article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "We present a case of a 17-year-old man with first-episode schizophrenia who developed olanzapine-induced hepatitis, cholestasis, and splenomegaly, all of which were reversed after ceasing olanzapine. Clinicians prescribing olanzapine should be aware of this possible hepatotoxicity. Patient education, vigilance from clinicians, and careful clinical examination can help detect this complication early.",
"affiliations": "Castle Peak Hospital, Tuen Mun, Hong Kong. simonsylui@yahoo.com.hk",
"authors": "Lui|S Y|SY|;Tso|Steve|S|;Lam|M|M|;Cheung|Eric F C|EF|",
"chemical_list": "D014150:Antipsychotic Agents; D001569:Benzodiazepines; D000077152:Olanzapine",
"country": "China",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1024-2708",
"issue": "15(5)",
"journal": "Hong Kong medical journal = Xianggang yi xue za zhi",
"keywords": null,
"medline_ta": "Hong Kong Med J",
"mesh_terms": "D000293:Adolescent; D014150:Antipsychotic Agents; D001569:Benzodiazepines; D056486:Chemical and Drug Induced Liver Injury; D002681:China; D002779:Cholestasis; D006801:Humans; D008297:Male; D000077152:Olanzapine; D012559:Schizophrenia; D013163:Splenomegaly",
"nlm_unique_id": "9512509",
"other_id": null,
"pages": "394-6",
"pmc": null,
"pmid": "19801701",
"pubdate": "2009-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Possible olanzapine-induced hepatotoxicity in a young Chinese patient.",
"title_normalized": "possible olanzapine induced hepatotoxicity in a young chinese patient"
} | [
{
"companynumb": "HK-MACLEODS PHARMACEUTICALS US LTD-MAC2022035254",
"fulfillexpeditecriteria": "1",
"occurcountry": "HK",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OLANZAPINE"
},
"drugad... |
{
"abstract": "Cirrhosis resulting from autoimmune hepatitis is associated with an increased risk of hepatocellular carcinoma. A common treatment for autoimmune hepatitis, azathioprine, is also associated with the development of many other cancers, predominantly lymphomas. The strongest association is seen for post-transplant lymphoma and hepatosplenic T-cell lymphoma in Crohn's disease and ulcerative colitis patients; there is also an association with a variety of cutaneous malignancies. A relationship between azathioprine and sarcoma has not been demonstrated, though there have been sporadic case reports. We report here the development of leiomyosarcoma in a patient who was treated with azathioprine for autoimmune hepatitis without cirrhosis.",
"affiliations": "Department of Internal Medicine, University of South Dakota Sanford School of Medicine, Sioux Falls, South Dakota.;Department of Internal Medicine, Wake Forest School of Medicine; BronxCare Health System, Bronx, New York.;Department of Internal Medicine, Division of Hepatology and Gastroenterology, University of South Dakota Sanford School of Medicine, Sioux Falls, South Dakota.;Department of Family Medicine, University of South Dakota Sanford School of Medicine, Sioux Falls, South Dakota.",
"authors": "Abdallah|Mohamed|M|;Saleh|Mohamed|M|;Elgouhari|Hesham|H|;Huntington|Mark K|MK|",
"chemical_list": "D007166:Immunosuppressive Agents; D001379:Azathioprine",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0038-3317",
"issue": "72(5)",
"journal": "South Dakota medicine : the journal of the South Dakota State Medical Association",
"keywords": null,
"medline_ta": "S D Med",
"mesh_terms": "D001379:Azathioprine; D003093:Colitis, Ulcerative; D003424:Crohn Disease; D006801:Humans; D007166:Immunosuppressive Agents; D007890:Leiomyosarcoma",
"nlm_unique_id": "101265265",
"other_id": null,
"pages": "214-216",
"pmc": null,
"pmid": "31454474",
"pubdate": "2019-05",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Development of Leiomyosarcoma in a Patient Treated with Azathioprine.",
"title_normalized": "development of leiomyosarcoma in a patient treated with azathioprine"
} | [
{
"companynumb": "US-MYLANLABS-2019M1091526",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": "2",
... |
{
"abstract": "Although this effect is not widely recognized, testosterone therapy can interact with thrombophilia, causing osteonecrosis. In 12 men and 4 women who had idiopathic osteonecrosis a median of 6 months after the onset of testosterone therapy, the authors examined the interaction between testosterone therapy and previously undiagnosed thrombophilia. The authors hypothesized that patients who had osteonecrosis after starting testosterone therapy were more likely than 110 normal control subjects or 48 patients who had osteonecrosis and were not receiving testosterone therapy to have thrombophilia. Measures of thrombophilia included Factor V Leiden, prothrombin, PAI-1 gene mutations, Factor VIII, Factor XI, anticardiolipin antibody immunoglobulin G or immunoglobulin M, and homocysteine values. In 10 cases, osteonecrosis occurred 6 months or less after the onset of testosterone therapy, and in all 16 cases, it occurred after a median of 6 months of testosterone therapy. Of the 16 cases, 5 (31%) were Factor V Leiden heterozygotes vs 2 of 109 (2%) healthy control subjects (P=.0003) and 4 of 48 patients who had osteonecrosis and were not receiving testosterone therapy (P=.04). Of the 16 cases, 4 (25%) had high (>150%) Factor VIII levels vs 7 of 103 (7%) healthy control subjects (P=.04), and 3 (19%) had high (>150%) Factor XI levels vs 3 of 101 (3%) healthy control subjects (P=.03). Of the 16 patients with osteonecrosis, 14 (88%) had at least 1 abnormal procoagulant value (of the 8 measured) vs 47 of 110 (43%) healthy control subjects (P=.0009). Of the 5 men whose serum estradiol level was measured while they were receiving testosterone therapy, this level was high (≥42.6 pg/mL) in 4. When testosterone therapy is given to patients with thrombophilia, they are at increased risk for osteonecrosis.",
"affiliations": null,
"authors": "Glueck|Charles J|CJ|;Riaz|Rashid|R|;Prince|Marloe|M|;Freiberg|Richard A|RA|;Wang|Ping|P|",
"chemical_list": "D000728:Androgens; D017395:Plasminogen Activator Inhibitor 1; C051321:SERPINE1 protein, human; C095381:factor V Leiden; C427184:recombinant factor VIII SQ; D013739:Testosterone; D005165:Factor V; D011516:Prothrombin; D005169:Factor VIII",
"country": "United States",
"delete": false,
"doi": "10.3928/01477447-20151120-03",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0147-7447",
"issue": "38(12)",
"journal": "Orthopedics",
"keywords": null,
"medline_ta": "Orthopedics",
"mesh_terms": "D000328:Adult; D000368:Aged; D000728:Androgens; D016022:Case-Control Studies; D005165:Factor V; D005169:Factor VIII; D005260:Female; D006801:Humans; D007006:Hypogonadism; D007989:Libido; D008297:Male; D008875:Middle Aged; D009154:Mutation; D010020:Osteonecrosis; D017395:Plasminogen Activator Inhibitor 1; D011516:Prothrombin; D013739:Testosterone; D019851:Thrombophilia",
"nlm_unique_id": "7806107",
"other_id": null,
"pages": "e1073-8",
"pmc": null,
"pmid": "26652327",
"pubdate": "2015-12",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Testosterone Therapy Can Interact With Thrombophilia, Leading to Osteonecrosis.",
"title_normalized": "testosterone therapy can interact with thrombophilia leading to osteonecrosis"
} | [
{
"companynumb": "US-MYLANLABS-2016M1005847",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TESTOSTERONE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nPoisoning is an infrequent cause of consultation in a pediatric emergency department (PED), but it can be potentially serious. Pediatricians should know how to use the available antidotes properly.\n\n\nOBJECTIVE\nTo analyze the use of antidotes in a PED and to assess the suitability of their indications.\n\n\nMETHODS\nA retrospective review of antidote use in a PED between January 2008 and June 2012. Inclusion criteria were age younger than 18 years and consultation for suspicious poisoning by a substance that could be treated with an antidote. The adequacy of antidote indication was based on the recommendations of the Spanish Society of Pediatric Emergencies (SSPE).\n\n\nRESULTS\nA total of 1728 consultations for suspicious poisoning (0.4% of the total visits in the PED) were recorded. In 353 cases (20.4%) the involved poison could be treated with an antidote. Sixty-seven patients received an antidote (3.9% of consultations for suspicious poisoning), and a total of 69 administrations of an antidote were made: 100% oxygen (46), N-acetylcysteine (10), flumazenil (4), naloxone (3), deferoxamine (2), vitamin K (2), bicarbonate (1), and carnitine (1). In 3 cases there was no indication for administration: flumazenil without respiratory depression, and vitamin K following coumarin exposure. As side effects, agitation was noted after the use of flumazenil, and a decrease in the prothrombin time during infusion of N-acetylcysteine.\n\n\nCONCLUSIONS\nThe administration of antidotes in this PED is uncommon and, mainly, in accordance with the SSPE recommendations, and without serious side effects. The use of flumazenil needs to be limited to the cases with a clear indication and without any contraindication.",
"affiliations": "Servicio de Urgencias de Pediatría, Hospital Sant Joan de Deu, Esplugues de Llobregat, Barcelona, España. Electronic address: lmartinez@hsjdbcn.org.;Servicio de Urgencias de Pediatría, Hospital Sant Joan de Deu, Esplugues de Llobregat, Barcelona, España.;Servicio de Urgencias de Pediatría, Hospital Sant Joan de Deu, Esplugues de Llobregat, Barcelona, España.;Servicio de Pediatría, Hospital Pediátrico de Coimbra, Coimbra, Portugal.;Servicio de Urgencias de Pediatría, Hospital Sant Joan de Deu, Esplugues de Llobregat, Barcelona, España.;Servicio de Urgencias de Pediatría, Hospital Sant Joan de Deu, Esplugues de Llobregat, Barcelona, España.",
"authors": "Martínez Sánchez|L|L|;Almario Hernández|A F|AF|;Escuredo Argullós|L|L|;Maçao|P|P|;Trenchs Sainz de la Maza|V|V|;Luaces Cubells|C|C|",
"chemical_list": "D000931:Antidotes",
"country": "Spain",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1695-4033",
"issue": "81(4)",
"journal": "Anales de pediatria (Barcelona, Spain : 2003)",
"keywords": "Antidotes; Antídotos; Children; Emergency medical services; Intoxicación; Niños; Poisoning; Urgencias",
"medline_ta": "An Pediatr (Barc)",
"mesh_terms": "D000293:Adolescent; D000931:Antidotes; D002648:Child; D002675:Child, Preschool; D004636:Emergency Service, Hospital; D004638:Emergency Treatment; D005260:Female; D006801:Humans; D008297:Male; D011041:Poisoning; D012189:Retrospective Studies",
"nlm_unique_id": "101162596",
"other_id": null,
"pages": "220-5",
"pmc": null,
"pmid": "24439102",
"pubdate": "2014-10",
"publication_types": "D004740:English Abstract; D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Antidote use in a pediatric emergency department.",
"title_normalized": "antidote use in a pediatric emergency department"
} | [
{
"companynumb": "ES-ABBVIE-14P-144-1263539-00",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VALPROATE SODIUM"
},
"drugadditional": nul... |
{
"abstract": "Mycobacterium marinum is the etiologic agent of fish tank granuloma. The clinical course is usually benign: spontaneous healing is possible within weeks or months. However, fish tank granuloma is sometimes resistant to several antibiotics. We report a case of M. marinum infection of a finger in a 73-year-old cook. The disease was resistant to a number of antibiotics and required the amputation. The history of this patient testifies that M. marinum can be resistant to several antibiotics and that skin infections can be sometimes so severe as to require the amputation of a finger.",
"affiliations": "Department of Pathophysiology and Transplantation, Università degli Studi di Milano, I.R.C.C.S. Foundation, Cà Granda Ospedale Maggiore Policlinico, Milan, Italy, stefano.veraldi@unimi.it.;Department of Pathophysiology and Transplantation, Università degli Studi di Milano, I.R.C.C.S. Foundation, Cà Granda Ospedale Maggiore Policlinico, Milan, Italy, stefano.veraldi@unimi.it.;Department of Pathophysiology and Transplantation, Università degli Studi di Milano, I.R.C.C.S. Foundation, Cà Granda Ospedale Maggiore Policlinico, Milan, Italy, stefano.veraldi@unimi.it.",
"authors": "Veraldi|Stefano|S|;Pontini|Paolo|P|;Nazzaro|Gianluca|G|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/IDR.S179815",
"fulltext": "\n==== Front\nInfect Drug ResistInfect Drug ResistInfection and Drug ResistanceInfection and Drug Resistance1178-6973Dove Medical Press 10.2147/IDR.S179815idr-11-2069Case ReportAmputation of a finger in a patient with multidrug-resistant Mycobacterium marinum skin infection Veraldi Stefano Pontini Paolo Nazzaro Gianluca Department of Pathophysiology and Transplantation, Università degli Studi di Milano, I.R.C.C.S. Foundation, Cà Granda Ospedale Maggiore Policlinico, Milan, Italy, stefano.veraldi@unimi.itCorrespondence: Stefano Veraldi, Dermatology Unit, University of Milan, Via Pace 9, 20122 Milan, Italy, Tel +39 2 5503 5109, Fax +39 2 5032 0779, Email stefano.veraldi@unimi.it2018 30 10 2018 11 2069 2071 © 2018 Veraldi et al. This work is published and licensed by Dove Medical Press Limited2018The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed.Mycobacterium marinum is the etiologic agent of fish tank granuloma. The clinical course is usually benign: spontaneous healing is possible within weeks or months. However, fish tank granuloma is sometimes resistant to several antibiotics. We report a case of M. marinum infection of a finger in a 73-year-old cook. The disease was resistant to a number of antibiotics and required the amputation. The history of this patient testifies that M. marinum can be resistant to several antibiotics and that skin infections can be sometimes so severe as to require the amputation of a finger.\n\nKeywords\ncookMycobacterium marinumclarithromycinamputation\n==== Body\nIntroduction\nMycobacterium marinum is an acid-fast, aerobic, nonmotile, non-sporulating, photochromogen bacterium. It possesses a thick cell wall made up of wax (40%–70%) and lipids (25%–30%). M. marinum growth is usually slow: 2–6 weeks on Löwenstein–Jensen medium, at the temperature of 25°C–33°C. In culture, with a light source, the color changes from white to yellow because of the accumulation of β-carotene crystals.1,2\nM. marinum has a worldwide diffusion, mainly in temperate and hot-humid climates. Its natural habitat is fresh and salt water. Penetration of M. marinum in the skin occurs through abrasions or excoriations. Incubation period is usually 3 weeks; however, 35% of patients has an incubation period ≥30 days.3\nM. marinum is the etiologic agent of fish tank granuloma. Hands (fingers and dorsum), wrists and forearms are most frequently involved.3–9 Fish tank granuloma is characterized by four clinical presentations: type I: single erosive or ulcerative or crusted or verrucous papules, nodules and plaques; type II: more or less numerous and widespread lesions, often with a sporotrichoid distribution (multiple nodules along superficial lymphatics; regional lymphadenopathy is possible); type III: deep infections (bursitis, tenosynovitis, arthritis, osteomyelitis), with or without skin involvement; and type IV: widespread or disseminated lesions, systemic involvement and bacteremia, almost exclusively in immunocompromised patients.5,8,10–14 In types I and II, the clinical course is benign: spontaneous healing is possible within weeks or months;8,11,13 however, scar formation and reinfection, because of no permanent immunity, are possible. We report a case of type I M. marinum infection of a finger which was resistant to a number of antibiotics and required the amputation.\n\nCase report\nA 73-year-old Caucasian cook was admitted because of painful swelling, ulcers and crusts located at the left index finger. The patient stated that she was in good general health, except for mild essential arterial hypertension. Furthermore, the patient stated that the swelling had appeared 2 years earlier, followed, 6 months later, by the appearance of the ulcers. She was subjected to a biopsy at a dermatological center, with diagnosis of mycobacteriosis, although cultural examinations were negative for mycobacteria. The patient was treated with minocycline (100 mg/day for 3 months). However, this therapy was stopped because of both clinical failure and appearance of headache, dizziness and tinnitus. The patient was unsuccessfully treated at a second center with doxycycline (100 mg/day for 3 months) and nonsteroidal anti-inflammatory drugs. She subsequently went to a third center, where it was decided to use rifampicin (600 mg/day) and ethambutol (400 mg/day) for 4 months; however, no clinical remission was observed. When the patient was admitted at our hospital, dermatological examination revealed a severe erythematous swelling involving the left index finger. A roundish ulcer, of 0.8 cm diameter, with fibrinous bed and well-defined borders, and a round crust, of 0.7 cm diameter, were also visible at the medial and medial-lower surface of the finger, respectively (Figure 1). The patient complained of severe pain. General physical examination did not show anything pathological: in particular, no axillary lymphadenopathy was recorded. Laboratory examinations revealed leukocytosis (10,800 leukocytes/mm3), and increase in erythrocyte sedimentation rate (49 mm at the first hour), C-reactive protein (9 mg/dL) and α1-acid glycoprotein (4.1 mg/mL). All the other laboratory tests, including immunological tests, were within normal ranges or negative. X-rays showed a mild involvement of the periosteum of the second phalanx. Ultrasonography showed a dermal and subcutaneous swelling. Neurological examination, which was necessary in order to understand the nature of the severe pain reported by the patient, was negative. We performed a new biopsy. Histopathologic examination showed tubercular-like granulomas, with some Langhans cells and an inflammatory infiltrate with lymphocytes and neutrophils. Two out of three cultures were positive for M. marinum. PCR confirmed that the causative agent was M. marinum. Mycological examinations were negative. In vitro drug susceptibility testing was not performed. This was decided because, in our experience, based on ~60 patients with M. marinum skin infections, in vitro sensitivity was rarely correlated to in vivo sensitivity. The patient was treated with clarithromycin, according to a regimen we recently proposed (500 mg/day for 10 consecutive days/month for 5 months);15 oral diclofenac (100 mg/day) was added. This therapy induced only a slight improvement of the clinical picture; in particular, the patient complained of severe pain. She was therefore sent to a plastic surgery unit, where it was decided to perform the amputation of the finger. No additional antibiotic therapy was prescribed. We did not examine the patient anymore, but her surgeons stated that the follow-up (36 months) was negative.\n\nWritten informed consent has been provided by the patient to have the case details and the accompanying image published.\n\nDiscussion\nM. marinum skin infections can sometimes be considered as occupational diseases. However, they have been exceptionally reported in cooks.16–18 The patient we have described showed to be resistant to a number of antibiotics, including clarithromycin, which is, in our personal experience, the most effective antibiotic for the treatment of fish tank granuloma.15 However, according to literature data, M. marinum is often resistant, both in vitro and in vivo, to several antibiotics.13 In addition, in vitro sensitivity is not always correlated to in vivo sensitivity.13 In conclusion, no established therapy of choice does exist, and no therapeutic studies based on large groups of patients have been published.13 As previously mentioned, in this patient it was necessary to perform the amputation of the involved finger. This was also decided because of the severe pain reported by the patient. To our knowledge, six cases of amputation of a finger because of M. marinum infection were reported in the literature.9,19–23 In all cases, the infection was resistant to several antibiotics: isoniazid, rifampicin and ethambutol;19 rifampicin, ethambutol, clarithromycin and doxycycline;21 clarithromycin;22 and clarithromycin, moxifloxacin and ceftaroline.23 In addition, in one patient, destruction of the metacarpophalangeal joint capsule, flexor and extensor tenosynovitis, metacarpal and proximal phalanx bone destruction and abscess were recorded.19 In other two patients, amputation was considered as necessary because of osteomyelitis followed by fractures20 and flexor tenosynovitis,22 respectively. Finally, an amputation was performed because of methicillin-resistant Staphylococcus aureus superinfection.9 In our patient, bursitis, tenosynovitis, arthritis and osteomyelitis were not detected. The history of this patient testifies that M. marinum can be resistant to several antibiotics and that skin infections can be sometimes so severe as to require the amputation of a finger.\n\nDisclosure\n\nThe authors report no conflicts of interest in this work.\n\nFigure 1 Erythematous swelling, ulcer and crust located at the left index finger.\n==== Refs\nReferences\n1 Gluckman SJ Marinum M Mycobacterium marinum Clin Dermatol 1995 13 3 273 276 8521369 \n2 Palenque E Skin disease and nontuberculous atypical mycobacteria Int J Dermatol 2000 39 9 659 666 11044189 \n3 Jernigan JA Farr BM Incubation period and sources of exposure for cutaneous Mycobacterium marinum infection: case report and review of the literature Clin Infect Dis 2000 31 2 439 443 10987702 \n4 Edelstein H Mycobacterium marinum skin infections. Report of 31 cases and review of the literature Arch Intern Med 1994 154 12 1359 1364 8002687 \n5 Bhatty MA Turner DP Chamberlain ST Mycobacterium marinum hand infection: case reports and review of literature Br J Plast Surg 2000 53 2 161 165 10878841 \n6 Aubry A Chosidow O Caumes E Robert J Cambau E Sixty-three cases of Mycobacterium marinum infection: clinical features, treatment, and antibiotic susceptibility of causative isolates Arch Intern Med 2002 162 15 1746 1752 12153378 \n7 Bhambri S Bhambri A del Rosso JQ Atypical mycobacterial cutaneous infections Dermatol Clin 2009 27 1 63 73 18984369 \n8 Bonamonte D de Vito D Vestita M Aquarium-borne Mycobacterium marinum skin infection. Report of 15 cases and review of the literature Eur J Dermatol 2013 23 4 510 516 24002023 \n9 Johnson MG Stout JE Twenty-eight cases of Mycobacterium marinum infection: retrospective case series and literature review Infection 2015 43 6 655 662 25869820 \n10 Piersimoni C Scarparo C Extrapulmonary infections associated with nontuberculous mycobacteria in immunocompetent persons Emerg Infect Dis 2009 15 9 1351 1358 19788801 \n11 Petrini B Mycobacterium marinum : ubiquitous agent of waterborne granulomatous skin infections Eur J Clin Microbiol Infect Dis 2006 25 10 609 613 17047903 \n12 Pandian TK Deziel PJ Otley CC Eid AJ Razonable RR Mycobacterium marinum infections in transplant recipients: case report and review of the literature Transpl Infect Dis 2008 10 5 358 363 18482202 \n13 Rallis E Koumantaki-Mathioudaki E Treatment of Mycobacterium marinum cutaneous infections Expert Opin Pharmacother 2007 8 17 2965 2978 18001256 \n14 Gonzalez-Santiago TM Drage LA Nontuberculous Mycobacteria: Skin and Soft Tissue Infections Dermatol Clin 2015 33 3 563 577 26143432 \n15 Veraldi S Çuka E Nazzaro G Treatment of sporotrichoid fish tank granuloma with pulsed clarithromycin Dermatology 2014 229 2 83 87 25228273 \n16 Arai H Nakajima H Nagai R Mycobacterium marinum infection of the skin in Japan J Dermatol 1984 11 1 37 42 6376574 \n17 Cennimo DJ Agag R Fleegler E Mycobacterium marinum hand infection in a “sushi chef ” Eplasty 2009 9 400 406 \n18 Veraldi S Çuka E Vaira F Nazzaro G Mycobacterium marinum skin infection in a sushi cook G Ital Dermatol Venereol 2016 151 5 569 570 27595206 \n19 Wendt JR Lamm RC Altman DI Cruz HG Achauer BM An unusually aggressive Mycobacterium marinum hand infection J Hand Surg Am 1986 11 5 753 755 3760509 \n20 Vazquez JA Sobel JD A case of disseminated Mycobacterium marinum infection in an immunocompetent patient Eur J Clin Microbiol Infect Dis 1992 11 10 908 911 1486885 \n21 Rajesh G Ip WY Chow SP Fung BK Treating deep-seated mycobacterium marinum infection in the hand: a report of three cases Hand Surg 2006 11 1-2 83 88 17080536 \n22 Pang HN Lee JY Puhaindran ME Tan SH Tan AB Yong FC Jyl L Abh T Mycobacterium marinum as a cause of chronic granulomatous tenosynovitis in the hand J Infect 2007 54 6 584 588 17207859 \n23 Patel SS Tavana ML Boger MS Win SS Rimawi BH Necrotizing soft tissue infection occurring after exposure to Mycobacterium marinum Case Rep Infect Dis 2014 2014 702613 25506004\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1178-6973",
"issue": "11()",
"journal": "Infection and drug resistance",
"keywords": "Mycobacterium marinum; amputation; clarithromycin; cook",
"medline_ta": "Infect Drug Resist",
"mesh_terms": null,
"nlm_unique_id": "101550216",
"other_id": null,
"pages": "2069-2071",
"pmc": null,
"pmid": "30464549",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "27595206;17207859;26143432;19915656;18482202;18984369;10987702;12153378;24002023;3760509;10878841;8002687;6376574;25228273;18001256;8521369;25869820;11044189;1486885;17047903;17080536;25506004;19788801",
"title": "Amputation of a finger in a patient with multidrug-resistant Mycobacterium marinum skin infection.",
"title_normalized": "amputation of a finger in a patient with multidrug resistant mycobacterium marinum skin infection"
} | [
{
"companynumb": "IT-BAUSCH-BL-2019-000066",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXYCYCLINE"
},
"drugadditional": null,
... |
{
"abstract": "Use of interferon and ribavirin to treat chronic hepatitis C virus (HCV) infection in kidney transplant recipients is limited because of the risk for allograft rejection and poor tolerability.\nTo evaluate the safety and efficacy of the interferon- and ribavirin-free regimen ledipasvir-sofosbuvir in kidney transplant recipients with chronic genotype 1 or 4 HCV infection.\nRandomized, phase 2, open-label study. (ClinicalTrials.gov: NCT02251717).\n5 sites in Europe.\nTreatment-naive or -experienced kidney transplant recipients with chronic genotype 1 or 4 HCV infection, with or without compensated cirrhosis, and with an estimated glomerular filtration rate (eGFR) of 40 mL/min or greater were randomly assigned 1:1 to receive ledipasvir (90 mg) and sofosbuvir (400 mg) for 12 or 24 weeks.\nThe primary end point was sustained virologic response at 12 weeks after therapy ended (SVR12).\nAmong 114 patients, the median age was 53 years, 58% were male, 91% had genotype 1 infection, 69% were treatment naive, and 15% had compensated cirrhosis. The median eGFR was 56 mL/min (range, 35 to 135 mL/min). One hundred percent of patients (57 of 57) treated for 12 weeks (95% CI, 94% to 100%) and 100% of those (57 of 57) treated for 24 weeks (CI, 94% to 100%) achieved SVR12. Serious adverse events were reported in 13 patients (11%). Of these, 3 events-syncope, pulmonary embolism, and serum creatinine increase-in 3 patients were determined to be treatment related. One patient permanently discontinued treatment because of an adverse event (syncope). The most frequent adverse events overall were headache (n = 22 [19%]), asthenia (n = 16 [14%]), and fatigue (n = 11 [10%]).\nThe study was open label, no inferential statistics were planned, and only patients with genotype 1 or 4 infection were included. Few patients with HCV genotype 1a and cirrhosis were enrolled.\nTreatment with ledipasvir-sofosbuvir for 12 or 24 weeks was well-tolerated and seemed to have an acceptable safety profile among kidney transplant recipients with HCV genotype 1 or 4 infection, all of whom achieved SVR12.\nGilead Sciences.",
"affiliations": "From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.;From Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy; Gilead Sciences, Foster City, California; Hôpital Saint Joseph, Marseilles, and Hôpital Cochin, Paris, France; Medical University of Vienna, Vienna, Austria; and Hannover Medical School, Hannover, Germany.",
"authors": "Colombo|Massimo|M|;Aghemo|Alessio|A|;Liu|Hong|H|;Zhang|Jie|J|;Dvory-Sobol|Hadas|H|;Hyland|Robert|R|;Yun|Chohee|C|;Massetto|Benedetta|B|;Brainard|Diana M|DM|;McHutchison|John G|JG|;Bourlière|Marc|M|;Peck-Radosavljevic|Markus|M|;Manns|Michael|M|;Pol|Stanislas|S|",
"chemical_list": "D000998:Antiviral Agents; D001562:Benzimidazoles; D005449:Fluorenes; D007166:Immunosuppressive Agents; C586541:ledipasvir; D000069474:Sofosbuvir",
"country": "United States",
"delete": false,
"doi": "10.7326/M16-1205",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-4819",
"issue": "166(2)",
"journal": "Annals of internal medicine",
"keywords": null,
"medline_ta": "Ann Intern Med",
"mesh_terms": "D000328:Adult; D000368:Aged; D000998:Antiviral Agents; D001562:Benzimidazoles; D004334:Drug Administration Schedule; D024882:Drug Resistance, Viral; D004359:Drug Therapy, Combination; D005260:Female; D005449:Fluorenes; D005838:Genotype; D005919:Glomerular Filtration Rate; D019698:Hepatitis C, Chronic; D006801:Humans; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D000069474:Sofosbuvir",
"nlm_unique_id": "0372351",
"other_id": null,
"pages": "109-117",
"pmc": null,
"pmid": "27842383",
"pubdate": "2017-01-17",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": null,
"title": "Treatment With Ledipasvir-Sofosbuvir for 12 or 24 Weeks in Kidney Transplant Recipients With Chronic Hepatitis C Virus Genotype 1 or 4 Infection: A Randomized Trial.",
"title_normalized": "treatment with ledipasvir sofosbuvir for 12 or 24 weeks in kidney transplant recipients with chronic hepatitis c virus genotype 1 or 4 infection a randomized trial"
} | [
{
"companynumb": "IT-MYLANLABS-2017M1042109",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMIODARONE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nA case is reported of acute bilateral myopia and angle closure glaucoma in a 7-year-old patient from topiramate toxicity. This is the second known reported case of topiramate induced acute angle closure glaucoma and third known reported case of topiramate induced acute myopia in a pediatric patient.\n\n\nMETHODS\nThis case presents a 7-year-old who had recently begun topiramate therapy for seizures and headache. She developed painless blurred vision and acute bilateral myopia, which progressed to acute bilateral angle closure glaucoma. After a routine eye exam where myopia was diagnosed, the patient presented to the emergency room with symptoms of acute onset blurry vision, tearing, red eyes, swollen eyelids, and photophobia. The symptoms, myopia, and angle closure resolved with topical and oral intraocular pressure lowering medications, topical cyclopentolate, and discontinuation of topiramate.\n\n\nCONCLUSIONS\nAcute angle closure glaucoma is a well-known side effect of topiramate, but is rarely seen in children. It cautions providers to the potential ophthalmic side effects of commonly used medications in the pediatric population. It highlights the need to keep a broad differential in mind when encountering sudden onset blurry vision in the primary care clinic, the need for careful consideration of side effects when starting topiramate therapy in a child, and the need for parental counseling of side effects.",
"affiliations": "Vanderbilt Eye Institute, 2311 Pierce Avenue, Nashville, TN 37232, USA. Yuna.rapoport@vanderbilt.edu.",
"authors": "Rapoport|Yuna|Y|;Benegas|Nancy|N|;Kuchtey|Rachel W|RW|;Joos|Karen M|KM|",
"chemical_list": "D000927:Anticonvulsants; D000077236:Topiramate; D005632:Fructose",
"country": "England",
"delete": false,
"doi": "10.1186/1471-2431-14-96",
"fulltext": "\n==== Front\nBMC PediatrBMC PediatrBMC Pediatrics1471-2431BioMed Central 1471-2431-14-962471282510.1186/1471-2431-14-96Case ReportAcute myopia and angle closure glaucoma from topiramate in a seven-year-old: a case report and review of the literature Rapoport Yuna 1Yuna.rapoport@vanderbilt.eduBenegas Nancy 1Nancy.benegas@vanderbilt.eduKuchtey Rachel W 1Rachel.w.kuchtey@vanderbilt.eduJoos Karen M 1Karen.joos@vanderbilt.edu1 Vanderbilt Eye Institute, 2311 Pierce Avenue, Nashville, TN 37232, USA2014 9 4 2014 14 96 96 8 12 2013 25 2 2014 Copyright © 2014 Rapoport et al.; licensee BioMed Central Ltd.2014Rapoport et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nA case is reported of acute bilateral myopia and angle closure glaucoma in a 7-year-old patient from topiramate toxicity. This is the second known reported case of topiramate induced acute angle closure glaucoma and third known reported case of topiramate induced acute myopia in a pediatric patient.\n\nCase presentation\nThis case presents a 7-year-old who had recently begun topiramate therapy for seizures and headache. She developed painless blurred vision and acute bilateral myopia, which progressed to acute bilateral angle closure glaucoma. After a routine eye exam where myopia was diagnosed, the patient presented to the emergency room with symptoms of acute onset blurry vision, tearing, red eyes, swollen eyelids, and photophobia. The symptoms, myopia, and angle closure resolved with topical and oral intraocular pressure lowering medications, topical cyclopentolate, and discontinuation of topiramate.\n\nConclusion\nAcute angle closure glaucoma is a well-known side effect of topiramate, but is rarely seen in children. It cautions providers to the potential ophthalmic side effects of commonly used medications in the pediatric population. It highlights the need to keep a broad differential in mind when encountering sudden onset blurry vision in the primary care clinic, the need for careful consideration of side effects when starting topiramate therapy in a child, and the need for parental counseling of side effects.\n\nAcute angle closureDrug reactionGlaucomaElevated intraocular pressureSeizuresAcute myopia\n==== Body\nBackground\nAcute angle closure glaucoma (ACG) from topiramate toxicity is well reported in adults. The largest case series was published in 2004 by Fraunfelder et al. [1] of 83 bilateral and 3 unilateral cases. Of these, almost 50% had been using 50 mg or less of topiramate. Eighty-five percent of these cases occurred within the first 2 weeks, with an overall mean of 7 days. There were 5 cases that occurred within hours when the dose of topiramate was doubled. These reported findings of most likely occurrence within 2 weeks and a dosage under 50 mg have been replicated in another large case series [2].\n\nTopiramate is a sulfamate-substituted monosaccharide and works via blockage of voltage-gated sodium channels, hyperpolarization of potassium currents, enhancement of postsynaptic GABA receptor activity, and suppression of AMPA/kainite receptor. It is absorbed rapidly after oral intake and crosses the blood–brain barrier. It is mostly excreted in the urine, and has an elimination half-life of 21 hours [2]. In children, it was initially approved in July 1999 as adjunctive treatment for patients 2 years of age and older with partial onset seizures. Later, it was approved for seizures associated with Lennox-Gastaut syndrome, generalized tonic clonic seizures, and as initial monotherapy for partial onset or primary generalized epilepsy. Topiramate has been approved in the adult population as preventive therapy for headache and migraine and is used off-label for these conditions in the pediatric population. In 2011, the pediatric population (0–16 years) accounted for 7% of total use of topiramate with 2.1 million prescriptions and 315,000 patients; 81% of pediatric patients were aged 10–18 years [3].\n\nAcute myopia and angle closure glaucoma are two of many adverse side effects of topiramate. The underlying mechanism of acute myopia and acute angle closure glaucoma is a ciliochoroidal effusion. This leads to ciliary body edema which causes relaxation of zonular fibers, lens thickening, and anterior displacement of the lens -iris complex. The iris bowing forward physically blocks the drain of the eye, preventing aqueous fluid drainage. This ultimately causes secondary ACG and myopia. The ciliochoroidal effusion caused by sulphonamides is an idiosyncratic response in the uveal tissue, and is dose independent [4]. The hapten hypothesis postulates that reactive drug metabolites bind to proteins, forming altered proteins, which are recognized as foreign substances and incite immune reactions [4]. A patient must receive a sensitizing dose prior to inciting the immune reaction with the subsequent dose. The risk of any adverse reaction to a sulfonamide is 3% [5].\n\nMost common ocular signs of acute ACG from topiramate include abnormal vision, acute intraocular pressure elevation, acute myopia [6], microcystic corneal edema, shallow anterior chamber [1], circumciliary congestion, retinal striae [7], macular folds, choroidal detachments, and ciliochroidal detachments [8]. Besides topiramate, other sulfonamides have been reported to cause a similar clinical syndrome, including acetazolamide [9], sulfasalazine [10], hydrochlorothiazide [10], and indapamide [4,11]. All ocular findings are reversible if recognized early and the drug is discontinued.\n\nTreatment includes immediate discontinuation of topiramate, aqueous suppressants including oral or intravenous (IV) acetazolamide and IV mannitol, topical beta blockers, topical carbonic anhydrase inhibitors, topical prostaglandin analogues, and topical cycloplegics such as cyclopentolate or atropine, which work by relaxing the ciliary processes and deepening the anterior chamber. Acute angle closure usually resolves within 24–48 hours with medical treatment, and myopia resolves within 1–2 weeks of discontinuing the topiramate. If refractory, other measures reported to be successful include oral/ IV steroids [12], argon laser peripheral iridoplasty [13], and surgical intervention including choroidal drainage [14], vitrectomy, cataract extraction/ intraocular lens placement, and other glaucoma surgeries.\n\nWhile there are numerous case reports in the literature of adults presenting with acute ACG from topiramate toxicity in addition to the two case series mentioned above, there are very few case reports in children. One article reports acute myopia in an 8-year-old male with a 6 diopter myopic shift without ACG [15], and one reports a 5-year-old female presenting with acute ACG and acute myopia [16].\n\nThis is the second known reported case of acute ACG in a pediatric patient. In this case report, we discuss the presentation, treatment, and resolution of symptoms, and discuss a differential diagnosis of pediatric narrow angles and of elevated intraocular pressure in a child with seizures. We discuss the potential differences between presentation and treatment in the adult and pediatric population. We stress the importance of careful consideration of side effects when starting topiramate therapy in a child, and the need for parental counseling of side effects.\n\nCase presentation\nHistory of present illness and review of systems\nA 7-year-old female with a history of seizures and headaches presented to the pediatric emergency room (ER) with acute onset of blurry vision. The morning of presentation, she awoke with blurry vision. She presented to her pediatrician, who referred her to an optometrist, where she was refracted to a visual acuity (VA) of 20/20 with a myopic refraction. Visual acuity had been 20/20 at distance previously. Acute myopia is not an altogether unusual presentation to an optometrist and generally a new myopia patient does not cause alarm. She continued to experience worsening vision accompanied with red eyes, swollen eyelids, excessive tearing and photophobia. She denied pain, burning, itching, mucus discharge, or pain with extraocular movements. She denied systemic symptoms including dizziness, nausea, vomiting, malaise, neck stiffness, fever, or any focal neurological complaints. Her last dose of topiramate was 25 mg, 20 hours prior to presentation.\n\nPast medical, surgical, ocular, medication, social and allergic history\nShe had had 3 focal seizures from age 3–4, and had been treated with levetiracetam until 3 months prior to presentation, having been seizure free for three years. Her headaches returned, and she had one seizure while in school, which consisted of dysconjugate eye movements and brief unresponsiveness. After consultation with her primary pediatrician and her neurologist, topiramate 25 mg at bedtime was started 2 weeks prior to presentation. Her only other medication was cyproheptadine 5 ml at bedtime, as needed. She had no other medical or surgical history. Social, allergic and family history was noncontributory. She was developing normally.\n\nExamination\nIn the emergency room, her VA without correction was light perception at 20 feet in both eyes, count fingers at 14 inches in both eyes, and 20/20 at 3 inches in both eyes. In a complete ophthalmologic examination, vision is typically tested at distance (20 feet) and at near (14 inches). In this patient’s case, vision was also checked at 2 inches because anteriorization of the lens leading to acute myopia was suspected. Pupils were 6 mm, minimally reactive, with no relative afferent papillary defect in either eye. Extraocular movements were intact. Fields were constricted 360 degrees to confrontation in both eyes. Intraocular pressure (IOP) measured 40 mmHg in the right eye and 41 mmHg in the left eye, as measured by tonometry using a portable tonopen. External exam was significant for slightly edematous upper and lower lids. On slit lamp exam, sclera and conjunctiva showed 1+ injection, with conjunctival chemosis temporally bilaterally. There was no corneal edema. The anterior chamber was diffusely shallow bilaterally. The irides were round with a regular insertion, without iris bombe. There was irido-corneal touch as seen by the Van Herick method [17]. The lenses were clear. Fundus exam showed a pink and healthy optic disc in both eyes with sharp margins, with a cup: disc ratio of 0.25. The rest of the fundus examination was unremarkable. No choroidal effusions were seen.\n\nTreatment\nUpon diagnosis with topiramate-induced acute ACG, she was treated with oral acetazolamide 10 mg/kg × 2 doses, and 5 rounds of topical dorzolamide/timolol and topical bimatoprost in both eyes. Her IOP decreased to 28 mmHg in the right eye, 29 mmHg in the left eye, and her symptoms improved. She was no longer photophobic, the eyelid edema had subsided, and VA was now 20/60 at 14 inches. She was discharged home overnight with topical dorzolamide/timolol twice daily in both eyes, oral acetazolamide 10 mg/kg three times daily × 3 days, and topical cyclopentolate three times daily in the right eye. Topiramate was discontinued and was placed on her allergy list.\n\nClinical course\nShe was followed in the clinic closely. The day after her initial presentation, her VA was 20/200 in the right eye, 20/150 in the left eye at distance (20 feet), and 20/60 in the right eye, 20/40 + 3 in the left eye at near (14 inches); IOP was 23 mmHg in the right eye, 21 mmHg in the left eye, and all medications were continued. Her slit lamp examination was unchanged (Figure 1a). In the pediatric population in whom gonioscopy examination is very difficult, anterior segment optical coherence tomography (OCT) is a useful way of discerning anatomy of the angle and the anterior chamber. Anterior segment OCT (Visante; Jena, Germany) in our patient showed anterior iris convexity, iridocorneal apposition at the angle, and an anterior lens vault in both eyes (Figure 1c). All medications were discontinued at eight days after presentation, when her VA was 20/25 + 3, 20/25 at distance, and IOPs were 12 mmHg in the right eye, 11 mmHg in the left eye. At her last follow up visit 2 months after initial presentation, VA and IOP were normal off medications. She had remained headache and seizure free. Repeat slit lamp photograph (Figure 1b) and anterior segment OCT (Figure 1d) demonstrated return to normal anatomy. The anterior chambers were deep, and there was no iridocorneal touch, anterior iris convexity, or anterior lens vault in both eyes.\n\nFigure 1 Clinical and imaging findings. A. Slit lamp exam of the right eye demonstrating diffusely shallow AC, large pupils, no K edema, and slightly injected conjunctiva. B. Normal slit lamp photograph of the right eye after resolution of acute angle closure C. Anterior segment OCT of the right eye demonstrating abnormal anterior iris convexity, iridocorneal apposition at the angle, and an anterior lens vault D. Normal anterior segment OCT of the right eye demonstrating horizontal iris, no iridocorneal apposition, anterior iris convexity, or anterior lens vault.\n\nConclusion\nThis case highlights the fact that drug-induced angle closure, while rare in the pediatric population, should be suspected in children who present with acute onset of blurry vision and have features of bilateral acute angle closure, myopic shift and elevated intraocular pressure. Other considerations in a child with narrow angles similarly caused by a ciliochoroidal effusion include scleritis, uveitis, juvenile idiopathic arthritis, tumors such as retinoblastoma and medulloepithelioma, and exudative retinal detachments. A full differential is presented here, organized by mechanism (Table 1). The patient’s history of seizures and presentation with elevated IOP is in hindsight clearly linked to topiramate, but upon initial consideration those two features could be linked in and of themselves. Childhood phacomatoses such as Sturge Weber, Klippel-Trenaunay-Weber Syndrome, Wyburn-Mason syndrome, tuberous sclerosis, and neurofibromatosis I, as well as Aicardi Syndrome, the Ring 14 Syndrome [18], and CASK mutation [19] all present with epilepsy in childhood and have different mechanisms of elevating IOP (Table 2).\n\nTable 1 Differential diagnosis of childhood narrow angles\n\nAnterior segment dysgenesis\tPosterior ‘Pushing’ mechanism\t\n Corneal anomalies: microcornea, cornea plana/sclerocornea\tAnterior rotation of ciliary body\t\n Axenfeld-Rieger syndrome, Peters anomaly, Aniridia\t Nanophthalmos, Inflammation (scleritis, uveitis, juvenile idiopathic arthritis)\t\n Ectopia lentis (trauma, homocystinuria, Marfan syndrome, Ehlers’-Danlos, syndrome, Weill-Marchesani syndrome\t Drug-induced\t\nPupillary block\tPressure from posterior segment\t\n Aphakia\t Tumor (retinoblastoma, medulloepithelioma)\t\n Microspherophakia\t Exudative retinal detachment\t\nAnterior “Pulling’ mechanism without pupillary block\tContraction of retrolental tissue\t\n Neovascular (tuberous sclerosis)\t Persistent fetal vasculature\t\n Peripheral anterior synechiae\t Retinopathy of prematurity\t\nTable 2 Differential diagnosis of elevated intraocular pressure and seizures in children\n\nAicardi syndrome\tMicrophthalmos\tAgenesis of corpus callosum, depigmented chorioretinal lacunae\t\nCASK mutation\tAnterior segement dysgenesis, megalocornea\tDystonia, psychomotor retardation, severe, intellectual disability, scoliosis, mild, dysmorphism, progressive microcephaly\t\nKlippel-Trenaunay-Weber syndrome\tIncreased episcleral venous pressure\tPort-wine stains, venous and lymphatic malformations, soft tissue hypertrophy of affected limbs\t\nNeurofibromatosis\tAnterior segment dysgenesis\tOptic nerve glioma, Lisch nodules, café au lait spots, neurofibromas, freckling of intertriginous areas\t\nRing 14 syndrome\tUnknown\tMacular white spots, strabismus, short, stature, microcephaly, scoliosis\t\nSturge Weber syndrome\tIncreased episcleral venous pressure\tPort-wine stains, ipsilateral leptomeningeal, vascular malformations\t\nTuberous sclerosis\tAnterior segment neovascularization, retinal detachment\tRetinal astrocytic hamartomas, ash-leaf spots, adenoma sebaceum, cardiac rhabdomyoma\t\nWyburn-Mason syndrome\tIntraocular hemorrhage\tRetinal racemose hemangiomas, arteriovascular, malformation with dilated and tortuous shunt vessels\t\nDiagnosis Intraocular Pressure Elevation Mechanism Other Clinical Findings.\n\nA thorough history and examination should eliminate most of the previous entities from consideration. As this is the second known reported independent case report of childhood ACG from topiramate, it is difficult to draw conclusions as to differences between the clinical presentation and course between children and adults. Since they are both caused by the same mechanism, the same course and outcome is assumed to occur. Treatment is the same as in adults except topical alpha agonists are contraindicated in children. Further investigation and reports will help elucidate potential differences between adults and children.\n\nIn comparison with the one other case of pediatric ACG from topiramate [16], our patient did not present with headache, nausea, and fatigue, had a slightly lower IOP (40 vs. 50 mmHg), did not show microcystic corneal edema, but did have iridocornreal touch. In addition to pressure-lowering medications, a thorough review of systemic medications should be undertaken with discontinuation of the most probable causative agent. A high index of suspicion for drug-induced causes will allow for a quick diagnosis and complete visual recovery.\n\nImportant clinical pearls of topiramate toxicity induced angle closure glaucoma were highlighted by this case report. The first presenting sign of acute angle closure from topiramate toxicity may be blurring of vision bilaterally at distance with normal vision at near, representing the myopic shift, and occurs prior to symptoms and elevated IOP. Eighty five percent of cases of IOP elevation occur within two weeks of use. Finally, primary narrow angle glaucoma is rare under 40 years of age, and secondary angle closure glaucoma, particularly drug-induced ACG, must be considered in pediatric patients.\n\nRequesting consent statement\nWritten informed consent was obtained from the patient’s parent for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nAbbreviations\nACG: Angle closure glaucoma; EEG: Electroencephalogram; ER: Emergency room; IOP: Intraocular pressure; IV: Intravenous; OCT: Optical coherence tomography; VA: Visual acuity.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\nYR was involved in the patient care, performed the literature review, and drafted the manuscript. NB was involved in the patient care and edited the manuscript. RK was involved in the patient care and edited the manuscript. KJ analyzed the data and was involved in the manuscript drafting and critical revision for content. All parties approved the final manuscript.\n\nPre-publication history\nThe pre-publication history for this paper can be accessed here:\n\nhttp://www.biomedcentral.com/1471-2431/14/96/prepub\n\nAcknowledgment\nI would like to take this opportunity to thank the parent and patient for allowing me to submit this case. Supported in part by an Unrestricted Departmental Grant to the Vanderbilt Eye Institute by Research to Prevent Blindness, Inc., New York.\n==== Refs\nFraunfelder FW Fraunfelder FT Keates EU Topiramate-associated acute, bilateral, secondary angle-closure glaucoma Ophthalmol 2004 111 109 111 10.1016/j.ophtha.2003.04.004 \nAbtahi MA Abtahi SH Fazel F Roomizadeh P Etemadifar M Jenab K Akbari M Topiramate and the vision: a systematic review Clin Ophthalmol 2012 6 117 131 22275816 \nElgin V Food and Drug Administration Pediatric focused safety review: Topamax (topiramate). Pediatric Advisory Committee Meeting Available at: [http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/PediatricAdvisoryCommittee/UCM272861.pdf] \nSenthil S Garudadri C Rao HB Maheshwari R Bilateral simultaneous acute angle closure caused by sulphonamide derivatives: a case series Indian J Ophthalmol 2010 58 248 252 10.4103/0301-4738.62657 20413935 \nPanday VA Rhee DJ Review of sulfonamide-induced acute myopia and acute bilateral angle-closure glaucoma Compr Ophthalmol Update 2007 8 271 276 18201514 \nGuier CP Elevated intraocular pressure and myopic shift linked to topiramate use Optom Vis Sci 2007 84 1070 1073 10.1097/OPX.0b013e31815b9e38 18091300 \nSen HA O’Halloran HS Lee WB Case reports and small case series: topiramate-induced acute myopia and retinal striae Arch Ophthalmol 2001 119 775 777 11346412 \nKumar M Kesarwani S Rao A Garnaik A Macular folds: an unusual association in topiramate toxicity Clin Exp Optom 2012 95 449 452 10.1111/j.1444-0938.2012.00722.x 22571653 \nMalagola R Arrico L Giannotti R Pattavina L Acetazolamide-induced cilio choroidal effusion after cataract surgery: unusual posterior involvement Drug Des Devel Ther 2013 7 33 36 23378740 \nLee GC Tam CP Danesh-Meyer HV Myers JS Katz LJ Bilateral angle closure glaucoma induced by sulphonamide-derived medications Clin Experiment Ophthalmol 2007 35 1 55 58 10.1111/j.1442-9071.2006.01365.x 17300572 \nBlain P Paques M Massin P Erginay A Santiago P Gaudric A Acute transient myopia induced by indapamide Am J Ophthalmol 2000 129 538 540 10.1016/S0002-9394(99)00402-X 10764870 \nRhee DJ Ramos-Esteban JC Nipper KS Rapid resolution of topiramate-induced angle-closure glaucoma with methylprednisolone and mannitol Am J Ophthalmol 2006 141 1133 1134 10.1016/j.ajo.2006.01.021 16765687 \nZalta AH Smith RT Peripheral iridoplasty efficacy in refractory topiramate-associated bilateral acute angle-closure glaucoma Arch Ophthalmol 2008 126 1603 1605 10.1001/archopht.126.11.1603 19001233 \nParikh R Parikh S Das S Thomas R Choroidal drainage in the management of acute angle closure after topiramate toxicity J Glaucoma 2007 16 691 693 10.1097/IJG.0b013e318098739b 18091456 \nHussein M Coats DK Acute transient myopia in a child Medscape Ophthalmology 2002 3 http://www.medscape.com/viewarticle/439476 \nLin J Fosnot J Edmond J Bilateral angle closure glaucoma in a child receiving oral topiramate J AAPLEFT EYE 2003 7 66 68 \nVan Herick W Shaffer RN Schwartz A Estimation of width of angle of anterior chamber. Incidence and significance of the narrow angle Am J Ophthalmol 1969 68 626 9 5344324 \nZollino M Seminara L Orteschi D Gobbi G Giovannini S Della Giustina E Frattini D Scarano A Neri G The ring 14 syndrome: clinical and molecular definition Am J Med Genet A 2009 149 1116 1124 19441122 \nBurglen L Chantot-Bastaraud S Garel C Milh M Touraine R Zanni G Petit F Afenjar A Goizet C Barresi S Coussement A loleft eye C Lazaro L Joriot S Desguerre I Lacombe D DesPortes V Bertini E Siffroi JP de Villemeur TB Rodriguez D Spectrum of pontocerebellar hypoplasia in 13 girls and boys with CASK mutations: confirmation of a recognizable phenotype and first description of a male mosaic patient Orphanet J Rare Dis 2012 7 18 10.1186/1750-1172-7-18 22452838\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2431",
"issue": "14()",
"journal": "BMC pediatrics",
"keywords": null,
"medline_ta": "BMC Pediatr",
"mesh_terms": "D000927:Anticonvulsants; D002648:Child; D003937:Diagnosis, Differential; D005260:Female; D005632:Fructose; D015812:Glaucoma, Angle-Closure; D006261:Headache; D006801:Humans; D009216:Myopia; D012640:Seizures; D000077236:Topiramate",
"nlm_unique_id": "100967804",
"other_id": null,
"pages": "96",
"pmc": null,
"pmid": "24712825",
"pubdate": "2014-04-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D016454:Review",
"references": "23378740;22571653;12690373;14711721;18201514;19441122;18091300;22275816;18091456;10764870;22452838;16765687;17300572;19001233;5344324;20413935;11346412",
"title": "Acute myopia and angle closure glaucoma from topiramate in a seven-year-old: a case report and review of the literature.",
"title_normalized": "acute myopia and angle closure glaucoma from topiramate in a seven year old a case report and review of the literature"
} | [
{
"companynumb": "US-JNJFOC-20140416098",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TOPIRAMATE"
},
"drugadditional": null,
... |
{
"abstract": "Aggressive behavior is among the most common reasons for referral to psychiatric clinics and confers significant burden on individuals. Aggression remains poorly defined; there is currently no consensus on the best ways to recognize, diagnose, and treat aggression in clinical settings. In this review, we synthesize the available literature on aggression in children and adolescents and propose the concept of impulsive aggression (IA) as an important construct associated with diverse and enduring psychopathology. Articles were identified and screened from online repositories, including PubMed, PsychInfo, the Cochrane Database, EMBase, and relevant book chapters, using combinations of search terms such as \"aggression,\" \"aggressive behavio(u)r,\" \"maladaptive aggression,\" \"juvenile,\" and \"developmental trajectory.\" These were evaluated for quality of research before being incorporated into the article. The final report references 142 sources, published from 1987 to 2019. Aggression can be either adaptive or maladaptive in nature, and the latter may require psychosocial and biomedical interventions when it occurs in the context of central nervous system psychopathology. Aggression can be categorized into various subtypes, including reactive/proactive, overt/covert, relational, and IA. IA in psychiatric or neurological disorders is reviewed along with current treatments, and an algorithm for systematic evaluation of aggression in the clinical setting is proposed. IA is a treatable form of maladaptive aggression that is distinct from other aggression subtypes. It occurs across diverse psychiatric and neurological diagnoses and affects a substantial subpopulation. IA can serve as an important construct in clinical practice and has considerable potential to advance research.",
"affiliations": "Department of Psychiatry, Division of Child & Adolescent Psychiatry, University of Connecticut Medical School, Farmington, Connecticut.;Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, New York.;NeuroScience, Inc., Herndon, Virginia.;Behavioral Medical Center-Troy, Troy, Michigan.;Department of Pediatrics, Emory University School of Medicine, Atlanta, Georgia.;Department of Psychiatry and Behavioral Sciences, Children's National Medical Center, Washington, District of Columbia.;Department of Psychiatry, University of Arkansas for Medical Science, Little Rock, Arkansas.;Section of Child and Adolescent Neuropsychiatry, University of Turin, Turin, Italy.;Department of Psychiatry and Behavioral Sciences, Johns Hopkins University, Baltimore, Maryland.;Department of Cognitive Neuroscience, Donders Institute for Brain, Cognition and Behaviour, Radboud University Medical Center, Nijmegen, The Netherlands.",
"authors": "Connor|Daniel F|DF|;Newcorn|Jeffrey H|JH|;Saylor|Keith E|KE|;Amann|Birgit H|BH|;Scahill|Lawrence|L|;Robb|Adelaide S|AS|;Jensen|Peter S|PS|;Vitiello|Benedetto|B|;Findling|Robert L|RL|;Buitelaar|Jan K|JK|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1089/cap.2019.0039",
"fulltext": "\n==== Front\nJ Child Adolesc PsychopharmacolJ Child Adolesc PsychopharmacolcapJournal of Child and Adolescent Psychopharmacology1044-54631557-8992Mary Ann Liebert, Inc., publishers 140 Huguenot Street, 3rd FloorNew Rochelle, NY 10801USA 3145371510.1089/cap.2019.003910.1089/cap.2019.0039ReviewMaladaptive Aggression: With a Focus on Impulsive Aggression in Children and Adolescents Connor Daniel F. MD1Newcorn Jeffrey H. MD2Saylor Keith E. PhD, ScM3Amann Birgit H. MD4Scahill Lawrence MSN, PhD5Robb Adelaide S. MD6,7Jensen Peter S. MD8Vitiello Benedetto MD9Findling Robert L. MD, MBA10,11Buitelaar Jan K. MD, PhD121 Department of Psychiatry, Division of Child & Adolescent Psychiatry, University of Connecticut Medical School, Farmington, Connecticut.2 Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, New York.3 NeuroScience, Inc., Herndon, Virginia.4 Behavioral Medical Center—Troy, Troy, Michigan.5 Department of Pediatrics, Emory University School of Medicine, Atlanta, Georgia.6 Department of Psychiatry and Behavioral Sciences, Children's National Medical Center, Washington, District of Columbia.7 Department of Psychiatry and Behavioral Sciences, George Washington University, Washington, District of Columbia.8 Department of Psychiatry, University of Arkansas for Medical Science, Little Rock, Arkansas.9 Section of Child and Adolescent Neuropsychiatry, University of Turin, Turin, Italy.10 Department of Psychiatry and Behavioral Sciences, Johns Hopkins University, Baltimore, Maryland.11 Department of Psychiatry and Behavioral Sciences, Kennedy Krieger Institute, Baltimore, Maryland.12 Department of Cognitive Neuroscience, Donders Institute for Brain, Cognition and Behaviour, Radboud University Medical Center, Nijmegen, The Netherlands.Funding: Editorial support was funded by Supernus Pharmaceuticals, Inc., and was provided by IMPRINT Science, New York, NY, USA. J.K. Buitelaar was supported by funding from the European Community's Seventh Framework Programme (FP7/2007–2013) under grant agreements no. 602805 (Aggressotype), no. 603016 (MATRICS), and no. 278948 (TACTICS).\n\nAddress correspondence to: Daniel F. Connor, MD, Department of Psychiatry, Division of Child & Adolescent Psychiatry, University of Connecticut Medical School, 263 Farmington Avenue, MC 1410, Farmington, CT 06030-1410 connor@psychiatry.uchc.edu01 10 2019 07 10 2019 07 10 2019 29 8 576 591 © Daniel F. Connor et al. 2019; Published by Mary Ann Liebert, Inc.2019This Open Access article is distributed under the terms of the Creative Commons License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Abstract\nObjective: Aggressive behavior is among the most common reasons for referral to psychiatric clinics and confers significant burden on individuals. Aggression remains poorly defined; there is currently no consensus on the best ways to recognize, diagnose, and treat aggression in clinical settings. In this review, we synthesize the available literature on aggression in children and adolescents and propose the concept of impulsive aggression (IA) as an important construct associated with diverse and enduring psychopathology.\n\nMethods: Articles were identified and screened from online repositories, including PubMed, PsychInfo, the Cochrane Database, EMBase, and relevant book chapters, using combinations of search terms such as “aggression,” “aggressive behavio(u)r,” “maladaptive aggression,” “juvenile,” and “developmental trajectory.” These were evaluated for quality of research before being incorporated into the article. The final report references 142 sources, published from 1987 to 2019.\n\nResults: Aggression can be either adaptive or maladaptive in nature, and the latter may require psychosocial and biomedical interventions when it occurs in the context of central nervous system psychopathology. Aggression can be categorized into various subtypes, including reactive/proactive, overt/covert, relational, and IA. IA in psychiatric or neurological disorders is reviewed along with current treatments, and an algorithm for systematic evaluation of aggression in the clinical setting is proposed.\n\nConclusions: IA is a treatable form of maladaptive aggression that is distinct from other aggression subtypes. It occurs across diverse psychiatric and neurological diagnoses and affects a substantial subpopulation. IA can serve as an important construct in clinical practice and has considerable potential to advance research.\n\nKeywords\nmaladaptive aggressionimpulsive aggressionaggressionpsychiatric disordersneurological disorders\n==== Body\nIntroduction\nAggressive behavior is one of the most common reasons children and adolescents are referred to psychiatric clinics, and it co-occurs with several psychiatric and neurological disorders (Connor 2002; Bambauer and Connor 2005; Jensen et al. 2007). Clinical levels of aggression in children are associated with significant individual, familial, and societal economic burdens that increase with the age of the aggressive child (Raaijmakers et al. 2011). Despite the prevalence and cost of aggression—and more than 100 years of research on the subject—it remains poorly defined in the clinical setting. Currently, a number of constructs are used to describe aggressive behavior, including symptoms (e.g., irritability or hostility) (Ramirez and Andreu 2006); diagnoses (e.g., intermittent explosive disorder [IED], disruptive mood dysregulation disorder [DMDD], oppositional defiant disorder [ODD], or conduct disorder [CD]) (American Psychiatric Association 2013); and behaviors (e.g., impulsivity) (Ramirez and Andreu 2006). This lack of well-defined nosology creates diagnostic discrepancies, which, in turn, influence the clinician's ability to devise and tailor optimal treatment strategies for the individual patient. In this review, we focus on the concept of impulsive aggression (IA) in children and adolescents and present other characterizations and frameworks of aggression for context.\n\nSince the last comprehensive child psychiatry reviews of aggression were published, there have been several new developments in the field (Connor et al. 2006; Jensen et al. 2007). First, within child psychiatry literature, discussion of aggression has largely been supplanted by research on irritability (Pagliaccio et al. 2018; Winters et al. 2018) and classified as DMDD in the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5) (American Psychiatric Association 2013). Next, IA has been identified as a treatable indication and an unmet pharmacotherapy need (Robb et al. 2019). Finally, new formulations are under development to meet this need.\n\nOur specific aims are to (1) discuss the definitions and categories of the aggression-related constructs currently used, including the idea of adaptive and maladaptive aggression, with an emphasis on IA; (2) provide a brief discussion of the normative developmental aspects of aggression; (3) briefly discuss the developmental neurobiology of IA; (4) present pediatric psychiatric and neurological diagnoses commonly associated with IA; and (5) review psychosocial and biological interventions, both previously used and new, for IA. Because of space limitations, our review cannot provide a discussion of aggression-related concepts such as self-injurious behaviors (SIB) or suicide, nor can it provide a detailed, in-depth focus on the neurobiology of aggression. Furthermore, because of limitations in the clinical research on pediatric aggression subtypes, some of our discussion pertains to generalized aggressive behaviors.\n\nWe conclude by suggesting that the construct of IA may be an important one to advance, both for describing behavior that presents in clinical settings and for improving the focus of treatment. A better understanding of the different types of aggression may help clinicians determine whether behaviors presented by their patients reflect natural adaptive mechanisms or a neurobiologically driven pathological condition, and in turn, facilitate more targeted identification.\n\nMethods\nAreas of interest for advancing our understanding of maladaptive aggression (and its subsets) were identified and the relevant literature was reviewed. Articles for inclusion were screened from PubMed, PsychInfo, Scopus, the Cochrane Database, EMBase, and relevant book chapters using the search terms “aggression,” “aggressive behavio(u)r,” “maladaptive aggression,” “juvenile,” and “developmental trajectory.” The search period was from 1987 to 2019, inclusive. Of the many sources that met these criteria, 142 were selected to capture the current state of the field and are included in the article and Supplementary Data.\n\nAggression and Aggression-Related Emotional Constructs\nA number of aggression-related constructs are included in the discussion of aggression, which potentially creates uncertainty for patients, clinicians, and researchers. Therefore, we begin by defining common aggression-related constructs, understanding that there may be some overlap across terms (Supplementary Table S1). The following terms are prominent in the literature:\n(1) Irritability refers to a heightened propensity or vulnerability to feeling angry, and has been defined as an emotional state in which an individual is “easily annoyed and provoked to anger” (Safer 2009; American Psychiatric Association 2013). It is the main characteristic of the newly developed diagnosis category, DMDD, but is present in several other disorders (American Psychiatric Association 2013; Winters et al. 2018).\n\n(2) Like irritability, the term anger refers to an emotion. However, it is distinguished from irritability, in that anger may be the emotional component of an aggressive behavior. State anger is one possible affective component of aggressive behaviors. Trait anger is associated with the frequency, duration, and intensity of angry emotions. (Miller et al. 1996; Ramirez and Andreu 2006).\n\n(3) Agitation has been defined as a state characterized by feelings of inner tension, with irritability and anxiety, and externalized symptoms, including excessive motor activity.\n\n(4) Hostility refers to a negative mindset of anger and aversion toward a person or thing; it is often accompanied by a desire to do harm to another. “Hostile attribution,” a related cognition, involves interpreting ambiguous environmental stimuli as threatening, increasing risk for responding with aggressive behaviors. In sum, these terms and concepts refer to mood states or emotions that may precede or co-occur with aggressive behavior. A clear understanding of these behavioral predispositions may help in the identification and treatment of aggressive behavior in clinical practice.\n\n\n\nAdaptive and Maladaptive Aggression\nThe working concept of aggression, as described by Ramirez and Andreu, is “the delivery of any form of definite and observable harm-giving behavior toward any target” (Ramirez and Andreu 2006). Aggression is a central facet of the behavioral repertoire across species (Connor 2002). Adaptive aggression is defined as a behavior arising from a central nervous system (CNS) that functions optimally because of evolutionary adaptation (Connor 2002). It is a normal part of development (Connor 2002), and serves many important, easily recognizable short- and long-term goals, including resource acquisition, defense of the individual or group, and establishment of dominance in social groups. Adaptive aggressive behaviors serve many prosocial ends such as competition in academic pursuits, sports, and/or business.\n\nHowever, adaptive aggression may also cause much harm and distress in society. An example is neighborhood gang violence. In gangs, groups of individuals establish a leadership hierarchy, defend “turf,” sometimes with violence, and may engage in predatory theft of resources. All of these behaviors are adaptive by the above definition, yet may clearly cause harm to individuals and society. Adaptive aggressive behaviors that threaten societal norms may require intervention from psychosocial, familial, educational, juvenile or criminal justice, or political-economic institutions in certain circumstances. However, adaptive aggression does not require, and is unlikely to show, a positive response to biomedical intervention (Connor 2002).\n\nMaladaptive aggression may be an associated behavior of an impaired CNS that is not functioning optimally, and is more likely to occur in individuals with psychiatric or neurological illnesses. Sometimes called pathological aggression, maladaptive aggression is conceptualized as the extreme of a normal distribution of aggressive behaviors in the general population (Walters and Ruscio 2013; Waltes et al. 2016).\n\nMaladaptive aggression occurs in response to minimal or absent provocation, and tends to be abrupt, impulsive, inappropriately intense, and frequent, and is often excessive in duration (Bambauer and Connor 2005; Jensen et al. 2007). Outside observers of a child who is vulnerable to maladaptive aggression often report that the child has “lost control,” suggesting an extreme of behavioral and emotional dysregulation (Bambauer and Connor 2005). This type of behavior is considered maladaptive compared to aggressive behaviors observed in comparison groups of nonafflicted children (Connor 2002; Bambauer and Connor 2005). When maladaptive aggression is severe, and when it occurs in the context of psychopathology, management may require biomedical therapy, in addition to psychosocial interventions (Jensen et al. 2007; Saylor and Amann 2016).\n\nIn addition to optimized/nonoptimized CNS function, the environmental context in which aggression occurs is important in determining whether aggression is expressed in an adaptive or maladaptive manner. For example, consider two scenarios with the same hypothetical subject, a child with attention-deficit/hyperactivity disorder (ADHD), walking home alone from school, who is suddenly surrounded by a youth gang intent on taunting, bullying, and then physically assaulting him. In scenario (a), the child responds with sudden, frenzied, impulsive intense aggression toward his attackers, who are momentarily taken aback. Using this brief interruption to maximal advantage, the child runs away and makes his safe escape from the gang encounter. Now consider scenario (b), in which this same child arrives home, puts off completing his homework assignments, and settles in front of an electronic, first-person shooter game to calm down. Intensely absorbed in the game, he does not hear his mother tell him to turn off the game, wash his hands, and come to dinner. She raises her voice, commanding him to turn off the game. He responds with sudden, frenzied, impulsive intense verbal threats toward his mother, throwing objects, and punching the wall. Both scenarios are examples of IA, but while the first is more adaptive in the service of individual response to a threat, the same behavior in the second scenario appears more maladaptive in the context of an ordinary request.\n\nSubtypes of Aggression\nAggression can be categorized into numerous subtypes, which may be expressed in either adaptive or maladaptive ways, predominantly in a context-dependent manner, as shown above. A variety of scales and questionnaires have been developed to assess the various subtypes of aggression in clinical populations (Table 1). Aggressive behaviors are often complex and heterogeneous, and there may be varying degrees of overlap between subtypes, complicating an already intricate landscape (Fig. 1) (Connor and McLaughlin 2006). Nevertheless, the distinction between adaptive and maladaptive aggression, and among aggression subtypes that are impulsive, affective, reactive, and/or dysregulated, is heuristically useful and may foster better identification of the individuals and types of aggression that are appropriate candidates for biomedical and/or psychosocial interventions (Connor 2002). Below, we will review aggression subtypes in clinical practice and research.\n\nFIG. 1. Overlapping characteristics among aggression subtypes.\n\nTable 1. Some Measures of Aggression Types\n\nAggression type\tRating scale\tDescription\tReporter\tAge (years)\tAvailability\t\nReactive and proactive aggression\tThe Reactive-Proactive Aggression Questionnaire (Raine et al. 2006)\t23-item questionnaire; 12 proactive aggression items, 11 reactive aggression questions\tSelf\t6–17\tReproduced in the open access publication (Raine et al. 2006)\t\nAffective and predatory aggression\tVitiello Aggression Questionnaire (Vitiello et al. 1990; Vitiello and Stoff 1997)\t10-item questionnaire, scoring −5 (purely affective) to +5 (purely predatory)\tCaregiver\t10–18\tAvailable from the author (not in the public domain)\t\nHostile aggression\tAggression Questionnaire (Buss and Perry 1992; Buss and Warren 2000)\tNewer version of the Buss-Durkee Hostility Inventory; 34 items assess 5 domains: physical aggression, verbal aggression, anger, hostility, and indirect aggression\tSelf\t9–18\tAvailable for purchase\t\nInstrumental aggression\tThe Appetitive Aggression Scale (Weierstall and Elbert 2011)\t15 items measuring a person's propensity toward violence-related reward\tSelf\t13–95\tReproduced in the open access publication (Weierstall and Elbert 2011)\t\nOvert and covert aggression\tRetrospective-Modified Overt Aggression Scale (Blader et al. 2010)\t16 items rated over previous week in 4 domains: verbal aggression, physical aggression toward others, aggression toward self, and destruction of property\tCaregiver\t6–13\tReproduced in the open access publication (Blader et al. 2010)\t\nRelational aggression\tDirect and Indirect Aggression Scale (Collett et al. 2003)\t12 items assessing behaviors that covertly exploit social relationships\tSelf or Peer\t8–15\tFreely available\t\nImpulsive aggression\tUnder development\t15 items assessing impulsive aggression in children and adolescents with ADHD\tCaregiver\t6–17\tNot yet available\t\nADHD, attention-deficit/hyperactivity disorder.\n\nReactive and proactive aggression\nReactive aggression (RA) and proactive aggression (PA) are partially overlapping, yet behaviorally distinct constructs, with divergent underlying physiological hallmarks and neurological circuits (Connor 2002, 2017). RA is defined as an angry, hostile, or defensive response to frustration, provocation, or perceived threat that is rooted in the frustration-aggression model (Connor 2002; Thomson and Centifanti 2018). It is characterized by high emotional valence, autonomic nervous system arousal, and activation of fight-flight physiological mechanisms. RA can be further subcategorized according to the cause as “reactive aggression due to internal frustration” and “reactive aggression due to external provocation” (Smeets et al. 2017). In contrast, PA is a deliberate, goal-directed behavior. It is often explained by social learning theory by modeling from others and the pursuit of reward (Connor 2002). PA is characterized by overcontrolled, planned behavior accompanied by low emotional valence and low autonomic system arousal.\n\nAs discussed in detail by Bushman and Anderson (2001), some have argued that viewing RA and PA in a dichotomous manner may thwart advances in treatment. Although the dichotomy has provided the foundation for developing theories of aggression, it is now clear that aggressive acts may be more complicated than the dichotomous model implies. For example, an aggressive act may be planned and cold at the time of the occurrence, but may also be motivated by anger and the desire to harm another, as exemplified by the tragic mass murder that occurred at Columbine High School in 1999 (Bushman and Anderson 2001; Connor 2002).\n\nReactive-proactive–related aggression subtypes\nSubtypes of aggression related to RA and PA include predatory-affective, hostile-instrumental, and offensive-defensive aggression. The predatory and affective aggression constructs resemble PA and RA, respectively, but the predatory-affective continuum applies mainly to animal research (Connor 2002). Hostile aggression, also referred to as “affective,” “angry,” “retaliatory,” or “hot” aggression, is impulsive and angry. Instrumental aggression, also referred to as “cold” aggression, is premeditated and occurs in the absence of acute anger (Bushman and Anderson 2001; Connor 2002). Harm is not the intended goal of the behavior; rather, the aggressive act is designed to provide some reward or advantage to the aggressor (e.g., contingency reinforcement).\n\nHostile attribution bias is a common social-cognitive distortion that may lead to aggression. It refers to thinking that another person is responsible for some negative outcome; it has been correlated with RA, and has been described in children as young as 8 years of age (Dodge et al. 2015). This bias is predictive of acts of maladaptive RA in adulthood, suggesting that exaggeration of perceived threat may contribute to the development of chronic maladaptive aggression over time (Dodge et al. 2015). Offensive aggression is an unprovoked, instrumental behavior or attack aimed at achieving a goal, often occurring in the context of competition for social dominance or resource acquisition (Connor 2002; Veroude et al. 2016). Defensive aggression is a provoked behavior in response to an immediate threat, with the aim of reducing or eliminating the threat (Connor 2002; Veroude et al. 2016).\n\nAlthough the offensive-defensive paradigm emerged from preclinical neurobiological research, it may apply to clinical research (Connor 2002; Veroude et al. 2016). For example, in a study of 369 second-grade boys and girls, evaluated again 6 years later, and then followed by examination of criminal records in young adulthood, Pulkkinen reported that general (offensive and defensive) aggression at age 8 predicted offensive aggression at age 14 and criminal convictions at age 20 (Pulkkinen 1987).\n\nOvert and covert aggression\nOvert aggression is characterized by an open and observable response to a stimulus, such as physical fighting, property destruction, or threats of harm to others (Marsee et al. 2011; Connor 2017). This subcategory of aggression may be identified early in development. It is often initiated in the first year of life, substantially increasing in frequency with physical growth between ages 3 and 4 years, followed by a steady decline beginning at school age and continuing into adulthood (Nagin and Tremblay 2005; Olson et al. 2013). For example, about 80% of toddlers engage in some form of overt aggression (Tremblay et al. 2018). By third grade, ∼12% of children engage in hitting (the most common form of early overt aggression) (NICHD Early Child Care Research Network 2004; Olson et al. 2013).\n\nIn contrast, covert aggression is surreptitious and is exemplified by avoidance of direct confrontation, manifesting in behaviors such as stealing, cheating, vandalism, and lying; these behaviors are predictive of maladaptive aggression in adulthood (Olson et al. 2013; Connor 2017). Longitudinal data from the Oregon Youth Study, for example, showed significant intraindividual evolution in parent-rated covert antisocial behavior in boys over a 5-year period; boys who showed increases in covert antisocial behavior had relatively high levels of juvenile offenses and adult re-offense (Patterson et al. 2005; Olson et al. 2013).\n\nRelational aggression\nRelational aggression refers to the purposeful intent to harm another through social manipulation (Björkqvist et al. 1992; Connor 2002). Also known as indirect or social aggression (Archer and Coyne 2005), this subtype of aggression is predominant in females (Björkqvist et al. 1992; Connor 2002). Examples of relational aggression include intentional peer exclusion, sharing secrets, spreading rumors or gossip, and verbal bullying (which also shares characteristics with instrumental and predatory aggression) (Björkqvist et al. 1992; Connor 2002).\n\nSimple relational aggression is evident as early as age 3 (e.g., covering ears to ignore a peer), may become more complex in elementary/early middle school (e.g., excluding a peer), and becomes increasingly complex in adolescence (e.g., by use of social media) (Ostrov et al. 2004; Williams and Guerra 2007; Leff et al. 2010). The prevalence of relational aggression is considered moderately stable across early and middle childhood. Perpetrators tend to have additional problems, including adjustment and social processing difficulties, emotional arousal deficits, and reduction in perceived popularity.\n\nImpulsive aggression\nIA is a maladaptive form of aggression that is reactive and overt, and occurs outside of the acceptable social context (Jensen et al. 2007; Connor 2016). In contrast to the subtypes delineated above, which can be either adaptive or maladaptive depending on the context, IA is a maladaptive expression of aggression. Characteristics include sudden, intense aggression inappropriately expressed in relationship to environmental precipitants. The individual may have frequent aggressive episodes, difficulty terminating aggression, and remorse when the episode ends. IA can be identified early in development (Lansford 2018), and the presence of this type of behavior is predictive of diverse and persistent psychopathology (Tremblay et al. 2018). It can be conceptualized as an associated feature in numerous diagnoses (Connor and McLaughlin 2006; Jensen et al. 2007; Saylor and Amann 2016).\n\nIA has been reported to be elevated in ADHD, traumatic brain injury (TBI), autism spectrum disorder (ASD), dementia, borderline and antisocial personality disorders, psychosis, unipolar and bipolar affective disorders, substance use disorders, IED, and post-traumatic stress disorder (PTSD) (Jordan et al. 1992; Weisbrot and Ettinger 2002; Turgay 2004; Soyka 2011; American Psychiatric Association 2013; Freestone et al. 2013; Wood and Thomas 2013; Carroll et al. 2014; Ropper et al. 2014; Zhuo et al. 2014; Farmer et al. 2015; Connor et al. 2017).\n\nAlthough IA is likely the most common form of aggression in clinical populations, there are currently no diagnostic criteria for IA defined in the DSM-5 (American Psychiatric Association 2013; Saylor and Amann 2016). Furthermore, there is no therapeutic agent currently indicated for the treatment of IA, although development of a therapeutic agent for the treatment of IA in children and adolescents with ADHD is ongoing. Thus, at present, there is uncertainty on the diagnostic classification and treatment of IA (Robb et al. 2019).\n\nIn sum, maladaptive aggressive behavior can manifest in a myriad of ways and be subclassified for clinical and research purposes. However, some subtypes share common attributes and regularly co-occur.\n\nDevelopmental Aspects and the Neurobiology of Aggression\nAggression is a normal part of development displayed by most children (Connor 2002). It typically occurs at a higher frequency in boys than in girls (Connor 2002). Overt aggressive behaviors (e.g., pushing, shoving, hitting, kicking, and biting) in the service of obtaining desired objects (or protecting one's desired objects from others) are common among toddlers and peak between ages 3 and 4 years (Tremblay et al. 2018). These physical behaviors begin to decrease around 5–6 years of age, as development of verbal and interpersonal skills helps to moderate aggressive impulses and facilitate more socially acceptable activities (e.g., sports competition and academic achievement). With increasing cognitive development, verbal aggression (e.g., threats and insults), relational and indirect forms of aggression (e.g., excluding a peer and malicious gossip), and covert aggressive activities (e.g., lying and cheating) increase and become more socially complex (Ostrov et al. 2004; Williams and Guerra 2007; Leff et al. 2010).\n\nConsidering reactive IA subtypes, a study of a normative sample from mid-childhood to early adolescence (starting at 7 years of age and followed annually for 6 years) identified 4 trajectory groups of RA: high stable, moderate decreasing, low increasing, and low stable (Cui et al. 2016). Over the course of development into adulthood, there is a general decrease in overt, impulsive, and reactive forms of aggression (Lansford 2018).\n\nDiscussion of the developmental neurobiology of IA is complicated by a paucity of studies on specific subtypes of aggression. Most studies focus on the development of conduct problems, antisocial behaviors, CD, ODD, callous-unemotional (CU) personality traits, and/or generalized aggressive behaviors (Klahr and Burt 2014; Noordermeer et al. 2016; Salekin 2017; Bevilacqua et al. 2018; Huesmann 2018). Furthermore, mapping the mechanisms underlying antisocial and aggressive behavior is challenging, as the behaviors arise from a complex, nonuniform, dynamic, interactive, and nonlinear interplay of heritable, biological, and cognitive factors; neuropathology; early life experience; social context; and environmental risk and protective factors across development (Meyer and Lee 2019).\n\nThe very complexity of these factors and interactions leads to etiological models of aggression that are limited in their utility for the individual practitioner and in their usefulness to clinically predict individual differences in risk for maladaptive aggression across development.\n\nTo help elucidate these complexities, we present a selective and descriptive summary of heritable, neurobiological, and environmental factors that are important in the development of aggression. Given the scarcity of studies specifically focused on IA, we cite literature from a number of conduct and antisocial behavior studies as well as general aggression literature. We specifically discuss IA where evidence is available.\n\nHeritable factors\nA meta-analysis of twin and adoption studies reported a heritability of 65% for generalized aggressive behavior (Burt 2009). Shared environmental factors accounted for 5% and the nonshared environment accounted for 30% of the variance. Boys show higher heritability estimates than girls, especially during adolescence (Wang et al. 2013; Waltes et al. 2016). Different subtypes of aggression show different heritability estimates, with higher estimates for PA (32%–48%) than for IA (20%–43%) (Waltes et al. 2016). Developmental differences in heritability estimates are observed, as well, with the stability of preschool aggressive behaviors being mainly due to genetic factors and additional contributions from nonshared environmental factors identified as development proceeds (Lacourse et al. 2014). The strongest genetic findings on aggression stability were observed for PA (85%) compared to RA (48%) from school age to adolescence (Waltes et al. 2016).\n\nNeurobiology\nNeurobiological factors that are important in IA include the actions of the prefrontal cortex (PFC) and its reciprocal connections with mid-brain structures involved in the acute threat response system, including the amygdala, hypothalamus, and periaqueductal gray (PAG) (Blair 2016; Bartholow 2018). In turn, these regulate the hypothalamic-pituitary-adrenal (HPA) stress response system (Walker et al. 2018). The neural circuits that appear to control aggressive responding are not specialized for this purpose alone, but support more generalized cognitive functioning such as emotional reactivity, emotional regulation, and cognitive control (Fanning et al. 2017).\n\nBrain structures involved in the social behavior network include the anterior hypothalamic nucleus, ventromedial hypothalamus, medial amygdala, bilateral septum, PAG, and the bed nucleus of the stria terminalis (Bartholow 2018). PFC structures are thought to interact with the social-behavioral network by inhibiting or modulating their activation, allowing “top-down” control over aggressive responding (Fanning et al. 2017). A more nuanced view includes the role of the ventromedial PFC in providing information on the potential rewards and costs of future action, including aggressive responding, so that optimal response choice to environmental inputs may be achieved (Blair 2016).\n\nIn this model, IA may arise based on the recruitment of the acute threat response system, with concurrent hypofunctionality of the PFC (deficient top-down control) and enhanced cognitive expectation of reward with diminished expectations of consequence for aggressive behaviors (Rosell and Siever 2015; Blair 2016; Bartholow 2018).\n\nThe amygdala is a medial temporal lobe structure that plays an essential role in the integration of stimuli with sensory, emotional, and motivational relevance. Multiple neural connections between the amygdala and other CNS regions shape cognitive, affective, motor, and sympathetic nervous system responses to affectively and motivationally salient environmental stimuli (Rosell and Siever 2015). There exists much evidence supporting the involvement of the amygdala in fear conditioning and extinction (Marek et al. 2013), as well as in aggression (Sah 2017). For example, compared with controls, patients with maladaptive RA show increased amygdala responsiveness when exposed to threat stimuli (Blair 2010). Structural imaging studies support reduced amygdala volume, while facial expression studies indicate enhanced amygdala responsiveness in individuals with trait aggression (Rosell and Siever 2015). Imaging studies have been further consistent, with a hyporesponsive amygdala and impaired orbitofrontal cortical activity observed in psychopaths who are at risk for instrumental, proactive, and aggressive behaviors (Blair 2010). These findings suggest that overarousal of the amygdala and enhanced amygdala threat sensitivity (fear) may be associated with vulnerability to IA in a “bottom-up” model.\n\nThe striatum is composed of the caudate nucleus, putamen, and globus pallidus. The striatum integrates widespread and direct cortical inputs and modulates thalamocortical activity. As a result, the striatum plays an important role in the appropriate selection and regulation of motor, cognitive, and emotional response sequences (Rosell and Siever 2015). These structures are involved with aggressive responding through their role in goal-directed, motivational, and risk-reward information processing. These activities are modulated by the dopamine and serotonin systems, which together encode expected value and reward/risk of actions in response to environmental cues (Rosell and Siever 2015). This suggests that alterations in the functioning of the striatum may result in nonoptimized information concerning the rewards and/or consequences of IA responding.\n\nNeurotransmitter systems\nThe neurobiology of IA is complex, with many different neurotransmitters involved. One of the best-studied systems in the neurobiology of aggression is the serotonergic (5-HT) system. Strong preclinical and clinical data suggest the involvement of 5-HT receptor signaling and/or 5-HT metabolism and turnover in IA behaviors in humans (Yanowitch and Coccaro 2011; Coccaro et al. 2015; Rosell and Siever 2015).\n\nTwo hypotheses are proposed for the importance of the 5-HT system in IA. The first suggests that 5-HT stabilizes information flow in neural activity, thereby modulating reactivity to both internal and external stimuli. In this model, 5-HT serves to constrain behavior, indicating that a 5-HT deficit is associated with increased impulsivity (Spoont 1992). According to the second hypothesis, diminished net 5-HT neurotransmission leads to greater irritability, which is conceptualized as a lower threshold for responding to noxious stimuli in those with IA (Coccaro et al. 2015). Currently, 14 distinct 5-HT receptors are known and are grouped into seven main families, named 5-HT1 to 5-HT7 (Gothert 2013). 5-HT1B agonists, 5-HT2A antagonists, and 5-HT2C agonists may help modulate IA through effects on impulsive responding (Coccaro et al. 2015).\n\nThe dopaminergic (DA) system plays a role in aggression, given its involvement in decision making, reward salience, motivation, and executive cognitive functioning (including cognitive control) (Rosell and Siever 2015). For example, the DA system is involved in the pathophysiology and psychopharmacology of ADHD, a condition often associated with IA (Gadow et al. 2014). Although research on DA and IA is limited, adequate DA availability in frontal-cortical systems may support the cognitive enhancing effects of DA, while DA systems in the striatum modulate reward processing. This suggests that greater availability of DA may protect the individual against nonadvantageous, aggressive responses to environmental frustration or provocation (Rosell and Siever 2015). Currently, five DA receptors are known: D1, D2, D3, D4, and D5 (Wang et al. 2018). While the D2 receptor is the primary target for neuroleptics and atypical antipsychotics, the D4 receptor may also be important in aggression (Buchmann et al. 2014).\n\nIn addition to activating the acute threat response system and fight-or-flight mechanisms that play a key role in individual survival, norepinephrine (NE) also has important functions in the PFC—especially under stressful conditions. Preclinical studies have shown that during stress, high levels of circulating catecholamines rapidly impair the top-down cognitive functions of the PFC, while strengthening the activity of the amygdala and basal ganglia (Arnsten 2009). Traumatic stress exposure may lead to dendritic atrophy in the PFC, dendritic enrichment in the amygdala, and strengthening of the NE system (Arnsten et al. 2015). High levels of NE release during conditions of traumatic stress engage alpha-1 and beta-1 adrenoceptors, which reduce the firing of PFC neurons, but strengthen neuronal activity in the amygdala (Arnsten et al. 2015). For example, in cases of child abuse, this effect on neuronal activity may result in individual hypersensitivity to cues of threat from the environment and vulnerability to dysregulated IA behaviors (Ford et al. 2011).\n\nOther chemical and hormonal systems important in aggression include the neuropeptides arginine vasopressin (AVP) and oxytocin (OT), and the steroid hormones cortisol and testosterone. AVP has a role as a direct neuromodulator in the CNS and is thus important in the regulation of social behaviors. In preclinical research, direct administration of AVP into the hypothalamus of hamsters enhanced aggressive responding, while AVP antagonists attenuated aggression (Ferris et al. 1997). OT has an important role in the modulation of social behaviors such as affiliation, parental bonding and care of young, social communication, and anxiety-like behaviors (Kelly and Wilson 2019). Preclinical research has demonstrated an antiaggressive role for OT that appears to be complex and strongly influenced by neurobiological systems that also modulate anxiety and stress (Kelly and Wilson 2019). Cortisol and testosterone are steroid hormones that appear to influence aggression in an interdependent manner through the modulation of the amygdala's fear-or-threat neural circuits (Rosell and Siever 2015).\n\nEnvironmental factors\nHeritable and neurobiological vulnerabilities to aggressive responding appear to express themselves most strongly in permissive or threatening environments (Tremblay et al. 2018). Numerous studies of children show that aggression is associated with characteristics of the social environment.\n\nFor example, one longitudinal study on the early development of chronic physical aggression found that the association between antisocial parental behaviors and those of children begins early in life, between 17 and 42 months of age (Tremblay et al. 2004). This study showed that mothers of children who became chronically aggressive were often young at the time of the child's birth, living in poverty, functioning as a single parent, had not completed high school, had smoked during pregnancy, engaged in a coercive parenting style, and/or experienced depression as a mother (Tremblay et al. 2004, 2018). Thus, the child's heritable and neurobiological vulnerabilities may interact with a dysfunctional caregiving environment early in life, influencing development of a brain that has difficulties controlling emotions and behavior (Tremblay et al. 2018).\n\nAdverse traumatic childhood experiences, including severe stress, child abuse, and neglect, are additional potent risk factors for violent and aggressive behaviors in some individuals across the lifespan (McCrory et al. 2010; Bland et al. 2018). Studies indicate that experiencing maltreatment and adversity during early development may alter the neurobiological development and functioning of the HPA axis, hippocampus, amygdala, corpus callosum, and the PFC in ways that increase risk for psychopathology and altered threat responding, including IA (McCrory et al. 2010; Meyer and Lee 2019).\n\nClinical Diagnoses Associated with IA\nIA is an associated symptom of many psychiatric and neurologic disorders (Bambauer and Connor 2005; Connor and McLaughlin 2006; Connor 2017). Generally, associated IA does not denote a specific disorder, but is instead indicative of disorder severity. (Connor and McLaughlin 2006). Because disorders complicated by maladaptive aggression are numerous, in this study, we will focus on those that are most commonly observed in pediatric clinical settings.\n\nAttention-deficit/hyperactivity disorder\nAggression is common in children and adolescents with ADHD. In the hallmark Multimodal Treatment Study of Children with ADHD (MTA) study, for example, 54% of children with ADHD exhibited clinically significant aggression before treatment, with IA reported to be the predominant subtype (The MTA Cooperative Group 1999). In the MTA study, 26% of children whose symptoms were managed by ADHD medication exhibited persistent IA (The MTA Cooperative Group 1999; Jensen et al. 2007; Saylor and Amann 2016), demonstrating that ADHD management may not adequately address this behavior.\n\nDisruptive behavioral disorders\nAggression is commonly observed in children and adolescents with ODD and CD (Turgay 2004). For example, in a study of 129 children and adolescents referred for serious aggressive behavior, 93% were diagnosed with ODD and 38% with CD (Turgay 2004). CU traits, lack of remorse, and empathy deficits are all associated with increased risk for serious aggression, including the instrumental and proactive forms (Urben et al. 2018).\n\nBlader et al. (2013) evaluated whether CU traits attenuate stimulant monotherapy in children with ADHD. Specifically, the study evaluated remission of aggression (Retrospective-Modified Overt Aggression Scale [R-MOAS] score <15) in children with ADHD and aggressive behavior as well as concomitant ODD or CD after stimulant optimization. Approximately half of the treated patients exhibited remission of aggressive behavior. However, neither CU traits nor PA was predictive of remission in children with ADHD and ODD/CD. These results suggest that even in children with PA, first-line treatment with ADHD medication is warranted, and may reduce aggression in some patients.\n\nMood disorders\nAlthough aggression was historically recognized as a way of expressing depressed mood, our understanding of mood disorders has expanded to view aggression as a co-occurring feature of the primary mood disorder. Irritability has long been seen as a symptom of depressive episodes, including the diagnosis of DMDD (Winters et al. 2018). However, aggressive behaviors—such as temper tantrums, destruction of property, and assaultive behavior—have also been observed in mixed and manic states in children with bipolar disorder (Weisbrot and Ettinger 2002; Connor et al. 2017). A study of 685 adults showed that subjects with bipolar disorder (I and II) exhibit more impulsivity and aggression/hostility over the course of their lifetimes than those with unipolar depression (Dervic et al. 2015). However, when specifically evaluating affective temperament and aggression in the euthymic state, few differences were observed (Dolenc et al. 2015), suggesting that aggression is a state-dependent, rather than a persistent, trait. Thus, differential diagnosis of irritability and aggression within mood disorder populations is essential for planning treatment and tracking response (de Aguiar Ferreira et al. 2014).\n\nSchizophrenia and psychosis\nPsychosis is present in several disorders, including—but not limited to—schizophrenia and bipolar disorder (Khushu and Powney 2016). Although the majority of patients with psychosis are not aggressive, there is evidence of increased aggression and violence during psychotic episodes (Soyka 2011). Aggression is particularly common during first-episode psychosis, with the prevalence of violent acts estimated at 31% (16% of this patient population demonstrated “serious” aggression) (Winsper et al. 2013). Over a longer course of illness, the Danish National Birth Cohort study showed that men and women with schizophrenia demonstrated a greater likelihood of committing violent crime (odds ratios of 4.6 and 23.2, respectively) compared with normal controls (Brennan et al. 2000).\n\nASD and intellectual disability\nAggression is more prevalent in patients with ASD than in the general population (Carroll et al. 2014; Farmer et al. 2015). A 2014 study categorized children with ASD into five aggressive behavioral subtypes: “hot” aggression only, “cold” aggression only, SIB only, aggression and SIB, and nonaggressive behavior (Carroll et al. 2014), suggesting that the canonical subtypes of RA and PA exist in children with ASD. Gender strongly influences aggression in children with ASD: when subjected to an aggressive attack, boys with ASD have been shown to react more aggressively than control subjects, whereas girls with ASD react less aggressively. Farmer et al. (2015) compared the frequency and types of aggressive behavior in a clinically ascertained sample of children with ASD to a sample of clinic-referred children with a range of psychiatric disorders. Neither group was selected for aggression. Based on parent reports, children with ASD demonstrated less aggressive behavior than children clinically referred for behavioral/psychological problems without ASD. The aggression in children with ASD was more likely to be reactive than proactive (Farmer et al. 2015).\n\nChildren with intellectual disability (ID) also have an increased prevalence of IA behavior. In a 15–18-month longitudinal study of 417 children with severe ID, aggression was present in 68% of the subjects, as assessed by teachers (Davies and Oliver 2016). Impulsivity was significantly associated with aggression in these children, as well.\n\nPost-traumatic stress disorder\nMaladaptive aggression has consistently been shown to co-occur with PTSD (Jordan et al. 1992). This association appears to be largely driven by the hyperarousal cluster of symptoms evident in PTSD and/or information processing deficits (Weber 2008).\n\nTourette's syndrome\nReports show that behavioral problems, including maladaptive aggression, occur in ∼23%–40% of the population with Tourette's syndrome (TS) (Budman et al. 1998; Ropper et al. 2014; Kumar et al. 2016). Based on clinical reports, aggressive behaviors in patients with TS are characterized by rage attacks, which are episodic and explosive in nature (Budman et al. 1998; Kumar et al. 2016). These outbursts may be larger in magnitude than common temper tantrums and are associated with autonomic activation (hyperarousal) and subsequent loss of control.\n\nEpilepsy (ictal, peri-ictal, and post-ictal periods)\nApproximately 30% of patients newly diagnosed with epilepsy and ∼50% of patients with treatment-resistant epilepsy have psychiatric disorders, cognitive impairment, and social difficulties (Lin et al. 2012; Brodie et al. 2016). Although the evidence is scarce, available data suggest that aggression occurs in ∼4%–7% of patients with epilepsy (Brodie et al. 2016). Most aggressive incidents occur during the post-ictal period (Brodie et al. 2016).\n\nTraumatic brain injury\nAggression is frequent following TBI. One framework that may be useful for distinguishing the type of aggression following TBI in clinical practice is to categorize it as either impulsive or episodic aggression, distinguished by the time of onset and the location of the injury (Wood and Thomas 2013; Ropper et al. 2014). In patients with TBI, IA tends to occur in the acute period postinjury and may be associated with confusion and compromised problem solving. TBI often involves damage to the orbital and medial PFC, negatively affecting regulation of the amygdala. In the chronic phases of TBI, aggression is more commonly “episodic,” which, together with IA, may be grouped under the heading of IED (as per the DSM-5). Individuals with TBI exhibit seemingly sporadic mood swings, sometimes described as a “Jekyll and Hyde” phenomenon that has been associated with electric disturbances in the temporal lobe (Wood and Thomas 2013).\n\nEvaluation of Aggression in the Clinical Setting\nGuidelines for the clinical management of early-onset maladaptive aggression and IA highlight the need for thorough, systematic characterization and diagnostic evaluation of the aggressive behavior before initiating treatment (Fig. 2) (Knapp et al. 2012; Felthous and Stanford 2015). Evaluation can be considered in three steps. Step one involves recognition of maladaptive aggression. Adaptive aggression, which generally has clear and understandable objectives, does not require biomedical intervention. Maladaptive aggression requires intervention that may include psychopharmacological treatment. Assessment of contextual factors (e.g., family, school, peer group, or neighborhood) that may trigger or maintain maladaptive aggression is fundamental to treatment planning.\n\nFIG. 2. Decision-making algorithm for the assessment of aggression in clinically referred children and adolescents (Connor 2002; Connor et al. 2006; Conduct Problems Prevention Research Group 2011; Henggeler and Sheidow 2012; Dodge et al. 2015; Gurnani et al. 2016).\n\nFollowing identification of maladaptive aggression, step two is to consider a psychiatric or neurological diagnosis for which maladaptive aggression is an accompanying symptom. Step three is to identify the maladaptive aggression subtype, which may guide the treatment approach. Predominantly hostile, predatory, and instrumental aggression subtypes require therapies that emphasize family intervention, behavioral treatments, cognitive behavioral therapies (CBTs), environmental monitoring, and multisystemic interventions. Aggression that is predominantly impulsive, reactive, and affective may require adjunctive pharmacotherapy, in addition to the above interventions (Connor et al. 2006).\n\nTreatment of Aggression\nMultiple evidence-based, multisystemic treatments for aggression, antisocial behavior, and CD have been investigated and deemed effective, including Multisystemic Therapy (MST) (Henggeler and Schaeffer 2016) and the North Carolina FAST Track program (Conduct Problems Prevention Research Group 2011). These studies did not distinguish the form or function of aggressive behavior and generally report on more generalized overt aggression, conduct problems, and antisocial behaviors.\n\nMST is a family- and community-based intervention originally developed for juvenile offenders. More recently, it has been adapted for a range of serious externalizing problems, including violent offending and juvenile substance abuse (Zajac et al. 2015). Because of the multidetermined nature of youth antisocial behaviors, MST targets concurrent risk factors at the level of the individual, family, school, and community. Outcomes on externalizing behavior are reported, but not IA specifically. Currently, 11 randomized trials and eight studies in youths with CD support the efficacy of MST (Zajac et al. 2015).\n\nThe Fast Track program interventions include parental management training, social skills training, and a universal classroom curriculum, all of which target a variety of risk factors for the development of conduct problems. Ten-year outcomes reveal reduced risk for youth antisocial outcomes compared to a nonintervention group (Pasalich et al. 2016). Specific outcomes on IA are not reported, however.\n\nRecent reviews of psychosocial interventions and psychopharmacology for aggression are available to assist the clinician. For children and adolescents, the Treatment of Maladaptive Aggression in Youth (T-MAY), the Treatment Recommendations for the Use of Antipsychotics for Aggressive Youth (TRAAY), and the Antisocial Behaviour and Conduct Disorders in Children and Young People: Recognition and Management National Institute for Health and Care Excellence (NICE) guidelines provide recommendations for physicians on the treatment of maladaptive aggression (Pappadopulos et al. 2003; Knapp et al. 2012; Scotto Rosato et al. 2012; National Institute for Health and Care Excellence 2013).\n\nIA is the most common aggression subtype seen in clinical practice (Saylor and Amann 2016). As such, the remainder of the symptom management discussion will focus on IA. Management of IA requires a personalized, multifactorial approach (Connor 2002). First-line therapy should include psychosocial interventions, adding pharmacological interventions if the former fail to curtail symptoms. Because IA often arises in the context of other diagnoses, the T-MAY and TRAAY guidelines recommend that treatment focuses on the primary disorder rather than IA (Pappadopulos et al. 2003; Scotto Rosato et al. 2012).\n\nWhen aggression is particularly severe, however, it may be necessary to initiate treatment with antiaggression agents concurrent with the treatment for the primary condition (Scotto Rosato et al. 2012). Furthermore, guidelines indicate that routine use of validated scales to measure severity of aggressive symptoms is essential for accurate evaluation and treatment optimization over time (Pappadopulos et al. 2003). The T-MAY and NICE guidelines also emphasize the importance of engaging family and community in treatment programs (Scotto Rosato et al. 2012; National Institute for Health and Care Excellence 2013).\n\nPsychosocial interventions\nEvidence-based psychosocial interventions for the treatment of maladaptive aggression, including IA, should be incorporated in a comprehensive treatment plan throughout all phases of care (Pappadopulos et al. 2003; Jensen et al. 2007; Knapp et al. 2012; Scotto Rosato et al. 2012; Gurnani et al. 2016). Psychosocial interventions include empirically supported, family-based interventions, patient-oriented techniques (such as social skills, visual and auditory interventions for those with limited language, and conflict-resolution training), parent training (e.g., reinforcing positive interactions and improving discipline strategies), teacher training (e.g., classroom management strategies), and programs targeting core deficits (Webster-Stratton et al. 2004, 2008; Kim et al. 2008; Henggeler and Sheidow 2012; Knapp et al. 2012; Maglione et al. 2012; Bearss et al. 2015).\n\nPsychotherapy treatment approaches generally do not distinguish between types of aggression, and focus more generally on addressing physical aggression, verbal aggression, or externalizing behaviors. Core deficits targeted include anger, delay aversion, hostile attribution biases, impulsivity, emotional overarousal, and poor frustration tolerance (Sukhodolsky and Scahill 2012; Lee and DiGiuseppe 2018). To date, specific treatment approaches for IA, compared with more generalized aggression, have not been reported.\n\nFossum et al. (2008) conducted a meta-analysis of the literature evaluating the effects of psychosocial interventions on disruptive or aggressive behavior in children and adolescents, confirming the moderate positive effects of psychosocial interventions on maladaptive aggression. This is further supported by a more recent meta-analysis that also demonstrated moderate effects of psychological treatment in reducing parent-, teacher-, and observer-rated behavioral problems in children and adolescents with CD. A further review of meta-analyses aimed at evaluating the effects of CBT on anger control problems and aggression reported that CBT is moderately effective in reducing anger and aggression, compared to the smaller effects of other psychosocial interventions evaluated (Del Vecchio and O'Leary 2004; Saini 2009; Hofmann et al. 2012). These approaches are recommended as the primary modality of aggression management, as they have been demonstrated to be moderately effective in reducing aggressive behavior in controlled studies, with a low risk of adverse effects (Knapp et al. 2012).\n\nPharmacological treatment\nIf psychosocial interventions are not sufficient to reduce IA, adjunctive pharmacological treatment is recommended (Fig. 2). As summarized above, the currently recommended strategy is to treat the primary disorder first (using monotherapy when possible), in conjunction with continuing psychosocial interventions (Khan et al. 2019). Psychopharmacological research specifically focused on aggression subtypes such as IA remains scarce.\n\nMany more studies are available on the psychopharmacological treatment of aggression-related diagnoses such as CD (Hambly et al. 2016), ODD (Pringsheim et al. 2015), and ADHD-related disruptive behavior disorders (Newcorn et al. 2005). For example, the Treatment Of Severe Childhood Aggression (TOSCA) study found a moderate effect size (ES) for risperidone versus placebo when added to optimized stimulant and ongoing parent management training in children with ADHD and CD, and/or ODD (Gadow et al. 2014). Other studies have examined the effects of psychopharmacology on generalized childhood overt aggression (Pappadopulos et al. 2006). Despite a growing pediatric psychopharmacological research base on aggression-related diagnoses and constructs, however, few studies have specifically investigated aggression subtypes such as IA.\n\nA review of the literature from 1980 to 2005 revealed 45 randomized, controlled trials that addressed the treatment of generalized overt aggression. Overall, the ES for psychiatric medications in treating aggression was 0.56. Larger effects were noted for stimulants (ES = 0.9), atypical antipsychotics (ES = 0.9), and typical antipsychotics (ES = 0.7). Lesser effects were noted in clinical trials assessing the effectiveness of antidepressants and mood stabilizers in treating maladaptive aggression (Pappadopulos et al. 2006). For treatment of irritability in patients with ASD, the only currently FDA-approved treatments are risperidone and aripiprazole (Carroll et al. 2014).\n\nAntipsychotic use in children and adolescents has increased, in part, due to their off-label use in the treatment of maladaptive aggression and conduct problems (Kalverdijk et al. 2017). Despite this increase, there are no FDA-approved treatments for the management of IA, and there is limited information on the management of IA in patients with psychiatric and neurological disorders. In the interim, IA is increasingly treated with off-label atypical antipsychotics (Olfson et al. 2015). This is a source of growing concern, due to the potential long-term adverse effects of antipsychotic use, including weight gain and cardiometabolic dysfunction (Olfson et al. 2015; Scahill et al. 2016). This issue underscores the need for improving treatment options for patients with IA (Gurnani et al. 2016).\n\nSPN-810, an extended-release formulation of molindone, is currently in development as a novel treatment for IA in patients with ADHD when taken in conjunction with standard ADHD treatment. A Phase 2a proof-of-concept study with immediate-release molindone demonstrated improvements in disruptive/aggressive behaviors in children with ADHD and persistent, serious conduct problems (Stocks et al. 2012). In a Phase 2b study in children with ADHD and refractory IA, SPN-810 use resulted in significant improvement from baseline in the R-MOAS versus placebo (p < 0.05) (Brittain et al. 2015). In this study, SPN-810 was generally well tolerated, with the most frequent adverse events being headache, sedation, and increased appetite.\n\nPhase 3 trials with SPN-810 are ongoing (Brittain et al. 2015). Although the specific mechanism by which SPN-810 exerts effects on IA is presently unknown, emerging data suggest it functions as a D2-receptor antagonist and serotonin 5-HT2B antagonist. In theory, these actions may help modulate impairments in decision making associated with hypothesized reduced frontal-cortical control of top-down information processing, which in turn may help regulate a disinhibited threat response neural network (Robb et al. 2019).\n\nDiscussion\nProgress in research and treatment will benefit from the development and application of consensus-driven definitions. We propose that IA is an important clinical concept because it (1) is an identifiable construct (Bambauer and Connor 2005; Raine et al. 2006); (2) appears as a similar construct across multiple common child and adolescent psychiatric diagnoses (Jensen et al. 2007); (3) appears to be measurable in the clinical setting (Jensen et al. 2007); (4) is highly correlated with symptom severity across multiple psychiatric diagnoses (Connor and McLaughlin 2006); (5) has an identifiable neurobiology that appears distinct from other forms of serious aggression such as proactive and instrumental forms of aggression, and the CU personality traits linked to psychopathy and severe CD (Blair 2016); and (6) appears more medication responsive than predatory, instrumental forms of aggression (Blader et al. 2013; Gurnani et al. 2016).\n\nWe have defined the terms maladaptive aggression and IA as having distinct meanings. We have also identified IA as a subset of maladaptive aggression, and highlighted interventions that might be required, depending on clinical presentation. Given growing concerns about off-label prescribing of psychiatric medications—especially atypical antipsychotics—to children and adolescents with aggressive behavior, the construct of IA may serve to focus pediatric psychopharmacology on an aggression subtype that is more responsive to medication (Pappadopulos et al. 2006).\n\nHowever, the presented taxonomy of aggression is not without limitations. Although aggression subtypes may appear distinct at the variable level, they frequently co-occur at the patient level. Consequently, clinicians are faced with the dilemma of evaluating and treating a complex behavior with overlapping attributes. Increased agreement on the definition of maladaptive aggression (versus adaptive aggressive behaviors) and subtypes such as IA that may respond to medications can promote a better starting place for thoughtful, safe, and effective pharmacotherapy in children and adolescents. Identifying the boundaries between subtypes of aggression may also inform future research.\n\nControversies in the field remain to be addressed. For example, it is presently unclear if IA would best be clinically considered a categorical DSM-5 diagnosis such as IED (Coccaro et al. 2015) or a dimensional phenomenon such as the assessment of fever or pain in the medical-surgical setting (Raine et al. 2006). Furthermore, it is also unclear if IA should be addressed as a measurable symptom complex independent of diagnosis (similar to the measurement of fever/pain), or if it should be studied principally within well-defined diagnostic groups such as ADHD, bipolar disorder, psychotic disorders, ASD, and depression (Jensen et al. 2007).\n\nThe latter approach would be congruent with current expert consensus guidelines to facilitate recognizing clear indicators of treatment efficacy during randomized controlled trials (Jensen et al. 2007). This view is also supported by the FDA, given the recent designation of fast-track status for SPN-810 in the treatment of IA (United States Securities and Exchange Commission 2015; United States Securities and Exchange Commission 2016), illustrating the importance of treating this condition and addressing this unmet pharmacotherapy need (Robb et al. 2019).\n\nConclusions\nFurther research should focus on better methods of assessing IA in the clinical setting. The validation of self- and observer-reported rating scales for the IA construct is an important first step to help address some of the issues raised above. Better methods for identifying IA will facilitate neuroimaging and neurobiological studies of the construct. This, in turn, may lead to more scientifically informed clinical research and facilitate evidence-based psychosocial and psychopharmacological interventions for IA.\n\nClinical Significance\nIA is expressed in many psychiatric and neurological disorders and is a common problem seen by clinicians in everyday practice. Several types of interventions for aggression are possible, based on its clinical presentation. In this article, we have defined the terms “maladaptive aggression” and “IA” as distinct constructs that may warrant different treatment approaches. We believe that the application of these definitions in clinical practice will facilitate the proper identification and treatment of IA.\n\nSupplementary Material\nSupplemental data\n Acknowledgment\nWe thank Bernd Schmidt, MD, PhD, and Shawn A. Candler, MD, for their guidance.\n\nDisclosures\nD.F. Connor reports the following: Supernus Pharmaceuticals, Inc. (consultant) and Shire Pharmaceuticals (grant).\n\nJ.H. Newcorn reports the following: Akili Interactive (consultant); Alcobra (consultant); Arbor (consultant); Cingulate Therapeutics (consultant); Enzymotec (consultant and research support); KemPharm (consultant); Lundbeck (consultant and research support); Medice (consultant); NLS Pharma (consultant); Pfizer (consultant); Rhodes (consultant); Shire (consultant and research support); Sunovion (consultant); and Supernus Pharmaceuticals, Inc. (consultant).\n\nK.E. Saylor reports the following: Supernus Pharmaceuticals, Inc. (consultant); Neurovance (consultant); Alcobra (consultant); Eli Lilly (consultant); Otsuka (consultant); Purdue (consultant); and Shire Pharmaceuticals (consultant).\n\nB.H. Amann reports the following: Ironshore Pharmaceuticals & Development, Inc., Purdue Pharma L.P., Akili Interactive, Tris Pharma, Inc., Rhodes Pharmaceuticals L.P., Neos Therapeutics, Inc., Takeda Pharmaceuticals, Inc., Lundbeck, Inc., Otsuka Pharmaceutical Co. Ltd., Shire Plc, and Supernus Pharmaceuticals, Inc.\n\nL. Scahill reports the following: American Psychological Association (royalties); Department of Defense (research support); Guilford Press (royalties); Janssen (consultant); National Institutes of Health (research support); Neurocrine (consultant); Oxford Press (royalties); Roche (consultant); Shire (consultant); Supernus Pharmaceuticals, Inc. (consultant); Teva (consultant); and Yamo (consultant).\n\nA.S. Robb reports the following: Actavis/Forest Laboratories (consultant, research support, and travel support); Aevi Genomic Medicine, Inc. (data safety monitoring board); AACAP (honorarium and travel support); AAP (honorarium, travel support); Bracket (consultant); Case Western Reserve (honorarium and travel support); Child and Adolescent Psychiatric Society of Greater Washington (honorarium); College of Neurologic and Psychiatric Pharmacists (honorarium and travel support); Eli Lilly (royalties); GlaxoSmithKline (royalties); Guilford Press (royalties); Johnson & Johnson (royalties); Lundbeck/Takeda (advisor, research support, and travel support); Neuronetics (data safety monitoring board); Neuroscience Education Institute (honorarium and travel support); Nevada Psychiatric Association (honorarium and travel support); National Center for Advancing Translational Sciences (research support); NICHD (advisor); NIMH (data safety monitoring board); NINDS (research support); NACCME (honorarium and travel support); Pfizer, Inc. (research support, stock/equity, and travel support); Sunovion Pharmaceuticals, Inc. (advisor and travel support); Supernus Pharmaceuticals, Inc. (research support); SyneuRx (research support); and University of Cambridge (advisor).\n\nP.S. Jensen reports the following: REACH Institute (board member, travel support); Guilford Press (royalties); APPI (royalties); Random House (royalties); Oxford Press (royalties); CATCH Services, LLC (shareholder); Ironshore Pharmaceuticals & Development, Inc. (consultant); and Shire Pharmaceuticals (consultant and grant).\n\nB. Vitiello reports the following: Medice (consultant) and Teva Pharmaceutical Industries (consultant).\n\nR.L. Findling reports the following: Aevi Genomic Medicine (research support and consultant); Akili (research support, consultant); Alcobra Pharma (research support and consultant); AACAP (speaker's bureau); Amarex Clinical Research (consultant); American Psychiatric Press (royalties); Bracket (consultant); ePharmaSolutions (consultant); Forest Laboratories, Inc. (research support); Genentech (consultant); Guilford Press (consultant); Ironshore Pharmaceuticals & Development, Inc. (consultant); KemPharm, Inc. (consultant); Lundbeck, Inc. (research support and consultant); Merck & Co., Inc. (consultant); National Institutes of Health (research support and consultant); Neurim Pharmaceuticals, Inc. (research support and consultant); Nuvelution Pharmaceuticals (consultant); Otsuka America Pharmaceutical, Inc. (consultant); PCORI (research support); Pfizer, Inc. (research support); Physicians Postgraduate Press (consultant); Purdue Pharma L.P. (research support); Roche (research support); Sage Therapeutics (royalties); Shire (research support); Sunovion Pharmaceuticals, Inc. (research support, consultant); Supernus Pharmaceuticals, Inc. (research support and consultant); SyneuRx (research support); Teva Pharmaceutical Industries Ltd. (consultant); TouchPoint (consultant); Tris Pharma, Inc. (consultant); and Validus Pharmaceuticals LLC (research support and consultant).\n\nJ.K. Buitelaar reports the following: Janssen Cilag BV (consultant, advisory board member, and/or speaker); Eli Lilly (consultant, advisory board member, and/or speaker); Lundbeck (consultant, advisory board member, and/or speaker); Shire (consultant, advisory board member, and/or speaker); Roche (consultant, advisory board member, and/or speaker); Medice (consultant, advisory board member, and/or speaker); Novartis (consultant, advisory board member, and/or speaker); Servier (consultant, advisory board member, and/or speaker); Roche (research support); and Vifor (research support).\n\nSupplementary Material\nSupplementary Data\n\nSupplementary Table S1\n==== Refs\nReferences\nAmerican Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders , 5th ed. Washington, DC : American Psychiatric Publishing ; 2013 \nArcher J and Coyne SM : An integrated review of indirect, relational, and social aggression . Pers Soc Psychol Rev \n9 :212 –230 , 2005 16083361 \nArnsten AF , Raskind MA , Taylor FB , Connor DF : The effects of stress exposure on prefrontal cortex: Translating basic research into successful treatments for post-traumatic stress disorder . Neurobiol Stress \n1 :89 –99 , 2015 25436222 \nArnsten AF : Stress signalling pathways that impair prefrontal cortex structure and function . Nat Rev Neurosci \n10 :410 –422 , 2009 19455173 \nBambauer KZ , Connor DF : Characteristics of aggression in clinically referred children . CNS Spectr \n10 :709 –718 , 2005 16142211 \nBartholow BD : The aggressive brain: Insights from neuroscience . Curr Opin Psychol \n19 :60 –64 , 2018 29279225 \nBearss K , Johnson C , Smith T , Lecavalier L , Swiezy N , Aman M , McAdam DB , Butter E , Stillitano C , Minshawi N , Sukhodolsky DG , Mruzek DW , Turner K , Neal T , Hallett V , Mulick JA , Green B , Handen B , Deng Y , Dziura J , Scahill L : Effect of parent training vs parent education on behavioral problems in children with autism spectrum disorder: A randomized clinical trial . JAMA \n313 :1524 –1533 , 2015 25898050 \nBevilacqua L , Hale D , Barker ED , Viner R : Conduct problems trajectories and psychosocial outcomes: A systematic review and meta-analysis . Eur Child Adolesc Psychiatry \n27 :1239 –1260 , 2018 28983792 \nBjörkqvist K , Österman K , Kaukiainen A : The development of direct and indirect aggressive strategies in males and females . In: Of Mice and Women: Aspects of Female Aggression . Edited by Björkqvist K , Niemelä P \nSan Diego, CA , Academic Press ; 1992 , pp. 51 –64 \nBlader JC , Pliszka SR , Jensen PS , Schooler NR , Kafantaris V : Stimulant-responsive and stimulant-refractory aggressive behavior among children with ADHD . Pediatrics \n126 :e796 –e806 , 2010 20837589 \nBlader JC , Pliszka SR , Kafantaris V , Foley CA , Crowell JA , Carlson GA , Sauder CL , Margulies DM , Sinha C , Sverd J , Matthews TL , Bailey BY , Daviss WB : Callous-unemotional traits, proactive aggression, and treatment outcomes of aggressive children with attention-deficit/hyperactivity disorder . J Am Acad Child Adolesc Psychiatry \n52 :1281 –1293 , 2013 24290461 \nBlair RJ : Neuroimaging of psychopathy and antisocial behavior: A targeted review . Curr Psychiatry Rep \n12 :76 –82 , 2010 20425314 \nBlair RJ : The neurobiology of impulsive aggression . J Child Adolesc Psychopharmacol \n26 :4 –9 , 2016 26465707 \nBland VJ , Lambie I , Best C : Does childhood neglect contribute to violent behavior in adulthood? A review of possible links . Clin Psychol Rev \n60 :126 –135 , 2018 29454475 \nBrennan PA , Mednick SA , Hodgins S : Major mental disorders and criminal violence in a Danish birth cohort . Arch Gen Psychiatry \n57 :494 –500 , 2000 10807490 \nBrittain ST , Stocks JD , Johnson JK , Liranso T , Findling RL : Extended-release molindone (SPN-810) as adjunctive therapy in the management of impulsive aggression in children with attention deficit hyperactivity disorder (ADHD) receiving optimized stimulant monotherapy and behavioral therapy . San Antonio, TX : American Academy of Child and Adolescent Psychiatry. Poster Presentation , 2015 \nBrodie MJ , Besag F , Ettinger AB , Mula M , Gobbi G , Comai S , Aldenkamp AP , Steinhoff BJ : Epilepsy, antiepileptic drugs, and aggression: An evidence-based review . Pharmacol Rev \n68 :563 –602 , 2016 27255267 \nBuchmann AF , Zohsel K , Blomeyer D , Hohm E , Hohmann S , Jennen-Steinmetz C , Treutlein J , Becker K , Banaschewski T , Schmidt MH , Esser G , Brandeis D , Poustka L , Zimmermann US , Laucht M : Interaction between prenatal stress and dopamine D4 receptor genotype in predicting aggression and cortisol levels in young adults . Psychopharmacology (Berl) \n231 :3089 –3097 , 2014 24553580 \nBudman CL , Bruun RD , Park KS , Olson ME : Rage attacks in children and adolescents with Tourette's disorder: A pilot study . J Clin Psychiatry \n59 :576 –580 , 1998 9862602 \nBurt SA : Are there meaningful etiological differences within antisocial behavior? Results of a meta-analysis . Clin Psychol Rev \n29 :163 –178 , 2009 19193479 \nBushman BJ , Anderson CA : Is it time to pull the plug on the hostile versus instrumental aggression dichotomy? \nPsychol Rev \n108 :273 –279 , 2001 11212630 \nBuss A , Warren W : Aggression Questionnaire . Los Angeles, CA , Western Psychological Services , 2000 \nBuss AH , Perry M : The aggression questionnaire . J Pers Soc Psychol \n63 :452 –459 , 1992 1403624 \nCarroll D , Hallett V , McDougle CJ , Aman MG , McCracken JT , Tierney E , Arnold LE , Sukhodolsky DG , Lecavalier L , Handen BL , Swiezy N , Johnson C , Bearss K , Vitiello B , Scahill L : Examination of aggression and self-injury in children with autism spectrum disorders and serious behavioral problems . Child Adolesc Psychiatr Clin N Am \n23 :57 –72 , 2014 24231167 \nCoccaro EF , Fanning JR , Phan KL , Lee R \nSerotonin and impulsive aggression . CNS Spectr \n20 :295 –302 , 2015 25997605 \nCollett BR , Ohan JL , Myers KM : Ten-year review of rating scales. VI: Scales assessing externalizing behaviors . J Am Acad Child Adolesc Psychiatry \n42 :1143 –1170 , 2003 14560165 \nConduct Problems Prevention Research Group : The effects of the fast track preventive intervention on the development of conduct disorder across childhood . Child Dev \n82 :331 –345 , 2011 21291445 \nConnor DF , Carlson GA , Chang KD , Daniolos PT , Ferziger R , Findling RL , Hutchinson JG , Malone RP , Halperin JM , Plattner B , Post RM , Reynolds DL , Rogers KM , Saxena K , Steiner H , Stanford/Howard/AACAP Workgroup on Juvenile Impulsivity and Aggression : Juvenile maladaptive aggression: A review of prevention, treatment, and service configuration and a proposed research agenda . J Clin Psychiatry \n67 :808 –820 , 2006 16841631 \nConnor DF , Ford JD , Pearson GS , Scranton VL , Dusad A : Early-onset bipolar disorder: Characteristics and outcomes in the clinic . J Child Adolesc Psychopharmacol \n27 :875 –883 , 2017 28829159 \nConnor DF , McLaughlin TJ : Aggression and diagnosis in psychiatrically referred children . Child Psychiatry Hum Dev \n37 :1 –14 , 2006 16779500 \nConnor DF : Aggression and Antisocial Behavior in Children and Adolescents: Research and Treatment . New York, NY , The Guilford Press , 2002 \nConnor DF : Aggressive and antisocial behavior . In: The Cambridge Encyclopedia of Child Development . Edited by Hopkins B , Geangu E , Linkenauger W \nCambridge, UK , Cambridge University Press , 2017 , pp. 443 –448 \nConnor DF : On the challenge of maladaptive and impulsive aggression in the clinical treatment setting . J Child Adolesc Psychopharmacol \n26 :2 –3 , 2016 26835875 \nCui L , Colasante T , Malti T , Ribeaud D , Eisner MP : Dual trajectories of reactive and proactive aggression from mid-childhood to early adolescence: Relations to sensation seeking, risk taking, and moral reasoning . J Abnorm Child Psychol \n44 :663 –675 , 2016 26370547 \nDavies LE , Oliver C : Self-injury, aggression and destruction in children with severe intellectual disability: Incidence, persistence and novel, predictive behavioural risk markers . Res Dev Disabil \n49–50 :291 –301 , 2016 \nde Aguiar Ferreira A , Vasconcelos AG , Neves FS , Correa H : Affective temperaments and antidepressant response in the clinical management of mood disorders . J Affect Disord \n155 :138 –141 , 2014 24215897 \nDel Vecchio T , O'Leary KD : Effectiveness of anger treatments for specific anger problems: A meta-analytic review . Clin Psychol Rev \n24 :15 –34 , 2004 14992805 \nDervic K , Garcia-Amador M , Sudol K , Freed P , Brent DA , Mann JJ , Harkavy-Friedman JM , Oquendo MA : Bipolar I and II versus unipolar depression: Clinical differences and impulsivity/aggression traits . Eur Psychiatry \n30 :106 –113 , 2015 25280430 \nDodge KA , Malone PS , Lansford JE , Sorbring E , Skinner AT , Tapanya S , Tirado LM , Zelli A , Alampay LP , Al-Hassan SM , Bacchini D , Bombi AS , Bornstein MH , Chang L , Deater-Deckard K , Di Giunta L , Oburu P , Pastorelli C : Hostile attributional bias and aggressive behavior in global context . Proc Natl Acad Sci U S A \n112 :9310 –9315 , 2015 26170281 \nDolenc B , Dernovsek MZ , Sprah L , Tavcar R , Perugi G , Akiskal HS : Relationship between affective temperaments and aggression in euthymic patients with bipolar mood disorder and major depressive disorder . J Affect Disord \n174 :13 –18 , 2015 25474481 \nFanning JR , Keedy S , Berman ME , Lee R , Coccaro EF : Neural correlates of aggressive behavior in real time: A review of fMRI studies of laboratory reactive aggression . Curr Behav Neurosci Rep \n4 :138 –150 , 2017 29607288 \nFarmer C , Butter E , Mazurek MO , Cowan C , Lainhart J , Cook EH , DeWitt MB , Aman M : Aggression in children with autism spectrum disorders and a clinic-referred comparison group . Autism \n19 :281 –291 , 2015 24497627 \nFelthous AR , Stanford MS : A proposed algorithm for the pharmacotherapy of impulsive aggression . J Am Acad Psychiatry Law \n43 :456 –467 , 2015 26668223 \nFerris CF , Melloni RH Jr. , Koppel G , Perry KW , Fuller RW , Delville Y : Vasopressin/serotonin interactions in the anterior hypothalamus control aggressive behavior in golden hamsters . J Neurosci \n17 :4331 –4340 , 1997 9151749 \nFord JD , Wasser T , Connor DF : Identifying and determining the symptom severity associated with polyvictimization among psychiatrically impaired children in the outpatient setting . Child Maltreat \n16 :216 –226 , 2011 21493616 \nFossum S , Handegard BH , Martinussen M , Morch WT : Psychosocial interventions for disruptive and aggressive behaviour in children and adolescents: A meta-analysis . Eur Child Adolesc Psychiatry \n17 :438 –451 , 2008 18427863 \nFreestone M , Howard R , Coid JW , Ullrich S : Adult antisocial syndrome co-morbid with borderline personality disorder is associated with severe conduct disorder, substance dependence and violent antisociality . Personal Ment Health \n7 :11 –21 , 2013 24343921 \nGadow KD , Arnold LE , Molina BS , Findling RL , Bukstein OG , Brown NV , McNamara NK , Rundberg-Rivera EV , Li X , Kipp HL , Schneider J , Farmer CA , Baker JL , Sprafkin J , Rice RR Jr. , Bangalore SS , Butter EM , Buchan-Page KA , Hurt EA , Austin AB , Grondhuis SN , Aman MG : Risperidone added to parent training and stimulant medication: Effects on attention-deficit/hyperactivity disorder, oppositional defiant disorder, conduct disorder, and peer aggression . J Am Acad Child Adolesc Psychiatry \n53 :948 –959 e941, 2014 25151418 \nGothert M : Serotonin discovery and stepwise disclosure of 5-HT receptor complexity over four decades. Part I. General background and discovery of serotonin as a basis for 5-HT receptor identification . Pharmacol Rep \n65 :771 –786 , 2013 24145072 \nGurnani T , Ivanov I , Newcorn JH : Pharmacotherapy of aggression in child and adolescent psychiatric disorders . J Child Adolesc Psychopharmacol \n26 :65 –73 , 2016 26881859 \nHambly JL , Khan S , McDermott B , Bor W , Haywood A : Pharmacotherapy of conduct disorder: Challenges, options and future directions . J Psychopharmacol \n30 :967 –975 , 2016 27436231 \nHenggeler SW , Schaeffer CM : Multisystemic therapy: Clinical overview, outcomes, and implementation research . Fam Process \n55 :514 –528 , 2016 27370172 \nHenggeler SW , Sheidow AJ : Empirically supported family-based treatments for conduct disorder and delinquency in adolescents . J Marital Fam Ther \n38 :30 –58 , 2012 22283380 \nHofmann SG , Asnaani A , Vonk IJ , Sawyer AT , Fang A : The efficacy of cognitive behavioral therapy: A review of meta-analyses . Cognit Ther Res \n36 :427 –440 , 2012 \nHuesmann LR : An integrative theoretical understanding of aggression: A brief exposition . Curr Opin Psychol . 19 :119 –124 , 2018 29279209 \nJensen PS , Youngstrom EA , Steiner H , Findling RL , Meyer RE , Malone RP , Carlson GA , Coccaro EF , Aman MG , Blair J , Dougherty D , Ferris C , Flynn L , Green E , Hoagwood K , Hutchinson J , Laughren T , Leve LD , Novins DK , Vitiello B : Consensus report on impulsive aggression as a symptom across diagnostic categories in child psychiatry: Implications for medication studies . J Am Acad Child Adolesc Psychiatry \n46 :309 –322 , 2007 17314717 \nJordan BK , Marmar CR , Fairbank JA , Schlenger WE , Kulka RA , Hough RL , Weiss DS : Problems in families of male Vietnam veterans with posttraumatic stress disorder . J Consult Clin Psychol \n60 :916 –926 , 1992 1460153 \nKalverdijk LJ , Bachmann CJ , Aagaard L , Burcu M , Glaeske G , Hoffmann F , Petersen I , Schuiling-Veninga CCM , Wijlaars LP , Zito JM : A multi-national comparison of antipsychotic drug use in children and adolescents, 2005–2012 . Child Adolesc Psychiatry Ment Health \n11 :55 , 2017 29046716 \nKelly AM , Wilson LC : Aggression: Perspectives from social and systems neuroscience . Horm Behav \n2019 [Epub ahead of print]; DOI: 10.1016/j.yhbeh.2019.04.010 \nKhan S , Down J , Aouira N , Bor W , Haywood A , Littlewood R , Heussler H , McDermott B : Current pharmacotherapy options for conduct disorders in adolescents and children . Expert Opin Pharmacother \n20 :571 –583 , 2019 30702354 \nKhushu A , Powney MJ : Haloperidol for long-term aggression in psychosis . Cochrane Database Syst Rev \n11 :CD009830 , 2016 27889922 \nKim E , Cain KC , Webster-Stratton C : The preliminary effect of a parenting program for Korean American mothers: A randomized controlled experimental study . Int J Nurs Stud \n45 :1261 –1273 , 2008 17996239 \nKlahr AM , Burt SA : Evaluation of the known behavioral heterogeneity in conduct disorder to improve its assessment and treatment . J Child Psychol Psychiatry \n55 :1300 –1310 , 2014 24889762 \nKnapp P , Chait A , Pappadopulos E , Crystal S , Jensen P , TMAY Steering Group : Treatment of maladaptive aggression in youth: CERT guidelines I. Engagement, assessment, and management . Pediatrics \n129 :e1562 –e1576 , 2012 22641762 \nKumar A , Trescher W , Byler D : Tourette syndrome and comorbid neuropsychiatric conditions . Curr Dev Disord Rep \n3 :217 –221 , 2016 27891299 \nLacourse E , Boivin M , Brendgen M , Petitclerc A , Girard A , Vitaro F , Paquin S , Ouellet-Morin I , Dionne G , Tremblay RE : A longitudinal twin study of physical aggression during early childhood: Evidence for a developmentally dynamic genome . Psychol Med \n44 :2617 –2627 , 2014 24443874 \nLansford JE : Development of aggression . Curr Opin Psychol \n19 :17 –21 , 2018 29279216 \nLee AH , DiGiuseppe R : Anger and aggression treatments: A review of meta-analyses . Curr Opin Psychol \n19 :65 –74 , 2018 29279226 \nLeff SS , Waasdorp TE , Crick NR : A review of existing relational aggression programs: Strengths, limitations, and future directions . School Psych Rev \n39 :508 –535 , 2010 21666876 \nLin JJ , Mula M , Hermann BP : Uncovering the neurobehavioural comorbidities of epilepsy over the lifespan . Lancet \n380 :1180 –1192 , 2012 23021287 \nMaglione MA , Gans D , Das L , Timbie J , Kasari C , Technical Expert Panel, HRSA Autism Intervention Research – Behavioral (AIR-B) Network : Nonmedical interventions for children with ASD: Recommended guidelines and further research needs . Pediatrics \n130 \nSuppl 2 :S169 –S178 , 2012 23118248 \nMarek R , Strobel C , Bredy TW , Sah P : The amygdala and medial prefrontal cortex: Partners in the fear circuit . J Physiol \n591 :2381 –2391 , 2013 23420655 \nMarsee MA , Barry CT , Childs KK , Frick PJ , Kimonis ER , Munoz LC , Aucoin KJ , Fassnacht GM , Kunimatsu MM , Lau KSL : Assessing the forms and functions of aggression using self-report: Factor structure and invariance of the Peer Conflict Scale in youths . Psychol Assess \n23 :792 –804 , 2011 21500922 \nMcCrory E , De Brito SA , Viding E : Research review: The neurobiology and genetics of maltreatment and adversity . J Child Psychol Psychiatry \n51 :1079 –1095 , 2010 20546078 \nMeyer HC , Lee FS : Translating developmental neuroscience to understand risk for psychiatric disorders . Am J Psychiatry \n176 :179 –185 , 2019 30818985 \nMiller TQ , Smith TW , Turner CW , Guijarro ML , Hallet AJ : A meta-analytic review of research on hostility and physical health . Psychol Bull \n119 :322 –348 , 1996 8851276 \nNagin DS , Tremblay RE : What has been learned from group-based trajectory modeling? Examples from physical aggression and other problem behaviors . Ann Am Acad Pol Soc Sci \n602 :82 –117 , 2005 \nNational Institute for Health and Care Excellence: Antisocial Behaviour and Conduct Disorders in Children and Young People: Recognition Intervention and Management . Leicester, UK , British Psychological Society , 2013 \nNewcorn JH , Spencer TJ , Biederman J , Milton DR , Michelson D : Atomoxetine treatment in children and adolescents with attention-deficit/hyperactivity disorder and comorbid oppositional defiant disorder . J Am Acad Child Adolesc Psychiatry \n44 :240 –248 , 2005 15725968 \nNICHD Early Child Care Research Network : Trajectories of physical aggression from toddlerhood to middle childhood: Predictors, correlates, and outcomes . Monogr Soc Res Child Dev \n69 :vii , 1 –129 , 2004 \nNoordermeer SD , Luman M , Oosterlaan J : A systematic review and meta-analysis of neuroimaging in oppositional defiant disorder (ODD) and conduct disorder (CD) taking attention-deficit hyperactivity disorder (ADHD) into account . Neuropsychol Rev \n26 :44 –72 , 2016 26846227 \nOlfson M , King M , Schoenbaum M : Treatment of young people with antipsychotic medications in the United States . JAMA Psychiatry \n72 :867 –874 , 2015 26132724 \nOlson SL , Sameroff AJ , Lansford JE , Sexton H , Davis-Kean P , Bates JE , Pettit GS , Dodge KA : Deconstructing the externalizing spectrum: Growth patterns of overt aggression, covert aggression, oppositional behavior, impulsivity/inattention, and emotion dysregulation between school entry and early adolescence . Dev Psychopathol \n25 :817 –842 , 2013 23880394 \nOstrov JM , Woods KE , Yeh EAJ , Casas JF , Crick NR : An observational study of delivered and received aggression, gender, and social-psychological adjustment in preschool: Abstract “This white crayon doesn't work … ” . University of Nebraska Omaha Psychology Faculty Publications \n2004 \nPagliaccio D , Pine DS , Barch DM , Luby JL , Leibenluft E : Irritability trajectories, cortical thickness, and clinical outcomes in a sample enriched for preschool depression . J Am Acad Child Adolesc Psychiatry \n57 :336 –342 .e336, 2018 29706163 \nPappadopulos E , Macintyre Ii JC , Crismon ML , Findling RL , Malone RP , Derivan A , Schooler N , Sikich L , Greenhill L , Schur SB , Felton CJ , Kranzler H , Rube DM , Sverd J , Finnerty M , Ketner S , Siennick SE , Jensen PS : Treatment Recommendations for the Use of Antipsychotics for Aggressive Youth (TRAAY). Part II . J Am Acad Child Adolesc Psychiatry \n42 :145 –161 , 2003 12544174 \nPappadopulos E , Woolston S , Chait A , Perkins M , Connor DF , Jensen PS : Pharmacotherapy of aggression in children and adolescents: Efficacy and effect size . J Can Acad Child Adolesc Psychiatry \n15 :27 –39 , 2006 18392193 \nPasalich DS , Witkiewitz K , McMahon RJ , Pinderhughes EE , the Conduct Problems Prevention Research Group : Indirect effects of the fast track intervention on conduct disorder symptoms and callous-unemotional traits: Distinct pathways involving discipline and warmth . J Abnorm Child Psychol \n44 :587 –597 , 2016 26242993 \nPatterson GR , Shaw DS , Snyder JJ , Yoerger K : Changes in maternal ratings of children's overt and covert antisocial behavior . Aggress Behav \n31 :473 –484 , 2005 \nPringsheim T , Hirsch L , Gardner D , Gorman DA : The pharmacological management of oppositional behaviour, conduct problems, and aggression in children and adolescents with attention-deficit hyperactivity disorder, oppositional defiant disorder, and conduct disorder: A systematic review and meta-analysis. Part 2: Antipsychotics and traditional mood stabilizers . Can J Psychiatry \n60 :52 –61 , 2015 25886656 \nPulkkinen L : Offensive and defensive aggression in humans: A longitudinal perspective . Aggress Behav \n13 :197 –212 , 1987 \nRaaijmakers MA , Posthumus JA , van Hout BA , van Engeland H , Matthys W \nCross-sectional study into the costs and impact on family functioning of 4-year-old children with aggressive behavior . Prev Sci \n12 :192 –200 , 2011 21369841 \nRaine A , Dodge K , Loeber R , Gatzke-Kopp L , Lynam D , Reynolds C , Stouthamer-Loeber M , Liu J : The Reactive-Proactive Aggression Questionnaire: Differential correlates of reactive and proactive aggression in adolescent boys . Aggress Behav \n32 :159 –171 , 2006 20798781 \nRamirez JM , Andreu JM : Aggression, and some related psychological constructs (anger, hostility, and impulsivity); some comments from a research project . Neurosci Biobehav Rev \n30 :276 –291 , 2006 16081158 \nRobb A , Schwabe S , Ceresoli-Borroni G , Nasser A , Yu C , Marcus R , Candler S , Findling R : A proposed anti-maladaptive aggression agent classification: Improving our approach to treating impulsive aggression . Postgrad Med \n131 :129 –137 , 2019 30678534 \nRopper AH , Samuels MA , Klein JP : Adams and Victor's Principles of Neurology (10th ed.). New York , McGraw-Hill Education , 2014 \nRosell DR , Siever LJ : The neurobiology of aggression and violence . CNS Spectr \n20 :254 –279 , 2015 25936249 \nSafer DJ : Irritable mood and the Diagnostic and Statistical Manual of Mental Disorders . Child Adolesc Psychiatry Ment Health \n3 :35 , 2009 19852843 \nSah P : Fear, anxiety, and the amygdala . Neuron \n96 :1 –2 , 2017 28957662 \nSaini M : A meta-analysis of the psychological treatment of anger: Developing guidelines for evidence-based practice . J Am Acad Psychiatry Law \n37 :473 –488 , 2009 20018996 \nSalekin RT : Research review: What do we know about psychopathic traits in children? \nJ Child Psychol Psychiatry \n58 :1180 –1200 , 2017 28542927 \nSaylor KE , Amann BH : Impulsive aggression as a comorbidity of attention-deficit/hyperactivity disorder in children and adolescents . J Child Adolesc Psychopharmacol \n26 :19 –25 , 2016 26744906 \nScahill L , Jeon S , Boorin SJ , McDougle CJ , Aman MG , Dziura J , McCracken JT , Caprio S , Arnold LE , Nicol G , Deng Y , Challa SA , Vitiello B : Weight gain and metabolic consequences of risperidone in young children with autism spectrum disorder . J Am Acad Child Adolesc Psychiatry \n55 :415 –423 , 2016 27126856 \nScotto Rosato N , Correll C , Pappadopulos E , Chait A , Crystal S , Jensen PS , TMAY Steering Committee : Treatment of maladaptive aggression in youth: CERT guidelines II. Treatments and ongoing management . Pediatrics \n129 :e1577 –e1586 , 2012 22641763 \nSmeets KC , Oostermeijer S , Lappenschaar M , Cohn M , van der Meer JM , Popma A , Jansen LM , Rommelse NN , Scheepers FE , Buitelaar JK : Are proactive and reactive aggression meaningful distinctions in adolescents? A variable- and person-based approach . J Abnorm Child Psychol \n45 :1 –14 , 2017 27113216 \nSoyka M : Neurobiology of aggression and violence in schizophrenia . Schizophr Bull \n37 :913 –920 , 2011 21860037 \nSpoont MR : Modulatory role of serotonin in neural information processing: Implications for human psychopathology . Psychol Bull \n112 :330 –350 , 1992 1454898 \nStocks JD , Taneja BK , Baroldi P , Findling RL : A phase 2a randomized, parallel group, dose-ranging study of molindone in children with attention-deficit/hyperactivity disorder and persistent, serious conduct problems . J Child Adolesc Psychopharmacol \n22 :102 –111 , 2012 22372512 \nSukhodolsky DG , Scahill L : Cognitive-Behavioral Therapy for Anger and Aggression in Children . New York : The Guilford Press , 2012 \nThe MTA Cooperative Group : A 14-month randomized clinical trial of treatment strategies for attention-deficit/hyperactivity disorder. Multimodal Treatment Study of Children with ADHD . Arch Gen Psychiatry \n56 :1073 –1086 , 1999 10591283 \nThomson ND , Centifanti LCM : Proactive and reactive aggression subgroups in typically developing children: The role of executive functioning, psychophysiology, and psychopathy . Child Psychiatry Hum Dev \n49 :197 –208 , 2018 28681106 \nTremblay RE , Nagin DS , Seguin JR , Zoccolillo M , Zelazo PD , Boivin M , Perusse D , Japel C : Physical aggression during early childhood: Trajectories and predictors . Pediatrics \n114 :e43 –e50 , 2004 15231972 \nTremblay RE , Vitaro F , Cote SM : Developmental origins of chronic physical aggression: A bio-psycho-social model for the next generation of preventive interventions . Annu Rev Psychol \n69 :383 –407 , 2018 29035692 \nTurgay A : Aggression and disruptive behavior disorders in children and adolescents . Expert Rev Neurother \n4 :623 –632 , 2004 15853581 \nUnited States Securities and Exchange Commission: Form 10-K/A: Annual report . Washington, DC , 2015 \nUnited States Securities and Exchange Commission: Form 10-Q: Quarterly report . Washington, DC , 2016 \nUrben S , Habersaat S , Pihet S , Suter M , de Ridder J , Stephan P : Specific contributions of age of onset, callous-unemotional traits and impulsivity to reactive and proactive aggression in youths with conduct disorders . Psychiatr Q \n89 :1 –10 , 2018 28345108 \nVeroude K , Zhang-James Y , Fernandez-Castillo N , Bakker MJ , Cormand B , Faraone SV : Genetics of aggressive behavior: An overview . Am J Med Genet B Neuropsychiatr Genet \n171B :3 –43 , 2016 26345359 \nVitiello B , Behar D , Hunt J , Stoff D , Ricciuti A : Subtyping aggression in children and adolescents . J Neuropsychiatry Clin Neurosci \n2 :189 –192 , 1990 2136074 \nVitiello B , Stoff DM : Subtypes of aggression and their relevance to child psychiatry . J Am Acad Child Adolesc Psychiatry \n36 :307 –315 , 1997 9055510 \nWalker SE , Papilloud A , Huzard D , Sandi C : The link between aberrant hypothalamic-pituitary-adrenal axis activity during development and the emergence of aggression-animal studies . Neurosci Biobehav Rev \n91 :138 –152 , 2018 27751733 \nWalters GD , Ruscio J : Trajectories of youthful antisocial behavior: Categories or continua? \nJ Abnorm Child Psychol \n41 :653 –666 , 2013 23188257 \nWaltes R , Chiocchetti AG , Freitag CM : The neurobiological basis of human aggression: A review on genetic and epigenetic mechanisms . Am J Med Genet B Neuropsychiatr Genet \n171 :650 –675 , 2016 26494515 \nWang P , Niv S , Tuvblad C , Raine A , Baker LA : The genetic and environmental overlap between aggressive and non-aggressive antisocial behavior in children and adolescents using the self-report delinquency interview (SR-DI) . J Crim Justice \n41 :277 –284 , 2013 24465061 \nWang S , Che T , Levit A , Shoichet BK , Wacker D , Roth BL : Structure of the D2 dopamine receptor bound to the atypical antipsychotic drug risperidone . Nature \n555 :269 –273 , 2018 29466326 \nWeber DL : Information processing bias in post-traumatic stress disorder . Open Neuroimag J \n2 :29 –51 , 2008 19639038 \nWebster-Stratton C , Jamila Reid M , Stoolmiller M : Preventing conduct problems and improving school readiness: Evaluation of the incredible years teacher and child training programs in high-risk schools . J Child Psychol Psychiatry \n49 :471 –488 , 2008 18221346 \nWebster-Stratton C , Reid MJ , Hammond M : Treating children with early-onset conduct problems: Intervention outcomes for parent, child, and teacher training . J Clin Child Adolesc Psychol \n33 :105 –124 , 2004 15028546 \nWeierstall R , Elbert T : The Appetitive Aggression Scale-development of an instrument for the assessment of human's attraction to violence . Eur J Psychotraumatol \n2 , 2011 \nWeisbrot DM , Ettinger AB : Aggression and violence in mood disorders . Child Adolesc Psychiatr Clin N Am \n11 :649 –671 , xi, 2002 12222088 \nWilliams KR , Guerra NG : Prevalence and predictors of internet bullying . J Adolesc Health \n41 :S14 –S21 , 2007 18047941 \nWinsper C , Ganapathy R , Marwaha S , Large M , Birchwood M , Singh SP : A systematic review and meta-regression analysis of aggression during the first episode of psychosis . Acta Psychiatr Scand \n128 :413 –421 , 2013 23521361 \nWinters DE , Fukui S , Leibenluft E , Hulvershorn LA : Improvements in irritability with open-label methylphenidate treatment in youth with comorbid attention deficit/hyperactivity disorder and disruptive mood dysregulation disorder . J Child Adolesc Psychopharmacol \n28 :298 –305 , 2018 29708762 \nWood RL , Thomas RH : Impulsive and episodic disorders of aggressive behaviour following traumatic brain injury . Brain Inj \n27 :253 –261 , 2013 23438346 \nYanowitch R , Coccaro EF : The neurochemistry of human aggression . Adv Genet \n75 :151 –169 , 2011 22078480 \nZajac K , Randall J , Swenson CC : Multisystemic therapy for externalizing youth . Child Adolesc Psychiatr Clin N Am \n24 :601 –616 , 2015 26092742 \nZhuo Y , Bradizza CM , Maisto SA : The influence of treatment attendance on subsequent aggression among severely mentally ill substance abusers . J Subst Abuse Treat \n47 :353 –361 , 2014 25124261\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1044-5463",
"issue": "29(8)",
"journal": "Journal of child and adolescent psychopharmacology",
"keywords": "aggression; impulsive aggression; maladaptive aggression; neurological disorders; psychiatric disorders",
"medline_ta": "J Child Adolesc Psychopharmacol",
"mesh_terms": "D000293:Adolescent; D000374:Aggression; D002648:Child; D006801:Humans; D007175:Impulsive Behavior; D001523:Mental Disorders",
"nlm_unique_id": "9105358",
"other_id": null,
"pages": "576-591",
"pmc": null,
"pmid": "31453715",
"pubdate": "2019-10",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": "23420655;25280430;1460153;26744906;22641763;17996239;24497627;24553580;24443874;27370172;19852843;9055510;21666876;8851276;15667346;27891299;11212630;26846227;22893817;18221346;21493616;28542927;26881859;27113216;26132724;25436222;24231167;18047941;25886656;16779500;24290461;2136074;15853581;24889762;10807490;27436231;29035692;29607288;25898050;19455173;14560165;21369841;29279225;24145072;28983792;21291445;15725968;26370547;21500922;25151418;22078480;9862602;16081158;23521361;20837589;26345359;28681106;10591283;26170281;30678534;29466326;23021287;28345108;16841631;9151749;14992805;30818985;29046716;29279226;1403624;23118248;16142211;27751733;27255267;21860037;31002771;23459093;1454898;16083361;30702354;29708762;25474481;29454475;26242993;12222088;23438346;20546078;19193479;18427863;22372512;29279209;26668223;24215897;22641762;19639038;18392193;25936249;12544174;23880394;28957662;22283380;26465707;15231972;27889922;26765248;24465061;20798781;26092742;29279216;26494515;20018996;24343921;28829159;27126856;23188257;26835875;17314717;15028546;20425314;29706163;25997605;25124261",
"title": "Maladaptive Aggression: With a Focus on Impulsive Aggression in Children and Adolescents.",
"title_normalized": "maladaptive aggression with a focus on impulsive aggression in children and adolescents"
} | [
{
"companynumb": "US-OTSUKA-2019_041946",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nSecukinumab, a fully human anti-interleukin-17A monoclonal antibody, has demonstrated superior efficacy to ustekinumab in the phase 3b CLEAR study of moderate to severe plaque psoriasis. Here, we report 16-week results from CLARITY, a second head-to-head trial comparing secukinumab with ustekinumab.\n\n\nMETHODS\nIn the phase 3b CLARITY study, patients were randomized 1:1 to receive subcutaneous secukinumab 300 mg or ustekinumab per label. The co-primary objectives were to demonstrate the superiority of secukinumab over ustekinumab at Week 12 in relation to the proportion of patients with (1) 90% or more improvement from baseline Psoriasis Area and Severity Index (PASI 90) and (2) a score of 0/1 (clear/almost clear) on the modified Investigator's Global Assessment (IGA mod 2011 0/1). Key secondary objectives were also assessed, as was Dermatology Life Quality Index (DLQI) 0/1 (no impact of skin disease on patients' quality of life) response. Missing values were handled by multiple imputation except for DLQI 0/1, where last observation carried forward techniques were utilized.\n\n\nRESULTS\nBoth co-primary objectives were met: secukinumab was superior to ustekinumab for the proportion of patients achieving a PASI 90 (66.5% vs. 47.9%) and IGA mod 2011 0/1 response (72.3% vs. 55.4%) at Week 12 (p < 0.0001). PASI 90 responses were greater with secukinumab compared to ustekinumab from as early as Week 4 (16.7% vs. 4.0%) and out to Week 16 (76.6% vs. 54.2%). Similarly, IGA mod 2011 0/1 findings were greater with secukinumab at Week 4 (26.9% vs. 7.8%) and at Week 16 (78.6% vs. 59.1%). DLQI 0/1 response rates were also greater with secukinumab compared to ustekinumab at Week 4 (33.9% vs. 18.0%), Week 12 (64.0% vs. 51.7%), and Week 16 (68.4% vs. 55.9%).\n\n\nCONCLUSIONS\nThe results of this study confirm the superior efficacy of secukinumab over ustekinumab in treating patients with moderate to severe psoriasis.\n\n\nBACKGROUND\nClinicaltrials.gov Identifier, NCT02826603.\n\n\nBACKGROUND\nNovartis Pharma AG, Basel, Switzerland.",
"affiliations": "Psoriasis Treatment Center of Central New Jersey, East Windsor, NJ, USA. dreamacres1@aol.com.;Icahn School of Medicine at Mount Sinai, New York, NY, USA.;Icahn School of Medicine at Mount Sinai, New York, NY, USA.;Novartis Pharma AG, Basel, Switzerland.;Novartis Pharma AG, Basel, Switzerland.;Novartis Pharma AG, Basel, Switzerland.;Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA.;Novartis Beijing Novartis Pharma Co. Ltd, Shanghai, China.;Novartis Pharma AG, Basel, Switzerland.;Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA.;Oregon Medical Research Center, Portland, OR, USA.;Icahn School of Medicine at Mount Sinai, New York, NY, USA.",
"authors": "Bagel|Jerry|J|;Nia|John|J|;Hashim|Peter W|PW|;Patekar|Manmath|M|;de Vera|Ana|A|;Hugot|Sophie|S|;Sheng|Kuan|K|;Xia|Summer|S|;Gilloteau|Isabelle|I|;Muscianisi|Elisa|E|;Blauvelt|Andrew|A|;Lebwohl|Mark|M|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1007/s13555-018-0265-y",
"fulltext": "\n==== Front\nDermatol Ther (Heidelb)\nDermatol Ther (Heidelb)\nDermatology and Therapy\n2193-8210\n2190-9172\nSpringer Healthcare Cheshire\n\n30334147\n265\n10.1007/s13555-018-0265-y\nOriginal Research\nSecukinumab is Superior to Ustekinumab in Clearing Skin in Patients with Moderate to Severe Plaque Psoriasis (16-Week CLARITY Results)\nBagel Jerry dreamacres1@aol.com\n\n1\nNia John 2\nHashim Peter W. 2\nPatekar Manmath 3\nde Vera Ana 3\nHugot Sophie 3\nSheng Kuan 4\nXia Summer 5\nGilloteau Isabelle 3\nMuscianisi Elisa 4\nBlauvelt Andrew 6\nLebwohl Mark 2\n1 grid.478094.6 Psoriasis Treatment Center of Central New Jersey, East Windsor, NJ USA\n2 0000 0001 0670 2351 grid.59734.3c Icahn School of Medicine at Mount Sinai, New York, NY USA\n3 0000 0001 1515 9979 grid.419481.1 Novartis Pharma AG, Basel, Switzerland\n4 0000 0004 0439 2056 grid.418424.f Novartis Pharmaceuticals Corporation, East Hanover, NJ USA\n5 Novartis Beijing Novartis Pharma Co. Ltd, Shanghai, China\n6 grid.477719.b Oregon Medical Research Center, Portland, OR USA\n17 10 2018\n17 10 2018\n12 2018\n8 4 571579\n28 8 2018\n© The Author(s) 2018\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.\nIntroduction\n\nSecukinumab, a fully human anti-interleukin-17A monoclonal antibody, has demonstrated superior efficacy to ustekinumab in the phase 3b CLEAR study of moderate to severe plaque psoriasis. Here, we report 16-week results from CLARITY, a second head-to-head trial comparing secukinumab with ustekinumab.\n\nMethods\n\nIn the phase 3b CLARITY study, patients were randomized 1:1 to receive subcutaneous secukinumab 300 mg or ustekinumab per label. The co-primary objectives were to demonstrate the superiority of secukinumab over ustekinumab at Week 12 in relation to the proportion of patients with (1) 90% or more improvement from baseline Psoriasis Area and Severity Index (PASI 90) and (2) a score of 0/1 (clear/almost clear) on the modified Investigator’s Global Assessment (IGA mod 2011 0/1). Key secondary objectives were also assessed, as was Dermatology Life Quality Index (DLQI) 0/1 (no impact of skin disease on patients’ quality of life) response. Missing values were handled by multiple imputation except for DLQI 0/1, where last observation carried forward techniques were utilized.\n\nResults\n\nBoth co-primary objectives were met: secukinumab was superior to ustekinumab for the proportion of patients achieving a PASI 90 (66.5% vs. 47.9%) and IGA mod 2011 0/1 response (72.3% vs. 55.4%) at Week 12 (p < 0.0001). PASI 90 responses were greater with secukinumab compared to ustekinumab from as early as Week 4 (16.7% vs. 4.0%) and out to Week 16 (76.6% vs. 54.2%). Similarly, IGA mod 2011 0/1 findings were greater with secukinumab at Week 4 (26.9% vs. 7.8%) and at Week 16 (78.6% vs. 59.1%). DLQI 0/1 response rates were also greater with secukinumab compared to ustekinumab at Week 4 (33.9% vs. 18.0%), Week 12 (64.0% vs. 51.7%), and Week 16 (68.4% vs. 55.9%).\n\nConclusion\n\nThe results of this study confirm the superior efficacy of secukinumab over ustekinumab in treating patients with moderate to severe psoriasis.\n\nTrial Registration\n\nClinicaltrials.gov Identifier, NCT02826603.\n\nFunding\n\nNovartis Pharma AG, Basel, Switzerland.\n\nElectronic supplementary material\n\nThe online version of this article (10.1007/s13555-018-0265-y) contains supplementary material, which is available to authorized users.\n\nKeywords\n\nModerate to severe psoriasis\nSecukinumab\nUstekinumab\nNovartis Pharma AGissue-copyright-statement© Springer Healthcare Ltd., part of Springer Nature 2018\n==== Body\nIntroduction\n\nTreatment approaches in psoriasis range from traditional topical therapy and phototherapy to systemic interventions that target the immune system at different stages. Systemic therapies have advanced over time to target psoriasis-specific immune cytokines such as interleukin (IL)-12/23, or recently IL-17A, and their associated signaling pathways. Ustekinumab (an IL-12/23 inhibitor) has demonstrated good clinical efficacy in phase 3 studies with better Psoriasis Area Severity Index (PASI) response rates than those of etanercept (a tumor necrosis factor [TNF] inhibitor) [1, 2].\n\nSecukinumab is a fully human monoclonal antibody that selectively neutralizes IL-17A, a key effector cytokine involved in the development of psoriasis [3, 4]. In the 52-week double-blinded CLEAR study, secukinumab (79.0%) was found to be superior to ustekinumab (57.6%) as assessed by PASI 90 response at Week 16 (p < 0.0001) [5] and Week 52 (p < 0.0001) [6]. Superior clinical efficacy with secukinumab was also associated with significantly greater improvement in health-related quality of life (HRQoL) when compared with ustekinumab. In the current study, we report 16-week results from the 52-week CLARITY study, the second head-to-head trial comparing secukinumab with ustekinumab in moderate to severe plaque psoriasis. Distinct from the CLEAR study, CLARITY includes a larger patient population (N = 1102 vs. N = 676), a greater proportion of US patients (64.2% vs. 12.6%), and an assessment of primary efficacy objectives at Week 12 (vs. Week 16).\n\nMethods\n\nStudy Population\n\nPatients (≥ 18 years) with moderate to severe chronic plaque psoriasis (PASI ≥ 12, static 5-point Investigator’s Global Assessment 2011 modified version [IGA mod 2011] score ≥ 3, and body surface area [BSA] involvement ≥ 10%) and who were inadequately controlled by topical treatments, phototherapy, and/or previous systemic therapy were eligible (key exclusion criteria are presented in Table S1).\n\nStudy Design\n\nCLARITY (NCT02826603) is a multicenter, randomized, double-blinded, active-controlled, parallel-group, phase 3b trial. Eligible patients were randomized 1:1 to receive either subcutaneous secukinumab 300 mg at Baseline, Weeks 1, 2, and 3, and then every 4 weeks from Weeks 4 to 48, or subcutaneous ustekinumab (45 mg for patient weighing ≤ 100 kg or 90 mg for patient weighing > 100 kg) at Baseline, Week 4, and then every 12 weeks (Fig. 1).Fig. 1 Study design of the CLARITY study. ¥Ustekinumab dose is based on body weight at baseline; 45 mg for patient ≤ 100 kg; 90 mg for patient > 100 kg. †For patients with premature treatment discontinuation only. F4 = follow-up visit approximately 4 weeks after the EOT visit. F8 = follow-up visit approximately 8 weeks after the EOT visit. ↓ = active dose administration; in order to maintain blinding, patients received placebo administrations at several time points (not shown in this study design figure). The screening phase duration was at least 2 weeks and up to 4 weeks. BL baseline, EOT end of treatment phase\n\nStudy Objectives\n\nThe co-primary objectives of the study were to demonstrate the superiority of secukinumab compared to ustekinumab with respect to PASI 90 response and IGA mod 2011 0/1 (clear or almost clear skin) at Week 12. The following key secondary objectives were assessed sequentially by a hierarchical testing strategy, which tested the superiority of secukinumab compared to ustekinumab with respect to (in hierarchical order): PASI 75 response at Week 12, PASI 75 response at Week 4, PASI 90 at Week 16, PASI 100 at Week 16, IGA mod 2011 0/1 at Week 16, PASI 100 at Week 12, and PASI 75 at Week 16. Dermatology Life Quality Index (DLQI) 0/1 response (representing no impact of skin disease on patients’ quality of life) was also assessed at Weeks 4, 12, and 16.\n\nStatistical Analyses\n\nCo-primary variables and key secondary variables were evaluated using a logistic regression model with treatment group, baseline body weight strata (≤ 100 kg, > 100 kg), and baseline PASI as explanatory variables. Missing values were handled by multiple imputation except for DLQI 0/1, where missing values were handled using last observation carried forward.\n\nStudy Oversight\n\nAll procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in the study.\n\nResults\n\nStudy Population\n\nA total of 1102 patients, of whom almost two-thirds were US patients (64.2%), were randomized to either secukinumab 300 mg (n = 550) or ustekinumab 45/90 mg (n = 552). The rate of discontinuation was low and balanced between treatment arms (Fig. 2). Similarly, demographic and baseline disease characteristics were well balanced across patients (Table 1).Fig. 2 Patient disposition\n\nTable 1 Patient demographic and baseline disease characteristics\n\nCharacteristics\tSecukinumab 300 mg (n = 550)\tUstekinumab 45/90 mg (n = 552)\t\nAge, years (mean ± SD)\t45.4 ± 14.1\t45.3 ± 14.2\t\nGender–male, n (%)\t356 (64.7)\t376 (68.1)\t\nRace–Caucasian, n (%)\t414 (75.3)\t410 (74.3)\t\nBody weight (mean ± SD)\n\n> 100 kg, n (%)\n\n\t91.0 ± 24.9\n\n189 (34.4)\n\n\t93.0 ± 24.9\n\n188 (34.1)\n\n\t\nPASI (mean ± SD)\n\nPASI > 20, n (%)\n\n\t20.8 ± 9.0\n\n210 (38.2)\n\n\t21.3 ± 9.2\n\n226 (40.9)\n\n\t\nBSA affected, % (mean ± SD)\t29.2 ± 17.9\t29.5 ± 17.7\t\nIGA mod 2011—severe disease, n (%)\t209 (38.0)\t239 (43.3)\t\nMean time since first diagnosis of plaque-type psoriasis, years (mean ± SD)\t16.8 ± 11.9\t17.3 ± 13.3\t\nPrevious exposure to biologic psoriasis therapy—yes, n (%)\t110 (20.0)\t130 (23.6)\t\nBSA body surface area, IGA mod 2011 Investigator’s Global Assessment 2011 modification, PASI Psoriasis Area and Severity Index, SD standard deviation\n\nEfficacy\n\nBoth co-primary objectives were met: secukinumab was superior to ustekinumab for the proportion of patients that achieved PASI 90 responses at Week 12 (66.5% vs. 47.9%; p < 0.0001) and for the proportion of patients that achieved IGA mod 2011 0/1 responses at Week 12 (72.3% vs. 55.4%; p < 0.0001) (Fig. 3). Indeed, PASI 90 responses were greater with secukinumab compared to ustekinumab from as early as Week 4 (16.7% vs. 4.0%; p < 0.0001),and out to Week 16 (76.6% vs. 54.2%; p < 0.0001). Similarly, IGA mod 2011 0/1 findings were greater with secukinumab at Week 4 (26.9% vs. 7.8%; p < 0.0001) and at Week 16 (78.6% vs. 59.1%; p < 0.0001). Clear skin responses (PASI 100) were also greater among secukinumab treated patients compared to ustekinumab at every time point from Week 4 out to Week 16 (Fig. 3).Fig. 3 PASI 90 (a), IGA mod 2011 0/1 (b), and PASI 100 (c) responses out to Week 16. Missing values handled by multiple imputation. IGA mod 2011 0/1 Investigator’s Global Assessment, 2011 modification, clear (0) or almost clear (1) score, PASI 90 Psoriasis Area and Severity Index 90% improvement vs. Baseline, PASI 100 Psoriasis Area and Severity Index 100% improvement vs Baseline. *p < 0.0001\n\nAll key secondary objectives assessing the superiority of secukinumab to ustekinumab were also met in the hierarchical testing strategy (Table 2).Table 2 Hierarchical efficacy analysis of key secondary objectives (% responders)\n\nParameters\tSecukinumab 300 mg (n = 550)\tUstekinumab 45/90 mg (n = 552)\tp value\t\nPASI 75 at Week 12\t88.0%\t74.2%\t< 0.0001\t\nPASI 75 at Week 4\t40.2%\t16.3%\t< 0.0001\t\nPASI 90 at Week 16\t76.6%\t54.2%\t< 0.0001\t\nPASI 100 at Week 16\t45.3%\t26.7%\t< 0.0001\t\nIGA mod 2011 0/1 at Week 16\t78.6%\t59.1%\t< 0.0001\t\nPASI 100 at Week 12\t38.1%\t20.1%\t< 0.0001\t\nPASI 75 at Week 16\t91.7%\t79.8%\t< 0.0001\t\nIGA mod 2011 0/1 investigator’s global assessment 2011 modification clear (0) or almost clear (1), PASI psoriasis area and severity index\n\nQuality of Life\n\nThe proportion of patients with a DLQI 0/1 response was greater with secukinumab compared to ustekinumab at Week 4 (33.9% vs. 18.0%; p < 0.0001), at Week 12 (64.0% vs. 51.7%; p < 0.0001), and at Week 16 (68.4% vs. 55.9%; p < 0.0001) (Fig. 4).Fig. 4 DLQI 0/1 response out to Week 16. Missing values handled by last observation carried forward. DLQI 0/1 Dermatology Life Quality Index 0/1 (representing no impact of skin disease on patients’ quality of life). *p < 0.0001\n\nSafety\n\nTreatment-emergent adverse events (AEs) reported up to week 16 for both the secukinumab and ustekinumab treatment groups are presented in Table 3. The total number of reported AEs was comparable between the secukinumab group (47.5%) and the ustekinumab group (46.4%). There were two deaths, one due to acute intoxication by cocaine and another due to sudden cardiac death (patient had a history of hypertension and atherosclerosis). The incidence of non-fatal serious AEs (SAEs) was low for both groups (2.5% for secukinumab and 1.6% for ustekinumab). AEs in the system organ class of “infections and infestations” were reported most often (22.2% for secukinumab and 21.2% for ustekinumab); however, most events were non-serious, manageable, and did not lead to study drug discontinuation. To maintain blinding until after the final database lock at Week 52, the distributions of rare AEs for both study treatments are not presented.Table 3 Treatment-emergent adverse events to Week 16\n\nTreatment emergent AEs\tSecukinumab 300 mg (n = 550)\tUstekinumab 45/90 mg (n = 552)\t\nDuration of exposure (subject years)\t170.8\t171.1\t\nAll AEs\t261 (47.5)\t256 (46.4)\t\nAll non-fatal SAEs\t14 (2.5)\t9 (1.6)\t\nDiscontinued study treatment due to any AE\t11 (2.0)\t7 (1.3)\t\nMost frequent AEsa\t\n Nasopharyngitis\t25 (4.5)\t25 (4.5)\t\n URTI\t25 (4.5)\t33 (6.0)\t\n Diarrhea\t17 (3.1)\t12 (2.2)\t\n Headache\t16 (2.9)\t15 (2.7)\t\n Sinusitis\t11 (2.0)\t7 (1.3)\t\nInfections and infestations\t122 (22.2)\t117 (21.2)\t\nData are n (%) unless otherwise stated\n\nAE adverse event, SAE serious adverse event, URTI upper respiratory tract infection\n\naBy preferred term and occurring at an incidence of ≥ 2% in either treatment arm. AEs are listed in decreasing order of frequency in the secukinumab arm\n\nDiscussion\n\nPsoriasis is a complex disease associated with a notable patient burden and comorbidity. Studies comparing the effectiveness of therapies in moderate to severe plaque psoriasis are important to facilitate an informed choice of treatment for patients. This 16-week analysis of the CLARITY study confirmed the superiority of secukinumab compared to ustekinumab in clearing skin, and achieving a greater quality of life improvement, in patients with moderate to severe plaque psoriasis.\n\nUstekinumab is a fully human monoclonal anti-IL-12/23 antibody, which has proved to be a safe and efficacious treatment for moderate to severe plaque psoriasis. PASI 90 response rates of approximately 42% were reported with ustekinumab (combined doses) in pivotal studies (PHOENIX 1, PHOENIX 2, and ACCEPT) after 12 weeks of treatment [1, 2, 7]. Secukinumab is a fully human monoclonal anti-IL-17A antibody, which has shown long-lasting efficacy and safety for a variety of psoriasis manifestations, including psoriatic arthritis and psoriasis localized to the nails, scalp, palms, and soles [5, 8–12]. In the double-blinded CLEAR study, secukinumab (79.0%) was found to be superior to ustekinumab (57.6%) in treating patients with moderate to severe plaque psoriasis, as assessed by PASI 90 response at Week 16 (p < 0.0001) [5]. In the present CLARITY study, it was again found that secukinumab had a superior PASI 90 response to ustekinumab, both at Week 12 (66.5% vs. 47.9%; p < 0.0001) and at Week 16 (76.6% vs. 54.2%; p < 0.0001). Secukinumab also demonstrated an earlier onset of response than ustekinumab; 40.2% of secukinumab-treated patients were PASI 75 responders as early as Week 4 compared to 16.3% (p < 0.0001) of ustekinumab-treated patients.\n\nIn an era of more efficacious biologic treatments, a state of clear or almost clear skin is considered an achievable therapeutic target for psoriasis patients [13, 14]. In our study, a greater proportion of patients achieved clear or almost clear skin (IGA mod 2011 0/1) after 12 weeks of secukinumab treatment in comparison to ustekinumab treatment (72.3% vs. 55.4%; p < 0.0001). Similarly, IGA mod 2011 0/1 rates were higher for those receiving secukinumab in comparison to ustekinumab at Week 16 (78.6% vs. 59.1%; p < 0.0001). With secukinumab demonstrating superiority to ustekinumab for both PASI 90 and IGA mod 2011 0/1 responses at Week 12, both co-primary endpoints of the study were met.\n\nPatients with psoriasis experience a significant impairment to their quality of life [15]. Thus, it is recommended to include quality of life outcome measures as therapeutic targets [13]. The proportion of patients reporting no impact of skin disease on their quality of life (DLQI 0/1 response) was examined in this study. We found that patients treated with secukinumab had superior improvements in DLQI 0/1 to ustekinumab at Weeks 12 (64.0% vs. 51.7%, respectively) and 16 (68.4% vs. 55.9%). These findings are similar to those reported in the CLEAR study, where the proportion of DLQI 0/1 responders was also greater at Week 16 with secukinumab (71.9%) compared to ustekinumab (57.4%) [5].\n\nSimilar to previous secukinumab clinical trials, the safety profile of secukinumab remained favorable with no new safety signals identified to Week 16. Complete safety data from the 52-week CLARITY trial will be presented later.\n\nThis is the second head-to-head trial demonstrating the superior efficacy of secukinumab compared to ustekinumab in treating patients with moderate to severe psoriasis. The CLARITY study included a larger patient population (N = 1102 vs. N = 676) and a greater proportion of US patients (64.2% vs. 12.6%) than the CLEAR study.\n\nA potential limitation of the CLARITY study is the absence of a placebo arm. Since both secukinumab and ustekinumab have previously demonstrated superior efficacy compared with placebo in phase 3 trials, the inclusion of a placebo arm here was considered unethical [1, 8]. In addition, while patient-reported DLQI was examined in the present study, other patient reported outcomes (such as relief of symptoms) were not. Previously, in the CLEAR study, secukinumab was found to be superior to ustekinumab at reducing psoriasis-related pain, itching, and scaling through 52 weeks of treatment [6].\n\nConclusions\n\nThe results of this study confirm the superior efficacy of secukinumab over ustekinumab, with a rapid onset from Week 4, in treating patients with moderate to severe psoriasis.\n\nElectronic supplementary material\n\nBelow is the link to the electronic supplementary material. Supplementary material 1 (PDF 93 kb)\n\nAcknowledgements\n\nThe authors thank the patients and investigators who participated in the study.\n\nFunding\n\nThis investigation was sponsored by Novartis Pharma AG, Basel, Switzerland. Novartis Pharma AG also funded the journal article processing charges. All authors had full access to all of the data in this study and take complete responsibility for the integrity of the data and accuracy of the data analysis.\n\nMedical writing support\n\nThe authors thank Brendan Marshall, PhD of Novartis Ireland Ltd. for providing medical writing support which was funded by Novartis Pharma AG, Switzerland in accordance with Good Publication Practice (GPP3) guidelines (http://www.ismpp.org/gpp3).\n\nAuthorship\n\nAll named authors meet the International Committee of Medical Journal Editors (ICMJE) criteria for authorship for this article, take responsibility for the integrity of the work as a whole, and have given their approval for this version to be published.\n\nDisclosures\n\nJerry Bagel is an investigator and/or consultant and/or speaker for AbbVie, Amgen, Boehringer-Ingelheim, Janssen, Leo, Novartis, Celgene, Eli Lilly, Sun, and Valiant. Manmath Patekar is an employee of Novartis Pharma AG, Basel, Switzerland. Ana de Vera is an employee of Novartis Pharma AG, Basel, Switzerland. Sophie Hugot is an employee of Novartis Pharma AG, Basel, Switzerland. Isabelle Gilloteau is an employee of Novartis Pharma AG, Basel, Switzerland. Elisa Muscianisi is an employee of Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA. Kuan Sheng is an employee of Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA. Summer Xia is an employee of Beijing Novartis Pharma Co. Ltd, Shanghai, China. Andrew Blauvelt has served as a scientific consultant and clinical study investigator for AbbVie, Aclaris, Akros, Allergan, Almirall, Amgen, Boehringer Ingelheim, Celgene, Dermavant, Dermira, Eli Lilly and Company, Galderma, Genentech/Roche, GlaxoSmithKline, Janssen, Leo, Meiji, Merck Sharp & Dohme, Novartis, Pfizer, Purdue Pharma, Regeneron, Revance, Sandoz, Sanofi Genzyme, Sienna Pharmaceuticals, Sun Pharma, UCB, Valeant, and Vidac and as a paid speaker for Janssen, Regeneron, and Sanofi Genzyme. Mark Lebwohl is an employee of Mount Sinai which receives research funds from AbbVie, Boehringer Ingelheim, Celgene, Eli Lilly, Incyte, Janssen/Johnson & Johnson, Leo Pharmaceuticals, Medimmune/Astra Zeneca, Novartis, Pfizer, Sciderm, UCB, Valeant, and Vidac. Mark Lebwohl is also a consultant for Allergan, Aqua, Boehringer-Ingelheim, LEO Pharma, Menlo, and Promius. John Nia and Peter W. Hashim have nothing to disclose.\n\nCompliance with Ethics Guidelines\n\nAll procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in the study.\n\nData Availability\n\nThe datasets generated during and/or analyzed during the current study are not publicly available to prevent unblinding of treatment groups in the ongoing CLARITY trial.\n\nOpen Access\n\nThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.\n\nEnhanced digital features\n\nTo view enhanced digital features for this article go to 10.6084/m9.figshare.7140818.\n==== Refs\nReferences\n\n1. Leonardi CL Kimball AB Papp KA Efficacy and safety of ustekinumab, a human interleukin-12/23 monoclonal antibody, in patients with psoriasis: 76-week results from a randomised, double-blind, placebo-controlled trial (PHOENIX 1) Lancet 2008 371 9625 1665 1674 10.1016/S0140-6736(08)60725-4 18486739\n2. Papp KA Langley RG Lebwohl M Efficacy and safety of ustekinumab, a human interleukin-12/23 monoclonal antibody, in patients with psoriasis: 52-week results from a randomised, double-blind, placebo-controlled trial (PHOENIX 2) Lancet 2008 371 9625 1675 1684 10.1016/S0140-6736(08)60726-6 18486740\n3. Zeichner JA Armstrong A The role of IL-17 in the pathogenesis and treatment of psoriasis J Clin Aesthet Dermatol 2016 9 6 Suppl 1 S3 S6 28439340\n4. Blauvelt Andrew Chiricozzi Andrea The Immunologic Role of IL-17 in Psoriasis and Psoriatic Arthritis Pathogenesis Clinical Reviews in Allergy & Immunology 2018 55 3 379 390 10.1007/s12016-018-8702-3 30109481\n5. Thaci D Blauvelt A Reich K Secukinumab is superior to ustekinumab in clearing skin of subjects with moderate to severe plaque psoriasis: CLEAR, a randomized controlled trial J Am Acad Dermatol 2015 73 3 400 409 10.1016/j.jaad.2015.05.013 26092291\n6. Blauvelt A Reich K Tsai TF Secukinumab is superior to ustekinumab in clearing skin of subjects with moderate-to-severe plaque psoriasis up to 1 year: results from the CLEAR study J Am Acad Dermatol 2017 76 1 60 69 10.1016/j.jaad.2016.08.008 27663079\n7. Griffiths CE Strober BE van de Kerkhof P Comparison of ustekinumab and etanercept for moderate-to-severe psoriasis New Engl J Med 2010 362 2 118 128 10.1056/NEJMoa0810652 20071701\n8. Langley RG Elewski BE Lebwohl M Secukinumab in plaque psoriasis–results of two phase 3 trials New Engl J Med 2014 371 4 326 338 10.1056/NEJMoa1314258 25007392\n9. McInnes IB Mease PJ Kirkham B Secukinumab, a human anti-interleukin-17A monoclonal antibody, in patients with psoriatic arthritis (FUTURE 2): a randomised, double-blind, placebo-controlled, phase 3 trial Lancet 2015 386 9999 1137 1146 10.1016/S0140-6736(15)61134-5 26135703\n10. Baeten D Sieper J Braun J Secukinumab, an interleukin-17A inhibitor, in ankylosing spondylitis New Engl J Med 2015 373 26 2534 2548 10.1056/NEJMoa1505066 26699169\n11. European Medicines Agency. Summary of product characteristics (Secukinumab). http://www.ema.europa.eu/docs/en_GB/document_library/EPAR_-_Product_Information/human/003729/WC500183129.pdf. Accessed May 17, 2018.\n12. Novartis US. Summary of prescribing information (Secukinumab). https://www.pharma.us.novartis.com/sites/www.pharma.us.novartis.com/files/cosentyx.pdf. Accessed May 17, 2018.\n13. Gladman DD Poulin Y Adams K Treating psoriasis and psoriatic arthritis: position paper on applying the treat-to-target concept to Canadian daily practice J Rheum 2017 44 4 519 534 10.3899/jrheum.161473 28604347\n14. Armstrong AW Siegel MP Bagel J From the medical board of the National Psoriasis Foundation: treatment targets for plaque psoriasis J Am Acad Dermatol 2017 76 2 290 298 10.1016/j.jaad.2016.10.017 27908543\n15. Armstrong AW Schupp C Wu J Bebo B Quality of life and work productivity impairment among psoriasis patients: findings from the National Psoriasis Foundation survey data 2003-2011 PLoS One 2012 7 12 e52935 10.1371/journal.pone.0052935 23285231\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": null,
"issue": "8(4)",
"journal": "Dermatology and therapy",
"keywords": "Moderate to severe psoriasis; Secukinumab; Ustekinumab",
"medline_ta": "Dermatol Ther (Heidelb)",
"mesh_terms": null,
"nlm_unique_id": "101590450",
"other_id": null,
"pages": "571-579",
"pmc": null,
"pmid": "30334147",
"pubdate": "2018-12",
"publication_types": "D016428:Journal Article",
"references": "26699169;25007392;18486740;23285231;27908543;20071701;26092291;28439340;28604347;27663079;26135703;30109481;18486739",
"title": "Secukinumab is Superior to Ustekinumab in Clearing Skin in Patients with Moderate to Severe Plaque Psoriasis (16-Week CLARITY Results).",
"title_normalized": "secukinumab is superior to ustekinumab in clearing skin in patients with moderate to severe plaque psoriasis 16 week clarity results"
} | [
{
"companynumb": "US-JNJFOC-20181232425",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "USTEKINUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "The risk of developing Hodgkin lymphoma (HL) is increased in immunodeficiencies or during the treatment of some autoimmune diseases. The development of new therapeutic agents has highlighted the risk of unusual lymphoid proliferations, particularly classical HL (cHL). We report the clinicopathological findings of 13 cHL arising in patients treated for a primary haematological malignancy. Eight patients had received an immunomodulator, protein tyrosine-kinase inhibitor or monoclonal antibody, which may have contributed to the cHL development. Most patients had disseminated disease with poor prognostic factors at cHL diagnosis. Despite the initial presentation, good outcomes were achieved with standard cHL chemotherapy.",
"affiliations": "Department of Haemato-Oncology, Saint-Louis Hospital, Assistance Publique-Hôpitaux de Paris, Université Paris 7-Diderot, Paris, France.",
"authors": "Cheminant|Morgane|M|;Galicier|Lionel|L|;Brière|Josette|J|;Boutboul|David|D|;Micléa|Jean-Michel|JM|;Venon|Marie-Dominique|MD|;Robin|Marie|M|;Thieblemont|Catherine|C|;Brice|Pauline|P|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1111/j.1365-2141.2012.09202.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-1048",
"issue": "158(5)",
"journal": "British journal of haematology",
"keywords": null,
"medline_ta": "Br J Haematol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D005260:Female; D019337:Hematologic Neoplasms; D006689:Hodgkin Disease; D006801:Humans; D016130:Immunophenotyping; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D016896:Treatment Outcome",
"nlm_unique_id": "0372544",
"other_id": null,
"pages": "644-8",
"pmc": null,
"pmid": "22734472",
"pubdate": "2012-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Therapy-related classical Hodgkin lymphoma after a primary haematological malignancy: a report on 13 cases.",
"title_normalized": "therapy related classical hodgkin lymphoma after a primary haematological malignancy a report on 13 cases"
} | [
{
"companynumb": "PHHY2012FR055041",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugadditional": null,
"drugad... |
{
"abstract": "OBJECTIVE\nBecause of concerns about malignancy risks, using biological disease-modifying antirheumatic drugs (bDMARDs) in patients with a history of malignancy remains a challenging issue in rheumatology practice. This study aimed to investigate bDMARD preferences of physicians when treating of rheumatoid arthritis (RA) and spondyloarthritis (SpA) patients with a history of malignancy.\n\n\nMETHODS\nThe data for this cross-sectional study were gathered from the TReasure database using a date range of December 2017 and January 2020. Biological disease-modifying antirheumatic drug preferences were analyzed for 40 RA patients and 25 SpA patients with a history of malignancy.\n\n\nRESULTS\nThe most frequently prescribed bDMARD was rituximab, which was given to 28 RA patients (70%). For 25 patients (62.5%), the time between the diagnosis of malignancy and starting on a bDMARD regimen was less than 60 months, with a median interval of 43.5 months. Among SpA patients, the preferred bDMARDs were secukinumab and etanercept, which were each administered to 7 patients (28%). For 13 SpA patients (52%), the time between the diagnosis of malignancy and starting on bDMARDs was less than 60 months, with a median interval of 97 months.\n\n\nCONCLUSIONS\nThe observed bDMARD preferences may be related to the therapeutic effects of rituximab on lymphoproliferative malignancies, the protective effects of secukinumab on tumor progression, and the short half-life of etanercept. Biological disease-modifying antirheumatic drugs should be used in RA and SpA patients with malignancy in case of high inflammatory activity.",
"affiliations": "From the *Division of Rheumatology, Department of Internal Medicine, University of Health Sciences, Gulhane Faculty of Medicine †Division of Rheumatology, Department of Internal Medicine, Hacettepe University Faculty of Medicine ‡Division of Rheumatology, Department of Internal Medicine, Ankara Yıldırım Beyazıt University Faculty of Medicine, Ankara §Division of Rheumatology, Department of Internal Medicine, Eskisehir Osmangazi University Faculty of Medicine, Eskisehir ∥Division of Rheumatology, Department of Internal Medicine, University of Health Sciences, Bakırkoy Dr. Sadi Konuk Training and Research Hospital, Istanbul ¶Division of Rheumatology, Department of Internal Medicine, Uludag University Faculty of Medicine, Bursa #Division of Rheumatology, Department of Internal Medicine, Ankara City Hospital, Ankara **Division of Rheumatology, Department of Internal Medicine, Koc University Faculty of Medicine, Istanbul ††Division of Rheumatology, Department of Internal Medicine, Izmir Katip Celebi University Faculty of Medicine, Izmir ‡‡Division of Rheumatology, Department of Internal Medicine, Faculty of Medicine, Tekirdag Namık Kemal University, Tekirdag §§Division of Rheumatology, Department of Internal Medicine, Akdeniz University Faculty of Medicine, Antalya ∥∥Division of Rheumatology, Department of Internal Medicine, Marmara University Faculty of Medicine, Istanbul, Turkey.",
"authors": "Tekgoz|Emre|E|;Colak|Seda|S|;Yardimci|Kubra G|KG|;Kucuksahin|Orhan|O|;Cınar|Muhammet|M|;Yilmaz|Sedat|S|;Kasifoglu|Timucin|T|;Bes|Cemal|C|;Yagiz|Burcu|B|;Erden|Abdulsamet|A|;Kilic|Levent|L|;Kanitez|Nilufer A|NA|;Ertenli|Ali I|AI|;Coskun|Belkis N|BN|;Ediboglu|Elif D|ED|;Mercan|Ridvan|R|;Kiraz|Sedat|S|;Yazisiz|Veli|V|;Karadag|Omer|O|;Atagunduz|Pamir|P|;Kalyoncu|Umut|U|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/RHU.0000000000001699",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1076-1608",
"issue": null,
"journal": "Journal of clinical rheumatology : practical reports on rheumatic & musculoskeletal diseases",
"keywords": null,
"medline_ta": "J Clin Rheumatol",
"mesh_terms": null,
"nlm_unique_id": "9518034",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34014053",
"pubdate": "2021-01-19",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Physicians' Biological Drug Preference in Patients With Rheumatoid Arthritis and Spondyloarthritis With a History of Malignancy: Perspectives From the Treasure Database.",
"title_normalized": "physicians biological drug preference in patients with rheumatoid arthritis and spondyloarthritis with a history of malignancy perspectives from the treasure database"
} | [
{
"companynumb": "TR-AMGEN-TURSP2022058248",
"fulfillexpeditecriteria": "2",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ADALIMUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "Specific treatment is available for only a few substances taken in overdose. We report here a patient who attempted suicide with a massive overdose of insulin and thyroxine, a combination not previously reported, and discuss the specific treatments given to mitigate the harmful effects of this combination.",
"affiliations": "Department of Chemical Pathology, Charing Cross and Westminster Medical School, Westminster Hospital, London.",
"authors": "Flood|J G|JG|;Williams|T D|TD|;Bacon|R C|RC|",
"chemical_list": "D007328:Insulin; D013974:Thyroxine",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-0947",
"issue": "44(12)",
"journal": "The British journal of clinical practice",
"keywords": null,
"medline_ta": "Br J Clin Pract",
"mesh_terms": "D062787:Drug Overdose; D004357:Drug Synergism; D006801:Humans; D007328:Insulin; D008297:Male; D008875:Middle Aged; D013406:Suicide, Attempted; D013974:Thyroxine",
"nlm_unique_id": "0372546",
"other_id": null,
"pages": "747-8",
"pmc": null,
"pmid": "2102224",
"pubdate": "1990-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Full recovery following massive overdose with insulin and thyroxine.",
"title_normalized": "full recovery following massive overdose with insulin and thyroxine"
} | [
{
"companynumb": "GB-NOVOPROD-32353",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INSULIN PORK\\INSULIN PURIFIED PORK"
},
"drugaddition... |
{
"abstract": "Vascular anomalies (VA), characterized by the abnormal development or growth of blood and/or lymphatic vessels, encompasses a spectrum of conditions with a range of symptoms and complications. VA are frequently associated with cutaneous complications that can cause significant morbidity. Systemic sirolimus has previously been shown to be effective in the treatment of complicated VA. There are limited studies to date on the use of topical sirolimus for the treatment of cutaneous manifestations of VA.\n\n\n\nRetrospective review of medical records of pediatric patients with VA treated with topical sirolimus at a single quaternary pediatric institution. Response was determined by clinical subjective and objective measures of improvement.\n\n\n\nTwenty-three patients with cutaneous VA manifestations were treated with topical sirolimus. Median age was 14 (range 4-27 years). The main indication for treatment was complication of lymphatic blebbing (82%, n = 19) including lymphatic fluid leakage, bleeding, pain, pruritus, swelling, or recurrent infection. Treatment course ranged from 109 to 1424 days with median of 622 days. No major side effects were reported. Eighty-six percent of patients (n = 20) had subjective or objective improvement of cutaneous lesions. Lymphatic blebbing complications improved in 90% (n = 17) of individuals. Eighty-two percent (n = 14) of patients not receiving concurrent systemic sirolimus demonstrated improvement with topical therapy. One patient electively stopped treatment due to pruritus and burning sensation.\n\n\n\nTopical sirolimus appears to be a beneficial therapy for lymphatic blebbing associated with lymphatic malformations or mixed malformations with a lymphatic component, although benefit in other VA remains unclear. Topical sirolimus was well-tolerated with minimal side effects.",
"affiliations": "Division of Hematology, Hemangioma and Vascular Malformation Center, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.;Division of Hematology, Hemangioma and Vascular Malformation Center, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.;Division of Pediatric Surgery, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Division of Hematology, Hemangioma and Vascular Malformation Center, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.",
"authors": "Badia|Priscila|P|0000-0002-7916-9022;Ricci|Kiersten|K|0000-0002-7253-5632;Gurria|Juan P|JP|;Dasgupta|Roshni|R|;Patel|Manish|M|;Hammill|Adrienne|A|0000-0003-0820-4924",
"chemical_list": "D007166:Immunosuppressive Agents; D020123:Sirolimus",
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.28088",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "67(4)",
"journal": "Pediatric blood & cancer",
"keywords": "blebs; lymphatic; sirolimus; topical; vascular malformations",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D000287:Administration, Topical; D000293:Adolescent; D000328:Adult; D002648:Child; D002675:Child, Preschool; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D044148:Lymphatic Abnormalities; D008297:Male; D012189:Retrospective Studies; D020123:Sirolimus; D012871:Skin Diseases; D054079:Vascular Malformations; D055815:Young Adult",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "e28088",
"pmc": null,
"pmid": "31930696",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Topical sirolimus for the treatment of cutaneous manifestations of vascular anomalies: A case series.",
"title_normalized": "topical sirolimus for the treatment of cutaneous manifestations of vascular anomalies a case series"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/20/0121309",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SIROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nMultidrug-resistant Acinetobacter baumannii (MDRAB) has emerged as an increasingly important pathogen that causes nosocomial meningitis. However, MDRAB-associated nosocomial meningitis is rarely reported in children.\n\n\nMETHODS\nWe report the case of a 1-year-old girl with a choroid plexus papilloma, who developed postoperative nosocomial meningitis due to MDRAB. The bacterial strain was sensitive only to tigecycline and colistin, and showed varying degrees of resistance to penicillin, amikacin, ceftriaxone, cefixime, cefotaxime, ciprofloxacin, levofloxacin, gentamicin, meropenem, imipenem, and tobramycin. She was cured with intravenous doxycycline and intraventricular gentamicin treatment.\n\n\nCONCLUSIONS\nDoxycycline and gentamicin were shown to be effective and safe in the treatment of a pediatric case of MDRAB meningitis.",
"affiliations": "Department of Infectious Diseases, Children's Hospital of Fudan University, Shanghai 201102, China.;Department of General Medicine, Children's Hospital of Fudan University, Shanghai 201102, China.;Department of Infectious Diseases, Children's Hospital of Fudan University, Shanghai 201102, China.;Department of Infectious Diseases, Children's Hospital of Fudan University, Shanghai 201102, China. yuhui4756@sina.com.",
"authors": "Wu|Xia|X|;Wang|Lu|L|;Ye|Ying-Zi|YZ|;Yu|Hui|H|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12998/wjcc.v7.i24.4342",
"fulltext": "\n==== Front\nWorld J Clin CasesWJCCWorld Journal of Clinical Cases2307-8960Baishideng Publishing Group Inc jWJCC.v7.i24.pg434210.12998/wjcc.v7.i24.4342Case ReportPostoperative multidrug-resistant Acinetobacter baumannii meningitis successfully treated with intravenous doxycycline and intraventricular gentamicin: A case report Wu Xia Department of Infectious Diseases, Children’s Hospital of Fudan University, Shanghai 201102, ChinaWang Lu Department of General Medicine, Children’s Hospital of Fudan University, Shanghai 201102, ChinaYe Ying-Zi Department of Infectious Diseases, Children’s Hospital of Fudan University, Shanghai 201102, ChinaYu Hui Department of Infectious Diseases, Children’s Hospital of Fudan University, Shanghai 201102, China. yuhui4756@sina.comAuthor contributions: Wu X and Wang L contributed equally to this work; Wu X and Wang L designed and wrote the report; Ye YZ and Yu H reviewed the manuscript for its intellectual content and revised the entire work; all authors have read and approved the final manuscript.\n\nSupported by The Shanghai Pujiang Program, No. 12PJ1401500.\n\nCorresponding author: Hui Yu, PhD, Chief Doctor, Department of Infectious Diseases, Children’s Hospital of Fudan University, No. 399, Wanyuan Road, Shanghai 201102, China. yuhui4756@sina.com\n\nTelephone: +86-21-64931184 Fax: +86-21-64931184\n\n26 12 2019 26 12 2019 7 24 4342 4348 18 9 2019 11 11 2019 23 11 2019 ©The Author(s) 2019. Published by Baishideng Publishing Group Inc. All rights reserved.2019This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial.BACKGROUND\nMultidrug-resistant Acinetobacter baumannii (MDRAB) has emerged as an increasingly important pathogen that causes nosocomial meningitis. However, MDRAB-associated nosocomial meningitis is rarely reported in children.\n\nCASE SUMMARY\nWe report the case of a 1-year-old girl with a choroid plexus papilloma, who developed postoperative nosocomial meningitis due to MDRAB. The bacterial strain was sensitive only to tigecycline and colistin, and showed varying degrees of resistance to penicillin, amikacin, ceftriaxone, cefixime, cefotaxime, ciprofloxacin, levofloxacin, gentamicin, meropenem, imipenem, and tobramycin. She was cured with intravenous doxycycline and intraventricular gentamicin treatment.\n\nCONCLUSION\nDoxycycline and gentamicin were shown to be effective and safe in the treatment of a pediatric case of MDRAB meningitis.\n\n Acinetobacter baumanniiMeningitisDoxycyclineGentamicinMultidrug resistanceCase report\n==== Body\nCore tip: Multidrug-resistant Acinetobacter baumannii (MDRAB) is a troublesome pathogen owing to multidrug resistance. Postoperative nosocomial meningitis due to Acinetobacter baumannii is rarely reported in children. Nosocomial meningitis due to MDRAB is fatal and its treatment is challenging because of the low blood-brain barrier permeability of antibiotic drugs. We describe the case of a child who developed post-neurosurgical meningitis due to MDRAB that was effectively treated by the combination of intravenous doxycycline and intraventricular gentamicin administration.\n\nINTRODUCTION\nAcinetobacter baumannii (A. baumannii) is a Gram-negative bacterium that causes various nosocomial infections[1,2]. Postoperative nosocomial meningitis due to A. baumannii is rarely reported in children. Treatment of A. baumannii infection is of concern due to the increasing prevalence of multidrug resistance[3]. In this report, we present the case of a child who developed post-neurosurgical meningitis due to multidrug-resistant A. baumannii (MDRAB). The child was successfully treated with intravenous doxycycline and intraventricular gentamicin administration. This report also presents a systematic literature review concerning MDRAB-associated nosocomial meningitis in children.\n\nCASE PRESENTATION\nChief complaints\nA 1-year-old girl with head trauma was admitted to our hospital in November 2016. At four weeks after surgery, the patient was febrile and disturbance of consciousness was observed.\n\nHistory of present illness\nThe patient fell off the bed and mild head trauma was suspected. Incidentally, a computed tomography (CT) scan of the head revealed an intracranial space-occupying lesion (Figure 1A). One week after the admission, the child underwent a brain tumor resection. Immunohistochemical staining of the specimens indicated a choroid plexus papilloma. On the fourth postoperative week, she suddenly developed an altered state of consciousness with febrile illness. External ventricular drainage was performed. During the course of the disease, the patient had no diarrhea, abdominal pain, nausea, vomiting, cold, or any other discomfort.\n\nFigure 1 Computed tomography images. A: Computed tomography (CT) showed an intracranial space-occupying lesion; B-G: CT examination results during patient follow-up.\n\nHistory of past illness\nThe patient had no medical history of chronic diseases such as diabetes, coronary and other heart diseases, infectious diseases such as hepatitis and tuberculosis, surgery, blood transfusion, trauma, and drug allergy. The patient’s history of preventive inoculation was unknown.\n\nPersonal and family history\nShe was operated for a choroid plexus papilloma in November 2016. The rest of the personal and family history was unexceptional.\n\nPhysical examination upon admission\nAt admission, the patient showed stable vital signs; however, the skin on the right side of the forehead was swollen, approximately 5.5 cm × 4 cm in size. On the fourth postoperative week, she suddenly developed an altered state of consciousness and hypertonia of limbs, along with the disappearance of the direct and indirect pupillary light reflexes.\n\nLaboratory examinations\nCerebrospinal fluid (CSF) examination showed a white blood cell count of 500/mm3. The patient was diagnosed with meningitis and intravenous administrations of meropenem (120 mg/kg/d divided q8h) and vancomycin (60 mg/kg/d divided q6h) were initiated; however, the patient did not show any improvement. After 5 d, CSF analysis showed a white blood cell count of 40000/mm3, protein concentration of 573 mg/dL, and glucose concentration of 0 mmol/L. CSF culture was positive for A. baumannii, which was sensitive only to tigecycline and colistin while it showed varying degrees of resistance to penicillin, amikacin, ceftriaxone, cefixime, cefotaxime, ciprofloxacin, levofloxacin, gentamicin, meropenem, imipenem, and tobramycin.\n\nFINAL DIAGNOSIS\nPostoperative MDRAB meningitis.\n\nTREATMENT\nAs colistin has severe side effects in children, the patient was started on tigecycline (2 mg/kg/d divided q12h). After 12 d of antibiotic therapy with tigecycline, the patient still had a fever. The CSF culture was positive for MDRAB. Doxycycline is known to be active against MDRAB and was administered to the patient following the failure of tigecycline (4 mg/kg/d divided q12h) and intraventricular gentamicin (2 mg/d, once daily) was administered. The patient became afebrile 6 d later. After 17 d, the CSF was found to be sterile. Doxycycline and gentamicin were administered for 8 wk. The clinical course of the patient is shown in Figure 2.\n\nFigure 2 Clinical course of a 1-year-old patient with multidrug-resistant Acinetobacter baumannii meningitis. CTRX: Ceftriaxone (Rocephin); MEPM: Meropenem; VAN: Vancomycin; TGC: Tigecycline; DO: Doxycycline; GM: Gentamicin; WBC: White blood cell; CRP: C-reactive protein; CSF: Cerebrospinal fluid; ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; BUN: Blood urea nitrogen; Cr: Creatinine.\n\nOUTCOME AND FOLLOW-UP\nThere were no serious side effects of doxycycline and gentamicin treatment. The patient is now healthy and is receiving scheduled follow-up and her CT examination results remained normal at the subsequent two-year follow-up (Figure 1).\n\nDISCUSSION\nMDRAB is a troublesome pathogen in healthcare institutions owing to multidrug resistance, which is a threat to the current antibiotic era[4]. Nosocomial meningitis due to MDRAB is fatal and its treatment is challenging because of the low blood-brain barrier permeability of antibiotic drugs[5,6]. Thus, the choice of antibiotics is critical to the treatment of nosocomial MDRAB meningitis. It is also important to analyze the blood and CSF cultures before treatment initiation to avoid inappropriate antibiotic use. In the present case, CSF culture showed the presence of MDRAB that was sensitive only to tigecycline and colistin.\n\nIn the past, colistin had been used successfully against Gram-negative bacteria; however, its prescription decreased due to nephrotoxicity[7]. Tigecycline is a broad-spectrum bacteriostatic compound of glycylcyclines, which is active against several multidrug-resistant pathogens as well as MDRAB[8]. In our case, tigecycline was initially administered intravenously, but the patient did not respond to the treatment and continued to manifest typical signs of meningitis. The possible explanation of the therapeutic failure of intravenous tigecycline treatment could be attributed to its poor ability to penetrate through the blood-brain barrier. Thus, a combination of intravenous and intraventricular (IVT) antibiotic administration may be a therapeutic option to ensure sterilization of the CSF. Both doxycycline and tigecycline belong to the tetracycline class of antibiotics. Doxycycline was administered following the failure of tigecycline, known to be active against MDRAB. In our case, doxycycline was effective in the treatment of the CNS infection, which may be explained by an increased doxycycline distribution in the CNS owing to the disruption of the blood-brain barrier, in inflammatory diseases like meningitis. However, further pharmacological studies are needed to confirm this observation. Moreover, the intraventricular gentamicin administration could effectively sterilize the CSF.\n\nMDRAB has emerged as an increasingly important pathogen often associated with post-neurosurgical meningitis[9]. In the literature, the number of pediatric cases with MDRAB meningitis is low. Data regarding the clinical characteristics, therapy, and treatment outcomes in pediatric cases are summarized in Table 1[10-15]. Since active antibiotics including tigecycline and colistin diffuse poorly to the central nervous system, it is a challenge to treat patients via intravenous administration of these drugs. The IVT administration of these antibiotics is currently the only treatment option for MDRAB meningitis.\n\nTable 1 Clinical features of the reported series of multidrug-resistant Acinetobacter baumannii meningitis in children\n\nRef.\tAge (yr)\tSex\tAcinetobacter susceptibility\tFinal regimen(s)\tToxicity\tTreatment outcome\t\nKaplan et al[10]\t4\tNR\tMultidrug resistant\tCefotaxime and aminoglycoside IV, and colistin IVR\tNone\tCure\t\nNg et al[11]\t4\tMale\tMultidrug resistant\tAmikacin and colistin IV, and colistin IT\tChemical meningitis\tCure\t\nOzdemir et al[12]\t3\tFemale\tColistin\tColistin and ampicillin–sulbactam IV, and colistin IT\tNone\tCure\t\n14\tFemale\tColistin\tMeropenem and ampicillin–sulbactam IV, and rifampin PO\tNone\tCure\t\n1\tMale\tColistin\tColistin and meropenem IV\tNone\tCure\t\nLee et al[13]\t3\tMale\tImipenem\tColistin IV\tNone\tCure\t\nGanjeifar et al[14]\t6\tMale\tDoxycycline and rifampin\tColistin and rifampin IV, and colistin IVR\tNR\tCure\t\nJiménez-Mejías et al[15]\t14\tMale\tColistin\tColistin IV\tNone\tCure\t\nIT: Intrathecal; IV: Intravenous; IVR: Intraventricular; PO: Peroral; NR: Not reported.\n\nCONCLUSION\nIn conclusion, this case suggests that the combination of intravenous doxycycline and intraventricular gentamicin administration may be a potentially effective and safe therapeutic option for the treatment of childhood MDRAB meningitis.\n\nInformed consent statement: The patient’s family members provided written informed consent.\n\nConflict-of-interest statement: The authors have no conflicts of interest to declare.\n\nCARE Checklist (2016) statement: The manuscript was prepared and revised according to the CARE Checklist (2016).\n\nManuscript source: Unsolicited manuscript\n\nPeer-review started: September 18, 2019\n\nFirst decision: October 24, 2019\n\nArticle in press: November 23, 2019\n\nSpecialty type: Medicine, Research and Experimental\n\nCountry of origin: China\n\nPeer-review report classification\n\nGrade A (Excellent): 0\n\nGrade B (Very good): B\n\nGrade C (Good): C\n\nGrade D (Fair): D\n\nGrade E (Poor): 0\n\nP-Reviewer: Cure E, Schwan WR, Yellanthoor RB S-Editor: Zhang L L-Editor: Wang TQ E-Editor: Wu YXJ\n==== Refs\n1 Munoz-Price LS Weinstein RA Acinetobacter infection N Engl J Med 2008 358 1271 1281 18354105 \n2 Bergogne-Bérézin E Towner KJ Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features Clin Microbiol Rev 1996 9 148 165 8964033 \n3 Peleg AY Seifert H Paterson DL Acinetobacter baumannii: emergence of a successful pathogen Clin Microbiol Rev 2008 21 538 582 18625687 \n4 Kim BN Peleg AY Lodise TP Lipman J Li J Nation R Paterson DL Management of meningitis due to antibiotic-resistant Acinetobacter species Lancet Infect Dis 2009 9 245 255 19324297 \n5 Jain R Danziger LH Multidrug-resistant Acinetobacter infections: an emerging challenge to clinicians Ann Pharmacother 2004 38 1449 1459 15280512 \n6 Levin AS Barone AA Penço J Santos MV Marinho IS Arruda EA Manrique EI Costa SF Intravenous colistin as therapy for nosocomial infections caused by multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clin Infect Dis 1999 28 1008 1011 10452626 \n7 Karageorgopoulos DE Falagas ME Current control and treatment of multidrug-resistant Acinetobacter baumannii infections Lancet Infect Dis 2008 8 751 762 19022191 \n8 Pankey GA Tigecycline J Antimicrob Chemother 2005 56 470 480 16040625 \n9 Giamarellou H Antoniadou A Kanellakopoulou K Acinetobacter baumannii: a universal threat to public health? Int J Antimicrob Agents 2008 32 106 119 18571905 \n10 Kaplan SL Patrick CC Cefotaxime and aminoglycoside treatment of meningitis caused by gram-negative enteric organisms Pediatr Infect Dis J 1990 9 810 814 2263430 \n11 Ng J Gosbell IB Kelly JA Boyle MJ Ferguson JK Cure of multiresistant Acinetobacter baumannii central nervous system infections with intraventricular or intrathecal colistin: case series and literature review J Antimicrob Chemother 2006 58 1078 1081 16916866 \n12 Ozdemir H Tapisiz A Ciftçi E Ince E Mokhtari H Güriz H Aysev AD Doğru U Successful treatment of three children with post-neurosurgical multidrug-resistant Acinetobacter baumannii meningitis Infection 2010 38 241 244 20358244 \n13 Lee SY Lee JW Jeong DC Chung SY Chung DS Kang JH Multidrug-resistant Acinetobacter meningitis in a 3-year-old boy treated with i.v. colistin Pediatr Int 2008 50 584 585 18937759 \n14 Ganjeifar B Zabihyan S Baharvahdat H Baradaran A Multidrug-resistant Acinetobacter baumannii ventriculitis: a serious clinical challenge for neurosurgeons Br J Neurosurg 2016 30 589 590 27387018 \n15 Jiménez-Mejías ME Pichardo-Guerrero C Márquez-Rivas FJ Martín-Lozano D Prados T Pachón J Cerebrospinal fluid penetration and pharmacokinetic/pharmacodynamic parameters of intravenously administered colistin in a case of multidrug-resistant Acinetobacter baumannii meningitis Eur J Clin Microbiol Infect Dis 2002 21 212 214 11957024\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2307-8960",
"issue": "7(24)",
"journal": "World journal of clinical cases",
"keywords": " Acinetobacter baumannii; Case report; Doxycycline; Gentamicin; Meningitis; Multidrug resistance",
"medline_ta": "World J Clin Cases",
"mesh_terms": null,
"nlm_unique_id": "101618806",
"other_id": null,
"pages": "4342-4348",
"pmc": null,
"pmid": "31911917",
"pubdate": "2019-12-26",
"publication_types": "D002363:Case Reports",
"references": "20358244;18625687;19324297;27387018;19022191;18571905;11957024;2263430;18354105;16040625;8964033;10452626;18937759;15280512;16916866",
"title": "Postoperative multidrug-resistant Acinetobacter baumannii meningitis successfully treated with intravenous doxycycline and intraventricular gentamicin: A case report.",
"title_normalized": "postoperative multidrug resistant acinetobacter baumannii meningitis successfully treated with intravenous doxycycline and intraventricular gentamicin a case report"
} | [
{
"companynumb": "CN-AKRON, INC.-2080686",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AMIKACIN SULFATE"
},
"drugadditional": null,
... |
{
"abstract": "Antihypertensive agents such as spironolactone have been reported to cause lichenoid drug eruptions. Eruptive keratoacanthomas (KA), considered to be well-differentiated squamous cell carcinoma (SCC), may develop in the setting of such lichenoid reactions. Thus, definitive treatment is imperative. This case report describes a patient on spironolactone who developed a lichenoid drug eruption followed by eruptive KAs and SCC. The treatment approach used systemic methotrexate. While most treatment regimens for widespread eruptive KA/SCC employ intralesional methotrexate, this case demonstrated the utility of its systemic counterpart. This may have also facilitated the resolution of the patient's lichenoid eruption. There are only three other reports in the literature describing a spironolactone-induced lichenoid drug eruption. Further investigations are needed to evaluate the adverse cutaneous effects of spironolactone as well as the efficacy of systemic methotrexate in treating patients with a significant number of SCCs arising from lichenoid drug eruptions.",
"affiliations": "Medicine, University of Central Florida College of Medicine, Orlando, USA.;Dermatopathology, New York Medical College, Valhalla, USA.;Internal Medicine, University of Central Florida College of Medicine, Orlando, USA.",
"authors": "Kunadia|Anuj|A|;Shulman|Kenneth|K|;Sami|Naveed|N|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.17713",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184\nCureus Palo Alto (CA)\n\n10.7759/cureus.17713\nDermatology\nInternal Medicine\nSpironolactone-Induced Lichenoid Drug Reaction and Subsequent Diffuse Eruptive Squamous Cell Carcinomas Successfully Treated With Systemic Methotrexate\nMuacevic Alexander\nAdler John R\nKunadia Anuj 1\nShulman Kenneth 2\nSami Naveed 3\n1 Medicine, University of Central Florida College of Medicine, Orlando, USA\n2 Dermatopathology, New York Medical College, Valhalla, USA\n3 Internal Medicine, University of Central Florida College of Medicine, Orlando, USA\nNaveed Sami naveed.sami@ucf.edu\n4 9 2021\n9 2021\n13 9 e1771318 7 2021\n4 9 2021\nCopyright © 2021, Kunadia et al.\n2021\nKunadia et al.\nhttps://creativecommons.org/licenses/by/3.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nThis article is available from https://www.cureus.com/articles/65824-spironolactone-induced-lichenoid-drug-reaction-and-subsequent-diffuse-eruptive-squamous-cell-carcinomas-successfully-treated-with-systemic-methotrexate\nAntihypertensive agents such as spironolactone have been reported to cause lichenoid drug eruptions. Eruptive keratoacanthomas (KA), considered to be well-differentiated squamous cell carcinoma (SCC), may develop in the setting of such lichenoid reactions. Thus, definitive treatment is imperative. This case report describes a patient on spironolactone who developed a lichenoid drug eruption followed by eruptive KAs and SCC. The treatment approach used systemic methotrexate. While most treatment regimens for widespread eruptive KA/SCC employ intralesional methotrexate, this case demonstrated the utility of its systemic counterpart. This may have also facilitated the resolution of the patient’s lichenoid eruption. There are only three other reports in the literature describing a spironolactone-induced lichenoid drug eruption. Further investigations are needed to evaluate the adverse cutaneous effects of spironolactone as well as the efficacy of systemic methotrexate in treating patients with a significant number of SCCs arising from lichenoid drug eruptions.\n\nkeratoacanthoma\nlichenoid drug eruption\nspironolactone\nspironolactone drug reaction\ncutaneous drug reaction\nsquamous cell carcinoma\nThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\npmcIntroduction\n\nLichenoid drug eruptions have been attributed to various drugs. Antihypertensive agents such as methyldopa and, less frequently, spironolactone have been reported to cause cutaneous eruptions demonstrating clinical and histopathological characteristics consistent with lichen planus [1]. Additionally, there have been reports of eruptive keratoacanthoma (KA) developing in the setting of such lichenoid reactions [2]. KAs are considered to be well-differentiated squamous cell carcinoma (SCC) with metastatic potential. Thus, definitive treatment is imperative to avoid potentially life-threatening complications [3,4]. This case describes a patient on spironolactone who presented with an associated lichenoid drug eruption followed by eruptive KAs and SCC, treated with systemic methotrexate.\n\nCase presentation\n\nA 74-year-old female presented with a six-month history of a diffuse pruritic cutaneous eruption on the upper and lower extremities (images of lower extremity are shown in Figure 1 (A, B). The eruption started three weeks after starting spironolactone (50mg/d) for the treatment of hypertension. Her past medical history included polymyalgia rheumatica (PMR) managed with prednisone (3mg/d). The patient did not have any other associated history including infectious hepatitis (B or C) or thyroid dysfunction. A punch biopsy of the skin lesion revealed a psoriasiform and lichenoid dermatitis with eosinophils most consistent with a drug eruption (Figure 2). Spironolactone was considered the most likely cause due to the timeline of its initiation and onset of the rash. The patient was treated with topical triamcinolone 0.1% ointment and tacrolimus 0.1% ointment each applied to affected areas once a day and intramuscular (IM) triamcinolone injection 1 mL of 40.0 mg/mL.\n\nFigure 1 A. Erythematous irregularly shaped macules and plaques on the right lateral thigh (before treatment). B. Resolved lesions on the right lateral thigh (after treatment) with mild residual erythema.\n\nFigure 2 A. Biopsy demonstrating lichenoid dermatitis (red arrow) with focal parakeratosis (green arrow) at 10x magnification. B. Biopsy demonstrating lichenoid with interface dermatitis (blue arrow) changes and a few eosinophils dermatitis (yellow arrow) at 20x magnification.\n\nAt her one-month follow-up, the patient stated she noticed newer lesions that were different from her initial eruption on the upper and lower extremities. These lesions were tender hyperkeratotic erythematous papules, some of which were crateriform and dome-shaped. Biopsies of multiple lesions from three different anatomical sites revealed SCC-KA type and well-differentiated SCCs (Figure 3). Since there were numerous similar small cutaneous lesions along with her history of PMR, which needed a steroid sparing agent, methotrexate was initiated and titrated to 15mg/wk. She demonstrated notable improvement of both her cutaneous and rheumatological conditions. After three months, only two residual SCCs needed surgical excision. The patient continues to do well at her ten-month follow-up with no new lichenoid eruption and SCCs. \n\nFigure 3 A. Biopsy from the left radial dorsal hand demonstrating a crateriform proliferation of atypical keratinocytes with glassy eosinophlic cytoplasms infiltrating the dermis (yellow arrow) at 2x magnification, consistent with squamous cell carcinoma-keratoacanthoma type. B. Biopsy from the right proximal dorsal forearm demonstrating irregular aggregates of atypical keratinocytes infiltrating the dermis (blue arrow) at 4x magnification, consistent with a well-differentiated squamous cell carcinoma.\n\nDiscussion\n\nSpironolactone is a nonselective mineralocorticoid receptor antagonist, which can also bind to androgen and progesterone receptors. It is commonly used to treat hypertension and heart failure, with off-label use in acne. Common adverse effects include gynecomastia and hyperkalemia [5]. A less common side effect is various skin rashes [6-8]. A literature search in PubMed resulted in only three other reports describing a spironolactone-induced lichenoid drug eruption (Table 1). These cases were reported in women aged 62-74 years. One study reported a spironolactone dose of 100mg/day. All cases had cutaneous involvement and exhibited resolution of the lichenoid eruption upon withdrawal of spironolactone, taking an average of seven weeks to resolve (ranging from two weeks to about three months) [1,7,8]. One case in the literature exhibited residual erythema and peripheral hyperpigmentation, similar to our patient, who also had mild erythema. Residual changes were not described in the other cases.\n\nTable 1 Review of spironolactone-induced lichenoid cutaneous eruptions reported in literature, including current case.\n\nSCC: squamous cell carcinoma\n\nCase\tAge\tSex\tTime from spironolactone initiation to lichenoid eruption\tDose\tResolution upon withdrawal of spironolactone?\tTime from spironolactone cessation to eruption resolution\t\nCurrent\t74\tF\t3 weeks\t50mg/day\tYes\t3 months with two residual SCCs requiring excision\t\nDownham [1]\t62\tF\tNot Reported\tNot Reported\tYes\tWithin 3 months with residual erythema and peripheral hyperpigmentation remaining\t\nLark et al [7]\t74\tF\t7 months\t100mg/day\tYes\t2 weeks\t\nSchön et al [8]\t73\tF\tNot Reported\tNot Reported\tYes\t>2 months\t\n\nCases of similar eruptions may also arise in the setting of Grinspan’s syndrome, described as a triad of lichen planus, diabetes mellitus, and hypertension. It has been hypothesized that the lichenoid eruptions in Grinspan’s syndrome could be drug-induced from anti-hypertensive and anti-diabetic drugs [9]. While lichenoid eruptions have been more commonly associated with mucosal tissues, cutaneous eruption with nifedipine has also been reported. Moreover, malignant transformation of SCC in Grinspan’s syndrome has been only reported in oral lichen planus. This syndrome was unlikely in our patient due to the absence of oral involvement of her lichenoid eruption.\n\nCutaneous eruptive KAs arising in the setting of lichenoid reactions have also been previously described in the literature. Programmed cell death 1 (PD1) inhibitors such as nivolumab and pembrolizumab have been reported to induce lichenoid dermatitis and subsequent eruptive KAs [2,10]. While the exact mechanism is unclear, the proliferation of KAs may be analogous to those arising in hypertrophic lichens planus, verrucous lupus erythematosus, and other trauma, during which time wound healing is associated with a lichenoid host response [11]. The inflammatory environment of lichenoid reactions may also facilitate a kerato-acanthomatous reaction in predisposed individuals [2].\n\nThere are multiple treatment modalities, both medical and surgical, that have been used in the treatment of KAs including intralesional methotrexate, which may additionally be used for the treatment of SCC [12]. This case demonstrates that this treatment can be extrapolated to the use of systemic methotrexate for treating widespread eruptive KAs/SCCs. Systemic methotrexate may have also facilitated the resolution of the initial lichenoid eruption.\n\nConclusions\n\nThis case highlights the potential for spironolactone to induce a lichenoid drug reaction and consequent eruption of KAs and SCC. The described approach to treating the patient was to employ systemic methotrexate as an 'umbrella' therapy to successfully treat the widespread cutaneous eruptions along with her PMR as a steroid-sparing agent. Further investigations are needed to evaluate the adverse cutaneous effects of spironolactone, as well as the efficacy of systemic methotrexate in treating patients with a significant number of SCCs arising from lichenoid drug eruptions.\n\nHuman Ethics\n\nThe authors have declared that no competing interests exist.\n\nConsent was obtained or waived by all participants in this study\n==== Refs\nReferences\n\n1 Spironolactone-induced lichen planus JAMA Downham TF 1138 240 1978\n2 Eruptive keratoacanthomas arising in the setting of lichenoid toxicity after programmed cell death 1 inhibition with nivolumab J Eur Acad Dermatol Venereol Feldstein SI Patel F Larsen L Kim E Hwang S Fung MA 0 9 32 2018\n3 Keratoacanthoma: a clinically distinct variant of well differentiated squamous cell carcinoma Adv Anat Pathol Beham A Regauer S Soyer HP Beham-Schmid C 269 280 5 1998 https://pubmed.ncbi.nlm.nih.gov/10021894/ 10021894\n4 Keratoacanthoma: is it a real entity? Ann Plast Surg Manstein CH Frauenhoffer CJ Besden JE 469 472 40 1998 9600429\n5 Spironolactone Patibandla S Heaton J Kyaw H Treasure Island, FL StatPearls Publishing 2021 https://www.ncbi.nlm.nih.gov/books/NBK554421\n6 Spironolactone-associated cutaneous effects: a case report and a review of the literature Dermatology Gupta AK Knowles SR Shear NH 402 405 189 1994 7873830\n7 Lichenoid drug eruption induced by spironolactone Clin Exp Dermatol Clark C Douglas WS 43 44 23 1998 9667111\n8 Lichenoid drug eruption induced by spironolactone Acta Derm Venereol Schön MP Tebbe B Trautmann C Orfanos CE 476 74 1994 7701889\n9 Grinspan's syndrome: a drug-induced phenomenon? Oral Surg Oral Med Oral Pathol Lamey PJ Gibson J Barclay SC Miller S 184 185 70 1990 2290647\n10 Eruptive keratoacanthomas associated with pembrolizumab therapy JAMA Dermatol Freites-Martinez A Kwong BY Rieger KE Coit DG Colevas AD Lacouture ME 694 697 153 2017 28467522\n11 Clinico-morphological features of BRAF inhibition-induced proliferative skin lesions in cancer patients Cancer Belum VR Rosen AC Jaimes N 60 68 121 2015 25186461\n12 Cutaneous ultrasound for tumor thickness measurement in squamous cell carcinoma: the effect of neoadjuvant intralesional methotrexate in 40 patients Dermatol Surg Bergón-Sendín M Pulido-Pérez A Carretero López F Díez-Sebastián J Suárez-Fernández R 530 536 46 2020 31517661\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "13(9)",
"journal": "Cureus",
"keywords": "cutaneous drug reaction; keratoacanthoma; lichenoid drug eruption; spironolactone; spironolactone drug reaction; squamous cell carcinoma",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e17713",
"pmc": null,
"pmid": "34650887",
"pubdate": "2021-09",
"publication_types": "D002363:Case Reports",
"references": "9600429;2290647;10021894;9667111;28467522;28776778;7701889;682278;31517661;7873830;25186461",
"title": "Spironolactone-Induced Lichenoid Drug Reaction and Subsequent Diffuse Eruptive Squamous Cell Carcinomas Successfully Treated With Systemic Methotrexate.",
"title_normalized": "spironolactone induced lichenoid drug reaction and subsequent diffuse eruptive squamous cell carcinomas successfully treated with systemic methotrexate"
} | [
{
"companynumb": "US-OXFORD PHARMACEUTICALS, LLC-2121166",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SPIRONOLACTONE"
},
"drugaddition... |
{
"abstract": "Neuroleptic malignant syndrome (NMS) is a potentially lethal adverse drug reaction. We report a case of NMS potentially induced by dehydration in a female patient suffering from schizoaffective disorder. We discuss possible aetiologies and triggering factors alongside the existing literature.",
"affiliations": "Department of Psychiatry, Assistance Publique Hopitaux de Marseille, Marseille, France.;Department of Psychosis Studies, Institute of Psychiatry, Psychology and Neuroscience, King's College London, London, UK.;Department of Psychiatry, Assistance Publique Hopitaux de Marseille, Marseille, France.;Department of Psychiatry, Assistance Publique Hopitaux de Marseille, Marseille, France.",
"authors": "Korchia|Théo|T|;Blackman|Graham|G|;Cermolacce|Michel|M|;Richieri|Raphaëlle|R|",
"chemical_list": "D014150:Antipsychotic Agents; D009465:Neuromuscular Agents; D001569:Benzodiazepines; D003006:Clopenthixol",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-223922",
"fulltext": "\n==== Front\nBMJ Case RepBMJ Case RepcasereportsbmjcasereportsBMJ Case Reports1757-790XBMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR bcr-2017-22392210.1136/bcr-2017-223922Unexpected Outcome (Positive or Negative) Including Adverse Drug Reactions15061525Case ReportNeuroleptic malignant syndrome following reintroduction of an antipsychotic after overdose Korchia Théo 1Blackman Graham 2Cermolacce Michel 1Richieri Raphaëlle 1231 Department of Psychiatry, Assistance Publique Hopitaux de Marseille, Marseille, France2 Department of Psychosis Studies, Institute of Psychiatry, Psychology and Neuroscience, King’s College London, London, UK3 Institut Fresnel - UMR 7249, Faculté des Sciences de Saint Jérôme, Marseille, FranceCorrespondence to Dr Raphaëlle Richieri, raphaelle.richieri-le_rouzic@kcl.ac.uk2018 3 8 2018 3 8 2018 2018 bcr201722392214 7 2018 © BMJ Publishing Group Limited 2018. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2018This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.Neuroleptic malignant syndrome (NMS) is a potentially lethal adverse drug reaction. We report a case of NMS potentially induced by dehydration in a female patient suffering from schizoaffective disorder. We discuss possible aetiologies and triggering factors alongside the existing literature.\n\npsychiatry (drugs and medicines)unwanted effects / adverse reactionsspecial-featureunlocked\n==== Body\nBackground\nNeuroleptic malignant syndrome (NMS) is a potentially lethal adverse drug reaction that affects 0.2% to 3.2% of psychiatric inpatients.1 Despite being a well-recognised condition, the pathogenesis of NMS is not fully understood. Although many risk factors have been identified, predicting which patients will develop NMS and when, remains extremely difficult.2 We report a case of NMS and discuss possible aetiologies with reference to the existing literature.\n\nCase presentation\nA 57-year-old woman with an established diagnosis of schizoaffective disorder was admitted to the emergency department following an attempted suicide by taking an overdose of cyamemazine 750 mg (a first-generation antipsychotic of the phenothiazine class) and lercanidipine 300 mg (an antihypertensive of the dihydropyridine class of calcium channel blockers) tablets.\n\nShe had a medical history of obesity (body mass index 33 kg/m2), obstructive sleep apnoea, cholecystectomy, well-controlled hypertension, type 2 diabetes and hyperlipidaemia and was prescribed bisoprolol, lercanidipine, atorvastatin and metformin. For management of her schizoaffective symptoms, she was prescribed zuclopenthixol decanoate 300 mg monthly (a long-acting injectable antipsychotic) and cyamemazine 50 mg daily.\n\nShe was asymptomatic on arrival to the emergency department, however subsequently developed vasoplegic syndrome requiring admission to intensive care unit (ICU) and treatment with intravenous norepinephrine 4 mg/hour for hypotension. After a 3-day medical admission, she was transferred to a psychiatric ward.\n\nInvestigations\nOn admission to the psychiatric ward, she presented as depressed with mild anxiety and psychomotor agitation, with no evidence of suicidal ideation or psychotic symptoms. Blood tests were normal, except for persistently deranged liver function tests (aspartate aminotransferase, AST=59 IU/L; alanine aminotransferase, ALT=30 IU/L). Zuclopenthixol decanoate was continued, and cyamemazine (25 mg to 75 mg daily) was restarted for antipsychotic prophylaxis. Escitalopram (10 mg daily) was started for treatment of depressive symptoms.\n\nFive weeks into her admission on a psychiatric ward, a medication administration error occurred and instead of receiving zuclopenthixol decanoate, she was given 100 mg zuclopenthixol acetate intramuscularly (the short-acting form of the drug). The following day, she presented with acute confusion, which continued for 6 days. There was no evidence of hyperthermia, autonomic dysfunction, raised creatine kinase (CK) or white cell count (WCC). Zuclopenthixol was paused for 2 months before being restarted in tablet form (zuclopenthixol dihydrochloride; titrated from 5 to 40 mg daily over 2 weeks). Cyamemazine was continued at a low dose (50 mg to 100 mg daily) before being discontinued a week before the reintroduction of zuclopenthixol. The reintroduction of zuclopenthixol was initially well tolerated and led to an improvement in her anxiety and depressive symptoms.\n\nTwo weeks after restarting zuclopenthixol, she was noted to be clinically dehydrated with dry mucous membranes and reduced skin elasticity. Biochemical analysis revealed increased serum creatinine (141 µmol/L) and hypernatraemia (151 mmol/L), and she was commenced on intravenous fluids. Two days later, she developed confusion with stupor, hyperthermia (39.4°C), persistent hypertension (160/98 mm Hg) and severe muscle rigidity. She was transferred to ICU where blood tests revealed deranged CK (6326 IU/L), WCC (14 000/mm3), sodium (153 mmol/L), creatinine (117 µmol/L), fibrinogen (551 g/L) and evidence of hepatic cytolysis (AST=158 IU/L and ALT=76 IU/L). Electroencephalograms, head CT scan, lumbar puncture, blood cultures and urinalysis were all unremarkable.\n\nOutcome and follow-up\nA clinical diagnosis of NMS was made. All antipsychotics were discontinued, and she spent a 10-day period on ICU where she received rehydration therapy, muscle relaxants and regular benzodiazepines (oxazepam 30 mg daily) leading to full resolution of her neurological symptoms and confusion. After being transferred back to a psychiatry ward, she was not restarted on antipsychotic medication but was instead treated with a course of electroconvulsive therapy. This led to a significant improvement in her psychotic symptoms by the third session (20 days after the onset of NMS). At follow-up, 11 months after the onset of NMS, she remained neurologically intact and her schizoaffective symptoms remained partially controlled on maintenance electroconvulsive therapy (ECT) without antipsychotic medication.\n\nDiscussion\nWe describe a case of NMS occurring in a patient with schizoaffective disorder after receiving excessive amounts of antipsychotic medication on two occasions within a 6-week period: the first in the context of an attempted suicide and the second following an accidental overdose due to an administration error.\n\nAccording to Diagnostic and Statistical Manual of Mental Disorders (DSM-5), diagnosis of NMS requires a patient to meet the following major criteria: (1) exposure to a dopamine blocking agent, (2) severe muscle rigidity and (3) fever, and at least 2 of 10 minor criteria.3 Our patient presented all of the major criteria, and seven of the minor criteria (raised CK, diaphoresis, tachycardia, increased blood pressure and heart rate, altered consciousness and leucocytosis). While the patient clearly displayed the classic features indicative of NMS, there are several atypical aspects of the case worthy of discussion.\n\nNotably, the patient did not develop NMS until 2 months after the iatrogenic overdose of zuclopenthixol. This is surprising given that maximum serum concentration following intramuscular injection of zuclopenthixol acetate occurs after 24–48 hours, and plasma elimination half life is approximately 20 hours.4 Further, around the time of the medication error, additional risk factors for NMS were present, including concomitant treatment with two first-generation antipsychotics and psychomotor agitation.1 5 Instead, NMS occurred later while being prescribed a single antipsychotic (zuclopenthixol dihydrochloride) at a low dose.\n\nIn the present case, acute renal failure (ARF) and hepatic cytolysis were not the sequelae of NMS. Rather, they predated NMS, and therefore may have played a causative role2 6 by impairing the metabolism and excretion of zuclopenthixol leading to elevated serum concentrations of the drug. Also of note, escitalopram, which is a cytochrome P450 2D6 enzyme inhibitor, was prescribed at the time NMS developed, and therefore may have contributed towards raised serum concentrations of zuclopenthixol.\n\nThe pathogenesis of NMS can be considered a complex cascade of dysregulation of multiple neurochemical and neuroendocrine systems, culminating in an end-stage hypermetabolic syndrome.7 A central dopaminergic blockade theory has been proposed to explain NMS involving striatal and hypothalamic dopamine receptors.8 There is also evidence to suggest that dysregulation of the sympathetic nervous system may account for, at least some of, the features of NMS.9 Finally, more recently a neuroimmunological explanation of NMS has been proposed, implicating the role of proinflammatory cytokines.10 In our case report, the elevation of fibrinogen (an acute phase protein) is consistent with this later hypothesis, with the patient’s dehydration potentially acting as an inflammatory stimulus.\n\nThis case report highlights the importance of recognising that patients may develop NMS several years after starting antipsychotic therapy. Furthermore, NMS may occur any time, but particularly in the presence of additional risk factors, such as dehydration. ARF in the presence NMS is associated with a mortality risk of approximately 50%,11 therefore, it is vital that clinicians are vigilant for evidence of dehydration in patients treated with antipsychotics.\n\nPatient’s perspective\nThe ECT allowed me to resume activities that I had not been doing for several years as dancing, seeing friends, playing cards and improved substantially my quality of life.\n\nLearning points\nNeuroleptic malignant syndrome (NMS) is a serious and potentially lethal adverse drug reaction.\n\nNMS is unpredictable but is related to the administration of dopamine antagonists.\n\nNMS can be best described as a complex cascade of multiple dysregulated neurochemical and neuroendocrine systems, potentially culminating in an end-stage hypermetabolic syndrome.\n\nRisk factors for NMS, such as dehydration as well as renal and hepatic impairment, should be considered prior to, and during treatment with antipsychotics.\n\nThe authors thank the patient for her understanding and permission to publish her case.\n\nContributors: TK, MC: contributed to the acquisition or interpretation of data. TK, GB, MC, RR: drafted the work or revised it critically for important intellectual content. TK, GB, MC, RR: read the final version of this manuscript, approve its content and submission for publication. TK, GB, MC, RR: agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: None declared.\n\nPatient consent: Obtained.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n==== Refs\nReferences\n1 Pelonero AL , Levenson JL , Pandurangi AK \nNeuroleptic malignant syndrome: a review . Psychiatr Serv \n1998 ;49 :1163 –72 . 10.1176/ps.49.9.1163 9735957 \n2 Tse L , Barr AM , Scarapicchia V , et al \nNeuroleptic malignant syndrome: a review from a clinically oriented perspective . Curr Neuropharmacol \n2015 ;13 :395 –406 . 10.2174/1570159X13999150424113345 26411967 \n3 American Psychiatric Association . Diagnostic and statistical manual of mental disorders . 5th edn \nWashington, DC : American Psychiatric Publishing , 2013 .\n4 https://www.lundbeck.com/upload/il/files/pdf/patient_and_doctor_information/Clopixol_Acuphase_leafelt_pcr_approval.pdf \n5 Viejo LF , Morales V , Puñal P , et al \nRisk factors in neuroleptic malignant syndrome. A case-control study . Acta Psychiatr Scand \n2003 ;107 :45 –9 . 10.1034/j.1600-0447.2003.02385.x 12558541 \n6 Ninčević Ž , Lasić D , Glavina T , et al \nQuetiapine poisoning associated with neuroleptic malignant syndrome, rhabdomyolysis and renal failure: a case report . Psychiatr Danub \n2017 ;29 :84 –6 .28291979 \n7 Belvederi Murri M , Guaglianone A , Bugliani M , et al \nSecond-generation antipsychotics and neuroleptic malignant syndrome: systematic review and case report analysis . Drugs R D \n2015 ;15 :45 –62 . 10.1007/s40268-014-0078-0 25578944 \n8 Levenson JL \nNeuroleptic malignant syndrome . Am J Psychiatry \n1985 ;142 :1137 –45 . 10.1176/ajp.142.10.1137 2863986 \n9 Gurrera RJ \nSympathoadrenal hyperactivity and the etiology of neuroleptic malignant syndrome . Am J Psychiatry \n1999 ;156 :169 –80 . 10.1176/ajp.156.2.169 9989551 \n10 Anglin RE , Rosebush PI , Mazurek MF \nNeuroleptic malignant syndrome: a neuroimmunologic hypothesis . CMAJ \n2010 ;182 :E834 –E838 . 10.1503/cmaj.091442 20696799 \n11 Shalev A , Hermesh H , Munitz H \nMortality from neuroleptic malignant syndrome . J Clin Psychiatry \n1989 ;50 :18 –25 .\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "psychiatry (drugs and medicines); unwanted effects / adverse reactions",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D014150:Antipsychotic Agents; D001569:Benzodiazepines; D003006:Clopenthixol; D003681:Dehydration; D062787:Drug Overdose; D005260:Female; D005440:Fluid Therapy; D006801:Humans; D008875:Middle Aged; D009459:Neuroleptic Malignant Syndrome; D009465:Neuromuscular Agents; D011618:Psychotic Disorders",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30076161",
"pubdate": "2018-08-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "2562951;20696799;2863986;25578944;28291979;12558541;9735957;9989551;26411967",
"title": "Neuroleptic malignant syndrome following reintroduction of an antipsychotic after overdose.",
"title_normalized": "neuroleptic malignant syndrome following reintroduction of an antipsychotic after overdose"
} | [
{
"companynumb": "FR-LANNETT COMPANY, INC.-FR-2018LAN001177",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ZUCLOPENTHIXOL HYDROCHLORIDE"
},
... |
{
"abstract": "We report a case of bilateral acute angle closure glaucoma developing after prone position ventilation for severe COVID-19 pneumonia. A 53-year-old diabetic and hypertensive male developed blurred vision and ocular discomfort in both eyes after prone position ventilation for severe COVID-19 pneumonia. At initial examination he was noted to have diffuse corneal edema with shallow anterior chambers and mid dilated non reacting pupils. His intraocular pressure was 48 and 54 mm Hg in right and left eye, respectively. Following intravenous mannitol (20%) infusion, oral acetazolamide 250 mg 3 times daily, along with topical therapy with combination Brimonidine and Brinzolamide eye drops and Fluoromethalone eye drops his corneal edema resolved and subsequent to laser iridotomy his intraocular pressures lowered significantly and could be maintained below 16 mm Hg in both eyes with topical therapy alone. With prone position ventilation being a commonly used adjuvant treatment for acute respiratory distress syndrome associated with COVID-19 pneumonia, acute angle closure may be precipitated in these patients if they have pre-existing narrow angles. Awareness of the possibility and its recognition may allow prompt ophthalmic referral, early treatment and minimize visual consequences.",
"affiliations": "Department of Ophthalmology, Deenanath Mangeshkar Hospital and Research Centre, Erandawne, Near Mhatre Bridge, Pune, Maharashtra, India.",
"authors": "Nerlikar|Roopali R|RR|;Palsule|Aratee C|AC|;Vadke|Shantanu|S|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/IJG.0000000000001864",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1057-0829",
"issue": "30(8)",
"journal": "Journal of glaucoma",
"keywords": null,
"medline_ta": "J Glaucoma",
"mesh_terms": "D000086382:COVID-19; D015812:Glaucoma, Angle-Closure; D006801:Humans; D007429:Intraocular Pressure; D008297:Male; D008875:Middle Aged; D016684:Prone Position; D000086402:SARS-CoV-2",
"nlm_unique_id": "9300903",
"other_id": null,
"pages": "e364-e366",
"pmc": null,
"pmid": "33927149",
"pubdate": "2021-08-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17804920;12860820;30515243;21081770;32309812;33211075;32519360;20797650",
"title": "Bilateral Acute Angle Closure Glaucoma After Prone Position Ventilation for COVID-19 Pneumonia.",
"title_normalized": "bilateral acute angle closure glaucoma after prone position ventilation for covid 19 pneumonia"
} | [
{
"companynumb": "IN-MYLANLABS-2022M1006783",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "1",
... |
{
"abstract": "MEDICAL HISTORY AND CLINICAL COURSE: A 42-year-old patient with hairy cell leukemia had been treated for 3 years by a hematologist in private practice. Initially the patient received 1 course of cladribine upon which the disease went into complete remission. 6 weeks ago a relapse was diagnosed and combination therapy with cladibrin and rituximab was initiated. Now the patient presented to the emergency room with shortness of breath and pain when breathing.\n\n\nMETHODS\nIn the chest x-ray, patchy infiltrates and pleural effusions were found on both sides. The subsequently performed computed tomography showed bilateral compactions with an Halo suspicious for fungal infiltrates. Upon admission to the hospital, an empirical antibiotic therapy with clarithromycin and piperacillin/tazobactam was initiated, which was later escalated to meropenem and linezolid. Additionally, an antifungal therapy with voriconazole was started and later switched to liposomal amphotericin B. At his admission, a positive aspergillus antigen could be detected in the microbiological laboratory. Under antimycotic treatment the aspergillus antigen was repeatedly negative. The patient presented with pronounced cytopenias and after a switch of therapy to vemurafenib and filgrastim, the hematopoiesis could only be stimulated insufficiently. The patient was transferred to the intensive care unit three days after admission with severe respiratory failure. He died on day 8 after admission. AUTOPSY AND DIAGNOSIS: Diagnosis was consistent with relapse of hairy cell leukemia with positive BRAF mutation and a bone marrow infiltration > 80 %. Autopsy revealed a significant hepato-splenomegaly, a lack of erythro-, granulo- and thrombopoiesis. Clots interspersed with fungal hyphae were found in both lungs and an infarction of the spleen with evidence of fungal hyphae was detected. The cultural findings post mortem on yeast or mold were negative.\n\n\nCONCLUSIONS\nPatients with refractory hairy cell leukemia and prolonged neutropenia are at increased risk for systemic fungal infections. Therefore, prohylactic antimycotic therapy should be considered early in this group of patients. The therapeutic approach of vemurafenib in treatment-refractory hairy cell leukemia is promising and offers an additional treatment option. In the present case, the patient could unfortunately not be stabilized due to the septic complications.",
"affiliations": "Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Institut für Pathologie, Universitätsklinikum Tübingen.;Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Abteilung für Onkologie, Hämatologie, Klinische Immunologie, Rheumatologie und Pulmonologie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Institut für Pathologie, Universitätsklinikum Tübingen.;Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Institut für Pathologie, Universitätsklinikum Tübingen.;Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.;Abteilung für Endokrinologie, Diabetologie, Angiologie, Nephrologie und Klinische Chemie, Medizinische Klinik und Poliklinik, Universitätsklinikum Tübingen.",
"authors": "Haap|M|M|;Neumayer|B|B|;Kopp|H-G|HG|;Peter|S|S|;Haen|S|S|;Riessen|R|R|;Artunc|F|F|;Fend|F|F|;Kanz|L|L|;Müller|M R|MR|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1055/s-0041-100947",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0012-0472",
"issue": "140(6)",
"journal": "Deutsche medizinische Wochenschrift (1946)",
"keywords": null,
"medline_ta": "Dtsch Med Wochenschr",
"mesh_terms": "D000328:Adult; D003937:Diagnosis, Differential; D017809:Fatal Outcome; D006801:Humans; D007938:Leukemia; D008297:Male; D009181:Mycoses; D009503:Neutropenia; D011014:Pneumonia; D017211:Treatment Failure",
"nlm_unique_id": "0006723",
"other_id": null,
"pages": "426-7",
"pmc": null,
"pmid": "25774734",
"pubdate": "2015-03",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Pulmonary infection in neutropenia.",
"title_normalized": "pulmonary infection in neutropenia"
} | [
{
"companynumb": "DE-PFIZER INC-2015175217",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PIPERACILLIN SODIUM\\TAZOBACTAM SODIUM"
},
"dr... |
{
"abstract": "OBJECTIVE\nAdalimumab (ADA) has become a valuable treatment option for juvenile idiopathic arthritis (JIA). The importance of combination with methotrexate (MTX) is unclear.\n\n\nMETHODS\nData from the German Biologics in Paediatric Rheumatology (BIKER) registry are reported. Response to treatment was analysed using JIA American College of Rheumatology (ACR) scores, 10-joint Juvenile Arthritis Disease Activity Score (JADAS10), and improvement of functional status and ACR inactive disease criteria. Compa-risons between rates of adverse events (AEs) and serious adverse events (SAEs) provided data for the safety assessment.\n\n\nRESULTS\nOverall, 584 patients with non-systemic JIA started ADA therapy, 61% of whom received concomitant MTX treatment at baseline. The latter patients were younger (p < 0.001), with shorter disease duration (p = 0.001), more frequently had antinuclear antibodies (p = 0.04), and had higher baseline JADAS10 scores (p = 0.03). In patients with ADA monotherapy, enthesitis-related arthritis (p = 0.004) and presence of human leucocyte antigen-B27 (p = 0.008) were documented more often. Mean treatment duration in both cohorts was 15 months. Comparable last follow-up rates for JIA ACR 30/50/70/90% response, JADAS minimal disease activity, JADAS remission, and ACR inactive disease were, respectively, 75/72/64/49%, 66%, 46%, and 58% for ADA monotherapy, and 77/72/61/45%, 64%, 48%, and 55%, for ADA + MTX. During 1082 patient-years (PY) of ADA exposure, 725 AEs (67/100 PY), including 57 SAEs (5.3/100 PY), were reported. Serious infections were reported in 10 patients (0.9/100 PY) and 11 (1.0/100 PY) had varicella infections/zoster reactivation. Rates of AEs, SAEs, infectious events, and serious infections did not differ between the cohorts. Elevated transaminases (p = 0.005) and gastrointestinal events (p < 0.0001) were reported more often in the combination cohort. Two pregnancies and no deaths were reported.\n\n\nCONCLUSIONS\nADA demonstrated an acceptable risk profile and high percentages of patients in both cohorts showed sufficient treatment response. No differences in treatment response or adherence to treatment were found.",
"affiliations": "a Department of Paediatrics , Centre for Paediatric Rheumatology, Asklepios Clinic Sankt Augustin , Sankt Augustin , Germany.;c Institute of Medical Statistics and Computational Biology , University of Cologne , Cologne , Germany.;d German Rheumatism Research Centre Berlin, and Charité University Medicine , Berlin , Germany.;e Hamburg Centre of Paediatric and Adolescent Rheumatology , Hamburg , Germany.;f German Centre for Paediatric and Adolescent Rheumatology , Garmisch-Partenkirchen , Germany.;a Department of Paediatrics , Centre for Paediatric Rheumatology, Asklepios Clinic Sankt Augustin , Sankt Augustin , Germany.",
"authors": "Klein|A|A|;Becker|I|I|;Minden|K|K|;Foeldvari|I|I|;Haas|J P|JP|;Horneff|G|G|",
"chemical_list": "D018501:Antirheumatic Agents; D000068879:Adalimumab; D008727:Methotrexate",
"country": "England",
"delete": false,
"doi": "10.1080/03009742.2018.1488182",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-9742",
"issue": "48(2)",
"journal": "Scandinavian journal of rheumatology",
"keywords": null,
"medline_ta": "Scand J Rheumatol",
"mesh_terms": "D000068879:Adalimumab; D000293:Adolescent; D018501:Antirheumatic Agents; D001171:Arthritis, Juvenile; D002648:Child; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D008137:Longitudinal Studies; D008297:Male; D008727:Methotrexate; D011247:Pregnancy; D012042:Registries; D016896:Treatment Outcome",
"nlm_unique_id": "0321213",
"other_id": null,
"pages": "95-104",
"pmc": null,
"pmid": "30411654",
"pubdate": "2019-03",
"publication_types": "D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Adalimumab versus adalimumab and methotrexate for the treatment of juvenile idiopathic arthritis: long-term data from the German BIKER registry.",
"title_normalized": "adalimumab versus adalimumab and methotrexate for the treatment of juvenile idiopathic arthritis long term data from the german biker registry"
} | [
{
"companynumb": "PHHY2018DE189489",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ADALIMUMAB"
},
"drugadditional": "3",
"druga... |
{
"abstract": "A total of 60 patients with muscle invasive transitional cell carcinoma of the bladder were entered into the nonrandomized study. The 1st group consisted of 30 patients treated by M-VAC neo-adjuvant chemotherapy followed by radical cystectomy when a residual tumor had been detected by biopsy made after the treatment. The overall clinical response was 70%. Fifteen (50%) out of 30 patients achieved clinical complete response (cCR). Objective pathologic response was attained in 6 (66.7%) of 9 evaluable patients who underwent radical cystectomy, pathologic complete response (pCR) was observed in two (22.2%) patients. Ten (33.3%) patients are still alive at a median follow-up of 22+ months. There were three (10%) drug-related deaths. The 2nd group consisted of 30 patients treated by CMV (with carboplatin) neo-adjuvant chemotherapy followed by radical pathologic response was attained in 9 (47.4%) of 19 evaluable patients, with pCR in 6 (31.6%) patients. Twenty four (80%) patients are still alive at a median follow-up of 13+ months. There was one (3.3%) drug-related death. The authors recommend immediate radical cystectomy following neo-adjuvant chemotherapy in all patients if their total status it allows.",
"affiliations": "Department of Urology, Comenius University School of Medicine, Dérer Hospital, Bratislava, Slovakia.",
"authors": "Ondrus|D|D|;Hornák|M|M|;Bárdos|A|A|;Ondrus|B|B|",
"chemical_list": "D014747:Vinblastine; D004317:Doxorubicin; D002945:Cisplatin; D008727:Methotrexate",
"country": "Slovakia",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-2685",
"issue": "41(5)",
"journal": "Neoplasma",
"keywords": null,
"medline_ta": "Neoplasma",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D002295:Carcinoma, Transitional Cell; D017024:Chemotherapy, Adjuvant; D002945:Cisplatin; D003131:Combined Modality Therapy; D015653:Cystectomy; D004317:Doxorubicin; D005260:Female; D006801:Humans; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D009361:Neoplasm Invasiveness; D009367:Neoplasm Staging; D001749:Urinary Bladder Neoplasms; D014747:Vinblastine",
"nlm_unique_id": "0377266",
"other_id": null,
"pages": "263-8",
"pmc": null,
"pmid": "7854496",
"pubdate": "1994",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Systemic chemotherapy for muscle invasive bladder cancer.",
"title_normalized": "systemic chemotherapy for muscle invasive bladder cancer"
} | [
{
"companynumb": "SK-PFIZER INC-2015072123",
"fulfillexpeditecriteria": "1",
"occurcountry": "SK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "OBJECTIVE\nThe frequency and cause of neurologic complications (NC) following hematopoietic stem cell transplantation (HSCT) have changed over time. We have analyzed the NC in 185 consecutive patients who underwent HSCT in a period of 5 years in a single HSCT Unit.\n\n\nMETHODS\n185 consecutive patients underwent HSCT (44 allogeneic) between February 2000 and March 2005 to treat hematologic malignancies. Most frequent diagnoses were multiple myeloma (41 patients) and acute myeloblastic leukemia (n = 35). Demographic and clinical data, HSCT characteristics and procedure-related events with special attention to neurological findings were recorded. Imaging studies (magnetic resonance imaging and/or computerized tomography scan), cerebro-spinal fluid analyses and microbiological studies were performed in all patients developing NC.\n\n\nRESULTS\nAfter a median follow-up of 27 months, 14 patients (7.5%) developed NC, 6 of them after an allogeneic HSCT. The most common conditioning regimen in these patients was BEAM (5/14); 6 patients submitted to allogenic-HSCT received methotrexate and cyclosporin as graft-versus-host disease prophylaxis, and intrathecal prophylaxis of relapse was administered to 3 patients. The median time to the appearance of a NC was 13 days from HSCT (range: -4 to + 135 days). Seizures (8 cases) and encephalopathy (n = 2) were the most frequent clinical manifestations. In 12 cases the cause of the NC was related to drugs, there was one case of viral encephalitis and in the remaining case was caused by hemorrhage. Two patients died, one due to thrombotic thrombocytopenic purpura attributed to cyclosporin and the other due to viral encephalitis.\n\n\nCONCLUSIONS\nIn our series drug toxicity was the main cause of NC (particularly seizures) following HSCT. Our results contrast with previous studies in which infections, especially of fungal origin, were the main cause of NC. These changes over time should be taken into account during diagnostic procedures.",
"affiliations": "Servicio de Hematología Clínica, Institut Català d'Oncologia-Hospital Germans Trias i Pujol, Badalona, Spain. mbatlle@ns.hugtip.scs.es",
"authors": "Batlle|Montserrat|M|;Oriol|Albert|A|;Ribera|Josep-Maria|JM|;Lozano|Manuel|M|;Ferrà|Christelle|C|;Sancho|Juan Manuel|JM|;Xicoy|Blanca|B|;Feliu|Evarist|E|",
"chemical_list": "D000970:Antineoplastic Agents; D007166:Immunosuppressive Agents",
"country": "Spain",
"delete": false,
"doi": "10.1016/s0025-7753(05)72159-x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0025-7753",
"issue": "125(18)",
"journal": "Medicina clinica",
"keywords": null,
"medline_ta": "Med Clin (Barc)",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000970:Antineoplastic Agents; D005260:Female; D019337:Hematologic Neoplasms; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D008875:Middle Aged; D009422:Nervous System Diseases; D020258:Neurotoxicity Syndromes; D012640:Seizures",
"nlm_unique_id": "0376377",
"other_id": null,
"pages": "697-9",
"pmc": null,
"pmid": "16435442",
"pubdate": "2005-11-19",
"publication_types": "D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Neurologic complications following hematopoietic stem cell transplantation. Study of 14 patients.",
"title_normalized": "neurologic complications following hematopoietic stem cell transplantation study of 14 patients"
} | [
{
"companynumb": "ES-PFIZER INC-2020367432",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": "1",
... |
{
"abstract": "Acute coronary syndrome (ACS) coinciding with active malignancy presents a unique clinical challenge given intersecting pathophysiology and treatment-related effects. There is little established clinical guidance on management strategies, rendering most treatment approaches anecdotal. We present a case highlighting the complexity of managing a patient being treated for malignancy who concurrently suffers from ACS. We then review the literature on co-management of ACS and malignancy, including reports of specific cancer therapies associated with ACS, unique features of clinical presentation and optimal use of dual antiplatelet therapy to minimize risks of bleeding and thrombosis. We also describe gaps in current literature, challenges in systematically studying the clinical intersection of these disease processes and propose alternative methodologies for further research.",
"affiliations": "Section of Cardiology, Department of Medicine, Dartmouth-Hitchcock Medical Center, Lebanon, NH, USA.;Department of Medicine, University of California Riverside, Moreno Valley, CA 92555, USA.;Department of Medicine, Weill Cornell Medical College, NY 10065, USA.;Department of Medicine, University of California Riverside, Moreno Valley, CA 92555, USA.;Department of Medicine, University of Maryland, School of Medicine, Baltimore, MD 21201, USA.;Stamford Health Medical Group, Stamford, CT 06905, USA.;Department of Medicine, Memorial Sloan Kettering Cancer Center, NY 10065, USA.",
"authors": "Mohanty|Bibhu D|BD|;Mohanty|Sudipta|S|;Hussain|Yasin|Y|;Padmaraju|Chandrasekhar|C|;Aggarwal|Sameer|S|;Gospin|Rebekah|R|;Yu|Anthony F|AF|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "England",
"delete": false,
"doi": "10.2217/fca-2017-0002",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1479-6678",
"issue": "13(3)",
"journal": "Future cardiology",
"keywords": "acute coronary syndrome; cancer; cardio-oncology; chemotherapy; ischemic heart disease",
"medline_ta": "Future Cardiol",
"mesh_terms": "D054058:Acute Coronary Syndrome; D000970:Antineoplastic Agents; D003328:Coronary Thrombosis; D006470:Hemorrhage; D006801:Humans; D008297:Male; D008875:Middle Aged; D009203:Myocardial Infarction; D017202:Myocardial Ischemia; D015607:Stents; D001749:Urinary Bladder Neoplasms",
"nlm_unique_id": "101239345",
"other_id": null,
"pages": "247-257",
"pmc": null,
"pmid": "28570141",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "24512409;12884648;19742144;26111880;16697705;11263603;20307244;25246465;12075751;26065990;21314064;23473109;22044821;26457558;20624997;11230498;25593528;17911198;17143713;10779453;27585514;27448538;9546998;10801757;15589015;26756277;16354605;26130984;22218740;8300889;25230593;19060498;8971584;27262860;19382279;25399658;23768984;19936641;12668833;2424354;10653825;16520857;10458712;22588943;1243105;26337999;16782933;26112199;18765315;20548817;17167763;19371823;27022039;26337996;2292051;15751647",
"title": "Management of ischemic coronary disease in patients receiving chemotherapy: an uncharted clinical challenge.",
"title_normalized": "management of ischemic coronary disease in patients receiving chemotherapy an uncharted clinical challenge"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/17/0092314",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE"
},
... |
{
"abstract": "QTc prolongation is a risk factor for development of torsades de pointes (TdP). Combination therapy with fluoroquinolones and azoles is used in patients with hematologic malignancies for prophylaxis and treatment of infection. Both drug classes are implicated as risk factors for QTc prolongation. The cumulative effect on and incidence of QTc prolongation for this combination have not been previously described. A retrospective chart review was performed with hospitalized inpatients from 1 September 2008 to 31 January 2010 comparing QTc interval data from electrocardiogram (ECG) assessment at baseline and after the initiation of combination therapy. Ninety-four patients were eligible for inclusion. The majority, 88 patients (93.6%), received quinolone therapy with levofloxacin. Fifty-three patients (56.4%) received voriconazole; 40 (42.6%) received fluconazole. The overall mean QTc change from baseline was 6.1 (95% confidence interval [CI], 0.2 to 11.9) ms. Twenty-one (22.3%) of the studied patients had clinically significant changes in the QTc while receiving combination fluoroquinolone-azole therapy. Statistically significant risk factors for clinically significant changes in QTc were hypokalemia (P = 0.03) and a left-ventricular ejection fraction of <55% (P = 0.02). Low magnesium (P = 0.11), exposure to 2 or more drugs with the potential to prolong the QTc interval (P = 0.17), and female sex (P = 0.21) trended toward significance. Combination therapy with fluoroquinolone and azole antifungals is associated with increased QTc from baseline in hospitalized patients with hematologic malignancies. One in five patients had a clinically significant change in the QTc, warranting close monitoring and risk factor modification to prevent the possibility of further QTc prolongation and risk of TdP.",
"affiliations": "Hospital Pharmacy Services, Mayo Clinic, Rochester, MN, USA. zeuli.john@mayo.edu",
"authors": "Zeuli|John D|JD|;Wilson|John W|JW|;Estes|Lynn L|LL|",
"chemical_list": "D000935:Antifungal Agents; D011743:Pyrimidines; D014230:Triazoles; D064704:Levofloxacin; D015725:Fluconazole; D015242:Ofloxacin; D065819:Voriconazole",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.00958-12",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "57(3)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": null,
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D000328:Adult; D000368:Aged; D000935:Antifungal Agents; D004334:Drug Administration Schedule; D004359:Drug Therapy, Combination; D004562:Electrocardiography; D005260:Female; D015725:Fluconazole; D019337:Hematologic Neoplasms; D006801:Humans; D007008:Hypokalemia; D064704:Levofloxacin; D008133:Long QT Syndrome; D008297:Male; D008875:Middle Aged; D009181:Mycoses; D015242:Ofloxacin; D011743:Pyrimidines; D012307:Risk Factors; D016171:Torsades de Pointes; D014230:Triazoles; D018487:Ventricular Dysfunction, Left; D065819:Voriconazole",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": "1121-7",
"pmc": null,
"pmid": "23229485",
"pubdate": "2013-03",
"publication_types": "D016428:Journal Article",
"references": "18319048;17251531;11253862;17251530;14999113;3716982;20185054;18454341;15472801;1542320;16336514;11253855;16869820;17109296;21258094;10577320;12495173;12736279;16628725;11830802;16148284;11302406;16148283;8445816;20297862;17143043",
"title": "Effect of combined fluoroquinolone and azole use on QT prolongation in hematology patients.",
"title_normalized": "effect of combined fluoroquinolone and azole use on qt prolongation in hematology patients"
} | [
{
"companynumb": "US-JNJFOC-20130307949",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VORICONAZOLE"
},
"drugadditional": null,
... |
{
"abstract": "Acetaminophen poisoning is one of the common accidental poisoning in children. Accidental administration of mismatched doses of drops for syrups can lead to life-threatening overdose. N-acetylcysteine (NAC) is the specific antidote; however, extracorporeal therapy such as continuous venovenous hemofiltration (CVVH) can be used as a rescue measure when there is no improvement despite adequate NAC therapy and can be lifesaving. We reported an 18-month-old male infant patient who presented with acetaminophen poisoning following accidental ingestion of acetaminophen drops in place of syrup and developed fulminant hepatic failure. Treatment with NAC did not lead to improvement and CVVH was used as a rescue therapy for 24 hours which led to dramatic clinical and biochemical improvement with intact neurological outcome.",
"affiliations": "Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.;Division of Pediatric Critical Care, Advanced Pediatrics Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, India.",
"authors": "Awasthi|Puspraj|P|;Jindal|Ankush|A|;Sharma|Yogish|Y|;Williams|Vijai|V|;Ravikumar|Namita|N|;Nallasamy|Karthi|K|;Angurana|Suresh Kumar|SK|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1055/s-0040-1712158",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2146-4626",
"issue": "10(2)",
"journal": "Journal of pediatric intensive care",
"keywords": "acetaminophen; continuousvenovenous hemofiltration; poisoning",
"medline_ta": "J Pediatr Intensive Care",
"mesh_terms": null,
"nlm_unique_id": "101592756",
"other_id": null,
"pages": "159-161",
"pmc": null,
"pmid": "33884219",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports",
"references": "10634007;22320209;28812394;26484583;30248244;27118496;26325537;26166142;15800420;31446483;24099020;29605069;11863129;25133498;25228327;30956824",
"title": "Continuous Venovenous Hemofiltration as a Rescue Therapy for Severe Acetaminophen Toxicity in a Toddler.",
"title_normalized": "continuous venovenous hemofiltration as a rescue therapy for severe acetaminophen toxicity in a toddler"
} | [
{
"companynumb": "IN-VISTAPHARM, INC.-VER202105-001339",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN\\HYDROCODONE"
},
"dr... |
{
"abstract": "The approach to transplantation in human immunodeficiency virus (HIV)-positive patients has been conservative due to fear of exacerbating an immunocompromised condition. As a result, HIV-positive patients with diabetes were initially excluded from beta cell replacement therapy. Early reports of pancreas transplant in patients with HIV described high rates of early graft loss with limited follow-up. We report long-term follow-up of islet or pancreas transplantation in HIV-positive type 1 diabetic patients who received a kidney transplant concurrently or had previously undergone kidney transplantation. Although 4 patients developed polyoma viremia, highly active antiretroviral therapy and adequate infectious prophylaxis were successful in providing protection until CD4+ counts recovered. Coordination with HIV providers is critical to reduce the risk of rejection by minimizing drug-drug interactions. Also, protocols for prophylaxis of opportunistic infections and strategies for monitoring and treating BK viremia are important given the degree of immunosuppression required. This series demonstrates that type 1 diabetic patients with well-controlled HIV and renal failure can be appropriate candidates for beta cell replacement, with a low rate of infectious complications, early graft loss, and rejection, so excellent long-term graft survival is possible. Additionally, patients with HIV and cardiovascular contraindications can undergo islet infusion.",
"affiliations": "Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;School of Medicine, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.;Department of Surgery, Division of Transplantation, University of California San Francisco, San Francisco, California.",
"authors": "Roll|Garrett R|GR|0000-0001-6241-7037;Posselt|Andrew M|AM|;Freise|Jonathan|J|0000-0001-7737-7699;Baird|Julia|J|;Syed|Shareef|S|0000-0002-1475-778X;Mo Kang|Sang|S|0000-0002-9064-0006;Hirose|Ryutaro|R|0000-0002-2307-0170;Szot|Gregory L|GL|;Zarinsefat|Arya|A|;Feng|Sandy|S|0000-0002-2601-4350;Worner|Giulia|G|;Sarwal|Minnie|M|0000-0003-1212-3959;Stock|Peter G|PG|0000-0002-5806-0167",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1111/ajt.15796",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1600-6135",
"issue": "20(8)",
"journal": "American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons",
"keywords": "clinical research/practice; diabetes: type 1; immunosuppressant; immunosuppression/immune modulation; infection and infectious agents - viral: BK/JC/polyoma; infection and infectious agents - viral: human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS); islet transplantation; pancreas/simultaneous pancreas-kidney transplantation",
"medline_ta": "Am J Transplant",
"mesh_terms": "D003922:Diabetes Mellitus, Type 1; D005500:Follow-Up Studies; D006084:Graft Rejection; D006085:Graft Survival; D015658:HIV Infections; D006679:HIV Seropositivity; D006801:Humans; D016035:Pancreas Transplantation; D051437:Renal Insufficiency",
"nlm_unique_id": "100968638",
"other_id": null,
"pages": "2091-2100",
"pmc": null,
"pmid": "31994295",
"pubdate": "2020-08",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "12752321;28509373;25040016;21094878;20883548;28707821;22328294;27099169;20304199;22221659;16539632;22448973;22172869;21083386;20346065",
"title": "Long-term follow-up of beta cell replacement therapy in 10 HIV-infected patients with renal failure secondary to type 1 diabetes mellitus.",
"title_normalized": "long term follow up of beta cell replacement therapy in 10 hiv infected patients with renal failure secondary to type 1 diabetes mellitus"
} | [
{
"companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-20-04898",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LAMIVUDINE"
},
"d... |
{
"abstract": "BACKGROUND\n(131) I-metaiodobenzylguanidine (MIBG) produces a 37% response rate in relapsed/refractory neuroblastoma, and could be used to improve remission status prior to myeloablative chemotherapy with autologous stem cell transplant (ASCT). The purpose of our report was to evaluate safety and response with MIBG therapy followed by myeloablative busulfan and melphalan (BuMel) with ASCT in patients with refractory neuroblastoma.\n\n\nMETHODS\nRetrospective chart review was done on patients treated with MIBG (18 mCi/kg) on Day 1 and ASCT on day 14. Six to eight weeks after MIBG, patients without progressive disease received IV busulfan on days -6 to -2 (target Css 700-900), melphalan (140 mg/m2 IV) on day -1, and ASCT on Day 0. Response and toxicity were evaluated after MIBG and again after myeloablative therapy.\n\n\nRESULTS\nEight patients completed MIBG/ASCT followed by BuMel/ASCT. MIBG was well tolerated, with grade 3 or 4 non-hematologic toxicity limited to one patient with sepsis. Grade 3 mucositis occurred in six patients after BuMel/ASCT. One patient developed sinusoidal obstructive syndrome (SOS) and died 50 days post-ASCT following myeloablative conditioning. All patients engrafted neutrophils (median 16.5 days) and platelets (median 32 days) after BuMel, excluding the patient with SOS. After all therapy, there were three complete, two partial, and one minor response in seven evaluable patients.\n\n\nCONCLUSIONS\nMIBG at doses up to 18 mCi/kg can be safely administered 6 weeks prior to a BuMel consolidative regimen for refractory neuroblastoma. Preceding MIBG did not impair engraftment following BuMel. This regimen is being further evaluated in a Children's Oncology Group (COG) trial.",
"affiliations": "Department of Pediatrics, University of California, San Francisco School of Medicine, San Francisco, California 94143, USA. Sarah.French@ucsf.edu",
"authors": "French|Sarah|S|;DuBois|Steven G|SG|;Horn|Biljana|B|;Granger|Meaghan|M|;Hawkins|Randall|R|;Pass|Amy|A|;Plummer|Ellen|E|;Matthay|Katherine|K|",
"chemical_list": "D000970:Antineoplastic Agents; D019275:Radiopharmaceuticals; D019797:3-Iodobenzylguanidine; D002066:Busulfan; D008558:Melphalan",
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.24351",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "60(5)",
"journal": "Pediatric blood & cancer",
"keywords": null,
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D019797:3-Iodobenzylguanidine; D000970:Antineoplastic Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D002066:Busulfan; D002648:Child; D002675:Child, Preschool; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D008297:Male; D008558:Melphalan; D009447:Neuroblastoma; D019275:Radiopharmaceuticals; D012189:Retrospective Studies; D033581:Stem Cell Transplantation; D014182:Transplantation, Autologous",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "879-84",
"pmc": null,
"pmid": "23024113",
"pubdate": "2013-05",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "131I-MIBG followed by consolidation with busulfan, melphalan and autologous stem cell transplantation for refractory neuroblastoma.",
"title_normalized": "131i mibg followed by consolidation with busulfan melphalan and autologous stem cell transplantation for refractory neuroblastoma"
} | [
{
"companynumb": "US-OTSUKA-US-2013-10630",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BUSULFAN"
},
"drugadditional": "3",
"... |
{
"abstract": "Opioid analgesics are commonly used post-lung transplant, but have many side effects and are associated with worse outcomes. We conducted a retrospective review of all lung transplant recipients who were treated with a multimodal opioid-sparing pain protocol. The use of liposomal bupivacaine intercostal nerve block was variable due to hospital restrictions. The primary objective was to describe opioid requirements and patient-reported pain scores early post-lung transplant and to assess the impact of intraoperative liposomal bupivacaine intercostal nerve block. We treated 64 lung transplant recipients with our protocol. Opioid utilization decreased to a mean of 43 milligram oral morphine equivalents by postoperative day 4. Median pain scores peaked at 4 on postoperative day 1 and decreased thereafter. Only three patients were discharged home with opioids, all of whom were taking opioid agonist therapy pre-transplant for opioid use disorder. Patients who received liposomal bupivacaine intercostal nerve block in the operating room had a significant reduction in opioid consumption over postoperative day 1 through 4 (228 mg vs. 517 mg, P= .032). A multimodal opioid-sparing pain management protocol is feasible and resulted in weaning of opioids prior to hospital discharge.",
"affiliations": "Department of Pharmacy, NYU Langone Health, New York, New York, USA.;Transplant Institute, NYU Langone Health, New York, New York, USA.;Department of Pharmacy, NYU Langone Health, New York, New York, USA.;Department of Cardiothoracic Surgery, NYU Langone Health, New York, New York, USA.;Transplant Institute, NYU Langone Health, New York, New York, USA.;Transplant Institute, NYU Langone Health, New York, New York, USA.;Transplant Institute, NYU Langone Health, New York, New York, USA.;Department of Cardiothoracic Surgery, NYU Langone Health, New York, New York, USA.;Department of Cardiothoracic Surgery, Northwell Health, Manhasset, New York, USA.",
"authors": "Lewis|Tyler C|TC|https://orcid.org/0000-0003-2197-1917;Sureau|Kimberly|K|;Katz|Alyson|A|;Fargnoli|Anthony|A|;Lesko|Melissa|M|;Rudym|Darya|D|;Angel|Luis F|LF|;Chang|Stephanie H|SH|;Kon|Zachary N|ZN|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/ctr.14512",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-0063",
"issue": null,
"journal": "Clinical transplantation",
"keywords": "enhanced recovery; lung transplant; opioid-sparing; pain; thoracotomy",
"medline_ta": "Clin Transplant",
"mesh_terms": null,
"nlm_unique_id": "8710240",
"other_id": null,
"pages": "e14512",
"pmc": null,
"pmid": "34658078",
"pubdate": "2021-10-18",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Multimodal opioid-sparing pain management after lung transplantation and the impact of liposomal bupivacaine intercostal nerve block.",
"title_normalized": "multimodal opioid sparing pain management after lung transplantation and the impact of liposomal bupivacaine intercostal nerve block"
} | [
{
"companynumb": "US-ORG100016242-2021000553",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BUPIVACAINE"
},
"drugadditional": "4",
... |
{
"abstract": "Immunotherapy-related adverse events (irAEs) associated with immune-checkpoint inhibitors can affect nearly any organ system including commonly the luminal gastrointestinal tract, hepatobiliary system, lungs, endocrine glands, and skin, many of which have described imaging manifestations. In patients without clinically suspected irAEs, imaging findings may be the first indication of an abnormality that prompts further workup to facilitate early detection and initiation of appropriate treatment, such as therapy discontinuation or corticosteroid therapy. While some irAEs have well described imaging correlates, such as pneumonitis, hypophysitis, and colitis, others are not well described, such as nephritis. We report 2 cases of irAE nephritis associated with PD-1 inhibitor therapy and their imaging features.",
"affiliations": "Department of Radiology Division of Abdominal Imaging, Department of Radiology, Massachusetts General Hospital, Boston, MA.",
"authors": "Khauli|Mark A|MA|;An|Thomas J|TJ|;Anderson|Mark A|MA|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/CJI.0000000000000398",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1524-9557",
"issue": null,
"journal": "Journal of immunotherapy (Hagerstown, Md. : 1997)",
"keywords": null,
"medline_ta": "J Immunother",
"mesh_terms": null,
"nlm_unique_id": "9706083",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34670254",
"pubdate": "2021-10-20",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Imaging Findings in Immunotherapy-related Renal Toxicity.",
"title_normalized": "imaging findings in immunotherapy related renal toxicity"
} | [
{
"companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2021-135059",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NIVOLUMAB"
},
"drugaddi... |
{
"abstract": "Tolosa-Hunt syndrome (THS) is a rare syndrome of painful ophthalmoplegia secondary to an idiopathic granulomatous inflammation affecting the cavernous sinus, superior orbital fissure or orbit. Pregnancy and pregnancy-related hormones have been identified as potential triggers. A 39-year-old gravida-2 para-1 woman with prior chronic intake of combined oral contraceptives (COC) suffered two episodes of painful ophthalmoplegia-the first event with spontaneous remission and the relapse occurring during pregnancy and with complete resolution following steroid treatment. MRI revealed a postinflammatory mass at the junction of the left orbital apex and anterior cavernous sinus, supporting the diagnosis of THS. To our knowledge, this is the first report of a THS relapse occurring during pregnancy following a chronic history of COC intake. This case adds to the growing evidence supporting the relationship between immune and hormonal factors that may be present during pregnancy and the disease pathogenesis of THS.",
"affiliations": "Department of Neurosciences, College of Medicine and Philippine General Hospital, University of the Philippines Manila, Manila, Metro Manila, Philippines bcpiamonte@gmail.com.;Department of Obstetrics and Gynecology, College of Medicine and Philippine General Hospital, University of the Philippines Manila, Manila, Metro Manila, Philippines.;Department of Neurosciences, College of Medicine and Philippine General Hospital, University of the Philippines Manila, Manila, Metro Manila, Philippines.",
"authors": "Piamonte|Bernadeth Lyn Cal|BLC|http://orcid.org/0000-0001-9745-9384;Ong|Keno Lorenzo|KL|;Cenina|Alvin Rae|AR|",
"chemical_list": "D003277:Contraceptives, Oral, Combined",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-238944",
"fulltext": "\n==== Front\nBMJ Case Rep\nBMJ Case Rep\nbmjcr\nbmjcasereports\nBMJ Case Reports\n1757-790X BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR \n\n33462037\nbcr-2020-238944\n10.1136/bcr-2020-238944\nCase Report\n1506\n1332\n276\n200\nTolosa-Hunt syndrome relapse during pregnancy following chronic intake of combined oral contraceptives\nhttp://orcid.org/0000-0001-9745-9384Piamonte Bernadeth Lyn Cal 1 Ong Keno Lorenzo 2 Cenina Alvin Rae 1 1 Department of Neurosciences, College of Medicine and Philippine General Hospital, University of the Philippines Manila, Manila, Metro Manila, Philippines\n2 Department of Obstetrics and Gynecology, College of Medicine and Philippine General Hospital, University of the Philippines Manila, Manila, Metro Manila, Philippines\nCorrespondence to Dr Bernadeth Lyn Cal Piamonte; bcpiamonte@gmail.com\n2021 \n18 1 2021 \n18 1 2021 \n14 1 e23894423 12 2020 © BMJ Publishing Group Limited 2020. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2021http://creativecommons.org/licenses/by-nc/4.0/This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.Tolosa-Hunt syndrome (THS) is a rare syndrome of painful ophthalmoplegia secondary to an idiopathic granulomatous inflammation affecting the cavernous sinus, superior orbital fissure or orbit. Pregnancy and pregnancy-related hormones have been identified as potential triggers. A 39-year-old gravida-2 para-1 woman with prior chronic intake of combined oral contraceptives (COC) suffered two episodes of painful ophthalmoplegia—the first event with spontaneous remission and the relapse occurring during pregnancy and with complete resolution following steroid treatment. MRI revealed a postinflammatory mass at the junction of the left orbital apex and anterior cavernous sinus, supporting the diagnosis of THS. To our knowledge, this is the first report of a THS relapse occurring during pregnancy following a chronic history of COC intake. This case adds to the growing evidence supporting the relationship between immune and hormonal factors that may be present during pregnancy and the disease pathogenesis of THS.\n\npregnancyheadache (including migraines)neuroopthalmologyspecial-featureunlocked\n==== Body\nBACKGROUND\nTolosa-Hunt syndrome (THS) is a rare condition characterised by painful ophthalmoplegia attributed to an idiopathic granulomatous inflammation of the cavernous sinus, superior orbital fissure or orbit.1 It has an estimated incidence of nearly one to two cases per million per year and is ultimately a diagnosis of exclusion.2 While its aetiology remains unknown, few reports in the literature have documented its dysimmune pathogenesis influenced by pregnancy and pregnancy-related hormones.3 4\n\nCase presentation\nA 39-year-old gravida-2 para-1 woman with a known history of hypertension presented at our institution pregnant at 31 2/7 weeks of gestation with sudden-onset, moderate-to-severe left temporal headache radiating to the orbital-periorbital area with ipsilateral abduction deficit, binocular diplopia, tearing and blurring of vision. This occurred following a chronic history of combined oral contraceptive (COC) intake containing ethinyl oestradiol and levonorgestrel for 7 years. She reported a similar event of painful ophthalmoplegia that occurred 2 years earlier that spontaneously resolved 6 weeks after symptom onset. Examination at the time of admission revealed left esotropia, left lateral rectus palsy and elevated blood pressures. Visual function and fundus examination demonstrated bilateral error of refraction and grade II hypertensive retinopathy. There was no objective sensory deficit on the left side of the face, proptosis or signs of Horner syndrome. Temporary and slight relief of pain was reported with normalisation of blood pressure and administration of intramuscular dexamethasone given for fetal lung maturity. However, the patient’s ophthalmoplegia did not improve.\n\nInvestigations\nInitial workup revealed an elevated erythrocyte sedimentation rate of 60 mm/hour, mild leucocytosis of 15.50×109/L on complete blood count and proteinuria of more than 0.3 g on 24-hour urine protein measurement. Baseline serum electrolytes and coagulation profile were normal. Cerebrospinal fluid (CSF) studies, which included aerobic cultures, cytology, and tests for fungal and tuberculous infections, were unremarkable. Thyroid function tests were normal and antidouble stranded DNA and anticonnective tissue disease antibody tests were negative. Screening for diabetes mellitus with glycated haemoglobin and fasting blood sugar was unremarkable. Serum and CSF rapid plasma reagin results to screen for syphilis were normal. Brain MRI showed a small, T1 hyperintense, T2/fluid-attenuated inversion recovery isointense soft tissue focus with minimal gadolinium enhancement at the junction of the left orbital apex and anterior cavernous sinus, compatible with granulomatous inflammation (figure 1). The left orbit was also oriented medially and there was atrophy of the left lateral rectus muscle. MR angiography was unremarkable, other than a hypolastic/absent A1 segment of the right anterior cerebral artery, which may be a normal anatomical variant.\n\nFigure 1 (A) T1-weighted non-contrast, (B) T1-weighted contrast and (C) T2-weighted brain MRI images in axial cuts showing the postinflammatory mass lesion (arrow) at the junction of the left orbital apex and anterior cavernous sinus. Images were generated using a gadolinium-based contrast agent.\n\nDifferential diagnosis\nThe diagnosis of THS was based on the unilateral orbital-periorbital headache developing with a paresis of the ipsilateral sixth cranial nerve, granulomatous inflammation at the junction of the orbital apex and anterior cavernous sinus demonstrated by MRI, and absence of other clinical or radiographic signs or symptoms fulfilling the International Classification of Headache Disorders.5 Vascular aetiologies, such as a carotid aneurysm or diabetic or arteritic infarction, as differential diagnoses were less likely based on cranial imaging and negative screening tests for diabetes mellitus. Infectious causes, such as focal abscesses, syphilitic pachymeningitis or tuberculous meningoencephalitis, were ruled out due to the absence of characteristic meningeal signs or systemic signs of infection as well as the unremarkable blood and CSF findings. Neoplasms, such as lymphoma, meningioma or nasopharyngeal carcinoma, were considered but ruled out due to uncharacteristic cranial imaging coupled with negative CSF findings. Moreover, the lack of orbital signs pointing to a mechanical restriction, such as in thyroid orbitopathy or orbital pseudotumor, and negative thyroid function tests rule out these considerations. Based on her elevated blood pressure and total urine protein, the patient was also managed obstetrically as a case of chronic hypertension with superimposed pre-eclampsia with severe features.\n\nTreatment, outcome and follow-up\nLabour was induced, and due to a non-reassuring fetal status, an uncomplicated caesarean delivery followed. After delivery, the patient completed prednisone 80 mg daily dose for 3 days, with gradual down-tapering by 20 mg every 2 weeks thereafter; this resulted in progressive alleviation and subsequent complete resolution of the patient’s headache and ophthalmoplegia after 5 weeks. On follow-up after 6 months, there was no reported recurrence.\n\nDiscussion\nTHS is characterised by a non-specific lymphoplasmacytic inflammation of the septa and wall of the cavernous sinus, associated with proliferation of fibroblasts, epithelioid cells and occasional giant cells.6 7 The exact cause of this inflammatory process remains unknown. There seems to be no consistent link to an infectious organism.8 Few associations with other inflammatory disorders, such as systemic lupus erythematosus (SLE), Hashimoto thyroiditis, Hodgkin lymphoma and rheumatoid polyarthritis, have been reported; hence, an autoimmune aetiology has been suggested, but is still unclear.9 Traumatic injury has also been associated as a potential trigger for THS.10 To date, only two cases of THS occurring during pregnancy have been reported in the literature. Levin and Karussis (2002) first reported a 32-year-old woman with two episodes of THS, both of which were linked to changes in gonadal hormone levels—the onset triggered by clomiphene treatment and the relapse triggered by progesterone treatment during pregnancy.4 A second report by Litwin and Leung (2017) described a case of a 24-year-old woman who presented with THS during pregnancy following progesterone administration for first-trimester bleeding.3\n\nVirtually every organ system undergoes changes during pregnancy, including the immune system. These immune responses contribute to the outcome of pregnancy and to disease pathogenesis as well.11 The complex tolerance that exists at the maternal-fetal interface is in part due to the physiological suppression of various immunological functions.12 During pregnancy, there is a functional shift of CD4 T lymphocyte subpopulations towards T helper cells (Th)2-mediated immunity and an increased secretion of the Th2 cytokines—interleukin (IL) 4, IL-10, IL-13.4 Therefore, while suppression of Th1-mediated immunity is an important anti-inflammatory component of pregnancy, promotion of antibody-based immunity by Th2 cytokines has resulted in flares of autoimmune diseases mediated mainly by autoantibodies, such as SLE.12\n\nPregnancy-related hormones also exert immunological changes. Progesterone has been shown to inhibit the development of Th1 immune responses and promote Th2 cytokine secretion.11 13 The differential effects of oestrogen are partly determined by its concentration: low or physiological doses of oestradiol promote Th1 responses and enhance secretion of proinflammatory cytokines (eg, IL-1, IL-6 and tumour necrosis factor-α (TNF-α)), whereas high or pregnancy doses augment Th2 responses and reduce the production of these cytokines.11 With reduced expression of TNF-α, which could be neurotoxic, oestrogen offers a neuroprotective effect.14 Interestingly, however, attenuation of TNF-α by pregnancy-levels of oestrogen and progesterone has also been shown to further promote granuloma formation by decreasing TNF-induced-apoptosis of granuloma cells.15 The shielding effect of these hormones, along with their enhanced expression of angiogenic factors, implicates their importance in the pathogenesis of uncontrolled inflammation and may prove relevant in the pathogenesis of THS.3 15\n\nIn this patient, the chronic administration of combined oestrogen and progesterone on top of the immunomodulating effects of pregnancy could have precipitated her episodes of THS. To our knowledge, this is the first report of a THS relapse occurring during pregnancy following a chronic history of COC intake. This case adds to the growing evidence supporting the interplay between immune and hormonal factors and the disease pathogenesis of THS.\n\nLearning points\nPregnancy and pregnancy-related hormones have been identified as potential triggers of Tolosa-Hunt syndrome (THS).\n\nImmune response during pregnancy contributes to disease pathogenesis.\n\nOestrogen and progesterone may prove relevant in the pathogenesis of THS.\n\nContributors: BLCP: Research project: conception, organisation, execution. Manuscript preparation: writing of the first draft. KLO and ARC: Manuscript preparation: review and critique.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: None declared.\n\nPatient consent for publication: Obtained.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n==== Refs\nReferences\n1 Binder DK , Sonne DC , Fischbein NJ \nCranial nerves: anatomy, pathology, imaging . New York, NY : Thieme Medical Publishers, Inc , 2010 : 37 .\n2 Iaconetta G , Stella L , Esposito M , et al \nTolosa-Hunt syndrome extending in the cerebello-pontine angle\n. Cephalalgia \n2005 ;25 :746 –50\n. 10.1111/j.1468-2982.2005.00924.x 16109058 \n3 Litwin CE , Leung ASO \nTolosa-Hunt syndrome presenting during pregnancy following progesterone administration\n. Int J Gynaecol Obstet \n2017 ;137 :340 –1\n. 10.1002/ijgo.12145 28295285 \n4 Levin N , Karussis D \nInfluence of progesterone and clomiphene on Tolosa-Hunt syndrome\n. Neurology \n2002 ;59 :1661 –2\n. 10.1212/01.WNL.0000035415.68190.65 12451225 \n5 Headache classification Committee of the International headache Society (IHS) the International classification of headache disorders, 3rd edition\n. Cephalalgia \n2018 ;38 :1 –211\n. 10.1177/0333102417738202 \n6 Tolosa E \nPeriarteritic lesions of the carotid siphon with the clinical features of a carotid infraclinoidal aneurysm\n. J Neurol Neurosurg Psychiatry \n1954 ;17 :300 –2\n. 10.1136/jnnp.17.4.300 13212421 \n7 Hunt WE , Meagher JN , LeFever HE , et al \nPainful opthalmoplegia. its relation to indolent inflammation of the carvernous sinus\n. Neurology \n1961 ;11 :56 –62\n. 10.1212/WNL.11.1.56 13716871 \n8 Kline LB , Hoyt WF \nThe Tolosa-Hunt syndrome\n. J Neurol Neurosurg Psychiatry \n2001 ;71 :577 –82\n. 10.1136/jnnp.71.5.577 11606665 \n9 Vailati A , Marena C , Comis S , et al \nHashimoto's thyroiditis in association with Tolosa Hunt syndrome: a case report\n. Thyroid \n1993 ;3 :125 –7\n. 10.1089/thy.1993.3.125 8369651 \n10 Granados-Reyes GM , Soriano-Redondo E , Duran-Ferreras E \n[Tolosa-Hunt syndrome following traumatic eye injury]\n. Rev Neurol \n2012 ;54 :729 –33\n.22673949 \n11 Robinson DP , Klein SL \nPregnancy and pregnancy-associated hormones alter immune responses and disease pathogenesis\n. Horm Behav \n2012 ;62 :263 –71\n. 10.1016/j.yhbeh.2012.02.023 22406114 \n12 Cunningham FG , Leveno KJ , Bloom SL \nWilliams obstetrics . 25th edn , 2018 : 58 –9\n.\n13 Piccinni MP , Giudizi MG , Biagiotti R , et al \nProgesterone favors the development of human T helper cells producing Th2-type cytokines and promotes both IL-4 production and membrane CD30 expression in established Th1 cell clones\n. J Immunol \n1995 ;155 :128 –33\n.7541410 \n14 Koellhoffer EC , McCullough LD \nThe effects of estrogen in ischemic stroke\n. Transl Stroke Res \n2013 ;4 :390 –401\n. 10.1007/s12975-012-0230-5 24323337 \n15 Yuan K , Wing L-YC , Lin MT \nPathogenetic roles of angiogenic factors in pyogenic granulomas in pregnancy are modulated by female sex hormones\n. J Periodontol \n2002 ;73 :701 –8\n. 10.1902/jop.2002.73.7.701\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1757-790X",
"issue": "14(1)",
"journal": "BMJ case reports",
"keywords": "headache (including migraines); neuroopthalmology; pregnancy",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000328:Adult; D003277:Contraceptives, Oral, Combined; D005260:Female; D006801:Humans; D011247:Pregnancy; D011248:Pregnancy Complications; D012008:Recurrence; D020333:Tolosa-Hunt Syndrome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33462037",
"pubdate": "2021-01-18",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "11606665;8369651;13716871;12146528;12451225;13212421;22673949;7541410;29368949;16109058;24323337;28295285;22406114",
"title": "Tolosa-Hunt syndrome relapse during pregnancy following chronic intake of combined oral contraceptives.",
"title_normalized": "tolosa hunt syndrome relapse during pregnancy following chronic intake of combined oral contraceptives"
} | [
{
"companynumb": "PH-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-291834",
"fulfillexpeditecriteria": "1",
"occurcountry": "PH",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVONORGESTREL"
},
"... |
{
"abstract": "BACKGROUND\nIn countries with high prevalence of HIV/AIDS infection, particularly in black Africa, shingles is one of the main opportunistic infections during immunosuppression due to AIDS in young patients. If immunological weakness is important, usually when the CD4 cell count is less than 100 cells/mm(3), the risk of inflammatory reactions in the first three months after initiating of antiretroviral treatment (ART) is very high. This inflammatory reaction is called immune reconstitution inflammatory syndrome (IRIS). This observation reports the first documented case of IRIS with V1 shingles in a young HIV patient at University Hospital of Brazzaville.\n\n\nMETHODS\nA 40 years old patient was seen for a pain of the right side of the face and a complete immobility of the eyeball. The diagnosis of V1 shingles with a pan uveitis, and a paralysis of III, IV and VI nerves was made. The patiants HIV status was positive and CD4 cell count was 150 cells/mm(3). After two months of evolution under ART with a CD4 count of 850 cells /mm(3), the symptomatology was quickly complicated by significant inflammation causing a phtisis bulbi.\n\n\nCONCLUSIONS\nCD4 cells count is an important indicator in the HIV/AIDS therapy. In some major forms of IRIS, momentary pause of anti retroviral treatment is sometimes necessary.",
"affiliations": "Department of Ophthalmology, University Hospital of Brazzaville.;Department of Medicinel (Dermatology unit), Talangaï Hospital of Brazzaville.",
"authors": "Atipo-Tsiba|P W|PW|;Kombo Bayonne|E S|ES|",
"chemical_list": "D019380:Anti-HIV Agents",
"country": "Ethiopia",
"delete": false,
"doi": "10.4314/ejhs.v26i3.14",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1029-1857",
"issue": "26(3)",
"journal": "Ethiopian journal of health sciences",
"keywords": "AIDS; Immune reconstitution Inflammatory Syndrome; Oculomotor Nerves Paralysis; Shingles",
"medline_ta": "Ethiop J Health Sci",
"mesh_terms": "D017088:AIDS-Related Opportunistic Infections; D000328:Adult; D019380:Anti-HIV Agents; D023241:Antiretroviral Therapy, Highly Active; D018791:CD4 Lymphocyte Count; D015496:CD4-Positive T-Lymphocytes; D005123:Eye; D015658:HIV Infections; D006562:Herpes Zoster; D006801:Humans; D054019:Immune Reconstitution Inflammatory Syndrome; D007165:Immunosuppression Therapy; D007249:Inflammation; D008297:Male; D009802:Oculomotor Nerve; D015840:Oculomotor Nerve Diseases; D014605:Uveitis",
"nlm_unique_id": "101224773",
"other_id": null,
"pages": "297-300",
"pmc": null,
"pmid": "27358552",
"pubdate": "2016-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17945155;25601456;25373075;25954081;15750393;26142251;22752438;22562000;26265849",
"title": "Immune Reconstitution Inflammatory Syndrome and Shingles Associated with a Combined Paralysis of Three Oculomotor Nerves: A Case Report.",
"title_normalized": "immune reconstitution inflammatory syndrome and shingles associated with a combined paralysis of three oculomotor nerves a case report"
} | [
{
"companynumb": "CG-MYLANLABS-2017M1029786",
"fulfillexpeditecriteria": "1",
"occurcountry": "CG",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LAMIVUDINE"
},
"drugadditional": "3",
... |
{
"abstract": "Based on the results of the trastuzumab for gastric cancer (ToGA) trial, the regimen of Xeloda/5-FU+CDDP+trastuzu- mab (XPT/FPT) has become the standard of care for treatment of HER2-positive unresectable or recurrent gastric cancers. In our hospital, the percentage of HER2-positive gastric cancer patients is 16.7%; we present a case of recurrence 26 months after gastric cancer surgery. A 67-year-old man presented with locoregional lymph node recurrence, with swelling in a paraaortic lymph node. ¹⁸F-fluorodeoxy glucose positron emission tomography (FDG-PET) examination revealed abnormal accumulation in these lymph nodes. He was treated with a regimen of XPT chemotherapy because of the HER2-positive status of his gastric cancer. After 8 courses, the lymph nodes had shrunk and FDG-PET examination revealed no abnormal accumulation. Imaging revealed the presence of interstitial pneumonia, and the adverse events of venous thromboembolism, and grade 3 hand-foot syndrome were detected; as a result, chemotherapy was suspended. The XPT regimen may be an effective treatment for HER2-positive unresectable or recurrent gastric cancers. HER2 status should be the key determinant in the strategy for the treatment of unresectable and recurrent gastric cancers in the future.",
"affiliations": "Dept. of Surgery, Nishinomiya Municipal Central Hospital.",
"authors": "Oka|Yoshio|Y|;Okada|Kaoru|K|;Uemura|Hisashi|H|;Nakane|Shigeru|S|;Miyake|Yasuhiro|Y|;Higaki|Naozumi|N|;Murakami|Masakazu|M|;Hayashida|Hirohito|H|;Nezu|Riichiro|R|",
"chemical_list": "D018719:Receptor, ErbB-2",
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-0684",
"issue": "41(12)",
"journal": "Gan to kagaku ryoho. Cancer & chemotherapy",
"keywords": null,
"medline_ta": "Gan To Kagaku Ryoho",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D006801:Humans; D008207:Lymphatic Metastasis; D008297:Male; D018719:Receptor, ErbB-2; D012008:Recurrence; D013274:Stomach Neoplasms",
"nlm_unique_id": "7810034",
"other_id": null,
"pages": "2433-5",
"pmc": null,
"pmid": "25731548",
"pubdate": "2014-11",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "A case of locoregional recurrence after gastric cancer surgery, which was treated with XPT regimen chemotherapy.",
"title_normalized": "a case of locoregional recurrence after gastric cancer surgery which was treated with xpt regimen chemotherapy"
} | [
{
"companynumb": "JP-ROCHE-1431267",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TRASTUZUMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "Malignant catatonia is an unusual and highly fatal neuropsychiatric condition which can present with clinical and biochemical manifestations similar to those of pheochromocytoma. Differentiating between the two diseases is essential as management options greatly diverge. We describe a case of malignant catatonia in a 20-year-old male who presented with concurrent psychotic symptoms and autonomic instability, with markedly increased 24-hour urinary levels of norepinephrine at 1752 nmol/day (normal, 89-470 nmol/day), epinephrine at 1045 nmol/day (normal, <160 nmol/day), and dopamine at 7.9 μ mol/day (normal, 0.4-3.3 μ mol/day). The patient was treated with multiple sessions of electroconvulsive therapy, which led to complete clinical resolution. Repeat urine collections within weeks of this presenting event revealed normalization or near normalization of his catecholamine and metanephrine levels. Malignant catatonia should be considered in the differential diagnosis of the hypercatecholamine state, particularly in a patient who also exhibits concurrent catatonic features.",
"affiliations": "Department of Pathology and Laboratory Medicine, University of British Columbia, 855 West 12th Avenue, Vancouver, BC, Canada V5Z 1M9.",
"authors": "Wong|Sophia|S|;Hughes|Barbara|B|;Pudek|Morris|M|;Li|Dailin|D|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2013/815821",
"fulltext": "\n==== Front\nCase Rep EndocrinolCase Rep EndocrinolCRIM.ENDOCRINOLOGYCase Reports in Endocrinology2090-65012090-651XHindawi Publishing Corporation 10.1155/2013/815821Case ReportMalignant Catatonia Mimicking Pheochromocytoma http://orcid.org/0000-0002-7250-3657Wong Sophia \n1\n*http://orcid.org/0000-0001-8532-8491Hughes Barbara \n2\nhttp://orcid.org/0000-0001-6432-263XPudek Morris \n1\n\n3\nLi Dailin \n1\n\n3\n1Department of Pathology and Laboratory Medicine, University of British Columbia, 855 West 12th Avenue, Vancouver, BC, Canada V5Z 1M92Department of Medicine, Ridge Meadows Hospital, 11666 Laity Street, Maple Ridge, BC, Canada V2X 7G53Division of Clinical Chemistry, Department of Pathology and Laboratory Medicine, Vancouver General Hospital, 855 West 12th Avenue, Vancouver, BC, Canada V5Z 1M9*Sophia Wong: swong6@providencehealth.bc.caAcademic Editors: J. Broom and T. Nagase\n\n2013 22 10 2013 2013 81582126 8 2013 17 9 2013 Copyright © 2013 Sophia Wong et al.2013This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Malignant catatonia is an unusual and highly fatal neuropsychiatric condition which can present with clinical and biochemical manifestations similar to those of pheochromocytoma. Differentiating between the two diseases is essential as management options greatly diverge. We describe a case of malignant catatonia in a 20-year-old male who presented with concurrent psychotic symptoms and autonomic instability, with markedly increased 24-hour urinary levels of norepinephrine at 1752 nmol/day (normal, 89–470 nmol/day), epinephrine at 1045 nmol/day (normal, <160 nmol/day), and dopamine at 7.9 μmol/day (normal, 0.4–3.3 μmol/day). The patient was treated with multiple sessions of electroconvulsive therapy, which led to complete clinical resolution. Repeat urine collections within weeks of this presenting event revealed normalization or near normalization of his catecholamine and metanephrine levels. Malignant catatonia should be considered in the differential diagnosis of the hypercatecholamine state, particularly in a patient who also exhibits concurrent catatonic features.\n==== Body\n1. Introduction\nMalignant catatonia (MC) is an uncommon and highly lethal neuropsychiatric condition first reported by Calmeil in 1832 [1]. Since then, it has been described in the medical literature by a litany of names, among them pernicious catatonia, lethal catatonia, and acute fulminating psychosis [2]. Similar to MC, pheochromocytoma is also a potentially fatal disease, and the two conditions can present with overlapping clinical and biochemical traits. It is vital that these pathologies be differentiated, as therapeutic options greatly diverge between the two. \n\n2. Case Presentation\nA 20-year-old male was seen by the internal medicine service for fever and hypertension NYD (not yet diagnosed). The patient initially presented to the hospital for abnormal behavior, hallucinations, and delusions. He had become increasingly withdrawn over the past few months and began to experience auditory and visual hallucinations several days prior to admission. The patient denied any chills or rigors. He had a chronic productive cough and a persistent sore throat but no other infectious symptoms. There was no history of headaches or seizures.\n\nHe was started on sertraline 25 mg daily three days before his hospitalization, although his compliance was questionable. He recently completed a full course of amoxicillin and clarithromycin for pharyngitis, but these provided minimal alleviation of his complaints. He was not on any other regular medications at home. The patient was a nonsmoker and had not ingested any alcohol in recent months. He was a chronic cannabis user who had smoked marijuana almost daily for the past three to four years and had also consumed some psilocybin mushrooms two weeks prior to admission. Family history was negative for hypertension, pheochromocytomas, or other endocrine tumors. \n\nOn examination, the patient was noted to be markedly diaphoretic, with flushing over his cheeks. His blood pressure was 157/112 mm Hg, heart rate 124 beats per minute, and temperature 37.8°C. The respiratory rate was 18 breaths per minute and oxygen saturation 98% on room air. He appeared tremulous and was stiff in his movements. He responded to questions with single-word answers and was resistant to most commands. He refused to open his mouth for examination. His neurological examination was grossly intact. Cardiac examination revealed normal S1 and S2 with no extra heart sounds. There was a grade 1/6 systolic murmur heard throughout the precordium. Respiratory, abdominal, and rheumatological examinations were unremarkable. \n\nLaboratory investigations revealed leukocytosis of 13.9 × 109/L (normal, 4.0–11.0 × 109/L) with absolute neutrophils of 12.1 × 109/L (normal, 2.0–8.0 × 109/L) and absolute monocytes of 1.0 × 109/L (normal, 0.1–0.8 × 109/L). C-reactive protein (CRP) was elevated at 41 mg/L (normal, <10 mg/L). Throat, urine, and blood cultures were negative. A lumbar puncture was performed, with normal cerebrospinal fluid (CSF) analysis and cytology. The CSF culture was unremarkable; testing for syphilis and toxoplasma serology, cryptococcal antigen, enterovirus ribonucleic acid (RNA), herpes simplex virus deoxyribonucleic acid (DNA), and acid fast bacilli smear was all negative. \n\nExtended electrolytes, glucose, and renal and liver function results returned within normal limits. Ethanol level was <2.0 mmol/L, and urine drug screen detected only the presence of cannabinoids and benzodiazepines. An autoimmune workup, including antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA), autoantibodies to extractable nuclear antigens (ENA), rheumatoid factor (RF), and antithyroperoxidase antibodies (TPOAb), was negative. Creatine kinase was 256 U/L (normal, <165 U/L), thyroid stimulating hormone (TSH) 1.43 mU/L (normal, 0.30–5.50 mU/L), and ceruloplasmin 304 mg/L (normal, 220–495 mg/L). Supine renin level was elevated at 0.40 ng/L/s (normal, <0.28 ng/L/s) but the supine aldosterone level was unremarkable at 182 pmol/L (normal, 30–415 pmol/L). Twenty-four-hour urinary catecholamines revealed strikingly increased excretions of norepinephrine at 1752 nmol/day (normal, 89–470 nmol/day), epinephrine at 1045 nmol/day (normal, <160 nmol/day), and dopamine at 7.9 μmol/day (normal, 0.4–3.3 μmol/day). Urinary metanephrine levels were not obtained. \n\nComputed tomography (CT) of the head revealed no intracranial abnormality. Electroencephalography was normal and no unusual findings were noted on echocardiography. \n\nThe patient was admitted and his sertraline dose increased to 50 mg daily. He was also prescribed quetiapine (which worsened his agitation), as well as PRN loxapine and lorazepam. Because a diagnosis of serotonin syndrome was considered, the patient's sertraline and quetiapine were subsequently discontinued. He was also prophylactically started on meropenem, but the antibiotic was stopped when all cultures returned negative. For blood pressure and heart rate control, he was initiated on metoprolol 12.5 mg twice daily; this was eventually increased to 25 mg twice daily and supplemented by terazosin 1 mg daily.\n\nInterestingly, the patient presented with near identical symptoms of psychosis and autonomic instability four years ago, following what appeared to be an episode of tonsillitis. He later developed catatonia during his hospitalization. A diagnosis of MC was made, and he was treated with multiple sessions of electroconvulsive therapy (ECT). Due to the similarity of the patient's current presentation to this previous event, a trial of ECT was introduced, with striking improvement in his clinical status. The patient required a total of nine ECT sessions over a three-week period for complete resolution of his psychiatric features and autonomic instability.\n\nEight days after the patient was started on ECT for presumed recurrent MC, a repeat 24-hour urinary specimen was collected to confirm prior results. This was performed while the patient was on metoprolol and terazosin. The urinary catecholamines showed much improved, albeit mildly elevated, norepinephrine of 524 nmol/day and epinephrine of 308 nmol/day. Dopamine, metanephrine, and normetanephrine excretions were normal at 3.0 μmol/day, 1.58 μmol/day (normal, 0.26–1.73 μmol/day), and 1.66 μmol/day (normal, 0.48–2.42 μmol/day), respectively. Another urine collection twelve days thereafter revealed norepinephrine, epinephrine, and dopamine levels of 550 nmol/day, 98 nmol/day, and 2.2 μmol/day, respectively. Metanephrine and normetanephrine excretions were within reference limits at 0.91 μmol/day and 2.29 μmol/day, respectively. As the patient's urinary catecholamine and metanephrine levels normalized or near normalized with treatment of his psychiatric illness, no further investigations, such as an abdominal/pelvic CT, were performed. His initial markedly elevated urinary catecholamine results were thought to be secondary to MC.\n\n3. Discussion\nSimilar to simple or nonmalignant catatonia, patients with MC exhibit the following clinical symptoms and signs [3]: psychosocial withdrawal (mutism, stupor, staring, and negativism) and/or hyperactivity (impulsivity, combativeness, and nudism);\n\nmotor features (posturing, rigidity, and waxy flexibility);\n\nbizarre repetitious behaviors (mannerism, stereotypy, echophenomena, and command automatism).\n\nAt least two of the above features, lasting for a minimum of several to twenty-four hours, are needed for a diagnosis of catatonia [2]. Rating scales, such as the Bush-Francis catatonia rating scale [4], the Bräunig catatonia rating scale [5], and the Northoff catatonia scale [6], may assist in its recognition. When individuals with catatonia develop hyperthermia and/or autonomic instability, such as tachycardia, labile/elevated blood pressure, tachypnea, diaphoresis, urinary retention/incontinence, constipation, and/or acrocyanosis, their catatonia has evolved into the “malignant” type, and rapid deterioration of their clinical status often ensues [3, 7, 8]. \n\nIn contrast, pheochromocytoma is a rare catecholamine-secreting tumor with an incidence of <0.3% in hypertensive patients [9] and up to 4.2% in patients with an adrenal incidentaloma [10]. The classic triad of episodic headache, sweating, and tachycardia is only present in 24% of cases [11]. Hypertension may be sustained and/or paroxysmal; some patients may even be normotensive, especially if the tumor is discovered incidentally on imaging, if screening is performed for familial cases, or if the tumor is secreting solely dopamine [12]. Other clinical features associated with pheochromocytoma, particularly those which overlap with symptoms of MC, include flushing/warmth, hyperthermia, heat intolerance, tremulousness, anxiety, dyspnea, and constipation [9, 12]. Screening for pheochromocytoma is usually achieved via 24-hour urinary total/fractionated metanephrines and/or catecholamines or plasma fractionated metanephrines [13]. Markedly elevated results (defined as greater than two or three times the upper limit of normal) warrant further investigations [14]. Once the diagnosis is confirmed biochemically, various imaging modalities, including CT, magnetic resonance imaging (MRI), iodine-123-labelled metaiodobenzylguanidine (123I-MIBG) scintigraphy, fluorodeoxyglucose positron emission tomography (FDG-PET), and indium-111-pentetreotide scintigraphy (Octreoscan), may be used to elucidate the location of the tumor [15]. Most pheochromocytomas are curable by surgical resection; for malignant cases, tumor mass reduction, along with radionuclide therapy with or without chemotherapy, is the mainstay of treatment [15].\n\nIn the preneuroleptic era, MC comprised 0.25–3.5% of admissions to the psychiatric ward and had a fatal outcome in 75–100% of cases. Its prevalence and lethality have diminished to 0.13–0.50% and 60%, respectively, in the postneuroleptic period [16]. The mean age of onset of MC is 33 years, with a female preponderance (male to female ratio of 1 : 2) [16]. Association with psychosis is most common; however, mood disorders, neurological and medical precipitants (including infectious, metabolic, and/or toxic derangements), medications, and idiopathic causes have also been linked to MC [3]. \n\nMC consists of three stages. Patients first experience a prodrome of anorexia, insomnia, and mood lability, lasting on average of two weeks in duration. This is then followed by a period of relentless motor agitation, often with violent aggression, auditory and visual hallucinations, and bizarre delusions. Patients also demonstrate catatonic signs and autonomic instability and may refuse all oral intake, leading to dehydration and electrolyte imbalances [16]. This second phase may last for hours to weeks. The final stage is depicted by severe hyperpyrexia and stuporous exhaustion, ending in cardiovascular collapse, coma, and death [16]. \n\nAlthough the pathophysiology of MC is not well defined, central dopaminergic hypoactivity, particularly in the basal ganglia-thalamocortical circuits, has been proposed as the underlying mechanism [3, 17]. Alterations in norepinephrine, serotonin, gamma-aminobutyric acid (GABA), and glutamate neurotransmission may also contribute to the development of MC [3, 18]. The clinical features of MC may seem similar to those of neuroleptic malignant syndrome (NMS) and serotonin syndrome. In fact, both conditions are now regarded as iatrogenic variants of MC [8, 19–21], triggered by the use of antipsychotic or antidepressant agents, respectively.\n\nLaboratory findings in MC are nonspecific and include leukocytosis [22], elevated creatine kinase [23], decreased serum iron [24], and increased transaminases [17]. Because the patient's clinical presentation resembles that of an infectious encephalopathy, an extensive neurological workup is often undertaken but yields no significant findings [21]. In our patient, 24-hour urinary catecholamine levels were markedly elevated, with norepinephrine excretion greater than 3.5 times the upper limit of normal (ULN), epinephrine excretion greater than 6.5 times ULN, and dopamine excretion greater than 2.3 times ULN. These results are in accordance with the increased urinary catecholamine and metanephrine values described in other case reports for both MC and NMS [25–27]. \n\nIt is important to note that quetiapine, an atypical antipsychotic with alpha-adrenergic antagonism and norepinephrine reuptake inhibition properties, has been described in the literature to raise normetanephrine (and to a lesser extent, metanephrine) results [28, 29], with presumed effects on catecholamine levels as well. Our patient only received two low doses of quetiapine (50–100 mg) prior to sample collection, and such a striking elevation in urinary catecholamines secondary to this seemed unlikely. Further, on both repeat urinary specimens, the catecholamine and metanephrine values were either within, or mildly above, normal limits, despite the patient now being on two medications (an alpha-blocker and a beta-blocker) that are known to increase urine catecholamine and/or metanephrine levels [29–31]. These results on repeat testing are reassuring in ruling out the presence of a pheochromocytoma and support the clinician's decision to forego unwarranted imaging that would have exposed the patient to a considerable dose of ionizing radiation [32].\n\nRegardless of its initial etiology, fully-developed MC is frequently lethal and necessitates urgent intervention. Aggressive supportive care, such as intravenous fluids and cooling devices, should be instituted early. Blood pressure and cardiac rhythm should be closely monitored and managed appropriately. Conventional and atypical neuroleptics are generally ineffective in the treatment of MC and may in fact aggravate the condition once it is in the advanced stages [33, 34]. Benzodiazepines (e.g., high-dose lorazepam at 8–16 mg/day) [35] are frequently prescribed and can improve the clinical course in most patients [3], but have limited use once MC becomes fulminant [33]. ECT is the most definitive and effective therapeutic option currently available, especially for patients refractory to benzodiazepines and/or those with MC secondary to a functional psychiatric cause [16]. For MC associated with an organic etiology, treatment should be aimed at the underlying disorder. ECT may, nevertheless, provide some relief of MC symptoms, although any effects achieved are likely temporary if the primary process remains uncorrected [16]. \n\nIn summary, we present a case of MC with clinical and biochemical findings mimicking those seen in pheochromocytoma. Treatment of the patient's MC resulted in complete resolution of his hyperadrenergic symptoms and normalization or near normalization of his urinary catecholamine and metanephrine levels. MC should be considered in the differential diagnosis of the hypercatecholamine state, especially in a patient who also exhibits concurrent catatonic features. Although rare, a missed diagnosis of MC may have grave consequences. \n\nConflict of Interests\nThe authors declare no conflict of interests.\n==== Refs\n1 Calmeil LF Dictionnaire de MéDecine: Ou Répertoire Général Des Sciences MédicaLes Considérées sous Les Rapports, Théorique Et Pratique 1832 2nd edition Paris, France BechEt \n2 Fink M Taylor MA The catatonia syndrome: forgotten but not gone Archives of General Psychiatry 2009 66 11 1173 1177 2-s2.0-70350644890 19884605 \n3 Philbrick KL Rummans TA Malignant catatonia Journal of Neuropsychiatry and Clinical Neurosciences 1994 6 1 1 13 2-s2.0-0028117256 7908547 \n4 Bush G Fink M Petrides G Dowling F Francis A Catatonia. I. Rating scale and standardized examination Acta Psychiatrica Scandinavica 1996 93 2 129 136 2-s2.0-0029916688 8686483 \n5 Bräunig P Krüger S Shugar G Höffler J Börner I The Catatonia Rating Scale I—development, reliability, and use Comprehensive Psychiatry 2000 41 2 147 158 2-s2.0-0034020133 10741894 \n6 Northoff G Koch A Wenke J Catatonia as a psychomotor syndrome: a rating scale and extrapyramidal motor symptoms Movement Disorders 1999 14 3 404 416 10348462 \n7 Tang CP Leung CM Ungvari GS Leung WK The syndrome of lethal catatonia Singapore Medical Journal 1995 36 4 400 402 2-s2.0-0029564570 8919156 \n8 Fink M Catatonia: a syndrome appears, disappears, and is rediscovered Canadian Journal of Psychiatry 2009 54 7 437 445 2-s2.0-70249091513 19660165 \n9 Stein PP Black HR A simplified diagnostic approach to pheochromocytoma. A review of the literature and report of one institution’s experience Medicine 1991 70 1 46 66 2-s2.0-0025978264 1988766 \n10 Mantero F Terzolo M Arnaldi G A survey on adrenal incidentaloma in Italy Journal of Clinical Endocrinology and Metabolism 2000 85 2 637 644 2-s2.0-0034454579 10690869 \n11 Baguet J-P Hammer L Mazzuco TL Circumstances of discovery of phaeochromocytoma: a retrospective study of 41 consecutive patients European Journal of Endocrinology 2004 150 5 681 686 2-s2.0-2942751899 15132724 \n12 Manger WM The protean manifestations of pheochromocytoma Hormone and Metabolic Research 2009 41 9 658 663 2-s2.0-70350392972 19242899 \n13 Sawka AM Jaeschke R Singh RJ Young WF Jr. A comparison of biochemical tests for pheochromocytoma: measurement of fractionated plasma metanephrines compared with the combination of 24-hour urinary metanephrines and catecholamines Journal of Clinical Endocrinology and Metabolism 2003 88 2 553 558 2-s2.0-0037323423 12574179 \n14 Yu R Wei M False positive test results for pheochromocytoma from 2000 to 2008 Experimental and Clinical Endocrinology and Diabetes 2010 118 9 577 585 2-s2.0-77958140565 19998239 \n15 Adler JT Meyer-Rochow GY Chen H Pheochromocytoma: current approaches and future directions Oncologist 2008 13 7 779 793 2-s2.0-48749092390 18617683 \n16 Mann SC Caroff SN Bleier HR Lethal catatonia American Journal of Psychiatry 1986 143 11 1374 1381 2-s2.0-0023032983 3777225 \n17 Mann SC Caroff SN Campbell EC Greenstein RA Identification and treatment of malignant catatonia Child and Adolescent Psychopharmacology News 2003 8 6 7 12 \n18 Carroll BT The universal field hypothesis of catatonia and neuroleptic malignant syndrome CNS Spectrums 2000 5 7 26 33 2-s2.0-0033861043 \n19 Fink M Neuroleptic malignant syndrome and catatonia: one entity or two? Biological Psychiatry 1996 39 1 1 4 2-s2.0-0030070128 8719118 \n20 White DAC Catatonia and the neuroleptic malignant syndrome—a single entity? British Journal of Psychiatry 1992 161 558 560 2-s2.0-0026646907 1393347 \n21 Fink M Taylor MA The many varieties of catatonia European Archives of Psychiatry and Clinical Neuroscience 2001 251 1 I8 I13 2-s2.0-0034965336 11776271 \n22 Singerman B Raheja R Malignant catatonia—a continuing reality Annals of Clinical Psychiatry 1994 6 4 259 266 2-s2.0-0028672308 7647836 \n23 Northoff G Wenke J Pflug B Increase of serum creatine phosphokinase in catatonia: an investigation in 32 acute catatonic patients Psychological Medicine 1996 26 3 547 553 2-s2.0-0029990410 8733213 \n24 Lee JWY Serum iron in catatonia and neuroleptic malignant syndrome Biological Psychiatry 1998 44 6 499 507 2-s2.0-0032530137 9777183 \n25 Nisijima K Malignant catatonia accompanied by high urinary catecholamine levels mimicking the presentation of pheochromocytoma Psychiatry and Clinical Neurosciences 2009 63 3 428 429 2-s2.0-65649145156 \n26 Sokoro AAH Zivot J Ariano RE Neuroleptic malignant syndrome versus serotonin syndrome: the search for a diagnostic tool Annals of Pharmacotherapy 2011 45 9 p. e50 2-s2.0-80052434010 \n27 Feibel JH Schiffer RB Sympathoadrenomedullary hyperactivity in the neuroleptic malignant syndrome: a case report American Journal of Psychiatry 1981 138 8 1115 1116 2-s2.0-0019416707 6114644 \n28 Doogue M Soule S Hunt P Another cause of “pseudophaeochromocytoma”—quetiapine associated with a false positive normetanephrine result Clinical Endocrinology 2007 67 3 472 473 2-s2.0-34548023059 17645566 \n29 Whiting MJ Doogue MP Advances in biochemical screening for phaeochromocytoma using biogenic amines The Clinical Biochemist Reviews 2009 30 1 3 17 19224007 \n30 Barron J Phaeochromocytoma: diagnostic challenges for biochemical screening and diagnosis Journal of Clinical Pathology 2010 63 8 669 674 2-s2.0-77955754575 20547690 \n31 Eisenhofer G Goldstein DS Walther MM Biochemical diagnosis of pheochromocytoma: how to distinguish true- from false-positive test results Journal of Clinical Endocrinology and Metabolism 2003 88 6 2656 2666 2-s2.0-0038305505 12788870 \n32 Smith-Bindman R Lipson J Marcus R Radiation dose associated with common computed tomography examinations and the associated lifetime attributable risk of cancer Archives of Internal Medicine 2009 169 22 2078 2086 2-s2.0-73149110471 20008690 \n33 Detweiler MB Mehra A Rowell T Kim KY Bader G Delirious mania and malignant catatonia: a report of 3 cases and review Psychiatric Quarterly 2009 80 1 23 40 2-s2.0-61449262751 19199033 \n34 Taylor MA Fink M Catatonia in psychiatric classification: a home of its own American Journal of Psychiatry 2003 160 7 1233 1241 2-s2.0-0042978721 12832234 \n35 Van Den Eede F Van Hecke J Van Dalfsen A Van Den Bossche B Cosyns P Sabbe BGC The use of atypical antipsychotics in the treatment of catatonia European Psychiatry 2005 20 5-6 422 429 2-s2.0-24944518446 15964746\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-651X",
"issue": "2013()",
"journal": "Case reports in endocrinology",
"keywords": null,
"medline_ta": "Case Rep Endocrinol",
"mesh_terms": null,
"nlm_unique_id": "101576457",
"other_id": null,
"pages": "815821",
"pmc": null,
"pmid": "24251048",
"pubdate": "2013",
"publication_types": "D016428:Journal Article",
"references": "19242899;12832234;20547690;10348462;1393347;19224007;10690869;1988766;20008690;12574179;8719118;3777225;12788870;18197153;9777183;8686483;18617683;7647836;6114644;19660165;7908547;8919156;10741894;15964746;17645566;19566780;21878660;19199033;11776271;8733213;19884605;19998239;15132724",
"title": "Malignant catatonia mimicking pheochromocytoma.",
"title_normalized": "malignant catatonia mimicking pheochromocytoma"
} | [
{
"companynumb": "CA-APOTEX-2017AP023733",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SERTRALINE HYDROCHLORIDE"
},
"drugadditional": n... |
{
"abstract": "We examined response to oxcarbazepine prescribed for irritability/agitation symptoms in a retrospective case series of 30 patients with Autism Spectrum Disorder (ASD). The average patient was 12.0 years old (range 5-21) and taking two other psychotropic medications (range 0-4). Fourteen patients (47 %) had a clinical global impression of improvement score of 'much improved' during treatment. Ten patients (33 %) showed an improvement on their clinical global impression of severity score. Seven patients (23 %) had a clinically significant adverse event or side effect leading to oxcarbazepine discontinuation. Without a placebo group, it is not possible to evaluate whether oxcarbazepine provides benefit for irritability/agitation symptoms in ASD. The high rate of adverse events suggests its use should be accompanied by caution.",
"affiliations": "Department of Psychiatry, Vanderbilt University Medical Center, 1601 23rd Avenue South, Nashville, TN 37232, USA.",
"authors": "Douglas|Jessica F|JF|;Sanders|Kevin B|KB|;Benneyworth|M Hannah|MH|;Smith|Jessica L|JL|;Dejean|Virginia M|VM|;McGrew|Susan G|SG|;Veenstra-Vanderweele|Jeremy|J|",
"chemical_list": "C476610:oxcarbamazepine; D002220:Carbamazepine",
"country": "United States",
"delete": false,
"doi": "10.1007/s10803-012-1661-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0162-3257",
"issue": "43(5)",
"journal": "Journal of autism and developmental disorders",
"keywords": null,
"medline_ta": "J Autism Dev Disord",
"mesh_terms": "D000293:Adolescent; D002220:Carbamazepine; D002648:Child; D002659:Child Development Disorders, Pervasive; D002675:Child, Preschool; D005260:Female; D006801:Humans; D007508:Irritable Mood; D008297:Male; D011595:Psychomotor Agitation; D012189:Retrospective Studies; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "7904301",
"other_id": null,
"pages": "1243-7",
"pmc": null,
"pmid": "22976374",
"pubdate": "2013-05",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "20431403;19324530;15276670;20980991;19948625;20824493;18645422;18254071;12625991;17162653;11450816;17975720;11587873;19797985;15458610;17475749;20010551;8919710;17630868;16816222;12849396;18775367;18439113;16608550;12151468;21464191;19552755;15112459;16765022;20309621;15492353;18472486;15946331;14594332;17287715",
"title": "Brief report: retrospective case series of oxcarbazepine for irritability/agitation symptoms in autism spectrum disorder.",
"title_normalized": "brief report retrospective case series of oxcarbazepine for irritability agitation symptoms in autism spectrum disorder"
} | [
{
"companynumb": "US-APOTEX-2014AP006163",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OXCARBAZEPINE"
},
"drugadditional": null,
... |
{
"abstract": "Autologous hematopoietic cell transplant (aHCT) has a significant survival advantage in patients with high-risk (HR) neuroblastoma. Transplant-associated thrombotic microangiopathy (TA-TMA) is a serious complication and may result in chronic renal disease leading to delay in subsequent posttransplant therapy and limitations of treatment options. Dinutuximab represents an important therapeutic advance in the treatment of pediatric HR neuroblastoma, but historically has not been administered in patients with GFR < 60 mL/m2 /min. Here, we present the safe outcome of dinutuximab administration while on renal replacement therapy in two cases of HR neuroblastoma with end-stage renal disease secondary to TA-TMA.",
"affiliations": "Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Division of Pharmacy, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.;Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio.",
"authors": "Emberesh|Myesa|M|0000-0003-3402-402X;Rubinstein|Jeremy D|JD|0000-0002-1934-2954;Young|Jennifer|J|0000-0002-7597-1413;Benoit|Stefanie W|SW|;Dandoy|Christopher E|CE|0000-0002-4001-9203;Weiss|Brian D|BD|",
"chemical_list": "D000911:Antibodies, Monoclonal; D000970:Antineoplastic Agents; C112746:dinutuximab",
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.28852",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "68(3)",
"journal": "Pediatric blood & cancer",
"keywords": "dialysis; dinutuximab; end-stage renal disease; neuroblastoma; transplant-associated thrombotic microangiopathy",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D000911:Antibodies, Monoclonal; D000970:Antineoplastic Agents; D002648:Child; D002675:Child, Preschool; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007676:Kidney Failure, Chronic; D008297:Male; D009447:Neuroblastoma; D011379:Prognosis; D006435:Renal Dialysis",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "e28852",
"pmc": null,
"pmid": "33381917",
"pubdate": "2021-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tolerance of dinutuximab therapy for treatment of high-risk neuroblastoma in two patients with end-stage renal disease on dialysis.",
"title_normalized": "tolerance of dinutuximab therapy for treatment of high risk neuroblastoma in two patients with end stage renal disease on dialysis"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/21/0134678",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AMLODIPINE BESYLATE"
},
"drugadditional... |
{
"abstract": "Osimertinib is the main treatment choice for pretreated patients with advanced non-small cell lung cancer (NSCLC) harbouring epidermal growth factor receptor (EGFR) T790M mutations. However, the choice of subsequent therapy when progressive disease has developed after osimertinib treatment remains a major therapeutic challenge. This study evaluated the efficacy of osimertinib-based combination therapies in patients who developed progressive disease after treatment with osimertinib.\n\n\n\nWe enrolled NSCLC patients harbouring T790M mutations pretreated with first- or second-generation EGFR tyrosine-kinase inhibitors and were receiving osimertinib at two tertiary referral centres between August 2015 and July 2019, and the subsequent treatment efficacy was assessed.\n\n\n\nOsimertinib-based combination therapy yielded better overall survival (OS) than chemotherapy alone (not achieved vs. 7.8 months; hazard ratio, 0.39; 95 % confidence interval 0.17-0.89; P = 0.025) according to the Cox proportional hazards model adjusted for possible confounders. Synergism (combination index <1) between AZD9291 and chemotherapy and a higher proportion of apoptosis cells in combination treatment were also demonstrated in the T790M-positive PC9 cell line with acquired resistance to AZD9291.\n\n\n\nOur data supported the hypothesis that osimertinib-based combination therapy is associated with improved OS among patients with clinical progression following the use of osimertinib. These findings warrant further validation in a randomised controlled study.",
"affiliations": "Department of Internal Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: n049978@mail.hosp.ncku.edu.tw.;Department of Internal Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: n510217@mail.hosp.ncku.edu.tw.;Department of Internal Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: yangszuchun@gmail.com.;Department of Nursing, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: lynnewu727@gmail.com.;Department of Surgery, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: tsengyl@mail.ncku.edu.tw.;Department of Surgery, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: i5493149@gmail.com.;Department of Surgery, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: b85401067@gmail.com.;Department of Medical Imaging, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: gracelinchiaying@msn.com.;Department of Internal Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan; Institute of Clinical Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan; Department of Biochemistry and Molecular Biology, College of Medicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: n032989@mail.hosp.ncku.edu.tw.;Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan; Department of Respiratory Therapy, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan; Department of Respiratory Care, Chang Gung University of Science and Technology, Chiayi, Taiwan. Electronic address: ccwang52@adm.cgmh.org.tw.;Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan; Department of Respiratory Therapy, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan. Electronic address: mengchih@cgmh.org.tw.;Department of Internal Medicine, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan; Department of Medical Imaging, National Cheng Kung University Hospital, College of Medicine, National Cheng Kung University, Tainan, Taiwan; Center of Applied Nanomedicine, National Cheng Kung University, Tainan, Taiwan. Electronic address: sunnysu@mail.ncku.edu.tw.",
"authors": "Su|Po-Lan|PL|;Tsai|Jeng-Shiuan|JS|;Yang|Szu-Chun|SC|;Wu|Yi-Lin|YL|;Tseng|Yau-Lin|YL|;Chang|Chao-Chun|CC|;Yen|Yi-Ting|YT|;Lin|Chia-Ying|CY|;Lin|Chien-Chung|CC|;Wang|Chin-Chou|CC|;Lin|Meng-Chih|MC|;Su|Wu-Chou|WC|",
"chemical_list": "D000178:Acrylamides; D000814:Aniline Compounds; D047428:Protein Kinase Inhibitors; C000596361:osimertinib; D066246:ErbB Receptors",
"country": "Ireland",
"delete": false,
"doi": "10.1016/j.lungcan.2021.06.014",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0169-5002",
"issue": "158()",
"journal": "Lung cancer (Amsterdam, Netherlands)",
"keywords": "Combination therapy; Osimertinib resistance; T790M mutation",
"medline_ta": "Lung Cancer",
"mesh_terms": "D000178:Acrylamides; D000814:Aniline Compounds; D002289:Carcinoma, Non-Small-Cell Lung; D066246:ErbB Receptors; D006801:Humans; D008175:Lung Neoplasms; D009154:Mutation; D047428:Protein Kinase Inhibitors",
"nlm_unique_id": "8800805",
"other_id": null,
"pages": "137-145",
"pmc": null,
"pmid": "34214933",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Survival benefit of osimertinib combination therapy in patients with T790M-positive non-small-cell lung cancer refractory to osimertinib treatment.",
"title_normalized": "survival benefit of osimertinib combination therapy in patients with t790m positive non small cell lung cancer refractory to osimertinib treatment"
} | [
{
"companynumb": "TW-ROCHE-2908245",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "Current treatment guidelines caution against osseous reconstruction using free flap tissue to treat bisphosphonate-related osteonecrosis of the jaw (BRONJ). The primary rationale for this stance is the theoretical risk of nonunion and recurrence of disease within the reconstruction. Emerging evidence suggests that these theoretical risks may be overestimated. We performed a literature review of this procedure for the treatment of advanced BRONJ. We also present a new case report of resection and microvascular reconstruction in a 58-year-old man with stage III BRONJ.\n\n\n\nA MEDLINE search was performed to gather all reports of maxillary and mandibular reconstruction using free tissue flap transfer for BRONJ. Inclusion criteria were confirmed stage II or III BRONJ, free tissue transfer and reconstruction, and reported complications. Articles were excluded if they contained only local flap reconstruction, wound closure without reconstruction, or osteoradionecrosis. Outcomes from our case report were added to the analysis.\n\n\n\nWe identified 10 articles that met criteria. Adding our case, we identified 40 cases of free flap reconstruction. The rate of nonunion was 5% (2 of 40). Fistulas formed in 4 cases (10%). BRONJ recurred in 2 cases (5%).\n\n\n\nComplication rates after free flap microvascular reconstruction in BRONJ seem acceptable. Nonunion is relatively rare and should not be the sole reason to recommend against free flap reconstruction. A randomized clinical trial would help clarify the role of this procedure in refractory BRONJ; however, we believe that segmental resection and microvascular reconstruction is a viable option in select cases of BRONJ. © 2016 Wiley Periodicals, Inc. Head Neck 38:1278-1285, 2016.",
"affiliations": "Maxillofacial Surgery Unit, Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Maxillofacial Surgery Unit, Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Maxillofacial Surgery Unit, Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.;Department of Plastic, Reconstructive, Aesthetic Surgery, Maxillofacial Surgery, and Burn Unit, Hospital São João, Porto, Portugal.",
"authors": "Neto|Tiago|T|;Horta|Ricardo|R|;Balhau|Rui|R|;Coelho|Lígia|L|;Silva|Pedro|P|;Correia-Sá|Inês|I|;Silva|Álvaro|Á|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/hed.24395",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1043-3074",
"issue": "38(8)",
"journal": "Head & neck",
"keywords": "bisphosphonate-related osteonecrosis of the jaw (BRONJ); bisphosphonates; fibula free flap reconstruction; medication-related osteonecrosis of the jaw; osteonecrosis",
"medline_ta": "Head Neck",
"mesh_terms": "D000368:Aged; D059266:Bisphosphonate-Associated Osteonecrosis of the Jaw; D016025:Bone Transplantation; D005260:Female; D058752:Free Tissue Flaps; D006085:Graft Survival; D006801:Humans; D008297:Male; D063175:Mandibular Reconstruction; D008875:Middle Aged; D011379:Prognosis; D016032:Randomized Controlled Trials as Topic; D019651:Reconstructive Surgical Procedures; D018570:Risk Assessment; D016896:Treatment Outcome",
"nlm_unique_id": "8902541",
"other_id": null,
"pages": "1278-85",
"pmc": null,
"pmid": "27159622",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Resection and microvascular reconstruction of bisphosphonate-related osteonecrosis of the jaw: The role of microvascular reconstruction.",
"title_normalized": "resection and microvascular reconstruction of bisphosphonate related osteonecrosis of the jaw the role of microvascular reconstruction"
} | [
{
"companynumb": "PHHY2016PT106324",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ZOLEDRONIC ACID"
},
"drugadditional": "1",
"... |
{
"abstract": "Denosumab is a monoclonal antibody used for prevention of skeletal-related events (SREs) in patients with bone metastases from solid tumors. Hypocalcemia is a rare and dangerous side effect of the drug Denosumab. We present a case of a patient with metastatic prostate cancer who developed severe hypocalcemia after the administration of the drug. The patient's vitamin D levels were low when checked after administration of the drug, which likely predisposed him to the development of hypocalcemia. He was placed on high doses of oral and intravenous (IV) calcium and vitamin D without any appreciable response in the serum calcium level. His ionized calcium remained below 0.71 mmol/L despite very high doses of oral and IV calcium supplements. During the hospital course, he developed hydronephrosis from the spread of a tumor and did not want to undergo percutaneous nephrostomy tube placement; therefore, it was decided to dialyse him for acute renal failure and to correct his hypocalcemia. Checking calcium and vitamin D levels prior to the administration of Denosumab is vital in preventing hypocalcemia. If hypocalcemia is severe and not responsive to high doses of vitamin D, oral and IV calcium, then hemodialysis with a high calcium bath can correct this electrolyte abnormality.",
"affiliations": "Department of Internal Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA.;Department of Internal Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA ; Department of Nephrology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA.;Department of Internal Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA.;University of Illinois at Chicago, Chicago, IL 60607, USA.;Department of Nephrology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA.;Department of Internal Medicine, Mayo Clinic Hospital, Phoenix, AZ 85054, USA.",
"authors": "Muqeet Adnan|Mohammed|M|;Bhutta|Usman|U|;Iqbal|Tanzeel|T|;AbdulMujeeb|Sufyan|S|;Haragsim|Lukas|L|;Amer|Syed|S|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2014/565393",
"fulltext": "\n==== Front\nCase Rep NephrolCase Rep NephrolCRINCase Reports in Nephrology2090-66412090-665XHindawi Publishing Corporation 10.1155/2014/565393Case ReportSevere Hypocalcemia due to Denosumab in Metastatic Prostate Cancer Muqeet Adnan Mohammed \n1\n*Bhutta Usman \n1\n\n2\nIqbal Tanzeel \n1\nAbdulMujeeb Sufyan \n3\nHaragsim Lukas \n2\nAmer Syed \n4\n1Department of Internal Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA2Department of Nephrology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73117, USA3University of Illinois at Chicago, Chicago, IL 60607, USA4Department of Internal Medicine, Mayo Clinic Hospital, Phoenix, AZ 85054, USA*Mohammed Muqeet Adnan: mohammedabdul-muqeetadnan@ouhsc.eduAcademic Editor: Yoshihide Fujigaki\n\n2014 26 6 2014 2014 56539315 3 2014 1 6 2014 2 6 2014 Copyright © 2014 Mohammed Muqeet Adnan et al.2014This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Denosumab is a monoclonal antibody used for prevention of skeletal-related events (SREs) in patients with bone metastases from solid tumors. Hypocalcemia is a rare and dangerous side effect of the drug Denosumab. We present a case of a patient with metastatic prostate cancer who developed severe hypocalcemia after the administration of the drug. The patient's vitamin D levels were low when checked after administration of the drug, which likely predisposed him to the development of hypocalcemia. He was placed on high doses of oral and intravenous (IV) calcium and vitamin D without any appreciable response in the serum calcium level. His ionized calcium remained below 0.71 mmol/L despite very high doses of oral and IV calcium supplements. During the hospital course, he developed hydronephrosis from the spread of a tumor and did not want to undergo percutaneous nephrostomy tube placement; therefore, it was decided to dialyse him for acute renal failure and to correct his hypocalcemia. Checking calcium and vitamin D levels prior to the administration of Denosumab is vital in preventing hypocalcemia. If hypocalcemia is severe and not responsive to high doses of vitamin D, oral and IV calcium, then hemodialysis with a high calcium bath can correct this electrolyte abnormality.\n==== Body\n1. Case Report\nA 45-year-old gentleman with a three-year history of metastatic (bone, liver, and lymph nodes) prostate cancer and hypertension presented to the hospital with worsening leg swelling and hematuria. He had been treated with androgen deprivation therapy in the past, along with three doses of zoledronic acid for bone metastases. The bone pain was not controlled with the above regimen and it was decided to switch him to Denosumab. He received the dose approximately 13 days prior to hospitalization. Vitals at admission were significant for a blood pressure (BP) of 160/90 mmHg. Pertinent findings on physical examination were the presence of bilateral lower extremity edema and negative Chvostek and Trousseau's signs. The electrocardiogram showed a prolonged QT interval. Laboratory studies on admission revealed sodium of 135 mEq/L, potassium of 4.9 mEq/L, chloride of 105 mEq/L, bicarbonate of 23 mEq/L, blood urea nitrogen (BUN) of 22 mg/dL, creatinine of 1.34 mg/dL, glucose of 133 mg/dL, and calcium of 4.5 mg/dL, with albumin being 2.5 g/dL at admission. Phosphorus level was 6.1 mg/dL. The ionized calcium level at admission was 0.58 mmol/L. Laboratory studies done 13 days prior, when the drug was given, showed serum calcium of 8.4 mg/dL with an albumin of 2.9 g/dL. His vitamin D levels had not been checked prior to the administration of Denosumab. After admission to the hospital, his vitamin D 25-OH level was low at 12.1 ng/mL and vitamin D 1,25 dihydroxy level was high at 95.4 pg/mL. His initial PTH level was high at 440.7 pg/mL.\n\nHe was started on 50,000 IU of ergocalciferol every 7 days, 2 mcg of calcitriol twice daily, and high doses of IV and oral calcium supplementation. Over the next 16 days, the patient received high doses of calcium carbonate; he was first started on 5 gm twice daily of calcium carbonate and 1337 mg of calcium acetate. Since the ionized calcium levels were consistently below 0.60 mmol/L, he was slowly increased to 10 gm twice daily of calcium carbonate and 3335 mg of calcium acetate thrice daily with meals. During the hospitalization, he received a total of 80 gm of IV calcium gluconate and 370 gm of oral calcium, but the highest ionized calcium level that could be achieved was 0.71 mmol/L. Figures 1 and 2 show the calcium and ionized calcium levels during the hospital while receiving oral and IV calcium supplementation.\n\nHe continued to have worsening lower-extremity edema, for which he was started on treatment with hydrochlorothiazide (HCTZ) to help with diuresis as well as with the hypocalcemia. His renal function kept worsening during his hospital stay and his creatinine reached 4.12 mg/dL. During workup for his renal failure, he was found to have hydronephrosis due to the spreading tumor. The options available were either placement of percutaneous nephrostomy tubes by interventional radiology to relieve the hydronephrosis and continued attempts at correction of his electrolytes via medical management or placement of a tunneled dialysis catheter and starting hemodialysis. After a discussion of the risks and benefits of each procedure and the overall prognosis of his condition, the patient opted for hemodialysis. Hemodialysis was initiated on the sixteenth day of hospitalization. He was dialysed daily for the next nine days with a high calcium bath along with two- to three-liter ultrafiltration daily to help get fluid off. His edema improved significantly, his serum calcium levels came above 8 mg/dL, and his ionized calcium stayed above 1 mmol/L without any IV supplementation; however, the oral supplementation with calcium acetate and 10 gm of calcium carbonate twice daily was continued. Due to the poor prognosis of the underlying disease, it was decided to send him home on hospice after arrangement of outpatient hemodialysis to prevent further hypocalcemia and maintain euvolemia. He died approximately three weeks later.\n\n2. Discussion\nDenosumab is a fully human monoclonal antibody, administered subcutaneously, that inhibits osteoclast mediated bone resorption in bone metastases from solid tumors and multiple myeloma. It blocks the RANK ligand from activating the osteoclasts. Tumor cells secrete growth factors to stimulate osteoblasts to release RANK ligand. RANK ligand binds to RANK receptors on the osteoclasts and stimulates them to increase bone resorption. Denosumab blocks this action and hence a major part of calcium metabolism is blocked.\n\nIt has been approved by the US Food and Drug Administration (FDA) for use in postmenopausal women with risk of osteoporosis under the trade name Prolia and for the prevention of skeletal-related events in patients with bone metastases from solid tumors under the trade name XGEVA.\n\nThe recommended dose for XGEVA is 120 mg subcutaneously every four weeks, whereas for Prolia, it is 60 mg subcutaneous every six months.\n\nThe use of Denosumab is associated with a significantly increased risk of developing hypocalcemia [1, 2]. There have been very few case reports describing hypocalcemia to a great degree in patients who receive Denosumab [3]. One case report mentioned hypocalcemia in a dialysis patient after a single dose of Denosumab [3]. Patients are recommended to take 1000 mg oral calcium and 400 IU vitamin D daily in the insert for Prolia. The XGEVA insert recommends the administration of calcium and vitamin D as necessary to prevent hypocalcemia. None of the inserts recommend checking vitamin D levels prior to giving the drug or a certain vitamin D level below which the drug should not be administered.\n\nWe would like to emphasize the importance of checking and supplementing vitamin D levels prior to administration of this drug as well as checking serum calcium levels periodically after drug administration. Patients with low vitamin D levels can develop severe hypocalcemia that can be resistant to treatment. Patients might not always have symptoms of hypocalcemia until the serum calcium falls to dangerously low levels. Our patient did not have any of the classic symptoms of hypocalcemia (neuromuscular irritability, seizures, etc.) and presented to the hospital with worsening leg edema. The only manifestation of hypocalcemia that he had was a prolonged QT interval on electrocardiogram. Indeed, if he had not had leg swelling or hematuria, his hypocalcemia may not have been detected until he had a seizure or a fatal cardiac arrhythmia.\n\nThere are cases reported of hypocalcemia after administration of denosumab, but very few cases showing such resistant hypocalcemia. Since our patient was on very high doses of oral and IV calcium, discharge was virtually impossible. We elected to start the patient on hemodialysis for two reasons: firstly, his worsening acute renal failure due to hydronephrosis, as he did not want to undergo percutaneous nephrostomy tubes placed; and secondly, his resistant hypocalcemia. Even if the patient did not have renal failure, we may have resorted to hemodialysis just to treat his hypocalcemia since all our options for medically managing the patient were getting exhausted without any real increase in the serum calcium level.\n\nIn patients who are already on dialysis, the hypocalcemia can be treated with a high calcium bath in addition to vitamin D supplement. However, in patients with normal renal function, hypocalcemia can usually be treated with a combination of oral and IV calcium along with activated vitamin D. In rare cases like these, hemodialysis with a high calcium bath may be an option.\n\nIn conclusion, we would recommend checking vitamin D 25 OH and serum calcium levels prior to starting treatment with Denosumab. Baseline phosphorus, albumin, and parathyroid hormone should also be checked prior to administration. If vitamin D levels are low, they should be supplemented prior to starting treatment. If treatment cannot be delayed to bring the vitamin D level within the normal range, then vitamin D supplement should be provided along with starting the drug. In either case, the serum calcium level should be monitored periodically to ensure that it does not fall below the normal range. Patients should be maintained on low doses of oral calcium and vitamin D daily while getting Denosumab to prevent hypocalcemia. It has been reported that the prophylactic administration of calcium 500 mg a day and vitamin D 400 IU daily can decrease the risk of hypocalcemia induced by Denosumab [2, 4]. Prolia is not expected to cause such severe hypocalcemia due to the low dose at six-month intervals. XGEVA, on the other hand, might be expected to cause more hypocalcemia since it is given at a higher dose and more frequently.\n\nConflict of Interests\nThe authors declare that there is no conflict of interests regarding the publication of this paper.\n\nFigure 1 Calcium levels while in the hospital remaining low despite ergocalciferol, calcitriol, and high doses of IV and oral calcium supplementation.\n\nFigure 2 Ionized calcium levels during the hospital stay. Hemodialysis was initiated on day 16 due to worsening renal failure and persistent hypocalcemia.\n==== Refs\n1 Qi W-X Lin F He A-N Tang L-N Shen Z Yao Y Incidence and risk of denosumab-related hypocalcemia in cancer patients: a systematic review and pooled analysis of randomized controlled studies Current Medical Research and Opinion 2013 29 9 1067 1073 2-s2.0-84882759793 23745518 \n2 Pharmaceuticals and Medical Devices Agency http://www.info.pmda.go.jp/kinkyu_anzen/file/kinkyu20120911_1.pdf \n3 Mccormick BB Davis J Burns KD Severe hypocalcemia following denosumab injection in a hemodialysis patient American Journal of Kidney Diseases 2012 60 4 626 628 2-s2.0-84866349211 22854051 \n4 Buonerba C Caraglia M Malgieri S Calcitriol: a better option than vitamin D in denosumab-treated patients with kidney failure? Expert Opinion on Biological Therapy 2013 13 2 149 151 2-s2.0-84872186108 23265605\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-665X",
"issue": "2014()",
"journal": "Case reports in nephrology",
"keywords": null,
"medline_ta": "Case Rep Nephrol",
"mesh_terms": null,
"nlm_unique_id": "101598418",
"other_id": null,
"pages": "565393",
"pmc": null,
"pmid": "25054070",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": "22854051;23265605;23745518",
"title": "Severe Hypocalcemia due to Denosumab in Metastatic Prostate Cancer.",
"title_normalized": "severe hypocalcemia due to denosumab in metastatic prostate cancer"
} | [
{
"companynumb": "US-AMGEN-USASP2014027747",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DENOSUMAB"
},
"drugadditional": null,
... |
{
"abstract": "A 69-year-old man with multiple liver metastases from sigmoid colon cancer received mFOLFOX6 plus cetuximab(Cmab) chemotherapy. A partial response was observed; hence, we performed an extended left hepatectomy, 3 partial liver resections, and a sigmoidectomy. After 4 courses of CapeOX, a recurrent lesion occurred between S8 and S7 of the liver, and we changed the regimen to FOLFIRI plus bevacizumab(BV). Three months later, he had Grade 3 febrile neutropenia and CT scan findings showed ground glass opacity in the superior lobes of both lungs. We diagnosed pneumocystis pneumonia(PCP)and administered steroids and trimethoprim/sulfamethoxazole. The signs of PCP thus improved. PCP during chemotherapy for gastrointestinal cancer is rarely reported, but recently it has increased.",
"affiliations": "Division of Cancer Medicine, Dept. of Gastroenterological Surgery, Kanazawa University.",
"authors": "Higashi|Yuri|Y|;Nakamura|Keishi|K|;Hirose|Atsushi|A|;Sakai|Seisho|S|;Kinoshita|Jun|J|;Makino|Isamu|I|;Hayashi|Hironori|H|;Oyama|Katsunobu|K|;Inokuchi|Masafumi|M|;Miyashita|Tomoharu|T|;Tajima|Hidehiro|H|;Takamura|Hiroyuki|H|;Ninomiya|Itasu|I|;Fushida|Sachio|S|;Ohta|Tetsuo|T|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-0684",
"issue": "44(12)",
"journal": "Gan to kagaku ryoho. Cancer & chemotherapy",
"keywords": null,
"medline_ta": "Gan To Kagaku Ryoho",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D006801:Humans; D008297:Male; D009362:Neoplasm Metastasis; D016720:Pneumocystis Infections; D011014:Pneumonia; D012811:Sigmoid Neoplasms",
"nlm_unique_id": "7810034",
"other_id": null,
"pages": "1326-1328",
"pmc": null,
"pmid": "29394622",
"pubdate": "2017-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A Case of Pneumocystis Pneumonia Developed during Chemotherapy for Sigmoid Colon Cancer.",
"title_normalized": "a case of pneumocystis pneumonia developed during chemotherapy for sigmoid colon cancer"
} | [
{
"companynumb": "JP-TEVA-2018-JP-919275",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CAPECITABINE"
},
"drugadditional": "1",
... |
{
"abstract": "Antibodies against PD1 have been used to treat progressive multifocal leukoencephalopathy (PML), a rare brain disease caused by JC virus. We used these antibodies (nivolumab) to treat PML in 3 kidney transplant recipients. All died within 8 weeks of diagnosis. Hence, nivolumab did not improve PML outcome after solid organ transplantation.",
"affiliations": null,
"authors": "Medrano|Chloé|C|;Vergez|François|F|;Mengelle|Catherine|C|;Faguer|Stanislas|S|;Kamar|Nassim|N|;Del Bello|Arnaud|A|",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000077594:Nivolumab",
"country": "United States",
"delete": false,
"doi": "10.3201/eid2511.190705",
"fulltext": "\n==== Front\nEmerg Infect Dis\nEmerging Infect. Dis\nEID\nEmerging Infectious Diseases\n1080-6040\n1080-6059\nCenters for Disease Control and Prevention\n\n31625858\n19-0705\n10.3201/eid2511.190705\nResearch Letter\nResearch Letter\nEffectiveness of Immune Checkpoint Inhibitors in Transplant Recipients with Progressive Multifocal Leukoencephalopathy\nEffectiveness of Immune Checkpoint Inhibitors in Transplant Recipients with Progressive Multifocal Leukoencephalopathy\nImmune Checkpoint Inhibitors in Transplant Recipients with Progressive Multifocal Leukoencephalopathy\nMedrano Chloé\nVergez François\nMengelle Catherine\nFaguer Stanislas\nKamar Nassim\nDel Bello Arnaud\nHôpital Rangueil, Toulouse, France (C. Medrano, S. Faguer, N. Kamar, A. Del Bello);\nUniversité Paul Sabatier, Toulouse (C. Medrano, F. Vergez, S. Faguer, N. Kamar, A. Del Bello);\nHôpital de Toulouse, Toulouse (F. Vergez, C. Mengelle);\nHôpital Purpan, Toulouse (C. Mengelle, N. Kamar, A. Del Bello)\nAddress for correspondence: Del Bello Arnaud, CHU Rangueil, Nephrology Dialysis and Organ Transplant, 1 Ave Jean Poulhès, Toulouse 31059, France; email: delbello.a@chu-toulouse.fr\n11 2019\n25 11 21452147\nAntibodies against PD1 have been used to treat progressive multifocal leukoencephalopathy (PML), a rare brain disease caused by JC virus. We used these antibodies (nivolumab) to treat PML in 3 kidney transplant recipients. All died within 8 weeks of diagnosis. Hence, nivolumab did not improve PML outcome after solid organ transplantation.\n\nKeywords:\n\nprogressive multifocal leukoencephalopathy\nPML\nimmune checkpoint inhibitors\nnivolumab\nT-cell exhaustion\nkidney transplantation\nJC virus\nviruses\nBK virus\nimmunosuppression\n==== Body\nThe role of T-cell exhaustion in the development of progressive multifocal leukoencephalopathy (PML), a rare brain disease caused by JC virus, has prompted clinicians to use immune checkpoint inhibitor molecules to treat JC virus–infected patients. Recently, Cortese et al. (1) used antibodies against PD1 to treat PML in 8 patients (6 with a history of blood disorders and 2 with HIV infection). They noted improvement or stabilization of symptoms for 5 patients but no benefit for the others.\n\nSince 2017, we have treated PML in 3 kidney transplant recipients with a definitive diagnosis, according to the American Academy of Neurology (https://www.aan.com) consensus, made 5 (range 2–17) years after transplantation. We have compiled clinical and radiologic findings for these patients (Appendix Figures 1–3). Since transplantation, the patients had been receiving mycophenolic acid and steroids with either belatacept (n = 1) or tacrolimus (n = 2). At PML diagnosis, immunosuppressants were immediately withdrawn, and nivolumab (antibodies against PD1) was given at a dose of 3 mg/kg every 15 days (2 injections for 2 patients and 3 injections for 1) (Table). For the patient who had received belatacept, we performed 3 apheresis sessions to remove the drug before nivolumab initiation. All patients died within the first 8 weeks after PML diagnosis because of rapid progression of neurologic symptoms.\n\nTable Characteristics of 3 patients with PML who received nivolumab, France, 2017*\n\nPatient characteristics\tTotal lymphocytes; CD4+; CD8+, n/mm3\tClinical course\tAdditional therapy\tJCV in CSF, log10 copies/mL\tLoss of kidney function\t\nPatient 1: age 81 y; received transplant 5 y before PML diagnosis; received treatment with Tac, MPA, prednisone\tB: 300; 76; 56/LFU: 1,000; 602; 250†\tRapid progression of neurologic disorders despite 2 injections of nivolumab; death from progression of PML 6 wk after diagnosis\tMirtazapine 15 mg/d\tB: 3.5/LFU: NA\tNo\t\nPatient 2: age 77 y; received transplant 2 y before PML diagnosis; received treatment with belatacept, MPA, and prednisone\tB: 377; 162; 106/LFU: 444; 117; 210‡\tRapid progression of neurologic disorders despite 3 injections of nivolumab; death from progression of PML 6 wk after diagnosis\tMirtazapine 15 mg/d; γ interferon therapy (100 μg) added 1 day after second and third injections\tB: 2.9/LFU: 5\tYes\t\nPatient 3: age 67 y; received transplant 17 y before PML diagnosis; received treatment with Tac, MPA, prednisone\tB: 487; 287; 67/LFU: 2,076; 1,183; 477§\tRapid neurologic degradation despite 2 injections of nivolumab; death from progression of PML 4 wk after diagnosis\tMirtazapine 15 mg/d\tB: 2.9/LFU: NA\tNo\t\n*B, baseline; CSF, cerebrospinal fluid; JCV, JC virus; LFU, last follow-up; MPA, mycophenolic acid; NA, not available, PML, progressive multifocal leukoencephalopathy; Tac, tacrolimus.\n†LFU for patient 1 was 1 wk after the second injection of nivolumab.\n‡LFU for patient 2 was 4 d after the third injection of nivolumab.\n§LFU for patient 3 was 1 wk after the second injection of nivolumab.\n\nMagnetic resonance imaging was performed before each injection and a few days before death, but images showed no signs of immune reconstitution inflammatory syndrome. Conversely, images did show progression of PML features. As expected, the percentage of T cells expressing PD1, which was assessed for 2 patients, dramatically decreased after receipt of nivolumab (Appendix Figure 4), whereas other inhibitory receptors tested (2b4 and CD160) remained stable or increased. In addition, functional analysis showed a reduction of cytokine production by CD4+ and CD8+ T cells and an improvement of cytotoxic ability, a phenotype compatible with more terminally differentiated exhausted cells, which are less likely to respond to anti-PD1 immune checkpoint inhibitor (2).\n\nResearch has suggested that PML could occur at any time after transplantation (3), even several years after engraftment, which was the case for the 3 patients reported here. As opposed to the results reported by Cortese et al. (1), the outcomes for the 3 patients we report, who received nivolumab, was very bad and in line with the PML outcomes usually reported after solid-organ transplant patients (i.e., median survival time <6 months) (3). The difference between the patients reported by Cortese et al. and the patients that we report is probably use of immunosuppressive agents (calcineurin inhibitors or costimulation blockers) that can lead to persistent T-cell dysfunction, despite withdrawal of these treatments, resulting in refractory T-cell dysfunction after use of anti-PD1 blockers, as reported in ex vivo experiments (4). This hypothesis is supported by the absence of kidney rejection in 2 of the 3 patients. Of note, all 5 patients reported by Cortese et al. (1) for whom anti-PD1 blockers were efficient were not receiving immunosuppressive therapy at PML diagnosis.\n\nMoreover, the 3 patients reported here had profound lymphopenia at diagnosis, which for 2 patients did not improve after receipt of nivolumab (Table). Although there is no established relationship between the severity of lymphopenia and the response to anti-PD1, the 3 patients with unfavorable outcomes reported by Cortese et al. (1) also had severe lymphopenia. This finding suggests that immunotherapies can be ineffective in patients with severe lymphopenia. The use of ex vivo expanded, BK virus–specific T cells (5) should be tested in this setting. For the kidney transplant patients with PML reported here, use of nivolumab, associated with immunosuppressive therapy withdrawal, did not restore efficient immune response and did not improve the outcomes.\n\nAppendix\n\nClinical course of disease for 3 transplant recipients who received immune checkpoint inhibitors (nivolumab) for severe progressive multifocal leukoencephalopathy; expression of surface T-cell inhibitory molecules in 2 patients after receipt of nivolumab.\n\nDr. Medrano is a nephrologist who works in the nephrology and organ transplant department at the Hôpital Rangueil in Toulouse, France, and specializes in intensive care therapy.\n\nSuggested citation for this article: Medrano C, Vergez F, Mengelle C, Faguer S, Kamar N, Del Bello A. Effectiveness of immune checkpoint inhibitors in transplant recipients with severe progressive multifocal leukoencephalopathy. Emerg Infect Dis. 2019 Nov [date cited]. https://doi.org/10.3201/eid2511.190705\n==== Refs\nReferences\n\n1. Cortese I, Muranski P, Enose-Akahata Y, Ha SK, Smith B, Monaco M, et al. Pembrolizumab treatment for progressive multifocal leukoencephalopathy. N Engl J Med. 2019;380 :1597–605. 10.1056/NEJMoa1815039 30969503\n2. Blackburn SD, Shin H, Freeman GJ, Wherry EJ. Selective expansion of a subset of exhausted CD8 T cells by alphaPD-L1 blockade. Proc Natl Acad Sci U S A. 2008;105 :15016–21. 10.1073/pnas.0801497105 18809920\n3. Mateen FJ, Muralidharan R, Carone M, van de Beek D, Harrison DM, Aksamit AJ, et al. Progressive multifocal leukoencephalopathy in transplant recipients. Ann Neurol. 2011;70 :305–22. 10.1002/ana.22408 21823157\n4. Dekeyser M, de Goër de Herve MG, Hendel-Chavez H, Labeyrie C, Adams D, Nasser GA, et al. Refractory T-Cell anergy and rapidly fatal progressive multifocal leukoencephalopathy after prolonged CTLA4 therapy. Open Forum Infect Dis. 2017;4 :ofx100. 10.1093/ofid/ofx100 28638849\n5. Muftuoglu M, Olson A, Marin D, Ahmed S, Mulanovich V, Tummala S, et al. Allogeneic BK virus-specific t cells for progressive multifocal leukoencephalopathy. N Engl J Med. 2018;379 :1443–51. 10.1056/NEJMoa1801540 30304652\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1080-6040",
"issue": "25(11)",
"journal": "Emerging infectious diseases",
"keywords": "BK virus; JC virus; PML; T-cell exhaustion; immune checkpoint inhibitors; immunosuppression; kidney transplantation; nivolumab; progressive multifocal leukoencephalopathy; viruses",
"medline_ta": "Emerg Infect Dis",
"mesh_terms": "D000074322:Antineoplastic Agents, Immunological; D006801:Humans; D056747:Immunomodulation; D007577:JC Virus; D016030:Kidney Transplantation; D007968:Leukoencephalopathy, Progressive Multifocal; D000077594:Nivolumab; D066027:Transplant Recipients; D016896:Treatment Outcome",
"nlm_unique_id": "9508155",
"other_id": null,
"pages": "2145-2147",
"pmc": null,
"pmid": "31625858",
"pubdate": "2019-11",
"publication_types": "D016422:Letter",
"references": "18809920;30969503;28638849;21823157;30304652",
"title": "Effectiveness of Immune Checkpoint Inhibitors in Transplant Recipients with Progressive Multifocal Leukoencephalopathy.",
"title_normalized": "effectiveness of immune checkpoint inhibitors in transplant recipients with progressive multifocal leukoencephalopathy"
} | [
{
"companynumb": "FR-MYLANLABS-2019M1119579",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThe number of kidney transplant recipients (KTRs) from diabetic nephropathy (DN) and with cardiovascular disease (CVD) history has increased worldwide. Nevertheless, epidemiologic evidence of CVD in KTRs remains limited.\n\n\nMETHODS\nWe investigated post-transplant CVD in 1614 adult KTRs between 1990 and 2014. CVD was defined according to the international classification of diseases (ICD-10). All-cause mortality was also investigated. Final follow-up was performed in March 2016. The KTRs were categorized into four groups according to DN and CVD at surgery.\n\n\nRESULTS\nDuring the follow-up period, 309 KTRs experienced CVDs and 124 KTRs died. The 15-year cumulative CVDs rate was 87% in KTRs with both DN and CVD history, and the rate in KTRs without those was 22.3%. DN and CVD were associated with increased risk of post-transplant CVD [hazard ratio (HR), 3.44; 95% confidence interval (CI), 2.03-5.82; P < 0.001], and the impact marked increased after 7.5 years follow-up period (HR, 16.56; 95% CI, 6.56-41.8; P < 0.001). DN and CVD in KTRs were associated with mortality (HR, 3.32; 95% CI, 1.34-8.22; P = 0.009), and post-transplant CVD was the leading cause (35.5%) of overall death. However, DN and CVD were not associated with increased graft failure rate.\n\n\nCONCLUSIONS\nThe risk of post-transplant CVDs incidence in KTRs with DN and CVD history is high, and it increases during the late transplant period. Appropriate routine cardiovascular screening and evaluation are needed to reduce late-onset CVD incidence.",
"affiliations": "Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan. okumi@twmu.ac.jp.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Nephrology, Tokyo Women's Medical University, Tokyo, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.;Department of Urology, Tokyo Women's Medical University, 8-1 Kawada-cho, Shinjuku, Tokyo, 162-8666, Japan.",
"authors": "Okumi|Masayoshi|M|http://orcid.org/0000-0001-7443-2621;Kakuta|Yoichi|Y|;Unagami|Kohei|K|;Maenosono|Ryoichi|R|;Miyake|Katsunori|K|;Iizuka|Junpei|J|;Takagi|Toshio|T|;Ishida|Hideki|H|;Tanabe|Kazunari|K|;|||",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1007/s10157-017-1500-z",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1342-1751",
"issue": "22(3)",
"journal": "Clinical and experimental nephrology",
"keywords": "Cardiovascular disease; Diabetic nephropathy; Epidemiology; Kidney transplantation",
"medline_ta": "Clin Exp Nephrol",
"mesh_terms": "D000328:Adult; D002318:Cardiovascular Diseases; D015331:Cohort Studies; D003928:Diabetic Nephropathies; D005260:Female; D006801:Humans; D007564:Japan; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications",
"nlm_unique_id": "9709923",
"other_id": null,
"pages": "702-709",
"pmc": null,
"pmid": "29159526",
"pubdate": "2018-06",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D064888:Observational Study",
"references": "19339088;14961990;17876274;14581387;22753303;27664574;26769764;9820470;27282330;24352519;10477542;28010785;19845597;20415903;14638926;26555133;27862344;11477152;27761671;27174593;26673558;27884399;22000138;26985745;16788687;22594581;17108318",
"title": "Cardiovascular disease in kidney transplant recipients: Japan Academic Consortium of Kidney Transplantation (JACK) cohort study.",
"title_normalized": "cardiovascular disease in kidney transplant recipients japan academic consortium of kidney transplantation jack cohort study"
} | [
{
"companynumb": "JP-ROCHE-1963230",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BASILIXIMAB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Tumor lysis syndrome (TLS) is characterized by hyperkalemia, hyperuricemia, hypocalcemia and hyperphosphatemia. This report describes a case of hypercalcemia in TLS in a patient with diffuse large B cell lymphoma.",
"affiliations": "Hematologist/Medical Oncologist, St. Joseph Regional Cancer Center, 1250 Idaho Street, Lewiston, ID 83501 USA.",
"authors": "Shah|Binay Kumar|BK|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.1007/s12288-013-0264-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0971-4502",
"issue": "30(Suppl 1)",
"journal": "Indian journal of hematology & blood transfusion : an official journal of Indian Society of Hematology and Blood Transfusion",
"keywords": "Hypercalcemia; Lymphoma; Paraneoplastic syndrome; Tumor lysis syndrome",
"medline_ta": "Indian J Hematol Blood Transfus",
"mesh_terms": null,
"nlm_unique_id": "9425818",
"other_id": null,
"pages": "88-9",
"pmc": null,
"pmid": "25332546",
"pubdate": "2014-09",
"publication_types": "D002363:Case Reports",
"references": "12184049;12619944;21561350;7387355",
"title": "Hypercalcemia in tumor lysis syndrome.",
"title_normalized": "hypercalcemia in tumor lysis syndrome"
} | [
{
"companynumb": "US-JNJFOC-20160809415",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
"... |
{
"abstract": "OBJECTIVE\nThe purpose of this study was to assess change in body mass index (BMI) and age- and gender-adjusted BMI Z-score in subjects ages 2-20 years with autism spectrum disorders (ASD), who were treated longitudinally with risperidone or aripiprazole at a tertiary care ASD clinic.\n\n\nMETHODS\nAs part of a larger project involving longitudinal drug treatment data in ASD, detailed demographic and treatment data were collected for 142 subjects ages 2-20 years who had been started on risperidone or aripiprazole for treatment of irritability. Mean age at start of treatment, treatment duration, final Clinical Global Impressions-Improvement Scale score, BMI change per year of treatment, and BMI Z-score change per year of treatment (primary outcome measure) were calculated for each drug treatment group. Group means were compared using t tests and Wilcoxon rank sum tests.\n\n\nRESULTS\nThere was a statistically significant BMI and BMI Z-score increase in the risperidone and aripiprazole treatment groups individually. No statistically significant difference between the two treatment groups was noted in mean BMI change per year of treatment or BMI Z-score change per year of treatment.\n\n\nCONCLUSIONS\nIn our review of long-term naturalistic treatment of irritability using risperidone versus aripiprazole in persons with ASD, a significant increase in both BMI and age- and gender-adjusted BMI Z-score was noted for each treatment group. No significant difference in BMI or BMI Z-score change was noted when the two treatment groups were compared. We conclude that in our patient population at a tertiary care ASD clinic, the effects of risperidone and aripiprazole on body weight gain in naturalistic long-term treatment are no different.",
"affiliations": "1 Cincinnati Children's Hospital Medical Center , Cincinnati, Ohio.",
"authors": "Wink|Logan K|LK|;Early|Maureen|M|;Schaefer|Tori|T|;Pottenger|Amy|A|;Horn|Paul|P|;McDougle|Christopher J|CJ|;Erickson|Craig A|CA|",
"chemical_list": "D014150:Antipsychotic Agents; D010879:Piperazines; D015363:Quinolones; D000068180:Aripiprazole; D018967:Risperidone",
"country": "United States",
"delete": false,
"doi": "10.1089/cap.2013.0099",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1044-5463",
"issue": "24(2)",
"journal": "Journal of child and adolescent psychopharmacology",
"keywords": null,
"medline_ta": "J Child Adolesc Psychopharmacol",
"mesh_terms": "D000293:Adolescent; D014150:Antipsychotic Agents; D000068180:Aripiprazole; D015992:Body Mass Index; D002648:Child; D002659:Child Development Disorders, Pervasive; D002675:Child, Preschool; D005260:Female; D006801:Humans; D007508:Irritable Mood; D008297:Male; D010879:Piperazines; D015363:Quinolones; D018967:Risperidone; D015430:Weight Gain; D055815:Young Adult",
"nlm_unique_id": "9105358",
"other_id": null,
"pages": "78-82",
"pmc": null,
"pmid": "24564519",
"pubdate": "2014-03",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D064888:Observational Study",
"references": "21813076;15169706;19948625;22506734;19861668;21295450;17910205;20848330;9672054;22544019;22405602;12151468;18533764;22166172;15492353;12860772;19797985;22406333;22332047;21768610",
"title": "Body mass index change in autism spectrum disorders: comparison of treatment with risperidone and aripiprazole.",
"title_normalized": "body mass index change in autism spectrum disorders comparison of treatment with risperidone and aripiprazole"
} | [
{
"companynumb": "US-JNJFOC-20140417472",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "UNSPECIFIED INGREDIENT"
},
"drugadditional": nul... |
{
"abstract": "Pemphigoid gestationis (PG) is an autoimmune blistering disease associated with pregnancy. It is characterized by the presence of autoantibodies against bullous pemphigoid antigens in the basement membrane zone. A 32 year old female developed PG in the first pregnancy and had a stillbirth. PG recurred during the second trimester of her second pregnancy. Systemic corticosteroid therapy was cause for concern since patient developed gestational diabetes. Patient was unwilling to use insulin. Intravenous immunoglobulin (IVIg) was used as a treatment of last resort. The dose was 2g/kg/cycle. It was given every two weeks antepartum and every three weeks for three months postpartum. PG improved within four weeks of IVIg therapy. Serum and tissue immunopathological studies were negative prior to delivery. A healthy neonate was born. No adverse events to IVIg were observed. No disease was observed ten months postpartum.",
"affiliations": "Center for Blistering Diseases, 697 Cambridge St, Boston, MA, USA.;Asaad Alhamad Center for Dermatology, Kuwait City, Kuwait.;Center for Blistering Diseases, 697 Cambridge St, Boston, MA, USA. Electronic address: arahmedmd@msn.com.",
"authors": "Nguyen|Tegan|T|;Alraqum|Esraa|E|;Razzaque Ahmed|A|A|",
"chemical_list": "D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1567-5769",
"issue": "26(1)",
"journal": "International immunopharmacology",
"keywords": "Autoimmune disease; Intravenous immunoglobulin; Pemphigoid gestationis",
"medline_ta": "Int Immunopharmacol",
"mesh_terms": "D000328:Adult; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D006559:Pemphigoid Gestationis; D011247:Pregnancy; D011256:Pregnancy Outcome; D012008:Recurrence; D016896:Treatment Outcome",
"nlm_unique_id": "100965259",
"other_id": null,
"pages": "1-3",
"pmc": null,
"pmid": "25765353",
"pubdate": "2015-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Positive clinical outcome with IVIg as monotherapy in recurrent pemphigoid gestationis.",
"title_normalized": "positive clinical outcome with ivig as monotherapy in recurrent pemphigoid gestationis"
} | [
{
"companynumb": "US-ROXANE LABORATORIES, INC.-2015-RO-01907RO",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditi... |
{
"abstract": "Hematopoietic cell transplantation is an effective treatment for patients with nonmalignant diseases and for many is the only known cure. Conventional myeloablative regimens have been associated with unacceptably high early transplant-related mortality (TRM), particularly in patients with comorbid conditions. This prospective multicenter trial was designed to determine the safety and engraftment efficacy of treosulfan-based conditioning in patients with nonmalignant diseases. Thirty-one patients received HLA-matched related (n = 4) or unrelated (n = 27) grafts after conditioning with treosulfan (total dose, 42 g/m(2)), fludarabine (total dose, 150 mg/m(2)), ± thymoglobulin (6 mg/kg; n = 22). Graft-versus-host disease (GVHD) prophylaxis consisted of tacrolimus and methotrexate. All patients engrafted. Day-100 TRM was 0%. With a median follow-up of 2 years, the 2-year survival was 90%. Three patients died of GVHD, recurrent hemophagocytic lymphohistiocytosis, and a surgical complication, respectively. The cumulative incidences of grades II to IV and III to IV acute GVHD at day 100 and chronic GVHD at 2 years were 62%, 10%, and 21%, respectively. Patients who received thymoglobulin had a significantly lower incidence of grades III to IV acute GVHD (0% versus 33%; P = .005). These results indicate that the combination of treosulfan, fludarabine, and thymoglobulin is effective at establishing donor engraftment with low toxicity and improved survival in patients with nonmalignant diseases and support the need for future disease-specific clinical trials.",
"affiliations": "Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington. Electronic address: lburroug@fhcrc.org.;Oregon Health & Science University, Portland, Oregon.;University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington.;Medical College of Wisconsin, Milwaukee, Wisconsin.;Vanderbilt University, Nashville, Tennessee.;Children's Hospital Colorado, Aurora, Colorado.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;Medical College of Wisconsin, Milwaukee, Wisconsin.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington.;Fred Hutchinson Cancer Research Center, Seattle, Washington; University of Washington School of Medicine, Seattle, Washington; Seattle Children's Hospital, Seattle, Washington.",
"authors": "Burroughs|Lauri M|LM|;Nemecek|Eneida R|ER|;Torgerson|Troy R|TR|;Storer|Barry E|BE|;Talano|Julie-An|JA|;Domm|Jennifer|J|;Giller|Roger H|RH|;Shimamura|Akiko|A|;Delaney|Colleen|C|;Skoda-Smith|Suzanne|S|;Thakar|Monica S|MS|;Baker|K Scott|KS|;Rawlings|David J|DJ|;Englund|Janet A|JA|;Flowers|Mary E D|ME|;Deeg|H Joachim|HJ|;Storb|Rainer|R|;Woolfrey|Ann E|AE|",
"chemical_list": "D000961:Antilymphocyte Serum; D018906:Antineoplastic Agents, Alkylating; D007166:Immunosuppressive Agents; D019653:Myeloablative Agonists; C018404:treosulfan; C512542:thymoglobulin; D014740:Vidarabine; D002066:Busulfan; C024352:fludarabine; D016559:Tacrolimus; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1083-8791",
"issue": "20(12)",
"journal": "Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation",
"keywords": "Allo-transplantation; Clinical results in inherited disorders; Conditioning regimen; Nonmalignant diseases; Reduced-intensity conditioning",
"medline_ta": "Biol Blood Marrow Transplant",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000741:Anemia, Aplastic; D000961:Antilymphocyte Serum; D018906:Antineoplastic Agents, Alkylating; D002066:Busulfan; D002648:Child; D002675:Child, Preschool; D005199:Fanconi Anemia; D005260:Female; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007166:Immunosuppressive Agents; D007223:Infant; D008297:Male; D008727:Methotrexate; D019653:Myeloablative Agonists; D011446:Prospective Studies; D016559:Tacrolimus; D019172:Transplantation Conditioning; D061349:Unrelated Donors; D014740:Vidarabine",
"nlm_unique_id": "9600628",
"other_id": null,
"pages": "1996-2003",
"pmc": null,
"pmid": "25196857",
"pubdate": "2014-12",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016448:Multicenter Study; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "12931121;16338616;23085832;21659356;12239144;21297673;16413398;21325599;18978748;22533862;24487253;15111931;7703498;24035782;22158386;21228326;22645178;22742881;19822218;23637873;18492115;12947008;7581076;16151422;20498405;10979948;2230693;23355537;16635793;20007560;20643476;20685259;2911570;8663884;23160007;15004542;16339666;24162790;16115132;17660844;17032176;22326631;10100572;11259721;22198540",
"title": "Treosulfan-based conditioning and hematopoietic cell transplantation for nonmalignant diseases: a prospective multicenter trial.",
"title_normalized": "treosulfan based conditioning and hematopoietic cell transplantation for nonmalignant diseases a prospective multicenter trial"
} | [
{
"companynumb": "US-SA-2014SA175873",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "Our report describes the outcome of a twin pregnancy in a woman who was maintained on tacrolimus after a living related renal transplant. Both babies born at 32 weeks of gestation developed severe respiratory distress requiring ventilator assistance and went on to develop congestive heart failure. Echocardiograms on both babies showed dilated heart chambers. Twin A succumbed to complications, but twin B, who was treated more aggressively with vasopressors, recovered. Autopsy findings on twin A revealed a thrombotic cardiomyopathy with degeneration of cardiac muscle. We believe that the unusual outcome in this set of twins may have been a result of cardiomyopathy secondary to tacrolimus used by the mother during her pregnancy.",
"affiliations": "Division of Pediatric Nephrology, SUNY Health Science Center at Brooklyn, New York 11203, USA.",
"authors": "Vyas|S|S|;Kumar|A|A|;Piecuch|S|S|;Hidalgo|G|G|;Singh|A|A|;Anderson|V|V|;Markell|M S|MS|;Baqi|N|N|",
"chemical_list": "D007166:Immunosuppressive Agents; D016572:Cyclosporine; D001379:Azathioprine; D007741:Labetalol; D011241:Prednisone; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1097/00007890-199902150-00028",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1337",
"issue": "67(3)",
"journal": "Transplantation",
"keywords": null,
"medline_ta": "Transplantation",
"mesh_terms": "D001379:Azathioprine; D002585:Cesarean Section; D016572:Cyclosporine; D017809:Fatal Outcome; D005260:Female; D006084:Graft Rejection; D006801:Humans; D006973:Hypertension; D007166:Immunosuppressive Agents; D007231:Infant, Newborn; D007234:Infant, Premature; D016030:Kidney Transplantation; D007741:Labetalol; D019520:Living Donors; D008297:Male; D009679:Nuclear Family; D011241:Prednisone; D011247:Pregnancy; D011249:Pregnancy Complications, Cardiovascular; D011256:Pregnancy Outcome; D016559:Tacrolimus; D014427:Twins",
"nlm_unique_id": "0132144",
"other_id": null,
"pages": "490-2",
"pmc": null,
"pmid": "10030303",
"pubdate": "1999-02-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Outcome of twin pregnancy in a renal transplant recipient treated with tacrolimus.",
"title_normalized": "outcome of twin pregnancy in a renal transplant recipient treated with tacrolimus"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2017SP012394",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional... |
{
"abstract": "The ketogenic diet (KD) may have a role in treating super-refractory status epilepticus (SRSE). Predominantly used in paediatric epilepsy, there are few reports of its use in adults. We describe a 19-year-old man with UBE2A deficiency syndrome, drug resistant generalized epilepsy, and severe intellectual disability, who developed SRSE. Initiation of the KD on day 81 of his intensive care unit stay and achieving a state of ketosis seven days later resulted in SRSE resolution and discharge from hospital and recovery to his normal cognitive state. Initiating the KD required a multidisciplinary team for diet initiation and carer education. The KD requires a prospective study of efficacy for SRSE and this should include adult patients.",
"affiliations": "Department of Neurology, Queen's Medical Centre, Nottingham, United Kingdom.;Department of Neurology, Queen's Medical Centre, Nottingham, United Kingdom.;Daisy Garland Ketogenic Dietitian, Queen's Medical Centre, Nottingham, United Kingdom.;Department of Critical Care, Queen's Medical Centre, Nottingham, United Kingdom.;Department of Critical Care, Queen's Medical Centre, Nottingham, United Kingdom.;Department of Neurology, Queen's Medical Centre, Nottingham, United Kingdom.",
"authors": "Allen|Christopher Martin|CM|;Hall|Christiana Avye|CA|;Cox|Naomi Elizabeth|NE|;Ryan|Hayley|H|;De Beer|Thearina|T|;O'Donoghue|Michael Francis|MF|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebr.2021.100456",
"fulltext": "\n==== Front\nEpilepsy Behav Rep\nEpilepsy Behav Rep\nEpilepsy & Behavior Reports\n2589-9864\nElsevier\n\nS2589-9864(21)00030-7\n10.1016/j.ebr.2021.100456\n100456\nCase Report\nAdjunctive use of the ketogenic diet in a young adult with UBE2A deficiency syndrome and super-refractory status epilepticus\nAllen Christopher Martin christopher.allen2@nuh.nhs.uk\na⁎\nHall Christiana Avye a\nCox Naomi Elizabeth b\nRyan Hayley c\nDe Beer Thearina c\nO'Donoghue Michael Francis a\na Department of Neurology, Queen’s Medical Centre, Nottingham, United Kingdom\nb Daisy Garland Ketogenic Dietitian, Queen’s Medical Centre, Nottingham, United Kingdom\nc Department of Critical Care, Queen’s Medical Centre, Nottingham, United Kingdom\n⁎ Corresponding author at: Department of Neurology, Queen’s Medical Centre, Nottingham University Hospitals NHS Trust, Nottingham NG7 2UH, United Kingdom. christopher.allen2@nuh.nhs.uk\n07 5 2021\n2021\n07 5 2021\n16 1004564 1 2021\n21 4 2021\n24 4 2021\n© 2021 The Author(s)\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nHighlights\n\n• UBE2A deficiency syndrome causes X-linked intellectual disability and epilepsy.\n\n• Our patient with super-refractory status epilepticus failed conventional therapy.\n\n• He responded to the ketogenic diet with a long-term favourable outcome.\n\n• Our report should prompt consideration of the ketogenic diet for these conditions.\n\nThe ketogenic diet (KD) may have a role in treating super-refractory status epilepticus (SRSE). Predominantly used in paediatric epilepsy, there are few reports of its use in adults. We describe a 19-year-old man with UBE2A deficiency syndrome, drug resistant generalized epilepsy, and severe intellectual disability, who developed SRSE. Initiation of the KD on day 81 of his intensive care unit stay and achieving a state of ketosis seven days later resulted in SRSE resolution and discharge from hospital and recovery to his normal cognitive state. Initiating the KD required a multidisciplinary team for diet initiation and carer education. The KD requires a prospective study of efficacy for SRSE and this should include adult patients.\n\nKeywords\n\nStatus Epilepticus\nIntensive Care\nNeurogenetics\n==== Body\n1 Introduction\n\nSuper-refractory status epilepticus (SRSE) is defined as status epilepticus that continues in spite of standard first and second line anti-seizure treatments, and at least 24 hours of anaesthesia, or upon withdrawal of anesthesia.[1] UBE2A deficiency, first described in 2006[2] causes an X-linked moderate to severe intellectual disability, genetic generalized epilepsy, speech impairment, dysmorphic facial features and skin abnormalities.[3] Ubiquitin conjugating enzyme E2A is involved in the ubiquitin protease pathway, post-replication DNA damage repair and regulation of transcription. How its deficiency causes epilepsy has yet to be elucidated.[4], [5]\n\n2 Case presentation\n\nA 19-year-old man with a background of surgically corrected coarctation of the aorta and a ventricular septal defect, severe learning disability and drug-resistant generalized epilepsy presented with SRSE. During his admission, whole exome sequencing revealed the cause of his intellectual disability and epilepsy to be UBE2A deficiency syndrome caused by a p.Asp101del mutation. At presentation, he had not experienced tonic-clonic seizures for some years and had never experienced status epilepticus before. His usual seizure types were daily absences and myoclonus, a few tonic seizures per week and rare tonic-clonic seizures. He was fully ambulatory but used a wheelchair when outdoors due to his tonic attacks and refusal to wear a helmet. His behavior could be challenging and obstinent. He lived with his family and communicated using signing (Makaton) and single words. He was taking lamotrigine, levetiracetam, clobazam and zonisamide. Sodium valproate had been tried but discontinued because of aggression. He had a vagus nerve stimulator (Model 106, Aspire SR; LivaNova) and used buccal midazolam as a rescue anti-seizure medication. Brain MRI had been performed at 19 months and 18 years. These demonstrated numerous non-progressive subcortical and periventricular white matter T2 hyperintensities, a 1.3 cm complex pineal lesion and progressive cerebral and cerebellar atrophy.\n\nHe was admitted to our hospital in generalized tonic-clonic status epilepticus. He was treated in the intensive care unit with intravenous valproate loading, followed by intubation and sedation with midazolam, propofol and later thiopental, (Fig. 1) in order to cause burst-suppression on EEG. Chest x-ray and sputum cultures confirmed a community acquired pneumonia. Extensive investigation, including screening for an alternative infection, brain imaging (both CT and MRI) and CSF analysis were unremarkable.Fig. 1 Treatments used during intensive care admission. Anti-seizure medication and anesthetic agents used during intensive care unit admission.\n\nEach time sedation was reduced, he continued to have either generalized tonic or tonic-clonic seizures or generalized epileptiform activity on EEG, fulfilling the definition of SRSE. Phenytoin, rufinamide, acetazolamide and methylprednisolone were tried without success. On day 81 of his admission, as there had been no resolution of his SRSE a classic ketogenic diet (KD) was initiated. Seven days later he reached a state of ketosis; a mean ketone concentration ≥ 2 mmol/L (Fig. 2) and a reduction in seizure frequency was seen clinically and confirmed using EEG. All convulsive seizures ceased though absences and rare tonic seizures remained. Intravenous midazolam infusion was weaned and he regained consciousness. Initiating the KD required a multidisciplinary team to provide prolonged intensive care, specialized nutritional advice, gastrostomy tube placement, care-giver education, and screening of prescription medications for suitability. Weaning from his tracheostomy was prolonged due to acquired critical illness polyneuropathy. On day 196 he was discharged from the intensive care unit to the neurology ward. He was successfully discharged to a supported living facility on the KD and has remained compliant via his gastrostomy. The only long-term consequence was leg weakness due to polyneuropathy. A further episode of pneumonia 18 months later led to clusters of tonic seizures over 72 hours that were rapidly controlled with intravenous valproate. At two years he has remained free of generalized tonic-clonic seizures but had occasional absences persist. He remains on a higher number of anti-seizure medications than at baseline. Attempts to reduce his polypharmacy are planned to be undertaken in future if there is sustained stability. He returned to his baseline cognitive state.Fig. 2 Maximum daily Glasgow Coma Score and average ketone concentration during intensive care admission. The maximum Glasgow Coma Score (blue) achieved each day during intensive care admission displayed against the average ketone concentration (red).\n\n3 Discussion\n\nThe first published use of the KD in an adult with SRSE was in 2008[6] and following several promising case series, a small (n = 15) prospective multicenter trial was performed in the United States.[7] This showed 79% of those completing the KD achieved resolution of SRSE, although mortality in this group was still 33%. The KD does not contribute to hemodynamic instability seen with anesthetic agents. There may be additional neuroprotective benefits related to improved mitochondrial function due to increased energy reserves combined with decreased production of reactive oxygen species.[8] Contraindications include propofol infusion for anesthesia,[9] carnitine or pyruvate carboxylase deficiency, a deficiency of fatty acid metabolism and porphyria. Relative contraindications include inability to maintain adequate nutrition and a surgical focus identified by neuroimaging.[10] A KD trained dietitian is needed for initiation and long-term monitoring. Input from a pharmacist is required. Many medicines, such as potassium supplements, contain enough carbohydrate to prevent ketosis.\n\nThe use of whole exome sequencing detected UBE2A deficiency syndrome in this case. The mechanism that links its deficiency to epilepsy has yet to be elucidated. We speculate that KD may have worked in this case by improving mitochondrial function as UBE2A deficiency impairs the clearance of dysfunctional mitochondria.[4]\n\nThe KD is now included in several adult SRSE treatment algorithms [1], [11], [12] despite the current lack of evidence. This uncommon condition has a high mortality and further prospective studies are required to advance our understanding of available treatments. In our case, adjunctive use of the KD led to an immediate and sustained recovery of a critically ill patient with a favourable outcome.\n\n4 Conclusion\n\nThe ketogenic diet, as part of polytherapy, successfully treated our patient with UBE2A deficiency syndrome and SRSE. We propose it should be considered as an option for other patients with treatment resistant epilepsy secondary to UBE2A deficiency syndrome. Additional prospective trials may support its efficacy in the treatment of adult convulsive super-refractory status epilepticus associated with UBE2A.\n\nEthical approval information\n\nResearch ethics approval not required.\n\nDeclaration of Competing Interest\n\nThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\n\nAcknowledgements\n\nWe would like to thank all members of the clinical team whose hard work contributed to our patient surviving their critical illness.\n\nFunding info\n\nThere is no funding to report for this article.\n==== Refs\nReferences\n\n1 Shorvon S. Ferlisi M. The treatment of super-refractory status epilepticus: a critical review of available therapies and a clinical treatment protocol Brain: J Neurol 134 10 2011 2802 2818\n2 Nascimento R.M.P. Otto P.A. de Brouwer A.P.M. Vianna-Morgante A.M. UBE2A, which encodes a ubiquitin-conjugating enzyme, is mutated in a novel X-linked mental retardation syndrome Am J Hum Genet 79 3 2006 549 555 16909393\n3 Cordeddu V. Macke E.L. Radio F.C. Lo Cicero S. Pantaleoni F. Tatti M. Refinement of the clinical and mutational spectrum of UBE2A deficiency syndrome Clin Genet 98 2 2020 172 178 32415735\n4 Haddad D. Vilain S. Vos M. Esposito G. Matta S. Kalscheuer V. Mutations in the intellectual disability gene Ube2a cause neuronal dysfunction and impair parkin-dependent mitophagy Mol Cell 50 6 2013 831 843 23685073\n5 Bruinsma C.F. Savelberg S.M.C. Kool M.J. Jolfaei M.A. Van Woerden G.M. Baarends W.M. An essential role for UBE2A/HR6A in learning and memory and mGLUR-dependent long-term depression Hum Mol Genet 25 1 2016 1 8 26476408\n6 Bodenant M. Moreau C. Sejourne C. Auvin S. Delval A. Cuisset J.M. Interest of the ketogenic diet in a refractory status epilepticus in adults Revue neurologique. 164 2 2008 194 199 18358881\n7 Cervenka M.C. Hocker S. Koenig M. Bar B. Henry-Barron B. Kossoff E.H. Phase I/II multicenter ketogenic diet study for adult superrefractory status epilepticus Neurology. 88 10 2017 938 943 28179470\n8 McDonald T.J.W. Cervenka M.C. Ketogenic Diets for Adults With Highly Refractory Epilepsy Epilepsy Currents. 17 6 2017 346 350 29217974\n9 Baumeister F.A.M. Oberhoffer R. Liebhaber G.M. Kunkel J. Eberhardt J. Holthausen H. Fatal propofol infusion syndrome in association with ketogenic diet Neuropediatrics. 35 4 2004 250 252 15328567\n10 Kossoff EH, Zupec-Kania BA, Amark PE, Ballaban-Gil KR, Christina Bergqvist AG, Blackford R, et al. Optimal clinical management of children receiving the ketogenic diet: recommendations of the International Ketogenic Diet Study Group. Epilepsia; 2009;50(2):304-17.\n11 Bayrlee A. Ganeshalingam N. Kurczewski L. Brophy G.M. Treatment of Super-Refractory Status Epilepticus Curr Neurol Neurosci Rep 15 10 2015 66 26299274\n12 Holtkamp M. Pharmacotherapy for Refractory and Super-Refractory Status Epilepticus in Adults Drugs 78 3 2018 307 326 29368126\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2589-9864",
"issue": "16()",
"journal": "Epilepsy & behavior reports",
"keywords": "Intensive Care; Neurogenetics; Status Epilepticus",
"medline_ta": "Epilepsy Behav Rep",
"mesh_terms": null,
"nlm_unique_id": "101750909",
"other_id": null,
"pages": "100456",
"pmc": null,
"pmid": "34095805",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "26476408;29368126;15328567;16909393;18358881;29217974;28179470;32415735;21914716;18823325;23685073;26299274",
"title": "Adjunctive use of the ketogenic diet in a young adult with UBE2A deficiency syndrome and super-refractory status epilepticus.",
"title_normalized": "adjunctive use of the ketogenic diet in a young adult with ube2a deficiency syndrome and super refractory status epilepticus"
} | [
{
"companynumb": "GB-TEVA-2022-GB-2045307",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAZOLAMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Hepatic sinusoidal obstruction syndrome (SOS), also known as veno-occlusive disease (VOD) can be a life-threatening complication after hematopoietic stem cell transplantation (HSCT). Diagnosis is often difficult and traditionally based on clinical parameters. Shear wave elastography (SWE) is a modern non-invasive liver stiffness measurement technique using ultrasound. In this monocentric study, we evaluated the role of SWE in diagnosing SOS/VOD in 63 adult patients undergoing HSCT from February 2020 to August 2020 in real world settings. Three patients developed SOS/VOD. This was accompanied by an increase in shear wave velocity in all three patients, indicating that this method may contribute to establishing the diagnosis SOS/VOD after HSCT.",
"affiliations": "Department of Hepatology and Gastroenterology, Charité-Universitätsmedizin Berlin, Campus Virchow-Klinikum (CVK) und Campus Charité Mitte (CCM), 13353 Berlin, Germany.;Department of Hematology, Oncology and Tumor Immunology, Charité-Universitätsmedizin Campus Virchow-Klinikum (CVK), 13353 Berlin, Germany.;Department of Radiology, Charité-Universitätsmedizin Berlin, Campus Charité Mitte (CCM), 10117 Berlin, Germany.;Department of Hepatology and Gastroenterology, Charité-Universitätsmedizin Berlin, Campus Virchow-Klinikum (CVK) und Campus Charité Mitte (CCM), 13353 Berlin, Germany.;Department of Hepatology and Gastroenterology, Charité-Universitätsmedizin Berlin, Campus Virchow-Klinikum (CVK) und Campus Charité Mitte (CCM), 13353 Berlin, Germany.;Department of Hematology, Oncology and Tumor Immunology, Charité-Universitätsmedizin Campus Virchow-Klinikum (CVK), 13353 Berlin, Germany.;Department of Hepatology and Gastroenterology, Charité-Universitätsmedizin Berlin, Campus Virchow-Klinikum (CVK) und Campus Charité Mitte (CCM), 13353 Berlin, Germany.",
"authors": "Schulz|Marten|M|0000-0003-0298-0156;Vuong|Lam Giang|LG|;Müller|Hans Peter|HP|;Maibier|Martin|M|;Tacke|Frank|F|0000-0001-6206-0226;Blau|Igor Wolfgang|IW|;Wree|Alexander|A|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/diagnostics11060928",
"fulltext": "\n==== Front\nDiagnostics (Basel)\nDiagnostics (Basel)\ndiagnostics\nDiagnostics\n2075-4418\nMDPI\n\n34064217\n10.3390/diagnostics11060928\ndiagnostics-11-00928\nArticle\nShear Wave Elastography in the Detection of Sinusoidal Obstruction Syndrome in Adult Patients Undergoing Allogenic Hematopoietic Stem Cell Transplantation\nhttps://orcid.org/0000-0003-0298-0156\nSchulz Marten 1*\nVuong Lam Giang 2\nMüller Hans Peter 3\nMaibier Martin 1\nhttps://orcid.org/0000-0001-6206-0226\nTacke Frank 1\nBlau Igor Wolfgang 2\nWree Alexander 1\nMelchor Juan Academic Editor\n1 Department of Hepatology and Gastroenterology, Charité-Universitätsmedizin Berlin, Campus Virchow-Klinikum (CVK) und Campus Charité Mitte (CCM), 13353 Berlin, Germany; martin.maibier@charite.de (M.M.); frank.tacke@charite.de (F.T.); alexander.wree@charite.de (A.W.)\n2 Department of Hematology, Oncology and Tumor Immunology, Charité-Universitätsmedizin Campus Virchow-Klinikum (CVK), 13353 Berlin, Germany; lam.vuong@charite.de (L.G.V.); igor.blau@charite.de (I.W.B.)\n3 Department of Radiology, Charité-Universitätsmedizin Berlin, Campus Charité Mitte (CCM), 10117 Berlin, Germany; hans_peter.mueller@charite.de\n* Correspondence: marten.schulz@charite.de; Tel.: +49-30450553022\n21 5 2021\n6 2021\n11 6 92829 4 2021\n18 5 2021\n© 2021 by the authors.\n2021\nhttps://creativecommons.org/licenses/by/4.0/ Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).\nHepatic sinusoidal obstruction syndrome (SOS), also known as veno-occlusive disease (VOD) can be a life-threatening complication after hematopoietic stem cell transplantation (HSCT). Diagnosis is often difficult and traditionally based on clinical parameters. Shear wave elastography (SWE) is a modern non-invasive liver stiffness measurement technique using ultrasound. In this monocentric study, we evaluated the role of SWE in diagnosing SOS/VOD in 63 adult patients undergoing HSCT from February 2020 to August 2020 in real world settings. Three patients developed SOS/VOD. This was accompanied by an increase in shear wave velocity in all three patients, indicating that this method may contribute to establishing the diagnosis SOS/VOD after HSCT.\n\nsinusoidal obstruction syndrome (SOS)\nveno-occlusive disease (VOD)\nhematopoietic stem cell transplantation (HSCT)\nshear wave elastography (SWE)\nliver stiffness measurement (LSM)\n==== Body\n1. Introduction\n\nSinusoidal obstruction syndrome, also known as veno-occlusive disease (SOS/VOD) is a rare, potentially life-threatening microcirculatory disorder of the hepatic sinuses that can occur after hematopoietic stem cell transplantation (HSCT). Its incidence has been reported to be as high as 60% with a mean incidence of 13.7%. Treatment regimens that have been associated with SOS/VOD contain amongst others busulfan, carmustine or cyclophosphamide [1].\n\nIn the current understanding of the disease development, a chemotherapy dependent toxic damage to hepatic sinusoidal endothelial cells leads to a local inflammation and migration of blood cells into the space of Disse conducting an obstruction of the sinusoidal microcirculation that can lead to fibrosis. This cascade promotes liver dysfunction, rising portal blood pressure and fluid retention [2,3]. Since the primary damage occurs in the hepatic sinusoids, the term “SOS” is preferred rather than “VOD” [4].\n\nIn most cases, clinical signs appear in the first month after HSCT, displaying a broad spectrum of possible symptoms from asymptomatic courses to severe cases with multi-organ failure (MOF) and mortality up to 80% [1].\n\nIn the absence of specific biomarkers, diagnosis is often difficult and is traditionally based on clinical parameters. The so-called Baltimore [5] and Seattle [6] criteria have been replaced by the revised criteria for the diagnosis of SOS/VOD proposed by the European Society for Blood and Marrow Transplantation (EBMT) [7]: in the first 21 days after HSCT, (classical) SOS/VOD is diagnosed by bilirubin ≥2 mg/dL and two of the following criteria: painful hepatomegaly, weight gain >5% and ascites. Beyond day 21 after HSCT, it is diagnosed as classical SOS/VOD or histologically proven or by the presence of two or more of the following criteria: bilirubin ≥2 mg/dL, painful hepatomegaly, weight gain >5%, ascites and hemodynamical or/and US evidence of SOS/VOD.\n\nIn order to establish a diagnosis as accurately and early as possible, imaging, especially ultrasound-based, is often beneficial. Traditional B-mode and Doppler signs such as ascites, gallbladder wall-thickening, hepatosplenomegaly, reduced or reversed portal vein flow or elevated resistive index (RI) of the hepatic artery (≥0.75) are unspecific [8,9]. Modern ultrasound-based techniques such as contrast-enhanced ultrasound (CEUS) or noninvasive liver-stiffness measurement (LSM) have shown few but promising results in diagnosing SOS/VOD [8,10]. Liver stiffness measurement is a well-established technique in detecting and grading liver fibrosis in chronic liver diseases such as viral hepatitis or non-alcoholic fatty liver disease (NAFLD) [11]. Liver stiffness can be accurately measured by shear wave elastography (SWE) of the elastic properties of liver tissue. Recently, a new technique, which additionally analyses the dispersion of shear waves has been developed as a tool to assess liver viscosity as a surrogate for inflammation [12]. The first clinical studies suggest that via shear wave dispersion imaging (SWD), necroinflammation of the liver can be measured [13,14].\n\nIn animal models, elevated stiffness parameters in SOS/VOD were measured using LSM-techniques [15,16]. Furthermore, small numbers of SOS/VOD patients have been described that were examined by different LSM methods. Fontanilla et al. reported two SOS/VOD patients whose high acoustic radiation force impulse (ARFI) elastography velocities decreased under SOS/VOD treatment [17]. Increased values in ARFI-measurements have been associated with severe complications after HSCT [18]. In addition, anecdotal reports indicate that elevated liver stiffness can be found in patients with SOS/VOD using LSM techniques such as transient elastography (TE) [19] or two-dimensional shear wave elastography (2D-SWE) [20,21] which is a method that allows the display of real-time images of shear wave propagation in a focused area in which a region of interest (ROI) can be placed for quantitative measurement. Given these scarce but promising results, we aimed at further assessing 2D-SWE in the context of diagnosing SOS/VOD in adults as a non-invasive, easily repeatable tool in clinically applicable real world settings of a high-volume tertiary care center.\n\n2. Materials and Methods\n\nIn this monocentric prospective study, 63 consecutive adult patients undergoing 2D-SWE examination before allogeneic HSCT in the Department of Hematology, Oncology and Tumor Immunology, Charité-Universitätsmedizin Berlin, Germany, were included from February 2020 until August 2020. Prior to starting the conditioning regimen, all patients underwent an abdominal ultrasound (US) including grayscale US, Doppler measurement of the portal vein and 2D-SWE using Canon (former Toshiba) Aplio 500 US system (Canon Medical systems Corporation, Otawara, Tochigi, Japan). All US examinations were performed by an experienced sonographer with experience in liver ultrasound and sonoelastography (>6000 US, >2000 SWEs). All patients gave written informed consent.\n\nThe 2D-SWE value was defined as the median value of at least 3, preferably 5 to 10 SWE measurements of good quality. Real time imaging allowed the examiner to assess reliability of a measurement immediately: After homogenous color filling of the 2D-SWE elastogram and the display of parallel lines in the propagation mode, a ROI was placed at least 1 cm below the liver capsule and 3–5 cm from the transducer in a right intercostal position. Measurements were performed during a transient breath hold (without deep inspiration) avoiding large vessels and ascites according to the guidelines of the European Federation of Societies for Ultrasound in Medicine and Biology (EFSUMB) [22].\n\nFrom the beginning of the conditioning regimen, laboratory tests were assessed daily in addition to daily clinical assessment for the presence of SOS/VOD until 30 days after HSCT. SOS/VOD diagnosis was established by clinical signs according to the revised criteria for the diagnosis of SOS/VOD by the EBMT [7].\n\nIn patients with clinical signs for SOS/VOD, grayscale and Doppler ultrasound and 2D-SWE were analyzed. Other possible hepatobiliary complications after HSCT were also evaluated. Follow-up ultrasound and 2D-SWE examinations were conducted if possible according to the patient’s clinical status and course. All patients with clinically established SOS/VOD diagnosis underwent an additional single SWD examination using Canon Aplio i800 ultrasound system (Canon Medical systems Corporation, Otawara, Tochigi, Japan). A total of 6–7 SWD measurements were performed as described above for SWE measurements.\n\nData collection and statistical analysis was performed using IBM SPSS Statistics for Windows, (Version 27.0. Armonk, NY, USA: IBM Corp). Clinical values were retrospectively collected from the patients’ medical records and entered into SPSS data sheet.\n\n3. Results\n\n3.1. Patient Characteristics\n\nDuring the study period, 63 patients were enrolled before allogenic HSCT, 20 (31.7%) were female and 43 were male (68.3%), mean age was 54.6 (median 57) years (range 22–72 years). The three patients who developed SOS/VOD after HSCT were 36, 45 and 64 years old. The patient characteristics are displayed in Table 1 and Table 2. The most frequent underlying disease overall was acute myeloid leukemia (AML) (28 patients, 44.4%), followed by 13 patients with myelodysplastic syndrome (MDS), seven patients had lymphoma, eight patients had acute lymphatic leukemia (ALL), three patients had chronic myeloid leukemia (CML), one patient had multiple myeloma (MM), one patient had lymphomatoid granulomatosis, one patient had essential thrombocytosis (ET) and one patient had hypereosinophilic syndrome. Three patients (4.8%) developed clinical SOS/VOD (according to [7]), their underlying diseases were AML, CML and MM. As Table 2 shows, SOS/VOD was diagnosed on day +18, +18 and +21 after HSCT. 47 (74.6%) patients of our cohort had a matched unrelated stem cell donor, eight (12.7%) a matched related donor and eight (12.7%) had a mismatch donor. Two of the SOS/VOD patients had a matched unrelated donor and one had a mismatch donor.\n\n3.2. Conditioning Regimen\n\nIn the study collective, 20 (31.7%) patients received either a myeloablative conditioning (MAC) with 4 × 3.2 mg/kg busulfan and 2 × 60 mg/kg cyclophosphamide or a MAC with 8–12 Gy total body irradiation (TBI) and cyclophophosphamide or fludarabine. One patient with multiple myeloma received treosulfan, thiotepa and fludarabine (TTF) as MAC. Reduced conditioning regimen (RIC) was applied for 43 patients with 3 × 12 g/m2 treosulfan and 5 × 30 mg/m2 fludarabine or 2 × 3.2 mg/kg busulfan and 5 × 30 mg/m2 fludarabine. All three of the SOS/VOD-patients received MAC.\n\n3.3. Pretherapeutic SWE Measurement\n\nMean SWE at baseline before starting of the conditioning was 1.42 m/S (6.1 kPa), median SWE 1.38 m/S (5.7 kPa) in the study cohort. One patient with ALL displayed advanced liver stiffness (12.9 m/S) but did not develop clinical SOS/VOD after HSCT. SWE measurement in patients who did not develop SOS/VOD after HSCT did not indicate increased liver stiffness in this cohort: 1.42 m/S (6.1 kPa). In patients that developed SOS/VOD after HSCT, pre-transplant SWE measurements were also without signs of elevated liver stiffness: 1.29 m/S (4.9 kPa). None of the patients had ascites at baseline.\n\n3.4. Pretherapeutic Portal Vein Velocity\n\nMean PV velocity was measured in 57 patients at baseline. Overall PV velocity at baseline was 22.5 cm/S. In patients who did not develop SOS/VOD, PV velocity was 22.4 cm/S and in patients who developed SOS/VOD baseline PV velocity was 24.7 cm/S respectively.\n\n3.5. Ultrasound Findings in SOS/VOD Patients\n\nThe three patients who developed SOS/VOD after HSCT were clinically diagnosed by fulfilling EBMT criteria on day +18, +18 and +21 after transplantation, and all 3 patients were categorized as severe. Ultrasound after HSCT displayed signs of SOS/VOD in two patients (Patients 1 and 3) who presented a gallbladder wall-thickening, ascites and a reduced or reversed portal vein flow (as depicted for Patient 1 in Figure 1). Ascites quantities were low and there was no depiction of ascites in the region of 2D-SWE measurement. Follow-up US under defibrotide therapy displayed normalization of gallbladder wall and portal vein flow in Patient 1, and Patient 3 did not show changes in US findings under therapy. Patient 2 did not develop US signs of SOS/VOD in the course of disease.\n\n3.6. SWE Measurement in SOS/VOD Patients\n\nSWE examination showed increased SWE values in all SOS/VOD patients as depicted in Figure 2 and in Table 2. Patient 1 had an increase in elasticity from 5.9 kPa to up to 58.8 kPa, Patient 2 increased from 4.7 kPa to 9.8 kPa and Patient 3 increased from 4.2 kPa before HSCT to a measured maximum SWE value of 45.5 kPa. Follow-up SWE measurements are presented in Figure 2.\n\n3.7. SWE Measurement under Treatment with Defibrotide\n\nPatient 1 had a strong early increase in SWE velocity of 2.75 m/S up to 4.17 m/S. Under defibrotide treatment, SWE velocities decreased and stabilized around 2.5 m/S (representative SWE values of Patient 1 are depicted in Figure 1). Patient 1 died on day +110. Follow-up SWE measurements in Patients 2 and 3 did not decrease in the course of disease. Patient 2 displayed constantly elevated SWE velocities between 1.7 and 1.8 m/S. SWE levels further increased in patient 3 up to 3.72 m/S. These patients died on day +63 and day +78.\n\n3.8. SWD Measurement\n\nSWD examination was performed in all three SOS/VOD patients, timepoints after HSCT were day +20, +54, +46. Mean SWD was 18.3 (m/S)/kHz, SWD values were elevated in all three patients: in Patient 1, SWD was 16.7 (m/S)/kHz, in Patient 2 SWD was 17.2 (m/S)/kHz and in Patient 3, SWD was (20.9 m/S)/kHz (the threshold for “severe” provided by the manufacturer is 16 (m/S)/kHz).\n\n4. Discussion\n\nThis study aimed at further assessing the role of modern ultrasound-based techniques in the detection of SOS/VOD after HSCT in real world settings. Briefly, 2D-SWE is a method that has the advantage of visualizing the tissue at the same time of performing stiffness measurement. To our knowledge, this is the first study evaluating the role of 2D-SWE in a larger cohort of adults in the context of SOS/VOD after HSCT. Recent reports have demonstrated the usefulness of LSM by TE in adults and 2D-SWE in children in contributing to an early diagnosis of SOS/VOD after HSCT [19,20]. Recently, Colecchia and colleagues found an increase in liver stiffness values in all four patients that developed SOS/VOD in a study of 78 patients undergoing HSCT and prior LSM via TE [19] indicating that LSM can play a role in the detection of SOS/VOD. Since TE does not provide visualization of the examined tissue, results can be influenced by factors such as ascites, which is not uncommon in SOS/VOD patients and was also seen in two of our patients. By real-time visualization of the area in which LSM is performed, 2D-SWE can exclude the presence of ascites in the region of measurement resulting in reliable values. In our view, this is a clear advantage of 2D-SWE over TE in the context of SOS/VOD. Recently, Reddivalla et al. examined 25 pediatric patients before and after HSCT with 2D-SWE. All 5 patients who developed SOS/VOD displayed increased liver stiffness [20]. Lazzari and colleagues reported monitoring of defibrotide treatment using 2D-SWE in one patient with SOS/VOD after HSCT [21]. However, there was no baseline liver stiffness measured impeding conclusions on the properties of 2D-SWE in contributing to the diagnosis of SOS/VOD. Given the rarity of this potentially life-threatening disease, reported cases are few in numbers. Both Redivalla et al. and Colecchia et al. performed numerous liver stiffness measurements in all patients after HSCT. This is especially important in order to find the most accurate time point for LSM in early detection of SOS/VOD, which might even be earlier than clinical suspicion for SOS/VOD. In routine clinical practice, US and LSM examinations in the extremely vulnerable patient group soon after HSCT require more effort and time than regular examinations. Since US machines with SWE capacities are rarely exclusively utilized in transplant wards, they need to be transported there for the examination in appropriate hygiene conditions. Therefore, in our view a realistic approach to the utilization of SWE in the context of SOS/VOD is rather in single or few examinations in addition to a clinical suspicion that is not fully determined and in evaluation of clinical course and treatment response. In our cohort, all three SOS/VOD patients had a severe course of disease with MOF, all patients died despite therapy with defibrotide. SWE-measurements after HSCT were only performed if patients were stable enough to be transported, which in our opinion is a real-life approach to this clinical situation. All three SOS/VOD patients clearly displayed considerable increases in SWE values once clinical diagnosis was established compared to values before HSCT as depicted in Figure 2 and Table 2. The increase in stiffness in Patients 1 and 3 even surpassed 40 kPa (the rise of stiffness values in Patient 1 is also depicted in Figure 1). This underlines that an increase in SWE values can be a useful marker in establishing the diagnosis of SOS/VOD after HSCT. In Patient 2, no traditionally known US signs of SOS/VOD such as ascites, gallbladder wall-thickening or reduced/reversed portal vein flow could be detected but the patient displayed an increase in SWE velocity. This indicates that SWE measurement is possibly a more sensitive method for SOS/VOD detection than conventional US. Fontanilla et al. described a normalization of elevated ARFI values in two SOS/VOD patients corresponding to their treatment response [17]. In our cohort, Patients 2 and 3 did not recover under treatment and died. Their SWE values did not decrease in the course of disease. Patient 1 stabilized clinically under defibrotide treatment but remained severely compromised with high levels of bilirubin (>20 mg/dL). Accordingly, US signs of SOS/VOD such as gallbladder thickening and reversed PV flow could not be detected in follow-up US. As depicted in Figure 2, his elasticity parameters decreased and stabilized to a lower, still elevated level around 20 kPa. In our view, this finding corresponds to a (partial) treatment response. However, SWE values in our SOS/VOD patients reflected their clinical state underlining that SWE values and clinical course of SOS/VOD are associated.\n\nA limitation of SWE in the context of SOS/VOD is the frequent occurrence of ascites that may interfere with measurements. In order to obtain reliable SWE measurements, large amounts of ascites should be drained if present. However, the possibility of visualization of ascites in SWE-measurements is a clear advantage over TE in SOS/VOD patients. Other limitations of our study are the small size of the cohort from only one center. No SWE measurements were performed in patients after HSCT without clinical signs of SOS/VOD hence evidence for earlier signs of disease that may be displayed in SWE could not be provided. Once the diagnosis SOS/VOD was established, US examinations and SWE/SWD were not performed on certain fixed time points because patients had to be stable enough to be transported which makes comparison more difficult.\n\nSince early pathophysiological changes include migration of red blood cells, leucocytes and cellular debris into the space of Disse, leading to obstruction of the sinusoidal microcirculation [23], one can speculate that especially in these early stages that involve necroinflammation, SWD might be a helpful tool for earlier detection than traditional means of diagnosis. Even though SWD is not a widely established method, and therefore, no validated thresholds exist, our SOS/VOD patients all displayed high dispersion values compared with reported values for NAFLD or liver transplant rejection [13,14]. SWD examination in our cohort took place after clinical diagnosis was established, in two patients late in the course of disease, hence the time period when an increase of dispersion levels occurred remains unknown. This study is the first to address the modern method of SWD in the context of SOS/VOD and suggests that SWD might have a role in detecting of SOS/VOD, further research is needed and should be focused on early stages after HSCT. In our view, the combination of SWE and SWD has the potential of providing helpful information for early detection and evaluation of the clinical course of SOS/VOD after HSCT.\n\n5. Conclusions\n\nOur study provides further evidence that SWE can play an important role in the accurate non-invasive detection of SOS/VOD after HSCT in clinical routine. More research with larger cohorts is needed to further assess the role of SWE in early detection of SOS/VOD in order to initiate treatment as early as possible. SWD should also be considered in such trials.\n\nAuthor Contributions\n\nConceptualization, M.S. and A.W.; methodology, M.S. and A.W.; software, M.S. and A.W.; validation, M.S., A.W. and F.T.; formal analysis, M.S. and A.W.; investigation, M.S. and L.G.V.; data curation, M.S., L.G.V., M.M. and A.W.; writing—original draft preparation, M.S.; writing—review and editing, M.S., L.G.V., M.M., H.P.M., F.T., I.W.B. and A.W.; visualization, M.S. and A.W.; supervision, F.T., I.W.B.; project administration, M.S. and A.W. All authors have read and agreed to the published version of the manuscript.\n\nFunding\n\nWe acknowledge support from the German Research Foundation (DFG) and the OpenAccess Publication Fund of Charité–Universitätsmedizin Berlin.\n\nInstitutional Review Board Statement\n\nThe study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the local Ethics Committees of the Universities of Berlin (EA1/004/18, 18 January 2018).\n\nInformed Consent Statement\n\nInformed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patients to publish this paper.\n\nData Availability Statement\n\nThe data are not publicly available due to privacy restrictions.\n\nConflicts of Interest\n\nThe authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.\n\nFigure 1 US imaging and SWE in a 36-year-old SOS/VOD patient. Gallbladder wall-thickening (A); reversed portal vein flow in color Doppler ultrasound (B); 2D-SWE before HSCT (C); and after development of SOS/VOD after HSCT (D).\n\nFigure 2 Courses of SWE values (kPa) of the three SOS/VOD patients. Day 0 is the day of HSCT, Patient 1 died on day +110, Patient 2 died on day +63, and Patient 3 on day +78.\n\ndiagnostics-11-00928-t001_Table 1 Table 1 Patient characteristics.\n\n\t\tStudy Cohort (n = 63)\tNo SOS/VOD (n = 60)\tSOS/VOD (n = 3)\t\ndisease type\tAML\t28 (44.4%)\t27\t1\t\n\tMDS\t13 (20.6%)\t13\t0\t\n\tlymphoma\t7 (11.1%)\t7\t0\t\n\tALL\t8 (12.7%)\t6\t0\t\n\tCML\t3 (4.8%)\t2\t1\t\n\tlymphomatoid granulomatosis\t1 (1.6%)\t1\t0\t\n\thypereosinophilic syndrome\t1 (1.6%)\t1\t0\t\n\tMM\t1 (1.6%)\t0\t1\t\n\tET\t1 (1.6%)\t1\t0\t\nstem cell donor\tmatched unrelated\t47 (74.6%)\t45\t2\t\n\tmatched related\t8 (12.7%)\t8\t0\t\n\tmismatch\t8 (12.7%)\t6\t1\t\nconditioning regimen\tMAC\t20 (31.7%)\t17\t3\t\n\tRIC\t43 (68.3%)\t43\t0\t\ngender\tfemale\t20 (31.7%)\t19\t1\t\n\tmale\t43 (68.3%)\t41\t2\t\nage (years)\t55\t54.9\t48.3\t\nbaseline SWE (m/S)\t1.42\t1.43\t1.29\t\nbaseline SWE (kPa)\t6.1\t6.2\t4.9\t\nbaseline PV velocity (cm/S)\t22.5 (n = 57)\t22.4\t24.7\t\nAbbreviations: AML acute myeloid leukemia; MDS myelodysplastic syndrome; ALL acute lymphoblastic leukemia; CML chronic myeloid leukemia; MM multiple myeloma; ET essential thrombocytosis; SWE shear wave elastography; PV portal vein; MAC myeloablative conditioning with busulfan 4 × 3.2 mg/kg and 2× cyclophosphamide 60 mg/kg for AML, CML and MDS, 12 Gy and 2 × 60 mg/kg cyclophosphamide i.v. or 8 Gy and 4 × 30 mg/m2 fludarabine for ALL, TTF (3 × 12 g/m2 treosulfan, 5 × 30 mg/m2 fludarabine and 2.5 mg/kg thiotepa) for multiple myeloma; RIC = reduced conditioning with 3 × 12 g/m2 treosulfan and 5 × 30 mg/m2 fludarabine or 5 × 30 mg/m2 fludarabine and 2 × 3.2 mg/kg busulfan i.v.\n\ndiagnostics-11-00928-t002_Table 2 Table 2 Characteristics of SOS/VOD patients.\n\nPatient\tGender\tAge\tHSCT Type\tConditioning Regimen\tUnderlying Disease\tBaseline 2D-SWE (m/S)\tBaseline 2D-SWE (kPa)\tBaseline PV Velocity (cm/S)\tClinical SOS/VOD Diagnosis †\tSerum Bilirubin >2 mg/dL at Diagnosis\tSWE at SOS/VOD Diagnosis (m/S)\tSWE at SOS/VOD Diagnosis (kPa)\tMax. Increase in SWE (m/S; kPa)\tMax. SWE (m/S; kPa)\tAscites in US\tDecreased/Reversed PV Flow\tGallbladder Wall Thickening\tDate of US/SWE\tSOS/VOD Severity †\tMax. Bilirubin (mg/dL)\tSOS/VOD Therapy\tOutcome\tSWD ((m/S)/kHz); (day)\t\n1\tmale\t36\tallogenic (MMUD)\t4 × 3.2 mg/kg busulfan, 2 × 60 mg/kg cyclophosphamide\tAML\t1.42\t5.9\t29\t+18\t3.26\t4.17\t58.8\t2.75; 52.9\t4.17; 58.8\tyes ‡\tyes\tyes\t+18\tsevere\t34.71\tDEF, diuretics\tDeath (+110)\t16.7 (+20)\t\n2\tfemale\t64\tallogenic (MUD)\ttreosulfan, fludarabine, thiothepa\tMM\t1.26\t4.7\t29\t+18\t5.62\t1.71\t8.9\t0.52; 5\t1.78; 9.8\tno\tno\tno\t+19\tsevere\t20.76\tDEF, diuretics\tdeath (+63)\t17.2 (+54)\t\n3\tmale\t45\tallogenic (MUD)\t4 × 3.2 mg/kg busulfan, 2 × 60 mg/kg cyclophosphamide\tCML\t1.20\t4.2\t16\t+21\t4.46\t2.11\t13.9\t2.52; 41.3\t3.72; 45.5\tyes ‡\tyes\tyes\t+47\tsevere\t35.83\tDEF, diuretics\tdeath (+78)\t20.9 (+47)\t\nAbbreviations: MUD, matched unrelated donor; MMUD, mismatch unrelated donor; AML, acute myeloid leukemia; MM, multiple myeloma; PV, portal vein; † according to Mohty et al. 2016 [7]; US, ultrasound; DEF, defibrotide; SWE, shear wave elastography; SWD, shear wave dispersion. ‡ Small amounts of ascites, no detection of ascites in the area of 2D-SWE measurement.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Coppell J.A. Richardson P.G. Soiffer R. Martin P.L. Kernan N.A. Chen A. Guinan E. Vogelsang G. Krishnan A. Giralt S. Hepatic veno-occlusive disease following stem cell transplantation: Incidence, clinical course, and outcome Biol. Blood Marrow Transplant. 2010 16 157 168 10.1016/j.bbmt.2009.08.024 19766729\n2. Corbacioglu S. Jabbour E.J. Mohty M. Risk Factors for Development of and Progression of Hepatic Veno-Occlusive Disease/Sinusoidal Obstruction Syndrome Biol. Blood Marrow Transplant. 2019 25 1271 1280 10.1016/j.bbmt.2019.02.018 30797942\n3. Nassereddine S. Alsubait S. Tabbara I. Sinusoidal Obstruction Syndrome (Veno-occlusive Disease) Following Hematopoietic Stem Cell Transplant: Insights and Therapeutic Advances Anticancer Res. 2018 38 2597 2605 10.21873/anticanres.12501 29715079\n4. DeLeve L.D. Shulman H.M. McDonald G.B. Toxic injury to hepatic sinusoids: Sinusoidal obstruction syndrome (veno-occlusive disease) Semin. Liver Dis. 2002 22 27 42 10.1055/s-2002-23204 11928077\n5. Jones R.J. Lee K.S. Beschorner W.E. Vogel V.G. Grochow L.B. Braine H.G. Vogelsang G.B. Sensenbrenner L.L. Santos G.W. Saral R. Venoocclusive disease of the liver following bone marrow transplantation Transplantation 1987 44 778 783 10.1097/00007890-198712000-00011 3321587\n6. McDonald G.B. Sharma P. Matthews D.E. Shulman H.M. Thomas E.D. Venocclusive disease of the liver after bone marrow transplantation: Diagnosis, incidence, and predisposing factors Hepatology 1984 4 116 122 10.1002/hep.1840040121 6363247\n7. Mohty M. Malard F. Abecassis M. Aerts E. Alaskar A.S. Aljurf M. Arat M. Bader P. Baron F. Bazarbachi A. Revised diagnosis and severity criteria for sinusoidal obstruction syndrome/veno-occlusive disease in adult patients: A new classification from the European Society for Blood and Marrow Transplantation Bone Marrow Transplant. 2016 51 906 912 10.1038/bmt.2016.130 27183098\n8. Dietrich C.F. Trenker C. Fontanilla T. Görg C. Hausmann A. Klein S. Lassau N. Miquel R. Schreiber-Dietrich D. Dong Y. New Ultrasound Techniques Challenge the Diagnosis of Sinusoidal Obstruction Syndrome Ultrasound Med. Biol. 2018 44 2171 2182 10.1016/j.ultrasmedbio.2018.06.002 30076031\n9. Mahgerefteh S.Y. Sosna J. Bogot N. Shapira M.Y. Pappo O. Bloom A.I. Radiologic imaging and intervention for gastrointestinal and hepatic complications of hematopoietic stem cell transplantation Radiology 2011 258 660 671 10.1148/radiol.10100025 21339345\n10. Trenker C. Burchert A. Schumacher C. Schäfer J.A. Dohse M. Timmesfeld N. Neubauer A. Sohlbach K. Michel C. Görg C. Pathologic Hepatic Contrast-Enhanced Ultrasound Pattern in Patients Undergoing Allogeneic Stem Cell Transplantation Ultrasound Med. Biol. 2020 46 1865 1871 10.1016/j.ultrasmedbio.2020.03.001 32499194\n11. Schulz M. Tacke F. Identifying High-Risk NASH Patients: What We Know so Far Hepat. Med. 2020 12 125 138 10.2147/HMER.S265473 32982495\n12. Sugimoto K. Moriyasu F. Oshiro H. Takeuchi H. Yoshimasu Y. Kasai Y. Itoi T. Clinical utilization of shear wave dispersion imaging in diffuse liver disease Ultrasonography 2020 39 3 10 10.14366/usg.19031 31645092\n13. Sugimoto K. Moriyasu F. Oshiro H. Takeuchi H. Abe M. Yoshimasu Y. Kasai Y. Sakamaki K. Hara T. Itoi T. The Role of Multiparametric US of the Liver for the Evaluation of Nonalcoholic Steatohepatitis Radiology 2020 296 532 540 10.1148/radiol.2020192665 32573385\n14. Lee D.H. Lee J.Y. Bae J.S. Yi N.J. Lee K.W. Suh K.S. Kim H. Lee K.B. Han J.K. Shear-Wave Dispersion Slope from US Shear-Wave Elastography: Detection of Allograft Damage after Liver Transplantation Radiology 2019 293 327 333 10.1148/radiol.2019190064 31502939\n15. Park S.H. Lee S.S. Sung J.Y. Na K. Kim H.J. Kim S.Y. Park B.J. Byun J.H. Noninvasive assessment of hepatic sinusoidal obstructive syndrome using acoustic radiation force impulse elastography imaging: A proof-of-concept study in rat models Eur. Radiol. 2018 28 2096 2106 10.1007/s00330-017-5179-z 29218616\n16. Shin J. Yoon H. Cha Y.J. Han K. Lee M.J. Kim M.J. Shin H.J. Liver stiffness and perfusion changes for hepatic sinusoidal obstruction syndrome in rabbit model World J. Gastroenterol. 2020 26 706 716 10.3748/wjg.v26.i7.706 32116418\n17. Fontanilla T. Hernando C.G. Claros J.C. Bautista G. Minaya J. Del Carmen Vega M. Piazza A. Méndez S. Rodriguez C. Arangüena R.P. Acoustic radiation force impulse elastography and contrast-enhanced sonography of sinusoidal obstructive syndrome (Veno-occlusive Disease): Preliminary results J. Ultrasound Med. 2011 30 1593 1598 10.7863/jum.2011.30.11.1593 22039033\n18. Karlas T. Weber J. Nehring C. Kronenberger R. Tenckhoff H. Mössner J. Niederwieser D. Tröltzsch M. Lange T. Keim V. Value of liver elastography and abdominal ultrasound for detection of complications of allogeneic hemopoietic SCT Bone Marrow Transplant. 2014 49 806 811 10.1038/bmt.2014.61 24710567\n19. Colecchia A. Ravaioli F. Sessa M. Alemanni V.L. Dajti E. Marasco G. Vestito A. Zagari R.M. Barbato F. Arpinati M. Liver Stiffness Measurement Allows Early Diagnosis of Veno-Occlusive Disease/Sinusoidal Obstruction Syndrome in Adult Patients Who Undergo Hematopoietic Stem Cell Transplantation: Results from a Monocentric Prospective Study Biol. Blood Marrow Transplant. 2019 25 995 1003 10.1016/j.bbmt.2019.01.019 30660772\n20. Reddivalla N. Robinson A.L. Reid K.J. Radhi M.A. Dalal J. Opfer E.K. Chan S.S. Using liver elastography to diagnose sinusoidal obstruction syndrome in pediatric patients undergoing hematopoetic stem cell transplant Bone Marrow Transplant. 2020 55 523 530 10.1038/s41409-017-0064-6 29335626\n21. Lazzari L. Marra P. Greco R. Giglio F. Clerici D. Venturini E. Paesano P. Albanese S. Serio F. Ciceri F. Ultrasound elastography techniques for diagnosis and follow-up of hepatic veno-occlusive disease Bone Marrow Transplant. 2019 54 1145 1147 10.1038/s41409-019-0432-5 30679827\n22. Dietrich C.F. Bamber J. Berzigotti A. Bota S. Cantisani V. Castera L. Cosgrove D. Ferraioli G. Friedrich-Rust M. Gilja O.H. txt Update 2017 (Long Version) Ultraschall Med. 2017 38 e48 10.1055/a-0641-0076 30176678\n23. Mohty M. Malard F. Abecassis M. Aerts E. Alaskar A.S. Aljurf M. Arat M. Bader P. Baron F. Bazarbachi A. Sinusoidal obstruction syndrome/veno-occlusive disease: Current situation and perspectives-a position statement from the European Society for Blood and Marrow Transplantation (EBMT) Bone Marrow Transplant. 2015 50 781 789 10.1038/bmt.2015.52 25798682\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2075-4418",
"issue": "11(6)",
"journal": "Diagnostics (Basel, Switzerland)",
"keywords": "hematopoietic stem cell transplantation (HSCT); liver stiffness measurement (LSM); shear wave elastography (SWE); sinusoidal obstruction syndrome (SOS); veno-occlusive disease (VOD)",
"medline_ta": "Diagnostics (Basel)",
"mesh_terms": null,
"nlm_unique_id": "101658402",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34064217",
"pubdate": "2021-05-21",
"publication_types": "D016428:Journal Article",
"references": "30076031;29335626;32982495;27183098;22039033;32573385;31502939;30679827;29218616;30797942;6363247;32499194;30660772;24710567;30176678;11928077;19766729;29715079;3321587;31645092;25798682;21339345;32116418",
"title": "Shear Wave Elastography in the Detection of Sinusoidal Obstruction Syndrome in Adult Patients Undergoing Allogenic Hematopoietic Stem Cell Transplantation.",
"title_normalized": "shear wave elastography in the detection of sinusoidal obstruction syndrome in adult patients undergoing allogenic hematopoietic stem cell transplantation"
} | [
{
"companynumb": "DE-PFM-2021-10135",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BUSULFAN"
},
"drugadditional": "4",
"drugad... |
{
"abstract": "Patients with autoantibodies to interferon-γ (IFN-γ) may develop severe nontuberculous mycobacterial infections. We describe the novel use of daratumumab in a patient with autoantibodies to IFN-γ who had progressive infection, resulting in clinical and radiographic improvement.",
"affiliations": "Laboratory of Clinical Immunology and Microbiology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.;Laboratory of Clinical Immunology and Microbiology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.;Laboratory of Clinical Immunology and Microbiology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.;Medical Science and Computing, Rockville, Maryland, USA.;Laboratory of Clinical Immunology and Microbiology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.;Laboratory of Clinical Immunology and Microbiology, Division of Intramural Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.",
"authors": "Ochoa|Sebastian|S|;Ding|Li|L|;Kreuzburg|Samantha|S|;Treat|Jennifer|J|;Holland|Steven M|SM|;Zerbe|Christa S|CS|",
"chemical_list": "D000911:Antibodies, Monoclonal; D001323:Autoantibodies; C556306:daratumumab; D007371:Interferon-gamma",
"country": "United States",
"delete": false,
"doi": "10.1093/cid/ciaa1086",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1058-4838",
"issue": "72(12)",
"journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America",
"keywords": "autoantibodies; daratumumab; disseminated; interferon gamma; mycobacteria",
"medline_ta": "Clin Infect Dis",
"mesh_terms": "D000911:Antibodies, Monoclonal; D001323:Autoantibodies; D006801:Humans; D007371:Interferon-gamma; D009165:Mycobacterium Infections, Nontuberculous; D009170:Nontuberculous Mycobacteria",
"nlm_unique_id": "9203213",
"other_id": null,
"pages": "2206-2208",
"pmc": null,
"pmid": "32745179",
"pubdate": "2021-06-15",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D052060:Research Support, N.I.H., Intramural",
"references": "30291113;30403942;22403254;32743508;26308596;31415286;29996069;22170314;31429907",
"title": "Daratumumab (Anti-CD38) for Treatment of Disseminated Nontuberculous Mycobacteria in a Patient With Anti-Interferon-γ Autoantibodies.",
"title_normalized": "daratumumab anti cd38 for treatment of disseminated nontuberculous mycobacteria in a patient with anti interferon autoantibodies"
} | [
{
"companynumb": "US-BAYER-2021-209879",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": null,
... |
{
"abstract": "While traditional cytotoxic agents play a limited role in advanced dermatofibrosarcoma protuberans (DFSP), the treatment of sunitinib for patients with advanced DFSP after imatinib failure is not well defined. The objective of this case report was to analyze the relationship between molecular mechanisms and clinical outcomes of sunitinib treatment in patients with advanced DFSP after imatinib failure. In this case report, a 37-year-old man suffered from advanced DFSP progression after surgical operation, microwave ablation, and chemotherapy. The immunohistochemistry in this patient revealed abundant expression of platelet-derived growth factor receptor-beta on tumor cells, which is one of the drug targets of sunitinib. The nucleotide sequence analysis revealed COL1A1-PDGFB fusion transcripts in this patient. Thus, we treated the patient with sunitinib, a multi-targeted tyrosine kinase inhibitor, after imatinib failure. After treatment with sunitinib, the patient exhibited a partial response and 9 months' progression-free survival without significant adverse drug effects. In our case, the patient with advanced DFSP experienced a favorable outcome in 9-months' progression-free survival and a significant improvement of quality of life without serious side effects after sunitinib treatment. Therefore, sunitinib could serve as another treatment option for patients with advanced DFSP.",
"affiliations": "Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.;Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People's Republic of China.",
"authors": "Xiao|Wei|W|;Que|Yi|Y|;Peng|Ruiqing|R|;Ding|Ya|Y|;Zhao|Jingjing|J|;Wen|Xizhi|X|;Weng|Desheng|D|;Zhang|Xiaoshi|X|;Guan|Yuanxiang|Y|;Zhang|Xing|X|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/OTT.S150235",
"fulltext": "\n==== Front\nOnco Targets TherOnco Targets TherOncoTargets and TherapyOncoTargets and therapy1178-6930Dove Medical Press 10.2147/OTT.S150235ott-11-2439Case ReportA favorable outcome of advanced dermatofibrosarcoma protuberans under treatment with sunitinib after imatinib failure Xiao Wei 12Que Yi 12Peng Ruiqing 12Ding Ya 12Zhao Jingjing 12Wen Xizhi 12Weng Desheng 12Zhang Xiaoshi 12Guan Yuanxiang 23*Zhang Xing 12*\n1 Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou, People’s Republic of China\n2 State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, People’s Republic of China\n3 Department of Gastric Surgery, Sun Yat-sen University Cancer Center, Guangzhou, People’s Republic of ChinaCorrespondence: Xing Zhang, Melanoma and Sarcoma Medical Oncology Unit, Sun Yat-sen University Cancer Center, Guangzhou 510060, People’s Republic of China, Tel +86 20 8734 3629, Email zhangxing@sysucc.org.cn* These authors equally contributed to the work\n\n2018 01 5 2018 11 2439 2443 © 2018 Xiao et al. This work is published and licensed by Dove Medical Press Limited2018The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed.While traditional cytotoxic agents play a limited role in advanced dermatofibrosarcoma protuberans (DFSP), the treatment of sunitinib for patients with advanced DFSP after imatinib failure is not well defined. The objective of this case report was to analyze the relationship between molecular mechanisms and clinical outcomes of sunitinib treatment in patients with advanced DFSP after imatinib failure. In this case report, a 37-year-old man suffered from advanced DFSP progression after surgical operation, microwave ablation, and chemotherapy. The immunohistochemistry in this patient revealed abundant expression of platelet-derived growth factor receptor-beta on tumor cells, which is one of the drug targets of sunitinib. The nucleotide sequence analysis revealed COL1A1-PDGFB fusion transcripts in this patient. Thus, we treated the patient with sunitinib, a multi-targeted tyrosine kinase inhibitor, after imatinib failure. After treatment with sunitinib, the patient exhibited a partial response and 9 months’ progression-free survival without significant adverse drug effects. In our case, the patient with advanced DFSP experienced a favorable outcome in 9-months’ progression-free survival and a significant improvement of quality of life without serious side effects after sunitinib treatment. Therefore, sunitinib could serve as another treatment option for patients with advanced DFSP.\n\nKeywords\nCOL1A1-PDGFB fusion genedermatofibrosarcoma protuberansplatelet-derived growth factor receptor-betasunitinib\n==== Body\nIntroduction\nDermatofibrosarcoma protuberans (DFSP) is a rare mesenchymal tumor with intermediate grade malignancy, which is infrequently capable of transferring into high-grade fibrosarcomas. It usually appears in adults, and is frequently located on the trunk, groin, lower extremity, and seldom in the head and neck. Local surgical resection with wide margins is still an accepted treatment.1 However, DFSP has a high tendency for local recurrence and a small risk of distant metastasis after excision.2 The fusion between the collagen type I alpha 1 gene (COL1A1) and the platelet-derived growth factor (PDGF)-chain gene (PDGFB), which are located in 17q22 and 22q13, respectively, is the characteristic of DFSP.3 The expression of COL1A1-PDGFB fusion protein leads to overexpression of PDGF and promotes continuous activation of PDGFR-beta in DFSP cells.4\n\nSunitinib is a small inhibitor of multi-tyrosine protein kinases such as platelet-derived growth factor receptor (PDGF-R), vascular endothelial growth factor receptor, stem cell factor receptor, fetal liver tyrosine kinase receptor, and colony-stimulating factor receptor. It blocks multiple intracellular signaling pathways, reduces tumor vascularization and triggers cancer cell apoptosis, which results in tumor shrinkage. The range of application for sunitinib comprises gastrointestinal stromal tumors (GIST), neuroendocrine tumors, and advanced renal cell cancer.5\n\nHerein, we have presented the case of a 37-year-old man who suffered from a progression of advanced DFSP after surgical operation, microwave ablation, and chemotherapy. We detected the COL1A1-PDGFB fusion transcripts and over-expression of PDGFR-beta in this patient so that we treated the patient with sunitinib after imatinib failure, whose targets include PDGFR-beta in developing the process of DFSP. Eventually, the patient experienced a favorable outcome after sunitinib treatment.\n\nCase report\nIn December 2011, a 37-year old, previously healthy man found a painless mass on his left partes temporalis. In January 2012, the patient underwent radical functional dissection and histopathological examination showed DFSP. The postoperative computed tomography imaging technique (CT) in February 2012 (1 month after initial diagnosis) revealed multiple nodular metastases in both lungs. The patient was then treated with doxorubicin (ADM, 50 mg/m2), ifosfamide (IFO, 7.5 g/m2) and dacarbazine (DTIC, 1 g/m2) (3 weeks for one course) followed by a therapeutic evaluation of progressive disease (PD). Subsequently, the patient received a combined therapy with lung metastatic tumor microwave ablation and a chemotherapy regimen of gemcitabine (GEM, 1 g/m2) and paclitaxel liposome (90 mg/m2) (3 weeks for one course) in May 2012. In September 2012, on account of the recurrence of two masses on the left side of the lumbar part and right side of the abdominal wall (8 months after initial diagnosis), the patient underwent palliative tumor resection on the abdominal wall. The histopathological examination revealed DFSP.\n\nOwing to multiple systemic metastases, poor general condition and suboptimal compliance, the patient indicated that he could not tolerate standard treatment including chemotherapy and radiation therapy anymore. As the PDGF signaling pathway was described to be involved in the development of DFSP, we detected the molecular profile of the tumor with informed consent from the patient. The paraffin-embedded tissue sections of this patient were stained with a rabbit polyclonal anti-PDGFR-beta antibody (1:400, Santa Cruz Biotechnology Inc., Dallas, TX, USA, sc-339) by immunohistochemistry. We also detected the COL1A1-PDGFB fusion transcripts by reverse transcription polymerase chain reaction and the PCR primer sequences, which were previously described by Patel et al and which are presented in Table 1.6\n\nThe experimental results showed the COL1A1-PDGFB fusion transcripts and over-expression of PDGFR-beta in paraffin-embedded samples of this patient (Figure 1). The results suggested that the PDGFR-targeted agents might be an appropriate treatment for this tumor. Therefore, in the first month of 2013, the patient initiated oral therapy with imatinib and experienced stable disease during the regular repeated examinations. However, an abdominal CT scan with contrast enhancement showed tumor growth in the lung and a new metastasis in the pancreas in May 2014 (28 months after initial diagnosis) and the general condition of the patient showed significant deterioration.\n\nAs we know, sunitinib inhibits cellular signaling by targeting multiple receptor tyrosine kinases including PDGFR. So, in the absence of a proven effective systemic therapy for this case (the first reliable report on DFSP in sunitinib treatment was in May 2015), we decided to treat our patient with sunitinib in October 2014.7 The dosing schedule was 37.5 mg once daily, taken orally for 4 consecutive weeks, followed by a 2-week rest period (schedule 4/2). The patient tolerated this dosage well and the adverse reaction was mild, except for grade 2 hypertension, which subsided under the treatment of Amlodipine. The tumor size on the left upper arm was shrinking and a regular CT/MRI scan showed partial response in the lung and pancreas metastases over 2 months from initiation of sunitinib (35 months after initial diagnosis) (Figure 2). Therefore, our patient continued the sunitinib therapy and during this treatment, he experienced stable disease and was able to cope with daily activities. A progressive disease was observed by the follow-up investigation in July 2015 (42 months after initial diagnosis). The CT and MRI scans showed an increase in size of the left upper arm mass and metastatic tumor in the lung and pancreas. The patient did not wish to receive any further therapy while we suggested treatment with pazopanib. It resulted in a constant deterioration of the patient’s general condition and he died due to multiple organ failure in November 2015 (46 months after initial diagnosis). In total, the progression-free survival was 9 months in this patient under treatment with sunitinib.\n\nDiscussion\nDermatofibrosarcoma protuberans is known as an uncommon variety of sarcoma, which induces some neoplasms within the deep layers of epidermis. This particular tumor ordinarily spreads gradually and may come to be an elevated nodule. For patients with DFSP, radical surgery could be the only curative procedure. However, this particular tumor has an inclination to relapse following surgical resection. On the other hand, it seldom spreads to other parts of the body.\n\nFor the patient in our case report, massive tumor progression was unresponsive to many therapeutic options, including surgery, cytotoxic agents, and microwave ablation. Therefore, due to abundant expression of PDGFR-beta, we initiated imatinib treatment, followed by sunitinib treatment after imatinib failure. During the subsequent 9 months after the sunitinib treatment, the tumor mass on the body surface and both lungs in our patient decreased in size, and he was able to achieve an improvement in quality of life without serious adverse drug reaction. The immunohistochemistry in this patient revealed abundant expression of PDGFR-beta on tumor cells, and the nucleotide sequence analysis revealed COL1A1-PDGFB fusion transcripts. It may be hypothesized that sunitinib may have contributed to an anti-tumor effect to DFSP via PDGFR-dependent mechanisms.\n\nThe mechanisms of sunitinib resistance are largely unclear. A study showed that treatment with anti-angiogenic agents would disrupt PDGF signaling between perivascular cells and endothelial cells, and a disturbed balance between destruction of the tumor vasculature and destabilization of the vessel wall could facilitate hematogenous metastasis.8 Further studies to interpret the resistance mechanisms of sunitinib on DFSP cells are needed in order to substantiate our clinical observation.\n\nThe patient in our case had not responded to conventional chemotherapies including doxorubicin, ifosfamide, dacarbazine, gemcitabine and paclitaxel liposome. The result is concordant with the widely accepted view that traditional cytotoxic agents play a limited role in DFSP.9 Previously, researchers have reported promising outcomes in advanced DFSP with sorafenib with 5 months’ progression-free survival. It is apparent that tyrosine kinase inhibitors may be effective for patients with advanced DFSP.10\n\nIn May 2015, it was documented in the scientific literature that sunitinib treatment revealed favorable medical efficacy as another remedy choice for patients with advanced DFSP after imatinib failure.7 However, they have not analyzed the relationship between molecular mechanisms and clinical outcomes, which is part of our case report. We treated an advanced DFSP patient with sunitinib after various conventional therapy failures in October 2014 and the patient received a favorable 9-month progression-free survival. In our study, a tentative approach of sunitinib for advanced DFSP would provide helpful information to clinicians.\n\nIn our case, the patient with advanced DFSP experienced a favorable outcome in 9-month progression-free survival and a significant improvement of quality of life without serious side effects after sunitinib treatment. The detection of COL1A1-PDGFB fusion transcripts in the samples of this patient is in accordance with one of the drug targets of sunitinib-PDGFR-beta. According to our single-patient experience, sunitinib could represent a tentative treatment for patients with advanced DFSP.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. Consent was obtained using the standardized informed consent forms of the participating institutions. The project and consent process were approved by the ethics board of the Sun Yat-sen University Cancer Center, Guangzhou.\n\nAcknowledgments\nThis work was supported by the National Scientific Foundation of China (No 81372887, 81772863).\n\nDisclosure\n\nThe authors report no conflicts of interest in this work.\n\nFigure 1 (A) The PDGFR-beta expression in dermatofibrosarcoma protuberans (DFSP) by immunohistochemical staining in our case (100× and 400× original). PDGFR-beta is diffuse and strong staining in the paraffin-embedded tissue sample from our patient who received the sunitinib treatment. (B) Negative IHC staining of PDGFR-beta in another tissue sample from patient with DFSP. (C) Expression of COL1A1-PDGFB fusion transcripts. Ethidium bromide-stained agarose gel of reverse transcription polymerase chain reaction products from the paraffin-embedded tissue sample. (a) Amplification product of COL1A1 exon 43 forward primer and PDGFB exon 2 reverse primer yields a discrete band, indicating a breakpoint located downstream of COL1A1 exon 43. (b) The internal control is verified by amplification of β-actin gene. (D) Nucleotide sequence analysis showing COL1A1-PDGFB fusion transcripts. The panel shows the nucleotide sequence of COL1A1-PDGFB fusion transcripts. The end of exon 44 in the COL1A1 gene was fused with the start of exon 2 in the PDGFB gene detected in the tissue sample.\n\nAbbreviations: PDGFR, platelet-derived growth factor receptor; IHC, immunohistochemistry.\n\nFigure 2 The regular CT scan before and after sunitinib treatment. Radiology of pretreatment (A) and post-treatment (B) findings in our patient under sunitinib treatment.\n\nNotes: (A) Baseline with evidence of lung (right red arrow) and pancreas (left red arrow) metastases before starting sunitinib. (B) Evidence of decrease in tumor size on regular scan after 3 months of sunitinib treatment.\n\nTable 1 Primer sequences of the COL1A1 and PDGFB gene\n\nPrimer\tNucleotide sequence (5′ → 3′)\t\nCOL1A1 (forward)\t\t\n Exon 5\tGCATCC CTG GAC AGC CTG GA\t\n Exon 8\tAAG GCT TCC AAG GTC CCC CT\t\n Exon 12\tGTG CCA AGG GAG ATG CTG GT\t\n Exon 17\tGTG CTG TTG GTG CTA AGG GTG A\t\n Exon 20\tAGG AGA CAC TGG TGC TAA GGG AGA\t\n Exon 23\tCTG GTC TGC CTG GTG CCA A\t\n Exon 27\tTGC TGG CAA AGATGG AGA GGC T\t\n Exon 31\tCGA GAG AGG TTT CCC TGG CGA\t\n Exon 32\tTGA ACG TGG TGC AGC TGG TCT TC\t\n Exon 36\tGCG AAC CTG GTG ATG CTG GT\t\n Exon 39\tGGC AAA GAA GGC GGC AAA GGT\t\n Exon 40\tGGA GAG AGA GGC TTC CCT GGT CTT\t\n Exon 43\tCCT GCT GGC AAG AGT GGT GAT\t\n Exon 46\tCTG GTG AAC AAG GTC CCT CTG GA\t\n Exon 48\tCCA CCT CAA GAG AAG GCT CAC GA\t\n Exon 49\tGCA ACC TGG ATG CCATCA AAG TCT T\t\n Exon 50\tGCC TCC CAG AAC ATC ACC TAC CA\t\n Exon 51\tGCA AGA CAG TGATTG AAT ACA AAA CCA\t\nPDGFB (reverse)\t\t\n Exon 2\tATC AAA GGA GCG GAT CGA GTG GTC\t\nNote: Data from Patel et al.6\n\nAbbreviation: PDGFB, platelet-derived growth factor-chain gene.\n==== Refs\nReferences\n1 Gloster HM Jr Dermatofibrosarcoma protuberans J Am Acad Dermatol 1996 35 3 Pt 1 355 374 quiz 375–356 8784271 \n2 Mendenhall WM Zlotecki RA Scarborough MT Dermatofibrosarcoma protuberans Cancer 2004 101 11 2503 2508 15503305 \n3 Simon MP Pedeutour F Sirvent N Deregulation of the platelet- derived growth factor B-chain gene via fusion with collagen gene COL1A1 in dermatofibrosarcoma protuberans and giant-cell fibroblastoma Nature Genet 1997 15 1 95 98 8988177 \n4 McArthur G Molecularly targeted treatment for dermatofibrosarcoma protuberans Sem Oncol 2004 31 2 Suppl. 6 30 36 \n5 Bilbao-Meseguer I Jose BS Lopez-Gimenez LR Drug interactions with sunitinib J Oncol Pharm Pract 2015 21 1 52 66 24403097 \n6 Patel KU Szabo SS Hernandez VS Dermatofibrosarcoma protuberans COL1A1-PDGFB fusion is identified in virtually all dermatofibrosarcoma protuberans cases when investigated by newly developed multiplex reverse transcription polymerase chain reaction and fluorescence in situ hybridization assays Human Pathol 2008 39 2 184 193 17950782 \n7 Fu Y Kang H Zhao H Sunitinib for patients with locally advanced or distantly metastatic dermatofibrosarcoma protuberans but resistant to imatinib Int J Clin Experim Medi 2015 8 5 8288 8294 \n8 Xian X Håkansson J Ståhlberg A Pericytes limit tumor cell metastasis J Clin Invest 2006 116 3 642 651 16470244 \n9 Lemm D Mügge LO Mentzel T Höffken K Current treatment options in dermatofibrosarcoma protuberans J Cancer Res Clin Oncol 2009 135 5 653 665 19205737 \n10 Kamar FG Kairouz VF Sabri AN Dermatofibrosarcoma protuberans (DFSP) successfully treated with sorafenib: case report Clin Sarcoma Res 2013 3 1 5 23557478\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1178-6930",
"issue": "11()",
"journal": "OncoTargets and therapy",
"keywords": "COL1A1-PDGFB fusion gene; dermatofibrosarcoma protuberans; platelet-derived growth factor receptor-beta; sunitinib",
"medline_ta": "Onco Targets Ther",
"mesh_terms": null,
"nlm_unique_id": "101514322",
"other_id": null,
"pages": "2439-2443",
"pmc": null,
"pmid": "29760553",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "8988177;26221412;16470244;15503305;15176002;24403097;19205737;17950782;8784271;23557478",
"title": "A favorable outcome of advanced dermatofibrosarcoma protuberans under treatment with sunitinib after imatinib failure.",
"title_normalized": "a favorable outcome of advanced dermatofibrosarcoma protuberans under treatment with sunitinib after imatinib failure"
} | [
{
"companynumb": "CN-MYLANLABS-2018M1037793",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IMATINIB"
},
"drugadditional": null,
... |
{
"abstract": "An infant developed a severe condition of recurrent and persistent watery diarrhea at 40 days of age. The child had been partially breast-fed, and the mother used topiramate for epilepsy. Hospital examination excluded a viral or bacterial infection and failed to identify any other potential cause. After two weeks, topiramate exposure was suspected to be the cause, and breast-feeding was suspended. The diarrhea ceased within 2 days. Analysis of the breast milk showed a topiramate concentration of 15.7 μmol/L (5.3 μg/mL). There is little information on the use of topiramate in breast-feeding women. The potential effects on the children are not known. Topiramate passes into breast milk, and the concentration may equal the therapeutic plasma concentration. In this case, the infant may have ingested up to 40% of the mother's weight-adjusted dose. Diarrhea is a well-known adverse reaction to topiramate and has the potential to cause serious electrolyte disturbances in neonates and infants. The condition improved rapidly after suspension of breast-feeding. Topiramate in breast milk may reach levels that cause adverse effects in infants. Based on the adverse reaction profile of topiramate and the milk concentration, the diarrhea was assessed as a probable adverse drug reaction in the infant.",
"affiliations": "Regional Medicines Information & Pharmacovigilance Centre (RELIS), Department of Pharmacology, Oslo University Hospital, Norway.;Regional Medicines Information & Pharmacovigilance Centre (RELIS), Department of Pharmacology, Oslo University Hospital, Norway.;Dr. Randersgate Medical Centre, Askim, Norway.;The National Centre for Epilepsy, Oslo University Hospital, Norway ; Department of Pharmacology, Oslo University Hospital, Norway.;Institute of Clinical Medicine, University of Oslo, Norway ; Department of Paediatric Medicine, Oslo University Hospital, Norway.",
"authors": "Westergren|Tone|T|;Hjelmeland|Knut|K|;Kristoffersen|Bjørg|B|;Johannessen|Svein Ivar|SI|;Kalikstad|Betty|B|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ebcr.2013.12.006",
"fulltext": "\n==== Front\nEpilepsy Behav Case RepEpilepsy Behav Case RepEpilepsy & Behavior Case Reports2213-3232Elsevier S2213-3232(13)00052-210.1016/j.ebcr.2013.12.006Case ReportProbable topiramate-induced diarrhea in a 2-month-old breast-fed child — A case report☆ Westergren Tone tone.westergren@ous-hf.noa⁎Hjelmeland Knut a1Kristoffersen Bjørg b2Johannessen Svein Ivar cdKalikstad Betty efa Regional Medicines Information & Pharmacovigilance Centre (RELIS), Department of Pharmacology, Oslo University Hospital, Norwayb Dr. Randersgate Medical Centre, Askim, Norwayc The National Centre for Epilepsy, Oslo University Hospital, Norwayd Department of Pharmacology, Oslo University Hospital, Norwaye Institute of Clinical Medicine, University of Oslo, Norwayf Department of Paediatric Medicine, Oslo University Hospital, Norway⁎ Corresponding author at: RELIS Sor-Ost, Oslo University Hospital, Ulleval, PO Box 4956 Nydalen, 0424 Oslo, Norway. Fax: + 47 23016410. tone.westergren@ous-hf.no1 Present address: Division of Forensic Medicine and Drug Abuse Research, Norwegian Institute of Public Health, Oslo, Norway.\n\n2 Løkentunet Nursing Home, Askim, Norway.\n\n20 1 2014 2014 20 1 2014 2 22 23 17 12 2013 20 12 2013 23 12 2013 © 2013 The Authors2013This is an open access article under the CC BY-NC-SA license (http://creativecommons.org/licenses/by-nc-sa/3.0/).An infant developed a severe condition of recurrent and persistent watery diarrhea at 40 days of age. The child had been partially breast-fed, and the mother used topiramate for epilepsy. Hospital examination excluded a viral or bacterial infection and failed to identify any other potential cause. After two weeks, topiramate exposure was suspected to be the cause, and breast-feeding was suspended. The diarrhea ceased within 2 days. Analysis of the breast milk showed a topiramate concentration of 15.7 μmol/L (5.3 μg/mL). There is little information on the use of topiramate in breast-feeding women. The potential effects on the children are not known. Topiramate passes into breast milk, and the concentration may equal the therapeutic plasma concentration. In this case, the infant may have ingested up to 40% of the mother's weight-adjusted dose. Diarrhea is a well-known adverse reaction to topiramate and has the potential to cause serious electrolyte disturbances in neonates and infants. The condition improved rapidly after suspension of breast-feeding. Topiramate in breast milk may reach levels that cause adverse effects in infants. Based on the adverse reaction profile of topiramate and the milk concentration, the diarrhea was assessed as a probable adverse drug reaction in the infant.\n\nKeywords\nTopiramateBreast-feedingPharmacokineticsAdverse drug reactionDiarrhea\n==== Body\n1 Introduction\nTopiramate is one of the newer antiepileptic drugs and is also approved for migraine prophylaxis [1]. There is little information concerning topiramate use in breast-feeding women, but case reports indicate that it is transferred into human milk and that milk concentrations may equal those in maternal plasma [2], [3], [4], [5]. We report a case of long-lasting diarrhea in a breast-fed infant exposed to topiramate.\n\n2 Case report\nA patient with epilepsy, aged 31, had been treated with topiramate 100 mg/day for several years. The treatment was continued unchanged throughout her pregnancy with good therapeutic effect. A healthy girl with a birth weight of 2735 g was born after an induced birth 2 days after term. The topiramate treatment was continued while breast-feeding. In order to reduce infant exposure to topiramate, two daily breast milk meals were replaced with formula meals a week after birth. The baby initially thrived and had a normal development. At 40 days of age and body weight of 4735 g, she became ill, with 8–10 watery, foamy stools a day. No other family member had diarrhea or gastrointestinal upset. Her weight gain rate eventually declined, and she was referred to the hospital outpatient clinic. Relevant differential diagnoses such as infection or somatic cause of the diarrhea were excluded, but she still suffered from diarrhea. After 18 days of frequent, watery stools, the general practitioner suspected a causal relationship with topiramate, and breast-feeding was suspended. Within 2 days, the frequency was reduced to 2–3 stools a day, and the mother observed more solid feces, with smell and color returning to normal.\n\nWhile breast-feeding was suspended, the mother used a breast pump and stored the milk in a freezer (− 20 °C). She gave her consent to have the milk analyzed for topiramate, and the milk was sent for analysis after a storage time of 4.5 months. A sample was analyzed for topiramate by fluorescence polarization immunoassay based on the competitive binding principle (Innofluor Topiramate Assay System, Seradyn, Indianapolis, IN, U.S.A.). The assay system was used on a TDx analyzer (Abbott, Abbott Park, IL, U.S.A.). The lower limit of detection was 0.3 μg/mL (0.89 μmol/L). Precision studies have shown a coefficient of variation (CV) of < 5%. The analysis showed a topiramate concentration of 15.7 μmol/L in the mother's milk, corresponding to 5.3 μg/mL. The plasma concentration in the child was not measured.\n\n3 Discussion\nBreast-feeding is generally recommended, even if the mother is using antiepileptic drugs, but adverse effects in the child may necessitate reduction or withdrawal of breast-feeding. Little is known regarding the use of topiramate in breast-feeding women and the risk of adverse effects in their children. Animal studies have demonstrated the excretion of topiramate in milk [6]. While there are no systematic studies of topiramate excretion in human milk, some study results indicate a considerable transfer. The product information does not state explicitly that topiramate is contraindicated during breast-feeding but advises that a risk/benefit assessment should be made before deciding whether to stop breast-feeding or to withdraw topiramate [6].\n\nA literature search in Medline Ovid, EMBASE, handbooks, and databases on drugs and lactation provided little additional information. Published case reports of topiramate use while breast-feeding [2], [3], [4], [5] include a total of only eight patients. A general finding is transfer into breast milk and milk/plasma ratios of 0.6–1.1. Concentrations of topiramate in the breast milk of three patients were 1.6–3.6, 6.9, and 13.7 μmol/L (0.5, 2.3, and 4.7 μg/mL), respectively, after daily doses of 150 or 200 mg, measured 14–97 days after delivery. The weight-adjusted relative dose to the infant was estimated at 3–23% of the maternal dose. Two of the mothers were using carbamazepine, a substance known to induce the metabolism of topiramate [3]. Another case report found a topiramate concentration of 3.1 μg/mL (9.1 μmol/L) after a daily dose of 150 mg in one patient 12 days after delivery [5]. We have not found any studies investigating stability of topiramate in breast milk, but topiramate in human plasma stored for a period of 1 month at − 80 °C has shown that the drug is stable [7]. Topiramate is not metabolized to any great extent unless the patient is using concomitant CYP enzyme inducers [6].\n\nThe child's plasma concentration will depend on the amount of drug in the milk, the amount absorbed from the intestine of the child, and the child's ability to eliminate the compound. In five of six mother/infant pairs, plasma levels of topiramate in the infants were 10–20% of the maternal plasma levels and in one case could not be detected [2], [3]. In the case reported here, a milk concentration of 5.3 μg/mL (15.7 μmol/L) and an estimated daily intake of 450 mL of mother's milk in an infant weighing 4735 g would result in a daily dose of 0.5-mg/kg topiramate. Other case reports have described theoretical infant dosages of 0.1–0.7 mg/kg/day [3] and 0.6 mg/kg/day [5]. The mother's body weight was 70 kg, and the relative infant dose was estimated at 0.35. The infant described here may have ingested a topiramate dose of 35% of the mother's weight-adjusted dose.\n\nWithdrawal of breast milk was associated with rapid clinical improvement of the child's condition, supporting the theory of an adverse drug reaction. Diarrhea is a well-known and very common adverse reaction to topiramate [6], and the infant's condition improved upon withdrawal of topiramate. The diarrhea was assessed as a probable adverse reaction to topiramate in the breast milk. Other case reports describing topiramate use in breast-feeding women do not describe side effects in the children. To our knowledge, this is the first report of probable topiramate-induced diarrhea in a breast-fed infant. Infant diarrhea increases the risk of electrolyte disturbances, and topiramate in the breast milk may be a hitherto unknown risk factor.\n\nThe case has been reported to the National Health Authorities in Norway, registered as number NO-NOMAADVRE-RELISS-2008-5232.\n\nConflict of interest\nThe authors have received no funding to write the manuscript and have no conflicts of interest.\n\n☆ This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.\n==== Refs\nReferences\n1 Reimers A. Brodtkorb E. Second-generation antiepileptic drugs and pregnancy: a guide for clinicians Expert Rev Neurother 12 6 2012 707 717 22650173 \n2 Öhman I. Leuf G. Tomson T. Topiramate kinetics during lactation Epilepsia 48 Suppl. 7 2007 156 157 [Abstract] \n3 Öhman I. Vitols S. Luef G. Söderfeldt B. Tomson T. Topiramate kinetics during delivery, lactation, and in the neonate: preliminary observations Epilepsia 43 10 2002 1157 1160 12366729 \n4 Gentile S. Topiramate in pregnancy and breastfeeding Clin Drug Investig 29 2 2009 139 141 \n5 Fröscher W. Jürges U. Topiramateinnahme während des Stillens Aktuel Neurol 33 2006 215 217 \n6 Summary of product characteristics, Topamax http://www.medicines.org.uk/emc/medicine/6768/SPC/Topamax+25+mg%2c+50mg%2c+100mg%2c+200mg+Tablets+and+Sprinkle+Capsules+15%2c+25+or+50+mg./#UNDESIRABLE_EFFECTS 2013 [accessed 28. November] \n7 Matar K.M. Therapeutic drug monitoring of topiramate by liquid chromatography–tandem mass spectrometry Clin Chimica Acta 411 2010 729 734\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "2213-3232",
"issue": "2()",
"journal": "Epilepsy & behavior case reports",
"keywords": "Adverse drug reaction; Breast-feeding; Diarrhea; Pharmacokinetics; Topiramate",
"medline_ta": "Epilepsy Behav Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101614202",
"other_id": null,
"pages": "22-3",
"pmc": null,
"pmid": "25667861",
"pubdate": "2014",
"publication_types": "D002363:Case Reports",
"references": "12366729;19133709;20138857;22650173",
"title": "Probable topiramate-induced diarrhea in a 2-month-old breast-fed child - A case report.",
"title_normalized": "probable topiramate induced diarrhea in a 2 month old breast fed child a case report"
} | [
{
"companynumb": "NO-JNJFOC-20141106700",
"fulfillexpeditecriteria": "2",
"occurcountry": "NO",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TOPIRAMATE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo determine whether interferon therapy during human pregnancy increases reproductive risks in women.\n\n\nMETHODS\nThis longitudinal, controlled cohort study consisted of three groups of women: an exposed group, a disease matched unexposed group, and a healthy comparative group. Subjects were selected from women contacting the Motherisk Program regarding maternal beta interferon exposure, mostly for multiple sclerosis during pregnancy, from 1997 to 2004. After delivery all of the women were re-contacted for a follow-up interview regarding maternal health, pregnancy outcome, and neonatal health.\n\n\nRESULTS\nThe study group (n = 16 women, 23 pregnancies) were exposed to interferon beta-1a (Avonex, Rebif) and interferon-1b (Betaseron). There was a decrease in mean birth weight in the exposed group (3,189 +/- 416 g) as compared to healthy controls (3,783 +/- 412 g, p = 0.002). Women exposed to beta interferon had a higher rate of miscarriages and stillbirths (39.1%) vs healthy controls (5%) (p = 0.03), even after correction for potential confounders. There were two major malformations (abnormality in the X chromosome, Down's syndrome) among exposed fetuses.\n\n\nCONCLUSIONS\nBeta interferon therapy in the first trimester of pregnancy appears to be associated with an increased risk for fetal loss and low birth weight.",
"affiliations": "Division of Clinical Pharmacology-Toxicology, The Hospital for Sick Children, Toronto, Ontario, Canada.",
"authors": "Boskovic|R|R|;Wide|R|R|;Wolpin|J|J|;Bauer|D J|DJ|;Koren|G|G|",
"chemical_list": "D007155:Immunologic Factors; D000068576:Interferon beta-1b; D016899:Interferon-beta; D000068556:Interferon beta-1a",
"country": "United States",
"delete": false,
"doi": "10.1212/01.wnl.0000180575.77021.c4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-3878",
"issue": "65(6)",
"journal": "Neurology",
"keywords": null,
"medline_ta": "Neurology",
"mesh_terms": "D000014:Abnormalities, Drug-Induced; D000022:Abortion, Spontaneous; D000328:Adult; D015331:Cohort Studies; D005260:Female; D005313:Fetal Death; D006801:Humans; D007155:Immunologic Factors; D007230:Infant, Low Birth Weight; D007231:Infant, Newborn; D000068556:Interferon beta-1a; D000068576:Interferon beta-1b; D016899:Interferon-beta; D008137:Longitudinal Studies; D009103:Multiple Sclerosis; D011247:Pregnancy; D011297:Prenatal Exposure Delayed Effects; D011446:Prospective Studies; D012307:Risk Factors",
"nlm_unique_id": "0401060",
"other_id": null,
"pages": "807-11",
"pmc": null,
"pmid": "16186517",
"pubdate": "2005-09-27",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The reproductive effects of beta interferon therapy in pregnancy: a longitudinal cohort.",
"title_normalized": "the reproductive effects of beta interferon therapy in pregnancy a longitudinal cohort"
} | [
{
"companynumb": "CA-BIOGENIDEC-2015BI150223",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "INTERFERON BETA-1A"
},
"drugadditional": nul... |
{
"abstract": "Baclofen, predominantly excreted by the kidneys is accumulated in patients with renal insufficiency leading to the central nervous system toxicity. Here the author reports a patient with end-stage renal disease on maintenance hemodialysis (HD) who developed drowsiness and became unresponsive within a day after taking single 10 mg dose of baclofen. Patient improved completely after two sessions of HD.",
"affiliations": "Department of Nephrology, Mahatma Gandhi Medical College and Research Institute, Puducherry, India.",
"authors": "Radhakrishnan|Hemachandar|H|",
"chemical_list": "D001418:Baclofen",
"country": "Saudi Arabia",
"delete": false,
"doi": "10.4103/1319-2442.182437",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1319-2442",
"issue": "27(3)",
"journal": "Saudi journal of kidney diseases and transplantation : an official publication of the Saudi Center for Organ Transplantation, Saudi Arabia",
"keywords": null,
"medline_ta": "Saudi J Kidney Dis Transpl",
"mesh_terms": "D058186:Acute Kidney Injury; D001418:Baclofen; D006801:Humans; D007676:Kidney Failure, Chronic; D006435:Renal Dialysis",
"nlm_unique_id": "9436968",
"other_id": null,
"pages": "595-7",
"pmc": null,
"pmid": "27215257",
"pubdate": "2016-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Baclofen-induced neurotoxicity in a patient with end-stage renal disease.",
"title_normalized": "baclofen induced neurotoxicity in a patient with end stage renal disease"
} | [
{
"companynumb": "IN-NORTHSTAR HEALTHCARE HOLDINGS-IN-2016NSR001858",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PANTOPRAZOLE SODIUM"
},
... |
{
"abstract": "OBJECTIVE\nCalcineurin inhibitor (CNI)-based immunosuppressive regimen is widely used for preventing rejection in solid organ transplantation. Hyperkalemic renal tubular acidosis (RTA) caused by CNI is uncommon and potentially underappreciated. We reported four such cases to increase awareness of this risk and to provide recommendations for its management based on our experience.\n\n\nMETHODS\nFour middle-aged males underwent solid organ transplant (two kidneys, one liver, one heart) and were treated with CNI-based immunosuppressive regimen (one cyclosporine A, three tacrolimus). On post-operative day 13-35, hyperkalemic hyperchloremic non-gap metabolic acidosis developed. All patients had relatively preserved renal function, normal urine output and plasma aldosterone level. Reduction in CNI dosage was partly effective; the patient on cyclosporine A was treated with fludrocortisone, and two others temporarily switched to sirolimus (SRL).\n\n\nCONCLUSIONS\nWe should alert for CNI-induced hyperkalemic RTA in transplant recipients. By CNI dosage reduction or adding low dose fludrocortisone, or temporarily switching to SRL, the prognosis of CNI-induced hyperkalemic RTA is favourable.",
"affiliations": "Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, Binjiang Branch Hospital, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.;Department of Nephrology, The Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang, China.",
"authors": "Lin|W|W|;Mou|L|L|;Tu|H|H|;Zhu|L|L|;Wang|J|J|;Chen|J|J|;Hu|Y|Y|",
"chemical_list": "D065095:Calcineurin Inhibitors; D007166:Immunosuppressive Agents",
"country": "England",
"delete": false,
"doi": "10.1111/jcpt.12485",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0269-4727",
"issue": "42(1)",
"journal": "Journal of clinical pharmacy and therapeutics",
"keywords": "calcineurin inhibitor; fludrocortisone; hyperkalemic renal tubular acidosis; sirolimus; solid organ; transplantation",
"medline_ta": "J Clin Pharm Ther",
"mesh_terms": "D000141:Acidosis, Renal Tubular; D065095:Calcineurin Inhibitors; D006801:Humans; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D066027:Transplant Recipients",
"nlm_unique_id": "8704308",
"other_id": null,
"pages": "122-124",
"pmc": null,
"pmid": "27966241",
"pubdate": "2017-02",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Clinical analysis of hyperkalemic renal tubular acidosis caused by calcineurin inhibitors in solid organ transplant recipients.",
"title_normalized": "clinical analysis of hyperkalemic renal tubular acidosis caused by calcineurin inhibitors in solid organ transplant recipients"
} | [
{
"companynumb": "CN-MYLANLABS-2017M1012265",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "1",
... |
{
"abstract": "Prurigo pigmentosa, also referred to as Nagashima's disease, is a rare inflammatory skin condition of unknown etiology. It typically presents as pruritic erythematous papules, papulovesicles, and vesicles appearing in a reticular pattern on the back, chest, or neck. The histological features of prurigo pigmentosa vary according to the stage of the disease. Early-stage disease is characterized by a superficial perivascular infiltrate of neutrophils; spongiosis and necrotic keratinocytes commonly appear in later stages. The etiology of prurigo pigmentosa has yet to be determined. Oral minocycline is usually the first-line therapy for prurigo pigmentosa. However, doxycycline, macrolide antibiotics, and/or dapsone (diaminodiphenyl sulfone) may be indicated for some patients. We describe the key features of prurigo pigmentosa, including the epidemiology, clinical and histologic presentation, differential diagnosis, postulated pathogenesis, and treatment options for this condition.",
"affiliations": "University of Nevada School of Medicine, 1060 Wiegand Road, Encinitas, CA, 92024, USA. brycebeutler@hotmail.com.;Department of Dermatology, University of California San Diego, San Diego, CA, USA. mitehead@gmail.com.;Department of Dermatology, University of California San Diego, San Diego, CA, USA. ral002@ucsd.edu.",
"authors": "Beutler|Bryce D|BD|;Cohen|Philip R|PR|;Lee|Robert A|RA|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000890:Anti-Infective Agents; D003879:Dermatologic Agents",
"country": "New Zealand",
"delete": false,
"doi": "10.1007/s40257-015-0154-4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1175-0561",
"issue": "16(6)",
"journal": "American journal of clinical dermatology",
"keywords": null,
"medline_ta": "Am J Clin Dermatol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000900:Anti-Bacterial Agents; D000890:Anti-Infective Agents; D001707:Biopsy, Needle; D003879:Dermatologic Agents; D018450:Disease Progression; D005260:Female; D006801:Humans; D017495:Hyperpigmentation; D007150:Immunohistochemistry; D015994:Incidence; D008297:Male; D011536:Prurigo; D035583:Rare Diseases; D012189:Retrospective Studies; D018570:Risk Assessment; D012720:Severity of Illness Index; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "100895290",
"other_id": null,
"pages": "533-43",
"pmc": null,
"pmid": "26334426",
"pubdate": "2015-12",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Prurigo Pigmentosa: Literature Review.",
"title_normalized": "prurigo pigmentosa literature review"
} | [
{
"companynumb": "US-LUPIN PHARMACEUTICALS INC.-2015-04147",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DOXYCYCLINE"
},
"drugadditiona... |
{
"abstract": "OBJECTIVE\nLevetiracetam is an antiepileptic medication that has been reported to be both well-tolerated and effective in treating generalized tonic-clonic, myoclonic, and partial-onset seizures. The adverse effects most commonly reported in tolerability trials include somnolence, fatigue/asthenia, headaches, dizziness, and nausea. However, there have been a few reports suggesting possible detrimental effects of levetiracetam on renal function.\n\n\nMETHODS\nHere we describe the case of a previously healthy 23-year-old female patient who developed acute kidney injury 1 day after the initiation of levetiracetam therapy for new-onset seizures.\n\n\nRESULTS\nBased on the time course of the patient's rise in serum creatinine and the exclusion of other causes, this case suggests that levetiracetam use contributed to the acute kidney injury.\n\n\nCONCLUSIONS\nLevetiracetam is a widely used drug that has been reported to be generally tolerable and effective; however, it has the potential to negatively affect renal function. This potential consequence of therapy should be considered when deciding whether or not to prescribe this medication, and renal function should be monitored during treatment.",
"affiliations": "Department of Neurology, School of Medicine, Boston University, Boston, Massachusetts. Electronic address: dcs@bu.edu.;Department of Neurology, School of Medicine, Boston University, Boston, Massachusetts.;Department of Neurology, School of Medicine, Boston University, Boston, Massachusetts.",
"authors": "Spengler|Danielle C|DC|;Montouris|Georgia D|GD|;Hohler|Anna D|AD|",
"chemical_list": "D000927:Anticonvulsants; D000077287:Levetiracetam; D010889:Piracetam",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0149-2918",
"issue": "36(8)",
"journal": "Clinical therapeutics",
"keywords": "epilepsy; levetiracetam; medication toxicity; renal failure, seizures",
"medline_ta": "Clin Ther",
"mesh_terms": "D058186:Acute Kidney Injury; D000927:Anticonvulsants; D005260:Female; D006801:Humans; D000077287:Levetiracetam; D010889:Piracetam; D012640:Seizures; D055815:Young Adult",
"nlm_unique_id": "7706726",
"other_id": null,
"pages": "1303-6",
"pmc": null,
"pmid": "24986483",
"pubdate": "2014-08-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Levetiracetam as a possible contributor to acute kidney injury.",
"title_normalized": "levetiracetam as a possible contributor to acute kidney injury"
} | [
{
"companynumb": "US-ROXANE LABORATORIES, INC.-2014-RO-01442RO",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadd... |
{
"abstract": "BACKGROUND\nDirect oral anticoagulants (DOACs), as substrates of cytochrome P450 (CYP) 3A4 and/or P-glycoprotein, are susceptible to drug-drug interactions (DDIs). Hepatitis C direct-acting antiviral agents (DAAs), via P-glycoprotein or CYP3A4 inhibition, may increase DOAC exposure with relevant bleeding risk. We performed a systematic review on DDIs between DOACs and DAAs.\n\n\nMETHODS\nTwo reviewers independently identified studies through electronic databases, until 7 July 2020, supplementing the search by reviewing conference abstracts and the ClinicalTrials.gov website.\n\n\nRESULTS\nOf 1386 identified references, four articles were finally included after applying the exclusion criteria. Three phase I clinical studies in healthy volunteers assessed interactions between dabigatran and glecaprevir/pibrentasvir, odalasvir/simeprevir, or sofosbuvir/velpatasvir/voxilaprevir, showing an increase in the dabigatran area under the concentration-time curve (AUC) by 138%, 103%, and 161%, respectively.\n\n\nCONCLUSIONS\nDOACs and DAAs are under-investigated for DDI risk. Real-world studies are needed to assess the clinical relevance of the pharmacokinetic interactions with dabigatran and describe the actual spectrum of possible DDIs between DAAs and other DOACs.",
"affiliations": "Department of Medicine and Surgery, Research Center on Thromboembolic Disorders and Antithrombotic Therapies, University of Insubria, Varese, Italy.;Department of Medical and Surgical Sciences, Alma Mater Studiorum-University of Bologna, Via Irnerio 48, 40126, Bologna, Italy.;Internal Medicine Unit, 'Sant' Anna' Hospital, San Fermo della Battaglia, Como, Italy.;Department of Medicine and Surgery, Research Center on Thromboembolic Disorders and Antithrombotic Therapies, University of Insubria, Varese, Italy.;Department of Medical and Surgical Sciences, Alma Mater Studiorum-University of Bologna, Via Irnerio 48, 40126, Bologna, Italy. emanuel.raschi@unibo.it.;Department of Medicine and Surgery, Research Center on Thromboembolic Disorders and Antithrombotic Therapies, University of Insubria, Varese, Italy.",
"authors": "Bellesini|Marta|M|;Bianchin|Matteo|M|;Corradi|Chiara|C|;Donadini|Marco Paolo|MP|;Raschi|Emanuel|E|http://orcid.org/0000-0003-0487-7996;Squizzato|Alessandro|A|",
"chemical_list": "D000925:Anticoagulants; D000998:Antiviral Agents; D065692:Cytochrome P-450 CYP3A Inhibitors; D051544:Cytochrome P-450 CYP3A; C510163:CYP3A4 protein, human",
"country": "New Zealand",
"delete": false,
"doi": "10.1007/s40261-020-00962-y",
"fulltext": "\n==== Front\nClin Drug Investig\nClin Drug Investig\nClinical Drug Investigation\n1173-2563 1179-1918 Springer International Publishing Cham \n\n32809123\n962\n10.1007/s40261-020-00962-y\nSystematic Review\nDrug–Drug Interactions between Direct Oral Anticoagulants and Hepatitis C Direct-Acting Antiviral Agents: Looking for Evidence Through a Systematic Review\nBellesini Marta 12 Bianchin Matteo 3 Corradi Chiara 4 Donadini Marco Paolo 12 http://orcid.org/0000-0003-0487-7996Raschi Emanuel emanuel.raschi@unibo.it 3 Squizzato Alessandro 124 1 grid.18147.3b0000000121724807Department of Medicine and Surgery, Research Center on Thromboembolic Disorders and Antithrombotic Therapies, University of Insubria, Varese, Italy \n2 grid.18147.3b0000000121724807Department of Medicine and Surgery, Research Center on Thromboembolic Disorders and Antithrombotic Therapies, University of Insubria, Como, Italy \n3 grid.6292.f0000 0004 1757 1758Department of Medical and Surgical Sciences, Alma Mater Studiorum-University of Bologna, Via Irnerio 48, 40126 Bologna, Italy \n4 Internal Medicine Unit, ‘Sant’ Anna’ Hospital, San Fermo della Battaglia, Como, Italy \n18 8 2020 \n18 8 2020 \n2020 \n40 11 1001 1008\n© The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License, which permits any non-commercial use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc/4.0/.Background\nDirect oral anticoagulants (DOACs), as substrates of cytochrome P450 (CYP) 3A4 and/or P-glycoprotein, are susceptible to drug–drug interactions (DDIs). Hepatitis C direct-acting antiviral agents (DAAs), via P-glycoprotein or CYP3A4 inhibition, may increase DOAC exposure with relevant bleeding risk. We performed a systematic review on DDIs between DOACs and DAAs.\n\nMethods\nTwo reviewers independently identified studies through electronic databases, until 7 July 2020, supplementing the search by reviewing conference abstracts and the ClinicalTrials.gov website.\n\nResults\nOf 1386 identified references, four articles were finally included after applying the exclusion criteria. Three phase I clinical studies in healthy volunteers assessed interactions between dabigatran and glecaprevir/pibrentasvir, odalasvir/simeprevir, or sofosbuvir/velpatasvir/voxilaprevir, showing an increase in the dabigatran area under the concentration–time curve (AUC) by 138%, 103%, and 161%, respectively.\n\nConclusions\nDOACs and DAAs are under-investigated for DDI risk. Real-world studies are needed to assess the clinical relevance of the pharmacokinetic interactions with dabigatran and describe the actual spectrum of possible DDIs between DAAs and other DOACs.\n\nissue-copyright-statement© Springer Nature Switzerland AG 2020\n==== Body\nKey Points\n\nThis is the first systematic review assessing evidence about direct oral anticoagulants/direct-acting antiviral agents (DOACs/DAAs) drug–drug interactions (DDIs).\t\nDAAs increase dabigatran concentration, while no studies were available for other DOACs.\t\nReal-world studies are needed to evaluate clinical relevance of this interaction and to describe the actual spectrum of possible DDIs between DAAs and other DOACs.\t\n\n\nIntroduction\nIn recent years, the direct oral anticoagulants (DOACs) apixaban, dabigatran, edoxaban, and rivaroxaban have been progressively introduced worldwide. By virtue of their favorable pharmacological properties, including predictable pharmacokinetics [1], compared with vitamin K antagonists (VKAs), DOACs are recommended by major guidelines as first-choice anticoagulants for the treatment of venous thromboembolism (VTE) and stroke prevention in non-valvular atrial fibrillation (AF), as documented by current estimates on the incidence of new users [2–4].\n\nNevertheless, risk of bleeding remains a potentially serious complication and preventive strategies should be targeted to real-world susceptible patients, largely underrepresented in clinical trials, such as extreme weights, severe kidney insufficiency, and concomitant administration of potentially interacting medications.\n\nAmong the various unsettled issues, the impact of polypharmacy and drug–drug interactions (DDIs) is perceived as a key research priority [5], also to disentangle the contribution of pharmacodynamic and pharmacokinetic mechanisms. Although DOACs have fewer DDIs than VKAs, significant interactions can still occur; DOACs are substrates of cytochrome P450 (CYP) 3A4 and/or P-glycoprotein (P-gp), making them susceptible to pharmacokinetic DDIs (see Table 1). In particular, coadministration of dabigatran and rifampicin, via P-gp induction, has been documented to lower dabigatran concentration by more than 60%; coadministration of rivaroxaban with ketoconazole or ritonavir has instead been shown to raise rivaroxaban concentrations by more than 150%, via CYP3A4 and P-gp/BCRP (ABCG2) inhibition [6, 7]. At present, there is no accepted threshold for a change in DOAC concentrations that defines clinical significance; however, the anticoagulant effect of DOACs is concentration-dependent, and significant changes in DOAC concentrations likely affects clinical outcomes [8].Table 1 Predicted pharmacokinetic drug interactions between the main hepatitis C direct-acting antiviral agents and direct oral anticoagulants\n\n\tDDIs with DOACs (PK prediction)\t\nDabigatran\tRivaroxaban\tApixaban\tEdoxaban\t\nP-gp substrate\tYes\tYes\tNo (minimal)\tYes\t\nCYP3A4 substrate\tNo\tYes (moderate, 18%)\tYes (moderate, 25%)\tNo (minimal, 4%)\t\nBCRP substrate\tNo\tYes\tYes\tNo\t\nOATP1B1 substrate\tNo\tNo\tNo\tYes\t\nHepatitis C direct-acting antiviral agents\tPK pathway causing DDIs\t\t\t\t\t\nSofosbuvir\t\tNo interaction expected\tNo interaction expected\tNo interaction expected\tNo interaction expected\t\nSofosbuvir/ledipasvir\tMild to moderate P-gp inhibition (by ledipasvir)\n\nWeak inhibition of OATPB1 (by ledipasvir)\n\n\tPotential interaction\tPotential interaction\tPotential interaction\tPotential interaction\t\nSofosbuvir/velpatasvir\tMild P-gp inhibition (by velpatasvir)\n\nInhibition of BCRP (by velpatasvir)\n\n\tPotential interaction\tPotential interaction\tPotential interaction\tPotential interaction\t\nOmbitasvir/paritaprevir/ritonavir + dasabuvir\tP-gp inhibition\n\nInhibition of CYP3A4 (by paritaprevir and ritonavir)\n\nInhibition of BCRP (by ritonavir and dasabuvir)\n\nInhibition of OATP1B1 (by paritaprevir)\n\n\tPotential interaction\tAvoid coadministration (not recommended)\tAvoid coadministration (not recommended)\tPotential interaction\t\nGrazoprevir/elbasvir\tWeak inhibition of CYP3A4 (by grazoprevir)\n\nMild P-gp inhibition (by elbasvir)\n\nInhibition of BCRP (by elbasvir/grazoprevir)\n\n\tPotential interaction\tPotential interaction\tPotential interaction\tPotential interaction\t\nSofosbuvir/velpatasvir/ voxilaprevir\tMild P-gp inhibition (by velpatasvir and voxilaprevir)\n\nInhibition of BCRP (by velpatasvir and voxilaprevir)\n\nInhibition of OATP1B1 (by velpatasvir and voxilaprevir)\n\n\tAvoid coadministration (not recommended)\tPotential interaction\tPotential interaction\tAvoid coadministration (not recommended)\t\nGlecaprevir/pibrentasvir\tWeak inhibition of CYP3A4\n\nStrong inhibition of P-gp\n\nInhibition of BCRP\n\n\tAvoid coadministration (not recommended)\tPotential interaction\tPotential interaction\tPotential interaction\t\nSimeprevir\tMild–moderate P-gp inhibition\n\nInhibition of CYP3A4\n\nInhibition of OATPB1\n\n\tPotential interaction\tPotential interaction\tPotential interaction\tPotential interaction\t\nBased on https://www.hep-druginteractions.org (University of Liverpool) [12] and Talavera Pons et al. [13]\n\nCYP cytochrome P450, P-gp P-glycoprotein, BCRP breast cancer resistance protein, PK pharmacokinetic, DOACs direct oral anticoagulants, DDIs drug–drug interactions, OATP organic anion-transporting polypeptide\n\n\n\nWhile laboratory tests to assess the intensity of anticoagulation and the detection of DDIs are easily accessible for VKAs by monitoring the international normalized ratio, DOAC-specific tests and guidance for using them in special situations are now available with several limitations. In particular, there is actually no consensus on the therapeutic range of DOACs, even if information can be derived from phase II–III clinical trials regarding the ‘on‐therapy’ range [9]. Based on data from pharmacokinetic studies, expert societies have proposed algorithms and thresholds for some clinical situations, which need to be validated in targeted prospective studies [9, 10].\n\nIn parallel with the increasing uptake of DOACs, several direct-acting antiviral agents (DAAs) for chronic hepatitis C virus (HCV) have been licensed in recent years; these agents have expanded the pharmacological armamentarium for treating HCV infection, with remarkable effectiveness and a good tolerability profile [11]. However, relevant treatment regimens contain at least two and up to five drugs, and carry potential metabolic- or transport-mediated DDIs via P-gp or CYP3A4 inhibition (see Table 1) [12, 13]. The potential for DDIs needs special consideration for HCV-infected individuals with concomitant comorbidities, such as AF or VTE, requiring anticoagulant treatment.\n\nRecent studies have suggested an increased risk of VTE among HCV-infected patients, coupled with an increased incidence of AF [14, 15], thus resulting in a likely rise in the number of DOAC prescriptions in the near future in patients with HCV infection. In addition, the use of DOACs in patients with liver disease is expected to increase in the next years as a result of the link between metabolic as well as viral liver disease and cardiovascular complications, and due to the concomitant increasing prevalence of nonalcoholic fatty liver disease and nonalcoholic steatohepatitis (NASH) [16]. In particular, on the one hand, HCV infection is often associated with both hepatic steatosis and with a specific HCV-associated dysmetabolic syndrome [17], while on the other hand, NASH currently represents the leading cause of chronic liver disease and is independently associated with an increased risk of cardiovascular diseases, namely cardiac rhythm disorders (mainly AF) and VTE [18–21]. Therefore, an increasing number of patients affected by chronic liver disease will be candidates for anticoagulant treatment with DOACs [16].\n\nIn patients with cirrhosis, the use of DOACs is controversial and challenging for a number of reasons, including (1) cirrhosis was an exclusion criteria of pivotal trials; (2) patients with cirrhosis are at risk of both bleeding and thrombotic complications; and (3) DOACs, especially rivaroxaban, have been associated with increased reporting of serious and early-onset liver injury [22, 23]. For these reasons, current guidelines and drug regulatory agencies (US FDA and European Medicines Agency) contraindicated all DOACs in patients with cirrhosis Child–Turcotte–Pugh (CTP) class C, while variously allowing their use in patients with cirrhosis CTP class B and A [3, 24]. Emerging real-world data suggest that DOACs can effectively and safely be used in CTP A patients, and cautiously in CTP B cirrhotic patients, compared with VKAs [16], thus supporting the importance of an accurate evaluation of possible DDIs in HCV co-infected cirrhotic patients.\n\nBecause of these pharmacokinetic bases, the combination of DOACs and DAAs is not recommended, or is to be used with caution, as per major guidelines and online tools, albeit with little information on clinical relevance and relative proper management [11, 12].\n\nWe aimed to systematically assess the evidence regarding DDIs between DOACs and DAAs, and to provide adjunctive information on their clinical relevance, including management in clinical practice.\n\nMethods\nThis systematic review was performed according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines [25]. The protocol was designed a priori but was not submitted to public repositories.\n\nWe searched studies that assessed DDIs between DOACs and DAAs, using the MEDLINE (1966 to 7 July 2020) and EMBASE (1980 to 7 July 2020) electronic databases. The search strategy was developed without any language restriction using https://www.embase.com: ‘antiinfective agent’ AND ‘hepatitis c’ AND ‘anticoagulant agent’.\n\nWe supplemented our search by handsearching unpublished literature, including the ClinicalTrials.gov website and congress abstracts of the International Society on Thrombosis and Haemostasis (ISTH), European Association for the Study of the Liver (EASL), International Society of Pharmacovigilance (ISoP), International Society for Pharmacoepidemiology (ISPE), and the European Association for Clinical Pharmacology and Therapeutics (EACPT).\n\nTwo investigators (MB and MB) independently performed study selection. According to prespecified selection criteria, articles were included if (1) the study evaluated potential interaction between DOACs and DAAs; and (2) outcome measures were reported. Disagreements were resolved through discussion with a third reviewer (AS).\n\nTwo reviewers independently extracted data on study and population characteristics, type of intervention and outcome measures.\n\nWe established a priori to use the Cochrane ROBINS-I and RoB 2 tools for quality assessment but they were not applicable due to the type of included studies [26, 27].\n\nResults\nWe identified 1385 references through a systematic database search. After applying inclusion criteria, three studies (Kosloski et al. [28], Boyle et al. [29], and Ouwerkerk-Mahadevan et al. [30]) were eligible for inclusion. One additional study was identified through handsearching of EASL conference abstracts (Garrison et al. [31]). Of four articles included in this systematic review, only one was available in full text [28]. A PRISMA flow diagram detailing the screening process is shown in Fig. 1.Fig. 1 PRISMA flow diagram of the study selection process (included and excluded studies). DOACs direct oral anticoagulants, DAAs direct-acting antiviral agents for chronic hepatitis C, DDIs drug–drug interactions, VKA vitamin K antagonist\n\n\n\nOf the included studies, three were phase I studies conducted in healthy volunteers, each assessing interactions between dabigatran and glecaprevir/pibrentasvir, odalasvir/simeprevir, or sofosbuvir/velpatasvir/voxilaprevir [28, 30, 31]. Characteristics of the included studies and outcome measures are reported in Table 2.Table 2 Characteristics of the included studies and outcome measures\n\n\tKosloski et al. [28]\tBoyle et al. [29]\tOuwerkerk-Mahadevan et al. [30]\tGarrison et al. [31]\t\nJournal, year\tJournal of Pharmacology and Experimental Therapeutics, 2019\tJournal of Hepatology, 2019\tClinical Pharmacology and Therapeutics (CPT), 2018\tJournal of Hepatology, 2017\t\nData presentation\tFull text\tCongress poster (EASL)\tCongress poster (ASCPT)\tCongress poster (EASL)\t\nStudy type\tPhase I\tRetrospective observational\tPhase I\tPhase I\t\nPopulation\tHealthy volunteers (11)\tUK DOAC + DAA patients (54) over 1 year\n\nDOACs: 37 rivaroxaban, 14 apixaban, 2 dabigatran, 1 edoxaban\n\n\tHealthy volunteers (15)\tHealthy volunteers\t\nIntervention\tDabigatran + glecaprevir/pibrentasvir\tNone. Review of management strategies for DDIs between DOACs and DAAs (various types of combination)\tDabigatran + odalasvir/simeprevir\n\nSequential administration\n\n\tDabigatran + sofosbuvir/velpatasvir/voxilaprevir\t\nComparator\tNo comparator\tNo comparator\tNo comparator\tNo comparator\t\nOutcome measures\tDabigatran Cmax and AUC∞ were 105% and 138% higher, respectively, during coadministration with glecaprevir/pibrentasvir compared with dabigatran alone\tManagement strategies: 24 (44.4%) clinical monitoring, 13 (24.1%) anti-Xa activity blood monitoring, 9 (16.7%) switch to LMWH, 7 (13%) switch DAAs, 1 (1.9%) wait until DOACs completed for finite courses\n\nNo serious bleeding reported\n\n\tDabigatran Cmax, AUClast and AUC∞ increased by 48%,76%, and 68%, respectively, upon coadministration with odalasvir (day 17), and by 70%, 114%, and 103%, respectively, upon coadministration with odalasvir/simeprevir (day 26), versus dabigatran alone (day 1)\n\nNo deaths or serious adverse events were reported\n\n\tTotal dabigatran AUC was ↑161% following administration of sofosbuvir/velpatasvir/voxilaprevir with dabigatran\t\nASCPT American Society for Clinical Pharmacology and Therapeutics, AUC area under the concentration–time curve, AUC∞ AUC from time zero to infinity, AUClast AUC from time zero to time of the last quantifiable concentration, Cmax maximum plasma concentration, DAAs hepatitis C direct-acting antivirals, DDIs drug–drug interactions, DOACs direct oral anticoagulants, EASL European Association for the Study of the Liver, LMWH low-molecular-weight heparin, ↑ indicates increased\n\n\n\nIncreased dabigatran concentrations during coadministration with DAAs was found, with the area under the concentration–time curve (AUC) increasing by 138%, 103%, and 161%, respectively.\n\nOne study was a retrospective observational study, with the aim of reviewing management strategies adopted by clinicians to handle DDIs. The study was conducted in a population of 54 patients taking DOACs and DAAs, over a 1-year period [29]. Clinical monitoring was the most common strategy (no serious bleeding events were reported).\n\nDiscussion\nTo the best of our knowledge, this is the first systematic review aimed at evaluating DDIs between DOACs and DAAs. The following key findings can be identified. First, there are no postmarketing real-world data specifically investigating the clinical impact of DOAC-DAA combinations; second, notwithstanding the systematic search, including several gray areas of the literature, only a few studies have assessed these DDIs from a pharmacokinetic perspective only; third, for dabigatran only, dedicated drug interaction studies were retrieved without information on rivaroxaban, abixaban or edoxaban (the most frequently used DOACs in current clinical practice).\n\nOverall, the paucity of data urgently calls for dedicated real-world studies to verify the actual clinical relevance of the pharmacokinetic interactions with dabigatran, and investigate the real risk in users of anti-factor Xa drugs, both in terms of bleeding risk and occurrence of liver injury. In fact, both rivaroxaban and apixaban are P-gp and BCRP substrates, whereas the active substrate of edoxaban is also a substrate of OATP1B1, thus making clinically important drug interactions highly likely.\n\nThe new oral hepatitis C drugs are examples where interpretation of a potential interaction may be particularly complex due to multiple drugs with different pharmacokinetic profiles concomitantly administered [32]. For instance, ledipasvir and sofosbuvir are P-gp substrates in vitro (and ledipasvir is also a P-gp inhibitor), whereas paritaprevir, ritonavir and dasabuvir all inhibit P-gp in vitro. Our data (even a twofold increased AUC of dabigatran) strongly suggest the clinical importance of this pharmacokinetic interaction. Apart from additional stringent clinical monitoring of susceptible patients (e.g. elderly with organ impairment receiving polypharmacy), outdistanced administration of the object and precipitant drug could be a viable option to minimize the likelihood of a pharmacokinetic interaction between dabigatran and DAAs, as previously demonstrated with verapamil (a P-gp and CYP3A4 inhibitor); administration of dabigatran etexilate (the prodrug) 2 h before verapamil did not significantly increase exposure to dabigatran etexilate (< 20% increase in AUC) [33].\n\nNotably, there are key differences in the pharmacokinetic profiles among DOACs; apart from P-gp interactions (with dabigatran, as a prodrug, more likely to be affected), the extent of hepatic metabolism varies substantially, with rivaroxaban and apixaban undergoing non-negligible (65–75%) liver pathways, mediated for 25% by CYP3A4/5 and CYP2J2 [34]. Therefore, real-world studies are essential to verify the actual bleeding risk in users of DOACs and DAAs, especially considering that different DAAs possess additional properties on CYP3A4 (inhibitors or substrates), and the potential mismatch between pharmacokinetic data and observed associations in population-based studies [32, 35]. For dabigatran (in patients aged > 85 years), recent cohort studies on rivaroxaban and edoxaban found increased bleeding occurrence in patients exposed to P-gp inhibitors and moderate CYP3A4 inhibitors, as also expected from clinical trials, where frequencies of bleeding events and mortality, but not stroke and systemic embolism, were increased with the increasing number of concomitant drugs [36–38].\n\nMoreover, as shown in our review, DDIs between dabigatran and the DAAs tested resulted in a change of dabigatran concentration > 25%; this cut-off was used in a previous review assessing DDIs of DOACs as a clinically significant change for maximum concentration (Cmax) and AUC, in line with FDA guidance [39]. The actual relationship between these pharmacokinetic bases and clinical outcomes is still debated.\n\nWe noted partial disagreement between international guidelines; the EASL guidelines contraindicated some combinations of DAAs/DOACs, whereas there is no specific mention in the 2018 European Heart Rhythm Association (EHRA) guidelines, and only coadministration of an HIV protease inhibitor (e.g. ritonavir) with DOACs is not recommended [3, 11]. Our findings may support an evidence-based update of future guidelines, in particular regarding coadministration of dabigatran with glecaprevir/pibrentasvir, odalasvir/simeprevir, or sofosbuvir/velpatasvir/voxilaprevir. However, with regard to DDIs between DOACs and antiretroviral HIV treatment (sharing similar predicted pharmacokinetic DDIs with DAAs), in a recent small series of 14 HIV-infected patients concurrently treated with a variety of an antiretroviral and dabigatran for AF, dabigatran levels remained within the population expected range [40]. This further highlights the need for real-world targeted studies to assess the clinical relevance of the pharmacokinetic interaction that emerged in our review between dabigatran and HCV DAAs.\n\nThe strengths of our study include its systematic approach, including the implementation of our search with gray literature, through handsearching of conference abstracts. However, limitations of this systematic review should be acknowledged, which are mainly related to study design and full-text availability.\n\nApart from the very limited number of available studies, most studies were pharmacokinetic phase I trials, conducted in a small number of healthy volunteers. However, we believe this limitation should further raise awareness of clinicians on the risk of bleeding in subjects with chronic HCV and concomitant diseases, such as AF or VTE, taking several medications.\n\nDue to the study design, a comparator was not tested. Therefore, no conclusions can be drawn as to whether the use of other anticoagulant treatments (such as heparin or VKAs), instead of DOACs, would bring benefit in this context. Although no major complications or major bleeding were reported in the studies included, also considering the small number of subjects enrolled, no firm conclusions can be made on the clinical relevance of these results due to the lack of consensus on clinically relevant changes in DOAC concentrations correlating with actual clinical outcomes.\n\nLastly, little information was available in the literature on how to manage potential DDIs between DOACs and DAAs in clinical practice; the only study available was a small observational study showing heterogeneity in the approaches used by clinicians to handle DDIs between DOACs and DAAs [41]. Therefore, our results further highlight the lack of data available and the urgent conduction of targeted studies.\n\nConclusions\nThe paucity of data documented by this systematic review underline the need to assess the actual clinical impact of anticipated pharmacokinetic interactions between DOACs and DAAs through real-world studies, thus supporting clinicians in safe prescribing.\n\nAcknowledgements\nOpen access funding provided by Alma Mater Studiorum - Universitá di Bologna within the CRUI-CARE Agreement. This systematic review was presented as an e-poster at the ISTH 2020 Virtual Congress (12–14 July 2020).\n\nAuthor Contributions\nMB was responsible for the conceptualization and study design, data extraction, data presentation, data interpretation, and manuscript drafting and editing. MB was responsible for the data extraction, data presentation, and data interpretation. CC was responsible for the data interpretation. MPD was responsible for the conceptualization and study design, and data interpretation. ER was responsible for the conceptualization and study design, data interpretation, and manuscript drafting and editing. AS supervised the project and is guarantor for the study; he was responsible for the conceptualization and study design, data interpretation, and manuscript editing. All authors provided substantial contributions to data interpretation and discussion. They critically revised the content and approved the final version of the manuscript.\n\nDeclarations\nFunding\nThis work was supported by institutional research funds.\n\nConflict of interest\nMarta Bellesini, Matteo Bianchin, Chiara Corradi, and Marco Paolo Donadini declare they have no conflicts of interest. Emanuel Raschi reports personal fees from Novartis, outside the submitted work. Alessandro Squizzato received fees for lectures and/or advisory board meetings from Daiichi Sankyo, Pfizer, Bristol Myers Squibb, Bayer, and Boehringer Ingelheim.\n\nEthics approval\nNot applicable.\n\nConsent to participate\nNot applicable.\n\nConsent for publication\nNot applicable.\n\nAvailability of data and material\nData sharing is not applicable to this article as no new data were created or analyzed in this study.\n\nCode availability\nNot applicable.\n==== Refs\nReferences\n1. Raschi E Bianchin M Ageno W De Ponti R De Ponti F Risk–benefit profile of direct-acting oral anticoagulants in established therapeutic indications: an overview of systematic reviews and observational studies Drug Saf 2016 39 1175 1187 10.1007/s40264-016-0464-3 27696300 \n2. Kearon C Akl EA Ornelas J Antithrombotic therapy for VTE disease: CHEST guideline and expert panel report Chest 2016 149 315 352 10.1016/j.chest.2015.11.026 26867832 \n3. Steffel J Verhamme P Potpara TS The 2018 European Heart Rhythm Association practical guide on the use of non-vitamin K antagonist oral anticoagulants in patients with atrial fibrillation Eur Heart J 2018 39 1330 1393 10.1093/eurheartj/ehy136 29562325 \n4. Ibáñez L Sabaté M Vidal X Incidence of direct oral anticoagulant use in patients with nonvalvular atrial fibrillation and characteristics of users in 6 European countries (2008–2015): a cross-national drug utilization study Br J Clin Pharmacol 2019 85 2524 2539 10.1111/bcp.14071 31318059 \n5. Raschi E Bianchin M Gatti M Squizzato A De Ponti F Comparative effectiveness and safety of direct oral anticoagulants: overview of systematic reviews Drug Saf 2019 42 1409 1422 10.1007/s40264-019-00866-7 31552603 \n6. Härtter S Koenen-Bergmann M Sharma A Nehmiz G Lemke U Timmer W Decrease in the oral bioavailability of dabigatran etexilate after co-medication with rifampicin Br J Clin Pharmacol 2012 74 490 500 10.1111/j.1365-2125.2012.04218.x 22348256 \n7. Mueck W Kubitza D Becka M Co-administration of rivaroxaban with drugs that share its elimination pathways: pharmacokinetic effects in healthy subjects Br J Clin Pharmacol 2013 76 455 466 10.1111/bcp.12075 23305158 \n8. Testa S Legnani C Antonucci E Drug levels and bleeding complications in atrial fibrillation patients treated with direct oral anticoagulants J Thromb Haemost 2019 17 1064 1072 10.1111/jth.14457 31013383 \n9. Douxfils J Ageno W Samama C-M Lessire S ten Cate H Verhamme P Laboratory testing in patients treated with direct oral anticoagulants: a practical guide for clinicians J Thromb Haemost 2018 16 209 219 10.1111/jth.13912 29193737 \n10. Tripodi A Ageno W Ciaccio M Position paper on laboratory testing for patients on direct oral anticoagulants. A consensus document from the SISET, FCSA, SIBioC and SIPMeL Blood Transfus. 2018 16 462 470 29106357 \n11. European Association for the Study of the Liver EASL recommendations on treatment of hepatitis C 2018 J Hepatol 2018 69 461 511 10.1016/j.jhep.2018.03.026 29650333 \n12. University of Liverpool, HEP drug interactions. Liverpool HEP interactions. https://www.hep-druginteractions.org/. Accessed 22 July 2020.\n13. Talavera Pons S Boyer A Lamblin G Chennell P Châtenet F Nicolas C Managing drug–drug interactions with new direct-acting antiviral agents in chronic hepatitis C Br J Clin Pharmacol 2017 83 269 293 10.1111/bcp.13095 27530469 \n14. Wijarnpreecha K Thongprayoon C Panjawatanan P Ungprasert P Hepatitis C virus infection and risk of venous thromboembolism: a systematic review and meta-analysis Ann Hepatol 2017 16 514 520 10.5604/01.3001.0010.0279 28611268 \n15. Yang Y-H Chiang H-J Yip H-K Chen K-J Chiang JY Lee MS Risk of new-onset atrial fibrillation among Asian chronic hepatitis C virus carriers: a nationwide population-based cohort study J Am Heart Assoc 2019 8 e012914 31711382 \n16. Ballestri S Capitelli M Fontana MC Arioli D Romagnoli E Graziosi C Direct oral anticoagulants in patients with liver disease in the era of non-alcoholic fatty liver disease global epidemic: a narrative review Adv Ther 2020 37 1910 1932 10.1007/s12325-020-01307-z 32285340 \n17. Ballestri S Nascimbeni F Romagnoli D Baldelli E Targher G Lonardo A Type 2 diabetes in non-alcoholic fatty liver disease and hepatitis C virus infection—liver: the “musketeer” in the spotlight Int J Mol Sci 2016 17 355 10.3390/ijms17030355 27005620 \n18. Spinosa M Stine JG Nonalcoholic fatty liver disease-evidence for a thrombophilic state? Curr Pharm Des 2020 26 1036 1044 10.2174/1381612826666200131101553 32003679 \n19. Ballestri S Lonardo A Bonapace S Byrne CD Loria P Targher G Risk of cardiovascular, cardiac and arrhythmic complications in patients with non-alcoholic fatty liver disease World J Gastroenterol 2014 20 1724 1745 10.3748/wjg.v20.i7.1724 24587651 \n20. Anstee QM Mantovani A Tilg H Targher G Risk of cardiomyopathy and cardiac arrhythmias in patients with nonalcoholic fatty liver disease Nat Rev Gastroenterol Hepatol 2018 15 425 439 10.1038/s41575-018-0010-0 29713021 \n21. Di Minno MND Tufano A Rusolillo A Di Minno G Tarantino G High prevalence of nonalcoholic fatty liver in patients with idiopathic venous thromboembolism World J Gastroenterol 2010 16 6119 6122 10.3748/wjg.v16.i48.6119 21182227 \n22. Raschi E Bianchin M De Ponti R De Ponti F Ageno W Emerging therapeutic uses of direct-acting oral anticoagulants: an evidence-based perspective Pharmacol Res 2017 120 206 218 10.1016/j.phrs.2017.03.026 28366835 \n23. Raschi E Poluzzi E Koci A Salvo F Pariente A Biselli M Liver injury with novel oral anticoagulants: assessing post-marketing reports in the US Food and Drug Administration adverse event reporting system Br J Clin Pharmacol 2015 80 285 293 10.1111/bcp.12611 25689417 \n24. Qamar A Vaduganathan M Greenberger NJ Giugliano RP Oral anticoagulation in patients with liver disease J Am Coll Cardiol 2018 71 2162 2175 10.1016/j.jacc.2018.03.023 29747837 \n25. Shamseer L Moher D Clarke M Ghersi D Liberati A Petticrew M PRISMA-P Group Preferred reporting items for systematic review and meta-analysis protocols (PRISMA-P) 2015: elaboration and explanation BMJ 2015 350 g7647 10.1136/bmj.g7647 25555855 \n26. Sterne JA Hernán MA Reeves BC ROBINS-I: a tool for assessing risk of bias in non-randomised studies of interventions BMJ 2016 355 i4919 10.1136/bmj.i4919 27733354 \n27. Sterne JAC Savović J Page MJ RoB 2: a revised tool for assessing risk of bias in randomised trials BMJ 2019 366 l4898 10.1136/bmj.l4898 31462531 \n28. Kosloski MP Bow DAJ Kikuchi R Wang H Kim EJ Marsh K Translation of in vitro transport inhibition studies to clinical drug-drug interactions for glecaprevir and pibrentasvir J Pharmacol Exp Ther 2019 370 278 287 10.1124/jpet.119.256966 31167814 \n29. Boyle A Davidson K Cassidy C THU-130-management strategies for drug drug interactions between direct oral anticoagulants and hepatitis C directly acting agents: a multicentre review J Hepatol 2019 70 e216 e217 10.1016/S0618-8278(19)30405-0 \n30. Ouwerkerk-Mahadevan S Gamil M Van Hemelryck S Hillewaert V Biermer M Pharmacokinetic interaction between the P-glycoprotein substrate dabigatran etexilate and HCV direct-acting antiviral agents, odalasvir and simeprevir Clin Pharmacol Ther 2018 103 S84 \n31. Garrison KL Kirby B Stamm LM Ma G Vu A Ling J Drug-drug interaction profile of sofosbuvir/velpatasvir/voxilaprevir fixed-dose combination J Hepatol 2017 66 S492 S493 10.1016/S0168-8278(17)31381-8 \n32. Lund M Petersen TS Dalhoff KP Clinical Implications of P-glycoprotein modulation in drug–drug interactions Drugs 2017 77 859 883 10.1007/s40265-017-0729-x 28382570 \n33. Härtter S Sennewald R Nehmiz G Reilly P Oral bioavailability of dabigatran etexilate (Pradaxa(® ) ) after co-medication with verapamil in healthy subjects Br J Clin Pharmacol 2013 75 1053 1062 10.1111/j.1365-2125.2012.04453.x 22946890 \n34. Gelosa P Castiglioni L Tenconi M Baldessin L Racagni G Corsini A Pharmacokinetic drug interactions of the non-vitamin K antagonist oral anticoagulants (NOACs) Pharmacol Res 2018 135 60 79 10.1016/j.phrs.2018.07.016 30040996 \n35. Chang S-H Chou I-J Yeh Y-H Chiou M-J Wen M-S Kuo C-T Association Between use of non-vitamin K oral anticoagulants with and without concurrent medications and risk of major bleeding in nonvalvular atrial fibrillation JAMA 2017 318 1250 1259 10.1001/jama.2017.13883 28973247 \n36. Bernier M Lancrerot S-L Rocher F Van-Obberghen EK Olivier P Lavrut T Major bleeding events in octagenarians associated with drug interactions between dabigatran and P-gp inhibitors J Geriatr Cardiol 2019 16 806 811 31853245 \n37. Hanigan S Das J Pogue K Barnes GD Dorsch MP The real world use of combined P-glycoprotein and moderate CYP3A4 inhibitors with rivaroxaban or apixaban increases bleeding J Thromb Thrombolysis 2020 49 636 643 10.1007/s11239-020-02037-3 31925665 \n38. Harskamp RE Teichert M Lucassen WAM van Weert HCPM Lopes RD Impact of polypharmacy and P-glycoprotein- and CYP3A4-modulating drugs on safety and efficacy of oral anticoagulation therapy in patients with atrial fibrillation Cardiovasc Drugs Ther 2019 33 615 623 10.1007/s10557-019-06907-8 31520256 \n39. Herink MC Zhuo YF Williams CD DeLoughery TG Clinical management of pharmacokinetic drug interactions with direct oral anticoagulants (DOACs) Drugs 2019 79 1625 1634 10.1007/s40265-019-01183-0 31440911 \n40. Perram J O’Dwyer E Holloway C Use of dabigatran with antiretrovirals HIV Med 2019 20 344 346 10.1111/hiv.12722 30924585 \n41. Testa S Ageno W Antonucci E Management of major bleeding and outcomes in patients treated with direct oral anticoagulants: results from the START-Event registry Intern Emerg Med 2018 13 1051 1058 10.1007/s11739-018-1877-z 29790125\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1173-2563",
"issue": "40(11)",
"journal": "Clinical drug investigation",
"keywords": null,
"medline_ta": "Clin Drug Investig",
"mesh_terms": "D000925:Anticoagulants; D000998:Antiviral Agents; D051544:Cytochrome P-450 CYP3A; D065692:Cytochrome P-450 CYP3A Inhibitors; D004347:Drug Interactions; D006526:Hepatitis C; D006801:Humans",
"nlm_unique_id": "9504817",
"other_id": null,
"pages": "1001-1008",
"pmc": null,
"pmid": "32809123",
"pubdate": "2020-11",
"publication_types": "D016428:Journal Article; D000078182:Systematic Review",
"references": null,
"title": "Drug-Drug Interactions between Direct Oral Anticoagulants and Hepatitis C Direct-Acting Antiviral Agents: Looking for Evidence Through a Systematic Review.",
"title_normalized": "drug drug interactions between direct oral anticoagulants and hepatitis c direct acting antiviral agents looking for evidence through a systematic review"
} | [
{
"companynumb": "BE-ALKEM LABORATORIES LIMITED-BE-ALKEM-2020-06385",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "SIMEPREVIR"
},
"druga... |
{
"abstract": "BACKGROUND\nIntravenous acetylcysteine (Acetadote™ in the US) is the treatment of choice for acute acetaminophen poisoning in most of the world. However, the complicated dosing regimen is prone to errors in preparation and administration.\n\n\nMETHODS\nA 21 year-old woman (70 kg) took an overdose of acetaminophen and ethanol. Her serum acetaminophen concentration was > 200 mg/L. Acetylcysteine infusion was ordered. Due to misreading of the columns in the table in the Acetadote™ package insert, she received a five-fold overdose of 52.5 g of acetylcysteine in 500 mL over 1 h and then 17.5 g of acetylcysteine in 500 mL to run over 4 h. The dose error was detected 20 min into the second infusion. Her acetaminophen concentration fell quickly, and her highest transaminase concentrations occurred day 2. Her hemoglobin and hematocrit quickly dropped from 14.8 g/dL and 44.0% on admission to 6.2 g/dL and 17.3% on day 7. Subsequently she developed hematuria and a rapidly rising serum creatinine. She was transferred to a tertiary care hospital, where she underwent hemodialysis every two days for two weeks, transfusions of packed red blood cells, and plasmapheresis until hematologic testing ruled out thrombotic thrombocytopenia purpura.\n\n\nCONCLUSIONS\nA five-fold overdose of acetylcysteine was followed by unexpected hemolysis and acute renal failure. The mechanism of hemolysis after acetylcysteine overdose is unclear. A simpler infusion regimen with standard concentrations would prevent a similar error.",
"affiliations": "Washington University, Emergency Medicine, 660 S Euclid Avenue, Campus Box 8072, St. Louis, 63110, United States. mullinsm@wusm.wustl.edu",
"authors": "Mullins|Michael E|ME|;Vitkovitsky|Irena V|IV|",
"chemical_list": "D000082:Acetaminophen; D000111:Acetylcysteine",
"country": "England",
"delete": false,
"doi": "10.3109/15563650.2011.609821",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-3650",
"issue": "49(8)",
"journal": "Clinical toxicology (Philadelphia, Pa.)",
"keywords": null,
"medline_ta": "Clin Toxicol (Phila)",
"mesh_terms": "D000082:Acetaminophen; D000111:Acetylcysteine; D058186:Acute Kidney Injury; D000328:Adult; D005260:Female; D006461:Hemolysis; D006463:Hemolytic-Uremic Syndrome; D006801:Humans; D008508:Medication Errors; D011041:Poisoning; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "101241654",
"other_id": null,
"pages": "755-9",
"pmc": null,
"pmid": "21970774",
"pubdate": "2011-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Hemolysis and hemolytic uremic syndrome following five-fold N-acetylcysteine overdose.",
"title_normalized": "hemolysis and hemolytic uremic syndrome following five fold n acetylcysteine overdose"
} | [
{
"companynumb": "US-JNJFOC-20111007380",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nBisphosphonate (BP) therapy in the treatment of bone diseases and malignancy may induce a major side effect known as bisphosphonate-related osteonecrosis of the jaws (BRONJ). A particular view of this condition is reported in this case series investigating eight patients. The aim of the study was to evaluate the BRONJ lesions concerning their aspects and progression. Also, identify if it is possible to predict the degree of severity in these cases.\n\n\nMETHODS\nPatients were evaluated by their condition and systemic health. The lesions were evaluated in clinical and radiographic aspects. The patients were followed-up for 2 years.\n\n\nRESULTS\nThe patients presented with specific peculiarities, and the BRONJ lesions varied in several characteristics. The BRONJ lesions ranged from simple to severe conditions, and the complicated cases presented with major pain, swelling, secondary infection and an extensive necrotic area, classified with high grade of severity.\n\n\nCONCLUSIONS\nThe patients presented here confirm the existence of a relation between multiple features and BRONJ and to understand the whole process of aggravation, all systemic and local information have to be taken into account, together with all data related to the BP utilized. Regardless of the low incidence of this side effect in relation to osteoporosis treatment, in some cases, the BRONJ may become a severe condition and compromise the patient's quality of life.",
"affiliations": "UFR de Médecine Lyon-Est Domaine Laennec, INSERM UMR 1033, Université de Lyon, 7-11 Rue Guillaume Paradin, 69372 Lyon Cedex 08, France ; Department of Stomatology, Faculty of Dentistry, University of São Paulo, Av. Prof. Lineu Prestes, 2227, Cidade Universitária, São Paulo, CEP 05508-000 Brazil ; A. C. Camargo Cancer Center, Fundação Antonio Prudente, Rua Professor Antônio Prudente 211, São Paulo, 01509-900 Brazil.;Department of Stomatology, Faculty of Dentistry, University of São Paulo, Av. Prof. Lineu Prestes, 2227, Cidade Universitária, São Paulo, CEP 05508-000 Brazil ; Santos Metropolitan University, Rua da Constituição 374, Vila Nova, Santos, 11015-470 Brazil.;UFR de Médecine Lyon-Est Domaine Laennec, INSERM UMR 1033, Université de Lyon, 7-11 Rue Guillaume Paradin, 69372 Lyon Cedex 08, France.;Santos Metropolitan University, Rua da Constituição 374, Vila Nova, Santos, 11015-470 Brazil.;Department of Stomatology, Faculty of Dentistry, University of São Paulo, Av. Prof. Lineu Prestes, 2227, Cidade Universitária, São Paulo, CEP 05508-000 Brazil ; A. C. Camargo Cancer Center, Fundação Antonio Prudente, Rua Professor Antônio Prudente 211, São Paulo, 01509-900 Brazil.;Department of Stomatology, Faculty of Dentistry, University of São Paulo, Av. Prof. Lineu Prestes, 2227, Cidade Universitária, São Paulo, CEP 05508-000 Brazil.",
"authors": "Rabelo|Gustavo Davi|GD|;Assunção|José Narciso Rosa|JN|;Chavassieux|Pascale|P|;Soares|Haroldo Arid|HA|;Alves|Fabio Abreu|FA|;Lemos|Celso Augusto|CA|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.1007/s12663-014-0707-8",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0972-8270",
"issue": "14(3)",
"journal": "Journal of maxillofacial and oral surgery",
"keywords": "Bisphosphonate; Cancer; Jaws; Osteonecrosis; Osteoporosis",
"medline_ta": "J Maxillofac Oral Surg",
"mesh_terms": null,
"nlm_unique_id": "101538309",
"other_id": null,
"pages": "699-705",
"pmc": null,
"pmid": "26225065",
"pubdate": "2015-09",
"publication_types": "D016428:Journal Article",
"references": "22180055;18336375;7477143;16750501;22359627;23756612;23524435;9294113;23647292;21079615;23652790;23036797;23288026;20333419;21555003",
"title": "Bisphosphonate-Related Osteonecrosis of the Jaws and Its Array of Manifestations.",
"title_normalized": "bisphosphonate related osteonecrosis of the jaws and its array of manifestations"
} | [
{
"companynumb": "FR-JUBILANT CADISTA PHARMACEUTICALS-2016JUB00052",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"druga... |
{
"abstract": "<p>Annular elastolytic giant cell granuloma, also known as actinic granuloma, is a rare skin condition with a chronic course that is often resistant to treatment. Literature is sparse, and only a handful of case reports are available to guide treatment decisions. Typical first line treatment options include topical and intralesional steroids, topical pimecrolimus, and cryotherapy. Resistant cases have been treated with cyclosporine, systemic steroids, antimalarials, and oral retinoids. In particular, acitretin and isotretinoin have shown success in three cases. However, these medications can have side effects and require frequent lab monitoring. We present a case of a 47-year-old woman with bilateral forearm lesions consistent with annular elastolytic giant cell granuloma who was successfully treated with topical tretinoin.</p> <p><em>J Drugs Dermatol. 2017;16(7):699-700.</em></p>.",
"affiliations": null,
"authors": "Wagenseller|Aubrey|A|;Larocca|Cecilia|C|;Vashi|Neelam A|NA|",
"chemical_list": "D000970:Antineoplastic Agents; D014212:Tretinoin",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-9616",
"issue": "16(7)",
"journal": "Journal of drugs in dermatology : JDD",
"keywords": null,
"medline_ta": "J Drugs Dermatol",
"mesh_terms": "D000970:Antineoplastic Agents; D004547:Elastic Tissue; D005260:Female; D016460:Granuloma Annulare; D006101:Granuloma, Giant Cell; D006801:Humans; D008875:Middle Aged; D016896:Treatment Outcome; D014212:Tretinoin",
"nlm_unique_id": "101160020",
"other_id": null,
"pages": "699-700",
"pmc": null,
"pmid": "28697223",
"pubdate": "2017-07-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Treatment of Annular Elastolytic Giant Cell Granuloma With Topical Tretinoin.",
"title_normalized": "treatment of annular elastolytic giant cell granuloma with topical tretinoin"
} | [
{
"companynumb": "US-BAUSCH-BL-2017-028681",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TRETINOIN"
},
"drugadditional": null,
... |
{
"abstract": "Efavirenz, a non-nucleoside reverse-transcriptase inhibitor (NNRTI) is one of the most commonly prescribed antiretroviral drugs. The present article provides a systematic overview and meta-analysis of clinical trials comparing efavirenz and other active drugs currently recommended for treatment of HIV-infected, antiretroviral-naive patients. Electronic databases (Pubmed, Embase, the Cochrane Library, Trip Database) were searched up till 23 December 2013 for randomized controlled clinical trials published as a peer-reviewed papers, and concerning efavirenz-based regimens used as initial treatment for HIV infection. Thirty-four studies were included in the systematic review, while twenty-six trials were suitable for the meta-analysis. Efavirenz was compared with drugs from four different classes: NNRTIs other than efavirenz (nevirapine or rilpivirine), integrase strand transfer inhibitors (InSTIs), ritonavir-boosted protease inhibitors (bPI) and chemokine (C-C motif) receptor 5 (CCR5) antagonists (maraviroc), all of them were added to the background regimen. Results of the current meta-analysis showed that efavirenz-based regimens were equally effective as other recommended regimens based on NNRTI, ritonavir-boosted PI or CCR5 antagonist in terms of efficacy outcomes (disease progression and/or death, plasma viral HIV RNA <50 copies/ml) while statistically significant more patients treated with InSTI achieved plasma viral load <50 copies/ml at week 48. In comparison with both InSTI-based and CCR5-based therapy, efavirenz-based treatment was associated with a higher risk of therapy discontinuation due to adverse events. However, comparisons of efevirenz-based treatment with InSTI-based and CCR5-based therapy were based on a limited number of trials, therefore, conclusions from these two comparisons must be confirmed in further reliable randomized controlled studies. Results of our meta-analysis support the present clinical guidelines for antiretroviral-naive, HIV-infected patients, in which efavirenz is one of the most preferred regimens in the analyzed population. Beneficial safety profile of InSTI-based and CCR5-based therapy over efavirenz-based treatment needs further studies.",
"affiliations": "Independent EBM expert, Kraków, Poland.;Drug Management Department, Institute of Public Health, Faculty of Health Sciences, Jagiellonian University, Krakow, Poland.;Department of Neurobiology, Institute of Pharmacology, Polish Academy of Sciences, Krakow, Poland.",
"authors": "Kryst|Joanna|J|;Kawalec|Paweł|P|;Pilc|Andrzej|A|",
"chemical_list": "D000480:Alkynes; D019380:Anti-HIV Agents; D048588:Benzoxazines; D003521:Cyclopropanes; D017320:HIV Protease Inhibitors; D019713:Receptors, CCR5; D018894:Reverse Transcriptase Inhibitors; C098320:efavirenz; D019438:Ritonavir",
"country": "United States",
"delete": false,
"doi": "10.1371/journal.pone.0124279",
"fulltext": "\n==== Front\nPLoS OnePLoS ONEplosplosonePLoS ONE1932-6203Public Library of Science San Francisco, CA USA 2593300410.1371/journal.pone.0124279PONE-D-14-37303Research ArticleEfavirenz-Based Regimens in Antiretroviral-Naive HIV-Infected Patients: A Systematic Review and Meta-Analysis of Randomized Controlled Trials Efavirenz in HIV-Infected ART-Naive PatientsKryst Joanna \n3\nKawalec Paweł \n1\n*Pilc Andrzej \n2\n\n1 \nDrug Management Department, Institute of Public Health, Faculty of Health Sciences, Jagiellonian University, Krakow, Poland\n\n2 \nDepartment of Neurobiology, Institute of Pharmacology, Polish Academy of Sciences, Krakow, Poland\n\n3 \nIndependent EBM expert, Kraków, Poland\nSluis-Cremer Nicolas Academic Editor\nUniversity of Pittsburgh, UNITED STATES\nCompeting Interests: The authors have declared that no competing interests exist.\n\nConceived and designed the experiments: PK JK. Performed the experiments: PK JK. Analyzed the data: JK PK. Contributed reagents/materials/analysis tools: PK JK. Wrote the paper: JK PK AP.\n\n* E-mail: pawel.kawalec@uj.edu.pl1 5 2015 2015 10 5 e012427921 9 2014 12 3 2015 © 2015 Kryst et al2015Kryst et alThis is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.Efavirenz, a non-nucleoside reverse-transcriptase inhibitor (NNRTI) is one of the most commonly prescribed antiretroviral drugs. The present article provides a systematic overview and meta-analysis of clinical trials comparing efavirenz and other active drugs currently recommended for treatment of HIV-infected, antiretroviral-naive patients. Electronic databases (Pubmed, Embase, the Cochrane Library, Trip Database) were searched up till 23 December 2013 for randomized controlled clinical trials published as a peer-reviewed papers, and concerning efavirenz-based regimens used as initial treatment for HIV infection. Thirty-four studies were included in the systematic review, while twenty-six trials were suitable for the meta-analysis. Efavirenz was compared with drugs from four different classes: NNRTIs other than efavirenz (nevirapine or rilpivirine), integrase strand transfer inhibitors (InSTIs), ritonavir-boosted protease inhibitors (bPI) and chemokine (C-C motif) receptor 5 (CCR5) antagonists (maraviroc), all of them were added to the background regimen. Results of the current meta-analysis showed that efavirenz-based regimens were equally effective as other recommended regimens based on NNRTI, ritonavir-boosted PI or CCR5 antagonist in terms of efficacy outcomes (disease progression and/or death, plasma viral HIV RNA <50 copies/ml) while statistically significant more patients treated with InSTI achieved plasma viral load <50 copies/ml at week 48. In comparison with both InSTI-based and CCR5-based therapy, efavirenz-based treatment was associated with a higher risk of therapy discontinuation due to adverse events. However, comparisons of efevirenz-based treatment with InSTI-based and CCR5-based therapy were based on a limited number of trials, therefore, conclusions from these two comparisons must be confirmed in further reliable randomized controlled studies. Results of our meta-analysis support the present clinical guidelines for antiretroviral-naive, HIV-infected patients, in which efavirenz is one of the most preferred regimens in the analyzed population. Beneficial safety profile of InSTI-based and CCR5-based therapy over efavirenz-based treatment needs further studies.\n\nThe payment for the article will be covered by sources of Institute of Pharmacology of Polish Academy of Sciences. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are included within the paper and the reference list.Data Availability\nAll relevant data are included within the paper and the reference list.\n==== Body\nIntroduction\nHighly-active antiretroviral therapy (HAART) with three or more antiretroviral drugs is nowadays a “gold standard” of HIV treatment. HAART has been shown to reduce morbidity and mortality in HIV-infected patients [1–2]. Results from recent studies show that about 80% of treatment-naive patients reached plasma HIV RNA level below detection limit after 48 weeks of HAART therapy (when intent-to-treat (ITT) approach was applied) [3–4]. Currently investigated treatment options concerning new classes of drugs, such as for example chemokine (C-C motif) receptor 5 (CCR5) antagonists and integrase inhibitors (InSTI) may improve efficacy outcomes in HIV-infected patients. Efavirenz belongs to the class of non-nucleoside reverse-transcriptase inhibitors (NNRTIs) and is one of the most commonly prescribed antiretroviral medications in the world [5]. The efficacy and safety of efavirenz were assessed in numerous head-to-head randomized controlled trials (RCTs). Its effectiveness in antiretroviral-naive and treatment-exposed HIV-infected patients was compared with various regimens (mostly PI-based), however there is still a lack of comprehensive review regarding comparison of efavirenz-based therapy with other, actually recommended regimens. Recent practice guidelines of initial treatment in HIV-infected patients, among preferred combinations of antiretroviral drugs mentioned two nucleoside reverse transcriptase inhibitors (NRTIs) plus either a non-nucleoside reverse-transcriptase inhibitor (NNRTI), ritonavir-boosted protease inhibitor (ritonavir-boosted PI) or integrase strand transfer inhibitor (InSTI) [6–8]. In some circumstances, a CCR5 antagonist in combination with two NRTIs are also recommended [6–7]. In the light of numerous trials regarding the use of efavirenz in HIV-infected, antiretroviral-naive patients, we performed systematic review and meta-analysis of randomized controlled trials in order to establish differences between efavirenz-based regimens and other regimens recommended by clinical experts to be used in HIV-infected patients previously untreated with antiretroviral therapy.\n\nMethods\nThis review was performed in accordance with the preferred reporting items for systematic reviews and meta-analyses (PRISMA) guidelines [9] and methods described in the Cochrane Handbook [10]. A systematic search of electronic databases and reference lists of all eligible studies published up till 23 December 2013 was conducted in order to identify all relevant studies. The search was conducted in the following databases: Medline via PubMed, EMBASE, the Cochrane Central Register of Controlled Trials (CENTRAL), and the Trip Database. The search strategy included MeSH and EMTREE terms combined the with boolean logical operators AND and OR (Table 1). The search results were restricted to clinical studies and methodological filters were used for the selection of randomized controlled trials (RCTs). No limits were applied for language of articles. The Cochrane Database of Systematic Reviews, PubMed and EMBASE databases were also searched for review articles. We included all randomized controlled trials published as a full text comparing efavirenz with any other, commonly used treatment schedule in adult HIV-infected patients without prior exposure to antiretroviral therapy (studies assessing placebo as a comparator were excluded). Data presented only at conference meetings in abstract form were not included in the systematic review and meta-analysis, as the reliability of such results is lower than published peer-reviewed references. We also excluded studies where efavirenz was admini\\\\stered to patients in every treatment arm, trials conducted only on children and infants and carried out in HIV-infected patients with other concurrent infectious illnesses, like hepatitis B, hepatitis C or tuberculosis. The following outcomes were assessed: (i) progression of disease or death, (ii) virological response to treatment, and (iii) safety profile (defined as risk of adverse events and discontinuation of the treatment due to adverse events).\n\n10.1371/journal.pone.0124279.t001Table 1 MeSH subject headings and EMTREE keywords used in search strategy construction (last updated: 23.12.2013).\nKeywords (combined with boolean logical operators: AND, OR)\t\nMedical condition\t(Viruses, Human Immunodeficiency) OR (AIDS Virus) OR (AIDS Viruses) OR (Virus, AIDS) OR (Viruses, AIDS) OR (HTLV-III) OR (Human Immunodeficiency Virus) OR (Human Immunodeficiency Viruses) OR (Human T Cell Lymphotropic Virus Type III) OR (Human T Lymphotropic Virus Type III) OR (Human T-Cell Leukemia Virus Type III) OR (Human T-Cell Leukemia Virus Type III) OR (Human T-Cell Lymphotropic Virus Type III) OR (Human T-Cell Lymphotropic Virus Type III) OR (Immunodeficiency Virus, Human) OR (Immunodeficiency Viruses, Human) OR (LAV-HTLV-III) OR (Lymphadenopathy-Associated Virus) OR (Lymphadenopathy-Associated Virus) OR (Lymphadenopathy-Associated Viruses) OR (Virus, Lymphadenopathy-Associated) OR (Viruses, Lymphadenopathy-Associated) OR (Virus, Human Immunodeficiency) OR (Acquired Immune Deficiency Syndrome Virus) OR (Acquired Immunodeficiency Syndrome Virus) OR (aids associated lentivirus) OR (aids associated retrovirus) OR (aids associated virus) OR (aids related virus) OR HIV OR (immunodeficiency associated virus) OR (immunodeficiency viruses primate) OR lav OR (LAV (AIDS)) OR (lentiviruses, primate) OR (lymphadenopathy associated retrovirus) OR (Lymphadenopathy associated virus) OR (virus, lymphadenopathy associated)\t\nIntervention\tEfavirenz OR EFV OR EFZ OR (efavirenz, (R)-isomer) OR Sustiva OR (L 743726) OR (L-743,726) OR (L-743726) OR (L 743,726) OR Stocrin OR (Merck Sharp and Dohme brand of efavirenz) OR (DMP 266) OR (DMP-266) OR (dmp266) OR efavir OR filginase OR l743726 OR (efavirenz, (S)-isomer) OR (virorrever)\t\nMethodological limits\tPubMed: Humans, Randomized Controlled Trial; EMBASE: Humans, Randomized Controlled Trial, Embase only; CENTRAL: No limits applied; word variations have been searched\t\nTwo reviewers (J.K., P.K.) performed an independent search and selection process. Disagreements were resolved by discussion, consensus, and arbitration by the third author (A.P.). Full texts of articles were reviewed according to the predefined inclusion or exclusion criteria. The second reviewer (P.K.) verified data extracted by the first author (J.K.). The following data were extracted: study design, characteristics of study participants, interventions, duration of treatment and clinical outcomes. We used Jadad scale [11] (which evaluates studies based on their description of randomization, blinding, and dropouts) to assess the methodological quality of the included studies (Table 2).\n\n10.1371/journal.pone.0124279.t002Table 2 Methodological quality of included RCTs.\nStudy (acronym if stated)\tJadad score\tAllocation concealment\t\n\t1\t2\t3\t4\t5\tTotal\t\t\n[15] Cohen 2011, THRIVE\t1\t0\t1\t1\t1\t4\tNot reported\t\n[16] Gaytán 2004\t1\t0\t0\t0\t0\t1\tNot reported\t\n[17] Gazzard 2011, [18] Nelson 2011, SENSE\t1\t0\t1\t1\t1\t4\tNot reported\t\n[19] Molina 2011, ECHO\t1\t0\t1\t1\t1\t4\tNot reported\t\n[20] Nunez 2002, SENC\t1\t0\t0\t0\t1\t2\tNot reported\t\n[21] Pozniak 2010, TMC278-C204\t1\t0\t0\t0\t1\t2\tNot reported\t\n[22] van den Berg-Wolf 2008, substudy of FIRST [23]\t1\t0\t0\t0\t0\t1\tNot reported\t\n[24] van Leth 2004, 2NN\t1\t0\t0\t0\t1\t2\tDescribed\t\n[25] Vernazza 2013, A5271015\t1\t0\t1\t0\t1\t3\tNot reported\t\n[26] Wester 2010, TSHEPO\t1\t0\t0\t0\t1\t2\tNot reported\t\n[28] Cohen 2011, GS-236-014\t1\t0\t1\t1\t1\t4\tNot reported\t\n[\n29\n] Lennox 2009, [30] Lennox 2010, STARTMRK\t1\t0\t1\t1\t1\t4\tDescribed\t\n[31] Markowitz 2007, [32] Markowitz 2009, Protocol 004\t1\t0\t1\t1\t1\t4\tNot reported\t\n[33] Sax 2012, [34] Zolopa 2013, GS-US-236-0102\t1\t0\t1\t1\t1\t4\tDescribed\t\n[35] van Lunzen 2012, [36] Stellbrink 2013,SPRING-1\t1\t0\t0\t0\t1\t2\tNot reported\t\n[37] Walmsley 2013, SINGLE\t1\t0\t1\t1\t1\t4\tNot reported\t\n[38] Albini 2012\t1\t0\t0\t0\t1\t2\tNot reported\t\n[39] Bartlett 2006, CLASS\t1\t0\t0\t0\t1\t2\tNot reported\t\n[40] Cameron 2008, M03-613\t1\t0\t0\t0\t1\t2\tNot reported\t\n[41] Daar 2011, A5202\t1\t0\t0\t0\t1\t2\tDescribed\t\n[42] Echeverría 2010, LAKE\t1\t0\t0\t0\t1\t2\tNot reported\t\n[43] Honda 2011\t1\t0\t0\t0\t1\t2\tNot reported\t\n[44] Josephson 2010, [45] Edén 2010, [46] Andersson 2013, NORTHIV\t1\t0\t0\t0\t1\t2\tNot reported\t\n[47] Kumar 2013, SUPPORT\t1\t0\t0\t0\t1\t2\tNot reported\t\n[48] Mallolas 2008, TRIZEFAL\t1\t0\t0\t0\t1\t2\tNot reported\t\n[49] Miró 2010, ADVANZ\t1\t0\t0\t0\t1\t2\tNot reported\t\n[50] Puls 2010, ALTAIR\t1\t0\t0\t0\t1\t2\tNot reported\t\n[51] Ratsela 2010, PHISIDA II\t1\t0\t0\t0\t1\t2\tNot reported\t\n[52] Riddler 2008, A5142\t1\t0\t0\t0\t1\t2\tNot reported\t\n[53] Sierra-Madero 2010\t1\t0\t0\t0\t1\t2\tNot reported\t\n[54] Torti 2005,[55] Torti 2008\t1\t0\t0\t0\t1\t2\tNot reported\t\n[56] Copper 2010, [57] Sierra-Madero 2010, MERIT\t1\t0\t1\t0\t1\t3\tNot reported\t\n[58] Currier 2008, ASCENT\t1\t0\t0\t0\t1\t2\tNot reported\t\n[59] Landovitz 2008\t1\t0\t1\t0\t1\t3\tNot reported\t\n\n1—Was the study described as randomized?\n\n\n2—Was the method of randomization described and appropriate?\n\n\n3—Was the study described as double blind?\n\n\n4—Was the method of blinding described and appropriate?\n\n\n5—Were withdrawals and dropouts described?\n\nReduction of Risk Ratio (RR) was obtained for data showing the benefit of treatment, while for negative endpoints, the increase in RR was assessed, all with 95% confidence intervals (CI). The results obtained from separate trials were combined using appropriate meta-analysis methods. If possible, data from intention-to-treat (ITT) analyses, which assessed patients according to their assigned treatment group were extracted. An inverse variance and the Mantel-Haenszel or DerSimonian-Laird methods were used in dependence on the data input and heterogeneity of test results. The clinical heterogeneity was assessed by examining the characteristics of the studies, whereas the statistical heterogeneity was assessed using the Chi-square test, with a significance level p<0.10. A fixed effects model was used when no statistical heterogeneity was detected, otherwise the random effects model was used. Meta-analysis was performed with RevMan V 5.2 software.\n\nResults\nThe electronic searches yielded 766 items after duplicates were removed. The selection of titles and abstracts resulted in 107 potentially relevant articles, of which 64 references were excluded due to the reasons presented in Fig 1. Finally 34 studies described in 44 references met the predefined inclusion criteria. Twenty-six RCTs were suitable for quantitative synthesis (meta-analysis). The flow of information through the different phases of the systematic review is shown in Fig 1.\n\n10.1371/journal.pone.0124279.g001Fig 1 PRISMA flow diagram for selection of studies identified in the systematic review.\nThirty-four randomized controlled trials published in English as peer-reviewed articles were included. These included studies were grouped in the following way. Firstly, background regimen, common in compared groups, was identified. Active drugs added to the common background regimen were considered as comparators. Two different regimens adequate for comparisons with efavirenz were identified: NNRTI (non-nucleoside reverse transcriptase inhibitor), InSTI (integrase strand transfer inhibitor), bPI (ritonavir-boosted protease inhibitor), and CCR5 (CC chemokine receptor type 5), all added to the specified background regimens. We did not take into consideration regimens containing unboosted PI and triple NRTIs regimens as they are no longer used in the clinical practice.\n\nThe predefined inclusion criteria for studies included the absence of any prior treatment with antiretroviral therapy, however finally, trials recruiting patients with limited previous exposure to antiretroviral therapy were included (Table 3). Both patient-important endpoints (AIDS disease progression and/or death) and surrogate endpoints (virological response measured with plasma HIV RNA level, pVL) were extracted from the studies. Plasma viral load (pVL) is a globally accepted endpoint used to measure the efficacy of antiretroviral drugs [12]. In the included studies, the virological response was defined as plasma HIV RNA level below 400 and below 50 copies/ml. We assessed only the pVL<50 copies/ml, as the suppression of pVL to 50 copies/ml is a better predictor for durable virological success than a suppression to <400–500 copies/ml [13–14]. For safety analysis an overall risk of grade 3/4 adverse events was assessed when it was possible; otherwise clinical adverse events data were included. We also evaluated the risk of discontinuation of assigned treatment due to treatment toxicity.\n\n10.1371/journal.pone.0124279.t003Table 3 Characteristics of the randomized controlled trials for efavirenz compared to different regimens used to treat antiretroviral–naive HIV-infected adult patients.\nStudy author, year of publication, study type, sites\tPopulation\tStudy duration\tInterventions*\n\t\nbackground regimen (2 NRTIs/2 NRTIs+1 PI) + efavirenz vs background regimen + NNRTI\t\n[15] Cohen 2011, THRIVE, RCT, double-blind, double-dummy, 98 centers in 21 countries (United States and Puerto Rico, Canada, Australia, Europe, South Africa, Asia, Latin America)\tART-naive, age ≥18 years, pVL >5 000 copies/ml\t96 weeks\tA: 2 NRTI + EFV, N = 340; B: 2 NRTI + RPV, N = 340; (2 NRTI included: TDF + FTC or AZT + 3TC or ABC + 3TC)\t\n[16] Gaytán 2004, RCT, open-label, 1 center in Mexico\tART-naive, age ≥18 years, pVL >55 000 copies/ml\t48 weeks\tA: AZT + 3TC + EFV, N = 30; B: AZT + 3TC + NVP, N = 28\t\n[17] Gazzard 2011, [18] Nelson 2011, SENSE, RCT, double-blind, centers in Europe, Russia and Israel\tART-naive, pVL>5 000 copies/ml\t48 weeks\tA: 2 NRTI + EFV, N = 78; B: 2 NRTI + ETV, N = 79; (2 NRTI included: TDF + FTC or AZT + 3TC or ABC + 3TC)\t\n[19] Molina 2011, ECHO, RCT, double-blind, double-dummy, 112 centers in 21 countries (United States, Canada, Australia, South Africa, Europe, Asia, Latin America)\tART-naive, age ≥18 years, pVL>5 000 copies/ml\t96 weeks\tA: TDF + FTC + EFV, N = 348; B: TDF + FTC + RPV, N = 346\t\n[20] Núñez 2002, SENC, RCT, open-label, 1 center in Spain\tART-naive, age > 18 years, pVL: 500–100 000 copies/ml\t48 weeks\tA: ddI + d4T + EFV, N = 31; B: ddI + d4T + NVP, N = 36\t\n[21] Pozniak 2010, TMC278-C204, RCT, open-label, 54 centers in 14 countries (Asia, South Africa, Uganda, Europe, United States, Russia, Puerto Rico, Latin America)\tART-naive, age ≥18 years (≤2 weeks treatment with NRTI and/or PI was allowed), pVL >5 000 copies/ml\t96 weeks\tA: 2 NRTI + EFV, N = 89; B: 2 NRTI + RPV, N = 279 (25 mg N = 93, 75 mg N = 95, 150 mg N = 91); (2 NRTI included: TDF + FTC or AZT + 3TC)\t\n[22] van den Berg-Wolf 2008, NNRTI substudy of FIRST trial [23], RCT, open-label, 17 clinical trials units at 80 sites in the United States\tART-naive (less than 4 weeks of prior NRTI use or 1 week of 3TC use was allowed), age ≥13 years\tmedian—5 years\tpatients randomized to NNRTI+NRTIs strategy (N = 110) or PI+NNRTI+NRTIs strategy (118) and then randomized to: A: EFV, N = 111; B: NVP, N = 117 (NRTIs included: ABC + 3TC or ddI + d4T or AZT + 3TC or d4T + 3TC; PI included: NFV, INV, /r\t\n[24] van Leth 2004, 2NN, RCT, open-label, centers in North and South America, Australia, Europe, South Africa and Thailand\tART-naive, age ≥16 years, pVL >5 000 copies/ml\t48 weeks\tA: d4T+ 3TC+ EFV, N = 400; B: d4T + 3TC + NVP (400 mg once daily), N = 220; C: d4T + 3TC + NVP (200 mg twice daily), N = 387\t\n[25] Vernazza 2013, A5271015, RCT, double-blind, centers in Argentina, Australia, Canada, Italy, Mexico, Poland, South Africa, Switzerland and the United Kingdom\tART-naive (less than 14 days of prior ART was allowed), age ≥18 years, pVL ≥1 000 copies/ml\t96 weeks\tA: TDF + FTC + EFV, N = 63; B: TDF + FTC + LRV (500 mg), N = 66; C: TDF + FTC + LRV (750 mg), N = 66\t\n[26] Wester 2010, TSHEPO, RCT, open-label, one center in Botswana\tART-naive, age ≥ 18 years, pVL >55 000 copies/ml\t3 years\tA: 2 NRTI + EFV, N = 325; B: 2 NRTI + NVP, N = 325; (2 NRTI included: AZT + 3TC or AZT + ddI or d4T + 3TC)\t\nbackground regimen (2 NRTIs) + efavirenz vs background regimen + InSTI\t\n[28] Cohen 2011, GS-236-014, RCT, double-blinded, double-dummy, mulit-center (centers not described)\tART-naive, age ≥18 years, pVL ≥5 000 copies/ml\t48 weeks\tA: FTC + TDF + EFV, N = 23; B: FTC + TDF + EVG + COBI, N = 48\t\n[29] Lennox 2009, [30] Lennox 2010, STARTMRK, RCT, double-blind, 67 study centers in Australia, Brazil, Canada, Chile, Colombia, France, Germany, India, Italy, Mexico, Peru, Spain, Thailand, and United States\tART-naive, age ≥18 years, pVL >5 000 copies/ml\t96 weeks\tA:TDF + FTC + EFV, N = 284; B: TDF + FTC + RAL, N = 282\t\n[31] Markowitz 2007, [32] Markowitz 2009, Protocol 004 part II, RCT, double-blinded, 29 centers in United States, Canada, Latin America, Thailand, and Australia\tART-naive (less than 7 days of ART was permitted), 30 patients received 10 days of RAL in monotherapy as a first part of the study**), age ≥18 years, pVL ≥5 000 copies/ml\t96 weeks\tA: TDF + 3TC + EFV, N = 39; B: TDF + 3TC + RAL (100 mg bid N = 41, 200 mg bid N = 40, 400 mg bid N = 41, 600 mg bid N = 40)\t\n[33] Sax 2012, [34] Zolopa 2013, GS-US-236-0102, RCT, double-blinded, centers in North America\tART-naive, age ≥18 years, pVL ≥5 000 copies/ml\t96 weeks\tA: FTC + TDF + EFV, N = 354; B: FTC + TDF + EVG + COBI, N = 353\t\n[35] van Lunzen 2012, [36] Stellbrink 2013, SPRING-1, RCT, open-label (only dose but not drug allocation was masked), 34 sites in France, Germany, Italy, Russia, Spain, and the United States\tART-naive (up to 10 days of ART was permitted), age ≥18 years, pVL>1 000 copies/ml\t96 weeks\tA: 2 NRTI + EFV, N = 50; B: 2 NRTI + DTG (10 mg N = 53, 25 mg N = 51, 50 mg N = 51); (2 NRTI included: TDF + FTC or ABC + 3TC)\t\n[37] Walmsley 2013, SINGLE, RCT, double-blind, centers in North America, Europe, and Australia\tART-naive, age ≥18 years, pVL ≥1 000 copies/ml\t48 weeks\tA: TDF + FTC + EFV, N = 419; B: ABC + 3TC + DTG, N = 414\t\nbackground regimen (2 or 3 NRTIs) + efavirenz vs background regimen + bPI\t\n[38] Albini 2012, RCT, open-label, 4 centers in Italy\tART-naive, age ≥18 years\t48 weeks\tA: TDF + FTC + EFV, N = 43; B: TDF + FTC + ATV/r, N = 48\t\n[39] Bartlett 2006, CLASS, RCT, open-label, centers in United States\tART-naive (less than 2 weeks of prior ART), pVL ≥5 000 copies/ml\t96 weeks\tA: ABC + 3TC + EFV, N = 97; B: ABC + 3TC + APV/r, N = 96\t\n[40] Cameron 2008, M03-613, RCT, open-label, centers in Canada, United States and Spain\tART-naive, pVL >1 000 copies/ml\t96 weeks\tA: AZT + 3TC + EFV, N = 51; B: AZT + 3TC + LPV/r, N = 104\t\n[41] Daar 2011, A5202, RCT, open-label (only NRTI treatment was blinded), 59 centers in the United States and Puerto Rico\tART-naive (up to 7 days of ART was allowed), age ≥16 years\tmedian—138 weeks\tA: 2 NRTI + EFV, N = 929; B: 2 NRTI + ATV/r, N = 928; 2 NRTI included: ABC + 3TC or TDF + FTC***\n\t\n[42] Echeverría 2010, LAKE, RCT, open-label, 19 centers in Spain and Italy\tART-naive, age ≥18 years\t48 weeks\tA: ABC + 3TC + EFV, N = 63; B: ABC + 3TC + LPV/r, N = 63\t\n[43] Honda 2011, RCT, open-label, 1 center in Japan\tART-naive, CD4+ T lymphocyte 100–300 cell/mm3, men only\t96 weeks\tA: 3TC + ABC + EFV, N = 36; B: 3TC + ABC + ATV/r, N = 35\t\n[44] Josephson 2010, [45] Edén 2010, [46] Andersson 2013, NORTHIV, RCT, open-label, centers in Sweden and Norway\tART-naive, age ≥16 years\t144 weeks\tA: 2 NRTI + EFV, N = 78 [46]; B: 2 NRTI + ATV/r, N = 82 [46]; C: 2 NRTI + LPV/r, N = 83 [46]; 2 NRTI included: ABC + 3TC or TDF + FTC OR AZT + 3TC or others\t\n[47] Kumar 2013, SUPPORT, RCT, open-label, centers in United States\tART-naive (≤14 days of treatment with any ART), pVL >5 000 copies/ml\t96 weeks\tA: ABC + 3TC + EFV, N = 50; B: ABC + 3TC + FPV/r, N = 51\t\n[47] Mallolas 2008, TRIZEFAL, RCT, open-label, 18 centers in Spain\tART-naive, pVL >10 000 copies/ml\t72 weeks\tA: ABC + 3TC + AZT + EFV, N = 109 (N = 104 were analyzed); B: ABC + 3TC + AZT + LPV/r, N = 111 (N = 105 were analyzed)\t\n[49] Miró 2010, ADVANZ, RCT, open-label, 6 centers in Spain\tART-naive, age ≥18 years, CD4+ T lymphocyte <100 cells/μl\t36 months\tA: AZT + 3TC + EFV, N = 35; B: AZT + 3TC + IDV/r, N = 35\t\n[50] Puls 2010, ALTAIR, RCT, open-label, 36 centers in Australia, Thailand, Argentina, France, Singapore and United Kingdom\tART-naive, age >18 years, pVL >2 000 copies/ml\t48 weeks\tA: TDF + FTC + EFV, N = 115; B: TDF + FTC + ATV/r, N = 107\t\n[51] Ratsela 2010, PHISIDA II, RCT, open-label, 6 centers in the Republic of South Africa\tART-naive (less than 7 days of ART was allowed), age ≥14 years, CD4+ T lymphocyte <200 cell counts\tmedian 24.7 months\tA: 2 NRTI + EFV, N = 888; B: 2 NRTI + LPV/r, N = 883; 2 NRTI included: AZT + ddI or d4T + 3TC\t\n[52] Riddler 2008, A5142, RCT, open-label, centers in United States, centre in Dublin and Durban\tART-naive, age ≥13 years, pVL ≥2 000 copies/ml\t96 weeks\tA: 2 NRTI + EFV, N = 250; B: 2 NRTI + LPV/r, N = 253; (2 NRTI included: 3TC and: AZT or d4T or TDF)\t\n[53] Sierra-Madero 2010, RCT, open-label, 10 centers in Mexico\tART-naive, age ≥18 years, pVL ≥1 000 copies/ml\t48 weeks\tA: AZT + 3TC + EFV, N = 95; B: AZT + 3TC + LPV/r, N = 94\t\n[54] Torti 2005,[55] Torti 2008, substudy of SISTHER, RCT, open-label, 1 center in Italy\tART-naive, pVL ≥1 000 copies/ml\t52 weeks\tA: TDF + 3TC + EFV, N = 37 [55], N = 10 [54]; B: AZT + 3TC + LPV/r, N = 27[55], N = 9 [54]; C: TDF + ddI + EFV#, N = 11 [54]\t\nbackground regimen (2 NRTIs) + efavirenz vs background regimen + CCR5\t\n[56] Copper 2010, [57] Sierra-Madero 2010, MERIT, RCT, double-blinded, double-dummy, centers in North and South America, Europe, South Africa, and Australia\tART-naive, age ≥16 years, pVL ≥2 000 copies/ml\t96 weeks##\n\tA: AZT + 3TC + EFV, N = 361; B: AZT + 3TC + MVC, N-360\t\n[58] Currier 2008, ASCENT, RCT, partially double-blinded, 33 centers in United States, 4 in Canada and 24 in European Union\tART-naive, age ≥13 years, pVL ≥10 000 copies/ml,\t96 weeks###\n\tA: 3TC + AZT + EFV, N = 29; B: 3TC + AZT + APL (600 mg N = 58, 800 mg N = 58)\t\n[59] Landovitz 2008, RCT, double-blinded (centers not described)\tART-naive (less than 2 weeks of ART was allowed, patients in VCV arm received VCV for 14 days in monotherapy), age ≥18 years, pVL ≥5 000 copies/ml\t48 weeks\tA: AZT + 3TC + EFV, N = 24; B: AZT + 3TC + VCV, N = 68 (all doses combined)\t\n3TC—lamivudine, ABC—abacavir, APL—aplaviroc, APV—amprenavir, ART—antiretroviral therapy, ATV—atazanavir, AZT—zidovudine, bid—twice a day, bPI—ritonavir-boosted protease inhibitor, CCR5—CC chemokine receptor type 5, COBI—cobicistat, d4T - stavudine, ddC—zalcitabine, ddI—didanosine, DTG—dolutegravir, EFV—efavirenz, ETV—etravirine, EVG—elvitegravir, FPV—fosamprenavir, FTC—emtricitabine, IDV—indinavir, MVC—maraviroc, LPV—lopinavir, LRV—lersivirine, NFV—nelfinavir, NNRTI—non-nucleoside reverse transcriptase inhibitor, NRTI—nucleoside reverse transcriptase inhibitor, NVP—nevirapine, PI—protease inhibitor, r—ritonavir, RAL—raltegravir, RCT—randomized controlled trial, RPV—rilpivirine, SQV—saquinavir, TDF—tenofovir, pVL—plasma HIV RNA, VCV—vicriviroc.\n\n* interventions included in meta-analysis only.\n\n**raltegravir monotherapy did not influenced the efficacy results, so both groups (pretreated and not pretreated with raltegravir were combined).\n\n***results for groups assigned EFV + different NRTIs and separately ATV/r + different NRTIs were combined.\n\n#enrolment in the TDF + ddI + EFV arm was stopped as soon as the high rate of virological failure was recognized.\n\n##once-daily MVC arm was discontinued prematurely and not analyzed.\n\n###stopped prematurely due to unexpected hepatotoxicity.\n\nThe characteristics of the included studies are presented in Table 3. Eleven studies were double-blind. Only four of the included studies provided information about allocation concealment. Most of the trials reported data about patient withdrawals and drop-outs from the study. Jadad scores ranged from 1 to 4, mostly due to a lack of blinding and insufficient data about randomization methods used (Table 2).\n\nEffectiveness of adding efavirenz vs non-nucleoside reverse transcriptase inhibitor (NNRTI) to the background regimen\nTen studies were suitable for inclusion in the comparison of efavirenz vs. other NNRTI added to the background regimen: THRIVE [15], Gaytán [16], SENSE [17–18], ECHO [19], SENC [20], TMC278-C204 [21], NNRTI substudy [22] of the FIRST trial [23], 2NN [24], A5271015 [25], TSHEPO [26]. Nevirapine was used as a comparator in five studies [16,20,22,24,26], rilpivirine in three studies [15,19,21], while one study accessed etravirine [17–18], and one study included lersivirine as a comparator [25]. Data from SENSE trial [17–18] were excluded from meta-analysis because etravirine, according to the current guidelines, is not recommended as an initial therapy in HIV-infected patients, due to the insufficient data in antiretroviral-naive patients [6]. We also did not include results of A5271015 [25] study, because the clinical development of lersivirine for the treatment of HIV infection was discontinued in February 2013. With regard to TSHEPO [26] study, it was not possible to meta-analyze the outcomes due to their inconsistency with other trials. In FIRST substudy [22] and TMC278-C204 study [21], previous limited exposure to antiretroviral therapy was permitted (Table 3). In nevirapine studies, three of them evaluated patients during the course of 48 weeks while in two trials the follow-up period lasted 3 to 5 years (median). In all three studies, where rilpivirine was given to HIV-infected patients the follow-up period lasted 96 weeks. Studies were heterogeneous regarding baseline plasma HIV RNA level (>500 to >55 000 copies/ml). In two trials (Gaytán [16] and FIRST substudy [22]) it was unclear whether the efficacy results were obtained in ITT (intention-to-treat) population. Data for nevirapine given at different doses in two arms in the 2NN study [24] were aggregated. TMC278-C204 study [21] assessed rilpivirine at three doses: 25, 75 and 150 mg, however, data concerning only 25 mg dose were used in the meta-analysis, according to product characteristics [27]. No statistically significant differences between efavirenz and other NNRTI were observed when the primary efficacy endpoint—death was analyzed (RR = 1.06; 95% CI: 0.66–1.68; p>0.05), or composite outcome—disease progression or death was evaluated (RR = 1.28; 95% CI: 0.86–1.90; p>0.05). There were no statistically significant differences between analyzed groups in the proportion of patients with virological response at weeks 48–52 (plasma viral loads below 50 copies/ml: RR = 1.00; 95% CI: 0.96–1.04; p>0.05). Results of meta-analysis showed that the risk of discontinuation of assigned treatment due to intolerance was comparable in both arms, without statistically significant differences (RR = 1.01; 95% CI: 0.82–1.24; p>0.05), Fig 2. It should be noticed that although data from SENSE trial [17–18] were excluded from the above comparisons, we also tested whether inclusion of the data from this trial can change the cumulative effect. We found similar results on efficacy and safety based on cumulative data, regardless of the inclusion results from SENSE trial (data not shown).\n\n10.1371/journal.pone.0124279.g002Fig 2 Forest plot of comparison: efavirenz vs other NNRTI added to the background regimen.\nEffectiveness of adding efavirenz vs integrase strand transfer inhibitor (InSTI) added to the background regimen\nSix trials were included in the comparison between efavirenz and integrase strand transfer inhibitors added to the background regimen in the treatment of HIV-infected antiretroviral-naive patients: GS-236-014 [28], STARTMRK [29–30], Protocol 004 part II [31–32], GS-US-236-0102 [33–34], SPRING-1 [35–36] and SINGLE [37]. In the two trials, raltegravir was used as an InSTI [29–32], in the next two trials, elvitegravir in combination with cobicistat (a potent CYP 3A inhibitor that increases concentration of elvitegravir, and has no antiviral activity itself) were applied [28], [33–34], two studies assessed dolutegravir as an InSTI [35–37]. Results of Protocol 004 part II, STARTMRK, GS-US-236-0102 and SPRING-1 were reported separately for 48-week and 96-week follow-up period. Previous limited exposure to HAART was permitted in two trials: Protocol 004 part II [31–32], and SPRING-1 [35–36]. Four trials provided 96-week results: Protocol 004 part II, STARTMRK, GS-US-236-0102 and SPRING-1, while two studies comprised data only for 48 weeks of treatment: GS-236-014, and SINGLE. Most studies included patients with plasma viral load baseline of more than 5 000 copies/ml (only SPRING-1 [35–36] and SINGLE [37] study included patients with pVL>1 000 copies/ml). Protocol 004 part II [31–32] study assessed four different doses of raltegravir, however while only 400 mg of raltegravir twice a day is consistent with product characteristics, data for this dosage was included in the meta-analysis. After 48-weeks of treatment in Protocol 004 part II, raltegravir arms were combined and all group of patients were given 400 mg twice a day of raltegravir, therefore, data for 96 weeks were shown for all patients initially assigned raltegravir irrespective of the initial dose. Data for discontinuation of treatment due to clinical and laboratory adverse events from Protocol 004 part II study were combined [32]. SPRING-1 trial assessed three different doses of dolutegravir, however, since the study findings showed that 50 mg dolutegravir once daily is the most appropriate dose, data only for this dose were included in meta-analysis. Results of the present meta-analysis showed no statistically significant differences between efavirenz vs. integrase strand transfer inhibitor added to the background regimen for the following outcomes: death (RR = 1.24; 95% CI: 0.33–4.61; p>0.05) and proportion of patients with pVL<50 copies/ml at week 96 (RR = 1.04; 95% CI: 0.99–1.09; p>0.05). Statistically significant more patients treated with integrase strand transfer inhibitor achieved plasma viral load <50 copies/ml at week 48 (RR = 1.06; 95% CI: 1.03–1.10; p<0.05), while in terms of toxicity higher risk of discontinuation of therapy due to adverse events was reported when an efavirenz-based regimens were used (RR = 2.30; 95% CI: 1.60–3.31; p<0.05), Fig 3.\n\n10.1371/journal.pone.0124279.g003Fig 3 Forest plot of comparison: efavirenz vs InSTI added to the background regimen.\nEffectiveness of adding efavirenz vs ritonavir-boosted protease inhibitor (bPI) to the background regimen\nFifteen studies were included in the comparison of efavirenz vs ritonavir-boosted protease inhibitor (bPI) added to the background regimen: Albini 2012 [38], CLASS [39], M03-613 [40], A5202 [41], LAKE [42], Honda 2011 [43], NORTHIV [44–46], SUPPORT [47], TRIZEFAL [48], ADVANZ [49], ALTAIR [50], PHISIDA II [51], A5142 [52], Sierra-Madero 2010 [53], substudy of SISTHER [54–55]. Lopinavir and atazanavir were used as protease inhibitors in eight and five trials, respectively, while amprenavir, indinavir and fosamprenavir were used in single studies, all of them were ritonavir-boosted. Six trials lasted 48–52 weeks, but the follow-ups of the remaining studies were longer (up to 36 months). Four studies additionally included patients with a limited previous exposure to HAART therapy (PHISIDA II [50], A5202 [41], CLASS [39], and SUPPORT [46]). Studies were heterogeneous in regard to the baseline plasma HIV RNA level (>1000 to >10 000 copies/ml), although, in many studies baseline plasma viral load was not a criterion of patient’s inclusion. In Albini 2012 study, the changes of GFR (glomerular filtration rate) during therapy were the primary endpoint [38]. With regard to TRIZEFAL [48] study, it was not possible to meta-analyze the efficacy outcomes due to their inconsistency with other trials, likewise in the substudy of SISTHER trial where plasma viral load was measured only at week 28 [54–55]. In the M03-613 study [40], after 24 weeks of combined therapy with 2 NRTI and lopinavir/ritonavir, the nucleoside reverse transcriptase inhibitor backbone was discontinued. That means 48-week results reflected a comparison of 2 NRTI+efavirenz and two-drug regimen of lopinavir/ritonavir without NRTI background and therefore, data from M03-613 trial [40] were not sufficiently homogeneous for inclusion in the current meta-analysis. The A5202 study did not provide information about the total number of patients in separate groups in whom measurement of pVL<50 copies/ml was performed at week 48 and 96, thus inclusion of this data in the current meta-analysis was not possible [41]. In NORTHIV trial, the results of the study were combined from both PI-based regimens [44–46]. No statistically significant differences between efavirenz and PI-based regimen were observed when the primary efficacy endpoints were analyzed: death (RR = 1.05; 95% CI: 0.84–1.32; p>0.05) and disease progression defined in three studies as an occurrence of AIDS-defining events (RR = 1.18; 95% CI: 0.88–1.58; p>0.05). There were also no statistically significant differences between the analyzed groups (efavirenz vs. ritonavir-boosted PI, both added to the background therapy) in the proportion of patients with plasma viral loads below 50 copies/ml at weeks 48–52 (RR = 0.94; 95% CI: 0.86–1.04; p>0.05) and at weeks 96–104 (RR = 0.98; 95% CI: 0.80–1.19; p>0.05), Fig 4.\n\n10.1371/journal.pone.0124279.g004Fig 4 Forest plot of comparison: efavirenz vs ritonavir-boosted PI (bPI) added to the background regimen-efficacy data.\nResults of meta-analysis showed that the risk of discontinuation of treatment due to its intolerance was comparable for both arms, without statistically significant differences (RR = 1.16; 95% CI: 0.87–1.55; p>0.05), and the risk of grade 3/4 adverse events was similar in both groups (RR = 0.85; 95% CI: 0.57–1.25; p>0.05), Fig 5.\n\n10.1371/journal.pone.0124279.g005Fig 5 Forest plot of comparison: efavirenz vs ritonavir-boosted PI (bPI) added to the background regimen-safety data.\nEffectiveness of adding efavirenz vs CC chemokine receptor type 5 (CCR5) antagonist added to the background regimen\nThree trials were included in the comparison of efavirenz vs. CCR5 antagonists, both added to the background regimen in the treatment of HIV-infected antiretroviral-naive patients: MERIT [56–57], ASCENT [58], Landovitz 2008 [59]. Three different CCR5 antagonists were assessed in the above studies: maraviroc [56–57], aplaviroc [58] and vicriviroc [59]. Since clinical studies investigating aplaviroc were discontinued due to cases of hepatoxicity identified during phase II and III studies (including ASCENT study) [60] and currently this agent is not authorized for marketing in the United States and the European Union, results of ASCENT study were excluded from the present analysis. Unfortunately, it was not possible to meta-analyze the results of MERIT [56–57] and Landovitz 2008 [59] trials due to inconsistent efficacy and safety outcomes measured in the above-mentioned studies. It should be noted that results of the Landovitz 2008 study [59] showed higher rates of virologic failure in vicriviroc groups (25 mg and 50 mg once a day) compared with efavirenz group, suggesting that higher doses of vicriviroc should be investigated in the future clinical trials. Results from MERIT study were described in two references where data for 48-week and 96-week follow-up periods were reported [56–57]. Results for 96-week follow-up were assessed post-hoc in population of 614 patients with CCR5-tropic (R5) HIV-1 that was confirmed with greater sensitivity assay that during randomization [57]. Results of the present analysis (based on MERIT study results, data not shown) revealed no statistically significant differences between efavirenz and maraviroc added to the 2 NRTI for the clinical outcomes: death (RR = 1.00; 95% CI: 0.06–15.88; p>0.05) and disease progression defined as an occurrence of C category events indicating a development of AIDS (RR = 1.99; 95% CI: 0.76–5.26; p>0.05) at week 48. Likewise, risk of death in the two treatment arms did not differ statistically for 96-week follow-up period (RR = 1.50; 95% CI: 0.25–8.90; p>0.05). No statistically significant differences were observed between efavirenz and maraviroc in regard to virological outcomes: plasma viral load below 50 copies/ml at week 48 (RR = 0.94; 95% CI: 0.85–1.04; p>0.05) and at week 96 (RR = 0.94; 95% CI: 0.83–1.07; p>0.05). Comparison of efavirenz and CCR5 antagonist in terms of toxicity showed no statistically significant differences between the analyzed regimens in the risk of grade 3/4 adverse events at week 48 (RR = 1.23; 95% CI: 0.94–1.61; p>0.05) and at week 96 (RR = 1.16; 95% CI: 0.91–1.47; p>0.05), however, a significantly higher risk of discontinuation of therapy due to adverse events was observed during treatment with efavirenz-based regimen (RR = 3.26; 95% CI: 1.86–5.70; p<0.05), which was confirmed for both 48 and 96-week follow-up periods.\n\nDiscussion\nThe choice of the first-line therapy (initial therapy) is determined by various considerations, which include severity of infection, drug tolerability, presence of drug-resistant mutations in non-treated populations, pregnancy or availability of drugs. The cost of therapy is also an important factor, especially in low-resource countries [61]. Difficulties in finding the optimal treatment option for HIV-infected patients which would provide optimal efficacy, durability of antiretroviral activity, tolerability and convenient dosing schedule are reflected by numerous antiretroviral regimens evaluated in clinical trials. Among the initial regimens, the most preferred by clinical experts is a backbone combination of two NRTIs—tenofovir disoproxil fumarate and emtricitabine plus an active drug from one of the following classes: NNRTI (efavirenz), PI (ritonavir-boosted atazanavir, ritonavir-boosted darunavir) or InSTI (raltegravir, dolutegravir) [6–8]. The recommended alternative regimens consist of active drugs which represent the following classes: NNRTI (rilpivirine and nevirapine), PI (fosamprenavir/ritonavir, lopinavir/ritonavir), InSTI (elvitegravir/cobicistat) and CCR5 antagonist (maraviroc) [6–8].\n\nEfavirenz is one of the most commonly used antiretroviral drugs and is one of the preferred treatment options for HIV-infected antiretroviral-naive (ART-naive) patients [62]. To our knowledge this is the first such a broad systematic review containing meta-analysis comparing efavirenz-based therapy with other currently recommended antiretroviral regimens used to treat antiretroviral-naive HIV-infected adult patients. Our report is also the most recent systematic review regarding efavirenz-based regimens evaluated in randomized controlled trials conducted in population of HIV-infected patients previously untreated with antiretroviral therapy.\n\nAccording to the current guidelines for the use of antiretroviral agents during the initial therapy of HIV-infected patients, comparisons were made between efavirenz and drugs from 4 different classes: NNRTI (other than efavirenz), ritonavir-boosted PI (bPI), InSTI and CCR5, all of them added to the backbone regimen. Our meta-analysis demonstrated that efficacy of all regimens based on the above-mentioned drugs were comparable, the analysis did not show any differences in terms of clinical endpoints (death or disease progression usually defined as an occurrence of AIDS-defining events). In terms of virological response (decline in plasma viral load to the predefined levels at week 48) only comparison of efavirenz vs. InSTI showed a statistically significant difference favoring integrase strand transfer inhibitor while in other analysis differences were not statistically significant. The results of the individual studies included in our comparison of efavirenz vs. integrase strand transfer inhibitors showed a trend toward a better effect of InSTI on virological response at week 48. Above effect in the individual studies was not statistically significant probably due to the small number of patients (studies: GS-236-014 [28], SPRING-1 [35–36], Protocol 004 part II [31–32]) while results of SINGLE [37] trial that recruited more than 800 patients showed a statistically significant difference favoring InSTI in comparison with efavirenz. Integrase strand transfer inhibitors are a promising group of antiretroviral agents. Results of a recent FLAMINGO study showed that dolutegravir was superior to darunavir plus ritonavir, both with combination with NRTIs in treatment of HIV-infected ART-naive patients [63]. It is worth noting that, given the results of the latest research Department of Health and Human Services (DHHS) added dolutregravir in combination with selected NRTIs as one of the preferred options in ART-naive HIV-infected patients [6].\n\nOur results are generally in agreement with meta-analysis performed by the other authors. Mbuagbaw et al. [64] found no differences in efficacy between efavirenz and nevirapine-based therapy (irrespective of the dosage of nevirapine) applied as an initial treatment for the antiretroviral-naive, HIV-infected patients. Efavirenz and nevirapine compared as a part of a three-drug combination were both equally effective in the suppression of HIV infection for such outcomes as: virological success (percentage of participants achieving undetectable plasma HIV RNA concentration over time), clinical progression of AIDS and mortality. Similar observations were reported by Siegfried et al. [61] who demonstrated equivalent efficacy of two NNRTIs (efavirenz and nevirapine-based regimens) for the treatment of HIV infection in antiretroviral treatment-naive adults [61]. We also confirmed results of our previous meta-analysis where no statistically significant differences were shown between nevirapine and efavirenz in terms of disease progression or death as well as virological response and safety profile in antiretroviral-naive HIV-infected patients [65]. However meta-analysis of Pillay et al. showed that efavirenz-treated, treatment-naive patients were more likely to achive virologic success than patients treated with nevirapine (RR = 1.04; 95% CI: 1.00–1.08) [66]. It should be mentioned, that about half of the trials included to the above-mentioned meta-analysis [66] involved patients co-infected with tuberculosis, and hence these studies were excluded from our meta-analysis.\n\nIn terms of virological response our results are in contrast with the direct meta-analysis of Chou et al. which showed that NNRTI-based regimens in ART-naive patients were better than PI-based regimens with regard to decrease of plasma HIV RNA levels below 50 copies/ml [67]. However, the probable explanation for the observed discrepancy between both meta-analyses is that different trials were included. Chou et al. combined all studies evaluating drugs that belong to a NNRTI or PI class, while our analysis was consistent with the current guidelines for the first-line treatment. For this reason, we excluded studies assessing regimens not recommended for the first-line treatment (for example delavirdine as an NNRTI or unboosted-PI). In addition, the meta-analysis of Chou et al. [67] was performed in 2006, since that time the results of about 15 new RCTs have been published, which we could include in the current meta-analysis. Therefore, some of the regimens analyzed in our meta-analysis were not included in the previous one (for example rilpivirine as NNRTI or ritonavir-boosted atazanavir). Restriction to regimens including the older generation of PIs (that may be less potent) in the previous meta-analysis, could be the explanation of the observed differences between NNRTI and PI-based regimens [67], not confirmed by our cumulative results.\n\nIt should be noticed that the current meta-analysis described in this report has several limitations. The most important is that we were not able to aggregate results from studies comparing efavirenz and CCR5 antagonist-based regimens, due to inconsistent efficacy and safety outcomes measured in the included studies. For this reason, comparison of efavirenz and CCR5 antagonists was based on data from only one study, in which maraviroc was evaluated. The trial that was excluded from our meta-analysis (due to non-homogeneous outcomes in both trials evaluating CCR5 inhibitors) assessed vicriviroc, an experimental CCR5 antagonist, that is still in the phase of clinical trials and has not yet been approved for the treatment of HIV-infected, antiretroviral-naive patients. In addition, we did not identify the trials comparing a ritonavir-boosted darunavir (recommended by current guidelines) with efavirenz-based regimen in the analyzed population.\n\nAnother limitation was related to heterogeneity of the included studies regarding background regimens, baseline characteristics of randomized patients (especially proportions of patients in various stages of the disease), duration of follow-up periods, baseline median HIV RNA level, as well as differences in the definitions of the analyzed endpoints. While relatively low baseline HIV RNA plasma level is considered to be a predictive factor of virologic success during antiretroviral therapy [6,20], it should be noticed that the baseline plasma viral load varied within studies included in the meta-analysis (for example: pVL in studies included in the comparison of efavirenz and other NNRTI ranged from >5 000 copies/ml [15,17–19,24] to 100 000 copies/ml [20]). However, it should be emphasized that relatively large number of trials included in the individual meta-analysis (especially comparing NNRTI and ritnovir-boosted PI), reduced the influence of potential confounders and made the obtained results reliable.\n\nAdditionally, the absence of subgroup analysis in dependence on background regimens, due to a limited number of trials suitable for inclusion into separate comparisons, is another limitation of the present meta-analysis. A previous systematic review demonstrated that efavirenz is the most effective when administrated on a tenofovir and emtricitabine backbone [68], that is consistent with the currently published treatment guidelines for antiretroviral-naive patients [6,8]. The above-mentioned results indicate that backbone regimen may affect the results obtained in separate comparisons (when background regimen consisted of 2 NRTI was different in both treatment arms). However, it should be mentioned, that in most included studies backbone regimen was the same in the compared groups. Moreover, in the most recently published trials (assessing rilpivirine or InSTI), the already established and recommended combination of tenofovir and emtricitabine was used as a backbone regimen.\n\nIn this systematic review, we did not analyze trials including patients with comorbid, clinically relevant illnesses. There were several reasons for that, mainly the existence of separate recommendations for these groups of patients. Firstly, clinical guidelines recommend efavirenz as an initial ART regimen for patients on rifampin-based treatment for tuberculosis (while other NNRTIs as nevirapine are not recommended) [7–8]. Moreover, co-administration of rifampin and PIs (with or without ritonavir boosting) is not recommended [6], that restricts treatment options in those group of patients mostly to efavirenz-based therapy. Secondly, a systematic review and meta-analysis of studies, in which HIV/HCV co-infected patients were included, showed that statistically less patients with HIV/HCV co-infection reached plasma viral load <50 copies/ml at week 48 than HIV mono-infected patients (68,2% vs 80,4% respectively) [69]. In addition, patients with concurrent illnesses are at higher risk of adverse events leading to therapy discontinuation, moreover, a larger number of pills they have to take probably decreases the adherence to assigned treatment. What is more, interactions between the administered drugs should be also taken into consideration. We decided that the above factors could increase the heterogeneity of the included studies and decrease reliability of cumulative results of the meta-analysis and therefore we excluded such studies from our review.\n\nThe overall toxicity profile of efavirenz-based and other assessed regimens was comparable. However, a significantly higher risk of the discontinuation of therapy due to adverse events was observed in efavirenz group when compared with integrase inhibitors and CCR5 antagonists. It should be noticed that comparison with CCR5 antagonists was based on data from only one study and the reliability of these results is limited (further studies may change these preliminary conclusions). We did not analyze particular adverse events observed during treatment with of efavirenz-based regimens, however, neuropsychiatric adverse events were the most common side effects associated with efavirenz, that can limit the use of this agent [62]. Four systematic reviews regarding neuropsychiatric adverse events associated with efavirenz treatment have been recently published [62,70–72]. A systematic review performed by Kenedi et al. [62] demonstrated high rates of neuropsychiatric side effects among efavirenz-treated patients; vivid dreams, insomnia and mood changes were reported in approximately 50% of patients initiating treatment with efavirenz [62]. In antiretroviral-naive patients receiving efavirenz-based therapy, significantly higher rates of grade 1–4 neurological and psychiatric adverse events were reported compared to other regimens based on protease inhibitors or other NNRTIs [70]. Unfortunately, due to a different classification system used to access the above side effects reported in particular studies, limited data were suitable for comparison [70]. It should be noticed that most of the efavirenz-associated neuropsychiatric adverse events were generally mild and transient in nature. Based on the findings from clinical trials, efavirenz should not be initiated in patients with a history of severe psychiatric disorders, active mental illnesses, depressive symptom or severe sleep disorders in spite of the convenience of once daily dosing [62,70]. Recently published meta-analysis showed that patients receiving efavirenz were more likely to experience severe central nervous system-related adverse events than nevirapine [71]. Clinical experts indicate the need for large randomized controlled trials to determine if the neuronal toxicity induced by efavirenz results in clinically significant neurological impairment [72]. Despite the increased risk of neuropsychiatric adverse events in some of predisposed patients, efavirenz seems to have an acceptable safety profile. What is important, a meta-analysis of Gazzard et al. 2010 demonstrated no statistically significant differences between efavirenz and other first-line antiretroviral agents in regards to the incidence of any other side effects even such as severe or life-threatening adverse events [69].\n\nSome authors suggest increased risk of suicide during efavirenz treatment. Recent meta-analysis of four randomized controlled trials showed an increased rate of suicidality events (including also suicidal ideation) in patients treated with efavirenz-containing antiretroviral regimen compared to other regimens. However while only completed/attempted suicides where assessed only a trend towards higher rates of above events in efavirenz group was reported [73]. Mentioned results were not confirmed in observational study where no higher death rates from suicide amongst patients treated with efavirenz than other regimens were reported [74]. What is more no evident association between efavirenz use and suicidality was reported when data from Food and Drug Administration Adverse Event Reporting System (FAERS) database were analyzed [75].\n\nResults of the current meta-analysis strengthen the current clinical guidelines where active drugs from four different classes of antiretroviral agents are recommended. However, it should be noticed that some regimens can be recommended for a specific population of patients. For example rilpivirine is now recommended in patients with pretreatment HIV RNA ≤100,000 copies/mL, while the combination of elvitegravir/cobicistat/tenofovir/emtricitabine is recommended for patients with pre-treatment creatinine clearance >70 mL/min [6].\n\nIn conclusion, the results of the present meta-analysis support the current clinical guidelines for antiretroviral-naive, HIV-infected patients. Efavirenz-based therapy should be considered as one of the most preferred treatment options in ART-naive patients, however it should be prescribed with caution in patients with underlying psychiatric conditions. Results of recent studies suggests good efficacy and beneficial safety profile of drugs from new classes of antiretroviral agents (integrase inhibitors, CCR5 anatagonists) compared with other initial regimens used nowadays in clinical practice for the treatment of HIV-infected patients, however more data from further, reliable RCTs are needed to confirm above results.\n\nSupporting Information\nS1 PRISMA Checklist (DOC)\n\nClick here for additional data file.\n==== Refs\nReferences\n1 \nMurphy EL , Collier AC , Kalish LA , Assmann SF , Para MF , Flaniqan TP , et al\nHighly active antiretroviral therapy decreases mortality and morbidity in patients with advanced HIV disease . Ann Intern Med . 2001 ;135 : 17 –26 .\n11434728 \n2 \nMocroft A , Vella S , Benfield TL , Chiesi A , Miller V , Gargalianos P , et al\nChanging patterns of mortality across Europe in patients infected with HIV-1 . Lancet \n1998 ;352 : 1725 –1730 .\n9848347 \n3 \nGulick RM , Ribaudo HJ , Shikuma CM , Lustgarten S , Squires KE , Meyer WA 3rd. AIDS Clinical Trials Group Study A5095 Team. Triple-nucleoside regimens versus efavirenz-containing regimens for the initial treatment of HIV-1 infection . N Engl J Med . 2004 ;350 (18 ): 1850 –1861 .\n15115831 \n4 \nGallant J , DeJesus E , Arribas J , Pozniak A , Gazzard B , Campo RE , et al\nTenofovir DF, emtricitabine, and efavirenz vs. zidovudine, lamivudine, and efavirenz for HIV . N Engl J Med . 2006 ;354 : 251 –260 .\n16421366 \n5 \nVrouenraets SM , Wit FW , van Tongeren J , Lange JM . Efavirenz: a review . Expert Opin Pharmacother . 2007 ;8 (6 ): 851 –871 .\n17425480 \n6 \nPanel on Antiretroviral Guidelines for Adults and Adolescents\nGuidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents . Department of Health and Human Services Available: http://aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf. Accessed October 06, 2014.\n7 \nThompson MA , Aberg JA , Hoy JF , Telenti A , Benson C , Cahn P , et al\nAntiretroviral treatment of adult HIV infection: 2012 recommendations of the International Antiviral Society-USA panel . JAMA . 2012 ;308 (4 ): 387 –402 . 10.1001/jama.2012.7961 \n22820792 \n8 WHO. Consolidated guidelines on general HIV care and the use of antiretroviral drugs for treating and preventing HIV infection: recommendations for a public health approach. June 2013.\n9 \nMoher D , Liberati A , Tetzlaff J , Altman DG , The Prisma Group . Preferred reporting items for systematic reviews and meta-analyses: The PRISMA statement . Int J Surg . 2010 ;8 (5 ): 336 –341 . 10.1016/j.ijsu.2010.02.007 \n20171303 \n10 \nHiggins JPT , Green S . Cochrane handbook for systematic reviews of interventions Version 5.1.0 [updated March 2011]\nCochrane Collaboration and John Wiley \n2011 Available: www.cochrane-handbook.org.\n11 \nJadad AR , Moore RA , Carroll D , Jenkinson C , Reynolds JM , Gavaghan DJ , et al\nAssessing the quality of reports of randomized clinical trials: is blinding necessary? \nControl Clin Trials \n1996 ;17 (1 ): 1 –12 .\n8721797 \n12 \nAlbert JM , Conway B , Ioannidis JP , Reichelderfer P . Statistical issues for HIV surrogate endpoints: point/counterpoint. An NIAID workshop . Stat Med . 1998 ;17 (21 ): 2435 –2462 .\n9819838 \n13 \nRaboud JM , Montaner JS , Conway B , Rae S , Reiss P , Vella S , et al\nSuppression of plasma viral load below 20 copies/ml is required to achieve a long-term response to therapy . AIDS \n1998 ;12 (13 ): 1619 –1624 .\n9764780 \n14 \nRaboud JM , Rae S , Montaner JS . The Incas Avanti Study Groups. Predicting HIV RNA virologic outcome at 52-weeks follow-up in antiretroviral clinical trials . J Acquir Immune Defic Syndr . 2000 ;24 (5 ): 433 –439 .\n11035613 \n15 \nCohen CJ , Andrade-Villanueva J , Clotet B , Fourie J , Johnson MA , Ruxrungtham K , et al\nRilpivirine versus efavirenz with two background nucleoside or nucleotide reverse transcriptase inhibitors in treatment-naive adults infected with HIV-1 (THRIVE): a phase 3, randomized, non-inferiority trial . Lancet \n2011 ;378 (9787 ): 229 –237 . 10.1016/S0140-6736(11)60983-5 \n21763935 \n16 \nGaytán JJA , Garza ERZ , Garcia MC , Chavez SBV . Nevirapine or efavirenz in combination with two nucleoside analogues in HIV-infected antiretroviral-naive patients . Med Int Mex . 2004 ;20 (1 ): 29 –33 .\n17 \nGazzard B , Duvivier C , Zagler C , Castagna A , Hill A , van Delft Y , et al\nPhase 2 double-blind, randomized trial of etravirine versus efavirenz in treatment-naive patients: 48-week results . AIDS \n2011 ;25 (18 ): 2249 –2258 . 10.1097/QAD.0b013e32834c4c06 \n21881478 \n18 \nNelson M , Stellbrink HJ , Podzamczer D , Banhegyi D , Gazzard D , Hill A , et. al\nA comparison of neuropsychiatric adverse events during 12 weeks of treatment with etravirine and efavirenz in a treatment-naive, HIV-1-infected population . AIDS \n2011 ;25 (3 ): 335 –340 . 10.1097/QAD.0b013e3283416873 \n21150563 \n19 \nMolina JM , Cahn P , Grinsztejn B , Lazzarin A , Mills A , Saag M , et al\nRilpivirine versus efavirenz with tenofovir and emtricitabine in treatment-naive adults infected with HIV-1 (ECHO): a phase 3 randomised double-blind active-controlled trial . Lancet \n2011 ;378 (9787 ): 238 –246 . 10.1016/S0140-6736(11)60936-7 \n21763936 \n20 \nNúñez M , Soriano V , Martín-Carbonero L , Barrios AA , Barreiro PP , Blanco F , et al\nSENC (Spanish efavirenz vs. nevirapine comparison) trial: a randomized, open-label study in HIV-infected naive individuals . HIV Clin Trials . 2002 ;3 (3 ): 186 –194 .\n12032877 \n21 \nPozniak AL , Morales-Ramirez J , Katabira E , Steyn D , Lupo SH , Santoscoy M , et al\nEfficacy and safety of TMC278 in antiretroviral-naive HIV-1 patients: week 96 results of a phase IIb randomized trial . AIDS \n2010 ;24 (1 ): 55 –65 . 10.1097/QAD.0b013e32833032ed \n19926964 \n22 \nvan den Berg-Wolf M , Hullsiek KH , Peng G , Kozal MJ , Novak RM , Chen L , et al\nVirologic, immunologic, clinical, safety, and resistance outcomes from a long-term comparison of efavirenz-based versus nevirapine-based antiretroviral regimens as initial therapy in HIV-1-infected persons . HIV Clin Trials . 2008 ;9 (5 ): 324 –336 . 10.1310/hct0905-324 \n18977721 \n23 \nMacArthur RD , Novak RM , Peng G , Chen L , Xiang Y , Hullsiek KH , et al\nA comparison of three highly active antiretroviral treatment strategies consisting of non-nucleoside reverse transcriptase inhibitors, protease inhibitors, or both in the presence of nucleoside reverse transcriptase inhibitors as initial therapy (CPCRA 058 FIRST Study): a long-term randomised trial . Lancet \n2006 ;368 (9553 ): 2125 –2135 .\n17174704 \n24 \nvan Leth F , Phanuphak P , Ruxrungtham K , Baraldi E , Miller S , Gazzard B , et al\nComparison of first-line antiretroviral therapy with regimens including nevirapine, efavirenz, or both drugs, plus stavudine and lamivudine: a randomised open-label trial, the 2NN Study . Lancet \n2004 ;363 (9417 ): 1253 –1263 .\n15094269 \n25 \nVernazza P , Wang C , Pozniak A , Weil E , Pulik P , Cooper DA , et al\nEfficacy and safety of lersivirine (UK-453,061) versus efavirenz in antiretroviral treatment-naiveHIV-1-infected patients: week 48 primary analysis results from an ongoing, multicenter, randomized, double-blind, phase IIb trial . J Acquir Immune Defic Syndr . 2013 ;62 (2 ): 171 –179 . 10.1097/QAI.0b013e31827a2ba2 \n23328090 \n26 \nWester CW , Thomas AM , Bussmann H , Moyo S , Makhema JM , Gaolathe T , et al\nNon-nucleoside reverse transcriptase inhibitor outcomes among combination antiretroviral therapy-treated adults in Botswana . AIDS \n2010 ;24 (Suppl 1 ): S27 –S36 . 10.1097/01.aids.0000366080.91192.55 \n20023437 \n27 http://www.ema.europa.eu/docs/en_GB/document_library/EPAR_-_Product_Information/human/002264/WC500118874.pdf \n28 \nCohen C , Elion R , Ruane P , Shamblaw D , DeJesus E , Rashbaum B , et al\nRandomized, phase 2 evaluation of two single-tablet regimens elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate versus efavirenz/emtricitabine/tenofovir disoproxil fumarate for the initial treatment of HIV infection . AIDS \n2011 ;25 (6 ): F7 –F12 . 10.1097/QAD.0b013e328345766f \n21412057 \n29 \nLennox JL , DeJesus E , Lazzarin A , Pollard RB , Madruga JV , Berger DS , et al\nSafety and efficacy of raltegravir-based versus efavirenz-based combination therapy in treatment-naive patients with HIV-1 infection: a multicentre, double-blind randomised controlled trial . Lancet \n2009 ;374 (9692 ): 796 –806 . 10.1016/S0140-6736(09)60918-1 \n19647866 \n30 \nLennox JL , Dejesus E , Berger DS , Lazzarin A , Pollard RB , Ramalho Madruga JV , et al\nRaltegravir Versus Efavirenz Regimens in Treatment-Naive HIV-1-Infected Patients: 96-Week Efficacy, Durability, Subgroup, Safety, and Metabolic Analyses . J Acquir Immune Defic Syndr . 2010 ;55 (1 ): 39 –48 . 10.1097/QAI.0b013e3181da1287 \n20404738 \n31 \nMarkowitz M , Nguyen BY , Gotuzzo E , Mendo F , Ratanasuwan W , Kovacs C , et al\nRapid and durable antiretroviral effect of the HIV-1 Integrase inhibitor raltegravir as part of combination therapy in treatment-naive patients with HIV-1 infection: results of a 48-week controlled study . J Acquir Immune Defic Syndr . 2007 ;46 (2 ): 125 –133 .\n17721395 \n32 \nMarkowitz M , Nguyen BY , Gotuzzo E , Mendo F , Ratanasuwan W , Kovacs C , et al\nSustained antiretroviral effect of raltegravir after 96 weeks of combination therapy in treatment-naive patients with HIV-1 infection . J Acquir Immune Defic Syndr . 2009 ;52 (3 ): 350 –356 . 10.1097/QAI.0b013e3181b064b0 \n19648823 \n33 \nSax PE , DeJesus E , Mills A , Zolopa A , Cohen C , Wohl D , et al\nCo-formulated elvitegravir, cobicistat, emtricitabine, and tenofovir versus co-formulated efavirenz, emtricitabine, and tenofovir for initial treatment of HIV-1 infection: a randomised, double-blind, phase 3 trial, analysis of results after 48 weeks . Lancet \n2012 ;379 (9835 ): 2439 –2448 . 10.1016/S0140-6736(12)60917-9 \n22748591 \n34 \nZolopa A , Sax PE , DeJesus E , Mills A , Cohen C , Wohl D , et al\nA randomized double-blind comparison of coformulated elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate versusefavirenz/emtricitabine/tenofovir disoproxil fumarate for initial treatment of HIV-1 infection: analysis of week 96 results . J Acquir Immune Defic Syndr . 2013 ;63 (1 ): 96 –100 . 10.1097/QAI.0b013e318289545c \n23392460 \n35 \nvan Lunzen J , Maggiolo F , Arribas JR , Rakhmanova A , Yeni P , Young B , et al\nOnce daily dolutegravir (S/GSK1349572) in combination therapy in antiretroviral-naive adults with HIV: planned interim 48 week results from SPRING-1, a dose-ranging, randomised, phase 2b trial . Lancet Infect Dis . 2012 ;12 (2 ): 111 –118 . 10.1016/S1473-3099(11)70290-0 \n22018760 \n36 \nStellbrink HJ , Reynes J , Lazzarin A , Voronin E , Pulido F , Felizarta F , et al\nDolutegravir in antiretroviral-naive adults with HIV-1: 96-week results from a randomized dose-ranging study . AIDS \n2013 ;27 (11 ): 1771 –1778 . 10.1097/QAD.0b013e3283612419 \n23807273 \n37 \nWalmsley SL , Antela A , Clumeck N , Duiculescu D , Eberhard A , Gutiérrez F , et al\nDolutegravir plus abacavir-lamivudine for the treatment of HIV-1 infection . N Engl J Med . 2013 ;369 (19 ): 1807 –1818 . 10.1056/NEJMoa1215541 \n24195548 \n38 \nAlbini L , Cesana BM , Motta D , Foca E , Gotti D , Calabresi A , et al\nA randomized, pilot trial to evaluate glomerular filtration rate by creatinine or cystatin C in naive HIV-infected patients after tenofovir/emtricitabine in combination with atazanavir/ritonavir or efavirenz . J Acquir Immune Defic Syndr . 2012 ;59 (1 ):18 –30 . 10.1097/QAI.0b013e31823a6124 \n21992924 \n39 \nBartlett JA , Johnson J , Herrera G , Sosa N , Rodriguez A , Liao Q , et al\nLong-term results of initial therapy with abacavir and Lamivudine combined with Efavirenz, Amprenavir/Ritonavir, or Stavudine . J Acquir Immune Defic Syndr . 2006 ;43 (3 ): 284 –292 .\n16967040 \n40 \nCameron DW , da Silva BA , Arribas JR , Myers MA , Bellos NC , Gilmore N , et al\nA 96-week comparison of lopinavir-ritonavir combination therapy followed by lopinavir-ritonavir monotherapy versus efavirenz combination therapy . J Infect Dis . 2008 ;198 (2 ): 234 –240 . 10.1086/589622 \n18540803 \n41 \nDaar ES , Tierney C , Fischl MA , Sax PE , Mollan K , Budhathoki C , et al\nAtazanavir plus ritonavir or efavirenz as part of a 3-drug regimen for initial treatment of HIV-1 . Ann Intern Med . 2011 ;154 (7 ): 445 –456 . 10.7326/0003-4819-154-7-201104050-00316 \n21320923 \n42 \nEcheverría P , Negredo E , Carosi G , Gálvez J , Gómez JL , Ocampo A , et al\nSimilar antiviral efficacy and tolerability between efavirenz and lopinavir/ritonavir, administered with abacavir/lamivudine (Kivexa), in antiretroviral-naïve patients: a 48-week, multicentre, randomized study (Lake Study) . Antiviral Res . 2010 ;85 (2 ): 403 –408 . 10.1016/j.antiviral.2009.11.008 \n19941906 \n43 \nHonda M , Ishisaka M , Ishizuka N , Kimura S , Oka S . Japanese Anti-HIV-1 QD Therapy Study Group. Open-label randomized multicenter selection study of once daily antiretroviral treatment regimen comparing ritonavir-boosted atazanavir to efavirenz with fixed-dose abacavir and lamivudine . Intern Med . 2011 ;50 (7 ): 699 –705 .\n21467701 \n44 \nJosephson F , Andersson MC , Flamholc L , Gisslén M , Hagberg L , Ormaasen V , et al\nThe relation between treatment outcome and efavirenz, atazanavir or lopinavir exposure in the NORTHIV trial of treatment-naïve HIV-1 infected patients . Eur J Clin Pharmacol . 2010 ;66 (4 ): 349 –357 . 10.1007/s00228-009-0763-z \n19967342 \n45 \nEdén A , Andersson LM , Andersson O , Flamholc L , Josephson F , Nilsson S , et al\nDifferential effects of efavirenz, lopinavir/r, and atazanavir/r on the initial viral decay rate in treatment naïve HIV-1-infected patients . AIDS Res Hum Retroviruses . 2010 ;26 (5 ): 533 –540 . 10.1089/aid.2009.0177 \n20455766 \n46 \nAndersson LM , Vesterbacka J , Blaxhult A , Flamholc L , Nilsson S , Ormaasen V , et al\nLopinavir/ritonavir, atazanavir/ritonavir, and efavirenz in antiretroviral-naive HIV-1-infected individuals over 144 weeks: An open-label randomized controlled trial . Scand J Infect Dis . 2013 ;45 : 543 –551 . 10.3109/00365548.2012.756985 \n23294034 \n47 \nKumar P , DeJesus E , Huhn G , Sloan L , Small CB , Edelstein H , et al\nEvaluation of cardiovascular biomarkers in a randomized trial of fosamprenavir/ritonavir vs. efavirenz with abacavir/lamivudine in underrepresented, antiretroviral-naive, HIV-infected patients (SUPPORT): 96-week results . BMC Infect Dis . 2013 ;13 (1 ): 269 \n10.1186/1471-2334-13-269 \n23741991 \n48 \nMallolas J , Pich J , Peñaranda M , Domingo P , Knobel H , Pedrol E , et al\nInduction therapy with trizivir plus efavirenz or lopinavir/ritonavir followed by trizivir alone in naive HIV-1-infected adults . AIDS \n2008 ;22 (3 ): 377 –384 . 10.1097/QAD.0b013e3282f3db2c \n18195564 \n49 \nMiró JM , Manzardo C , Pich J , Domingo P , Ferrer E , Arribas JR , et al\nImmune reconstitution in severely immunosuppressed antiretroviral-naive HIV type 1-infected patients using a nonnucleoside reverse transcriptase inhibitor-based or a boosted protease inhibitor-based antiretroviral regimen: three-year results (The Advanz Trial): a randomized, controlled trial . AIDS Res Hum Retroviruses . 2010 ;26 (7 ): 747 –757 . 10.1089/aid.2009.0105 \n20624069 \n50 \nPuls RL , Srasuebkul P , Petoumenos K , Boesecke C , Duncombe C , Duncombe C , et al\nEfavirenz versus boosted atazanavir or zidovudine and abacavir in antiretroviral treatment-naive, HIV-infected subjects: week 48 data from the Altair study . Clin Infect Dis . 2010 ;51 (7 ): 855 –864 . 10.1086/656363 \n20735258 \n51 \nPhidisa II Writing Team for Project Phidisa , Ratsela A , Polis M , Dhlomo S , Emery S , Grandits G , Khabo P , et al\nA randomized factorial trial comparing 4 treatment regimens in treatment-naive HIV-infected persons with AIDS and/or a CD4 cell count <200 cells/μL in South Africa . J Infect Dis . 2010 ;202 (10 ):1529 –1537 . 10.1086/656718 \n20942650 \n52 \nRiddler SA , Haubrich R , DiRienzo AG , Peeples L , Powderly WG , Klingman KL , et al\nClass-sparing regimens for initial treatment of HIV-1 infection . N Engl J Med . 2008 ;358 (20 ): 2095 –2106 . 10.1056/NEJMoa074609 \n18480202 \n53 \nSierra-Madero J , Villasis-Keever A , Méndez P , Mosqueda-Gómez JL , Torres-Escobar I , Gutiérrez-Escolano F , et al\nProspective, randomized, open label trial of Efavirenz vs Lopinavir/Ritonavir in HIV+ treatment-naive subjects with CD4+<200 cell/mm3 in Mexico . J Acquir Immune Defic Syndr . 2010 ;53 (5 ):582 –588 . 10.1097/QAI.0b013e3181cae4a1 \n20090545 \n54 \nTorti C , Quiros-Roldon E , Regazzi M , Antinori A , Patroni A , Villani P , et al\nEarly virological failure after tenofovir + didanosine + efavirenz combination in HIV-positive patients upon starting antiretroviral therapy . Antivir Ther . 2005 ;10 (4 ): 505 –13 .\n16038476 \n55 \nTorti C , Quiros-Roldan ME , Cologni G , Nichelatti M , Ceresoli F , Pinti M , et al\nPlasma HIV load and proviral DNA decreases after two standard antiretroviral regimens in HIV-positive patients naïve to antiretrovirals . Curr HIV Res . 2008 ;6 (1 ):43 –48 .\n18288974 \n56 \nCooper DA , Heera J , Goodrich J , Tawadrous M , Saag M , Dejesus E , et al\nMaraviroc versus efavirenz, both in combination with zidovudine-lamivudine, for the treatment of antiretroviral-naive subjects with CCR5-tropic HIV-1 infection . J Infect Dis . 2010 ;201 (6 ): 803 –813 . 10.1086/650697 \n20151839 \n57 \nSierra-Madero J , Di Perri G , Wood R , Saag M , Frank I , Craig C , et al\nEfficacy and safety of maraviroc versus efavirenz, both with zidovudine/lamivudine: 96-week results from the MERIT study . HIV Clin Trials . 2010 ;11 (3 ): 125 –132 . 10.1310/hct1103-125 \n20736149 \n58 \nCurrier J , Lazzarin A , Sloan L , Clumeck N , Slims J , McCarty D , et al\nAntiviral activity and safety of aplaviroc with lamivudine/zidovudine in HIV-infected, therapy-naive patients: the ASCENT (CCR102881) study . Antivir Ther . 2008 ;13 (2 ): 297 –306 .\n18505181 \n59 \nLandovitz RJ , Angel JB , Hoffmann C , Horst H , Opravil M , Long J , et al\nPhase II study of vicriviroc versus efavirenz (both with zidovudine/lamivudine) in treatment-naive subjects with HIV-1 infection . J Infect Dis . 2008 ;198 (8 ): 1113 –1122 . 10.1086/592052 \n18783318 \n60 \nCrabb C . GlaxoSmithKline ends aplaviroc trials . AIDS \n2006 ;20 (5 ): 641 \n16514292 \n61 \nSiegfried NL , Van Deventer PJ , Mahomed FA , Rutherford GW . Stavudine, lamivudine and nevirapine combination therapy for treatment of HIV infection and AIDS in adults . Cochrane Database Syst Rev . 2006 ;2 : CD004535 \n16625606 \n62 \nKenedi CA , Goforth HW . A systematic review of the psychiatric side-effects of efavirenz . AIDS Behav . 2011 ;15 (8 ): 1803 –1818 . 10.1007/s10461-011-9939-5 \n21484283 \n63 \nClotet B , Feinberg J , van Lunzen J , Khuong-Josses MA , Antinori A , Dumitru I , et al\nOnce-daily dolutegravir versus darunavir plus ritonavir in antiretroviral-naive adults with HIV-1 infection (FLAMINGO): 48 week results from the randomised open-label phase 3b study . Lancet \n2014 ;383 (9936 ): 2222 –2231 . 10.1016/S0140-6736(14)60084-2 \n24698485 \n64 \nMbuagbaw LC , Irlam JH , Spaulding A , Rutherford GW , Siegfried N . Efavirenz or nevirapine in three-drug combination therapy with two nucleoside-reverse transcriptase inhibitors for initial treatment of HIV infection in antiretroviral-naïve individuals . Cochrane Database Syst Rev . 2010 ;12 : CD004246 \n10.1002/14651858.CD004246.pub3 \n21154355 \n65 \nKawalec P , Kryst J , Mikrut A , Pilc A . Nevirapine-based regimens in HIV-infected antiretroviral-naive patients: systematic review and meta-analysis of randomized controlled trials . PLoS One \n2013 ;8 (10 ): e76587 \n10.1371/journal.pone.0076587 \n24116123 \n66 \nPillay P , Ford N , Shubber Z , Ferrand RA . Outcomes for efavirenz versus nevirapine-containing regimens for treatment of HIV-1 infection: a systematic review and meta-analysis \nPLoS One \n2013 ;8 (7 ): e68995 \n10.1371/journal.pone.0068995 \n23894391 \n67 \nChou R , Fu R , Huffman LH , Korthuis PT . Initial highly-active antiretroviral therapy with a protease inhibitor versus a non-nucleoside reverse transcriptase inhibitor: discrepancies between direct and indirect meta-analyses . Lancet \n2006 ;368 (9546 ): 1503 –1515 .\n17071284 \n68 \nBartlett JA , Chen SS , Quinn JB . Comparative Efficacy of Nucleoside/Nicleotide Reverse Transcriptase Inhibitors in Combination with Efavirenz: Results of Systematic Overview . HIV Clin Trial . 2007 ;8 (4 ): 221 –226 .\n17720662 \n69 \nPulido F , Hill A , van Delft , Moecklinghoff C . Impact of hepatitis C co-infection on response to antiretroviral treatment . AIDS Rev . 2012 ;14 (2 ): 124 –131 .\n22627608 \n70 \nGazzard B , Balkin A , Hill A . Analysis of neuropsychiatric adverse events during clinical trials of efavirenz in antiretroviral-naïve patients: a systematic review . AIDS Rev . 2010 ;12 (2 ): 67 –75 .\n20571601 \n71 \nShubber Z , Calmy A , Andrieux-Meyer I , Vitoria M , Renaud-Théry F , Shaffer N , et al\nAdverse events associated with nevirapine and efavirenz-based first-line antiretroviral therapy: a systematic review and meta-analysis . AIDS \n2013 ;27 (9 ): 1403 –1412 . 10.1097/QAD.0b013e32835f1db0 \n23343913 \n72 \nDecloedt EH , Maartens G . Neuronal toxicity of efavirenz: a systematic review . Expert Opin Drug Saf . 2013 ;12 (6 ): 841 –846 . 10.1517/14740338.2013.823396 \n23889591 \n73 \nMollan KR , Smurzynski M , Eron JJ , Daar ES , Campbell TB , Sax PE , et al\nAssociation between efavirenz as initial therapy for HIV-1 infection and increased risk for suicidal ideation or attempted or completed suicide: an analysis of trial data . Ann Intern Med . 2014 ;161 (1 ): 1 –10 . 10.7326/M14-0293 \n24979445 \n74 \nSmith C , Ryom L , Monforte Ad , Reiss P , Mocroft A , El-Sadr W , et al\nLack of association between use of efavirenz and death from suicide: evidence from the D:A:D study . J Int AIDS Soc . 2014 ;17 (4 Suppl 3): 19512 \n10.7448/IAS.17.4.19512 \n25394021 \n75 \nNapoli AA , Wood JJ , Coumbis JJ , Soitkar AM , Seekins DW , Tilson HH , et al\nNo evident association between efavirenz use and suicidality was identified from a disproportionality analysis using the FAERS database . J Int AIDS Soc . 2014 ;17 : 19214 \n10.7448/IAS.17.1.19214 \n25192857\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1932-6203",
"issue": "10(5)",
"journal": "PloS one",
"keywords": null,
"medline_ta": "PLoS One",
"mesh_terms": "D000328:Adult; D000480:Alkynes; D019380:Anti-HIV Agents; D023241:Antiretroviral Therapy, Highly Active; D048588:Benzoxazines; D003521:Cyclopropanes; D015658:HIV Infections; D017320:HIV Protease Inhibitors; D006801:Humans; D016032:Randomized Controlled Trials as Topic; D019713:Receptors, CCR5; D018894:Reverse Transcriptase Inhibitors; D019438:Ritonavir; D016896:Treatment Outcome",
"nlm_unique_id": "101285081",
"other_id": null,
"pages": "e0124279",
"pmc": null,
"pmid": "25933004",
"pubdate": "2015",
"publication_types": "D016428:Journal Article; D017418:Meta-Analysis; D013485:Research Support, Non-U.S. Gov't; D016454:Review; D000078182:Systematic Review",
"references": "23741991;25192857;25394021;11035613;11434728;12032877;8721797;9764780;9819838;9848347;16038476;16421366;16514292;16625606;17071284;16967040;17174704;17425480;17720662;17721395;18195564;18288974;18480202;21150563;21412057;21320923;21467701;21763935;21763936;21484283;21881478;21992924;22018760;22627608;22748591;22820792;23328090;23392460;23294034;23807273;18505181;18540803;18783318;18977721;19647866;19648823;19926964;20023437;19941906;20151839;19967342;20171303;20404738;15094269;15115831;20090545;20455766;20571601;20624069;20736149;20735258;20942650;21154355;23894391;23343913;24116123;23889591;24195548;24698485;24979445",
"title": "Efavirenz-Based Regimens in Antiretroviral-Naive HIV-Infected Patients: A Systematic Review and Meta-Analysis of Randomized Controlled Trials.",
"title_normalized": "efavirenz based regimens in antiretroviral naive hiv infected patients a systematic review and meta analysis of randomized controlled trials"
} | [
{
"companynumb": "US-CIPLA LTD.-2015US06095",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ABACAVIR"
},
"drugadditional": null,
... |
{
"abstract": "We herein report a case of a consciousness disorder that was induced by the syndrome of inappropriate antidiuretic hormone secretion following cisplatin (CDDP) and 5 -fluorouracil (5-FU) chemotherapy in a patient with tongue cancer. A 72- year-old woman complained of tongue pain and was admitted to our hospital for neoadjuvant chemotherapy, under a diagnosis of tongue squamous cell carcinoma (T4aN2bM0). She was treated with CDDP and 5-FU. On the second day after administration, she complained of nausea and anorexia, and on the third day, she showed impaired consciousness. Laboratory studies revealed that the patient had a serum sodium concentration 112mEq/L, and no dehydration was noted. The patient was diagnosed with SIADH, using the appropriate diagnostic criteria based on serum and urine hypoosmolality. We subsequently discontinued chemotherapy and initiated fluid restriction and sodium supplements. Two days after this treatment, her consciousness level improved, and on the fifth day of treatment, laboratory studies revealed a serum sodium level of 134mEq/ L.",
"affiliations": "Division of Oral and Maxillofacial Biopathological Surgery, Dept. of Medicine of Sensory and Motor Organs, School of Medicine, Tottori University Faculty of Medicine.",
"authors": "Tamura|Takayuki|T|;Taniguchi|Naomi|N|;Otsuki|Kazuma|K|;Narai|Takashi|T|;Kawasaki|Makoto|M|;Fujii|Nobuyuki|N|;Doi|Rieko|R|;Kodani|Isamu|I|",
"chemical_list": "D002945:Cisplatin; D005472:Fluorouracil",
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-0684",
"issue": "45(5)",
"journal": "Gan to kagaku ryoho. Cancer & chemotherapy",
"keywords": null,
"medline_ta": "Gan To Kagaku Ryoho",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D002294:Carcinoma, Squamous Cell; D002945:Cisplatin; D003244:Consciousness Disorders; D005260:Female; D005472:Fluorouracil; D006258:Head and Neck Neoplasms; D006801:Humans; D007177:Inappropriate ADH Syndrome; D020360:Neoadjuvant Therapy; D000077195:Squamous Cell Carcinoma of Head and Neck; D014062:Tongue Neoplasms",
"nlm_unique_id": "7810034",
"other_id": null,
"pages": "855-857",
"pmc": null,
"pmid": "30026451",
"pubdate": "2018-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "A Case of Consciousness Disorder Induced by the Syndrome of Inappropriate Antidiuretic Hormone Secretion Following Cisplatin and 5-Fluorouracil Chemotherapy in a Patient with Tongue Cancer.",
"title_normalized": "a case of consciousness disorder induced by the syndrome of inappropriate antidiuretic hormone secretion following cisplatin and 5 fluorouracil chemotherapy in a patient with tongue cancer"
} | [
{
"companynumb": "JP-MYLANLABS-2018M1064955",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": "1",
... |
{
"abstract": "Drug-induced liver injury has been reported to cause up to 10% of adverse drug reactions in the United States. Risk factors for druginduced liver injury include female gender, older age, interacting medications and drugs that are metabolized by the liver. This case report describes a patient who was newly initiated on tizanidine, an alpha2 adrenergic agonist used for muscle spasm and musculoskeletal pain, and bortezomib, a proteasome inhibitor used for multiple myeloma. Both medications are metabolized by cytochrome P450 isoenzyme 1A2. The medications were suspected of causing acute hepatitis based on the timing of their initiation and evidence to suggest that they can cause acute hepatitis. The Naranjo adverse drug reaction scale was scored as possible. In addition, the drugs' blood levels may have been increased by acyclovir and hydralazine, both inhibitors of cytochrome P450 isoenzyme 1A2. A dilemma for the team was how to best manage bortezomib. It is part of first line treatment for multiple myeloma when combined with lenalidomide and dexamethasone. Other proteasome inhibitors are available for multiple myeloma treatment. When starting chemotherapy, it is important to be aware of medications that cause a rise in liver enzymes, potential drug interactions, and how best to manage the clinical consequences.",
"affiliations": "Lloyd L. Gregory School of Pharmacy, 8527Palm Beach Atlantic University, West Palm Beach, FL, USA.;Lloyd L. Gregory School of Pharmacy, 8527Palm Beach Atlantic University, West Palm Beach, FL, USA.",
"authors": "Dougherty|John A|JA|https://orcid.org/0000-0002-2393-6296;Elder|Christopher T|CT|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/0897190020977763",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0897-1900",
"issue": null,
"journal": "Journal of pharmacy practice",
"keywords": "adverse drug event; bortezomib; hepatitis; multiple myeloma; tizanidine",
"medline_ta": "J Pharm Pract",
"mesh_terms": null,
"nlm_unique_id": "8900945",
"other_id": null,
"pages": "897190020977763",
"pmc": null,
"pmid": "33317373",
"pubdate": "2020-12-15",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Managing Multiple Myeloma in the Face of Drug-Induced Adverse Drug Reaction.",
"title_normalized": "managing multiple myeloma in the face of drug induced adverse drug reaction"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK202101177",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LABETALOL\\LABETALOL HYDROCHLORIDE"
},
"... |
{
"abstract": "Pituitary apoplexy is an uncommon phenomenon typically characterized by vascular insufficiency or acute hemorrhage into a pituitary adenoma. The overall incidence of pituitary apoplexy ranges between 1 and 25% of all pituitary adenomas. With the widespread use of MRI technology, the diagnosis of asymptomatic intratumoral hemorrhage is closer to 10%. The authors report a case of a 27-year-old female in her 36th week of pregnancy who presented with severe onset headache and acute left-sided vision loss. MRI of the brain revealed a large hemorrhagic mass occupying the sella turcica. The patient underwent an emergent endoscopic endonasal transsphenoidal resection for pituitary apoplexy. Postoperatively, the patient's neurologic deficit resolved. Minimally invasive endoscopic endonasal transsphenoidal resection of pituitary apoplexy can be safely utilized in third trimester pregnant women presenting with acute severe neurologic deficits.",
"affiliations": "Department of Neurosurgery, Montefiore Medical Center, 3316 Rochambeau Avenue, Bronx, NY 10467, USA.;American Center for Spine and Neurosurgery, Libertyville, IL, USA.;Department of Neurosurgery, Montefiore Medical Center, 3316 Rochambeau Avenue, Bronx, NY 10467, USA.;Department of Otorhinolaryngology, Montefiore Medical Center, Bronx, NY, USA.",
"authors": "Tandon|Adesh|A|0000-0001-7946-9669;Alzate|Juan|J|;LaSala|Patrick|P|;Fried|Marvin P|MP|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2014/397131",
"fulltext": "\n==== Front\nSurg Res PractSurg Res PractSRPSurgery Research and Practice2356-77592356-6124Hindawi Publishing Corporation 10.1155/2014/397131Case ReportEndoscopic Endonasal Transsphenoidal Resection for Pituitary Apoplexy during the Third Trimester of Pregnancy http://orcid.org/0000-0001-7946-9669Tandon Adesh \n1\n*Alzate Juan \n2\nLaSala Patrick \n1\nFried Marvin P. \n3\n1Department of Neurosurgery, Montefiore Medical Center, 3316 Rochambeau Avenue, Bronx, NY 10467, USA2American Center for Spine and Neurosurgery, Libertyville, IL, USA3Department of Otorhinolaryngology, Montefiore Medical Center, Bronx, NY, USA*Adesh Tandon: atandon26@gmail.comAcademic Editor: Tadanori Tomita\n\n2014 2 1 2014 2014 3971312 8 2013 7 10 2013 Copyright © 2014 Adesh Tandon et al.2014This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Pituitary apoplexy is an uncommon phenomenon typically characterized by vascular insufficiency or acute hemorrhage into a pituitary adenoma. The overall incidence of pituitary apoplexy ranges between 1 and 25% of all pituitary adenomas. With the widespread use of MRI technology, the diagnosis of asymptomatic intratumoral hemorrhage is closer to 10%. The authors report a case of a 27-year-old female in her 36th week of pregnancy who presented with severe onset headache and acute left-sided vision loss. MRI of the brain revealed a large hemorrhagic mass occupying the sella turcica. The patient underwent an emergent endoscopic endonasal transsphenoidal resection for pituitary apoplexy. Postoperatively, the patient's neurologic deficit resolved. Minimally invasive endoscopic endonasal transsphenoidal resection of pituitary apoplexy can be safely utilized in third trimester pregnant women presenting with acute severe neurologic deficits.\n==== Body\n1. Introduction\nSchloffer and Hochenegg performed the first successful transsphenoidal surgery in 1908 while in Vienna [1]. Soon thereafter, Harvey Cushing perfected the transsphenoidal approach for sellar lesions in 1910, but he later abandoned it secondary to its limited exposure. In the 1960s, the introduction of the operative microscope by Hardy and the advent of fluoroscopy by Giout resulted in the resurgence of the approach [1, 2]. While the introduction of endoscopic techniques in several surgical fields have become the standard of care for many pathologies, only recently, neurosurgeons have become more interested in applying this technology in the management of some unique disease entities. Over the last decade, neurosurgeons have advanced minimally invasive endoscopic techniques in dealing with pituitary lesions. There have been a number of studies comparing more traditional “open” approaches to the sella, with endoscopic assisted and with purely endoscopic surgeries. In most of these studies, there are no statistically significant differences between the three different types of treatments with regards to outcome [3–10]. Herein, we present the case of a 27-year-old pregnant female who developed acute vision loss during her third trimester, secondary to pituitary apoplexy. She successfully underwent a minimally invasive endoscopic endonasal transsphenoidal resection of the pituitary apoplexy.\n\n2. Case Report\n2.1. History and Examination\nThis 27-year-old pregnant woman, presented initially at 19 weeks gestation with intermittent headaches, nausea, and vomiting for two months duration. She was admitted to an outside hospital and was diagnosed with a prolactin secreting pituitary adenoma. At that time, the patient was noted to have normal visual acuity in both eyes with no evidence of field cut as well. The patient was treated with bromocriptine therapy given the diagnosis of prolactinoma. At 36-week-gestation, the patient presented to our hospital with severe onset headache and acute vision loss in the left eye. MRI of the brain revealed a suprasellar, hemorrhagic mass measuring approximately 2.1 × 1.3 cm in size with noted optic chiasm compression (Figure 1). On neurological examination, the patient was noted to have decreased visual acuity in the left eye (20/200), with normal vision in the right eye. Visual field testing revealed a severe bitemporal visual field loss. All other cranial nerves remained intact. Given the significant, acute, neurologic deficit noted upon the examination, the decision was made to offer the patient minimally invasive surgical intervention. Prior to the planned surgery, a lengthy discussion with the anesthesia team was conducted with regards to risks to the unborn fetus. A multidisciplinary “team” approach was implemented to ensure the greatest degree of safety for the patient.\n\n2.2. Operation and Postoperative Course\nThe patient was taken to the operating room to undergo an endoscopic endonasal transsphenoidal resection of the pituitary apoplexy. The patient's head was immobilized using a three-pin head fixation device. The operation was performed endoscopically through both nostrils. The left middle turbinate was fractured outward to widen the corridor to the sphenoethmoid recess in order to facilitate the identification of the sphenoid ostium. Bilateral anterior sphenoidectomies were performed extensively with Kerrison rongeurs. The intersinus septum of the sphenoid sinus and sinus mucosa were then removed (Figure 2). The bone in the anterior wall of the sella was notably attenuated. The exposed dura mater was then incised and old blood products extruded under pressure once the dura was opened and an internal decompression of the tumor was performed (Figure 3). The interface between the pseudocapsule of the tumor and normal pituitary gland was identified and dissected with a microdissector and a small ring curette. Once the remaining tumor had been identified in the corners, it was removed under direct endoscopic visualization. Care was taken not to tear the arachnoid membrane to reduce the risk of postoperative cerebrospinal fluid leakage. The entire procedure lasted less than two hours. The patient was transferred to the neurosurgical intensive care unit for postoperative care. On postoperative day one, the patient developed polyuria and increased serum sodium. The patient was treated with desmopressin and liberal intake of water for central diabetes insipidus. The patient's serum sodium stabilized after one day and the central diabetes insipidus remained only transiently. Upon examination, the patient demonstrated rapid visual acuity and visual field improvement. Finally, the patient was transferred to the labor and delivery unit where an elective Cesarean section was done one week after the endoscopic endonasal surgery was concluded. The newborn and the mother remained in stable condition. Postoperative MRI revealed complete excision of the tumor, with no further evidence of optic chiasm compression (Figure 4).\n\n2.3. Pathological Examination\nFrozen sections revealed mainly blood products with fragments of pituitary gland tissue. The histopathology was consistent with prolactinoma. \n\n3. Discussion\nProlactinomas and nonsecreting adenomas are the most common pituitary tumors. They represent 40% and 39% of all pituitary tumors, respectively [10]. Pituitary adenomas, especially prolactinomas, may evolve as macroadenomas or microadenomas [11]. Clinically significant increases in size occur in approximately 1–5% of all microprolactinomas [12].\n\nDuring pregnancy, there is a normal increase in the volume and T1 hyperintensity of the anterior pituitary as demonstrated by MRI. This is explained by a relative increase in the number of lactotrophs of the pituitary gland. Normally, lactotrophs comprise from 15 to 20% of the gland. During pregnancy this number may increase to almost 50%, which accounts for the increase in prolactin production [11].\n\nMacroprolactinomas account for the most common pituitary lesion in pregnant women. Approximately 35% of macroprolactinomas enlarge during pregnancy making their medical or surgical management a priority prior to the pregnancy [13]. The initial management of prolactinomas during pregnancy is medical therapy with dopamine agonists. However, in cases of pituitary apoplexy associated with acute optic chiasm or optic nerve compression, the management requires prompt surgical intervention to decompress the optic apparatus [14–18]. Surgical intervention is indicated to prevent permanent vision loss.\n\nPituitary apoplexy is characterized by the abrupt destruction of pituitary gland tissue secondary to infarction or hemorrhage of the gland itself. This phenomenon is usually more common in macroprolactinomas and in some rare cases may be associated with lymphocytic adenohypophysitis [15, 19]. Clinical features of pituitary apoplexy include severe headache, stiff neck, fever, visual disturbances, and symptoms of adrenal insufficiency accompanied with circulatory shock. Anticipation of this clinical entity and prompt recognition of symptoms may prevent disastrous consequences. Subacute pituitary apoplexy occurs in about 10 to 15% of adenomas, but, in general, clinical symptoms remain mild in pregnant women [13].\n\nOnce the pituitary apoplectic event is identified in a pregnant woman, care must be directed to both mother and fetus in a manner designed to optimize the physiologic stability of both. A “team” approach is required, which includes a neurosurgeon, an ICU personal, and an obstetrician [20]. Prompt ICU care and subsequent neurosurgical intervention can lead to improvements in neurological deficits. Traditionally, an open transseptal approach may have been used for resection of the pituitary adenoma, but more recently some neurosurgeons may choose to utilize the endoscopic endonasal approach to the sella turcica.\n\nThe endoscopic, endonasal, transsphenoidal surgery has comparable surgical outcomes to conventional microscopic transsphenoidal surgery [3–8, 21–23]. Patients' generally have a quick recovery, short hospital stays, and minimal postoperative discomfort [24]. The two main advantages of the endoscopic approach, when compared with the standard microsurgical operation, arise from the dynamic optical ability afforded by the endoscope and from the absence of a transsphenoidal retractor [14]. The endoscope allows for greater visualization within the sella turcica itself. With the addition of the 30 degree endoscope, surgeons can visualize portions of the pituitary tumor that they may have tried to blindly dissect with the use of the operative microscope. The endoscope also allows for clear delineation of the arachnoid membrane and so may facilitate a lower risk for cerebrospinal fluid leakage. Additionally, with the absence of sphenoidal retractors surgeons gain greater visibility and dexterity of their microsurgical instruments.\n\nGondim et al. described a case of a patient with a macroadenoma in treatment with bromocriptine that was stopped after the patient became pregnant. In the third trimester, pituitary apoplexy developed requiring surgical treatment. The patient underwent a successful endoscopic endonasal resection of the pituitary apoplexy [16]. The patient reportedly had resolution of her neurologic deficits. More recently, Iuliano and Laws described two cases where pituitary apoplexy developed in pregnant women. Both cases were initially managed conservatively but ultimately required operative intervention to prevent vision loss [25].\n\nOur patient presented with headache and visual loss, with a known history of a pituitary tumor. As suspected, MRI confirmed pituitary apoplexy in this pregnant woman. The patient underwent a minimally invasive, endoscopic, endonasal pituitary apoplexy resection. Postoperatively, the patient's visual disturbances resolved and she was safely able to undergo an elective Cesarean section one week later. \n\n4. Conclusion\nPituitary apoplexy in pregnancy is a rare event. The new advances in endoscopic surgery permit a rapid, minimally invasive treatment, in cases associated with acute optic nerve compression. The endoscopic, endonasal approach is a safe alternative to open cranial surgery for the treatment of pituitary apoplexy in third trimester pregnant women. \n\nConflict of Interests\nThe authors declare that there is no conflict of interests regarding the publication of this paper.\n\nAuthors' Contribution\nAll of the listed authors have made substantial contributions in the conception and design of this short report. They have also participated in the acquisition and analysis of the data. All of the authors made contributions in drafting this original case report and approved its final draft for submission.\n\nFigure 1 Sagittal T1 MRI of brain without contrast shows area of hyperintensity within the sella and suprasellar regions (red arrow). This likely represents pituitary apoplexy within the known macroadenoma.\n\nFigure 2 Intraoperative view through the operative endoscope revealing the intersinus septum within the sphenoid sinus and the floor of the sella turcica.\n\nFigure 3 Intraoperative view through the operative endoscope revealing the hemorrhagic pituitary apoplexy being removed in a piece meal fashion.\n\nFigure 4 Postoperative sagittal T1 MRI of brain without contrast shows resolution of the prior areas of hyperintensity within the sella turcica (red arrow). The pituitary stalk is now visible (yellow arrow).\n==== Refs\n1 Liu JK Das K Weiss MH Laws ER Jr. Couldwell WT The history and evolution of transsphenoidal surgery Journal of Neurosurgery 2001 95 6 1083 1096 2-s2.0-0035204075 11765830 \n2 Welbourn RB The evolution of transsphenoidal pituitary microsurgery Surgery 1986 100 6 1185 1190 2-s2.0-0022861189 3538463 \n3 Batra PS Citardi MJ Worley S Lee J Lanza DC Resection of anterior skull base tumors: comparison of combined traditional and endoscopic techniques American Journal of Rhinology 2005 19 5 521 528 2-s2.0-27944465319 16270609 \n4 Frank G Pasquini E Farneti G The endoscopic versus the traditional approach in pituitary surgery Neuroendocrinology 2006 83 3-4 240 248 2-s2.0-33750036403 17047389 \n5 Jain AK Gupta AK Pathak A Bhansali A Bapuraj JR Excision of pituitary adenomas: randomized comparison of surgical modalities British Journal of Neurosurgery 2007 21 4 328 331 2-s2.0-34547700414 17676450 \n6 Koren I Hadar T Rappaport ZH Yaniv E Endoscopic transnasal transsphenoidal microsurgery versus the sublabial approach for the treatment of pituitary tumors: Endonasal complications Laryngoscope 1999 109 11 1838 1840 2-s2.0-0032739728 10569418 \n7 Nasseri SS Kasperbauer JL Strome SE McCaffrey TV Atkinson JL Meyer FB Endoscopic transnasal pituitary surgery: report on 180 Cases American Journal of Rhinology 2001 15 4 281 287 2-s2.0-0035409684 11554662 \n8 Neal JG Patel SJ Kulbersh JS Osguthorpe JD Schlosser RJ Comparison of techniques for transsphenoidal pituitary surgery American Journal of Rhinology 2007 21 2 203 206 2-s2.0-34249774598 17424881 \n9 Rosen MR Saigal K Evans J Keane WM A review of the endoscopic approach to the pituitary through the sphenoid sinus Current Opinion in Otolaryngology and Head and Neck Surgery 2006 14 1 6 13 2-s2.0-33144486719 16467631 \n10 Gsponer J de Tribolet N Déruaz J-P Diagnosis, treatment, and outcome of pituitary tumors and other abnormal intrasellar masses. Retrospective analysis of 353 patients Medicine 1999 78 4 236 269 2-s2.0-0032853444 10424206 \n11 Soto-Ares G Cortet-Rudelli C Delmaire C Pruvo JP Pituitary adenomas and pregnancy: morphological features at MRI Journal de Radiologie 2002 83 3 329 335 2-s2.0-0036230856 11979226 \n12 Gemzell C Wang CF Outcome of pregnancy in women with pituitary adenoma Fertility and Sterility 1979 31 4 363 372 2-s2.0-0018381438 428578 \n13 Jan M Destrieux C Pituitary disorders in pregnancy Neurochirurgie 2000 46 2 88 94 2-s2.0-0034094190 10844349 \n14 de Heide LJM van Tol KM Doorenbos B Pituitary apoplexy presenting during pregnancy Netherlands Journal of Medicine 2004 62 10 393 396 2-s2.0-9244232268 15683096 \n15 Fujimaki T Hotta S Mochizuki T Pituitary apoplexy as a consequence of lymphocytic adenohypophysitis in a pregnant woman: a case report Neurological Research 2005 27 4 399 402 2-s2.0-19544367783 15949237 \n16 Gondim J Ramos F Jr. Pinheiro I Schops M Tella OI Jr. Minimally invasive pituitary surgery in a hemorrhagic necrosis of adenoma during pregnancy Minimally Invasive Neurosurgery 2003 46 3 173 176 2-s2.0-0042665468 12872196 \n17 Lunardi P Rizzo A Missori P Fraioli B Pituitary apoplexy in an acromegalic woman operated on during pregnancy by transphenoidal approach International Journal of Gynecology and Obstetrics 1991 34 1 71 74 2-s2.0-0025917634 1671026 \n18 Ohtsubo T Asakura T Kadota K A report of a transsphenoidal operation during pregnancy for a pituitary adenoma No Shinkei Geka 1991 19 9 867 870 2-s2.0-0025885080 1944797 \n19 Lee MS Pless M Apoplectic lymphocytic hypophysitis: case report Journal of Neurosurgery 2003 98 1 183 185 2-s2.0-0037218762 12546370 \n20 Raps EC Galetta SL Flamm ES Neuro-intensive care of the pregnant woman Neurologic Clinics 1994 12 3 601 611 2-s2.0-0027939836 7990793 \n21 Sethi DS Leong J-L Endoscopic pituitary surgery Otolaryngologic Clinics of North America 2006 39 3 563 583 2-s2.0-33744532563 16757232 \n22 Wolfsberger S Neubauer A Bühler K Advanced virtual endoscopy for endoscopic transsphenoidal pituitary surgery Neurosurgery 2006 59 5 1001 1009 2-s2.0-33845187681 17143234 \n23 Cappabianca P Cavallo LM de Divitiis E Day JD Ciric IS Laws ER Jr. Endoscopic endonasal transsphenoidal surgery Neurosurgery 2004 55 4 933 941 2-s2.0-4744374158 15458602 \n24 Jho HD Alfieri A Endoscopic endonasal pituitary surgery: evolution of surgical technique and equipment in 150 operations Minimally Invasive Neurosurgery 2001 44 1 1 12 2-s2.0-0035030963 11409304 \n25 Iuliano S Laws ER Management of pituitary tumors in pregnancy Seminars in Neurology 2011 31 4 423 427 2-s2.0-82155171304 22113515\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2356-6124",
"issue": "2014()",
"journal": "Surgery research and practice",
"keywords": null,
"medline_ta": "Surg Res Pract",
"mesh_terms": null,
"nlm_unique_id": "101628730",
"other_id": null,
"pages": "397131",
"pmc": null,
"pmid": "25374951",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": "12872196;11409304;16270609;15458602;17047389;3538463;11554662;12546370;10844349;15949237;15683096;17424881;7990793;22113515;10424206;10569418;17676450;11979226;1671026;428578;1944797;17143234;16467631;11765830;16757232",
"title": "Endoscopic Endonasal Transsphenoidal Resection for Pituitary Apoplexy during the Third Trimester of Pregnancy.",
"title_normalized": "endoscopic endonasal transsphenoidal resection for pituitary apoplexy during the third trimester of pregnancy"
} | [
{
"companynumb": "US-VALIDUS PHARMACEUTICALS LLC-US-2016VAL000183",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "BROMOCRIPTINE MESYLATE"
},
... |
{
"abstract": "The most common pathogen in pediatric cystic fibrosis (CF) patients is Staphylococcus aureus, and drug-resistant species are associated with negative outcomes. Methicillin-resistant Staphylococcus aureus (MRSA) is notoriously hard to treat because many antibiotics are not FDA approved for children and drug allergies or intolerances can prohibit the use of others. Telavancin is currently indicated for hospital-acquired pneumonia and ventilator-associated pneumonia caused by MRSA, but it has not been studied in patients with CF or in pediatrics. As a semi-synthetic derivative of vancomycin, it is unknown if cross-reactivity with telavancin occurs in patients with vancomycin hypersensitivity or intolerance. In this case series, we describe three adolescent patients with CF and previous intolerance to vancomycin who received telavancin for bronchopulmonary exacerbations.",
"affiliations": "Department of Pharmacy, University of North Carolina Medical Center, 101 Manning Drive, Campus Box 7600, Chapel Hill, NC 27514, United States.;Division of Pediatric Pulmonology, Department of Pediatrics, University of North Carolina School of Medicine, 450-D MacNider Hall, Campus Box 7217, Chapel Hill, NC 27599-7217, United States.;Division of Pediatric Pulmonology, Department of Pediatrics, University of North Carolina School of Medicine, 450-D MacNider Hall, Campus Box 7217, Chapel Hill, NC 27599-7217, United States.; Division of Pulmonary and Critical Care Medicine, Department of Medicine, University of North Carolina School of Medicine, 125 MacNider Hall, Campus Box 7005, Chapel Hill, NC 27599-7005, United States.;Division of Pediatric Pulmonology, Department of Pediatrics, University of North Carolina School of Medicine, 450-D MacNider Hall, Campus Box 7217, Chapel Hill, NC 27599-7217, United States.;Department of Pharmacy, University of North Carolina Medical Center, 101 Manning Drive, Campus Box 7600, Chapel Hill, NC 27514, United States.. Electronic address: Cameron.Mckinzie@unchealth.unc.edu.",
"authors": "Bernstein|Adam T|AT|;Leigh|Margaret W|MW|;Goralski|Jennifer L|JL|;Esther|Charles R|CR|;McKinzie|Cameron J|CJ|",
"chemical_list": "D000617:Aminoglycosides; D000900:Anti-Bacterial Agents; D000077427:Lipoglycopeptides; D014640:Vancomycin; C487637:telavancin",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jcf.2018.08.003",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1569-1993",
"issue": "17(6)",
"journal": "Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society",
"keywords": "Child; MRSA; Pediatric; Telavancin; Vancomycin",
"medline_ta": "J Cyst Fibros",
"mesh_terms": "D000293:Adolescent; D000617:Aminoglycosides; D000900:Anti-Bacterial Agents; D002648:Child; D003428:Cross Infection; D003550:Cystic Fibrosis; D004342:Drug Hypersensitivity; D005260:Female; D006801:Humans; D000077427:Lipoglycopeptides; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D008826:Microbial Sensitivity Tests; D013203:Staphylococcal Infections; D016896:Treatment Outcome; D014640:Vancomycin",
"nlm_unique_id": "101128966",
"other_id": null,
"pages": "e48-e50",
"pmc": null,
"pmid": "30170755",
"pubdate": "2018-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Use of telavancin in adolescent patients with cystic fibrosis and prior intolerance to vancomycin: A case series.",
"title_normalized": "use of telavancin in adolescent patients with cystic fibrosis and prior intolerance to vancomycin a case series"
} | [
{
"companynumb": "US-PFIZER INC-2018391940",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LINEZOLID"
},
"drugadditional": "3",
... |
{
"abstract": "We herein describe the case of an 18-year-old girl who presented with dizziness and headache in 2012. In 2013, brain magnetic resonance imaging revealed multiple intracerebral small lesions and intracerebral hydrocephalus. She was diagnosed with neurosarcoidosis following a brain biopsy. Although prednisolone, methotrexate, and azathioprine were administered, her hydrocephalus worsened and her granulomatous lesions were observed to increase in number on MRI. The patient's hydrocephalus showed no improvement despite her undergoing one ventriculoperitoneal shunt procedure, one septum pellucidum fenestration, and three ventriculoatrial shunt procedures. Infliximab therapy was then initiated, which resulted in a reduction in the size of the granulomatous lesions and the improvement of the patient's clinical symptoms. Infliximab may be a viable therapeutic option for treating intractable neurosarcoidosis.",
"affiliations": "Department of Neurology, Saitama Medical University International Medical Center, Japan.",
"authors": "Sano|Hiroyasu|H|;Deguchi|Ichiro|I|;Fukuoka|Takuya|T|;Hayashi|Takeshi|T|;Uchino|Akira|A|;Adachi|Jun-ichi|J|;Yasuda|Masanori|M|;Takao|Masaki|M|;Tanahashi|Norio|N|",
"chemical_list": "D000069285:Infliximab",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.55.5506",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0918-2918",
"issue": "55(7)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000293:Adolescent; D002493:Central Nervous System Diseases; D005260:Female; D006801:Humans; D006849:Hydrocephalus; D000069285:Infliximab; D008279:Magnetic Resonance Imaging; D012507:Sarcoidosis",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "811-4",
"pmc": null,
"pmid": "27041170",
"pubdate": "2016",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Intractable Neurosarcoidosis Effectively Treated with Infliximab.",
"title_normalized": "intractable neurosarcoidosis effectively treated with infliximab"
} | [
{
"companynumb": "JP-WATSON-2016-08804",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": null,
... |
{
"abstract": "Afatinib, a second-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, is effective as first-line treatment in patients with EGFR-mutated non-small cell lung cancer (NSCLC). We report 2 cases of EGFR-mutated locally advanced NSCLC treated in neoadjuvant setting with EGFR tyrosine kinase inhibitor at University of Florence/Careggi Hospital. In both cases, afatinib was used for up to 3 months, until 1 week before surgery. Both patients achieved significant reduction (downstaging) of the pulmonary mass and lymphadenopathies and after surgery, it was decided for both cases to restore afatinib treatment up to a further 4 months. Both patients experienced local and distant disease relapses after 9 and 10 months, respectively, and then we restored the afatinib treatment.",
"affiliations": "1 Medical Oncology Unit, Azienda Ospedaliero-Universitaria Careggi, Florence, Italy.;2 Medical Oncology Unit, Misericordia Hospital, Grosseto, Italy.;3 Radiation Oncology Unit, Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy.;3 Radiation Oncology Unit, Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy.;4 Thoracic Surgery Unit, Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy.;3 Radiation Oncology Unit, Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy.;1 Medical Oncology Unit, Azienda Ospedaliero-Universitaria Careggi, Florence, Italy.;4 Thoracic Surgery Unit, Azienda Ospedaliero-Universitaria Careggi, University of Florence, Florence, Italy.",
"authors": "Mazzoni|Francesca|F|;Petreni|Paolo|P|;Perna|Marco|M|;Scotti|Vieri|V|;Bongiolatti|Stefano|S|;Livi|Lorenzo|L|;Di Costanzo|Francesco|F|;Voltolini|Luca|L|",
"chemical_list": "D047428:Protein Kinase Inhibitors; D000077716:Afatinib; C512478:EGFR protein, human; D066246:ErbB Receptors",
"country": "United States",
"delete": false,
"doi": "10.1177/0300891618775204",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-8916",
"issue": "104(6)",
"journal": "Tumori",
"keywords": "EGFR; Non-small cell lung cancer; afatinib; neo-adjuvant",
"medline_ta": "Tumori",
"mesh_terms": "D000328:Adult; D000077716:Afatinib; D000368:Aged; D002289:Carcinoma, Non-Small-Cell Lung; D066246:ErbB Receptors; D005260:Female; D006801:Humans; D008175:Lung Neoplasms; D008297:Male; D009154:Mutation; D047428:Protein Kinase Inhibitors",
"nlm_unique_id": "0111356",
"other_id": null,
"pages": "NP5-NP9",
"pmc": null,
"pmid": "29895214",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Afatinib with subsequent surgery in stage III NSCLC with EGFR mutation: Lessons learned from two clinical experiences.",
"title_normalized": "afatinib with subsequent surgery in stage iii nsclc with egfr mutation lessons learned from two clinical experiences"
} | [
{
"companynumb": "IT-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2018-BI-031586",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "AFATINIB"
},
"dr... |
{
"abstract": "Vasculitis can be a primary disorder or a cutaneous manifestation of a viral infection. The present case describes an atypical localized cutaneous varicella-zoster virus infection inducing a small vessel vasculitis in a patient with multisystem sarcoidosis. Additionally, we discuss the differential diagnoses and treatment options. Varicella-Zoster infection occurs more frequently in immunosuppressed populations and can present with uncharacteristic clinical manifestations complicating the diagnosis as in the present case.",
"affiliations": "Department of Dermatology, Oregon Health and Science University, Portland, Oregon. kellerje@ohsu.edu.",
"authors": "Clark|Ashley K|AK|;Dhossche|Julie|J|;Korcheva|Veselina B|VB|;Keller|Jesse J|JJ|",
"chemical_list": "D000998:Antiviral Agents",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "24(11)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000368:Aged; D000998:Antiviral Agents; D006562:Herpes Zoster; D006801:Humans; D008297:Male; D017445:Skin Diseases, Vascular; D017193:Skin Diseases, Viral; D014657:Vasculitis",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30695979",
"pubdate": "2018-11-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Herpes zoster presenting as unilateral vasculitis.",
"title_normalized": "herpes zoster presenting as unilateral vasculitis"
} | [
{
"companynumb": "US-PFIZER INC-2019036004",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "This is a case of an 8-year-old, Caucasian boy with a complex prior medical history who presented with worsening, acute, left-sided abdominal pain and fever after empiric treatment for a urinary tract infection. Repeat urinalysis was negative for infection. A renal ultrasound assessing for occult perinephric abscess or nephronia revealed normal kidneys but found a tubular structure adjacent to the left kidney. A CT scan further revealed a splenic infarction secondary to torsion. He had a surgical evaluation but was treated empirically with piperacillin/tazobactam for 10 days due to concern for infectious complications following splenic infarction. He had complete resolution of his pain and symptoms. He received routine vaccines for asplenia prior to being discharged home without any further sequelae.",
"affiliations": "Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.;Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.;Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.;Pediatrics, University of Alabama at Birmingham, Birmingham, Alabama, USA.",
"authors": "Molina|Adolfo L|AL|http://orcid.org/0000-0002-2461-4467;Smola|Cassi|C|;Wu|Chang L|CL|;Hofto|Meghan E|ME|",
"chemical_list": "D000900:Anti-Bacterial Agents; D010406:Penicillins; D000077725:Piperacillin, Tazobactam Drug Combination",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-228425",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "12(5)",
"journal": "BMJ case reports",
"keywords": "gastrointestinal system; medical education; paediatrics; preventative pediatrics; surgery",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000900:Anti-Bacterial Agents; D002648:Child; D006801:Humans; D008297:Male; D010406:Penicillins; D000077725:Piperacillin, Tazobactam Drug Combination; D013159:Splenic Infarction; D014102:Torsion Abnormality; D018615:Ultrasonography, Doppler, Color",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31092484",
"pubdate": "2019-05-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "20928991;9486895;19328367;3764696;17366703;30021736;22818221;26602427;1306065;5049847;22785639",
"title": "Splenic infarction from vascular torsion in a child with normal splenic anatomy.",
"title_normalized": "splenic infarction from vascular torsion in a child with normal splenic anatomy"
} | [
{
"companynumb": "US-TEVA-2019-US-1070403",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PNEUMOCOCCAL VACCINE POLYVALENT"
},
"drugadditi... |
{
"abstract": "Severe aplastic anemia is a rare and potentially life-threatening disease of the bone marrow often requiring allogeneic hematopoietic stem cell transplantation. Pathogenesis of the disease can vary and often remains enigmatic. Occasionally, severe aplastic anemia is associated with prior severe acute hepatitis. Differential diagnosis of acute non-viral hepatitis challenges the physician as pathogenesis remains unclear.We here present a case of a young patient presenting with acute hepatitis followed by severe aplastic anemia successfully treated with allogeneic hematopoietic stem cell transplantation. Due to immunosuppressive treatment with azathioprine for acute hepatitis of putative autoimmune pathogenesis and coincident infection with parvovirus B19, diagnosis of the sequential disease of acute hepatitis followed by severe aplastic anemia was complicated. We discuss the caveats and present a review of the literature.",
"affiliations": "I. Department of Medicine, University Medical Center of Hamburg-Eppendorf, Hamburg, Germany.;I. Department of Medicine, University Medical Center of Hamburg-Eppendorf, Hamburg, Germany.;Institute of Pathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.;Department of Stem Cell Transplantation, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.;II. Department of Medicine, University Medical-Center Hamburg-Eppendorf, Hamburg, Germany.;I. Department of Medicine, University Medical Center of Hamburg-Eppendorf, Hamburg, Germany.;Department of Pediatrics, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.;Department of Stem Cell Transplantation, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.;Department of Stem Cell Transplantation, University Medical Center Hamburg-Eppendorf, Hamburg, Germany.",
"authors": "Weiler-Normann|Christina|C|;Hartl|Johannes|J|;Weidemann|Sören|S|;von Pein|Ute-Marie|UM|;Fiedler|Walter|W|;Schramm|Christoph|C|;Brinkert|Florian|F|;Kröger|Nicolaus|N|;Christopeit|Maximilian|M|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "Germany",
"delete": false,
"doi": "10.1055/s-0043-121737",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0044-2771",
"issue": "56(1)",
"journal": "Zeitschrift fur Gastroenterologie",
"keywords": null,
"medline_ta": "Z Gastroenterol",
"mesh_terms": "D000208:Acute Disease; D000741:Anemia, Aplastic; D018380:Hematopoietic Stem Cell Transplantation; D006525:Hepatitis, Viral, Human; D006801:Humans; D007166:Immunosuppressive Agents; D010322:Parvoviridae Infections; D016732:Parvovirus B19, Human; D016896:Treatment Outcome",
"nlm_unique_id": "0033370",
"other_id": null,
"pages": "51-54",
"pmc": null,
"pmid": "29316578",
"pubdate": "2018-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acute hepatitis as a prequel to very severe aplastic anemia.",
"title_normalized": "acute hepatitis as a prequel to very severe aplastic anemia"
} | [
{
"companynumb": "DE-BAUSCH-BL-2018-002728",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Despite data suggesting safety and efficacy in ulcerative colitis patients treated with inpatient infliximab, prior studies did not focus on patients with extensive colitis, the group at highest risk for requiring surgery.\n\n\n\nThis was a single center, retrospective study (2008-2015) of consecutive patients who required admission because of severe extensive ulcerative colitis defined by preoperative symptoms and computed tomography scans and postoperative histology. Patients admitted for high-dose steroids were compared with steroid refractory inpatients provided with one or two infusions of infliximab. The primary study outcome was colectomy rates; secondary outcomes included mean length of stay and 60-d complication rates.\n\n\n\nA total of 174 patients required admission with steroids for extensive ulcerative colitis. Of these, 19 (10%) also received infliximab. Among the subjects treated with infliximab, 15 (78%) required total colectomy during that admission versus 81 (52%) who received steroids alone (P = 0.03). Postoperative readmission rates, surgical-site infections, return to the operating room, and all-complication rates were similar between the cohorts (P > 0.05).\n\n\n\nFor steroid refractory extensive ulcerative colitis, inpatient infliximab did not lower colectomy rates or increase postoperative complications compared with patients treated with steroids alone.",
"affiliations": "Department of Surgery, College of Medicine, The Pennsylvania State University, Hershey, Pennsylvania.;Department of Surgery, College of Medicine, The Pennsylvania State University, Hershey, Pennsylvania.;Department of Surgery, College of Medicine, The Pennsylvania State University, Hershey, Pennsylvania.;Department of Public Health Sciences, College of Medicine, The Pennsylvania State University, Hershey, Pennsylvania.;Department of Surgery, College of Medicine, The Pennsylvania State University, Hershey, Pennsylvania. Electronic address: dstewart@pennstatehealth.psu.edu.",
"authors": "Andrew|Rachel E|RE|;Lauria|Alexis|A|;Puleo|Frances J|FJ|;Berg|Arthur|A|;Stewart|David B|DB|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D005765:Gastrointestinal Agents; D013256:Steroids; D000069285:Infliximab",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jss.2017.05.077",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-4804",
"issue": "219()",
"journal": "The Journal of surgical research",
"keywords": "Colectomy; Complications; Infliximab; Steroids; Ulcerative colitis",
"medline_ta": "J Surg Res",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000893:Anti-Inflammatory Agents; D003082:Colectomy; D003093:Colitis, Ulcerative; D003131:Combined Modality Therapy; D005260:Female; D005765:Gastrointestinal Agents; D006760:Hospitalization; D006801:Humans; D000069285:Infliximab; D007262:Infusions, Intravenous; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D012720:Severity of Illness Index; D013256:Steroids; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "0376340",
"other_id": null,
"pages": "18-24",
"pmc": null,
"pmid": "29078879",
"pubdate": "2017-11",
"publication_types": "D023362:Evaluation Study; D016428:Journal Article",
"references": null,
"title": "Inpatient infliximab is ineffective at preventing colectomy for steroid refractory extensive colitis.",
"title_normalized": "inpatient infliximab is ineffective at preventing colectomy for steroid refractory extensive colitis"
} | [
{
"companynumb": "US-JNJFOC-20170702516",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "3",
"... |
{
"abstract": "A6-year-old girl affected to systemic lupus erythematosus with symptoms of fever, weakness, and lethargy, cough, chest pain, and abnormalchest x-ray. The isolated Aspergillus fumigatus was identified using partial calmodulin gene sequencing. Gradual improvement was observed onday 19 of treatment with amphotericinB (50 mg /day).",
"affiliations": "Department of Parasitology and Mycology School of Medicine Mashhad University of Medical Sciences Mashhad Iran.;Department of Pediatrics Faculty of Medicine Mashhad University of Medical Sciences Mashhad Iran.;Basic Sciences in Infectious Diseases Research Center Shiraz University of Medical Sciences Shiraz Iran.;Basic Sciences in Infectious Diseases Research Center Shiraz University of Medical Sciences Shiraz Iran.;Allergy Research Center Mashhad University of Medical Sciences Mashhad Iran.",
"authors": "Kashefi|Elham|E|;Seyedi|Seyed Javad|SJ|;Zomorodian|Kamiar|K|;Zare Shahrabadi|Zahra|Z|;Zarrinfar|Hossein|H|https://orcid.org/0000-0002-1449-4668",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.4248",
"fulltext": "\n==== Front\nClin Case Rep\nClin Case Rep\n10.1002/(ISSN)2050-0904\nCCR3\nClinical Case Reports\n2050-0904\nJohn Wiley and Sons Inc. Hoboken\n\n10.1002/ccr3.4248\nCCR34248\nCase Report\nCase Reports\nSuccessful treatment of pulmonary aspergillosis due to Aspergillus fumigatus in a child affected by systemic lupus erythematosus: A case report from Northeastern Iran\nKASHEFI et al.\nKashefi Elham 1\nSeyedi Seyed Javad 2\nZomorodian Kamiar 3\nZare Shahrabadi Zahra 3\nZarrinfar Hossein https://orcid.org/0000-0002-1449-4668\n4 Zarrinfarh@mums.ac.ir\n\n1 Department of Parasitology and Mycology School of Medicine Mashhad University of Medical Sciences Mashhad Iran\n2 Department of Pediatrics Faculty of Medicine Mashhad University of Medical Sciences Mashhad Iran\n3 Basic Sciences in Infectious Diseases Research Center Shiraz University of Medical Sciences Shiraz Iran\n4 Allergy Research Center Mashhad University of Medical Sciences Mashhad Iran\n* Correspondence\nHossein Zarrinfar, Allergy Research Center, Laboratory of Parasitology and Mycology, Ghaem Hospital, Mashhad University of Medical Sciences, Mashhad, Iran.\nEmail: Zarrinfarh@mums.ac.ir\n\n24 5 2021\n5 2021\n9 5 10.1002/ccr3.v9.5 e0424812 4 2021\n29 3 2021\n19 4 2021\n© 2021 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nA6‐year‐old girl affected to systemic lupus erythematosus with symptoms of fever, weakness, and lethargy, cough, chest pain, and abnormalchest x‐ray. The isolated Aspergillus fumigatus was identified using partial calmodulin gene sequencing. Gradual improvement was observed onday 19 of treatment with amphotericinB (50 mg /day).\n\nAmphotericin B (50 mg /day) was effective tocure a6‐year‐old girl with systemic lupus erythematosus affected to a pulmonary infection with Aspergillus fumigatus.\n\nAspergillusfumigatus\nchild\nIran\nsystemic lupus erythematosus\nMashhad University of Medical Sciences 10.13039/501100004748 970789 source-schema-version-number2.0\ncover-dateMay 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.2 mode:remove_FC converted:24.05.2021\nKashefi E , Seyedi SJ , Zomorodian K , Zare Shahrabadi Z , Zarrinfar H . Successful treatment of pulmonary aspergillosis due to Aspergillus fumigatus in a child affected by systemic lupus erythematosus: A case report from Northeastern Iran. Clin Case Rep. 2021;9 :e04248. 10.1002/ccr3.4248\n\nFunding information\n\nThe study was financially supported by the Deputy of Research of MUMS with No. 970789\n==== Body\n1 INTRODUCTION\n\nA 6‐year‐old girl affected with systemic lupus erythematosus with symptoms of fever, weakness, and lethargy, cough, chest pain, and abnormal chest X‐ray. The isolated Aspergillus fumigatus was identified using partial calmodulin gene sequencing. Gradual improvement was observed on day 19 of treatment with amphotericin B (50 mg/day).\n\nSystemic lupus erythematosus (SLE) is a chronic autoimmune disorder that can be severe and life‐threatening. It is an inflammatory disease with unknown cause that manifests as kidney, skin‐mucosal, joint, blood, cardiopulmonary, neurological, or immunological involvement. 1 Death in SLE patients may be due to organ involvement, treatment complications, or cardiovascular disorders. 1 Infections are one of the leading causes of death in children and adults with SLE. 2 , 3 Pulmonary aspergillosis (PA) is a fungal infection caused by Aspergillus species, usually associated with primary immunodeficiency, transplant patients, and the use of immunosuppressive drugs. 4 , 5 , 6 However, PA is rarely reported among juvenile systemic lupus erythematosus (JSLE) patients. 7 , 8 More than 90% of patients with PA have a history of corticosteroid treatment, immunosuppressive and broad‐spectrum antibiotics therapies, and acute granulocytopenia. 3 According to some studies, the mortality rate of untreated PA is approximately 100% and the life expectancy in patients treated with amphotericin B is approximately 34%. 9 Effective management of PA requires rapid and accurate diagnosis based on clinical signs and paraclinical findings. In some cases, high‐resolution computed tomography (CT) scan of the lungs can be a diagnostic method for PA among hematologic patients. 10 We describe a case of A fumigatus isolated from a PA in a child affected by SLE that was successfully treated with a systemic amphotericin B.\n\n2 CASE REPORT\n\nA six‐year‐old girl living in Mashhad, Iran, has been suffering from SLE since she was 5 years old. In August 2018, she was admitted to Akbar Pediatric Hospital in Mashhad due to a week‐long fever, and then generalized body pain, weakness and lethargy, accompanied by cough and chest pain. Moreover, she was suffering from abdominal pain, complaining of severe and intermittent headache in the frontal or retro‐orbital area along with nausea, vomiting and diarrhea. The chest radiograph appearance showed effusion pleural effusion, pneumothorax, consolidation with dimensions of 43 × 66 mm, and collapse in the left lung (Figure 1). Also, abdominal ultrasound showed hepatomegaly and bowel dilatation in large intestine. Her laboratory and hematological findings showed white blood cell (WBC) = 12.8 × 10⁹/L, red blood cell (RBC) = 3.8 × 1012/L, hemoglobin (Hb) = 10.7 g/dl, hematocrit (Ht) = 33.1%, platelet (Plt) = 460 × 109/L, neutrophil (Neu)=51%, lymphocyte (Lym) = 40%, sweat test Na=56 mEq/L, sweat test Cl=38 mEq/L, pH=7.3, PCO2=47 mm Hg, PO2=34.8 mm Hg, HCO3=22.5 mEq/L, blood culture=after 48 hours was negative, complement level C3 = 49 mg/dL, C4 = 12 mg/dL. The patient took steroid medications such as budesonide, hydrocortisone, prednisolone (5 mg/day for 2 days), and also hydroxychloroquine (100 mg / day for 2 days), and amikacin. One week after admission and taking the mentioned drugs, the patient's laboratory results were as follows: WBC=11.1 × 10⁹/L, RBC=4.6 × 1012/L, Hb=12.8 g/dL, Ht=38.7%, Plt=390 × 10⁹/L, Neu=64%, Lym=29%, urea=42 mg/dL, creatinine=0.8 mg/dL). One month after admission and taking steroid drugs, due to increased respiratory symptoms, C‐reactive protein (CRP) = 67 mg/dL, and erythrocyte sedimentation rate (ESR) = 34 mm/h, the physicians suspected an infection. The bronchial mucosa was examined using a fiber‐optic bronchoscopy that revealed erythematous, inflamed, thick, and abundant discharge. Moreover, degenerated mycelium was observed in direct microscopic examination with 15% potassium hydroxide (KOH). Direct smear of bronchoalveolar lavage (BAL) specimen did not show fast acid bacilli, and culture was negative for Mycobacterium tuberculosis (BK) and other bacteria. The BAL fluid was cultured on sabouraud dextrose agar with chloramphenicol (SC) (Merck, Germany) medium at 35°C for 5 days. The color of the grown colonies was white and wrinkled initially and then turned to green‐turquoise (Figure 2). Microscopic characteristics demonstrated smooth‐walled conidiophores, and terminate in a clavate vesicle in the absence of metulae, uniseriate and the rounded conidia which was classified as Aspergillus species. Therefore, this disease was categorized according to EORTC guidelines as probable IPA. After DNA extraction (DENAzist Asia, Mashhad, Iran) according to the manufacturer's instructions, the final identification was performed using partial calmodulin (CaM) gene sequencing using two primer pairs, namely cmd5 (CCGAGTACAAGGAGGCCTTC) and cmd6 (CCGATAGAGGTCATAACGTGG). 11 The genome sequence of the isolated Aspergillus was identified using BLAST algorithm (NCBI) and submitted to the GenBank under the accession number MW459247 as A fumigatus. Antifungal susceptibility testing was performed according to the CLSI M38‐A2 broth microdilution method guidelines, using four antifungals, namely itraconazole, voriconazole, fluconazole, and caspofungin. 12 The antifungal minimum inhibitory concentration (MIC) values of itraconazole, voriconazole, fluconazole, and caspofungin were estimated 1, 0.25, 64, and 4 µg/mL, respectively.\n\nFIGURE 1 Chest X‐ray revealed consolidation in the left lung, arrow A and B, and it manifested collapse, in the left lung, arrow C\n\nFIGURE 2 Appearance of Aspergillus fumigatus colonies on sabouraud dextrose agar with chloramphenicol (SC)\n\nFollowing, amphotericin B injection (50 mg/day) was prescribed for 19 days to treat this patient. With the start of taking the amphotericin B, the patient's gradual recovery continued, which was even seen on the chest radiograph appearance (Figure 3). Finally, the patient was discharged after 41 days of hospitalization with a relative improvement.\n\nFIGURE 3 Chest X‐ray revealed gradual recovery in the lung left, after chest tube and treatment with amphotericin B\n\n3 DISCUSSION\n\nPA is one of the opportunistic fungal infections in susceptible patients with immune disorders that has increased in recent years. 4 , 5 , 6 , 13 Among patients with autoimmune diseases, individuals with SLE have predisposing factors for the spread of infection, which leads to death in the first year after diagnosis, approximately with a mortality of 20%‐55%. 1 , 14 Predisposing factors for infection in SLE patients include immunodeficiency, low complement levels, lymphopenia, neutropenia, and immunosuppressive drugs include steroid drugs. 14 In the study, the serum levels of complement C3 and C4 were 49 and 12 mg/dL, respectively, which was lower than the normal level of complement. This finding is similar to a 2012 study by Camila Franca et al in Brazil on C3 depletion. Their patient was a 14‐year‐old girl with JSLE with a C3 level of 13 mg/dL. 15 Although most infections in SLE are caused by bacterial pathogens, new articles demonstrate an increasing incidence of invasive fungal lung infections. 9 , 16 In addition, SLE patients with fungal infections have a poorer prognosis than other individuals without SLE. 9 The pattern of prescribing antifungal drugs in children with aspergillosis is different from that in adults, so more care should be taken in their diagnosis and treatment. 17 According to some results, mortality in untreated PA in SLE patients is approximately 100% and the life expectancy among patients treated with amphotericin B is approximately 34%. 9 Amphotericin B alone or in combination with 5‐fluorocytosine or rifampin is the mainstay of treatment for PA, but the duration of treatment is still unknown. 18 In our patient, after 19 days of administration and use of amphotericin B, a gradual improvement in clinical condition and radiography was observed. Although the liposomal form of amphotericin B has fewer side effects, it could not be used in this governmental hospital due to its high price and lack of availability. In this patient, after taking immunosuppressive drugs such as hydrocortisone, prednisolone, budesonide palmicort, the count peripheral blood lymphocytes decreased to 11% and leukocytes to 1.7 × 10⁹/L. In the VBG test on the first day of hospitalization, the high level of PCO2 (47 mm Hg) was probably due to incomplete ventilation and respiratory distress in the patient. As a result, the concentration of CO2 in the blood increased and the patient developed respiratory acidosis, which following medical procedures the PCO2 decreased to 42.3 mm Hg. Indeed, CRP has been traditionally utilized as a marker of infection and often in excess of 50 mg/dL can indicate the presence of infections in SLE patients. The level of this marker in the patient was 67 mg/dL, which was suspected to have an infection due to respiratory symptoms and radiographic images. Although C albicans and P jiroveci are common fungal agents in patients with SLE, Aspergillus species are also rarely reported. 3 , 7 , 19 In a study by Silva et al in Brazil (2012) on patients with JSLE, 2.1% had acute PA. 8 More than 90% of patients with invasive PA have a history of corticosteroid use, immunosuppressive drugs, acute granulocytopenia, or broad‐spectrum antibiotics. 3 , 19 However, mortality in PA depends on the degree and duration of granulocytopenia, the organs affected, and the treatment strategies. Bronchoscopy is one of the effective diagnostic methods in these patients, which was also used in this study. High‐resolution CT scan of the lungs can be a helpful diagnostic method for PA, which in this case showed an effusion pleural effusion along with pneumothorax, and consolidation due to the infection. However, one of the limitations that can be mentioned in this study is the unavailability of lung tissue biopsy for pathological examinations. In this study, calmodulin gene was used to identify the Aspergillus isolate, which is one of the effective genes in the accurate identification of different species in this genus. An intriguing point in our study was that the isolated A fumigatus was resistant to caspofungin based on results of in vitro assays, which show the importance of antifungal resistance among isolates of A fumigatus in Iran. 20 , 21 Thus, this issue can be a concern, and therefore, experimental treatments should be limited except in special cases.\n\n4 CONCLUSION\n\nA correct diagnosis of PA and timely treatment can relieve their symptoms and decrease complications. Thus, correct differentiation between opportunistic fungal agents should be considered, and this case can be an interesting topic to start a more comprehensive study in this group of patients.\n\nCONFLICT OF INTEREST\n\nThe authors declare that they have no conflicts of interest.\n\nAUTHOR CONTRIBUTIONS\n\nEK: contributed to this manuscript by specimen collection and routine laboratory examinations and writing the manuscript. SJS: contributed to the patient's care; initially diagnosed the patient; and performed the follow‐up care. KZ and ZZS: contributed to this manuscript by identifying fungi, studying the antifungal susceptibility. HZ: (corresponding author) contributed to this manuscript by collecting information for the case report. All authors: reviewed and approved the final manuscript.\n\nETHICAL STATEMENT\n\nThis case was approved with an Ethics Committee code: IR.MUMS.MEDICAL.REC.1397.576.\n\nACKNOWLEDGMENTS\n\nThis case was derived from a Master's thesis and financially supported by the Deputy of Research of Mashhad University of Medical Sciences (grant No. 970789). Published with written consent of the patient.\n\nDATA AVAILABILITY STATEMENT\n\nWritten informed consent was obtained from patient and was available for provision to the journal on demand.\n==== Refs\nREFERENCES\n\n1 Bernatsky S , Boivin JF , Joseph L , et al. Mortality in systemic lupus erythematosus. Arthritis Rheum. 2006;54 (8 ):2550‐2557.16868977\n2 Chai LY‐A , Hsu L‐Y . Recent advances in invasive pulmonary aspergillosis. Curr Opin Pulmonary Med. 2011;17 (3 ):160‐166.21252677\n3 Canova E , Rosa D , Vallada M , Silva C . Invasive aspergillosis in juvenile systemic lupus erythematosus. A clinicopathologic case. Clin Exp Rheumatol. 2002;20 (5 ):736.12412216\n4 Zarrinfar H , Mirhendi H , Makimura K , Satoh K , Khodadadi H , Paknejad O . Use of mycological, nested PCR, and real‐time PCR methods on BAL fluids for detection of Aspergillus fumigatus and A. flavus in solid organ transplant recipients. Mycopathologia. 2013;176 (5–6 ):377‐385.24045934\n5 Zanganeh E , Zarrinfar H , Rezaeetalab F , et al. Predominance of non‐fumigatus Aspergillus species among patients suspected to pulmonary aspergillosis in a tropical and subtropical region of the Middle East. Microb Pathog. 2018;116 :296‐300.29410233\n6 Zarrinfar H , Mirhendi H , Fata A , Khodadadi H , Kordbacheh P . Detection of Aspergillus flavus and A. fumigatus in bronchoalveolar lavage specimens of hematopoietic stem cell transplants and hematological malignancies patients by real‐time polymerase chain reaction, nested PCR and mycological assays. Jundishapur J Microbiol. 2015;8 (1 ):e13744. 25763133\n7 Katz A , Ehrenfeld M , Livneh A , et al. Aspergillosis in systemic lupus erythematosus. Semin Arthritis Rheum. 1996;26 (3 ):635‐640.8989808\n8 Silva M , Ribeiro A , Fiorot F , et al. Invasive aspergillosis: a severe infection in juvenile systemic lupus erythematosus patients. Lupus. 2012;21 (9 ):1011‐1016.22451602\n9 Wang LR , Barber CE , Johnson AS , Barnabe C . Invasive fungal disease in systemic lupus erythematosus: a systematic review of disease characteristics, risk factors, and prognosis. Paper presented at: Seminars in arthritis and rheumatism; 2014.\n10 Roilides E . Early diagnosis of invasive aspergillosis in infants and children. Med Mycol. 2006;44 (s1 ):199‐205.16702098\n11 Hong S‐B , Go S‐J , Shin H‐D , Frisvad JC , Samson RA . Polyphasic taxonomy of Aspergillus fumigatus and related species. Mycologia. 2005;97 (6 ):1316‐1329.16722222\n12 Alastruey‐Izquierdo A , Melhem MS , Bonfietti LX , Rodriguez‐Tudela JL . Susceptibility test for fungi: clinical and laboratorial correlations in medical mycology. Rev Inst Med Trop São Paulo. 2015;57 :57‐64.\n13 Hedayati MT , Armaki MT , Charati JY , Hedayati N , Seyedmousavi S , Denning DW . Burden of fungal infections in Iran. J Infect Dev Countries. 2018;12 (10 ):910‐918.\n14 Campos Costa F , Freitas J , Oliveira M , Malcata A . Lupus nephritis complicated by cytomegalovirus colitis, aspergillosis and brain abscess. Lupus. 2019;28 (12 ):1495‐1497.31474190\n15 França C , Cavalcante EG , Ribeiro A , Oliveira GT , Litvinov N , Silva CA . Disseminated histoplasmosis in a juvenile lupus erythematosus patient. Acta Reumatol Port. 2012;37 (3 ):279.\n16 Jahromi S . A retrospective study of the risk factors for invasive Aspergillosis in Iran. Virol Mycol. 2013;2 :1. 10.4172/2161-0517.1000111\n17 Cervera R , Khamashta MA , Font J , et al. Morbidity and mortality in systemic lupus erythematosus during a 10‐year period: a comparison of early and late manifestations in a cohort of 1,000 patients. Medicine. 2003;82 (5 ):299‐308.14530779\n18 Perfect JR , Pickard WW , Hunt DL , Palmer B , Schell WA . The use of amphotericin B in nosocomial fungal infection. Rev Infect Dis. 1991;13 (3 ):474‐479.1866552\n19 Gonzalez‐Crespo MR , Gomez‐Reino JJ . Invasive aspergillosis in systemic lupus erythematosus. Semin Arthritis Rheum. 1995;24 (5 ):304‐314. 10.1016/S0049-0172(95)80002-6 7604298\n20 Nabili M , Shokohi T , Moazeni M , et al. High prevalence of clinical and environmental triazole‐resistant Aspergillus fumigatus in Iran: is it a challenging issue? J Med Microbiol. 2016;65 (6 ):468‐475.27008655\n21 Ahangarkani F , Badali H , Abbasi K , et al. Clonal expansion of environmental triazole resistant aspergillus fumigatus in Iran. J Fungi. 2020;6 (4 ):199.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-0904",
"issue": "9(5)",
"journal": "Clinical case reports",
"keywords": "Aspergillusfumigatus; Iran; child; systemic lupus erythematosus",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "e04248",
"pmc": null,
"pmid": "34084517",
"pubdate": "2021-05",
"publication_types": "D002363:Case Reports",
"references": "29410233;14530779;7604298;32004161;22451602;21252677;24045934;33019714;8989808;25763133;12412216;26465371;31474190;16868977;27008655;1866552;30408904;16722222;25129259;23348119",
"title": "Successful treatment of pulmonary aspergillosis due to Aspergillus fumigatus in a child affected by systemic lupus erythematosus: A case report from Northeastern Iran.",
"title_normalized": "successful treatment of pulmonary aspergillosis due to aspergillus fumigatus in a child affected by systemic lupus erythematosus a case report from northeastern iran"
} | [
{
"companynumb": "IR-PFIZER INC-2021767367",
"fulfillexpeditecriteria": "1",
"occurcountry": "IR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HYDROCORTISONE SODIUM SUCCINATE"
},
"drugaddit... |
{
"abstract": "A 51-year-old man with a past history of hypothyroidism suddenly became comatose after a few days of general malaise and headache. On admission to our hospital, his consciousness level was Japan Coma Scale III-200, but no focal neurological deficits were evident. Serum anti-thyroglobulin antibody was >4,000 IU/ml and anti-thyroid peroxidase antibody was 265 IU/ml. Well characterized neuronal antibodies were not fully examined in this case, but based on high titers of serum thyroid antibodies, methylprednisolone pulse therapy was started under diagnosis of suspected Hashimoto encephalopathy. Although methylprednisolone pulse therapy was effective, every time the dose of oral prednisolone was reduced, relapse attacks similar to the first episode occurred, a total of seven times. At each relapse, cerebrospinal fluid findings and MRI findings were normal. Plasmapheresis and azathioprine were added, until two years after onset, when further acute neurological attacks no longer occurred, but attention and memory impairments persisted. Relapse in Hashimoto encephalopathy is not rare; careful, long-term follow-up is needed.",
"affiliations": "Department of Neurology, Graduate School of Medical Sciences, Kumamoto University.;Department of Neurology, Saiseikai Kumamoto Hospital.;Department of Neurology, Graduate School of Medical Sciences, Kumamoto University.;Department of Neurology, Saiseikai Kumamoto Hospital.",
"authors": "Harada|Shizuka|S|;Inatomi|Yuichiro|Y|;Nakajima|Makoto|M|;Yonehara|Toshiro|T|",
"chemical_list": "D001323:Autoantibodies; D015415:Biomarkers; D013954:Thyroglobulin; D011239:Prednisolone; D001379:Azathioprine; D008775:Methylprednisolone",
"country": "Japan",
"delete": false,
"doi": "10.5692/clinicalneurol.cn-001361",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0009-918X",
"issue": "60(3)",
"journal": "Rinsho shinkeigaku = Clinical neurology",
"keywords": "Hashimoto encephalopathy; anti-thyroglobulin antibody; azathioprine; plasmapheresis; steroid",
"medline_ta": "Rinsho Shinkeigaku",
"mesh_terms": "D001323:Autoantibodies; D001379:Azathioprine; D015415:Biomarkers; D050031:Hashimoto Disease; D006801:Humans; D007167:Immunotherapy; D008297:Male; D008775:Methylprednisolone; D008875:Middle Aged; D010951:Plasma Exchange; D011239:Prednisolone; D020551:Pulse Therapy, Drug; D012008:Recurrence; D013954:Thyroglobulin",
"nlm_unique_id": "0417466",
"other_id": null,
"pages": "200-205",
"pmc": null,
"pmid": "32101843",
"pubdate": "2020-03-31",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "A suspected case of Hashimoto encephalopathy with frequent relapses despite multiple courses of immunotherapy.",
"title_normalized": "a suspected case of hashimoto encephalopathy with frequent relapses despite multiple courses of immunotherapy"
} | [
{
"companynumb": "JP-PFIZER INC-2020117899",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "This is the second of two manuscripts detailing the pharmacodynamic derivation of peginterferon lambda-1a (Lambda) dosing and treatment durations for Phase 3 studies in hepatitis C virus (HCV) infection, based on Phase 2 data. Herein, we describe the derivation of regression models for 12-week on-treatment virologic response and safety outcomes at 120, 180, and 240 μg Lambda with ribavirin. In patients with HCV genotypes 1 or 4, there was a significant (P = 0.024) relationship between undetectable HCV-RNA at Week 4 and Lambda exposure (AUC or Cmax ), with the largest difference between adjacent dose levels between the 180 and 120 μg exposure ranges. Risk of Grade 3-4 aminotransferase or bilirubin elevations relative to a peginterferon alfa-2a/ribavirin control were related to Lambda exposure for all patients, and the largest increase between adjacent dose levels was seen for 240 versus 180 μg. Anemia and neutropenia events were lower than control across all doses and exposures. Based on these data and those in our previous manuscript, Phase 3 studies will evaluate fixed 180 µg doses of Lambda in combination with ribavirin and a direct-acting antiviral for 24-48 weeks in HCV genotypes 1 or 4 or 12-24 weeks in genotypes 2 or 3.",
"affiliations": "Bristol-Myers Squibb Research and Development at Hopewell, Hopewell, NJ, USA.",
"authors": "Hruska|Matthew|M|;Wang|Xiaodong|X|;Chan|Phyllis|P|;Ahmad|Alaa|A|;Freeman|Jeremy|J|;Horga|Maria Arantxa|MA|;Hillson|Jan|J|;Kansra|Vikram|V|;Lopez-Talavera|Juan-Carlos|JC|",
"chemical_list": "D000998:Antiviral Agents; C471044:IFNL3 protein, human; D016898:Interferon-alpha; D007378:Interleukins; D012367:RNA, Viral; D011994:Recombinant Proteins; C000600496:peginterferon lambda-1a; D011092:Polyethylene Glycols; D012254:Ribavirin; D007372:Interferons; C100416:peginterferon alfa-2a",
"country": "England",
"delete": false,
"doi": "10.1002/jcph.361",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0091-2700",
"issue": "55(1)",
"journal": "Journal of clinical pharmacology",
"keywords": "dose-selection; exposure-response models; pharmacodynamics; simulation",
"medline_ta": "J Clin Pharmacol",
"mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D017326:Clinical Trials, Phase III as Topic; D004305:Dose-Response Relationship, Drug; D004311:Double-Blind Method; D004359:Drug Therapy, Combination; D005260:Female; D005838:Genotype; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D016898:Interferon-alpha; D007372:Interferons; D007378:Interleukins; D016015:Logistic Models; D008297:Male; D008875:Middle Aged; D008954:Models, Biological; D011092:Polyethylene Glycols; D012367:RNA, Viral; D011994:Recombinant Proteins; D012254:Ribavirin; D016896:Treatment Outcome; D019562:Viral Load",
"nlm_unique_id": "0366372",
"other_id": null,
"pages": "73-80",
"pmc": null,
"pmid": "25042797",
"pubdate": "2015-01",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article",
"references": null,
"title": "Derivation of Phase 3 dosing for peginterferon lambda-1a in chronic hepatitis C, Part 2: Exposure-response analyses for efficacy and safety variables.",
"title_normalized": "derivation of phase 3 dosing for peginterferon lambda 1a in chronic hepatitis c part 2 exposure response analyses for efficacy and safety variables"
} | [
{
"companynumb": "US-ROCHE-1142637",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PEGINTERFERON ALFA-2A"
},
"drugadditional": null,
... |
{
"abstract": "Huntington's disease is caused by at least 36 cytosine-adenine-guanine (CAG) repeats in an HTT gene allele, but repeat tracts in the intermediate range (27-35 repeats) also display a subtle phenotype. This patient had a slightly elongated CAG repeat tract (29 repeats), a prominent family history of Parkinson's disease (PD), and a clinical phenotype mostly consistent with PD, but early dystonia and poor levodopa response. Neurophysiological test results were more consistent with Huntington's disease (HD) than PD. It is suggested that the intermediate allele modulated the clinical phenotype of PD in this patient.",
"affiliations": "Department of Neurology, Siun Sote North Karelia Central Hospital, 80120 Joensuu, Finland. jussi.sipila@utu.fi.",
"authors": "Jot|Sipilä|S|0000-0003-0183-9054",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/brainsci9100245",
"fulltext": "\n==== Front\nBrain SciBrain ScibrainsciBrain Sciences2076-3425MDPI 10.3390/brainsci9100245brainsci-09-00245Case ReportParkinsonism with a Hint of Huntington’s from 29 CAG Repeats in HTT https://orcid.org/0000-0003-0183-9054JOT Sipilä 1231 Department of Neurology, Siun Sote North Karelia Central Hospital, 80120 Joensuu, Finland; jussi.sipila@utu.fi2 Division of Clinical Neurosciences, Turku University Hospital, 20521 Turku, Finland3 Department of Neurology, University of Turku, 20520 Turku, Finland22 9 2019 10 2019 9 10 24504 9 2019 20 9 2019 © 2019 by the author.2019Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Huntington’s disease is caused by at least 36 cytosine-adenine-guanine (CAG) repeats in an HTT gene allele, but repeat tracts in the intermediate range (27–35 repeats) also display a subtle phenotype. This patient had a slightly elongated CAG repeat tract (29 repeats), a prominent family history of Parkinson’s disease (PD), and a clinical phenotype mostly consistent with PD, but early dystonia and poor levodopa response. Neurophysiological test results were more consistent with Huntington’s disease (HD) than PD. It is suggested that the intermediate allele modulated the clinical phenotype of PD in this patient.\n\nclinical neurologydifferential diagnosisgeneticsneurodegenerative diseaseparkinsonismmovement disordersneurophysiology\n==== Body\n1. Introduction\nHuntington’s disease (HD) is caused by a cytosine-adenine-guanine (CAG) repeat tract of at least 36 repeats in the HTT gene while intermediate alleles (IAs, 27–35 CAG repeats) are associated with a subtle, or sometimes even an overt phenotype [1,2,3,4]. The typical movement disorder in HD is characterized by both hyper- and hypokinesia with hyperkinesia more prominent in the early stages. However, in the rare Westphal variant, most often found in patients with disease onset before adulthood, hypokinesia predominates from the onset. Interestingly, HD has also been reported to manifest as a levodopa-responsive multiple system atrophy (MSA) [5]. Moreover, IAs have been reported to even cause manifest HD in some cases but this is being debated [6,7,8,9,10]. The reported prevalence of IAs on the population level in Caucasians is 6%, but this is dependent on the chromosome 4 haplotype distribution in the population and is therefore probably much lower in Finland where the haplotype distribution differs from other Western European populations [11,12,13]. Here is presented a patient with a phenotype largely consistent with akinetic-rigid Parkinson’s disease but with peculiar features suggesting that the intermediate HTT allele (29 CAG repeats) may have modulated the phenotype.\n\n2. Case Report\nThe patient presented at the age of 71 years with gait difficulties that had developed during the preceding year and characterized by slowing of ambulation and involuntary bending of the toes when walking. He had also developed hypokinesia in all activities, deterioration of handwriting, constipation and a dry cough. On examination, hypokinesia and hypomimia were present along with a forward stooping posture, short and shuffling gait, impaired balance control and clumsiness of fine motor control. The signs were more obvious on the left side and he also leaned left when walking. According to the patient, his sister had been diagnosed with PD at the age of 50 years and died at the age of 64 years. His maternal uncle had also developed PD at the age of 60–70 years. The patient records for these relatives are not available.\n\nBeta-CIT Spect revealed symmetric and severe depletion of dopamine transporter proteins in the putamina and slightly less severe, diffuse depletion in the caudate nuclei (Figure 1). There were minor changes in thyroid function testing that were normalized after the initiation of thyroxine replacement therapy. Creatine kinase levels were slightly elevated (up to 500) and an extensive muscle disease work-up (including e.g., MRI imaging and genetic panel testing) was performed leading only to a diagnosis of axial and limb muscle myopathy and monoallelic mutations associated with recessively inherited diseases in AGL and SBF1 genes which were apparently incidental findings. Polysomnography revealed a severe sleep apnoea (oxygen desaturation index 37.5 /h) with desaturations down to 45% during rapid eye-movement (REM)-sleep. REM behavioral sleep disorder was not observed. Several tests, including head non-contrast computed tomography (Figure 1), bronchoscopy and colonoscopy, lung function tests, and many routine blood tests, provided normal results.\n\nThe patient was treated with levodopa (up to 600 mg per day with entacapone), ropinirole and amantadine along with physical therapy. These proved of little benefit, although discontinuation (because of no apparent benefit) of amantadine at four years from symptom onset led to profound rigidity and difficulties in the initiation of walking which both improved when amantadine was continued. Amitriptyline, gabapentin and tizanidine were prescribed for pain with also a modest effect at best. Botulinum toxin injections were tried for the feet to no effect.\n\nFive years after symptom onset the patient was alert and oriented. He had camptocormia but no Pisa sign. His speech was dysarthric and therefore difficult to understand at times. No cognitive decline was evident and CERAD had been normal a year earlier. There were no observations of psychiatric symptoms or hallucinations. There was only slight postural and action tremor evident in the upper limbs with no resting tremor. There were no dyskinetic or choreatic movements despite dopaminergic medication. Slight rigidity was observed, mostly in the upper limbs. Bradykinesia was evident, the gait was shuffling. Postural reflexes were impaired, but he was able to walk unassisted in the examination room. He used a walker at home and an electric moped when moving outside. Saccade initiation was slightly slow, and saccades were slightly hypometric, but the eye movement range was full. He was able to keep his tongue protruded for 10 s without problems. There were only mild autonomic symptoms. Of clinical rating scales, Unified Parkinson’s Disease Rating Scale (UPDRS) III gave 40 points, Unified Huntington’s Disease Rating Scale (UHDRS) III 20 points, Unified Multiple System Atrophy Rating Scale (UMSARS) II 19 points and UMSARS III 17 points.\n\nBecause of the poor levodopa response (although very high doses were not tried) and previous reports of atypical manifestations of HD, HTT was analysed and the test showed alleles of 29 and 17 CAG repeats. To further differentiate between HD and PD, the blink reflex was tested with a result showing a swift habituation with normal R1 and R2 latencies.\n\nA tendency to fall intermittently had developed seven years from symptom onset. At this time the patient also developed delusions and anxiety which were somewhat relieved with the discontinuation of ropinirole. CERAD was performed again with pathologic results only in Mini Mental State Examination (23/30 including full points in orientation and 4/5 points in serial-7 s) and constructional praxis recall (33%, while word recall was 75%). Two months after this he fell at home, sustaining a femoral fracture which was treated surgically. Recovery was slow and the patient died of pneumonia five weeks after the operation. No autopsy was performed. The family members were given genetic counselling, but none of them have opted for predictive testing.\n\n3. Discussion\nThis patient’s phenotype was mainly consistent with Parkinson’s disease. Considering the MDS clinical diagnostic criteria for Parkinson’s disease [14], the patient manifested bradykinesia and asymmetric rigidity, two of the cardinal features of PD. There were also no absolute exclusion criteria or red flags present. Additionally, the signs and symptoms were better captured by UPRDS than UHDRS or UMSARS. On the other hand, he fulfilled no supportive criteria either and therefore a diagnosis of clinically established PD cannot be made. Considering that HTT IAs are known to exert discernible effects on physiology [1,2,3], it appears plausible that this patient’s IA affected the phenotype. Consistent with this, this patient’s blink reflex results habituated swiftly similarly to patients with HD whereas in PD delayed or no habituation has been reported [15,16,17]. Moreover, although the clinical phenotype in this patient was mostly consistent with PD, there was early dystonia when still untreated which is very uncommon in PD and, according to Tolosa and Compta, should raise the suspicion of other entities [18].\n\nConsidering the rarity of HD in Finland and the population genetic factors underlying this [12,13], it is unlikely that the association presented here was a mere coincidence. Indeed, the only study that has studied the matter so far in Finns reported an IA prevalence of 0.9% [11]. Furthermore, somatic mosaicism is well documented in HD with the repeat lengths longest in the brain regions that are the worst affected by the disease process [19,20,21]. Therefore, the IA may well exert more effects than could be deduced from the mere blood test analysis. Interestingly, a recent Spanish study reported an IA prevalence of 2.9% among healthy controls and 3.5% among patients with PD whereas the frequency was 5.3% among patients with frontotemporal lobar degeneration and 6.0% among patients with Alzheimer’s disease (AD) and the difference was statistically significant only between healthy controls and AD patients [22]. They also reported no atypical symptoms or clinical features distinctive of HD among IA carriers, but the analysis appears to primarily have been aimed at finding signs of HD among the carriers whereas the patient reported here was analysed in more depth. All in all, considering the early dystonia, the poor levodopa response and neurophysiology results suggestive of HD rather than PD as well as the clinical criteria, it appears that the HTT IA modulated the parkinsonism phenotype of this patient.\n\nAcknowledgments\nThis study has received no funding. The author would like to thank Raija Soikkeli, MD, for neurophysiological studies in this case.\n\nConflicts of Interest\nThe author has nothing to disclose.\n\nFigure 1 Beta-CIT-Spect and non-contrast computed tomography imaging excerpts from the time of diagnosis.\n==== Refs\nReferences\n1. Cubo E. Ramos-Arroyo M.A. Martinez-Horta S. Martínez-Descalls A. Calvo S. Gil-Polo C. Clinical manifestations of intermediate allele carriers in Huntington disease Neurology 2016 87 571 578 10.1212/WNL.0000000000002944 27402890 \n2. Killoran A. Biglan K.M. Jankovic J. Eberly S. Kayson E. Oakes D. Young A.B. Shoulson I. Characterization of the Huntington intermediate CAG repeat expansion phenotype in PHAROS Neurology 2013 80 2022 2027 10.1212/WNL.0b013e318294b304 23624566 \n3. Savitt D. Jankovic J. Clinical phenotype in carriers of intermediate alleles in the huntingtin gene J. Neurol. Sci. 2019 402 57 61 10.1016/j.jns.2019.05.010 31103960 \n4. Ha A.D. Beck C.A. Jankovic J. Intermediate CAG repeats in Huntington’s disease: Analysis of COHORT Tremor Other Hyperkinet. Mov. 2012 2 10.7916/D8FF3R2P \n5. Reuter I. Hu M.T. Andrews T.C. Brooks D.J. Clough C. Chaudhuri K.R. Late onset levodopa responsive Huntington’s disease with minimal chorea masquerading as Parkinson plus syndrome J. Neurol. Neurosurg. Psychiatry 2000 68 238 241 10.1136/jnnp.68.2.238 10644798 \n6. Squitieri F. Jankovic J. Huntington’s disease: How intermediate are intermediate repeat lengths? Mov. Disord. 2012 27 1714 1717 10.1002/mds.25172 23008174 \n7. Ha A.D. Jankovic J. Exploring the correlates of in intermediate CAG repeats in Huntington disease Postgrad. Med. 2011 123 116 121 10.3810/pgm.2011.09.2466 21904093 \n8. Garcia-Ruiz P.J. Garcia-Caldentey J. Herranz A. Feliz C. del Val J. Martínez-Castrillo J.C. Late onset Huntington’s disease with 29 CAG repeat expansion J. Neurol. Sci. 2016 363 114 115 10.1016/j.jns.2016.02.030 27000233 \n9. Herishanu Y.O. Parvari R. Pollack Y. Shelef I. Marom B. Martino T. Cannella M. Squitieri F. Huntington disease in subjects from an Israeli Karaite community carrying alleles of intermediate and expanded CAG repeats in the HTT gene: Huntington disease or phenocopy? J. Neurol. Sci. 2009 277 143 146 10.1016/j.jns.2008.11.005 19059613 \n10. Oosterloo M. Van Belzen M.J. Bijlsma E.K. Roos R.A. Is there convincing evidence that intermediate repeats in the HTT gene cause Huntington’s disease? J. Huntingt. Dis. 2015 4 141 148 10.3233/JHD-140120 \n11. Kay C. Collins J.A. Wright G.E. Baine F. Miedzybrodzka Z. Aminkeng F. Semaka A.J. McDonald C. Davidson M. Madore S.J. The molecular epidemiology of Huntington disease is related to intermediate allele frequency and haplotype in the general population Am. J. Med Genet. Part B Neuropsychiatr. Genet. 2018 177 346 357 10.1002/ajmg.b.32618 29460498 \n12. Sipilä J.O. Hietala M. Siitonen A. Päivärinta M. Majamaa K. Epidemiology of Huntington’s disease in Finland Park. Relat. Disord. 2015 21 46 49 10.1016/j.parkreldis.2014.10.025 25466405 \n13. Ylönen S. Sipilä J.O. Hietala M. Majamaa K. HTT haplogroups in Finnish patients with Huntington disease Neurol. Genet. 2019 5 e334 10.1212/NXG.0000000000000334 31086827 \n14. Postuma R.B. Berg D. Stern M. Poewe W. Olanow C.W. Oertel W. Obeso J. Marek K. Litvan I. Lang A.E. MDS clinical diagnostic criteria for Parkinson’s disease Mov. Disord. 2015 30 1591 1601 10.1002/mds.26424 26474316 \n15. Esteban A. Giménez-Roldàn S. Blink reflex in Huntingon’s chorea and Parkinson’s disease Acta Neurol. Scand. 1975 52 145 157 10.1111/j.1600-0404.1975.tb05768.x 125518 \n16. Bollen E. Arts R.J.H.M. Roos R.A.C. van der Velde E.A. Buruma O.J. Brainstem reflexes and brainstem auditory evoked responses in Huntington’s chorea J. Neurol. Neurosurg. Psychiatry 1986 49 313 315 10.1136/jnnp.49.3.313 2937885 \n17. Töpper R. Schwarz M. Lange H.W. Hefter H. Noth J. Neurophysiological abnormalities in the Westphal variant of Huntington’s disease Mov. Disord. 1998 13 920 928 10.1002/mds.870130610 9827616 \n18. Tolosa E. Compta Y. Dystonia in Parkinson’s disease J. Neurol. 2006 253 Suppl. 7 vii7 vii13 10.1007/s00415-006-7003-6 17131231 \n19. Telenius H. Kremer B. Goldberg Y.P. Theilmann J. Andrew S.E. Zeisler J. Adam S. Greenberg C. Ives E.J. Clarke L.A. Somatic and gonadal mosaicism of the Huntington disease gene CAG repeat in brain and sperm Nat. Genet. 1994 6 409 414 10.1038/ng0494-409 8054984 \n20. Aronin N. Chase K. Young C. Sapp E. Schwarz C. Matta N. Kornreich R. Landwehrmeyer B. Bird E. Beal M.F. CAG expansion affects the expression of mutant Huntingtin in the Huntington’s disease brain Neuron 1995 15 1193 1201 10.1016/0896-6273(95)90106-X 7576661 \n21. Chen C.-M. Craven L. Detloff P.J. Ennis M. Shelbourne P.F. Kennedy L. Evans E. Dramatic tissue-specific mutation length increases are an early molecular event in Huntington disease pathogenesis Hum. Mol. Genet. 2003 12 3359 3367 14570710 \n22. Menéndez-González M. Clarimón J. Allende I.R. Blázquez M. Martín E.S.S. Fernández C.G. Lleó A. Dols-Icardo O. Illán-Gala I. Morís G. HTT gene intermediate alleles in neurodegeneration: Evidence for association with Alzheimer’s disease Neurobiol. Aging 2019 76 215.e9 215.e14 10.1016/j.neurobiolaging.2018.11.014 30583877\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2076-3425",
"issue": "9(10)",
"journal": "Brain sciences",
"keywords": "clinical neurology; differential diagnosis; genetics; movement disorders; neurodegenerative disease; neurophysiology; parkinsonism",
"medline_ta": "Brain Sci",
"mesh_terms": null,
"nlm_unique_id": "101598646",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31546689",
"pubdate": "2019-09-22",
"publication_types": "D002363:Case Reports",
"references": "23440000;25466405;14570710;125518;19059613;29460498;17131231;31086827;26397895;27402890;23008174;30583877;31103960;26474316;23624566;8054984;7576661;21904093;10644798;27000233;9827616;2937885",
"title": "Parkinsonism with a Hint of Huntington's from 29 CAG Repeats in HTT.",
"title_normalized": "parkinsonism with a hint of huntington s from 29 cag repeats in htt"
} | [
{
"companynumb": "FI-GLAXOSMITHKLINE-FI2019GSK231696",
"fulfillexpeditecriteria": "1",
"occurcountry": "FI",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TIZANIDINE"
},
"drugadditional": "3"... |
{
"abstract": "The WATCHMAN left atrial (LA) appendage closure system is an alternative therapy for stroke prevention in patients with atrial fibrillation who are intolerant to chronic oral anticoagulation with warfarin. Infrequently, LA device-related thrombus (DRT) has been suspected. Optimal treatment of DRT is not known, and the efficacy of novel oral anticoagulants (NOAC) in this setting has not been previously described. A 69-year-old woman with permanent atrial fibrillation underwent WATCHMAN device placement. A transesophageal echocardiogram (TEE) performed 45 days following implant revealed a well-seated device. A 1-year follow-up TEE revealed a 1.2 × 0.8 cm sized DRT on the LA aspect of the WATCHMAN device. She was prescribed dabigatran 150 mg po BID for 3 months and she remained on aspirin 325 mg per day. She returned approximately 4 months later (and several weeks after completing her 3-month course of dabigatran) for a repeat TEE, which revealed complete resolution of the DRT. A TEE was performed approximately 8 months later and revealed a new DRT measuring 1 cm in diameter on the LA aspect of the device. This is the first report of successful WATCHMAN DRT treatment with a NOAC, and the first report of late DRT recurrence following treatment to resolution with an anticoagulant. This case report demonstrates that (1) WATCHMAN DRT may form late following implantation, (2) DRT resolution is possible with NOACs, specifically dabigatran, and (3) late recurrence of DRT is possible, even after treatment to initial resolution with systemic anticoagulation.",
"affiliations": "Saint Luke's Mid America Heart Institute, Kansas City, Missouri.;Saint Luke's Mid America Heart Institute, Kansas City, Missouri.;Saint Luke's Mid America Heart Institute, Kansas City, Missouri.;Boston Scientific Corporation, St. Paul, Minnesota.;Saint Luke's Mid America Heart Institute, Kansas City, Missouri.",
"authors": "Qazi|Abdul H|AH|;Wimmer|Alan P|AP|;Huber|Kenneth C|KC|;Latus|George G|GG|;Main|Michael L|ML|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1111/echo.13174",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0742-2822",
"issue": "33(5)",
"journal": "Echocardiography (Mount Kisco, N.Y.)",
"keywords": "atrial fibrillation; left atrial appendage thrombus; multiplane transesophageal echocardiography; transesophageal echocardiogram",
"medline_ta": "Echocardiography",
"mesh_terms": null,
"nlm_unique_id": "8511187",
"other_id": null,
"pages": "792-795",
"pmc": null,
"pmid": "26775639",
"pubdate": "2016-05",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Resolution (and Late Recurrence) of WATCHMAN Device-Related Thrombus Following Treatment with Dabigatran.",
"title_normalized": "resolution and late recurrence of watchman device related thrombus following treatment with dabigatran"
} | [
{
"companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2016-BI-04515BI",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"d... |
{
"abstract": "This article evaluates the efficacy of enoxaparin when targeting anti-factor Xa levels of 0.5 to 1 units per milliliter in the neonatal intensive care unit.\n\n\n\nThis is a retrospective chart review of 45 neonates receiving enoxaparin for the treatment of venous thromboembolism. Enoxaparin dosing and corresponding anti-factor Xa levels were collected. Time to resolution of clot was confirmed by imaging and compared between clots in various locations.\n\n\n\nThe median time to clot resolution was 76 days (interquartile range 40-91 days). Clot location, postnatal age, and sex at the clot onset were significantly associated with time to clot resolution in a multivariable Cox model (p-value: 0.03, 0.03, and < 0.01, respectively). Of the 54 patients analyzed for safety, 5 patients (9.3%) experienced bleeding events resulting in the discontinuation of enoxaparin.\n\n\n\nBased on our findings, 50% of all patients evaluated, regardless of thrombus location, achieved resolution within the first 76 days of therapy. Clots located in the extremities tended to resolve sooner, hence earlier reimaging should be considered.",
"affiliations": "Department of Pharmacy, Nationwide Children's Hospital, Columbus, Ohio.;Department of Pharmacy, Nationwide Children's Hospital, Columbus, Ohio.;Center for Biostatistics, Ohio State University Medical Center, Biostatistics Resource at Nationwide Children's Hospital, Columbus, Ohio.;Department of Pharmacy, Nationwide Children's Hospital, Columbus, Ohio.",
"authors": "Song|Diane|D|;Magers|Jacqueline|J|;Abdel-Rasoul|Mahmoud|M|;Prusakov|Pavel|P|",
"chemical_list": "D000925:Anticoagulants; D017984:Enoxaparin; D015951:Factor Xa",
"country": "United States",
"delete": false,
"doi": "10.1055/s-0039-1698456",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0735-1631",
"issue": "38(5)",
"journal": "American journal of perinatology",
"keywords": null,
"medline_ta": "Am J Perinatol",
"mesh_terms": "D000925:Anticoagulants; D017984:Enoxaparin; D015951:Factor Xa; D005260:Female; D006470:Hemorrhage; D006801:Humans; D007231:Infant, Newborn; D007363:Intensive Care Units, Neonatal; D008297:Male; D009820:Ohio; D016016:Proportional Hazards Models; D012189:Retrospective Studies; D054556:Venous Thromboembolism",
"nlm_unique_id": "8405212",
"other_id": null,
"pages": "463-468",
"pmc": null,
"pmid": "31655489",
"pubdate": "2021-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Evaluation of the Efficacy of Enoxaparin in the Neonatal Intensive Care Unit.",
"title_normalized": "evaluation of the efficacy of enoxaparin in the neonatal intensive care unit"
} | [
{
"companynumb": "US-NOVARTISPH-NVSC2021US287575",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ENOXAPARIN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nEndoscopic cryotherapy can eradicate neoplastic Barrett's esophagus (BE). A new contact cryoballoon focal ablation system (CbFAS)) freezes esophageal mucosa with nitrous oxide. We studied the safety and efficacy of CbFAS for complete eradication of neoplastic Barrett's esophagus.\n\n\nMETHODS\nIn a prospective clinical trial, consecutive BE patients with confirmed neoplasia (low-grade dysplasia [LGD], high-grade dysplasia [HGD], and/or intramucosal adenocarcinoma [ImCA]), at least 1 cm of BE, with or without prior ablation, were treated with a dose 10 seconds of spray per site. EMR was performed for nodular lesions. Treatments were repeated every 10 to 12 weeks until complete eradication, with a maximum of 5 treatments. Primary outcomes were complete eradication of all dysplasia (CE-D) and complete eradication of intestinal metaplasia (CE-IM) at 1 year (intention-to-treat analysis).\n\n\nRESULTS\nForty-one assessable patients (22 treatment naive, 19 previously ablated) with LGD (n = 13), HGD (n = 23), or ImCA (n = 5) were treated. The median procedure time was 30 minutes. The median number of ablation procedures for CE-IM was 3 (interquartile range, 2-4). Overall 1-year CE-D and CE-IM rates were 95% and 88%, respectively. CE-D rate was significantly lower (67%) in those with ultra-long BE compared with those with <8 cm (100%, P = .02). Median pain scores were zero at day 1. Four patients (9.7%) developed mild dysphagia from stenoses requiring dilation. One patient on aspirin developed upper GI bleeding that did not require therapy.\n\n\nCONCLUSIONS\nMultifocal nitrous oxide cryotherapy using CbFAS is a promising, highly effective, and safe endoscopic treatment for primary or rescue therapy of BE-associated neoplasia and IM. (Clinical trial registration number: NCT02534233.).",
"affiliations": "Division of Gastroenterology and Hepatology, Johns Hopkins Medical Institutions, Baltimore, Maryland, USA.;Division of Gastroenterology, University North Carolina, Chapel Hill, Chapel Hill, North Carolina, USA.;Division of Gastroenterology and Hepatology, Johns Hopkins Medical Institutions, Baltimore, Maryland, USA.;Division of Gastroenterology and Hepatology, Johns Hopkins Medical Institutions, Baltimore, Maryland, USA.;Division of Gastroenterology and Hepatology, Johns Hopkins Medical Institutions, Baltimore, Maryland, USA.;Digestive and Liver Disease, Columbia University Medical Center, New York, New York, USA.",
"authors": "Canto|Marcia Irene|MI|;Shaheen|Nicholas J|NJ|;Almario|Jose Alejandro|JA|;Voltaggio|Lysandra|L|;Montgomery|Elizabeth|E|;Lightdale|Charles J|CJ|",
"chemical_list": "D005740:Gases; D009609:Nitrous Oxide",
"country": "United States",
"delete": false,
"doi": "10.1016/j.gie.2018.03.024",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0016-5107",
"issue": "88(3)",
"journal": "Gastrointestinal endoscopy",
"keywords": null,
"medline_ta": "Gastrointest Endosc",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000368:Aged; D001471:Barrett Esophagus; D002278:Carcinoma in Situ; D003452:Cryosurgery; D000069916:Endoscopic Mucosal Resection; D004938:Esophageal Neoplasms; D004945:Esophagoscopy; D005260:Female; D005740:Gases; D006801:Humans; D008297:Male; D008875:Middle Aged; D009609:Nitrous Oxide; D011446:Prospective Studies",
"nlm_unique_id": "0010505",
"other_id": null,
"pages": "438-446.e2",
"pmc": null,
"pmid": "29626424",
"pubdate": "2018-09",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D059040:Video-Audio Media",
"references": null,
"title": "Multifocal nitrous oxide cryoballoon ablation with or without EMR for treatment of neoplastic Barrett's esophagus (with video).",
"title_normalized": "multifocal nitrous oxide cryoballoon ablation with or without emr for treatment of neoplastic barrett s esophagus with video"
} | [
{
"companynumb": "US-BAYER-2018-106474",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FAMOTIDINE"
},
"drugadditional": null,
... |
{
"abstract": "There is a lack of literature documenting the use of alemtuzumab in pediatric multiple sclerosis (MS) patients. Here we describe a 16-year-old and a 17-year-old patient receiving alemtuzumab and being followed for 37 months and 20 months, respectively. Both patients experienced a 1.0 decrease in Expanded Disability Status Scale since initial alemtuzumab infusion and had stable disease. No serious infusion reactions, infections, or definite relapses were recorded on follow-up. Alemtuzumab has been relatively well-tolerated and effective; however, larger, longer-term studies are necessary to understand the specific risks and benefits of alemtuzumab in pediatric MS.",
"affiliations": "Faculty of Medicine, University of British Columbia,Canada.;Division of Neurology, Department of Medicine, University of British Columbia, Vancouver, Canada.",
"authors": "Jure Hunt|David|D|https://orcid.org/0000-0003-0842-7538;Traboulsee|Anthony|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/2055217320926613",
"fulltext": "\n==== Front\nMult Scler J Exp Transl Clin\nMult Scler J Exp Transl Clin\nMSO\nspmso\nMultiple Sclerosis Journal - Experimental, Translational and Clinical\n2055-2173 SAGE Publications Sage UK: London, England \n\n10.1177/2055217320926613\n10.1177_2055217320926613\nShort Report\nShort-term outcomes of pediatric multiple sclerosis patients treated with alemtuzumab at a Canadian University multiple sclerosis clinic\nhttps://orcid.org/0000-0003-0842-7538Jure Hunt David Faculty of Medicine, University of British Columbia,Canada\n Traboulsee Anthony Division of Neurology, Department of Medicine, University of British Columbia, Vancouver, Canada\n2211 Wesbrook Mall, Room S199, Vancouver V6T 2B5, Canada. Traboulsee.assistant@ubc.ca\n1 7 2020 \nApr-Jun 2020 \n6 2 205521732092661329 10 2019 4 4 2020 © The Author(s) 20202020SAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons LicensesCreative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).There is a lack of literature documenting the use of alemtuzumab in pediatric multiple sclerosis (MS) patients. Here we describe a 16-year-old and a 17-year-old patient receiving alemtuzumab and being followed for 37 months and 20 months, respectively. Both patients experienced a 1.0 decrease in Expanded Disability Status Scale since initial alemtuzumab infusion and had stable disease. No serious infusion reactions, infections, or definite relapses were recorded on follow-up. Alemtuzumab has been relatively well-tolerated and effective; however, larger, longer-term studies are necessary to understand the specific risks and benefits of alemtuzumab in pediatric MS.\n\nAlemtuzumabdisease-modifying therapiesimmunologymultiple sclerosissecond-line treatmentteriflunomidecover-dateApril-June 2020typesetterts2\n==== Body\nIntroduction\nDespite the paucity of completed phase 3 trials for treatment interventions in pediatric-onset multiple sclerosis (POMS), more patients are being treated with new-generation disease-modifying therapies (DMTs).1,2 While there has been a recent report of alemtuzumab use in POMS patients,3 there is an absence of literature on alemtuzumab use in POMS patients under the age of 18. A phase 3 trial evaluating alemtuzumab in POMS is set to be completed in 2026 (NCT03368664). Due to this delay, it is important that smaller studies help inform physicians in the meantime in using this highly efficacious therapy, as have been previously done for most DMTs in the POMS population.1,2,4 Here we report alemtuzumab therapy in two POMS patients under the age of 18 and comment on safety and effectiveness following infusion.\n\nMethods\nA retrospective chart review was performed at the University of British Columbia multiple sclerosis (MS) clinic to identify MS patients who received alemtuzumab prior to their 18th birthday and consented to retrospective chart review. Data collection forms captured date and symptoms at MS onset, history of DMT use, history of relapses, Expanded Disability Status Scale (EDSS) changes, infections post-alemtuzumab, and laboratory monitoring from the patients’ electronic medical records.\n\nPatient 1\nA 14-year-old male presented in October 2014 with left leg weakness and partial foot drop. Fluid-attenuated inversion recovery imaging captured several lesions, including one in the right motor strip accounting for the left lower limb symptoms (Figure 1(a)). One year later, the patient developed new brain lesions in the absence of clinical relapse, and both the clinical and radiological findings supported a diagnosis of MS.5 Due to the rapid accumulation of disease burden, alemtuzumab was the preferred first-line treatment, but drug coverage was not approved. With the absence of phase 3 trials for treatment interventions in POMS at the time, teriflunomide (14 mg/day) was started based primarily on patient preference. Over the following year, the patient’s EDSS increased from 2.0 to 2.5 following a brainstem relapse, with seven new brain and brainstem lesions. The 16-year-old patient was started on alemtuzumab in June 2016 (60 mg over 5 days) and received a second course one year later (36 mg over 3 days). The infusions were unremarkable for significant adverse reactions. In 37 months of follow-up, the patient has not developed secondary autoimmunity, radiological worsening of disease, or clinical relapse, and has had a stable EDSS of 1.5 since August 2016.\n\nFigure 1. Axial fluid-attenuated inversion recovery images of Patient 1 and Patient 2.\n\n(a) At presentation (October 2014), six months prior to starting alemtuzumab (January 2016), and 36 months after starting alemtuzumab therapy (June 2019).\n\n(b) Two months prior to starting alemtuzumab (October 2017), and 20 months after starting alemtuzumab (August 2019). The artifact in the periventricular images pre-alemtuzumab is due to the patient’s dental braces.\n\nPatient 2\nA 16-year-old male, diagnosed with POMS in South America at age 8, developed a relapse in February 2017 with vertigo, diplopia, and facial numbness, and was treated with intravenous (IV) steroids for 3 days. Two more brainstem relapses with radiological worsening occurred in May and August 2017, both of which were treated with IV steroids. His EDSS at this time was 2.5. Anti-MOG tests were not available at the time of investigation; however, both lesion quantity and location, as well as the disease course, supported the initial diagnosis of MS.5,6 He was briefly placed on teriflunomide (14 mg/day) but was transitioned to alemtuzumab after drug coverage approval in December 2017. The initial (60 mg over 5 days) and subsequent infusions one year later (36 mg over 3 days) were unremarkable for significant infusion reactions. Six months after initiating alemtuzumab, the patient developed a presumed viral illness, with increased fatigue for two weeks and mild headache for five days. He had no fever or signs of meningeal involvement and had complete recovery. Eight months after starting alemtuzumab, he retrospectively reported increased fatigue and non-specific balance and coordination issues that resolved within one week without the use of steroids. There was no evidence of radiological worsening on follow-up one year after this report of transiently decreased coordination and fatigue (Figure 1(b)). Moderate asymptomatic neutropenia (absolute neutrophil count (ANC) of 0.6 × 109/L) developed in May 2019, which recovered to an ANC of 1.2 × 109/L the following month and has remained at this level since last follow-up in July 2019. In June 2019, the patient had an EDSS of 1.5.\n\nDiscussion\nAfter two courses of alemtuzumab and 37 and 20 months of follow-up, both patients have had a 1.0 decrease in EDSS and currently have stable disease. Since initiating alemtuzumab, there have been no serious infections or MS relapses. On routine follow-up, Patient 2 retrospectively reported transiently decreased coordination and fatigue that resolved within one week, eight months after beginning alemtuzumab. Due to the lack of radiological worsening or new neurological symptoms, a return back to baseline, and the inability to rule out fever or infection at this time, we did not interpret this as a relapse. While the sample size is limited, these cases document the successful treatment of two POMS patients using alemtuzumab with no serious short-term adverse events.\n\nIn the phase 3 trials for alemtuzumab in adult-onset MS (AOMS), moderate neutropenia (ANC ≥ 0.5 to <1.0 × 109/L) was observed in 11/798 participants in the second year after initial infusion.7 Patient 2 developed moderate afebrile neutropenia 18 months after starting alemtuzumab that may be of autoimmune origin. As neutrophil counts recovered to a less depleted state the following month, further investigations or treatment have not been pursued, but confirm the need for monthly hematological monitoring in POMS patients post-alemtuzumab.\n\nThe high risk of secondary autoimmunity associated with alemtuzumab often relegates it to a second- or third-line DMT. The mechanism driving secondary autoimmunity is unknown; however, high pre-treatment IL-21 levels and an elevated B cell:T regulatory cell ratio following partial lymphocyte reconstitution have been hypothesized as contributing factors.8,9 After bone marrow ablation and transplant, T cells are reconstituted two to three times more rapidly in children compared with adults.10 This observation may be important in the context of alemtuzumab, due to it causing potent lymphocyte depletion. Laboratory monitoring post-alemtuzumab does not routinely capture lymphocyte subsets, so we cannot comment on T cell dynamics in POMS patients post-alemtuzumab. Future studies should evaluate if POMS and AOMS patients differ with regards to B and T cell reconstitution following alemtuzumab therapy, and the effect this has on secondary autoimmunity and infection.\n\nAuthor contributions\nDavid Jure Hunt: data acquisition, analysis and interpretation; drafted the manuscript; study design; and conceptualization. Anthony Traboulsee: data interpretation; manuscript review; study design; and conceptualization.\n\nDeclaration of conflicting interests\nThe author(s) declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: David Jure Hunt has no conflicts of interest to declare. Anthony Traboulsee has received grant funding from the Multiple Sclerosis Society of Canada, Canadian Institute for Health Research, F Hoffmann-La Roche, and Sanofi Genzyme; he has also received honoraria or travel grants from Teva Canada Innovation, F Hoffmann-La Roche, Merck/EMD Serono, Sanofi Genzyme, and Chugai Pharmaceuticals.\n\nFunding\nThe author(s) received no financial support for the research, authorship, and/or publication of this article.\n\nORCID iD\nDavid Jure Hunt https://orcid.org/0000-0003-0842-7538\n==== Refs\nReferences\n1 Krysko KM Graves J Rensel M , et al\nUse of newer disease-modifying therapies in pediatric multiple sclerosis in the US\n. Neurology \n2018 ; \n91 : e1778 –e1787\n.30333163 \n2 Otallah S Banwell B. \nPediatric multiple sclerosis: an update.\n\nCurr Neurol Neurosci Rep \n2018 ; \n18 : 76 .30229541 \n3 Margoni M Rinaldi F Miante S , et al\nAlemtuzumab following natalizumab in highly active paediatric-onset multiple sclerosis.\n\nMult Scler J Exp Transl Clin \n2019 ; \n5 : 2055217319875471 .31555463 \n4 Rensel M. \nLong-term treatment strategies of pediatric multiple sclerosis, including the use of disease modifying therapies\n. Children (Basel) \n2019 ; \n6 : pii E73.\n5 Thompson AJ Banwell BL Barkhof F , et al\nDiagnosis of multiple sclerosis: 2017 revisions of the McDonald criteria\n. Lancet Neurol \n2018 ; \n17 : 162 –173\n.29275977 \n6 Jurynczyk M Geraldes R Probert F , et al\nDistinct brain imaging characteristics of autoantibody-mediated CNS conditions and multiple sclerosis.\n\nBrain \n2017 ; \n140 : 617 –627\n.28364548 \n7 Baker D Giovannoni G Schmierer K. \nMarked neutropenia: significant but rare in people with multiple sclerosis after alemtuzumab treatment\n. Mult Scler Relat Disord \n2017 ; \n18 : 181 –183\n.29141806 \n8 Baker D Herrod SS Alvarez-Gonzalez C , et al\nInterpreting lymphocyte reconstitution data from the pivotal phase 3 trials of alemtuzumab.\n\nJAMA Neurol \n2017 ; \n74 : 961 –969\n.28604916 \n9 Jones JL Phuah CL Cox AL , et al\nIL-21 drives secondary autoimmunity in patients with multiple sclerosis, following therapeutic lymphocyte depletion with alemtuzumab (Campath-1H).\n\nJ Clin Invest \n2009 ; \n119 : 2052 –2061\n.19546505 \n10 Small TN Papadopoulos EB Boulad F , et al\nComparison of immune reconstitution after unrelated and related T-cell-depleted bone marrow transplantation: effect of patient age and donor leukocyte infusions\n. Blood \n1999 ; \n93 : 467 –480\n.9885208\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2055-2173",
"issue": "6(2)",
"journal": "Multiple sclerosis journal - experimental, translational and clinical",
"keywords": "Alemtuzumab; disease-modifying therapies; immunology; multiple sclerosis; second-line treatment; teriflunomide",
"medline_ta": "Mult Scler J Exp Transl Clin",
"mesh_terms": null,
"nlm_unique_id": "101668877",
"other_id": null,
"pages": "2055217320926613",
"pmc": null,
"pmid": "32655877",
"pubdate": "2020",
"publication_types": "D016428:Journal Article",
"references": "19546505;30229541;28604916;29275977;9885208;31159312;30333163;28364548;29141806;31555463",
"title": "Short-term outcomes of pediatric multiple sclerosis patients treated with alemtuzumab at a Canadian University multiple sclerosis clinic.",
"title_normalized": "short term outcomes of pediatric multiple sclerosis patients treated with alemtuzumab at a canadian university multiple sclerosis clinic"
} | [
{
"companynumb": "CA-SA-2020SA191426",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ALEMTUZUMAB"
},
"drugadditional": null,
"d... |
{
"abstract": "Ebstein's anomaly (EA) is mainly thought of as a right heart condition, however, congenital left-sided lesions can co-exist. Therefore, it is paramount to include the left side of the heart as part of a routine investigation in these patients. We present a 57-year-old symptomatic patient with EA and progressive tricuspid regurgitation (TR) associated with acquired left ventricular outflow obstruction (LVOTO).\nA 57-year-old women, known to have severe EA presented with shortness of breath and chest pain on exertion secondary to progression of the tricuspid valve regurgitation and right ventricle dilatation leading to a dynamic compression of the left outflow tract requiring surgical intervention.\nLeft ventricular obstruction secondary to severe TR and dilation of the right ventricle can present and remain silent at rest but becoming significant on exertion. Therefore, we recommend that all patients with EA and significant TR undergo exercise echocardiography at regular intervals to specifically look for acquired dynamic LVOTO.",
"affiliations": "Bristol Heart Institute, University Hospitals Bristol & Weston NHS Foundation Trust, Bristol, UK.;Bristol Heart Institute, University Hospitals Bristol & Weston NHS Foundation Trust, Bristol, UK.;Bristol Heart Institute, University Hospitals Bristol & Weston NHS Foundation Trust, Bristol, UK.",
"authors": "Ordoñez|Maria Victoria|MV|;Bedair|Radwa|R|;Curtis|Stephanie L|SL|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/ehjcr/ytaa077",
"fulltext": "\n==== Front\nEur Heart J Case Rep\nEur Heart J Case Rep\nehjcr\nEuropean Heart Journal: Case Reports\n2514-2119 Oxford University Press \n\n10.1093/ehjcr/ytaa077\nytaa077\nCase Reports\nCongenital Heart Disease\nAcademicSubjects/MED00200\nLeft heart matters in Ebstein’s anomaly: the importance of a closer follow up—a case report\nOrdoñez Maria Victoria Bedair Radwa Curtis Stephanie L Garg Pankaj Handling Editor Abumuaileq Rami Riziq Yousef Editor Refaat Marwan Editor von Klemperer Kate Editor Mukherjee Rahul Editor Green Peregrine Editor \nBristol Heart Institute, University Hospitals Bristol & Weston NHS Foundation Trust, Bristol, UK\nCorresponding author. Tel: +44 117 9230000, Email: stephanie.curtis@UHBristol.nhs.uk\n8 2020 \n29 6 2020 \n29 6 2020 \n4 4 1 5\n25 4 2019 10 7 2019 17 3 2020 © The Author(s) 2020. Published by Oxford University Press on behalf of the European Society of Cardiology. 2020This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nBackground\nEbstein’s anomaly (EA) is mainly thought of as a right heart condition, however, congenital left-sided lesions can co-exist. Therefore, it is paramount to include the left side of the heart as part of a routine investigation in these patients. We present a 57-year-old symptomatic patient with EA and progressive tricuspid regurgitation (TR) associated with acquired left ventricular outflow obstruction (LVOTO).\n\nCase summary\nA 57-year-old women, known to have severe EA presented with shortness of breath and chest pain on exertion secondary to progression of the tricuspid valve regurgitation and right ventricle dilatation leading to a dynamic compression of the left outflow tract requiring surgical intervention.\n\nDiscussion\nLeft ventricular obstruction secondary to severe TR and dilation of the right ventricle can present and remain silent at rest but becoming significant on exertion. Therefore, we recommend that all patients with EA and significant TR undergo exercise echocardiography at regular intervals to specifically look for acquired dynamic LVOTO. \n\nEbstein’s anomalyTricuspid regurgitationLeft ventricular outflow obstruction (LVOTO)Case report\n==== Body\nLearning points\nEbstein’s anomaly should not be regarded as a disease confined only to the right side of the heart.\n\nLeft side lesions can be present as well. Left ventricular outflow obstruction (LVOTO) can be acquired and dynamic, secondary to a leftward displacement of the interventricular septum due to severe right ventricular dilation ± severe tricuspid regurgitation or fixed. Dysfunction of the left ventricle can be present due to an abnormal ventricular–ventricle interaction or non-compaction.\n\nDynamic LVOTO has to be thought of as a potential complication despite the absence of a significant gradient on echo at rest.\n\nA thorough investigation of the heart both at rest and on exertion has to be performed when following up this subset of patients with the aim to reveal underlying LVOTO.\n\n\n\n\nIntroduction\nEbstein’s anomaly (EA) is predominantly considered a right heart condition but it is well recognized that congenital left-sided lesions can co-exist and be the leading cause of clinical deterioration. The incidence is approximately 1 per 200 000 live births and it accounts for <1% of all cases of congenital heart disease with no gender preponderance. In its most severe form, the diagnosis may be established in utero or infancy, requiring early surgery but can be diagnosed later in childhood and not uncommonly in adulthood. Therefore, it is paramount to always investigate the heart in its entirety. We present a 57-year-old symptomatic patient with EA and progressive tricuspid regurgitation (TR) associated with acquired left ventricular outflow obstruction (LVOTO).\n\nTimeline\nNine months prior to presentation\tMedical history of Ebstein’s anomaly and hypertension. Asymptomatic.\t\n\tTransthoracic echocardiogram: moderate tricuspid regurgitation (TR).\t\n\tPatient was on bendroflumethazide and recently, started on losartan.\t\nUpon presentation to peripheral clinic\tBecame symptomatic: progressive dyspnoea and chest pain.\t\n\tNo signs of heart failure.\t\n\tTransthoracic echocardiogram: severe TR. Left ventricular outflow obstruction.\t\n\tChest pain was provoked by vasodilator medication (losartan).\t\n\tMedication was discontinued and chest pain disappeared.\t\nOne month later\tProgression of shortness of breath. Cardio-pulmonary test: VO2max decreased.\t\n\t\t\n\tCoronary tomography: normal coronaries.\t\n\tSurgical referral.\t\nSix months later\tCardiac magnetic resonance: severe TR. Preserved right ventricular ejection fraction.\t\nA year after presentation\tTransoesophageal echocardiogram: increased velocity to left ventricular outflow (LVOT) tract.\t\n\tStress echocardiogram: significant increase in LVOT velocity on exercise.\t\n\tSurgical decision was made.\t\nCase presentation \nA 57-year-old woman with a known history of EA with moderate TR and systemic hypertension became symptomatic with progressive dyspnoea and angina-like chest pain, occurring primarily on exertion or after meals. The patient denied syncope and dizziness but had occasional palpitations on exertion. \n\nThe patient was taking bendroflumethazide only for hypertension, having found her chest pain worsened on losartan.\n\nOn examination, height was 163 cm, weight 57 kg, blood pressure was 157/74 mmHg, heart rate 75 b.p.m., and oxygen saturations were 98%. Her jugular venous pressure was not elevated, chest was clear and there was no peripheral oedema. There was a grade 2/6 pansystolic murmur at the left sternal edge.\n\nElectrocardiogram (ECG) showed normal sinus rhythm with a prolonged PR interval (220 ms) and right bundle branch block (QRS duration 160 ms) (Figure 1). A 24 h Holter monitoring showed sinus rhythm with first degree heart block throughout, 54–104 b.p.m., with occasional runs of ventricular bigeminy and premature ventricular complexes. Full blood count, renal and liver function tests were normal.\n\n\nFigure 1 Dopplers of peak forward flow velocity across the left ventricular outflow tract on transthoracic echocardiography. (A) At rest: peak velocity 1.92 m/s. (B) Post-Valsava manoeuvre: peak velocity 2.63 m/s. (C) With leg raising: peak velocity 5.22 m/s.\n\nTransthoracic echocardiography performed in 2014 showed a small, non-hypertrophied left ventricle with normal function. The commissure of the posterior and septal leaflets of the tricuspid valve was significantly apically displaced (42 mm), resulting in a large atrialized component of the right ventricle. The anterior leaflet was large and redundant. There was severe TR. Aortic and mitral valve morphology was normal. There was no systolic anterior motion of the mitral valve. The aortic annulus was small and there was turbulent flow through the left ventricular outflow (LVOT) due to the abnormal motion of the atrialized portion of the right ventricle in systole, resulting in a peak velocity through the LVOT of 2.6 m/s at rest, increasing to 3.5 m/s post-Valsalva (peak gradient 27 mmHg at rest and 48 mmHg post-Valsava) (Supplementary material online, Video S1).\n\nGiven the patient’s cardiovascular risk profile, computed tomography of the coronary arteries was undertaken, which was normal.\n\nSymptoms persisted and worsened with an objective deterioration in functional capacity over a 5-month period, based on cardiopulmonary exercise testing done (VO2max: 24.3 mL/kg/min—METS 6.9 in July vs. VO2max: 18.7 mL/kg/min—METS 5.3 in December with a reduced oxygen pulse). \n\nA year later a cardiac magnetic resonance imaging showed an increase in the right ventricular end-diastolic volume over a 12-month period, from 123 mL/m2 (ejection fraction 64%) to 146 mL/m2 (ejection fraction 57%). The tricuspid regurgitant fraction increased from 32% to 52%.\n\nTransoesophageal echocardiography (TOE) was performed to explore the LVOT anatomy in 2015. Post-TOE, transthoracic echocardiography demonstrated a resting peak velocity of 1.9 m/s across the LVOT, which increased to 5.2 m/s (incomplete Doppler envelope) with leg raising (Figure 2). No atrial septal defects were identified. In the same year, an exercise stress echocardiography showed a significant increase in peak gradient to 157 mmHg and a peak flow velocity through the LVOT from 2.1 m/s (mean gradient 12 mmHg) at rest to 6.3 m/s (mean gradient 95 mmHg) at peak stress at very low workload (25 W) (Figure 3).\n\n\nFigure 2 Dopplers of peak forward flow velocity across the left ventricular outflow tract on stress echocardiography. (A) At rest: peak velocity 2.16 m/s. (B) At peak exercise 6.3 m/s.\n\nFigure 3 Cardiac magnetic resonance imaging. (A) Contrast-enhanced two-chamber view showing apical displacement of the septal leaflet of the tricuspid valve (arrow). (B) Three-chamber view showing narrowing of the left ventricular outflow tract at end-systole. No systolic anterior motion of the mitral valve was found (SAM). (C) Four-chamber end-diastole view. Leftward displacement of the septum during diastole (arrow) due to the protrusion of the atrialized right ventricle. (D) Four-chamber end-systole view. Persistence of the leftward displacement of the interventricular septum during systole (arrow).\n\nLosartan was switched to verapamil 80 mg three times daily due to the chest pain being worse on losartan. The mechanism for this was felt to be myocardial ischaemia due to exacerbation of the LVOTO secondary to reduction of the systemic vascular resistance and therefore reduction in coronary blood flow. We felt that verapamil might reduce any dynamic LVOTO in a manner similar to that in hypertrophic obstructive cardiomyopathy. She was also prescribed indapamide 2.5 mg once a day instead of bendroflumethazide with good blood pressure control.\n\nThe patient’s case was reviewed at the multidisciplinary meeting and the decision was made to proceed to cardiac surgery for tricuspid valve repair or replacement in the hope that this would reduce the LVOTO and some LVOTO resection if possible.\n\nDue to the rarity of the condition, the patient has chosen not to have surgery and is currently seeking several opinions worldwide.\n\nDiscussion\nEbstein’s anomaly is rare. Although the condition exhibits typical characteristics, each affected patient has different morphological and haemodynamic features, resulting in different natural histories.1 Age of presentation and symptomatology depend on the anatomic and functional severity of the tricuspid valve abnormality as well as the presence of associated anomalies such as septal defects, and the arrhythmia burden.2 The combination of EA and an atrial septal defect or patent foramen ovale is found in 60–70% of cases.1–3 Wolff–Parkinson–White syndrome occurs in 10–29% cases, and results in supraventricular tachycardia in at least 15% of these.1\n\nEbstein’s anomaly was originally described as a lesion affecting the right side of the heart.4 Along with the cardinal tricuspid valve anomaly, pulmonary stenosis, atresia, and hypoplastic pulmonary arteries have been described. However, left-sided lesions are increasingly being recognised, largely due to improvements in cardiac imaging, and are thought to be present in 39% of cases. These include non-compaction of the left ventricle and muscular left ventricular bands, as well as abnormalities of the mitral valve, such as mitral valve prolapse and accessory mitral valve tissue. Atretic or bicuspid valves have also been described, as has coarctation of the aorta and subaortic stenosis.4\n\nLeft ventricular outflow obstruction associated with EA is very rare. Isobe et al.5 reported a case of EA and LVOTO due to abnormal accessory tissue of the mitral valve but others have described dynamic LVOTO due to severe TR.6 Li et al.1 reported a large series of 245 patients who underwent tricuspid valve surgery. Six were found to have LVOTO at the time of surgery, none of whom had signs of it preoperatively. The severe LVOTO could be treated with reoperation of the atrialized right ventricle. In a large review of patients with EA from the Mayo clinic, only two patients out of 106 had LVOTO mimicking hypertrophic obstructive cardiomyopathy and requiring myectomy.4\n\nHirata reported the case of a 59-year-old woman with similar features, where a 20 mm displacement of the posterior and septal leaflets’ commissure resulted in abnormal motion of the basal septum causing LVOTO.7 In this case, the ECG and transthoracic echo both showed signs of left ventricular hypertrophy (LVH), both of which would have prompted looking for significant LVOTO. Furthermore, this patient had severe LVOTO at rest and this was unlikely to be missed on routine echocardiography. Moreover, the patient also had systolic anterior motion of the mitral valve as a result of the LVOTO and consequent severe mitral regurgitation.\n\nIn this case, we describe dynamic severe LVOTO in EA due to worsening and severe TR into an atrialization right ventricle with consequent abnormal motion of the basal interventricular septum. The haemodynamics were subtle at rest and exacerbated by exercise provoking angina secondary to severe LVOTO. This case adds to the current literature base on EA as the LVOTO was not present at rest and there was no LVH. Moreover, unusually, the patient complained of angina in the presence of normal coronary arteries, hinting at the underlying pathophysiology. This illustrates the importance of always searching for potential LVOTO despite the absence of a significant gradient at rest or LVH, particularly if the patient complains of classical angina with no coronary disease.\n\nA multicentre registry would help to understand the mechanisms that lead to the development of acquired LVOTO in EA thereby potentially improve outcomes with earlier surgery in this subset of patients.\n\nConclusions\nEbstein’s anomaly is mainly a right-sided heart condition. However, in addition to the co-existence of congenital left-sided lesions, worsening of the TR and consequently dilation of the right ventricle can result in progressive acquired dynamic LVOTO that may require correction at the time of surgical repair of the tricuspid valve.\n\nIn this case, the full diagnosis was not made initially as the patient had minimal LVOTO at rest and no LVH. We therefore advise congenital cardiologists that EA can rarely be complicated by acquired LVOTO secondary to progressive TR and right ventricular dilatation. We recommend that all patients with EA and significant TR undergo exercise echocardiography at regular intervals to specifically look for acquired dynamic LVOTO.\n\nLead author biography \nDr Maria Victoria Ordoñez, adult cardiologist specialist in adult congenital heart disease trained in Buenos Aires, Argentina, and Montreal, Canada. Currently, working as a research and clinical ACHD fellow at the Bristol Heart Institute, Bristol University, Bristol, UK.\n\nSupplementary material\n\nSupplementary material is available at European Heart Journal - Case Reports online.\n\n\nSlide sets: A fully edited slide set detailing this case and suitable for local presentation is available online as Supplementary data.\n\n\nConsent: The author/s confirm that written consent for submission and publication of this case report including image(s) and associated text has been obtained from the patient in line with COPE guidance. \n\n\nConflict of interest: none declared.\n\nSupplementary Material\nytaa077_Supplementary_Data Click here for additional data file.\n==== Refs\nReferences\n1 \nLi B , Sun HS , Pan SW , Xu JP. \nOutcomes of Ebstein’s anomaly patients treated with tricuspid valvuloplasty or tricuspid valve replacement: experience of a single center\n. Chin Med J (Engl) 2018 ;131 :1067 –1074\n.29692378 \n2 \nGatzoulis MA , Webb GD , Daubeney PEF. \nDiagnosis and Management of Adult Congenital Heart Disease , 3rd ed , 2017.\n3 \nBrown ML , Dearani JA , Danielson GK , Cetta F , Connolly HM , Warnes CA , Li Z , Hodge DO , Driscoll DJ ; Mayo Clinic Congenital Heart Center. \nThe outcomes of operations for 539 patients with Ebstein anomaly\n. J Thorac Cardiovasc Surg 2008 ;135 :1120 –1136\n.18455593 \n4 Attenhofer J, Connolly HM, O'leary PW, Warnes CA, Tajik AJ, Seward JB. Left heart lesions in patients with Ebstein anomaly. Mayo Clin Proc 2005;80:361–368.\n5 \nIsobe M , Tanaka M , Sekiguchi M. \nSubaortic stenosis due to accessory tissue of the mitral valve associated with Ebstein’s anomaly in an adult\n. Int J Cardiol 1996 ;57 :286 –288\n.9024918 \n6 \nWaterhouse DF , Murphy TM , McCreery CJ , O'Hanlon R. \nAn unusual cause of dynamic left ventricular outflow obstruction: An unusual case of dynamic LVOTO\n. Int J Cardiol 2015 ;197 :282 –283\n.26142976 \n7 \nHirata K , Yagi N , Kubota S , Wake M , Tengan T. \nCase of Ebstein anomaly complicated by left ventricular outflow tract obstruction secondary to deformed basal septum attributable to atrialized right ventricle\n. Circulation 2016 ;133 :e33 –e37\n.26811277\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2514-2119",
"issue": "4(4)",
"journal": "European heart journal. Case reports",
"keywords": "Case report; Ebstein’s anomaly; Left ventricular outflow obstruction (LVOTO); Tricuspid regurgitation",
"medline_ta": "Eur Heart J Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101730741",
"other_id": null,
"pages": "1-5",
"pmc": null,
"pmid": "32974476",
"pubdate": "2020-08",
"publication_types": "D002363:Case Reports",
"references": "18455593;26142976;26811277;29692378;15757018;9024918",
"title": "Left heart matters in Ebstein's anomaly: the importance of a closer follow up-a case report.",
"title_normalized": "left heart matters in ebstein s anomaly the importance of a closer follow up a case report"
} | [
{
"companynumb": "GB-MICRO LABS LIMITED-ML2020-03973",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LOSARTAN"
},
"drugadditional": "1",
... |
{
"abstract": "Women with histories of opioid misuse face drug-related stigma, which can be amplified during pregnancy. While women are often blamed for their drug use and urged to change, the social contexts that create and reinforce stigma are largely unchallenged. Drawing on a multidimensional model of stigma, we examine how stigma manifested across women's pregnancy journeys to shape access and quality of care.\n\n\n\nWe triangulate in-depth interviews with 28 women with histories of opioid misuse who were pregnant or recently gave birth and 18 healthcare providers in Ohio. Thematic analysis examined how stigma operates across contexts of care.\n\n\n\nProviders represented physicians, nurses, social workers, counselors, and healthcare administrators. Among 28 women, average age was 30 (range: 22-41) and 79 % were White. Most women used prenatal medication-assisted treatment (MAT), including Suboxone (n = 19) or methadone (n = 8), and 15 were pregnant. Evidence of stigma emerged across healthcare contexts. Structural stigma encoded barriers to care in insurance practices and punitive drug treatment, while enacted stigma manifested as mistreatment and judgment from providers. Unpredictability of an infant diagnosis of neonatal abstinence syndrome (NAS), even when women were \"doing everything right\" by using MAT, perpetuated anticipated stigma from fear of loss of custody and internalized stigma among women who felt guilty about the diagnosis. Providers recognized the harmful effects of these stigmas and many actively addressed it.\n\n\n\nWe recommend harm reduction approaches to address the multiplicity of stigmas that women navigate in opioid misuse and pregnancy to improve healthcare experiences.",
"affiliations": "The Ohio State University, Department of Anthropology, 4034 Smith Lab, 174 W 18(th) Avenue, Columbus, OH, 43210, United States; University of California, Riverside, Department of Anthropology, 900 University Ave, 1320B Watkins Hall, Riverside, CA, 92521, United States. Electronic address: jsyverts@ucr.edu.;The Ohio State University, Department of Anthropology, 4034 Smith Lab, 174 W 18(th) Avenue, Columbus, OH, 43210, United States; University of Pennsylvania School of Social Policy and Practice, 3701 Locust Walk, Philadelphia, PA, 19104, United States. Electronic address: htoneff@upenn.edu.;Phyllis & Harvey Sandler School of Social Work, Florida Atlantic University College of Social Work & Criminal Justice, 777 Glades Road, SO 308, Boca Raton, FL, 33431, United States. Electronic address: howardh@fau.edu.;Phyllis & Harvey Sandler School of Social Work, Florida Atlantic University College of Social Work & Criminal Justice, 777 Glades Road, SO 308, Boca Raton, FL, 33431, United States. Electronic address: cspadola@fau.edu.;The Ohio State University, College of Social Work, 1947 North College Road, Columbus, OH, 43210, United States; University of Southern California Suzanne Dworak-Peck School of Social Work, Montgomery Ross Fisher Building, 669 West 34th Street, Los Angeles, CA, 90089-0411, United States. Electronic address: dmadden@usc.edu.;The Ohio State University, College of Social Work, 1947 North College Road, Columbus, OH, 43210, United States; University of Southern California Suzanne Dworak-Peck School of Social Work, Montgomery Ross Fisher Building, 669 West 34th Street, Los Angeles, CA, 90089-0411, United States. Electronic address: johnclap@usc.edu.",
"authors": "Syvertsen|Jennifer L|JL|;Toneff|Hannah|H|;Howard|Heather|H|;Spadola|Christine|C|;Madden|Danielle|D|;Clapp|John|J|",
"chemical_list": "D002047:Buprenorphine; D008691:Methadone",
"country": "Ireland",
"delete": false,
"doi": "10.1016/j.drugalcdep.2021.108677",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0376-8716",
"issue": "222()",
"journal": "Drug and alcohol dependence",
"keywords": "Buprenorphine; Methadone; Neonatal abstinence syndrome (NAS); Opioids; Pregnancy; Stigma",
"medline_ta": "Drug Alcohol Depend",
"mesh_terms": "D000328:Adult; D002047:Buprenorphine; D005260:Female; D006282:Health Personnel; D006801:Humans; D007231:Infant, Newborn; D008691:Methadone; D009357:Neonatal Abstinence Syndrome; D009820:Ohio; D058850:Opiate Substitution Treatment; D009293:Opioid-Related Disorders; D011247:Pregnancy; D011248:Pregnancy Complications",
"nlm_unique_id": "7513587",
"other_id": null,
"pages": "108677",
"pmc": null,
"pmid": "33775446",
"pubdate": "2021-05-01",
"publication_types": "D016428:Journal Article; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": null,
"title": "Conceptualizing stigma in contexts of pregnancy and opioid misuse: A qualitative study with women and healthcare providers in Ohio.",
"title_normalized": "conceptualizing stigma in contexts of pregnancy and opioid misuse a qualitative study with women and healthcare providers in ohio"
} | [
{
"companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2021-02727",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHADONE HYDROCHLORIDE"
},
... |
{
"abstract": "In 2017, the European Medicines Agency approved rituximab biosimilars (R-biosimilars) for treatment of diffuse large B-cell lymphoma (DLBCL). Thereafter, the Netherlands was one of the first countries to implement R-biosimilars, given lower costs compared with rituximab originator (R-originator). This study's objective was to investigate whether overall survival (OS) of patients with DLBCL receiving R-biosimilars is similar to patients treated with R-originator. DLBCL patients ≥18 years, diagnosed between 2014 and 2018, who received at least 1 cycle of rituximab combined with cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) were identified in the Netherlands Cancer Registry. Patients were categorized into R-originator or R-biosimilars groups based on data from a central repository of the Dutch medicinal drug market. The primary end point was 3-year OS, defined as the time between diagnosis and all-cause death. By the end of 2018, 91% of purchased rituximab were biosimilars. In total, 4429 patients were identified with 876 in the R-biosimilars group and 3553 in the R-originator group. Patients in the R-biosimilars group less frequently received >6 cycles of R-CHOP compared with patients treated with R-originator (24% vs 30%, P = .003). The 3-year OS did not differ between patients treated with R-originator or R-biosimilars (73% vs 73%, P = .855). This was confirmed with a multivariable Cox regression analysis accounting for sex, age, International Prognostic Index score, and number of R-CHOP cycles. In conclusion, the 3-year OS is similar for patients treated with CHOP in combination with R-originator or R-biosimilars and, therefore, favors the use of R-biosimilars in DLBCL treatment management.",
"affiliations": "Department of Research and Development, Netherlands Comprehensive Cancer Organisation (IKNL), Utrecht, The Netherlands.;Department of Hematology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, Leiden University Medical Center, Leiden, The Netherlands.;Department of Hematology, Amsterdam University Medical Center, Amsterdam, The Netherlands.;Department of Hematology, Amsterdam University Medical Center, Amsterdam, The Netherlands.;Department of Hematology, Amsterdam University Medical Center, Amsterdam, The Netherlands.;Department of Research and Development, Netherlands Comprehensive Cancer Organisation (IKNL), Utrecht, The Netherlands.;Department of Hematology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, Erasmus MC Cancer Institute, Rotterdam, The Netherlands.;Department of Hematology, Radboud University Medical Center, Nijmegen, The Netherlands.;Department of Hematology, University Medical Center Utrecht, Utrecht, The Netherlands.;Department of Medical Oncology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, Maastricht University Medical Center, Maastricht, The Netherlands; and.;Department of Clinical Pharmacy and Pharmacology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, University Medical Center Groningen, Groningen, The Netherlands.;Department of Hematology, University Medical Center Groningen, Groningen, The Netherlands.",
"authors": "Brink|Mirian|M|0000-0002-6014-4810;Kahle|Xaver U|XU|0000-0001-8248-7008;Vermaat|Joost S P|JSP|;Zijlstra|Josee M|JM|0000-0003-1074-5922;Chamuleau|Martine|M|;Kersten|Marie José|MJ|;Durmaz|Müjde|M|;Plattel|Wouter J|WJ|0000-0001-9828-9460;Lugtenburg|Pieternella J|PJ|0000-0002-6735-8651;Stevens|Wendy|W|;Mous|Rogier|R|;de Vries|Elisabeth G E|EGE|0000-0002-8949-7425;van der Poel|Marjolein W M|MWM|;Panday|Prashant V Nannan|PVN|;Huls|Gerwin|G|;van Meerten|Tom|T|;Nijland|Marcel|M|0000-0002-2740-2873",
"chemical_list": "D059451:Biosimilar Pharmaceuticals; D000069283:Rituximab; D014750:Vincristine",
"country": "United States",
"delete": false,
"doi": "10.1182/bloodadvances.2021004295",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2473-9529",
"issue": "5(15)",
"journal": "Blood advances",
"keywords": null,
"medline_ta": "Blood Adv",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D059451:Biosimilar Pharmaceuticals; D006801:Humans; D016403:Lymphoma, Large B-Cell, Diffuse; D000069283:Rituximab; D014750:Vincristine",
"nlm_unique_id": "101698425",
"other_id": null,
"pages": "2958-2964",
"pmc": null,
"pmid": "34338755",
"pubdate": "2021-08-10",
"publication_types": "D016428:Journal Article",
"references": "27345636;15955905;31809224;30083415;11807147;28935843;24401022;29791832;28796588;24550425;18226581;28095160",
"title": "Impact of rituximab biosimilars on overall survival in diffuse large B-cell lymphoma: a Dutch population-based study.",
"title_normalized": "impact of rituximab biosimilars on overall survival in diffuse large b cell lymphoma a dutch population based study"
} | [
{
"companynumb": "NL-CELLTRION INC.-2021NL011351",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE\\DOXORUBICIN\\PREDNISONE\\VINCRISTINE"
... |
{
"abstract": "Publication bias is a type of systematic error when synthesizing evidence that cannot represent the underlying truth. Clinical studies with favorable results are more likely published and thus exaggerate the synthesized evidence in meta-analyses. The trim-and-fill method is a popular tool to detect and adjust for publication bias. Simulation studies have been performed to assess this method, but they may not fully represent realistic settings about publication bias. Based on real-world meta-analyses, this article provides practical guidelines and recommendations for using the trim-and-fill method. We used a worked illustrative example to demonstrate the idea of the trim-and-fill method, and we reviewed three estimators (R0, L0, and Q0) for imputing missing studies. A resampling method was proposed to calculate P values for all 3 estimators. We also summarized available meta-analysis software programs for implementing the trim-and-fill method. Moreover, we applied the method to 29,932 meta-analyses from the Cochrane Database of Systematic Reviews, and empirically evaluated its overall performance. We carefully explored potential issues occurred in our analysis. The estimators L0 and Q0 detected at least one missing study in more meta-analyses than R0, while Q0 often imputed more missing studies than L0. After adding imputed missing studies, the significance of heterogeneity and overall effect sizes changed in many meta-analyses. All estimators generally converged fast. However, L0 and Q0 failed to converge in a few meta-analyses that contained studies with identical effect sizes. Also, P values produced by different estimators could yield different conclusions of publication bias significance. Outliers and the pre-specified direction of missing studies could have influential impact on the trim-and-fill results. Meta-analysts are recommended to perform the trim-and-fill method with great caution when using meta-analysis software programs. Some default settings (e.g., the choice of estimators and the direction of missing studies) in the programs may not be optimal for a certain meta-analysis; they should be determined on a case-by-case basis. Sensitivity analyses are encouraged to examine effects of different estimators and outlying studies. Also, the trim-and-fill estimator should be routinely reported in meta-analyses, because the results depend highly on it.",
"affiliations": "Department of Statistics, Florida State University, FL.",
"authors": "Shi|Linyu|L|;Lin|Lifeng|L|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000015987",
"fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 31169736MD-D-19-0070210.1097/MD.0000000000015987159874400Research ArticleObservational StudyThe trim-and-fill method for publication bias: practical guidelines and recommendations based on a large database of meta-analyses Shi Linyu MSLin Lifeng PhD∗Omboni. Stefano Department of Statistics, Florida State University, FL.∗ Correspondence: Lifeng Lin, 201B OSB, 117N Woodward Ave, Tallahassee, FL 32306, USA (e-mail: linl@stat.fsu.edu).6 2019 07 6 2019 98 23 e1598723 1 2019 15 5 2019 16 5 2019 Copyright © 2019 the Author(s). Published by Wolters Kluwer Health, Inc.2019This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial License 4.0 (CCBY-NC), where it is permissible to download, share, remix, transform, and buildup the work provided it is properly cited. The work cannot be used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc/4.0Abstract\nPublication bias is a type of systematic error when synthesizing evidence that cannot represent the underlying truth. Clinical studies with favorable results are more likely published and thus exaggerate the synthesized evidence in meta-analyses. The trim-and-fill method is a popular tool to detect and adjust for publication bias. Simulation studies have been performed to assess this method, but they may not fully represent realistic settings about publication bias. Based on real-world meta-analyses, this article provides practical guidelines and recommendations for using the trim-and-fill method. We used a worked illustrative example to demonstrate the idea of the trim-and-fill method, and we reviewed three estimators (R0, L0, and Q0) for imputing missing studies. A resampling method was proposed to calculate P values for all 3 estimators. We also summarized available meta-analysis software programs for implementing the trim-and-fill method. Moreover, we applied the method to 29,932 meta-analyses from the Cochrane Database of Systematic Reviews, and empirically evaluated its overall performance. We carefully explored potential issues occurred in our analysis. The estimators L0 and Q0 detected at least one missing study in more meta-analyses than R0, while Q0 often imputed more missing studies than L0. After adding imputed missing studies, the significance of heterogeneity and overall effect sizes changed in many meta-analyses. All estimators generally converged fast. However, L0 and Q0 failed to converge in a few meta-analyses that contained studies with identical effect sizes. Also, P values produced by different estimators could yield different conclusions of publication bias significance. Outliers and the pre-specified direction of missing studies could have influential impact on the trim-and-fill results. Meta-analysts are recommended to perform the trim-and-fill method with great caution when using meta-analysis software programs. Some default settings (e.g., the choice of estimators and the direction of missing studies) in the programs may not be optimal for a certain meta-analysis; they should be determined on a case-by-case basis. Sensitivity analyses are encouraged to examine effects of different estimators and outlying studies. Also, the trim-and-fill estimator should be routinely reported in meta-analyses, because the results depend highly on it.\n\nKeywords\nmeta-analysispublication biassystematic reviewtrim-and-fill methodOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nPublication bias has been a major threat to the validity of the conclusions of meta-analyses and systematic reviews.[1–4] It occurs when the studies in a meta-analysis are selectively published based on their results (e.g., the significance of their P values, the magnitude of their effect estimates, or their sample sizes).[5] Studies with less significant results or smaller sample sizes are often more likely suppressed from publication, either by journal editors or authors themselves who may lack enthusiasm for publishing such studies.[6] Consequently, if publication bias appears in a meta-analysis, the synthesized effect estimates may be exaggerated in an artificially favorable direction. For example, Turner et al[7] identified a total of 74 studies of antidepressant agents that were registered in the US Food and Drug Administration (FDA); among them, 23 were not published. Overall, the effect sizes in the published studies increased by 32% compared with those in the FDA.\n\nThe best method to deal with publication bias is to retrieve related unpublished results as in Turner et al.[7] However, this method is often time-consuming and may be infeasible in many meta-analyses from the practical perspective. Also, the quality of the unpublished results without peer reviews may be questionable. Therefore, various statistical methods have been alternatively used to assess publication bias.[8–12] Among them, the trim-and-fill is one of the most popular methods over the past 20 years.[13–15] Based on a search on Google Scholar on 10 January 2019, Figure 1 shows the number of publications containing the exact phrase “trim-and-fill” year by year since the introduction of this method in 2000. The histogram presents a sharply increasing trend, especially after 2010.\n\nFigure 1 Histogram of publications that used the trim-and-fill method from 2000 to 2018.\n\nCompared with other statistical methods (such as selection models[8]), the trim-and-fill method is relatively intuitive and efficient to detect and adjust for potential publication bias. It is a nonparametric approach based on examining the funnel plot's asymmetry. The funnel plot is widely and frequently used in meta-analyses for assessing publication bias[16]; it is a scatter plot with studies’ effect sizes on the horizontal axis and their standard errors (or other measures of precision, e.g., sample sizes) on the vertical axis.[17–19] The funnel plot is supposed to be symmetrical if no publication bias appears.[9] Missing studies suppressed by publication bias in a meta-analysis usually lead to a noticeable asymmetrical funnel plot. Unlike other popular methods for detecting publication bias (such as various regression tests[9,20]), the trim-and-fill method not only indicates the significance of publication bias but also provide bias-adjusted results.[21] Therefore, this method attracts many evidence users in practical applications and is very effective to perform sensitivity analyses, especially when extracting unpublished results is infeasible and can be only approximated by statistically imputed missing studies.\n\nThe aims of this article are 2-folded. The trim-and-fill method is essentially a delicate statistical approach which involves non-trivial computing procedures, and most meta-analysts rely on user-friendly statistical programs (e.g., R, Stata, and SAS) to implement it. However, the implementation contains many important steps for determining the direction and magnitude of publication bias, and the statistical programs often provide default options for the steps which may be overlooked or even misused by their users. This article provides practical guidelines for appropriately and accurately using the trim-and-fill method.\n\nIn addition, the existing literature has examined the performance of the trim-and-fill method via extensive simulation studies,[14,22–24] which suggested that the method may be used with caution in the presence of substantial heterogeneity between studies in a meta-analysis. However, it is often difficult to justify the appropriateness of the simulation settings in clinical practice, because publication bias could be induced by many factors, including the studies’ effect size magnitudes, P values, and sample sizes. In fact, the assumptions about the suppressed (missing) studies are dramatically different in different statistical methods for publication bias: the trim-and-fill method assumes that the studies with the most extreme effect size magnitudes in an unfavorable direction are suppressed, while many other methods assume that the suppression depends only on P values or sample sizes.[8,9,20,25] Consequently, it is critical to evaluate the properties of the trim-and-fill method among real-world meta-analyses, which may be more practical and informative than simulated meta-analyses. This article applies the trim-and-fill method to a large collection of meta-analyses published in the Cochrane Database of Systematic Reviews and summarizes its overall performance. The findings offer useful recommendations for implementing the trim-and-fill method in future meta-analyses.\n\n2 Methods\n2.1 An illustrative example\nFigure 2(A) shows the funnel plot of a meta-analysis by Andersen et al[26] (pages 55 and 56) on comparing the effects between antibiotics and placebo on preventing infection among patients with simple appendicitis after appendix surgeries. This meta-analysis combined 26 studies, containing a total of 2610 participants who took antibiotics after appendectomy and 2707 who took placebo. The endpoint was wound infection, which can be measured as a binary outcome. Regardless the original statistical analyses performed by Andersen et al,[26] here we used the odds ratio (OR) as the effect size based on the 2 × 2 table reported by each study and analyzed it on a logarithmic scale. A larger effect size indicated a worse wound infection, while a smaller effect size indicated a better condition of wound. Therefore, smaller effect sizes in the negative direction were likely favored in the publication process, and studies with larger effect sizes might be suppressed in the positive direction.\n\nFigure 2 Funnel plots of the meta-analysis by Andersen et al[26] before (panel A) and after (panel B) applying the trim-and-fill method. The closed dots indicate the observed studies, and the open dots indicate the missing studies imputed by the trim-and-fill method (based on the estimator L0). The dashed lines that create a triangular area indicate the 95% confidence limits (under the fixed-effect setting), and the vertical solid line represents the overall effect size.\n\nThe distribution of the published studies displayed in the funnel plot is consistent with the foregoing observation. The lower right area in the funnel plot seems to contain some missing studies that tend to report more serious wound infections with larger standard errors (implying smaller sample sizes). Such missing studies have less desirable clinical results and thus are likely suppressed. Because of the potentially missing studies, the funnel plot looks fairly asymmetrical and strongly indicates publication bias. The overall log OR is estimated as −0.928 with 95% confidence interval (CI) [−1.172, −0.685]; that is, the OR is 0.395 with 95% CI [0.310, 0.504].\n\n2.2 Fundamental idea of the trim-and-fill method\nThe trim-and-fill method aims at estimating potentially missing studies due to publication bias in the funnel plot and adjusting the overall effect estimate. The fundamental assumption of the trim-and-fill method is that the studies with the most extreme effect sizes, either on the left or on the right side, are suppressed. The direction of the missing studies depends on the expectation from general stakeholders (including patients, physicians, decision makers, and sponsors) on a case-by-case basis. For example, the studies in the foregoing illustrative example favor the negative direction of the OR, because they indicate reduced wound infections. Consider another example where the effect size remains to be the OR and the outcome is smoking cessation[27]; the OR in the positive direction may be favored in this case, because it indicates a higher smoking cessation rate and supports the effectiveness of interventions.\n\nThe idea of the trim-and-fill method is to first trim the studies that cause a funnel plot's asymmetry so that the overall effect estimate produced by the remaining studies can be considered minimally impacted by publication bias, and then to fill imputed missing studies in the funnel plot based on the bias-corrected overall estimate.\n\nIn practice, without the true overall effect size, it is infeasible to identify the studies to be trimmed at the first step. An iterative algorithm is consequently applied to deal with this problem. Specifically, at the initial step, based on the estimated overall effect size in the original meta-analysis without any adjustment for publication bias, we can use a certain estimator (see Table 1) to estimate the number of missing studies. However, because the result may be subject to publication bias, we need to trim some studies (the number of which equals to the estimated number of missing studies) with effect sizes in the favorable direction (opposite to that of missing studies), so that the funnel plot becomes more symmetrical and the remaining studies are less influenced by publication bias. Then, we use the trimmed meta-analysis to obtain an updated overall effect estimate and continue to estimate the number of missing studies until it converges (i.e., remaining the same in 2 consecutive steps). Finally, the imputed missing studies are filled in the funnel plot to adjust for publication bias. Section 2.3 provides more details of the iterative algorithm.\n\nTable 1 Notation used in the trim-and-fill method assuming that studies with effect sizes in the negative direction are suppressed.\n\nIn the current literature, the algorithm's convergence and the number of iterations that lead to the convergence are largely unknown. This article will present findings of these important properties of the trim-and-fill method. Moreover, in this article and in many realistic applications, studies collected in a meta-analysis is often considered heterogeneous,[28,29] and the random-effects meta-analysis model, such as the DerSimonian–Laird method,[30] is used to incorporate between-study heterogeneity in the overall effect estimate.[31]\n\nFigure 2(B) presents the funnel plot with the missing studies imputed by the trim-and-fill method. Eight missing studies are filled in the plot, and the overall log OR becomes −0.790 with 95% CI [−1.024, −0.557].\n\n2.3 Implementation\nTable 1 gives the notation used in a meta-analysis and the trim-and-fill method, including 3 estimators R0, L0, and Q0 for imputing the missing studies. The overall effect size θ is unknown and of primary interest; therefore, the foregoing 3 estimators of the number of missing studies cannot be directly calculated and need to be updated step by step using the iterative algorithm.\n\nThe original trim-and-fill method by Duval and Tweedie[13] tentatively assumes that k0 studies with the most extreme effect sizes in the negative direction are suppressed due to publication bias. If the missing studies are in the positive direction as in the illustrative example in Section 2.1, one may simply invert the direction of the original effect sizes (i.e., and ) so that the direction of missing studies becomes negative. Then, the standard trim-and-fill method can be directly applied to the inverted data and the final results are back-transformed by inverting the direction again.\n\nIn practice, the direction of potentially missing studies may differ case by case, and this must be pre-specified before performing the trim-and-fill method. False positive conclusions about publication bias may arise if this direction is wrongly specified. Many meta-analysis software programs use Egger regression[9] to suggest such a direction as the default. A positive intercept from Egger regression indicates the meta-analysis result tend to be biased toward the right side of the funnel plot, and the missing studies are in the negative direction.[11] In contrast, a negative intercept implies bias toward the left side, and the missing studies are likely in the positive direction. Although Egger regression provides a convenient way to determine the direction of missing studies, its decision may be opposite to that based on stakeholders’ belief in some case, leading to invalid results from the trim-and-fill method. Therefore, for each specific meta-analysis, researchers should judge the direction of potentially missing studies by accounting for stakeholders’ expectation, instead of relying only on Egger regression.\n\nAs its name suggests, the trim-and-fill method consists of 2 main steps. The first step aims at trimming k0 studies in the opposite direction of missing studies so that the trimmed meta-analysis is less affected by publication bias. The iterative algorithm is applied to estimate the number of missing studies k0 as well as the overall effect size θ; their estimates are denoted as and , respectively. We use the illustrative example in Section 2.1 to show the process of this iterative algorithm. Egger regression shows that the missing studies tend to be on the right, which agrees with the funnel plot in Figure 2(A). Using the random-effects model, the initial overall effect size in the original meta-analysis is estimated as . At the first iteration, based on the estimator L0, the number of missing studies is estimated as for the centralized data . Consequently, 7 studies with the most negative effect sizes on the left side are trimmed; based on the remaining 19 studies, the estimated overall effect size is updated as . The estimated number of missing studies is further updated as after using to centralize the studies. We continue to trim 8 studies with the most negative effect sizes and obtain updated estimate , which leads to , equaling to in the previous iteration; therefore, the estimated overall effect size remains to be . The algorithm converges at the third iteration, and the final estimate of the number of missing studies is .\n\nThe second major step is to fill missing studies in the funnel plot. Specifically, the estimate of the overall effect size in the last iteration that achieves the convergence is used as the axis of symmetry, and we project 8 studies with the most negative effect sizes from the left side to the right side in the funnel plot as in Figure 2(B). Applying the random-effects model to the filled meta-analysis with the observed 26 studies and the imputed 8 missing studies, the final bias-adjusted estimate of the overall effect size is with 95% CI [−1.024, −0.557].\n\nCompared with the original meta-analysis, the estimated overall log OR is closer to zero, because the imputed missing studies are added in the positive direction. Also, its 95% CI shrinks slightly, possible because more studies are included in the meta-analysis and thus the result becomes more precise.\n\n2.4 Calculation of P value\nBesides adjusting for publication bias, most meta-analyses report P values to show the significance of the bias. The significance level for publication bias is often set to .1 (instead of the commonly-used .05[32]), because most statistical tests have low power to detect publication bias.[25] The P value of the trim-and-fill method is usually calculated based on the R0 estimator, because it follows the negative binomial distribution under the null hypothesis of no publication bias. It is infeasible to derive the theoretical (closed-form) null distributions of L0 and Q0[13]; alternatively, we propose to use the resampling method to calculate the P values for all 3 estimators.\n\nReferring to the notation in Table 1, the process of calculating the resampling-based P values is as follows. First, under the null hypothesis, we estimate the overall effect size as and the between-study variance as in the original meta-analysis. Also, we calculate the three estimators for the trim-and-fill method as R0, L0, and Q0. Second, we generate a total of B (say, B = 10,000) resampled meta-analyses under the null hypothesis. For the bth resampled meta-analysis, we sample n within-study variances from those of the original meta-analysis, , with replacement, and we denote them as . Also, we sample the effect sizes from under the null hypothesis. Third, for each resampled meta-analysis, we obtain the three trim-and-fill estimators and denote them as , , and . Finally, the resampling-based P values of the three estimators are calculated as \n\n \n\n \n\nwhere is the indicator function, and the constant one is artificially added to both numerator and denominator in each proportion to avoid calculating the P values as zero.\n\nIn the illustrative example in Section 2.1, based on B = 10,000 resampling iterations, the P values of R0, L0 and Q0 are <.01, .02 and .03, respectively, all indicating significant publication bias. Moreover, the theoretical P value of R0 (based on the negative binomial distribution under the null hypothesis) is also <.01.\n\n2.5 Software programs\nMany software programs are available to perform the trim-and-fill method. Table 2 provides a summary of several commonly-used programs, including the function trimfill() in the two R core packages for meta-analysis, “metafor”[33] (version 2.0–0) and “meta”[34] (version 4.9–2), the Stata (version 15) command metatrim,[35,36] the SAS (version 9.4) macro PUB_BIAS,[37] and the commercial program Comprehensive Meta-Analysis (CMA, version 3.0).[38] Of note, the Reviewer Manager (RevMan, version 5),[39] which is the software specifically used for preparing and maintaining Cochrane reviews, cannot perform the trim-and-fill method.[40]\n\nTable 2 Commonly-used software programs for performing the trim-and-fill method.\n\nAll programs except the SAS macro use L0 as the default trim-and-fill estimator; R0 is the only option in the SAS macro PUB_BIAS. The R package “metafor” and Stata command metatrim can implement all three estimators, while Q0 is not available in the R package “meta”. The Stata macro metatrim refers to R0, L0, and Q0 as “run”, “linear”, and “quadratic”, respectively. In addition, the direction of missing studies is usually determined using Egger regression in these programs by default, while CMA is a menu-driven program and asks users to choose the direction of missing studies.\n\n2.6 Empirical evaluation\nTo comprehensively assess the performance of the trim-and-fill method among realistic meta-analyses, we applied the method to a large collection of meta-analyses from the Cochrane Database of Systematic Reviews, which offers leading sources of evidence on healthcare-related topics.\n\nWe collected all Cochrane reviews from 2003 Issue 1 to 2018 Issue 5, and downloaded their data iteratively using the R package “RCurl”[41] in May 2018. We selected meta-analyses containing at least 5 studies from all reviews and classified them into 2 groups based on their outcomes (binary or non-binary). For each meta-analysis with binary outcomes, we used the log OR as the effect size, regardless the choice of effect size in its original review. When zero counts existed in a study's 2 × 2 table, the continuity correction of 0.5 was added to all 4 data cells to adjust the (log) OR and its variance.[39] If both groups of the study had no events, the (log) OR was not estimable and was removed from our analysis.\n\nWe used the package “metafor”[33] (version 2.0–0) in R (version 3.5.1) to perform the trim-and-fill method for each eligible meta-analysis based on all three estimators R0, L0, and Q0, and obtained the number of iterations to achieve the trim-and-fill algorithm's convergence. Also, we estimated the number of missing studies, the original and bias-adjusted overall effect sizes, and the P value of the Q test for heterogeneity in each meta-analysis.\n\nMoreover, using some convenience samples, we compared the P values of all three estimators and investigated the effects of outlying studies on the trim-and-fill results. The outlying studies were identified using the diagnostics proposed by Viechtbauer and Cheung[42] under the random-effects setting. Specifically, a residual of each study in a meta-analysis was calculated and was expected to approximately follow the standard normal distribution; the study was considered outlying if its residual was larger than three in absolute magnitude. In addition, we carefully explored the potential issues occurred when performing the trim-and-fill method. We summarized the method's overall empirical performance and provided practical recommendations.\n\nNo ethical approval and patient consent were required in our study, because this article focused on statistical methods for meta-analyses, and all analyses were performed based on published data in the literature.\n\n3 Results\n3.1 Overall empirical performance of the trim-and-fill method\n3.1.1 The estimated number of missing studies\nIn total, our analysis included 18,562 meta-analyses with binary outcomes and 11,370 with non-binary outcomes. The upper panels in Figures 3 and 4 show the frequencies of the estimated number of missing studies based on the three estimators among meta-analyses with binary and non-binary outcomes, respectively. Recall that implied no publication bias. The R0 estimator ranged from 0 to 38 for binary outcomes and from 0 to 18 for non-binary outcomes; it detected publication bias in much less meta-analyses than L0 (ranging from 0 to 34 for binary outcomes and from 0 to 24 for non-binary outcomes) and Q0 (ranging from 0 to 62 for binary outcomes and from 0 to 113 for non-binary outcomes). The R0 estimator was zero in 11,147 (60.1%) meta-analyses with binary outcomes, while 6099 (32.9%) ones had L0 = 0 and Q0 = 0. Among meta-analyses with non-binary outcomes, 7495 (65.9%) had R0 = 0 and 5168 (45.5%) had L0 = 0 and Q0 = 0. The R0 estimator tended to detect less missing studies than L0 and Q0 for both outcome types.\n\nFigure 3 Histograms of the estimated number of missing studies (upper panels) and the number of iterations to achieve the convergence of the trim-and-fill algorithm (lower panels) based on the three estimators R0, L0 and Q0 among Cochrane meta-analyses with binary outcomes.\n\nFigure 4 Histograms of the estimated number of missing studies (upper panels) and the number of iterations to achieve the convergence of the trim-and-fill algorithm (lower panels) based on the three estimators R0, L0 and Q0 among Cochrane meta-analyses with non-binary outcomes.\n\nThe L0 and Q0 were estimated as zero among the same meta-analyses, possibly because their mathematical formulas were similar in the absence of publication bias (k0 = 0). However, in the presence of publication bias (k0 > 0), L0 tended to detect less missing studies than Q0. In general, L0 detected 1 or 2 missing studies in many meta-analyses. As shown in Figure 3(C) and 4(C), the distributions of Q0 had heavy right tails; Q0 detected at least ten missing studies in much more meta-analyses than the other 2 estimators.\n\n3.1.2 The number of iterations to achieve the trim-and-fill algorithm's convergence\nThe lower panels in Figures 3 and 4 present the number of iterations to achieve the convergence of the trim-and-fill algorithm using the three estimators among the Cochrane meta-analyses with binary and non-binary outcomes, respectively. All 3 estimators converged fast in most cases; the frequencies generally had a decreasing trend as the number of iterations increased. The R0 estimator converged slightly faster than L0, while both converged within four iterations in around 98% meta-analyses for both outcome types. Furthermore, L0 tended to converge faster than Q0.\n\n3.1.3 Changes of heterogeneity and overall effect size\nTable 3 presents the changes of the significance of heterogeneity (based on the Q test) and overall effect sizes after applying the trim-and-fill method to the Cochrane meta-analyses. Of note, the significant level was set to .05 here, which was different from that for publication bias tests. For most meta-analyses with binary outcomes, their heterogeneity remained non-significant after using the trim-and-fill method, while around 20% meta-analyses remained significantly heterogeneous. A noticeable proportion of meta-analyses (about 5–15%) were not significantly heterogeneous before using the trim-and-fill method, but their heterogeneity became significant after adding imputed missing studies. The heterogeneity in only few meta-analyses (much less than 1%) was originally significant and became non-significant when using the trim-and-fill method. These were possibly because adding imputed missing studies likely extended the distribution range of a meta-analysis and thus made the whole set of studies more heterogeneous. For example, referring to the illustrative example in Figure 2, the log OR mostly ranged from −3 to 0 in the original meta-analysis, and the range extended to from −3 to 1.5 after incorporating the eight imputed missing studies. In addition, Q0 changed the significance of heterogeneity in more meta-analyses than the other 2 estimators, possibly because it could detect more missing studies (Fig. 3) and thus lead to more heterogeneous bias-adjusted meta-analyses.\n\nTable 3 Changes of the significance of the heterogeneity (based on the Q test) and the estimated overall effect size () before and after applying the trim-and-fill method to Cochrane meta-analyses.\n\nWhen the outcomes were non-binary, a larger proportion of meta-analyses was significantly heterogeneous compared with those with binary outcomes: around 50% of meta-analyses with non-binary outcomes remained significantly heterogeneous after using the trim-and-fill method. The other trends were similar to those for binary outcomes.\n\nFor both binary and non-binary outcomes, the significance of the estimated overall effect sizes changed in a noticeable number of meta-analyses after using the trim-and-fill method. The corresponding proportions roughly ranged from 1% to 8%, depending on the estimators used to impute missing studies; Q0 inverted the significance in more meta-analyses than the other 2 estimators. The inverted significance of might be interpreted from two perspectives. On the one hand, the imputed missing studies were likely in an unfavorable direction and adding them into the meta-analysis might move toward the null value, so that might become non-significant. On the other hand, incorporating missing studies in the meta-analysis effectively increased the total sample size and thus the precision, so that the CI of might shrink and might become significant if the true effect size was away from the null value. Because the significance of depended on various factors, it should be explored case by case.\n\n3.2 Issues occurred when performing the trim-and-fill method\n3.2.1 Case of failing to calculate the trim-and-fill estimator\nWhen we used Q0 to implement the trim-and-fill method among the Cochrane meta-analyses with binary outcomes, 3784 (20.39%) produced errors in estimating the number of missing studies; specifically, R displayed NaN (“not a number”) for Q0. Similar issues occurred for non-binary outcomes; Q0 produced NaN in 1880 (16.53%) meta-analyses with non-binary outcomes. Such unusual results were because these meta-analyses led to negative values inside the square root in the formula of Q0; see Table 1. To avoid this issue, if the value inside the square root was negative, we slightly revised the formula of Q0 by setting this negative value to 1/4, so that Q0 was estimated as n−1; this was the maximum number of missing studies that could be estimated by the trim-and-fill method. After the revision, Q0 was successfully calculated in all meta-analyses.\n\n3.2.2 Case of the trim-and-fill method failing to converge\nIn 2 Cochrane meta-analyses with binary outcomes and 6 with non-binary outcomes, the trim-and-fill algorithm did not converge when using L0 and Q0 due to different reasons. In these cases, the estimators continued to oscillate (e.g., calculated as 4, 5, 4, 5, 4, and so on) after sufficient iterations so that the algorithm could not converge.\n\nFirst, L0 in one meta-analysis with binary outcomes by Li et al[43] (page 42) did not converge. This meta-analysis included 12 studies comparing effects of intravenous magnesium with placebo on myocardial infarction, and the outcome was cardiogenic shock. Potential missing studies were on the right side because negative effect sizes indicated less cardiogenic shocks and thus better treatment effects. The L0 estimator continuously oscillated between 4 and 5 after 2 trim-and-fill iterations, while R0 and Q0 converged to 2 and 11, respectively. The oscillation of L0 was possibly because the effect sizes of several studies were fairly close to zero and 1 study had an overwhelming weight (>90%) in this meta-analysis. Therefore, the estimated overall effect size differed little during the trim-and-fill iterations, and such slight differences caused two studies to continuously exchange their ranks in the term Tn used to calculate L0 (see Table 1). Consequently, L0 was rounded to either 4 or 5 and did not converge.\n\nSecond, Q0 in a few meta-analyses also did not converge. For example, in a meta-analysis with binary outcomes by Spooner et al[44] (page 48), Q0 oscillated between 3 and 4, while both R0 and L0 converged to 2. This meta-analysis contained five studies on the effect of mast-cell substance on preventing exercise-induced bronchoconstriction or asthma among children. In another meta-analysis by Heiwe et al[45] (page 281), Q0 also did not converge. This meta-analysis compared the effects of 4-to-6-month cardiovascular exercise with control group on a non-binary outcome (the maximum heart rate), and the effect size was the mean difference. Both meta-analyses potentially had missing studies on the right side in the funnel plot. In each of them, the 2 rightmost studies with the largest effect sizes had identical point estimates and standard errors, and thus they overlapped in the funnel plots. The oscillation of Q0 was likely caused by intrinsic computational inaccuracy in R when the “metafor” package analyzing the 2 rightmost studies with identical effect sizes. For example, interestingly, the output of 1.2/0.2 – 6 in R (version 3.5.1) was not exactly zero; instead, R returned a very tiny negative value. Although the computational inaccuracy was tiny, it impacted the calculation of studies’ ranks for Q0 (see Table 1).\n\nSimilarly, Q0 did not converge in other 5 meta-analyses with non-binary outcomes, because in each of them at least 2 studies had identical point estimates of their effect sizes (while their standard errors might differ) and their effect sizes were the most extreme ones (in either the negative or positive direction). Therefore, these studies fell on the same vertical line in the funnel plot, and Q0 could not converge also due to intrinsic computational inaccuracy in R.\n\nThese findings suggested that Q0 might not converge if a meta-analysis contained at least 2 studies with identical point estimates of effect sizes. Among the Cochrane meta-analyses, 1308 (7.05%) with binary outcomes and 2294 (20.18%) with non-binary outcomes had at least two such studies. Furthermore, 512 (2.76%) and 151 (1.33%) meta-analyses with binary and non-binary outcomes had at least 2 studies with identical point estimates and also identical standard errors, respectively. Nevertheless, if the corresponding studies were not the most extreme ones in the meta-analysis, the identical effect sizes did not cause the issue of convergence.\n\n3.2.3 Disagreement between P values based on different estimators\nTable 4 presents P values of all 3 trim-and-fill estimators in a convenience sample of three meta-analyses by Andersen et al,[26] Li et al,[43] and Spooner et al[44] which have been introduced before. Because L0 or Q0 oscillated in the last 2 meta-analyses, we stopped the trim-and-fill algorithm at the 100th iteration so that the P value could be calculated.\n\nTable 4 P values of the 3 trim-and-fill estimators in 3 Cochrane meta-analyses.\n\nThe P values of R0 based on the theoretical distribution and the resampling method were fairly similar in all 3 meta-analyses; however, the P values of different estimators might lead to different conclusions about publication bias significance. For example, in the meta-analysis by Li et al,[43] both R0 and L0 indicated non-significant publication bias, while Q0 implied significant bias (at the level 0.1). In the meta-analysis by Spooner et al,[44]R0 detected significant publication bias, while the other 2 estimators did not.\n\n3.2.4 Impact of outlying studies on the trim-and-fill method\nWe used the meta-analysis by Khanna et al[46] (page 346) to illustrate the impact of outlying studies on the trim-and-fill method. This meta-analysis collected 8 studies comparing effects of aripiprazole and clozapine on adverse effects among patients who experienced at least one adverse effect; the outcome was binary. Based on the outlier detection method by Viechtbauer and Cheung[42] under the random-effects setting, the rightmost study had a residual larger than 3 and thus was considered outlying. All three trim-and-fill estimators were zero, implying no publication bias. However, if this outlying study was removed, both L0 and Q0 became 2, while R0 remained to be zero.\n\n4 Discussion\n4.1 Main findings\nThis article has illustrated the use of the trim-and-fill method and investigated its performance and potential issues in realistic applications based on a large collection of Cochrane meta-analyses. The trim-and-fill algorithm can mostly converge fast within 4 iterations, while a few meta-analyses required much more iterations to achieve the convergence, especially when using the Q0 estimator.\n\nIn the original papers by Duval and Tweedie,[13,14] both R0 and L0 are recommended. The L0 estimator may be preferable when a meta-analysis contains over 25% missing studies because it likely has a smaller mean squared error. The R0 estimator is preferable when a meta-analysis has many observed studies (n is large)[2]; also, it has the simplest formula and its null distribution is exactly the negative binomial distribution which can be used to calculate the theoretical P value of publication bias. Our study has shown that both L0 and Q0 detected missing studies in noticeably more meta-analyses than R0, and the estimated number of missing studies by Q0 was often larger than that by L0.\n\nIn meta-analyses that contained studies with identical effect sizes, L0 and Q0 may fail to converge, while R0 had no such issues. Also, although only R0 had a closed-form null distribution to yield P values, we have illustrated that the resampling method can be used to calculate P values for all 3 estimators. Based on convenience samples of three meta-analyses, P values based on different estimators could inform difference extents of publication bias significance. In addition, we have shown that outlying studies could have great impact on the trim-and-fill method.\n\n4.2 Strengths and limitations\nOur study was based on a total of 29,932 Cochrane meta-analyses, which are considered high-quality evidence for aiding healthcare-related decisions. We extracted the Cochrane meta-analyses at the subgroup-specific level, so these meta-analyses were not too heterogeneous. The trim-and-fill method was performed under the random-effects setting to properly account for heterogeneity.[31] Using the realistic meta-analyses, instead of simulated meta-analyses as in several existing studies,[14,22–24] our findings could offer practical guidelines and recommendations for the trim-and-fill method, because simulations may not fully induce the true mechanism of publication bias.\n\nNevertheless, our analysis had several limitations. First, because the database of meta-analyses used in this article was huge, it was infeasible to identify the true status of publication bias and the direction of potentially missing studies in each meta-analysis. Egger regression was used to determine the direction of missing studies, but it might be inaccurate. Second, we used only the R package “metafor” to implement the trim-and-fill method. Different programs may have slightly different implementation details, for example, when rounding the trim-and-fill estimators[13,14]; therefore, the results produced by different programs may not be identical. Third, our analysis depended on the assumptions made by the trim-and-fill method to assess publication bias; however, they may be violated in some cases. The trim-and-fill method is based on the funnel plot, while the funnel plot's asymmetry may be attributable to some other factors besides publication bias.[47] We could not rule out the confounders that might cause the asymmetry of funnel plots in our large database of meta-analyses.\n\n4.3 Practical implications\nAlthough the trim-and-fill method is attractive and popular, its implementation requires extensive statistical coding, so nearly all meta-analysts rely on certain statistical programs to perform the method. Our study indicates that cautions are needed when meta-analysts perform the trim-and-fill method and report its results.\n\nFirst, as shown in Figures 3 and 4 and Table 3, the results of the trim-and-fill method depend greatly on the selected estimator (R0, L0, or Q0) for imputing missing studies. In the current literature, the specific estimator is rarely reported. We recommend meta-analysts to try all three estimators as sensitivity analyses because different estimators may be advantageous in different situations, and to clearly specify the estimators used in their analyses.\n\nSecond, heterogeneity and publication bias may mutually impact each other. On the one hand, as shown in Table 3, many meta-analyses became heterogeneous after incorporating imputed missing studies by the trim-and-fill method. Publication bias could noticeably influence the estimate of heterogeneity.[48] On the other hand, existing studies have shown that substantial heterogeneity may seriously impair the power of the trim-and-fill method.[23] In the presence of both substantial heterogeneity and publication bias, meta-analysts should carefully examine whether the funnel plot's asymmetry is truly caused by publication bias or confounded by heterogeneity.[49] More sophisticated statistical methods (e.g., selection models) may be used to better model publication bias in such cases.[22]\n\nThird, meta-analysts should be aware of the potential issues when performing the trim-and-fill method. For example, our empirical analysis has shown that some trim-and-fill estimators may not converge or cannot be calculated using some meta-analysis programs. These issues are likely due to some intrinsic computational inaccuracy of the programs when the meta-analysis contains studies with identical effect sizes. Meta-analysts might want to use different programs to implement the trim-and-fill method and check if the issues continue to occur.\n\nFourth, all 3 trim-and-fill estimators can yield P values using the resampling method, and these P values may inform different extents of publication bias significance. Again, it is critical to report the estimator used in the meta-analysis, so that the conclusion about publication bias can be replicable.\n\nFifth, outlying studies should be carefully investigated when using the trim-and-fill method. The studies with extreme outlying effect sizes may greatly influence the detection of publication bias. Different directions of the outliers may mislead meta-analysis results to different extents, and the statistical power of the trim-and-fill method may be sharply decreased due to outliers. Suppose missing studies are truly in the negative direction. If the outliers are in the opposite direction, then the estimated overall effect size (before adjusting publication bias) may be too positive, and the trim-and-fill method may wrongly estimate the number of missing studies. On the other hand, if the outliers and the potentially missing studies happen to be in the same detection, the outliers may mask the missing studies, and the trim-and-fill method may fail to detect publication bias. Sensitivity analyses that include and exclude potential outliers may be considered to assess the impact of the outliers on the meta-analysis conclusions.[50]\n\nLast but not least, the direction of missing studies is essential when performing the trim-and-fill method. Some meta-analysis programs (such as the R package “metafor” used in our analysis) apply Egger regression to automatically determine this direction, and some (such as CMA) may simply use the negative direction as the default. However, neither option is guaranteed to be correct for a specific meta-analysis. Egger regression is known to produce inflated false positive rates for (log) OR,[20,25,51] so its estimated intercept may not accurately reflect the true direction of missing studies. In practice, meta-analysts must incorporate stakeholders’ preferences to decide the direction. If the direction is determined wrongly, the trim-and-fill results will change greatly and are completely invalid. For example, in the illustrative example in Section 2.1, missing studies are expected to be in the positive direction, because negative effect sizes imply less wound infections and are favored by stakeholders. If we set the direction of missing studies to be negative and re-apply the trim-and-fill method to the illustrative example, none of the three estimators implies significant publication bias.\n\n4.4 Future work\nThe Cochrane meta-analyses used in our study do not have gold standards to ascertain publication bias, and it is infeasible to obtain the true magnitude and direction of publication bias in each Cochrane meta-analysis. Our future work includes applying the trim-and-fill method to meta-analyses in which unpublished studies can be retrieved from certain sources,[7,52] such as clinical trial registries including ClinicalTrials.gov by the US National Institutes of Health and the International Clinical Trials Registry Platform by the World Health Organization. Such meta-analyses permit the comparison between the actual unpublished studies with the imputed missing studies by the trim-and-fill method. Also, the current trim-and-fill method is applicable only to univariate meta-analyses. Methodological work is highly needed to generalize it to multivariate and network meta-analyses of multiple outcomes and multiple treatments.[53]\n\nAuthor contributions\nConceptualization: Lifeng Lin.\n\nData curation: Lifeng Lin.\n\nFormal analysis: Linyu Shi.\n\nMethodology: Linyu Shi, Lifeng Lin.\n\nSoftware: Linyu Shi.\n\nSupervision: Lifeng Lin.\n\nValidation: Lifeng Lin.\n\nVisualization: Linyu Shi.\n\nWriting – original draft: Linyu Shi.\n\nWriting – review & editing: Lifeng Lin.\n\nLifeng Lin orcid: 0000-0002-3562-9816.\n\nAbbreviations: CI = confidence interval, FDA = Food and Drug Administration, OR = odds ratio.\n\nLL was supported in part by the Committee on Faculty Research Support (COFRS) program from Florida State University Council on Research and Creativity.\n\nThe authors have no conflicts of interest to disclose.\n==== Refs\nReferences\n[1] Dickersin K \nThe existence of publication bias and risk factors for its occurrence . JAMA \n1990 ;263 :1385–9 .2406472 \n[2] Rothstein HR Sutton AJ Borenstein M \nPublication Bias in Meta-Analysis: Prevention, Assessment and Adjustments . Chichester, UK : John Wiley & Sons ; 2005 .\n[3] Moher D Liberati A Tetzlaff J \nPreferred reporting items for systematic reviews and meta-analyses: the PRISMA statement . PLoS Med \n2009 ;6 :e1000097.19621072 \n[4] Gurevitch J Koricheva J Nakagawa S \nMeta-analysis and the science of research synthesis . Nature \n2018 ;555 :175–82 .29517004 \n[5] Bax L Moons KG \nBeyond publication bias . J Clin Epidemiol \n2011 ;64 :459–62 .21194886 \n[6] Nissen SB Magidson T Gross K \nPublication bias and the canonization of false facts . ELife \n2016 ;5 :e21451.27995896 \n[7] Turner EH Matthews AM Linardatos E \nSelective publication of antidepressant trials and its influence on apparent efficacy . N Engl J Med \n2008 ;358 :252–60 .18199864 \n[8] Sutton AJ Song F Gilbody SM \nModelling publication bias in meta-analysis: a review . Stat Methods Med Res \n2000 ;9 :421–45 .11191259 \n[9] Egger M Davey Smith G Schneider M \nBias in meta-analysis detected by a simple, graphical test . BMJ \n1997 ;315 :629–34 .9310563 \n[10] Jin Z-C Zhou X-H He J \nStatistical methods for dealing with publication bias in meta-analysis . Stat Med \n2015 ;34 :343–60 .25363575 \n[11] Lin L Chu H \nQuantifying publication bias in meta-analysis . Biometrics \n2018 ;74 :785–94 .29141096 \n[12] Lin L Chu H Murad MH \nEmpirical comparison of publication bias tests in meta-analysis . J Gen Intern Med \n2018 ;33 :1260–7 .29663281 \n[13] Duval S Tweedie R \nA nonparametric “trim and fill” method of accounting for publication bias in meta-analysis . J Am Stat Assoc \n2000 ;95 :89–98 .\n[14] Duval S Tweedie R \nTrim and fill: a simple funnel-plot–based method of testing and adjusting for publication bias in meta-analysis . Biometrics \n2000 ;56 :455–63 .10877304 \n[15] Sutton AJ Duval SJ Tweedie RL \nEmpirical assessment of effect of publication bias on meta-analyses . BMJ \n2000 ;320 :1574–7 .10845965 \n[16] Herrmann D Sinnett P Holmes J \nStatistical controversies in clinical research: publication bias evaluations are not routinely conducted in clinical oncology systematic reviews . Ann Oncol \n2017 ;28 :931–7 .28039176 \n[17] Light RJ Pillemer DB \nSumming Up: The Science of Reviewing Research. \nCambridge, MA : Harvard University Press ; 1984 .\n[18] Peters JL Sutton AJ Jones DR \nContour-enhanced meta-analysis funnel plots help distinguish publication bias from other causes of asymmetry . J Clin Epidemiol \n2008 ;61 :991–6 .18538991 \n[19] Lin L \nGraphical augmentations to sample-size-based funnel plot in meta-analysis . Res Synth Methods \n2019 ;In press. DOI: 10.1002/jrsm.1340 .\n[20] Peters JL Sutton AJ Jones DR \nComparison of two methods to detect publication bias in meta-analysis . JAMA \n2006 ;295 :676–80 .16467236 \n[21] Murad MH Chu H Lin L \nThe effect of publication bias magnitude and direction on the certainty in evidence . BMJ Evid-Based Med \n2018 ;23 :84–6 .\n[22] Terrin N Schmid CH Lau J \nAdjusting for publication bias in the presence of heterogeneity . Stat Med \n2003 ;22 :2113–26 .12820277 \n[23] Peters JL Sutton AJ Jones DR \nPerformance of the trim and fill method in the presence of publication bias and between-study heterogeneity . Stat Med \n2007 ;26 :4544–62 .17476644 \n[24] Moreno SG Sutton AJ Ades AE \nAssessment of regression-based methods to adjust for publication bias through a comprehensive simulation study . BMC Med Res Methodol \n2009 ;9 :2.19138428 \n[25] Macaskill P Walter SD Irwig L \nA comparison of methods to detect publication bias in meta-analysis . Stat Med \n2001 ;20 :641–54 .11223905 \n[26] Andersen BR Kallehave FL Andersen HK \nAntibiotics versus placebo for prevention of postoperative infection after appendicectomy . Cochrane Datab Syst Rev \n2005 ;3 : Art. No.: CD001439 .\n[27] Hasselblad V \nMeta-analysis of multitreatment studies . Med Decis Making \n1998 ;18 :37–43 .9456207 \n[28] Higgins JPT \nCommentary: heterogeneity in meta-analysis should be expected and appropriately quantified . Int J Epidemiol \n2008 ;37 :1158–60 .18832388 \n[29] Ma X Lin L Qu Z \nPerformance of between-study heterogeneity measures in the Cochrane Library . Epidemiology \n2018 ;29 :821–4 .29847495 \n[30] DerSimonian R Laird N \nMeta-analysis in clinical trials . Control Clin Trials \n1986 ;7 :177–88 .3802833 \n[31] Riley RD Higgins JPT Deeks JJ \nInterpretation of random effects meta-analyses . BMJ \n2011 ;342 :d549.21310794 \n[32] Sellke T Bayarri MJ Berger JO \nCalibration of p values for testing precise null hypotheses . Am Stat \n2001 ;55 :62–71 .\n[33] Viechtbauer W \nConducting meta-analyses in R with the metafor package . J Stat Software \n2010 ;36 :3.\n[34] Schwarzer G \nmeta: An R package for meta-analysis . R News \n2007 ;7 :40–5 .\n[35] Palmer TM Sutton AJ Peters JL \nContour-enhanced funnel plots for meta-analysis . Stata J \n2008 ;8 :242–54 .\n[36] Palmer TM Sterne JAC \nMeta-Analysis in Stata: An Updated Collection from the Stata Journal . 2nd ed. College Station, TX : Stata Press ; 2016 .\n[37] Rendina-Gobioff G, D Kromrey J. PUB_BIAS: a SAS® macro for detecting publication bias in meta-analysis ; 2006 .\n[38] Borenstein M Hedges LV Higgins JPT \nIntroduction to Meta-Analysis. \nChichester, UK : John Wiley & Sons ; 2009 .\n[39] Higgins JPT Green S \nCochrane Handbook for Systematic Reviews of Interventions. \nChichester, UK : John Wiley & Sons ; 2008 .\n[40] Bax L Yu L-M Ikeda N \nA systematic comparison of software dedicated to meta-analysis of causal studies . BMC Med Res Methodol \n2007 ;7 :40.17845719 \n[41] Temple Lang D. RCurl: General Network (HTTP/FTP/...) Client Interface for R. R package version 1.95-4.82016 .\n[42] Viechtbauer W Cheung MWL \nOutlier and influence diagnostics for meta-analysis . Res Synth Methods \n2010 ;1 :112–25 .26061377 \n[43] Li J Zhang Q Zhang M \nIntravenous magnesium for acute myocardial infarction . Cochrane Datab Syst Rev \n2007 ;2 : Art. No.: CD002755 .\n[44] Spooner C Spooner GR Rowe BH \nMast-cell stabilising agents to prevent exercise-induced bronchoconstriction . Cochrane Database Syst Rev \n2003 ;4 : Art. No.: CD002307 .\n[45] Heiwe S Jacobson SH \nExercise training for adults with chronic kidney disease . Cochrane Database Syst Rev \n2011 ;10 : Art.No.: CD003236 .\n[46] Khanna P Suo T Komossa K \nAripiprazole versus other atypical antipsychotics for schizophrenia . Cochrane Database Syst Rev \n2014 ;1 : Art. No.: CD006569 .\n[47] Sterne JAC Sutton AJ Ioannidis JPA \nRecommendations for examining and interpreting funnel plot asymmetry in meta-analyses of randomised controlled trials . BMJ \n2011 ;343 :d4002.21784880 \n[48] Jackson D \nThe implications of publication bias for meta-analysis’ other parameter . Stat Med \n2006 ;25 :2911–21 .16345059 \n[49] Ioannidis JPA Trikalinos TA \nThe appropriateness of asymmetry tests for publication bias in meta-analyses: a large survey . Canad Med Assoc J \n2007 ;176 :1091–6 .17420491 \n[50] Lin L Chu H Hodges JS \nAlternative measures of between-study heterogeneity in meta-analysis: reducing the impact of outlying studies . Biometrics \n2017 ;73 :156–66 .27167143 \n[51] Lin L \nBias caused by sampling error in meta-analysis with small sample sizes . PLoS One \n2018 ;13 :e0204056.30212588 \n[52] Eyding D Lelgemann M Grouven U \nReboxetine for acute treatment of major depression: systematic review and meta-analysis of published and unpublished placebo and selective serotonin reuptake inhibitor controlled trials . BMJ \n2010 ;341 :c4737.20940209 \n[53] Riley RD Jackson D Salanti G \nMultivariate and network meta-analysis of multiple outcomes and multiple treatments: rationale, concepts, and examples . BMJ \n2017 ;358 :j3932.28903924\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0025-7974",
"issue": "98(23)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D016208:Databases, Factual; D017408:Guidelines as Topic; D006801:Humans; D015201:Meta-Analysis as Topic; D017594:Publication Bias",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e15987",
"pmc": null,
"pmid": "31169736",
"pubdate": "2019-06",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The trim-and-fill method for publication bias: practical guidelines and recommendations based on a large database of meta-analyses.",
"title_normalized": "the trim and fill method for publication bias practical guidelines and recommendations based on a large database of meta analyses"
} | [
{
"companynumb": "US-OTSUKA-2019_035395",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "We conducted a double-randomised phase III trial to evaluate a concomitant taxane-anthracycline regimen in node-positive breast cancer and the efficacy of trastuzumab in the human epidermal growth factor receptor 2 (HER2)-positive subpopulation.\n\n\n\nA total of 3010 patients with node-positive breast cancer were randomly assigned to receive 6 cycles of 500 mg/m2 of fluorouracil, 100 mg/m2 of epirubicin and 500 mg/m2 of cyclophosphamide (FEC) or 75 mg/m2 of epirubicin and 75 mg/m2 of docetaxel (ED). Patients with HER2-positive tumours were secondary randomly assigned to either trastuzumab or observation. The primary end-point was disease-free survival (DFS) in the two chemotherapy arms.\n\n\n\nAfter a 115-month median follow-up, DFS was not significantly better in the ED arm (DFS: 70%, 95% confidence interval [CI]: 67-72) than in the FEC arm (DFS: 68%, 95% CI: 65-70; hazard ratio [HR] = 0.88, 95% CI: 0.77-1.01; p = 0.064). The OS was not different between FEC (OS: 80%, 95% CI: 78-83) and ED (OS: 81%, 95% CI: 79-83); HR = 0.97, 95% CI: 0.81-1.16; p = 0.729). ED appeared more toxic. In the 528 HER2-positive subset, there was trend for a higher DFS, in the intention-to-treat population, in the trastuzumab arm (DFS: 68%, 95% CI: 61-74) than in the observation arm (DFS: 60%, 95% CI: 54-66; HR = 0.77, 95% CI: 0.57-1.03; p = 0.079). In the per-protocol population, DFS was significantly higher in the trastuzumab arm (DFS: 70%, 95% CI: 63-76) than in the observation arm (DFS: 59%, 95% CI: 53-65; HR = 0.69, 95% CI: 0.51-0.94; p = 0.0156). The OS was not different between these 2 arms.\n\n\n\nThis study did not show superiority of the concomitant anthracycline-taxane arm which was more toxic in high-risk node-positive breast cancer patients. Long-term results of the HER2-positive subpopulation are in line with those of the other adjuvant trastuzumab trials but quantitatively less pronounced mostly because of lack of power.",
"affiliations": "Medical Oncology Department, Institut du Cancer, IRCM, INSERM, Univ Montpellier, France. Electronic address: veronique.dhondt@icm.unicancer.fr.;Medical Oncology Department, Clinique Notre Dame, Charleroi, Belgium.;Biometrics Unit, Institut du Cancer, Montpellier, France.;Medical Oncology Department, Centre François Baclesse, Caen, France.;Medical Oncology Department, Institut Curie & St Cloud, Université Paris Descartes, Paris, France.;Medical Oncology Department, Centre Eugène Marquis, Rennes, France.;Medical Oncology Department, Institut de Cancérologie de l'Ouest, Saint-Herblain, France.;Medical Oncology Department, Centre Georges-François Leclerc, Dijon, France.;Medical Oncology Department, Institut Paoli-Calmettes, Marseille, France.;Medical Oncology Department, Institut Bergonié, Bordeaux, France.;Medical Oncology Department, Institut de Cancérologie de Lorraine - Alexis Vautrin, Vandoeuvre-Les-Nancy, France.;Medical Oncology Department, Centre Antoine Lacassagne, Nice, France.;Medical Oncology Department, Institut Sainte-Catherine, Avignon, France.;Medical Oncology Department, Centre Armoricain de Radiothérapie, d'Imagerie et d'Oncologie, Plérin, France.;Medical Oncology Department, Centre-Médico Chirurgical Les Ormeaux, Le Havre, France.;Medical Oncology Department, Institut Curie, Centre René Huguenin, Saint-Cloud, France.;Medical Oncology Department, Polyclinique Bordeaux Nord Aquitaine, Bordeaux, France.;Medical Oncology Department, CH - Hôpital de Fleyriat, Bourg-en-Bresse, France.;UCBG, R&D UNICANCER, Paris, France.;Medical Oncology Department, IUCT Claudius Regaud, Toulouse, France.;Medical Oncology Department, Gustave Roussy, Villejuif, France.;Medical Oncology Department, IUCT Claudius Regaud, Toulouse, France.",
"authors": "D'Hondt|Véronique|V|;Canon|Jean-Luc|JL|;Roca|Lise|L|;Levy|Christelle|C|;Pierga|Jean-Yves|JY|;Le Du|Fanny|F|;Campone|Mario|M|;Desmoulins|Isabelle|I|;Goncalves|Anthony|A|;Debled|Marc|M|;Rios|Maria|M|;Ferrero|Jean-Marc|JM|;Serin|Daniel|D|;Hardy-Bessard|Anne-Claire|AC|;Piot|Gilles|G|;Brain|Etienne|E|;Dohollou|Nadine|N|;Orfeuvre|Hubert|H|;Lemonnier|Jerome|J|;Roché|Henri|H|;Delaloge|Suzette|S|;Dalenc|Florence|F|",
"chemical_list": "D018943:Anthracyclines; D001952:Bridged-Ring Compounds; D043823:Taxoids; D000077143:Docetaxel; C080625:taxane; D015251:Epirubicin; C508053:ERBB2 protein, human; D018719:Receptor, ErbB-2; D000068878:Trastuzumab",
"country": "England",
"delete": false,
"doi": "10.1016/j.ejca.2019.09.014",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-8049",
"issue": "122()",
"journal": "European journal of cancer (Oxford, England : 1990)",
"keywords": "Adjuvant chemotherapy; Adjuvant trastuzumab; Breast cancer; Taxanes",
"medline_ta": "Eur J Cancer",
"mesh_terms": "D000328:Adult; D000368:Aged; D018943:Anthracyclines; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D001952:Bridged-Ring Compounds; D018572:Disease-Free Survival; D000077143:Docetaxel; D015251:Epirubicin; D005260:Female; D006801:Humans; D008875:Middle Aged; D018719:Receptor, ErbB-2; D043823:Taxoids; D000068878:Trastuzumab",
"nlm_unique_id": "9005373",
"other_id": null,
"pages": "91-100",
"pmc": null,
"pmid": "31634648",
"pubdate": "2019-11",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "UCBG 2-04: Long-term results of the PACS 04 trial evaluating adjuvant epirubicin plus docetaxel in node-positive breast cancer and trastuzumab in the human epidermal growth factor receptor 2-positive subgroup.",
"title_normalized": "ucbg 2 04 long term results of the pacs 04 trial evaluating adjuvant epirubicin plus docetaxel in node positive breast cancer and trastuzumab in the human epidermal growth factor receptor 2 positive subgroup"
} | [
{
"companynumb": "FR-SA-2019SA297172",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "EPIRUBICIN"
},
"drugadditional": null,
"dr... |
{
"abstract": "In the past decade novel agents are on the market for non-small cell lung cancer adenocarcinoma based on pharmacogenomics. The epidermal growth factor receptor mutation, anaplastic lymphoma kinase and programmed death-ligand 1 investigation is necessary in the everyday clinical practice for the oncologic patient. Immunotherapy is nowadays the novel therapy for advanced stage non-small cell lung cancer with two agents nivolumab and pembrolizumab. In the current case series we will present adverse effects from our centers and comment on the treatment and follow-up of the patients.",
"affiliations": "Pulmonary Department-Oncology Unit, \"Theageneio\" Anticancer Hospital, Thessaloniki, Greece.;Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greece.;Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greece.;Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greece.;Microdiagnostics, Pathology Private Center, Thessaloniki, Greece.;Microdiagnostics, Pathology Private Center, Thessaloniki, Greece.;Microdiagnostics, Pathology Private Center, Thessaloniki, Greece.;Surgery Department, \"Interbalkan\" European Medical Center, Thessaloniki, Greece.;Pharmacology-Clinical Pharmacology, Department of Clinical, Pharmacology, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Department of Respiratory and Critical Care Medicine, Changhai Hospital, The Second Military Medical University, Shanghai, China.;Sana Clinic Group Franken, Department of Cardiology / Pulmonology / Intensive Care / Nephrology, \"Hof\" Clinics, University of Erlangen, Hof, Germany.",
"authors": "Zarogoulidis|Paul|P|;Chinelis|Panos|P|;Athanasiadou|Anastasia|A|;Tsiouda|Theodora|T|;Trakada|Georgia|G|;Kallianos|Anastasios|A|;Veletza|Lemonia|L|;Hatzibougias|Dimitris|D|;Mihalopoulou|Electra|E|;Goupou|Eirini|E|;Kosmidis|Christoforos|C|;Sardeli|Chrysanthi|C|;Huang|Haidong|H|;Hohenforst-Schmidt|Wolfgang|W|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.rmcr.2017.07.004",
"fulltext": "\n==== Front\nRespir Med Case RepRespir Med Case RepRespiratory Medicine Case Reports2213-0071Elsevier S2213-0071(17)30226-510.1016/j.rmcr.2017.07.004Case ReportPossible adverse effects of immunotherapy in non-small cell lung cancer; treatment and follow-up of three cases Zarogoulidis Paul pzarog@hotmail.comab∗Chinelis Panos bAthanasiadou Anastasia bTsiouda Theodora bTrakada Georgia cKallianos Anastasios cVeletza Lemonia cHatzibougias Dimitris dMihalopoulou Electra dGoupou Eirini dKosmidis Christoforos eSardeli Chrysanthi fHuang Haidong gHohenforst-Schmidt Wolfgang ha Pulmonary Department-Oncology Unit, “Theageneio” Anticancer Hospital, Thessaloniki, Greeceb Pulmonary Oncology Unit, “G. Papanikolaou” General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greecec Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greeced Microdiagnostics, Pathology Private Center, Thessaloniki, Greecee Surgery Department, “Interbalkan” European Medical Center, Thessaloniki, Greecef Pharmacology-Clinical Pharmacology, Department of Clinical, Pharmacology, School of Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki, Greeceg Department of Respiratory and Critical Care Medicine, Changhai Hospital, The Second Military Medical University, Shanghai, Chinah Sana Clinic Group Franken, Department of Cardiology / Pulmonology / Intensive Care / Nephrology, “Hof” Clinics, University of Erlangen, Hof, Germany∗ Corresponding author. Pulmonary Department-Oncology Unit, “G. Papanikolaou” General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.Pulmonary Department-Oncology Unit“G. Papanikolaou” General HospitalAristotle University of ThessalonikiThessalonikiGreece pzarog@hotmail.com14 7 2017 2017 14 7 2017 22 101 105 1 7 2017 8 7 2017 11 7 2017 © 2017 The Authors2017This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).In the past decade novel agents are on the market for non-small cell lung cancer adenocarcinoma based on pharmacogenomics. The epidermal growth factor receptor mutation, anaplastic lymphoma kinase and programmed death-ligand 1 investigation is necessary in the everyday clinical practice for the oncologic patient. Immunotherapy is nowadays the novel therapy for advanced stage non-small cell lung cancer with two agents nivolumab and pembrolizumab. In the current case series we will present adverse effects from our centers and comment on the treatment and follow-up of the patients.\n\nKeywords\nNSCLCImmunotherapyAdenocarcinomaNivolumabColitisPneumonitisPericarditis\n==== Body\n1 Introduction\nDuring the past ten years a bloom of novel therapies has been observed for non-small cell lung cancer [1], [2]. In specific based on the pharmacogenomics of the cancer novel targeted drugs are on the market [3]. The epidermal growth factor mutation (EGFR) and the anaplastic lymphoma kinase (ALK) should be first investigated in non-small lung cancer (NSCLC) adenocarcinoma. Moreover; nowadays programmed death-ligand 1 (PD-L1) has to be also investigated as in the case of >50% overexpression the patient can receive immunotherapy (pembrolizumab) as first line treatment. The programmed death-ligand 1 (PD-L1) overexpression can be investigated also in squamous cell NSCLC. In the case where both EGFR and >50% PD-L1 is observed then the patient should start its first line with tyrosine kinase inhibitors (TKIs) [4]. The cost of immunotherapy still remains high when compared to the standard non-specific cytotoxic therapy [5], however; the progression free survival is higher and less adverse effects for the patients. We present two cases with adverse effects due to immunotherapy administration and comment on them.\n\n2 Case report 1\nA 65 year old patient was diagnosed with squamous cell carcinoma in 2014 stage IIa at that time. Two years after during follow-up he presented disease relapse in the site of the surgery (lobectomy) (Fig. 1). He received four cycles of carbo/pax doublet and remained under follow-up. Three months after he presented in the outpatient cabinet with head ache and bone metastasis was diagnosed with scintigraphy bone scan. Programmed death-ligand 1 (PD-L1) was investigated and the expression was 0%. However; nivolumab was initiated due to the toxic adverse effects presented during the first line with neutropenia. Nivolumab 150 mg/15 days was initiated and after three administrations bowel rupture was observed and the patient had an emergency surgery and colostomy was performed. After three months without any therapy the surgeons decided to make an anastomosis of the bowel. A PET-CT was performed in order to make restaging (Fig. 2). In the site of the anastomosis as it can be observed there is an area that retain Hi 18-FDG, however; it was considered to be due to the inflammation of the area. The patient during the three months had stable disease in the thorax and the bone pain was manageable with mild painkillers. Zoledronic acid was initiated along with a platinum doublet.Fig. 1 Disease relapse with CT of the thorax.\n\nFig. 1Fig. 2 PET-CT with hi FDG retention in the site of anastomosis.\n\nFig. 2\n\n3 Case report 2\nA 60 year patient was diagnosed with adenocarcinoma with bronchoscopy and he was stage IV due to bone metastasis. He was EGFR and ALK negative and PD-L1 0%. He received four cycles with carboplatin AUC 6 and permetrexed 500 × BSA. He had stable disease for 3 months until relapse and nivolumab was initiated as second line treatment. During restaging after four months of treatment with immunotherapy pericarditis was observed and aspiration was performed (Fig. 3). The cytology report was negative for disease relapse and the pericarditis was attributed to the immunotherapy, as it is known that orogonitis is considered an adverse effect of immunotherapy. Immunotherapy stopped, and the patient received third line chemotherapy with a doublet of carbo plus gemcitabine along with methylprednisolone tablets 2 × 16 mg daily for 1 week with the appropriate tapering during a thirty day period.Fig. 3 Pericarditis with CT of the thorax.\n\nFig. 3\n\n4 Case report 3\nA 55 year old patient was diagnosed with adenocarcinoma with biopsy under CT guidance. He was diagnosed with stage IV disease due to positive pleural effusion. He was EGFR and ALK negative, however; he had PD-L1 65%. Pembrolizumab 200 mg every 21 days was initiated. Unfortunately after four months of immunotherapy administration restaging with PET-CT demonstrated pneumonitis (Fig. 4, Fig. 5). Immunotherapy was stopped and the patient received second line chemotherapy with a doublet of carbo plus a taxane derivative along with methylprednisolone tablets 2 × 16 mg daily for 1 week with the appropriate tapering during a thirty day period.Fig. 4 PET-CT images after a four month administration of pembrolizumab administration.\n\nFig. 4Fig. 5 PET-CT images after a four month administration of pembrolizumab administration.\n\nFig. 5\n\n5 Discussion\nImmunotherapy is considered a mild therapy when compared to the non-specific cytotoxic agents. However; there are still some side effects to consider such orogonitis, pneumonitis, psoriasis, diabetes mellitus and transient thyroid malfunction [6], [7], [8], [9]. Myasthenia gravis was also recently observed [10]. Nivolumab is licensed as second line therapy for advanced non-small cell lung cancer, while pembrolizumab can be used as first line treatment in the case of PD-L1 >50% and as second line when PD-L1 >1% [11]. Nivolumab based on a recent publication could be considered as first line treatment in the case of PD-L1 >5% as it has a more safe profile when compared to chemotherapy [12]. Targeted therapy with tyrosine kinase inhibitors (TKIs) or “targeted” immunotherapy based on the PD-L1 expression, in every case less adverse effects certainly should be considered first for every patient. The performance status of the patient plays an important role in for the treatment efficacy of immunotherapy, while it is not necessary for the use of TKIs. Re-biopsy might be also considered in the future for every patient after disease relapse because the tissue genome is certainly affected by the use of therapy [13], [14], [15], [16]. In the case of immunotherapy close follow-up of the patients is necessary on order to efficiently cop with the adverse effects of immune therapy. The percentage of adverse effects is the same in both immunotherapy drugs [17]. Patients should be frequently checked for transient thyreotoxicosis, since this adverse effect is mostly frequently to occur [18]. Patients' hormone levels should be carefully checked and if necessary treatment should be administered.\n\nConflict of interest\nNone to declare.\n==== Refs\nReferences\n1 Domvri K. Zarogoulidis P. Darwiche K. Browning R.F. Li Q. Turner J.F. Kioumis I. Spyratos D. Porpodis K. Papaiwannou A. Tsiouda T. Freitag L. Zarogoulidis K. Molecular targeted drugs and biomarkers in NSCLC, the evolving role of individualized therapy J. Cancer 4 9 2013 736 754 24312144 \n2 Zarogoulidis K. Zarogoulidis P. Darwiche K. Boutsikou E. Machairiotis N. Tsakiridis K. Katsikogiannis N. Kougioumtzi I. Karapantzos I. Huang H. Spyratos D. Treatment of non-small cell lung cancer (NSCLC) J. Thorac. Dis. 5 Suppl 4 2013 S389 S396 24102012 \n3 Domvri K. Darwiche K. Zarogoulidis P. Zarogoulidis K. Following the crumbs: from tissue samples, to pharmacogenomics, to NSCLC therapy Transl. Lung Cancer Res. 2 4 2013 256 258 25806240 \n4 Reck M. Rodriguez-Abreu D. Robinson A.G. Hui R. Csoszi T. Fulop A. Gottfried M. Peled N. Tafreshi A. Cuffe S. O'Brien M. Rao S. Hotta K. Leiby M.A. Lubiniecki G.M. Shentu Y. Rangwala R. Brahmer J.R. K.- Investigators Pembrolizumab versus chemotherapy for PD-L1-positive non-small-cell lung cancer N. Engl. J. Med. 375 19 2016 1823 1833 27718847 \n5 Huang M. Lou Y. Pellissier J. Burke T. Liu F.X. Xu R. Velcheti V. Cost effectiveness of pembrolizumab vs. Standard-of-care chemotherapy as first-line treatment for metastatic NSCLC that expresses high levels of PD-L1 in the United States PharmacoEconomics 2017 (ahead of print) \n6 Iwama S. Arima H. Clinical practice and mechanism of endocrinological adverse events associated with immune checkpoint inhibitors Nihon Rinsho Men'eki Gakkai kaishi Jpn. J. Clin. Immunol. 40 2 2017 90 94 \n7 van Kooten M.J. van den Berg G. Glaudemans A. Hiltermann T.J.N. Groen H.J.M. Rutgers A. Links T.P. Transient thyrotoxicosis during nivolumab treatment Neth. J. Med. 75 5 2017 204 207 28653941 \n8 Ruiz-Banobre J. Perez-Pampin E. Garcia-Gonzalez J. Gomez-Caamano A. Baron-Duarte F.J. Lopez-Lopez R. Vazquez-Rivera F. Development of psoriatic arthritis during nivolumab therapy for metastatic non-small cell lung cancer, clinical outcome analysis and review of the literature Lung Cancer 108 2017 217 221 28625638 \n9 Godwin J.L. Jaggi S. Sirisena I. Sharda P. Rao A.D. Mehra R. Veloski C. Nivolumab-induced autoimmune diabetes mellitus presenting as diabetic ketoacidosis in a patient with metastatic lung cancer J. Immunother. Cancer 5 2017 40 28515940 \n10 Makarious D. Horwood K. Coward J.I.G. Myasthenia gravis: an emerging toxicity of immune checkpoint inhibitors Eur. J. Cancer 82 2017 128 136 28666240 \n11 Malhotra J. Jabbour S.K. Aisner J. Current state of immunotherapy for non-small cell lung cancer Transl. Lung Cancer Res. 6 2 2017 196 211 28529902 \n12 Carbone D.P. Reck M. Paz-Ares L. Creelan B. Horn L. Steins M. Felip E. van den Heuvel M.M. Ciuleanu T.E. Badin F. Ready N. Hiltermann T.J.N. Nair S. Juergens R. Peters S. Minenza E. Wrangle J.M. Rodriguez-Abreu D. Borghaei H. Blumenschein G.R. Jr. Villaruz L.C. Havel L. Krejci J. Corral Jaime J. Chang H. Geese W.J. Bhagavatheeswaran P. Chen A.C. Socinski M.A. CheckMate I. First-line nivolumab in stage IV or recurrent non-small-cell lung cancer N. Engl. J. Med. 376 25 2017 2415 2426 28636851 \n13 Zarogoulidis P. Gaga M. Huang H. Darwiche K. Rapti A. Hohenforst-Schmidt W. Tissue is the issue and tissue competition. Re-biopsy for mutation T790: where and why? Clin. Transl. Med. 6 1 2017 6 28101783 \n14 Dorantes-Heredia R. Ruiz-Morales J.M. Cano-Garcia F. Histopathological transformation to small-cell lung carcinoma in non-small cell lung carcinoma tumors Transl. Lung Cancer Res. 5 4 2016 401 412 27652204 \n15 Takegawa N. Hayashi H. Iizuka N. Takahama T. Ueda H. Tanaka K. Takeda M. Nakagawa K. Transformation of ALK rearrangement-positive adenocarcinoma to small-cell lung cancer in association with acquired resistance to alectinib Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 27 5 2016 953 955 \n16 Miyamoto S. Ikushima S. Ono R. Awano N. Kondo K. Furuhata Y. Fukumoto K. Kumasaka T. Transformation to small-cell lung cancer as a mechanism of acquired resistance to crizotinib and alectinib Jpn. J. Clin. Oncol. 46 2 2016 170 173 26613679 \n17 Leventakos K. Mansfield A.S. Advances in the treatment of non-small cell lung cancer: focus on nivolumab, pembrolizumab, and atezolizumab BioDrugs Clin. Immunother. Biopharm. Gene Ther. 30 5 2016 397 405 \n18 Orlov S. Salari F. Kashat L. Walfish P.G. Induction of painless thyroiditis in patients receiving programmed death 1 receptor immunotherapy for metastatic malignancies J. Clin. Endocrinol. Metab. 100 5 2015 1738 1741 25751110\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2213-0071",
"issue": "22()",
"journal": "Respiratory medicine case reports",
"keywords": "Adenocarcinoma; Colitis; Immunotherapy; NSCLC; Nivolumab; Pericarditis; Pneumonitis",
"medline_ta": "Respir Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101604463",
"other_id": null,
"pages": "101-105",
"pmc": null,
"pmid": "28752057",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": "28625638;28653941;26811347;28603206;28529902;28515940;27718847;28666240;28101783;28636851;27411930;28620848;25751110;25806240;24312144;26613679;24102012;27652204",
"title": "Possible adverse effects of immunotherapy in non-small cell lung cancer; treatment and follow-up of three cases.",
"title_normalized": "possible adverse effects of immunotherapy in non small cell lung cancer treatment and follow up of three cases"
} | [
{
"companynumb": "GR-ACCORD-103779",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "3",
"drug... |
{
"abstract": "Several single-center studies have suggested that higher doses of vancomycin, aimed at producing trough concentrations of >15 mg/liter, are associated with increased risk of nephrotoxicity. We prospectively assessed the relative incidence of nephrotoxicity in relation to trough concentration in patients with documented methicillin-resistant Staphylococcus aureus (MRSA) infections at seven hospitals throughout South Carolina. Adult patients receiving vancomycin for at least 72 h with at least one vancomycin trough concentration determined under steady-state conditions were prospectively studied. The relationship between vancomycin trough concentrations of >15 mg/ml and the occurrence of nephrotoxicity was assessed using univariate and multivariate analyses, controlling for age, gender, race, dose, length of therapy, use of other nephrotoxins (including contrast media), intensive care unit (ICU) residence, episodes of hypotension, and comorbidities. Nephrotoxicity was defined as an increase in serum creatinine of 0.5 mg/dl or a ≥ 50% increase from the baseline for two consecutive measurements. MICs of vancomycin for the MRSA isolates were also determined. A total of 288 patients were studied between February 2008 and June 2010, with approximately one-half having initial trough concentrations of ≥ 15 mg/ml. Nephrotoxicity was observed for 42 patients (29.6%) with trough concentrations >15 mg/ml and for 13 (8.9%) with trough concentrations of ≤ 15 mg/ml. Multivariate analysis revealed vancomycin trough concentrations of >15 mg/ml and race (black) as risk factors for nephrotoxicity in this population. Vancomycin trough concentrations of >15 mg/ml appear to be associated with a 3-fold increased risk of nephrotoxicity.",
"affiliations": "Department of Clinical Pharmacy and Outcome Sciences, South Carolina College of Pharmacy, Charleston and Columbia, South Carolina 29425, USA. bossoja@musc.edu",
"authors": "Bosso|John A|JA|;Nappi|Jean|J|;Rudisill|Celeste|C|;Wellein|Marlea|M|;Bookstaver|P Brandon|PB|;Swindler|Jenna|J|;Mauldin|Patrick D|PD|",
"chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin; D003404:Creatinine",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.00168-11",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "55(12)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": null,
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D003404:Creatinine; D003428:Cross Infection; D005260:Female; D006761:Hospitals; D006801:Humans; D015994:Incidence; D007674:Kidney Diseases; D008297:Male; D055624:Methicillin-Resistant Staphylococcus aureus; D008826:Microbial Sensitivity Tests; D008875:Middle Aged; D015999:Multivariate Analysis; D011446:Prospective Studies; D013022:South Carolina; D013203:Staphylococcal Infections; D016896:Treatment Outcome; D014640:Vancomycin",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": "5475-9",
"pmc": null,
"pmid": "21947388",
"pubdate": "2011-12",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": "16957043;16982298;16469106;20699455;16087824;21460308;21130609;21460309;15889380;19106348;12491202;9448557;17692725;15184410;18419491;15509186;17060545;17623693;21183005;3558716;19001107;19586413;18591266;20558550;14727222;10395142;14711073;18694905;18227177;17940231;16323118;19398641;18947320;16310570;12594640",
"title": "Relationship between vancomycin trough concentrations and nephrotoxicity: a prospective multicenter trial.",
"title_normalized": "relationship between vancomycin trough concentrations and nephrotoxicity a prospective multicenter trial"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2015SP002669",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional"... |
{
"abstract": "Terbinafine is a commonly used antifungal medication. Its side effects, while widely known, are rarely described and can be missed by the medical community. We present a 55-year-old woman who visited her primary care physician with onychomycosis. She started treatment with terbinafine, and 1 week later developed a rash in the left flank that extended to the chest, back, and upper part of lower extremities. Laboratory results showed elevated liver enzymes. A treatment with steroids did not improve the rash and she was admitted to our institution. She was started with intravenous dexamethasone, topical hydrocortisone and triamcinolone. Seven days later the liver enzymes normalised, and the rash resolved on the chest and back. Our patient had concurrent acute generalised exanthematous pustulosis and hepatitis that together has been very rarely associated with terbinafine.",
"affiliations": "Jackson Memorial Hospital, Miami, Florida, USA.;Jackson Memorial Hospital, Miami, Florida, USA.;Jackson Memorial Hospital, Miami, Florida, USA.;Jackson Memorial Hospital, Miami, Florida, USA dcasadesus@hotmail.com.",
"authors": "Carnio|Lorenzo R|LR|;Johnson Shaw|Mary E|ME|;Schnur|Jack|J|;Casadesus|Damian|D|",
"chemical_list": "D000935:Antifungal Agents; D000077291:Terbinafine",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-238930",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(1)",
"journal": "BMJ case reports",
"keywords": "drugs and medicines; hepatitis other; pharmacology and therapeutics; skin; unwanted effects / adverse reactions",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D056150:Acute Generalized Exanthematous Pustulosis; D000935:Antifungal Agents; D056486:Chemical and Drug Induced Liver Injury; D005260:Female; D006801:Humans; D008875:Middle Aged; D014009:Onychomycosis; D000077291:Terbinafine",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33462036",
"pubdate": "2021-01-18",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Concurrent terbinafine-induced acute generalised exanthematous pustulosis and hepatitis.",
"title_normalized": "concurrent terbinafine induced acute generalised exanthematous pustulosis and hepatitis"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/21/0132170",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALENDRONIC ACID"
},
"drugadditional": "3... |
{
"abstract": "BACKGROUND\nTemporomandibular joint (TMJ) arthritis and involvement is commonly seen in Juvenile Idiopathic Arthritis (JIA). Therapy includes conservative measures, but also includes intraarticular corticosteroid injections (IASI) and systemic immunosuppressive therapy. Despite aggressive medical therapy, some patients develop arthritic changes and frank TMJ ankylosis that can result in persistent pain and limitation in range of motion (ROM). A surgical option is prosthetic TMJ replacement with concurrent correction of dentofacial deformities, which can be performed simultaneously. The objective of this study was to evaluate the outcomes of prosthetic TMJ replacement in a cohort of adolescent females with JIA and severe TMJ involvement.\n\n\nMETHODS\nThis is a retrospective case series that took place at one tertiary care center. Patients with a diagnosis of JIA who also underwent alloplastic TMJ replacement were identified through electronic medical record system (EMR) and reviewed. Chart review included analysis of all documents in the EMR, including demographic data, JIA history, surgical complications, ROM of TMJ measured by maximal incisal opening in millimeters (mm) and TMJ pain scores (4-point Likert scale: none, mild, moderate, severe) obtained pre- and postoperatively.\n\n\nRESULTS\nFive female patients, ages 15-17 year when TMJ replacement was performed, had nine total joints replaced with a post-operative follow-up period of 12-30 months. All patients had polyarticular, seronegative JIA and were treated with IASI and multiple immunosuppressive therapies without resolution of TMJ symptoms. One patient had bilateral TMJ ankylosis. Three of the five patients demonstrated significant dentofacial deformities, and all underwent simultaneous or staged orthognathic surgery. All patients had improvement in TMJ pain with most (80%) reporting no pain, and all had similar or improved ROM of their TMJ postoperatively. There was one delayed postoperative infection with Cutibacterium Acnes that presented 15 months after surgery and required removal and reimplantation of prosthesis.\n\n\nCONCLUSIONS\nThe sequelae of TMJ arthritis and involvement from JIA in the adolescent population can be difficult to treat. Current medical therapy can be successful, however, in select cases that develop chronic changes in the TMJ despite extensive medical therapy, early results show that prosthetic joint replacement maybe a reasonable surgical option. With prosthetic joint replacement pain levels were reduced and range of motion was maintained or improved for all patients.",
"affiliations": "Division of Plastic and Craniofacial Surgery, Children's Mercy Hospital, 2401 Gillham Road, Kansas City, MO, 64108, USA. mlypka@cmh.edu.;University of Missouri-Kansas City School of Medicine, 2411 Holmes Street, Kansas City, MO, 64108, USA.;University of Missouri-Kansas City School of Medicine, 2411 Holmes Street, Kansas City, MO, 64108, USA.",
"authors": "Lypka|Michael|M|;Shah|Karina|K|;Jones|Jordan|J|",
"chemical_list": "D007166:Immunosuppressive Agents",
"country": "England",
"delete": false,
"doi": "10.1186/s12969-020-00453-6",
"fulltext": "\n==== Front\nPediatr Rheumatol Online J\nPediatr Rheumatol Online J\nPediatric Rheumatology Online Journal\n1546-0096 BioMed Central London \n\n453\n10.1186/s12969-020-00453-6\nResearch Article\nProsthetic temporomandibular joint reconstruction in a cohort of adolescent females with juvenile idiopathic arthritis\nLypka Michael mlypka@cmh.edu 12 Shah Karina 2 Jones Jordan 23 1 grid.239559.10000 0004 0415 5050Division of Plastic and Craniofacial Surgery, Children’s Mercy Hospital, 2401 Gillham Road, Kansas City, MO 64108 USA \n2 grid.266756.60000 0001 2179 926XUniversity of Missouri-Kansas City School of Medicine, 2411 Holmes Street, Kansas City, MO 64108 USA \n3 grid.239559.10000 0004 0415 5050Division of Rheumatology, Children’s Mercy Hospital, 2401 Gillham Road, Kansas City, MO 64108 USA \n4 9 2020 \n4 9 2020 \n2020 \n18 6818 3 2020 3 7 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nTemporomandibular joint (TMJ) arthritis and involvement is commonly seen in Juvenile Idiopathic Arthritis (JIA). Therapy includes conservative measures, but also includes intraarticular corticosteroid injections (IASI) and systemic immunosuppressive therapy. Despite aggressive medical therapy, some patients develop arthritic changes and frank TMJ ankylosis that can result in persistent pain and limitation in range of motion (ROM). A surgical option is prosthetic TMJ replacement with concurrent correction of dentofacial deformities, which can be performed simultaneously. The objective of this study was to evaluate the outcomes of prosthetic TMJ replacement in a cohort of adolescent females with JIA and severe TMJ involvement.\n\nMethods\nThis is a retrospective case series that took place at one tertiary care center. Patients with a diagnosis of JIA who also underwent alloplastic TMJ replacement were identified through electronic medical record system (EMR) and reviewed. Chart review included analysis of all documents in the EMR, including demographic data, JIA history, surgical complications, ROM of TMJ measured by maximal incisal opening in millimeters (mm) and TMJ pain scores (4-point Likert scale: none, mild, moderate, severe) obtained pre- and postoperatively.\n\nResults\nFive female patients, ages 15–17 year when TMJ replacement was performed, had nine total joints replaced with a post-operative follow-up period of 12–30 months. All patients had polyarticular, seronegative JIA and were treated with IASI and multiple immunosuppressive therapies without resolution of TMJ symptoms. One patient had bilateral TMJ ankylosis. Three of the five patients demonstrated significant dentofacial deformities, and all underwent simultaneous or staged orthognathic surgery. All patients had improvement in TMJ pain with most (80%) reporting no pain, and all had similar or improved ROM of their TMJ postoperatively. There was one delayed postoperative infection with Cutibacterium Acnes that presented 15 months after surgery and required removal and reimplantation of prosthesis.\n\nConclusion\nThe sequelae of TMJ arthritis and involvement from JIA in the adolescent population can be difficult to treat. Current medical therapy can be successful, however, in select cases that develop chronic changes in the TMJ despite extensive medical therapy, early results show that prosthetic joint replacement maybe a reasonable surgical option. With prosthetic joint replacement pain levels were reduced and range of motion was maintained or improved for all patients.\n\nKeywords\nTemporomandibular jointJoint replacement; juvenile idiopathic arthritisTherapyissue-copyright-statement© The Author(s) 2020\n==== Body\nBackground\nTemporomandibular joint (TMJ) arthritis is present in 40–96% of children with Juvenile Idiopathic Arthritis (JIA) [1]. TMJ arthritis can present in all subtypes of JIA, however, appears more prevalent in extended oligoarticular and polyarticular rheumatoid factor negative subtypes [2]. The diagnosis can be challenging as physical exam findings may be absent initially, and become more noticeable later in the disease course with decrease in mouth opening, lateral deviation, and pain with motion [3]. TMJ involvement can be characterized by magnetic resonance imaging (MRI), however, patients may present with a range of clinical signs and symptoms that do not always correlate with radiographic findings [4–6]. Symptoms can vary widely for those with TMJ involvement and some present with combination of pain, limitation in range of motion (ROM), progressive mandibular retrognathia or asymmetry, and imaging ranging from condylar resorption to severe arthritic changes, even TMJ ankylosis [7]. Therapy for TMJ arthritis and involvement can vary broadly from conservative measures such as splint therapy, to arthrocentesis and/or arthroscopy [8, 9], with or without intraarticular steroid injection (IASI) [8, 9], to more complex medical therapies such as systemic immunosuppression (biologic and synthetic disease modifying antirheumatic drugs [DMARDs]). These therapies can be effective for managing patients with TMJ pain and limitation in ROM, however, despite conservative measures in addition to aggressive medical therapy, a small number of patients will require surgical intervention to treat severe TMJ involvement and progressive dentofacial deformities [10]. In certain situations, TMJ replacement may be warranted and can be combined with orthognathic surgery to achieve the best esthetic and functional outcome [11–13]. In adults, prosthetic replacement has become the preferred method of reconstruction to treat the TMJ that has been affected by severe arthritis [14]. However, there is limited data on prosthetic TMJ replacement in children with severe TMJ involvement [13, 15, 16]. Our objective was to evaluate the outcomes of prosthetic TMJ replacement in a cohort of adolescent females with JIA and severe TMJ involvement.\n\nMethods\nIn a retrospective case series at Children’s Mercy Kansas City, a tertiary care Children’s hospital, five patients were identified through the electronic medical records (EMR) from January 1, 2017 to December 31, 2018. Patients were identified if they had a diagnosis of JIA and underwent TMJ replacement with either unilateral or bilateral prosthetic joints. Patients were included in the review if they were aged between 12 years and 18 years and met the Edmonton 2001 International League of Associations for Rheumatology (ILAR) criteria for JIA [17]. They were excluded if they either did not have JIA or did not undergo surgery for a prosthetic joint replacement of the TMJ. Individual charts were manually reviewed to confirm JIA diagnosis and TMJ prosthetic joint replacement. Chart review included analysis of all documents included in the EMR, including demographic data, JIA subtype, imaging and laboratory studies, treatment (medical and surgical), surgical complications, and response to treatment. Maximal incisal opening was measured in millimeters (mm) to assess ROM of TMJ, and TMJ pain perception was evaluated using a 4-point visual analog scale (none, mild, moderate, severe) before and after replacement (latest follow-up). Preoperative and postoperative periods were defined by at least 3 months prior to and 3 months after TMJ prosthetic placement.\n\nThis study was approved by the institutional review board at Children’s Mercy Kansas City and is in accordance with the ethical standards established in the 1964 Declaration of Helsinki. Formal consent was not required for this type of study, but formal consent was obtained for use of patient pictures.\n\nResults\nA total of five patients met inclusion criteria; all were female with an average age of 9.0 years (range 1.2 to 14.4 years) at JIA diagnosis, 13.5 years (range 10.3 to 16.3 years) at age of TMJ arthritis diagnosis, and 16.9 years (range 15.3 to 17.9 years) at age of TMJ prosthetic replacement. All patients had polyarticular, seronegative JIA. All patients had MRI with contrast that showed abnormalities suggestive of TMJ involvement prior to surgery, which included: synovitis, erosion, marrow edema, effusion, sclerosis, flattened condyles, disc displacement, thinning and absence. One of the patients exhibited overt bilateral TMJ ankylosis with severe limitation in maximal incisal opening (15 mm) preoperatively. Maximal incisal opening recorded immediately preoperative averaged 33 mm and ranged from 15 mm to 45 mm and was similar or improved postoperatively with an average of 37 mm at latest follow up (range 30 mm to 45 mm) (Table 1). All five patients had an element of mandibular hypoplasia, and three of the five patients demonstrated mandibular hypoplasia significant enough to consider orthognathic surgery. One patient (shown in Fig. 1.) had mandibular hypoplasia with asymmetry, the right condyle being more severely affected. All five patients reported TMJ pain preoperatively with four reporting severe pain with TMJ motion and one reporting mild pain. Two of the patients had chronic pain syndrome while an additional patient was suspected to have chronic pain syndrome, however, at the postoperative evaluation only one patient had mild TMJ pain (which later resolved) while the rest had no TMJ pain (Table 1). Chronic widespread pain scores were not collected since TMJ was the only joint of interest in this case series. All patients have remained without TMJ pain throughout the postoperative period.\nTable 1 Demographics and Outcomes\n\nID\tAgea\tDiagnosisb\tTMJc Replacement\nLaterality\tFacial Diagnosis\tPain leveld\tMaximal incisal opening (mm)\tPain leveld\tMaximal incisal opening (mm)\tFollow-upe\t\n\t\t\t\t\tPreoperative\tPostoperative\t\t\n1\t16\tPolyarticular ANA+\tBilateral\tMandibular hypoplasia\tSevere\t35\tNone\t35\t30\t\n2\t17\tPolyarticular ANA-\tBilateral\tMandibular hypoplasia\tSevere\t30\tmild\t35\t29\t\n3\t17\tPolyarticular ANA-\tRight\tMandibular hypoplasia/asymmetry\tSevere\t45\tNone\t45\t15\t\n4\t15\tPolyarticular ANA-\tBilateral\tMandibular hypoplasia/ankylosis\tMild\t15\tNone\t30\t12\t\n5\t17\tPolyarticular ANA-\tBilateral\tMandibular hypoplasia\tSevere\t40\tNone\t40\t12\t\naAge in years\n\nbJuvenile idiopathic arthritis subtype diagnosis\n\ncTemporomandibular joint\n\ndPain level is a 4-point Likert scale (none, mild, moderate, severe)\n\neFollow-up in months\n\nMaximal incisal opening was recorded immediately preoperatively and at latest follow-up visit (at least 6 months from surgery)\n\nFig. 1 Pre and postoperative images of patient with mandibular asymmetry/deficiency and right TMJ involvement who underwent simultaneous orthognathic surgery with right TMJ replacement. Simulation of orthognathic surgery shown, including Le fort 1 osteotomy, left sagittal split osteotomy, genioplasty, and right condylectomy. Wax up of TMJ prosthesis shown in the patient’s newly simulated jaw position\n\n\n\nFor therapy, all patients were initially referred to primary dentist for occlusal stabilization splits, however, there was minimal degree of TMJ symptom reduction and difficulty with compliance in dental follow-up and split use. Patients also received at least one arthrocentesis with steroid injection (most patients within 6 months of TMJ replacement) with one patient having multiple injections (Table 2). There was an average of 2.8 years (range 0.3 to 6.3 years) from JIA diagnosis to introduction of the first biologic DMARD for treatment of JIA. All patients had history of biologic and synthetic DMARD therapies for JIA treatment prior to preoperative period, but during course of treatment (Table 2) and at diagnosis of TMJ arthritis one patient was on no systemic therapy, three patients were on a synthetic DMARD in combination with biologic DMARD, while one was on combination synthetic DMARD therapy. At diagnosis of TMJ arthritis, all patients had IASI of the affected TMJ joint, while one had addition of biologic DMARD and two had change in their biologic DMARD (Table 2). At diagnosis of TMJ arthritis by MRI with contrast three patients clinically had TMJ arthritis only, while the other two patients had TMJ arthritis and other joints with active arthritis (one with active arthritis in one knee and the other with active arthritis in one wrist). There was an average of 3.4 years between initial evidence of TMJ arthritis and surgical replacement. During the perioperative period, all patients had their biologic and synthetic DMARDs held for at least one dosing cycle prior to TMJ replacement. Biologic and synthetic DMARD therapy was resumed at least 14 days after TMJ replacement. By the postoperative period, all patients were on combination biologic and synthetic DMARD therapy.\nTable 2 Medical and Surgical Therapies\n\nID\tIntraarticular Steroid injection\tOrthognathic Surgery\tConcurrent procedures\tMedical therapy\t\n\t\t\t\tPreoperative\tPostoperative\t\n1\tYes\tNo\tNo\tMethotrexatec\n\nAbataceptc\n\nEtanercept\n\nAdalimumab\n\nInfliximab\n\nTocilizumab\n\n\tMethotrexatec Infliximabc\t\n2\tYes\tLe Fort I, bilateral sagittal splits (staged)\tSubmental liposuction\tMethotrexatec\n\nHydroxychloroquinec\n\nAdalimumabc\n\nEtanercept\n\nInfliximab\n\n\tMethotrexatec\n\nAbataceptc\n\n\t\n3\tYes\tLe Fort I, left sagittal split, genioplasty (simultaneous)\tSubmental liposuction\tHydroxychloroquinec\n\nSulfasalazinec\n\nMethotrexatec\n\nAbataceptc\n\nEtanercept\n\nAdalimumab\n\nInfliximab\n\n\tLeflunomidec\n\nAdalimumabc\n\nTofacitinib\n\nSulfasalazine\n\n\t\n4\tYesa\tGenioplasty (simultaneous)\tNo\tMethotrexatec\n\nEtanerceptc\n\nAdalimumab\n\n\tMethotrexatec\n\nAdalimumabc\n\n\t\n5\tYesb\tNo\tNo\tNonec\n\nEtanercept\n\nInfliximab\n\nAdalimumab\n\n\tMethotrexatec\n\nInfliximabc\n\n\t\naArthrocentesis with steroid injection performed at outside institution\n\nbPatient had arthrocentesis with steroid injection three times pre-operatively\n\ncDenotes perioperative therapy that patient was on 3 months preoperatively and 3 months postoperatively\n\n\n\nThere were nine total joints replaced using the TMJ concepts (Ventura, CA) custom fitted prosthesis. Patients had a post-operative follow-up that ranged from 12 to 30 months. There was one delayed postoperative infection that presented 1 year after surgery. The patient presented with isolated TMJ pain without systemic signs of infection. There was no redness, swelling, fever, or TMJ limitation. Further investigation revealed a normal CT scan without any overt signs of infection or implant malfunction. Surgical exploration was performed and did not reveal any overt signs of infection or implant malfunction. The TMJ fossa was cultured and grew Cutibacterium Acnes. An antibiotic spacer was placed, and oral antibiotics initiated for a four-month period. After the period of antibiotics, the TMJ prosthesis was replaced. Recurrent or additional infections have not occurred in this patient or others since that time. Other adverse outcomes included one patient with right-sided temporal branch facial weakness, and one patient with marginal mandibular weakness, both of which resolved over a two-month period.\n\nDiscussion\nTMJ arthritis and involvement is present in many children with JIA and can be difficult to monitor and treat. While conservative measures and medical therapies are most used and appropriate [1], a definitive surgical option may be needed for a patient suffering from chronic TMJ involvement with pain, limited ROM, and history of maximized conservative therapies such as splints, arthrocentesis, arthroscopy and IASI and aggressive systemic therapies such as synthetic and biologic DMARDs. The decision to perform prosthetic TMJ replacement in the adolescent with JIA is a difficult one, and there is no consensus among maxillofacial surgeons regarding the preferred treatment [18, 19]. Certainly, it must be a consideration in patients with severe TMJ symptoms, involvement, deformity and dysfunction who had no improvement with multiple medical and conservative therapies, and perhaps the preferred treatment in cases of TMJ ankylosis [13] or other dentofacial deformities. Despite encouraging long term results [20, 21], it is likely a prosthetic would need to be replaced during adulthood due to wear of the prosthesis over time. The time period for revision or re-replacement is currently unknown. Additionally, there is an inherent risk of infection of any prosthetic appliance, which is more concerning in a population that is being treated with immunosuppressant medications. The risks of TMJ replacement should not be taken lightly, but the risks are often outweighed by the benefit of effective pain relief with a stable joint and preserved ROM, all of which was accomplished in this cohort.\n\nEvidence remains unclear on the efficacy of systemic therapy for treatment of TMJ arthritis as part of JIA, and that TMJ arthritis may behave differently compared to other joint disease seen with JIA [1]. Local therapies such as IASI have been shown to decrease inflammation in the TMJ, however, serious adverse effects of heterotrophic bone formation and condylar resorption have also been seen with IASIs [22], causing some to limit the use or repeat use of IASI. Others support maximizing systemic medical therapy as an alternative or in conjunction with IASI based on the severity of disease [1]. All the patients in this study had IASI and aggressive maximization of their systemic therapies with use of different combinations of biologic and synthetic DMARDs at time of TMJ arthritis diagnosis and prior to surgery, but despite those efforts, developed chronic, worsening TMJ pain due to TMJ involvement and damage and ultimately opted for surgical intervention. There was an average of 2.8 year between JIA diagnosis and introduction of first biologic DMARD, which may indicate that earlier introduction of biologic DMARD is necessary to minimize TMJ damage and symptoms, however, one patient did have biologic DMARD introduced 4 months after JIA diagnosis and still required TMJ replacement.\n\nTwo of the patients had a diagnosis of chronic pain syndrome, and a third had concerning features suggestive of chronic pain syndrome, which is associated with chronic, widespread pain, and commonly involve other temporomandibular disorders. There is evidence that orofacial pain in adolescents with JIA can be associated with stress, depression and catastrophizing [23], and therefore can be difficult to discern TMJ involvement versus TMJ disorder. For the patients in this cohort, all had isolated worsening of TMJ symptoms with MRI evidence of chronic damage which is more suggestive of TMJ involvement. It should be noted that continuous abnormalities may be seen on repeat MRI due to damage from mechanical changes that are secondary to the initial chronic inflammatory changes. This is likely the cause of the isolated worsening TMJ pain despite aggressive conservative and systemic therapy with biologic and synthetic DMARDs. Additionally, with TMJ replacement all patients had resolution of TMJ pain, despite three of the patients continuing to have chronic pain in locations outside the TMJ. We recommend diligence in determining the exact cause of TMJ symptoms prior to surgery, but isolated worsening of TMJ symptoms along with MRI evidence of TMJ damage maybe an early sign that surgical intervention should be considered.\n\nMany patients with JIA have TMJ involvement with dentofacial deformities that can result in pain and limited ROM. This can result as either a direct consequence of their condition or due to pre-existing conditions, such as mandibular retrognathia or mandibular asymmetry [24]. Elective orthognathic surgery to correct significant malocclusion in a patient with JIA is typically deferred for orthodontic camouflage so as not to affect joint health, but the esthetic and psychologic benefits of corrective jaw surgery cannot be overlooked [25]. A potential benefit in performing TMJ replacement is that concurrent orthognathic surgery is possible. The decision to perform orthognathic surgery simultaneous with joint replacement is one based on severity of deformity and patient preference. By no means is simultaneous orthognathic surgery obligatory with joint replacement. With routine employment of three-dimensional virtual surgical planning, TMJ replacement and orthognathic surgery can be planned and performed simultaneously (Fig. 1). Orthodontic treatment to align the dental arches prior to or immediately after combined joint replacement/orthognathic surgery is warranted. Arguably, any JIA patient with TMJ involvement, and certainly any patient who is a candidate for joint replacement, should be evaluated by an orthodontist to address concurrent malocclusion.\n\nA potential complication after joint replacement is infection, and one patient in this series developed infection 1 year after surgery without typical signs of infection. The patient described periodic swelling and pain of the cheek over the TMJ that was not clinically noticeable. It is possible that the patient’s immunosuppressive therapies altered the presentation of the infection, however, it is unclear. In an adult retrospective review of total joint prostheses, 8 of 579 protheses were noted to be infected. It was found that acute infection (within 30 days of surgery) was more frequent (5/8) than delayed infections (31 days to 6 years; 3/8). A treatment strategy for acute infections included a protocol of debridement, irrigating catheters, and intravenous antibiotics to salvage the prosthesis, while delayed infections usually require removal and replacement of the prosthesis [26]. In the delayed infections group, one of three patients grew Cutibacterium acnes [26], which was the same bacterium isolated in our case. Additionally, the patient in our case also required removal and replacement of the prosthesis.\n\nIt is currently unclear how immunosuppressant therapies used for JIA may impact TMJ infections after prosthesis placement. Most literature is focused on infection related orthopedic surgery, but not specifically regarding the maxillofacial complex. Methotrexate, when continued or stopped prior surgery, was not shown to increase early complications after orthopedic surgery in a randomized trial [27], while the influence on infection rates has been debated [28]. A retrospective study [29] examined the risk of postoperative infection at the site of various orthopedic surgeries in patients with rheumatoid arthritis who were treated with immunosuppressants (mostly biologic and synthetic DMARDs), and found 0.8% (of 50,359 surgical cases) had postoperative infections. It was noted that the risk of infection significantly increased in patients taking multiple synthetic DMARDs or combination therapy with biologic and synthetic DMARDs. In this case series, all patients had their biologic and synthetic DMARDs held before and after surgery, however, the American College of Rheumatology does offer perioperative therapy guidance for adult patients with rheumatic disease undergoing elective surgery, and suggests that synthetic DMARDs (specifically methotrexate, leflunomide, hydroxychloroquine and sulfasalazine) may be continued through surgery. Further, biologic DMARDs should be held for at least one dosing cycle with planned surgery at the end of the dosing cycle and may be resumed once wounds show evidence of healing (approximately 14 days) [30].\n\nThe limitations of this study include the small sample size and retrospective design, which precludes more sophisticated data analysis including subgroup analysis of patients based on initial presentation and therapy. However, this is the largest cohort of JIA patients with TMJ prosthesis reported to date. Future studies in a larger population will allow for more detailed exploration of outcomes and adverse events.\n\nConclusion\nTMJ arthritis is present in many children with JIA, and while conservative and aggressive systemic medical therapies such as biologics and synthetic DMARDs are preferred, some that are refractory to extensive medical therapy may benefit from prosthetic joint replacement, which can improve pain and maintain maximal incisal opening. Infections are a potential complication and risk factor in an immunocompromised patient undergoing surgery for a prosthetic joint implant. Further studies are needed with greater numbers of patients, and with longer follow up to assess pain, ROM and adverse events.\n\nAbbreviations\nANAAnti-nuclear antigen\n\nDMARDDisease modifying anti-rheumatic drug\n\nEMRElectronic medical record system\n\nIASIIntraarticular corticosteroid injections\n\nILARInternational League of Associations for Rheumatology\n\nJIAJuvenile Idiopathic Arthritis\n\nmmMillimeters\n\nROMRange of motion\n\nTMJTemporomandibular joint\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nDesign: ML JJ. Acquisition and analysis of data: ML KS JJ. Interpretation of data: ML KS JJ. Drafted work and substantively revised it: ML KS JJ. All authors read and approved the final manuscript.\n\nAuthors’ information\nNot applicable.\n\nFunding\nNone.\n\nAvailability of data and materials\nThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\n\nEthics approval and consent to participate\nIRB approved.\n\nConsent for publication\nNot applicable.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n==== Refs\nReferences\n1. Stoll ML Kau CH Waite PD Cron RQ Temporomandibular joint arthritis in juvenile idiopathic arthritis, now what? Pediatr Rheumatol Online J 2018 16 1 32 10.1186/s12969-018-0244-y 29695255 \n2. Cannizzaro E Schroeder S Muller LM Kellenberger CJ Saurenmann RK Temporomandibular joint involvement in children with juvenile idiopathic arthritis J Rheumatol 2011 38 3 510 515 10.3899/jrheum.100325 21159837 \n3. Demant S Hermann NV Darvann TA Zak M Schatz H Larsen P 3D analysis of facial asymmetry in subjects with juvenile idiopathic arthritis Rheumatology. 2011 50 3 586 592 10.1093/rheumatology/keq329 21097878 \n4. Twilt M Mobers SM Arends LR ten Cate R van Suijlekom-Smit L Temporomandibular involvement in juvenile idiopathic arthritis J Rheumatol 2004 31 7 1418 1422 15229966 \n5. Rodiuc N Barlet X Hok S Perfus-Barbeoch L Allasia V Engler G Evolutionarily distant pathogens require the Arabidopsis phytosulfokine signalling pathway to establish disease Plant Cell Environ 2016 39 7 1396 1407 10.1111/pce.12627 26290138 \n6. Resnick CM Vakilian PM Breen M Zurakowski D Caruso P Henderson L Quantifying Temporomandibular joint Synovitis in children with juvenile idiopathic arthritis Arthritis Care Res 2016 68 12 1795 1802 10.1002/acr.22911 \n7. Billiau AD Hu Y Verdonck A Carels C Wouters C Temporomandibular joint arthritis in juvenile idiopathic arthritis: prevalence, clinical and radiological signs, and relation to dentofacial morphology J Rheumatol 2007 34 9 1925 1933 17696265 \n8. Stoll ML Good J Sharpe T Beukelman T Young D Waite PD Intra-articular corticosteroid injections to the temporomandibular joints are safe and appear to be effective therapy in children with juvenile idiopathic arthritis J Oral Maxillofac Surg 2012 70 8 1802 1807 10.1016/j.joms.2011.11.003 22265164 \n9. Resnick CM Vakilian PM Kaban LB Peacock ZS Quantifying the effect of Temporomandibular joint intra-articular steroid injection on synovial enhancement in juvenile idiopathic arthritis J Oral Maxillofac Surg 2016 74 12 2363 2369 10.1016/j.joms.2016.06.189 27474460 \n10. Hsieh YJ Darvann TA Hermann NV Larsen P Liao YF Bjoern-Joergensen J Facial morphology in children and adolescents with juvenile idiopathic arthritis and moderate to severe temporomandibular joint involvement Am J Orthod Dentofac Orthop 2016 149 2 182 191 10.1016/j.ajodo.2015.07.033 \n11. Resnick CM Frid P Norholt SE Stoustrup P Peacock ZS Kaban LB An algorithm for management of dentofacial deformity resulting from juvenile idiopathic arthritis: results of a multinational consensus conference J Oral Maxillofac Surg 2019 77 6 1152 e1 1152e33 10.1016/j.joms.2019.02.014 30885610 \n12. Mehra P Wolford LM Baran S Cassano DS Single-stage comprehensive surgical treatment of the rheumatoid arthritis temporomandibular joint patient J Oral Maxillofac Surg 2009 67 9 1859 1872 10.1016/j.joms.2009.04.035 19686922 \n13. Frid P Resnick C Abramowicz S Stoustrup P Norholt SE Temporomandibular joint juvenile arthritis work group T. surgical correction of dentofacial deformities in juvenile idiopathic arthritis: a systematic literature review Int J Oral Maxillofac Surg 2019 48 8 1032 1042 10.1016/j.ijom.2019.01.007 30704836 \n14. Mehra P Henry CH Giglou KR Temporomandibular joint reconstruction in patients with autoimmune/connective tissue disease J Oral Maxillofac Surg 2018 76 8 1660 1664 10.1016/j.joms.2018.03.014 29660305 \n15. Mercuri LG Swift JQ Considerations for the use of alloplastic temporomandibular joint replacement in the growing patient J Oral Maxillofac Surg 2009 67 9 1979 1990 10.1016/j.joms.2009.05.430 19686937 \n16. Resnick CM Temporomandibular joint reconstruction in the growing child Oral Maxillofac Surg Clin North Am 2018 30 1 109 121 10.1016/j.coms.2017.08.006 29153233 \n17. Petty RE Southwood TR Manners P Baum J Glass DN Goldenberg J International league of associations for rheumatology classification of juvenile idiopathic arthritis: second revision, Edmonton, 2001 J Rheumatol 2004 31 2 390 392 14760812 \n18. Kinard BE Abramowicz S Juvenile idiopathic arthritis practice patterns among oral and maxillofacial surgeons J Oral Maxillofac Surg 2017 75 11 2333 e1 2333 e8 10.1016/j.joms.2017.07.159 28822720 \n19. Te Veldhuis EC Te Veldhuis AH Koudstaal MJ Treatment management of children with juvenile idiopathic arthritis with temporomandibular joint involvement: a systematic review Oral Surg Oral Med Oral Pathol Oral Radiol 2014 117 5 581 589 10.1016/j.oooo.2014.01.226 24650371 \n20. Wolford LM Mercuri LG Schneiderman ED Movahed R Allen W Twenty-year follow-up study on a patient-fitted temporomandibular joint prosthesis: the Techmedica/TMJ concepts device J Oral Maxillofac Surg 2015 73 5 952 960 10.1016/j.joms.2014.10.032 25631865 \n21. Leandro LF Ono HY Loureiro CC Marinho K Guevara HA A ten-year experience and follow-up of three hundred patients fitted with the Biomet/Lorenz microfixation TMJ replacement system Int J Oral Maxillofac Surg 2013 42 8 1007 1013 10.1016/j.ijom.2013.04.018 23769150 \n22. Lochbuhler N Saurenmann RK Muller L Kellenberger CJ Magnetic resonance imaging assessment of Temporomandibular joint involvement and mandibular growth following corticosteroid injection in juvenile idiopathic arthritis J Rheumatol 2015 42 8 1514 1522 10.3899/jrheum.141502 26034145 \n23. Dimitrijevic Carlsson A Wahlund K Kindgren E Skogh T Starkhammar Johansson C Alstergren P Orofacial pain in juvenile idiopathic arthritis is associated with stress as well as psychosocial and functional limitations Pediatric Rheumatology Online J 2019 17 1 83 10.1186/s12969-019-0385-7 \n24. Twilt M Schulten AJ Nicolaas P Dulger A van Suijlekom-Smit LW Facioskeletal changes in children with juvenile idiopathic arthritis Ann Rheum Dis 2006 65 6 823 825 10.1136/ard.2005.042671 16699052 \n25. Sun H Shang HT He LS Ding MC Su ZP Shi YL Assessing the quality of life in patients with Dentofacial deformities before and after Orthognathic surgery J Oral Maxillofac Surg 2018 76 10 2192 2201 10.1016/j.joms.2018.03.026 29684310 \n26. Wolford LM Rodrigues DB McPhillips A Management of the infected temporomandibular joint total joint prosthesis J Oral Maxillofac Surg 2010 68 11 2810 2823 10.1016/j.joms.2010.05.089 20822842 \n27. Grennan DM Gray J Loudon J Fear S Methotrexate and early postoperative complications in patients with rheumatoid arthritis undergoing elective orthopaedic surgery Ann Rheum Dis 2001 60 3 214 217 10.1136/ard.60.3.214 11171680 \n28. McLean-Tooke A Aldridge C Waugh S Spickett GP Kay L Methotrexate, rheumatoid arthritis and infection risk: what is the evidence? Rheumatology. 2009 48 8 867 871 10.1093/rheumatology/kep101 19447771 \n29. Scherrer CB Mannion AF Kyburz D Vogt M Kramers-de Quervain IA Infection risk after orthopedic surgery in patients with inflammatory rheumatic diseases treated with immunosuppressive drugs Arthritis Care Res 2013 65 12 2032 2040 10.1002/acr.22077 \n30. Goodman SM Springer B Guyatt G Abdel MP Dasa V George M 2017 American College of Rheumatology/American Association of hip and Knee Surgeons Guideline for the perioperative Management of Antirheumatic Medication in patients with rheumatic diseases undergoing elective Total hip or Total knee Arthroplasty Arthritis Rheumatol 2017 69 8 1538 1551 10.1002/art.40149 28620948\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1546-0096",
"issue": "18(1)",
"journal": "Pediatric rheumatology online journal",
"keywords": "Joint replacement; juvenile idiopathic arthritis; Temporomandibular joint; Therapy",
"medline_ta": "Pediatr Rheumatol Online J",
"mesh_terms": "D000293:Adolescent; D000844:Ankylosis; D001171:Arthritis, Juvenile; D019643:Arthroplasty, Replacement; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D010043:Outcome and Process Assessment, Health Care; D059408:Pain Management; D011183:Postoperative Complications; D019919:Prosthesis Implantation; D016459:Prosthesis-Related Infections; D016059:Range of Motion, Articular; D020127:Recovery of Function; D012086:Reoperation; D013704:Temporomandibular Joint; D013705:Temporomandibular Joint Disorders",
"nlm_unique_id": "101248897",
"other_id": null,
"pages": "68",
"pmc": null,
"pmid": "32887620",
"pubdate": "2020-09-04",
"publication_types": "D016428:Journal Article",
"references": "21097878;29695255;29684310;23861140;20822842;19447771;23769150;31856854;30885610;17696265;22265164;30704836;11171680;29153233;14760812;26290138;28822720;24650371;15229966;16699052;19686922;28620948;29660305;27474460;26034145;19686937;21159837;27110936;26827974;25631865",
"title": "Prosthetic temporomandibular joint reconstruction in a cohort of adolescent females with juvenile idiopathic arthritis.",
"title_normalized": "prosthetic temporomandibular joint reconstruction in a cohort of adolescent females with juvenile idiopathic arthritis"
} | [
{
"companynumb": "US-MYLANLABS-2021M1062055",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": "3",
... |
{
"abstract": "In primary mediastinal large B-cell lymphoma, central nervous system (CNS) relapse is an uncommon event with a dismal prognosis. We report about the successful management of CNS relapse with chemoimmunotherapy according to MATRix (methotrexate, cytarabine, thiotepa, and rituximab) protocol followed by autologous stem cell transplant.",
"affiliations": "Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.;Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.;Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.;Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.;Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.;Institute of Hematology \"L. e A. Seràgnoli\" University of Bologna Bologna Italy.",
"authors": "Marangon|Miriam|M|;Casadei|Beatrice|B|;Broccoli|Alessandro|A|;Argnani|Lisa|L|;Cavo|Michele|M|;Zinzani|Pier Luigi|PL|https://orcid.org/0000-0002-2112-2651",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.2706",
"fulltext": "\n==== Front\nClin Case Rep\nClin Case Rep\n10.1002/(ISSN)2050-0904\nCCR3\nClinical Case Reports\n2050-0904 John Wiley and Sons Inc. Hoboken \n\n10.1002/ccr3.2706\nCCR32706\nCase Report\nCase Reports\nManagement of central nervous system relapse in a young patient affected by primary mediastinal large B‐cell lymphoma: A case report\nMARANGON et al.Marangon Miriam \n1\n Casadei Beatrice \n1\n Broccoli Alessandro \n1\n Argnani Lisa \n1\n Cavo Michele \n1\n Zinzani Pier Luigi https://orcid.org/0000-0002-2112-2651\n1\npierluigi.zinzani@unibo.it \n1 \nInstitute of Hematology “L. e A. Seràgnoli”\nUniversity of Bologna\nBologna\nItaly\n\n* Correspondence\n\nPier Luigi Zinzani, Institute of Hematology “L. e A. Seràgnoli”, University of Bologna, Via Massarenti, 9‐40138 Bologna, Italy.\n\nEmail: pierluigi.zinzani@unibo.it\n\n08 4 2020 \n6 2020 \n8 6 10.1002/ccr3.v8.6933 937\n02 7 2019 24 10 2019 25 10 2019 © 2020 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Abstract\nIn primary mediastinal large B‐cell lymphoma, central nervous system (CNS) relapse is an uncommon event with a dismal prognosis. We report about the successful management of CNS relapse with chemoimmunotherapy according to MATRix (methotrexate, cytarabine, thiotepa, and rituximab) protocol followed by autologous stem cell transplant.\n\nIn primary mediastinal large B‐cell lymphoma, central nervous system (CNS) relapse is an uncommon event with a dismal prognosis. We report about the successful management of CNS relapse with chemoimmunotherapy according to MATRix (methotrexate, cytarabine, thiotepa, and rituximab) protocol followed by autologous stem cell transplant.\n\n\nautologous stem cell transplantcentral nervous system involvementMATRix regimenprimary mediastinal large B‐cell lymphoma source-schema-version-number2.0cover-dateJune 2020details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.8.4 mode:remove_FC converted:19.06.2020\n\n\nMarangon \nM \n, \nCasadei \nB \n, \nBroccoli \nA \n, \nArgnani \nL \n, \nCavo \nM \n, \nZinzani \nPL \n. Management of central nervous system relapse in a young patient affected by primary mediastinal large B‐cell lymphoma: A case report\n. Clin Case Rep . 2020 ;8 :933 –937\n. 10.1002/ccr3.2706\n==== Body\n1 INTRODUCTION\nPrimary mediastinal large B‐cell lymphoma (PMBCL) is an uncommon tumor which constitutes about 2%‐3% of all non‐Hodgkin lymphomas and 6%‐10% of diffuse large B‐cell lymphomas (DLBCL). In this disease, central nervous system (CNS) relapse is a quite uncommon event, which constitutes nevertheless a therapeutic challenge due to its dismal prognosis. Since in literature there are currently no data available concerning management of CNS relapse in PMBCL, we refer to studies conducted in DLBCL. Here, we report about the successful management of CNS relapse with chemoimmunotherapy according to MATRix (methotrexate, cytarabine, thiotepa, and rituximab) protocol followed by autologous stem cell transplant in a young woman affected by PMBCL. Further follow‐up is needed to determine long‐term outcome.\n\nPrimary mediastinal large B‐cell lymphoma (PMBCL) is a mature B‐cell neoplasm which arises from thymic B cells.1 This uncommon disease affects more often women in their third or fourth decades of life. It usually presents with a rapidly progressive mediastinal mass which can be associated with symptoms related to superior vena cava syndrome. About 70% of patients have a bulky mass (>10 cm) at diagnosis. Distant spread to extra‐mediastinal lymph nodes or extranodal sites (ie, to the kidneys, adrenal glands, liver and ovaries) is uncommon at the time of presentation, but it can occur more frequently at the time of relapse.2, 3 Central nervous system (CNS) involvement rarely occurs at the time of onset, and it can be a quite infrequent site of disease recurrence; the main pattern of CNS disease is constituted by parenchymal lesions.4, 5 CNS recurrence is typically characterized by a dismal prognosis, and its treatment represents a difficult challenge for clinicians.\n\nHere, we report about the successful management of CNS relapse with chemoimmunotherapy according to MATRix (methotrexate, cytarabine, thiotepa, and rituximab) protocol followed by autologous stem cell transplant (ASCT) in a young patient affected by PMBCL.6, 7\n\n\nA 25‐year‐old young woman was transferred to our Institute in October 2016 from emergency department, where she was admitted due to the appearance of hacking cough, facial edema and conjunctival swelling. She had undergone a total body computed tomography (CT) scan, which showed a right mediastinal bulky mass (transverse diameters of 11 and 7.5 cm, respectively, and longitudinal diameter of 10 cm) compressing right cardiac structures, inferior vena cava, right pulmonary artery, right bronchus, surrounding ascending aorta and infiltrating pleura. Furthermore, supra and subdiaphragmatic adenopathies, multiple pulmonary nodules, a right pleural effusion, pancreatic, renal and right adrenal involvement were observed. Subsequently, a CT‐guided mediastinal biopsy was performed, leading to a diagnosis of PMBCL. Immunophenotype on diagnostic biopsy was as follows: CD20+, PAX5+, CD30±, CD10‐, BCL6+, BCL2±, IRF4+. 18F‐fluorodeoxyglucose positron emission tomography (18FDG‐PET) confirmed the presence of uptake at the mediastinal bulky mass, further mediastinal adenopathies, lungs, pancreas, kidneys, and right adrenal gland. Bone marrow biopsy was negative. According to Ann Arbor staging system, the disease was stage IV A, due to the absence of lymphoma‐related “B” symptoms. Physical examination revealed only the presence of neck and shoulders' edema; peripheral blood count revealed mild anemia and a white blood cell count of 13.000/mmc, with a normal differential count; platelet count was normal. Lactate dehydrogenase (LDH) was elevated. Age‐adjusted IPI was 2 (high‐intermediate risk).\n\nFrom October 2016 to January 2017, the patient was treated with 12 cycles of R‐MACOP‐B chemoimmunotherapy, which is administered weekly (cyclophosphamide and doxorubicin on cycles 1, 3, 5, 7, 9, 11; methotrexate and vincristine on cycles 2, 6, 10; bleomycin and vincristine on cycles 4, 8, 12) with prednisone given continuously and anti‐CD20 rituximab boost during four of the 12 cycles. During the treatment, the patient experienced grade IV neutropenia responsive to granulocyte‐colony stimulating factor, methotrexate‐related grade III oral mucositis and grade II nausea. Due to the incidental finding of a thyroid nodule at 18FDG‐PET scan, with normal thyroid function, an ultrasound and Doppler were performed. Ultrasound findings were consistent with the diagnosis of thyroid adenoma, which required annual follow‐up.\n\n\n18FDG‐PET was performed after 6 cycles and after the completion of 12 cycles of therapy; at both time points, complete response (CR) was shown (Deauville score 1 and 1, respectively).\n\nIn April 2017, 3 months after the completion of chemoimmunotherapy, the patient started complaining transient dysarthria and expressive aphasia; therefore, a cranial CT scan was immediately performed, showing a left temporal mass with associated edema. Magnetic resonance imaging (MRI) confirmed the finding (Figure 1), and a total body CT scan and 18FDG‐PET did not show further sites of disease involvement.\n\nFigure 1 Magnetic resonance imaging at central nervous system lymphoma recurrence\n\nThus, the patient underwent partial avulsion of the lesion through a left craniotomy at neurosurgical facility. Histological analysis revealed a diffuse large B‐cell lymphoma (DLBCL), which was considered to be consistent with a CNS recurrence of the primary mediastinal lymphoma.\n\nThe patient was treated with 4 cycles of chemoimmunotherapy with MATRix regimen.6\n\n\nDuring the cycles, the patient experienced febrile episodes with negative blood cultures, responsive to broad spectrum antibacterial therapy, and an episode of blurred vision during the second cycle, with the finding of keratoconjunctivitis sicca at ophthalmic examination. After the second cycle, the patient presented a febrile episode associated with a chest CT scan finding consistent with invasive fungal infection; therefore, a broncho‐alveolar lavage was performed, showing galactomannan positivity, and an antifungal therapy with amphotericin B was undertaken.\n\nDuring the 4 cycles of MATRix treatment, the patient developed grade IV neutropenia, which resolved after granulocyte‐colony stimulating factor (G‐CSF) administration, grade III anemia, which required red blood cell transfusions, and grade IV thrombocytopenia, which required platelet transfusions.\n\nAfter the second cycle, an attempt to mobilize peripheral blood stem cells (PBSC) was performed, without the obtainment of a PBSC count sufficient for collection; mobilizing treatment with granulocyte‐colony stimulating factor and plerixafor was therefore performed again after the third cycle, with the achievement of a CD 34+ cells'peak of 10.000/mL on day +19 after the completion of chemotherapy and subsequent collection of 3.54 × 106 CD34+ cells/kg.\n\nThe last cycle was complicated by a reaction to cytarabine, characterized by fever, skin rash, and severe headache; the subsequent cytarabine and thiotepa administrations were therefore suspended. A single, total dose of 2900 mg of cytarabine was delivered in the fourth cycle, before the development of hypersensitivity reaction.\n\nAfter fourth and last cycle of therapy, both MRI (Figure 2) and 18FDG‐PET (Deauville score 1) showed a CR. Subsequently, the patient received conditioning treatment with carmustine and thiotepa, followed by ASCT. The main toxicities of this therapy were grade III oral and oropharyngeal mucositis associated with herpes simplex virus 1 reactivation, which required total parenteral nutrition, antiacid, and antiviral treatment, and a prolonged hematologic toxicity. Engraftment of neutrophils (ANC > 500/mmc) was observed on day +10 after ASCT, while engraftment of platelets (PLT count > 20.000/mmc) was observed on day +16. Both 18FDG‐PET and CT scan of the brain showed a CR 2 months after ASCT.\n\nFigure 2 Magnetic resonance imaging at the end of MATRix (methotrexate, cytarabine, thiotepa, and rituximab) regimen (complete response)\n\nThe case report study was approved by the local ethical committee. Written informed consent for publication of her clinical details and clinical images was obtained from the patient. Timeline of the case report is shown in Table 1.\n\nTable 1 Timeline\n\nOctober 2016\tDiagnosis of PMBCL\t \t\nOctober 2016\tR‐MACOP‐B\tCR\t\nApril 2017\tCNS recurrence\t \t\nApril 2017\tStart of MATRix regimen\t \t\nJune 2017\tMobilization of peripheral blood stem cells\t \t\nAugust 2017\tEnd of MATRix regimen\tCR\t\nJanuary 2018\tASCT\t \t\nMarch 2018\tEvaluation post‐ASCT\tCR\t\nAbbreviations: ASCT, autologous stem cell transplant; CNS, central nervous system; CR, complete response; MATRix, methotrexate, cytarabine, thiotepa, and rituximab; PMBCL, primary mediastinal B‐cell lymphoma; R‐MACOP‐B, rituximab, methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin.\n\nJohn Wiley & Sons, LtdPMBCL is an uncommon tumor which constitutes about 2%‐3% of all non‐Hodgkin lymphomas and 6%‐10% of DLBCL.2 In this disease, CNS relapse is a quite uncommon event, which constitutes nevertheless a therapeutic challenge due to its dismal prognosis. Since in literature there are currently no data available concerning management of CNS relapse in PMBCL, we refer to studies conducted in DLBCL.\n\nIn a large trial conducted in prerituximab era involving 899 patients, a cumulative CNS relapse incidence of 2.8% was reported among patients affected by intermediate or high‐grade lymphoma, who were treated with polichemotherapy regimens. In this trial, CNS recurrence appeared to occur early (all cases occurred within 24 months from the end of treatment) and was characterized by a dismal prognosis.8\n\n\nThe addition of monoclonal antibody rituximab to polichemotherapy regimens such as CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone) conferred an advantage in terms of risk of CNS involvement in DLBCL, although its real benefit is still controversial.9\n\n\nSeveral attempts were made to better identify patients at high risk of CNS involvement, in order to guide specific diagnostic workup and to select patients for appropriate therapeutic or prophylactic measures. Recently, an international group developed a risk model called “CNS‐International Prognostic Index” (CNS‐IPI).10 The score was developed analysing patients who were enrolled in studies from the German High‐Grade Non‐Hodgkin Lymphoma Study Group and the MabThera International Trial and was subsequently validated in an independent data set from the British Columbia Cancer Lymphoid Cancer database. The study confirmed the infrequence, earliness, and aggressive course of CNS relapse in aggressive B‐cell lymphomas; the model defining the CNS‐IPI included IPI factors. Of note, in the validation study, patients affected by PMBCL were excluded; another limitation of the study is the fact that, even with this robust risk score, a very high‐risk group remains difficult to identify.10 At diagnosis, our patient had kidney and adrenal gland involvement, more than one extranodal site, stage IV disease and elevated LDH; therefore, she had high‐risk disease (CNS‐IPI 4). Due to the lack of consensus and of recommendations on CNS prophylaxis in PMBCL and the failure of several studies to demonstrate a benefit of intrathecal (IT) prophylaxis in DLBCL, we did not perform IT prophylaxis after first‐line chemoimmunotherapy.11, 12\n\n\nSince the patient achieved a complete remission after first‐line treatment, we did not perform consolidative mediastinal radiotherapy (RT); in fact, as recent studies suggested that consolidation with RT can be safely omitted in patients who achieve PET‐negativity after first‐line chemoimmunotherapy, we do not usually administer RT in this setting of patients.13, 14, 15\n\n\nPatients who experience CNS relapse have a poor prognosis; thus, they should receive treatment according to modern protocols for primary CNS lymphoma, such as methotrexate‐/cytarabine‐based schemes. Recently, in an international randomised phase II trial, the addition of rituximab and thiotepa to a cytarabine and methotrexate therapeutic scheme showed a significant benefit in terms of CR rate, overall response rate, 30 months‐progression‐free survival and overall survival, if compared to methotrexate and cytarabine or with methotrexate, cytarabine and rituximab in patients affected by primary CNS lymphoma. In this study, patients with responsive or stable disease after the first stage were randomised to receive whole‐brain radiotherapy (WBRT) or ASCT; the results from the second randomisation showed that WBRT and ASCT are both feasible and effective as consolidation therapies.6, 7\n\n\nFollowing the promising results showed in the study by Ferreri and colleagues, at the time of CNS relapse, we treated our patient with four courses of chemo‐immunotherapy with methotrexate, cytarabine, thiotepa, and rituximab according to MATRix protocol, with the obtainment of a CR since the second cycle of treatment; although both ASCT and WBRT are effective consolidation strategies in patients affected by primary CNS DLBCL7, due to the young age of the patient and the known risk of cognitive impairment related to WBRT, we decided to perform ASCT. 18FDG‐PET and CT scan of the brain documented the maintenance of CR two months after the procedure.\n\nIn conclusion, we report the successful management of a CNS relapse of PMBCL with MATRix treatment; further follow‐up is needed to determine long‐term outcome.\n\nCONFLICT OF INTEREST\nNone declared.\n\nAUTHOR CONTRIBUTIONS\nMM, BC, AB, and PLZ: analyzed and interpreted the patient data regarding the hematologic disease; MC: provided advice for treatment and analyzed and interpreted the patient data regarding the hematologic disease; MM, LA, and PLZ: were major contributor in writing the manuscript; and all authors: read, revised, and approved the final manuscript.\n==== Refs\nREFERENCES\n1 \n\nSwerdlow \nSH \n, \nCampo \nE \n, \nPileri \nSA \n, et al. The 2016 revision of the World Health Organization classification of lymphoid neoplasms\n. Blood . 2016 ;127 (20 ):2375 ‐2390\n.26980727 \n2 \n\nMartelli \nM \n, \nFerreri \nA \n, \nDi Rocco \nA \n, \nAnsuinelli \nM \n, \nJohnson \nPWM \n. Primary mediastinal large B‐cell lymphoma\n. Crit Rev Oncol Hematol . 2017 ;113 :318 ‐327\n.28318892 \n3 \n\nZinzani \nPL \n, \nPiccaluga \nPP \n. Primary Mediastinal DLBCL: evolving biologic understanding and therapeutic strategies\n. Curr Oncol Rep . 2011 ;13 (5 ):407 ‐415\n.21789543 \n4 \n\nBishop \nPC \n, \nWilson \nWH \n, \nPearson \nD \n, \nJanik \nJ \n, \nJaffe \nES \n, \nElwood \nPC \n. CNS involvement in primary mediastinal large B‐cell lymphoma\n. J Clin Oncol . 1999 ;17 (8 ):2479 ‐2485\n.10561312 \n5 \n\nPapageorgiou \nSG \n, \nDiamantopoulos \nP \n, \nLevidou \nG \n, et al. Isolated central nervous system relapses in primary mediastinal large B‐cell lymphoma after CHOP‐like chemotherapy with or without Rituximab\n. Hematol Oncol . 2013 ;31 (1 ):10 ‐17\n.22610484 \n6 \n\nFerreri \nAJM \n, \nCwynarski \nK \n, \nPulczynski \nE \n, et al. Chemoimmunotherapy with methotrexate, cytarabine, thiotepa, and rituximab (MATRix regimen) in patients with primary CNS lymphoma: results of the first randomisation of the International Extranodal Lymphoma Study Group‐32 (IELSG32) phase 2 trial\n. Lancet Haematol . 2016 ;3 (5 ):e217 ‐227\n.27132696 \n7 \n\nFerreri \nAJM \n, \nCwynarski \nK \n, \nPulczynski \nE \n, et al. Whole‐brain radiotherapy or autologous stem‐cell transplantation as consolidation strategies after high‐dose methotrexate‐based chemoimmunotherapy in patients with primary CNS lymphoma: results of the second randomisation of the International Extranodal Lymphoma Study Group‐32 phase 2 trial\n. Lancet Haematol . 2017 ;4 (11 ):e510 ‐e523\n.29054815 \n8 \n\nBernstein \nSH \n, \nUnger \nJM \n, \nLeBlanc \nM \n, \nFriedberg \nJ \n, \nMiller \nTP \n, \nFisher \nRJ \n. Natural history of CNS relapse in patients with aggressive non Hodgkin’s lymphoma: a 20‐year follow‐up analysis of SWOG 8516‐The Southwest Oncology Group\n. J Clin Oncol . 2009 ;27 (1 ):114 ‐119\n.19047289 \n9 \n\nVilla \nD \n, \nConnors \nJM \n, \nShenkier \nTN \n, \nGascoyne \nRD \n, \nSehn \nLH \n, \nSavage \nKJ \n. Incidence and risk factors for central nervous system relapse in patients with diffuse large B cell lymphoma: The impact of the addition of rituximab to CHOP chemotherapy\n. Ann Oncol . 2010 ;21 (5 ):1046 ‐1052\n.19861575 \n10 \n\nSchmitz \nN \n, \nZeynalova \nS \n, \nNickelsen \nM \n, et al. CNS International prognostic index: a risk model for CNS relapse in patients with diffuse large B‐cell lymphoma treated with R‐CHOP\n. J Clin Oncol . 2016 ;34 (26 ):3150 ‐3156\n.27382100 \n11 \n\nKumar \nA \n, \nVanderplas \nA \n, \nLaCasce \nAS \n, et al. Lack of benefit of central nervous system prophylaxis for diffuse large B‐cell lymphoma in the rituximab era: findings from a large national database\n. Cancer . 2012 ;118 :2944 ‐2951\n.22006274 \n12 \n\nGuirguis \nHR \n, \nCheung \nMC \n, \nMahrous \nM \n, et al. Impact of central nervous system (CNS) prophylaxis on the incidence and risk factors for CNS relapse in patients with diffuse large B‐cell lymphoma treated in the rituximab era: a single centre experience and review of the literature\n. Br J Haematol . 2012 ;159 :39 ‐49\n.22849793 \n13 \n\nBroccoli \nA \n, \nCasadei \nB \n, \nStefoni \nV \n, et al. The treatment of primary mediastinal large B‐cell lymphoma: a two decades monocentric experience with 98 patients\n. BMC Cancer . 2017 ;17 :276 .28415982 \n14 \n\nZinzani \nPL \n, \nBroccoli \nA \n, \nCasadei \nB \n, et al. The role of rituximab and positron emission tomography in the treatment of primary mediastinal large B‐cell lymphoma: experience on 74 patients\n. Hematol Oncol . 2015 ;33 (4 ):145 ‐150\n.25256959 \n15 \n\nDunleavy \nK \n, \nPittaluga \nS \n, \nMaeda \nLS \n, et al. Dose adjusted EPOCH‐rituximab therapy in primary mediastinal B‐cell lymphoma\n. N Engl J Med . 2013 ;368 :1408 ‐1416\n.23574119\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-0904",
"issue": "8(6)",
"journal": "Clinical case reports",
"keywords": "MATRix regimen; autologous stem cell transplant; central nervous system involvement; primary mediastinal large B‐cell lymphoma",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "933-937",
"pmc": null,
"pmid": "32577237",
"pubdate": "2020-06",
"publication_types": "D002363:Case Reports",
"references": "29054815;28415982;22849793;25256959;23574119;10561312;26980727;21789543;22610484;19861575;27132696;22006274;19047289;27382100;28318892",
"title": "Management of central nervous system relapse in a young patient affected by primary mediastinal large B-cell lymphoma: A case report.",
"title_normalized": "management of central nervous system relapse in a young patient affected by primary mediastinal large b cell lymphoma a case report"
} | [
{
"companynumb": "IT-TEVA-2020-IT-1835302",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "GATA2 deficiency, first described in 2011, is a bone marrow failure disorder resulting in a complex haematological and immunodeficiency syndrome characterised by cytopenias, severe infections, myelodysplasia and leukaemia. The only curative treatment is allogeneic haematopoietic stem cell transplantation (HSCT). Although knowledge on this syndrome has greatly expanded, in clinical practice many challenges remain. In particular, guidelines on optimal donor and stem cell source and conditioning regimens regarding HSCT are lacking. Additionally, genetic analysis of GATA2 is technically cumbersome and could easily result in false-negative results. With this report, we wish to raise awareness of these pitfalls amongst physicians dealing with haematological malignancies and primary immunodeficiencies.",
"affiliations": "Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Department of Pediatrics, Division of Pediatric Hemato-Oncology and Stem Cell Transplantation, Ghent University Hospital, Ghent, Belgium.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Department of Hematology, Ghent University Hospital, Ghent, Belgium.;Center for Medical Genetics, Ghent University and Ghent University Hospital, Ghent, Belgium.;Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Department of Hematology, General Hospital OLV Aalst, Aalst, Belgium.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Center for Medical Genetics, Ghent University and Ghent University Hospital, Ghent, Belgium.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.;Primary Immunodeficiency Research Lab, Center for Primary Immunodeficiency Ghent, Jeffrey Modell Diagnosis and Research Center, Ghent University Hospital, Ghent, Belgium.",
"authors": "Bogaert|Delfien J|DJ|;Laureys|Genevieve|G|;Naesens|Leslie|L|;Mazure|Dominiek|D|;De Bruyne|Marieke|M|;Hsu|Amy P|AP|;Bordon|Victoria|V|;Wouters|Erik|E|;Tavernier|Simon J|SJ|;Lambrecht|Bart N|BN|;De Baere|Elfride|E|;Haerynck|Filomeen|F|;Kerre|Tessa|T|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1111/bjh.16247",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-1048",
"issue": "188(5)",
"journal": "British journal of haematology",
"keywords": "GATA2 deficiency; graft versus host disease; haematopoietic stem cell transplantation; leukaemia; myelodysplasia",
"medline_ta": "Br J Haematol",
"mesh_terms": "D000328:Adult; D064591:Allografts; D005260:Female; D000077428:GATA2 Deficiency; D019337:Hematologic Neoplasms; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007153:Immunologic Deficiency Syndromes; D008297:Male",
"nlm_unique_id": "0372544",
"other_id": null,
"pages": "768-773",
"pmc": null,
"pmid": "31710708",
"pubdate": "2020-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "GATA2 deficiency and haematopoietic stem cell transplantation: challenges for the clinical practitioner.",
"title_normalized": "gata2 deficiency and haematopoietic stem cell transplantation challenges for the clinical practitioner"
} | [
{
"companynumb": "NVSC2019BE035588",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MYCOPHENOLATE MOFETIL"
},
"drugadditional": "3",
... |
{
"abstract": "Hand hygiene has always been an area of emphasis within the hospital setting, never more so than during the coronavirus disease 2019 (COVID-19) pandemic. The consumption of alcohol-containing hand sanitizer products, whether intentional or accidental, often garners attention, particularly since these products may contain methanol. This report describes a case of surreptitious theft and intentional ingestion of the emergency department's (ED) ethanol-based hand sanitizer by a patient who presented to the ED clinically intoxicated with a high ethanol level. When the patient remained clinically intoxicated for more than 18 hours and had a rising serum ethanol level in the ED, clinicians searched his belongings and found several purloined bottles of the ED's hand sanitizer. When confronted, the patient admitted to ingesting hand sanitizer during his ED stay. This case highlights the need for clinicians to be suspicious of intentional ingestion of ethanol-containing products for at-risk patients. Additionally, it demonstrates that measures and protocols should be put in place that minimize the ability for the inappropriate use of these widely accessible products within the hospital.",
"affiliations": "Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA.;Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA.;Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA.;Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA.;Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA.",
"authors": "Pourmand|Ali|A|;Ghassemi|Mateen|M|;Frasure|Sarah E|SE|;Kreisman|Alexandrer|A|;Shesser|Robert|R|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.17906",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184\nCureus Palo Alto (CA)\n\n10.7759/cureus.17906\nEmergency Medicine\nSubstance Use and Addiction\nHand Sanitizer Intoxication in the Emergency Department\nMuacevic Alexander\nAdler John R\nPourmand Ali 1\nGhassemi Mateen 1\nFrasure Sarah E 1\nKreisman Alexandrer 1\nShesser Robert 1\n1 Department of Emergency Medicine, George Washington University School of Medicine and Health Sciences, Washington DC, USA\nSarah E. Frasure sarahfrasure@yahoo.com\n12 9 2021\n9 2021\n13 9 e1790612 9 2021\nCopyright © 2021, Pourmand et al.\n2021\nPourmand et al.\nhttps://creativecommons.org/licenses/by/3.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nThis article is available from https://www.cureus.com/articles/70719-hand-sanitizer-intoxication-in-the-emergency-department\nHand hygiene has always been an area of emphasis within the hospital setting, never more so than during the coronavirus disease 2019 (COVID-19) pandemic. The consumption of alcohol-containing hand sanitizer products, whether intentional or accidental, often garners attention, particularly since these products may contain methanol. This report describes a case of surreptitious theft and intentional ingestion of the emergency department’s (ED) ethanol-based hand sanitizer by a patient who presented to the ED clinically intoxicated with a high ethanol level. When the patient remained clinically intoxicated for more than 18 hours and had a rising serum ethanol level in the ED, clinicians searched his belongings and found several purloined bottles of the ED’s hand sanitizer. When confronted, the patient admitted to ingesting hand sanitizer during his ED stay. This case highlights the need for clinicians to be suspicious of intentional ingestion of ethanol-containing products for at-risk patients. Additionally, it demonstrates that measures and protocols should be put in place that minimize the ability for the inappropriate use of these widely accessible products within the hospital.\n\nalcohol misuse\nsubstance abuse\nhand sanitizer\nhand hygiene\nethanol intoxication\nThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\npmcIntroduction\n\nNon-beverage or surrogate alcohols are substances that may be consumed as an alternative to traditional alcoholic beverages containing alcohol. These substances may include mouthwash, perfumes, aftershave, cough syrup, liquid cold remedies, rubbing alcohol, gasoline, paint thinner, jellied alcohols, hairspray, and hand sanitizers [1-4]. Some individuals suffering from alcoholism may choose these methods of alcohol consumption in order to become intoxicated. The widespread availability of hand sanitizers during the coronavirus disease 2019 (COVID-19) pandemic has led to an increase in the intentional ingestion of ethanol-based hand sanitizers.\n\nPer World Health Organization and Centers for Disease Control guidelines for hand hygiene, alcohol-based hand sanitizers are readily available in healthcare settings [5,6]. Used as low-viscosity rinses, gels, or foams, alcohol-based hand sanitizers contain 60-95% ethanol or isopropanol and are efficacious for reducing the transmission of pathogenic microorganisms [7]. However, their accessibility and presence in the emergency department (ED) poses a hazard for patients with alcohol dependency as they may be tempted to imbibe ethanol-based hand sanitizers. Although accidental or intentional ingestion of hand sanitizers by children and teenagers have received media attention and have been previously discussed in the literature [8], we present a case in which an adult patient, who requested to be transferred to a detoxification program while in the ED, surreptitiously ingested hand sanitizer while under clinical supervision.\n\nCase presentation\n\nA 30-year-old male with a history of ethanol use disorder (consuming 1.5 L/day of liquor) complicated by withdrawal seizures, depression, and asthma presented to the ED via emergency medical services after being found intoxicated in a park. Initial vital signs were notable for blood pressure 146/79 mmHg, heart rate 118 beats/minute, respiratory rate 20 breaths/minute, temperature 98.6°F, and oxygen saturation of 99% on room air. His physical examination, aside from being intoxicated with slurred speech and an unsteady gait, was unremarkable. There was no external evidence of trauma. Given his risk of self-reported withdrawal seizures and delirium tremens, the patient was placed on a telemetry monitor and on the Clinical Institute Withdrawal Assessment for Alcohol (CIWA) protocol. The patient received 2 liters of normal saline fluid and intravenous lorazepam. His initial blood alcohol level (BAL) was 359 mg/dl. The patient initially requested to be transferred to a local program for alcohol detoxification but the requirement for eligibility was a BAL less than 100 mg/dl. The patient was re-evaluated for sobriety during changes of shift by the oncoming emergency medicine resident. Strangely, however, he remained clinically intoxicated after 18 hours in the ED. He was subsequently found to have several bottles of the hospital’s hand sanitizer in his possession. At this time, a repeat BAL was as 372 mg/dl and the patient was admitted to the hospital 20 hours after his initial arrival to the ED for observation and monitoring for possible development of withdrawal symptoms.\n\nDiscussion\n\nAlthough cases of intentional hand sanitizer ingestion have been previously described, we describe a unique case in which a patient, who voluntarily requested to enter a detoxification program, did not disappear or hide to secretly ingest hand sanitizers [9-11]. Instead, while waiting to be transferred to the Psychiatric Institute of Washington for detoxification, the patient ingested ethanol-based hand sanitizer from dispensers around the ED-an environment in which patients and clinicians are constantly in close contact. Previous cases report hospitalized patients drinking hand sanitizer in their rooms or in the bathroom [12-16]. Other settings also included the psychiatric unit, a homeless shelter bathroom, or a prison [17]. This case demonstrates the ease by which a patient suffering from ethanol use disorder can obtain alcohol in the emergency department.\n\nAlthough ingestion of ethanol-based hand sanitizers should follow the general treatment protocol as ethanol consumption, intoxication from ethanol-based hand sanitizers can lead to serious and life-threatening adverse health effects. These include, but are not limited to, central nervous system and respiratory depression, cardiac dysrhythmias or arrest, nausea and vomiting, liver injury, and lactic and ketoacidosis [18]. Protection of the patient’s respiratory function with possible intubation is a priority given ethanol’s effect on depressing the central nervous system [19,20].\n\nCurrently, there are no recommendations regarding the potential misuse of hand sanitizers. Given the extensive utilization of hand sanitizers, coupled with a surge in ethanol sales since the beginning of the COVID-19 pandemic, healthcare providers should be aware of the potential misuse of hand sanitizers as intoxicants. The widespread endorsement of hand sanitizers by public health and medical experts opens a new dimension in medicine, one in which clinicians must also be cautioned of their potential misuse by patients suffering from alcoholism or other mental illnesses. We recommend that emergency staff be educated regarding the possibility of high-risk patients imbibing hand sanitizer, as well as signs of intoxication or changes in mental status. Clinicians should be well-versed in asking specific questions to patients or family members regarding potential alcohol-containing solutions in the household, such as engine additives stored in the garage or mouthwash in the bathroom.\n\nHospitals should implement measures or protocols that minimize the possibility of the misuse of ethanol-based hand sanitizers. Such protocols include a reevaluation of where hand sanitizer dispensers are physically located throughout the emergency department and their accessibility to patients at higher risk. Since hand sanitizer bottles or pouches in wall dispensers can be easily removed and consumed by patients, we recommend the installation of lockable wall dispensers or the use of alcohol-based wipes. This recommendation would not deter from the practice of using the hand sanitizer when entering or leaving the patient’s room to prevent the transmission of pathogens. Lastly, hand sanitizer dispensers often have the percent alcohol content written on the bottle which may appeal to patients with alcohol dependence and result in consumption. One case report described a patient who secretly drank isopropanol-based hand sanitizer in the bathroom of a hospital because the label indicated “63% v/v isopropyl alcohol,” believing it had higher alcohol content than vodka [20]. Thus, it may be advisable to adjust hand sanitizer labels to make the alcohol content less recognizable to patients, and decrease attraction for abuse. The installation of additional sinks with soap dispensers would be another option in high-risk areas in hospitals or other inpatient facilities.\n\nPromoting and maintaining hand hygiene while also protecting patients with alcohol abuse disorders presents a major challenge to both patient safety and risk mitigation. Clinicians should be aware of the possible misuse of hand sanitizer. Increased awareness and implementation of safety protocols in emergency departments might minimize intentional hand sanitizer ingestion. We recommend the use of lockable wall dispensers as a way to reduce hand sanitizer ingestion in the hospital.\n\nConclusions\n\nPromoting and maintaining hand hygiene while also protecting patients with alcohol abuse disorders presents a major challenge to both patient safety and risk mitigation. Clinicians should be aware of the possible misuse of hand sanitizer. Increased awareness and implementation of safety protocols in emergency departments might minimize intentional hand sanitizer ingestion. The use of lockable wall dispensers or alcohol-based wipes could help to reduce hand sanitizer ingestion in the hospital.\n\nHuman Ethics\n\nThe authors have declared that no competing interests exist.\n\nConsent was obtained or waived by all participants in this study\n==== Refs\nReferences\n\n1 Alcoholics who drink mouthwash: the spectrum of nonbeverage alcohol use J Stud Alcohol Egbert AM Reed JS Powell BJ Liskow BI Liese BS 473 481 46 1985 4087909\n2 Acute ethanol intoxication after consumption of hairspray Pharmacotherapy Carnahan RM Kutscher EC Obritsch MD Rasmussen LD 1646 1650 25 2005 16232026\n3 Intentional ingestion of hand sanitizer in an adult psychiatric unit Ment Health Clin Stevens DL Hix M 60 63 10 2020 32257734\n4 Intoxication of a prison inmate with an ethyl alcohol-based hand sanitizer N Engl J Med Doyon S Welsh C 529 530 356 2007 17267920\n5 World Health Organization. WHO guidelines on hand hygiene in health care 10 2020 World Health Organization 2009 https://www.who.int/publications/i/item/9789241597906\n6 Centers for Disease Control and Prevention. Hand hygiene in healthcare settings 10 2020 2019 https://www.cdc.gov/handhygiene/index.html\n7 Guideline for hand hygiene in health-care settings: recommendations of the Healthcare Infection Control Practices Advisory Committee and the HICPAC/SHEA/APIC/IDSA Hand Hygiene Task Force Infect Control Hosp Epidemiol Boyce JM Pittet D 0 40 23 2002\n8 Acute alcohol intoxication in a child following ingestion of an ethyl-alcohol-based hand sanitizer Int J Clin Pharmacol Ther Hertzog JH Radwick A 557 560 53 2015 25943177\n9 Intentional ingestion of ethanol-based hand sanitizer by a hospitalized patient with alcoholism Mayo Clin Proc Thanarajasingam G Diedrich DA Mueller PS 1288 1289 82 2007 17908534\n10 Death caused by ingestion of an ethanol-based hand sanitizer J Emerg Med Schneir AB Clark RF 358 360 45 2013 23706595\n11 Ingestion of hand sanitizer by a hospitalized patient with a history of alcohol abuse Am J Health Syst Pharm Bookstaver PB Norris LB Michels JE 2203 2204 65 2008 19020181\n12 Alcohol hand rubs: hygiene and hazard BMJ Archer JR Wood DM Tizzard Z Jones AL Dargan PI 1154 1155 335 2007 18048543\n13 Changing dispensers may prevent intoxication from isopropanol and ethyl alcohol-based hand sanitizers Ann Emerg Med Weiner SG 486 50 2007 17881325\n14 A case of mixed intoxication with isopropyl alcohol and propanol-1 after ingestion of a topical antiseptic solution Clin Toxicol (Phila) Blanchet B Charachon A Lukat S Huet E Hulin A Astier A 701 704 45 2007 17849246\n15 A voluntary ingestion of alcohol-based hand rub J Hosp Infect Tavolacci MP Marini H Vanheste S Merle V Coulon AM Micaud G Czernichow P 86 87 66 2007 17350719\n16 A surprising side effect of hand antisepsis Intensive Care Med Meyer P Baudel JL Maury E Offenstadt G 1600 31 2005 16187062\n17 A patient who prefers to imbibe ethanol-based hand sanitizer over traditional alcoholic beverages Am J Addict Jones R Schuhmann L El-Mallakh R 148 149 22 2013 23414500\n18 Acute alcohol intoxication Eur J Intern Med Vonghia L Leggio L Ferrulli A Bertini M Gasbarrini G Addolorato G 561 567 19 2008 19046719\n19 The rising incidence of intentional ingestion of ethanol-containing hand sanitizers Crit Care Med Gormley NJ Bronstein AC Rasimas JJ 290 294 40 2012 21926580\n20 Intoxication of a hospitalized patient with an isopropanol-based hand sanitizer N Engl J Med Emadi A Coberly L 530 531 356 2007 17267921\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "13(9)",
"journal": "Cureus",
"keywords": "alcohol misuse; ethanol intoxication; hand hygiene; hand sanitizer; substance abuse",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e17906",
"pmc": null,
"pmid": "34660101",
"pubdate": "2021-09",
"publication_types": "D002363:Case Reports",
"references": "16232026;16187062;17267921;17849246;21926580;25943177;12515399;17267920;23414500;18048543;4087909;23706595;19020181;17350719;17908534;17881325;32257734;19046719",
"title": "Hand Sanitizer Intoxication in the Emergency Department.",
"title_normalized": "hand sanitizer intoxication in the emergency department"
} | [
{
"companynumb": "US-PROCTER_AND_GAMBLE-PH21009891",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ALCOHOL"
},
"drugadditional": "3",
... |
{
"abstract": "One-third of patients with papillary thyroid cancer (PTC) develop persistent or recurrent disease after initial therapy. Most patients with persistent or recurrent disease undergo reoperation, but the role of treatment with radioactive iodine (RAI) after reoperation is unclear.\n\n\n\nTo determine whether receipt of RAI after reoperation for recurrent PTC is associated with improved outcomes.\n\n\n\nThis retrospective cohort study included electronic health record data from 102 patients who underwent neck reoperation for persistent or recurrent PTC at a tertiary referral center from April 2006 to January 2016; 50 patients received RAI after reoperation, and 52 did not receive RAI after reoperation. Data analysis was performed from September 1, 2017, to December 1, 2017.\n\n\n\nSuppressed thyroglobulin (Tg) levels were compared between patients who underwent reoperation and received RAI and patients who underwent reoperation without receipt of RAI at the following time points: before reoperation (Tg0), after reoperation (Tg1), and after RAI or a comparable time interval among patients whose cases were managed without RAI (Tg2). Outcomes were biochemical response and structural recurrence after reoperation.\n\n\n\nThe cohort comprised 102 patients who underwent neck reoperation for persistent or recurrent PTC (median age, 44 years [interquartile range, 33-54 years; SD, 14 years]; 67 [66%] female), 50 of whom received treatment with RAI after reoperation. Clinicopathologic characteristics of the patients at the time of the initial surgical procedure were similar between the reoperation with RAI group and the reoperation without RAI group with the exception of tumor (T) stage (T3 and T4, 28 of 50 [56%] vs 19 of 52 [37%]). Although median Tg levels were similar between the reoperation with RAI group and the reoperation without RAI group (Tg0, 3.3 ng/mL vs 2.4 ng/mL; Tg1, 0.6 ng/mL vs 0.2 ng/mL; and Tg2, 0.5 ng/mL vs 0.2 ng/mL; all differences were nonsignificant), the rate of excellent response at Tg1 was lower in the reoperation with RAI group (4 of 33 [12%] vs 24 of 51 [47%]; P = .007). Structural recurrence after reoperation occurred in 18 of 50 patients (36%) in the reoperation with RAI group and 10 of 52 patients (19%) in the reoperation without RAI group. In multivariable analysis accounting for clinicopathologic characteristics and Tg0, receipt of RAI after reoperation was not associated with the rate of a second structural recurrence. In subset analyses limited to patients with incomplete response to reoperation and patients with T3 or T4 tumors, no association between receipt of RAI and the risk of a second recurrence was found.\n\n\n\nPatients who received RAI after reoperation had outcomes similar to those in patients who underwent reoperation alone. RAI after reoperation was not associated with a significant clinical benefit in this limited series. Larger multicenter studies are required to determine whether receipt of RAI after reoperation improves outcomes among patients with recurrent PTC.",
"affiliations": "Section of Endocrine Surgery, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles.;Section of Endocrine Surgery, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles.;Department of Biomathematics, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles.;Section of Endocrine Surgery, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles.;Section of Endocrine Surgery, David Geffen School of Medicine at University of California, Los Angeles, Los Angeles.",
"authors": "Hung|Matthew L|ML|;Wu|James X|JX|;Li|Ning|N|;Livhits|Masha J|MJ|;Yeh|Michael W|MW|",
"chemical_list": "D015415:Biomarkers; D007457:Iodine Radioisotopes; D013954:Thyroglobulin",
"country": "United States",
"delete": false,
"doi": "10.1001/jamasurg.2018.2659",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2168-6254",
"issue": "153(12)",
"journal": "JAMA surgery",
"keywords": null,
"medline_ta": "JAMA Surg",
"mesh_terms": "D000328:Adult; D015415:Biomarkers; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D007457:Iodine Radioisotopes; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D012044:Regression Analysis; D012086:Reoperation; D012189:Retrospective Studies; D013954:Thyroglobulin; D000077273:Thyroid Cancer, Papillary; D013964:Thyroid Neoplasms",
"nlm_unique_id": "101589553",
"other_id": null,
"pages": "1098-1104",
"pmc": null,
"pmid": "30140908",
"pubdate": "2018-12-01",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "27732700;27732688;22136266;25642591;25205448;27966046;21976723;22526913;21508143;17199433;24238053;26462967;28359102;24494778;29126111;1597728;7977430;20332244;9874472;12016468",
"title": "Association of Radioactive Iodine Administration After Reoperation With Outcomes Among Patients With Recurrent or Persistent Papillary Thyroid Cancer.",
"title_normalized": "association of radioactive iodine administration after reoperation with outcomes among patients with recurrent or persistent papillary thyroid cancer"
} | [
{
"companynumb": "US-CURIUM-201900163",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "SODIUM IODIDE I-131"
},
"drugadditional": null,
... |
{
"abstract": "Introduction: Lung cancer is still the leading cause of cancer among cancer patients. Although there are novel therapies as second line treatment for NSCLC, there is an issue for elderly patients. Patients and Methods: We collected retrospectively data from 60 patients >75 years of age. Thirty of these patients received nab-paclitaxel and first line treatment and were compared to thirty patients that received only best supportive care. Results: The median life of patients at the date of disease progression, although increased by the administration of the drug (92 days versus 70) was not confirmed statistically significantly (Mann-Whitney test: W = 280, p = 0.138). The administration of drug seems to keep stable the biological condition of patients (McNemar's test: χ2 = 0.033, p = 0.99). Patients with chemotherapy the death rate was increased by 50% as compared to those with best supportive care (12 vs 8), the median life until the unfortunate event surpassed statistically significantly the latter (150 days of life as compared to 108, Mann-Whitney test: W = 57.5, p = 0.045). Discussion: Nab-paclitaxel as a monotherapy could be considered as a first line treatment option for patients > 75 years of age without any previous cardiological medical history when compared to best supportive care.",
"affiliations": "Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Department of Respiratory and Critical Care Medicine, Changhai Hospital, The Second Military Medical University, Shanghai, China.;Department of Respiratory and Critical Care Medicine, Changhai Hospital, The Second Military Medical University, Shanghai, China.;Department of Food Technology, School of Food Technology and Nutrition, Alexander Technological Educational Institute, Thessaloniki, Greece.;Department of Nutrition and Dietetics, Alexander Technological Educational Institute, Thessaloniki, Greece.;Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Pulmonary Oncology Unit, \"G. Papanikolaou\" General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece.;Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greece.;General Surgery Department, European Interbalkan Medical Center, Thessaloniki, Greece.;Second Pulmonary Clinic, 'Sotiria' Chest Diseases Hospital, Athens, Greece.;Division of Pulmonary and Critical Care Medicine, Sheikh Zayed Cardiovascular & Critical Care Tower, Baltimore, U.S.A.;Division of Pulmonary and Critical Care Medicine, Sheikh Zayed Cardiovascular & Critical Care Tower, Baltimore, U.S.A.;Research Laboratory and International Collaboration, Bon Secours Cancer Institute, VA, USA.;Medical Clinic I, ''Fuerth'' Hospital, University of Erlangen, Fuerth, Germany.",
"authors": "Zarogoulidis|Paul|P|;Huang|Haidong|H|;Bai|Chong|C|;Petridis|Dimitris|D|;Papadopoulou|Susana|S|;Faniadou|Eleni|E|;Eleftheriadou|Ellada|E|;Trakada|Georgia|G|;Cristoforos|Kosmidis|K|;Rapti|Aggeliki|A|;Yarmus|Lonny|L|;Kopman|David-Feller|DF|;Man|Yan-Gao|YG|;Hohenforst-Schmidt|Wolfgang|W|",
"chemical_list": null,
"country": "Australia",
"delete": false,
"doi": "10.7150/jca.19463",
"fulltext": "\n==== Front\nJ CancerJ CancerjcaJournal of Cancer1837-9664Ivyspring International Publisher Sydney 10.7150/jca.19463jcav08p1673Research PaperNab-paclitaxel as First Line Treatment for NSCLC in Elderly Patients More Than 75 Years Old Zarogoulidis Paul 1✉*Huang Haidong 3*Bai Chong 3*Petridis Dimitris 4Papadopoulou Susana 5Faniadou Eleni 1Eleftheriadou Ellada 1Trakada Georgia 6Cristoforos Kosmidis 7Rapti Aggeliki 8Yarmus Lonny 9Kopman David-Feller 9Man Yan-Gao 10Hohenforst-Schmidt Wolfgang 2*1 Pulmonary Oncology Unit, “G. Papanikolaou” General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece;2 Medical Clinic I, ''Fuerth'' Hospital, University of Erlangen, Fuerth, Germany;3 Department of Respiratory and Critical Care Medicine, Changhai Hospital, The Second Military Medical University, Shanghai, China;4 Department of Food Technology, School of Food Technology and Nutrition, Alexander Technological Educational Institute, Thessaloniki, Greece;5 Department of Nutrition and Dietetics, Alexander Technological Educational Institute, Thessaloniki, Greece;6 Division of Pulmonology, Department of Clinical Therapeutics, National and Kapodistrian University of Athens School of Medicine, Alexandra Hospital, Athens, Greece;7 General Surgery Department, European Interbalkan Medical Center, Thessaloniki, Greece;8 Second Pulmonary Clinic, 'Sotiria' Chest Diseases Hospital, Athens, Greece;9 Division of Pulmonary and Critical Care Medicine, Sheikh Zayed Cardiovascular & Critical Care Tower, Baltimore, U.S.A;10 Research Laboratory and International Collaboration, Bon Secours Cancer Institute, VA, USA.✉ Corresponding author: Paul Zarogoulidis, M.D, Ph. D, Pulmonary Department-Oncology Unit, “G. Papanikolaou” General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece Fax: 00302310992424 Mobile: 00306977271974 E-mail: pzarog@hotmail.com* Paul Zarogoulidis, Wolfgang Hohenforst-Schmidt, Haidong Huang and Chong Bai contributed equally to this work.\n\nCompeting Interests: The authors have declared that no competing interest exists.\n\n2017 4 6 2017 8 9 1673 1678 3 2 2017 3 5 2017 © Ivyspring International Publisher2017This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions.Introduction: Lung cancer is still the leading cause of cancer among cancer patients. Although there are novel therapies as second line treatment for NSCLC, there is an issue for elderly patients. Patients and Methods: We collected retrospectively data from 60 patients >75 years of age. Thirty of these patients received nab-paclitaxel and first line treatment and were compared to thirty patients that received only best supportive care. Results: The median life of patients at the date of disease progression, although increased by the administration of the drug (92 days versus 70) was not confirmed statistically significantly (Mann-Whitney test: W = 280, p = 0.138). The administration of drug seems to keep stable the biological condition of patients (McNemar's test: χ2 = 0.033, p = 0.99). Patients with chemotherapy the death rate was increased by 50% as compared to those with best supportive care (12 vs 8), the median life until the unfortunate event surpassed statistically significantly the latter (150 days of life as compared to 108, Mann-Whitney test: W = 57.5, p = 0.045). Discussion: Nab-paclitaxel as a monotherapy could be considered as a first line treatment option for patients > 75 years of age without any previous cardiological medical history when compared to best supportive care.\n\nNSCLCnab-paclitaxelAbraxaneadenocarcinomasquamuschemotherapy.\n==== Body\nIntroduction\nLung cancer still remains the leading cause of death among cancer patients with an increasing rate among women. 1 Lung cancer is still underdiagnosed due to the lack of early disease symptoms and blood markers. A hallmark in late stage disease for non-small cell lung cancer was the discovery of targeted therapy with tyrosine kinase inhibitors (TKIS) for adenocarcinoma as first line treatment.2 Later on immunotherapy followed as second line treatment for adenocarcinoma and squamous cell carcinoma.3 It is known that non-specific cytotoxic agents induce adverse effects and therefore it is of benefit for the patient if possible to receive a treatment without adverse effects or less than those observed with chemotherapy.4 Recently afatinib was approved as second line treatment for squamous cell carcinoma, providing to treating physicians an additional less toxic therapy.5 Currently an issue that treating physicians have to cope with is the group of the elderly patients more than 75 years of age which are newly diagnosed and cannot receive targeted therapy. Although we have several treatment choices for second line treatment we do not have many choices for first line treatment. Regarding which patient is considered elder, we have observed through the published literature that for Europe the elderly are considered those >75, but for US >65 years of age. 6, 7 Performance status is very important and in most cases the choice of treatment for the elderly is based on this. There are data regarding second line treatment with nab-paclitaxel as second line treatment for the elderly, however; there are no data regarding whether it could be used as first line treatment.8 Moreover; there are recently published data regarding the efficacy of nab-paclitaxel in combination with carboplatin for non-small cell lung cancer.9 Nab-paclitaxel belongs to the taxane family, however; it is designed in a so that it has a local sustain release effect and deep penetration in tumor tissue. Moreover; it is faster diffused within cancer tissue than normal tissue.10 Regarding the elderly patients there are still no data regarding nab-paclitaxel as first line treatment and this is what we investigated in our retrospective study.\n\nPatients and Methods\nAll patients met the following inclusion criteria: 1) they had a histologic or cytologic diagnosis of stage IV NSCLC, 2) they were ≥ 75 years, 3) they had an Eastern Cooperative Oncology Group PS #2, 4) they had not received our first-line chemotherapy or targeted therapy, 5) no known heart disease and ejection fraction ≥ 40% and 6) they had measurable disease as defined by Response Evaluation Criteria in Solid Tumors (RECIST).11 Patients were excluded if they had symptomatic brain metastases or preexisting peripheral neuropathy (grade 1 or higher) and symptomatic heart disease. We could not evaluate elderly patients by comprehensive geriatric assessment due to some patients with unknown sociodemographic factors. Our study was approved by the investigational review board (IRB) of our hospital “G. Papanikolaou” University General Hospital, as a retrospective study. Informed consent for every patient is always acquired upon initiation of the patient therapy.\n\nNab-paclitaxel was administered weekly on days 1, 8, and 15, followed by 2 weeks of rest. This mode of administration has been previously used.12 Treatment was repeated every 5 weeks until disease progression or unacceptable toxicity. A dose of 100 mg/m2 was administered for ~30 minutes with corticosteroid and antihistamine premedication as per our hospitals protocol. The protocol recommended that if patients experienced grade 3 or 4 neutropenia or thrombocytopenia during treatment, they should receive a subcutaneous injection of granulocyte colony-stimulating factor or epoetin alfa to address such hematological toxicities.\n\nThe primary efficacy end point was overall response rate (ORR), defined as the percentage of patients having either a complete response (CR) or a partial response (PR), determined according to the RECIST guidelines.11 Secondary efficacy end points included disease control rate (DCR; defined as the percentage of patients with stable disease [SD] for 16 weeks and CR and PR), progression-free survival (PFS; defined as the time from treatment to the objective progression of disease), and overall survival (OS; defined as the time from treatment to death). Response assessments were performed every 5 weeks with a chest x-ray and every 5 weeks according to RECIST. All patients had a baseline computed tomography (CT) examination of the chest and a reassessment every 4 treatment cycles. Hematologic (every week after each treatment) and imaging examinations (every 5 weeks with chest x-ray) were routinely performed during treatment with nab-paclitaxel. The safety end points were as follows: 1) the incidence of treatment-related AEs based on National Cancer Institute Common Toxicity Criteria Version 2.0, 2) laboratory abnormalities, and 3) serious AEs.\n\nAll analyses were performed using statistical software.\n\nResults\nWe retrospectively reviewed 60 patients with Stage IV, 30 who received nab-paclitaxel as first-line treatment and 30 without (best supportive care) from March 2016 to January 2017 in the “G. Papanikolaou” General Hospital, Thessaloniki, Greece.\n\nThe median life of patients at the date of disease progression, although increased by the administration of the drug (92 days versus 70) was not confirmed statistically significantly (Mann-Whitney test: W = 280, p = 0.138). Figure 1 shows the distribution of patients from both treatments as they affected time of progression and survival time.\n\nIn contrast, although in patients with chemotherapy the death rate was increased by 50% as compared to those with best supportive care (12 vs 8), the median life until the unfortunate event surpassed statistically significantly the latter (150 days of life as compared to 108, Mann-Whitney test: W = 57.5, p = 0.045).\n\nIt is worthy to mention that women patients belonging to the conventional group, recorded a shorter lifespan than mean. Gender seems to play an important role in the life of patients and only in the supportive care group. Indeed, this group in Figure 2 is distinguished by a clear reduction of the median survival time of women (50 days), 2.5 times lower than that of men (127.5 days). It is reminded, that two medians whose intequartiles (boxes) do not overlap, they differ statistically significantly. This striking effect does not occur when disease progress matters.\n\nThe administration of drug seems to keep stable the biological condition of patients or at least that does not worsen (McNemar's test: χ2 = 0.033, p = 0.99, Table 1). In fact, as shown by the cross-tabulated frequencies of both performance statuses PS (upon initiation and follow up), the patients have not deteriorated after using the drug. 12 patients remained steadily in good condition before and after (00), 7 aggravated their health, 8 improved their profile from 1 to 0, while 3 patients did not switch from bad condition 11.\n\nThe condition of patients in the conventional group showed a significant deterioration (McNemar's test: χ2 = 4.5, p = 0.034). According to their performance status (Table 2, cross-tabulated frequencies), of the 30 patients, 4 remained in good health until disease progression (00), 14 showed signs of deterioration (01), 4 improved their condition (10) and 8 did not change from bad condition (11).\n\nAnother notable difference between the two protocols is found in the metastasis detection points after inspecting the disease progression. Figure 3 easily reveals that lung metastases prevail exclusively in patients with chemotherapy, spotted in 11 out of 25 (44%) and totaling up to 27.5% of 40 investigated patients. On the other hand the incidence of metastasis in brain (2) and bones (3) is nearly a unique event in patients treated with the conventional protocol. Tables 3-4.\n\nDiscussion\nNab-paclitaxel has been used for several cancers 12 such as; breast cancer and pancreatic cancer 13, 14. Moreover; in a recent publication by Solimann HH. et al. 15 it is suggested that nab-paclitaxel could enhance the efficacy of checkpoint inhibitors such as; immunotherapeutic agents. In another study by Li Z. et al.\n16 it was observed that increased expression of Secreted Protein Acidic and Rich in Cysteine (SPARC) in gastric cancer was a prognostic factor for worse treatment result. The same observation was made for rectal cancer 17. In the study by Kurtul N. et al.\n18 increased SPARC expression was associated with poor prognosis when patients were treated with nab-paclitaxel and concurrent radiotherapy. In the study by Kaira K. et al. 19 a combination of carboplatin and nab-paclitaxel plus radiotherapy was administered as first line in unresectable stage III NSCLC with safety and efficacy in patients ≤65 years of age. Nab-paclitaxel can be used in NSCLC as first line treatment as an alternative to best supportive care in the group of the “elderly” ≥75 years of age. In our study the number of patients is small (60) and the number of adenocarcinoma patients is even smaller (only 12/30NSCLC) in order to observe a clear difference of survival benefit between squamous cell carcinoma and adenocarcinoma (most common diagnosis). Certainly there is a survival benefit from the monotherapy administered. Treating physicians should always considered not only the adverse effects that will follow from a chemotherapy treatment but, also the performance status that will deteriorate when a patient is left without any primary treatment. A balance between therapy and adverse effects is necessary. The cardiac adverse effects in 3 patients receiving nab-paclitaxel occurred within 24 hours of administration and they were considered acute and since the patients were hospitalized they were treated immediately. These patients underwent coronary angiography and where necessary they were treated according to their indication by the cardiologists of our institution. Prior to the medication administration they did not have symptoms/signs of coronary disease as described in the patients and methods section they fulfilled the criteria for inclusion in our study. Our main issues observed in the best support care group was pleural effusion which could not always be dealt with pleurodesis and multiple hospitilisations due to malnutrition and respiratory distress. On the other hand we had two deaths which were attributed to nab-paclitaxel, however; these two patients did not have a previous coronary vessel evaluation. Heart ultrasound which was indeed requested by each patient before chemotherapy evaluation is not enough for this group of patients (elderly). Balancing this information we should check the number of patients that had adverse effects in the best supportive group because they did not receive any therapy. Pericarditis, pleural effusion, malnutrition from enlarged lymph nodes (number 7) and heart tamponade that occurred in these patients, because they did not receive any primary treatment. Jejunostomy which could be applied, is not always acceptable by the patient and there are cases which where the performance status of the patient deteriorates also from the application of this mode of nutrition. Furthermore; hematologic (every week after each treatment) evaluation is indeed necessary for every patient and moreover; the hematologic adverse effects were not as severe as expected. More clinical studies are needed in order to establish chemotherapy monotherapy with nab-paclitaxel for the elderly ≥75 years of age, or probably to a subgroup of these patients. Current data indicate that it can be used when compared to best support care.\n\nThis study was supported by Project of Shanghai Municipal Health Bureau (Grant number: 20124166). Project of New Clinical Technology Development of Changhai Hospital (Grant number: NT201506).\n\nFigure 1 Βoxplots describing the evolution of patients based on the two protocols.\n\nFigure 2 Boxplots describing the interactive effects between patient protocols and sex during the course of the disease process (left) and life (right).\n\nFigure 3 Distribution of identifying signs of metastases in patients of both protocols. TTP2= time to progression; 1) Brain, 2) Bone, 3)Belly, 4) Chest, 5) Combination\n\nTable 1 Cross-tabulation of patients submitted to chemotherapy showing particular performance status upon initiation (PS1) and upon followup (PS2). 0=good condition and 1= moderate to bad condition\n\nPS1\tPS2\tAll\t\n0\t1\t\n0\t12\t7\t19\t\n1\t8\t3\t11\t\nAll\t20\t10\t30\t\nTable 2 Cross-tabulation of patients in the conventional group showing particular performance status upon initiation (PS1) and upon followup (PS2). 0=good condition and 1= moderate to bad condition\n\nPS1\tPS2\tAll\t\n0\t1\t\n0\t4\t14\t18\t\n1\t4\t8\t12\t\nAll\t8\t22\t30\t\nTable 3 Baseline Characteristics\n\nClinical features\tNab-Paclitaxel Group\tBest Supportive Care\t\nSex\t\t\t\nMale\t27\t18\t\nFemale\t3\t12\t\nAge\t77.63\t77.76\t\nPS 0 upon diagnosis\t19\t6\t\nPS 1 upon diagnosis\t11\t24\t\nPS 0 upon follow up\t18\t23\t\nPS 1 upon follow up\t12\t7\t\nTable 4 Adverse effects\n\n\tNab-Paclitaxel Group\tBest Supportive Care\t\nCardiac\t3\t6\t\nDysphagia\t1\t9\t\nNeutropenia\t5\t0\t\nThrombocytopenia\t9\t0\t\nAlopecia\t21\t0\t\nFatigue\t15\t9\t\nHypersensitivity\t1\t0\t\n*Regarding neutropenia and thrombocytopenia the numbers reflect the number of patients that presented these adverse effects and not the number of subcutaneous injections\n==== Refs\n1 Siegel RL Miller KD Jemal A Cancer Statistics, 2017 CA: a cancer journal for clinicians 2017 doi:10.3322/caac.21387 \n2 Domvri K Zarogoulidis P Darwiche K Browning RF Li Q Turner JF Molecular Targeted Drugs and Biomarkers in NSCLC, the Evolving Role of Individualized Therapy Journal of Cancer 2013 4 736 54 doi:10.7150/jca.7734 24312144 \n3 Cortinovis DL Canova S Abbate M Colonese F Bidoli P Focus on Nivolumab in NSCLC Frontiers in medicine 2016 3 67. doi:10.3389/fmed.2016.00067 28018902 \n4 Hong C Mei T Wang J [Intercalated Combination of Chemotherapy and EGFR-TKIs versus Chemotherapy Alone in the First-line Treatment of Advanced Non-small Cell Lung Cancer: A Meta-analysis] Zhongguo fei ai za zhi = Chinese journal of lung cancer 2016 19 837 46 doi:10.3779/j.issn.1009-3419.2016.12.06 27978869 \n5 Keating GM Afatinib: A Review in Advanced Non-Small Cell Lung Cancer Targeted oncology 2016 11 825 35 doi:10.1007/s11523-016-0465-2 27873136 \n6 Saint-Jean O LeGuen J [Geriatric intervention in oncology for elderly patients] Cancer radiotherapie: journal de la Societe francaise de radiotherapie oncologique 2015 19 377 81 doi:10.1016/j.canrad.2015.07.017 26344438 \n7 Hohenforst-Schmidt W Zarogoulidis P Steinheimer M Benhassen N Tsiouda T Baka S Tyrosine Kinase Inhibitors for the Elderly Journal of Cancer 2016 7 687 93 doi:10.7150/jca.14819 27076850 \n8 Jin F Zhu H Shi F Kong L Yu J A retrospective analysis of safety and efficacy of weekly nab-paclitaxel as second-line chemotherapy in elderly patients with advanced squamous non-small-cell lung carcinoma Clinical interventions in aging 2016 11 167 73 doi:10.2147/CIA.S97363 26929611 \n9 Langer CJ Hirsh V Ko A Renschler MF Socinski MA Weekly nab-paclitaxel in combination with carboplatin as first-line therapy in patients with advanced non-small-cell lung cancer: analysis of safety and efficacy in patients with renal impairment Clinical lung cancer 2015 16 112 20 doi:10.1016/j.cllc.2014.09.003 25572008 \n10 ABRAXANE® for Injectable Suspension (paclitaxel protein-bound particles for injectable suspension) (albumin-bound) FDA https://www.accessdata.fda.gov/drugsatfda_docs/label/2013/021660s037lbl.pdf \n11 Therasse P Arbuck SG Eisenhauer EA Wanders J Kaplan RS Rubinstein L New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada Journal of the National Cancer Institute 2000 92 205 16 \n12 Miyauchi E Inoue A Usui K Sugawara S Maemondo M Saito H Fujita Y Kato T Suzuki T Harada T Watanabe H Nakagawa T Ichinose M Phase II Study of Modified Carboplatin Plus Weekly Nab-Paclitaxel in Elderly Patients with Non-Small Cell Lung Cancer: North Japan Lung Cancer Study Group Trial 1301 Oncologist 2017 doi: 10.1634/theoncologist.2017-0059 \n13 Zong Y Wu J Shen K Nanoparticle albumin-bound paclitaxel as neoadjuvant chemotherapy of breast cancer: a systematic review and meta-analysis Oncotarget 2017 doi:10.18632/oncotarget.14477 \n14 Ghosn M Ibrahim T Assi T El Rassy E Kourie HR Kattan J Dilemma of first line regimens in metastatic pancreatic adenocarcinoma World journal of gastroenterology 2016 22 10124 30 doi:10.3748/wjg.v22.i46.10124 28028360 \n15 Soliman HH nab-Paclitaxel as a potential partner with checkpoint inhibitors in solid tumors OncoTargets and therapy 2017 10 101 12 doi:10.2147/OTT.S122974 28053544 \n16 Li Z Li AD Xu L Bai DW Hou KZ Zheng HC SPARC expression in gastric cancer predicts poor prognosis: Results from a clinical cohort, pooled analysis and GSEA assay Oncotarget 2016 7 70211 22 doi:10.18632/oncotarget.12191 28053291 \n17 Kurtul N Tasdemir EA Unal D Izmirli M Eroglu C SPARC: As a prognostic biomarker in rectal cancer patients treated with chemo-radiotherapy Cancer biomarkers section A of Disease markers 2016 doi:10.3233/CBM-161733 \n18 Kurtul N Eroglu C Unal D Tasdemir EA Orhan O Zararsiz G Prognostic value of SPARC expression in unresectable NSCLC treated with concurrent chemoradiotherapy Asian Pacific journal of cancer prevention: APJCP 2014 15 8911 6 25374228 \n19 Kaira K Tomizawa Y Imai H Sakurai R Matsuura M Yoshii A Phase I study of nab-paclitaxel plus carboplatin and concurrent thoracic radiotherapy in patients with locally advanced non-small cell lung cancer Cancer chemotherapy and pharmacology 2016 doi:10.1007/s00280-016-3217-1\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1837-9664",
"issue": "8(9)",
"journal": "Journal of Cancer",
"keywords": "Abraxane; NSCLC; adenocarcinoma; chemotherapy.; nab-paclitaxel; squamus",
"medline_ta": "J Cancer",
"mesh_terms": null,
"nlm_unique_id": "101535920",
"other_id": null,
"pages": "1673-1678",
"pmc": null,
"pmid": "28775787",
"pubdate": "2017",
"publication_types": "D016428:Journal Article",
"references": "27076850;26344438;10655437;28061451;27978869;28055103;28018902;28526722;28053291;25572008;27995307;28009327;26929611;25374228;28028360;28053544;24312144;27873136",
"title": "Nab-paclitaxel as First Line Treatment for NSCLC in Elderly Patients More Than 75 Years Old.",
"title_normalized": "nab paclitaxel as first line treatment for nsclc in elderly patients more than 75 years old"
} | [
{
"companynumb": "GR-CELGENEUS-GRC-2017028510",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": "3",
... |
{
"abstract": "It has been demonstrated that sustained virological response (SVR) in patients with chronic hepatitis C indicates resolution of infection. We describe a late hepatitis C virus (HCV) relapse with nearly identical HCV genotype 1a RNA, 14 months after a SVR achievement following a 12-month pegylated-interferon plus ribavirin treatment in a human immunodeficiency virus (HIV) infected patient. This virological relapse occurred concomitantly with interruption of highly active antiretroviral therapy and subsequent increased immunosuppression. HCV retreatment was successful and HCV RNA was undetectable at 50 months of follow-up. This case suggests that late relapse of HCV infection in HIV-positive patients with SVR is possible in case of increased immunodeficiency related to highly active antiretroviral therapy interruption. In such circumstances, a close monitoring of HCV viremia and aminotransferases should be performed.",
"affiliations": "URMITE UM 63 CNRS 7278 IRD 198 INSERM 1095, Facultés de Médecine et de Pharmacie, Aix-Marseille Univ., Marseille Cedex 05, France.",
"authors": "Colson|Philippe|P|;Bregigeon|Sylvie|S|;Tourres|Christian|C|;Solas|Caroline|C|;Poizot-Martin|Isabelle|I|;Tamalet|Catherine|C|",
"chemical_list": "D000998:Antiviral Agents; D016898:Interferon-alpha; D012367:RNA, Viral; D012254:Ribavirin",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1386-6532",
"issue": "58(1)",
"journal": "Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology",
"keywords": "HCV recurrence; HIV–HCV coinfection; Hepatitis C virus; Pegylated-interferon alpha plus ribavirin therapy",
"medline_ta": "J Clin Virol",
"mesh_terms": "D000998:Antiviral Agents; D016000:Cluster Analysis; D005838:Genotype; D015658:HIV Infections; D015497:HIV-1; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D016898:Interferon-alpha; D008297:Male; D008875:Middle Aged; D010802:Phylogeny; D012367:RNA, Viral; D012008:Recurrence; D012254:Ribavirin; D017422:Sequence Analysis, DNA",
"nlm_unique_id": "9815671",
"other_id": null,
"pages": "309-14",
"pmc": null,
"pmid": "23810614",
"pubdate": "2013-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Relapse of hepatitis C virus after 14 months of sustained virological response following pegylated-interferon alpha plus ribavirin therapy in a human immunodeficiency virus type 1 infected patient.",
"title_normalized": "relapse of hepatitis c virus after 14 months of sustained virological response following pegylated interferon alpha plus ribavirin therapy in a human immunodeficiency virus type 1 infected patient"
} | [
{
"companynumb": "FR-MYLANLABS-2017M1005621",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LAMIVUDINE"
},
"drugadditional": "3",
... |
{
"abstract": "Every fifth patient with ulcerative colitis (UC) experiences severe acute flare at some point in the course of the disease. Corticosteroids (Cs) remain the treatment of choice in acute flare. Data on the efficacy of first intravenous Cs in the long-term prognosis of UC are scarce and were investigated here.\nAll episodes of patients with acute UC admitted to Tampere University Hospital and treated with intravenous Cs between January 2007 and January 2016 were identified from patient records and reviewed. The risks for colectomy and for continuous use of Cs were evaluated. Predictive factors were analysed.\nThe study comprised 217 patients of whom 184 (85%) responded to intravenous Cs at index flare. Of the 33 non-responders, 31 (94%) were treated with intravenous cyclosporine A and 28 responded. Five (2.3%) patients needed emergency colectomy. Twenty-six (12%) patients underwent colectomy within 1 year of index flare. Overall colectomy rate was 56 (26%) during follow-up (median 7.5 years, range 0.1-10.5). Six months after index flare 66 (30%) patients were still on steroids. In this series 149 (69%) required further Cstherapy and 104 (48%) needed rehospitalization for new flare at some point during follow-up. Overall 155 patients were treated with thiopurines, of whom 72% within the first year after admission. A total of 36 patients had infliximab as a first-line biological treatment, nine needed second-line therapy with adalimumab or vedolizumab after infliximab failed.\nAlthough intravenous Cs were efficient in inducing clinical response in patients with severe acute UC, only one fifth maintained remission in the long term. Two-thirds of patients required further Cs and the overall colectomy rate remained at 26%. High relapse rate indicates the need for closer monitoring of these patients. Enhancement of maintenance therapy should be considered at early stage after acute flare.",
"affiliations": "Department of Gastroenterology and Alimentary Tract Surgery, Tampere University Hospital, Tampere, Finland.;Department of Gastroenterology and Alimentary Tract Surgery, Tampere University Hospital, Tampere, Finland.;Department of Gastroenterology and Alimentary Tract Surgery, Tampere University Hospital, Tampere, Finland.;Faculty of Social Sciences, Tampere University, Tampere, Finland.;Department of Gastroenterology and Alimentary Tract Surgery, Tampere University Hospital, Tampere, Finland.;Department of Gastroenterology and Alimentary Tract Surgery, Tampere University Hospital, Tampere, Finland.",
"authors": "Eronen|Heli|H|;Ilus|Tuire|T|;Jussila|Airi|A|;Huhtala|Heini|H|https://orcid.org/0000-0003-1372-430X;Collin|Pekka|P|;Oksanen|Pia|P|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D007166:Immunosuppressive Agents; D016572:Cyclosporine; D000069285:Infliximab",
"country": "England",
"delete": false,
"doi": "10.1080/00365521.2020.1867892",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0036-5521",
"issue": "56(3)",
"journal": "Scandinavian journal of gastroenterology",
"keywords": "Severe ulcerative colitis; clinical outcome; colectomy; corticosteroid; cyclosporin",
"medline_ta": "Scand J Gastroenterol",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D003082:Colectomy; D003093:Colitis, Ulcerative; D016572:Cyclosporine; D006801:Humans; D007166:Immunosuppressive Agents; D000069285:Infliximab; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "0060105",
"other_id": null,
"pages": "234-238",
"pmc": null,
"pmid": "33496198",
"pubdate": "2021-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Long-term outcome of patients with acute ulcerative colitis after first course of intravenous corticosteroids.",
"title_normalized": "long term outcome of patients with acute ulcerative colitis after first course of intravenous corticosteroids"
} | [
{
"companynumb": "FI-CELLTRION INC.-2021FI001692",
"fulfillexpeditecriteria": "1",
"occurcountry": "FI",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "3",
... |
{
"abstract": "We recently experienced 2 young adult patients who developed ischemic stroke after regular intravenous immunoglobulin (IVIg) therapy for agammaglobulinemia with diagnosis of common variable immunodeficiency (CVID) in their childhood. Patient 1 was 26-year-old woman, who developed Wallenberg's syndrome 6 days after the last IVIg therapy, but had no further stroke recurrence with cilostazol later. Patient 2 was 37-year-old man, who developed recurrent cerebral infarction in the territory of bilateral lenticulostriate branches like branch atheromatous disease (BAD) several days after the IVIg therapy. However, he had no further stroke recurrence after bone marrow transplantation (BMT) therapy for his lymphoproliferative disorder. It was suggested that IVIg therapy was associated to these different types of ischemic stroke in our 2 young adult patients with minimal vascular risk factors. Although IVIg therapy is widely used as a relatively safe medication for immunodeficiency disorders or autoimmune diseases, we need to pay more attention to stroke occurrence with regular IVIg therapy.",
"affiliations": "Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.;Department of Neurology, Kurashiki Heisei Hospital, Okayama, Japan.;Department of Pediatrics and Developmental Biology, Tokyo Medical and Dental University, Tokyo, Japan.;Department of Neurology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan. Electronic address: yumikonakano@okayama-u.ac.jp.",
"authors": "Nakano|Yumiko|Y|;Hayashi|Takeshi|T|;Deguchi|Kentaro|K|;Sato|Kota|K|;Hishikawa|Nozomi|N|;Yamashita|Toru|T|;Ohta|Yasuyuki|Y|;Takao|Yoshiki|Y|;Morio|Tomohiro|T|;Abe|Koji|K|",
"chemical_list": "D016756:Immunoglobulins, Intravenous",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-510X",
"issue": "361()",
"journal": "Journal of the neurological sciences",
"keywords": "Agammaglobulinemia; Intravenous immunoglobulin; Stroke; Thrombotic complication",
"medline_ta": "J Neurol Sci",
"mesh_terms": "D000328:Adult; D000361:Agammaglobulinemia; D002545:Brain Ischemia; D017074:Common Variable Immunodeficiency; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D014854:Lateral Medullary Syndrome; D008297:Male; D012008:Recurrence; D020521:Stroke",
"nlm_unique_id": "0375403",
"other_id": null,
"pages": "9-12",
"pmc": null,
"pmid": "26810508",
"pubdate": "2016-02-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Two young stroke patients associated with regular intravenous immunoglobulin (IVIg) therapy.",
"title_normalized": "two young stroke patients associated with regular intravenous immunoglobulin ivig therapy"
} | [
{
"companynumb": "JP-BAYER-2016-064069",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "WARFARIN"
},
"drugadditional": null,
"d... |
{
"abstract": "BACKGROUND The introduction of immunotherapy in the management of metastatic lung cancer appears to be changing their natural history. Most patients tolerate immunotherapy without any significant adverse events. Nevertheless, a significant number of patients still experience adverse effects. Autoimmune hemolytic anemia has been described as mostly related to warm autoantibodies. The following case report describes cold agglutinin disease with hemolysis secondary to Pembrolizumab therapy for the treatment of metastatic lung cancer. CASE REPORT A 58-year-old woman noted a left neck mass 4 months prior to her presentation. A biopsy confirmed the presence of metastatic adenocarcinoma, consistent with primary lung cancer. Further evaluation revealed the tumor to be PDL-1-positive. She was started on Pembrolizumab, Pemetrexed, and carboplatin chemotherapy regimen. Her CBC was within normal limits when she started therapy, but within 4 weeks hemoglobin dropped to 4.3 g/dL. Further evaluation showed high cryoglobulin levels and a high cold agglutinin titer. Complement C3 DAT was positive. A peripheral smear showed clumps of red cells and the serum IgM was elevated. The diagnosis of CAD was made. She was then started on Rituximab. Imaging showed a significant response, with decreased disease burden. CONCLUSIONS Our case shows a unique presentation of CAD, initially presumed to be myelosuppression secondary to chemotherapy. Instead, a peripheral smear revealed Pembrolizumab to be the cause of cold agglutinin disease. Due to the relatively unknown association between these 2 entities, patient care was delayed. Finally, after initiation of Rituximab therapy, the patient's CBC began to recover.",
"affiliations": "Department of Internal Medicine, Unity Health, Searcy, AR, USA.;Department of Internal Medicine, Duke University, Durham, NC, USA.;College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR, USA.;Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR, USA.;Department of Hematology and Oncology, Baylor University, Houston, TX, USA.;Department of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR, USA.",
"authors": "Atiq|Osman|O|;Atiq|Saad O|SO|;Atiq|Zainab O|ZO|;Patel|Vijay|V|;Atiq|Mohammad O|MO|;Atiq|Omar T|OT|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D003450:Cryoglobulins; D000069283:Rituximab; C582435:pembrolizumab",
"country": "United States",
"delete": false,
"doi": "10.12659/AJCR.924283",
"fulltext": "\n==== Front\nAm J Case Rep\nAm J Case Rep\namjcaserep\nThe American Journal of Case Reports\n1941-5923 International Scientific Literature, Inc. \n\n32887867\n10.12659/AJCR.924283\n924283\nArticles\nPembrolizumab-Induced Cold Agglutinin Disease\nAtiq Osman DEFG1 Atiq Saad O. EF2 Atiq Zainab O. E3 Patel Vijay B4 Atiq Mohammad O. E5 Atiq Omar T. BDE6 \n1 Department of Internal Medicine, Unity Health, Searcy, AR, U.S.A.\n\n2 Department of Internal Medicine, Duke University, Durham, NC, U.S.A.\n\n3 College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR, U.S.A.\n\n4 Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR, U.S.A.\n\n5 Department of Hematology and Oncology, Baylor University, Houston, TX, U.S.A.\n\n6 Department of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR, U.S.A.\nCorresponding Author: Osman Atiq, e-mail: Osman.atiq@unity-health.orgAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\n\n2020 \n05 9 2020 \n21 e924283-1 e924283-4\n14 3 2020 25 6 2020 31 7 2020 © Am J Case Rep, 20202020This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Patient: Female, 58-year-old\n\nFinal Diagnosis: Cold agglutinin disease • lung adenocarcinoma\n\nSymptoms: Anemia • fatigue • GI bleeding • neck mass • thrombocytopenia\n\nMedication:—\n\nClinical Procedure: —\n\nSpecialty: Hematology • General and Internal Medicine • Oncology\n\nObjective:\nUnusual clinical course\n\nBackground:\nThe introduction of immunotherapy in the management of metastatic lung cancer appears to be changing their natural history. Most patients tolerate immunotherapy without any significant adverse events. Nevertheless, a significant number of patients still experience adverse effects. Autoimmune hemolytic anemia has been described as mostly related to warm autoantibodies. The following case report describes cold agglutinin disease with hemolysis secondary to Pembrolizumab therapy for the treatment of metastatic lung cancer.\n\nCase Report:\nA 58-year-old woman noted a left neck mass 4 months prior to her presentation. A biopsy confirmed the presence of metastatic adenocarcinoma, consistent with primary lung cancer. Further evaluation revealed the tumor to be PDL-1-positive. She was started on Pembrolizumab, Pemetrexed, and carboplatin chemotherapy regimen. Her CBC was within normal limits when she started therapy, but within 4 weeks hemoglobin dropped to 4.3 g/dL. Further evaluation showed high cryoglobulin levels and a high cold agglutinin titer. Complement C3 DAT was positive. A peripheral smear showed clumps of red cells and the serum IgM was elevated. The diagnosis of CAD was made. She was then started on Rituximab. Imaging showed a significant response, with decreased disease burden.\n\nConclusions:\nOur case shows a unique presentation of CAD, initially presumed to be myelosuppression secondary to chemo-therapy. Instead, a peripheral smear revealed Pembrolizumab to be the cause of cold agglutinin disease. Due to the relatively unknown association between these 2 entities, patient care was delayed. Finally, after initiation of Rituximab therapy, the patient’s CBC began to recover.\n\nMeSH Keywords:\nAnemia, Hemolytic, AutoimmuneImmunotherapyLung Neoplasms\n==== Body\nBackground\nCold agglutinin disease (CAD) is the second most common cause of autoimmune hemolytic anemia. However, the average time to diagnose a patient with CAD is 37.4 months [1]. CAD is mostly associated with infections, autoimmune disease, and malignancies. While it has been described in patients with various cancers, the association was believed to be incidental rather than secondary to malignancy [1].\n\nThe recent introduction of immunotherapy has revolutionized the treatment of cancer. Tumors use PD-L1 receptors as a means of hiding from the body’s own defense mechanisms – the T cells. Pembrolizumab, a humanized monoclonal antibody, allows the T cells to overcome this defense mechanism by binding to the PD-1 receptor, thereby inhibiting the deactivation of T cells and allowing for the destruction of the tumor cells by T cells. Common adverse effects of immunotherapy include fatigue, pruritis, lymphocytopenia, hyperglycemia, and hypothyroidism. CAD alone had not yet been directly associated with Pembrolizumab therapy.\n\nWe present a unique case of symptomatic hemolytic anemia caused by CAD after undergoing treatment with Pembrolizumab, leading to cessation of treatment; a follow-up PET scan showed complete remission.\n\nCase Report\nA 59-year-old woman with a history of alcohol and tobacco abuse presented with a left neck mass. A CT scan showed a right upper-lung mass with right hilar, right mediastinal, and left supraclavicular lymphadenopathy. Fine-needle aspiration confirmed the presence of metastatic adenocarcinoma. PET-CT and MRI of the brain showed no other metastases. The tumor was negative for EGFR, ALK, ROS1, BRAF, MET, and ERBB2. KRAS-G12A mutation was present. Microsatellite status was stable, and the tumor mutational burden could not be determined. PD-L1 immunohistochemistry showed a Tumor Proportion Score (TPS) of 90%. The patient was started on a regimen of Pembrolizumab, Pemetrexed, and Carboplatin, and was also started on vitamin B12 and folic acid supplementation, per protocol. Baseline CBC, CMP, and TSH were within normal limits, except for a WBC 16.46×103 cells/dL (neutrophils 92.2%, lymphocytes 5.4%, monocytes 1.0%, basophils 0.4%, eosinophils 0.0%), an elevated total bilirubin (3.7 mg/dL) with a direct bilirubin of 0.4 mg/dL, and alkaline phosphatase of 170 IU/L. She tolerated the first cycle of chemotherapy without any reported issues. At the time of her second cycle, 3 weeks later, her hemoglobin (Hgb) had dropped to 8 g/dL, with an MCV of 100.4 and an elevated RDW of 18.8. The WBC remained elevated at 13.2 and platelets remained normal at 401 k. LDH had increased from 187 to 262, while total bilirubin decreased to 1.7 mg/dL. She received her second cycle of treatment as planned. Ten days later, the WBC decreased to 2.8, platelets decreased to 36 k, Hgb was 7.6, and total bilirubin normalized to 1.2, while LDH and MCV decreased to 229 and 87.6, respectively. RDW remained elevated. At the time of the third cycle of therapy, WBC and platelets were normal and Hgb was stable. A week later, she developed melena and Hgb dropped to 6.4 mg/dL, WBC to 2.5, and PLT to 136. She was admitted to the hospital and given PRBCs for symptomatic anemia. EGD showed a Mallory Weiss tear, with oozing of blood and chronic active gastritis/peptic ulcer disease. She was continued on a PPI and discharged. At the time of her fourth and last cycle of therapy, total bilirubin, MCV, WBC, and PLT were normal. LDH and RDW were elevated, with a stable Hgb. PET-CT showed no evidence of disease, except for a right upper-lobe lung lesion measuring 1.7×1.2 cm, with an SUV of 1.4. Three weeks later, her Hgb was 9.6, while her MCV and total bilirubin were normal. She was started on maintenance Pembrolizumab and Pemetrexed. Laboratory values continued to fluctuate as above. She periodically required PRBCs for symptomatic anemia, but there was no evidence of ongoing GI bleeding. Bone marrow evaluation was normal except for being mildly hypocellular. After the fifth cycle of maintenance therapy, she was admitted to the hospital with chest tightness and increased dyspnea. The evaluation was unre-markable and she was discharged upon resolution of symptoms. Treatment was held to allow her to recuperate. A month later, she still required PRBCs almost every 2 weeks, so further hematologic evaluation was undertaken. A peripheral blood smear showed marked red cell agglutination and polychromasia. The retic count was 6.19%, haptoglobin was low-normal at 32 mg/dL, while DAT-poly-specific, IgG, and C3 were positive. Serum protein electrophoresis, ANA antibody panel, PNH panel, and hepatitis profile were normal. Serum IgM was elevated at 259, with normal IgG and IgA. Mycoplasma IgM was negative, but IgG was positive at 0.35U/L. Cryoglobulins were detected at 48 h. Immunofixation showed type II cryoglobulin with monoclonal IgM kappa and polyclonal IgG. Serum IgM cryoprecipitate was elevated at 1 mg/dL, with normal IgG and IgA. The cold agglutinin titer was elevated at 1: 128 and was as high as 1: 512.\n\nA diagnosis of secondary cold agglutinin disease was made. The patient was given steroids, with stabilization of Hgb lasting a couple of weeks, and then the steroids were tapered off. Rituximab was then administered at 375 mg/m2 weekly for 4 weeks, with stabilization and gradual improvement of Hgb over the following several weeks. The patient did not require any further PRBC transfusions. Serum cryoglobulins became undetectable, and the cold agglutinin titer decreased to 1: 64. A follow-up PET-CT showed essentially complete metabolic resolution of lung cancer (Figure 1).\n\nDiscussion\nWe present a case of cold agglutinin disease, secondary to the use of Pembrolizumab, that remitted after treatment with Rituximab. Although there are some case reports describing the association between Nivolumab and CAD, our literature search showed only 1 other possible instance of Pembrolizumab-induced CAD, reported by Okawa et al. [2], which was complicated by the fact that the patient developed hemophagocytic lymphohistiocytosis. Our case is also unique in that there was no other associated autoimmune condition.\n\nUpon review, our patient developed CAD after 2 cycles of treatment with Pembrolizumab. This follows a trend that was reported in treatment with Nivolumab, another PD-1 inhibitor [3]. When these checkpoint inhibitors are used, they typically cause AIHA within 2–8 weeks of therapy [4]. Checkpoint inhibitors, in general, have been associated with warm antibody AIHA rather than CAD [5].\n\nAdmittedly, our patient was not being treated solely with Pembrolizumab when she was diagnosed with CAD. A second drug, Pemetrexed, had been started and stopped alongside Pembrolizumab. However, Pemetrexed has been described in association with warm AIHA rather than CAD [6]. Severe hematologic toxicity has also been reported with Pemetrexed use. We were able to avoid this by supplementing the patient with vitamin B12 and folate, as shown in the early trials of Pemetrexed [6].\n\nOur patient’s ongoing alcoholism lead to an episode of acute gastritis and melena, requiring transfusions of PRBCs. The patient continued to require transfusions and her immuno-chemo-therapy was held, with the intention to restart once the hemoglobin stabilized. However, she continued to require frequent transfusions despite cessation of GI bleeding. A review of her peripheral blood smear proved to be the needed catalyst that led to the diagnosis of Pembrolizumab-induced cold agglutinin disease and its successful management (Figure 2).\n\nConclusions\nThe case described shows a unique example of cold agglutinin disease secondary to the use of Pembrolizumab while treating metastatic lung cancer. Other possible causes were ruled out through laboratory testing and literature review. An early diagnosis may be possible by having a low threshold for review of peripheral blood smear at the earliest suspicion of hemolysis when using Pembrolizumab. As suggested by this case, steroids may be ineffective, and Rituximab should be started early after the diagnosis of CAD secondary to checkpoint blockade. Whether CAD is a marker of long-term remission of an otherwise fatal lung cancer following a few months of Pembrolizumab along with standard chemotherapy therapy is unknown but is an interesting question.\n\nFigure 1. Timeline of events from initial contact until resolution.\n\nFigure 2. Peripheral smear showing agglutination and faint polychromasia. Stained with Wright-Giemsa. 200× magnification.\n==== Refs\nReferences:\n1. Swiecki P Hegerova LT Gertz MA Cold agglutinin disease Blood 2013 122 1114 2 23757733 \n2. Okawa S Kayatani H Fujiwara K Pembrolizumab-induced autoimmune hemolytic anemia and hemophagocytic lympohistiocytosis in non-small cell lung cancer Intern Med 2019 58 699 702 30828042 \n3. Palla AR Kennedy D Mosharraf H Doll D Autoimmune hemolytic anemia as a complication of nivolumab therapy Case Rep Oncol 2016 9 691 97 27920704 \n4. Hasanov M Konoplev SN Hernandez CMR Nivolumab-induced cold agglutinin syndrome successfully treated with rituximab Blood Advances 2018 2 15 1865 68 30072374 \n5. Tanios GE Doley PB Munker R Autoimmune hemolytic anemia associated with the use of immune checkpoint inhibitors for cancer: 68 cases from the Food and Drug Administration database and review Eur J Haematol 2018 102 2 157 62 30347480 \n6. Park GM Han KS Chang YH Immune hemolytic anemia after treatment with pemetrexed for lung cancer J Thorac Oncol 2008 3 2 196 97 18303446\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "1941-5923",
"issue": "21()",
"journal": "The American journal of case reports",
"keywords": null,
"medline_ta": "Am J Case Rep",
"mesh_terms": "D000744:Anemia, Hemolytic, Autoimmune; D061067:Antibodies, Monoclonal, Humanized; D003450:Cryoglobulins; D005260:Female; D006801:Humans; D008875:Middle Aged; D000069283:Rituximab",
"nlm_unique_id": "101489566",
"other_id": null,
"pages": "e924283",
"pmc": null,
"pmid": "32887867",
"pubdate": "2020-09-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "30072374;30347480;18303446;27920704;30828042;23757733",
"title": "Pembrolizumab-Induced Cold Agglutinin Disease.",
"title_normalized": "pembrolizumab induced cold agglutinin disease"
} | [
{
"companynumb": "US-009507513-2010USA008947",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThe incidence of postoperative complications following pacemaker or implantable cardioverter-defibrillator implantations in patients treated with new oral anticoagulation agents has not been studied. Here we present a first comparison of complications after cardiac rhythm device (CRD) implantations in patients with atrial fibrillation (AF) treated with dabigatran or uninterrupted warfarin.\n\n\nRESULTS\nUsing a case-control study design, we compared complications within 30 days after 236 CRD procedures performed under uninterrupted warfarin (n=118) or interrupted dabigatran (n=118).There were no significant differences in the baseline characteristics of both groups. In the warfarin group, 9 (8%) pocket hematomas were observed vs. 3 (3%) in the dabigatran group (P=0.075). Two complications in the warfarin group necessitated surgical intervention as opposed to none in the dabigatran group (P=0.156). The postprocedural blood loss expressed as a drop in hemoglobin was significantly greater in the warfarin group (-0.9±0.7 vs. -0.5±0.4 mmol/L, P=0.023). In the dabigatran group, 1 case of transient ischemic attack occurred. The mean time to hospital discharge was shorter in patients treated with dabigatran (2.5±2.3 vs. 3.8±4.1 days, P=0.02).\n\n\nCONCLUSIONS\nThe incidence and severity of bleeding complications may be lower in patients treated with periprocedurally discontinued dabigatran when compared with uninterrupted warfarin therapy. Further evaluation of peri-interventional complications and establishment of an optimal anticoagulation management protocol are needed.",
"affiliations": "Department of Electrophysiology, Heart Center Leipzig.",
"authors": "Kosiuk|Jedrzej|J|;Koutalas|Emmanuel|E|;Doering|Michael|M|;Nedios|Sotirios|S|;Sommer|Philipp|P|;Rolf|Sascha|S|;Darma|Angeliki|A|;Breithardt|Ole A|OA|;Dinov|Borislav|B|;Hindricks|Gerhard|G|;Richter|Sergio|S|;Bollmann|Andreas|A|",
"chemical_list": "D000991:Antithrombins; D001562:Benzimidazoles; D006454:Hemoglobins; D015091:beta-Alanine; D014859:Warfarin; D000069604:Dabigatran",
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1346-9843",
"issue": "78(10)",
"journal": "Circulation journal : official journal of the Japanese Circulation Society",
"keywords": null,
"medline_ta": "Circ J",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000991:Antithrombins; D001281:Atrial Fibrillation; D001562:Benzimidazoles; D016022:Case-Control Studies; D000069604:Dabigatran; D005260:Female; D006454:Hemoglobins; D006801:Humans; D015994:Incidence; D008297:Male; D008875:Middle Aged; D010138:Pacemaker, Artificial; D019106:Postoperative Hemorrhage; D011446:Prospective Studies; D014859:Warfarin; D015091:beta-Alanine",
"nlm_unique_id": "101137683",
"other_id": null,
"pages": "2402-7",
"pmc": null,
"pmid": "25253506",
"pubdate": "2014",
"publication_types": "D016430:Clinical Trial; D003160:Comparative Study; D016428:Journal Article",
"references": null,
"title": "Comparison of dabigatran and uninterrupted warfarin in patients with atrial fibrillation undergoing cardiac rhythm device implantations. Case-control study.",
"title_normalized": "comparison of dabigatran and uninterrupted warfarin in patients with atrial fibrillation undergoing cardiac rhythm device implantations case control study"
} | [
{
"companynumb": "DE-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2014-BI-06006GD",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "BACKGROUND\nEmphysematous pyelonephritis (EP) is an uncommon acute infection characterized by the presence of gas in the renal parenchyma. It is extremely rare in hemodialysis (HD) patients and diabetics account for most cases. It is a rapidly progressive and life threatening infection with a high mortality rate. We report a case of emphysematous pyelonephritis in a HD patient who was treated successfully with radical nephrectomy and antibiotic therapy.\n\n\nMETHODS\nA 46-year-old diabetic male with end stage renal disease (ESRD) secondary to diabetic nephropathy and on maintenance HD for the last five years presented with a two weeks history of fever and loin pain. He was treated with oral ciprofloxacin for one week with no improvement. His blood culture isolated Escherichia coli. Computed tomography scan of the abdominal disclosed an enlarged left kidney with massive gaseous collections. Accordingly, the diagnosis of emphysematous pyelonephritis was put forward, the patient underwent left nephrectomy together with intravenous imipenum and amikacin with good clinical response. The removed kidney showed features of acute pyelonephritis with micro-abscesses on histopathology. .\n\n\nCONCLUSIONS\nEmphysematous pyelonephritis should always be considered in diabetics presenting with fever, loin pain, and features of sepsis not responding to antibiotic therapy; even though being on dialysis. Computed tomography scan of the abdomen remains an early diagnostic tool. Early treatment with potent antibiotics with or without surgical intervention can save patients' life.",
"affiliations": "Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.;Departement of Nephrology, Fattouma Bourguiba Hospital and University Faculty of Medicine, Monastir, Tunisia.",
"authors": "Hamouda|M|M|;Aloui|S|S|;Skhiri|H|H|;Letaif|A|A|;Frih|M A|MA|;Ben Dhia|N|N|;Elmay|M|M|",
"chemical_list": null,
"country": "Sudan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "7(2)",
"journal": "Arab journal of nephrology and transplantation",
"keywords": null,
"medline_ta": "Arab J Nephrol Transplant",
"mesh_terms": "D048909:Diabetes Complications; D004646:Emphysema; D006801:Humans; D007676:Kidney Failure, Chronic; D008297:Male; D008875:Middle Aged; D011704:Pyelonephritis; D006435:Renal Dialysis",
"nlm_unique_id": "101530790",
"other_id": null,
"pages": "109-11",
"pmc": null,
"pmid": "25366506",
"pubdate": "2014-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Emphysematous pyelonephritis in a diabetic patient on maintenance hemodialysis: a case report.",
"title_normalized": "emphysematous pyelonephritis in a diabetic patient on maintenance hemodialysis a case report"
} | [
{
"companynumb": "TN-BAYER-2014-169658",
"fulfillexpeditecriteria": "1",
"occurcountry": "TN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nBullous pemphigoid (BP) is an autoimmune bullous disease requiring immunosuppressive therapy. Kaposi sarcoma (KS) is an angioproliferative tumor associated with the opportunistic viral infection human herpes virus 8 (HHV-8). It is a well-known condition associated with longstanding human immunodeficiency virus infection, but it may also occur in the context of iatrogenic immunosuppression.\n\n\nOBJECTIVE\nAlthough a rare complication, all dermatologists dealing with immunosuppressors must be aware and have a high index of suspicion when a patient presents with rapidly progressive violaceous papules.\n\n\nRESULTS\nWe describe an Italian male patient treated for bullous pemphigoid with topical and systemic corticosteroids and mycophenolate mofetil (MMF) who developed multifocal cutaneous KS after a few months of therapy.\n\n\nCONCLUSIONS\nTo our knowledge, KS onset associated with MMF and corticosteroids intake for BP treatment has not been reported previously. KS associated with iatrogenic immunosuppression can have an aggressive course, and it must be promptly recognised since cessation of immunosuppression therapy can lead to complete resolution. Immune restoration is the key to control this viral infection.",
"affiliations": "1 Department of Dermatology, Saint-Luc Hospital, Montreal University, Montréal, QC, Canada.;1 Department of Dermatology, Saint-Luc Hospital, Montreal University, Montréal, QC, Canada.",
"authors": "Tremblay|Catherine|C|;Friedmann|Dominique|D|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid; D011241:Prednisone",
"country": "United States",
"delete": false,
"doi": "10.1177/1203475417712247",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1203-4754",
"issue": "21(5)",
"journal": "Journal of cutaneous medicine and surgery",
"keywords": "Kaposi sarcoma; bullous pemphigoid; immunosuppression; mycophenolate mofetil",
"medline_ta": "J Cutan Med Surg",
"mesh_terms": "D000369:Aged, 80 and over; D000893:Anti-Inflammatory Agents; D006801:Humans; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D008297:Male; D009173:Mycophenolic Acid; D010391:Pemphigoid, Bullous; D011241:Prednisone; D012514:Sarcoma, Kaposi; D012878:Skin Neoplasms",
"nlm_unique_id": "9614685",
"other_id": null,
"pages": "449-451",
"pmc": null,
"pmid": "28580800",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Kaposi Sarcoma Associated With Iatrogenic Immunosuppression: A Rare Complication of Bullous Pemphigoid Treatment.",
"title_normalized": "kaposi sarcoma associated with iatrogenic immunosuppression a rare complication of bullous pemphigoid treatment"
} | [
{
"companynumb": "CA-MYLANLABS-2017M1074127",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "Background and Objectives: Sugammadex is a modified γ-cyclodextrin largely used to prevent postoperative residual neuromuscular blockade induced by neuromuscular aminosteroid blocking agents. Although Sugammadex is considered more efficacious and safer than other drugs, such as Neostigmine, significant and serious complications after its administration, such as hypersensitivity, anaphylaxis and, more recently, severe cardiac events, are reported. Case presentation: In this report, we describe the case of an 80-year-old male with no medical history of cardiovascular disease who was scheduled for percutaneous nephrolithotripsy under general anesthesia. The intraoperative course was uneventful; however, the patient developed a rapid and severe hypotension, asystole and cardiac arrest after Sugammadex administration. Spontaneous cardiac activity and hemodynamic stability was restored with pharmacological therapy and chest compression. The patient was stabilized and discharged uneventfully on postoperative day 10. Conclusions: The potential causes of cardiac arrest after Sugammadex administration have been carefully considered, yet all indications point to Sugammadex as the direct causative agent. On the basis of laboratory and clinical tests, we can exclude among the cause of bradycardia, Kounis syndrome, acute myocardial infarction, coronary spasm and other arrhythmias, but not anaphylaxis. Although Sugammadex is considered an increasingly important option in the prevention of postoperative residual neuromuscular blockade, anesthesiologists should consider it a causative agent of cardiac arrest during surgery. This case highlights the necessity of increased pharmacovigilance and further studies to examine Sugammadex safety and mechanism through which it may cause severe bradycardia, hypotension and cardiac arrest.",
"affiliations": "Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Anesthesia and Intensive Care Unit, \"A. Cardarelli\" Hospital, Azienda Sanitaria Regionale del Molise, 86100 Campobasso, Italy.;Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy.;Anesthesia and Intensive Care Unit, \"A. Cardarelli\" Hospital, Azienda Sanitaria Regionale del Molise, 86100 Campobasso, Italy.",
"authors": "Fierro|Carmen|C|0000-0002-1200-2519;Medoro|Alessandro|A|0000-0002-6285-607X;Mignogna|Donatella|D|0000-0002-4314-056X;Porcile|Carola|C|0000-0001-8658-9909;Ciampi|Silvia|S|0000-0002-7193-5060;Foderà|Emanuele|E|0000-0002-7150-9176;Flocco|Romeo|R|;Russo|Claudio|C|;Martucci|Gennaro|G|",
"chemical_list": "D002800:Cholinesterase Inhibitors; D000077122:Sugammadex",
"country": "Switzerland",
"delete": false,
"doi": "10.3390/medicina57010079",
"fulltext": "\n==== Front\nMedicina (Kaunas)\nmedicina\nMedicina\n1010-660X 1648-9144 MDPI \n\n33477765\n10.3390/medicina57010079\nmedicina-57-00079\nCase Report\nSevere Hypotension, Bradycardia and Asystole after Sugammadex Administration in an Elderly Patient\nhttps://orcid.org/0000-0002-1200-2519Fierro Carmen 1 https://orcid.org/0000-0002-6285-607XMedoro Alessandro 1 https://orcid.org/0000-0002-4314-056XMignogna Donatella 1 https://orcid.org/0000-0001-8658-9909Porcile Carola 1 https://orcid.org/0000-0002-7193-5060Ciampi Silvia 1 https://orcid.org/0000-0002-7150-9176Foderà Emanuele 1 Flocco Romeo 2 Russo Claudio 13* Martucci Gennaro 2 1 Department of Medicine and Health Sciences, University of Molise, 86100 Campobasso, Italy; c.fierro@studenti.unimol.it (C.F.); alessandro.medoro@unimol.it (A.M.); donatella.mignogna@studenti.unimol.it (D.M.); carola.porcile@unimol.it (C.P.); s.ciampi@studenti.unimol.it (S.C.); e.fodera@studenti.unimol.it (E.F.)\n2 Anesthesia and Intensive Care Unit, “A. Cardarelli” Hospital, Azienda Sanitaria Regionale del Molise, 86100 Campobasso, Italy; romeoflocco@hotmail.com (R.F.); gennaromart@libero.it (G.M.)\n3 UOC Governance del Farmaco, Azienda Sanitaria Regionale del Molise, 86100 Campobasso, Italy\n* Correspondence: claudio.russo@unimol.it\n19 1 2021 \n1 2021 \n57 1 7930 11 2020 14 1 2021 © 2021 by the authors.2021Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Background and Objectives: Sugammadex is a modified γ-cyclodextrin largely used to prevent postoperative residual neuromuscular blockade induced by neuromuscular aminosteroid blocking agents. Although Sugammadex is considered more efficacious and safer than other drugs, such as Neostigmine, significant and serious complications after its administration, such as hypersensitivity, anaphylaxis and, more recently, severe cardiac events, are reported. Case presentation: In this report, we describe the case of an 80-year-old male with no medical history of cardiovascular disease who was scheduled for percutaneous nephrolithotripsy under general anesthesia. The intraoperative course was uneventful; however, the patient developed a rapid and severe hypotension, asystole and cardiac arrest after Sugammadex administration. Spontaneous cardiac activity and hemodynamic stability was restored with pharmacological therapy and chest compression. The patient was stabilized and discharged uneventfully on postoperative day 10. Conclusions: The potential causes of cardiac arrest after Sugammadex administration have been carefully considered, yet all indications point to Sugammadex as the direct causative agent. On the basis of laboratory and clinical tests, we can exclude among the cause of bradycardia, Kounis syndrome, acute myocardial infarction, coronary spasm and other arrhythmias, but not anaphylaxis. Although Sugammadex is considered an increasingly important option in the prevention of postoperative residual neuromuscular blockade, anesthesiologists should consider it a causative agent of cardiac arrest during surgery. This case highlights the necessity of increased pharmacovigilance and further studies to examine Sugammadex safety and mechanism through which it may cause severe bradycardia, hypotension and cardiac arrest.\n\nSugammadexbradycardiahypotensionasystolecardiac arrestadverse drug reaction\n==== Body\n1. Introduction\nThe modified γ-cyclodextrin Sugammadex is widely used to antagonize the post-operative residual neuromuscular blockade induced by neuromuscular aminosteroid blocking agents (NMBAs), such as Rocuronium bromide or Vecuronium bromide, used in adult anesthesia to ease endotracheal intubation, mechanical ventilation and surgical access. In detail, Sugammadex binds NMBA clearing nicotinic receptors, quickly reversing residual neuromuscular blockade and reducing the risk of postoperative respiratory complications.\n\nSugammadex has been reported to be more efficacious and safer than other drugs, such as Neostigmine, with lower incidence of common adverse drug reactions (ADRs) such as postoperative nausea and vomiting, dry mouth, tachycardia and dizziness [1,2,3]. However, the incidence of significant ADRs is almost similar between Sugammadex and Neostigmine: hypersensitivity, anaphylaxis [4,5] and, more recently, severe cardiac events such as coronary vasospasm and acute coronary syndrome [6,7,8], AV block [9], hypotension [10] and bradycardia with or without cardiac arrest [11,12,13,14] are described. \n\n2. Case Presentation\nIn this report, we describe the case of bradycardia and cardiac arrest after Sugammadex administration in an elderly patient undergoing percutaneous nephrolithotripsy under general anesthesia for renal pelvis and calyceal lithiasis. The patient is an 80-year-old male (158 cm, 55 kg) in polytherapy for hypothyroidism, hyperuricemia, diabetes and chronic obstructive pulmonary disease with 50 mg Levothyroxine, 300 mg Allopurinol, 500 mg Metformin and 322 µg Aclidinium Bromide inhalation, respectively. However, he had no specific past medical history about coronary heart disease or any other cardiovascular disease. The results of preoperative electrocardiogram (ECG), chest X-ray and laboratory tests were normal. The patient went into surgery after premedication with 2 mg Midazolam intravenously (i.v.). Antibiotic prophylaxis was performed with 1 g Cefotaxime i.v.; ECG, noninvasive blood pressure (NIBP), end-tidal carbon dioxide (EtCO2) and oxygen saturation (SpO2) were monitored throughout the surgery. \n\nThe patient’s initial vital signs were: NIBP 120/70 mmHg, SpO2 98% and heart rate 75 beats/min. General mask ventilation was applied with 10% oxygen, and tracheal intubation was done without accident 2 min after Rocuronium administration. General anesthesia was induced with 140 mg Propofol and a total of 30 mg Rocuronium and, after tracheal intubation, was maintained with 2% (v/v) Sevoflurane and 0.3 mg Fentanyl. The second part of the surgery was done in a prone position. The patient’s intraoperative vital signs were maintained within the following ranges: systolic blood pressure: 120–130 mmHg; diastolic blood pressure: 70–80 mmHg, heart rate: 80–110 bpm, SpO2: 100%, EtCO2: 37%. An additional 10 mg Rocuronium was administered during the surgery to maintain muscle relaxation, so the total dose of Rocuronium was 40 mg. The total fluid input was 2500 mL (crystalloids). The intraoperative course was uneventful. \n\nAt the surgery end, the Sevoflurane administration was stopped and, after 5 min, 200 mg Sugammadex was administered to the patient: one minute later he developed severe bradycardia with heart rate below 35 beats/min and systolic blood pressure decreased to below 50 mmHg, and was promptly treated with a total of 10 mg Ephedrine and 1 mg Atropine i.v. to restore normal heart rate and systolic blood pressure. However, the patient’s clinical condition rapidly worsened with the onset of severe hypotension, asystole and cardiac arrest. Concomitant cardiopulmonary resuscitation with chest compression was performed for 1 min, restoring spontaneous cardiac activity and hemodynamic stability; the patient was transferred to the intensive care unit (ICU). Arterial blood gas after resuscitation showed: pH 7.32, PaO2: 126 mmHg, PaCO2: 25 mmHg, base excess: −8.4 mmol/L, HCO3: 19 mmol/L, lactate: 8 mmol/L, Na+: 136 mEq/L, Mg2+: 1.58 mg/dl, K+: 3.1 mEq/L, Ca2+: 7 mEq/L, glucose: 150 mg/dl and hemoglobin: 10.6 g/dl. Cardiac enzymes and troponins were normal, and postoperative cardiac workup including ECG and transthoracic echocardiography did not show any pathological sign. The patient was stabilized with optimal oxygen saturation level and spontaneous respiration during the following 3 days in ICU, transferred to the urology ward on postoperative day 3 and discharged uneventfully on postoperative day 10. \n\n3. Discussion\nThe main clues point to Sugammadex as the cause of bradycardia, hypotension and cardiac arrest, both for the temporal proximity of administration and for the occurrence of similar, albeit rare, reports in the literature [15,16] as well as for the drug therapy used to resuscitate the patient based uniquely to Ephedrine and Atropine. Using the Naranjo nomogram, a 7 point-score (probable) was set to this report (Table 1). \n\nThe Sugammadex data sheet clearly states that “Cases of marked bradycardia, some of which have resulted in cardiac arrest, have been observed within minutes after the administration of [Sugammadex]”. The incidence of marked bradycardia at three different Sugammadex doses (2, 4 and 16 mg/kg) in pooled phase 1–3 patients was respectively 1, 1 and 5%. Although, our patient received a dose closer to 4 mg/kg, according to the Sugammadex prescribing information, this dose should not have conferred higher risk for the ADR observed, considering that low-dose Sugammadex (2 mg/kg) does not seem to protect against the chance that life-threatening bradycardia can occur [15]. Moreover, from 2009 to 2020, 292 cases of major cardiac events were reported after Sugammadex/Sugammadex sodium administration in the FAERS database [16], including bradycardia (n = 159), cardiac arrest (n = 115) and cardio-respiratory arrest (n = 18). In the same timeframe, Neostigmine/Neostigmine bromide or methylsulfate has been associated with 75 events, including bradycardia (n = 39), cardiac arrest (n = 28) and cardio-respiratory arrest (n = 8). The analysis, in the same period, of the frequency of total cardiovascular ADRs in respect to allergic or immune-based events shows very close values (567 vs. 574 ADRs, respectively).\n\nAlthough Sugammadex-induced anaphylaxis is commonly associated with generalized skin rash, wheezing, bronchospasm and tachycardia [4,5] and our patient did not show these clinical signs, allergic-reaction symptoms during anesthesia could be nonspecific, and anaphylaxis-induced cardiovascular collapse has been reported. No other symptoms commonly linked to generalized anaphylaxis (e.g., increased peak inspiratory pressures seen with mechanical ventilation, initial drop in EtCO2 and facial or soft palate edema) were observed in the patient. Considering the absence of information about tryptase level or subsequent allergy testing with Sugammadex, we formally cannot exclude anaphylaxis as the primary cause of cardiac arrest [18]. Nonetheless, the fact that our patient responded to a single dose of Ephedrine and Atropine without a relapse of hemodynamic instability and without having to recourse instead to Epinephrine boluses or drip would suggest a greater likelihood of a direct cardiovascular effect rather than secondary to anaphylaxis. Moreover, in the Summary of Product Information released by EMA [19] it is stated that bradycardia induced by Sugammadex should be treated by an anticholinergic agent such as Atropine.\n\nConversely, no evidence of Kounis syndrome, as recently reported associated with Sugammadex administration, or acute myocardial infarction accompanied by coronary spasm or other arrhythmias were observed [6,7,8], considering the rapid recovery without a relapse of hemodynamic instability, the unnecessity of vasodilators administration and clinical and laboratory normal results during the hours following the cardiac arrest. Moreover, the patient, despite his advanced age, had no medical history of cardiovascular disease or of allergic reactions before this event, unlike patients described in similar reports that are characterized, at least, by hypertension [12,13,14]. Currently, there is no information in the literature about possible drug–drug interaction between Sugammadex and the patient’s polytherapy. \n\n4. Conclusions\nIn conclusion, although Sugammadex provides an important option for anesthesiologists in the prevention of postoperative residual neuromuscular blockade, it should be considered as a causative agent of cardiac arrest during surgery, directly or following anaphylaxis, even at the lowest recommended doses. For this reason, Sugammadex should be administered slowly, always with full ECG and hemodynamic changes monitoring after its administration [18], and anesthesiologists should be more rigorous in their ADRs reporting to pharmacovigilance agencies. Furthermore, it would be desirable to investigate the genetic and molecular mechanisms that induce the cardiovascular effects of Sugammadex in a specific subpopulation of patients.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor Contributions\nC.F., A.M., D.M. and C.R. collected all patient data and drafted the manuscript. C.P., S.C. and E.F. collaborated on manuscript writing. C.F., G.M. and R.F. participated in the care of the patient. All authors gave their comments on the article and approved the final version. All authors have read and agreed to the published version of the manuscript.\n\nFunding\nThis research was funded by AIFA (Agenzia Italiana del Farmaco): Progetti regionali di Farmacovigilanza (CUP D39E19000990001).\n\nInstitutional Review Board Statement\nNot applicable.\n\nInformed Consent Statement\nInformed consent of the patient was obtained.\n\nData Availability Statement\nData and material are available on reasonable request.\n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\nmedicina-57-00079-t001_Table 1Table 1 Naranjo nomogram for the assessment of adverse drug reaction (ADR). This questionnaire designed by Naranjo et al. [17] establishes whether an ADR was caused or not by a drug. The ADR is assigned to a probability category from the total score as follows: “definite” if the overall score is 9 or higher, “probable” for a score of 5–8, “possible” for a score of 1–4 and “doubtful” if the score is 0 or less. Bolded numbers apply to the patient’s case.\n\nAssessment Questions\tYes\tNo\tDon’t Know\t\n1. Are there previous conclusive reports on the ADR?\t\n+1\n\t0\t0\t\n2. Did ADR appear after the suspected drug was given?\t\n+2\n\t−1\t0\t\n3. Did the ADR improve when the drug was discontinued, or a specific antagonist was given?\t\n+1\n\t0\t0\t\n4. Did the ADR appear when the drug was re-administered?\t+2\t−1\t\n0\n\t\n5. Are there alternative causes that could have caused the ADR?\t−1\t\n+2\n\t0\t\n6. Did the reaction reappear when a placebo was given?\t−1\t+1\t\n0\n\t\n7. Was the drug detected in any body fluid in toxic concentrations?\t+1\t0\t\n0\n\t\n8. Was the reaction more severe when the dose was increased, or less severe when the dose was decreased?\t+1\t0\t\n0\n\t\n9. Did the patient have a similar reaction to the same or similar drugs in any previous exposure?\t+1\t\n0\n\t0\t\n10. Was the ADR confirmed by any objective evidence?\t\n+1\n\t0\t0\t\nTotal Score\t\n\t7 = Probable\n==== Refs\nReferences\n1. Hristovska A.-M. Duch P. Allingstrup M. Afshari A. Efficacy and safety of sugammadex versus neostigmine in reversing neuromuscular blockade in adults Cochrane Database Syst. Rev. 2017 8 CD012763 10.1002/14651858.CD012763 28806470 \n2. Kaufhold N. Schaller S.J. Stäuble C. Baumüller E. Ulm K. Blobner M. Fink H. Sugammadex and neostigmine dose-finding study for reversal of residual neuromuscular block at a train-of-four ratio of 0.2 (SUNDRO20) Br. J. Anaesth. 2016 116 233 240 10.1093/bja/aev437 26787792 \n3. Kim Y.-H. Sugammadex: Watch out for new side effects Korean J. Anesthesiol. 2016 69 427 428 10.4097/kjae.2016.69.5.427 27703621 \n4. Miyazaki Y. Sunaga H. Kida K. Hobo S. Inoue N. Muto M. Uezono S. Incidence of anaphylaxis associated with Sugammadex Anesth. Analg. 2018 126 1505 1508 10.1213/ANE.0000000000002562 29064876 \n5. Obara S. Kurosawa S. Honda J. Oishi R. Iseki Y. Murakawa M. Cardiac arrest following anaphylaxis induced by sugammadex in a regional hospital J. Clin. Anesth. 2018 44 62 63 10.1016/j.jclinane.2017.11.003 29145023 \n6. Hoshino K. Kato R. Nagasawa S. Kozu M. Morimoto Y. A case of repetitive cardiac arrest due to coronary vasospasm after Sugammadex administration Masui. Jpn. J. Anesthesiol. 2015 64 622 627 \n7. Ko M.J. Kim Y.H. Kang E. Lee B.C. Lee S. Jung J.W. Cardiac arrest after sugammadex administration in a patient with variant angina: A case report Korean J. Anesthesiol. 2016 69 514 517 10.4097/kjae.2016.69.5.514 27703634 \n8. Yanai M. Ariyoshi K. Two Cardiac Arrests that Occurred after the Administration of Sugammadex: A Case of Kounis Syndrome Case Rep. Emerg. Med. 2020 2020 10.1155/2020/6590101 32128264 \n9. Saito I. Osaka Y. Shimada M. Transient third-degree AV block following sugammadex J. Anesth. 2015 29 641 10.1007/s00540-015-1980-5 25672653 \n10. Kokki M. Ali M. Turunen M. Kokki H. Suspected unexpected adverse effect of sugammadex: Hypotension Eur. J. Clin. Pharmacol. 2012 68 899 900 10.1007/s00228-011-1196-z 22205274 \n11. Bilgi M. Demirhan A. Akkaya A. Tekelioglu Y. Kocoglu H. Sugammadex associated Persistent Bradycardia Int. J. Med. Sci. Public Health 2014 3 372 374 10.5455/ijmsph.2013.251220131 \n12. Sanoja I.A. Toth K.S. Profound Bradycardia and Cardiac Arrest After Sugammadex Administration in a Previously Healthy Patient: A Case Report A A Pract. 2019 12 22 24 10.1213/XAA.0000000000000834 30004912 \n13. Oliveira C. Marques C. Simões V. Spencer L. Poeira R. Casteleira M. Severe bradycardia and asystole associated with sugammadex: Case report Braz. J. Anesthesiol. 2019 69 218 221 10.1016/j.bjan.2018.09.010 30348442 \n14. Bhavani S.S. Severe bradycardia and asystole after sugammadex Br. J. Anaesth. 2018 121 95 96 10.1016/j.bja.2018.02.036 29935601 \n15. BRIDION: Highlights of Prescribing Information Available online: https://www.merck.com/product/usa/pi_circulars/b/bridion/bridion_pi.pdf (accessed on 28 December 2020) \n16. FDA Adverse Events Reporting System (FAERS) Public Dashboard Available online: https://fis.fda.gov/sense/app/d10be6bb-494e-4cd2-82e4-0135608ddc13/sheet/45beeb74-30ab-46be-8267-5756582633b4/state/analysis (accessed on 28 December 2020) \n17. Naranjo C.A. Busto U. Sellers E.M. Sandor P. Ruiz I. A Roberts E. Janecek E. Domecq C. Greenblatt D.J. A method for estimating the probability of adverse drug reactions Clin. Pharmacol. Ther. 1981 30 239 245 10.1038/clpt.1981.154 7249508 \n18. Hunter J.M. Naguib M. Sugammadex-induced bradycardia and asystole: How great is the risk? Br. J. Anaesth. 2018 121 8 12 10.1016/j.bja.2018.03.003 29935599 \n19. BRIDION—Summary of Product Information Released by EMA Available online: https://www.ema.europa.eu/en/documents/product-information/bridion-epar-product-information_en.pdf (accessed on 28 December 2020)\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1010-660X",
"issue": "57(1)",
"journal": "Medicina (Kaunas, Lithuania)",
"keywords": "Sugammadex; adverse drug reaction; asystole; bradycardia; cardiac arrest; hypotension",
"medline_ta": "Medicina (Kaunas)",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D001919:Bradycardia; D002800:Cholinesterase Inhibitors; D006323:Heart Arrest; D006801:Humans; D007022:Hypotension; D007669:Kidney Calculi; D008096:Lithotripsy; D008297:Male; D019148:Neuromuscular Blockade; D000077122:Sugammadex",
"nlm_unique_id": "9425208",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33477765",
"pubdate": "2021-01-19",
"publication_types": "D002363:Case Reports",
"references": "22205274;27703634;29064876;30348442;27703621;29145023;28806470;29935599;30004912;26437552;26787792;25672653;7249508;32128264;29935601",
"title": "Severe Hypotension, Bradycardia and Asystole after Sugammadex Administration in an Elderly Patient.",
"title_normalized": "severe hypotension bradycardia and asystole after sugammadex administration in an elderly patient"
} | [
{
"companynumb": "IT-009507513-2102ITA007481",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "SUGAMMADEX SODIUM"
},
"drugadditional": "4",... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.