating; D014409:Tumor Necrosis Factor-alpha", "nlm_unique_id": "100959226", "other_id": null, "pages": "288-93", "pmc": null, "pmid": "24313920", "pubdate": "2016", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Peripheral neuropathies during biologic therapies.", "title_normalized": "peripheral neuropathies during biologic therapies" }
[ { "companynumb": "JP-JNJFOC-20100405995", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "SULFASALAZINE" }, "drugadditional": null, ...
{ "abstract": "While there is evidence to support the use of extracorporeal membrane oxygenation in acute respiratory distress syndrome due to a variety of causes, its use in chlorine gas-induced acute respiratory distress syndrome has not been described in the English medical literature. We present a young girl who had severe acute respiratory distress syndrome following exposure to chlorine gas during the disinfection process at a swimming pool. She failed conventional management and underwent venovenous extracorporeal membrane oxygenation. Despite multiple infections and a pneumothorax, she eventually recovered. Chlorine gas was the first agent of chemical warfare which caused a massive death toll during the First World War. Even today, the chemical is produced in large quantities and the threat of a large-scale leak is ever-present from industrial accidents or terrorist attacks. The criteria to assess and manage chlorine gas-induced acute respiratory distress syndrome are likely to be the same as for other causes of acute respiratory distress syndrome and extracorporeal membrane oxygenation can be used successfully.", "affiliations": "Cardiothoracic Unit, Karapitiya Teaching Hospital, Galle, Sri Lanka.;Neonatal Intensive Care Unit, Karapitiya Teaching Hospital, Galle, Sri Lanka.;Microbiology Department, Karapitiya Teaching Hospital, Galle, Sri Lanka.;Faculty of Medicine, University of Ruhuna, Galle, Sri Lanka.;Cardiothoracic Unit, Karapitiya Teaching Hospital, Galle, Sri Lanka.;Cardiothoracic Unit, Karapitiya Teaching Hospital, Galle, Sri Lanka.", "authors": "Harischandra|Tolusha|T|0000-0001-9791-5431;Withanaarachchi|Kapilani|K|0000-0002-0145-7673;Piyasiri|Bhagya|B|;Wickramasuriya|Hesaru|H|;Piyasiri|Gihan|G|;Firmin|Richard|R|", "chemical_list": "D002713:Chlorine", "country": "England", "delete": false, "doi": "10.1177/0267659120922013", "fulltext": null, "fulltext_license": null, "issn_linking": "0267-6591", "issue": "35(6)", "journal": "Perfusion", "keywords": "ARDS; ECMO; chlorine; extracorporeal membrane oxygenation; respiratory distress syndrome; swimming pool", "medline_ta": "Perfusion", "mesh_terms": "D002648:Child; D002713:Chlorine; D015199:Extracorporeal Membrane Oxygenation; D005260:Female; D006801:Humans; D012128:Respiratory Distress Syndrome; D013551:Swimming Pools", "nlm_unique_id": "8700166", "other_id": null, "pages": "543-545", "pmc": null, "pmid": "32441230", "pubdate": "2020-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Successful use of extracorporeal membrane oxygenation in acute respiratory distress syndrome following accidental chlorine gas inhalation at a swimming pool.", "title_normalized": "successful use of extracorporeal membrane oxygenation in acute respiratory distress syndrome following accidental chlorine gas inhalation at a swimming pool" }
[ { "companynumb": "LK-SUN PHARMACEUTICAL INDUSTRIES LTD-2020RR-260731", "fulfillexpeditecriteria": "1", "occurcountry": "LK", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "MEROPENEM" }, "druga...
{ "abstract": "As a global health pandemic, the novel severe acute respiratory syndrome-coronavirus 2 (SARS- CoV2) outbreak began in December 2019 which rapidly spread to more than 200 countries. Respiratory complications and fever are the most obvious symptoms. Sometimes the neurological features are superimposed on the main disease and complicate patient's status.\nWe describe 6 patients with COVID-19 and concomitant quadriparesia who underwent electrodiagnosis using EMG/NCS and results indicated 3 axonal variants of Guillain-Barré syndrome (GBS), including; 2 cases AMAN (acute motor axonal neuropathy), 1 case AMSAN (acute motor and sensory axonal neuropathy), three myopathies, including one combination of CIN/CIM (critical illness neuropathy/critical illness myopathy), one CIM and one acute polymyositis in these cases.\nEarly diagnosis of the neuromuscular disorders of coronavirus could help for correct planning in the treatment of COVID-19 patients. Since GBS and inflammatory myopathies have an autoimmune basis, the immunotherapies such as IVIG, steroids, plasma exchange and other novel treatments as hemoperfusion can promise better and faster recovery in respiratory function and neuromuscular activity among COVID-19 patients who have musculature paralysis concomitantly. However, all these treatments are challenging and further clinical trials should be done to confirm the efficacy and safety of mentioned therapies.", "affiliations": "Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.;Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.;Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.;Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.;Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.;Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran.", "authors": "Eslamian|Fariba|F|;Taleschian-Tabrizi|Negar|N|;Izadseresht|Behzad|B|;Shakouri|Seyyed Kazem|SK|;Gholian|Shakiba|S|;Rahbar|Mohammad|M|", "chemical_list": null, "country": "Iran", "delete": false, "doi": "10.22088/cjim.12.0.451", "fulltext": "\n==== Front\nCaspian J Intern Med\nCaspian J Intern Med\nCJIM\nCaspian Journal of Internal Medicine\n2008-6164\n2008-6172\nBabol University of Medical Sciences Babol, Iran\n\n10.22088/cjim.12.0.451\nCase Report\nElectrophysiologic findings in patients with COVID-19 and quadriparesia in the northwest of Iran, A case series study and literature review\nEslamian Fariba MD 1*\nTaleschian-Tabrizi Negar MD 1\nIzadseresht Behzad MD 1\nShakouri Seyyed Kazem MD 1\nGholian Shakiba MD 1\nRahbar Mohammad MD 1\n1 Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Tabriz, Iran\n* Correspondence: Fariba Eslamian, Physical Medicine and Rehabilitation Research Center, Imam Reza Hospital, Tabriz University of Medical Sciences, Golgasht Ave., Tabriz, 5166615556, Iran. E-mail: eslamiyanf@tbzmed.ac.ir, Tel: 0098 9143154912, Fax: 0098 4133361651\n2021\n12 Suppl 2 S451S459\n2 11 2020\n8 12 2020\n23 12 2020\nhttps://creativecommons.org/licenses/by/3.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License, (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nBackground:\n\nAs a global health pandemic, the novel severe acute respiratory syndrome-coronavirus 2 (SARS- CoV2) outbreak began in December 2019 which rapidly spread to more than 200 countries. Respiratory complications and fever are the most obvious symptoms. Sometimes the neurological features are superimposed on the main disease and complicate patient's status.\n\nCase Presentation:\n\nWe describe 6 patients with COVID-19 and concomitant quadriparesia who underwent electrodiagnosis using EMG/NCS and results indicated 3 axonal variants of Guillain–Barré syndrome (GBS), including; 2 cases AMAN (acute motor axonal neuropathy), 1 case AMSAN (acute motor and sensory axonal neuropathy), three myopathies, including one combination of CIN/CIM (critical illness neuropathy/critical illness myopathy), one CIM and one acute polymyositis in these cases.\n\nConclusion:\n\nEarly diagnosis of the neuromuscular disorders of coronavirus could help for correct planning in the treatment of COVID-19 patients. Since GBS and inflammatory myopathies have an autoimmune basis, the immunotherapies such as IVIG, steroids, plasma exchange and other novel treatments as hemoperfusion can promise better and faster recovery in respiratory function and neuromuscular activity among COVID-19 patients who have musculature paralysis concomitantly. However, all these treatments are challenging and further clinical trials should be done to confirm the efficacy and safety of mentioned therapies.\n\nKey Words\n\nAcute motor axonal neuropathy\nCOVID-19\nCorona virus\nCritical illness myopathy\nCritical illness neuropathy\nGBS\nQuadriparesis\n==== Body\npmcThe novel coronavirus, causing severe acute respiratory syndrome- coronavirus 2 (SARS- CoV2), emerged in Wuhan City, China, on the late December 2019 which drew significant attention and effort as a global health concern (1). World Health Organization (WHO) named it coronavirus disease-2019 (COVID-19) and declared it as pandemic on March 11, 2020 (2). On October 10th 2020, approximately 45 million cases of COVID-19 were reported, including 1,189,499 death (3). In addition to respiratory tract infection symptoms, neuromuscular, and nervous system involvement are more recently identified as presentations of this disease (4). Patients with more severe infections have common co-morbidities, and tend to present more atypical symptoms, including neurological and skeletal muscle injury manifestations (5).\n\nPrevious studies on MERS and SARS suggested a direct invasion of virus or molecular changes due to immune-mediated response causing neuromuscular disorders such as Guillain-Barre Syndrome (GBS) which could be the same in SARS-CoV2 (6-8). It is known that SARS-CoV-2 can stimulate immune reaction resulting in cytokines storming, especially Interleukin-6 (IL-6), which activates inflammatory cascade causing tissue damage (9). Central or peripheral nervous system involvement may be caused by the direct invasion of viruses or stimulating the body's innate and adaptive immune responses to infection. However, the available evidence is not in favor of high neurovirulence of SARS-CoV-2 or related coronaviruses, unlike herpes simplex virus and some enteroviruses, causing the destruction of neurons (10). On the other hand, prolonged hospitalization and mechanical ventilation can lead to secondary neuromuscular problems such as critical illness polyneuropathy (CIP) or critical illness myopathy (CIM) (11) which their occurrence was not well studied in severe cases of COVID-19 patients. This case series aims to describe the clinical and electrodiagnostic findings of six patients who had coronavirus disease and suffered from four limb muscular weakness.\n\nCases presentations\n\nCase1: A 52-year-old man presented with cough and dyspnea, and due to O2 saturation below 90%, he was admitted to ICU in a teaching hospital, a specialized center for COVID patients. Respiratory distress progression led to intubation. PCR test, as well as lung CT-scan, was positive for coronavirus. Routine anti-COVID treatment is in-line with protocols for respiratory care demanding ICU-patients, including broad-spectrum antibiotics, anticoagulant therapy with enoxaparin, vitamin D oral supplement, none steroids anti-inflammatory drugs, and corticosteroids were administered. Due to four limbs, weakness patient was referred for electrodiagnosis 18 days after admission. EMG/NCS test showed an acute motor axonal neuropathy (AMAN), classified as GBS axonal variant neuropathy. Thus, IVIG 15-20 g/day for 5 days was added to his medications plan, and after 3 weeks, the patient was extubated. After a total duration of 50 days, he was discharged with partial dyspnea and relatively good recovery, and he was advised to continue quarantine at home. Table 1 shows demographic, clinical, and para-clinical findings and table 2 shows electrodiagnostic parameters and final EDX diagnosis in this patient.\n\nTable 1 Demographic and clinical characteristics of COVID -19 patients associated with quadriparesia who underwent electrodiagnsotic tests\n\nPatient ID\tAge\tsex\tFirst symptoms\tConcomitant problem (PMH)\tInterval between disease onset-weakness onset and disease onset-EDX exam (days)\tLevel of conciseness\n(GCS score) at EDX time\tCOVID PCR test chest CT, WBC\nCPK\tElectrodiagnostic diagnosis\tDrug Treatment\t\n#1\t52\tmale\tcoughing and respiratory distress\t--\t10-18\t14\tPCR: positive\nChest CT: positive\nWBC:4500 lymph:18%\nCPK:172\nCSF Protein:54mg/dl\tAMAN*\tIVIG+ prednisolone+ routine anti COVID\t\n#2\t62\tmale\tRenal colic and fever\tNephrolithiasis, Pyelonephritis, nephrectomy and diabetes\t5-15\t12\tPCR: positive\nChest CT: positive\nWBC:17000 lymph:6.7%\tAMAN*\tIVIG+ Broad-spectrum antibiotics+ anti COVID\t\n#3\t76\tmale\tDiarrhea and cough\t--\t5-7\t15\tPCR: positive\nChest CT: positive\nWBC:14000\nCRP:+3\nCPK:328\nCSFProtein:76mg/dl\tAMSAN†\tIVIG+ routine anti COVID\t\n#4\t58\tmale\tDry cough and respiratory dyspenea\t-\t20-22\t10\tInitial PCR: positive\nAfter 6 weeks :Neg\nCPK:1283 WBC:11300\nLymph:7.1%\tCIN/CIM €\tIVIG+ prednisolone+ routine anti COVID\t\n#5\t32\tfemale\tFever and respiratory distress\t--\t45-69\t14\tInitial PCR: positive\nAfter 8 weeks :Neg\nWBC:11600\nCPK:450\tCIM €\troutine anti COVID+ IVIG +prednisolone\t\n#6\t34\tmale\tMuscular weakness and respiratory distress\tOpium addict\t0-30\t13\tInitial PCR: posetive\nChest CT: positive\nCPK:1819\nWBC:14000\tPolymyositis\tPrednisolone-hydroxychlroqiune+ routine anti COVID+ IVIG\t\n*AMAN: acute motor axonal neuropathy, †AMSAN: acute motor and sensory axonal neuropathy, €CIN/CIM: critical illness neuropathy/critical illness myopathy.\n\nTable 2 Electrodiagnostic parameters among COVID-19 patients with quadriparesia\n\nPatient ID\tTibial CMAP *\namp ‡ (mv)\tTibial CMAP\ndistal latency(ms)\tTibial CMAP\nNCV €\n(m/s)\tTibial\nF-wave latency\n(ms)\tPeroneal CMAP * amp ‡\n(mv)\tMedian CMAP amp ‡\n(mv)\tMedian\nCMAP *\nNCV €\n(m/s)\tUlnar CMAP * amp ‡\n(mv)\tSural SNAP † amp ‡\n(µv)\tUlnar SNAP† amp ‡\n(µv)\tMedian SNAP† amp ‡\n(µv)\tPresence\nof muscle\nfibrillation and MUAP ₤ pattern\tEDX\nImpression\t\n#1\t3.8Ω\t6.1\t38.5\t60.3\t0.0\t0.3\t48\t0.8\t6\t15\t14\t+2,neurogenic\tAMAN\t\n#2\t3.6\t5.5\t42\t0.0\t0.0\t0.7\t50\t1.4\t3\t28\t17\t+3, neurogenic\tAMAN\t\n#3\t2.0\t7.2\t44\t0.0\t0.8\t7.9\t36\t5.2\t0.0\t10\t11\t0, neurogenic\tAMSAN\t\n#4\t1.6\t6.0\t49\t58.5\t0.0\t0.8\t58\t1.2\t0.0\t17\t14\t+1,neuromyogenic\tCIN/CIM\t\n#5\t3.4\t7.4\t53\t48\t1.8\t2.8\t51\t2.2\t18\t30\t28\t+1,myogenic\tCIM\t\n#6\t0.4\t6.8\t54\t0.0\t0.2\t2.7\t56\t2.0\t24\t27\t46\t+3, myogenic\tPolymyositis\t\n*CMAP: compound muscle action potential, ‡ amp: amplitude, †SNAP: sensory nerve action potential, €NCV: nerve conduction velocity. Ω: the numbers, which are below or above the reference values, are shown as bold numbers. ₤MUAPs: motor units action potentials. Average of right and left side motor or sensory nerves are presented.\n\nTable 3 Diagnostic criteria for electrophysiological and clinical features of neuromuscular disorders in this study (12, 30-31)\n\n\tClinical picture\tMotor NCS\tSensory NCS\tNeedle EMG findings\t\nClassic GBS\tAcute onset of weakness and numbness in distal of lower limbs then upper limbs in adults and children. Progressive weakness ensues over the course of 2-4 weeks. Elevated CSF protein without pleocytosis is the characteristic finding. Immunologic attack against myelin sheath exists.\tProlonged distal motor latencies and slow conduction velocities associated with conduction block, absent or prolonged F-waves latencies .(within demyelination range; NCVs€<70%of lower limit of normal and latencies greater than 150% of upper limit of normal).\tProlonged distal sensory latencies, low amplitude SNAPs\tReduced recruitment of MUAPs₤ associated with some fibrillation potentials may be seen when CMAPs are low amplitude and these signs are present between weeks 2-4 (peaking 6-15 weeks).\t\nAMAN*\tAbrupt onset of generalized weakness in adults or children. Distal muscles more affected than proximals. Cranial nerves deficit and respiratory failure requiring mechanical ventilation is seen in one-third of patients. Antecedent and positive serology of C.Jejuni is seen in 67-90%. Albuminocytologic dissociation is the rule.\tLow amplitude or absent CMAPs₤. If obtainable, distal latencies and conduction velocities are normal or mildly reduced (axonal loss pattern)\tNormal SNAPsµ\tIncreased fibrillation potentials and decreased recruitment of large, long and polyphasic MUAPs mainly in distal muscles (neurogenic pattern)\t\nAMSAN †\tRapidly progressive and severe generalized weakness over only a few days as opposed to a couple weeks in most AIDP patients. Facial and respiratory muscles involvement can be expected. DTRs are diminished or absent.\tLow amplitude or absent CMAPs. If obtainable, distal latencies and conduction velocities are normal or mildly reduced (axonal loss pattern)\tLow amplitude or absent SNAPs\tIncreased fibrillation potentials and decreased recruitment of large, long and polyphasic MUAPs (neurogenic pattern)\t\nCIN ‡\tSevere generalized muscle weakness, may be first recognized by inability to wean patient from ventilator. Respiratory muscle involvement is prominent. DTRs are diminished or absent. Sepsis and multiorgan failure are the primary causes. That is common among patients with staying longer than 20 days in ICU.\tLow amplitude or absent CMAPs\tLow amplitude or absent SNAPs\tIn severe & acute form: inability to actively recruit MUAPs with presence of profuse fibrillation potentials. In early reinnervation: small and polyphasic MUAPs are present and then with recovery large MUAPs are recruited.\t\nCIM Ω\tSevere generalized muscle weakness, may be first recognized by inability to wean patient from ventilator. DTRs are diminished or absent CPK usually moderately elevated (up to 10 times of normal value). Other names: Acute quadriplegic myopathy, acute illness myopathy myopthy with loss of myosin or thick filaments\tLow amplitude CMAPs\tNormal or mildly reduced\nSNAPs\tIn severe & acute form: inability to actively recruit MUAPs with presence of fibrillation potentials, In moderate involvement or recovery period: small, short and polyphasic MUAPs, are frequently present.(myogenic pattern)\t\n* AMAN: acute motor axonal neuropathy, † AMSAN: acute motor and sensory axonal neuropathy, ‡CIN: critical illness neuropathy , ΩCIM: critical illness myopathy, €NCV: nerve conduction velocity, ₤CMAP: compound muscle action potential, , µSNAP: sensory nerve action potential, are present ₤MUAPs: motor units action potentials\n\nCase 2: A 62-year-old man with a history of diabetes and nephrolithiasis was admitted to the hospital due to fever and renal colic. Due to severe pyelonephritis and several unsuccessful dialyses, he underwent nephrectomy surgery. During the hospitalization period, respiratory problems and decreased consciousness were added to the clinical picture, and CT-scan showed the signs of pulmonary involvement with COVID-19, and the patient transferred to ICU. Anti-COVID therapy, including azithromycin, hydroxychloroquine, and other medications due to the above-mentioned protocol were prescribed to him. The patient was referred for electrodiagnosis 15 days after admission due to four limbs muscular weakness. Electrodiagnostic findings were suggestive of acute motor axonal neuropathy (AMAN) or GBS axonal variant neuropathy. IVIG 20 g SD was added to the treatment plan, and broad-spectrum antibiotics due to kidney surgery, diabetes and long-term patient hospitalization were continued. After 3 months, the consciousness level of patient improved, he was still sedated and unable to tolerate weaning from mechanical ventilation; hence, he was tracheostomized and then discharged to home due to his consent. Two weeks later, his clinical status deteriorated due to uremia and decreased in O2 saturation, and he was hospitalized again, and finally, after 2 weeks passed away.\n\nCase 3: A 76-year-old male patient presented to the hospital with diarrhea and coughing and a history of one-week common cold. Chest CT showed minor pulmonary changes in favor of involvement with coronavirus, and the PCR test was positive. After 5 days of admission, he could not move his legs and could not stand or walk. Therefore, electrodiagnostic tests to evaluate lower limb weakness were performed. During the EDX examination, the patient was absolutely conscious under nasal auxiliary oxygen without intubation or respiratory distress. EMG/NCS showed the mixed type axonal and demyelinating sensorimotor peripheral neuropathy, which could be related to early stages of GBS or one of its axonal variants because only 5 days passed and the findings of electrodiagnostic criteria for typical GBS was not completely fulfilled yet (12). IVIG 20 g per day for 5 days concomitant anti- COVID treatment was started for the patient, and after 2 weeks of admission, he was discharged to home with good recovery.\n\nCase 4: A 46-year-old man with dry cough and dyspnea presented to emergency care department. His O2 saturation at admission was 78%, and the PCR test of coronavirus was positive, and lymphopenia and anemia were also detected in laboratory tests. Muscular weakness in four limbs and persistent respiratory distress caused the patient to be referred to the electrodiagnosis center in the rehabilitation department after 22 days of admission for further evaluation to determine the reason for quadriplegia.\n\nEMG/NCS exam showed a critical illness neuropathy concomitant with myopathy in proximal muscles (CIN/CIM), associated to serum CPK rising. Prednisolone 25 mg daily and IVIG 5 gr SD and then 3 sessions of hemoperfusion were added to baseline anti-COVID therapy, and after 35 days of admission, the patient was discharged to home with good health status.\n\nCase 5: A 32-year-old female patient who was one of the laboratory sciences staff initially presented with symptoms of common cold and then suffered from fever and respiratory disturbances. At the time of admission, the PCR test was positive, and she was hospitalized in ICU; her clinical picture deteriorated with empyema and pneumomediastinum. Anti COVID-19 treatment and broad-spectrum antibiotics and then hemoperfusion was prescribed. After 70 days of admission due to systemic illness and quadriplegia, she underwent electrodiagnostic tests, and CIM was diagnosed. Long-term admission leads to disuse and muscle mass atrophy, and finally, CIM superimposed on her underlying pulmonary illness. A tracheostomy was performed for her due to prolonged admission and inability to wean from mechanical ventilation.\n\nAt last, after 3.5 months, she was tracheostomized, repeated PCR tests were negative, infections were improved and the patient had a relatively stable condition discharged to home. Now at follow-up evaluation, she has recovered well, her tolerance without supplemental oxygen increased, and she is on the waiting list for decannulation and tracheostomy removal.\n\nCase 6: An addict 34-year-old male patient before admission suffered from four limb muscular weakness and myalgia for several days. He was admitted to a local hospital due to myopathy and pneumonia with serum CPK level raised up to 1820 IU/lit. Afterward, he was referred to a specialized center and admitted to the rheumatology department. Bilateral pulmonary consolidations in the bases of two lungs were observed regarding coronavirus involvement.\n\nO2 saturation was 92%, and serum CPK was still elevated, and the patient was transferred to ICU. 30 days after disease onset, electrodiagnostic tests were performed. The results showed an acute and ongoing myogenic process in all upper and lower limbs muscles which was suggestive of active polymyositis. Prednisolone 60 mg daily, hydroxychloroquine 200mg, IVIG 25 gr for 5 days were prescribed to him associated to other antibiotics and drugs. Two weeks later, PCR testing was negative, but the patient was still intubated and hospitalized in the ICU because of neuromuscular weakness and the inability to weave mechanical ventilation. Then, multiple complications, including pneumothorax, pulmonary thromboembolism (PTE), and consequent tracheal arterial bleeding due to full anticoagulant dose, deteriorated patient’s condition.\n\nAt last, he passed away after a total duration of 3 months of hospitalization. All the first 5 patients had areflexia and patient 6 had hyporeflexia. CSF analysis in 2 patients with GBS variants was performed and results are shown in table 1. The summary of clinical and EDX findings of these 6 patients is indicated in tables 1-2.\n\nThis study was performed according to the ethical standards, and the local ethics committee approved it with an assigned number of IR.TBZMED.REC1399.534.\n\nDiscussion\n\nTo categorize our findings, we encountered two types of neuromuscular dysfunction among COVID-19 patients: first; co-incidence of axonal variants of GBS associated to infection within the acute phase (less than 4 weeks of disease onset) and second; critical illness neuropathy and myopathy, which are the consequences of long term admission in the hospital which could occur in any critical and chronic systemic illness after a longstanding stay in ICU (more than 4-8 weeks of hospitalization), especially in patients with respiratory failure who need mechanical ventilation. GBS is an acute immune-mediated polyradiculoneuropathy in which the mechanism of autoimmune disorder plays an important role to create it (13). GBS is classified due to the type of nerve fibers involvement and mode of fiber injury to acute inflammatory demyelinating polyneuropathy (AIDP), acute motor axonal neuropathy (AMAN), acute motor and sensory axonal neuropathy (AMSAN) or a subtype consistent to ophthalmoplegia, ataxia, and areflexia without any weakness which is defined as Miller Fisher Syndrome (MFS) (14).\n\nAbout two-thirds of cases are associated to an antecedent infection such as Campylobacter Jejuni which is more frequent in axonal variant, and it is also reported in viral diseases such as SARS-CoV, MERC-CoV, or Zika epidemics (13-15). There were some reports of covid-19 patients who developed GBS as AMAN type following this disease (16). The electrophysiological feature of NCS in AMAN is low amplitude or unobtainable CMAPs with normal SNAPs. When CMAPs are obtained, distal latencies and conduction velocities are normal or mildly reduced. Increased fibrillation potentials and decreased recruitment of neurogenic MUAPs (motor units action potentials) could be appreciated in the needle exam (12). All of these findings were observed in electrodiagnostic tests of our sampled patients (cases 1-2).\n\nTo our knowledge, four cases of GBS due to COVID-19 were reported in Iran. Sedaghat and Karimi reported a 65-year-old man with acute progressive symmetric ascending quadriparesis who had confirmed COVID-19 diagnosis two weeks before disease onset. Electrodiagnostic studies were compatible to AMSAN or an axonal variant of GBS (16). Ebrahimzadeh et al. reported two COVID-19 cases with(acute inflammatory demyelinating polyneuropathy or classic GBS) (AIDP) (17), and Farzi et al. revealed a demyelinating type polyneuropathy in a 41- year- old male patient who developed ascending paralysis following infection with SARS-CoV-2 virus. Electrodiagnostic evaluation in this patient indicated AIDP and was treated with IVIG, which resulted in a favorable response (18).\n\nA systematic review about neurological manifestations of COVID-19 was published, and 82 cases with neurological disorders were identified in which 17 patients had GBS (4). Gupta A et al. suggested that whereas AIDP and demyelinating neuropathy are more common with GBS related to dengue and Zika virus, the most COVID-19-related GBS patients had Acute motor axonal neuropathy (AMAN) and AMSAN (19). This result is exactly confirmed by the current study. In this regard, from electrodiagnosis point of view, our patients showed axonal variants of GBS, including AMAN and AMSAN rather than classic GBS. Moreover, motor nerves involvement was greater than sensory nerves, and low amplitudes CMAPs were more frequent than low amplitudes SNAPs. In contrast, two recent systemic reviews showed the results against above conclusion, and they indicated patterns more compatible with a demyelinating polyradiculoneuropathy versus axonal type polyneuropathies (4, 20). Anyway, COVID-19 is a novel, challenging infective disease, and its complications need to be explored more in the future. Accordingly, all GBS subtypes (AIDP, AMAN, AMSAN, MFS) can be expected with COVID-19; therefore, screening of ganglioside antibodies to assess autoimmunity may be helpful (21).\n\nIn this case series, we diagnosed three myopathies among COVID-19 patients, including a combination of CIM/CIN, pure CIM, and acute polymyositis. The last patient (case 6) was admitted with a clinical picture of polymyositis initially and after hospitalization infection of coronavirus and pneumonia superimposed on the underlying myositis. The former patients (cases 4-5) were admitted to ICU because of COVID-19, and they were involved with CIM/CIN or pure CIM several weeks later.\n\nSkeletal muscle injury is defined as a patient having myalgia and elevated serum creatine kinase level above 200 IU/L. The last studies indicated that patients with COVID-19 and muscle injury had significantly higher levels of creatine kinase (median, 400.0 IU/L), regardless of their severity (5). Mao et al. concluded that this injury may be due to the direct effect of the virus on muscle tissue. The other possible mechanism proposed is the infection-mediated immune response which cause elevated pro-inflammatory cytokines in serum, resulting in skeletal muscle damage; however, the association of SARS-CoV-2 binding with angiotensin- converting enzyme-2 (ACE-2) receptors in muscle is other probable mechanism, but there is still need for more investigation. Patients with a muscle injury had lower lymphocyte counts, higher neutrophil counts, higher C-reactive protein and D-dimer levels, and increased blood coagulation function as well (5).\n\nZhang et al. reported a 38-year-old man with COVID-19 and myalgia in which lab findings showed extremely increased CPK (>42,670 U/L), as well as elevated inflammatory markers indicating a myositis associated to rhabdomyolysis. It was discovered that this complication was due to SARS-CoV-2 (22). Viral myositis can be caused by viruses such as influenza A and B, human immunodeficiency virus (HIV), hepatitic B and C, and herpes simplex virus (23). Beydon et al. reported a case of myositis secondary to covid-19 in a patient. Symptoms appeared suddenly on walking with diffuse myalgias, increased CPK level, and proximal lower limb muscle weakness, causing him to fall. Fever occurred at day 4, and chest involvement of COVID-19 emerged on day 10 after the initial presentation. MRI showed bilateral edema in the external obturator muscle and quadriceps, suggesting myositis (24). The history of this patient was in line with our case 6, who was predominantly presented with polymyositis manifestation and followed by pulmonary involvement, which could emphasize the importance of non-specified musculoskeletal presentation in early diagnosis of COVID-19. Critical illness polyneuropathy (CIP) involving sensorimotor nerves and critical illness myopathy (CIM) involving skeletal muscles are frequent complications which can occur in 25–45% of critically ill patients, especially those with long term ICU hospitalization, mechanically ventilated ones, serious non-neurological medical reasons including acute or chronic renal failure, COPD exacerbation, pulmonary thromboembolism (PTE), cerebral and gastrointestinal hemorrhage, complications of ischemic heart diseases, or multiple organ failure (11, 25).\n\nThe underlying pathology may be microcirculatory dysfunction leading to hypoperfusion or hyper-inflammatory status which can damage motor neurons integrity (26). COVID-19 leads to severe ARDS (acute respiratory distress syndrome), and the necessity for mechanical ventilation was reported from 26% to 47.3 % in severe case (27, 28) which indicates the possibility of CIP and CIM occurrence is considerable, CIP/CIM are not well studied in COVID-19 yet. CIN and CIM tend to appear later than GBS in our study, and it was mentioned that the difference among them is important (29). Clinical features and electrodiagnostic findings of AMAN, AMASAN, CIM, and CIN are presented in table 3 (12, 30-31). There is no established treatment for CIN and CIM, the treatment of the underlying disease is vital. IVIG was recently noticed as an adjuvant treatment of COVID-19, and early studies showed the promising effects of IVIG at the therapeutic dose of 0.3–0.5 g/kg to improve the general condition of COVID-19 patients, especially in early administration in critically ill patients (31- 33). Moreover, combining IVIG with a moderate-dose of corticosteroids may improve patients outcomes (34). Relatively favorable outcomes were achieved from using IVIG in our study; however, the efficacy is not thoroughly confirmed yet, and there is the potential of the exaggerated inflammatory response (33).\n\nOther novel treatment options opposing immune dysregulation in COVID-19, such as extracorporeal hemoperfusion, are a feasible option to purify blood to stop cytokine storm (35). Plasma exchange could also be beneficial by removing cytokines and preventing pathologic coagulation, and maintaining microcirculation (36). Plasma from patients recovered from COVID-19 or convalescent plasma containing antibodies against SARS-CoV2 has shown promising results in patients with severe COVID-19 (37). Thus, electrodiagnostic tests and early diagnosis of acute neuropathies or critical illness neuromyopathies could emphasize using novel treatments even more, which could be beneficial for both conditions.\n\nIn conclusion to conclude, we reported six cases with COVID-19 associated to quadriparesia who underwent electrodiagnostic tests, and it was found that two cases had AMAN, one AMASN, one CIN/CIM, one pure CIM, and one polymyositis. Immunotherapies such as steroids, plasma exchange, IVIG, and novel procedures could be good and promising treatments in GBS variants, which may be beneficial for pulmonary lesions of COVID-19 at the same time. Therefore, early diagnosis of acute neuropathies or myopathies could help better planning of treatment among patients with COVID-19 who have neuromuscular weakness concomitantly. Nonetheless, all these treatments are challenging and further clinical trials are required to confirm the efficacy and safety of mentioned therapies.\n\nAcknowledgments\n\nWe greatly acknowledge Tabriz Imam Reza University Hospital, Physical Medicine, and Rehabilitation department staff for the performance of this study.\n\nConflict of Interest:\n\nThere of no conflict of interests.\n==== Refs\nReferences\n\n1 Tang X Wu C Li X On the origin and continuing evolution of SARS-CoV-2 Natl Sci Rev 2020\n2 WHO Director-General’s opening remarks at the media briefing on COVID-19–11 March 2020: World Health Organization 2020 [Accessed 2020.7.6] Available at: https://www.who.int/dg/speeches/detail/who-director-general-s-opening-remarks-at-themedia-briefing-on-covid-19---11-march-2020\n3 COVID-19 Situation Update Worldwide, as of 31 October 2020: European Centre for Disease Prevention and Control 2020 [Accessed 2020.31.10] Available at: https://www.ecdc.europa.eu/en/geographical-distribution-2019-ncov-cases\n4 Ghannam M Alshaer Q Al-Chalabi M Neurological involvement of coronavirus disease 2019: a systematic review J Neurol 2020 267 3135 53 32561990\n5 Mao L Jin H Wang M Neurologic manifestations of hospitalized patients with coronavirus disease 2019 in Wuhan, China JAMA Neurol 2020 77 683 90 32275288\n6 Tsai LK Hsieh ST Chao CC Neuromuscular disorders in severe acute respiratory syndrome Arch Neurol 2004 61 1669 73 15534177\n7 Kim JE Heo JH Kim HO Neurological complications during treatment of middle east respiratory syndrome J Clin Neurol 2017 13 227 33 28748673\n8 Baig AM Neurological manifestations in COVID‐19 caused by SARS‐CoV‐2 CNS Neurosci Ther 2020 26 499 501 32266761\n9 Liu B Li M Zhou Z Guan X Xiang Y Can we use interleukin-6 (IL-6) blockade for coronavirus disease 2019 (COVID-19)-induced cytokine release syndrome (CRS)? J Autoimm 2020 111 102452\n10 Ellul MA Benjamin L Singh B Neurological associations of COVID-19 Lancet Neurol 2020 19 767 83 32622375\n11 Zhou C Wu L Ni F Critical illness polyneuropathy and myopathy: a systematic review Neural Regen Res 2014 9 101 10 25206749\n12 Amato AA Dumitru D Dumitru D Amato AA Zwarts MJ Acquired neuropathies Electrodiagnostic medicine 2002 2nd ed. Philadelphia PA: Hanley & Belfus Inc 1041\n13 Dimachkie MM Barohn RJ Guillain-Barré syndrome and variants Neurol Clin 2013 31 491 510 23642721\n14 Prakash A Singh H Sarma P nCoV-2019 infection induces neurological outcome and manifestation, linking its historical ancestor SARS-CoV & MERS-CoV: A systematic review and meta-analysis Preprint 2020\n15 Barbi L Coelho AVC Alencar LCAD Crovella S Prevalence of Guillain-Barré syndrome among Zika virus infected cases: a systematic review and meta-analysis Braz J Infect Dis 2018 22 137 41 29545017\n16 Sedaghat Z Karimi N Guillain Barre syndrome associated with COVID-19 infection: a case report J Clin Neurosci 2020 76 233 5 32312628\n17 Ebrahimzadeh SA Ghoreishi A Rahimian N Guillain-Barré Syndrome associated with the coronavirus disease 2019 (COVID-19) Neurol Clin Pract 2020 10\n18 Farzi MA Ayromlou H Jahanbakhsh N Guillain-Barré syndrome in a patient infected with SARS-CoV-2, a case report J Neuroimmunol 2020 346 577294 32590125\n19 Gupta A Paliwal VK Garg RK Is COVID-19-related Guillain-Barré syndrome different? Brain Behav Immun 2020 87 177 8 32445789\n20 Abu-Rumeileh S Abdelhak A Foschi M Tumani H Otto M Guillain–Barré syndrome spectrum associated with COVID-19: an up-to-date systematic review of 73 cases J Neurol  2021 268 1133 70 32840686\n21 Dalakas MC Guillain-Barré syndrome: The first documented COVID-19–triggered autoimmune neurologic disease: More to come with myositis in the offing Neurol Neuroimmunol Neuroinflamm 2020 7 e781 32518172\n22 Zhang Q Shan KS Minalyan A O'Sullivan C Nace T a rare presentation of coronavirus disease 2019 (COVID-19) induced viral myositis with subsequent rhabdomyolysis Cureus 2020 12 e8074 32542129\n23 Crum-Cianflone NF Bacterial, fungal, parasitic, and viral myositis Clin Microbiol Rev 2008 21 473 94 18625683\n24 Beydon M Chevalier K Al Tabaa O Myositis as a manifestation of SARS-CoV-2 Ann Rheum Dis 2020 217573\n25 Eslamian F Rahbar M Neuromuscular disorders in critically-ill patients–approaches to electrophysiologic changes in critical illness neuropathy and myopathy Adv Clin Neurophysiol 2012\n26 Bercker S Weber-Carstens S Deja M Critical illness polyneuropathy and myopathy in patients with acute respiratory distress syndrome Crit Care Med 2005 33 711 5 15818093\n27 Wang D Hu B Hu C Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China JAMA 2020 323 1061 9 32031570\n28 Richardson S Hirsch JS Narasimhan M Presenting characteristics, comorbidities, and outcomes among 5700 patients hospitalized with COVID-19 in the New York City area JAMA 2020 323 2052 9 32320003\n29 Toscano G Palmerini F Ravaglia S Guillain-Barré syndrome associated with SARS-CoV-2 N Engl J Med 2020 382 2574 6 32302082\n30 Preston DC Shapiro BE Approach to electrodiagnostic studies in the intensive care unit Electromyography and neuromuscular disorders. 4th ed. Philadelphia, USA: Elsevier Inc 2021 718\n31 Amato AA Dumitru D Dumitru D Amato AA Zwarts MJ Acquired myopathies Electrodiagnostic medicine 2002 2nd ed Philadelphia PA: Hanley & Belfus Inc 1371 404\n32 Mohtadi N Ghaysouri A Shirazi S Recovery of severely ill COVID-19 patients by intravenous immunoglobulin (IVIG) treatment: A case series Virology 2020 548 1 5 32530808\n33 Xie Y Cao S Dong H Effect of regular intravenous immunoglobulin therapy on prognosis of severe pneumonia in patients with COVID-19 J Infect 2020 81 318 56\n34 Nguyen AA Habiballah SB Platt CD Immunoglobulins in the treatment of COVID-19 infection: Proceed with caution Clin Immunol 2020 216 108459 32418917\n35 Saghazadeh A Rezaei N Towards treatment planning of COVID-19: Rationale and hypothesis for the use of multiple immunosuppressive agents: Anti-antibodies, immunoglobulins, and corticosteroids Int Immunopharmacol 2020 84 106560 32413736\n36 Safari S Salimi A Zali A Extracorporeal hemoperfusion as a potential therapeutic option for severe COVID-19 patients; a Narrative Review Arch Acad Emerg Med 2020 8 e67 33134963\n37 Keith P Day M Perkins L A novel treatment approach to the novel coronavirus: an argument for the use of therapeutic plasma exchange for fulminant COVID-19 Crit Care 2020 24 128 32241301\n38 Piechotta V Chai KL Valk SJ Convalescent plasma or hyperimmune immunoglobulin for people with COVID‐19: a living systematic review Cochrane Database Syst Rev 2020 7 CD013600 32648959\n\n", "fulltext_license": "CC BY", "issn_linking": "2008-6164", "issue": "12(Suppl 2)", "journal": "Caspian journal of internal medicine", "keywords": "Acute motor axonal neuropathy; COVID-19; Corona virus; Critical illness myopathy; Critical illness neuropathy; GBS; Quadriparesis", "medline_ta": "Caspian J Intern Med", "mesh_terms": null, "nlm_unique_id": "101523876", "other_id": null, "pages": "S451-S459", "pmc": null, "pmid": "34760104", "pubdate": "2021", "publication_types": "D002363:Case Reports", "references": "32327427;32031570;18625683;32445789;34145351;32590125;32518172;28748673;32418917;32320003;25206749;32241301;32283154;15534177;32648959;33134963;15818093;29545017;32840686;34676127;32561990;32530808;32302082;32413736;32266761;32291137;32622375;32312628;32275288;23642721;32542129", "title": "Electrophysiologic findings in patients with COVID-19 and quadriparesia in the northwest of Iran, A case series study and literature review.", "title_normalized": "electrophysiologic findings in patients with covid 19 and quadriparesia in the northwest of iran a case series study and literature review" }
[ { "companynumb": "IR-LUPIN PHARMACEUTICALS INC.-2022-01769", "fulfillexpeditecriteria": "2", "occurcountry": "IR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "AZITHROMYCIN" }, "drugaddition...
{ "abstract": "The association between microscopic colitis (MC) and inflammatory bowel disease (IBD) is uncertain and infrequently reported. Rare cases in the literature consist of simultaneous MC and IBD, or progression of one condition to the other. We present a unique case of clinically and endoscopically diagnosed and successfully treated IBD that revealed MC on histology months later due to reappearance of diarrhea. Common pathophysiologic mechanisms, such as tumor necrosis factor α and T helper type 1 cells, may explain the MC and IBD relationship. During endoscopy, a prompt biopsy should be taken if suspicious for MC, thus decreasing the duration of patient's symptoms and saving healthcare costs.", "affiliations": "Internal Medicine, Hurley Medical Center, Flint, USA.;Gastroenterology, Ascension Providence Hospital, Southfield, USA.;Gastroenterology, Ascension Providence Hospital, Southfield, USA.;Gastroenterology, Ascension Providence Hospital, Southfield, USA.", "authors": "Hussain|Murtaza Shabbir|MS|;Balagoni|Harika|H|;Dwivedi|Sankalp|S|;Piper|Marc|M|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.7759/cureus.18299", "fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184\nCureus Palo Alto (CA)\n\n10.7759/cureus.18299\nGastroenterology\nMacroscopic to Microscopic – A Case of Crohn’s Disease Progressing to Collagenous Colitis\nMuacevic Alexander\nAdler John R\nHussain Murtaza Shabbir 1\nBalagoni Harika 2\nDwivedi Sankalp 2\nPiper Marc 2\n1 Internal Medicine, Hurley Medical Center, Flint, USA\n2 Gastroenterology, Ascension Providence Hospital, Southfield, USA\nMurtaza Shabbir Hussain mhussai2@hurleymc.com\n26 9 2021\n9 2021\n13 9 e1829926 9 2021\nCopyright © 2021, Hussain et al.\n2021\nHussain et al.\nhttps://creativecommons.org/licenses/by/3.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nThis article is available from https://www.cureus.com/articles/67150-macroscopic-to-microscopic---a-case-of-crohns-disease-progressing-to-collagenous-colitis\nThe association between microscopic colitis (MC) and inflammatory bowel disease (IBD) is uncertain and infrequently reported. Rare cases in the literature consist of simultaneous MC and IBD, or progression of one condition to the other. We present a unique case of clinically and endoscopically diagnosed and successfully treated IBD that revealed MC on histology months later due to reappearance of diarrhea. Common pathophysiologic mechanisms, such as tumor necrosis factor α and T helper type 1 cells, may explain the MC and IBD relationship. During endoscopy, a prompt biopsy should be taken if suspicious for MC, thus decreasing the duration of patient's symptoms and saving healthcare costs.\n\nmicroscopic colitis\ninflammatory bowel disease\ncollagenous colitis\nlymphocytic colitis\ngi endoscopy\nThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\npmcIntroduction\n\nIn resource-poor countries, symptoms of diarrhea are one of the top leading causes of death due to severe dehydration, regardless of the cause. On the other hand, in resource-rich countries, diarrhea is more of an ‘inconvenience’ presenting as a common concern in ambulatory care. Majority of cases are infectious and of viral etiology. Noninfectious causes include malabsorption disorders, functional disorders, and organic disorders such as inflammatory bowel disease (IBD) and microscopic colitis (MC). MC is divided into collagenous colitis (CC) and lymphocytic colitis (LC) and presents as chronic, watery diarrhea but normal-appearing mucosa on colonoscopy [1,2]. IBD, classified into ulcerative colitis (UC) and Crohn’s disease (CD), is an autoimmune condition that clinically presents with abdominal pain, bloody or non-bloody diarrhea, weight loss, and evidence of inflammation on endoscopy. IBD and MC are distinct regarding their epidemiology, clinical manifestations, management, and pathology. There is a rare incidence of MC in known IBD patients and vice versa [3]. Equally as rare is the concurrent manifestation of IBD and MC.\n\nWe report a patient who was treated for clinically diagnosed CD. The recurrence of diarrheal symptoms resulted in further testing, which led to the diagnosis of CC.\n\nCase presentation\n\nA 56-year-old-female with a history of anxiety and chronic smoking presented to our hospital with 12-day progressive, non-bloody diarrhea, 20-30 episodes/day including nocturnal episodes, associated with diffuse, cramping, lower abdominal pain. She denied fever, chills, sick contacts, travel, food contamination, medication changes, or recent antibiotics. She tried Imodium at home with no improvement. On presentation, she had mild leukocytosis, mild transaminitis, elevated C-reactive protein of 102 mg/L and fecal calprotectin 484 mcg/g. Computed tomography (CT) abdomen/pelvis did not show any acute abnormalities. Stool studies were negative for infection. She underwent esophagogastroduodenoscopy, which showed mild gastritis and duodenitis, biopsies negative for Helicobacter pylori and celiac disease. Colonoscopy showed mild to moderate colitis with mucosal congestion, granularity, and cobble-stoning in a continuous and circumferential pattern from the rectum to the descending colon. Mild altered vascularity, congestion (edema), and friability were found as patches surrounded by normal mucosa in the transverse colon, ascending colon, and cecum with associated terminal ileitis (Figure 1). The ileocecal valve was stenotic and difficult to intubate. The limited visualized portion appeared normal. Biopsy revealed mild chronic active colitis negative for granulomas and dysplasia (Figure 2).\n\nFigure 1 Initial colonoscopy demonstrating terminal ileitis\n\n \n\nFigure 2 Hematoxylin and eosin stain biopsy reveals mild-chronic active colitis without granulomas or dysplasia\n\nCT enterography showed narrowing of the terminal ileum with focal wall thickening and two more strictures in the small bowel. The patient was diagnosed with CD, started on IV steroids, and improved significantly. She was eventually transitioned to adalimumab outpatient. Three months later, she was readmitted with 10-day non-bloody diarrhea despite being compliant with adalimumab. After ruling out infections, including Clostridium difficile, she was started on oral steroids. Colonoscopy showed improved colitis from previous examination (Figure 3) but biopsy revealed increased subepithelial collagen plate with minimal mucosal distortion suggestive of CC (Figure 4).\n\nFigure 3 Endoscopic findings after treatment with steroids and IV adalimumab show benign mucosa\n\nFigure 4 Hematoxylin and eosin stain biopsy exhibits findings of increased subepithelial collagen, consistent with collagenous colitis\n\nShe was started on budesonide in addition to adalimumab with no improvement. Review of medications showed selective serotonin reuptake inhibitor usage, which was discontinued. She was counseled to quit smoking but unsuccessful. Off the oral steroids, she continued to have 10-15 bowel movements. Trials of cholestyramine, bismuth, and loperamide were unsuccessful. Repeat colonoscopy showed endoscopically benign mucosa but continued presence of CC on biopsy. Given the refractoriness of symptoms, the patient was referred to a tertiary IBD center.\n\nDiscussion\n\nMC is a clinicopathologic disorder, histologically subdivided into LC with increased intraepithelial lymphocytes (>20/100 colonic surface epithelial cells) and CC with atypically thickened subepithelial collagen band >10 μm [4]. MC is postulated to develop via an immunological response to various mucosal insults in predisposed patients [3]. LC, in particular, is associated with other autoimmune conditions such as celiac disease, psoriasis, and rheumatoid arthritis [5]. \n\nIBD manifests as endoscopically visible ulcerated mucosa, loss of vascularity, edema, friability, strictures, and so on. UC usually presents as bloody diarrhea while CD presents as fistulas, obstruction, and abdominal masses. Our patient initially presented with diarrhea, elevated inflammatory markers, and endoscopic and imaging findings consistent with CD. She was appropriately treated with IV steroids and adalimumab. Recurrence of her diarrhea prompted repeat colonoscopy, which revealed features of CC.\n\nThe relationship between IBD and MC is uncertain. MC could be a continuum of IBD; new-onset MC diagnosis was found after a median (range) of 20 (2-52) years in established IBD patients [1,5]. Conversely, established MC patients may also develop IBD, at a 17-fold increase in relative risk [6]. Additionally, cases of IBD patients in remission showed CC on biopsies [7]. Some MC patients reported a family history of UC [8], alluding to the role of genetic factors between the two.\n\nPathophysiologically, in MC, it is theorized that tumor necrosis factor-α (TNF-α) triggers the downregulation of tight junction proteins, claudin-4, -5, -8, increasing permeability, thus leading to diarrhea [9]. Permeability is also increased by non-steroidal anti-inflammatory drugs and proton-pump inhibitors, common MC triggers, that allow antigens to pass into the lamina propria provoking lymphocytosis [2]. Increased expression of TNF-α, interferon-γ, and the Th1-specific transcription factor T-BET in patients with MC who eventually developed IBD suggests a common immunological pathophysiological pathway in the MC-to-IBD transformation [3,10]. Few studies found associations between human leukocyte antigen haplotypes, DQ2 and DQ8, and risk of CC, LC, and IBD development [11-15]. Gut dysbiosis has been noted in both IBD and MC, again suggesting a common pathophysiological pathway [16-18]. The association between smoking and IBD is well established. Recent meta-analysis demonstrates that active smoking significantly increased incidence of MC with OR 3.58 [19].\n\nEarly consideration and diagnosis of MC in patients with IBD is important in tailoring the treatment regimen. Primary recommendation is cessation of potential triggers. For milder disease, cholestyramine, atropine/diphenoxylate, bismuth subsalicylate, and loperamide may be utilized. For moderate-to-severe disease, budesonide is recommended. Refractory patients require additional medications, such as infliximab, azathioprine, and methotrexate. Likewise, anti-TNF-α agents have demonstrated a good response rate [20]. The most severe cases, like poorly controlled IBD cases, require surgical diversion, colectomy, and diverting ostomy.\n\nIBD has known complications such as malignancy and immune-mediated diseases such as ankylosing spondylitis and autoimmune thyroid disease. A systematic review showed an association between rheumatic diseases and MC [4,5], but no real conclusions can be made regarding MC and its association with classic IBD complications [4]. The complication rates and prognosis with MC-IBD overlap are unknown.\n\nConclusions\n\nOur case highlights the possibility of development or co-existence of CC in a patient with CD. Whether MC is a spectrum of IBD or it is exacerbated by trigger factors is unclear. MC should be considered as a differential in IBD patients who were previously controlled or not responding to appropriate therapy presenting with chronic watery diarrhea. Prompt diagnosis can help early management of the disease and thereby improve quality of life for the patients and reduce healthcare costs.\n\nHuman Ethics\n\nThe authors have declared that no competing interests exist.\n\nConsent was obtained or waived by all participants in this study\n==== Refs\nReferences\n\n1 Microscopic colitis in patients with ulcerative colitis or Crohn's disease: a retrospective observational study and review of the literature Scand J Gastroenterol Wickbom A Bohr J Nyhlin N 410 416 53 2018 29546806\n2 Symptomatic microscopic colitis atop quiescent inflammatory bowel disease: a case series ACG Case Rep J Megna B Saha S Wald A Agni R Matkowskyj KA Caldera F 0 4 2017\n3 Microscopic colitis evolved into inflammatory bowel diseases is characterized by increased Th1/Tc1 cells in colonic mucosal lamina propria Dig Dis Sci Li J Yan Y Meng Z 2755 2767 62 2017 28597107\n4 Microscopic colitis and its associations with complications observed in classic inflammatory bowel disease: a systematic review Scand J Gastroenterol Solberg F Ohlsson B 312 320 55 2020 32182146\n5 Microscopic colitis: is it a spectrum of inflammatory bowel disease? World J Gastroenterol Jegadeesan R Liu X Pagadala MR Gutierrez N Butt M Navaneethan U 4252 4256 19 2013 23864791\n6 Microscopic colitis and risk of inflammatory bowel disease in a nationwide cohort study Gastroenterology Khalili H Burke KE Roelstraete B Sachs MC Olén O Ludvigsson JF 1574 1583 158 2020 31926169\n7 Development of collagenous colitis in inflammatory bowel disease: two case reports and a review of the literature Gastroenterol Rep (Oxf) Saad RE Shobar RM Jakate S Mutlu EA 218 222 7 2019 31217987\n8 Lymphocytic colitis: a retrospective clinical study of 199 Swedish patients Gut Olesen M Eriksson S Bohr J Järnerot G Tysk C 536 541 53 2004 15016748\n9 Microscopic colitis: a review of collagenous and lymphocytic colitis Gastroenterol Hepatol (N Y) Boland K Nguyen GC 671 677 13 2017 https://pubmed.ncbi.nlm.nih.gov/29230146/ 29230146\n10 Th1 pathway: the missing link between inflammatory bowel disease and microscopic colitis? Dig Dis Sci Carrasco A Fernández-Bañares F 2609 2611 62 2017 28776143\n11 Predisposing HLA-DQ2 and HLA-DQ8 haplotypes of coeliac disease and associated enteropathy in microscopic colitis Eur J Gastroenterol Hepatol Fernández-Bañares F Esteve M Farré C 1333 1338 17 2005 16292086\n12 Human leucocyte antigen and TNFalpha polymorphism association in microscopic colitis Eur J Gastroenterol Hepatol Koskela RM Karttunen TJ Niemelä SE Lehtola JK Ilonen J Karttunen RA 276 282 20 2008 18334870\n13 Amino acid position 11 of HLA-DRβ1 is a major determinant of chromosome 6p association with ulcerative colitis Genes Immun Achkar JP Klei L de Bakker PI 245 252 13 2012 22170232\n14 High-density mapping of the MHC identifies a shared role for HLA-DRB1*01:03 in inflammatory bowel diseases and heterozygous advantage in ulcerative colitis Nat Genet Goyette P Boucher G Mallon D 172 179 47 2015 25559196\n15 Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease Nature Jostins L Ripke S Weersma RK 119 124 491 2012 23128233\n16 Microscopic colitis is characterized by intestinal dysbiosis Clin Gastroenterol Hepatol Morgan DM Cao Y Miller K 984 986 18 2020 31254673\n17 Proinflammatory sulfur-reducing bacteria are more abundant in colonic biopsies of patients with microscopic colitis compared to healthy controls Dig Dis Sci Millien V Rosen D Hou J Shah R 432 438 64 2019 30324555\n18 An altered composition of the microbiome in microscopic colitis is driven towards the composition in healthy controls by treatment with budesonide Scand J Gastroenterol Rindom Krogsgaard L Kristian Munck L Bytzer P Wildt S 446 452 54 2019 31009268\n19 The association between smoking and both types of microscopic colitis: a systematic review and meta-analysis Arab J Gastroenterol Al Momani L Balagoni H Alomari M 9 18 21 2020 32241698\n20 Efficacy of anti-TNF therapies in refractory severe microscopic colitis J Crohns Colitis Esteve M Mahadevan U Sainz E Rodriguez E Salas A Fernández-Bañares F 612 618 5 2011 22115383\n\n", "fulltext_license": "CC BY", "issn_linking": "2168-8184", "issue": "13(9)", "journal": "Cureus", "keywords": "collagenous colitis; gi endoscopy; inflammatory bowel disease; lymphocytic colitis; microscopic colitis", "medline_ta": "Cureus", "mesh_terms": null, "nlm_unique_id": "101596737", "other_id": null, "pages": "e18299", "pmc": null, "pmid": "34722074", "pubdate": "2021-09", "publication_types": "D002363:Case Reports", "references": "29546806;23128233;28597107;15016748;31217987;30324555;31009268;29230146;28776143;29299484;18334870;31926169;23864791;32182146;31254673;22170232;16292086;32241698;25559196;22115383", "title": "Macroscopic to Microscopic - A Case of Crohn's Disease Progressing to Collagenous Colitis.", "title_normalized": "macroscopic to microscopic a case of crohn s disease progressing to collagenous colitis" }
[ { "companynumb": "NVSC2020US041835", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ADALIMUMAB" }, "drugadditional": "3", "druga...
{ "abstract": "OBJECTIVE\nDesensitization regimens including use of intravenous immune globulin and rituximab have been reported to overcome renal transplant hyperacute rejection. A retrospective case-control study was performed to assess the results and complications of renal transplantation with desensitization therapy for donor-specific antibody (DSA) in a transplant center in Asia, where donor exchange was usually not allowed.\n\n\nMETHODS\nBetween January 2007 and December 2013, 22 patients with DSA received live-donor renal transplantation after desensitization (DSA group). During the same period, the DSA group was compared to the NSA group (152 renal transplants) who had no specific antibody to the donors (66 from deceased donors and 86 from living relatives). Rejection, renal function, graft and patient survival rates, infection, and cancer incidence were reviewed and analyzed from medical records.\n\n\nRESULTS\nThe DSA group (46.8%) had significantly higher acute rejection rates than the NSA group (13.7%) at the 1-year follow-up. The estimated renal function, 5-year graft, and patient survival rates were comparable between the groups. The DSA group (19.6%) had significantly higher 5-year de novo cancer incidence than the NSA group (8.5%; p = 0.028); three patients of the DSA group developed urothelial carcinoma 17.0 ± 3.0 months after transplantation. By using stepwise Cox regression analysis, desensitization therapy was identified as the sole independent risk factor for post-transplant urothelial carcinoma.\n\n\nCONCLUSIONS\nWhen compared to renal transplantation without DSA, desensitization therapy for DSA resulted in equivalent renal transplant outcome but potentially increased risk of urothelial carcinoma after transplantation.", "affiliations": "Department of Surgery, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan.;Department of Surgery, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan.;Department of Surgery, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan; Department of Medical Education, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan.;Department of Surgery, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan. Electronic address: mengkuntsai@ntu.edu.tw.", "authors": "Yang|Ching-Yao|CY|;Lee|Chih-Yuan|CY|;Yeh|Chi-Chuan|CC|;Tsai|Meng-Kun|MK|", "chemical_list": "D006680:HLA Antigens; D007518:Isoantibodies", "country": "Singapore", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0929-6646", "issue": "115(6)", "journal": "Journal of the Formosan Medical Association = Taiwan yi zhi", "keywords": "desensitization; kidney transplantation; urothelial carcinoma", "medline_ta": "J Formos Med Assoc", "mesh_terms": "D000328:Adult; D002277:Carcinoma; D016022:Case-Control Studies; D003888:Desensitization, Immunologic; D005260:Female; D006084:Graft Rejection; D006680:HLA Antigens; D006801:Humans; D007518:Isoantibodies; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D012307:Risk Factors; D016019:Survival Analysis; D013624:Taiwan; D014019:Tissue Donors; D014571:Urologic Neoplasms; D019459:Urothelium", "nlm_unique_id": "9214933", "other_id": null, "pages": "426-33", "pmc": null, "pmid": "26725772", "pubdate": "2016-06", "publication_types": "D016428:Journal Article", "references": null, "title": "Renal transplantation across the donor-specific antibody barrier: Graft outcome and cancer risk after desensitization therapy.", "title_normalized": "renal transplantation across the donor specific antibody barrier graft outcome and cancer risk after desensitization therapy" }
[ { "companynumb": "TW-ROCHE-1790461", "fulfillexpeditecriteria": "1", "occurcountry": "TW", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PREDNISOLONE" }, "drugadditional": "3", "dru...
{ "abstract": "We present a 23-year-old woman on immunosuppressive therapy with polyarticular, culture-negative septic arthritis. She underwent irrigation and debridement with empiric antibiotic therapy but had recurrence of septic arthritis despite treatment. Polymerase chain reaction testing eventually identified Ureaplasma as the causative organism. She was successfully treated with an extended course of organism-specific antibiotics.\n\n\n\nMore patients are being treated with immune modulating therapies. Immunosuppressed patients are at risk for atypical infections and may have different presentations than immunocompetent patients. Newer diagnostic modalities can help identify causative organisms and direct treatment in the case of negative cultures.", "affiliations": "1The George Washington University School of Medicine and Health Sciences, Washington, District of Columbia 2Department of Orthopedic Surgery, The George Washington University School of Medicine and Health Sciences, Washington, District of Columbia.", "authors": "Whiting|Zachariah G|ZG|;Doerre|Teresa|T|", "chemical_list": "D000900:Anti-Bacterial Agents; D004318:Doxycycline", "country": "United States", "delete": false, "doi": "10.2106/JBJS.CC.20.00057", "fulltext": null, "fulltext_license": null, "issn_linking": "2160-3251", "issue": "10(3)", "journal": "JBJS case connector", "keywords": null, "medline_ta": "JBJS Case Connect", "mesh_terms": "D000900:Anti-Bacterial Agents; D001170:Arthritis, Infectious; D004318:Doxycycline; D005260:Female; D006801:Humans; D007165:Immunosuppression Therapy; D016133:Polymerase Chain Reaction; D014509:Ureaplasma; D055815:Young Adult", "nlm_unique_id": "101596828", "other_id": null, "pages": "e2000057", "pmc": null, "pmid": "32910594", "pubdate": "2020", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Diagnosis of Culture-Negative Septic Arthritis with Polymerase Chain Reaction in an Immunosuppressed Patient: A Case Report.", "title_normalized": "diagnosis of culture negative septic arthritis with polymerase chain reaction in an immunosuppressed patient a case report" }
[ { "companynumb": "US-009507513-2103USA006991", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "ERTAPENEM SODIUM" }, "drugadditional": null,...
{ "abstract": "Melioidosis is caused by Burkholderia pseudomallei, water-and-soil gram-negative bacteria predominantly found in Southeast Asia and Australia. Herein, we reported a 63-year-old Thai man presenting with prolonged fever, non-productive cough, and weight loss for 3 months. He underwent deceased donor kidney transplantation 4 years ago and was on many immunosuppressive agents after transplantation. At presentation, his chest radiograph showed a mass-like lesion in the left upper lobe. Histopathological examination of a transthoracic needle lung biopsy yielded adenocarcinoma, while tissue culture grew for B. pseudomallei. He was diagnosed with stage IIIA non-small cell lung cancer (T4N0M0) co-existing with localized pulmonary melioidosis. After intensive and eradication therapy for melioidosis, his well-being improved with the resolution of fever. He sequentially underwent left upper lobectomy, but the procedure was not accomplished due to severe adhesions surrounding the left lung and great vessels. After surgery, he received concurrent chemoradiation therapy for his lung cancer. Nevertheless, the disease progressed, and he finally passed away. Since fever is not a common manifestation of lung cancer, co-existing infection, such as tuberculosis, fungal infection, and melioidosis, should always be excluded in patients suspected of having lung cancer presenting with unexplained fever.", "affiliations": "Division of Pulmonary and Pulmonary Critical Care Medicine, Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Division of Pulmonary and Pulmonary Critical Care Medicine, Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Division of Diagnostic Radiology, Department of Diagnostic and Therapeutic Radiology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Division of Pulmonary and Pulmonary Critical Care Medicine, Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.", "authors": "Laplertsakul|Gunthiga|G|;Sutherasan|Yuda|Y|0000-0003-1754-0962;Suwatanapongched|Thitiporn|T|;Incharoen|Pimpin|P|;Petnak|Tananchai|T|0000-0002-7633-4029", "chemical_list": null, "country": "New Zealand", "delete": false, "doi": "10.2147/IDR.S262410", "fulltext": "\n==== Front\nInfect Drug Resist\nInfect Drug Resist\nidr\nidr\nInfection and Drug Resistance\n1178-6973 Dove \n\n262410\n10.2147/IDR.S262410\nCase Report\nNon-Small Cell Lung Carcinoma with Concomitant Localized Pulmonary Melioidosis: A Rare Co-Existing Disease\nLaplertsakul et alLaplertsakul et alLaplertsakul Gunthiga 1 http://orcid.org/0000-0003-1754-0962Sutherasan Yuda 1 Suwatanapongched Thitiporn 2 Incharoen Pimpin 3 http://orcid.org/0000-0002-7633-4029Petnak Tananchai 1 1 Division of Pulmonary and Pulmonary Critical Care Medicine, Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand\n2 Division of Diagnostic Radiology, Department of Diagnostic and Therapeutic Radiology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand\n3 Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand\nCorrespondence: Tananchai PetnakDivision of Pulmonary and Pulmonary Critical Care Medicine, Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, 270 Ramathibodi Hospital, Rama VI Road, Ratchathewi, Bangkok10400, Thailand Tel/Fax +66 2 201 1619 Email tananchai.pet@mahidol.edu\n24 8 2020 \n2020 \n13 2957 2961\n14 5 2020 27 7 2020 © 2020 Laplertsakul et al.2020Laplertsakul et al.This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).Abstract\nMelioidosis is caused by Burkholderia pseudomallei, water-and-soil gram-negative bacteria predominantly found in Southeast Asia and Australia. Herein, we reported a 63-year-old Thai man presenting with prolonged fever, non-productive cough, and weight loss for 3 months. He underwent deceased donor kidney transplantation 4 years ago and was on many immunosuppressive agents after transplantation. At presentation, his chest radiograph showed a mass-like lesion in the left upper lobe. Histopathological examination of a transthoracic needle lung biopsy yielded adenocarcinoma, while tissue culture grew for B. pseudomallei. He was diagnosed with stage IIIA non-small cell lung cancer (T4N0M0) co-existing with localized pulmonary melioidosis. After intensive and eradication therapy for melioidosis, his well-being improved with the resolution of fever. He sequentially underwent left upper lobectomy, but the procedure was not accomplished due to severe adhesions surrounding the left lung and great vessels. After surgery, he received concurrent chemoradiation therapy for his lung cancer. Nevertheless, the disease progressed, and he finally passed away. Since fever is not a common manifestation of lung cancer, co-existing infection, such as tuberculosis, fungal infection, and melioidosis, should always be excluded in patients suspected of having lung cancer presenting with unexplained fever.\n\nKeywords\nnon-small cell lung cancermelioidosisco-existing infectionkidney transplantation\n==== Body\nIntroduction\nCo-existing infection simultaneously diagnosed with lung cancer is not a common manifestation. Therefore, the presence of a mass-like lesion and fever of unknown origin warrant further investigations to exclude primary infection mimicking malignancy or coinciding infection with lung cancer. Although concomitant infections secondary to post-obstructive pneumonia, the most common coinciding infection, occur approximately 20% of patients with lung cancer,1 a simultaneous presentation of lung cancer and melioidosis is rarely encountered in routine clinical practice. Herein, we reported a patient with an unusual simultaneous presentation of localized pulmonary Burkholderia pseudomallei infection and primary pulmonary adenocarcinoma in an old non-diabetic kidney transplant recipient who was a former smoker living in central Thailand, an endemic area of melioidosis.2\n\nCase Report\nA 63-year-old Thai male farmer residing in central Thailand presented with prolonged fever and non-productive cough for 3 months. He also complained of intermittent chest tightness at the left hemithorax and losing 4 kg of his weight. He was admitted to the local hospital and diagnosed with bacterial pneumonia at that time. However, his fever did not subside following 14 days of intravenous meropenem. He was, therefore, transferred to our hospital for further investigations. He was a former smoker of 25 pack-years quitted 2 years ago before the presentation. He had end-stage renal disease requiring deceased donor kidney transplantation 4 years ago. After transplantation, he was on immunosuppressive agents, including mycophenolate mofetil and cyclosporine. Acyclovir was also prescribed for herpes infection prophylaxis.\n\nHe was referred to our hospital. Physical examination showed an asthenic patient with anicteric sclera. His vital signs revealed a body temperature of 38°c, blood pressure of 100/60 mm Hg, a pulse rate of 90/minute, and a respiratory rate of 17/minute. His oxygen saturation was 95% at ambient air. Respiratory examination revealed decreased breath sound at the left upper lung zone without crackles or egophony. Other physical examinations were unremarkable.\n\nComplete blood count showed mild anemia with a hemoglobin level of 10.1 g/dL and leukocytosis with white blood cells count of 22 x 103/µL, 91% neutrophils. Blood chemistry tests remained within normal ranges. The chest radiograph (Figure 1A) and contrast-enhanced chest CT (Figure 1B) showed a large mass in the left upper lobe. A transthoracic core-needle biopsy of the left upper lobe mass was performed. The biopsy specimens were sent for pathological and microbiological studies. The histopathology revealed non-small cell carcinoma admixed with necrotic tissues. The immunohistochemical studies for cytokeratin (CK) AE1/AE3, CK7, and thyroid transcription factor-1 (TTF-1) were positive, compatible with primary lung adenocarcinoma. The Brown-Hopp stain revealed a single cluster of gram-negative bipolar rods with safety pin appearance characteristics of B. pseudomallei. (Figure 2A–D). B. pseudomallei subsequently grew on tissue culture. His serum antibody titer against B. pseudomallei was positive with a titer of 1:1280. His blood culture for aerobes and serum cryptococcal antigen were negative. The patient was finally diagnosed with stage IIIA non-small cell lung cancer (T4N0M0) co-existing with localized pulmonary melioidosis. The molecular analysis did not detect mutations of epidermal growth factor receptor (EGFR) genes and the rearrangement of anaplastic lymphoma kinase (ALK) gene.Figure 1 (A, B) The chest radiograph (A) and contrast-enhanced axial chest CT image with a mediastinal-window setting (B) obtained at our hospital showing a large mass (arrows in A and B) in the left upper lobe. The mass exhibits heterogeneous contrast enhancement with a central low-attenuation area. Note blunting of the left costophrenic angle secondary to left pleural thickening. There is no enlarged mediastinal or hilar lymph node.\n\nFigure 2 (A–D) Histopathology revealed (A) Tumor admixed with necrotic tissue (HE stain, 100x), (B) Gram-negative bipolar rods resembling safety pins (Brown-Hopp stain, 1000x), (C) Non-small cell carcinoma favor adenocarcinoma (HE stain, 200x), (D) TTF-1 immunohistochemistry positive nuclear staining (200x).\n\n\n\nAfter 3 weeks of intravenous ceftazidime, his fever subsided, and his well-being improved. He gradually gained his weight. Oral co-trimoxazole was sequentially prescribed for 20 weeks after the completion of intravenous ceftazidime treatment. He underwent surgery for left thoracotomy and left upper lobectomy. However, the procedure was not accomplished due to severe adhesion surrounding the entire left lung and great vessels. After surgery, he received concurrent chemoradiation therapy with a paclitaxel-based regimen for adenocarcinoma. Nevertheless, he developed progression of disease soon after. Three cycles of palliative chemotherapy using pemetrexed were delivered. Unfortunately, he finally passed away after 2 years after the initial presentation.\n\nDiscussion\nClinical presentations of lung cancer might be various. While common clinical symptoms include cough, chest tightness, and hemoptysis, patients with lung cancer incidentally discovered on radiological studies might be asymptomatic.3 Fever is considered as an atypical presentation of lung cancer and could be due to non-infectious causes related to cancer itself or related to psychogenic conditions, such as anxiety.4–6 However, infectious causes should always be excluded, particularly bacterial infection secondary to post-obstructive pneumonia, one of the most common causes of fever in patients with lung cancer. The differentiation between chronic infection, lung cancer, and a co-existing condition (akin to our case) is also challenging.\n\nThe diagnosis of melioidosis is usually difficult due to various and nonspecific clinical presentation. Generally, melioidosis is considered a great mimicker because it can cause chronic cavitary lesions mimicking reactivation of tuberculosis, a mass-like lesion leading to superior vena cava obstruction mimicking lung cancer,7 and acute fatal pneumonia similar to other infections.8 According to the previous study in northeastern Thailand, melioidosis accounted for 20% of community-acquired sepsis, with mortality rate of 35–40%.8 The most common radiographic finding of pulmonary melioidosis is lobar or segmental consolidation, followed by pulmonary nodules, cavity, and pleural effusion.9,10 Occasionally, melioidosis manifests as a mass-like lesion indistinguishable from lung cancer.11 A simultaneous presentation of lung cancer and chronic infection, especially melioidosis, is rare. Mays et al previously described lung cancer developed after a long latency of chronic cavitary form of pulmonary melioidosis.12 Their observation was different from our case. In the present case, the diagnosis of lung cancer was simultaneously established with the initial presentation of pulmonary melioidosis. At present, there is no clear mechanism explaining why malignancy can be infected, or such finding is just a coincidence. Although our patient did not have common risk factors of melioidosis, such as diabetes mellitus and thalassemia diseases, we speculated that worsening of immune status from immunosuppressive therapy accompanied by living in the endemic area might be responsible for developing melioidosis.13\n\nAntibiotics therapy for melioidosis is generally divided into 2 phases, the initial intensive phase and the eradication phase. The antibiotic of choice for the intensive phase is intravenous ceftazidime or meropenem in the setting of critical illness.2 The duration of treatment in the intensive phase is at least 14 days but can be prolonged depending on the severity of disease and clinical response. The eradication phase is initiated following the intensive therapy aiming to prevent later relapse of melioidosis. The antibiotic of choice for eradication therapy is oral co-trimoxazole.2 According to a recent multicenter randomized, double-blind trial for eradication therapy in Thailand, combination therapy using co-trimoxazole and doxycycline did not provide an additional benefit over co-trimoxazole alone.14 The treatment duration for the eradication phase is at least 12–20 weeks, according to a lower rate of relapse compared to 8 weeks of treatment.\n\nThe median time of therapeutic response following the intravenous antibiotics was previously reported approximately 9 days, but delayed resolution of fever may occur up to 1 month.15 Therefore, an extended period of intensive therapy may be required in a slow-responsive patient. Our patient did not respond to a 14-day course of meropenem but responded well to a 21-day of intravenous ceftazidime. The follow-up chest radiograph obtained after intensive therapy and 8-weeks of co-trimoxazole monotherapy showing a slight decrease in size of the left upper lobe mass (Figure 3) suggesting regression of melioidosis within lung cancer.Figure 3 The follow-up chest radiograph obtained after intensive therapy and 8 weeks of co-trimoxazole monotherapy showing a slight decrease in size of the left upper lobe mass (arrows), which suggests partial regression of melioidosis within lung cancer.\n\n\n\nNoteworthy, the most common pathogen coinciding with lung cancer is M. tuberculosis.16 In addition to melioidosis, other rare infections have been reported. The co-existence of endobronchial Talaromyces marneffei and adenocarcinoma has been reported in a 50-year-old healthy woman presenting with one month of chronic cough and prolonged fever.17\nEntamoeba histolytica causing pulmonary infection in a patient with lung adenocarcinoma after receiving chemotherapy has also been reported.18\n\nConclusion\nIn conclusion, we have reported an uncommon simultaneous presentation of primary lung cancer and localized pulmonary melioidosis in an old man residing in the endemic area of B. pseudomallei. This case highlighted the importance to exclude an unusual cause of coinciding infection in patients with suspected lung cancer presenting with unexplained fever. Further histopathological and microbiological studies, including tissue culture for possible pathogens in endemic areas, are mandatory for a precise diagnosis and appropriate treatment.\n\nEthic and Consent Statement\nThis case report was approved by the Ethics Committee on Human Rights related to research involving human subjects at Faculty of Medicine Ramathibodi Hospital. The written informed consent was obtained from the patient for publication of this case report and any accompanying images.\n\nDisclosure\nThe abstract of this paper was presented at the CHEST Annual Meeting 2019 as a poster presentation with interim findings. The poster’s abstract was published in “Poster abstract” in the CHEST Journal Volume 156, Issue 4, Supplement: https://doi.org/10.1016/j.chest.2019.08.555. The authors report no conflicts of interest for this work.\n==== Refs\nReferences\n1. Akinosoglou \nKS , Karkoulias \nK , Marangos \nM . Infectious complications in patients with lung cancer\n. Eur Rev Med Pharmacol Sci . 2013 ;17 (1 ):8 –18\n.23329518 \n2. Wiersinga \nWJ , Virk \nHS , Torres \nAG , et al. Melioidosis\n. Nat Rev Dis Primers . 2018 ;4 (1 ):17107 . doi:10.1038/nrdp.2017.107 29388572 \n3. Buccheri \nG , Ferrigno \nD . Lung cancer: clinical presentation and specialist referral time\n. Eur Respir J . 2004 ;24 (6 ):898 –904\n. doi:10.1183/09031936.04.00113603 15572529 \n4. Kim \nMS , Koh \nJS , Baek \nHJ , Ryoo \nBY , Kim \nCH , Lee \nJC . Neoplastic fever caused by lung cancer\n. J Thorac Oncol . 2007 ;2 (2 ):158 –159\n. doi:10.1016/S1556-0864(15)30045-9 17410033 \n5. Zee \nYK , Soo \nRA . Non-small cell lung cancer presenting with neoplastic fever at diagnosis and relapse\n. Int J Infect Dis . 2010 ;14 (6 ):e518 –e521\n. doi:10.1016/j.ijid.2009.06.009 19699672 \n6. Xu \nM , Zhang \nX , Xu \nZ , et al. Psychogenic fever in a patient with small cell lung cancer: a case report\n. BMC Cancer . 2015 ;15 (1 ):445 . doi:10.1186/s12885-015-1462-z 26024659 \n7. Wilson \nM , Smith \nS , Brown \nJ , Hanson \nJ . Melioidosis mimicking primary lung malignancy with superior vena cava obstruction\n. IDCases . 2016 ;6 :58 –59\n. doi:10.1016/j.idcr.2016.09.014 27713860 \n8. Hinjoy \nS , Hantrakun \nV , Kongyu \nS , et al. Melioidosis in Thailand: present and future\n. Trop Med Infect Dis . 2018 ;3 (2 ):38 . doi:10.3390/tropicalmed3020038 29725623 \n9. Maneechotesuwan \nK . An exotic pulmonary infection in Thailand: melioidosis\n. Respirology . 1999 ;4 (4 ):419 –422\n. doi:10.1046/j.1440-1843.1999.00216.x 10612579 \n10. Burivong \nW , Wu \nX , Saenkote \nW , Stern \nEJ . Thoracic radiologic manifestations of melioidosis\n. Curr Probl Diagn Radiol . 2012 ;41 (6 ):199 –209\n. doi:10.1067/j.cpradiol.2012.01.001 23009770 \n11. Zaw \nKK , Wasgewatta \nSL , Kwong \nKK , Fielding \nD , Heraganahally \nSS , Currie \nBJ . Chronic pulmonary melioidosis masquerading as lung malignancy diagnosed by EBUS guided sheath technique\n. Respir Med Case Rep . 2019 ;28 :100894 .31312598 \n12. Mays \nEE , Ricketts \nEA . Melioidosis: recrudescence associated with bronchogenic carcinoma twenty-six years following initial geographic exposure\n. Chest . 1975 ;68 (2 ):261 –263\n. doi:10.1378/chest.68.2.261 1149556 \n13. Suputtamongkol \nY , Chaowagul \nW , Chetchotisakd \nP , et al. Risk factors for melioidosis and bacteremic melioidosis\n. Clin Infect Dis . 1999 ;29 (2 ):408 –413\n. doi:10.1086/520223 10476750 \n14. Chaowagul \nW , Suputtamongkol \nY , Dance \nDA , Rajchanuvong \nA , Pattara-arechachai \nJ , White \nNJ . Relapse in melioidosis: incidence and risk factors\n. J Infect Dis . 1993 ;168 (5 ):1181 –1185\n.8228352 \n15. Simpson \nAJ , Suputtamongkol \nY , Smith \nMD , et al. Comparison of imipenem and ceftazidime as therapy for severe melioidosis\n. Clin Infect Dis . 1999 ;29 (2 ):381 –387\n. doi:10.1086/520219 10476746 \n16. Morales-Garcia \nC , Parra-Ruiz \nJ , Sanchez-Martinez \nJA , Delgado-Martin \nAE , Amzouz-Amzouz \nA , Hernandez-Quero \nJ . Concomitant tuberculosis and lung cancer diagnosed by bronchoscopy\n. Int J Tuberc Lung Dis . 2015 ;19 (9 ):1027 –1032\n. doi:10.5588/ijtld.14.0578 26260819 \n17. Lin \nF , Qiu \nY , Zeng \nW , Liang \nY , Zhang \nJ . Talaromyces marneffei infection in a lung cancer patient: a rare case report\n. BMC Infect Dis . 2019 ;19 (1 ):336 . doi:10.1186/s12879-019-3968-5 31014277 \n18. Liu \nYY , Ying \nY , Chen \nC , et al. Primary pulmonary amebic abscess in a patient with pulmonary adenocarcinoma: a case report\n. Infect Dis Poverty . 2018 ;7 (1 ):34 . doi:10.1186/s40249-018-0419-2 29699585\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1178-6973", "issue": "13()", "journal": "Infection and drug resistance", "keywords": "co-existing infection; kidney transplantation; melioidosis; non-small cell lung cancer", "medline_ta": "Infect Drug Resist", "mesh_terms": null, "nlm_unique_id": "101550216", "other_id": null, "pages": "2957-2961", "pmc": null, "pmid": "32904496", "pubdate": "2020", "publication_types": "D002363:Case Reports", "references": "23329518;31312598;31014277;10476746;8228352;10476750;26260819;10612579;17410033;29388572;27713860;19699672;1149556;29699585;15572529;29725623;26024659;23009770", "title": "Non-Small Cell Lung Carcinoma with Concomitant Localized Pulmonary Melioidosis: A Rare Co-Existing Disease.", "title_normalized": "non small cell lung carcinoma with concomitant localized pulmonary melioidosis a rare co existing disease" }
[ { "companynumb": "TH-ACCORD-201542", "fulfillexpeditecriteria": "1", "occurcountry": "TH", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CYCLOSPORINE" }, "drugadditional": "3", "dru...
{ "abstract": "While an abundance of literature exists describing adverse reactions to vancomycin (eg, nausea, vomiting, red man syndrome, acute kidney injury), there is scarce evidence demonstrating vancomycin anaphylactic reactions requiring cardiopulmonary resuscitation. We report a case of a patient who had 2 separate preoperative episodes of cardiac arrest following vancomycin that occurred 4 weeks apart. Both episodes of anaphylaxis required cardiopulmonary resuscitation, which led to a successful patient outcome. We discuss identification and treatment of vancomycin-induced anaphylaxis.", "affiliations": "From the Moffitt Cancer Center, Department of Anesthesiology, University of South Florida School of Medicine, Tampa, Florida.", "authors": "Evans|Trip|T|;Patel|Sephalie|S|", "chemical_list": "D014640:Vancomycin", "country": "United States", "delete": false, "doi": "10.1213/XAA.0000000000000586", "fulltext": null, "fulltext_license": null, "issn_linking": "2325-7237", "issue": "9(9)", "journal": "A & A case reports", "keywords": null, "medline_ta": "A A Case Rep", "mesh_terms": "D016887:Cardiopulmonary Resuscitation; D005260:Female; D006323:Heart Arrest; D006617:Hip Dislocation; D006801:Humans; D008875:Middle Aged; D011300:Preoperative Care; D014640:Vancomycin", "nlm_unique_id": "101637720", "other_id": null, "pages": "262-264", "pmc": null, "pmid": "28622151", "pubdate": "2017-11-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Two Consecutive Preoperative Cardiac Arrests Involving Vancomycin in a Patient Presenting for Hip Disarticulation: A Case Report.", "title_normalized": "two consecutive preoperative cardiac arrests involving vancomycin in a patient presenting for hip disarticulation a case report" }
[ { "companynumb": "US-EMCURE PHARMACEUTICALS LTD-2020-EPL-000547", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "VANCOMYCIN HYDROCHLORIDE" }, ...
{ "abstract": "OBJECTIVE\nTo evaluate sustained viral response (SVR) of 8-wk ledipasvir/sofosbuvir therapy among non-cirrhotic, genotype-1 hepatitis C virus (HCV) patients with RNA < 6 million IU/mL.\n\n\nMETHODS\nWe performed a retrospective cohort study to examine SVR rates, predictors of treatment failure and safety analysis of 8-wk ledipasvir/sofosbuvir (LDV/SOF) therapy among non-cirrhotic, genotype 1 HCV patients with viral load < 6 million IU/mL. Primary outcome was an achievement of SVR at 12 wk after treatment. Secondary outcomes were identifying predictors of treatment failure and adverse events during treatment.\n\n\nRESULTS\nTotal 736 patients: 55% males, 51% Caucasians and 65% were genotype 1a. Non-cirrhotic state of 53% was determined by clinical judgment (imaging, AST, platelet count) and 47% had documented liver fibrosis testing (biopsy, vibration-controlled transient elastography, serum biomarkers). Overall SVR12 was 96%. No difference in SVR12 was seen between patients whose non-cirrhotic state was determined by clinical judgment and patients who had fibrosis testing. Age groups, gender, ethnicity and genotype 1 subtype did not predict SVR. Non-cirrhotic state determined by clinical judgment based on simple, non-invasive tests were not associated with lower SVR [OR = 1.02, 95%CI: 0.48-2.17, P = 0.962]. The AUROC for hepatitis C RNA viral load was 0.734 (P < 0.001, 95%CI: 0.66-0.82). HCV RNA 2.2 million IU/mL was identified as the cutoff value with sensitivity 73% and specificity 64%. HCV RNA < 2.2 million IU/mL was associated with significantly higher SVR 98% with OR = 0.22 (95%CI: 0.1-0.49, P < 0.001) compared to SVR 92% in HCV RNA ≥ 2.2 million IU/mL. No death or morbidities were reported.\n\n\nCONCLUSIONS\nOur outcomes validate safety and effectiveness of 8-wk LDV/SOF therapy in non-cirrhotic, untreated HCV genotype 1 patients with HCV RNA < 6 million IU/mL.", "affiliations": "Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United States.;Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United States.;Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United States.;Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United States.;Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United States.", "authors": "Latt|Nyan L|NL|;Yanny|Beshoy T|BT|;Gharibian|Derenik|D|;Gevorkyan|Rita|R|;Sahota|Amandeep K|AK|", "chemical_list": "D000998:Antiviral Agents; D001562:Benzimidazoles; D005449:Fluorenes; C000595958:ledipasvir, sofosbuvir drug combination; D014542:Uridine Monophosphate; D000069474:Sofosbuvir", "country": "United States", "delete": false, "doi": "10.3748/wjg.v23.i26.4759", "fulltext": "\n==== Front\nWorld J GastroenterolWorld J. GastroenterolWJGWorld Journal of Gastroenterology1007-93272219-2840Baishideng Publishing Group Inc jWJG.v23.i26.pg475910.3748/wjg.v23.i26.4759Retrospective StudyEight-week ledipasvir/sofosbuvir in non-cirrhotic, treatment-naïve hepatitis C genotype-1 patients with hepatitis C virus-RNA < 6 million: Single center, real world effectiveness and safety Latt Nyan L Yanny Beshoy T Gharibian Derenik Gevorkyan Rita Sahota Amandeep K Nyan L Latt, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, Jacksonville, FL 32224, United StatesBeshoy T Yanny, Amandeep K Sahota, Division of Gastroenterology and Hepatology, Kaiser Permanente, Los Angeles Medical Center, Los Angeles, CA 90027, United StatesDerenik Gharibian, Pharmacy Operations Office, Kaiser Permanente, Los Angeles Medical Center, Los Angeles, CA 90027, United StatesRita Gevorkyan, Department of Clinical Operations, Kaiser Permanente Southern California, CA 91107, United StatesAuthor contributions: Latt NL and Sahota AK designed the research; Latt NL and Yanny BT performed the data abstraction, contributed to the analysis; Latt NL wrote the paper; Gharibian D and Sahota AK provided clinical advice and supervised the report; Gevorkyan R helped with the data abstraction and provided clinical advice.\n\nCorrespondence to: Nyan L Latt, MD, Transplant Hepatology Fellow, Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, United States. latt.nyan@mayo.edu\n\nTelephone: +1-904-9563256 Fax: +1-904-9563359\n\n14 7 2017 14 7 2017 23 26 4759 4766 16 1 2017 8 3 2017 9 6 2017 ©The Author(s) 2017. Published by Baishideng Publishing Group Inc. All rights reserved.2017This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial.AIM\nTo evaluate sustained viral response (SVR) of 8-wk ledipasvir/sofosbuvir therapy among non-cirrhotic, genotype-1 hepatitis C virus (HCV) patients with RNA < 6 million IU/mL.\n\nMETHODS\nWe performed a retrospective cohort study to examine SVR rates, predictors of treatment failure and safety analysis of 8-wk ledipasvir/sofosbuvir (LDV/SOF) therapy among non-cirrhotic, genotype 1 HCV patients with viral load < 6 million IU/mL. Primary outcome was an achievement of SVR at 12 wk after treatment. Secondary outcomes were identifying predictors of treatment failure and adverse events during treatment.\n\nRESULTS\nTotal 736 patients: 55% males, 51% Caucasians and 65% were genotype 1a. Non-cirrhotic state of 53% was determined by clinical judgment (imaging, AST, platelet count) and 47% had documented liver fibrosis testing (biopsy, vibration-controlled transient elastography, serum biomarkers). Overall SVR12 was 96%. No difference in SVR12 was seen between patients whose non-cirrhotic state was determined by clinical judgment and patients who had fibrosis testing. Age groups, gender, ethnicity and genotype 1 subtype did not predict SVR. Non-cirrhotic state determined by clinical judgment based on simple, non-invasive tests were not associated with lower SVR [OR = 1.02, 95%CI: 0.48-2.17, P = 0.962]. The AUROC for hepatitis C RNA viral load was 0.734 (P < 0.001, 95%CI: 0.66-0.82). HCV RNA 2.2 million IU/mL was identified as the cutoff value with sensitivity 73% and specificity 64%. HCV RNA < 2.2 million IU/mL was associated with significantly higher SVR 98% with OR = 0.22 (95%CI: 0.1-0.49, P < 0.001) compared to SVR 92% in HCV RNA ≥ 2.2 million IU/mL. No death or morbidities were reported.\n\nCONCLUSION\nOur outcomes validate safety and effectiveness of 8-wk LDV/SOF therapy in non-cirrhotic, untreated HCV genotype 1 patients with HCV RNA < 6 million IU/mL.\n\nHepatitis CSustained viral responseLedipasvirCirrhosisSofosbuvir\n==== Body\nCore tip: We highlight that sustained viral response (SVR) outcomes in patients with their non-cirrhotic status determined by clinical judgment using simple, cheap, non-invasive tests such as platelet count, sonographic finding of spleen size and hepatic morphology, are comparable with those who had specialized tests such as liver biopsy, vibration-controlled transient elastography or specialized serum biomarker test. We also validate the fact that hepatitis C virus (HCV) RNA plays a role in predicting SVR (AUROC = 0.743, 95%CI: 0.66-0.82) with a cutoff value of 2.2 million IU/mL. Significantly higher 98% SVR was observed among HCV RNA < 2.2 million IU/mL, compared to 92% SVR with HCV RNA ≥ 2.2 million IU/mL.\n\nINTRODUCTION\nHepatitis C virus (HCV) infection is a major cause of cirrhosis, hepatocellular carcinoma and liver-related mortality[1]. Recent studies estimate the prevalence of HCV to be between 1.2%-1.5% in the United States, which is approximately 4.5-5 million. This population is composed of 1 million incarcerated/homeless individuals, hospitalized patients, and people living on Indian reservations, and also includes 3.6 million from the 2003-2010 National Health and Nutrition Examination Survey[2,3]. The prevalence of HCV is declining, but HCV-related cirrhosis is still expected to peak in the year 2020[4]. Therefore, effective, safe and well-tolerated treatment regimens with shorter duration are urgently needed.\n\nHepatitis C treatment has evolved from a 78-wk interferon monotherapy to 48-wk pegylated interferon plus ribavirin therapy and now 12-wk therapy with newer all-oral direct-acting antiviral (DAA) agents. DAA regimens have revolutionized the treatment of hepatitis C with their excellent sustained virologic response (SVR), tolerable side effect profiles and shorter duration of therapy. Despite the high cost of newer DAAs, a cost-effective analysis has demonstrated that ledipasvir/sofosbuvir (LDV/SOF)-based regimens will reduce long-term HCV-related complications and are cost-effective in the majority of chronic HCV patients [5].\n\nION-3 trial demonstrated that an 8-wk LDV/SOF therapy in non-cirrhotic, treatment naïve genotype 1 HCV patients with HCV RNA < 6 million IU/mL is non-inferior to 12-wk LDV/SOF therapy (SVR: 94% vs 95%)[6]. The shorter duration of treatment can remarkably increase patient compliance and substantially reduce treatment cost. Real-world studies have reported that SVR rates are comparable to those observed in ION-3 trial[7-10]. However, conflicting data has been reported by a large real-world cohort from Veteran’s Affairs in which researchers found that non-cirrhotic patients with HCV-RNA < 6 million IU/mL were less likely to achieve SVR with 8-wk LDV/SOF treatment compared to 12-wk treatment [9].\n\nEight-week LDV/SOF therapy for non-cirrhotic, genotype 1 HCV patients is not included in HCV guidelines by American Association for the Study of Liver Diseases and Infectious Diseases Society of America due to lack of real-world validation for comparable SVR with 12-wk therapy[11]. European Association for the Study of the Liver and United States Food and Drug Administration recommend considering 8-wk therapy with caution in treatment-naïve genotype-1 HCV patients without cirrhosis who have pre-treatment viral load < 6 million IU/mL[12,13]. We contemplated that shorter duration of treatment could provide the lower cost, the higher patient compliance and adherence as long as the shorter duration therapy can provide the comparable outcomes. We performed a retrospective cohort study to examine the SVR rates, the predictors of treatment failure and the safety analysis of 8-wk LDV/SOF therapy among non-cirrhotic, previously untreated genotype-1 HCV patients with viral load < 6 million IU/mL.\n\nMATERIALS AND METHODS\nStudy population\nKaiser Permanente Southern California (KPSC) is a large, integrated healthcare system with over 4 million members. Integrated healthcare is delivered to members at 14 medical centers throughout the region. All interactions with the healthcare system, such as clinic/emergency department/urgent care visits, hospital admissions and outpatient laboratory tests are captured in an integrated electronic medical record (EMR) system and the data is available for research purposes. Emergency care delivered at outside facilities is captured in a claims system that is also available. The KPSC Regional guidelines for 8-wk LDV/SOF therapy were developed and all providers were notified for eligibility criteria: genotype-1, non-cirrhotic, HCV-RNA < 6 million IU/mL and no prior treatment failure. Cirrhotic status of some patients was confirmed by liver biopsy or other non-invasive testing such as vibration-controlled transient elastography (VCTE) or FIBROSPECT II test in some KPSC centers. In some patients, non-cirrhotic status of some patients was determined by clinical judgement of treating healthcare providers using sonographic morphology of the liver, the spleen size and the platelet count in other KPSC centers. All patients with platelet count less than 150 × 109/L underwent a form of hepatic fibrosis testing such as liver biopsy, VCTE or FIROSPEcT II. Every patient had hepatic sonography and baseline laboratory testing prior to hepatitis C treatment. We developed a protocol for KPSC nurse practitioners, physician assistants and pharmacists, who specialized in hepatitis C treatment, to document intended treatment duration and rationales, pre-treatment testing and close monitoring of patients during treatment such as laboratory testing every 2 wk, calling/messaging to identify any barriers/adverse events and providing coping mechanisms/strategies if any event occurred.\n\nInclusion criteria: patients with age ≥ 18 years, HCV viral load < 6 million IU/mL, no cirrhosis or prior treatment failure and who had received 8-wk LDV/SOF therapy for chronic HCV genotype-1 infection. Exclusion criteria: patients without SVR12 (SVR at 12 wk after end of treatment) data, patients who did not complete the intended therapy and patients who missed doses for more than seven consecutive days. Individuals who fulfilled above criteria were included in the final study analysis.\n\nStudy design\nWe conducted a retrospective cohort study from December 2015 to December 2016, of all patients who had completed 8-wk LDV/SOF therapy. Patient’s clinical and demographic information was captured from KPSC-EMR system. We developed a standardized protocol with explicit criteria for data abstraction including pre- and post-treatment laboratory results, co-morbid medical conditions, liver biopsy (Metavir fibrosis staging), VCTE (kilopascal), FIBROSPECT II test (serum biomarkers), adverse events, clinic/urgent care/emergency department visits and hospitalizations during treatment. Two data abstractors, who are familiar with the EMR system, collected the data according to the protocol criteria to maximize the inter-rater reliability of data abstraction.\n\nSafety analysis\nPatient reported side effects such as fatigue, headache, insomnia, arthralgia/myalgia, nausea, cough, rash, dizziness, diarrhea, pruritus, irritability and edema, were recorded. Serious adverse events were defined as any event requiring care at the emergency department or hospital admission.\n\nStudy outcome\nPrimary outcome of our study was achievement of SVR at 12 wk after treatment. Secondary outcomes were identifying predictors of treatment failure and adverse events during treatment. SVR was defined as non-detectable level of HCV-RNA test.\n\nStatistical analysis\nFor the primary endpoint evaluating SVR12 and for the evaluation of adherence, the final analysis was restricted to per-protocol fashion of those patients who completed therapy and returned for follow-up HCV-RNA testing 3 mo after the end of treatment. The rationale to exclude patients who were lost to follow-up was to counter artificial lowering of the calculated SVR rates. Descriptive statistics were used to compare the baseline differences between those individuals who did or did not achieve SVR12. We used cross-tabulation with Pearson χ2 test to determine the significant difference between categorical variables and 2-tailed Independent-samples t-test to determine the significant difference between 1 categorical variable and 1 quantitative variable. We used multivariate logistic regression to estimate OR and 95%CI to identify predictors of treatment failure while adjusting for confounding variables. All data were entered into and analyzed using IBM SPSS Statistics 20 (IBM, Armonk, NY, United States).\n\nRESULTS\nWe identified total of 775 non-cirrhotic, genotype 1 HCV patients with HCV-RNA < 6 million IU/mL who received 8-wk LDV/SOF treatment. Seven hundred and thirty-six patients were included in the final analysis after exclusion of patients who reported missing doses, discontinued treatment due to adverse events and patients who did not follow-up for SVR12. Figure 1 demonstrates the flow chart of patient selection process.\n\nFigure 1 Flow chart of patient selection process. This flow chart summarizes patient identification for eligibility and inclusion/exclusion criteria.\n\nThe demographic and clinical characteristics of patients are outlined in Table 1. The mean age was 58 years, 55% were males, 51% were Caucasian and 65% had genotype 1a infection. Fifty-three percent of patients considered to be non-cirrhotic were determined by healthcare providers based on clinical judgement (platelet count, spleen size, hepatic morphology on ultrasound) and 47% patients had documented liver fibrosis testing (43% liver biopsy, 3% VCTE and 0.4% FIBROSPECT II). Mean HCV-RNA log10 was 6.2.\n\nTable 1 Demographic and clinical characteristics of patients prior to hepatitis c treatment n (%)\n\nCharacteristics\tn = 736\t\nAge, mean ± SD (yr)\t58 ± 10\t\nRange\t(23-85)\t\nMale sex\t403 (55)\t\nEthnicity\t\t\nCaucasian\t374 (51)\t\nAfrican American\t178 (24)\t\nHispanic\t158 (21)\t\nAsian/Pacific islanders\t26 (4)\t\nHCV genotype-subtype\t\t\n1a\t475 (64)\t\n1b\t242 (33)\t\n1 without confirmed subtype\t19 (3)\t\nLiver biopsy\t317 (43)\t\nVibration-controlled transient elastography\t25 (3)\t\nFIBROSpect II\t3 (0.4)\t\nOverall fibrosis score\t\t\nStage 0\t45 (13)\t\nStage 1\t164 (48)\t\nStage 2\t104 (30)\t\nStage 3\t29 (8)\t\nStage 3-4 or 4\t2 (1)\t\nNon-cirrhotic state determined by clinical judgement\t391 (53)\t\nHCV RNA - log10 IU/mL, mean ± SD\t6.2 ± 0.2\t\nHCV RNA ≥ 2.2 million IU/mL\t219 (30)\t\nPre-treatment laboratory values\t\t\nGFR, mean ± SD (Range)\t79 ± 11 (40-89)\t\nPlatelet count (103/mm3), mean ± SD (Range)\t218 ± 55 (45-495)\t\nINR, mean ± SD (Range)\t0.99 ± 0.7 (0.8-1.3)\t\nAlbumin, mean ± SD (Range)\t3.9 ± 0.4 (2.1-5.1)\t\nMissing\t101 (14.0)\t\nCo-morbid conditions\t\t\nPsychiatric diagnoses\t145 (20.0)\t\nChronic kidney disease\t35 (5.0)\t\nPsoriasis\t16 (2.0)\t\nHIV co-infection\t5 (0.7)\t\nCryoglobulinemia\t4 (0.5)\t\nHCV-related glomerulonephritis\t2 (0.3)\t\nHBV co-infection\t2 (0.3)\t\nHepatocellular carcinoma\t1 (0.1)\t\nHCV: Hepatitis C virus; HBV: Hepatitis B virus; GFR: Glomerular filtration rate; INR: International normalized ration; HIV: Human immunodeficiency virus.\n\nTable 2 demonstrates the study outcomes (SVR). Overall SVR12 was 96%. None of the patients who achieved SVR12 had viral relapse at 24-wk post treatment. Fifty-nine percent patients had SVR24 data at the time of analysis. We found no difference in SVR12 between patients whose non-cirrhotic state was determined by clinical judgment and patients who had fibrosis testing. No significant difference in SVR12 was seen among gender, genotype 1 subtype, ethnicity, type of fibrosis tests and fibrosis stages. Special populations; those co-infected with HIV and HBV achieved 100% SVR12. When reviewed by age groups, patients with age > 65 years had lower SVR compared to age groups 55-65 and < 55 years but no statistical significance was observed (Figure 2).\n\nTable 2 Sustained viral response 12 rate by various patient characteristics for non-cirrhotic patients with genotype 1 hepatitis C virus infection treated with 8-week ledipasvir/sofosbuvir therapy\n\nCharacteristics\tSVR12 (%) (n = 736)\tP value\t\nOverall\t96 (708/736)\t\t\nNon-cirrhotic state determined by clinical judgement\t96 (376/391)\t0.962\t\nNon-cirrhotic state determined by biopsy, VCTE, FIBROSPECT II\t96 (332/345)\t\t\nHCV RNA ≥ 2.2 million IU/mL\t92 (201/219)\t< 0.001\t\nHCV RNA < 2.2 million IU/mL\t98 (507/270)\t\t\nHIV co-infection\t100 (6/6)\t\t\nHBV co-infection\t100 (2/2)\t\t\nGender\t\t0.071\t\nMale\t95 (383/403)\t\t\nFemale\t98 (325/333)\t\t\nHCV genotype-subtype\t\t0.414\t\n1a\t96 (454/475)\t\t\n1b\t98 (236/324)\t\t\nUndetermined\t95 (18/19)\t\t\nEthnicity\t\t\t\nCaucasian\t96 (357/374)\t\t\nAfrican American\t96 (171/178)\t\t\nHispanic\t98 (155/158)\t0.544\t\nAsian/Pacific Islander\t96 (25/26)\t\t\nAge groups\t\t0.311\t\n< 55 yr\t97 (216/223)\t\t\n55-65 yr\t97 (369/382)\t\t\n> 65 yr\t94 (123/131)\t\t\nFibrosis Tests\t\t0.489\t\nLiver biopsy\t97 (306/317)\t\t\nVibration-controlled transient elastography\t92 (23/25)\t\t\nFIBROSPECT II\t100 (3/3)\t\t\nOverall fibrosis stage (cumulative: biopsy/VCTE/FIBROSPECT II)\t\t\t\nStage 0\t98 (44/45)\t\t\nStage 1\t95 (155/164)\t0.611\t\nStage 2\t98 (102/104)\t\t\nStage 3\t97 (28/29)\t\t\nStage 4\t100 (2/2)\t\t\nHCV: Hepatitis C virus; VCTE: Vibration-controlled transient elastography; SVR: Sustained viral response.\n\nFigure 2 Sustained virologic response rates among patients with various clinical and demographic characteristics. SVR: Sustained viral response.\n\nWe found that HCV RNA viral load plays a role in predicting SVR with high accuracy - the area under a receiver operating characteristic (AUROC) was 0.743 (95%CI: 0.66-0.82) with a cutoff value of 2.2 million IU/mL, as depicted in Figure 3. A significantly lower SVR was observed among patients with HCV-RNA more than 2.2 million IU/mL (91% vs 98%, P < 0.001). Table 3 exhibits the odds ratios for SVR12 in multivariate logistic regression. We found that patients with HCV-RNA less than 2.2 million IU/mL were more likely to achieve SVR compared to those with more than 2.2 million IU/mL (OR = 0.22, 95%CI: 0.1-0.49, P < 0.001). Age groups, gender, ethnicity and genotype 1 subtype did not predict SVR. Non-cirrhotic state determined by clinical judgment based on simple, non-invasive tests was not associated with lower SVR (OR = 1.02, 95%CI: 0.48-2.17, P = 0.962).\n\nTable 3 Odds ratios for sustained viral response at 12 week in multivariate logistic regression for non-cirrhotic, hepatitis c genotype 1 patients treated with 8-week ledipasvir/sofosbuvir therapy\n\nCharacteristics\tOR (95%CI) for SVR12 (n = 736)\tP value\t\nAge 55-65 yr (ref. < 55)\t0.92 (0.36-2.34)\t0.861\t\nAge > 65 yr (ref. < 55)\t0.5 (0.18-1.41)\t0.188\t\nMale (ref. female)\t0.47 (0.21-1.08)\t0.077\t\nAfrican-American (ref. Caucasian)\t0.84 (0.11-6.57)\t0.868\t\nHispanic (ref. Caucasian)\t2.07 (0.21-20.66)\t0.537\t\nAsian/Pacific Islander (ref. Caucasian)\t0.98 (0.16-8.28)\t0.983\t\nNon-cirrhotic state determined by clinical judgement (ref. Fibrosis Test: biopsy/VCTE/FIBROSPECT)\t1.02 (0.48-2.17)\t0.962\t\nHCV RNA ≥ 2200000 IU/mL (ref. < 2200000 IU/mL)\t0.22 (0.1-0.49)\t< 0.001\t\nHCV genotype - subtype 1b (ref. 1a)\t2.19 (0.25-19.15)\t0.480\t\nHCV: Hepatitis C virus; VCTE: Vibration-controlled transient elastography; SVR: Sustained viral response.\n\nFigure 3 Area under a receiver operating characteristic curve for hepatitis C RNA viral load was 0.734 (P < 0.001, 95%CI: 0.66-0.82).\n\nTable 4 reveals the safety analysis of the patients who received 8-wk LDV/SOF therapy. Three (0.5%) patients discontinued treatment due to intolerable adverse events: severe rheumatoid arthritis exacerbation, intractable nausea and declining renal function with glomerular filtration rate 22. One patient who developed drug-induced liver injury (DILI) from LED/SOF therapy with positive biopsy findings discontinued the treatment. Interestingly, one of two patients who were excluded from the study due to missing more than 7 d of therapy achieved SVR. This patient HCV-RNA was 625000 IU/mL. No death or significant morbidities were reported. Four (0.5%) patients experienced serious adverse events during therapy: 2 were hospitalized for observation to evaluate non-cardiac chest pain, 1 was hospitalized for DILI and 1 was due to emergency department admission for pneumonia. The most common minor adverse events were fatigue (14%), headache (13%), insomnia (5%), arthralgia/myalgia (4%) and nausea (4%).\n\nTable 4 Adverse events, hospital admissions and discontinuation rates of patients with genotype 1 hepatitis C virus infection who received 8-wk ledipasvir/sofosbuvir therapy\n\nAdverse events\tn (%)\t\nNo. adverse event, mean ± SD (Range)\t0.5 ± 0.7 (0-6)\t\nSerious adverse events\t4 (0.5)\t\nHospital admissions\t\t\nNon-cardiac chest pain\t2\t\nDrug-induced liver injury\t1\t\nPneumonia\t1\t\nMinor adverse events\t\t\nFatigue\t104 (14)\t\nHeadache\t98 (13)\t\nInsomnia\t35 (5)\t\nArthralgia/myalgia\t29 (4)\t\nNausea\t29 (4)\t\nCough\t15 (2)\t\nRash\t19 (3)\t\nDizziness\t12 (2)\t\nDiarrhea\t14 (2)\t\nPruritus\t11 (1)\t\nIrritability/anxiety\t10 (1)\t\nEdema\t2 (< 0.5)\t\nDiscontinuation\t4 (0.5)\t\nDrug-induced liver injury\t1\t\nSevere rheumatoid arthritis exacerbation\t1\t\nIntractable nausea\t1\t\nDecreased renal function during treatment (GFR < 30)\t1\t\nDeath\t0\t\nGFR: Glomerular filtration rate.\n\nDISCUSSION\nOur findings have validated that SVR rate of 8-wk LDV/SOF therapy in treatment naïve, non-cirrhotic, genotype 1 HCV patients with RNA < 6 million IU/mL is comparable with clinical trials and preliminary outcomes from small real-world studies[7-9]. We demonstrated that there is no difference in SVR between patients whose cirrhosis state was determined by fibrosis testing or clinical judgment. All patients had at least baseline ultrasound of the liver and blood tests such as transaminases levels, platelet count and International normalized ration. We calculated overall fibrosis stages on biopsy, VCTE and FIBROSPECT II and found no difference in SVR across fibrosis stages although very few patients had stage 0, 3 and 4. Our finding suggests that clinical judgment of non-cirrhotic state results in same outcome of SVR 96% compared to SVR of patients who had liver biopsy, VCTE or FIBROSPECT tests.\n\nIn our cohort, all patients had pre-treatment HCV-RNA < 6 million IU/mL. We divided to 2 subgroups containing RNA < 800000 IU/mL and > 800000 IU/mL. We found that patients with lower RNA < 800000 IU/mL achieved significantly higher SVR compared to patients with higher RNA in both univariate and multivariate analyses. This finding suggests that HCV viral load plays an important role in predicting SVR although the determination of the optimal cut-off value of HCV-RNA level to consider 8-wk therapy to achieve SVR is currently not available [14]. Our study highlights that HCV RNA 2.2 million IU/mL was associated significant impact on outcomes with AUROC 0.73. While female gender and Latino ethnicity achieved slightly higher SVRs, there is no statistical difference compared to male gender and other ethnicities. We found no difference in SVR rates between African-Americans and Caucasians in contrast to other studies which demonstrated the decreased likelihood of SVR in African-American population[12].\n\nThe wholesale acquisition cost for LDV/SOF combination drug in the United States is $1125 per pill. Cost of 8-wk course of therapy is $63000 and cost of 12-wk course is $94500 - net cost saving of $31500 per patient when 8-wk treatment is administered. Healthcare expenses can substantially be reduced by selecting 8-wk LDV/SOF therapy in treatment-naïve, non-cirrhotic genotype 1 HCV patients.\n\nThe strengths of our study are its real-world experience and an integrated healthcare model involving all clinical services. We were able to abstract data regarding all clinic/emergency department/urgent care visits, hospitalizations, telephone/electronic-mail encounters and all laboratory tests from the integrated EMR system. All providers used KPSC-Regional HCV treatment guidelines which is readily available on the EMR system for review. Treatment duration, reasons for discontinuation and medication compliance were clearly documented. All patients in the final analysis had good post-treatment follow ups with available SVR12 data. The limitation of our study is its retrospective nature.\n\nIn conclusion, our outcomes from real-world cohort validate high SVR rates in non-cirrhotic, treatment naïve HCV genotype 1 patients with HCV RNA < 6 million IU/mL who received 8-wk LDV/SOF therapy. There was no difference in SVR between patients whose non-cirrhotic state was determined by clinical judgment and patients who had fibrosis testing. HCV RNA less than 2.2 million IU/mL was associated with significantly higher SVR. LDV/SOF therapy is safe and well-tolerated with high adherence rates. Therefore, 8-wk LDV/SOF therapy can be used in selected subset of patients with chronic HCV genotype 1 infection who meet aforementioned clinical criteria. Further studies are in need to evaluate and validate HCV RNA cutoff value to achieve the optimal more than 95% of SVR.\n\nCOMMENTS\nBackground\nHepatitis C treatment has evolved from a 78-wk interferon monotherapy to 48-wk pegylated interferon plus ribavirin therapy and now 12-wk therapy with newer all-oral direct-acting antiviral (DAA) agents. DAA regimens have revolutionized the treatment of hepatitis C with their excellent sustained virologic response (SVR), tolerable side effect profiles and shorter duration of therapy. Although ION-3 trials and other real-world studies have revealed that 8-wk ledipasvir/sofosbuvir therapy is effective and has comparable sustained viral response outcomes for non-cirrhotic patients who have untreated genotype-1 hepatitis C virus (HCV) infection and HCV RNA < 6 million IU/mL, the current AASLD guidelines recommend 12-wk therapy. Eight-week therapy may provide significantly lower cost, better patient compliance and adherence.\n\nResearch frontiers\nThe authors validated that SVR outcomes in 8-wk LED/SOF therapy was comparable with 12-wk therapy in this large, real-wold cohort.\n\nInnovations and breakthroughs\nThis study highlights that HCV RNA 2.2 million IU/mL was associated significant impact on outcomes with AUROC 0.73. Patients with HCV RNA more than 2.2 millon IU/mL were observed to have significantly lower SVR (92% vs 98%, P < 0.001). They found no difference in SVR rates between African-Americans and Caucasians in contrast to other studies which demonstrated the decreased likelihood of SVR in African-American population.\n\nApplications\nThis study validate other real-world studies which have shown that 8-wk therapy in selected subset of patients (non-cirrhotic, untreated, genotype-1 with HCV RNA < 6 million IU/mL) is effective and comparable to 12-wk therapy. We can apply these findings and amend changes in national guidelines regarding HCV treatment which can save significant amount of HCV treatment cost and boost patient compliance and adherence.\n\nPeer-review\nThis study is good, and it's important knowledge for clinicians before treating HCV patients.\n\nManuscript source: Invited manuscript\n\nSpecialty type: Gastroenterology and hepatology\n\nCountry of origin: United States\n\nPeer-review report classification\n\nGrade A (Excellent): 0\n\nGrade B (Very good): B\n\nGrade C (Good): C, C\n\nGrade D (Fair): 0\n\nGrade E (Poor): 0\n\nInstitutional review board statement: This study was reviewed and approved by Kaiser Permanente Southern California Institutional Review Board.\n\nInformed consent statement: Patients were not required to give informed consent to the study. The study was qualified for an ‘exempt status’ by the Institutional Review Board due to its retrospective nature. We collected only the existing data from electronic medical records, the date were stored without any patient identifiers.\n\nConflict-of-interest statement: We have no financial relationships to disclose.\n\nData sharing statement: No additional data are available.\n\nPeer-review started: January 18, 2017\n\nFirst decision: February 9, 2017\n\nArticle in press: June 12, 2017\n\nP- Reviewer: Gatselis NK, Ratnasari N, Sirin G S- Editor: Gong ZM L- Editor: A E- Editor: Li D\n==== Refs\n1 Rosen HR Clinical practice. Chronic hepatitis C infection N Engl J Med 2011 364 2429 2438 21696309 \n2 Denniston MM Jiles RB Drobeniuc J Klevens RM Ward JW McQuillan GM Holmberg SD Chronic hepatitis C virus infection in the United States, National Health and Nutrition Examination Survey 2003 to 2010 Ann Intern Med 2014 160 293 300 24737271 \n3 Edlin BR Eckhardt BJ Shu MA Holmberg SD Swan T Toward a more accurate estimate of the prevalence of hepatitis C in the United States Hepatology 2015 62 1353 1363 26171595 \n4 Jacobson IM Davis GL El-Serag H Negro F Trépo C Prevalence and challenges of liver diseases in patients with chronic hepatitis C virus infection Clin Gastroenterol Hepatol 2010 8 924 933; quiz e117 20713178 \n5 Chhatwal J Kanwal F Roberts MS Dunn MA Cost-effectiveness and budget impact of hepatitis C virus treatment with sofosbuvir and ledipasvir in the United States Ann Intern Med 2015 162 397 406 25775312 \n6 Kowdley KV Gordon SC Reddy KR Rossaro L Bernstein DE Lawitz E Shiffman ML Schiff E Ghalib R Ryan M Ledipasvir and sofosbuvir for 8 or 12 weeks for chronic HCV without cirrhosis N Engl J Med 2014 370 1879 1888 24720702 \n7 Lai JB Witt MA Pauly MP Ready J Allerton M Seo S Witt DJ Eight- or 12-Week Treatment of Hepatitis C with Ledipasvir/Sofosbuvir: Real-World Experience in a Large Integrated Health System Drugs 2017 77 313 318 28078644 \n8 Kowdley KV Sundaram V Jeon CY Qureshi K Latt NL Sahota A Lott S Curry MP Tsai N Chaiyakunapruk N Eight weeks of ledipasvir/sofosbuvir is effective for selected patients with genotype 1 hepatitis C virus infection Hepatology 2017 65 1094 1103 28027579 \n9 Backus LI Belperio PS Shahoumian TA Loomis TP Mole LA Real-world effectiveness of ledipasvir/sofosbuvir in 4,365 treatment-naive, genotype 1 hepatitis C-infected patients Hepatology 2016 64 405 414 27115523 \n10 Wilder JM Jeffers LJ Ravendhran N Shiffman ML Poulos J Sulkowski MS Gitlin N Workowski K Zhu Y Yang JC Safety and efficacy of ledipasvir-sofosbuvir in black patients with hepatitis C virus infection: A retrospective analysis of phase 3 data Hepatology 2016 63 437 444 26547499 \n11 American Association for the Study of Liver Diseases; Infectious Diseases Society of America HCV Guidance: Recommendations for Testing, Managing, and Treating Hepatitis C Available from: http://www.hcvguidelines.org/full-report/initial-treatment-hcv-infection \n12 European Association for Study of Liver EASL Recommendations on Treatment of Hepatitis C 2015 J Hepatol 2015 63 199 236 25911336 \n13 Harvoni (ledipasvir and sofosbuvir) tablet product information. Foster City, CA: Gilead Sciences, Inc.; 2015 Available from: http://www.accessdata.fda.gov/drugsatfda_docs/label/2015/205834s001lbl.pdf \n14 O’Brien TR Feld JJ Kottilil S Pfeiffer RM No scientific basis to restrict 8 weeks of treatment with ledipasvir/sofosbuvir to patients with hepatitis C virus RNA & lt; 6,000,000 IU/mL Hepatology 2016 63 28 30 26474163\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1007-9327", "issue": "23(26)", "journal": "World journal of gastroenterology", "keywords": "Cirrhosis; Hepatitis C; Ledipasvir; Sofosbuvir; Sustained viral response", "medline_ta": "World J Gastroenterol", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000998:Antiviral Agents; D001562:Benzimidazoles; D005260:Female; D005449:Fluorenes; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D000069474:Sofosbuvir; D000072230:Sustained Virologic Response; D014542:Uridine Monophosphate; D019562:Viral Load; D055815:Young Adult", "nlm_unique_id": "100883448", "other_id": null, "pages": "4759-4766", "pmc": null, "pmid": "28765697", "pubdate": "2017-07-14", "publication_types": "D016428:Journal Article", "references": "28078644;26547499;26171595;25911336;28027579;25775312;20713178;24737271;26474163;21696309;27115523;24720702", "title": "Eight-week ledipasvir/sofosbuvir in non-cirrhotic, treatment-naïve hepatitis C genotype-1 patients with hepatitis C virus-RNA < 6 million: Single center, real world effectiveness and safety.", "title_normalized": "eight week ledipasvir sofosbuvir in non cirrhotic treatment na ve hepatitis c genotype 1 patients with hepatitis c virus rna 6 million single center real world effectiveness and safety" }
[ { "companynumb": "US-GILEAD-2017-0287004", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "LEDIPASVIR\\SOFOSBUVIR" }, "drugadditional": nul...
{ "abstract": "Heparin-induced thrombocytopenia (HIT) is a rare but potentially devastating and life-threatening complication from using heparin. HIT not only causes thrombocytopenia, but it also carries an increased risk for fatal thrombotic complications. In this report, we describe the case of a patient in whom fatal HIT developed after successful surgical repair of a posterior post-infarction ventricular septal rupture with cardiopulmonary bypass.", "affiliations": "Department of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, Turkey.;Department of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, Turkey.;Department of Cardiology, Faculty of Medicine, University of Turgut Ozal, Ankara, Turkey.;Department of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, Turkey.;Department of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, Turkey.;Department of Cardiovascular Surgery, Turkiye Yuksek Ihtisas Hospital, Ankara, Turkey.", "authors": "Nazli|Yunus|Y|;Colak|Necmettin|N|;Demircelik|Bora|B|;Alpay|Mehmet Faith|MF|;Cakir|Omer|O|;Cagli|Kerim|K|", "chemical_list": "D000925:Anticoagulants; D006493:Heparin", "country": "South Africa", "delete": false, "doi": "10.5830/CVJA-2015-001", "fulltext": "\n==== Front\nCardiovasc J AfrCardiovasc J AfrTBCCardiovascular Journal of Africa1995-18921680-0745Clinics Cardive Publishing 2659299010.5830/CVJA-2015-001Case ReportA fatal complication after repair of post-infarction ventricular septal rupture: heparin-induced thrombocytopenia with thrombosis Nazli Yunus MDyunusnazli@gmail.comDepartment of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, TurkeyColak Necmettin MDDepartment of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, TurkeyAlpay Mehmet Fatih MDDepartment of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, TurkeyCakir Omer MDDepartment of Cardiovascular Surgery, Faculty of Medicine, University of Turgut Ozal, Ankara, TurkeyDemircelik Bora MDDepartment of Cardiology, Faculty of Medicine, University of Turgut Ozal, Ankara, TurkeyCagli Kerim MD---May-Jun 2015 26 3 e11 e15 www.cvja.co.za25 2 2014 10 1 2015 Copyright © 2015 Clinics Cardive Publishing2015This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Abstract\nHeparin-induced thrombocytopenia (HIT) is a rare but potentially devastating and life-threatening complication from using heparin. HIT not only causes thrombocytopenia, but it also carries an increased risk for fatal thrombotic complications. In this report, we describe the case of a patient in whom fatal HIT developed after successful surgical repair of a posterior post-infarction ventricular septal rupture with cardiopulmonary bypass.\n\nheparinthrombocytopeniathrombosispost-infarction ventricular septal rupture\n==== Body\nAbstract\nHeparin-induced thrombocytopenia (HIT) is a rare but potentially devastating and life-threatening complication of heparin therapy. HIT not only causes thrombocytopenia, but it also carries an increased risk for both arterial and venous thrombotic complications, despite the administration of heparin as an anticoagulating agent.1\n\nHIT is associated with antibodies to a complex of heparin–platelet factor 4 (H-PF4). HIT-associated antibodies are generally detected after open-heart surgery.2,3 Post-infarction ventricular septal rupture (PI-VSR) following acute myocardial infarction has a high mortality rate and surgical repair also presents a high risk of mortality.\n\nIn this report, we describe the case of a patient in whom fatal HIT developed after successful surgical repair of a posterior PI-VSR on cardiopulmonary bypass (CPB). This is rare, and a limited number of cases have been reported following surgical repair of a PI-VSR.\n\nCase report\nA 74-year-old man presented with chest pain to a local hospital, from where he was transferred to our institution, with a PI-VSR. He had been anticoagulated with unfractioned heparin (UFH) (1 000 IU/h daily) for three days since the myocardial infarction (MI) had occurred.\n\nOn admission, his heart rate was 92 beats/min, blood pressure was 90/50 mmHg and weight was 85 kg. Physical examination showed a systolic murmur at the left sternal border. Cardiac catheterisation was performed, during which a single intravenous dose of 2 500 units of heparin was administered. Coronary angiography showed critical stenoses in the mid segment of the left anterior descending artery and ostium of the second diagonal branch, and occlusion in the distal segment of the right coronary artery (Fig. 1A, B). The time between the onset of acute MI and surgery was three days.\n\nFigure 1. (A, B) Coronary angiography showing critical stenoses of the left anterior descending artery and ostium of the second diagonal branch, and occlusion of the right coronary artery. (C) Transthoracic echocardiography showing post-infarction postero-inferior ventricular septal rupture (VSR) (white arrow). (D) Surgery photograph showing VSR (white asterisk) and (E) necrotic and decayed basal portion of the postero-medial papillary muscle (white arrow). (F) Surgery photograph showing that the VSR was closed (black asterisk) with a patch and the posteromedial papillary muscle was attached to the left ventricular wall with polytetrafluoroethylene sutures (black arrow). LV: left ventricle, RV: right ventricle.\n\nTransthoracic echocardiography revealed poor left ventricular wall motion and a large postero-inferior ventricular septal rupture (Fig. 1C). To prevent cardiogenic shock, intra-aortic balloon pump assistance was initiated and anticoagulation was continued with a heparin infusion of 500 IU/h over three hours.\n\nThereafter, the patient was taken to the operating room for emergency surgery because of haemodynamic deterioration. After induction of general anaesthesia, transoesophageal echocardiography (TEE) was performed to evaluate the repair of the VSR. A median sternotomy was performed. Cardiopulmonary bypass was instituted with ascending aortic and bicaval venous cannulation. Heparin (300 U/kg) was given to obtain an activated clotting time of more than 400 s.\n\nFirstly, a longitudinal transinfarction incision was made in the left ventricular myocardium parallel to and 1 cm away from the posterior descending artery. The post-infarction VSR was closed with a double velour fabric polyester patch (Bard® Debakey®, IMPRA, Inc) using a 3-0 polypropylene suture (Ethicon, Inc, Somerville, NJ) with a teflon pledget through the left ventricle (Fig. 1D).\n\nThe posteromedial papillary muscle was carefully inspected and the basal portion of the posteromedial papillary muscle appeared to be necrotic (Fig. 1E). The decayed base of the posteromedial papillary muscle was attached to the left ventricular wall using two interrupted mattress 4-0 polytetrafluoroethylene (goretex) sutures with a teflon pledget (Fig. 1F). The posterior left ventriculotomy was closed in two layers over two teflon felt strips using 2-0 polypropylene sutures (Ethicon, Inc, Somerville, NJ).\n\nCABG was then performed with sequential grafting of the saphenous vein to the left anterior descending artery and second diagonal branch. Peri-operative transoesophageal echocardiography demonstrated well-preserved left ventricular wall contraction except for the infarcted area, with no evidence of residual leak.\n\nSuccessful weaning from cardiopulmonary bypass was achieved with an intra-aortic balloon pump (IABP) and low-dose inotropic support. The patient tolerated the surgical procedure well, and his initial postoperative course was uneventful. He remained intubated for 13 hours in ICU with a 24- and 48-hour postoperative blood loss of 750 and 300 ml, respectively. For 48 hours during the immediate postoperative period, the patient was managed with intra-aortic balloon counter pulsation and small doses of inotropic drugs. He was weaned off IABP on the third postoperative day.\n\nA total dose of 98 500 IU of heparin was given before (72 000 IU) and during (26 500 IU) cardiopulmonary bypass (CPB) at our hospital. Anticoagulation was reversed by protamine at the end of the operation. Following separation from bypass, the patient was given a total of six units of fresh frozen plasma and eight units of packed red cells.\n\nBlood tests were done regularly and the platelet count was monitored daily. Laboratory findings on admission showed a normal platelet count (210 × 103 cells/μl). Thrombocytopaenia developed postoperatively on day four with falls in platelet count of more than 50%, with a platelet level of 64 × 103 cells/μl, from an initial admission count of 210 × 103 cells/μl. The nadir platelet count was 25 × 103 cells/μl on the seventh postoperative day (Fig. 2). Fig. 2 summarises the patient’s platelet counts and key clinical events during hospitalisation.\n\nFigure 2. Platelet counts and key clinical events during hospitalisation. ARF: acute renal failure, IABP: intra-aortic balloon pump, OR: operating room.\n\nOn postoperative day five, right-hand cyanosis was noted with absent radial pulses and was attributed to the presence of a right radial arterial catheter. The radial arterial catheter was removed the same day without improvement. Doppler ultrasound showed an occlusion of the radial artey and a patent ulnar artery. Also, a superficial venous thrombosis (cephalic and basilic vein) was detected in the right arm by Doppler ultrasound.\n\nOn postoperative day six, ischaemic changes developed on the front of both feet (Fig. 3). The ischaemic changes in the right hand worsened from that of the previous day. Additionally, an occlusion of the right ulnar artery was detected by Doppler ultrasound. A brachial artery thrombectomy was performed three times on the same day because of increased ischaemic changes. The thrombectomy was not successful.\n\nFigure 3. The ischaemic changes in the right hand (A), right foot (B), and left food (C).\n\nWe suspected type 2 HIT. Heparin therapy was immediately discontinued on postoperative day three, including all intravenous fluids and lines. On the basis of the clinical symptoms, we used the ‘4 Ts’ clinical scoring system to test for the possibility of HIT, and found a high probability of heparin-induced thrombocytopenia.\n\nA laboratory test was performed on postoperative day six, and a definitive diagnosis of HIT was made by serological test, confirming positive antibodies to the heparin–PF4 complexes with a slow turnaround time. Complete thrombophilic studies were unremarkable for other hypercoagulable conditions.\n\nAnticoagulation was immediately started with fondaparinux, which is the only alternative anticoagulant agent in our country, at the recommended dose for these patients (7.5 mg/day, subcutaneous) on postoperative day four because of a fall in platelet count of more than 50%. The patient’s platelet count had not increased during therapy with fondaparinux after seven days.\n\nThe patient developed acute renal insufficiency requiring haemodialysis on postoperative day nine. Fondaparinux (2.5 mg) was also instilled directly into the dialysis circuit on dialysis days. On the 11th day postoperatively, the patient died of multiple organ failure despite intensive care.\n\nDiscussion\nUnfractionated heparin (UFH) is routinely used worldwide during CPB procedures and other various conditions for systemic anticoagulation.4 However, a small percentage of patients treated with UFH or low-molecular weight heparin (LMWH) suffer complications caused by side effects of the drug, the most serious of which is HIT.1 HIT is an adverse effect of the drug causing potentially fatal thrombotic or thromboembolic complications. HIT is a clinicopathological condition initiated with heparin exposure and characterised by a fall in the platelet count and paradoxical thrombophilia.5,6\n\nHIT syndrome may be classified into two distinct subtypes based on differences in the pathophysiology and clinical features: type 1 and type 2. Type 1 HIT is non-immune and typically occurs as a fall in platelet count within the first two days after starting heparin. Platelet levels generally decrease by 10–20%.7 This condition usually resolves spontaneously without treatment or complications within days, even with continued heparin use. It is a non-immune-mediated disorder and appears to be due to a direct activation of the platelets by heparin, leading to platelet aggregation and, as a result, thrombocytopenia.\n\nBy contrast, the less common and more severe form, type 2 HIT is an immune-mediated disorder caused by antibody formation against the circulating H-PF4 complexes. This type can be associated with thrombotic or thromboembolic complications. It is also known as heparin-induced thrombocytopenia and thrombosis (HITT) and white clot syndrome due to platelet-rich arterial thrombosis.5 In most cases, thrombocytopenia develops on approximately the fifth day of initiation of heparin.8\n\nThe incidence of type 2 HIT is significantly higher after exposure to UFH versus LMWH (2.6 vs 0.2%).9 Surgical patients (especially cardiac surgery) are also more likely to develop HIT than medical patients.5\n\nThe incidence of HITT in patients who have undergone cardiac surgery has been estimated at between 0.12 and 1.3%.10 Cardiac surgical patients are at a greater risk for postoperative HITT due to several factors. First, most of these patients have had previous exposure to heparin for diagnostic, prophylactic and therapeutic purposes. Second, they are exposed to high-dose intra-operative heparin during CPB, and platelet activation is associated with surgery and CPB. Third, this exposure is usually continued in the postoperative period (either prophylactically or for flushing the lines).11\n\nThe common clinical presentation of HIT involves thrombocytopenia and thrombosis. Thrombocytopenia is the primary manifestation of HIT, but the degree and onset of the fall in platelet count may be variable. Type 1 HIT is often characterised by a fall in platelet count within one and four days after heparin exposure, with a nadir level of 100 000 cells/μl, spontaneous normalisation despite continued heparin use, and no other clinical sequelae.\n\nOn the other hand, type 2 HIT occurs within five to 10 days after the administration of heparin. The platelet counts fall more significantly by ≥ 50% or ≥ 100 000 cells/μl, with a median nadir of ~ 60 000 cells/μl.7 However, even when platelet counts in type 2 HIT are typically < 20 000/μl, spontaneous bleeding is uncommon. Thrombosis is the main contributor to morbidity and mortality associated with type 2 HIT, and HIT is fatal in an estimated 5–10% of patients, typically due to thrombotic or thromboembolic events.\n\nThrombosis may accompany thrombocytopenia in 30–60% of patients. Although thrombosis may occur in any vascular bed, venous thrombosis is more common than arterial thrombosis and often presents as deep-vein thrombosis or pulmonary embolism. However, arterial thrombosis can be predominant in cardiac and vascular surgical patients.5 Major complications of arterial thrombosis are acute limb ischaemia, stroke and acute myocardial infarction. Arterial thrombi are uncommonly seen in the renal, mesenteric or spinal arteries.4\n\nThe diagnosis of HIT is essentially made on the basis of clinical grounds and a decrease in platelet count in a patient receiving heparin, for which there are no obvious causes. Laboratory assays (frequently with slow turnaround times) play a supportive role and involve functional and non-functional tests.12 Most laboratory tests are not readily available in the acute setting.8\n\nHIT should be suspected in the setting of absolute thrombocytopenia (platelet count < 150 000 cells/μl) as well as relative thrombocytopenia (fall in platelet count of at least 50% from baseline value). However, this syndrome should also be considered in patients with the unexplained development of new or progressive thrombosis while receiving a heparin product.\n\nTo aid in the diagnosis of HIT, a specific scoring system for clinical diagnosis, called the 4 Ts score was developed and validated by Lo et al.13 A score is calculated based on the following four categories: degree of thrombocytopenia, timing of onset of thrombocytopenia, clinical sequelae such as the development of venous or arterial thrombosis, and presence of other aetiologies of thrombocytopenia.5\n\nFunctional and immunological tests for HIT involve the platelet aggregation test (PAT), serotonin release assay (SRA), heparin-induced platelet aggregation (HIPA) test, the anti-HPF4 complex antibody enzyme-linked immunosorbent assays (ELISA), and flow cytometry studies.8 The sensitive (> 90%) but less specific (~ 71%) H-PF4 ELISA test is often used as a screening test, and the SRA (sensitivity and specificity 100 and 97%, respectively) can be performed as a confirmatory test, but is not universally available and utilised.12\n\nThe HIT-associated mortality rate in cardiac surgery patients is 35–42%.7 About 20% of patients developing HIT syndrome may require limb amputation because of peripheral arterial thrombosis. This syndrome is associated with a myriad of complications, including multiple organ systems: mesenteric ischaemia, renal insufficiency and stroke.8\n\nDelays in the availability of diagnostic assay results frequently necessitate initiation of treatment for HIT based on clinical evaluation alone. When HIT with or without thrombosis is suspected postoperatively, the first step in treatment is immediate discontinuation of all heparin exposure, including heparin flushes and LMWH.12\n\nIn addition to heparin discontinuation, patients with either HIT with thrombosis or isolated HIT (type 2 HIT without thrombosis) require further treatment with an alternative anticoagulant agent. Heparin discontinuation alone is insufficient, because patients (even type 2 HIT without thrombosis) remain in a prothrombotic state. In light of the sustained thrombus propagation that occurs with HIT, current treatment is focused on reduction of thrombin generation via direct thrombin inhibition (e.g. bivalirudin, lepirudin, argatroban) or indirect factor Xa inhibition (e.g. danaparoid, fondaparinux).5\n\nProphylactic and therapeutic fondaparinux failed to prevent the development of and to treat HIT in our case, but we used fondaparinux because it is the only alternative anticoagulant agent in our country. Although successful results have been reported in the treatment of HIT with the use of fondaparinux, it was recommended as grade 2C at the 9th ACCP Conference on Antithrombotic Therapy and Prevention of Thrombosis.14\n\nThere are often plausible alternative explanations in critical patients with thrombocytopenia. CPB and the use of the IABP are clearly associated with thrombocytopenia. However, in our patient, the decreased platelet count was not attributed to these devices and conditions because there was no drop (> 50%) in platelet count within the first three postoperative days. It is also essential to differentiate HIT from other conditions causing thrombocytopenia, such as haemodilution, disseminated intravascular coagulation and sepsis. In our patient, these conditions were excluded by several examinations and laboratory tests.\n\nConclusion\nHIT is a clinicopathological syndrome in which one or more clinical events occur, usually thrombocytopenia or thrombosis. Patients undergoing cardiac surgery can be at risk of HIT in the early postoperative period, therefore daily platelet counts should be performed during this period. If signs of HIT develop in a patient receiving heparin, it must be stopped immediately and alternative anticoagulant agents started. In our case, we did not have success with fondaparinux as the alternative anticoagulant. Despite discontinuation of heparin and initiation of alternative anticoagulant agents, high morbidity and mortality rates are associated with HIT.\n==== Refs\nReferences\n1 Ishida K Imamaki M Ishida A Shimura H Miyazaki M Heparininduced thrombocytopenia after coronary artery bypass grafting with cardiopulmonary bypass: report of a case. Surg Today 2004 34 1041 4043 15580389 \n2 Bauer TL Arepally G Konkle BA et al. Prevalence of heparin-associated antibodies without thrombosis in patients undergoing cardiopulmonary bypass surgery. Circulation 1997 95 1242 1246 9054855 \n3 Yoon JH Jang IK Heparin-induced thrombocytopenia in cardiovascular patients: pathophysiology, diagnosis, and treatment. Cardiol Rev 2011 19 143 153 21464642 \n4 Mitchell C Riley CA Vahid B Unusual complication of heparininduced thrombocytopenia after mitral valve surgery: spontaneous rupture of spleen. Ann Thorac Surg 2007 83 1172 1174 17307485 \n5 Hess CN Becker RC Alexander JH Lopes RD Antithrombotic therapy in heparin-induced thrombocytopenia: guidelines translated for the clinician. J Thromb Thrombolysis 2012 34 552 561 22843169 \n6 Smythe MA Forsyth LL Warkentin TE Smith MD Sheppard JA Shannon F Progressive, fatal thrombosis associated with heparinınduced thrombocytopenia after cardiac surgery despite “therapeutic” anticoagulation with argatroban: Potential role for PTT and ACT confounding. J Cardiothorac Vasc Anesth 2014 8 25 doi: 10.1053/j. jvca. 2014.04.029. \n7 Yamamoto N Nie M Hari Y Ohara K Miyaji K Death due to undetected heparin-induced thrombocytopenia after cardiac surgery. Gen Thorac Cardiovasc Surg 2012 60 511 513 22627957 \n8 DuBose J Sutherland M Moulton M Krishnan B Cohn J Pratt JW Heparin-induced thrombocytopenia and thrombosis syndrome after cardiac surgery Curr Surg 2004 61 209 212 15051266 \n9 Martel N Lee J Wells PS Risk for heparin-induced thrombocytopenia with unfractionated and low-molecular-weight heparin thromboprophylaxis: a meta-analysis. Blood 2005 106 2710 2715 15985543 \n10 Aouifi A Blanc P Piriou V et al. Cardiac surgery with cardiopulmonary bypass in patients with type II heparin induced thrombocytopenia. Ann Thorac Surg 2001 71 678 683 11235727 \n11 Antoniou TH Stavridis G Daganou M Melissari E Gatzonis S Heparin-induced thrombocytopenia thrombosis after cardiac surgery. A case report. Acta Anaesthesiol Scand 2000 44 991 993 10981578 \n12 Cormack GM Kaufman LJ Severe heparin-induced thrombocytopenia: when the obvious is not obvious, a case report. J Med Case Rep 2007 1 13 17470295 \n13 Lo GK Juhl D Warkentin TE Sigouin CS Eichler P Greinacher A Evaluation of pretest clinical score (4 T’s) for the diagnosis of heparininduced thrombocytopenia in two clinical settings. J Thromb Haemost 2006 4 759 765 16634744 \n14 Linkins LA Dans AL Moores LK et al. Treatment and prevention of heparin-induced thrombocytopenia: antithrombotic therapy and prevention of thrombosis, 9th edn. American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012 141 e495 530\n\n", "fulltext_license": "CC BY", "issn_linking": "1015-9657", "issue": "26(3)", "journal": "Cardiovascular journal of Africa", "keywords": null, "medline_ta": "Cardiovasc J Afr", "mesh_terms": "D000368:Aged; D000925:Anticoagulants; D006348:Cardiac Surgical Procedures; D002315:Cardiopulmonary Bypass; D017023:Coronary Angiography; D001026:Coronary Artery Bypass; D017809:Fatal Outcome; D006493:Heparin; D006801:Humans; D008297:Male; D009203:Myocardial Infarction; D013536:Suture Techniques; D013921:Thrombocytopenia; D013927:Thrombosis; D013997:Time Factors; D016896:Treatment Outcome; D018658:Ventricular Septal Rupture", "nlm_unique_id": "101313864", "other_id": null, "pages": "e11-5", "pmc": null, "pmid": "26592990", "pubdate": "2015-05-23", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "17307485;15580389;22315270;9054855;22627957;10981578;16634744;21464642;17470295;15051266;15985543;11235727;25169901;22843169", "title": "A fatal complication after repair of post-infarction ventricular septal rupture: heparin-induced thrombocytopenia with thrombosis.", "title_normalized": "a fatal complication after repair of post infarction ventricular septal rupture heparin induced thrombocytopenia with thrombosis" }
[ { "companynumb": "TR-FRESENIUS KABI-FK201505038", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, "drugadditional": null...
{ "abstract": "BACKGROUND\nCrimean-Congo hemorrhagic fever (CCHF) is a severe infectious disease that is not endemic in the United Arab Emirates (UAE).\n\n\nMETHODS\nWe report two cases of confirmed CCHF diagnosed in Dubai, UAE, during Hajj season 2010. Both patients presented with an acute history of high-grade fever, skin rash, and hematemesis.\n\n\nCONCLUSIONS\nIn spite of maximal supportive measures and intravenous ribavirin therapy, both patients died within a few days from start of illness. More than 250 health care workers came into variable degrees of contact with the index cases, and none of them developed signs or symptoms suggestive of acquiring the illness. Health care workers from nonendemic regions should be aware of zoonotic hemorrhagic fevers imported via infected cattle and ticks and be able to diagnose and properly manage suspected cases in a timely manner. In addition, proper infection-control measures should be undertaken to prevent nosocomial spread of infection.", "affiliations": "Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Virology laboratory, Dr. Sulaiman Faqih Hospital, Jeddah, Kingdom of Saudi Arabia.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Virology laboratory, Dr. Sulaiman Faqih Hospital, Jeddah, Kingdom of Saudi Arabia.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Department of Microbiology and Immunology, College of Medicine and Health Sciences, United Arab Emirates University, Abu Dhabi, United Arab Emirates.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.;Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates.", "authors": "Mohamed Al Dabal|Laila|L|;Rahimi Shahmirzadi|Mohmamed Reza|MR|;Baderldin|Samar|S|;Abro|Ali|A|;Zaki|Ali|A|;Dessi|Zulfa|Z|;Al Eassa|Essa|E|;Khan|Gulfaraz|G|;Shuri|Hassan|H|;Alwan|Abid Mustafa|AM|", "chemical_list": null, "country": "Iran", "delete": false, "doi": "10.5812/ircmj.38374", "fulltext": "\n==== Front\nIran Red Crescent Med JIran Red Crescent Med J10.5812/ircmjKowsarIranian Red Crescent Medical Journal2074-18042074-1812Kowsar 10.5812/ircmj.38374Case ReportCrimean-Congo Hemorrhagic Fever in Dubai, United Arab Emirates, 2010: Case Report Mohamed AL Dabal Laila 1*Rahimi Shahmirzadi Mohmamed Reza 1Baderldin Samar 2Abro Ali 1Zaki Ali 2Dessi Zulfa 1Al Eassa Essa 1Khan Gulfaraz 3Shuri Hassan 1Alwan Abid Mustafa 11 Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates2 Virology laboratory, Dr. Sulaiman Faqih Hospital, Jeddah, Kingdom of Saudi Arabia3 Department of Microbiology and Immunology, College of Medicine and Health Sciences, United Arab Emirates University, Abu Dhabi, United Arab Emirates* Corresponding Author: Laila Mohamed AL Dabal, Infectious Diseases and Microbiology Units, Rashid Hospital, Dubai Health Authority, Dubai, United Arab Emirates, E-mail: lmdabal@dha.gov.ae27 7 2016 8 2016 18 8 e3837404 6 2016 09 7 2016 Copyright © 2016, Iranian Red Crescent Medical Journal2016This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.Introduction\nCrimean-Congo hemorrhagic fever (CCHF) is a severe infectious disease that is not endemic in the United Arab Emirates (UAE).\n\nCase Presentation\nWe report two cases of confirmed CCHF diagnosed in Dubai, UAE, during Hajj season 2010. Both patients presented with an acute history of high-grade fever, skin rash, and hematemesis.\n\nConclusions\nIn spite of maximal supportive measures and intravenous ribavirin therapy, both patients died within a few days from start of illness. More than 250 health care workers came into variable degrees of contact with the index cases, and none of them developed signs or symptoms suggestive of acquiring the illness. Health care workers from nonendemic regions should be aware of zoonotic hemorrhagic fevers imported via infected cattle and ticks and be able to diagnose and properly manage suspected cases in a timely manner. In addition, proper infection-control measures should be undertaken to prevent nosocomial spread of infection.\n\nCCHFUAEHealth Care WorkersInfection Control\n==== Body\n1. Introduction\nCrimean-Congo hemorrhagic fever (CCHF) is an arthropod-borne viral infection that infects domestic and wild animals and can be transmitted to humans via several routes. The causative agent of CCHF is an RNA virus of the genus Nairovirus belonging to the Bunyaviridae family of viruses (1). Over several decades, serious outbreaks with high case-fatality rates have been reported from different parts of the world, including the Middle East (2-6). CCHF is becoming a global problem, and more cases are expected to be diagnosed as the disease becomes endemic to more areas due to movement of livestock, changes in hunting activities and agricultural practices (7). A real threat exists to health care workers managing patients with CCHF and causing nosocomial outbreaks, which may have high fatality rates (8). Another concern is related to the potential use of the virus as a weapon of bioterrorism, given the limited availability of diagnostic laboratory services with Biosafety Level 4 facilities (9).\n\nCCHF is not endemic to UAE; however, two documented limited outbreaks occurred in 1979 and 1994 and were associated with high mortality rates among infected health care workers (10, 11). Here, we report two recent cases of confirmed CCHF.\n\n2. Case Presentation\n2.1. Case 1\nOn October 28, 2010, a previously healthy 24-year-old male butcher working in Dubai Abattoir complained of fever, headache, and right lower quadrant abdominal pain, which was managed symptomatically in a private clinic, and he was discharged home. Two days later, he developed vomiting and non-bloody loose motions with generalized abdominal pain. He was admitted to another private hospital in Dubai for workup as a case of acute abdomen. Investigations on October 30, 2010, revealed the following: white blood cells (WBC) 11.8 × 103/µL (87.9% neutrophils), hemoglobin (Hb) 15.1 g/dL, platelets (Plt) 145 × 103/µL, creatinine 1.2 mg/dL, bilirubin 0.6 mg/dL, urine red blood cells (RBC) 10 - 15, AST 196 U/L, INR 1.7, GGT 55 U/L, alkaline phosphatase 79 U/L, PT 19 seconds. Chest X-ray was normal, and abdominal ultrasound showed a small right renal stone. The patient was given intravenous antibiotics and managed symptomatically for fever and abdominal complaints. On November 1, 2010, his condition deteriorated and he developed hematemesis and melena with worsening abdominal pain and continuous high spikes of temperature. Repeated labs were as follows: WBC 5.96 × 103/µL (88.2% neutrophils), Hb 14.3 g/dL, Plt 35 × 103/µL. He was referred to our hospital for further evaluation and management of his fever, severe thrombocytopenia, and acute gastrointestinal bleeding.\n\nAt the time of admission to our hospital, the patient was febrile (38.3°C), his pulse rate was 120/minutes, and BP was 90/60 mmHg. He looked acutely ill, though conscious and oriented. He had congested eyes and a petechial rash over the chest and lower limbs. There was generalized abdominal tenderness without organomegaly. A systemic examination revealed no other gross abnormality. Investigations revealed WBC 14.1 (neutrophilia with bandemia), Hb 14.2 g/dL, Plt 8 × 103/µL, D-dimer 5.3, urea 55 mg/dL, ESR 120 mm in the first hour, LDH 3086 U/L, ALT 72 U/L, PT 32.4 seconds, PTT 159.8 seconds, INR 3.34, urine RBC 20 - 25. Repeated AST was 5400 U/L.\n\nThe initial differential diagnosis included tauleremia, leptospirosis, and severe community-acquired bacterial infection, and accordingly he was started on levofloxacin, ceftriaxone, and gentamicin. A presumptive diagnosis of viral hemorrhagic fever (most likely CCHF) was also entertained in view of his occupation, and a loading dose of intravenous ribavirin therapy was given a few hours later. The patient was transferred to a single room for isolation with barrier nursing, and strict infection-control measures were adopted to minimize the number of medical staff members in contact with the patient and eliminate exposure to the patient’s body fluids. He underwent endoscopy, which showed severe hemorrhagic gastroduodenitis with active bleeding. The patient’s condition continued to deteriorate, and he developed respiratory compromise requiring mechanical ventilation. Despite all supportive measures, maximum inotropic support, and IV ribavirin therapy, the patient died on November 4, 2010, due to severe DIC and circulatory failure.\n\nA sample of the patient’s blood and ticks collected from the abattoir were sent to a regional reference laboratory in Saudi Arabia, and polymerase chain reaction (PCR) testing for Crimean-Congo virus was positive for both samples.\n\nAround 140 health care workers (physicians, nurses, and laboratory staff) came into variable degrees of contact with the patient or his body fluids during his admission to our hospital. They were classified into five groups according to their degree of contact:\n\nGroup 1 (high risk): percutaneous contact with blood (needle-sharp sticks or patient’s blood contact with broken skin or mucosa): nil\n\nGroup 2: patient’s blood contact to unbroken skin: 3\n\nGroup 3: patient’s body fluid contact to unbroken skin: 2\n\nGroup 4: physical contact with the patient without exchange of fluids: 32\n\nGroup 5: close proximity to the patient (1 m) without physical contact: 103\n\nConcerned staff members were requested to measure their temperature twice daily and to report to the emergency room if they developed any febrile illness (T > 38.3°C) or mucocutaneous bleeding. Staff members in groups 1 and 2 were also counseled regarding post-exposure prophylactic ribavirin therapy. All individuals preferred close follow-up with an infectious disease specialist, and nobody received ribavirin therapy. In addition to health care workers, the patient’s roommates, work colleagues, and close family members were contacted and interviewed and were advised to report to our hospital immediately in case they developed fever, loose motions, or bleeding. All were followed for 21 days post-exposure to the index case, and none of the medical staff in our hospital or the referring hospital nor any of his close contacts developed symptoms suggestive of acquiring the infection. It should be noted that no serological testing was carried out to document subclinical infection.\n\n2.2. Case 2\nAnother previously healthy young male (33 years old) presented to a private hospital in Dubai on November 23, 2010, with 5 days’ history of high-grade temperature, vomiting, and loose motions. On the day of admission, he developed hematemesis and melena. Clinically, he was febrile, hypotensive, and tachycardic, with a generalized petechial rash. The patient was resuscitated and transferred to our hospital for further evaluation and management. Importantly, the patient was in Dubai Abattoir during the Hajj holidays, a few days prior to the start of his illness. Laboratory investigations revealed the following results: WBC 4.29 × 103/µL, Hb 17 g/dL, Plt 40 × 103/µL (dropped to 26 × 103/µL within a few hours of admission), creatinine 2.1 mg/dL, NA 138 mmol/L, K 5.3 mmol/L, INR 1.947, D-dimer > 20. Chest X-ray was normal, and abdominal ultrasound revealed minimal ascites. CCHF was highly suspected in this case, and he was resuscitated and shifted to ICU and mechanically ventilated, with a loading dose of intravenous ribavirin started immediately. A few hours later, he passed a large amount of fresh blood per rectum, his general condition worsened with uncontrolled circulatory collapse, and he died on the day of admission, 7 days after the start of illness. The patient’s blood sample was sent to the same regional hospital for CCHF viral PCR testing, and the results were confirmatory for CCHF by PCR. Similar infection-control measures were taken as in index Case 1, and no medical staff in our hospital or the referring hospital developed clinical infection. His wife and three children were also contacted, and they, too, did not develop the illness clinically.\n\nTable 1. Patient Characteristics, Clinical Manifestations, and Laboratory Findings Upon Presentation\n\tCase 1\tCase 2\t\n\nAge, y\n\t24\t33\t\n\nGender\n\tMale\tMale\t\n\nSymptom\n\tFever, headache, abdominal pain, loose motions\tFever, vomiting, loose motions, melena, hematemesis\t\n\nClinical finding\n\t\t\t\n\tFebrile\tHypotensive febrile\t\n\tMaintained vital signs\tTachycardia\t\n\t\tPetechial rash\t\n\nWBC\n\t11.8 × 103/µL\t4.29 × 103/µL\t\n\nHb\n\t15.1 g/L\t17 g/L\t\n\nPlatelet\n\t145 × 103/µL\t40 × 103/µL\t\n\nCreatinine\n\t1.2 mg/dL\t2.1 mg/dL\t\n\nCXR\n\tNormal\tNormal\t\n\nAbdominal USS\n\tRenal stone\tMinimal ascites\t\n\nPT,\nsec\n\t19 \t21\t\n\nINR\n\t1.7\t1.95\t\nTable 2. Clinical Features\nPhase\tClinical Features\t\n\nPhase 1\n\tIncubation phase lasts 2 - 9 days and depends to some extent on how the infection was acquired.\t\n\nPhase 2\n\tPre-hemorrhagic phase usually manifests as high-grade fever, body aches, abdominal pain, and loose motions. Clinically, the patient looks sick, with congested conjunctiva, and is often tachypnic. There is generalized skin flushing. This phase lasts 3 - 5 days. Ribavirin therapy might be most effective during this period (12); however, delays in suspecting CCHF often lead to delays in starting therapy, which affects the overall disease outcome.\t\n\nPhase 3\n\tHemorrhagic phase ensues with persistent high-grade fever and gastrointestinal bleeding. In addition to massive hematemesis and melena, there might be epistaxis, gum bleeding, conjunctival hemorrhage, cerebral hemorrhage, vaginal bleeding, and hematuria. This is the most critical phase of the illness with the highest mortality rates. Patients develop circulatory collapse and severe coagulation disturbance, requiring massive and frequent blood transfusions. Reported case mortality is generally 10 - 40%, though figures as high as 80 - 100% (as in our patients) have been reported, particularly in instances of nosocomial infection. Of note is the difference in mortality between nosocomial cases and community-acquired cases, with significantly higher mortality rates in the former. One explanation could be a lower viral load from a direct tick bite in cases of community-acquired infection.\t\n\nPhase 4\n\tConvalescent phase usually begins 15 - 20 days after disease onset in patients who survive the hemorrhagic phase. Patients usually report generalized weakness, alopecia, memory loss, and poor appetite.\t\n3. Discussion\nCCHF is not endemic in UAE, and only sporadic cases with limited nosocomial outbreaks have been reported, including one from this hospital. Regionally, the disease has been reported in Oman, KSA, Kuwait, Iran, Pakistan, India, and Iraq (13-24). In nonendemic Gulf countries, the risk of acquiring human infection is mostly related to imported livestock that carry infected ticks. The risk seems to be greatest during Hajj season, when hundreds of thousands of cattle are imported to the region for the ceremonial sacrifice.\n\nFollowing initial infection by tick bite or contact with body fluids of an infected animal or human, four different phases of illness are recognized, as described first by Hoogstraal in 1979 and subsequently by others (25-28). Not all patients pass through the same phases, depending on the severity of their illness and their response to therapy.\n\nOur patient in Case 1 initially presented to a private hospital in Phase 2 (pre-hemorrhagic), which progressed to Phase 3 (hemorrhagic), while the patient in Case 2 came in the hemorrhagic phase with persistent fever and circulatory collapse.\n\nLaboratory and imaging findings in this disease depend on the stage in which the patient presents. In the hemorrhagic phase, the laboratory results usually indicate severe thrombocytopenia and disturbed coagulation profile. The hematological profile usually indicates leucopenia, anemia and thrombocytopenia. Hepatic transaminases are elevated, and figures in the thousands can be seen with severe hepatic necrosis. Ergonul et al. found that age, male gender, high platelet levels, and high ALT, AST, WBC, and PTT values and decrease in these values during follow-up are all indicative of a poor prognosis (12). Lactate dehydrogenase and creatinine kinases are nonspecifically elevated and have also been shown to be associated with poor outcome. Kidney function is usually preserved unless the patient develops acute renal failure. Ardalan et al. reported a case of CCHF presenting as thrombotic microangiopathy and acute renal failure (29). Case 2 in this study presented with renal impairment. Urinalysis reveals hematuria and proteinuria. Pulmonary manifestations of CCHF include pleural effusion with or without hemothorax, diffuse alveolar hemorrhage, and ARDS (30-32). Engin et al. conducted a prospective study on 44 confirmed cases of CCHF and found that patients with severe infection had lower left ventricular ejection fraction, higher systolic pulmonary artery pressure, and more frequent pericardial effusion compared with nonsevere cases and concluded that severe and fatal CCHF cases have impaired cardiac functions, which could be linked to increased fatality in severe infections (33).\n\nAbdominal ultrasound can show ascites or organomegaly, as seen in our patient in Case 2. As highlighted above, the hallmark of CCHF is bleeding diathesis resulting from vascular endothelial injury, which in turns leads to prolonged bleeding time, PT, APTT, elevated fibrinogen degradation products, and decreased fibrinogen (34). In both cases discussed here, INR was raised at the beginning of presentation although higher in Case 2 and later progressed to DIC.\n\nThe confirmation of CCHF infection relies on antibody detection by ELISA, antigen detection, virus isolation and PCR tests. These tests should be performed in high biosafety-level laboratories. Both of our cases were confirmed by PCR in a reference laboratory.\n\nManagement of human cases with CCHF has two main objectives: managing index case(s) and preventing human-human transmission. Active management of infected patients mostly relies on optimal supportive measures and restoration of a normal coagulation profile, depending on the severity of the infection. Data on the efficacy of ribavirin therapy in treating CCHF is conflicting, and there is no consensus nor clear guidelines on its role in the management of confirmed or suspected cases of CCHF. To date, it is the only available option to treat viral hemorrhagic fevers, such as CCHF, hantavirus, and Lassa fever, although it is not yet approved by the FDA for the management of CCHF. Several studies have examined oral or IV ribavirin therapy during different stages of the illness and have shown variable results in terms of efficacy and mortality (35-38). Having that said, the authors of two recent meta-analyses of data on ribavirin therapy in managing CCHF concluded that there is no strong evidence supporting the use of the drug to reduce mortality among infected patients (39, 40). Accordingly, we can make no clear recommendations on the efficacy or optimal dose of oral or IV ribavirin therapy for the management of CCHF. In our studied cases, ribavirin was started within a few days of symptom initiation. Despite this, both patients died of severe hemorrhage.\n\nPreventing human-human transmission is very important in this disease, especially among health care workers in nonendemic countries, who may not suspect the disease early in its course. The risk of transmission is highest during the hemorrhagic phase via incidental needle-stick injuries or exposure to infected body fluids through broken skin. Microbiology laboratory personnel could be at risk when handling infected material without proper infection-control measures. To control nosocomial infections, it is important to take precautions; barrier nursing, hand washing, and use of surgical masks and gloves are mandatory and effective in controlling infection when managing a suspected case (41).\n\nA debatable question is whether to give oral ribavirin prophylaxis to those who come into contact with confirmed CCHF patients or highly suspicious cases. This is not an easy question to answer, as we lack strong data on the efficacy of oral ribavirin in preventing secondary cases of CCHF, who should receive post-exposure prophylactic therapy, and the optimal dose and duration of prophylaxis.\n\nCurrent recommendations suggest administration of oral ribavirin therapy to people with close contact to the index cases, particularly if exposed to body fluids or tissue. They should be followed closely and asked to report immediately if they develop any febrile illness. Basic laboratory workup includes CBC, liver enzymes, and coagulation profile. If the clinical suspicion of acquiring a secondary infection is high, then post-exposure prophylaxis is recommended with 200 mg ribavirin orally twice daily for 5 - 14 days (42, 43).\n\n3.1. Conclusion\nCCHF is not endemic to UAE and other Gulf countries, and both cases described above occurred as a result of importing cattle with infected ticks. In nonendemic countries, a high level of suspicion is required in patients with fever, low platelets, and hemorrhagic tendencies. CCHF should be strongly suspected if the patients’ occupation involves exposure to animals. Health care providers and preventive medicine practitioners need to be aware of this serious and potentially lethal imported zoonotic illness and should use proper infection-control measures to prevent the spread of such fatal cases in the future, especially during the Hajj season.\n\nAuthors’ Contribution:Study concept and design, Laila Mohamed AL Dabal; analysis and interpretation of data, Ali Abro, Samar Badreedine, Ali Zaki; drafting of the manuscript, Laila Mohamed AL Dabal, Gulfaraz Khan. critical revision for important intellectual content, Mohammad Reza Rahimi, Ali Abro, Zulfa Deesi, Hassan Shuri; statistical analysis, Laila Mohamed AL Dabal, Essa Aleassa, Abid Abid.\n==== Refs\nReferences\n1 Schmaljohn CS Nichol ST Knipe DM Howley PM Griffin DE Lamb RA Martin MA Bunyaviridae. Fields virology. 2007 5th ed 1741 89 Philadelphia Lippincott Williams and Wilkins \n2 Maltezou HC Andonova L Andraghetti R Bouloy M Ergonul O Jongejan F et al. Crimean-Congo hemorrhagic fever in Europe: current situation calls for preparedness. Euro Surveill. 2010 15 10 19504 20403306 \n3 Drosten C Minnak D Emmerich P Schmitz H Reinicke T Crimean-Congo hemorrhagic fever in Kosovo. J Clin Microbiol. 2002 40 3 1122 3 11880460 \n4 Christova I Di Caro A Papa A Castilletti C Andonova L Kalvatchev N et al. Crimean-Congo hemorrhagic fever, southwestern Bulgaria. Emerg Infect Dis. 2009 15 6 983 5 10.3201/eid1506.081567 19523314 \n5 Athar MN Khalid MA Ahmad AM Bashir N Baqai HZ Ahmad M et al. Crimean-Congo hemorrhagic fever outbreak in Rawalpindi, Pakistan, February 2002: contact tracing and risk assessment. Am J Trop Med Hyg. 2005 72 4 471 3 15827289 \n6 Bakir M Ugurlu M Dokuzoguz B Bodur H Tasyaran MA Vahaboglu H et al. Crimean-Congo haemorrhagic fever outbreak in Middle Anatolia: a multicentre study of clinical features and outcome measures. J Med Microbiol. 2005 54 Pt 4 385 9 10.1099/jmm.0.45865-0 15770025 \n7 Vorou R Pierroutsakos IN Maltezou HC Crimean-Congo hemorrhagic fever. Curr Opin Infect Dis. 2007 20 5 495 500 10.1097/QCO.0b013e3282a56a0a 17762783 \n8 Aradaib IE Erickson BR Mustafa ME Khristova ML Saeed NS Elageb RM et al. Nosocomial outbreak of Crimean-Congo hemorrhagic fever, Sudan. Emerg Infect Dis. 2010 16 5 837 9 10.3201/eid1605.091815 20409377 \n9 Bossi P Tegnell A Baka A Van Loock F Hendriks J Werner A et al. Bichat guidelines for the clinical management of haemorrhagic fever viruses and bioterrorism-related haemorrhagic fever viruses. Euro Surveill. 2004 9 12 11 2 15677844 \n10 Suleiman MN Muscat-Baron JM Harries JR Satti AG Platt GS Bowen ET et al. Congo/Crimean haemorrhagic fever in Dubai. An outbreak at the Rashid Hospital. Lancet. 1980 2 8201 939 41 6107588 \n11 Khan AS Maupin GO Rollin PE Noor AM Shurie HH Shalabi AG et al. An outbreak of Crimean-Congo hemorrhagic fever in the United Arab Emirates, 1994-1995. Am J Trop Med Hyg. 1997 57 5 519 25 9392589 \n12 Ergonul O Celikbas A Baykam N Eren S Dokuzoguz B Analysis of risk-factors among patients with Crimean-Congo haemorrhagic fever virus infection: severity criteria revisited. Clin Microbiol Infect. 2006 12 6 551 4 10.1111/j.1469-0691.2006.01445.x 16700704 \n13 Williams RJ Al-Busaidy S Mehta FR Maupin GO Wagoner KD Al-Awaidy S et al. Crimean-congo haemorrhagic fever: a seroepidemiological and tick survey in the Sultanate of Oman. Trop Med Int Health. 2000 5 2 99 106 10747269 \n14 Hassanein KM El-Azazy OM Isolation of Crimean-Congo hemorrhagic fever virus from ticks on imported Sudanese sheep in Saudi Arabia. Ann Saudi Med. 2000 20 2 153 4 17322717 \n15 el-Azazy OM Scrimgeour EM Crimean-Congo haemorrhagic fever virus infection in the western province of Saudi Arabia. Trans R Soc Trop Med Hyg. 1997 91 3 275 8 9231193 \n16 Al-Nakib W Lloyd G El-Mekki A Platt G Beeson A Southee T Preliminary report on arbovirus-antibody prevalence among patients in Kuwait: evidence of Congo/Crimean virus infection. Trans R Soc Trop Med Hyg. 1984 78 4 474 6 6435292 \n17 Chinikar S Persson SM Johansson M Bladh L Goya M Houshmand B et al. Genetic analysis of Crimean-congo hemorrhagic fever virus in Iran. J Med Virol. 2004 73 3 404 11 10.1002/jmv.20106 15170636 \n18 Izadi S Naieni KH Madjdzadeh SR Nadim A Crimean-Congo hemorrhagic fever in Sistan and Baluchestan Province of Iran, a case-control study on epidemiological characteristics. Int J Infect Dis. 2004 8 5 299 306 10.1016/j.ijid.2003.10.008 15325599 \n19 Chinikar S Ghiasi SM Moradi M Goya MM Shirzadi MR Zeinali M et al. Geographical distribution and surveillance of Crimean-Congo hemorrhagic fever in Iran. Vector Borne Zoonotic Dis. 2010 10 7 705 8 10.1089/vbz.2009.0247 20854025 \n20 Chinikar S Ghiasi SM Hewson R Moradi M Haeri A Crimean-Congo hemorrhagic fever in Iran and neighboring countries. J Clin Virol. 2010 47 2 110 4 10.1016/j.jcv.2009.10.014 20006541 \n21 Saleem J Usman M Nadeem A Sethi SA Salman M Crimean-Congo hemorrhagic fever: a first case from Abbottabad, Pakistan. Int J Infect Dis. 2009 13 3 121 3 10.1016/j.ijid.2008.07.023 18922717 \n22 Jamil B Hasan RS Sarwari AR Burton J Hewson R Clegg C Crimean-Congo hemorrhagic fever: experience at a tertiary care hospital in Karachi, Pakistan. Trans R Soc Trop Med Hyg. 2005 99 8 577 84 10.1016/j.trstmh.2005.03.002 15935414 \n23 Mourya DT Yadav PD Shete AM Gurav YK Raut CG Jadi RS et al. Detection, isolation and confirmation of Crimean-Congo hemorrhagic fever virus in human, ticks and animals in Ahmadabad, India, 2010-2011. PLoS Negl Trop Dis. 2012 6 5 1653 10.1371/journal.pntd.0001653 22616022 \n24 Majeed B Dicker R Nawar A Badri S Noah A Muslem H Morbidity and mortality of Crimean-Congo hemorrhagic fever in Iraq: cases reported to the National Surveillance System, 1990-2010. Trans R Soc Trop Med Hyg. 2012 106 8 480 3 10.1016/j.trstmh.2012.04.006 22633179 \n25 Whitehouse CA Crimean-Congo hemorrhagic fever. Antiviral Res. 2004 64 3 145 60 10.1016/j.antiviral.2004.08.001 15550268 \n26 Appannanavar SB Mishra B An update on crimean congo hemorrhagic Fever. J Glob Infect Dis. 2011 3 3 285 92 10.4103/0974-777X.83537 21887063 \n27 Ergonul O Crimean-Congo haemorrhagic fever. Lancet Infect Dis. 2006 6 4 203 14 10.1016/S1473-3099(06)70435-2 16554245 \n28 Hoogstraal H The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. J Med Entomol. 1979 15 4 307 417 113533 \n29 Ardalan MR Tubbs RS Chinikar S Shoja MM Crimean-Congo haemorrhagic fever presenting as thrombotic microangiopathy and acute renal failure. Nephrol Dial Transplant. 2006 21 8 2304 7 10.1093/ndt/gfl248 16735392 \n30 Tanir G Tuygun N Balaban I Doksoz O A case of Crimean-congo hemorrhagic fever with pleural effusion. Jpn J Infect Dis. 2009 62 1 70 2 19168966 \n31 Doganci L Ceyhan M Tasdeler NF Sarikayalar H Tulek N Crimean Congo hemorrhagic fever and diffuse alveolar haemorrhage. Trop Doct. 2008 38 4 252 4 10.1258/td.2008.070406 18820205 \n32 Dogan OT Engin A Salk I Epozturk K Eren SH Elaldi N et al. Evaluation of respiratory findings in Crimean-Congo hemorrhagic fever. Southeast Asian J Trop Med Public Health. 2011 42 5 1100 5 22299435 \n33 Engin A Yilmaz MB Elaldi N Erdem A Yalta K Tandogan I et al. Crimean-Congo hemorrhagic fever: does it involve the heart? Int J Infect Dis. 2009 13 3 369 73 10.1016/j.ijid.2008.07.019 18980852 \n34 Bodur H Akinci E Onguru P Uyar Y Basturk B Gozel MG et al. Evidence of vascular endothelial damage in Crimean-Congo hemorrhagic fever. Int J Infect Dis. 2010 14 8 704 7 10.1016/j.ijid.2010.02.2240 20627646 \n35 Mardani M Jahromi MK Naieni KH Zeinali M The efficacy of oral ribavirin in the treatment of crimean-congo hemorrhagic fever in Iran. Clin Infect Dis. 2003 36 12 1613 8 10.1086/375058 12802764 \n36 Elaldi N Bodur H Ascioglu S Celikbas A Ozkurt Z Vahaboglu H et al. Efficacy of oral ribavirin treatment in Crimean-Congo haemorrhagic fever: a quasi-experimental study from Turkey. J Infect. 2009 58 3 238 44 10.1016/j.jinf.2009.01.014 19246100 \n37 Erduran E Zaman T Deger O Tekelioglu Y Bahadir A In vitro determination of apoptotic effect of heparin on lymphoblasts by using flow cytometric DNA analysis and measurements of caspase-9 activation and cytochrome C level. J Pediatr Hematol Oncol. 2012 34 1 26 9 10.1097/MPH.0b013e318228177f 22052169 \n38 Tasdelen Fisgin N Ergonul O Doganci L Tulek N The role of ribavirin in the therapy of Crimean-Congo hemorrhagic fever: early use is promising. Eur J Clin Microbiol Infect Dis. 2009 28 8 929 33 10.1007/s10096-009-0728-2 19301047 \n39 Ascioglu S Leblebicioglu H Vahaboglu H Chan KA Ribavirin for patients with Crimean-Congo haemorrhagic fever: a systematic review and meta-analysis. J Antimicrob Chemother. 2011 66 6 1215 22 10.1093/jac/dkr136 21482564 \n40 Soares-Weiser K Thomas S Thomson G Garner P Ribavirin for Crimean-Congo hemorrhagic fever: systematic review and meta-analysis. BMC Infect Dis. 2010 10 207 10.1186/1471-2334-10-207 20626907 \n41 Naderi HR Sarvghad MR Bojdy A Hadizadeh MR Sadeghi R Sheybani F Nosocomial outbreak of Crimean-Congo haemorrhagic fever. Epidemiol Infect. 2011 139 6 862 6 10.1017/S0950268810002001 20800007 \n42 Tutuncu EE Gurbuz Y Ozturk B Kuscu F Sencan I Crimean Congo haemorrhagic fever, precautions and ribavirin prophylaxis: a case report. Scand J Infect Dis. 2009 41 5 378 80 10.1080/00365540902882434 19343611 \n43 Mardani M Keshtkar-Jahromi M Crimean-Congo hemorrhagic fever. Arch Iran Med. 2007 10 2 204 14 17367225\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2074-1804", "issue": "18(8)", "journal": "Iranian Red Crescent medical journal", "keywords": "CCHF; Health Care Workers; Infection Control; UAE", "medline_ta": "Iran Red Crescent Med J", "mesh_terms": null, "nlm_unique_id": "101319850", "other_id": null, "pages": "e38374", "pmc": null, "pmid": "27795839", "pubdate": "2016-08", "publication_types": "D002363:Case Reports", "references": "20409377;22633179;12802764;21482564;20854025;6107588;19246100;19523314;19301047;16554245;15550268;10747269;16700704;20800007;17367225;20403306;6435292;22299435;20006541;19168966;21887063;17762783;19343611;22616022;15677844;20626907;20627646;15325599;19008137;9231193;15170636;113533;17322717;15770025;9392589;18980852;18820205;22052169;11880460;16735392;15935414;15827289", "title": "Crimean-Congo Hemorrhagic Fever in Dubai, United Arab Emirates, 2010: Case Report.", "title_normalized": "crimean congo hemorrhagic fever in dubai united arab emirates 2010 case report" }
[ { "companynumb": "AE-BAUSCH-BL-2017-005556", "fulfillexpeditecriteria": "1", "occurcountry": "AE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RIBAVIRIN" }, "drugadditional": "3", ...
{ "abstract": "We report on a so-far never described association between glomerulonephritis and sarcoid-like lung disease after long-term interferon beta (IFNb) treatment for relapsing-remitting multiple sclerosis. The interest in this case resides in the documented remission after IFNb discontinuation. The history of IFNb-related adverse events is probably not yet completely written. The rapid reversal of the pathological signs in our patient underlines the importance of careful clinical and laboratory surveillance, including kidney functional parameters, for an early diagnosis of IFNb-related diseases.", "affiliations": "SCDO Neurologia 2 - Centro di Riferimento Regionale Sclerosi Multipla, Orbassano, Italy m.capobianco@alice.it.;SS Nefrologia, Dipartimento di Scienze Cliniche e Biologiche, Università degli Studi di Torino, Orbassano, Italy.;SS Nefrologia, Dipartimento di Scienze Cliniche e Biologiche, Università degli Studi di Torino, Orbassano, Italy.;Medicina Nucleare, Istituto per la Ricerca e la Cura del Cancro, Candiolo, Italy.;SS Nefrologia, Dipartimento di Scienze Cliniche e Biologiche, Università degli Studi di Torino, Orbassano, Italy.;SCDU Pneumologia, Dipartimento di Scienze Cliniche e Biologiche, Univeristà degli Studi di Torino, Orbassano, Italy.;Centro Interreggionale Malattie Rare, Università degli Studi di Torino, Torino, Italy.;SCDO Neurologia 2 - Centro di Riferimento Regionale Sclerosi Multipla, Orbassano, Italy.", "authors": "Capobianco|Marco|M|;Piccoli|Giorgina|G|;Neve Vigotti|Federica|F|;Scapoli|Paola|P|;Deagostini|Maria Chiara|MC|;Albera|Carlo|C|;Roccatello|Dario|D|;Bertolotto|Antonio|A|", "chemical_list": "D007166:Immunosuppressive Agents; D000068556:Interferon beta-1a", "country": "England", "delete": false, "doi": "10.1177/1352458513519839", "fulltext": null, "fulltext_license": null, "issn_linking": "1352-4585", "issue": "20(7)", "journal": "Multiple sclerosis (Houndmills, Basingstoke, England)", "keywords": "Disease-modifying therapies; adverse event; nephritis; sarcoidosis", "medline_ta": "Mult Scler", "mesh_terms": "D004334:Drug Administration Schedule; D005260:Female; D005921:Glomerulonephritis; D006801:Humans; D007166:Immunosuppressive Agents; D000068556:Interferon beta-1a; D020529:Multiple Sclerosis, Relapsing-Remitting; D000072078:Positron Emission Tomography Computed Tomography; D012074:Remission Induction; D017565:Sarcoidosis, Pulmonary; D013997:Time Factors; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "9509185", "other_id": null, "pages": "889-91", "pmc": null, "pmid": "24446386", "pubdate": "2014-06", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Interferon beta-related nephropathy and interstitial lung disease: a new association and a long-term warning.", "title_normalized": "interferon beta related nephropathy and interstitial lung disease a new association and a long term warning" }
[ { "companynumb": "IT-US-EMD SERONO, INC.-7299759", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "INTERFERON BETA-1A" }, "drugadditional"...
{ "abstract": "Patients with DNA-damage response genes (DDR)-related pancreas cancer (BRCA1/2 or other DNA-damage related genes) may have improved outcomes secondary to increased sensitivity to DNA-damaging drugs (platinum chemotherapy/ poly ADP ribose polymerase (PARP)-inhibitors). However, data is scarce pertaining to outcomes in this subset of patients. Our objective was to retrospectively identify DDR-related pancreas cancer patients and report on clinical outcomes.\nPancreas cancer patients with a germline pathogenic variant in BRCA1/2 or other DDR gene were identified retrospectively through review of medical records (medical genetics/oncology) and genetic testing results at our institution. Data regarding clinical outcomes, therapy received, and survival was subsequently extracted.\nA total of 11 patients with pancreas cancer were identified to carry a pathogenic DDR-variant: BRCA1 (3), ATM (4), BRCA2 (2), PALB2 (1) and FANCC (1). Five of these individuals had prior history of other cancers. Clinically these tumors were localized (4), locally advanced (3), and metastatic (4) at diagnosis. Four out of 11 patients were still alive at time of data review. Survival in the 7 patients who had died was 13.7, 140.0, 20.5, 22.3, 23.5, 25.8, and 111.5 months. All patients with advanced disease had exposure to platinum chemotherapy.\nHistorical survival in patients with advanced and metastatic pancreas cancer is poor. Results of this DDR-subset of patients do show significantly superior outcomes, likely secondary to exposure to platinum drugs. This data, alongside other similar cohorts, would favor the DDR-genes being a predictive marker with improved survival if exposed to these drugs and the new class of drugs, PARP-inhibitors.", "affiliations": "Department of Clinical Genomics, Mayo Clinic, Jacksonville, FL 32224 USA.;Department of Diagnostic and Consultative Medicine, Mayo Clinic, Jacksonville, FL 32224 USA.;Holden Comprehensive Cancer Center, University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242 USA.", "authors": "Macklin-Mantia|Sarah K|SK|0000-0001-5141-3321;Hines|Stephanie L|SL|;Kasi|Pashtoon M|PM|", "chemical_list": null, "country": "Poland", "delete": false, "doi": "10.1186/s13053-020-00148-9", "fulltext": "\n==== Front\nHered Cancer Clin Pract\nHered Cancer Clin Pract\nHereditary Cancer in Clinical Practice\n1731-2302 1897-4287 BioMed Central London \n\n148\n10.1186/s13053-020-00148-9\nResearch\nRetrospective review of outcomes in patients with DNA-damage repair related pancreatic cancer\nhttp://orcid.org/0000-0001-5141-3321Macklin-Mantia Sarah K. Macklin.sarah@mayo.edu 1 Hines Stephanie L. Hines.stephanie@mayo.edu 2 Kasi Pashtoon M. pashtoon-kasi@uiowa.edu 3 1 grid.417467.70000 0004 0443 9942Department of Clinical Genomics, Mayo Clinic, Jacksonville, FL 32224 USA \n2 grid.417467.70000 0004 0443 9942Department of Diagnostic and Consultative Medicine, Mayo Clinic, Jacksonville, FL 32224 USA \n3 grid.214572.70000 0004 1936 8294Holden Comprehensive Cancer Center, University of Iowa, 200 Hawkins Drive, Iowa City, IA 52242 USA \n10 8 2020 \n10 8 2020 \n2020 \n18 1723 4 2020 24 7 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nPatients with DNA-damage response genes (DDR)-related pancreas cancer (BRCA1/2 or other DNA-damage related genes) may have improved outcomes secondary to increased sensitivity to DNA-damaging drugs (platinum chemotherapy/ poly ADP ribose polymerase (PARP)-inhibitors). However, data is scarce pertaining to outcomes in this subset of patients. Our objective was to retrospectively identify DDR-related pancreas cancer patients and report on clinical outcomes.\n\nMethods\nPancreas cancer patients with a germline pathogenic variant in BRCA1/2 or other DDR gene were identified retrospectively through review of medical records (medical genetics/oncology) and genetic testing results at our institution. Data regarding clinical outcomes, therapy received, and survival was subsequently extracted.\n\nResults\nA total of 11 patients with pancreas cancer were identified to carry a pathogenic DDR-variant: BRCA1 (3), ATM (4), BRCA2 (2), PALB2 (1) and FANCC (1). Five of these individuals had prior history of other cancers. Clinically these tumors were localized (4), locally advanced (3), and metastatic (4) at diagnosis. Four out of 11 patients were still alive at time of data review. Survival in the 7 patients who had died was 13.7, 140.0, 20.5, 22.3, 23.5, 25.8, and 111.5 months. All patients with advanced disease had exposure to platinum chemotherapy.\n\nConclusions\nHistorical survival in patients with advanced and metastatic pancreas cancer is poor. Results of this DDR-subset of patients do show significantly superior outcomes, likely secondary to exposure to platinum drugs. This data, alongside other similar cohorts, would favor the DDR-genes being a predictive marker with improved survival if exposed to these drugs and the new class of drugs, PARP-inhibitors.\n\nKeywords\nHereditary cancerPancreatic cancerPlatinum chemotherapyPARP inhibitorsBRCA1/2Genetic testingissue-copyright-statement© The Author(s) 2020\n==== Body\nBackground\nFor years, germline testing for hereditary cancer syndromes was completed largely to provide guidance for future surveillance and provided little to no clinical utility for those already affected with pancreatic cancer. Developments in our understanding of pancreatic cancer pathology opened additional applications for genetic results. Individualized approaches for pancreatic adenocarcinoma receive keen attention as survival rates are among the poorest, with 5-year survival around 8% [1]. Germline and somatic results can influence management recommendations and possibly general prognosis as well.\n\nTreatment alterations can be considered if a cancer shows mismatch repair (MMR) or DNA damage repair (DDR) deficiency [2–5]. Individuals with a DDR-related cancer can include those with a pathogenic, germline or somatic BRCA1/2 variant and other genes within the homologous recombination and Fanconi anemia pathways. This population appears to have better outcomes compared to the general pancreatic cancer population. Median all stage overall pancreatic cancer survival has been reported as 14 months for those with a pathogenic BRCA1/2 variant [6]. For reference, those with metastatic pancreatic cancer generally have an estimated median survival below 6 months [7, 8]. Following clear margin removal of a pancreatic tumor, median survival time increases to around 23 months [8, 9]. Prognosis between those with a BRCA1/2-related pancreatic cancer and those with an apparently sporadic cancer may be more similar if both tumors are resectable [10].\n\nDDR-related pancreatic tumors also appear to have a better response to platinum- based regimens and/or PARP inhibitors [2, 6, 11]. Stage 3 or 4 pancreatic cancer survival increased from 9 to 22 months for those with a BRCA1/2 mutation (P = 0.039) if a platinum-based chemotherapy was introduced into their care [6]. Another study reported median time of survival of 11 months in the BRCA1/2- population (95% CI, 1.5–12) and 23.3 months in BRCA1/2+ group (95% CI, 3.8–30.2) with cisplatin, gemcitabine and veliparib [2]. Others found median survival was 46.6 months for those with a pathogenic BRCA1/2 or PALB2 variant following platinum exposure compared to 23.3 for those without a variant detected [12].\n\nMethods\nThis clinical review was approved by the Mayo Clinic Florida Institutional Review Board (ID:18–006620). The clinical histories of patients with pancreatic adenocarcinoma and a germline pathogenic variant in a hereditary cancer gene were retrospectively reviewed. Patients were identified by the Mayo Clinic Florida Clinical Genomics Department and the Division of Oncology between 2016 and 2018. These patients had not only imaging to confirm their pancreatic cancer diagnoses, but also pathology analysis confirming adenocarcinoma. Patients had been referred to the Clinical Genomics Department due to personal history, family history, and/or a somatic genetic test result suggestive of a hereditary cancer syndrome in accordance with the standard of care for genetic testing at the time. Patients underwent germline genetic testing through various CAP accredited/ CLIA certified commercial genetic testing companies.\n\nResults\nEleven patients with pancreatic cancer were found to carry a hereditary cancer risk. The average age of pancreatic cancer diagnosis of this population was 60.3 years (SD = 15.9). All patients were Caucasian, aside from Patient 11 who was African American. Patient 5 reported possible Ashkenazi Jewish ancestry. Five patients had prior history of cancer [Table 1]. Patients 3, 4, and 11 had a breast cancer diagnosis prior to age 50. Patients 2–6, 8, 9, and 11 had at least 1 first degree relative with pancreatic, breast, ovarian, or prostate cancer, and 6 of those patients had at least 2 of those diagnoses in first degree relatives. In most cases, it was not possible to determine whether the variants had been maternally or paternally inherited. Pathogenic variants detected were within BRCA1 [2], ATM [3], BRCA2 [4], PALB2 [1] and FANCC [1]. Three individuals had variants of uncertain significance (VUSs) reported. Patient 11 had a VUS in PMS2, and Patient 5 had 1 in POLE. Patient 3 had a VUS in RAD50, RAD51C, and SDHB. While some variants had initially been detected through a somatic focused test, all were confirmed to be present in the germline DNA.\nTable 1 Clinical History of Patients with a DDR- related Pancreatic Cancer\n\nPt\tSex\tPrior cancer\tFamily historyh\tDx.\nage\tClinical stage at dx.\tGene\tVariant\tSurvival (mo.)\tSx.\tChemotherapy\t\nDrug\tDuration (mo.)\t\n1\tM\t–\tFDR: Colon (P)\t30–35\tmetastatic\tBRCA1\tc.34C > T\t25.8\tNo\tFOLFIRINOX\t5\t\nSDR: Breast (P), Prostate (M), Renal (M)\tErlotinib\t1\t\nGemcitabine, Nab-Paclitaxel\t6\t\n2\tM\t–\tFDR: Pancreas (P), Prostate (P), Uterine (M)\t55–60\tmetastatic\tBRCA1\tc.5080G > T\t23.5\tYesa\tFOLFIRINOX\t3\t\nGemcitabine, Nab-Paclitaxel\t2\t\nGemcitabine\t2\t\nGemcitabine, Cisplatin\t7\t\n3\tF\tbreast\tFDR: Breast (M), Colon (P)\t40–45\tmetastatic\tATM\tc.2921 + 1G > A\t13.7\tNo\tFOLFIRINOX\t8\t\nSDR: Colon (P)\t\n4\tF\tbilateral breast\tFDR: Breast (M), Colon (P), Ovarian (M)\t50–55\tlocally advanced\tBRCA1\tc.2722G > T\t111.5\tYes\tGemcitabine\t6\t\nFOLFIRINOX\t6\t\nSDR: 3 Breast (P)\tGemcitabine, Nab-Paclitaxel\t1\t\nGemcitabine\t8\t\nFOLXFOX\t6\t\nIrinotecan\t3\t\nNivolumab\t13\t\nNivolumab, Gemcitabine, Carboplatin\t1\t\nNivolumab, Gemcitabine\t2\t\nNivolumab\t1\t\nPARPi (Rucaparib)\t1\t\n5\tF\t–\tFDR: Pancreas (M), Prostate (P)\t60–65\tmetastatic\tATM\tc.7630-2A > C\t20.5\tNo\tFOLFIRINOX\t14\t\nSDR: Breast (M), 2 Pancreas (M), Prostate (P)\tGemcitabine, Cisplatin\t4\t\n6\tM\t–\tFDR: Breast (M), Ovarian (M)\t60–65\tlocally advanced\tBRCA2\tc.9435_9436del\t34.3b\tYesa\tFOLFIRINOX\t2\t\nSDR: 2 Breast (P)\tGemcitabine, Capecitabine\t5\t\n7\tM\tbasal cell carcinoma\tSDR: Bladder (M), Breast (P), Colon (P)\t70–75\tlocally advanced\tFANCC\tc.1642C > T\t22.3\tNo\tGemcitabine, Nab-Paclitaxel\t4\t\nFOLFIRINOX\t7\t\n8\tF\t–\tFDR: Breast (M), Melanoma (M)\t40–45\tlocalized\tPALB2\tc.487_488delGT\t84.4b\tYes\tGemcitabine\t5\t\nSDR: Breast (M)\t\n9\tF\tmelanoma, bladder\tFDR: Breast (M), Melanoma, 2 Pancreatic, Prostate (P)\t80+\tlocalized\tATM\tc.6975 + 2 T > C\t56.6b\tYes\tGemcitabine\t3\t\n10\tM\t–\tFDR: Cholangiocarcinoma\t80+\tlocalized\tATM\tc.2921 + 1G > A\t43.2b\tYes\tGemcitabine\t2\t\nSDR: Glioblastoma\t\n11\tF\tbreast\tFDR: Breast (M), Prostate (P)\t75–80\tlocalized\tBRCA2\tc.1976_1977insSVA\t14.0c\tYes\tGemcitabine\t3\t\nSDR: Breast (M), 4 Prostate (M), Prostate (P)\t\naResectable following chemotherapy. bThese patients have not passed away. cDied due to comorbidities (no recurrence). dFDR: First Degree Relative. eSDR: Second degree relative. f(P): Paternal relative. g(M): Maternal relative. hUnconfirmed cancers/ unconfirmed primaries are not included\n\n\n\nFour tumors were initially localized, 3 locally advanced, and 4 metastatic. At time of diagnosis, 5 of the tumors discovered were resectable, and 2 were deemed resectable only following chemotherapy. Survival for patients initially diagnosed with either metastatic or advanced disease that had died at the time of clinical review measured 13.7, 20.5, 22.3, 23.5, 25.8, and 111.5 months (Fig. 1). All patients with advanced disease had exposure to platinum chemotherapy. Patient 4 had the longest treatment period. Initially, she presented as locally advanced and later had recurrence/metastatic disease for which she received systemic therapy with multiple lines. She passed from fatal pneumonitis secondary to immunotherapy.\nFig. 1 Timeline of survival following diagnosis of pancreatic adenocarcinoma\n\n\n\nDiscussion\nPatients with DDR-related pancreatic cancer had significantly improved survival in our cohort. This contrasts sharply with historical landmark studies of pancreatic cancer where survival ranges between of 6–11 months [13]. Response duration was also significantly longer compared to what has been reported, likely secondary to increased sensitivity to DNA-damaging drugs. The increased survival is comparable to previous research on DDR-related pancreatic cancer cohorts [2, 12].\n\nPatient 11 was the only individual in this population to pass away before the general population median survival time for a similarly staged tumor. Unfortunately, at the time of her pancreatic cancer diagnosis, she had other significant co-morbidities, including end-stage renal disease requiring dialysis. At the time of her passing, there was no evidence of cancer recurrence on MRI or CT.\n\nEstimates vary, but around 5–15% of all patients with pancreatic cancer have a detectable pathogenic DDR-related gene variant, and around 5% have a BRCA1/2 variant specifically [14–16]. The National Comprehensive Cancer Network (NCCN) recommends BRCA1/2 analysis for all diagnosed with pancreatic adenocarcinoma [17]. The significant, potential impact for the patient and their family has led to this approval.\n\nEven with potential, personal benefit, cost can still be a prohibitive factor. Patient 2 had not been able to complete germline testing initially due to high personal cost despite young diagnosis and family history of pancreatic, prostate, and uterine cancer in first degree relatives. Results of circulating tumor DNA (ctDNA) testing and an additional testing platform that reported somatic/ germline status confirmed his germline BRCA1 variant.\n\nIt is less well studied whether other DDR-related gene variants would respond to platinum based chemotherapies and/or PARP-inhibitors in same way as BRCA1/2. BRCA1/2 and PALB2 are known to be associated with an increased risk for pancreatic cancer [18–21]. Evidence supports that risk for pancreatic cancer may be elevated as well in those with a pathogenic ATM variant [22], and BRCA1 is a downstream target of the ATM gene [23]. FANCC is less well characterized and associated with lower penetrance for hereditary cancer risk [17]; limited research suggests an association with pancreatic cancer [24, 25]. The FANCC gene is a DDR-related gene in the Fanconi anemia pathway [26]. Decisions regarding chemotherapy should be weighed and discussed on an individual basis preferably in a molecular tumor board setting. Further research should include these other DDR-related cohorts to explore if they derive similar benefit. It is also important to note that most experts would suggest that cisplatin may be superior as compared to other platinum drugs. Furthermore, irinotecan, which is part of FOLFIRINOX combination chemotherapy, is a DNA-damaging drug (topoisomerase inhibitor). Therefore, the benefit derived in patients who are exposed to FOLFIRINOX is likely from both the irinotecan and the platinum part of the combination chemotherapy.\n\nThe relatively small sample size, large number of resectable tumors, and the retrospective, single-institutional nature of this study with selection bias are all limitations.\n\nConclusions\nOur study corroborates previous studies and expands the literature with inclusion of non-BRCA1/2 genes. This case series does suggest that patients with pancreatic cancer due to DDR-related genes may have better overall outcomes than the general population with pancreatic cancer. Their response to platinum based or other DNA-damaging chemotherapies may be the driving factor. Similar results are being reported from pooled large cohorts from other major academic centers. With universal germline testing now endorsed for pancreatic cancer, data regarding DDR-related pancreatic cancer will significantly increase. For the time being, with platinum-based therapies already approved for these patients, if there is a choice, it would be reasonable to choose a DNA-damaging based therapy and/or participation in some of the PARP-inhibitor trials.\n\nAbbreviations\nMMRMismatch repair\n\nDDRDNA damage repair\n\nMSIMicrosatellite instability\n\nPARPPoly ADP ribose polymerase\n\nVUSVariant of uncertain significance\n\nNCCNNational Comprehensive Cancer Network\n\nctDNACirculating tumor DNA\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nStephanie L. Hines and Pashtoon M. Kasi share senior authorship.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nAll authors participated in the design of the study. SM reviewed and analyzed the patient data regarding the oncologic disease and genetic testing. All authors were major contributors in writing the manuscript. All authors read and approved the final manuscript.\n\nFunding\nNo sources of funding to report.\n\nAvailability of data and materials\nThe dataset generated/ analyzed during the current study are not publicly available as individual privacy could be compromised but are available from the corresponding author on reasonable request.\n\nEthics approval and consent to participate\nThis retrospective, clinical review was approved by the Mayo Clinic Florida Institutional Review Board (ID: 18–006620). It was approved by expedited review procedures (45 CFR 46.110, item 5). The Reviewer conducted a risk-benefit analysis, and determined the study constitutes minimal risk research.\n\nConsent for publication\nNot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Siegel RL Miller KD Jemal A Cancer statistics, 2018 CA Cancer J Clin 2018 68 7 30 10.3322/caac.21442 29313949 \n2. O'Reilly EM Lee JW Lowery MA Capanu M Stadler ZK Moore MJ Phase 1 trial evaluating cisplatin, gemcitabine, and veliparib in 2 patient cohorts: Germline BRCA mutation carriers and wild-type BRCA pancreatic ductal adenocarcinoma Cancer. 2018 124 1374 1382 10.1002/cncr.31218 29338080 \n3. Piklak R Valle JW McNamara MG Germline mutations in pancreatic cancer and potential new therapeutic options Oncotarget 2017 8 73240 73257 10.18632/oncotarget.17291 29069866 \n4. Le DT Durham JN Smith KN Wang H Bartlett BR Aulakh LK Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade Science. 2017 357 409 413 10.1126/science.aan6733 28596308 \n5. Release P. FDA approves first cancer treatment for any solid tumor with a specific genetic feature; https://www.fda.gov/newsevents/newsroom/pressannouncements/ucm560167.htm (2017). Accessed 6 Dec 2018.\n6. Golan T Kanji ZS Epelbaum R Devaud N Dagan E Holter S Overall survival and clinical characteristics of pancreatic cancer in BRCA mutation carriers Br J Cancer 2014 111 1132 1138 10.1038/bjc.2014.418 25072261 \n7. Golan T, Sella T, Margalit O, Amit U, Halpern N, Aderka D, et al. Short and long-term survival in metastatic pancreatic adenocarcioma, 1993-2013. J Natl Compr Cancer Netw. 2017:1022–7. 10.6004/jnccn.2017.0138.\n8. Vincent A Herman J Schulick R Hruban RH Goggins M Pancreatic Cancer Lancet. 2011 378 607 620 10.1016/S0140-6736(10)62307-0 21620466 \n9. Konstantinidis IT Warshaw AL Allen JN Blaszkowsky LS Castillo CF Deshpande V Pancreatic ductal adenocarcinoma: is there a survival difference for R1 resections versus locally advanced unresectable tumors? What is a \"true\" R0 resection? Ann Surg 2013 257 731 736 10.1097/SLA.0b013e318263da2f 22968073 \n10. Golan T Sella T O’Reilly EM Katz MH Epelbaum R Kelsen DP Overall survival and clinical characteristics of BRCA mutation carriers with stage I/II pancreatic cancer Br J Cancer 2017 116 697 702 10.1038/bjc.2017.19 28183138 \n11. Waddell N Pajic M Patch AM Chang DK Kassahn KS Bailey P Whole genomes redefine the mutational landscape of pancreatic cancer Nature. 2015 518 495 501 10.1038/nature14169 25719666 \n12. Yu S, Agarwal P, Mamtani R, Symecko H, Spielman K, O’Hara M, et al. Retrospective survival analysis of patients with resected pancreatic ductal adenocarcinoma and a Germline BRCA or PALB2 mutation. JCO Precision Oncol. 2019. 10.1200/PO.18.00271.\n13. Conroy T Desseigne F Ychou M Bouche O Guimbaud Becouarn Y FOLFIRINOX versus gemcitabine for metastatic pancreatic Cancer N Engl J Med 2011 364 1817 1825 10.1056/NEJMoa1011923 21561347 \n14. Hu C Hart SN Bamlet WR Moore RM Nandakumar K Eckloff BW Prevalence of pathogenic mutations in cancer predisposition genes among pancreatic cancer patients Cancer Epidemiol Biomark Prev 2016 35 207 211 10.1158/1055-9965.EPI-15-0455 \n15. Ryan DP Hong TS Bardeesy N Pancreatic adenocarcinoma N Engl J Med 2014 371 1039 1049 10.1056/NEJMra1404198 25207767 \n16. Shi C Hruban RH Klein AP Familial pancreatic cancer Arch Pathol Lab Med 2009 133 365 374 10.1043/1543-2165-133.3.365 19260742 \n17. Daly MB, Pilarski R, Berry MP, Buys SS, Friedman S, Garber JE, et al. Genetic/ Familial High-Risk Assessment: Breast and Ovarian: Version 3.2019. National Comprehensive Cancer Network (2019). https://www.nccn.org/professionals/physician_gls/pdf/genetics_screening.pdf. Accessed 9 Dec 2019.\n18. Thompson D Easton DF And breast Cancer linkage consortium. Cancer incidence in BRCA1 mutation carriers J Natl Cancer Inst 2002 94 1358 1365 10.1093/jnci/94.18.1358 12237281 \n19. van Asperen CJ Brohet RM Meijers-Heijboer EJ Hoogerbrugge N Verhoef S Vasen HF Cancer risks in BRCA2 families: estimates for sites other than breast and ovary J Med Genet 2005 42 711 719 10.1136/jmg.2004.028829 16141007 \n20. Borecka M Mutation analysis of the PALB2 gene in unselected pancreatic cancer patients in the Czech Republic Cancer Genet 2016 209 5 199 204 10.1016/j.cancergen.2016.03.003 27106063 \n21. Jones S Hruban RH Kamiyama M Borges M Zhang X Parsons DW Exomic sequencing identifies PALB2 as a pancreatic Cancer susceptibility gene Science. 2009 324 217 10.1126/science.1171202 19264984 \n22. Roberts NJ Jiao Y Yu J Kopelovich L Peterson GM Bondy ML ATM mutations in hereditary pancreatic cancer patients Cancer Discov 2012 2 41 46 10.1158/2159-8290.CD-11-0194 22585167 \n23. Lavin MF Delia D Chessa L ATM and the DNA damage response. Workshop on ataxia-telangiectasia and related syndromes EMBO Rep 2006 7 154 160 10.1038/sj.embor.7400629 16439996 \n24. van der Heijden MS Yeo CJ Hruban RH Kern SE Fanconi anemia gene mutations in young-onset pancreatic cancer Cancer Res 2003 63 2585 2588 12750283 \n25. Rogers CD van der Heijden MS Brune K Yeo CJ Hruban RH Kern SE Goggins M The genetics of FANCC and FANCG in familial pancreatic cancer Cancer Biol Ther 2004 3 167 169 10.4161/cbt.3.2.609 14726700 \n26. Donahue SL Campbell C A DNA double strand break repair defect in Fanconi Anemia fibroblasts J Biol Chem 2002 277 46243 46247 10.1074/jbc.M207937200 12361951\n\n", "fulltext_license": "CC BY", "issn_linking": "1731-2302", "issue": "18()", "journal": "Hereditary cancer in clinical practice", "keywords": "BRCA1/2; Genetic testing; Hereditary cancer; PARP inhibitors; Pancreatic cancer; Platinum chemotherapy", "medline_ta": "Hered Cancer Clin Pract", "mesh_terms": null, "nlm_unique_id": "101231179", "other_id": null, "pages": "17", "pmc": null, "pmid": "32793315", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": "25207767;12750283;21561347;25719666;14726700;19260742;21620466;16141007;25072261;26483394;22585167;28596308;29338080;28183138;27106063;16439996;19264984;29069866;29313949;22968073;12237281;12361951", "title": "Retrospective review of outcomes in patients with DNA-damage repair related pancreatic cancer.", "title_normalized": "retrospective review of outcomes in patients with dna damage repair related pancreatic cancer" }
[ { "companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-086532", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "NIVOLUMAB" }, "drugaddi...
{ "abstract": "Amphetamine induced ischaemic colitis is an exceedingly rare presentation of amphetamine toxicity. The cases reported in the literature have described mild or transient disease. We present a fatal case of ischaemic colitis induced by amphetamine use in a 44-year-old woman who presented in extremis after a cardiac arrest en route to the emergency department. A short history of headache, abdominal pain, vomiting and agitation preceded her admission. Imaging revealed changes consistent with ischaemic colitis. Emergency laparotomy revealed widespread colonic necrosis necessitating a subtotal colectomy. Despite aggressive resuscitation and inotropic support from arrival, the patient deteriorated intraoperatively and died in the immediate postoperative period. Histology showed arterial type ischaemia/reperfusion injury of the area supplied by the superior mesenteric artery. The patient's serum amphetamine level was 0.52mg/l (peak therapeutic levels <0.2mg/l). The postmortem examination concluded that amphetamines were the likely cause of the vasospasm, leading to profound colonic ischaemia.", "affiliations": "Royal Liverpool and Broadgreen University Hospitals NHS Trust , UK.;Royal Liverpool and Broadgreen University Hospitals NHS Trust , UK.;Royal Liverpool and Broadgreen University Hospitals NHS Trust , UK.;Royal Liverpool and Broadgreen University Hospitals NHS Trust , UK.", "authors": "Green|P A|PA|;Battersby|Clf|C|;Heath|R M|RM|;McCrossan|L|L|", "chemical_list": "D000661:Amphetamine", "country": "England", "delete": false, "doi": "10.1308/rcsann.2016.0350", "fulltext": null, "fulltext_license": null, "issn_linking": "0035-8843", "issue": "99(7)", "journal": "Annals of the Royal College of Surgeons of England", "keywords": "Amphetamines; Ischaemic Colitis", "medline_ta": "Ann R Coll Surg Engl", "mesh_terms": "D000328:Adult; D000661:Amphetamine; D003082:Colectomy; D017091:Colitis, Ischemic; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D015427:Reperfusion Injury", "nlm_unique_id": "7506860", "other_id": null, "pages": "e200-e201", "pmc": null, "pmid": "28853604", "pubdate": "2017-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "19426289;9800164;1761842;19687384;2054019", "title": "A fatal case of amphetamine induced ischaemic colitis.", "title_normalized": "a fatal case of amphetamine induced ischaemic colitis" }
[ { "companynumb": "GB-SHIRE-GB201723878", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LISDEXAMFETAMINE DIMESYLATE" }, "drugadditional": ...
{ "abstract": "High-dose methotrexate (HDMTX) is a commonly used treatment for hematologic malignancies involving the central nervous system. Two case reports described possible delayed methotrexate clearance in patients receiving concurrent levetiracetam, while a retrospective cohort study did not find this association. The objective of this single-center, retrospective case-control study of 121 patients who received their first cycle of HDMTX was to investigate the association between HDMTX clearance time and concomitant levetiracetam use. The most common diagnosis was primary central nervous system lymphoma (47.9%). The mean HDMTX dose was 4601 mg/m2 (standard deviation [SD], 2052.6 mg/m2 ). Concurrent levetiracetam was administered in 30 of 121 patients (24.8%), with a mean total daily levetiracetam dose of 1434.4 mg (SD, 622.9 mg; range, 900-3000 mg). Baseline characteristics were similar between patients who received concomitant levetiracetam and those who did not. The mean time to methotrexate clearance was 82.5 hours (SD, 51.2; 95% confidence interval, 69.4-95.7) in the concomitant levetiracetam group and 72.4 hours (SD, 31.2; 95% confidence interval, 61.7-83.0) in the nonlevetiracetam group, which was not significantly different (P > .05), even in the subgroup receiving methotrexate doses >3500 mg/m2 . Grade 3 or higher toxicity occurred in 33.3% of the concomitant levetiracetam group and in 34.1% of nonconcomitant levetiracetam patients. This study, which, to our knowledge, is the first examining levetiracetam effect on only the first dose of HDMTX, supports the larger retrospective study finding no significant effect of levetiracetam on HDMTX clearance time, and suggests that administering concomitant levetiracetam does not affect HDMTX toxicity.", "affiliations": "Massachusetts General Hospital Department of Pharmacy, Boston, Massachusetts, USA.;James J. Peters VA Medical Center, New York, New York, USA.;MCPHS University, Boston, Massachusetts, USA.;Massachusetts General Hospital Department of Pharmacy, Boston, Massachusetts, USA.;Massachusetts General Hospital Department of Pharmacy, Boston, Massachusetts, USA.", "authors": "Lou|Uvette|U|;Kwok|Jamie|J|;Nguyen|Thu Anne|TA|;Zhou|Allen|A|;Luk|Samantha O|SO|", "chemical_list": "D000927:Anticonvulsants; D000964:Antimetabolites, Antineoplastic; D000077287:Levetiracetam; D008727:Methotrexate", "country": "England", "delete": false, "doi": "10.1002/jcph.1544", "fulltext": null, "fulltext_license": null, "issn_linking": "0091-2700", "issue": "60(3)", "journal": "Journal of clinical pharmacology", "keywords": "clinical pharmacology; drug-drug interaction; levetiracetam; lymphoma; methotrexate; oncology; therapeutic drug monitoring", "medline_ta": "J Clin Pharmacol", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000927:Anticonvulsants; D000964:Antimetabolites, Antineoplastic; D016543:Central Nervous System Neoplasms; D004334:Drug Administration Schedule; D004347:Drug Interactions; D005260:Female; D019337:Hematologic Neoplasms; D006801:Humans; D000077287:Levetiracetam; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D012189:Retrospective Studies; D055815:Young Adult", "nlm_unique_id": "0366372", "other_id": null, "pages": "324-330", "pmc": null, "pmid": "31729053", "pubdate": "2020-03", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": "18929686;22111860;24259648;22530664;30369593;27511814;27496039;8040679;7250179;19076159;28394433;23129570;31385988;17190914;16734512", "title": "Effect of Levetiracetam on Time to High-Dose Methotrexate Clearance in Patients With Hematologic Malignancies.", "title_normalized": "effect of levetiracetam on time to high dose methotrexate clearance in patients with hematologic malignancies" }
[ { "companynumb": "US-UCBSA-2019051916", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "METHOTREXATE" }, "drugadditional": "3", "...
{ "abstract": "BACKGROUND\nWe describe a patient with blastic plasmacytoid dendritic cell neoplasm with central nervous system involvement and the outcome of venetoclax use in this setting.\n\n\nMETHODS\nA 54-year-old Caucasian male was referred to the Haematology Unit with an enlarged inguinal lymph node which was diagnostic of a blastic plasmacytoid dendritic cell neoplasm. The staging revealed disseminated disease (skin, visceral, lymph nodes, and bone marrow). He received chemotherapy with an acute myeloid leukaemia-like regime. Afterwards, he underwent allogeneic haematopoietic stem cell transplantation, though it was not successful, showing a relapse 14 months later with hepatic and central nervous system dissemination. Intrathecal chemotherapy was administered, and venetoclax (anti-bcl2 agent) was started in an off-label indication based on most recent literature. The disease halted its course for 3 months. In the end, the patient's disease progressed and so he succumbed due to infectious complications.\n\n\nCONCLUSIONS\nVenetoclax monotherapy seems not enough to control the disease progression under CNS involvement and other treatments should be investigated.", "affiliations": "Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain. nilalbiol@gmail.com.;Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain.;Pathology Department. Hospital de la Santa Creu i Sant Pau, Barcelona, Spain.;Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain.;Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain.;Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain.", "authors": "Albiol|Nil|N|http://orcid.org/0000-0003-2942-1362;Novelli|Silvana|S|;Mozos|Anna|A|;Pratcorona|Marta|M|;Martino|Rodrigo|R|;Sierra|Jorge|J|", "chemical_list": "D019086:Bridged Bicyclo Compounds, Heterocyclic; D013449:Sulfonamides; C579720:venetoclax", "country": "England", "delete": false, "doi": "10.1186/s13256-021-02939-7", "fulltext": "\n==== Front\nJ Med Case Rep\nJ Med Case Rep\nJournal of Medical Case Reports\n1752-1947\nBioMed Central London\n\n2939\n10.1186/s13256-021-02939-7\nCase Report\nVenetoclax in relapsed/refractory blastic plasmacytoid dendritic cell neoplasm with central nervous system involvement: a case report and review of the literature\nhttp://orcid.org/0000-0003-2942-1362\nAlbiol Nil nilalbiol@gmail.com\n\n1\nNovelli Silvana 12\nMozos Anna 3\nPratcorona Marta 12\nMartino Rodrigo 12\nSierra Jorge 12\n1 grid.413396.a 0000 0004 1768 8905 Haematology Department. Hospital de la Santa Creu i Sant Pau, Mas Casanovas 90, Barcelona, Spain\n2 grid.429289.c Josep Carreras Leukaemia Research Institute (Hospital Sant Pau Campus), Barcelona, Spain\n3 grid.413396.a 0000 0004 1768 8905 Pathology Department. Hospital de la Santa Creu i Sant Pau, Barcelona, Spain\n26 6 2021\n26 6 2021\n2021\n15 32622 1 2021\n1 6 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nWe describe a patient with blastic plasmacytoid dendritic cell neoplasm with central nervous system involvement and the outcome of venetoclax use in this setting.\n\nCase presentation\n\nA 54-year-old Caucasian male was referred to the Haematology Unit with an enlarged inguinal lymph node which was diagnostic of a blastic plasmacytoid dendritic cell neoplasm. The staging revealed disseminated disease (skin, visceral, lymph nodes, and bone marrow). He received chemotherapy with an acute myeloid leukaemia-like regime. Afterwards, he underwent allogeneic haematopoietic stem cell transplantation, though it was not successful, showing a relapse 14 months later with hepatic and central nervous system dissemination. Intrathecal chemotherapy was administered, and venetoclax (anti-bcl2 agent) was started in an off-label indication based on most recent literature. The disease halted its course for 3 months. In the end, the patient’s disease progressed and so he succumbed due to infectious complications.\n\nConclusions\n\nVenetoclax monotherapy seems not enough to control the disease progression under CNS involvement and other treatments should be investigated.\n\nKeywords\n\nBlastic plasmacytoid dendritic cell neoplasm\nBcl-2\nVenetoclax\nBPDCN\nissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\n\nBlastic plasmacytoid dendritic cell neoplasm (BPDCN) is an aggressive haematological malignancy which frequently presents with skin, bone marrow (BM), lymph node, and splenic infiltration at a median age of 67 years. Central nervous system (CNS) involvement and circulating leukaemia cells might be present (10%) [1]. There is no standard therapy, and patients frequently receive acute myeloid leukaemia (AML)-like regimens or are enrolled in clinical trials [2]. For patients who respond to chemotherapy, autologous or preferably allogeneic haematopoietic stem cell transplant (allo-HSCT) may prolong survival [3]. However, the median survival is approximately 1 year or even shorter for patients with disseminated disease. Age >60 years, abnormal karyotype and TdT negativity are some prognostic factors which have recently been associated with a lower overall survival [4].\n\nA gene expression analysis suggested that BPDCN was similar to AML on a molecular expression basis, and identified that the anti-apoptotic B-cell lymphoma 2 (BCL2) gene is highly expressed in BPDCN compared to normal plasmacytoid dendritic cells. BCL2 is also expressed in AML, and recently it has been reported that some cases of AML are sensitive to the Bcl-2 inhibitor venetoclax [5].\n\nWe present the case of a patient diagnosed with BPDCN that relapsed after allo-HSCT; venetoclax was considered the best therapeutic option based on recently published data.\n\nCase presentation\n\nA 54-year-old Caucasian male with a history non-ST elevation myocardial infarction in 2015 was diagnosed with blastic plasmacytoid dendritic cell neoplasm in July 2016 due to an inguinal tumor. At the time of diagnosis a positron emission tomography (PET/CT) scan had revealed subcentimeter mildly hypermetabolic adenopathies in various territories (multiple lymph nodes involvement, hepatic, and splenic infiltration). He also had small skin plaques in lower extremities. The ganglion biopsy had shown an infiltration of 56% of atypical lymphocytes and peripheral blastosis, with a paracortical infiltration by Tdt+ cells, without expression of B or T markers while CD123 and CD56 had resulted positive, and a Ki-67 index of 60%, with negativity for CD34, CD3, CD20, myeloperoxidase, lysozyme. BM aspiration resulted dry and immunophenotype showed an abnormal CD4+, CD45weak, CD56+, CD123+ and HLA-DR+ cells (dendritic cells). BPDCN is characterized by high levels of CD123 and weak expression of CD45, while also being positive for CD4, CD36, CD56, as well as absence of lineage-associated antigens; this is considered a unique phenotype virtually pathognomonic of BPDCN [6].\n\nHe received 2 cycles of hyper-CVAD without intrathecal therapy (cyclophosphamide 300 mg/m2 BID days 1–4, vincristine 2 mg days 4 and 11, doxorubicin 25 mg/m2 q24h days 4–5, dexamethasone 40 mg QD days 1–4 and 8–11, methotrexate 1 g/m2 day 1, and cytarabine 3 g/m2 BID days 2–3) from July 2016 to November 2016, after which persisted a blast count of 11% in the bone marrow (partial response –PR-). The main complication was pulmonary oedema due to ventricular dysfunction secondary acute myocardial infarction which required implantation of a drug-coated stent on the circumflex artery. He continued with an AML-like scheme with high doses of ara-C (3 g/m2 days 1, 3 and 5) in December 2016, achieving a complete response (CR) assessed by BM biopsy and PET/CT.\n\nTherefore, given the high risk of recurrence and the availability of an identical human leucocyte antigen (HLA) sibling, on March 2017 he underwent a reduced-intensity allo-HSCT (due to the history of two myocardial infarctions), conditioned with fludarabine 52 mg/day and busulfan 66 mg q6h plus graft-vs-host disease (GvHD) prophylaxis with sirolimus and tacrolimus. The number of haematopoietic stem cells infused was 5.02 x106 CD34/Kg. One month after transplant, April 2017, a BM biopsy was performed showing CR. He developed mild skin chronic GvHD, which did not avoid immunosuppressant suspension until 6 months after allo-HSCT.\n\nNevertheless, 1 year later, March 2018, on a control PET/CT nonspecific hepatic lesions were evidenced (Fig. 1A), later confirmed by magnetic resonance imaging -MRI- (Fig. 2A) and tru-cut biopsy (Fig. 3); he then received intermediate dose ara-C (1.5 g/m2 days 1–5) and first infusion of donor lymphocytes on May 2018. One month after treatment start, a PET/CT and hepatic MRI (Fig. 2B) showed progression of one of the hepatic lesions and later on that same week he consulted with a short history of oppressive headache, photophobia, and tinnitus, without additional neurological symptoms. He also referred blurred vision lasting a few minutes and an episode of amaurosis fugax. The headache worsened with decubitus and improved with sitting. Analgesic treatment was optimised without improvement, so he consulted again the day after.Fig. 1 A PET/CT scan with non-specific hepatic lesions (March 2018). B PET/CT scan showing progression and liver enlargement under venetoclax treatment (September 2018)\n\nFig. 2 A Initial MRI showing liver spread of the disease (March 2018). Hepatic lesions were identified in segments VII and VIII of the liver. B Progression of the hepatic lesions. C Stability of the hepatic lesions under venetoclax treatment (August 2018)\n\nFig. 3 Histological sections of the liver biopsy showed a nodular infiltrate of blast cells, with ample cytoplasm, irregular nuclei and small nucleoli. There were occasional small lymphocytes intermingled with neoplastic cells. Tumour cells were diffusely positive for TdT, CD43 and CD56, as well as CD123. Only heterogeneous expression of CD4 was observed. A Nodular infiltration of the liver by blast cells. B Neoplastic cells show diffuse immunoreactivity for CD123. C Positive immunoreactivity for bcl-2. D Occasional intense positivity for p53 (less than 3%)\n\nWith suspicion of CNS dissemination, a cerebral CT scan was performed, which showed signs of leptomeningeal spread. A lumbar puncture was executed with a high-pressure fluid outlet, so the procedure was suspended due to the risk of intracranial hypertension.\n\nFollowing the presumptive diagnosis of intracranial hypertension due to CNS dissemination of his leukaemia, dexamethasone (8 mg TID) was started and a new lumbar puncture was performed three days later administering triple intrathecal chemotherapy (methotrexate 12 mg, ara-C 30 mg, hydrocortisone 20 mg) thrice in July 2018. In cerebrospinal fluid (CSF), 1025 atypical cells were shown, compatible with dissemination of dendritic cell leukaemia (Fig. 4).Fig. 4 Cerebrospinal fluid smear (May-Grünwald-Giemsa staining) showing massive blast cell infiltration of the central nervous system. Lower right quadrant detail: zoom-in of blasts morphology in CNS. Upper right quadrant detail: blast morphology in peripheral blood. Blast cells are of large size and show a monocytic appearance, with irregular nuclei shape and some of them with nucleoli\n\nA week after, the 2nd dose was administered and a total of 165 cells were obtained. Three days after the 3rd dose was given obtaining 15 cells. No more CSF analysis was performed. All in all, 6 doses were given.\n\nAfter extensive review of literature and based on other cases previously reported [5, 7–10], taking into account that malignant cells had a high expression of bcl-2 (Fig. 3C), venetoclax off-label was begun in an ascending scheme. The patient agreed to this off-label use. He started at a dose of 50 mg QD (July 2018) and gradually increased it up to 800 mg QD. After two months under treatment, on August 2018 an hepatic MRI was performed showing stability (Fig. 2C). However, on September 2018 a routine blood test suggested progression as liver enzymes and lactate dehydrogenase (LDH) increased while platelet levels went down. It was followed by a new BM aspirate and PET/CT, which confirmed progression under venetoclax treatment (Fig. 1B).\n\nA palliative strategy was adopted, stopping venetoclax and starting hydroxyurea, azacytidine and dexamethasone. The patient eventually died one month and a half after stopping the treatment with venetoclax, on October 2018.\n\nA post-mortem next generation sequencing (NGS) study was performed on the liver biopsy using the TruSight®Tumor 15 (Illumina) kit, which analyses the following 15 genes: AKT1, BRAF, EGFR, ERBB2, FOXL2, GNA11, GNAQ, KIT, KRAS, MET, NRAS, PDGFRA, PIK3CA, RET, and TP53. The bioinformatics analysis was performed through the software Variant Studio, focusing on these regions: KRAS (exons 2, 3, and 4), NRAS (exons 2, 3, and 4), BRAF (exon 15), EGFR (exons 18, 19, 20, and 21), PIK3CA (exons 10 and 21). None of them was mutated. However, a mutation in the exon 7 of TP53 (p.Gly245Ser, g. 7577548, c.733G>A) was found in 57,4% of the samples.\n\nThe tru-cut biopsy had already showed intense expression of p53 in few cells that should be related to that mutation found in the NGS analysis, presumably correlating to a malfunctioning p53 protein, and thus leading to a poorer prognosis.\n\nDiscussion and conclusions\n\nCurrently, the pathogenesis underlying the transformation of haematopoietic progenitors to BPDCN remains unclear. Using targeted sequencing techniques, some genes (e.g. ASXL1, TP53, TET2) have been found to be mutated in BPDCN as well as in other myeloid malignancies [7]. However, none was specific of BPDCN.\n\nVenetoclax is a bcl-2 inhibitor currently authorised to treat chronic lymphocytic leukaemia (CLL). BPDCN also shows BCL2 gene overexpression and TP53 mutation [7]. Following this reasoning, it has been tested on BPDCN with favourable outcomes [5, 7, 8]. Montero et al. first described promising results with venetoclax both in vitro and in vivo (through xenografts) [7]. They also proved in mice an overall survival of 21 days.\n\nAt the time of giving venetoclax to our patient, there were 6 cases reported: one by Agha et al. [10] two also by Montero et al. [7] two by DiNardo et al. [5] and one by Grushchak et al. [8]. The first one responded very fast and maintained complete response for at least 9 months reported [10]. The two reported by Montero et al. had relapsed disease after CD123-targeting therapy and achieved a partial response at 4 weeks of venetoclax treatment: one of them progressed after 12 weeks and the other one died from intracranial haemorrhage probably secondary to severe venetoclax-induced thrombocytopaenia; the two included in DiNardo’s trial had received more than 2 prior lines of therapy and achieved cutaneous response with venetoclax; the remaining one relapsed after CHOP and auto-HSCT, after which received venetoclax achieving a CR during 10 months. Only in one of them a PET/CT response and >50% of blast reduction in bone marrow were reported.\n\nWhen comparing these patients to ours, the median age was older (73,4), neither of them had CNS involvement nor were treated with allo-HSCT. Furthermore, in all the 5 cases specific techniques were used to predict bcl-2 inhibition response. Although we could not perform any of these techniques at the relapse, we decided to try it out in our patient, as the malignant cells overexpressed bcl-2 in the previous hepatic biopsy. The disease halted its course for two months. After that, it was reactivated reactivated. For that reason, venetoclax therapy was stopped.\n\nEven though the patient had CNS disease, during venetoclax treatment period no neuroimaging techniques were performed. However, he did not show neurologic symptoms. Albeit venetoclax’s role in CNS has not been specifically studied, mainly because CLL rarely involves CNS, and there are no tests available in our centre to measure its concentration in CSF, there is evidence that suggests it can get to the CNS, though this has only been proved in mice [9].\n\nAlthough disease progression stopped for two months, better results have been achieved in the previously described case reports. This may be due to the addition of a hypomethylating agent in some of them or due to the clinical features of the patients. We did not add a hypomethylating agent because at that time there was little evidence of its efficacy in combination therapy in BPDCN. Thus, the fact that neither of them presented CNS disease suggests a less aggressive subset of BPDCN. Moreover, as they were not treated with allo-HSCT, the disease might be more chemo-sensitive, considering they received less intense chemotherapy regimens. In fact, the patient who showed a CR of 10 months had only been treated with CHOP and auto-HSCT, whereas our patient received hyper-CVAD, AML-like scheme and reduced intensity conditioning regime for allo-HSCT plus intrathecal therapy. There is also the possibility that our patient’s disease was not fully sensitive to venetoclax, as we did not perform a bcl-2 overexpression test at relapse.\n\nAt the time of writing this paper, more results of venetoclax use are available. In another case report by Beziat et al., the patient did not exhibit a very good response, as some cutaneous lesions remained stable while others responded [11]. Then, two other papers in combination therapy with hypometilating agents report pretty good results, with rapid and durable responses [12, 13]. A summary of cases in which venetoclax was used, including ours, is available in Table 1.Table 1. Summary of cases available in the literature that used venetoclax in BPDCN\n\nStudy\tN\tMedian age\tMedian previous lines\tAdded treatments\tType of response\tMax. duration of response\tFollow-up\t\nGrushchak et al. Medicine (2017)[8]\t1\t65\t2\tNo\tCR\t>10 months\t10 months\t\nMontero et al. Cancer Discov. (2017)[7]\t2\t76,5\t3\tNo\tPR\t4 weeks\tUntil death\t\nDiNardo et al. Am J Hematol. (2018)[5]\t2\t74,5\t3\tYes, NR but probably HMA or LDAC\tCR/PR\tNR\tNR\t\nAgha et al. N Engl J Med. (2018)[10]\t1\t62\t4\tNo\tCR\t>9 months\t9 months\t\nBeziat et al. Leuk Res. (2019)[11]\t1\t77\t1\tNo\tPR\t1 month\tNR\t\nPiccini et al. Ann Hematol. (2020)[12]\t1\t64\t2\tAzacitidine\tCR\t>11 months\t11 months\t\nSamhouri et al. J Oncol Pharm Pract. (2020)[13]\t1\t79\t1\tAzacitidine\tPR\t>6 months\t6 months\t\nAlbiol et al. J Med Case Rep. (2021)\t1\t54\t4 plus intrathecal therapy\tNo\tPR\t3 months\tUntil death\t\nCR complete response, PR partial response, NR not reported, HMA hypomethylating agent, LDAC low-dose ara-C\n\nTaking everything into account, there is limited bibliography available involving blastic plasmacytoid dendritic cell neoplasms, and the treatment regimens are not based on the strongest level of evidence [1, 2]. Moreover, few cases are diagnosed each year and the survival rate of them is little to nothing.\n\nThe best therapeutic option for a newly diagnosed case of BPDCN is to be enrolled in a clinical trial or, if not available, to receive acute lymphoblastic leukaemia (ALL)-like regimens, AML-like regimens or a combination of both followed by an allo-HSCT if eligible. No statistical differences have been observed between using an ALL-like regime against an AML-like one [2]. However, a recent analysis by the MSKCC and two other US centres found statistically significant differences between ALL and AML-like regimens, suggesting a better overall survival (OS) if an ALL-like regime was used [4].\n\nAs of clinical trials, there are different approaches being tested right now. The most innovative seem to be those targeting CD123 (interleukin-3 receptor), as it is quite specific of blastic plasmacytoid dendritic cells. One of the most promising trials is a diphtheria toxin and IL-3 fusion protein -Tagraxofusp (Tagrax®)- also known as SL-401 [14, 15]. It is a CD-123 directed cytotoxin which has shown high response rates at the cost of little toxicity, so it enlightens the future of BPDCN management. It was approved by the Food and Drug Administration (FDA) in December 2018 and it is now recommended as a first line induction regime (evidence grade 2C) [16].\n\nThere are also antibodies against CD-123 (e.g. IMGN632, a CD123-Targeting Antibody-Drug Conjugate (ADC) with a deoxyribonucleic acid (DNA)-Alkylating Payload) and CAR-T cells [17], which are showing promising results but are still on preclinical phase due to safety profile issues [18].\n\nOther promising agents include pralatrexate, an antifolate drug used in 8 patients with BPDCN achieving an overall response rate of 75% and 4 of them reaching complete response, and enasidenib, an IDH2 inhibitor which halted disease progression for 8 months in a patient with IDH2 mutation [4].\n\nAll in all, evidence suggests that venetoclax in combination with hypomethylating agents could be useful in some BPDCN patients, but in advanced stages it shows little efficacy, especially if it is used alone. Nevertheless, further studies are needed to demonstrate its real role. Currently, there is an on-going clinical trial (NCT03485547) which is trying to give more answers. Moreover, considering the infrequency of this disease it is unlikely that in the nearly following years we can get any strong evidence about it.\n\nAbbreviations\n\nBPDCN Blastic plasmacytoid dendritic cell neoplasm\n\nBM Bone marrow\n\nCNS Central nervous system\n\nAML Acute myeloid leukaemia\n\nallo-HSCT Allogeneic haematopoietic stem cell transplant\n\nDNA Deoxyribonucleic acid\n\nPET/CT Positron emission tomography/computerised tomography scan\n\nPR Partial response\n\nCR Complete response\n\nFDA Food and Drug Administration\n\nGVHD Magnetic resonance imaging (MRI)\n\nHLA Human leucocyte antigen\n\nTID Ter in die\n\nCSF Cerebrospinal fluid\n\nQD Quaque die\n\nBID Bis in die\n\nNGS Next Generation Sequencing\n\nCLL Chronic Lymphocytic Leukaemia\n\nALL Acute lymphoblastic leukaemia\n\nMSKCC Memorial Sloan Kettering Cancer Center\n\nOS Overall survival\n\nADC Antibody-Drug Conjugate\n\nCAR-T cells Chimeric Antigen Receptor T cells\n\nAcknowledgements\n\nNot applicable.\n\nAuthors' contributions\n\nNA gathered the data and wrote the main text of the report. SN reviewed and corrected the manuscript, and she also was the main physician in charge of the treatment decisions. AM performed the histological analysis of the biopsies’ samples. MP performed and interpreted the molecular analysis of the sample. RM performed the research involving this patient’s clinical decisions. JS reviewed and corrected the manuscript. Consent for publication was obtained from all of the authors. All authors read and approved the final manuscript.\n\nFunding\n\nNo funding was granted for this research.\n\nAvailability of data and materials\n\nData sharing is not applicable to this article as no datasets were generated or analysed during the current study.\n\nDeclarations\n\nEthics approval and consent to participate\n\nThis report has been approved by the Ethics Committee of Hospital de la Santa Creu i Sant Pau and all of the research has been performed in accordance with the Declaration of Helsinki.\n\nConsent for publication\n\nWritten informed consent was obtained from the patients for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\n\nThe authors declare no conflicts of interests.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Kerr D Zhang L Sokol L Blastic plasmacytoid dendritic cell neoplasm Curr Treat Options Oncol 2019 20 1 9 10.1007/s11864-019-0605-x 30715612\n2. Poret E Vidal C Desbrosses Y Angelot Delettre F Pagadoy M Pugin A How to treat blastic plasmacytoid dendritic cell neoplasm (BPDCN) Patients : results on 86 patients of the French BPDCN Network Blood. 2015 126 23 10.1182/blood.V126.23.23.23\n3. Kharfan-Dabaja MA Al Malki MM Deotare U Raj RV El-Jurdi N Majhail N Haematopoietic cell transplantation for blastic plasmacytoid dendritic cell neoplasm: a North American multicentre collaborative study Br J Haematol 2017 179 5 781 789 10.1111/bjh.14954 28980314\n4. Taylor J Haddadin M Upadhyay VA Grussie E Mehta-Shah N Brunner AM Multicenter analysis of outcomes in blastic plasmacytoid dendritic cell neoplasm offers a pre-targeted therapy benchmark Blood. 2019 134 8 678 87 10.1182/blood.2019001144 31243042\n5. DiNardo CD Rausch CR Benton C Kadia T Jain N Pemmaraju N Clinical experience with the BCL2-inhibitor venetoclax in combination therapy for relapsed and refractory acute myeloid leukemia and related myeloid malignancies Am J Hematol 2018 93 3 401 407 10.1002/ajh.25000 29218851\n6. Steven H. Swerdlow, Elias Campo, Nancy Lee Harris. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. 4th ed. Steven H. Swerdlow, Elias Campo, Nancy Lee Harris, Elaine S. Jaffe, Stefano A. Pileri, Harald Stein, et al., editors. Vol. 2. Lyon: International Agency for Research on Cancer (IARC); 2017.\n7. Montero J Stephansky J Cai T Griffin GK Cabal-Hierro L Togami K Blastic plasmacytoid dendritic cell neoplasm is dependent on BCL-2 and sensitive to venetoclax Cancer Discov. 2017 7 2 156 10.1158/2159-8290.CD-16-0999 27986708\n8. Grushchak S Joy C Gray A Opel D Speiser J Reserva J Novel treatment of blastic plasmacytoid dendritic cell neoplasm: a case report Medicine (Baltimore). 2017 96 51 e9452 10.1097/MD.0000000000009452 29390581\n9. Reda G Cassin R Dovrtelova G Matteo C Giannotta J D’Incalci M Venetoclax penetrates in cerebrospinal fluid and may be effective in CLL with central nervous system involvement Haematologica. 2019 104 5 e222 10.3324/haematol.2018.213157 30765472\n10. Agha ME Monaghan SA Swerdlow SH Venetoclax in a Patient with a Blastic Plasmacytoid Dendritic-Cell Neoplasm N Engl J Med. 2018 379 15 1479 81 10.1056/NEJMc1808354 30304659\n11. Beziat G Ysebaert L Gaudin C Steinmeyer Z Balardy L Venetoclax to treat relapsed blastic plasmacytoid dendritic cell neoplasm: a case-report and review of literature Leukemia Research. 2019 85 106199 10.1016/j.leukres.2019.106199 31415942\n12. Piccini M Loscocco GG Gianfaldoni G Grieco P Palmieri G Pilerci S Quick complete response achievement with venetoclax and azacitidine in a case of relapsed disseminated blastic plasmacytoid dendritic cell neoplasm Ann Hematol. 2020 99 907 9 10.1007/s00277-020-03939-1 32030448\n13. Samhouri Y Ursu S Dutton N Tanvi V Fazal S Tagraxofusp followed by combined azacitidine and venetoclax in blastic plasmacytoid dendritic cell neoplasm: a case report and literature review J Oncol Pharm Pract. 2020 10.1177/1078155220951850 32847479\n14. Frankel AE Woo JH Ahn C Pemmaraju N Medeiros BC Carraway HE Activity of SL-401, a targeted therapy directed to interleukin-3 receptor, in blastic plasmacytoid dendritic cell neoplasm patients Blood 2014 124 3 385 392 10.1182/blood-2014-04-566737 24859366\n15. Pemmaraju N Sweet KL Lane AA Stein AS Vasu S Blum W Results of Pivotal Phase 2 Trial of SL-401 in Patients with Blastic Plasmacytoid Dendritic Cell Neoplasm (BPDCN) Blood. 2017 130 Suppl 1 1 28684444\n16. Pemmaraju N Lane AA Sweet KL Stein AS Vasu S Blum W Tagraxofusp in blastic plasmacytoid dendritic-cell neoplasm N Engl J Med 2019 380 17 1628 1637 10.1056/NEJMoa1815105 31018069\n17. Kovtun Y Jones GE Adams S Harvey L Audette CA Wilhelm A A CD123-targeting antibody-drug conjugate, IMGN632, designed to eradicate AML while sparing normal bone marrow cells Blood Adv 2018 2 8 848 858 10.1182/bloodadvances.2018017517 29661755\n18. Arcangeli S Rotiroti MC Bardelli M Simonelli L Magnani CF Biondi A Balance of anti-CD123 chimeric antigen receptor binding affinity and density for the targeting of acute myeloid leukemia Mol Ther 2017 25 8 1933 1945 10.1016/j.ymthe.2017.04.017 28479045\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "15(1)", "journal": "Journal of medical case reports", "keywords": "BPDCN; Bcl-2; Blastic plasmacytoid dendritic cell neoplasm; Venetoclax", "medline_ta": "J Med Case Rep", "mesh_terms": "D019086:Bridged Bicyclo Compounds, Heterocyclic; D002490:Central Nervous System; D003713:Dendritic Cells; D006801:Humans; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D012878:Skin Neoplasms; D013449:Sulfonamides", "nlm_unique_id": "101293382", "other_id": null, "pages": "326", "pmc": null, "pmid": "34172079", "pubdate": "2021-06-26", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "32030448;28479045;32847479;24859366;28980314;31243042;31415942;30765472;30715612;30304659;27986708;31018069;29661755;29390581;29218851", "title": "Venetoclax in relapsed/refractory blastic plasmacytoid dendritic cell neoplasm with central nervous system involvement: a case report and review of the literature.", "title_normalized": "venetoclax in relapsed refractory blastic plasmacytoid dendritic cell neoplasm with central nervous system involvement a case report and review of the literature" }
[ { "companynumb": "ES-ABBVIE-21K-144-3971275-00", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "SIROLIMUS" }, "drugadditional": null, ...
{ "abstract": "Leptospirosis is a zoonosis found worldwide, with an incidence that is approximately 10 times higher in the tropics than in temperate regions. The main reservoir of leptospirosis is the rat and human infection usually results from exposure to infected animal urine or tissues. Only 10% of cases are symptomatic. We present here two confirmed and two probable cases of leptospirosis in a family returning from whitewater rafting in Thailand, illustrating the wide variety of the clinical manifestations of this infection. Two of the patients were hospitalized and presented a probable Jarisch-Herxheimer reaction after initiation of beta-lactam therapy. The two others patients were treated empirically with doxycycline. We discuss here some relevant aspects of the epidemiology, clinical manifestations, therapy and the challenge of an early diagnosis of leptospirosis.", "affiliations": null, "authors": "Gallardo|C|C|;Williams-Smith|J|J|;Jaton|K|K|;Asner|S|S|;Cheseaux|J-J|JJ|;Troillet|N|N|;Manuel|O|O|;Berthod|D|D|", "chemical_list": "D000900:Anti-Bacterial Agents; D047090:beta-Lactams; D004318:Doxycycline", "country": "Switzerland", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1660-9379", "issue": "11(470)", "journal": "Revue medicale suisse", "keywords": null, "medline_ta": "Rev Med Suisse", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000818:Animals; D000900:Anti-Bacterial Agents; D004318:Doxycycline; D005260:Female; D006801:Humans; D007922:Leptospirosis; D008297:Male; D011998:Recreation; D045483:Rivers; D013785:Thailand; D014195:Travel; D015047:Zoonoses; D047090:beta-Lactams", "nlm_unique_id": "101219148", "other_id": null, "pages": "872-6", "pmc": null, "pmid": "26050305", "pubdate": "2015-04-15", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article", "references": null, "title": "Leptospirosis in a family after whitewater rafting in Thailand.", "title_normalized": "leptospirosis in a family after whitewater rafting in thailand" }
[ { "companynumb": "CH-TEVA-594615ISR", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "MEROPENEM" }, "drugadditional": null, "drug...
{ "abstract": "A 53-year-old woman was hospitalized due to septic shock after developing pneumococcal pneumonia after undergoing esophageal cancer surgery. Her transverse colon became perforated after receiving antimicrobial chemotherapy; therefore, emergency subtotal colectomy was performed. Fungi detected in both her colon tissue and a drainage sample indicated intestinal mucormycosis. Early intensive treatment with high-dose liposomal amphotericin B was successful, and she was subsequently discharged from the hospital. The fungal isolates were identified to be Lichtheimia ramosa and Aspergillus calidoustus via gene sequencing using panfungal primers as well as species-specific primers against elongation factor 1 and beta-tubulin for detecting Lichtheimia and Aspergillus, respectively.", "affiliations": "Department of Bacteriology, Osaka City University Graduate School of Medicine, Japan.;Department of Bacteriology, Osaka City University Graduate School of Medicine, Japan.;Department of Infection Control Center, Osaka Police Hospital, Japan.;Clinical Laboratory Center, Osaka Police Hospital, Japan.;Department of Bacteriology, Osaka City University Graduate School of Medicine, Japan.;Research Center for Infectious Disease Sciences, Osaka City University Graduate School of Medicine, Japan.;Research Center for Infectious Disease Sciences, Osaka City University Graduate School of Medicine, Japan.;Department of Infection Control Center, Osaka Police Hospital, Japan.", "authors": "Kaneko|Yukihiro|Y|;Oinuma|Ken-Ichi|KI|;Terachi|Tsuneko|T|;Arimura|Yasuaki|Y|;Niki|Mamiko|M|;Yamada|Koichi|K|;Kakeya|Hiroshi|H|;Mizutani|Tetsu|T|", "chemical_list": "D000935:Antifungal Agents; C068538:liposomal amphotericin B; D000666:Amphotericin B", "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.0254-17", "fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 2952694210.2169/internalmedicine.0254-17Case ReportSuccessful Treatment of Intestinal Mycosis Caused by a Simultaneous Infection with Lichtheimia ramosa and Aspergillus calidoustus Kaneko Yukihiro 12Oinuma Ken-Ichi 12Terachi Tsuneko 3Arimura Yasuaki 4Niki Mamiko 12Yamada Koichi 25Kakeya Hiroshi 25Mizutani Tetsu 3\n1 Department of Bacteriology, Osaka City University Graduate School of Medicine, Japan\n2 Research Center for Infectious Disease Sciences, Osaka City University Graduate School of Medicine, Japan\n3 Department of Infection Control Center, Osaka Police Hospital, Japan\n4 Clinical Laboratory Center, Osaka Police Hospital, Japan\n5 Department of Infection Control Science, Osaka City University Graduate School of Medicine, JapanCorrespondence to Dr. Yukihiro Kaneko, ykaneko@med.osaka-cu.ac.jp\n\n9 3 2018 15 8 2018 57 16 2421 2424 21 9 2017 5 1 2018 Copyright © 2018 by The Japanese Society of Internal Medicine2018The Internal Medicine is an Open Access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).A 53-year-old woman was hospitalized due to septic shock after developing pneumococcal pneumonia after undergoing esophageal cancer surgery. Her transverse colon became perforated after receiving antimicrobial chemotherapy; therefore, emergency subtotal colectomy was performed. Fungi detected in both her colon tissue and a drainage sample indicated intestinal mucormycosis. Early intensive treatment with high-dose liposomal amphotericin B was successful, and she was subsequently discharged from the hospital. The fungal isolates were identified to be Lichtheimia ramosa and Aspergillus calidoustus via gene sequencing using panfungal primers as well as species-specific primers against elongation factor 1 and beta-tubulin for detecting Lichtheimia and Aspergillus, respectively. \n\nintestinal mucormycosisLichtheimia ramosaAspergillus calidoustuszygomycosisfungal infection\n==== Body\nIntroduction\nMucormycosis, previously called zygomycosis, is a life-threatening infection caused by filamentous fungi that belong to the order Mucorales. Mucormycosis mainly occurs in immunocompromised individuals, and most commonly affects the sinuses or lungs following the inhalation of fungal spores. Gastrointestinal mucormycosis is relatively rare and accounts for only 4-7% of all mucormycosis cases (1, 2). Lichtheimia ramosa, formerly known as Absidia ramosa, is an uncommon human pathogen belonging to the order Mucorales (3). Separately, Aspergillus calidoustus was once identified as Aspergillus ustus, another rare pathogen, but it was reclassified as a new species following the discovery of distinct characteristics by Varga et al. in 2008 (4). We herein describe a rare episode of a patient with invasive intestinal mycosis caused by a simultaneous infection with L. ramosa and A. calidoustus.\n\nCase Report\nA 53-year-old woman was admitted to Osaka Police Hospital with septic shock after having contracted pneumococcal pneumonia. She had undergone surgery for esophageal cancer 2.5 years prior to this presentation. Her gastric tube, which had been reconstructed by esophagogastrostomy, had become obstructed and her nutrition status was poor (body mass index: 11.8 kg/m2). She had a history of smoking (10 cigarettes/day) and alcohol consumption (4 glasses of wine/day). She did not have diabetes mellitus and tested negative for the human immunodeficiency virus antibody. Penicillin-susceptible Streptococcus pneumoniae was isolated from hemoculture, and she was treated with meropenem (2 g/day), immunoglobulin (5 g/day), and hydrocortisone (200 mg/day) for 7 days under ventilation and continuous hemodiafiltration for an invasive pneumococcal infection.\n\nOn day 12, abdominal radiography and computed tomography revealed free air in the peritoneal cavity (Fig. 1), and emergency surgery was performed for a transverse colon perforation. Multiple ulcers were observed throughout the colon along with a single perforation associated with thinning of the intestinal wall. Hence, we performed subtotal colectomy from the cecum to the upper rectum and created a stoma. The formation of colonic ulcers and fistula was confirmed by histopathological examinations (Fig. 2A and B). A 38℃ fever and high degree of inflammation were sustained after surgery, although no lung field lesions were observed. Meropenem, teicoplanin, metronidazole, and caspofungin were administered to treat the perforation peritonitis. Fever and rectal bleeding persisted on day 16, and multiple ulcers and bleeding in the residual rectum were confirmed by colonoscopy. Aspergillus spp. and other filamentous fungi were isolated from drainage from Douglas' pouch. An Aspergillus galactomannan antigen test was positive (0.5 pg/mL). On day 20, filamentous fungi were detected in almost all ulcers in the colon tissue collected during surgery (Fig. 2C-E). Gastrointestinal type mucormycosis and aspergillosis were suspected, and liposomal amphotericin B (L-AMB) administration was started at 8 mg/kg. Subsequently, the fever subsided, filamentous fungus was no longer detected in the drainage fluid from Douglas' pouch, and the inflammatory response both diminished. The multiple ulcers markedly improved along with the patient's general condition, and she was discharged from the hospital (Fig. 3).\n\nFigure 1. Abdominal radiography and computed tomography findings. Radiograph (A) and computed tomography scan (B) showing the entire colon filled with gas and free air in the suprahepatic area (red arrow).\n\nFigure 2. Macroscopic and microscopic examination of the removed colon. A and B: Multiple ulcers (black arrows) and a fistula (white arrow) were recognized macroscopically (A) or under loupe magnification (B). C-E: A microscopic examination revealed filamentous fungi in the ulcerative region (Magnification: ×400). The tissue specimens were stained with Hematoxylin and Eosin staining (B and E), periodic acid Schiff (C), or Grocott methenamine silver (D).\n\nFigure 3. The clinical course of the patient. Fever subsided after intensive liposomal amphotericin B (L-AMB) treatment. Filled inverted triangles (▼) indicate the date when the WBC and CRP data were obtained. AZM: azithromycin, CF: colonofiberscopy, CPFG: caspofungin, LZD: linezolid, MEPM: meropenem, TAZ/PIPC: tazobactam/piperacillin, TEIC: teicoplanin\n\nTwo filamentous fungi that were isolated from the Douglas pouch drainage sample were further investigated. Each of their macroscopic and microscopic characteristics was distinct. Gene sequencing using panfungal primers against the internal transcribed spacer and D1/D2 of the 26S nuclear ribosomal RNA gene revealed one strain to be Lichtheimia spp. and the other to be Aspergillus spp. Further analysis using species-specific primers targeting elongation factor 1α of Lichtheimia and β-tubulin of Aspergillus identified the species as L. ramosa (100% match in a 407 bp region) and A. calidoustus (100% match in a 343 bp region), respectively. The specific primers for internal transcribed spacer were: for ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC); for D1/D2: NL1 (GCATATCAATAAGCGGAGGAAAA) and NL4 (GGTCCGTGTTTCAAGACGG); for elongation factor 1α: EF1alpha M1 (GCTGGTATCTCCAAGGATGG) and EF1alpha M2 (CGACGGACTTGACTTCRGTGG); and for β-tubulin: bTub1 (AATTGGTGCCGCTTTCTGG) and bTub2 (AGTTGTCGGGACGGAATAG) (3, 5-7).\n\nDiscussion\nWe successfully treated a patient with intestinal mycosis caused by a coinfection with L. ramosa and A. calidoustus. These species are often isolated from patients who have undergone transplantations (4, 8) and are currently regarded as emerging fungal pathogens. Although the epidemiological status of mucormycosis in Japan is unclear, autopsy case studies indicate that Mucorales fungi are the third most frequent cause of invasive fungal infection (9, 10). A rising incidence rate of mucormycosis has been reported in European countries, with Lichtheimia spp. being one of the most frequently involved species (11). Most patients who develop such infections have serious background diseases or other conditions such as hematological malignancies or trauma/surgical wounds, or else are receiving immunosuppressant therapy (11). The risk factors in our patient included alcohol consumption, malnutrition, immunocompromised status induced by invasive pneumococcal disease, broad-spectrum antibacterial drug administration, and high-dose steroid therapy. Because she initially had no gastrointestinal symptoms such as abdominal pain and melena, the time of gastrointestinal mycosis onset was unknown. A histopathological analysis indicated the presence of filamentous fungi, but did not clearly differentiate between Aspergillus and Mucorales spp. The endothelial cells exhibited slightly positive immunostaining for cytomegalovirus, but the patient's blood tested negative for C7-HRP at admission.\n\nThis episode was rare in that the patient was simultaneously infected with both L. ramosa and A. calidoustus. Moreover, this is the first reported case of gastrointestinal A. calidoustus infection to our knowledge, although one patient with gastrointestinal mucormycosis caused by L. ramosa was previously reported (12). An accurate diagnosis of mycosis requires the genetic investigation of fungal isolates, which is difficult to perform at medical facilities lacking specialized laboratories. Therefore, a significant number of patients with A. calidoustus infection may have been overlooked in the past, and its incidence rate may be much higher than the currently accepted estimate.\n\nMucormycosis has a high mortality rate mainly owing to its rapid progression and challenging premortal diagnosis (11, 13). Mucorales spp. are generally difficult to cultivate from tissue specimens. Moreover, many patients are ineligible for surgery because of their poor physical condition. Therefore, the proportion of patients with confirmed premortal diagnoses of mucormycosis is quite small; a relatively large number of patients are diagnosed for the first time at autopsy. To achieve a successful outcome, clinicians must often commence antifungal therapy based on a presumptive diagnosis at an early stage of infection. High-dose L-AMB is very effective against most Mucorales species with a few exceptions, such as Cunninghamella bertholletiae (11). In our patient, emergency surgery was performed immediately, and fungal culturing and histopathological examinations were conducted; intestinal mucormycosis was suspected based on these clinical findings, and high-dose L-AMB therapy was therefore initiated. We therefore would like to emphasize that an early presumptive diagnosis and the immediate initiation of antifungal therapy are critical for achieving a favorable outcome in such patients.\n\n\nThe authors state that they have no Conflict of Interest (COI).\n\nFinancial Support\nThis research is partially supported by the Research Program on Emerging and Re-emerging Infectious Diseases funded by the Japan Agency for Medical Research and Development, Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science to H.K. (16725777) and Y.K. (17894158), and Pfizer Academic Contributions to Y.K.\n\nAcknowledgement\nWe thank Yukimi Kira and Yoriko Yabunaka (Central Laboratory of Osaka City University Medical School) for their valuable technical support.\n==== Refs\n1. Roden MM , Zaoutis TE , Buchanan WL , et al \nEpidemiology and outcome of zygomycosis: a review of 929 reported cases . Clin Infect Dis \n41 : 634 -653 , 2005 .16080086 \n2. Lanternier F , Dannaoui E , Morizot G , et al \nA global analysis of mucormycosis in France: the RetroZygo Study (2005-2007) . Clin Infect Dis \n54 : S35 -S43 , 2012 .22247443 \n3. Woo PC , Leung SY , Ngan AH , Lau SK , Yuen KY \nA significant number of reported Absidia corymbifera (Lichtheimia corymbifera) infections are caused by Lichtheimia ramosa (syn. Lichtheimia hongkongensis): an emerging cause of mucormycosis . Emerg Microbes Infect \n1 : e15 , 2012 .26038425 \n4. Varga J , Houbraken J , Van Der Lee >HA , Verweij PE , Samson RA \nAspergillus calidoustus sp. nov., causative agent of human infections previously assigned to Aspergillus ustus . Eukaryot Cell \n7 : 630 -638 , 2008 .18281596 \n5. White TJ , Bruns TD , Lee SB , et al \nAmplification and direct sequencing of fungal ribosomal rna genes for phylogenetics . In: PCR Protocols A Guide to Methods and Applications . Innis MA , Gelfand DH , Sninsky JJ , White TJ , Eds. Academic Press , New York , 1990 : 315 -322 .\n6. Kurtzman CP , Robnett CJ \nIdentification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene . J Clin Microbiol \n35 : 1216 -1223 , 1997 .9114410 \n7. Balajee SA , Gribskov JL , Hanley E , Nickle D , Marr KA \nAspergillus lentulus sp. nov., a new sibling species of A. fumigatus . Eukaryot Cell \n4 : 625 -632 , 2005 .15755924 \n8. Egli A , Fuller J , Humar A , et al \nEmergence of Aspergillus calidoustus infection in the era of posttransplantation azole prophylaxis . Transplantation \n94 : 403 -410 , 2012 .22805441 \n9. Shimodaira K , Okubo Y , Nakayama H , et al \nTrends in the prevalence of invasive fungal infections from an analysis of annual records of autopsy cases of Toho University . Mycoses \n55 : 435 -443 , 2012 .22320199 \n10. Kurosawa M , Yonezumi M , Hashino S , et al \nEpidemiology and treatment outcome of invasive fungal infections in patients with hematological malignancies . Int J Hematol \n96 : 748 -757 , 2012 .23111539 \n11. Guinea J , Escribano P , Vena A , et al \nIncreasing incidence of mucormycosis in a large Spanish hospital from 2007 to 2015: Epidemiology and microbiological characterization of the isolates . PLoS One \n12 : e0179136 , 2017 .28591186 \n12. Irtan S , Lamerain M , Lesage F , et al \nMucormycosis as a rare cause of severe gastrointestinal bleeding after multivisceral transplantation . Transpl Infect Dis \n15 : E235 -E238 , 2013 .24103142 \n13. Yano S , Minami J , Nishiwaki K , et al \nRapid progression and unusual premortal diagnosis of mucormycosis in patients with hematologic malignancies: analysis of eight patients . Int J Hematol \n93 : 344 -350 , 2011 .21365229\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": "57(16)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": "Aspergillus calidoustus; Lichtheimia ramosa; fungal infection; intestinal mucormycosis; zygomycosis", "medline_ta": "Intern Med", "mesh_terms": "D000666:Amphotericin B; D000935:Antifungal Agents; D001230:Aspergillus; D005260:Female; D006801:Humans; D007410:Intestinal Diseases; D008875:Middle Aged; D009091:Mucormycosis; D016896:Treatment Outcome", "nlm_unique_id": "9204241", "other_id": null, "pages": "2421-2424", "pmc": null, "pmid": "29526942", "pubdate": "2018-08-15", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "28591186;22805441;15755924;22320199;24103142;21365229;22247443;18281596;9114410;26038425;23111539;16080086", "title": "Successful Treatment of Intestinal Mycosis Caused by a Simultaneous Infection with Lichtheimia ramosa and Aspergillus calidoustus.", "title_normalized": "successful treatment of intestinal mycosis caused by a simultaneous infection with lichtheimia ramosa and aspergillus calidoustus" }
[ { "companynumb": "JP-MYLANLABS-2018M1066420", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MEROPENEM" }, "drugadditional": "3", ...
{ "abstract": "Olanzapine, a second generation antipsychotic, has previously been associated with an increased risk of venous thromboembolism (VTE). In this mini-review we describe a case of a thirty-year-old schizophrenic patient who was diagnosed with a deep venous thrombosis (DVT) six months after starting olanzapine therapy, as well as seventeen other VTE cases in patients using olanzapine reported to the Netherlands Pharmacovigilance Centre Lareb. In 14 of these reports, patients had reported additional risk factors for VTE. We found disproportionate Reporting Odds Ratios (RORs) in the global database VigiBase for olanzapine and the reactions deep vein thrombosis (ROR of 1.38 with a 95% CI (Confidence Interval) of 1.22-1.57) and pulmonary embolism (ROR of 1.99 with a 95% CI of 1.81-2.19). The mechanism behind the association of olanzapine with VTE could be explained by two risk factors, substantial weight gain and lethargy, both common side effects of olanzapine. So far, a direct effect of olanzapine on platelet aggregation or coagulation has not been found. Schizophrenic patients are more likely to have diagnostic delay in the diagnosis of VTE, as symptoms such as lethargy and impaired pain perception result in diminished pain perception and pain expression, while they are at increased risk of developing VTE. Currently no validated risk score is available for detection of psychiatric patients who might benefit from pharmacologic VTE prophylaxis. In patients developing a VTE while being treated with olanzapine, discontinuation of olanzapine could be considered based on the individual risk profile, control of psychotic symptoms and antipsychotic treatment options.", "affiliations": "St. Vincent's Hospital, Darlinghurst, NSW, Australia.", "authors": "Dijkstra|M E|ME|;van der Weiden|C F S|CFS|;Schol-Gelok|S|S|;Muller-Hansma|A H G|AHG|;Cohen|G|G|;van den Bemt|P M L A|PMLA|;Kruip|M J H A|MJHA|", "chemical_list": "D014150:Antipsychotic Agents; D005343:Fibrinolytic Agents; D000077152:Olanzapine", "country": "Netherlands", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0300-2977", "issue": "76(6)", "journal": "The Netherlands journal of medicine", "keywords": null, "medline_ta": "Neth J Med", "mesh_terms": "D000328:Adult; D014150:Antipsychotic Agents; D005343:Fibrinolytic Agents; D005500:Follow-Up Studies; D006801:Humans; D007273:Injections, Intramuscular; D008297:Male; D009426:Netherlands; D000077152:Olanzapine; D018570:Risk Assessment; D012563:Schizophrenia, Paranoid; D016896:Treatment Outcome; D018608:Ultrasonography, Doppler; D020246:Venous Thrombosis", "nlm_unique_id": "0356133", "other_id": null, "pages": "263-268", "pmc": null, "pmid": "30152405", "pubdate": "2018-08", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Venous thrombosis during olanzapine treatment: a complex association.", "title_normalized": "venous thrombosis during olanzapine treatment a complex association" }
[ { "companynumb": "AU-ACCORD-072068", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CLOZAPINE" }, "drugadditional": null, "druga...
{ "abstract": "OBJECTIVE\nLPS-responsive beige-like anchor protein (LRBA) deficiency is a combined immunodeficiency and immune dysregulation. The authors present a case report of LPSresponsive beige-like anchor protein (LRBA) deficiency with the history of autoimmunity, enteropathy and visceral leishmaniasis. Sirolimus therapy was started for autoimmunity and enteropathy but was discontinued due to recurrent leishmaniasis. Therefore, a common side-effect of many immunosuppressive drugs in patients with LRBA deficiency is increased susceptibility to infections.\n\n\nMETHODS\nWhole exome sequencing was performed to detect the underlying genetic mutation and Leishmania DNA was detected by the PCR technique in this patient.\n\n\nRESULTS\nWhole exome sequencing of the patient reported a homozygous frameshift deletion mutation in the LRBA gene (NM_006726: exon29: c.4638delC, p. S1546fs). Leishmania DNA PCR was positive in this case.\n\n\nCONCLUSIONS\nParasite infections manifestations report in LRBA deficiency. Leishmania infections in patients with chronic diarrhea and autoimmunity should be considered for immunodeficiency.", "affiliations": "Research Center for Immunodeficiencies, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran.;Allergy and Clinical Immunology Department, School of Medicine, Bushehr University of Medical Science, Bushehr, Iran.;Department of Immunology, Specialised Immunology Laboratory of Dr. Shahrooei, Ahvaz, Iran.;Non-communicable Diseases Research Center, Alborz University of Medical Sciences, Karaj, Iran.;Research Center for Immunodeficiencies, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran.;Research Center for Immunodeficiencies, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran.;Research Center for Immunodeficiencies, Pediatrics Center of Excellence, Children's Medical Center, Tehran University of Medical Sciences, Tehran, Iran.", "authors": "Salami|Fereshte|F|;Shirkani|Afshin|A|;Shahrooei|Mohammad|M|;Azizi|Gholamreza|G|;Yazdani|Reza|R|;Abolhassani|Hassan|H|;Aghamohammadi|Asghar|A|", "chemical_list": "D048868:Adaptor Proteins, Signal Transducing; D008070:Lipopolysaccharides; C428703:LRBA protein, human", "country": "United Arab Emirates", "delete": false, "doi": "10.2174/1871530319666190807161546", "fulltext": null, "fulltext_license": null, "issn_linking": "1871-5303", "issue": "20(3)", "journal": "Endocrine, metabolic & immune disorders drug targets", "keywords": "LPS-responsive beige-like anchor; autoimmunity; enteropathy; leishmaniasis; parasite infections; primary immunodeficiency.", "medline_ta": "Endocr Metab Immune Disord Drug Targets", "mesh_terms": "D048868:Adaptor Proteins, Signal Transducing; D015551:Autoimmunity; D002675:Child, Preschool; D005260:Female; D006801:Humans; D007153:Immunologic Deficiency Syndromes; D007896:Leishmaniasis; D008070:Lipopolysaccharides", "nlm_unique_id": "101269157", "other_id": null, "pages": "479-484", "pmc": null, "pmid": "31389321", "pubdate": "2020", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Leishmaniasis and Autoimmunity in Patient with LPS-Responsive Beige-Like Anchor Protein (LRBA) Deficiency.", "title_normalized": "leishmaniasis and autoimmunity in patient with lps responsive beige like anchor protein lrba deficiency" }
[ { "companynumb": "IR-NVP-000001", "fulfillexpeditecriteria": "1", "occurcountry": "IR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "SIROLIMUS" }, "drugadditional": null, "drugadmi...
{ "abstract": "Germ cell tumors are the most common malignancy in men aged 15-35 years old, with a small percentage presenting in an extragonadal location. These tumors are seldom identified in the gastrointestinal tract. There is increased risk of extragonadal germ cell tumors (EGCT) in men with Klinefelter syndrome (KS). We report a rare case of a 37-year-old male with KS and EGCT discovered in the duodenum and pelvis. After treatment with Bleomycin-Etoposide-Cisplatin (BEP), he developed growing teratoma syndrome (GTS) and myelodysplasia. Despite surgical excision of the pelvic growing teratoma, he unfortunately died secondary to complications of severe bone marrow suppression.", "affiliations": "Louisiana State University, Department of Urology, 1542 Tulane Avenue, New Orleans, LA, 70112, USA.;Louisiana State University, Department of Urology, 1542 Tulane Avenue, New Orleans, LA, 70112, USA.;Louisiana State University, Department of Urology, 1542 Tulane Avenue, New Orleans, LA, 70112, USA.", "authors": "Konheim|Jeremy A|JA|;Israel|Jonathan A|JA|;Delacroix|Scott E|SE|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.eucr.2016.09.006", "fulltext": "\n==== Front\nUrol Case RepUrol Case RepUrology Case Reports2214-4420Elsevier S2214-4420(16)30112-710.1016/j.eucr.2016.09.006OncologyKlinefelter Syndrome with Poor Risk Extragonadal Germ Cell Tumor Konheim Jeremy A. Jeremy.konheim@gmail.com∗Israel Jonathan A. Delacroix Scott E. Louisiana State University, Department of Urology, 1542 Tulane Avenue, New Orleans, LA, 70112, USA∗ Corresponding author. Jeremy.konheim@gmail.com22 10 2016 1 2017 22 10 2016 10 1 3 13 8 2016 8 9 2016 16 9 2016 © 2016 The Authors2016This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Germ cell tumors are the most common malignancy in men aged 15-35 years old, with a small percentage presenting in an extragonadal location. These tumors are seldom identified in the gastrointestinal tract. There is increased risk of extragonadal germ cell tumors (EGCT) in men with Klinefelter syndrome (KS). We report a rare case of a 37-year-old male with KS and EGCT discovered in the duodenum and pelvis. After treatment with Bleomycin-Etoposide-Cisplatin (BEP), he developed growing teratoma syndrome (GTS) and myelodysplasia. Despite surgical excision of the pelvic growing teratoma, he unfortunately died secondary to complications of severe bone marrow suppression.\n\nKeywords\nExtragonadal germ cell tumorKlinefelter syndromeGrowing teratoma syndromeMyelodysplasia\n==== Body\nIntroduction\nGerm cell tumors are the most common malignancy in the testicle, and the most common malignancy in males 15-35 years old.1 It is reported that 5% of germ cell tumors are extragonadal.1 Men with Klinefelter syndrome (KS) have an increased risk of developing extragonadal germ cell tumors (EGCT), though the overall risk has not warranted routine screening in the KS population.2 The most common primary site of EGCT is the mediastinum, followed by the retroperitoneum.1 Literature has described cases of EGCTs located in the pineal gland, presacral area, bladder, prostate, and liver.1 To our knowledge, there has never been a published case of EGCT of gastrointestinal origin. We report a case of a patient with KS and EGCT of duodenal origin.\n\nCase presentation\nA 37-year-old male presented with nausea, vomiting, abdominal pain, weight loss, and symptoms of gastroesophageal reflux disease despite medical management. Computed tomography (CT) demonstrated a 16 cm distal gastric mass and a 7 cm pelvic mass (Fig. 1A–C). Biopsy of the gastric mass was nondiagnostic. Esophagogastroduodenoscopy identified a mass at the distal pyloric region of the stomach suggestive of a hemangioma, but was not biopsied due to concern for bleeding. An exploratory laparotomy was performed with resection of abdominal mass, partial gastrectomy, partial hepatectomy, and a roux-en-y gastroduodenostomy. Pathologic analysis demonstrated mixed germ cell tumor with components of immature teratoma and yolk sac tumor, consistent with extragonadal nonseminomatous germ cell tumor (NSGCT). The patient was referred to Louisiana State University Department of Urology for further evaluation. On physical examination, he was tall with long limbs, and had bilaterally descended small atrophic testicles with no masses. Tumor markers were: β-hCG 13 (<5), AFP 10511 (<15), and LDH 247 (<201). Karyotype was performed, which diagnosed Klinefelter syndrome (47 XXY). A scrotal ultrasound revealed small (<1 cc) testes bilaterally with no masses. Staging CT of the chest, abdomen, and pelvis was significant for an 8.4 × 7.0 × 5.6 cm pelvic mass, mild right hydroureteronephrosis, bilateral pelvic lymphadenopathy >1 cm, T11 vertebral body fracture, and mediastinal lymphadenopathy >1 cm. Magnetic resonance imaging (MRI) of the brain was negative for metastasis. Bone scan was performed, which demonstrated a T11 lytic lesion concerning for pathologic compression fracture (Fig. 2). This staged the patient as cTxN1M1bS3 nonseminomatous EGCT, Stage IIIC, with poor prognostic features. The patient was treated with four cycles of Bleomycin-Etoposide-Cisplatin (BEP) chemotherapy per NCCN guidelines. Tumor markers, repeated after chemotherapy, had normalized. Postchemotherapy imaging demonstrated disease progression despite chemotherapy, with interval progression from 8.4 × 7 × 5.6 cm to 10 × 8 × 8.1 cm, and multiple new liver metastases (Fig. 3A). The pelvic/retroperitoneal mass was consistent with growing teratoma syndrome (GTS).3 Additionally, the patient developed myelodysplasia secondary to treatment, with severe thrombocytopenia (Platelet counts < 5000). MRI of the pelvis was performed for surgical planning (Fig. 3B). Despite his severe thrombocytopenia, he underwent extirpation of the pelvic/retroperitoneal growing teratoma, right seminal vesicle, and right distal ureter. Concomitant psoas hitch and ureteral reimplantation was performed. Pathologic analysis demonstrated mature teratoma, consistent with GTS. The patient had an uncomplicated immediate postoperative course and was discharged home on postoperative day five. Unfortunately, the patient continued to experience progressive bone marrow suppression, and was unable to receive further therapy. Patient died secondary to progression of his disease and severe bone marrow suppression 5 months later.\n\nDiscussion\nExtragonadal germ cell tumors have been identified in a variety of anatomical locations.1, 4 Incidence of EGCT in abdominal viscera, such as the duodenum, is very rare.1 Unfortunately, there is very little referenced in the literature about abdominal visceral EGCT. Knowledge is therefore extrapolated from mediastinal and retroperitoneal EGCT, which are the most common sites of disease. As compared with seminomatous EGCT, nonseminomatous ECGT have worse prognosis, with a 5-year survival rate of 62% for retroperitoneal and 45% for mediastinal.1 Presence of a nonpulmonary visceral metastasis or primary tumor location other than testicle and retroperitoneum automatically places a patient in the International Germ Cell Cancer Collaboration Group (IGCCCG) classification of poor prognosis. This group has a 5-year survival rate of 48%.5 Surgery is an integral component of treatment of EGCT due to the risk of residual viable tumor. In one series, after secondary surgery, 25% of patients with nonseminomatous retroperitoneal EGCT had viable undifferentiated tumor in the specimen, and 16% had major teratoma.1 Additionally, surgical excision is the treatment of choice in the setting of GTS. GTS is defined as enlarging retroperitoneal mass or metastatic lesion during systemic chemotherapy for NSGCT, with normalization of tumor markers, and predominance of mature teratoma in resected specimen.3 In cases with partial remission or disease progression after resection, there is a role for salvage chemotherapy. The median survival time for patients requiring salvage chemotherapy after relapse was 11-15 months.1\n\nIn addition to the poor prognostic factors, the patient also developed myelodysplasia with severe thrombocytopenia and bone marrow suppression. Patients with nonseminomatous mediastinal EGCT have a known increased risk of developing acute megakaryoblastic leukemia and myelodysplasia with abnormal megakaryocytes.1 This is seen in 2% of patients, which is 250 times greater incidence as compared to the general population.1 After development of hematologic malignancy, median survival is approximately 5-6 months despite efforts to treat.1 We intended to perform further site-directed excisions of his likely multiple growing teratomas after improved control of his thrombocytopenia and possibly salvage chemotherapy. Unfortunately, the patient was never able to tolerate these treatments, and succumbed to complications of his disease 5 months after surgery.\n\nConclusion\nWe report a rare case of EGCT and GTS in a male with KS who initially presented with a duodenal mass, which has not been described in the literature. Unfortunately in this patient with GTS, he was unable to reach complete resection due to severe complications of chemotherapy and of his disease, ultimately resulting in his death.\n\nConflicts of interest\nNone.\n\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nFigure 1 CT abdomen/pelvis on initial presentation, axial (A,B) and coronal (C). These images demonstrate the duodenal mass (A, C), and the pelvic mass (B), which were identified at presentation, the red arrows point to the “duodenal mass,” and “pelvic mass”.\n\nFigure 1Figure 2 Bone scan demonstrating T11 lesion, the red arrow points to the “T11 lesion”.\n\nFigure 2Figure 3 CT (A) and MRI (B) after BEP × 4 cycles, demonstrating growing teratoma the red arrows point to the “growing teratoma”.\n\nFigure 3\n==== Refs\nReferences\n1 Schmoll H.-J. Extragonadal germ cell tumors Ann Oncol 13 2002 265 272 12401700 \n2 Nichols C. Heerema N. Palmer C. Klinefelter's syndrome associated with mediastinal germ cell neoplasms JCO 5 1987 1290 1294 \n3 Spiess P.E. Kassouf W. Brown G.A. Surgical management of growing teratoma syndrome: the M.D. Anderson Cancer Center experience J Urol 177 2007 1330 1334 17382725 \n4 Taori K. Rathod J. Deshmukh A. Primary extragonadal retroperitoneal teratoma in an adult Br J Radiol 79 2006 e120 e122 16980665 \n5 International germ cell consensus classification: a prognostic factor-based staging system for metastatic germ cell cancers. International Germ Cell Cancer Collaborative Group J Clin Oncol 15 1997 594 603 9053482\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2214-4420", "issue": "10()", "journal": "Urology case reports", "keywords": "Extragonadal germ cell tumor; Growing teratoma syndrome; Klinefelter syndrome; Myelodysplasia", "medline_ta": "Urol Case Rep", "mesh_terms": null, "nlm_unique_id": "101626357", "other_id": null, "pages": "1-3", "pmc": null, "pmid": "27800296", "pubdate": "2017-01", "publication_types": "D002363:Case Reports", "references": "9053482;12401700;16980665;17382725;3040921", "title": "Klinefelter Syndrome with Poor Risk Extragonadal Germ Cell Tumor.", "title_normalized": "klinefelter syndrome with poor risk extragonadal germ cell tumor" }
[ { "companynumb": "US-FRESENIUS KABI-FK201609135", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ETOPOSIDE" }, "drugadditional": null, ...
{ "abstract": "NSAIDs are nonsteroidal anti-inflammatory drugs, thus, they will provide analgesic, antipyretic, anti-inflammatory, antiplatelet effects. Severe poisoning and death because of acute intoxication can occur by ingestions of more than 400 mg/kg. This cross-sectional retrospective study was carried out in on all patients referred to Loghman Hakim Hospital from 2011 to 2016. Grouping of our patients was based on the amount of NSAID ingestion, Type of NSAID, patient's conscious level according to Reed Scaling criteria, suicide attempt, and gender. Data were analyzed using the SPSS software. A P-value of 0.05 or less was considered to be statistically significant. The period prevalence of NSAID poisoning was 0.14% and the incidence was 3.816/100,000/year. The uppermost number of poisoning were seen in 2012 (20.96%). Mean age was 23.75 ± 9.76 years and most of the intoxications were seen in females (66.37%). Of the patients, 140 (61.13%) had ingested less than 200 mg/kg, and 9.17% committed suicide having a mortality rate of 0.43%. The most common NSAIDs that had been used were Ibuprofen (73.79%). Of patients, 83.4% underwent through common complications of NSAID poisoning. We find significant relationship between the type of NSAID and higher sodium, BUN, ALT, ALP, CPK levels in men, and higher LDH level in women. Besides, we found substantial correlation between using short-acting NSAIDs and female gender, suicide action, arrival to the hospital less than 12 h, amounts under 200 mg/kg, hospitalization longer than 12 h, and presentation of loss of consciousness.", "affiliations": "Department of Toxicology and Pharmacology, Islamic Azad University of Medical Sciences, Tehran, Iran.;Department of Clinical Toxicology, Loghman-Hakim Hospital, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.", "authors": "Bagherian Rad|Nazanin|N|;Rahimi|Mitra|M|", "chemical_list": null, "country": "Iran", "delete": false, "doi": "10.22037/ijpr.2019.111720.13316", "fulltext": "\n==== Front\nIran J Pharm Res\nIran J Pharm Res\nIJPR\nIranian Journal of Pharmaceutical Research : IJPR\n1735-0328 1726-6890 Shaheed Beheshti University of Medical Sciences Tehran, Iran \n\n10.22037/ijpr.2019.111720.13316\nOriginal Article\nPattern of NSAID Poisoning in a Referral Poisoning Center of Iran: Solutions to Reduce the Suicide\nBagherian Rad Nazanin a Rahimi Mitra b* \na \nDepartment of Toxicology and Pharmacology, Islamic Azad University of Medical Sciences, Tehran, Iran. \n\n\nb \nDepartment of Clinical Toxicology, Loghman-Hakim Hospital, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.\n\n* Corresponding author: E-mail: mrahimi744@gmail.com\nAutumn 2019 \n18 Suppl1 249 257\n4 2019 12 2019 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.NSAIDs are nonsteroidal anti-inflammatory drugs, thus, they will provide analgesic, antipyretic, anti-inflammatory, antiplatelet effects. Severe poisoning and death because of acute intoxication can occur by ingestions of more than 400 mg/kg. This cross-sectional retrospective study was carried out in on all patients referred to Loghman Hakim Hospital from 2011 to 2016. Grouping of our patients was based on the amount of NSAID ingestion, Type of NSAID, patient’s conscious level according to Reed Scaling criteria, suicide attempt, and gender. Data were analyzed using the SPSS software. A P-value of 0.05 or less was considered to be statistically significant. The period prevalence of NSAID poisoning was 0.14% and the incidence was 3.816/100,000/year. The uppermost number of poisoning were seen in 2012 (20.96%). Mean age was 23.75 ± 9.76 years and most of the intoxications were seen in females (66.37%). Of the patients, 140 (61.13%) had ingested less than 200 mg/kg, and 9.17% committed suicide having a mortality rate of 0.43%. The most common NSAIDs that had been used were Ibuprofen (73.79%). Of patients, 83.4% underwent through common complications of NSAID poisoning. We find significant relationship between the type of NSAID and higher sodium, BUN, ALT, ALP, CPK levels in men, and higher LDH level in women. Besides, we found substantial correlation between using short-acting NSAIDs and female gender, suicide action, arrival to the hospital less than 12 h, amounts under 200 mg/kg, hospitalization longer than 12 h, and presentation of loss of consciousness. \n\nKey Words\nAnti-inflammatory agentsNon-steroidalPoisoningAdverse effectsOverdose\n==== Body\nIntroduction\nNSAIDs are nonsteroidal anti-inflammatory drugs. They, non-selectively, impede cyclo-oxygenases and reduce the formation of prostaglandins and thromboxanes (Eicosanoids in cell membranes). Thus, they will provide analgesic, antipyretic, anti-inflammatory, anti-platelet effects. This group of drugs has one prototype named Acetylsalicylic acid (ASA) that itself consists of over 20 types of drugs and irreversibly hinder cyclooxygenases (1). After ingestion, NSAIDs mostly are gone through hepatic metabolism by CYP2C8, 2C9, 2C19 and/or glucuronidation. They tend to bind to proteins, which define their distribution to the central nervous system (CNS). The metabolites excrete via glomerular filtration and tubular discharge. NSAID’s half-life is either short acting (<8 h) or long acting (>8 h). Consequently, active metabolites of those with longer half-life would have further enterohepatic circulation (2–3). Severe poisoning and death as a result of acute intoxication with NSAIDs can occur by ingestions of more than 400 mg/kg. There are six aspects of acute NSAID toxicity (4). First and following the intake of great amounts of NSAIDs such as ibuprofen, naproxen, and phenylbutazone, enhanced anion gap metabolic acidosis take place. This can cause cardiac dysrhythmias and electrolyte deviations (5–8). Acute renal failure (reversible) is the second clinical aspect of acute NSAID toxicity that is due to vasodilator prostaglandins’ blockage (9). Third and in cases of ibuprofen overdose, hypotension and cardiovascular collapse cause cardiovascular toxicity (8). Moreover, 30 percent of Ibuprofen intoxications would develop CNS toxicity (drowsiness to coma) (10). Yet seizure was observed only with intake of propionic acids, pyrazolones, acetic acids, and anthranilic acids (11–13). Besides after ingestion of phenylbutazone and indomethacin aplastic anemia and agranulocytosis have been reported. Last but not least, anaphylaxis has been shown in certain cases as well (14). The 2016 report of the American Association of Poison Control Centers, demonstrated that analgesics are still the most common category of drug in acute overdose (11.2%; 18.1% intentional overdose; 80.42% fatality following ingestion) having slightly increase over the past few years (15). We found the same results from the National Poisons Information Service of United Kingdom with paracetamol in the first place and ibuprofen in the second (16). Although there are several case reports from other countries, we find no report on NSAIDs toxicity’s incidence, prevalence, distribution, and mortality in Iran. Therefore, the main aim of this study is an epidemiological investigation on NSAIDs intoxication, along with finding solutions to reduce the suicide actions associated with NSAID abuse.\n\nExperimental\nAfter confirmation by the Ethics Committee of Islamic Azad University of Medical Sciences, this cross-sectional retrospective study was carried out in on all patients referred to Loghman Hakim Hospital from January 2011 to January 2016. This center is a referral poison center, which serves a population of more than 12.5 million and has an annual emergency department census of 24000 to 30000 only for poisoned patients. Based on the Loghman Hakim Hospital of Shahid Beheshti University of Medical Sciences’ policies, written consent is given for using patient’s information for research prior to their admission to the hospital. In addition, the study protocol obeys the ethical guidelines of the Declaration of Helsinki. Entry criteria include patient’s complete record, a definitive diagnosis of pure NSAID toxicity. A self-made questionnaire containing information regarding the demographics, type of NSAID and purpose of use, on-presentation vital signs and laboratory data, duration of hospitalization, treatments given, and the outcome was filled for every single patient. At large, a total of 14,754 patients with NSAIDs poisoning and consumption of simultaneous drugs were extracted from hospital’s database. Only 229 cases had pure NSAID toxicity during six-year period. Grouping of our patients was based on the amount of NSAID ingestion (below 200 mg/kg; 200-400 mg/kg; more than 400 mg/kg), Type of NSAID (short vs. long acting NSAIDs), patient’s conscious level according to Reed Scaling criteria (loss of consciousness or LOC and no loss of consciousness or No LOC), suicide attempt, and gender. It should be noted that short-acting NSAIDs are Ibuprofen, Diclofenac, Indomethacin, Aspirin, Mefenamic acid that have less than eight hours half-life. In contrast, there are long acting NSAIDs, which are as follows: Naproxen, Celecoxib, Meloxicam, and Piroxicam. Data were analyzed using the social package for statistical analysis SPSS software version 25. The data was presented by mean ± SD for continuous variables and frequency for categorical variables. Distribution of the data was tested by the Kolmogorov–Smirnov test. The Chi-square (plus odds ratio) and Fisher’s exact tests along with Lambda, Phi, Cramer’s V., Eta, Pearson, Spearman correlation coefficients were used to analyze qualitative variables. Statistical comparison was made using Mann–Whitney U-test or Kruskal-Wallis test for nonparametric variables and independent t-test (Two-tailed) or One-way Anova for parametric ones. Multiple Regression (linear) was used to foresee the value of a variable based on the value of other variables. The outcome (dependent variable) was type of the NSAID that caused poisoning. The Predictor (independent variable) were demographics, vital signs, arterial blood gases analysis, laboratory results, and complications. For all tests, a P-value of 0.05 or less was considered to be statistically significant.\n\nResults\nHere, we present the number of clients referring to the emergency department of Loghman Hakim hospital with pure NSAID poisoning in six years. The period prevalence of NSAID poisoning was 0.14% in six years, and the incidence was 3.816/100,000/year. It should be noted that total population of hospitalized poisoned patients within these six years in our hospital was 164,333.\n\nAll of the 229 participants had oral ingestion of NSAIDs. The uppermost number of NSAID poisoning were seen in 2012 (n = 48, 20.96%), and the lowermost number of whom were related to the year 2015 (n = 29, 12.66%). Other year’s distribution of NSAID intoxicated patients was as follows: 2011 (n = 38, 16.59%), 2013 (n = 44, 19.21%), 2014 (n = 30, 13.10%), 2016 (n = 40, 17.46%).\n\nBased on the Demographics results, the majority of patients were female 66.37% (152 cases). Mean age of patients was 23.75 ± 9.76 years with a range of 13 to 90 years. With respect to gender, the average age was 25.09 ± 9 and 23.08 ± 9 for males and females, correspondingly. Of the patients, 140 (61.13%) had ingested less than 200 mg of NSAIDs per kg, 59 cases (25.76%) had consumed 200 to 400 mg/kg, and 30 cases (13.10%) had ingested more than 400 mg/kg of NSAIDs. Twenty-one individual has committed suicide action and the mortality rate of our study was 0.43%. \n\nOf the included patients, 224 cases (97.81%) had intentional consumption and the rest (2.18%) of our patients had used NSAIDs inadvertently. The NSAIDs that had been used were Ibuprofen (n = 169), Aspirin (n = 36), Diclofenac (n = 3), Naproxen (n = 3), Mefenamic Acid (n = 3), Indomethacin (n = 2), Meloxicam (n = 1). Moreover, there were cases who used combination of NSAIDs [Aspirin + Ibuprofen (n = 3), Ibuprofen + Indomethacin (n = 2), Ibuprofen + Diclofenac (n = 2), Ibuprofen + Naproxen (n = 1), Ibuprofen + Mefenamic acid (n = 3), Ibuprofen + Diclofenac + Naproxen + Celecoxib (n = 1)]. \n\n\nTable 1 shows general characteristics of NSAID poisoned patients from their arrival to the emergency department to their release from the hospital. All of which revealed to have a significant correlation with using short acting NSAIDs. In addition, through analysis of the time interval (hours) between NSAID ingestion and arrival of poisoned patients to the hospital revealed that most of the subjects arrived under 4 h (n = 139, 60%), and the minority of patients arrived between 17-20 h interval (n = 3, 1%).\n\nOn the basis of clinical manifestations, 191 patients underwent through common complications of NSAID poisoning (Figure 1). The majority of our patients presented gastrointestinal complications (n = 125, 65.44%), followed by neurologic complications (n = 12, 62.82%) and acid-base deviations (n = 55, 28.79%). On the other hand, respiratory complications were only observed in four cases (2.09%). \n\nBased on every patient’s condition, we used different therapeutic approaches. Commonly, the most prevalent treatment option was mixture of administration of activated charcoal and sorbitol, fluid therapy, psychiatric consult, and supportive treatment (76.4%). All of our patients were undergone supportive treatment and fluid therapy, and 227 (99.12 %) of whom were administrated with charcoal and sorbitol. Of patients, 226 cases (98.68%) had psychiatric consult. The smallest amount of individual treatment approaches were belong to bicarbonate sodium administration (7 cases, 3.05%), and gastrointestinal washing (6 cases, 2.62%). In addition, eight (3.49%) patients required to be intubated, and consequently they were transferred to the intensive care unit.\n\nUnfortunately, one of our patients did not survive. Patient was female with 16 years of age. She took Ibuprofen orally, having intentional purpose of use but did not commit suicide. The amount of drug was under 200 mg/kg. She was arrived to the emergency room of hospital having 1-4 hinterval between ingestion and entrance. Her on arrival vital stats were as follows: PR = 120 per min, RR = 18 per min, BP = 85/50 mmHg, T = 37 °C. Her consciousness level was two on the basis of reed scale criteria. ABG analysis revealed respiratory acidosis (pH 7.24, PCo2 = 66.70, HCo3 = 16.60) (Table 2). Treatment options were administration of activated charcoal and sorbitol, gastrointestinal washing, fluid therapy, intubation, bicarbonate sodium, and supportive care. Ultimately, she underwent neurological (agitation and seizure), renal complications (acute renal failure followed by vasodilator prostaglandin’s blockage), and acid-base deviations. Despite our very best effort, she was passed away under 12 h of hospitalization. The cause of death was cardiac arrest and CPR was not successful.\n\nDiscussion\nIn this study, we presented epidemiology of NSAID poisoning along with the demographics, laboratory analysis, clinical complications, and treatment options. Within six years of this study, we found 229 cases of NSAID intoxications. The majority of patients were found in 2012 year. In this study, we found a slight increase in NSAIDs abuse between 2011 and 2016. Based on CDC report, due to the aging population, we would encounter increase in using NSAIDs. Most of our intoxicated patients were female, abused ibuprofen, ingested under 200 mg/kg of NSAIDs, took under four hours between oral ingestion and emergency room admission, and were not suicidal. Of cases, 188 ones underwent major complications and one patient did not survive.\n\nHere, the mortality rate associated with NSAID poisoning was estimated as 0.43%. It was due to neurological (agitation and seizure), renal complication, and persistent acid-base deviations followed by cardiac arrest. This result is very low, in contrast to 2016 report of the American Association of Poison Control Centers (80.42%) (15). Another study revealed a 30-day mortality of 25% resultant from peptic ulcer perforation among 2061 patients of three Danish counties (17). Besides, a systematic review study between years 1997-2008 demonstrated 61,067 cases of NSAID poisoning and revealed that the mortality rates were decreasing from 11.6% to 7.4%. This study only considered upper gastrointestinal bleed and perforation in hospitalized cases (18). One other study showed a mortality rate of 21.99% due to cardiovascular disease in United Kingdome Norfolk Arthritis Register (19). Out of these investigations we can conclude that our mortality rate in a referral poison center of Iran is lower than any other studies. This is because we considered all of the cases of NSAID poisoning, no matter what was the complication that resulted death, as long as they had used NSAIDs only. Furthermore, we included every person with any background disease that resulted their usage of NSAID.\n\nEvery day and all around the world, more than 30 million of people are using NSAIDs. Based on recent analysis on global sales, ibuprofen, diclofenac, and naproxen have the majority of sales, correspondingly either by prescription or over-the-counter (20). This can justify why Ibuprofen is among the most abused NSAIDs both in this study and many others (21). In contrast, COX-2 selective agents such as meloxicam and celecoxib are experiencing a huge decrease (55.1 to 29.2% in US; 8.4% in Germany) over the past few years, while non selective NSAIDS are having an increase globally (50.2 to 73.9% in US; 19.0 million in defined daily doses in Germany), studies in the US and Germany revealed (22, 23). In addition, although many estimations pointed 10-40% of NSAIDs usage happened in patients older than 65 years of age (21), only two cases (0.87%) of our study had this age range. This reveals that our young population had more inclination toward using NSAIDs than elderly patients. The reasons could be this young population is not aware of potential side effects of NSAIDs mainly because they are bought over-the-counter and they are presumed to be safe.\n\nThere are many reports on complications associated with NSAID abuse. The incidence of gastrointestinal complications (both upper and lower GI) is 12.9-50.4% based on systemic reviews (20). However, the incidence of GI complications in our study was higher (65.44% of adverse effects, 54.58% of total included population). It was seen, particularly, in cases who used ibuprofen, naproxen, aspirin, diclofenac, mefenamic acid, and indomethacin. Studies showed that COX-2 selective NSAIDs have lower risk for GI complications than others. It should be noted that there are several risk factors pertaining to NSAIDs’ GI complications, such as higher dosage use, elderly, Helicobacter Pylori infection, and history of peptic ulcers. Likewise, simultaneous use of low-dose aspirin can magnify GI adverse effects (20). \n\nNeurologic complications consisted 62.82% of the complications of our study. Ibuprofen, aspirin, indomethacin, meloxicam, and mefenamic acid were among the culprit NSAIDs in such patients. Based on a prospective study, 30% of cases with ibuprofen overdose developed CNS toxicity (10). Seizures have been reported with abuse of ibuprofen, diclofenac, indomethacin, and mefenamic acids both in large and small doses. Seizures could be due to decline in production of prostaglandin and thromboxane (11). \n\nAcid-base alteration had the third grade of adverse effects in our study (28.79%). It was seen in patients who ingested ibuprofen, indomethacin, aspirin, naproxen, and diclofenac. Studies indicated that metabolic acidosis can occur in such patients due to the enhanced onion gap, and it is especially associated with ibuprofen and naproxen (5–8). In this study, 18 (32.72%) of cases with acid-base abnormalities experienced metabolic acidosis, nonetheless, most of the cases underwent through respiratory acidosis (n = 27, 49.09%).\n\nLaboratory analysis for detection of NSAID poisoning consist of BUN and creatinine, serum electrolytes, complete blood count, and arterial blood gasses (24). In this research, we find significant relationship the NSAID type and the following laboratory values; A) Elevated values in males: 1. Na (141.58 ± 3.75, 0.06 mmol/L increase in men compared to women), 2. BUN (32.80 ± 11.10, 8.78 mg/dL increase in men compared to women), 3. ALT (24 ± 23, 6 U/L increase in men in men compared to women), 4. ALP (219 ± 136, 29 U/L increase in men compared to women), 5. CPK (243 ± 507, 140 µg/L increase in men compared to women). B) Elevated values in females: LDH (498 ± 178, 14 U/L increase in women compared to men). Although, there are scarce amount of studies that were reported laboratory values, in NSAID poisoned patients, we found one case report that represent same results with respect to laboratory panels only, as ours (25). \n\nSince there are no antidotes for NSAID poisoning, management of such cases is to secure airways, decontamination of GI tract, correction of acid-base deviations, using benzodiazepines for seizures (26).\n\nIn conclusion, we find significant association between the type of NSAID and higher sodium, BUN, ALT, ALP, CPK levels in men, and higher LDH level in women. In addition, we found substantial correlation between using short-acting NSAIDs and female gender, suicide action, arrival to the hospital less than 12 h, amounts under 200 mg/kg, hospitalization longer than 12 h, and presentation of loss of consciousness.\n\nAccording to the results of this study, a part of NSAIDs poisoned individuals used NSAIDs intentionally and suicidally. The proper use of media advertising, holding various seminars as well as conducting more research on psychological problems can reduce suicide rates in our country. We recommend more investigations on psychological injuries which have a significant role in identifying root causes of suicide action. Early diagnosis of these problems could prevent mental crises lead to suicide. Moreover, adequate training and supervision of pharmacies is important for controlling NSAIDs poisoning. Because these are over-the-counter drugs (OTC), they are being sold without prescription. The consequences are easier access for people, negligence the side effects, and misuse of the drug for non-therapeutic purposes. Finally, studies with a larger sample size and across the country can provide a wealth of information on the situation and deliver patterns of consumption in the country. Besides, timely diagnosis and treatment of these patients can reduce mortality and complications.\n\nFigure 1 Complications of NSAID poisoned individuals\n\nTable 1 General characteristics of NSAID poisoned patients\n\nVariable\t\nLong-acting NSAIDs\n\n\nN = 6, Percent of Column\n\t\nShort-acting NSAIDs\n\n\nN = 223, Percent of Column\n\t\nP-\nvalue\n*\n\t\nOdds Ratio\n\t\n95% Confidence Interval\n\t\nMultiple Regression\n\n\nR, R square, \nP\n\t\nGender\nMale\nFemale\t3 (50%)\n3 (50%)\t74 (33.18%)\n149 (66.81%)\t<0.001\t.000\t0.098-2.000\tR = 0.231\nR2 = 0.053\nP = 0.015\t\nYear\n2011\n2012\n2011\n2014\n2015\n2016\t0\n2 (33.33%)\n0\n4 (66.66%)\n0\n0\t38 (17.04%)\n46 (20.62%)\n44 (19.73%)\n26 (11.65%)\n29 (13%)\n40 (17.93%)\t.003\tNS**\t\nSuicide Attempt\t1 (16.66%)\t20 (8.96%)\t<0.001\t<0.001\t0.055-4.000\t\nInterval between consumption and admission\n<12 h\n>12 h\t5 (83.33%)\n1 (16.66%)\t204 (91.47%)\n19 (8.52%)\t0.038\tNS\tR = 0.063\nR2 = 0.004\nP = 0.828\t\nAmount of NSAID (mg/kg)\n<200 mg/kg\n200-400 mg/kg\n>400 mg/kg\t5 (83.33%)\n0\n1 (16.66%)\t135 (60.53%)\n59 (26.45%)\n29 (13%)\t<0.001\tNS\t\nDuration of Hospitalization\n<12 h\n12-24 h\n24-48 h\n>48 h\t1 (16.67%)\n4 (66.66%)\n1 (16.67%)\n0\t5 (2.24%)\n209 (93.72%)\n6 (2.69%)\n3 (1.34%)\t0.031\tNS\t\nPresentation of Clinical Complications\t3 (50%)\t188 (84.30%)\t0.026\tNS\tR = 0.152\nR2 = 0.023\nP < 0.001\t\nLoss of Consciousness\t0\t19 (8.52%)\t<0.001\tNS\t\nICU Stay\t0\t8 (3.58%)\t<0.001\tNS\t\n\n*A P-value of 0.05 or less was considered to be statistically significant. **NS = not significant. P-values are obtained using Lambda, Phi, Cramer’s V., Chi-Square, Eta, Fisher’s Exact, Pearson, Spearman correlation coefficients based on each variable. \n\nTable 2 The on arrival Vital Signs, Arterial Blood Gases, Laboratory Panel distribution, and age in the included patients of this study\n\n\nParameter\n\t\nGender\n\n\t\nP\n-value\n**\n\t\nSuicide\n\n\t\nP-\nvalue\n\t\nMultiple Regression\n\n\nR, R2, \nP\n\t\n\nMale\n\n\t\nFemale\n\n\t\nYes\n\n\t\nNo\n\n\t\n\nMean\n\t\nSD\n\t\nMean\n\t\nSD\n\t\nMean\n\t\nSD\n\t\nMean\n\t\nSD\n\t\nAge (year)\t25.09\t9.75\t23.08\t9.72\tNS***\t23.52\t7.04\t23.78\t10\tNS\t\nNS\n\t\n\nVital Signs\n\t\nPR (beat/min)\t92\t18\t90\t15\tNS\t93\t16\t90\t16\tNS\tR = 0.144\nR2 = 0.021\nP = 0.883\t\nRR (beat/min)\t16\t3\t16\t2\tNS\t17\t5\t16\t2\tNS\t\nSBP (mmHg)\t117\t16\t112\t14\t0.006\t117\t24\t114.03\t13\tNS\t\nDBP (mmHg)\t75\t9\t72\t8\t0.008\t72\t11\t73\t9.01\tNS\t\nT (°C)\t36\t0.00\t36\t0.00\tNS\t36\t0.00\t36\t0.00\tNS\t\n\nArterial Blood Gases\n\t\nPH\t7\t0.06\t7\t0.05\tNS\t7\t0.05\t7\t0.06\tNS\tR = 0.043\nR2 = 0.002\nP = 0.950\t\nPCO2\t44\t7\t40\t7\t0.001\t37\t8.03\t42\t7\t0.020\t\nHCO3*\t25\t4\t23\t4\t0.003\t21\t3\t24\t4\t0.001\t\n\nLaboratory Panels\n\t\t\nBs (mg/dL)\t114\t51\t111.06\t18\tNS\t105\t12\t112\t34\tNS\tR = 0.144\nR2 = 0.021\nP = 0.883\t\nFBS (mg/dL)\t105\t41\t96\t32\tNS\t122\t65\t96\t30\t0.007\t\nNa* (mmol/L)\t141.58\t3.75\t141.52\t3.66\t<0.001\t140.95\t3.86\t141.61\t3.67\t<0.001\tR = 0.073\nR2 = 0.005\n P = 0.582\t\nK (mmol/L)\t4.12\t0.40\t4.17\t0.39\tNS\t4.21\t.38\t4.15\t.39\tNS\t\nBUN (mg/dL)\t32.8\t11.1\t24.02\t6.6\t<0.001\t27\t10.4\t27.02\t9.29\tNS\tR = 0.158\nR2 = 0.025\nP = 0.066\t\nCr (mg/dL)\t1.13\t11.1\t0.93\t0.18\t<0.001\t1.11\t.27\t0.99\t0.19\t0.041\t\nAST (U/L)\t29\t27\t24\t11\tNS\t24\t8\t26\t19\tNS\tR = 0.062\nR2 = 0.004\nP = 0.846\t\nALT (U/L)\t24\t23\t18\t10\t0.003\t19\t14\t20\t16\tNS\t\nALP (U/L)\t219\t136\t190\t78\t<0.001\t196\t73\t200\t105\tNS\t\nCPK (µg/L)\t243\t507\t103\t83\tNS\t157\t154\t151.03\t321\tNS\tR = 0.256\nR2 = 0.065\nP = 0.004\t\nLDH (U/L)\t484\t202\t498\t178\tNS\t504\t154\t492\t189\tNS\t\nBili T (mg/dL)\t0.76\t0.49\t0.61\t0.29\tNS\t0.46\t0.25\t0.68\t0.38\t0.006\tR = 0.041\nR2 = 0.002\nP = 0.845\t\nBili D (mg/dL)\t0.23\t0.21\t0.19\t0.11\tNS\t0.14\t0.07\t0.21\t0.16\t0.016\t\nPR: Pulse rate; RR: respiratory rate; SBP: systolic blood pressure; DBP: diastolic blood pressure; T: temperature; Bs: blood sugar; FBS: fasting blood sugar; Na: sodium; K: potassium; BUN: Blood Urea Nitrogen; Cr: creatinine; AST: aspartate aminotransferase; ALT: alanine aminotransferase; ALP: alkaline phosphatase; CPK: Creatine phosphokinase; LDH: Lactate dehydrogenase; SD: standard deviation; Bil T: Bilirubin Total; Bil D: Bilirubin Direct. *Na and HCo3 had normal distribution, thus independent sample t-test was used for these parameters only. **A P-value of 0.05 or less was considered to be statistically significant. ***NS: not significant.\n\nAcknowledgment\nThe authors express their sincere appreciations to the staff of archive section of Loghman Hakim Hospital for their assistance and support.\n==== Refs\nReferences\n1 Morita I Distinct functions of COX 1 and COX 2 Prostaglandins Other Lipid Mediat 2002 68 165 75 12432916 \n2 Saad J Pellegrini MV Nonsteroidal Anti-Inflammatory Drugs (NSAID) Toxicity. [Updated 2020 Jan 17] 2020 StatPearls Publishing \n3 Pereira Leite C Nunes C Jamal SK Cuccovia IM Reis S Nonsteroidal anti-inflammatory therapy: a journey toward safety Med. Res. Rev 2017 37 802 59 28005273 \n4 Volans G Monaghan J Colbridge M Ibuprofen overdose Int. J. Clin. Pract 2003 135 54 60 \n5 Levine M Khurana A Ruha AM Polyuria, acidosis, and coma following massive ibuprofen ingestion J. Med. Toxicol 2010 6 315 7 20419362 \n6 Marciniak KE Thomas IH Brogan TV Roberts JS Czaja Mazor SS Massive ibuprofen overdose requiring extracorporeal membrane oxygenation for cardiovascular support Pediatr. Crit. Care Med 2007 8 180 2 17273120 \n7 Wood DM Monaghan J Streete P Jones AL Dargan PI Fatality after deliberate ingestion of sustained release ibuprofen: a case report Crit. Care 2006 10 R44 16542487 \n8 Holubek W Stolbach A Nurok S Lopez O Wetter A Nelson L A report of two deaths from massive ibuprofen ingestion J. Med. Toxicol 2007 3 52 5 18072160 \n9 Gambaro G Perazella MA Adverse renal effects of anti-inflammatory agents: evaluation of selective and nonselective cyclooxygenase inhibitors J. Intern. Med 2003 253 643 52 12755960 \n10 McElwee NE Veltri JC Bradford DC Rollins DE A prospective, population based study of acute ibuprofen overdose: complications are rare and routine serum levels not warranted Ann. Emerg. Med 1990 19 657 62 2188537 \n11 Sanchez Hernandez MC Delgado J Navarro AM Orta JC Hernandez M Conde J Seizures induced by NSAID Allergy 1999 54 90 1 \n12 Steinhauser HB Hertting G Lowering of the convulsive threshold by non-steroidal anti-inflammatory drugs Eur. J. Pharmacol 1981 69 199 203 7202518 \n13 Robson RH Balali M Critchley J Proudfoot AT Prescott L Mefenamic acid poisoning and epilepsy Br. Med. J 1979 2 1438 \n14 Risks of agranulocytosis aplastic anemia A first report of their relation to drug use with special reference to analgesics The International Agranulocytosis and Aplastic Anemia Study. JAMA 1986 256 1749 57 3747087 \n15 Gummin DD Mowry JB Spyker DA Brooks DE Fraser MO Banner W 2016 Annual Report of the American Association of Poison Control Centers’ National Poison Data System (NPDS): 34th Annual Report Clin. Toxicol. (Phila) 2017 55 1072 254 29185815 \n16 Thomas S Duarte Davidson R National Poisons Information Service Report 2017/18 [Internet] 2018 Available from: https://www.awttc.org/news/NPIS-Annual-Report-2017-18 \n17 Thomsen RW Riis A Munk EM Nørgaard M Christensen S Sørensen HT 30-day mortality after peptic ulcer perforation among users of newer selective COX 2 inhibitors and traditional NSAIDs: a population based study Am. J. Gastroenterol 2006 101 2704 17026569 \n18 Straube S Tramèr MR Moore RA Derry S McQuay HJ Mortality with upper gastrointestinal bleeding and perforation: effects of time and NSAID use BMC Gastroenterol 2009 9 41 19500343 \n19 Goodson NJ Brookhart AM Symmons DPM Silman AJ Solomon DH Non-steroidal anti-inflammatory drug use does not appear to be associated with increased cardiovascular mortality in patients with inflammatory polyarthritis: results from a primary care based inception cohort of patients Ann. Rheum. Dis 2009 68 367 72 18408253 \n20 Conaghan PG A turbulent decade for NSAIDs: update on current concepts of classification, epidemiology, comparative efficacy, and toxicity Rheumatol. Int 2012 32 1491 502 22193214 \n21 Lanas A Ferrandez A Inappropriate prevention of NSAID induced gastrointestinal events among long term users in the elderly Drugs Aging 2007 24 121 31 17313200 \n22 Schüssel K Schulz M Prescribing of COX 2 inhibitors in Germany after safety warnings and market withdrawals Int. J. Pharm. Sci. Rev. Res 2006 61 878 86 \n23 Greenberg JD Fisher MC Kremer J Chang H Rosenstein ED Kishimoto M Lee S Yazici Y Kavanaugh A Abramson SB The COX 2 inhibitor market withdrawals and prescribing patterns by rheumatologists in patients with gastrointestinal and cardiovascular risk Clin. Exp. Rheumatol 2009 27 395 \n24 Hadgraft J Lowe NJ Hensby C Formulation of anti-inflammatory agents Nonsteroidal anti-inflammatory drugs 1989 New York Karger Publisher 21 43 \n25 Chen HW Chen KC Chen JS Colchicine and NSAID combination causing acute kidney injury J. Coll. Physicians Surg. Pak 2012 22 737 9 23146861 \n26 Jones A Over the counter analgesics: a toxicologic perspective Am. J. Ther 2002 9 245 57 11941384\n\n", "fulltext_license": "CC BY", "issn_linking": "1726-6882", "issue": "18(Suppl1)", "journal": "Iranian journal of pharmaceutical research : IJPR", "keywords": "Adverse effects; Anti-inflammatory agents; Non-steroidal; Overdose; Poisoning", "medline_ta": "Iran J Pharm Res", "mesh_terms": null, "nlm_unique_id": "101208407", "other_id": null, "pages": "249-257", "pmc": null, "pmid": "32802104", "pubdate": "2019", "publication_types": "D016428:Journal Article", "references": "18408253;519499;18072160;16542487;20419362;29185815;17069430;22193214;19604430;28005273;12432916;23146861;10195372;17273120;19500343;3747087;2188537;17313200;7202518;11941384;12755960;12723749;17026569", "title": "Pattern of NSAID Poisoning in a Referral Poisoning Center of Iran: Solutions to Reduce the Suicide.", "title_normalized": "pattern of nsaid poisoning in a referral poisoning center of iran solutions to reduce the suicide" }
[ { "companynumb": "IR-BION-008986", "fulfillexpeditecriteria": "1", "occurcountry": "IR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "IBUPROFEN" }, "drugadditional": null, "drugadm...
{ "abstract": "BACKGROUND\nErectile dysfunction (ED) is very common among heart failure patients and has a very dramatic, negative impact on patients' quality of life. Both ED and heart failure have several risk factors in common; however, little data exist on the correlation between the heart failure-targeted interventions and improvement of ED.\n\n\nOBJECTIVE\nTo report a case of improved sexual function after cardiac resynchronization.\n\n\nMETHODS\nWe report the case of a 63-year-old man with ischemic cardiomyopathy and long-standing ED, who experienced significant improvement of his sexual function following biventricular pacing device implantation. Notably, earlier interventions attempting to improve his ED, namely, heart failure medication adjustments and phosphodiesterase-5 inhibitors, have failed.\n\n\nRESULTS\nFollowing cardiac resynchronization therapy, patient's erectile function improved without any other ED-specific treatment.\n\n\nCONCLUSIONS\nTo the best of our knowledge, this is the first report of improved sexual function in a patient with heart failure and ED following cardiac resynchronization therapy. Although the exact mechanisms remain unknown, we believe that cardiac resynchronization improves ED through improved cardiac and endothelial function.", "affiliations": "Cedars Sinai Heart Institute, Los Angeles, CA 90048, USA.", "authors": "Domanski|Damian|D|;Rosanio|Salvatore|S|;Schwarz|Ernst R|ER|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1111/j.1743-6109.2009.01281.x", "fulltext": null, "fulltext_license": null, "issn_linking": "1743-6095", "issue": "6(10)", "journal": "The journal of sexual medicine", "keywords": null, "medline_ta": "J Sex Med", "mesh_terms": "D002304:Cardiac Pacing, Artificial; D002311:Cardiomyopathy, Dilated; D006801:Humans; D018783:Impotence, Vasculogenic; D008297:Male; D008875:Middle Aged; D010410:Penile Erection; D016896:Treatment Outcome", "nlm_unique_id": "101230693", "other_id": null, "pages": "2910-4", "pmc": null, "pmid": "19453907", "pubdate": "2009-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Improved erectile function after cardiac resynchronization therapy in a patient with heart failure-a case report.", "title_normalized": "improved erectile function after cardiac resynchronization therapy in a patient with heart failure a case report" }
[ { "companynumb": "US-DRREDDYS-USA/USA/17/0086155", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nIncreased susceptibility to infections is among the main safety concerns raised by biological agents. We describe five cases of Whipple's disease diagnosed during treatment with biological agents.\n\n\nMETHODS\nWe retrospectively identified five cases of Whipple's disease diagnosed between 2003 and 2009 in patients treated with TNFalpha antagonists in five French hospitals.\n\n\nRESULTS\nFive patients (four male; mean age: 50.4 years; range: 38-67) underwent biological therapy according to prior diagnoses of rheumatoid arthritis (n=2), ankylosing spondylitis (n=2), or spondyloarthropathy (n=1). Biological therapy failed to control the disease, which responded to appropriate antibiotics for Whipple's disease. Retrospectively, clinical symptoms before biological therapy were consistent with Whipple's disease. All five patients had favorable outcomes (mean follow-up, 29 months [13-71]).\n\n\nCONCLUSIONS\nBiological therapy probably worsened preexisting Whipple's disease, triggering the visceral disorders. Whipple's disease must be ruled out in patients with joint disease, as patients with this spontaneously fatal condition should not receive immunosuppressive agents.", "affiliations": "Service de rhumatologie, Inserm U922, centre hospitalier universitaire d'Angers, 4, rue Larrey, 49933 Angers cedex 9, France. emhoppe@chu-angers.fr", "authors": "Hoppé|Emmanuel|E|;Masson|Charles|C|;Audran|Maurice|M|;Drillon|Marie|M|;Andreu|Marita|M|;Saraux|Alain|A|;Berthelot|Jean-Marie|JM|;Maugars|Yves|Y|;Hmamouchi|Ihsane|I|;Morel|Jacques|J|", "chemical_list": "D000900:Anti-Bacterial Agents; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D007074:Immunoglobulin G; D007166:Immunosuppressive Agents; D018124:Receptors, Tumor Necrosis Factor; D014409:Tumor Necrosis Factor-alpha; D006886:Hydroxychloroquine; D000069285:Infliximab; D000068879:Adalimumab; D004318:Doxycycline; D000068800:Etanercept", "country": "France", "delete": false, "doi": "10.1016/j.jbspin.2010.03.015", "fulltext": null, "fulltext_license": null, "issn_linking": "1297-319X", "issue": "77(4)", "journal": "Joint bone spine", "keywords": null, "medline_ta": "Joint Bone Spine", "mesh_terms": "D000068879:Adalimumab; D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D001172:Arthritis, Rheumatoid; D004318:Doxycycline; D000068800:Etanercept; D005260:Female; D006801:Humans; D006886:Hydroxychloroquine; D007074:Immunoglobulin G; D007166:Immunosuppressive Agents; D000069285:Infliximab; D008297:Male; D008875:Middle Aged; D018124:Receptors, Tumor Necrosis Factor; D012189:Retrospective Studies; D025242:Spondylarthropathies; D013167:Spondylitis, Ankylosing; D014409:Tumor Necrosis Factor-alpha; D008061:Whipple Disease", "nlm_unique_id": "100938016", "other_id": null, "pages": "335-9", "pmc": null, "pmid": "20471891", "pubdate": "2010-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Whipple's disease diagnosed during biological treatment for joint disease.", "title_normalized": "whipple s disease diagnosed during biological treatment for joint disease" }
[ { "companynumb": "FR-CELLTRION INC.-2017FR006357", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", ...
{ "abstract": "Ralstonia mannitolilytica (R. mannitolilytica.) is an emerging aerobic Gram-negative bacteria causing infection among immunocompromised patients. R. mannitolilytica, has been described in hospital outbreaks, mainly as bloodstream infection, but also as meningitis, hemoperitoneum infection and post renal transplant infection. We describe the first reported case of R. mannitolilytica infective endocarditis.", "affiliations": "Internal Medicine Department, Centro Hospitalar de São João, Porto, Portugal.;Internal Medicine Department, Centro Hospitalar de São João, Porto, Portugal.;Internal Medicine Department, Centro Hospitalar de São João, Porto, Portugal.;Unit for the Prevention and Control of Infection and Antimicrobial Resistance, Centro Hospitalar de São João, Porto, Portugal.", "authors": "Carreira|Marta|M|;Gomes|Clara|C|;Silva|Margarida|M|;Duro|Raquel|R|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.idcr.2020.e01003", "fulltext": "\n==== Front\nIDCases\nIDCases\nIDCases\n2214-2509 Elsevier \n\nS2214-2509(20)30311-5\n10.1016/j.idcr.2020.e01003\ne01003\nArticle\nRalstonia mannitollylitica endocarditis: A case report\nCarreira Marta marta.soares.c@gmail.coma⁎ Gomes Clara a Silva Margarida a Duro Raquel b a Internal Medicine Department, Centro Hospitalar de São João, Porto, Portugal\nb Unit for the Prevention and Control of Infection and Antimicrobial Resistance, Centro Hospitalar de São João, Porto, Portugal\n⁎ Corresponding author at: Internal Medicine Department, Centro Hospitalar de São João, Alameda Prof. Hernâni Monteiro, 4200–319, Porto, Portugal. marta.soares.c@gmail.com\n27 10 2020 \n2020 \n27 10 2020 \n22 e0100328 8 2020 24 10 2020 24 10 2020 © 2020 Published by Elsevier Ltd.2020This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Highlights\n• Ralstonia mannitolilytica infective endocarditis is extremely rare.\n\n• Early recognition and correct approach is critical.\n\n• Antimicrobial treatment is difficult, especially in the presence of resistance.\n\n\n\nRalstonia mannitolilytica (R. mannitolilytica.) is an emerging aerobic Gram-negative bacteria causing infection among immunocompromised patients. R. mannitolilytica, has been described in hospital outbreaks, mainly as bloodstream infection, but also as meningitis, hemoperitoneum infection and post renal transplant infection. We describe the first reported case of R. mannitolilytica infective endocarditis.\n\nKeywords\nRalstonia mannitolilyticaInfective endocarditisBacteremia\n==== Body\nIntroduction\nRalstonia spp. are aerobic Gram-negative non-fermentative bacteria that can be found in water and soil, now emerging as an opportunistic pathogen causing infection among immunocompromised patients [1]. Ralstonia mannitolilytica (R. mannitolilytica) has been previously associated with bloodstream infection [2], [3], [4]\n\nWe report a rare case of persistent R. mannitolytica bacteremia which lead to the diagnosis of infective endocarditis (IE).\n\nCase\nA 60 year-old man with a past medical history of alcoholism and chronic liver disease (Child-Pugh A), secondary insulin-dependent diabetes mellitus and diabetic nephropathy with end-stage renal disease (ESRD), began intermittent hemodialysis eight months before admission, initially through a right jugular central venous dialysis catheter. Since he presented fever, blood cultures were performed and R. mannitolilytica was isolated. The patient was treated with ceftazidime for two weeks and central venous catheter was removed, presenting then a functional right brachial arteriovenous fistula. Transthoracic and transesophageal echocardiograms were negative for signs of endocarditis. However, fever persisted, as well as positive blood cultures for Gram-negative bacilli, so the patient was admitted to further investigation.\n\nThe patient reported no complaints, physical examination was unremarkable, and chest radiograph and abdominal ultrasound showed no signs of infection. Another transesophageal echocardiogram (Fig. 1) was performed, presenting now a large and fistulized abscess located close to the left coronary cusp, with a continuous shunt directed towards the left atrium and part of its content protruding on the left ventricle outflow tract. The aortic valve was functionally bicuspid and showed moderate regurgitation. As such, the diagnosis of infective endocarditis was established, according to the modified Duke criteria.Fig. 1 Transesophageal echocardiogram (TTE) in Midesophageal Long-Axis view (ME LAX) showing an aortic valve involved by endocarditis (A). Note that the mitral apparatus (B) doesn’t show any signs of involvement.\n\nFig. 1\n\nThe persistently isolated R. mannitolilytica was resistant to beta-lactam antibiotics (including carbapenems) and colistin, being only sensitive to trimethoprim/sulfamethoxazole (TMP-SMX) and ciprofloxacin. The patient was treated with ciprofloxacin (400 mg after dialysis on dialysis days) and TMP-SMX (5 mg/kg/day of the TMP component, after dialysis on dialysis days) in combination for two weeks, with decreasing fever spikes, but maintaining positive blood cultures. In subsequent blood cultures, sensitivity tests showed resistance to ciprofloxacin (minimum inhibitory concentration = 4 mg/L, EUCAST breakpoint) but still susceptibility to TMP-SMX (minimum inhibitory concentration of 0,5 mg/L, EUCAST breakpoint). The patient continued treatment exclusively with a higher dose of TMP-SMX of 15 mg/kg/day of the TMP component after dialysis, on dialysis days.\n\nContrast-enhanced cardiac computed tomography (Fig. 2) suggested a contained rupture of a pseudoaneurysm in the aortic angle, measuring 27 × 15 mm on axial and 25 mm on coronal planes, in close relation to the left sinus of Valsalva (immediately inferior), its neck located 16 mm from left coronary ostium origin. The patient was referred for cardiothoracic surgery, which was performed at 36th day in-hospital, with incision and drainage of perivalvular abscess, closure of fistula to the left atrium, closure of abscess with bovine pericardium and replacement of the aortic valve with bioprosthetic valve. Aortic valve culture isolated R. mannitolilytica with similar MIC for TMP-SMX. After surgery, three sets of blood cultures were negative. Because of large-volume pericardial effusion with cardiac tamponade, the patient was submitted to pericardiotomy nine days later and transesophageal echocardiogram performed during surgery showed a normofunctioning aortic valve and no vegetations or fistulas. Although he had persistently negative blood cultures after the first surgical intervention, he could not be weaned off vasopressors nor continuous venovenous hemofiltration, maintaining high serum inflammatory markers and altered mental status. Blood cultures collected on 23rd day of antibiotics after the first negative blood cultures, showed growth of yeasts, later identified as Candida albicans. The patient started treatment with caspofungin but died two days later.Fig. 2 Contrast-enhanced cardiac computed tomography showing a contained rupture of a pseudoaneurysm in the aortic angle.\n\nFig. 2\n\nDiscussion\nInfection due to Ralstonia spp. is becoming more prevalent mainly due to three bacterial species: Ralstonia pickettii, Ralstonia insidiosa and Ralstonia mannitolilytica\n[1]. Usually isolated in water and soil samples, these bacteria are widespread in many different types of water supplies, including hospital water supplies [1]. Ralstonia spp. persists in sterile solutions due to its ability to grow and survive over a wide range of temperatures (15–42 °C) and pass through both 0.2 and 0.45 μm filters, which are used to filter-sterilize medical solutions [5].\n\nR. mannitolilytica, has been described in a few hospital outbreaks, mainly as bloodstream infection [2], [3], [4], but also as meningitis [6], hemoperitoneum infection [6] and post renal transplant infection [7]. All patients with previously reported R. mannitolytica infection recovered completely [2], [3], [4], [6], [7].\n\nThere have been only two previous reports of endocarditis associated with Ralstonia spp [8], [9]. Both patients had bloodstream infection thought to be associated to an indwelling catheter or intravenous drug abuse. Both patients died. To the best of our knowledge this is the first reported case of R. mannitolilytica infective endocarditis\n\nRisk factors for Ralstonia infection are not well established but appear to include immunocompromised patients, indwelling devices and neonates [1]. Our patient had a few predisposing factors that could facilitate Ralstonia infection Firstly, he was diabetic, presented chronic liver disease Child-Pugh A and had a central venous catheter placed for intermittent hemodialysis eight months earlier. Although previous outbreaks have implicated hemodialysis machines, this was an isolated case. On the other hand, he was later found to have a bicuspid aortic valve which is a well-known risk factor for infective endocarditis and associated complications such as valve destruction and abscess formation [10].\n\nThere is no standardized empirical treatment for Ralstonia infection and data about antimicrobial susceptibility is scarce. R. mannitolilytica is intrinsically resistant to colistin with variable susceptibility to ceftazidime, cefepime, carbapenem and aminoglycosides [11]. In previously reported cases, all R. mannitolilytica associated bloodstream infection showed susceptibility to sulfamethoxazole-trimethoprim and most of the strains appeared susceptible to fluoroquinolones, cefotaxime and piperacillin-tazobactam [11].\n\nWhen the patient first presented to our hospital he had already been treated with ceftazidime for two weeks. Isolated R. mannitolilytica was resistant to all beta-lactam antibiotics, being only sensitive to TMP-SMX and ciprofloxacin. Similarly to standardized Gram negative infective endocarditis treatment we chose to treat the patient with two antibiotics, each from a different antimicrobial class, which allows for two different mechanisms of bacterial killing. TMP-SMX is a combination antibiotic comprised of a dihydrofolate reductase inhibitor and a folic acid synthesis inhibitor that block sequential steps in folic acid synthesis in susceptible bacteria. The usual dose is 5−10 mg/kg q6−12 hours, based on the TMP component, although higher doses are recommend when treating nocardiosis or Pneumocystis pneumonia. In dialysis patients the usual dose is 5−10 mg/kg q24hours after dialysis on dialysis days. We chose to start with a smaller dose giving the risk of intolerance and the uncertainty of the correct dosage. However, once resistance to ciprofloxacin was documented and considering the high risk of failure, we adjusted to a higher dose to improve the chances of cure with close monitoring of possible side effects.\n\nSurgery was initially delayed for it was perceived to be of high risk due to the patient’s functional status and comorbidities (ESRD and chronic liver disease).\n\nHowever, R. mannitolilytica easily acquires antimicrobial resistance, as emphasized by our case in which it gained resistance to ceftazidime and ciprofloxacin after being exposed to these drugs for two weeks. Persistent bacteremia despite appropriate treatment prompted surgery, which appeared to efficiently control infection. Unfortunately the patient died due to complications of surgery and fungemia.\n\nThis case highlights a very rare form of infection due to Ralstonia spp. Endocarditis was initially deemed unlikely because ETT had no evidence of vegetations or de novo valvular changes and Ralstonia spp is not a typical agent of IE. However, the diagnosis of IE was later established and R. mannitolilytica acquired progressive resistance to the antibiotics. This case illustrates that despite its rarity Ralstonia infection should be considered and managed appropriately, especially in ESRD patients.\n\nFunding\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nEthical approval\nPatient family’s written consent has been obtained before writing and submitting this manuscript.\n\nCRediT authorship contribution statement\nMarta Carreira: Writing - original draft, Writing - review & editing. Clara Gomes: Writing - review & editing. Margarida Silva: Writing - review & editing. Raquel Duro: Supervision.\n\nDeclaration of Competing Interest\nThe authors of this manuscript have no conflicts of interests.\n==== Refs\nReferences\n1 Ryan M.P. Adley C.C. Ralstonia spp.: emerging global opportunistic pathogens Eur J Clin Microbiol Infect Dis 33 3 2014 291 304 24057141 \n2 Dowsett E. Hospital infections caused by contaminated fluids Lancet 1 7764 1972 1338 \n3 Daxboeck F. Characterization of clinically isolated Ralstonia mannitolilytica strains using random amplification of polymorphic DNA (RAPD) typing and antimicrobial sensitivity, and comparison of the classification efficacy of phenotypic and genotypic assays J Med Microbiol 54 Pt 1 2005 55 61 15591256 \n4 Gröbner S. Monoclonal outbreak of catheter-related bacteraemia by Ralstonia mannitolilytica on two haemato-oncology wards J Infect 55 6 2007 539 544 17881058 \n5 Anderson R.L. Factors associated with Pseudomonas pickettii intrinsic contamination of commercial respiratory therapy solutions marketed as sterile Appl Environ Microbiol 50 6 1985 1343 1348 4091563 \n6 Vaneechoutte M. One case each of recurrent meningitis and hemoperitoneum infection with Ralstonia mannitolilytica J Clin Microbiol 39 12 2001 4588 4590 11724893 \n7 Mukhopadhyay C. Bhargava A. Ayyagari A. Ralstonia mannitolilytica infection in renal transplant recipient: first report Indian J Med Microbiol 21 4 2003 284 286 17643046 \n8 Graber C.D. Endocarditis due to a lanthanic, unclassified Gram-negative bacterium (group IV d) Am J Clin Pathol 49 2 1968 220 223 5183825 \n9 Orme J. Native valve endocarditis due to Ralstonia pickettii: a case report and literature review Case Rep Infect Dis 2015 2015 324675 25648998 \n10 Lamas C.C. Eykyn S.J. Bicuspid aortic valve--a silent danger: analysis of 50 cases of infective endocarditis Clin Infect Dis 30 2 2000 336 341 10671338 \n11 Boattini M. Ralstonia mannitolilytica bacteraemia: a case report and literature review Infez Med 26 4 2018 374 378 30555144\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2214-2509", "issue": "22()", "journal": "IDCases", "keywords": "Bacteremia; Infective endocarditis; Ralstonia mannitolilytica", "medline_ta": "IDCases", "mesh_terms": null, "nlm_unique_id": "101634540", "other_id": null, "pages": "e01003", "pmc": null, "pmid": "33204634", "pubdate": "2020", "publication_types": "D002363:Case Reports", "references": "30555144;17881058;17643046;25648998;4113427;4091563;15591256;10671338;24057141;11724893;5183825", "title": "Ralstonia mannitollylitica endocarditis: A case report.", "title_normalized": "ralstonia mannitollylitica endocarditis a case report" }
[ { "companynumb": "PT-TEVA-2021-PT-1938109", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CEFTAZIDIME" }, "drugadditional": "3", ...
{ "abstract": "A 43-year-old male received intravenous propofol, atracurium and gentamicin and experienced cardiovascular collapse with the features of an acute drug reaction. Prolonged cardiopulmonary resuscitation with fluids and large amounts of adrenaline and noradrenaline led to full recovery without neurological deficit. No biochemical abnormality was detected.", "affiliations": "Department of Anaesthesia, Derriford Hospital, Plymouth, UK.", "authors": "Sneyd|J R|JR|", "chemical_list": "D000316:Adrenergic alpha-Agonists; D018686:Anesthetics, Intravenous; D000900:Anti-Bacterial Agents; D005839:Gentamicins; D003473:Neuromuscular Nondepolarizing Agents; D014662:Vasoconstrictor Agents; D001279:Atracurium; D009638:Norepinephrine; D015742:Propofol; D004837:Epinephrine", "country": "England", "delete": false, "doi": "10.1046/j.1365-2346.1998.00360.x", "fulltext": null, "fulltext_license": null, "issn_linking": "0265-0215", "issue": "15(5)", "journal": "European journal of anaesthesiology", "keywords": null, "medline_ta": "Eur J Anaesthesiol", "mesh_terms": "D000316:Adrenergic alpha-Agonists; D000328:Adult; D018686:Anesthetics, Intravenous; D000900:Anti-Bacterial Agents; D001279:Atracurium; D016887:Cardiopulmonary Resuscitation; D004342:Drug Hypersensitivity; D004837:Epinephrine; D005440:Fluid Therapy; D005500:Follow-Up Studies; D005839:Gentamicins; D006801:Humans; D008297:Male; D003473:Neuromuscular Nondepolarizing Agents; D009638:Norepinephrine; D015742:Propofol; D012769:Shock; D014662:Vasoconstrictor Agents", "nlm_unique_id": "8411711", "other_id": null, "pages": "600-2", "pmc": null, "pmid": "9785077", "pubdate": "1998-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Catecholamine-resistant cardiovascular collapse after propofol, atracurium and gentamicin.", "title_normalized": "catecholamine resistant cardiovascular collapse after propofol atracurium and gentamicin" }
[ { "companynumb": "GB-PFIZER INC-04H-167-0271850-00", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "GENTAMICIN SULFATE" }, "drugadditional...
{ "abstract": "Introduction Ophthalmic segment aneurysms may present with visual symptoms due to direct compression of the optic nerve. Treatment of these aneurysms with the Pipeline embolization device (PED) often results in visual improvement. Flow diversion, however, has also been associated with occlusion of the ophthalmic artery and visual deficits in a small subset of cases. Case report A 49-year-old Caucasian female presented with subarachnoid hemorrhage due to a ruptured anterior communicating artery aneurysm. On follow-up imaging, the patient was found to have a right asymptomatic ophthalmic segment aneurysm. Due to the irregular shape of the aneurysm and history of aneurysmal subarachnoid hemorrhage, the decision was made to treat the aneurysm with a PED. Postoperatively, the patient complained of floaters in the right eye. Detailed ophthalmologic examination showed retinal hemorrhage and cotton-wool spots on the macula. Such complication after PED placement has never been reported in the literature. Conclusion Visual complications after PED placement for treatment of ophthalmic segment aneurysms are rare. It is thought that even in cases where the ophthalmic artery occludes, patients remain asymptomatic due to the rich collateral supply from the external carotid artery branches. Here we report a patient who developed an acute retinal hemorrhage after PED placement.", "affiliations": "1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.;1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.;1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.;1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.;2 The Medical Eye Center, Manchester, USA.;1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.;1 Department of Neurosurgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, USA.", "authors": "Adeeb|Nimer|N|;Moore|Justin|J|;Griessenauer|Christoph J|CJ|http://orcid.org/0000-0002-2952-3812;Gupta|Raghav|R|;Fazelat|Ahad A|AA|;Ogilvy|Christopher S|CS|;Thomas|Ajith J|AJ|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1177/1591019918771929", "fulltext": null, "fulltext_license": null, "issn_linking": "1591-0199", "issue": "24(4)", "journal": "Interventional neuroradiology : journal of peritherapeutic neuroradiology, surgical procedures and related neurosciences", "keywords": "Pipeline; complications; flow diversion; hemorrhage; retinal; visual", "medline_ta": "Interv Neuroradiol", "mesh_terms": "D000208:Acute Disease; D015901:Angiography, Digital Subtraction; D002533:Cerebral Angiography; D004621:Embolization, Therapeutic; D005260:Female; D006801:Humans; D002532:Intracranial Aneurysm; D008875:Middle Aged; D009880:Ophthalmic Artery; D012166:Retinal Hemorrhage", "nlm_unique_id": "9602695", "other_id": null, "pages": "383-386", "pmc": null, "pmid": "29754516", "pubdate": "2018-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "25339649;23723311;22790243;25385746;25584955;26943842;23485409;26162031;22224787;28559080;25624975", "title": "Acute retinal hemorrhage after Pipeline embolization device placement for treatment of ophthalmic segment aneurysm: A case report.", "title_normalized": "acute retinal hemorrhage after pipeline embolization device placement for treatment of ophthalmic segment aneurysm a case report" }
[ { "companynumb": "US-BAYER-2018-146597", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadditional": null, "dr...
{ "abstract": "Diclofenac and dexamethasone injection mixture could be associated with fatal cardiovascular events, further studies are warrantied to explore the safety of this injection mixture and explore the genetic role of it.", "affiliations": "Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.;Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.;Faculty of Medicine Umm Alqura University Mecca Saudi Arabia.;Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.;Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.;Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.;Baiji General Hospital Ministry of Health Salah ad Din Iraq.;Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan.", "authors": "Naser|Abdallah Y|AY|https://orcid.org/0000-0001-8440-7446;Qadus|Sami|S|;Alwafi|Hassan|H|;Jarrar|Qais|Q|;Ayoub|Rami|R|;Jaradat|Abdolelah Ali|AA|;Atiyah|Riyadh Mohammed|RM|;Alqaisy|Abdulrahman Ibrahim|AI|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1002/ccr3.3988", "fulltext": "\n==== Front\nClin Case Rep\nClin Case Rep\n10.1002/(ISSN)2050-0904\nCCR3\nClinical Case Reports\n2050-0904\nJohn Wiley and Sons Inc. Hoboken\n\n10.1002/ccr3.3988\nCCR33988\nCase Report\nCase Reports\nDexamethasone and diclofenac intramuscular mixture injection and risk of death: A case series study\nNASER et al.\nNaser Abdallah Y. https://orcid.org/0000-0001-8440-7446\n1 abdallah.naser@iu.edu.jo\n\nQadus Sami 1\nAlwafi Hassan 2\nJarrar Qais 1\nAyoub Rami 1\nJaradat Abdolelah Ali 1\nAtiyah Riyadh Mohammed 3\nAlqaisy Abdulrahman Ibrahim 1\n1 Department of Applied Pharmaceutical Sciences and Clinical Pharmacy Faculty of Pharmacy Isra University Amman Jordan\n2 Faculty of Medicine Umm Alqura University Mecca Saudi Arabia\n3 Baiji General Hospital Ministry of Health Salah ad Din Iraq\n* Correspondence\nAbdallah Y. Naser, Department of Applied Pharmaceutical Sciences and Clinical Pharmacy, Faculty of Pharmacy, Isra University, Amman, Jordan.\nEmail: abdallah.naser@iu.edu.jo\n\n27 2 2021\n4 2021\n9 4 10.1002/ccr3.v9.4 22182221\n08 2 2021\n01 2 2021\n13 2 2021\n© 2021 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.\n\nAbstract\n\nDiclofenac and dexamethasone injection mixture could be associated with fatal cardiovascular events, further studies are warrantied to explore the safety of this injection mixture and explore the genetic role of it.\n\nDexamethasone and diclofenac are commonly used medications for multiple anti inflammatory and analgesic purposes. Despite the multiple evidences on the synergistic anti inflammatory actions of them, there are no studies on the safety of mixing them in the same syringe for injection. Three patients have died due to cardiovascular events within 24 hours of receiving dexamethasone and diclofenac injection mixture, which we hypothesis that it could be the main reason for their death due to potential drug‐drug interaction.\n\ncardiovascular\ndexamethasone\ndiclofenac\nmixture\nsafety\nsource-schema-version-number2.0\ncover-dateApril 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.2 mode:remove_FC converted:27.04.2021\nNaser AY , Qadus S , Alwafi H , et al. Dexamethasone and diclofenac intramuscular mixture injection and risk of death: A case series study. Clin Case Rep. 2021;9 :2218–2221. 10.1002/ccr3.3988\n==== Body\n1 CASES PRESENTATION\n\nSteroidal and nonsteroidal anti‐inflammatory medications are associated with adverse events including hematobiochemical and immunological changes, and cardiovascular events. Three patients died after being given an intramuscular injection of a mixed diclofenac sodium and dexamethasone. We hypothesized that this combination may be fatal in some cases.\n\nData were extracted from the medical records at Baiji General Hospital, Ministry of Health, Salah ad Din, Iraq. The three patients were males who aged from 28 to 60 years. Two of the patients had comorbidities (diabetes mellitus, hypertension, and dyslipidemia) and they were on treatments while the third was not complaining of previous diseases. Two patients were smokers; none of them were alcoholic or allergic to any medication. In the 24 hours prior to their death, the patients complained of various symptoms such as abdominal pain, headache, and loss of appetite. However, immediately prior to their death, the patients’ main complaints were chest pain, shortness of breath, severe vomiting, and hyperthermia. The only common thing in between them is that they have received diclofenac and dexamethasone injection mixture in the 24 hours prior to their death (Table 1).\n\nTABLE 1 Characteristics of the patients\n\nAge (years)\tGender\tComorbidities\tTreatment received before death\tCause of death\tMedication use history\tSymptoms presented 24 h before death\tSymptoms presented immediately before death\tSmoking history\t\n40\tMale\tHypertension and dyslipidemia\tDiclofenac, dexamethasone, and Ampiclox (ampicillin + cloxacillin)\tMyocardial infarction\tEnalapril, thiazide, spironolactone, statin, and vitamin E\tHeadache\tChest pain and shortness of breath\tYes\t\n60\tMale\tHypertension, type 2 diabetes mellitus, and dyslipidemia\tDiclofenac and dexamethasone\tMyocardial infarction\tMetformin, metoprolol, valsartan, and diuretics\tNone\tChest pain and shortness of breath\tNo\t\n28\tMale\tNone\tDiclofenac, dexamethasone, congestal (chloropheniramine, dextromethorphan, acetaminophen, and pseudoephedrine), and paracetamol.\tHeart attack\tNone\tLoss of appetite and abdominal pain\tAbdominal pain, hyperthermia, and severe vomiting\tYes\t\nJohn Wiley & Sons, Ltd\n\n2 DISCUSSION\n\nAnti‐inflammatory drugs alleviate inflammation by decreasing the plasma concentration of the inflammatory mediators that are released during the inflammatory response. 1 , 2 Steroidal anti‐inflammatory drugs (SAIDs) and nonsteroidal anti‐inflammatory drugs (NSAIDs) are the most commonly used anti‐inflammatory drugs for pain management. SAIDs inhibit the release of arachidonic acid, the precursor of prostaglandins, whereas NSAIDs inhibit the cyclooxygenase‐1 or cyclooxygenase‐2 (COX‐ 1 or COX‐ 2) enzyme. Both classes have proven a high efficacy in relieving pain, reducing inflammation, and fever. 3 Anti‐inflammatory medications are associated with adverse reactions including hematobiochemical and immunological changes, and cardiovascular and gastrointestinal adverse effects. 4 In a study comprising a large database in the UK, it has been reported that extensive use of diclofenac substantially increases the risk of acute myocardial infarction (AMI). 5 Similarly, previous studies reported a relationship between the use of diclofenac and the development of cardiovascular problems including myocardial infarction. 5 , 6 , 7 , 8 Preclinical studies have shown that diclofenac treatment caused significant molecular and histological alterations in mouse hearts after repeated‐dose administration. 9 On the other hand, it has been revealed that diclofenac can cause a significant increase in plasma cardiac markers at single‐dose treatment in ram. 10 Recently, a Danish review of a series of 252 nationwide cohort studies compared the adverse cardiovascular events related to diclofenac therapy. The study has found that diclofenac initiators were at increased risk of major adverse cardiovascular events (atrial fibrillation or flutter, ischemic stroke, heart failure, acute myocardial infarction, and cardiac death) when compared to initiators with other NSAIDs or paracetamol. 7 The study has also found that the risk of a first cardiovascular event is significantly greater for 30‐day use of diclofenac than for a 30‐day use of other NSAIDs or paracetamol. Diclofenac sodium cause marked increase in aspartate aminotransferase (AST) and alanine aminotransferase (ALT), urea, and creatinine levels. 11 These disturbances of liver and kidney function tests may be due to its serious side effects (such as gastrointestinal ulceration or bleeding, kidney and liver damage, myocardial infarction, and cardiac sudden death 12 , 13 ) as well as increase in ALP and AST may be attributed to cardiovascular side effects of diclofenac, which may induce myocardial damage or infarction that are related to the inhibition of Cox synthesis. 10 Additionally, the change in the balance between COX‐1 and COX‐2 activities in the body has been suggested to have a role in triggering multiple adverse effects including GI complications, bleeding disorder, and cardiogenic events. 14\n\nDexamethasone cause marked decrease in total protein, gamma globulin, and total globulin beside insignificant decrease in albumin. 4 Dexamethasone can also cause cardiovascular effects including alterations in heart‐pressure measurement. 15 Sholter et al 16 have also reported adverse cardiovascular events associated with the long‐term use of corticosteroids. The main reported side effects were dyslipidemia, hypertension, and left ventricular wall rupture after myocardial infarction. It has been concluded that these effects may predispose treated patients to coronary artery disease when high doses and prolonged courses of treatment are used. 16 The separate use of members of both steroidal and nonsteroidal classes have been well established for the management of acute as well as chronic inflammatory conditions. 2 , 17 , 18 , 19 , 20 However, the combined use of both steroidal and nonsteroidal anti‐inflammatory drugs (mixed in the same injection) is not commonly explored and has less clear‐cut outcomes. In the Middle East region, mixing dexamethasone and diclofenac sodium in the same syringe, and administering the mixture intramuscularly to patients complaining of severe pain, is a common practice. However, there is a scarcity in the research concerning the safety of the parenteral combination of corticosteroids and NSAIDs in the same syringe.\n\nIn this article, we report the clinical characteristics of three patients who died due to heart attack or MI. However, the only common thing we have found among the deceased subjects is that they have been administered a combined injection of dexamethasone and diclofenac mixed in the same syringe and injected intramuscularly to alleviate certain type of pain or inflammation. Having in mind the possibility of gastrointestinal and cardiovascular side effects induced by anti‐inflammatory drugs, we tend to think about the combination as being the culprit in these cases.\n\nBamgbose et al 21 reported that coadministration of dexamethasone and different NSAIDs have shown to provide synergistic anti‐inflammatory activity. Park et al, 22 2019 suggested that coadministration of NSAID with dexamethasone in a low dose can reduce the dose of both drugs, consequently decreasing the potential side effects of monotherapies in which each drug is separately administered. However, in the abovementioned studies, dexamethasone and different NSAIDs were given separately but at the same time.\n\nTo benefit from the superior therapeutic efficacy and the reduced side effects of diclofenac/dexamethasone combination, both drugs were incorporated in several novel formulations which have been investigated. Elron‐Gross et al have injected a novel combination of the two drugs into mice, which have demonstrated a full biological activity. This formulation has been recommended for the treatment of the most severe cases of osteoarthritis. 23 In a more advanced research, Assali et al 24 have found that a nano‐formulation of the twin‐drug has a sustained release profile with an excellent anti‐inflammatory activity in vivo.\n\nIt has been reported that concomitant therapy of corticosteroids and anticoagulant significantly increase the gastrointestinal complications and bleeding side effects. 25 Hence, coadministration of dexamethasone, a corticosteroid drug, and diclofenac which is an NSAID drug can elevate the risk of GIT ulceration, perforation, and hemorrhagic event induced by NSAID. 26 Moreover, there is a strong evidence that cardiovascular events including stroke and myocardial infarction are associated with diclofenac sodium administration. 27 Additionally, diclofenac potassium and dexamethasone reported to be associated with causing several hematobiochemical and immunological changes. 4 In light of that, an increase in the risk of death due to dexamethasone/diclofenac coadministration could be explained.\n\nThis may suggest that cardiovascular side effects are exacerbated by the coadministration of diclofenac and dexamethasone injection mixture. Inter‐individual variation in this cardiovascular response among the patients with coadministrated drugs may be attributed to many factors such as genetic polymorphisms, health status, and drug‐drug interaction. Thus, further studies including histological investigation are proposed in order to investigate the risk factors involved in the development of cardiovascular effects induced by the coadministration of diclofenac and dexamethasone.\n\n3 CONCLUSION\n\nThere is no clear evidence in the literature on the safety of diclofenac and dexamethasone injection mixture.\n\nDespite that there is no documented fatal effect associated with the use of this mixture; we suggest that mixing them together in the same syringe maybe associated with increased risk of death due to cardiovascular events. Hence, healthcare professionals should be aware of the possibility of fatal cardiovascular events when using this mixture.\n\nCONFLICT OF INTEREST\n\nThe authors declare no conflict of interest.\n\nAUTHOR CONTRIBUTIONS\n\nAN, SQ, and QJ: performed conceptualization, methodology, formal analysis, data curation, validation, writing the original draft, writing‐review and editing, project administration, and funding acquisition. RAtiyah and AA: collected the data. SQ, HA, QJ, RAyoub, and AJ: involved in interpretation, writing the original draft, and writing‐review and editing. AN: provided resources and supervised the study. All authors agreed to be accountable for the content of the work.\n\nETHICAL APPROVAL\n\nEthical approval for this study was obtained from the research ethics committee (REC) at the faculty of pharmacy at Isra University (PH – 2021 ‐ 03)).\n\nACKNOWLEDGMENTS\n\nThis study was supported by Isra University (Amman, Jordan). Published with written consent of the patient.\n\nDATA AVAILABILITY STATEMENT\n\nData sharing is not applicable to this article as no new data were created or analyzed in this study.\n==== Refs\nREFERENCES\n\n1 Sharma J , Al‐Banoon A . The role of inflammatory mediator bradykinin in cardiovascular and renal diseases. Open Access Sci Rep. 2012;1 :1–7.\n2 Vane J , Botting R . Mechanism of action of nonsteroidal anti‐inflammatory drugs. Am J Med. 1998;104 (3 ):2‐8.\n3 Del Grossi MM , Cruz Lopes L , Silva MT , Barberato‐Filho S , Motta RHL , Bergamaschi CC . Use of steroid and nonsteroidal anti‐inflammatories in the treatment of rheumatoid arthritis: systematic review protocol. Medicine. 2018;97 (41 ):e12658.30313057\n4 Aem A , Abo‐Kora SY . Adverse effects of diclofenac potassium and dexamethason on some hematobiochemical and immunological parameters in Egyptian goat bucks. J Am Sci. 2015;11 (7 ):92‐99.\n5 Jick S , Kaye J , Jick H . Diclofenac and acute myocardial infarction in patients with no major risk factors. Br J Clin Pharmacol. 2007;64 (5 ):662‐667.17509036\n6 Jick S . The risk of gastrointestinal bleed, myocardial infarction, and newly diagnosed hypertension in users of meloxicam, diclofenac, naproxen, and piroxicam. Pharmacotherapy. 2000;20 (7 ):741‐744.10907963\n7 Schmidt M , Sorensen HT , Pedersen L . Diclofenac use and cardiovascular risks: series of nationwide cohort studies. BMJ. 2018;362 :k3426.30181258\n8 White W , Faich G , Whelton A , et al. Comparison of thromboembolic events in patients treated with celecoxib, a cyclooxygenase‐2 specific inhibitor, versus ibuprofen or diclofenac. Am J Cardiol. 2002;89 (4 ):425‐430.11835924\n9 Jarrar YB , Jarrar Q , Abed A , Abu‐Shalhoob M . Effects of nonsteroidal anti‐inflammatory drugs on the expression of arachidonic acid‐metabolizing Cyp450 genes in mouse hearts, kidneys and livers. Prostaglandins Other Lipid Mediat. 2019;141 :14‐21.30763676\n10 Er A , Dik B , Corum O , Cetin G . Cardiac safety of diclofenac at a single dose in ram. ScientificWorldJournal. 2013;2013 :808731.24228015\n11 El‐ Maddawy ZK , Ibrahim M . Hepato‐renal and hematological effects of diclofenac sodium in rats. Global J Pharmacol. 2013;7 :123‐132.\n12 Gan TJ . Diclofenac: an update on its mechanism of action and safety profile. Curr Med Res Opin. 2010;26 :1731‐1751.\n13 Hermann M . Cardiovascular risk associated with nonsteroidal anti‐inflammatory drugs. Curr Rheumatol Rep. 2009;11 :31‐35.19171109\n14 Meade EA , Smith WL , DeWitt DL . Differential inhibition of prostaglandin endoperoxide synthase (cyclooxygenase) isozymes by aspirin and other non‐steroidal anti‐inflammatory drugs. J Biol Chem. 1993;268 : 6610‐6614.8454631\n15 Tain Y , Chen C , Sheen J , et al. Melatonin attenuates prenatal dexamethasone‐induced blood pressure increase in a rat model. J Am Soc Hypertens. 2014;8 (4 ):216‐226.24731552\n16 Sholter D , Armstrong P . Adverse effects of corticosteroids on the cardiovascular system. Can J Cardiol. 2000;16 (4 ):505‐511.10787466\n17 Bertolini A , Ottani A , Sandrini M . Dual acting anti‐inflammatory drugs: a reappraisal. Pharmacol Res. 2001;44 (6 ):437‐450.11735348\n18 Pilatti G , André dos Santos F , Bianchi A , Cavassim R , Tozetto C . The use of celecoxib and dexamethasone for the prevention and control of postoperative pain after periodontal surgery. J Periodontol. 2006;77 (11 ):1809‐1814.17076604\n19 Schumacher H , Chen L . Injectable corticosteroids in treatment of arthritis of the knee. Am J Med. 2005;118 (11 ):1208‐1214.16271901\n20 Towheed T . Pennsaid therapy for osteoarthritis of the knee: a systematic review and metaanalysis of randomized controlled trials. J Rheumatol. 2006;33 (3 ):567‐573.16511925\n21 Bamgbose BO , Akinwande JA , Adeyemo WL , Ladeinde AL , Arotiba GT , Ogunlewe MO . Effects of co‐administered dexamethasone and diclofenac potassium on pain, swelling and trismus following third molar surgery. Head Face Med. 2005;1 :11.16274480\n22 Park MK , Kang SH , Son JY , et al. Co‐administered low doses of ibuprofen and dexamethasone produce synergistic antinociceptive effects on neuropathic mechanical allodynia in rats. J Pain Res. 2019;12 :2959‐2968.31802933\n23 Elron‐Gross I , Glucksam Y , Margalit R . Liposomal dexamethasone‐diclofenac combinations for local osteoarthritis treatment. Int J Pharm. 2009;376 (1–2 ):84‐91.19409466\n24 Assali M , Shawahna R , Dayyeh S , Shareef M , Alhimony I . Dexamethasone‐diclofenac loaded polylactide nanoparticles: preparation, release and anti‐inflammatory activity. Eur J Pharm Sci. 2018;12 (122 ):179‐184.\n25 Piper JM , Ray WA , Daugherty JR , Griffin MR . Corticosteroid use and peptic ulcer disease: role of nonsteroidal anti‐inflammatory drugs. Ann Intern Med. 1991;114 (9 ):735‐740.2012355\n26 Lazzaroni M , Bianchi PG . Gastrointestinal side‐effects of traditional non‐steroidal anti‐inflammatory drugs and new formulations. Aliment Pharmacol Ther. 2004;20 :48‐58.\n27 Opr M . Trans‐Tasman early warning system: processes in Australia and New Zealand. 2013.\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2050-0904", "issue": "9(4)", "journal": "Clinical case reports", "keywords": "cardiovascular; dexamethasone; diclofenac; mixture; safety", "medline_ta": "Clin Case Rep", "mesh_terms": null, "nlm_unique_id": "101620385", "other_id": null, "pages": "2218-2221", "pmc": null, "pmid": "33936668", "pubdate": "2021-04", "publication_types": "D002363:Case Reports", "references": "20470236;30181258;19171109;29981402;10787466;11835924;30313057;31802933;11735348;16511925;9572314;15335413;16271901;8454631;2012355;17509036;10907963;17076604;24228015;16274480;24731552;19409466;30763676", "title": "Dexamethasone and diclofenac intramuscular mixture injection and risk of death: A case series study.", "title_normalized": "dexamethasone and diclofenac intramuscular mixture injection and risk of death a case series study" }
[ { "companynumb": "JO-BAUSCH-BL-2021-009691", "fulfillexpeditecriteria": "1", "occurcountry": "IQ", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ENALAPRIL" }, "drugadditional": null, ...
{ "abstract": "Rosuvastatin, is a widely-used statin for the treatment of hypercholesterolemia and the prevention of cardiovascular diseases. Although rosuvastatin is well tolerated, about 3/10.000 patients can suffer severe myopathy. Rhabdomyolysis is a severe medical condition that causes injury to the skeletal muscle, electrolyte imbalances, acute renal failure and extreme creatine kinase (CK) elevation. Little is known regarding the molecular involvement of rosuvastatin-induced rhabdomyolysis (RIR). It has been demonstrated that genomic variants associated with decreased enzymatic activity of proteins are important determinants in plasmatic and skeletal muscle distribution of rosuvastatin and its toxicity. Until now, no interactions of ticagrelor, ezetimibe and rosuvastatin have been described with the consideration of pharmacogenomics predisposition. The present report involves a whole-exome sequencing (WES), in a patient affected by rosuvastatin-induced rhabdomyolysis. A pharmacogenomic dissection was performed by analyzing a comprehensive subset of candidate genes (n=160) potentially related to RIR. The genes were selected according to their implication in drug metabolism or inherited myopathies. Using an innovative approach of bioinformatics analysis, considering rare and common variants, we identified 19 genomic variations potentially related to the pharmacokinetic/pharmacodynamic modifications of rosuvastatin, ezetimibe and ticagrelor. The affected genes are involved in Phase I metabolism (CYP2C19, CYP2E1, CYP1A1, CYP2D6 and CYP2C9), Phase II metabolism (UGT2B15 and UGT2B7), influx transportation (SLCO1B3 and SLCO2B1), efflux transportation (ABCG8, ABCB11, ABCC4 and ABCB1), drug targeting (NPC1L1) and inherited myopathy etiology (OBSCN). We report three rare, potentially pathogenic molecular variants in CYP2C19, NPC1L1 and OBSCN genes. Pharmacogenetic analysis indicated that the patient was a carrier of inactivating alleles in several pharmacogenes involved in drug toxicity. The whole-exome sequencing and bioinformatics analysis presented here represents an innovative way to identify genomic variants contributing with RIR´s origin and evokes the polygenic nature of adverse drug reactions.", "affiliations": "Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.;Medical Clinic Service, Hospital Universitario Mayor Méderi-Universidad Del Rosario, Bogotá, Colombia.;Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.;Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.;Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.;Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.;Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia.", "authors": "Calderon-Ospina|Carlos Alberto|CA|0000-0002-7305-8727;Hernández-Sómerson|Mario|M|;García|Ana María|AM|;Mejia|Adriana|A|;Tamayo-Agudelo|Caroll|C|;Laissue|Paul|P|0000-0003-4180-4796;Fonseca Mendoza|Dora Janeth|DJ|0000-0002-7323-6570", "chemical_list": null, "country": "New Zealand", "delete": false, "doi": "10.2147/PGPM.S228709", "fulltext": "\n==== Front\nPharmgenomics Pers Med\nPharmgenomics Pers Med\nPGPM\nppm\nPharmacogenomics and Personalized Medicine\n1178-7066 Dove \n\n228709\n10.2147/PGPM.S228709\nCase Report\nA Pharmacogenomic Dissection of a Rosuvastatin-Induced Rhabdomyolysis Case Evokes the Polygenic Nature of Adverse Drug Reactions\nCalderon-Ospina et alCalderon-Ospina et alhttp://orcid.org/0000-0002-7305-8727Calderon-Ospina Carlos Alberto 1 Hernández-Sómerson Mario 2 García Ana María 1 Mejia Adriana 1 Tamayo-Agudelo Caroll 1 http://orcid.org/0000-0003-4180-4796Laissue Paul 1 http://orcid.org/0000-0002-7323-6570Fonseca Mendoza Dora Janeth 1 1 Center for Research in Genetics and Genomics-CIGGUR, GENIUROS Research Group, School of Medicine and Health Sciences. Universidad Del Rosario, Bogotá, Colombia\n2 Medical Clinic Service, Hospital Universitario Mayor Méderi-Universidad Del Rosario, Bogotá, Colombia\nCorrespondence: Dora Janeth Fonseca Mendoza Universidad Del Rosario, Cra 24 N° 63c-69, Bogotá, ColombiaTel +5712920200Fax +571 3499390 Email dora.fonseca@urosario.edu.co* These authors contributed equally to this work\n\n\n02 3 2020 \n2020 \n13 59 70\n26 8 2019 28 11 2019 © 2020 Calderon-Ospina et al.2020Calderon-Ospina et al.This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).Abstract\nRosuvastatin, is a widely-used statin for the treatment of hypercholesterolemia and the prevention of cardiovascular diseases. Although rosuvastatin is well tolerated, about 3/10.000 patients can suffer severe myopathy. Rhabdomyolysis is a severe medical condition that causes injury to the skeletal muscle, electrolyte imbalances, acute renal failure and extreme creatine kinase (CK) elevation. Little is known regarding the molecular involvement of rosuvastatin-induced rhabdomyolysis (RIR). It has been demonstrated that genomic variants associated with decreased enzymatic activity of proteins are important determinants in plasmatic and skeletal muscle distribution of rosuvastatin and its toxicity. Until now, no interactions of ticagrelor, ezetimibe and rosuvastatin have been described with the consideration of pharmacogenomics predisposition. The present report involves a whole-exome sequencing (WES), in a patient affected by rosuvastatin-induced rhabdomyolysis. A pharmacogenomic dissection was performed by analyzing a comprehensive subset of candidate genes (n=160) potentially related to RIR. The genes were selected according to their implication in drug metabolism or inherited myopathies. Using an innovative approach of bioinformatics analysis, considering rare and common variants, we identified 19 genomic variations potentially related to the pharmacokinetic/pharmacodynamic modifications of rosuvastatin, ezetimibe and ticagrelor. The affected genes are involved in Phase I metabolism (CYP2C19, CYP2E1, CYP1A1, CYP2D6 and CYP2C9), Phase II metabolism (UGT2B15 and UGT2B7), influx transportation (SLCO1B3 and SLCO2B1), efflux transportation (ABCG8, ABCB11, ABCC4 and ABCB1), drug targeting (NPC1L1) and inherited myopathy etiology (OBSCN). We report three rare, potentially pathogenic molecular variants in CYP2C19, NPC1L1 and OBSCN genes. Pharmacogenetic analysis indicated that the patient was a carrier of inactivating alleles in several pharmacogenes involved in drug toxicity. The whole-exome sequencing and bioinformatics analysis presented here represents an innovative way to identify genomic variants contributing with RIR´s origin and evokes the polygenic nature of adverse drug reactions.\n\nKeywords\npharmacogenomicsrhabdomyolysisrosuvastatinadverse drug reactionwhole-exome sequencingpolymorphisms\n==== Body\nIntroduction\nRhabdomyolysis is a clinical emergency characterized by skeletal muscle damage resulting in the release of intracellular muscle components into the bloodstream and extracellular space.1,2 Clinically, this disease is associated with elevated CK levels, electrolyte imbalances, acute renal failure, and disseminated intravascular coagulation.3 Some of these cases result from a secondary adverse reaction (ADR) to the ingestion of medications including antihistamines, antipsychotics, lipid-lowering medications, and statins.2 Statin-induced myopathy (SIM) affects 10–25% of individuals treated, and includes myopathy, myalgia, and myonecrosis.4 The most severe form of these myopathies, rhabdomyolysis, occurs in 0.1% of patients.5 Dual ticagrelor/rosuvastatin therapy, which is generally safe and well tolerated, is used for acute coronary syndrome (ACS) treatment. However, at least 8 cases of rhabdomyolysis secondary to rosuvastatin and ticagrelor have been reported in the literature and in the World Health Organization’s Adverse Drug Reactions Database (VigiBase).6 The molecular pathophysiology of rhabdomyolysis is complex, possibly involving numerous genes acting in several molecular overlapping cascades.\n\nHerein, to identify gene variants potentially related to statin and myotoxicity, we performed whole-exome sequencing and an innovative downstream bioinformatics analysis in a Colombian patient affected by RIR. WES is a large-scale DNA sequencing technology with potential relevance in identifying genomic variations related to drug response.7 By using in silico analyses, that included the identification of rare and common genomic variants in a subset of 160 candidate genes, we identified 19 genomic variants potentially related to the RIR. We found three rare, potentially pathogenic molecular variants (in terms of the In silico prediction and the conservation of the residue during evolution) in CYP2C19, NPC1L1 and OBSCN genes. We suggest that the rare variants and single nucleotide variants (SNVs) in these pharmacogenes can contributed to the myotoxicity observed in our patient.\n\nWe estimate that advanced computational analyses, large-scale DNA analysis and clinical information likely enhances drug phenotype predictions and highlights its use in personalized medicine.\n\nCase Presentation\nA 65-year-old woman admitted to the emergency room, presented a ten-day history of weakness and generalized musculoskeletal pain predominantly in the lower limbs. Additionally, she presented colicky abdominal pain associated with distension and the presence of dark urine.\n\nThe patient presented a medical history of stage IV chronic kidney disease, dilated cardiomyopathy of ischemic origin with 38% LVEF, type 2 diabetes mellitus, hypertension, and multivessel coronary disease with revascularization eight months prior. She was being treated with losartan, carvedilol, linagliptin, insulin detemir, rosuvastatin + ezetimibe 40mg/10mg daily for 2 years, aspirin and ticagrelor 90mg every 12 hrs since her intervention eight months ago.\n\nPhysical examination revealed the patient to be dehydrated, hypotensive, tachycardic, with palpebral edema and abdominal distension.\n\nParaclinical tests reported metabolic acidosis, increased transaminases and a euthyroid profile, leukocytosis with left shift, hyponatremia (122mmol/L), hyperkalemia (6.7mmol/L), hypocalcemia (7.8mmol/L), hyperphosphatemia (14mmol/L), and elevated nitrates (creatinine 9.6mg/dl and BUN 162mg/dl). A urinalysis with urine culture accompanied by a renal ultrasound confirmed the pyelonephritis diagnosis. The patient was taken to hemodialysis and anti-hyperkalemic treatment was initiated.\n\nOn the second day of admission, a decrease in nitrate levels and improvement of electrolyte levels was evidenced; however, the patient persisted with pain in the lower limbs, associated with a total CPK level of 38,987 UI/L, more than 300 times higher than the reference values (26-192UI/L). A 12-lead EKG did not show changes in acute myocardial ischemia, ruling out an acute coronary syndrome; thereafter, rosuvastatin and ezetimibe were suspended.\n\nAn electromyography was performed with nerve conduction velocities in four extremities, which resulted compatible with intrinsic muscle fiber compromise suggestive of rhabdomyolysis, later a skeletal muscle biopsy confirmed the diagnosis.\n\nA rapid urine test confirmed the existence of myoglobinuria. On the eighth day of hospitalization, a marked decrease in CPK was observed (14,000 UI/L). The patient was discharged 2 months after admission with a final diagnosis of acute kidney injury KDIGO score of 3, secondary to a statin induced-rhabdomyolysis.\n\nMolecular Analysis\nFor WES, a total amount of 1.0 μg genomic DNA per sample was used as input material for the DNA library preparation. Sequencing libraries were generated using Agilent Sure Select Human All Exon kit (Agilent Technologies, CA,USA). Fragmentation was carried out to generate 180–280 bp fragments. After adenylation of 3ʹ ends of DNA fragments, adapter oligonucleotides were ligated and selectively enriched in a PCR reaction. After PCR reaction, library hybridize with liquid phase with biotin labeled probe, then use magentic beads with streptomycin to capture the exons. Captured libraries were enriched in a PCR reaction to add index tags to prepare for hybridization. Products were purified using AMPure XP system (Beckman Coluter, Berverly, USA) and quantified on the Agilent Bioanalyzer 2100 system. Libraries were sequenced on HiSeq Ilumina platform, paired-end 150 pb. The short reads (Raw Data) were analyzed in FASTQ format. The rew reads were aligned to the reference HG18 with Burrows-Wheeler Aligner (BWA) software. The variants were identified with SAMtools. Data quality guaranteed that >80% of bases have a sequencing quality score >Q30 and minimum average coverage of 30X. Following genomic variant detection, the variants were annoted using the tool ANNOVAR to identify affected genomic regions, protein coding changes, allele frequencies reported by Genome Aggregation Database (gnomAD) and In house database-WES of Colombian people and to predict the deleteriousness of mutations (SIFT and,PolyPhen). Library preparation and sequencing were carried out at Novogene (Beijing-China).\n\nA subset of 160 candidate genes was created (Table 1). The genes were selected according to their implication in inherited myopathies (70-Rhab) or pharmacological metabolism (90-Rhab) in statins and the drugs administrated to our patient. Candidate genes for 70-Rhab were selected through a review of literature and a public database (Online Mendelian Inheritance in Man (OMIM). The pharmacogenes (90-Rhab) were identified by their action on the metabolism of the medications (targets, enzymes and transporters). This information was subtracted from a literature review and public databases (https://www.drugbank.ca/ and https://www.pharmgkb.org/).Table 1 Genes Analyzed\n\n90-Rhab Subset Genes/Related Pharmacological Metabolism\t70-Rhab Subset Genes/Related Inherited Myopathies\t\nABCB1\tCYP2E1\tPRKAG3\tABHD5\tGYG1\t\nABCB11\tCYP3A4\tPRY12\tACAD9\tGYS1\t\nABCC1\tCYP3A5\tPTGS1\tACADL\tHADHA\t\nABCC2\tCYP3A7\tPTGS1\tACADM\tHADHB\t\nABCC3\tDPP4\tPTGS2\tACADS\tISCU\t\nABCC4\tEDNRA\tRPS6KA3\tACADVL\tLAMP2\t\nABCC5\tGJA1\tSELE\tADSL\tLDHA\t\nABCG2\tHDAC2\tSLC15A1\tAGL\tLPIN1\t\nABCG5\tHIF1A\tSLC16A1\tAHCY\tOBSCN\t\nABCG8\tHMGCR\tSLC22A11\tALDOA\tOPA1\t\nADRA1A\tHSPA5\tSLC22A12\tAMPD1\tOPA3\t\nADRA1B\tIGF1R\tSLC22A6\tANO5\tPFKM\t\nADRA1D\tIKBKB\tSLC22A7\tBCS1L\tPGAM2\t\nADRA2A\tINSR\tSLC22A8\tCACNA1S\tPGK1\t\nADRA2B\tITGAL\tSLC2A9\tCAV3\tPGM1\t\nADRA2C\tITGB2\tSLC7A11\tCOQ2\tPHKA1\t\nADRB1\tKCNH2\tSLCO1A2\tCOQ8A\tPHKB\t\nADRB2\tKCNJ4\tSLCO1B1\tCPT1B\tPHKG1\t\nAGTR1\tNDUFC2\tSLCO1B3\tCPT2\tPNPLA2\t\nAHR\tNFKB1\tSLCO2B1\tCYP2C8\tPOL\t\nAKR1C1\tNFKB2\tSOAT1\tDGUOK\tPOLG\t\nALB\tNPC1L1\tTP53\tDLD\tPOLG2\t\nANPEP\tNPPB\tUGT1A1\tDMD\tPRKAG2\t\nCYP1A1\tPON3\tUGT1A3\tDYSF\tPYGM\t\nCYP1A2\tPRKAA1\tUGT2B15\tENO3\tRRM2B\t\nCYP2B6\tPRKAA2\tUGT2B17\tETFA\tRYR1\t\nCYP2C19\tPRKAB1\tUGT2B7\tETFB\tSCN4A\t\nCYP2C8\tPRKAB2\tVCAM1\tETFDH\tSLC22A5\t\nCYP2C9\tPRKAG1\tVEGFA\tFBP2\tSLC25A20\t\nCYP2D6\tPRKAG2\tXDH\tFDX1L\tSUCLA2\t\n\tFKRP\tTAZ\t\nFKTN\tTK2\t\nFLAD1\tTSFM\t\nGAA\tTWNK\t\nGBE1\tTYMP\t\nNotes: A subset of 160 candidate genes was created. The genes were selected according to their implication in inherited myopathies (70-Rhab) or pharmacological metabolism (90-Rhab) in statins and the drugs administrated to our patient.\n\n\n\n\nIn the 70-Rhab and 90-Rhab subsets, sequence variants with potential deleterious effect (missense, nonsense, splice site, frameshift), and MAF <1% were selected for analysis. We used SIFT and PolyPhen2 software to predict whether an amino acid substitution affects protein function. Sequences of proteins with altered amino acids were compared with orthologous of some mammalian species using available public database sequences (https://www.uniprot.org/uniprot/). We considered a variation relevant if residue was conserved during evolution. For splice site variants, we performed in silico prediction of potential pathogenicity using Human Splicing Finder software (http://www.umd.be/HSF/). Additionally, for 90-Rhab genes subset we included common genomic variants previously described for their clinical involvement in drug metabolism. Using STRING v.11.0 interaction database, we identified possible interactions (PPIs) between proteins potentially altered for molecular variants (confidence score > 0.400) (https://string-db.org/cgi/network.pl).\n\nThe Ethics Committee of Universidad del Rosario approved this study and it was conducted according to the principles of the Helsinki Declaration (institutional review board reference CS/ABN062). Written informed consent was obtained from the patient for DNA analysis and publication of the case report.\n\nResults\nPharmacogenomic Analysis\nThe descriptions of the molecular variants for the subsets 70-Rhab and 90-Rhab are shown in Table 2. In the 90-Rhab subset of genes a total of 18 genomic variants were identified: 7 in genes of phase I metabolism; 2 in phase II metabolism genes; 3 in the Influx transporters; 5 in the efflux and 1 in the target of ezetimibe. Regarding subset 70-Rhab, a variant in the OBSCN gene was identified. Three potentially pathogenic variants with very low MAF (genomAD and In House WES) were found CYP2C19 (c.394C> T, MAF= 0.00044 and 0.001), NPC1L1 (c.1581-6C> G, MAF= 0.00017 and 0) and OBSCN (c.35T> A, MAF= 0.0033 and 0). For CYP2C19 and OBSCN, protein alignments revealed that the Arginine residue at position 132 and the Phenylalanine residue at position 12 are conserved among mammalian species (Figure 1). Regarding NCP1L1 c.1581-6G> C variant, In Silico predictions indicate that it affects splicing due to the alteration of the acceptor site. Multilevel analysis of genes involved in possible mechanisms of Rhabdomyolysis are shown in Figure 2. Protein-protein interaction data retrieved from STRING v11.0 is shown in Figure 3. Mainly PPIs predicted in our network were co-expressed. For phase I metabolism enzymes (CYPs and UGTs) more PPIs were evident (Figure 3). For network protein, PPI enrichment p-value determined by STRING v.11.0 was <1.0e-16.Table 2 Pharmacogenomic Profile Patient. Description of the Molecular Variants for the Subsets 70 Rhab and 90 Rhab\n\nGenomic Variants\tGene\tVariant\tdbSNP Number\tProtein Change\tType Variant\tFrequency Public Database: GenomAD\tRelated to\tZygosity\t\n90-Rhab panel\tMAF<1%/In Silico predictors\tCYP2C19\tc.394C>T\trs149590953\tp.Arg132Trp\tMissense\t0.0004455\tMetabolism rosuvastatin, aspirin\tHet\t\nNPC1L1\tc.1581-6C>G\trs534710579\t_\tSplice site\t0.00017\tTarget ezetimibe\tHet\t\nMAF>1%\tCYP2C19\tc.991G>A\trs3758581\tp.Val331Ile\tMissense\t0.05973\tMetabolism rosuvastatin, aspirin\tHet\t\nCYP2D6\tc.1094G>A\trs1058172\tp.Arg365His\tMissense\t0.09385\tMetabolism rosuvastatin, ticagrelor,carvedilol\tHet\t\nCYP2D6\tc.271C>A\trs28371703\tp.Leu91Met\tMissense\t0.09516\tMetabolism rosuvastatin, ticagrelor,carvedilol\tHet\t\nCYP2D6\tc.100C>T\trs1065852\tp.Pro34Ser\tMissense\t0.2068\tMetabolism rosuvastatin, ticagrelor,carvedilol\tHet\t\nCYP2C9\tc.1075A>C\trs1057910\tp.Ile359Leu\tMissense\t0.06154\tMetabolism rosuvastatin, ticagrelor,carvedilol\tHet\t\nCYP2D6\tc.506-1G>A\trs3892097\t_\tSplice site\t0.1384\tMetabolism rosuvastatin, ticagrelor,carvedilol\tHet\t\nUGT2B15\tc.253T>G\trs1902023\tp.Tyr85Asp\tMissense\t0.5149\tMetabolism ezetimibe\tHet\t\nUGT2B7\tc.802T>C\trs7439366\tp.Tyr268His\tMissense\t0.5636\tMetabolism ticagrelor, ezetimibe, carvedidol,rosuvastatin\tHet\t\nABCG8\tc.161A>G\trs4148211\tp.Tyr54Cys\tMissense\t0.4217\tTransporter Ezetimibe\tHet\t\nABCB11\tc.1331T>C\trs2287622\tp.Val444Ala\tMissense\t0.5694\tTransporter rosuvastatin,ezetimibe,carvedilol\tHet\t\nABCC4\tc.912G>T\trs2274407\tp.Lys304Asn\tMissense\t0.09757\tTransporter rosuvastatin\tHet\t\nABCB1\tc.2677T>G\trs2032582\tp.Ser893Ala\tMissense\t0.5498\tTransporter rosuvastatin, ezetimibe\tHet\t\nABCB1\tc.61A>G\trs9282564\tp.Asn21Asp\tMissense\t0.07495\tTransporter rosuvastatin, ezetimibe\tHet\t\nSLCO1B3\tc.334T>G\trs4149117\tp.Ser112Ala\tMissense\t0.7967\tTransporter rosuvastatin\tHom\t\nSLCO1B3\tc.699G>A\trs7311358\tp.Met233Ile\tMissense\t0.7967\tTransporter rosuvastatin\tHom\t\nSLCO2B1\tc.935G>A\trs12422149\tp.Arg312Gln\tMissense\t0.1759\tTransporter rosuvastatin,ezetimibe\tHom\t\n70-Rhab panel\tMAF<1%/In Silico predictors pathogenic\tOBSCN\tc.35T>A\trs191837710\tp.Phe12Tyr\tMissense\t0.003315\tSarcomere-Sarcoplasmic Reticulum (SR) connection\tHet\t\n\n\n\nDiscussion\nWe presented a case report that involved WES in a patient affected by rhabdomyolysis. To date, molecular involvement exploration in this phenotype has been limited to a few SNV´s in genes related to drug metabolism in phase I and II.8 Due to the molecular complexity of rhabdomyolysis pathophysiology, we focused our study on a subset of 160 genes potentially related to phenotype. The genes proposed are relevant in the myopathies susceptibility. We conducted a large-scale DNA sequencing approach using two bioinformatics analysis: a) stringent filters that enable the identification of rare variants with potentially strong functional effects and b) filtering of frequent genomics variants reported in literature. This approach led us to identify 19 genomic variants in 14 genes, three of which are rare (MAF<0.3%), and potentially pathogenic (CYP2C19, NCP1L1 and OSBCN). These findings corroborate that our approach with selected groups of genes is a powerful strategy for molecular dissection of severe ADR and evokes the polygenic nature of myotoxicity. Successful studies have been made by our research group using WES to identified candidate genes of complex diseases and now in pharmacogenetics.9–13\n\nAccording to the Naranjo scale, it was estimated for the patient analyzed that the rhabdomyolysis was induced by rosuvastatin (8 points “probable”).14,15 Considering the timeline of our patient’s medication use (Rosuvastatin-ezetimibe treatment had been established two years prior the reaction), we estimate that exposure to ticagrelor triggered the rhabdomyolysis. The Horn scale indicated as probable (5 points) the implication of this pharmacological interaction in the ADR observed in our patient. Despite these considerations, it is important to recognize as a limiting factor of our study that, as with any adverse reaction, it is difficult to attribute causality to a specific drug even with the use of expert judgment, algorithms or Bayesian/probabilistic approaches.16\n\nAmong the medications used by the patient, a potential moderate drug-drug interaction between rosuvastatin and ezetimibe has been identified. It has been documented that co-administration of ezetimibe and statins leads to a potential risk of myopathy and elevated transaminase levels. It has been suggest that the combination of statins and ezetimibe should be performed with caution and that these medications should be discontinued if myopathy is suspected or diagnosed.17 The reduction in CK (from 38,917 to 14,000 IU/L) in our patient after rosuvastatin-ezetimibe suspension supports this hypothesis. Even so, we must recognize that there may be unknown drug-drug interactions with statins that are potentially related to the increased risk of myopathies and that may influence the accurate identification of drug-gene interactions.18\n\nTo date, 8 cases of rhabdomyolysis induced by rosuvastatin and ticagrelor have been reported.6 We performed a molecular multilevel analysis according to the mechanisms involved in the potential influence of ticagrelor on the elimination/disposal of rosuvastatin: a) kidney damage caused by ticagrelor, b) Genetic polymorphisms in drug metabolizing enzymes and c) decreased biliary and renal excretion of rosuvastatin secondary to transporter competition.6 This analysis allowed us to hypothesize the action of the genetic polymorphism in the final disposition of rosuvastatin, involved in the generation of rhabdomyolysis in our patient (Figure 2).\n\nKidney damage is an ADR frequently associated with ticagrelor; in the PLATO trial (The Platelet Inhibition and Patient Outcomes) it was determined that the concentration of serum creatinine increased by more than 30% in patients receiving ticagrelor, being the pre-existing kidney impairment an important factor in the outcome.19 This constitutes a determining risk factor in our patient who at the time of the administration of ticagrelor was suffering from stage IV chronic renal failure and whose decompensation was probably triggered by the ingestion of the antiplatelet drug after the revascularization. The patient reported a creatinine value of 9.2 mg/dl (above the normal value). The mechanism explaining the worsening of renal function with the use of ticagrelor is unknown but it has been proposed that inhibition of adenosine reuptake by the medication reduces the glomerular filtration rate of the afferent renal arteriole.20 In the clinical management of patients with renal failure, the dose of rosuvastatin must be adjusted and high doses as prescribed in our patient (40mg daily) is contraindicated. It is estimated that the plasma concentration of rosuvastatin may increase three times in patients with severe kidney injury.19 We estimate that in the reported case the deterioration of renal function due to ticagrelor and the dose of rosuvastatin and ezetimibe were determinants in the increase of the serum concentration of rosuvastatin related to rhabdomyolysis.\n\nThe risk of myotoxicity from rosuvastatin is dependent on the plasma concentration of the medication in the blood and myocytes. Through WES, we identified in our patient, 19 genetic variations affecting drug pharmacokinetics and pharmacodynamics. Regarding the enzymes of phase I metabolism, the patient carried alleles that confer a potential variation in normal metabolism phenotype: (CYP2C9*3 (c.A1075C), CYP2C19 (c.991G>A), CYP2C19 (c.394C>T), CYP2D6 (c.271C>A), CYP2D6*10 (c.100C>T) and CYP2D6*4 (c.506-1G>A). Although only 10% of rosuvastatin is metabolized by the enzymes CYP2C9 and CPY2C19 the presence of variants related to low enzyme activity compromise the drug’s disposal and predisposes its potential toxicity.21 A rare variant CYP2C19 -c.394C>T was identified in the patient, the in silico analysis demonstrates its pathogenicity, and the conservation of the amino acid in mammal species suggests a role in its biological function (Figure 1). The metabolism of carvedilol is fundamentally affected by the alleles of CYP2D6 and CYP2C9, for the described case, the decrease in enzymatic activity conferred by CYP2D6*4, CYP2D6*10, and CYP2C9*3 estimates a potential increase in the plasma concentration of R(+) carvedilol and a potential therapeutic failure in the treatment of cardiac failure.22 This observation evokes that despite being treated with carvedilol, the patient suffered a cardiac complication that required the use of ticagrelor, the main trigger of rhabdomyolysis. With respect to enzymes associated to phase II metabolism, variants UGT2B7*2 and UGT2B15*2, related to the impact of rosuvastatin lactonization and ezetimibe glucuronidation, respectively, were identified. The lactones in relation to the acid form of statins are stronger inducers of toxicity. UGT2B7*2 polymorphism can modulate lactone induction by glucuronidation and contribute to rosuvastatin toxicity.6 Ezetimibe is metabolized primarily by a glucuronidation reaction by UGT1A1, 1A3 and 2B15 to form its main phenolic metabolite, ezetimibe-glucuronide.The allele UGT2B15*2 has an enzymatic activity 5 times lower than the wild type allele which results in a decreased formation of active ezetimibe glucuronides.23 From this perspective, it can be assumed that the reduction of ezetimibe-glucuronide may potentially influence the pharmacological effect of the medication.24 The lipid-lowering action of ezetimibe may additionally be affected by the presence of a potentially pathogenic variant in NPC1L1- c.1581-6C>G, the target of the medication. This is a rare variant (MAF: 0.00017-genomAD and 0-In house WES-database) and the In Silico prediction indicates that it affects splicing due to the alteration of the acceptor site. Although only a functional study (e.g.minigenes) would establish with certainty the implication of the mutation, the findings allow us to hypothesize that the therapeutic effect of ezetimibe in the patient may be affected. The need to compensate for the desired lipid-lowering effect may be related to the prescription of a high unsafe dose of rosuvastatin (40 mg) in the patient, with the potential risk of elevated plasma concentration and development of rhabdomyolysis. Ezetimibe is a potential additional risk factor for our patient, as it has been established that this medication can induce myalgia in statin-intolerant patients.25 Although the associated mechanism is unknown, a pharmacokinetic interaction between ezetimibe and rosuvastatin has recently been identified, and the co-administration of the medications increases systemic exposure to free ezetimibe, which may favor its absorption by the gastrointestinal tract for its muscle interaction and subsequent induction of muscular ADR.25,26\n\nOther mechanism related to rosuvastatin-ticagrelor associated myopathy involved drug transporters8. All statins are substrates of membrane transporters that play an important role in the disposition of the drug. Previous studies have identified that simple nucleotide polymorphisms (SNPs) in the SLCO1B1 gene (c.388A>G and c.521T>C) have a functional effect on OATP1B1.27 Specifically, the c.388A>G polymorphism (SLCO1B1*1B) is associated with high enzymatic activity and low plasma concentrations for OATP1B1 substrates. On the contrary c.521T>C (SLCO1B1*5) reduces the activity of the transporter and increases the plasma concentration of substrates.28 The effect of polymorphisms depends on the satin used. SNP SLCO1B1-C.521T>C has been associated with simvastatin (4-fold increase in the risk of myopathy) but not with other statins.29,30 This finding is consistent with the fact that the polymorphism fundamentally affects simvastatin since it generates an area under the curve (AUC) 221% higher in patients with the c.521CC genotype in relation to the c.521TT genotype. However, the effect is much less in atorvastatin (AUC increase of 173%) and almost non-existent for other statins.31 Additionally, the SLCO1B1*1B/SLCO1B1*1B genotype has been associated with a reduction of up to 35% in pravastatin AUC, but does not affect the pharmacokinetics of rosuvastatin.32 Our patient was not a carrier of risk alleles SLCO1B1-c.521T>C or c.388A>G or any genetic variant potentially related to myopathy. SLCO1B1 is expressed in the basolateral membrane of human hepatocytes, in where, additionally, SLCO1B3 and SLCO2B1 are expressed in similar amounts.33 The differences in the effect of SLCO1B1 polymorphisms on the pharmacokinetics of individual statins can be partially explained by the contribution of other OATPs in their hepatic uptake.31 Rosuvastatin transport is mediated by SLCO1B1, 1B3 and 2B1. The interindividual variability in patients drug response can be explained by SLCO1B3- c.T334G, c.G699A and SLCO2B1- c.935G>A,c.1175T>C polymorphisms. SLCO1B3 polymorphisms are in strong linkage disequilibrium and are related to a decreased activity, increased toxicity and increased plasma levels of their substrates.34 The functional impact of SLCO2B1-c.935G>A has been associated with reduced plasma levels of montelukast, a leukotriene receptor antagonist.35\nSLCO2B1-c.1175T>C has been associated with a reduction in the activity of substrates such as estrone sulfate, as well as a reduction in the area under the fexofenadine curve.36 Knauer et al, identified the expression of SLCO2B1 in the sarcolemma membrane of skeletal muscle, which determines that control in rosuvastatin concentration is not performed solely by transporters located in the liver and intestine. It is estimated that in addition to the high plasma concentration of rosuvastatin, the concentration of the medication in the muscle fiber has an impact on the risk of rhabdomyolysis.37 Regarding statin efflux transporters, the expression of ABCC1, ABCC4, and ABCC5 in skeletal muscle has been demonstrated. These transporters are expressed in the sarcolemma membrane of muscle fibers and perform a protective role in the intracellular accumulation of statins.38 In the analyzed patient the variant ABCC4-c.912G>T was identified, located in the splice acceptor site 3ʹ of the pre-mRNA of exon 8. Functional studies have indicated that it leads to the elimination of about 300bp in exon 8 and as a consequence the protein exhibits low enzymatic activity.39 Although ABCB1 (P-pg) has not been associated with rosuvastatin toxicity, the implication of the allele ABCB1-c.2677T>G has been associated with the increase of muscle toxicity and myalgia from simvastatin.40 The dynamic interplay between influx and efflux transporter activities likely modified muscle fiber rosuvastatin concentrations, which determines susceptibility to muscular ADR such as Rhabdomyolysis.\n\nIntegrating our findings, we suggest that the total effect of altered proteins supports the hypothesis that the risk of myotoxicity from rosuvastatin is dependent on the concentration of the medication.41 Our results of PPIs using STRING database corroborate that the proteins analyzed interact with each other and are co-expressed. The PPI enrichment p-value predicted (<1.0e-16), indicated that our network proteins have more interactions than expected which implies that the proteins are biologically connected, as a group.42\n\nFinally, we also suggest one new mechanism related to the potencial rol of OBSCN in establishing the sarcomere-sarcoplasmic reticulum (SR) connection, which could have increased the risk of Rhabdomyolysis.43 Ablation of obscurin in mice results in alterations in the SR architecture with marked sarcolemma fragility.44\nOBSCN-c.35T>A can potentially affect the interaction with SR-associated proteins such as Titin and myomesin and facilitate the fragility. The interaction between these proteins involve the N-terminal end of the OBSCN, so we estimate that genetic variants in other positions are not potentially related to the establishment of the sarcomere-sarcoplasmic reticulum (SR) connection. Muscle biopsies from patients with stain-induced myopathy have shown structural changes in the SR.45\n\nDespite the considerations made of the potential impact of the rare variants identified in our patient (CYP2C9 c.394C>T; NPC1L1 c.1581-6C>G and OBSCN c.35T>A), in terms of the In Silico prediction (according to the case) and the conservation of the residue involved during the evolution, we recognize our limitation regarding the possibility of carrying out association analysis of rare variants in biologically plausible metabolizing enzymes or transporter genes that could have led to a large increase in drug exposure. Advances in large-scale DNA sequencing technology, such as WES, have allowed us to explore the contribution of rare or low-frequency variants in human phenotypes and adverse drug reactions.18,46\n\nThe analysis of GWAS on common variants, has permitted the establishment of a significant number of gene and phenotype associations, many of them with low effects and explains a small proportion of heritability. The analysis of rare variants could potentially explain more significant effects than common SNPs.47 Since many rare independent variants are found in the genome in relation to common variants, several statistical methods (gene-burden scores, variance- component test, combined test and others) have been proposed to increase power in association studies by mixing information of multiple rare variants with a functional genomic unit (e.g. gene or exon).46 Recently, Floyd et al reported a multi-site whole-exome sequencing study to investigate whether rare coding variants confer an increased risk of statin-related myopathy (SMR),included rhabdomyolisis.18 The analysis sample included 505 cases that received treatment with statins at the onset time of muscle injury symptoms and 2047 controls from North America and the United Kingdom. Rare variants (MAF<1%) identified by WES were collapsed into gene-burden scores and tested for association with the risk of SMR. Through large-scale DNA analysis, joint variant calling and statistical methods, the authors did not identify new variants associated with SMR. Similar to other reports, the study revealed the association of SNP SLCO1B1-c.521T>C with a 4-fold increased risk of severe SMR, while in mild forms of SMR this association was not evidenced.18 Nevordola et al conducted a WES study in 88 patients with statin-associated myopathy and assessed the burden of rare variants using candidate-gene and exome-wide association analysis. The strategy allowed the identification of a new gene potentially related to the phenotype (CLCN1) and case-specific pathogenic variants in MYOT,CYP3A5,SH3TC2,FBXO32 and RMB20.48 These results, initially discrepant, may be due to the difference in the phenotypes analyzed in both studies (mostly severe SMR in one and mild SMR in the other) and support the potential role of rare variants in susceptibility to stain myopathy. As hypothesized by Floy, it is possible that there are rare variants associated with SMR in non-coding regions that escape the WES analysis.18\n\nTaken together, our findings reveal the potential relevance of WES as a comprehensive pharmacogenomics approach to identify common and/or rare variants potentially related to SMR. We estimate that in vitro functional studies can validate the implication of rare case-specific variants such as the one reported in this study. Despite the uncertainly in the incorporation of WES into the health system, we estimate that the integration of WES data likely enhances future drug dosing. Even so, it must be carefully analyzed for the potential involvement of rare variants in severe SMR phenotypes.\n\nConclusion\nThis is the first case in which whole-exome sequencing of an affected patient is performed to explain the genetic susceptibility to rhabdomyolysis induced by ticagrelor, rosuvastatin and ezetimibe. The patient was at high risk for ADR, being an elderly female, with an excessive dose of rosuvastatin and renal impairment. Our molecular findings argue in favor of the polygenic nature of rhabdomyolysis where the accumulation of rosuvastatin due to metabolism impairment, the alteration in transport proteins (SLCO1B3, SLCO2B1, ABCG8, ABCB11, ABCC4 and ABCB1), and in drug target (NCP1L1), are potential effectors in the analyzed myotoxicity. We proposed for the first time the implication of the susceptibility gene (OBSCN) in phenotype.\nFigure 1 Protein alignments.\n\nNotes: For CYP2C19 and OBSCN, protein alignments revealed that the Arginine residue at position 132 and the Phenylalanine residue at position 12 are conserved among mammalian species.\n\n\nFigure 2 Genes potentially involved in rosuvastatin-induced rhabdomyolysis.\n\nNotes: Genomic variants identified by WES in the subsets 70-Rhab and 90-Rhab. A total of 19 molecular variants were identified in 15 genes related to inherited myopathies and drug metabolism.\n\n\nFigure 3 Protein-protein interaction.\n\nNote: Data retrieved from STRING v.11.0 predicts protein-protein interaction (PPIs).\n\n\n\nAcknowledgments\nThe authors would like to thank the Hospital Universitario Mayor MEDERI for their constant support.\n\nAbbreviations\nRIR, rosuvastatin-induced rhabdomyolysis; WES, whole-exome sequencing; ADR, adverse drugs reaction; SIM, statin induced myopathy; ACS, acute coronary syndrome; SNV, single nucleotide variant; SMR, statin-related myopathy.\n\nData Sharing Statement\nData obtained in our study is available from the corresponding author on request.\n\nFunding\nThis project was supported by the Universidad del Rosario (Grant CS/ABN062). The fund was mainly used for WES analysis.\n\nDisclosure\nThe authors report no conflicts of interest in this work.\n==== Refs\nReferences\n1. Scalco \nRS , Gardiner \nAR , Pitceathly \nRD , et al. Rhabdomyolysis: a genetic perspective\n. Orphanet J Rare Dis . 2015 ;10 :51 . doi:10.1186/s13023-015-0264-3 25929793 \n2. Torres \nPA , Helmstetter \nJA , Kaye \nAM , Kaye \nAD . Rhabdomyolysis: pathogenesis, diagnosis, and treatment\n. Ochsner J . 2015 ;15 (1 ):58 –69\n.25829882 \n3. Huerta-Alardin \nAL , Varon \nJ , Marik \nPE . Bench-to-bedside review: rhabdomyolysis – an overview for clinicians\n. Crit Care . 2005 ;9 (2 ):158 –169\n. doi:10.1186/cc2978 15774072 \n4. Thompson \nPD , Panza \nG , Zaleski \nA , Taylor \nB . Statin-associated side effects\n. J Am Coll Cardiol . 2016 ;67 (20 ):2395 –2410\n. doi:10.1016/j.jacc.2016.02.071 27199064 \n5. Ganga \nHV , Slim \nHB , Thompson \nPD . A systematic review of statin-induced muscle problems in clinical trials\n. Am Heart J . 2014 ;168 (1 ):6 –15\n. doi:10.1016/j.ahj.2014.03.019 24952854 \n6. Vrkic Kirhmajer \nM , Macolic Sarinic \nV , Simicevic \nL , et al. Rosuvastatin-induced rhabdomyolysis - possible role of ticagrelor and patients’ pharmacogenetic profile\n. Basic Clin Pharmacol Toxicol . 2018 ;123 (4 ):509 –518\n. doi:10.1111/bcpt.2018.123.issue-4 29734517 \n7. Schwarz \nUI , Gulilat \nM , Kim \nRB . The role of next-generation sequencing in pharmacogenetics and pharmacogenomics\n. Cold Spring Harb Perspect Med . 2019 ;9 :2 . doi:10.1101/cshperspect.a033027 \n8. Vrablik \nM , Zlatohlavek \nL , Stulc \nT , et al. Statin-associated myopathy: from genetic predisposition to clinical management\n. Physiol Res . 2014 ;63 (Suppl 3 ):S327 –334\n.25428737 \n9. Ortega-Recalde \nO , Vergara \nJI , Fonseca \nDJ , et al. Whole-exome sequencing enables rapid determination of xeroderma pigmentosum molecular etiology\n. PLoS One . 2014 ;8 (6 ):e64692 . doi:10.1371/journal.pone.0064692 23755135 \n10. Patino \nLC , Battu \nR , Ortega-Recalde \nO , et al. Exome sequencing is an efficient tool for variant late-infantile neuronal ceroid lipofuscinosis molecular diagnosis\n. PLoS One . 2014 ;9 (10 ):e109576 . doi:10.1371/journal.pone.0109576 25333361 \n11. Patino \nLC , Beau \nI , Carlosama \nC , et al. New mutations in non-syndromic primary ovarian insufficiency patients identified via whole-exome sequencing\n. Hum Reprod . 2017 ;32 (7 ):1512 –1520\n. doi:10.1093/humrep/dex089 28505269 \n12. Quintero-Ronderos \nP , Mercier \nE , Fukuda \nM , et al. Novel genes and mutations in patients affected by recurrent pregnancy loss\n. PLoS One . 2017 ;12 (10 ):e0186149 .29016666 \n13. Fonseca \nDJ , Patino \nLC , Suarez \nYC , et al. Next generation sequencing in women affected by nonsyndromic premature ovarian failure displays new potential causative genes and mutations\n. Fertil Steril . 2015 ;104 (1 ):154 –162.e152\n. doi:10.1016/j.fertnstert.2015.04.016 25989972 \n14. Naranjo \nCA , Busto \nU , Sellers \nEM , et al. A method for estimating the probability of adverse drug reactions\n. Clin Pharmacol Ther . 1981 ;30 (2 ):239 –245\n. doi:10.1038/clpt.1981.154 7249508 \n15. Horn \nJR , Hansten \nPD , Chan \nLN . Proposal for a new tool to evaluate drug interaction cases\n. Ann Pharmacother . 2007 ;41 (4 ):674 –680\n. doi:10.1345/aph.1H423 17389673 \n16. Agbabiaka \nTB , Savovic \nJ , Ernst \nE . Methods for causality assessment of adverse drug reactions: a systematic review\n. Drug Safety . 2008 ;31 (1 ):21 –37\n. doi:10.2165/00002018-200831010-00003 18095744 \n17. Fux \nR , Morike \nK , Gundel \nUF , Hartmann \nR , Gleiter \nCH . Ezetimibe and statin-associated myopathy\n. Ann Intern Med . 2004 ;140 (8 ):671 –672\n. doi:10.7326/0003-4819-140-8-200404200-00034 15096354 \n18. Floyd \nJS , Bloch \nKM , Brody \nJA , et al. Pharmacogenomics of statin-related myopathy: meta-analysis of rare variants from whole-exome sequencing\n. PLoS One . 2019 ;14 (6 ):e0218115 .31242253 \n19. van Vuren \nAJ , de Jong \nB , Bootsma \nHP , Van der Veen \nMJ , Feith \nGW . Ticagrelor-induced renal failure leading to statin-induced rhabdomyolysis\n. Neth J Med . 2015 ;73 (3 ):136 –138\n.25852115 \n20. Cattaneo \nM , Schulz \nR , Nylander \nS . Adenosine-mediated effects of ticagrelor: evidence and potential clinical relevance\n. J Am Coll Cardiol . 2014 ;63 (23 ):2503 –2509\n. doi:10.1016/j.jacc.2014.03.031 24768873 \n21. Kirchheiner \nJ , Brockmoller \nJ . Clinical consequences of cytochrome P450 2C9 polymorphisms\n. Clin Pharmacol Ther . 2005 ;77 (1 ):1 –16\n. doi:10.1016/j.clpt.2004.08.009 15637526 \n22. Dean \nL . Carvedilol therapy and CYP2D6 genotype In: Pratt \nV , McLeod \nH , Rubinstein \nW , Dean \nL , Kattman \nB , Malheiro \nA , editors. Medical Genetics Summaries . Bethesda (MD) : National Center for Biotechnology Information (US) ; 2012 :1 –6\n.\n23. Court \nMH , Duan \nSX , Guillemette \nC , et al. Stereoselective conjugation of oxazepam by human UDP-glucuronosyltransferases (UGTs): S-oxazepam is glucuronidated by UGT2B15, while R-oxazepam is glucuronidated by UGT2B7 and UGT1A9\n. Drug Metab Dispos . 2002 ;30 (11 ):1257 –1265\n. doi:10.1124/dmd.30.11.1257 12386133 \n24. van Heek \nM , Farley \nC , Compton \nDS , Hoos \nL , Davis \nHR . Ezetimibe selectively inhibits intestinal cholesterol absorption in rodents in the presence and absence of exocrine pancreatic function\n. Br J Pharmacol . 2001 ;134 (2 ):409 –417\n. doi:10.1038/sj.bjp.0704260 11564660 \n25. Simard \nC , Poirier \nP . Ezetimibe-associated myopathy in monotherapy and in combination with a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor\n. Can J Cardiol . 2006 ;22 (2 ):141 –144\n. doi:10.1016/S0828-282X(06)70253-7 16485049 \n26. Kim \nCH , An \nH , Kim \nSH , Shin \nD . Pharmacokinetic and pharmacodynamic interaction between ezetimibe and rosuvastatin in healthy male subjects\n. Drug Des Devel Ther . 2017 ;11 :3461 –3469\n. doi:10.2147/DDDT.S146863 \n27. Tirona \nRG , Leake \nBF , Merino \nG , Kim \nRB . Polymorphisms in OATP-C: identification of multiple allelic variants associated with altered transport activity among European- and African-Americans\n. J Biol Chem . 2001 ;276 (38 ):35669 –35675\n. doi:10.1074/jbc.M103792200 11477075 \n28. Mwinyi \nJ , Johne \nA , Bauer \nS , Roots \nI , Gerloff \nT . Evidence for inverse effects of OATP-C (SLC21A6) 5 and 1b haplotypes on pravastatin kinetics\n. Clin Pharmacol Ther . 2004 ;75 (5 ):415 –421\n. doi:10.1016/j.clpt.2003.12.016 15116054 \n29. Link \nE , Parish \nS , Armitage \nJ , et al. SLCO1B1 variants and statin-induced myopathy–a genomewide study\n. N Engl J Med . 2008 ;359 (8 ):789 –799\n.18650507 \n30. Carr \nDF , O’Meara \nH , Jorgensen \nAL , et al. SLCO1B1 genetic variant associated with statin-induced myopathy: a proof-of-concept study using the clinical practice research datalink\n. Clin Pharmacol Ther . 2013 ;94 (6 ):695 –701\n. doi:10.1038/clpt.2013.161 23942138 \n31. Niemi \nM . Transporter pharmacogenetics and statin toxicity\n. Clin Pharmacol Ther . 2010 ;87 (1 ):130 –133\n. doi:10.1038/clpt.2009.197 19890253 \n32. Choi \nJH , Lee \nMG , Cho \nJY , Lee \nJE , Kim \nKH , Park \nK . Influence of OATP1B1 genotype on the pharmacokinetics of rosuvastatin in Koreans\n. Clin Pharmacol Ther . 2008 ;83 (2 ):251 –257\n. doi:10.1038/sj.clpt.6100267 17568401 \n33. Ho \nRH , Tirona \nRG , Leake \nBF , et al. Drug and bile acid transporters in rosuvastatin hepatic uptake: function, expression, and pharmacogenetics\n. Gastroenterology . 2006 ;130 (6 ):1793 –1806\n. doi:10.1053/j.gastro.2006.02.034 16697742 \n34. Laitinen \nA , Niemi \nM . Frequencies of single-nucleotide polymorphisms of SLCO1A2, SLCO1B3 and SLCO2B1 genes in a finnish population\n. Basic Clin Pharmacol Toxicol . 2011 ;108 (1 ):9 –13\n. doi:10.1111/pto.2010.108.issue-1 20560925 \n35. Mougey \nEB , Feng \nH , Castro \nM , Irvin \nCG , Lima \nJJ . Absorption of montelukast is transporter mediated: a common variant of OATP2B1 is associated with reduced plasma concentrations and poor response\n. Pharmacogenet Genomics . 2009 ;19 (2 ):129 –138\n. doi:10.1097/FPC.0b013e32831bd98c 19151602 \n36. Imanaga \nJ , Kotegawa \nT , Imai \nH , et al. The effects of the SLCO2B1 c.1457C > T polymorphism and apple juice on the pharmacokinetics of fexofenadine and midazolam in humans\n. Pharmacogenet Genomics . 2011 ;21 (2 ):84 –93\n. doi:10.1097/FPC.0b013e32834300cc 21280267 \n37. Knauer \nMJ , Urquhart \nBL , Meyer zu Schwabedissen \nHE , et al. Human skeletal muscle drug transporters determine local exposure and toxicity of statins\n. Circ Res . 2010 ;106 (2 ):297 –306\n. doi:10.1161/CIRCRESAHA.109.203596 19940267 \n38. Leslie \nEM , Deeley \nRG , Cole \nSP . Multidrug resistance proteins: role of P-glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in tissue defense\n. Toxicol Appl Pharmacol . 2005 ;204 (3 ):216 –237\n. doi:10.1016/j.taap.2004.10.012 15845415 \n39. Mesrian Tanha \nH , Rahgozar \nS , Mojtabavi Naeini \nM . ABCC4 functional SNP in the 3ʹ splice acceptor site of exon 8 (G912T) is associated with unfavorable clinical outcome in children with acute lymphoblastic leukemia\n. Cancer Chemother Pharmacol . 2017 ;80 (1 ):109 –117\n. doi:10.1007/s00280-017-3340-7 28550450 \n40. Rodrigues \nAC . Efflux and uptake transporters as determinants of statin response\n. Expert Opin Drug Metab Toxicol . 2010 ;6 (5 ):621 –632\n. doi:10.1517/17425251003713519 20367534 \n41. Sakamoto \nK , Kimura \nJ . Mechanism of statin-induced rhabdomyolysis\n. J Pharmacol Sci . 2013 ;123 (4 ):289 –294\n. doi:10.1254/jphs.13R06CP 24257439 \n42. Szklarczyk \nD , Gable \nAL , Lyon \nD , et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets\n. Nucleic Acids Res . 2019 ;47 (D1 ):D607 –d613\n. doi:10.1093/nar/gky1131 30476243 \n43. Bagnato \nP , Barone \nV , Giacomello \nE , Rossi \nD , Sorrentino \nV . Binding of an ankyrin-1 isoform to obscurin suggests a molecular link between the sarcoplasmic reticulum and myofibrils in striated muscles\n. J Cell Biol . 2003 ;160 (2 ):245 –253\n. doi:10.1083/jcb.200208109 12527750 \n44. Randazzo \nD , Giacomello \nE , Lorenzini \nS , et al. Obscurin is required for ankyrinB-dependent dystrophin localization and sarcolemma integrity\n. J Cell Biol . 2013 ;200 (4 ):523 –536\n. doi:10.1083/jcb.201205118 23420875 \n45. Draeger \nA , Monastyrskaya \nK , Mohaupt \nM , et al. Statin therapy induces ultrastructural damage in skeletal muscle in patients without myalgia\n. J Pathol . 2006 ;210 (1 ):94 –102\n. doi:10.1002/(ISSN)1096-9896 16799920 \n46. Bomba \nL , Walter \nK , Soranzo \nN . The impact of rare and low-frequency genetic variants in common disease\n. Genome Biol . 2017 ;18 (1 ):77 . doi:10.1186/s13059-017-1212-4 28449691 \n47. Nicolae \nDL . Association tests for rare variants\n. Annu Rev Genomics Hum Genet . 2016 ;17 :117 –130\n. doi:10.1146/annurev-genom-083115-022609 27147090 \n48. Neroldova \nM , Stranecky \nV , Hodanova \nK , et al. Rare variants in known and novel candidate genes predisposing to statin-associated myopathy\n. Pharmacogenomics . 2016 ;17 (13 ):1405 –1414\n. doi:10.2217/pgs-2016-0071 27296017\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1178-7066", "issue": "13()", "journal": "Pharmacogenomics and personalized medicine", "keywords": "adverse drug reaction; pharmacogenomics; polymorphisms; rhabdomyolysis; rosuvastatin; whole-exome sequencing", "medline_ta": "Pharmgenomics Pers Med", "mesh_terms": null, "nlm_unique_id": "101514107", "other_id": null, "pages": "59-70", "pmc": null, "pmid": "32184647", "pubdate": "2020", "publication_types": "D002363:Case Reports", "references": "27296017;23420875;15096354;28505269;16697742;30476243;24768873;15774072;29844222;25428737;25929793;15637526;12527750;19940267;24257439;29734517;25333361;15116054;7249508;15845415;18650507;11564660;27199064;24952854;20367534;18095744;28550450;23942138;31242253;17568401;25852115;29016666;28449691;19890253;25829882;17389673;16485049;20560925;27147090;25989972;19151602;29255347;11477075;16799920;21280267;12386133;23755135", "title": "A Pharmacogenomic Dissection of a Rosuvastatin-Induced Rhabdomyolysis Case Evokes the Polygenic Nature of Adverse Drug Reactions.", "title_normalized": "a pharmacogenomic dissection of a rosuvastatin induced rhabdomyolysis case evokes the polygenic nature of adverse drug reactions" }
[ { "companynumb": "CO-JUBILANT CADISTA PHARMACEUTICALS-2020JUB00113", "fulfillexpeditecriteria": "1", "occurcountry": "CO", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "LOSARTAN" }, "drugadd...
{ "abstract": "Acute myeloid leukemia (AML) harboring Fms-like tyrosine kinase 3 (FLT3) internal tandem duplication (ITD) mutation is associated with shorter remission and higher relapse risk. Several FLT3 inhibitors have been used in clinical trials, but their efficacy in extramedullary disease remains unclear. In the present case, a 56-year-old man was diagnosed with FLT3-ITD mutated AML. Due to bone marrow relapse during consolidation therapy, he underwent salvage therapy and a myeloablative conditioning regimen, followed by peripheral blood stem cell transplantation (PBSCT) from a HLA-matched related donor. Acute graft-versus-host disease (GVHD) did not develop, and complete donor chimerism was confirmed on days 27 and 96 after PBSCT. On day 180, he experienced extensive chronic GVHD and had several subcutaneous tumors in his body, which were diagnosed as myeloid sarcoma by pathological examination. We considered this to be a case of isolated extramedullary relapse, as his bone marrow had maintained complete donor chimerism. Treatment with etoposide and ranimustine produced no effect, and tumor progression continued. We started administration of gilteritinib, a FLT3/AXL inhibitor, after identifying the FLT3-ITD mutation in the tumor. Subsequently, there has been a remarkable regression of the tumors. Gilteritinib can be effective in isolated extramedullary relapse after allogeneic stem cell transplantation.", "affiliations": "Department of Hematology, National Hospital Organization, Kure Medical Center and Chugoku Cancer Center, 3-1 Aoyama-chou, Kure, Hiroshima, 737-0023, Japan. kida.michiko.fd@mail.hosp.go.jp.;Department of Hematology, National Hospital Organization, Hiroshima-Nishi Medical Center, Otake, Japan.;Department of Hematology, National Hospital Organization, Kure Medical Center and Chugoku Cancer Center, 3-1 Aoyama-chou, Kure, Hiroshima, 737-0023, Japan.;Department of Hematology, National Hospital Organization, Kure Medical Center and Chugoku Cancer Center, 3-1 Aoyama-chou, Kure, Hiroshima, 737-0023, Japan.;Department of Diagnostic Pathology, National Hospital Organization, Kure Medical Center and Chugoku Cancer Center, Kure, Hiroshima, Japan.;Department of Hematology, National Hospital Organization, Kure Medical Center and Chugoku Cancer Center, 3-1 Aoyama-chou, Kure, Hiroshima, 737-0023, Japan.", "authors": "Kida|Michiko|M|;Kuroda|Yoshiaki|Y|;Kido|Miki|M|;Chishaki|Ren|R|;Kuraoka|Kazuya|K|;Ito|Takuo|T|", "chemical_list": "D000814:Aniline Compounds; D011719:Pyrazines; C000609080:gilteritinib; C497970:FLT3 protein, human; D051941:fms-Like Tyrosine Kinase 3", "country": "Japan", "delete": false, "doi": "10.1007/s12185-020-02855-4", "fulltext": null, "fulltext_license": null, "issn_linking": "0925-5710", "issue": "112(2)", "journal": "International journal of hematology", "keywords": "Acute myeloid leukemia; FLT3-ITD; Gilteritinib; Isolated extramedullary relapse", "medline_ta": "Int J Hematol", "mesh_terms": "D000814:Aniline Compounds; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D008297:Male; D008875:Middle Aged; D009154:Mutation; D009364:Neoplasm Recurrence, Local; D011719:Pyrazines; D020080:Tandem Repeat Sequences; D014184:Transplantation, Homologous; D016896:Treatment Outcome; D051941:fms-Like Tyrosine Kinase 3", "nlm_unique_id": "9111627", "other_id": null, "pages": "243-248", "pmc": null, "pmid": "32170661", "pubdate": "2020-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Successful treatment with gilteritinib for isolated extramedullary relapse of acute myeloid leukemia with FLT3-ITD mutation after allogeneic stem cell transplantation.", "title_normalized": "successful treatment with gilteritinib for isolated extramedullary relapse of acute myeloid leukemia with flt3 itd mutation after allogeneic stem cell transplantation" }
[ { "companynumb": "JP-ASTELLAS-2020JP005382", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PREDNISOLONE" }, "drugadditional": null, ...
{ "abstract": "Metal-on-metal arthroplasty may lead to elevated blood chromium (Cr) and cobalt (Co) levels (>7 μg/l). Since carcinogenic, mutagenic, and teratogenic effects have been suggested, there is concern of pregnancy hazards for women with this condition. The 34-year-old patient has had a unilateral hip replacement for seven years. Before her pregnancy high Cr (47 μg/l) and Co (103 μg/l) blood concentrations were measured, but she did not develop any symptoms. A male infant was delivered after 41 weeks with first degree hypospadias. His levels were increased at 3 weeks of age: 14 μg/l (Cr) and 20 μg/l (Co), but decreased by 9 weeks to 6.7 μg/l (Cr) and 10.0 μg/l (Co). Maternal levels at delivery were 25 μg/l (Cr) and 51 μg/l (Co). The child was fully breast-fed and developed normally. An association between hypospadias and Cr/Co has to be considered speculative. The otherwise favorable outcome of this case may be reassuring for pregnant and breast-feeding patients with metal-on-metal hip replacements.", "affiliations": "Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité - Universitätsmedizin, Berlin, Germany.;Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité - Universitätsmedizin, Berlin, Germany.;Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité - Universitätsmedizin, Berlin, Germany. Electronic address: christof.schaefer@charite.de.", "authors": "Oppermann|Marc|M|;Borisch|Cornelia|C|;Schaefer|Christof|C|", "chemical_list": "D002857:Chromium; D003035:Cobalt", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0890-6238", "issue": "53()", "journal": "Reproductive toxicology (Elmsford, N.Y.)", "keywords": "Chromium; Cobalt; Lactation; Metal-on-metal arthroplasty; Pregnancy", "medline_ta": "Reprod Toxicol", "mesh_terms": "D000328:Adult; D019644:Arthroplasty, Replacement, Hip; D002857:Chromium; D003035:Cobalt; D005260:Female; D005312:Fetal Blood; D006801:Humans; D007021:Hypospadias; D007231:Infant, Newborn; D007774:Lactation; D008297:Male; D008895:Milk, Human; D011247:Pregnancy", "nlm_unique_id": "8803591", "other_id": null, "pages": "51-3", "pmc": null, "pmid": "25828057", "pubdate": "2015-06", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Hip arthroplasty with high chromium and cobalt blood levels--Case report of a patient followed during pregnancy and lactation period.", "title_normalized": "hip arthroplasty with high chromium and cobalt blood levels case report of a patient followed during pregnancy and lactation period" }
[ { "companynumb": "DE-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2015-BI-33290GD", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "d...
{ "abstract": "Non-Candida opportunistic yeasts are emerging causes of bloodstream infection (BSI) in immunocompromised hosts. However, their clinical presentation, management, and outcomes in stem cell transplant (SCT) recipients are not well described. We report the first case to our knowledge of Pseudozyma BSI in a SCT recipient. He had evidence of cutaneous involvement, which has not been previously described in the literature. He became infected while neutropenic and receiving empiric micafungin, which is notable because Pseudozyma is reported to be resistant to echinocandins. He was successfully treated with the sequential use of liposomal amphotericin B and voriconazole. A review of the literature revealed nine reported instances of Pseudozyma fungemia. We performed a retrospective review of 3557 SCT recipients at our institution from January 2000 to June 2015 and identified four additional cases of non-Candida yeast BSIs. These include two with Cryptococcus, one with Trichosporon, and one with Saccharomyces. Pseudozyma and other non-Candida yeasts are emerging pathogens that can cause severe and disseminated infections in SCT recipients and other immunocompromised hosts. Clinicians should have a high degree of suspicion for echinocandin-resistant yeasts, if patients develop breakthrough yeast BSIs while receiving echinocandin therapy.", "affiliations": "Division of Infectious Diseases, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA.;Division of Infectious Diseases, Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA.;Bone Marrow Transplantation and Leukemia Section, Division of Oncology, Washington University School of Medicine, St. Louis, MO, USA.;Division of Infectious Diseases, Rush University Medical Center, Chicago, IL, USA.", "authors": "Pande|Anupam|A|;Non|Lemuel R|LR|;Romee|Rizwan|R|;Santos|Carlos A Q|CA|", "chemical_list": "D000935:Antifungal Agents; D054714:Echinocandins; D055666:Lipopeptides; C068538:liposomal amphotericin B; D003561:Cytarabine; D016179:Granulocyte Colony-Stimulating Factor; D000666:Amphotericin B; D014740:Vidarabine; D065819:Voriconazole; D000077551:Micafungin; D015255:Idarubicin", "country": "Denmark", "delete": false, "doi": "10.1111/tid.12664", "fulltext": null, "fulltext_license": null, "issn_linking": "1398-2273", "issue": "19(2)", "journal": "Transplant infectious disease : an official journal of the Transplantation Society", "keywords": "\nPseudozyma\n; stem cell transplant; yeast bloodstream infections", "medline_ta": "Transpl Infect Dis", "mesh_terms": "D000328:Adult; D000666:Amphotericin B; D000935:Antifungal Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D001706:Biopsy; D003454:Cryptococcus; D003561:Cytarabine; D003881:Dermatomycoses; D054714:Echinocandins; D005076:Exanthema; D005334:Fever; D016469:Fungemia; D016179:Granulocyte Colony-Stimulating Factor; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D015255:Idarubicin; D016867:Immunocompromised Host; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D055666:Lipopeptides; D008297:Male; D000077551:Micafungin; D009894:Opportunistic Infections; D012189:Retrospective Studies; D012440:Saccharomyces; D016879:Salvage Therapy; D014250:Trichosporon; D014587:Ustilaginales; D014740:Vidarabine; D065819:Voriconazole; D015003:Yeasts", "nlm_unique_id": "100883688", "other_id": null, "pages": null, "pmc": null, "pmid": "28099778", "pubdate": "2017-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Pseudozyma and other non-Candida opportunistic yeast bloodstream infections in a large stem cell transplant center.", "title_normalized": "pseudozyma and other non candida opportunistic yeast bloodstream infections in a large stem cell transplant center" }
[ { "companynumb": "US-ASTELLAS-2017US003546", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "MICAFUNGIN SODIUM" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nChemotherapies are associated with significant interindividual variability in therapeutic effect and adverse drug reactions. In lung cancer, the use of gemcitabine and carboplatin induces grade 3 or 4 myelosuppression in about a quarter of the patients, while an equal fraction of patients is basically unaffected in terms of myelosuppressive side effects. We therefore set out to identify genetic markers for gemcitabine/carboplatin-induced myelosuppression.\n\n\nMETHODS\nWe exome sequenced 32 patients that suffered extremely high neutropenia and thrombocytopenia (grade 3 or 4 after first chemotherapy cycle) or were virtually unaffected (grade 0 or 1). The genetic differences/polymorphism between the groups were compared using six different bioinformatics strategies: (i) whole-exome nonsynonymous single-nucleotide variants association analysis, (ii) deviation from Hardy-Weinberg equilibrium, (iii) analysis of genes selected by a priori biologic knowledge, (iv) analysis of genes selected from gene expression meta-analysis of toxicity datasets, (v) Ingenuity Pathway Analysis, and (vi) FunCoup network enrichment analysis.\n\n\nRESULTS\nA total of 53 genetic variants that differed among these groups were validated in an additional 291 patients and were correlated to the patients' myelosuppression. In the validation, we identified rs1453542 in OR4D6 (P = 0.0008; OR, 5.2; 95% CI, 1.8-18) as a marker for gemcitabine/carboplatin-induced neutropenia and rs5925720 in DDX53 (P = 0.0015; OR, 0.36; 95% CI, 0.17-0.71) as a marker for thrombocytopenia. Patients homozygous for the minor allele of rs1453542 had a higher risk of neutropenia, and for rs5925720 the minor allele was associated with a lower risk for thrombocytopenia.\n\n\nCONCLUSIONS\nWe have identified two new genetic markers with the potential to predict myelosuppression induced by gemcitabine/carboplatin chemotherapy.", "affiliations": "Science for Life Laboratory, School of Biotechnology, Division of Gene Technology, Royal Institute of Technology, Solna, Sweden. Department of Forensic Genetics and Forensic Toxicology, National Board of Forensic Medicine, Linköping, Sweden. Division of Drug Research, Clinical Pharmacology, Department of Medical and Health Sciences, Linköping University, Linköping, Sweden. henrik.green@liu.se.;Science for Life Laboratory, School of Biotechnology, Division of Gene Technology, Royal Institute of Technology, Solna, Sweden.;Science for Life Laboratory, School of Biotechnology, Division of Gene Technology, Royal Institute of Technology, Solna, Sweden. NextBio, Cupertino, California.;Science for Life Laboratory, School of Biotechnology, Division of Gene Technology, Royal Institute of Technology, Solna, Sweden.;Department of Oncology and Pathology, Karolinska Institute and Oncology Clinic, Karolinska University Hospital, Stockholm, Sweden.;Department of Oncology and Pathology, Karolinska Institute and Oncology Clinic, Karolinska University Hospital, Stockholm, Sweden.;Department of Medical Oncology, Christie Hospital, Manchester, United Kingdom. Institute of Cancer Sciences, University of Manchester, Manchester, United Kingdom.;Division of Drug Research, Clinical Pharmacology, Department of Medical and Health Sciences, Linköping University, Linköping, Sweden.;Unité INSERM U 981, Université Paris Sud, Département de Médecine, Institut Gustave Roussy, Villejuif, France.;Department of Clinical Physiology, University Hospital, Linköping, Sweden. Department of Medical and Health Sciences, Linköping University, Linköping, Sweden. Department of Pulmonary Medicine, University Hospital, Linköping, Sweden.;Department of Oncology and Pathology, Karolinska Institute and Oncology Clinic, Karolinska University Hospital, Stockholm, Sweden.;Department of Oncology and Pathology, Karolinska Institute and Oncology Clinic, Karolinska University Hospital, Stockholm, Sweden.;Division of Drug Research, Clinical Pharmacology, Department of Medical and Health Sciences, Linköping University, Linköping, Sweden.;Science for Life Laboratory, School of Biotechnology, Division of Gene Technology, Royal Institute of Technology, Solna, Sweden.", "authors": "Gréen|Henrik|H|;Hasmats|Johanna|J|;Kupershmidt|Ilya|I|;Edsgärd|Daniel|D|;de Petris|Luigi|L|;Lewensohn|Rolf|R|;Blackhall|Fiona|F|;Vikingsson|Svante|S|;Besse|Benjamin|B|;Lindgren|Andrea|A|;Brandén|Eva|E|;Koyi|Hirsh|H|;Peterson|Curt|C|;Lundeberg|Joakim|J|", "chemical_list": "D005819:Genetic Markers; D003841:Deoxycytidine; C056507:gemcitabine; D016190:Carboplatin", "country": "United States", "delete": false, "doi": "10.1158/1078-0432.CCR-15-0964", "fulltext": null, "fulltext_license": null, "issn_linking": "1078-0432", "issue": "22(2)", "journal": "Clinical cancer research : an official journal of the American Association for Cancer Research", "keywords": null, "medline_ta": "Clin Cancer Res", "mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D016190:Carboplatin; D002289:Carcinoma, Non-Small-Cell Lung; D003841:Deoxycytidine; D064420:Drug-Related Side Effects and Adverse Reactions; D059472:Exome; D005260:Female; D005819:Genetic Markers; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D009503:Neutropenia; D020641:Polymorphism, Single Nucleotide; D013921:Thrombocytopenia", "nlm_unique_id": "9502500", "other_id": null, "pages": "366-73", "pmc": null, "pmid": "26378035", "pubdate": "2016-01-15", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Using Whole-Exome Sequencing to Identify Genetic Markers for Carboplatin and Gemcitabine-Induced Toxicities.", "title_normalized": "using whole exome sequencing to identify genetic markers for carboplatin and gemcitabine induced toxicities" }
[ { "companynumb": "SE-CIPLA LTD.-2016SE00658", "fulfillexpeditecriteria": "1", "occurcountry": "SE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CARBOPLATIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nWe present what we believe to be the first case in the literature of rhabdomyolysis-induced renal failure caused by a probable drug interaction between elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate (EVG/COBI/FTC/TDF) and pravastatin/fenofibrate.\n\n\nMETHODS\nA 68-year old Caucasian man presented with progressive pain in both legs two weeks after commencing treatment with EVG/COBI/FTC/TDF. He was found to have biochemical evidence of rhabdomyolysis and acute renal failure.\n\n\nCONCLUSIONS\nWe emphasize the need for post marketing surveillance of adverse effects of new products. Pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients taking COBI and fenofibrate with and without other comorbidities. Meanwhile, we suggest that creatine kinase levels should be monitored and patients advised to report myalgias when using concomitant EVG/COBI/FTC/TDF and pravastatin/fenofibrate. This case serves as an important reminder to use estimated glomerular filtration rates rather than serum creatinine levels when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline estimated glomerular filtration rates, it may be prudent to check these filtration rates more frequently than usual. In patients with reduced estimated glomerular filtration rates, potentially nephrotoxic combinations should be avoided wherever possible.", "affiliations": "Tropical Disease Unit, Antwerp University Hospital, Wilrijkstraat 10, Edegem, Belgium. veronique.suttels@outlook.com.;Department of Clinical Sciences, Institute of Tropical Medicine, Kronenburgstraat 43/3, 2000, Antwerp, Belgium. eflorence@itg.be.;Department of Pharmacy, Antwerp University Hospital, Wilrijkstraat 10, Edegem, Belgium. john.leys@uza.be.;Department of Clinical Sciences, Institute of Tropical Medicine, Kronenburgstraat 43/3, 2000, Antwerp, Belgium. mvekemans@itg.be.;Tropical Disease Unit, Antwerp University Hospital, Wilrijkstraat 10, Edegem, Belgium. jvdende@itg.be.;Department of Clinical Sciences, Institute of Tropical Medicine, Kronenburgstraat 43/3, 2000, Antwerp, Belgium. evlieghe@itg.be.;Department of Clinical Sciences, Institute of Tropical Medicine, Kronenburgstraat 43/3, 2000, Antwerp, Belgium. ckenyon@itg.be.", "authors": "Suttels|Veronique|V|;Florence|Eric|E|;Leys|John|J|;Vekemans|Marc|M|;Van den Ende|Jef|J|;Vlieghe|Erika|E|;Kenyon|Chris|C|", "chemical_list": "D019380:Anti-HIV Agents; D000924:Anticholesteremic Agents; D000069545:Elvitegravir, Cobicistat, Emtricitabine, Tenofovir Disoproxil Fumarate Drug Combination; D000960:Hypolipidemic Agents; D017035:Pravastatin; D011345:Fenofibrate", "country": "England", "delete": false, "doi": "10.1186/s13256-015-0671-z", "fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 67110.1186/s13256-015-0671-zCase ReportA 68-year old male presenting with rhabdomyolysis-associated acute kidney injury following concomitant use of elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate and pravastatin/fenofibrate: a case report Suttels Veronique veronique.suttels@outlook.com Florence Eric eflorence@itg.be Leys John john.leys@uza.be Vekemans Marc mvekemans@itg.be Van den Ende Jef jvdende@itg.be Vlieghe Erika evlieghe@itg.be Kenyon Chris ckenyon@itg.be Tropical Disease Unit, Antwerp University Hospital, Wilrijkstraat 10, Edegem, Belgium Department of Clinical Sciences, Institute of Tropical Medicine, Kronenburgstraat 43/3, 2000 Antwerp, Belgium Department of Pharmacy, Antwerp University Hospital, Wilrijkstraat 10, Edegem, Belgium 8 9 2015 8 9 2015 2015 9 19015 12 2014 11 8 2015 © Suttels et al. 2015\nOpen Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Introduction\nWe present what we believe to be the first case in the literature of rhabdomyolysis-induced renal failure caused by a probable drug interaction between elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate (EVG/COBI/FTC/TDF) and pravastatin/fenofibrate.\n\nCase presentation\nA 68-year old Caucasian man presented with progressive pain in both legs two weeks after commencing treatment with EVG/COBI/FTC/TDF. He was found to have biochemical evidence of rhabdomyolysis and acute renal failure.\n\nConclusion\nWe emphasize the need for post marketing surveillance of adverse effects of new products. Pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients taking COBI and fenofibrate with and without other comorbidities. Meanwhile, we suggest that creatine kinase levels should be monitored and patients advised to report myalgias when using concomitant EVG/COBI/FTC/TDF and pravastatin/fenofibrate. This case serves as an important reminder to use estimated glomerular filtration rates rather than serum creatinine levels when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline estimated glomerular filtration rates, it may be prudent to check these filtration rates more frequently than usual. In patients with reduced estimated glomerular filtration rates, potentially nephrotoxic combinations should be avoided wherever possible.\n\nissue-copyright-statement© The Author(s) 2015\n==== Body\nIntroduction\nThe novel single tablet regimen of elvitegravir (EVG), cobicistat (COBI), emtricitabine (FTC), and tenofovir disoproxil fumarate (TDF) is used to treat human immunodeficiency virus (HIV)-1 infection. Contemporary guidelines do not advise caution, dose adjustments, or enhanced monitoring of patients who are taking concomitant pravastatin and EVG/COBI/FTC/TDF [1]. We describe the case of a 68-year-old patient who developed rhabdomyolysis and acute kidney injury (AKI) following the commencement of EVG/COBI/FTC/TDF. To the best of our knowledge, this is the first such case reported in the literature.\n\nCase presentation\nOur patient, a 68-year old Caucasian man, was first diagnosed with HIV-1 infection in 1993. After six years on FTC, zidovudine, and ritonavir-boosted lopinavir he was switched to EVG/COBI/FTC/TDF owing to the development of dyslipidemia and a desire for treatment simplification. He also had hypertension, gout, and impaired renal function. His weight was 73kg with a body mass index of 24.7kg/m2. At the time of the therapy switch, his serum creatinine level was in the normal range (1.16mg/dL) and results from a urine analysis were normal, but his estimated glomerular filtration rate (eGFR) via both the Modification of Diet in Renal Disease (MDRD) and the Cockcroft–Gault formulas was slightly reduced (66.6mL/min per 1.73m2 and 62.9mL/min per 1.73m2, respectively). Other medications he continued to take were acetyl salicylic acid 80mg, lisinopril 5mg, pravastatin 40mg, fenofibrate 267mg, and allopurinol 100mg (all once daily). Our patient’s age, comorbidities, polypharmacy, and slightly impaired renal function were possible risk factors for altered drug effects and interactions [2].\n\nTwo weeks after the switch, our patient developed progressive pain in both calves and thighs. The following week he experienced anorexia, nausea, and dark urine, and presented to our hospital with clinical and biochemical evidence of established rhabdomyolysis and acute tubular necrosis.\n\nA laboratory investigation on admission revealed the following: creatine kinase (CK) >20,000U/L, creatinine 11.9mg/dL, urea 248mg/dL, and eGFR 4mL/min per 1.73m2. His electrolytes and thyroid function tests were normal. A urine analysis showed evidence of acute tubular necrosis. He tested negative for the rs4363657 single-nucleotide polymorphism located within SLCO1B1 gene. This gene encodes the organic anion transporting polypeptide 1B1 (OATP1B1) that has been associated with statin-induced myopathy defined as muscle pain or weakness with elevated CK levels [3].\n\nAll medication was discontinued and intravenous fluid replacement was initiated. Gradually, the myalgia resolved and his renal function recuperated without the need for dialysis. Antiretroviral therapy was recommenced three weeks after admission, first with darunavir, norvir, lamivudine, and abacavir, adjusted according to his eGFR. After one week, the darunavir was changed to lopinavir because of persisting gastrointestinal complaints. On discharge, four weeks after admission, his serum creatinine was 4.8mg/dL and his eGFR was 12mL/min per 1.73m2. At last evaluation five months post-discharge, he was asymptomatic and his kidney function showed further improvement (serum creatinine of 1.51mg/dL and eGFR of 47mL/min per 1.73m2). His CD4 lymphocyte count was 810 cells/μL and he had an undetectable viral load (<20 copies/mL).\n\nDiscussion\nThe nature and timing of our patient’s presentation with rhabdomyolysis-induced AKI two weeks after switching to EVG/COBI/FTC/TDF suggests a drug-induced etiology. His Naranjo Adverse Drug Reaction Probability Score was 6 (indicating a probable adverse drug event) [4]. It is possible that a number of factors combined to cause the rhabdomyolysis (Fig. 1). His age and reduced eGFR at baseline would have predisposed him to nephrotoxicity from TDF and fenofibrate [5–7]. Besides his chronic HIV infection and hypertension, it is possible that his chronic aspirin treatment, albeit in low doses, may have reduced his baseline renal function [8]. This reduced GFR could have increased his serum levels of fenofibrate, TDF, and, to a lesser extent, pravastatin [2, 6].Fig. 1 Possible pathophysiological mechanisms leading to rhabdomyolysis and acute kidney injury in this case. 1B1 and 1B3 organic anion transporters 1B1 and 1B3, 3A4 cytochrome P450 3A4, BCRP breast cancer resistance protein, GIT gastrointestinal tract, PGP P-glycoprotein, PTC proximal tubular cell, X inhibited by cobicistat\n\n\n\nCOBI is a novel potent CYP3A4 inhibitor, used to boost the levels of EVG in the co-formulation EVG/COBI/FTC/TDF [9]. It also inhibits the secretion of creatinine by the proximal tubule, leading to a slight (<10%) increase in serum creatinine and a decrease of eGFR. There is no evidence of a decline in actual GFR and the decline in eGFR is fully and promptly reversible upon discontinuation [9, 10]. COBI has not been studied in patients with an eGFR under 70mL/min per 1.73m2. COBI has a number of other off-target effects. It inhibits CYP2A6, p-glycoprotein (P-gp), and OATP1B1 [11]. Although both pravastatin and rosuvastatin undergo minimal CYP450 metabolism, a pharmacokinetic study showed that COBI increased the maximum serum concentration of rosuvastatin by 89%. This was thought to be due to COBI-induced inhibition of intestinal efflux by breast cancer resistance protein (BCRP) or hepatic uptake by OATPs [12].\n\nAlthough no pharmacokinetic studies have been performed on the interaction between COBI and pravastatin, COBI would be expected to increase the serum levels of pravastatin by a number of mechanisms: inhibition of BCRP intestinal and biliary efflux pumps; inhibition of the P-gp intestinal, biliary, and renal efflux pumps; and inhibition of OATP1B1-mediated entry into hepatocytes [9, 13]. Pravastatin levels inside skeletal muscle cells may also be increased by COBI-induced inhibition of P-gp efflux from these cells [14]. Statin-induced rhabdomyolysis is thought to result from a number of factors. Drug interactions, particularly those leading to increased levels of statins, have been found to play a prominent role in a number of studies [15–17]. The predicted increase in pravastatin levels in serum and muscle cells in our patient may thus have been sufficient to trigger rhabdomyolysis, which would have caused a further decline in eGFR leading to self-reinforcing increases in TDF and pravastatin/fenofibrate. The observed enhanced risk of rhabdomyolysis when pravastatin is used simultaneously with a high dose fenofibrate may also be mediated by fibrate inhibition of statin excretion and hence higher serum statin levels [18]. It is also possible that EVG played a role. There have been six case reports of raltegravir (another integrase inhibitor) linked to rhabdomyolysis. Pravastatin was used concomitantly in one of these cases [19]. Of potential relevance to our case, this association has only been detected during post marketing surveillance. As a result of these cases, the US Food and Drug Administration now recommends caution in using raltegravir in patients with increased risk for muscle damage [20]. Finally, there have been reports of acute tubular necrosis after adding TDF to lisinopril therapy [21].\n\nConclusion\nTwo large trials reporting the efficacy of EVG/COBI/FTC/TDF were industry sponsored [22, 23]. A Cochrane review found that industry-sponsored clinical trials are significantly more likely than non-commercially funded studies to report favorable efficacy and safety results. Plausible mechanisms for the minimization of side effects include excluding up to 30% due to comorbidities [24].\n\nThese considerations justify the need for post marketing surveillance of adverse effects of new products. We believe that pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients on COBI and fenofibrate with and without other comorbidities. Meanwhile, we encourage caution in the concomitant use of EVG/COBI/FTC/TDF and pravastatin/fenofibrate. The case serves as an important reminder to use eGFR rather than serum creatinine when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline eGFRs, it may be prudent to check the eGFR more frequently than usual. In patients with reduced eGFRs, potentially nephrotoxic combinations should be avoided wherever possible. If there are no alternatives then patients should be closely monitored and advised to report myalgia as promptly as possible.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nAbbreviations\nAKIAcute kidney injury\n\nBRCPBreast cancer resistance protein\n\nCKCreatine kinase\n\nCYPCytochrome P450\n\neGFRestimated glomerular filtration rate\n\nEVG/COBI/FTC/TDFElvitegravir, cobicistat, emtricitabine, tenofovir disoproxil fumarate\n\nMDRDModification of Diet in Renal Disease\n\nOATPOrganic anion transporting polypeptide\n\nP-gpP-glycoprotein\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\n\nVS, CK, EV, and JV analyzed and interpreted the patient’s data during his hospitalization period for acute kidney failure and rhabdomyolysis. VS, CK, and JL performed the review of the literature and summary of possible interaction mechanisms. CK developed Fig. 1. EF and MV took part in the clinical discussions and followed the patient in ambulatory care. All authors read and approved the final manuscript.\n\nAcknowledgements\nThe authors declare no sources of funding for this case report.\n==== Refs\nReferences\n1. Stribild [package insert]. Carrigtohill, Ireland: Gilead Sciences Ltd; 2013.\n2. Szadkowska I Stanczyk A Aronow WS Kowalski J Pawlicki L Ahmed A Statin therapy in the elderly: a review Arch Gerontol Geriatr 2010 50 1 114 8 10.1016/j.archger.2008.12.012 19217673 \n3. Link E Parish S Armitage J Bowman L Heath S Matsuda F SLCO1B1 variants and statin-induced myopathy—a genomewide study N Engl J Med 2008 359 8 789 99 10.1056/NEJMoa0801936 18650507 \n4. Naranjo CA Busto U Sellers EM Sandor P Ruiz I Roberts EA A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 1981 30 2 239 45 10.1038/clpt.1981.154 7249508 \n5. Gallant JE Parish MA Keruly JC Moore RD Changes in renal function associated with tenofovir disoproxil fumarate treatment, compared with nucleoside reverse-transcriptase inhibitor treatment Clin Infect Dis 2005 40 8 1194 8 10.1086/428840 15791522 \n6. Attridge RL Frei CR Ryan L Koeller J Linn WD Fenofibrate-associated nephrotoxicity: a review of current evidence Am J Health Syst Pharm 2013 70 14 1219 25 10.2146/ajhp120131 23820458 \n7. Danjuma MI Mohamad-Fadzillah NH Khoo S An investigation of the pattern of kidney injury in HIV-positive persons exposed to tenofovir disoproxil fumarate: an examination of a large population database (MHRA database) Int J STD AIDS 2014 25 4 273 9 10.1177/0956462413504747 24067251 \n8. Segal R Lubart E Leibovitz A Iaina A Caspi D Renal effects of low dose aspirin in elderly patients Isr Med Assoc J 2006 8 10 679 82 17125112 \n9. Temesgen Z Cobicistat, a pharmacoenhancer for HIV treatments Drugs Today (Barc) 2013 49 4 233 7 23616950 \n10. Meyer zu Schwabedissen HE Verstuyft C Kroemer HK Becquemont L Kim RB Human multidrug and toxin extrusion 1 (MATE1/SLC47A1) transporter: functional characterization, interaction with OCT2 (SLC22A2), and single nucleotide polymorphisms Am J Physiol Renal Physiol. 2010 298 4 F997 1005 10.1152/ajprenal.00431.2009 20053795 \n11. Cobicistat [package insert]. Gilead Sciences, Inc. Foster City, CA 94404. Issued: 09/2014. Available from: http://www.gilead.com/~/media/files/pdfs/medicines/hiv/tybost/tybost_pi.pdf?la=en.\n12. Custodio JM Wang H Hao J Lepist EI Ray AS Andrews J Pharmacokinetics of cobicistat boosted-elvitegravir administered in combination with rosuvastatin J Clin Pharmacol 2014 54 6 649 56 10.1002/jcph.256 24375014 \n13. Ito MK Maki KC Brinton EA Cohen JD Jacobson TA Muscle symptoms in statin users, associations with cytochrome P450, and membrane transporter inhibitor use: a subanalysis of the USAGE study J Clin Lipidol 2014 8 1 69 76 10.1016/j.jacl.2013.10.006 24528687 \n14. Ghirlanda G Oradei A Manto A Lippa S Uccioli L Caputo S Evidence of plasma CoQ10-lowering effect by HMG-CoA reductase inhibitors: a double-blind, placebo-controlled study J Clin Pharmacol 1993 33 3 226 9 10.1002/j.1552-4604.1993.tb03948.x 8463436 \n15. Patel AM Shariff S Bailey DG Juurlink DN Gandhi S Mamdani M Statin toxicity from macrolide antibiotic coprescription: a population-based cohort study Ann Intern Med 2013 158 12 869 76 10.7326/0003-4819-158-12-201306180-00004 23778904 \n16. Kashani A Phillips CO Foody JM Wang Y Mangalmurti S Ko DT Risks associated with statin therapy: a systematic overview of randomized clinical trials Circulation 2006 114 25 2788 97 10.1161/CIRCULATIONAHA.106.624890 17159064 \n17. Melli G Chaudhry V Cornblath DR Rhabdomyolysis: an evaluation of 475 hospitalized patients Medicine (Baltimore) 2005 84 6 377 85 10.1097/01.md.0000188565.48918.41 16267412 \n18. Graham DJ Staffa JA Shatin D Andrade SE Schech SD La Grenade L Incidence of hospitalized rhabdomyolysis in patients treated with lipid-lowering drugs JAMA 2004 292 21 2585 90 10.1001/jama.292.21.2585 15572716 \n19. Croce F Vitello P Dalla Pria A Riva A Galli M Antinori S Severe raltegravir-associated rhabdomyolysis: a case report and review of the literature Int J STD AIDS 2010 21 11 783 5 10.1258/ijsa.2010.010246 21187364 \n20. ISENTRESS [package insert]. Whitehouse Station, NJ: Merck Sharp & Dohme Corp.; 2009. Available from http://www.merck.com/product/usa/pi_circulars/isentress/isentress_pi.pdf.\n21. James CW Steinhaus MC Szabo S Dressier RM Tenofovir-related nephrotoxicity: case report and review of the literature Pharmacotherapy 2004 24 3 415 8 10.1592/phco.24.4.415.33182 15040657 \n22. Sax PE DeJesus E Mills A Zolopa A Cohen C Wohl D Co-formulated elvitegravir, cobicistat, emtricitabine, and tenofovir versus co-formulated efavirenz, emtricitabine, and tenofovir for initial treatment of HIV-1 infection: a randomised, double-blind, phase 3 trial, analysis of results after 48 weeks Lancet 2012 379 9835 2439 48 10.1016/S0140-6736(12)60917-9 22748591 \n23. DeJesus E Rockstroh JK Henry K Molina JM Gathe J Ramanathan S Co-formulated elvitegravir, cobicistat, emtricitabine, and tenofovir disoproxil fumarate versus ritonavir-boosted atazanavir plus co-formulated emtricitabine and tenofovir disoproxil fumarate for initial treatment of HIV-1 infection: a randomised, double-blind, phase 3, non-inferiority trial Lancet 2012 379 9835 2429 38 10.1016/S0140-6736(12)60918-0 22748590 \n24. Lundh A Sismondo S Lexchin J Busuioc OA Bero L Industry sponsorship and research outcome Cochrane Database Syst Rev. 2012 12 MR000033 23235689\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "9()", "journal": "Journal of medical case reports", "keywords": null, "medline_ta": "J Med Case Rep", "mesh_terms": "D058186:Acute Kidney Injury; D000368:Aged; D019380:Anti-HIV Agents; D000924:Anticholesteremic Agents; D004347:Drug Interactions; D000069545:Elvitegravir, Cobicistat, Emtricitabine, Tenofovir Disoproxil Fumarate Drug Combination; D011345:Fenofibrate; D015658:HIV Infections; D006801:Humans; D000960:Hypolipidemic Agents; D008297:Male; D017035:Pravastatin; D012206:Rhabdomyolysis", "nlm_unique_id": "101293382", "other_id": null, "pages": "190", "pmc": null, "pmid": "26347243", "pubdate": "2015-09-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "15791522;15572716;17125112;17159064;18650507;19217673;20053795;22748591;22748590;21187364;23235689;23616950;23778904;23820458;24528687;24067251;24375014;15040657;7249508;8463436;16267412", "title": "A 68-year old male presenting with rhabdomyolysis-associated acute kidney injury following concomitant use of elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate and pravastatin/fenofibrate: a case report.", "title_normalized": "a 68 year old male presenting with rhabdomyolysis associated acute kidney injury following concomitant use of elvitegravir cobicistat emtricitabine tenofovir disoproxil fumarate and pravastatin fenofibrate a case report" }
[ { "companynumb": "BE-CIPLA LTD.-2015BE07450", "fulfillexpeditecriteria": "1", "occurcountry": "BE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LAMIVUDINE" }, "drugadditional": null, ...
{ "abstract": "A prospective clinical trial was conducted for patients undergoing cardiac sparing (CS) whole lung irradiation (WLI) using intensity modulated radiation therapy (IMRT). The 3 trial aims were (1) to demonstrate the feasibility of CS IMRT with real-time central quality control; (2) to determine the dosimetric advantages of WLI using IMRT compared with standard anteroposterior (AP) techniques; and (3) to determine acute tolerance and short-term efficacy after a protocol-mandated minimum 2-year follow-up for all patients.\n\n\n\nAll patients underwent a 3-dimensional chest computed tomography scan and a contrast-enhanced 4-dimensional (4D) gated chest computed tomography scan using a standard gating device. The clinical target volume was the entire bilateral 3-dimensional lung volume, and the internal target volume was the 4D minimum intensity projection of both lungs. The internal target volume was expanded by 1 cm to get the planning target volume. All target volumes, cardiac contours, and treatment plans were centrally reviewed before treatment. The different cardiac volumes receiving percentages of prescribed radiation therapy (RT) doses on AP and IMRT WLI plans were estimated and compared.\n\n\n\nThe target 20 patients were accrued in 2 years. Median RT dose was 15 Gy. Real-time central quality assurance review and plan preapproval were obtained for all patients. WLI using IMRT was feasible in all patients. Compared with standard AP WLI, CS IMRT resulted in a statistically significant reduction in radiation doses to the whole heart, atria, ventricles, and coronaries. One child developed cardiac dysfunction and pulmonary restrictive disease 5.5 years after CS IMRT (15 Gy) and doxorubicin (375 mg/m2). The 2- and 3-year lung metastasis progression-free survival was 65% and 52%, respectively.\n\n\n\nWe have demonstrated the feasibility of WLI using CS IMRT and confirmed the previously reported advantages of IMRT, including superior cardiac protection and superior dose coverage of 4D lung volumes. Further studies are required to establish the efficacy and safety of this irradiation technique.", "affiliations": "Radiation Oncology, Northwestern University, Chicago, Illinois. Electronic address: j-kalapurakal@northwestern.edu.;Radiation Oncology, Northwestern University, Chicago, Illinois.;Pediatric Oncology and Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Illinois.;Pediatric Oncology and Medical Imaging, Ann & Robert H. Lurie Children's Hospital of Chicago, Chicago, Illinois.;Radiation Oncology, Northwestern University, Chicago, Illinois.;Radiation Oncology, Northwestern University, Chicago, Illinois.;Imaging and Radiation Oncology Core, Providence, Rhode Island.;Imaging and Radiation Oncology Core, Providence, Rhode Island.;Imaging and Radiation Oncology Core, Providence, Rhode Island.;Imaging and Radiation Oncology Core, Providence, Rhode Island.;Radiation Oncology, Emory University, Atlanta, Georgia.;Pediatric Oncology, Nemours Children's Clinic, Jacksonville, Florida.;Radiation Oncology, Harvard University, Boston, Massachusetts.;Imaging and Radiation Oncology Core, Houston, Texas.;Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York.;Radiation Oncology, MD Anderson Cancer Center, Houston, Texas.;Imaging and Radiation Oncology Core, Providence, Rhode Island.", "authors": "Kalapurakal|John A|JA|;Gopalakrishnan|Mahesh|M|;Walterhouse|David O|DO|;Rigsby|Cynthia K|CK|;Rademaker|Alfred|A|;Helenowski|Irene|I|;Kessel|Sandy|S|;Morano|Karen|K|;Laurie|Fran|F|;Ulin|Ken|K|;Esiashvili|Natia|N|;Katzenstein|Howard|H|;Marcus|Karen|K|;Followill|David S|DS|;Wolden|Suzanne L|SL|;Mahajan|Anita|A|;Fitzgerald|Thomas J|TJ|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.ijrobp.2018.08.034", "fulltext": null, "fulltext_license": null, "issn_linking": "0360-3016", "issue": "103(1)", "journal": "International journal of radiation oncology, biology, physics", "keywords": null, "medline_ta": "Int J Radiat Oncol Biol Phys", "mesh_terms": "D000293:Adolescent; D000328:Adult; D002648:Child; D002675:Child, Preschool; D002985:Clinical Protocols; D005260:Female; D006321:Heart; D006801:Humans; D008168:Lung; D008175:Lung Neoplasms; D008297:Male; D011446:Prospective Studies; D011832:Radiation Injuries; D011879:Radiotherapy Dosage; D011880:Radiotherapy Planning, Computer-Assisted; D050397:Radiotherapy, Intensity-Modulated; D014057:Tomography, X-Ray Computed; D055815:Young Adult", "nlm_unique_id": "7603616", "other_id": null, "pages": "28-37", "pmc": null, "pmid": "30170102", "pubdate": "2019-01-01", "publication_types": "D016428:Journal Article; D016448:Multicenter Study; D052061:Research Support, N.I.H., Extramural", "references": "15049022;11283124;19996459;9738574;15825155;22818413;8235988;22138463;10944599;16989913;8315419;15226229;23765910;10348287;19139431;17980506;18398583;22386373;21384541;7799012;2544249;29874141;15868594;15162142;9744975;8960517;20142603;17577017;15329918", "title": "Cardiac-Sparing Whole Lung IMRT in Patients With Pediatric Tumors and Lung Metastasis: Final Report of a Prospective Multicenter Clinical Trial.", "title_normalized": "cardiac sparing whole lung imrt in patients with pediatric tumors and lung metastasis final report of a prospective multicenter clinical trial" }
[ { "companynumb": "US-MYLANLABS-2018M1097528", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nA patient who was initially considered to have a glioblastoma (GBM) had molecular analysis, showing that it was a pleomorphic xanthoastrocytoma (PXA). Up to 78% of PXA tumors have BRAF V600E mutations. Primary brain tumors with BRAF mutations can have a good response to BRAF MEK inhibitors (BRAF MEKi), and there may be a synergistic response when combined with autophagy inhibitors.\nA 20-year-old man found to have a large brain mass with midline shift underwent resection. He was diagnosed with \"GBM\" and treated with radiation and temozolomide with subsequent disease recurrence. Review of histology showed malignant PXA with BRAF V600E mutation. Treatment with Dabrafenib and Trametinib was started, and tumor size increased in size after 14 months of treatment. Given studies showing that resistance to BRAF inhibition can be overcome by autophagy inhibition, chloroquine was added. Patient has been on \"triple\" therapy for 15 months and has radiographically Stable Disease. At MCC, 3% of patients with gliomas have BRAF mutations who could potentially benefit from this combination therapy.\n\n\nCONCLUSIONS\nThis is the first report of a PXA patient receiving therapy with BRAF MEKi and an autophagy inhibitor with prolonged stable disease. This patient highlights the importance of a molecular interrogation in gliomas to provide an integrated diagnosis and effective treatment. This may be useful in up to 3% of glioma patients with BRAF mutations. Molecular testing in neuro-oncology is providing new avenues of diagnosis and treatment, and detailed molecular interrogation should be considered routine.", "affiliations": "H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA. yolanda.pina@moffitt.org.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.;H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL, 33617, USA.", "authors": "Piña|Yolanda|Y|http://orcid.org/0000-0003-1383-5704;Fusco|Michael J|MJ|;Macaulay|Robert J|RJ|;Walko|Christine M|CM|;Peguero|Edwin|E|;Evernden|Brittany R|BR|;Smalley|Keiran S|KS|;Forsyth|Peter|P|", "chemical_list": "D007093:Imidazoles; D010091:Oximes; D011728:Pyridones; D011744:Pyrimidinones; C560077:trametinib; D002738:Chloroquine; C482119:BRAF protein, human; D048493:Proto-Oncogene Proteins B-raf; C561627:dabrafenib", "country": "Germany", "delete": false, "doi": "10.1007/s00415-019-09575-8", "fulltext": "\n==== Front\nJ Neurol\nJ. Neurol\nJournal of Neurology\n0340-5354 1432-1459 Springer Berlin Heidelberg Berlin/Heidelberg \n\n9575\n10.1007/s00415-019-09575-8\nOriginal Communication\nUsing personalized medicine in gliomas: a genomic approach to diagnosis and overcoming treatment resistance in a case with pleomorphic xanthoastrocytoma\nhttp://orcid.org/0000-0003-1383-5704Piña Yolanda yolanda.pina@moffitt.org Fusco Michael J. Macaulay Robert J. Walko Christine M. Peguero Edwin Evernden Brittany R. Smalley Keiran S. Forsyth Peter grid.468198.a0000 0000 9891 5233H. Lee Moffitt Cancer Center & Research Institute, 12902 USF Magnolia Dr., Tampa, FL 33617 USA \n21 11 2019 \n21 11 2019 \n2020 \n267 3 783 790\n11 7 2019 30 9 2019 3 10 2019 © The Author(s) 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.Introduction\nA patient who was initially considered to have a glioblastoma (GBM) had molecular analysis, showing that it was a pleomorphic xanthoastrocytoma (PXA). Up to 78% of PXA tumors have BRAF V600E mutations. Primary brain tumors with BRAF mutations can have a good response to BRAF MEK inhibitors (BRAF MEKi), and there may be a synergistic response when combined with autophagy inhibitors.\n\nPresentation of the case\nA 20-year-old man found to have a large brain mass with midline shift underwent resection. He was diagnosed with “GBM” and treated with radiation and temozolomide with subsequent disease recurrence. Review of histology showed malignant PXA with BRAF V600E mutation. Treatment with Dabrafenib and Trametinib was started, and tumor size increased in size after 14 months of treatment. Given studies showing that resistance to BRAF inhibition can be overcome by autophagy inhibition, chloroquine was added. Patient has been on “triple” therapy for 15 months and has radiographically Stable Disease. At MCC, 3% of patients with gliomas have BRAF mutations who could potentially benefit from this combination therapy.\n\nConclusion\nThis is the first report of a PXA patient receiving therapy with BRAF MEKi and an autophagy inhibitor with prolonged stable disease. This patient highlights the importance of a molecular interrogation in gliomas to provide an integrated diagnosis and effective treatment. This may be useful in up to 3% of glioma patients with BRAF mutations. Molecular testing in neuro-oncology is providing new avenues of diagnosis and treatment, and detailed molecular interrogation should be considered routine.\n\nKeywords\nPleomorphic xanthoastrocytomaBRAF inhibitionMEK inhibitionV600E mutationAutophagy inhibitionChloroquineissue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2020\n==== Body\nIntroduction\nPleomorphic xanthoastrocytoma (PXA) is a rare low-grade astrocytoma, which accounts for less than 1% of all central nervous system (CNS) neoplasms. It is most commonly found in children and young adults. It is characterized by spindle-shaped or pleomorphic astrocytes with frequent intracytoplasmic lipid vacuoles, moderate-to-marked nuclear atypia, eosinophilic granular bodies, frequent desmoplasia, and patchy chronic inflammation. Mitotic activity is usually sparse. PXA is usually low grade, but may be anaplastic as in the current case report. Recently, a growing body of evidence has shifted the classification of gliomas based on histological and molecular findings, with PXA and anaplastic PXA perceived as separate entities, and classified by the World Health Organization (WHO) as grade II and III, respectively. This is mainly based on the mitotic index (MI), with WHO grade III based on MI equal to or greater than 5 mitotic cells per every 10 high power field (HPF), with or without accompanying necrosis [1, 2]. Magnetic Resonance Imaging (MRI) of the brain demonstrates either a solid mass or a solid-cystic pattern with the cystic component hypointense on T1-weighted images and hyperintense on T2, and the solid component showing contrast enhancement that is hypo- or isointense on T1-weighted images and iso- or slightly hyperintense on T2 [3, 4].\n\nSixty to seventy-eight percent of PXA tumors have a BRAF V600E mutation. This mutation is frequently found in PXA and has allowed targeted molecular therapy in many other different tumor types [5–10]. There are few clinical trials in BRAF-mutated gliomas. The VE-BASKET study, which treated a wide range of glioma patients with BRAF V600 mutation with BRAF inhibition, showed a PXA case with a complete response (14% of PXA treated, n = 7, and 4% of all gliomas, n = 24), two cases with partial responses (29% of PXA, and 8% of all gliomas), and three cases with stable disease (43% of PXA, and 12.5% of all gliomas). The median progression-free survival was 5.5 months in all the gliomas treated, and more than 39.1 months in a PXA case [11]. There are several case reports of combined BRAF MEKi in PXA patients [12–14]. As well as an enhanced response to BRAF inhibition when combined with autophagy inhibition in glioma cell lines [15]. However, experience with BRAF MEKi with the addition of chloroquine has not been published in PXAs. Here, we present a patient with a malignant PXA with a BRAF V600E mutation, who had a prolonged response to BRAF MEKi and benefited by the addition of chloroquine with an ongoing prolonged disease control.\n\nCase presentation\nA 19-year-old man developed blurry vision with new headaches in November 2014. He had bilateral papilledema. A MRI brain showed a large right-sided lesion involving the parieto-temporal lobes, hyperintense on T1 and T2-weighted sequences, with significant surrounding vasogenic edema on T2-weighted fluid-attenuated inversion recovery (FLAIR), contrast enhancement post-gadolinium, and a right-to-left midline shift (Fig. 1a, b). The overall appearance of this lesion looked a bit unusual for a classical GBM. He had a subtotal resection on January 30th, 2015, and was diagnosed by a local pathologist with a “GBM”. He completed 6 weeks of radiation therapy (RT) and temozolomide (TMZ). Four months later, a follow-up MRI showed an increase in the size of the enhancing tumor and, despite the possibility of pseudoprogression, a second surgical resection was performed on June 2nd, 2015 and showed “GBM”. Maintenance TMZ was started and follow-up imaging showed stable disease (Fig. 1).Fig. 1 MRI of the brain demonstrating a right-sided, large parieto-temporo-occipital mass, which appeared unusual for a classical GBM, with surrounding vasogenic edema and a right-to-left midline shift. a, b Initial MRI of the brain prior to surgery for tumor resection in January 2015. a T1-weighted post-contrast demonstrating heterogeneous enhancement. b T2-weighted fluid-attenuated inversion recovery (FLAIR) shows significant surrounding vasogenic edema. c, d Status-post resection and two cycles of maintenance TMZ in September 2015. c T1-weighted post-contrast. d Status-post resection, T2-weighted FLAIR sequence\n\n\n\nThe patient was referred to the Neuro-Oncology clinic at MCC in June 2015. Histology review showed that he had a malignant PXA grade III–IV, rather than a GBM. It had multinucleated giant cells, prominent nucleoli, and eosinophilic granular bodies on 600 × HPF, and a high mitotic index with dysplastic neurons on 200 × HPF (Fig. 2). Histological samples were GFAP positive, with necrosis, ATRX retained, had a proliferation rate of 2% by Ki-67, and was positive for BRAF V600E on IHC (Fig. 3). Foundation one testing confirmed the BRAF V600E mutation, IDH1 wild-type, and no EGFRviii. Other testing showed that the tumor was negative for 1p/19q co-deletion and was O6-methylguanine-DNA methyltransferase (MGMT) promoter unmethylated.Fig. 2 Histology of tumor sample demonstrating an atypical malignant glioma that resembled a PXA rather than a GBM. a Non-infiltrating tumor, WHO grade III–IV, H&E, × 20 HPF. b Neoplastic astrocytes and binucleated giant cells, with prominent nucleoli, nuclear vacuolation, and eosinophilic granular bodies, H&E, × 600 HPF. c Vascular proliferation, × 200 HPF. d Necrosis, × 200 HPF\n\nFig. 3 Immunohistochemistry (original magnification × 200 HPF). Tumor cells: a were GFAP-positive; b had a Ki-67 proliferation index of 2%; c retained ATRX; and d were diffusely positive for BRAF V600E\n\n\n\nAfter an initial 17 months of stable disease, on his MRI, there was a small increase in the size of his tumor (Fig. 4). Accordingly, combination therapy with BRAF kinase and MEK inhibitors, Dabrafenib 150 mg PO BID and Trametinib 2 mg PO OD, was started on November 2016. As soon as 2 months after starting treatment, there was radiographic evidence of disease regression, though it did not meet the criteria for a Partial Response because of its small size. The patient was continued on this treatment regimen for 10 months and further serial imaging showed stable disease.Fig. 4 Lesion size changes based on RANO criteria and response to treatment. a Dabrafenib and trametinib combination therapy was initiated. b Treatment was discontinued for a holiday and re-started after disease progression (c). d Autophagy inhibitor was added to dabrafenib and trametinib. e Last MRI brain showed slight decrease in the size of the mass and the central cystic component measuring 1.9 × 1.6 cm, compared to prior measuring 2.1 × 1.5 cm 2 months earlier; there were no changes in the peripheral enhancing aspect of the lesion. Target lesion response measured by RANO criteria. Star = CR (all target lesions disappeared). Triangle = SD (SPD < 50% decrease to < 25% increase). Rhomboid = PD (SPD increased by ≥ 25% from nadir value)\n\n\n\nAfter 8 months of treatment, in July 2017, treatment was held to give the patient a “drug holiday,” but, 2 months later, his MRI showed disease progression. Dabrafenib and Trametinib were re-started, and he remained stable until January 2018 when he had disease progression with BRAF MEKi. Since resistance to BRAF inhibition can be overcome by autophagy inhibition [15–17], we added the autophagy inhibitor chloroquine (500 mg PO daily) to his BRAF MEKi therapy. Each tablet of chloroquine contains 500 mg of chloroquine phosphate USP and the equivalent to 300 mg chloroquine base, which is the standard, maximal safe dose that is FDA-approved for adults [18].\n\nBased on the Response Assessment in Neuro-Oncology (RANO) criteria, the lesion size was measured, the sum of the perpendicular diameters (SPD) calculated and plotted (Fig. 4). The tumor decreased by more than 25% after BRAF MEKi was started (Fig. 4a) but unfortunately increased after a drug holiday (Fig. 4c), and continued to grow despite re-starting therapy with BRAF MEKi (Fig. 4d), at which point the autophagy inhibitor chloroquine was added halting the rate of tumor progression and even causing a slight decrease in the lesion size (Fig. 4e).\n\nThere are no reported potential interactions between chloroquine and Dabrafenib and/or Trametinib. Chloroquine’s adverse effects can be multisystemic affecting the eyes (e.g., retinopathy, visual disturbances), hearing, liver, gastrointestinal system (e.g., nausea, vomiting, diarrhea, abdominal cramps), muscles (e.g., myopathy), skin (e.g., erythema multiforme, Stevens–Johnson syndrome), cardiac (e.g., prolonged QT interval), hematologic system (e.g., pancytopenia), and nervous system (e.g., seizures, extrapyramidal signs) [18]. Given these side effects, we had taken precautionary measures with close monitoring every 1–2 months since started triple therapy, checking complete blood cells counts, complete metabolic panels, electrocardiogram, and echocardiograms. Overall, our patient tolerated the triple therapy well for 17 months until recently, when he complained of mild nausea, diarrhea, and a skin rash. The decision was made to hold chloroquine, while continuing Dabrafenib and Trametinib, with plans to re-assess him in 2 months.\n\nIn summary, radiographically, he has had Stable Disease with BRAF MEKi for 14 months, and later with the addition of chloroquine for a total of > 2.5 years of treatment (triple therapy for 17 months), without major side effects from the treatment, until recently for which he is receiving a drug holiday from chloroquine.\n\nDiscussion\nPXA is a rare low-grade astrocytoma, which may be anaplastic, as in the case herein presented. An MRI can show either a solid mass or a solid-cystic lesion, with the cystic component being hypointense on T1 and hyperintense on T2, and the solid component having contrast enhancement that is hypo- or isointense on T1 and iso- or slightly hyperintense on T2 [3, 4]. These radiographic findings make it possible to misdiagnose this as a malignant glioma or a GBM. Histologically, PXA is composed of neoplastic astrocytes and multinucleated giant cells with prominent nucleoli and/or nuclear vacuolation, with immunoreactivity to S100 protein and GFAP [19]. Sixty to seventy-eight percent of PXA tumors have been found to carry BRAF V600E mutation, which was more frequently found in PXA tumors than in any other neuroepithelial neoplasm of the CNS [5–10]; it can be detected via immunohistochemistry [20] or by molecular techniques. The relationship of anaplastic PXA to epithelioid glioblastomas, which also carry the BRAF V600E alteration, remains unsettled.\n\nBRAF V600E mutations result in the constitutive activation of the BRAF pathway, which includes mitogen-activated extracellular signal kinase (MEK) 1 and 2 activation. This mutation is found in a number of primary brain gliomas, including PXAs [7, 9, 21, 22], gangliogliomas, and papillary craniopharyngiomas [23]. Dabrafenib (Tanfinlar®) is a BRAF kinase inhibitor approved by the U.S. FDA for BRAF V600E melanomas [24]. Metastatic melanoma tumors with BRAF V600E mutations have a complete (6%) or partial tumor regression (62.5%) in most patients treated with the BRAF inhibitor [25]. Combination therapy with Dabrafenib and Trametinib (Mekinist®), an MEK 1 and 2 inhibitor, produces superior response rate to BRAF inhibition alone and has been approved for metastatic melanoma with either BRAF V600E or V600K mutations [26].\n\nSeveral Clinical Trials have shown that BRAF inhibition monotherapy (e.g., vemurafenib) is effective in melanoma brain metastases [27–30] and small case series have shown that several primary BRAF mutant brain tumors (i.e., primary neuroepithelial brain tumors, malignant astrocytomas, papillary craniopharyngiomas, and other nonmelanoma cancers) also respond to BRAF inhibition [21, 23, 31, 32]. Surprisingly, papillary craniopharyngiomas have BRAF mutations and patients may respond dramatically [23]. Others have reported BRAF mutant anaplastic PXAs having partial responses to BRAF inhibitor monotherapy [31, 33]. And, more recently, there are reports of BRAF MEKi. Similarly, few case reports have shown promising results after combination therapy with BRAF MEKi in PXA patients with BRAF mutations [12–14].\n\nUnfortunately, tumors often develop resistance to targeted therapies, and hence, approaches to overcome resistance to BRAF MEKi would be very useful [22, 34]. One such approach is by inhibiting autophagy. Maddodi et al. showed that autophagy is triggered by hyperactivation of the ERK pathway by upstream BRAF activating mutations in melanomas in vitro and in vivo. [35] Autophagy inhibition in BRAF mutant melanoma animal inhibits tumor growth and prolongs survival [34]. In addition, high autophagic index in melanomas correlates with short survival and autophagy inhibition is effective in vitro. [36] Similar results are seen in BRAF V600E lung, and pancreatic and colorectal cancers, and hence, this is not tumor type specific [37, 16]. This strategy of combining autophagy inhibition with BRAF inhibition monotherapy in brain tumors was demonstrated in several brain tumors, including PXAs, using chloroquine [15–17]. Therefore, we combined BRAF MEKi with chloroquine and transformed a radiographically growing tumor (Fig. 4c, d) into a long (> 18 months) and sustained stability of disease in a patient without side effects for almost 1.5 years. This supports the hypothesis that autophagy inhibition can make brain tumors with BRAF mutations more chemosensitive to BRAF inhibition.\n\nThe current case report has several limitations, which include the lack of ability to generalize, risk of misinterpretation, and no established cause-effect relationship. As a single case report, findings cannot be generalized to represent similar groups of patients, partly for its dearth of an established cause–effect association from therapy, which can lead to misinterpretation. The observed response to treatment in this patient initially to dual BRAF MEKi, and subsequently to triple therapy with the addition of chloroquine, allows us to generate a hypothesis, aid in pharmacovigilance, and describe novel treatments when research designs are not possible due, for instance, to the rarity of the disease, or give us insight into the creation of controlled clinical trials in the future.\n\nTo our knowledge, this is the first case reported of combination therapy of BRAF MEKi with the autophagy inhibitor chloroquine in a brain tumor patient. This highlights the importance of a molecular interrogation of gliomas to provide an integrated diagnosis in gliomas and effective targeted treatment. Encouraged by these results, we reviewed glioma cases at Moffitt Cancer Center (MCC), who had similar molecular profiling, and found 3% patients with gliomas carrying BRAF mutations. These patients could potentially benefit from treatment with BRAF MEKi in combination with chloroquine. Molecular testing in neuro-oncology is providing new avenues of diagnosis and treatment, and detailed molecular interrogation should be considered routine.\n\nCompliance with ethical standards\nConflicts of interest\nThe authors of this manuscript have no conflict of interest to report.\n\nEthical standards\nThe current article does not contain any studies with humans or animals performed by any of the authors.\n\nInformed consent\nThe patient has given his informed consent for the case report to be published.\n==== Refs\nReferences\n1. Giannini C Scheithauer BW Burger PC Brat DJ Wollan PC Lach B O'Neill BP Pleomorphic xanthoastrocytoma: what do we really know about it? Cancer 1999 85 9 2033 2045 10.1002/(SICI)1097-0142(19990501)85:9<2033::AID-CNCR22>3.0.CO;2-Z 10223246 \n2. Wesseling P Capper D WHO 2016 classification of gliomas Neuropathol Appl Neurobiol 2018 44 2 139 150 10.1111/nan.12432 28815663 \n3. Goncalves VT Reis F Queiroz Lde S Franca M Jr Pleomorphic xanthoastrocytoma: magnetic resonance imaging findings in a series of cases with histopathological confirmation Arq Neuropsiquiatr 2013 71 1 35 39 10.1590/S0004-282X2012005000016 23249973 \n4. Yu S He L Zhuang X Luo B Pleomorphic xanthoastrocytoma: MR imaging findings in 19 patients Acta Radiol 2011 52 2 223 228 10.1258/ar.2010.100221 21498352 \n5. Bettegowda C Agrawal N Jiao Y Wang Y Wood LD Rodriguez FJ Hruban RH Gallia GL Binder ZA Riggins CJ Exomic sequencing of four rare central nervous system tumor types Oncotarget 2013 4 4 572 583 10.18632/oncotarget.964 23592488 \n6. Chappe C Padovani L Scavarda D Forest F Nanni-Metellus I Loundou A Mercurio S Fina F Lena G Colin C Dysembryoplastic neuroepithelial tumors share with pleomorphic xanthoastrocytomas and gangliogliomas BRAF(V600E) mutation and expression Brain Pathol 2013 23 5 574 583 10.1111/bpa.12048 23442159 \n7. Dias-Santagata D Lam Q Vernovsky K Vena N Lennerz JK Borger DR Batchelor TT Ligon KL Iafrate AJ Ligon AH BRAF V600E mutations are common in pleomorphic xanthoastrocytoma: diagnostic and therapeutic implications PLoS ONE 2011 6 3 e17948 10.1371/journal.pone.0017948 21479234 \n8. Ida CM Rodriguez FJ Burger PC Caron AA Jenkins SM Spears GM Aranguren DL Lachance DH Giannini C Pleomorphic xanthoastrocytoma: natural history and long-term follow-up Brain Pathol 2015 25 5 575 586 10.1111/bpa.12217 25318587 \n9. Schindler G Capper D Meyer J Janzarik W Omran H Herold-Mende C Schmieder K Wesseling P Mawrin C Hasselblatt M Analysis of BRAF V600E mutation in 1,320 nervous system tumors reveals high mutation frequencies in pleomorphic xanthoastrocytoma, ganglioglioma and extra-cerebellar pilocytic astrocytoma Acta Neuropathol 2011 121 3 397 405 10.1007/s00401-011-0802-6 21274720 \n10. Zhang J Wu G Miller CP Tatevossian RG Dalton JD Tang B Orisme W Punchihewa C Parker M Qaddoumi I Whole-genome sequencing identifies genetic alterations in pediatric low-grade gliomas Nat Genet 2013 45 6 602 612 10.1038/ng.2611 23583981 \n11. Kaley T Touat M Subbiah V Hollebecque A Rodon J Lockhart AC Keedy V Bielle F Hofheinz RD Joly F BRAF inhibition in BRAF(V600)-mutant gliomas: results from the VE-BASKET study J Clin Oncol Off J Am Soc Clin Oncol 2018 36 JCO2018789990 10.1200/JCO.2018.78.9990 \n12. Hussain F Horbinski CM Chmura SJ Yamini B Lukas RV Response to BRAF/MEK inhibition after progression with BRAF inhibition in a patient with anaplastic pleomorphic xanthoastrocytoma Neurologist 2018 23 5 163 166 10.1097/NRL.0000000000000194 30169370 \n13. Amayiri N Swaidan M Al-Hussaini M Halalsheh H Al-Nassan A Musharbash A Tabori U Hawkins C Bouffet E Sustained response to targeted therapy in a patient with disseminated anaplastic pleomorphic xanthoastrocytoma J Pediatr Hematol Oncol 2018 40 6 478 482 10.1097/MPH.0000000000001032 29200156 \n14. Brown NF Carter T Kitchen N Mulholland P Dabrafenib and trametinib in BRAFV600E mutated glioma CNS Oncol 2017 6 4 291 296 10.2217/cns-2017-0006 28984141 \n15. Mulcahy Levy JM Zahedi S Griesinger AM Morin A Davies KD Aisner DL Kleinschmidt-DeMasters BK Fitzwalter BE Goodall ML Thorburn J Autophagy inhibition overcomes multiple mechanisms of resistance to BRAF inhibition in brain tumors Elife 2017 6 e19671 10.7554/eLife.19671 28094001 \n16. Kinsey CG Camolotto SA Boespflug AM Guillen KP Foth M Truong A Schuman SS Shea JE Seipp MT Yap JT Publisher correction: protective autophagy elicited by RAF→MEK→ERK inhibition suggests a treatment strategy for RAS-driven cancers Nat Med 2019 25 620 627 10.1038/s41591-019-0367-9 30833748 \n17. Levy JM Thompson JC Griesinger AM Amani V Donson AM Birks DK Morgan MJ Mirsky DM Handler MH Foreman NK Autophagy inhibition improves chemosensitivity in BRAF(V600E) brain tumors Cancer Discov 2014 4 7 773 780 10.1158/2159-8290.CD-14-0049 24823863 \n18. Food and Drug Administration (FDA) Drug and safety data sheet (2013). FDA: aralen chloroquine phosphate, USP. Reference ID: 3402523. http://www.accessdata.fda.gov/drugsatfda_docs/label/2013/006002s043lbl.pdf\n19. Louis DN Ohgaki H Wiestler OD Cavenee WK Burger PC Jouvet A Scheithauer BW Kleihues P The 2007 WHO classification of tumours of the central nervous system Acta Neuropathol 2007 114 2 97 109 10.1007/s00401-007-0243-4 17618441 \n20. Ida CM Vrana JA Rodriguez FJ Jentoft ME Caron AA Jenkins SM Giannini C Immunohistochemistry is highly sensitive and specific for detection of BRAF V600E mutation in pleomorphic xanthoastrocytoma Acta Neuropathol Commun 2013 1 20 10.1186/2051-5960-1-20 24252190 \n21. Nicolaides TP Li H Solomon DA Hariono S Hashizume R Barkovich K Baker SJ Paugh BS Jones C Forshew T Targeted therapy for BRAFV600E malignant astrocytoma Clin Cancer Res 2011 17 24 7595 7604 10.1158/1078-0432.CCR-11-1456 22038996 \n22. Hartsough E Shao Y Aplin AE Resistance to RAF inhibitors revisited J Investig Dermatol 2014 134 2 319 325 10.1038/jid.2013.358 24108405 \n23. Brastianos PK Shankar GM Gill CM Taylor-Weiner A Nayyar N Panka DJ Sullivan RJ Frederick DT Abedalthagafi M Jones PS Dramatic response of BRAF V600E mutant papillary craniopharyngioma to targeted therapy J Natl Cancer Inst 2015 108 2 djv310 10.1093/jnci/djv310 26498373 \n24. Hauschild A Grob JJ Demidov LV Jouary T Gutzmer R Millward M Rutkowski P Blank CU Miller WH Jr Kaempgen E Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial Lancet 2012 380 9839 358 365 10.1016/S0140-6736(12)60868-X 22735384 \n25. Flaherty KT Puzanov I Kim KB Ribas A McArthur GA Sosman JA O'Dwyer PJ Lee RJ Grippo JF Nolop K Inhibition of mutated, activated BRAF in metastatic melanoma N Engl J Med 2010 363 9 809 819 10.1056/NEJMoa1002011 20818844 \n26. Owens GM New FDA drug approvals hit an 18-year high in 2014 Am Health Drug Benefits 2015 8 Spec Feature 15 17 25945154 \n27. Chapman PB Robert C Larkin J Haanen JB Ribas A Hogg D Hamid O Ascierto PA Testori A Lorigan PC Vemurafenib in patients with BRAFV600 mutation-positive metastatic melanoma: final overall survival results of the randomized BRIM-3 study Ann Oncol 2017 28 10 2581 2587 10.1093/annonc/mdx339 28961848 \n28. Dummer R Goldinger SM Turtschi CP Eggmann NB Michielin O Mitchell L Veronese L Hilfiker PR Felderer L Rinderknecht JD Vemurafenib in patients with BRAF(V600) mutation-positive melanoma with symptomatic brain metastases: final results of an open-label pilot study Eur J Cancer 2014 50 3 611 621 10.1016/j.ejca.2013.11.002 24295639 \n29. Flaherty L Hamid O Linette G Schuchter L Hallmeyer S Gonzalez R Cowey CL Pavlick A Kudrik F Curti B A single-arm, open-label, expanded access study of vemurafenib in patients with metastatic melanoma in the United States Cancer J 2014 20 1 18 24 10.1097/PPO.0000000000000024 24445759 \n30. McArthur GA Chapman PB Robert C Larkin J Haanen JB Dummer R Ribas A Hogg D Hamid O Ascierto PA Safety and efficacy of vemurafenib in BRAF(V600E) and BRAF(V600K) mutation-positive melanoma (BRIM-3): extended follow-up of a phase 3, randomised, open-label study Lancet Oncol 2014 15 3 323 332 10.1016/S1470-2045(14)70012-9 24508103 \n31. Hyman DM Puzanov I Subbiah V Faris JE Chau I Blay JY Wolf J Raje NS Diamond EL Hollebecque A Vemurafenib in multiple nonmelanoma cancers with BRAF V600 mutations N Engl J Med 2015 373 8 726 736 10.1056/NEJMoa1502309 26287849 \n32. Preusser M Bienkowski M Birner P BRAF inhibitors in BRAF-V600 mutated primary neuroepithelial brain tumors Expert Opin Investig Drugs 2016 25 1 7 14 10.1517/13543784.2016.1110143 \n33. Usubalieva A Pierson CR Kavran CA Huntoon K Kryvenko ON Mayer TG Zhao W Rock J Ammirati M Puduvalli VK Primary meningeal pleomorphic xanthoastrocytoma with anaplastic features: a report of 2 cases, one with BRAF(V600E) mutation and clinical response to the BRAF inhibitor dabrafenib J Neuropathol Exp Neurol 2015 74 10 960 969 10.1097/NEN.0000000000000240 26352988 \n34. Xie X Koh JY Price S White E Mehnert JM Atg7 overcomes senescence and promotes growth of BrafV600E-driven melanoma Cancer Discov 2015 5 4 410 423 10.1158/2159-8290.CD-14-1473 25673642 \n35. Maddodi N Huang W Havighurst T Kim K Longley BJ Setaluri V Induction of autophagy and inhibition of melanoma growth in vitro and in vivo by hyperactivation of oncogenic BRAF J Investig Dermatol 2010 130 6 1657 1667 10.1038/jid.2010.26 20182446 \n36. Ma XH Piao S Wang D McAfee QW Nathanson KL Lum JJ Li LZ Amaravadi RK Measurements of tumor cell autophagy predict invasiveness, resistance to chemotherapy, and survival in melanoma Clin Cancer Res 2011 17 10 3478 3489 10.1158/1078-0432.CCR-10-2372 21325076 \n37. Strohecker AM Guo JY Karsli-Uzunbas G Price SM Chen GJ Mathew R McMahon M White E Autophagy sustains mitochondrial glutamine metabolism and growth of BrafV600E-driven lung tumors Cancer Discov 2013 3 11 1272 1285 10.1158/2159-8290.CD-13-0397 23965987\n\n", "fulltext_license": "CC BY", "issn_linking": "0340-5354", "issue": "267(3)", "journal": "Journal of neurology", "keywords": "Autophagy inhibition; BRAF inhibition; Chloroquine; MEK inhibition; Pleomorphic xanthoastrocytoma; V600E mutation", "medline_ta": "J Neurol", "mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001254:Astrocytoma; D001932:Brain Neoplasms; D002738:Chloroquine; D019008:Drug Resistance, Neoplasm; D006801:Humans; D007093:Imidazoles; D008297:Male; D010091:Oximes; D057285:Precision Medicine; D048493:Proto-Oncogene Proteins B-raf; D011728:Pyridones; D011744:Pyrimidinones; D055815:Young Adult", "nlm_unique_id": "0423161", "other_id": null, "pages": "783-790", "pmc": null, "pmid": "31748891", "pubdate": "2020-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "20818844;23583981;29200156;23442159;28815663;17618441;30833748;28094001;25318587;21325076;24295639;23592488;23965987;24108405;10223246;26352988;30351999;26287849;26536389;24252190;20182446;21274720;28961848;24823863;28984141;24445759;25673642;22038996;30169370;21498352;21479234;24508103;26498373;23249973;22735384", "title": "Using personalized medicine in gliomas: a genomic approach to diagnosis and overcoming treatment resistance in a case with pleomorphic xanthoastrocytoma.", "title_normalized": "using personalized medicine in gliomas a genomic approach to diagnosis and overcoming treatment resistance in a case with pleomorphic xanthoastrocytoma" }
[ { "companynumb": "NVSC2019US048795", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DABRAFENIB" }, "drugadditional": "3", "druga...
{ "abstract": "'Chronic Lyme disease' is a controversial condition. As any hard evidence is lacking that unresolved systemic symptoms, following an appropriately diagnosed and treated Lyme disease, are related to a chronic infection with the tick-borne spirochaetes of the Borrelia genus, the term 'chronic Lyme disease' should be avoided and replaced by the term 'post-treatment Lyme disease syndrome.' The improper prescription of prolonged antibiotic treatments for these patients can have an impact on the community antimicrobial resistance and on the consumption of health care resources. Moreover, these treatments can be accompanied by severe complications. In this case report, we describe a life-threatening ceftriaxone-induced immune hemolytic anemia with an acute kidney injury (RIFLE-stadium F) due to a pigment-induced nephropathy in a 76-year-old woman, who was diagnosed with a so-called 'chronic Lyme disease.'", "affiliations": "a Department of Nephroloy , Ghent University Hospital , Gent , Belgium.;a Department of Nephroloy , Ghent University Hospital , Gent , Belgium.;a Department of Nephroloy , Ghent University Hospital , Gent , Belgium.;a Department of Nephroloy , Ghent University Hospital , Gent , Belgium.", "authors": "De Wilde|Maarten|M|;Speeckaert|Marijn|M|;Callens|Rutger|R|;Van Biesen|Wim|W|", "chemical_list": "D000900:Anti-Bacterial Agents; D002443:Ceftriaxone", "country": "England", "delete": false, "doi": "10.1080/17843286.2016.1180829", "fulltext": null, "fulltext_license": null, "issn_linking": "1784-3286", "issue": "72(2)", "journal": "Acta clinica Belgica", "keywords": "Ceftriaxone; Drug-induced hemolytic anemia; ‘Chronic Lyme disease’", "medline_ta": "Acta Clin Belg", "mesh_terms": "D000368:Aged; D000744:Anemia, Hemolytic, Autoimmune; D000900:Anti-Bacterial Agents; D002443:Ceftriaxone; D002908:Chronic Disease; D005260:Female; D006801:Humans; D008193:Lyme Disease", "nlm_unique_id": "0370306", "other_id": null, "pages": "133-137", "pmc": null, "pmid": "27169474", "pubdate": "2017-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Ceftriaxone-induced immune hemolytic anemia as a life-threatening complication of antibiotic treatment of 'chronic Lyme disease'.", "title_normalized": "ceftriaxone induced immune hemolytic anemia as a life threatening complication of antibiotic treatment of chronic lyme disease" }
[ { "companynumb": "BE-ROCHE-1915938", "fulfillexpeditecriteria": "1", "occurcountry": "BE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "drugadditional": "3", "drug...
{ "abstract": "BACKGROUND\nBullous pemphigoid (BP) is an acquired subepidermal autoimmune blistering disease in which there are humoral and cellular responses against the BP180 and BP230 antigens. Dipeptidyl peptidase (DPP)-4 inhibitors enhance endogenous glucagon peptide-1 and glucose-dependent insulinotropic polypeptide secretion with food intake, which leads to insulin secretion, as well as to the reduction of glucagon secretion. Recently, several cases of DPP-4 inhibitor-associated BP have been reported.\n\n\nOBJECTIVE\nTo report 3 cases of DPP-4 inhibitor-associated BP, one of which is due to linagliptin use, as well as to review all currently published cases of DPP-4 inhibitor-associated BP.\n\n\nMETHODS\nThree patients diagnosed with BP at our department showed a clear temporal relationship between the introduction of DPP-4 for the treatment of diabetes and the onset of BP. One case was due to linagliptin use, while the other 2 cases were due to an association with vildagliptin-metformin use.\n\n\nCONCLUSIONS\nThis is the first report of linagliptin-associated BP. Furthermore, 2 other cases of vildagliptin-associated BP are reported.", "affiliations": "Department of Dermatology, Hospital Universitario Virgen Macarena, Seville, Spain.", "authors": "Mendonça|Francisco Manuel Ildefonso|FM|;Martín-Gutierrez|Francisco José|FJ|;Ríos-Martín|Juan José|JJ|;Camacho-Martinez|Francisco|F|", "chemical_list": "D054873:Dipeptidyl-Peptidase IV Inhibitors; D009570:Nitriles; D011759:Pyrrolidines; D000069476:Linagliptin; D000077597:Vildagliptin; D000218:Adamantane", "country": "Switzerland", "delete": false, "doi": "10.1159/000443330", "fulltext": null, "fulltext_license": null, "issn_linking": "1018-8665", "issue": "232(2)", "journal": "Dermatology (Basel, Switzerland)", "keywords": null, "medline_ta": "Dermatology", "mesh_terms": "D000218:Adamantane; D000368:Aged; D000369:Aged, 80 and over; D054873:Dipeptidyl-Peptidase IV Inhibitors; D003875:Drug Eruptions; D005260:Female; D006801:Humans; D000069476:Linagliptin; D008297:Male; D009570:Nitriles; D010391:Pemphigoid, Bullous; D011759:Pyrrolidines; D000077597:Vildagliptin", "nlm_unique_id": "9203244", "other_id": null, "pages": "249-53", "pmc": null, "pmid": "26820308", "pubdate": "2016", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Three Cases of Bullous Pemphigoid Associated with Dipeptidyl Peptidase-4 Inhibitors - One due to Linagliptin.", "title_normalized": "three cases of bullous pemphigoid associated with dipeptidyl peptidase 4 inhibitors one due to linagliptin" }
[ { "companynumb": "ES-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2016-BI-06376NB", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RAMIPRIL" }, "d...
{ "abstract": "The present study describes a case of laxative-induced rhabdomyolysis in an elderly patient. An 87-year-old woman was hospitalized for the onset of confusion, tremors, an inability to walk, and a fever that she had been experiencing for 36 hours. She often took high dosages of lactulose and sorbitol syrup as a laxative (about 70 g/day). During her physical examination, the patient was confused, drowsy, and she presented hyposthenia in her upper and lower limbs, symmetric and diffuse moderate hyporeflexia, and her temperature was 37.8 degrees C. Laboratory tests revealed severe hyponatremia with hypokalemia, hypocalcemia, hypochloremia, and metabolic alkalosis. Moreover, rhabdomyolysis markers were found. The correction of hydroelectrolytic imbalances with saline, potassium and sodium chlorure, calcium gluconate was the first treatment. During her hospitalization the patient presented acute delirium, treated with haloperidol and prometazine chloridrate intramuscularly. She was discharged 12 days later, after resolution of symptoms, and normalized laboratory tests. Over-the-counter drugs such as laxatives are usually not considered dangerous; on the other hand, they may cause serum electrolytic imbalance and rhabdomyolysis. A careful monitoring of all the drugs taken by the elderly is one of the most important duties of a physician since drug interactions and their secondary effects may be fatal.", "affiliations": "Geriatrist, Geriatric Unit, Pugliese-Ciaccio Hospital, Catanzaro, Italy.", "authors": "Merante|Alfonso|A|;Gareri|Pietro|P|;Marigliano|Norma Maria|NM|;De Fazio|Salvatore|S|;Bonacci|Elvira|E|;Torchia|Carlo|C|;Russo|Gaetano|G|;Lacroce|Pasquale|P|;Lacava|Roberto|R|;Castagna|Alberto|A|;De Sarro|Giovambattista|G|;Ruotolo|Giovanni|G|", "chemical_list": "D054368:Laxatives; D004366:Nonprescription Drugs", "country": "New Zealand", "delete": false, "doi": "10.2147/cia.s8832", "fulltext": null, "fulltext_license": null, "issn_linking": "1176-9092", "issue": "5()", "journal": "Clinical interventions in aging", "keywords": "elderly; laxatives; over-the-counter drugs; rhabdomyolysis", "medline_ta": "Clin Interv Aging", "mesh_terms": "D000369:Aged, 80 and over; D004305:Dose-Response Relationship, Drug; D005260:Female; D006801:Humans; D054368:Laxatives; D004366:Nonprescription Drugs; D012206:Rhabdomyolysis", "nlm_unique_id": "101273480", "other_id": null, "pages": "71-3", "pmc": null, "pmid": "20396636", "pubdate": "2010-04-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "7074473;7249508;19109115;15941885;12754322;15774072;3316670;15712785;17446616", "title": "Laxative-induced rhabdomyolysis.", "title_normalized": "laxative induced rhabdomyolysis" }
[ { "companynumb": "IT-VISTAPHARM, INC.-VER201801-000307", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "SORBITOL" }, "drugadditional": "3"...
{ "abstract": "A 40-year-old Caucasian lady with focal crescentic glomerulonephritis (p-ANCA) demonstrated by kidney biopsy, was treated with intravenous pulse steroids followed by weekly outpatient rituximab infusions (375 mg/m2). Five days after the fourth and final rituximab infusion, she developed headaches, altered mental status and seizures. Upon transfer to our facility, magnetic resonance imaging of the brain revealed cortical white matter changes suggestive of possible progressive multifocal leukoencephalopathy (PML) or posterior reversible encephalopathy syndrome (PRES). She was aggressively treated with antihypertensives, anti-seizure medications, intravenous steroids, plasmapheresis and ventilatory support while awaiting cerebrospinal fluid analysis and polymerase chain reaction on John Cunningham virus DNA. She had a complete recovery and, at 1 year follow up, was found to be doing well. Awareness of potential complications of rituximab therapy, such as PRES or PML is critical in providing appropriate treatment.", "affiliations": "Deaconess Health System, 600 Mary Street, Evansville, IN, USA.;Lynchburg Nephrology, 2091 Langhorne Road, Lynchburg, VA, USA.;University of Oklahoma, 4444 E. 41st Street Tulsa, OK, USA.;Deaconess Health System, 600 Mary Street, Evansville, IN, USA.", "authors": "Pathireddy|Samata|S|;Bose|Subashish|S|;Baradhi|Krishna|K|;Aeddula|Narothama Reddy|NR|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1093/omcr/omz072", "fulltext": "\n==== Front\nOxf Med Case ReportsOxf Med Case ReportsomcrOxford Medical Case Reports2053-8855Oxford University Press 3139872310.1093/omcr/omz072omz072Case ReportRare but not beyond care: a young female with altered mental status and seizures Pathireddy Samata 1Bose Subashish 2Baradhi Krishna 3http://orcid.org/0000-0001-8530-668XAeddula Narothama Reddy 11 Deaconess Health System, 600 Mary Street, Evansville, IN, USA2 Lynchburg Nephrology, 2091 Langhorne Road, Lynchburg, VA, USA3 University of Oklahoma, 4444 E. 41st Street Tulsa, OK, USACorrespondence address: Deaconess Health System, 600 Mary street, Evansville, IN 47747, USA. Tel: +001 812 492 5202; Fax: +001 812 426 6610; E-mail: dr.anreddy@gmail.com or nareddy@iu.edu8 2019 10 8 2019 10 8 2019 2019 8 omz07218 12 2018 2 6 2019 21 6 2019 © The Author(s) 2019. Published by Oxford University Press.2019This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nA 40-year-old Caucasian lady with focal crescentic glomerulonephritis (p-ANCA) demonstrated by kidney biopsy, was treated with intravenous pulse steroids followed by weekly outpatient rituximab infusions (375 mg/m2). Five days after the fourth and final rituximab infusion, she developed headaches, altered mental status and seizures. Upon transfer to our facility, magnetic resonance imaging of the brain revealed cortical white matter changes suggestive of possible progressive multifocal leukoencephalopathy (PML) or posterior reversible encephalopathy syndrome (PRES). She was aggressively treated with antihypertensives, anti-seizure medications, intravenous steroids, plasmapheresis and ventilatory support while awaiting cerebrospinal fluid analysis and polymerase chain reaction on John Cunningham virus DNA. She had a complete recovery and, at 1 year follow up, was found to be doing well. Awareness of potential complications of rituximab therapy, such as PRES or PML is critical in providing appropriate treatment.\n==== Body\nIntroduction\nRituximab treatment is associated with rare but significant adverse events of posterior reversible encephalopathy syndrome (PRES) or progressive multifocal leukoencephalopathy (PML) [1]. Our case highlights the need for clinical acumen, awareness, early recognition of neurological symptoms and diagnosis related to such rare complications. Both of these complications may have similar clinical presentations and may appear indistinguishable on magnetic resonance imaging (MRI) [1]. Rituximab, an anti-CD20 monoclonal antibody, carries a ‘black box’ warning for PML, raising a high degree of concern for PML when new neurological symptoms accompany white matter changes on the MRI [1]. We report PRES after rituximab use in a patient who had a clinical presentation and white matter changes on the MRI that are indistinguishable from PML.\n\nCase Report\nA 40-year-old Caucasian lady with a prior medical history of chronic kidney disease stage 4 with a recently diagnosed biopsy-proven focal crescentic glomerulonephritis (p-ANCA), chronic obstructive pulmonary disease, obstructive sleep apnea (OSA), diabetes mellitus type 2, hypertension and morbid obesity was transferred from outside hospital (OSH) with altered mental status, headaches and generalized tonic-clonic seizures. Given rapid clinical deterioration and progressive cognitive decline, she was transferred to our facility. Upon arrival, the patient’s Glasgow Coma Scale was 4, was hypoxic and required emergent endotracheal intubation.\n\nAfter a recent diagnosis of focal crescentic glomerulonephritis, she had received three doses of 1 gm intravenous pulse methylprednisolone followed by oral prednisone(1 mg/kg/day) along with weekly outpatient rituximab intravenous infusions (375 mg/m2). The last and fourth dose of rituximab was 5 days before her presentation.\n\nShe was an active smoker with 15 pack years history, and family history was not relevant to her current presentation. Her physical examination was notable for obesity, intubated status, with reduced air entry in the posterior lung fields and trace pedal oedema. Blood pressure on presentation was 162/79 mm Hg. Her husband endorsed good compliance with medications and continuous positive airway pressure for her OSA. Laboratory studies showed serum creatinine of 2.2 mg/dL and blood urea nitrogen of 29 mg/dL. White cell count was 10.8 (1000/uL), haemoglobin was 12 gm/dL and platelets was 230 (1000/uL). Urine analysis showed 3+ protein, 40 RBCs and 4 WBCs. She underwent extensive serological work up 5 weeks prior and were relevant with her pauci-immune ANCA vasculitis. HIV, hepatitis B and C serologies were unremarkable. A lumbar puncture with cerebrospinal fluid (CSF) examination showed normal opening pressure, clear fluid, 0 WBCs, protein of 47 mg/dL and glucose of 131 mg/dL. An MRI showed cortical white matter changes suggestive of possible PML or PRES (Fig. 1a–c). CSF polymerase chain reaction (PCR) for herpes simplex virus (HSV) and John Cunningham virus (JCV) were negative. Flow cytometry and cytology were negative. Serum JCV PCR was negative. Brain biopsy deferred given clinical improvement.\n\nFigure 1 \na-c: Multi-planar, multi-sequence, non-contrast MRI brain (T1-, T2-weighted images and FLAIR). Extensive white matter changes predominantly in subcortical and to a lesser extent in periventricular white matter, seen symmetrically throughout the cerebral hemispheres in the bilateral frontal lobes, parietal, temporal lobes and occipital lobes.\n\nTreatment\nThe patient received intravenous levetiracetam (Keppra), antihypertensives, empiric broad spectrum antibiotics and had two sessions of plasmapheresis (with albumin replacement) to remove rituximab to avoid further ill effect on the central nervous system from it and to promote immune reconstitution while awaiting final CSF analysis. She opened eyes, responded to verbal commands on Day 5 and was extubated on Day 7 of her hospitalization.\n\nDiscussion\nPRES is a clinico-radiographic syndrome of various etiologies, first described by Hinchey et al. [2] in a case series in 1996. This complex clinical syndrome presents with varied clinical features such as headache, confusion, altered mental status, visual disturbances and seizures. Seizures are often presenting manifestation and are usually tonic-clonic. The clinical syndrome is associated with characteristic neuroimaging findings of bilateral posterior cerebral white matter oedema. The pathogenesis is unclear, but it appears to be related to disordered cerebral autoregulation and endothelial dysfunction [2]. A wide variety of medical conditions and medications are implicated as causes of PRES [3]. PRES is usually benign. However, cases with progressive cerebral oedema, intracerebral haemorrhage leading to death have been reported [4].\n\nPML is a severe demyelinating disease of the central nervous system, caused by reactivation of the JCV, which can induce a lytic infection involving the central nervous System myelin-producing cells, the oligodendrocytes [5]. Usually, PML occurs almost exclusively in immunosuppressed individuals. However, there are isolated case reports of PML in patients without apparent immunosuppression [6]. In a retrospective population-based analysis of a health insurance database, the incidence rates of PML in patients with autoimmune vasculitis was 10.8 per 100 000 person years [7]. Clinically, PML presents with subacute neurological symptoms such as altered mental status, hemiparesis, ataxia and visual symptoms such as hemianopia and diplopia. On MRI scan, PML lesions are seen as areas of a decreased signal on T1-weighted images and increased signal on T2-weighted and fluid-attenuated inversion recovery (FLAIR) sequences [8]. Seizures can occur in up to 44% of patients who survive PML. In patients with PML, the course is usually progressive and fatal, and those who survive are left with severe neurologic sequelae.\n\nA chimeric anti-CD20 monoclonal antibody, rituximab is increasingly used in the treatment of haematological malignancies such as non-Hodgkin’s lymphoma, chronic lymphocytic leukaemia, rheumatoid arthritis, systemic lupus erythematosus, neuromyelitis optica and ANCA-associated vasculitis. First approved in 1997, it is routinely used with more than two million prescriptions between 1997 and 2017 in the USA (http://www.rituxan.com, accessed on 4 May 2019). Adverse effects range from the familiar (infusion reactions, pancytopenia, bacterial and viral infections and cardiac events) to the rare (PML, cytokine release syndrome and respiratory failure). Given the expression of CD20 in activated endothelial cells, rituximab may cause direct cell damage, endothelin-mediated vasospasm and dysfunction, which may lead to PRES.\n\nThe clinical overlap between PRES and PML can make differentiating these two neurologic disorders challenging. PML can resemble PRES on MRI, making the clinical presentation a critical distinguishing factor between these two conditions [1]. One cannot rely on radiographic imaging to establish the diagnosis of PML; confirmatory evidence should include the demonstration of the JCV in the CSF or the brain [9]. In our patient, rather an acute onset of symptoms was more in line with PRES than PML. Laboratory findings were also relatively supportive of the later.\n\nOn the literature review, we found a few other cases of PRES associated with the use of rituximab. Patients had rituximab therapy for a variety of diseases: B-cell lymphoma, systemic lupus erythematosus, solid organ transplantation, hepatitis C, lupus nephritis, cryoglobulinemia and neuromyelitis optica. To the best of our knowledge, this is the first reported case of rituximab use associated with PRES in a patient with ANCA vasculitis. Perhaps, our case contributes to the debate, whether ANCA vasculitis is an established risk factor for the development of PRES as reported previously [10]. Rituximab is indicated in the management of the pauci-immune ANCA vasculitis. It should be notable that our case has other risk factors for the development of PRES, such as hypertension and ANCA vasculitis. Rituximab association with PRES is rather weak as both the underlying conditions, e.g. systemic lupus erythematosus, and the treatments utilized for these disorders may contribute to PRES.\n\nRituximab is rarely associated with severe adverse reactions, and usually that happens in patients with pre-existing risk factors for such adverse effects as in our case. Treatment of PRES consists mainly of blood pressure control, infection treatment, seizure control, renal replacement therapy and withdrawal of the inciting factor. To differentiate between PML and PRES, careful history, physical and laboratory examinations are extremely important.\n\nACKNOWLEDGEMENTS\nNone.\n\nConflict of interest statement\nNone declared.\n\nFunding\nNone.\n\nEthical Approval\nNone needed.\n\nConsent\nConsent obtained from the patient and available on request.\n\nGuarantor\nNarothama Reddy Aeddula, Subhasish Bose.\n==== Refs\nReferences\n1. \nBerger JR , Neltner J , Smith C , Cambi F \nPosterior reversible encephalopathy syndrome masquerading as progressive multifocal leukoencephalopathy in rituximab treated neuromyelitis optica . Mult Scler Relat Disord 2014 ;3 :728 –31 . 10.1016/j.msard.2014.08.004 .\nAccessed May 1st 2019 .25891552 \n2. \nHinchey J , Chaves C , Appignani B , Breen J , Pao L , Wang A , et al. \nA reversible posterior leukoencephalopathy syndrome . N Engl J Med 1996 ;334 :494 –500 .8559202 \n3. \nLamy C , Oppenheim C , Mas JL \nPosterior reversible encephalopathy syndrome . Handb Clin Neurol 2014 ;121 :1687 –701 . doi: 10.1016/B978-0-7020-4088-7.00109-7 .24365441 \n4. \nStott VL , Hurrell MA , Anderson TJ \nReversible posterior leukoencephalopathy syndrome: a misnomer reviewed . Intern Med J 2005 ;35 :83 –90 .15705136 \n5. \nTan CS , Koralnik IJ \nProgressive multifocal leukoencephalopathy and other disorders caused by JC virus: clinical features and pathogenesis . Lancet Neurol 2010 ;9 :425 –37 . doi: 10.1016/S1474-4422(10)70040-5 . Review.20298966 \n6. \nGrewal J , Dalal P , Bowman M , Kaya B , Otero JJ , Imitola J \nProgressive multifocal leukoencephalopathy in a patient without apparent immunosuppression . J Neurovirol 2016 ;22 :683 –687 .27273076 \n7. \nAmend KL , Turnbull B , Foskett N , Napalkov P , Kurth T , Seeger J \nIncidence of progressive multifocal leukoencephalopathy in patients without HIV . Neurology 2010 ;75 :1326 –32 . doi: 10.1212/WNL.0b013e3181f73600 .20938025 \n8. \nSahraian MA , Radue EW , Eshaghi A , Besliu S , Minagar A \nProgressive multifocal leukoencephalopathy: a review of the neuroimaging features and differential diagnosis . Eur J Neurol 2012 ;19 :1060 –9 . doi: 10.1111/j.1468-1331.2011.03597.x .22136455 \n9. \nBerger JR , Aksamit AJ , Clifford DB , Davis L , Koralnik IJ , Sejvar JJ , et al. \nPML diagnostic criteria: consensus statement from the AAN neuroinfectious disease section . Neurology 2013 ;80 :1430 –8 . doi: 10.1212/WNL.0b013e31828c2fa1 .23568998 \n10. \nPatel UV , Patel NJ \nPosterior reversible leukoencephalopathy syndrome as a presenting manifestation of p-ANCA-associated vasculitis . BMJ Case Rep 2014 ; pii: bcr2013202022. doi: 10.1136/bcr-2013-202022 ..\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2053-8855", "issue": "2019(8)", "journal": "Oxford medical case reports", "keywords": null, "medline_ta": "Oxf Med Case Reports", "mesh_terms": null, "nlm_unique_id": "101642070", "other_id": null, "pages": null, "pmc": null, "pmid": "31398723", "pubdate": "2019-08-01", "publication_types": "D016428:Journal Article", "references": "15705136;20298966;20938025;22136455;23568998;24365441;24855074;25891552;27273076;8559202", "title": "Rare but not beyond care: a young female with altered mental status and seizures.", "title_normalized": "rare but not beyond care a young female with altered mental status and seizures" }
[ { "companynumb": "US-TEVA-2020-US-1509992", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "METHYLPREDNISOLONE" }, "drugadditional": null, ...
{ "abstract": "Hepatic arterial embolisation therapy (HAET) is a treatment of liver metastases of gastrointestinal neuroendocrine tumours (GI-NETs). HAET increases circulating vascular endothelial growth factor levels. Everolimus is a treatment in NETs that may have antiangiogenic activity.\n\n\n\nThis phase II study was conducted in patients with predominant and progressive liver metastases from GI-NETs. Everolimus was initiated 7-30 days after HAET. The hypothesis was that everolimus after HAET would increase hepatic progression-free survival (hPFS) rate at 24 months from 35% to 50%.\n\n\n\nAmong the 74 patients included, 88% had small-bowel primary tumour, 43% had grade I and 57% grade II tumour, and 51% had extrahepatic metastases. Patients underwent one (n = 19), two (n = 54), or three (n = 1) HAET procedures. hPFS at 24 months was 33% (95% confidence interval [CI], 22.5-43.7); 40 (54%) patients had objective response. Median (95% CI) hPFS, PFS, and overall survival were 19 (14-23), 17 (13-22), and 51 (33-60) months. The most common grade III-IV toxicities (>5%) in patients receiving both HAET and everolimus (n = 67) were elevated liver enzymes (55%), fatigue (18%), diarrhoea (16%), anaemia (12%), hypertriglyceridaemia (7%) and mucositis (6%).\n\n\n\nThe primary end-point was not reached. This sequence allows high liver response with HAET, and everolimus controls the extrahepatic disease.\n\n\n\nNCT01678664 (clinicaltrials.gov).", "affiliations": "Oncology Department, Edouard Herriot Hospital, Hospices Civils de Lyon, Lyon, France. Electronic address: thomas.walter@chu-lyon.fr.;HepatoGastroenterology and Digestive Oncology Department, University Hospital Dijon, University of Burgundy and Franche Comté, FFCD, EPICAD INSERM LNC-UMR 1231, Dijon, France.;Gastroenterology Department, Cochin Hospital, Paris, France.;Biostatistics, FFCD, EPICAD INSERM LNC-UMR 1231, University of Burgundy and Franche Comté, Dijon, France.;Gastroenterology Department, CHU Robert Debré, Reims, France.;Gastroenterology Department, CHU Angers, Angers, France.;Gastroenterology Department, Saint Louis Hospital, APHP and Avicenne Hospital, APHP, Bobigny, France.;Gastroenterology Department, CHU Côte de Nacre, Caen, France.;Gastroenterology Department, Beaujon Hospital, Clichy, France.;Radiology Department, Edouard Herriot Hospital, Hospices Civils de Lyon, Lyon, France.;Gastroenterology Department, Jean Minjoz Hospital, Besançon, France.;Gastroenterology Department, CHU La Timone, Marseille, France.;Gastroenterology Department, European Georges Pompidou Hospital, Paris, France.;Hepatogastroenterology and Digestive Oncology Department, CHU Tours, Tours, France.;Digestive Oncology Department, CHU Haut Lévêque, Bordeaux, France.;Digestive Oncology Department, CHU Estaing, Clermont-Ferrand, France.;Gastroenterology Department, CHU Charles Nicolle, Rouen, France.;Medical Oncology Department, Centre Georges-François Leclerc, Dijon, France.;Hepatogastroenterology Department, CHR La Source, Orléans, France.;Digestive Oncology Department, Hôpital Rangueil, Toulouse, France.;Medical Oncology Department, Gustave Roussy, Paris Saclay University, Villejuif, France.;Oncology Department, Edouard Herriot Hospital, Hospices Civils de Lyon, Lyon, France.;Interventional Radiology Department, Gustave Roussy Villejuif & UFR Medecine Kremlin Bicetre Paris Sud University, Villejuif, France.", "authors": "Walter|Thomas|T|;Lepage|Come|C|;Coriat|Romain|R|;Barbier|Emilie|E|;Cadiot|Guillaume|G|;Caroli-Bosc|Francois-Xavier|FX|;Aparicio|Thomas|T|;Bouhier-Leporrier|Karine|K|;Hentic-Dhome|Olivia|O|;Gay|Frédérique|F|;Dupont-Gossart|Anne-Claire|AC|;Duluc|Muriel|M|;Lepere|Céline|C|;Lecomte|Thierry|T|;Smith|Denis|D|;Petorin|Caroline|C|;Di-Fiore|Frédéric|F|;Ghiringhelli|Francois|F|;Legoux|Jean-Louis|JL|;Guimbaud|Rosine|R|;Baudin|Eric|E|;Lombard-Bohas|Catherine|C|;de Baère|Thierry|T|;|||", "chemical_list": "D000903:Antibiotics, Antineoplastic; D000970:Antineoplastic Agents; D013311:Streptozocin; D004317:Doxorubicin; D000068338:Everolimus", "country": "England", "delete": false, "doi": "10.1016/j.ejca.2019.09.021", "fulltext": null, "fulltext_license": null, "issn_linking": "0959-8049", "issue": "123()", "journal": "European journal of cancer (Oxford, England : 1990)", "keywords": "Everolimus; Gastrointestinal tract; Liver embolisation; Neuroendocrine", "medline_ta": "Eur J Cancer", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000903:Antibiotics, Antineoplastic; D000970:Antineoplastic Agents; D001859:Bone Neoplasms; D016461:Chemoembolization, Therapeutic; D004317:Doxorubicin; D004621:Embolization, Therapeutic; D000068338:Everolimus; D005260:Female; D005770:Gastrointestinal Neoplasms; D006499:Hepatic Artery; D006801:Humans; D008113:Liver Neoplasms; D008175:Lung Neoplasms; D008198:Lymph Nodes; D008297:Male; D008875:Middle Aged; D018358:Neuroendocrine Tumors; D010534:Peritoneal Neoplasms; D000077982:Progression-Free Survival; D013311:Streptozocin", "nlm_unique_id": "9005373", "other_id": null, "pages": "92-100", "pmc": null, "pmid": "31678771", "pubdate": "2019-12", "publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Everolimus after hepatic arterial embolisation therapy of metastases from gastrointestinal neuroendocrine tumours: The FFCD 1104-EVACEL-GTE phase II study.", "title_normalized": "everolimus after hepatic arterial embolisation therapy of metastases from gastrointestinal neuroendocrine tumours the ffcd 1104 evacel gte phase ii study" }
[ { "companynumb": "NVSC2019FR033553", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "EVEROLIMUS" }, "drugadditional": "3", "druga...
{ "abstract": "This case reports the findings and management of a late preterm female infant born with congenital bilateral eyelid eversion with chemosis. The pathogenic process remains unknown but typically presents at birth, predominantly affecting the upper eyelid of both eyes. Black males, patients with trisomy 21, and collodion infants have a higher incidence of eyelid eversion. Treatment modalities range from conservative therapy including eye patching with antibiotic and lubricating ointment to invasive surgical eyelid suturing. In this case report, successful resolution of chemosis and eyelid inversion occurred with conservative management.", "affiliations": null, "authors": "Kirkpatrick|Ashley|A|;Ledlow|Donna|D|;Dixon|Eunice|E|;Philips|Joseph B|JB|", "chemical_list": "D000900:Anti-Bacterial Agents; D005938:Glucocorticoids; D012462:Saline Solution, Hypertonic; D003907:Dexamethasone", "country": "United States", "delete": false, "doi": "10.1891/0730-0832.37.3.137", "fulltext": null, "fulltext_license": null, "issn_linking": "0730-0832", "issue": "37(3)", "journal": "Neonatal network : NN", "keywords": null, "medline_ta": "Neonatal Netw", "mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D001458:Bandages; D002585:Cesarean Section; D000072700:Conservative Treatment; D003907:Dexamethasone; D003937:Diagnosis, Differential; D003941:Diagnostic Techniques, Ophthalmological; D004483:Ectropion; D005143:Eyelids; D005260:Female; D005865:Gestational Age; D005938:Glucocorticoids; D006801:Humans; D006973:Hypertension; D007231:Infant, Newborn; D016104:Oligohydramnios; D011247:Pregnancy; D011248:Pregnancy Complications; D012462:Saline Solution, Hypertonic; D064746:Therapy, Soft Tissue; D016896:Treatment Outcome", "nlm_unique_id": "8503921", "other_id": null, "pages": "137-140", "pmc": null, "pmid": "29789052", "pubdate": "2018-05-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Congenital Bilateral Eyelid Eversion and Chemosis: A Case Study.", "title_normalized": "congenital bilateral eyelid eversion and chemosis a case study" }
[ { "companynumb": "US-TEVA-2018-US-982699", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "AMLODIPINE BESYLATE" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nMetastatic breast cancer (mBC) patients with DPYD genetic variants linked to loss of dihydropyrimidine dehydrogenase (DPD) activity are at risk of severe capecitabine-associated toxicities. However, prospective DPYD genotyping has not yet been implemented in routine clinical practice. Following a previous internal review in which two patients underwent lengthy hospitalisations whilst receiving capecitabine, and were subsequently found to be DPD deficient, we initiated routine DPYD genotyping prior to starting capecitabine. This study evaluates the clinical application of routine DPYD screening at a large cancer centre in London.\n\n\nMETHODS\nWe reviewed medical records for consecutive patients with mBC who underwent DPYD genotyping before commencing capecitabine between December 2014 and December 2017. Patients were tested for four DPYD variants associated with reduced DPD activity.\n\n\nRESULTS\nSixty-six patients underwent DPYD testing. Five (8.4%) patients were found to carry DPYD genetic polymorphisms associated with reduced DPD activity; of these, two received dose-reduced capecitabine. Of the 61 patients with DPYD wild-type, 14 (23%) experienced grade 3 toxicities which involved palmar-plantar erythrodysesthesia (65%), and gastrointestinal toxicities (35%); no patient was hospitalised due to toxicity.\n\n\nCONCLUSIONS\nProspective DPYD genotyping can be successfully implemented in routine clinical practice and can reduce the risk of severe fluoropyrimidine toxicities.", "affiliations": "Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Purine Research Laboratory, Viapath, Guy's and St Thomas' NHS Foundation Trust, Westminster Bridge Road, London, SE1 7EH, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK.;Breast Unit, Guy's and St Thomas' NHS Foundation Trust and King's Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT, UK. Janine.mansi@gstt.nhs.uk.", "authors": "Stavraka|Chara|C|http://orcid.org/0000-0001-7623-299X;Pouptsis|Athanasios|A|;Okonta|Leroy|L|;DeSouza|Karen|K|;Charlton|Philip|P|;Kapiris|Matthaios|M|;Marinaki|Anthony|A|;Karapanagiotou|Eleni|E|;Papadatos-Pastos|Dionysis|D|;Mansi|Janine|J|", "chemical_list": "D000964:Antimetabolites, Antineoplastic; D000069287:Capecitabine; D042943:Dihydrouracil Dehydrogenase (NADP); D005472:Fluorouracil", "country": "Netherlands", "delete": false, "doi": "10.1007/s10549-019-05144-9", "fulltext": "\n==== Front\nBreast Cancer Res TreatBreast Cancer Res. TreatBreast Cancer Research and Treatment0167-68061573-7217Springer US New York 514410.1007/s10549-019-05144-9Brief ReportClinical implementation of pre-treatment DPYD genotyping in capecitabine-treated metastatic breast cancer patients http://orcid.org/0000-0001-7623-299XStavraka Chara chara.stavraka@gstt.nhs.uk 1Pouptsis Athanasios th.pouptsis@gmail.com 1Okonta Leroy leroy.okonta@nhs.net 1DeSouza Karen Karen.DeSouza@bsuh.nhs.uk 1Charlton Philip Philip.charlton@nhs.net 1Kapiris Matthaios Matthaios.kapiris@gstt.nhs.uk 1Marinaki Anthony Tony.Marinaki@viapath.co.uk 2Karapanagiotou Eleni eleni.karapanagiotou@gstt.nhs.uk 1Papadatos-Pastos Dionysis Dionysis.Papadatos-Pastos@uclh.nhs.uk 1Mansi Janine 020 7188 7188Janine.mansi@gstt.nhs.uk 11 grid.420545.2Breast Unit, Guy’s and St Thomas’ NHS Foundation Trust and King’s Biomedical Centre, 4th Floor, Bermondsey Wing, Great Maze Pond, London, SE1 9RT UK 2 grid.420545.2Purine Research Laboratory, Viapath, Guy’s and St Thomas’ NHS Foundation Trust, Westminster Bridge Road, London, SE1 7EH UK 12 2 2019 12 2 2019 2019 175 2 511 517 13 1 2019 21 1 2019 © The Author(s) 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.Purpose\nMetastatic breast cancer (mBC) patients with DPYD genetic variants linked to loss of dihydropyrimidine dehydrogenase (DPD) activity are at risk of severe capecitabine-associated toxicities. However, prospective DPYD genotyping has not yet been implemented in routine clinical practice. Following a previous internal review in which two patients underwent lengthy hospitalisations whilst receiving capecitabine, and were subsequently found to be DPD deficient, we initiated routine DPYD genotyping prior to starting capecitabine. This study evaluates the clinical application of routine DPYD screening at a large cancer centre in London.\n\nMethods\nWe reviewed medical records for consecutive patients with mBC who underwent DPYD genotyping before commencing capecitabine between December 2014 and December 2017. Patients were tested for four DPYD variants associated with reduced DPD activity.\n\nResults\nSixty-six patients underwent DPYD testing. Five (8.4%) patients were found to carry DPYD genetic polymorphisms associated with reduced DPD activity; of these, two received dose-reduced capecitabine. Of the 61 patients with DPYD wild-type, 14 (23%) experienced grade 3 toxicities which involved palmar–plantar erythrodysesthesia (65%), and gastrointestinal toxicities (35%); no patient was hospitalised due to toxicity.\n\nConclusions\nProspective DPYD genotyping can be successfully implemented in routine clinical practice and can reduce the risk of severe fluoropyrimidine toxicities.\n\nKeywords\nDPYD genotypingDPYD screeningFluoropyrimidinesToxicitiesMetastatic breast cancerCapecitabineissue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2019\n==== Body\nIntroduction\nBreast cancer is the most common malignancy among women accounting for 23% of new cancer cases and 15% of cancer-related deaths annually in the world [1]. Capecitabine, an orally administered pro-drug of 5-fluoruracil has a pivotal role in the therapeutic armamentarium for metastatic breast cancer (mBC) usually as monotherapy but also in combination with lapatinib [2]. Fluoropyrimidines are considered to be safe and well tolerated with a side-effect profile that includes diarrhoea, mucositis, palmar–plantar erythrodysesthesia (PPE), bone marrow suppression and nausea. Although the majority of patients receiving fluoropyrimidines experience mild toxicities, usually managed with supportive measures, approximately 10–30% of patients will develop severe (grade ≥ 3) toxicities which can result in lengthy hospitalisations or death in 0.5–1% of cases [3–5].\n\nFluoropyrimidine toxicities have been strongly associated with reduced activity of the enzyme dihydropyrimidine dehydrogenase (DPD), which is the rate-limiting enzyme in the catabolism of fluoropyrimidines [6–9]. DPD catabolises 80% of 5-fluoruracil (5-FU), into the non-cytotoxic metabolite 5-fluoro-5,6-dihydrouracil (dHFU) and patients with partial deficiency have 1.5-times increased 5-FU exposure when treated with standard doses [6, 10]. Approximately, 3–5% of the North American and European population have partial DPD deficiency, whereas complete deficiency is much rarer with a prevalence of 0.01–0.1% [11–13].\n\nThe activity of DPD has been found to be regulated at the genetic, transcriptional (by transcription factors SP1 and AP3) and post-transcriptional level (microRNA 27-a and microRNA 27-b) [14–16]. The most prevalent cause of DPD deficiency though, is the presence of deleterious polymorphisms in its encoding DPYD gene, which have received much interest as predictive biomarkers for fluoropyrimidine-induced toxicities [13, 17–21]. Four DPYD genetic variants have been established as clinically relevant and associated with severe toxicities: DPYD*2A (IVS14 + 1G > A, c.1905 + 1G > A, or rs3918290), c.2846A > T (p.D949V or rs67376798), c.1679T > G (rs55886062, DPYD*13, p.I560S), and c.1236G > A (rs56038477, p.E412E, Hap B3) [13, 22–25]. A fifth variant c.1601G > A (p.S534N, DPYD*4, or rs1801158), has been associated with impaired DPD activity [26] but its clinical relevance remains inconclusive [13]. Current evidence suggests that heterozygous carriers of these variants have an average decrease in the DPD activity of approximately 25% (c.2846A > T, c.1236G > A) and 50% (DPYD*2A, c.1679T > G) [24]. The Clinical Pharmacogenetics Implementation Consortium (CPIC) has issued guidance on appropriate dose reductions in patients harbouring these polymorphisms to prevent severe toxicities [24] Despite growing evidence supporting the significant clinical and financial benefits of routine DPYD genotype screening prior to fluoropyrimidine administration, this is not yet the standard of care [27–32]. The ability to predict and prevent severe capecitabine-associated toxicities is of paramount importance particularly in metastatic breast cancer patients, as a number of alternative treatment options are available. Such toxicities can result in death or pose significant delays to consequent treatment and may even compromise patients’ fitness to receive further treatment.\n\nBased on our initial experience with two mBC patients who were hospitalised and retrospectively found to be DPD deficient, we previously conducted an internal review including 48 patients and found that: (a) none of the other patients who were receiving capecitabine during that time (December 2012 to December 2013) underwent lengthy hospital admission for capecitabine toxicities and (b) the cost of the inpatient stay far outweighed the total cost of testing all those patients for DPD (£15 525 versus £1575 based on the cost of the test at that time) [33].\n\nFollowing this, routine DPYD screening prior to prescribing capecitabine was initiated at Guy’s and St Thomas’ NHS Trust (GSTT) in December 2014 using an in-house developed genotyping assay [34]. In this retrospective observational study, we describe our centre’s experience and clinically evaluate prospective DPYD genotyping for metastatic breast cancer patients treated with capecitabine. In particular, we evaluated the feasibility of implementing DPYD tests in routine clinical practice, treatment decisions and outcomes based on the pharmacogenetic test results, and its utility in preventing severe toxicities.\n\nMethods\nProspective DPYD genotyping\nAt GSTT routine, DPYD genotype screening was implemented in December 2014 for all mBC patients who were thought suitable to receive capecitabine. Patients were tested for the following four DPYD genetic variants which are prevalent in the British population and associated with severe capecitabine-associated toxicities: DPYD*2A (IVS14 + 1G > A, c.1905 + 1G > A, or rs3918290), c.2846A > T (p.D949V or rs67376798), c.1679T > G (rs55886062, DPYD*13, p.I560S) and c.1601G > A (S534N, DPYD*4, or rs1801158) [34, 35]. The pharmacogenetic tests were performed in our institutional laboratory and their prospective nature was determined by comparing the genotyping date with the date of treatment initiation.\n\nPatient population\nWe retrospectively identified metastatic breast cancer patients who were prescribed capecitabine (monotherapy or in combination with lapatinib) between December 2014 and December 2017 at GSTT.\n\nElectronic patient records were reviewed, and information collected on demographic and clinical characteristics including age, gender, ECOG performance status, prescribed treatment regimen, performance of pre-treatment DPYD genotyping test, DPYD genotype outcome, time of treatment initiation, nature and grade of capecitabine-associated toxicities, dose modifications, reasons for treatment discontinuation and hospitalisation. Toxicities were graded according to the NCI—CTCAE v4.0. The feasibility of the routine application of DPYD pre-treatment testing in clinical practice was evaluated by assessing the percentage of patients screened for DYPD when a prescription of capecitabine was given. The turnaround time of the test was also evaluated as well as the presence of associated treatment delays. Patients who did not receive capecitabine due to non DPYD-related reasons were not included in the analysis.\n\nStatistical analysis\nDescriptive statistics were generated to characterise the study cohort in terms of clinicopathological parameters. Categorical outcomes were presented as a frequency and proportion. The SPSS statistical package version 25 (IBM SPSS Inc., USA).\n\nOfficial approval for the use of retrospective data was granted by Guy’s and St Thomas’ Clinical Audit Office. Data were handled in accordance with the Declaration of Helsinki and all patients had provided informed consent prior to DPYD testing.\n\nResults\nBetween December 2014 and December 2017, a total of 72 consecutive mBC patients were considered for capecitabine as a monotherapy or in combination with lapatinib and tested for DPD deficiency. All patients had a pre-treatment DPYD test (100%). Of these 72 patients, 5 did not receive capecitabine due to poor performance status or disease complications, and 1 patient died 6 days after starting cycle 1 due to variceal bleeding. None of these six patients had a DPYD variant and they were excluded from the analysis. The final analysis was on the remaining 66 patients. Patient characteristics are summarised in Table 1. Five of 66 (8%) were found to be heterozygous variant allele carriers (Table 1) with their pharmacogenomic test results being accompanied by recommendations for dose modifications as per our institutional guidelines as follows: heterozygous c.1905 + 1G > A for treatment with 50% dose reduction, heterozygous c.2846A > T and heterozygous c.1601G > A for treatment with 25% dose reduction [34]. Three of these patients did not receive capecitabine, and an alternative regimen was prescribed by their treating physician. Treatment outcomes for the DPYD variant carriers are summarised in Table 2. The other two patients received a 50% dose reduction of capecitabine during their first cycle of treatment with no complications. The c.2846A < T variant carrier had a subsequent dose increase to 75% on cycle 2 which was tolerated very well. Conversely, on increasing the dose for the c.1905 + 1G > A carrier she developed grade 3 toxicities (PPE, diarrhoea, nausea, neutropaenia) requiring hospitalisation for 10 days and treatment cessation.\n\n\nTable 1 Patient demographic and clinical characteristics\n\nCharacteristic\tNumber (%), N = 66\t\nSex\t\n Male\t2 (3%)\t\n Female\t64 (97%)\t\nMean age, years\t58 (28–85)\t\nECOG performance status\t\n 0\t22 (33%)\t\n 1\t24 (36%)\t\n 2\t9 (14%)\t\n 3\t2 (3%)\t\n Not specified\t9 (14%)\t\nDPYD status\t\n Wild type\t61 (92%)\t\n  Heterozygous c.1601G > A\t2\t\n  Heterozygous c.2846A < T\t2\t\n  Heterozygous c.1905 + 1G > A\t1\t\n Capecitabine received\t63 (95%)\t\n  Single agent\t49 (22%)\t\n  Combination with lapatinib\t14 (78%)\t\nECOG Eastern Cooperative Oncology Group Performance Status\n\n\n\n\n\nTable 2 Treatment outcomes based on pharmacogenomic results for patients carrying DPYD polymorphisms\n\nNo.\tPatient summary\tDPYD variant\tTreatment outcome\t\n1\t56F, ECOG PS1\tHeterozygous c.2846A < T\tCapecitabine not given\n\nAlternative treatment\n\n\t\n2\t42F, ECOG PS 2\tHeterozygous c.1601G > A\tCapecitabine not given\n\nAlternative treatment\n\n\t\n3\t62F, ECOG PS 1\tHeterozygous c.1601G > A\tCapecitabine not given\n\nAlternative treatment\n\n\t\n4\t45F, ECOG PS 0\tHeterozygous c.1905 + 1G > A\tC1 DR 50% with no complications, C2 dose increased to 75%: admitted with G3 toxicities (PPE, diarrhoea, nausea, neutropaenia), treatment stopped, and patient recovered\t\n5\t59F, ECOG PS 0\tHeterozygous c.2846A < T\tC1 DR 50%: no complications. C2 dose increased to 75%: no toxicities\t\nF female, ECOG PS Eastern Cooperative Oncology Group Performance Status, C cycle, DR dose reduction\n\n\n\n\nOf the 61 patients with a wild-type DPYD genotype, 14 (23%) experienced capecitabine-related adverse events (G > 3) such as PPE and gastrointestinal symptoms including diarrhoea and mucositis (Table 3). In two patients, treatment was stopped, however, none of these patients required hospitalisation. A total of 9 patients (15%) required a dose reduction at the outset of treatment due to comorbidities or poor performance status. There was no death associated with capecitabine treatment in our patient cohort.\n\n\nTable 3 Capecitabine-related toxicities and dose modifications in DPYD wild-type patients\n\nToxicity ≥ grade 3\tNumber (%) (N = 61)\t\nOverall toxicity\t14 (23%)\t\nGastrointestinal toxicities\t5 (8%)\t\nPalmar-plantar erythrodysesthesia\t9 (15%)\t\nHaematological\t0 (0%)\t\nCapecitabine-related hospital admissions\t0 (0%)\t\nTreatment discontinuation because of capecitabine induced adverse events\t2 (3%)\t\nCapecitabine related deaths\t0 (0%)\t\nDose reduction on treatment outset\t\n 25%\t6 (10%)\t\n 50%\t3 (5%)\t\n\n\n\nThe test turnaround time for the DPYD genotyping results was 2–3 working days and did not cause delays in treatment initiation. The cost of the test was £57.56 per patient.\n\nDiscussion\nIn this observational study, we evaluated the feasibility and usefulness of routine prospective DPYD genotyping for the prevention of severe toxicities in mBC patients treated with capecitabine. Our results show that the implementation of DPYD screening in clinical practice was feasible and well accepted by clinicians, as every patient who was considered for capecitabine in our institution was successfully screened. The rapid turnaround time and relatively low cost of the test contributed to this, although these factors may vary across different treatment centres globally. This is in keeping with outcomes from large prospective multicentre studies supporting the feasibility and cost-effectiveness of prospective DPYD genotyping for patients receiving fluoropyrimidine-based treatment across all tumour types [27, 28].\n\nThis evaluation is limited by its relatively small sample size. The low number of DPYD variant carriers precludes a formal evaluation of the effect of DPYD screening on capecitabine-induced toxicities.\n\nOur patients were screened at our in-house facility for four DPYD variants with an assay that had a combined predictive value of > 99% and negative predictive value of 80% [34]. Only two of the five patients identified as carriers of DPYD polymorphisms received a reduced dose of capecitabine; this was 50% in both patients, but of note was the severe toxicity when the dose was increased by 25% for one of these patients. The consequence of giving full dose capecitabine, without the knowledge of the DPD deficiency, could have resulted in very severe morbidity or even death.\n\nThe patients who did not receive capecitabine carried c.2846A > T and c.1601G > A polymorphisms, for which a recommendation of 25% dose reduction is advised. The variability seen in the treatment decisions made by the physicians could reflect uncertainty due to the lack of adequate safety data in the literature at that time. Only recently have large studies emerged evaluating the clinical relevance and providing safety outcomes for commonly screened variants [13, 27, 28, 32]. Although the Clinical Pharmacogenetics Implementation Consortium (CPIC) has issued comprehensive guidance on dose adjustments, there is a need for more real-world safety data to identify the optimal dosing for each genotype [24, 28].\n\nFrom the patients found to be wild-type DPYD, only 23% developed grade 3 toxicities which were managed with supportive measures or dose reductions but did not result in hospitalisation. It has been previously reported that patients who do not carry DPYD variants can still experience severe side effects. This can be due to the sensitivity of the assay, the presence of unrecognised and hence unscreened polymorphisms, or post-transcriptional modifications and variation in other genes influencing fluoropyrimidine drug metabolism [14, 15, 24, 28, 30]. DPD phenotyping testing can predict DPD activity more accurately than DPYD genotyping, however, its cost and lengthy turnaround time make it difficult to implement in clinical practice [36]. Similarly, not all patients carrying deleterious DPYD variants will experience severe toxicity at standard doses, which may result in their undertreatment. Careful dose titration upon an initial dose reduction has been suggested by CPIC to address this issue [24].\n\nDespite the growing amount of evidence favouring the routine implementation of DPYD genotype screening in clinical practice [27, 28, 31], this remains a subject of debate and controversy. Utilising pharmacogenomics to prevent avoidable toxicities, and death, is of paramount importance for patient care. This has even greater implications for patients with mBC for whom a plethora of therapeutic options are available. Our study demonstrates that routine implementation of DPYD genotyping in this patient population is feasible and can guide treatment decisions in a personalised manner.\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and\ninstitutional affiliations.\n\nData availability\nThe datasets during and/or analysed during the current study are available from the corresponding author on reasonable request.\n\nCompliance with ethical standards\nConflict of interest\nThe authors declare no conflict of interest.\n\nEthical approval\nAll procedures performed in studies involving human participants were in accordance with the Ethical Standards of the Institutional and/or National Research Committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Official approval for the use of retrospective data was granted by Guy’s and St Thomas’ Clinical Audit Office. This article does not contain any studies with animals performed by any of the authors.\n\nInformed consent\nIt was obtained from all patients who underwent DPYD genotyping.\n==== Refs\nReferences\n1. Bray F Ferlay J Soerjomataram I Siegel RL Torre LA Jemal A Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA 2018 68 6 394 424 30207593 \n2. Geyer CE Forster J Lindquist D Chan S Romieu CG Pienkowski T Jagiello-Gruszfeld A Crown J Chan A Kaufman B Skarlos D Campone M Davidson N Berger M Oliva C Rubin SD Stein S Cameron D Lapatinib plus capecitabine for HER2-positive advanced breast cancer N Engl J Med 2006 355 26 2733 2743 10.1056/NEJMoa064320 17192538 \n3. Hoff PM Ansari R Batist G Cox J Kocha W Kuperminc M Maroun J Walde D Weaver C Harrison E Burger HU Osterwalder B Wong AO Wong R Comparison of oral capecitabine versus intravenous fluorouracil plus leucovorin as first-line treatment in 605 patients with metastatic colorectal cancer: results of a randomized phase III study J Clin Oncol 2001 19 8 2282 2292 10.1200/JCO.2001.19.8.2282 11304782 \n4. Van Cutsem E Twelves C Cassidy J Allman D Bajetta E Boyer M Bugat R Findlay M Frings S Jahn M McKendrick J Osterwalder B Perez-Manga G Rosso R Rougier P Schmiegel WH Seitz JF Thompson P Vieitez JM Weitzel C Harper P Oral capecitabine compared with intravenous fluorouracil plus leucovorin in patients with metastatic colorectal cancer: results of a large phase III study J Clin Oncol 2001 19 21 4097 4106 10.1200/JCO.2001.19.21.4097 11689577 \n5. Mikhail SE Sun JF Marshall JL Safety of capecitabine: a review Expert Opin Drug Saf 2010 9 5 831 841 10.1517/14740338.2010.511610 20722491 \n6. Diasio RB Harris BE Clinical pharmacology of 5-fluorouracil Clin Pharmacokinet 1989 16 4 215 237 10.2165/00003088-198916040-00002 2656050 \n7. Longley DB Harkin DP Johnston PG 5-fluorouracil: mechanisms of action and clinical strategies Nat Rev Cancer 2003 3 5 330 338 10.1038/nrc1074 12724731 \n8. van Kuilenburg AB Haasjes J Richel DJ Zoetekouw L Van Lenthe H De Abreu RA Maring JG Vreken P van Gennip AH Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification of new mutations in the DPD gene Clin Cancer Res 2000 6 12 4705 4712 11156223 \n9. Milano G Etienne MC Pierrefite V Barberi-Heyob M Deporte-Fety R Renée N Dihydropyrimidine dehydrogenase deficiency and fluorouracil-related toxicity Br J Cancer 1999 79 3–4 627 630 10.1038/sj.bjc.6690098 10027340 \n10. Heggie GD Sommadossi JP Cross DS Huster WJ Diasio RB Clinical pharmacokinetics of 5-fluorouracil and its metabolites in plasma, urine, and bile Cancer Res 1987 47 8 2203 2206 3829006 \n11. Mattison LK Fourie J Desmond RA Modak A Saif MW Diasio RB Increased prevalence of dihydropyrimidine dehydrogenase deficiency in african-americans compared with caucasians Clin Cancer Res 2006 12 5491 5495 10.1158/1078-0432.CCR-06-0747 17000684 \n12. Etienne MC Lagrange JL Dassonville O Fleming R Thyss A Renee N Schneider M Demard F Milano G Population study of dihydropyrimidine dehydrogenase in cancer patients J Clin Oncol 1994 12 11 2248 2253 10.1200/JCO.1994.12.11.2248 7964939 \n13. Meulendijks D Henricks LM Sonke GS Deenen MJ Froehlich TK Amstutz U Largiader CR Jennings BA Marinaki AM Sanderson JD Kleibl Z Kleiblova P Schwab M Zanger UM Palles C Tomlinson I Gross E van Kuilenburg AB Punt CJ Koopman M Beijnen JH Cats A Schellens JH Clinical relevance of DPYD variants c.1679T > G, c.1236G > A/HapB3, and c.1601G > A as predictors of severe fluoropyrimidine-associated toxicity: a systematic review and meta-analysis of individual patient data Lancet Oncol 2015 16 16 1639 1650 10.1016/S1470-2045(15)00286-7 26603945 \n14. Amstutz U Offer SM Sistonen J Joerger M Diasio RB Largiadèr CR Polymorphisms in MIR27A associated with early-onset toxicity in fluoropyrimidine-based chemotherapy Clin Cancer Res 2015 21 9 20382044 10.1158/1078-0432.CCR-14-2817 \n15. Offer SM Butterfield GL Jerde CR Fossum CC Wegner NJ Diasio RB microRNAs miR-27a and miR-27b directly regulate liver dihydropyrimidine dehydrogenase expression through two conserved binding sites Mol Cancer Ther 2014 13 3 742 751 10.1158/1535-7163.MCT-13-0878 24401318 \n16. Zhang X Li L Fourie J Davie JR Guarcello V Diasio RB The role of Sp1 and Sp3 in the constitutive DPYD gene expression Biochimica et biophysica acta 2006 1759 5 247 256 10.1016/j.bbaexp.2006.05.001 16806531 \n17. Madi A Fisher D Maughan TS Colley JP Meade AM Maynard J Humphreys V Wasan H Adams RA Idziaszczyk S Harris R Kaplan RS Cheadle JP Pharmacogenetic analyses of 2183 patients with advanced colorectal cancer; potential role for common dihydropyrimidine dehydrogenase variants in toxicity to chemotherapy Eur J Cancer 2018 102 3139 10.1016/j.ejca.2018.07.009 \n18. Lee AM, Shi Q, Pavey E, Alberts SR, Sargent DJ, Sinicrope FA, Berenberg JL, Goldberg RM, Diasio RB (2014) DPYD variants as predictors of 5-fluorouracil toxicity in adjuvant colon cancer treatment (NCCTG N0147). J Natl Cancer Inst 106 (12). 10.1093/jnci/dju298\n19. Pellicer M Garcia-Gonzalez X Garcia MI Blanco C Garcia-Alfonso P Robles L Gravalos C Rueda D Martinez J Pachon V Longo F Martinez V Iglesias I Salvador S Sanjurjo M Lopez-Fernandez LA Use of exome sequencing to determine the full profile of genetic variants in the fluoropyrimidine pathway in colorectal cancer patients affected by severe toxicity Pharmacogenomics 2017 18 13 1215 1223 10.2217/pgs-2017-0118 28745575 \n20. Deenen MJ Tol J Burylo AM Doodeman VD de Boer A Vincent A Guchelaar HJ Smits PH Beijnen JH Punt CJ Schellens JH Cats A Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer Clin Cancer Res 2011 17 10 3455 3468 10.1158/1078-0432.CCR-10-2209 21498394 \n21. Rosmarin D Palles C Church D Domingo E Jones A Johnstone E Wang H Love S Julier P Scudder C Nicholson G Gonzalez-Neira A Martin M Sargent D Green E McLeod H Zanger UM Schwab M Braun M Seymour M Thompson L Lacas B Boige V Ribelles N Afzal S Enghusen H Jensen SA Etienne-Grimaldi MC Milano G Wadelius M Glimelius B Garmo H Gusella M Lecomte T Laurent-Puig P Martinez-Balibrea E Sharma R Garcia-Foncillas J Kleibl Z Morel A Pignon JP Midgley R Kerr D Tomlinson I Genetic markers of toxicity from capecitabine and other fluorouracil-based regimens: investigation in the QUASAR2 study, systematic review, and meta-analysis J Clin Oncol 2014 32 10 1031 1039 10.1200/JCO.2013.51.1857 24590654 \n22. van Kuilenburg AB Dobritzsch D Meinsma R Haasjes J Waterham HR Nowaczyk MJ Maropoulos GD Hein G Kalhoff H Kirk JM Baaske H Aukett A Duley JA Ward KP Lindqvist Y van Gennip AH Novel disease-causing mutations in the dihydropyrimidine dehydrogenase gene interpreted by analysis of the three-dimensional protein structure Biochem J 2002 364 Pt 1 157 163 10.1042/bj3640157 11988088 \n23. Vreken P Van Kuilenburg AB Meinsma R Smit GP Bakker HD De Abreu RA van Gennip AH A point mutation in an invariant splice donor site leads to exon skipping in two unrelated Dutch patients with dihydropyrimidine dehydrogenase deficiency J Inherit Metab Dis 1996 19 5 645 654 10.1007/BF01799841 8892022 \n24. Amstutz U Henricks LM Offer SM Barbarino J Schellens JHM Swen JJ Klein TE McLeod HL Caudle KE Diasio RB Schwab M Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing: 2017 update Clin Pharmacol Ther 2018 103 2 210 216 10.1002/cpt.911 29152729 \n25. Henricks LM Lunenburg CA Meulendijks D Gelderblom H Cats A Swen JJ Schellens JH Guchelaar HJ Translating DPYD genotype into DPD phenotype: using the DPYD gene activity score Pharmacogenomics 2015 16 11 1277 1286 10.2217/pgs.15.70 26265346 \n26. Offer SM Wegner NJ Fossum C Wang K Diasio RB Phenotypic profiling of DPYD variations relevant to 5-fluorouracil sensitivity using real-time cellular analysis and in vitro measurement of enzyme activity Cancer Res 2013 73 6 1958 1968 10.1158/0008-5472.CAN-12-3858 23328581 \n27. Deenen MJ Meulendijks D Cats A Sechterberger MK Severens JL Boot H Smits PH Rosing H Mandigers CM Soesan M Beijnen JH Schellens JH Upfront genotyping of DPYD*2A to individualize fluoropyrimidine therapy: a safety and cost analysis J Clin Oncol 2016 34 3 227 234 10.1200/JCO.2015.63.1325 26573078 \n28. Henricks LM Lunenburg C de Man FM Meulendijks D Frederix GWJ Kienhuis E Creemers GJ Baars A Dezentje VO Imholz ALT Jeurissen FJF Portielje JEA Jansen RLH Hamberg P Ten Tije AJ Droogendijk HJ Koopman M Nieboer P van de Poel MHW Mandigers C Rosing H Beijnen JH Werkhoven EV van Kuilenburg ABP van Schaik RHN Mathijssen RHJ Swen JJ Gelderblom H Cats A Guchelaar HJ Schellens JHM DPYD genotype-guided dose individualisation of fluoropyrimidine therapy in patients with cancer: a prospective safety analysis Lancet Oncol 2018 \n29. Henricks LM Opdam FL Beijnen JH Cats A Schellens JHM DPYD genotype-guided dose individualization to improve patient safety of fluoropyrimidine therapy: call for a drug label update Ann Oncol 2017 28 12 2915 2922 10.1093/annonc/mdx411 29045513 \n30. Lunenburg C Henricks LM Guchelaar HJ Swen JJ Deenen MJ Schellens JHM Gelderblom H Prospective DPYD genotyping to reduce the risk of fluoropyrimidine-induced severe toxicity: ready for prime time Eur J Cancer 2016 54 40 48 10.1016/j.ejca.2015.11.008 26716401 \n31. Ruzzo A Graziano F Galli F Galli F Rulli E Lonardi S Ronzoni M Massidda B Zagonel V Pella N Mucciarini C Labianca R Ionta MT Bagaloni I Veltri E Sozzi P Barni S Ricci V Foltran L Nicolini M Biondi E Bramati A Turci D Lazzarelli S Verusio C Bergamo F Sobrero A Frontini L Menghi M Magnani M Dihydropyrimidine dehydrogenase pharmacogenetics for predicting fluoropyrimidine-related toxicity in the randomised, phase III adjuvant TOSCA trial in high-risk colon cancer patients Br J Cancer 2017 117 9 1269 1277 10.1038/bjc.2017.289 29065426 \n32. Henricks LM Lunenburg C de Man FM Meulendijks D Frederix GWJ Kienhuis E Creemers GJ Baars A Dezentje VO Imholz ALT Jeurissen FJF Portielje JEA Jansen RLH Hamberg P Ten Tije AJ Droogendijk HJ Koopman M Nieboer P van de Poel MHW Mandigers C Rosing H Beijnen JH van Werkhoven E van Kuilenburg ABP van Schaik RHN Mathijssen RHJ Swen JJ Gelderblom H Cats A Guchelaar HJ Schellens JHM A cost analysis of upfront DPYD genotype-guided dose individualisation in fluoropyrimidine-based anticancer therapy Eur J Cancer 2018 107 60 67 10.1016/j.ejca.2018.11.010 30544060 \n33. De Souza K Papadatos-Pastos D Karapanagiotou L Sandri I Marinaki A Mansi J DPYD genotyping as a potential cost-effective predictive biomarker of capecitabine toxicity in breast cancer Clin Oncol 2015 27 6 e12 10.1016/j.clon.2015.01.021 \n34. Loganayagam A Arenas Hernandez M Corrigan A Fairbanks L Lewis CM Harper P Maisey N Ross P Sanderson JD Marinaki AM Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity Br J Cancer 2013 108 12 2505 2515 10.1038/bjc.2013.262 23736036 \n35. Loganayagam A Arenas-Hernandez M Fairbanks L Ross P Sanderson JD Marinaki AM The contribution of deleterious DPYD gene sequence variants to fluoropyrimidine toxicity in British cancer patients Cancer Chemother Pharmacol 2010 65 2 403 406 10.1007/s00280-009-1147-x 19795123 \n36. van Staveren MC Guchelaar HJ van Kuilenburg AB Gelderblom H Maring JG Evaluation of predictive tests for screening for dihydropyrimidine dehydrogenase deficiency Pharmacogenomics J 2013 13 5 389 395 10.1038/tpj.2013.25 23856855\n\n", "fulltext_license": "CC BY", "issn_linking": "0167-6806", "issue": "175(2)", "journal": "Breast cancer research and treatment", "keywords": "Capecitabine; DPYD genotyping; DPYD screening; Fluoropyrimidines; Metastatic breast cancer; Toxicities", "medline_ta": "Breast Cancer Res Treat", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000964:Antimetabolites, Antineoplastic; D001943:Breast Neoplasms; D018567:Breast Neoplasms, Male; D000069287:Capecitabine; D042943:Dihydrouracil Dehydrogenase (NADP); D005260:Female; D005472:Fluorouracil; D005838:Genotype; D006801:Humans; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D011110:Polymorphism, Genetic; D012189:Retrospective Studies", "nlm_unique_id": "8111104", "other_id": null, "pages": "511-517", "pmc": null, "pmid": "30746637", "pubdate": "2019-06", "publication_types": "D016428:Journal Article", "references": "10027340;11156223;11304782;11689577;11988088;12724731;16806531;17000684;17192538;19795123;20722491;21498394;23328581;23736036;23856855;24401318;24590654;25381393;25655103;26265346;2656050;26573078;26603945;26716401;28745575;29045513;29065426;29152729;30114658;30207593;30348537;30544060;3829006;7964939;8892022", "title": "Clinical implementation of pre-treatment DPYD genotyping in capecitabine-treated metastatic breast cancer patients.", "title_normalized": "clinical implementation of pre treatment dpyd genotyping in capecitabine treated metastatic breast cancer patients" }
[ { "companynumb": "GB-ALKEM LABORATORIES LIMITED-GB-ALKEM-2019-01681", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CAPECITABINE" }, "dru...
{ "abstract": "The objective of this case series was to describe botulinum toxin therapy as a novel treatment of intractable head pain following lateral skull base surgery.\n\n\n\nIntractable headaches following lateral skull base surgery are described in 23%-75% of patients and can significantly impact quality of life. Currently, the etiology of the headaches is unclear and treatment options are limited. Botulinum toxin is indicated for a multitude of functional and cosmetic reasons, including chronic migraine, and has been further described in treatment of various postsurgical pain syndromes.\n\n\n\nIn this case series, 4 patients underwent subcutaneous peri-incisional injections of botulinum toxin for intractable headache and head pain syndromes. Three patients had undergone lateral skull base surgery and the fourth patient had undergone a temporoparietal fascial flap harvest. Average injection dose ranged from 20 to 60 units with an average duration of effect ranging from 2 weeks to 4 months.\n\n\n\nAll patients experienced significant relief of chronic head pain and returned for additional peri-incisional botulinum toxin injections, suggesting meaningful patient-perceived value.\n\n\n\nBotulinum toxin therapy may represent a novel treatment for intractable head pain following lateral skull base surgery and temporoparietal fascial flap harvest. This study represents a small case series and, although 100% of the patients who were treated significantly improved, future inquiry is necessary to confirm these findings.", "affiliations": "Vanderbilt University School of Medicine, Nashville, TN, USA.;Department of Otolaryngology - Head and Neck Surgery, Vanderbilt University Medical Center, Nashville, TN, USA.;Department of Otolaryngology - Head and Neck Surgery, Vanderbilt University Medical Center, Nashville, TN, USA.;Department of Otolaryngology - Head and Neck Surgery, Vanderbilt University Medical Center, Nashville, TN, USA.;Department of Otolaryngology - Head and Neck Surgery, Vanderbilt University Medical Center, Nashville, TN, USA.", "authors": "Dang|Sabina|S|;Shinn|Justin R|JR|;Sowder|Justin|J|;Ries|William Russell|WR|;Stephan|Scott J|SJ|", "chemical_list": "D009465:Neuromuscular Agents; D001905:Botulinum Toxins", "country": "United States", "delete": false, "doi": "10.1111/head.13616", "fulltext": null, "fulltext_license": null, "issn_linking": "0017-8748", "issue": "59(9)", "journal": "Headache", "keywords": "botulinum A toxin; botulinum toxin; craniotomy; intractable headache; postoperative pain; skull base neoplasms", "medline_ta": "Headache", "mesh_terms": "D000328:Adult; D001905:Botulinum Toxins; D059350:Chronic Pain; D003399:Craniotomy; D005260:Female; D020773:Headache Disorders; D006801:Humans; D008875:Middle Aged; D009465:Neuromuscular Agents; D019635:Neurosurgical Procedures; D010148:Pain, Intractable; D010149:Pain, Postoperative; D019291:Skull Base; D013524:Surgical Flaps; D016896:Treatment Outcome", "nlm_unique_id": "2985091R", "other_id": null, "pages": "1624-1630", "pmc": null, "pmid": "31471906", "pubdate": "2019-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Peri-Incisional Botulinum Toxin Therapy for Treatment of Intractable Head Pain After Lateral Skull Base Surgery: A Case Series.", "title_normalized": "peri incisional botulinum toxin therapy for treatment of intractable head pain after lateral skull base surgery a case series" }
[ { "companynumb": "US-JNJFOC-20191122176", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "METHOCARBAMOL" }, "drugadditional": null, ...
{ "abstract": "Acute splenic sequestration crisis is a complication of sickle cell disease (SCD) occurring when intrasplenic red blood cell (RBC) sickling prevents blood from leaving the spleen, causing acute splenic enlargement. Although typically seen in young children, it has been reported in older children with hemoglobin (Hb)SC disease, eventually resulting in functional asplenia. Ceftriaxone is a frequently used antibiotic of choice for children with SCD, because of its efficacy against invasive pneumococcal disease.\n\n\n\nWe report a case of a 9-year-old female with HbSC disease, who had a fatal reaction after receiving a dose of ceftriaxone in the outpatient clinic for fever. Her Hb level decreased abruptly from 9.3 to 2.3 mg/dL. RBC clumps with no visible hemolysis were observed in the postreaction sample. Autopsy examination revealed marked splenomegaly with acute congestion and sickled cells in the spleen and liver. Serologic testing revealed a positive direct antiglobulin test with polyspecific antibody, anti-C3, and anti-C3d, but negative with anti-immunoglobulin G. Ceftriaxone-dependent RBC antibodies were detected in her serum and RBC eluate when tested in the presence of the drug.\n\n\n\nWe report a new presentation of ceftriaxone-induced drug reaction in a patient with SCD mimicking an acute splenic sequestration crisis. Review of the literature for cases of ceftriaxone-induced drug reactions in pediatric patients revealed nine previously reported cases of ceftriaxone-induced immune hemolytic anemia in children with SCD since 1995, but none with an initial presentation suggestive of acute splenic sequestration crisis.", "affiliations": "Transfusion Services.;Transfusion Services.;Pathology and Laboratory Medicine.;BloodCenter of Wisconsin, Milwaukee, Wisconsin.;Cancer and Blood Disorders, Children's Hospitals and Clinics of Minnesota, Minneapolis, Minnesota.", "authors": "Van Buren|Nancy L|NL|;Gorlin|Jed B|JB|;Reed|Robyn C|RC|;Gottschall|Jerome L|JL|;Nelson|Stephen C|SC|", "chemical_list": "D001323:Autoantibodies; D002443:Ceftriaxone", "country": "United States", "delete": false, "doi": "10.1111/trf.14536", "fulltext": null, "fulltext_license": null, "issn_linking": "0041-1132", "issue": "58(4)", "journal": "Transfusion", "keywords": null, "medline_ta": "Transfusion", "mesh_terms": "D000744:Anemia, Hemolytic, Autoimmune; D001323:Autoantibodies; D002443:Ceftriaxone; D002648:Child; D004912:Erythrocytes; D017809:Fatal Outcome; D005260:Female; D006450:Hemoglobin SC Disease; D006801:Humans; D008099:Liver; D013154:Spleen; D013163:Splenomegaly", "nlm_unique_id": "0417360", "other_id": null, "pages": "879-883", "pmc": null, "pmid": "29473172", "pubdate": "2018-04", "publication_types": "D002363:Case Reports", "references": null, "title": "Ceftriaxone-induced drug reaction mimicking acute splenic sequestration crisis in a child with hemoglobin SC disease.", "title_normalized": "ceftriaxone induced drug reaction mimicking acute splenic sequestration crisis in a child with hemoglobin sc disease" }
[ { "companynumb": "US-APOTEX-2018AP012718", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "drugadditional": null, ...
{ "abstract": "An 87-year-old man with dementia with Lewy bodies, living in residential aged care, exhibited rapid functional decline and weight loss associated with injurious falls over 9 months. Independent clinicians (geriatrician and exercise physiologist) assessed him during an extended wait-list period prior to his commencement of a pilot exercise trial. The highly significant role of treatable factors including polypharmacy, sarcopenia and malnutrition as contributors to frailty and rapid functional decline in this patient are described. The results of a targeted intervention of deprescribing, robust exercise and increased caloric intake on his physical and neuropsychological health status are presented. This case highlights the need to aggressively identify and robustly treat reversible contributors to frailty, irrespective of advanced age, progressive 'untreatable' neurodegenerative disease and rapidly deteriorating health in such individuals. Frailty is not a contraindication to robust exercise; it is, in fact, one of the most important reasons to prescribe it.", "affiliations": "Faculty of Medicine and Health, School of Health Sciences, The University of Sydney, Lidcombe, New South Wales, Australia michael.inskip@sydney.edu.au.;Faculty of Medicine and Health, School of Health Sciences, The University of Sydney, Lidcombe, New South Wales, Australia.;Centre for Healthy Brain Ageing (CHeBA), School of Psychiatry, University of New South Wales, Sydney, New South Wales, Australia.;Faculty of Medicine and Health, School of Health Sciences, The University of Sydney, Lidcombe, New South Wales, Australia.", "authors": "Inskip|Michael|M|http://orcid.org/0000-0001-5150-8582;Mavros|Yorgi|Y|http://orcid.org/0000-0002-2588-0425;Sachdev|Perminder Singh|PS|http://orcid.org/0000-0002-9595-3220;Fiatarone Singh|Maria A|MA|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1136/bcr-2019-231336", "fulltext": "\n==== Front\nBMJ Case Rep\nBMJ Case Rep\nbmjcr\nbmjcasereports\nBMJ Case Reports\n1757-790X BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR \n\nbcr-2019-231336\n10.1136/bcr-2019-231336\nReminder of Important Clinical Lesson\n1506\n1524\n1329\n587\n200\n1315\n1560\n1305\nCase reportInterrupting the trajectory of frailty in dementia with Lewy bodies with anabolic exercise, dietary intervention and deprescribing of hazardous medications\nhttp://orcid.org/0000-0001-5150-8582Inskip Michael 12 http://orcid.org/0000-0002-2588-0425Mavros Yorgi 1 http://orcid.org/0000-0002-9595-3220Sachdev Perminder Singh 34 Fiatarone Singh Maria A 156 1 Faculty of Medicine and Health, School of Health Sciences, The University of Sydney, Lidcombe, New South Wales, Australia\n2 Sport and Exercise Science, College of Healthcare Sciences, James Cook University, Townsville, QLD, Australia\n3 Centre for Healthy Brain Ageing (CHeBA), School of Psychiatry, University of New South Wales, Sydney, New South Wales, Australia\n4 Neuropsychiatric Institute, The Prince of Wales Hospital, Sydney, New South Wales, Australia\n5 The University of Sydney, Sydney Medical School, Camperdown, New South Wales, Australia\n6 Hebrew SeniorLife and Jean Mayer USDA Human Nutrition Research Center on Aging, Tufts University, Boston, Massachusetts, USA\nCorrespondence to Michael Inskip; michael.inskip@sydney.edu.au\n2020 \n26 4 2020 \n26 4 2020 \n13 4 e23133625 3 2020 © BMJ Publishing Group Limited 2020. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2020http://creativecommons.org/licenses/by-nc/4.0/This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.An 87-year-old man with dementia with Lewy bodies, living in residential aged care, exhibited rapid functional decline and weight loss associated with injurious falls over 9 months. Independent clinicians (geriatrician and exercise physiologist) assessed him during an extended wait-list period prior to his commencement of a pilot exercise trial. The highly significant role of treatable factors including polypharmacy, sarcopenia and malnutrition as contributors to frailty and rapid functional decline in this patient are described. The results of a targeted intervention of deprescribing, robust exercise and increased caloric intake on his physical and neuropsychological health status are presented. This case highlights the need to aggressively identify and robustly treat reversible contributors to frailty, irrespective of advanced age, progressive ‘untreatable’ neurodegenerative disease and rapidly deteriorating health in such individuals. Frailty is not a contraindication to robust exercise; it is, in fact, one of the most important reasons to prescribe it.\n\ngeriatric medicinesports and exercise medicinememory disordersnutritiongeneral guidance on prescribingspecial-featureunlocked\n==== Body\nBackground\nFrailty is a medical syndrome of increased dependency, vulnerability to stressors and excess mortality that is driven by diminished strength, endurance, neuropsychological and physiological functions.1 The prevalence of frailty increases with age and chronic disease burden. However, there are also significant reversible components to this syndrome that are critical to diagnose and treat specifically. Morley et al describe the aetiology of frailty as the interaction among four central factors: sarcopenia, malnutrition, atherosclerosis and cognitive impairment.2 Extrinsic factors such as decreased physical activity and immobilisation, insufficient dietary energy and protein intake, texture-modified diets and the iatrogenic effects of medications may add to pathophysiologic stressors including cachexia from chronic disease, cardiac and skeletal muscle dysfunction, sedation, apathy, depression, loneliness, delirium, psychosis, anorexia of ageing, dysphagia, poor dentition, impairment of vision, smell and taste. All of these stressors exert pressure on these four key components of frailty and are modifiable to a varying degree.2–10 Additionally, malnutrition, cognitive impairment and atherosclerosis can all exacerbate sarcopenia by contributing to a negative energy balance, reduced drive to exercise and a significant reduction in physical capacity, respectively.11\n\nIn the residential aged care environment, there is a confluence of these risk factors for frailty, resulting in a five-fold higher incidence than among community-dwelling older adults.12 13 Guidelines for aged care facilities traditionally focus on safety/falls reduction,14 which is the leading cause of accidental death in these facilities.15 Many recommendations for falls reduction, such as deprescribing high-risk medications and offering challenging balance exercises, may improve frailty as well.14 However, a safety focus can also lead to undesirable practices such as the use of restraints and immobilising chairs, which may reduce falls risk but actively exacerbate underlying frailty; thereby leaving the individual even more vulnerable to injurious falls and adverse outcomes.16 Recently released guidelines on frailty clearly recommend anabolic interventions such as progressive resistance exercise and increased protein/energy intake as first-line treatments to prevent and treat frailty.17 Evidence for the efficacy of this approach in frail populations has been available since the 1990s18 but has not yet become routine practice within residential aged care. The potential for remediating frailty is significant, especially for those living with dementia, who experience the highest levels of frailty in this setting.19 Notably, the aetiology of frailty in individuals with dementia is reported to have minimal correlation with the burden of disease pathology in the brain,20 suggesting that the higher incidence of frailty cannot be attributed to normal disease course and may be related to factors more amenable to intervention.\n\nThe following case provides a rare, longitudinal insight into the aetiology and progression of frailty in a patient of advanced age with an aggressive neurodegenerative disease: dementia with Lewy bodies (DLB). We highlight the critical importance of differentiating disease progression from remediable causes of frailty, and the positive outcomes of a comprehensive intervention of deprescribing, increased protein–energy intake and robust anabolic exercise.\n\nCase presentation\nAn 87-year-old man diagnosed with mild DLB 1 year prior by a geriatrician and living in a residential aged care facility since diagnosis was screened for a pilot exercise trial.21 He satisfied both the 2005 and 2017 criteria for the diagnosis of probable DLB including the onset of dementia prior to motor symptoms and the presence of two or more core features: fluctuating cognition and alertness, well-formed visual hallucinations and spontaneous parkinsonism features.22 23 He resided in a room by himself and his wife lived in the community, visiting daily. He had a recent history of recurrent falls and had lost 7% of his body weight in the 12 months since moving into the facility. Medical history included osteoporosis with hip fracture 5 years prior, chronic obstructive pulmonary disease (COPD), gout, dyslipidaemia, hypertension, macular degeneration, depression and a history of excessive alcohol consumption prior to admission. Medications included mirtazapine, aspirin, perindopril, atorvastatin, tiotropium bromide, paracetamol and allopurinol. A texture-modified diet had been implemented due to concerns surrounding dysphagia and potential aspiration. The patient was observed to rapidly deteriorate in health status, precipitated by two injurious falls over 9 months while enrolled in a wait-list control period for the exercise trial. Evaluations were conducted to identify potential aetiologic factors in his rapid functional decline.\n\nInvestigations\nThe study geriatrician and exercise physiologist undertook external investigations during an extended, 9-month wait-list period due to the ill health of the patient prior to intervening. Table 1 presents a timeline of relevant investigations and adverse events. A key limitation to investigations involved the lack of dietary assessment and nutritional biochemistry, as the study geriatrician was not the primary physician for the patient and therefore was not authorised to order these in his residential aged care setting. A compete biochemistry panel would have allowed for further evaluation of malnutrition, impaired cognition and strength through indices such as serum albumin, electrolyte abnormalities, vitamin B12 or iron deficiencies, thyroid hormone imbalances and diabetes. Physical assessment revealed the predominant DLB features in the patient, which were non-threatening hallucinations, orthostasis, drooling, mild rigidity in all limbs with a full range of motion, ataxia and postural instability. Notably absent were dystonia, dyskinesia, depression and dysphagia.\n\nTable 1 Investigations and patient timeline\n\nTime point/event\tNovember 2016, initial assessment\tDecember 2016\tEarly February 2017, reassessme\tFebruary 2017\tAugust 2017, reassessment\t\nReview of systems\tPatient reports constant hunger, feelings of isolation and dizziness on standing. Negative for pain, depression, Cardiovascular symptoms or dyspnoea\tPatient still reports constant hunger, and feelings of isolation increased. Negative for dizziness, pain, depression, CVD Sx or dyspnoea\tPatient reports hunger, increased isolation. Negative for pain, troubling hallucinations, depression, CVD Sx or dyspnoea.\t\nClinical course and physical examination\tWeight loss >5 kg in 12 months and reduced muscle bulk diffusely. Kyphotic posture c/w Hx of hip fracture (2012). Ecchymosis widespread, acute ankle sprain. Cerebellar ataxia w. standing and walking c/w Hx excessive alcohol use.\tSepsis and seizure following fall. Further weight loss of 6.5 kg in 2 months, diffuse wasting. Ecchymosis still present. Decreased alertness c/w delirium, gait stability and strength/function.\tFurther weight loss of 11 kg in 5 months and severe, diffuse wasting. Healed rib fracture secondary to fall, immobilised with restraints. Decreased alertness. Ecchymosis still present. Unable to stand. Tardive dyskinesia, trunk dystonia to the right side, increased limb rigidity. Fetal posture in the supine position with hamstring contractures.\t\nMMSE\nSPPB\nMNA-SF\nWeight/BMI\nOrthostatic BP and HR\nLying (0 min)\nStanding (1 min)\nStanding (3 min)\nBIA SMI\nGrip strength\n(85 year+percentile.26)\t21/30\n5/12\n10/14 (at-risk)\n74.5 kg/23 kgm−2\nSymptomatic—dizziness\n120/50 mm Hg, 50 bpm\n110/50 mm Hg, 62 bpm\n108/48 mm Hg, 70 bpm\n8.43 kgm−2\nL—25 kg (45th percentile)\nR—26 kg (40th percentile)\t17/30\n4/12\n4/14 (Malnourished)\n68 kg/21 kg/m2\nnot symptomatic\n118/50 mm Hg, 56 bpm\n126/60 mm Hg, 70 bpm\n128/460 mm Hg, 68 bpm\n7.8 kgm−2\nL—20 kg (25th percentile)\nR—17 kg (10th percentile)\t13/30\n0/12\n0/14 (malnourished)\n57 kg / 17.7 kg/m2\nUnable to perform due to immobility\n\n\nN/A\nL—17 kg (15th percentile)\nR—17 kg (10th percentile\t\nPathology\tTC: 4.7 mmol/L, LDL: 2.5 mmol/L, Vit. D: 58 nmol/L\tNo pathology results available for review by the research team\tNo pathology results available for review by the research team\t\nRecommendations to facility doctor\tReview need for aspirin, perindopril, atorvastatin, and mirtazapine.\nRecommend vitamin D—1000 IU/day.\nFlagged as high falls risk, malnourished and sarcopenic\tIncrease energy intake by an addition of high protein supplements and larger meal portions.\nReview needs for aspirin\tDiscussed in the Intervention section\t\nImplemented recommendations\tRemoval of perindopril and atorvastatin. Vitamin D was not added, aspirin and mirtazapine not removed\tFood portions not increased, high energy supplements prescribed (1080 kJ/day)\t\nMeasured in kg/m2, <9.5 kg/m2 is considered Sarcopenic.27\n\nDecember 2016, adverse event: patient sustained minor elbow wound from injurious fall in facility. Infected wound led to sepsis, resulting in seizure and hospitalisation. Sodium valproate added to prescription. Patient restrained and catheterised and subsequently developed UTI and delirium.\n\nFebruary 2017, adverse event: patient experienced injurious fall within facility resulting in several fractured ribs and required hospitalisation. Physical restraints implemented in the reclining chair. Following medications added to prescription over 5-month period; risperidone, buprenorphine (patch), oxycodone, paracetamol. Supra-pubic catheter placed. Several UTIs reported. Completely immobile and highly sedated.\n\nBIA SMI, bioelectrical impedance skeletal muscle index; BMI, body mass index; BP, blood pressure; HR, heart rate; LDL, low density lipoprotein; MMSE, mini-mental state exam; MNA-SF, Mini-nutritional Assessment Short Form; SPPB, short physical performance battery; Sx, symptoms; TC, total cholesterol; UTI, urinary tract infection.\n\nDifferential diagnosis\nThe aged care management plan for the patient appeared palliative and reactionary in approach to falls, pain management and psychosis, and suggested that the decline in function was viewed as an inevitable accompaniment to his DLB. However, the external research team elucidated many core, modifiable factors potentially contributing to the frailty through their investigations.\n\nNatural disease course of DLB\nDLB is an aggressive form of dementia with a lifespan postdiagnosis of 3–8 years.24 The rate of cognitive decline in prospective studies is two to four points on the Mini-mental State Exam (MMSE) every year postdiagnosis.24 The disease is characterised by acute fluctuations and a progressive decline in function over time, and is not relapsing–remitting in nature. The patient at baseline had mild cognitive impairment, was only mildly rigid with full range of motion and did not have depression, troubling hallucinations, dystonia or dyskinesia. Poorer prognostic outcomes are mainly precipitated in DLB by neuropsychiatric symptoms and hospitalisations from falls and bronchopneumonia,25 similar to the general ageing cohort. However, this patient presented with a much more rapid cognitive deterioration of eight points over 9 months. Despite no change to his non-threatening hallucinations, the antipsychotic risperidone was added to his medication regime, resulting in an acute worsening in extrapyramidal symptoms including tardive dyskinesia, trunk dystonia and rigidity. The rapid onset of these symptoms suggest iatrogenesis/delirium rather than the natural, degenerative disease progression.\n\nSarcopenia\nThe patient was sarcopenic at baseline, worsening at follow-up time points. Both isometric handgrip and appendicular strength were below age-matched thresholds at baseline26 and deteriorated over the 9-month period in concert with declining physical activity levels. Body composition analysis confirmed a skeletal muscle mass (SMM) index below the sarcopenia definition of <9.5 kg/m2,27 deteriorating from 8.43 to 7.8 kg/m2 in the first 8 weeks of acute illness/sepsis, associated with a 6.5 kg overall weight loss. This equates to an average weekly loss of muscle mass of 250 g/week during that period, which is significantly higher than estimated in young, healthy bedrest models of muscle atrophy of 100–200 g/week,28 and consistent with the literature reports of 25% of body weight loss being SMM.11 This muscle loss likely continued (although not directly measured) with the further 11 kg of weight loss in the subsequent 5 months concomitant with restraint use, immobilisation and recurrent infections. Additionally, a significant decrease in gait speed, transfer and balance function accompanying muscle loss, progressing to non-ambulatory, chair/bed-bound status confirmed severe sarcopenia. Finally, the use of atorvastatin and vitamin D deficiency were also potential contributors to muscle weakness throughout the early stages of the decline.29\n\nMalnutrition\nThe patient was at risk of malnutrition at baseline according to the Mini-nutritional Assessment (MNA)30 and developed severe malnutrition during the follow-up. Anorexia of ageing is a contributing factor to be considered, however, the patient always reported hunger, not loss of appetite. By contrast, there were multiple modifiable factors potentially driving insufficient energy intake.31 First, the prescription of anti-cholinergic and/or sedating medications (oxycodone, buprenorphine, risperidone, sodium valproate, mirtazapine, tiotropium) likely decreased the patient’s opportunity to eat and contributed to the dysphagia known to be present in DLB32 as well as reduced saliva production, impairing mastication and swallowing along with the absence of lower teeth. A pureed diet was prescribed due to fear of aspiration. Texture-modified diets have been observed to significantly reduce the daily energy and protein intake in older adults10 as does eating in isolation with minimal social engagement.5 Additionally, there were potentially underlying cachexic processes from the recurrent infections, COPD diagnosis as well as statin and ACE-inhibitor prescriptions.7 Finally, the patient reported feeling hunger between meals and readily ate all food provided, which suggests the energy or protein content of food provided was not satiating or sufficient. Furthermore, no assessment of caloric intake or calculation of energy requirements for maintenance (approximately 30 kcal/kg/day) or weight increase (35 kcal/kg/day) or protein needs (1.2 g/kg/day) was conducted by the aged care facility despite severe and persistent weight loss.33–35\n\nCognitive impairment and atherosclerotic processes\nThe patient was eulipidaemic and normotensive, with no history or current symptoms of cerebrovascular or cardiovascular disease, and no current alcohol or smoking (ex-smoker—discontinued 10 years prior) suggesting that atherosclerosis was not a recent contributing factor to progressive frailty or cognitive impairment. Apathy and depression are common predictors of malnutrition and cognitive performance in DLB,4 8 36 yet were absent in this patient at all assessment points. The high sedative burden of his medication regimen (five drugs with this side effect) was likely contributing to his cognitive impairment,6 37 especially considering the extra-pyramidal side effects observed (tardive dyskinesia, rigidity, trunk dystonia). His significantly reduced level of alertness and loss of postural control and communication ability witnessed just after administration of risperidone and sodium valproate was consistent with a drug-related delirium. The rapid eight-point decrease in his MMSE over a 9-month period, which is a similar decline to that reported in postoperative literature,9 38 was likely precipitated by recurrent and persistent delirium from multiple episodes of infection and malnutrition, in addition to the central nervous system side effects of several medications noted above.\n\nSummary\nThe final diagnosis we provided to the facility staff was an exacerbation of underlying frailty due to sarcopenia, malnutrition, polypharmacy and isolation/immobility, with all factors potentially treatable with targeted, robust interventions and changes in clinical care. All of these factors were inseparably involved in the decline (figure 1). For example, sedating drugs reduced the ability to eat, exacerbated sarcopenia and impaired strength and functional mobility, increasing fall risk further. Thus, without a comprehensive approach to all implicated factors, recovery would be sub-optimal or impossible.\n\nFigure 1 Contribution to frailty trajectory. Timeline illustrating the contributions of various negative and positive factors to the development of frailty and rehabilitation within the patient over the course of 29 months with inclusion of adverse events. The size of the plus/minus images indicates the relative magnitude of the effect on patient health at each stage. UTI, urinary tract infection.\n\nTreatment\nDeprescribing\nOver the course of observation, deprescribing with rationale was recommended to the facility doctor at several time points (figure 2) to reduce iatrogenic influences of polypharmacy based on consensus criteria.39 Primarily, most drugs were recommended for removal through lack of indication or being prescribed beyond the duration of treatment, which are standalone reasons to deprescribe. Additionally, specific contraindications included duplicate drug classes, ACE inhibitors with low/normal BP, anticholinergics in patients with dementia/delirium, long-acting with short-acting opioids for breakthrough pain, overall increased anticholinergic burden and inappropriate antipsychotics use for several categories including prescription for Parkinsonian disorders, behavioural symptoms in dementia and in patients with falls risk. There was also one indication for starting a prescription, namely adding vitamin D for known osteoporotic fractures of hip, spine and ribs and low lab value in an institutionalised patient.\n\nFigure 2 Intervention components.\n\nExercise and nutrition\nThe study exercise physiologist commenced intensive anabolic exercise, and the facility was instructed to increased energy intake from 1080 to 5040 kJ/day through liquid supplements, in addition to implementing a high energy, high-protein diet and re-evaluating the need for a pureed diet as there was no evidence of aspiration. This was done in response to the severe and progressive undernutrition present, as evidenced by a weight loss of 17.5 kg, body mass index of 23 kg/m2 decreasing to 17.7 kg/m2, marked muscle wasting on physical exam, MNA score decreasing from 10/14 to 0/14, and complaints of hunger. Falls and infections are well-known co-morbidities associated with poor nutritional status in nursing home residents and were also present in this case. Protein and caloric supplementations significantly reduce mortality and complications as well as promoting weight change in undernourished patients.40 Exercises were progressed in weeks 1–3 and administered in the facility to regain strength, standing and walking function to enable transport to the clinical gym for weeks 4–8. High-intensity progressive resistance training was performed on key muscle groups. All training throughout the 8-week period occurred as 3 days/week for 1-hour sessions and are described in figure 2.\n\nOutcome and follow-up\nThe patient improved significantly following deprescribing and had no adverse consequences. A total of nine medications were assessed and recommended for immediate removal from the prescription across all time points. The prescription at each time point is detailed in figure 3. All medications except sodium valproate were ultimately removed, and high-energy supplements were prescribed (5040 kJ/day) in addition to his normal meal routine. The patient’s wife signed a waiver to allow the addition of some solid foods to his daily diet. The exercise intervention (figure 2) was tolerated well by the patient, and all 24 sessions were completed with no adverse events. Figure 4 displays key intervention results of the patient prior to, and following interventions. Figure 5 illustrates the rapid, clinically significant improvement in his overall function and health status, which included a transition from being chair-bound to ambulatory with contact guarding.\n\nFigure 3 Patient medication prescription timeline.\n\nFigure 4 Frailty measures and outcomes from intervention. Graphs: relationship between body weight over time with (top) skeletal muscle index, (middle) cognition and (bottom) physical function. Intervention occurred between 9 and 11 months indicated in the green zone. Indicates no data collection, extrapolated from 29-month value of similar body weight. MMSE, mini-mental state examination; SPPB, short physical performance battery.\n\nFigure 5 Rapid deconditioning and rehabilitation of patient. (A) Patient able to stand without hands at baseline assessment. (B) Weight loss of 8 kg and unable to stand without lifter after sepsis and delirium. (C) Further loss of 17.5 kg, immobile after rib fracture, deconditioning and sedation. (D) Weight gain of 5 kg, patient walking with contact guard after intensive rehabilitation for 8 weeks. BL, baseline.\n\nThe patient was followed up 18 months after the study contact ceased, during which time no specific exercise was provided by the facility (2019). He had initially continued to walk with his wife’s support until he became too weak to stand with her assistance and was again wheelchair-bound. He was unable to stand even with assistance and had flexion contractures of both knees. He had lost all the weight that had been restored during the intervention period and weighed only 56.5 kg (17.5 kg/m2, malnourished), with severe wasting of all skeletal muscles. Superficial lacerations were present on limbs. He was alert and conversational and had no extrapyramidal or psychotic symptoms, although his MMSE had declined to 12/30, which was a similar score to when he was last at this body weight prior to intervention. His only regular medications were paracetamol, vitamin D and a laxative solution.\n\nCurrent care plan\nDeprescribing has been successfully implemented, and although the presence of malnutrition was documented and dietary supplements prescribed by the facility, the continued weight loss suggests that actual energy and protein intake are far below needs. Actual documentation of his nutrient intake is needed via analysis of food/nutrients provided, portion consumed and intake relative to his energy and protein needs for weight gain/anabolism using standard metabolic equations.33\n\nThe severe sarcopenia (low strength, SMM and functional mobility) he now manifests suggests that without robust anabolic exercise, this sarcopenia is insufficiently addressed by the deprescribing and nutritional supplementation. It should be noted that without anabolic exercise, nutritional supplements reduce habitual intake at meals, and thus do not actually augment total nutrient intake as anticipated.41 Thus, resistance training is the critical missing component needed for treatment of both sarcopenia and malnutrition.\n\nDiscussion\nThis is the first documented case of intensive progressive resistance training administered in a patient with DLB. The literature surrounding the effects of exercise is scarce and limited to several case reports,42 which evaluate aerobic, neuro-motor or functional training in clinically stable individuals. Additionally, this case provides a rare, longitudinal insight into the factors contributing to the rapid development of frailty in a patient with dementia in residential care and the key clinical assessments that guided effective rehabilitation.\n\nHowever, the rapid decline reported in this scenario is likely to be a common but poorly documented occurrence in aged care facilities due to the high prevalence of risk factors. For instance, dementia is present in approximately 60% of all residential care patients.43 One-third are sarcopenic,20 one-half are currently, or at-risk of malnutrition36 and over 60% are frail.44 Additionally, almost one-half of all residents are prescribed at least one potentially inappropriate medication, of which neuroleptics are the most common.45\n\nThis case highlights the concerning disparity between recommended optimal care for frailty and the reality of care for some patients in residential aged care facilities. The highest cause of accidental death in aged care facilities is falls, and as expected, the industry has evolved to prioritise safety and falls reduction. However, implementing immobilisation and restraints as a strategy to reduce falls further exacerbates the process of frailty, which is independently the most significant risk factor for falls.46 Furthermore, the healthcare costs for frail patients far exceed the cost of non-frail patients, which places further strain on service delivery within residential aged care facilities.47\n\nComprehensive geriatric assessment involving deprescribing, anabolic resistance training exercise and increased protein–energy intake are effective methods of mitigating the cycle of frailty.17 48 49 Importantly, withdrawal of anabolic interventions will likely precipitate a return to the previous level of functional decline. Extreme frailty is not a contraindication to comprehensive geriatric assessment and robust anabolic interventions. Conversely, it is one of the most important reasons to implement these treatment strategies.\n\nPatient’s perspective\nWhen my husband began to get worse, I felt like I was losing him. He was confused and upset, and his condition was bad. I would worry every time I would receive a call from the aged care facility, as I feared my husband might have injured himself once again. During this time, I felt like his quality of life was very poor. I couldn’t talk normally with him and could not take him out for a coffee or a meal. I was very scared for his future, he had lost that much weight and was always sleeping, and the staff at the facility had told me to prepare for the worst.\n\nA few days after his medications were removed, he was more awake and his humour and happiness came back. He began to know where he was, and it was beautiful to see him start doing the exercises to get him stronger and build muscle. Soon he was walking and we could get him into my car to drive him to the clinic, so he could do even more intense exercise. I even started training myself. My husband said that the exercise programme and walking again was a ‘wonderful experience’. I kept walking him every day after the intervention finished, even though the staff was hesitant. We only stopped when he started to lose muscle again, which made it harder for me to stand him on his own. It would be great to see him able to do the robust resistance exercises again as he did in the study, as I think it is the only thing that can keep him strong enough to walk. The biggest challenge is finding the right facility and professionals that know how to train my husband like those in the study.\n\nLearning points\nThis case highlights the concerning disparity between recommended optimal care for frailty and the reality of care for some patients in residential aged care facilities\n\nThe aetiology of frailty in dementia has many significant modifiable components that must be differentiated from the contributions of normal ageing and underlying disease.\n\nAnabolic interventions consisting of robust progressive resistance training, and increased energy and protein intakes are the most effective treatments for sarcopenia, malnutrition and frailty.\n\nDeprescribing in dementia when appropriate and observing patient condition offers an effective way of gauging iatrogenic contributions of polypharmacy to frailty, cognitive decline, sarcopenia and malnutrition.\n\nHighly clinically meaningful outcomes can be gained using resistance training in patients with advanced age, neurodegenerative disease and severe sarcopenia, including regaining of ambulatory status in previously immobilised, chair-restrained patients. However, withdrawal of anabolic exercise reverses these gains.\n\nContributors: MI and MAFS involved the conception of the work and acquisition and analysis of data. MI, YM, PSS and MAFS involved in the interpretation and drafting and editing the work; approved the final work and all agreed to be accountable for questions pertaining to accuracy and integrity of work.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: None declared.\n\nPatient consent for publication: Next of kin consent obtained.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n==== Refs\nReferences\n1 Morley JE , Vellas B , van Kan GA , et al \nFrailty consensus: a call to action\n. J Am Med Dir Assoc \n2013 ;14 :392 –7\n. 10.1016/j.jamda.2013.03.022 23764209 \n2 Morley JE , Perry III HM , Miller DK \nSomething about frailty\n. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences \n2002 ;57 :M698 –704\n.\n3 Mueller C , Molokhia M , Perera G , et al \nPolypharmacy in people with dementia: associations with adverse health outcomes\n. Exp Gerontol \n2018 ;106 :240 –5\n. 10.1016/j.exger.2018.02.011 29452289 \n4 Breitve MH , Brønnick K , Chwiszczuk LJ , et al \nApathy is associated with faster global cognitive decline and early nursing home admission in dementia with Lewy bodies\n. Alzheimers Res Ther \n2018 ;10 :83 . 10.1186/s13195-018-0416-5 30121084 \n5 Beck AM , Ovesen L \nInfluence of social engagement and dining location on nutritional intake and body mass index of old nursing home residents\n. J Nutr Elder \n2003 ;22 :1 –11\n. 10.1300/J052v22n04_01 \n6 McShane R , Keene J , Gedling K , et al \nDo neuroleptic drugs hasten cognitive decline in dementia? prospective study with necropsy follow up\n. BMJ \n1997 ;314 :266. 10.1136/bmj.314.7076.266 9022490 \n7 Morley JE , Thomas DR , Wilson M-MG \nCachexia: pathophysiology and clinical relevance\n. Am J Clin Nutr \n2006 ;83 :735 –43\n. 10.1093/ajcn/83.4.735 16600922 \n8 Roqué M , Salvà A , Vellas B \nMalnutrition in community-dwelling adults with dementia (NutriAlz trial)\n. J Nutr Health Aging \n2013 ;17 :295 –9\n. 10.1007/s12603-012-0401-9 23538648 \n9 Saczynski JS , Marcantonio ER , Quach L , et al \nCognitive trajectories after postoperative delirium\n. N Engl J Med \n2012 ;367 :30 –9\n. 10.1056/NEJMoa1112923 22762316 \n10 Wright L , Cotter D , Hickson M , et al \nComparison of energy and protein intakes of older people consuming a texture modified diet with a normal Hospital diet\n. J Hum Nutr Diet \n2005 ;18 :213 –9\n. 10.1111/j.1365-277X.2005.00605.x 15882384 \n11 Morley JE , Anker SD , von Haehling S \nPrevalence, incidence, and clinical impact of sarcopenia: facts, numbers, and epidemiology—update 2014 . Springer , 2014 .\n12 Collard RM , Boter H , Schoevers RA , et al \nPrevalence of frailty in community-dwelling older persons: a systematic review\n. J Am Geriatr Soc \n2012 ;60 :1487 –92\n. 10.1111/j.1532-5415.2012.04054.x 22881367 \n13 Kojima G \nPrevalence of frailty in nursing homes: a systematic review and meta-analysis\n. J Am Med Dir Assoc \n2015 ;16 :940 –5\n. 10.1016/j.jamda.2015.06.025 26255709 \n14 ACSQHC \nPreventing falls and harm from falls in older people . Commonwealth of Australia : Australian Commission on Safety and Quality in Healthcare , 2009 .\n15 Ibrahim JE , Bugeja L , Willoughby M , et al \nPremature deaths of nursing home residents: an epidemiological analysis\n. Med J Aust \n2017 ;206 :442 –7\n. 10.5694/mja16.00873 28566062 \n16 Joosten E , Demuynck M , Detroyer E , et al \nPrevalence of frailty and its ability to predict in hospital delirium, falls, and 6-month mortality in hospitalized older patients\n. BMC Geriatr \n2014 ;14 :1. 10.1186/1471-2318-14-1 24393272 \n17 Dent E , Lien C , Lim WS , et al \nThe Asia-Pacific clinical practice guidelines for the management of frailty\n. J Am Med Dir Assoc \n2017 ;18 :564 –75\n. 10.1016/j.jamda.2017.04.018 28648901 \n18 Singh NA , Quine S , Clemson LM , et al \nEffects of high-intensity progressive resistance training and targeted multidisciplinary treatment of frailty on mortality and nursing home admissions after hip fracture: a randomized controlled trial\n. J Am Med Dir Assoc \n2012 ;13 :24 –30\n. 10.1016/j.jamda.2011.08.005 21944168 \n19 Matusik P , Tomaszewski K , Chmielowska K , et al \nSevere frailty and cognitive impairment are related to higher mortality in 12-month follow-up of nursing home residents\n. Arch Gerontol Geriatr \n2012 ;55 :22 –4\n. 10.1016/j.archger.2011.06.034 21764151 \n20 Buchman AS , Yu L , Wilson RS , et al \nAssociation of brain pathology with the progression of frailty in older adults\n. Neurology \n2013 ;80 :2055 –61\n. 10.1212/WNL.0b013e318294b462 23635961 \n21 University of Sydney \nThe pride trial: promoting independence in Lewy body dementia through exercise\n, 2016 Available: https://www.anzctr.org.au/Trial/Registration/TrialReview.aspx?id=370405 [Accessed 04 Jun 2019 ].\n22 McKeith IG , Boeve BF , Dickson DW , et al \nDiagnosis and management of dementia with Lewy bodies: fourth consensus report of the DLB Consortium\n. Neurology \n2017 ;89 :88 –100\n. 10.1212/WNL.0000000000004058 28592453 \n23 McKeith IG , Dickson DW , Lowe J , et al \nDiagnosis and management of dementia with Lewy bodies: third report of the DLB Consortium\n. Neurology \n2005 ;65 :1863 –72\n. 10.1212/01.wnl.0000187889.17253.b1 16237129 \n24 Mueller C , Ballard C , Corbett A , et al \nThe prognosis of dementia with Lewy bodies\n. Lancet Neurol \n2017 ;16 :390 –8\n. 10.1016/S1474-4422(17)30074-1 28342649 \n25 Hanyu H , Sato T , Hirao K , et al \nDifferences in clinical course between dementia with Lewy bodies and Alzheimer's disease\n. Eur J Neurol \n2009 ;16 :212 –7\n. 10.1111/j.1468-1331.2008.02388.x 19146642 \n26 Roush JR , Gombold KL , Bay RC \nNormative grip strength values in males and females, ages 50 to 89 years old\n. Internet Journal of Allied Health Sciences and Practice \n2017 ;16 :7 .\n27 Janssen I , Heymsfield SB , Baumgartner RN , et al \nEstimation of skeletal muscle mass by bioelectrical impedance analysis\n. J Appl Physiol \n2000 ;89 :465 –71\n. 10.1152/jappl.2000.89.2.465 10926627 \n28 English KL , Paddon-Jones D \nProtecting muscle mass and function in older adults during bed rest\n. Curr Opin Clin Nutr Metab Care \n2010 ;13 :34 –9\n. 10.1097/MCO.0b013e328333aa66 19898232 \n29 Campins L , Camps M , Riera A , et al \nOral drugs related with muscle wasting and sarcopenia. A review\n. Pharmacology \n2017 ;99 :1 –8\n. 10.1159/000448247 27578190 \n30 Kaiser MJ , Bauer JM , Ramsch C , et al \nValidation of the mini nutritional assessment short-form (MNA®-SF): a practical tool for identification of nutritional status\n. The Journal of Nutrition, Health and Aging \n2009 ;13 :782 –8\n. 10.1007/s12603-009-0214-7 \n31 Morley JE , Argiles JM , Evans WJ , et al \nNutritional recommendations for the management of sarcopenia\n. J Am Med Dir Assoc \n2010 ;11 :391 –6\n. 10.1016/j.jamda.2010.04.014 20627179 \n32 Payne M , Morley JE \nEditorial: dysphagia, dementia and frailty\n. J Nutr Health Aging \n2018 ;22 :562 –5\n. 10.1007/s12603-018-1033-5 29717753 \n33 Gaffney-Stomberg E , Insogna KL , Rodriguez NR , et al \nIncreasing dietary protein requirements in elderly people for optimal muscle and bone health\n. J Am Geriatr Soc \n2009 ;57 :1073 –9\n. 10.1111/j.1532-5415.2009.02285.x 19460090 \n34 Marzola E , Nasser JA , Hashim SA , et al \nNutritional rehabilitation in anorexia nervosa: review of the literature and implications for treatment\n. BMC Psychiatry \n2013 ;13 :290. 10.1186/1471-244X-13-290 24200367 \n35 Olin AO , Osterberg P , Hådell K , et al \nEnergy-enriched Hospital food to improve energy intake in elderly patients\n. JPEN J Parenter Enteral Nutr \n1996 ;20 :93 –7\n. 10.1177/014860719602000293 8676539 \n36 Smoliner C , Norman K , Wagner K-H , et al \nMalnutrition and depression in the institutionalised elderly\n. Br J Nutr \n2009 ;102 :1663 –7\n. 10.1017/S0007114509990900 19622192 \n37 Wolf A , Leucht S , Pajonk F-G \nDo antipsychotics lead to cognitive impairment in dementia? A meta-analysis of randomised placebo-controlled trials\n. Eur Arch Psychiatry Clin Neurosci \n2017 ;267 :187 –98\n. 10.1007/s00406-016-0723-4 27530185 \n38 Bickel H , Gradinger R , Kochs E , et al \nHigh risk of cognitive and functional decline after postoperative delirium. A three-year prospective study\n. Dement Geriatr Cogn Disord \n2008 ;26 :26 –31\n. 10.1159/000140804 18577850 \n39 O'Mahony D , O'Sullivan D , Byrne S , et al \nSTOPP/START criteria for potentially inappropriate prescribing in older people: version 2\n. Age Ageing \n2015 ;44 :213 –8\n. 10.1093/ageing/afu145 25324330 \n40 Milne AC , Potter J , Vivanti A , et al \nProtein and energy supplementation in elderly people at risk from malnutrition\n. Cochrane Database Syst Rev \n2009 ;2 :CD003288 . 10.1002/14651858.CD003288.pub3 \n41 Manders M , de Groot CPGM , Blauw YH , et al \nEffect of a nutrient-enriched drink on dietary intake and nutritional status in institutionalised elderly\n. Eur J Clin Nutr \n2009 ;63 :1241 –50\n. 10.1038/ejcn.2009.28 19455176 \n42 Inskip M , Mavros Y , Sachdev PS , et al \nExercise for individuals with Lewy body dementia: a systematic review\n. PLoS One \n2016 ;11 :e0156520. 10.1371/journal.pone.0156520 27258533 \n43 Matthews FE , Dening T , UK Medical Research Council Cognitive Function and Ageing Study \nPrevalence of dementia in institutional care\n. Lancet \n2002 ;360 :225 –6\n. 10.1016/S0140-6736(02)09461-8 12133659 \n44 Theou O , Tan ECK , Bell JS , et al \nFrailty levels in residential aged care facilities measured using the frailty index and FRAIL-NH scale\n. J Am Geriatr Soc \n2016 ;64 :e207 –12\n. 10.1111/jgs.14490 27783396 \n45 Parsons C , Johnston S , Mathie E , et al \nPotentially inappropriate prescribing in older people with dementia in care homes: a retrospective analysis\n. Drugs Aging \n2012 ;29 :143 –55\n. 10.2165/11598560-000000000-00000 22204669 \n46 Thapa PB , Brockman KG , Gideon P , et al \nInjurious falls in nonambulatory nursing home residents: a comparative study of circumstances, incidence, and risk factors\n. J Am Geriatr Soc \n1996 ;44 :273 –8\n. 10.1111/j.1532-5415.1996.tb00913.x 8600195 \n47 Bock J-O , König H-H , Brenner H , et al \nAssociations of frailty with health care costs--results of the ESTHER cohort study\n. BMC Health Serv Res \n2016 ;16 :128. 10.1186/s12913-016-1360-3 27074800 \n48 Fiatarone MA , O'Neill EF , Ryan ND , et al \nExercise training and nutritional supplementation for physical frailty in very elderly people\n. N Engl J Med \n1994 ;330 :1769 –75\n. 10.1056/NEJM199406233302501 8190152 \n49 Turner G , Clegg A , British Geriatrics Society , et al \nBest practice guidelines for the management of frailty: a British geriatrics Society, age UK and Royal College of general practitioners report\n. Age Ageing \n2014 ;43 :744 –7\n. 10.1093/ageing/afu138 25336440\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1757-790X", "issue": "13(4)", "journal": "BMJ case reports", "keywords": "general guidance on prescribing; geriatric medicine; memory disorders; nutrition; sports and exercise medicine", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000058:Accidental Falls; D000369:Aged, 80 and over; D000069340:Deprescriptions; D003937:Diagnosis, Differential; D005081:Exercise Therapy; D016330:Frail Elderly; D006801:Humans; D020961:Lewy Body Disease; D008297:Male; D044342:Malnutrition; D055948:Sarcopenia", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "32341088", "pubdate": "2020-04-26", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "30121084;18577850;28566062;27530185;27578190;29452289;16237129;29717753;28592453;22881367;23538648;16600922;24200367;26255709;21944168;21764151;19370584;27258533;27074800;23635961;25324330;25425503;27783396;19455176;12133659;19622192;22204669;9022490;19460090;23764209;19812868;8676539;25336440;20627179;19146642;15882384;12403796;22762316;28342649;8600195;10926627;19898232;28648901;24393272;8190152", "title": "Interrupting the trajectory of frailty in dementia with Lewy bodies with anabolic exercise, dietary intervention and deprescribing of hazardous medications.", "title_normalized": "interrupting the trajectory of frailty in dementia with lewy bodies with anabolic exercise dietary intervention and deprescribing of hazardous medications" }
[ { "companynumb": "AU-ALVOGEN-2020-ALVOGEN-113674", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "ATORVASTATIN" }, "drugadditional": "1", ...
{ "abstract": "Ipilimumab is a standard therapy for advanced melanoma. Severe immune related adverse events occur in up to 30% of patients and require treatment with immunosuppressants such as steroids or the anti-TNFα antibody, infliximab. We describe two patients with advanced melanoma treated with ipilimumab. Both suffered from severe immune related side effects and required prolonged immunosuppression with steroids and/or infliximab. Both patients recovered and in spite of the immune suppression, demonstrate clinical evidence of tumor control. This argues that distinct immunological effector functions control nosocomial infection and tumor, respectively. To our knowledge, these are also the first two case reports of pneumocystis pneumonia in this setting.", "affiliations": "Cancer Sciences Unit; University of Southampton and University Hospital Southampton NHS Foundation Trust ; Southampton, UK ; University Hospital Southampton NHS Foundation Trust ; Southampton, UK ; Southampton Experimental Cancer Medicine Center; University of Southampton and University Hospital Southampton NHS Foundation Trust ; Southampton, UK.;University Hospital Southampton NHS Foundation Trust ; Southampton, UK ; Southampton Experimental Cancer Medicine Center; University of Southampton and University Hospital Southampton NHS Foundation Trust ; Southampton, UK.;University Hospital Southampton NHS Foundation Trust ; Southampton, UK.;University Hospital Southampton NHS Foundation Trust ; Southampton, UK.;University Hospital Southampton NHS Foundation Trust ; Southampton, UK.;Cancer Sciences Unit; University of Southampton and University Hospital Southampton NHS Foundation Trust ; Southampton, UK ; University Hospital Southampton NHS Foundation Trust ; Southampton, UK ; Southampton Experimental Cancer Medicine Center; University of Southampton and University Hospital Southampton NHS Foundation Trust ; Southampton, UK.", "authors": "Arriola|Edurne|E|;Wheater|Matthew|M|;Krishnan|Radhika|R|;Smart|James|J|;Foria|Vipul|V|;Ottensmeier|Christian|C|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1080/2162402X.2015.1040218", "fulltext": null, "fulltext_license": null, "issn_linking": "2162-4011", "issue": "4(10)", "journal": "Oncoimmunology", "keywords": "immunosuppression; infliximab; ipilimumab; melanoma; opportunistic; pneumocystis; pneumonia; steroids", "medline_ta": "Oncoimmunology", "mesh_terms": null, "nlm_unique_id": "101570526", "other_id": null, "pages": "e1040218", "pmc": null, "pmid": "26451305", "pubdate": "2015-10", "publication_types": "D016428:Journal Article", "references": "17982122;24451730;24991413;16670323;23622345;9151783;25232180;20525992;19507029;25420451;23774827;25428503;15504255;17916444;21224015", "title": "Immunosuppression for ipilimumab-related toxicity can cause pneumocystis pneumonia but spare antitumor immune control.", "title_normalized": "immunosuppression for ipilimumab related toxicity can cause pneumocystis pneumonia but spare antitumor immune control" }
[ { "companynumb": "GB-JNJFOC-20150911824", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "IPILIMUMAB" }, "drugadditional": null, ...
{ "abstract": "Serious neurological adverse events have been reported from large scale community-based ivermectin treatment campaigns against Onchocerciasis volvulus in Africa. The mechanism of these events has been debated in the literature, largely focusing on the role of concomitant infection with Loa loa versus the presence of mdr-1 gene variants in humans allowing ivermectin penetration into the central nervous system. A case series of serious neurological adverse events occurring with the use of ivermectin outside of the onchocerciasis indication has been identified in VigiBase, an international database of suspected adverse drug reactions. Forty-eight cases have been reported from multiple countries in which ivermectin has been prescribed for multiple indications; clinical review excluded 20 cases with more probable explanations or other exclusion criteria. Within the remaining 28 cases, there is supportive evidence for a causative role of ivermectin including presence of the drug in brain tissue in one case and recurrence of symptoms on repeated exposure in three cases. This series suggests that serious neurological adverse events observed with the use of ivermectin in the treatment of onchocerciasis may not be entirely explained by concomitant high burden loiasis infections. By comparison with the extensive post marketing experience with ivermectin in the successful treatment of parasitic infections, the number of reported cases suggests that such events are likely rare. However, elucidation of individual-level risk factors could contribute to therapeutic decisions that can minimize harms. Further investigation into the potential for drug-drug interactions and explorations of polymorphisms in the mdr-1 gene are recommended.", "affiliations": "Uppsala Monitoring Centre, Uppsala, Sweden.", "authors": "Chandler|Rebecca E|RE|", "chemical_list": "D007559:Ivermectin", "country": "United States", "delete": false, "doi": "10.4269/ajtmh.17-0042", "fulltext": "\n==== Front\nAm J Trop Med HygAm. J. Trop. Med. HygtpmdtropmedThe American Journal of Tropical Medicine and Hygiene0002-96371476-1645The American Society of Tropical Medicine and Hygiene 29210346tpmd17004210.4269/ajtmh.17-0042ArticlesSerious Neurological Adverse Events after Ivermectin—Do They Occur beyond the Indication of Onchocerciasis? Chandler Rebecca E. *Uppsala Monitoring Centre, Uppsala, Sweden* Address correspondence to Rebecca E. Chandler, Uppsala Monitoring Centre, Uppsala, Sweden. E-mail: rebecca.chandler@who-umc.orgFinancial support: This study was funded entirely by the Uppsala Monitoring Centre.\n\nAuthor’s address: Rebecca Chandler, Uppsala Monitoring Centre, Uppsala, Sweden, E-mail: rebecca.chandler@who-umc.org.\n\n2 2018 04 12 2017 04 12 2017 98 2 382 388 17 1 2017 03 10 2017 © The American Society of Tropical Medicine and Hygiene2018This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Abstract.\nSerious neurological adverse events have been reported from large scale community-based ivermectin treatment campaigns against Onchocerciasis volvulus in Africa. The mechanism of these events has been debated in the literature, largely focusing on the role of concomitant infection with Loa loa versus the presence of mdr-1 gene variants in humans allowing ivermectin penetration into the central nervous system. A case series of serious neurological adverse events occurring with the use of ivermectin outside of the onchocerciasis indication has been identified in VigiBase, an international database of suspected adverse drug reactions. Forty-eight cases have been reported from multiple countries in which ivermectin has been prescribed for multiple indications; clinical review excluded 20 cases with more probable explanations or other exclusion criteria. Within the remaining 28 cases, there is supportive evidence for a causative role of ivermectin including presence of the drug in brain tissue in one case and recurrence of symptoms on repeated exposure in three cases. This series suggests that serious neurological adverse events observed with the use of ivermectin in the treatment of onchocerciasis may not be entirely explained by concomitant high burden loiasis infections. By comparison with the extensive post marketing experience with ivermectin in the successful treatment of parasitic infections, the number of reported cases suggests that such events are likely rare. However, elucidation of individual-level risk factors could contribute to therapeutic decisions that can minimize harms. Further investigation into the potential for drug–drug interactions and explorations of polymorphisms in the mdr-1 gene are recommended.\n==== Body\nINTRODUCTION\nIvermectin is a member of the class of avermectins, which are highly active broad-spectrum, anti-parasitic agents. It is indicated for use in the treatment of strongyloidiasis (Strongyloides stercoralis) and onchocerciasis (Onchocerca volvulus).1 It is also commonly used to treat scabies, although usage patterns for this indication vary between countries. In the scabies indiciation, it is approved for first-line therapy in some countries (within Europe), second-line therapy in others (such as Australia), or only recommended for special circumstances, such as immunocompromised or institutionalized patients or when topical therapy has failed (the United States).2–4 Furthermore, it has been suggested for use in the treatment of head lice given the recent increase in the burden of this condition in the developed world.5 Ivermectin is not thought to readily cross the blood-brain barrier in humans as it is excluded by a P-glycoprotein drug pump (mdr-1).6 Therefore, it has been considered to be free of the potential to cause neurological adverse drug reactions, except in situations of overdose.7,8\n\nSerious neurological adverse events were initially reported in public health programs in Africa to eliminate onchocerciasis through community-based ivermectin treatment; cases of encephalopathy and coma were reported in Cameroon and the Democratic Republic of Congo in persons who concomitantly harbored high densities of another filarial species, Loa loa. Subsequent analyses revealed a correlation between pre-ivermectin treatment L. loa microfilarial density and the risk of developing a serious neurological adverse event.9,10 The mechanism of these events has been debated in the literature, largely focusing on the role of concomitant high burden infection with L. loa versus the presence of mdr-1 gene variants in humans allowing ivermectin penetration into the central nervous system (CNS).11,12\n\nStatistical signal detection screening of the VigiBase, a global database of individual case safety reports (reports) of adverse events for the WHO program for International Drug Monitoring, is performed on a periodic basis. During a screening designed to be sensitive to reports from Africa, Asia, Latin America, and the Caribbean, a serious report of ataxia from the Democratic Republic of Congo was identified which stated: “This patient …realises these conditions [encephalopathy]. It is very surprising to notice that there were no microfilariae in the calibrated thick blood smear.” The lack of evidence of a high density of L. loa in the blood smear appeared to challenge the literature on serious neurological adverse events after ivermectin, and it therefore triggered a review of all reports of such events for ivermectin beyond the indication of use for onchocerciasis.\n\nMETHODS\nThe data source was VigiBase, a computerized pharmacovigilance system in which reports describing adverse events are recorded in a structured, hierarchical form. Reports are received from national pharmacovigilance centers in the 125 countries participating in the WHO Program for International Drug Monitoring.13 All reports for ivermectin received into VigiBase up to November 27, 2016, were identified for use in this investigation. All analyses were performed on adverse event data using the Medical Dictionary for Regulatory Activities (MedDRA®) System Organ Class (SOC) and Preferred Term-level terminology.\n\nRESULTS\nA total of 1,668 reports for ivermectin were identified. The most commonly reported adverse events for ivermectin were pruritus (25.3%), headache (13.9%), and dizziness (7.5%). Under the MedDRA SOC “Neurological disorders,” there were a total of 426 reports; 156 of these were classified as “serious” according to ICH Guidance.14 Of the serious reports, 60.9% (95) originated from Africa, 20.5% (32) from the Americas, 12.2% (19) from Europe, and 6.4% (10) from Asia. One duplicate report was identified and excluded from the analysis.\n\nSixty-four of the 155 serious reports described the use of ivermectin for O. volvulus. Forty-two reports did not include an indication; one reported only “infection parasitic.” The remaining 48 reports underwent clinical review, and twenty reports were further excluded from this analysis. Reasons for exclusion were neurological adverse events reported in the context of other clinical syndromes (lactic acidosis/circulatory collapse, cerebral infarction/cerebral artery embolism, neuroleptic malignant syndrome, hepatitis/hepatic failure, brain cancer, pneumonia with hypotension, accidental exposure to product, sepsis complicating chemotherapy, multi-organ failure, history of epilepsy, and Alzheimer’s disease), topical ivermectin for rosacea, prolonged time to onset of events in comparison with the known half-life of ivermectin (14 days and 8 years), and unclear onset of symptoms in relation to ivermectin.\n\nThe remaining 28 reports are included in this case series (Table 1). The cases were received from the United States, France, Japan, the Netherlands, Germany, Canada, and Sierra Leone. The patient ages were included in 25 reports and ranged from 11 to 97 years. Fourteen reports described adverse events in males, 13 in females, and the gender was not provided in one report. Scabies was included as an indication in 10 reports, acarodermatitis (within the MedDRA terminology, acarodermatitis may be used to indicate any of the following terms: acarodermatitis, Norwegian scabies, Sarcoptes scabeii infestation, scabies, and scabies infestation) in eight, filariasis due to Wucheria bancrofti in five, strongyloidiasis in three, teniasis in one, and myiasis in one. The time to onset of the serious neurological events ranged from hours to 7 days, with 14 cases noting a time to onset of 1 day or less. Examples of serious neurological adverse events reported included such terms as unable to walk, consciousness disturbed or depressed level of consciousness or loss of consciousness, seizure or convulsion, encephalopathy or coma, and tremor. The reported dosages of ivermectin ranged between 3 and 24 mg. Most of the cases reported a one-time dose or two doses separated by 1 week. Weight information was provided for most of the cases, and there was no suggestion of overdose based on the data provided. Nine reports documented a positive dechallenge, with resolution of symptoms after discontinuing ivermectin without further intervention. Three reports documented a positive rechallenge, with recurrence of symptoms with re-exposure to ivermectin, including one case with repeated symptoms on three separate treatment courses with ivermectin. Concomitant medications were reported in 20 cases. In nine of the cases, the drugs co-administered with ivermectin were also reported to be “suspected” for the described adverse drug reactions, including oxatomide, piperonyl butoxide/esdepallethrime (topical), darunavir and ritonavir, terbinafine, and albendazole. Eight cases reported concomitant drugs with known CNS effects, including antidepressants, antipsychotics, benzodiazepines, and anticonvulsants; however, in none of these cases were the concomitant CNS-acting agents considered to be “suspected.”\n\nTable 1 Case series describing serious neurological adverse events after treatment with ivermectin beyond the onchocerciasis indication\n\nCase\tAge/sex\tIndication\tDose\tWeight (kg)\tOther suspect (S) or concomitant (C) medications\tReported adverse event terms\tTime to onset\tAdditional info\t\n1\t11/F\tScabies\t9 mg\t40\t–\tEncephalopathy, coma, emesis\t1 day\tRecovered. Positive dechallenge. Presented with depressed level of consciousness, without evidence of fever or hypoglycaemia. Glasgow coma scale 9. Naloxone given without effect. LP, EEG, and MRI all performed and negative. Multiple cultures and serologies negative.\t\n2\t28/M\tScabies\t18 mg\t–\t–\tConfusional state, amnesia, malaise, emesis\t1 day\tRecovered. Similar symptoms reported twice in the past after ivermectin. Presented with confusional state, Glasgow coma scale 13. Neurological exam negative.\t\n3†\t24/M\tScabies\t3 mg\t–\tOxatomide (S)\tConfusion, convulsive disorder cephalgia, fatigue, fall\t0 day\tRecovered. Patient presented with headache, fatigue and fall. Sent to hospital. Sleepy but awake, opened eyes to pain. No evidence of tongue biting, urinary incontinence. Normal neurological exam, normal CT. No previous history of neurological disease.\t\n4\t18/M\tScabies infestation\t15 mg\t79\t–\tLightheadedness, headache, unable to walk\t1 day\t“Patient developed headache and dizziness to the point of being unable to walk.” Positive dechallenge Recovered in 24 hours.\t\n5\t32/F\tScabies\t24 mg\t109\t–\tTremor, dizzy spells, mucosal dryness, abdominal pain lower\t8 hours\t–\t\n6\t14/M\tScabies\t1 DF*, 1 per 1 day\t–\tPiperonyl butoxide/esdepallethrime (topical) (S)\tDizziness, crying abnormal, monoparesis, tremor, rigors, chills\t10 hours\tRecovered. Positive dechallenge\t\n7\t48/F\tScabies\t9 mg day 0, 9 mg day 7\t68\tPiperonyl butoxide/esdepallethrime (topical) (S)\tMuscle weakness, hypoaesthesia, paraesthesia\t–\tRecovered. Symptoms occurred after each dose of ivermectin and topical piperonyl butoxide. Lasted 20–40 minutes. Was unable to speak.\t\n8\t33/M\tScabies\t12 mg\t65\tDarunavir, ritonavir (both S)\tConvulsions generalized\t1 day\tRecovered. Positive dechallenge with all 3 drugs. Patient had started darunavir 12 months prior and ritonavir 8 days prior. Head scan normal.\t\n9†\t–/M\tScabies infestation\t12 mg\t70\tRanitidine, amantidine, trazadone, lorazepam, haloperidol, toprimate, hydroxyzine, risperidone (all C)\tConfusional state, unconsciousness\t–\t–\t\n10\t81/M\tScabies\t3 mg\t–\t–\tCerebellar syndrome, mental confusion, MRI abnormal\t1–2 days\tDrug withdrawn, no effect observed. Patient with altered state of consciousness, aggression, confusion. Exam revealed thrombocytopenia, eosinophilia, dehydration and renal failure. MRI abnormal 2 weeks after dosing.\t\n11†\t58/F\tAcarodermatitis\t12 mg\t60\tAlprazolam, Etizolam (both C)\tConsciousness disturbed\t0 day\tPositive dechallenge. Recovered within 8 days. No dates of use for alprazolam or etizolam provided.\t\n12†\t51/M\tAcarodermatitis\t18 mg day 0, 18 mg day 7\t79\tPregabalin, lamotrigine, aripiprazole, meloxicam, simvastatin, docusate (all C)\tAbasia, aphasia, blindness, disease recurrence\t–\tPositive rechallenge\t\n13\t54/F\tAcarodermatitis\tTwo “pills” day 0, two “pills” day 7\t68\t–\tConvulsion, local swelling, nausea, headache, heart rate increased, confusional state\t–\t–\t\n14\t81/M\tAcarodermatitis\t9 mg\t50\tRivastigmine, memantine, lornoxicam, troxipide (all C)\tTremor, pyrexia\t0 day\tPositive dechallenge\t\n15†\t–/–\tAcarodermatitis\t–\t–\tValproic acid, levetiracetam (both C)\tSeizure, off label use\t–\tNo dates of use provided for any of the reported medicines. Only ivermectin reported as “suspected.”\t\n16\t81/F\tAcarodermatitis\t12 mg day 0, 12 mg day 7\t–\tDigoxin, rebamipide, crotamiton, magnesium oxide, senna (all C)\tDepressed level of consciousness, vomiting, asphyxia, pruritus aggravated, skin eruption\t5 days after last dose\tDied, 5 days after last dose from the events of depressed level of consciousness and asphyxia. Digoxin initiated 1 day prior to death.\t\n17†\t56/F\tAcarodermatitis\t12 mg\t55\tTerbinafine (S), dexlansoprazole, milnacipran, gabapentin, promethazine, meloxicam, trazadone, levothyroxine, propranolol, Lisinopril, predinose, azathioprine, diazepam, nortriptyline, lansoprazole, amoxicillin, furosemide, hydrochloroquine, vitamin D, vitamins (all C)\tAphasia, somatic delusion abnormal faeces, alopecia, dry mouth, dyspnoea, ear infection, flushing, gastrointestinal motility disorder, headache, heart rate increased, lip swelling, musculoskeletal discomfort, oral discomfort, red blood cell count decreased, swollen tongue, urine color abnormal, urine odor abnormal, weight decreased white blood cell count decreased\t2–5 days for aphasia and somatic delusion\tDrug withdrawn, no effect observed\t\n18\t97/F\tAcarodermatitis\t9 mg day 0, 9 mg day 7\t47\tFebuxostat, furosemide, lansoprazole, sennoside a + b, magnesium oxide, carbocisteine, etizolam (all C)\tDepressed level of consciousness, loss of consciousness, vomiting\t6 days after 1st dose and 5 days after 2nd dose\tRecovered. Positive dechallenge\t\n19\t64/M\tStrongyloidiasis\t12 mg oral then subcutaneous\t57\t–\tComa, neurotoxicity\t–\tDrug withdrawn, fatal outcome. Tx initiated for Strongyloides stercoralis infection in patient on prednisone for giant cell arteritis. Patient was s/p aortic valve replacement. Ivermectin levels measured in brain tissue at autopsy (30 ng/g). None of the most common polymorphisms in mdr-1 present.\t\n20†\t59/F\tStrongyloidiasis Nematodiasis\t21 mg day 0, 21 mg day 1\t100\tLevothyroxine, olopatadine, vitamines, omega-3, melatonin, ascorbic acid, formoterol/budesonide doxycycline, potassium citrate, pioglitazone, probiotics, vitamin D, prasterone, progesterone, colesevelam, montelukast. desvenlafaxine (all C)\tPain in jaw, tremor chest pain, chills back pain, tachycardia, dyspnoea, loss of consciousness, pain in extremity, thinking abnormal, peripheral coldness, hypersomnia, dizziness, asthenia, feeling abnormal, palpitations, paraesthesia, fatigue, blood potassium decreased, dysgeusia, constipation, muscle twitching, sedation, vertigo, sensation of heaviness, feeling cold, mood altered, feeling drunk, oropharyngeal pain, coxsackie virus test positive, inappropriate schedule of drug administration, orthostatic hypotension, neuralgia,affect lability, hypertension, asthma, confusional state, cough, nystagmus, headache, pyrexia, somnolence\t1–2 days\tDrug withdrawn, no effect observed.\t\n21\t–/M\tStrongyloidiasis\t18 mg day 0, 18 mg day 1\t86\t–\tQuality of life decreased, sleep disorder\t–\t–\t\n22\t28/M\tFilariasis due to Wuchereria bancrofti\t12 mg\t–\tAlbendazole (S), diclofenac, amoxicillin (both C)\tUnconsciousness\t0 day\tRecovered. Gastric lavage. Patient concomitantly treated for Ascariasis\t\n23\t36/M\tFilariasis due to Wuchereria bancrofti\t12 mg\t–\tAlbendazole (S)\tHeadache, vomiting, diarrhea, abdominal discomfort\t1 day\tRecovered Patient concomitantly treated for Ascariasis\t\n24\t43/F\tFilariasis due to Wuchereria bancrofti\t9 mg\t–\tAlbendazole (S)\tHeadache, dizziness, vomiting\t2 days\tRecovered Patient concomitantly treated for Ascariasis\t\n25\t11/F\tFilariasis due to Wuchereria bancrofti\t9 mg\t–\tAlbendazole (S)\tHeadache, Dizziness, Vomiting\t0 day\tRecovered Patient concomitantly treated for Ascariasis\t\n26\t72/M\tFilariasis due to Wuchereria bancrofti\t12mg\t–\tAlbendazole (S)\tHeadache, abdominal discomfort, itching vomiting, oedema\t0 day\tRecovered Patient concomitantly treated for Ascariasis\t\n27\t–/F\tMyiasis\t12 mg\t–\t–\tSeizure, off label use\t–\tNot recovered\t\n28\t75/F\tTaeniasis\t6 mg\t59\tLisinopril, amlodipine, metoprolol, clopidogrel (all C)\tAsthenia, dizziness, dyspnoea, paraesthesia, vision decreased\t0 day\tRecovered with sequelae\t\nEEG = electroencephalogram; LP = lumbar puncture; MRI = magnetic resonance imaging.\n\n* DF = dosage form; for ivermectin, 1 dosage form = 3 g.\n\n† Cases with concomitant medications with central nervous system effects.\n\nTwo patients had a fatal outcome reported. One died of asphyxia 5 days after a dose of ivermectin (case 16). The other fatal case has been previously published and documented the presence of ivermectin in brain tissue: “A 64-year-old male with a past medical history of giant cell arteritis, treated with prednisone developed sepsis, complicated by multisystem organ failure, after an aortic valve replacement. Sputum culture revealed S. stercoralis. A diagnosis of S. stercoralis hyperinfection syndrome was made; he was initiated on ivermectin 12 mg every 48 hours. He received three oral doses followed by two subcutaneous doses. In spite of clinical and microbiological improvement, the patient remained in a vegetative state and died on day 25. Autopsy revealed an elevated level of ivermectin in the brain tissue, 14 days after the last dose”15 (case 19).\n\nDISCUSSION\nFrom a global database of suspected adverse drug reactions we have identified a case series describing serious neurological adverse events with the use of ivermectin beyond its indication for O. volvulus. Supportive evidence for a causative role of ivermectin was found with the identification of ivermectin in brain tissue in one case and recurrence of symptoms on repeated exposure to ivermectin in three cases. This case series suggests that the serious neurological adverse events observed with the use of ivermectin in the treatment of onchocerciasis cannot be entirely explained by concomitant high burden loiasis infections.\n\nIvermectin exhibits poor penetration of the blood-brain barrier of vertebrate animals due to the presence of a drug-transporting p-glycoprotein.6 However, studies in knockout mice for the p-glycoprotein encoding gene, mdr-1, displayed levels of ivermectin in the brain which were 90-fold greater than normal mice.16 Furthermore, it is well established in the veterinary world that certain breeds of dogs, such as collies, are sensitive to the neurotoxic effects of ivermectin as a loss of function in the mdr-1 gene in these breeds allows for an accumulation of ivermectin within the brain.17 Symptoms of neurotoxicity include lethargy, drooling, tremors/seizures, inability to stand, disorientation, and coma.\n\nSerious neurological events in humans, such as encephalopathy, confusion, stupor, or coma, after ivermectin were initially observed in campaigns to treat O. volvulus in African countries. Co-infection with L. loa was found to be a risk factor for the development of these reactions, and the product label recommends posttreatment follow up for patients who have been in L. loa endemic areas of West and Central Africa.9,10 Furthermore, there have also been published concerns raised regarding the safety of use of ivermectin in the treatment of elderly patients with scabies.18,19 A study investigating escalating high doses of ivermectin in healthy adults was performed to explore the safety of its use in the treatment of head lice. The authors documented no evidence of CNS toxicity in doses up to 10 times the highest FDA-approved dose of 200 µg/kg. However, the study population was limited to a total of 68 subjects, almost 90% of which were of Hispanic origin.20 Drug safety surveillance for idiosyncratic reactions has been recommended.19\n\nThe product label for ivermectin notes that the neurological events of dizziness (2.8%), somnolence (0.9%), vertigo (0.9%), and tremor (0.9%) were observed in human clinical trials for the treatment of strongyloidiasis and assessed as at least possibly related to ivermectin, whereas drug-related headache (0.2%) was observed in trials for onchocerciasis. The label further includes warnings for the occurrence of serious neurological adverse events in the contexts of concomitant infection of onchocerciasis and loiasis and accidental intoxication with veterinary formulations of ivermectin.1 Although some of the adverse events experienced by subjects in this case series were observed in clinical trials (dizziness, headache), there were other events of a more serious nature which are suggestive of ivermectin penetration into the brain: loss of consciousness/depressed level of consciousness, abasia, tremor, vomiting, and coma.\n\nClinical review of the cases within this case series has focused largely on three important confounders: co-administered drugs with known CNS effects, overdosing, and evidence of secondary impairment of the blood-brain barrier. A number of cases report co-administered drugs with known CNS-effects, such as antihistamines (case 3), antidepressants/antipsychotics (cases 9 and 20), anxiolytics, and/or antiepileptics (cases 9, 11, 12, 15, and 17). In only case 3 was the concomitant drug reported as “suspected” as a potential cause of the reported adverse events. Further assessment of the other cases is complicated by lack of information on the treatment courses of drugs which were not “suspected.” However, in one case (case 11) the symptoms apparently resolved when ivermectin was discontinued (“positive dechallenge”), and in another (case 12) the events recurred with repeated dosing of ivermectin (“positive rechallenge”). Five cases noted concomitant administration of albendazole whose package insert describes both headache and dizziness as possible adverse drug reactions (cases 22–26); in all cases, albendazole was considered also to be “suspected.” In case 22, however, the reported adverse event of “unconsciousness” would not be an expected event from this additional anti-parasitic agent. There was no evidence of overdosing in any of the cases upon review of dosage recommendations and weight data provided in the case reports. Obvious evidence of blood-brain barrier insufficiency, such as sepsis or malignancy, resulted in exclusion from the final case list; however, it is possible that there remain cases in the case series in which the blood-brain barrier has been weakened by the indication for ivermectin, such as strongyloidiasis (case 19).\n\nA number of cases included in the final case series may be related to drug–drug interactions. Drugs that are substrates of CYP3A4 enzymes are often also substrates for P-glycoprotein transport, and thus there may be a risk of increased absorption past the blood-brain barrier with concomitant ivermectin administration.21 Several cases presented here reported concomitant use of such drugs, such as statins (case 12), HIV protease inhibitors (case 8), calcium channel blockers (case 28), and benzodiazepines (cases 9, 11, 17, 18). A recent publication documents evidence of an in vitro interaction of ivermectin and a number of antiretroviral agents.22 Current labeling for ivermectin contains no warning for co-administration with CYP3A4 substrates.\n\nAnother possible explanation is that some humans experiencing serious neurological adverse events after ivermectin therapy may have mutations in the mdr-1 gene, allowing for penetration of ivermectin into the CNS. More than 50 naturally occurring single nucleotide polymorphisms (SNPs) have been identified in the mdr-1 gene; the majority of these SNP are silent, and there is no current evidence of a mutation that results in loss of function. However, various combinations of these SNPs, composing different P-glycoprotein haplotypes, have been found to exhibit reduced mdr-1 expression.23 Bourguinat et al.24 analyzed mdr-1 genotypes in 13 subjects from Cameroon: four who experienced a serious adverse event and nine who did not. Haplotypes associated with altered drug disposition were present as homozygotes in two of the patients experiencing serious adverse events and in none of the control patients. One of the cases in our series was investigated for the most common polymorphisms associated with decreased mdr-1 expression and found that none were present; however, further details were not provided.15\n\nLimitations of spontaneous adverse event reports are that they are come from both voluntary and regulated sources, a suspicion that the reported drug caused the event may or may not be present, and the amount of information included in the report is variable. Detection of “signals” in these types of databases is intended to be hypothesis-generating rather than evidence of causality.\n\nIn conclusion, there is evidence that serious neurological adverse events can occur with ivermectin beyond the treatment of O. volvulus complicated by concomitant high burden L. loa infection. Potential explanations include concomitantly administered drugs which inhibit CYP3A4 and polymorphisms in the mdr-1 gene. By comparison with the extensive post marketing experience with ivermectin in the successful treatment of parasitic infections, the total number of reported cases suggests that such events are likely rare. However, elucidation of individual-level risk factors could contribute to therapeutic decisions that can minimize harms. Further investigation into the potential for drug interactions and explorations of polymorphisms in the mdr-1 gene are recommended.\n\nAcknowledgment:\nI would like to acknowledge all of the member countries participating in the WHO Programme for International Drug Monitoring who have contributed the individual case safety reports included in this analysis. However, the opinions and conclusions are not necessarily those of the various centres or of the WHO. I also thank Jenny Hartman of the Netherlands Pharmacovigilance Centre Lareb as well as Kristina Star and Pia Caduff-Janosa, both of the Uppsala Monitoring Centre, for their thoughtful comments and critique of this manuscript.\n==== Refs\nREFERENCES\n1. Merck Sharp and Dohme BV , 2010 \nStromectol (ivermectin) Package Insert . Available at: https://www.merck.com/product/usa/pi_circulars/s/stromectol/stromectol_pi.pdf. Accessed September 21, 2017. \n2. No authors listed , 2002 \nIvermectin: new indication. Oral treatment of scabies: simple and effective . Prescrire Int \n11 : 137 –140 .12378743 \n3. NPSMedicineWise , 2014 \nInvermectin (Stromectol) for Typical and Crusted Scabies . Available at: https://www.nps.org.au/radar/articles/ivermectin-stromectol-for-typical-and-crusted-scabies. Accessed October 1, 2017 .\n4. Fawcett RS , 2003 \nIvermectin use in scabies . Am Fam Physician \n68 : 1089 –1092 .14524395 \n5. Chosidow O Giraudeau B Cottrell J Izri A Hofmann R Mann SG Burgess I , 2010 \nOral ivermectin versus malathion lotion for difficult-to-treat head lice . N Engl J Med \n362 : 896 –905 .20220184 \n6. Cordon-Cardo C O’Brien JP Casals D Rittman-Grauer L Biedler JL Melamed MR Bertino JR , 1989 \nMulti-drug resistance gene (P-glycoprotein) is expressed by endothelial cells at blood-brain barrier sites . Proc Natl Acad Sci USA \n86 : 695 –698 .2563168 \n7. Chung K Yang CC Wu ML Deng JF Tsai WJ , 1999 \nAgricultural avermectins: an uncommon but potentially fatal cause of pesticide poisoning . Ann Emerg Med \n34 : 51 –57 .10381994 \n8. Yang CC , 2012 \nAcute human toxicity of macrocyclic lactones . Curr Pharm Biotechnol \n13 : 999 –1003 .22039794 \n9. Boussinesq M Gardon J Gardon-Wendel N Chippaux JP , 2003 \nClinical picture, epidemiology, and outcome of Loa-associated serious adverse events related to mass ivermectin treatment of onchocerciasis in Cameroon . Filaria J \n2 (Suppl 1 ): S4 .14975061 \n10. Gardon J Gardon-Wendel N Demanga-Ngangue Kamguo J Chippaux JP Boussinesq M , 1997 \nSerious reactions after mass treatment of onchocerciasis with ivermectin in an area endemic for Loa loa infections . Lancet \n350 : 18 –22 .9217715 \n11. Geary TG , 2005 \nIvermectin 20 years on: maturation of a wonder drug . Trends Parasitol \n21 : 530 –532 .16126457 \n12. Boussinesq M Kamguo J Pion SD Gardon J , 2006 \nWhat are the mechanisms associated with post-ivermectin serious adverse events? \nTrends Parasitol \n22 : 244 –246 .16632406 \n13. Lindquist M , 2008 \nVigibase, the WHO global ICSR database system: basic facts . Drug Inf J \n42 : 409 –419 .\n14. ICH Expert Working Group , 2003 \nIch Harmonised Tripartite Guideline Post-Approval Safety Data Management: Definitions and Standards for Expedited Reporting E2d . Available at: https://www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guidelines/Efficacy/E2D/Step4/E2D_Guideline.pdf. Accessed September 21, 2017. \n15. van Westerloo DJ Landman GW Prichard R Lespine A Visser LG , 2014 \nPersistent coma in Strongyloides hyperinfection syndrome associated with persistently increased ivermectin levels . Clin Infect Dis \n58 : 143 –144 .24065325 \n16. Schinkel AH \n1994 \nDisruption of the mouse mdr1a-p-glycopretin gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs . Cell \n77 : 491 –502 .7910522 \n17. Mealey KL Bentjen SA Gay JM Cantor GH , 2001 \nIvermectin sensitivity in collies is associated with a deletion mutation of the mdr1 gene . Pharmacogenetics \n11 : 727 –733 .11692082 \n18. Barkwell R Shields S , 1997 \nDeaths associated with ivermectin treatment of scabies . Lancet \n349 : 1144 –1145 .\n19. Coyne PE Addiss DG , 1997 \nDeaths associated with ivermectin for scabies . Lancet \n350 : 215 –216 .\n20. Guzzo CA Furtek CI Porras AG Chen C Tipping MS Clineschmidt CM Sciberras DG Hsieh JY Lasseter KC , 2002 \nSafety, tolerability, and pharmacokinteics of escalating high doses of ivermectin in healthy study subjects . J Clin Pharmacol \n42 : 1122 –1133 .12362927 \n21. Benet LZ Cummins CL Wu CY , 2004 \nUnmasking the dynamic interplay between efflux transporters and metabolic enzymes . Int J Pharm \n277 : 3 –9 .15158963 \n22. Kigen G Edwards G , 2017 \nDrug-transporter mediated interactions between anthelminthic and antiretroviral drugs across the Caco-2 cell monolayers . BMC Pharmacol Toxicol \n18 : 20 .28468637 \n23. Macdonald N Gledhill A , 2007 \nPotential impact of ABCB1 (p-glycoprotein) polymorphisms on avermectin toxicity in humans . Arch Toxicol \n81 : 553 .17354009 \n24. Bourguinat C Kamgno J Boussinesq M MacKenzie CD Prichard R Geary TG , 2010 \nAnalysis of the mdr-1 gene in patients co-infected with Onchocerca volvulus and Loa loa who experienced a post-ivermectin serious adverse event . Am J Trop Med Hyg \n83 : 28 –32 .\n\n", "fulltext_license": "CC BY", "issn_linking": "0002-9637", "issue": "98(2)", "journal": "The American journal of tropical medicine and hygiene", "keywords": null, "medline_ta": "Am J Trop Med Hyg", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000818:Animals; D002648:Child; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D006801:Humans; D007559:Ivermectin; D008117:Loa; D008297:Male; D008875:Middle Aged; D017181:Onchocerca volvulus; D009855:Onchocerciasis; D012532:Scabies; D017171:Strongyloides stercoralis", "nlm_unique_id": "0370507", "other_id": null, "pages": "382-388", "pmc": null, "pmid": "29210346", "pubdate": "2018-02", "publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": "20595473;28468637;20220184;9113017;12362927;14975061;2563168;14524395;9217715;16126457;11692082;12378743;15158963;16632406;24065325;9250202;10381994;7910522;17354009;22039794", "title": "Serious Neurological Adverse Events after Ivermectin-Do They Occur beyond the Indication of Onchocerciasis?", "title_normalized": "serious neurological adverse events after ivermectin do they occur beyond the indication of onchocerciasis" }
[ { "companynumb": "SE-EDENBRIDGE PHARMACEUTICALS, LLC-SE-2018EDE000098", "fulfillexpeditecriteria": "1", "occurcountry": "SE", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "IVERMECTIN" }, "dru...
{ "abstract": "Although the β-blocker propranolol is considered one of the most effective tremor treatments and other β-blockers are often prescribed to patients with tremor, those with partial β-agonist activity on β-adrenoreceptors can theoretically induce or exacerbate tremor. Here we report 2 patients with tremor induced or worsened by such β-blockers.\nCase 1 is a 38-year-old man with worsening of tremor in both upper extremities after the introduction of pindolol as an adjunct treatment for severe depression. The tremor improved 1 month after discontinuing this medication. Case 2 is a 77-year-old woman with new bilateral hand tremor after receiving labetalol for the management of hypertension during a hospital admission. Tremor markedly attenuated after eliminating labetalol.\nβ-Blockers with partial agonist activity can induce or exacerbate tremor.", "affiliations": "The Edmond J. Safra Program in Parkinson's Disease and the Morton and Gloria Shulman Movement Disorders Clinic, Toronto Western Hospital, Division of Neurology, Department of Medicine University of Toronto Toronto Ontario Canada.;The Edmond J. Safra Program in Parkinson's Disease and the Morton and Gloria Shulman Movement Disorders Clinic, Toronto Western Hospital, Division of Neurology, Department of Medicine University of Toronto Toronto Ontario Canada.;James J. and Joan A. Gardner Center for Parkinson's Disease and Movement Disorders, UC Gardner Neuroscience Institute, Department of Neurology University of Cincinnati Cincinnati Ohio USA.;The Edmond J. Safra Program in Parkinson's Disease and the Morton and Gloria Shulman Movement Disorders Clinic, Toronto Western Hospital, Division of Neurology, Department of Medicine University of Toronto Toronto Ontario Canada.", "authors": "Al-Shorafat|Duha M|DM|;Bhowmick|Suvorit|S|https://orcid.org/0000-0003-1794-1985;Espay|Alberto J|AJ|https://orcid.org/0000-0002-3389-136X;Fasano|Alfonso|A|https://orcid.org/0000-0001-5346-0180", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1002/mdc3.13176", "fulltext": null, "fulltext_license": null, "issn_linking": "2330-1619", "issue": "8(3)", "journal": "Movement disorders clinical practice", "keywords": "Beta blockers; intrinsic sympathomimetic activity; labetalol; pindolol; tremor", "medline_ta": "Mov Disord Clin Pract", "mesh_terms": null, "nlm_unique_id": "101630279", "other_id": null, "pages": "449-452", "pmc": null, "pmid": "33816676", "pubdate": "2021-04", "publication_types": "D002363:Case Reports", "references": "9114912;22523509;16297844;25689398;7443595;24750978;26989572;15504795;3332615", "title": "β-Blocker-Induced Tremor.", "title_normalized": "blocker induced tremor" }
[ { "companynumb": "CA-VALIDUS PHARMACEUTICALS LLC-CA-VDP-2022-015194", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "FUROSEMIDE" }, "druga...
{ "abstract": "Glucocorticoid (GC)-induced diabetes mellitus (DM) is theoretically unlikely to occur in patients with adrenal insufficiency if adequate physiological replacement doses of GC are given. Herein we report a patient with holoprosencephaly who developed GC-induced DM due to frequent and prolonged administration of high-dose GC for suspected adrenal crisis (AC). GC treatment should be started whenever AC cannot be ruled out. However, the initial and subsequent doses should be adjusted to the severity of AC and to the pace of clinical recovery with treatment, respectively.", "affiliations": "Division of Endocrinology and Metabolism, Tokyo Metropolitan Children's Medical Center, Tokyo, Japan.;Division of Endocrinology and Metabolism, Tokyo Metropolitan Children's Medical Center, Tokyo, Japan.;Division of Endocrinology and Metabolism, Tokyo Metropolitan Children's Medical Center, Tokyo, Japan.", "authors": "Karashima|Ryoko|R|;Shimada|Aya|A|;Hasegawa|Yukihiro|Y|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.1297/cpe.28.31", "fulltext": "\n==== Front\nClin Pediatr EndocrinolClin Pediatr EndocrinolCPEClinical Pediatric Endocrinology0918-57391347-7358The Japanese Society for Pediatric Endocrinology 2018-002210.1297/cpe.28.31Case ReportFrequent and prolonged administration of glucocorticoid for acute adrenal\ninsufficiency treatment can cause diabetes mellitus: A case of\nholoprosencephaly Karashima Ryoko 1Shimada Aya 1Hasegawa Yukihiro 11 Division of Endocrinology and Metabolism, Tokyo Metropolitan\nChildren’s Medical Center, Tokyo, JapanCorresponding author: Yukihiro Hasegawa, MD, PhD, Division of Endocrinology and\nMetabolism, Tokyo Metropolitan Children’s Medical Center, 2-8-29 Musashi-dai, Fuchu, Tokyo\n183-8561, JapanE-mail: yhaset@gmail.com24 4 2019 2019 28 2 31 36 15 7 2018 02 1 2019 2019©The Japanese Society for Pediatric\nEndocrinology2019This is an open-access article distributed under the terms of the Creative\nCommons Attribution Non-Commercial No Derivatives (by-nc-nd) License. (CC-BY-NC-ND 4.0:\n\nhttp://creativecommons.org/licenses/by-nc-nd/4.0/). Abstract.\nGlucocorticoid (GC)-induced diabetes mellitus (DM) is theoretically unlikely to occur in\npatients with adrenal insufficiency if adequate physiological replacement doses of GC are\ngiven. Herein we report a patient with holoprosencephaly who developed GC-induced DM due\nto frequent and prolonged administration of high-dose GC for suspected adrenal crisis\n(AC). GC treatment should be started whenever AC cannot be ruled out. However, the initial\nand subsequent doses should be adjusted to the severity of AC and to the pace of clinical\nrecovery with treatment, respectively.\n\nglucocorticoid-induced diabetesadrenal crisishydrocortisone\n==== Body\nIntroduction\nGlucocorticoids (GC) are widely prescribed for the treatment of autoimmune and malignant\ndiseases and can cause a dose-dependent increase in blood glucose levels in patients without\nadrenal insufficiency (AI) or pre-existing diabetes mellitus (DM) (1). The odds ratio for new-onset DM in patients treated with GC reportedly\nranges from approximately 1.5 to 2.5 (1). GC-induced DM is theoretically less likely to\noccur in AI patients if adequate physiological replacement doses are given.\n\nHerein we report the occurrence of GC-induced DM in a patient with holoprosencephaly (HPE).\nDM developed at least partly due to frequent and prolonged administration of high-dose GC\nfor adrenal crisis (AC), referred to as acute AI in this manuscript. In this report, we\nhighlight the importance of adjusting the initial and subsequent doses in order to avoid\nGC-induced DM.\n\nCase Presentation\nThe patient was a 10-yr-old male child with intrauterine growth retardation born at 36 wk\nof gestation after a C-section due to fetal asphyxia (birth weight 1324 g). HPE was\ndiagnosed according to the characteristic physical findings, including a cleft lip palate,\nmicrophthalmia, and diagnostic MRI findings. At the age of 2 yr, IGF-1, LH, FSH, TSH, and\nfree T4 were 25.5 ng/mL, < 0.07 mIU/mL, 1.14 mIU/mL, 3.94 μIU/mL, and 1.10 ng/dL,\nrespectively. The patient did not have any symptoms of hypothalamic dysfunction, such as an\ninstability of body temperature. The patient’s obesity, shown in Table 1Table 1. Case presentation\n, was probably due to excess calories. There was no replacement of hormonal\nagents other than hydrocortisone (HDC) up to the age of 10 yr and 9 mo.\n\nAI was suspected based on a low basal cortisol level early in the morning (3.5 μg/dL) and a\nlow cortisol level at the time of the AC (11.2 μg/dL) at 6 yr and 3 mo of age. A CRH loading\ntest showed an equivocal peak cortisol level of 17.8 μg/dL (reference value, > 18.0\nμg/dL) at the time. Thus, administration of HDC (100 mg/m2/d) was started at 6 yr\nand 5 mo of age only in clinical situations in which AC was suspected. AI was not\ndefinitively diagnosed at this point. The patient was always bedridden, and his nutrition\nwas provided entirely via tube feeding. He was unable to express his intentions or speak.\nOnly objective findings, such as fever, tachycardia, and vomiting were clues to the\npossibility of AC.\n\nThere was no family history of DM. Risk factors for DM in this patient were obesity and\nlack of exercise. Prior to HDC therapy, which was initially done only when AC was suspected,\nrandom samplings of blood glucose yielded findings of 100 to 130 mg/dL. Transient\npostprandial hyperglycemia (368 mg/dL) was first recognized during a respiratory infection\nat 6 yr and 7 mo of age. The total amount of HDC was 1278.7 mg/m2 until then, and\nthe total duration of HDC administration exceeding 8 mg/m2/d was 18 d (Table 1). The highest dose (100 mg/m2/d)\nwas administered for 16 of the 18 d. The episodes associated with suspected AC at that time\nwere vomiting and respiratory infection, and the continuous administration of the highest\ndose during these episodes was 5 and 11 d, respectively. In retrospect, these durations were\nrelatively long. Hyperglycemia in these periods resolved after discontinuation of HDC.\n\nThe total amount of HDC administered from 6 yr and 7 mo to 8 yr and 7 mo of age was 12036.3\nmg/m2, and the total duration of administration exceeding 8 mg/m2/d\nwas 224 d. The highest dose (100 mg/m2/d) was administered for 67 of the 224 d.\nThe episodes associated with suspected AC were vomiting (7 episodes), respiratory infection\n(5 episodes), and tachycardia (1 episode), and the continuous duration of administration of\nthe highest dose for these episodes was 2–8 d, 3–10 d, and 4 d, respectively. Postprandial\nhyperglycemia remained above 200 mg/dL after the age of 8 yr and 7 mo. The anti-GAD and -IA2\nantibodies were negative at the time. GC-induced DM was diagnosed based on the HbA1c value\n(7.5%). As blood glucose occasionally declined naturally to around 140 to 160 mg/dL before\ntube feeding, the endogenous secretion of insulin apparently still continued although at low\nlevels. Indeed, the IRI level was 12.4 mIU/mL when the blood glucose level was 180 mg/dL.\nSince the patient was obese, metformin (125 mg/d) was first introduced to improve insulin\nresistance but had no effect. Thus, insulin injections with insulin aspart and glargine were\nstarted at 8 yr and 9 mo old. The HbA1c at this time was 8.0%.\n\nAt 8 yr and 6 mo of age, the basal cortisol level early in the morning was undetectable\n(< 1.0 μg/dL). The test was done before 9 o’clock before oral HDC administration when he\nvisited us in a poor condition, or stressful situation. This cortisol level was consistent\nwith the complete suppression of endogenous GC, and daily oral replacement of HDC (8\nmg/m2/d) was started. ACTH deficiency at 6 yr and 3 mo was not unequivocally\ndocumented as explained above. Thus, the low peak value of cortisol (< 1.0 μg/dL) at 8 yr\nand 6 mo might simply have reflected the subsequent excess of exogenous GC.\n\nAll 15 episodes that were treated with HDC for suspected AC and/or prevention of AC are\nshown in Table 2Table 2. Clinical manifestations of each adrenal crisis episode on admission\n. Hyponatremia (122 mEq/L, 128 mEq/L) was recognized in two of the 15 episodes,\nwhich were apparently the only episodes of severe AC in retrospect. The duration of\ntreatment with 100 mg/m2/d of HDC ranged from two to 11 d for these 15 episodes.\nBecause vomiting, one of the most frequent symptoms in this patient, improved with\ntreatment, we concluded that the vomiting episodes were related to AC. Other diseases\ncausing vomiting such as ileus or gastroenteritis were denied.\n\nAt 10 yr and 9 mo old, the total amount of insulin was 1.2–1.4 U/kg/d, and HbA1c (NGSP) was\n6.1%. The dose and frequency of HDC therapy for AC were not reduced after 8 yr 9 mo, and the\npatient needed over 1 U/kg/d insulin for two years until the time of this writing,\nsuggesting that the steroid diabetes had become irreversible. Mild fatty liver detected by\nan echograph was the only symptom or finding relevant to the excess exogenous GC besides\nobesity and hyperglycemia (data not shown).\n\nDiscussion\nWe described a case of GC-induced DM in a patient with HPE. DM developed after frequent and\nprolonged administration of high-dose GC for suspected AC.\n\nThe maximum dose of HDC used for AC in this report (100 mg/m2/d) was not\nexcessive for major stress or severe AC when compared to previous recommendations. A\nprevious report mentioned that 100–400 mg/d of HDC should be administered to adults in cases\nof major stress, including open abdominal surgery, severe trauma, childbirth, and frequent\ndiarrhea/vomiting (2). The clinical practice\nguidelines of the Japan Endocrine Society (JES) (3)\nrecommend a continuous infusion of 150 mg of HDC for 24 h and the administration of 100 mg\nof HDC on the next day for cases of major physical stress in adults. The Endocrine Society\n(ES) recommends that suspected AC in children should be treated with an immediate parental\ninjection of 50 mg/m2 HDC followed by 50–100 mg/m2/d of HDC (4).\n\nOne reason for the development of diabetes mellitus in this patient was the unusually high\nfrequency of treatment with 100 mg/m2/d of HDC. If we follow the definition of\nmajor stress or severe AC by Grossman et al. (2), only two of 15 episodes treated with 100 mg/m2/d of HDC in\nour study apparently qualify as severe AC. The dose for treating AC theoretically varies\naccording to the stress level; therefore, a lower dose could have been selected (2).\n\nAnother cause of GC-induced DM in our case was prolonged administration of high dose GC.\nWhile the acute symptoms persisted for one to three days, the duration of treatment with 100\nmg/m2/d of HDC ranged from two to 11 d in our case (Table 2). The prolonged administration was due to the patient’s\ncondition as described. In retrospect, the physicians had just finished administering HDC\ntreatment when AC was completely recovered in the patient. The cortisol levels in critically\nill children reportedly rise only during the first 24 h (5). The plasma CRH, ACTH, cortisol, norepinephrine, and renin activities in\npatients undergoing neck surgery returned to the basal levels by the first postoperative day\n(6). Serum cortisol levels in individuals with\nnormal adrenal function reach a peak at the time of tracheal extubation immediately after\nthe end of surgery and normalize within 48 h. Two of the most recent studies (1,2,3) do not mention the duration of GC administration during\nstress, whereas the Japanese guidelines recommended tapering to a maintenance dose over a\nperiod of 1–4 wk after symptom improvement in children (3). We believe that a tapering period of 1–4 wk is too long based on the findings\nof the present and previous reports (5, 6).\n\nSeveral studies have reported on diabetes mellitus in patients with ACTH deficiency. A\nprevious report mentioned that 2% of adults having hypopituitarism with ACTH deficiency\ndeveloped DM after daily treatment with 20 mg HDC (7).\nIn another report, GC therapy in hypopituitarism adults with 26 mg HDC was shown to cause\nmild elevations in the circulating glucose and insulin level without inducing overt DM even\nin the presence of an acceptable plasma cortisol level (8). However, these doses of 20 and 26 mg HDC are pharmacological, compared to\nphysiological secretion of cortisol, or 6–8 mg/m2. These data suggest that the\nincidence of DM may not be high if the dose is physiological.\n\nIn conclusion, the possible causes of GC-induced DM in our case were frequent and prolonged\nadministration of high-dose GC. As AC is a life-threatening complication in patients with\nchronic AI, treatment should be started whenever AC cannot be ruled out. However, the\ninitial and subsequent doses should be adjusted depending on the severity of AC and on the\npace of clinical recovery with treatment, respectively.\n\nAcknowledgment\nWe are indebted to Mr. James R. Valera for his assistance in editing this manuscript.\n==== Refs\nReferences\n1 Clore JN Thurby-Hay L \nGlucocorticoid-induced hyperglycemia .\nEndocr Pract 2009 ;15 :\n469 –74 . doi: 10.4158/EP08331.RAR 19454391 \n2 Grossman A Johannsson G Quinkler M Zelissen P \nTherapy of endocrine disease: Perspectives on the\nmanagement of adrenal insufficiency: clinical insights from across\nEurope . Eur J\nEndocrinol 2013 ;169 :\nR165 –75 . doi: 10.1530/EJE-13-0450 24031090 \n3 Yanase T Tajima T Katabami T Iwasaki Y Tanahashi Y Sugawara A et al \nDiagnosis and treatment of adrenal insufficiency including\nadrenal crisis: a Japan Endocrine Society clinical practice guideline\n[Opinion] . Endocr\nJ 2016 ;63 : 765 –84 .\ndoi: 10.1507/endocrj.EJ16-0242 27350721 \n4 Bornstein SR Allolio B Arlt W Barthel A Don-Wauchope A Hammer GD et al \nDiagnosis and treatment of primary adrenal insufficiency:\nan endocrine society clinical practice guideline . J Clin\nEndocrinol Metab 2016 ;101 :\n364 –89 . doi: 10.1210/jc.2015-1710 26760044 \n5 Charmandari E Lichtarowicz-Krynska EJ Hindmarsh PC Johnston A Aynsley-Green A Brook CG \nCongenital adrenal hyperplasia: management during critical\nillness . Arch Dis\nChild 2001 ;85 : 26 –8 .\ndoi: 10.1136/adc.85.1.26 11420193 \n6 Udelsman R Norton JA Jelenich SE Goldstein DS Linehan WM Loriaux DL et al \nResponses of the hypothalamic-pituitary-adrenal and\nrenin-angiotensin axes and the sympathetic system during controlled surgical and\nanesthetic stress . J Clin Endocrinol\nMetab 1987 ;64 :\n986 –94 . doi: 10.1210/jcem-64-5-986 3031124 \n7 McConnell EM Bell PM Hadden DR McCance DR Sheridan B Atkinson AB \nPrevalence of diabetes and impaired glucose tolerance in\nadult hypopituitarism on low dose oral hydrocortisone replacement\ntherapy . Clin Endocrinol\n(Oxf) 2001 ;54 :\n593 –9 . doi: 10.1046/j.1365-2265.2001.01269.x 11380489 \n8 Al-Shoumer KA Beshyah SA Niththyananthan R Johnston DG \nEffect of glucocorticoid replacement therapy on glucose\ntolerance and intermediary metabolites in hypopituitary adults .\nClin Endocrinol (Oxf) 1995 ;42 :\n85 –90 . doi: 10.1111/j.1365-2265.1995.tb02602.x 7889636\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-5739", "issue": "28(2)", "journal": "Clinical pediatric endocrinology : case reports and clinical investigations : official journal of the Japanese Society for Pediatric Endocrinology", "keywords": "adrenal crisis; glucocorticoid-induced diabetes; hydrocortisone", "medline_ta": "Clin Pediatr Endocrinol", "mesh_terms": null, "nlm_unique_id": "9433330", "other_id": null, "pages": "31-36", "pmc": null, "pmid": "31037021", "pubdate": "2019", "publication_types": "D016428:Journal Article", "references": "11380489;11420193;19454391;24031090;26760044;27350721;3031124;7889636", "title": "Frequent and prolonged administration of glucocorticoid for acute adrenal insufficiency treatment can cause diabetes mellitus: A case of holoprosencephaly.", "title_normalized": "frequent and prolonged administration of glucocorticoid for acute adrenal insufficiency treatment can cause diabetes mellitus a case of holoprosencephaly" }
[ { "companynumb": "JP-PFIZER INC-2019219171", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HYDROCORTISONE" }, "drugadditional": "1", ...
{ "abstract": "Ichthyosis prematurity syndrome (IPS) is a rare disorder of autosomal recessive inheritance. The cardinal features include prematurity, vernix like hyperkeratosis, eosinophilia and neonatal asphyxiation. This case report discusses the presentation and management of IPS. We aim to characterise the common features, the spectrum of disease within a single family and discuss a potential role for low-dose dexamethasone in the management of ventilator-dependent patients with IPS.", "affiliations": "Department of Neonatology, Rotunda Hospital Neonatal Unit, Dublin, Ireland.;Department of Neonatology, Rotunda Hospital Neonatal Unit, Dublin, Ireland.;Department of Neonatology, Rotunda Hospital Neonatal Unit, Dublin, Ireland.;Department of Neonatology, Rotunda Hospital Neonatal Unit, Dublin, Ireland mboyle@rotunda.ie.", "authors": "Henderson|Davina|D|http://orcid.org/0000-0002-2503-4886;Murphy|Claire A|CA|;O'Dea|Mary|M|;Boyle|Michael A|MA|http://orcid.org/0000-0002-2960-7653", "chemical_list": "D003907:Dexamethasone", "country": "England", "delete": false, "doi": "10.1136/bcr-2021-243348", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "14(8)", "journal": "BMJ case reports", "keywords": "congenital disorders; dermatology; neonatal and paediatric intensive care", "medline_ta": "BMJ Case Rep", "mesh_terms": "D003907:Dexamethasone; D006801:Humans; D007057:Ichthyosis; D007231:Infant, Newborn; D007235:Infant, Premature, Diseases; D007642:Keratosis", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "34417235", "pubdate": "2021-08-20", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Experience of low-dose dexamethasone use in the respiratory management of ichthyosis prematurity syndrome.", "title_normalized": "experience of low dose dexamethasone use in the respiratory management of ichthyosis prematurity syndrome" }
[ { "companynumb": "IE-PFIZER INC-202101259628", "fulfillexpeditecriteria": "1", "occurcountry": "IE", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "HYDROCORTISONE SODIUM SUCCINATE" }, "drugadd...
{ "abstract": "Malaria in pregnancy is associated with adverse maternal and perinatal outcomes. The first-line treatment for severe malaria in the second and third trimesters of pregnancy is parenteral artesunate, according to WHO recommendations. Resistance of Plasmodium falciparum to artesunate has not yet been noted in our country. We report a case highly suspicious of such. A pregnant woman presented with the clinical signs of malaria. After paraclinical confirmation of the diagnosis, she was admitted and injectable artesunate was given for 72 h at the recommended dosage, with antipyretic without any improvement. Artesunate was therefore replaced by parenteral quinine, with favourable evolution. Resistance of Plasmodium falciparum to artesunate might be present in our country. This patient provides a warning about possible artesunate resistance, and this calls for careful monitoring of other cases of malaria been treated with this drug to ascertain the possibility of resistant cases.", "affiliations": "Full Professor, Obstetrician & Gynecologist, Department of Obstetrics and Gynecology; Faculty of Medicine and Biomedical Sciences & University Teaching Hospital, Yaoundé, Cameroon.;Resident in Obstetrics and Gynecology; Department of Obstetrics and Gynecology, Faculty of Medicine and Biomedical Sciences, University Teaching Hospital of Yaoundé, University of Yaoundé, Yaoundé, Cameroon.;Obstetrician & Gynecologist, Department of Obstetrics and Gynecology, Faculty of Medicine and Biomedical Sciences, University Teaching Hospital of Yaoundé, University of Yaoundé, Yaoundé, Cameroon.", "authors": "Nkwabong|Elie|E|https://orcid.org/0000-0002-9140-5833;Tseunwo|Claudine|C|;Nkene Mawamba|Yvette|Y|", "chemical_list": "D000962:Antimalarials; D037621:Artemisinins; D000077332:Artesunate", "country": "England", "delete": false, "doi": "10.1177/00494755211011899", "fulltext": null, "fulltext_license": null, "issn_linking": "0049-4755", "issue": "51(4)", "journal": "Tropical doctor", "keywords": "Cameroon; Plasmodium falciparum; artesunate resistance", "medline_ta": "Trop Doct", "mesh_terms": "D000962:Antimalarials; D037621:Artemisinins; D000077332:Artesunate; D002163:Cameroon; D005260:Female; D006801:Humans; D016778:Malaria, Falciparum; D010963:Plasmodium falciparum; D011247:Pregnancy", "nlm_unique_id": "1301706", "other_id": null, "pages": "626-627", "pmc": null, "pmid": "34102929", "pubdate": "2021-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Suspected Plasmodium falciparum resistance to artesunate in Cameroon: A case report.", "title_normalized": "suspected plasmodium falciparum resistance to artesunate in cameroon a case report" }
[ { "companynumb": "CM-LUPIN PHARMACEUTICALS INC.-2021-25089", "fulfillexpeditecriteria": "2", "occurcountry": "CM", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "QUININE" }, "drugadditional": ...
{ "abstract": "Purpose: Over the last decade, there has been tremendous progress in the treatment of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). To understand whether this has resulted in better ophthalmic outcomes, we aimed to study the incidence of severe ocular complications (SOCs) in the acute and chronic stage among SJS/TEN patients, major causative medications, and therapeutic effect of medical and surgical treatment. Methods: Using electronic medical records review of patients of Chang Gung Memorial Hospital Linkou Branch from 2010 to 2020, 119 patients (236 eyes) received ophthalmic consultation during the acute stage and were retrospectively studied. Sotozono's grading score systems for acute and chronic SJS/TEN were employed for accessing correlation between acute and chronic presentations, the therapeutic effect of systemic etanercept treatment, and outcome of early amniotic membrane transplantation (AMT) performed in patients with severe acute SOCs. Results: There were 46 male and 73 female patients with a mean age of 45.6 ± 22.7 years old (2-90 years), and follow-up time of 408.3 ± 351.0 (116-1,336) days. The numbers of patients with SJS, overlap syndrome, and TEN were 87, 9, and 23, respectively. In total, 109 eyes (55 patients) had acute SOCs, which comprised 46.2% of patients who underwent ophthalmic examination. Antiepileptics were the most common category of culprit drugs causing SOCs in the acute stage. At the end of follow-up, there were 14 eyes (9 patients) with chronic SOCs (5.9%), and non-steroidal anti-inflammatory drugs and cold medicine were the most common causative medications that were associated with severe chronic sequela. The correlation between Sotozono's acute and chronic grading score showed a positive relationship [Spearman's rank correlation coefficient (r) = 0.52, p < 0.001]. The average chronic grading scores in patients receiving systemic corticosteroid combined with etanercept treatment were significantly lower than those receiving corticosteroid only, Finally, the average chronic grading scores in patients receiving AMT <7 days after onset were significantly lower than those performed beyond 7 days. Conclusion: Our study implies that acute manifestation can be an indicator for chronic sequelae. Additional early etanercept treatment and early AMT showed beneficial effect in reducing chronic ocular sequela.", "affiliations": "Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Keelung, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan.;Department of Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan.;Department of Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan.", "authors": "Ma|David Hui-Kang|DH|;Tsai|Tsung-Ying|TY|;Pan|Li-Yen|LY|;Chen|Shin-Yi|SY|;Hsiao|Ching-Hsi|CH|;Yeh|Lung-Kun|LK|;Tan|Hsin-Yuan|HY|;Lu|Chun-Wei|CW|;Chen|Chun-Bing|CB|;Chung|Wen-Hung|WH|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fmed.2021.661891", "fulltext": "\n==== Front\nFront Med (Lausanne)\nFront Med (Lausanne)\nFront. Med.\nFrontiers in Medicine\n2296-858X\nFrontiers Media S.A.\n\n10.3389/fmed.2021.661891\nMedicine\nOriginal Research\nClinical Aspects of Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis With Severe Ocular Complications in Taiwan\nMa David Hui-Kang 1234*\n\nTsai Tsung-Ying 1†\n\nPan Li-Yen 1†\nChen Shin-Yi 5\nHsiao Ching-Hsi 16\nYeh Lung-Kun 16\nTan Hsin-Yuan 16\nLu Chun-Wei 678910\n\nChen Chun-Bing 6789101112\n\nChung Wen-Hung 6789101112\n\n1Department of Ophthalmology, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n2Department of Chinese Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan\n3Center for Tissue Engineering, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n4Department of Ophthalmology, Xiamen Chang Gung Hospital, Xiamen, China\n5Department of Ophthalmology, Chang Gung Memorial Hospital, Keelung, Taiwan\n6Department of Medicine, College of Medicine, Chang Gung University, Taoyuan, Taiwan\n7Department of Dermatology, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n8Drug Hypersensitivity Clinical and Research Center, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n9Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan\n10Immune-Oncology Center of Excellence, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n11Cancer Vaccine and Immune Cell Therapy Core Laboratory, Chang Gung Memorial Hospital, Taoyuan, Taiwan\n12Department of Dermatology, Xiamen Chang Gung Hospital, Xiamen, China\nEdited by: Mayumi Ueta, Kyoto Prefectural University of Medicine, Japan\n\nReviewed by: Mee Kum Kim, Seoul National University, South Korea; Swapna Shanbhag, L. V. Prasad Eye Institute, India; Passara Jongkhajornpong, Decision Research, United States\n\n*Correspondence: David Hui-Kang Ma davidhkma@yahoo.com\nThis article was submitted to Ophthalmology, a section of the journal Frontiers in Medicine\n\n†These authors have contributed equally to this work\n\n12 5 2021\n2021\n8 66189131 1 2021\n08 4 2021\nCopyright © 2021 Ma, Tsai, Pan, Chen, Hsiao, Yeh, Tan, Lu, Chen and Chung.\n2021\nMa, Tsai, Pan, Chen, Hsiao, Yeh, Tan, Lu, Chen and Chung\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nPurpose: Over the last decade, there has been tremendous progress in the treatment of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). To understand whether this has resulted in better ophthalmic outcomes, we aimed to study the incidence of severe ocular complications (SOCs) in the acute and chronic stage among SJS/TEN patients, major causative medications, and therapeutic effect of medical and surgical treatment.\n\nMethods: Using electronic medical records review of patients of Chang Gung Memorial Hospital Linkou Branch from 2010 to 2020, 119 patients (236 eyes) received ophthalmic consultation during the acute stage and were retrospectively studied. Sotozono's grading score systems for acute and chronic SJS/TEN were employed for accessing correlation between acute and chronic presentations, the therapeutic effect of systemic etanercept treatment, and outcome of early amniotic membrane transplantation (AMT) performed in patients with severe acute SOCs.\n\nResults: There were 46 male and 73 female patients with a mean age of 45.6 ± 22.7 years old (2–90 years), and follow-up time of 408.3 ± 351.0 (116–1,336) days. The numbers of patients with SJS, overlap syndrome, and TEN were 87, 9, and 23, respectively. In total, 109 eyes (55 patients) had acute SOCs, which comprised 46.2% of patients who underwent ophthalmic examination. Antiepileptics were the most common category of culprit drugs causing SOCs in the acute stage. At the end of follow-up, there were 14 eyes (9 patients) with chronic SOCs (5.9%), and non-steroidal anti-inflammatory drugs and cold medicine were the most common causative medications that were associated with severe chronic sequela. The correlation between Sotozono's acute and chronic grading score showed a positive relationship [Spearman's rank correlation coefficient (r) = 0.52, p < 0.001]. The average chronic grading scores in patients receiving systemic corticosteroid combined with etanercept treatment were significantly lower than those receiving corticosteroid only, Finally, the average chronic grading scores in patients receiving AMT <7 days after onset were significantly lower than those performed beyond 7 days.\n\nConclusion: Our study implies that acute manifestation can be an indicator for chronic sequelae. Additional early etanercept treatment and early AMT showed beneficial effect in reducing chronic ocular sequela.\n\nStevens-Johnson syndrome\ntoxic epidermal necrolysis\nocular complication\namniotic membrane transplantation\netanercept\nTaiwan\n==== Body\nIntroduction\n\nStevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) is a potentially life-threatening and vision-impairing immune-mediated disease with an estimated annual incidence of 1–5 per 1,000,000 individuals globally (1). The incidence differs among countries. A study from Korea reported incidences of 3.96–5.03 for SJS and 0.94–1.45 for TEN per million individuals from 2010 to 2013 (2). An incidence rate of 5.76 SJS/TEN cases per million person-years were reported from the UK (database between 1995 and 2013) (3).\n\nTwo studies from the US reported similar incidences. The annual SJS spectrum incidence rate reported by White et al. was 12.35 per million people per year (database between 2010 and 2012) (1), and Hsu et al. reported that the mean estimated incidences of SJS, SJS/TEN, and TEN were 9.2, 1.6, and 1.9 per million adults per year, respectively (database between 2010 and 2012) (4).\n\nIn Taiwan, utilizing data from the National Health Insurance Research Database (NHIRD) of Taiwan from 2000 to 2008, Syu et al. reported that the overall SJS incidence rate was 3.6 per million people per year (study database between 2000 and 2008) (5). These data may potentially reveal a considerable number of patients affected by ocular complications. Severe ocular complications (SOCs) in chronic SJS/TEN include dry eye, chronic inflammation and neovascularization of the cornea, symblepharon and keratinization of the conjunctiva. If not properly handled, SOCs often result in permanent visual loss.\n\nBecause of severe dry eye, SOCs in SJS/TEN are more difficult to treat by surgery; therefore, prevention is the key to reduce the incidence of SOCs in SJS/TEN.\n\nAlthough Taiwan was the first country to report an intense association of human leukocyte antigen (HLA)-B*15:02 and carbamazepine-induced SJS/TEN (6), and the first to implement HLA-B*15:02 screening for carbamazepine users (7), reports focusing on ocular manifestations of SJS/TEN from Taiwan are limited. In 2007, Chang et al. reported a total of 207 patients with 213 episodes/attacks of SJS/TEN. The most frequent causative drugs were carbamazepine and allopurinol. Dry eye was the most frequent ocular sequelae identified within 3 months after hospital discharge (17.2%) followed by symblepharon (4.7%) and corneal scarring (4.7%) (8).\n\nOver the last decade, there has been considerable progress not only in diagnostic methods but also in treatment protocols, especially the early application of amniotic membrane transplantation (AMT) (9–12), and it has been shown that the long-term outcomes of AMT to be quite favorable (9, 13). In this article, we aim to study the incidence of SOCs among SJS/TEN patients, major causative medications, the final outcome of affected patients, therapeutic effect of systemic corticosteroids combined with etanercept treatment, and beneficial effect of early AMT.\n\nMaterials and Methods\n\nThis retrospective study to collect and analyze electronic medical records of SJS/TEN was approved by the Institutional Review Boards of Chang Gung Medical Foundation (IRB approval No. 202100092B0). All experimental procedures were conducted in accordance with the principles set forth in the Helsinki Declaration.\n\nThe list of SJS/TEN patients who were admitted to Chang Gung Memorial Hospital, Linkou Branch from January 2010 to July 2020 was retrieved from the database maintained by the Department of Dermatology. The electronic medical records were retrospectively reviewed, and the recorded data included information on gender, presenting age, causative medications/diseases, and systemic treatments. Regarding disease chronicity, Shanbhag et al. have defined the acute phase as the period between symptom onset of SJS/TEN up to 2 months later; the subacute phase was defined as 2–6 months after symptom onset; and the chronic phase was defined as more than 6 months after symptom onset (14). Ocular manifestations in the acute stage were retrieved from ophthalmic consultation records. To record the severity of ocular involvement at the first time of consultation in the acute stage (within 1 week from the first manifestation), the Sotozono acute stage ocular surface grading score (OSGS) was employed (15). OSGS ranges from grade 0 to 3, with grade 0 indicating no ocular surface involvement, grade 1 indicating mild involvement with conjunctival hyperemia, grade 2 indicating severe involvement with accompanying pseudomembrane formation or ocular surface epithelial defects, and grade 3 indicating very severe involvement with both pseudomembrane formation and ocular surface epithelial defects. The eyes with greater than grade 2 ocular involvement were considered to have acute severe ocular complications (SOCs). The initial VA and ophthalmic medical and surgical treatments were also reviewed. Visual acuity (VA) was evaluated in naked-eye with standard Snellen E chart. Regarding the causative medications, those with acute SOCs (grade 2 and grade 3) were analyzed and compared in percentage.\n\nIn the chronic stage (defined as at least 6 months from the first manifestation), ocular involvement was assessed according to the scoring system proposed by Sotozono et al. (16). Complications were broadly defined as corneal, conjunctival, and eyelid complications. There are a total of 13 categories of findings, such as superficial punctate keratopathy (SPK), hyperemia, trichiasis, and symblepharon. Each category scored from 0 to 3, and the maximal score was 39. Treatment in the chronic stage, Schirmer test values and vision were also recorded. Because there was a high portion of missing data for Schirmer test values, the diagnosis of dry eye was made if the patient's Schirmer's test I value (without topical anesthesia) was <10 mm and/or the cornea showed greater than grade 1 SPK. To judge the severity of the ocular manifestation in the chronic stage, the patient's last electronic medical records with a detailed eye examination was used as a reference (Table 1). Patients with Sotozono's chronic stage grading scores 0–5 were considered to have non- or minimal ocular involvement. Patients with scores 6–10 exhibited mild involvement, scores 11–15 indicate moderate involvement, and scores > 16 were considered to have severe involvement.\n\nTable 1 Demographics and grading of patients receiving ophthalmic examination in acute and chronic stage of SJS/TEN from 2010 to 2020.\n\nDemographics/characteristics\t\nNumber of patients\t119\t\nTotal eye number\t236\t\nMean age ± SD (range)\t45.6 ± 22.7 (2–90)\t\nGender, n (%)\t\n  Male\t46 (38.7)\t\n  Female\t73 (61.3)\t\nLaterality, n (%)\t\n  Bilateral\t117 (98.3)\t\n  Unilateral\t2 (1.7)\t\nDiagnosis, n (%)\t\n  SJS\t87 (73.1)\t\n  Overlap syndrome\t9 (7.6)\t\n  TEN\t23 (19.3)\t\nMean follow-up time (days)\t408.3 ± 351.0 (116–1,336)\t\nSotozono's acute stage grading scores, n = eyes (%)\t\n  Grade 0\t30 (12.7)\t\n  Grade 1\t97 (41.1)\t\n  Grade 2\t79 (33.5)\t\n  Grade 3\t30 (12.7)\t\n  Mean OSGS in acute stage (range)\t1.46 ± 0.87 (0–3)\t\nSotozono's chronic stage grading scores, n = eyes (%)\t\n  0–5\t195 (82.6)\t\n  6–10\t22 (9.3)\t\n  11–15\t5 (2.1)\t\n  >16\t14 (5.9)\t\n  Mean OSGS in chronic stage (range)\t3.54 ± 5.50 (0–33)\t\nSJS, Stevens-Johnson syndrome; TEN, toxic epidermal necrolysis; OSGS, ocular surface grading score.\n\nBased on published therapeutic benefits of steroid therapy at disease onset in preventing ocular complications (17), systemic treatment with steroid pulse therapy (1–1.5 mg/kg/day prednisolone by intravenous injection until the skin lesions were healed), intravenous methylprednisolone or hydrocortisone has also been commonly administered to SJS/TEN patients admitted to dermatology wards (17, 18). Based on the conclusion from a randomized and controlled trial from our hospital (2009–2015) (19), additional subcutaneous etanercept (Enbrel; Pfizer) has been prescribed for recalcitrant SJS/TEN patients with progression of blistering or erythema even after methylprednisolone (>1 mg/kg/day) treatment for 3–5 days. To investigate the effect of additional systemic etanercept on long-term ocular outcome, we focused on patients whose medical records showed treatment with intravenous corticosteroids with or without additional subcutaneous etanercept. Demographics of the patients in each group such as age, gender, and distribution of top 5 culprit drugs were compared, and we found no significant difference in these parameters (Table 5). Thereafter, the acute and chronic stage severity grading scores were compared between these two groups.\n\nIn the acute stage, we used topical balanced salt solution (BSS, Alcon) for lubrication, levofloxain (Cravit, Santen) as a prophylactic antibiotic, Tobradex ointment (Alcon) as topical corticosteroid ointment for eyelid wounds, and preservative-free 0.1% betamethasone (Fusone, AIM Medicine, Taiwan) qid to q3h when conjunctival congestion was evident. Conjunctival pseudomembranes were removed every 2–4 days. If grade 3 and sometimes grade 2 ocular involvement was noted, amniotic membrane (AM) dressing using cryopreserved AM was performed to protect the entire ocular surface. Before 2019, suture-fixated AM dressing was performed (20–22). Since 2020, sutureless AM dressing using cyanoacrylate glue to fixate AM at the lid margin has been adopted (23). This novel technique significantly reduced the time and discomfort of the surgery. To study the influence of timing of AM transplantation (AMT; AM grafting or AM dressing) on the outcome, we compared the Sotozono's chronic grading score of patients who received AMT less than or more than 7 days after onset.\n\nStatistics\n\nAll statistics were calculated using SPSS software version 23.0 for Windows (SPSS, Inc., Chicago, IL, USA). Continuous variables are presented as the mean and standard deviation (SD). Spearman's rank correlation was used to present the association between Sotozono's acute and chronic grading score. Correlation coefficients (ρ) were also calculated. Student's t-test was used to compare the difference in demographics, follow-up duration, acute and chronic grading scores between patients treated with or without additional etanercept, and chronic grading scores in patients receiving AMT before or beyond 7 days after onset. Chi-squared test was used to compare distribution of causative medications between patients treated with or without additional etanercept. A p < 0.05 was deemed to be statistically significant.\n\nResults\n\nFrom January 2010 until July 2020, a total of 294 patients were registered in the Department of Dermatology database. Among them, 119 patients (236 eyes) received ophthalmic consultation during the acute stage and were recruited in this study. There were 46 male and 73 female patients with a mean age of 45.6 +/– 22.7 years old (2–90 years). The numbers (percentages) of patients with SJS, overlap syndrome, and TEN were 87 (73.1%), 9 (7.6%), and 23 (19.3%), respectively. When the number of involved eyes was calculated, using Sotozono's acute OSGS, there were 30 eyes without ocular involvement (grade 0, 12.7%), 97 eyes with mild involvement (grade 1, 41.1%), 79 eyes with severe involvement (grade 2, 33.5%), and 30 eyes with the most severe involvement (grade 3, 12.7%). Given that patients with greater than grade 2 ocular involvement were considered to have SOCs, there were 109 eyes (55 patients) in total with acute SOCs, comprising 46.2% of patients who had ophthalmic examination, and 18.6% of total patients (Table 1). In the chronic stage, when the assessment was done at an averaged 408.3 ± 351.0 (116–1,336) days after onset, there were 195 eyes (82.6%) with Sotozono's chronic grading scores 0–5 (non- or minimal ocular involvement). Twenty-two eyes (9.3%) with scores 6–10 (mild involvement), 5 eyes (2.1%) with scores 11–15 (moderate involvement), and 14 eyes (5.9%) with scores >16 (severe involvement) (Table 1).\n\nAmong 67 identifiable drugs that were associated with acute SOCs, antiepileptics (carbamazepine, phenytoin, lamitrogine, etc.) was the category of drugs that were associated with most acute SOCs (n = 15, 22.4%) followed by antibiotics (n = 12, 17.9%), allopurinol (n = 8, 11.9%), non-steroidal anti-inflammatory drug (NSAID; n = 7, 10.4%), and sulfa drugs (n = 6, 9.0%) (Table 2). In terms of a single drug, allopurinol was the drug that was associated with most acute SOCs. In 14 eyes of the 9 patients with chronic SOCs, NSAID and cold medicine were the most common causative medications that were associated with chronic SOCs (44.4%, Table 2).\n\nTable 2 Top 5 causative drug categories responsible for acute and chronic SOCs in SJS/TEN patients.\n\nName of causative drugs\tNo. of patients (%)\t\nAcute SOCs\tN = 67\t\nAntiepileptics\t15 (22.4)\t\n  Phenytoin\t2 (3.0)\t\n  Carbamazepine\t4 (6.0)\t\n  Oxcarbazepine\t5 (7.5)\t\n  Lamotrigine\t2 (3.0)\t\n  Zonisamide\t2 (3.0)\t\nAntibiotics\t12 (17.9)\t\n  Cephalexin\t1 (1.5)\t\n  Cefuroxime\t1 (1.5)\t\n  Ceftazidime\t1 (1.5)\t\n  Ceftriaxone\t1 (1.5)\t\n  Norfloxacin\t1 (1.5)\t\n  Levofloxacin\t1 (1.5)\t\n  Moxifloxacin\t1 (1.5)\t\n  Amoxicillin\t3 (4.5)\t\n  Vancomycin\t2 (3.0)\t\nAllopurinol\t8 (11.9)\t\nNSAIDs\t7 (10.4)\t\n  Diclofenac\t3 (4.5)\t\n  Ibuprofen\t1 (1.5)\t\n  Mefenamic acid\t3 (4.5)\t\nSulfa drugs\t6 (9.0)\t\n  Sulfasalazine\t3 (4.5)\t\n  Sulfonamide\t3 (4.5)\t\nMiscellaneous\t19 (28.4)\t\nChronic SOCs\tN = 9\t\nNSAIDs\t4 (44.4)\t\nDiclofenac\t2 (22.2)\t\nMefenamic acid\t1 (11.1)\t\nCold medicine\t19 (11.1)\t\nAnti-epileptics\t2 (22.2)\t\nCarbamazepine\t1 (11.1)\t\nLamotrigine\t1 (11.1)\t\nAntibiotics\t\t\nCefuroxime\t1 (11.1)\t\nSulfa drugs\t\t\nSulfasalazine\t1 (11.1)\t\nTenofovir\t1 (11.1)\t\nSOCs, Severe ocular complications.\n\nNSAIDs, Non-steroidal anti-inflammatory drugs.\n\nThe average grading score for all patients in the acute stage was 1.46 ± 0.87. The value in the chronic stage (at the end of follow-up) was 3.54 ± 5.50. For patients whose grading score ranged from 0 to 3 during the acute stage, their corresponding chronic stage grading scores were 0.67 ± 0.80, 1.62 ± 1.99, 4.70 ± 6.38, and 9.60 ± 7.73, respectively. The correlation between Sotozono's acute and chronic grading score showed a moderately correlated relationship [Spearman's rank correlation coefficient (ρ) = 0.52, p < 0.001] (Figure 1). This finding implies that patients who presented with more severe acute ocular manifestations tended to suffer from sequelae in the chronic stage.\n\nFigure 1 Correlations between Sotozono's acute (15) and chronic (16) stage grading score of SJS/TEN patients evaluated during the acute and chronic stage, respectively.\n\nJudging from Sotozono's chronic stage ocular complication category, hyperemia was the most common chronic stage ocular complication, followed by SPK, meibomian gland dysfunction, mucocutaneous junction involvement, and trichiasis. Judged from the Schirmer test value and the presence of corneal staining, the incidence of dry eye in the chronic stage was estimated to be 49.2% (116 eyes) (Table 3).\n\nTable 3 Ocular manifestations in chronic stage of SJS/TEN patients.\n\nCharacteristic\tNumber of eye\tPercentage (%)\t\nCorneal complication\t\n  Superficial punctate keratitis\t117\t49.58\t\n  Epithelium defect\t29\t12.29\t\n  Loss of POV*\t9\t3.81\t\n  Conjunctivalization\t13\t5.51\t\n  Neovasculization\t22\t9.32\t\n  Opacification\t19\t8.05\t\n  Keratinization\t14\t5.93\t\nConjunctival complication\t\n  Hyperemia\t122\t51.69\t\n  Symblepharon\t8\t3.39\t\nEyelid complication\t\n  Tichiasis\t49\t20.76\t\n  MC* junction involvement\t62\t26.27\t\n  Meibomian gland involvement\t90\t38.14\t\n  Punctal damage\t7\t2.97\t\n* POV, Palisades of Vogt; MC, Mucocutaneous.\n\nWhen best corrected vision in the chronic stage was measured, data were available from 174 eyes. Among them, 112 eyes (64.4%) had vision better than 20/40, and 43 eyes (24.7%) had vision between 20/40 and 20/200. Nine eyes (5.2%) had vision between 20/200 and 20/2,000, and 10 eyes (5.7%) had vision worse than 20/2,000.\n\nTo study the effect of additional systemic etanercept on long-term ocular manifestations, there was no significant difference in gender, age, distribution of culprit drugs, and follow-up time between patients receiving corticosteroid treatment only and patients receiving corticosteroid plus etanercept treatment (Table 4). The average acute stage score for patients who received additional systemic etanercept was 1.32 ± 0.76 (0–3). The value for patients who received systemic corticosteroid only treatment was 1.49 ± 0.90 (0–3; p = 0.171). In the chronic stage, the average score for additional etanercept treated patients was 1.64 ± 2.47 (0–14), which was significantly lower than the score for corticosteroid only treated patients (3.95 ± 5.76; range 0–33, p < 0.001) (Table 4).\n\nTable 4 Comparison between corticosteroid with or without additional etanercept treatment on Sotozono's acute and chronic stage grading score.\n\n\tCorticosteroid +\tCorticosteroid\tp-value\t\n\tetanercept\tonly\t\t\nNumber (patient/eye)\t31/62\t82/164\t\t\nGender (M/F)\t15/16\t32/50\t0.126\t\nAge (years old)\t48.00 ± 18.72\t45.79 ± 24.06\t0.601\t\nMean follow up time (days)\t485.00 ± 502.42\t360.82 ± 319.64\t0.319\t\nTime to intervention (days)\t1.96 ± 1.49\t0.78 ± 0.64\t0.003\t\nMajor causative drugs\t\nAnti-epileptics\t24 (38.71%)\t48 (29.27%)\t0.264\t\nAntibiotics\t11 (17.74%)\t26 (15.58%)\t\t\nAllopurinol\t6 (9.68%)\t10 (6.10%)\t\t\nNSAID\t6 (9.68%)\t26 (15.58%)\t\t\nSulfa drugs\t2 (3.23%)\t18 (10.98%)\t\t\nOthers\t13 (20.97%)\t36 (21.95%)\t\t\nSotozono's grading score\t\nAcute stage\t\n  Mean\t1.323\t1.488\t0.171\t\n  Std. deviation\t0.763\t0.903\t\t\n  Std. Error Mean\t0.097\t0.071\t\t\nChronic stage\t\n  Mean\t1.645\t3.951\t<0.001\t\n  Std. deviation\t2.470\t5.765\t\t\n  Std. error mean\t0.314\t0.450\t\t\n\nFinally, for surgical treatment, during the acute stage (<2 months after onset), 7 patients (13 eyes) received AM grafting (AMG) and 7 patients (14 eyes) received AM dressing (AMD) at an averaged 8.15 ± 4.5 days and 4.93 ± 4.6 days, respectively, after onset. During the chronic stage, seven patients (12 eyes) received oral mucosal transplantation to correct lid margin keratinization, 4 patients (7 eyes) received punctal occlusion to treat dry eye, and 2 patients (4 eyes) received correction of entropion (Table 5). When we compare the Sotozono's chronic stage grading scores in patients receiving AM transplantation (AMG + AMD) less than or more than 7 days after onset, we found that in AMG group and combined AMG and AMD group, the scores were significantly lower when the operation was performed <7 days (2.17 ± 2.63 vs. 15.6 ± 12.94, p = 0.031; 6.29 ± 4.69 vs. 13.60 ± 11.22, p = 0.025; Chi-squared test). This implies that patients receiving earlier AM transplantation were associated with less severe chronic SOCs (Table 5).\n\nTable 5A Surgical intervention in the acute and the chronic stage of SJS/TEN.\n\nType of\tPatient\tEye\tTime to\t\nsurgery\t(%)\t(%)\tintervention (days)\t\nAcute stage\t\n  AMG*\t7 (5.88)\t13 (5.51)\t8.15 ± 4.5 (3–15)\t\n  AMD*\t7 (5.88)\t14 (5.93)\t4.93 ± 4.6 (0–14)\t\nChronic stage\t\n  OMT*\t7 (5.88)\t12 (5.08)\t\t\n  Punctum suture\t4 (3.36)\t7 (2.97)\t\t\n  Correction of entropion\t2 (1.68)\t4 (1.69)\t\t\n\nTable 5B Comparison of Sotozono's chronic stage grading score in patients receiving AM transplantation more than or < 7 days after onset.\n\nType of surgery\tOnset to intervention\tChronic stage\tp-value\t\n\t(in days)\tgrading score\t\t\nAMG\t≧7 day (n = 7)\t15.6 ± 12.94 (4~33)\t0.031\t\n\t<7 day (n = 6)\t2.17 ± 2.63 (0~6)\t\t\nAMD\t≧7 day (n = 3)\t8.33 ± 2.08 (6~10)\t0.904\t\n\t<7 day (n = 11)\t8.55 ± 3.98 (5~16)\t\t\nAMG + AMD\t≧7 day (n = 10)\t13.60 ± 11.22 (4~33)\t0.025\t\n\t<7 day (n = 17)\t6.29 ± 4.69 (0~16)\t\t\n*AMG, Amniotic membrane graft; *AMD, Amniotic membrane dressing; *OMT, Oral mucosal transplantation.\n\nDiscussion\n\nIn multiple-country epidemiological studies of medication risk related to SJS/TEN in Asian populations (1998–2017), Wang et al. reported that antiepileptic drugs/antipsychotics (53%) were the most common category of drugs that caused SJS/TEN followed by antibiotics/antiviral agents (20%), allopurinol (19%), and NSAIDs (4%) (24). In Taiwan, Chang et al. previously reported that carbamazepine was the most common medication that caused SJS/TEN followed by allopurinol and phenytoin (8). With the ground-breaking finding that the human leukocyte antigen HLA-B*15:02 was intensively associated with carbamazepine-induced SJS/TEN in Han Chinese individuals (6), subsequent government health insurance covering HLA-B*15:02 screening dramatically reduced the incidence of carbamazepine-induced SJS/TEN (7). When all registered patients within the last 10 years were reviewed, antiepileptics were still the most common category of drugs that caused acute SOCs followed by antibiotics and allopurinol. However, allopurinol was the most common single culprit drug that caused acute SOC followed by oxcarbazepine and carbamazepine. Recently, cold medicine (antipyretic or analgesic but not antibiotics a patient takes when catching cold) was thought to be the most common drug that induces SOCs in chronic SJS/TEN (25–29). We also had similar observations in our recent study based on patients from outpatient clinics, and identified HLA B*0207 to be associated with cold medicine-induced SJS/TEN with SOCs (30). In this study, NSAID and cold medicine were found to be the most common causative medications that were associated with chronic SOCs. A significant association was noted between HLA-B*15:02 and oxcarbazepine-induced SJS/TEN; however, the incidence and severity were lower than those of carbamazepine-induced STS/TEN (31). On the other hand, although a strong association of HLA-B*5801 with allopurinol-induced SJS/TEN has been reported (32, 33), the relatively lower incidence of allopurinol-induced SJS/TEN does not support the implementation of gene screening.\n\nOne may think that patients with more severe dermatological involvement also have more severe ocular involvement. However, Morales et al. reported that although ocular damage in the acute stage was more frequent in patients with epidermal detachment >10% of the total body surface area, the SCORTEN value did not correlate with the severity of eye involvement in the acute stage (34). Heng et al. reported that the grading of acute ocular disease severity does not correlate with systemic disease severity but is significantly associated with the time to resolution of ocular involvement in TEN (35). Yip et al. also stressed that the severity of acute ocular disease and abnormal laboratory tests were not found to be significant risk factors for late complications (36).\n\nTo identify predictors for the development of chronic ocular complications, Gueudry et al. retrospectively reviewed the records for demographics, cause of the condition, and severity of ocular involvement. They found that (1) Patients with TEN had more frequent but not more severe acute ocular involvement; (2) Dry eye syndrome was the most common late complication; (3) The severity of acute ocular disease was found to be the only significant risk factor for late complications. Although late complications are more frequent in patients with severe initial eye involvement, these complications may also develop in patients without initial ocular symptoms (37). In this study, we found a good correlation between the severity of acute ocular manifestations and chronic ocular sequelae; nevertheless, we also observed that some patients with only minimal ocular involvement in the beginning deteriorated over the years due to insults from chronic inflammation, dry eye, trichiasis and lid margin keratinization. Therefore, we agree with Shanbhag et al. that patients with any acute ocular involvement regardless of severity should be seen by an ophthalmologist for life given that severe and irreversible complications can occur at any time, even decades after acute disease (38).\n\nThere are several different grading systems to define the severity of ocular involvement in chronic SJS/TEN (16, 39, 40). We chose to use Sotozono's 2007 grading system because the system includes the most observation features, each with a score range, which facilitates quantitative comparison between different groups (16). We found hyperemia to be the most common chronic stage ocular complication followed by dry eye, SPK, and meibomian gland dysfunction. However, in our hospital, not all acute SJS/TEN patients (294 patients in the last decade) were seen by ophthalmologists. It was only when patients presented with red eye or other ophthalmic symptoms that dermatologists sent out a consultation request (119 patients, 236 eyes in total). This is the major drawback in the study as this might overestimate the SOC rate given that many non-consulted patients were in fact patients without any ocular involvement. For example, the percentages of patients with acute SOCs, chronic SOCs, and late severe vision impairment (< 20/200) were 46.2, 5.9, and 10.9%, respectively, among consulted patients, but the value could be as low as 18.7, 2.4, and 3.4%, respectively, if non-examined patients were all considered free of eye involvement. This projected value would be very similar to the report by Power et al. which indicates that 16% of patients with SJS-spectrum will experience severe ocular involvement (41), and the report by Shanbhag et al. which indicates that only 3% eyes had vision worse than 20/200 after aggressive treatment (14).\n\nPreviously, a high portion of SJS/TEN patients often suffered from chronic debilitating sequelae. In 2007, Sotozono et al. reported that greater than half of their patients had final vision worse than 20/200 (74 eyes, 53.6%) with an average chronic SJS grading score of 25.66 (16). With the awareness that early and aggressive intervention in the acute stage is key to prevent long-term complications, a specific protocol for acute ocular care in SJS/TEN, including aggressive use of AMT (22, 23), was instituted at Massachusetts Eye Infirmary in January 2008, which was highly successful in reducing corneal blindness and severe vision-threatening complications (14). In the report of Shanbhag et al. after adapting the protocol, only 3% (2/78) of eyes had vision worse than 20/200 in contrast to 50% (9/18) before the protocol (14). In this study, systemic corticosteroids were administered to all but 5 patients in the acute stage, and 27 of the 30 eyes with acute grade 3 involvement received either AMG or AMD. We believe that in the last decade, aggressive systemic immunosuppressives and early AM transplantation have already contributed to reduced long-term ocular complications. In this study, the average chronic grading scores in patients receiving AMT <7 days after onset were significantly lower than those performed beyond 7 days, suggesting the beneficial effect of early AMT in reducing chronic SOCs (9, 13).\n\nIn addition to systemic corticosteroids (17, 39), other immunomodulatory medications, such as intravenous immunoglobulin (IVIG) (39, 42) and cyclosporine A (43, 44), have been used to treat acute SJS/TEN. Although IVIG was found to be ineffective, the use of cyclosporine may offer a greater mortality benefit (45) in the treatment of SJS/TEN, and cyclosporine and glucocorticosteroids were shown to be the more promising systemic immunomodulating therapies (43). Recently, our dermatology colleagues reported the beneficial effect of systemic etanercept treatment in promoting epidermal regeneration and reducing the incidence of gastrointestinal hemorrhage and mortality in acute SJS/TEN in a randomized, controlled study (19). The use of subcutaneous etanercept is generally safe, but we need to pay attention to whether there is tuberculosis, hepatitis B, hepatitis C, and serious infections before the injection. In the present study, we also found that patients receiving additional systemic etanercept exhibited better final vision and significantly lower chronic SJS/TEN grading scores. This encourages us to conduct a study to trace the long-term ocular condition in the original cohort of patients (manuscript in preparation).\n\nIn summary, we found that patients with severe acute ocular manifestations in SJS/TEN tend to suffer from chronic ocular involvement. Antiepileptics were the category of drugs that caused most acute SOCs, whilst NSAIDs and cold medicines were associated with most chronic SOCs. With aggressive medical and surgical treatment, eyes suffering from chronic complications of SJS/TEN have decreased in the last decade. Finally, systemic etanercept given in the acute stage showed promise in reducing long-term ocular morbidity; however, the efficacy and long-term benefit still await further investigation.\n\nData Availability Statement\n\nThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.\n\nEthics Statement\n\nThe studies involving human participants were reviewed and approved by Institutional Review Boards of Chang Gung Medical Foundation. Written informed consent from the participants' legal guardian/next of kin was not required to participate in this study in accordance with the national legislation and the institutional requirements.\n\nAuthor Contributions\n\nDM: writing of the manuscript, patient care and surgery. T-YT: review of electronic medical records, statistical analysis, and making of tables and figure. L-YP: review of electronic medical records, statistical analysis, and making of tables. S-YC: patient care and surgery. C-HH, H-YT, and L-KY: ophthalmic consultation. C-WL: dermatological care of patients. C-BC: dermatological care of patients and provides patient list. W-HC: dermatological care of patients and inventor of systemic etanercept treatment. All authors contributed to the article and approved the submitted version.\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The handling Editor declared a past collaboration with several of the authors DM, W-HC, and S-YC.\n\nThe authors are grateful to Biostatistical Section, Clinical Trial Center, Chang Gung Memorial Hospital (MOHW110-TDU-B-212-123005) for the statistical support.\n\nFunding. The study was supported by research grants from the Ministry of Science and Technology, Taiwan (MOST) 106-2314-B-182A-043-; and Chang Gung Memorial Hospital, Taiwan (CMPRPG1J0011) to DM.\n==== Refs\nReferences\n\n1. White KD Abe R Ardern-Jones M Beachkofsky T Bouchard C Carleton B . SJS/TEN 2017: building multidisciplinary networks to drive science and translation. J Allergy Clin Immunol Pract. (2018) 6 :38–69. 10.1016/j.jaip.2017.11.023 29310768\n2. Yang MS Lee JY Kim J Kim GW Kim BK Kim JY . Incidence of Stevens-Johnson syndrome and toxic epidermal necrolysis: a nationwide population-based study using national health insurance database in Korea. PLoS ONE. (2016) 11 :e0165933. 10.1371/journal.pone.0165933 27835661\n3. Frey N Jossi J Bodmer M Bircher A Jick SS Meier CR . The epidemiology of Stevens-Johnson syndrome and toxic epidermal necrolysis in the UK. J Invest Dermatol. (2017) 137 :1240–7. 10.1016/j.jid.2017.01.031 28202399\n4. Hsu DY Brieva J Silverberg NB Silverberg JI . Morbidity and mortality of Stevens-Johnson syndrome and toxic epidermal necrolysis in United States adults. J Invest Dermatol. (2016) 136 :1387–97. 10.1016/j.jid.2016.03.023 27039263\n5. Syu FK Pan HY Chuang PC Huang YS Cheng CY Cheng FJ . Incidence of stevens-johnson syndrome following combination drug use of allopurinol, carbamazepine and phenytoin in Taiwan: a case-control study. J Dermatol. (2018) 45 :1080–7. 10.1111/1346-8138.14528 29963717\n6. Chung WH Hung SI Hong HS Hsih MS Yang LC Ho HC . Medical genetics: a marker for Stevens-Johnson syndrome. Nature. (2004) 428 :486. 10.1038/428486a 15057820\n7. Chen P Lin JJ Lu CS Ong CT Hsieh PF Yang CC . Carbamazepine-induced toxic effects and HLA-B*1502 screening in Taiwan. N Engl J Med. (2011) 364 :1126–33. 10.1056/NEJMoa1009717 21428768\n8. Chang YS Huang FC Tseng SH Hsu CK Ho CL Sheu HM . Erythema multiforme, Stevens-Johnson syndrome, and toxic epidermal necrolysis: acute ocular manifestations, causes, and management. Cornea. (2007) 26 :123–9. 10.1097/ICO.0b013e31802eb264 17251797\n9. Shanbhag SS Hall L Chodosh J Saeed HN . Long-term outcomes of amniotic membrane treatment in acute Stevens-Johnson syndrome/toxic epidermal necrolysis. Ocul Surf. (2020) 18 :517–22. 10.1016/j.jtos.2020.03.004 32200005\n10. Sharma N Thenarasun SA Kaur M Pushker N Khanna N Agarwal T . Adjuvant role of amniotic membrane transplantation in acute ocular Stevens-Johnson Syndrome: a randomized control trial. Ophthalmology. (2016) 123 :484–91. 10.1016/j.ophtha.2015.10.027 26686968\n11. Kohanim S Palioura S Saeed HN Akpek EK Amescua G Basu S . Acute and chronic ophthalmic involvement in Stevens-Johnson syndrome/toxic epidermal necrolysis - a comprehensive review and guide to therapy. II. Ophthalmic disease. Ocul Surf. (2016) 14 :168–88. 10.1016/j.jtos.2016.02.001 26882981\n12. Ciralsky JB Sippel KC Gregory DG . Current ophthalmologic treatment strategies for acute and chronic Stevens-Johnson syndrome and toxic epidermal necrolysis. Curr Opin Ophthalmol. (2013) 24 :321–8. 10.1097/ICU.0b013e3283622718 23680755\n13. Yang Y Fung SSM Chew H Mireskandari K Ali A . Amniotic membrane transplantation for Stevens-Johnson syndrome/toxic epidermal necrolysis: the Toronto experience. Br J Ophthalmol. (2020). 10.1136/bjophthalmol-2020-316056. [Epub ahead of print].32830126\n14. Shanbhag SS Rashad R Chodosh J Saeed HN . Long-term effect of a treatment protocol for acute ocular involvement in Stevens-Johnson syndrome/toxic epidermal necrolysis. Am J Ophthalmol. (2019) 208 :331–41. 10.1016/j.ajo.2019.07.006 31326519\n15. Sotozono C Ueta M Nakatani E Kitami A Watanabe H Sueki H . Japanese research committee on severe cutaneous adverse, predictive factors associated with acute ocular involvement in Stevens-Johnson syndrome and toxic epidermal necrolysis. Am J Ophthalmol. (2015) 160 :228–37.e2. 10.1016/j.ajo.2015.05.002 25979679\n16. Sotozono C Ang LP Koizumi N Higashihara H Ueta M Inatomi T . New grading system for the evaluation of chronic ocular manifestations in patients with Stevens-Johnson syndrome. Ophthalmology. (2007) 114 :1294–302. 10.1016/j.ophtha.2006.10.029 17475335\n17. Araki Y Sotozono C Inatomi T Ueta M Yokoi N Ueda E . Successful treatment of Stevens-Johnson syndrome with steroid pulse therapy at disease onset. Am J Ophthalmol. (2009) 147 :1011.e1. 10.1016/j.ajo.2008.12.040 19285657\n18. Lin CY Wang CW Hui CR Chang YC Yang CH Cheng CY . Delayed-type hypersensitivity reactions induced by proton pump inhibitors: a clinical and in vitro T-cell reactivity study. Allergy. (2018) 73 :221–9. 10.1111/all.13235 28658503\n19. Wang CW Yang LY Chen CB Ho HC Hung SI Yang CH . The Taiwan severe cutaneous adverse reaction, randomized, controlled trial of TNF-alpha antagonist in CTL-mediated severe cutaneous adverse reactions. J Clin Invest. (2018) 128 :985–96. 10.1172/JCI93349 29400697\n20. Kobayashi A Yoshita T Sugiyama K Miyashita K Niida Y Koizumi S . Amniotic membrane transplantation in acute phase of toxic epidermal necrolysis with severe corneal involvement. Ophthalmology. (2006) 113 :126–32. 10.1016/j.ophtha.2005.09.001 16324747\n21. Shay E Kheirkhah A Liang L Sheha H Gregory DG Tseng SC . Amniotic membrane transplantation as a new therapy for the acute ocular manifestations of Stevens-Johnson syndrome and toxic epidermal necrolysis. Surv Ophthalmol. (2009) 54 :686–96. 10.1016/j.survophthal.2009.03.004 19699503\n22. Ma KN Thanos A Chodosh J Shah AS Mantagos IS . A novel technique for amniotic membrane transplantation in patients with acute Stevens-Johnson syndrome. Ocul Surf. (2016) 14 :31–6. 10.1016/j.jtos.2015.07.002 26387869\n23. Shanbhag SS Chodosh J Saeed HN . Sutureless amniotic membrane transplantation with cyanoacrylate glue for acute Stevens-Johnson syndrome/toxic epidermal necrolysis. Ocul Surf. (2019) 17 :560–4. 10.1016/j.jtos.2019.03.001 30872140\n24. Wang YH Chen CB Tassaneeyakul W Saito Y Aihara M Choon SE . Asian severe cutaneous adverse reaction, the medication risk of Stevens-Johnson syndrome and toxic epidermal necrolysis in Asians: the major drug causality and comparison with the US FDA label. Clin Pharmacol Ther. (2019) 105 :112–20. 10.1002/cpt.1071 29569740\n25. Ueta M Kannabiran C Wakamatsu TH Kim MK Yoon KC Seo KY . Trans-ethnic study confirmed independent associations of HLA-A*02:06 and HLA-B*44:03 with cold medicine-related Stevens-Johnson syndrome with severe ocular surface complications. Sci Rep. (2014) 4 :5981. 10.1038/srep05981 25099678\n26. Ueta M . Cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe ocular complications-phenotypes and genetic predispositions. Taiwan J Ophthalmol. (2016) 6 :108–18. 10.1016/j.tjo.2016.06.001 29018724\n27. Wakamatsu TH Ueta M Tokunaga K Okada Y Loureiro RR Costa KA . Human leukocyte antigen class I genes associated with Stevens-Johnson syndrome and severe ocular complications following use of cold medicine in a Brazilian population. JAMA Ophthalmol. (2017) 135 :355–60. 10.1001/jamaophthalmol.2017.0074 28278336\n28. Jongkhajornpong P Lekhanont K Pisuchpen P Chantaren P Puangsricharern V Prabhasawat P . Association between HLA-B*44:03-HLA-C*07:01 haplotype and cold medicine-related Stevens-Johnson syndrome with severe ocular complications in Thailand. Br J Ophthalmol. (2018) 102 :1303–7. 10.1136/bjophthalmol-2017-311823 29706602\n29. Tangamornsuksan W Chanprasert S Nadee P Rungruang S Meesilsat N Ueta M . HLA genotypes and cold medicine-induced Stevens-Johnson syndrome/toxic epidermal necrolysis with severe ocular complications: a systematic review and meta-analysis. Sci Rep. (2020) 10 :10589. 10.1038/s41598-020-67610-5 32601360\n30. Ma KS Chung WH Hsueh YJ Chen SY Tokunaga K Kinoshita S . Human leucocyte antigen association of patients with Stevens-Johnson syndrome/toxic epidermal necrolysis with severe ocular complications in Han Chinese. Br J Ophthalmol. (2021). 10.1136/bjophthalmol-2020-317105. [Epub ahead of print].33441319\n31. Chen CB Hsiao YH Wu T Hsih MS Tassaneeyakul W Jorns TP . Taiwan severe cutaneous adverse reaction, risk and association of HLA with oxcarbazepine-induced cutaneous adverse reactions in Asians. Neurology. (2017) 88 :78–86. 10.1212/WNL.0000000000003453 27913699\n32. Chung WH Hung SI . Genetic markers and danger signals in stevens-johnson syndrome and toxic epidermal necrolysis. Allergol Int. (2010) 59 :325–32. 10.2332/allergolint.10-RAI-0261 20962567\n33. Hung SI Chung WH Liou LB Chu CC Lin M Huang HP . HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proc Natl Acad Sci USA. (2005) 102 :4134–9. 10.1073/pnas.0409500102 15743917\n34. Morales ME Purdue GF Verity SM Arnoldo BD Blomquist PH . Ophthalmic manifestations of Stevens-Johnson syndrome and toxic epidermal necrolysis and relation to SCORTEN. Am J Ophthalmol. (2010) 150 :505–10.e1. 10.1016/j.ajo.2010.04.026 20619392\n35. Heng JS Malik N Joshi N Hayes M Jones I Fuller LC . Severity of acute ocular involvement is independently associated with time to resolution of ocular disease in toxic epidermal necrolysis patients. Br J Ophthalmol. (2015) 99 :251–4. 10.1136/bjophthalmol-2014-305506 25138767\n36. Yip LW Thong BY Lim J Tan AW Wong HB Handa S . Ocular manifestations and complications of Stevens-Johnson syndrome and toxic epidermal necrolysis: an Asian series. Allergy. (2007) 62 :527–31. 10.1111/j.1398-9995.2006.01295.x 17313402\n37. Gueudry J Roujeau JC Binaghi M Soubrane G Muraine M . Risk factors for the development of ocular complications of Stevens-Johnson syndrome and toxic epidermal necrolysis. Arch Dermatol. (2009) 145 :157–62. 10.1001/archdermatol.2009.540 19221260\n38. Shanbhag SS Chodosh J Fathy C Goverman J Mitchell C Saeed HN . Multidisciplinary care in Stevens-Johnson syndrome. Ther Adv Chronic Dis. (2020) 11 :2040622319894469. 10.1177/2040622319894469 32523661\n39. Kim DH Yoon KC Seo KY Lee HS Yoon SC Sotozono C . The role of systemic immunomodulatory treatment and prognostic factors on chronic ocular complications in Stevens-Johnson syndrome. Ophthalmology. (2015) 122 :254–64. 10.1016/j.ophtha.2014.08.013 25262319\n40. Sharma N Venugopal R Maharana PK Chaniyara M Agarwal T Pushker N . Multistep grading system for evaluation of chronic ocular sequelae in patients with Stevens-Johnson syndrome. Am J Ophthalmol. (2019) 203 :69–77. 10.1016/j.ajo.2019.01.028 30731084\n41. Power WJ Ghoraishi M Merayo-Lloves J Neves RA Foster CS . Analysis of the acute ophthalmic manifestations of the erythema multiforme/Stevens-Johnson syndrome/toxic epidermal necrolysis disease spectrum. Ophthalmology. (1995) 102 :1669–76. 10.1016/S0161-6420(95)30811-1 9098260\n42. Yip LW Thong BY Tan AW Khin LW Chng HH Heng WJ . High-dose intravenous immunoglobulin in the treatment of toxic epidermal necrolysis: a study of ocular benefits. Eye. (2005) 19 :846–53. 10.1038/sj.eye.6701653 15389280\n43. Zimmermann S Sekula P Venhoff M Motschall E Knaus J Schumacher M . Systemic immunomodulating therapies for Stevens-Johnson syndrome and toxic epidermal necrolysis: a systematic review and meta-analysis. JAMA Dermatol. (2017) 153 :514–22. 10.1001/jamadermatol.2016.5668 28329382\n44. Hall LN Shanbhag SS Rashad R Chodosh J Saeed HN . The effects of systemic cyclosporine in acute Stevens-Johnson syndrome/toxic epidermal necrolysis on ocular disease. Ocul Surf. (2020) 19 :128–32. 10.1016/j.jtos.2020.05.003 32445836\n45. Kirchhof MG Miliszewski MA Sikora S Papp A Dutz JP . Retrospective review of Stevens-Johnson syndrome/toxic epidermal necrolysis treatment comparing intravenous immunoglobulin with cyclosporine. J Am Acad Dermatol. (2014) 71 :941–7. 10.1016/j.jaad.2014.07.016 25087214\n\n", "fulltext_license": "CC BY", "issn_linking": "2296-858X", "issue": "8()", "journal": "Frontiers in medicine", "keywords": "Stevens-Johnson syndrome; Taiwan; amniotic membrane transplantation; etanercept; ocular complication; toxic epidermal necrolysis", "medline_ta": "Front Med (Lausanne)", "mesh_terms": null, "nlm_unique_id": "101648047", "other_id": null, "pages": "661891", "pmc": null, "pmid": "34055837", "pubdate": "2021", "publication_types": "D016428:Journal Article", "references": "17313402;29706602;28329382;19699503;30872140;15389280;33441319;27039263;27913699;20962567;25979679;27835661;17475335;32445836;29400697;16324747;32200005;26882981;32523661;25087214;29310768;17251797;31326519;15743917;9098260;32830126;19285657;28202399;32601360;21428768;30731084;29018724;28658503;25138767;26686968;20619392;28278336;23680755;25262319;29569740;25099678;29963717;26387869;15057820;19221260", "title": "Clinical Aspects of Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis With Severe Ocular Complications in Taiwan.", "title_normalized": "clinical aspects of stevens johnson syndrome toxic epidermal necrolysis with severe ocular complications in taiwan" }
[ { "companynumb": "TW-GLAXOSMITHKLINE-TWCH2021GSK069360", "fulfillexpeditecriteria": "1", "occurcountry": "TW", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "IBUPROFEN" }, "drugadditional": "3...
{ "abstract": "Gemcitabine plus nab-paclitaxel is the current standard chemotherapy for patients with metastatic pancreatic cancer. We conducted a phase I/II study in Japan, in which high response rates and manageable toxicity were observed. In this study, two patients were reported as experiencing pancreatitis due to chemotherapy. In general, pancreatitis is sometimes observed when the tumor involves the pancreatic duct, and the onset is observed before the diagnosis or at the initial stage. The onset of pancreatitis in these cases was unique and observed after the start of chemotherapy. Pancreatitis may be induced by the alleviation of stenosis of the pancreatic duct associated with tumor shrinkage.", "affiliations": "Division of Hepatobiliary and Pancreatic Oncology, Kanagawa Cancer Center, Japan.;Department of Medical Oncology, Kyorin University Faculty of Medicine, Japan.;Department of Hepatobiliary and Pancreatic Oncology, National Cancer Center Hospital, Japan.;Department of Hepatobiliary and Pancreatic Oncology, National Cancer Center Hospital East, Japan.;Division of Hepatobiliary and Pancreatic Oncology, Kanagawa Cancer Center, Japan.;Department of Gastroenterology, Aichi Cancer Center Hospital, Japan.;Department of Cancer Survey and Gastrointestinal Oncology, Osaka International Cancer Institute, Japan.;Department of Medical Oncology, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, Japan.;Department of Medical Oncology, St. Marianna University School of Medicine Hospital, Japan.;Department of Medical Oncology, Kyorin University Faculty of Medicine, Japan.", "authors": "Ueno|Makoto|M|;Nagashima|Fumio|F|;Ueno|Hideki|H|;Ikeda|Masafumi|M|;Ohkawa|Shinichi|S|;Mizuno|Nobumasa|N|;Ioka|Tatsuya|T|;Omuro|Yasushi|Y|;Nakajima|Takako Eguchi|TE|;Furuse|Junji|J|", "chemical_list": "C520255:130-nm albumin-bound paclitaxel; D000418:Albumins; D003841:Deoxycytidine; C056507:gemcitabine; D017239:Paclitaxel", "country": "Japan", "delete": false, "doi": "10.2169/internalmedicine.2362-18", "fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 3124323310.2169/internalmedicine.2362-18Case ReportPhase I/II Study: Experience with the Late Onset of Acute Pancreatitis after the Start of Chemotherapy with Gemcitabine Plus nab-Paclitaxel for Metastatic Pancreatic Cancer Ueno Makoto 1Nagashima Fumio 2Ueno Hideki 3Ikeda Masafumi 4Ohkawa Shinichi 1Mizuno Nobumasa 5Ioka Tatsuya 6Omuro Yasushi 7Nakajima Takako Eguchi 8Furuse Junji 9\n1 Division of Hepatobiliary and Pancreatic Oncology, Kanagawa Cancer Center, Japan\n2 Department of Medical Oncology, Kyorin University Faculty of Medicine, Japan\n3 Department of Hepatobiliary and Pancreatic Oncology, National Cancer Center Hospital, Japan\n4 Department of Hepatobiliary and Pancreatic Oncology, National Cancer Center Hospital East, Japan\n5 Department of Gastroenterology, Aichi Cancer Center Hospital, Japan\n6 Department of Cancer Survey and Gastrointestinal Oncology, Osaka International Cancer Institute, Japan\n7 Department of Medical Oncology, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, Japan\n8 Department of Medical Oncology, St. Marianna University School of Medicine Hospital, Japan\n9 Department of Medical Oncology, Kyorin University Faculty of Medicine, JapanCorrespondence to Dr. Makoto Ueno, uenom@kcch.jp\n\n27 6 2019 15 10 2019 58 20 2957 2962 11 11 2018 27 2 2019 Copyright © 2019 by The Japanese Society of Internal MedicineThe Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).Gemcitabine plus nab-paclitaxel is the current standard chemotherapy for patients with metastatic pancreatic cancer. We conducted a phase I/II study in Japan, in which high response rates and manageable toxicity were observed. In this study, two patients were reported as experiencing pancreatitis due to chemotherapy. In general, pancreatitis is sometimes observed when the tumor involves the pancreatic duct, and the onset is observed before the diagnosis or at the initial stage. The onset of pancreatitis in these cases was unique and observed after the start of chemotherapy. Pancreatitis may be induced by the alleviation of stenosis of the pancreatic duct associated with tumor shrinkage. \n\nadverse eventgemcitabinenab-paclitaxelpancreatic adenocarcinomataxane\n==== Body\nIntroduction\nMetastatic pancreatic cancer is associated with a poor prognosis. The 5-year overall survival of patients with metastatic pancreatic cancer is 1-2% (1,2). Recently, based on results from phase III trials, the FOLFIRINOX and gemcitabine (GEM) plus nab-paclitaxel (nab-PTX) regimen has been approved and is used as a standard chemotherapy regimen for metastatic pancreatic cancer (3,4). In Japan, a phase I/II study of GEM plus nab-PTX as chemotherapy for metastatic pancreatic cancer was performed from 2012 to 2015 to confirm the efficacy and safety. The results showed that GEM plus nab-PTX was associated with promising efficacy, and a response rate of 58.8% and median overall survival of 13.5 months, as well as acceptable toxicity, were observed (5).\n\nPancreatic cancer typically originates from the epithelium of the pancreatic duct and causes stenosis of the pancreatic duct and dilation of this duct in the caudal portion of the pancreas. In some patients who develop pancreatic cancer, pancreatitis is also observed before the diagnosis or at the initial stage; however, it typically recovers gradually with symptomatic treatment alone due to the atrophy of the caudal portion of the pancreas. We are unaware of any reports of the late onset of acute pancreatitis after chemotherapy for pancreatic cancer.\n\nIn the Japanese study, 2 of 34 (5.9%) total enrolled patients experienced the late onset of pancreatitis after the start of GEM plus nab-PTX. To our knowledge, this is the first report of the late onset of pancreatitis after the start of chemotherapy with GEM plus nab-PTX.\n\nCase Reports\nCase 1\nA woman in her 60s was diagnosed with pancreatic head cancer with metastases to the lung and paraaortic lymph nodes. The pathological diagnosis of this patient was invasive ductal carcinoma. Reported complications included hypertension (grade 3), constipation (grade 1) and hyperlipidemia (grade 1). Computed tomography (CT) with intravenous contrast revealed a pancreatic tumor measuring 22 mm in diameter, slight dilation of the pancreatic duct, and no atrophic pancreatic parenchyma (Fig. 1A and C). The patient received five cycles of GEM plus nab-PTX treatment. After five doses, the patient experienced pancreatitis (grade 3) as assessed by the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. In Cycle 2, the patient experienced grade 3 pancreatitis three times, as confirmed by CT (Fig. 1D-F).\n\nFigure 1. Computed tomography (CT) findings for Case 1. A: Pancreatic head cancer prior to chemotherapy, 22 mm in diameter (arrows). B: Pancreatic head cancer on Cycle 4 Day 21, 19 mm in diameter (best response) (arrows). C: The body and tail of the pancreas prior to chemotherapy. D1-3: The body and tail of the pancreas when Grade 3 pancreatitis (arrowheads) was observed on Cycle 2 Day 10. CT image of ascites (circle). E: The body and tail of the pancreas when Grade 3 pancreatitis (arrowhead) was observed on Cycle 2 Day 24. F: The body and tail of the pancreas when Grade 3 pancreatitis (arrowhead) was observed on Cycle 2 Day 32.\n\nThe dosing regimen, changes in amylase values, C-reactive protein (CRP) levels and the grade of pancreatitis are shown in Fig. 2. Serum amylase and CRP levels were elevated to 3,665 IU/L and 10.8 mg/dL respectively, at 1 month after the start of chemotherapy. CT showed a low density in the pancreas parenchyma with slight dilation of the pancreatic duct and acute necrotic collection (ANC). Nafamostat mesilate was administered to treat the pancreatitis, and the patient was instructed to temporarily fast; fluid replacement of 3 L/day was performed. After the initial onset of pancreatitis was resolved, GEM plus nab-PTX was resumed; however, acute pancreatitis with ANC continued to recur every few weeks, with nafamostat mesilate again administered in response. In Cycle 5, the patient was treated with GEM monotherapy. However, acute pancreatitis with ANC recurred again. Finally, the pancreatitis successfully resolved by one month after the onset of the last episode. Although the patient's response to the chemotherapy was stable disease based on the Response Evaluation Criteria in Solid Tumors (RECIST) v1.1, a 13.4% decrease in the sum of the longest diameters of the patient's primary lesions was observed (Fig. 1B).\n\nFigure 2. Changes in amylase values and the grade of pancreatitis for Case 1.\n\nCase 2\nA man in his 50s was diagnosed with pancreatic head cancer with metastases to the liver. The patient had obstructive jaundice and had undergone placement of a covered metallic stent before the start of chemotherapy. The pathological diagnosis for the patient was invasive ductal carcinoma. Reported complications included cholestasis (grade 1). CT with intravenous contrast revealed a pancreatic tumor measuring 25 mm in diameter, slight dilation of the pancreatic duct and no atrophic pancreatic parenchyma (Fig. 3A and C).\n\nFigure 3. Computed tomography (CT) findings for Case 2. A: Pancreatic head cancer prior to chemotherapy, 25 mm in diameter (arrows). B: Pancreatic head cancer on Cycle 8 Day 16, 9 mm in diameter (best response) (arrows). C: The body and tail of the pancreas prior to chemotherapy. D1-4: The body and tail of the pancreas when Grade 2 pancreatitis (arrowheads) was observed on Cycle 3 Day 9. CT scan of ascites (circle). E: The body and tail of the pancreas when Grade 3 pancreatitis with WON (arrowhead) was observed on Cycle 4 Day 15. F: The body and tail of the pancreas when Grade 3 pancreatitis with continuous cyst drainage (arrowhead) was observed on Cycle 9 Day 23.\n\nThe patient received 10 cycles of GEM plus nab-PTX treatment. Treatment was discontinued due to disease progression. After two months, the patient experienced a partial response according to RECIST v1.1 (Fig. 3B), and slight pancreatitis (grade 2) with ANC as assessed by CTCAE version 4.0 in the caudal portion of the pancreas was observed. Pancreatitis was also confirmed by CT (Fig. 3D1-4). Furthermore, CT showed a low-density area in the body of the pancreatic parenchyma as well as surrounding the tail of the pancreas. Gabexate mesilate and fluid replacement of 3 L/day were administered, and the patient was instructed to temporarily fast.\n\nAfter resuming the administration of GEM plus nab-PTX, the pancreatitis (grade 3) recurred. Although pancrelipase and camostat mesilate were administered, the pancreatitis worsened (grade 4). It became associated with a walled-off necrosis (WON), and the CRP level increased to 29.9 mg/dL in Cycle 4 (Fig. 3E). Endoscopic ultrasound-guided cyst drainage was performed, and the patient's infection recovered. GEM plus nab-PTX was resumed and continued for 10 months with continuous cyst drainage. Although the pancreatitis recurred, severe pancreatitis did not develop (Fig. 3F). The dosing regimen, changes in amylase values and CRP levels and the grade of pancreatitis are shown in Fig. 4.\n\nFigure 4. Changes in amylase values and the grade of pancreatitis for Case 2.\n\nDiscussion\nPancreatitis caused by pancreatic cancer occurs on occasion, with a reported rate of 3% (6). In general, acute pancreatitis is sometimes induced when the pancreatic duct is stenosed due to pancreatic cancer. However, because of atrophy of the caudal pancreas, most patients do not develop pancreatitis, and pancreatitis usually occurs before the diagnosis or at the initial stage of pancreatic cancer. At later stages, the frequency of pancreatitis decreases due to the progression of pancreatic parenchyma atrophy. In the present two patients, pancreatitis was observed with a late onset, after several courses of chemotherapy. Such patients are very rare and are not typically observed after the start of chemotherapy for pancreatic cancer.\n\nGEM plus nab-PTX was associated with a high response rate (58.8%), and the waterfall plots showed significant tumor shrinkage. Tumor shrinkage rather than drug toxicity, patient predisposition or concomitant medications may have been responsible for the late onset of pancreatitis after starting chemotherapy with GEM plus nab-PTX. Acute pancreatitis may be induced by the alleviation of stenosis of the pancreatic duct associated with tumor shrinkage. In addition, restraint of the atrophy of the pancreatic parenchyma and pancreatic juice stagnation may have also been involved. In these two patients, slight dilation of the pancreatic duct was observed, and the pancreatitis seemed to recur easily. In addition, in Case 2, the presence of a biliary metallic stent seemed to worsen the pancreatitis (7).\n\nOf note, there have been no reports of similar events of pancreatitis with FOLFIRINOX, which is an equally effective chemotherapy regimen. These pancreatitis cases were therefore thought to be associated with either pancreatic duct obstruction or drug-induced pancreatitis. The detailed reasons for the present findings are unclear due to the limited evidence available at present. There have been no reports of correlations between GEM plus nab-PTX and late onset of pancreatitis. However, there have been reports of improvement in pancreatic parenchyma fibrosis caused by GEM plus nab-PTX (8), which may improve the pancreatic function and be related to the late onset of pancreatitis.\n\nConclusion\nTwo patients experienced the late onset of pancreatitis after the start of GEM plus nab-PTX. As this condition can become serious, due consideration should be given to the risk of pancreatitis as a possible complication with GEM plus nab-PTX.\n\n\nAuthor's disclosure of potential Conflicts of Interest (COI).\n\nMakoto Ueno: Honoraria, Taiho Pharmaceutical. Fumio Nagashima: Honoraria, Taiho Pharmaceutical; Research funding, Taiho Pharmaceutical. Hideki Ueno: Honoraria, Taiho Pharmaceutical. Masafumi Ikeda: Honoraria, Taiho Pharmaceutical. Shinichi Ohkawa: Honoraria, Taiho Pharmaceutical. Nobumasa Mizuno: Honoraria, Taiho Pharmaceutical; Research funding, Taiho Pharmaceutical. Tatsuya Ioka: Honoraria, Taiho Pharmaceutical; Research funding, Taiho Pharmaceutical. Takako Eguchi Nakajima: Honoraria, Taiho Pharmaceutical; Research funding, Taiho Pharmaceutical. Junji Furuse: Honoraria, Taiho Pharmaceutical; Research funding, Taiho Pharmaceutical.\n\nFinancial Support\nThis study (JapicCTI-121987) was sponsored by Taiho Pharmaceutical.\n\nAcknowledgement\nWe would like to thank all of the patients and their families who participated in this study, as well as the investigators and their teams.\n==== Refs\n1. \nSohal DP , Mangu PB , Khorana AA , et al \nMetastatic pancreatic cancer: American Society of Clinical Oncology Clinical Practice Guideline . J Clin Oncol \n34 : 2784 -2796 , 2016 .27247222 \n2. \nGong J , Tuli R , Shinde A , Hendifar AE \nMeta-analyses of treatment standards for pancreatic cancer . Mol Clin Oncol \n4 : 315 -325 , 2016 .26998283 \n3. \nConroy T , Desseigne F , Ychou M , et al \nFOLFIRINOX versus gemcitabine for metastatic pancreatic cancer . N Engl J Med \n364 : 1817 -1825 , 2011 .21561347 \n4. \nVon Hoff DD , Ervin T , Arena FP , et al \nIncreased survival in pancreatic cancer with nab-paclitaxel plus gemcitabine . N Engl J Med \n369 : 1691 -1703 , 2013 .24131140 \n5. \nUeno H , Ikeda M , Ueno M , et al \nPhase I/II study of nab-paclitaxel plus gemcitabine for chemotherapy-naive Japanese patients with metastatic pancreatic cancer . Cancer Chemother Pharmacol \n77 : 595 -603 , 2016 .26842789 \n6. \nImamura M , Asahi S , Yamauchi H , Tadokoro K , Suzuki H \nMinute pancreatic carcinoma with initial symptom of acute pancreatitis . J Hepatobiliary Pancreat Surg \n9 : 632 -636 , 2002 .12541052 \n7. \nIsayama H , Nakai Y , Kogure H , Yamamoto N , Koike K \nBiliary self-expandable metallic stent for unresectable malignant distal biliary obstruction: which is better: covered or uncovered? \nDig Endosc \n25 (Suppl ): 71 -74 , 2013 .\n8. \nVon Hoff DD , Ramanathan RK , Borad MJ , et al \nGemcitabine plus nab-paclitaxel is an active regimen in patients with advanced pancreatic cancer: a phase I/II trial . J Clin Oncol \n29 : 4548 -4554 , 2011 .21969517\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "0918-2918", "issue": "58(20)", "journal": "Internal medicine (Tokyo, Japan)", "keywords": "adverse event; gemcitabine; nab-paclitaxel; pancreatic adenocarcinoma; taxane", "medline_ta": "Intern Med", "mesh_terms": "D000208:Acute Disease; D000368:Aged; D000418:Albumins; D000971:Antineoplastic Combined Chemotherapy Protocols; D021441:Carcinoma, Pancreatic Ductal; D003841:Deoxycytidine; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D017239:Paclitaxel; D010190:Pancreatic Neoplasms; D010195:Pancreatitis; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "9204241", "other_id": null, "pages": "2957-2962", "pmc": null, "pmid": "31243233", "pubdate": "2019-10-15", "publication_types": "D002363:Case Reports; D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article", "references": "26842789;21969517;27247222;21561347;26998283;23617653;12541052;24131140", "title": "Phase I/II Study: Experience with the Late Onset of Acute Pancreatitis after the Start of Chemotherapy with Gemcitabine Plus nab-Paclitaxel for Metastatic Pancreatic Cancer.", "title_normalized": "phase i ii study experience with the late onset of acute pancreatitis after the start of chemotherapy with gemcitabine plus nab paclitaxel for metastatic pancreatic cancer" }
[ { "companynumb": "JP-TEVA-2019-JP-1153189", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "PACLITAXEL" }, "drugadditional": "1", ...
{ "abstract": "BACKGROUND\nNon-steroidal anti-inflammatory drugs (NSAIDs) induce acute kidney injury (AKI) in volume-depleted patients; however the prevalence of this complication is likely underestimated. We assessed the impact of ibuprofen exposure on renal function among dehydrated children with acute gastroenteritis (AGE) to further characterize NSAID-associated AKI.\n\n\nMETHODS\nOver a 1-year period dehydrated children with AGE (n = 105) were prospectively enrolled and grouped as cases, presenting with AKI (n = 46) or controls, not presenting with AKI (n = 59). AKI was defined by pediatric RIFLE (pRIFLE) criteria.\n\n\nRESULTS\nAmong the children enrolled in the study, AKI prevalence was 44 %, and 34 (54 %) of the 63 patients who received ibuprofen developed renal impairment. Relative to the controls, children presenting with AKI were younger (median age 0.66 vs. 1.74 years; p < 0.001) and received ibuprofen more frequently (74 vs. 49 %, p = 0.01). After adjusting for the degree of dehydration, ibuprofen exposure remained an independent risk factor for AKI (p < 0.001, odds ratio 2.47, 95 % confidence interval 1.78-3.42). According to the pRIFLE criteria, 17 patients were at the 'risk' stage of AKI severity, 24 were at the 'injury' stage, and five were at the 'failure' stage; none required dialysis. Distribution of patients within categories was similar regardless of ibuprofen exposure. All cases fulled recovered from AKI.\n\n\nCONCLUSIONS\nIbuprofen-associated AKI was 54 % in our cohort of dehydrated children with AGE. Drug exposure increased the risk for developing AKI by more than twofold, independent of the magnitude of the dehydration.", "affiliations": "Nephrology Unit, Hospital General de Niños Pedro de Elizalde, Montes de Oca 40, 1270, Ciudad Autónoma de Buenos Aires, Argentina, abalestracci@yahoo.com.ar.", "authors": "Balestracci|Alejandro|A|;Ezquer|Mauricio|M|;Elmo|María Eugenia|ME|;Molini|Andrea|A|;Thorel|Claudia|C|;Torrents|Milagros|M|;Toledo|Ismael|I|", "chemical_list": "D000894:Anti-Inflammatory Agents, Non-Steroidal; D007052:Ibuprofen", "country": "Germany", "delete": false, "doi": "10.1007/s00467-015-3105-7", "fulltext": null, "fulltext_license": null, "issn_linking": "0931-041X", "issue": "30(10)", "journal": "Pediatric nephrology (Berlin, Germany)", "keywords": null, "medline_ta": "Pediatr Nephrol", "mesh_terms": "D058186:Acute Kidney Injury; D000293:Adolescent; D000894:Anti-Inflammatory Agents, Non-Steroidal; D001118:Argentina; D002648:Child; D002675:Child, Preschool; D003681:Dehydration; D005260:Female; D005500:Follow-Up Studies; D005759:Gastroenteritis; D006801:Humans; D007052:Ibuprofen; D007223:Infant; D007231:Infant, Newborn; D008297:Male; D015995:Prevalence; D011379:Prognosis; D011446:Prospective Studies; D013997:Time Factors", "nlm_unique_id": "8708728", "other_id": null, "pages": "1873-8", "pmc": null, "pmid": "25895445", "pubdate": "2015-10", "publication_types": "D016428:Journal Article", "references": "17331245;23872929;14977711;17344039;23360563;2025537;19083019;8604285;9374563;951142;17396113;17638093;15289767;17293366;19345549;9424574;16894011;21357332;20419362;9113963;18228043;15973524;14745553;10506264;18695832;19651573;3176471", "title": "Ibuprofen-associated acute kidney injury in dehydrated children with acute gastroenteritis.", "title_normalized": "ibuprofen associated acute kidney injury in dehydrated children with acute gastroenteritis" }
[ { "companynumb": "AR-PFIZER INC-2015439576", "fulfillexpeditecriteria": "1", "occurcountry": "AR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "IBUPROFEN" }, "drugadditional": null, ...
{ "abstract": "We report a case of severe COVID-19 pneumonia complicated by fatal co-infection with a multi-triazole resistant Aspergillus fumigatus and highlight the importance of recognising the significance of Aspergillus sp. isolation from respiratory samples. Early diagnosis and detection of triazole resistance are essential for appropriate antifungal therapy to improve outcome in patients with coronavirus associated invasive aspergillosis.", "affiliations": "Department of Microbiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.;Department of Medicine, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.;Department of Microbiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.;Department of Anaesthesia and Intensive Care, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.;Department of Radiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.;Department of Microbiology, St. James's Hospital, Dublin, Ireland.;Department of Microbiology, St. James's Hospital, Dublin, Ireland.;Department of Microbiology, St. James's Hospital, Dublin, Ireland.;Department of Microbiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland.", "authors": "Mohamed|Aia|A|;Hassan|Tidi|T|;Trzos-Grzybowska|Marta|M|;Thomas|Jubil|J|;Quinn|Aidan|A|;O'Sullivan|Maire|M|;Griffin|Auveen|A|;Rogers|Thomas R|TR|;Talento|Alida Fe|AF|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.mmcr.2020.06.005", "fulltext": "\n==== Front\nMed Mycol Case Rep\nMed Mycol Case Rep\nMedical Mycology Case Reports\n2211-7539\nElsevier\n\nS2211-7539(20)30042-7\n10.1016/j.mmcr.2020.06.005\nCAPA Case Report\nMulti-triazole-resistant Aspergillus fumigatus and SARS-CoV-2 co-infection: A lethal combination\nMohamed Aia a\nHassan Tidi b\nTrzos-Grzybowska Marta a\nThomas Jubil c\nQuinn Aidan d\nO'Sullivan Maire fg\nGriffin Auveen f\nRogers Thomas R. fg\nTalento Alida Fe talenta@tcd.ie\nalida.talento@hse.ie\nae∗\na Department of Microbiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland\nb Department of Medicine, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland\nc Department of Anaesthesia and Intensive Care, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland\nd Department of Radiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland\ne Department of Microbiology, Royal College of Surgeons, Ireland, Dublin, Ireland\nf Department of Microbiology, St. James's Hospital, Dublin, Ireland\ng Deparment of Clinical Microbiology, Trinity College Dublin, Dublin, Ireland\n∗ Corresponding author. Department of Microbiology, Our Lady of Lourdes Hospital Drogheda, Co. Louth, Ireland. talenta@tcd.iealida.talento@hse.ie\n26 6 2020\n3 2021\n26 6 2020\n31 1114\n10 6 2020\n19 6 2020\n21 6 2020\n© 2020 The Author(s)\n2020\nThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nWe report a case of severe COVID-19 pneumonia complicated by fatal co-infection with a multi-triazole resistant Aspergillus fumigatus and highlight the importance of recognising the significance of Aspergillus sp. isolation from respiratory samples. Early diagnosis and detection of triazole resistance are essential for appropriate antifungal therapy to improve outcome in patients with coronavirus associated invasive aspergillosis.\n\nKeywords\n\nCOVID-19 pneumonia\nInvasive pulmonary aspergillosis\nMulti-triazole resistance\n==== Body\n1 Introduction\n\nSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2), causing COVID-19 infection, is a newly recognised pathogen that has been traced to Wuhan (Hubei province) in China [1]. The clinical spectrum of COVID-19 varies from asymptomatic infection to severe pneumonia requiring mechanical ventilation. The overall case fatality rate is estimated to be 2.7%, which increases to 4.5% in those ≥ 60 years old [2]. Secondary infections with bacterial and fungal pathogens have been reported in patients with COVID-19 pneumonia which may be due to virus induced mucosal damage and/or the dysregulated immune response seen in patients with acute respiratory distress syndrome [3,4].\n\nWe report severe COVID-19 pneumonia with multi-triazole-resistant Aspergillus fumigatus co-infection in a patient not known to be immunocompromised to highlight the importance of early diagnosis and detection of triazole resistance.\n\n2 Case\n\nA 66-year-old male presented to the emergency department with a history of progressive shortness of breath (SOB), myalgia, headaches, non-productive cough and fever.\n\nTwo days previously, he had contacted his general practitioner (GP) describing a seven-day history of fever and cough. He had returned from the United Kingdom eight days earlier after visiting a relative who was subsequently diagnosed with COVID-19. He was advised to self-isolate and monitor his symptoms. Due to progressive SOB, he re-presented to his GP who referred him to the hospital for further management.\n\nThe patient had Type 2 diabetes mellitus, hypertension, hyperlipidaemia and obesity with a body mass index of 35.5 (weight 90kg) with no hospital admissions in the past eight years. His medications included metformin, aspirin, simvastatin and ramipril. He had no history of prior triazole antifungal therapy. He was an ex-smoker but had not been previously diagnosed to have chronic lung disease. He works as a ground maintenance personnel where he is exposed to fungicides daily.\n\nOn presentation, a portable chest radiograph was performed which showed unilateral peripheral left basal airspace shadowing (Fig. 1A). In view of the clinical presentation, radiographic findings and the recent exposure history, the patient was admitted under contact and droplet precautions.Fig. 1 A. Portable chest radiograph taken on day of admission showing unilateral peripheral left basal airspace shadowing. B. Portable chest radiograph taken on Day 12 of hospitalization (Day 20 of COVID-19 infection). The endotracheal tube and bilateral central lines are in satisfactory position. There has been interval progression of the left peripheral airspace shadowing with additional right upper and lower zone peripheral airspace shadowing with no evidence of cavitation.\n\nFig. 1\n\nOn admission (Day 7 of COVID-19 illness), the patient was noted to be pyrexial (temperature of 38.6 °C), tachycardic (pulse rate of 174 beats per minute) with new onset atrial fibrillation, normotensive (BP 117/69 mmHg), tachypnic (24 breaths per minute) with oxygen saturation of 84% on room air. He was commenced on a trial of continuous positive airway pressure with oxygen therapy. Preliminary laboratory results revealed white cell count of 4.7 × 109/L (reference range 4.0–11.0 × 109/L), neutrophil count 3.0 × 109/L (reference range 2.0–7.0 × 109/L), lymphocyte count 0.8 × 109/L (reference range 1.0–3.0 × 109/L) and C-reactive protein of 118 mg/L (reference range < 5.0 mg/L). Nasopharyngeal and oropharyngeal swabs detected SARS-CoV-2 using real-time reverse transcriptase polymerase chain reaction on day 3. He was commenced on azithromycin (500 mg on day 1 and 250 once daily on days 2 and 3) and hydroxychloroquine (200 mg twice daily) orally as per our local protocol at that time.\n\nOn day 4 (Day 11 of COVID-19 illness) he developed worsening hypoxic respiratory failure with a Sequential Organ Failure Assessment (SOFA) score of 6 necessitating intensive care unit (ICU) admission for ventilatory support. The patient was proned initially for 15 hours which did not improve his oxygenation. This, combined with significant hemodynamic instability, were contraindications for further proning. His condition continued to deteriorate progressing to multi-organ failure on day 7 (Day 14 of COVID-19 illness) which included acute respiratory failure, acute kidney injury requiring continuous renal replacement therapy and vasopressor support due to septic shock. His SOFA score increased to 12. He had continuing pyrexia and copious amounts of purulent respiratory secretions prompting a repeat septic screen which included culture of blood and endotracheal aspirate (ETA).\n\nEmpiric antimicrobial therapy for hospital-acquired pneumonia with intravenous (IV) piperacillin-tazobactam (4.5g three times a day) was started. Subsequently, ETA culture grew Klebsiella varicola (susceptible to piperacillin-tazobactam), Aspergillus sp. and Candida albicans. Antifungal therapy with IV liposomal amphotericin B (3 mg per kg once daily) was commenced due to the patients rapidly deteriorating status and uncertainty of the full identification of the mould isolate which may be resistant to triazoles. The Aspergillus sp. was referred for further identification and antifungal susceptibility testing, as were serum samples for detection of 1–3, β-d-glucan (BDG) antigen and galactomannan (GM) antigen and ETA for GM antigen.\n\nHis SOFA score on day 11 (Day 18 of COVID-19 illness) increased to 16. Antibiotic therapy was escalated to IV meropenem (1g twice daily) and vancomycin, with dosing based on renal function, due to ongoing pyrexia and deteriorating status. He was not prescribed systemic steroids at any time during his critical illness.\n\nA repeat portable chest radiograph on day 12 (Day 20 of COVID-19 illness) showed progression to additional right upper and lower zone peripheral airspace shadowing with no evidence of cavitation (Fig. 1B). He remained haemodynamically unstable which precluded further radiological investigations. In view of his non-responsive multi-organ failure, and after discussion with his family, the patient's life-support was withdrawn. He died on day 14 of hospitalization (Day 22 of COVID-19 illness).\n\nThe Aspergillus sp. isolated from the ETA was confirmed to be A. fumigatus. Phenotypic testing utilising a 4-well triazole resistance screen (VIP check™, Mediaproducts BV, The Netherlands) (Fig. 2A and B) as well as determination of minimum inhibitory concentrations (MIC) utilising gradient strips (Liofilchem, Waltham MA, USA) were suggestive of triazole resistance (Table 1) [5]. The MIC to amphotericin was 0.125 mg/L (susceptible ≤ 1 mg/L) [5]. Genotypic testing utilising a commercial assay (Aspergenius™, Pathonostics B.V. The Netherlands) on the ETA detected A. fumigati complex with the TR34L98H resistance mutation in the cyp51A gene, the most common mutation in triazole-resistant A. fumigatus originating from an environmental source. The serum and ETA GM optical density index (ODI) were 1.1 and 5.5 respectively (Platelia™ Aspergillus Ag EIA, WA, USA). Serum BDG was 202 pg per milliliter (Fungitell™ Assay, Associates of Cape Cod, USA). These results (Table 1) were consistent with severe COVID-19 pneumonia and triazole-resistant invasive pulmonary aspergillus co-infection.Fig. 2 A and B VIPcheck™ plate, a four well triazole resistance screen plate which contains itraconazole (I) 4 mg per liter, voriconazole (V) 2 mg per liter, posaconazole.\n\n(P) 0.5 mg per liter, and growth control (GC). This is a simple phenotypic test used to screen for triazole resistance due to the common mutations in the cyp51A gene in A. fumigatus from an environmental source. The photos show a susceptible control strain AF293 (2A) where growth is only seen on GC well and the patient's isolate (2B) with growth in all wells consistent with findings seen in A. fumigatus with the cyp51A TR34/L98H mutation.\n\nFig. 2\n\nTable 1 Laboratory results.\n\nTable 1\tPatient's Isolate\nA. fumigatus\taClinical breakpoint\n> Resistant\t\nAntifungal Susceptibility Test\t\t\t\nMinimum inhibitory\t\t\t\nconcentration (MIC) mg/L\t\t\t\nVoriconazole\t2.0\t1\t\nItraconazole\t>32\t1\t\nPosaconazole\t1.0\t0.25\t\nAmphotericin B\t0.125\t1\t\nFungal antigensb\tPatient's results\tCut-off\t\nGalactomannan Optical\t\t\t\nDensity Index (ODI)\t\t\t\nSerum\t1.1\t≥ 0.5\t\nTracheal aspirate\t5.5\tN/A\t\n1,3 β-d-glucan pg/mL\t\t\t\nSerum\t202\t≥ 80\t\na Based on the European Committee on Antimicrobial Susceptibility testing guidelines.\n\nb Fungal antigens: Galactomannan cut-off based on Platelia™ Aspergillus Ag EIA and 1–3 β-d-glucan cut-off based on Fungitell™ assay.\n\n3 Discussion\n\nPreviously known to cause infections in severely immunocompromised patients, A. fumigatus is now recognised as an emerging pathogen in critical care patients suffering chronic respiratory disorders and as a complication of severe influenza infection [6]. Aspergillus colonisation can rapidly lead to invasive aspergillosis following severe influenza infection due to multiple pathways including structural lung damage coupled with disruption of mucociliary clearance, leukopenia, Th1/Th2 imbalance and diffuse damage to the respiratory mucosa [7]. In addition, severe respiratory viral infections such as influenza have been identified as an independent risk factor for IPA with high mortality [6]. Although our patient did not receive steroids, their use in critical care patients is linked to increased risk of invasive fungal infections [6]. Like other causes of viral pneumonias, SARS-CoV-2 may impair local mucosal and systemic immune defenses [3].\n\nThirty-four cases of COVID-19 associated invasive aspergillosis (CAPA) have been reported to date [[8], [9], [10], [11], [12], [13], [14], [15], [16], [17]]. These were all patients with severe pneumonia with adult respiratory distress symdome, most of whom had no known history of immunocompromise. These has led to challenges in early diagnosis since most of them do not have the classical risk factors for invasive aspergillosis.\n\nHistopathology and culture from sterile site samples and biopsy remain the gold standard for proven IPA however the definition of probable or “putative” IPA has expanded but remains to be a composite of the host factors, clinical features and mycological evidence [6,18]. Although severe viral pneumonia is not considered a risk factor for IPA or other invasive mould disease according to the European Organisation for Research and Treatment of Cancer/Mycoses Study Group definitions, the structural damage to the lung parenchyma, in addition to the dysregulated immune response, can lead to IPA [6]. Recently a panel of experts proposed a case definition for influenza associated invasive aspergillosis (IAPA) which may be useful to classify COVID-19 patients with invasive aspergillosis. Following this case definition a patient with COVID-19 detected in respiratory sample by PCR, pulmonary infiltrates and a positive serum or bronchoalveolar lavage galactomannan has criteria consistent with probable CAPA [19]. Our patient had radiographic findings consistent with COVID-19 pneumonia. Unfortunately, his clinical status did not allow for computed tomography (CT) to be performed. Other mycological evidence of IPA include culture of Aspergillus sp. from non-sterile sites or detection of fungal antigens such as serum BDG. Our patient had COVID-19 pneumonia, A. fumigatus from a tracheal aspirate with elevated serum BDG and GM and elevated ETA GM, findings consistent with COVID-19 and probable IPA co-infection.\n\nMulti-triazole resistance in A. fumigatus has recently emerged and is linked to the use of triazole-containing compounds as agricultural fungicides or less commonly prolonged triazole use [20]. The former mechanism of resistance typically affects azole näive patients and is characterised by elevated MICs to itraconazole, voriconazole and posaconazole as was found in our patient. This is of serious concern since triazoles are recommended as the first-line and most effective treatment for IPA [21]. Of the 34 cases reported so far, only 7 cases had reported susceptibility results of which one was triazole resistant A. fumigatus [16] similar to our case. Our patient's exposure to fungicides daily in his work has most likely led to exposure and colonisation with triazole-resistant A. fumigatus which was further supported by detection of cyp51A TR34L98H mutation from our patient's ETA, the most prevalent triazole resistance mutation from environmental source [20].\n\nThis case highlights the importance of early evaluation of patients with COVID-19 pneumonia because of the risk of secondary or co-infection with fungal pathogens. Case definitions have been proposed for IAPA [6,19] which can be modified for early recognition of CAPA. The occurrence of multi-triazole resistance in this case emphasises the urgent need for antifungal drug susceptibility testing of Aspergillus isolates using a rapid and simple phenotypic method and/or by detection of Cyp51 gene associated triazole resistance mutations directly on respiratory samples.\n\nFunding sources\n\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nDeclaration of competing interestCOI\n\nT.R.Rogers has received grants and personal fees from 10.13039/100005564 Gilead Sciences , personal fees from 10.13039/100015278 Pfizer Healthcare Ireland , personal fees from Menarini Pharma outside the submitted work, A.F.Talento has received grant and personal fees from 10.13039/100005564 Gilead Sciences and personal fees from 10.13039/100015278 Pfizer Healthcare Ireland outside the submitted work. The other authors have no conflict of interests.\n==== Refs\nReferences\n\n1 Zhu N. Zhang D. Wang W. Li X. Yang B. Song J. A novel coronavirus from patients with pneumonia in China, 2019 N. Engl. J. Med. 382 8 2020 727 733 31978945\n2 Verity R. Okell L.C. Dorigatti I. Winskill P. Whittaker C. Imai N. Estimates of the severity of coronavirus disease 2019 : a model-based analysis Lancet Infect. Dis. 3099 20 2020 1 9\n3 Qin Chuan Zhou Luoqi Hu Ziwei Zhang Shuoqi Yang Sheng Yu Tao Xie Cuihong Ma Ke Shang Ke Wang Wei Tian Dai-Shi Dysregulated immune response in patients with COVID-19 in Wuhan China Clin. Infect. Dis. 2020 In press\n4 Xu Z. Shi L. Wang Y. Zhang J. Huang L. Zhang C. Pathological findings of COVID-19 associated with acute respiratory distress syndrome Lancet Respir. Med. Internet 8 4 2020 420 422 10.1016/S2213-2600(20)30076-X Available from:\n5 European committee on antimicrobial susceptibility testing [internet] [cited 2020 Apr 9]. Available from: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/AFST/Clinical_breakpoints/AFST_BP_v10.0_200204.pdf 2020\n6 Schauwvlieghe A.F.A.D. Rijnders B.J.A. Philips N. Verwijs R. Vanderbeke L. Van Tienen C. Invasive aspergillosis in patients admitted to the intensive care unit with severe influenza: a retrospective cohort study Lancet Respir. Med. Internet 6 10 2018 782 792 Available from: https://linkinghub.elsevier.com/retrieve/pii/S2213260018302741\n7 Garcia-Vidal C. Barba P. Arnan M. Moreno A. Ruiz-Camps I. Gudiol C. Invasive aspergillosis complicating pandemic influenza A (H1N1) infection in severely immunocompromised patients Clin. Infect. Dis. 53 6 2011 16 19\n8 Lescure F.-X. Bouadma L. Nguyen D. Parisey M. Wicky P.-H. Behillil S. Clinical and virological data of the first cases of COVID-19 in Europe: a case series Lancet Infect. Dis. 2 20 2020 1 10\n9 Alanio A, Dellière S, Fodil S, Bretagne S. High Prevalence of Putative Invasive Pulmonary Aspergillosis in Critically Ill COVID-19 Patients. :1–5.\n10 Koehler P. Cornely O.A. Böttiger B.W. Dusse F. Eichenauer D.A. Fuchs F. COVID-19 associated pulmonary aspergillosis Mycoses April 2020 528 534 32339350\n11 Prattes J. Valentin T. Hoenigl M. Talakic E. Reisinger Pe A.C. Invasive pulmonary aspergillosis complicating COVID-19 in the ICU - a case report Med. Mycol. Case Rep. 2020 In press\n12 Antinori S. Rech R. Galimberti L. Castelli A. Angeli E. Fossali T. Invasive pulmonary aspergillosis complicating SARS-CoV-2 pneumonia: a diagnostic challenge Trav. Med. Infect. Dis. April 2020 101752\n13 Blaize M. Mayaux J. Nabet C. Lampros A. Marcelin A.-G. Thellier M. Fatal invasive aspergillosis and coronavirus disease in an immunocompetent patient Emerg. Infect. Dis. 26 7 2020\n14 van Arkel A.L.E. Rijpstra T.A. Belderbos H.N.A. van Wijngaarden P. Verweij P.E. Bentvelsen R.G. COVID-19 associated pulmonary aspergillosis Am. J. Respir. Crit. Care Med. 2020 1 10\n15 Lahmer T. Rasch S. Spinner C. Geisler F. Schmid R.M. Huber W. Invasive pulmonary aspergillosis in severe coronavirus disease 2019 pneumonia Clin. Microbiol. Infect. Internet xxxx 2020 10.1016/j.cmi.2020.05.032 2019–20. Available from:\n16 Meijer Eelco F.J. Dofferhoff Anton S.M. Hoiting Oscar Buil J.B. Meis J. Azole Resistant COVID-19 Associated Pulmonary Aspergillosis in an Immunocompetent Host : a Case Report 2020 (June)\n17 Rutsaert L. Steinfort N. Van Hunsel T. Bomans P. Naesens R. Mertes H. COVID-19-associated invasive pulmonary aspergillosis Ann. Intensive Care Internet 10 1 2020 71 Available from: http://www.ncbi.nlm.nih.gov/pubmed/32488446\n18 Blot S.I. Taccone F.S. Van Den Abeele A.M. Bulpa P. Meersseman W. Brusselaers N. A clinical algorithm to diagnose invasive pulmonary aspergillosis in critically ill patients Am. J. Respir. Crit. Care Med. Internet 186 1 2012 56 64 Available from: http://www.embase.com/search/results?subaction=viewrecord&from=export&id=L365165397\n19 Verweij Paul E. Rjinders Bart J.A. Brüggemann Roger J.M. Azoulay Ellie Bassetti Matteo Blot Stijn Calandra Thierry Cornely Oliver Review of Influenza-Associated Pulmonary Aspergillosis and Proposal for a Case Definition: an Expert Opinion 2020 Intensive Care Med Press\n20 Verweij Paul E. Mellado Emilia Melchers W. Multiple-triazole resistant aspergillosis N. Engl. J. Med. 356 2007 1481 1483\n21 Patterson T.F. Thompson G.R. Denning D.W. Fishman J.A. Hadley S. Herbrecht R. Practice guidelines for the diagnosis and management of aspergillosis: 2016 update by the infectious diseases society of America Clin. Infect. Dis. 63 4 2016 e1 60 27365388\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2211-7539", "issue": "31()", "journal": "Medical mycology case reports", "keywords": "COVID-19 pneumonia; Invasive pulmonary aspergillosis; Multi-triazole resistance", "medline_ta": "Med Mycol Case Rep", "mesh_terms": null, "nlm_unique_id": "101598259", "other_id": null, "pages": "11-14", "pmc": null, "pmid": "32837879", "pubdate": "2021-03", "publication_types": "D002363:Case Reports", "references": null, "title": "Multi-triazole-resistant Aspergillus fumigatus and SARS-CoV-2 co-infection: A lethal combination.", "title_normalized": "multi triazole resistant aspergillus fumigatus and sars cov 2 co infection a lethal combination" }
[ { "companynumb": "IE-TEVA-2021-IE-1927299", "fulfillexpeditecriteria": "1", "occurcountry": "IE", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "AZITHROMYCIN ANHYDROUS" }, "drugadditional": nu...
{ "abstract": "BACKGROUND\nTreatment of germ cell tumours with cisplatin-based chemotherapy results in cure for the majority of patients. There is, however, a small but significant mortality rate, reported to be higher in patients with multiple co-morbidities.\n\n\nMETHODS\nWe report our management of a renal transplant patient with spina bifida, who was diagnosed with stage IIIC, poor-risk, non-seminomatous germ cell carcinoma. A marker-negative partial response, which has been maintained more than 2 years following completion of treatment, was seen following chemotherapy with cisplatin and etoposide. Performance status has been preserved at pre-treatment levels.\n\n\nCONCLUSIONS\nAdministration of cisplatin-based chemotherapy is feasible for treatment of renal transplant patients with advanced non-seminomatous germ cell tumours. Treatment strategies require careful planning and monitoring. Dose modifications may be required. This case highlights a favourable outcome in spite of multiple obstacles to ideal management.", "affiliations": "Department of Medical Oncology, Cork University Hospital, Ireland.", "authors": "Graham|Donna M|DM|;Plant|William D|WD|;Mayer|Nick J|NJ|;Power|Derek G|DG|", "chemical_list": "D005047:Etoposide; D002945:Cisplatin", "country": "Switzerland", "delete": false, "doi": "10.1159/000356837", "fulltext": null, "fulltext_license": null, "issn_linking": "0378-584X", "issue": "36(12)", "journal": "Onkologie", "keywords": null, "medline_ta": "Onkologie", "mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D002945:Cisplatin; D005047:Etoposide; D006801:Humans; D007676:Kidney Failure, Chronic; D016030:Kidney Transplantation; D008297:Male; D009367:Neoplasm Staging; D009373:Neoplasms, Germ Cell and Embryonal; D016135:Spinal Dysraphism; D016896:Treatment Outcome", "nlm_unique_id": "7808556", "other_id": null, "pages": "760-2", "pmc": null, "pmid": "24356568", "pubdate": "2013", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Metastatic germ cell tumour following renal transplantation.", "title_normalized": "metastatic germ cell tumour following renal transplantation" }
[ { "companynumb": "IE-MYLANLABS-2015M1011778", "fulfillexpeditecriteria": "1", "occurcountry": "IE", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": null, ...
{ "abstract": "Rapid eye movement (REM) sleep behavioral disorder is characterized by the absence of muscular atonia during REM sleep. In this disorder, patients can violently act out their dreams, placing them at risk for traumatic fractures during these episodes. REM sleep behavioral disorder (RBD) can be a sign of future neurodegenerative disease and has also been found to be a side effect of certain psychiatric medications. We present a case of venlafaxine-induced RBD in a 55 year old female who presented with a 13 year history of intermittent parasomnia and dream enactment in addition to a recent history of two fractures requiring intervention.", "affiliations": "School of Medicine, University of Texas Medical Branch, Galveston, TX, USA.;Department of Family Medicine, University of Texas Medical Branch, Galveston, TX, USA.", "authors": "Ryan Williams|R|R|;Sandigo|Gustavo|G|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.tcr.2017.10.017", "fulltext": "\n==== Front\nTrauma Case RepTrauma Case RepTrauma Case Reports2352-6440Elsevier S2352-6440(17)30054-710.1016/j.tcr.2017.10.017ArticleVenlafaxine-induced REM sleep behavioral disorder presenting as two fractures☆ Ryan Williams R. rrwillia@utmb.edua⁎Sandigo Gustavo ba School of Medicine, University of Texas Medical Branch, Galveston, TX, USAb Department of Family Medicine, University of Texas Medical Branch, Galveston, TX, USA⁎ Corresponding author at: 301 University Boulevard, Galveston, TX 77555, USA.301 University BoulevardGalvestonTX77555USA rrwillia@utmb.edu28 10 2017 10 2017 28 10 2017 11 18 19 25 10 2017 © 2017 The Authors2017This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Rapid eye movement (REM) sleep behavioral disorder is characterized by the absence of muscular atonia during REM sleep. In this disorder, patients can violently act out their dreams, placing them at risk for traumatic fractures during these episodes. REM sleep behavioral disorder (RBD) can be a sign of future neurodegenerative disease and has also been found to be a side effect of certain psychiatric medications. We present a case of venlafaxine-induced RBD in a 55 year old female who presented with a 13 year history of intermittent parasomnia and dream enactment in addition to a recent history of two fractures requiring intervention.\n\nKeywords\nREM sleepParasomniaVenlafaxineFracture\n==== Body\nIntroduction\nREM sleep behavior disorder is a condition in which the patient lacks atonia during REM sleep and therefore has the ability to physically act out dreams [1]. RBD can occur as a primary (idiopathic) disorder or secondary to obstructive sleep apnea, narcolepsy, α-synucleinopathies, or psychiatric medications [1]. Selective serotonin reuptake inhibitors (SSRIs), serotonin-norepinephrine reuptake inhibitors (SNRIs), and tricyclic antidepressants are typically the causative agents of medication-induced RBD; however, antipsychotics may also be to blame [2]. Antidepressants have even been shown to increase muscle tone during REM sleep in people who do not have RBD [3]. There is also a theory that RBD due to medication may actually be an earlier presentation of RBD secondary to neurodegenerative conditions because those with medication-induced RBD have an increased risk of α-synucleinopathies compared to the general population [4].\n\nThe typical clinical presentation of a patient with RBD includes intermittent complex motor behaviors and/or vocalization during REM sleep. These movements appear purposeful and can range from gentle and subtle to violent and thrashing. Injuries during these episodes can be life and limb threatening as well as costly for the patient and the healthcare system as a whole; therefore, prompt recognition and treatment is necessary to forego these preventable risks and expenses.\n\nReport of a case\nA 55 year old Caucasian female presented to the sleep medicine clinic with a chief complaint of insomnia and sleepwalking. She complained of sleep onset and maintenance insomnia as well as waking up feeling unrefreshed and tired the following day. She also complained of sleepwalking and sleepeating, usually occurring around 2:30 in the morning. Her husband sleeps in another room every night because she frequently punches and kicks during sleep and had unknowingly hit him before. She sustained two fractures as a result of these nighttime behaviors. About one year ago, she fractured the base of her left fifth metatarsal and was treated with a fracture boot. She also sustained a comminuted, dorsally-displaced right distal radius fracture requiring open reduction and internal fixation with a plate and screws. She reported that all of these symptoms gradually began about 13 years ago. She admitted to decreased interest and pleasure in hobbies, feeling down, depressed and hopeless. She denied snoring, cataplexy, hypnopompic/hypnagogic hallucinations, and sleep paralysis. She has a past medical history of bipolar disorder, generalized anxiety disorder, attention deficit disorder, hypothyroidism and gastroesophageal reflux disorder. Past surgical history was positive for abdominoplasty, gastric bypass, and right wrist open reduction internal fixation. No one in her family had experienced any similar symptoms. The patient denied smoking, alcohol, and illicit drug use. She was taking lamotrigine, venlafaxine, ziprasidone, methylphenidate, levothyroxine, and pantoprazole. Physical examination was unremarkable.\n\nUpon further questioning and medication review, it was ascertained that she started venlafaxine 13 years ago. It wasn't until after the start of this medication that her symptoms began. The patient underwent polysomnography which had no focal findings of an RBD episode. Venlafaxine was then cross-titrated with buproprion. She was originally taking venlafaxine extended release 150 milligrams (mg) which was decreased to 37.5 mg for 7 days and then stopped. Buproprion extended release was started at 150 mg for 6 days and increased to 300 mg. Methylphenidate 54 mg was tapered and stopped as well. She noticed her symptoms became less frequent and she was able to sleep longer and feel refreshed the next day. Upon stopping the medication she had complete resolution of her symptoms. She did, however, report starting having more vivid dreams. She denied nightmares but described these dreams as being exceptionally colorful and vibrant.\n\nDiscussion\nThe exact mechanism of RBD or medication-induced RBD has not yet been elucidated. However, there are theories of how atonia is lost during REM sleep in these conditions. Under normal conditions, motoneurons are hyperpolarized leaving the skeletal muscle unable to contract. Activation of both the GABA-ergic and glycinergic systems have been shown to account for this phenomenon [5]. Inhibition of excitatory cell systems such as glutamate, noradrenaline, and serotonin is another reason for REM sleep muscle atonia [5]. Therefore, inhibition of the GABA and glycine systems and overactivation of the excitatory systems are possible pathological mechanisms of RBD. However, the serotonergic system has been found to not be the etiology of this disease spectrum [6].\n\nOur patient suffered from venlafaxine-induced RBD for around 13 years. Unfortunately, none of her other providers recognized her symptoms as possible side effects of her psychiatric medication. She even suffered through two fractures and had to undergo surgery because of it. She was treated by discontinuing the causative medication and starting another psychiatric medication from a different class in its place. Other possible treatments of RBD include pramipexole, clonazepam, and melatonin [5]. The gold standard of RBD diagnosis is a positive polysomnography (PSG) along with sleep history; however, the test-retest reliability of objective tests like PSG is low for RBD [7]. Our patient was diagnosed by sleep history alone and the diagnosis was confirmed when her symptoms resolved upon discontinuation of venlafaxine.\n\nAll medical professionals should be aware of REM sleep behavioral disorder and medication-induced RBD and should have a low threshold to refer to a sleep medicine specialist if their patients are experiencing concerning symptoms.\n\nConflict of interest statement\nNone.\n\nRole of the funding source\nNone.\n\n☆ This work has not been presented at any meeting.\n==== Refs\nReferences\n1 Lee K. Baron K. Soca R. Attarian H. The prevalence and characteristics of REM sleep without atonia (RSWA) in patients taking antidepressants J. Clin. Sleep Med. 12 3 2016 Mar 351 355 26446247 \n2 Tan L. Zhou J. Liang B. Li Y. Lei F. Du L. Yang L. Li T. Tang X.A. Case of quetiapine-induced rapid eye movement sleep behavior disorder Biol. Psychiatry 79 5 2016 Mar 1 e11 2 25444160 \n3 McCarter S.J. St. Louis E.K. Sandness D.J. Arndt K.A. Erickson M.K. Tabatabai G.M. Boeve B.F. Silber M.H. Antidepressants increase REM sleep muscle tone in patients with and without REM sleep behavior disorder Sleep 38 6 2015 Jun 1 907 917 25325487 \n4 Postuma R.B. Gagnon J.F. Tuineaig M. Bertrand J.A. Latreille V. Desjardins C. Montplaisir J.Y. Antidepressants and REM sleep behavior disorder: isolated side effect or neurodegenerative signal Sleep 36 11 2013 Nov 1 1579 1585 24179289 \n5 Peever J. Luppi P.H. Montplaisir J. Breakdown in REM sleep circuitry underlies REM sleep behavior disorder Trends Neurosci. 37 5 2014 May 31 279 288 24673896 \n6 Arnaldi D. Famà F. De Carli F. Morbelli S. Ferrara M. Picco A. Accardo J. Primavera A. Sambuceti G. Nobili F. The role of the serotonergic system in REM sleep behavior disorder Sleep 38 9 2015 Sep 1 1505 1509 25845692 \n7 Neikrug A.B. Ancoli-Israel S. Diagnostic tools for REM sleep behavior disorder Sleep Med. Rev. 16 5 2012 Oct 31 415 429 22169258\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2352-6440", "issue": "11()", "journal": "Trauma case reports", "keywords": "Fracture; Parasomnia; REM sleep; Venlafaxine", "medline_ta": "Trauma Case Rep", "mesh_terms": null, "nlm_unique_id": "101711730", "other_id": null, "pages": "18-19", "pmc": null, "pmid": "29644271", "pubdate": "2017-10", "publication_types": "D002363:Case Reports", "references": "25845692;24179289;22169258;25325487;24673896;25444160;26446247", "title": "Venlafaxine-induced REM sleep behavioral disorder presenting as two fractures.", "title_normalized": "venlafaxine induced rem sleep behavioral disorder presenting as two fractures" }
[ { "companynumb": "US-BAUSCH-BL-2017-031586", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ZIPRASIDONE" }, "drugadditional": null, ...
{ "abstract": "A 35-year-old parturient with antiphospholipid syndrome and a working diagnosis of hemolysis, elevated liver enzyme, and low platelets (HELLP) underwent a cesarean delivery 9 hours after receiving heparin. Her preoperative activated partial thromboplastin time and rotational thromboelastometry (ROTEM) intrinsic pathway (INTEM) clotting time were 120 and 1870 seconds, respectively. Fresh frozen plasma was administered for heparin neutralization. The ROTEM INTEM/heparinase assay (HEPTEM) ratio can help confirm heparin neutralization and guide intraoperative transfusion management.", "affiliations": "From the Departments of Anesthesiology.;From the Departments of Anesthesiology.;From the Departments of Anesthesiology.;Obstetrics, Gynecology and Reproductive Sciences, Yale School of Medicine, New Haven, Connecticut.;Obstetrics, Gynecology and Reproductive Sciences, Yale School of Medicine, New Haven, Connecticut.;From the Departments of Anesthesiology.", "authors": "Fiol|Antonio Gonzalez|AG|;Fardelmann|Kristen L|KL|;McGuire|Patsy J|PJ|;Merriam|Audrey A|AA|;Miller|Alex|A|;Alian|Aymen|A|", "chemical_list": "D006493:Heparin", "country": "United States", "delete": false, "doi": "10.1213/XAA.0000000000001182", "fulltext": null, "fulltext_license": null, "issn_linking": "2575-3126", "issue": "14(6)", "journal": "A&A practice", "keywords": null, "medline_ta": "A A Pract", "mesh_terms": "D000328:Adult; D016736:Antiphospholipid Syndrome; D002585:Cesarean Section; D005260:Female; D017359:HELLP Syndrome; D006493:Heparin; D006801:Humans; D010314:Partial Thromboplastin Time; D010949:Plasma; D011247:Pregnancy; D013916:Thrombelastography", "nlm_unique_id": "101714112", "other_id": null, "pages": "e01182", "pmc": null, "pmid": "32224689", "pubdate": "2020-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "The Application of ROTEM in a Parturient With Antiphospholipid Syndrome in the Setting of Anticoagulation for Cesarean Delivery: A Case Report.", "title_normalized": "the application of rotem in a parturient with antiphospholipid syndrome in the setting of anticoagulation for cesarean delivery a case report" }
[ { "companynumb": "US-DRREDDYS-USA/USA/20/0122277", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, "drugadditional": nul...