article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "Statin-associated necrotizing autoimmune myositis (NAM) is an autoimmune condition characterized by severe acute-onset proximal muscle weakness, a very high creatinine kinase (CK) level, and prominent myofiber necrosis and minimal lymphocytic infiltration on muscle biopsy. Unlike self-limited statin myopathy, this condition usually requires aggressive immunomodulation therapy to assist recovery and prevent future disability. In this case report, we present a patient who developed progressive muscle weakness after taking atorvastatin for one year. At initial presentation, her CK level was 28,000 U/L. She was diagnosed with statin-associated NAM and started on high-dose intravenous solumedrol, mycophenolate, and intravenous immunoglobulin (IVIG) therapy. However, she subsequently developed acute bilateral vision loss and right side hemineglect; she was diagnosed with posterior reversible encephalopathy syndrome (PRES), thought to be a possible delayed adverse reaction to IVIG. IVIG was discontinued, and the patient was treated with supportive therapy. At six-month follow-up, she had significant improvement in muscle strength and vision.",
"affiliations": "UCLA-Olive View Internal Medicine Residency Program, Sylmar, CA, USA.;Division of Rheumatology, Department of Medicine, Olive View-UCLA Medical Center, Sylmar, CA, USA.;Division of Rheumatology, Department of Medicine, Olive View-UCLA Medical Center, Sylmar, CA, USA.",
"authors": "Fung|Brian M|BM|https://orcid.org/0000-0002-2558-5733;Heinze|Emil R|ER|https://orcid.org/0000-0001-8802-3140;Wong|Andrew L|AL|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2019/4601304",
"fulltext": "\n==== Front\nCase Rep MedCase Rep MedCRIMCase Reports in Medicine1687-96271687-9635Hindawi 10.1155/2019/4601304Case ReportStatin-Associated Necrotizing Autoimmune Myositis Complicated by an Uncommon Adverse Effect to Treatment https://orcid.org/0000-0002-2558-5733Fung Brian M. brianfung@outlook.com\n1\nhttps://orcid.org/0000-0001-8802-3140Heinze Emil R. \n2\nWong Andrew L. \n2\n\n1UCLA-Olive View Internal Medicine Residency Program, Sylmar, CA, USA\n2Division of Rheumatology, Department of Medicine, Olive View-UCLA Medical Center, Sylmar, CA, USAAcademic Editor: Mark E. Shaffrey\n\n2019 25 6 2019 2019 46013043 1 2019 22 4 2019 9 6 2019 Copyright © 2019 Brian M. Fung et al.2019This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Statin-associated necrotizing autoimmune myositis (NAM) is an autoimmune condition characterized by severe acute-onset proximal muscle weakness, a very high creatinine kinase (CK) level, and prominent myofiber necrosis and minimal lymphocytic infiltration on muscle biopsy. Unlike self-limited statin myopathy, this condition usually requires aggressive immunomodulation therapy to assist recovery and prevent future disability. In this case report, we present a patient who developed progressive muscle weakness after taking atorvastatin for one year. At initial presentation, her CK level was 28,000 U/L. She was diagnosed with statin-associated NAM and started on high-dose intravenous solumedrol, mycophenolate, and intravenous immunoglobulin (IVIG) therapy. However, she subsequently developed acute bilateral vision loss and right side hemineglect; she was diagnosed with posterior reversible encephalopathy syndrome (PRES), thought to be a possible delayed adverse reaction to IVIG. IVIG was discontinued, and the patient was treated with supportive therapy. At six-month follow-up, she had significant improvement in muscle strength and vision.\n==== Body\n1. Introduction\nStatin-associated myopathy has historically been thought of as a self-limited entity associated with statin use. However, over the past decade, an autoimmune variety of statin-associated myopathy has been recognized, with different characteristics from the self-limited disease; this immune-mediated entity was initially called statin-induced immune-mediated necrotizing myopathy (IMNM) and now commonly referred to as statin-associated necrotizing autoimmune myositis (NAM) [1]. This type of myopathy usually requires aggressive immunosuppression or immunomodulation therapy with corticosteroids and/or intravenous immunoglobulin (IVIG) therapy [2, 3]. Although IVIG is generally well tolerated and has been shown to contribute to high recovery rates [4], it is not without risks [5]. In this case report, we present a patient who developed posterior reversible encephalopathy syndrome (PRES), thought to be a possible delayed adverse reaction to receiving IVIG for treatment of statin-associated NAM.\n\n2. Case Presentation\nA 53-year-old woman with past medical history of type 2 diabetes mellitus, hyperlipidemia, and depression presented to the emergency department with progressive bilateral weakness over 6 months. She reported weakness that began in her lower extremities and then progressed to her upper extremities, affecting primarily her proximal muscle strength. She had no associated numbness or tingling, fevers, chills, headache, rashes or skin changes, joint pain, or recent injury. Her medications included metformin, glyburide, aspirin, and sertraline. She was also on a high-intensity statin for the past year without any recent dosage changes.\n\nPhysical examination was significant for reduced muscle strength involving the neck, bilateral deltoids, and quadriceps. She appeared unsteady on her feet with a slightly widened gait. Deep tendon reflexes, sensation, and coordination were intact throughout all extremities. Initial labs were significant for a leukocytosis of 12,500 K/cumm, aspartate aminotransferase (AST) of 773 U/L, alanine transferase (ALT) of 763 U/L, erythrocyte sedimentation rate (ESR) of 35 mm/hr, C-reactive protein of 24 mg/L, and markedly elevated creatinine kinase (CK) of 28,000 U/L. ANA was 1 : 80 titer with a nucleolar pattern by HEp-2 indirect immunofluorescence (IF), and the anti-dsDNA antibody was negative by the Crithidia luciliae IF test (CLIFT). Magnetic resonance imaging (MRI) of the patient's pelvis revealed extensive edema throughout the proximal pelvic musculature with a symmetric distribution consistent with myositis (Figure 1). Furthermore, an electromyogram and nerve conduction study demonstrated diffuse and active irritable myopathy, and a muscle biopsy of the vastus lateralis revealed necrotizing myopathy with minimal inflammatory infiltrate and MHC1 immunostaining consistent with NAM (Figure 2).\n\nGiven the aforementioned findings, the patient was started on high-dose intravenous solumedrol, mycophenolate mofetil, and four consecutive days of IVIG for treatment of a necrotizing myositis (NM), which resulted in improvement in the creatinine kinase down to 8,000 after a week into therapy. An extended myositis panel and 3-hydroxy-3-methylglutaryl coenzyme-A (also known as HMG-CoA reductase or HMGCR) antibody test later resulted with positive PM/Scl-100 antibody (by qualitative immunoblot, ARUP Laboratories) and significantly elevated HMGCR antibody level (>200 units, by semiquantitative enzyme-linked immunosorbent assay, ARUP Laboratories), consistent with statin-associated NAM.\n\nAbout one week into the patient's treatment course, the patient developed acute bilateral vision loss and right side hemineglect. A magnetic resonance angiogram (MRA) of the head revealed development of diffuse arterial narrowing and irregularity consistent with cerebral vasospasm. Furthermore, she had areas of signal abnormality in the bilateral frontal, parietal, and occipital lobes with diffusion restriction. Consultation with neuroradiology suggested that the patient's neurological findings were consistent with PRES (Figure 3), suspected to be related to a delayed reaction to IVIG therapy. The patient was subsequently started on nimodipine and magnesium. Subsequent serial MRAs and neurological exams revealed radiographic and clinical improvement, respectively. However, her vision only improved minimally at that time. She was discharged with daily mycophenolate and sent to a rehabilitation facility to continue muscle strengthening and ambulation gait training. At 6-month follow-up, she reported marked improvement in physical strength and her vision was significantly improved; her CK returned to normal levels.\n\n3. Discussion\nBased on the patient's serological, histological, and clinical findings, a diagnosis of statin-associated NAM was made (anti-HMGCR-positive subset). Although the patient had a positive PM/Scl-100 antibody and an ANA with nucleolar pattern, she did not have any extra-muscular involvement such as interstitial lung disease, inflammatory joint disease, mechanic's hands, sclerodactyly, or Raynaud's phenomenon which would typically be seen in an overlap myositis (OM), such as an OM with scleroderma. However, it remains unknown whether she will develop additional symptoms over time. Patients with an idiopathic inflammatory myopathy (IIM) or autoimmune inflammatory myositis (AIM) can now more routinely be classified by their autoantibody pattern associated with different disease characteristics and treatment responses [1, 4]; however, we have not been able to find any studies of statin-associated NAM with a patient having both anti-HMGCR and anti-PM/Scl-100 antibodies simultaneously at the time of this report.\n\nStatin-associated NAM is an autoimmune muscle disease (and subtype of IIM) characterized by prominent myofiber necrosis and minimal lymphocytic infiltration [6]. It is strongly associated with statin exposure and the development of HMG-CoA reductase antibody, although it can also occur in patients who have never taken a statin [6]. Compared to a self-limited statin myopathy, statin-associated NAM is more commonly associated with clinical proximal muscle weakness, higher creatinine kinase values, HLA-DRB1∗11:01 positivity, an irritable myopathy on EMG, diffuse muscle edema seen on MRI, and muscle necrosis with minimal inflammation on muscle biopsy [6–8]. It is important to note that time of onset is variable and may occur even years after statin exposure [6]. Simply discontinuing statin treatment in NAM is often inadequate as muscle damage and necrosis often continues even after cessation of the statin [6, 9]. Thus, most patients require aggressive immunosuppression or immunomodulation therapy, with first-line therapy including the use of high-dose corticosteroids and/or IVIG, as well as other immunotherapies such as methotrexate, azathioprine, mycophenolate, and/or rituximab, depending on the individual patient [2, 3, 6]. Interestingly, age appears to play a role in response to therapy, with a recent cohort study finding younger patients to have more severe disease and a worse prognosis compared to older patients [10]. Furthermore, it appears that earlier and more intense treatment is associated with improved outcomes [4, 7]. In this case, the patient was treated with a combination of corticosteroids, IVIG, and mycophenolate given her younger age and severe disease presentation. A recent study has found that human anti-HMGCR antibodies can induce muscle weakness in mice and appear to be directly pathogenic towards muscle through a complement-mediated mechanism; thus, in the future, plasma exchanges and complement-targeting therapies may also play a role in the treatment of NAM [11].\n\nAlthough no randomized clinical trials have been performed to guide therapy of statin-associated NAM, IVIG has been shown to be a relatively safe and effective therapy for this autoimmune condition [4, 12]. Common adverse reactions include malaise, headache, and abdominal pain, although these reactions are generally mild [5]. However, IVIG has also been shown to be associated with several more serious adverse effects, including anaphylaxis, transfusion-associated lung injury, and thromboembolic events [13]; there are also a few case reports of PRES in patients receiving IVIG for neurological diseases such as Guillain–Barré and Miller–Fisher syndrome [14–17], including a case involving amelioration of PRES after IVIG treated early on with plasma exchange/immunoadsorption therapy [18]. However, from our review of the literature, there have been no published cases of PRES in a patient receiving IVIG for statin-associated NAM.\n\nIn this case, the patient's initial symptom of PRES was bilateral vision loss. Although the patient had a history of diabetes, a dilated fundus exam did not show any retinopathy, retinal ischemia, or anterior optic nerve involvement. Intraocular pressures were within normal ranges, and bilateral corneas and lens appeared normal. Furthermore, an MRI of the orbits was unremarkable, with normal appearing optic nerves and no intraconal mass identified. A systemic vasculitis related to the patient's newly diagnosed inflammatory myositis was also considered in the differential of the patient's neuroradiographic findings; however, the patient had interval progression of hyperintense lesions prior to improving (which would not be expected to be seen while on corticosteroid therapy). Thus, given the normal orbital and ocular structures, as well as the abnormal intracranial imaging findings, a diagnosis of PRES was made. In addition, the patient's clinical course suggests that IVIG may have been associated with the patient's development of PRES. The patient developed hyperintense lesions of her bilateral occipital regions and irregularities of the vertebral vessels after receiving IVIG treatment, similar to previously reported cases of PRES after administration of IVIG (although the reported timing of symptom onset in the literature is typically sooner, ranging between 24 hours after initiation of IVIG and 4–7 days after completion of IVIG therapy) [15–18]. Furthermore, she did not have any hypertensive episodes (or acute blood pressure fluctuations), kidney disease, signs or symptoms of infection, or electrolyte abnormalities that could otherwise explain the development of PRES [19–21].\n\nPRES is a syndrome defined by neurological signs (most commonly headache, vomiting, and visual disturbances) and radiographic abnormalities (typically hyperintense signals on T2-weighted MR imaging especially in bilateral occipital regions, responsible for vision loss) [14]. Although little is known about the pathophysiology behind this disease process, it has been postulated that sudden changes in plasma viscosity induced by IVIG infusion, vasogenic edema, and cerebral vasospasm may lead to the development of PRES [14, 22]. Treatment of PRES involves cessation of the offending agent (in this case, the course of IVIG was already completed over one week before onset of symptoms) and strict blood pressure control when elevated [23]. Magnesium (often low in patients with PRES) should be repleted given its (prophylactic) anticonvulsive and vasodilating effects [24]. Furthermore, calcium antagonists are sometimes needed in the setting of cerebral vasospasm, as was the case in our patient [23, 25]. Improvement in neurological signs and symptoms is variable, depending on the initial severity of imaging and types of complications (e.g., progression of vasogenic edema to cytotoxic edema and ischemia) [26].\n\n4. Conclusion\nThis clinical case report describes two suspected medication-induced adverse effects (statin-associated NAM and IVIG-induced PRES) in a single patient. We hope this report will serve as an important reminder that every medication can potentially have adverse effects (common, uncommon, and atypical), that the risks and benefits of each medication treatment must be considered, and that unusual/atypical adverse effects of even critical therapeutic medication treatments need to be recognized early, in order to optimize patient care outcomes.\n\nAcknowledgments\nThe authors would like to thank Dr. William H. Yong, MD, Professor of Pathology and Laboratory Medicine, at the David Geffen School of Medicine at UCLA for providing and interpreting the histopathology images of this case.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nFigure 1 (a) T1-weighted and (b) short tau inversion recovery (STIR) sequences showing edema (hyperintense areas on STIR, white arrows) in the proximal thigh muscles, characteristic of an inflammatory myositis.\n\nFigure 2 Hematoxylin and eosin-stained frozen section (400x magnification) of the vastus lateralis revealing marked fiber size variation with necrotic (black arrows) and regenerating (white arrows) myofibers consistent with a necrotizing autoimmune myositis.\n\nFigure 3 MRI T2-weighted sequence with hyperintense signal involving the occipital (arrows) and parietal lobes bilaterally, suggestive of posterior reversible encephalopathy syndrome.\n==== Refs\n1 Senécal J. L. Raynauld J. P. Troyanov Y. Editorial: a new classification of adult autoimmune myositis Arthritis & Rheumatology 2017 69 5 878 884 10.1002/art.40063 2-s2.0-85017433146 28382651 \n2 McGrath E. R. Doughty C. T. Amato A. A. Autoimmune myopathies: updates on evaluation and treatment Neurotherapeutics 2018 5 4 976 994 10.1007/s13311-018-00676-2 2-s2.0-85055704430 \n3 Mammen A. L. Tiniakou E. Intravenous immune globulin for statin-triggered autoimmune myopathy New England Journal of Medicine 2015 373 17 1680 1682 10.1056/nejmc1506163 2-s2.0-84944930649 26488714 \n4 Kassardjian C. D. Lennon V. A. Alfugham N. B. Mahler M. Milone M. Clinical features and treatment outcomes of necrotizing autoimmune myopathy JAMA Neurology 2015 72 9 996 1003 10.1001/jamaneurol.2015.1207 2-s2.0-84942238174 26192196 \n5 Bichuetti-Silva D. C. Furlan F. P. Nobre F. A. Immediate infusion-related adverse reactions to intravenous immunoglobulin in a prospective cohort of 1765 infusions International Immunopharmacology 2014 23 2 442 446 10.1016/j.intimp.2014.09.015 2-s2.0-84912129477 25257732 \n6 Christopher-Stine L. Basharat P. Statin-associated immune-mediated myopathy Current Opinion in Lipidology 2017 28 2 186 192 10.1097/mol.0000000000000399 2-s2.0-85013096178 28207435 \n7 Pinal-Fernandez I. Casal-Dominguez M. Mammen A. L. Immune-Mediated Necrotizing Myopathy Current Rheumatology Reports 2018 20 4 p. 21 10.1007/s11926-018-0732-6 2-s2.0-85044519350 \n8 Mohassel P. Mammen A. L. Anti-HMGCR Myopathy Journal of Neuromuscular Diseases 2018 5 1 11 20 10.3233/jnd-170282 2-s2.0-85043700213 29480216 \n9 Musset L. Allenbach Y. Benveniste O. Anti-HMGCR antibodies as a biomarker for immune-mediated necrotizing myopathies: a history of statins and experience from a large international multi-center study Autoimmunity Reviews Oct. 2016 15 10 983 993 10.1016/j.autrev.2016.07.023 2-s2.0-84981717423 27491568 \n10 Tiniakou E. Pinal-Fernandez I. Lloyd T. E. More severe disease and slower recovery in younger patients with anti-3-hydroxy-3-methylglutaryl-coenzyme a reductase-associated autoimmune myopathy Rheumatology (Oxford, England) 2017 56 5 787 794 \n11 Bergua C. Chiavelli H. Allenbach Y. \nIn vivo pathogenicity of IgG from patients with anti-SRP or anti-HMGCR autoantibodies in immune-mediated necrotising myopathy Annals of the Rheumatic Diseases 2019 78 1 131 139 10.1136/annrheumdis-2018-213518 2-s2.0-85054830271 30309969 \n12 Tiniakou E. Christopher-Stine L. Immune-mediated necrotizing myopathy associated with statins: history and recent developments Current Opinion in Rheumatology 2017 29 6 p. 604 10.1097/bor.0000000000000438 2-s2.0-85030755789 \n13 Orange J. S. Hossny E. M. Weiler C. R. Use of intravenous immunoglobulin in human disease: a review of evidence by members of the primary immunodeficiency committee of the American academy of allergy, asthma and immunology Journal of Allergy and Clinical Immunology 2006 117 4 S525 S553 10.1016/j.jaci.2006.01.015 2-s2.0-33645341439 16580469 \n14 Belmouaz S. Desport E. Leroy F. Posterior reversible encephalopathy induced by intravenous immunoglobulin Nephrology Dialysis Transplantation 2008 23 1 417 419 10.1093/ndt/gfm594 2-s2.0-44449164984 \n15 Nakajima M. Posterior reversible encephalopathy complicating intravenous immunoglobulins in a patient with Miller-Fisher syndrome European Neurology 2005 54 1 58 60 10.1159/000087720 2-s2.0-26944479342 16118497 \n16 Ribeiro B. N. D. F. Salata T. M. Borges R. S. Marchiori E. Posterior reversible encephalopathy syndrome following immunoglobulin therapy in a patient with Miller-Fisher syndrome Radiologia Brasileira 2016 49 1 58 59 10.1590/0100-3984.2015.0129 2-s2.0-84959510898 26929465 \n17 Voltz R. Rosen F. V. Yousry T. Beck J. Hohlfeld R. Reversible encephalopathy with cerebral vasospasm in a Guillain-Barre syndrome patient treated with intravenous immunoglobulin Neurology 1996 46 1 250 251 10.1212/wnl.46.1.250 2-s2.0-0029902656 8559387 \n18 Stetefeld H. R. Lehmann H. C. Fink G. R. Burghaus L. Posterior reversible encephalopathy syndrome and stroke after intravenous immunoglobulin treatment in miller-fisher syndrome/bickerstaff brain stem encephalitis overlap syndrome Journal of Stroke and Cerebrovascular Diseases 2014 23 9 e423 e425 10.1016/j.jstrokecerebrovasdis.2014.05.034 2-s2.0-84907983664 25149206 \n19 Hobson E. V. Craven I. Blank S. C. Posterior reversible encephalopathy syndrome: a truly treatable neurologic illness Peritoneal Dialysis International 2012 32 6 590 594 10.3747/pdi.2012.00152 2-s2.0-84870994780 23212858 \n20 Bartynski W. S. Posterior reversible encephalopathy syndrome, part 1: fundamental imaging and clinical features American Journal of Neuroradiology 2008 29 6 1036 1042 10.3174/ajnr.a0928 2-s2.0-46749155876 18356474 \n21 Camara-Lemarroy C. R. Gonzalez-Moreno E. I. Ortiz-Corona J. D. J. Posterior reversible encephalopathy syndrome due to malignant hypercalcemia: physiopathological considerations Journal of Clinical Endocrinology & Metabolism 2014 99 4 1112 1116 10.1210/jc.2013-3487 2-s2.0-84898400989 24476076 \n22 Incecik F. Hergüner M. O. Altunbasak S. Yıldızdas D. Reversible posterior encephalopathy syndrome due to intravenous immunoglobulin in a child with Guillain-Barré syndrome Journal of Pediatric Neurosciences 2011 6 2 138 140 22408666 \n23 Fischer M. Schmutzhard E. Posterior reversible encephalopathy syndrome Journal of Neurology 2017 264 8 1608 1616 10.1007/s00415-016-8377-8 2-s2.0-85008194320 28054130 \n24 Chardain A. Mesnage V. Alamowitch S. Posterior reversible encephalopathy syndrome (PRES) and hypomagnesemia: A frequent association? Revue Neurologique Jun. 2016 172 6-7 384 388 10.1016/j.neurol.2016.06.004 2-s2.0-84979658208 27371132 \n25 Lamy C. Oppenheim C. Mas J. L. Biller J. Ferro J. M. Chapter 109—Posterior reversible encephalopathy syndrome Handbook of Clinical Neurology 2014 121 Amsterdam, Netherlands Elsevier 1687 1701 \n26 Gao B. Lyu C. Lerner A. McKinney A. M. Controversy of posterior reversible encephalopathy syndrome: what have we learnt in the last 20 years? Journal of Neurology, Neurosurgery & Psychiatry 2018 89 1 14 20 10.1136/jnnp-2017-316225 2-s2.0-85040015089\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "2019()",
"journal": "Case reports in medicine",
"keywords": null,
"medline_ta": "Case Rep Med",
"mesh_terms": null,
"nlm_unique_id": "101512910",
"other_id": null,
"pages": "4601304",
"pmc": null,
"pmid": "31341481",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "16118497;16580469;17971381;18356474;22408666;23212858;24365441;24476076;25149206;25257732;26192196;26488714;26929465;27371132;27491568;28054130;28096458;28207435;28382651;28794149;28857949;29480216;29582188;30309969;30341597;8559387",
"title": "Statin-Associated Necrotizing Autoimmune Myositis Complicated by an Uncommon Adverse Effect to Treatment.",
"title_normalized": "statin associated necrotizing autoimmune myositis complicated by an uncommon adverse effect to treatment"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/19/0112485",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ATORVASTATIN"
},
"drugadditional": "1",
... |
{
"abstract": "Secondary hyperparathyroidism (SHPT) is a rare complication of furosemide therapy that can occur in patients treated with the loop diuretic for a long period of time. We report a 6-month-old 28-weeks premature infant treated chronically with furosemide for his bronchopulmonary dysplasia, who developed hypocalcemia and severe SHPT, adversely affecting his bones. Discontinuation of the loop diuretic and the addition of supplemental calcium and calcitriol only partially reversed the SHPT, bringing serum parathyroid hormone level down from 553 to 238 pg/mL. After introduction of the calcimimetic Cinacalcet, we observed a sustained normalization of parathyroid hormone concentration at 27 to 63 pg/mL and, with that correction, of all biochemical abnormalities and healing of the bone disease. No adverse effects were noted. We conclude that in cases of SHPT due to furosemide in which traditional treatment fails, there may be room to consider the addition of a calcimimetic agent.",
"affiliations": "Sections of Nephrology, Bone and Mineral Disorder Clinic, and.;Sections of Nephrology, Bone and Mineral Disorder Clinic, and.;Neonatology, The Children's Mercy Hospitals and Clinics, University of Missouri at Kansas City, Kansas City, Missouri.;Sections of Nephrology, Bone and Mineral Disorder Clinic, and.;Neonatology, The Children's Mercy Hospitals and Clinics, University of Missouri at Kansas City, Kansas City, Missouri.;Sections of Nephrology, Bone and Mineral Disorder Clinic, and ualon@cmh.edu.",
"authors": "Srivastava|Tarak|T|;Jafri|Shahryar|S|;Truog|William E|WE|;Sebestyen VanSickle|Judith|J|;Manimtim|Winston M|WM|;Alon|Uri S|US|",
"chemical_list": "D057966:Calcimimetic Agents; D010281:Parathyroid Hormone; D005665:Furosemide; D002118:Calcium; D000069449:Cinacalcet",
"country": "United States",
"delete": false,
"doi": "10.1542/peds.2016-3789",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0031-4005",
"issue": "140(6)",
"journal": "Pediatrics",
"keywords": null,
"medline_ta": "Pediatrics",
"mesh_terms": "D057966:Calcimimetic Agents; D002118:Calcium; D000069449:Cinacalcet; D005665:Furosemide; D006801:Humans; D006962:Hyperparathyroidism, Secondary; D007223:Infant; D008279:Magnetic Resonance Imaging; D008297:Male; D010281:Parathyroid Hormone",
"nlm_unique_id": "0376422",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29192005",
"pubdate": "2017-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Successful Reversal of Furosemide-Induced Secondary Hyperparathyroidism With Cinacalcet.",
"title_normalized": "successful reversal of furosemide induced secondary hyperparathyroidism with cinacalcet"
} | [
{
"companynumb": "US-VALIDUS PHARMACEUTICALS LLC-US-2018VAL000018",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ERGOCALCIFEROL"
},
"dru... |
{
"abstract": "Few reports are available on children with pre-extensively drug-resistant tuberculosis (pre-XDR-TB), which is defined as Mycobacterium tuberculosis resistant to both isoniazid and rifampicin plus resistance to either a fluoroquinolone or a second-line injectable drug. Pre-XDR-TB treatment for children usually has been individualized based on drug susceptibility test (DST) results, but treatment remains challenging due to the lack of studies based on existing treatment guidelines in children and lack of availability of the new drugs. We report two cases of pre-XDR-TB in children who have responded well to individualized treatment regimens. Because toxic drugs are used for long duration, close monitoring of adverse drug reactions is important.",
"affiliations": "Department of Child Health, Hasan Sadikin General Hospital/Faculty of Medicine, Universitas Padjadjaran, Indonesia.;Department of Child Health, Hasan Sadikin General Hospital/Faculty of Medicine, Universitas Padjadjaran, Indonesia.;Department of Child Health, Hasan Sadikin General Hospital/Faculty of Medicine, Universitas Padjadjaran, Indonesia.;Department of Child Health, Hasan Sadikin General Hospital/Faculty of Medicine, Universitas Padjadjaran, Indonesia.",
"authors": "Nataprawira|Heda Melinda|HM|;Septiane|Indah|I|;Sudarwati|Sri|S|;Wulandari|Diah Asri|DA|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2021.101544",
"fulltext": "\n==== Front\nRespir Med Case Rep\nRespir Med Case Rep\nRespiratory Medicine Case Reports\n2213-0071\nElsevier\n\nS2213-0071(21)00206-9\n10.1016/j.rmcr.2021.101544\n101544\nCase Report\nTwo cases of pre-extensively drug resistant tuberculosis in children in Indonesia\nNataprawira Heda Melinda heda_1155@yahoo.com\n∗\nSeptiane Indah\nSudarwati Sri\nWulandari Diah Asri\nDepartment of Child Health, Hasan Sadikin General Hospital/Faculty of Medicine, Universitas Padjadjaran, Indonesia\n∗ Corresponding author. heda_1155@yahoo.com\n12 11 2021\n2021\n12 11 2021\n34 1015449 11 2020\n18 5 2021\n7 11 2021\n© 2021 The Authors\n2021\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).\nFew reports are available on children with pre-extensively drug-resistant tuberculosis (pre-XDR-TB), which is defined as Mycobacterium tuberculosis resistant to both isoniazid and rifampicin plus resistance to either a fluoroquinolone or a second-line injectable drug. Pre-XDR-TB treatment for children usually has been individualized based on drug susceptibility test (DST) results, but treatment remains challenging due to the lack of studies based on existing treatment guidelines in children and lack of availability of the new drugs. We report two cases of pre-XDR-TB in children who have responded well to individualized treatment regimens. Because toxic drugs are used for long duration, close monitoring of adverse drug reactions is important.\n\nKeywords\n\nPre-extensively drug resistant tuberculosis\nChildren\nCase report\n==== Body\npmc1 Introduction\n\nThe incidence of drug–resistant tuberculosis is increasing in many areas of the world [1]. Drug resistant tuberculosis is devided in to several types such as monoresistant, polydrug-resistant, multidrug-resistant (MDR), pre-extensively drug resistant (pre-XDR), extensively drug resistant (XDR) [1,2]. In 2016, a total of 8014 cases of XDR-TB were reported to the WHO by 72 countries [3]. Estimates suggest that 650.000 children with MDR-TB, 4.7% have XDR TB, unfortunately there is still lack data of pre–XDR cases reported in children [4]. Pre-XDR TB is MDR TB plus resistance to fluoroquinolone or second line injectable drugs (capreomycin, amikacin, kanamycin) [5]. Pre-XDR TB is confirmed by M.tuberculosis culture and drug susceptibility test (DST) either genotypically (by first- and second-line line-probe assays or whole-genome sequencing) or phenotypically (by culture-based DST) [5,6]. The management of pre-XDR TB in children remains challenging because of the limited availability of the new drugs and appropriate treatment regimens guidelines. Pre–XDR TB treatment regimen for children have historically been individualized on the basis of LPA or mycobacterial DST of the organism of the child. The long duration treatment of Pre-XDR TB has lead to several adverse reactions which should be monitored frequently [7,8]. We present two cases of children diagnosed as pre-XDR TB who received individualized strategy treatment based on their culture and DST result.\n\n2 Case 1\n\nA–3 months-old-boy presented with severe malnutrition, known cholestatic jaundice diagnosed as congenital cytomegalovirus infection and contact of his father who was diagnosed with MDR-TB but was not compliant with his treatment. His tuberculin skin test was positive, chest radiograph revealed right perihilar infiltrate and X-pert MTB/RIF on gastric aspirate was positive for M. tuberculosis complex with resistance to rifampicin. Other baseline investigations revealed a small atrial septal defect on echocardiography, mild to moderate hearing loss on audiology, normal vision and retinas on ophthalmological evaluation, raised bilirubin and liver enzymes (alanine and aspartate transaminases) and positive cytomegalovirus (CMV) IgM with a negative CMV PCR. He was HIV-unexposed and his HIV ELISA was negative, but CD4% was low (19%). Culture of the gastric aspirate eventually was positive, confirming M. tuberculosis resistant to isoniazid and rifampicin on line-probe assay as well as resistant to second-line injectable agents with second-line LPA, but susceptible to the fluoroquinolones. He was therefore confirmed as pre-XDR-TB. The mother's sputum was X-pert MTB/RIF negative. The chest x-ray showed active tuberculosis with infiltrates at the right upper-middle lung field with an increased of bronchovascular marking (Fig. 1). We treated him with five kind of less hepatotoxic anti tuberculosis drugs by individualized treatment based on the updated WHO 2018 guidelines. He commenced the treatment with moxifloxacin (10 mg/kg/day divided in tow dose), linezolid (10 mg/kg/day once daily), cycloserin (10 mg/kg/day once daily), ethambutol (20 mg/kg/day once daily) and para-aminosalysilic acid (200 mg/kg/day divided in two dose). After seven days receiving the pre- XDR-TB treatment, the liver enzymes improved, no adverse reaction such as vomiting, dhiarrea was reported. He also recieved gancyclovir for the CMV infection. He was followed every one month, he shows weight increment to 5.8 kg from 3.6 kg in 3 months and increased gradually every month. His nutritional status improved to normal from severe malnutrition after 20 months of treatment. No adverse reaction such as vomiting nor dhiarrea was reported. The growth and milestones development were appropriate. Laboratory evaluation showed improvement of liver function. Hematologic and neurologic (peripheral and toxic optic neuropathy) adverse effects were monitored during linezolid treatment. No anemia nor thrombocytopenia was found. For the optic toxic neuropathy evaluation, normal vision was concluded through examination of response to light, pupil response, ability to follow a target and ophthalmoscopy examination of the retina was also done to exclude CMV retinitis symptom and the result was normal. The M.tuberculosis culture evaluation result was negative on the first and third month of treatment.Fig. 1 Chest X-Ray of a 3-months-old boy with Pre-XDR TB. It shows infiltrate at the upper-middle right lung field with an increased of bronchovascular marking.\n\nFig. 1\n\n3 Case 2\n\nA–14 years-old-girl presented with severe weight loss (severe malnutrition), with chief complaint of fever since 1 month and hemoptysis since 2 days prior. Her parents showed negative for TB screening. History of tuberculosis contact is her neighbour identified MDR-TB and received treatment in our hospital. Her X-pert MTB/RIF revealed positive Mycobacterium tuberculosis with Rifampicin resistant. Culture M. tuberculosis was positive, confirming M. tuberculosis resistant to isoniazid and rifampicin on line-probe assay as well as resistant to second-line injectable agents with second-line LPA, but susceptible to the fluoroquinolones. The chest x-ray showed active tuberculosis with opacity at the right hilar, lobulated infiltrate in the left apex, nodular at left hilar, and enlarged bilateral peri-hilar lymph nodes (Fig. 2). Before starting the therapy she was consulted to the Psychiatry, Ophthalmology and Ear, Nose and Throat department. Baseline electrocardiography (ECG) showed normal QT interval. HIV screening was negative. She started on individualized drugs regimen for pre–XDR TB with levofloxacin (10 mg/kg/day once daily), ethionamide (15 mg/kg/day once daily), cycloserine (10 mg/kg/day once daily), pyrazinamide (35 mg/kg/day once daily), para-aminosalicylic acid (PAS 200 mg/kg/day divided in two dose), bedaquiline (200 mg once daily for 2 weeks). On the second day receiving bedaquiline, the ECG showed prolonged QT interval >500 ms without any electrolyte imbalance, so bedaquiline was stopped and ECG was examined every day. She started to receive linezolid 400 mg per day (10 mg/kg/day once daily) replacing bedaquiline. There was no more prolonged QT after given linezolid. Laboratory examination and clinical manifestation was monitored due to the side effects of the therapy. During hospitalization no other adverse reaction occurred. The laboratory examination is within normal limit. After two weeks hospitalized, she was discharged. She was followed every one month, no adverse reaction of nausea, vomit, jaundice was reported. Linezolid toxicity was also observed during treatment, hematologic value was normal, no anemia nor thrombocytopenia was found, there were no vision loss and color vision test result was normal (evaluated through Ishihara test). No peripheral neuropathy signs (paresthesia, numbness in extremities) were reported. Her weight increased 2 kg after 3 months treatment and her nutritional status improved to normal weight from severe malnutrition after 20 months of treatment. The M.tuberculosis culture result was negative on the first and third month of treatment.Fig. 2 Chest X-Ray of a 14-years-olf girl with Pre-XDR TB. It shows opacity at the right hilar, lobulated infiltrate in the left apex, nodular at left hilar, and lymph node enlargement at bilateral peri-hilar.\n\nFig. 2\n\n4 Discussion\n\nWe reported two cases of children diagnosed as pre–XDR TB. To our knowledge, this is the first cases of pre–XDR TB in children in Indonesia. The incidence of drug–resistant tuberculosis is increasing in many areas of the world [1]. There are two major in types of drug resistance. Pre-XDR TB is confirmed by M.tuberculosis culture, line probe assays (LPA) and drug susceptibility test (DST). The LPA is a family of DNA strip-based test that determine of amplicons (DNA amplification products) to probes targeting the most common resistance associated mutations to first and second line drugs. Line probe assay demonstrated high sensitivity 96.7% and high specificity 98.8% for detecting pre-XDR TB and XDR-TB [6,7]. Phenotypic drug sensitivity testing (DST) in these case uses the liquid culture BACTEC Mycobacterium growth indicator tubes (MGIT) 960 system. The BACTEC MGIT 960 system is fully automated, detects high volume mycobacteria growth, detection and susceptibility testing. The results revealed in 9–15 days [8]. On both cases, the DST result was resistance to TB second line injectable drugs (kanamycin, capreomycin, amikacin) but susceptible to fluoroquinolones. Thus, in our case, both of them were diagnosed and treated based on the LPA and DST result, and the M. tuberculosis culture result was positive. Clinically, MDR-TB must be considered in children with a clinical manifestation of tuberculosis with several condition: history of tuberculosis 6–12 months prior, no improvement after first line medication for 2–3 months, contact with TB patient who died during treatment, and treatment failed [9]. In our case, both of them were suspected MDR-TB due to the history of MDR-TB contact. The management of pre-XDR TB in children remains challenging because of the limited availability of the new drugs and appropriate treatment regimens guidelines [9,10]. Pre–XDR TB treatment regimen for children have historically been individualized on the basis of LPA or mycobacterial DST of the organism of the child. WHO describes treatment strategies for MDR and pre–XDR TB is divided into standardized treatment, drug resistance surveillance (DRS) data from representative patient population are used to as the basis for regimen design in the absence of individual DST, standardized treatment is classified into conventional (20–26 months) and short term treatment (9–11 months). Individualized treatment is each regimen designed based on the patient's past history of TB treatment, and individual DST result, this strategy is used for the pre-XDR and XDR treatment [3,11,12]. In our case the patient received regimen that is based on the LPA and DSTresult. Individualized treatment should be given for at least 18–24 months of duration [10,11]. There are lack data on the optimal combination of medications and duration of treatment for pre-XDR TB in children. A systematic review reported treatment outcomes in 37 children with XDR-TB, 81% of them had a successful treatment outcome (cured and complete treatment), as defined by WHO guidelines [4]. Even though we still can't defined the treatment outcome in our patient, treatment outcomes were defined by using standard 2016 WHO MDR TB outcome definitions as classified by treating clinicians: cured (treatment completed as recommended by the national policy without evidence of failure and >3 consecutive cultures taken at least 30 days apart were negative after the intensive phase of treatment); treatment complete (as for cure but without records of negative cultures); treatment failed (treatment stopped or requiring change of 2 drugs because of persistent positive cultures at end of the intensive phase or reversion to positive cultures in the continuation phase, or evidence of additional acquired resistance or adverse drug reactions); death (for any reason while receiving treatment); or loss to follow up (treatment interruption for 2 consecutive months) [3,11]. Treatment was given based on the updated WHO 2018 guidelines, that regimen should be given at least five types of antituberculosis drug in intensive phase, four of second line that is proved still sensitive or never been used before, and one from the first line of antituberculosis drugs [1,2,12]. Every anti tuberculosis drugs was reported to have variable adverese reactions, one of them is hepatotoxic [13]. A systemic review and meta-analysis identified eight studies for a total of 315 patients with MDR-TB and pre-XDR TB, estimates for treatment success was 81.67% (95% CI), with the most common drug-related adverese events were nausea and vomiting. Other serious adverse events were hearing loss, psychiatric effects, and hypothyroidism. This suggests pre-XDR TB can be succesfully treated in children, with the overall proportion of children achieving treatment success [14]. In our first case, he had a previous elevated liver function due to cytomegalovirus infection so it was difficult to decide the best regimen for him. We started individualized regimen that is reported less hepatotoxic. The limitation of the first case is the negative result of the PCR-CMV, but this result might be influenced due to the examination that was taken after receiving 2 weeks of Gancyclovir due to the financial problems of his parents to attempt earlier examination. Mortality and defaulting seemed to be lower for children than for adults [14]. In our second case, adverse events that developed was prologed QT interval on the ECG due to bedaquiline, but it was improving after we altered to linezolid. Linezolid was reported useful and safe in treating children with pre-XDR TB [15,16]. No other adverse reactions occurred. Both of them are planned to have 18–24 months of treatment duration accordance to the WHO guidelines. Second line antituberculosis drugs used in pre-XDR TB have more adverse effects than the first line drugs. This, combined with large number of medications used for long duration, lead to frequently observed adverse effects in children on pre-XDR-TB treatment [17]. Although in this coronavirus (COVID-19) pandemic situation, both of them are assured to receive the treatment with good compliance based on the WHO guidelines to ensure continuity of essential services for all TB patients during the COVID-19 pandemic. Adequate availability TB medicines are provided to take home to ensure treatment completion without visiting hospitals or other treatment centres [18]. The limitation of our cases report is as the end of therapy outcomes were not assessed at the time of reporting this case, however interim outcomes were analyzed in details.\n\n5 Conclusion\n\nTreatment of pre-XDR TB for children remains challenging due to the lack data of treatment guidelines for children. Therefore it is important to treat children with pre–XDR TB by individualized strategy based on the clinical manifestations, line probe assays, and drug susceptibility testing result. Due to the long duration of treatment, close monitoring of adverse reaction should be done routinely. This pandemic COVID-19 situation should not be a barrier for the TB patients to receive a continuity treatment and monitoring.\n\nDeclaration of competing interest\n\nNon to declare.\n\nAcknowledgements\n\nAll authors thank to the patient's parent for giving consent of this case report publication.\n==== Refs\nReferences\n\n1 World Health Organization Multidrug-resistant Tuberculosis in Children and Adolescents in Children in WHO European Region 2019\n2 World Health Organization WHO Consolidated Guidelines on Drug-Resitant Tuberculosis Treatment 2019\n3 World Health Organization Updated WHO MDR-TB Treatment Guidelines and the Use of New Drugs in Children 2016\n4 Osman M. Harausz E. Anthony J. Prats G. Schaaf Moore B. Treatment outcomes in global systematic review and patient meta-analysis of children with extensively drug resistant tuberculosis Emerg. Infect. Dis. 25 3 2019 441 450 30789141\n5 Furin J. Seddon J. Carlos P. Mills T.A. Becerra M. Day K. Management of multidrug-resistant tuberculosis in children:A field guide Sentinel Project Pediatr. Drug-Resist. Tubercul. 2016 1 62\n6 World Health Organization The Use of Molecular Line Probe Assays for the Detection of Resistance to Second-Line Antituberculosis Drugs: Policy Guidance 2016 World Health Organization Geneva\n7 World Health Organization Technical Manual for Drug Susceptibility Testing of Medicine Used in the Treatment of Tuberculosis 2018 World Health Organization Geneva\n8 Alarcon V. Arrascue A. Ticona M. Obregon G. Cornejo G. Vargas D. Programmatic management of patients with pre-extensively drug–resistant tuberculosis in Peru, 2011–2014 Int. J. Tubercul. Lung Dis. 22 10 2018 1220 1226\n9 Harausz E. Anthony J. Law S. Schaaf S. Kredo T. Treatment and outcomes in children with multi-drug resistant tuberculosis : a systematic review and individual patient data meta-analysis PLoS Med. 15 7 2018 1 26\n10 Caminero J. Piubello A. Scardigli A. Miglori G. Proposal for a standardised treatment regimen to manage pre- and extensively drug-resistant tuberculosis cases Eur. Respir. J. 50 2017 1 9\n11 Huynh J. Marais B. Multidrug-resistant tuberculosis infection and disease in children : a review of new and repurposed drugs Ther. Adv. Infect. Dis. 6 2019 1 16\n12 Prats G. Svensson M. Weld E. Schaaf S. Hesseling C. Current status of pharmacokinetic and safety studies of multidrug-resistant tubercuosis treatment in children Int. J. Tubercul. Lung Dis. 22 2 2018 S15 S23\n13 Wu S. Zhang M. Sun F. Chen M. Zhou L. Wang N. Adverse events associated with the treatment of multidrug-resistant tuberculosis : a systematic review and meta-analysis Am. J. Therapeut. 2013 1 10\n14 Ettehad D. Schaaf S. Seddon J. Cooke G. Ford N. Treatment outcomes for children with multidrug-resistant tuberculosis :a systematic review and meta-analysis Lancet Infect. Dis. 12 2012 449 456 22373593\n15 Shah I. Dey A. Sherty Linezolid in children with drug resistant tuberculosis J. Infect. Dis. 2018 1 3 0 29506075\n16 Harausz E. Anthony J. Prats G. Seddon J. Schaaf S. Anneke C. New and repurposed drugs for pediatric multidrug-resistant tuberculosis Am. J. Respir. Crit. Care Med. 195 10 2017 1300 1310 27854508\n17 Schaaf S. Anthony J. Prats G. McKenna L. Seddon J. Challenges of using new and repurposed drugs for the treatment of multidrug resistant tuberculosis in children Expet Rev. Clin. Pharmacol. 19 2018 1 12\n18 World Health Organization Tuberculosis and COVID–19 [cited 2020 Mei 02]. Available from: https://www.who.int/tb/COVID_19considerations_tuberculosis_services.pdf 2020\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2213-0071",
"issue": "34()",
"journal": "Respiratory medicine case reports",
"keywords": "Case report; Children; Pre-extensively drug resistant tuberculosis",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "101544",
"pmc": null,
"pmid": "34824970",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "22373593;24284652;27854508;29665949;30789141;28679614;29280409;30236192;31367376;29995958;30296864",
"title": "Two cases of pre-extensively drug resistant tuberculosis in children in Indonesia.",
"title_normalized": "two cases of pre extensively drug resistant tuberculosis in children in indonesia"
} | [
{
"companynumb": "ID-MLMSERVICE-20211125-3239014-1",
"fulfillexpeditecriteria": "1",
"occurcountry": "ID",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LINEZOLID"
},
"drugadditional": "3",
... |
{
"abstract": "Otitis externa is an infection of the external auditory canal. It rarely results in facial palsy except in severe cases such as necrotizing otitis externa, which is a life-threatening invasive infection of the external auditory canal. Early recognition with prompt and appropriate treatment of necrotizing otitis externa is crucial to prevent more sinister complications. Here we report a case of an elderly gentleman who presented with otitis externa and developed facial palsy a month later. We identified possible problems that may have led to the complication so that such an occurrence can be prevented in the future.",
"affiliations": "MB, BCh, BAO, MOphthal, Department of Ophthalmology, University of Malaya Medical Centre, Kuala Lumpur, Malaysia. Email: aliyyabadaruddin@gmail.com.;FRCS, Department of Ophthalmology, University of Malaya Medical Centre, Kuala Lumpur, Malaysia.",
"authors": "Badaruddin|Aliyya|A|;Choo|May May|MM|",
"chemical_list": null,
"country": "Malaysia",
"delete": false,
"doi": "10.51866/cr1108",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1985-2274",
"issue": "16(1)",
"journal": "Malaysian family physician : the official journal of the Academy of Family Physicians of Malaysia",
"keywords": "facial nerve palsy; malignant otitis externa; necrotizing otitis externa",
"medline_ta": "Malays Fam Physician",
"mesh_terms": null,
"nlm_unique_id": "101466855",
"other_id": null,
"pages": "117-120",
"pmc": null,
"pmid": "33948150",
"pubdate": "2021-03-25",
"publication_types": "D002363:Case Reports",
"references": "12892351;3106546;24649388;12695217;16025065;24950586;4631220;3106547",
"title": "Facial nerve palsy in otitis externa: A red flag?",
"title_normalized": "facial nerve palsy in otitis externa a red flag"
} | [
{
"companynumb": "MY-EMD SERONO-9219304",
"fulfillexpeditecriteria": "1",
"occurcountry": "MY",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GLICLAZIDE"
},
"drugadditional": "3",
"... |
{
"abstract": "Burkitt lymphoma (BL) is an aggressive B-cell non-Hodgkin lymphoma that is almost uniformly associated with translocations involving the gene for MYC on chromosome 8. The 3 subtypes of BL, endemic, sporadic, and immunodeficiency-associated, differ from epidemiologic and clinical perspectives but may be genetically similar. Prompt administration of multiagent immunochemotherapy regimens is associated with favorable outcomes for the majority of patients. Survival is inferior in older patients, likely reflecting increased therapy-related toxicity, possibly resulting in decreased treatment intensity. Central nervous system prophylaxis, tumor lysis prevention and treatment, and management of infectious complications from myelosuppressive regimens are critical. Prognosis of refractory or relapsed disease is poor and patients are best treated on clinical trials when available.",
"affiliations": "Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA.;Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA.",
"authors": "Jacobson|Caron|C|;LaCasce|Ann|A|",
"chemical_list": "D003561:Cytarabine; D014750:Vincristine; D005047:Etoposide; D004317:Doxorubicin; D003520:Cyclophosphamide; D007069:Ifosfamide; D011241:Prednisone; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1182/blood-2014-06-538504",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0006-4971",
"issue": "124(19)",
"journal": "Blood",
"keywords": null,
"medline_ta": "Blood",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D002051:Burkitt Lymphoma; D003520:Cyclophosphamide; D003561:Cytarabine; D004317:Doxorubicin; D005047:Etoposide; D006801:Humans; D007069:Ifosfamide; D008297:Male; D008727:Methotrexate; D009303:Nasopharyngeal Neoplasms; D011241:Prednisone; D011379:Prognosis; D014178:Translocation, Genetic; D014750:Vincristine",
"nlm_unique_id": "7603509",
"other_id": null,
"pages": "2913-20",
"pmc": null,
"pmid": "25258344",
"pubdate": "2014-11-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "How I treat Burkitt lymphoma in adults.",
"title_normalized": "how i treat burkitt lymphoma in adults"
} | [
{
"companynumb": "US-MYLANLABS-2014M1013150",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
... |
{
"abstract": "Lacosamide (LCM) is a well-tolerated and increasingly used second-generation AED, and side effects such as atrial fibrillation are rare and poorly characterized. Supported by a literature review, we share our experience of the management of the first reported case of cardioembolic cerebral infarcts in the context of de novo atrial fibrillation, which appeared following a 200-mg intravenous infusion of LCM for the treatment of non-convulsive status epilepticus. Case report and literature review using search items including \"atrial fibrillation OR atrial flutter AND LCM\" in the thesaurus of Medline. We found three cases of atrial fibrillation/atrial flutter secondary to LCM, one following a 200-mg intravenous infusion. In one patient, previous risk factors for atrial fibrillation were reported and another was started on warfarin; all required suspension of LCM for cessation of atrial fibrillation. Previous risk factors for atrial fibrillation in our patient were older age, male gender, obesity, hypertension, valvular disease, first-degree atrioventricular block and left anterior fascicle block. Atrial fibrillation appeared at the end of the infusion and ceased after a loading dose of amiodarone and suspension of LCM. Apixaban was initiated indefinitely five days later, and MRI showed four acute silent infarctions. The appearance of atrial fibrillation has severe therapeutic and clinical implications and the use of LCM might be reconsidered within a context of increased predisposition to developing atrial fibrillation. If atrial fibrillation appears, the drug should be discontinued and anticoagulation should be considered according to embolic risk. Further investigation is needed in order to better categorize the risk profile of lacosamide regarding atrial fibrillation.",
"affiliations": "Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.;Department of Neurology, Hospital Universitario Ramón y Cajal. Madrid, Spain.",
"authors": "Corbellini|Álvaro Beltrán|ÁB|;Torre|Paula Pérez|PP|;Hristova|Velina Nedkova|VN|;Sanz|Beatriz Zarza|BZ|;García|Adriana Celdrán de Castro|ACC|;Jorge|Fernando Rodriguez|FR|;García|Juan Luís Chico|JLC|;Díaz|Paloma Parra|PP|;Catevilla|Francisco Javier Buisan|FJB|",
"chemical_list": "D000927:Anticonvulsants; D000078334:Lacosamide",
"country": "France",
"delete": false,
"doi": "10.1684/epd.2020.1136",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1294-9361",
"issue": "22(1)",
"journal": "Epileptic disorders : international epilepsy journal with videotape",
"keywords": "arrhythmia; atrial fibrillation; elderly; lacosamide; status epilepticus; stroke",
"medline_ta": "Epileptic Disord",
"mesh_terms": "D000369:Aged, 80 and over; D000927:Anticonvulsants; D001281:Atrial Fibrillation; D002544:Cerebral Infarction; D004617:Embolism; D006801:Humans; D007262:Infusions, Intravenous; D000078334:Lacosamide; D008297:Male; D013226:Status Epilepticus",
"nlm_unique_id": "100891853",
"other_id": null,
"pages": "83-89",
"pmc": null,
"pmid": "32043469",
"pubdate": "2020-02-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Cardioembolic acute cerebral micro-infarcts in the context of atrial fibrillation after low-dose intravenous infusion of lacosamide.",
"title_normalized": "cardioembolic acute cerebral micro infarcts in the context of atrial fibrillation after low dose intravenous infusion of lacosamide"
} | [
{
"companynumb": "ES-UCBSA-2019043722",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LACOSAMIDE"
},
"drugadditional": "1",
"dr... |
{
"abstract": "The front-line therapy for CLL young and fit patients is chemo-immunotherapy with fludarabine-cyclophosphamide-rituximab (FCR). FCR regimen results in a significant myelosuppression and high rates of early and late infections especially in elderly patients. German CLL study group compared FCR vs. bendamustine-rituximab (BR) in fit untreated patients. The response rates with BR or FCR were comparable, BR could be an alternative 1st-line treatment for elderly patients. Here we report retrospective data of 70 elderly (≥65 years) CLL patients from 12 Italian centers treated with BR as front-line therapy. The primary end points were overall response rate (complete remission/partial remission) and safety. Forty-seven males and 23 females, with a median age of 72 years, were included in the study. Eight patients were unfit for CIRS. The OR rate was 88.6% (31.4% CR and 57.2% PR). Progression free survival, treatment free survival and overall survival rates at 2-years were 79%, 90.3% and 89.6%, respectively. Only del17 was independent unfavorable parameter on the response rate and PFS. Our results indicate that BR front-line at standard dose provides a high response rate with a good safety profile, even if more than 50% of patients experienced a bendamustine dose reduction until 70 mg/m2.",
"affiliations": "Catholic University of the Sacred Heart, A. Gemelli Policlinic, Rome, Italy. Electronic address: l.laurenti@rm.unicatt.it.;Catholic University of the Sacred Heart, A. Gemelli Policlinic, Rome, Italy.;Catholic University of the Sacred Heart, A. Gemelli Policlinic, Rome, Italy.;Haematology Unit, \"G. Panico\" Hospital, Tricase, Lecce, Italy.;International Center for Genetic Engineering & Biotechnology, Monterotondo Scalo, Italy.;Careggi Hospital, Florence, Italy.;Tor Vergata University, Rome, Italy.;La Sapienza University, Umberto I Policlinic, Rome, Italy.;IRCCS Ca' Granda - Università degli Studi, Milan, Italy.;San Giovanni Addolorata Hospital, Rome, Italy.;S. Chiara Hospital, Pisa, Italy.;University of Messina, Messina, Italy.;A. Businco Hospital, Cagliari, Italy.;Le Scotte Policlinic, Siena, Italy.;Paolo Giaccone Policlinic, Palermo, Italy.;Catholic University of the Sacred Heart, A. Gemelli Policlinic, Rome, Italy.;Careggi Hospital, Florence, Italy.;Tor Vergata University, Rome, Italy.;Tor Vergata University, Rome, Italy.;IRCCS Ca' Granda - Università degli Studi, Milan, Italy.;San Giovanni Addolorata Hospital, Rome, Italy.;S. Chiara Hospital, Pisa, Italy.;University of Messina, Messina, Italy.;La Sapienza University, Umberto I Policlinic, Rome, Italy.;Catholic University of the Sacred Heart, A. Gemelli Policlinic, Rome, Italy.;IRCCS Centro di Riferimento Oncologico della Basilicata, Rionero in Vulture, Italy.",
"authors": "Laurenti|Luca|L|;Innocenti|Idanna|I|;Autore|Francesco|F|;Vannata|Barbara|B|;Efremov|Dimitar G|DG|;Ciolli|Stefania|S|;Del Poeta|Giovanni|G|;Mauro|Francesca Romana|FR|;Cortelezzi|Agostino|A|;Borza|Paola Anticoli|PA|;Ghio|Francesco|F|;Mondello|Patrizia|P|;Murru|Roberta|R|;Gozzetti|Alessandro|A|;Cariccio|Maria Rosa Lanza|MR|;Piccirillo|Nicola|N|;Boncompagni|Riccardo|R|;Cantonetti|Maria|M|;Principe|Maria Ilaria Del|MI|;Reda|Gianluigi|G|;Bongarzoni|Velia|V|;Cervetti|Giulia|G|;Pitini|Vincenzo|V|;Foà|Robin|R|;Sica|Simona|S|;D'Arena|Giovanni|G|",
"chemical_list": "D000069283:Rituximab; D000069461:Bendamustine Hydrochloride",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0145-2126",
"issue": "39(10)",
"journal": "Leukemia research",
"keywords": "Bendamustine; CLL; Elderly patients; First-line treatment; Rituximab",
"medline_ta": "Leuk Res",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069461:Bendamustine Hydrochloride; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D007558:Italy; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D008297:Male; D012189:Retrospective Studies; D000069283:Rituximab",
"nlm_unique_id": "7706787",
"other_id": null,
"pages": "1066-70",
"pmc": null,
"pmid": "26307523",
"pubdate": "2015-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Bendamustine in combination with rituximab for elderly patients with previously untreated B-cell chronic lymphocytic leukemia: A retrospective analysis of real-life practice in Italian hematology departments.",
"title_normalized": "bendamustine in combination with rituximab for elderly patients with previously untreated b cell chronic lymphocytic leukemia a retrospective analysis of real life practice in italian hematology departments"
} | [
{
"companynumb": "IT-TEVA-540953USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": null,
"drug... |
{
"abstract": "Uterine arteriovenous fistula (AVF) is a rare, but potentially life-threatening condition. Acquired fistulae may occur as a result of trauma or instrumentation, endometrial carcinoma, gestational trophoblastic disease, and intrauterine devices (IUDs). Herein the authors present the case of a 33-year-old woman with a uterine AVF developing after uterine perforation during the placement of a levonorgestrel IUD. The fistula was diagnosed using color Doppler ultrasonography and angiography and the treatment was conducted by minimally invasive approach using uterine artery embolization.",
"affiliations": null,
"authors": "Kondo|W|W|;Tessmann Zomer M|||;Erzinger|F L|FL|",
"chemical_list": "D003271:Contraceptive Agents, Female; D016912:Levonorgestrel",
"country": "China",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0390-6663",
"issue": "43(4)",
"journal": "Clinical and experimental obstetrics & gynecology",
"keywords": null,
"medline_ta": "Clin Exp Obstet Gynecol",
"mesh_terms": "D000328:Adult; D000792:Angiography; D001164:Arteriovenous Fistula; D003271:Contraceptive Agents, Female; D005260:Female; D006801:Humans; D007434:Intrauterine Devices; D007436:Intrauterine Devices, Medicated; D016912:Levonorgestrel; D055357:Uterine Artery Embolization; D014595:Uterine Perforation",
"nlm_unique_id": "7802110",
"other_id": null,
"pages": "602-605",
"pmc": null,
"pmid": "29734558",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Uterine arteriovenous fistula after perforation during the placement of an intrauterine device - Minimally invasive treatment using uterine artery embolization.",
"title_normalized": "uterine arteriovenous fistula after perforation during the placement of an intrauterine device minimally invasive treatment using uterine artery embolization"
} | [
{
"companynumb": "BR-BAYER-2016-208879",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LEVONORGESTREL"
},
"drugadditional": null,
... |
{
"abstract": "Granulomatous pneumonitis is a rare complication of bacillus Calmette-Guerin immunotherapy following intravesical administration of bacillus Calmette-Guerin. The authors present an unusual case of a 67-year-old man who developed mild and non-specific symptoms, following intravesical bacillus Calmette-Guerin instillations. Examinations revealed features of miliary tuberculosis and granuloma suggestive of mycobacterial infection. Anti-tuberculosis treatment resulted in a remarkable improvement in his symptoms and gradually upgrading of radiological appearance. The symptoms were less severe than some others described but this case provides evidence that, even in some cases, specific treatment may be necessary. We highlight the importance of recognizing miliary Mycobacterium bovis as a probable complication of bacillus Calmette-Guerin immunotherapy. The clinical disease course can be mild, despite extensive bilateral miliary nodules on primary presentation.",
"affiliations": "Pulmonology - Thorax Department. Centro Hospitalar Lisboa Norte. Lisboa. Portugal.;Pulmonary Diagnosis Center Dr. Ribeiro Sanches. Lisboa. Portugal.;Pulmonary Diagnosis Center Dr. Ribeiro Sanches. Lisboa. Portugal.;Pulmonary Diagnosis Center Dr. Ribeiro Sanches. Lisboa. Portugal.",
"authors": "Clérigo|Vera|V|;Castro|Ana|A|;Mourato|Teresa|T|;Gomes|Conceição|C|",
"chemical_list": "D000276:Adjuvants, Immunologic; D001500:BCG Vaccine",
"country": "Portugal",
"delete": false,
"doi": "10.20344/amp.10250",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0870-399X",
"issue": "32(4)",
"journal": "Acta medica portuguesa",
"keywords": "BCG Vaccine; Granuloma/chemically induced; Pneumonia/chemically induced; Urinary Bladder Neoplasms/drug therapy",
"medline_ta": "Acta Med Port",
"mesh_terms": "D000276:Adjuvants, Immunologic; D000283:Administration, Intravesical; D000368:Aged; D001500:BCG Vaccine; D006099:Granuloma; D006801:Humans; D007167:Immunotherapy; D008297:Male; D011014:Pneumonia; D035583:Rare Diseases; D014057:Tomography, X-Ray Computed; D014391:Tuberculosis, Miliary; D001749:Urinary Bladder Neoplasms",
"nlm_unique_id": "7906803",
"other_id": null,
"pages": "316-320",
"pmc": null,
"pmid": "31067427",
"pubdate": "2019-04-30",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "A Rare Case of Granulomatous Pneumonitis Due to Intravesical BCG for Bladder Cancer.",
"title_normalized": "a rare case of granulomatous pneumonitis due to intravesical bcg for bladder cancer"
} | [
{
"companynumb": "PT-SA-2019SA169377",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BACILLUS CALMETTE-GUERIN ANTIGEN, UNSPECIFIED SUBSTRAIN"
},
... |
{
"abstract": "The Spanish Myeloma Group conducted a trial to compare bortezomib/thalidomide/dexamethasone (VTD) versus thalidomide/dexamethasone (TD) versus vincristine, BCNU, melphalan, cyclophosphamide, prednisone/vincristine, BCNU, doxorubicin, dexamethasone/bortezomib (VBMCP/VBAD/B) in patients aged 65 years or younger with multiple myeloma. The primary endpoint was complete response (CR) rate postinduction and post-autologous stem cell transplantation (ASCT). Three hundred eighty-six patients were allocated to VTD (130), TD (127), or VBMCP/VBAD/B (129). The CR rate was significantly higher with VTD than with TD (35% vs 14%, P = .001) or with VBMCP/VBAD/B (35% vs 21%, P = .01). The median progression-free survival (PFS) was significantly longer with VTD (56.2 vs 28.2 vs 35.5 months, P = .01). In an intention-to-treat analysis, the post-ASCT CR rate was higher with VTD than with TD (46% vs 24%, P = .004) or with VBMCP/VBAD/B (46% vs 38%, P = .1). Patients with high-risk cytogenetics had a shorter PFS and overall survival in the overall series and in all treatment groups. In conclusion, VTD resulted in a higher pre- and posttransplantation CR rate and in a significantly longer PFS although it was not able to overcome the poor prognosis of high-risk cytogenetics. Our results support the use of VTD as a highly effective induction regimen prior to ASCT. The study was registered with http://www.clinicaltrials.gov (NCT00461747) and Eudra CT (no. 2005-001110-41).",
"affiliations": "Hospital Clínic de Barcelona, Barcelona, Spain.",
"authors": "Rosiñol|Laura|L|;Oriol|Albert|A|;Teruel|Ana Isabel|AI|;Hernández|Dolores|D|;López-Jiménez|Javier|J|;de la Rubia|Javier|J|;Granell|Miquel|M|;Besalduch|Joan|J|;Palomera|Luis|L|;González|Yolanda|Y|;Etxebeste|María Asunción|MA|;Díaz-Mediavilla|Joaquín|J|;Hernández|Miguel T|MT|;de Arriba|Felipe|F|;Gutiérrez|Norma C|NC|;Martín-Ramos|María Luisa|ML|;Cibeira|María Teresa|MT|;Mateos|María Victoria|MV|;Martínez|Joaquín|J|;Alegre|Adrián|A|;Lahuerta|Juan José|JJ|;San Miguel|Jesús|J|;Bladé|Joan|J|;|||",
"chemical_list": "D000970:Antineoplastic Agents; D001897:Boronic Acids; D011719:Pyrazines; D013792:Thalidomide; D000069286:Bortezomib; D003907:Dexamethasone",
"country": "United States",
"delete": false,
"doi": "10.1182/blood-2012-02-408922",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0006-4971",
"issue": "120(8)",
"journal": "Blood",
"keywords": null,
"medline_ta": "Blood",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D001897:Boronic Acids; D000069286:Bortezomib; D003907:Dexamethasone; D018572:Disease-Free Survival; D005260:Female; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D060828:Induction Chemotherapy; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D011719:Pyrazines; D013234:Stem Cells; D013792:Thalidomide; D014182:Transplantation, Autologous",
"nlm_unique_id": "7603509",
"other_id": null,
"pages": "1589-96",
"pmc": null,
"pmid": "22791289",
"pubdate": "2012-08-23",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Superiority of bortezomib, thalidomide, and dexamethasone (VTD) as induction pretransplantation therapy in multiple myeloma: a randomized phase 3 PETHEMA/GEM study.",
"title_normalized": "superiority of bortezomib thalidomide and dexamethasone vtd as induction pretransplantation therapy in multiple myeloma a randomized phase 3 pethema gem study"
} | [
{
"companynumb": "ES-JNJFOC-20170800962",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugadditional": n... |
{
"abstract": "When patients with chronic kidney disease are infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) they can face two specific problems: virus-specific immune responses may be impaired and remdesivir, an antiviral drug described to shorten recovery, is contraindicated. Antiviral treatment with convalescent plasma (CP) could be an alternative treatment option. In this case report, we present two kidney transplant recipients and two hemodialysis patients who were infected with SARS-CoV-2 and received CP. Antibodies against the receptor-binding domain in the S1 subunit of the SARS-CoV-2 spike protein were determined sequentially by immunoglobulin G (IgG) enzyme-linked immunosorbent assay (ELISA) and neutralization assay and specific cellular responses by interferon-gamma ELISpot. Before treatment, in both kidney transplant recipients and one hemodialysis patient antibodies were undetectable by ELISA (ratio < 1.1), corresponding to low neutralizing antibody titers (≤1:40). ELISpot responses in the four patients were either weak or absent. After CP treatment, we observed an increase of SARS-CoV-2-specific antibodies (IgG ratio and neutralization titer) and of specific cellular responses. After intermittent clinical improvement, one kidney transplant recipient again developed typical symptoms on Day 12 after treatment and received a second cycle of CP treatment. Altogether, three patients clinically improved and could be discharged from the hospital. However, one 83-year-old multimorbid patient deceased. Our data suggest that the success of CP therapy may only be temporary in patients with chronic kidney disease; which requires close monitoring of viral load and antiviral immunity and possibly an adaptation of the treatment regimen.",
"affiliations": "Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Virology, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Institute for Transfusion Medicine, University Hospital Essen, University of Duisburg-Essen, Essen, Germany.;Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen, University of Duisburg-Essen, Essen, Germany.",
"authors": "Lindemann|Monika|M|0000-0001-6708-4390;Krawczyk|Adalbert|A|;Dolff|Sebastian|S|0000-0001-5549-1706;Konik|Margarethe|M|;Rohn|Hana|H|;Platte|Maximillian|M|;Thümmler|Laura|L|;Schwarzkopf|Sina|S|;Schipper|Leonie|L|;Bormann|Maren|M|;van de Sand|Lukas|L|;Breyer|Marianne|M|;Klump|Hannes|H|0000-0003-3536-1212;Knop|Dietmar|D|;Lenz|Veronika|V|;Temme|Christian|C|;Dittmer|Ulf|U|;Horn|Peter A|PA|;Witzke|Oliver|O|",
"chemical_list": "D057134:Antibodies, Neutralizing; D000914:Antibodies, Viral; D000998:Antiviral Agents; D007074:Immunoglobulin G; D064370:Spike Glycoprotein, Coronavirus; C000657845:spike protein, SARS-CoV-2; D002097:C-Reactive Protein",
"country": "United States",
"delete": false,
"doi": "10.1002/jmv.26840",
"fulltext": "\n==== Front\nJ Med Virol\nJ Med Virol\n10.1002/(ISSN)1096-9071\nJMV\nJournal of Medical Virology\n0146-6615\n1096-9071\nJohn Wiley and Sons Inc. Hoboken\n\n33527424\n10.1002/jmv.26840\nJMV26840\nResearch Article\nResearch Articles\nSARS‐CoV‐2‐specific humoral and cellular immunity in two renal transplants and two hemodialysis patients treated with convalescent plasma\nLINDEMANN et al.\nLindemann Monika http://orcid.org/0000-0001-6708-4390\n1 monika.lindemann@uk-essen.de\n\nKrawczyk Adalbert 2 3\nDolff Sebastian https://orcid.org/0000-0001-5549-1706\n2\nKonik Margarethe 2\nRohn Hana 2\nPlatte Maximillian 2\nThümmler Laura 1\nSchwarzkopf Sina 1\nSchipper Leonie 2\nBormann Maren 2\nvan de Sand Lukas 2\nBreyer Marianne 1\nKlump Hannes https://orcid.org/0000-0003-3536-1212\n1\nKnop Dietmar 1\nLenz Veronika 1\nTemme Christian 1\nDittmer Ulf 3\nHorn Peter A. 1\nWitzke Oliver 2\n1 Institute for Transfusion Medicine, University Hospital Essen University of Duisburg‐Essen Essen Germany\n2 Department of Infectious Diseases, West German Centre of Infectious Diseases, Universitätsmedizin Essen University of Duisburg‐Essen Essen Germany\n3 Institute for Virology, University Hospital Essen University of Duisburg‐Essen Essen Germany\n* Correspondence Monika Lindemann, Institute for Transfusion Medicine, Robert‐Koch‐Haus, Virchowstr. 179, University Hospital Essen, 45147 Essen, Germany.\nEmail: monika.lindemann@uk-essen.de\n\n09 2 2021\n10.1002/jmv.2684022 1 2021\n08 12 2020\n29 1 2021\n© 2021 The Authors. Journal of Medical Virology published by Wiley Periodicals LLC.\nThis is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.\n\nAbstract\n\nWhen patients with chronic kidney disease are infected with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) they can face two specific problems: virus‐specific immune responses may be impaired and remdesivir, an antiviral drug described to shorten recovery, is contraindicated. Antiviral treatment with convalescent plasma (CP) could be an alternative treatment option. In this case report, we present two kidney transplant recipients and two hemodialysis patients who were infected with SARS‐CoV‐2 and received CP. Antibodies against the receptor‐binding domain in the S1 subunit of the SARS‐CoV‐2 spike protein were determined sequentially by immunoglobulin G (IgG) enzyme‐linked immunosorbent assay (ELISA) and neutralization assay and specific cellular responses by interferon‐gamma ELISpot. Before treatment, in both kidney transplant recipients and one hemodialysis patient antibodies were undetectable by ELISA (ratio < 1.1), corresponding to low neutralizing antibody titers (≤1:40). ELISpot responses in the four patients were either weak or absent. After CP treatment, we observed an increase of SARS‐CoV‐2‐specific antibodies (IgG ratio and neutralization titer) and of specific cellular responses. After intermittent clinical improvement, one kidney transplant recipient again developed typical symptoms on Day 12 after treatment and received a second cycle of CP treatment. Altogether, three patients clinically improved and could be discharged from the hospital. However, one 83‐year‐old multimorbid patient deceased. Our data suggest that the success of CP therapy may only be temporary in patients with chronic kidney disease; which requires close monitoring of viral load and antiviral immunity and possibly an adaptation of the treatment regimen.\n\nHighlights\n\nAfter treatment with convalescent plasma we observed an increase of specific humoral and cellular immunity in two kidney transplant recipients and two haemodialysis patients with SARS‐CoV‐2 infection.\n\nHowever, the success of convalescent plasma therapy was only be temporary in one transplant recipient.\n\nShort‐term monitoring of viral load and antiviral immunity appears as mandatory for this patient group.\n\ncellular immunity\nconvalescent plasma\nCOVID‐19\nELISpot\nhemodialysis\nkidney transplantation\nRudolf Ackermann FoundationGrant to O.W. Stiftung Universitätsmedizin Essen 10.13039/501100010380 Grant to A.K. source-schema-version-number2.0\nedited-statecorrected-proof\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.1 mode:remove_FC converted:01.04.2021\nLindemann M , Krawczyk A , Dolff S , et al. SARS‐CoV‐2‐specific humoral and cellular immunity in two renal transplant and two hemodialysis patients treated with convalescent plasma. J Med Virol. 2021;1–8. 10.1002/jmv.26840 32492206\n==== Body\n1 INTRODUCTION\n\nIn patients with chronic kidney disease and infected with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) treatment can be complicated because their immune function is suppressed due to medication to prevent allograft rejection and/or the underlying kidney disease. Thereby, the formation of specific antibodies and of T‐cell immunity is impaired; which can result in a prolonged persistence of SARS‐CoV‐2 (for up to 2 months 1 ). Furthermore, remdesivir, an antiviral nucleoside analog that shortened the time to recovery in adults hospitalized with coronavirus 2019 (COVID‐19) disease, 2 is contraindicated in this special cohort. Antiviral treatment with convalescent plasma (CP) could be an alternative treatment option. Data on patients with chronic kidney disease infected with SARS‐CoV‐2 and receiving CP treatment are still limited. We are aware of only 14 described kidney transplant recipients who received CP. 3 , 4 , 5 , 6 , 7 Whereas clinical improvement after CP has been shown for all six kidney transplant recipients included in three studies, 3 , 4 , 5 in the fourth study 6 a mortality rate for solid organ recipients (including six with kidney allograft) in the range of recipients without CP treatment 8 , 9 , 10 was reported (23% 6 vs. 24%–32%, 8 , 9 , 10 respectively). In the fifth study describing HIV‐infected kidney transplant recipients 7 one of the two patients died after having received CP treatment. However, the previous reports did not present data on the course of SARS‐CoV‐2‐specific antibodies or cellular responses in the patients.\n\nIt was the aim of the current study to follow‐up up virus‐specific humoral and cellular immunity in patients with chronic kidney disease who were infected with SARS‐CoV‐2 and received CP therapy. We functionally analyzed the antibodies (by neutralization assay) and measured specific cellular responses by the highly sensitive ELISpot method, using various protein antigens of SARS‐CoV‐2 as specific stimuli. Finally, in one transplant recipient who again developed typical COVID‐19 symptoms after initial clinical improvement, we had the chance to modify the treatment regimen and to apply the second cycle of CP therapy.\n\n2 MATERIALS AND METHODS\n\n2.1 Patients and blood donors\n\nThe current case report includes two renal transplant recipients and two hemodialysis patients (Table 1) and their respective CP donors. Within the study period (July 27 to September 9, 2020), all SARS‐CoV‐2 infected renal transplant and hemodialysis patients with an estimated glomerular filtration rate (eGFR) < 30 ml/min/1.73 m2 were included. The four patients included in the current study had chronic kidney disease according to the eGFR of 7–29 ml/min/1.73 m2. Both transplant recipients received tacrolimus, mycophenolate mofetil, and prednisone, both hemodialysis patients dexamethasone. The kidney transplant recipients were treated with prednisone to prevent organ rejection (which was not changed due to COVID‐19 infection), whereas the dialysis‐requiring patients were specifically treated with dexamethasone for 5 days to prevent an exaggerated immune response during COVID‐19 infection. Treatment with CP started when patients with chronic kidney disease without detectable immunoglobulin G (IgG) antibodies against SARS‐CoV‐2 showed increasing oxygen demand/clinical deterioration (RTX01, RTX02, and HD01) or when oxygen supply via nasal cannula was no longer sufficient in a patient with chronic kidney disease with detectable antibodies (HD02). One patient suffered from moderate (RTX02) and three from severe COVID‐19 disease. 11 More detailed information on the patients and the therapy used can be found in Table 1. One cycle of CP consisted of three units, separated with the Amicus™ (Fresenius Kabi), each containing 200–280 ml, which was applied at Days 1, 3, and 5. The study was approved by the local ethics committee (20‐9256‐BO for the patients and 20‐9225‐BO for the donors) and the study participants provided written informed consent. The procedures were in accordance with the institutional and national ethical standards as well as with the Helsinki Declaration of 1975, as revised in 2013. Four donors were selected based on their SARS‐CoV‐2 IgG ratio after polymerase chain reaction (PCR)‐confirmed SARS‐CoV‐2 infection and additional parameters like blood group and weight (Table 2). Details on the donor selection criteria have been described recently. 12\n\nTable 1 Clinical characteristics of patients with chronic kidney disease\n\nID\tSex/age/blood group\tCP intervala (days)\tCP units/cycles\t(Pre‐existing) comorbidity/cause of death\tCOVID‐19 therapy\tSeverity of COVID‐19 disease/outcome (discharge from hospitalb)\t\nRTX01\tF/63/O\t3\t6/2\tRTX 1997 and 2001, chronic antibody‐mediated rejection, hypertension, asthma bronchial, reactive arthritis\tOxygen administration via nasal cannula\tSeverec/A (d28)\t\nRTX02\tF/62/A\t13\t3/1\tRTX 14.08.2020 (13 days before SARS‐CoV‐2 infection), steroid‐induced diabetes, hypertension\tNo oxygen necessary (minimum oxygen saturation 92%)\tModerate (CT: pneumonia, but clinically asymptomatic)/A (d16)\t\nHD01\tF/83/A\t4\t2d/1\tHD since 02/2012, type II diabetes, coronary heart disease, atrial fibrillation, apoplexy, acute event of fall (no evidence of stroke)/COVID‐19 pneumonia\tOxygen administration first via nasal cannula, then 50–60 L/min high‐flow ventilation (FiO2 60%), dexamethasone\tSeverec/D\t\nHD02\tF/78/O\t7\t3/1\tHD since 01/2020, type II diabetes, hypertension, chronic obstructive pulmonary disease, adipositas\tOxygen administration via nasal cannula, dexamethasone\tSeverec/A (d8)\t\nAbbreviations: A, alive; COVID, coronavirus; CP, convalescent plasma; CT, computed tomography; D, deceased; HD, hemodialysis; RTX, renal transplantation; SARS‐CoV‐2, severe acute respiratory syndrome coronavirus 2.\n\na Interval between the onset of symptoms or positivity to SARS‐CoV‐2 polymerase chain reaction and treatment with CP.\n\nb Discharge from hospital given as days after initiation of CP treatment.\n\nc Oxygen supplementation but no mechanical ventilation.\n\nd The patient deceased due to COVID‐19 pneumonia after having received two CP units.\n\nJohn Wiley & Sons, Ltd.\nThis article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.\n\nTable 2 Characteristics of convalescent plasma donors\n\nID\tSex\tAge\tBlood group\tAntibody ratio\tNeutralizing antibody titer\tHLA antibodies\t\nD‐RTX01\tF\t55\tO\t5.83\t1:1280\tneg\t\nD‐RTX02\tM\t53\tA\t7.33\t1:320\tneg\t\nD‐HD01\tM\t40\tA\t10.44\t1:160\tneg\t\nD‐HD02\tF\t48\tO\t3.39\t1:320\tneg\t\nAbbreviations: D, donor; neg, negative.\n\nJohn Wiley & Sons, Ltd.\nThis article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.\n\n2.2 Antibody enzyme‐linked immunosorbent assay\n\nTo assess SARS‐CoV‐2‐specific humoral immunity, IgG antibodies in donor and patient sera were determined by a CE marked anti‐SARS‐CoV‐2 IgG semi‐quantitative enzyme‐linked immunosorbent assay (ELISA; Euroimmun), according to the manufacturer's instructions. The ELISA plates were coated with recombinant SARS‐CoV‐2 spike (S) 1 protein (receptor binding domain). Serum samples were analyzed automatically at a 1:100 dilution, using the Immunomat™ (Virion\\Serion). Results are given as a ratio (patient sample/control sample). An antibody ratio of ≥1.1 was considered positive, of ≥0.8 to <1.1 borderlines and of <0.8 negative.\n\n2.3 Virus neutralization assay\n\nThe function of specific antibodies was measured by a cell‐culture based neutralization assay, using Vero E6 cells (ATCC® CRL‐1586™) and a clinical isolate of SARS‐CoV‐2 in a biosafety level 3 laboratory. 12 , 13 Neutralization capacity was determined by endpoint dilution assay, expressed as 50% tissue culture infective dose (TCID50)/ml. Serial dilutions (1:20 to 1:1280) of the respective sera were preincubated with 100 TCID50 of SARS‐CoV‐2 for 1 h at 37°C and added afterward to confluent Vero E6 cells cultured in 96‐well microtiter plates. On Day 3 after infection, the cells were stained with crystal violet (Roth) solved in 20% methanol (Merck) and the appearance of cytopathic effects (CPE) was analyzed by light microscopy. The neutralizing titer was defined as the reciprocal of the highest serum dilution at which no CPE breakthrough in any of the triplicate cultures was observed.\n\n2.4 ELISpot assay\n\nTo assess SARS‐CoV‐2‐specific cellular immunity, we performed ELISpot assays, using peptide pools of the S1/S2 protein, the S1 protein, and the membrane (M) protein (PepTivator®, Miltenyi Biotec) and an S1 protein antigen of SARS‐CoV‐2 (Sino Biological). The peptide pools consist mainly of 15‐mer sequences with 11 amino acids overlap. We tested 250,000 peripheral blood mononuclear cells per cell culture and measured interferon‐gamma (IFN‐γ) production after 19 h, as published recently in detail. 12 Spot numbers were analyzed by an ELISpot reader (AID Fluorospot; Autoimmun Diagnostika GmbH). Mean values of duplicate cell cultures were considered. SARS‐CoV‐2‐specific spots were determined as stimulated minus nonstimulated (background) values (spots increment). We defined threefold higher SARS‐CoV‐2‐specific spots versus background together with at least three spots above background as a positive response. This cut‐off was set based on negative control values as specified previously. 12\n\n3 RESULTS\n\nIn both kidney recipients and one hemodialysis patient with undetectable SARS‐CoV‐2‐specific IgG (ratio < 1.1) and low neutralizing antibody titers ( ≤ 1:40; RTX01, RTX02, and HD01; Table 1) we observed an increase of antibody titers (Figure 1A‐C). A 63‐year‐old female who was transplanted twice (RTX01) initially showed a clinical response to CP therapy, but at Day 12 again developed typical symptoms of COVID‐19 disease (fever and shortage of air; Figure 2A,B). Therefore, she received another cycle of CP therapy (from the same donor). SARS‐CoV‐2 antibodies increased after both CP cycles and SARS‐CoV‐2 viral load decreased (C t value to the PCR increased from 17.8 to 25.8 after the first and to 34.9 after the second CP cycle; Figure 2C). The patient could be discharged from the hospital on Day 28 after initiation of CP treatment. Since Day 13 after initiation of CP therapy oxygen supplementation via nasal cannula could be completely stopped and at Day 29 viral load became undetectable. The second kidney transplant recipient (RTX02), a 62‐year‐old female who received her graft 13 days before the detection of SARS‐CoV‐2 infection, also showed a decrease of the viral load (C t value to the PCR increased from 21.6 to 30.3 after the CP cycle and to 35.4 on Day 16 after initiation of CP treatment, when the patient was discharged from the hospital). On Day 39 after CP therapy, SARS‐CoV‐2 viral load became undetectable in the nasopharyngeal swab. The third patient, an 83‐year‐old multimorbid female (HD01), showed no clinical improvement despite increasing neutralizing antibody titers and decreasing C‐reactive protein and deceased due to COVID‐19 pneumonia on Day 4 after initiation of CP therapy. She had been on hemodialysis for 8 years, suffered from diabetes mellitus, coronary heart disease, had apoplexy in 2010, and an acute event of fall.\n\nFigure 1 Course of specific humoral and cellular immunity in four patients with chronic kidney disease infected with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) and receiving convalescent plasma treatment. Antibodies were determined by an S1 specific immunoglobulin G (IgG) enzyme‐linked immunosorbent assay (Euroimmun) and by cell‐culture based neutralization assay (NT titer). Cellular responses were analyzed by an interferon‐gamma (IFN‐γ) ELISpot assay, using peptide pools of the S1/S2, S1, and M protein and an S1 protein antigen as specific stimuli (depicted as S1/S2, S1, M, and S ELI). We here present data on two kidney transplant recipients (RTX01, RTX02) and two patients on hemodialysis (HD01, HD02) and compared their immune responses with those of the corresponding donors of convalescent plasma (CP; shaded area). SARS‐CoV‐2‐specific antibody data (IgG ratio and NT titer) are given on the left Y‐axis and ELISpot data on the right one. Horizontal dashed lines represent the cut‐off values for positive reactions (IgG ratio of 1.1 and NT titer of 1:20). Vertical dotted lines indicate the time points of convalescent plasma applications (CP1, CP2, and CP3). Related data points are connected. PBMC, peripheral blood mononuclear cells\n\nFigure 2 Course of oxygen demand, C‐reactive protein, and severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) viral load in four patients with chronic kidney disease infected with SARS‐CoV‐2 and receiving convalescent plasma treatment. We here present data on two kidney transplant recipients (RTX01, RTX02) and two patients on hemodialysis (HD01, HD02) which were tested up to Day 39 after receiving convalescent plasma (CP). Vertical dotted lines indicate the time points of convalescent plasma applications (CP1, CP2, and CP3). Of note, only RTX01 received two cycles of CP while the remaining three patients received one cycle. A ct value of SARS‐CoV‐2 RNA > 40 was considered negative\n\nThe antibody ratios in these first three patients before the CP therapy were 0.15, 0.14, and 0.17, and the respective neutralizing antibody titers 1:20, <1:20, and 1:40. After CP therapy, antibodies in the patients reached a maximum ratio of 3.07, 2.19, and 3.70, corresponding to a neutralizing titer of up to 1:640, 1:160, and 1:640, respectively. In the donors, the antibody ratios were 5.83, 7.33, and 10.44, and the neutralizing titers 1:1280, 1:320, and 1:160, respectively.\n\nThe fourth patient, a 78‐year‐old female with pre‐existing antibodies (HD02), showed rapid clinical improvement and could be discharged from the hospital on Day 8 after initiation of CP treatment. Before CP treatment, SARS‐CoV‐2 was detectable by PCR at a low level (C t value of 31.1). On Day 14 after CP therapy, viral load was undetectable. The patient also showed an increase of specific immunity (ratio 5.96 → 7.01; neutralizing titer 1:640 → 1:1280; Figure 1D). However, SARS‐CoV‐2‐specific antibodies in the CP donor of the fourth patient were lower than in the patient (ratio: 3.39, neutralizing titer: 1:320).\n\nCellular immunity could be followed‐up by IFN‐γ ELISpot, using four different SARS‐CoV‐2‐specific antigens (peptide pools of the S1/S2, S1, and M protein and an S1 protein antigen). Before CP treatment, one patient was negative to the ELISpot (HD02) and three showed weak responses (RTX01, RTX02, and HD01). Three patients could be followed‐up after CP treatment. In these three patients, IFN‐γ production to the ELISpot intermittently increased, reaching a maximum at Days 6–14 after CP therapy.\n\n4 DISCUSSION\n\nOur data show an increase of specific humoral and cellular immunity in two kidney transplant recipients and two hemodialysis patients with SARS‐CoV‐2 infection after treatment with CP. This may represent the natural course of infection. However, the increase of immune responses occurred very close in time to the administration of CP; which suggests that there may be a causal relationship between treatment with CP and the increase in humoral and cellular immune responses. CP contains neutralizing antibodies as well as anti‐inflammatory cytokines and other immunomodulatory proteins. This combination could improve virus control in immunocompromised patients. 3 CP therapy thus could bridge the phase of acute COVID‐19 disease. However, presumably due to drug‐induced immunosuppression or impaired kidney function, the immune responses were not as long‐acting as expected. In one patient with two prior kidney transplantations (RTX01) two cycles of therapy were necessary for successful treatment. It can be supposed that the patient herself was unable to mount an adequate antibody response and that the passively transferred antibodies partly bound the virus that resides in the affected organs and in the respective lymphoid tissue. 14 Theoretically, it is possible that CP therapy mitigates the native humoral immune response and leaves an individual vulnerable to subsequent reinfection with SARS‐CoV‐2. 3 , 15 This phenomenon appears more likely in immunosuppressed versus otherwise healthy individuals. Concerning ELISpot data, we observed a maximum of IFN‐γ responses shortly after completion of the CP cycle. Of note, cellular immunity is regarded as important for recovery from SARS‐CoV‐2 infection 16 and appears as short‐lived in the current cohort. As CP therapy is a form of passive immunization, an increase in cellular responses is not expected at first glance. After an initial increase, IFN‐γ production decreased again, which could reflect the fact that proinflammatory immune responses shifted to anti‐inflammatory responses. 17 It has already been shown that there was a reduction in proinflammatory cytokines like IL‐6 and an increase in anti‐inflammatory cytokines after CP was administered. 18 , 19 , 20 Moreover, chronic kidney disease suppressed T‐cell function, which could impede long‐term protection against reinfection. 3 , 21\n\nThree out of four patients with chronic kidney disease showed clinical improvement; which is in the range of previous reports. 3 , 4 , 5 , 6 However, due to the low patient number, it was beyond the aim of our study to answer the question of CP therapy was effective. This answer can only be given by large randomized clinical studies such as the Randomized Evaluation of COVID‐19 Therapy (RECOVERY) trial 22 ; which is currently underway.\n\nIn conclusion, our data suggest that despite an increase of SARS‐CoV‐2‐specific immunity the success of CP therapy may only be temporary in patients with chronic kidney disease. Thus, short‐term treatment control (monitoring of viral load and antiviral immunity) appears mandatory for this patient group. If necessary, the treatment regimen has to be adapted.\n\nCONFLICT OF INTERESTS\n\nThe authors declare that there are no conflict of interests.\n\nETHICS STATEMENT\n\nThe study was approved by the local ethics committee (20‐9256‐BO for the patients and 20‐9225‐BO for the donors) and the study participants provided written informed consent.\n\nAUTHOR CONTRIBUTIONS\n\nMonika Lindemann, Adalbert Krawczyk, Veronika Lenz, Ulf Dittmer, Peter A. Horn, and Oliver Witzke conceived and designed the study. Laura Thümmler, Sina Schwarzkopf, Leonie Schipper, Maren Bormann, and Lukas van de Sand performed the experiments and analyzed the data. Sebastian Dolff, Margarethe Konik, Hana Rohn, Maximillian Platte, Marianne Breyer, Hannes Klump, Dietmar Knop, Veronika Lenz, Christian Temme, Peter A. Horn, and Oliver Witzke took care of the patients or convalescent plasma donors and participated in the collection and interpretation of data. Monika Lindemann had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analyses. Monika Lindemann, Adalbert Krawczyk, Sebastian Dolff, Peter A. Horn, and Oliver Witzke wrote the manuscript. All authors gave final approval of the manuscript.\n\nACKNOWLEDGEMENTS\n\nThis study was supported by the Stiftung Universitätsmedizin Essen (Adalbert Krawczyk) and the Rudolf Ackermann Foundation (Oliver Witzke). The authors would like to thank Babette Große‐Rhode and Martina Filipovic for their excellent technical assistance. The authors, furthermore, thank all volunteers for their participation and the donation of blood samples. Open Access funding enabled and organized by Projekt DEAL.\n==== Refs\nREFERENCES\n\n1 Gajurel K . Persistently positive severe acute respiratory syndrome coronavirus 2 (SARS‐COV2) nasopharyngeal PCR in a kidney transplant recipient. Transpl Infect Dis. 2020;22 :e13408.32652872\n2 Beigel JH , Tomashek KM , Dodd LE , et al. Remdesivir for the treatment of Covid‐19—Preliminary report. N Engl J Med. 2020;383 :1813‐1826.32445440\n3 Naeem S , Gohh R , Bayliss G , et al. Successful recovery from COVID‐19 in three kidney transplant recipients who received convalescent plasma therapy. Transpl Infect Dis. 2020:e13451.32815238\n4 Jiang J , Miao Y , Zhao Y , et al. Convalescent plasma therapy: helpful treatment of COVID‐19 in a kidney transplant recipient presenting with serve clinical manifestation and complex complications. Clin Transplant. 2020;34 (9 ):e14025.32602952\n5 Fung M , Nambiar A , Pandey S , et al. Treatment of immunocompromised COVID‐19 patients with convalescent plasma [published online ahead of print September 29, 2020]. Transpl Infect Dis. e13477 10.1111/tid.13477 32989856\n6 Rahman F , Liu STH , Taimur S , et al. Treatment with convalescent plasma in solid organ transplant recipients with COVID‐19: experience at large transplant center in New York City. Clin Transplant. 2020;34 :e14089.32918761\n7 Mehta SA , Rana MM , Motter JD , et al. Incidence and outcomes of COVID‐19 in kidney and liver transplant recipients with HIV: report from the National HOPE in Action Consortium. Transplantation. 2021;105 (1 ):216‐224.33165238\n8 Akalin E , Azzi Y , Bartash R , et al. Covid‐19 and kidney transplantation. N Engl J Med. 2020;382 (25 ):2475‐2477.32329975\n9 Pereira MR , Mohan S , Cohen DJ , et al. COVID‐19 in solid organ transplant recipients: Initial report from the US epicenter. Am J Transplant. 2020;20 (7 ):1800‐1808.32330343\n10 Cravedi P , Mothi SS , Azzi Y , et al. COVID‐19 and kidney transplantation: results from the TANGO International Transplant Consortium. Am J Transplant. 2020;20 :3140‐3148.32649791\n11 WHO . Clinical management of severe acute respiratory infection when COVID‐19 is suspected. 2020; https://www.who.int/publications-detail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus-(ncov)-infection-is-suspected. Accessed November 26, 2020.\n12 Schwarzkopf S , Krawczyk A , Knop D , et al. Cellular Immunity in COVID‐19 convalescents with PCR‐confirmed infection but with undetectable SARS‐CoV‐2‐specific IgG. Emerg Infect Dis. 2021;27 (1 ):122‐129.\n13 Heilingloh CS , Aufderhorst UW , Schipper L , et al. Susceptibility of SARS‐CoV‐2 to UV irradiation. Am J Infect Control. 2020;48 (10 ):1273‐1275.32763344\n14 Liu J , Zheng X , Tong Q , et al. Overlapping and discrete aspects of the pathology and pathogenesis of the emerging human pathogenic coronaviruses SARS‐CoV, MERS‐CoV, and 2019‐nCoV. J Med Virol. 2020;92 (5 ):491‐494.32056249\n15 Crowe JE Jr , Firestone CY , Murphy BR . Passively acquired antibodies suppress humoral but not cell‐mediated immunity in mice immunized with live attenuated respiratory syncytial virus vaccines. J Immunol. 2001;167 (7 ):3910‐3918.11564809\n16 Braun J , Loyal L , Frentsch M , et al. SARS‐CoV‐2‐reactive T cells in healthy donors and patients with COVID‐19. Nature. 2020;587 :270‐274. 10.1038/s41586-020-2598-9 32726801\n17 Lucas C , Wong P , Klein J , et al. Longitudinal analyses reveal immunological misfiring in severe COVID‐19. Nature. 2020;584 (7821 ):463‐469.32717743\n18 Rojas M , Rodríguez Y , Monsalve DM , et al. Convalescent plasma in Covid‐19: possible mechanisms of action. Autoimmun Rev. 2020;19 (7 ):102554.32380316\n19 Jaiswal V , Nasa P , Raouf M , et al. Therapeutic plasma exchange followed by convalescent plasma transfusion in critical COVID‐19—An exploratory study. Int J Infect Dis. 2021;102 :332‐334.33157287\n20 Shen C , Wang Z , Zhao F , et al. Treatment of 5 critically ill patients with COVID‐19 with convalescent plasma. JAMA. 2020;323 (16 ):1582‐1589.32219428\n21 Kronbichler A , Gauckler P , Windpessl M , et al. COVID‐19: implications for immunosuppression in kidney disease and transplantation. Nat Rev Nephrol. 2020;16 (7 ):365‐367.32409782\n22 Haynes R . Randomised evaluation of COVID‐19 therapy (RECOVERY). 2020; https://clinicaltrials.gov/ct2/show/NCT04381936. Accessed November 26, 2020.\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0146-6615",
"issue": "93(5)",
"journal": "Journal of medical virology",
"keywords": "COVID-19; ELISpot; cellular immunity; convalescent plasma; hemodialysis; kidney transplantation",
"medline_ta": "J Med Virol",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D057134:Antibodies, Neutralizing; D000914:Antibodies, Viral; D000998:Antiviral Agents; D002097:C-Reactive Protein; D000086382:COVID-19; D058501:Enzyme-Linked Immunospot Assay; D005260:Female; D006801:Humans; D007111:Immunity, Cellular; D056724:Immunity, Humoral; D007116:Immunization, Passive; D007074:Immunoglobulin G; D016030:Kidney Transplantation; D008875:Middle Aged; D006435:Renal Dialysis; D000086402:SARS-CoV-2; D064370:Spike Glycoprotein, Coronavirus",
"nlm_unique_id": "7705876",
"other_id": null,
"pages": "3047-3054",
"pmc": null,
"pmid": "33527424",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "SARS-CoV-2-specific humoral and cellular immunity in two renal transplants and two hemodialysis patients treated with convalescent plasma.",
"title_normalized": "sars cov 2 specific humoral and cellular immunity in two renal transplants and two hemodialysis patients treated with convalescent plasma"
} | [
{
"companynumb": "DE-TEVA-2021-DE-1920104",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nMatrix-induced autologous chondrocyte implantation (MACI) has demonstrated encouraging clinical results in the treatment of knee chondral defects. However, earlier studies suggested that chondrocyte implantation in the patellofemoral (PF) joint was less effective than in the tibiofemoral (TF) joint.\n\n\nOBJECTIVE\nTo compare the radiological and clinical outcomes of those undergoing MACI to either the femoral condyles or PF joint.\n\n\nMETHODS\nCohort study; Level of evidence, 3.\n\n\nMETHODS\nA total of 194 patients were included in this analysis, including 127 undergoing MACI to the medial (n = 94) and lateral (n = 33) femoral condyle, as well as 67 to the patella (n = 35) or trochlea (n = 32). All patients were evaluated clinically (Knee injury and Osteoarthritis Outcome Score [KOOS], visual analog scale, Short Form-36) before surgery and at 3, 12, and 24 months after surgery, while magnetic resonance imaging (MRI) was undertaken at 3, 12, and 24 months, with the MOCART (magnetic resonance observation of cartilage repair tissue) scoring system employed to evaluate the quality and quantity of repair tissue, as well as an MRI composite score. Patient satisfaction was evaluated.\n\n\nRESULTS\nNo significant group differences ( P > .05) were seen in demographics, defect size, prior injury, or surgical history, while the majority of clinical scores were similar preoperatively. All clinical scores significantly improved over time ( P < .05), with a significant group effect observed for KOOS activities of daily living ( P = .008), quality of life ( P = .008), and sport ( P = .017), reflecting better postoperative scores in the TF group. While the PF group had significantly lower values at baseline for the KOOS activities of daily living and quality of life subscales, it actually displayed a similar net improvement over time compared with the TF group. At 24 months, 93.7% (n = 119) and 91.0% (n = 61) of patients were satisfied with the ability of MACI to relieve their knee pain, 74.0% (n = 94) and 65.7% (n = 44) with their ability to participate in sport, and 90.5% (n = 115) and 83.6% (n = 56) satisfied overall, in the TF and PF groups, respectively. MRI evaluation via the MOCART score revealed a significant time effect ( P < .05) for the MRI composite score and graft infill over the 24-month period. While subchondral lamina scored significantly better ( P = .002) in the TF group, subchondral bone scored significantly worse ( P < .001). At 24 months, the overall MRI composite score was classified as good/excellent in 98 TF patients (77%) and 54 PF patients (81%).\n\n\nCONCLUSIONS\nMACI in the PF joint with concurrent correction of PF maltracking if required leads to similar clinical and radiological outcomes compared with MACI on the femoral condyles.",
"affiliations": "School of Human Sciences, University of Western Australia, Crawley, Perth, Western Australia, Australia.;Perth Orthopaedic and Sports Medicine Centre, West Perth, Western Australia, Australia.;Perth Radiological Clinic, Subiaco, Perth, Western Australia, Australia.;School of Surgery (Orthopaedics), University of Western Australia, Crawley, Perth, Western Australia, Australia.;Perth Orthopaedic and Sports Medicine Centre, West Perth, Western Australia, Australia.",
"authors": "Ebert|Jay R|JR|;Schneider|Adrian|A|;Fallon|Michael|M|;Wood|David J|DJ|;Janes|Gregory C|GC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/0363546517724761",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0363-5465",
"issue": "45(14)",
"journal": "The American journal of sports medicine",
"keywords": "chondral defect; clinical outcomes; magnetic resonance imaging; matrix-induced autologous chondrocyte implantation; patellofemoral; tibiofemoral",
"medline_ta": "Am J Sports Med",
"mesh_terms": "D000203:Activities of Daily Living; D000293:Adolescent; D000328:Adult; D002357:Cartilage Diseases; D002358:Cartilage, Articular; D019902:Chondrocytes; D015331:Cohort Studies; D005260:Female; D006801:Humans; D007718:Knee Injuries; D007719:Knee Joint; D008297:Male; D008875:Middle Aged; D019637:Orthopedic Procedures; D020370:Osteoarthritis, Knee; D010329:Patella; D057071:Patellofemoral Joint; D014182:Transplantation, Autologous",
"nlm_unique_id": "7609541",
"other_id": null,
"pages": "3243-3253",
"pmc": null,
"pmid": "28910133",
"pubdate": "2017-12",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "A Comparison of 2-Year Outcomes in Patients Undergoing Tibiofemoral or Patellofemoral Matrix-Induced Autologous Chondrocyte Implantation.",
"title_normalized": "a comparison of 2 year outcomes in patients undergoing tibiofemoral or patellofemoral matrix induced autologous chondrocyte implantation"
} | [
{
"companynumb": "AU-VERICEL CORPORATION-VCEL-2017-000893",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "AUTOLOGOUS CULTURED CHONDROCYTES\\SUS SCROFA COLLAG... |
{
"abstract": "BACKGROUND\nVascular closure devices (VCDs) are frequently used for hemostasis with endovascular procedures by employing sutures or plug devices (using collagen or hydrogel) or through the use of a metal clip made of nickel and titanium, such as the StarClose SE device. In comparison to manual compression (MC), VCDs are associated with earlier time to discharge and ambulation, improved patient comfort, and better cost-effectiveness.\n\n\nMETHODS\nA 77-year-old man with history of ischemic cardiomyopathy with non-ST segment elevation myocardial infarction (NSTEMI) underwent diagnostic cardiac catheterization with deployment of a StarClose SE vascular closure device for hemostasis. Upon repeat access 4 days later for coronary intervention, retrograde sheath angiography revealed a pseudo-aneurysm emanating from the center of the StarClose clip.\n\n\nCONCLUSIONS\nA review of the literature shows VCDs to be non-inferior to MC, with an overall high success rate. Major and minor complications rates are comparable to those with MC, and pseudo-aneurysm is an infrequent complication.",
"affiliations": "Department of Cardiovascular Medicine, Carilion Roanoke Memorial Hospital, Roanoke, VA, USA.;Department of Cardiovascular Medicine , Carilion Roanoke Memorial Hospital, Roanoke, VA, USA.",
"authors": "Memon|Sehrish|S|;Ball|Timothy C|TC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12659/ajcr.896587",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1941-5923",
"issue": "17()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000368:Aged; D017541:Aneurysm, False; D005263:Femoral Artery; D006801:Humans; D008297:Male; D011859:Radiography; D065506:Vascular Closure Devices",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "207-10",
"pmc": null,
"pmid": "27026227",
"pubdate": "2016-03-30",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "19455658;20093310;21679086;22162141;22781471;23796092;23207656;25399273;26680377;17039509;17039508;16415194;8164284;17950141;17696624;17200896;17515479",
"title": "Central Pseudo-Aneurysm Formation Following Arterial Closure with a StarClose SE Device: When a StarClose Doesn't Completely Close.",
"title_normalized": "central pseudo aneurysm formation following arterial closure with a starclose se device when a starclose doesn t completely close"
} | [
{
"companynumb": "US-PFIZER INC-2016245759",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": "3",
"... |
{
"abstract": "BACKGROUND Pancytopenia is a hematological condition which is characterized by decreases in all three cellular elements: RBC, WBC, and platelets. As a result, patients with pancytopenia are more prone to anemia, infections, and excessive bleeding. Pancytopenia can be caused by medications or drug interactions that suppress the bone marrow. This case report highlights a drug interaction between allopurinol and mercaptopurine which led to pancytopenia and septic infection, resulting in the patient's death. This could easily have been avoided if a clinical pharmacist had been consulted. CASE REPORT A 55-year-old female patient with a past medical history of gout, depression, back pain, and type 2 diabetes was recently diagnosed with ulcerative colitis and was discharged with a new prescription of mercaptopurine. After 2 months of concurrent use of allopurinol and mercaptopurine, she developed infected foot ulcers, which progressed rabidly to sepsis. At the time, her laboratory findings confirmed pancytopenia. Despite treatment, the patient died. CONCLUSIONS This case illustrates the importance of consulting a clinical pharmacist in order to avoid such medical error. The dose of mercaptopurine should be reduced to 25% of the recommended dose when it is given concurrently with allopurinol to reduce the risk of pancytopenia. Health care providers should think about the significant role of clinical pharmacy services. In our case, there were no clinical pharmacist involved in the care of this patient, and as a result of such negligence, the patient lost her life.",
"affiliations": "Department of Pharmacy Practice, Collage of Pharmacy, Princess Nora University, Riyadh, Saudi Arabia.",
"authors": "Alhubaishi|Alaa A|AA|",
"chemical_list": "D006074:Gout Suppressants; D007166:Immunosuppressive Agents; D000493:Allopurinol; D015122:Mercaptopurine",
"country": "United States",
"delete": false,
"doi": "10.12659/AJCR.914166",
"fulltext": "\n==== Front\nAm J Case RepAm J Case RepamjcaserepThe American Journal of Case Reports1941-5923International Scientific Literature, Inc. 3143982710.12659/AJCR.914166914166ArticlesPancytopenia and Septic Infection Caused by Concurrent Use of Allopurinol and Mercaptopurine: A Case Report Illustrating the Importance of Clinical Pharmacist Consultation Alhubaishi Alaa A. ACEDepartment of Pharmacy Practice, Collage of Pharmacy, Princess Nora University, Riyadh, Saudi ArabiaAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\nCorresponding Author: Alaa A. Alhubaishi, e-mail: aaalhubaishi@pnu.edu.sa2019 23 8 2019 20 1245 1247 17 11 2018 22 4 2019 © Am J Case Rep, 20192019This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Patient: Female, 55\n\nFinal Diagnosis: Allopurinol and mercaptopurine interaction causing pancytopenia and septic infection\n\nSymptoms: Sepsis\n\nMedication: —\n\nClinical Procedure: Fluid transfusion and cephalexin\n\nSpecialty: Pharmacology and Pharmacy\n\nObjective:\nAdverse events of drug therapy\n\nBackground:\nPancytopenia is a hematological condition which is characterized by decreases in all three cellular elements: RBC, WBC, and platelets. As a result, patients with pancytopenia are more prone to anemia, infections, and excessive bleeding. Pancytopenia can be caused by medications or drug interactions that suppress the bone marrow. This case report highlights a drug interaction between allopurinol and mercaptopurine which led to pancytopenia and septic infection, resulting in the patient’s death. This could easily have been avoided if a clinical pharmacist had been consulted.\n\nCase Report:\nA 55-year-old female patient with a past medical history of gout, depression, back pain, and type 2 diabetes was recently diagnosed with ulcerative colitis and was discharged with a new prescription of mercaptopurine. After 2 months of concurrent use of allopurinol and mercaptopurine, she developed infected foot ulcers, which progressed rabidly to sepsis. At the time, her laboratory findings confirmed pancytopenia. Despite treatment, the patient died.\n\nConclusions:\nThis case illustrates the importance of consulting a clinical pharmacist in order to avoid such medical error. The dose of mercaptopurine should be reduced to 25% of the recommended dose when it is given concurrently with allopurinol to reduce the risk of pancytopenia. Health care providers should think about the significant role of clinical pharmacy services. In our case, there were no clinical pharmacist involved in the care of this patient, and as a result of such negligence, the patient lost her life.\n\nMeSH Keywords:\nDrug Interactions6-MercaptopurinePharmacistsAllopurinolPancytopenia\n==== Body\nBackground\nPancytopenia is a hematological condition which is characterized by decreases in all three cellular elements: RBC, WBC, and platelets [1]. It is defined as hemoglobin less than 13.5 g/dl in males or 11.5 g/dl in females, leucocyte count less than 4.5×109/L, and platelet count less than 15×109/L [2]. Pancytopenia can be life threating and may evolve insidiously in some cases. The causes of pancytopenia vary widely in different studies [3,4]. Megaloblastic anemia is considered the most common cause of pancytopenia; however, there are other underlying causes. Medications or drug interactions that suppress the bone marrow have been also reported to cause pancytopenia [5,6]. Allopurinol is a xanthine oxidase inhibitor indicated for management of patients with gout. The most frequent adverse reaction to allopurinol is skin rash [7]. Mercaptopurine is a thiopurine which is used for a number of conditions related to immune diseases. It is also used off label for inflammatory bowel diseases, including Crohn’s disease and ulcerative colitis. Serious toxic effects of mercaptopurine include myelosuppression and hepatotoxicity [8]. There are few published case reports describing pancytopenia as a result of concurrent use of allopurinol and thiopurines. The published case reports are likely to represent only a small fraction of the actual cases because pancytopenia may not be recognized as being the result of drug interactions [5,9]. This interaction is very old, and it was first described in 1963 by Gertrude Elion, who reported that giving a xanthine oxidase inhibitor with a thiopurine can substantially increase the effect of the thiopurine, leading to bone marrow suppression, and that will reduce the activation and replication of blood cells, inducing apoptosis and causing pancytopenia [10]. Therefore, the dose of thiopurine should be reduced to 25% of the recommended dose when allopurinol is given concurrently. In contrast, other studies reported the intentional use of allopurinol with mercaptopurine in some inflammatory bowel disease cases to enhance thiopurine treatment; however, the dose of mercaptopurine was managed [11,12]. Here we report the case of a 55-year-old woman who died after a septic infection in the presence of pancytopenia after taking mercaptopurine while on allopurinol. This incident occurred in the absence of clinical pharmacy services in one of the hospitals in the Riyadh region of Saudi Arabia.\n\nCase Report\nA 55-year-old female patient with a history of gout, depression, back pain, and type 2 diabetes was recently diagnosed with ulcerative colitis. A new prescription of mercaptopurine 100 mg daily was dispensed and she was told to continue all other medications. She was taking allopurinol 300 mg twice daily, fluoxetine 150 mg daily, ibuprofen 200 mg twice daily as needed, metformin 500 mg twice daily, and glipizide 300 mg twice daily. Two months prior to her admission, she had received allopurinol and mercaptopurine concurrently. During that time, a progressive pancytopenia had developed to the point that, on admission, her hemoglobin level was 8.6 g/dL, WBC count was 2.2×109/L, and platelet count was 9.35×109/L. Bone marrow aspiration excluded hypoplastic anemia hematological malignancies, megaloblastic anemia, leishmaniasis, and Gaucher disease. At this point, the pancytopenia etiology was not recognized.\n\nOn admission, the patient was confused, anxious, and pale. She complained of breathlessness and palpitation. The patient was febrile, with body temperature of 39.6°C, heart rate of 112 beat/min, respiratory rate of 26 breaths/min, SaO2 88%, and BP 80/68 mmHg. She was hemodynamically unstable at the time of admission. One liter of isotonic solution was transfused immediately. The laboratory investigation showed sodium 138 mmol/L, potassium 5.5 mmol/L, chloride 120 mmol/L, bicarbonate 12 mmol/L, BUN 30 mg/dL, creatinine 2.9 mg/dL, uric acid 4 mg/dL, glucose 490 mg/dL, A 1c 11.2%, albumin 22 g/L, AST 56 U\\L, ALT 60 U/L, neutrophils 0.9×109/L, and serum lactate 7 mmol/L.\n\nPatient’s both feet were covered with very moist and foul-smelling gauzes. Her family stated that she had stepped on something sharp 5 days ago and had developed bloody ulcers, but she did not seek medical care at that time. On physical examination, her ulcers were reddish and edematous; a yellowish discharge was noted from her ulcerated skin lesions. It was primarily diagnosed as diabetic foot ulcer. Blood and wound cultures were obtained and the patient was given cephalexin intravenously. After the initial fluid transfusion, no improvement was observed in patient status. Within 1 hour of admission, sepsis developed and the patient died.\n\nDiscussion\nIt is known that pancytopenia can result from concurrent use of allopurinol and mercaptopurine. Patients with pancytopenia are fatigued due to anemia, more susceptible to infections due to leucopenia, and are at risk of excessive bleeding due to thrombocytopenia. There are very few case reports in the literature regarding pancytopenia risk as a result of xanthan oxidase inhibitor and thiopurine interaction. In 1970, it was reported that a 61-year-old man on azathioprine died of pancytopenia, bleeding, and sepsis after starting allopurinol therapy [5]. In 2009, the New Zealand Health Department issued a safety notice after a patient on azathioprine and allopurinol died of pancytopenia [9].\n\nIn our case, the patient was concurrently on allopurinol 300 mg twice daily and mercaptopurine 100 mg daily for 2 months prior to admission. During that time, she had gradually developed pancytopenia, which had increased her risk of infections.\n\nHer foot ulcers developed from an injury 5 days prior to her admission. At that time, her immune system was not functioning well enough to fight her infection, not only because of pancytopenia, but also due to her history of uncontrolled diabetes. High blood glucose levels can weaken the immune system defenses [13]. Moreover, myelosuppression is known as a side effect of mercaptopurine, and the concurrent use with allopurinol definitely increases the risk of myelosuppression, resulting in pancytopenia with the exclusion of other hematological causes. Because of the pancytopenia, foot infection, and hemodynamic instability, the possibility of bacterial sepsis was strongly considered. A blood culture showed gram-positive cocci later identified as Staphylococcus aureus. We concur with other authors that predisposition to infection or sepsis in patients with pancytopenia can be induced by an interaction between allopurinol and a thiopurine. The evaluation of this patient’s medication history and the possibility of drug interaction with the new prescription was missed in this case. Failing to recognize or monitor for this interaction increased the risk of pancytopenia and infections. The interaction between allopurinol and mercaptopurine certainly could have been avoided if the mercaptopurine dose was reduced as recommended and the patient was monitored. This is an example of the importance of the involvement of a clinical pharmacist in patient’s care to avoid such tragedy.\n\nConclusions\nMost hospitals in Saudi Arabia lack clinical pharmacy services. This case illustrates a significant medical error which resulted in a patient’s death. The drug interaction between allopurinol and mercaptopurine contributed to pancytopenia, which reduced the patient’s ability to fight her infection, resulting in sepsis and death. It is recommended to reduce the dose of mercaptopurine to 25% of the recommended dose when combined with allopurinol. There is a significant need for a qualified clinical pharmacist to be included in the health care team with other professions to perform their role as drug experts. In our case, there were no clinical pharmacist involvement in the care of this patient; as the result of such negligence, the patient lost her life.\n\nThe author would like to thank Dr. Tarq F Alkhowaiter for his kind support and assistance in writing.\n\nConflict of interests\n\nNone.\n==== Refs\nReferences:\n1. Gayathri BN Rao KS Pancytopenia: A clinico-hematological study J Lab Physicians 2011 3 1 15 20 21701657 \n2. Naseem S Varma N Das R Pediatric patients with bicytopenia/pancytopenia: Review of etiologies and clinico-hematological profile at a tertiary center Indian J Pathol Microbiol 2011 54 75 80 21393882 \n3. Das Makheja K Kumar Maheshwari B Arain S The common causes leading to pancytopenia in patients presenting to tertiary care hospital Pak J Med Sci 2013 29 5 1108 11 24353701 \n4. Imbert M Scoazec JY Mary JY Adult patients presenting with pancytopenia: A reappraisal of underlying pathology and diagnostic procedures in 213 cases Hematol Pathol 1989 3 159 67 2628415 \n5. Gearry RB Day AS Barclay ML Azathioprine and allopurinol: A two-edged interaction J Castroenterol Hepatol 2010 25 649 56 \n6. NSW Health Safety Notice. Allopurinol and Azathioprine. A Serious and Known Drug Interaction, 2009; 011/09: 1–2. Available from URL: http://www.health.nsw.gov.au/resources/quality/sabs/pdf/sn20090507.pdf \n7. Allopurinol Lexi-Drugs.Lexicomp Wolters Kluwer Health, Inc Riverwood, IL Available at: http://online.lexi..com \n8. Mercaptopurine Lexi-Drugs.Lexicomp Wolters Kluwer Health, Inc Riverwood, IL Available at: http://online.lexi..com \n9. Horn JR Hansten PH Another thiopurine- allopurinol tragedy. Retrieved from http://www.hanstenandhorn.com/news.htm \n10. McInnes GT Lawson DH Jick H Acute adverse reactions attributed to allopurinol in hospitalised patients Ann Rheum Dis 1981 40 3 245 49 7247470 \n11. DeConti RC Calabresi P Use of Allopurinol for prevention and control of hyperuricemia in patients with neoplastic disease New Engl J Med 1966 274 481 86 5904287 \n12. Moreau B Clement P Theoret Y Seidman EG Allopurinol in combination with thiopurine induces mucosal healing and improves clinical and metabolic outcomes in IBD Therap Adv Gastroenterol 2017 10 11 819 27 \n13. Casqueiro J Casqueiro J Alves C Infections in patients with diabetes mellitus: A review of pathogenesis Indian J Endocrinol Metab 2012 16 Suppl. 1 S27 36 22701840\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1941-5923",
"issue": "20()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000493:Allopurinol; D003093:Colitis, Ulcerative; D017719:Diabetic Foot; D004347:Drug Interactions; D017809:Fatal Outcome; D005260:Female; D006073:Gout; D006074:Gout Suppressants; D006801:Humans; D007166:Immunosuppressive Agents; D015122:Mercaptopurine; D008875:Middle Aged; D010198:Pancytopenia; D010595:Pharmacists; D010607:Pharmacy Service, Hospital; D012017:Referral and Consultation; D018805:Sepsis",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "1245-1247",
"pmc": null,
"pmid": "31439827",
"pubdate": "2019-08-23",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "21393882;21701657;2628415;7247470;5904287;20492321;24353701;29147133;22701840",
"title": "Pancytopenia and Septic Infection Caused by Concurrent Use of Allopurinol and Mercaptopurine: A Case Report Illustrating the Importance of Clinical Pharmacist Consultation.",
"title_normalized": "pancytopenia and septic infection caused by concurrent use of allopurinol and mercaptopurine a case report illustrating the importance of clinical pharmacist consultation"
} | [
{
"companynumb": "SA-ACCORD-153125",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional": null,
"druga... |
{
"abstract": "In the last five years we observed 8 young patients aged under 15 years, in whom the basal ganglia were calcified after application of methotrexate and/or radiotherapy for treatment of a brain or cerebellar tumor. In both patients leukoencephalopathy was evident besides calcification of the basal ganglia and, in one, the ventricles were enlarged and he had also signs of cerebral and cerebellar atrophy. In the production of leukoencephalopathies and calcifications by chemo- and radiotherapy, the age is a very important factor. In adult patients it is exceptional to see them. Brain immaturity is probably associated with the presence of leukoencephalopathy and intracranial calcifications.",
"affiliations": "Department of Neuroradiology, Hospital 20 de Noviembre, ISSSTE, Mexico City.",
"authors": "Fernández-Bouzas|A|A|;Ramirez Jiménez|H|H|;Vázquez Zamudio|J|J|;Alonso-Vanegas|M|M|;Mendizabal Guerra|R|R|",
"chemical_list": "D011344:Procarbazine; D014750:Vincristine; D008130:Lomustine; D003606:Dacarbazine; D008727:Methotrexate",
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0390-5616",
"issue": "36(4)",
"journal": "Journal of neurosurgical sciences",
"keywords": null,
"medline_ta": "J Neurosurg Sci",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001284:Atrophy; D001480:Basal Ganglia Diseases; D001932:Brain Neoplasms; D002114:Calcinosis; D002552:Cerebral Ventricles; D002675:Child, Preschool; D003131:Combined Modality Therapy; D003388:Cranial Fossa, Posterior; D016371:Cranial Irradiation; D003606:Dacarbazine; D003704:Dementia; D005260:Female; D005909:Glioblastoma; D006801:Humans; D007278:Injections, Spinal; D008130:Lomustine; D008527:Medulloblastoma; D008727:Methotrexate; D011344:Procarbazine; D011832:Radiation Injuries; D014750:Vincristine",
"nlm_unique_id": "0432557",
"other_id": null,
"pages": "211-4",
"pmc": null,
"pmid": "1339093",
"pubdate": "1992",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Brain calcifications and dementia in children treated with radiotherapy and intrathecal methotrexate.",
"title_normalized": "brain calcifications and dementia in children treated with radiotherapy and intrathecal methotrexate"
} | [
{
"companynumb": "MX-PFIZER INC-2017079760",
"fulfillexpeditecriteria": "1",
"occurcountry": "MX",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE SODIUM"
},
"drugadditional": "3",... |
{
"abstract": "Secondary central nervous system (CNS) relapse is a serious and fatal complication of diffuse large B cell lymphoma (DLBCL). Data on secondary CNS (SCNS) relapse were mostly obtained from western countries with limited data from developing countries. We analyzed the data of 2034 newly diagnosed DLBCL patients enrolled into the multi-center registry under Thai Lymphoma Study Group from setting. The incidence, September 2006 to December 2013 to represent outcome from a resource limited pattern, management, and outcome of SCNS relapse were described. The 2-year cumulative incidence (CI) of SCNS relapse was 2.7 %. A total of 729, 1024, and 281 patients were classified as low-, intermediate-, and high-risk CNS international prognostic index (CNS-IPI) with corresponding 2-year CI of SCNS relapse of 1.5, 3.1, and 4.6 %, respectively (p < 0.001). Univariate analysis demonstrated advance stage disease, poor performance status, elevated lactate dehydrogenase, presence of B symptoms, more than one extranodal organ involvement, high IPI, and high CNS-IPI group as predictive factors for SCNS relapse. Rituximab exposure and intrathecal chemoprophylaxis offered no protective effect against SCNS relapse. At the time of analysis, six patients were alive. Median OS in SCNS relapsed patients was significantly shorter than relapsed patients without CNS involvement (13.2 vs 22.6 months) (p < 0.001). Primary causes of death were progressive disease (n = 35, 63.6 %) and infection (n = 9, 16.7 %). In conclusion, although the incidence of SCNS relapse in our cohort was low, the prognosis was dismal. Prophylaxis for SCNS involvement was underused even in high-risk patients. Novel approaches for SCNS relapse prophylaxis and managements are warranted.",
"affiliations": "Division of Hematology, Department of Internal Medicine, Faculty of Medicine, Chulalongkorn University, 1873 Rama IV road Pathumwan, Bangkok, Thailand. kwudhikarn@hotmail.com.;Division of Hematology, Department of Internal Medicine, Faculty of Medicine, Chulalongkorn University, 1873 Rama IV road Pathumwan, Bangkok, Thailand.;Department of Internal Medicine, Prince of Songkla University, Songkhla, Thailand.;Department of Internal Medicine, Prince of Songkla University, Songkhla, Thailand.;Department of Internal Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Department of Internal Medicine, Ramathibodi Hospital, Mahidol University, Bangkok, Thailand.;Department of Internal Medicine, Siriraj Hospital, Mahidol University, Bangkok, Thailand.;Department of Internal Medicine, Siriraj Hospital, Mahidol University, Bangkok, Thailand.;Department of Internal Medicine, Chiang Mai University, Chiang Mai, Thailand.;Department of Internal Medicine, Chiang Mai University, Chiang Mai, Thailand.;Department of Internal Medicine, Srinakharinwirot University, Nakhon Nayok, Thailand.;Department of Internal Medicine, Thammasart University, Bangkok, Thailand.;Department of Internal Medicine, Khon Kaen University, Khon Kaen, Thailand.;Department of Internal Medicine, Khon Kaen University, Khon Kaen, Thailand.;Department of Internal Medicine, Naresuan University, Phitsanulok, Thailand.;Department of Internal Medicine, Phramongkutklao Hospital and College of Medicine, Bangkok, Thailand.;Department of Internal Medicine, Phramongkutklao Hospital and College of Medicine, Bangkok, Thailand.;Department of Internal Medicine, Rajavithi Hospital, Bangkok, Thailand.;Department of Internal Medicine, Khonkaen Regional Hospital, Khon Kaen, Thailand.;Department of Internal Medicine, Chulabhorn Hospital, Bangkok, Thailand.;Division of Hematology, Department of Internal Medicine, Faculty of Medicine, Chulalongkorn University, 1873 Rama IV road Pathumwan, Bangkok, Thailand.",
"authors": "Wudhikarn|Kitsada|K|http://orcid.org/0000-0001-9528-8681;Bunworasate|Udomsak|U|;Julamanee|Jakrawadee|J|;Lekhakula|Arnuparp|A|;Chuncharunee|Suporn|S|;Niparuck|Pimjai|P|;Ekwattanakit|Supachai|S|;Khuhapinant|Archrob|A|;Norasetthada|Lalita|L|;Nawarawong|Weerasak|W|;Makruasi|Nisa|N|;Kanitsap|Nonglak|N|;Sirijerachai|Chittima|C|;Chansung|Kanchana|K|;Wong|Peerapon|P|;Numbenjapon|Tontanai|T|;Prayongratana|Kannadit|K|;Suwanban|Tawatchai|T|;Wongkhantee|Somchai|S|;Praditsuktavorn|Pannee|P|;Intragumtornchai|Tanin|T|;|||",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00277-016-2848-y",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0939-5555",
"issue": "96(1)",
"journal": "Annals of hematology",
"keywords": "CNS prophylaxis; CNS-IPI; Diffuse large B cell lymphoma; Secondary CNS relapse",
"medline_ta": "Ann Hematol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D016543:Central Nervous System Neoplasms; D005260:Female; D005500:Follow-Up Studies; D006295:Health Resources; D006801:Humans; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D011446:Prospective Studies; D012042:Registries; D013785:Thailand; D055815:Young Adult",
"nlm_unique_id": "9107334",
"other_id": null,
"pages": "57-64",
"pmc": null,
"pmid": "27752821",
"pubdate": "2017-01",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Secondary central nervous system relapse in diffuse large B cell lymphoma in a resource limited country: result from the Thailand nationwide multi-institutional registry.",
"title_normalized": "secondary central nervous system relapse in diffuse large b cell lymphoma in a resource limited country result from the thailand nationwide multi institutional registry"
} | [
{
"companynumb": "TH-JNJFOC-20170126790",
"fulfillexpeditecriteria": "1",
"occurcountry": "TH",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "After renal transplantation, there is a need for immunosuppressive regimens which effectively prevent allograft rejection, while preserving renal function and minimizing side effects. From this perspective, mesenchymal stromal cell (MSC) therapy is of interest. In this randomized prospective, single-center, open-label trial, we compared MSCs infused 6 and 7 weeks after renal transplantation and early tacrolimus withdrawal with a control tacrolimus group. Primary end point was quantitative evaluation of interstitial fibrosis in protocol biopsies at 4 and 24 weeks posttransplant. Secondary end points included acute rejection, graft loss, death, renal function, adverse events, and immunological responses. Seventy patients were randomly assigned of which 57 patients were included in the final analysis (29 MSC; 28 controls). Quantitative progression of fibrosis failed to show benefit in the MSC group and GFR remained stable in both groups. One acute rejection was documented (MSC group), while subclinical rejection in week 24 protocol biopsies occurred in seven patients (four MSC; three controls). In the MSC group, regulatory T cell numbers were significantly higher compared to controls (p = .014, week 24). In conclusion, early tacrolimus withdrawal with MSC therapy was safe and feasible without increased rejection and with preserved renal function. MSC therapy is a potentially useful approach after renal transplantation.",
"affiliations": "Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Transplant Surgery and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Clinical Pharmacy and Toxicology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Clinical Pharmacy and Toxicology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Pathology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Immunology, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.;Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.",
"authors": "Reinders|Marlies E J|MEJ|0000-0001-9543-567X;Groeneweg|Koen E|KE|0000-0001-9077-1471;Hendriks|Sanne H|SH|0000-0002-0974-3666;Bank|Jonna R|JR|0000-0003-0369-0126;Dreyer|Geertje J|GJ|0000-0001-6166-7819;de Vries|Aiko P J|APJ|0000-0002-9284-3595;van Pel|Melissa|M|0000-0002-3746-0380;Roelofs|Helene|H|0000-0002-6014-6285;Huurman|Volkert A L|VAL|0000-0002-7162-1467;Meij|Paula|P|;Moes|Dirk J A R|DJAR|0000-0003-3219-253X;Fibbe|Willem E|WE|0000-0001-8539-9011;Claas|Frans H J|FHJ|0000-0003-4157-6201;Roelen|Dave L|DL|0000-0002-1846-1193;van Kooten|Cees|C|0000-0002-6257-0899;Kers|Jesper|J|0000-0002-2418-5279;Heidt|Sebastiaan|S|0000-0002-6700-188X;Rabelink|Ton J|TJ|0000-0001-6780-5186;de Fijter|Johan W|JW|0000-0003-3076-5584",
"chemical_list": "D007166:Immunosuppressive Agents; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1111/ajt.16528",
"fulltext": "\n==== Front\nAm J Transplant\nAm J Transplant\n10.1111/(ISSN)1600-6143\nAJT\nAmerican Journal of Transplantation\n1600-6135\n1600-6143\nJohn Wiley and Sons Inc. Hoboken\n\n33565206\n10.1111/ajt.16528\nAJT16528\nOriginal Article\nORIGINAL ARTICLES\nClinical Science\nAutologous bone marrow‐derived mesenchymal stromal cell therapy with early tacrolimus withdrawal: The randomized prospective, single‐center, open‐label TRITON study\nREINDERS et al.\nReinders Marlies E. J. https://orcid.org/0000-0001-9543-567X\n1 m.e.j.reinders@lumc.nl\n\nGroeneweg Koen E. https://orcid.org/0000-0001-9077-1471\n1\nHendriks Sanne H. https://orcid.org/0000-0002-0974-3666\n2\nBank Jonna R. https://orcid.org/0000-0003-0369-0126\n1\nDreyer Geertje J. https://orcid.org/0000-0001-6166-7819\n1\nde Vries Aiko P. J. https://orcid.org/0000-0002-9284-3595\n1\nvan Pel Melissa https://orcid.org/0000-0002-3746-0380\n2 3\nRoelofs Helene https://orcid.org/0000-0002-6014-6285\n2\nHuurman Volkert A. L. https://orcid.org/0000-0002-7162-1467\n4\nMeij Paula 5\nMoes Dirk J. A. R. https://orcid.org/0000-0003-3219-253X\n5\nFibbe Willem E. https://orcid.org/0000-0001-8539-9011\n2\nClaas Frans H. J. https://orcid.org/0000-0003-4157-6201\n2\nRoelen Dave L. https://orcid.org/0000-0002-1846-1193\n2\nvan Kooten Cees https://orcid.org/0000-0002-6257-0899\n1\nKers Jesper https://orcid.org/0000-0002-2418-5279\n6 7 8\nHeidt Sebastiaan https://orcid.org/0000-0002-6700-188X\n2\nRabelink Ton J. https://orcid.org/0000-0001-6780-5186\n1\nde Fijter Johan W. https://orcid.org/0000-0003-3076-5584\n1\n1 Department of Internal Medicine (Nephrology) and Transplant Center Leiden University Medical Center Leiden the Netherlands\n2 Department of Immunology Leiden University Medical Center Leiden the Netherlands\n3 NECSTGEN Leiden the Netherlands\n4 Department of Transplant Surgery and Transplant Center Leiden University Medical Center Leiden the Netherlands\n5 Department of Clinical Pharmacy and Toxicology Leiden University Medical Center Leiden the Netherlands\n6 Department of Pathology Leiden University Medical Center Leiden the Netherlands\n7 Department of Pathology Amsterdam UMC University of Amsterdam Amsterdam the Netherlands\n8 Van ‘t Hoff Institute for Molecular Sciences (HIMS) University of Amsterdam Amsterdam the Netherlands\n* Correspondence\nMarlies E. J. Reinders, Department of Internal Medicine (Nephrology) and Transplant Center, Leiden University Medical Center, Leiden, the Netherlands.\nEmail: m.e.j.reinders@lumc.nl\n\n18 3 2021\n9 2021\n21 9 10.1111/ajt.v21.9 30553065\n01 2 2021\n10 11 2020\n01 2 2021\n© 2021 The Authors. American Journal of Transplantation published by Wiley Periodicals LLC on behalf of The American Society of Transplantation and the American Society of Transplant Surgeons.\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.\n\nAfter renal transplantation, there is a need for immunosuppressive regimens which effectively prevent allograft rejection, while preserving renal function and minimizing side effects. From this perspective, mesenchymal stromal cell (MSC) therapy is of interest. In this randomized prospective, single‐center, open‐label trial, we compared MSCs infused 6 and 7 weeks after renal transplantation and early tacrolimus withdrawal with a control tacrolimus group. Primary end point was quantitative evaluation of interstitial fibrosis in protocol biopsies at 4 and 24 weeks posttransplant. Secondary end points included acute rejection, graft loss, death, renal function, adverse events, and immunological responses. Seventy patients were randomly assigned of which 57 patients were included in the final analysis (29 MSC; 28 controls). Quantitative progression of fibrosis failed to show benefit in the MSC group and GFR remained stable in both groups. One acute rejection was documented (MSC group), while subclinical rejection in week 24 protocol biopsies occurred in seven patients (four MSC; three controls). In the MSC group, regulatory T cell numbers were significantly higher compared to controls (p = .014, week 24). In conclusion, early tacrolimus withdrawal with MSC therapy was safe and feasible without increased rejection and with preserved renal function. MSC therapy is a potentially useful approach after renal transplantation.\n\nTRITON, a randomized, prospective, single‐center, open‐label study, shows that autologous mesenchymal stromal cell therapy and early tacrolimus withdrawal was feasible and safe, without increased rejection and with preserved renal function.\n\nclinical research/practice\nclinical trial\nimmune regulation\nimmunosuppression/immune modulation\nimmunosuppressive regimens – minimization/withdrawal\nkidney transplantation/nephrology\nkidney transplantation: living donor\nstem cells\nAstellas Pharma Global Development 10.13039/100007705 Novartis Pharma 10.13039/100008792 ZonMW‐TAS 10.13039/501100001826 116004104 source-schema-version-number2.0\ncover-dateSeptember 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.8 mode:remove_FC converted:15.10.2021\n==== Body\npmcAbbreviations\n\nABMR antibody‐mediated rejection\n\nAE adverse event\n\nBM bone marrow\n\nBPAR biopsy‐proven acute rejection\n\nCCMO Dutch Central Committee on Research involving Human Subjects\n\nCNI calcineurin inhibitor\n\ndnDSA de novo donor‐specific antibodies\n\nDSMB data safety monitoring board\n\nEVL everolimus\n\nGFR glomerular filtration rate\n\nGMP Good Manufacturing Practice\n\nHLA human leukocyte antigen\n\nI/R ischemia reperfusion\n\nIFTA interstitial fibrosis and tubular atrophy\n\nLUMC Leiden University Medical Center\n\nMSC mesenchymal stromal cells\n\nSAB single antigen bead\n\nSAE serious adverse event\n\nSCAR subclinical acute rejection\n\nSD standard deviation\n\nSR Sirius Red\n\nTCMR T cell‐mediated rejection\n\nTreg regulatory T cell\n\nUMCG University Medical Center Groningen\n\n1 INTRODUCTION\n\nOver the last two decades significant progress has been achieved in short‐term survival of kidney transplants. 1 , 2 Unfortunately, these advancements have not led to a similar improvement in long‐term kidney transplant survival rates. Various factors, including donor graft quality, ischemia/reperfusion (I/R) injury, alloreactivity, viral infections, and drug therapy, may adversely affect renal structure causing graft scarring and compromising long‐term function. 3 The intensity of current immunosuppressive drugs, albeit efficacious in preventing rejection, is associated with increased risk for (viral) infections and malignancies. Calcineurin inhibitors (CNIs) are the cornerstone of current immunosuppressive therapy, but they have direct nephrotoxic effects. It has been demonstrated that CNI withdrawal should be undertaken before month 6 to prevent the occurrence of irreversible tubulointerstitial damage. 4 , 5 So far, early CNI withdrawal studies have proven to be risky and invariably lead to increased rejection and even loss of grafts. 6 Consequently, there is a need for immunosuppressive regimens that can prevent allograft rejection, while preserving renal function and promoting patient and graft survival in the long term. MSCs have immunosuppressive properties and roles in tissue repair, and various (mainly experimental) studies have demonstrated that MSCs may increase regulatory T cell (Treg) levels and polarize the immune system toward tolerance. 7 , 8 In renal transplantation, early studies using MSCs focused on safety and feasibility. 9 , 10 , 11 , 12 Although most of these studies were not designed as efficacy trials, there were indications that MSCs possess immunosuppressive properties, as evidenced by an increase in Tregs and downregulation of cytotoxic CD8T+ cells in a small number of patients. We performed a randomized, prospective, single‐center, open‐label study in living‐donor kidney transplant recipients in which we compared autologous bone marrow (BM)‐derived MSC therapy (infused at weeks 6 and 7) with concomitant early tacrolimus withdrawal (at week 8) to standard tacrolimus dose. Primary end point was quantitative evaluation of interstitial fibrosis and secondary end points included biopsy‐proven acute rejection, graft loss, death, renal function, adverse events, and immunological responses at week 24. We chose to perform the study on a background of alemtuzumab‐based induction to minimize the risk for acute rejection 13 and mTOR inhibition, since experimental studies demonstrated tolerogenic properties in combination with MSCs. 14 In a post hoc long‐term analysis, peripheral blood immune cell composition was also obtained at week 52 in patients with sufficient follow‐up. In addition, the efficacy end point (biopsy‐proven acute rejection (BPAR), graft loss, or death) was obtained up to 5 years in patients who had a longer follow‐up.\n\n2 MATERIAL AND METHODS\n\n2.1 Study design and patients\n\nThe TRITON study is a 24‐weeks investigator‐initiated, randomized, prospective, open‐label, single‐center, clinical study, performed at the Leiden University Medical Center (LUMC), the Netherlands. The trial design has been published previously. 15 The trial protocol, available at the Appendix S1 and S2 section, was approved by the local ethics committee at the LUMC, Leiden, and by the Central Committee on Research involving Human Subjects (CCMO) in the Netherlands. The trial was performed in accordance with the principles of the Declaration of Helsinki. In total, 70 de novo renal recipients of a kidney from a living donor, 18–75 years of age, were recruited from the transplant clinics of the LUMC. The inclusion/exclusion criteria were described previously. 15 Written informed consent was obtained from all participants.\n\n2.2 Randomization and masking\n\nPatients were randomly assigned before transplantation to either the MSC or control group in a ratio 1:1 (Figure S1). A patient was randomized only after verification of eligibility and informed consent. The randomization procedure was designed and implemented by the IMO (Informatie Management Onderzoek) department of the University Medical Center Groningen (UMCG), the Netherlands, using a web‐based system (ALEA). Investigator or authorized delegate from the study staff received an individual login code with which they could randomize their patients. The web application returned the allocated treatment. As a confirmation, the web application also sent an e‐mail with the randomization information to selected users. Patients maintained this randomization number throughout the study. Because of the nature of the intervention (BM biopsy and MSC infusions), participants and physicians were not masked to treatment assignment.\n\n2.3 Procedures\n\nAll patients in the study received alemtuzumab (anti‐CD52),15 mg subcutaneously, at days 0 and 1 as well as tacrolimus (Prograft®), everolimus (EVL; Certican®), and low‐dose prednisone, as maintenance therapy (Figure S1). 15 Patients in the MSC group received two doses of autologous BM MSCs, intravenously at weeks 6 and 7 after transplantation. Autologous MSCs were chosen instead of third‐party MSCs to prevent alloimmunization. The dose of tacrolimus was reduced to 50% at the time of the second MSC infusion and completely withdrawn 1 week later. Patients received a higher dose of prednisolone (15 mg instead of 10 mg) for 14 days after the second infusion to diminish risks of tacrolimus withdrawal. In patients in the control group, the trough level of tacrolimus was lowered to a target of 6–8 ng/ml 8 weeks after transplantation. BM was aspirated from the posterior iliac crest of all patients in the MSC group under general anesthesia during the renal transplantation, as described previously. 15 This protocol was approved by the local ethics committee (P13.283) and by the CCMO (NL4371200013). Processing of the MSCs took place at the Interdivisional Good Manufacturing Practice (GMP) Facility of the LUMC (Table S1). 15 The MSC product was infused via peripheral infusion within 30 min with a target dose of 1.5 × 106 per/kg body weight IV (range 1–2 × 106), according to our previous study. 15 Monitoring of the patients occurred according to the assessment schedule, as described in the protocol (page 28).\n\n2.4 Outcomes\n\nThe primary end point was the quantitative progression of interstitial fibrosis between the 4‐ and 24‐week protocol biopsies as measured by morphometric analysis of collagen deposition. Interstitial collagen fibers in protocol biopsies were visualized by Sirius Red (SR) staining and quantified as a percentage of total tubulointerstitial tissue (glomeruli and large vessels excluded) by quantifying positive pixels in five representative locations at 40× magnification with a macro created in ImageJ version 1.50i. 16 Included secondary end points were composite end point efficacy failure (BPAR, graft loss, or death); proteinuria, Banff scores at the protocol biopsies, renal function as measured by estimated (e)glomerular filtration rate (GFR), (serious) adverse events ((S)AE), including (viral) infections, the presence of de novo donor‐specific antibodies (dnDSA), and peripheral blood immune cell composition. Scoring of renal biopsies was performed in a blinded fashion by a renal pathologist from our center after completion of the study, using the most recent Banff classification. 17 Findings in a protocol biopsy with evidence of rejection were reported as subclinical acute rejection (SCAR). Renal function was calculated by the eGFR (ml/min/1.73 m2) using the CKD‐EPI formula. 15 AEs and SAEs were documented according to Medical Dictionary for Regulatory Activities (MedDRA®); the international medical terminology developed under the auspices of the International Council for Harmonization of Technical Requirements for Pharmaceuticals for Human Use. Tacrolimus and EVL quantification was assessed using a previously validated LC–MS/MS assay. 18\n\n2.5 Immunological monitoring\n\nFor human leukocyte antigen (HLA) antibody analysis, serum samples were screened using Luminex screen assay (Lifecodes, Immucor) and analyzed with a Luminex 200 reader. Definitions of the negative/positive discriminations were used as suggested by the provider. When positive, a single antigen bead (SAB) assay (Lifecodes, Immucor) was performed as standard‐of‐care. Assignment of positivity was assessed according to the manufacturer's instructions. Since MSCs are suggested to have immunomodulatory properties, we performed phenotypical analysis of leukocyte subpopulations on fresh whole blood. Staining, acquisition, and data analysis were performed strictly adhering to “The One” study protocol. 19 Absolute cell counts were obtained using the BD Multitest kit (BD Biosciences).\n\n2.6 Post hoc analysis\n\nPhenotypical analysis of leukocyte subpopulations was, in addition to the 24‐week time point, also performed 52 weeks after renal transplantation. Assessment of composite end point efficacy failure (BPAR, graft loss, or death) and renal function by eGFR was also obtained in patients with a follow‐up up to 5 years in a post hoc analysis (n = 52 at 1 year, n = 40 at 2 years, n = 24 at 3 years, n = 17 at 4 years, and n = 13 at 5 years, Table 4).\n\n2.7 Statistical analysis\n\nThe study was designed to have a sample size of 25 in each group, or 50 in total, to have a power to detect a relative difference in mean percentages of fibrosis of at least 25% using an independent sample t test with a 0.05 two‐sided significance level (α), as described previously. 15 We anticipated that 70% of the included patients would have valid measurements (withdrawal included) and therefore included 70 patients. Data analysis was performed using SPSS version 25.0 (SPSS, Inc.) and all graphs were created using GraphPad Prism version 8.0 (GraphPad Prism Software, Inc.). Parametric data were described as mean ± SD, nonparametric data as median and interquartile range (IQR), and categorical data as numbers and percentages. p < .05 were considered statistically significant. The slopes of eGFR data were calculated and analyzed using a linear regression analysis. Immune monitoring data were analyzed using the Mann–Whitney test with Bonferroni correction for multiple testing. A data safety monitoring board (DSMB) monitored the safety of subjects. The trial is registered with ClinicalTrials.gov, NCT02057965.\n\n3 RESULTS\n\n3.1 Patients\n\nBetween March 3, 2014 and January 17, 2020, 70 patients, aged 19 to 74 years, were enrolled in the study: 36 patients were randomly assigned to the MSC group and 34 to the control group (Figure 1). Thirteen patients did not receive allocated treatment, because of abnormal MSC growth (defined as karyotypic abnormalities in the final product; n = 4), contra indication for MSC infusion due to the COVID‐19 pandemic (n = 1), impossibility of obtaining a baseline renal biopsy (n = 2 in MSC and n = 1 in control group), withdrawn informed consent (n = 4 in control group) and (relative) contra indication for prednisone usage (n = 1 control group). In total, 29 patients were assigned to the MSC and 28 to the control group (Figure 1). Patient baseline characteristics were similar in both groups (Table 1). Of the 29 patients in the MSC group, 28 patients received two infusions of MSCs, all within the proposed range. One patient received one dose of MSCs within the proposed range. The second dose was not given because of the COVID‐19 pandemic. This patient gave informed consent to continue the study. All patients had stable vital signs before and after MSC infusion monitored using MEWS (Table S1). In 28 patients in the MSC group and 23 patients in the control group, two renal biopsies could be obtained (Figure 1), in order to assess the quantitative progression of interstitial fibrosis.\n\nFIGURE 1 Trial profile. MSC, mesenchymal stromal cell\n\nTABLE 1 Baseline characteristics\n\nCharacteristic\tMSC (n = 29)\tControl (n = 28)\t\nRecipient\t\nAge, mean (SD), years\t50 (14)\t50 (15)\t\nMale sex, no. (%)\t26 (90)\t20 (71)\t\nBody weight, mean (SD), kg\t81 (14)\t82 (14)\t\nPrimary diagnosis, no. (%)\t\nIgA nephropathy\t7 (24)\t3 (11)\t\nHypertension\t3 (10)\t9 (32)\t\nPolycystic kidney disease\t9 (31)\t3 (11)\t\nDiabetes\t5 (17)\t0\t\nReflux nephropathy\t0\t2 (7)\t\nMembranous nephropathy\t1 (3)\t1 (4)\t\nLupus nephritis\t1 (3)\t0\t\nOther\t2 (7)\t3 (11)\t\nUnknown\t1 (3)\t7 (25)\t\nDonor\t\nAge, mean (SD), years\t55 (13)\t51 (11)\t\nMale sex, no. (%)\t14 (48)\t10 (36)\t\neGFR (pre‐donation), mean (SD)\t109.7 (12.0)\t109.3 (12.7)\t\nTransplant\t\nType, related, no. (%)\t13 (45)\t15 (54)\t\nHLA A/B mismatch, mean (SD)\t2.3 (1.3)\t2.4 (0.9)\t\nHLA DQ/DR mismatch, mean (SD)\t1.2 (0.6)\t1.3 (0.5)\t\nCold‐ischemia time, mean (SD), h\t3.1 (0.6)\t3.0 (0.5)\t\nFirst warm ischemia time, mean (SD), min\t3.7 (2.1)\t5.2 (4.3)\t\nSecond warm ischemia time, mean (SD), min\t27.0 (3.7)\t31.1 (14.4)\t\nCytomegalovirus IgG status, no. (%)\t\nD+/R+\t9 (31)\t6 (21)\t\nD+/R−\t7 (24)\t9 (32)\t\nD−/R+\t1 (3)\t2 (7)\t\nD−/R−\t12 (41)\t11 (39)\t\nEpstein‐Barr virus IgG D+/R, no. (%)\t1 (3)\t1 (4)\t\nNote\n\nData are described as mean standard deviation (SD). Categorical data are described as number (%) (mentioned in every specific variable row).\n\nAbbreviations: GFR, glomerular filtration rate; HLA, human leukocyte antigen.\n\nJohn Wiley & Sons, Ltd\n\n3.2 Quantitative progression of fibrosis score\n\nThe quantitative progression of fibrosis score in the biopsies was similar in both groups (MSC group 1.0 ± 7.9; control group 0.3 ± 7.8, p = .755). The fibrosis score remained stable both within the MSC (week 4, 15.2 ± 6.6 and week 24, 16.2 ± 5.3, p = .526) and control group (week 4, 17.0 ± 4.6 and week 24 17.3 ± 5.7, p = .870) (Figure 2; Figure S2). Delta Banff scores from 4 to 24 weeks were similar in the two groups, in particular the delta ti‐score (p = .8), the delta interstitial fibrosis/tubular atrophy (IFTA) score (p = .4), and the delta ah‐score (p = .4) (Figure S3).\n\nFIGURE 2 Interstitial fibrosis scores. Quantitative progression of interstitial fibrosis (delta Sirius Red) between the 4‐ and 24‐week renal biopsy (percentage). MSC, mesenchymal stromal cell\n\n3.3 Patient survival, renal function, and biopsy scores\n\nPatient survival during the study follow‐up was 100% in both groups. All patients had a functioning kidney graft at the end of the 24‐week study period (Table 2). eGFR was 56 ± 16 ml/min/1.73 m2 in the MSC (n = 29) and 42 ± 9 ml/min/1.73 m2 in the control group (n = 28) at the time of MSC infusion (Figure 3A). Mean eGFR and 24‐h proteinuria (Table S2) in the MSC group were similar as compared with the control group, with a mean of 56 ± 15 ml/min/1.73 m2 and 47 ± 16 ml/min/1.73 m2, respectively, at week 24 (Figure 3A). The slope from 4 to 24 weeks in the MSC group (slope = −0.22; intercept = 58.15) was not significantly different from the control group (slope = 0.09; intercept = 43.33) (p = .08, Figure 3B). Only one acute rejection episode (combination of T cell [TCMR] and antibody‐mediated rejection [ABMR]), documented by for‐cause biopsy, was found during the study period in the MSC group (1/29 or 3.4%) (Table 2). In this patient, immune suppression had been further reduced due to persistent BK viremia/nephropathy. In the control group, four patients had an indication for a for‐cause renal biopsy, without evidence of rejection (Table 2). The 24‐week protocol biopsies showed SCAR in 14.3% and 13.0% of patients in the MSC (4/28) and control group (3/23), respectively. Protocol biopsies in the MSC group showed a chronic active TCMR Banff IA (n = 1 patient), active ABMR (n = 2, of which one also had active ABMR in the 4‐week protocol biopsy; both having class I and II DSAs, C4d positive only at 6 months), and one mixed active ABMR and acute TCMR IA. Biopsies in the control group demonstrated acute TCMR Banff IA (n = 2 patients) and a mixed active ABMR and acute TCMR IA (n = 1 patient) (Table 2). All patients had a negative HLA antibody screening before and 4 weeks after transplantation. In the MSC group, seven patients developed dnDSA at week 24 (24%) (Table 3). Their protocol renal biopsies demonstrated no rejection (n = 3), borderline suspicious for acute TCMR (n = 1), ABMR (n = 2, both C4d negative), and ABMR/TCMR IA (n = 1, C4d+). In the control group, two patients developed HLA class‐II dnDSA without signs of rejection in their protocol biopsies.\n\nTABLE 2 Secondary end points (graft loss, renal function, and biopsy scores) during the study period of 24 weeks\n\nEnd point study period of 24 weeks\tMSC group (n = 29)\tControl group (n = 28)\t\nGraft loss, no. (%)\t0\t0\t\neGFR < 30 ml/min/1.73 m2, no. (%)\t0\t3 (12)\t\nPatients with for‐cause biopsies, no. (%)\t1 (3)\t4 (14)\t\nABMR, TCMR II and BK nephropathy\t1\t\t\nBK nephropathy\t\t1\t\nAcute tubular necrosis\t\t1\t\nHyaline thickening\t\t1\t\nNo abnormalities\t\t1\t\nPatient's protocol biopsies, no. (%)\t\n4 weeks\t29 (100)\t28 (100)\t\nABMR\t1\t0\t\nNo rejection\t28\t28\t\n24 weeks\t28 (97)\t23 (82)\t\nTCMR IA\t1\t2\t\nABMR\t2 a\t0\t\nABMR and TCMR IA\t1\t1\t\nNo rejection\t24\t20\t\nNote\n\nData are described as number (%) (also mentioned in every specific variable row).\n\nAbbreviations: ABMR, antibody‐mediated rejection; eGFR, estimated glomerular filtration rate; IFTA, interstitial fibrosis and tubular atrophy; MSC, mesenchymal stromal cell; TCMR, T cell‐mediated rejection; TIN, tubulointerstitial nephritis.\n\na One patient demonstrated ABMR at 4 and 24 weeks.\n\nJohn Wiley & Sons, Ltd\n\nFIGURE 3 eGFR during the study period of 24 weeks. (A) eGFR (ml/min/1.73 m2), calculated by the CKD‐EPI formula and depicted per time point as mean ± SD, of patients in the MSC and control groups. (B) Slopes of the eGFR in the MSC group were not significantly different from the control group (p = .08). Slope and intercept data per group are described, including 95% confidence intervals [Color figure can be viewed at wileyonlinelibrary.com]\n\nTABLE 3 Secondary end points (SAE, AE, viral infections, and dnDSA) during the study period of 24 weeks\n\nEnd point study period of 24 weeks\tMSC group (n = 29)\tControl group (n = 28)\t\nSerious adverse events, total, no.\t19\t25\t\nInjury, poisoning, and procedural complications\t6\t7\t\nInfections and infestations\t2\t7\t\nGastrointestinal disorders\t2\t3\t\nRenal and urinary disorders\t2\t2\t\nMetabolism and nutrition disorders\t2\t2\t\nTherapeutic and nontherapeutic responses\t2\t1\t\nInvestigations\t1\t1\t\nVascular disorders\t0\t1\t\nMusculoskeletal and connective tissue disorders\t0\t1\t\nImmune system disorders\t1\t0\t\nPsychiatric disorders\t1\t0\t\nAdverse events, total, no.\t272\t301\t\nInvestigations\t51\t46\t\nBlood and lymphatic system disorders\t39\t36\t\nInfections and infestations\t32\t38\t\nVascular disorders\t35\t31\t\nMetabolism and nutrition disorders\t26\t30\t\nGastrointestinal disorders\t21\t32\t\nRenal and urinary disorders\t5\t17\t\nInjury, poisoning and procedural complications\t9\t15\t\nGeneral disorders and administration site conditions\t10\t12\t\nNervous system disorders\t6\t10\t\nMusculoskeletal and connective tissue disorders\t9\t7\t\nCardiac disorders\t10\t5\t\nRespiratory, thoracic and mediastinal disorders\t5\t7\t\nSkin and subcutaneous tissue disorders\t8\t4\t\nPsychiatric disorders\t2\t4\t\nReproductive system and breast disorders\t1\t2\t\nNeoplasm benign, malignant and unspecified\t1\t2\t\nEye disorders\t1\t2\t\nImmune system disorders\t0\t1\t\nEar and labyrinth disorders\t1\t0\t\nViral infections, no. (%)\t\nEBV virus infection a\t1 (3)\t2 (7)\t\nCMV virus infection a\t2 (7)\t3 (11)\t\nBK virus infection b\t11 (38)\t10 (36)\t\nBK nephropathy\t1 (3)\t3 (11)\t\ndnDSA, no. (%)\t\nYes c\t7 (24)\t2 (7)\t\nAnti‐class I\t0\t0\t\nAnti‐class II\t4 (14)\t2 (7)\t\nAnti‐class I and II\t3 (10)\t0\t\nNo\t22 (76)\t26 (89)\t\nNote\n\n(Serious) adverse events are reported using the MedDRA classification with standardized categories. All data are described as the total count. Numbers in parentheses are percentages.\n\nAbbreviations: CMV, cytomegalovirus; dnDSA, de novo donor‐specific antibodies measured at week 24; EBV, Epstein‐Barr virus; MSC, mesenchymal stromal cells.\n\na Peak serum levels (logarithmic) of EBV and CMV range from 2.5 to 3.2 and from 2.7 to 4, respectively.\n\nb Peak serum levels of BK range from 5.1 to 6.9 in patients with BK nephropathy and from 2.6 to 6.9 in patients without signs of BK nephropathy.\n\nc dnDSA is considered positive in case of an MFI ≥ 500.\n\nJohn Wiley & Sons, Ltd\n\n3.4 Immunosuppressive drug levels and change of regime\n\nImmunosuppressive drug levels were within or only slightly out of prespecified target ranges. EVL levels, however, were significantly lower at three time points in the control group (Table S3). All patients in the MSC group were on EVL at the end of the 24‐week study period. In the MSC group, tacrolimus was reintroduced in one patient, because of acute rejection. In the control group, tacrolimus was discontinued in two patients because of BK nephropathy. EVL was switched to mycophenolate mofetil in four patients after a thrombovascular event and discontinued in two patients (CMV infection and infected lymphocele, respectively).\n\n3.5 (Serious) adverse events\n\nForty‐four SAEs were reported, of which 19 in the MSC and 25 in the control group. In total, 272 AEs were reported in the MSC and 301 in the control group (Table 3). There were no AEs directly related to the MSC infusions. In the control group, 15 viral infections (EBV, CMV, and BK viremia) developed and 14 in the MSC group (Table 3). BK nephropathy occurred in one patient in the MSC (3%) and in three patients in the control group (11%).\n\n3.6 Immune monitoring\n\nImmune monitoring studies demonstrated that absolute numbers of peripheral blood CD45+ leukocytes and CD14+ monocytes remain stable after transplantation between weeks 6 and 52 in the MSC and control groups (Figure 4A,B). CD19+ B cells and CD56+ NK cells decreased after alemtuzumab‐based induction in both groups and re‐appeared from week 12 onwards; however, no statistically significant change was measured between the groups (Figure 4C,D). CD3+CD8+ T cells, CD3+CD4+ T cells, as well as CD4+CD25hiCD127lo Tregs showed a decrease after alemtuzumab‐based induction in both groups while still being suppressed at week 52 (Figure 4E,G). Total Treg numbers were significantly higher in the MSC group with tacrolimus withdrawal as compared to the control group at 24 and 52 weeks after transplantation (p = .014 and p = .047, respectively), due to the increase in absolute number of CD4+CD25hiCD127loCD45RA− memory Tregs (p = .040 and p = .047) (Figure 4G,H). Absolute numbers of naïve Tregs (CD4+CD25hiCD127loCD45RA+) were similar in both groups (Figure S4). Percentages of total and naïve Tregs were not different between the two groups at any time points, whereas percentages of memory Tregs within the total CD4 population were elevated in the control group only at week 12, which normalized the weeks thereafter (Figure S5).\n\nFIGURE 4 Peripheral blood immune cell composition before and after MSC infusion. Absolute numbers of (A) CD45+ leucocytes, (B) CD14+ monocytes, (C) CD19+ B cells, (D) CD56+ NK cells, (E) CD8+ T cells, (F) CD4+ T cells, (G) CD4+CD25hiCD127lo Tregs, and (H) CD4+CD25hiCD127loCD45RA‐ memory Tregs per mL of blood are shown at baseline before transplantation, before the first MSC infusion (week 6), and time points after both infusions (weeks 12, 24, and 52). Violin plots are given for every time point with the number of individuals studied at each time point below the x‐axis. p values are given for the differences between MSC and control groups when <.05 after Bonferroni correction for multiple testing. MSC, mesenchymal stromal cell; NK, natural killer; Treg, regulatory T cell\n\n3.7 Post hoc analysis\n\nIn the post hoc longer (intermediate)‐term follow‐up analysis (up to 5 years), graft loss was observed in two patients in the control group (Table 4). Renal function in the MSC group was preserved with an eGFR between 47 and 57 ml/min/1.73 m2 (Table 4). In the patients in the control group, eGFR gradually declined with a mean of 42 ml/min/1.73 m2 at year 1 and 37 ml/min/1.73 m2 at year 5, while seven patients dropped with their eGFR < 30 ml/min/1.73 m2. For‐cause biopsies were indicated in one patient in the MSC and eight patients in the control group. In the for‐cause biopsy in the MSC group, recurrence of IgA nephropathy was found (n = 1). In the control group, acute TCMR IB (n = 1), acute TCMR II (n = 1), mixed active ABMR and acute TCMR IB (n = 1), BK nephropathy (n = 2), tubulointerstitial nephritis/pyelonephritis (n‐1), IFTA grade III (n = 1), and medullary inflammation NOS (sv negative) (n = 1) were observed. In the post hoc analyses, none of the seven patients with de novo DSA needed a for‐cause biopsy renal biopsy or developed an eGFR < 30 ml/min/1.73 m2. However, it is of importance to note that in three of these seven patients CNI was restarted by their treating nephrologist after the 24‐week study period (Table S4).\n\nTABLE 4 Post hoc analysis (1–5 years) of end points (graft loss, renal function, and biopsy scores)\n\nEnd point post hoc analysis\tMSC group\tControl group\t\n1 year\tn = 26\tn = 26\t\n2 years\tn = 20\tn = 20\t\n3 years\tn = 10\tn = 14\t\n4 years\tn = 7\tn = 10\t\n5 years\tn = 6\tn = 7\t\nGraft loss, no.\t0\t2 a\t\nTime after Tx, years\t\t3.8 and 4.5\t\neGFR, mean (SD) [n], ml/min/1.73 m2\t\n1 year\t57 (15) [26]\t42 (11) [26]\t\n2 years\t55 (15) [20]\t39 (12) [20]\t\n3 years\t53 (14) [10]\t34 (14) [14]\t\n4 years\t47 (10) [7]\t36 (12) [9]\t\n5 years\t50 (20) [6]\t37 (15) [5]\t\neGFR < 30 ml/min/1.73 m2, no.\t0\t7\t\nTime after Tx, median (IQR), years\t\t3 (1–3)\t\nPatients with for‐cause biopsies, no. (%)\t1 (3)\t8 (29)\t\nRecurrence IgA nephropathy\t1\t\t\nTCMR IB\t\t1\t\nTCMR II\t\t1\t\nABMR and TCMR IB\t\t1\t\nBK nephropathy\t\t2\t\nTIN/pyelonephritis\t\t1\t\nIFTA grade III\t\t1\t\nMedullary inflammation\t\t1\t\nNote\n\nAll data are described as the total count. Numbers in parentheses are percentages (also mentioned in the specific variable row).\n\nAbbreviations: ABMR, antibody‐mediated rejection; eGFR, estimated glomerular filtration rate; IFTA, interstitial fibrosis and tubular atrophy; MSC, mesenchymal stromal cell; TCMR, T cell‐mediated rejection; TIN, tubulointerstitial nephritis.\n\na One patient TCMR and recurrence membranous nephropathy; one patient chronic transplant dysfunction.\n\nJohn Wiley & Sons, Ltd\n\n4 DISCUSSION\n\nIn this randomized clinical study, we found that quantitative fibrosis scores and renal function remained stable in patients with MSC therapy and concomitant early tacrolimus withdrawal within the study period of 24 weeks. Only one acute rejection episode was documented in the MSC group after further reduction of clinical immunosuppression in the context of persistent BK viremia/nephropathy. Of interest, there were significantly higher numbers of Tregs in the MSC group with tacrolimus withdrawal compared to the controls. In addition, post hoc analyses demonstrated preserved renal function in the MSC group without evidence of late rejection. Clinical studies with MSCs in kidney transplantation, mainly phase 1 trials with still limited numbers of patients, have demonstrated that MSC treatment after kidney transplantation is safe and feasible. 9 , 10 , 11 , 12 , 20 , 21 In most studies, MSCs were administered at an early time point against the background of regular immune suppression with the aim to induce immunologic tolerance. The current strategy with MSCs and complete withdrawal of CNI have not been studied before in a randomized trial. Minimization of CNIs is a well‐established strategy to limit structural long‐term damage to the graft and minimize the side effects associated with clinical immunosuppression. 5 , 22 A number of trials have demonstrated the efficacy of EVL in conjunction with reduced exposure to CNIs in preventing organ loss or dysfunction in kidney transplant recipients. 23 Of importance, complete avoidance and replacement of a CNI by EVL in de novo transplant recipients are not justified, since unacceptable high acute rejection rates were observed with this strategy. 24 The capability of MSCs to allow reduction of 50% CNI was demonstrated in a previous study with third‐party MSCs in 16 living kidney transplant recipients. 21 The combination of an mTOR inhibitor and MSCs was chosen in the current study since experimental evidence demonstrated tolerogenic properties and an increase in regulatory immune cell subsets. 14 In our study, fibrosis scores were similar in both the MSC group and the controls, thereby failing to meet the primary end point, and the incidence of acute rejection 24 weeks after implantation was low. One explanation might be the use of alemtuzumab, 13 which was chosen as we anticipated a higher immunological risk due to the early CNI withdrawal. Indeed, given the potency of the immunosuppression regimen used in our study, seeing differences in fibrosis scores and rejection with the short study duration is unlikely. Of interest, however, the post hoc analysis with follow‐up up to 5 years showed a higher incidence of for‐cause biopsies in the control group, with findings of both BPAR and BK nephropathy, suggesting that the effect of MSC infusion in combination with CNI withdrawal carried through way beyond the period that alemtuzumab is effective. Future studies with a sufficient number of patients and duration of follow‐up are needed to be able to draw more definite conclusions. Several studies have reported an increased incidence of dnDSA in renal transplant recipients receiving EVL, especially when converted early after transplantation, and it was also suggested that the use of alemtuzumab‐based induction could aggravate this. 25 , 26 In general, dnDSA has been shown to be associated with poor graft survival and increased acute rejection in kidney transplant recipients. 27 In the large ELEVATE Trial, however, conversion to EVL at 10–14 weeks posttransplant was associated with renal function parameters similar to that observed with standard therapy. In this study, the dnDSA data, available in a subset of patients, suggested more frequent anti‐HLA Class‐I DSA under EVL. Differences in propensity to develop dnDSA, however, did not appear to have resulted in ABMR within the 2‐year observation frame of the study. 28 In our study, we also found an increased incidence of dnDSA in patients where tacrolimus was withdrawn. This was associated with (asymptomatic) signs of ABMR in the protocol biopsies of three of these patients of which one, in retrospect, already had subclinical ABMR in the 4‐week biopsy. There were no signs of deteriorating graft function in these patients. Furthermore, the post hoc analyses showed no graft losses, no need for additional for‐cause biopsies, and stable renal function in these patients as well as the MSC group as a whole. Nevertheless, given the epidemiological association with graft loss (which is, however, based on for‐cause DSA measurements), the nephrologists taking care of these patients restarted the CNI in three patients after the study period. Longer follow‐up in all patients is warranted to draw more definite conclusions here. Variable outcomes on renal function after MSC therapy have been described and it has been suggested that timing of MSC administration is of major importance. Indeed, early clinical trials have demonstrated an engraftment syndrome with infiltration of immune cells and C3 deposits when MSCs were administered 7 days after renal transplantation, which was not observed when MSCs were given before implantation. 29 In the study by Erpicum et al., eGFR values at day 7 were higher in the MSC‐treated patients. 12 In our study, patients in the MSC group started with a higher eGFR, as compared to controls, which was preserved throughout the study period and the post hoc follow‐up period. This unequal randomization was, to the best of our knowledge, found by chance and could have influenced our results. In the control group, there was increased graft loss as well as a higher number of patients with inferior renal function (i.e., eGFR < 30 ml/min/1.73 m2), possibly due to an increase in BPAR and BK nephropathy in these patients.\n\nSo far, hardly any safety issues have been reported after systemic infusion of MSCs in humans, except for a transient fever and one cardiac event with an unclear causal relationship to the intervention. 12 In our study, there were no side effects directly related to the MSC infusion. We found that (S)AEs (including viral infections) were similar in the two groups. This is in contrast to our previous study where an increased incidence of viral infections was observed after MSC therapy. 10 Possibly this is due to the fact that MSCs were given on top of regular immune suppression in our previous study. This observation is of particular relevance with the ongoing COVID‐19 pandemic. Recent observational studies have shown that kidney transplant recipients are at increased risk for severe morbidity due to their systemic immune suppression and often reduced renal function. 30\n\nMSCs have shown to condition the immune system, by releasing extracellular vesicles or membrane particles or by undergoing apoptosis. This may actively engage recipient monocytes/phagocytes and eventually Tregs, enabling long‐term tolerogenic activity that becomes self‐sustained even after disappearance of the infused MSCs themselves. 8 , 31 Of interest, in our current study, we found an increase in the absolute number of Tregs in the MSC group with tacrolimus withdrawal versus control, which has not been reported before in a randomized clinical trial with MSCs in transplant recipients. However, since there was a difference in tacrolimus use between both groups and a difference in total CD4+ T cell counts at week 12, it is not possible to deduce the results solely to the MSC treatment. Concomitantly, the percentage of memory Tregs within total CD4 T cells showed an increase in the control group compared to the MSC group at 12 weeks (Figure S5), after which the percentages in total and Treg subsets remained similar, indicating that the increase in absolute Treg numbers in the MSC group is at least partially due to changes in the total CD4+ T cell number.\n\nAt present, randomized trials with MSCs are still very limited and the field is only slowly advancing also due to stringent regulatory requirements, the need for clinical grade cell production facilities, and the associated costs. However, we recently also reported the feasibility of administration of third‐party “off‐the‐shelf” MSCs in kidney transplant recipients. 11 This option makes manufacturing and regulation easier and the use of MSC suitable for a wider spectrum of clinical application and much more feasible. We believe that the results of our current trial set the stage for the next steps and use of MSCs in the field of kidney transplantation to reduce the need for excessive use of clinical immunosuppressants.\n\nDISCLOSURE\n\nThe authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.\n\nSupporting information\n\nAppendix S1\n\nClick here for additional data file.\n\nAppendix S2\n\nClick here for additional data file.\n\nACKNOWLEDGMENTS\n\nWe thank the research department of internal medicine of the Leiden University Medical Center for their help with the study visits. We thank the research technicians from the Transplant Immunology lab for technical assistance with the immune monitoring. This investigator‐initiated study was partially funded by unrestricted research grants from Astellas and Novartis. The funders had no role in the study design, data collection, data analysis, data interpretation, or writing of the report. Part of this work was supported by a grant from ZonMW‐TAS program nr 116004104.\n==== Refs\nREFERENCES\n\n1 Lamb KE , Lodhi S , Meier‐Kriesche HU . Long‐term renal allograft survival in the United States: a critical reappraisal. Am J Transplant. 2011;11 (3 ):450‐462.20973913\n2 Coemans M , Süsal C , Döhler B , et al. Analyses of the short‐ and long‐term graft survival after kidney transplantation in Europe between 1986 and 2015. Kidney Int. 2018;94 (5 ):964‐973.30049474\n3 Wekerle T , Segev D , Lechler R , Oberbauer R . Strategies for long‐term preservation of kidney graft function. Lancet. 2017;389 (10084 ):2152‐2162.28561006\n4 Rostaing L , Kamar N . mTOR inhibitor/proliferation signal inhibitors: entering or leaving the field? J Nephrol. 2010;23 (2 ):133‐142.20155724\n5 Nankivell BJ , Borrows RJ , Fung CL , O'Connell PJ , Chapman JR , Allen RD . Calcineurin inhibitor nephrotoxicity: longitudinal assessment by protocol histology. Transplantation. 2004;78 (4 ):557‐565.15446315\n6 Sawinski D , Trofe‐Clark J , Leas B , et al. Calcineurin inhibitor minimization, conversion, withdrawal, and avoidance strategies in renal transplantation: a systematic review and meta‐analysis. Am J Transplant. 2016;16 (7 ):2117‐2138.26990455\n7 Aggarwal S , Pittenger MF . Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood. 2005;105 (4 ):1815‐1822.15494428\n8 Galleu A , Riffo‐Vasquez Y , Trento C , et al. Apoptosis in mesenchymal stromal cells induces in vivo recipient‐mediated immunomodulation. Sci Transl Med. 2017;9 (416 ):eaam7828.29141887\n9 Perico N , Casiraghi F , Introna M , et al. Autologous mesenchymal stromal cells and kidney transplantation: a pilot study of safety and clinical feasibility. Clin J Am Soc Nephrol. 2011;6 (2 ):412‐422.20930086\n10 Reinders MEJ , de Fijter JW , Roelofs H , et al. Autologous bone marrow‐derived mesenchymal stromal cells for the treatment of allograft rejection after renal transplantation: results of a phase I study. Stem Cells Transl Med. 2013;2 (2 ):107‐111.23349326\n11 Dreyer GJ , Groeneweg KE , Heidt S , et al. Human leukocyte antigen selected allogeneic mesenchymal stromal cell therapy in renal transplantation: the Neptune study, a phase I single‐center study. Am J Transplant. 2020;20 (10 ):2905‐2915.32277568\n12 Erpicum P , Weekers L , Detry O , et al. Infusion of third‐party mesenchymal stromal cells after kidney transplantation: a phase I‐II, open‐label, clinical study. Kidney Int. 2019;95 (3 ):693‐707.30528263\n13 3C Study Collaborative Group , Haynes R , Harden P , et al. Alemtuzumab‐based induction treatment versus basiliximab‐based induction treatment in kidney transplantation (the 3C Study): a randomised trial. Lancet 2014;384 (9955 ):1684‐1690.25078310\n14 Ge W , Jiang J , Baroja ML , et al. Infusion of mesenchymal stem cells and rapamycin synergize to attenuate alloimmune responses and promote cardiac allograft tolerance. Am J Transplant. 2009;9 (8 ):1760‐1772.19563344\n15 Reinders MEJ , Bank JR , Dreyer GJ , et al. Autologous bone marrow derived mesenchymal stromal cell therapy in combination with everolimus to preserve renal structure and function in renal transplant recipients. J Transl Med. 2014;12 :331.25491391\n16 Grimm PC , Nickerson P , Gough J , et al. Computerized image analysis of Sirius Red‐stained renal allograft biopsies as a surrogate marker to predict long‐term allograft function. J Am Soc Nephrol. 2003;14 (6 ):1662‐1668.12761269\n17 Loupy A , Haas M , Roufosse C , et al. The Banff 2019 Kidney Meeting Report (I): updates on and clarification of criteria for T cell‐ and antibody‐mediated rejection. Am J Transplant. 2020;20 (9 ):2318‐2331.32463180\n18 Moes D , van der Bent SAS , Swen JJ , et al. Population pharmacokinetics and pharmacogenetics of once daily tacrolimus formulation in stable liver transplant recipients. Eur J Clin Pharmacol. 2016;72 (2 ):163‐174.26521259\n19 Streitz M , Miloud T , Kapinsky M , et al. Standardization of whole blood immune phenotype monitoring for clinical trials: panels and methods from the ONE study. Transplant Res. 2013;2 (1 ):17.24160259\n20 Perico N , Casiraghi F , Todeschini M , et al. Long‐term clinical and immunological profile of kidney transplant patients given mesenchymal stromal cell immunotherapy. Front Immunol. 2018;9 :1359.29963053\n21 Pan G‐H , Chen Z , Xu LU , et al. Low‐dose tacrolimus combined with donor‐derived mesenchymal stem cells after renal transplantation: a prospective, non‐randomized study. Oncotarget. 2016;7 (11 ):12089‐12101.26933811\n22 Nankivell BJ , Kuypers DR . Diagnosis and prevention of chronic kidney allograft loss. Lancet. 2011;378 (9800 ):1428‐1437.22000139\n23 Pascual J , Berger SP , Witzke O , et al. Everolimus with reduced calcineurin inhibitor exposure in renal transplantation. J Am Soc Nephrol. 2018;29 (7 ):1979‐1991.29752413\n24 Vincenti F , Ramos E , Brattstrom C , et al. Multicenter trial exploring calcineurin inhibitors avoidance in renal transplantation. Transplantation. 2001;71 (9 ):1282‐1287.11397963\n25 Liefeldt L , Brakemeier S , Glander P , et al. Donor‐specific HLA antibodies in a cohort comparing everolimus with cyclosporine after kidney transplantation. Am J Transplant. 2012;12 (5 ):1192‐1198.22300538\n26 Todeschini M , Cortinovis M , Perico N , et al. In kidney transplant patients, alemtuzumab but not basiliximab/low‐dose rabbit anti‐thymocyte globulin induces B cell depletion and regeneration, which associates with a high incidence of de novo donor‐specific anti‐HLA antibody development. J Immunol. 2013;191 (5 ):2818‐2828.23913968\n27 Wiebe C , Gibson IW , Blydt‐Hansen TD , et al. Evolution and clinical pathologic correlations of de novo donor‐specific HLA antibody post kidney transplant. Am J Transplant. 2012;12 (5 ):1157‐1167.22429309\n28 de Fijter JW , Holdaas H , Øyen O , et al. Early conversion from calcineurin inhibitor‐ to everolimus‐based therapy following kidney transplantation: results of the randomized ELEVATE trial. Am J Transplant. 2017;17 (7 ):1853‐1867.28027625\n29 Perico N , Casiraghi F , Gotti E , et al. Mesenchymal stromal cells and kidney transplantation: pretransplant infusion protects from graft dysfunction while fostering immunoregulation. Transpl Int. 2013;26 (9 ):867‐878.23738760\n30 Elias M , Pievani D , Randoux C , et al. COVID‐19 infection in kidney transplant recipients: disease incidence and clinical outcomes. J Am Soc Nephrol. 2020;31 (10 ):2413‐2423.32847984\n31 de Witte SFH , Luk F , Sierra Parraga JM , et al. Immunomodulation by therapeutic mesenchymal stromal cells (MSC) is triggered through phagocytosis of MSC By monocytic cells. Stem Cells. 2018;36 (4 ):602‐615.29341339\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1600-6135",
"issue": "21(9)",
"journal": "American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons",
"keywords": "clinical research/practice; clinical trial; immune regulation; immunosuppression/immune modulation; immunosuppressive regimens - minimization/withdrawal; kidney transplantation/nephrology; kidney transplantation: living donor; stem cells",
"medline_ta": "Am J Transplant",
"mesh_terms": "D001853:Bone Marrow; D006084:Graft Rejection; D006801:Humans; D007166:Immunosuppressive Agents; D045164:Mesenchymal Stem Cell Transplantation; D059630:Mesenchymal Stem Cells; D011446:Prospective Studies; D016559:Tacrolimus",
"nlm_unique_id": "100968638",
"other_id": null,
"pages": "3055-3065",
"pmc": null,
"pmid": "33565206",
"pubdate": "2021-09",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": "20930086;22300538;22429309;25078310;28027625;29341339;23349326;26521259;15494428;29963053;32463180;26990455;30528263;11397963;24160259;29752413;30049474;26933811;23738760;32847984;20973913;25491391;20155724;28561006;32277568;12761269;22000139;23913968;29141887;19563344;15446315",
"title": "Autologous bone marrow-derived mesenchymal stromal cell therapy with early tacrolimus withdrawal: The randomized prospective, single-center, open-label TRITON study.",
"title_normalized": "autologous bone marrow derived mesenchymal stromal cell therapy with early tacrolimus withdrawal the randomized prospective single center open label triton study"
} | [
{
"companynumb": "NL-ALKEM LABORATORIES LIMITED-NL-ALKEM-2021-00943",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALEMTUZUMAB"
},
"drug... |
{
"abstract": "BACKGROUND\nTo obtain a perspective of the current status of catheter ablation for the cure of atrial fibrillation, the Japanese Heart Rhythm Society conducted a nationwide survey: the Japanese Catheter Ablation Registry of Atrial Fibrillation. In this report, we aimed to evaluate the periprocedural use of direct oral anticoagulants with respect to thromboembolic or bleeding complications.\n\n\nMETHODS\nUsing an online questionnaire, the Japanese Heart Rhythm Society requested electrophysiology centers in Japan to register the relevant data of patients who underwent atrial fibrillation ablation over selected five-months from 2011 to 2014. We compared the clinical profiles and the ablation data, including the incidence of pericardial effusion, major bleeding, and ischemic stroke among patients with periprocedural use of warfarin or a direct oral anticoagulant.\n\n\nRESULTS\nA total of 204 institutions reported data on 6200 atrial fibrillation ablation sessions. We analyzed data obtained from 4698 subjects (Age 63.2±10.6 yr; 73.9% male, 26.1% female) who were administered warfarin or a direct oral anticoagulant, at least up to the day before atrial fibrillation ablation. Warfarin was administered to 54.7% of patients. Dabigatran, rivaroxaban, and apixaban were used in 21.9%, 12.9%, and 10.6% of patients, respectively. Clinical profiles of apixaban-treated patients were similar to those of warfarin-treated patients; they were different from the clinical profiles of patients treated with dabigatran or rivaroxaban. There were 104 complications in 103 subjects (2.2%). Complications were more frequent in older patients (65.3±8.6 yr vs. 63.1±10.7 yr; P=0.012), patients on chronic hemodialysis (4.9% vs. 1.1%; P=0.001), or those treated with warfarin (66.0% vs. 54.4%; P=0.019). Multiple logistic regression analysis revealed that age (OR, 1.02; 95% CI: 1.00-1.04; P=0.035), chronic hemodialysis (OR, 4.40; CI: 1.68-11.50; P=0.003), and assistance by 3-D mapping system (OR, 0.30; CI: 0.16-0.57; P<0.001) were significantly related to the incidence of complications, while periprocedural direct oral anticoagulant was not a predictive factor for complication.\n\n\nCONCLUSIONS\nCompared with uninterrupted warfarin, the choice of a direct oral anticoagulant as a periprocedural oral anticoagulant did not significantly change the incidence of serious complications.",
"affiliations": "Fourth Department of Internal Medicine, Teikyo University, School of Medicine, 3-8-3 Mizonokuchi, Takatsu-ku, Kawasaki, Kanagawa 213-8507, Japan.;Cardiovascular Division, Faculty of Medicine, University of Tsukuba, Japan.;Department of Cardiology, Tokyo Women׳s Medical University, Japan.;Cardiovascular Center, Sakurabashi Watanabe Hospital, Japan.;Division of Cardiology, Gunma Prefectural Cardiovascular Center, Japan.;Heart Rhythm Center, Fukuoka Sanno Hospital, Japan.;Division of Cardiology, Nippon Medical School, Japan.;The Department of Cardiology, The Jikei University School of Medicine, Japan.;Division of Cardiology, Tokai University Hachioji Hospital, Japan.;Division of Cardiology, Tachikawa Hospital, Japan.;Division of Cardiology, Saiseikai Kumamoto Hospital, Japan.;Heart Rhythm Center, Tokyo Medical and Dental University, Japan.",
"authors": "Murakawa|Yuji|Y|;Nogami|Akihiko|A|;Shoda|Morio|M|;Inoue|Koichi|K|;Naito|Shigeto|S|;Kumagai|Koichiro|K|;Miyauchi|Yasushi|Y|;Yamane|Teiichi|T|;Morita|Norishige|N|;Mitamura|Hideo|H|;Okumura|Ken|K|;Hirao|Kenzo|K|;|||",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1016/j.joa.2016.10.002",
"fulltext": "\n==== Front\nJ ArrhythmJ ArrhythmJournal of Arrhythmia1880-42761883-2148Elsevier S1880-4276(16)30139-910.1016/j.joa.2016.10.002Original ArticleReport of periprocedural oral anticoagulants in catheter ablation for atrial fibrillation: The Japanese Catheter Ablation Registry of Atrial Fibrillation (J-CARAF) Murakawa Yuji MDmurakawa@med.teikyo-u.ac.jpa⁎Nogami Akihiko MDbShoda Morio MDcInoue Koichi MDdNaito Shigeto MDeKumagai Koichiro MDfMiyauchi Yasushi MDgYamane Teiichi MDhMorita Norishige MDiMitamura Hideo MDjOkumura Ken MDkHirao Kenzo MDlon behalf of the Japanese Heart Rhythm Society Members a Fourth Department of Internal Medicine, Teikyo University, School of Medicine, 3-8-3 Mizonokuchi, Takatsu-ku, Kawasaki, Kanagawa 213-8507, Japanb Cardiovascular Division, Faculty of Medicine, University of Tsukuba, Japanc Department of Cardiology, Tokyo Women׳s Medical University, Japand Cardiovascular Center, Sakurabashi Watanabe Hospital, Japane Division of Cardiology, Gunma Prefectural Cardiovascular Center, Japanf Heart Rhythm Center, Fukuoka Sanno Hospital, Japang Division of Cardiology, Nippon Medical School, Japanh The Department of Cardiology, The Jikei University School of Medicine, Japani Division of Cardiology, Tokai University Hachioji Hospital, Japanj Division of Cardiology, Tachikawa Hospital, Japank Division of Cardiology, Saiseikai Kumamoto Hospital, Japanl Heart Rhythm Center, Tokyo Medical and Dental University, Japan⁎ Corresponding author. murakawa@med.teikyo-u.ac.jp27 10 2016 6 2017 27 10 2016 33 3 172 176 23 8 2016 26 9 2016 2 10 2016 © 2016 Japanese Heart Rhythm Society. Published by Elsevier B.V.2016Japanese Heart Rhythm SocietyThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Background\nTo obtain a perspective of the current status of catheter ablation for the cure of atrial fibrillation, the Japanese Heart Rhythm Society conducted a nationwide survey: the Japanese Catheter Ablation Registry of Atrial Fibrillation. In this report, we aimed to evaluate the periprocedural use of direct oral anticoagulants with respect to thromboembolic or bleeding complications.\n\nMethods\nUsing an online questionnaire, the Japanese Heart Rhythm Society requested electrophysiology centers in Japan to register the relevant data of patients who underwent atrial fibrillation ablation over selected five-months from 2011 to 2014. We compared the clinical profiles and the ablation data, including the incidence of pericardial effusion, major bleeding, and ischemic stroke among patients with periprocedural use of warfarin or a direct oral anticoagulant.\n\nResults\nA total of 204 institutions reported data on 6200 atrial fibrillation ablation sessions. We analyzed data obtained from 4698 subjects (Age 63.2±10.6 yr; 73.9% male, 26.1% female) who were administered warfarin or a direct oral anticoagulant, at least up to the day before atrial fibrillation ablation. Warfarin was administered to 54.7% of patients. Dabigatran, rivaroxaban, and apixaban were used in 21.9%, 12.9%, and 10.6% of patients, respectively. Clinical profiles of apixaban-treated patients were similar to those of warfarin-treated patients; they were different from the clinical profiles of patients treated with dabigatran or rivaroxaban. There were 104 complications in 103 subjects (2.2%). Complications were more frequent in older patients (65.3±8.6 yr vs. 63.1±10.7 yr; P=0.012), patients on chronic hemodialysis (4.9% vs. 1.1%; P=0.001), or those treated with warfarin (66.0% vs. 54.4%; P=0.019). Multiple logistic regression analysis revealed that age (OR, 1.02; 95% CI: 1.00–1.04; P=0.035), chronic hemodialysis (OR, 4.40; CI: 1.68–11.50; P=0.003), and assistance by 3-D mapping system (OR, 0.30; CI: 0.16–0.57; P<0.001) were significantly related to the incidence of complications, while periprocedural direct oral anticoagulant was not a predictive factor for complication.\n\nConclusions\nCompared with uninterrupted warfarin, the choice of a direct oral anticoagulant as a periprocedural oral anticoagulant did not significantly change the incidence of serious complications.\n\nKeywords\nAtrial fibrillationCatheter ablationWarfarinDirect oral anticoagulant\n==== Body\n1 Introduction\nTechnological and technical innovations of catheter ablation for various arrhythmias are continuously being introduced into practice. Tenacious effort is required to ensure that in each country this treatment is performed in accordance with the international standards [1]. The Japanese Heart Rhythm Society (JHRS) conducted annual nationwide registries of patients who underwent catheter ablation for atrial fibrillation (AF): the Japanese Catheter Ablation Registry of Atrial Fibrillation (J-CARAF) [2], [3], [4].\n\nCurrently, uninterrupted warfarin therapy is considered superior to interrupted anticoagulation strategy with respect to thromboembolic and bleeding complications [5], [6], [7], [8]. Moreover, some studies, including our previous report [2], have evaluated the safety and efficacy of direct oral anticoagulants (DOAC) in the management of AF ablation [9], [10], [11], [12], [13], [14], [15], [16], [17], [18]. However, the number of subjects analyzed in earlier studies is rather small. In this report, we compared the clinical features and incidence of bleeding complication and ischemic stroke during, and immediately after AF ablation among patients receiving periprocedural treatment with warfarin or a DOAC. The aim of this study was to elucidate the current status of the use of DOAC as a periprocedural anticoagulant during AF ablation in Japan, and to evaluate the periprocedural use of a DOAC with respect to thromboembolic or bleeding complications.\n\n2 Material and methods\nThe method of this survey has previously been reported [3], [4]. In short, the survey was performed retrospectively using an online questionnaire. The JHRS members were notified by e-mail. Data on patient backgrounds, methods of pulmonary vein isolation and related techniques, complications, as well as the periprocedural pharmacological treatments were collected for AF ablation sessions performed in September 2011, May 2012, September 2012, September 2013, and September 2014. Patient data included age, sex, previous AF ablation, AF type (paroxysmal, PAF; persistent, or long-standing, LS; persistent), thromboembolism risk factors, and echocardiographic parameters. When one of the oral anticoagulants (OACs) was intentionally continued at least up to the day before the AF ablation, they were considered to have been used periprocedural. The OAC administered on the day of AF ablation was not included in the data.\n\nAlthough some patients had not received any periprocedural OAC, the reasons for this were beyond the scope of the survey, and the details of anticoagulant management might have widely varied in these patients. Moreover, the definition of periprocedural OAC was not precisely defined in the early stages of the survey; thus, some patients who were actually administered an OAC until the day before AF ablation, but not on the day of the procedure might have been inadvertently categorized as patients without periprocedural OAC. Therefore, in this report, only the data of subjects who were recorded as having received warfarin or a DOAC were analyzed.\n\nMajor bleeding complications included pericardial effusion (PE) that needed pericardiocentesis or surgery, hemothorax, retroperitoneal hematoma, and massive bleeding at the puncture site. Stroke was evaluated based on clinical parameters. Silent brain infarctions on magnetic resonance imaging, or transient ischemic attacks were not included. Centers with ≥10 procedures per month were defined as high-volume centers, and centers with ≤9 procedures per month were defined as low-volume centers.\n\nThe continuous variables with a normal distribution were expressed as the mean±SD. Comparison of continuous variables between two groups was done using unpaired Student׳s t-test. Comparisons of variables among the four study groups were performed using one-way analysis of variance with post-hoc Bonferroni test. Categorical variables were compared using Tukey׳s test. A multiple logistic regression analysis was performed for variables with univariate P value<0.1, to detect the independent determinants for the occurrence of complications. A P<0.05 was considered statistically significant.\n\n3 Results\n3.1 General observations\nTwo-hundred-and-four institutions reported the data of 6200 AF ablation sessions. Among them, 1502 patients were registered as not having received periprocedural OAC treatment. We analyzed the data of the remaining 4698 subjects (age 63.2±10.6 yr; 73.9% male, 26.1% female) who were administered warfarin or a DOAC up to the day before AF ablation.\n\nIn the population, there were 77.9% first AF ablation sessions, 64.2% (n= 3017) patients with PAF, 22.2% (n= 1043) patients with persistent AF, and 13.6% (n=638) patients with LS-persistent AF.\n\n3.2 Periprocedural anticoagulant strategies\nAs a periprocedural OAC, warfarin was administered to 54.7% of patients (2568). Dabigatran and rivaroxaban were used in 21.9% of patients (1027) and 12.9% of patients (606), respectively. The remaining 10.6% patients (497) were treated with apixaban. A total of 45.3% of patients (2130) were taking a DOAC at least up to the day before AF ablation.\n\n3.3 Comparison of patient profiles\nAs shown in Table 1, the percentage of PAF in patients treated with warfarin (60.7%) is significantly smaller than those treated with dabigatran (66.8%; P<0.01) or rivaroxaban (72.6%; P<0.01). Lone AF was less frequent in patients with uninterrupted warfarin (20.0%) or apixaban (17.9%), than in those treated with dabigatran (25.7%) or rivaroxaban (25.6%). The CHADS2 and CHA2DS2-VASc scores were relatively high in patients treated with warfarin and apixaban. Thus, the clinical profiles of apixaban-treated patients were similar to those of warfarin-treated patients, but were not to those of patients treated with either of dabigatran or rivaroxaban.Table 1 Comparison of clinical and procedural profiles among four patient groups.\n\nTable 1.\tWarfarin\tDabigatran\tRivaroxaban\tApixaban\tP value\t\nNumber of patients:\t2568 (54.7%)\t1027 (21.9%)\t606 (12.9%)\t497 (10.6%)\tW vs. D\tW vs. R\tW vs. A\tD vs. R\tD vs. A\tR vs. A\t\nAge (yrs)\t61.2±10.6\t63.8±10.3\t62.7±11.2\t64.6±10.9\t⁎⁎\t\t\t⁎\t⁎⁎\t⁎\t\nMale\t75.2%\t76.0%\t71.5%\t66.4%\t\t\t⁎⁎\t\t⁎⁎\t\t\nFirst session\t75.5%\t78.9%\t81.6%\t84.1%\t\t⁎⁎\t⁎⁎\t\t\t\t\nPAF\t60.7%\t66.8%\t72.6%\t66.6%\t⁎⁎\t⁎⁎\t\t⁎\t\t\t\nLone AF\t20.0%\t25.7%\t25.6%\t17.9%\t⁎⁎\t⁎\t\t\t⁎⁎\t⁎⁎\t\nCHADS2 score\t1.16±1.07\t0.92±0.98\t0.86±0.92\t1.05±1.07\t⁎⁎\t⁎⁎\t\t\t\t⁎\t\nCHA2DS2-VASc score\t1.95±1.48\t1.59±1.35\t1.64±1.32\t1.98±1.49\t⁎⁎\t⁎⁎\t\t\t⁎⁎\t⁎⁎\t\nLVEF (%)\t62.6±10.4\t64.4±8.8\t64.6±9.2\t63.5±9.4\t⁎⁎\t⁎⁎\t⁎\t\t\t\t\nLAD (mm)\t40.9±6.6\t40.3±6.5\t39.2±7.0\t39.8±7.1\t\t⁎⁎\t⁎⁎\t\t\t\t\nProcedure time (hrs)\t3.5±1.2\t3.3±1.2\t3.5±1.2\t3.5±1.2\t\t\t\t\t\t\t\nHemodialysis\t2.2%\t0.0%\t0.0%\t0.0%\t⁎⁎\t⁎⁎\t⁎⁎\t\t\t\t\nDeep sedation\t50.4%\t42.3%\t55.6%\t47.5%\t⁎⁎\t\t\t⁎⁎\t\t⁎⁎\t\nLVEF: left ventricular ejection fraction, LAD: left atrial diameter, LAD: left atrial diameter,\n\nW: warfarin, D: dabigatran, R: rivaroxaban, A: apixaban.\n\n⁎ P<0.05,\n\n⁎⁎ P<0.01.\n\n\n\n3.4 Complications\nA total of 104 complications occurred in 2.2% of patients (103). The incidences of PE, major bleeding, and stroke are shown in Table 2. In one patient treated with periprocedural apixaban, PE required surgical repair, while pericardiocentesis was performed in 50 patients. Hemothorax, retroperitoneal hematoma, and massive bleeding at the puncture site were seen in one, three, and 46 patients, respectively. Ischemic stroke was diagnosed in three patients. Both PE and hemothorax occurred in one patient treated with warfarin. The clinical profiles, procedures of AF ablation, and the choices of periprocedural OACs were compared among patients, with or without complications (Table 3). Complications were more frequent in older patients (65.3±8.6 yr vs. 63.1±10.7 yr; P=0.012), patients on chronic hemodialysis (4.9% vs. 1.1%; P=0.001), or those treated with warfarin (66.0% vs. 54.4%; P=0.019). Furthermore, 3-D mapping systems were used more frequently in patients without complications (81.6% vs. 93.6%; P<0.001). In the high-volume and low-volume centers, complications occurred in 1.7% and 2.6% of procedures, respectively (P=0.434).Table 2 Periprocedural oral anticoagulation, complications, and clinical and procedural profiles.\n\nTable 2.\tWarfarin\tDabigatran\tRivaroxaban\tApixaban\tTotal\t\nNumber of patients\t2568 (54.7%)\t1027 (21.9%)\t606 (12.9%)\t497 (10.6%)\t4698\t\nPE+bleeding+stroke (pts.)\t68 (2.6%)\t15 (1.5%)\t14 (2.3%)\t6 (1.2%)\t103 (2.2%)\t\nPericardial effusion (PE)\t39 (1.5%)\t5 (0.5%)*\t5 (0.8%)\t2 (0.4%)\t51 (1.1%)\t\nBleeding\t29 (1.1%)\t9 (0.9%)\t8 (1.3%)\t4 (0.8%)\t40 (0.8%)\t\nStroke\t1 (0.0%)\t1 (0.1%)\t1 (0.2%)\t0\t3 (0.1%)\t\nBoth PE and bleeding event occurred in one patient treated with warfarin.\n\n* P<0.05 vs. warfarin.\n\nTable 3 Clinical profiles, procedures of AF ablation, and periprocedural OAC.\n\nTable 3.\tPE+bleeding+stroke\t\t\n\t+\t(−)\tP value\t\nn\t103\t4595\t\t\nAge (yr)\t65.3±8.6\t63.1±10.7\t0.012\t\nGender (male)\t71.8%\t74.0%\t0.616\t\nFirst session\t83.5%\t77.8%\t0.616\t\nPAF\t63.1%\t64.2%\t0.812\t\nLone AF\t21.4%\t21.8%\t0.922\t\nLow-volume center\t39.8%\t35.8%\t0.404\t\nCHADS2 score\t1.11±1.08\t1.06±1.04\t0.637\t\nCHA2DS2-VASc score\t1.99±1.49\t1.83±1.44\t0.271\t\nLVEF (%)\t63.9±9.3\t63.3±9.8\t0.500\t\nLAD (mm)\t40.7±6.4\t40.4±6.7\t0.683\t\nChronic hemodialysis\t4.9%\t1.1%\t0.001\t\nDeep anesthesia\t57.3%\t48.8%\t0.089\t\n3-D mapping\t81.6%\t93.6%\t<0.001\t\nIrrigation catheter\t75.7%\t82.7%\t0.064\t\nCryobaloon\t1.0%\t2.5%\t0.327\t\nCFAE ablation\t12.6%\t10.5%\t0.491\t\nLA linear ablation\t21.4%\t24.6%\t0.448\t\nWarfarin\t66.0%\t54.4%\t0.019\t\nDabigatran\t14.6%\t22.0%\t0.070\t\nRivaroxaban\t13.6%\t12.9%\t0.832\t\nApixaban\t5.8%\t10.7%\t0.113\t\nPE: pericardial effusion, AF: atrial fibrillation, PAF: paroxysmal atrial fibrillation, LVEF: left ventricular ejection fraction, LAD: left atrial diameter, LA: left atrium,\n\nCFAE: complex fractionated atrial electrogram\n\n\n\nTable 4 shows the results of the multiple logistic regression analysis. Age, chronic hemodialysis, and lack of assistance of the 3-D mapping system were significantly related to complications, while the choice of periprocedural OAC was not significantly associated with the incidence of complications.Table 4 Results of multiple logistic regression analysis.\n\nTable 4.\tOdds ratio\t95% CI\tP value\t\nAge (yr)\t1.02\t1.00–1.04\t0.035\t\nChronic hemodialysis\t4.40\t1.68–11.50\t0.003\t\nDeep anesthesia\t1.29\t0.86–1.92\t0.220\t\n3-D mapping\t0.30\t0.16–0.57\t<0.001\t\nIrrigation catheter\t1.07\t0.61–1.89\t0.808\t\nWarfarin\t1.34\t0.80–2.23\t0.263\t\nDabigatran\t0.90\t0.45–1.77\t0.751\t\n95% CI: 95% confidence interval\n\n\n\n4 Discussion\n4.1 Major findings\nThe major findings of the present study are as follows: (1) DOACs are used in 50% of patients who underwent AF ablation with a periprocedural OAC; (2) clinical profiles of apixaban-treated patients are similar to those of warfarin-treated patients, but not to those treated with either of the other two DOACs; and (3) periprocedural use of a DOAC did not significantly affect the incidence of major complications.\n\n4.2 Earlier studies\nThe meta-analysis suggests that patients treated with rivaroxaban have a similar incidence of thromboembolic events and major bleeding compared with warfarin [17]. The rate of serious complications in patients on apixaban undergoing AF ablation is low, and similar to that seen in patients treated with uninterrupted warfarin [18]. One study has reported that dabigatran increases the risk of bleeding and ischemic stroke [14]. However, several other studies have concluded that dabigatran may safely be substituted for warfarin [2], [9], [10], [11], [13], [15]. Although there are several articles that report an increase or decrease in adverse events with periprocedural DOACs, most studies find no remarkable differences in bleeding and thrombotic events between warfarin and DOACs [19].\n\n4.3 Interpretation of the present results\nIn the present study, the overall incidence of PE, major bleeding, and stroke does not show significant difference among the DOAC or warfarin treated patients. Pericardial effusion occurs infrequently among patients treated with dabigatran, than in patients treated with warfarin. Some differences in the clinical profiles among patients treated with warfarin and those treated with three DOACs suggest that warfarin and apixaban have been used in patients with frailer or clinically complicated profiles. Considering the diverse clinical features among DOAC treated patients, the choice of specific DOACs seems to have been made individually, on the basis of presumed merits and demerits of each anticoagulant to a certain extent. Moreover, none of the DOACs drastically increased or decreased the number of serious complications assessed in our present study.\n\n4.4 Limitations\nIn this study, the data of patients were collected from a large number of centers. Thus, we assume that our observations may offer a perspective of periprocedural anticoagulant management during AF ablation. The risk of early complications is related to many factors, such as underlying heart diseases, and the procedures used for ablation [3]. Because of significant variations in clinical features among different DOACs, it may be possible that the present results fail to elucidate the advantages or disadvantages of each DOAC. Diagnosis of the complications was entirely entrusted to individual physicians. Special care must be taken to interpret the present results that might have been biased by the limitations inherent to observational studies. Finally, because details of the dosage regimen of OACs, and of heparin usage in individual patients were not included in this survey, it is not possible to identify the most suitable anticoagulant management of AF ablation from the results.\n\n5 Conclusions\nDOACs are widely used in Japan as safe substitutes for warfarin, without significant increase in ischemic stroke and bleeding complications. Warfarin and apixaban are used in patients with frail or complicated profiles. Choice of any DOAC as a periprocedural OAC does not significantly affect the incidence of serious complications.\n\nConflict of interest\nAll authors declare no conflict of interest related to this study.\n\nAcknowledgement\nThis survey was conducted with the voluntary support of the JHRS members.\n==== Refs\nReferences\n1 Da Costa A. Catheter ablation procedures: role of nation-wide registries Europace 11 2009 133 134 19106199 \n2 Murakawa Y. Nogami A. Shoda M. Nationwide survey of catheter ablation for atrial fibrillation: the Japanese catheter ablation registry of atrial fibrillation (J-CARAF)–A report on periprocedural oral anticoagulants J Arrhythm 31 2015 29 32 26336520 \n3 Inoue K. Murakawa Y. Nogami A. Clinical and procedural predictors of early complications of ablation for atrial fibrillation: analysis of the national registry data Heart Rhythm 11 2014 2247 2253 25131666 \n4 Murakawa Y. Nogami A. Shoda M. Nationwide survey of catheter ablation for atrial fibrillation: the Japanese Catheter Ablation Registry of Atrial Fibrillation (J-CARAF)--report of 1-year follow-up Circ J 78 2014 1091 1096 [PMID: 24662400] 24662400 \n5 Di Biase L. Burkhardt J.D. Mohanty P. Periprocedural stroke and management of major bleeding complications in patients undergoing catheter ablation of atrial fibrillation: the impact of periprocedural therapeutic international normalized ratio Circulation 121 2010 2550 2556 20516376 \n6 Santangeli P. Di Biase L. Horton R. Burkhardt J.D. Ablation of atrial fibrillation under therapeutic warfarin reduces periprocedural complications: evidence from a meta-analysis Circ Arrhythm Electrophysiol 5 2012 302 311 22271713 \n7 Hakalahti A. Uusimaa P. Ylitalo K. Catheter ablation of atrial fibrillation in patients with therapeutic oral anticoagulation treatment Europace 13 2011 640 645 21398311 \n8 Wazni O.M. Beheiry S. Fahmy T. Barrett C. Atrial fibrillation ablation in patients with therapeutic international normalized ratio: comparison of strategies of anticoagulation management in the periprocedural period Circulation 116 2007 2531 2534 17998456 \n9 Shurrab M. Morillo C.A. Schulman S. Safety and efficacy of dabigatran compared with warfarin for patients undergoing radiofrequency catheter ablation of atrial fibrillation: a meta-analysis Can J Cardiol 29 2013 1203 1210 23993352 \n10 Kim J.S. She F. Jongnarangsin K. Dabigatran vs. warfarin for radiofrequency catheter ablation of atrial fibrillation Heart Rhythm 10 2013 483 489 23237911 \n11 Providência R. Albenque J.P. Combes S. Safety and efficacy of dabigatran versus warfarin in patients undergoing catheter ablation of atrial fibrillation: a systematic review and meta-analysis Heart 100 2014 324 335 23878175 \n12 Lakkireddy D. Reddy Y.M. Di Biase L. Feasibility & safety of uninterrupted rivaroxaban for periprocedural anticoagulation in patients undergoing radiofrequency ablation for atrial fibrillation: results from a multicenter prospective registry J Am Coll Cardiol 63 9 2014 82 88 \n13 Kaseno K. Naito S. Nakamura K. Efficacy and safety of periprocedural dabigatran in patients undergoing catheter ablation of atrial fibrillation Circ J 76 2012 2337 2342 [PMID: 22785434] 22785434 \n14 Lakkireddy D. Reddy Y.M. Di Biase L. Feasibility and safety of dabigatran versus warfarin for periprocedural anticoagulation in patients undergoing radiofrequency ablation for atrial fibrillation: results from a multicenter prospective registry J Am Coll Cardiol 59 2012 1168 1174 22305113 \n15 Rillig A. Lin T. Plesman J. Apixaban, rivaroxaban, and dabigatran in patients undergoing atrial fibrillation ablation J Cardiovasc Electrophysiol 27 2016 147 153 26464027 \n16 Potpara T.S. Larsen T.B. Deharo J.C. Oral anticoagulant therapy for stroke prevention in patients with atrial fibrillation undergoing ablation: results from the First European Snapshot Survey on Procedural Routines for Atrial Fibrillation Ablation (ESS-PRAFA) Europace 17 2015 986 993 26023177 \n17 Li W. Gao C. Li M. Safety and efficacy of rivaroxaban versus warfarin in patients undergoing catheter ablation of atrial fibrillation: a meta-analysis of observational studies Discov Med 19 2015 193 201 [PMID: 25828523] 25828523 \n18 Blandino A. Bianchi F. Biondi-Zoccai G. Apixaban for periprocedural anticoagulation during catheter ablation of atrial fibrillation: a systematic review and meta-analysis of 1691 patients J Interv Card Electrophysiol 46 2016 225 236 27217030 \n19 Abed H.S. Chen V. Kilborn M.J. Periprocedural management of novel oral anticoagulants during atrial fibrillation ablation: controversies and review of the current evidence Heart Lung Circ 2016 [Epub ahead of print]\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1880-4276",
"issue": "33(3)",
"journal": "Journal of arrhythmia",
"keywords": "Atrial fibrillation; Catheter ablation; Direct oral anticoagulant; Warfarin",
"medline_ta": "J Arrhythm",
"mesh_terms": null,
"nlm_unique_id": "101263026",
"other_id": null,
"pages": "172-176",
"pmc": null,
"pmid": "28607611",
"pubdate": "2017-06",
"publication_types": "D016428:Journal Article",
"references": "27425183;24662400;25828523;17998456;26336520;23993352;19106199;20516376;26464027;22785434;25131666;21398311;23878175;23237911;22305113;22271713;27217030;26023177;24412445",
"title": "Report of periprocedural oral anticoagulants in catheter ablation for atrial fibrillation: The Japanese Catheter Ablation Registry of Atrial Fibrillation (J-CARAF).",
"title_normalized": "report of periprocedural oral anticoagulants in catheter ablation for atrial fibrillation the japanese catheter ablation registry of atrial fibrillation j caraf"
} | [
{
"companynumb": "JP-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-037685",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "Background: Repeated supratherapeutic ingestion (RSTI) of paracetamol can result in acute liver injury. Management guidelines vary worldwide and in Australia, acetylcysteine treatment is recommended in patients with a paracetamol concentration ≥20 mg/L and/or alanine transaminase (ALT) ≥50 U/L. Objectives: To investigate patients with RSTI of paracetamol and determine whether admission ALT <50 U/L rules out those who develop hepatotoxicity (ALT >1000 U/L). Method: Retrospective review of paracetamol RSTI presentations to two toxicology services over a four-year period. Patients were included if they ingested >4 g per 24 h of paracetamol for a period >8 h, regardless of intent. Data collected included demographics, ingestion history, pathology results, treatments and outcomes. Results: 266 patients were identified with median ingested dose of 9 g per 24 h (IQR: 6-12 g) over a median of 2 days (IQR: 1-5 days). On presentation, paracetamol was detected in 192 (72%), with median concentration of 14 mg/L (IQR: 7-27 mg/L). Median ALT on admission in those developing hepatotoxicity was significantly higher, 1182 U/L (IQR: 598-4251 U/L), compared to 30 U/L (IQR: 18-59 U/L; p < .0001) in those who did not. All 17 who developed hepatotoxicity had an ALT ≥50 U/L on presentation. Five patients presenting with an ALT <50 U/L developed a peak ALT between 50 and 1000 U/L, of which three had a paracetamol concentration <20 mg/L. 139 (52%) received acetylcysteine, of which 64 received an abbreviated course (<20 h), with a median length of infusion of 11 h (IQR: 7-14 h). 127 (48%) patients were not treated with acetylcysteine, none of these patients returned to hospital. Conclusions: Our results confirm that those developing hepatotoxicity from RSTI of paracetamol have an elevated ALT on presentation. Presenting ALT <50 U/L appears to be a safe threshold not to administer acetylcysteine, provided the paracetamol concentration is low.",
"affiliations": "a Prince of Wales Hospital Clinical School , University of NSW , NSW , Australia.;b Department of Clinical Toxicology and Pharmacology, Calvary Mater Newcastle and Clinical Toxicology Research Group , University of Newcastle , Callaghan , NSW , Australia.;b Department of Clinical Toxicology and Pharmacology, Calvary Mater Newcastle and Clinical Toxicology Research Group , University of Newcastle , Callaghan , NSW , Australia.;b Department of Clinical Toxicology and Pharmacology, Calvary Mater Newcastle and Clinical Toxicology Research Group , University of Newcastle , Callaghan , NSW , Australia.;c Department of Clinical Toxicology , Prince of Wales Hospital , Randwick , NSW , Australia.;d NSW Health Pathology , Prince of Wales Hospital, Randwick , NSW , Australia.;c Department of Clinical Toxicology , Prince of Wales Hospital , Randwick , NSW , Australia.",
"authors": "Egan|Harry|H|;Isbister|Geoffrey K|GK|http://orcid.org/0000-0003-1519-7419;Robinson|Jennifer|J|;Downes|Michael|M|;Chan|Betty S|BS|http://orcid.org/0000-0003-0083-282X;Vecellio|Elia|E|;Chiew|Angela L|AL|http://orcid.org/0000-0002-0079-5056",
"chemical_list": "D018712:Analgesics, Non-Narcotic; D000082:Acetaminophen; D000410:Alanine Transaminase; D000111:Acetylcysteine",
"country": "England",
"delete": false,
"doi": "10.1080/15563650.2018.1547829",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-3650",
"issue": "57(8)",
"journal": "Clinical toxicology (Philadelphia, Pa.)",
"keywords": "Paracetamol; acetylcysteine; hepatotoxicity",
"medline_ta": "Clin Toxicol (Phila)",
"mesh_terms": "D000082:Acetaminophen; D000111:Acetylcysteine; D000328:Adult; D000410:Alanine Transaminase; D018712:Analgesics, Non-Narcotic; D056486:Chemical and Drug Induced Liver Injury; D062787:Drug Overdose; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies",
"nlm_unique_id": "101241654",
"other_id": null,
"pages": "703-711",
"pmc": null,
"pmid": "30789042",
"pubdate": "2019-08",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Retrospective evaluation of repeated supratherapeutic ingestion (RSTI) of paracetamol †.",
"title_normalized": "retrospective evaluation of repeated supratherapeutic ingestion rsti of paracetamol"
} | [
{
"companynumb": "AU-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-291970",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"d... |
{
"abstract": "Fibrates are widely prescribed as hypolipidemic drugs and are considered as safe. We report the case of a 69 year-old woman who probably developed a major allergic reaction following a Fenofibrate prescription (generic form) of 300 mg per day. Clinical features included asthenia, hyperthermia (40.5 degrees C) and slight muscular pain. Biological abnormalities were mildly elevated muscular enzymes and pancytopenia rapidly developed. All bacteriologic, virologic, immune and radiologic investigations were normal. Evolution was spontaneously favorable with Fenofibrate withdrawal. This is the first reported case of major fever and pancytopenia following a Fenofibrate prescription. Adverse effects of Fenofibrate are briefly reviewed and their usual favorable outcomes following drug removal are outlined.",
"affiliations": "Service des Maladies Métaboliques, Hôpital Lapeyronie, Centre Hospitalier Universitaire de Montpellier, 34295 Montpellier Cedex 05. rrabasa@mnet.fr",
"authors": "Rabasa-Lhoret|R|R|;Rasamisoa|M|M|;Avignon|A|A|;Monnier|L|L|",
"chemical_list": "D000960:Hypolipidemic Agents; D011345:Fenofibrate",
"country": "France",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1262-3636",
"issue": "27(1)",
"journal": "Diabetes & metabolism",
"keywords": null,
"medline_ta": "Diabetes Metab",
"mesh_terms": "D000368:Aged; D002763:Cholecystectomy; D004342:Drug Hypersensitivity; D005260:Female; D011345:Fenofibrate; D005334:Fever; D006801:Humans; D006949:Hyperlipidemias; D000960:Hypolipidemic Agents; D007958:Leukocyte Count; D010198:Pancytopenia; D010976:Platelet Count; D013610:Tachycardia",
"nlm_unique_id": "9607599",
"other_id": null,
"pages": "66-8",
"pmc": null,
"pmid": "11240449",
"pubdate": "2001-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rare side-effects of fenofibrate.",
"title_normalized": "rare side effects of fenofibrate"
} | [
{
"companynumb": "FR-AUROBINDO-AUR-APL-2021-015326",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "FENOFIBRATE"
},
"drugadditional": "1",... |
{
"abstract": "BACKGROUND\nIdiopathic systemic capillary leak syndrome (ISCLS) is rarely seen, and presents with recurrent episodes of hypotension, shock, hemoconcentration, and hypoproteinemia. The main pathology is the dysfunction of the vascular endothelium, and it is characterized by an increase of capillary permeability that is accompanied by the loss of intravascular fluid and protein.\n\n\nMETHODS\nWe present a 58-year-old female who presented with peripheral edema, leg pain, and syncope at the emergency department. Interestingly demyemilising neuropathy, which is a rare finding, ensued on day 4. She is still being treated using intravenous immunoglobulin therapy.\n\n\nCONCLUSIONS\nThe early signs and symptoms of ISCLS may be subtle; therefore the diagnosis can easily be missed and prompt treatment of the syndrome may be postponed. Thus, the clinician must consider ISCLS in differential diagnosis in cases of hypotension, hemoconcentration, and hypoalbuminemia.",
"affiliations": "Department of Internal Medicine, Istanbul Florence Nightingale Hospital, Istanbul, Turkey.;Department of Nephrology, Bezmialem Vakif University, Faculty of Medicine, Istanbul, Turkey.",
"authors": "Yardimci|Bulent|B|;Kazancioglu|Rumeyza|R|",
"chemical_list": null,
"country": "Iran",
"delete": false,
"doi": "10.5812/ircmj.29249",
"fulltext": "\n==== Front\nIran Red Crescent Med JIran Red Crescent Med J10.5812/ircmjKowsarIranian Red Crescent Medical Journal2074-18042074-1812Kowsar 10.5812/ircmj.29249Case ReportIdiopathic Systemic Capillary Leak Syndrome: A Case Report Yardimci Bulent 1*Kazancioglu Rumeyza 21 Department of Internal Medicine, Istanbul Florence Nightingale Hospital, Istanbul, Turkey2 Department of Nephrology, Bezmialem Vakif University, Faculty of Medicine, Istanbul, Turkey* Corresponding Author: Bulent Yardimci, Department of Internal Medicine, Istanbul Florence Nightingale Hospital, Istanbul, Turkey. Tel: +90-2123756565, Fax: +90-2122244982, E-mail: bulentyardimci@yahoo.com2 2016 20 2 2016 18 2 e2924920 4 2015 19 5 2015 04 6 2015 Copyright © 2016, Iranian Red Crescent Medical Journal2016This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.Introduction\nIdiopathic systemic capillary leak syndrome (ISCLS) is rarely seen, and presents with recurrent episodes of hypotension, shock, hemoconcentration, and hypoproteinemia. The main pathology is the dysfunction of the vascular endothelium, and it is characterized by an increase of capillary permeability that is accompanied by the loss of intravascular fluid and protein.\n\nCase Presentation\nWe present a 58-year-old female who presented with peripheral edema, leg pain, and syncope at the emergency department. Interestingly demyemilising neuropathy, which is a rare finding, ensued on day 4. She is still being treated using intravenous immunoglobulin therapy.\n\nConclusions\nThe early signs and symptoms of ISCLS may be subtle; therefore the diagnosis can easily be missed and prompt treatment of the syndrome may be postponed. Thus, the clinician must consider ISCLS in differential diagnosis in cases of hypotension, hemoconcentration, and hypoalbuminemia.\n\nCapillary Leak SyndromeClarkson DiseaseSystemic Capillary Leak SyndromeEdemaShockMultiple Organ Failure\n==== Body\n1. Introduction\nIdiopathic systemic capillary leak syndrome (ISCLS) or Clarkson’s Disease is a rare and systemic disease, which affects the entire vascular system (1). The triad of hypotension, hemoconcentration, and hypoalbuminemia is highly suggestive of the diagnosis (1-3). It may be difficult to differentiate ISCLS from sepsis, toxic shock syndrome, anaphylaxis, and drug reactions, especially during the acute phase (3). An early diagnosis may prevent overtreatment and may lead to an effective therapy.\n\n2. Case Presentation\nA 58-year-old female presented with syncope at the Istanbul American hospital emergency department on September 21, 2012. Her symptoms, which were present for the past two days, included fatigue, diarrhea, swollen legs, and leg pain. The patient was conscious, sweaty, anxious, and pale. Her arterial blood pressure (ABP) was 80/40 mmHg, pulse rate was 118/minute with a regular rhythm, and her body temperature was 37.2 C. Heart sounds did not reveal any abnormality, the respiratory rate was slightly higher (28/minute), and pulmonary auscultation was normal. She complained of muscular pain during palpation of the leg muscles. She had bilateral lower limb edema. The laboratory analysis revealed high hemoglobin and hematocrit levels. A thorax computed tomography (CT) scan did not reveal any abnormalities, and echocardiography revealed a hyperkinetic heart but there was no wall distress.\n\nTwo hours after her admission, the patient’s general condition deteriorated. Hypotension was augmented and anuria ensued. She was followed up at the ICU with intensive hydration. Enoxaparine sodium 40 mg sc BID and oral acetylsalicylic acid tablet 300 mg were started. Abdominal ultrasonography showed two gallstones of 2 cm in diameter and a left kidney stone of 1.5 cm in diameter. Urinalysis showed 20 - 30 leucocytes in every microscopic area. Intravenous Levofloxacin 500 mg/day was thus added to the treatment. Her urine culture showed 100.000 CFU Eschericia Coli, but a hemoculture and throat culture were negative. The initial laboratory tests are presented in Table 1. Protein electrophoresis showed only alpha-2 increase. On the second day, her blood pressure and pulse stabilized, and intravenous isotonic sodium therapy was continued. On day four, neuropathy in the limbs developed and electromyographic evaluation of lower extremities showed a bilateral axonal injury of the fibular nerve. Intravenous methyl-prednisolone, tramadol hydrochloride tablets, and alpha-lipoic-acid tablets were commenced. With intensive hydration therapy, antibiotic treatment, and neuropathy treatment, the general condition of the patient stabilized and she was able to walk 10 days after the onset of the symptoms. She was discharged on the 15th day with Alpha-lipoic acid tab 2 × 600 mg, terbutaline tab 5 mg/day, Teophylline tab 400 mg/day, and Tramadol hydrochlorur tab 150 mg/day. She is still being treated with IV Immunoglobulin therapy in the 27th month.\n\nTable 1. The Laboratory Results of the Patient\nSerum\tPatient’s Initial Result\tNormal Range\t\n\nHemoglobin\n\t18.3, gr/dL\t11.7 - 16\t\n\nHematocrit\n\t54.3, %\t35 - 47\t\n\nWhite Blood Cell\n\t11850, mm3\t4100 - 11000\t\n\nBlood Urea Nitrogen\n\t47.3, mg/dL\t8 - 23\t\n\nCreatinine\n\t2.6, mg/dL\t0.6 - 1.1\t\n\nCreatinine Kinase\n\t630, U/L\t< 170\t\n\nAlbumin\n\t3.3, mg/dL\t3.5 - 5.5\t\n3. Discussion\nIdiopathic systemic capillary leak syndrome (ISCLS) is a rare disorder which was first described by Clarkson in 1960 (1). In the past 54 years, around 150 cases have been diagnosed (2). The main symptoms of ISCLS are hypotension or shock, hemoconcentration, and hypoalbuminemia due to a sudden shift of fluid and macromolecules from the intravascular space to the interstitial space (2, 3).\n\nThe patient in our case showed signs of shock, acute renal failure, hemoconcentration and hypoalbuminemia without proteinuria, and edema during presentation. These findings are suggestive of ISCLS. It is necessary to exclude anaphylaxis, sepsis, septic shock, toxic shock syndrome, hereditary angioedema, and drug reactions for an ISCLS diagnosis (4, 5). She had a prodromal period of two days, which presented with weakness, leg pain, and diarrhea. Her medical history was lacking any signs or symptoms of a disease. A monoclonal gammopathy is reported in the majority of ISCLS patients and supports the diagnosis. Nevertheless, we did not find monoclonal gammopathy in our case. This may be the weak point of diagnosis in our case, but it is not an absolute diagnostic criterion (6, 7). Moreover, rhabdomyolysis, demyelinising neuropathy, and absence of paraproteinemia are distinctive characteristics of our case. Despite bilateral leg edema neither abdominal compartment syndrome nor an extremity compartment syndrome occurred. The presentation of this case is in accordance with Kapoor et al. (8), who reported fatigue, presyncope, and generalized or localized pain in 88, 76, and 76% of the patients, respectively. Again, according to Kapoor et al., acute renal failure, rhabdomyolysis, and compartment syndrome were present in 57, 36, and 20% the patients, respectively. Interestingly, our case showed all these three complications together (8).\n\nA urinary infection may be a precipitant factor, but our case did not have any urinary symptoms or high fever. She also got worse in two hours in the emergency department. This clinical condition led to a confusion concerning diagnosis and treatment. After a series of investigations, the probability of ISCLS was sought. Intravenous immunoglobulin (IVIG) therapy was started three months later. The treatment during the acute phase consisted of rapid fluid infusion, intravenous vasopressors, and measures to maintain proper blood oxygenation. For prevention of possible future episodes, various methods of treatment have been tried. We prefer Terbutaline and Theophyline at first. These agents are bronchodilators and mainly used for Asthma Bronchiale. They are used for ISCLS as off-label agents, because they increase intracellular cyclic adenosine-monophosphate (cAMP) content and the subsequent rise of cAMP inhibits capillary leakage (5). IVIG therapy is the other choice for ISCLS treatment. IVIG therapy might be effective in acute attacks (9), and it is also used to prevent future attacks (3). IVIG therapy was started 4 months after the presentation. She had a new attack after 11 months with hypotension, edema, and hemoconcentration, and she was hospitalized. After 10 days she was discharged with IVIG therapy. Our patient is still in remission and we haven’t seen any new attacks.\n\n3.1. Conclusion\nISCLS is a rare and potentially fatal syndrome. Prodromal symptoms may be missed by the clinician, because the clinical picture is usually similar to a viral infection. Nevertheless, the main clinical presentation may be severe, and it may cause a missed diagnosis and therefore an inappropriate treatment. Furthermore, the presence of hypotension, hemoconcentration, and hypoalbuminemia should add ISCLS to a differential diagnosis.\n==== Refs\nReferences\n1 Govig BA Javaheri S The systemic capillary leak syndrome. Ann Intern Med. 2010 153 11 764 10.7326/0003-4819-153-11-201012070-00014 21135305 \n2 Duron L Delestre F Amoura Z Arnaud L [Idiopathic and secondary capillary leak syndromes: A systematic review of the literature]. Rev Med Interne. 2015 36 6 386 94 10.1016/j.revmed.2014.11.005 25600329 \n3 Gousseff M Arnaud L Lambert M Hot A Hamidou M Duhaut P et al. The systemic capillary leak syndrome: a case series of 28 patients from a European registry. Ann Intern Med. 2011 154 7 464 71 10.7326/0003-4819-154-7-201104050-00004 21464348 \n4 Dams K Meersseman W Verbeken E Knockaert DC A 59-year-old man with shock, polycythemia, and an underlying paraproteinemia. Chest. 2007 132 4 1393 6 10.1378/chest.07-0456 17934127 \n5 Rabbolini DJ Ange N Walters GD Pidcock M Randall KL Systemic capillary leak syndrome: recognition prevents morbidity and mortality. Intern Med J. 2013 43 10 1145 7 10.1111/imj.12271 24134172 \n6 Xie Z Chan E Yin Y Ghosh CC Wisch L Nelson C et al. Inflammatory Markers of the Systemic Capillary Leak Syndrome (Clarkson Disease). J Clin Cell Immunol. 2014 5 1000213 10.4172/2155-9899.1000213 25405070 \n7 Druey KM Greipp PR Narrative review: the systemic capillary leak syndrome. Ann Intern Med. 2010 153 2 90 8 10.7326/0003-4819-153-2-201007200-00005 20643990 \n8 Kapoor P Greipp PT Schaefer EW Mandrekar SJ Kamal AH Gonzalez-Paz NC et al. Idiopathic systemic capillary leak syndrome (Clarkson's disease): the Mayo clinic experience. Mayo Clin Proc. 2010 85 10 905 12 10.4065/mcp.2010.0159 20634497 \n9 Zipponi M Eugster R Birrenbach T High-dose intravenous immunoglobulins: a promising therapeutic approach for idiopathic systemic capillary leak syndrome. BMJ Case Rep. 2011 2011 10.1136/bcr.12.2010.3599 22696704\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2074-1804",
"issue": "18(2)",
"journal": "Iranian Red Crescent medical journal",
"keywords": "Capillary Leak Syndrome; Clarkson Disease; Edema; Multiple Organ Failure; Shock; Systemic Capillary Leak Syndrome",
"medline_ta": "Iran Red Crescent Med J",
"mesh_terms": null,
"nlm_unique_id": "101319850",
"other_id": null,
"pages": "e29249",
"pmc": null,
"pmid": "27195144",
"pubdate": "2016-02",
"publication_types": "D002363:Case Reports",
"references": "21464348;25405070;20634497;24134172;17934127;25600329;21135305;20643990;22696704",
"title": "Idiopathic Systemic Capillary Leak Syndrome: A Case Report.",
"title_normalized": "idiopathic systemic capillary leak syndrome a case report"
} | [
{
"companynumb": "TR-MYLANLABS-2016M1008831",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ENOXAPARIN SODIUM"
},
"drugadditional": null... |
{
"abstract": "Pseudomembranous colitis (PMC) is known to develop after antibiotic treatment, but is rarely associated with antituberculosis (anti-TB) agents. We report a 28-year-old woman without underlying diseases developing PMC after 126 days of anti-TB treatment. Severe diarrhea and abdominal cramping pain were experienced. Colonoscopic biopsy proved the diagnosis of PMC. Her symptoms improved after discontinuing the anti-TB agents but recurred shortly after challenging with rifampin and isoniazid. Metronidazole administration and replacement of rifampin with levofloxacin successfully cured the PMC. Our report supports the notion that rifampin can induce PMC.",
"affiliations": "Division of Infectious Diseases, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung City, Taiwan.",
"authors": "Chen|Tun-Chieh|TC|;Lu|Po-Liang|PL|;Lin|Wei-Ru|WR|;Lin|Chun-Yu|CY|;Wu|Jeng-Yih|JY|;Chen|Yen-Hsu|YH|",
"chemical_list": "D000995:Antitubercular Agents; D012293:Rifampin",
"country": "United States",
"delete": false,
"doi": "10.1097/MAJ.0b013e31819f1eec",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9629",
"issue": "338(2)",
"journal": "The American journal of the medical sciences",
"keywords": null,
"medline_ta": "Am J Med Sci",
"mesh_terms": "D000328:Adult; D000995:Antitubercular Agents; D016360:Clostridioides difficile; D004761:Enterocolitis, Pseudomembranous; D005260:Female; D006801:Humans; D012293:Rifampin",
"nlm_unique_id": "0370506",
"other_id": null,
"pages": "156-8",
"pmc": null,
"pmid": "19561451",
"pubdate": "2009-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Rifampin-associated pseudomembranous colitis.",
"title_normalized": "rifampin associated pseudomembranous colitis"
} | [
{
"companynumb": "TW-LUPIN PHARMACEUTICALS INC.-2015-00655",
"fulfillexpeditecriteria": "2",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RIFAMPIN"
},
"drugadditional":... |
{
"abstract": "Hepatitis E is one of the leading causes of acute viral hepatitis worldwide. Chronic infection with hepatitis E is less common and limited to immunosuppressed patients and is usually due to genotype 3 of the virus. Genotype 1, the most prevalent strain in the South Asian region, is seldom known to be associated with chronic hepatitis. Here we describe a case of chronic hepatitis E with genotype 1 in a post-liver transplant setting. In the index case, previously compensated cryptogenic cirrhosis was decompensated by an acute hepatitis E infection, which necessitated liver transplantation because of acute chronic liver failure. This later progressed to chronicity. This case may have significant implications in management, especially in the post-liver transplant setting.",
"affiliations": "Department of Hepatology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Hepatology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Virology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Virology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Virology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Hepatology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Histopathology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Gastroenterology, Sanjay Gandhi Postgraduate Institute of Medical Science (SGPGI), Lucknow, Uttar Pradesh, India.;Department of Hepatology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.;Department of Hepatology, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India.",
"authors": "Rathi|Sahaj|S|;Duseja|Ajay|A|;Thakur|Vikram|V|;Ratho|Radha K|RK|;Singh|Mini P|MP|;Taneja|Sunil|S|;Das|Ashim|A|;Aggarwal|Rakesh|R|;Dhiman|Radha K|RK|;Chawla|Yogesh K|YK|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.1016/j.jceh.2020.07.006",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0973-6883",
"issue": "11(3)",
"journal": "Journal of clinical and experimental hepatology",
"keywords": "ACLF, acute-on-chronic liver failure; ACR, acute cellular rejection; CHE, chronic hepatitis E; HEV, hepatitis E virus; ORF, open reading frame; RdRp, RNA-dependent RNA polymerase; chronic hepatitis E; genotype 1; post-liver transplant; ribavirin",
"medline_ta": "J Clin Exp Hepatol",
"mesh_terms": null,
"nlm_unique_id": "101574137",
"other_id": null,
"pages": "400-403",
"pmc": null,
"pmid": "33994721",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "21354150;24645943;18287603;32139278;27516529;24596581;26551551;22549046",
"title": "Chronic Hepatitis E With Genotype 1-Masquerading as Allograft Rejection After LiverTransplantation.",
"title_normalized": "chronic hepatitis e with genotype 1 masquerading as allograft rejection after livertransplantation"
} | [
{
"companynumb": "IN-STRIDES ARCOLAB LIMITED-2021SP030163",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditiona... |
{
"abstract": "Richter syndrome (RS) represents the development of high-grade lymphoma in patients with chronic lymphocytic leukaemia (CLL) or small lymphocytic lymphoma (SLL) and presents a diagnostic and therapeutic challenge with an adverse prognosis. The genetic background and morphology of RS in CLL patients treated with chemoimmunotherapy is extensively characterised; however, our knowledge about RS in patients treated with targeted oral therapies should be extended. To understand the morphologic and molecular changes leading to RS in CLL patients treated with the Bruton's tyrosine kinase inhibitor, ibrutinib, and the BCL2 inhibitor, venetoclax, sequential samples from six CLL/SLL patients undergoing RS were collected in both the CLL and RS phases. A detailed immunophenotypic analysis of formalin-fixed, paraffin-embedded tissue specimens of RS phase was performed, followed by extensive molecular characterisation of CLL and RS samples, including the immunoglobulin heavy chain gene (IGH) rearrangement, TP53 mutations, drug-induced resistance mutations in BTK and BCL2 genes and various copy number changes and point mutations detectable with multiplex ligation-dependent probe amplification (MLPA). Rare, non-diffuse large B-cell lymphoma phenotypes of RS were observed in 3/6 cases, including plasmablastic lymphoma and a transitory entity between diffuse large B-cell lymphoma and classical Hodgkin lymphoma. The majority of cases were clonally related and harboured an unmutated variable region of the immunoglobulin heavy chain gene. Abnormalities affecting the TP53 gene occurred in all patients, and every patient carried at least one genetic abnormality conferring susceptibility to RS. In the background of RS, 2/5 patients treated with ibrutinib showed a BTK C481S resistance mutation. One patient developed a BCL2 G101V mutation leading to venetoclax resistance and RS. In conclusion, our findings contribute to better understanding of RS pathogenesis in the era of targeted oral therapies. Rare phenotypic variants of RS do occur under the treatment of ibrutinib or venetoclax, and genetic factors leading to RS are similar to those identified in patients treated with chemoimmunotherapy. To our best knowledge, we have reported the first BCL2 G101V mutation in an RS patient treated with venetoclax.",
"affiliations": "HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary.;Department of Internal Medicine and Haematology, Semmelweis University, Budapest, Hungary.;Department of Internal Medicine and Oncology, Semmelweis University, Budapest, Hungary.;Department of Internal Medicine and Oncology, Semmelweis University, Budapest, Hungary.;National Institute of Oncology, Budapest, Hungary.;National Institute of Oncology, Budapest, Hungary.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary; Department of Laboratory Medicine, Division of Pathology, Karolinska Institutet, Karolinska University Hospital, Stockholm, Sweden.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary.;Central Hospital of Southern Pest, National Institute for Haematology and Infectology, Budapest, Hungary.;HCEMM-SE Molecular Oncohematology Research Group, Budapest, Hungary; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Budapest, Hungary. Electronic address: timar.botond@med.semmelweis-univ.hu.",
"authors": "Gángó|Ambrus|A|;Kiss|Richárd|R|;Farkas|Péter|P|;Hanna|Eid|E|;Demeter|Judit|J|;Deák|Beáta|B|;Lévai|Dóra|D|;Kotmayer|Lili|L|;Alpár|Donát|D|;Matolcsy|András|A|;Bödör|Csaba|C|;Mátrai|Zoltán|Z|;Timár|Botond|B|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.pathol.2021.04.008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0031-3025",
"issue": null,
"journal": "Pathology",
"keywords": "Chronic lymphocytic leukaemia; Richter syndrome; clonal evolution; ibrutinib",
"medline_ta": "Pathology",
"mesh_terms": null,
"nlm_unique_id": "0175411",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34332791",
"pubdate": "2021-07-28",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Morphologic and molecular analysis of Richter syndrome in chronic lymphocytic leukaemia patients treated with ibrutinib or venetoclax.",
"title_normalized": "morphologic and molecular analysis of richter syndrome in chronic lymphocytic leukaemia patients treated with ibrutinib or venetoclax"
} | [
{
"companynumb": "HU-ABBVIE-21K-076-4031593-00",
"fulfillexpeditecriteria": "1",
"occurcountry": "HU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VENETOCLAX"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nActinomycosis is a chronic and extensive granulomatous, bacterial infection. Revelation by oral ulceration is rare.\n\n\nMETHODS\nA 76-year-old patient with diabetes was treated with dabrafenib for stage IV melanoma. A follow-up visit revealed two ulcerated, infiltrated and hyperalgesic lesions of the palate and gingiva. There were no associated signs. The laboratory findings were normal. The possibility of squamous cell carcinoma occurring with BRAF inhibitors was discussed, despite the rarity of such cases in the literature. Histological examination showed an actinomycotic grain. A scan of the facial mass showed no osteitis. Antimicrobial therapy was initiated with amoxicillin for four months, with a favorable outcome.\n\n\nCONCLUSIONS\nActinomycetes are Gram-positive filamentous saprophytic bacteria of the oral cavity and the gastrointestinal tract. They can become pathogenic under the influence of several factors. Cervicofacial involvement in the form of a peri-mandibular inflammatory nodule with secondary fistulation on the skin or in the mouth is the classic presentation. To our knowledge, no cases of opportunistic infection under BRAF inhibitors have been described. Only two cases of tuberculosis have been reported with sorafenib. The initial presentation led to suspicion of squamous cell carcinoma. In our patient, poor oral hygiene and diabetes were the two key factors considered. Moreover, this is the first case reported under dabrafenib, which does not appear to be a favoring factor. We would stress the importance of mucosal examination in patients treated with BRAF inhibitors.",
"affiliations": "Service de dermatologie, CHU d'Amiens, 1, place Victor-Pauchet, 80000 Amiens, France; Université de Picardie-Jules-Verne, 80000 Amiens, France. Electronic address: fanny.dessirier@gmail.com.;Service de dermatologie, CHU d'Amiens, 1, place Victor-Pauchet, 80000 Amiens, France; Université de Picardie-Jules-Verne, 80000 Amiens, France.;Service de dermatologie, CHU d'Amiens, 1, place Victor-Pauchet, 80000 Amiens, France; Université de Picardie-Jules-Verne, 80000 Amiens, France.;Université de Picardie-Jules-Verne, 80000 Amiens, France; Service d'anatomie pathologique, CHU d'Amiens, 80000 Amiens, France.;Université de Picardie-Jules-Verne, 80000 Amiens, France; Service d'anatomie pathologique, CHU d'Amiens, 80000 Amiens, France.;Service de dermatologie, CHU d'Amiens, 1, place Victor-Pauchet, 80000 Amiens, France; Université de Picardie-Jules-Verne, 80000 Amiens, France.",
"authors": "Dessirier|F|F|;Arnault|J-P|JP|;Denamps|J|J|;Sevestre|H|H|;Attencourt|C|C|;Lok|C|C|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D007093:Imidazoles; D010091:Oximes; D000658:Amoxicillin; C561627:dabrafenib",
"country": "France",
"delete": false,
"doi": "10.1016/j.annder.2017.11.002",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0151-9638",
"issue": "145(3)",
"journal": "Annales de dermatologie et de venereologie",
"keywords": "Actinomycose; Actinomycosis; Dabrafenib; Gingiva ulceration; Inhibiteur de BRAF; Palate ulceration; Ulcération de la gencive; Ulcération du palais",
"medline_ta": "Ann Dermatol Venereol",
"mesh_terms": "D000196:Actinomycosis; D000368:Aged; D000658:Amoxicillin; D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D003924:Diabetes Mellitus, Type 2; D005260:Female; D005881:Gingiva; D006801:Humans; D007093:Imidazoles; D016867:Immunocompromised Host; D008545:Melanoma; D019226:Oral Ulcer; D010091:Oximes; D010159:Palate; D012307:Risk Factors; D012878:Skin Neoplasms; D016896:Treatment Outcome",
"nlm_unique_id": "7702013",
"other_id": null,
"pages": "173-177",
"pmc": null,
"pmid": "29195664",
"pubdate": "2018-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Actinomycosis revealed by ulceration of the palate and gingiva.",
"title_normalized": "actinomycosis revealed by ulceration of the palate and gingiva"
} | [
{
"companynumb": "PHHY2018FR169253",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABRAFENIB"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Individuals with single-ventricle congenital heart disease who are palliated to a Fontan circulation are at risk for heart failure and liver disease, with recurrent ascites being a potentially debilitating cause of late morbidity. Although ascites associated with heart failure or liver failure is usually characterized by a high serum-ascites albumin gradient (SAAG), we have observed multiple instances of ascites in Fontan patients with low SAAG, suggesting an inflammatory process. We present three cases in which recalcitrant ascites severely and adversely impacted the quality of life and describe our initial experience with intraperitoneal corticosteroids in this setting.",
"affiliations": "Department of Medicine, Division of Cardiology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.;Department of Medicine, Division of Cardiology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.;Department of Medicine, Division of Rheumatology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.;Department of Medicine, Division of Gastroenterology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.;Department of Medicine, Division of Cardiology, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, USA.",
"authors": "Wu|Fred M|FM|http://orcid.org/0000-0002-4580-8199;Valente|Anne M|AM|;Nigrovic|Peter A|PA|;Rutherford|Anna E|AE|;Singh|Michael N|MN|",
"chemical_list": "D000305:Adrenal Cortex Hormones",
"country": "United States",
"delete": false,
"doi": "10.1111/jocs.15244",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0886-0440",
"issue": "36(2)",
"journal": "Journal of cardiac surgery",
"keywords": "Fontan operation; adult congenital heart disease; ascites; congestive heart failure",
"medline_ta": "J Card Surg",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D001201:Ascites; D018729:Fontan Procedure; D006330:Heart Defects, Congenital; D006801:Humans; D011788:Quality of Life",
"nlm_unique_id": "8908809",
"other_id": null,
"pages": "735-738",
"pmc": null,
"pmid": "33305839",
"pubdate": "2021-02",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Intraperitoneal corticosteroids for recurrent ascites in patients with Fontan circulation: Initial clinical experience.",
"title_normalized": "intraperitoneal corticosteroids for recurrent ascites in patients with fontan circulation initial clinical experience"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2021SP002453",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TRIAMCINOLONE ACETONIDE"
},
"d... |
{
"abstract": "Amyotrophic lateral sclerosis is characterized by the selective death of motor neurons. Stem cells have been proposed as a potential therapeutic strategy. The safety of stem cell transplantation into the frontal motor cortex to improve upper motor neuron function is described. Sixty-seven patients with definite amyotrophic lateral sclerosis were included. After giving their informed consent, the patients underwent magnetic resonance imaging, functional rating, pulmonary function test, and laboratory tests. Their bone marrow was stimulated with daily filgrastim (300 µg) given subcutaneously for 3 days. Peripheral blood mononuclear cells were obtained by leukapheresis. Isolated CD133(+) stem cells were suspended in 300 µl of the patient's cerebrospinal fluid and implanted into the motor cortex. Adverse events were recorded at each step of the procedure and were classified according to the Common Terminology Criteria for Adverse Events v3.0. The survival at 1 year was 90% after transplantation. with a mean long-term survival rate of 40.17 months from diagnosis. The most common adverse events were in grades I-II and involved transient skin pain (19.5% of patients) attributed to the insertion of the Mahurkar catheter into the subclavian vein, minor scalp pain (15.9%), and headache (12.2%) from the surgical procedure. Several patients (1.5 - 4.5%) reported diverse grade I adverse events. There were two deaths, one considered to be associated with the procedure (1.5%) and the other associated with the disease. Autologous stem cell transplantation into the frontal motor cortex is safe and tolerated well by patients. Further controlled studies are required to define the efficacy of this procedure.",
"affiliations": "Neurology Service, Hospital San Jose Tec de Monterrey, Monterrey, Nuevo Leon, Mexico. drhectormtz@yahoo.com",
"authors": "Martínez|Héctor R|HR|;Molina-Lopez|Juan Francisco|JF|;González-Garza|María Teresa|MT|;Moreno-Cuevas|Jorge E|JE|;Caro-Osorio|Enrique|E|;Gil-Valadez|Alfonso|A|;Gutierrez-Jimenez|Eugenio|E|;Zazueta-Fierro|Oscar E|OE|;Meza|J Alfonso|JA|;Couret-Alcaraz|Patricio|P|;Hernandez-Torre|Martin|M|",
"chemical_list": "D011994:Recombinant Proteins; D016179:Granulocyte Colony-Stimulating Factor; D000069585:Filgrastim",
"country": "United States",
"delete": false,
"doi": "10.3727/096368911X582769",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0963-6897",
"issue": "21(9)",
"journal": "Cell transplantation",
"keywords": null,
"medline_ta": "Cell Transplant",
"mesh_terms": "D000690:Amyotrophic Lateral Sclerosis; D005240:Feasibility Studies; D005260:Female; D000069585:Filgrastim; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D007937:Leukapheresis; D008297:Male; D045164:Mesenchymal Stem Cell Transplantation; D008875:Middle Aged; D009044:Motor Cortex; D011994:Recombinant Proteins",
"nlm_unique_id": "9208854",
"other_id": null,
"pages": "1899-907",
"pmc": null,
"pmid": "23356668",
"pubdate": "2012",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Stem cell transplantation in amyotrophic lateral sclerosis patients: methodological approach, safety, and feasibility.",
"title_normalized": "stem cell transplantation in amyotrophic lateral sclerosis patients methodological approach safety and feasibility"
} | [
{
"companynumb": "MX-AMGEN-MEXSP2020047236",
"fulfillexpeditecriteria": "2",
"occurcountry": "MX",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FILGRASTIM"
},
"drugadditional": null,
... |
{
"abstract": "Surgical-site infection, spinal cord abscess, and catheter tip granuloma are known but rare complications of intrathecal drug delivery systems (IDDS). To date, there are no published cases of brain abscess in a patient with an IDDS. In this study, we report a case of a cancer patient with an IDDS for management of cancer pain who developed a brain abscess with profound mental status changes and clinical management challenges.",
"affiliations": "Department of Anesthesiology, Feinberg School of Medicine, Northwestern University , Chicago, Illinois.;Department of Anesthesiology, Feinberg School of Medicine, Northwestern University , Chicago, Illinois.",
"authors": "Walega|David R|DR|;Korn|Marc|M|",
"chemical_list": "D000701:Analgesics, Opioid",
"country": "United States",
"delete": false,
"doi": "10.1089/jpm.2017.0628",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1557-7740",
"issue": "21(5)",
"journal": "Journal of palliative medicine",
"keywords": "abscess; infection; intrathecal catheter; intrathecal drug delivery; intrathecal pump; intrathecal therapy",
"medline_ta": "J Palliat Med",
"mesh_terms": "D000701:Analgesics, Opioid; D001922:Brain Abscess; D000072716:Cancer Pain; D016503:Drug Delivery Systems; D006801:Humans; D007278:Injections, Spinal; D017410:Practice Guidelines as Topic; D012189:Retrospective Studies",
"nlm_unique_id": "9808462",
"other_id": null,
"pages": "727-729",
"pmc": null,
"pmid": "29649397",
"pubdate": "2018-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Management of a Cancer Patient with an Intrathecal Drug Delivery System and an Acute Brain Abscess.",
"title_normalized": "management of a cancer patient with an intrathecal drug delivery system and an acute brain abscess"
} | [
{
"companynumb": "US-MYLANLABS-2018M1038397",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3",
... |
{
"abstract": "We describe an elderly case of idiopathic dilatation of the right atrium in which right-sided heart failure was exacerbated by drug-induced bradyarrhythmia. An 84-year-old man, who had a 10-year history of episodic edema, was treated with proscillaridin and verapamil hydrochloride at another hospital. He had experienced a poor appetite and general malaise 2 months previously, and exertional dyspnea 10 days previously. On admission, he had jugular venous dilatation, systemic edema, and hepatomegaly. On auscultation, a third heart sound originating from the right ventricle and systolic murmur of tricuspid regurgitation were heard. An admission electrocardiogram showed an atrial standstill and junctional escape rhythm with a QRS rate of 31 beats/minute. Chest roentgenogram revealed a bilateral pleural effusion and cardiomegaly with a cardiothoracic ratio of 76%, but no pulmonary congestion. Echocardiogram disclosed idiopathic dilatation of the right atrium and secondary tricuspid regurgitation. He was given a diagnosis of right-sided heart failure due to idiopathic dilatation of the right atrium exacerbated by bradyarrhythmia, which was suspected to derive from the side effects of proscillaridin and verapamil hydrochloride. Thus, these agents were withheld. In addition, the patient reduced sodium intake and was treated with diuretics and beta-adrenergic agonist. Thereafter, right-sided heart failure markedly improved. At the time of the last follow-up 16 months after discharge, he felt well.",
"affiliations": "Department of Internal Medicine, Yawatahama General Hospital.",
"authors": "Kodama-Takahashi|K|K|;Ohshima|K|K|;Yamamoto|K|K|;Iwata|T|T|",
"chemical_list": "D002316:Cardiotonic Agents; D014700:Verapamil; D011442:Proscillaridin",
"country": "Japan",
"delete": false,
"doi": "10.3143/geriatrics.38.544",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-9173",
"issue": "38(4)",
"journal": "Nihon Ronen Igakkai zasshi. Japanese journal of geriatrics",
"keywords": null,
"medline_ta": "Nihon Ronen Igakkai Zasshi",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D001281:Atrial Fibrillation; D001919:Bradycardia; D006332:Cardiomegaly; D002316:Cardiotonic Agents; D004108:Dilatation, Pathologic; D006325:Heart Atria; D006333:Heart Failure; D006801:Humans; D008297:Male; D011442:Proscillaridin; D014700:Verapamil",
"nlm_unique_id": "7507332",
"other_id": null,
"pages": "544-7",
"pmc": null,
"pmid": "11523170",
"pubdate": "2001-07",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "An elderly case of idiopathic dilatation of the right atrium in which right-sided heart failure was exacerbated by drug-induced bradyarrhythmia.",
"title_normalized": "an elderly case of idiopathic dilatation of the right atrium in which right sided heart failure was exacerbated by drug induced bradyarrhythmia"
} | [
{
"companynumb": "JP-RECRO GAINESVILLE LLC-REPH-2019-000181",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PROSCILLARIDIN"
},
"drugaddit... |
{
"abstract": "We describe the efficacy of high-dose barbiturates and early administration of a parenteral ketogenic diet (KD) as initial treatments for acute status epilepticus (SE) in an 8-year-old girl with febrile infection-related epilepsy syndrome (FIRES). The patient was admitted to our hospital with refractory focal SE. Abundant epileptic discharges over the left frontal region were observed on electroencephalogram (EEG). Treatment with continuous infusion of thiamylal for 4 hours, increased incrementally to 40 mg/kg/h, successfully ended the clinical SE, and induced a burst-suppression coma. The infusion rate was then gradually decreased to 4 mg/kg/h over the next 12 hours. Parenteral KD was administered from days 6 to 21 of illness. Continuous infusion of thiamylal was switched to midazolam on day 10 without causing seizures or EEG exacerbations. The patient has remained seizure free in the 15 months since hospital discharge. The effectiveness of KD for the treatment of FIRES has attracted attention amongst clinicians, but KD treatment may need to last for 2 to 4 days before it can stop SE, a time period that could cause irreversible brain damage. Considering the severity of SE in our patient and the dose of barbiturates needed to treat it, we consider this case to have had a good clinical outcome. The results suggest that rapid termination of seizure using high-dose barbiturates in conjunction with early administration of parenteral KD could reduce the development of chronic epilepsy in patients with FIRES.",
"affiliations": "Department of Child Neurology, Comprehensive Epilepsy Center, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Child Neurology, Comprehensive Epilepsy Center, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Emergency & Critical Care Medicine, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Division of Nutrition, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Division of Rehabilitation, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Division of Rehabilitation, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Pediatrics, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Child Neurology, Comprehensive Epilepsy Center, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Pediatrics, Iwata City Hospital, Okubo, Iwata, Shizuoka, Japan.;Division of Clinical Laboratory, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Epilepsy and Surgery, Comprehensive Epilepsy Center, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.;Department of Child Neurology, Comprehensive Epilepsy Center, Seirei Hamamatsu General Hospital, Hamamatsu, Shizuoka, Japan.",
"authors": "Baba|Shimpei|S|0000-0002-0596-3338;Okanishi|Tohru|T|0000-0003-3295-2236;Ohsugi|Koichi|K|;Suzumura|Rika|R|;Niimi|Keiko|K|;Shimizu|Sayuri|S|;Sakihama|Hiroshi|H|;Itamura|Shinji|S|;Hirano|Keiko|K|;Nishimura|Mitsuyo|M|;Fujimoto|Ayataka|A|;Enoki|Hideo|H|",
"chemical_list": "D001463:Barbiturates; D013840:Thiamylal; D008874:Midazolam",
"country": "Germany",
"delete": false,
"doi": "10.1055/s-0040-1716903",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0174-304X",
"issue": "52(2)",
"journal": "Neuropediatrics",
"keywords": null,
"medline_ta": "Neuropediatrics",
"mesh_terms": "D001463:Barbiturates; D002648:Child; D003131:Combined Modality Therapy; D055423:Diet, Ketogenic; D004569:Electroencephalography; D000073376:Epileptic Syndromes; D005260:Female; D005334:Fever; D006801:Humans; D007239:Infections; D008874:Midazolam; D010288:Parenteral Nutrition; D013226:Status Epilepticus; D013840:Thiamylal",
"nlm_unique_id": "8101187",
"other_id": null,
"pages": "133-137",
"pmc": null,
"pmid": "33231274",
"pubdate": "2021-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Possible Role of High-Dose Barbiturates and Early Administration of Parenteral Ketogenic Diet for Reducing Development of Chronic Epilepsy in Febrile Infection-Related Epilepsy Syndrome: A Case Report.",
"title_normalized": "possible role of high dose barbiturates and early administration of parenteral ketogenic diet for reducing development of chronic epilepsy in febrile infection related epilepsy syndrome a case report"
} | [
{
"companynumb": "JP-MICRO LABS LIMITED-ML2021-01820",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": ... |
{
"abstract": "BACKGROUND\nThis study aimed to determine the maximum tolerated dose (MTD), dose-limiting toxicity, and efficacy of second-line chemotherapy with FOLFIRINOX after gemcitabine (GEM)-based chemotherapy failure in metastatic pancreatic cancer (MPC).\n\n\nMETHODS\nWe studied 18 histopathologically proven MPC patients. The schedule was 85 mg/m oxaliplatin, irinotecan, and 400 mg/m leucovorin, followed by 400 mg/m 5-fluorouracil (5-FU) as a bolus on day 1 and 2400 mg/m 5-FU as a 46-hour continuous infusion biweekly. The dose of irinotecan was defined as follows: level 0: 100 mg/m, level 1: 125 mg/m, level 2: 150 mg/m, and level 3: 180 mg/m. The doses of other drugs were fixed. The primary endpoint of phase II study was the response rate (RR).\n\n\nRESULTS\nWe initially evaluated 6 patients in a phase I study. One patient developed neutropenia and 1 patient developed hyperglycemia and severe infection. Accordingly, level 1 was chosen as the MTD. According to a phase II study, the RR was 22.2% and the disease control rate was 61.1%. The progression-free survival and overall survival were 2.8 (range, 0.7-19.1) and 9.8 (2.4-19.8) months, respectively. The most common severe adverse event was neutropenia (66.7%). Febrile neutropenia occurred in 1 (5.6%) case.\n\n\nCONCLUSIONS\nThe recommended dose was 85 mg/m oxaliplatin, 100 mg/m irinotecan, and 400 mg/m leucovorin, followed by 400 mg/m 5-FU as a bolus on day 1 and 2400 mg/m 5-FU as a 46-hour continuous infusion. These results indicate that second-line FOLFIRINOX is a marginally effective treatment for GEM-based chemotherapy failure cases.",
"affiliations": "Graduate School of Medicine, Department of Oncology, Yokohama City University, Japan Shimamura Clinic and Yokohama City University Graduate School of Medicine Department of Oncology Graduate School of Medicine, Department of Gastroenterological Surgery, Yokohama City University, Japan.",
"authors": "Kobayashi|Noritoshi|N|;Shimamura|Takeshi|T|;Tokuhisa|Motohiko|M|;Goto|Ayumu|A|;Endo|Itaru|I|;Ichikawa|Yasushi|Y|",
"chemical_list": "D000970:Antineoplastic Agents; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D003841:Deoxycytidine; D000077146:Irinotecan; C056507:gemcitabine; D002955:Leucovorin; D005472:Fluorouracil; D002166:Camptothecin",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000006769",
"fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 28489753MD-D-17-0073410.1097/MD.0000000000006769067694500Research ArticleClinical Trial/Experimental StudyEffect of FOLFIRINOX as second-line chemotherapy for metastatic pancreatic cancer after gemcitabine-based chemotherapy failure Kobayashi Noritoshi MD, PhDa∗Shimamura Takeshi MD, PhDbTokuhisa Motohiko MD, PhDaGoto Ayumu MD, PhDaEndo Itaru MD, PhDcIchikawa Yasushi MD, PhDaPezzilli. Raffaele a Graduate School of Medicine, Department of Oncology, Yokohama City University, Japanb Shimamura Clinic and Yokohama City University Graduate School of Medicine Department of Oncologyc Graduate School of Medicine, Department of Gastroenterological Surgery, Yokohama City University, Japan.∗ Correspondence: Noritoshi Kobayashi, Yokohama City University, Graduate School of Medicine, Department of Oncology, Fuku-ura, Kanazawa-ku, Yokohama, Japan (e-mail: norikoba@.yokohama-cu.ac.jp).5 2017 12 5 2017 96 19 e67696 2 2017 3 4 2017 6 4 2017 Copyright © 2017 the Author(s). Published by Wolters Kluwer Health, Inc.2017This is an open access article distributed under the Creative Commons Attribution-Share Alike License 4.0, which allows others to remix, tweak, and build upon the work, even for commercial purposes, as long as the author is credited and the new creations are licensed under the identical terms. http://creativecommons.org/licenses/by-sa/4.0Abstract\nBackground:\nThis study aimed to determine the maximum tolerated dose (MTD), dose-limiting toxicity, and efficacy of second-line chemotherapy with FOLFIRINOX after gemcitabine (GEM)-based chemotherapy failure in metastatic pancreatic cancer (MPC).\n\nMethods:\nWe studied 18 histopathologically proven MPC patients. The schedule was 85 mg/m2 oxaliplatin, irinotecan, and 400 mg/m2 leucovorin, followed by 400 mg/m2 5-fluorouracil (5-FU) as a bolus on day 1 and 2400 mg/m2 5-FU as a 46-hour continuous infusion biweekly. The dose of irinotecan was defined as follows: level 0: 100 mg/m2, level 1: 125 mg/m2, level 2: 150 mg/m2, and level 3: 180 mg/m2. The doses of other drugs were fixed. The primary endpoint of phase II study was the response rate (RR).\n\nResults:\nWe initially evaluated 6 patients in a phase I study. One patient developed neutropenia and 1 patient developed hyperglycemia and severe infection. Accordingly, level 1 was chosen as the MTD. According to a phase II study, the RR was 22.2% and the disease control rate was 61.1%. The progression-free survival and overall survival were 2.8 (range, 0.7–19.1) and 9.8 (2.4–19.8) months, respectively. The most common severe adverse event was neutropenia (66.7%). Febrile neutropenia occurred in 1 (5.6%) case.\n\nConclusion:\nThe recommended dose was 85 mg/m2 oxaliplatin, 100 mg/m2 irinotecan, and 400 mg/m2 leucovorin, followed by 400 mg/m2 5-FU as a bolus on day 1 and 2400 mg/m2 5-FU as a 46-hour continuous infusion. These results indicate that second-line FOLFIRINOX is a marginally effective treatment for GEM-based chemotherapy failure cases.\n\nKeywords\nFOLFIRINOXgemcitabinepancreatic cancerphase I/II studysecond-line chemotherapyOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nPancreatic cancer is a relatively frequent malignancy, with a 5-year overall survival (OS) rate of only about 6%.[1] Its incidence has gradually increased over the past 10 years, and >360,000 new cases were projected to occur worldwide in 2015.[2] Metastatic pancreatic cancer (MPC) is one of the most aggressive malignancies. Without treatment, the median survival time is consistently <6 months.[3] Gemcitabine (GEM) has been the standard treatment for metastatic pancreatic cancer since 1997, based on a modest survival benefit compared to bolus 5-fluorouracil (5-FU),[4] and is currently recognized as the standard regimen for MPC.\n\nVarious GEM-based combination regimens have also been investigated. Recently, combination treatment of nab-paclitaxel plus GEM improved OS compared with GEM alone in previously untreated patients with MPC (8.5 vs 6.7 months, Hazard Ratio (HR): 0.72, P < .001).[5] Hence, GEM-based chemotherapy has remained the standard first-line chemotherapy for MPC worldwide. However, in 2010, a new standard of care emerged when the combination regimen FOLFIRINOX was shown to significantly improve the survival of fit patients with MPC compared with GEM as first-line therapy.[6]\n\nA significant percentage (approximately 60%) of MPC patients with relatively good performance status may require second- or even third-line therapy.[7] There are 2 worldwide standard regimens for patients resistant to GEM-based chemotherapy, but there is controversy over their use. The results of a randomized phase III study (the CONKO-003 trial) comparing oxaliplatin/5-FU/folinic acid (OFF) with 5-FU/folinic acid were reported in 2014.[8] OFF was associated with a significantly longer median time to progression (2.9 vs 2.0 months, HR: 0.68, P = .019) and median OS (5.9 vs 3.3 months, HR: 0.66, P = .010), and is thus considered as second-line treatment for GEM refractory patients in Europe.\n\nRecently, an international phase III study found that nanoliposomal irinotecan with 5-FU and leucovorin extends the survival of patients with MPC who previously received GEM-based chemotherapy.[9] The median OS and progression-free survival (PFS) in patients who received nanoliposomal irinotecan plus 5-FU and leucovorin were 6.1 months and 3.1 months, respectively. According to these 2 randomized phase III studies, 5-FU and leucovorin should be key agents for the second-line treatment of MPC after GEM-based chemotherapy failure.\n\nTo our knowledge, only 1 retrospective study has evaluated FOLFIRINOX treatment for MPC patients with disease progression after first-line GEM-based chemotherapy.[10] The aim of the present study was to evaluate the efficacy and safety of second-line FOLFIRINOX treatment in patients with progressive disease following GEM-based chemotherapy, as a prospective phase I/II study.\n\n2 Materials and methods\n2.1 Patients\nAll patients were aged 18 years or more with histologically or cytologically confirmed metastatic pancreatic adenocarcinoma. Patients who were previously treated with GEM-based first-line chemotherapy were eligible for this study if they met the following inclusion criteria: Eastern Cooperative Oncology Group performance status (PS) of 0 or 1, aged 18 to 75 years, MPC with at least 1 measurable lesion based on the Response Evaluation Criteria in Solid Tumors (RECIST), and adequate hematological, liver, and renal functions (hemoglobin >9.0 g/dL, white blood cell count <10,000/mm3, neutrophil count >1,500/mm3, platelet count >100,000/mm3, total bilirubin <1.5-fold higher than the upper normal limit, serum transaminase <three-fold higher than the upper normal limit, creatinine <1.5-fold higher than the upper normal limit). All patients provided their written informed consent.\n\nPatients were excluded if they had grade 2 or higher peripheral sensory neuropathy, received a blood transfusion, blood products, or hematopoietic growth factor preparations, such as granulocyte-colony stimulating factor (G-CSF) within 7 days before enrolment; had UGT genetic polymorphisms (homozygous UGT1A1∗28 or UGT1A1∗6 or heterozygous UGT1A1∗6 and UGT1A1∗28); apparent coelomic fluid (pleural effusion, ascites, or pericardial fluid) or peritoneal dissemination; poorly controlled diabetes; synchronous or metachronous double cancer; brain metastases; significant gastrointestinal bleeding or obstruction; or active infection.\n\nThis study was initially approved by the Institutional Review Board of Yokohama City University Hospital (B110512020, B130905042) and was conducted according to the Declaration of Helsinki and guidelines on good clinical practice. The clinical trial registration number was UMIN000005808.\n\n2.2 Study design\nThis was an open-label, single-center, nonrandomized, phase I/II study. All laboratory tests required to assess eligibility had to be completed within 7 days prior to the start of treatment.\n\nPhase I: The primary endpoint of the phase I study was the determination of the recommended dose for the chemotherapy regimen. The treatment schedule comprised oxaliplatin, irinotecan, and leucovorin on day 1, followed by 5-FU as a bolus on day 1, and 2400 mg/m2 5-FU as a 46-hour continuous infusion biweekly. The doses of oxaliplatin, leucovorin, bolus 5-FU, and continuous 5-FU were fixed (85 mg/m2, 400 mg/m2, 400 mg/m2, and 2400 mg/m2, respectively), and the dose of irinotecan was defined as follows: level 0: 100 mg/m2, level 1: 125 mg/m2, level 2: 150 mg/m2, and level 3: 180 mg/m2.\n\nStarting at level 1, we planned to test each dose level in 3 to 6 patients. No intrapatient dose escalation was allowed. Dose escalation used a standard “3 + 3” design. The maximum tolerated dose (MTD) was defined as the dose level at which 0 of 3 or 1 of 6 patients experienced dose-limiting toxicity (DLT), with the next highest dose having at least 2 of 3 or 2 of 6 patients encountering DLT during the first 2 cycles. We also evaluated the results of the phase I study as a phase II study.\n\nPhase II: The primary endpoint of the phase II study was the response rate (RR), and the secondary endpoints were the OS, PFS, disease control rate (DCR), and safety for all patients, including those involved in the first stage of the study. Pretreatment evaluation using contrast-enhanced computed tomography was performed within 4 weeks before the patient's enrollment. Tumor responses were evaluated every 2 cycles using RECIST version 1.0.[11]\n\n2.3 Definition of DLTs and dose-reduction criteria of the phase II study\nDLTs were determined during the first 2 treatment cycles. DLTs were defined using the Common Terminology Criteria for Adverse Events version 4.0, as one or more of the following effects attributable to the study drug: (1) grade 4 neutropenia lasting longer than 5 days (G-CSF was allowed for grade 4 neutropenia and febrile neutropenia, while pegylated filgrastim was not allowed as primary prophylaxis,) (2) febrile neutropenia, (3) grade 4 thrombocytopenia, (4) any other grade 3 or 4 toxicity, and (5) delay of recovery from treatment-related toxicity for more than 2 weeks. Chemotherapy was delayed until recovery from the following could be achieved: neutrophil count <1500/mm3, platelet count <75,000/mm3, and total bilirubin >1.5 mg/dL.\n\nThe dose-reduction criteria of the phase II study were defined according to the number of adverse events (AEs) following the treatment. At the first, second, and third occurrence of an AE, the bolus 5-FU was removed, the bolus 5-FU was removed and the dose of oxaliplatin was reduced to 60 mg/m2, and the study was stopped, respectively. Dose reduction was required for one or more of the following events: (1) grade 4 neutropenia, (2) febrile neutropenia, (3) grade 4 thrombocytopenia, (4) any other grade 3 or 4 toxicity, and (5) delay of recovery from treatment-related toxicity for more than 2 weeks. If there was intestinal pneumonitis of any grade or grade 3 peripheral sensory neuropathy, chemotherapy was stopped. All patients routinely received palonosetron, aprepitant, and dexamethasone for emesis prophylaxis during each cycle.\n\n2.4 Statistical analysis\nThe number of patients to be enrolled was planned using the Southwest Oncology Group (SWOG) standard design (attained design). The null hypothesis was that the overall response rate would be <5% and the alternative hypothesis was that the overall response rate would be >25%; the α error was 5% (one-tailed) and the β error was 20% (one-tailed). The alternative hypothesis was established based on data from previous reports. The sample size was determined as 18 cases. The median survival time and the corresponding 95% confidence intervals (CIs) for OS and PFS were estimated using the Kaplan–Meier method. PFS was defined as the time from day 1 of cycle 1 until the first event (progressive disease or death from any cause). If no such event occurred, data for that patient were censored on the day of the last imaging procedure. OS was defined as the time from day 1 of cycle 1 until death from any cause. In the absence of an event, data were censored on the last day of survival confirmation. All analyses were performed using SPSS version 21.0 (IBM, New York).\n\n3 Results\n3.1 Patients\nBetween June 2011 and March 2014, 18 patients were enrolled in this study. The patient characteristics at baseline are shown in Table 1. The median age of the patients was 63 (46–68) years. In total, 80% of the patients were classified as having a performance status (PS) of 0, while 20% were classified as having PS 1. Five cases (28%) were pancreas head cancer, 4 of which were treated using metallic stent placement before the study. Eight cases (44.4%) were recurrent tumors after primary resection. The major metastatic sites were the liver and lymph nodes.\n\nTable 1 Characteristics of the patients with unresectable pancreatic cancer treated with second-line FOLFIRINOX (n = 18).\n\nAll patients received GEM-based chemotherapy (GEM alone: n = 7, GEM plus S-1: n = 11) before enrolling in this study. The median treatment time was 4.3 (1.6–26) months.\n\n3.2 Treatment exposure\nIn level 1 of the phase I study, 8 patients were initially enrolled, and 2 of them were excluded. One patient was excluded because of duodenal perforation that occurred after the first treatment cycle. In this case, the metallic stent in the bile duct injured the duodenal mucosa, and FOLFIRINOX was not related to this severe AE. While this patient recovered by only fasting for 1 week, they were still excluded from the study. The other patient did not develop a severe AE, but chose not to continue the treatment after the first cycle. Among the initially treated 3 patients, 1 patient experienced DLT of grade 4 neutropenia after the first cycle of treatment. In the additionally included 3 patients, 1 patient experienced DLTs of grade 3 severe infection, grade 4 hyperglycemia, and grade 3 thrombocytopenia after the second treatment cycle. This patient had undergone endoscopic metallic stent placement before enrolment into this trial and experienced obstructive cholangitis that necessitated re-endoscopic treatment. The next treatment was performed with a 2-week delay to allow recovery from these toxicities. Accordingly, as 2 of the total of 6 patients showed DLT, we performed dose reduction to level 0 (100 mg/m2 irinotecan). In the first 3 cases of level 0, 1 patient experienced DLT of grade 3 anemia, while in the additional 3 cases, there was no DLT. Hence, level 0 was defined as the recommended dose (Table 2). Based on these results, in the phase II study, these 6 patients were enrolled using level 0 irinotecan.\n\nTable 2 Phase I study of the patients with unresectable pancreatic cancer treated with second-line FOLFIRINOX.\n\n3.3 Efficacy\nEighteen patients received FOLFIRINOX, and a complete response, partial response, stable disease, and disease progression were observed in 0, 4, 7, and 7 patients, respectively. The RR was 22.2% and the DCR was 61.1% (Tables 3 and 4).\n\nTable 3 Efficacy results in the patients with unresectable pancreatic cancer treated with second-line FOLFIRINOX (n = 18).\n\nTable 4 Toxicities in the patients with unresectable pancreatic cancer treated with second-line FOLFIRINOX (n = 18).\n\nThe PFS was 2.8 months (95% CI, 2.3–3.1), and the OS was 9.8 months (95% CI, 6.4–13.1). Moreover, the OS from first-line chemotherapy was 15.5 months (95% CI, 9.0–21.9) (Figs. 1–3). At the time of this analysis, all 18 patients had died and none were lost to follow-up.\n\nFigure 1 Kaplan–Meier analysis of progression-free survival in a phase II study of FOLFIRINOX as second-line chemotherapy for unresectable pancreatic cancer after gemcitabine-based chemotherapy failure. The median progression-free survival was 2.8 months (95% confidence interval, 2.3–3.1). No patient data were censored.\n\nFigure 2 Kaplan–Meier analysis of overall survival in a phase II study of FOLFIRINOX as second-line chemotherapy for unresectable pancreatic cancer after gemcitabine-based chemotherapy failure. The median survival was 9.8 months (95% confidence interval, 6.4–13.1). No patient data were censored.\n\nFigure 3 Kaplan–Meier analysis of overall survival from first-line treatment in a phase II study of FOLFIRINOX as second-line chemotherapy for unresectable pancreatic cancer after gemcitabine-based chemotherapy failure. The median survival was 15.5 months (95% confidence interval, 9.0–21.9). No patient data were censored.\n\n3.4 Safety\nThere were no treatment-related deaths. Overall, 14 patients (83.3%) experienced grade 3 or 4 AEs (Table 5). The major grade 3 or 4 AEs were hematologic toxicities, such as neutropenia (66.7%). Febrile neutropenia occurred in 2 cases (11.1%). G-CSF treatment was necessary for 7 patients (38.8%). Anemia (16.7%) and thrombocytopenia (11.1%) also occurred. Nonhematological toxicities included appetite loss, nausea, vomiting, and sensory neuropathy, and there were no grade 3 or 4 nonhematological AEs. Cholinergic syndrome related to irinotecan occurred in 3 patients (16.7%). Severe AEs, including bile duct infection (11.1%), hyperglycemia (11.1%), hypoxia (5.6%), and pulmonary artery thrombosis (5.6%), also occurred.\n\nTable 5 Relative dose intensity of the second-line FOLFIRINOX for unresectable pancreatic cancer.\n\n4 Discussion\nIn the present study, we administered second-line FOLFIRINOX treatment in Japanese MPC patients. We started this study in June 2011; at that time, FOLFIRINOX was not yet approved in Japan for MPC. Moreover, there was no recommended second-line treatment for pancreatic cancer, and full-dose cytotoxic triplet of FOLFIRINOX was considered high risk for Japanese pancreatic cancer patients as the second-line treatment. Furthermore, the AEs of FOLFIRINOX are generally believed to be more severe compared with those of GEM-based chemotherapy, and second-line treatment tends to be associated with more severe AEs than first-line therapy. Accordingly, a feasibility study of FOLFIRINOX for Japanese patients was deemed necessary, and we performed the present phase I study of FOLFIRINOX as second-line treatment for MPC.\n\nInitially, the appropriate dose of irinotecan needed to be established. In the standard regimen of FOLFIRINOX, irinotecan is recommended at a dose of 180 mg/m2.[6] However, in Japan, in FOLFIRI treatment for colorectal cancer, the most commonly used dose of irinotecan in clinical practice is 150 mg/m2. In a previous study on the recommended regimen of FOLFOXIRI for Japanese metastatic colorectal cancer, the irinotecan dose was 150 mg/m2 and bolus 5-FU was omitted.[12] In that study, patients homozygous for UGT1A1∗28 or UGT1A1∗6 or heterozygous for both UGT1A1∗6 and UGT1A1∗28 were excluded. Based on these previous studies, we determined that level 1 of the irinotecan dose (125 mg/m2) of FOLFIRINOX for second-line treatment of pancreatic cancer should be decreased below the commonly used dosage for colorectal cancer. We also excluded patients homozygous for UGT1A1∗28 or UGT1A1∗6 or heterozygous for both UGT1A1∗6 and UGT1A1∗28. UGT1A1 is involved in the metabolism of SN-38, an active metabolite of irinotecan, and variants of UGT1A1 have been reported to intensify myelosuppression, such as severe neutropenia.[13]\n\nIn the present study, at level 1, 2 out of the total of 6 patients showed DLTs, including grade 4 neutropenia, grade 4 hyperglycemia, grade 3 cholangitis (severe infection), and grade 3 thrombocytopenia. In general, obstructive cholangitis and hyperglycemia are not considered direct treatment-related toxicities. In particular, hyperglycemia is considered to be related to the prophylactic use of dexamethasone as an anti-emetic agent. However, in this case, moderate neutropenia and moderate appetite loss continued during treatment; therefore, we decided that these severe conditions were treatment-related toxicities. As a result, in second-line FOLFIRINOX treatment for pancreatic cancer patients, 125 mg/m2 irinotecan might be a life-threatening dose. For first-line FOLFIRINOX, a Japanese phase II study reported that the relative dose intensity of irinotecan was 70%, and a study from Yale university similarly reported a relative dose intensity of 64%, that is, doses of approximately 115 to 125 mg/m2.[14,15] Herein, we administered this treatment as second-line therapy and did not remove the bolus 5-FU from the regimen; therefore, the recommended dose of irinotecan (100 mg/m2) for second-line FOLFIRINOX might be reasonable.\n\nRecently, a number of studies have suggested that modification to the FOLFIRINOX regimen may decrease toxicities without compromising efficacy,[16–18] and, in many studies, the bolus 5-FU was thus removed and/or the irinotecan dose was decreased (165–130 mg/m2). Recently, a phase II study of modified FOLFIRINOX for chemotherapy-naïve Japanese patients was reported.[19] This modified FOLFIRINOX regimen comprised 150 mg/m2 irinotecan and no bolus 5-FU, and showed improved safety with maintained efficacy without prophylactic pegfilgrastim. In the study by Ueno et al., the relative dose intensity of irinotecan was 89.3% (134 mg/m2). In contrast, in our study, we did not plan to exclude the bolus 5-FU, as the dose of irinotecan might have been slightly decreased as a result. Recently, an international phase III study showed that nanoliposomal irinotecan with 5-FU and leucovorin extends the survival of patients with MPC who previously received GEM-based chemotherapy 9). In this study, the dose of nanoliposomal irinotecan was equivalent to 70 mg/m2 of irinotecan base every 2 weeks, and the relative dose intensity was 69.8%. Our recommended dose (100 mg/m2 irinotecan) might be sufficient as second-line chemotherapy for MPC.\n\nIn our phase II study, the primary endpoint (RR) was considered insufficient, and this study became a negative study. However, the RR and DCR were slightly higher than those reported in previous studies (Table 6). FOLFIRINOX is the first triplet regimen investigated in a prospective study on second-line regimens for MPC cases, and we speculate that its cytotoxic effects might contribute to the higher RR and DCR; however, the rate of severe neutropenia might be higher than with other regimens. Moreover, while the PFS did not differ from that of other studies using different regimens, the OS, especially when calculated from the first-line treatment, was longer than previously reported. In our study, the median duration of first-line treatment with GEM or GEM plus S-1 was 4.3 months, which is in accordance with previous studies in which metastatic pancreatic cancer patients received GEM-based chemotherapy for approximately 3 to 5 months.[8,25] Furthermore, in our study, the third-line treatment was not specified, with 9, 4, 1, 2, and 1 cases receiving only best supportive care, GEM monotherapy, nab-paclitaxel plus GEM, GEM plus S-1, and S-1 monotherapy, respectively; however, the median time to treatment failure of these third-line chemotherapies was 1.4 months (data not shown). As we recruited the patients in this study at the time of first-line treatment failure, and because this treatment was not approved in Japan at the time, patients with a relatively good PS might have been selected in this study.\n\nTable 6 Past reported studies of second-line treatment for unresectable pancreatic cancer.\n\nBoth regimens of FOLFIRINOX and nab-paclitaxel plus GEM are effective and feasible treatments for MPC cases. However, there is not enough evidence regarding which regimen to select first. Recently, Portal et al. reported that first-line FOLFIRINOX followed by nab-paclitaxel plus GEM was associated with a median PFS and OS of 5.1 and 8.8 months, respectively;[26] from the start of first-line chemotherapy, the median OS was 18 months. According to these findings, the authors concluded that second-line nab-paclitaxel plus GEM following FOLFIRINOX was feasible and had modest activity and clinical benefit in advanced pancreatic cancer. In our study, there was no case of nab-paclitaxel plus GEM as first-line treatment, with patients receiving either GEM alone or GEM plus S-1. Hence, in the future, prospective studies of second-line FOLFIRINOX following nab-paclitaxel plus GEM are needed.\n\nIn conclusion, this is the first prospective study of second-line FOLFIRINOX for MPC worldwide. The results of the present study suggest that FOLFIRINOX is a marginally effective treatment for GEM based chemotherapy failure cases and is feasible as second-line treatment for select advanced pancreatic cancer patients that may be able to prolong OS.\n\nAcknowledgments\nWe thank all patients, clinicians, and support staff who participated in this study.\n\nAbbreviations: 5-FU = 5-fluorouracil, FOLFIRINOX = oxaliplatin, irinotecan, fluorouracil, and leucovorin, G-CSF = granulocyte-colony stimulating factor, GEM = gemcitabine.\n\nThe authors have no funding and conflicts of interest to disclose.\n==== Refs\nReferences\n[1] Rahib L Smith B Alzenberg R \nProjecting cancer incidence and deaths to 2030; the unexpected burden of thyroid, liver, and pancreas cancers in the United States . Cancer Res \n2014 ;74 :2913 –21 .24840647 \n[2] Malik N Salerno May K Chandrasekhar R \nTreatment of locally advanced unresectable pancreatic cancer: a 10-year experience . J Gastrointest Oncol \n2012 ;3 :326 –34 .23205309 \n[3] Hidalgo M \nPancreatic cancer . N Engl J Med \n2010 ;362 :1605 –17 .20427809 \n[4] Burris HA 3rdMoore MJ Andersen J \nImprovements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial . J Clin Oncol \n1997 ;5 :2403 –13 .\n[5] Von Hoff DD Ervin T Arena FP \nIncreased survival in pancreatic cancer with nab-paclitaxel plus gemcitabine . N Engl J Med \n2013 ;369 :1691 –703 .24131140 \n[6] Conroy T Desseigne F Ychou M \nFOLFIRINOX versus gemcitabine for metastatic pancreatic cancer . N Engl J Med \n2011 ;364 :1817 –25 .21561347 \n[7] Dahan L Bonnetain F Ychou M \nCombination 5-fluorouracil, folinic acid and cisplatin (LV5FU2-CDDP) followed by gemcitabine or the verse sequence in metastatic pancreatic cancer: final results of a randomized strategic phase III trial (FFCD 0301) . Gut \n2010 ;59 :1527 –34 .20947887 \n[8] Oettle H Riess H Stieler JM \nSecond-line oxaliplatin, folinic acid, and fluorouracil versus folinic acid and fluorouracil alone for gemcitabine-refractory pancreatic cancer: outcomes from the CONKO-003 Trial . J Clin Oncol \n2014 ;32 :2423 –9 .24982456 \n[9] Wang-Gillam A Li CP Bodoky G \nNanoliposomal irinotecan with fluorouracil and folinic acid in metastatic pancreatic cancer after previous gemcitabine-based therapy (NAPOLI-1): a global, randomised, open-label, phase 3 trial . Lancet \n2016 ;387 :545 –57 .26615328 \n[10] Assaf E Verlinde CM Delbaldo C \n5-fluorouracil/leucovorin combined with irinotecan and oxaliplatin (FOLFIRINOX) as second-line chemotherapy in patients with metastatic pancreatic adenocarcinoma . Oncology \n2011 ;80 :301 –6 .21778770 \n[11] Therasse P Arbuck SG Eisenhauer EA \nNew guidelines to evaluate the response to treatment in solid tumors. European organization for research and treatment of cancer, national cancer institute of the United States, National Cancer Institute of Canada . J Natl Cancer Inst \n2000 ;92 :205 –16 .\n[12] Sunakawa Y fujita K Ichikawa W \nA phase I study of infusional 5-Fluorouracil, leucovorin, oxaliplatin and irinotecan in Japanese patients with advanced colorectal cancer who harbor UGT1A1:1/∗1,:1/∗6 or ∗1/∗28 . Oncology \n2012 ;82 :242 –8 .22508373 \n[13] Gagne JF Montminy V Belanger P \nCommon human UGT1A1 polymorphisms and the altered metabolism of irinotecan active metabolite 7-ethyl-10-hydroxycamptothecin (SN-38) . Mol Pharmacol \n2002 ;62 :608 –17 .12181437 \n[14] Okusaka T Ikeda M Fukutomi A \nPhase II study of FOLFIRINOX for chemotherapy-naïve Japanese patients with metastatic pancreatic cancer . Cancer Sci \n2014 ;105 :1321 –6 .25117729 \n[15] Gunturu KS Yao X Cong X \nFOLFIRINOX for locally advanced and metastatic pancreatic cancer: single institution retrospective review of efficacy and toxicity . Med Oncol \n2013 ;30 :361 .23271209 \n[16] Mahaseth H Brutcher E Kauh J \nModified FOLFIRINOX regimen with improved safety and maintained efficacy in pancreatic adenocarcinoma . Pancreas \n2013 ;42 :1311 –5 .24152956 \n[17] Blazer M Wu C Goldberg RM \nNeoadjuvant modified (m) FOLFIRINOX for locally advanced unresectable (LAPC) and borderline resectable (BRPC) adenocarcinoma of the pancreas . Ann Surg Oncol \n2015 ;22 :1153 –9 .25358667 \n[18] Ghorani E Wong HH Hewitt C \nSafety and efficacy of modified FOLFIRINOX for advanced pancreatic adenocarcinoma: a UK single-centre experience . Oncology \n2015 ;89 :281 –7 .26372905 \n[19] Ueno M Ozaka M Ishii H \nPhase II study of modified FOLFIRINOX for chemotherapy-naïve patients with metastatic pancreatic cancer. 2016 ASCO Annual Meeting . J Clin Oncol \n2016 ;34 (suppl) :abstr 4111 .\n[20] Pelzer U Schwaner I Stieler J \nBest supportive care (BSC) versus oxaliplatin, folinic acid and 5-fluorouracil (OFF) plus BSC in patients for second-line advanced pancreatic cancer: a phase III-study from the German CONKO-study group . Europ J Cancer \n2011 ;47 :1676 –81 .\n[21] Yoo C Hwang JY Kim JE \nA randomized phase II study of modified FOLFIRI.3 vs modified FOLFOX as second-line therapy in patients with gemcitabine-refractory advanced pancreatic cancer . Br J Cancer \n2009 ;101 :1658 –63 .19826418 \n[22] Morizane C Okusaka T Furuse J \nA phase II study of S-1 in gemcitabine-refractory metastaticpancreatic cancer . Cancer Chemother Pharmacol \n2009 ;63 :313 –9 .18398614 \n[23] Ohkawa S Okusaka T Isayama H \nRandomised phase II trial of S-1 plus oxaliplatin vs S-1 in patients with gemcitabine-refractory pancreatic cancer . Br J Cancer \n2015 ;103 :1 –7 .\n[24] Ueno M Okusaka TY Omuro Y \nA randomized phase II study of S-1 plus oral leucovorin versus S-1 monotherapy in patients with gemcitabine-refractory advanced pancreatic cancer . Ann Oncol \n2016 ;27 :502 –8 .26681680 \n[25] Mizuno N Yamao K Komatsu Y \nRandomized phase II trial of S-1 versus S-1 plus irinotecan (IRIS) in patients with gemcitabine-refractory pancreatic cancer. 2013 Gastrointestinal Cancers Symposium . J Clin Oncol \n2013 ;31 :suppl abstr 263 .\n[26] Portal A Pernot S Tougeron D \nNab-paclitaxel plus gemcitabine for metastatic pancreatic adenocarcinoma after Folfirinox failure: an AGEO prospective multicentre cohort . Br J Cancer \n2015 ;113 :989 –95 .26372701\n\n",
"fulltext_license": "CC BY-SA",
"issn_linking": "0025-7974",
"issue": "96(19)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D002166:Camptothecin; D003841:Deoxycytidine; D018572:Disease-Free Survival; D004305:Dose-Response Relationship, Drug; D019008:Drug Resistance, Neoplasm; D005260:Female; D005472:Fluorouracil; D005500:Follow-Up Studies; D006801:Humans; D000077146:Irinotecan; D053208:Kaplan-Meier Estimate; D002955:Leucovorin; D008297:Male; D020714:Maximum Tolerated Dose; D008875:Middle Aged; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D010190:Pancreatic Neoplasms; D019233:Retreatment; D016896:Treatment Outcome",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e6769",
"pmc": null,
"pmid": "28489753",
"pubdate": "2017-05",
"publication_types": "D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article",
"references": "25358667;21778770;25880004;26372701;23271209;21561347;23205309;18398614;24840647;26615328;24982456;12181437;24152956;10655437;9196156;20427809;26372905;26681680;25117729;19826418;21565490;20947887;22508373;24131140",
"title": "Effect of FOLFIRINOX as second-line chemotherapy for metastatic pancreatic cancer after gemcitabine-based chemotherapy failure.",
"title_normalized": "effect of folfirinox as second line chemotherapy for metastatic pancreatic cancer after gemcitabine based chemotherapy failure"
} | [
{
"companynumb": "JP-PFIZER INC-2017240402",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3",
... |
{
"abstract": "Thyroid storm is a life-threatening presentation, with heart failure and tachyarrhythmias being common manifestations. This case highlights that a flail mitral valve from chordae tendineae rupture can be a cause of worsening heart failure and cardiogenic shock in a thyroid storm, albeit a rare complication.\nWe describe a patient who was admitted for a thyroid storm precipitated by pneumonia, who later developed an acute flail mitral valve from chordae tendineae rupture.\nA 55-year-old woman with no past medical history was admitted with fever, dyspnea, lower limb swelling, and hemoptysis. She was febrile, tachycardic, and in fluid overload. Her heart sounds were dual, and no murmurs were heard. Initial investigations indicated primary hyperthyroidism and pneumonia. She was diagnosed with a thyroid storm precipitated by pneumonia, complicated by heart failure. Her Burch-Wartofsky score was 70. She was started on intravenous hydrocortisone, oral propylthiouracil, oral Lugol's iodine, and oral cholestyramine, together with intravenous amoxicillin-clavulanate and intravenous furosemide. She continued to deteriorate in the medical intensive care unit, with worsening hypoxia and hypotension. Echocardiography showed an acute flail posterior mitral valve leaflet with torrential mitral regurgitation from rupture of the chordae tendineae. She subsequently underwent a bioprosthetic mitral valve replacement.\nAn acute flail mitral valve precipitated by thyroid storm leading to refractory cardiogenic shock is rare. Factors contributing to the rupture of valve chordae tendineae include the effect of hyperthyroidism on papillary muscle function, a hyperdynamic circulation leading to vulvular stress, as well as pre-existing mitral valve pathology.",
"affiliations": null,
"authors": "Chen|Abel Weiliang|AW|;Wee|Hui Chia|HC|;Sonawane|Vikram|V|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.4158/ACCR-2018-0137",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2376-0605",
"issue": "5(1)",
"journal": "AACE clinical case reports",
"keywords": null,
"medline_ta": "AACE Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101670593",
"other_id": null,
"pages": "e4-e6",
"pmc": null,
"pmid": "31966990",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "4050712;3966373;8325286;22690898;17127140;3998316;3812318;15694895;23920160;5156265;23130563;7254298",
"title": "FLAIL MITRAL VALVE: A RARE COMPLICATION OF A THYROID STORM.",
"title_normalized": "flail mitral valve a rare complication of a thyroid storm"
} | [
{
"companynumb": "SG-IMPAX LABORATORIES, LLC-2018-IPXL-04073",
"fulfillexpeditecriteria": "1",
"occurcountry": "SG",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IODINE\\POTASSIUM IODIDE"
},
... |
{
"abstract": "Treatment of chronic hepatitis C virus (HCV) infection in patients with chronic kidney disease (CKD) is essential. The availability of sofosbuvir (SOF) has dramatically improved overall HCV cure rates, however there is insufficient data regarding its use in patients with CKD. We evaluated SOF in patients with hepatitis C genotype 1 (G1) and moderately impaired renal function.\n\n\n\nWe retrospectively reviewed all patients treated with a SOF-based regimen from December 2013 through September 2015 at Virginia Mason Medical Center. Data was then collected for HCV G1 patients with stage 3 CKD.\n\n\n\nA total of 28 patients with HCV G1 and stage 3 CKD were treated with a SOF-based regimen. Twenty-one patients had stage 3A CKD (estimated glomerular filtration rate [eGFR] 45-60 mL/min/1.73m2) and 7 patients had stage 3B CKD (eGFR 30-45 mL/min/1.73m2). The overall rate of sustained virologic response (SVR) 12 weeks after completion of therapy (SVR12) was 85.7% (24/28). SVR12 in stage 3A CKD patients was 81.0% (17/21) and in stage 3B CKD patients, SVR12 was 100% (7/7). Based on the treatment regimen used, the SVR12 was 81.8% (9/11), 92.3% (12/13), and 75.0% (3/4) for SOF/ledipasvir (LDV), SOF/simeprevir (SIM), and SOF/pegylated interferon (PEG)/ribavirin (RBV), respectively. Greater than 30% reduction eGFR was observed in 4 out of 28 patients.\n\n\n\nSOF-based regimens resulted in high SVR12 rates in patients with moderately impaired renal function. During therapy, HCV patients with CKD should be carefully monitored for worsening renal function.",
"affiliations": "Division of Hepatology, Department of Internal Medicine, Kyung Hee University Hospital at Gangdong, Kyung Hee University School of Medicine, Seoul, Korea.;Division of Hepatology, Department of Internal Medicine, Kyung Hee University Hospital at Gangdong, Kyung Hee University School of Medicine, Seoul, Korea.;Department of Digestive Disease Institute, Virginia Mason Medical Center, Seattle, WA, USA.;Department of Digestive Disease Institute, Virginia Mason Medical Center, Seattle, WA, USA.;Department of Digestive Disease Institute, Virginia Mason Medical Center, Seattle, WA, USA.",
"authors": "Shin|Hyun Phil|HP|;Park|Ji-Ae|JA|;Burman|Blaire|B|;Kozarek|Richard A|RA|;Siddique|Asma|A|0000-0002-1284-6906",
"chemical_list": "D000998:Antiviral Agents; D000069474:Sofosbuvir",
"country": "Korea (South)",
"delete": false,
"doi": "10.3350/cmh.2016.0087",
"fulltext": "\n==== Front\nClin Mol HepatolClin Mol HepatolCMHClinical and Molecular Hepatology2287-27282287-285XThe Korean Association for the Study of the Liver 2882751210.3350/cmh.2016.0087cmh-2016-0087Original ArticleEfficacy and safety of sofosbuvir-based regimens for treatment in chronic hepatitis C genotype 1 patients with moderately impaired renal function Shin Hyun Phil 1Park Ji-Ae 1Burman Blaire 2Kozarek Richard A. 2http://orcid.org/0000-0002-1284-6906Siddique Asma 2\n1 Division of Hepatology, Department of Internal Medicine, Kyung Hee University Hospital at Gangdong, Kyung Hee University School of Medicine, Seoul, Korea\n2 Department of Digestive Disease Institute, Virginia Mason Medical Center, Seattle, WA, USACorresponding author : Asma Siddique Digestive Disease Institute, Virginia Mason Medical Center, 1100 9th Avenue PO Box 900 Seattle, Washington 98101, USA Tel: +1-206-223-2319, Fax: +1-206-223-6379 E-mail: Asma.Siddique@virginiamason.org12 2017 22 8 2017 23 4 316 322 20 12 2016 4 5 2017 19 6 2017 Copyright © 2017 by The Korean Association for the Study of the Liver2017This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Background/Aims\nTreatment of chronic hepatitis C virus (HCV) infection in patients with chronic kidney disease (CKD) is essential. The availability of sofosbuvir (SOF) has dramatically improved overall HCV cure rates, however there is insufficient data regarding its use in patients with CKD. We evaluated SOF in patients with hepatitis C genotype 1 (G1) and moderately impaired renal function.\n\nMethods\nWe retrospectively reviewed all patients treated with a SOF-based regimen from December 2013 through September 2015 at Virginia Mason Medical Center. Data was then collected for HCV G1 patients with stage 3 CKD.\n\nResults\nA total of 28 patients with HCV G1 and stage 3 CKD were treated with a SOF-based regimen. Twenty-one patients had stage 3A CKD (estimated glomerular filtration rate [eGFR] 45–60 mL/min/1.73m2) and 7 patients had stage 3B CKD (eGFR 30–45 mL/min/1.73m2). The overall rate of sustained virologic response (SVR) 12 weeks after completion of therapy (SVR12) was 85.7% (24/28). SVR12 in stage 3A CKD patients was 81.0% (17/21) and in stage 3B CKD patients, SVR12 was 100% (7/7). Based on the treatment regimen used, the SVR12 was 81.8% (9/11), 92.3% (12/13), and 75.0% (3/4) for SOF/ledipasvir (LDV), SOF/simeprevir (SIM), and SOF/pegylated interferon (PEG)/ribavirin (RBV), respectively. Greater than 30% reduction eGFR was observed in 4 out of 28 patients.\n\nConclusions\nSOF-based regimens resulted in high SVR12 rates in patients with moderately impaired renal function. During therapy, HCV patients with CKD should be carefully monitored for worsening renal function.\n\nSofosbuvirChronic kidney diseasesHepatitis CSafety\n==== Body\nINTRODUCTION\nHepatitis C virus (HCV) has infected over 170 million people worldwide [1,2] and is one of the main causes of chronic liver disease in Korea [3]. HCV infection can cause renal disease in both native and transplanted kidneys including membranoproliferative glomerulonephritis, with or without cryoglobulinemia, membranous nephropathy and significantly reduces graft survival in renal transplant recipients [4]. It is reported that HCV patients have 23% greater relative risk of chronic kidney disease (CKD) compared to those without HCV [5]. It is therefore essential to treat HCV in patients with any stage of CKD.\n\nUntil recently the treatment of HCV infection in patients with CKD consisted of pegylated interferon (PEG) with or without ribavirin (RBV); however treatment outcomes were poor and side effects sometimes intolerable [6,7]. With the availability of the direct acting antivirals (DAAs), substantial changes in the treatment of HCV in patients with CKD is anticipated. The American Association for the Study of Liver Diseases and the Infectious Diseases Society of America recommend that patients with mild-to-moderate renal impairment can be treated without any dose adjustment while using any of the recommended agents/regimens to treat HCV. In patients with severe renal impairment (estimated Glomerular Filtration Rate [eGFR] less than 30 mL/min), the FDA recommended regimen is standard-dose ombitasvir-paritaprevir-ritonavir and dasabuvir with or without ribavirin or fixed-dose elbasvir/grazoprevir [8].\n\nSofosbuvir (SOF), a HCV NS5B nucleotide inhibitor, has primary renal clearance and therefore is not recommended in patients with estimated glomerular filtration rate (eGFR) less than 30 mL/min. A study in patients with advanced renal disease (eGFR<30 mL/min/1.73m2) is currently in progress. SOF may be safe in treatment of HCV in patients with mild or moderate renal impairment, however there is extremely limited clinical data of its use in this unique patient population.\n\nThe aim of this current study is to define safety and efficacy of SOF-based regimens among those HCV-infected patients with moderate renal impairment in a real-world setting.\n\nPATIENTS AND METHODS\nPatients\nWe retrospectively reviewed electronic medical records of all adult patients with chronic HCV infection treated with SOF-based regimens at Virginia Mason Medical Center from December 2013 to September 2015. We then reviewed data of all HCV G1 patients treated with SOF-based regimens who had eGFR between 30–60 mL/min/1.73m2 at baseline. eGFR was calculated by the modification of diet in renal disease study equation as 186 × (Creatinine/88.4)-1.154 × (Age)-0.203 × (0.742 if female) × (1.210 if black) [9]. eGFR 45–60 mL/min/1.73m2 was defined as CKD stage 3A and eGFR 30–45 mL/min/1.73m2 was defined as CKD stage 3B. The diagnosis of cirrhosis was made by liver biopsy and/or transient elastography with a median score above 12.5 kPa being considered as consistent with cirrhosis (on a scale of 1.5 to 75.0 kPa). Treatment history was categorized into treatment naïve and treatment experienced based on history of previous HCV treatment.\n\nLaboratory tests were checked prior to initiation of treatment, at least once a month throughout the treatment period, at the end of treatment, and post-treatment week 4 and week 12. Complete blood count, serum aminotransferase enzymes, albumin, total bilirubin, and serum creatinine were measured using standard laboratory procedures. Worsening of renal function was defined as a 30% reduction in eGFR from baseline at any point during treatment [10]. HCV RNA levels were checked with a lower limit of quantification of 12 IU/mL.\n\nDefinition of virologic response was undetectable HCV RNA levels. A rapid virologic response (RVR) was defined as undetectable HCV RNA at week 4 of treatment. We evaluated rate of sustained virologic response (SVR), as defined as undetectable HCV RNA 12 weeks post treatment (SVR12). Virologic relapse was defined as a serum HCV RNA level more than 12 IU/mL at anytime during treatment or during 12-week post-treatment period. HCV RNA level > 800,000 IU/mL was used as cut-off value high HCV RNA level [11]. Adverse events on treatment were collected at clinic visits or by patient report throughout treatment period. Transfusion or use of erythropoietin during treatment was reviewed. This study was approved by the institutional review board of Virginia Mason Medical Center.\n\nStatistical analysis\nCategorical data are expressed as number (percentage), whereas continuous data are expressed as mean ± SD. The Student’s t test was used to compare means, and the chi square test or Fisher’s exact test was used to compare proportions. P<0.05 was considered statistically significant. Statistical analyses were performed using the Statistical Package for the Social Sciences (SPSS) version 18.0 for Windows (IBM Corp., Armonk, NY, USA).\n\nRESULTS\nBaseline characteristics\nTwenty-eight patients with baseline CKD stage 3 were included after review of all HCV G1 patients treated with SOF-based regimen during this period. Majority of the patients had genotype 1A, and 50% of the patients had cirrhosis. Among the 28 patients, 11 patients were treated with SOF/LDV, 13 with SOF/simeprevir (SIM), and 4 with SOF/PEG/RBV. Although statistically not significant, the mean age was younger and the presence of cirrhosis was lower in the SOF/PEG/RBV group compared to the other 2 groups. According to baseline eGFR, 21 patients were regarded as having CKD stage 3A, and seven patients with CKD stage 3B. There were no statistically significant differences between CKD stage 3A and CKD stage 3B groups; with the exception of renal function and bilirubin level. Bilirubin level was higher in CKD 3A group, likely due to higher number of patients with cirrhosis in this group. Baseline characteristics are shown in Table 1.\n\nVirologic response\nSVR12 was achieved in 24 of 28 patients (85.7%). All 7 patients with CKD stage 3B achieved a SVR12. Among patients with CKD stage 3A, 81% (17/21) achieved SVR12. Of the 4 patients with CKD stage 3A who relapsed, 2 received SOF/LDV, 1 patient each received SOF/SIM and SOF/PEG/RBV. The treatment results of each regimen according to baseline renal function are provided in Figure 1.\n\nSVR12 rates in patients who achieved RVR was higher than those who did not achieve RVR (90.0 % vs. 60.0%, P=0.206) and SVR12 was higher in patients without cirrhosis compared to those with cirrhosis (92.9% vs. 78.6%, P=0.302). SVR12 rates in patients less than 65 years old was higher compared to those 65 years or older (94.4% vs. 70.0%, P=0.109). Based on genotype, SVR12 was 94.4% (17/18) in patients with genotype 1A and 70% (7/10) in patients with genotype 1B (P=0.109). Statistically, there were no significant factors to predict treatment success. Treatment results according to population subgroup using univariate analysis are provided in Table 2.\n\nAdverse effects and safety\nAll patients completed treatment, and only 1 patient failed to take RBV for 2 days. A full list of adverse events is provided in Table 3. Fatigue and headaches were the most common adverse events. No serious adverse events were reported. Four patients had worsening renal function, which included 2 out of 21 patients (9.5%) with CKD stage 3A and 2 out of 7 patients (28.6%) with CKD stage 3B (Fig. 2). All 4 patients subsequently recovered renal function back to their baseline. Four patients had anemia defined as hemoglobin less than 10 g/dL or over 2 g/dL drop in hemoglobin. This included 3 patients (14.3%) with CKD stage 3A and 1 patient (14.3%) with CKD stage 3B. In the CKD stage 3A group, 2 patients required transfusion, and 2 patients were treated with erythropoietin, while 1patient with CKD stage 3B required erythropoietin therapy.\n\nDISCUSSION\nSOF acts by inhibiting HCV NS5B RNA-dependent RNA polymerase, which is required for hepatitis C viral replication. SOF is metabolized in the liver to its pharmacologically active metabolite (GS-461203), which gets incorporated into HCV RNA by the NS5B polymerase and acts as a chain terminator. It also produces inactive metabolite GS-331007, which enters the circulation and is renally eliminated. In patients with renal impairment, the area under the concentration-time curve (AUC) of GS-331007 is increased by 56% in mild, 90% in moderate and 456% in severe renal impairment subjects, compared to normal subjects [12]. As a result SOF is not recommended in patient with severe renal impairment. Several clinical trials have evaluated the safety and efficacy of SOF with heterogenous results.\n\nThe HCV TARGET study, a multicenter prospective observation study, captured data from 1893 patients treated with a SOF based regimen [4]. 168 of these patients had baseline eGFR 46–60 mL/min/1.73m2, 55 patients with eGFR 31–45 mL/min/1.73m2 and 18 with eGFR ≤ 30 mL/min/1.73m2, majority were genotype 1. These patients were treated with SOF based regimen including SOF/PEG/RBV, SOF/RBV or SOF/SIM with or without RBV. The overall SVR12 was 82–83% and was similar across eGFR groups. However, these patients experienced higher rates of worsening renal dysfunction and other serious adverse events. In comparison, other clinical trials did not report significant worsening renal function when treated with either full dose of SOF (400 mg) every other day or half dose (200 mg) daily, however these trials enrolled small number of patients [12].\n\nOur study included regimens SOF/LDV, SOF/SIM and SOF/PEG/RBV and is important because SOF/LDV is now available in genotype 1a and 1b with RAV in Korea although experience in CKD is insufficient yet. LDV has biliary clearance and therefore no dose reduction is required for patients with mild to moderate renal insufficiency. We specifically focused on patients with moderately impaired renal function.\n\nIn our study, the overall SVR12 rate in CKD stage 3 patients was high at 85.7%. The SVR12 rate based on treatment regimen was 81.8% for SOF/LDV, 92.3% for SOF/SIM, and 75.0% for SOF/PEG/RBV. Other studies with SOF based regimens have also shown high SVR rates and SOF has been found to be well tolerated both in moderate and severe renal impairment patients [13,14].\n\nBased on the CKD stage, SVR12 in patients with CKD stage 3A was 81.0 % and in CKD stage 3B patients it was 100%. Although there was no significant difference in baseline characteristics between the two groups, CKD 3A group had more treatment experienced patients (36.0% vs. 28.6%) and also higher number of patients with cirrhosis (52.4% vs. 42.9%) (Table 1).\n\nIn our study, 2 patients failed to achieve SVR in the SOF/LDV group. One patient was a 67-year-old Caucasian man, treatment naïve with cirrhosis, and the second patient was a 78-year-old Caucasian woman, treatment experienced with stage 2 fibrosis. The patient in SOF/SIM group who failed to achieve SVR12 was a 70-year-old African-American man, treatment experienced with cirrhosis, and the patient treated with PEG/RBV/SOF that failed to achieve SVR was a 57-year-old Caucasian man with cirrhosis.\n\nWe observed worsening renal function to be more common in patients with CKD stage 3B (28.6%) compared with CKD stage 3A (9.5%). We performed a multivariate analysis to try and identify any factors that could predict worsening renal function in patients with CKD being treated with SOF based regimen, however no obvious risk factors were identified. This is maybe due to the fact that only a small number of patients experienced worsening renal function. Therefore renal function during SOF-based treatment should be carefully monitored in all patients with CKD stage 3.\n\nHowever, all patients recovered baseline renal function without discontinuation of treatment. In our study, of the 4 patients who experienced worsening renal function during therapy, 2 patients had compensated cirrhosis and were not on diuretics, and the other 2 patients were non-cirrhotics.\n\nAnemia is a common adverse event in RBV including regimens [15], and CKD patients generally have a lower baseline hemoglobin level. Three patients (14.3%) with CKD stage 3A and 1 patient (14.3%) with CKD stage 3B had anemia with a hemoglobin level lower than 10 g/dL during treatment. Three of the patients received SOF/PEG/RBV, and the fourth received SOF/SIM. Other adverse events were rare and not severe. Most common side effects were fatigue and headache. No patient discontinued treatment due to side effects.\n\nWe tried to analyze the predictors affecting treatment outcomes, but none were considered as predictors of SVR, possibly due to the small number of patients.\n\nThis study has unique strengths compared to that of previous studies. This is the first real-life treatment response and adverse effects data of CKD stage 3 patients using various SOF-based regimens in a single center. The limitations of this study are its retrospective nature and the small number of included patients. Moreover, the diagnosis of cirrhosis was made by different methods.\n\nIn conclusion, SOF-based regimens resulted in high SVR12 rates without serious adverse events in patients with moderately impaired renal function. Both CKD stage 3A and CKD stage 3B patients can be considered for treatment with a SOF-based regimen, however clinicians should be cautious and monitor for worsening of renal functions during treatment.\n\nAuthor contributions\n\nAsma Siddique and Hyun Phil Shin have full access to all of the data and have responsibility for the data and the data analysis.\n\n\n- Study design: Asma Siddique, and Hyun Phil Shin\n\n- Acquisition and interpretation of data: Asma Siddique, Blaire Burman, Hyun Phil Shin\n\n- Drafting of the manuscript: Asma Siddique, Richard A. Kozarek\n\n- Critical revision of the manuscript for important intellectual content: Asma Siddique, and Hyun Phil Shin\n\n- Statistical analysis: Ji-Ae Park\n\n\n\nConflicts of Interest: The authors have no conflicts to disclose.\n\nThis research was supported in part by The Research Fund of the Korean Association for the Study of the Liver (2015).\n\nAbbreviations\nCKDchronic kidney disease\n\neGFRestimated glomerular filtration rate\n\nHCVhepatitis C virus\n\nLDVledipasvir\n\nPEGpegylated interferon\n\nSIMsimeprevir\n\nSOFsofosbuvir\n\nSVRsustained virologic response\n\nRBVribavirin\n\nRVRrapid virologic response\n\nFigure 1. Virologic response by treatment regimen and baseline renal function. SVR, sustained virologic response; SOF, sofosbuvir; LDV, ledipasvir; SIM, simeprevir; PEG, pegylated interferon; RBV, ribavirin; CKD 3A, estimated glomerular filtration rate [eGFR] 45–60 mL/min/1.73mm2 ; CKD 3B, eGFR 30-45 mL/min/1.73mm2 .\n\nFigure 2. The change of estimated glomerular filtration rate (eGFR) in patients with worsening of renal function during treatment. EOT, end of treatment; SOF, sofosbuvir; SIM, simeprevir; LDV, ledipasvir.\n\nTable 1. Demographic and clinical characteristics of patients at baseline\n\nBaseline characteristic\tCKD 3A (n=21)\tCKD 3B (n=7)\tAll patients (n=28)\tP-value\t\nTreatment regimen (n, %)\t\t\t\t0.097*\t\n SOF/LDV\t6 (28.6)\t5 (71.4)\t11 (39.3)\t\t\n SOF/SIM\t12 (57.1)\t1 (14.3)\t13 (46.4)\t\t\n SOF/PEG/RBV\t3 (14.3)\t1 (14.3)\t4 (14.3)\t\t\nAge (mean±SD, range), years\t61.0 ± 11.2 (27-78)\t62.9 ± 5.4 (56-72)\t61.4 ± 10.0 (27-78)\t0.67\t\nMale Sex (n, %)\t19 (47.6)\t5 (71.4)\t15 (53.6)\t0.253*\t\nBody-mass index (mean±SD, range)\t28.3 ± 4.2 (21-36.7)\t25.5 ± 2.6 (23.2-30.9)\t27.6 ± 4.0 (21-36.7)\t0.113\t\nRace (n, %)\t\t\t\t0.253*\t\n White\t19 (90.5)\t5 (71.4)\t24 (85.7)\t\t\n African American\t1 (4.8)\t1 (14.3)\t2 (7.1)\t\t\n Other\t1 (4.8)\t1 (14.3)\t2 (7.1)\t\t\nHCV genotype (n, %)\t\t\t\t0.674*\t\n 1a\t14 (66.7)\t4 (57.1)\t18 (64.3)\t\t\n 1b\t7 (33.3)\t3 (42.9)\t5 (31)\t\t\nPrevious HCV treatment (n, %)\t\t\t\t0.212*\t\n Naïve\t12 (57.1)\t5 (72.4)\t17 (60.7)\t\t\n Treatment experienced (IFN based) (n, %)\t9 (42.9)\t2 (28.6)\t11 (39.3)\t\t\nCirrhosis (n, %)\t11 (52.4)\t3 (42.9)\t14(50.0)\t1*\t\nDiabetes (n, %)\t4 (19.0)\t4 (57.1)\t8 (28.6)\t0.142*\t\nPre-laboratory test (mean±SD, range)\t\t\t\t\t\n HCV RNA (log10 U/L)\t6.1 ± 0.9 (2.8-7.0)\t6.1 ± 0.6 (5.2-6.8)\t6.1 ± 0.0 (2.8-7.0)\t0.841\t\n Hb (g/dL)\t13.5 ± 2.0 (8.6-16.1)\t13.3 ± 2.3 (11.0-16.5)\t13.4 ± 2.0 (8.6-16.5)\t0.853\t\n Platelet (109/L)\t144.1 ± 72.5 (29-284)\t153.4 ± 44.0 (85-214)\t146.5 ± 65.9 (29-284)\t0.754\t\n PT (INR)\t1.14 ± 0.16 (0.9-1.4)\t1.04 ± 0.09 (1.0-1.2)\t1.12 ± 0.03 (0.9-1.4)\t0.195\t\n Albumin (g/dL)\t3.7 ± 0.6 (2.0-4.6)\t3.7 ± 0.4 (3.0-4.2)\t3.7 ± 0.6 (2.0-4.6)\t0.91\t\n ALT (U/L)\t69.2 ± 53.2 (21-250)\t56.4 ± 42.2 (6-134)\t66 ± 50.2 (6-250)\t0.57\t\n AST (U/L)\t62.5 ± 32.8 (25-160)\t47.3 ± 27.2 (13-87)\t58.7 ± 31.7 (13-160)\t0.279\t\n Bilirubin (mg/dL)\t0.8 ± 0.4 (0.3-2.0)\t0.5 ± 0.2 (0.4-0.8)\t0.7 ± 0.4 (0.3-2.0)\t0.029\t\n Creatinine (mg/dL)\t1.2 ± 0.2 (0.9-1.7)\t1.8 ± 0.3 (1.3-2.2)\t1.3 ± 0.4 (0.9-2.2)\t<0.001\t\n CrCl (mL/min/1.73m2)\t55.2 ± 3.7 (47.4-59.9)\t36.6 ± 6.4 (30.0-44.2)\t50.6 ± 9.3 (30.0-59.9)\t<0.001\t\nValues are presented as mean ± SD or n (%) unless otherwise indicated. The body-mass index is the weight in kilograms divided by the square of height in meters.\n\nCKD, chronic kidney disease; CKD 3A, estimated glomerular filtration rate (eGFR) 45–60 mL/min/1.73m2; CKD 3B, eGFR 30-45 mL/min/1.73m2; SOF, sofosbuvir; LDV, ledipasvir; SIM, simeprevir; PEG, pegylated interferon; RBV, ribavirin; SD, standard deviation; HCV, hepatitis C virus; IFN, interferon; Hb, hemoglobin; PT, prothrombin time; INR, international normalized ratio; ALT, alanine transaminase; AST, aspartate transaminase; CrCl, creatinine clearance.\n\n* Fisher’s exact test.\n\nTable 2. SVR12 rates in patients by population subgroup\n\nResponse\tSVR12 rates-no./ total no. (%)\tP-value\t\nChronic kidney disease stage\t\t0.545*\t\n 3A\t17/21 (81.0)\t\t\n 3B\t7/7 (100)\t\t\nTreatment regimen\t\t0.469*\t\n SOF/LDV\t9/11 (81.8)\t\t\n SOF/SIM\t12/13 (92.3)\t\t\n SOF/PEG/RBV\t3/4 (75.0)\t\t\nRapid virological response†\t\t0.166*\t\n RVR (-)\t3/5 (60.0)\t\t\n RVR (+)\t18/20 (90.0)\t\t\nCirrhosis\t\t0.596*\t\n Cirrhosis (-)\t13/14 (92.9)\t\t\n Cirrhosis (+)\t11/14 (78.6)\t\t\nDM\t\t0.555\t\n DM (-)\t18/20 (90.0)\t\t\n DM (+)\t6/8 (75.0)\t\t\nGender\t\t1*\t\n Male\t13/15 (86.7)\t\t\n Femele\t11/13 (84.6)\t\t\nAge\t\t0.116*\t\n <65\t17/18 (94.4)\t\t\n 65\t7/10 (70.0)\t\t\nBMI\t\t1*\t\n <30\t17/20 (85.0)\t\t\n 30\t7/8 (87.5)\t\t\nPretreatment HCV RNA (IU/mL)\t\t1*\t\n <800,000\t6/7 (85.7)\t\t\n ≥800,000\t18/21 (85.7)\t\t\nPrevious treatment\t\t1*\t\n Naïve\t15/17 (88.2)\t\t\n Treatment experienced\t9/11 (81.8)\t\t\nHCV genotype (n, %)\t\t0.116*\t\n 1a\t17/18 (94.4)\t\t\n 1b\t7/10 (70.0)\t\t\nRace (n, %)\t\t1*\t\n Caucasian\t20/24 (83.3)\t\t\n African American\t2/2 (100)\t\t\n Other\t2/2 (100)\t\t\nThe body-mass index is the weight in kilograms divided by the square of height in meters.\n\nSVR12, sustained virological response 12 weeks post treatment; SOF, sofosbuvir; LDV, ledipasvir; SIM, simeprevir; PEG, pegylated interferon; RBV, ribavirin; RVR, rapid virological response; DM, diabetes mellitus; BMI, body mass index; HCV, hepatitis C virus.\n\n* Fisher’s exact test;\n\n† RVR had not been tested in three patients.\n\nTable 3. Adverse events by baseline renal function\n\nAdverse events\tCKD 3A (n=21)\tCKD 3B (n=7)\tAll patients (n=28)\t\nSymptoms\t\t\t\t\n Fatigue\t3\t2\t5\t\n Headache\t2\t1\t3\t\n Abdominal discomfort\t1\t0\t1\t\n Rash\t1\t0\t1\t\n Dizziness\t1\t0\t1\t\n Diarrhea\t1\t0\t1\t\n Nausea\t1\t0\t1\t\n Anxiety\t1\t0\t1\t\n Eye discomfort\t1\t0\t1\t\nBlood tests related\t\t\t\t\n Decreasing Hb level to <10.0 g/dL\t1\t1\t2\t\n Decreasing Hb level to <8.5 g/dL\t2\t0\t2\t\nErythropoietin use during treatment.\t2\t1\t3\t\nTransfusion for anemia\t2\t0\t2\t\nWorsening of renal function\t2\t2\t4\t\nWorsening of renal function was defined as a 30% reduction in eGFR from baseline during treatment.\n\nCKD 3A, estimated glomerular filtration rate (eGFR) 45–60 mL/min/1.73m2; CKD 3B, eGFR 30-45 mL/min/1.73m2; Hb, hemoglobin.\n==== Refs\nREFERENCES\n1 Ghany MG Strader DB Thomas DL Seeff LB American Association for the Study of Liver Diseases Diagnosis, management, and treatment of hepatitis C: an update Hepatology 2009 49 1335 1374 19330875 \n2 Shepard CW Finelli L Alter MJ Global epidemiology of hepatitis C virus infection Lancet Infect Dis 2005 5 558 567 16122679 \n3 Shon HS Choi HY Kim JR Ryu SY Lee YJ Lee MJ Comparison and analysis of the prevalence of hepatitis C virus infection by region in the Republic of Korea during 2005-2012 Clin Mol Hepatol 2015 21 249 256 26526977 \n4 Saxena V Koraishy FM Sise ME Lim JK Schmidt M Chung RT Safety and efficacy of sofosbuvir-containing regimens in hepatitis C-infected patients with impaired renal function Liver Int 2016 36 807 816 26923436 \n5 Park H Adeyemi A Henry L Stepanova M Younossi Z A meta-analytic assessment of the risk of chronic kidney disease in patients with chronic hepatitis C virus infection J Viral Hepat 2015 22 897 905 25904153 \n6 Berenguer M Treatment of chronic hepatitis C in hemodialysis patients Hepatology 2008 48 1690 1699 18972442 \n7 Bunchorntavakul C Maneerattanaporn M Chavalitdhamrong D Management of patients with hepatitis C infection and renal disease World J Hepatol 2015 7 213 225 25729476 \n8 Smolders EJ de Kanter CT van Hoek B Arends JE Drenth JP Burger DM Pharmacokinetics, efficacy, and safety of hepatitis C virus drugs in patients with liver and/or renal impairment Drug Saf 2016 39 589 611 27098247 \n9 Levey AS Bosch JP Lewis JB Greene T Rogers N Roth D A more accurate method to estimate glomerular filtration rate from serum creatinine: a new prediction equation Ann Intern Med 1999 130 461 470 10075613 \n10 Zeuzem S Rodríguez-Torres M Rajender Reddy K Marcellin P Diago M Craxi A Optimized threshold for serum HCV RNA to predict treatment outcomes in hepatitis C patients receiving peginterferon alfa-2a/ribavirin J Viral Hepat 2012 19 766 774 23043383 \n11 Vardeny O Wu DH Desai A Rossignol P Zannad F Pitt B Influence of baseline and worsening renal function on efficacy of spironolactone in patients With severe heart failure: insights from RALES (Randomized Aldactone Evaluation Study) J Am Coll Cardiol 2012 60 2082 2089 23083787 \n12 Cornprost M Denning JM Clemons D Marbury TC Alcorn H Smith WB The effect of renal impairment and end stage renal disease on the single-dose pharmacokinetics of PSI-7977 J Hepatol 2012 56 S433 \n13 Bhamidimarri KR Czul F Peyton A Levy C Hernandez M Jeffers L Safety, efficacy and tolerability of half-dose sofosbuvir plus simeprevir in treatment of Hepatitis C in patients with end stage renal disease J Hepatol 2015 63 763 765 26095179 \n14 Nazario HE Ndungu M Modi AA Sofosbuvir and simeprevir in hepatitis C genotype 1-patients with end-stage renal disease on haemodialysis or GFR < 30 ml/min Liver Int 2016 36 798 801 26583882 \n15 Canonico PG Kastello MD Spears CT Brown JR Jackson EA Jenkins DE Effects of ribavirin on red blood cells Toxicol Appl Pharmacol 1984 74 155 162 6740666\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2287-2728",
"issue": "23(4)",
"journal": "Clinical and molecular hepatology",
"keywords": "Chronic kidney diseases; Hepatitis C; Safety; Sofosbuvir",
"medline_ta": "Clin Mol Hepatol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000998:Antiviral Agents; D004359:Drug Therapy, Combination; D005260:Female; D005838:Genotype; D005919:Glomerular Filtration Rate; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D008297:Male; D008875:Middle Aged; D051436:Renal Insufficiency, Chronic; D012189:Retrospective Studies; D012720:Severity of Illness Index; D000069474:Sofosbuvir; D000072230:Sustained Virologic Response; D016896:Treatment Outcome",
"nlm_unique_id": "101586730",
"other_id": null,
"pages": "316-322",
"pmc": null,
"pmid": "28827512",
"pubdate": "2017-12",
"publication_types": "D016428:Journal Article",
"references": "19330875;26526977;10075613;18972442;23083787;27098247;16122679;23043383;25904153;26095179;25729476;26923436;26583882;6740666",
"title": "Efficacy and safety of sofosbuvir-based regimens for treatment in chronic hepatitis C genotype 1 patients with moderately impaired renal function.",
"title_normalized": "efficacy and safety of sofosbuvir based regimens for treatment in chronic hepatitis c genotype 1 patients with moderately impaired renal function"
} | [
{
"companynumb": "KR-GILEAD-2018-0313984",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "SOFOSBUVIR"
},
"drugadditional": null,
... |
{
"abstract": "Granulomatosis with polyangiitis (GPA) is a systemic necrotizing granulomatosis vasculitis characterized by predilection to affect small- and medium-sized blood vessels and commonly affects the upper and lower respiratory tract and kidneys in most cases. Genital involvement is reported in <1% of cases in large cohorts and nearly all cases have been in the setting of multisystemic disease or during the course of the disease in patients already diagnosed as GPA. A case is presented of uncommon limited urogenital GPA in a 66-year-old woman with an irregular mass occupying urethra and vagina. The patient showed a good response after Corticoids and Methotrexate.",
"affiliations": "Rheumatology Unit, Hospital General de Villarrobledo, Villarrobledo, Albacete, Spain.;Department of Rheumatology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain.;Department of Rheumatology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain.;Department of Rheumatology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain.;Department of Urology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain.",
"authors": "Soro Marín|Sandra|S|0000-0002-8263-0764;Júdez Navarro|Enrique|E|;Sianes Fernández|Manuela|M|;Sánchez Nievas|Ginés|G|;Romero|Juan Gabriel Lorenzo|JG|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2017/9407675",
"fulltext": "\n==== Front\nCase Rep RheumatolCase Rep RheumatolCRIRHCase Reports in Rheumatology2090-68892090-6897Hindawi 10.1155/2017/9407675Case ReportAn Unusual Presentation of Limited Granulomatosis with Polyangiitis Involving Vagina and Urethra http://orcid.org/0000-0002-8263-0764Soro Marín Sandra \n1\n\n*\nJúdez Navarro Enrique \n2\nSianes Fernández Manuela \n2\nSánchez Nievas Ginés \n2\nRomero Juan Gabriel Lorenzo \n3\n1Rheumatology Unit, Hospital General de Villarrobledo, Villarrobledo, Albacete, Spain2Department of Rheumatology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain3Department of Urology, Complejo Hospitalario Universitario de Albacete, Albacete, Spain*Sandra Soro Marín: sandrasoromarin@hotmail.comAcademic Editor: Lars-Peter Erwig\n\n2017 13 3 2017 2017 940767517 11 2016 7 2 2017 Copyright © 2017 Sandra Soro Marín et al.2017This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Granulomatosis with polyangiitis (GPA) is a systemic necrotizing granulomatosis vasculitis characterized by predilection to affect small- and medium-sized blood vessels and commonly affects the upper and lower respiratory tract and kidneys in most cases. Genital involvement is reported in <1% of cases in large cohorts and nearly all cases have been in the setting of multisystemic disease or during the course of the disease in patients already diagnosed as GPA. A case is presented of uncommon limited urogenital GPA in a 66-year-old woman with an irregular mass occupying urethra and vagina. The patient showed a good response after Corticoids and Methotrexate.\n==== Body\n1. Introduction\nGranulomatosis with polyangiitis is a multisystemic vasculitis associated with anti-neutrophil cytoplasmic antibodies (ANCAs) characterized by necrotizing granulomatous inflammation of the upper and lower respiratory tract and kidney. Necrotizing vasculitis affects predominantly small-sized blood vessels [1].\n\nEven though GPA is considered a systemic disease, limited forms may occur without evidence of systemic involvement (no vasculitic features) mainly affecting respiratory tract. Limited urogenital tract form is reported in <1% of cases. Gynaecological involvement is even much more unusual and occurs in a minority of patients. To the best of our knowledge, just one case of limited form with uterine cervix and vagina involvement has been reported in medical literature [2]. The diagnosis of GPA is mainly made by the histological demonstration of vasculitis, necrosis, and granulomatosis inflammation. Immunosuppressive agents, especially Cyclophosphamide, are the cornerstone of the treatment of GPA.\n\nWe report a case of a patient with a rare form of limited GPA affecting the urethra and vagina simultaneously as the first manifestation. Methotrexate was the treatment of choice for this limited GPA with a good response.\n\n2. Case Report\nA 62-year-old woman presented with a 3-month history of vesical tenesmus without dysuria, vaginal bleeding, and low grade fever was referred to gynaecological and urological units. Her past medical history was significant for hypertension, osteoporosis, and B-thalassemia. She underwent hysterectomy and adnexectomy 12 years before due to fibroids. Clinical examination revealed abdominal pain and irregular hardening of anterior vagina encompassing urethra. No disorders involving respiratory tract, cardiovascular system, ear, or eyes were noted. A test of cervical smear and colposcopic evaluation were normal. Vital signs were normal, except temperature 37.5°C. Laboratory test revealed a hemoglobin level of 9,8 g/dL, 13430 leukocytes, and 630000 platelets. Urinalysis and intravenous urography were normal. Ultrasonography, abdomen computed tomography (CT), and pelvic magnetic resonance showed an irregular mass with crenulated margins occupying the urethra and vagina (Figures 1 and 2). Under the presumptive diagnosis of tumor, biopsy was carried with several specimens obtained. The biopsy showed a granulomatous inflammatory reaction, with small- and medium-sized vessels vasculitis and a hemorrhagic and necrotic background and without the characteristic features of caseating necrosis. The diagnosis of limited GPA was considered and patient was referred to Rheumatology Unit.\n\nWe proceeded to extend the study. Chest X-rays were normal and a skin test for tuberculosis was negative. Laboratory test revealed a sedimentation rate of 31 mm/h and C-reactive protein level of 20.7 mg/dL. The serum chemistry was unremarkable with creatinine of 1.0 mg/dL. Tumor markers were all in normal range. Anemia, thrombocytosis, and leukocytosis persisted. Anti-neutrophil cytoplasmic antibodies (c-ANCA) at a titer of 1/80 were noted. Rest of immunological studies was negative.\n\nPrednisone (0,5/mg/kg/day) and oral Methotrexate (10 mg per week) were started with resolution of the mass and the symptoms. Sustained remission was achieved. Two years later, the patient was admitted to hospital for septic shock of urinary tract origin. Methotrexate was suspended and treatment with Prednisone (5 mg per day) was continued. The patient remained well; however two years later she began with a 2-week history of abdominal pain and vaginal bleeding. MRI showed mucosal edema at bladder neck and proximal urethra and persistence of vaginourethral fistula. Laboratory tests including ANCAs were normal. Prednisone dose was increased (0,5/mg/kg/day) and Azathioprine was started but had to be discontinued for hepatotoxicity. At this moment, five years after the onset of the symptoms, patient is in remission under low dose of Prednisone (2,5 mg per day), Methotrexate (7,5 mg per week), and Trimethoprim/Sulfamethoxazole three days per week for recurrent urinary tract infections prophylaxis.\n\n3. Discussion\nGranulomatosis with polyangiitis is an anti-neutrophil cytoplasmic antibodies- (ANCAs-) associated vasculitis characterized by granulomatous and necrotizing inflammation of small- and medium-sized arteries. It is an uncommon disease with a prevalence of approximately 22–157 cases per million and preferentially affects Caucasians in the 6th decade of life [3]. It is characterized by involving preferentially the upper and lower respiratory tract. Urologic and especially gynaecological manifestations of GPA are rare and only have been reported in <1% of cases with evident signs at this level [2, 4]. Information is derived from case reports and 3 small series [5–7]. In GPA, urogenital symptoms are mainly observed as part of generalized systemic disease. The diagnosis of limited urogenital GPA is uncommon [7].\n\nLaboratory findings include elevated acute phase reactants, leukocytosis, thrombocytosis, and normocytic normochromic anemia. ANCAs are present in 75–87.5% of cases, of these 90% are directed against proteinase 3 (PR3) being highly specific for GPA. The remaining are against myeloperoxidase (MPO) [5–7]. Urogenital disease is an unusual presenting feature of GPA occurring in 12–18% of patients [5, 6]. Most of these patients will develop systemic disease at some time during the course of the illness and only few cases will remain as urogenital limited GPA. The case presented did not developed systemic manifestations and the main symptom was urogenital. Recurrences are observed in 36–50% of patients with urological manifestations [5–7]. Furthermore, some cases are asymptomatic or with mild manifestations because genital examination is not a routine in the GPA management [8].\n\nTo The best of our knowledge there are 19 published cases of GPA presenting as an inflammatory lesion involving urogenital tract which are discovered in imaging studies and are described like pseudotumors [2, 9–13].\n\nThe most common urogenital manifestations are prostatitis (the urological manifestation with the highest number of reported cases, approximately 40), penile necrosis (20 cases reported) [7], orchitis (12.5–36% GPA patients with urogenital disease), ureter involvement (20 reports), renal masses (18 cases), urethritis (8 cases), and epididymitis (4 patients) [3]. Vagina or cervix is very rarely affected (1 case) [2].\n\nThere are no controlled studies about the therapeutic approach of urogenital GPA. Therefore, general GPA treatment can be applied to the urogenital involvement. Treatment will depend on the severity of the symptoms [14]. In the extensive disease, Glucocorticoids, Cyclophosphamide, or Rituximab will be considered. Methotrexate or Azathioprine is valid options in limited disease [15]. Most patients have an excellent response with immunosuppressive therapy. Surgical treatment is reserved for temporary measure to relief obstructive symptoms.\n\n4. Conclusion\nWe describe a rare case of GPA with isolated urogenital involvement as the only manifestation, without systemic symptoms, where diagnosis was provided by a mass biopsy and supported by analytical findings. We would like to stress on the importance of a genital examination in patients with systemic illness. Immunosuppressive drugs should be used as first-line therapy to avoid unnecessary surgery and prevent recurrences.\n\nConflicts of Interest\nThe authors declare that they have no conflicts of interest.\n\nFigure 1 Coronal plane pelvic MRI showed an irregular mass with crenulated margins occupying the urethra and vagina.\n\nFigure 2 Axial plane pelvic MRI showed an irregular mass with crenulated margins occupying the urethra and vagina.\n==== Refs\n1 Jennette J. C. Falk R. J. Bacon P. A. 2012 Revised International Chapel Hill consensus conference nomenclature of vasculitides Arthritis and Rheumatism 2013 65 1 1 11 10.1002/art.37715 2-s2.0-84871251698 23045170 \n2 Bastone P. Squifflet J. L. Marbaix E. Houssiau F. Successful treatment of gynaecological involvement of granulomatosis with polyangiitis (Wegener's granulomatosis) by rituximab Clinical and Experimental Rheumatology 2015 33 2, supplement 89 S-142 S-144 \n3 Alba M. A. Moreno-Palacios J. Beça S. Cid M. C. Urologic and male genital manifestations of granulomatosis with polyangiitis Autoimmunity Reviews 2015 14 10 897 902 10.1016/j.autrev.2015.05.012 2-s2.0-84940615095 26028174 \n4 Comarmond C. Cacoub P. Granulomatosis with polyangiitis (Wegener): clinical aspects and treatment Autoimmunity Reviews 2014 13 11 1121 1125 10.1016/j.autrev.2014.08.017 2-s2.0-84908543178 25149391 \n5 Dufour J.-F. Le Gallou T. Cordier J.-F. Urogenital manifestations in Wegener granulomatosis: a study of 11 cases and review of the literature Medicine 2012 91 2 67 74 10.1097/md.0b013e318239add6 2-s2.0-84857824162 22391468 \n6 Huong D. L. T. Papo T. Piette J.-C. Urogenital manifestations of wegener granulomatosis Medicine (United States) 1995 74 3 152 161 2-s2.0-0029018330 \n7 Davenport A. Downey S. E. Goel S. MacIvert A. G. Wegener's granulomatosis involving the urogenital tract British Journal of Urology 1996 78 3 354 357 10.1046/j.1464-410X.1996.00166.x 2-s2.0-0030430114 8881941 \n8 Agraharkar M. Gokhale S. Gupta R. Wegener's granulomatosis diagnosed by testicular biopsy International Urology and Nephrology 2002 34 4 559 564 10.1023/A:1025642217482 2-s2.0-0141990809 14577505 \n9 Ward A. Konya C. Mark E. J. Rosen S. Granulomatosis with polyangiitis presenting as a renal tumor American Journal of Surgical Pathology 2014 38 10 1444 1448 10.1097/PAS.0000000000000294 2-s2.0-84908540173 25025447 \n10 Roussou M. Dimopoulos S. K. Dimopoulos M. A. Anastasiou-Nana M. I. Wegener’s Granulomatosis Presenting as a Renal Mass Urology 2008 71 3 547.e1 547.e2 10.1016/j.urology.2007.11.046 \n11 Ruiz Carazo E. Medina Benitez A. López Milena G. Rabaza Espigares J. León L. Marquez B. Multiple renal masses as initial manifestation of Wegener's granulomatosis American Journal of Roentgenology 2001 176 1 116 118 10.2214/ajr.176.1.1760116 2-s2.0-0035184237 11133548 \n12 Villa-Forte A. Hoffman G. S. Wegener's granulomatosis presenting with a renal mass Journal of Rheumatology 1999 26 2 457 458 2-s2.0-0032954848 9972987 \n13 Smith D. J. Milroy C. M. Chapple C. R. An unusual renal mass? Wegener's granulomatosis British Journal of Urology 1993 72 980 981 8306175 \n14 Duna G. F. Galperin C. Hoffman G. S. Wegener's granulomatosis Rheumatic Disease Clinics of North America 1995 21 4 949 986 2-s2.0-0029563702 8592744 \n15 De Groot K. Rasmussen N. Bacon P. A. Randomized trial of cyclophosphamide versus methotrexate for induction of remission in early systemic antineutrophil cytoplasmic antibody-associated vasculitis Arthritis and Rheumatism 2005 52 8 2461 2469 10.1002/art.21142 2-s2.0-23644455521 16052573\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6897",
"issue": "2017()",
"journal": "Case reports in rheumatology",
"keywords": null,
"medline_ta": "Case Rep Rheumatol",
"mesh_terms": null,
"nlm_unique_id": "101585353",
"other_id": null,
"pages": "9407675",
"pmc": null,
"pmid": "28386506",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": "18342212;26028174;7760722;8306175;11133548;23045170;22391468;16052573;9972987;25025447;25149391;8592744;26016766;14577505;8881941",
"title": "An Unusual Presentation of Limited Granulomatosis with Polyangiitis Involving Vagina and Urethra.",
"title_normalized": "an unusual presentation of limited granulomatosis with polyangiitis involving vagina and urethra"
} | [
{
"companynumb": "ES-ACCORD-050595",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": "1",
"dru... |
{
"abstract": "Lafora disease (LD) is a rare, lethal, progressive myoclonus epilepsy for which no targeted therapy is currently available. Studies on a mouse model of LD showed a good response to metformin, a drug with a well known neuroprotective effect. For this reason, in 2016, the European Medicines Agency granted orphan designation to metformin for the treatment of LD. However, no clinical data is available thus far.\n\n\n\nWe retrospectively collected data on LD patients treated with metformin referred to three Italian epilepsy centres.\n\n\n\nTwelve patients with genetically confirmed LD (6 EPM2A, 6 NHLRC1) at middle/late stages of disease were treated with add-on metformin for a mean period of 18 months (range: 6-36). Metformin was titrated to a mean maintenance dose of 1167 mg/day (range: 500-2000 mg). In four patients dosing was limited by gastrointestinal side-effects. No serious adverse events occurred. Three patients had a clinical response, which was temporary in two, characterized by a reduction of seizure frequency and global clinical improvement.\n\n\n\nMetformin was overall safe in our small cohort of LD patients. Even though the clinical outcome was poor, this may be related to the advanced stage of disease in our cases and we cannot exclude a role of metformin in slowing down LD progression. Therefore, on the grounds of the preclinical data, we believe that treatment with metformin may be attempted as early as possible in the course of LD.",
"affiliations": "IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy. francesca.bisulli@unibo.it.;Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna, Italy.;Epilepsy Centre, Clinic of Nervous System Diseases, University of Foggia, Ospedali Riuniti, Foggia, Italy.;Department of Neurophysiology and Diagnostic Epileptology, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy.;Pediatric Neurology, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy.;IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy.;IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy.;IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy.;Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna, Italy.;Epilepsy Centre, Clinic of Nervous System Diseases, University of Foggia, Ospedali Riuniti, Foggia, Italy.;Epilepsy Centre, Clinic of Nervous System Diseases, University of Foggia, Ospedali Riuniti, Foggia, Italy.;IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy.;IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy.",
"authors": "Bisulli|Francesca|F|0000-0002-1109-7296;Muccioli|Lorenzo|L|;d'Orsi|Giuseppe|G|;Canafoglia|Laura|L|;Freri|Elena|E|;Licchetta|Laura|L|;Mostacci|Barbara|B|;Riguzzi|Patrizia|P|;Pondrelli|Federica|F|;Avolio|Carlo|C|;Martino|Tommaso|T|;Michelucci|Roberto|R|;Tinuper|Paolo|P|",
"chemical_list": "D008687:Metformin; C478960:NHLRC1 protein, human; D044767:Ubiquitin-Protein Ligases; D054558:Protein Tyrosine Phosphatases, Non-Receptor; C114990:EPM2A protein, human",
"country": "England",
"delete": false,
"doi": "10.1186/s13023-019-1132-3",
"fulltext": "\n==== Front\nOrphanet J Rare DisOrphanet J Rare DisOrphanet Journal of Rare Diseases1750-1172BioMed Central London 113210.1186/s13023-019-1132-3Letter to the EditorTreatment with metformin in twelve patients with Lafora disease http://orcid.org/0000-0002-1109-7296Bisulli Francesca +39-051-4966937francesca.bisulli@unibo.it 12Muccioli Lorenzo 2d’Orsi Giuseppe 3Canafoglia Laura 4Freri Elena 5Licchetta Laura 12Mostacci Barbara 1Riguzzi Patrizia 1Pondrelli Federica 2Avolio Carlo 3Martino Tommaso 3Michelucci Roberto 1Tinuper Paolo 121 0000 0004 1784 5501grid.414405.0IRCCS Istituto delle Scienze Neurologiche di Bologna, Ospedale Bellaria, Bologna, Italy 2 0000 0004 1757 1758grid.6292.fDepartment of Biomedical and Neuromotor Sciences, University of Bologna, Bologna, Italy 3 0000000121049995grid.10796.39Epilepsy Centre, Clinic of Nervous System Diseases, University of Foggia, Ospedali Riuniti, Foggia, Italy 4 0000 0001 0707 5492grid.417894.7Department of Neurophysiology and Diagnostic Epileptology, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 5 0000 0001 0707 5492grid.417894.7Pediatric Neurology, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 21 6 2019 21 6 2019 2019 14 14911 4 2019 12 6 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nLafora disease (LD) is a rare, lethal, progressive myoclonus epilepsy for which no targeted therapy is currently available. Studies on a mouse model of LD showed a good response to metformin, a drug with a well known neuroprotective effect. For this reason, in 2016, the European Medicines Agency granted orphan designation to metformin for the treatment of LD. However, no clinical data is available thus far.\n\nMethods\nWe retrospectively collected data on LD patients treated with metformin referred to three Italian epilepsy centres.\n\nResults\nTwelve patients with genetically confirmed LD (6 EPM2A, 6 NHLRC1) at middle/late stages of disease were treated with add-on metformin for a mean period of 18 months (range: 6–36). Metformin was titrated to a mean maintenance dose of 1167 mg/day (range: 500–2000 mg). In four patients dosing was limited by gastrointestinal side-effects. No serious adverse events occurred. Three patients had a clinical response, which was temporary in two, characterized by a reduction of seizure frequency and global clinical improvement.\n\nConclusions\nMetformin was overall safe in our small cohort of LD patients. Even though the clinical outcome was poor, this may be related to the advanced stage of disease in our cases and we cannot exclude a role of metformin in slowing down LD progression. Therefore, on the grounds of the preclinical data, we believe that treatment with metformin may be attempted as early as possible in the course of LD.\n\nKeywords\nMetforminLafora diseaseProgressive myoclonus epilepsyEPM2AEPM2BNHLRC1issue-copyright-statement© The Author(s) 2019\n==== Body\nIntroduction\nLafora disease (LD) is a lethal, autosomal recessive, progressive myoclonus epilepsy. LD is caused by mutations in EPM2A or NHLRC1, encoding laforin and malin, respectively. With loss of function of either, structurally abnormal glycogen becomes insoluble and accumulates as Lafora bodies, responsible for disease progression [1]. Disruptions in cell homeostasis such as proteasomal dysfunction, oxidative stress, autophagy impairment, and mitochondrial dysfunction, also play a role in the pathophysiology of LD [2]. Symptoms typically begin in adolescence, and death commonly occurs within 10 years of onset. Antiepileptic drugs (AED) are partially effective on myoclonus and seizures but don’t have a major influence on the progression of cognitive and behavioural symptoms [3]. Despite the presence of new promising treatment strategies, no targeted therapy for LD in humans is currently available [3]. Metformin is an activator of AMP-induced kinase (AMPK) and is the most commonly prescribed drug for type 2 diabetes mellitus [4, 5]. AMPK is a key cellular energy sensor that, once activated by falling energy status, responds by activating catabolic pathways and inhibiting anabolic ones, such as glycogen synthesis [6]. Interestingly, the reduction of brain glycogen synthesis is one of the most promising therapeutic avenues for LD [3]. Moreover, through the activation of AMPK, metformin promotes autophagy and can also prevent brain mitochondrial dysfunction, decrease oxidative stress, and inhibit apoptotic cascade by preventing the permeability transition pore opening [7–11]. Through these and possibly other mechanisms, metformin acts as a neuroprotective agent in different neurodegenerative diseases [11–14]. It was also shown to facilitate seizure termination in mice [15]. A mouse model of LD treated with metformin showed amelioration of neuropathological symptoms, reduced seizure susceptibility and decreased accumulation of Lafora bodies [16, 17]. In 2016, the European Medicines Agency granted orphan designation to metformin for the treatment of LD (decision number EU/3/16/1803). However, no clinical data on treatment with metformin in LD is available thus far [3], also because of its extreme rarity. Here, we present a case series of LD patients treated with metformin.\n\nMethods\nWe collected data from three Italian epilepsy centres in which treatment with add-on metformin was proposed to all referred patients with genetically confirmed LD, irrespective of the stage of disease progression. Liver and kidney dysfunction, which may predispose to the development of lactic acidosis in diabetic patients treated with metformin, were excluded by standard laboratory testing in all patients. The stage of disease progression was assessed using a disability scale based on the residual motor and mental functions, daily living and social abilities [18]. Metformin was titrated to an individual target dose starting from 500 mg/die, depending on tolerability and clinical response. The latter was assessed considering the frequency of generalized tonic-clonic seizures, myoclonus severity, as well as the clinical, patient, and caregiver global impression.\n\nPatients were evaluated at least at monthly frequency, either on an outpatient basis, during hospitalisation, or using telephone interviews with caregivers and home-made videos. If patients were hospitalised in institutes other than the three participating centres, data on their clinical status were obtained through the referring clinicians.\n\nResults\nStudy population and treatment details\nTwelve consecutive Italian patients with genetically confirmed LD were screened for contraindications and were consequently treated with add-on metformin. The first patient commenced treatment in February 2016. Last follow-up visit was in March 2019. Two cases were previously reported [19]. Clinical features of the subjects and treatment details are summarized in Table 1.Table 1 Clinical features and treatment details\n\nClinical Features\tPre-Treatment Assessment\tMetformin Treatment\t\nPt\tAge (y), Sex\tOnset age (y)\tMutationa\tDisease duration (y)\tConcomitant AEDs\tNo. GTCS (last 28 days)\tMyoclonusb\tDisability scalec\tMaximal dose (mg), adjusted dose (mg)\tOutcome\tDuration (months)\tAdverse events\t\n1\t17d, F\t13\tEPM2A: c.491 T > G (p.Ile164Ser), c.539 T > C (p.Leu180Pro)\t4\tVPA, ZNS, PB\t0e\t+++\t4\t3000, 1500\tMild improvement (see text)\t6\tDiarrhoea\t\n2\t21, M\t16\tNHRLC1: c.436G > A (p.Asp146Asn), c.1133 T > C (p.Leu378Pro)\t4\tVPA, LEV, PERf, CNZ, CLB\t18\t+\t3\t2000, 1000\tSeizure-freedom, improved cognition, lasted for 6 months\t9\tDiarrhoea\t\n3g\t25, F\t13\tEPM2A: c.243_246del (p.Asp82Argfs*7)\t10\tVPA, LEV, ZNS, PB, CNZ\t3\t+++\t4\t500, 500\tDisease progression\t12h\tNone\t\n4g\t19, F\t10\tNHLRC1: c.205C > G (p.Pro69Ala); c.826_829dup (p.Ala277Aspfs*23)\t7\tVPA, LEV, ZNS, CNZ\t6\t+++\t4\t1000, 500\tDisease progression\t24\tAsthenia\t\n5\t17,F\t13\tNHLRC1: c.205C > G (p.Pro69Ala)\t3\tVPA, LEV, PER, CNZ\t8\t+++\t4\t2000, 2000\tDisease progression\t13\tNone\t\n6\t23, M\t14\tEPM2A: c.721C > T (p.Arg241*)\t7\tLEV, TPM, ZNS\t7\t+++\t4\t2000, 2000\tDisease progression\t9h\tElevated CPK, muscle cramps\t\n7\t23, M\t10\tEPM2A: c.721C > T (p.Arg241*)\t11\tVPA, PB, PHT, PER, CNZ\t11\t+++\t3\t2000, 2000\tDisease progression\t28\tNone\t\n8\t18, M\t14\tNHLRC1: c.992del (p.Gly331Glufs*3)\t2\tVPA, LEV, PER\t2\t++\t2\t1700, 500\tDisease progression\t26\tDiarrhoea\t\n9\t22, F\t13\tNHLRC1: c.992del (p.Gly331Glufs*3)\t7\tVPA, ZNS, PER\t3\t+++\t4\t1700, 500\tDisease progression\t26\tDiarrhoea\t\n10\t50, F\t18\tEPM2A: c.721C > T (p.Arg241*), c.835G > A (p.Gly279Ser)\t29\tVPA, LEV, ZNS, CNZ\t1\t+++\t4\t1000, 1000\tMild improvement (see text)\t36\tNone\t\n11\t19, F\t11\tEPM2A: c.323G > T (p.Arg108Leu)\t7\tVPA, PB, PER, CNZ\t0.5\t+++\t4\t1000, 1000\tDisease progression\t12\tNone\t\n12\t18, M\t13\tNHLRC1: c.436G > A (p.Asp146Asn), c.1133 T > C (p.Leu378Pro)\t4\tVPA, LEV, ZNS, PB\t3\t++\t3\t1500, 1500\tDisease progression\t12\tNone\t\nLegend: AED antiepileptic drug, CLB clobazam, CNZ clonazepam, GTCS generalized tonic-clonic seizures, LD Lafora disease, LEV levetiracetam, PB phenobarbital, PER perampanel, PHT phenytoin, TPM topiramate, VPA valproate, ZNS zonisamide\n\naWhen only one variant is indicated, this is intended as homozygous. EPM2A RefSeq ID: NM_005670.4; NHLRC1 RefSeq: NM_198586.2\n\nbMyoclonus severity: +, mild myoclonus, i.e. does not interfere with activities of daily living; ++, moderate myoclonus, i.e. interferes with activities of daily living but not with deambulation; +++, severe myoclonus, i.e. interferes with deambulation\n\ncDisability scale developed by Franceschetti et al. [18]: 1, mild cognitive and motor impairment, preserved daily living activities, and social interaction; 2, moderate mental decline, limitations in motor activities and limited social interaction; 3, severe mental and motor impairment, needing help in walking and regular assistance in daily activity, and poor social interaction; 4, patient weelchair-bound or bedridden, and no significant daily living activities or social interaction\n\nddeceased\n\nethe patient did not present any GTCS but had 4 prolonged myoclonic seizures in 28 days requiring benzodiazepine rescue medications\n\nfperampanel was introduced at the same time as metformin\n\ngpreviously published in Ref. [19]\n\nhsuspended\n\n\n\nOf the 12 patients, 7 were female. Mean age at disease onset was 13 years. Metformin was introduced at middle/late stages of disease, after a mean of 8 years from onset. Treatment duration ranged from 6 to 36 months (mean = 18 months). Metformin was titrated to an individual target dose depending on tolerability and clinical response, up to 3000 mg/day. The mean maintenance dose was 1167 mg/day (range: 500-2000 mg).\n\nClinical outcome\nIn 9 out of 12 patients, metformin did not produce any relevant clinical benefit. In the remainder, we observed a clinical improvement. When metformin was introduced, patient 1 was staying in a long-term care facility in a vegetative state, had subcontinuous myoclonic jerks, no spontaneous motor activity and weekly generalized myoclonic seizures, lasting more than 5 min if not treated with benzodiazepines. During the 6 months of metformine therapy, the patient showed reduction of myoclonic seizures frequency with consequent reduction of benzodiazepine rescue medications, as well as the appearance of eye response to vocal stimuli. A further clinical deterioration followed, and the patient died of tracheostomy-related late bleeding. Patient 2 had a transitory clinical response, lasted approximately 6 months, characterized by improvement in behaviour and cognition and seizure-freedom. However, perampanel (up to 6 mg/day) was introduced at the same time as metformin because of the rapidly progressing clinical deterioration, and may therefore be responsible for the clinical improvement. Patient 10 had a long disease progression and at time of metformin introduction was bedridden, severely cognitively impaired, had subcontinous myoclonic jerks and approximately one generalized tonic clonic seizure (GTCS) per month. Treatment resulted in a reduction of myoclonus intensity, freedom from GTCS and an improved responsiveness, maintained for the 36 months of follow-up, during which concomitant AED regimen was not modified.\n\nAdverse events\nAdverse events (AEs) were reported in six patients. The most common was diarrhoea (n = 4), which subsided in all patients after dose adjustment. Patient 4 reported asthenia with metformin at 1000 mg, not clearly related to treatment. Patient 6 had muscle cramps and elevated CPK, resolved after discontinuation. Patient 3 was given a maximal dose of 500 mg because pre-treatment basal glycaemia was at the lower normal limit. In this case, metformin was suspended after 12 months because there was no clinical benefit. No serious AEs were reported in any patient.\n\nDiscussion\nSafety and tolerability\nTo the best of our knowledge, this is the first documentation of metformin use in humans with LD. None of our patients experienced serious AEs. In one case, reversible side effects brought to discontinuation. Gastrointestinal side effects are a well known metformin AE, are usually transient and subside once the dose is adjusted or when administered with meals [4]. Therefore, metformin was overall well tolerated and safe in our small cohort of LD subjects.\n\nEfficacy and study limitations\nOf twelve treated patients, three had a clinical response, which was temporary in two. However, it was difficult to assess the role played by metformin in patient 2, who was simultaneously started on perampanel. Even though the disease eventually progressed in all treated patients but one with end-stage disease, we cannot exclude that metformin may have the potential to slow down LD progression, as no prospective study on LD natural history is available for comparison. The considerable mean delay of 8 years between disease onset and metformin introduction may be a potential reason for its apparent low efficacy. It is likely that the mechanisms by which metformin may ameliorate disease course in LD, i.e. inhibition of glycogen synthesis, autophagy promotion, reduction of oxidative stress, maintenance of mitochondrial capacities, and inhibition of apoptosis, might be more incisive if treatment is commenced soon after disease onset. Theoretically, the neuroprotective action of metformin would be even more pronounced if treatment is started in the pre-symptomatic phase in genetically diagnosed siblings of LD patients, in whom neuronal degeneration has not been established yet. Indeed, in the pre-clinical studies in which the efficacy of metformin treatment in a mouse model of LD was established, the drug was administered when the mice were 3 months old, at the beginning of their neurological impairment [16, 17].\n\nWe acknowledge the methodological limitations of our study, which was retrospective, not randomized, not controlled, and involved a small number of subjects. These limitations are, however, intrinsically related to the rarity of LD, to the lack of effective alternative therapies and to the overall safety of metformin, which brought us to offer this opportunity to all eligible patients.\n\nConclusions\nMetformin was overall safe in our small cohort of LD patients at middle/late stages of disease. Even though the clinical outcome was poor, this may be related to the relatively advanced stage of disease in our cohort and we cannot exclude a role of metformin in slowing down LD progression. Therefore, on the grounds of the preclinical data, we believe that treatment with metformin may be attempted as early as possible in the course of LD. Efficacy of metformin in LD should be further evaluated in randomized controlled trials involving larger cohorts of patients.\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nFrancesca Bisulli and Lorenzo Muccioli contributed equally to this work.\n\nWe would like to thank Dr. Jose Serratosa and Dr. Antonio Delgado-Escueta for their precious suggestion to use metformin in patients with Lafora disease. We are also grateful to Mr. Alberto Gubellini and Mrs. Stefania Gamberini for secretarial help.\n\nAuthors’ contributions\nFB: conception of the work; acquisition, analysis and interpretation of data; substantively revised the work. LM: conception of the work; acquisition, analysis and interpretation of data; drafted the work. GdO: conception of the work; acquisition, analysis and interpretation of data. LC: conception of the work; acquisition, analysis and interpretation of data. EF: conception of the work; acquisition, analysis and interpretation of data. LL: acquisition, analysis and interpretation of data. BM: acquisition, analysis and interpretation of data. PR: acquisition and analysis of data. FP: acquisition and analysis of data. CA: acquisition and analysis of data. TM: acquisition and analysis of data. RM: conception of the work; acquisition, analysis and interpretation of data. PT: conception of the work; acquisition, analysis and interpretation of data; substantively revised the work. All authors read and approved the final manuscript.\n\nFunding\nThe authors received no specific funding for this work.\n\nAvailability of data and materials\nThe datasets during and/or analysed during the current study are available from the corresponding author on reasonable request.\n\nEthics approval and consent to participate\nEtichal Committee Approval 375/2018/OSS/AUSLBO.\n\nConsent for publication\nConsent was obtained using institutional consent forms.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Sullivan Mitchell Nitschke Silvia Steup Martin Minassian Berge Nitschke Felix Pathogenesis of Lafora Disease: Transition of Soluble Glycogen to Insoluble Polyglucosan International Journal of Molecular Sciences 2017 18 8 1743 10.3390/ijms18081743 \n2. Romá-Mateo C Aguado C García-Giménez JL Oxidative stress, a new hallmark in the pathophysiology of Lafora progressive myoclonus epilepsy Free Radic Biol Med 2015 88 30 41 10.1016/j.freeradbiomed.2015.01.034 25680286 \n3. Nitschke F Ahonen SJ Nitschke S Mitra S Minassian BA Lafora disease – from pathogenesis to treatment strategies Nat Rev Neurol 2018 14 606 617 10.1038/s41582-018-0057-0 30143794 \n4. Rojas LB Gomes MB Metformin: an old but still the best treatment for type 2 diabetes Diabetol Metab Syndr 2013 5 6 10.1186/1758-5996-5-6 23415113 \n5. Zhou G Myers R Li Y Role of AMP-activated protein kinase in mechanism of metformin action J Clin Invest 2001 108 1167 1174 10.1172/JCI13505 11602624 \n6. Hardie DG Rosso FA Hawley SA AMPK: a nutrient and energy sensor that maintains energy homeostasis Nat Rev Mol Cell Biol 2012 13 251 262 10.1038/nrm3311 22436748 \n7. Alzoubi KH Khabour OF Al-Azzam SI Tashtoush MH Mhaidat NM Metformin eased cognitive impairment induced by chronic l-methionine administration: potential role of oxidative stress Curr Neuropharmacol 2014 12 186 192 10.2174/1570159X11666131120223201 24669211 \n8. El-Mir MY Detaille D R-Villanueva G Neuroprotective role of antidiabetic drug metformin against apoptotic cell death in primary cortical neurons J Mol Neurosci 2008 34 77 87 10.1007/s12031-007-9002-1 18040888 \n9. Pintana H Apaijai N Pratchayasakul W Chattipakorn N Chattipakorn SC Effects of metformin on learning and memory behaviors and brain mitochondrial functions in high fat diet induced insulin resistant rats Biochem Biophys Res Commun 2014 448 414 417 10.1016/j.bbrc.2014.04.130 24802403 \n10. Poels J Spasić MR Callaerts P Norga KK Expanding roles for AMP-activated protein kinase in neuronal survival and autophagy Bioessays 2009 31 944 952 10.1002/bies.200900003 19644919 \n11. Wang C Liu C Gao K Metformin preconditioning provide neuroprotection through enhancement of autophagy and suppression of inflammation and apoptosis after spinal cord injury Biochem Biophys Res Commun 2016 477 534 540 10.1016/j.bbrc.2016.05.148 27246734 \n12. Ashabi G Khodagholi F Khalaj L Goudarzvand M Nasiri M Activation of AMP-activated protein kinase by metformin protects against global cerebral ischemia in male rats: interference of AMPK/PGC-1alpha pathway Metab Brain Dis 2014 29 47 58 10.1007/s11011-013-9475-2 24435937 \n13. Dulovic M Jovanovic M Xilouri M The protective role of AMP-activated protein kinase in alpha-synuclein neurotoxicity in vitro Neurobiol Dis 2014 63 1 11 10.1016/j.nbd.2013.11.002 24269733 \n14. Rotermund C Machetanz G Fitzgerald JC The therapeutic potential of metformin in neurodegenerative diseases Front Endocrinol 2018 9 400 10.3389/fendo.2018.00400 \n15. Yang Y Zhu B Zheng F Chronic metformin treatment facilitates seizure termination Biochem Biophys Res Commun 2017 484 450 455 10.1016/j.bbrc.2017.01.157 28137587 \n16. Berthier A Payá M Garcia-Cabrero AM Pharmacological interventions to ameliorate neuropathological symptoms in a mouse model of Lafora disease Mol Neurobiol 2016 53 1296 1309 10.1007/s12035-015-9091-8 25627694 \n17. Sánchez-Elexpuru G Serratosa JM Sanz P Sánchez MP 4-Phenylbutyric acid and metformin decrease sensitivity to pentylenetetrazol-induced seizures in a Malin knockout model of Lafora disease Neuroreport 2017 28 268 271 10.1097/WNR.0000000000000751 28181916 \n18. Franceschetti S Gambardella A Canafoglia L Clinical and genetic findings in 26 italian patients with Lafora disease Epilepsia 2006 47 640 643 10.1111/j.1528-1167.2006.00479.x 16529633 \n19. Ferlazzo E Canafoglia L Michelucci R Mild Lafora disease: clinical, neurophysiologic, and genetic findings Epilepsia 2014 55 e129 e133 10.1111/epi.12806 25270369\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1750-1172",
"issue": "14(1)",
"journal": "Orphanet journal of rare diseases",
"keywords": "EPM2A; EPM2B; Lafora disease; Metformin; NHLRC1; Progressive myoclonus epilepsy",
"medline_ta": "Orphanet J Rare Dis",
"mesh_terms": "D000293:Adolescent; D000818:Animals; D004195:Disease Models, Animal; D005260:Female; D006801:Humans; D020192:Lafora Disease; D008297:Male; D008687:Metformin; D009154:Mutation; D020191:Myoclonic Epilepsies, Progressive; D054558:Protein Tyrosine Phosphatases, Non-Receptor; D012189:Retrospective Studies; D044767:Ubiquitin-Protein Ligases",
"nlm_unique_id": "101266602",
"other_id": null,
"pages": "149",
"pmc": null,
"pmid": "31227012",
"pubdate": "2019-06-21",
"publication_types": "D016422:Letter",
"references": "24435937;18040888;28800070;16529633;25680286;27246734;22436748;28137587;25270369;24669211;24269733;19644919;22925597;11602624;28181916;25627694;30072954;30143794;23415113",
"title": "Treatment with metformin in twelve patients with Lafora disease.",
"title_normalized": "treatment with metformin in twelve patients with lafora disease"
} | [
{
"companynumb": "IT-SUN PHARMACEUTICAL INDUSTRIES LTD-2019RR-217593",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PERAMPANEL"
},
"dru... |
{
"abstract": "BACKGROUND\nThe aim was to report the occurrence of after application of olanzapine long-acting injection (OLAI) in patients with schizophrenia during one year period.\n\n\nMETHODS\nDuring one year period, OLAI was applied to 30 patients with schizophrenia (18 men, 12 women) who were non-adherent to previous treatment with oral olanzapine. Patients were 20-58 years of age (39 years old on average), diagnosed with SCID based on DSM-IV-TR criteria. Patients received OLAI in dosage between 210-405 mg (287±62 (mean ± SD)) every 2-4 weeks.\n\n\nRESULTS\nOut of 30 patients that received OLAI, 29 patients improved significantly without side-effects, and one patient developed post-injection delirium/sedation syndrome (PDSS). The patient's somatic condition stabilized and treatment with OLAI was discontinued due to the PDSS.\n\n\nCONCLUSIONS\nThe occurrence of PDSS is not common and when it occurs, in our experience, it was reversible.",
"affiliations": "University Psychiatric Hospital Vrapče, Bolnička cesta 32, HR-10090 Zagreb, Croatia, suzana.uzun@bolnica-vrapce.hr.",
"authors": "Uzun|Suzana|S|;Kozumplik|Oliver|O|;Ćelić|Ivan|I|;Pivac|Nela|N|;Mimica|Ninoslav|N|",
"chemical_list": "D003692:Delayed-Action Preparations; D001569:Benzodiazepines; D000077152:Olanzapine",
"country": "Croatia",
"delete": false,
"doi": "10.24869/psyd.2017.497",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0353-5053",
"issue": "29(4)",
"journal": "Psychiatria Danubina",
"keywords": null,
"medline_ta": "Psychiatr Danub",
"mesh_terms": "D000328:Adult; D001143:Arousal; D001569:Benzodiazepines; D003244:Consciousness Disorders; D003692:Delayed-Action Preparations; D003693:Delirium; D005260:Female; D006801:Humans; D007273:Injections, Intramuscular; D008297:Male; D008875:Middle Aged; D000077152:Olanzapine; D012559:Schizophrenia; D012565:Schizophrenic Psychology; D013577:Syndrome; D055815:Young Adult",
"nlm_unique_id": "9424753",
"other_id": null,
"pages": "497-499",
"pmc": null,
"pmid": "29197208",
"pubdate": "2017-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Occurrence of post-injection delirium/sedation syndrome after application of olanzapine long-acting injection during one year period.",
"title_normalized": "occurrence of post injection delirium sedation syndrome after application of olanzapine long acting injection during one year period"
} | [
{
"companynumb": "HR-CIPLA LTD.-2017HR30485",
"fulfillexpeditecriteria": "1",
"occurcountry": "HR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OLANZAPINE"
},
"drugadditional": "1",
... |
{
"abstract": "Seventeen patients who had cutaneous complications following pentazocine injections are presented. The mean age was 50 years; total daily pentazocine dose ranged from 60 to 2,400 mg; evidence of psychiatric illness was present in 94%, and previous drug or alcohol abuse was noted in 65%. Fifty-three percent of our series of patients had a medical or paramedical background. Eighteen percent had diabetes mellitus, and 65% had a personal or family history (or both) of diabetes. A hypothesis is presented for this association. Characteristic histologic findings included fibrosis of the dermis and panniculus, with vascular alterations, fat necrosis with granulomatous inflammation, and vascular thrombosis with occasional endarteritis. We emphasize that medical and paramedical personnel and patients with a personal or family history of diabetes should be added to the group of patients considered to be at special risk for cutaneous complications of pentazocine injections.",
"affiliations": null,
"authors": "Palestine|R F|RF|;Millns|J L|JL|;Spigel|G T|GT|;Schroeter|A L|AL|",
"chemical_list": "D010423:Pentazocine",
"country": "United States",
"delete": false,
"doi": "10.1016/s0190-9622(80)80292-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0190-9622",
"issue": "2(1)",
"journal": "Journal of the American Academy of Dermatology",
"keywords": null,
"medline_ta": "J Am Acad Dermatol",
"mesh_terms": "D000328:Adult; D006801:Humans; D008297:Male; D001523:Mental Disorders; D008875:Middle Aged; D010423:Pentazocine; D010859:Pigmentation Disorders; D012598:Sclerosis; D012867:Skin; D012883:Skin Ulcer; D019966:Substance-Related Disorders",
"nlm_unique_id": "7907132",
"other_id": null,
"pages": "47-55",
"pmc": null,
"pmid": "7354151",
"pubdate": "1980-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Skin manifestations of pentazocine abuse.",
"title_normalized": "skin manifestations of pentazocine abuse"
} | [
{
"companynumb": "US-PFIZER INC-2016528842",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PENTAZOCINE LACTATE"
},
"drugadditional": "3",... |
{
"abstract": "BACKGROUND\nThe detection of severe acute respiratory syndrome coronavirus (SARS-CoV-2) is challenging, particularly in post-mortem human tissues. However, there is increasing evidence for viral SARS-CoV-2 manifestation in non-respiratory tissues. In this context, it is a current matter of debate, whether SARS-CoV-2 shows hepatotropism.\n\n\nMETHODS\nHere, we report a case of an 88-year-old women with massive SARS-CoV-2 viremia, severe jaundice and clinical signs of an acute hepatitis, who died within a few days from an acute liver failure without showing any clinical signs of pneumonia. Autopsy revealed a severe chronic and acute liver damage with bile duct infestation by SARS-CoV-2 that was accompanied by higher expressions of angiotensin-converting enzyme-2 (ACE2), Cathepsin L and transmembrane serine protease 2 (TMPRSS2).\n\n\nCONCLUSIONS\nOur findings indicate an enhanced biliary susceptibility to viral infection with SARS-CoV-2, that might have resulted from pre-existing severe liver damage. Furthermore, our findings emphasize the differential diagnosis of coronavirus disease 2019 (COVID-19)-associated liver failure in the clinical setting of an inexplicable jaundice.",
"affiliations": "Institute of Pathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany. jana.ihlow@charite.de.;Department of Gastroenterology, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Spandau, Neue Bergstraße 6, 13585, Berlin, Germany.;Institute of Virology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany.;Institute of Veterinary Pathology, Freie Universität Berlin, Robert-von-Ostertag-Straße 15, 14163, Berlin, Germany.;Institute of Veterinary Pathology, Freie Universität Berlin, Robert-von-Ostertag-Straße 15, 14163, Berlin, Germany.;Institute of Neuropathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany.;Institute of Neuropathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany.;Department of Hematology, Oncology and Palliative Care, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Spandau, Neue Bergstraße 6, 13585, Berlin, Germany.;Institute of Pathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany.;Institute of Pathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117, Berlin, Germany.;Department of Pathology, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Neukölln, Rudower Straße 48, 12351, Berlin, Germany.",
"authors": "Ihlow|Jana|J|http://orcid.org/0000-0001-5484-1321;Seelhoff|Alexander|A|;Corman|Victor M|VM|;Gruber|Achim D|AD|;Dökel|Simon|S|;Meinhardt|Jenny|J|;Radbruch|Helena|H|;Späth-Schwalbe|Ernst|E|;Elezkurtaj|Sefer|S|;Horst|David|D|;Herbst|Hermann|H|",
"chemical_list": "D007703:Peptidyl-Dipeptidase A",
"country": "England",
"delete": false,
"doi": "10.1186/s12879-021-06605-7",
"fulltext": "\n==== Front\nBMC Infect Dis\nBMC Infect Dis\nBMC Infectious Diseases\n1471-2334\nBioMed Central London\n\n6605\n10.1186/s12879-021-06605-7\nCase Report\nCOVID-19: a fatal case of acute liver failure associated with SARS-CoV-2 infection in pre-existing liver cirrhosis\nhttp://orcid.org/0000-0001-5484-1321\nIhlow Jana jana.ihlow@charite.de\n\n1\nSeelhoff Alexander 2\nCorman Victor M. 3\nGruber Achim D. 4\nDökel Simon 4\nMeinhardt Jenny 5\nRadbruch Helena 5\nSpäth-Schwalbe Ernst 6\nElezkurtaj Sefer 1\nHorst David 1\nHerbst Hermann 7\n1 grid.6363.0 0000 0001 2218 4662 Institute of Pathology, Charité–Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117 Berlin, Germany\n2 Department of Gastroenterology, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Spandau, Neue Bergstraße 6, 13585 Berlin, Germany\n3 grid.6363.0 0000 0001 2218 4662 Institute of Virology, Charité–Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117 Berlin, Germany\n4 grid.14095.39 0000 0000 9116 4836 Institute of Veterinary Pathology, Freie Universität Berlin, Robert-von-Ostertag-Straße 15, 14163 Berlin, Germany\n5 grid.6363.0 0000 0001 2218 4662 Institute of Neuropathology, Charité–Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Charitéplatz 1, 10117 Berlin, Germany\n6 Department of Hematology, Oncology and Palliative Care, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Spandau, Neue Bergstraße 6, 13585 Berlin, Germany\n7 Department of Pathology, Vivantes Netzwerk für Gesundheit GmbH Berlin, Vivantes Hospital Neukölln, Rudower Straße 48, 12351 Berlin, Germany\n3 9 2021\n3 9 2021\n2021\n21 90120 6 2021\n23 8 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nThe detection of severe acute respiratory syndrome coronavirus (SARS-CoV-2) is challenging, particularly in post-mortem human tissues. However, there is increasing evidence for viral SARS-CoV-2 manifestation in non-respiratory tissues. In this context, it is a current matter of debate, whether SARS-CoV-2 shows hepatotropism.\n\nCase presentation\n\nHere, we report a case of an 88-year-old women with massive SARS-CoV-2 viremia, severe jaundice and clinical signs of an acute hepatitis, who died within a few days from an acute liver failure without showing any clinical signs of pneumonia. Autopsy revealed a severe chronic and acute liver damage with bile duct infestation by SARS-CoV-2 that was accompanied by higher expressions of angiotensin-converting enzyme-2 (ACE2), Cathepsin L and transmembrane serine protease 2 (TMPRSS2).\n\nConclusion\n\nOur findings indicate an enhanced biliary susceptibility to viral infection with SARS-CoV-2, that might have resulted from pre-existing severe liver damage. Furthermore, our findings emphasize the differential diagnosis of coronavirus disease 2019 (COVID-19)-associated liver failure in the clinical setting of an inexplicable jaundice.\n\nKeywords\n\nCOVID-19\nSARS-CoV-2\nBile duct\nHepatitis\nCase report\nCharité - Universitätsmedizin Berlin (3093)Open Access funding enabled and organized by Projekt DEAL.\n\nissue-copyright-statement© The Author(s) 2021\n==== Body\npmcBackground\n\nOver the past year, there have been numerous reports and extensive discussions about the impact of pre-existing health conditions on the clinical course and the severity of COVID-19 [1]. In this context, it is a matter of debate, which cell types except respiratory epithelial cells become infected by SARS-CoV-2 [2] and how this may contribute to the clinical presentation of the disease. Recently, it has been shown that SARS-CoV-2 may be associated with gastrointestinal disorders such as gastroenteritis and hepatitis [3, 4]. However, the evidence on whether SARS-CoV-2 may directly infect, and damage gastrointestinal tissues is scarce [5–7] and should be interpreted with caution. In post-mortem assessment of COVID-19 tissue, the localization of the virus can be hampered by autolysis, enzymatic activity, and pre-existing organ damage. Thus, COVID-19 autopsy results should consequently be interpreted with regard to these limitations which is highlighted by the following case.\n\nCase presentation\n\nJaundice as initial symptom of severe COVID-19\n\nHere, we report a case of 88-year-old women who presented with pronounced jaundice and nausea at a care home, 46 days after initial hospital discharge from surgical treatment for an incarcerated femoral hernia with ileus and wound dehiscence. From the medical record, arterial hypertension (treated with Ramipril 5 mg daily), chronic gastritis (treated with Omeprazole 20 mg daily), chronic renal insufficiency (treated with Torasemid 5 mg daily) and a healed pneumonia that had taken place 1 year prior to the events were known as further conditions. During her temporary stay at the care home (Fig. 1) the patient developed a severe jaundice with pale stools. Of note, two other patients were reportedly positive for SARS-CoV-2 infection at the care home.Fig. 1 Timeline of events from onset of symptoms to death\n\nDue to the rapid deterioration of her jaundice, the patient was re-admitted to the hospital (Vivantes Hospital Spandau, Berlin), where she presented with an unspecific indolent abdominal pressure pain and inactive peristalsis during the physical examination. There were no signs of hepatic encephalopathy or ascites. Neither fever nor respiratory symptoms were present, and the initial SARS-CoV-2 PCR test from a pharyngeal swab was negative. Also, antibodies for SARS-CoV-2 infection were negative in the peripheral blood. However, a second swab, conducted three days later, revealed a positive result. Also, PCR from stool was positive for SARS-CoV-2 RNA. Sampling of the peripheral blood showed a leucocytosis of 15.3/nl and signs of acute inflammation, reflected by a CRP value of 14.5 mg/l, a ferritin level of 7797 µg/l and an interleukin-6 level of 71 ng/l. Furthermore, parameters for cholestasis were excessively elevated above normal levels with a gamma-GT of 397 U/l, an alkaline phosphatase of 269 U/l, and a direct hyperbilirubinemia (direct bilirubin 24.2 mg/dl, indirect bilirubin of 4.5 mg/dl, ratio 5.4). Furthermore, urea levels of up to 78 mg/dl, an LDH level of 253 U/l, an ALT level of 1,632 U/l, an AST level of 1690 U/l and a high De Ritis ratio of 1.03 reflected a severe liver damage. In addition, parameters of liver function such as coagulation or albumin-synthesis were severely affected with an aPTT of 36.9 s, an INR of 2.12, a quick level (thromboplastin time) of 31% and an albumin level of 29.4 g/l.The GLDH level was 10 U/l, and the ALT + AST /GLDH ratio was 332.2, suggesting a cholestatic genesis. Consecutively, hepatitis A, B, C and E, cytomegaly virus (CMV) associated hepatitis, sclerosing cholangitis (p-ANCA 0.9 U/ml, c-ANCA 2.2. U/ml), primary biliary cirrhosis (ANA negative, AMA IFT 1:320, AMA M2 negative) and autoimmune hepatitis (LKM negative, SMA negative, IgG4 0.197 g/l, IgG 13.44 g/l) were excluded as causes of liver damage. Subsequently, x-ray and CT scans revealed a relapse of the abdominal hernia with a cecal prolapse and a thickening of the intestinal wall. Furthermore, a small scar with pronounced vascular markings was visible in the left lower pulmonary lobe without evidence for pneumonia. The liver, pancreas and spleen presented normal; however, the intrahepatic bile ducts showed a mild dilatation with a diameter of 9 mm in the common bile duct. Abdominal ultrasound and endosonography revealed a thickening of the intra- and extrahepatic bile duct walls and the gall bladder wall without signs of biliary obstruction. Upon the assumption of a COVID-19 related hepatitis, liver biopsy and convalescent plasma therapy were planned but could not be conducted since the patient’s health condition deteriorated rapidly. Therefore, she could only be treated with best supportive care which included treatment with L-Ornithine L-Aspartate, Simethicon, Prednisolone, Morphine, antibiotics (Rifaximine, Piperacillin/Tazobactam) and anticoagulative medication (Enoxaparine, Heparin). 12 days after the hospital re-admission, the patient died from acute liver failure. During the entire course of her stay, she had not developed any clinical signs of pneumonia.\n\nAutopsy and post-mortem diagnostics uncover bile duct infection by SARS-CoV-2\n\nA full body autopsy was performed within 36 h after death, in line with the safety guidelines recommended by the Center for Disease Control and Prevention (CDC) and local ethical guidelines (EA 1/144/13 and EA2/066/20). The macroscopic assessment revealed a subtotal liver dystrophy as immediate cause of death. Furthermore, we found foci which were suspicious of pneumonia in both lower lobes of the lung.\n\nNative and formaldehyde-fixed paraffin embedded (FFPE) tissue samples were collected from each organ for the assessment of virus burden and histopathology, respectively. Sections of FFPE-tissues were generally stained with hematoxylin–eosin (HE). Additionally, the liver tissue was stained with Periodic-acid Schiff (PAS) reaction as well as Gomori, chromotrope aniline blue and Fouchet stains. Furthermore, we performed immunohistochemical stainings with antibodies for Myeloperoxidase (Dako, polyclonal), CD68 (Dako, #PG-M1), CD20 (Dako, #L26), CD3 (Dako, polyclonal), CD4 (Leica, #4B12), CD8 (Dako, #C8/144B), MUM1 (Zytomed, #MUM1p), ACE 2 (Proteintech, polyclonal), Cathepsin B (Abcam, #ab109131), Cathepsin L (Ptglab, #10938-1-AP) and TMPRSS2(Abcam, #ab109131). Additionally, SARS-CoV-2 in-situ hybridization (ISH) was performed using the ViewRNA™ ISH Tissue Assay Kit (Invitrogen by Thermo Fisher Scientific, Darmstadt, Germany) following the manufacturer’s instructions with minor adjustments. For post-mortem viral SARS-CoV-2 PCR, 50 mg of fresh-frozen samples were acquired (Fig. 2A) and homogenized. Subsequently RNA was purified, using the MagNA Pure 96 system and the MagNA Pure 96 DNA and Viral NA Large Volume Kit (Roche) following the manufacturer’s instructions. RNA extracts were used for quantitative real-time PCR targeting the SARS-CoV-2 E-gene. Viral RNA was quantified by photometrically quantified in vitro RNA transcripts. Total DNA was measured in all extracts using the Qubit dsDNA HS Assay kit (Thermo Fisher Scientific).Fig. 2 Autopsy results. A SARS-CoV-2 RNA copies in each organ system measured as log10 /10.000 cells. B–D Histopathology of the lung: areas of pneumonic congestion without any further destruction of the lung parenchyma (B PAS reaction, C, D H&E stain). E–G: SARS-CoV-2 in-situ-hybridization of the lung: specific reaction in pulmonary macrophages (E) and pneumocytes (F, G). H–J Histopathology of the liver: subtotal liver cirrhosis with moderate portal inflammatory infiltrates and proliferating bile ducts (H, arrow), areas of acute liver cell necrosis (I, asterisk) and cholestasis (J, arrow). K–M Immunohistochemistry of the liver: strong reactivity of bile duct epithelium for antibodies against ACE2 (K), Cathepsin L (L) and TMPRSS2 (M). N–P SARS-CoV-2 in-situ-hybridization of the liver: strong cytoplasmatic signals in the bile duct epithelium (arrows)\n\nHistopathology revealed acute liver cell necrosis with canalicular cholestasis but also a subtotal porto-portal liver cirrhosis with reactive ductular proliferation (Fig. 2H–J) accompanied by a moderate T-cell rich portal inflammatory infiltrate that was partially spreading to the hepatic interface and mainly consisting of CD8 + cytotoxic T-cells (CD8/CD4 ratio 2:1). T-cells accounted for 60% of the infiltrate. In contrast to the controls, the remaining infiltrate was enriched for macrophages (20%), granulocytes (15%) and composed of a small amount of B- and plasma cells (< 3%). Immunohistochemical staining for ACE2, TMPRSS2 and Cathepsin L showed strong membranous signals in the intrahepatic bile duct epithelium (Fig. 2K–M), especially in comparison to the hepatic control tissue. Cathepsin L was strongly expressed in the cytoplasm and on cell membranes of the bile duct epithelium and the hepatocytes both in the patient’s liver and the cirrhotic control but not in the control containing healthy liver tissue. Using SARS-CoV-2 ISH, we found strong signals within the bile duct epithelium , less the possibility of co-existing enzymatic activity (Fig. 2N–P). In contrast, SARS-CoV-2 RNA could not be detected in hepatocytes via ISH. Additionally, post-mortem SARS-CoV-2 PCR confirmed excessive viral RNA load in all tissues with maximum values in the liver, the gallbladder, the gut and the lung. Viral log10-SARS-CoV-2 RNA copies are shown in Fig. 2 A. Interestingly, the autopsy also revealed bilateral disseminated foci of pneumonia in the lung and both pneumocytes and alveolar macrophages showed strong signals in the SARS-CoV-2 ISH (Fig. 2), indicating the simultaneous presence of an unrecognized COVID-19 pneumonia despite the lack of clinical symptoms. However, there was no evidence of a diffuse alveolar damage.\n\nDiscussion and conclusions\n\nBy revealing liver failure as a foremost symptom of an infection with SARS-CoV-2 even in the clinical absence of pneumonia, this case does not only add further information to the varying clinical presentations of COVID-19 but also underlines the challenge of SARS-CoV-2 localization that complicates COVID-19 post-mortem diagnostics.\n\nOur autopsy results indicate that the 88-year-old woman who presented with inexplicable jaundice was suffering from a previously unknown severe chronic liver damage that was rapidly aggravated by cholestasis following SARS-CoV-2 viremia in the bile ducts, suggesting the clinical picture of a cholestatic subtype of viral hepatitis. However, a direct cause-effect relationship cannot be proven, since the patient also received medication that may have caused hepatotoxicity (such as Piperacilin/Tazobactam or Enoxaparine) and may have accelerated the hepatic decompensation. Moreover, autolysis or enzymatic activity within the bile duct epithelium might have influenced our results. On the assumption, that the combined sensitivity of in-situ-hybridization, immunohistochemistry and SARS-CoV-2 PCR is sufficient, our findings suggest that pre-existing liver damage might have led to a higher susceptibility to SARS-CoV-2 in the bile duct epithelium due to stronger expressions of ACE2, TMPRSS2 and particularly Cathepsin L which has been shown to accelerate cleavage induction and endocytosis of the virus [4]. This theory is supported by similar results found organoids in vitro and via RNA single cell sequencing of hepatic tissue in vivo [8, 9]. Recent studies have also shown that human cholangiocytes are amongst the highest expressors of ACE 2 [10] and that an inflammatory microenvironment, which was obviously present in the previously damaged liver of our patient and potentially triggered by the preceding abdominal conditions, enhances the co-expression of both ACE 2 and TMPRSS2 on hepatocytes and cholangiocytes [4, 11]. Apart from a higher SARS-CoV-2 infection susceptibility in previously damaged tissues, recent studies also promote the theory of an indirect SARS-CoV-2-related end organ damage by activation of the inflammasome [12, 13]. In our patient, this is supported by the enrichment of macrophages, neutrophils, and tissue cytotoxic T-lymphocytes in the inflammatory portal infiltrate. In addition, there is evidence on the hepatotropic potential of SARS-CoV-2 irrespective of previous cell damage [5, 7]. On the contrary, especially electron microscopic evidence should be interpreted with some caution, since cell specific structures that are needed for the procedure are easily damaged by autolysis [14, 15] and diverging results were detected by others with RNA single cell sequencing [16]. Since ISH is more robust (and more likely available in routine diagnostics), we do believe, that our findings are an important and necessary confirmation and addition to the current literature, because they strongly consolidate the theory, that SARS-CoV-2 might infest the biliary epithelium. Since we observed a strong ISH reactivity for SARS-CoV-2 in pulmonary macrophages and high SARS-CoV-2 RNA-values in all mucosal tissues, the possibility of a retrograde bile duct infection cannot be precluded although a direct infection due to higher susceptibility resulting from pre-existing liver damage is far more likely.\n\nThus, the presented case fuels the general debate on cellular SARS-CoV-2 reservoirs and future studies that implement co-staining and electron microscopy will be necessary to determine the potential direct impact of SARS-CoV-2 on hepatocytes and bile duct epithelium.\n\nAbbreviations\n\nACE2 Angiotensin-converting enzyme-2\n\nALT Alanine aminotransferase\n\nANA Antinuclear antibodies\n\nANCA (c, p) Anti neutrophil cytoplasmatic antibodies (c = cytoplasmatic, p = perinuclear)\n\naPTT Activated partial thromboplastin time\n\nAST Aspartate aminotransferase\n\nCDC Center for disease control and prevention\n\nCMV Cytomegaly virus\n\nCOVID-19 Coronavirus Disease 2019\n\nCRP C-reactive protein\n\nCT Computed tomography\n\nDNA Deoxyribonucleic acid\n\nFFPE Formaldehyde-fixed paraffin embedded\n\nGamma-GT Gamma-glutamyltransferase\n\nGFR Glomerular filtration rate\n\nGLDH Glutamate dehydrogenase\n\nHE Hematoxylin–eosin\n\nIFT Immunofluorescence technique\n\nIgG Immune globuline G\n\nINR International normalized ratio\n\nISH In-situ hybridization\n\nLDH Lactate dehydrogenase\n\nLKM Liver kidney microsomal antibodies\n\nRNA Ribonucleic acid\n\nPAS Periodic-acid Schiff\n\nPCR Polymerase chain reaction\n\nSARS-CoV-2 Severe acute respiratory syndrome coronavirus 2\n\nSMA Smooth muscle actin antibodies\n\nTMPRSS2 Transmembrane serine protease 2\n\nAcknowledgements\n\nWe acknowledge Jay Knox and Anna Xylander for their excellent technical support during the autopsy procedure.\n\nAuthors’ contributions\n\nJI, AS, ADG and HH designed the study. HH, ADG, SE and DH supervised the study. JI, AS, VMC, ADG, SD, JM, HR, ES, SE, DH and HH performed necessary clinical and diagnostic workup required for this study. JI, AS, ADG and HH collected, analyzed, and interpreted the data. JI, ADG and HH wrote the manuscript draft. All authors critically revised the manuscript. All authors read and approved the final manuscript.\n\nFunding\n\nOpen Access funding enabled and organized by Projekt DEAL. We acknowledge support from the German Research Foundation (DFG) and the Open Access Publication Fund of Charité–Universitätsmedizin Berlin.\n\nAvailability of data and materials\n\nMaterials are available from the corresponding author upon reasonable request. However, patient-related data are not available publicly due to ethical restrictions.\n\nDeclarations\n\nEthics approval and consent to participate\n\nThis study was in line with local ethical guidelines (EA 1/144/13 and EA2/066/20) and the Declaration of Helsinki. Written consent was obtained from next of kin.\n\nConsent for publication\n\nWritten consent was obtained from next of kin.\n\nCompeting interests\n\nAll authors declare that there is no competing interest with regard to this work.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nJana Ihlow, Alexander Seelhoff, Victor M. Corman, Achim D. Gruber, Simon Dökel, Jenny Meinhardt, Helena Radbruch, Ernst Späth-Schwalbe, Sefer Elezkurtaj, David Horst and Hermann Herbst contributed equally to this study\n==== Refs\nReferences\n\n1. Ng WH Tipih T Makoah NA Vermeulen J-G Goedhals D Sempa JB Comorbidities in SARS-CoV-2 Patients: a systematic review and meta-analysis MBio 2021 12 1 e03647 e3720 10.1128/mBio.03647-20 33563817\n2. Li S, Jiang L, Li X, Lin F, Wang Y, Li B, et al. Clinical and pathological investigation of patients with severe COVID-19. JCI insight. 2020;5(12).\n3. Lagana SM Kudose S Iuga AC Lee MJ Fazlollahi L Remotti HE Hepatic pathology in patients dying of COVID-19: a series of 40 cases including clinical, histologic, and virologic data Mod Pathol 2020 33 11 2147 2155 10.1038/s41379-020-00649-x 32792598\n4. Nardo AD Schneeweiss-Gleixner M Bakail M Dixon ED Lax SF Trauner M Pathophysiological mechanisms of liver injury in COVID-19 Liver Intern 2021 41 1 20 32 10.1111/liv.14730\n5. Wang Y Liu S Liu H Li W Lin F Jiang L SARS-CoV-2 infection of the liver directly contributes to hepatic impairment in patients with COVID-19 J Hepatol 2020 73 4 807 816 10.1016/j.jhep.2020.05.002 32437830\n6. Livanos AE Jha D Cossarini F Gonzalez-Reiche AS Tokuyama M Aydillo T Intestinal host response to SARS-CoV-2 infection and COVID-19 outcomes in patients with gastrointestinal symptoms Gastroenterol 2021 160 7 2435 2450 10.1053/j.gastro.2021.02.056\n7. Pirisi M Rigamonti C D'Alfonso S Nebuloni M Fanni D Gerosa C Liver infection and COVID-19: the electron microscopy proof and revision of the literature Eur Rev Med Pharmacol Sci 2021 25 4 2146 2151 33660834\n8. Qi F Qian S Zhang S Zhang Z Single cell RNA sequencing of 13 human tissues identify cell types and receptors of human coronaviruses Biochem Biophys Res Commun 2020 526 1 135 140 10.1016/j.bbrc.2020.03.044 32199615\n9. Zhao B Ni C Gao R Wang Y Yang L Wei J Recapitulation of SARS-CoV-2 infection and cholangiocyte damage with human liver ductal organoids Protein Cell 2020 11 10 771 775 10.1007/s13238-020-00718-6 32303993\n10. Aizarani N Saviano A Sagar Mailly L Durand S Herman JS A human liver cell atlas reveals heterogeneity and epithelial progenitors Nature 2019 572 7768 199 204 10.1038/s41586-019-1373-2 31292543\n11. Lizardo-Thiebaud MJ Cervantes-Alvarez E Limon-de la Rosa N Tejeda-Dominguez F Palacios-Jimenez M Méndez-Guerrero O Direct or collateral liver damage in SARS-CoV-2-infected patients Semin Liver Dis 2020 40 3 321 330 10.1055/s-0040-1715108 32886936\n12. Rodrigues TS de Sá KSG Ishimoto AY Becerra A Oliveira S Almeida L Inflammasomes are activated in response to SARS-CoV-2 infection and are associated with COVID-19 severity in patients J Exp Med 2021 218 3 e20201707 10.1084/jem.20201707 33231615\n13. Ferreira AC Soares VC de Azevedo-Quintanilha IG Dias SdSG Fintelman-Rodrigues N Sacramento CQ SARS-CoV-2 engages inflammasome and pyroptosis in human primary monocytes Cell Death Discov. 2021 7 1 43 10.1038/s41420-021-00428-w 33649297\n14. Dittmayer C Meinhardt J Radbruch H Radke J Heppner BI Heppner FL Why misinterpretation of electron micrographs in SARS-CoV-2-infected tissue goes viral Lancet 2020 396 10260 e64 e65 10.1016/S0140-6736(20)32079-1 33031763\n15. Bangash MN Patel JM Parekh D Murphy N Brown RM Elsharkawy AM SARS-CoV-2: is the liver merely a bystander to severe disease? J Hepatol 2020 73 4 995 996 10.1016/j.jhep.2020.05.035 32502510\n16. De Smet V Verhulst S van Grunsven LA Single cell RNA sequencing analysis did not predict hepatocyte infection by SARS-CoV-2 J Hepatol 2020 73 4 993 995 10.1016/j.jhep.2020.05.030 32473193\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2334",
"issue": "21(1)",
"journal": "BMC infectious diseases",
"keywords": "Bile duct; COVID-19; Case report; Hepatitis; SARS-CoV-2",
"medline_ta": "BMC Infect Dis",
"mesh_terms": "D000369:Aged, 80 and over; D000086382:COVID-19; D005260:Female; D006801:Humans; D008103:Liver Cirrhosis; D017114:Liver Failure, Acute; D007703:Peptidyl-Dipeptidase A; D000086402:SARS-CoV-2",
"nlm_unique_id": "100968551",
"other_id": null,
"pages": "901",
"pmc": null,
"pmid": "34479499",
"pubdate": "2021-09-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "32437830;32792598;32473193;32502510;33231615;33676971;32427582;33190346;33031763;32199615;33563817;33649297;32886936;33660834;31292543;32303993",
"title": "COVID-19: a fatal case of acute liver failure associated with SARS-CoV-2 infection in pre-existing liver cirrhosis.",
"title_normalized": "covid 19 a fatal case of acute liver failure associated with sars cov 2 infection in pre existing liver cirrhosis"
} | [
{
"companynumb": "DE-TEVA-2021-DE-1970182",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PIPERACILLIN SODIUM\\TAZOBACTAM SODIUM"
},
"dru... |
{
"abstract": "The absence of blisters, the presence of mild systemic symptoms, and the patient's age guided the diagnosis.",
"affiliations": "North Colorado Family Medicine Residency Program, Greeley (Dr. Cook); Delta Health Family Medicine, CO (Dr. Angles); Family Physicians of Greeley, CO (Dr. Morley).;North Colorado Family Medicine Residency Program, Greeley (Dr. Cook); Delta Health Family Medicine, CO (Dr. Angles); Family Physicians of Greeley, CO (Dr. Morley).;North Colorado Family Medicine Residency Program, Greeley (Dr. Cook); Delta Health Family Medicine, CO (Dr. Angles); Family Physicians of Greeley, CO (Dr. Morley).;University of Texas Health, San Antonio.",
"authors": "Cook|Jeffrey S|JS|;Angles|Amber|A|;Morley|Erin|E|;Usatine|Richard P|RP|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12788/jfp.0264",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0094-3509",
"issue": "70(7)",
"journal": "The Journal of family practice",
"keywords": null,
"medline_ta": "J Fam Pract",
"mesh_terms": null,
"nlm_unique_id": "7502590",
"other_id": null,
"pages": "353-355",
"pmc": null,
"pmid": "34818169",
"pubdate": "2021-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Urticaria and edema in a 2-year-old boy.",
"title_normalized": "urticaria and edema in a 2 year old boy"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2022SP000825",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AMOXICILLIN"
},
"drugadditiona... |
{
"abstract": "OBJECTIVE\nTo report a case of deferoxamine-induced maculopathy and present the use of multimodal retinal imaging to study this disease entity.\n\n\nMETHODS\nThis is an observational case report of one patient. Multimodal imaging with fundus autofluorescence, infrared imaging, and spectral domain optical coherence tomography was used to investigate the macular changes induced by deferoxamine toxicity.\n\n\nRESULTS\nA 53-year-old man with history of β-thalassemia presented with decreased vision in both eyes 1 month after initiating deferoxamine therapy. Infrared imaging showed areas of increased stippled infrared intensity through the macula. Fundus autofluorescence revealed diffuse areas of stippled hyperautofluorescence and hypoautofluorescence. Spectral domain optical coherence tomography changes included disruption of the ellipsoid zone, attenuation of the photoreceptors, and deposits within the retinal pigment epithelium.\n\n\nCONCLUSIONS\nA case of deferoxamine-induced maculopathy was described and the use of multimodal retinal imaging to study this disease entity was presented.",
"affiliations": "*Department of Ophthalmology, University of Southern California, Los Angeles, California; †Edward S. Harkness Eye Institute, College of Physicians and Surgeons, Columbia University, New York, New York; ‡Deparment of Pathology and Cell Biology, College of Physicians and Surgeons, Columbia University, New York, New York; §Department of Ophthalmology, Weill Cornell Medical College, New York, New York; and ¶Barbara and Donald Jonas Laboratory of Stem Cell and Regenerative Medicine, College of Physicians and Surgeons, Columbia University, New York, New York.",
"authors": "Gelman|Rony|R|;Kiss|Szilard|S|;Tsang|Stephen H|SH|",
"chemical_list": "D007502:Iron Chelating Agents; D017262:Siderophores; D003676:Deferoxamine",
"country": "United States",
"delete": false,
"doi": "10.1097/ICB.0000000000000059",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1935-1089",
"issue": "8(4)",
"journal": "Retinal cases & brief reports",
"keywords": null,
"medline_ta": "Retin Cases Brief Rep",
"mesh_terms": "D003676:Deferoxamine; D006801:Humans; D007502:Iron Chelating Agents; D008297:Male; D008875:Middle Aged; D012164:Retinal Diseases; D017262:Siderophores; D014786:Vision Disorders; D017086:beta-Thalassemia",
"nlm_unique_id": "101298744",
"other_id": null,
"pages": "306-9",
"pmc": null,
"pmid": "25372534",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D064888:Observational Study; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": "15187676;7042160;11772599;3964637;12756028;20532952",
"title": "Multimodal imaging in a case of deferoxamine-induced maculopathy.",
"title_normalized": "multimodal imaging in a case of deferoxamine induced maculopathy"
} | [
{
"companynumb": "US-TEVA-559380USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "DEFEROXAMINE\\DEFEROXAMINE MESYLATE"
},
"drugaddition... |
{
"abstract": "OBJECTIVE\nTo study infectious complications in renal transplant recipients receiving mycophenolate mofetil (MMF) for prevention of acute transplant rejection or treatment of chronic allograft nephropathy (CAN).\n\n\nMETHODS\nA group of renal transplant recipients (n=47) receiving 1.0-2.0 g/day MMF with cyclosporine A (CsA) and steroids as maintaining immunosuppression was compared to a group (n=47) taking triple immunosuppressive therapy which included azathioprine (Aza). Separate group of patients (n=9) received MMF for treatment of CAN. In all groups etiology and incidence of infections were evaluated.\n\n\nRESULTS\nDuring 2 years various posttransplant infections developed in 72.3% patients on MMF and 93.6% on Aza. The incidence of viral infections was 53.2% in MMF and 59.6% in Aza group, the incidence of bacterial infection--55.3 and 70.2%, respectively. Among 9 recipients with CAN the infections occurred in five. There were two cases of active tuberculosis in Aza group, one--in MMF group and one in patients with CAN.\n\n\nCONCLUSIONS\nWe suggest that MMF in the dose 1-2 g/day does not increase infection rates in renal transplant recipients comparing Aza.",
"affiliations": null,
"authors": "Prokopenko|E I|EI|;Shcherbakova|E O|EO|;Vatazin|A V|AV|;Kruglov|E E|EE|;Pasov|S A|SA|;Budnikova|N E|NE|;Agafonova|S G|SG|;Rusanova|E V|EV|",
"chemical_list": "D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid",
"country": "Russia (Federation)",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0040-3660",
"issue": "77(1)",
"journal": "Terapevticheskii arkhiv",
"keywords": null,
"medline_ta": "Ter Arkh",
"mesh_terms": "D000208:Acute Disease; D006084:Graft Rejection; D006801:Humans; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D015994:Incidence; D016030:Kidney Transplantation; D008875:Middle Aged; D009173:Mycophenolic Acid; D009894:Opportunistic Infections; D012189:Retrospective Studies; D012307:Risk Factors; D014184:Transplantation, Homologous",
"nlm_unique_id": "2984818R",
"other_id": null,
"pages": "67-72",
"pmc": null,
"pmid": "15759459",
"pubdate": "2005",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Infectious complications in using mofetil micofenolate in patients with renal allotransplant.",
"title_normalized": "infectious complications in using mofetil micofenolate in patients with renal allotransplant"
} | [
{
"companynumb": "RU-ROCHE-1950179",
"fulfillexpeditecriteria": "1",
"occurcountry": "RU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOSPORINE"
},
"drugadditional": "3",
"dru... |
{
"abstract": "BACKGROUND\nApproximately 30% of children with medulloblastoma (MB) experience recurrence, which is usually incurable. This study compared the overall survival (OS) of patients receiving temozolomide (TMZ) and irinotecan with that of patients receiving TMZ, irinotecan, and bevacizumab for recurrent MB/central nervous system (CNS) primitive neuroectodermal tumor (PNET).\n\n\nMETHODS\nPatients with relapsed/refractory MB or CNS PNET were randomly assigned to receive TMZ (150 mg/m2 /day PO on days 1-5) and irinotecan (50 mg/m2 /day IV on days 1-5) with or without bevacizumab (10 mg/kg IV on days 1 and 15).\n\n\nRESULTS\nOne hundred five patients were eligible and treated on study. Median OS was 13 months in the standard arm and 19 months with the addition of bevacizumab; median event-free survival (EFS) was 6 months in the standard arm and 9 months with the addition of bevacizumab. The hazard ratio for death from the stratified relative-risk regression model is 0.63. Overall, 23 patients completed 12 courses of planned protocol therapy, 23% (12/52) in the experimental arm with bevacizumab versus 21% (11/53) in the standard arm. Toxicity profiles were comparable in both treatment arms. The estimate of the incidence of feasibility events associated with the bevacizumab arm is three of 52 (5.8%) (95% CI 1.2-16%). Events included myelosuppression, electrolyte abnormalities, diarrhea, and elevated transaminases. One intracranial hemorrhage event was observed in each arm.\n\n\nCONCLUSIONS\nThe addition of bevacizumab to TMZ/irinotecan significantly reduced the risk of death in children with recurrent MB. The combination was relatively well tolerated in this heavily pretreated cohort. The three-drug regimen demonstrated a sufficient risk reduction to warrant further investigation.",
"affiliations": "Albert Einstein College of Medicine, Children's Hospital at Montefiore, Bronx, New York, USA.;Department of Preventive Medicine, University of Southern California, Los Angeles, California, USA.;Dana-Farber/Harvard Cancer Center, Boston, Massachusetts, USA.;Children's Oncology Group, Monrovia, California, USA.;Children's Oncology Group, Monrovia, California, USA.;Department of Preventive Medicine, University of Southern California, Los Angeles, California, USA.;Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA.;Saint Jude Children's Research Hospital, Memphis, Tennessee, USA.",
"authors": "Levy|Adam S|AS|https://orcid.org/0000-0002-1593-8099;Krailo|Mark|M|;Chi|Susan|S|;Villaluna|Doojduen|D|;Springer|Linda|L|;Williams-Hughes|Chris|C|;Fouladi|Maryam|M|;Gajjar|Amar|A|https://orcid.org/0000-0001-5019-0699",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.29031",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "68(8)",
"journal": "Pediatric blood & cancer",
"keywords": "PNET; bevacizumab; irinotecan; recurrent medulloblastoma; temozolomide",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": null,
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "e29031",
"pmc": null,
"pmid": "33844469",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Temozolomide with irinotecan versus temozolomide, irinotecan plus bevacizumab for recurrent medulloblastoma of childhood: Report of a COG randomized Phase II screening trial.",
"title_normalized": "temozolomide with irinotecan versus temozolomide irinotecan plus bevacizumab for recurrent medulloblastoma of childhood report of a cog randomized phase ii screening trial"
} | [
{
"companynumb": "US-PFIZER INC-2021681129",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TEMOZOLOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nUp to 40% of elderly patients with untreated diffuse large B-cell lymphoma (DLBCL) given a regimen of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone every 21 days (R-CHOP21) relapse or develop refractory disease. Lenalidomide has high activity in relapsed or refractory aggressive B-cell lymphomas. In phase 2 of the REAL07 trial, we aimed to establish the safety and efficacy of the combination of lenalidomide and R-CHOP21 in elderly patients with untreated DLBCL.\n\n\nMETHODS\nREAL07 was an open-label, multicentre trial that was done in 13 centres in Italy and one in Germany. Eligible patients were aged 60-80 years; had newly diagnosed, untreated, CD20-positive, Ann Arbor stage II-IV DLBCL or grade 3b follicular lymphoma; had an Eastern Cooperative Oncology Group performance status of 0-2; had an International Prognostic Index (IPI) risk of low-intermediate, intermediate-high, or high; and were fit according to comprehensive geriatric assessment. Participants were to receive 15 mg oral lenalidomide on days 1-14 of six 21-day cycles, and standard doses of R-CHOP21 chemotherapy (375 mg/m(2) intravenous rituximab, 750 mg/m(2) intravenous cyclophosphamide, 50 mg/m(2) intravenous doxorubicin, and 1·4 mg/m(2) intravenous vincristine on day 1, and 40 mg/m(2) oral prednisone on days 1-5). The primary endpoint was frequency of overall response (complete response [CR] and partial response [PR]), which was assessed by (18)F-fluorodeoxyglucose ((18)F-FDG) PET at the end of the treatment. Analyses were by intention to treat. This trial is registered with ClinicalTrials.gov, number NCT00907348.\n\n\nRESULTS\n49 patients were included in phase 2: nine had been enrolled into phase 1 between Oct 23, 2008, and June 4, 2009, and had received the maximum tolerated dose of 15 mg lenalidomide; and 40 were enrolled into phase 2 between April 28, 2010, and June 3, 2011. 45 patients (92%, 95% CI 81-97) achieved a response (42 [86%] CR; three [6%] PR). Three patients (6%) did not respond and one (2%) died for reasons unrelated to treatment or disease. 277 (94%) of 294 planned cycles of lenalidomide and R-CHOP21 were completed. Grade 3-4 neutropenia was reported in 87 cycles (31%), grade 3-4 leukopenia in 77 (28%), and grade 3-4 thrombocytopenia in 35 (13%). No grade 4 non-haematological adverse events were reported. No patients died during the study as a result of toxic effects.\n\n\nCONCLUSIONS\nLenalidomide with R-CHOP21 is effective and safe in elderly patients with untreated DLBCL.\n\n\nBACKGROUND\nFondazione Italiana Linfomi and Celgene.",
"affiliations": "Hematology, Azienda Ospedaliero Universitaria Città della Salute e della Scienza di Torino, Turin, Italy. Electronic address: uvitolo@cittadellasalute.to.it.;Hematology, Azienda Ospedaliero Universitaria Città della Salute e della Scienza di Torino, Turin, Italy.;Division of Hematology, Department of Translational Medicine, Amedeo Avogadro University of Eastern Piedmont, Azienda Ospedaliero-Universitaria Maggiore della Carità, Novara, Italy.;Unit of Hematology 1, Istituto di Ricovero e Cura a Carattere Scientifico Hospital and University, Istituto dei Tumori San Martino, Genoa, Italy.;Unit of Biostatistics, Epidemiology and Public Health, Department of Cardiac, Thoracic and Vascular Sciences, University of Padua, Padua, Italy.;Department of Molecular Biotechnology and Health Science and Center for Experimental Research and Medical Studies, University of Turin, Turin, Italy; Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, USA.;Division of Medical Oncology A, Centro di Riferimento Oncologico Aviano National Cancer Institute, Aviano, Italy.;Unit of Hematology and Hemopoietic Stem Cell Transplantation, Ospedale Cardinale G Panico, Tricase, Italy.;Department of Molecular Biotechnologies and Health Sciences, University of Turin, Turin, Italy.;Università degli studi di Perugia, Azienda Ospedaliera Santa Maria, Terni, Italy.;Department of Oncology and Hematology, Infermi Hospital, Rimini, Italy.;Institute of Hematology Lorenzo ed Ariosto Seràgnoli, University of Bologna, Bologna, Italy.;Hematology Unit, S S Antonio e Biagio e Cesare Arrigo Hospital, Alessandria, Italy.;Istituto Scientifico Romagnolo per lo studio e la Cura dei Tumori, Istituti di Ricovero e Cura a Carattere Scientifico, Meldola, Italy.;Hematology Unit, Department of Oncology and Hematology, Santa Maria delle Croci Hospital, Ravenna, Italy.;Medizinische Klinik und Poliklinik III, Klinikum der Universität München, Munich, Germany.;Hematology, Azienda Ospedaliero Universitaria Città della Salute e della Scienza di Torino, Turin, Italy.;Hematology, Azienda Ospedaliero Universitaria Città della Salute e della Scienza di Torino, Turin, Italy.;Unit of Hematology 1, Istituto di Ricovero e Cura a Carattere Scientifico Hospital and University, Istituto dei Tumori San Martino, Genoa, Italy.;Department of Molecular Biotechnology and Health Science and Center for Experimental Research and Medical Studies, University of Turin, Turin, Italy; Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, USA.;Department of Molecular Biotechnologies and Health Sciences, University of Turin, Turin, Italy.;Unit of Clinical Epidemiology, Azienda Ospedaliero Universitaria Città della Salute e della Scienza di Torino and Centro di Riferimento per l'Epidemiologia e la Prevenzione Oncologica in Piemonte, Turin, Italy.;Division of Hematology, Department of Translational Medicine, Amedeo Avogadro University of Eastern Piedmont, Azienda Ospedaliero-Universitaria Maggiore della Carità, Novara, Italy.;Struttura Complessa Ematologia e Dipartimento Oncologia Medica, Spedali Civili, Brescia, Italy.",
"authors": "Vitolo|Umberto|U|;Chiappella|Annalisa|A|;Franceschetti|Silvia|S|;Carella|Angelo Michele|AM|;Baldi|Ileana|I|;Inghirami|Giorgio|G|;Spina|Michele|M|;Pavone|Vincenzo|V|;Ladetto|Marco|M|;Liberati|Anna Marina|AM|;Molinari|Anna Lia|AL|;Zinzani|Pierluigi|P|;Salvi|Flavia|F|;Fattori|Pier Paolo|PP|;Zaccaria|Alfonso|A|;Dreyling|Martin|M|;Botto|Barbara|B|;Castellino|Alessia|A|;Congiu|Angela|A|;Gaudiano|Marcello|M|;Zanni|Manuela|M|;Ciccone|Giovannino|G|;Gaidano|Gianluca|G|;Rossi|Giuseppe|G|;|||",
"chemical_list": "D058846:Antibodies, Monoclonal, Murine-Derived; C571759:R-CHOP protocol; D000069283:Rituximab; D013792:Thalidomide; D014750:Vincristine; D004317:Doxorubicin; D003520:Cyclophosphamide; D000077269:Lenalidomide; D011241:Prednisone",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1470-2045",
"issue": "15(7)",
"journal": "The Lancet. Oncology",
"keywords": null,
"medline_ta": "Lancet Oncol",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D058846:Antibodies, Monoclonal, Murine-Derived; D000971:Antineoplastic Combined Chemotherapy Protocols; D003520:Cyclophosphamide; D004317:Doxorubicin; D005260:Female; D006801:Humans; D000077269:Lenalidomide; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D008875:Middle Aged; D011241:Prednisone; D000069283:Rituximab; D013792:Thalidomide; D014750:Vincristine",
"nlm_unique_id": "100957246",
"other_id": null,
"pages": "730-7",
"pmc": null,
"pmid": "24831981",
"pubdate": "2014-06",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Lenalidomide plus R-CHOP21 in elderly patients with untreated diffuse large B-cell lymphoma: results of the REAL07 open-label, multicentre, phase 2 trial.",
"title_normalized": "lenalidomide plus r chop21 in elderly patients with untreated diffuse large b cell lymphoma results of the real07 open label multicentre phase 2 trial"
} | [
{
"companynumb": "IT-CELGENEUS-083-21880-14055205",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "LENALIDOMIDE"
},
"drugadditional": null... |
{
"abstract": "Lactic acidosis is a serious but uncommon side effect of metformin use. We discuss the pathophysiological mechanisms of lactic acidosis with particular regard to the role played by the drug as a potential cause of the entity. We report on a severe case of this kind of drug toxicity in a patient with type 2 diabetes mellitus, admitted to the emergency department with acute renal failure symptoms. The diagnosis was supported by elevated serum levels of the biguanide, a procedure scarcely used in clinical practice. The management of this complication consists in drug discontinuation and hemodialysis with bicarbonate that provides symptomatic and ethiological treatment by removing both the lactate and the hypoglycemic agent from the serum. Since the symptoms of metformin-associated lactic acidosis are unspecific and its onset is subtle, a high level of suspicion is needed to establish an early diagnosis.",
"affiliations": "Servicio de Urgencias, Hospital San Agustín, Avilés, Spain.",
"authors": "Macías-Robles|M D|MD|;Maciá-Bobes|C|C|;Yano-Escudero|R|R|;Fernández-Diéguez|O|O|;Alvarez-Lecue|O|O|",
"chemical_list": "D007004:Hypoglycemic Agents; D008687:Metformin",
"country": "Spain",
"delete": false,
"doi": "10.4321/s1137-66272011000100014",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1137-6627",
"issue": "34(1)",
"journal": "Anales del sistema sanitario de Navarra",
"keywords": null,
"medline_ta": "An Sist Sanit Navar",
"mesh_terms": "D000140:Acidosis, Lactic; D058186:Acute Kidney Injury; D000368:Aged; D005260:Female; D006801:Humans; D007004:Hypoglycemic Agents; D008687:Metformin",
"nlm_unique_id": "9710381",
"other_id": null,
"pages": "115-8",
"pmc": null,
"pmid": "21532654",
"pubdate": "2011",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Metformin-induced lactic acidosis due to acute renal failure.",
"title_normalized": "metformin induced lactic acidosis due to acute renal failure"
} | [
{
"companynumb": "ES-RANBAXY-2011RR-50519",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ENALAPRIL"
},
"drugadditional": null,
... |
{
"abstract": "Atypical femoral fractures (AFFs) are uncommon and often related to prolonged bisphosphonate (BP) treatment. Isolated cases have been linked to mutations of tissue nonspecific alkaline phosphatase (ALPL). Moreover, mutations in the geranylgeranyl pyrophosphate synthase (GGPPS) gene, which can be inhibited by BPs, and in the enzyme of the cytochrome P450 superfamily (CYP1A1), related to the metabolism of several drugs, have also been associated with AFF development. Our aim was to analyze the incidence of ALPL, GGPS1, and CYP1A1 gene mutations in patients with AFFs and their clinical characteristics. Seventeen women with AAFs were included. All patients underwent Sanger sequencing of the ALPL, GGPS1, and CYP1A1 genes, analyzing the presence of mutations and polymorphisms in these genes. The clinical characteristics of the patients, previous treatments, ALP substrates (vitamin B6 and phosphoethanolamine), bone turnover markers, and bone mass were also analyzed. Three of 17 patients (17.6%) presented heterozygous mutations in the ALPL (p.Gly288Ala) or CYP1A1 (p.Arg136His, p.Val409Ile) genes. Only the patient with the ALPL mutation presented increased ALP substrates. Patients with CYP1A1 variants had glucocorticoid-induced osteoporosis. All patients were previously treated with BPs during 85.5 ± 38 months, and nearly 50% were also treated with glucocorticoids. The AFF was bilateral in 35% of cases. In conclusion, ALPL and CYP1A1 mutations may be related to the development of AFF in patients treated with BPs. The evaluation of ALP substrates in patients with low ALPL levels allows the identification of patients with hypophosphatasia. The role of CYP1A1 mutations in AFF needs further study. © 2018 The Authors. JBMR Plus published by Wiley Periodicals, Inc. on behalf of American Society for Bone and Mineral Research.",
"affiliations": "Rheumatology Department Institut d'Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) Network for Biomedical Research in Hepatic and Digestive Diseases (CIBERehd) Clínic Foundation for Biomedical Research (FCRB) Hospital Clínic University of Barcelona Barcelona Spain.;Immunology Department IDIBAPS CIBERehd FCRB Hospital Clínic University of Barcelona Barcelona Spain.;Rheumatology Department Institut d'Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) Network for Biomedical Research in Hepatic and Digestive Diseases (CIBERehd) Clínic Foundation for Biomedical Research (FCRB) Hospital Clínic University of Barcelona Barcelona Spain.;Molecular Biology Core Laboratory IDIBAPS CIBERehd FCRB Hospital Clínic University of Barcelona Barcelona Spain.;Rheumatology Department Institut d'Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) Network for Biomedical Research in Hepatic and Digestive Diseases (CIBERehd) Clínic Foundation for Biomedical Research (FCRB) Hospital Clínic University of Barcelona Barcelona Spain.;Rheumatology Department Institut d'Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS) Network for Biomedical Research in Hepatic and Digestive Diseases (CIBERehd) Clínic Foundation for Biomedical Research (FCRB) Hospital Clínic University of Barcelona Barcelona Spain.",
"authors": "Peris|Pilar|P|;González-Roca|Eva|E|;Rodríguez-García|Sebastian C|SC|;Del Mar López-Cobo|María|M|;Monegal|Ana|A|;Guañabens|Núria|N|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/jbm4.10064",
"fulltext": "\n==== Front\nJBMR PlusJBMR Plus10.1002/(ISSN)2473-4039JBM4JBMR Plus2473-4039John Wiley and Sons Inc. Hoboken 10.1002/jbm4.10064JBM410064Original ArticleOriginal ArticlesIncidence of Mutations in the ALPL, GGPS1, and CYP1A1 Genes in Patients With Atypical Femoral Fractures ALPL, GGPS1, and CYP1A1 mutations in atypical femoral fracturesPERIS ET ALPeris Pilar pperis@clinic.ub.es \n1\n\n†\nGonzález‐Roca Eva \n2\n\n†\nRodríguez‐García Sebastian C \n1\ndel Mar López‐Cobo María \n3\nMonegal Ana \n1\nGuañabens Núria \n1\n\n1 \nRheumatology Department\nInstitut d'Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS)\n Network for Biomedical Research in Hepatic and Digestive Diseases (CIBERehd)\nClínic Foundation for Biomedical Research (FCRB)\nHospital Clínic\nUniversity of Barcelona\nBarcelona\nSpain\n\n2 \nImmunology Department\nIDIBAPS\nCIBERehd\nFCRB\nHospital Clínic\nUniversity of Barcelona\nBarcelona\nSpain\n\n3 \nMolecular Biology Core Laboratory\nIDIBAPS\nCIBERehd\nFCRB\nHospital Clínic\nUniversity of Barcelona\nBarcelona\nSpain\n* \nAddress correspondence to: Pilar Peris, MD, PhD, Rheumatology Department, Villarroel 170, Hospital Clínic, 08036 Barcelona, Spain. E‐mail: \npperis@clinic.ub.es\n† PP and EGR contributed equally to this work.\n\n22 6 2018 1 2019 3 1 10.1002/jbm4.v3.129 36 19 12 2017 26 3 2018 23 5 2018 © 2018 The Authors. JBMR Plus published by Wiley Periodicals, Inc. on behalf of American Society for Bone and Mineral Research.This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.ABSTRACT\nAtypical femoral fractures (AFFs) are uncommon and often related to prolonged bisphosphonate (BP) treatment. Isolated cases have been linked to mutations of tissue nonspecific alkaline phosphatase (ALPL). Moreover, mutations in the geranylgeranyl pyrophosphate synthase (GGPPS) gene, which can be inhibited by BPs, and in the enzyme of the cytochrome P450 superfamily (CYP1A1), related to the metabolism of several drugs, have also been associated with AFF development. Our aim was to analyze the incidence of ALPL, GGPS1, and CYP1A1 gene mutations in patients with AFFs and their clinical characteristics. Seventeen women with AAFs were included. All patients underwent Sanger sequencing of the ALPL, GGPS1, and CYP1A1 genes, analyzing the presence of mutations and polymorphisms in these genes. The clinical characteristics of the patients, previous treatments, ALP substrates (vitamin B6 and phosphoethanolamine), bone turnover markers, and bone mass were also analyzed. Three of 17 patients (17.6%) presented heterozygous mutations in the ALPL (p.Gly288Ala) or CYP1A1 (p.Arg136His, p.Val409Ile) genes. Only the patient with the ALPL mutation presented increased ALP substrates. Patients with CYP1A1 variants had glucocorticoid‐induced osteoporosis. All patients were previously treated with BPs during 85.5 ± 38 months, and nearly 50% were also treated with glucocorticoids. The AFF was bilateral in 35% of cases. In conclusion, ALPL and CYP1A1 mutations may be related to the development of AFF in patients treated with BPs. The evaluation of ALP substrates in patients with low ALPL levels allows the identification of patients with hypophosphatasia. The role of CYP1A1 mutations in AFF needs further study. © 2018 The Authors. JBMR Plus published by Wiley Periodicals, Inc. on behalf of American Society for Bone and Mineral Research.\n\nATYPICAL FEMORAL FRACTURESHYPOPHOSPHATASIAGENE MUTATIONSBISPHOSPHONATESALPLGGPS1CYP1A1Societat Catalana de Reumatologia source-schema-version-number2.0component-idjbm410064cover-dateJanuary 2019details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.5.6 mode:remove_FC converted:19.01.2019\n==== Body\nIntroduction\nAtypical femoral fractures (AFFs) are an uncommon type of fracture often related to prolonged bisphosphonate (BP) treatment. This type of fracture is commonly nontraumatic. It is characteristically located in the subtrochanteric region or the femoral diaphysis and is frequently bilateral. Although the cause of AFF is not well known, its development has been linked to long‐term use of BPs.1, 2, 3, 4 However, isolated cases of AFF have also been related to mutations of tissue nonspecific alkaline phosphatase (ALPL) as a clinical form of presentation of hypophosphatasia in adults.5, 6\n\n\nThe clinical presentation of hypophosphatasia may vary widely, from severe perinatal to mild forms with scarce clinical expression in adults.7 This entity may be easily overlooked in adults presenting with stress fractures in the lower extremities, articular chondrocalcinosis, or relapsing calcific periarthritis.8, 9 Clinical suspicion is therefore essential for diagnosis. In addition, a recent study described mutations in the enzyme of geranylgeranyl pyrophosphate synthase (GGPS1), which can be inhibited by BPs, as well as in the enzyme of the cytochrome P450 superfamily CYP1A1, the latter related to the metabolism of several drugs associated with the development of AFF.10, 11 Taking into account all of the above and the recent recommendations of the AFF Task Force of the American Society for Bone and Mineral Research (ASBMR) regarding the need for greater knowledge on the pathophysiology of AFF,3 it is essential to know if subjects with AFF present genetic alterations favoring the development of this characteristic type of fracture.\n\nTherefore, the aim of this study was to analyze the presence of ALPL, GGPS1, and CYP1A1 gene mutations in patients with AFF as well as the clinical characteristics of these patients.\n\nPatients and Methods\nPatients\nWe included all the patients diagnosed with AFF in our hospital from January 2009 to January 2016. The study was conducted at the Metabolic Bone Diseases Unit of the Rheumatology Department of the Hospital Clinic. The diagnosis of AFF was based on the ASBMR task force criteria.3 In all subjects a clinical history was obtained with special reference to risk factors for osteoporosis and previous symptoms of AFF. Previous skeletal fractures, age at menopause, and previous treatments for osteoporosis and duration were recorded in all patients, as well as weight, height, and body mass index (BMI) expressed as weight per height squared (kg/m2). In addition, other concomitant treatments and diseases were also recorded. All subjects gave informed consent, and the Ethics Committee of the hospital approved the study (HCB/2014/0045). After acceptance and signing the informed consent to participate in the study, blood analysis for genetic and biochemical studies and BMD measurements were performed. Patients were clinically assessed after presenting the fracture.\n\nBiochemical determinations\nThe biochemical profile at baseline included: serum creatinine, glucose, calcium, and phosphate, total alkaline phosphatase (total ALP) performed by standard procedures; the substrates of alkaline phosphatase (pyridoxal‐5′ phosphate in serum [vitamin B6] and phosphoethanolamine in urine [PEA]) (performed by high‐pressure liquid chromatography); serum 25OHD (using the Liason DiaSorin, chemiluminiscent immunoassay system, Stillwater, MN, USA); bone alkaline phosphatase (bone ALP) and propeptide amino‐terminal of type I procollagen (P1NP) as bone formation markers assessed by ELISA (IDS, Vitro, Boldon, England) and electrochemiluminescence by the automated Cobas e411 method (Roche, Mannheim, Germany); and serum carboxy‐terminal telopeptide of type I collagen (sCTx) by the automated Cobas e411 method (Roche), the latter determined as a bone resorption marker. Blood and urinary samples were obtained between 8:00 a.m. and 10:00 a.m. after overnight fasting.\n\nGenetic analysis\nSanger sequencing for the ALPL, GGPS1, and CYP1A1 genes was performed in all patients. Genomic DNA was extracted from peripheral blood using the MagNA Pure 96 DNA and Viral NA Large Volume Kit on the automated DNA extractor MagNA Pure 96 System (Roche Life Science, Switzerland). Standard PCR procedures were performed for Sanger sequencing of all the exons and intron splicing sites of the ALPL (NM_000478), GGPS1 (NM_001037277), and CYP1A1 (NM_000499) genes. Primer sequences are available upon request.\n\nBMD measurements\nBMD of the proximal femur (neck and total femur) and lumbar spine was measured by dual X‐ray absorptiometry (Lunar Prodigy, Radiation Corporation Madison, WI, USA). The coefficients of variations for total femur and lumbar spine are 0.6 and 0.8, respectively. Osteoporosis was defined according to the WHO criteria with T‐score values < −2.5 in any of these locations.12\n\n\nData analysis\nAll data are expressed as mean ± standard deviation (SD). The nonparametric Mann‐Whitney U test was used to compare differences for continuous variables. Differences between proportions were assessed with the chi‐square test. A p value <0.05 was considered statistically significant.\n\nGenetic data analysis was performed with the SeqPilot module of the JSI medical System GmbH software. Sorting Tolerant from Intolerant (SIFT), Polyphen2, and Mutation Taster algorithms were used to predict the effect of the new or low‐frequency variants detected in patients’ samples.13, 14, 15 Classification of variants into pathogenic, uncertain significance, or benign was performed following the American College of Medical Genetics and Genomics (ACMG) recommendations.16 Visualization of the ALPL variant in the 3D model of Alpl protein was performed using PyMol v0.98rc5 visualization software with the model described by Silvent and colleagues.17\n\n\nResults\nGeneral characteristics\nSeventeen patients (all white women) with AAF with a mean age of 71 ± 10 years (range, 52 to 87 years) were included in the study. The characteristics of the patients are shown in Table 1. Briefly, all patients (17/17) were previously treated with BPs during a mean period of 85.5 ± 38 months (range, 14 to 144 months); most (16/17) received treatment with alendronate (3/16 cases received sequential treatment: alendronate followed by zoledronate [one case] or denosumab [two cases]), and only one of 17 was treated with risedronate. Treatment with BPs was ≤5 years in five patients. Most patients received calcium and vitamin D supplementation (15/17; 88%). Nearly 50% of the patients (8/17) were additionally treated with glucocorticoids (GCC), most cases for rheumatologic disorders (Table 1); 18% of the AFF patients (3/17) were diabetic and 47% (7/17) received concomitant treatment with proton pump inhibitors (PPIs). Most patients (13/17; 76%) had had previous fragility fractures and 55% (6/11 with BMD available for hip and/or spine) had densitometric osteoporosis. In relation to the characteristics of AFF, most patients presented the fracture in the right femur (10/17), only one in the left, being the AFF bilateral in six cases (35%). Most patients (13/17; 76%) had a spontaneous fracture with only four patients presenting the fracture after a low‐energy trauma. Previous symptoms, in the form of groin or thigh pain, were reported in 41% of the patients (7/17), with a mean duration of 6 ± 2.8 months.\n\nTable 1 General Characteristics of the Patients With AFFs\n\nCase\tSex (M/F)/ Age (years)\tUnderlying disease\tGCC therapy\tBMI (kg/m2)\tPrevious OP therapy\na\n\n\tDuration of anti‐OP treatment (months)\tPrevious fragility Fx\tTreatment with PPIs\tDiabetes\tType of AFF\tPresence of previous associated symptoms related to the fracture\tDuration of symptoms (months)\tFN T‐score\t\n1\tF/63\tGCC‐OP; ITP\tYes\t29.9\tALD\t96\tYes\tNo\tNo\tBilateral\tNo\t–\t−2\t\n2\tF/71\tPM‐OP\tNo\t29.2\tALD\t72\tYes\tYes\tNo\tBilateral\tNo\t–\t−2.3\t\n\t\t\t\t\tDmab\t12\t\t\t\t\t\t\t\t\n3\tF/75\tGCC‐OP; PMR\tYes\t33.7\tRIS\t60\tYes\tYes\tNo\tUnilateral\tNo\t–\t−2.5\t\n4\nb\n\n\tF/77\tGCC‐OP; COPD\tYes\t32.3\tALD\t36\tYes\tYes\tYes\tUnilateral\tYes\t2\t−2.7\t\n5\tF/77\tPM‐OP\tNo\t22.8\tALD\t72\tYes\tNo\tNo\tUnilateral\tYes\t2\t−1.8\t\n6\tF/68\tGCC‐OP; asthma\tYes\t24.6\tALD\t132\tYes\t–\tNo\tUnilateral\tNo\t–\t−2\t\n7\nb\n\n\tF/67\tPM‐OPc\tNo\t23.7\tALD\t96\tNo\tNo\tNo\tUnilateral\tYes\t3\t−2.2\t\n8\tF/52\tGCC‐OP; RA\tYes\t29.1\tALD\t132\tNo\tNo\tNo\tBilateral\tYes\t12\t−2.3\t\n9\tF/78\tPM‐OP\tNo\t29.9\tALD\t72\tYes\tNo\tNo\tBilateral\tYes\t24\t–\t\n10\tF/56\tGCC‐OP; Sjögren syndrome; sarcoidosis\tYes\t26.1\tALD\t120\tYes\tYes\tNo\tUnilateral\tNo\t–\t−1.5\t\n\t\t\t\t\tZOL\t24\t\t\t\t\t\t\t\t\n11\tF/76\tPM‐OP\tNo\t35.1\tALD\t36\tYes\tNo\tNo\tUnilateral\tYes\t3\t−1\t\n\t\t\t\t\tDmab\t6\t\t\t\t\t\t\t\t\n12\tF/52\tGCC‐OP; polymyositis\tYes\t26.3\tALD\t120\tYes\tYes\tNo\tUnilateral\tNo\t–\t−2.3\t\n13\tF/83\tPM‐OP\tNo\t36.7\tALD\t48\tYes\tNo\tYes\tUnilateral\tNo\t–\t−2.6\t\n14\tF/69\tPM‐OP\tNo\t26.2\tALD\t14\tYes\tYes\tYes\tUnilateral\tNo\t–\t–\t\n15\tF/81\tPM‐OP\tNo\t28.5\tALD\t96\tNo\tNo\tNo\tBilateral\tNo\t–\t–\t\n16\tF/87\tPM‐OP\tNo\t28\tALD\t108\tNo\tNo\tNo\tBilateral\tYes\t2\t–\t\n17\nb\n\n\tF/75\tGCC‐OP; RA\tYes\t29.1\tALD\t144\tYes\tYes\tNo\tUnilateral\tNo\t–\t−1.3\t\nAFF = atypical femoral fracture; M = male; F = female; GCC = glucocorticoid; BMI = body mass index; OP = osteoporosis; Fx = fracture; PPI = proton pump inhibitor; FN = femoral neck; GCC‐OP = glucocorticoid‐induced osteoporosis; ITP = idiopathic thrombocytopenic purpura; ALD = alendronate; PM‐OP = postmenopausal osteoporosis; Dmab = denosumab; PMR = polymyalgia rheumatica; RIS = risedronate; COPD = chronic obstructive pulmonary disease; RA = rheumatoid arthritis; ZOL = zoledronate.\n\na Previous treatment of OP with ALD, RIS, ZOL, or Dmab.\n\nb The three patients with gene mutations (cases 4 and 17: CYP1A1 mutation; case 7: ALPL mutation).\n\n cInitially diagnosed with PM‐OP but after the fracture the diagnosis was hypophosphatasia.\n\n© 2018 American Society for Bone and Mineral ResearchVitamin D serum levels were deficient (<20 ng/mL) in most of the patients (8/11) analyzed after the fracture (73%), but none of the patients presented biochemical alterations consistent with osteomalacia (data not shown).18 Formation and/or resorption bone turnover markers were among the reference values in most patients, with increased values in 44% (7/16) and 21% (3/14), respectively (Table 2).\n\nTable 2 Variants Identified in the ALPL, GGPS1, and CYP1A1 Genes and Laboratory Results in Patients With Atypical Femoral Fractures\n\n\tVariants\t\nCase\tGene\tNucleotide change\tAmino acid change\tStatus\tVariant classification\na\n\n\tVariant id\tExAC frequencies (EUR–Non‐Finnish) (%)\nb\n\n\tBioinformatic predictions\nc\n\n\tTotal ALP\nd\n\n\tVitamin B6\ne\n\n\tBone ALP\nf\n\n\tP1NP\ng\n\n\tCTx\nh\n\n\t25OHD\ni\n\n\t\n1\t\nALPL\n\tc.455G>A\tp.Arg152His\tHeterozygous\tPol\trs14934498\t1.16\t\t97\t36\t7.1\t10\t0.14\t28.5\t\n2\t\nGGPS1\n\tc.142‐6dup\t−\tHeterozygous\tPol\tRs3841735\t38.1\t\t−\t10\t−\t−\t−\t−\t\n3\t−\t−\t−\t−\t−\t\t\t\t132*\t18\t−\t36\t−\t18.6\t\n4\nj\n\n\t\nCYP1A1\n\tc.407G>A\tp.Arg136His\tHeterozygous\tVUS\trs202201538\t0*\tDamaging; benign; disease causing\t97\t45\t13.5\t39\t0.11\t15.4\t\n\t\nGGPS1\n\tc.142‐6dup\t−\tHeterozygous\tPol\trs3841735\t38.1\t\t\t\t\t\t\t\t\n5\t−\t−\t−\t−\t−\t\t\t\t74\t40\t\n14.9\n\t\n66\n\t0.41\t16.7\t\n6\t\nALPL\n\tc.1565T>C\tp.Val522Ala\tHomozygous\tPol\trs34605986\t12.39\t\t78\t36\t9.7\t20\t0.11\t22.4\t\n\t\nGGPS1\n\tc.142‐6dup\t–\tHomozygous\tPol\trs3841735\t38.1\t\t\t\t\t\t\t\t\n7\nj\n\n\t\nALPL\n\tc.863G>C\tp.Gly288Ala\tHeterozygous\tLikely pathogenic\t\tNA\tDamaging; probably damaging; disease causing\t97*\t\n143\n\t10.2\t\n67\n\t\n0.71\n\t−\t\n\t\nGGPS1\n\tc.142‐6dup\t−\tHeterozygous\tPol\trs3841735\t38.1\t\t\t\t\t\t\t\t\n8\t\nALPL\n\tc.1565T>C\tp.Val522Ala\tHeterozygous\tPol\trs34605986\t12.39\t\t84\t−\t10.5\t8\t0.16\t−\t\n9\t\nALPL\n\tc.1565T>C\tp.Val522Ala\tHeterozygous\tPol\trs34605986\t12.39\t\t50\t61\t−\t49\t−\t18\t\n\t\nGGPS1\n\tc.142‐6dup\t–\tHomozygous\tPol\trs3841735\t38.1\t\t\t\t\t\t\t\t\n10\t\nALPL\n\tc.1565T>C\tp.Val522Ala\tHeterozygous\tPol\trs34605986\t12.39\t\t218*\t24\t24\t53\t0.20\t−\t\n11\t\nALPL\n\tc.455G>A\tp.Arg152His\tHeterozygous\tPol\trs14934498\t1.16\t\t92\t17\t\n17.3\n\t\n86\n\t0.27\t−\t\n12\t\nGGPS1\n\tc.142‐6dup\t−\tHomozygous\tPol\trs3841735\t38.1\t\t120\t17\t10.6\t35\t0.29\t16.2\t\n13\t\nALPL\n\tc.787T>C\tp.Tyr263His\tHomozygous\tPol\trs3200254\t10.76\t\t94\t26\t\n25.8\n\t\n71\n\t0.52\t100\t\n\t\nGGPS1\n\tc.142‐6dup\t−\tHeterozygous\tPol\trs3841735\t38.1\t\t\t\t\t\t\t\t\n14\t−\t−\t−\t−\t−\t−\t\t\t211\t38\t\n33.7\n\t\n94\n\t\n0.81\n\t10\t\n15\t\nGGPS1\n\tc.142‐6dup\t−\tHomozygous\tPol\trs3841735\t38.1\t\t108\t72\t−\t\n162\n\t0.56\t16.4\t\n16\t\nALPL\n\tc.455G>A\tp.Arg152His\tHeterozygous\tPol\trs14934498\t1.16\t\t82\t21\t−\t\n93\n\t\n0.65\n\t17.8\t\n\t\nCYP1A1\n\tc.1382C>A\tp.Thr461Asn\tHeterozygous\tPol\trs1799814\t4.4\t\t\t\t\t\t\t\t\n17j\t\nCYP1A1\n\tc.1225G>A\tp.Val409Ile\tHeterozygous\tVUS\trs769134905\tNA\tTolerated; benign; disease‐causing\t54\t26\t7.7\t25\t0.29\t−\t\nValues in bold are above the normal range.\n\nExAC = Exome Aggregation Consortium; EUR = European; ALP = alkaline phosphatase; Pol = polymorphism; VUS = variant of uncertain significance.\n\na Classification of variants following the ACMG recommendations.16\n\n\nb ExAC frequencies: only European–Non‐Finnish population frequencies shown (NA: not registered in ExAC; *8.651e–05 in Latino population [1 allele out of 11560]).\n\nc Predictions from SIFT, Polyphen2, and MutationTaster, respectively.\n\nd Total ALP (normal values: 46–116 U/L; *measured in some patients with another method: normal values: 80–240 U/L).\n\ne Vitamin B6 (normal values: 15–96 nmol/L).\n\nf Bone ALP (reference values in premenopausal women: 6–13.6 ng/mL).\n\ng P1NP (reference values in premenopausal women: 22–63 ng/mL).\n\nh CTx (reference values in premenopausal women: 0.02–0.58 ng/mL).\n\ni 25 OH vitamin D (normal values: ≥20 ng/mL).\n\nj The three patients with gene mutations (cases 4 and 17: CYP1A1 mutation; case 7: ALPL mutation).\n\n© 2018 American Society for Bone and Mineral ResearchWhen comparing patients with AFF treated with versus without GCC, the former were younger (64 ± 75 versus 76 ± 56 years, p = 0.015) and were also treated with BPs for a longer period of time (105 ± 38 versus 68.2 ± 30 months, p = 0.046). These patients also showed significantly lower mean values of bone formation and resorption markers (Table 3).\n\nTable 3 Patients With AFFs Associated With GCC Treatment Versus Non–GCC‐Treated Patients\n\n\tGCC AFF (n = 8)\tNo GCC AFF (n = 9)\t\np\n\t\nAge (years)\t64 ± 75\t76 ± 56\t0.015\t\nBMI (kg/m2)\t28.9 ± 3.1\t28.9 ± 4.6\tn.s\t\nDuration of BP treatment (months)\t105 ± 38\t68.2 ± 30\t0.046\t\nType of AFF\t2 Bilateral AFFs\t4 Bilateral AFFs\tn.s.\t\nFemoral neck T‐score\t−2 ± 0.8\t−1.9 ± 0.5\tn.s.\t\nBone ALP (ng/mL)\t11.9 ± 5.7\t20.3 ± 9.3\t0.06\t\nP1NP (ng/mL)\t28.1 ± 15\t85.9 ± 34\t<0.001\t\nCTx (ng/mL)\t0.186 ± 0.08\t0.561 ± 0.18\t0.002\t\nValues are mean ± SD or as indicated.\n\nAFF = atypical femoral fracture; GCC = glucocorticoid; n.s. = not significant.\n\n© 2018 American Society for Bone and Mineral ResearchGenetic and biochemical results\nThree of the 17 patients (17.6%) presented heterozygous variants of interest: one variant in the ALPL gene and two in the CYP1A1 gene. The ALPL variant consisted in a G to C transversion at position c.863 of the ALPL gene leading to the amino acid change p.Gly288Ala, which can be classified as a likely pathogenic variant. This variant has not been registered in the databases of genomic diversity Exome Aggregation Consortium (ExAC),19 the 1000 Genomes Project,20 or in disease‐associated databases (The Tissue Nonspecific Alkaline Phosphatase [TNAP] Gene Mutations Database and The Human Gene Mutation Database).21, 22 Visualization of the residue in the placental TNAP 3D model shows that it is located in the calcium binding domain (Fig. 1), which is important for the correct maintenance of structure and function of the protein.17\n\n\nFigure 1 The location of the residue 288 in the 3D model of TNAP. The model is based on that described by Silvent and colleagues.17 Monomers are highlighted in yellow and magenta while residues of the active site are green and those of the crown domain are represented in sticks. The calcium binding site is depicted in cyan and the red arrow highlights the residue 288 in orange.\n\nCopyright © 2017 Wiley Periodicals, Inc.The variants identified in the CYP1A1 gene are (i) a G to A transition at position c.407 of the CYP1A1 gene leading to the amino acid change p.Arg136His; and (ii) a G to A transition at position c.1225 of the CYP1A1 gene leading to the amino acid change p.Val409Ile. According to the ACMG guidelines, both variants found in the CYP1A1 gene can be classified as a variant of uncertain significance (VUS), and the Mutation Taster bioinformatic algorithm predicted both variants to be disease‐causing (Table 2).15 Variant p.Arg136His has only been registered in the ExAC genomic diversity database (rs202201538) in only one allele out of 11,560 from an individual of Latino origin, wherase the p.Val409Ile variant (rs769134905) has been identified in one allele out of 3854 from an individual of the UK10K project.23\n\n\nOnly the patient with the ALPL likely pathogenic variant presented an increase in ALP substrates (vitamin B6 serum levels) with marginally decreased total ALP levels (Table 2) at the time of evaluation (after the AFF). In this patient treatment with teriparatide was initiated after the AFF and was maintained for 2 years; total ALP was within normal values and/or marginally decreased during teriparatide treatment. However, total ALP decreased after finishing treatment, with low values in all the subsequent determinations (4/4); serum vitamin B6 values were always increased (in 5/5 determinations [independently of teriparatide treatment]). The two patients with the CYP1A1 VUS variants had GCC‐induced osteoporosis and had been receiving treatment with BPs for 3 and 12 years, respectively. In addition, eight of 17 patients (47%) presented polymorphisms in the ALPL gene; eight of 17 patients (47%) in the GGPS1 gene, and one patient presented a polymorphism of the CYP1A1 gene (Table 2). When we evaluated the serum levels of total ALP and/or the substrates of ALP (vitamin B6 and PEA), none of the patients with polymorphisms of the ALPL gene presented abnormal values (ie, decreased total ALP or increased ALP substrates).\n\nDiscussion\nThe present study shows that mutations in the ALPL and CYP1A1 genes may be related to the development of AFF in patients receiving BPs indicating the need to evaluate ALP substrates in patients with low total ALP levels prior to initiating BP treatment. In addition, in view of the present results the role of CYP1A1 mutations in AFF needs further study.\n\nIn our series most patients with AFF presented with clinical characteristics similar to previous studies, such as the relatively younger age (with a mean age of 71 years) compared to that observed in the “typical” fragility hip fracture, the frequent vitamin D deficiency, the relatively higher BMD values commonly within the osteopenic range, and the frequent use of PPIs in 47% of subjects as well as concomitant GCC treatment in nearly 50% of these patients.1, 2, 3, 24 Interestingly, GCC‐treated patients showed some differential clinical characteristics compared with the remaining patients, such as younger age, more depressed bone turnover after the fracture, and a longer period of treatment with BPs previous to the fracture. Thus, although previous treatment with BPs was present in all patients, alendronate being the drug most frequently used, patients with GCC‐induced osteoporosis were treated with BPs during a mean period of 105 months, compared with 68 months in the remaining subjects. In addition, it should be noted that five of 17 subjects (∼30%) were treated with BPs for less than 5 years, which is the recommended minimal period of time proposed by several recent guidelines.25 Of note, one of these patients presented a mutation in the CYP1A1 gene.\n\nAlthough at present the pathophysiology of AFF is not clear, it has been suggested that prolonged BP treatment could persistently decrease cortical bone remodeling, and theoretically, alter the resolution of the stress microfractures that occurs in this location, increasing the risk for developing this type of fractures. Of interest is the similarity of fracture characteristics observed in other disorders, such as hypophosphatasia, a rare inborn metabolic bone disease caused by mutations in the ALPL gene.7 The clinical presentation of hypophosphatasia varies widely from lethal perinatal forms associated with severe mineralization defects to mild forms with scarce clinical expression in adults.7, 26, 27 Thus, as previously commented in the Introduction, hypophosphatasia in adults may be easily overlooked, presenting with stress fractures in the lower extremities, including diaphyseal femoral fractures.5, 6, 8 This entity should be suspected when total ALP serum levels are decreased, and—after ruling out other possible causes of low levels of total ALP—diagnosed by measuring the substrates of this enzyme (especially vitamin B6) and confirmed by mutational analysis of the ALPL gene whenever possible.7, 27, 28 The incidence of hypophosphatasia for severe forms in the general population is low (1/100,000 inborn). However, at present the incidence of mild versus moderate forms in the adult population is unknown, with an estimated prevalence of carriers of “moderate‐mild” mutations of nearly 1 in 6370 in the European population.27 Recently, it has been suggested that there may be a relatively high prevalence of asymptomatic “carriers” in 1 per 250 to 300 people.29 All of this indicates the need to take into account this entity, especially when evaluating antiosteoporotic treatment with BPs. Thus, BPs are analogues of calcium pyrophosphate and also inhibit the activity of APL by binding to Zn++ and to Mg ++(both needed for ALP activity).5, 30 For this reason, these drugs would be particularly contraindicated in hypophosphatasia, because they would worsen bone mineralization. In this sense, and similar to our study, Sutton and colleagues5 reported a patient with hypophosphatasia initially misdiagnosed with osteoporosis who developed a bilateral AFF after 4 years of treatment with BPs. Our patient was also initially misdiagnosed with postmenopausal osteoporosis and treated with oral BPs, developing the fracture after 7 years of treatment. The total ALP values were in the lower normal range at the time of evaluation, but it should be pointed out that this patient was evaluated after the fracture, when increased total ALP values can be observed and should be taken into account when evaluating these patients.31, 32 Of note, this patient showed markedly decreased total ALP levels after finishing treatment with teriparatide in all the subsequent determinations during the follow‐up, with a concomitant increase in vitamin B6 serum levels, further confirming the diagnosis of hypophosphatasia in this patient. The genetic analysis confirmed the presence of a new heterozygous and likely pathogenic variant, p.Gly288Ala, which, according to bioinformatic prediction, resulted in theoretical protein damage.13, 14, 15 To further study the possible pathogenicity of the variant identified we used a 3D model of TNAP with which we could locate the variant in the calcium binding domain, which is considered relevant for maintaining protein structure and function.17 Moreover, this variant has not been identified in the general population or in disease‐associated individuals. All of this strongly indicates that the p.Gly288Ala variant may play a pathogenic role in the manifestations of disease in this patient.\n\nWe also observed several polymorphisms in the ALPL gene in eight AFF patients, all of which are also described in the general population, with prevalences ranging from 1.24% to 11.1% in the European (non‐Finnish) population.19 None of these patients presented decreased total ALP levels nor increased ALP substrates, thereby suggesting that these ALPL polymorphisms do not play a pathologic role of in these cases.\n\nOf interest were the variants detected in the CYP1A1 gene in two patients. The MutationTaster bioinformatic algorithm predicted both variants to be disease‐causing, reinforcing the idea that these two variants may underlie disease pathogenicity. This is in concordance with the fact that these variants have not been reported in the general population (as in the case of p.Val409Ile) or have been described with a very low allele frequency (such as p.Arg136His).19 We also observed the presence of the pThr461Asn polymorphism in this gene in another AFF patient.\n\nRecently, a CYP1A1 gene mutation has also been reported in three sisters who all presented AFF after treatment with BPs.11 After performing whole‐exome sequencing to detect possible shared genetic variants involved in the AFF development in these sisters, the authors observed mutations in the GGPS1 gene, thereby suggesting a possible effect on the activity of the geranylgeranyl pyrophosphate synthetase, and consequently on the effect of BPs on the mevalonate pathway. Nevertheless, they also observed a mutation in the CYP1A1 gene, not only in the three sisters but also in an unrelated patient with AFF, further suggesting a potential role of this mutation in some cases with AFF.\n\nCytochromes P450 (CYP) are a major source of variability in drug pharmacokinetics and response, especially the CYP1, CYP2, and CYP3 families, which are responsible for the biotransformation of most foreign substances, including 70% to 80% of all drugs in clinical use.10 It should be noted that the expression of each CYP is influenced by several factors, such as genetic, regulatory cytokines, hormones, and age and sex, among others.10 Moreover, the CYP1A1 gene not only encodes enzymes which catalyze many reactions involved in drug metabolism, but also the synthesis of cholesterol and steroids, the latter possibly influencing the effect of GCCs. Indeed, previous studies have shown different efficiencies in the hydroxylation of steroid hormones depending on the allelic variants on the CYP1A1 gene, resulting in changes in its catalytic efficiency.33 Our two patients with the CYP1A1 gene mutation had a GCC‐induced osteoporosis related to chronic obstructive pulmonary disease and rheumatoid arthritis, respectively, with previous fragility fractures and were also receiving treatment with BPs prior to developing the fracture. Therefore, in these particular patients we can speculate not only a possible role of these mutations in BP metabolism but also in the effect of GCC therapy. It should be noted that GCC treatment constitutes an important risk factor related to the development of AFF, with nearly 50% of the patients presenting this associated comorbidity in several series.3, 24, 34 Of interest, CYP1A1 has recently been shown to suppress AMP‐activated protein kinase (AMPK) signaling,35 which has been related to the development of osteoporosis in experimental studies. In addition, AMPK signaling has been shown to modulate the mevalonate pathway,36 which is also a target of bisphosphonates. All of the latter linking CYP1A1 with the bisphosphonate pathway indicates the need to perform functional studies in these CYP1A1 mutations. Additionally, as commented on the previous page, we also observed a CYP1A1 polymorphism in another elderly patient diagnosed with postmenopausal osteoporosis who developed bilateral AFF after 9 years of BP treatment. Of note, this particular polymorphism has been previously related to low femoral BMD and increased bone resorption, a finding attributed to an increase in the metabolism of estrogens in this population group.37 Nonetheless, although we cannot rule out an increased estrogen catabolism in these patients, if that were the case, we would expect a preventive effect of BPs for the bone loss related to the accelerated estrogen catabolism.\n\nConversely, although all patients with AFF included in this series were previously treated with BPs, none presented mutations in the GGPS1 gene. This finding does not necessarily indicate the absence of a relationship of this gene mutation with AFF, but rather, suggests that if this were the case, it would probably be uncommon. Although we observed eight patients with a polymorphism (c.142‐6insT) in this gene, its high frequency in the European (non‐Finnish) population (33.6%),(19) rules out its role in the pathogenicity of AFF. Recently, a pilot study in subjects with AFF did not observe mutations or polymorphisms in this gene.38\n\n\nIn addition, it should be pointed out that patients with AFF may also have other nongenetic factors that may predispose to this type of fracture, such as femoral and/or lower limb deformities. In this sense, recent studies have also suggested a possible contribution of proximal femoral geometry in AFF, reporting either an excessive femoral offset and femoral neck angle in varus,39 and/or femorotibial valgus deformities in some of these subjects.40\n\n\nOur study, however, has some limitations, such as the relatively small number of patients, a limitation linked to AFF, a very uncommon entity; the absence of a control group and the absence of a functional study of the mutations analyzed. Nonetheless, the study also has several strengths such as the homogenous and well‐standardized population, the extensive genetic analysis, and the functional estimated evaluation of the gene mutations and polymorphisms analyzed, all of which constitute useful findings that may help to better understand the pathophysiology of this type of fracture.\n\nIn conclusion, ALPL and CYP1A1 mutations may be related to the development of AFF in patients treated with BPs. The evaluation of ALP substrates in patients with low or marginally low ALP levels allowed the identification of patients with hypophosphatasia. The role of CYP1A1 mutations in AFF clearly needs further study, not only evaluating the possible effect on BP but also on GCC metabolism.\n\nDisclosures\nAll authors state that they have no conflicts of interest.\n\nAcknowledgments\nThis work was supported by a grant from the Societat Catalana de Reumatologia. The PyMol v0.98rc5 visualization software was kindly provided by Dr. Mornet.\n\nAuthors’ roles: Study design: PP. Study conduct: PP and EGR. Data collection: PP, EGR, and SCRG. Data interpretation: PP and EGR. Drafting manuscript: PP and EGR. Revising manuscript content: PP, EGR, SCRG, MMLC, AM, and NG. Approving final version of manuscript: all authors. PP, EGR, and SCRG and take responsibility for the integrity of the data analysis.\n==== Refs\nReferences\n1 \n\nFeldstein \nAC \n, \n\nBlack \nD \n, \n\nPerrin \nN \n, et al. Incidence and demography of femur fractures with and without atypical features . \nJ Bone Miner Res , \n2012 ;27 :977 –86 .\n22275107 \n2 \n\nLo \nJC \n, \n\nHui \nRL \n, \n\nGrimsrud \nCD \n, et al. The association of race/ethnicity and risk of atypical femur fracture among older women receiving oral bisphosphonate therapy . \nBone . \n2016 ;85 :142 –7 .\n26769007 \n3 \n\nShane \nE \n, \n\nBurr \nD \n, \n\nAbrahamsen \nB \n, et al. Atypical subtrochanteric and diaphyseal femoral fractures: second report of a task force of the American Society for Bone and Mineral Research . \nJ Bone Miner Res . \n2014 ;29 :1 –24 .\n23712442 \n4 \n\nPark‐Wyllie \nLY \n, \n\nMamdani \nMM \n, \n\nJuurlink \nDN \n, et al. Bisphosphonate use and the risk of subtrochanteric or femoral shaft fractures in older women . \nJAMA . \n2011 ;305 :783 –9 .\n21343577 \n5 \n\nSutton \nRA \n, \n\nMumm \nS \n, \n\nCoburn \nSP \n, et al. Atypical femoral fractures during bisphosphonate exposure in adult hypophosphatasia . \nJ Bone Miner Res . \n2012 ;27 :987 –94 .\n22322541 \n6 \n\nMamman \nE \n, \n\nBriot \nK \n, \n\nRoux \nC. \n\nAtypical femoral fracture in a 51‐year‐old woman: revealing a hypophosphatasia . \nJoint Bone Spine . \n2016 ;83 :346 –8 .\n26992955 \n7 \n\nWhyte \nMP. \n\nPhysiological role of alkaline phosphatase explored in hypophosphatasia . \nAnn N Y Acad Sci . \n2010 ;1192 :190 –200 .\n20392236 \n8 \n\nBerkseth \nKE \n, \n\nTebben \nPJ \n, \n\nDrake \nMT \n, et al. Clinical spectrum of hypophosphatasia diagnosed in adults . \nBone . \n2013 ;54 :21 –7 .\n23352924 \n9 \n\nGuañabens \nN \n, \n\nMumm \nS \n, \n\nMöller \nI \n, et al. Calcific periarthritis as the only clinical manifestation of hypophosphatasia in middle‐aged sisters . \nJ Bone Miner Res . \n2014 ;29 :929 –34 .\n24123110 \n10 \n\nZanger \nUM \n, \n\nSchwab \nM. \n\nCytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation . \nPharmacol Ther . \n2013 ;138 :103 –41 .\n23333322 \n11 \n\nRoca‐Ayats \nN \n, \n\nBalcells \nS \n, \n\nGarcia‐Giralt \nN \n, et al. GGPS1 mutation and atypical femoral fractures with bisphosphonates . \nN Engl J Med . \n2017 ;376 :1794 –5 .\n28467865 \n12 World Health Organization. Assessment of fracture risk and its application to screening for postmenopausal osteoporosis: report of a WHO study group. [Geneva: World Health Organization. Meeting held in Rome from 22 to 25 June 1992. WHO Technical Report Series 843]. World Health Organ Tech Rep Ser. \n1994 ;843 :1 –129 . Available from: http://www.who.int/iris/handle/10665/39142.\n\n13 \n\nKumar \nP \n, \n\nHenikoff \nS \n, \n\nNg \nPC. \n\nPredicting the effects of coding non‐synonymous variants on protein function using the SIFT algorithm . \nNat Protoc . \n2009 ;4 :1073 –81 .\n19561590 \n14 \n\nAdzhubei \nIA \n, \n\nSchmidt \nS \n, \n\nPeshkin \nL \n, et al. A method and server for predicting damaging missense mutations . \nNat Methods . \n2010 ;7 :248 –9 .\n20354512 \n15 \n\nSchwarz \nJM \n, \n\nRödelsperger \nC \n, \n\nSchuelke \nM \n, et al. MutationTaster evaluates disease‐causing potential of sequence alterations . \nNat Methods . \n2010 ;7 :575 –6 .\n20676075 \n16 \n\nRichards \nS \n, \n\nAziz \nN \n, \n\nBale \nS \n, et al. ACMG Laboratory Quality Assurance Committee. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology . \nGenet Med . \n2015 ;17 :405 –24 .\n25741868 \n17 \n\nSilvent \nJ \n, \n\nGasse \nB \n, \n\nMorent \nE \n, \n\nSire \nJY. \n\nMolecular evolution of the tissue‐nonspecific alkaline phosphatase allows prediction and validation of missense mutations responsible for hypophosphatasia . \nJ Biol Chem . \n2014 ;289 :24168 –79 .\n25023282 \n18 \n\nGifre \nL \n, \n\nPeris \nP \n, \n\nMonegal \nA \n, Martinez de Osaba MJ, Alvarez L, Guañabens N. Osteomalacia revisited: a report on 28 cases . \nClin Rheumatol . \n2011 ;30 :639 –45 .\n20949298 \n19 ExAC Browser (Beta). Exome Aggregation Consortium [Internet]. Exome Aggregation Consortium [cited 2018 Jun 8]. Available from: http://exac.broadinstitute.org/.\n\n20 The International Genome Sample Resource (IGSR). 1000Genomes Project [Internet]. [cited 2018 Jun 8]. Available from: http://www.ensembl.org/index.html.\n\n21 The Tissue Nonspecific Alkaline Phosphatase Gene Mutations Database [Internet]. Versailles‐Saint Quentin en Yvelines, France: SESEP Laboratory/Unit of Cell and Genetics Pathology; 2018 [cited 2018 Jun 8]. Available from: http://www.sesep.uvsq.fr/03_hypo_mutations.php\n\n22 \n\nStenson \nPD \n, \n\nMort \nM \n, \n\nBall \nEV \n, \n\nShaw \nK \n, \n\nPhillips \nAD \n, \n\nCooper \nDN. \n\nThe Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine . \nHum Genet . \n2014 ;133 :1 –9 .\n24077912 \n23 UK10K Consortium; \n\nWalter \nK \n, \n\nMin \nJ \n, \n\nHuang \nJ \n, et al. The UK10K project identifies rare variants in health and disease . \nNature . \n2015 ;526 :82 –90 .\n26367797 \n24 \n\nKoh \nJH \n, \n\nMyong \nJP \n, \n\nYoo \nJ \n, et al. Predisposing factors associated with atypical femur fracture among postmenopausal Korean women receiving bisphosphonate therapy: 8 years’ experience in a single center . \nOsteoporos Int . \n2017 ;28 :3251 –9 .\n28748389 \n25 \n\nAdler \nRA \n, \n\nEl‐Hajj Fuleihan \nG \n, \n\nBauer \nDC \n, et al. Managing osteoporosis in patients on long‐term bisphosphonate treatment: report of a task force of the American Society for Bone and Mineral Research . \nJ Bone Miner Res . \n2016 ;31 :16 –35 .\n26350171 \n26 \n\nWenkert \nD \n, \n\nMcAlister \nWH \n, \n\nCoburn \nSP \n, et al. Hypophosphatasia: nonlethal disease despite skeletal presentation in utero (17 new cases and literature review) . \nJ Bone Miner Res . \n2011 ;26 :2389 –98 .\n21713987 \n27 \n\nMornet \nE \n, \n\nYvard \nA \n, \n\nTaillandier \nA \n, et al. A molecular‐based estimation of the prevalence of hypophosphatasia in the European population . \nAnn Hum Genet . \n2011 ;75 :439 –45 .\n21488855 \n28 \n\nMcKiernan \nFE \n, \n\nBerg \nRL \n, \n\nFuehrer \nJ. \n\nClinical and radiographic findings in adults with persistent hypophosphatasemia . \nJ Bone Miner Res . \n2014 ;29 :1651 –60 .\n24443354 \n29 \n\nWhyte \nMP. \n\nHypophosphatasia: enzyme replacement therapy brings new opportunities and new challenges . \nJ Bone Miner Res . \n2017 ;32 :667 –75 .\n28084648 \n30 \n\nCundy \nT \n, \n\nMichigami \nT \n, \n\nTachikawa \nK \n, et al. Reversible deterioration in hypophosphatasia caused by renal failure with bisphosphonate treatment . \nJ Bone Miner Res . \n2015 ;30 :1726 –37 .\n25736332 \n31 \n\nBowles \nSA \n, \n\nKurdy \nN \n, \n\nDavis \nAM \n, et al. Serum osteocalcin, total and bone‐specific alkaline phosphatase following isolated tibial shaft fracture . \nAnn Clin Biochem . \n1996 ;33 :196 –200 .\n8791981 \n32 \n\nIngle \nBM \n, \n\nHay \nSM \n, \n\nBottjer \nHM \n, et al. Changes in bone mass and bone turnover following distal forearm fracture . \nOsteoporos Int . \n1999 ;10 :399 –407 .\n10591838 \n33 \n\nSchwarz \nD \n, \n\nKisselev \nP \n, \n\nSchunch \nWH \n, et al. Allelic variants of human cytochrome p4501A1 (CYP1A1): effect of T461N and Ia62V substitutions on steroid hydroxylase specificity . \nPharmacogenetics . \n2000 ;10 :519 –30 .\n10975606 \n34 \n\nSaita \nY \n, \n\nIshijima \nM \n, \n\nMogami \nA \n, et al. The incidence of and risk factors for developing atypical femoral fractures in Japan . \nJ Bone Miner Metab . \n2015 ;33 :311 –8 .\n24852205 \n35 \n\nRodriguez \nM \n, \n\nPotter \nDA. \n\nCYP1A1 regulates breast cancer proliferation and survival . \nMol Cancer Res . \n2013 ;11 ;780 –92 .\n23576571 \n36 \n\nJeyabalan \nJ \n, \n\nShah \nM \n, \n\nViollet \nB \n, \n\nChenu \nC. \n\nAMP‐activated protein kinase pathway and bone metabolism . \nJ Endocrinol . \n2012 ;212 ;277 –90 .\n21903861 \n37 \n\nNapoli \nN \n, \n\nVillareal \nDT \n, \n\nMumm \nS \n, et al. Effect of CYP1A1 gene polymorphisms on estrogen metabolism and bone density . \nJ Bone Miner Res . \n2005 ;20 :232 –9 .\n15647817 \n38 \n\nPérez‐Núñez \nI \n, \n\nPérez‐Castrillón \nJL \n, \n\nZarrabeitia \nMT \n, et al. Exon array analysis reveals genetic heterogeneity in atypical femoral fractures . \nA pilot study. Mol Cell Biochem . \n2015 ;409 :45 –50 .\n26160281 \n39 \n\nMahjoub \nZ \n, \n\nJean \nS \n, \n\nLeclerc \nJT \n, et al. Incidence and characteristics of atypical femoral fractures: clinical and geometrical data . \nJ Bone Miner Res . \n2016 ;31 :767 –76 .\n26588590 \n40 \n\nKoh \nJH \n, \n\nMyong \nJP \n, \n\nJung \nSM \n, et al. Atypical femoral fracture in rheumatoid arthritis patients treated with bisphosphonates: a nested case‐control study . \nArthritis Rheumatol . \n2016 ;68 :77 –82 .\n26360133\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2473-4039",
"issue": "3(1)",
"journal": "JBMR plus",
"keywords": "ALPL; ATYPICAL FEMORAL FRACTURES; BISPHOSPHONATES; CYP1A1; GENE MUTATIONS; GGPS1; HYPOPHOSPHATASIA",
"medline_ta": "JBMR Plus",
"mesh_terms": null,
"nlm_unique_id": "101707013",
"other_id": null,
"pages": "29-36",
"pmc": null,
"pmid": "30680361",
"pubdate": "2019-01",
"publication_types": "D016428:Journal Article",
"references": "10591838;10975606;15647817;19561590;20354512;20392236;20676075;20949298;21343577;21488855;21713987;21903861;22275107;22322541;23333322;23352924;23576571;23712442;24077912;24123110;24443354;24852205;25023282;25736332;25741868;26160281;26350171;26360133;26367797;26588590;26769007;26992955;28084648;28467865;28748389;8791981",
"title": "Incidence of Mutations in the ALPL, GGPS1, and CYP1A1 Genes in Patients With Atypical Femoral Fractures.",
"title_normalized": "incidence of mutations in the alpl ggps1 and cyp1a1 genes in patients with atypical femoral fractures"
} | [
{
"companynumb": "ES-SUN PHARMACEUTICAL INDUSTRIES LTD-2019RR-200239",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALENDRONIC ACID"
},
... |
{
"abstract": "BACKGROUND\nInflammatory bowel diseases (IBD) are often treated with anti-tumor necrosis factor alpha (anti-TNFα) medications. Concomitant treatment of IBD with anti-TNFα agents and immunomodulators appears to be associated with an increased risk for lymphoma.\n\n\nMETHODS\nPatients who developed lymphoma while on monotherapy with an anti-TNFα agent were identified at three centers. Institutional Review Board approval was obtained.\n\n\nRESULTS\nFive adolescents and young adult patients with pediatric-onset IBD who were treated with infliximab (IFX) without exposure to thiopurines were subsequently diagnosed with lymphoma. Three of the five patients had bone involvement at presentation. Epstein-Barr virus was positive in 2 cases. Median time from diagnosis of IBD and exposure to IFX prior to diagnosis of lymphoma was 5 and 4.3 years, respectively.\n\n\nCONCLUSIONS\nThis case series reports long-term follow-up for young patients with IBD who were treated with IFX monotherapy and developed lymphoma. Three of the five patients had bone involvement. In general, the risk of lymphoma following exposure to anti-TNFα medications alone remains low, but the incidence of primary bone lymphomas in IBD has not been reported. Studies examining longer exposure times may be needed to determine the true lymphoma risk in patients treated with IFX monotherapy.",
"affiliations": "Pediatric Gastroenterology and Nutrition, Massachusetts General Hospital, CRPZ 5-560, 175 Cambridge Street, Boston, MA, 02114, USA.;Division of Pediatric Gastroenterology, Nutrition, and Liver Diseases, Hasbro Children's Hospital and Rhode Island Hospital, Hasbro Lower Level, 593 Eddy St., Providence, RI, 02903, USA.;Division of Gastroenterology, Brigham and Women's Hospital, Crohn's and Colitis Center, 75 Francis Street, Boston, MA, 02115, USA.;Pediatric Gastroenterology and Nutrition, Massachusetts General Hospital, CRPZ 5-560, 175 Cambridge Street, Boston, MA, 02114, USA.;Division of Pediatric Gastroenterology, Nutrition, and Liver Diseases, Hasbro Children's Hospital and Rhode Island Hospital, Hasbro Lower Level, 593 Eddy St., Providence, RI, 02903, USA.;Division of Pediatric Gastroenterology, Nutrition, and Liver Diseases, Hasbro Children's Hospital and Rhode Island Hospital, Hasbro Lower Level, 593 Eddy St., Providence, RI, 02903, USA.;Pediatric Gastroenterology and Nutrition, Massachusetts General Hospital, CRPZ 5-560, 175 Cambridge Street, Boston, MA, 02114, USA.;Department of Pathology, Rhode Island Hospital, The Miriam Hospital, Brown University, Box G-E5, Providence, RI, 02912, USA.;Division of Gastroenterology, Beth Israel Deaconess Medical Center, Beth Israel Deaconess Med Ctr., 330 Brookline Avenue, Rabb Rose 1, Boston, MA, 02215, USA.;Division of Gastroenterology, Beth Israel Deaconess Medical Center, Beth Israel Deaconess Med Ctr., 330 Brookline Avenue, Rabb Rose 1, Boston, MA, 02215, USA.;Division of Gastroenterology, Brigham and Women's Hospital, Crohn's and Colitis Center, 75 Francis Street, Boston, MA, 02115, USA.;Division of Gastroenterology, Brigham and Women's Hospital, Crohn's and Colitis Center, 75 Francis Street, Boston, MA, 02115, USA.;Pediatric Gastroenterology and Nutrition, Massachusetts General Hospital, CRPZ 5-560, 175 Cambridge Street, Boston, MA, 02114, USA. hwinter@mgh.harvard.edu.",
"authors": "Llanos-Chea|Alejandro|A|;Shapiro|Jason M|JM|;Winter|Rachel W|RW|;Jerger|Logan|L|;Menz|Timothy|T|;Gibson|Meghan|M|;Friedmann|Alison M|AM|;Treaba|Diana|D|;Papamichael|Konstantinos|K|;Cheifetz|Adam S|AS|;Friedman|Sonia|S|;Hamilton|Matthew J|MJ|;Winter|Harland S|HS|http://orcid.org/0000-0003-1122-4811",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1007/s10620-021-06884-9",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0163-2116",
"issue": null,
"journal": "Digestive diseases and sciences",
"keywords": "ANTI-TNFα; Adolescent; Inflammatory bowel diseases; Infliximab; Lymphoma; Young adult",
"medline_ta": "Dig Dis Sci",
"mesh_terms": null,
"nlm_unique_id": "7902782",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33595782",
"pubdate": "2021-02-17",
"publication_types": "D016428:Journal Article",
"references": "24462626;22271569;25698636;29114832;19558997;19274799;23032984;28193515;29762681;32840893;21398581;15831904;11677199;11241255;19828563;24444171;22147207;15138212;28038706;11781282;19837455;23574759;23891975;22031357;22902264",
"title": "Lymphoma in Pediatric-Onset Inflammatory Bowel Disease Treated with Infliximab Monotherapy: A Case Series.",
"title_normalized": "lymphoma in pediatric onset inflammatory bowel disease treated with infliximab monotherapy a case series"
} | [
{
"companynumb": "US-PFIZER INC-2021227116",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "1",
... |
{
"abstract": "Biological immune-modulator drugs, especially inhibitors of tumor necrosis factor-α, are frequently encountered in modern clinical practice and opportunistic infections are therefore a common concern. Infective pericarditis has been described as a complication of these treatments with possible life-threatening consequences. In similar cases cultures may isolate multiple opportunistic bacteria from the pericardial fluid without specific identification of the responsible germ, representing a problem for targeted antibiotic therapy. We present a case of acute pericarditis evolving in pericardial constriction and cardiac tamponade in a patient treated with adalimumab for psoriatic arthritis overlapping with recurrent polychondritis. Next-generation sequencing allowed the identification of a common oral pathogen as the aetiological agent confirming its role in the identification of species that can be overlooked by common microbiological techniques.",
"affiliations": "Cardiovascular Department, \"Ospedali Riuniti\" and University of Trieste, Trieste, Italy.;Institute for Maternal and Child Health, IRCCS \"Burlo Garofolo\", Trieste, Italy Department of Medical Sciences, University of Trieste, Trieste, Italy.;Medical Specialties Department, \"Ospedali Riuniti\" and University of Trieste, Trieste, Italy.;Cardiovascular Department, \"Ospedali Riuniti\" and University of Trieste, Trieste, Italy.",
"authors": "Poli|Stefano|S|http://orcid.org/0000-0003-4987-262X;Comar|Manola|M|;Luzzati|Roberto|R|;Sinagra|Gianfranco|G|",
"chemical_list": "D000900:Anti-Bacterial Agents; D007155:Immunologic Factors; D000068879:Adalimumab",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2016()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000068879:Adalimumab; D000900:Anti-Bacterial Agents; D002305:Cardiac Tamponade; D006801:Humans; D007155:Immunologic Factors; D008297:Male; D008875:Middle Aged; D009894:Opportunistic Infections; D010490:Pericardial Effusion; D010493:Pericarditis; D017422:Sequence Analysis, DNA; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "27571913",
"pubdate": "2016-08-29",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "25083725;17127203;24778855;22605835;15725041;26143497;9784541;19359261;24782175;19716440;12355476;24896819",
"title": "Molecular diagnosis of opportunistic pericardial infection in a patient treated with adalimumab: the role of next-generation sequencing.",
"title_normalized": "molecular diagnosis of opportunistic pericardial infection in a patient treated with adalimumab the role of next generation sequencing"
} | [
{
"companynumb": "IT-MYLANLABS-2017M1024176",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": "3",
... |
{
"abstract": "Quetiapine, an atypical antipsychotic, is widely used to treat delirium in intensive care units (ICUs). Studies demonstrate its efficacy and favorable safety profile. We report a case of an elderly patient who developed clinical and biochemical evidence of neuroleptic malignant syndrome (NMS) 5 days after quetiapine was commenced. Signs of NMS resolved after discontinuation of quetiapine and administration of dantrolene. Quetiapine-induced NMS has occurred with long-term use in the elderly in the outpatient setting. However, NMS has not previously been reported after treatment of ICU delirium. NMS is an important complication to consider before prescribing quetiapine in the ICU.",
"affiliations": "From the Department of Anaesthesia and Intensive Care Medicine, Beaumont Hospital, Dublin, Ireland.",
"authors": "Nestor|C|C|;O'Brien|D|D|;Dwyer|R|R|",
"chemical_list": "D014150:Antipsychotic Agents; D000069348:Quetiapine Fumarate; D003620:Dantrolene",
"country": "United States",
"delete": false,
"doi": "10.1213/XAA.0000000000001318",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2575-3126",
"issue": "14(11)",
"journal": "A&A practice",
"keywords": null,
"medline_ta": "A A Pract",
"mesh_terms": "D000368:Aged; D014150:Antipsychotic Agents; D003422:Critical Care; D003620:Dantrolene; D006801:Humans; D009459:Neuroleptic Malignant Syndrome; D000069348:Quetiapine Fumarate",
"nlm_unique_id": "101714112",
"other_id": null,
"pages": "e01318",
"pmc": null,
"pmid": "32985851",
"pubdate": "2020-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Neuroleptic Malignant Syndrome Secondary to Quetiapine in Critical Care: A Case Report.",
"title_normalized": "neuroleptic malignant syndrome secondary to quetiapine in critical care a case report"
} | [
{
"companynumb": "IE-ALKEM LABORATORIES LIMITED-IE-ALKEM-2020-07338",
"fulfillexpeditecriteria": "1",
"occurcountry": "IE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "QUETIAPINE FUMARATE"
},
... |
{
"abstract": "Isolated cases of pulmonary arterial hypertension (PAH) in patients treated with interferon (IFN) α or β have been reported in the literature. The aim of this study was to describe all consecutive cases of PAH patients with a history of IFN exposure identified in the French reference centre for severe pulmonary hypertension between 1998 and 2012. A total of 53 patients with PAH and a history of IFN therapy were identified. 48 patients had been treated with IFNα for chronic hepatitis C. Most of them had portal hypertension (85%) and 56% had HIV co-infection. Five additional patients had been treated with IFNβ for multiple sclerosis. The diagnosis of PAH was made within 3 years after IFN therapy in 66% of patients. Repeated haemodynamic assessment was available in 13 out of 16 patients exposed to IFN after the diagnosis of PAH. Increased pulmonary vascular resistance >20% was observed in 11 out of 13 cases (median 43% increase; IQR 32-67%). In five of these patients, IFN withdrawal resulted in spontaneous haemodynamic improvement. This retrospective analysis suggests that IFN therapy may trigger PAH. However, most of these patients had other risk factors for PAH. A prospective case-control study is necessary to definitively establish a link between IFN exposure and PAH.",
"affiliations": "Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France laurent.savale@bct.aphp.fr.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France Univ. Paris-sud, Faculté de Pharmacie, Châtenay Malabry, France AP-HP, Service de Pharmacie, Hôpital Antoine Béclère, Clamart, France.;UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France Univ. Paris-sud, Faculté de Pharmacie, Châtenay Malabry, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.;Université Paris-Sud, Faculté de Médecine, Le Kremlin Bicêtre, France AP-HP, Centre de Référence de l'Hypertension Pulmonaire Sévère, Département Hospitalo-Universitaire (DHU) Thorax Innovation (TORINO), Service de Pneumologie, Hôpital de Bicêtre, Le Kremlin Bicêtre, France UMR_S 999, INSERM, Laboratoire d'Excellence (LabEx) en Recherche sur le Médicament et l'Innovation Thérapeutique (LERMIT), Centre Chirurgical Marie Lannelongue, Le Plessis Robinson, France.",
"authors": "Savale|Laurent|L|;Sattler|Caroline|C|;Günther|Sven|S|;Montani|David|D|;Chaumais|Marie-Camille|MC|;Perrin|Swanny|S|;Jaïs|Xavier|X|;Seferian|Andrei|A|;Jovan|Roland|R|;Bulifon|Sophie|S|;Parent|Florence|F|;Simonneau|Gérald|G|;Humbert|Marc|M|;Sitbon|Olivier|O|",
"chemical_list": "D000998:Antiviral Agents; D007155:Immunologic Factors; D016898:Interferon-alpha; D016899:Interferon-beta",
"country": "England",
"delete": false,
"doi": "10.1183/09031936.00057914",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0903-1936",
"issue": "44(6)",
"journal": "The European respiratory journal",
"keywords": null,
"medline_ta": "Eur Respir J",
"mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D015331:Cohort Studies; D060085:Coinfection; D005260:Female; D005602:France; D015658:HIV Infections; D019698:Hepatitis C, Chronic; D006801:Humans; D006975:Hypertension, Portal; D006976:Hypertension, Pulmonary; D007155:Immunologic Factors; D016898:Interferon-alpha; D016899:Interferon-beta; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D008297:Male; D008875:Middle Aged; D009103:Multiple Sclerosis; D012189:Retrospective Studies; D012307:Risk Factors; D013997:Time Factors",
"nlm_unique_id": "8803460",
"other_id": null,
"pages": "1627-34",
"pmc": null,
"pmid": "25323231",
"pubdate": "2014-12",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Pulmonary arterial hypertension in patients treated with interferon.",
"title_normalized": "pulmonary arterial hypertension in patients treated with interferon"
} | [
{
"companynumb": "FR-BIOGENIDEC-2015BI006171",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "INTERFERON BETA-1A"
},
"drugadditional": nu... |
{
"abstract": "Viridians streptococcal shock syndrome is a subtype of toxic shock syndrome. Frequently, the diagnosis is missed initially because the clinical features are nonspecific. However, it is a rapidly progressive disease, manifested by hypotension, rash, palmar desquamation, and acute respiratory distress syndrome within a short period. The disease course is generally fulminant and rarely presents initially as a purpura over the plantar region. We present a case of a 54-year-old female hospital worker diagnosed with viridians streptococcal shock syndrome caused by Streptococcus gordonii. Despite aggressive antibiotic treatment, fluid hydration, and use of inotropes and extracorporeal membrane oxygenation, the patient succumbed to the disease. Early diagnosis of the potentially fatal disease followed by a prompt antibiotic regimen and appropriate use of steroids are cornerstones in the management of this disease to reduce the risk of high morbidity and mortality.",
"affiliations": "Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Cardiovascular Surgery, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.;Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan.",
"authors": "Liao|Chen-Yi|CY|;Su|Kuan-Jen|KJ|;Lin|Cheng-Hui|CH|;Huang|Shu-Fang|SF|;Chin|Hsien-Kuo|HK|;Chang|Chin-Wen|CW|;Kuo|Wu-Hsien|WH|;Ben|Ren-Jy|RJ|;Yeh|Yen-Cheng|YC|",
"chemical_list": null,
"country": "Egypt",
"delete": false,
"doi": "10.1155/2016/9463895",
"fulltext": "\n==== Front\nCan J Infect Dis Med MicrobiolCan J Infect Dis Med MicrobiolCJIDMMThe Canadian Journal of Infectious Diseases & Medical Microbiology = Journal Canadien des Maladies Infectieuses et de la Microbiologie Médicale1712-95321918-1493Hindawi Publishing Corporation 10.1155/2016/9463895Case ReportPlantar Purpura as the Initial Presentation of Viridians Streptococcal Shock Syndrome Secondary to Streptococcus gordonii Bacteremia Liao Chen-Yi \n1\n\n*\nSu Kuan-Jen \n1\nLin Cheng-Hui \n1\nHuang Shu-Fang \n1\nChin Hsien-Kuo \n2\nChang Chin-Wen \n1\nKuo Wu-Hsien \n1\nBen Ren-Jy \n1\nYeh Yen-Cheng \n1\n1Department of Internal Medicine, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan2Department of Cardiovascular Surgery, Kaohsiung Armed Forces General Hospital, No. 2 Zhongzheng 1st Road, Lingya District, Kaohsiung 802, Taiwan*Chen-Yi Liao: ericliao0217@gmail.com2016 17 4 2016 2016 946389517 9 2015 1 1 2016 Copyright © 2016 Chen-Yi Liao et al.2016This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Viridians streptococcal shock syndrome is a subtype of toxic shock syndrome. Frequently, the diagnosis is missed initially because the clinical features are nonspecific. However, it is a rapidly progressive disease, manifested by hypotension, rash, palmar desquamation, and acute respiratory distress syndrome within a short period. The disease course is generally fulminant and rarely presents initially as a purpura over the plantar region. We present a case of a 54-year-old female hospital worker diagnosed with viridians streptococcal shock syndrome caused by Streptococcus gordonii. Despite aggressive antibiotic treatment, fluid hydration, and use of inotropes and extracorporeal membrane oxygenation, the patient succumbed to the disease. Early diagnosis of the potentially fatal disease followed by a prompt antibiotic regimen and appropriate use of steroids are cornerstones in the management of this disease to reduce the risk of high morbidity and mortality.\n==== Body\n1. Introduction\nToxic shock syndrome (TSS) is an acute, toxin-mediated, and life-threatening illness, generally precipitated by infection with either Staphylococcus aureus or group A beta-hemolytic Streptococcus (GAS; Streptococcus pyogenes). It is characterized by high fever, rash, hypotension, multiorgan failure (involving at least three or more organ systems), and desquamation, typically of the palms and soles, 1-2 weeks after the onset of acute illness. Recently, a growing number of cases of another toxic shock-like syndrome manifested by alpha-hemolytic (viridians) streptococci named “viridians streptococcal shock syndrome” (VSSS) have been reported. The diagnosis usually requires microbiological evidence of viridians group streptococci (VGS) from blood culture and clinical manifestation characterized by hypotension, rash, palmar desquamation, and adult respiratory distress syndrome. The typical dermatologic presentation of VSSS generally starts with a rash and desquamation of the palms or soles, which occur 8–14 days after the onset of infection, presenting with a maculopapular appearance centrifugally spreading from the trunk to the face and extremities. VSSS may occur early or within 2-3 days after presentation and progress to respiratory failure within 48 h.\n\nThe viridians group streptococci (VGS) are a group of catalase-negative, Gram-positive cocci composed of heterogeneous groups of organisms with complex and controversial taxonomy. They are subclassified into six major groups, including the S. mutans group, S. salivarius group, S. anginosus group, S. mitis group, S. sanguinis group, and S. bovis group [1, 2]. Some taxonomists have lumped the S. sanguinis group in with the S. mitis group based on 16S rRNA gene sequence analysis, but S. sanguinis group organisms exhibit divergent phenotypic characteristics. The S. sanguinis group includes S. sanguinis, S. parasanguinis, and S. gordonii [1]. The VGS are pathogens with low virulence that are generally commensal in the oral cavity, upper airways, the gastrointestinal tract, and the female genital tract [3–5]. These organisms may invade sterile body sites, causing a series of infectious diseases such as orbital cellulitis [6], endophthalmitis [7], pneumonia [8], vertebral osteomyelitis [9], and bacteremia [10] and may even lead to life-threatening diseases such as endocarditis [2], meningitis [5], and toxic shock-like syndrome [4]. Although VGS disease may occur in healthy hosts, it most commonly manifests in those with underlying conditions, including immunosuppression or cardiac abnormalities [2].\n\nThe clinical presentation of S. gordonii infection may present as subacute bacterial endocarditis [11], septic arthritis [12], spontaneous bacterial peritonitis [13], and multiple subcutaneous abscesses [14].\n\nTo our knowledge, S. gordonii has never been reported as indolent prodrome with plantar pupular and rapid progressive VSSS. We present a case of a 54-year-old female with S. gordonii-related VSSS with a fatal outcome.\n\n2. Case Presentation\nA 54-year-old female hospital worker with a history of gout and valvular heart disease with moderate mitral regurgitation presented to the emergency department with a 1-month history of intermittent left foot pain and numbness extending from the knee to the calf region. She then developed acute upper respiratory tract infection, presenting with sore throat, rhinorrhea, and productive cough 11 days prior to admission. Subsequently, she had visited the orthopedic and neurology outpatient department 7 days prior to admission because of progressive numbness in the left calf region and limited range of motion when lifting her left foot, with symptoms persisting despite meticulous examination and treatment. She experienced poor appetite, general malaise, progressive arthralgia, and myalgia, particularly in the left foot. She had also called the dermatology outpatient department 3 days prior to admission because of progressive petechiae and purpura formation on her left plantar region. The patient used anxiolytic agents and sleeping pills. She denied the use of illicit drugs. She had no recent history of traveling. Besides, she had dental extraction 2 years ago with proper dentition. Physical examination revealed normal body temperature (35.9 degrees Celsius), rapid heart rate (110 beats/min), and low blood pressure (71/46 mmHg). The facial skin was intact, and there was no erythema, rash, or blisters. Examination of the oral cavity revealed an edematous tongue, pharynx, and buccal mucosa with no appearance of mucositis. Neck stiffness and localizing neurological signs were not observed, and her Glasgow coma score was 14. No redness of eye, vision changes, conjunctival suffusion, or Roth spots were noticed in eye examination. Her left lower limb examination was unremarkable with respect to soft tissue or skeletal injury. No desquamation of palms, Osler's node, or Janeway lesion was observed. Purpura on the left plantar region in the absence of blisters was observed 3 days prior to admission (Figure 1(a)), and petechiae on the lower abdomen (Figure 1(b)) and the left knee region (Figure 1(c)) were noticed 5 days prior to admission. The arms, posterior back, and right leg did not have any skin rash. No obvious pitting edema over the left lower limb and knee joint was noted (Figure 1(c)). No joint effusion or bone pains were noticed. Palpation of the soft tissues was nontender, with no signs of grimacing or withdrawal, and the consistency was soft with no signs of compartment syndrome. Active movements at the hip, knee, and ankle joints were within the normal range and not associated with pain. All peripheral pulses were normal with satisfactory capillary circulation. No dysesthesia or loss of proprioception was noticed in the lower extremity. Laboratory investigation revealed mild anemia with a hemoglobin of 109 g/L (normal range, 115–155), platelet count of 175 × 109/L (normal range, 150–400), leukocytosis with a white blood cell count of 25.0 × 109/L (normal range, 4.0–11.0), and a marked elevation of neutrophils (93.8%). Total bilirubin was 4.27 μmol/L (normal range, 5.1–17.1), alanine aminotransferase was 0.78 μkat/L (normal range, 0.11–0.86), aspartate aminotransferase was 0.43 μkat/L (normal range, 0.21–0.65), creatinine was 106.7 μmol/L (normal range, 53.3–99.1), C-reactive protein was 114.8 nmol/L (normal, <9.5), and albumin was 15 g/L (normal range, 35–57). Urine examination showed mild proteinuria, leukocyturia, and erythrocyturia.\n\nInitial chest X-ray revealed an increased lung marking over the right lower lung. A provisional diagnosis of cellulitis was made, and, upon microbiological advice, treatment was commenced with oxacillin (2 g) administered intravenously every 4 h as an empirical regimen. The patient started to have hemoptysis, developed hypotension, and progressive respiratory distress within 2 hours after admission. She was transferred to the intensive care unit (ICU) in acute respiratory failure (arterial blood gas analysis revealed a pH of 7.233, a pCO2 of 63.5 mmHg, and a pO2 of 44.4 mmHg with an FiO2 of 40%) and was intubated and placed on a ventilator. A second chest X-ray showed bilateral consolidation with a snowflake pattern (Figure 2(a)). Subsequently, the patient was placed on a lung-protective strategy and shifted to broad-spectrum antibiotics, including vancomycin (1.0 g) administered intravenously every 12 h, ceftriaxone (2.0 g) administered intravenously every day, and ciprofloxacin (400 mg) administered intravenously every 12 h. Chest computed tomography demonstrated diffuse alveolar and bilateral lung interstitial infiltrations with a presentation compatible with acute respiratory distress syndrome (ARDS; Figure 2(b)). While arriving at the intensive care unit, she developed unstable atrial fibrillation and returned to sinus rhythm after administration of antiarrhythmic agents (amiodarone) and three series of successful cardioversions. Transthoracic echocardiography showed mild to moderate mitral regurgitation and no evidence of vegetation. Because of the occurrence of refractory ARDS with severe hypercapnia and hypoxemia, the patient received 3 h of venovenous extracorporeal membrane oxygenation (ECMO) 1 day after admission (arterial blood gas analysis revealed a pH of 7.523, a pCO2 of 24.8 mmHg, and a pO2 of 50.3 mmHg with an FiO2 of 100%). Despite the administration of inotropic agents and high-dose norepinephrine, the patient succumbed to the disease after progressive bradycardia and fulminant shock.\n\nBecause of episodes of hemoptysis and a clinical picture of probable alveolar hemorrhage, we requested a complete infectious survey for possible etiology, including sputum culture, tuberculosis/acid fast stain, serology with enzyme-linked immunosorbent assay (ELISA) for Hantavirus, microscopic agglutination test for leptospirosis, and ELISA for human immunodeficiency virus (HIV), which eventually yielded unremarkable results. Autopsy was unavailable because of denial from the family; thus no objective evidence of bacterial endocarditis from heart tissue was obtained. The growth of S. gordonii was observed by 2 sets of blood cultures collected 4 hours apart using Becton Dickinson Diagnostic Instrument Systems (BACTEC). The blood culture was done on admission and showed positivity 3 days later. The bacterial isolates showed susceptibility to clindamycin, ceftriaxone, vancomycin, erythromycin, and levofloxacin.\n\n3. Discussion\nA definitive diagnosis was not made prior to death because of the rapid disease progression after admission following an 11-day mild prodrome. The possible reasons for this delay include the vague history and nonspecific clinical features, the absence of a clinically detectable septic focus in a previously healthy patient, and the time required for organisms to be cultured in the laboratory. The blood culture in our patient yielded S. gordonii, which belongs to the S. sanguinis group, and is one of the VGS, a genetically heterogeneous group of bacteria predominating in the human oropharynx [15]. The risk factors associated with VGS that have been identified are oral mucositis [16], profound neutropenia, high-dose chemotherapy like cytosine arabinoside, malignancy, particularly in pediatric patients with leukemia [17] and neutropenic cancer [10] and patients undergoing stem-cell transplants [18], antimicrobial prophylaxis with trimethoprim-sulfamethoxazole or fluoroquinolone, and the use of antacids, histamine type 2 receptor antagonists, or proton pump inhibitors [19, 20]. Our patient did not have oral symptoms and showed no evidence of mucositis. Mucositis is the most common route of entry for these organisms; however, in the study conducted by Gamis et al., nearly half of the cases of bacteremia (45%) occurred in patients without mucositis, suggesting that other mechanisms of entry are also important. In those that became bacteremic in the absence of mucositis, gastrointestinal toxicity was implicated as a potential risk factor [21].\n\nThe clinical course of VGS bacteremia is variable. Most cases present with minimal symptoms with complete recovery; others may present with a toxic shock-like syndrome known as VSSS characterized by hypotension, rash, palmar desquamation, and ARDS developing upon the onset of bacteremia in approximately 25% in the normal population [10] and in 13%–21% in children after bone marrow transplantation [18]. The mortality rate among patients with VGS bacteremia who develop complications is high: up to 80% in some case series and between 40% and 100% in children [18]. The current reported VGS species related VSSS include S. mitis, S. oralis, and S. viridans [20]. S. mitis is the most common VGS species associated with VSSS compared to non-S. mitis organisms [2, 19]. According to a study by Shelburne et al., patients infected with S. mitis strains were more likely to have moderate or severe clinical disease (e.g., VSSS) than those infected with non-S. mitis strains [22]. Although S. gordonii is one of the S. sanguinis group strains, it has seldom been reported as being implicated in VSSS.\n\nThe blood culture of S. gordonii in our patient showed susceptibility to clindamycin, ceftriaxone, vancomycin, erythromycin, and levofloxacin. Despite antibiotic therapy with vancomycin, ceftriaxone, and ciprofloxacin (quinolone), our patient succumbed to the VSSS which may be due to delayed proper antibiotic use in face of the mild prodrome. Through selective pressure, antibiotics that target Gram-negative organisms, such as quinolones, may promote VGS expansion and increase the risk of a patient becoming bacteremic [23]. A study conducted by Han et al. showed that isolation of a levofloxacin-resistant organism was linked to prophylactic use of quinolones [19]. Yacoub et al. proposed that the administration of moderate dose corticosteroids with short administration duration may be beneficial for preventing the development of ARDS in patients with S. mitis bacteremia [20]. Yacoub et al. carried out a study among a group of VSSS patients and reported a 100% recovery from ARDS. Though the case number is small, the study results may give VSSS a novel direction for effective therapy [20]. Our patient did not receive corticosteroid therapy during the hospital course due to no definite evidence of initial corticosteroid use according to the ARDS therapy guidelines.\n\nVGS endocarditis generally presents with an indolent course, involving prolonged low-grade fever and a variety of somatic complaints such as arthralgia, myalgia, weight loss, rigors, fatigue, weakness, and diaphoresis, which are symptoms mimicking the clinical course described in the present case. Infective endocarditis is a life-threatening disease caused by a bacterial infection of the endocardial surfaces of the heart. The oral pathogen S. gordonii is among the most common pathogens isolated from infective endocarditis patients. S. gordonii initiates dental plaque formation and endocarditis by entering into the blood stream, generally upon oral trauma [24]. S. gordonii colonizes platelet-fibrin thrombi, blood-clotting agents, in damaged heart valves or the endocardium, leading to damage and dysfunction of the heart valves [25].\n\nTEE (transesophageal echocardiogram) is unavailable in our case and transthoracic echocardiography showed mild to moderate mitral regurgitation and no evidence of vegetation. The relevant pathogen in our patient fulfilled one major criterion according to the modified Duke infective endocarditis criteria [26]. The past history of mitral regurgitation in our patient is a probable predisposing risk factor for the development of VGS endocarditis. However, the patient had no fever, vascular phenomena, or immunologic phenomena, which makes the current case fulfill only one minor criterion. The plantar lesion with the presentation of scattered purpura does not mimic the clinical presentation of typical Janeway lesion which is the common vascular phenomena of infective endocarditis manifested as irregular painless erythematous macules on the palm and soles. Thus, according to the modified Duke infective endocarditis criteria, infective endocarditis in our patient could be possible. We could not completely exclude this diagnosis because of the lack of TEE. In our patient, the indolent symptoms were indicative prodrome of endocarditis and 11 days later the patient developed VSSS.\n\n4. Conclusion\nThe atypical presentation of S. gordonii-related VSSS in our case included a mild prodrome including myalgia, arthralgia, and purpura with dominant symptoms only on the left foot lasting for approximately 2 weeks, which is easily overlooked and misdiagnosed. The disease course rapidly progressed into shock and ARDS within only 1 day of hospitalization, despite aggressive treatment. This patient had many demanding care issues to be treated in a quickly moving scenario; however, early identification of this prodrome with timely antibiotic use and corticosteroids might be beneficial in cases with VSSS.\n\nAcknowledgments\nThe authors wish to thank Dr. Yen-Cheng Yeh for his assistance in this case and thank Steve kerr for English proofreading.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and accompanying images.\n\nCompeting Interests\nThe authors declare that they have no competing interests.\n\nFigure 1 (a) A tattoo-like purpuric rash over the left plantar region was observed. (b) Petechiae on the lower abdomen region. (c) Petechiae on the left knee region with no obvious pitting edema on the left lower limb or knee joint were noted.\n\nFigure 2 (a) A second chest X-ray showed bilateral consolidation with a snowflake pattern (8 h upon admission). (b) Chest computed tomography of the lungs demonstrated diffuse bilateral alveolar and interstitial infiltrations with a presentation compatible with acute respiratory distress syndrome (ARDS).\n==== Refs\n1 Facklam R. What happened to the streptococci: overview of taxonomic and nomenclature changes Clinical Microbiology Reviews 2002 15 4 613 630 10.1128/cmr.15.4.613-630.2002 2-s2.0-0036779816 12364372 \n2 Doern C. D. Burnham C.-A. It's not easy being green: the viridans group streptococci, with a focus on pediatric clinical manifestations Journal of Clinical Microbiology 2010 48 11 3829 3835 10.1128/jcm.01563-10 2-s2.0-78049517994 20810781 \n3 Bek-Thomsen M. Tettelin H. Hance I. Nelson K. E. Kilian M. Population diversity and dynamics of Streptococcus mitis , Streptococcus oralis , and Streptococcus infantis in the upper respiratory tracts of adults, determined by a nonculture strategy Infection and Immunity 2008 76 5 1889 1896 10.1128/iai.01511-07 2-s2.0-42949110740 18316382 \n4 Lu H.-Z. Weng X.-H. Zhu B. Major outbreak of toxic shock-like syndrome caused by Streptococcus mitis \n Journal of Clinical Microbiology 2003 41 7 3051 3055 10.1128/jcm.41.7.3051-3055.2003 2-s2.0-0037493116 12843042 \n5 Kutlu S. S. Sacar S. Cevahir N. Turgut H. Community-acquired Streptococcus mitis meningitis: a case report International Journal of Infectious Diseases 2008 12 6 e107 e109 10.1016/j.ijid.2008.01.003 2-s2.0-54349086385 18378176 \n6 Seltz L. B. Smith J. Durairaj V. D. Enzenauer R. Todd J. Microbiology and antibiotic management of orbital cellulitis Pediatrics 2011 127 3 e566 e572 10.1542/peds.2010-2117 2-s2.0-79952225593 21321025 \n7 Kuriyan A. E. Weiss K. D. Flynn H. W. Jr. Endophthalmitis caused by streptococcal species: clinical settings, microbiology, management, and outcomes American Journal of Ophthalmology 2014 157 4 774.e1 780.e1 10.1016/j.ajo.2013.12.026 2-s2.0-84896070552 24418264 \n8 Choi S. H. Cha S. I. Choi K. J. Clinical characteristics of community-acquired viridans Streptococcal pneumonia \n Tuberculosis and Respiratory Diseases 2015 78 3 196 202 10.4046/trd.2015.78.3.196 26175772 \n9 Murillo O. Roset A. Sobrino B. Streptococcal vertebral osteomyelitis: multiple faces of the same disease Clinical Microbiology and Infection 2014 20 1 O33 O38 10.1111/1469-0691.12302 2-s2.0-84890804901 23889700 \n10 Tunkel A. R. Sepkowitz K. A. Infections caused by viridans streptococci in patients with neutropenia Clinical Infectious Diseases 2002 34 11 1524 1529 10.1086/340402 2-s2.0-0036604476 12015700 \n11 Teixeira P. G. Thompson E. Wartman S. Woo K. Infective endocarditis associated superior mesenteric artery pseudoaneurysm Annals of Vascular Surgery 2014 28 6 1563.e1 1563.e5 10.1016/j.avsg.2014.03.032 2-s2.0-84905098008 24704049 \n12 Yombi J. C. Belkhir L. Jonckheere S. \nStreptococcus gordonii septic arthritis : two cases and review of literature BMC Infectious Diseases 2012 12, article 215 10.1186/1471-2334-12-215 2-s2.0-84866098971 \n13 Cheung C. Y. Cheng N. H. Y. Chau K. F. Li C. S. \nStreptococcus gordonii peritonitis in a patient on CAPD Renal Failure 2011 33 2 242 243 10.3109/0886022x.2011.552146 2-s2.0-79951967023 21332347 \n14 Esposito S. Avallone L. Massari A. \nStreptococcus gordonii extensive multiple subcutaneous abscesses Infezioni in Medicina 2011 19 3 189 193 2-s2.0-80054772946 22037441 \n15 The Human Microbiome Project Consortium Structure, function and diversity of the healthy human microbiome Nature 2012 486 207 214 10.1038/nature11234 22699609 \n16 Husain E. Whitehead S. Castell A. Thomas E. E. Speert D. P. \nViridans streptococci bacteremia in children with malignancy: relevance of species identification and penicillin susceptibility Pediatric Infectious Disease Journal 2005 24 6 563 566 10.1097/01.inf.0000164708.21464.03 2-s2.0-20544436718 15933573 \n17 Lewis V. Yanofsky R. Mitchell D. Predictors and outcomes of viridans group streptococcal infections in pediatric acute myeloid leukemia: from the Canadian infections in AML research group Pediatric Infectious Disease Journal 2014 33 2 126 129 10.1097/inf.0000000000000058 2-s2.0-84893025294 24064558 \n18 Gassas A. Grant R. Richardson S. Predictors of viridans streptococcal shock syndrome in bacteremic children with cancer and stem-cell transplant recipients Journal of Clinical Oncology 2004 22 7 1222 1227 10.1200/JCO.2004.09.108 2-s2.0-2142648657 15051769 \n19 Han X. Y. Kamana M. Rolston K. V. I. Viridans streptococci isolated by culture from blood of cancer patients: clinical and microbiologic analysis of 50 cases Journal of Clinical Microbiology 2006 44 1 160 165 10.1128/jcm.44.1.160-165.2006 2-s2.0-30744469396 16390964 \n20 Yacoub A. T. Mojica L. Jones L. Knab A. Alrabaa S. Greene J. N. The role of corticosteroids in adult respiratory distress syndrome caused by viridans group streptococci bacteremia in neutropenic patients Mediterranean Journal of Hematology and Infectious Diseases 2014 6 e2014055 10.4084/mjhid.2014.055 \n21 Gamis A. S. Howells W. B. DeSwarte-Wallace J. Feusner J. H. Buckley J. D. Woods W. G. Alpha streptococcal infection during intensive treatment for acute myeloid leukemia: a report from the children's cancer group study CCG-2891 Journal of Clinical Oncology 2000 18 9 1845 1855 2-s2.0-0034184082 10784625 \n22 Shelburne S. A. Sahasrabhojane P. Saldana M. \nStreptococcus mitis strains causing severe clinical disease in cancer patients Emerging Infectious Diseases 2014 20 5 762 771 10.3201/eid2005.130953 2-s2.0-84898846252 24750901 \n23 Razonable R. R. Litzow M. R. Khaliq Y. Piper K. E. Rouse M. S. Patel R. Bacteremia due to viridans group Streptococci with diminished susceptibility to Levofloxacin among neutropenic patients receiving levofloxacin prophylaxis Clinical Infectious Diseases 2002 34 11 1469 1474 10.1086/340352 2-s2.0-0036604492 12015693 \n24 Azam S. S. Shamim A. An insight into the exploration of druggable genome of Streptococcus gordonii for the identification of novel therapeutic candidates Genomics 2014 104 3 203 214 10.1016/j.ygeno.2014.07.007 2-s2.0-84922613063 25068724 \n25 Plummer C. Douglas C. W. I. Relationship between the ability of oral streptococci to interact with platelet glycoprotein Ibα and with the salivary low-molecular-weight mucin, MG2 FEMS Immunology and Medical Microbiology 2006 48 3 390 399 10.1111/j.1574-695x.2006.00161.x 2-s2.0-33750951032 17069618 \n26 Tissières P. Gervaix A. Beghetti M. Jaeggi E. T. Value and limitations of the von Reyn, Duke, and modified Duke criteria for the diagnosis of infective endocarditis in children Pediatrics 2003 112 6 p. e467 10.1542/peds.112.6.e467 2-s2.0-0642303120\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1712-9532",
"issue": "2016()",
"journal": "The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale",
"keywords": null,
"medline_ta": "Can J Infect Dis Med Microbiol",
"mesh_terms": null,
"nlm_unique_id": "101226876",
"other_id": null,
"pages": "9463895",
"pmc": null,
"pmid": "27366188",
"pubdate": "2016",
"publication_types": "D016428:Journal Article",
"references": "12364372;18316382;15051769;24704049;21321025;17069618;25237468;26175772;12015700;25068724;22699609;22974507;15933573;12843042;21332347;24750901;24064558;18378176;22037441;24418264;23889700;20810781;12015693;16390964;10784625;14654647",
"title": "Plantar Purpura as the Initial Presentation of Viridians Streptococcal Shock Syndrome Secondary to Streptococcus gordonii Bacteremia.",
"title_normalized": "plantar purpura as the initial presentation of viridians streptococcal shock syndrome secondary to streptococcus gordonii bacteremia"
} | [
{
"companynumb": "TW-PFIZER INC-2016315762",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "OXACILLIN SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "Drug information resources are commonly used by health-care providers answering pregnancy-related medication questions. In 2015, the United States Food and Drug Administration approved a new pregnancy and lactation medication labeling content and format, removing the pregnancy category, and using a narrative. Despite labeling requirements changing, it is unknown if drug information resources updated monographs to reflect these changes.\n\n\n\nThe primary objective was to evaluate if commonly used drug information resources provide pregnancy information listed similar to the requirements of the Pregnancy and Lactation Labeling Rule (PLLR). Secondary analyses included evaluating the references and inclusion of the pregnancy category rating.\n\n\n\nPregnancy recommendations for 23 medications were evaluated in 9 drug information resources (Clinical Pharmacology, Drugs in Pregnancy and Lactation, Epocrates®, First Databank, LexiComp® Online, LexiComp® Online Pregnancy & Lactation, In-Depth, Medi-Span®, Micromedex®, and Multum®). The number of references per drug monograph and most recent reference publication year was obtained.\n\n\n\nLexiComp® Online Pregnancy & Lactation, In-Depth mimics the new PLLR structure and consistently had the highest number of and most recent references when the medication was included. Drugs in Pregnancy and Lactation was the next most similar in content with the PLLR and second in most references per monograph; however, the most recent reference was the textbook publication year.\n\n\n\nLexiComp® Online Pregnancy & Lactation, In-Depth and Drugs in Pregnancy and Lactation provided pregnancy information in a format most similar to the PLLR. However, several drug information resources contained pregnancy categories ratings that were to be removed from medication labeling per the PLLR.",
"affiliations": "Wingate University School of Pharmacy, Wingate, NC, USA.;Wake Forest Baptist Medical Center, Winston-Salem, NC, USA.;Auburn University Harrison School of Pharmacy, Meridian, MS, USA.",
"authors": "Harris|John Brock|JB|0000-0001-5052-8565;Holmes|Amy P|AP|;Eiland|Lea S|LS|0000-0001-7873-3157",
"chemical_list": "D004364:Pharmaceutical Preparations",
"country": "United States",
"delete": false,
"doi": "10.1177/1060028020956658",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1060-0280",
"issue": "55(4)",
"journal": "The Annals of pharmacotherapy",
"keywords": "drug information; drug safety; labeling; medication safety; pregnancy",
"medline_ta": "Ann Pharmacother",
"mesh_terms": "D000818:Animals; D001942:Breast Feeding; D004348:Drug Labeling; D005260:Female; D006801:Humans; D007774:Lactation; D004364:Pharmaceutical Preparations; D011247:Pregnancy; D014481:United States; D014486:United States Food and Drug Administration",
"nlm_unique_id": "9203131",
"other_id": null,
"pages": "459-465",
"pmc": null,
"pmid": "32885981",
"pubdate": "2021-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The Influence of the Food and Drug Administration Pregnancy and Lactation Labeling Rule on Drug Information Resources.",
"title_normalized": "the influence of the food and drug administration pregnancy and lactation labeling rule on drug information resources"
} | [
{
"companynumb": "US-OTSUKA-2021_008542",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "Nivolumab, an antibody against anti-programmed death type 1, has been used for treatment of advanced non-small cell lung cancer with improvement of overall survival. Usually, diarrhea, cutaneous rash, and pruritus are reported as the most common immune-related adverse effects of nivolumab therapy. Oral lesions and secondary adrenal insufficiency sometimes occur but usually are rare events. We report a case of a patient treated with nivolumab who then showed persistent oral ulcerative and lichenoid lesions, which were refractory to topical corticosteroids. The oral lesions were concomitant to nivolumab-induced adrenal insufficiency. These adverse events led to nivolumab discontinuation, which favored oral lesion healing and adrenal insufficiency remission. Through a brief review of the literature concerning nivolumab toxicity in the oral cavity, we discuss the clinical aspect and management of these lesions.",
"affiliations": "Hospital Israelita Albert Einstein, São Paulo, Brazil.;Hospital Israelita Albert Einstein, São Paulo, Brazil.;Hospital Israelita Albert Einstein, São Paulo, Brazil.;Hospital Israelita Albert Einstein, São Paulo, Brazil.;Hospital Paulistano, São Paulo, Brazil.;Pathology Department, School of Dentistry, University of São Paulo, São Paulo, Brazil.",
"authors": "Gobbi|Marcella Ferreira|MF|;Eduardo|Fernanda de Paula|FP|https://orcid.org/0000-0001-6939-988X;Bezinelli|Leticia Mello|LM|;de Carvalho|Danielle Lima Correa|DLC|;Monção do Vale|Silvana Kelly|SK|;Corrêa|Luciana|L|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1111/scd.12660",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0275-1879",
"issue": null,
"journal": "Special care in dentistry : official publication of the American Association of Hospital Dentists, the Academy of Dentistry for the Handicapped, and the American Society for Geriatric Dentistry",
"keywords": "adrenal insufficiency; immune checkpoint inhibitors; immunotherapy; lichenoid reaction; nivolumab adverse events; oral adverse events; stomatitis",
"medline_ta": "Spec Care Dentist",
"mesh_terms": null,
"nlm_unique_id": "8103755",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34717001",
"pubdate": "2021-10-30",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Severe oral ulcerative and lichenoid lesions associated with adrenal insufficiency in a patient treated with nivolumab: Report of a case and review of literature.",
"title_normalized": "severe oral ulcerative and lichenoid lesions associated with adrenal insufficiency in a patient treated with nivolumab report of a case and review of literature"
} | [
{
"companynumb": "BR-BRISTOL-MYERS SQUIBB COMPANY-BMS-2021-144457",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NIVOLUMAB"
},
"drugaddi... |
{
"abstract": "NRG1 fusion-positive lung cancers have emerged as potentially actionable events in lung cancer, but clinical support is currently limited and no evidence of efficacy of this approach in cancers beyond lung has been shown.\nHere, we describe two patients with advanced cancers refractory to standard therapies. Patient 1 had lung adenocarcinoma and patient 2 cholangiocarcinoma. Whole-genome and transcriptome sequencing were carried out for these cases with select findings validated by fluorescence in situ hybridization.\nBoth tumors were found to be positive for NRG1 gene fusions. In patient 1, an SDC4-NRG1 gene fusion was detected, similar gene fusions having been described in lung cancers previously. In patient 2, a novel ATP1B1-NRG1 gene fusion was detected. Cholangiocarcinoma is not a disease type in which NRG1 fusions had been described previously. Integrative genome analysis was used to assess the potential functional significance of the detected genomic events including the gene fusions, prioritizing therapeutic strategies targeting the HER-family of growth factor receptors. Both patients were treated with the pan HER-family kinase inhibitor afatinib and both displayed significant and durable response to treatment. Upon progression sites of disease were sequenced. The lack of obvious genomic events to describe the disease progression indicated that broad transcriptomic or epigenetic mechanisms could be attributed to the lack of prolonged response to afatinib.\nThese observations lend further support to the use of pan HER-tyrosine kinase inhibitors for the treatment of NRG1 fusion-positive in both cancers of lung and hepatocellular origin and indicate more broadly that cancers found to be NRG1 fusion-positive may benefit from such a clinical approach regardless of their site of origin.\nPersonalized Oncogenomics (POG) Program of British Columbia: Utilization of Genomic Analysis to Better Understand Tumour Heterogeneity and Evolution (NCT02155621).",
"affiliations": "Canada's Michael Smith Genome Sciences Centre.;Division of Medical Oncology, BC Cancer Agency, Vancouver.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Department of Pathology & Laboratory Medicine, Vancouver General Hospital, Vancouver.;Department of Pathology & Laboratory Medicine, Vancouver General Hospital, Vancouver.;Department of Pathology & Laboratory Medicine, Vancouver General Hospital, Vancouver.;Department of Pathology & Laboratory Medicine, Vancouver General Hospital, Vancouver.;Department of Pathology & Laboratory Medicine, BC Cancer Agency, Vancouver.;Department of Pathology & Laboratory Medicine, Vancouver General Hospital, Vancouver.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Division of Medical Oncology, BC Cancer Agency, Vancouver.;Division of Medical Oncology, BC Cancer Agency, Vancouver.;Division of Medical Oncology, BC Cancer Agency, Vancouver.;Division of Medical Oncology, BC Cancer Agency, Vancouver.;Canada's Michael Smith Genome Sciences Centre.;Canada's Michael Smith Genome Sciences Centre.;Division of Medical Oncology, BC Cancer Agency, Vancouver.",
"authors": "Jones|M R|MR|;Lim|H|H|;Shen|Y|Y|;Pleasance|E|E|;Ch'ng|C|C|;Reisle|C|C|;Leelakumari|S|S|;Zhao|C|C|;Yip|S|S|;Ho|J|J|;Zhong|E|E|;Ng|T|T|;Ionescu|D|D|;Schaeffer|D F|DF|;Mungall|A J|AJ|;Mungall|K L|KL|;Zhao|Y|Y|;Moore|R A|RA|;Ma|Y|Y|;Chia|S|S|;Ho|C|C|;Renouf|D J|DJ|;Gelmon|K|K|;Jones|S J M|SJM|;Marra|M A|MA|;Laskin|J|J|",
"chemical_list": "C094131:NRG1 protein, human; D020890:Neuregulin-1; D015514:Oncogene Proteins, Fusion; D047428:Protein Kinase Inhibitors; D011799:Quinazolines; C508304:SDC4 protein, human; D053671:Syndecan-4; D000077716:Afatinib",
"country": "England",
"delete": false,
"doi": "10.1093/annonc/mdx523",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0923-7534",
"issue": "28(12)",
"journal": "Annals of oncology : official journal of the European Society for Medical Oncology",
"keywords": "NRG1 gene fusion; afatinib; integrative genomic analysis; intrahepatic cholangiocarcinoma; lung adenocarcinoma; personalized medicine",
"medline_ta": "Ann Oncol",
"mesh_terms": "D000230:Adenocarcinoma; D000077192:Adenocarcinoma of Lung; D000328:Adult; D000077716:Afatinib; D001650:Bile Duct Neoplasms; D018281:Cholangiocarcinoma; D005260:Female; D020869:Gene Expression Profiling; D006801:Humans; D017404:In Situ Hybridization, Fluorescence; D008175:Lung Neoplasms; D020890:Neuregulin-1; D015514:Oncogene Proteins, Fusion; D047428:Protein Kinase Inhibitors; D011799:Quinazolines; D053671:Syndecan-4",
"nlm_unique_id": "9007735",
"other_id": null,
"pages": "3092-3097",
"pmc": null,
"pmid": "28950338",
"pubdate": "2017-12-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Successful targeting of the NRG1 pathway indicates novel treatment strategy for metastatic cancer.",
"title_normalized": "successful targeting of the nrg1 pathway indicates novel treatment strategy for metastatic cancer"
} | [
{
"companynumb": "CA-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-052495",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AFATINIB"
},
"dr... |
{
"abstract": "Catastrophic antiphospholipid syndrome (CAPS) is a rare, life-threatening form of antiphospholipid syndrome (APS) involving many organs and leading to their insufficiency. The pathogenesis of CAPS is associated with the presence of antiphospholipid antibodies (aPL). Typical therapy includes anticoagulation, glucocorticoids, therapeutic plasma exchanges and/or intravenous immunoglobulin. Despite this aggressive treatment, the mortality rate of 37% is still high. Novel therapeutic agents are required. Rituximab (RTX) is the most studied drug in APS also used in CAPS. Because of the rarity of CAPS occurrence it is impossible to plan a controlled, randomized study exploring its efficacy in CAPS. Therefore, case reports of its usage can be a source of our knowledge in this matter.\n\n\n\nA 35-year-old woman who displayed dyspnoea and peripheral edema was admitted to the Nephrology Clinic because of rapidly progressive renal insufficiency. Her history included autoimmune hemolytic anemia anemia, two miscarriages and the diagnosis of APS with the treatment of heparin and acetylosalicylic acid during her next pregnancy. In spite of this treatment, she gave birth to a dead fetus in 22 Hbd. She then developed CAPS with involvement of the kidneys, brain, skin, peripheral veins and central retinal artery. Lupus anticoagulant and β2-glicoprotein-I antibodies were positive. Immediately upon admission to the nephrology clinic, she received anticoagulation and corticosteroids along with therapeutic plasma exchanges. As a supportive treatment hemodialysis sessions were necessary. Under this treatment the amelioration of the general state was observed but renal failure persisted, therefore intravenous immunoglobulin was added. Afterwards, the kidney function recovered and the renal replacement therapy could be stopped. After this therapy, aPL became negative. Four weeks later lupus anticoagulant began to increase. Taking into account the risk factors of the relapse and the life-threatening course of the disease, rituximab was introduced. After administration of 2 g of RTX in three separate doses, we observed no new thrombotic events, the further amelioration of renal function and the negative profile of aPL.\n\n\n\nCAPS is a life-threatening condition and a prompt, complex treatment is necessary. Rituximab together with conventional therapy can be an additional option in case of the risk of relapse.",
"affiliations": "Department of Internal Diseases, Nephrology and Dialysis, Military Institute of Medicine, Szaserów 128, 04-141, Warsaw, Poland. ola@rymarz.pl.;Department of Internal Diseases, Nephrology and Dialysis, Military Institute of Medicine, Szaserów 128, 04-141, Warsaw, Poland.",
"authors": "Rymarz|Aleksandra|A|;Niemczyk|Stanisław|S|",
"chemical_list": "D017152:Antibodies, Antiphospholipid; D000925:Anticoagulants; D005938:Glucocorticoids; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D000069283:Rituximab",
"country": "England",
"delete": false,
"doi": "10.1186/s12882-018-0928-z",
"fulltext": "\n==== Front\nBMC NephrolBMC NephrolBMC Nephrology1471-2369BioMed Central London 92810.1186/s12882-018-0928-zCase ReportThe complex treatment including rituximab in the Management of Catastrophic Antiphospholid Syndrome with renal involvement Rymarz Aleksandra +48 607 059 427ola@rymarz.plarymarz@wim.mil.pl 1Niemczyk Stanisław +48 607 059 427sniemczyk@wim.mil.pl 21 0000 0004 0620 0839grid.415641.3Department of Internal Diseases, Nephrology and Dialysis, Military Institute of Medicine, Szaserów 128, 04-141 Warsaw, Poland 2 0000 0004 0620 0839grid.415641.3Department of Internal Diseases, Nephrology and Dialysis, Military Institute of Medicine, Szaserów 128, 04-141 Warsaw, Poland 8 6 2018 8 6 2018 2018 19 13228 7 2017 24 5 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nCatastrophic antiphospholipid syndrome (CAPS) is a rare, life-threatening form of antiphospholipid syndrome (APS) involving many organs and leading to their insufficiency. The pathogenesis of CAPS is associated with the presence of antiphospholipid antibodies (aPL). Typical therapy includes anticoagulation, glucocorticoids, therapeutic plasma exchanges and/or intravenous immunoglobulin. Despite this aggressive treatment, the mortality rate of 37% is still high. Novel therapeutic agents are required. Rituximab (RTX) is the most studied drug in APS also used in CAPS. Because of the rarity of CAPS occurrence it is impossible to plan a controlled, randomized study exploring its efficacy in CAPS. Therefore, case reports of its usage can be a source of our knowledge in this matter.\n\nCase presentation\nA 35-year-old woman who displayed dyspnoea and peripheral edema was admitted to the Nephrology Clinic because of rapidly progressive renal insufficiency. Her history included autoimmune hemolytic anemia anemia, two miscarriages and the diagnosis of APS with the treatment of heparin and acetylosalicylic acid during her next pregnancy. In spite of this treatment, she gave birth to a dead fetus in 22 Hbd. She then developed CAPS with involvement of the kidneys, brain, skin, peripheral veins and central retinal artery. Lupus anticoagulant and β2−glicoprotein-I antibodies were positive. Immediately upon admission to the nephrology clinic, she received anticoagulation and corticosteroids along with therapeutic plasma exchanges. As a supportive treatment hemodialysis sessions were necessary. Under this treatment the amelioration of the general state was observed but renal failure persisted, therefore intravenous immunoglobulin was added. Afterwards, the kidney function recovered and the renal replacement therapy could be stopped. After this therapy, aPL became negative. Four weeks later lupus anticoagulant began to increase. Taking into account the risk factors of the relapse and the life-threatening course of the disease, rituximab was introduced. After administration of 2 g of RTX in three separate doses, we observed no new thrombotic events, the further amelioration of renal function and the negative profile of aPL.\n\nConclusions\nCAPS is a life-threatening condition and a prompt, complex treatment is necessary. Rituximab together with conventional therapy can be an additional option in case of the risk of relapse.\n\nissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nCatastrophic antiphospholipid syndrome (CAPS) is a rare, life-threatening form of antiphospholipid syndrome (APS) affecting around 1% of all patients with APS. Its pathogenesis is associated with the presence of antiphospholipid antibodies (aPL) represented by anti β2−glicoprotein-I antibodies (aβ2GPI), anticardiolipin antibodies (aCL) and lupus anticoagulant (LA). These autoantibodies activate endothelial cells, platelets, immune cells and the complement system. This action induces intravascular thrombosis enhanced by the inhibition of anticoagulants and the fibrinolysis process [1]. The activation of immune cells is associated with cytokine storm and the development of systemic inflammatory response syndrome (SIRS) [2]. In recent times, the role of high levels of ferritin as a pro-inflammatory factor has been discussed. CAPS is postulated as one of the clinical conditions included in the hyperferritinemic syndrome [3]. Authors have suggested that an elevated ferritin level is not only a reflection of inflammation as an acute phase response but also an immunomodulatory molecule which contributes to the pathogenic mechanism of CAPS.\n\nThe clinical manifestation of CAPS is associated with arterial and/or venous thrombosis in vessels supplying at least three organs and resulted in their ischemia and failure. The diagnosis of CAPS can be set if the symptoms develop within 1 week [4]. The criteria was originally proposed by Asherson in 2002 and finally validated in 2005 [5, 6]. The most commonly affected organs include the kidneys (73%), lungs (60%), central nervous system (56%), heart (50%), skin (47%), liver (39%), peripheral vessels (37%), gastrointestinal tract (24%) [7]. The presence of aPL is not sufficient to activate coagulation storm. An additional factor called ‘second hit’ must also appear. In the recent report the ‘second hit’ was identified in 65% of patients with CAPS [7]. Among precipitating factors, infections, surgery, cessation of anticoagulation, drugs, obstetric complications, neoplasms should be enumerated [8]. APS can be a primary disease, but in 40% of cases it is concomitant to lupus erythematosus. Although kidneys at the presentation are affected only in 18% of cases, eventually 71% of patients experience kidney involvement. The manifestation of kidney disease is hypertension, proteinuria, hematuria, renal failure expressed by elevation of serum creatinine level and less frequently renal vein thrombosis and renal artery thrombosis. The essence of CAPS is microcirculation involvement and a typical histological demonstration is acute thrombotic microangiopathy. Similar changes also occur in haemolytic-uremic syndrome, thrombotic thrombocytopenic purpura, disseminated intravascular coagulation and heparin-induced thrombocytopenia, and these disorders should be taken into account in the differential diagnosis.\n\nConsidering that CAPS is a life-threatening event, therapeutic strategies should be applied quickly. Complex treatment directed against the thrombotic event and inflammation is also required. The anticoagulation (AC) with heparin, glucocorticoids (GCS), therapeutic plasma exchanges (TPE), immunoglobulin (IVIG) along with supportive treatment like hemodialysis or mechanical ventilation support are possible therapeutic options. According to the newest CAPS registry report the most frequently used combination is AC plus GCS (19%), followed by AC plus GCS plus TPE or IVIG (18%) [7]. The enhancement of therapy by TPE and/or IVIG reduces the mortality rate. Among 342 patients with CAPS, 160 who received triple therapy including TPE or/and IVIG had better survival than those on the double treatment (AC and GCS) [9]. In the case of CAPS secondary to systemic lupus erythematosus (SLE), cyclophosphamide administration is strongly recommended [8]. Despite advanced therapeutic strategies, the mortality rate is still at a high level of 37% [7]. Novel medications like rituximab or eculizumab are used in refractory and relapsing cases. Rituximab (RTX) humanized anti-CD20 monoclonal antibody primary used in B-cell malignancies is currently widely applied in many autoimmune disorders. According to CAPS registry, out of 20 patients treated with RTX, 15 recovered [10]. Eculizumab is a humanized monoclonal antibody directed against complement C5 convertase which prevents its activation. It is applied in atypical hemolytic-uremic syndrome and paroxysmal nocturnal hemoglobinuria. Animal models of APS thrombosis showed that complement activation plays a significant role in this phenomenon [11]. Knowledge about the utilization of eculizumab in humans is based on the case studies where this drug has been used in refractory cases [12].\n\nCase presentation\nA 35-year-old woman who displayed dyspnoea and peripheral edema was admitted to the Nephrology Clinic because of rapidly progressive renal insufficiency. Her history included autoimmunohemolytic anemia, two miscarriages and the diagnosis of APS with the treatment of heparin and acetylosalicylic acid (ASA) during her next pregnancy. The diagnosis of APS after the first miscarriage was supported by positive serological tests such as lupus anticoagulant, anti β2glicoprotein-1 antibodies class IgG and anticardiolipn antibodies class IgM and IgG. Despite this treatment, in 22 hbd ultrasound no heart function of the morphological normal fetus was revealed. After the dead fetus was delivered, there appeared edema of the legs, a reduction in the amount of urine and blurred vision. Ultrasounds with power Doppler of the lower limbs revealed deep vein thrombosis. The ophthalmic examination revealed the right central retinal artery thrombosis. The computer tomography (CT) scan of the head presented an ischemic stroke in the right temporal lobe. The CT scan of the chest only revealed a high amount of fluid in both pleural cavities without any abnormalities in the pulmonary veins or arteries. The clinical symptoms were accompanied by the following laboratory abnormalities: anaemia (Hgb - 7 g/dl), thrombocytopenia 134 G/l, leucocytosis (WBC) 14.36 G/l, elongate activated partial thromboplastin time (APTT) 69.7 s (reference range 23–35 s), elevated D-dimer level (4.33 μg/ml, reference range 0–0.5), elevated serum creatinine (4.8 mg/dl) and urea (79 mg/dl) levels. Fibrinogen level (247 mg/dl) and antithrombin activity (101%) were within the reference range. All of the described symptoms appeared within 1 week. Because of the deterioration of her general state - aggravating dyspnoea and peripheral oedema with concomitant rapidly progressive renal failure - the patient was moved to the Nephrology Clinic. Respiratory failure with mouth cyanosis, a vast amount of fluid in both pleural cavities, massive peripheral oedema and livedo reticularis on the skin were observed upon the patient’s admission. Laboratory findings included elevated creatinine (5,5 mg/dl) and urea level 92 mg/dl, Hgb 8.7 g/dl, PLT 143 G/l, WBC 13.6 G/l, daily proteinuria 0.7 g, erytrocyturia, hypoproteinemia (5 g/dl), hypoalbuminemia (2.5 g/dl), an elevated level of lactate dehydrogenase (548 U/L, reference range 135–223), elevated C-reactive protein level (4.7 mg/dl, reference range < 0.8), elevated ferritin level 308 ng/ml (reference range 30–200). Levels of complement components were C3–77 mg/dl (reference range 90–180), C4–10 mg/dl (reference range 10–40). Antibodies against β2 glicoprotein I were elevated (14 U/ml), the significant content of lupus anticoagulant was also revealed. Antinuclear antibodies (ANA), anti-double strength DNA antibodies, c-ANCA p-ANCA, anticardiolin antibodies (aCL) were negative. ADAMTS 13 and its inhibitor were normal. Abdominal ultrasound revealed the enlargement of both kidneys (left kidney 139 mm, right kidney 124 mm) with interstitial edema and left renal vein thrombosis. An X-ray of the chest demonstrated a high amount of fluid in both pleural cavities. Histopathological examination showed thrombotic microangiopathy (TMA) secondary to APS [Fig. 1].Fig. 1 Renal biopsy presenting fibrinoid necrosis of the vessel wall associated with thrombotic microangiopathy\n\n\n\nClinical signs, organ manifestation and laboratory findings are summarized in Table 1.Table 1 Clinical evolution of CAPS in the described patient\n\nOrgan manifestation\tClinical signs\tLaboratory abnormalities typical for CAPS\tLaboratory tests which were normal\t\nKidneys\t\n renal failure\tPeripheral edema\tThrombocytopenia\tFibrinogen\t\n renal vein thrombosis\tFluid in both pleural cavities\tElongate APTT\tANA\t\n hematuria\t\tElevated D-dimer\tAnti-dsDNA\t\n proteinuria\t\tReduced complement components C3 and C4\tADAMTS 13 and its inhibitor\t\nBrain\t\n stroke\t\tPositive lupus anticoagulant\t\t\nSkin\t\n livedo reticularis\tlivedo reticularis\tAntiβ2glicoprotein-I antibodies\t\t\nPeripheral vessel\t\n peripheral venous thrombosis\tEdema of the legs\tThrombotic microangiopathy in renal biopsy\t\t\nEye\t\n central retinal artery thrombosis\tBlurred vision\t\t\t\nAPTT activated partial thromboplastin time, ANA antinuclear antibodies, anti-dsDNA anti-double strength DNA antibodies, CAPS catastrophic antiphospholipid syndrome\n\n\n\nBecause of thrombosis of vasculature in more than three organs within a short period of time, the diagnosis of catastrophic antiphospholipid syndrome was made. Anticoagulation treatment with infusion of high molecular weight heparin was introduced. The dosage was modified according to APPT with a target level of 70–85 s. Glucocorticoids: methyprednisolon 1 g i.v. for three consecutive days, followed by prednisone 1 mg/kg/day (60 mg/day) were also used. Therapeutic plasma exchanges were added to remove antiphospholipid antibodies. Because of severe renal insufficiency with anuria, fluid overload with respiratory failure, daily hemodialysis treatment was introduced. Systemic antibiotic therapy with piperacyllin/tazobactam was also added. Under this treatment, an evident improvement was observed. Dyspnoea and the respiratory failure gradually disappeared, the haemoglobin level increased, the platelet amount normalized but oliguria still remained and regular hemodialysis sessions were necessary. High molecular weight heparin was replaced by the low molecular weight heparin (enoxaparin 60 mg). TPE were halted after five sessions. Because of the lack of amelioration of the kidney function, it was decided to enhance the treatment and intravenous immunoglobulin was introduced. The patient received five doses of IgG 0.4 g/kg/day. The CAPS treatment of this patient was summarized in Table 2.Table 2 Treatment of CAPS used in the described patient\n\nFirst line treatment\tAnticoagulation\tHigh molecular weight heparin (HMWH)\t\nLMWH\t\nOral anticoagulant (warfarin, INR > 3)\t\nGlucocorticoids\tMethylprednisolone 1 g i.v. for three consecutive days\t\nOral prednisone, 1 mg/kg/day (60 mg/day)\t\nOral prednisolone tapered to 20 mg within 6 weeks\t\nTPE\t5 sessions with the frequency every other day\t\n1,5 of total plasma volume per session\t\nReplacement fluid: 4% albumin solution and FFP\t\nImmunoglobulin\t5 doses of IgG 0,4 g/kg/day\t\nSecond line treatment\tRituximab\t2 g in three separate doses (600–800-600 mg) in two-month intervals\t\nFFP fresh frozen plasma, LMWH low molecular weight heparin\n\n\n\nIn the meantime, the temporary catheter was removed and a permanent catheter was introduced. The intervention was complicated by a haemorrhage in the place of the insertion. A few days later, fever, chills and elevated inflammatory markers disclosed a catheter induced infection. Ceftriaxon and linezolid were introduced with a positive response. The permanent catheter was replaced by another temporary one.\n\nThree weeks after immunoglobulin treatment, a gradual increase in the amount of urine and a decrease in serum creatinine and urea levels were observed. Renal replacement therapy could be discontinued after 5 weeks of treatment. The patient was discharged from the hospital with the creatinine level 3.2 mg/dl, urea level 157 mg/dl, concomitant erytrocyturia 250 cells/μl, daily proteinuria 0.5 g. All antiphospholipid antibodies were negative. The treatment at the discharge from the hospital was: oral anticoagulant (warfarin), prednisolon (20 mg/day), ASA and antihypertensive drugs.\n\nAfter 4 weeks (3 months after the first symptoms of CAPS occurred) the control laboratory tests revealed medium positive lupus anticoagulant, creatinine level was 2.5 mg/dl, urea level 142 mg/dl. Fearing a CAPS relapse, after the acceptance of the multidisciplinary committee, rituximab therapy was introduced. Before administering the drug, an infection screening was performed. HIV, hepatitis B and C, and tuberculosis markers were negative. Blood and urine cultures were also negative. The patient received 2 g of RTX in three separate doses (600–800-600 mg) in two-month intervals. During the therapy, the infection prophylaxis with trimetoprim/sulfametoxazol and acyclovir was used. Six months after the last dose of RTX, the serum creatinine level was 1.6 mg/dl, urea level 40 mg/dl, erytrocyturia 250 cells/μl, daily proteinuria 0.2 g. All antiphospholipid antibodies were negative. One year after the last dose of RTX, LA increased from negative to slightly positive but the renal function remained good with serum creatinine level 1.4 mg/dl and no new thrombotic events observed. Prednisone was stopped 2 years after the CAPS presentation and 15 months after the last dose of RTX.\n\nDiscussion\nCAPS is a rare yet serious autoimmune disorder. The most latest CAPS registry report, noted 500 patients of which 69% were female. There are some differences in epidemiology between primary and secondary CAPS. Patients with primary CAPS are older (mean age 39.8 vs. 32.8 years) and have a lower mortality rate (33 vs. 48%) than with secondary CAPS. Our female patient with primary CAPS was 35 years old. However, the most frequent precipitating factors are infections - in the presented case obstetric complication induced CAPS. Pregnancy related CAPS represent 8% of all CAPS cases [7]. Pregnancy loss is linked to the activation of complement cascade which plays a significant role in CAPS pathogenesis [13].\n\nThe most frequently affected organs are the kidneys, lungs, brain, heart, skin, liver and peripheral vessels. The diagnosis of CAPS requires the involvement of at least three organs. In the presented case, the kidneys, brain, skin, peripheral veins and central retinal artery were engaged. The clinical manifestation of renal involvement includes renal failure, proteinuria, arterial hypertension, hematuria and less often thrombosis of the renal vein or artery. Renal failure is the most common form of renal involvement resulting from thrombotic microangiopathy in glomeruli. This complication often requires a supplementary treatment such as hemodialysis sessions, as in the case of our patient who suffered from severe renal failure, arterial hypertension, proteinuria, hematuria and renal vein thrombosis.\n\nCAPS is a life-threatening condition which requires complex treatment directed at thrombotic events and the inflammatory state. Anticoagulation with heparin not only inhibits clot formation and promotes fibrinolysis but also prevents aPL from binding to their target on the cell surface and restraining complement activation [14]. Initially non-fractionated heparin and intravenous administration is preferred. The advantages of this kind of treatment are associated with the option of quickly reversing its action in case of bleeding or the necessity of invasive procedures. In long-term therapy, oral anticoagulation is recommended. In order to inhibit inflammation associated with CAPS, glucocorticoids (GCS) are used. GCS inhibit the nuclear factor (NF) - κß, a SIRS mediator through which anti-β2GPI antibodies induce coagulation and/or inflammation [15]. There are no evidence based recommendations for the optimal dosage nor the duration of GCS treatment. Traditionally patients receive 1000 mg of methylprednisolone for 3 to 5 days followed by oral prednisone. However, dual therapy with AC and GCS is the most commonly used option, where the recovery rate is 63.8%. The enhancement of treatment with therapeutic plasma exchanges ameliorates the recovery rate to 77.8% [8]. Contrary to immunosuppressors whose action is delayed after their usage, plasma exchanges remove promptly aPL antibodies and proinflammatory mediators such as Il-1, Il-6, Il-18, TNF-α, ferritin. However, these procedures also remove plasma immunoglobulins, sometimes causing their deep deficiency. Decreased plasma immunoglobulins levels are associated with an increased risk of infection and its supplementation can be indicated. Intravenous immunoglobulins (IVIG) are also used in the treatment of CAPS. They have a direct effect through the Fc receptor which enables the autoantibodies blockage and an increase in its clearance. An indirect effect is associated with immunomodulatory action through suppressing cytokines, inhibiting CD8 and inhibiting complement activation. Typical dosage is 0.4 g/kg/day for 5 days administered after the last plasma exchange session. Most analysis - concentrated on the result of CAPS treatment - groups the IVIG together with TPE proving that the triple (AC + GS + TPE or IVIG) or quadruple (AC + GS + TPE + IVIG) therapy is more effective than the double one. There is no analysis comparing the triple with quadruple therapy. However, there are various studies exploring the efficacy of IVIG in preventing thrombotic events in patients with APS. They revealed that patients who received IVIG in addition to conventional treatment had less thrombosis than the group only on classic therapy [16, 17]. In the aforementioned case, we initially used anticoagulation, glucocorticosteroids, therapeutic plasma exchanges and because of the lack of renal function recovery we added the intravenous immunoglobulins in a standard dose. Under this kind of treatment, a definite improvement in the renal function was observed and dialysis could be stopped.\n\nThe treatment enumerated earlier does not influence the production of autoantibodies. B cells are not only responsible for their generation after transforming into plasmatic cells, but can also function as antigen presenting cells, differentiate into B cells effectors, regulate helper T cells or can also release pro-inflammatory cytokines [18]. The usage of biologic agents depleting B cells in the CAPS therapy seems to have a strong theoretical foundation. Rituximab (RTX) is the monoclonal antibody directed against the B cell surface marker CD 20 found on pre-B cells maturing to memory B cells. RTX treatment causes a profound depletion of the B cells subset. RTX is the most studied biologic agent in CAPS therapy. “CAPS registry” reports that of 20 patients treated with RTX, 16 (80%) of them survived. RTX was used as a first line therapy in 40% of patients and 60% of them received the drug as a second line therapy because of a poor response to conventional treatment or relapses [9]. The most commonly used dosage was 2 g in two divided doses. The factors identified as being associated with a relapse of the disease are: concomitance of systemic lupus erythematosus, age above 36 years old; pulmonary and renal involvement; the presence of lupus anticoagulant; microangiopathic hemolitic anemia (MHA) [19]. In the presented case we decided to use RTX as a treatment preventing a relapse. The renal involvement with the necessity of renal replacement therapy, the reappearance of lupus anticoagulant and the presence of microangiopathic hemolitic anemia (MHA) were the risk factors presented by our patient which could befall a relapse. Taking into account the life-threatening course of the first episode of CAPS, preventing the relapse was extremely important. The risk of CAPS relapse outweighed the risk of additional immunosuppression. As with most patients with CAPS, our patient also received 2 g of RTX but in three separate doses. The treatment was effective in terms of clinical signs and immunity profile. Over the course of 1 year after the last dose of RTX, no new thrombotic event was observed and the renal function ameliorated. Under the treatment lupus anticoagulant also became negative, however, 1 year after the last dose of RTX it marginally increased to slightly positive. In the pilot study exploring the RTX effects in patients with non-criteria manifestation APS, RTX therapy did not significantly influence the aPL profile. However, it was effective in the treatment of some clinical manifestations of APS [20].\n\nConclusion\nCAPS is a life-threatening condition and prompt, complex treatment is necessary. The quadruple therapy including drugs acting in a different manner: anticoagulation, glucocorticoids, therapeutic plasma exchanges and intravenous immunoglobulins can capture this thrombotic and inflammatory storm. Rituximab as an immunosuppressive agent with a long-lasting action, can enhance the effect of this therapy and prevent a relapse. Further studies concerning the longitudinal influence of RTX on CAPS survivors are needed.\n\nAbbreviations\nACAnticoagulation\n\nANAAntinuclear antibodies\n\naPLAntiphospholipid antibodies\n\nAPSAntiphospholipid syndrome\n\nAPTTActivated partial thromboplastin time\n\nASAAcetylosalicylic acid\n\naβ2GPIAnti β2-glicoprotein-I antibodies\n\nCAPSCatastrophic antiphospholipid syndrome\n\nCTComputer tomography\n\nGCSGlucocorticoids\n\nIVIGImmunoglobulin\n\nLALupus anticoagulant\n\nMHAMicroangiopathic hemolitic anemia\n\nNFNuclear factor\n\nRTXRituximab\n\nSIRSSystemic inflammatory response syndrome\n\nSLESystemic lupus erythematosus\n\nTMAThrombotic microangiopathy\n\nTPETherapeutic plasma exchanges\n\nWBCLeucocytosis\n\nAcknowledgements\nWe would like to thank Dr. A. Perkowska for sharing the photo of microscopic changes in renal biopsy.\n\nAuthors’ contributions\nAR followed the patient and wrote the manuscript, SN followed the patient and revised the manuscript. Both authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nMultidisciplinary committee has accepted the treatment schedule.\n\nConsent for publication\nThe patient signed informed consent for publication.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Nayer A Ortega LM Catastrophic antiphospholipid syndrome: a clinical review J Nephropathol 2014 3 9 24644537 \n2. Espinosa G Bucciarelli S Cervera R Gómez-Puerta JA Font J Laboratory studies on pathophysiology of the catastrophic antiphospholipid syndrome Autoimmun Rev 2006 6 68 10.1016/j.autrev.2006.06.006 17138245 \n3. Rosário C Zandman-Goddard G Meyron-Holtz EG D'Cruz DP Shoenfeld Y The hyperferritinemic syndrome: macrophage activation syndrome, Still's disease, septic shock and catastrophic antiphospholipid syndrome BMC Med 2013 11 185 10.1186/1741-7015-11-185 23968282 \n4. Asherson RA Cervera R de Groot PG Erkan D Boffa MC Piette JC Catastrophic antiphospholipid syndrome: international consensus statement on classification criteria and treatment guidelines Lupus 2003 12 530 10.1191/0961203303lu394oa 12892393 \n5. Asherson RA Espinosa G Cervera R Font J Reverter JC Catastrophic antiphospholipid syndrome: proposed guidelines for diagnosis and treatment J Clin Rheumatol 2002 8 157 10.1097/00124743-200206000-00008 17041346 \n6. Cervera R Font J Gómez-Puerta JA Espinosa G Cucho M Bucciarelli S Ramos-Casals M Ingelmo M Piette JC Shoenfeld Y Asherson RA Catastrophic antiphospholipid syndrome registry project group. Validation of the preliminary criteria for the classification of catastrophic antiphospholipid syndrome Ann Rheum Dis 2005 64 1205 10.1136/ard.2004.025759 15708888 \n7. Rodríguez-Pintó I Moitinho M Santacreu I Shoenfeld Y Erkan D Espinosa G Cervera R CAPS registry project group (European forum on antiphospholipid antibodies). Catastrophic antiphospholipid syndrome (CAPS): descriptive analysis of 500 patients from the international CAPS registry Autoimmun Rev 2016 15 1120 10.1016/j.autrev.2016.09.010 27639837 \n8. Kazzaz NM McCune WJ Knight JS Treatment of catastrophic antiphospholipid syndrome Curr Opin Rheumatol 2016 28 218 10.1097/BOR.0000000000000269 26927441 \n9. Cervera R Rodríguez-Pintó I Colafrancesco S Conti F Valesini G Rosário C Agmon-Levin N Shoenfeld Y Ferrão C Faria R Vasconcelos C Signorelli F Espinosa G 14th international congress on antiphospholipid antibodies task force report on catastrophic antiphospholipid syndrome Autoimmun Rev 2014 13 699 10.1016/j.autrev.2014.03.002 24657970 \n10. Berman H Rodríguez-Pintó I Cervera R Morel N Costedoat-Chalumeau N Erkan D Shoenfeld Y Espinosa G Catastrophic antiphospholipid syndrome (CAPS) registry project group (European forum on antiphospholipid antibodies). Rituximab use in the catastrophic antiphospholipid syndrome: descriptive analysis of the CAPS registry patients receiving rituximab Autoimmun Rev 2013 12 1085 10.1016/j.autrev.2013.05.004 23777822 \n11. Pierangeli SS Girardi G Vega-Ostertag M Liu X Espinola RG Salmon J Requirement of activation of complement C3 and C5 for antiphospholipid antibody-mediated thrombophilia Arthritis Rheum 2005 52 2120 10.1002/art.21157 15986360 \n12. Kronbichler A Frank R Kirschfink M Szilágyi Á Csuka D Prohászka Z Schratzberger P Lhotta K Mayer G Efficacy of eculizumab in a patient with immunoadsorption-dependent catastrophic antiphospholipid syndrome: a case report Medicine (Baltimore) 2014 93 e143 10.1097/MD.0000000000000143 25474424 \n13. Oku K Amengual O Atsumi T Pathophysiology of thrombosis and pregnancy morbidity in the antiphospholipid syndrome Eur J Clin Investig 2012 42 1126 10.1111/j.1365-2362.2012.02697.x 22784367 \n14. Girardi G Redecha P Salmon JE Heparin prevents antiphospholipid antibody-induced fetal loss by inhibiting complement activation Nat Med 2004 10 1222 10.1038/nm1121 15489858 \n15. Auphan N DiDonato JA Rosette C Helmberg A Karin M Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis Science 1995 270 286 10.1126/science.270.5234.286 7569976 \n16. Tenti S Guidelli GM Bellisai F Galeazzi M Fioravanti A Long-term treatment of antiphospholipid syndrome with intravenous immunoglobulin in addition to conventional therapy Clin Exp Rheumatol 2013 31 877 23985161 \n17. Sciascia S Giachino O Roccatello D Prevention of thrombosis relapse in antiphospholipid syndrome patients refractory to conventional therapy using intravenous immunoglobulin Clin Exp Rheumatol 2012 30 409 22513222 \n18. Khattri S Zandman-Goddard G Peeva E B-cell directed therapies in antiphospholipid antibody syndrome-new directions based on murine and human data Autoimmun Rev 2012 11 717 10.1016/j.autrev.2011.12.011 22269862 \n19. Bucciarelli S Erkan D Espinosa G Cervera R Catastrophic antiphospholipid syndrome: treatment, prognosis, and the risk of relapse Clin Rev Allergy Immunol 2009 36 80 10.1007/s12016-008-8107-9 19051065 \n20. Erkan D Vega J Ramón G Kozora E Lockshin MD A pilot open-label phase II trial of rituximab for non-criteria manifestations of antiphospholipid syndrome Arthritis Rheum 2013 65 464 10.1002/art.37759 23124321\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2369",
"issue": "19(1)",
"journal": "BMC nephrology",
"keywords": null,
"medline_ta": "BMC Nephrol",
"mesh_terms": "D000328:Adult; D017152:Antibodies, Antiphospholipid; D000925:Anticoagulants; D016736:Antiphospholipid Syndrome; D002388:Catastrophic Illness; D004359:Drug Therapy, Combination; D005260:Female; D005313:Fetal Death; D005938:Glucocorticoids; D006801:Humans; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D011247:Pregnancy; D011248:Pregnancy Complications; D051437:Renal Insufficiency; D000069283:Rituximab",
"nlm_unique_id": "100967793",
"other_id": null,
"pages": "132",
"pmc": null,
"pmid": "29884138",
"pubdate": "2018-06-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "24644537;23985161;25474424;22269862;17138245;26927441;23968282;22513222;15489858;24657970;15708888;17041346;15986360;7569976;22784367;12892393;23777822;27639837;19051065;23124321",
"title": "The complex treatment including rituximab in the Management of Catastrophic Antiphospholid Syndrome with renal involvement.",
"title_normalized": "the complex treatment including rituximab in the management of catastrophic antiphospholid syndrome with renal involvement"
} | [
{
"companynumb": "PL-MYLANLABS-2018M1096179",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "3",
... |
{
"abstract": "Tenofovir disoproxil fumarate (TDF) is still widely prescribed for human immunodeficiency virus (HIV)-infected pregnant women, despite its renal and bone toxicity. Although TDF-exposed infants often show transient growth impairment, it is not clear whether maternal TDF causes infantile rickets via maternal/fetal renal dysfunction in Asian populations. This prospective observational study was conducted in Vietnam and involved pregnant HIV-infected women treated with TDF-based regimen (TDF group) or zidovudine-based regimen (AZT-group). At birth, 3, 12, and 18 months of age, and included body length, weight, head circumference, serum alkaline phosphatase (ALP), creatinine, calcium, phosphorus, urine-β2-microglobulin (U-BMG), percentage of tubular reabsorption of phosphate (%TRP), and radiographic wrist score for rickets. Age-adjusted multivariate linear regression analysis evaluated the association of TDF/AZT use during pregnancy with fetal renal function and bone health. The study included 63 mother-infant pairs (TDF group = 53, AZT group = 10). In the mothers, detectable U-BMG (>252 μg/L) was observed more frequently in the TDF- than AZT group (89 vs 50%, p<0.001), but other renal/bone parameters were similar. In infants, maternal TDF use was not associated with growth impairment, renal dysfunction, or abnormal bone findings, but with a slightly higher ALP levels (p = 0.019). However, shorter length was associated with maternal AZT (p = 0.021), and worse radiographic scores were associated with LPV/r (p = 0.024). In Vietnamese population, TDF usage during pregnancy was not associated with infant transient rickets, growth impairment, or renal dysfunction, despite mild maternal tubular impairment. Maternal AZT and LPV/r influenced infant growth and bone health, though further studies are needed to confirm this finding.",
"affiliations": "Department of Laboratory Medicine, Tokyo Medical University, Tokyo, Japan.;National Hospital for Tropical Diseases, Hanoi, Vietnam.;National Hospital of Obstetrics and Gynecology, Hanoi, Vietnam.;AIDS Clinical Center, National Center for Global Health and Medicine, Tokyo, Japan.;AIDS Clinical Center, National Center for Global Health and Medicine, Tokyo, Japan.;AIDS Clinical Center, National Center for Global Health and Medicine, Tokyo, Japan.;National Hospital for Tropical Diseases, Hanoi, Vietnam.;National Hospital for Tropical Diseases, Hanoi, Vietnam.;AIDS Clinical Center, National Center for Global Health and Medicine, Tokyo, Japan.",
"authors": "Kinai|Ei|E|0000-0001-5415-0854;Nguyen|Hoai Dung Thi|HDT|;Do|Ha Quan|HQ|;Matsumoto|Shoko|S|;Nagai|Moeko|M|;Tanuma|Junko|J|;Nguyen|Kinh Van|KV|;Pham|Thach Ngoc|TN|;Oka|Shinichi|S|",
"chemical_list": "D001613:beta 2-Microglobulin; D015215:Zidovudine; D000068698:Tenofovir; D010450:Endopeptidases; C086514:Alp protease",
"country": "United States",
"delete": false,
"doi": "10.1371/journal.pone.0250828",
"fulltext": "\n==== Front\nPLoS One\nPLoS One\nplos\nplosone\nPLoS ONE\n1932-6203\nPublic Library of Science San Francisco, CA USA\n\n10.1371/journal.pone.0250828\nPONE-D-21-05310\nResearch Article\nPeople and Places\nPopulation Groupings\nAge Groups\nChildren\nInfants\nPeople and Places\nPopulation Groupings\nFamilies\nChildren\nInfants\nMedicine and Health Sciences\nWomen's Health\nMaternal Health\nPregnancy\nMedicine and Health Sciences\nWomen's Health\nObstetrics and Gynecology\nPregnancy\nBiology and Life Sciences\nAnatomy\nRenal System\nMedicine and Health Sciences\nAnatomy\nRenal System\nPhysical Sciences\nChemistry\nChemical Compounds\nPhosphates\nPhysical sciences\nChemistry\nChemical compounds\nOrganic compounds\nVitamins\nVitamin D\nPhysical sciences\nChemistry\nOrganic chemistry\nOrganic compounds\nVitamins\nVitamin D\nMedicine and Health Sciences\nWomen's Health\nMaternal Health\nBirth\nMedicine and Health Sciences\nWomen's Health\nObstetrics and Gynecology\nBirth\nBiology and Life Sciences\nBiochemistry\nBiomarkers\nCreatinine\nBiology and Life Sciences\nAnatomy\nBody Limbs\nArms\nWrist\nMedicine and Health Sciences\nAnatomy\nBody Limbs\nArms\nWrist\nInfluence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health\nEffects of maternal tenofovir treatment on infantile rickets in Vietnam\nhttps://orcid.org/0000-0001-5415-0854\nKinai Ei Conceptualization Formal analysis Funding acquisition Project administration Writing – original draft 12*\nNguyen Hoai Dung Thi Data curation Investigation Project administration 3\nDo Ha Quan Data curation Investigation Project administration 4\nMatsumoto Shoko Data curation Formal analysis Investigation 2\nNagai Moeko Data curation Investigation 2\nTanuma Junko Funding acquisition Supervision 2\nNguyen Kinh Van Supervision 3\nPham Thach Ngoc Supervision 3\nOka Shinichi Funding acquisition Supervision Writing – review & editing 2\n1 Department of Laboratory Medicine, Tokyo Medical University, Tokyo, Japan\n2 AIDS Clinical Center, National Center for Global Health and Medicine, Tokyo, Japan\n3 National Hospital for Tropical Diseases, Hanoi, Vietnam\n4 National Hospital of Obstetrics and Gynecology, Hanoi, Vietnam\nXie Linglin Editor\nTexas A&M University College Station, UNITED STATES\nCompeting Interests: E.K. has received honoraria from Gilead Sciences, ViiV Healthcare, and MSD. S.O. received honoraria from MSD, Janssen Pharmaceutical and Gilead Sciences, and research grants from MSD, ViiV Healthcare, Gilead Sciences. The remaining authors declare no conflict of interest. This research was supported by the Japan Initiative for Global Research Network on Infectious Diseases from the Japan Agency for Medical Research and development, AMED. During the study period, antiretrovirals for Vietnamese patients were provided under the financial support of the U.S. President’s Emergency Plan for AIDS Relief (PEPFAR). This does not alter our adherence to PLOS ONE policies on sharing data and materials.\n\n* E-mail: ekinai@tokyo-med.ac.jp\n29 4 2021\n2021\n16 4 e025082817 2 2021\n14 4 2021\n© 2021 Kinai et al\n2021\nKinai et al\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\n\nTenofovir disoproxil fumarate (TDF) is still widely prescribed for human immunodeficiency virus (HIV)-infected pregnant women, despite its renal and bone toxicity. Although TDF-exposed infants often show transient growth impairment, it is not clear whether maternal TDF causes infantile rickets via maternal/fetal renal dysfunction in Asian populations. This prospective observational study was conducted in Vietnam and involved pregnant HIV-infected women treated with TDF-based regimen (TDF group) or zidovudine-based regimen (AZT-group). At birth, 3, 12, and 18 months of age, and included body length, weight, head circumference, serum alkaline phosphatase (ALP), creatinine, calcium, phosphorus, urine-β2-microglobulin (U-BMG), percentage of tubular reabsorption of phosphate (%TRP), and radiographic wrist score for rickets. Age-adjusted multivariate linear regression analysis evaluated the association of TDF/AZT use during pregnancy with fetal renal function and bone health. The study included 63 mother-infant pairs (TDF group = 53, AZT group = 10). In the mothers, detectable U-BMG (>252 μg/L) was observed more frequently in the TDF- than AZT group (89 vs 50%, p<0.001), but other renal/bone parameters were similar. In infants, maternal TDF use was not associated with growth impairment, renal dysfunction, or abnormal bone findings, but with a slightly higher ALP levels (p = 0.019). However, shorter length was associated with maternal AZT (p = 0.021), and worse radiographic scores were associated with LPV/r (p = 0.024). In Vietnamese population, TDF usage during pregnancy was not associated with infant transient rickets, growth impairment, or renal dysfunction, despite mild maternal tubular impairment. Maternal AZT and LPV/r influenced infant growth and bone health, though further studies are needed to confirm this finding.\n\nthe Japan Agency for Medical Research and developmentOka Shinichi This research was supported by the Japan Initiative for Global Research Network on Infectious Diseases from the Japan Agency for Medical Research and development, AMED. During the study period, antiretrovirals for Vietnamese patients were provided under the financial support of the U.S. president’s emergency plan for AIDS relief (PEPFAR). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are within the paper and its Supporting Information file.\nData Availability\n\nAll relevant data are within the paper and its Supporting Information file.\n==== Body\nIntroduction\n\nTenofovir disoproxil fumarate (TDF) is still widely used for treatment of human immunodeficiency virus (HIV) infection. In the past two decades, zidovudine (AZT)-based treatment was the only approved antiretrovirals for pregnant women and infants, despite its lower potency and toxicity. In 2013, the World Health Organization (WHO) recommended the use of TDF-based two nucleoside reverse transcriptase inhibitors (NRTIs) for pregnant women based on the high potency [1]. However, TDF is known to be nephrotoxic [2], mainly causing proximal tubular dysfunction [3, 4], which results in renal loss of phosphorus with a subsequent decrease in bone mineral density (BMD) in both the lumbar spine and pelvic bones [5, 6]. This mechanism was confirmed in a study that showed tenofovir alafenamide (TAF), a novel prodrug, reduced TDF-related nephrotoxicity, resulting in significant improvement in not only renal tubular function but also in bone mineral density [3].\n\nBased on the toxic effects of TDF on renal function and bone health, the safety of TDF in pregnant woman is a matter of concern. Especially given that TDF use during pregnancy can theoretically cause nutritional rickets during early neonatal life due to maternal renal loss of phosphate in late pregnancy [7]. Previous studies in rhesus macaques showed that TDF administration in neonates and infants resulted in severe rickets [8]. In human, most of the large international studies suggest that maternal TDF was not associated with infant growth impairment [9–11]. However, a few longitudinal cohort studies reported growth retardation of TDF-exposed infants within a few months after birth, though this was described as transient and self-corrected by 1–2 year of age [9, 12]. In addition, while whole-body bone mineral content was lower in TDF-exposed infants at the first 4 weeks after birth [13], lumbar spine BMD showed comparable level at 12 months after birth [14]. These findings suggest that maternal TDF can cause transient nutritional rickets due to maternal renal loss of phosphates, which can be overcome by nutritional replacement after birth. Furthermore, there is limited information on the effects of maternal TDF on infant growth in Asian population [14, 15], despite being considered vulnerable to TDF-associated nephrotoxicity due to the small body size [16].\n\nThe present study was designed to evaluate whether maternal TDF can cause transient nutritional rickets by impairing infant growth, renal function, or bone health in Vietnamese pregnant women with HIV.\n\nMaterials and methods\n\nSample population\n\nThis prospective observational study started in December 2016 and completed in December 2019. Vietnamese HIV-infected pregnant women who were already on anti-retroviral therapy (ART) were recruited at the National Hospital of Obstetrics and Gynecology (NHOG) before the third trimester. Each participant provided a signed informed consent after a thorough explanation of the purpose of the study and potential outcome. The inclusion criteria were as follows; 1) HIV-infected pregnant women, 2) free of acute AIDS-defining diseases, and 3) on treatment at the time of study entry with either TDF- or zidovudine (AZT)-based regimen, either after 26 gestational weeks or for more than 8 weeks during pregnancy. We also applied the following exclusion criteria; 1) HIV-infected infants (confirmed by HIV antibody test at 18 month of age), 2) preterm infants (<35 gestational weeks or <2000 g of birth weight), 3) multiple pregnancy (twins, triplets, or more), and 4) congenital disorders (e.g., failure to thrive, rickets or renal impairment). Since sex-specific standard normal values for height, weight, head circumference and laboratory values are not available for Vietnamese newborn/infants, we also recruited HIV-non-infected mothers and their infants in this study.\n\nThe study was approved by the Institutional Review Board of the National Center for Global Health and Medicine (NCGM), Tokyo, Japan (#NCGM-G-002030-00), National Hospital of Tropical Diseases (NHTD), Hanoi, Vietnam (#18/HDDD-NDTU), and National Hospital of Obstetrics and Gynecology (NHOG), Hanoi, Vietnam (#936/CN-PSTW).\n\nData collection\n\nThe enrolled pregnant women were asked to visit the NHTD at 32–36 gestational week for blood and urine tests on the viral load, cluster of differentiation 4 (CD4) cell count, and renal function (Fig 1). The NHOG provided delivery care support, checked whether newborns met the inclusion criteria, measured the body length, weight, and head circumference at birth, and recorded baseline clinical information, such as the Apgar score. The latter comprises five items related to the status of the newborn, which are measured immediately after birth: skin color, heart rate, tendon reflexes, muscle tone, and respiration. After the delivery, the mother-infant pairs, who conformed the study inclusion and exclusion criteria, visited the NHTD at 3, 12, and 18 months after delivery for maternal and infantile measurements of various physical parameters and laboratory tests. Specifically, the infant length, weight and head circumference, and serum alkaline phosphatase (ALP), creatinine, calcium, phosphorus, urine-β2-microglobulin (U-BMG), percentage of tubular reabsorption of phosphate (%TRP), and wrist radiographic score for rickets were obtained at these three visits. U-BMG was measured using a turbidimetric immunoassay with a coefficient of variation (CV) of 0.9–2.9% in manufacturer’s data (Abbott Quantia β2-Microglobulin reagent kit with ARCHITECT ci8200, Abbott Diagnostics, Abbott Park, IL). The %TRP was calculated using urine-phosphate and urine-creatinine measured from the spot urine sample, and serum-creatinine and serum-phosphorus levels obtained from blood samples drawn on the same day. Serum/urine phosphate and creatinine were measured using kinetic color test (Beckman Coulter AU480, Beckman Coulter, Brea, CA). At 3 months of age, serum 25 (OH) Vitamin D level was determined at NHTD using a delayed 1-step chemiluminescence microparticle immunoassay (CMIA) (Abbott ARCHITECT 25-OH Vitamin D assay reagent kit with ARCHITECT i2000SR immunoassay analyzer, Abbott Diagnostics, Abbott Park, IL). Its CV and the mean bias to the reference method were reported 2.7–4.6% and -16.3%, respectively [17].\n\n10.1371/journal.pone.0250828.g001 Fig 1 Flow chart of the subject enrollment process.\n\nSixty-seven HIV-infected and 10 HIV-negative pregnant women were recruited at the NHOG. Of the 57 TDF-treated mother-infant pairs, 4 pairs were excluded due to miscarriage (n = 1), delivery at other hospitals (n = 2), and twins (n = 1). Although 3 of the 10 HIV-negative mothers were enrolled and provided maternal data and infant physical data at birth, none of the infants was brought to the center for further physical measurement and laboratory tests.\n\nRadiographic scoring for nutritional rickets\n\nInfant wrist radiographic score for nutritional rickets was determined at 3, 12, and 18 months of age, using a widely adapted 10-point scoring system [18]. Briefly, a grade of 0 represents a normal wrist, a grade 1 represents a widened growth plate and irregularity of metaphyseal margin without concave cupping, and a grade 2 represents metaphyseal concavity with fraying of margins. The maximum score is 4, with 2 for both the radius and ulna. Each radiograph was scored independently by a trained physician at the National Center for Global Health and Medicine, who was blinded to clinical information.\n\nStatistical analysis\n\nThe clinical characteristics of the mothers and the infant baseline data were compared between the TDF and AZT groups using the chi-square test for nominal data and by the Mann-Whitney test for continuous parameters. The infant growth outcomes (length, weight, and head circumference) of the TDF and AZT groups were compared by two-way ANOVA at different ages. The prevalence of detectable U-BMG (>252 μg/L) and abnormal radiographic score for rickets in the two treatment groups were compared by the chi-square test. We also used linear multiple regression analyses to determine the relationship between growth parameters and the laboratory test values, and confounding factors other than maternal use of TDF and infant age, where maternal use of LPV/r, maternal age, CD4, and viral load, and gestational age, and infant age were set as the independent variables, and the estimates, 95% confidence interval (95% CI) were calculated. For U-BMG, multivariate logistic analysis was conducted where the presence of detectable level of U-BMG was set as the dependent variable with the same independent variables as in multiple regression analyses. All statistical analyses were performed using The Statistical Package for Social Sciences ver. 23.0 (SPSS, Chicago, IL).\n\nResults\n\nSample population\n\nA total of 67 HIV-infected pregnant women (57 TDF-treated women and 10 AZT-treated women) were enrolled in this study before the third trimester. Of those, 63 mother-infant pairs (TDF group, n = 53, AZT group, n = 10) who delivered at the NHOG met the study criteria (Fig 1). Although more than 30 non-HIV mothers were recruited, only 2 mother-infant pairs agreed to participate in the present study. While both pairs provided maternal demographic and laboratory data and infant physical data at birth, none visited our facility for further infant follow-up. The median maternal age of the 63 mothers was 32 years [interquartile range (IQR) 8.0], and median body weight during 32–36 gestational weeks was 57.5 kg (IQR 11.0), suggesting a non-pregnant body weight of less than 50 kg, similar to the majority of Vietnamese women (Table 1). There were no significant differences in age, body weight, VL and CD4 cell count between the 53 TDF and 10 AZT groups. Based on the 2013 WHO guidelines, which recommended the combination of TDF+3TC+EFV for all HIV-infected patients, including pregnant women, 53 of the 63 (84%) pregnant women received TDF-based regimen, while 49 of the 63 (78%) received TDF+3TC+EFV. Furthermore, LPV/r was used by 5 of the 10 (50%) mothers of the AZT group, but only by 7 of the 53 (11.1%) of the TDF group.\n\n10.1371/journal.pone.0250828.t001 Table 1 Clinical characteristics and laboratory test results of pregnant women at 32–36 weeks of gestation.\n\n\tTotal (n = 63)\tTDF (n = 53)\tAZT (n = 10)\tP value\t\nAge (years), median (IQR)\t32 (8.0)\t32 (6.1)\t32 (8.7)\t0.805\t\nBody weight (kg), median (IQR)\t57.3 (11.0)\t57.5 (12.3)\t57.3 (6.5)\t0.601\t\nGestational complications, n (%)\t2 (3.2)\t1 (1.9)\t1 (10)\t0.382\t\nCurrent Smoking, n (%)\t1 (1.6)\t1 (1.9)\t0 (0)\tn.a.\t\nAlcohol use, n (%)\t0 (0)\t0 (0)\t0 (0)\tn.a.\t\nCD4 cell count (median, IQR)\t298 (201)\t394 (191)\t442 (205)\t0.689\t\nHIV-RNA undetectable (<20) (n, %)\t49 (78)\t41 (77)\t8 (80)\t0.854\t\nAlkaline phosphatase (IU/L), median (IQR)\t102 (33)\t104 (33)\t84 (40)\t0.162\t\nCreatinine (mg/dL), median (IQR)\t0.59 (0.16)\t0.59 (0.15)\t0.53 (0.19)\t0.276\t\nCalcium (mg/dL), median (IQR)\t8.8 (0.5)\t8.7 (0.4)\t8.8 (0.4)\t0.316\t\nPhosphorus (mg/dL), median (IQR)\t3.3 (0.6)\t3.1 (0.9)\t3.6 (0.5)\t0.358\t\nU = BMG (μg/L), median (IQR)\t2755 (5222)\t3060 (5915)\t581 (3322)\t<0.001\t\nDetectable U-BMG (>252 μg/L), n (%)\t52 (83)\t47 (89)\t5 (50)\t<0.001\t\n%TRP (%), median (IQR)\t92.2 (6.2)\t91.5 (6.1)\t93.8 (6.1)\t0.241\t\nLow %TRP (<90%), n (%)\t22 (34.9)\t20 (38.5)\t2 (20.0)\t0.309\t\nVery low %TRP (<80%), n (%)\t0 (0)\t0 (0)\t0 (0)\tn.a.\t\n*Hemoglobin (g/dL), median (IQR)\t12.4 (1.4)\t12.6 (1.7)\t12.1 (0.8)\t0.260\t\n*Hematocrit (%), median (IQR)\t36.9 (4.5)\t37.3 (4.6)\t35.3 (1.1)\t0.214\t\n*Mean corpuscular volume (fL), median (IQR)\t97.4 (11.2)\t95.7 (7.2)\t109.3 (20.5)\t0.051\t\nHistory of AIDS-defining illness, n (%)\t0 (0)\t0 (0)\t0 (0)\tn.a.\t\nART initiation\t\t\t\t\t\n Before pregnancy, n (%)\t56 (89)\t47 (89)\t9 (90)\t0.903\t\n During pregnancy, n (%)\t7 (11)\t6 (11)\t1 (10)\t\t\nART duration (months), median (IQR)\t29 (51.7))\t28 (55.3)\t47 (53.8)\t0.155\t\nHistory of TDF use, n (%)\t57 (90)\t53 (100)\t4 (40)\tn.a.\t\nTDF duration (months), median (IQR)\t22 (38.3)\t26 (48.2)\t3 (28.3)\t0.235\t\nKey medications during pregnancy\t\t\t\t\t\n EFV, n (%)\t49 (77.8)\t49 (92.4)\t0 (0)\tn.a.\t\n NVP, n (%)\t7 (11.1)\t2 (3.8)\t5 (50)\t<0.001\t\n LPV/r, n (%)\t7 (11.1)\t2 (3.8)\t5 (50)\t<0.001\t\nP value was determined by chi-square test of t-test in comparison of TDF and AZT group.\n\n*Blood samples for hemoglobin, hematocrit, and mean corpuscular volume were collected from 31/63 participants (23 of TDF-treated mothers and 8 of AZT-treated mothers) for post-hoc analysis.\n\nIQR: interquartile range, TDF; tenofovir disoproxil fumarate, AZT; zidovudine, U-BMG; urine-β2-microglobulin, %TRP; the percentage of renal tubular reabsorption of phosphate, EFV; efavirenz, NVP; nevirapine, LPV/r; lopinavir-ritonavir (Kaletra)\n\nEffects of TDF on maternal laboratory tests\n\nLaboratory tests showed a tendency for higher levels of serum creatinine (0.59 vs. 0.53 mg/dL, p = 0.276), lower concentrations of serum phosphorus (3.1 vs. 3.6 mg/dL, p = 0.358), and higher percentage of mothers with low %TRP (38.7% vs. 20.0%, p = 0.309) in the TDF group, compared with the AZT group. Furthermore, a significantly larger proportion of mothers of the TDF group had high U-BMG compared with the AZT group (89% vs. 50%, p<0.001) (Table 1).\n\nEffects of TDF and AZT on newborn physical characteristics\n\nThe majority of infants were born at 39 weeks of gestation and none showed perinatal complications or congenital abnormalities. Body length and head circumference at birth were smaller in the AZT group compared with the TDF group [49.2 vs. 46.4 cm, p = 0.061 (body length), and 34.0 vs. 32.5 cm, p<0.001 (head circumference) in TDF and AZT group, respectively]. In Vietnam, it is the Government policy to treat all infants of HIV-infected mothers with nevirapine, but not AZT, during the first 6 weeks of life. The 25 (OH) vitamin D level at 3 months of the entire group was low (median: 32.1 IU/mL, IQR 13.6 IU/mL), and 24 of the total 63 (38.1%) infants had low levels of vitamin D (Table 2).\n\n10.1371/journal.pone.0250828.t002 Table 2 Baseline clinical characteristics of the study infants.\n\n\tTotal (n = 63)\tTDF (n = 53)\tAZT (n = 10)\tP value\t\nSex (male): n, (%)\t37 (58.7)\t34 (64.2)\t3 (30)\t0.129\t\nGestational age (week), median (IQR)\t39 (1.1)\t39 (1)\t39 (1.3)\t0.462\t\nBirth length (cm), median (IQR)\t48.0 (2.3)\t49.2 (1.7)\t46.0 (8.5)\t0.061\t\nBirth weight (g), median (IQR)\t3100 (500)\t3200 (550)\t2900 (750)\t0.165\t\nBirth head circumference (cm), median (IQR)\t34.0 (2.0)\t34 (1.8)\t32.5 (5.6)\t<0.001\t\nAPGAR score (1 min), median (IQR)\t9 (1)\t9 (1)\t9 (1)\tNS\t\nAPGAR score (5 min), median (IQR)\t10 (0)\t10 (0)\t10 (0)\tNS\t\nPerinatal complication, n (%)\t0 (0)\t0 (0)\t0 (0)\tNS\t\nCongenital abnormalities, n (%)\t0 (0)\t0 (0)\t0 (0)\tNS\t\nNutrition (breastfeeding), n (%)\t0 (0)\t0 (0)\t0 (0)\tNS\t\nPostpartum antiretroviral\t\t\t\t\t\n Zidovudine, n (%)\t0 (0)\t0 (0)\t0 (0)\tNS\t\n Nevirapine, n (%)\t63 (100)\t53 (100)\t10 (100)\tNS\t\nDuration of postpartum antiretrovirals (wks), median (IQR)\t6 (0)\t6 (0)\t6 (0)\tNS\t\n25-OH Vitamin D at 3 months (IU/mL), median (IQR)\t32.1 (13.6)\t32.3 (13.8)\t27.6 (15.6)\t0.411\t\nLow 25-OH Vitamin D at 3 months (<30 IU/mL), n (%)\t24 (38.1)\t19 (35.8)\t5 (50)\t0.428\t\n Deficient (<20 IU/mL), n (%)\t6 (9.5)\t6 (11.3)\t0 (0)\t0.316\t\n Insufficient (20–30 IU/mL), n (%)\t18 (28.6)\t13 (24.5)\t5 (50)\t0.242\t\nIQR: interquartile range, TDF; tenofovir disoproxil fumarate, AZT; zidovudine, n.a.: not available, NS: not significant\n\nComparative analysis of effects of TDF and AZT on infant growth, renal function and bone health\n\nNewborn body length, weight, and head circumference were significantly smaller in the AZT than TDF group (2-way ANOVA, adjusted for age (p = 0.002, 0.047, and 0.049, respectively) (Fig 2(A)–2(C)). Furthermore, ALP was significantly higher in the TDF compared with the AZT group (p = 0.007), whereas serum-creatinine, phosphorus and %TRP were not different (2-way ANOVA, p = 0.505, 0.583, and 0.972, respectively) (Fig 2(D)–2(G)).\n\n10.1371/journal.pone.0250828.g002 Fig 2 The dot plots provide comparisons of neonate/infant length (A), weight (B), and head circumference (C) between the TDF and AZT groups.\n\nThe box-whisker plots provide comparisons of neonate/infant serum creatinine (D), serum phosphorus (E), serum alkaline phosphatase (F), and the percentage of tubular reabsorption of phosphate (G) between the two groups. Data were compared by 2-way ANOVA to adjust for the influence of age.\n\nSerial analysis showed a decrease in U-BMG level with age in both treatment groups, but no significant difference in the prevalence of detectable U-BMG between the TDF and AZT groups [5/53 (9.4%) vs. 2/10 (20%) at 3 months (p = 0.293), respectively (Fig 3A)]. There were no significant differences in the wrist radiographic scores for rickets between the two groups irrespective of age. Rapid improvement was observed with time after birth in the TDF group, and no abnormal findings being observed at 18 months of age. In comparison, one of the 5 infants of the AZT group (20%) continued to have poor radiographic scores as they aged and the score was still abnormal at 18 months of age (Fig 3B).\n\n10.1371/journal.pone.0250828.g003 Fig 3 Comparison of the prevalence of elevated urine β2-microglobulin (A) and abnormal radiographic wrist score for rickets (B) between the TDF and AZT groups.\n\nData were compared by chi-square test.\n\nEffects of confounding factors on infant growth, renal function and bone health\n\nMultivariate linear regression analysis showed significant association between maternal TDF use and longer body length (estimate 2.52; 95% confidence interval (CI) 0.38–4.66, p = 0.021). Apart from infant age, no other confounding factors were associated with body length, weight, and head circumference (Table 3). Multivariate linear regression analyses with the same independent variables as those used in the models for physical parameters (Table 4) showed a significant association between high serum alkaline phosphatase levels and maternal TDF [estimates 41.22; 95%CI: 6.98–75.45), p = 0.019]. Overall, maternal TDF neither correlated with elevated serum creatinine, serum phosphorus, %TRP, radiographic score for rickets, nor with abnormal U-BMG. Interestingly, poor wrist radiographic score for rickets correlated significantly with maternal use of lopinavir/ritonavir (LPV/r), but not TDF (estimate 0.55; 95%CI: 0.08–1.02, p = 0.024).\n\n10.1371/journal.pone.0250828.t003 Table 3 Results of multivariate regression analysis of the association of various maternal/infant factors with infant body length, weight, and head circumference.\n\n\tLength\tWeight\tHead Circumference\t\n\tEstimate (95% CI)\tP value\tEstimate (95% CI)\tP value\tEstimate (95% CI)\tP value\t\nMaternal TDF (yes or no)\t2.52 (0.38 to 4.66)\t0.021\t130.1 (-393.1 to 653.3)\t0.624\t0.47 (-0.81 to 1.74)\t0.470\t\nMaternal LPV/r (yes or no)\t0.61 (-1.84 to 3.06)\t0.626\t-75.6 (-675.4 to 524.2)\t0.804\t-0.34 (-1.79 to 1.12)\t0.643\t\nGestational week at birth (per 1 week increase)\t0.20 (-1.69 to 1.35)\t0.542\t33.2 (-127.0 to 193.4)\t0.683\t-0.16 (-0.55 to 0.24)\t0.434\t\nInfant sex (male = 1, female = 0)\t-0.17 (-0.004 to 0.007)\t0.825\t-28.4 (-398.0 to 341.1)\t0.879\t-0.54 (-1.45 to 0.36)\t0.238\t\nInfant age (per 1 month increase)\t1.83 (1.73 to 1.93)\t<0.001\t-149.0 (-174.7 to -123.3)\t<0.001\t0.75 (0.68 to 0.81)\t<0.001\t\n\n10.1371/journal.pone.0250828.t004 Table 4 Results of multivariate regression analysis of the association of various laboratory findings with maternal and infant parameters.\n\n\tMaternal TDF (yes/no)\tMaternal LPV/r (yes/no)\tGestational age (/week increase)\tInfant sex (m = 1, f = 0)\tInfant age (/month increase)\t\nSerum creatinine\t\t\t\t\t\t\n Estimate (95% CI)\t0.03 (-0.02 to 0.07)\t0.03 (-0.03 to 0.08)\t0.009 (-0.005 to 0.023)\t0.01 (-0.02 to 0.04)\t0.005 (0.003 to 0.008)\t\n P value\t0.211\t0.315\t0.225\t0.541\t<0.001\t\nSerum phosphorus\t\t\t\t\t\t\n Estimate (95% CI)\t-0.05 (-0.39 to 0.29)\t-0.13 (-0.53 to 0.26)\t-0.04 (-0.15 to 0.07)\t0.10 (-0.10 to 0.36)\t-0.08 (-0.10 to -0.06)\t\n P value\t0.773\t0.507\t0.474\t0.427\t<0.001\t\nSerum alkaline phosphatase\t\t\t\t\t\t\n Estimate (95% CI)\t41.22 (6.98 to 75.45)\t-14.42 (-54.01 to 25.17)\t7.92 (-3.04 to 18.87)\t5.64 (-20.02 to 31.3)\t-5.34 (-7.25 to -3.42)\t\n P value\t0.019\t0.472\t0.155\t0.664\t<0.001\t\n%TRP\t\t\t\t\t\t\n Estimate (95% CI)\t0.09 (-4.93 to 5.12)\t1.05 (-4.77 to 6.86)\t-1.68 (-3.29 to -0.07)\t-0.71 (-4.48 to 3.06)\t-0.33 (-0.61 to -0.53)\t\n P value\t0.971\t0.722\t0.041\t0.709\t0.020\t\nWrist radiographic scores\t\t\t\t\t\t\n Estimate (95% CI)\t0.15 (-0.26 to 0.57)\t0.55 (0.08 to 1.02)\t0.08 (-0.05 to 0.21)\t-0.06 (-0.37 to 0.25)\t-0.05 (-0.08 to -0.03)\t\n P value\t0.463\t0.024\t0.242\t0.709\t<0.001\t\nDetectable U-BMG\t\t\t\t\t\t\n Odds ratio (95% CI)\t0.56 (0.11 to 2.80)\t0.37 (0.04 to 3.92)\t0.96 (0.90 to 1.03)\t1.21 (0.35 to 4.13)\t0.96 (0.87 to 1.06)\t\n P value\t0.480\t0.407\t0.281\t0.763\t0.391\t\nTDF: tenofovir disoproxil fumarate, LPV/r: the combination of lopinavir and ritonavir (Kaletra)\n\nDifferences in U-BMG were tested by logistic multivariate analysis, with U-BMG detectable level (>252 μg/L) set as the independent variable.\n\nPost-hoc evaluation\n\nHemoglobin, hematocrit, erythrocyte count, and mean corpuscular volume (MCV) were measured during pregnancy in the HIV-infected mothers managed clinically at NHTD. Hemoglobin and hematocrit levels (measured in 31 mothers, TDF group: 23/53, AZT group: 8/10) were not significantly different between the AZT and TDF groups, while MCV was larger in the AZT than the TDF group (109.1 vs 95.7 fL, respectively, p = 0.051, Table 1).\n\nDiscussion\n\nThe main finding of the present study was that TDF use by pregnant Vietnamese women was not associated with infant growth impediment, renal dysfunction, or nutritional rickets, although it correlated with mild maternal renal tubular dysfunction. While we did not investigate the mechanisms of these changes in the present study, we postulate the following mechanisms. First, since growth is rapid in both late pregnancy and early infancy [7, 19], preterm infants are at risk of metabolic bone diseases in the presence of low supplies of phosphorus and calcium [20]. Similarly, TDF-associated maternal renal tubular dysfunction during late pregnancy can cause blunted fetal growth based on inadequate supply of phosphate [21]. In the present study, although TDF use during pregnancy was associated with significantly high maternal U-BMG levels, the maternal and infant %TRP levels were not significantly different between the TDF and AZT groups. These results suggest that TDF use by the Vietnamese pregnant mothers was not associated with significant renal loss of phosphorus. Since high serum levels of ALP in the infant were associated with maternal TDF use, consistent with the findings in adult populations [4, 22], maternal TDF exposure seems to influence bone health of infants at subclinical levels. Second, infants aged 3 months had below normal levels of 25-OH Vitamin D (<30 IU/mL) (in 38% of TDF group and 50% of AZT group). These data are consistent with a number of previous studies that demonstrated higher rates of vitamin D deficiency among Asians, compared with Caucasians, probably due to insufficient dietary intake [23, 24]. Given vitamin D deficiency rickets is the most common etiology of rickets [7] especially in Asian countries, the lower serum levels of 25-OH vitamin D seem to mask the impact of TDF-associated infant growth disturbance via renal loss of phosphate.\n\nSurprisingly, our study identified AZT, rather than TDF, as the only significant risk factor for shorter infant body length. Various AZT toxic effects have been reported, including mitochondrial dysfunction with myopathy and cardiomyopathy [25], and bone marrow suppression [26]. Although reviews of ACTG 076 supported the safety of in utero exposure to AZT with respect to long-term infant development/growth [27], serious concerns have been raised about infant mitochondrial dysfunction [28, 29] and cardiac toxicity [30]. Since AZT passes easily through the placenta, it confers high plasma concentrations in cord blood/peripheral circulation of infants [31]. Asian population with small body size could be vulnerable to AZT toxicity if exposed to AZT in utero. Unfortunately, blood samples were not obtained from the infants in the present study for ethical reasons and thus no hematological parameters, lactate levels, blood gases, or creatine kinase levels were measured to evaluate AZT toxicity in infants. Post-hoc analysis did not show any differences in hematologic parameters between TDF and AZT maternal groups. Further studies are needed to determine the effects of AZT and TDF use during pregnancy on infant growth.\n\nLPV/r was used in 5 of the 10 (50%) AZT-treated women but only in 2 of the 53 (3.8%) pregnant mothers of the TDF group. A number of well-designed randomized controlled studies reported significant association between maternal use of protease inhibitors, such as LPV/r, and fetal prematurity [32, 33]. A more recent study concluded that the use of LPV/r was the most significant determinant of neonatal delayed growth [34]. Especially, protease inhibitors are reported to have adverse effects on bone health [6, 35] through the activation of osteoclasts [36] or blockade of osteoblast differentiation [37]. Since bone ALP is the main isozyme in infants, the low levels of ALP observed in our study in the AZT group may partly explain the low osteoblast activity in LPV/r-exposed infants. Furthermore, given that perinatal and postnatal exposure to LPV/r, a potent cytochrome p450 inhibitor, causes clinically-evident adrenal dysfunction [38], maternal exposure to LPV/r may have an adverse impact on infant growth or bone health.\n\nOur study has certain limitations. First, the smaller sample size of the AZT group limited the statistical power for appropriate comparison of renal/bone health markers, because Vietnamese pregnant women had been treated mainly with TDF-containing regimens in accordance with the 2013 launched WHO recommendation [1]. This limitation also curtailed full analysis of the association of AZT and LPV/r with infant growth and bone health, although the main finding of the present study was the adverse effects of AZT and LPV/r. Second, infant growth should be compared using Z-scores to standardize the data for sex and race. To our knowledge, there are no established standard norms for physical growth of Vietnamese newborns and infants. In addition, normal values of tests of renal function, bone health, and serum levels of vitamin D are also not available. Although we tried to collect data of non-HIV mother-infant pairs to deal with the lack of normative data for Vietnamese, only two of the enrolled non-HIV mother-infant pairs visited our center at the time of the study. In the present study, the higher percentage of male infants in the TDF group (34 of 53; 64%), compared with the AZT group (3 of 10; 30%), may explain the significant difference in body length between the two groups. However, in general, the difference in body length between the sexes is only 1 cm from birth to 18 months of age [39], whereas the present study showed a larger than expected difference (49.2 vs. 46.0 cm at birth and 75.0 vs. 71.0cm at 18 months of age in the TDF and AZT groups, respectively). Moreover, multivariate linear regression analysis showed that female sex was not associated with shorter length (p = 0.825).\n\nIn conclusion, we have demonstrated in the present study that the use of TDF during pregnancy was not associated with harmful effects on neonatal and infant growth, renal function, or bone health, though it was associated with mild maternal renal tubular dysfunction in Vietnamese population. Maternal AZT and LPV/r showed significant association with infant growth and bone health, which requires further investigation.\n\nSupporting information\n\nS1 Dataset (XLSX)\n\nClick here for additional data file.\n\nWe thank the children, caretakers and staff of all facilities who participated in the present study, especially M. Sata and H. Nguyen (AIDS Clinical Center), D.T. Thuy and P.T. Tuyen (NHTD, Hanoi, Vietnam), and N.T. Trang (NHOG, Hanoi, Vietnam).\n\n10.1371/journal.pone.0250828.r001\nDecision Letter 0\nXie Linglin Academic Editor\n© 2021 Linglin Xie\n2021\nLinglin Xie\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nSubmission Version0\n15 Mar 2021\n\nPONE-D-21-05310\n\nInfluence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health\n\nPLOS ONE\n\nDear Dr. Kinai,\n\nThank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.\n\nPlease submit your revised manuscript by 04/12/2021. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.\n\nPlease include the following items when submitting your revised manuscript:\n\nA rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.\n\nA marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.\n\nAn unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.\n\nIf you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.\n\nIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols\n\nWe look forward to receiving your revised manuscript.\n\nKind regards,\n\nLinglin Xie\n\nAcademic Editor\n\nPLOS ONE\n\nJournal Requirements:\n\nPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.\n\nWhen submitting your revision, we need you to address these additional requirements.\n\n1.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at\n\nhttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and\n\nhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf\n\n2. Thank you for stating the following in the Competing Interests section:\n\n\"E.K. has received honoraria from Gilead Sciences, ViiV Healthcare, and MSD. S.O. received honoraria from MSD, Janssen Pharmaceutical and Gilead Sciences, and research grants from MSD, ViiV Healthcare, Gilead Sciences. The remaining authors declare no conflict of interest.\n\nThis research was supported by the Japan Initiative for Global Research Network on Infectious Diseases from the Japan Agency for Medical Research and development, AMED. During the study period, antiretrovirals for Vietnamese patients were provided under the financial support of the U.S. president’s emergency plan for AIDS relief (PEPFAR).\"\n\nPlease confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: \"This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.\n\nPlease include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.\n\nPlease know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests\n\n3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.\n\nIn your revised cover letter, please address the following prompts:\n\na) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially identifying or sensitive patient information) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.\n\nb) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.\n\nWe will update your Data Availability statement on your behalf to reflect the information you provide.\n\n[Note: HTML markup is below. Please do not edit.]\n\nReviewers' comments:\n\nReviewer's Responses to Questions\n\nComments to the Author\n\n1. Is the manuscript technically sound, and do the data support the conclusions?\n\nThe manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.\n\nReviewer #1: Yes\n\nReviewer #2: Yes\n\n**********\n\n2. Has the statistical analysis been performed appropriately and rigorously?\n\nReviewer #1: Yes\n\nReviewer #2: I Don't Know\n\n**********\n\n3. Have the authors made all data underlying the findings in their manuscript fully available?\n\nThe PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.\n\nReviewer #1: Yes\n\nReviewer #2: Yes\n\n**********\n\n4. Is the manuscript presented in an intelligible fashion and written in standard English?\n\nPLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.\n\nReviewer #1: Yes\n\nReviewer #2: Yes\n\n**********\n\n5. Review Comments to the Author\n\nPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)\n\nReviewer #1: Overall it was a nicely written paper. Please see the attached document which contains my edits and comments.\n\nA few things:\n\n1. Please be sure to write out the entire word first before abbreviating it\n\n2. Be sure to include which BMD site you were referring to whole body ? lumbar spine? etc.\n\n3. Several sentences are extremely long and frankly don't make sense. Please modify.\n\nReviewer #2: The study investigated the effects of maternal use of TDF on renal function, infant growth, and bone related parameter in Vietnamese women, as compared to AZT. The study is important in that whether Asian women and infants are more susceptible to the detrimental impact of TDF on renal function and bone health has not been studied.\n\nIntroduction\n\nNeed to briefly introduce the use of zidovudine and if AZT has any effects on renal function and bone.\n\nMethods\n\nPlease provide the methods of serum 25(OH) vitamin D, and other measurements, as well as the precision and accuracy of these measurements\n\nBone-related markers such as P1NP should have been measured.\n\n**********\n\n6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.\n\nIf you choose “no”, your identity will remain anonymous but your review may still be made public.\n\nDo you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.\n\nReviewer #1: Yes: Lauren Coheley\n\nReviewer #2: Yes: Jay Cao\n\n[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link \"View Attachments\". If this link does not appear, there are no attachment files.]\n\nWhile revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.\n\nAttachment Submitted filename: PONE-D-21-05310_reviewer (1).pdf\n\nClick here for additional data file.\n\n10.1371/journal.pone.0250828.r002\nAuthor response to Decision Letter 0\nSubmission Version1\n12 Apr 2021\n\nMarch 31, 2021\n\nDr. Linglin Xie\n\nAcademic Editor\n\nPLOS ONE\n\nManuscript ID: PONE-D-21-05310\n\nManuscript title: Influence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health\n\nAuthors: Kinai E, et al\n\nDear Dr. Xie\n\nWe were pleased to know of the positive evaluation of our manuscript and its potential acceptance for publication in PLOS ONE, subject to adequate revision and response to the reviewers' comments.\n\nBased on the instructions, we logged into the journal website and submitted the file of the revised manuscript (file name: PONE-D-21-05310-R1) and the file of the point-by-point response to the comments raised by the reviewers (file name: PONE-D-21-05310-response) in Microsoft Word format.\n\nWe responded to all the comments raised by the reviewers and modified the text based on those comments. The added new text appears red in the revised manuscript.\n\nWe take this opportunity to express our gratitude to the reviewers for their constructive and useful remarks. Their comments allowed us to identify areas in our manuscript that needed modification and clarification. We also thank you for allowing us to resubmit a revised copy of the manuscript.\n\nI hope that the revised manuscript is now acceptable for publication in PLOS ONE.\n\nSincerely Yours,\n\nEi Kinai, MD, PhD\n\nDepartment of Laboratory Medicine, Tokyo Medical University\n\n6-7-1, Nishi-shinjuku, Shinjuku-ku,\n\nTokyo, 160-0023, Japan\n\nPhone: +81-3-3342-6111\n\nFax: +81-3-3340-5548\n\nE-mail: ekinai@tokyo-med.ac.jp\n\n=====================================================\n\nPoint-by-point response to the comments of Reviewer 1\n\nReviewer #1:\n\nOverall it was a nicely written paper. Please see the attached document which contains my edits and comments.\n\nWe thank the reviewer for the comments and help to improve the presentation. We replaced the original text with the text recommended by the reviewer (the revised text appears in red).\n\nIn the abstract, the reviewer modified “worse” to “lower?”. However, in the radiographic scoring system used in this study, a lower score represents better condition and a higher score reflects worse condition. In the abstract, LPV/r is associated with “higher” score, but such descriptor could be misleading and misinterpreted. Therefore, we prefer to stick to “worse” score used in the original manuscript (page 3, line 45).\n\nA few things:\n\n1. Please be sure to write out the entire word first before abbreviating it.\n\nWe thank the reviewer for the comment. We spell out all abbreviations, including “HIV” (abstract page 3, lines 27-28 and page 5, lines 52-3), “CD4” (page 7, line 111), and many others throughout the manuscript and Tables. The “Apgar” score refers to the physician who established the scoring system; “Virginia Apgar”, and we added the brief information on this scoring system (page 7, lines 115-117).\n\n2. Be sure to include which BMD site you were referring to whole body ? lumbar spine? etc.\n\nWe thank the reviewer for the comment. We specified the site of bone mineral density used in each reference. Thus, ref. 13 measured whole-body bone mineral contents, while ref.14 measured BMD of the lumbar spine (page 5-6, lines 70-75).\n\n3. Several sentences are extremely long and frankly don't make sense. Please modify.\n\nIn response to the comment, we went through the entire text and shortened any long sentence found in the original manuscript (page 5 lines 70-74, and page 10 lines 171-172). We also corrected a misprinted sentence (page 11 lines 195-6).\n\n<Note to the reviewer>\n\nWe like to clarify here one issue related to the inclusion of non-HIV mother-infant pairs. As described in the manuscript, our study was designed to collect data on both HIV-infected and non-HIV mother-infant pairs. However, only two non-HIV mother-infant pairs participated in the study, and, unfortunately, neither of them visited the research center after birth. Consequently, the data of non-HIV mother-infants pairs was too small for proper comparisons with those of HIV-infected pairs. To avoid any confusion, we deleted the data of non-HIV group infants from Table 2, and deleted the text “not shown in Fig.1” (page 7, line 102, and page 10, line 174).\n\n \n\nPoint-by-point response to the comments of Reviewer 2\n\nReviewer #2:\n\nThe study investigated the effects of maternal use of TDF on renal function, infant growth, and bone related parameter in Vietnamese women, as compared to AZT. The study is important in that whether Asian women and infants are more susceptible to the detrimental impact of TDF on renal function and bone health has not been studied.\n\nWe thank the reviewer for the positive evaluation. Since Asian women and infants are considered vulnerable to the toxicity of antiretroviral drugs due to their small body size, our study provides important information about the safety of TDF on pregnant women and infants.\n\nIntroduction\n\nNeed to briefly introduce the use of zidovudine and if AZT has any effects on renal function and bone.\n\nWe thank the reviewer for the comment. We expanded the Introduction by adding information about the history of AZT use as perinatal prophylaxis for mother-to-child transmission of HIV (page 5, line 53-55).\n\nMethods\n\nPlease provide the methods of serum 25(OH) vitamin D, and other measurements, as well as the precision and accuracy of these measurements\n\nBone-related markers such as P1NP should have been measured.\n\nWe thank the reviewer for the comment. For measurement of serum 25 (OH) vitamin D, we used the delayed 1-step chemiluminescence microparticle immunoassay (CMIA) (Abbott ARCHITECT 25-OH Vitamin D assay). We added brief information about the method of measurement of serum 25(OH) vitamin D (page 8, lines 131-136). The ARCHITECT assay has been validated and widely used worldwide. However, we do not have the original validation data. Instead, we elected to cite one validation paper as a reference (ref. 17).\n\nIn addition to 25(OH) Vitamin D, we also expanded the text to describe the methods used for measurements of U-BMG and %TRP (page 8, lines 124-131). We also added the coefficient of variation of the methods of U-BMG employed in this study (page 8, line 125).\n\nWe agree with the reviewer that we should have measured bone-specific markers such as P1NP.\n\n<Note to the reviewer>\n\nWe like to clarify here one issue related to the inclusion of non-HIV mother-infant pairs. As described in the manuscript, our study was designed to collect data on both HIV-infected and non-HIV mother-infant pairs. However, only two non-HIV mother-infant pairs participated in the study, and, unfortunately, neither of them visited the research center after birth. Consequently, the data of non-HIV mother-infants pairs was too small for proper comparisons with those of HIV-infected pairs. To avoid any confusion, we deleted the data of non-HIV group infants from Table 2, and deleted the text “not shown in Fig.1” (page 7, line 102, and page 10, line 174).\n\nAttachment Submitted filename: PONE-D-21-05310-response final.docx\n\nClick here for additional data file.\n\n10.1371/journal.pone.0250828.r003\nDecision Letter 1\nXie Linglin Academic Editor\n© 2021 Linglin Xie\n2021\nLinglin Xie\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nSubmission Version1\n15 Apr 2021\n\nInfluence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health\n\nPONE-D-21-05310R1\n\nDear Dr. Kinai,\n\nWe’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.\n\nWithin one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.\n\nAn invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.\n\nIf your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.\n\nKind regards,\n\nLinglin Xie\n\nAcademic Editor\n\nPLOS ONE\n\nAdditional Editor Comments (optional):\n\nReviewers' comments:\n\n10.1371/journal.pone.0250828.r004\nAcceptance letter\nXie Linglin Academic Editor\n© 2021 Linglin Xie\n2021\nLinglin Xie\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\n19 Apr 2021\n\nPONE-D-21-05310R1\n\nInfluence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health\n\nDear Dr. Kinai:\n\nI'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.\n\nIf your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.\n\nIf we can help with anything else, please email us at plosone@plos.org.\n\nThank you for submitting your work to PLOS ONE and supporting open access.\n\nKind regards,\n\nPLOS ONE Editorial Office Staff\n\non behalf of\n\nDr. Linglin Xie\n\nAcademic Editor\n\nPLOS ONE\n==== Refs\nReferences\n\n1 WHO Guidelines Approved by the Guidelines Review Committee. Consolidated Guidelines on the Use of Antiretroviral Drugs for Treating and Preventing HIV Infection: Recommendations for a Public Health Approach. Geneva: World Health Organization, Copyright (c) World Health Organization 2013; 2013.\n2 Cooper RD , Wiebe N , Smith N , Keiser P , Naicker S , Tonelli M . Systematic review and meta-analysis: renal safety of tenofovir disoproxil fumarate in HIV-infected patients. Clin Infect Dis. 2010;51 (5 ):496–505. Epub 2010/08/03. 10.1086/655681 .20673002\n3 Sax PE , Wohl D , Yin MT , Post F , DeJesus E , Saag M , et al . Tenofovir alafenamide versus tenofovir disoproxil fumarate, coformulated with elvitegravir, cobicistat, and emtricitabine, for initial treatment of HIV-1 infection: Two randomised, double-blind, phase 3, non-inferiority trials. Lancet (London, England). 2015;385 (9987 ):2606–15. Epub 2015/04/22. 10.1016/s0140-6736(15)60616-x .25890673\n4 Kinai E , Hanabusa H . Progressive renal tubular dysfunction associated with long-term use of tenofovir DF. AIDS Res Hum Retroviruses. 2009;25 (4 ):387–94. Epub 2009/04/14. 10.1089/aid.2008.0202 .19361280\n5 Gallant JE , Moore RD . Renal function with use of a tenofovir-containing initial antiretroviral regimen. AIDS. 2009;23 (15 ):1971–5. Epub 2009/08/22. 10.1097/QAD.0b013e32832c96e9 19696652\n6 McComsey GA , Kitch D , Daar ES , Tierney C , Jahed NC , Tebas P , et al . Bone mineral density and fractures in antiretroviral-naive persons randomized to receive abacavir-lamivudine or tenofovir disoproxil fumarate-emtricitabine along with efavirenz or atazanavir-ritonavir: Aids Clinical Trials Group A5224s, a substudy of ACTG A5202. J Infect Dis. 2011;203 (12 ):1791–801. Epub 2011/05/25. 10.1093/infdis/jir188 21606537\n7 Wharton B , Bishop N . Rickets. Lancet. 2003;362 (9393 ):1389–400. 10.1016/S0140-6736(03)14636-3 14585642\n8 Van Rompay KK , Brignolo LL , Meyer DJ , Jerome C , Tarara R , Spinner A , et al . 10.1128/aac.48.5.1469-1487.2004 . Antimicrob Agents Chemother. 2004;48 (5 ):1469–87. Epub 2004/04/24. PubMed Central PMCID: PMC400569.15105094\n9 Siberry GK , Williams PL , Mendez H , Seage GR 3rd , Jacobson DL , Hazra R , et al . Safety of tenofovir use during pregnancy: Early growth outcomes in HIV-exposed uninfected infants. AIDS. 2012;26 (9 ):1151–9. Epub 2012/03/03. 10.1097/QAD.0b013e328352d135 22382151\n10 Nucleoside reverse transcriptase inhibitor backbones and pregnancy outcomes. AIDS. 2019;33 (2 ):295–304. Epub 2018/12/19. 10.1097/QAD.0000000000002039 .30562172\n11 Pintye J , Langat A , Singa B , Kinuthia J , Odeny B , Katana A , et al . Maternal tenofovir disoproxil fumarate use in pregnancy and growth outcomes among HIV-Exposed Uninfected Infants in Kenya. Infect Dis Obstet Gynecol. 2015;2015 :276851. Epub 2016/01/30. 10.1155/2015/276851 26823647\n12 Gibb DM , Kizito H , Russell EC , Chidziva E , Zalwango E , Nalumenya R , et al . Pregnancy and infant outcomes among HIV-infected women taking long-term ART with and without tenofovir in the DART trial. PLoS Med. 2012;9 (5 ):e1001217. Epub 2012/05/23. 10.1371/journal.pmed.1001217 22615543\n13 Siberry GK , Jacobson DL , Kalkwarf HJ , Wu JW , DiMeglio LA , Yogev R , et al . Lower newborn bone mineral content associated with maternal use of tenofovir disoproxil fumarate during pregnancy. Clin Infect Dis. 2015;61 (6 ):996–1003. Epub 2015/06/11. 10.1093/cid/civ437 26060285\n14 Salvadori N , Fan B , Teeyasoontranon W , Ngo-Giang-Huong N , Phanomcheong S , Luvira A , et al . Maternal and infant bone mineral density 1 year after delivery in a randomized, controlled trial of maternal tenofovir disoproxil fumarate to prevent mother-to-child transmission of hepatitis B Virus. Clin Infect Dis. 2019;69 (1 ):144–6. Epub 2019/03/30. 10.1093/cid/ciy982 30924492\n15 Kourtis AP , Wiener J , Wang L , Fan B , Shepherd JA , Chen L , et al . Tenofovir disoproxil fumarate use during pregnancy and infant bone health: The Tenofovir in Pregnancy Pilot Study. Pediatr Infect Dis J. 2018;37 (11 ):e264–e8. Epub 2018/08/02. 10.1097/INF.0000000000002152 .30067600\n16 Nishijima T , Komatsu H , Gatanaga H , Aoki T , Watanabe K , Kinai E , et al . Impact of small body weight on tenofovir-associated renal dysfunction in HIV-infected patients: a retrospective cohort study of Japanese patients. PloS ONE. 2011;6 (7 ):e22661. Epub 2011/07/30. 10.1371/journal.pone.0022661 21799928\n17 Freeman J , Wilson K , Spears R , Shalhoub V , Sibley P . Performance evaluation of four 25-hydroxyvitamin D assays to measure 25-hydroxyvitamin D2. Clin Biochem 2015;48 (16–17 ):1097–104. Epub 2015 Jun 6. 10.1016/j.clinbiochem.2015.05.021 26054580\n18 Thacher TD , Fischer PR , Pettifor JM , Lawson JO , Manaster BJ , Reading JC . Radiographic scoring method for the assessment of the severity of nutritional rickets. J Trop Pediatr. 2000;46 (3 ):132–9. Epub 2000/07/14. 10.1093/tropej/46.3.132 .10893912\n19 Bishop N. Bone disease in preterm infants. Arch Dis Child. 1989;64 (10 Spec No):1403–9. Epub 1989/10/01. 10.1136/adc.64.10_spec_no.1403_spec_no.1403. 2686555\n20 Carpenter TO , Shaw NJ , Portale AA , Ward LM , Abrams SA , Pettifor JM . Rickets. Nat Rev Dis Prim. 2017;3 :17101. Epub 2017/12/22. 10.1038/nrdp.2017.101 .29265106\n21 Kinai E , Hosokawa S , Gomibuchi H , Gatanaga H , Kikuchi Y , Oka S . Blunted fetal growth by tenofovir in late pregnancy. AIDS. 2012;26 (16 ):2119–20. Epub 2012/10/12. 10.1097/QAD.0b013e328358ccaa .23052356\n22 Fux C , Rauch A , Simcock M , Bucher H , Hirschel B , Opravil M , et al . Tenofovir use is associated with an increase in serum alkaline phosphatase in the Swiss HIV Cohort Study. Antivir Ther. 2008;13 :1077–82. 19195333\n23 Lawson M , Thomas M . Vitamin D concentrations in Asian children aged 2 years living in England: Population survey. BMJ. 1999;318 (7175 ):28. Epub 1999/01/05. 10.1136/bmj.318.7175.28 9872879\n24 Chen YH , Fu L , Hao JH , Wang H , Zhang C , Tao FB , et al . Influent factors of gestational vitamin D deficiency and its relation to an increased risk of preterm delivery in Chinese population. Sci Rep. 2018;8 (1 ):3608. Epub 2018/02/28. 10.1038/s41598-018-21944-3 ; PubMed Central PMCID: PMC5827025.29483547\n25 Dalakas MC , Illa I , Pezeshkpour GH , Laukaitis JP , Cohen B , Griffin JL . Mitochondrial myopathy caused by long-term zidovudine therapy. N Engl J Med. 1990;322 (16 ):1098–105. Epub 1990/04/19. 10.1056/NEJM199004193221602 .2320079\n26 Aurpibul L , Puthanakit T , Sirisanthana T , Sirisanthana V . Haematological changes after switching from stavudine to zidovudine in HIV-infected children receiving highly active antiretroviral therapy. HIV Med. 2008;9 (5 ):317–21. Epub 2008/03/12. 10.1111/j.1468-1293.2008.00560.x .18331562\n27 Sperling RS , Shapiro DE , McSherry GD , Britto P , Cunningham BE , Culnane M , et al . Safety of the maternal-infant zidovudine regimen utilized in the Pediatric AIDS Clinical Trial Group 076 Study. AIDS. 1998;12 (14 ):1805–13. Epub 1998/10/29. 10.1097/00002030-199814000-00012 .9792381\n28 Blanche S , Tardieu M , Rustin P , Slama A , Barret B , Firtion G , et al . Persistent mitochondrial dysfunction and perinatal exposure to antiretroviral nucleoside analogues. Lancet. 1999;354 (9184 ):1084–9. Epub 1999/10/06. 10.1016/S0140-6736(99)07219-0 .10509500\n29 Barret B , Tardieu M , Rustin P , Lacroix C , Chabrol B , Desguerre I , et al . Persistent mitochondrial dysfunction in HIV-1-exposed but uninfected infants: clinical screening in a large prospective cohort. AIDS. 2003;17 (12 ):1769–85. Epub 2003/08/02. 10.1097/00002030-200308150-00006 .12891063\n30 Lipshultz SE , Easley KA , Orav EJ , Kaplan S , Starc TJ , Bricker JT , et al . Absence of cardiac toxicity of zidovudine in infants. Pediatric Pulmonary and Cardiac Complications of Vertically Transmitted HIV Infection Study Group. N Engl J Med. 2000;343 (11 ):759–66. Epub 2000/09/14. 10.1056/NEJM200009143431102 .10984563\n31 Kinai E , Kato S , Hosokawa S , Sadatsuki M , Gatanaga H , Kikuchi Y , et al . High plasma concentrations of zidovudine (AZT) do not parallel intracellular concentrations of AZT-triphosphates in infants during prevention of mother-to-child HIV-1 transmission. J Acquir Immune Defic Syndr. 2016;72 (3 ):246–53. Epub 2016/02/10. 10.1097/QAI.0000000000000950 .26859826\n32 Powis KM , Kitch D , Ogwu A , Hughes MD , Lockman S , Leidner J , et al . Increased risk of preterm delivery among HIV-infected women randomized to protease versus nucleoside reverse transcriptase inhibitor-based HAART during pregnancy. J Infect Dis. 2011;204 (4 ):506–14. Epub 2011/07/28. 10.1093/infdis/jir307 21791651\n33 Patel K , Van Dyke RB , Mittleman MA , Colan SD , Oleske JM , Seage GR , 3rd, et al . The impact of HAART on cardiomyopathy among children and adolescents perinatally infected with HIV-1. AIDS. 2012;26 (16 ):2027–37. Epub 2012/07/12. 10.1097/QAD.0b013e3283578bfa 22781228\n34 Blanche S , Tylleskar T , Peries M , Kankasa C , Engebretsen I , Meda N , et al . Growth in HIV-1-exposed but uninfected infants treated with lopinavir-ritonavir versus lamivudine: A secondary analysis of the ANRS 12174 trial. Lancet HIV. 2019;6 (5 ):e307–e14. Epub 2019/03/01. 10.1016/S2352-3018(18)30361-8 .30814028\n35 Kinai E , Nishijima T , Mizushima D , Watanabe K , Aoki T , Honda H , et al . Long-term use of protease inhibitors is associated with bone mineral density loss. AIDS Res Hum Retroviruses. 2014;30 (6 ):553–9. Epub 2014/02/06. 10.1089/aid.2013.0252 .24494779\n36 Modarresi R , Xiang Z , Yin M , Laurence J . WNT/beta-catenin signaling is involved in regulation of osteoclast differentiation by human immunodeficiency virus protease inhibitor ritonavir: Relationship to human immunodeficiency virus-linked bone mineral loss. Am J Pathol. 2009;174 (1 ):123–35. Epub 2008/12/20. 10.2353/ajpath.2009.080484 19095956\n37 Hirakawa H , Gatanaga H , Ochi H , Fukuda T , Sunamura S , Oka S , et al . Antiretroviral therapy containing HIV protease inhibitors enhances fracture risk by impairing osteoblast differentiation and bone quality. J Infect Dis. 2017;215 (12 ):1893–7. Epub 2017/05/20. 10.1093/infdis/jix246 .28525596\n38 Simon A , Warszawski J , Kariyawasam D , Le Chenadec J , Benhammou V , Czernichow P , et al . Association of prenatal and postnatal exposure to lopinavir-ritonavir and adrenal dysfunction among uninfected infants of HIV-infected mothers. JAMA. 2011;306 (1 ):70–8. Epub 2011/07/07. 10.1001/jama.2011.915 .21730243\n39 World Health Organization: The WHO child growth standards. Geneva, World Health Organization. 2009\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1932-6203",
"issue": "16(4)",
"journal": "PloS one",
"keywords": null,
"medline_ta": "PLoS One",
"mesh_terms": "D001827:Body Height; D010450:Endopeptidases; D005260:Female; D015658:HIV Infections; D006801:Humans; D007223:Infant; D008297:Male; D018811:Maternal Exposure; D015999:Multivariate Analysis; D011247:Pregnancy; D037841:Pregnant Women; D011446:Prospective Studies; D000068698:Tenofovir; D014744:Vietnam; D015215:Zidovudine; D001613:beta 2-Microglobulin",
"nlm_unique_id": "101285081",
"other_id": null,
"pages": "e0250828",
"pmc": null,
"pmid": "33914827",
"pubdate": "2021",
"publication_types": "D016428:Journal Article; D064888:Observational Study; D013485:Research Support, Non-U.S. Gov't",
"references": "21730243;22382151;24494779;14585642;21799928;23052356;26859826;29265106;20673002;30562172;10984563;25890673;21606537;26054580;9792381;30924492;19361280;30814028;19195333;22781228;28525596;30067600;29483547;10893912;18331562;22615543;10509500;2320079;12891063;21791651;2686555;26060285;19696652;15105094;9872879;19095956;26823647",
"title": "Influence of maternal use of tenofovir disoproxil fumarate or zidovudine in Vietnamese pregnant women with HIV on infant growth, renal function, and bone health.",
"title_normalized": "influence of maternal use of tenofovir disoproxil fumarate or zidovudine in vietnamese pregnant women with hiv on infant growth renal function and bone health"
} | [
{
"companynumb": "JP-GLAXOSMITHKLINE-VN2021GSK102375",
"fulfillexpeditecriteria": "1",
"occurcountry": "VN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ZIDOVUDINE"
},
"drugadditional": nul... |
{
"abstract": "To report the detection of retinitis in the second eye of a patient with viral acute retinal necrosis (ARN), before the appearance of clinical change, using swept-source optical coherence tomography.\nA 63 year-old male developed right-sided varicella-zoster virus (VZV) ARN, confirmed with aqueous sampling. High-dose intravenous aciclovir caused renal impairment and was suspended for two-days. One day later, left eye macular SS-OCT revealed focal retinal thickening and disruption of retinal architecture without clinically detectable retinitis. The patient was asymptomatic. Aqueous sampling was VZV PCR positive. He received bilateral foscarnet injections and renal adjusted dose of aciclovir. The left OCT signs improved with full restoration of retinal layers.\nWe report for the first time the use of OCT to detect pre-clinical second eye retinitis during ARN. Prompt diagnosis and combined systemic and intensive local antiviral therapy resulted in a favourable structural and functional outcome.",
"affiliations": "Manchester Royal Eye Hospital, Medical Academic Health Science Centre, Manchester University Hospitals NHS Foundation Trust, Manchester, UK.;Manchester Royal Eye Hospital, Medical Academic Health Science Centre, Manchester University Hospitals NHS Foundation Trust, Manchester, UK.;Manchester Royal Eye Hospital, Medical Academic Health Science Centre, Manchester University Hospitals NHS Foundation Trust, Manchester, UK.;Manchester Royal Eye Hospital, Medical Academic Health Science Centre, Manchester University Hospitals NHS Foundation Trust, Manchester, UK.",
"authors": "Pockar|S|S|;Jones|N P|NP|;Chhabra|R|R|;Steeples|L R|LR|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/09273948.2020.1783324",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0927-3948",
"issue": null,
"journal": "Ocular immunology and inflammation",
"keywords": "Acute retinal necrosis; optical coherence tomography; varicella zoster retinitis",
"medline_ta": "Ocul Immunol Inflamm",
"mesh_terms": null,
"nlm_unique_id": "9312169",
"other_id": null,
"pages": "1-3",
"pmc": null,
"pmid": "32815746",
"pubdate": "2020-08-20",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Detection of Pre-clinical Involvement of the Second Eye in Viral Acute Retinal Necrosis Using Optical Coherence Tomography.",
"title_normalized": "detection of pre clinical involvement of the second eye in viral acute retinal necrosis using optical coherence tomography"
} | [
{
"companynumb": "GB-GLAXOSMITHKLINE-GB2020GSK179056",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VALACYCLOVIR HYDROCHLORIDE"
},
"drug... |
{
"abstract": "A 62-year-old male with numerous subcutaneous nodules in the lower extremities was referred to The University of Tokyo Hospital. The patient suffered from systemic lupus erythematosus (SLE), diabetes mellitus, and persisting hepatic dysfunction, and had been treated for SLE with oral prednisolone 20 mg/day and oral cyclosporine 3 mg/kg/day. The culture of scales collected from the patient's skin surface on Sabouraud's dextrose agar medium showed features of Trichophyton rubrum. Topically applied bifonazole cream was effective for tinea corporis, but oral griseofulvin 500 mg/day was discontinued after 2-month administration because of deteriorated liver function. All the nodules were resected surgically. Histologically, resected granulomas showed dermal abscesses that were tightly encapsulated by fibrous capsules. Grocott staining revealed numerous fungal elements within abscesses. The patient's condition indicated the need to perform histopathological examination of granuloma trichophyticum in order to determine whether it is tightly encapsulated. Namely, the presence of cystic granuloma trichophyticum with abscesses encapsulated by fibrous capsules suggested that the patient should be treated by surgical resection of the lesions.",
"affiliations": "Department of Health and Nutrition, Wayo Women's University.",
"authors": "Kaneko|Takehiko|T|;Kaneko|Michiyo|M|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.3314/mmj.16-00030",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "58(1)",
"journal": "Medical mycology journal",
"keywords": null,
"medline_ta": "Med Mycol J",
"mesh_terms": "D003881:Dermatomycoses; D006099:Granuloma; D006801:Humans; D016867:Immunocompromised Host; D008297:Male; D008875:Middle Aged; D014005:Tinea; D016896:Treatment Outcome; D014249:Trichophyton",
"nlm_unique_id": "101562838",
"other_id": null,
"pages": "E29-E32",
"pmc": null,
"pmid": "28250361",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A Patient with Cystic Granuloma Trichophyticum who Required Surgical Resection.",
"title_normalized": "a patient with cystic granuloma trichophyticum who required surgical resection"
} | [
{
"companynumb": "JP-EDENBRIDGE PHARMACEUTICALS, LLC-JP-2017EDE000017",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE SODIUM PHOSPHATE"
... |
{
"abstract": "Giant fornix syndrome (GFS) was first described as a cause for a relapsing mucopurulent conjunctivitis. Predominantly elderly patients have enlarged superior fornices from superior aponeurosis dehiscence that permits the accumulation of protein coagulum that is colonised by bacteria. Established treatment includes the use of intensive topical antibiotic and corticosteroid. We describe a case of a 98-year-old woman with GFS who did not respond to several weeks of intensive (two hourly) treatment with topical prednisolone 1% drops and chloramphenicol. Subsequent additional regular sweeping of the fornices with cotton buds and topical medication did not improve her symptoms but which resolved with manual coagulum debridement and application of 10% povidone-iodine. This treatment offers an effective treatment option of GFS cases, which do not respond to intensive topical corticosteroids and chloramphenicol.",
"affiliations": "Cornea and External Diseases Department, Moorfields Eye Hospital NHS Foundation Trust, London, UK.;Cornea and External Diseases Department, Moorfields Eye Hospital NHS Foundation Trust, London, UK.;Cornea and External Diseases Department, Moorfields Eye Hospital NHS Foundation Trust, London, UK.",
"authors": "Karim|Rushmia|R|;Mandal|Niraj|N|;Tuft|Steve|S|",
"chemical_list": "D000891:Anti-Infective Agents, Local; D009883:Ophthalmic Solutions; D011206:Povidone-Iodine",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-225555",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "eye; ophthalmology",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000369:Aged, 80 and over; D000891:Anti-Infective Agents, Local; D003234:Conjunctivitis, Bacterial; D003646:Debridement; D003937:Diagnosis, Differential; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D055624:Methicillin-Resistant Staphylococcus aureus; D009883:Ophthalmic Solutions; D011206:Povidone-Iodine; D013203:Staphylococcal Infections",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30317197",
"pubdate": "2018-10-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "21099413;27387572;26730856;6721765;15288985;23187819;17491857;21862948",
"title": "Management of giant fornix syndrome with irrigation with povidone-iodine.",
"title_normalized": "management of giant fornix syndrome with irrigation with povidone iodine"
} | [
{
"companynumb": "GB-MYLANLABS-2018M1087945",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "Atypical femoral fractures (AFFs) are recently observed as a complication of long-term bone-modifying agent (BMA; bisphosphonate or denosumab) therapy for bone metastases. We describe the cases of two women diagnosed with breast cancer who developed incomplete AFF associated with BMAs prescribed for bone metastases. Radiographs of their femurs revealed thickening of the lateral subtrochanteric cortex, and tomosynthesis revealed a visible fracture line in the thickened cortex. They were initially treated with conservative management; however, the incomplete fracture resulted in a complete fracture. These cases highlight two major implications. First, symptomatic incomplete AFF associated with BMAs prescribed for bone metastases should be treated with surgical prophylaxis, given the fact that fracture healing is expected to require a longer duration and an incomplete fracture might potentially progress to a complete fracture during long-term conservative management. Second, tomosynthesis is useful in identifying radiolucent fracture lines that are reliable predictors of fracture propagation.",
"affiliations": "Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.;Musculoskeletal Oncology Service, Osaka International Cancer Institute, Osaka, Japan.",
"authors": "Tateiwa|Daisuke|D|;Outani|Hidetatsu|H|;Iwasa|Saya|S|;Imura|Yoshinori|Y|;Tanaka|Takaaki|T|;Oshima|Kazuya|K|;Naka|Norifumi|N|;Araki|Nobuhito|N|",
"chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D000069448:Denosumab",
"country": "England",
"delete": false,
"doi": "10.1177/2309499017727916",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1022-5536",
"issue": "25(3)",
"journal": "Journal of orthopaedic surgery (Hong Kong)",
"keywords": "atypical femoral fracture; bisphosphonate; bone metastasis; bone-modifying agent; denosumab; tomosynthesis",
"medline_ta": "J Orthop Surg (Hong Kong)",
"mesh_terms": "D000369:Aged, 80 and over; D050071:Bone Density Conservation Agents; D001859:Bone Neoplasms; D001943:Breast Neoplasms; D000069448:Denosumab; D004164:Diphosphonates; D005260:Female; D005264:Femoral Fractures; D006801:Humans; D008875:Middle Aged; D011859:Radiography",
"nlm_unique_id": "9440382",
"other_id": null,
"pages": "2309499017727916",
"pmc": null,
"pmid": "28844196",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Atypical femoral fracture associated with bone-modifying agent for bone metastasis of breast cancer: A report of two cases.",
"title_normalized": "atypical femoral fracture associated with bone modifying agent for bone metastasis of breast cancer a report of two cases"
} | [
{
"companynumb": "JP-AMGEN-JPNSP2017135695",
"fulfillexpeditecriteria": "2",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DENOSUMAB"
},
"drugadditional": null,
... |
{
"abstract": "Denosumab has become the preferred agent over zolendronic acid to help prevent skeletal-related events in patients with metastatic bone disease and multiple myeloma because it is approved for use in those with kidney dysfunction. However, denosumab has been linked to cases of hypocalcemia, particularly in those with advanced kidney disease.\nWe present the case of a patient with metastatic prostate cancer and chronic kidney disease due to obstructive nephropathy who developed severe hypocalcemia and hypomagnesemia after denosumab injection, which required intensive care unit admission, aggressive calcium supplementation, and hemodialysis assistance. We reviewed the evidence behind the safety profile of denosumab in chronic kidney disease, and we also looked at additional factors that may precipitate severe hypocalcemia with denosumab in advanced kidney disease.\nWe believe that denosumab should be avoided in advanced chronic kidney disease due to the potential life-threatening, severe hypocalcemia that has been observed.",
"affiliations": "Department of Internal Medicine, George Washington University School of Medicine, USA.;Division of Kidney Diseases and Hypertension, George Washington University School of Medicine, USA.;Division of Kidney Diseases and Hypertension, George Washington University School of Medicine, USA.;Division of Hematology and Oncology, George Washington University School of Medicine, USA.",
"authors": "Marlow|Christina F|CF|0000-0001-8779-1076;Sharma|Shailendra|S|;Babar|Faizan|F|;Lin|Jianqing|J|0000-0001-8972-6331",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2018/2059364",
"fulltext": "\n==== Front\nCase Rep Oncol MedCase Rep Oncol MedCRIONMCase Reports in Oncological Medicine2090-67062090-6714Hindawi 10.1155/2018/2059364Case ReportSevere Hypocalcemia and Hypomagnesemia with Denosumab in Advanced Chronic Kidney Disease: Case Report and Literature Review http://orcid.org/0000-0001-8779-1076Marlow Christina F. christinafmarlow@gmail.com\n1\nSharma Shailendra \n2\nBabar Faizan \n2\nhttp://orcid.org/0000-0001-8972-6331Lin Jianqing \n3\n\n1Department of Internal Medicine, George Washington University School of Medicine, USA\n2Division of Kidney Diseases and Hypertension, George Washington University School of Medicine, USA\n3Division of Hematology and Oncology, George Washington University School of Medicine, USAAcademic Editor: Constantine Gennatas\n\n2018 14 10 2018 2018 205936423 5 2018 17 9 2018 Copyright © 2018 Christina F. Marlow et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background\n Denosumab has become the preferred agent over zolendronic acid to help prevent skeletal-related events in patients with metastatic bone disease and multiple myeloma because it is approved for use in those with kidney dysfunction. However, denosumab has been linked to cases of hypocalcemia, particularly in those with advanced kidney disease. \n\nCase Presentation\n We present the case of a patient with metastatic prostate cancer and chronic kidney disease due to obstructive nephropathy who developed severe hypocalcemia and hypomagnesemia after denosumab injection, which required intensive care unit admission, aggressive calcium supplementation, and hemodialysis assistance. We reviewed the evidence behind the safety profile of denosumab in chronic kidney disease, and we also looked at additional factors that may precipitate severe hypocalcemia with denosumab in advanced kidney disease. \n\nConclusion\n We believe that denosumab should be avoided in advanced chronic kidney disease due to the potential life-threatening, severe hypocalcemia that has been observed.\n==== Body\n1. Introduction\nSkeletal-related events (SREs) are a significant source of morbidity in patients with metastatic bone disease due to solid tumor malignancies and multiple myeloma. SREs are typically defined as pathologic fracture, spinal cord compression, need for bone radiation, or surgical intervention to bone [1]. SREs are associated with a significant decrease in quality of life and performance status. Zoledronic acid and denosumab are typically used to reduce SREs. Zoledronic acid is a bisphosphonate and denosumab is a monoclonal antibody that inhibits osteoclast-mediated bone resorption by binding to receptor activator of nuclear factor-κB ligand (RANKL). In 2011, a randomized controlled trial conducted by Fizazi et al. showed that denosumab significantly delayed time to first SRE when compared to zoledronic acid (20.7 months versus 17.1 months, p = 0.0002) [2]. In terms of adverse side effects, bisphosphonates have been associated with renal toxicity and are contraindicated in patients with CrCl < 30 ml/min. Denosumab has emerged as an alternative agent in prevention of SREs in metastatic bone disease. However, denosumab is associated with a greater incidence of hypocalcemia [2]. There have been a number of cases reporting mild hypocalcemia associated with denosumab use [3, 4]. We present the case of a patient with metastatic prostate cancer who developed severe hypocalcemia in the setting of advanced chronic kidney disease (CKD) after receiving denosumab. We also searched the literature to evaluate the safety of denosumab use in chronic kidney disease.\n\n2. Case\nA 70-year-old African American gentleman with a history of CKD, pseudogout, and metastatic castration-resistant prostate cancer (to bone, nodes, and lung) was admitted to the hospital due to left knee swelling. He was incidentally found to be severely hypocalcemic to 2.7 mg/dl with EKG showing a prolonged QTC interval to 525 ms. Physical examination was negative for Chvostek and Trousseau's sign. Home medications included acetaminophen, amlodipine, bicalutamide, docusate-senna, lidocaine patches, ondansetron, and polyethylene glycol. Twenty-eight days prior, he had received his first dose of denosumab (together with leuprolide) when his calcium level was 8.8 mg/dl. He was prescribed vitamin D and calcium supplementation, but never took it. He finished a five-day course of prednisone 10 mg daily thirteen days prior for a pseudogout flare of the right foot. Other labs on admission were significant for phosphorus 5.5 mg/dl, total vitamin D3 31 IU, iPTH 93, and Mg 1.1 mg/dl. He was admitted to the intensive care unit for continuous, high-dose IV calcium gluconate and frequent electrolyte monitoring. During his ICU course, he received a total of 21 grams of IV calcium gluconate. He was also given 1 μg of oral calcitriol BID, 1000 mg of oral calcium carbonate TID, and aggressive magnesium supplementation. Unfortunately, the patient's creatinine worsened to 7.5 mg and he developed severe metabolic acidosis and hyponatremia in the setting of Clostridium difficile colitis. The decision was made to initiate hemodialysis given the poor recovery in kidney function from obstructive uropathy. For one week, he received intermittent hemodialysis with high calcium baths. Calcium, magnesium, and phosphate levels were monitored daily and supplemented as needed. Calcium levels improved to 8.5 mg/dl and magnesium levels improved to 2.0 mg/dl. He was discharged on 0.5 μg oral calcitriol daily, calcium carbonate 1000 mg BID, and continued intermittent hemodialysis.\n\nThe patient was originally diagnosed with de novo metastatic prostate cancer two years prior. He had not been on ADT or chemotherapy for approximately one year until he presented to our hospital two months prior with evidence of prostate cancer progression. His PSA was elevated to 1472 and he was found to have acute kidney injury with a Cr 12.8 mg/dl and a BUN of 131 mg/dl due to obstructive uropathy. CT of the abdomen/pelvis showed marked bilateral hydronephrosis due to a 6.3 cm pelvic mass and a 3.8 cm mass in the left ureteropelvic junction. Extensive pelvic and retroperitoneal lymphadenopathy was evident in addition to innumerable metastatic lytic skeletal lesions. Bilateral percutaneous nephrostomy tubes were placed by interventional radiology and the patient's creatinine improved to 7.3 mg/dl with a BUN of 120 mg/dl. Combined androgen deprivation was resumed and he was discharged with plans for close monitoring of renal functions with the ultimate plan to place ureteral stents depending upon renal recovery.\n\n3. Discussion\nDenosumab is a RANKL monoclonal antibody that blocks the RANKL receptor on the osteoclast, which results in reduced osteoclast activation and resultant bone resorption. Denosumab is more potent compared to bisphosphonates in preventing skeletal-related events in metastatic prostate cancer [2]. However, compared to bisphosphonates, the incidence of hypocalcemia is higher in patients treated with denosumab [2]. Although denosumab does not require renal dosing, the manufacturer recommends extreme caution with close monitoring of calcium levels in chronic kidney disease [5]. The risk of hypocalcemia with denosumab increases in patients with advanced stage kidney disease due to inherent defects in bone mineral metabolism and dependence on PTH-mediated bone resorption to maintain calcium levels.\n\nKnowledge of the pharmacokinetics of denosumab is critical in understanding the risk of hypocalcemia. Denosumab exhibits a nonlinear dose-dependent response [6, 7]. The volume of distribution is proportional to the body weight and central volume of distribution is 2.6 l/66 kg body weight [6, 7]. Maximum drug level is reached in seven to twenty-one days. The drug elimination is not dependent on renal or hepatic clearance [6, 7]. Hence, no dose adjustment is recommended for patients with CKD. Like other monoclonal antibodies, clearance is mediated by the reticuloendothelial system and receptor-mediated endocytosis [6, 7]. Given the long half-life of the medication, side effects may persist for a prolonged period.\n\nDenosumab is preferred over zoledronic acid in patients with both metastatic bone disease and chronic kidney disease because it is not cleared renally and is technically not nephrotoxic. However, there is a paucity of data regarding the safety of denosumab use in patients with advanced renal disease, that is, GFR < 30 ml/min or on hemodialysis, for the prevention of skeletal-related events in metastatic bone disease. An abstract of an open-label prospective study describes the effectiveness of denosumab at different stages of CKD in preventing SREs at the standard dose [8, 9]. However, severe hypocalcemia (i.e., <7 meq/dl) or symptomatic hypocalcemia was seen in the late stages of renal disease [10–12]. Similarly, in one observational study, 45 percent of the patients with baseline eGFR < 30 ml/min (n = 22) developed hypocalcemia during treatment with denosumab [13]. A dose-reduction strategy in CKD has been evaluated in only one case series study by Cicci et al. of refractory hypercalcemia due to MM and AKI [14]. They proposed the novel dosing strategy of 0.3 mg/kg of denosumab based on 4 case reports in patients with multiple myeloma over a fixed, reduced dose of 60 mg (from the standard 120 mg) in patients with renal dysfunction. Denosumab was used to treat refractory hypercalcemia associated with MM. Despite dose reduction, three out of four patients developed mild hypocalcemia with the effect lasting for 15–40 days [14]. Dose reduction might be an effective strategy to reduce the risk of severe hypocalcemia in CKD, but it requires further validation in large scale studies.\n\nThe higher risk of severe hypocalcemia in advanced kidney disease is due to the secondary hyperparathyroidism that is known to occur in end stage chronic kidney disease (Figure 1). Denosumab then further compounds the risk for hypocalcemia by blocking calcium release from the bone. In two trials evaluating the safety and efficacy of denosumab in patients with CKD stages 4 and 5, all patients received supplementation with calcium and vitamin D [5]. Despite these measures, patients developed hypocalcemia of variable degrees [13]. Hence, we believe that supplementing a vitamin D analogue prior to denosumab use in advanced CKD is unlikely to be an effective way of reducing hypocalcemia risk.\n\nWe also identified additional factors that may predispose advanced kidney disease patients to severe hypocalcemia with denosumab use including high bone turnover markers, hypomagnesemia, and concomitant use of steroids or bisphosphonates. Bone turnover markers can be helpful in predicting patients at risk for hypocalcemia because high bone turnover is seen with both bone mineral disease and metastatic bone disease [15]. Several markers have been shown to correlate with bone activity in patients with CKD who were treated with denosumab for osteoporosis including bone specific alkaline phosphatase, CTX, total P1NP, and TRAP [15–17]. Further studies should explore the utility of checking these markers prior to administration of denosumab to those at greater risk of severe hypocalcemia.\n\nHypomagnesemia is another risk factor that can predispose to severe hypocalcemia with denosumab use in CKD which was evident in the case of this patient. Low magnesium is observed in chronic kidney disease patients with diabetes [18]. Magnesium acts as a cofactor to calcium-sensing receptors on the parathyroid gland to regulate PTH secretion [19]. Low Mg levels increase PTH release, which increases bone turnover. Hypomagnesemia is also associated with low calcitriol levels which can also increase the risk of hypocalcemia with denosumab use in CKD [20]. Additional risk factors for severe hypocalcemia with denosumab use include concomitant use of hypocalcemia agents such as steroids, bisphosphonates, and calcimimetics [13]. This was particularly evident in this case as the patient received five days of steroids for pseudogout prior to the first dose of denosumab.\n\n4. Conclusion\nDenosumab is an effective agent at reducing SREs in patients with metastatic bone disease and is technically approved for use in CKD patients without dose reduction. Inherent bone mineral disease in advanced kidney disease increases the risk of hypocalcemia with denosumab use. Prospective studies are needed to explore the safety profile of denosumab at a reduced dose in CKD patients. Further research is needed to determine the clinical utility of bone turnover markers; however, they may be helpful tools to physicians to help determine a patient's risk of hypocalcemia prior to starting denosumab. Until further evidence, we believe that denosumab should be avoided in advanced chronic kidney disease due to the potential life-threatening, severe hypocalcemia that has been observed.\n\nConflicts of Interest\nThe authors declare that they have no competing interests.\n\nFigure 1 Calcium, phosphorus, and vitamin D metabolism in chronic kidney disease.\n==== Refs\n1 Smith M. R. Coleman R. E. Klotz L. Denosumab for the prevention of skeletal complications in metastatic castration-resistant prostate cancer: comparison of skeletal-related events and symptomatic skeletal events Annals of Oncology 2015 26 2 368 374 10.1093/annonc/mdu519 2-s2.0-84925339649 25425475 \n2 Fizazi K. Carducci M. Smith M. Denosumab versus zoledronic acid for treatment of bone metastases in men with castration-resistant prostate cancer: a randomised, double-blind study The Lancet 2011 377 9768 813 822 10.1016/S0140-6736(10)62344-6 2-s2.0-79952360832 21353695 \n3 Gartrell B. A. Coleman R. E. Fizazi K. Toxicities following treatment with bisphosphonates and receptor activator of nuclear factor-κ B ligand inhibitors in patients with advanced prostate cancer European Urology 2014 65 2 278 286 10.1016/j.eururo.2013.05.015 2-s2.0-84891837374 23706567 \n4 Fokkema M. I. de Heide L. J. van Schelven W. Hamdy N. A. Severe hypocalcaemia associated with extensive osteoblastic metastases in a patient with prostate cancer The Netherlands Journal of Medicine 2005 63 1 34 37 15719851 \n5 Xegeva (denosumab) and renal function [Prescribing information] 2010 Thousand Oaks, CA, USA Amgen Inc \n6 Tat S. K. Padrines M. Theoleyre S. OPG/membranous–RANKL complex is internalized via the clathrin pathway before a lysosomal and a proteasomal degradation Bone 2006 39 4 706 715 10.1016/j.bone.2006.03.016 2-s2.0-33748199511 16750945 \n7 Keizer R. J. Huitema A. D. R. Schellens J. H. M. Beijnen J. H. Clinical pharmacokinetics of therapeutic monoclonal antibodies Clinical Pharmacokinetics 2010 49 8 493 507 10.2165/11531280-000000000-00000 2-s2.0-77954472838 20608753 \n8 Block G. Egbuna O. Zeig S. The evaluation of denosumab safety in patients with chronic kidney disease: an open-label study Journal of Clinical Oncology 2014 32, article e20649 Supplement 15 \n9 Block G. Egbuna O. Zeig S. Safety of denosumab (DMAB) in patients (pts) with stage 4 or stage 5D chronic kidney disease (CKD) Annals of Oncology 2014 25, article iv528 Supplement 4 10.1093/annonc/mdu356.33 \n10 Huynh A. L. H. Baker S. T. Stewardson A. J. Johnson D. F. Denosumab-associated hypocalcaemia: incidence, severity and patient characteristics in a tertiary hospital setting Pharmacoepidemiology and Drug Safety 2016 25 11 1274 1278 10.1002/pds.4045 2-s2.0-84973370281 27255807 \n11 Body J. J. Bone H. G. de Boer R. H. Hypocalcaemia in patients with metastatic bone disease treated with denosumab European Journal of Cancer 2015 51 13 1812 1821 10.1016/j.ejca.2015.05.016 2-s2.0-84938740077 26093811 \n12 Okada N. Kawazoe K. Teraoka K. Identification of the risk factors associated with hypocalcemia induced by denosumab Biological and Pharmaceutical Bulletin 2013 36 10 1622 1626 10.1248/bpb.b13-00496 2-s2.0-84887114892 23934346 \n13 Watkins K. R. Rogers J. E. Atkinson B. Tolerability of denosumab in metastatic solid tumor patients with renal insufficiency Support Care Cancer 2015 23 6 1657 1662 10.1007/s00520-014-2521-8 2-s2.0-84939978254 25421444 \n14 Cicci J. D. Buie L. Bates J. van Deventer H. Denosumab for the management of hypercalcemia of malignancy in patients with multiple myeloma and renal dysfunction Clinical Lymphoma, Myeloma & Leukemia 2014 14 6 e207 e211 10.1016/j.clml.2014.07.005 2-s2.0-84922594159 \n15 Autio K. A. Farooki A. Glezerman I. G. Severe hypocalcemia associated with denosumab in metastatic castration-resistant prostate cancer: risk factors and precautions for treating physicians Clinical Genitourinary Cancer 2015 13 4 e305 e309 10.1016/j.clgc.2014.11.008 2-s2.0-84936986575 25559408 \n16 Lein M. Miller K. Wirth M. Bone turnover markers as predictive tools for skeletal complications in men with metastatic prostate cancer treated with zoledronic acid The Prostate 2009 69 6 624 632 10.1002/pros.20917 2-s2.0-65549161868 19143027 \n17 Ishikawa K. Nagai T. Sakamoto K. High bone turnover elevates the risk of denosumab-induced hypocalcemia in women with postmenopausal osteoporosis Therapeutics and Clinical Risk Management 2016 12 1831 1840 10.2147/TCRM.S123172 2-s2.0-85007524737 27980413 \n18 Corsonello A. Ientile R. Buemi M. Serum ionized magnesium levels in type 2 diabetic patients with microalbuminuria or clinical proteinuria American Journal of Nephrology 2000 20 3 187 192 10.1159/000013582 2-s2.0-0033947880 10878399 \n19 Agus Z. S. Hypomagnesemia Journal of the American Society of Nephrology 1999 10 7 1616 1622 10405219 \n20 Rude R. K. Adams J. S. Ryzen E. Low serum concentrations of 1,25-dihydroxyvitamin D in human magnesium deficiency The Journal of Clinical Endocrinology & Metabolism 1985 61 5 933 940 10.1210/jcem-61-5-933 2-s2.0-0022384704 3840173\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "2018()",
"journal": "Case reports in oncological medicine",
"keywords": null,
"medline_ta": "Case Rep Oncol Med",
"mesh_terms": null,
"nlm_unique_id": "101581035",
"other_id": null,
"pages": "2059364",
"pmc": null,
"pmid": "30405927",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "25421444;23706567;19143027;27255807;25425475;10405219;10878399;3840173;26093811;16750945;25559408;25128013;15719851;21353695;23934346;20608753;27980413",
"title": "Severe Hypocalcemia and Hypomagnesemia with Denosumab in Advanced Chronic Kidney Disease: Case Report and Literature Review.",
"title_normalized": "severe hypocalcemia and hypomagnesemia with denosumab in advanced chronic kidney disease case report and literature review"
} | [
{
"companynumb": "US-HORIZON-PRE-0163-2019",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "Opioid addiction is a world-wide tragedy, with severe consequences for both the victims and the society that must care for them. The pathways to addiction are multiple but postoperative opioid prescriptions for pain management are a major contributor to this crisis. This case report describes the differences in pain management during 2 different arthroplasties of the knees in the same person. After the first arthroplasty of the right knee 10 years ago, postoperative opioids were used, but after the second arthroplasty of the left knee in 2007, anti-inflammatory drugs took the place of opioids. The first postoperative treatment with opioids was marked by addiction and a nasty withdrawal. The recovery of knee function, driving, and return to work were prolonged. After the second arthroplasty in 2007, a combination of meloxicam (COX-2 inhibitor), high-dose acetaminophen (COX-1 inhibitor at higher doses), and diclofenac topical gel (COX-1 inhibitor with local effects) produced excellent pain control and significant reduction in swelling of the operated knee. The clinical course was smooth and recovery was rapid. The patient was walking normally and driving a car at 2 weeks and took an airplane trip at 4 weeks. After arthroplasty, postoperative opioids may not be necessary for most people.",
"affiliations": "Division of Allergy, Asthma and Immunology, Scripps Clinic Carmel Valley, San Diego, CA, USA.;Division of Home Health, Scripps Clinic, San Diego, CA, USA.",
"authors": "Stevenson|Donald D|DD|;Gasko|Jennifer L|JL|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/1179547618794650",
"fulltext": "\n==== Front\nClin Med Insights Case RepClin Med Insights Case RepICRspicrClinical Medicine Insights. Case Reports1179-5476SAGE Publications Sage UK: London, England 10.1177/117954761879465010.1177_1179547618794650Case ReportA Tale of Two Knee Implants in the Same Person: Narcotics for the\nFirst and Anti-inflammatory Drugs for the Second Stevenson Donald D 1Gasko Jennifer L 21 Division of Allergy, Asthma and\nImmunology, Scripps Clinic Carmel Valley, San Diego, CA, USA2 Division of Home Health, Scripps Clinic,\nSan Diego, CA, USADonald D Stevenson, Division of Allergy,\nAsthma and Immunology, Scripps Clinic Carmel Valley,3811 Valley Center Dr, San\nDiego 92130, CA, USA. Email: dstevensonmd@gmail.com27 8 2018 2018 11 11795476187946502 1 2018 6 7 2018 © The Author(s) 20182018SAGE Publications Ltd unless otherwise noted.\nManuscript content on this site is licensed under Creative Commons\nLicensesThis article is distributed under the terms of the Creative Commons\nAttribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which\npermits non-commercial use, reproduction and distribution of the work\nwithout further permission provided the original work is attributed as\nspecified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Opioid addiction is a world-wide tragedy, with severe consequences for both the\nvictims and the society that must care for them. The pathways to addiction are\nmultiple but postoperative opioid prescriptions for pain management are a major\ncontributor to this crisis. This case report describes the differences in pain\nmanagement during 2 different arthroplasties of the knees in the same person.\nAfter the first arthroplasty of the right knee 10 years ago, postoperative\nopioids were used, but after the second arthroplasty of the left knee in 2007,\nanti-inflammatory drugs took the place of opioids. The first postoperative\ntreatment with opioids was marked by addiction and a nasty withdrawal. The\nrecovery of knee function, driving, and return to work were prolonged. After the\nsecond arthroplasty in 2007, a combination of meloxicam (COX-2 inhibitor),\nhigh-dose acetaminophen (COX-1 inhibitor at higher doses), and diclofenac\ntopical gel (COX-1 inhibitor with local effects) produced excellent pain control\nand significant reduction in swelling of the operated knee. The clinical course\nwas smooth and recovery was rapid. The patient was walking normally and driving\na car at 2 weeks and took an airplane trip at 4 weeks. After arthroplasty,\npostoperative opioids may not be necessary for most people.\n\nnon-steroidal anti-inflammatory drugs (NSAIDs)Cyclooxygenase -1 enzyme (COX-1)Cyclooxygenase -2 enzyme (COX-2)COX-1 or 2 inhibitorsOpioidsGoniometercover-dateJanuary-December 2018\n==== Body\nPostoperative arthroplasty of the knee is painful and narcotics are routinely prescribed\nto control pain.1 Multiple side effects from opioids include constipation, drowsiness, nausea,\ndizziness, itching, weakness, dry mouth, sweating, appetite suppression, and addiction,\nto name the most common. It is unsafe to drive a vehicle while taking opioids. The\nworldwide opioid epidemic includes millions of persons who began their addictions\nfollowing prescriptions of opioids after surgical procedures.2\n\nCOX-1 and COX-2 inhibitors interrupt inflammation via the prostanoid pathways, leading to\na reduction in both swelling and pain.3,4 The following case report was the\nexperience of author D.D.S. as patient and author J.L.G. as physical therapist. In 2007,\n10 years ago, narcotics were prescribed after patient’s arthroplasty and in 2017\nanti-inflammatory drugs were used after a second knee replacement. The details of the 2\npostoperative courses are reported and shown in Table 1.\n\nTable 1. Goniometric measurements of range of motions of the operated knee and levels of\npain.\n\n\tDay 2\tDay 4\tDay 6\tDay 8\tDay 11\tDay 13\tDay 16\tDay 19\tDay 21\tDay 120\t\n2007\t\n Flexion\t78\t76\t78\t70\t85\t87\t93\t98\t105\t120\t\n Extension\t−25\t−20\t−17\t−14\t−13\t−11\t−10\t−8\t−6\t0\t\n Pain 0-10\t8−9\t8−9\t5−8\t4−8\t3−8\t0−8\t0−8\t0−8\t0−8\t0\t\n2017\t\n Flexion\t84\t90\t95\t100\t100\t100\t105\t110\t112\t120\t\n Extension\t−30\t−22\t−22\t−16\t−16\t−16\t−14\t−13\t−11\t0\t\n Pain 0-10\t1−3\t1−2\t1−2\t0−1\t0−2\t1−2\t0−1\t0−1\t0−1\t0\t\nNormal: knee flexion 135° and extension 0°.\n\nPain levels were recorded by J.L.G. during the 3 weeks of PT home visits. Day\n120 was recorded during visits in the orthopedic department. The first\nnumber was recorded at rest and the second number during walking and/or\nstretching exercises (pain levels: 0 = none and 10 = most severe).\n\nCase Report\nIn 2006, at age 71 years, a spontaneous microfracture of the tibial plateau of the\nright knee occurred in D.D.S. (patient). Four arthroscopies were unable to rescue\nthe cartilage, and 8 months later, in July 2007, successful arthroplasty was\nperformed without preoperative celecoxib 200 mg (by mouth) or blockade of the\nanterior branch of the femoral nerve. The patient was treated at home with physical\ntherapy (J.L.G.), ice packs, and oxycodone 5 mg/acetaminophen 325 mg as needed for\npain. Because of constant pain, accelerated during daily physical therapy and\nwalking, oxycodone/acetaminophen was taken 2 to 3 times per day. Immediate onset\nside effects included constipation and drowsiness. Flexion was limited by swelling\n(see Table 1, 2007). The\npatient underwent a long and difficult recovery, culminating in opioid addiction and\neventually an unpleasant narcotic withdrawal at postoperative week 5, driving a car\nstarted at 6 weeks, and return to work at 10 weeks.\n\nOsteoarthritis of the left knee developed slowly and for many years was treated with\nincreasing doses of a partial COX-2 inhibitor meloxicam 7.5 mg, starting with\npreexercise, then daily and eventually twice per day. Because of persistent pain and\nswelling, increased while walking, triamcinolone was injected into the knee but did\nnot provide any therapeutic relief. In July 2017, arthroplasty of the left knee was\nperformed. Preoperative celecoxib 200 mg was given by mouth. Anesthesia successfully\nblocked the anterior cutaneous branch of the femoral nerve, which prevented knee\npain for 30 hours. After transfer from recovery room to his inpatient room, the\npatient immediately walked. The next morning, he was discharged to home.\n\nHome program consisted of twice-daily physical therapy, ice packs, and every 6 hours\nmeloxicam 7.5 mg, extra strength acetaminophen 500 mg capsules, and diclofenac\nsodium gel applied to the cutaneous surface around the operated knee. For many\nyears, the patient has been unable to take oral COX-1 inhibitors (aspirin, naproxen,\nand ibuprofen, etc) because of gastritis with epigastric pain.4 Topical diclofenac gel was used in place of oral COX-1 inhibitors.5 Meloxicam at a dose of 7.5 mg, unlike COX-1 inhibitors, is a partial COX-2\ninhibitor which only partially blocks COX-1 and thus maintains synthesis of\nprostacyclin (PGI2). This difference allows PGI2 to continue\nto stimulate mucosal cell replication and thus eliminated epigastric pain. Knee pain\nwas absent at rest after day 7 and never exceeded a scale of 1 or 2 while walking or\nduring physical therapy (see Table 1, 2017). Therefore, oxycodone was never needed or taken. With\nthis protocol, swelling of the knee was minimal, which allowed early flexion and\nextension of the knee. Most pain occurred in surrounding muscles and the iliotibial\nband. At 2 weeks, the patient’s walking gait was judged to be normal by J.L.G. The\npatient also began driving his car at 2 weeks, as contrasted with 6 weeks after\narthroplasty in 2007. At 3 weeks, the patient walked longer distances, continued all\nstretching and aerobic exercises, shopped for groceries and other products, and was\nessentially back to normal. The 3 anti-inflammatory drug combinations did not induce\nany side effects. After the first week, sleep was restorative and free of nocturnal\nknee pain.\n\nAt 4 weeks follow-up, knee x-rays and physician assessment were normal. After 4 days,\nthe patient traveled by airplane (coach) from San Diego to Seattle and there was\nmore stiffness and transient joint swelling during and after the trip. At 4 weeks\nand 5 days, after walking 2 miles, left quadriceps muscle spasm occurred (severe\npain with straight leg rising) and there was an increase in swelling in the knee\njoint. Rest, ice packs, and continued anti-inflammatory medications resulted in\nreturn to baseline in 72 hours. At 5 weeks and 4 days, airplane travel was again\nassociated with pain, swelling, and stiffness at rest during the 4-hour travel time.\nAfter returning home, knee pain was again minimal. Part-time physician employment\nwas resumed at 6 weeks.\n\nAt 7 weeks, diclofenac gel was discontinued and doses of meloxicam and acetaminophen\nwere changed to every 8 hours with no increase in pain at rest or exercises. Walking\nwas increased to 1.8 miles every other day. Daily knee stretching exercises were\ncontinued. All normal activities were continued, except tennis. At 8 weeks, doses of\nmeloxicam and acetaminophen were changed to twice daily. There was no increase in\nknee pain. At 9 weeks, acetaminophen and meloxicam were reduced to once each\nmorning. Exercise and walking were continued once per day. At 10 weeks, all\nanti-inflammatory medications were discontinued. There was no pain except during\nmaximum flexion of the operated knee. At 14 weeks, tennis was restarted.\n\nDiscussion\nThe idea of preventing pain by preemptive use of anti-inflammatory drugs never\nallowed much pain to be generated in the first place. Pain management therefore\nflowed from a reduction in inflammation. The maximum recommended 24-hour dose of\nmeloxicam is 15 mg twice daily. Meloxicam 7.5 mg ×4 is 30 mg/d but spread out more\nevenly over 24 hours. The other COX-2 inhibitor celecoxib, taken either 100 or\n200 mg every 12 hours, could be substituted for meloxicam but was not used in this\ncase. Acetaminophen is a weak COX-1 inhibitor and therefore higher doses are needed.\nIf consuming alcohol, out of concern for inducing hepatic necrosis, a dose should\nnot exceed 2000 to 3000 mg/24 hours, although up to 4000 mg/24 hours is generally\nsafe in individuals not consuming alcoholic beverages. In 2007, a small dose of\nacetaminophen 325 mg 3 times per day was ineffective as an anti-inflammatory drug.\nThe COX-1 inhibitor diclofenac, delivered as a local gel around the operated knee 4\ntimes per day, meets Food and Drug Administration (FDA)-approved dosing schedules.5 Diclofenac gel effectively blocked most knee pain, when meloxicam was\ndiscontinued a week prior to arthroplasty in 2017. For patients without COX-1\ninhibitor gastritis, an oral COX-1 inhibitor would be an alternative choice as the\nthird drug in this protocol. OTC Aleve (naproxen) 220 mg 2 to 4 times per day might\nbe satisfactory. About 15% of the population cannot ingest COX-1 inhibitors because\nof gastric pain.4\n\nThis case report provided a unique opportunity to study the differences in\npostoperative pain management, namely, opioid vs anti-inflammatory medications.\nOpioids were the standard postoperative choice 10 years ago and the painful,\nopioid-addicted, and prolonged postoperative course in 2007 was common. The 2017\npostoperative anti-inflammatory drug treatment allowed early joint movement and a\nlarge reduction in pain. Opioids were never needed. Differences in pain thresholds\nfrom one person to the other cannot explain the differences in the 2 postoperative\ncourses because they occurred in the same patient.\n\nFunding:The author(s) received no financial support for the research, authorship, and/or\npublication of this article.\n\nDeclaration of conflicting interests:The author(s) declared no potential conflicts of interest with respect to the\nresearch, authorship, and/or publication of this article.\n\nAuthor Contributions: DS wrote first draft and edits; JG provided data for table and edits.\n==== Refs\nReferences\n1 \nMorris BJ Mir HR. \nThe opioid epidemic: impact on orthopaedic\nsurgery . J Am Acad Orthopedic Surg .\n2015 ;23 :267 –271 .\n2 \nKelley MA. \nCurrent postoperative pain management protocols contribute to the\nopioid epidemic in the United States . Am J\nOrthop .\n2015 ;44 :S5 –S8 .26447431 \n3 \nConaghan PG. \nA turbulent decade for NSAIDs: update on current concepts of\nclassification, epidemiology, comparative efficacy, and\ntoxicity . Rheumatol Int .\n2012 ;32 :1491 –1502 .22193214 \n4 \nKowalski ML Stevenson DD. \nClassification of reactions to nonsteroidal anti-inflammatory\ndrugs . Immunol Allergy Clin North Am .\n2013 ;33 :135 –145 .23639704 \n5 \nAltman R Bosch B Brune K. \nAdvances in NSAID development: evolution of diclofenac products\nusing pharmaceutical technology . Drugs .\n2015 ;75 :859 –877 .25963327\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1179-5476",
"issue": "11()",
"journal": "Clinical medicine insights. Case reports",
"keywords": "COX-1 or 2 inhibitors; Cyclooxygenase -1 enzyme (COX-1); Cyclooxygenase -2 enzyme (COX-2); Goniometer; Opioids; non-steroidal anti-inflammatory drugs (NSAIDs)",
"medline_ta": "Clin Med Insights Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101531893",
"other_id": null,
"pages": "1179547618794650",
"pmc": null,
"pmid": "30158828",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "25963327;26447431;23639704;22193214;25911660",
"title": "A Tale of Two Knee Implants in the Same Person: Narcotics for the First and Anti-inflammatory Drugs for the Second.",
"title_normalized": "a tale of two knee implants in the same person narcotics for the first and anti inflammatory drugs for the second"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2019R1-200767",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN\\OXYCODONE HYDROCHLORIDE"
... |
{
"abstract": "Posttraumatic stress disorder (PTSD) is a well-studied mental health condition with existing guidelines and algorithms for treatment of PTSD. Those guidelines, while acknowledging an increased complexity, fail to provide clear PTSD treatment guidelines when an individual has a concurrent traumatic brain injury (TBI) diagnosis. Therefore, a literature review along with an accompanying case presentation is presented to demonstrate the minimum necessary considerations for approaching treatment of this complex population. Treatment approaches must be lead by providers that have the expertise and training necessary to consider all facets of the patient and their potential options. The provider must consider the pathophysiology of PTSD and TBI and be capable of leading a team to identify the patient's source(s) of dysfunction, current cognitive abilities, and potential indications for psychotropic medications and/or other types of therapeutic intervention.",
"affiliations": "Department of Psychiatry, Wright State University-Boonshoft School of Medicine, 627 S. Edwin C. Moses Blvd, Dayton, OH, 45417-1461, USA. hansrwatson@yahoo.com.;Department of Psychiatry, Wright State University-Boonshoft School of Medicine, 627 S. Edwin C. Moses Blvd, Dayton, OH, 45417-1461, USA.;Department of Psychiatry, Wright State University-Boonshoft School of Medicine, 627 S. Edwin C. Moses Blvd, Dayton, OH, 45417-1461, USA.",
"authors": "Watson|Hans R|HR|;Ghani|Musammar|M|;Correll|Terry|T|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1007/s11920-016-0699-9",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1523-3812",
"issue": "18(7)",
"journal": "Current psychiatry reports",
"keywords": "Cognitive behavioral therapy; Neuropsychological tests; Posttraumatic stress disorder; Psychodynamic therapy; Psychopharmacology; Traumatic brain injury",
"medline_ta": "Curr Psychiatry Rep",
"mesh_terms": "D000070642:Brain Injuries, Traumatic; D019468:Disease Management; D006801:Humans; D017410:Practice Guidelines as Topic; D013313:Stress Disorders, Post-Traumatic",
"nlm_unique_id": "100888960",
"other_id": null,
"pages": "63",
"pmc": null,
"pmid": "27222137",
"pubdate": "2016-07",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": "24338345;21483429;20631631;25644881;12400200;18234750;20614457",
"title": "Treatment Options for Individuals with PTSD and Concurrent TBI: A Literature Review and Case Presentation.",
"title_normalized": "treatment options for individuals with ptsd and concurrent tbi a literature review and case presentation"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US08176",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SERTRALINE HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "OBJECTIVE\nTo report a case of teratogenic effect of imatinib mesylate (IM) in a newborn, whose mother was suffering from chronic myelogenous leukemia and was treated with IM for 4 years, including during her pregnancy.\n\n\nMETHODS\nThe newborn was diagnosed with microtia of the right ear, preauricular tag on the left side, absence of right depressor angular oris muscle, and imperforate anus. Infantogram showed dextrocardia, hemivertebrae in the thoracic region and cervical spina bifida occulta. The newborn was operated on for the imperforate anus and was discharged in good condition.\n\n\nCONCLUSIONS\nThis case revealed that IM is not safe for the fetus and leads to teratogenicity. Hence, we recommend that pregnant women should not be treated with IM.",
"affiliations": "J.C.D. Dental College, Sirsa, India.",
"authors": "Jain|Namita|N|;Sharma|Deepak|D|;Agrawal|Renu|R|;Jain|Adeesh|A|",
"chemical_list": "D000970:Antineoplastic Agents; D000068877:Imatinib Mesylate",
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000381806",
"fulltext": "\n==== Front\nMed Princ PractMed Princ PractMPPMedical Principles and Practice1011-75711423-0151S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.ch 2589667010.1159/000381806mpp-0024-0291Case ReportA Newborn with Teratogenic Effect of Imatinib Mesylate: A Very Rare Case Report Jain Namita aSharma Deepak b*Agrawal Renu cJain Adeesh caDepartment of Neonatology, J.C.D. Dental College, Sirsa, IndiabDepartment of Neonatology, Fernandez Hospital, Hyderabad, IndiacDepartment of Pediatrics, S.P. Medical College, Bikaner, India*Dr. Deepak Sharma, MD, DNB, Department of Neonatology, Fernandez Hospital, Opposite Old MLA Quarters, Hyderguda, Hyderabad, Andhra Pradesh 500029 (India), E-Mail dr.deepak.rohtak@gmail.com5 2015 17 4 2015 17 4 2015 24 3 291 293 12 8 2014 22 3 2015 Copyright © 2015 by S. Karger AG, Basel2015This is an Open Access article licensed under the terms of the Creative Commons Attribution-NonCommercial 3.0 Unported license (CC BY-NC) (www.karger.com/OA-license), applicable to the online version of the article only. Distribution permitted for non-commercial purposes only.Objective\nTo report a case of teratogenic effect of imatinib mesylate (IM) in a newborn, whose mother was suffering from chronic myelogenous leukemia and was treated with IM for 4 years, including during her pregnancy.\n\nCase Presentation and Intervention\nThe newborn was diagnosed with microtia of the right ear, preauricular tag on the left side, absence of right depressor angular oris muscle, and imperforate anus. Infantogram showed dextrocardia, hemivertebrae in the thoracic region and cervical spina bifida occulta. The newborn was operated on for the imperforate anus and was discharged in good condition.\n\nConclusion\nThis case revealed that IM is not safe for the fetus and leads to teratogenicity. Hence, we recommend that pregnant women should not be treated with IM.\n\nKey Words\nChronic myeloid leukemiaImatinib mesylateTeratogenCongenital malformationsNewbornPregnancyTyrosine kinase inhibitors\n==== Body\nIntroduction\nTreatment of chronic myelogenous leukemia (CML) with imatinib mesylate (IM) dates back to June 1998, but in spite of this long experience there is scarce information on the side effects of IM on fertility and/or pregnancy [1]. The manufacturer of IM recommends that women of childbearing age should avoid becoming pregnant while taking the drug, which is based on the results of preclinical trials that have shown teratogenicity in rats, rabbits, and dogs [1]. There are very few case reports on the outcome of pregnancy while on IM [2,3]. We report a case of a woman treated with IM while pregnant who delivered twins, one of whom had congenital malformations, while the other child and the mother were normal.\n\nCase Report\nA low-birth-weight (2.25 kg), late preterm (35 weeks) male infant with normal Apgar score was born by a nonconsanguineous marriage to a third gravida (G3P2L2A1) 27-year-old woman. The pregnant woman had regular antenatal checkups, and the baby was born by normal vaginal delivery. Her first pregnancy was ectopic, for which a laparotomy was performed 4 years previously; her second pregnancy resulted in normal vaginal delivery. The baby was healthy and well, without any malformations, and is now about 2½ years old.\n\nThe pregnant mother was on IM during the previous 4 years, including during the first and second index pregnancy. During the index pregnancy the antenatal scans were normal. There was no history of radiation exposure. On examination, the baby was diagnosed with malformed right external ears, preauricular tag on the left side, absence of right depressor angular oris muscle, and imperforate anus (fig. 1). Whole-body X-ray showed dextrocardia, hemivertebrae in the thoracic region and cervical spina bifida occulta (fig. 2). Abdominal and renal ultrasonography showed absent right kidney and ectopic left kidney in the pelvic region. Ultrasound of the head showed mild ventriculomegaly, and ECHO showed situs inversus with no other cardiac diseases. The infant was operated on for the imperforate anus, with an uneventful postoperative period. Hemogram, blood urea, blood sugar, serum calcium, and electrolytes were normal.\n\nThere was no family history of any significant illness or any other disorder. The mother was diagnosed with CML during her first pregnancy when her routine hemogram was suggestive of myeloproliferative disorder. Bone marrow examination done at that time showed CML breakpoint cluster region Abelson leukemia virus (quantified using real-time PCR) at a level of 83.04s%. She was prescribed IM 400 mg/day that was started about 1 month after diagnosis. She had regular monitoring by hemogram and PCR every 6 months and had complete hematological and cytological remission throughout. The baby was discharged in good condition but was lost to follow-up after 2 months.\n\nDiscussion\nThe neonate had multiple malformations that included malformed right ear pinna, preauricular skin tag on the left side, absence of right depressor angular oris muscle, dextrocardia, hemivertebrae in the thoracic region, cervical spina bifida occulta, absent right kidney and ectopic left kidney in the pelvic region, mild ventriculomegaly, and situs inversus.\n\nThe malformations of this neonate confirmed neonates with teratogenic effects of IM as previously reported [2,3,4]. The malformations were different for each neonate. Webb and Jafta [2] reported an infant with clinodactyly, short fifth fingers, and slightly downward slanting palpebral fissures, whereas another infant had clinodactyly and low-set ears. Pye et al. [3] reported cases of miscarriage, stillbirth, and renal and vertebral anomalies, as in our case (right renal agenesis and hemivertebrae). Cole et al. [4] reported cases of mothers who had complications that included spontaneous abortion, stillbirth, malformations, and low birth weight. This is the first reported case of its type, with the mother having both a normal infant in one pregnancy and a malformed infant in another pregnancy (although she continued to take the same dose of the drug). This could be due to the difference in the susceptibility of the fetus to the same drugs, possibly because of the difference in epigenetics of each child, and it could also be dose related, with longer absorption and concentration in the fetus.\n\nCML is a myeloproliferative disorder of blood stem cells. There is a fusion of the breakpoint cluster region BCR gene on chromosome 9 with the ABL (Abelson leukemia virus) gene on chromosome 22 which results in the formation of Philadelphia chromosome positive (pHs+) cells. Tyrosine kinase inhibitors, which are used in the treatment of CML, selectively inhibit the activity of the constitutively active protein kinase and regulate the cell cycle. IM is a tyrosine kinase inhibitor which is effective in producing long-term suppression of CML in the majority of patients [1]. Treating physicians do not know much about the treatment of CML during pregnancy – most of this information is from case reports using leukapheresis, hydroxyurea, and interferon. The usual side effects of IM include nausea, loose motions, headaches, leg aches/cramps, fluid retention, disturbances in vision, itchy rash, immunity suppression, bruising or bleeding, anorexia, weight gain, neutropenia, thrombocytopenia, anemia, and edema. Other rare side effects include severe congestive cardiac failure and can lead to delayed catch-up growth if used in prepubescent children [5]. The dermatological side effects of IM seen include nonspecific skin rashes, pruritus, alopecia, hyperhidrosis, stomatitis, xerostomia, superficial edema, hypopigmentation/depigmentation, hyperpigmentation, mucosal inflammation, lichenoid reaction, psoriasiform rash, and Stevens-Johnson syndrome [6,7]. The long-term side effects of IM include growth hormone deficiency in patients [8]. It is recommended that women of child-bearing age who are treated with IM should be aware of the potential teratogenicity of IM. Effective contraception should be used during IM therapy to prevent pregnancy [9] because IM crosses the placenta easily and very high concentrations have been found in the placenta [10].\n\nTherefore, we recommend that women should avoid being pregnant while on IM. However, the present case and other reported cases suggest that if a patient inadvertently becomes pregnant while on IM, the pregnancy can also have a favorable outcome. However, in the patient who does become pregnant while on treatment, balancing the risk to the fetus when continuing IM versus the risk to the mother when interrupting treatment remains difficult. We recommend the mother to undergo regular scans or TIFFA (targeted imaging for fetal anomalies) for detecting an associated anomaly in the fetus.\n\nConclusion\nPregnant mothers who are on IM may have a normal or a teratogenic outcome, as seen in this case. Hence, they need a strict follow-up.\n\nDisclosure Statement\nThe authors have no conflicts of interest to declare.\n\nFig. 1 Child with malformed external ear (microtia).\n\nFig. 2 Infantogram showing dextrocardia with situs inversus, hemivertebrae, and cervical spina bifida.\n==== Refs\nReferences\n1 Goldman JM Melo JV Chronic myeloid leukemia – advances in biology and new approaches to treatment N Engl J Med 2003 349 1451 1464 14534339 \n2 Webb MJ Jafta D Imatinib use in pregnancy Turk J Haematol 2012 29 405 408 24385730 \n3 Pye SM Cortes J Ault PR The effects of imatinib on pregnancy outcome Blood 2008 111 5505 5508 18322153 \n4 Cole S Kantarjian H Ault P Successful completion of pregnancy in a patient with chronic myeloid leukemia without active intervention: a case report and review of the literature Clin Lymphoma Myeloma 2009 9 324 327 19717385 \n5 Druker BJ Guilhot F O'Brien SG Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia N Engl J Med 2006 355 2408 2417 17151364 \n6 Brazzelli V Grasso V Borroni G Imatinib, dasatinib and nilotinib: a review of adverse cutaneous reactions with emphasis on our clinical experience J Eur Acad Dermatol Venereol 2013 27 1471 1480 23611501 \n7 Grasso V Vassallo C Croci G Tyrosine kinase inhibitors: muco-cutaneous side effects at the microscope G Ital Dermatol Venereol 2014 149 317 327 24819759 \n8 Kebapcilar L Bilgir O Alacacioglu I Does imatinib mesylate therapy cause growth hormone deficiency? Med Princ Pract 2009 18 360 363 19648757 \n9 Hensley ML Ford JM Imatinib treatment: specific issues related to safety, fertility, and pregnancy Semin Hematol 2003 40 21 25 12783371 \n10 Russell MA Carpenter MW Akhtar MS Lagattuta TF Egorin MJ Imatinib mesylate and metabolite concentrations in maternal blood, umbilical cord blood, placenta and breast milk J Perinatol 2007 27 241 243 17377606\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1011-7571",
"issue": "24(3)",
"journal": "Medical principles and practice : international journal of the Kuwait University, Health Science Centre",
"keywords": null,
"medline_ta": "Med Princ Pract",
"mesh_terms": "D000014:Abnormalities, Drug-Induced; D000970:Antineoplastic Agents; D005260:Female; D006801:Humans; D000068877:Imatinib Mesylate; D007230:Infant, Low Birth Weight; D007231:Infant, Newborn; D015464:Leukemia, Myelogenous, Chronic, BCR-ABL Positive; D008297:Male; D011247:Pregnancy; D011252:Pregnancy Complications, Neoplastic",
"nlm_unique_id": "8901334",
"other_id": null,
"pages": "291-3",
"pmc": null,
"pmid": "25896670",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "24819759;17377606;12783371;24385730;14534339;23611501;19717385;17151364;18322153;19648757",
"title": "A newborn with teratogenic effect of imatinib mesylate: a very rare case report.",
"title_normalized": "a newborn with teratogenic effect of imatinib mesylate a very rare case report"
} | [
{
"companynumb": "PHHY2015IN071409",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugadditional": null,
"drugad... |
{
"abstract": "Two siblings with an early onset of a neurodegenerative disease were presented with muscular hypotonia, secondary microcephaly, and severe developmental delay. Seizures were refractory to treatment but could be controlled with a ketogenic diet. Over the course of 5 years, whole exome sequencing (WES) was performed twice in both children. The first time the diagnosis was missed. The next one revealed compound heterozygous mutations in the gene coding for the tubulin folding cofactor D. Technical improvements in WES mandated a new investigation after a few years in children where the diagnosis has not been found.",
"affiliations": "University Children's Hospital Muenster, Muenster, Germany.;University Children's Hospital Muenster, Muenster, Germany.;University Children's Hospital Muenster, Muenster, Germany.;Center for Genomics and Transcriptomics, Tübingen, Germany.;University Children's Hospital Muenster, Muenster, Germany.;University Children's Hospital Muenster, Muenster, Germany.",
"authors": "Quitmann|Christina M|CM|https://orcid.org/0000-0001-8759-1613;Rust|Stephan|S|;Reunert|Janine|J|;Biskup|Saskia|S|;Fiedler|Barbara|B|;Marquardt|Thorsten|T|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/2329048X211034969",
"fulltext": "\n==== Front\nChild Neurol Open\nChild Neurol Open\nCNO\nspcno\nChild Neurology Open\n2329-048X\nSAGE Publications Sage CA: Los Angeles, CA\n\n10.1177/2329048X211034969\n10.1177_2329048X211034969\nOriginal Research Article\nTubulin Folding Cofactor D Deficiency: Missing the Diagnosis With Whole Exome Sequencing\nhttps://orcid.org/0000-0001-8759-1613\nQuitmann Christina M. 1\nRust Stephan Dr. rer. nat. 1\nReunert Janine Dr. 1\nBiskup Saskia Dr. med. Dr. rer. nat. 2\nFiedler Barbara Dr. med. 1\nMarquardt Thorsten Dr. med. 1\n1 39069 University Children’s Hospital Muenster , Muenster, Germany\n2 Center for Genomics and Transcriptomics, Tübingen, Germany\nChristina M. Quitmann, Department of General Pediatrics, Metabolic Diseases, University Children's Hospital Muenster, Albert-Schweitzer-Campus 1, 48149 Muenster, Germany. Email: c_quit01@uni-muenster.de\n5 8 2021\nJan-Dec 2021\n8 2329048X2110349693 3 2021\n18 6 2021\n7 7 2021\n© The Author(s) 2021\n2021\nSAGE Publications\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nTwo siblings with an early onset of a neurodegenerative disease were presented with muscular hypotonia, secondary microcephaly, and severe developmental delay. Seizures were refractory to treatment but could be controlled with a ketogenic diet. Over the course of 5 years, whole exome sequencing (WES) was performed twice in both children. The first time the diagnosis was missed. The next one revealed compound heterozygous mutations in the gene coding for the tubulin folding cofactor D. Technical improvements in WES mandated a new investigation after a few years in children where the diagnosis has not been found.\n\nTBCD deficiency\ntubulin\nketogenic diet\nneutropenia\nwhole exome sequencing\ncover-dateJanuary-December 2021\ntypesetterts19\n==== Body\nIntroduction\n\nMicrotubules play a crucial role for the cytoskeleton and are essential to develop synaptic connections, as well as to build axons and dendrites. They consist of α- and β-tubulins that form heterodimers and subsequently protofilaments. Several protofilaments build a hollow tubular structure. Polymerization and depolymerization of the microtubules are essential in proliferation, communication, development, and motility, which are organized by microtubule-organizing centers (MTOCs). To settle the polarity of the microtubules, a γ-tubulin ring complex is crucial because it functions as a microtubule nucleator at the MTOC and binds the β-subunit to expose the α-subunit (Zheng et al1).\n\nThe correct building of microtubule blocks requires additional proteins and cofactors. Native α- and β-tubulins initially interact with prefoldin, which is responsible for bringing them together with their corresponding chaperonin (chaperonin containing TCP-1 [CCT]—cytosolic chaperonin) (Vainberg et al2). After adenosine triphosphate hydrolysis, α- and β-tubulins interact with specialized chaperons, the tubulin folding cofactors, which assist in the correct folding of the α/β-tubulin heterodimers. Tubulin folding cofactor A (TBCA) is part of the β-folding pathway and tubulin folding cofactor B (TBCB) is part of the α-folding pathway. Tubulin folding cofactor C (TBCC), tubulin folding cofactor D (TBCD), and tubulin folding cofactor E (TBCE) are involved in both pathways. TBCB and TBCA need to bind to native α- and β-tubulins before the following cofactors can build a complex. Cofactors D, E, and C build the super complex with α- and β-tubulin to hydrolyze guanosine triphosphate (GTP). This results in the release of the correctly folded native α- and β-tubulin (see Figure 1). α- and β-tubulin monomers from depolymerized microtubules may also be recycled into this pathway by direct binding to TBCE and TBCD, respectively (see dotted dash line arrows in Figure 1) (Lewis et al3). ARL2, an adenosine diphosphate ribosylation factor-like protein, is involved in the regulation of the folding pathway by interacting with TBCD and β-tubulin. The TBCD·ARL2·β-tubulin trimer is a functional complex whose role is crucial in microtubule assembly (Francis et al4).\n\nFigure 1. (CCT) This picture shows the tubulin folding pathway and the involvement of several cofactors. The microtubules depolymerization depends on GTP hydrolysis and the correct interaction with the cofactors. TBCA and TBCB are described exclusively in 1 pathway, whereas TBCC, TBCD, and TBCE build the super complex to hydrolyze GTP and facilitate the release of the native tubulins. TBCD is crucial to release the native β-tubulin (modified from Bhamidipati et al5).\n\nAbbreviations: CCT, chaperonin containing TCP-1; GTP, guanosine triphosphate; TBCA, tubulin folding cofactor A; TBCB, tubulin folding cofactor B; TBCC, tubulin folding cofactor C; TBCD, tubulin folding cofactor D; TBCE, tubulin folding cofactor E.\n\nSeveral neurodegenerative diseases are described in the literature that have their cause in mutations of proteins, which are involved in microtubule formation or posttranslational modifications6 (MIM: #617193). Mutations in TBCD can result in a defective function of the cofactor and deficiencies in the structure, folding, or stability of the microtubules7 (Flex et al8) and lead to neuronal degenerative disorders (Miyake et al9).\n\nWhole exome sequencing (WES) is a very powerful method to diagnose ultra-rare genetic disorders such as TBCD deficiency. Often, it is only done once and not repeated even if no diagnosis could be found. However, continuous improvement of the method suggests that it can be useful to repeat the analysis.\n\nMaterials and Methods\n\nArray-comparative genomic hybridization (CGH) was performed in February 2010 using an Agilent 400k Array. Single nucleotide polymorphism (SNP)-chip analyses for homozygosity and identical by descent mapping were done essentially as described in Tegtmeyer et al10 using Illumina 660 W beadchips. The logarithm of the odds scores over the chromosomes were calculated using Merlin-1.1.2 software.11 Two exome analyses were done by CEGAT (Tübingen). For the first exomes in 2013, enrichment of exonic sequences was achieved with the Agilent Exome v.5 kit. For sequencing, an Illumina HiSeq2500 was used. For each patient, data from two runs were pooled. Reads were mapped to the hg19 reference sequence using the bwa-tool 0.7.2-r351. Variants were called with samtools 0.1.18 + bcftools 0.1.17 and VarScan 2.3.5. Annotation was based on Ensembl.74 + RefSeq.UCSC.20131210 + CCDSr15, dbSNP 138, dbNSFP 2.1, exome variant server , and human gene mutation database (HGMD) version 2013.04. Regarding the new exomes in 2018, enrichment was by Agilent Exome v.7, adapter trimming by Skewer 0.2.2 software, mapping to hg19 reference sequence using the bwa-tool 0.7.2-r351, variant calling by CeGaT StrataCall r1254, annotation was based on Ensembl.75 + RefSeq.UCSC.20180712 + CCDSr15, dbSNP 151, dbNSFP 3.4c, GnomAD 2.0.2, HGMD 2018.02, and indel realignment by assembly based realigner (PMID: 24907369).11\n\nTo investigate the effect of the discovered mutations in the TBCD gene (RefSeq GenBank: NM_005993.5), complementary DNA (cDNA) was synthesized using RNA obtained from peripheral blood cells by standard procedures. The region of interest was amplified using primers in exons 20 and 28 (5′- GAGGCTGCTGTCCATGACACTGAG, 5′-GGGGAAGTGTGGGTAACTGCTCT, product length 606 bp). Primers were 5′-tailed with M13 forward and reverse adapters for simplified sequencing M13F: TGTAAAACGACGGCCAGT and M13R: CAGGAAACAGCTATGACC. The product was sequenced by standard Sanger sequencing, using BigDye-terminator technology and primers M13F and M13R. Primers were searched using Primer blast software12 against sequences of the respective exons with neighboring intron regions. These sequences were extracted from Ensembl, ENSG00000141556.\n\nResults\n\nTwo siblings with a neurodegenerative disease are described with epileptic seizures, secondary microcephaly, and a severe developmental delay. Both siblings carry heterozygous, disease-causing mutations in the TBCD gene.\n\nPatients\n\nThe two siblings descent from healthy, unrelated parents who did not report any inherited disease in their family. Informed consent was obtained from the parents.\n\nPatient A (female) was born 3 weeks prior to the estimated date of birth with a body weight of 3140 g (36th percentile), length of 51 cm (48th percentile), 33.5 cm head circumference (24th percentile), Apgar 09/10/10, and umbilical cord pH (A) 7.3. She was presented at our hospital at the age of 8 months due to seizures and developmental delay. During the seizures, she grimaced and gazed at the top right. She showed hypersalivation and a fencing posture. The seizures were initially fever-associated but later occurred unprovoked. In the first clinical examination, she showed few spontaneous movements and could not sit without support. She presented with a progressive hypotonia of the lower limb that had been noticed before in a routine screening at the age of 6 months. She had a secondary microcephaly as well as a marginal splenomegaly with 7.5 cm (normal: <7.2 cm). No cardiac, abdominal, or pulmonic abnormalities were observed at this point of the investigation. She developed talipes equinus on both sides and hip luxations. Her length and weight were within the 25th and 50th percentile but her head circumference was below the third percentile. The newborn screening for metabolic disorders and the blood amino acids were normal. During the first 9 months, methylmalonic acid in the organic acids was several times significantly elevated and declined after the administration of vitamin B12.\n\nThe first electroencephalogram (EEG) was pathological with beta activity overlay and epileptiform discharges on the right hemisphere. Physiological stages of sleep were not verifiable. The following EEGs showed sharp-wave complexes on the left and right hemispheres. Tachycardia and low oxygen saturation were part of the seizures and generally higher amplitude on the right hemisphere was noticed. The patient slept a lot and regularly showed small seizures after waking up during the day. The seizures were both myoclonic and tonic and occurred with screaming or laughing.\n\nSeveral anticonvulsive drugs were used in mono and combination therapy (eg sulthiame, oxcarbazepine, topiramate, ethosuximide, and levetiracetam) led to fewer seizures, however, episodes with atypical absences remained. Finally, the patient was free from seizures after a ketogenic diet was introduced (see Figure 2).\n\nFigure 2. Seizure frequency under anticonvulsive therapy and ketogenic diet in patients A and B.\n\nBrain magnetic resonance imaging (MRI) revealed reduced supratentorial white matter volume and a hypoplasia of the corpus callosum. The neurocranium and myelination were age-appropriate at 8 months; however, a lack of developmental progression of myelinization in the following MRI was observed. Progressive brain atrophy with consecutive hydrocephalus ex vacuo was seen in the subsequent MRIs. Brain atrophy affected gray and white matter equally including the basal ganglia. The head of the caudate nucleus was almost undetectable in the MRI (see Figure 3).\n\nFigure 3. Patient A (1-3): Magnetic resonance imaging at the age of 12 months with progressive loss of brain volume. Extended liquor ventricles, hypomyelination and progressive depletion of the corpus callosum, and an almost nondefinable head of caudate nucleus (arrow) were observed. The photograph (4) was taken at the age of 7 years. Patient B (5-7), Magnetic resonance imaging at the age of 11 months showing a distinct global brain atrophy, hypomyelination and a thin corpus callosum. Especially the hippocampal regions and the caudate nuclei are thinned out (arrow). The photograph (8) was taken at the age of 8 years.\n\nMotor nerve conduction velocity was significantly reduced since the patient's first presentation at the age of 8 months (nervus tibialis posterior and nervus ulnaris). No signs of inflammation were observed in the muscle biopsy, but a pattern of neurogenic damage with fiber atrophy and hypertrophic groups of fibers was found. Sural nerve biopsy was normal. Her patellar, Achilles tendon, biceps, and triceps tendon reflexes were present until the age of 2.5 years. At this point exclusively the pupillary light reflex was consistently noticeable. She expressed almost no control over her head movements and developed a heavy tremor. She showed little motoric development but was able to express emotions such as joy and pain.\n\nAt 19 months of age, a premature thelarche was reported. Her breast development was classified according to the Tanner System as PH 1 B3. Furthermore, she had a growth spurt without a puberty-typical hormone profile or bone age, which made a precocious puberty seem unlikely. Due to muscular hypotension, she suffered from dysphagia and recurrent pulmonary infections. Furthermore, she developed an elevated diaphragm and atelectasis, which was treated symptomatically. Both patients developed intermittent neutropenia in the first years of life.\n\nShe had not reached the development milestones appropriate for her age from the age of 7 months onward, but she even lost previously acquired capabilities. At the age of 10 months, she could control her head occasionally, but she could not roll from front to back on her own, neither could she sit freely. Her grasp was uncoordinated, but she could laugh, focus, babble unspecifically, and show emotions.\n\nShe died at the age of 7 years of an airway infection.\n\nHer younger brother, patient B, was born 2 weeks prior to the estimated date of birth with a body weight of 3420 g (52nd percentile), length of 50 cm (26th percentile), head circumference of 35 cm (52nd percentile), Apgar 09/10/10, and umbilical cord pH (A) 7.3. He had developed completely appropriate to his age in the first 3 months after birth. Then he started to move less and showed extension in the legs while lifting him. At the age of 6 months, he presented with a hypotonia of the lower limb after kicking and moving actively in the first months after birth. He showed progressive hypotonia, neurodevelopmental delay, and fever associated epileptic seizures. In the first examination, the muscular reflexes were still present. By 9 months he stopped turning on the sides. He was diagnosed with a massive psychomotor retardation.\n\nThe EEG showed an asymmetry between the right and the left hemisphere. Sharp waves and beta activity overlay were observed. A treatment with levetiracetam did not decrease the seizure frequency, and he stayed very tired during the day. By 12 months he presented with fever while seizures appeared every 3 min. The anticonvulsive therapy was optimized with phenobarbital, which could decrease the seizure frequency to once every 20 to 60 min. Potassium bromide was added on suspicion of migrating partial epilepsy but needed to be stopped because of side effects. The seizure frequency remained high during occasionally occurring fever episodes. Eventually, a ketogenic diet finally decreased the seizure frequency with a fat–carbohydrate ratio of 3:1. The ketone bodies in the urine exceeded 80 mg/dL (see Figure 2).\n\nDuring the day, he still had several myoclonic twitches lifting his arms and opening his eyes wide. Occasionally he expressed a fencing posture. The pattern of myoclonia presented identically compared with the sister’s myoclonia. No physiological sleep structures appeared in the EEG, and he maintained a high susceptibility to seizures. The MRI results of both siblings showed similarities (see Figure 3). He developed dysphagia and from the age of 2.5 years, he received a majority of his food via a percutaneous endoscopic gastrostomy tube. He did not develop any ability to speak, had convergent strabism, and at 9 years old he developed nystagmus. The parents reported that the hand-mouth-contact had stopped by 5 years, and by 7 years he showed significantly less movement and anticipation. He is now 10 years old.\n\nRetrospectively, the mother reports several differences among the pregnancies with the 2 affected children and the following healthy sibling. The affected pregnancies shared a cervix insufficiency, which required a cervical cerclage; increased heart rates of the fetuses at around 160/170 bpm; and significantly less movement and activity. An ultrasound in the 20th week already showed borderline abnormalities in the brain, and both affected children were born 3 weeks early due to premature contractions.\n\nGenetics\n\nThe chromosomal analysis showed a standard karyotype and array CGH was inconspicuous. Since the parents came from a limited population of German immigrants to Russia, we also checked for unknown consanguinity by SNP-chip-analysis. In total 13.7 Mb of the genome were shared homozygous by the siblings, but WES showed no relevant mutations in those regions. About one-third of the genome was shared identical by descent by the siblings, but using the results of the first exome analysis no compound heterozygous mutations led to a candidate gene. The average coverage of that exome was 144× with 96.2% at least 30× for patient A and 308× with 98.7% at least 30× for patient B. The second exome in 2018 revealed 2 mutations in TBCD in both siblings (see Table 1). Retrospective inspection of the 2013 data showed that the c.230A > G was contained in the variant lists of both siblings, but the gene did not appear as relevant since the second mutation was not covered sufficiently (see Table 1, numbers taken from mapping-file), was therefore filtered off and was not listed in the respective variant list of patient A.\n\nTable 1. The Coverage of the Correspondent Regions in Whole Exome Sequencing (Patient A Female, Patient B Male); Given are the Counts Normal/Mutant Allele.\n\n\tPatient A\tPatient B\t\n\tc.230A > G\tc.2048_2052dupTAATA;\np.Glu685*\tc.230A > G\tc.2048_2052dupTAATA;\np.Glu685*\t\n2013 (CeGaT)\t19/22\t2/1 + 1 other divergent read at this position\t27/23\t8/3 + 1 other divergent read at this position\t\n2018 (CeGaT)\t53/57\t6/2\t129/136\t30/19\t\n\nFurthermore, no disease-causing mutation had been identified and published until 2016. The WES in 2018 (average coverage 149×; 96.7% at least 30× for patient B) finally led to our diagnosis and located the compound heterozygous mutation in patient B (see Table 1). Because patient A had been deceased just the correspondent regions were mapped again. The variant c.2048_2052dupTAATA; p.Glu685* was confirmed with Sanger sequencing because 2 reads of the variant with next generation sequencing were not sufficient.\n\nBy WES, the compound heterozygous mutations c.230A > G and c.2048_2052dup in the gene coding for TBCD were found in both patients. The mother is a heterozygous carrier of the missense mutation. The father is a heterozygous carrier of the variant c.2048_2052dup TAATA; p.Glu685* in exon 24, which results in a premature stop codon and probably in the following to a nonsense-mediated messenger RNA decay. This could clearly be visualized by a significantly reduced signal of the affected allele in the cDNA (panel B) in comparison with wild type cDNA (panel A) (see Figure 4).\n\nFigure 4. (A) Shows a healthy control, whereas the sequencing of exon 24 in the patient's complementary DNA. (B) Shows a decreased signal in the region of the duplicated TAATA-sequence (underlined).\n\nThe variant c.230A > G is predicted to be “deleterious” by PROVEAN,13 “likely pathogenic” by ClinVar (submitted 2018, submission number: SCV000892499)14 and “damaging” by sorting intolerant from tolerant (SIFT).15 Furthermore, both variants are predicted to be “disease causing” by mutation taster.16 In the following, we present a table with the known disease-causing mutations and references leading to a similar clinical presentation (see Table 2).\n\nTable 2. Known Disease-Causing Mutations in Tubulin Folding Cofactor D.\n\nNucleotide mutation\n(+1 as A of ATG start codon)\tConsequence of mutation\tAnnotation\tReference\tClinical comparator\t\nc.2048_2052dupTAATA;\np.Glu685* (het.)\tp.Glu685*→stopgain\trs1568044300\tThis study\t\t\nc.230A > G (het.)\tp.His77Arg\trs1409600874\tThis study, Zhang et al17\t\t\ndeletion of exons 28-39 (het.)\t\t\tZhang et al17\t\t\nc.230A > G (hom.)\tp.His77Arg\t\tElmas et al18\tOnset: 5 months, severe delay, spastic tetraplegia, seizures, brain atrophy\t\nc.3365C > T (het.)\tp.Pro1122Leu\t–\tTian et al19\t\t\nc.1739G > A (het.)\tp.Arg580Gln\t–\t\t\t\nc.230A > G (het.)\nc.907C > T (het.)\tp.His77Arg\np.Arg303*→stopgain\t\nrs751190601\t\t\t\nc.2953C > T (het.)\tp.Arg979Cys\trs768723646\t\t\t\nc.3550C > T (het.)\tp.Gln1184*→stopgain\trs754168355\t\t\t\nc.2419G > A (het.)\tp.Glu807Lys\trs199644299\tDi Bella et al20\t\t\nc.2852 + 3A > G (het.)\t\trs187081192\t\t\t\nc.202C > T (het.)\tp.Gln68Ter\t–\tIsik et al21\t\t\nc.880C > T (het.)\tp.Arg294Trp\trs200591137\t\t\t\nc.1423G > A (het.)\nc.554del (het.)\tp.Ala475Thr\np.Lys185Argfs*14\t–\n–\tStephen et al22\t\t\nc.(3099C > G) (hom.)\tp.Asn1033Lys\t–\tGronborg et al23\tOnset: 4–9 months, developmental regression, secondary microcephalus, hypotonia, spasticity, and early death\t\nc.2825G > A (hom.)\tp.Arg942Gln\trs1056577423\tIkeda et al24\tOnset: 1/6 month(s), Severe phenotype, epilepsy, early need of ventilation, and severe retardation\t\nc.1423G > A (hom.)\tp.Ala475Thr\t–\tPode-Shakked et al25\tSecondary microcephalus, epilepsy, hypotonia, intellectual disability, and mild dilatation of the ventricles\t\nc.2810C > G (hom.)\tp.Pro937Arg\t–\t\tMild ataxia, secondary microcephalus, epilepsy, intellectual disability, and mild cortical atrophy\t\nc.1757C > T (het.)\tp.Ala586V\t–\t\t\t\nc.3192-2A > G (het.)\tIVS34-2A > G\t–\t\t\t\nc.1160T > G (het.)\tp.Met387Arg\t–\tMiyake et al9\t\t\nc.1564-12C > G (het.)\tp.Gly522Phefs*14\t–\t\t\t\nc.2280C > A (het.)\tp.Tyr760*\t–\t\t\t\nc.2314C > T (het.)\tp.Arg772Cys\trs181969865\t\t\t\nc.2761G > A (het.)\tp.Ala921Thr\trs886041085\t\t\t\nc.2810C > G (hom)\tp.Pro937Arg\t–\t\tOnset: 9/11 months, epilepsy, regression, microcephalus, hypotonia, and muscle atrophy\t\nc.3365C > T (hom)\tp.Pro1122Leu\trs755177846\tFlex et al8\tSevere manifestation\t\nc.2981C > T (het.)\tp.Thr994Met\trs867484272\t\t\t\nc.3313G > A (het.)\tp.Val1105Met\trs764003906\t\t\t\nc.1876G > A (het.)\tp.Ala626Thr\trs749225304\t\t\t\nc.1130G > A (het.)\tp.Arg377Gln\trs764085684\t\t\t\nc.771 + 1_771 + 10del (het.)\t\trs1408793828\t\t\t\nc.1121C > T (het.)\tp.Thr374Met\t–\t\t\t\nc.686T > G (het.)\nc.3365C > T (het.)\tp.Leu229Arg\np.Pro1122Leu\trs778417127\nrs755177846\t\t\t\nc.1423G > A (hom.)\tp.Ala475Thr\t–\tEdvardson et al26\tOnset: 10/14 months, severe epilepsy, dystonia, and nystagmus\t\nc.1757C > T (hom.)\tp.Ala586Val\t–\t\tOnset: 12 months, rare epilepsy, dystonia, and spasticity\t\n\nDiscussion\n\nWe presented two patients with a severe neurodegenerative disease with 1 novel mutation in the TBCD gene and a particularly severe clinical phenotype.\n\nThe laboratory findings showed in both patients intermittent neutropenia. A possible explanation for the neutropenia could be the enhanced stability of the microtubules in TBCD deficiency, which was investigated and determined by Flex et al.8 This has also been observed as a side effect of the drug taxol. Taxol stabilizes microtubules (Abal et al27) and often leads to neutropenia (Rowinsky et al28).\n\nWe contemplate a hormonal involvement of the disease because our female patient presented with premature thelarche at the age of 19 months. A TBCD-deficient patient with hirsutism had been described in the literature,26 as well as a patient with cryptorchidism and hypothyroidism.18 Moreover, our male patient had undescended testicles, which could be caused by multiple factors. Further investigation of TBCD deficiency would be necessary to clarify a hormonal interaction of the disease.\n\nBy reconstructing the diagnostic way of the 2 patients, we want to emphasize the importance of reevaluation and potential repetition of diagnostics, especially if new technology is available. The average coverage had improved remarkably while the amount of required material decreased in the last decade which allows us to analyze more samples per run. The percentage of target sequences covered at least 20-fold had increased just marginally from ∼97% to 98% in the time between the first and the last successful sequencing. This overall improvement, however, also included significant relative improvements of many outliers (see Figure 5).\n\nFigure 5. This chart illustrates the increase of covered regions exceeding 20-fold with WES (CDS, and HGMD). The higher the coverage of coding sequences and disease-causing genes documented by the HGMD, the higher the probability to identify rare disease-causing mutations and interpret them correctly. While the coverage improved immensely in the last decade, the required input material decreased due to technological advance (CeGaT). The combined effect of the determinants facilitated diagnosing the TBCD deficiency.\n\nAbbreviations: WES, whole exome sequencing; CDS, coding sequences; HGMD, human gene mutation database; TBCD, tubulin folding cofactor D.\n\nAdditionally, we can report a novel disease-causing mutation (c.2048_2052dupTAATA; p.Glu685*) that had not been described previously. The heterozygous mutation c.230A > G had been described by Tian et al19 with a mild clinical manifestation. The variant c.230A > G in combination with the deletions of exons 28-39 leads to a heavy clinical manifestation with a phenotype similar to our patients (Zhang et al17), as well as the homozygous mutation (Elmas et al18). We compare the clinical presentation of the patients carrying the same variant c.230A > G in Table 3.\n\nTable 3. Comparison of Patients From Studies of Tian et al19 and Zhang et al17 Carrying the Same Heterozygous Variant With Different Phenotypes (N/A: Not Applicable).\n\n\tc.230A > G;\nc.907C > T19 (n = 1)\tc.230A > G;\ndeletions of exons 28–3917 (n = 1)\tc.230A > G;\nc.2048_2052dupTAATA\n(n = 2)\tc.230A > G\nc.230A > G (n = 1)18\t\nSeizures\tFever associated and good response to epileptic drugs\tNot fever associated, refractory to epileptic drugs\tFever associated and refractory to epileptic drugs, ketogenic diet reduced seizures\tPresent\t\nAge of onset\t6 months\t9 months\t6 months (patient B)\n8 months (patient A)\t5 months\t\nEEG\tLow amplitude spike waves midline, bilateral central top and frontal region during sleep\tHigh amplitude delta wave, during the seizures migration between both hemispheres\tAsymmetry between the right and the left hemisphere. Sharp waves and beta activity overlay.\tN/A\t\nMRI\tMyelination delay and defect in the white matter of the occipital lobe\tAtrophy,\nthin corpus callosum, extended liquor ventricles, and hypomyelination\tAtrophy,\nthin corpus callosum, extended liquor ventricles, hypomyelination, and undefinable head of caudate nucleus\tBifrontotemporal atrophy, dilated bilateral ventricles and third ventricular, periventricular hyperintensity, and thin corpus callosum\t\nNeurological examen\tNearly normal\tSevere delay\tSevere delay\tSevere delay\t\nSecondary microcephalus\tNo\tYes (<3 percentile)\tYes (<3 percentile)\tN/A\t\nMilestones\tAlmost reached the milestones according to the age\tDevelopmental regression after the onset\tDevelopmental regression after the onset\tSevere delay\t\nHypotonia\tNo\tYes\tYes\tN/A\t\nAbbreviations: EEG, electroencephalogram; MRI, magnetic resonance imaging.\n\nThe characteristics of phenotypes most likely depend on the remaining protein function and especially on the ability to interact with the cofactors and β-tubulin(Miyake et al9).\n\nThe milder mutation in our case might be the missense mutation c.230A > G and determines the clinical picture. It remains unclear whether modulating factors are present in the different patients.\n\nAt first glance, the second TBCD allele does not explain the clinical difference, as in all 3 cases a loss of function is predicted. A dominant effect, eg by incorporation of some truncated nonfunctional forms into the DEα-/β-tubulin/C-super complex, is also unlikely, since the parents were completely normal. However, it cannot be excluded that the mutation c.907C > T (p.Arg303*) reported by Tian et al19 is a hypomorphic nonsense mutation providing a relevant residual function. This may occur through mutation-induced alternative splicing with new splice sites or by exon skipping, leaving a protein with a significant remaining function (eg Roosing et al29) or by a significant percentage of read through. This could solve the paradox. In the patient described by Tian et al,19 the mutation c.230A > G would be the more severe defect than the hypomorphic stop, which would explain the mild phenotype in their patient(s) (Table 3). In contrast, the other patients in Table 3 with the heterozygous mutation likely would have a true stop as the second allele explaining their more severe phenotype. The homozygous missense mutation also leads to a severe phenotype because the residual protein function does not suffice.\n\nThe patient's complete genetic background should not be overlooked and be considered as a significant influence on the manifestation of the disease.\n\nForty-three patients with various mutations in the TBCD gene but different phenotypes had been described so far. The majority of patients developed a severe neurodegenerative disorder with an early onset within the first year; very few patients with mild clinical features could be identified. Aside from a symptomatic antiepileptic pharmacotherapy, there is no causal treatment until now. Most of the children developed severe respiratory problems and deceased within months or a few years.\n\nThe disease is probably underdiagnosed and not very widely known. It took a long time until the children could be diagnosed correctly. Early WESs did not result in the correct diagnosis, mostly due to a low coverage in the correspondent regions. The first description of the disease had not been published at that point. WES experienced a rapid development in the last decade due to the introduction of new diagnostic tools and efforts to increase efficiency. This progress was accompanied by an improvement of the coverage, which is an essential marker for the quality of a sample (Matthijs et al30). Overall, this advance and the publications about the candidate gene were crucial for the diagnosis of the patients presented above.\n\nThe current WES has a better coverage and makes faster diagnosis possible. In general, unresolved cases may profit from the repetition of sequencing using improved processes that facilitate the identification of rare diseases and may therefore provide the basis for any development of a specific therapeutic approach.\n\nAcknowledgments\n\nThe work was performed in the University Children's Hospital in Muenster, Germany.\n\nAuthor Contributions: Christina M Quitmann drafted the manuscript and contributed to analysis and interpretation of data. A substantial contribution to the analysis and interpretation of data was made by Stephan Rust, Dr. rer. nat. and Janine Reunert, Dr. Biskup Dr. rer. nat., Dr. med. and Barbara Fiedler Dr. med. contributed to acquisition of data and interpretation. Thorsten Marquardt Prof., Dr. med. supervised the work and contributed to conception and interpretation of the data. All authors had critically revised the manuscript, finally approved it and agree to be accountable for all aspects of the work.\n\nDeclaration of Conflicting Interests: The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nFunding: The authors received no financial support for the research, authorship, and/or publication of this article.\n\nORCID iD: Christina M. Quitmann https://orcid.org/0000-0001-8759-1613\n\nEthical Approval: Not applicable, because this article does not contain any studies with human or animal subjects.\n==== Refs\nReferences\n\n1 Zheng Y Wong ML Alberts B Mitchison T . Nucleation of microtubule assembly by a gamma-tubulin-containing ring complex. Nature. 1995;378 (6557 ):578-583. doi:10.1038/378578a0 8524390\n2 Vainberg IE Lewis SA Rommelaere H , et al. Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 1998;93 (5 ):863-873. doi:10.1016/s0092-8674(00)81446-4 9630229\n3 Lewis JA Tian G Cowan NJ . The alpha- and beta-tubulin folding pathways. Trends Cell Biol. 1997;7 (12 ):479-484.17709011\n4 Francis JW Newman LE Cunningham LA Kahn RA . A trimer consisting of the tubulin-specific chaperone D (TBCD), regulatory GTPase ARL2, and beta-tubulin is required for maintaining the microtubule network. J Biol Chem. 2017;292 (10 ):4336-4349. doi:10.1074/jbc.M116.770909 28126905\n5 Bhamidipati A Lewis SA Cowan NJ . ADP ribosylation factor-like protein 2 (Arl2) regulates the interaction of tubulin-folding cofactor D with native tubulin. J Cell Biol. 2000;149 (5 ):1087-1096. doi:10.1083/jcb.149.5.1087 10831612\n6 Baird FJ Bennett CL . Microtubule defects & neurodegeneration. J Genet Syndr Gene Ther. 2013;4 :203. doi:10.4172/2157-7412.1000203 24563812\n7 Cunningham LA Kahn RA . Cofactor D functions as a centrosomal protein and is required for the recruitment of the gamma-tubulin ring complex at centrosomes and organization of the mitotic spindle. J Biol Chem. 2008;283 (11 ):7155-7165. doi:10.1074/jbc.M706753200 18171676\n8 Flex E Niceta M Cecchetti S , et al. Biallelic mutations in TBCD, encoding the tubulin folding cofactor D. Perturb microtubule dynamics and cause early-onset encephalopathy. Am J Hum Genet. 2016;99 (4 ):962-973. doi:10.1016/j.ajhg.2016.08.003 27666370\n9 Miyake N Fukai R Ohba C , et al. Biallelic TBCD mutations cause early-onset neurodegenerative encephalopathy. Am J Hum Genet. 2016;99 (4 ):950-961. doi:10.1016/j.ajhg.2016.08.005 27666374\n10 Tegtmeyer LC Rust S van Scherpenzeel M , et al . Multiple phenotypes in phosphoglucomutase 1 deficiency. N Engl J Med. 2014;370 (6 ):533-542. 10.1056/NEJMoa1206605 24499211\n11 Abecasis GR Cherny SS Cookson WO Cardon LR . Merlin–rapid analysis of dense genetic maps using sparse gene flow trees. Nat Genet. 2002;30 (1 ):97-101. doi:10.1038/ng786 11731797\n12 Ye J Coulouris G Zaretskaya I Cutcutache I Rozen S Madden TL . Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13 :134. doi:10.1186/1471-2105-13-134 22708584\n13 Choi Y Sims GE Murphy S Miller JR Chan AP . Predicting the functional effect of amino acid substitutions and indels. PLOS One. 2012;7 (10):e46688,1-13. doi:10.1371/journal.pone.0046688\n14 Landrum MJ Lee JM Benson M , et al. Clinvar: improving access to variant interpretations and supporting evidence. Nucleic Acids Res. 2018;46 (D1 ):D1062-D1067. doi:10.1093/nar/gkx1153 29165669\n15 Sim NL Kumar P Hu J Henikoff S Schneider G Ng PC . SIFT Web server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res. 2012;40 (Web Server issue ):W452-W457. doi:10.1093/nar/gks539 22689647\n16 Schwarz JM Rodelsperger C Schuelke M Seelow D . Mutationtaster evaluates disease-causing potential of sequence alterations. Nat Methods. 2010;8 :575-576.\n17 Zhang Y Zhang L Zhou S . Developmental regression and epilepsy of infancy with migrating focal seizures caused by TBCD mutation: a case report and review of the literature. Neuropediatrics. 2020;51 (1 ):68-71. doi:10.1055/s-0039-1698423 31569255\n18 Elmas M Yıldız H Erdoğan M Gogus B Avcı K Solak M . Comparison of clinical parameters with whole exome sequencing analysis results of autosomal recessive patients; a center experience. Mol Biol Rep. 2019;1 :287-299.\n19 Tian D Rizwan K Liu Y , et al. Biallelic pathogenic variants in TBCD-related neurodevelopment disease with mild clinical features. Neurol Sci. 2019;40 (11 ):2325-2331. doi:10.1007/s10072-019-03979-0 31240573\n20 Di Bella D Magri S Benzoni C , et al. Hypomyelinating leukodystrophies in adults: clinical and genetic features. Eur J Neurol. 2020;28 (3 ):934-944. 10.1111/ene.14646 33190326\n21 Isik E Yilmaz S Atik T , et al. The utility of whole exome sequencing for identification of the molecular etiology in autosomal recessive developmental and epileptic encephalopathies. Neurol Sci. 2020;41 (12 ):3729-3739. doi:10.1007/s10072-020-04619-8 32705489\n22 Stephen J Nampoothiri S Vinayan KP , et al. Cortical atrophy and hypofibrinogenemia due to FGG and TBCD mutations in a single family: a case report. BMC Med Genet. 2018;19 (1 ):80. doi:10.1186/s12881-018-0597-6 29769041\n23 Gronborg S Risom L Ek J , et al. A Faroese founder variant in TBCD causes early onset, progressive encephalopathy with a homogenous clinical course. Eur J Hum Genet. 2018;26 (10 ):1512-1520. doi:10.1038/s41431-018-0204-5 29921875\n24 Ikeda T Nakahara A Nagano R , et al. TBCD may be a causal gene in progressive neurodegenerative encephalopathy with atypical infantile spinal muscular atrophy. J Hum Genet. 2017;4 :473-480.\n25 Pode-Shakked B Barash H Ziv L , et al. Microcephaly, intractable seizures and developmental delay caused by biallelic variants in TBCD: further delineation of a new chaperone-mediated tubulinopathy. Clin Genet. May 2017;91 (5 ):725-738. doi:10.1111/cge.12914 27807845\n26 Edvardson S Tian G Cullen H , et al. Infantile neurodegenerative disorder associated with mutations in TBCD, an essential gene in the tubulin heterodimer assembly pathway. Hum Mol Genet. 2016;25 (2 ):4635-4648. 10.1093/hmg/ddw292 28158450\n27 Abal M Andreu JM Barasoain I . Taxanes: microtubule and centrosome targets, and cell cycle dependent mechanisms of action. Curr Cancer Drug Targets. 2003;3 (3 ):193-203. doi:10.2174/1568009033481967 12769688\n28 Rowinsky EK Eisenhauer EA Chaudhry V Arbuck SG Donehower RC . Clinical toxicities encountered with paclitaxel (taxol). Semin Oncol. 1993;20 (4 Suppl 3 ):1-15.\n29 Roosing S Cremers FPM Riemslag FCC , et al. A rare form of retinal dystrophy caused by hypomorphic nonsense mutations in CEP290. Genes. 2017;8 (8 ).\n30 Matthijs G Souche E Alders M , et al. Guidelines for diagnostic next-generation sequencing. Eur J Hum Genet. 2016;24 (1 ):2-5. doi:10.1038/ejhg.2015.226 26508566\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2329-048X",
"issue": "8()",
"journal": "Child neurology open",
"keywords": "TBCD deficiency; ketogenic diet; neutropenia; tubulin; whole exome sequencing",
"medline_ta": "Child Neurol Open",
"mesh_terms": null,
"nlm_unique_id": "101691975",
"other_id": null,
"pages": "2329048X211034969",
"pmc": null,
"pmid": "34423067",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "27928163;17709011;30426380;23056405;28829391;28126905;29165669;29769041;18171676;28158450;27807845;10831612;8102012;31569255;12769688;24499211;27666370;20676075;22689647;27666374;11731797;24563812;8524390;22708584;9630229;29921875;33190326;31240573;26508566;32705489",
"title": "Tubulin Folding Cofactor D Deficiency: Missing the Diagnosis With Whole Exome Sequencing.",
"title_normalized": "tubulin folding cofactor d deficiency missing the diagnosis with whole exome sequencing"
} | [
{
"companynumb": "DE-UCBSA-2021049759",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "3",
... |
{
"abstract": "Chloramphenicol, a broad-spectrum antibiotic, is rarely used in the United States due to its well-described adverse effects. Because of its limited use, many clinicians are unfamiliar with its indications, spectrum of activity, and potential adverse drug effects. We describe a 12-year-old patient who presented after two craniotomies for a persistent brain abscess complicated by long-term chloramphenicol administration. Findings for this patient were consistent with many of the adverse drug effects associated with chloramphenicol, including elevated chloramphenicol serum concentrations, anemia, thrombocytopenia, reticulocytopenia, and severe metabolic acidosis. Rare manifestations of chloramphenicol toxicity that developed in this patient included neutropenia, visual field changes, and peripheral neuropathy. Chloramphenicol administration was discontinued, and hemodialysis was initiated for severe metabolic acidosis. The patient recovered with severe visual field deficits. Although chloramphenicol is rarely indicated, it remains an effective antibiotic. Healthcare providers should become familiar with the pharmacology, toxicology, and monitoring parameters for appropriate use of this antibiotic.",
"affiliations": "Department of Clinical Pharmacy and Outcomes Sciences, South Carolina College of Pharmacy, Medical University of South Carolina, Charleston, South Carolina.",
"authors": "Wiest|Donald B|DB|;Cochran|Joel B|JB|;Tecklenburg|Fred W|FW|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.5863/1551-6776-17.2.182",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1551-6776",
"issue": "17(2)",
"journal": "The journal of pediatric pharmacology and therapeutics : JPPT : the official journal of PPAG",
"keywords": "adverse drug effect; brain abscess; chloramphenicol; drug toxicity",
"medline_ta": "J Pediatr Pharmacol Ther",
"mesh_terms": null,
"nlm_unique_id": "101089851",
"other_id": null,
"pages": "182-8",
"pmc": null,
"pmid": "23118672",
"pubdate": "2012-04",
"publication_types": "D002363:Case Reports",
"references": "4954932;17737966;14576103;14790529;6886919;13649107;4577646;13034486;13843700;15398218;3380586;13806261;20840682;1242145;423057;3895607;387936;20739919;7229771;14284981;21121777;5416851;6338466;1736269;12905133;7417077;6792681;4825630;6375931;3554126;13762638;10427468;1503664;38742;6416440;3950830;13679531;6970918;5007558;4914780;6047242;20008037",
"title": "Chloramphenicol toxicity revisited: a 12-year-old patient with a brain abscess.",
"title_normalized": "chloramphenicol toxicity revisited a 12 year old patient with a brain abscess"
} | [
{
"companynumb": "US-PFIZER INC-2012281071",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nThe objective of this study is to provide an epidemiologic analysis of medication errors occurring outside of health care facilities that result in serious medical outcomes (defined by the National Poison Database System as \"moderate effect,\" \"major effect,\" \"death,\" or \"death, indirect report\").\n\n\nMETHODS\nNational Poison Database System data from 2000 through 2012 were used for this retrospective analysis of non-health care facility medication errors.\n\n\nRESULTS\nFrom 2000 through 2012, Poison Control Centers in the United States received data on 67,603 exposures related to unintentional therapeutic pharmaceutical errors that occurred outside of health care facilities that resulted in serious medical outcomes. The overall average rate of these medication errors was 1.73 per 100,000 population, and there was a 100.0% rate increase during the 13-year study period. Medication error frequency and rates increased for all age groups except children younger than 6 years of age. Medical outcome was most commonly reported as moderate effect (93.5%), followed by major effect (5.8%) and death (0.6%). Common types of medication errors included incorrect dose, taking or administering the wrong medication, and inadvertently taking the medication twice. The medication categories most frequently associated with serious outcomes were cardiovascular drugs (20.6%) (primarily beta blockers, calcium antagonists, and clonidine), analgesics (12.0%) (most often opioids and acetaminophen, alone and combination products), and hormones/hormone antagonists (11.0%) (in particular, insulin, and sulfonylurea).\n\n\nCONCLUSIONS\nThis study analyzed non-health care facility medication errors resulting in serious medical outcomes. The rate of non-health care facility medication errors resulting in serious medical outcomes is increasing, and additional efforts are needed to prevent these errors.",
"affiliations": "a Center for Injury Research and Policy at The Research Institute of Nationwide Children's Hospital , Columbus , OH , USA.;b Central Ohio Poison Center , Columbus , OH , USA.;a Center for Injury Research and Policy at The Research Institute of Nationwide Children's Hospital , Columbus , OH , USA.;a Center for Injury Research and Policy at The Research Institute of Nationwide Children's Hospital , Columbus , OH , USA.;a Center for Injury Research and Policy at The Research Institute of Nationwide Children's Hospital , Columbus , OH , USA.",
"authors": "Hodges|Nichole L|NL|http://orcid.org/0000-0003-2618-6440;Spiller|Henry A|HA|;Casavant|Marcel J|MJ|;Chounthirath|Thiphalak|T|;Smith|Gary A|GA|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/15563650.2017.1337908",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-3650",
"issue": "56(1)",
"journal": "Clinical toxicology (Philadelphia, Pa.)",
"keywords": "Medication error; NPDS; Poison Control Center; poisoning",
"medline_ta": "Clin Toxicol (Phila)",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D002648:Child; D002675:Child, Preschool; D005260:Female; D006801:Humans; D008297:Male; D008508:Medication Errors; D011039:Poison Control Centers; D012189:Retrospective Studies; D055815:Young Adult",
"nlm_unique_id": "101241654",
"other_id": null,
"pages": "43-50",
"pmc": null,
"pmid": "28691871",
"pubdate": "2018-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Non-health care facility medication errors resulting in serious medical outcomes.",
"title_normalized": "non health care facility medication errors resulting in serious medical outcomes"
} | [
{
"companynumb": "US-JNJFOC-20170720922",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": "3",
... |
{
"abstract": "Nivolumab is an anti-PD1 immune checkpoint inhibitor commonly used for the treatment of solid organ and hematological malignancies. Severe infusion reaction due to nivolumab is quite rare.\n\n\n\nWe report a case of severe infusion reaction due to nivolumab necessitating ICU admission and withdrawal of further nivolumab use in a patient with metastatic non-small cell lung cancer.\n\n\n\nOur knowledge and expertise with the use of immune checkpoint inhibitors are still evolving. This report highlights one of the rare possible side-effects that clinicians and patients may have to face with increasing indications and use of nivolumab in day to day practice.",
"affiliations": "Medical Oncology Department, Nepean Hospital Cancer Care Centre, Kingswood, New South Wales, Australia.;Clinical Immunology and Allergy, Nepean Hospital, Kingswood, New South Wales, Australia.;Intensive Care Unit, Nepean Hospital, Kingswood, New South Wales, Australia.;Medical Oncology Department, Nepean Hospital Cancer Care Centre, Kingswood, New South Wales, Australia.",
"authors": "Kumari|Seema|S|0000-0002-4393-9064;Yun|James|J|;Soares|James R|JR|;Ding|Pei N|PN|",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000077594:Nivolumab",
"country": "United States",
"delete": false,
"doi": "10.1002/cnr2.1246",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2573-8348",
"issue": "3(3)",
"journal": "Cancer reports (Hoboken, N.J.)",
"keywords": "immunotherapy; infusion reaction; nivolumab",
"medline_ta": "Cancer Rep (Hoboken)",
"mesh_terms": "D000074322:Antineoplastic Agents, Immunological; D002289:Carcinoma, Non-Small-Cell Lung; D064420:Drug-Related Side Effects and Adverse Reactions; D006801:Humans; D007262:Infusions, Intravenous; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D000077594:Nivolumab; D011379:Prognosis",
"nlm_unique_id": "101747728",
"other_id": null,
"pages": "e1246",
"pmc": null,
"pmid": "32671983",
"pubdate": "2020-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "32671983;28284782;29907163;20609855;26922661;28845909;28544595;31612928",
"title": "Severe infusion reaction due to nivolumab: A case report.",
"title_normalized": "severe infusion reaction due to nivolumab a case report"
} | [
{
"companynumb": "AU-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-044652",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NIVOLUMAB"
},
"drugaddi... |
{
"abstract": "Activated PI3K delta syndrome (APDS) belongs to the heterogeneous group of primary immunodeficiency disorders (PIDs). Progress in next-generation sequencing (NGS) enabled identification of gain-of-function mutations in phosphoinositide 3-kinase (PI3K) genes. Depending on the type of causative mutation, APDS is classified into two types: APDS 1 and APDS 2. To date, less than 100 cases of APDS have been reported. Clinical symptoms of APDS result from impaired immune regulation and are clinically manifested by recurrent infections, allergies, lymphoproliferation and autoimmunity. They show similarity to other PIDs. Therefore, many patients were diagnosed incorrectly. The availability of genetic testing has allowed establishing the correct diagnosis in increasing number of patients suffering from APDS.\nThe first male patient presented in infancy with recurrent infections. Subsequently he was found to suffer from hepatosplenomegaly, early portal hypertension, massive lymphoproliferation and hypogammaglobulinemia. The common E1021K mutation in the PI3KCD gene was identified. The patient underwent successful hematopoietic stem cell transplantation with resolution of most symptoms. The second patient suffered from persistent growth retardation since early life, facial dysmorphism and recurrent respiratory infections from early childhood. He was found to have systemic lympho-proliferation, panhypoglobulinemia and impaired antibody responses to vaccines. The introduction of NGS in Poland enabled rapid identification of a mutation in the PI3KR1 gene. Growth hormone administration seemed to have worsened the lymphoproliferation.\nPatients with suspected common variable immunodeficiency (CVID) and additional symptoms, such as allergy, facial dysmorphia, short stature, enhanced lymphoproliferation and lack of adequate response to human immunoglobulin replacement therapy, should be considered for NGS-based genetic testing. It may substantially shorten the time needed to establish the correct diagnosis, direct appropriate treatment and avoid potentially harmful therapies. To date, few cases of APDS have been described. It is important to report each of them to establish clinical indices and laboratory biomarkers of APDS 1 and APDS 2, to develop the standards of care in these conditions.",
"affiliations": "1Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Jagiellońska 13, 85-067 Bydgoszcz, Poland.;2Department of Paediatrics, Hematology and Oncology, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Curie Skłodowskiej 9, 85-092 Bydgoszcz, Poland.;1Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Jagiellońska 13, 85-067 Bydgoszcz, Poland.;2Department of Paediatrics, Hematology and Oncology, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Curie Skłodowskiej 9, 85-092 Bydgoszcz, Poland.;3Department of Paediatrics, Oncology, Hematology and Diabetology, Medical University of Łódź, Al. Kościuszki 4, 90-419 Łódź, Poland.;2Department of Paediatrics, Hematology and Oncology, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Curie Skłodowskiej 9, 85-092 Bydgoszcz, Poland.;2Department of Paediatrics, Hematology and Oncology, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Curie Skłodowskiej 9, 85-092 Bydgoszcz, Poland.",
"authors": "Ewertowska|Marlena|M|;Grześk|Elżbieta|E|;Urbańczyk|Anna|A|;Dąbrowska|Anna|A|;Bąbol-Pokora|Katarzyna|K|;Łęcka|Monika|M|;Kołtan|Sylwia|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s13223-020-00420-6",
"fulltext": "\n==== Front\nAllergy Asthma Clin Immunol\nAllergy Asthma Clin Immunol\nAllergy, Asthma, and Clinical Immunology : Official Journal of the Canadian Society of Allergy and Clinical Immunology\n1710-1484 1710-1492 BioMed Central London \n\n420\n10.1186/s13223-020-00420-6\nCase Report\nActivated phosphoinositide 3-kinase delta syndrome 1 and 2 (APDS 1 and APDS 2): similarities and differences based on clinical presentation in two boys\nEwertowska Marlena 12 Grześk Elżbieta 2 Urbańczyk Anna 12 Dąbrowska Anna 2 Bąbol-Pokora Katarzyna 3 Łęcka Monika 2 Kołtan Sylwia s.koltan@cm.umk.pl 2 1 grid.5374.50000 0001 0943 6490Faculty of Medicine, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Jagiellońska 13, 85-067 Bydgoszcz, Poland \n2 grid.5374.50000 0001 0943 6490Department of Paediatrics, Hematology and Oncology, Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Toruń, Curie Skłodowskiej 9, 85-092 Bydgoszcz, Poland \n3 grid.8267.b0000 0001 2165 3025Department of Paediatrics, Oncology, Hematology and Diabetology, Medical University of Łódź, Al. Kościuszki 4, 90-419 Łódź, Poland \n1 4 2020 \n1 4 2020 \n2020 \n16 2231 7 2019 23 3 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nActivated PI3K delta syndrome (APDS) belongs to the heterogeneous group of primary immunodeficiency disorders (PIDs). Progress in next-generation sequencing (NGS) enabled identification of gain-of-function mutations in phosphoinositide 3-kinase (PI3K) genes. Depending on the type of causative mutation, APDS is classified into two types: APDS 1 and APDS 2. To date, less than 100 cases of APDS have been reported. Clinical symptoms of APDS result from impaired immune regulation and are clinically manifested by recurrent infections, allergies, lymphoproliferation and autoimmunity. They show similarity to other PIDs. Therefore, many patients were diagnosed incorrectly. The availability of genetic testing has allowed establishing the correct diagnosis in increasing number of patients suffering from APDS.\n\nCase presentations\nThe first male patient presented in infancy with recurrent infections. Subsequently he was found to suffer from hepatosplenomegaly, early portal hypertension, massive lymphoproliferation and hypogammaglobulinemia. The common E1021K mutation in the PI3KCD gene was identified. The patient underwent successful hematopoietic stem cell transplantation with resolution of most symptoms. The second patient suffered from persistent growth retardation since early life, facial dysmorphism and recurrent respiratory infections from early childhood. He was found to have systemic lympho-proliferation, panhypoglobulinemia and impaired antibody responses to vaccines. The introduction of NGS in Poland enabled rapid identification of a mutation in the PI3KR1 gene. Growth hormone administration seemed to have worsened the lymphoproliferation.\n\nConclusions\nPatients with suspected common variable immunodeficiency (CVID) and additional symptoms, such as allergy, facial dysmorphia, short stature, enhanced lymphoproliferation and lack of adequate response to human immunoglobulin replacement therapy, should be considered for NGS-based genetic testing. It may substantially shorten the time needed to establish the correct diagnosis, direct appropriate treatment and avoid potentially harmful therapies. To date, few cases of APDS have been described. It is important to report each of them to establish clinical indices and laboratory biomarkers of APDS 1 and APDS 2, to develop the standards of care in these conditions.\n\nKeywords\nPI3KδPrimary immunodeficiencyAPDSHyper IgMGrowth hormoneGenetic testingissue-copyright-statement© The Author(s) 2020\n==== Body\nBackground\nPrimary immunodeficiency disorders (PIDs) are a group of immune system diseases, many of them caused by genetic defects [1, 2].\n\nPhosphoinositide 3-kinases (PI3Ks) are the family of enzymes expressed in various classes of cells and involved in signal transduction via a few main pathways. Class I PI3Ks are expressed in leukocytes and catalyze the synthesis of a second messenger, phosphatidylinositol 3,4,5-triphosphate (PIP3). PI3Ks are heterodimers composed of a catalytic and regulatory unit [3, 4].\n\nAPDS is a consequence of a gain-of-function (activating) mutation. APDS was first described in 2014 in a small group of patients with PID of unknown etiology [1, 5]. Using next-generation sequencing (NGS), a rare heterozygous mutation of the PI3KCD gene encoding catalytic subunit of the PI3K (PI3Kδ) has been identified. Then, other mutations of the PI3KR1 gene encoding the regulatory subunit (p85α PI3Kδ) have been described. Depending on the literature source, between 47 and 100 new cases of APDS have been reported since then [1, 3]. However, the exact number of patients with this condition is unknown. APDS resulting from mutation of the PI3KCD has been classified as APDS 1, whereas the disease associated with the mutation of the PI3KR1 is referred to as APDS 2 [5].\n\nAPDS is a complex deficiency of cellular and humoral immunity, which explains a heterogeneity of its clinical manifestations. Most patients present with recurrent respiratory infections, such as otitis media, sinusitis and pneumonia (typically with Haemophilus influenzae and Streptococcus pneumoniae as etiological factors), which suggests the presence of an antibody deficiency [1, 3, 6]. Also, viral infections, with herpesvirus simplex (HPV), cytomegalovirus (CMV) and Epstein–Barr virus (EBV) are reported, as well as parasitic and fungal infections, suggesting an impairment of T cell function [1, 3]. According to literature, patients with APDS 1 may also present with gastrointestinal infections [6, 7]. Another clinical manifestation are local and systemic lymphoproliferative disorders and hepatosplenomegaly observed since early childhood [3, 7–9]. Abnormalities in laboratory results include immune cytopenia and altered distribution of lymphocyte subpopulations [1, 5, 7, 8]. Because of the tendency to lymphoproliferation, patients with APDS are at increased risk of neoplastic transformation, mainly to hematologic malignancies [1, 3, 9]. APDS 1 and APDS 2 show some differences in their clinical presentation. Similarities and differences between these two disease entities are summarized in Table 1.Table 1 Clinical characteristics of APDS 1 and APDS 2 reported in the literature and manifestations of these conditions in our patients [1, 3, 5, 7, 11]\n\nManifestation\tAPDS 1\tAPDS 2\t\nTypical symptoms\tSymptoms in the patient 1\tTypical symptoms\tSymptoms in the patient 2\t\nInfectious complications\t\t\n Recurrent respiratory infections\t\n Pneumonia\t+\t+\t+\t+\t\n Bronchitis\t+\t+\t+\t+\t\n Sinusitis\t+\t+\t+\t+\t\n Otitis\t+\t−\t+\t+\t\n Viral infections\t\n HPV\t+\t−\t+\t−\t\n CMV\t+\t+\t+\t−\t\n EBV\t+\t−\t+\t−\t\n Adenovirus\t+\t+\t−\t−\t\n Parasitic and fungal infections\t+\t+\t+\t−\t\n Gastrointestinal infections\t+\t+\t−\t−\t\nNon-infectious complications\t\t\n Lymphadenopathy\t+\t+\t+\t+\t\n Splenomegaly\t+\t+\t+\t−\t\n Hepatomegaly\t+\t+\t+\t−\t\n Nodular lymphoid hyperplasia in the gastrointestinal tract\t+\t+\t+\t−\t\n Signs of facial dysmorphia\t−\t−\t+\t+\t\n Short stature\t−\t−\t+\t+\t\n Intellectual disability\t−\t−\t+\t−\t\n Microcephalia\t−\t−\t+\t−\t\nMutation\t\t\n E1021K\t+\t+\t−\t−\t\n N334K\t+\t−\t−\t−\t\n E525K\t+\t−\t−\t−\t\n C416R\t+\t−\t−\t−\t\n NM_181523\t−\t−\t+\t+\t\nLaboratory abnormalities\t\t\n Lower concentrations of IgG and IgA\t+\t+\t+\t+\t\n Elevated concentration of IgM\t+\t+\t+\t−\t\n Lymphopenia CD19+\t+\t+\t+\t+\t\n Elevated count of T lymphocytes CD8+\t+\t+\t+\t−\t\n Inverted CD4/CD8 ratio\t+\t+\t+\t+\t\n Lower count of naïve T lymphocytes CD4+ (CD4+CD45RA+)\t+\t+\t+\t−\t\n Lower count of naïve T lymphocytes CD8+ (CD8+CD45RA+)\t−\t−\t+\t−\t\nTreatment\t\t\n Immunoglobulin replacement therapy\t+\t+\t+\t+\t\n Immunosuppressive therapy\t+\t−\t+\t−\t\n Allo-HSCT\t+\t+\t+\t−\t\n\n\nIn this paper, we present two boys who had been diagnosed with APDS 1 and APDS 2, respectively. In the first case, the suspicion of aPID has been raised already in early childhood. However, because of limited access to appropriate diagnostic (in particular, genetic) tests, the diagnosis was established only after a few years. In the second case, clinical manifestations suggestive of an immunodeficiency disorder also emerged during early childhood, but PID was considered as a diagnosis only after the end of the first decade of life. As NGS-based testing has been already available in Poland, it took only a few months to establish the final diagnosis.\n\nCase presentation\nCase 1\nThe 13-year-old boy was born at term from an uncomplicated pregnancy (1st pregnancy, 1st delivery). The patient was delivered via cesarean due to the risk of fetal distress, in good general status, with a birthweight of 3900 g and body length of 57 cm. In the family history there was pollen and foot allergy in maternal uncle. Neonatal period was complicated by congenital pneumonia. Beginning at 6 months of age, the boy frequently suffered from recurrent chronic lower respiratory infections. The diagnostic process carried out in an outpatient setting, excluded cystic fibrosis and diagnosed with asthma. Since the neonatal period, the patient presented with periodically exacerbating diarrhea, with a few bowel movements per day. During one episode of the diarrhea exacerbation, Staphylococcus aureus was isolated from the stool culture. Gastrointestinal infection was diagnosed and antibiotic therapy was used. Because of a suspected immune disorder, the boy at the age of 3 was referred to the Department of Pediatrics, Hematology and Oncology for immunological diagnostics. Physical examination demonstrated pallor of the skin, hypertrophic palatine tonsils (type 4 in Pirquet classification), hepatomegaly (the largest dimension was 13 cm) and splenomegaly (the largest dimension was 11 cm) (Table 1). Abnormalities in laboratory results included hypochromic anemia with a normal concentration of ferritin, hypogammaglobulinemia, a titer of anti-HBs antibodies were 1.0 mIU/ml, a titer of CMV-IgG was < 0.2 IU/ml and concentration of isohemagglutinins was 1. Analysis of lymphocyte subpopulations showed a decrease in the percentages and absolute counts of B lymphocytes and T-helper cells, along with an increase in the proportion and absolute count of T-cytotoxic lymphocytes. The population of T-helper lymphocytes contained smaller than normal percentage of naive cells and normal proportion of memory cells, whereas a slight increase in the proportion of naive cells and considerably elevated percentage of memory cells was observed in the population of T-cytotoxic lymphocytes, which could reflect the frequent infections that the patient had [1]. The results of laboratory tests are summarized in Table 2. The boy was qualified for immunoglobulin replacement therapy. Because of concomitant anemia and hepatosplenomegaly, doppler flow in liver vessels were examined to exclude potential thromboembolism. Normal flow through the portal vein was observed at a speed of 22–25 cm/s. Moreover, the patient underwent gastroscopy, which revealed the signs of chronic gastro-duodenitis and dilated venous vessels of the fundus and significant unevenness of the gastric and duodenal mucosa, suggestive of early portal hypertension. Furthermore, Helicobacter pylori infection was diagnosed based on histopathological examination of gastrointestinal biopsy specimens.Table 2 Results of laboratory tests in the hereby reported patients\n\nLaboratory parameter\tCase 1b\tAge-specific norma\tCase 2c\tAge-specific norma\t\nLeukocyte count\t5.14 K/µl\t5–15 K/µl\t6.48 K/µl\t5–13 K/µl\t\nNeutrophil count\t3.23 K/µl\t1.5–8 K/µl\t3.04 K/µl\t2–8 K/µl\t\nHemoglobin concentration\t8.8 g/dl ↓↓\t11.5–14.0 g/dl\t13.0 g/dl\t11.5–15.5 g/dl\t\nPlatelet count\t145 K/µl\t100–490 K/µl\t373 K/µl\t100–450 K/µl\t\nIgG concentration\t<1.56 g/l ↓↓↓\t4.28–12.3 g/l\t2.0 g/l ↓↓↓\t8.5–13.0 g/l\t\nIgA concentration\t0.33 g/l ↓↓\t1.08–2.43 g/l\t<0.06 g/l ↓↓↓\t0.91–2.55 g/l\t\nIgM concentration\t2.3 g/l\t0.3–1.12 g/l\t0.27 g/l ↓↓↓\t0.66–1.55 g/l\t\nB lymphocytes (CD 19+)\t63/µl (4.72%) ↓↓↓\t400–1700/µl\t164/µl (5.4%) ↓↓\t200–600/µl\t\nT lymphocytes (CD 3+)\t1515/µl (78.9%) ↓↓\t2120–2830/µl\t2202/µl (72.5%)\t800–3500/µl\t\nT-helper lymphocytes (CD3+CD4+)\t207/µl (15.32%) ↓↓\t640–1560/µl\t777/µl (25.5%)\t400–2100/µl\t\nT-helper memory lymphocytes (CD3+CD4+CD45RO+)\t13.88% (186/µl)\t8.7–25.9%\t4.5% (137/µl) ↓↓↓\t27.2–62.0%\t\nNaïve T-helper lymphocytes (CD3+CD4+CD45RA+)\t2.35% (31/µl) ↓↓↓\t13.3–37.8%\t61.1% (1861/µl)\t31.1–66.3%\t\nT-cytotoxic lymphocytes (CD3+CD8+)\t680/µl (50.47%) ↑\t200–630/µl\t1075/µl (35.3%)\t200–1200/µl\t\nT-cytotoxic memory lymphocytes (CD3+CD8+CD45RO+)\t46.18% (622/µl) ↑↑\t3.9–20.2%\t54.8% (1669/µl) ↑↑\t15.9–46.4%\t\nNaïve T-cytotoxic lymphocytes (CD3+CD8+CD45RA+)\t24.9% (336/µl) ↑\t6.9–22%\t16.6% (506/µl) ↓↓\t44.1–77.1%\t\naDifferences in normal ranges reflect different age of patients at the time of laboratory testing\n\nbLaboratory test was performed on the patient aged 3 years\n\ncLaboratory test was performed on the patient aged 10 years\n\n\n\nThe clinical presentation raised suspicion of congenital immunodeficiency disorder. Differential diagnoses included hyper IgM syndrome, X-linked lymphoproliferative disease (XLP) and CVID, but the true cause of ailments has not been established at this timepoint. During subsequent years, the boy experienced massive hemorrhagic esophagitis with fungal superinfection, was diagnosed with chronic colorectal inflammation, chronic sinusitis and bronchitis, and showed the signs of gradually progressing lymphoproliferation (Fig. 1). Six years after the initial referral, the patient was eventually diagnosed with APDS 1 based on the result of NGS carried out abroad. The E1012K mutation was found in the PI3KCD [7]. The patient’s family has not been tested for the above mutation. Because of the unfavorable phenotype of the disease (massive lymphoproliferation with the risk of neoplastic transformation, respiratory infections resistant to immunoglobulin replacement therapy, adenoviral infections, cytomegaly and poor overall quality of life), the boy was qualified for allogenic hematopoietic stem cell transplantation (allo-HSCT) from his histocompatible healthy brother. In line with the EBMT/ESID guidelines for hematopoietic cell transplantation for primary immunodeficiencies, a less toxic conditioning regimen was used, with intravenous busulfan (2.8 mg/kg daily for 4 days), fludarabine (45 mg/m2 daily for 4 days) and anti-lymphocyte globulin (8 mg/kg per 3 days for 4 days). Currently, 5 years after the allo-HSCT, the boy presents with full donor chimerism, shows no signs of active graft versus host reaction and complete immunological reconstitution. The pathological non-neoplastic lymphoproliferation has resolved completely, and the boy does not require immunoglobulin replacement therapy. After the allo-HSCT, the patient underwent complete revaccination. The only health problem present in the boy currently is chronic paranasal sinusitis.Fig. 1 High-resolution computed tomography scan documenting severe lymphoproliferation within mediastinal lymph nodes of the 8-years-old boy with APDS 1\n\n\n\nCase 2\nThe second patient was an 11-year-old boy with a remarkable family history (mother after anti-lymphoma treatment and nephrectomy). The boy was born at term from an uncomplicated pregnancy (4th pregnancy, 2nd delivery). The patient was delivered via cesarean due to the post-nephrectomy status of his mother, in good general status, with a birthweight of 3300 g and body length of 55 cm. During the neonatal period, the boy presented with muscle tone abnormalities, which resolved after rehabilitation. Since the beginning of this life, the patient showed the signs of a growth disorder; differential diagnoses included abnormal thyroid function, hypoparathyroidism, adrenal insufficiency, celiac disease and Silver-Russel syndrome, but all these conditions were eventually excluded. Beginning in early childhood, the boy suffered from recurrent respiratory infections, primarily bronchitis and pneumonia. At 9 years of age, the patient experienced multiple episodes of recurrent upper respiratory infections, including sinusitis and otitis media, along with a few episodes of bronchitis. Analysis of immunoglobulin levels conducted in an outpatient setting revealed extremely low concentrations of IgA, IgM and IgG. The boy was referred to the Department of Pediatrics, Hematology and Oncology for further immunological diagnostics. Physical examination demonstrated deficits of body weight and height (below the 3rd percentile for age and sex), signs of facial dysmorphia (triangular face with disproportionally large neurocranium, hypertelorism, downward slanting eyes, broad nasal root, low set ears), geographic tongue and prominent papillae of the tongue’s base. Analysis of lymphocyte subpopulations demonstrated a decrease in the percentage and absolute count of B cells, with profound disorders in the distribution of CD3+CD4+CD45RO+ (memory) lymphocytes (decreased proportion with normal proportion of naïve, CD3+CD4+CD45RA+cells) and T lymphocytes CD8+ (a significant increase in the proportion of memory cells, with a decrease in the proportion of naïve cells) (Table 2). Testing of humoral immunity confirmed complete inability to synthesize specific antibodies. Ultrasonography of lymph nodes showed systemic lymphoproliferation with a reactive phenotype. The results raised suspicion of a CVID. Another potential diagnosis was a genetic syndrome associated with PID, the deficit of growth and facial dysmorphia. The patient was qualified for NGS-based testing, which demonstrated a mutation in the PI3KR1 gene (NM_181523.2); the result was later confirmed by means of direct sequencing. The patient’s family has not been tested for the above mutation. The final diagnosis of APDS 2 was established 9 months after an initial suspicion of an immunodeficiency disorder has been raised.\n\nCurrently, the boy is on subcutaneous immunoglobulin replacement therapy, which contributed to a significant reduction of the incidence of opportunistic infections and a decrease in lymphoproliferation severity. Since the patient presented with height deficit, his parents arranged and funded growth hormone therapy at a private clinic despite a written opinion from the immunologist about questionable effectiveness of such treatment in a child with APDS 2 [10]. The treatment was discontinued after a year: the boy gained 2 cm in height, but the implementation of the hormonal therapy co-existed with a substantial exacerbation of the systemic lymphoproliferative process. Furthermore, hyperplastic lingual papillae caused difficulty breathing that led to acute respiratory failure. The boy required Intensive Care Unit stay, intubation and respiratory support. The hyperplastic papillae of the tongue’s base had to be removed surgically. Histopathological examination of the surgical specimens confirmed massive benign lymphocytic infiltration. After discontinuation of the growth hormone therapy, the size of lymph nodes in all locations decreased considerably, and according to the boy’s parents, his quality of life returned to the pretreatment level (Table 1).\n\nDiscussion and conclusions\nThe growing availability of NGS-based testing facilitated detection of rare monogenic disorders. Both our patients presented with recurrent respiratory infections and lymphoproliferation. The boy with APDS 1 also had a history of gastrointestinal infections of both viral and bacterial etiology and hepatosplenomegaly. According to sparse published reports, patients with APDS 2 may present with growth deficits, facial dysmorphia, intellectual disability and microcephalia [1, 3, 10]. These clinical features can be used to distinguish APDS 2 from APDS 1, as to this date, they have not been reported in patients with the latter condition. Our patient with APDS 2 presented with facial dysmorphia and growth deficit, which is consistent with the previously published reports [3, 10]. A laboratory finding in APDS patients is impaired antibody production, primarily the deficiency of immunoglobulins G and A, with a concomitant increase in IgM level. While the first of our patients showed this pattern of alterations in immunoglobulin levels, the boy with APDS 2 presented with a severe deficiency of immunoglobulins in all main classes. Other laboratory abnormalities observed in APDS include a decrease in absolute count of B lymphocytes and naïve T lymphocytes, both cytotoxic (CD3+CD4+) and helper (CD3+CD8+) cells [1, 3, 11].\n\nMost patients with APDS reported in literature received human immunoglobulin replacement therapy since early childhood to reduce the incidence of opportunistic infections [6, 7]. Some authors used rapamycin in patients with APDS 1 and APDS 2 and reported beneficial effects of the treatment in the form of lesser incidence of opportunistic infections, resolution of lymphoproliferative process and hepatosplenomegaly [6, 8]. Although long-term treatment with rapamycin may be highly beneficial in patients with APDS 2, it is also associated with the risk of adverse events outside the immune system [8]. In patients with severe APDS, especially those with enhanced lymphoproliferation and profound lymphocyte dysfunction, allo-HSCT seems to be a therapeutic option, considering the potential risk of neoplastic transformation [6, 8, 12, 13]. We have implemented immunoglobulin replacement therapy in both our patients. In the boy with APDS 1, the treatment did not contribute to a substantial improvement of clinical status. Conversely, despite the treatment, the patient presented with recurrent bacterial and viral infections and progressive lymphoproliferation and hepatosplenomegaly. Considering the severity of APDS 1, the patient eventually received allo-HSCT from a histocompatible family donor with a good clinical effect. This confirms the appropriateness of such an approach in patients with particularly severe APDS.\n\nIn the second patient, the boy with APDS 2, immunoglobulin replacement therapy contributed to a considerable decrease in the incidence of respiratory infections and resolution of lymphoproliferation. As the boy presented with a growth deficit, he also received growth hormone therapy. The treatment has been implemented against the immunologist’s suggestion based on sparse published evidence that APDS 2 may be associated with resistance to growth hormone [3, 10]. The therapy has been discontinued after a year due to its poor clinical effect and a substantial increase in lymphoproliferative activity, the onset of which co-existed with the implementation of the treatment.\n\nAvailable evidence suggests that mutation of the PI3KR1 gene may have an oncogenic potential. Somatic mutations of the PI3KR1 have been found in patients with Burkitt lymphoma, endometrial cancer, colorectal cancer, ovarian cancer, gastric cancer and malignant melanoma, which points to likely oncogenic potential of this genetic defect [8]. Therefore, the presence of a severe lymphoproliferative process in our patient with APDS 2 raised an oncological alert. However, after discontinuation of growth hormone therapy, we observed a substantial decrease in lymph node size in all locations, which might confirm a link between lymphoproliferation and the hormonal treatment. Moreover, our experiences are consistent with a sparse published data on resistance to growth hormone in APDS 2 patients. Our observations suggest that treatment with this hormone is not only ineffective but may even pose a threat to the patient (respiratory failure).\n\nTo summarize, patients with suspected APDS should undergo genetic testing as it may substantially shorten the time needed to establish the correct diagnosis. Patients with suspected CVID and additional symptoms, such as intellectual disability, facial dysmorphia, allergy, short stature, enhanced lymphoproliferation and lack of adequate response to human immunoglobulin replacement therapy, should be qualified for NGS-based genetic testing. Unfortunately, the availability and financing of NGS in Poland is still limited. Due to these difficulties, future studies should define clinical indices and laboratory biomarkers of APDS 1 and APDS 2, to develop the standards of care in these conditions.\n\nAbbreviations\nAPDSActivated phosphoinositide 3-kinase delta syndrome\n\nPIDPrimary immunodeficiency disorder\n\nNGSNext-generation sequencing\n\nEBVEpstein–Barr virus\n\nCMVCytomegalovirus\n\nHSVHerpes simplex virus\n\nVZVVaricella zoster virus\n\nXLPX-linked lymphoproliferative disease\n\nCVIDCommon variable immunodeficiency\n\nallo-HSCTAllogenic hematopoietic stem cell transplantation\n\nHRCTHigh-resolution computed tomography\n\nCIDCombinated immunodeficiency\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nSK designed the study, supervised the study process and critically analyzed the manuscript for important intellectual content. ME reviewed the literature and drafted the manuscript. EG, AD and AU reviewed the literature and assisted in drafting the manuscript. MŁ drafted the abstract and reviewed and revised the manuscript. KB conducted genetic tests in the study patients and reviewed the manuscript. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work. All authors read and approved the final manuscript.\n\nFunding\nNo external funding.\n\nAvailability of data and materials\nNot applicable.\n\nEthics approval and consent to participate\nThe local Research Ethics Board has given permission for publication numer 161/2014. Parents agreed to publish photos.\n\nConsent for publication\nNot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Lucas CL Chandra A Nejentsev S Condliffe A Okkenhaug K PI3Kδ and primary immunodeficiencies Nat Rev Immunol. 2016 16 11 702 714 10.1038/nri.2016.93 27616589 \n2. Kotyla PJ Primary immunodeficiency syndromes—beginning of autoimmunity Forum Reumatologiczne. 2015 1 30 37 \n3. Garcia-Morato MB Garcia-Minaur S Molina Garicano J Santos Simarro F Del Pino Molina L Lopez-Granados E Ferreira Cerdan A Rodriguez Pena R Mutations in PIK3R1 can APDS2, SHORT syndrome or combination of the two Clin Immunol. 2017 179 77 80 10.1016/j.clim.2017.03.004 28302518 \n4. Okkenhaug K Signalling by the phosphoinositide 3-kinase family in immune cells Annu Rev Immunol 2013 31 675 704 10.1146/annurev-immunol-032712-095946 23330955 \n5. Narayan N Hewins P Lane P Rhodes B Activated PI3 kinase delta syndrome: a rare cause of inflammatory disease Rheumatol Adv Pract 2018 10.1093/rap/rky034.010 \n6. Elkaim E Neven B Bruneau J Mitsui-Sekinaka K Stanislas A Heurtier L Clinical and immunologic phenotype associated with activated phosphoinositide 3-kinase δ syndrome 2: a cohort study J Allergy Clin Immun. 2016 138 210 218 10.1016/j.jaci.2016.03.022 27221134 \n7. Coulter TI Chandra A Bacon CM Babar J Curtis J Goodlad JR Clinical spectrum and features of activated phosphoinositide 3-kinase δ syndrome: a large patient cohort study J Allergy Clin Immun. 2017 139 597 606 10.1016/j.jaci.2016.06.021 27555459 \n8. Takeda AJ Zhang Y Dornan GL Siempelkamp BD Jenkins ML Matthews HF Novel PIK3CD mutations affecting N-terminal residues of p110δ cause activated PI3Kδ syndrome (APDS) in humans J Allergy Clin Immun. 2017 140 1152 1155 10.1016/j.jaci.2017.03.026 28414062 \n9. Angulo I Vadas O Garcon F Banham-Hall E Plagnol V Leahy TR Phosphoinositide 3-kinase δ gene mutation predisposes to respiratory infection and airway damage Science 2013 342 866 871 10.1126/science.1243292 24136356 \n10. Alonso G Liberatore D Bernasconi A Rossi J Perez L Pasqualini T Growth hormone insensitivity in a girl with hyper IgM-like syndrome due to mutation in PIK3R1 Horm Res Peadiatr 2016 86 8 \n11. Elgizouli M Lowe DM Speckmann C Schubert D Hulsdunker J Eskandrian Z Activating PI3Kδ mutations in a cohort of 669 patients with primary immunodeficiency Clin Exp Immunol. 2015 183 221 229 10.1111/cei.12706 26437962 \n12. Kuhlen M Honscheid A Loizou L Nabhani S Fischer U Stepensky P De novo PIK3R1 gain-of-function with recurrent sinopulmonary infections, long-lasting chronic CMV-lymphadenitis and microcephaly Clin Immunol. 2016 162 27 30 10.1016/j.clim.2015.10.008 26529633 \n13. Nademi Z Slatter MA Dvorak CC Neven B Fischer A Suarez F Hematopoietic stem cell transplant in patients with activated PI3K delta syndrome J Allergy Clin Immunol. 2017 139 1046 1049 10.1016/j.jaci.2016.09.040 27847301\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1710-1484",
"issue": "16()",
"journal": "Allergy, asthma, and clinical immunology : official journal of the Canadian Society of Allergy and Clinical Immunology",
"keywords": "APDS; Genetic testing; Growth hormone; Hyper IgM; PI3Kδ; Primary immunodeficiency",
"medline_ta": "Allergy Asthma Clin Immunol",
"mesh_terms": null,
"nlm_unique_id": "101244313",
"other_id": null,
"pages": "22",
"pmc": null,
"pmid": "32265996",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "24136356;26437962;23330955;27221134;26529633;28302518;27555459;28414062;27847301;27616589",
"title": "Activated phosphoinositide 3-kinase delta syndrome 1 and 2 (APDS 1 and APDS 2): similarities and differences based on clinical presentation in two boys.",
"title_normalized": "activated phosphoinositide 3 kinase delta syndrome 1 and 2 apds 1 and apds 2 similarities and differences based on clinical presentation in two boys"
} | [
{
"companynumb": "PL-NOVOPROD-724096",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SOMATROPIN"
},
"drugadditional": "1",
"dru... |
{
"abstract": "In this phase I/II trial, BID, bendamustine (70, 80, or 90 mg/m2), ixazomib (4 mg), and dexamethasone (40 mg), was administered to 28 patients with relapsed and/or refractory multiple myeloma (RRMM) exposed to bortezomib and lenalidomide and refractory to at least one. A 3 + 3 dose escalation based on dose-limiting toxicities (DLTs) was employed in phase I (total 15); 2/6 patients developed DLTs (neutropenia and thrombocytopenia) at dose level 3 establishing the recommended phase II dose as bendamustine 80 mg/m2, ixazomib 4 mg, and dexamethasone 40 mg. The median age was 67 years (range, 42-72), and 43% were females. Patients received a median of 4 (range, 4-9) prior lines of therapy, of which ~50% were double refractory. In phase II, total 19 patients were treated. With a median follow-up of 17 months, 11% achieved very good partial response, 50% achieved partial response, and 27% achieved stable disease. Median progression free (PFS) and overall (OS) survival were 5.2 months (95% CI, 1.96-8.3) and 23.2 months (95% CI 16.3-30.07). The most frequent adverse events were anemia, thrombocytopenia, leukopenia, nausea, diarrhea, and infections. Peripheral neuropathy was infrequent. BID is a well-tolerated and effective combination therapy for patients with RRMM.",
"affiliations": "Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA. bdhakal@mcw.edu.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.;Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI, USA.",
"authors": "Dhakal|Binod|B|;D'Souza|Anita|A|;Hamadani|Mehdi|M|;Arce-Lara|Carlos|C|;Schroeder|Katrina|K|;Chhabra|Saurabh|S|;Shah|Nirav N|NN|;Gauger|Katelyn|K|;Keaton|Taylor|T|;Pasquini|Marcelo|M|;Hari|Parameswaran|P|",
"chemical_list": "D001896:Boron Compounds; C548400:ixazomib; D003907:Dexamethasone; D000069461:Bendamustine Hydrochloride; D005998:Glycine",
"country": "United States",
"delete": false,
"doi": "10.1038/s41408-019-0219-3",
"fulltext": "\n==== Front\nBlood Cancer JBlood Cancer JBlood Cancer Journal2044-5385Nature Publishing Group UK London 21910.1038/s41408-019-0219-3ArticlePhase I/II trial of bendamustine, ixazomib, and dexamethasone in relapsed/refractory multiple myeloma Dhakal Binod bdhakal@mcw.edu D’Souza Anita Hamadani Mehdi Arce-Lara Carlos Schroeder Katrina Chhabra Saurabh Shah Nirav N. Gauger Katelyn Keaton Taylor Pasquini Marcelo Hari Parameswaran 0000 0001 2111 8460grid.30760.32Division of Hematology/Oncology, Medical College of Wisconsin, Milwaukee, WI USA 29 7 2019 29 7 2019 8 2019 9 8 5625 3 2019 22 5 2019 © The Author(s) 2019Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.In this phase I/II trial, BID, bendamustine (70, 80, or 90 mg/m2), ixazomib (4 mg), and dexamethasone (40 mg), was administered to 28 patients with relapsed and/or refractory multiple myeloma (RRMM) exposed to bortezomib and lenalidomide and refractory to at least one. A 3 + 3 dose escalation based on dose-limiting toxicities (DLTs) was employed in phase I (total 15); 2/6 patients developed DLTs (neutropenia and thrombocytopenia) at dose level 3 establishing the recommended phase II dose as bendamustine 80 mg/m2, ixazomib 4 mg, and dexamethasone 40 mg. The median age was 67 years (range, 42–72), and 43% were females. Patients received a median of 4 (range, 4–9) prior lines of therapy, of which ~50% were double refractory. In phase II, total 19 patients were treated. With a median follow-up of 17 months, 11% achieved very good partial response, 50% achieved partial response, and 27% achieved stable disease. Median progression free (PFS) and overall (OS) survival were 5.2 months (95% CI, 1.96–8.3) and 23.2 months (95% CI 16.3–30.07). The most frequent adverse events were anemia, thrombocytopenia, leukopenia, nausea, diarrhea, and infections. Peripheral neuropathy was infrequent. BID is a well-tolerated and effective combination therapy for patients with RRMM.\n\nSubject terms\nPhase I trialsPhase II trialshttps://doi.org/10.13039/100011957Takeda Pharmaceutical Company Limited | Takeda Oncologyissue-copyright-statement© The Author(s) 2019\n==== Body\nIntroduction\nWith the introduction of several new classes of drugs, the survival outcomes of patients with multiple myeloma (MM) have improved considerably in the last decade1,2. Despite these effective treatments, the disease invariably relapses after a period, requiring continued intervention for disease control. Identification of new targets and development of novel agents against such targets are extremely important for the discovery of more effective treatments. Bendamustine, a bifunctional alkylator with antimetabolite activity, is an attractive option in MM due to its specific mode of activity, favorable toxicity profile, lack of cross reactivity with other agents, and its preclinical and clinical activity in patients resistant to alkylating agents3–5. In MM, bendamustine has clinical activity, both as a single agent6 and in combination with immunomodulators (ImIDs): thalidomide, lenalidomide, and pomalidomide7–9 or proteasome inhibitors (PI): bortezomib and carfilzomib10,11.\n\nIxazomib is an orally available peptide boronic acid that preferentially binds to the β5 subunit of the 20S proteasome12. Ixazomib has shown clinical activity both as single agent and in combination in newly diagnosed and relapsed/refractory multiple myeloma (RRMM)13–15. Ixazomib is approved in combination with lenalidomide and dexamethasone in treatment of MM patients with 1 prior therapy based on a phase III trial demonstrating improved progression free survival (PFS) compared to the control arm16. Proteasome inhibition has emerged as an important therapeutic strategy in MM; however, risk of peripheral neuropathy associated with bortezomib17 and cardiovascular toxicities18 associated with carfilzomib limit the use of these two major PI for prolonged periods of time among MM patients. Exploring the role of alternative PIs with non-overlapping toxicities like ixazomib is therefore a reasonable strategy for combination triplet regimens. In this phase I/II study, we assessed the safety and efficacy of the combination of bendamustine, ixazomib and dexamethasone (BID) in RRMM patients exposed to bortezomib and lenalidomide and refractory to at least one of the agents.\n\nSubjects and methods\nStudy design\nThis open-label, single-center phase I/II study was designed to assess the safety, tolerability, and efficacy of oral ixazomib combined with bendamustine and dexamethasone when delivered together in a 28-day cycle in patients with relapsed and/or refractory multiple myeloma (RRMM) for a maximum of eight cycles. In the phase I portion three doses of bendamustine 70 mg/m2, 80 mg/m2, and 90 mg/m2 days 1 and 2 were tested in combination with ixazomib 4 mg and dexamethasone 40 mg (20 mg in patients ≥75 years) on days 1, 8, and 15, respectively. In the phase II portion, bendamustine was given at recommended phase II dose (RP2D) along with ixazomib and dexamethasone in the same dose as phase I. All patients were informed of the investigational nature of the study and provided informed consent per institutional and federal guidelines. This study was approved by the Institutional Review Board from the Medical College of Wisconsin and was registered at clinicaltrials.gov (# NCT02477215).\n\nStudy objectives\nThe primary objective of the phase I portion of the study was to determine the RP2D of bendamustine when given in combination with ixazomib and dexamethasone. The primary objectives of the phase II portion were to estimate the overall response rates (ORR) of the three-drug combination. The secondary objectives included the estimation of the duration of response, survival (overall, OS and PFS) and clinical benefit rates (CBR).\n\nDrug administration\nIn the phase I portion of the study, a 3 + 3 design was employed, and dose escalation decisions were based on the dose-limiting toxicities (DLTs) occurring in cycle 1. DLTs were defined as any of the following events that were considered by the investigator to be related to therapy with bendamustine or ixazomib: grade 4 neutropenia or grade 3 neutropenia with fever ≥38.5 °C, grade 4 thrombocytopenia or grade 3 thrombocytopenia with clinically significant bleeding; DLTs also included any grade 3 or greater non-hematologic toxicity including grade ≥3 nausea that occurred despite maximal anti-emetic prophylaxis; diarrhea occurring despite maximal anti-diarrheal agents and delay in starting cycle 2 for >7 days because of lack of adequate recovery of hematologic and non-hematologic drug related toxicities. Anti-viral prophylaxis against herpes zoster was mandatory throughout the study period.\n\nPatients\nInclusion/exclusion criteria\nThe study enrolled patients of 18 years old or older diagnosed with RRMM who had prior exposure to PI (bortezomib and carfilzomib) and ImiDs (thalidomide, lenalidomide, or pomalidomide). Patients also had to be refractory to either of the bortezomib and lenalidomide according to the International Myeloma Working Group (IMWG) definition of refractory disease (progressive disease on or within 60 days of stopping PI or ImIDs). Patients were required to have measurable disease defined as serum monoclonal protein (M-protein) of ≥1 g/dl of IgG or IgM, ≥0.5 g/dl of IgA or IgD, urine M protein ≥200 mg/24 h, or involved serum-free light chain of ≥10 mg/dl, Eastern Cooperative Oncology Group of 0–2 and adequate hematologic (absolute neutrophil count >1000/mm3, platelets ≥75,000 mm3), hepatic (total bilirubin ≤1.5 upper limit of normal, alanine/aspartate aminotransferase ≤3 times the upper limit of normal), and renal (creatinine clearance ≥30 ml/minute) function. Recipients of autologous or allogeneic stem cell transplant were eligible as long as there were no ongoing transplant related side effects.\n\nKey exclusion criteria were grade >2 peripheral neuropathy; gastrointestinal disease or history of procedure that could interfere with the oral absorption of ixazomib; systemic treatment with strong CYP1A2 inhibitors or strong inhibitors/inducers within 14 days before the first dose of ixazomib; evidence of current, uncontrolled cardiovascular conditions; and ongoing/active systemic infection, active hepatitis B or C infection or known HIV positivity. Prior ixazomib was not allowed.\n\nDisease and toxicities assessments\nResponses were assessed using the International Myeloma Working group (IMWG) criteria19. Refractory to either bortezomib or carfilzomib and lenalidomide or pomalidomide was defined as double refractory; refractory to bortezomib, lenalidomide, carfilzomib, and pomalidomide as quadruple refractory and to CD38 antibody was defined as penta refractory. Adverse events (AEs) were monitored throughout the study and were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) v 4.03. The study investigators assessed disease responses.\n\nStatistical analysis\nThe phase I portion of the study was designed to identify doses of bendamustine with ixazomib and dexamethasone that were associated with an acceptable AE profile when delivered together in a 28-day cycle. The primary end point for the phase I was to assess the maximum tolerated dose (MTD). For the phase II portion of this trial, the primary end point was overall response rate (ORR) of the combination. The null hypothesis that the true response rates of <30% with weekly ixazomib and dexamethasone in RRMM13 was tested at 10% one sided significance level with 80% power. The sample size was calculated using a Simon 2-stage design. The six patients treated at the MTD in the phase I portion were also included in the phase II portion for overall sample size estimation. At stage I, 14 patients were enrolled on the study with a plan to continue enrollment if the observed response rate was at least 28.6% (4/14). At stage II, additional five patients (19 total) were to be enrolled and consider the combination “interesting” only if at least 6/19 (35.3%) patients achieved a response. Secondary end points of the phase II portion were: duration of response (defined as the first documented response to documented disease relapse, progression or death whichever occurs first), OS (defined as the time interval from the date of first study drug to death of date from any cause), PFS (defined as the time interval from the date of first study drug to relapse, progression or death from any cause), and CBR (defined as total responders and stable disease (SD) divided by the number of evaluable patients). Time-to-event measures were estimated using the Kaplan–Meier method.\n\nResults\nA total of 28 patients were enrolled between October 2015 and January 2018; 15 in phase I (3 at 70 mg/m2, 6 at 80 mg/m2 and 3 at 90 mg/m2) and 13 in phase II. Median age of patients was 67 years (range, 42–72); 43% were females and 75% were White. The baseline characteristics of these patients are described in Table 1. Patients received a median 4 (range, 3–9) lines of therapy, which included bortezomib (100%), lenalidomide (100%), carfilzomib (43%), pomalidomide (21%), and alkylating agents (36%). Eighty nine percent of patients had undergone prior autologous stem cell transplant; 46% and 25% of patients were double and quadruple refractory patients, respectively. The refractory status to the last line of treatment before enrollment was: 10 (35%) refractory to lenalidomide, 5 (18%) to daratumumab-based regimen, 4 (14%) to carfilzomib-based regimen, 3 (11%) to cyclophosphamide based regimen, 2 (7%) to elotuzumab-based regimen, and 4 (14%) to others (1 pomalidomide, 1 to pomalidomide and bortezomib and 2 to multi-agent chemotherapy).Table 1 Baseline characteristics\n\nVariable\t\nTotal number of patients\t28\t\nAge, median (range)\t67 (42–72)\t\nSex\t\n Male\t16 (57)\t\n Female\t12 (43)\t\nRace\t\n White\t21 (75)\t\n Black\t6 (21)\t\n Asian\t1 (4)\t\nIsotype\t\n Light chain\t5 (18)\t\n Non-Light chain\t23 (82)\t\nECOG performance status\t\n 0\t13 (46)\t\n 1\t11 (39)\t\n 2\t4 (14)\t\nISS staging at diagnosis\t\n I\t11 (39)\t\n II\t7 (25)\t\n III\t5 (18)\t\n Unknown\t5 (18)\t\nR-ISS at diagnosis\t\n I\t7 (25)\t\n II\t9 (32)\t\n Unknown\t11(39)\t\nCytogenetics\t\n Standard risk\t11 (39)\t\n High risk\t10 (35)\t\n Unknown\t7 (25)\t\nMedian lines of treatment\t4 (3–9)\t\nPrior lines of therapy\t\n Bortezomib\t\n Exposed\t28 (100)\t\n Refractory\t18 (64)\t\n Lenalidomide\t\n Exposed\t28 (100)\t\n Refractory\t24 (86)\t\n Carfilzomib Refractory\t3 (11)\t\n Pomalidomide Refractory\t3 (11)\t\n Elotuzumab Refractory\t2 (7)\t\n Daratumumab Refractory\t5 (18)\t\n Double Refractory\t13 (46)\t\n Quadruple/Penta Refractory\t7/6 (25/21)\t\nPrior stem cell transplant\t\n Yes\t25 (89)\t\n No\t3 (11)\t\nHigh risk: t (4;14), t (14:16), t 14:20), 1q gain, 1p deletion, del 17p; double refractory: refractory to lenalidomide or pomalidomide and bortezomib or carfilzomib; quadruple: refractory to lenalidomide, bortezomib, carfilzomib and pomalidomide; Penta refractory: refractory to CD38 mAB in addition to quadruple refractory\n\n\n\nThe median time from diagnosis to study enrollment was 66.5 months (range, 28–166). At the time of data cutoff, 11 (39%) of the patients had died and 17 (61%) were alive with a median follow-up of 17 months (range, 1–34).\n\nDose-limiting toxicities\nNo DLTs were observed in at dose level (DL) 1. Given that none of the three patients experienced DLTs at the dose level 1, dose level was escalated to level 2 at which level 1 patient developed grade 4 thrombocytopenia (DLT). Given that one of three patients experienced DLT, an additional three patients were enrolled at this dose level 2 and no further DLT was observed. Following a review of toxicities on DL2, three patients were enrolled on DL3. Among the first three patients, one patient developed grade 4 thrombocytopenia. Per 3 + 3 design, DL3 was expanded to enroll additional three patients; and one patient developed grade 4 neutropenia and thrombocytopenia. As two of six patients developed DLTs at DL3, the recommended phase 2 dose (RP2D) was one dose level below at DL2 (bendamustine 80 mg/m2, ixazomib 4 mg, and dexamethasone 40 mg).\n\nResponse\nOf the 19 patients treated at the phase 2 dosing scheme, 18 patients were evaluable for response per study definition, out of which seven completed all eight cycles. The median number of cycles completed was 41–8. The most frequent reason for discontinuation before eight cycles was disease progression. The ORR was 61% with very good partial response (VGPR) in 2 (11%), partial response (PR) in 9(50%) and stable disease in (SD) 5 (27%) and progressive disease in (PD) 2 (11%) (Table 2). One patient completed less than one cycle and was not evaluable for response. For patients treated at all dose levels, the ORR was 48% with VGPR in 2 (7%), PR in 11 (41%), SD in 11 (41%), and PD in 3 (11%) (Table 2). For responders, the median duration of response was 5.2 months2–13. At a median follow-up of 17 months, median PFS and OS was 5.2 months (95% CI, 1.96–8.3) and 23.2 months (95% CI 16.3–30.07), respectively (Fig. 1).Table 2 Response and outcomes\n\nVariable\tN (%) (Phase II/all patients)\t\nSCR\t0\t\nCR\t0\t\nVGPR\t2 (11)/2 (7)\t\nPR\t9 (50)/11 (41)\t\nSD\t5 (27)/11 (41)\t\nPD\t2 (11)/3 (11)\t\nORR\t11 (61)/13 (48)\t\nMedian PFS, months (range)\t5.2 (95% CI 1.9–8.3)\t\nMedian OS, months (range)\t23.2 (95% CI 16.3–30.07)\t\nMedian duration of response, months\t5.5 (2–9)\t\nMedian follow up, months (range)\t17 (1–34)\t\nsCR stringent complete response, CR complete response, VGPR very good partial response, PR partial response, SD stable disease, PD progressive disease, ORR overall response rate, PFS progression free survival, OS overall survival\n\nFig. 1 Kaplan–Meier estimates (in months) of progression free survival (PFS) and overall survival (OS) in patients treated with BID\n\n\n\nResponse rates in PI exposed and refractory patients (for all dose levels)\nTwelve (43%) of patients were exposed but not refractory to PI of which two (16.5%) had achieved VGPR, eight (67%) had PR, and two (16.5%) SD. Remaining 16 (57%) were refractory to PI- 3 to bortezomib only and 14 to both bortezomib and carfilzomib. For patients refractory to bortezomib only, one (33%) had PR, and two (67%) had SD. For those refractory to both bortezomib and carfilzomib, eight (57%) had SD, three (21%) PD, and one (7%) achieved PR while remaining one patient was not evaluable for response.\n\nTwenty-four (86%) patients were refractory to ImIDs of which two (8%) had VGPR, nine (37%) had PR, 11 (46%) had SD, and two (8%) had PD. Of 13 (46%) refractory to both PI and ImIds, one (8%) had PR, nine (69%) had SD, and three (23%) had PD.\n\nEffect on high-risk cytogenetics\nA total of 10 (35%) of patients had high-risk cytogenetics defined as presence of any of the following: t (4:14), t (14:16), t (14:20), 1q amplification, 1 p deletion, or 17p deletion (Table 1). However, of 18 evaluable phase two patients, only four (22%) had high-risk cytogenetics as defined above. The disease response for these four patients was as follows: one VGPR, one PR, and two SD. At the time of last follow-up, one patient died of disease progression and one died of progressive dementia, while two were still alive.\n\nAdverse events\nAn adverse event (AE) of any grade possibly related to treatment was reported in 100% of patients (Table 3). No treatment related deaths were observed. The most common hematological toxicities were lymphopenia (92%), thrombocytopenia (78.6%), leucopenia (61%), and anemia (57%), while the most common non-hematological toxicities included fatigue (64%), nausea (57%), diarrhea (39%), anorexia (35%), hypophosphatemia (28%), hypertension (28%), hyperglycemia (25%), hypoalbuminemia (25%), and dizziness (25%). Table 3 shows the grade 3 and 4 AEs possibly related to drug combination. Peripheral neuropathy was present in 17% of the patients and all were grades 1–2. The most common causes of death were disease progression 6(55%), pneumonia 3(27%), cardiac arrest 1 (9%), and progressive dementia 1 (9%).Table 3 Hematological and non-hematological toxicities\n\n\tDose level 1 (n = 3)\tDose level 2 (n = 19)\tDose level 3 (n = 6)\t\nAny grade\tGrade ≥3\tAny grade\tGrade ≥3\tAny grade\tGrade ≥3\t\nHematologic\t\n Neutropenia\t2\t1\t4\t3\t2\t1\t\n Anemia\t1\t1\t12\t6\t2\t0\t\n Thrombocytopenia\t3\t0\t13\t8\t6\t2\t\n Lymphopenia\t3\t3\t19\t17\t4\t2\t\n Leukopenia\t2\t1\t12\t4\t3\t1\t\nNon-hematologic\t\n Nausea\t2\t0\t10\t0\t4\t0\t\n Diarrhea\t1\t0\t8\t2\t2\t0\t\n Anorexia\t1\t0\t7\t0\t2\t0\t\n Increased AST/ALT\t2\t0\t0\t0\t2\t0\t\n Increased creatinine\t0\t0\t3\t0\t1\t0\t\n Hypophosphatemia\t0\t0\t6\t1\t2\t0\t\n Hypokalemia\t0\t0\t5\t1\t0\t0\t\n Hyperuricemia\t2\t0\t4\t1\t0\t0\t\n Hypoalbuminemia\t0\t0\t6\t0\t1\t0\t\n Peripheral sensory neuropathy\t0\t0\t5\t0\t0\t0\t\n Infections\t1\t1\t7\t1\t2\t0\t\n Respiratory failure\t0\t0\t1\t1\t0\t0\t\n Dizziness\t1\t0\t5\t1\t1\t0\t\n Hyperglycemia\t0\t0\t7\t0\t0\t0\t\n Hypertension\t1\t0\t7\t3\t0\t0\t\n Increased ALP\t2\t0\t2\t0\t1\t0\t\n\n\nDiscussion\nThis prospective phase I/II trial with BID showed an impressive ORR of 61%, and clinical benefit rate of 89% in heavily treated patients with RRMM where almost half (46%) of the patients were refractory to both bortezomib and lenalidomide. The combination was well-tolerated, with manageable toxicity profile. Given the tolerability and efficacy of bendamustine alone or in combination in RRMM, the combination with ixazomib and dexamethasone required further evaluation, as it is an oral PI with low risk of neurotoxicity compared to bortezomib.\n\nBendamustine is an active agent in several cancers. Ex-vivo models using cell lines from mature B-cell malignancies have demonstrated the efficacy of bendamustine to trigger distinct apoptotic pathways even in cells with defective DNA repair pathway (like p53 deficient cells)20. In MM, this observation forms a strong rationale for bendamustine combination with drugs like bortezomib, which have shown activity in high-risk myeloma particularly 17p and t (4:14)21,22. Since the majority of RRMM patients are already exposed to and/or refractory to bortezomib, combining bendamustine with another PI like ixazomib makes logical sense. Additionally, ixazomib has a favorable profile including oral administration and better tolerability. When combined with bortezomib, the MTD of bendamustine ranged from 70 mg/m2 up to a maximum of 90 mg/m2 on days 1 and 2;6,11,23 MTD of 80 mg/m2 of bendamustine this study, is thus, within the range observed previously. Likewise, the dose of bendamustine varies when combined with different ImiDs as well7,8. Lentzsch et al. established MTD of bendamustine at 75 mg/m2 on days 1 and 2 in patients with median 3 prior treatment lines in combination with lenalidomide with an ORR of 50%8. The results of these studies point to a potential synergism of bendamustine with PI or ImiDs and formed the basis of our study.\n\nThe therapeutic efficacy of ixazomib in bortezomib RRMM patients is understudied. In an experimental in vivo model, ixazomib showed activity on cells from bortezomib resistant patients24. This observation has been corroborated in several clinical trials; however, the variability in response observed across studies, and the small-scale study designs preclude any definite conclusions25,26. Responses observed in this study were comparable to bortezomib-bendamustine-dexamethasone which resulted in ORR of 60.8% in RRMM that included patients with prior exposure, but not refractory to bortezomib11. The slightly lower PFS and OS observed in our study reflects the more heavily pretreated patients and a high proportion dual refractory to novel agents. Additionally, in a prespecified and post-hoc analysis of TOURMALINE-MM1 trial, the addition of ixazomib was found to overcome the poor PFS associated with high-risk cytogenetics27. These observations provide an impetus for further investigating the role of ixazomib in combination with alkylators and other novel agents in heavily pretreated high-risk patients.\n\nBoth bendamustine and ixazomib has been tested separately in combination with pomalidomide in lenalidomide refractory patients in phase I/II studies9,28. Bendamustine (at MTD 120 mg/m2 total dose), in combination with pomalidomide, resulted in ORR of 61% and CBR 63% in patients with median 5 prior lines of therapy9. The median PFS and OS of the combination was 9.6 months and 21.3 months, respectively; 18% of the patients being on planned maintenance. When combined with pomalidomide, ixazomib resulted in ORR of 53% in patients with median 2 prior lines of therapy28. About 2/3rd of patients in this study were refractory to bortezomib who achieved ≥PR of 29% and CBR 71% with this combination. The median PFS and OS of the combination was 8.6 months and not reached, respectively. The ORR of 61% and CBR of 91% achieved with BID regimen in this study compares favorably with the previous two studies as 64% were bortezomib refractory, 86% lenalidomide refractory, and 46% to both. Additionally, planned maintenance therapy was not used in this study and might be effective for prolonging the response duration. Furthermore, three other novel combinations reported in similar patient population are worth discussing in this context—daratumumab, pomalidomide and dexamethasone (DPd)29, clarithromycin, pomalidomide and dexamethasone (ClaPd)30 and carfilzomib, pomalidomide and dexamethasone (KPd)31. The ORR was 60% for DPD, ClaPD and 50% for KPD with median 4–5 prior lines of therapy. The responses observed with BID after 4 prior lines is comparable, and future study combining this regimen with CD38 monoclonal antibody is being considered.\n\nThe toxicity profile of this regimen has been similar to that seen with previously reported bendamustine or ixazomib combinations4,14. No grade 3 or higher peripheral neuropathy was seen in this cohort, compared to 7% grade 3 and higher seen with the bortezomib combination11. As seen in other ixazomib studies, we did observe gastrointestinal toxicity, particularly nausea, but this was managed with supportive care measures. Hematological toxicity remains the most common category of AEs and was similar with the ixazomib and pomalidomide28. Compared to bendamustine and pomalidomide combination, we observed lower rates of grade 3 and higher infections despite the higher total dose of bendamustine (160 mg/m2 vs. 120 mg/m2)9.\n\nIn conclusion, the combination of bendamustine-ixazomib and dexamethasone is a well-tolerated and effective combination that can be used in heavily pretreated RRMM patients. These findings justify further study of this combination in RRMM patients especially with continued ixazomib maintenance in responders32. Our study could also form a basis for future combination studies with ultra-novel agents like monoclonal antibodies given the lower acquisition costs associated with bendamustine.\n\nPublisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor contributions\nB.D., K.S., K.T., T.K. and P.H.: concept, data collection, data analysis. B.D., A.D., M.H., S.C., N.S., M.P. and P.H.: clinical care and manuscript editing. B.D. and P.H.: concept, study design, manuscript generation. B.D. wrote the first draft of the manuscript and all authors approved the final version.\n\nConflict of interest\nB.D. has served on the advisory board for Takeda and Amgen. P.H. has received grant support and consulting honoraria from Takeda. A.D.—institutional funding: Amgen, Celgene, Merck, Prothena, Takeda; Consultancy: Prothena; Advisory board- Pfizer. M.H. reports Research Support/Funding: Takeda Pharmaceutical Company; Otsuka Pharmaceutical; Spectrum Pharmaceuticals; Astellas Pharma. Consultancy: MedImmune LLC; Janssen R &D; Incyte Corporation; ADC Therapeutics; Cellerant Therapeutics; Celgene Corporation; Pharmacyclics & DOVA Oncology. Speaker’s Bureau: Celgene Corporation (Inactive); Sanofi Genzyme. N.N.S. reports research funding from Lentigen, A miltenyi biotech company. He has served on the advisory boards for Kite, Juno, and Cellectar. The remaining authors declare that they have no conflict of interest.\n==== Refs\nReferences\n1. Kumar SK Continued improvement in survival in multiple myeloma: changes in early mortality and outcomes in older patients Leukemia 2014 28 1122 1128 10.1038/leu.2013.313 24157580 \n2. D’Souza A Trends in pre- and post-transplant therapies with first autologous hematopoietic cell transplantation among patients with multiple myeloma in the United States, 2004–2014 Leukemia 2017 31 1998 2000 10.1038/leu.2017.185 28663578 \n3. Cheson BD Rummel MJ Bendamustine: rebirth of an old drug J. Clin. Oncol. 2009 27 1492 1501 10.1200/JCO.2008.18.7252 19224851 \n4. Leoni LM The evolving role of bendamustine in lymphoid malignancy: understanding the drug and its mechanism of action-introduction Semin. Hematol. 2011 48 S1 S3 10.1053/j.seminhematol.2011.03.001 21530767 \n5. Rummel MJ Gregory SA Bendamustine’s emerging role in the management of lymphoid malignancies Semin. Hematol. 2011 48 S24 S36 10.1053/j.seminhematol.2011.03.004 21530769 \n6. Knop S The efficacy and toxicity of bendamustine in recurrent multiple myeloma after high-dose chemotherapy Haematologica 2005 90 1287 1288 16154860 \n7. Grey-Davies E Bendamustine, Thalidomide and Dexamethasone is an effective salvage regimen for advanced stage multiple myeloma Br. J. Haematol. 2012 156 552 555 10.1111/j.1365-2141.2011.08887.x 21950692 \n8. Lentzsch S Combination of bendamustine, lenalidomide, and dexamethasone (BLD) in patients with relapsed or refractory multiple myeloma is feasible and highly effective: results of phase 1/2 open-label, dose escalation study Blood 2012 119 4608 4613 10.1182/blood-2011-12-395715 22451423 \n9. Sivaraj D Bendamustine, pomalidomide, and dexamethasone for relapsed and/or refractory multiple myeloma Blood Cancer J. 2018 8 71 10.1038/s41408-018-0104-5 30065277 \n10. Gramatzki Mea. Carfilzomib in combination with bendamustine and dexamethasone (CBd) in relapsed and/or refractory patients with multiple myeloma: the phase I/II EMN09 study. Blood, 128, 3334 (2016).\n11. Ludwig H Bendamustine-bortezomib-dexamethasone is an active and well-tolerated regimen in patients with relapsed or refractory multiple myeloma Blood 2014 123 985 991 10.1182/blood-2013-08-521468 24227817 \n12. Kupperman E Evaluation of the proteasome inhibitor MLN9708 in preclinical models of human cancer Cancer Res. 2010 70 1970 1980 10.1158/0008-5472.CAN-09-2766 20160034 \n13. Kumar SK Phase 1 study of weekly dosing with the investigational oral proteasome inhibitor ixazomib in relapsed/refractory multiple myeloma Blood 2014 124 1047 1055 10.1182/blood-2014-01-548941 24904120 \n14. Kumar SK Safety and tolerability of ixazomib, an oral proteasome inhibitor, in combination with lenalidomide and dexamethasone in patients with previously untreated multiple myeloma: an open-label phase 1/2 study Lancet Oncol. 2014 15 1503 1512 10.1016/S1470-2045(14)71125-8 25456369 \n15. Kumar SK Randomized phase 2 trial of ixazomib and dexamethasone in relapsed multiple myeloma not refractory to bortezomib Blood 2016 128 2415 2422 10.1182/blood-2016-05-717769 27702799 \n16. Moreau P Oral Ixazomib, Lenalidomide, and Dexamethasone for multiple myeloma N. Engl. J. Med. 2016 374 1621 1634 10.1056/NEJMoa1516282 27119237 \n17. Moreau P Subcutaneous versus intravenous administration of bortezomib in patients with relapsed multiple myeloma: a randomised, phase 3, non-inferiority study Lancet Oncol. 2011 12 431 440 10.1016/S1470-2045(11)70081-X 21507715 \n18. Waxman AJ Carfilzomib-associated cardiovascular adverse events: a systematic review and meta-analysis JAMA Oncol. 2018 4 e174519 10.1001/jamaoncol.2017.4519 29285538 \n19. Kumar S International Myeloma Working Group consensus criteria for response and minimal residual disease assessment in multiple myeloma Lancet Oncol. 2016 17 e328 e346 10.1016/S1470-2045(16)30206-6 27511158 \n20. Roue G Bendamustine is effective in p53-deficient B-cell neoplasms and requires oxidative stress and caspase-independent signaling Clin. Cancer Res. 2008 14 6907 6915 10.1158/1078-0432.CCR-08-0388 18980985 \n21. Sonneveld P Bortezomib induction and maintenance treatment in patients with newly diagnosed multiple myeloma: results of the randomized phase III HOVON-65/ GMMG-HD4 trial J. Clin. Oncol. 2012 30 2946 2955 10.1200/JCO.2011.39.6820 22802322 \n22. Nooka AK Consolidation and maintenance therapy with lenalidomide, bortezomib and dexamethasone (RVD) in high-risk myeloma patients Leukemia 2014 28 690 693 10.1038/leu.2013.335 24220275 \n23. Berenson JR Phase I/II trial assessing bendamustine plus bortezomib combination therapy for the treatment of patients with relapsed or refractory multiple myeloma Br. J. Haematol. 2013 160 321 330 10.1111/bjh.12129 23150919 \n24. Chauhan D In vitro and in vivo selective antitumor activity of a novel orally bioavailable proteasome inhibitor MLN9708 against multiple myeloma cells Clin. Cancer Res. 2011 17 5311 5321 10.1158/1078-0432.CCR-11-0476 21724551 \n25. Berenson James R. Cohen Alexa Spektor Tanya M. Bitran Jacob D. Chen Gigi Qiqi Moezi Mehdi M. Bessudo Alberto Ye Joseph Z. Hager Steven Jeffrey Moss Robert A. Cartmell Alan D. Coleman Teresa A. Hrom John Stewart Eshaghian Shahrooz Maluso Tina Swift Regina A. Lim Stephen Replacement of ixazomib for relapsed/refractory multiple myeloma patients refractory to a bortezomib or carfilzomib-containing combination therapy Journal of Clinical Oncology 2017 35 15_suppl 8013 8013 10.1200/JCO.2017.35.15_suppl.8013 \n26. Reu, F. J. V. J. et al. A Phase I Study of Ixazomib in combination with Panobinostat and Dexamethasone in patients with relapsed or refractory multiple myeloma. Blood126, 4221 (2015).\n27. Avet-Loiseau H Ixazomib significantly prolongs progression-free survival in high-risk relapsed/refractory myeloma patients Blood 2017 130 2610 2618 10.1182/blood-2017-06-791228 29054911 \n28. Krishnan Amrita Kapoor Prashant Palmer Joycelynne M. Tsai Ni-Chun Kumar Shaji Lonial Sagar Htut Myo Karanes Chatchada Nathwani Nitya Rosenzweig Michael Sahebi Firoozeh Somlo George Duarte Lupe Sanchez James F. Auclair Daniel Forman Stephen J. Berdeja Jesus G. Phase I/II trial of the oral regimen ixazomib, pomalidomide, and dexamethasone in relapsed/refractory multiple myeloma Leukemia 2018 32 7 1567 1574 10.1038/s41375-018-0038-8 \n29. Chari A Daratumumab plus pomalidomide and dexamethasone in relapsed and/or refractory multiple myeloma Blood 2017 130 974 981 10.1182/blood-2017-05-785246 28637662 \n30. Mark TM Phase 2 study of clarithromycin, pomalidomide, and dexamethasone in relapsed or refractory multiple myeloma Blood Adv. 2019 3 603 611 10.1182/bloodadvances.2018028027 30792190 \n31. Shah JJ Carfilzomib, pomalidomide, and dexamethasone for relapsed or refractory myeloma Blood 2015 126 2284 2290 10.1182/blood-2015-05-643320 26384354 \n32. Dimopoulos M. A. (eds) Maintenance Therapy with the Oral Proteasome Inhibitor (PI) Ixazomib Significantly Prolongs Progression-Free Survival (PFS) Following Autologous Stem Cell Transplantation (ASCT) in Patients with Newly Diagnosed Multiple Myeloma (NDMM): Phase 3 Tourmaline-MM3 Trial (ASH, San Diego, 2018).\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2044-5385",
"issue": "9(8)",
"journal": "Blood cancer journal",
"keywords": null,
"medline_ta": "Blood Cancer J",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069461:Bendamustine Hydrochloride; D001896:Boron Compounds; D003907:Dexamethasone; D019008:Drug Resistance, Neoplasm; D005260:Female; D005998:Glycine; D006801:Humans; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D009364:Neoplasm Recurrence, Local; D061214:Patient Safety; D016896:Treatment Outcome",
"nlm_unique_id": "101568469",
"other_id": null,
"pages": "56",
"pmc": null,
"pmid": "31358733",
"pubdate": "2019-07-29",
"publication_types": "D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article",
"references": "26384354;22802322;30792190;27511158;24220275;29054911;25456369;19224851;21530767;24904120;21950692;21507715;18980985;29285538;28663578;16154860;22451423;27119237;23150919;21724551;30065277;20160034;24227817;27702799;32082000;24157580;21530769;28637662",
"title": "Phase I/II trial of bendamustine, ixazomib, and dexamethasone in relapsed/refractory multiple myeloma.",
"title_normalized": "phase i ii trial of bendamustine ixazomib and dexamethasone in relapsed refractory multiple myeloma"
} | [
{
"companynumb": "US-EAGLE PHARMACEUTICALS, INC.-US-2019EAG000065",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BENDAMUSTINE HYDROCHLORIDE"
},
... |
{
"abstract": "Reduced-intensity conditioning (RIC) regimens for hematopoietic stem cell transplantation (HCT) can reduce morbidity and mortality, but patients with advanced disease may require alternative approaches. In an initial report of RIC with fludarabine (FLU) and melphalan (MEL) with total marrow lymphoid irradiation (TMLI) in HCT for advanced hematologic malignancies in 33 patients, we found that the addition of TMLI to RIC was feasible and safe. Here we report long-term outcomes for these patients. This prospective study included 61 patients treated with TMLI to a dose of 12 Gy (1.5 Gy twice daily for 4 days), FLU (25 mg/m2/day for 5 days), and MEL (140 mg/m2/day for 1 day). Overall survival (OS), event-free survival (EFS), cumulative incidence of relapse (CIR), and nonrelapse mortality (NRM) were measured from the date of HCT. Survival outcomes were analyzed using Kaplan-Meier analysis. Patients were categorized as low/intermediate or high/very high risk using the Disease Risk Index. The median follow-up was 7.4 years. The majority of patients had acute leukemia (72%); 49% had high/very high-risk disease. The median patient age was 55 years (range, 9-70 years). Two-year OS, EFS, CIR, and NRM were 54% (95% confidence interval [CI], 41%-66%), 49% (95% CI, 36%-61%), 21% (95% CI, 13%-35%), and 30% (95% CI, 20%-43%), respectively. Five-year OS, EFS, CIR, and NRM were 42% (95% CI, 30%-54%), 41% (95% CI, 28%-53%), 26 (95% CI, 17%-40%), and 33% (95% CI, 23%-47%, respectively). Acute (any grade) and chronic (limited or extensive) graft-versus-host disease occurred in 69% and 74% of patients, respectively. The most common toxicity was mucositis. The addition of TMLI to FLU/MEL conditioning was well tolerated, with favorable outcomes. Dosage escalation of TMLI or other modifications may be needed to improve disease control.",
"affiliations": "Department of Radiation Oncology, City of Hope National Medical Center, Duarte, California. Electronic address: Lindsaygjensen@gmail.com.;Department of Biostatistics, City of Hope National Medical Center, Duarte, California.;Department of Radiation Oncology, City of Hope National Medical Center, Duarte, California.;Department of Biostatistics, City of Hope National Medical Center, Duarte, California.;Department of Hematology and Hematopoietic Cell Transplantation, City of Hope National Medical Center, Duarte, California.;Department of Hematology and Hematopoietic Cell Transplantation, City of Hope National Medical Center, Duarte, California; Department of Pediatrics, City of Hope National Medical Center, Duarte, California.",
"authors": "Jensen|Lindsay G|LG|;Stiller|Tracey|T|;Wong|Jeffrey Y C|JYC|;Palmer|Joycelynne|J|;Stein|Anthony|A|;Rosenthal|Joseph|J|",
"chemical_list": "D014740:Vidarabine; C024352:fludarabine; D008558:Melphalan",
"country": "United States",
"delete": false,
"doi": "10.1016/j.bbmt.2017.09.019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1083-8791",
"issue": "24(2)",
"journal": "Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation",
"keywords": "Hematopoietic stem cell transplantation; Reduced-intensity conditioning; Total marrow lymphoid irradiation",
"medline_ta": "Biol Blood Marrow Transplant",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001853:Bone Marrow; D002648:Child; D005260:Female; D019337:Hematologic Neoplasms; D006801:Humans; D015182:Lymphatic Irradiation; D008297:Male; D008558:Melphalan; D008875:Middle Aged; D011446:Prospective Studies; D016019:Survival Analysis; D019172:Transplantation Conditioning; D016896:Treatment Outcome; D014740:Vidarabine; D055815:Young Adult",
"nlm_unique_id": "9600628",
"other_id": null,
"pages": "301-307",
"pmc": null,
"pmid": "29032268",
"pubdate": "2018-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Total Marrow Lymphoid Irradiation/Fludarabine/ Melphalan Conditioning for Allogeneic Hematopoietic Cell Transplantation.",
"title_normalized": "total marrow lymphoid irradiation fludarabine melphalan conditioning for allogeneic hematopoietic cell transplantation"
} | [
{
"companynumb": "PHHY2017US179827",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUDARABINE PHOSPHATE"
},
"drugadditional": "3",
... |
{
"abstract": "A 63-year-old, non-smoking Asian woman presented to our hospital due to abnormal findings on chest radiography. She had no history of dust exposure. Chest radiography and CT imaging showed patchy ground-glass attenuation (GGA) in the bilateral lower lung lobes, a ground-glass nodule in the right lower lung lobe (diameter, 9.8 mm), and some thin-walled cysts in both lungs (Fig 1). Thickening of the interlobular septa, mediastinal lymphadenopathy, and pleural effusion were not evident. Video-assisted thoracic surgery was performed for the examination of the nodule and the background lung disease, and the nodule was histologically diagnosed as lung adenocarcinoma. Simultaneously, the lung background showed diffuse lymphocytic infiltration in the alveolar septum and peribronchovascular interstitium (Fig 2). There were no symptoms suggestive of autoimmune diseases such as dryness, arthralgia, skin rash, or fever. The patient was followed up without treatment for the interstitial lung disease.",
"affiliations": "Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan.;Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan.;Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan.;Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan.;Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan.;Department of Respiratory Medicine, Fukuoka University Chikushi Hospital, Fukuoka, Japan. Electronic address: hishii@fukuoka-u.ac.jp.",
"authors": "Kinoshita|Yoshiaki|Y|;Ikeda|Takato|T|;Ueda|Yusuke|Y|;Sasaki|Tomoya|T|;Kushima|Hisako|H|;Ishii|Hiroshi|H|",
"chemical_list": "D005938:Glucocorticoids; D008775:Methylprednisolone",
"country": "United States",
"delete": false,
"doi": "10.1016/j.chest.2021.01.018",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-3692",
"issue": "159(6)",
"journal": "Chest",
"keywords": null,
"medline_ta": "Chest",
"mesh_terms": "D000077192:Adenocarcinoma of Lung; D001706:Biopsy; D005260:Female; D005938:Glucocorticoids; D006801:Humans; D008168:Lung; D017563:Lung Diseases, Interstitial; D008175:Lung Neoplasms; D000072281:Lymphadenopathy; D008775:Methylprednisolone; D008875:Middle Aged; D012859:Sjogren's Syndrome; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome",
"nlm_unique_id": "0231335",
"other_id": null,
"pages": "e389-e394",
"pmc": null,
"pmid": "34099156",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A 63-Year-Old Woman With an Acute Exacerbation of Interstitial Pneumonia.",
"title_normalized": "a 63 year old woman with an acute exacerbation of interstitial pneumonia"
} | [
{
"companynumb": "JP-PRA-000171",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "The teratogenic risk of maternal valproic acid therapy and the prenatal effects on growth and morphogenesis have been difficult to determine, in part, because of the small number of epileptic women who receive valproic acid as the sole anticonvulsant therapy. An increased incidence of open neural tube defects has been suggested and other isolated case reports have noted the presence of certain dysmorphic features. We present a patient whose defects in morphogenesis appear to be associated with valproic acid exposure only, and suggest a clinical phenotype that our patient shares with other children exposed to prenatal valproic acid therapy. Features described previously include dysmorphic facies with hypertelorism, prominent forehead, low flat nasal bridge, low-set or odd-shaped ears, and micrognathia with growth deficiency of prenatal or postnatal onset. A striking and perhaps unique feature in our patient consists of hypoplasia of the lateral margins of the zygomatic arches. We discuss the pharmacokinetics of valproic acid in pregnancy and in the neonatal period.",
"affiliations": null,
"authors": "Tein|I|I|;MacGregor|D L|DL|",
"chemical_list": "D014635:Valproic Acid",
"country": "United States",
"delete": false,
"doi": "10.1001/archneur.1985.04060030113019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-9942",
"issue": "42(3)",
"journal": "Archives of neurology",
"keywords": null,
"medline_ta": "Arch Neurol",
"mesh_terms": "D000015:Abnormalities, Multiple; D004827:Epilepsy; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D008431:Maternal-Fetal Exchange; D009436:Neural Tube Defects; D011247:Pregnancy; D014635:Valproic Acid",
"nlm_unique_id": "0372436",
"other_id": null,
"pages": "291-3",
"pmc": null,
"pmid": "3919693",
"pubdate": "1985-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Possible valproate teratogenicity.",
"title_normalized": "possible valproate teratogenicity"
} | [
{
"companynumb": "CA-ABBVIE-17P-028-1915553-00",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VALPROIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "We report a 77-year-old human on renal dialysis for end-stage renal disease with heart failure and atrial fibrillation (AF) complicated by a high ventricular frequency. The underlying disease was thought as tachycardia-induced-cardiomyopathy. Intravenous infusion of amiodarone was initiated, and direct current cardioversion succeeded in converting AF to sinus rhythm. Then, excessive increases in the QT and Tpeak-Tend (Tp-e) intervals were seen and hypokalemia induced by hemodialysis led to the development of numerous episodes of torsades de pointes (TdP). Magnesium repletion was effective in preventing TdP, while Tp-e intervals returned to the previous values 2 days after the discontinuation of amiodarone.",
"affiliations": "Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.;Division of Cardiovascular Medicine, AOI Universal Hospital, Kanagawa, Japan.",
"authors": "Yonai|Ryo|R|;Kawabata|Mihoko|M|0000-0002-1023-2708;Maeda|Shingo|S|;Kawashima|Tomoyuki|T|;Tsuda|Yasuhide|Y|;Nakasone|Takashi|T|;Nakane|Hiroki|H|;Hirao|Kenzo|K|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1111/anec.12810",
"fulltext": "\n==== Front\nAnn Noninvasive Electrocardiol\nAnn Noninvasive Electrocardiol\n10.1111/(ISSN)1542-474X\nANEC\nAnnals of Noninvasive Electrocardiology\n1082-720X\n1542-474X\nJohn Wiley and Sons Inc. Hoboken\n\n33070441\n10.1111/anec.12810\nANEC12810\nCase Report\nCase Reports\nTorsade de pointes induced by intravenous amiodarone therapy accompanied by marked augmentation of the transmural dispersion of repolarization in a patient with tachycardia‐induced‐cardiomyopathy\nYONAI et al.\nYonai Ryo MD 1\nKawabata Mihoko MD, PhD https://orcid.org/0000-0002-1023-2708\n1 Kawabata.mh@aoikai.jp\n\nMaeda Shingo MD, PhD 1\nKawashima Tomoyuki MD 1\nTsuda Yasuhide MD 1\nNakasone Takashi MD 1\nNakane Hiroki MD 1\nHirao Kenzo MD, PhD 1\n1 Division of Cardiovascular Medicine AOI Universal Hospital Kanagawa Japan\n* Correspondence\nMihoko Kawabata, MD, PhD, Division of Cardiovascular Medicine, AOI Universal Hospital, 2‐9‐1, Tamachi, Kawasaki‐ku, Kawasaki‐City, Kanagawa 210‐0822, Japan.\nEmail: Kawabata.mh@aoikai.jp\n\n18 10 2020\n5 2021\n26 3 10.1111/anec.v26.3 e1281013 9 2020\n15 8 2020\n26 9 2020\n© 2020 The Authors. Annals of Noninvasive Electrocardiology published by Wiley Periodicals LLC\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nWe report a 77‐year‐old human on renal dialysis for end‐stage renal disease with heart failure and atrial fibrillation (AF) complicated by a high ventricular frequency. The underlying disease was thought as tachycardia‐induced‐cardiomyopathy. Intravenous infusion of amiodarone was initiated, and direct current cardioversion succeeded in converting AF to sinus rhythm. Then, excessive increases in the QT and Tpeak‐Tend (Tp‐e) intervals were seen and hypokalemia induced by hemodialysis led to the development of numerous episodes of torsades de pointes (TdP). Magnesium repletion was effective in preventing TdP, while Tp‐e intervals returned to the previous values 2 days after the discontinuation of amiodarone.\n\namiodarone\nhemodialysis\ntachycardia‐induced‐cardiomyopathy\ntorsade de pointes\nTpeak‐Tend interval\ntransmural dispersion of repolarization\nsource-schema-version-number2.0\ncover-dateMay 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.2 mode:remove_FC converted:29.05.2021\nYonai R , Kawabata M , Maeda S , et al. Torsade de pointes induced by intravenous amiodarone therapy accompanied by marked augmentation of the transmural dispersion of repolarization in a patient with tachycardia‐induced‐cardiomyopathy. Ann Noninvasive Electrocardiol. 2021;26 :e12810. 10.1111/anec.12810\n==== Body\n1 CASE REPORT\n\nA 77‐year‐old human on regular hemodialysis for end‐stage renal disease was admitted because of heart failure. He had been well until persistent atrial fibrillation (AF) with rapid ventricular response started 2 months prior. His past medical history included gastric cancer and bile duct cancer surgeries. ECG on admission revealed AF with a heart rate in the 100 s, and poor R wave progression with newly developed negative T waves in the precordial leads (Figure 1b), however, coronary angiography revealed no stenosis. Chest radiography confirmed left‐sided pleural effusion. Transthoracic echocardiography revealed diffuse left ventricular (LV) hypokinesis, with ejection fraction of 25%, which was 58% 3 months prior during sinus rhythm (SR). As the rapid AF was sustained and there were no other causes of the LV dysfunction, tachycardia‐induced‐LV dysfunction and heart failure were suspected. Transesophageal echocardiography revealed no intracardiac thrombus; then, intravenous amiodarone was initiated, and DC cardioversion succeeded in converting the AF to SR (Figure 1c). The QT intervals were measured manually with calipers in all 12 leads. They were defined as the time interval between the earliest deflection of the QRS complex and the point of T‐wave offset, which was defined by the return of the terminal T wave to the isoelectric baseline. When U waves were present, U waves were excluded using the presented guidelines (Lepechkin & Surawicz, 1952), therefore, QT interval was measured to the nadir of the curve between the T wave and U wave. Biphasic T waves were distinguished from U waves by comparison with similar complexes in contiguous ECG leads. If the end of the T wave could not be reliably determined or when the T waves were isoelectric or of low amplitude, QT measurements were not made and these leads were excluded from analysis. Then, T‐wave peak was determined, and the Tpeak‐Tend (Tp‐e) intervals from T‐wave peak to T‐wave end were measured. In the case of negative or biphasic T waves, T‐wave peak was defined to the nadir of the T wave. T waves smaller than 1.5 mm in amplitude were not measured. The Tp‐e value reported was the maximum. All measured QT and Tp‐e intervals were corrected (QTc and c‐Tp‐e) for heart rate using the Bazett formula (QTc; QT/√RR, c‐Tp‐e; Tp‐e/√RR). QTc interval was 444 ms during AF on admission, and after the conversion to SR, QTc interval was 440 ms and c‐Tp‐e 42 ms.\n\nFIGURE 1 The serial ECGs from 6 months prior to admission (a), on admission (b), just after successful direct current cardioversion with 4 hr of administration of intravenous amiodarone (c), and 15 hr after beginning amiodarone (d). (a) The rhythm was sinus rhythm (SR) with QTc interval of 426 ms. T waves were positive and symmetrical, and poor R wave progression was seen. (b) The rhythm was atrial fibrillation with a heart rate in the 100 s and QTc interval of 444 ms. Negative T waves in precordial leads newly developed. (c) Just after the recovery to SR, QTc interval was 440 ms. Negative T waves in the precordial leads were symmetrical with Tpeak‐Tend (Tp‐e) interval of 40 ms and corrected‐Tp‐e (c‐Tp‐e) interval of 42 ms. (d) QTc interval prolonged to 517 ms, which was accompanied by prolonged Tp‐e interval of 240 ms (c‐Tp‐e interval: 255 ms)\n\nECG taken 15 hr after beginning amiodarone revealed that QTc interval prolonged of 517 ms, which was accompanied by prolonged c‐Tp‐e interval of 255 ms (Figure 1d), with normal serum electrolytes. Therefore, the intravenous amiodarone was ceased (total dose of 370 mg). However, QTc and c‐Tp‐e interval did not recover; on the contrary, both prolonged even further after hemodialysis, which triggered hypokalemia (3.3 mEq/L). The patient developed repetitive short‐lasting torsade de pointes tachycardias (TdPs) terminating spontaneously (Figure 2). During the consecutive TdP episodes, he had syncope once. Magnesium repletion was effective in preventing TdP; however, T waves became symmetrical and c‐Tp‐e intervals shortened 2 days after the discontinuation of amiodarone (Figure 3). During the TdP episodes, isoproterenol could not be administered for fear of inducing AF. Following catheter ablation of AF, he kept SR. No TdP recurred, and the patient remained asymptomatic. Three months later, catheter ablation of atrial tachycardia which occurred newly was performed. LV function recovered 8 months later.\n\nFIGURE 2 12‐lead ECG (a) and ECG monitor strips (b) after hemodialysis. After regular hemodialysis, mild hypokalemia was induced. (a) Note the remarkably bizarre negative T waves in the precordial leads, which did not end when the next sinus rhythm QRS complex started. Therefore, QT or Tp‐e intervals could not be measured. In the 5th beat, torsade de pointes (TdP) terminated spontaneously. (b) The patient developed repetitive short‐lasting TdP episodes terminating spontaneously. A “short‐long‐short” sequence preceded the onset of TdP\n\nFIGURE 3 The serial ECGs from 10 hr after the discontinuation of amiodarone (a), 1 day after the discontinuation (b), 2 days after the discontinuation (c), and 1 month later (d). (a, b) T waves in the precordial leads were still negative and corrected‐ Tpeak‐Tend (c‐Tp‐e interval) was prolonged (291 and 341 ms, each). (c) Negative T waves were seen in all chest leads; however, they were symmetrical. (d) T waves in all chest leads were positive and symmetrical\n\n2 DISCUSSION\n\nAmiodarone is widely used for the treatment of malignant arrhythmias with a remarkably low frequency of proarrhythmia. The incidence of TdP associated with oral amiodarone is reported to be <1.0% (Hohnloser et al., 1994), while that with intravenous amiodarone is about 1.5% (Shenthar et al., 2017). Although both amiodarone and other antiarrhythmic drugs including class Ia and other class III prolong the QT interval, TdP is overwhelmingly rare during amiodarone therapy. The mechanism of the difference is that amiodarone homogeneously prolongs the ventricular repolarization, whereas other antiarrhythmic drugs prolong it in a nonhomogeneous fashion accompanied by an increase in QT interval dispersion (Friedman & Stevenson, 1998; Hii et al., 1992; Milberg et al., 2004; van Opstal et al., 2001). Antezelvich introduced the concept of Tp‐e interval in surface ECG as an index of transmural dispersion of repolarization (TDR) based on the studies with the coronary‐perfused wedge preparation, that repolarization of the epicardial action potential coincides with the peak of the T wave and repolarization of the mid‐myocardial cells (M cells) is coincident with the end of the T wave, so that Tp‐e interval provides a measure of TDR, with forecasting risk for the development of TdP (Sicouri & Antzelevitch, 1991). Studies have indicated that drugs that do not increase TDR have little or no potential to induce TdP despite causing a prolongation of the QT interval. Amiodarone has in common the ability to block IKs, IKr, and late INa. This combination produces a preferential prolongation of APD of the epicardium and endocardium so that the QT interval is prolonged, but the TDR is actually reduced and TdP rarely, if ever, occurs under these conditions (Hii et al., 1992; Kotake et al., 2015; Milberg et al., 2004; van Opstal et al., 2001).\n\nThe case reports of amiodarone‐induced‐TdP so far were rare and have shown significant QT prolongation, but without Tp‐e prolongation (Belardinelli et al., 2003; Friedman & Stevenson, 1998; Hii et al., 1992; Hohnloser et al., 1994; Kotake et al., 2015; Shenthar et al., 2017). The increased TDR could provide a more accurate electrophysiologic marker of the risk for TdP than does the QT interval. In this case with tachycardia‐induced‐cardiomyopathy (TCM) due to rapid AF, the QT interval prolonged dramatically with bizarre T waves suggesting augmented TDR after the administration of intravenous amiodarone. Finally, hypokalemia caused by hemodialysis initiated TdP accompanied by syncope. To the best of our knowledge, this is the first report of TdP with marked Tp‐e prolongation in a patient during amiodarone therapy.\n\nAlthough the mechanism responsible for the marked augmentation of TDR with amiodarone in our case is unclear, it would be speculated as multifactorial. TDR is increased by drugs, heart failure, acute myocardial infarction, and various channelopathies. First, we previously reported the possibility that the transmural heterogeneity of myocardial ischemia might influence the repolarization resulting in increased TDR (Kawabata et al., 2008). Although CAG revealed no lesions in this case, the possibility of myocardial ischemia in microvascular level could not be completely ruled out. Second, as both QT and Tp‐e intervals were not prolonged before the administration of amiodarone in this case, the marked QT/TDR increase was induced by amiodarone; however, the possibility of acquired long QT syndrome based on the genetic causes could not be excluded as a genetic test was not performed. Third, the underlying disease was thought as TCM in this patient. It is reported that in tachycardia‐induced heart failure K+ currents are down‐regulated ununiformly, causing enhanced TDR (Akar et al., 2005). It was speculated that the underlying molecular features in TCM would influence the augmentation of TDR in this case. Forth, a different distribution or clearance of amiodarone could be related. In previous report of animal models of acquired long QT syndrome, amiodarone increased QTc time in 6 of 7 dogs, while dispersion of repolarization was increased in 3. The three dogs tended to have higher tissue levels of amiodarone and its metabolite compared with those without dispersion of repolarization (van Opstal et al., 2001). In this case, we did not check the concentration of amiodarone or n‐desethylamiodarone; however, there was a possibility that they were quite high.\n\n3 CONCLUSION\n\nAlthough the reported incidence of TdP during amiodarone therapy is low, careful ECG monitoring should be undergone to check not only QT interval but Tp‐e interval.\n\nCONFLICT OF INTEREST\n\nNone.\n\nETHICAL APPROVAL\n\nThe authors have obtained the patient's informed consent.\n\nDATA AVAILABILITY STATEMENT\n\nThe data that support the findings of this study are available from the corresponding author upon reasonable request.\n==== Refs\nREFERENCES\n\nAkar, F. G. , Wu, R. C. , Juang, G. J. , Tian, Y. , Burysek, M. , DiSilvestre, D. , … Tomaselli, G. F. (2005). Molecular mechanisms underlying K+ current downregulation in canine tachycardia‐induced heart failure. American Journal of Physiology. Heart and Circulatory Physiology, 288 , H2887–H2896. 10.1152/ajpheart.00320.2004 15681701\nBelardinelli, L. , Antzelevitch, C. , & Vos, M. A. (2003). Assessing predictors of drug‐induced torsade de pointes. Trends in Pharmacological Sciences, 24 , 619–625. 10.1016/j.tips.2003.10.002 14654302\nFriedman, P. L. , & Stevenson, W. G. (1998). Proarrhythmia. American Journal of Cardiology, 82 , 50N–58N. 10.1016/s0002-9149(98)00586-4\nHii, J. T. , Wyse, D. G. , Gillis, A. M. , Duff, H. J. , Solylo, M. A. , & Mitchell, L. B. (1992). Precordial QT interval dispersion as a marker of torsade de pointes. Disparate effects of class Ia antiarrhythmic drugs and amiodarone. Circulation, 86 , 1376–1382. 10.1161/01.cir.86.5.1376 1423949\nHohnloser, S. H. , Klingenheben, T. , & Singh, B. N. (1994). Amiodarone‐associated proarrhythmic effects. A review with special reference to torsade de pointes tachycardia. Annals of Internal Medicine, 121 , 529–535. 10.7326/0003-4819-121-7-199410010-00009 8067651\nKawabata, M. , Hirao, K. , Takeshi, S. , Sakurai, K. , Inagaki, H. , Hachiya, H. , & Isobe, M. (2008). Torsades de pointes related to transient marked QT prolongation following successful emergent percutaneous coronary intervention for acute coronary syndrome. Journal of Electrocardiology, 41 , 117–122. 10.1016/j.jelectrocard.2007.09.009 18328336\nKotake, Y. , Kurita, T. , Akaiwa, Y. , Yasuoka, R. , Motoki, K. , Kobuke, K. , … Miyazaki, S. (2015). Intravenous amiodarone homogeneously prolongs ventricular repolarization in patients with life‐threatening ventricular tachyarrhythmia. Journal of Cardiology, 66 , 161–167. 10.1016/j.jjcc.2014.10.004 25468767\nLepechkin, E. , & Surawicz, B. (1952). The measurement of the QT‐interval of the electrocardiogram. Circulation, 6 , 378–387. 10.1161/01.cir.6.3.378 14954534\nMilberg, P. , Ramtin, S. , Mönnig, G. , Osada, N. , Wasmer, K. , Breithardt, G. , … Eckardt, L. (2004). Comparison of the in vitro electrophysiologic and proarrhythmic effects of amiodarone and sotalol in a rabbit model of acute atrioventricular block. Journal of Cardiovascular Pharmacology, 44 , 278–286. 10.1097/01.fjc.0000129581.81508.78 15475823\nShenthar, J. , Rachaiah, J. M. , Pillai, V. , Chakali, S. S. , Balasubramanian, V. , & Chollenhalli Nanjappa, M. (2017). Incidence of drug‐induced torsades de pointes with intravenous amiodarone. Indian Heart Journal, 69 , 707–713. 10.1016/j.ihj.2017.05.024 29174246\nSicouri, S. , & Antzelevitch, C. (1991). A subpopulation of cells with unique electrophysiological properties in the deep subepicardium of the canine ventricle: The M cell. Circulation Research, 68 , 1729–1741. 10.1161/01.RES.68.6.1729 2036721\nvan Opstal, J. M. , Schoenmakers, M. , Verduyn, S. C. , de Groot, S. H. M. , Leunissen, J. D. M. , van der Hulst, F. F. , … Vos, M. A. (2001). Chronic amiodarone evokes no torsade de pointes arrhythmias despite QT lengthening in an animal model of acquired long‐QT syndrome. Circulation, 104 , 2722–2727. 10.1161/hc4701.099579 11723026\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1082-720X",
"issue": "26(3)",
"journal": "Annals of noninvasive electrocardiology : the official journal of the International Society for Holter and Noninvasive Electrocardiology, Inc",
"keywords": "Tpeak-Tend interval; amiodarone; hemodialysis; tachycardia-induced-cardiomyopathy; torsade de pointes; transmural dispersion of repolarization",
"medline_ta": "Ann Noninvasive Electrocardiol",
"mesh_terms": null,
"nlm_unique_id": "9607443",
"other_id": null,
"pages": "e12810",
"pmc": null,
"pmid": "33070441",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports",
"references": "15681701;1423949;9809901;33070441;14654302;15475823;14954534;18328336;8067651;29174246;11723026;25468767;2036721",
"title": "Torsade de pointes induced by intravenous amiodarone therapy accompanied by marked augmentation of the transmural dispersion of repolarization in a patient with tachycardia-induced-cardiomyopathy.",
"title_normalized": "torsade de pointes induced by intravenous amiodarone therapy accompanied by marked augmentation of the transmural dispersion of repolarization in a patient with tachycardia induced cardiomyopathy"
} | [
{
"companynumb": "JP-FRESENIUS KABI-FK202011738",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "AMIODARONE HYDROCHLORIDE"
},
"drugadditio... |
{
"abstract": "BACKGROUND\nMetastatic leiomyosarcomas of uterine or soft-tissue origin have poor prognosis and moderate chemosensitivity. Trabectedin has shown activity in pretreated leiomyosarcoma. We did a single-group, multicentre, phase 2 trial (LMS-02) to assess the effect of first-line doxorubicin and trabectedin combination on disease control and survival.\n\n\nMETHODS\nAdults (18 years to physiological age ≤70 years) with measurable metastatic or unresectable uterine leiomyosarcoma or soft-tissue leiomyosarcoma who had not received any previous chemotherapy were enrolled at 19 centres in France. Treatment consisted of 60 mg/m(2) intravenous doxorubicin followed by 1·1 mg/m(2) trabectedin in a 3 h intravenous infusion on day 1, both by the central venous route, and 6 mg subcutaneous pegfilgrastim on day 2, repeated every 3 weeks for up to six cycles. Surgery for residual disease was permitted. The primary endpoint was the proportion of patients achieving disease control, defined as complete or partial response or stable disease. Stratification was done by anatomical site and analyses were per protocol. This study is registered with ClinicalTrials.gov, number NCT02131480.\n\n\nRESULTS\nBetween July 28, 2010, and May 10, 2013, 109 patients were enrolled and treated, of whom 108 were assessable for response: 47 in the uterine leiomyosarcoma group and 61 in the soft-tissue leiomyosarcoma group. 32 (68%) patients in the uterine leiomyosarcoma group and 45 (74%) in the soft-tissue leiomyosarcoma group received all six cycles of treatment. Of 47 patients with uterine leiomyosarcoma, 28 (59·6%, 95% CI 44·3-73·6) achieved a partial response and 13 (27·7%, 15·6-42·6) stable disease; 41 (87·2%, 74·3-95·2) patients achieved disease control. Of 61 patients with soft-tissue leiomyosarcoma, two (3·3%, 95% CI 0·4-11·7) achieved a complete response, 22 (36·1%, 25·0-50·8) had a partial response, and 32 (52·5%, 40·8-67·3) had stable disease; 56 (91·8%, 81·9-97·3) of patients achieved disease control. The most common grade 3-4 treatment-associated adverse events were neutropenia (84 [78%] of 108 patients), increased alanine aminotransferase concentration (42 [39%]), thrombocytopenia (40 [37%]), anaemia (29 [27%]), febrile neutropenia (26 [24%]), and fatigue (21 [19%]).\n\n\nCONCLUSIONS\nDespite expected but manageable toxic effects, these results support the activity of doxorubicin plus trabectedin as first-line treatment for uterine leiomyosarcoma and soft-tissue leiomyosarcoma. This combination should be developed further in a phase 3 trial against the present standard of care.\n\n\nBACKGROUND\nPharmamar and Amgen.",
"affiliations": "Department of Medical Oncology, Institut Gustave Roussy, Villejuif, France. Electronic address: patricia.pautier@gustaveroussy.fr.;Department of Medical Oncology, Institut Bergonié, Bordeaux, France.;Department of Medical Oncology, Institut Claudius-Regaud, Toulouse, France.;Department of Medical Oncology, Centre Oscar-Lambret, Lille, France.;Department of Medical Oncology, Centre Henri-Becquerel, Rouen, France.;Department of Medical Oncology, Centre François-Baclesse, Caen, France.;Department of Medical Oncology, Centre Val d'Aurelle, Montpellier, France.;Department of Medical Oncology, Hôpital Tenon, Paris, France.;Department of Medical Oncology, Centre GF Leclerc, Dijon, France.;Department of Medical Oncology, Institut Curie, Paris, France.;Department of Medical Oncology Centre Antoine Lacassagne, Nice, France.;Department of Medical Oncology, Institut Paoli-Calmettes, Marseille, France.;Department of Medical Oncology, Centre René Gauducheau, Saint Herblain, France.;Department of Medical Oncology, Hôpital Cochin, Paris, France.;Department of Medical Oncology, Institut de Cancérologie de la Loire, Saint Priest en Jarez, France.;Department of Medical Oncology, Centre Hospitalo-Universitaire Dupuytren, Limoges, France.;Department of Medical Oncology, Centre Paul Papin, Angers, France.;Department of Medical Oncology, Institut Bergonié, Bordeaux, France.;Department of Medical Oncology, Institut Gustave Roussy, Villejuif, France.;Department of Biostatistics, Institut Gustave Roussy, Villejuif, France.;Department of Medical Oncology, La Timone University Hospital, Marseille, France.",
"authors": "Pautier|Patricia|P|;Floquet|Anne|A|;Chevreau|Christine|C|;Penel|Nicolas|N|;Guillemet|Cécile|C|;Delcambre|Corinne|C|;Cupissol|Didier|D|;Selle|Frédéric|F|;Isambert|Nicolas|N|;Piperno-Neumann|Sophie|S|;Thyss|Antoine|A|;Bertucci|François|F|;Bompas|Emmanuelle|E|;Alexandre|Jerôme|J|;Collard|Olivier|O|;Lavau-Denes|Sandrine|S|;Soulié|Patrick|P|;Toulmonde|Maud|M|;Le Cesne|Axel|A|;Lacas|Benjamin|B|;Duffaud|Florence|F|;|||",
"chemical_list": "D004149:Dioxoles; D044005:Tetrahydroisoquinolines; D004317:Doxorubicin; D000077606:Trabectedin",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1470-2045",
"issue": "16(4)",
"journal": "The Lancet. Oncology",
"keywords": null,
"medline_ta": "Lancet Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D004149:Dioxoles; D004317:Doxorubicin; D005260:Female; D006801:Humans; D053208:Kaplan-Meier Estimate; D007890:Leiomyosarcoma; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D009367:Neoplasm Staging; D012983:Soft Tissue Neoplasms; D044005:Tetrahydroisoquinolines; D000077606:Trabectedin; D014594:Uterine Neoplasms",
"nlm_unique_id": "100957246",
"other_id": null,
"pages": "457-64",
"pmc": null,
"pmid": "25795402",
"pubdate": "2015-04",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Trabectedin in combination with doxorubicin for first-line treatment of advanced uterine or soft-tissue leiomyosarcoma (LMS-02): a non-randomised, multicentre, phase 2 trial.",
"title_normalized": "trabectedin in combination with doxorubicin for first line treatment of advanced uterine or soft tissue leiomyosarcoma lms 02 a non randomised multicentre phase 2 trial"
} | [
{
"companynumb": "FR-PFIZER INC-2018253182",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PEGFILGRASTIM"
},
"drugadditional": null,
... |
{
"abstract": "The present study aimed at evaluating whether a weekly cisplatin, epirubicin, and paclitaxel (PET) regimen could increase the pathological complete response (pCR) rate in comparison with a tri-weekly epirubicin and paclitaxel administration in locally advanced breast cancer (LABC) patients. Patients with stage IIIB disease were randomised to receive either 12 weekly cycles of cisplatin 30 mg m(-2), epirubicin 50 mg m(-2), and paclitaxel 120 mg m(-2) (PET) plus granulocyte-colony stimulating factor support, or four cycles of epirubicin 90 mg m(-2)+paclitaxel 175 mg m(-2) (ET) every 3 weeks. Overall, 200 patients (PET/ET=100/100) were included in this study. A pCR in both breast and axilla occurred in 16 (16%) PET patients and in six (6%) ET patients (P=0.02). The higher activity of PET was evident only in ER negative (27.5 vs 5.4%; P=0.026), and in HER/neu positive (31 vs 5%; P=0.037) tumours. The two arms yielded similar pCR rate in ER positive (PET/ET=7.5/7.1%) and HER/neu negative (PET/ET=10/6%) patients. At a 39 months median follow-up, 70 patients showed a progression or relapses (PET, 32 vs ET, 38). Anaemia, mucositis, peripheral neuropathy, and gastrointestinal toxicity were substantially more frequent in the PET arm. The PET weekly regimen is superior to ET in terms of pCR rate in LABC patients with ER negative and/or HER2 positive tumours Mature data in terms of disease-free and overall survival are needed to ascertain whether this approach could improve the prognosis of these subsets of LABC patients.",
"affiliations": "Giuseppe Frasci, Division of Medical Oncology A, National Tumor Institute, via Mariano Semmola 80131, Naples, Italy. giuseppe.frasci@libero.it",
"authors": "Frasci|G|G|;D'Aiuto|G|G|;Comella|P|P|;Thomas|R|R|;Botti|G|G|;Di Bonito|M|M|;De Rosa|V|V|;Iodice|G|G|;Rubulotta|M R|MR|;Comella|G|G|;|||",
"chemical_list": "D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; D016179:Granulocyte Colony-Stimulating Factor; D015251:Epirubicin; D018719:Receptor, ErbB-2; D017239:Paclitaxel; D002945:Cisplatin",
"country": "England",
"delete": false,
"doi": "10.1038/sj.bjc.6603395",
"fulltext": "\n==== Front\nBr J Cancer\nBr J Cancer\nBritish Journal of Cancer\n0007-0920\n1532-1827\nNature Publishing Group\n\n6603395\n10.1038/sj.bjc.6603395\n17047649\nClinical Study\nWeekly cisplatin, epirubicin, and paclitaxel with granulocyte colony-stimulating factor support vs triweekly epirubicin and paclitaxel in locally advanced breast cancer: final analysis of a sicog phase III study\nWeekly PET vs ET in LABC\nFrasci G 1*\nD'Aiuto G 1\nComella P 1\nThomas R 1\nBotti G 1\nDi Bonito M 1\nDe Rosa V 1\nIodice G 1\nRubulotta M R 1\nComella G 1\nfor the Southern Italy Cooperative Oncology Group (SICOG)- Italy\n1 Giuseppe Frasci, Division of Medical Oncology A, National Tumor Institute, via Mariano Semmola 80131, Naples, Italy\n* E-mail: giuseppe.frasci@libero.it\n23 10 2006\n17 10 2006\n95 8 10051012\n03 04 2006\n04 09 2006\n04 09 2006\nCopyright © 2006 Cancer Research UK\n2006\nCancer Research UK\nhttps://creativecommons.org/licenses/by/4.0/ This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material.If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit https://creativecommons.org/licenses/by/4.0/.\nThe present study aimed at evaluating whether a weekly cisplatin, epirubicin, and paclitaxel (PET) regimen could increase the pathological complete response (pCR) rate in comparison with a tri-weekly epirubicin and paclitaxel administration in locally advanced breast cancer (LABC) patients. Patients with stage IIIB disease were randomised to receive either 12 weekly cycles of cisplatin 30 mg m−2, epirubicin 50 mg m−2, and paclitaxel 120 mg m−2 (PET) plus granulocyte-colony stimulating factor support, or four cycles of epirubicin 90 mg m−2+paclitaxel 175 mg m−2 (ET) every 3 weeks. Overall, 200 patients (PET/ET=100/100) were included in this study. A pCR in both breast and axilla occurred in 16 (16%) PET patients and in six (6%) ET patients (P=0.02). The higher activity of PET was evident only in ER negative (27.5 vs 5.4%; P=0.026), and in HER/neu positive (31 vs 5%; P=0.037) tumours. The two arms yielded similar pCR rate in ER positive (PET/ET=7.5/7.1%) and HER/neu negative (PET/ET=10/6%) patients. At a 39 months median follow-up, 70 patients showed a progression or relapses (PET, 32 vs ET, 38). Anaemia, mucositis, peripheral neuropathy, and gastrointestinal toxicity were substantially more frequent in the PET arm. The PET weekly regimen is superior to ET in terms of pCR rate in LABC patients with ER negative and/or HER2 positive tumours Mature data in terms of disease-free and overall survival are needed to ascertain whether this approach could improve the prognosis of these subsets of LABC patients.\n\npaclitaxel\nepirubicin\ncisplatin\nweekly administration\nLABC\nrandomised trial\n==== Body\npmcThe role of chemotherapy in improving the prognosis of locally advanced breast cancer (LABC) patients is widely recognised. High objective response rates can be achieved with standard combination chemotherapy, rendering in most cases the tumour operable at the end of the treatment (Hortobagyi and Buzdar, 1997). Primary chemotherapy is also becoming very popular in patients with operable disease at diagnosis, since it permits a substantial increase in the rate of breast-sparing surgery, and allows an early pathological evaluation of the effect of treatment. The absence of residual tumour in both breast and axilla is associated with a much lower risk of relapse (Chollet et al, 2002; Faneyete et al, 2003). Unfortunately, the chance of achieving such a goal in women with LABC is low. Indeed, in the NSABP-B18 trial, the pCR rate after primary chemotherapy was <3% in women with T3 (operable) disease (Fisher et al, 1997). During the last decade, several new drugs with different mechanisms of action have been introduced into clinical practice. Among them, the taxanes (paclitaxel and docetaxel) have raised great enthusiasm, and have been rapidly incorporated in combination regimens (Dombernowsky et al, 1996; Moliterni et al, 1997).\n\nPhase III trials comparing taxane- vs non taxane-including regimens, have been carried out in breast cancer patients with loco-regional disease. Both in the NSABP-B27 (Bear et al, 2003) and in the Aberdeen (Smith et al, 2002) studies, the addition of docetaxel resulted in a two-times greater pCR rate in comparison with the standard arm. Notably, a substantial proportion of patients in the Aberdeen trial had LABC. French investigators (Dieras et al, 2004) reported a significantly higher pCR rate with primary doxorubicin plus paclitaxel in comparison with a standard doxorubicin plus cyclophosphamide regimen.\n\nA better therapeutic index has been recently hypothesised for the weekly paclitaxel administration. In an MDACC trial (Green et al, 2005), 258 patients with operable disease were randomised to receive either weekly or every 3 weeks paclitaxel followed by four FAC (5-fluorouracil, doxorubicin and cyclophosphamide cycles before surgery. The pCR rate in the weekly arm was twice that of the tri-weekly arm (28.8 vs 13.6%).\n\nIn the last few years, increasing interest has arisen about the role of platinum compounds in the treatment of breast cancer patients. Several cisplatin-based regimens have been tested in the neo-adjuvant setting, showing high anti tumour activity (Orlando et al, 2001; Ezzat et al, 2004). In the mid-nineties, we started the assessment of a weekly triplet regimen including cisplatin, epirubicin, and paclitaxel (PET regimen) in breast cancer patients (Frasci et al, 1999). This weekly approach was initially tested in a phase II study in women with LABC (Frasci et al, 2000). The promising activity data we observed (overall response rate, 90%, and pCR rate, 12%) prompted us to start the present phase III trial, which aimed at comparing this regimen with a tri-weekly epirubicin plus paclitaxel administration.\n\nMETHODS\n\nEligibility criteria\n\nPatients with histological proven locally advanced (T4 a-d and/or N2 fixed to other structures) breast cancer with no prior chemotherapy were eligible. Other selection criteria were: age <75, ECOG performance status ⩽2, adequate bone marrow (ANC ⩾2.0 × 109 l−1, platelet count ⩾100 × 109 l−1, and haemoglobin level ⩾100 g l−1), liver (bilirubin level <1.5 the upper normal limit [UNL], AST and/or ALT <3 × UNL, prothrombin time <1.5 times control), renal (creatinine clearance ⩾60 ml min−1) and cardiac functions (left ventricular ejection fraction >50%, absence of severe cardiac arrhythmia or heart failure, second- or third-degree heart block or acute myocardial infarction within 4 months prior to study entry). Previous or concurrent malignancy, were also considered as exclusion criteria, except for inactive nonmelanoma skin cancer, and in situ carcinoma of the cervix. All patients gave their written informed consent, and the trial was approved by the Independent Ethical Committee of the National Tumour Institute of Naples.\n\nPretreatment evaluation\n\nWithin 4 weeks before starting chemotherapy, all patients underwent the following studies: complete history and physical examination, ECG and bi-dimensional echocardiography, mammography, chest X-ray, liver ultrasonography, radionuclide bone scan (with X-ray evaluation of suspicious bone segments), and CT or MRI of the brain in the case of suspected brain involvement. Laboratory investigation included a complete blood cell count with white blood cell (WBC) differential and platelet count, BUN, creatinine, bilirubin, SGOT, alkaline phosphatase, lactate dehydrogenase, prothrombin time, partial thromboplastin and thrombin time, urinalysis. A core biopsy of the primary tumour was also performed with the immunohistochemical assessment of the main prognostic variables (steroid hormones receptors, Ki67, HER2/neu). The HER2/neu was measured by using the monoclonal antibodies Mab 1 and CB11 on 3 μm sections of paraffin-embedded tumour samples.\n\nTreatment\n\nAll eligible patients were randomly allocated to receive: (arm A) epirubicin 50 mg m−2 as an i.v. bolus, followed by paclitaxel 120 mg m−2 as a 1-h infusion, and cisplatin 30 mg m−2 as a 30 min infusion, weekly for a maximum of 12 cycles. Recombinant human G-CSF 300 μg day−1 was also given subcutaneously on days 3–5 of each week. Short-term forced hyperhydration (1 l of saline over 2 h), and prophylaxis for nausea/vomiting (HT3 receptor antagonists) were also performed. Prophylaxis for hypersensitivity reactions consisted of dexamethasone 8 mg i.v. and promethazine 50 mg i.m. plus ranitidine 50 mg i.v. 30 min before paclitaxel administration; or (arm B) epirubicin 90 mg m−2 as an i.v. bolus, followed by paclitaxel 175 mg m−2 as a 1-h infusion, every 3 weeks for a maximum of four cycles. The same antiemetic and antihypersensitivity procedures adopted for arm A were performed.\n\nWithin 4 weeks from the end of chemotherapy patients underwent surgery. Breast sparing surgery was performed whenever feasible. It consisted of quadrantectomy together with standard level I and II axillary lymph-node dissection.\n\nFour cycles of CMF were delivered after surgery, in patients whose pathologic assessment showed less than four involved axillary lymph nodes; whereas four FEC (epirubicin 60 mg m−2 instead of methotrexate) cycles were administered in those women showing four or more involved axillary nodes. On completion of postoperative chemotherapy, radiotherapy was performed on all patients who underwent conservative surgery, and to those who underwent mastectomy and had more than three axillary nodes involved, muscle, skin and/or nipple involvement, or had G3 tumour at diagnosis.\n\nHormone treatment was also given on completion of postoperative chemotherapy. LH-RH analogue for 2 years together with tamoxifen for 5 years was administered in premenopausal, and 5-year tamoxifen was given in postmenopausal women.\n\nDOSE ADJUSTMENTS ACCORDING TO TOXICITY\n\nArm A: chemotherapy was given at full doses if neutrophil count was ⩾1.5 × 109 l−1, and platelet count was ⩾100 × 109 l−1. Doses were reduced by 50% if neutrophil count was < 1.5/109 and ⩾1.0/109 l−1, or platelet count was <100 × 109 l−1 and ⩾75/109 l−1. In the case of grade ⩾3 neutropenia, grade ⩾2 thrombocytopenia, or grade >1 nonhaematological toxicity the treatment was always omitted. In the presence of grade 4 neutropenia, febrile neutropenia, grade 4 thrombocytopenia, grade 4 anaemia, grade 3–4 nonhaematological toxicity (except for alopecia) doses were reduced by 25% in the subsequent administrations. G-CSF was allowed in the presence of grade 4 neutropenia of any duration, or neutropenic fever, or if grade 3 neutropenia persisted for 2 weeks after the scheduled time of recycling. The treatment was definitively discontinued if chemotherapy could not be delivered 3 weeks after the scheduled time of recycling.\n\nArm B: chemotherapy was given at full doses for neutrophil count ⩾2000 mm−3, and platelet count ⩾100 000 mm−3. If neutrophil count was ⩾1500 mm−3 persisted after a 1-week delay, chemotherapy was delivered at 75% of the planned dose.\n\nIn the presence of grade 4 neutropenia, febrile neutropenia, grade 4 thrombocytopenia, grade 4 anaemia, grade 3–4 nonhaematological toxicity (except for alopecia) doses were reduced to 75% in the subsequent administrations. G-CSF was allowed in the presence of grade 4 neutropenia of any duration, or neutropenic fever, or if grade 3 neutropenia persisted for 2 weeks after the scheduled time of recycling. The treatment was definitively discontinued if chemotherapy could not be delivered three weeks after the scheduled time of recycling.\n\nToxicity and response evaluation criteria\n\nToxicity was assessed at the weekly visits and recorded using the NCI-CTC version 3.0. Complete blood cell and WBC count were performed once a week in all patients, and every other day in cases of grade 4 haematological toxicity. Bidimensional echocardiography was performed on completion of treatment.\n\nClinical tumour response was assessed within 2 weeks from the end of chemotherapy, and classified according to standard WHO criteria (Miller et al, 1981). Clinical examination, mammography, breast ultrasonography were performed to assess the regression of the tumour in both breast and axilla. In addition, chest X-ray, and abdomen ultrasonography were also performed, in order to exclude the presence of distant metastases.\n\nFor pathologic assessment of response, the amount of residual epithelial neoplastic cells in the tumour mass, and the location of malignant component (invasive vs intraductal) were taken into account (Chevallier et al, 1993). Response in the breast was scored as follows: class I (absence of residual malignant epithelial cells), class II (persistence of only in situ residual malignant component), class III (only focal invasive tumour residuals), class IV (no substantial modifications in the tumour mass). Patients showing a class I or II response in the breast, together with absence of axillary involvement were considered as pCR.\n\nEnd points and statistical considerations\n\nThe pCR rate was the main end point. We set as 5% the pCR rate expected with the administration of epirubicin plus paclitaxel, and we hypothesised a 10% increase with the PET regimen. To have an 80% power to demonstrate such a difference with an alpha error <5%, at least 90 patients per arm were required (Casagrande et al, 1978).\n\nProgression-free survival (PFS) and overall survival (OS) were also analysed. PFS was considered as the interval between randomisation and documentation of progressive disease or relapse (in surgically treated patients). Overall survival was considered as the interval between randomisation and death by any cause. All time-dependent curves were estimated by the Kaplan Meier method (Kaplan and Meier, 1958). All patients were included in the analysis of response and survival on an ‘intent to treat basis’.\n\nRESULTS\n\nDemographics\n\nBetween May 1999 and November 2004, 200 consecutive women with LABC were enrolled into this study. Table 1 outlines the main patient characteristics. Overall, 136 patients had T4a-b-c disease, while 47 women had inflammatory carcinoma, and 17 N2 disease. Patients (144) had ductal carcinoma, and oestrogen or progesterone receptors were positive in 110 and 103 patients, respectively. Patients (43) were HER2+.\n\nCompliance to proposed treatment\n\nWomen (13) in the PET and seven women in ET arm did not complete the planned number of chemotherapy cycles. Early disease progression was the cause of treatment discontinuation in three PET and four ET patients. The remaining early discontinuations were a consequence of severe toxicity or patient's refusal: in the PET arm, reasons for withdrawal were: severe emesis in two cases, persistence of severe mucositis in one case, severe peripheral neuropathy in two cases, severe fatigue in three cases, and patient's refusal in two cases. In the ET arm, severe emesis (one case), and fatigue (two cases) forced the treatment interruption.\n\nA treatment delay due to persistence of haematological toxicity or grade >1 non haematological toxicity on day of recycling occurred in 18 and 11 patients in PET and ET arm, respectively. A dose reduction was performed at least once in 35 PET and 21 ET patients, respectively. In all, 71 PET and 83 ET patients actually received ⩾80% of the planned dose-intensity (Figure 1).\n\nResponse\n\nAll the 200 enrolled patients were included into the response analysis on an ‘intent to treat basis’. Table 2 summarises clinical response data. In the PET arm, 28 complete and 60 partial responses were recorded at clinical restaging. An additional nine patients showed a minor regression or stabilisation of the tumour. In the ET arm, a clinically complete or partial response occurred in 19 and 59 patients, respectively. An additional 18 women showed a minor response or no change.\n\nAccording to receptor status, a clinical complete response occurred in 19/40 (47.5%) ER negative and 8/53 (15%) ER positive patients (one CR in a woman with hormone receptor status unknown) in the PET arm. In the ET arm, a clinical complete response occurred in 6/37 (16.2%) ER negative, and 12/57 (21%) ER positive patients (one CR in a patient with unknown hormone receptor status). Regarding HER2/neu status, 9/23 (40%) HER2+ and 16/68 (23.6%) HER2− achieved a complete response in the PET arm, as compared to 7/20 (35%) HER2+ and 10/68 (14.7%) HER 2− in ET arm (Table 3).\n\nOverall, 186 women (PET 94, ET 92) underwent surgery. Breast sparing surgery was performed in a total of 37 patients (PET 23, ET 14). Table 4 summarises the pathological response data. In all, 22 patients (PET 13, ET 9) showed absence of residual malignant epithelial cells, either invasive or intraductal, in the breast specimen. Only in situ residual tumour cells were found in additional 14 women (PET 9, ET 5). Therefore, the pCR rate in the breast was 22% in PET and 14% and ET arm, respectively. A pPR in the breast (i.e., only focal invasive tumour residuals in the removed breast tissue) was recorded in 38 PET and 26 ET patients, respectively. Overall, 59 women (PET 35, ET 24) showed negative axilla. Among the 141 patients with persistence of tumour in the axilla, 60 (PET 33, ET 27) had one to three lymph nodes involved, and 81 (PET 32, ET 49) four or more nodes.\n\nIn all, 22 patients (PET 16, ET 6) showed an absence of invasive tumour in both breast and axilla; the pCR rate being 16 and 6% in PET and ET arm, respectively (P=0.02). In the PET arm, 11 pCRs were observed among 40 ER negative tumours (27.5%) as compared to four pCRs among 53 ER positive (7.5%), and one among the seven with unknown hormone receptor status (14.3%). In the ET arm, two pCRs were registered in the 37 ER negative (5.4%) and four pCRs in the 57 ER positive tumours (7.1%). One out of four women with ER positive tumour, achieving a pCR, had negative PgR. All 11 ER negative tumours who achieved a pCR in the PET arm, were PgR negative too. If a comparison between the two arms is made taking into account the hormone receptor status, the advantage of PET treatment is highly evident in ER negative patients (PET 27.5 vs ET 5.4%; P=0.026), while it did not appear in the ER positive subgroup (PET 7.5 vs ET 7%) (Table 5).\n\nEight pCRs were observed in the 43 patients (18.6%) HER2/neu positive, as compared to 11/136 (8%) HER2 negative cases (3/21 patients with HER2/neu unknown had a pCR). Also in this case the superiority of the PET regimen was evident only in those patients with HER2 positive tumour (31 vs 5%; P=0.037) (Table 5).\n\nAfter a median follow-up of 39 (range, 4–70) months, 70 patients had progressed or relapsed (PET 32, ET 38), and the median PFS was 38.5 and 40.1 months in PET and ET arm, respectively. Five-year projected PFS probability was 30 and 25% for PET and ET, respectively (Figure 2).\n\nSeven (PET 4, ET 3) of the 22 patients showing a pCR had relapsed at the time of the present analysis (Figure 3).\n\nOverall, 35 out of 77 patients with ER negative tumour (PET 16, ET 19) had progression or relapse at the time of the present analysis, as compared to 31 (PET 14, ET 17) out of 110 patients with ER positive tumour; median PFS being 30.1 and 47.6 months, respectively (Figure 4). Median PFS times in ER positive patients were 38.2 months and 40.7 months for PET and ET, respectively; while they were 32 and 34 months, respectively, in ER negative patients (Figures 5, 6). Four failures occurred in the 13 patients with unknown receptor status.\n\nOverall, 19 (PET 8, ET 11) of the 43 patients with HER2 positive tumour had progressed or relapsed, median PFS being 25.5 months. A total of 43 (PET 20, ET 23) failures had occurred in the 136 HER2 negative patients, median PFS being 44.7 months (Figure 7).\n\nOverall, 26 deaths (PET 10, ET 16) had occurred at the time of the present analysis. Median survival had not been reached in both arms.\n\nToxicity\n\nA total of 1122 PET courses and 386 ET courses were delivered and analysed for toxicity. No toxic deaths were observed in either arms. Table 6 shows the number of patients in each arm who experienced at least one grade ⩾3 toxicity.\n\nHaematological toxicity was not substantially different in the two arms, except for anaemia. Overall 45 patients in PET and 38 in ET arm experienced a grade ⩾3 neutropenia. Grade 4 occurred in 17 and 18 cases, respectively. Neutropenic fever was observed in three PET and four ET patients. Severe thrombocytopenia was almost anecdotic, grade 3 or 4 occurring in only six patients (four PET and two ET). Only one case of grade 4 thrombocytopenia was recorded, occurring in the PET arm. Severe anaemia occurred in one ET patient, as compared to 13 (13%) PET patients.\n\nOverall, severe gastrointestinal toxicity and fatigue were also more frequent in the PET arm. They caused early chemotherapy discontinuation in a total of eight patients (five PET and three ET). Severe emesis, loss of appetite, and diarrhoea occurred in 10, 13, and 15% of PET as compared to 4, 5, and 2% of ET arm. Severe fatigue occurred in 11 (11%) patients of PET and two (2%) patients of ET arm.\n\nNeurotoxicity and mucositis and were also common side effects in both arms. Overall, 34 (34%) PET and 16 (16%) ET patients complained of sensory neuropathy, but it was severe in only three patients of PET arm, and in two cases it caused treatment discontinuation. Severe mucositis was recorded in 12 PET patients, and in one case it caused the definitive treatment discontinuation. Only one patient of the ET arm experienced severe mucositis. Renal, liver and cardiac toxicity were very uncommon. There were no cases of severe functional impairment of these organs. Five PET and three ET patients had a LVEF decrease below 50%. In all but one patient (treated with PET), LVEF returned within the normal range. No patients showed clinical signs of congestive heart failure.\n\nDISCUSSION\n\nIn the present randomised study, we aimed at evaluating whether 12 weekly preoperative cycles of PET with G-CSF support could improve the pCR rate achievable in patients with LABC (stage IIIB) in comparison with ET tri-weekly administration.\n\nOur results seem to suggest that the PET weekly treatment is more effective than the tri-weekly ET regimen in producing a pCR. Indeed, the chance of achieving a complete clearance of the tumour in both breast and axilla in the PET arm was more than twice that of the ET arm.\n\nThe rate of pCR obtained in the present study with the standard treatment (ET) does not seem to be underestimated. In the Milan NCI experience, the use of neoadjuvant doxorubicin-paclitaxel combination gave a 7% pCR rate in a study population including 41 II/IIIA and 38 IIIB patients (Moliterni et al, 1997). Canadian authors recently reported a 9% pCR rate in 49 patients with locally advanced disease, 60% of whom had stage IIB and IIIA. They also remarked that, depending on the definition of pCR used, the range of pCR varied from 4.2% (using definition from Chevallier) to 10.6% (using that of NSABP-27 study) (Dent et al, 2005).\n\nThe present study was sized setting the pCR rate as the target end point. Of course, the achievement of a complete eradication of the tumour in both breast and axilla may be considered a meaningful end point only if it is associated with a substantial improvement of the long-term disease-free survival.\n\nAt the time of the present analysis, the number of observed failures (70 progressions or relapses) is too low to even allow us to speculate about the impact that this new regimen may have on prognosis of these patients. Moreover, given the very small rate of patients who are expected to have a substantial DFS gain (16 vs 6% pCRs), a much larger study population would be required to statistically detect such a gain.\n\nAnalysis of our data strongly suggests that this dose dense approach may be superior only in some subsets of patients and not in the whole population. Indeed, an impressive increase of the pCR rate with the PET regimen was obtained in patients with ER negative (27.5 vs 5.4%) and/or HER2/neu positive tumour (31 vs 5%), while the activity of the two regimens was comparable in patients with ER positive (7.5 vs 7%) and/or HER2/neu negative tumour (10 vs 6%). The modest effect of the primary chemotherapy in ER positive tumours was noted by other investigators, who recently reported a much higher pCR rate with chemotherapy in ER/PgR negative patients (Faneyete et al, 2003; Colleoni et al, 2004; Ring et al, 2004; Gianni et al, 2005) and seems to suggest that aggressive chemotherapy should not be advisable in hormone-sensitive tumours. In a previous phase II study, testing the PET regimen in patients with large operable breast cancer, we observed a pCR rate in 66% in ER negative patients as compared to 14% in ER positive (Frasci et al, 2005).\n\nIn the present study, seven out of 22 pCRs relapsed. This relapse rate looks similar to that of the total population. However, in the ER/PgR negative group 4/13 pCRs relapsed as compared to 31/64 non-pCRs. Moreover, three out of four relapsing pCRs were also HER2 positive, and in two cases brain was the first site of relapse. These findings suggest that chemotherapy alone is not enough in the management of HER2 positive patients, who might benefit of a prolonged trastuzumab treatment.\n\nOn the other hand, the impressive increase of the pCR rate in ER/PgR negative tumours with the weekly treatment could represent a simple ‘optical illusion’ if not followed by a substantial advantage in long-term disease-free survival of patients. An occult metastatic spread may derive from malignant cell clones, which have developed an acquired resistance to cytotoxic drugs, and are therefore less sensitive to the induction chemotherapy than the primary tumour. At the Mount Sinai Medical Center 144 patients with LABC treated with neoadjuvant chemotherapy were reviewed to evaluate the prognostic impact of chemotherapy-induced histological changes. Little evidence in favour of predictivity of pathological response was found (Gajdos et al, 2002). In another recent report from the US NCI, 107 patients with stage III breast cancer were treated with a multimodality approach. Pathologic response was not associated with improved survival for stage IIIA and inflammatory breast cancer patients (Low et al, 2004). In an MDACC retrospective analysis conducted on 372 women with LABC, the DFS and OS of the pCRs group were significantly better than those of the other group; however, investigators remarked that a pCR did not eliminate the risk of recurrence (Kuerer et al, 1999).\n\nIn the present study, a reduction of the risk of relapse with the PET regimen becomes evident after 3 years in ER/PgR negative patients, and is maintained beyond 5 years. Given the small study population, it is clear that such a difference cannot be statistically significant, even with a more mature follow-up. A new randomised trial, specifically targeted to ER/PgR negative patients, with an adequate sample size is required to address this issue.\n\nThe impressive increase of the pCR rate in HER2/neu positive patients with the weekly treatment also deserves some considerations. There are several possible factors responsible for the observed better tumour shrinkage in the PET arm. Firstly, the increase of the epirubicin dose intensity, as previously reported by French authors (Petit et al, 2001).\n\nThe adoption of a weekly paclitaxel schedule might also have a role. In the CALGB 9840 trial, (Seidman et al, 2004) weekly paclitaxel significantly improved ORR and survival of metastatic breast cancer patients, when compared with standard every 3 weeks paclitaxel. However, in patients with HER2/neu normal tumour, the weekly administration failed to produce a significant gain in both ORR and survival.\n\nIn spite of the very impressive pCR rate observed in HER2 positive patients, the DFS outcome was disappointing in this group, the risk of relapse being relevant even in pCRs. Of course, the discovery of a drug specifically targeting HER2/neu overexpressing tumour cells has deeply modified the therapeutic strategy in this subset of patients. The capability of trastuzumab in improving the prognosis of patients with metastatic disease is well established (Slamon et al, 2001). Preliminary reports also suggest that the addition of trastuzumab to a standard anthracycline-taxane combination can dramatically increase the pCR rate in women with operable breast cancer (Buzdar et al, 2005).\n\nThe addition of trastuzumab to a dose dense aggressive chemotherapy, like PET, could result in a further substantial increment of the pCR rate. Moreover, it could substantially increase the probability of obtaining the eradication of the distant micrometastases, as suggested by the results of several large randomised trials (Piccart-Gebhart et al, 2005; Romond et al, 2005).\n\nA final consideration on the toxicity profiles of the two regimens deserves to be made. Although our dose dense approach did not cause any life-threatening toxicity, it produced a substantial increase of severe side effects, which may negatively impact on the quality of life of patients. Severe anaemia was significantly more frequent in the PET arm, and it resulted in a substantially higher proportion of patients complaining about severe fatigue. PET treatment was also associated with more severe nonhaematological toxicity. In particular, diarrhoea, peripheral neuropathy and mucositis occurred more frequently in the PET arm, being the main causes of patient's discomfort. In view of that, an accurate selection of patients who more likely can benefit of this approach is mandatory in the next future.\n\nIn conclusion, a 3-month preoperative treatment with weekly PET plus G-CSF support yields a significantly higher pathological complete response rate in women with LABC compared with four tri-weekly ET cycles. The superiority of the PET regimen was limited to hormone-receptor negative or HER2/neu overexpressing tumours. PET treatment was associated with a substantial increase in nonhaematological toxicity. A longer follow-up is needed to better evaluate the impact of this new approach on failure-free and OS. However, such a dose-dense approach is not recommended in women with ER/PgR positive LABC. Adequately powered, randomised trials are required to evaluate whether this approach can significantly improve prognosis of ER negative and/or HER2 positive LABC patients.\n\nFigure 1 Relative dose Intensity.\n\nFigure 2 Progression free survival.\n\nFigure 3 DFS according to pathological response.\n\nFigure 4 PFS according to ER status.\n\nFigure 5 PFS in ER/PgR positive.\n\nFigure 6 PFS in ER negative patients.\n\nFigure 7 PFS according to HER2 status.\n\nTable 1 Demographics\n\nCharacteristic\tPET (100 patients)\tET (100 patients)\tTotal (200 patients)\t\nAge\t\n Median (range)\t53 (27–73)\t54 (30–72)\t54 (27–73)\t\n < 65/⩾65\t52/48\t49/51\t101/99\t\n \t \t \t \t\nStage\t \t \t \t\n T4 N0\t12\t14\t26\t\n T4 N1\t79\t78\t157\t\n Any T N2\t9\t8\t17\t\n \t \t \t \t\nBreast tumour\t\n T4a-c/d\t67/24\t69/23\t136/47\t\n \t \t \t \t\nHistology\t \t \t \t\n Ductal\t71\t73\t144\t\n Lobular\t19\t18\t37\t\n Mixed\t4\t4\t8\t\n Mucinous\t3\t2\t5\t\n Other\t3\t3\t6\t\n \t \t \t \t\nGrading\t\n I\t9\t12\t21\t\n II\t33\t30\t63\t\n III\t55\t54\t109\t\n Unknown\t3\t4\t7\t\n \t \t \t \t\nMenopausal status\t\n Pre-/postmenopausal\t33/67\t31/69\t64/136\t\n \t \t \t \t\nHormone receptors status\t\n ER: yes/no/unknown\t53/40/7\t57/37/6\t110/77/13\t\n PgR: yes/no/unknown\t50/43/7\t53/41/6\t103/84/13\t\n \t \t \t \t\nHER/neu status\t\n Pos/neg/unknown\t23/68/9\t20/68/12\t43/136/21\t\n\nTable 2 Clinical response according to treatment ARM\n\n \tPET no. (%)\t \tET no. (%)\tTotal no. (%)\t\nComplete\t28 (28)\tP=NS\t19 (19)\t47 (23.5)\t\nPartial\t60 (60)\t \t59 (59)\t119 (59.5)\t\nMR/NC\t9 (9)\t \t18 (18)\t27 (13.5)\t\nPD\t3 (3)\t \t4 (4)\t7 (3.5)\t\n\nTable 3 Complete response according to hormone receptors and her/neu status\n\n \tPET no. (%)\t \tET no. (%)\tTotal no. (%)\t\nHormone receptors\t\n ER−\t19/40 (47.5)\tP<0.05\t6/37 (16.2)\t25/77 (32.5)\t\n ER+\t8/53 (15)\tP=NS\t12/57 (21)\t20/110 (18)\t\n Unknown\t1/7 (14.5)\t \t1/6 (16.5)\t2/13 (15.4)\t\n \t \t \t \t \t\nHER/neu\t \t \t \t \t\n +\t9/23 (40)\tP=NS\t7/20 (35)\t16/43 (37.2)\t\n −\t16/68 (23.6)\tP=NS\t10/68 (14.7)\t26/136 (19)\t\nUnknown\t3/9 (33.3)\t \t2/12 (16.7)\t5/21 (24)\t\n\nTable 4 Pathological assessment according to treatment arm\n\n \tPET no. (%)\t \tET no. (%)\tTotal no. (%)\t\nBreast\t\n Class I\t13 (13)\tP=NS\t9 (9)\t22 (11)\t\n Class II\t9 (9)\tP=NS\t5 (5)\t14 (7)\t\n Class III\t38 (38)\t \t26 (26)\t64 (32)\t\n Class IV\t40 (40)\t \t60 (60)\t100 (50)\t\n \t \t \t \t \t\nAxilla\t\n N0\t35 (35)\t \t24 (24)\t59 (29.5)\t\n N1–3\t33 (33)\t \t27 (27)\t60 (30)\t\n N >3\t32 (32)\t \t49 (49)\t81 (40.5)\t\npCR (class I+II and N0)\t16 (16)\tP=0.02\t6 (6)\t22 (11)\t\n\nTable 5 Pathological complete response according to pretreatment features\n\n \tPET no. pCR (%)\tET no. pCR (%)\tTotal no. pCR (%)\t\nER−\t11/40 (27.7)*\t2/37 (5.4)\t13/77 (17)\t\nER+\t4/53 (7.5)\t4/57 (7.1)\t8/110 (7)\t\nUnknown\t1/7 (14)\t0/6\t1/13 (8)\t\n \t \t \t \t\nHER pos\t7/23 (31)#\t1/20 (5)\t8/43 (18.6)\t\nHER neg\t7/68 (10)\t4/68 (6)\t11/136 (8)\t\nUnknown\t2/9 (22)\t1/12 (8)\t3/21 (14)\t\n* PET vs ET: P=0.026.\n\n# PET vs ET; P=0.037.\n\nTable 6 Who grade 3–4 toxicity in the two arms\n\n \tPET (100)\tET (100)\t\n \tNo. of patients (%)\tNo. of patients (%)\t\nNeutropenia\t45 (45)\t38 (38)\t\nSepsis\t3 (3)\t4 (4)\t\nThrombocytopenia\t4 (4)\t2 (2)\t\nAnaemia\t13 (13)\t1 (1)\t\nNausea\t9 (9)\t6 (6)\t\nVomiting\t6 (6)\t4 (4)\t\nLoss of appetite\t13 (10)\t5 (5)\t\nDiarrhoea\t15 (15)\t2 (2)\t\nMucositis\t12 (12)\t1 (1)\t\nNeurotoxicity\t3 (3)\t0\t\nRenal\t0\t0\t\nLiver\t0\t0\t\nFatigue\t11 (11)\t2 (2)\t\n \t \t \t\nCardiac toxicity\t\n < 50% LVEF\t5 (5)\t3 (3)\t\n Congestive failure\t0\t0\t\n \t \t \t\nSkin toxicity\t3 (3)\t0\n==== Refs\nBear HD, Anderson S, Brown A, Smith R, Mamounas EP, Fisher B, Margolese R, Theoret H, Soran A, Wickerham DL, Wolmark N, National Surgical Adjuvant Breast and Bowel Project protocol B-27 (2003) The effect on tumor response of adding sequential preoperative docetaxel to preoperative doxorubicin and cyclophosphamide: preliminary results from the National Surgical Adjuvant Breast and Bowel Project protocol B-2. J Clin Oncol 21 : 4165–417414559892\nBuzdar AU, Ibrahim NK, Francis D, Booser DJ, Thomas ES, Theriault RL, Pusztai L, Green MC, Arun BK, Giordano SH, Cristofanilli M, Frye DK, Smith TL, Hunt KK, Singletary SE, Sahin AA, Ewer MS, Buchholz TA, Berry D, Hortobagyi GN (2005) Significantly higher pathologic complete remission rate after neoadjuvant therapy with trastuzumab, paclitaxel, and epirubicin chemotherapy: results of a randomized trial in human epidermal growth factor receptor 2-positive operable breast cancer. J Clin Oncol 23 : 3676–368515738535\nCasagrande JT, Pike MC, Smith PG (1978) An improved formula for calculating sample sizes for comparing two binomial distributions. Biometrics 34 : 483–486719125\nChevallier B, Roche H, Olivier JP, Chollet P, Hurteloup P (1993) Inflammatory breast cancer. Pilot study of intensive induction chemotherapy (FEC-HD) results in a high histologic response rate. Am J Clin Oncol 16 : 223–2288338056\nChollet P, Amat S, Cure H, de Latour M, Le Bouedec G, Mouret-Reynier MA, Ferriere JP, Achard JL, Dauplat J, Penault-Llorca F (2002) Prognostic significance of a complete pathological response after induction chemotherapy in operable breast cancer. Br J Cancer 86 : 1041–104611953845\nColleoni M, Viale G, Zahrieh D, Pruneri G, Gentilini O, Veronesi P, Gelber RD, Curigliano G, Torrisi R, Luini A, Intra M, Galimberti V, Renne G, Nole F, Peruzzotti G, Goldhirsch A (2004) Chemotherapy is more effective in patients with breast cancer non expressing steroid hormone receptors: a study of preoperative treatment. Clin Cancer Res 10 : 6622–662815475452\nDent RA, Verma S, Fitzgerald B, Halloway C, Lickley L, Kahn H, Wright F, Pignol JP, Trudeau M, Lenis M, Clemons M (2005) Do clinical trials of neoadjuvant chemotherapy for locally-advanced breast cancer overestimate the actual response rates observed in clinical practice? J Clin Oncol 23 : 100s (abstr. 890)\nDieras V, Fumoleau P, Romieu G, Tubiana-Hulin M, Namer M, Mauriac L, Guastalla JP, Pujade-Lauraine E, Kerbrat P, Maillart P, Penault-Llorca F, Buyse M, Pouillart P (2004) Randomized parallel study of doxorubicin plus paclitaxel and doxorubicin plus cyclophosphamide as neoadjuvant treatment of patients with breast cancer. J Clin Oncol 22 : 4958–496515611510\nDombernowsky P, Gehl J, Boesgaard M, Paaske T, Jensen BV (1996) Doxorubicin and paclitaxel, a highly active combination in the treatment of metastatic breast cancer. Semin Oncol 23 : 23–27\nEzzat AA, Ibrahim EM, Ajarim DS, Rahal MM, Raja MA, Tulbah AM, Al-Malik OA, Al-Shabanah M, Sorbris R (2004) Phase II study of neoadjuvant paclitaxel and cisplatin for operable and locally advanced breast cancer: analysis of 126 patients. Br J Cancer 90 : 968–97414997191\nFaneyete IF, Schrama JG, Peterse JL, Remijnse PL, Rodenhuis S, van Vijver MJ (2003) Breast cancer response to neoadjuvant chemotherapy: predicting markers and relation with outcome. Br J Cancer 88 : 406–41212569384\nFisher B, Brown A, Mamounas E, Wieand S, Robidoux A, Margolese RG, Cruz Jr AB, Fisher ER, Wickerham DL, Wolmark N, DeCillis A, Hoehn JL, Lees AW, Dimitov NV (1997) Effect of preoperative chemotherapy on loco-regional disease in women with operable breast cancer: Findings from National Surgical Adjuvant Breast and Bowel Project B-18. J Clin Oncol 15 : 2483–24939215816\nFrasci G, D'Aiuto G, Comella P, Apicella A, Thomas R, Capasso I, Di Bonito M, Carteni G, Biglietto M, De Lucia L, Maiorino L, Piccolo S, Bianchi U, D'Aniello R, Lapenta L, Comella G (1999) Cisplatin-epirubicin-paclitaxel weekly administration in advanced breast cancer: A phase I study of the Southern Italy Cooperative Oncology Group. Breast Cancer Res and Treat 56 : 239–25210573115\nFrasci G, D’Aiuto G, Comella P, Thomas R, Botti G, Di Bonito M, D’Aiuto M, Romano G, Rubulotta MR, Comella G (2005) A two-month cisplatin-epirubicin-paclitaxel weekly administration is highly effective in large operable breast cancer. A SICOG phase II study Ann Oncol 16 : 1268–1275\nFrasci G, D'Aiuto G, Comella P, Thomas R, Capasso I, Di Bonito M, Rivellini F, Carteni G, De Lucia L, Maiorino L, D'Aniello R, Frezza P, Lapenta L, Comella G (2000) Cisplatin-epirubicin-paclitaxel weekly administration with G-CSF support in advanced breast cancer: A Southern Italy Cooperative Oncology Group. Phase II study. Breast Cancer Res Treat 62 : 87–9711016746\nGajdos C, Tartter PI, Estabrook A, Gistrak MA, Jaffer S, Bleiweiss I (2002) Relationship of clinical and pathologic response to neoadjuvant chemotherapy and outcome of locally advanced breast cancer. J Surg Oncol 80 : 4–1111967899\nGianni L, Baselga J, Eiermann W, Guillem Porta V, Semiglazov V, Lluch A, Zambetti M, Sabadell D, Raab G, Llombart Cussac A, Bozhok A, Martinez-Agullo A, Greco M, Byakhov M, Lopez Lopez JJ, Mansutti M, Valagussa P, Bonadonna G, European Cooperative Trial in Operable Breast Cancer Study Group (2005) Feasibility and tolerability of sequential doxorubicin/paclitaxel followed by cyclophosphamide, methotrexate, and fluorouracil and its effects on tumor response as preoperative therapy. Clin Cancer Res 11 : 8715–872116361558\nGreen MC, Buzdar A, Smith T, Ibrakim NK, Valero V, Rosales MF, Cristofanili M, Booser DJ, Pusztai L, Rivera E, Theriault RL, Carter C, Frye D, Hunt KK, Symmans WF, Strom EA, Sahin AA, Sikov W, Hortobagyi GN (2005) Weekly paclitaxel improves pathologic complete remission in operable breast cancer when compared with paclitaxel once every 3 weeks. J Clin Oncol 23 : 5983–599216087943\nHortobagyi G, Buzdar AU (1997) Locally-advanced breast cancer. In: Textbook of breast cancer: A clinical guide to therapy Bonadonna G, Hortobagyi GN, Gianni AM (eds) pp 155–168. London, UK: Martin Dunitz Ltd\nKaplan ES, Meier P (1958) Non parametric estimation for incomplete observations. J Am Stat Assoc 53 : 557–580\nKuerer HM, Newman LA, Smith TL, Ames FC, Hunt KK, Dhingra K, Theriault RL, Singh G, Binkley SM, Sneige N, Buchholz TA, Ross MI, McNeese MD, Buzdar AU, Hortobagyi GN, Singletary SE (1999) Clinical course of breast cancer patients with complete pathological primary tumor and axillary lymph node response to doxorubicin-based neoadjuvant chemotherapy. J Clin Oncol 17 : 460–46910080586\nLow JA, Berman AW, Steinberg SM, Danforth DN, Lippman ME, Swain SM (2004) Long-term follow-up for locally-advanced and inflammatory breast cancer patients treated with multimodality therapy. J Clin Oncol 22 : 4067–407415483018\nMiller AB, Hoogstraten B, Staquet M, Winkler A (1981) Reporting results of cancer treatment. Cancer 47 : 207–2147459811\nMoliterni A, Tarenzi E, Capri G, Terenziani M, Bertuzzi A, Grasselli G, Agresti R, Piotti P, Greco M, Salvadori B, Pilotti S, Lombardi F, Valagussa P, Bonadonna G, Gianni L (1997) Pilot study of primary chemotherapy with doxorubicin plus paclitaxel in women with locally advanced or operable breast cancer. Semin Oncol 24 , S17-10-S17-14\nOrlando L, Colleoni M, Curigliano G, Nole F, Ferretti G, Masci G, Peruzzotti G, Minchella I, Intra M, Veronesi P, Viale G, Goldhirsch A (2001) Chemotherapy with vinorelbine, cisplatin and continuous infusion of 5-fluorouracil in locally advanced breast cancer: a promising low-toxic regimen. Anticancer Res 21 : 4135–413911911307\nPetit T, Borel C, Ghnassia JP, Rodier JF, Escande A, Mors R, Haegele P (2001) Chemotherapy response of breast cancer depends on HER2 and anthracycline dose intensity in the neoadjuvant setting. Clin Cancer Res 7 : 1577–158111410493\nPiccart-Gebhart MJ, Procter M, Leyland-Jones B, Goldhirsch A, Untch M, Smith I, Gianni L, Baselga J, Bell R, Jackisch C, Cameron D, Dowsett M, Barrios CH, Steger G, Huang CS, Andersson M, Inbar M, Lichinitser M, Lang I, Nitz U, Iwata H, Thomssen C, Lohrisch C, Suter TM, Ruschoff J, Suto T, Greatorex V, Ward C, Straehle C, McFadden E, Dolci MS, Gelber RD, Herceptin Adjuvant (HERA) Trial Study Team (2005) Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer. N Engl J Med 353 (16): 1659–167216236737\nRing AE, Smith IE, Ashley S, Fulford LG, Lakhani SR (2004) Oestrogen receptor status, pathological complete response and prognosis in patients receiving neoadjuvant chemotherapy for early breast cancer. Br J Cancer 91 : 2012–201715558072\nRomond EH, Perez EA, Bryant J, Suman VJ, Geyer Jr CE, Davidson NE, Tan-Chiu E, Martino S, Paik S, Kaufman PA, Swain SM, Pisansky TM, Fehrenbacher L, Kutteh LA, Vogel VG, Visscher DW, Yothers G, Jenkins RB, Brown AM, Dakhil SR, Mamounas EP, Lingle WL, Klein PM, Ingle JN, Wolmark N (2005) Trastuzumab plus adjuvant chemotherapy for operable HER2-positive breast cancer. N Engl J Med 353 (16): 1673–168416236738\nSeidman AD, Berry D, Cirrincione C, Harris L, Dressler L, Muss H, Norton L, Winer E, Hudis C (2004) CALGB 9840: Phase III study of weekly paclitaxel via 1-hr infusion versus standard infusion every third week in the treatment of metastatic breast cancer, with trastuzumab for HER2 positive MBC and randomized for Taxol in HER2 normal MBC. J Clin Oncol 22 : 6s (abstr. 512)\nSlamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, Norton L (2001) Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. New Engl J Med 344 : 783–79211248153\nSmith IC, Heys SD, Hutcheon AW, Miller ID, Payne S, Gilbert FJ, Ah-See AK, Eremin O, Walker LJ, Sarkar JK, Eggleton SP, Ogston KN (2002) Neoadjuvant chemotherapy in breast cancer: Significantly enhanced response with docetaxel. J Clin Oncol 20 : 1456–146611896092\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0007-0920",
"issue": "95(8)",
"journal": "British journal of cancer",
"keywords": null,
"medline_ta": "Br J Cancer",
"mesh_terms": "D000328:Adult; D000368:Aged; D000740:Anemia; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D002945:Cisplatin; D003967:Diarrhea; D004334:Drug Administration Schedule; D015251:Epirubicin; D005221:Fatigue; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D053208:Kaplan-Meier Estimate; D008875:Middle Aged; D009503:Neutropenia; D017239:Paclitaxel; D010349:Patient Compliance; D018719:Receptor, ErbB-2; D011960:Receptors, Estrogen; D011980:Receptors, Progesterone; D016896:Treatment Outcome",
"nlm_unique_id": "0370635",
"other_id": null,
"pages": "1005-12",
"pmc": null,
"pmid": "17047649",
"pubdate": "2006-10-23",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": "10573115;16361558;11248153;11410493;11896092;11911307;11953845;11967899;12569384;14559892;14997191;15475452;15483018;719125;7459811;8338056;8893895;9215816;9374085;10080586;15558072;15611510;15738535;15937055;16087943;16236737;16236738;11016746",
"title": "Weekly cisplatin, epirubicin, and paclitaxel with granulocyte colony-stimulating factor support vs triweekly epirubicin and paclitaxel in locally advanced breast cancer: final analysis of a sicog phase III study.",
"title_normalized": "weekly cisplatin epirubicin and paclitaxel with granulocyte colony stimulating factor support vs triweekly epirubicin and paclitaxel in locally advanced breast cancer final analysis of a sicog phase iii study"
} | [
{
"companynumb": "IT-AMGEN-ITASP2022027963",
"fulfillexpeditecriteria": "2",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "FILGRASTIM"
},
"drugadditional": "4",
... |
{
"abstract": "Cryptococcal meningitis is a relatively common invasive fungal infection in immunocompromised patients, especially in solid organ transplant recipients. Clinical presentation typically includes fever, headache, photophobia, neck stiffness, and/or altered mental status. Unusual presentations may delay diagnosis. Therapy is challenging in renal transplant patients because of the nephrotoxicity associated with amphotericin B, the recommended treatment. We present a case of cryptococcal meningitis in a renal transplant recipient presenting as acute sinusitis with successful treatment using fluconazole as primary therapy.",
"affiliations": "Department of Medicine, St. John's Medical Center, Detroit, Michigan, USA.",
"authors": "Iyer|S P|SP|;Movva|K|K|;Wiebel|M|M|;Chandrasekar|P|P|;Alangaden|G|G|;Carron|M|M|;Tranchida|P|P|;Revankar|S G|SG|",
"chemical_list": "D000935:Antifungal Agents; D015725:Fluconazole",
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.12128",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "15(5)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "Cryptococcus; meningitis; renal transplantation; sinusitis",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D000935:Antifungal Agents; D003455:Cryptococcus neoformans; D003937:Diagnosis, Differential; D005260:Female; D015725:Fluconazole; D006801:Humans; D016867:Immunocompromised Host; D016030:Kidney Transplantation; D016919:Meningitis, Cryptococcal; D008875:Middle Aged; D012852:Sinusitis",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "E187-90",
"pmc": null,
"pmid": "24034280",
"pubdate": "2013-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Cryptococcal meningitis presenting as sinusitis in a renal transplant recipient.",
"title_normalized": "cryptococcal meningitis presenting as sinusitis in a renal transplant recipient"
} | [
{
"companynumb": "US-TEVA-617572USA",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMPHOTERICIN B"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nIn a recent multicenter randomized trial comparing unfractionated heparin (UFH) with low-molecular-weight heparin (dalteparin) for thromboprophylaxis in 3,746 critically ill patients, 17 patients (0.5%) developed heparin-induced thrombocytopenia (HIT) based on serotonin-release assay-positive (SRA+) status. A trend to a lower frequency of HIT with dalteparin vs UFH was observed in the intention-to-treat analysis (five vs 12 patients, P = .14), which was statistically significant (three vs 12 patients, P = .046) in a prespecified per-protocol analysis that excluded patients with DVT at study entry. We sought to characterize HIT outcomes and to determine how dalteparin thromboprophylaxis may reduce HIT frequency in patients in the ICU.\n\n\nMETHODS\nIn 17 patients with HIT, we analyzed platelet counts and thrombotic events in relation to the study drug and other open-label heparin, to determine whether the study drug plausibly explained seroconversion to SRA+ status and/or breakthrough of thrombocytopenia/thrombosis. We also compared antibody frequencies (dalteparin vs UFH) in 409 patients serologically investigated for HIT.\n\n\nRESULTS\nHIT-associated thrombosis occurred in 10 of 17 patients (58.8%) (8:1:1 venous:arterial:both). Dalteparin was associated with fewer study drug-attributable HIT-related events (P = .020), including less seroconversion (P = .058) and less breakthrough of thrombocytopenia/thrombosis (P = .032). Antiplatelet factor 4/heparin IgG antibodies by enzyme-linked immunosorbent assay were less frequent among patients receiving dalteparin vs UFH (13.5% vs 27.3%, P < .001). One patient with HIT-associated DVT died after UFH bolus (anaphylactoid reaction), whereas platelet counts recovered in two others with HIT-associated VTE despite continuation of therapeutic-dose UFH.\n\n\nCONCLUSIONS\nThe lower risk of HIT in patients in the ICU receiving dalteparin appears related to both decreased antibody formation and decreased clinical breakthrough of HIT among patients forming antibodies.",
"affiliations": "Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON, Canada. Electronic address: twarken@mcmaster.ca.;Department of Pathology and Molecular Medicine, McMaster University, Hamilton, ON, Canada.;Department of Clinical Epidemiology and Biostatistics, McMaster University, Hamilton, ON, Canada.;St. Michael's Hospital and the University of Toronto, Toronto, ON, Canada.;Ottawa Hospital General Campus and University of Ottawa, Ottawa, ON, Canada.;Pavilhão Pereira Filho, Santa Casa de Porto Alegre, Brazil.;Mount Sinai Hospital and the University of Toronto, Toronto, ON, Canada.;Alfred Hospital, Melbourne, Melbourne, VIC, Australia.;Flinders Medical Centre and Flinders University, Adelaide, SA, Australia.;Monash Medical Centre, Melbourne, VIC, Australia.;Box Hill Hospital and Monash University, Melbourne, VIC, Australia.;Mayo Clinic, Rochester, MN.;Capital Health Queen Elizabeth II Health Science Center and Dalhousie University, Halifax, NS, Canada.;Vancouver Island Health Authority, Victoria, BC, Canada.;Charles LeMoyne Hospital, Longueuil, QC, Canada.;St. Joseph's Healthcare, Hamilton, ON, Canada.;St. Joseph's Healthcare, Hamilton, ON, Canada.",
"authors": "Warkentin|Theodore E|TE|;Sheppard|Jo-Ann I|JI|;Heels-Ansdell|Diane|D|;Marshall|John C|JC|;McIntyre|Lauralyn|L|;Rocha|Marcelo G|MG|;Mehta|Sangeeta|S|;Davies|Andrew R|AR|;Bersten|Andrew D|AD|;Crozier|Tim M|TM|;Ernest|David|D|;Vlahakis|Nicholas E|NE|;Hall|Richard I|RI|;Wood|Gordon G|GG|;Poirier|Germain|G|;Crowther|Mark A|MA|;Cook|Deborah J|DJ|;|||",
"chemical_list": "D000925:Anticoagulants; D017985:Dalteparin",
"country": "United States",
"delete": false,
"doi": "10.1378/chest.13-0057",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-3692",
"issue": "144(3)",
"journal": "Chest",
"keywords": null,
"medline_ta": "Chest",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D001792:Blood Platelets; D016638:Critical Illness; D017985:Dalteparin; D004305:Dose-Response Relationship, Drug; D004797:Enzyme-Linked Immunosorbent Assay; D005260:Female; D006801:Humans; D007275:Injections, Intravenous; D008297:Male; D008875:Middle Aged; D011379:Prognosis; D013921:Thrombocytopenia; D055815:Young Adult",
"nlm_unique_id": "0231335",
"other_id": null,
"pages": "848-858",
"pmc": null,
"pmid": "23722881",
"pubdate": "2013-09",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Heparin-induced thrombocytopenia in medical surgical critical illness.",
"title_normalized": "heparin induced thrombocytopenia in medical surgical critical illness"
} | [
{
"companynumb": "PHHY2017CA040001",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DALTEPARIN"
},
"drugadditional": null,
"drug... |
{
"abstract": "BACKGROUND\nIncreasing numbers of patients are being treated with TNF-alpha inhibitors. Two patients in our outpatient clinic developed Merkel cell carcinoma during treatment with TNF alpha inhibitors. Since this is a very rare malignancy, this is a remarkable observation.\n\n\nMETHODS\nA 70-year-old male with rheumatoid arthritis had been treated with etanercept for two years when he discovered a nodule on his elbow that started growing rapidly. It was diagnosed as Merkel cell carcinoma. Despite treatment, the patient died 2 years later.\n\n\nCONCLUSIONS\nMerkel cell carcinoma is an aggressive malignancy with a clinically benign aspect. Patients treated with TNF-alpha inhibitors possibly have an increased risk of developing this malignancy.",
"affiliations": "Meander Medisch Centrum, Amersfoort. s.linn@meandermc.nl",
"authors": "Linn-Rasker|Suzanne P|SP|;van Albada-Kuipers|G A|GA|;Dubois|Stefan V|SV|;Janssen|Karlijn|K|;Zweers|Petra G M A|PG|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D018501:Antirheumatic Agents; D007074:Immunoglobulin G; D018124:Receptors, Tumor Necrosis Factor; D014409:Tumor Necrosis Factor-alpha; D000068879:Adalimumab; D000068800:Etanercept",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-2162",
"issue": "156(22)",
"journal": "Nederlands tijdschrift voor geneeskunde",
"keywords": null,
"medline_ta": "Ned Tijdschr Geneeskd",
"mesh_terms": "D000068879:Adalimumab; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D018501:Antirheumatic Agents; D001172:Arthritis, Rheumatoid; D015266:Carcinoma, Merkel Cell; D000068800:Etanercept; D005260:Female; D006801:Humans; D007074:Immunoglobulin G; D008297:Male; D008875:Middle Aged; D018124:Receptors, Tumor Necrosis Factor; D012878:Skin Neoplasms; D014409:Tumor Necrosis Factor-alpha",
"nlm_unique_id": "0400770",
"other_id": null,
"pages": "A4464",
"pmc": null,
"pmid": "22647228",
"pubdate": "2012",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Merkel cell carcinoma during treatment with TNF-alpha inhibitors: coincidence or warning?.",
"title_normalized": "merkel cell carcinoma during treatment with tnf alpha inhibitors coincidence or warning"
} | [
{
"companynumb": "NL-SA-2018SA180628",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
"... |
{
"abstract": "The nematode Strongyloides stercoralis, outside the tropics and subtropics present in small endemic foci, can cause an infection after direct skin contact with contaminated soil containing infective filariform larvae and, rarely, after intimate interhuman contact or after transplantation of an infected solid organ. Following skin penetration, migration, and maturation through several stages, a small number of invasive filariform larvae can develop anew in the gut lumen, perpetuating new cycles of penetration, tissue migration, and reproduction, without leaving the host.In a state of immunosuppression, autoinfection can progress to life-threatening hyperinfection and/or infection disseminated through virtually any organ. In developed countries, the most frequently recognized risk for severe hyperinfection is corticosteroid therapy, but this has been also described in malnourished, alcoholic, cancer, and transplant patients. Due to the frequent need for immunosuppressive therapy, patients suffering from inflammatory bowel disease (IBD) are susceptible to develop overwhelming strongyloidiasis. Strongyloidiasis can be easily overlooked in clinical settings, and in many European regions there is poor insight into the epidemiological burden of this disease.We present a case of S. stercoralis hyperinfection that triggered 3 successive episodes of sepsis caused by pathogens of the gut flora in a young patient suffering from stenotic form of Crohn's disease. S. stercoralis hyperinfection occurred in the corticosteroid-free period, shortly after resection of the terminal ileum, which was probably the trigger for the overwhelming course. The patient was successfully treated with 10-day albendazole therapy.",
"affiliations": "School of Medicine, University of Zagreb, Zagreb, Croatia.;School of Medicine, University of Zagreb, Zagreb, Croatia.;School of Medicine, University of Zagreb, Zagreb, Croatia.;School of Medicine, University of Zagreb, Zagreb, Croatia.;University Hospital Center Zagreb, Division of Gastroenterology and Hepatology, Zagreb, Croatia.;University Hospital Center Zagreb, Division of Gastroenterology and Hepatology, Zagreb, Croatia.",
"authors": "Topić|Mirjana Balen|MB|;Čuković-Čavka|Silvija|S|;Brinar|Marko|M|;Kalauz|Mirjana|M|;Škrlec|Ivica|I|;Majerović|Matea|M|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1055/a-0578-9799",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0044-2771",
"issue": "56(4)",
"journal": "Zeitschrift fur Gastroenterologie",
"keywords": null,
"medline_ta": "Z Gastroenterol",
"mesh_terms": "D000328:Adult; D000818:Animals; D003424:Crohn Disease; D006801:Humans; D007082:Ileum; D007165:Immunosuppression Therapy; D008297:Male; D011183:Postoperative Complications; D018805:Sepsis; D017171:Strongyloides stercoralis; D013322:Strongyloidiasis",
"nlm_unique_id": "0033370",
"other_id": null,
"pages": "380-383",
"pmc": null,
"pmid": "29642251",
"pubdate": "2018-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Terminal ileum resection as a trigger for Strongyloides stercoralis hyperinfection and ensuing serial sepsis in a 37-year-old patient with complicated Crohn's disease: a case report.",
"title_normalized": "terminal ileum resection as a trigger for strongyloides stercoralis hyperinfection and ensuing serial sepsis in a 37 year old patient with complicated crohn s disease a case report"
} | [
{
"companynumb": "PHHY2018HR166496",
"fulfillexpeditecriteria": "1",
"occurcountry": "HR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": "1",
... |
{
"abstract": "For the past 50 years, local anesthetics such as lidocaine have been commonly used in various clinical settings. Its use is not just limited to anesthesia and surgery but is also frequently utilized in internal medicine and in primary care setting for bedside procedures. Despite its widespread use, most physicians are not familiar with the life-threatening manifestations of lidocaine toxicity and its treatment. Our case demonstrates a successful resuscitation after cardiac arrest in a healthy 33-year-old female with systemic lidocaine toxicity after she received lidocaine as a local anesthetic. Our goal is to educate general internists and primary care physicians of the possible hazards of lidocaine use. We also aim to create mindfulness of the symptoms of lidocaine toxicity and the use of intravenous lipid emulsion as an antidote.",
"affiliations": "Department of Internal Medicine, University of Missouri Kansas City (UMKC).;Department of Internal Medicine, University of Missouri Kansas City (UMKC).;Internal Medicine, NYU Langone Medical Center, New York.",
"authors": "Hasan|Badar|B|;Asif|Talal|T|;Hasan|Maryam|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.1275",
"fulltext": "\n==== Front\nCureusCureus2168-8184Cureus2168-8184Cureus Palo Alto (CA) 2865295810.7759/cureus.1275CardiologyInternal MedicineMedical EducationLidocaine-Induced Systemic Toxicity: A Case Report and Review of Literature Muacevic Alexander Adler John R Hasan Badar 1Asif Talal 2Hasan Maryam 3\n1 \nDepartment of Internal Medicine, University of Missouri Kansas City (UMKC) \n2 \nCardiology, John H. Stroger Hospital of Cook County, Chicago, USA \n3 \nInternal Medicine, NYU Langone Medical Center, New York \nTalal Asif asift@umkc.edu25 5 2017 5 2017 9 5 e12758 5 2017 25 5 2017 Copyright © 2017, Hasan et al.2017Hasan et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/7277-lidocaine-induced-systemic-toxicity-a-case-report-and-review-of-literatureFor the past 50 years, local anesthetics such as lidocaine have been commonly used in various clinical settings. Its use is not just limited to anesthesia and surgery but is also frequently utilized in internal medicine and in primary care setting for bedside procedures. Despite its widespread use, most physicians are not familiar with the life-threatening manifestations of lidocaine toxicity and its treatment. Our case demonstrates a successful resuscitation after cardiac arrest in a healthy 33-year-old female with systemic lidocaine toxicity after she received lidocaine as a local anesthetic. Our goal is to educate general internists and primary care physicians of the possible hazards of lidocaine use. We also aim to create mindfulness of the symptoms of lidocaine toxicity and the use of intravenous lipid emulsion as an antidote.\n\nlidocaine-induced systemic toxicitylocal anesthetic toxicityintravenous lipid emulsionThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nLocal anesthetics are widely used in everyday practice [1]. Their application ranges from use in outpatient medicine clinics to emergency departments and operation theaters [1]. Systemic toxicity from local anesthetics is rarely seen but can be potentially lethal by causing seizures, arrhythmias and cardiovascular collapse [1]. The site of administration and the dose of the local anesthetic delivered are independent risk factors for systemic toxicity [1]. We present a rare case of lidocaine-induced systemic toxicity in a healthy 33-year-old female who underwent an elective procedure as an outpatient. Our aim is to raise awareness among general internists to identify the warning signs of local anesthetic toxicity. We also intend to create an understanding of the pathophysiology behind its various clinical manifestations and the use of intravenous lipid infusion as the treatment of choice to reverse the symptoms.\n\nCase presentation\nA 33-year-old female patient with no significant past medical history presented originally for an elective nasal septoplasty at an outpatient surgical center for a deviated nasal septum. On pre-procedure assessment, her blood pressure was 112/70 mmHg, heart rate 82 beats per minute (bpm), respiratory rate 18 per minute and temperature 98°F. The patient denied having any allergies, alcohol, tobacco or illicit drug use. On cardiovascular examination, she had regular rate and rhythm with no murmurs. Her respiratory, abdominal and neurological exam was also unremarkable.\n\nAfter preliminary assessment, she was intubated with propofol and succinylcholine. The patient was then given 60 milliliters (ml) of 2% lidocaine with 1% epinephrine subcutaneously in the nasal mucosa. Shortly after receiving the lidocaine, the patient experienced bradycardia followed by a pulseless electrical activity (PEA). Cardiopulmonary resuscitation (CPR) was initiated with the administration of one milligram (mg) of epinephrine a total of three times as per advanced cardiac life support (ACLS) algorithm. Twenty minutes into chest compressions, local anesthetic systemic toxicity was suspected by anesthesia, and the patient was given a 100 ml bolus of 20% intravenous lipid emulsion (intralipids) with restoration of normal sinus rhythm within three minutes of injection. The patient was then placed on the intralipid and norepinephrine infusion and was subsequently transferred to our cardiac intensive care unit (CICU).\n\nThe patient was hypotensive upon arrival with a blood pressure of 60/40 mmHg and a heart rate of 115 bpm. The initial laboratory evaluation showed a normal complete blood count, comprehensive metabolic panel and troponin T level. The electrocardiogram revealed sinus tachycardia. A chest x-ray was obtained that showed evidence of bilateral pulmonary edema. A transthoracic echocardiogram (TTE) showed a severely reduced left ventricular systolic function with estimated ejection fraction between 10-15% (Figure 1).\n\nFigure 1 Initial TTE obtained at the time of admission showing an estimated ejection fraction of 10-15%. The arrow shows the dilated left ventricular chamber.\nTTE - Transthoracic echocardiogram\n\nNo valvular abnormalities were noted.\n\nThe patient was started on furosemide drip. She was titrated off norepinephrine and started on dobutamine for inotropic support. The case was also discussed with the poison control center and we were recommended to continue with supportive management and intralipid therapy. Next day, a repeat TTE showed improved an ejection fraction of 55% (Figure 2).\n\nFigure 2 TTE obtained on day 2 of admission showing an improved ejection fraction of 55%. The arrow points to improved left ventricular contraction.\nTTE - Transthoracic echocardiogram\n\nThe patient was subsequently weaned off the dobutamine drip and the lipid infusion. She was successfully extubated at the same time as well. A cardiac magnetic resonance imaging looking for infiltrative or inflammatory cardiomyopathy was obtained and was negative. Two days later the patient was discharged and was faring well on follow-up.\n\nDiscussion\nLidocaine is a class 1 B antiarrhythmic agent, which is mainly used for the treatment of ventricular arrhythmias. Since its advent in 1948, it has also become the most commonly used local anesthetic in the outpatient setting. According to a report published in 2013 by the US Poison Control Center, there were 1454 reports of lidocaine exposure with five cases ending up as a fatality [2]. Miscalculation of the dose, injection of the drug into a blood vessel or repeated administration of therapeutic doses are the major causes of systemic toxicity [2-3].\n\nLidocaine works by binding voltage-gated sodium channels thus inhibiting the propagation of action potential. The main target organs are the central nervous system (CNS) and the cardiovascular system (CVS). Since the CNS is more sensitive to electrophysiological changes than the CVS, neurological symptoms such as dizziness, tinnitus and peri-oral numbness usually precede cardiovascular manifestations. Aburwai, et al. demonstrated lidocaine dose dependent cardiotoxicity in murine cardiomyocytes by inhibiting myocardial cellular respiration. They explained the clinical manifestations of sinus slowing, prolonging of QRS interval, hypotension, shock, and dysrhythmias [4-5]. Separation of sarcomeres, focal myocardial and perivascular fibrosis are the key histological manifestations that have been described in one autopsy report of a suicide case from oral lidocaine ingestion [6].\n\nThe diagnosis of lidocaine toxicity is usually clinical as serum levels are not readily available and they do not guide or change treatment. Therapeutic concentrations of lidocaine can be up to 5.5 milligrams per liter (mg/L), whereas a plasma level of 8-12 mg/L and above is associated with CNS and cardiotoxicity [7].\n\nThe most critical aspect of local anesthetic is appropriate dosing. The recommended maximum dose for subcutaneous infiltration of lidocaine without epinephrine is 4.5 milligrams per kilogram (mg/kg) and for lidocaine with epinephrine is 7 mg/kg [8]. Asystole is usually seen in patients who receive 800-1000 milligrams (mg) of intravenous lidocaine [1]. Our patient’s weight was 65 kg and she received 60 mL of 2% solution. This totals 1200 mg which is four times the amount of recommended dose of 292 mg in her case.\n\nOnce a patient develops cardiac arrest the only therapy that prevents mortality is lipid infusion. It was first demonstrated by Weinberg, et al. in rats during resuscitation after a lethal dose of bupivacaine [9]. American Society of Regional Anesthesia and Pain Medicine recommends an initial bolus of 1.5 mL/kg of 20% intravenous lipids (intralipids) followed by a continuous infusion of 0.25 mL/kg/minute. If cardiac stability is not restored, then the infusion rate can be doubled to 0.5 mL/kg/min, and it is recommended to continue the infusion until cardiac stability is restored for at least 10 minutes. Various mechanisms have been postulated on how lipid infusion works, but the most widely accepted is the “Sink” theory by which lipids create a sink that extracts local anesthetics from plasma making them unavailable for myocardial tissue [5]. Repeated aspiration before each injection is a useful strategy to prevent toxicity [3].\n\nOur patient had no previous cardiac history. She was injected with four times the recommended dose of lidocaine at the anterior aspect of the nasal septum (with a rich blood supply) leading to cardiac arrest. The rapid lipid infusion led to the return of spontaneous circulation and an improvement in the ejection fraction from 15 to 55% over 24 hours, hence preventing morbidity and mortality.\n\nConclusions\nSystemic toxicity of lidocaine can be life-threatening. The rapid identification of clinical symptoms is key to prevent mortality. Our aim is to ensure that general internists and primary care physicians are able to diagnose and treat lidocaine toxicity. Once a patient develops cardiac arrest, following the general ACLS protocol would not result in successful resuscitation, and administration of intravenous lipid infusion is key to prevent mortality.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n==== Refs\nReferences\n1 Knowledge of the research assistants regarding local anaesthetics and toxicity Turk J Anaesthesiol Reanim Karasu D Yılmaz C Özgünay ŞE 201 44 2016 27909594 \n2 Lidocaine induced cardiac arrest in the emergency department: effectiveness of lipid therapy J Emerg Med Tierney KJ Murano T Natal B 47 50 50 2016 26602425 \n3 Intravenous lipid emulsion–rescued at last Br Dent J Ciechanowicz SJ Patil VK 237 241 212 2012 22402543 \n4 Inhibition of murine cardiomyocyte respiration by amine local anesthetics Eur J Drug Metab Pharmacokinet Aburawi EH Souid AK 293 299 39 2014 24254523 \n5 Intractable cardiac arrest due to lidocaine toxicity successfully resuscitated with lipid emulsion Crit Care Med Dix SK Rosner GF Nayar M 872 874 39 2011 21263316 \n6 Suicide due to oral ingestion of lidocaine: a case report and review of the literature Forensic Sci Int Centini F Fiore C Riezzo I 57 62 171 2007 16787726 \n7 Central nervous system toxicity following topical skin application of lidocaine Eur J Clin Pharmacol Brosh-Nissimov T Ingbir M Weintal I 683 684 60 2004 15568142 \n8 Estimated maximal safe dosages of tumescent lidocaine Anesth Analg Klein JA Jeske DR 1350 122 2016 26895001 \n9 Lipid infusion accelerates removal of bupivacaine and recovery from bupivacaine toxicity in the isolated rat heart Reg Anesth Pain Med Weinberg GL Ripper R Murphy P 296 303 31 2006 16857549\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "9(5)",
"journal": "Cureus",
"keywords": "intravenous lipid emulsion; lidocaine-induced systemic toxicity; local anesthetic toxicity",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e1275",
"pmc": null,
"pmid": "28652958",
"pubdate": "2017-05-25",
"publication_types": "D002363:Case Reports",
"references": "16787726;21263316;26602425;15568142;16857549;24254523;22402543;27909594;26895001",
"title": "Lidocaine-Induced Systemic Toxicity: A Case Report and Review of Literature.",
"title_normalized": "lidocaine induced systemic toxicity a case report and review of literature"
} | [
{
"companynumb": "US-INTERNATIONAL MEDICATION SYSTEMS, LIMITED-2024199",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LIDOCAINE"
},
"dr... |
{
"abstract": "OBJECTIVE\nThe WHO Classification of Tumours of the Central Nervous System (2016) classifies nonmeningothelial malignant spindle cell tumors involving the extraaxial tissues of the posterior fossa as melanocytic tumors and malignant mesenchymal tumors (sarcomas). The objective of this study was to conduct a review of the literature pertaining to the management strategies of posterior fossa malignant spindle cell tumors in the pediatric population.\n\n\nMETHODS\nThe authors performed an institutional search of their pathology database for patients younger than 18 years of age who presented with posterior fossa malignant spindle cell tumors. A literature review was also performed using the PubMed database, with \"posterior fossa\" or \"spindle cell tumors\" or \"Ewing sarcoma\" or \"high-grade\" or \"spindle cell sarcoma\" or \"leptomeningeal melanocytoma\" as keywords. The database search was restricted to pediatric patients (age ≤ 18 years). Parameters reported from the literature review included patient age, tumor location, presenting symptoms, treatment modalities (resection, chemotherapy, and/or radiotherapy), leptomeningeal spread at or after the time of treatment, and follow-up length and resulting outcome.\n\n\nRESULTS\nThe authors report 3 rare cases of posterior fossa malignant spindle cell tumors, including Ewing sarcoma in a 13-year-old male; high-grade spindle cell sarcoma, not otherwise specified in a 10-year-old male; and primary leptomeningeal melanocytoma in a 16-year-old female. All 3 patients underwent resection and radiotherapy and either chemotherapy or targeted immunotherapy. At the last follow-up, all patients were alive with either resolution or stable disease.\n\n\nCONCLUSIONS\nA review of these 3 cases and the existing literature support managing patients with intracranial malignant spindle cell tumors with multimodal therapy that can include a combination of resection, radiotherapy, and chemotherapy or immunotherapy to prolong progression-free and overall survival.",
"affiliations": "1Department of Neurosurgery, Penn State Health Milton S. Hershey Medical Center, Hershey.;1Department of Neurosurgery, Penn State Health Milton S. Hershey Medical Center, Hershey.;1Department of Neurosurgery, Penn State Health Milton S. Hershey Medical Center, Hershey.;2Department of Pathology, Penn State Health Milton S. Hershey Medical Center, Hershey; and.;3College of Medicine, Penn State Health Milton S. Hershey Medical Center, Hershey, Pennsylvania.;3College of Medicine, Penn State Health Milton S. Hershey Medical Center, Hershey, Pennsylvania.;1Department of Neurosurgery, Penn State Health Milton S. Hershey Medical Center, Hershey.;1Department of Neurosurgery, Penn State Health Milton S. Hershey Medical Center, Hershey.",
"authors": "Gigliotti|Michael J|MJ|;Mau|Christine|C|;Specht|Charles S|CS|;Lawson|Cynthia|C|;McNutt|Sarah|S|;Natarajan|Shreela|S|;Rizk|Elias B|EB|;Iantosca|Mark|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1933-0707",
"issue": "28(5)",
"journal": "Journal of neurosurgery. Pediatrics",
"keywords": "extra-axial mesenchymal tumors; management; oncology; pediatric; posterior fossa; spindle cell tumors",
"medline_ta": "J Neurosurg Pediatr",
"mesh_terms": null,
"nlm_unique_id": "101463759",
"other_id": null,
"pages": "609-619",
"pmc": null,
"pmid": "34416730",
"pubdate": "2021-08-20",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Malignant spindle cell tumors of the posterior fossa in children: case series and review of management.",
"title_normalized": "malignant spindle cell tumors of the posterior fossa in children case series and review of management"
} | [
{
"companynumb": "US-009507513-2204USA010012",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TEMOZOLOMIDE"
},
"drugadditional": "4",
... |
{
"abstract": "Patients with invasive giant prolactinoma suffer from a constellation of symptoms including headache, blurred vision, lethargy, and sexual dysfunction. Cabergoline, a potent dopamine agonist, is a known medication prescribed for the treatment of invasive giant prolactinoma. Here, we report a case of invasive giant prolactinoma in a 52-year-old Saudi male with dramatic response to cabergoline treatment clinically, biochemically, and radiologically.",
"affiliations": "Department of Medicine, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia.;Specialized Diabetes and Endocrine Center, King Fahad Medical City, Riyadh, Saudi Arabia. ; King Saud bin Abdul-Aziz University, College of Medicine, King Fahad Medical City, Riyadh, Saudi Arabia.",
"authors": "Alsubaie|Sadeem|S|;Almalki|Mussa H|MH|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.4137/CCRep.S15790",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1179-5476",
"issue": "7()",
"journal": "Clinical medicine insights. Case reports",
"keywords": "cabergoline; giant prolactinoma; pituitary tumor",
"medline_ta": "Clin Med Insights Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101531893",
"other_id": null,
"pages": "49-51",
"pmc": null,
"pmid": "25002819",
"pubdate": "2014",
"publication_types": "D002363:Case Reports",
"references": "12699451;23497585;23226667;4028456;18941037;12186457;17287412;1352243;10651752;2385731;16267335",
"title": "Cabergoline treatment in invasive giant prolactinoma.",
"title_normalized": "cabergoline treatment in invasive giant prolactinoma"
} | [
{
"companynumb": "SA-MYLANLABS-2014M1014384",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVOTHYROXINE SODIUM"
},
"drugadditional": nu... |
{
"abstract": "Pediatric periorificial dermatitis is a papulopustular eruption found around the facial orifices in children. Although the treatment of the disease has been largely anecdotal and experience-based, studies have shown that topical calcineurin inhibitors, as well as other topical and oral antibiotics, such as metronidazole, can be effective treatment options. However, most of the studies with a sizable number of patients have been based on the Caucasian population. Herein, we evaluated the clinical efficacy of topical calcineurin inhibitors and topical/oral metronidazole in 24 Korean patients with pediatric periorificial dermatitis. The majority of the patients showed a complete response to treatment.",
"affiliations": "Department of Dermatology, Seoul National University College of Medicine, Seoul, Korea.;Department of Dermatology, Seoul National University College of Medicine, Seoul, Korea.",
"authors": "Lee|Hanjae|H|https://orcid.org/0000-0002-4455-8001;Kim|Kyu Han|KH|https://orcid.org/0000-0001-8376-9090",
"chemical_list": "D000900:Anti-Bacterial Agents; D065095:Calcineurin Inhibitors; D008795:Metronidazole",
"country": "England",
"delete": false,
"doi": "10.1111/1346-8138.15695",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-2407",
"issue": "48(3)",
"journal": "The Journal of dermatology",
"keywords": "metronidazole; pediatric dermatology; pediatric periorificial dermatitis; perioral dermatitis; topical calcineurin inhibitor",
"medline_ta": "J Dermatol",
"mesh_terms": "D000287:Administration, Topical; D000900:Anti-Bacterial Agents; D065095:Calcineurin Inhibitors; D002648:Child; D019557:Dermatitis, Perioral; D005076:Exanthema; D006801:Humans; D008795:Metronidazole",
"nlm_unique_id": "7600545",
"other_id": null,
"pages": "405-407",
"pmc": null,
"pmid": "33275294",
"pubdate": "2021-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Treatment of pediatric periorificial dermatitis with topical calcineurin inhibitor and topical/oral metronidazole.",
"title_normalized": "treatment of pediatric periorificial dermatitis with topical calcineurin inhibitor and topical oral metronidazole"
} | [
{
"companynumb": "KR-TOLMAR, INC.-20KR024484",
"fulfillexpeditecriteria": "2",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "METRONIDAZOLE"
},
"drugadditional": "1",
... |
{
"abstract": "We herein describe a patient with non-occlusive mesenteric ischemia (NOMI) potentially associated with the administration of a sodium glucose co-transporter 2 (SGLT2) inhibitor. A 60-year-old man with type 1 diabetes was transferred to our hospital due to vomiting and respiratory distress. He was treated with insulin, metformin and a SGLT2 inhibitor, which had recently been added. He was diagnosed with intestinal ischemia complicated by diabetic ketoacidosis and lactic acidosis. Urgent exploratory surgery was performed, and the gangrenous bowel was resected. Histological findings confirmed the diagnosis of NOMI. The administration of SGLT2 inhibitors therefore requires certain exceptions for type 1 diabetes and cautious monitoring for the occurrence of these possible adverse effects.",
"affiliations": "Diabetes Center, Ebina General Hospital, Japan.",
"authors": "Gocho|Naoki|N|;Aoki|Ema|E|;Okada|Chiho|C|;Omura|Kazuki|K|;Hirashima|Takeshi|T|;Suzuki|Natsuko|N|;Tanaka|Hideki|H|;Omori|Yasue|Y|",
"chemical_list": "D007004:Hypoglycemic Agents; D007328:Insulin; D051269:Sodium-Glucose Transporter 1; D000068896:Canagliflozin",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.55.6338",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0918-2918",
"issue": "55(13)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000140:Acidosis, Lactic; D000068896:Canagliflozin; D003922:Diabetes Mellitus, Type 1; D016883:Diabetic Ketoacidosis; D006801:Humans; D007004:Hypoglycemic Agents; D007328:Insulin; D008297:Male; D065666:Mesenteric Ischemia; D008875:Middle Aged; D016491:Peripheral Vascular Diseases; D051269:Sodium-Glucose Transporter 1",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "1755-60",
"pmc": null,
"pmid": "27374678",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Non-occlusive Mesenteric Ischemia with Diabetic Ketoacidosis and Lactic Acidosis Following the Administration of a Sodium Glucose Co-transporter 2 Inhibitor.",
"title_normalized": "non occlusive mesenteric ischemia with diabetic ketoacidosis and lactic acidosis following the administration of a sodium glucose co transporter 2 inhibitor"
} | [
{
"companynumb": "PHHY2016JP099208",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CANAGLIFLOZIN"
},
"drugadditional": "3",
"dr... |
{
"abstract": "OBJECTIVE\nTo identify the clinical characteristics, reasons for use and response to treatment with anakinra in a series of patients with Kawasaki Disease (KD).\n\n\nMETHODS\nA retrospective chart review of patients treated with anakinra for KD diagnosed according to the AHA criteria. We compared clinical, biological and echocardiographic characteristics of KD before and after anakinra use. We analysed reasons for use of anakinra, and compared treatment regimens used in 7 European KD referral centres.\n\n\nRESULTS\nEight boys and 3 girls with treatment-refractory KD, aged 4 months to 9 years old, received at least 2 different KD treatments prior to anakinra, which was given on mean at 25 days after disease onset (8 to 87 days). The main reasons for use of anakinra were clinical and biological inflammation, progression of coronary dilatations, and severe myocarditis with cardiac failure. Doses of anakinra ranged from 2 to 8 mg/kg and duration varied from 6 to 81 days. Efficacy of anakinra was judged in terms of fever resolution (100%), decrease of CRP (100%), and in terms of its effect on coronary artery dilatation Z scores, which decreased in 10/11 patients and increased in one who died suddenly of pericardial hemorrhage.\n\n\nCONCLUSIONS\nAnakinra used late in the disease course led to a rapid and sustained improvement in clinical and biological inflammation. Our retrospective analysis did show neither a striking nor a rapid decrease of coronary dilatations and we cannot determine if anakinra itself had an effect on coronary artery dimensions.",
"affiliations": "Université Paris Sud-Saclay, UVSQ, Le Kremlin Bicêtre, France; AP-HP, CHU de Bicêtre, Pediatric Rheumatology, CEREMAIA, Le Kremlin Bicêtre, France. Electronic address: isabelle.kone-paut@aphp.fr.;Ospedale Pediatrico Anna Meyer, Pediatric Rheumatology, Firenze, Italy.;Imperial College London, Pediatrics, London, United Kingdom.;Imperial College London, Pediatrics, London, United Kingdom.;CHU de Montpellier, Pediatrics, Montpellier, France.;CHU de Poitiers, Intensive Care Unit, Poitiers, France.;University Department Pro.Sa.M.I.G d'Alessandro, Palermo, Italy.;Hospital Sant Joan de Déu, Universitat de Barcelona, Pediatric Rheumatology, Barcelona, Spain.;Université Paris Sud-Saclay, UVSQ, Le Kremlin Bicêtre, France; AP-HP, CHU de Bicêtre, Pediatric Rheumatology, CEREMAIA, Le Kremlin Bicêtre, France.",
"authors": "Kone-Paut|Isabelle|I|;Cimaz|Rolando|R|;Herberg|Jethro|J|;Bates|Oliver|O|;Carbasse|Aurelia|A|;Saulnier|Jean Pierre|JP|;Maggio|Maria Cristina|MC|;Anton|Jordi|J|;Piram|Maryam|M|",
"chemical_list": "D053590:Interleukin 1 Receptor Antagonist Protein; D017472:Receptors, Interleukin-1",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.autrev.2018.01.024",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1568-9972",
"issue": "17(8)",
"journal": "Autoimmunity reviews",
"keywords": "Anakinra, coronary artery aneurysms; Autoinflammatory disease; Interleukin-1; Kawasaki disease; Pediatric; Pediatrics; Vasculitis",
"medline_ta": "Autoimmun Rev",
"mesh_terms": "D002648:Child; D002675:Child, Preschool; D018450:Disease Progression; D005260:Female; D006801:Humans; D007223:Infant; D053590:Interleukin 1 Receptor Antagonist Protein; D008297:Male; D009080:Mucocutaneous Lymph Node Syndrome; D011379:Prognosis; D017472:Receptors, Interleukin-1; D012189:Retrospective Studies",
"nlm_unique_id": "101128967",
"other_id": null,
"pages": "768-774",
"pmc": null,
"pmid": "29885546",
"pubdate": "2018-08",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The use of interleukin 1 receptor antagonist (anakinra) in Kawasaki disease: A retrospective cases series.",
"title_normalized": "the use of interleukin 1 receptor antagonist anakinra in kawasaki disease a retrospective cases series"
} | [
{
"companynumb": "FR-SHIRE-FR201840173",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": null,... |
{
"abstract": "We report the case of bilateral renal clear cell carcinoma in the native kidney, occurring fouryears after renal transplantation. Renal Doppler duplex sonography revealed large solid bilateral neoformation. Total-body computed tomography confirmed the presence of bilateral kidney lesions and also showed the presence of concomitant gross dyscariocinetic lesion of left hemotorax. The patient underwent bilateral native nephrectomy and the histological diagnosis was renal cell carcinoma. Subsequent left upper lobectomy revealed necrotic keratinizing squamous cell carcinoma. Then, the patients was switched tacrolimus to everolimus treatment and mycophenolate mofetil was reduced.",
"affiliations": "Department of Internal Medicine, Nephrology and Hypertension Unit, University of Rome Tor Vergata, Rome, Italy. annalisa.noce@fastwebnet.it",
"authors": "Noce|Annalisa|A|;Iaria|Giuseppe|G|;Durante|Olga|O|;Sforza|Daniele|D|;Canale|Maria Paola|MP|;Di Villahermosa|Simone Manca|SM|;Castagnola|Veronica|V|;Tisone|Giuseppe|G|;Di Daniele|Nicola|N|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1124-3562",
"issue": "84(4)",
"journal": "Archivio italiano di urologia, andrologia : organo ufficiale [di] Societa italiana di ecografia urologica e nefrologica",
"keywords": null,
"medline_ta": "Arch Ital Urol Androl",
"mesh_terms": "D006801:Humans; D007680:Kidney Neoplasms; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D014463:Ultrasonography",
"nlm_unique_id": "9308247",
"other_id": null,
"pages": "253-5",
"pmc": null,
"pmid": "23427757",
"pubdate": "2012-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bilateral native kidney neoplasia detected by ultrasound in functionning renal allograft recipient.",
"title_normalized": "bilateral native kidney neoplasia detected by ultrasound in functionning renal allograft recipient"
} | [
{
"companynumb": "IT-ACCORD-026302",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
"drug... |
{
"abstract": "A 95-year-old male with a medical history of focal epilepsy presented with transient ischemic attack (TIA)/pre-syncope like symptoms. He was on lacosamide (LCM) and levetiracetam. On evaluation, he was found to have left bundle branch block (LBBB), sinus pause of three seconds, and 1st degree atrioventricular (AV) block. After holding LCM, electrocardiogram changes were reversed to baseline (before commencing LCM). In conclusion, to the best of our knowledge, this is the first case of reversible LBBB along with sinoatrial (SA) node and AV node dysfunction in an elderly male on LCM therapy.",
"affiliations": "Department of Internal Medicine, New York Medical College, Metropolitan Hospital Center, New York, USA.;Department of Internal Medicine, New York Medical College, Metropolitan Hospital Center, New York, USA.;Department of Internal Medicine, Smt. B.K. Shah Medical Institute and Research Center, Sumandeep Vidyapeeth, Vadodara, IND.;Department of Internal Medicine, Amidhara Hospital, Surat, IND.;Department of Internal Medicine, New York Medical College, Metropolitan Hospital Center, New York, USA.",
"authors": "Majmundar|Monil M|MM|;Kansara|Tikal|T|;Shah|Palak|P|;Zala|Harshvardhan|H|;Chaudhari|Shobhana|S|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.10234",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184 Cureus Palo Alto (CA) \n\n10.7759/cureus.10234\nCardiology\nInternal Medicine\nLeft Bundle Branch Block: A Reversible Pernicious Effect of Lacosamide\nMuacevic Alexander Adler John R Majmundar Monil M 1 Kansara Tikal 1 Shah Palak 2 Zala Harshvardhan 3 Chaudhari Shobhana 1 \n1 \nDepartment of Internal Medicine, New York Medical College, Metropolitan Hospital Center, New York, USA \n\n2 \nDepartment of Internal Medicine, Smt. B.K. Shah Medical Institute and Research Center, Sumandeep Vidyapeeth, Vadodara, IND \n\n3 \nDepartment of Internal Medicine, Amidhara Hospital, Surat, IND \n\nMonil M. Majmundar monilmajmundar1804@gmail.com\n3 9 2020 \n9 2020 \n12 9 e1023424 8 2020 3 9 2020 Copyright © 2020, Majmundar et al.2020Majmundar et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/38374-left-bundle-branch-block-a-reversible-pernicious-effect-of-lacosamideA 95-year-old male with a medical history of focal epilepsy presented with transient ischemic attack (TIA)/pre-syncope like symptoms. He was on lacosamide (LCM) and levetiracetam. On evaluation, he was found to have left bundle branch block (LBBB), sinus pause of three seconds, and 1st degree atrioventricular (AV) block. After holding LCM, electrocardiogram changes were reversed to baseline (before commencing LCM). In conclusion, to the best of our knowledge, this is the first case of reversible LBBB along with sinoatrial (SA) node and AV node dysfunction in an elderly male on LCM therapy.\n\nleft bundle branch blocklacosamideav blockthe sinus nodeseizureThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nLacosamide (LCM) is a novel antiepileptic medication, approved in 2008, as adjunctive therapy for focal and secondarily generalized seizures. LCM acts by enhancing the slow inactivation of voltage-gated sodium channels. The drug has shown to provoke cardiac conduction abnormalities in the past. It has been associated with syncope, chest pain, atrioventricular (AV) blocks, atrial fibrillation, atrial flutter, and arrhythmias, including bradycardia. Other common side effects associated with LCM include diplopia, blurred vision, nausea, vomiting, headache, dizziness, and ataxia. No previous studies have shown a co-relation of LCM with left bundle branch block (LBBB) or sinus node dysfunction. Here, we report the first case of reversible LBBB along with sinoatrial (SA) node and AV node dysfunction in an elderly male on LCM therapy. Our aim is to make clinicians aware of reversible LBBB as a side effect with LCM.\n\nCase presentation\nA 95-year-old Hispanic male presented to the emergency department (ED) with the development of sudden onset of slurring of speech, dizziness, and difficulty in getting up from the sitting position, which resolved en-route to the hospital. He endorsed a similar episode two days ago. He denied any loss of consciousness, confusion, motor or sensory deficits, blurring of vision, diplopia, chest pain, palpitation, syncope, and dyspnea during the episode. In the emergency room, his blood pressure was 190/72 mmHg, and his pulse rate was 80 per minute. Cardiovascular examination showed normal heart sounds, did not show any murmur or added sounds, carotid pulse was regular, with good volume and pressure. Neurological examination did not reveal focal deficits or any other abnormalities; examination of other systems was trivial.\n\nThe patient's medical history included hypertension and focal epilepsy disorder. His home medications were lacosamide (LCM) 200 mg twice a day, levetiracetam 1500 mg twice a day, lisinopril 40 mg once a day, and amlodipine 10 mg daily.\n\nFingerstick, complete blood count, basic metabolic profile, hepatic function, urine toxicology, were nugatory. Thyroid stimulating hormone (TSH), Troponin T, and serum magnesium level were within the normal reference range. Initial electrocardiogram (EKG) revealed normal sinus rhythm, 1st degree AV block, and LBBB (Figure 1). Computed tomography (CT) of the head with angiography, echocardiography, and carotid duplex were normal. \n\nFigure 1 Electrocardiogram (EKG) on admission in January 2019\n1st degree atrioventricular (AV) block, left bundle branch block (LBBB), PR interval 378 msec, QRS 200 msec\n\nThe patient was admitted to the telemetry unit. Telemetry captured intermittent sinus bradycardia with heart rate as low as 30/min and SA node arrest of 3 seconds (Figure 2). The serum LCM level was sent. His LCM was switched over to topiramate and was observed in the coronary care unit (CCU) where he received an external pacemaker. Twenty-four hours after withdrawal of LCM, the patient’s EKG (Figure 3) did not divulge any sinoatrial node arrest; heart rate returned to a baseline of 54 per minutes; LBBB obliviated with QRS of 110 milliseconds (msec), and a result of LCM serum level was 15.8 mcg/ml (elevated). Subsequently, the patient was discharged post-24-hour observation. On review of records, we correlated the timeline from the initiation of LCM, its dose increment, and corresponding EKG readings (Figure 4-6). Each figure shows the dose of LCM and the corresponding increase in PR interval and QRS complex duration. The dose of LCM was increased for optimal seizure control. Figure 7 demonstrates the graphical representation of the correlation between LCM dosage, PR interval, and QRS interval.\n\nFigure 2 Telemetry recording\nSinus pause of 3 seconds with a heart rate of 30 per minute\n\nFigure 3 Electrocardiogram (EKG) 24 hours after holding lacosamide\nResolution of left bundle branch block (LBBB), 1st degree atrioventricular (AV) block, PR interval decreased to baseline 270 msec, QRS 110 msec\n\nFigure 4 Electrocardiogram (EKG) before starting lacosamide in September 2016\n1st degree atrioventricular (AV) block, PR interval 290 msec, QRS duration 112 msec\n\nFigure 5 Electrocardiogram (EKG) on lacosamide 200 mg per day in September 2017\n1st degree atrioventricular (AV) block, PR interval 322 msec, and QRS duration 134 msec\n\nFigure 6 Electrocardiogram (EKG) on lacosamide 400 mg per day in September 2018\nleft bundle branch block (LBBB), 1st degree atrioventricular (AV) block, PR interval 378 msec, QRS duration 200 msec\n\nFigure 7 Graphical representation of lacosamide (LCM) dose and PR interval, QRS duration.\nBaseline PR, QRS; With the increase in LCM dose, PR interval, and QRS duration increases; PR, QRS back to baseline after holding.\n\nThe patient was followed up in the clinic within a month of discharge. His repeat EKG in the clinic was normal. A follow-up with the Cardiology clinic in the next six months found the patient to have sick sinus syndrome and a permanent pacemaker was placed. The patient has been asymptomatic since then on routine follow-up. \n\nDiscussion\nLCM is known to be associated with several adverse cardiac events. LCM, at the recommended dose, can induce dose-dependent PR interval prolongation [1,2,3] and first-degree AV block [1,3,4]. LCM at a higher dose (600 mg/day) produces atrial flutter/fibrillation [1,5], sinus node dysfunction (500 mg/day) [6] and second/third-degree AV block [7,8]. Two clinical studies reported fatal cardiac arrests [1,2].\n\nHere, we report an association between LCM and LBBB characterized by prolonged QRS duration, SA node dysfunction indicated by sinus pause, and AV block indicated by prolonged PR interval. This patient’s baseline (in September 2016) PR interval and QRS duration were 290 msec and 112 msec, respectively (Figure 4). After the introduction of LCM with 200 mg per day in September 2016 due to the development of focal seizure, PR interval and QRS duration increased to 322 msec and 134 msec (EKG from September 2017) (Figure 5). The patient had another episode of seizure, following which the neurologist had augmented the dose to 300 mg per day in September 2017 and subsequently 400 mg per day in March 2018, and the patient developed LBBB with increment in PR interval to 378 msec and QRS duration to 200 msec (in September 2018) (Figure 6) which went unnoticed. After the admission to the telemetry floor in January 2019, telemetry recorded a sinus pause of 3 seconds (Figure 2) which might have led to episodes of pre-syncope. Elevated serum LCM level and resolution of EKG changes after holding LCM support LCM as a culprit of the patient’s clinical presentation and all EKG findings. Seizures can have a detrimental effect on the heart by causing tachycardia, syncope, hypoxia, or even sudden unexpected death (SUED).\n\nIn vitro studies have shown that LCM inhibits repetitive neuronal firing and stabilizes the neuronal membrane by enhancing the slow inactivation of sodium channels. There is no effect on fast inactivation of sodium channels. Clinically, PR and QRS prolongation are results of the AV nodal and infra-hisian conduction delay which generates action potentials (AP) through voltage-gated sodium channels. LCM’s inhibition of sodium channels can explain the hypothesis of PR and QRS prolongation. The development of LBBB with LCM can be explained only if LCM acts on calcium channels. However, none of the literature mentions the action of LCM on calcium channels, and hence its effect of sinus node dysfunction demands further research. \n\nConclusions\nTo the best of our knowledge, this is the first reported case of reversible LBBB associated with LCM. A dose-dependent increase in PR interval and QRS duration was found with sequential increase in LCM dose which was completely reversed by discontinuation of the drug. This case emphasizes the need for routine monitoring of EKG and LCM levels during every dose increment and at regular intervals. Based on the available data, close monitoring is required for patients taking LCM with underlying conduction abnormalities.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study\n\nWe thank Dr. Pekler, cardiology attending, and his team for taking care of the patient in the coronary care unit.\n==== Refs\nReferences\n1 Lacosamide in painful diabetic neuropathy: an 18-week double-blind placebo-controlled trial J Pain Shaibani A Fares S Selam J-L Arslanian A Simpson J Sen D Bongardt S 818 828 10 2009 19409861 \n2 Efficacy and safety of lacosamide in diabetic neuropathic pain: an 18-week double-blind placebo-controlled trial of fixed-dose regimens Clin J Pain Wymer JP Simpson J Sen D Bongardt S Lacosamide SP742 Study Group 376 385 25 2009 19454870 \n3 Intravenous lacosamide as a short-term replacement for oral lacosamide in partial-onset seizures Epilepsia Krauss G Ben-Menachem E Mameniskiene R 951 957 51 2009 20041945 \n4 Efficacy and safety of oral lacosamide as adjunctive therapy in adults with partial-onset seizures Epilepsia Ben-Menachem E Biton V Jatuzis D Abou-Khalil B Doty P Rudd GD 1308 1317 48 2007 17635557 \n5 Atrial flutter/atrial fibrillation associated with lacosamide for partial seizures Epilepsy Behav DeGiorgio CM 322 324 18 2010 20570216 \n6 Sinus node dysfunction: an adverse effect of lacosamide Epilepsia Chinnasami S Rathore C Duncan JS 0 3 54 2013 \n7 Atrioventricular block following lacosamide intoxication Epilepsy Behav Krause LU Brodowski KO Kellinghaus C 725 727 20 2011 21411374 \n8 Lacosamide-induced second-degree atrioventricular block in a patient with partial epilepsy Epilepsia Nizam A Mylavarapu K Thomas D Briskin K Wu B Saluja D Wong S 0 5 52 2011\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "12(9)",
"journal": "Cureus",
"keywords": "av block; lacosamide; left bundle branch block; seizure; the sinus node",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e10234",
"pmc": null,
"pmid": "33042675",
"pubdate": "2020-09-03",
"publication_types": "D002363:Case Reports",
"references": "20570216;21411374;17635557;20041945;19454870;21801173;19409861;23360388",
"title": "Left Bundle Branch Block: A Reversible Pernicious Effect of Lacosamide.",
"title_normalized": "left bundle branch block a reversible pernicious effect of lacosamide"
} | [
{
"companynumb": "US-UCBSA-2020042961",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMLODIPINE BESYLATE"
},
"drugadditional": "3",
... |
{
"abstract": "Poorly Differentiated Thyroid Carcinoma (PDTC), especially advanced PDTC, is an aggressive disease and displays a much poorer prognosis compared with well differentiated thyroid carcinoma. Surgery is the recommended treatment in the early stage of PDTC, however, no effective treatment modalities are currently available for advanced PDTCMethods: Two advanced PDTC patients with no radioiodine uptake adopted a cytotoxic chemotherapy with liposomal doxorubicin (35 mg/m(2), day 1) plus cisplatin (75 mg/m(2), day1-3) every 3 weeks. Computer tomography (CT) was performed after 6 cycles (case 1) or 5 cycles (case 2) of chemotherapy\n\n\n\nOur patients achieved remarkable response with one a Complete Remission (CR) and the other a very good Partial Remission (PR)Conclusion: Our findings indicate that liposomal doxorubicin-based chemotherapy regimens might produce response in PDTC patients, and improve their overall survival and quality of life. Hence we believe this result is very important for oncologists in treating PDTC.",
"affiliations": "a Chemotherapy Center, Zhejiang Province Cancer Hospital , Hangzhou , PR China.;b Laboratory of Clinical Pharmacy, Zhejiang Province Cancer Hospital , Hangzhou , PR China.;c Department of Pathology , Zhejiang Province Cancer Hospital , Hangzhou , PR China.;a Chemotherapy Center, Zhejiang Province Cancer Hospital , Hangzhou , PR China.;a Chemotherapy Center, Zhejiang Province Cancer Hospital , Hangzhou , PR China.;d Department of Head and Neck Surgery , Zhejiang Province Cancer Hospital , Hangzhou , PR China.",
"authors": "Yang|Haiyan|H|;Chen|Zhongjian|Z|;Wu|Meijuan|M|;Lei|Tao|T|;Yu|Haifeng|H|;Ge|Minghua|M|",
"chemical_list": "D000903:Antibiotics, Antineoplastic; C506643:liposomal doxorubicin; D011092:Polyethylene Glycols; D004317:Doxorubicin; D002945:Cisplatin",
"country": "United States",
"delete": false,
"doi": "10.1080/15384047.2016.1167295",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1538-4047",
"issue": "17(6)",
"journal": "Cancer biology & therapy",
"keywords": "Poorly differentiated thyroid carcinoma; chemotherapy; cis-platinum; complete remission; liposomal doxorubicin; partial remission",
"medline_ta": "Cancer Biol Ther",
"mesh_terms": "D000328:Adult; D000903:Antibiotics, Antineoplastic; D000971:Antineoplastic Combined Chemotherapy Protocols; D002454:Cell Differentiation; D002945:Cisplatin; D004317:Doxorubicin; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D011092:Polyethylene Glycols; D013964:Thyroid Neoplasms",
"nlm_unique_id": "101137842",
"other_id": null,
"pages": "693-7",
"pmc": null,
"pmid": "27302615",
"pubdate": "2016-06-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "2058861;21947747;22654560;20634178;20847059;4808917;23850894;18538481;17667551;6313176;23476646;15943045;18541894;16859430;3902203;3955552",
"title": "Remarkable response in 2 cases of Advanced Poorly Differentiated Thyroid Carcinoma with liposomal doxorubicin plus cisplatin.",
"title_normalized": "remarkable response in 2 cases of advanced poorly differentiated thyroid carcinoma with liposomal doxorubicin plus cisplatin"
} | [
{
"companynumb": "CN-JNJFOC-20160800485",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugadditional": n... |
{
"abstract": "To investigate safety and efficacy of high-dose chemotherapy followed by autologous stem cell transplantation (HCT-ASCT) in relapsed/refractory (r/r) primary central nervous system lymphoma (PCNSL), we conducted a single-arm multicentre study for immunocompetent patients (<66 years) with PCNSL failing high-dose methotrexate)-based chemotherapy. Induction consisted of two courses of rituximab (375 mg/m2), high-dose cytarabine (2 × 3 g/m2) and thiotepa (40 mg/m2) with collection of stem cells in between. Conditioning for HCT-ASCT consisted of rituximab 375 mg/m2, carmustine 400 mg/m2 and thiotepa (4 × 5 mg/kg). Patients commenced HCT-ASCT irrespective of response after induction. Patients not achieving complete remission (CR) after HCT-ASCT received whole-brain radiotherapy. Primary end point was CR after HCT-ASCT. We enrolled 39 patients; median age and Karnofsky performance score are 57 years and 90%, respectively. About 28 patients had relapsed and 8 refractory disease. About 22 patients responded to induction and 32 patients commenced HCT-ASCT. About 22 patients (56.4%) achieved CR after HCT-ASCT. Respective 2-year progression-free survival (PFS) and overall survival (OS) rates were 46.0% (median PFS 12.4 months) and 56.4%; median OS not reached. We recorded four treatment-related deaths. Thiotepa-based HCT-ASCT is an effective treatment option in eligible patients with r/r PCNSL. Comparative studies are needed to further scrutinise the role of HCT-ASCT in the salvage setting.",
"affiliations": "Department of Haematology/Oncology, Klinikum Stuttgart, Stuttgart, Germany.;Clinical Trials Unit, Medical Centre - University of Freiburg, Freiburg, Germany.;Department of Medicine, Hematology and Oncology, Ruhr-University of Bochum, Knappschaftskrankenhaus Bochum-Langendreer, Bochum, Germany.;Department of Hematology, Oncology and Tumor Immunology, Charite University Medicine, Berlin, Germany.;Department of Internal Medicine III, Center for Integrated Oncology (CIO), University Hospital Bonn, Bonn, Germany.;Department of Haematology and Oncology, Heidelberg University, Heidelberg, Germany.;Department of Neurology, University Hospital Munich LMU, Munich, Germany.;Medical Faculty, Department of Haematology, University of Duisburg-Essen, Essen, Germany.;Department of Internal Medicine III, University of Ulm, Ulm, Germany.;Department of Haematology and Oncology, University Tübingen, Tübingen, Germany.;Department of Oncology and Hematology, University of Hamburg, Hamburg, Germany.;III Medical Department, Technische Universität München, Munich, Germany.;Department of Internal Medicine II, University Hospital of Schleswig-Holstein, Campus Kiel, Germany.;Klinik für Innere Medizin I, Universität des Saarlandes, Homburg, Germany.;Department of Haematology/Oncology, Klinikum Stuttgart, Stuttgart, Germany.;Department of Haematology, Oncology and Stem Cell Transplantation, University Hospital Freiburg, Freiburg, Germany.;Department of Haematology, Oncology and Stem Cell Transplantation, University Hospital Freiburg, Freiburg, Germany.;Department of Haematology, Oncology and Stem Cell Transplantation, University Hospital Freiburg, Freiburg, Germany.;Department of Haematology, Oncology and Stem Cell Transplantation, University Hospital Freiburg, Freiburg, Germany.;Department of Haematology/Oncology, Klinikum Stuttgart, Stuttgart, Germany.",
"authors": "Kasenda|B|B|;Ihorst|G|G|;Schroers|R|R|;Korfel|A|A|;Schmidt-Wolf|I|I|;Egerer|G|G|;von Baumgarten|L|L|;Röth|A|A|;Bloehdorn|J|J|;Möhle|R|R|;Binder|M|M|;Keller|U|U|;Lamprecht|M|M|;Pfreundschuh|M|M|;Valk|E|E|;Fricker|H|H|;Schorb|E|E|;Fritsch|K|K|;Finke|J|J|;Illerhaus|G|G|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1038/leu.2017.170",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0887-6924",
"issue": "31(12)",
"journal": "Leukemia",
"keywords": null,
"medline_ta": "Leukemia",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001921:Brain; D016543:Central Nervous System Neoplasms; D003131:Combined Modality Therapy; D019008:Drug Resistance, Neoplasm; D005260:Female; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008223:Lymphoma; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D012008:Recurrence; D019233:Retreatment; D014182:Transplantation, Autologous; D016896:Treatment Outcome",
"nlm_unique_id": "8704895",
"other_id": null,
"pages": "2623-2629",
"pmc": null,
"pmid": "28559537",
"pubdate": "2017-12",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "High-dose chemotherapy with autologous haematopoietic stem cell support for relapsed or refractory primary CNS lymphoma: a prospective multicentre trial by the German Cooperative PCNSL study group.",
"title_normalized": "high dose chemotherapy with autologous haematopoietic stem cell support for relapsed or refractory primary cns lymphoma a prospective multicentre trial by the german cooperative pcnsl study group"
} | [
{
"companynumb": "DE-ADIENNEP-2017AD000016",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "THIOTEPA"
},
"drugadditional": "3",
... |
{
"abstract": "Non-valvular atrial fibrillation (AF) is an important risk factor for acute ischaemic stroke. There has been an increase in the use of direct-acting oral anticoagulants (DOAC therapy) in stroke prophylaxis due to their convenience and rapid action of onset. However, there is a lack of information in the literature regarding management options and possible mechanisms with the apparent failure of DOAC therapy.\nWe present a clinical case of a 51-year-old man presenting with transient ischaemic attacks on a background of AF on therapeutic doses of dabigatran. His medication box suggested 100% compliance and his admission coagulation studies showed a marginally prolonged activated partial thromboplastin time and thrombin time (TT). While in hospital, our patient had supervised doses of dabigatran (150 mg b.i.d.). Despite this, his peak dabigatran level was undetectable (<40 ng/mL). With the apparent failure of therapy, he was switched to apixaban 5 mg b.i.d., which showed subsequent peak levels in the target range.\nThere are a number of isolated case reports of DOAC failure in stroke prophylaxis and management has simply involved switching to another DOAC or warfarin. This case is unique as we have discovered undetectable levels of dabigatran providing a mechanism for failure.",
"affiliations": "Department of Cardiology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia.;Department of Haematology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia.;Department of Haematology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia.;Department of Cardiology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia.",
"authors": "Huynh|Ronald|R|0000-0001-8759-7425;Anderson|Stephanie|S|0000-0001-9304-6419;Chen|Vivien M|VM|0000-0001-5119-7470;Yeoh|Thomas|T|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/ehjcr/ytaa041",
"fulltext": "\n==== Front\nEur Heart J Case Rep\nEur Heart J Case Rep\nehjcr\nEuropean Heart Journal: Case Reports\n2514-2119 Oxford University Press \n\n10.1093/ehjcr/ytaa041\nytaa041\nCase Report\nOther\nA case report of recurrent transient ischaemic attacks on dabigatran for atrial fibrillation: real-world insight into treatment failure\nhttp://orcid.org/0000-0001-8759-7425Huynh Ronald y1 http://orcid.org/0000-0001-9304-6419Anderson Stephanie y2 http://orcid.org/0000-0001-5119-7470Chen Vivien M y2y3 Yeoh Thomas y1 Sommer Philipp Handling Editor Enache Bogdan Editor Cinier Goksel Editor Carazo Carlos Minguito Editor Memtsas Vassilios Parisis Editor y1 \nDepartment of Cardiology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia\ny2 \nDepartment of Haematology, Concord Repatriation General Hospital, 1 Hospital Road, Concord, New South Wales 2139, Australia\ny3 \nANZAC Research Institute, University of Sydney, Gate 3 Hospital Road, Concord, New South Wales 2139, Australia\n Corresponding author. Tel: +61 9767 5535, Email: tbhyeoh@gmail.com\n6 2020 \n03 3 2020 \n03 3 2020 \n4 2 1 4\n26 9 2019 22 10 2019 03 2 2020 © The Author(s) 2020. Published by Oxford University Press on behalf of the European Society of Cardiology.2020 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nBackground \nNon-valvular atrial fibrillation (AF) is an important risk factor for acute ischaemic stroke. There has been an increase in the use of direct-acting oral anticoagulants (DOAC therapy) in stroke prophylaxis due to their convenience and rapid action of onset. However, there is a lack of information in the literature regarding management options and possible mechanisms with the apparent failure of DOAC therapy.\n\nCase summary \nWe present a clinical case of a 51-year-old man presenting with transient ischaemic attacks on a background of AF on therapeutic doses of dabigatran. His medication box suggested 100% compliance and his admission coagulation studies showed a marginally prolonged activated partial thromboplastin time and thrombin time (TT). While in hospital, our patient had supervised doses of dabigatran (150 mg b.i.d.). Despite this, his peak dabigatran level was undetectable (<40 ng/mL). With the apparent failure of therapy, he was switched to apixaban 5 mg b.i.d., which showed subsequent peak levels in the target range.\n\nDiscussion \nThere are a number of isolated case reports of DOAC failure in stroke prophylaxis and management has simply involved switching to another DOAC or warfarin. This case is unique as we have discovered undetectable levels of dabigatran providing a mechanism for failure.\n\nCase reportStrokeAtrial fibrillationDirect-acting oral anticoagulation\n==== Body\nLearning points\nPatients presenting with stroke on therapeutic doses of direct-acting oral anticoagulants (DOACs) should be reviewed in detail for potential reasons for such failure.\n\nSubtherapeutic DOAC levels should be considered as a reason for treatment failure.\n\nIf subtherapeutic, considerations into mechanisms should include (though not encompassing) medication compliance, co-administration of medications interacting with the DOAC, gastric surgery, or potential genetic variations to DOAC metabolism.\n\n\n\n\nIntroduction\nNon-valvular atrial fibrillation (AF) is associated with a five-fold increased risk of acute ischaemic stroke.1 For more than 60 years, vitamin K antagonists have been used effectively to prevent stroke.1,2 Prescription of direct-acting oral anticoagulants (DOACs) in preference to warfarin for stroke prophylaxis has increased due to a number of attractive features including their rapid onset of action, lack of regular blood tests required for monitoring efficacy, and a much simpler dosing regimen compared with warfarin.3,4 However, little has been published about mechanisms of apparent failure of DOAC therapy in thromboembolic prophylaxis in AF. Here, we present a case of a 51-year-old man presenting with neurological symptoms on a background of AF on therapeutic dabigatran.\n\nTimeline\n \tEvents\t\nNovember 2015\t\nPresented to hospital with symptomatic rapidly conducting atrial flutter.\n\nSuccessful electrical cardioversion to sinus rhythm.\n\nCommenced on apixaban 5 mg b.i.d. and sotalol 40 mg b.i.d.\n\n\n\t\nMarch 2016\t\nSuccessful ablation of typical atrial flutter.\n\nDuring the electrophysiology study, the patient was noticed to have a tendency to atrial fibrillation (AF).\n\nDischarged in sinus rhythm.\n\n\n\t\nMay 2016\t\nRemained in sinus rhythm and asymptomatic.\n\nApixaban ceased—CHADsVASC 0 and changed to aspirin 100 mg daily.\n\n\n\t\nOctober 2016\t\nPresented to hospital with symptomatic AF.\n\nSuccessful electrical cardioversion to sinus rhythm.\n\nRecommenced on apixaban 5 mg b.i.d. and continued with sotalol 40 mg b.i.d. Blood pressure elevated and commenced antihypertensive therapy (CHADsVASC 1).\n\n\n\t\nSeptember 2018\t\nElective transoesophageal echocardiogram and direct current cardioversion which was unsuccessful—only remained in sinus rhythm for a few beats then returning to AF.\n\nIncreased sotalol to 80 mg b.i.d. and introduced digoxin.\n\nPatient in and out of sinus rhythm.\n\n\n\t\nOctober 2018\t\nCatheter ablation for AF discussed with patient.\n\nSwitched from apixaban to dabigatran 150 mg b.i.d. in preparation.\n\n\n\t\nNovember 2018\t\nAblation decided against and for medical therapy.\n\nPatient remained on dabigatran 150 mg b.i.d.\n\n\n\t\nMarch 2019\t\nPresented with several transient neurological symptoms while on dabigatran.\n\nHad four doses of observed dabigatran therapy in the hospital.\n\nDabigatran peak level (4 h post-dose) <40 ng/mL.\n\nHaematology consulted and therapy switched to apixaban 5 mg b.i.d. resulting in apparently on target levels.\n\n\n\t\nCase presentation\nA 51-year-old man on dabigatran for known AF (CHADsVASc 1 for hypertension) presented to emergency describing intermittent dysgraphia and short-lived episodes of receptive dysphasia in the prior week. He awoke at 6.30 am on the morning of his presentation with a diffuse headache. At 10.30 am, he developed a right superior visual field disturbance marked by colourful pixilation, lasting 2 min. These exact symptoms recurred at 4.30 pm with complete resolution.\n\nOur patient had a background of rapid atrial flutter requiring direct current cardioversion (DCCV) in 2015, with maintenance sotalol 40 mg b.i.d. and apixaban 5 mg b.i.d. He underwent atrial flutter ablation in 2016 but required repeat DCCV for recurrent AF. In September 2018, he was in asymptomatic rapid AF with unsuccessful DCCV. While being considered for AF ablation his apixaban was changed to dabigatran 150 mg b.i.d. given the availability of a reversal agent and lower bleeding risk5 as recommended by the cardiac electrophysiologist. Medical management was preferred but he remained on dabigatran. Other medications included digoxin 125 μg daily, fenofibrate 145 mg mane, atorvastatin 80 mg nocte, allopurinol 300 mg daily, fluvoxamine 50 mg mane, and metoprolol 100 mg b.i.d. The patient used a pharmacy packed medication box.\n\nOn presentation, his heart rate was 81 b.p.m. (irregular pulse), blood pressure was 127/98 mmHg, respiratory rate was 18 breaths/minute, oxygen saturation was 98% on room air, and he was afebrile. His cardiovascular examination was unremarkable. Initial blood work was normal except an eGFR of 36 mL/min/1.73 m2 (≥60 mL/min/1.73 m2) and creatinine 182 µmol/L (60–110 µmol/L). The renal function was normal previously. His electrocardiogram demonstrated AF. A computed tomography brain, carotid and circle of Willis angiogram, and brain magnetic resonance imaging did not show evidence of acute or recent infarct. The provisional diagnosis was a transient ischaemic attack (TIA) occurring despite therapeutic dabigatran administration.\n\nThe patient’s medication box indicated 100% medication compliance. Admission coagulation studies showed a marginally prolonged activated partial thromboplastin time (APTT) of 38 s (range 25–37 s) and thrombin time (TT) of 83.7 s (range 14–20 s). The TT suggested possible presence of dabigatran but only at subtherapeutic levels. After four further supervised doses of dabigatran 150 mg b.i.d., levels were undetectable by Hemoclot assay (Hyphen Biomed) on STA-R analyser (Stago) (<40 ng/mL). Anticoagulation was changed to apixaban 5 mg b.i.d. with subsequent peak levels of 299 ng/mL (on target range: 91–321 ng/mL). He has had no further neurological events at his most recent follow-up.\n\nDiscussion\nWhen a patient with AF prescribed therapeutic anticoagulation presents with a thromboembolic event, several issues need to be considered. First, the thromboembolic nature of the event must be confirmed. While our patient did not show conclusive evidence of a stroke on investigation, his symptoms were consistent with TIAs. Once established, the reasons for anticoagulation ‘failure’ should be considered. These are broadly categorized as due to subtherapeutic drug levels or an underlying pro-thrombotic disease state.6\n\nDirect-acting oral anticoagulants have been marketed as anticoagulants that do not require monitoring. This case illustrates a circumstance in which testing a drug level is important: a thrombotic event during therapeutic DOAC dosing. In this case, documentation of the inability to achieve therapeutic dosing with dabigatran explained the ‘event on anticoagulation’ allowing a switch to a different anticoagulant. This case also demonstrates the importance of understanding surrogate laboratory markers, such as the APTT and TT. Thrombin time is very sensitive to dabigatran and within our laboratory, a plasma level of dabigatran within the on-target range for therapy would be expected to return a result above the limit of the assay (>150 s). In a compliant patient with renal impairment, dabigatran would be expected to accumulate leading to a markedly prolonged APTT and TT. It is useful to systematically examine causes when subtherapeutic dabigatran levels are discovered (Table 1). Poor medication compliance was not the reason in our patient as his dabigatran plasma levels were <40 ng/mL (on target range for peak levels: 100–400 ng/mL) after directly observed therapy.\n\nTable 1 Reasons for failing to achieve dabigatran levels\n\n1. Poor medication compliance.\t\n2. Drug degradation\nThe drug monograph states that the drug should be stored protected from moisture and suggests relative instability when removed from original packaging, for example, when stored in pharmacy blister packs.\n\n\t\n3. Poor absorption in the lower oesophagus and duodenum, e.g. after bariatric surgery.\t\n4. P-glycoprotein efflux pump activity can be altered due to drug interactions (see Wessler et al.12 for full list).\nDrugs that inhibit P-gp activity (e.g. amiodarone, carvedilol and atorvastatin) may increase DOAC bioavailability and subsequent bleeding risk.\n\nRifampicin, an inducer of P-gp activity, St. John’s wort and carbamazepine have the potential to increase thromboembolic complications by reducing dabigatran levels.\n\n\t\n5. Single nucleotide polymorphism leading to loss of function mutation in carboxylesterase 1 and 2, enzymes crucial for dabigatran prodrug conversion.\t\nSeveral points in the absorption and metabolism process may interfere with achieving adequate dabigatran levels. Dabigatran is a highly selective direct thrombin inhibitor taken as a prodrug. Dabigatran etexilate is rapidly converted to its active form by carboxylesterase 1 and 2, in the intestine and liver, respectively.7 The prodrug capsules are composed of a tartaric acid core surrounded by dabigatran etexilate. This ensures an acidic microenvironment promoting drug dissolution and absorption independent of gastric pH but requires airtight storage to ensure stability (Table 1). A recent study reassuringly shows that drug levels in pharmacy blister packed tablets were stable out to 120 days.8\n\nReduced long-term cardiovascular event rates have been shown following bariatric surgery.9 Drug levels can be affected by the anatomical and biochemical changes seen following metabolic surgery.10 Our patient was obese with a weight of 102.4 kg and a body mass index (BMI) of 31.6 kg/m2 with no history of upper gastrointestinal surgery. ISTH guidelines indicate caution with DOAC use in patients >120 kg or BMI >40 kg/m2 until further data emerges.\n\nIntestinal absorption of both anti-FXa- and direct thrombin inhibitors is dependent on the P-gp efflux pump system. Many cardiovascular drugs affect the activity of the P-gp system11,12: our patient was not taking drugs or herbal medications likely to interact with dabigatran. Furthermore, an abnormality in the P-gp system should not be responsible for our patient’s dabigatran failure as apixaban absorption would also be affected given the common absorption pathway. Shi et al. identified a single nucleotide polymorphism, rs71647871, which confers a loss of function mutation in carboxylesterase 1.7 When hepatocytes expressing rs71647871 were incubated with dabigatran etexilate there was nil dabigatran detected. We suspect that our patient harbours a non-functioning variant of carboxylesterase 1 or 2 which renders him unable to metabolize the pro-drug. Further identification with genetic sequencing is in progress to validate our hypothesis and characterize the underlying mutation.\n\nOur patient had a TIA consequent to failure to achieve adequate anticoagulation. Best management is unclear if stroke occurs despite adequate anticoagulation; however, it is reasonable to consider an underlying procoagulant state. While underlying malignancy is the most common condition attributed to breakthrough venous thromboembolism,6,13 Elbadawi et al.14 argue that cancer does not increase stroke risk in AF patients. Other clinical conditions associated with venous thrombosis despite adequate anticoagulation include myeloproliferative disorders, anti-phospholipid syndrome, paroxysmal nocturnal haemoglobinuria, and Behcet’s disease. It may be reasonable to consider these as part of the differential diagnosis in stroke occurring with adequate anticoagulation.\n\nConclusion\nIn summary, we present a patient who suffered symptoms consistent with a TIA on a background of AF while on full-dose dabigatran. There have been isolated case reports of apparent DOAC treatment failure, where management had simply involved switching to another DOAC or warfarin. Our case is unique as we discovered undetectable levels of dabigatran providing a mechanism for treatment failure. Additionally, we found therapeutic anticoagulant levels with a different DOAC, apixaban. Understanding the mechanisms of this anomaly will assist in understanding treatment failures with DOACs in the setting of stroke prophylaxis and AF.\n\nLead author biography\nRonald Huynh completed his medical studies at the University of Notre Dame in Sydney Australia in 2013. He completed his Basic Physician’s Training in 2017 and is currently a cardiology advanced trainee at Concord Repatriation General Hospital in Sydney, Australia.\n\nSupplementary material\n\nSupplementary material is available at European Heart Journal - Case Reports online.\n\n\nSlide sets: A fully edited slide set detailing this case and suitable for local presentation is available online as Supplementary data.\n\n\nConsent: The author/s confirm that written consent for submission and publication of this case report including image(s) and associated text has been obtained from the patient in line with COPE guidance.\n\n\nConflict of interest: none declared.\n\nSupplementary Material\nytaa041_Supplementary_Data Click here for additional data file.\n==== Refs\nReferences\n1 \nWolf P , Abbott R , Kannel W. \nAtrial-fibrillation as an independent risk factor for stroke—the Framingham Study\n. Stroke 1991 ;22 :983 –988\n.1866765 \n2 \nHart R , Pearce L , Aguilar M. \nMeta-analysis: antithrombotic therapy to prevent stroke in patients who have nonvalvular atrial fibrillation\n. Ann Intern Med 2007 ;146 :857 –867\n.17577005 \n3 \nBanerjee A , Marin F , Lip G. \nA new landscape for stroke prevention in atrial fibrillation focus on new anticoagulants, antiarrhythmic drugs, and devices\n. Stroke 2011 ;42 :3316 –3322\n.21998051 \n4 \nLarsen T , Rasmusse L , Gorst-Rasmussen A , Skjøth F , Lane DA , Lip GY. \nDabigatran and warfarin for secondary prevention of stroke in atrial fibrillation patients: a nationwide cohort study\n. Am J Med 2014 ;127 :1172 –1178.e5\n.25193361 \n5 \nCalkins H , Willems S , Gerstenfeld EP , Verma A , Schilling R , Hohnloser SH , Okumura K , Serota H , Nordaby M , Guiver K , Biss B , Brouwer MA , Grimaldi M. \nUninterrupted dabigatran versus warfarin for ablation in atrial fibrillation\n. N Engl J Med 2017 ;376 :1627 –1636\n.28317415 \n6 \nSchulman S. \nHow I treat recurrent venous thromboembolism in patients on anticoagulant therapy\n. Blood 2017 ;129 :3285 –3293\n.28483766 \n7 \nShi J , Wang X , Nguyen J-H , Bleske BE , Liang Y , Liu L , Zhu H-J. \nDabigatran etexilate activation is affected by the CES1 genetic polymorphism G143E (rs71647871) and gender\n. Biochem Pharmacol 2016 ;119 :76 –84\n.27614009 \n8 \nWang EHZ , Bolt JL , Décarie D , Semchuk W , Ensom M. \nStability of dabigatran etexilate in manufacturer’s blister pack, unit-dose packaging, and community pharmacy blister pack\n. Can J Hosp Pharm 2015 ;68 :16 –21\n.25762815 \n9 \nBenotti PN , Wood GC , Carey DJ , Mehra VC , Mirshahi T , Lent MR , Petrick AT , Still C , Gerhard GS , Hirsch AG. \nGastric bypass surgery produces a durable reduction in cardiovascular disease risk factors and reduces the long-term risks of congestive heart failure\n. J Am Heart Assoc 2017 ;6 :e005126 .28536154 \n10 \nMartin K , Lee C , Farrell T , Moll S. \nOral anticoagulant use after bariatric surgery: a literature review and clinical guidance\n. Am J Med 2017 ;130 :517 –524\n.28159600 \n11 \nStöllberger C , Finsterer J. \nRelevance of P-glycoprotein in stroke prevention with dabigatran, rivaroxaban, and apixaban\n. Herz 2015 ;40 :140 –145\n.25616425 \n12 \nWessler JD , Grip LT , Mendell J , Giugliano RP. \nThe P-glycoprotein transport system and cardiovascular drugs\n. J Am Coll Cardiol 2013 ;61 :2495 –2502\n.23563132 \n13 \nSchulman S , Zondag M , Linkins L , Pasca S , Cheung Y , De Sancho M , Gallus A , Lecumberri R , Molnar S , Ageno W , Le Gal G , Falanga A , Hulegårdh E , Ranta S , Kamphuisen P , Debourdeau P , Rigamonti V , Ortel T , Lee A. \nRecurrent venous thromboembolism in anticoagulated patients with cancer: management and short-term prognosis\n. J Thromb Haemost 2015 ;13 :1010 –1018\n.25851122 \n14 \nElbadawi A , Elgendy IY , Ha LD , Baig B , Saad M , Adly H , Ogunbayo GO , Olorunfemi O , McKillop MS , Maffett SA. \nIn-hospital cerebrovascular outcomes of patients with atrial fibrillation and cancer (from the national inpatient sample database)\n. Am J Cardiol 2018 ;121 :590 –595\n.29352566\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2514-2119",
"issue": "4(2)",
"journal": "European heart journal. Case reports",
"keywords": "Atrial fibrillation; Case report; Direct-acting oral anticoagulation; Stroke",
"medline_ta": "Eur Heart J Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101730741",
"other_id": null,
"pages": "1-4",
"pmc": null,
"pmid": "32352054",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article",
"references": "27614009;28159600;28317415;25616425;25762815;28483766;21998051;25851122;17577005;23563132;25193361;29352566;1866765;28536154",
"title": "A case report of recurrent transient ischaemic attacks on dabigatran for atrial fibrillation: real-world insight into treatment failure.",
"title_normalized": "a case report of recurrent transient ischaemic attacks on dabigatran for atrial fibrillation real world insight into treatment failure"
} | [
{
"companynumb": "AU-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2020-BI-021971",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FENOFIBRATE"
},
... |
{
"abstract": "The appropriate management of hepatitis B virus (HBV) infection during pregnancy has not been established in Japan. We herein report five HBV-infected pregnant Japanese women who received tenofovir disoproxil fumarate (TDF). Two of them had been born after the introduction of nationwide immunoprophylaxis and were vertically infected with HBV, highlighting the need to address mother-to-child transmission further. In both entecavir-experienced and nucleoside/nucleotide analog-naïve mothers, TDF suppressed HBV replication without serious adverse events. All five children were free from congenital disorders, growth impairment, and HBV infection. TDF showed safety and efficacy for pregnant woman with chronic hepatitis B and might have helped prevent mother-to-child transmission.",
"affiliations": "Department of Hepatology, Osaka City General Hospital, Japan.;Department of Hepatology, Osaka City University Graduate School of Medicine, Japan.;Department of Hepatology, Osaka City General Hospital, Japan.;Department of Hepatology, Osaka City General Hospital, Japan.;Department of Hepatology, Osaka City University Graduate School of Medicine, Japan.;Department of Hepatology, Osaka City General Hospital, Japan.;Department of Hepatology, Osaka City General Hospital, Japan.;Department of Hepatology, Osaka City University Graduate School of Medicine, Japan.",
"authors": "Suoh|Maito|M|;Tamori|Akihiro|A|;Amano-Teranishi|Yuga|Y|;Nakai|Takashi|T|;Enomoto|Masaru|M|;Kawasaki|Yasuko|Y|;Kioka|Kiyohide|K|;Kawada|Norifumi|N|",
"chemical_list": "D000998:Antiviral Agents; D006513:Hepatitis B e Antigens; C413685:entecavir; D006147:Guanine; D000068698:Tenofovir",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.3504-19",
"fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 3194187010.2169/internalmedicine.3504-19Case ReportThe Administration of Tenofovir Disoproxil Fumarate for Pregnant Japanese Women with Chronic Hepatitis B Suoh Maito 12Tamori Akihiro 2Amano-Teranishi Yuga 1Nakai Takashi 1Enomoto Masaru 2Kawasaki Yasuko 1Kioka Kiyohide 1Kawada Norifumi 2\n1 Department of Hepatology, Osaka City General Hospital, Japan\n2 Department of Hepatology, Osaka City University Graduate School of Medicine, JapanCorrespondence to Dr. Akihiro Tamori, atamori@med.osaka-cu.ac.jp\n\n15 1 2020 15 1 2020 59 2 205 210 13 6 2019 29 7 2019 Copyright © 2020 by The Japanese Society of Internal MedicineThe Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).The appropriate management of hepatitis B virus (HBV) infection during pregnancy has not been established in Japan. We herein report five HBV-infected pregnant Japanese women who received tenofovir disoproxil fumarate (TDF). Two of them had been born after the introduction of nationwide immunoprophylaxis and were vertically infected with HBV, highlighting the need to address mother-to-child transmission further. In both entecavir-experienced and nucleoside/nucleotide analog-naïve mothers, TDF suppressed HBV replication without serious adverse events. All five children were free from congenital disorders, growth impairment, and HBV infection. TDF showed safety and efficacy for pregnant woman with chronic hepatitis B and might have helped prevent mother-to-child transmission. \n\ntenofovir disoproxil fumaratehepatitis B viruspregnancymother-to-child transmission\n==== Body\nIntroduction\nChronic infections of hepatitis B virus (HBV) are estimated to affect 719,000 people or 0.6% of the general population (1) and contribute to approximately 10-15% of cases of cirrhosis (2) and liver cancer (3) in Japan. To reduce the burden of these serious hepatic complications on public health, it is essential to block mother-to-child transmission, one of the primary sources of chronic HBV infection. In 1986, the Japanese government implemented a nationwide policy to administer fixed-schedule hepatitis B immunoglobulin (HBIG) and hepatitis B vaccine (HB vaccine) to babies born to HBV-infected mothers in order to prevent mother-to-child transmission (4, 5). Initially, this preventive program targeted only mothers who were positive for both hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg), but it was modified in 1995 to cover all mothers who were positive for HBsAg, regardless of HBeAg status (6). This selective immunoprophylaxis dramatically reduced the prevalence of HBV carriers among children from 0.20-0.75% to 0.01-0.04% (4-6). However, universal vaccination was not implemented until 2016 in Japan (7).\n\nAlthough chronic HBV infection typically remains stable during and after pregnancy, hepatitis flares occasionally occur in this period, presumably due to the dramatic hormonal and immunological alterations of pregnancy (8-12). The acute exacerbation is often self-limiting but may progress to hepatic decompensation or liver failure (8, 9, 11, 12). This is one of the reasons for the initiation or continuation of antiviral therapy for HBV-infected women during pregnancy (8-10, 13-15). Pregnancy is reportedly associated with an increased rate of spontaneous HBeAg seroconversion (16, 17), leading to the inactive phase of chronic HBV infection. Nonetheless, the adverse effects of antiviral therapy on the fetus, particularly with regard to teratogenicity, constitute serious concerns.\n\nFor the above reasons, pregnancy is an important point in the course of chronic HBV infection, both for pregnant women and the children born to them. However, there is little consensus regarding the appropriate management of pregnant women with chronic HBV infection in Japan. The guidelines for hepatitis B (version 3.1) published by the Japan Society of Hepatology (JSH) only mention that tenofovir disoproxil fumarate (TDF) is recommended over the other two first-choice nucleoside/nucleotide analogues (NAs) of entecavir (ETV) and tenofovir alafenamide (TAF) for women who are pregnant or wish to become so (18). Furthermore, the available data regarding the use of TDF for Japanese pregnant women infected with HBV are limited to situations that are not representative of daily clinical practice (19, 20).\n\nWe herein report five Japanese women who were treated with TDF for chronic hepatitis B during pregnancy and evaluate its efficacy and safety for pregnant women and the children born to them.\n\nCase Reports\nMaternal courses\nIn all five women, TDF 300 mg once daily was orally administered during pregnancy and after delivery to treat chronic hepatitis B, as a component of daily clinical practice; they did not breastfeed, as advised on the package insert. The clinical characteristics of these women are shown in Table 1, and their individual courses until the end of 2017 are depicted in Figure.\n\nTable 1. Clinical Characteristics of Five Mothers Treated with TDF for Chronic Hepatitis B during Pregnancy (Cases 1–5).\n\nCase no.\tAge (years)\tBirth year\tG\tP\tHBV genotype\tInfection route\tPrior IFN\tPrior NA\tHBeAg at pregnancy\tInitiation of TDF\t \tDelivery\t\nGA (weeks)\tHBV-DNA (log IU/mL)\tALT (U/L)\tGA (weeks)\tMode\tComplication\t\n1\t21\t1993\t1\t0\tC\tMTCT\tIFN-β\tETV\t+\t7\t<1.3\t15\t\t39\tCS\t-\t\n2\t30\t1985\t2\t1\tC\tMTCT\t-\tETV\t-\t(before this pregnancy)\t\t40\tVD\t-\t\n3\t31\t1985\t3\t1\tC\t(unknown)\t-\t-\t+\t33\t>8.2\t779\t\t39\tVD\t-\t\n4\t27\t1989\t1\t0\tC\tMTCT\t-\t-\t+\t31\t8.1\t228\t\t39\tVD\t-\t\n5\t41\t1975\t1\t0\tC\tMTCT\tPeg-IFN\t-\t-\t40\t7.0\t19\t\t41\tCS\tNRFS\t\nTDF: tenofovir disoproxil fumarate, G: gravidity, P: parity, HBV: hepatitis B virus, MTCT: mother-to-child transmission, IFN: interferon, Peg-IFN: pegylated interferon, NA: nucleoside/nucleotide analogue, ETV: entecavir, HBeAg: hepatitis B e antigen, GA: gestational age, ALT: alanine aminotransferase, CS: Caesarian section, VD: vaginal delivery, NRFS: non-reassuring fetal status\n\nFigure. The maternal courses of five pregnant women treated with TDF for chronic hepatitis B (Cases 1-5). Solid circle with solid line: serum ALT level, solid triangle with dotted line: serum HBV-DNA level. TDF: tenofovir disoproxil fumarate, ALT: alanine aminotransferase, HBV: hepatitis B virus, HBeAg: hepatitis B e antigen, CS: Caesarian section, IFN: interferon, ETV: entecavir, VD: vaginal delivery, Peg-IFN: pegylated interferon\n\nThe women ranged in age from 21 to 41 years old. Two had been born after the implementation of the national prevention program for mother-to-child transmission of HBV, which commenced in 1986 (Cases 1 and 4). Three were primigravida (Cases 1, 4, and 5), one was gravida 2, para 1 (Case 2), and one was gravida 3, para 1 (Case 3). All had HBV genotype C; the infection route was identified as mother-to-child transmission through a patient interview in all cases except for Case 3. Two had a history of interferon therapy (Cases 1 and 5), and two had been treated with ETV for a history of chronic active hepatitis (Case 1) or postpartum hepatitis flare after the delivery of a previous child (Case 2). Two achieved HBeAg seroconversion either spontaneously (Case 5) or during ETV therapy (Case 2).\n\nTwo women were administered TDF before pregnancy (Case 2) or in the first trimester (Case 1) by switching from ETV. In Case 2, TDF replaced ETV 9 months before the second pregnancy, reflecting the woman's desire to carry another child, and continued throughout the pregnancy. In Case 1, the patient became incidentally pregnant while taking ETV; she discontinued ETV, based on her own judgment, and switched to TDF at 7 weeks of gestation. In both women, ETV had reduced the HBV-DNA load to near or below the lower detection limit; this was maintained by subsequent TDF therapy.\n\nThe other three NA-naïve women started TDF for hepatitis flares (Cases 3 and 4) or HBV reactivation (Case 5) in the third trimester. In Cases 3 and 4, the women had persistently high viremia and received TDF when their respective serum alanine aminotransferase (ALT) levels rose to 779 U/L at 33 weeks and 228 U/L at 31 weeks of gestation. In particular, Case 3, who had been in the immunotolerant phase, presented with hepatic decompensation, as suggested by elevated serum total bilirubin levels (5.4 mg/dL) and decreased prothrombin activity (64%). In Case 5, as the pregnancy approached full-term, the maternal HBV-DNA levels gradually increased to 7.0 log IU/mL at 40 weeks of gestation, when TDF was introduced. As expected, hepatitis flare occurred in the perinatal period with maximal serum ALT levels of 169 U/L; this was milder than most of the previous flares the patient had experienced. Following the initiation of TDF, the maternal HBV-DNA load decreased below the detection limit at 7 months (Case 3), 8 months (Case 4), and 4 months (Case 5).\n\nAll women had singleton deliveries between 39 and 41 weeks of gestation. The modes of delivery were normal vaginal delivery in three (Cases 2, 3 and 4) and elective Caesarean section because of contractive pelvis (Case 1) and emergent Caesarean section due to a non-reassuring fetal status during labor induction (Case 5). During the follow-up period, none of the women exhibited any symptoms or laboratory abnormalities possibly related to TDF.\n\nOutcomes of children\nEvery child received standard neonatal care, including immunoprophylaxis with HBIG and HB vaccine immediately after birth and HB vaccine at one and six months of age, in accordance with the guidelines of the Health and Labor Ministry of Japan. The birth weight, Apgar score (1 and 5 minutes), birth defects, growth problems, and mother-to-child transmission of HBV are shown in Table 2. The number of each child corresponds to that of the child's mother. In summary, all infants exhibited normal growth and did not acquire HBV infection during the observation period.\n\nTable 2. Outcomes of Infants Who Were Born to HBV-infected Mothers Treated with TDF during Pregnancy.\n\nCase no.\tSex\tBirth weight (g)\tApgar score (1/5 minutes)\tBirth defect\tGrowth problem\tAt birth\t \tAfter immunoprophylaxis\tMTCT\t\nHBsAg\tHBV-DNA\tAge (weeks)\tHBsAg\tHBV-DNA\t\n1\tM\t3,296\t8/9\t-\t-\t-\t-\t\t38\t-\t-\t-\t\n2\tM\t3,585\t8/9\t-\t-\t(data not available due to delivery at other hospital)\t-\t\n3\tM\t3,209\t8/9\t-\t-\t-\t-\t\t53\t-\t-\t-\t\n4\tM\t3,206\t8/9\t-\t-\t-\t-\t\t34\t-\t-\t-\t\n5\tF\t3,056\t8/9\t-\t-\t-\t-\t\t37\t-\t(not tested)\t-\t\nThe number of each child corresponds to that of the child’s mother. HBV: hepatitis B virus, TDF: tenofovir disoproxil fumarate, M: male, F: female, HBsAg: hepatitis B surface antigen, MTCT: mother-to-child transmission\n\nDiscussion\nThis real-world clinical case series showed that TDF was safe and effective for pregnant Japanese women with chronic hepatitis B and the children born to them. Furthermore, TDF successfully suppressed HBV replication in both NA-naïve and ETV-experienced women. Except for one patient who underwent emergent Caesarian section for a non-reassuring fetal status during labor induction, none of the mothers in this study experienced serious obstetric complications or adverse events related to the administration of TDF. Furthermore, no children, including two who were exposed to TDF in the organogenetic period, developed congenital anomalies or growth impairments during the follow-up period.\n\nCritical considerations when administering antiviral therapy during pregnancy are the safety of the fetus and mother, as well as the efficacy of inhibiting maternal viral replication. In such cases, a potent NA with validated fetal safety must be selected because interferon therapy is contraindicated for use during pregnancy (14, 21, 22). Studies of antiviral therapy for pregnant women infected with human immunodeficiency virus supported that specific NAs were not associated with teratogenicity. According to the Antiretroviral Pregnancy Registry, there are sufficient data to evaluate the safety of lamivudine (LAM) and TDF; neither has been shown to increase the risk of birth defects in any trimester (23). Although breastfeeding while taking these NAs is discouraged according to the package inserts of each drug in Japan, it is not regarded as a contraindication overseas (21, 22, 24). The underlying rationale is that the level of these drugs secreted in breast milk is lower than the level that the fetus is exposed to in utero and thus is unlikely to be hazardous to infants. Of those two NAs, TDF is preferable to LAM, based on its high antiviral activity and genetic barrier against HBV (14, 21, 22). Despite concerns over the bone mineral density and renal function, there is a lack of safety warnings to withhold TDF during pregnancy for both mothers and infants born to them (25, 26). However, TAF, an equally powerful NA with improved bone and renal safety compared to TDF (27), has not been studied in pregnant women (21). Therefore, the evidence concerning the safety and efficacy profile of TAF in this setting is insufficient at present. Overall, antiviral therapy with TDF should be carefully considered for use in HBV-infected mothers who need such treatment, although the specific indications have not been firmly established. As described previously, JSH only refers to the drug of choice and does not provide details regarding patient selection or the timing of treatment (18). The American Association for the Study of Liver Diseases (AASLD) states that the treatment approach for pregnant women infected with HBV is similar to that in non-pregnant patients (21); in contrast, the European Association for the Study of Liver (EASL) has a more cautious perspective, advising treatment deferral until delivery in women without advanced fibrosis or cirrhosis (22).\n\nThe varied courses of the women with chronic HBV infection described in this report provide insight into the use of TDF treatment for women of childbearing age. If non-pregnant women with active hepatitis wish to conceive but require NA therapy, TDF should be introduced before pregnancy (22). While childbearing must be carefully planned in women who are using NA therapy, such women can become unintentionally pregnant. It should be noted that the withdrawal of antiviral agents during pregnancy frequently induces HBV reactivation and hepatitis flares (15, 28), whereas no flares occur if antiviral therapy is continued throughout pregnancy (15). Therefore, to prevent hepatitis flares, it is advisable to continue or switch to TDF once the pregnancy is noted, provided the mother accepts the safety profile of TDF (14). Untreated women in the immunotolerant or immunoactive phase may develop acute exacerbation during pregnancy; in such cases, TDF should be considered based on the severity of hepatitis (13, 14). Even if the maternal course is uneventful, HBV-infected women should be regularly monitored for postpartum flares, which may require antiviral therapy (8, 9).\n\nOur report of HBV-infected mothers emphasizes the need to address mother-to-child transmission in modern Japan further. The presence of chronic HBV infections in women born after the initiation of the preventive program who nonetheless acquired HBV from their mothers indicates that immunoprophylaxis alone cannot eliminate mother-to-child transmission. This finding is supported by the results of epidemiological studies, which have shown that mother-to-child transmission remains the most common cause of chronic HBV infection among Japanese people born after the preventive program was started (29, 30). Because incomplete immunoprophylaxis can result in mother-to-child transmission (31), the Japanese government simplified the vaccination schedule in 2013; this simplified schedule was used for the babies born to mothers in this report. However, there are many other known mechanisms of immunoprophylaxis failure, such as intrauterine infection (31, 32), HBsAg mutation (33, 34), and horizontal infection of the mother during pregnancy (31). Previous studies have indicated that a high maternal viral load is a risk factor for immunoprophylaxis failure (32, 35, 36). Thus, the presence of high viremia in the NA-naïve mothers in the present report serves as evidence that there remain Japanese women who can vertically transmit HBV to their children. Notably, while one mother had immunoprophylaxis failure, the other two were born before the introduction of the preventive program.\n\nIn addition to its principal purpose of treating maternal hepatitis, administration of TDF might have aided in preventing mother-to-child transmission. Both AASLD and EASL recommend antiviral therapy in combination with immunoprophylaxis for highly viremic pregnant women in order to reduce mother-to-child transmission of HBV (21, 22). Using this strategy, NA (preferably TDF) is administered to pregnant women with HBV-DNA >200,000 IU/mL, beginning in the late second or early third trimester and continuing until delivery or postpartum; the newborn then receives standard immunoprophylaxis with HBIG and HB vaccine. A number of prospective comparative studies (37, 38) and randomized controlled trials (39, 40) conducted overseas have shown that TDF significantly reduced the maternal viral load and mother-to-child transmission without increasing the incidence of clinically meaningful adverse events. However, a double-blind randomized controlled trial in Thailand suggested that if mother-to-child transmission was well controlled by immunoprophylaxis alone, the additional effect of TDF was not found to be statistically significant (0% in the TDF group vs. 2% in the placebo group) (41). In the preventive program implemented in Japan, the rates of immunoprophylaxis failure in prefecture-based studies were reportedly 0-6.5% during the late 1980s and early 1990s (4, 5); however, more recent nationwide data are unavailable. Thus far, the true advantage of adopting this strategy in Japan remains unclear; nonetheless, TDF should be appropriately delivered to HBV-infected pregnant women with valid reasons for treatment of liver disease, which is an approach that can also help prevent mother-to-child transmission.\n\nIn conclusion, we reported five cases of Japanese women with chronic hepatitis B who underwent TDF therapy during pregnancy. TDF was safe and effective for pregnant women with chronic HBV infection and the children born to them. Mother-to-child transmission of HBV remains a serious public health issue that is yet to be addressed fully in Japan. Considerations regarding antiviral therapy for HBV-infected women of childbearing age should include treatment of maternal liver disease and prevention of mother-to-child transmission.\n\n\nThe study protocol was approved by the ethical committees of Osaka City General Hospital and Osaka City University Hospital and conducted in accordance with the amended Declaration of Helsinki. Informed consent was waived due to the retrospective nature of the study.\n\n\nAuthor's disclosure of potential Conflicts of Interest (COI).\n\nNorifumi Kawada: Honoraria, Gilead Sciences; Research funding, Gilead Sciences.\n\nAcknowledgement\nWe thank the obstetricians and pediatricians of Osaka City General Hospital for caring for the mothers and children in this study.\n==== Refs\n1. \nRazavi-Shearer D , Gamkrelidze I , Nguyen MH , et al \nGlobal prevalence, treatment, and prevention of hepatitis B virus infection in 2016: a modelling study . Lancet Gastroenterol Hepatol \n3 : 383 -403 , 2018 .29599078 \n2. \nMichitaka K , Nishiguchi S , Aoyagi Y , Hiasa Y , Tokumoto Y , Onji M , Japan Etiology of Liver Cirrhosis Study Group \nEtiology of liver cirrhosis in Japan: a nationwide survey . Gastroenterol \n45 : 86 -94 , 2010 .\n3. \nKudo M , Izumi N , Ichida T , et al \nReport of the 19th follow-up survey of primary liver cancer in Japan . Hepatol Res \n46 : 372 -390 , 2016 .26970231 \n4. \nKoyama T , Matsuda I , Sato S , Yoshizawa H \nPrevention of perinatal hepatitis B virus transmission by combined passive-active immunoprophylaxis in Iwate, Japan (1981-1992) and epidemiological evidence for its efficacy . Hepatol Res \n26 : 287 -292 , 2003 .12963428 \n5. \nNoto H , Terao T , Ryou S , et al \nCombined passive and active immunoprophylaxis for preventing perinatal transmission of the hepatitis B virus carrier state in Shizuoka, Japan during 1980-1994 . J Gastroenterol Hepatol \n18 : 943 -949 , 2003 .12859724 \n6. \nShiraki K \nPerinatal transmission of hepatitis B virus and its prevention . J Gastroenterol Hepatol \n15 (Suppl ): E11 -E15 , 2000 .10921375 \n7. \nSaitoh A , Okabe N \nProgress and challenges for the Japanese immunization program: beyond the \"vaccine gap\" . Vaccine \n36 : 4582 -4588 , 2018 .29929825 \n8. \nNguyen G , Garcia RT , Nguyen N , Trinh H , Keeffe EB , Nguyen MH \nClinical course of hepatitis B virus infection during pregnancy . Aliment Pharmacol Ther \n29 : 755 -764 , 2009 .19183158 \n9. \nChang CY , Aziz N , Poongkunran M , et al \nSerum alanine aminotransferase and hepatitis B DNA flares in pregnant and postpartum women with chronic hepatitis B . Am J Gastroenterol \n111 : 1410 -1415 , 2016 .27456990 \n10. \nKushner T , Shaw PA , Kalra A , et al \nIncidence, determinants and outcomes of pregnancy-associated hepatitis B flares: a regional hospital-based cohort study . Liver Int \n38 : 813 -820 , 2018 .28941137 \n11. \nYang YB , Li XM , Shi ZJ , Ma L \nPregnant woman with fulminant hepatic failure caused by hepatitis B virus infection: a case report . World J Gastroenterol \n10 : 2305 -2306 , 2004 .15259091 \n12. \nArata S , Nozaki A , Takizawa K , et al \nHepatic failure in pregnancy successfully treated by online hemodiafiltration: chronic hepatitis B virus infection without viral genome mutation . Hepatol Res \n43 : 1356 -1360 , 2013 .23675979 \n13. \nPan CQ , Lee HM \nAntiviral therapy for chronic hepatitis B in pregnancy . Semin Liver Dis \n33 : 138 -146 , 2013 .23749670 \n14. \nHe T , Jia J \nChronic HBV: which pregnant women should be treated? \nLiver Int \n36 (Suppl 1 ): 105 -108 , 2016 .26725906 \n15. \nChang CY , Aziz N , Poongkunran M , et al \nSerum aminotransferase flares in pregnant and postpartum women with current or prior treatment for chronic hepatitis B . J Clin Gastroenterol \n52 : 255 -261 , 2018 .28323748 \n16. \nLin HH , Chen PJ , Chen DS , et al \nPostpartum subsidence of hepatitis B viral replication in HBeAg-positive carrier mothers . J Med Virol \n29 : 1 -6 , 1989 .2584955 \n17. \nTan HH , Lui HF , Chow WC \nChronic hepatitis B virus (HBV) infection in pregnancy . Hepatol Int \n2 : 370 -375 , 2008 .19669267 \n18. \nThe Japan Society of Hepatology.\nThe treatment guideline for hepatitis B (version 3.1) [Internet]. [cited 2019 Jul 1]; Available from: https://www.jsh.or.jp/files/uploads/HBV_GL_ver3.1_v1.2.pdf (in Japanese).\n19. \nTooyama M , Tamori A , Nakano A , et al \nA pregnant woman with acute hepatitis B in whom vertical transmission was prevented by tenofovir disoproxil fumarate . Clin J Gastroenterol \n6 : 173 -176 , 2013 .26181458 \n20. \nWakano Y , Sugiura T , Endo T , et al \nAntiviral therapy for hepatitis B virus during second pregnancies . J Obstet Gynaecol Res \n44 : 566 -569 , 2018 .29227001 \n21. \nTerrault NA , Lok ASF , McMahon BJ , et al \nUpdate on prevention, diagnosis, and treatment of chronic hepatitis B: AASLD 2018 hepatitis B guidance . Hepatology \n67 : 1560 -1599 , 2018 .29405329 \n22. \nEuropean Association for the Study of the Liver \nEASL 2017 Clinical Practice Guidelines on the management of hepatitis B virus infection . J Hepatol \n67 : 370 -398 , 2017 .28427875 \n23. \nBrown RS Jr, Verna EC , Pereira MR , et al \nHepatitis B virus and human immunodeficiency virus drugs in pregnancy: findings from the Antiretroviral Pregnancy Registry . J Hepatol \n57 : 953 -959 , 2012 .22766470 \n24. \nEhrhardt S , Xie C , Guo N , Nelson K , Thio CL \nBreastfeeding while taking lamivudine or tenofovir disoproxil fumarate: a review of the evidence . Clin Infect Dis \n60 : 275 -278 , 2015 .25313254 \n25. \nMugo NR , Hong T , Celum C , et al \nPregnancy incidence and outcomes among women receiving preexposure prophylaxis for HIV prevention: a randomized clinical trial . JAMA \n312 : 362 -371 , 2014 .25038355 \n26. \nMofenson LM , Baggaley RC , Mameletzis I \nTenofovir disoproxil fumarate safety for women and their infants during pregnancy and breastfeeding . AIDS \n31 : 213 -232 , 2017 .27831952 \n27. \nAgarwal K , Brunetto M , Seto WK , et al \n96 weeks treatment of tenofovir alafenamide vs. tenofovir disoproxil fumarate for hepatitis B virus infection . J Hepatol \n68 : 672 -681 , 2018 .29756595 \n28. \nKim HY , Choi JY , Park CH , et al \nOutcome after discontinuing antiviral agents during pregnancy in women infected with hepatitis B virus . J Clin Virol \n56 : 299 -305 , 2013 .23273664 \n29. \nKomatsu H , Inui A , Sogo T , Hiejima E , Kudo N , Fujisawa T \nSource of transmission in children with chronic hepatitis B infection after the implementation of a strategy for prevention in those at high risk . Hepatol Res \n39 : 569 -576 , 2009 .19260997 \n30. \nKomatsu H , Inui A , Fujisawa T , et al \nTransmission route and genotype of chronic hepatitis B virus infection in children in Japan between 1976 and 2010: a retrospective, multicenter study . Hepatol Res \n45 : 629 -637 , 2015 .25069950 \n31. \nTorii Y , Kimura H , Hayashi K , et al \nCauses of vertical transmission of hepatitis B virus under the at-risk prevention strategy in Japan . Microbiol Immunol \n57 : 118 -121 , 2013 .23252723 \n32. \nPeng S , Wan Z , Liu T , Zhu H , Du Y \nIncidence and risk factors of intrauterine transmission among pregnant women with chronic hepatitis B virus infection . J Clin Gastroenterol \n53 : 51 -57 , 2019 .29517711 \n33. \nHsu HY , Chang MH , Ni YH , Lin HH , Wang SM , Chen DS \nSurface gene mutants of hepatitis B virus in infants who develop acute or chronic infections despite immunoprophylaxis . Hepatology \n26 : 786 -791 , 1997 .9303514 \n34. \nLee le Y , Aw M , Rauff M , Loh KS , Lim SG , Lee GH \nHepatitis B immunoprophylaxis failure and the presence of hepatitis B surface gene mutants in the affected children . J Med Virol \n87 : 1344 -1350 , 2015 .25782362 \n35. \nZou H , Chen Y , Duan Z , Zhang H , Pan C \nVirologic factors associated with failure to passive-active immunoprophylaxis in infants born to HBsAg-positive mothers . J Viral Hepat \n19 : e18 -e25 , 2012 .22239517 \n36. \nWen WH , Chang MH , Zhao LL , et al \nMother-to-infant transmission of hepatitis B virus infection: significance of maternal viral load and strategies for intervention . J Hepatol \n59 : 24 -30 , 2013 .23485519 \n37. \nGreenup AJ , Tan PK , Nguyen V , et al \nEfficacy and safety of tenofovir disoproxil fumarate in pregnancy to prevent perinatal transmission of hepatitis B virus . J Hepatol \n61 : 502 -507 , 2014 .24801414 \n38. \nChen HL , Lee CN , Chang CH , et al \nEfficacy of maternal tenofovir disoproxil fumarate in interrupting mother-to-infant transmission of hepatitis B virus . Hepatology \n62 : 375 -386 , 2015 .25851052 \n39. \nPan CQ , Duan Z , Dai E , et al \nTenofovir to prevent hepatitis B transmission in mothers with high viral load . N Engl J Med \n374 : 2324 -2334 , 2016 .27305192 \n40. \nLin Y , Liu Y , Ding G , et al \nEfficacy of tenofovir in preventing perinatal transmission of HBV infection in pregnant women with high viral loads . Sci Rep \n8 : 15514 , 2018 .30341345 \n41. \nJourdain G , Ngo-Giang-Huong N , Harrison L , et al \nTenofovir versus placebo to prevent perinatal transmission of hepatitis B . N Engl J Med \n378 : 911 -923 , 2018 .29514030\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "59(2)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "hepatitis B virus; mother-to-child transmission; pregnancy; tenofovir disoproxil fumarate",
"medline_ta": "Intern Med",
"mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D002648:Child; D005260:Female; D006147:Guanine; D006513:Hepatitis B e Antigens; D006515:Hepatitis B virus; D019694:Hepatitis B, Chronic; D006801:Humans; D007231:Infant, Newborn; D018445:Infectious Disease Transmission, Vertical; D007564:Japan; D008297:Male; D009035:Mothers; D011247:Pregnancy; D011248:Pregnancy Complications; D011295:Prenatal Care; D000068698:Tenofovir; D019562:Viral Load",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "205-210",
"pmc": null,
"pmid": "31941870",
"pubdate": "2020",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "12963428;26725906;28323748;27831952;25069950;22766470;23252723;29929825;29756595;23675979;19183158;23485519;24801414;26181458;25851052;23749670;12859724;29599078;26970231;29227001;9303514;29514030;25038355;22239517;15259091;19260997;25313254;27456990;27305192;28941137;29405329;10921375;29517711;25782362;28427875;2584955;19669267;30341345;19789837;23273664",
"title": "The Administration of Tenofovir Disoproxil Fumarate for Pregnant Japanese Women with Chronic Hepatitis B.",
"title_normalized": "the administration of tenofovir disoproxil fumarate for pregnant japanese women with chronic hepatitis b"
} | [
{
"companynumb": "JP-GILEAD-2017-0303240",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TENOFOVIR DISOPROXIL FUMARATE"
},
"drugadditiona... |
{
"abstract": "A total of 5-10% of patients with retinoblastoma (RB) harbor deletion of the long arm (q) chromosome 13 (13q-). The treatment-related toxicities in this population have not been described.\n\n\n\nSixty-eight RB patients on a single institutional protocol (RET5) from 2005 to 2010 were reviewed. Genetic screening identified 11 patients (seven female) with 13q-. Patients with early (Reese-Ellsworth [R-E] group I-III) disease (6/23 with 13q-) received eight courses of vincristine/carboplatin (VC). Patients with advanced (R-E group IV-V) bilateral disease (2/27 with 13q-) received two courses of vincristine/topotecan (VT) followed by nine courses of alternating VT/VC. Patients undergoing upfront enucleation received histopathology-based chemotherapy: intermediate risk (2/8 with 13q-) or high risk (1/10 with 13q-). Dose reductions were mandated for >7 day delay in two consecutive courses following hematologic toxicity. Grades 3 and 4 hematologic, infectious, and gastrointestinal toxicities were compared between RET5 patients with and without 13q-.\n\n\n\nDemographics were similar between groups. When present, prolonged neutropenia (median 7 days, range 0-14 days) delayed chemotherapy and resulted in more frequent dose reductions among 13q- patients (5/11) than non-13q- patients (4/57) (P < 0.01). GI toxicity was similar between groups (5/11 13q- vs. 13/57 non-13q-; P = 0.14), but halted chemotherapy in one 13q- patient. Infectious complications and disease outcomes were similar between groups. At follow-up, all patients are alive (median 6.1 years, range 7.6 months-9.5 years).\n\n\n\n13q- RB patients had a higher incidence of neutropenia requiring chemotherapy dose reductions, but did not have increased treatment failure.",
"affiliations": "Division of Solid Tumor, Department of Oncology, St. Jude Children's Research Hospital, Memphis, Tennessee. Rachel.brennan@stjude.org.;Division of Solid Tumor, Department of Oncology, St. Jude Children's Research Hospital, Memphis, Tennessee.;Department of Biostatistics, St. Jude Children's Research Hospital, Memphis, Tennessee.;Department of Surgery, St. Jude Children's Research Hospital, Memphis, Tennessee.;Division of Solid Tumor, Department of Oncology, St. Jude Children's Research Hospital, Memphis, Tennessee.;Department of Surgery, St. Jude Children's Research Hospital, Memphis, Tennessee.",
"authors": "Brennan|Rachel C|RC|;Qaddoumi|Ibrahim|I|;Billups|Catherine A|CA|;Kaluzny|Tracy|T|;Furman|Wayne L|WL|;Wilson|Matthew W|MW|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.26138",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "63(11)",
"journal": "Pediatric blood & cancer",
"keywords": "13q deletion syndrome; 13q-; chemotherapy-related toxicity; neutropenia; retinoblastoma",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D002648:Child; D002675:Child, Preschool; D002872:Chromosome Deletion; D025063:Chromosome Disorders; D002882:Chromosomes, Human, Pair 13; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D008875:Middle Aged; D019572:Retinal Neoplasms; D012175:Retinoblastoma",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "1954-8",
"pmc": null,
"pmid": "27409525",
"pubdate": "2016-11",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "1004381;8418661;13973597;315199;21505449;7375916;7826849;19895612;24577551;23359405;24509483;7287000;2915374;3365680;22237022;8309761;14081487;14522775;22516936;16343894",
"title": "Patients with retinoblastoma and chromosome 13q deletions have increased chemotherapy-related toxicities.",
"title_normalized": "patients with retinoblastoma and chromosome 13q deletions have increased chemotherapy related toxicities"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US22766",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Although frequently prescribed, certain antibiotics such as trimethoprim-sulfamethoxazole carry the risk of a rare yet life-threatening adverse effect, termed drug-induced aseptic meningitis. Morbidity can be avoided if the medication is identified and discontinued. Patients in reported cases tend to be female and have an autoimmune disease or prior adverse reaction to the offending agent. As a rare and poorly characterized condition, the subset of patients using antibiotics at risk for aseptic meningitis remains unclear; hence, cataloging these adverse events remains critical for better elucidating the disease. Here, we report a 62-year-old man with psoriasis and no prior history of sulfa allergy, who presented with a sudden onset of fever, chills, vomiting, and muscle aches 5 hours after taking single doses of trimethoprim-sulfamethoxazole and ciprofloxacin. Common infectious causes were ruled out, and his medications were discontinued. Despite initial symptom resolution with discontinuation, the patient neurologically deteriorated over the next two days before eventually recovering with supportive care. This case highlights the variable presentation of drug-induced aseptic meningitis. In contrast to previous reports of drug-induced aseptic meningitis, our patient was male, older than the median age of 40 years, and did not have a prior adverse reaction to the antibiotic. Furthermore, to the best of our knowledge, we report a possible case of antibiotic-induced aseptic meningitis in a patient with psoriasis. Lastly, the case emphasizes not only the value of a thorough medication history but also the importance of recognizing that patients may deteriorate in the first 48 hours before resolution.",
"affiliations": "John A. Burns School of Medicine, University of Hawai'i at Mānoa, Honolulu, HI (AWKK, AG, WBH, AI, KK, JV).;John A. Burns School of Medicine, University of Hawai'i at Mānoa, Honolulu, HI (AWKK, AG, WBH, AI, KK, JV).;University of California Riverside School of Medicine, Riverside, CA (AC).;John A. Burns School of Medicine, University of Hawai'i at Mānoa, Honolulu, HI (AWKK, AG, WBH, AI, KK, JV).;John A. Burns School of Medicine, University of Hawai'i at Mānoa, Honolulu, HI (AWKK, AG, WBH, AI, KK, JV).;John A. Burns School of Medicine, University of Hawai'i at Mānoa, Honolulu, HI (AWKK, AG, WBH, AI, KK, JV).",
"authors": "Ko|Andrew Wai Kei|AWK|;Ghaffari-Rafi|Arash|A|;Chan|Alvin|A|;Harris|William B|WB|;Imasa|Arcelita|A|;Liow|Kore Kai|KK|;Viereck|Jason|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2641-5216",
"issue": "80(6)",
"journal": "Hawai'i journal of health & social welfare",
"keywords": "TMP-SMX; Trimethoprim; adverse effect; aseptic meningitis; drug reaction; drug-induced; meningitis; sulfamethoxazole",
"medline_ta": "Hawaii J Health Soc Welf",
"mesh_terms": null,
"nlm_unique_id": "101750601",
"other_id": null,
"pages": "129-133",
"pmc": null,
"pmid": "34195619",
"pubdate": "2021-06",
"publication_types": "D016428:Journal Article",
"references": "29364542;7249508;30731305;6333524;23062896;28165786;28570223;31885958;25003798;7352728;27579194;28611632;17921048;28435023;2320959;28404701;6602292;10268557;9228966;13092736;3958749;30850034;25240332;3752106;17199599;10268555;31318079;4002188;837643;16396068;29876667;10278126;10738845;483800;19224981;32358740;27324314;3489810;9296242",
"title": "A Case Report of Antibiotic-Induced Aseptic Meningitis in Psoriasis.",
"title_normalized": "a case report of antibiotic induced aseptic meningitis in psoriasis"
} | [
{
"companynumb": "US-BAYER-2021-188272",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Chemotherapy-induced cardiomyopathy is one of the major possible hazards that can result from potential cardiotoxic agents while treating cancer. Prognostic risk factors include the rate of drug administration, history of hypertension, female gender, extremes of age, previous history of mediastinal irradiation, cumulative dose and pre-existing heart disease. Close monitoring of the patients, timely diagnosis, use of well-known biomarkers including cardiac troponins, NT-ProBNP and imaging studies like 2D Echo or cardiac MRI are essential. Emerging biomarkers include carbonyl reductases (CBR1 and CBR3), aldo-keto reductases (AKR, type 1A1, 1C3, 7A2) and topoisomerase2β (Top2β). β blockers and ACE inhibitors have not only been shown to slow down the progression of cardiac dysfunction but also produce symptomatic improvement. Our case report describes a patient with acute myeloblastic leukaemia who developed severe cardiomyopathy acutely after starting the anthracycline-based regimen. Nevertheless, with timely intervention her symptoms improved and subsequently she successfully received allogeneic stem cell transplantation.",
"affiliations": "Department of General Internal Medicine, University of Arizona Medical Center-University Campus, Tucson, Arizona, USA.;Department of General Internal Medicine, University of Arizona Medical Center-University Campus, Tucson, Arizona, USA.;Department of General Internal Medicine, University of Arizona Medical Center-University Campus, Tucson, Arizona, USA.;Department of Hematology Oncology, University of Arizona Medical Center, Tucson, Arizona, USA.",
"authors": "Shahzad|Muhammad Asim|MA|;Ishtiaq|Rizwan|R|;Zahid|Umar|U|;Anwer|Faiz|F|",
"chemical_list": "D000319:Adrenergic beta-Antagonists; D000806:Angiotensin-Converting Enzyme Inhibitors; D000903:Antibiotics, Antineoplastic; D015415:Biomarkers",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2016-217210",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2016()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000319:Adrenergic beta-Antagonists; D000806:Angiotensin-Converting Enzyme Inhibitors; D000903:Antibiotics, Antineoplastic; D015415:Biomarkers; D009202:Cardiomyopathies; D005260:Female; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D008875:Middle Aged; D011379:Prognosis; D033581:Stem Cell Transplantation",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "27852680",
"pubdate": "2016-11-16",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "24142687;15860848;496103;12767102;12595346;21699467;21833028;25395954;21725655;12075731;24499452;18855640;22068815;12644586;22505958;20587042;759880;23850849;20117401;17329180;24562808;15717742;8644988;23714670;16473642;21353471;24269342;10888230;3922612;24091715;23125858;26338137;22664114;12075737;20837989",
"title": "Successful recovery and allogeneic stem cell transplant following chemotherapy-induced severe cardiomyopathy: literature review of management and prognostic factors.",
"title_normalized": "successful recovery and allogeneic stem cell transplant following chemotherapy induced severe cardiomyopathy literature review of management and prognostic factors"
} | [
{
"companynumb": "US-VALIDUS PHARMACEUTICALS LLC-US-2016VAL003248",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugadd... |
{
"abstract": "A 38-year-old female patient with systemic lupus erythematosus presented with pulmonary infiltrates and hypoxemia for several months following immunodepleting autologous hematopoietic stem cell transplantation. She was treated for influenza, which was isolated repeatedly from oropharynx and bronchoalveolar lavage (BAL) fluids, and later empirically for lupus pneumonitis, but died 6 months after transplant. Autopsy findings failed to show influenza in the lungs or lupus pneumonitis. A novel generic polymerase chain reaction (PCR)-based assay using degenerate primers identified human coronavirus (CoV) HKU1 RNA in BAL fluid at autopsy. CoV was confirmed by virus-specific PCRs of lung tissue at autopsy. Electron microscopy showed viral particles consistent with CoV HKU1 in lung tissue both at autopsy and from a previous biopsy. Although human CoV HKU1 infection is not usually severe, in highly immunocompromised patients, it can be associated with fatal pneumonia.",
"affiliations": "Division of Viral Products, Center for Biologics, Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA.",
"authors": "Uhlenhaut|C|C|;Cohen|J I|JI|;Pavletic|S|S|;Illei|G|G|;Gea-Banacloche|J C|JC|;Abu-Asab|M|M|;Krogmann|T|T|;Gubareva|L|L|;McClenahan|S|S|;Krause|P R|PR|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/j.1399-3062.2011.00657.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "14(1)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": null,
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D000328:Adult; D001344:Autopsy; D001706:Biopsy; D017934:Coronavirus; D018352:Coronavirus Infections; D017809:Fatal Outcome; D005260:Female; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008168:Lung; D011024:Pneumonia, Viral; D016133:Polymerase Chain Reaction",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "79-85",
"pmc": null,
"pmid": "21749586",
"pubdate": "2012-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052060:Research Support, N.I.H., Intramural",
"references": "16704837;16757599;12606750;19137502;5231356;17222582;16257260;19250860;18406664;10941338;12062393;16371626;16791762;16983613;18712820;15034574;16267760;15613317;18601953;16447108;15986174",
"title": "Use of a novel virus detection assay to identify coronavirus HKU1 in the lungs of a hematopoietic stem cell transplant recipient with fatal pneumonia.",
"title_normalized": "use of a novel virus detection assay to identify coronavirus hku1 in the lungs of a hematopoietic stem cell transplant recipient with fatal pneumonia"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK202005845",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": n... |
{
"abstract": "Alemtuzumab is an anti-CD52 monoclonal antibody approved for the treatment of multiple sclerosis (MS). It produces rapid depletion of T and B lymphocytes, which could predispose to opportunistic infections. We report one patient with MS who develops cytomegalovirus (CMV) primary infection after a third cycle of alemtuzumab, with spontaneous recovery associated with rapid lymphocyte reconstitution.",
"affiliations": "Department of Neurology, Hospital Universitario La Princesa, 28002 Madrid, Spain. Electronic address: claraguih@hotmail.com.;Department of Neurology, Hospital Universitario La Princesa, 28002 Madrid, Spain.;Department of Neurology, Hospital Universitario La Princesa, 28002 Madrid, Spain.;Department of Neurology, Hospital Universitario La Princesa, 28002 Madrid, Spain.",
"authors": "Aguirre|Clara|C|;Meca-Lallana|Virginia|V|;Sánchez|Pedro|P|;Vivancos|Jose|J|",
"chemical_list": "D000074323:Alemtuzumab",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.msard.2019.07.026",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2211-0348",
"issue": "35()",
"journal": "Multiple sclerosis and related disorders",
"keywords": null,
"medline_ta": "Mult Scler Relat Disord",
"mesh_terms": "D000328:Adult; D000074323:Alemtuzumab; D003586:Cytomegalovirus Infections; D005260:Female; D006801:Humans; D009103:Multiple Sclerosis",
"nlm_unique_id": "101580247",
"other_id": null,
"pages": "270-271",
"pmc": null,
"pmid": "31442904",
"pubdate": "2019-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Cytomegalovirus primary infection in a patient with multiple sclerosis treated with alemtuzumab.",
"title_normalized": "cytomegalovirus primary infection in a patient with multiple sclerosis treated with alemtuzumab"
} | [
{
"companynumb": "PHHY2019ES208332",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drugadditional": "... |
{
"abstract": "Drug rash with eosinophilia and systemic symptoms (DRESS) syndrome is a drug reaction commonly occurring in association with aromatic anticonvulsants and allopurinol. It is characterized by triad of fever, skin eruption, and systemic involvement. DRESS is rare with beta-lactam antibiotics and even rarer with ceftriaxone. We describe a case of pneumonia who developed ceftriaxone-induced rash, bicytopenia, eosinophilia, transaminitis and was eventually diagnosed and managed successfully as a case of DRESS.",
"affiliations": "Department of Internal Medicine, Armed Forces Medical College, Pune, India.;Department of Internal Medicine, Armed Forces Medical College, Pune, India.;Department of Internal Medicine, Armed Forces Medical College, Pune, India.;Department of Internal Medicine, Armed Forces Medical College, Pune, India.",
"authors": "Guleria|Vivek S|VS|;Dhillon|Mukesh|M|;Gill|Shaman|S|;Naithani|Nardeep|N|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/2279-042X.137077",
"fulltext": "\n==== Front\nJ Res Pharm PractJ Res Pharm PractJRPPJournal of Research in Pharmacy Practice2319-96442279-042XMedknow Publications & Media Pvt Ltd India JRPP-3-7210.4103/2279-042X.137077Case ReportCeftriaxone induced drug rash with eosinophilia and systemic symptoms Guleria Vivek S. 1Dhillon Mukesh 1Gill Shaman 1Naithani Nardeep 11 Department of Internal Medicine, Armed Forces Medical College, Pune, IndiaCorresponding author: Dr. Vivek S. Guleria, E-mail: viveksguleria@gmail.comApr-Jun 2014 3 2 72 74 2 2014 3 2014 Copyright: © Journal of Research in Pharmacy Practice2014This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Drug rash with eosinophilia and systemic symptoms (DRESS) syndrome is a drug reaction commonly occurring in association with aromatic anticonvulsants and allopurinol. It is characterized by triad of fever, skin eruption, and systemic involvement. DRESS is rare with beta-lactam antibiotics and even rarer with ceftriaxone. We describe a case of pneumonia who developed ceftriaxone-induced rash, bicytopenia, eosinophilia, transaminitis and was eventually diagnosed and managed successfully as a case of DRESS.\n\nCeftriaxoneDrug rash with eosinophilia and systemic symptomEosinophilia\n==== Body\nINTRODUCTION\nDrug rash with eosinophilia and systemic symptoms (DRESS) syndrome is an acute, severe, unpredictable cutaneous reaction to drugs leading to skin eruptions and visceral involvement. The characteristic features include a diffuse maculopapular rash, facial edema, exfoliative dermatitis, fever, lymphadenopathy, visceral involvement (renal impairment, carditis, pneumonitis), hematological abnormalities (mainly eosinophilia, lymphocytosis and atypical lymphocytes).[1] DRESS was first described by Chaiken et al. in 1950 with dilantin (phenytoin).[2] It occurs with numerous drugs (e.g., anticonvulsants, sulphonamides, and allopurinol).[3] DRESS with beta-lactam antibiotics has been also reported. Ceftriaxone, a cephalosporin is used for variety of infections. This drug is known to be associated with rare and mild side-effects such as urticaria, skin rash, diarrhea, vomiting, transient neutropenia, and hemolysis. However, ceftriaxone-induced DRESS is rare. To the best of our knowledge, there have been only two cases reported in the literature.[4] We report herein one case of DRESS induced by ceftriaxone.\n\nCASE REPORT\nA 33-year-old male was admitted (10, November 2013) with fever and dry cough of 4 days duration in a peripheral hospital. The patient had no known comorbidities and didn't give history of any drug allergy in the past. On examination, he was found to be febrile (100 F), had a pulse of 90/min, blood pressure of 126/80 mmHg, respiratory rate of 24/min and had crackles in right infrascapular region. Based on the clinical examination and chest X-ray, he was diagnosed to have pneumonia. His hematological and biochemical parameters were within the normal limit. He was started on injection of ceftriaxone (1 g, intravenous, every 24 h). On the 3rd day of admission, his fever dropped down and he was afebrile by day 6. Ceftriaxone was continued. On the 7th day, he developed transaminases elevation, alanine aminotransferase (alanine transaminase (ALT) =219 IU/L; aspartate aminotransferase (AST) =356 IU/L; alkaline phosphatase (ALP) =246 IU/L). On the 11th day, he had recurrence of high grade fever with maculopapular rash over trunk, extremities and swelling of wrist and ankles [Figures 1–3]. He was transferred to our center on day 11, with the following laboratory findings: Hemoglobin = 11.4 g%; total leucocyte count (TLC) =1900/cm3 with relative eosinophilia of 10%; platelets (Plt) count = 1,47,000/cm3(previous Plt = 2,00,000/cm3). His peripheral blood smear showed leucopenia with relative eosinophilia, 6% atypical lymphocytes, Plt: 1,50,000/cm3 and no evidence of hemolysis and hemoparasite. His liver enzymes were markedly raised as below: ALT = 766 IU/L; AST = 2424 IU/L; ALP = 162 IU/L, and lactate dehydrogenase = 3732 IU/L. His urea and creatinine were 46 and 1.7 mg/dL, respectively. Bone marrow aspiration/biopsy was done and presented to be normal. His hepatitis B surface antigen, antihepatitis C virus antibody, and human immunodeficiency virus antibody were all negative. Rapid diagnostic test for malaria and dengue serology were negative. A diagnosis of ceftriaxone-induced DRESS was made, based upon European Registry of severe cutaneous adverse reactions (RegiSCAR) criteria.[5] Ceftriaxone was stopped and patient was treated with injection of dexamethasone 4 mg, thrice a day for initial 2 days and later oral prednisolone 60 mg/day, which was gradually tapered over 6 weeks. Only after 48 h of steroid therapy, patient started improving symptomatically and became afebrile after 72 h. His rash cleared over 5 days and his hematological and biochemical parameters started improving after 72 h and became normal by day 8 of starting steroids [Table 1].\n\nFigure 1 Erythematous maculopapular rash over chest and abdomen\n\nFigure 2 Erythematous maculopapular rash over back\n\nFigure 3 Erythematous maculopapular rash over thigh\n\nTable 1 Hematological and biochemical laboratory findings of the patient\n\nDISCUSSION\nDrug rash with eosinophilia and systemic symptoms syndrome is a life-threatening adverse reaction to a drug with associated mortality rate of about 10%. Proposed mechanism of pathogenesis of DRESS has been failure of drug detoxification pathways leading to accumulation of harmful metabolites which in turn activate CD4 + CD8 + T-cells. These cells release interleukin-5 which activates eosinophils and sets up an inflammatory cascade.[6] Earlier, there was no consistent name for this syndrome and it was named after the culprit drug as phenytoin syndrome, allopurinol hypersensitivity syndrome, dapsone syndrome, etc., Bocquet et al.[7] proposed the term drug rash with eosinophilia and systemic symptoms (DRESS) to simplify the nomenclature of drug-hypersensitivity syndromes. Since then, various criteria have been evolved to define DRESS [Table 2]. Among all the criteria being used to diagnose DRESS, RegiSCAR criteria[5] is the most widely used.\n\nTable 2 Scoring systems for diagnosis of DRESS\n\nOur patient was diagnosed as DRESS syndrome as he was fulfilling all Bocquet et al.[7] proposed criteria and criteria 1, 2, 3, 4, 6, 7 of RegiSCAR.[5] However, except for fever, no other Japanese consensus group criteria[8] was being fulfilled, as the symptoms and signs had appeared early (11 days of ceftriaxone administration), there was leucopenia (TLC = 1900) rather than leukocytosis, and absolute eosinophil count was only 190/cm3 though there was relative increase in eosinophils (10% of TLC). Patient was treated as having ceftriaxone induced DRESS syndrome and he showed a uneventful recovery with steroids and cessation of the offending drug.\n\nThe culprit drugs most commonly associated with DRESS are anticonvulsants, allopurinol, minocycline, sulfasalazine, dapsone, nevirapine, and abacavir.[3] Ceftriaxone-induced DRESS is rare . To our knowledge, there have been only two cases of ceftriaxone-induced DRESS reported in the literature.[4] Until date, ceftriaxone has not been included in the list of drugs causing DRESS. DRESS is generally treated with moderate-or high-dose corticosteroids, but response may be suboptimal and prolonged treatment with systemic glucocorticoid may be required. Other immunosuppressive agents, such as cyclosporine, have also been used.[9]\n\nSource of Support: Nil\n\nConflict of Interest: None declared.\n==== Refs\nREFERENCES\n1 Kano Y Shiohara T The variable clinical picture of drug-induced hypersensitivity syndrome/drug rash with eosinophilia and systemic symptoms in relation to the eliciting drug Immunol Allergy Clin North Am 2009 29 481 501 19563993 \n2 Chaiken BH Goldberg BI Segal JP Dilantin sensitivity; report of a case of hepatitis with jaundice, pyrexia and exfoliative dermatitis N Engl J Med 1950 242 897 8 15416921 \n3 Tetsuo Shiohara Yoko Kano Ryo Takahashi Current Concepts on the Diagnosis and pathogenesis of Drug-induced Hypersensitivity Syndrome JMAJ 2009 52 347 52 \n4 Akcam FZ Aygun FO Akkaya VB DRESS like severe drug rash with eosinophilia, atypic lymphocytosis and fever secondary to ceftriaxone J Infect 2006 53 e51 3 16352341 \n5 Kardaun SH Sidoroff A Valeyrie-Allanore L Halevy S Davidovici BB Mockenhaupt M Variability in the clinical pattern of cutaneous side-effects of drugs with systemic symptoms: Does a DRESS syndrome really exist? Br J Dermatol s2007 156 609 11 17300272 \n6 Choquet-Kastylevsky G Intrator L Chenal C Bocquet H Revuz J Roujeau JC Increased levels of interleukin 5 are associated with the generation of eosinophilia in drug-induced hypersensitivity syndrome Br J Dermatol 1998 139 1026 32 9990366 \n7 Bocquet H Bagot M Roujeau JC Drug-induced pseudolymphoma and drug hypersensitivity syndrome (Drug Rash with Eosinophilia and Systemic Symptoms: DRESS) Semin Cutan Med Surg 1996 15 250 7 9069593 \n8 Shiohara T Iijima M Ikezawa Z Hashimoto K The diagnosis of a DRESS syndrome has been sufficiently established on the basis of typical clinical features and viral reactivations Br J Dermatol 2007 156 1083 4 17381452 \n9 Zuliani E Zwahlen H Gilliet F Marone C Vancomycin-induced hypersensitivity reaction with acute renal failure: Resolution following cyclosporine treatment Clin Nephrol 2005 64 155 8 16114793\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "2279-042X",
"issue": "3(2)",
"journal": "Journal of research in pharmacy practice",
"keywords": "Ceftriaxone; Drug rash with eosinophilia and systemic symptom; Eosinophilia",
"medline_ta": "J Res Pharm Pract",
"mesh_terms": null,
"nlm_unique_id": "101614023",
"other_id": null,
"pages": "72-4",
"pmc": null,
"pmid": "25114941",
"pubdate": "2014-04",
"publication_types": "D002363:Case Reports",
"references": "9069593;17381452;15416921;17300272;16114793;16352341;19563993;9990366",
"title": "Ceftriaxone induced drug rash with eosinophilia and systemic symptoms.",
"title_normalized": "ceftriaxone induced drug rash with eosinophilia and systemic symptoms"
} | [
{
"companynumb": "IN-B. BRAUN MEDICAL INC.-2064282",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CEFTRIAXONE SODIUM"
},
"drugadditional... |
{
"abstract": "In this study we describe a patient with gross deletion containing the BTK and TIMM8A genes. Mutations in these genes are responsible for X-linked agammaglobulinemia and Mohr-Tranebjaerg syndrome, respectively. X linked agammaglobulinemia is a rare primary immunodeficiency characterized by low levels of B lymphocytes and recurrent microbial infections, whereas, Mohr-Tranebjaerg syndrome is a progressive neurodegenerative disorder with early onset of sensorineural deafness.\nFor neuroimaging, the magnetic resonance imaging and magnetic resonance spectroscopy of the brain were performed. Microarray analysis was performed to establish the extent of deletion.\nThe first clinical symptoms observed in our patient at the age of 6 months were connected with primary humoral immunodeficiency, whereas clinical signs of MTS emerged in the third year of live. Interestingly, the loss of speech ability was not accompanied by hearing failure. Neuroimaging of the brain suggested leukodystrophy. Molecular tests revealed contiguous X-chromosome deletion syndrome encompassing BTK (from exons 6 through 19) and TIMM8A genes. The loss of the patient's DNA fragment was accurately localized from 100 601 727 to 100 617 576 bp on chromosome's loci Xq22.1.\nWe diagnosed XLA-MTS in the first Polish patient on the basis of particular molecular methods. We detected neurodegenerative changes in MRI and MR spectroscopy in this patient. Our results provide further insight into this rare syndrome.",
"affiliations": "Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Medical Genetics, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Medical Genetics, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Clinical Immunology, University Children's Hospital, Cracow, Poland.;Chair and Clinic of Children's Neurology, Faculty of Medicine, Medical University of Silesia, Katowice, Poland.;Department of Paediatrics and Neurology of Development Age, John Paul II Upper Silesian Child Health Centre, Katowice, Poland.;Department of Diagnostic Imaging, Chair of Radiology and Nuclear Medicine, Faculty of Medicine, Medical University of Silesia, Katowice, Poland.;Department of Diagnostic Imaging, Chair of Radiology and Nuclear Medicine, Faculty of Medicine, Medical University of Silesia, Katowice, Poland.;Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.;Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland.",
"authors": "Szaflarska|Anna|A|;Rutkowska-Zapała|Magdalena|M|;Gruca|Anna|A|;Szewczyk|Katarzyna|K|;Bik-Multanowski|Mirosław|M|;Lenart|Marzena|M|;Surman|Marta|M|;Kopyta|Ilona|I|;Głuszkiewicz|Ewa|E|;Machnikowska-Sokołowska|Magdalena|M|;Gruszczyńska|Katarzyna|K|;Pituch-Noworolska|Anna|A|;Siedlar|Maciej|M|",
"chemical_list": null,
"country": "Poland",
"delete": false,
"doi": "10.5114/ceji.2018.77383",
"fulltext": "\n==== Front\nCent Eur J ImmunolCent Eur J ImmunolCEJICentral-European Journal of Immunology1426-39121644-4124Polish Society of Experimental and Clinical Immunology 7738310.5114/ceji.2018.77383Clinical ImmunologyNeurodegenerative changes detected by neuroimaging in a patient with contiguous X-chromosome deletion syndrome encompassing BTK and TIMM8A genes Szaflarska Anna 12Rutkowska-Zapała Magdalena 12Gruca Anna 1Szewczyk Katarzyna 34Bik-Multanowski Mirosław 34Lenart Marzena 12Surman Marta 2Kopyta Ilona 5Głuszkiewicz Ewa 6Machnikowska-Sokołowska Magdalena 78Gruszczyńska Katarzyna 78Pituch-Noworolska Anna 12Siedlar Maciej 121 Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland2 Department of Clinical Immunology, University Children’s Hospital, Cracow, Poland3 Department of Medical Genetics, Institute of Paediatrics, Jagiellonian University Medical College, Cracow, Poland4 Department of Medical Genetics, University Children’s Hospital, Cracow, Poland5 Chair and Clinic of Children’s Neurology, Faculty of Medicine, Medical University of Silesia, Katowice, Poland6 Department of Paediatrics and Neurology of Development Age, John Paul II Upper Silesian Child Health Centre, Katowice, Poland7 Department of Diagnostic Imaging, Chair of Radiology and Nuclear Medicine, Faculty of Medicine, Medical University of Silesia, Katowice, Poland8 Department of Diagnostic Imaging and Surgical Radiology, John Paul II Upper Silesian Child Health Centre, Katowice, PolandCorrespondence: Magdalena Rutkowska-Zapała, Department of Clinical Immunology, Institute of Paediatrics, Jagiellonian University Medical College, 265 Wielicka St., 30-663 Krakow, Poland. e-mail: magdalena.rutkowska@uj.edu.pl30 6 2018 2018 43 2 139 147 06 7 2017 18 1 2018 Copyright: © 2018 Polish Society of Experimental and Clinical Immunology2018This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0) License, allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material, provided the original work is properly cited and states its license.Introduction\nIn this study we describe a patient with gross deletion containing the BTK and TIMM8A genes. Mutations in these genes are responsible for X-linked agammaglobulinemia and Mohr-Tranebjaerg syndrome, respectively. X linked agammaglobulinemia is a rare primary immunodeficiency characterized by low levels of B lymphocytes and recurrent microbial infections, whereas, Mohr-Tranebjaerg syndrome is a progressive neurodegenerative disorder with early onset of sensorineural deafness.\n\nMaterial and methods\nFor neuroimaging, the magnetic resonance imaging and magnetic resonance spectroscopy of the brain were performed. Microarray analysis was performed to establish the extent of deletion.\n\nResults\nThe first clinical symptoms observed in our patient at the age of 6 months were connected with primary humoral immunodeficiency, whereas clinical signs of MTS emerged in the third year of live. Interestingly, the loss of speech ability was not accompanied by hearing failure. Neuroimaging of the brain suggested leukodystrophy. Molecular tests revealed contiguous X-chromosome deletion syndrome encompassing BTK (from exons 6 through 19) and TIMM8A genes. The loss of the patient’s DNA fragment was accurately localized from 100 601 727 to 100 617 576 bp on chromosome’s loci Xq22.1.\n\nConclusions\nWe diagnosed XLA-MTS in the first Polish patient on the basis of particular molecular methods. We detected neurodegenerative changes in MRI and MR spectroscopy in this patient. Our results provide further insight into this rare syndrome.\n\nneuroimagingX-linked agammaglobulinemiaMohr-Tranebjaerg syndromeVanishing white matter leukodystrophyBTKTIMM8A\n==== Body\nIntroduction\nX-linked agammaglobulinaemia (XLA) is a primary immunodeficiency characterised by early-onset (usually between six and 12 months of age) bacterial infections, marked reduction in all classes of serum immunoglobulins, and almost total absence (less than 1%) of circulating B cells. The prevalence of XLA is estimated to be 1 in 190,000 male births or 1 in 379,000 live births [1]; however, it may vary, depending on racial and ethnic groups, from 3:1,000,000 to 6:1,000,000 males [2]. The BTK gene, mutations of which are responsible for XLA, is located at Xq21.3–Xq22, contains 19 exons, and encodes a 659 amino acid protein, composed of five different, functional domains [3,4]. In the same chromosomal region, located at Xq22.1 and 770 bp centromerically of the BTK gene, is the TIMM8A gene consisting of two exons, formerly named DDP1. Protein encoded by these gene functions as a translocase and is involved in the import and insertion of hydrophobic membrane proteins from the cytoplasm into the mitochondrial inner membrane [5,6]. Mutations in the TIMM8A gene cause Mohr-Tranebjaerg syndrome/Deafness Dystonia Syndrome (MTS/DDS), characterised by sensorineural hearing loss in childhood, followed by adolescent onset of progressive dystonia and a variety of non-obligatory neurological features. The prevalence of this rare neurodegenerative syndrome is unknown. To date, more than 90 cases (37 families) have been described [7-9].\n\nAccording to a database of BTK mutations [http://databases.lovd.nl/shared/genes/BTK], the majority of disruptions of this gene are the missense changes (app. 45%), frameshifts (app. 32%), and stop changes (app. 17%). The gross deletion frequency is 7-8% [10]. Moreover, part of these deletions includes the closely located TIMM8A gene, and sometimes TAF7L and DRP2 genes. This type of gross deletion has been described previously only in 17 patients from 14 unrelated families [11-18].\n\nIn this study, we report the first Polish patient with contiguous X-chromosome deletion syndrome including the BTK and TIMM8A genes. We present insightful molecular analysis by multiplex ligation-dependant probe amplification (MLPA) method and comparative genomic hybridisation (CGH) array, and discuss their utility in the diagnostic process. We also present a detailed clinical picture of an MTS-XLA patient, including abnormal results of neuroimaging that has not been described so far.\n\nMaterial and methods\nCase presentation\nThe patient was the first child born to healthy unrelated parents. The family history was affected with epilepsy in a cousin and schizophrenia in the grandparents. The family history was negative for immunodeficiency and hearing loss. The child was healthy at birth and up to five months. At five months of age, he was referred to hospital for skin abscesses (one on the face and two in the perianal region). When he was six months old he developed generalised purulent skin infection with fever and neutropenia (600 cells/μl). He subsequently received two antibiotics: Amoxicillin and Amikacin. From this time neutropenia appeared only during infections. The boy suffered from chronic candidiasis of oral mucosa, presumably because of prolonged antibiotic treatment. At seven months of age, he presented with pneumonia, which was treated with three antibiotics (Cefuroxime, Clindamycin, and finally Amikacin) with a good clinical response. Immunological tests revealed extremely low concentrations of serum immunoglobulins: IgG (0,09 g/l), IgA (< 0,06 g/l), and IgM (< 0,04 g/l). Flow cytometric analysis showed normal percentage and elevated absolute number of T cells: CD3-8335 cells/μl (age-matched normal values: 2500-5000 cells/μl), CD4-4213 cells/μl (age-matched normal values: 1600-4000 cells/μl), CD8-3847 cells/μl (age-matched normal values: 560-1700 cells/μl). B lymphocytes were absent. Percentage and absolute number of NK cells were within the normal range: 733 cells/μ (age-matched normal values: 170-830 cells/μl). Chemiluminescence was used to study the respiratory burst of neutrophils, and it was normal (the chemiluminescent response of neutrophils occurred after stimulation with latex particles).\n\nThe patient was referred to the Immunology Unit at the Children’s University Hospital in Cracow, where he received regular immunoglobulin substitution (intravenous and then subcutaneous). From this time, he had no severe infections. He was doing well until he was 2.5 years old, at which time he suffered from recurrent fevers without any other clinical signs of infection. He was treated with numerous antibiotics as well as antifungal drugs. At three years of age he presented increasing developmental retardation with the loss of speech ability.\n\nAt the age of three the boy was admitted to the hospital because of progressive weakness and somnolence. About three months earlier his parents stopped immunoglobulin substitution. On admission the Division of Paediatrics and Developmental Age Neurology, Upper Silesian Child’s Health Centre, Katowice, a neurological examination revealed: anisocoria, improper positioning of the head – tilted to the left side, cerebellar ataxia, wide-based gait, and kinetic and intention tremor. The blood tests showed a lack of IgA and IgM and very low concentration of IgG. The brain MRI revealed generalised cortical and subcortical atrophy of the brain and cerebellar hemispheres, areas of abnormal signal intensity, and reduced volume of white matter; there were no contrast enhancement. The MRI picture as well as 1H MR spectroscopy suggested leukodystrophy.\n\nAfter a few months of regular intravenous immunoglobulin substitution, an improvement in neurological status was observed. The boy has remained unable to speak, but he understands simple commands. He presents behavioural abnormalities (irritability). Currently there are no symptoms in neurological examination. The patient presents normal auditory brainstem response (ABR). Auditory Evoked Potentials (AEP) are also normal. There are no abnormalities of middle and external ear with normal tympanogram and evoked otoacoustic emissions. The patient did not present any marked neurological symptoms probably because of his young age. The first symptoms of MTS syndrome may appear at different ages (from 18 months to 19 years of age; see Table 1).\n\nTable 1 Clinical features, neuroimaging, and deletion characterisation in patients with XLA-MTS syndrome. The patients are listed according to the time of publication\n\nPatient/patient’s age at the description (country)\tFirst symptomes of immunodeficiency\tAge at XLA diagnosis\tAge when IVIg were started\tFirst symptomes of MTS syndrome\tDystonia\tAdditional clinical symptoms/other comments\tSize of the deletion\tCNS imaging\tReference\t\nP1/9 years (Norway)\t12 moths reccurent infections\tNo data\tNa data\t2 years – progressive sensineuronal deafness\t5 years – rapidly progressing dystonia\tNa data\tBTK (from intron 10-11) – TIMM8A\tNo data\tJin et al., 1996\t\nP2/4.5 years (Croatia)\t10 moths (Pseudomonas aeruginosa sepsis)\t10 months\t10 months\t3-4 years – hearing loss\tNo data\tPsychomotor development and neurologic examination were normal\tBTK (from intron 5-6) – TIMM8A\tNo data\tRichter et al., 2001\t\nP3/7.5 years (Croatia)\t8 months (severe pneumococcal respiratory infection)\t2 years\t2 years\t3-4 years – spech impairment 4-7 years – central hearing failure\tNo data\tPsychomotor developoment was normal\tBTK (from intron 18-19) – TIMM8A1\tNo data\tRichter et al., 2001\t\nP4/14 years (Lebanon)\t18 months (recurrent upper and lower respiratory tract infections)\t30 months\t30 months\t30 months – delayed speech 9 years – mild hearing loss\tNo data\t11 years – episodes of anger frustration, attention deficit disorder, learning disabilities, visual processing defect\tBTK (from intron 18-19) – TIMM8A\tNo data\tRichter et al., 2001\t\nP5/24 years (Italy)\t2 years – recurrent infections\t2 years\tNot specify\t2 years – bilateral hearing loss\n15 years – progressive visual loss \n19 years – the patient began to complain of writing difficulties that progressively worsened\t19 years – dystonic posturing of the right upper limb\tPsychometric testing showed a mild deficit in intellectual functioning\tBTK (at least from exon 19) – TIMM8A\tMRI of the brain and cervical spine was normal\tPizzuti et al., 2004\t\nP6/33 years (Czech Republic)\t2 years (recurrent respiratory infections)\t9 years\t18 years\tFrom 2 to 5 years of age-gradually worsed deafness, now: progressive deafness, abnormal speech, aggressive behaviour, muscle wasting\tNo data\tNo data\tBTK (from exon 19) – TIMM8A\tNo data\tSediva et al., 2007\t\nP7, brother of patient P6/25 years (Czech Republic)\t15 months (complicated sinusitis)\t18 months\t11 years\tSimilar history as his brother (Patient 6); progressive deafness since attending preschool\tNo data\tLess pronounced psychological component and general wasting\tBTK (from exon 19) – TIMM8A\tNo data\tSediva et al., 2007\t\nP8/died at the age of 6 years (Czech Republic)\t6 months (bronchitis)\t2 years\t20 months\t4 years – delayed speech development led to the discovery of sensorineural deafness\tFirst signs appeared at the age of 5 years and progerssed rapidly to a severe form of spasticity until his death due to pneumonitis and cardiorespiratory failure\tDied at the age of 6 years from progressive dystonia, neurological impairment and general wasting\tBTK (from exon 19) – TIMM8A\tNo data\tSediva et al., 2007\t\nP9/6 years (Estonia)\t3 months (recurrent respiratory infections).\t7 months\t8 months\tSubsequently developed slowly progressing psychomotor retardation and severe speech impairment;\n4 years – sensorineural hearing loss\tNo data\tNo spasticity has been documented\tBTK (from exon 6) – TIMM8A\tNo data\tSediva et al., 2007\t\nP10, brother of Patient 9/5 years (Estonia)\tAcute bronchopneumonia at the age of 7 months and chronic bronchitis since 16 months of age\t2 months\t6 months\t2.5 years – speech development has been delayed and signs of hearing loss could be demonstrated\tNo data\tNo data\tBTK (from exon 6) – TIMM8A\tNo data\tSediva et al., 2007\t\nP11/13 years (USA)\tAt 6 months of age with respiratory distress, pneumonia, and neutropenia that had resolved by the time of discharge\t8 months\t8 months\t3 years – progressive sensorineural hearing loss, delay in language and motor development\tNo data\tNo other nuerological deficits\tBTK – TIMM8A – TAF7L – DRP2\tNo data\tSediva et al., 2007\t\nP12/8 years (USA)\tRecurrent episodes of acute otitis media beginning at 4 months of age, a cutaneous staphylococcus infection\t5 years\tNot specify\t2 years – receptive and expressive language delay;\n3.5 years – severe sensorineural hearing loss\tNo data\tNeuropsychological investigation demonstrated normal developmental milestones other than speech and language\tBTK (from exon 17) – TIMM8A (exon 1)\tCT of the head and ophthalmologic examination were normal\tBrookes et al., 2008\t\nP13/6 years (Ukraine)\t5-6 months (bacterial pneumonia)\t4 years\t4 years\t2-3 years – severe speech delay\tNo data\tNo other nuerological deficits\tBTK (from exon 3) – TIMM8A – TAF7L – DRP2\tNo data\tJyonouchi et al., 2008\t\nP14, brother of patient P13/6 years (Ukraine)\t5-6 months (bacterial pneumonia)\t4 years\t4 years\t2-3 years – severe speech delay\tNo data\tNo other nuerological deficits\tBTK (from exon 3) –TIMM8A – TAF7L – DRP2\tNo data\tJyonouchi et al., 2008\t\nP15/15 years (Japanese)\t7 years (recurrent bacterial infections)\t7 years\tNot specify\t6 years – gradually worsed deafness\tNo data\tHearing losses are severe and progressive\tBTK (from exon 16) – TIMM8A\tNo data\tArai et al., 2011\t\nP16/10 years (Japanese)\t12 months (recurrent otitis media and sinusitis)\t8 years\tNot specify\t18 months – deafness and autism\tNo data\tHearing losses are severe and progressive\tBTK (from exon 6) – TIMM8A – TAF7L – DRP2\tNo data\tArai T et al., 2011\t\nP17/27 years (French Canadian)\t11 months\t11 months\t11 months\tDecreasing visual acuity;\n2 years – severe bilateral hearing loss\tSequelae included spastic lower extremity paraplegia\t20 years – metastatic testicular seminoma presented with testicular swelling and enlarged para- aortic nodes were identified\tBTK – TIMM8A – TAF7L\tNo data\tShaker et al., 2016\t\nMolecular analysis\nInformed consent for genetic analysis was obtained from the patient’s parents.\n\nDNA isolation\nGenomic DNA was isolated using QIAmp DNA Mini Kit (Qiagen, Hilden, Germany) from peripheral blood drawn into EDTA. DNA concentrations and quality were measured using a Quawell Q5000 UV-Vis spectrophotometer.\n\nBTK and TIMM8A gene amplification\nAll exons of BTK gene (reference sequence: ENSG00000010671) and exons and intron of TIMM8A gene (reference sequences: ENSG00000126953) were amplified by PCR method. Reactions were performed using 100 ng spectrophotometrically quantified DNA, 0.3 units of AmpliTaq Gold polymerase (Thermo Fisher Scientific, Waltham, MA USA), 0.5 mM of each dNTP, 2.5 mM MgCl2, and 0.5 μM of each specific primers (Genomed, Poland). The reaction volume was 20 μl. Primer sequences are available on request.\n\nMultiplex ligation-dependant probe amplification (MLPA)\nTo detect deletions/duplications of one or more exons of the BTK gene, MLPA analysis was performed using SALSA MLPA P210 BTK probemix (MRC-Holland, Amsterdam, The Netherlands) according to the manufacturer’s instructions. Briefly, DNA was denaturated at 98°C for 5 min and hybridized for at least 12 h at 60°C with a probe containing oligonucleotides to analyse all 19 exons of BTK gene. Next, 32 ml Ligase-65 master mix was added to each reaction and then incubated at 54°C followed by 5 min at 98°C to deactivate the enzyme. Finally, PCR was performed on 10 ml of the ligation product with FAM-labelled primers. For fragment analysis, 0.7 μl PCR products, 0.3 μl GeneScan –500 ROX internal size standard, and 9 μl formamide (Thermo Fisher Scientific, Waltham, MA USA) were run on an ABI Prism 3500 Genetic analyser (Applied Biosystems, Foster city, CA, USA). The obtained data were interpreted on the base of the copy number ratios, which were calculated by dividing the normalised mean peak areas of each exon in a sample from the patient with the normalised mean peak areas of the same exons in a sample from healthy control subjects. The data were analysed using Coffalyser software (MRC-Holland).\n\nMicroarray analysis\nThe Agilent SurePrint G3 CGH ISCA v2 Microarray Kit 8x60K array platform was used for a comprehensive exploration of the patient’s genomic profile and careful evaluation of genome abnormalities (Agilent Technologies, Santa Clara, CA). The study was performed according to the manufacturer’s instruction with additional enzymatic digestion. 350 ng of previously isolated patient’s genome DNA was used. The first step was digestion of the patient’s and reference DNA (Agilent Technologies, Santa Clara, CA) simultaneously with RsaI and AluI enzymes for 2 h at 37ºC. Next, digested samples were attached with random primers and were labelled for 2 h by using appropriately cyanine 5 (Cy5) for patient’s DNA and cyanine 3 (Cy3) for control DNA. An excess amount of fluorescence dyes was removed with purification columns (Agilent Technologies, Santa Clara, CA). The last step was 24 h hybridisation performed at 67°C with a rotation speed of 20 rpm. The microarray results and a graphical overview were obtained using the CytoGenomics software, edition v2.9.2.4; (Agilent Technologies, Santa Clara, CA).\n\nResults\nMolecular analysis\nInitial diagnosis of XLA in our patient was suggested by the very low level of serum immunoglobulins and absence of B cells, while the definitive diagnosis was established by detecting large deletions involving the BTK gene. Initial attempts of sequencing BTK gene revealed normal sequences of exons 2 to 5, but PCR reaction failed to amplify exons 6 through 19. To verify this observation, MLPA analysis was performed. As a result, an almost total reduction of the area of the peaks corresponding to exons 6-19 was observed (Fig. 1A.ii). MLPA analysis of BTK gene in the patient’s mother was also performed in order to determine the inheritance of the detected variant; however, no deletions were found (Fig. 1A.i). After the onset of neurological symptoms, further molecular tests were performed. Molecular diagnosis of MTS was based on microarray analysis. The aCGH analysis established 16 kb deletion including BTK and TIMM8A gene (Fig. 1B). The loss of the patient’s DNA fragment was accurately localised from 100 601 727 to 100 617 576 bp. Complete deletion of both exons of TIMM8A but no intron situated proximately was confirmed using PCR reaction (Fig. 1C). The scheme of detected BTK and TIMM8A genes deletion was presented on Figure 1D.\n\nFig. 1 A) Multiplex ligation-dependant probe amplification analysis of BTK gene in patient (ii) and patient’s mother (i). B) Array comparative genomic hybridisation analysis of the X-chromosome of our patient (gene view – TIMM8A and BTK genes deletions; cytoband – affected chromosome’s loci Xq22.1; chromosome view – affected chromosome X). C) Complete deletion of both exons of TIMM8A confirmed with PCR reaction and electrophoresis. D) Scheme of detected TIMM8A and BTK gene deletions\n\nNeuroimaging\nMRI images showed dilated lateral ventricle and, to a lesser extent, subarachnoid spaces, which means severe atrophy. Apart from that, there were extensive, multifocal, but not diffuse white matter abnormalities. The FLAIR images showed no tissue rarefaction or cystic abnormality. There was cerebellar atrophy. No enhancement after contrast was seen (Fig. 2). MR spectroscopy revealed neurons as well as myelin damage, suggesting degenerative process and an early stage of vanishing white matter leukodystrophy (VHM). However, the MRI images were not compatible with diagnosis of VHM because severe atrophy is not typical for primary white matter diseases. Such a picture suggested instead a primary neuronal disease. The partial regression of disseminated changes in the supratentorial white matter after four months also denies VHM. MRI changes have not been observed so far in MTS-XLA patients.\n\nFig. 2 Magnetic resonance imaging pictures of our patient with XLA-MTS. The images show that the lateral ventricles, and to a lesser degree the subarachnoid spaces, are dilated. The third ventricle, aqueduct, and fourth ventricle are enlarged. Extensive but not diffused signal abnormalities are seen in the cerebral white matter. The corpus callosum is involved in the white matter abnormality. There is cerebellar atrophy. No enhancement after contrast is observed\n\nDiscussion\nTo date, the simultaneous deletion of at least BTK and TIMM8A genes was previously described in 17 patients, but none from Poland. Detailed characterisation of all reported cases are shown in Table 1. According to these data, all the patients with XLA-MTS presented sensorineural deafness. Additionally, patients developed dystonia, visual processing defects, mental retardation, attention deficit disorder, learning disabilities, behaviour abnormalities, and general wasting. However, these symptoms were observed in different combinations and they are not related to the extent of deletion. On the contrary, our patient presents normal hearing ability, mild mental retardation, behavioural abnormalities (irritability), and no dystonia signs. He has no speech ability, but in the past he had been able to speak some single words. He had ataxia but only for a short period of time, after the long break in immunoglobulin substitution.\n\nThe data from neuroimaging in pure MTS patients published so far revealed unspecific alterations in computerised tomography (CT) scans, such as diffuse, generalised cerebral or cortical atrophy [7, 19]. In two patients with this syndrome magnetic resonance imaging (MRI) revealed atrophy of the occipital cortex. The results of the first PET study performed in a pure MTS patient exhibited hypometabolic areas over parietal, medial temporal, and frontal brain areas [20]. Next PET examination was described by Binder et al. in 2003 [8]. It revealed a pronounced reduction of metabolism in both occipital lobes, including the visual cortex, but also in the basal ganglia and both rostral parietal lobes. However, there are very few data on neuroimaging in MTS-XLA patients. In one patient, CT of the head was normal [15], and in the other, MRI of the brain and cervical spine was also normal [13]. There are no data of PET examinations in MTS-XLA patients.\n\nIn our study, a genetic basis of the disease was established by an array CGH analysis because the MLPA method was insufficient. The high resolution of aCGH allows an indication of changes in copy number variation even of a single gene. Therefore, the application of such analysis has increased in genetic abnormality diagnostics and was used to establish a diagnosis for patients 13 to 17 with XLA-MTS (Table 1). That is why we recommend array CGH analysis for more accurate diagnosis of gross deletions that comprise more than one gene.\n\nConclusions\nIn conclusion, on the basis of previously described cases (Table 1), we suggest that complete deletion of TIMM8A and BTK genes is associated with milder clinical picture in comparison to classical MTS syndrome. However, the observation period of these patients was very short (Table 1). Here, for the first time, we have detected neurodegenerative changes in MRI and MR spectroscopy in an XLA-MTS patient. We do not know if these findings are typical for this disease due to the very small amount of data about neuroimaging in XLA-MTS patients. That is why a description of each new case would be valuable to extend our knowledge about this rare syndrome.\n\nAcknowledgements\nThe authors would like to thank Professor of Child Neurology Marjo S. van der Knapp from VU University Medical Centre, The Netherlands for providing a professional description of e thMRI pictures of our Patient.\n\nThis work was supported by the “O zdrowie dziecka” Foundation of the University Children’s Hospital in Cracow.\n\nThe authors declare no conflict of interest.\n==== Refs\nReferences\n1 Winkelstein JA Marino MC Lederman HM X-linked agammaglobulinemia: report on a United States registry of 201 patients Medicine (Baltimore) 2006 85 193 202 16862044 \n2 Smith CIE Berglöf A Pagon RA Adam MP Ardinger HH X-Linked Agammaglobulinemia GeneReviews® [Internet] 1998 Seattle University of Washington 1993 2017 \n3 Tsukada S Saffran DC Rawlings DJ Deficient expression of a B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia Cell 1993 72 279 290 8425221 \n4 Vetrie D Vořechovský I Sideras P The gene involved in X-linked agammaglobulinaemia is a member of the Src family of protein-tyrosine kinases J Immunol 2012 188 2948 2955 22442492 \n5 Koehler CM Leuenberger D Merchant S Human deafness–dystonia syndrome is a mitochondrial disease Proc Natl Acad Sci USA 1999 96 2141 2146 10051608 \n6 Jin H Kendall E Freeman TC The human family of deafness/dystonia peptide (DDP) related mitochondrial import proteins Genomics 1999 61 259 267 10552927 \n7 Tranebjaerg L Schwartz C Eriksen H A new X linked recessive deafness syndrome with blindness, dystonia, fractures, and mental deficiency is linked to Xq22 J Med Genet 1995 32 257 263 7643352 \n8 Binder J Hofmann S Kreisel S Clinical and molecular findings in a patient with a novel mutation in the deafness-dystonia peptide (DDP1) gene Brain 2003 126 1814 1820 12805099 \n9 Ha AD Parratt KL Rendtorff ND The phenotypic spectrum of dystonia in Mohr-Tranebjaerg syndrome Mov Disord 2012 27 1034 1040 22736418 \n10 Stenson PD Ball EV Mort M Human Gene Mutation Database (HGMD), 2003 update Hum Mutat 2003 21 577 581 12754702 \n11 Jin H May M Tranebjaerg L A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-1), dystonia, mental deficiency and blindness Nat Genet 1996 14 177 180 8841189 \n12 Richter D Conley ME Rohrer J A contiguous deletion syndrome of X-linked agammaglobulinemia and sensorineural deafness Pediatr Allergy Immunol 2001 12 107 111 11338284 \n13 Pizzuti A Fabbrini G Salehi L Focal dystonia caused by Mohr-Tranebjaerg syndrome with complete deletion of the DDP1 gene Neurology 2004 62 1021 1022 15037720 \n14 Sedivá A Smith CI Asplund AC Contiguous X-chromosome deletion syndrome encompassing the BTK, TIMM8A, TAF7L, and DRP2 genes J Clin Immunol 2007 27 640 646 17851739 \n15 Brookes JT Kanis AB Tan LY Cochlear implantation in deafness-dystonia-optic neuronopathy (DDON) syndrome Int J Pediatr Otorhinolaryngol 2008 72 121 126 17936919 \n16 Jyonouchi H Geng L Törüner GA Monozygous twins with a microdeletion syndrome involving BTK, DDP1, and two other genes; evidence of intact dendritic cell development and TLR responses Eur J Pediatr 2008 167 317 321 17520285 \n17 Arai T Zhao M Kanegane H Genetic analysis of contiguous X-chromosome deletion syndrome encompassing the BTK and TIMM8A genes J Hum Genet 2011 56 577 582 21753765 \n18 Shaker M Lorigiano TH Vadlamudi A Xq22.1 contiguous gene deletion syndrome of X-linked agammaglobulinemia and Mohr-Tranebjćrg syndrome Ann Allergy Asthma Immunol 2016 116 578 579 27048950 \n19 Jensen PK Reske-Nielsen E Hein-Sørensen O Warburg M The syndrome of opticoacoustic nerve atrophy with dementia Am J Med Genet 1987 28 517 518 3425626 \n20 Tranebjaerg L Jensen PK Van Ghelue M Neuronal cell death in the visual cortex is a prominent feature of the X-linked recessive mitochondrial deafness-dystonia syndrome caused by mutations in the TIMM8a gene Ophthalmic Genet 2001 22 207 223 11803487\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "1426-3912",
"issue": "43(2)",
"journal": "Central-European journal of immunology",
"keywords": "BTK; Mohr-Tranebjaerg syndrome; TIMM8A; Vanishing white matter leukodystrophy; X-linked agammaglobulinemia; neuroimaging",
"medline_ta": "Cent Eur J Immunol",
"mesh_terms": null,
"nlm_unique_id": "9702239",
"other_id": null,
"pages": "139-147",
"pmc": null,
"pmid": "30135625",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "10552927;15037720;7643352;22736418;10051608;8425221;17851739;11803487;21753765;12805099;8841189;17520285;22442492;11338284;16862044;27048950;17936919;3425626;12754702",
"title": "Neurodegenerative changes detected by neuroimaging in a patient with contiguous X-chromosome deletion syndrome encompassing BTK and TIMM8A genes.",
"title_normalized": "neurodegenerative changes detected by neuroimaging in a patient with contiguous x chromosome deletion syndrome encompassing btk and timm8a genes"
} | [
{
"companynumb": "PHHY2018PL119152",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMOXICILLIN"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Mycobacterium avium complex (MAC) is a rare cause of meningoencephalitis. Non-tuberculous mycobacterium meningoencephalitis including MAC meningoencephalitis is an important cause of rapidly progressive dementia. We present a case of MAC meningoencephalitis in an immunosuppressed woman who had progressively impaired cognitive function. An 83-year-old woman who had been taking glucocorticoid for myasthenia gravis developed cognitive dysfunction and visual hallucinations over a period of 2 weeks. Cerebrospinal fluid (CSF) findings were normal, but MAC was positive in CSF culture and M. avium and M. intracellulare were identified by PCR. She was treated with multiple antimycobacterial agents and her symptoms fully recovered. MAC meningoencephalitis is an unusual cause of progressively impaired cognitive function. The possibility of mycobacterial central nervous system infection cannot be excluded by normal CSF findings.",
"affiliations": "Department of Internal Medicine, Akiota Hospital, Yamagata-gun, Hiroshima, Japan.;Department of Internal Medicine, Akiota Hospital, Yamagata-gun, Hiroshima, Japan.",
"authors": "Okazaki|Yuji|Y|;Higashi|Yusuke|Y|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-229022",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "12(4)",
"journal": "BMJ case reports",
"keywords": "infection (neurology); memory disorders; meningitis",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000369:Aged, 80 and over; D060825:Cognitive Dysfunction; D005260:Female; D006801:Humans; D008590:Meningoencephalitis; D015269:Mycobacterium avium Complex; D015270:Mycobacterium avium-intracellulare Infection",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30948407",
"pubdate": "2019-04-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "29391245;19146759;1265506;20937194;8953070;29081366;21980068;15200833;9153472;7622897;18668637;5422557",
"title": "Unusual cause of progressively impaired cognitive function: Mycobacterium avium complex meningoencephalitis.",
"title_normalized": "unusual cause of progressively impaired cognitive function mycobacterium avium complex meningoencephalitis"
} | [
{
"companynumb": "JP-BAUSCH-BL-2019-013035",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "Obinutuzumab is used for the treatment of chronic lymphocytic leukemia. So far there are no data of using this for retreatment in patients who have received it previously. We introduced obinutuzumab for the retreatment in a chronic lymphocytic leukemia patient, who had first achieved partial remission with it and eventually relapsed over a course of 2.5 years. After retreatment with single-agent obinutuzumab, the patient achieved a partial remission again within one cycle and continues to maintain the response status. This case is a platform for considering obinutuzumab as a viable option for retreatment of chronic lymphocytic leukemia patients who have received it before, similar to the pattern of use for other anti-CD20 monoclonal antibodies in this disease, including rituximab.",
"affiliations": "Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.;Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USA.",
"authors": "Khurana|Sharad|S|;Ahmed|Salman|S|;Alegria|Victoria R|VR|;Aulakh|Sonikpreet|S|;Ailawadhi|Meghna|M|;Singh|Anshika|A|;Chanan-Khan|Asher|A|;Ailawadhi|Sikander|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1177/2050313X18823917",
"fulltext": "\n==== Front\nSAGE Open Med Case RepSAGE Open Med Case RepSCOspscoSAGE Open Medical Case Reports2050-313XSAGE Publications Sage UK: London, England 10.1177/2050313X1882391710.1177_2050313X18823917Case ReportRetreatment with obinutuzumab: An addition to the therapeutic landscape of chronic lymphocytic leukemia Khurana Sharad Ahmed Salman Alegria Victoria R Aulakh Sonikpreet Ailawadhi Meghna Singh Anshika Chanan-Khan Asher Ailawadhi Sikander Division of Hematology-Oncology, Mayo Clinic, Jacksonville, FL, USASikander Ailawadhi, Division of Hematology-Oncology, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA. Email: ailawadhi.sikander@mayo.edu16 1 2019 2019 7 2050313X188239179 2 2018 13 12 2018 © The Author(s) 20192019SAGE PublicationsThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Obinutuzumab is used for the treatment of chronic lymphocytic leukemia. So far there are no data of using this for retreatment in patients who have received it previously. We introduced obinutuzumab for the retreatment in a chronic lymphocytic leukemia patient, who had first achieved partial remission with it and eventually relapsed over a course of 2.5 years. After retreatment with single-agent obinutuzumab, the patient achieved a partial remission again within one cycle and continues to maintain the response status. This case is a platform for considering obinutuzumab as a viable option for retreatment of chronic lymphocytic leukemia patients who have received it before, similar to the pattern of use for other anti-CD20 monoclonal antibodies in this disease, including rituximab.\n\nHematologyobinutuzumabretreatmentchronic lymphocytic leukemiacover-dateJanuary-December 2019\n==== Body\nIntroduction\nChronic lymphocytic leukemia (CLL) is a treatable but incurable hematologic malignancy, with recent introduction of several new therapeutic agents.1,2 Fixed-duration therapy utilizing anti-CD20 monoclonal antibodies (MoAbs) with or without cytotoxic chemotherapy remains a mainstay for CLL treatment, compared with newer targeted agents that usually require indefinite treatment to progression or intolerability. While retreatment with rituximab, a first-generation anti-CD20 MoAb has been reported in relapsed non-Hodgkin lymphomas (NHL),3 retreatment data with obinutuzumab, the most novel agent in this class is not reported yet, especially in CLL. Overall, obinutuzumab has an acceptable safety profile with mainly grades 1 and 2 adverse events (AEs) and more severe AEs (grades 3–5) being reported relatively infrequently within clinical trials.4 The three major safety events were infusion-related reactions (IRRs), hematologic AEs, primarily neutropenia and infections.4 We report clinical experience with retreatment using obinutuzumab after the patient had received it previously, achieved a partial response and subsequently relapsed.\n\nCase\nA 65-year-old male, with a past medical history of glaucoma, cataract, squamous cell carcinoma of the right eyelid, hyperplastic polyp and hyperlipidemia, was diagnosed with Rai stage 0 CLL by absolute monotypic B-cell lymphocytosis >5 × 109/L on normal peripheral flow cytometry, in the year 2000. He did not have any high-risk markers, with CD38 negative disease that showed del 13q on fluorescent in situ hybridization (FISH) and normal beta-2-microglobulin (B2M) as well as lactate dehydrogenase (LDH). He remained asymptomatic and under observation for several years but was noted to have rapidly increasing lymphocytosis, progressive lymphadenopathy, symptomatic splenomegaly and thrombocytopenia in 2015 (Table 1 and Figure 1). Bone marrow biopsy revealed hypercellular marrow with diffuse involvement by lambda light chain-restricted small lymphocytes occupying 95% of the marrow space. First-line treatment was planned with obinutuzumab (1000 mg) and chlorambucil as per standard guidelines5 but the patient never started chlorambucil due initially to a concern of tumor lysis syndrome from significant disease burden, and later due to development of prolonged neutropenia and thrombocytopenia on obinutuzumab alone. The dose of obinutuzumab was reduced by 20% for cycle 4 and he was given daily G-CSF for three days after the obinutuzumab dose for that cycle only. After completion of six planned cycles of single-agent obinutuzumab, the patient achieved partial response (PR) to therapy as measured by greater than 50% reduction in absolute lymphocyte count (ALC) and splenomegaly as well as a platelet level greater than 100 × 109/L, as per iwCLL guidelines.6 Disease was detectable as minimal residual disease (MRD) only, by CLL specific MRD peripheral flow cytometry 0.37%, 2 months after completion of treatment, without residual blood, spleen or lymphadenopathy detected. His CLL remained stable over the next 2 years with only slight increase in lymphocytosis. Approximately two-and-a-half years after initial treatment, thrombocytopenia and rapid increase in lymphocytosis were noted (Table 1 and Figure 1).\n\nTable 1. Laboratory findings at various time points during clinical course of the index case.\n\nLaboratory parameter\tNormal range\tAt initial diagnosis (June 2000)\tPrior to first obinutuzumab treatment (January 2015)\tAt end of first obinutuzumab treatment (July 2015)\tPrior to obinutuzumab retreatment (September 2017)\tAfter retreatment (January 2018)\t\nWBC (×109/L)\t3.5–10.5\t13.2\t190\t7.3\t48.1\t2.9\t\nALC (×109/L)\t0.9–2.9\t9.3\t184.3\t1.11\t42.38\t0.83\t\nANC (×109/L)\t1.7–7.0\tNA\t1.9\t5.63\t1.41\t\t\nHgb (g/dL)\t12–15.5\t15.6\t13.1\t14.2\t12.8\t14.3\t\nPlatelets (×109/L)\t150–450\t159\t86\t113\t76\t89\t\nLDH (U/L)\t122–222\t152\t223\t169\t183\t146\t\nPeripheral flow cytometry\t–\tMonotypic B-cells\tMonotypic B-cells\tToo few to be calculated\tMonotypic B-cells\tToo few to be calculated\t\nMRD\t–\tNA\tNA\t0.37%\tNA\t0.05%\t\nFISH\t<7%\t\t\t13q del\t13q del\t–\t\nLymphadenopathy\t\t\t\tYes\tN/A\tN/A\t\nSplenomegaly\t\t\t\tYes\tN/A\tN/a\t\nWBC: white blood cell count; ALC: absolute lymphocyte count; ANC: absolute neutrophil count; Hgb: hemoglobin; LDH: lactate dehydrogenase; FISH: fluorescent in situ hybridization; MRD: minimal residual disease; NA: not available.\n\nFigure 1. Absolute lymphocyte count at various time points during clinical course of the index case.\n\nA repeat flow cytometry confirmed monoclonal B-cell population along with an upward trending ALC, confirming disease relapse. A repeat FISH once again showed a 13q deletion. Retreatment was initiated due to worsening fatigue and concern for infections as Absolute neutrophil count (ANC) was trending downward. After discussing several treatment options, a shared decision of reintroducing obinutuzumab was taken based on the prolonged initial response of over 2 years with this as a single agent. Lymphocyte count normalized after only one cycle of retreatment and the patient eventually achieved partial response again per the same iwCLL guidelines.6 Grade 2 IRR was noted at initial treatment but not at retreatment while grade 2 neutropenia and thrombocytopenia were noted at initial as well as retreatment with obinutuzumab. The patient continues to follow up 1 year after the relapse for surveillance and provided informed consent for reporting.\n\nDiscussion\nObinutuzumab is a gylocengineered, humanized type II anti-CD20 MoAb and its combination with chlorambucil is one of the frontline treatment options for CLL patients.5,7 Obinutuzumab plus chlorambucil had a favorable safety profile (up to 35% of patients with severe neutropenia and up to 12% with severe infections).5 The Phase1/2 GAUGUIN study showed that monotherapy with obinutuzumab was active in heavily pre-treated relapsed/refractory CLL.8 The CLL11 trial (NCT01010061) of the German CLL Study Group demonstrated that the anti-CD20 monoclonal antibody obinutuzumab was superior to rituximab. At the same time, a recent study has pointed out potential use of Obinutuzumab as monotherapy in treatment-naïve patients.4 While retreatment with earlier generation anti-CD20 MoAb, rituximab, is a widespread practice in management of B-cell malignancies, ours is the first report of retreating CLL in the same patient using obinutuzumab and achieving partial response for a second time. The grade 2 IRR which was noted at initial treatment could be attributed to higher ALC as has been suggested by another previous report.9 Furthermore, obinutuzumab monotherapy induces natural killer cell depletion in the peripheral blood of patients with chronic lymphocytic leukemia and this may be linked to its mechanism of action as well as its pharmacodynamics, but has not yet been fully elucidated.10 With a longer follow-up, the higher rate of eradication of MRD that has been observed with obinutuzumab as compared with rituximab may have lead to an overall survival benefit and an improvement in progression-free survival.5 As obinutuzumab is used more frequently in CLL, retreatment may be studied systematically in planned, prospective clinical trials.\n\nDeclaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship and/or publication of this article.\n\nFunding: The author(s) received no financial support for the research, authorship and/or publication of this article.\n\nEthical approval: Our institution does not require ethical approval for reporting individual cases or case series.\n\nInformed consent: Written informed consent was obtained from the patient(s) for their anonymized information to be published in this article.\n==== Refs\nReferences\n1 \nHallek M. \nChronic lymphocytic leukemia: 2017 update on diagnosis, risk stratification, and treatment . Am J Hematol \n2017 ; 92 (9 ): 946 –965 .28782884 \n2 \nShustik C Bence-Bruckler I Delage R et al \nAdvances in the treatment of relapsed/refractory chronic lymphocytic leukemia . Ann Hematol \n2017 ; 96 (7 ): 1185 –1196 .28389687 \n3 \nJohnston A Bouafia-Sauvy F Broussais-Guillaumot F et al \nRetreatment with rituximab in 178 patients with relapsed and refractory B-cell lymphomas: a single institution case control study . Leuk Lymphoma \n2010 ; 51 (3 ): 399 –405 .20038227 \n4 \nGay ND Kozin E Okada C et al \nObinutuzumab monotherapy in previously untreated chronic lymphocytic leukemia . Leuk Lymphoma \n2017 : 59 (9 ): 2258 –2260 .29249186 \n5 \nGoede V Fischer K Busch R et al \nObinutuzumab plus chlorambucil in patients with CLL and coexisting conditions . N Engl J Med \n2014 ; 370 (12 ): 1101 –1110 .24401022 \n6 \nHallek M Cheson BD Catovsky D et al \niwCLL guidelines for diagnosis, indications for treatment, response assessment, and supportive management of CLL . Blood \n2018 ; 131 (25 ): 2745 –2760 .29540348 \n7 \nIllidge TM. \nObinutuzumab (GA101)—a different anti-CD20 antibody with great expectations . Expert Opin Biol Ther \n2012 ; 12 (5 ): 543 –545 .22428785 \n8 \nCartron G de Guibert S Dilhuydy MS et al \nObinutuzumab (GA101) in relapsed/refractory chronic lymphocytic leukemia: final data from the phase 1/2 GAUGUIN study . Blood \n2014 ; 124 (14 ): 2196 –2202 .25143487 \n9 \nFreeman CL Morschhauser F Sehn L et al \nCytokine release in patients with CLL treated with obinutuzumab and possible relationship with infusion-related reactions . Blood \n2015 ; 126 (24 ): 2646 –2649 .26447188 \n10 \nGarcia-Munoz R Aguinaga L Feliu J et al \nObinutuzumab induces depletion of NK cells in patients with chronic lymphocytic leukemia . Immunotherapy \n2018 ; 10 (6 ): 491 –499 .29562857\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2050-313X",
"issue": "7()",
"journal": "SAGE open medical case reports",
"keywords": "Hematology; chronic lymphocytic leukemia; obinutuzumab; retreatment",
"medline_ta": "SAGE Open Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101638686",
"other_id": null,
"pages": "2050313X18823917",
"pmc": null,
"pmid": "30728976",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "20038227;22428785;24401022;25143487;26447188;28389687;28782884;29249186;29540348;29562857",
"title": "Retreatment with obinutuzumab: An addition to the therapeutic landscape of chronic lymphocytic leukemia.",
"title_normalized": "retreatment with obinutuzumab an addition to the therapeutic landscape of chronic lymphocytic leukemia"
} | [
{
"companynumb": "US-ROCHE-2259513",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "OBINUTUZUMAB"
},
"drugadditional": null,
"dr... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.