article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "Novel drugs such as immunomodulators and proteasome inhibitors have improved the survival of patients with multiple myeloma. Like all therapeutic agents, appropriate dosing based on metabolism and clearance is important to maintain efficacy while avoiding toxicity. Hepatic impairment (HI) in multiple myeloma patients is rare but well described either due to disease or therapy-related factors. However, limited data are available on the appropriate use and dosing of the novel agent therapeutics in myeloma patients with HI. Furthermore, data on HI secondary to the novel agent toxicity are also sparse. This systematic review highlights the evidence on the use of novel agents like thalidomide, lenalidomide, pomalidomide, bortezomib and carfilzomib in patients with HI as well as their associated hepatic toxicities.",
"affiliations": "Department of Pharmacy, Denver Health, Denver, CO 80204, USA.",
"authors": "Stansfield|Lindsay C|LC|;Gonsalves|Wilson I|WI|;Buadi|Francis K|FK|",
"chemical_list": "D000970:Antineoplastic Agents; D007155:Immunologic Factors; D061988:Proteasome Inhibitors",
"country": "England",
"delete": false,
"doi": "10.2217/fon.14.270",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1479-6694",
"issue": "11(3)",
"journal": "Future oncology (London, England)",
"keywords": "hepatic impairment; myeloma; novel agents",
"medline_ta": "Future Oncol",
"mesh_terms": "D000970:Antineoplastic Agents; D006801:Humans; D007155:Immunologic Factors; D008107:Liver Diseases; D009101:Multiple Myeloma; D061988:Proteasome Inhibitors; D016896:Treatment Outcome",
"nlm_unique_id": "101256629",
"other_id": null,
"pages": "501-10",
"pmc": null,
"pmid": "25675129",
"pubdate": "2015",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D016454:Review; D000078182:Systematic Review",
"references": "22833546;24421329;21410373;18665361;22462599;9607928;22789729;19083237;16365178;24955783;15738379;22916049;22072815;11235821;22127618;7513432;21552449;16803426;17984315;24712303;19714720;11418482;11279644;22394984;22727252;18032763;21551005;23935022;10384139;24007748;17493431;16103134;18362366;9842637;18753647;24957143;21841166;22993370;12010810;24399786;18032762;15958804;18021472;18971951;12598363;24157580;17975015;22571202",
"title": "The use of novel agents in multiple myeloma patients with hepatic impairment.",
"title_normalized": "the use of novel agents in multiple myeloma patients with hepatic impairment"
} | [
{
"companynumb": "US-PFIZER INC-2018314674",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BORTEZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nGamma-hydroxybutyrate (GHB) and its precursors have gained popularity over the last decade as a drug in the party and club scene; however, the clinical knowledge of these substances is low. In the literature there have been case reports of severe dependence and withdrawal but there is a lack of systematic knowledge about the clinical course and complications of detoxification treatment.\n\n\nOBJECTIVE\nThe aim of this article is to evaluate the prevalence, treatment course, complications and compliance of GHB patients seeking inpatient qualified detoxification treatment (QDT).\n\n\nMETHODS\nA retrospective evaluation of the hospital charts of all patients admitted to this clinic in 2017 for QDT of GHB. The Jewish Hospital in Berlin (Jüdisches Krankenhaus Berlin) provides specialized inpatient units for addictive diseases and a general intensive care unit. The control population came from a prospective study of all patients with addictive diseases who were treated in the same hospital in 2012.\n\n\nRESULTS\nIn 2017 a total of 18 patients with GHB addiction were treated in this hospital. This corresponds to a 1‑year prevalence of 2.28% of all addictive diseases in this year. During detoxification treatment 52% of the GHB patients had to be temporarily transferred to the intensive care unit, 5% had to be temporarily mechanically ventilated and 26% suffered from withdrawal delirium. Of the patients 42% terminated treatment prematurely against medical advice.\n\n\nCONCLUSIONS\nWithdrawal treatment from GHB is a severe and potentially dangerous condition, the prevalence of complications was higher than for most other drugs and the rate of intensive care and withdrawal delirium was very high. Further studies are urgently needed with the aim of reducing the complication rates of GHB withdrawal and enhancing therapy adherence.",
"affiliations": "Jüdisches Krankenhaus Berlin - Akademisches Lehrkrankenhaus, Charité - Universitätsmedizin Berlin, Heinz-Galinksi-Str. 1, 13347, Berlin, Deutschland. peter.neu@jkb-online.de.",
"authors": "Neu|Peter|P|",
"chemical_list": "D012978:Sodium Oxybate",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00115-018-0636-8",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-2804",
"issue": "90(5)",
"journal": "Der Nervenarzt",
"keywords": "Complications; Delirium; Detoxification; Gamma-Hydroxybutyrate (GHB); Intensive care unit",
"medline_ta": "Nervenarzt",
"mesh_terms": "D001604:Berlin; D006801:Humans; D011446:Prospective Studies; D012189:Retrospective Studies; D012978:Sodium Oxybate; D013375:Substance Withdrawal Syndrome; D019966:Substance-Related Disorders",
"nlm_unique_id": "0400773",
"other_id": null,
"pages": "509-515",
"pmc": null,
"pmid": "30362026",
"pubdate": "2019-05",
"publication_types": "D016428:Journal Article",
"references": "12002803;12063087;12765217;15538955;15987921;16857475;18226321;18266111;19547737;19555805;20488831;21154180;22440552;25016356;25843781;27003176;28367351;4293055;7299403;7449723;8299669;9060200",
"title": "Course and complications of GHB detoxification treatment: a 1-year case series.",
"title_normalized": "course and complications of ghb detoxification treatment a 1 year case series"
} | [
{
"companynumb": "DE-TEVA-2019-DE-1074137",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DIAZEPAM"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nWe report a balloon-occluded arterial infusion therapy with an original four-lumen double-balloon catheter (4L-DB) which allows for the efficient injection of an anticancer agent at a high concentration to the target spot for patients with locally advanced uterine cervical cancer.\n\n\nMETHODS\nOne hundred and forty-three patients with locally advanced cervical cancer treated with neoadjuvant intra-arterial chemotherapy (NAIAC) or a primary radical hysterectomy (PRH) were retrospectively assessed. The patients in the NAIAC group received irinotecan 70 mg/m2 intravenously on day 1 and 8 and cisplatin 70 mg/m2 intra-arterially using the 4L-DB on day 2 of a 21-day course, and two courses were performed in principle. The radical hysterectomy was performed within 6 weeks after NAIAC.\n\n\nRESULTS\nNinety-four patients were treated with NAIAC, and 49 patients undertook a PRH. The response rate of NAIAC on MRI was 92.6%. Fourteen patients (14.6%) had no evidence of cancer cells on pathologic diagnoses. The NAIAC group had a longer disease-free survival than the PRH group (p=0.02); however, the overall survival was not significantly different. The relative risk (RR) for recurrence was higher in patients with lymph node metastasis (RR, 4.31; 95% CI, 2.23-8.43) and lower in those who underwent NAIAC (RR, 0.30; 95% CI, 0.14-0.68).\n\n\nCONCLUSIONS\nOur results with NAIAC using the 4L-DB catheter in locally advanced cervical cancer indicates beneficial effects on primary lesions and improves disease-free survival.",
"affiliations": "Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.;Department of Radiology, Osaka Medical College, Takatsuki, Japan.;Department of Pathology, Osaka Medical College, Takatsuki, Japan.;Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan.",
"authors": "Tanaka|Tomohito|T|;Terai|Yoshito|Y|;Fujiwara|Satoe|S|;Tanaka|Yoshimichi|Y|;Sasaki|Hiroshi|H|;Tsunetoh|Satoshi|S|;Yamamoto|Kazuhiro|K|;Yamada|Takashi|T|;Ohmichi|Masahide|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.18632/oncotarget.26518",
"fulltext": "\n==== Front\nOncotargetOncotargetOncotargetImpactJOncotarget1949-2553Impact Journals LLC 2651810.18632/oncotarget.26518Research PaperNeoadjuvant intra-arterial chemotherapy using an original four-lumen double-balloon catheter for locally advanced uterine cervical cancer Tanaka Tomohito 1Terai Yoshito 1Fujiwara Satoe 1Tanaka Yoshimichi 1Sasaki Hiroshi 1Tsunetoh Satoshi 1Yamamoto Kazuhiro 2Yamada Takashi 3Ohmichi Masahide 11 Department of Obstetrics and Gynecology, Osaka Medical College, Takatsuki, Japan2 Department of Radiology, Osaka Medical College, Takatsuki, Japan3 Department of Pathology, Osaka Medical College, Takatsuki, JapanCorrespondence to:Yoshito Terai,y-terai@osaka-med.ac.jp28 12 2018 28 12 2018 9 102 37766 37776 5 6 2018 13 12 2018 Copyright: © 2018 Tanaka et al.2018This article is distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use and redistribution provided that the original author and source are credited.OBJECTIVE\nWe report a balloon-occluded arterial infusion therapy with an original four-lumen double-balloon catheter (4L-DB) which allows for the efficient injection of an anticancer agent at a high concentration to the target spot for patients with locally advanced uterine cervical cancer.\n\nMETHODS\nOne hundred and forty-three patients with locally advanced cervical cancer treated with neoadjuvant intra-arterial chemotherapy (NAIAC) or a primary radical hysterectomy (PRH) were retrospectively assessed. The patients in the NAIAC group received irinotecan 70 mg/m2 intravenously on day 1 and 8 and cisplatin 70 mg/m2 intra-arterially using the 4L-DB on day 2 of a 21-day course, and two courses were performed in principle. The radical hysterectomy was performed within 6 weeks after NAIAC.\n\nRESULTS\nNinety-four patients were treated with NAIAC, and 49 patients undertook a PRH. The response rate of NAIAC on MRI was 92.6%. Fourteen patients (14.6%) had no evidence of cancer cells on pathologic diagnoses. The NAIAC group had a longer disease-free survival than the PRH group (p=0.02); however, the overall survival was not significantly different. The relative risk (RR) for recurrence was higher in patients with lymph node metastasis (RR, 4.31; 95% CI, 2.23-8.43) and lower in those who underwent NAIAC (RR, 0.30; 95% CI, 0.14-0.68).\n\nCONCLUSION\nOur results with NAIAC using the 4L-DB catheter in locally advanced cervical cancer indicates beneficial effects on primary lesions and improves disease-free survival.\n\nuterine cervical cancerlocally advanced uterine cervical cancerneoadjuvant chemotherapyradical hysterectomy\n==== Body\nINTRODUCTION\nWe previously reported a neoadjuvant intra-arterial chemotherapy (NAIAC) using an original four-lumen double-balloon (4L-DB) catheter (Figure 1) [1]. This catheter can expand the balloon in the internal iliac artery on the central and peripheral side of the uterine artery and selectively inject the anticancer agent into the uterine artery; the anticancer drug will not flow into other arteries, such as the inferior vesical artery, middle rectal artery, inferior gluteal artery or obturator artery. Therefore, a high concentration of the anticancer drug can be directly delivered to tumors through the uterine artery. The 4L-DB has also been used for bladder cancer [2–8], as well as cervical cancer [1]. Women with locally advanced cervical cancer (stage IB2, IIA2 and IIB) have a higher rate of recurrence and poor survival than those with early-stage disease (stage IA, IB1 and IIA1) [9]. In accord with the National Comprehensive Cancer Network's (NCCN) clinical guidelines, surgery or concurrent chemoradiotherapy (CCRT) is recommended in patients with stage IB1 and, in IIA1 cases, neoadjuvant chemotherapy (NAC) is not recommended [10] because a meta-analysis showed no advantage for NAC [11]. For patients with stage IB2, IIA2 and IIB disease, CCRT is also recommended, especially in patients with lymph node metastasis [10]. However, a NAC followed by radical hysterectomy is often commented on because several studies, including meta-analysis, have shown that NAC may improve the patient's prognosis [12, 13]. However, the appropriate treatment of stage IB2, IIA2 and IIB remains uncertain.\n\nFigure 1 Balloon-occluded arterial infusion therapy (BOAI)\nOriginal four-lumen double-balloon (4L-DB) catheter has a double balloon on the end. A slit between the double balloon allows for the infusion of the anticancer drug locally. The catheter is inserted from the femoral artery. Through the opposite internal iliac artery, the end is placed on the superior gluteal artery. The anticancer drug injected through the slit remains between the double balloon and is delivered to the uterine artery or feeding artery selectively.\n\nAdenocarcinoma currently comprises 10-20% of all cervical carcinomas in developed countries, compared to 5-10% three decades ago [14], and has a worse prognosis than squamous cell carcinoma [15, 16]. Several studies have shown that a radical hysterectomy has a better prognosis than radiotherapy in cervical adenocarcinoma [9, 17]. However, it may be difficult to perform a radical hysterectomy because cervical adenocarcinomas tend to form bulky tumors in some cases. NAC followed by a radical hysterectomy may improve the prognosis for bulky cervical adenocarcinoma. Cisplatin has been a key drug for cervical cancer because it has a 20% to 30% response rate as a single agent [18]. Irinotecan also has anticancer activity on cervical adenocarcinomas [19]. The response rate of intravenous neoadjuvant chemotherapy with cisplatin and irinotecan or nedaplatin and irinotecan for cervical cancer is 78.0-89.5% [20–23].\n\nThe current study demonstrates the efficacy and tolerance of NAIAC with cisplatin and irinotecan using a 4L-DB in patients with locally advanced cervical cancer, including adenocarcinoma.\n\nRESULTS\nAmong the 143 patients in the study with locally advanced cervical cancer, 94 patients received NAIAC, and 49 patients underwent primary radical hysterectomy (PRH) (Figure 2). Among the 94 patients who received NAIAC, 88 patients received two courses of NAIAC. The other 6 patients received one course of NAIAC because two patients had progression of the disease, one patient had no tumor regression, one patient had serious neuropathy, and one patient had general fatigue. Among the 88 patients who received two courses of NAIAC, 85 patients underwent radical hysterectomy (RH) after NAIAC. The other 3 patients received CCRT after NAIAC because one patient had progression of the disease, one patient had no tumor regression, and one patient experienced serious weight loss. Among the six patients who received one course of NAIAC, three underwent RH, and three received CCRT after NAIAC (Figure 1). Table 1 shows the characteristics, treatment and side effects of the 94 patients with locally advanced cervical cancer who underwent NAIAC. The mean (±standard deviation, SD) age of the patients was 49.4 ± 11.4 years. A total of 13 patients had the International Federation of Obstetricians and Gynecologists (FIGO) stage IB2 disease, 17 had stage IIA2 disease, and 64 had stage IIB disease. Histologically, 73 patients had squamous cell carcinoma, and 21 had adenocarcinoma. Eighty-eight patients underwent two courses of NAIAC, and the other six patients had only one course of NAIAC. Eighty-eight patients underwent RH after NAIAC and the other six patients received CCRT after NAIAC. The mean (± SD) tumor size was 46 ± 13 mm before NAIAC, decreasing to 14 ± 16 mm after NAIAC. The most frequent side effect was blood toxicity. Forty-six patients (48.9%) had grade 3 or grade 4 leukopenia. One patient (1.1%) had grade 3 thrombocytopenia. One (1.1%) had grade 3 anemia. There were no other grade 3 or more side effects. Table 2 shows the response to NAIAC for magnetic resonance imaging (MRI) and pathology. Among the 94 patients with locally advanced cervical cancer who underwent NAIAC, 37 patients had complete response (CR), 50 patients had partial response (PR), four patients had stable disease (SD), and three patients had progressive disease (PD) for MRI, resulting in a response rate of 92.6%. Among the 73 patients with squamous cell carcinoma who underwent NAIAC, 29 patients had CR, 39 patients had PR, three patients had SD, and two patients had PD, thus yielding a response rate of 93.2%. Among the 21 patients with adenocarcinoma who underwent NAIAC, eight patients had CR, 11 patients had PR, one patient had SD, and one patient had PD, resulting in a response rate of 90.5%. Pathologically, among the 88 patients with locally advanced cervical cancer who underwent NAIAC followed by RH, 14 patients (15.9%) had grade 3 response, 41 patients had grade 2 response, 23 had grade 1b response, 9 had grade 1a response, and one patient had grade 0 response. Among the 68 patients with squamous cell carcinoma, 13 patients (19.1%) had grade 3 response, 31 patients had grade 2 response, 18 had grade 1b response, five had grade 1a response and one patient had grade 0 response. Among the 20 patients with adenocarcinoma, one patient (5.0%) had grade 3 response, 10 patients had grade 2 response, five had grade 1b response, and four had grade 1a response. Table 3 shows the characteristics of patients who underwent NAIAC followed by RH and primary RH. Eighty-eight patients underwent NAIAC followed by RH. In contrast, 49 patients underwent primary RH. The mean (±standard deviation, SD) age was not significantly different between the groups (49.0 ± 11.4 vs. 50.5 ± 11.5 years, p=0.9). In the NAIAC group, 12 patients had FIGO stage IB2 disease, 17 had stage IIA2 disease, and 59 had stage IIB disease. In the PRH group, 15 patients had FIGO stage IB2 disease, 17 had stage IIA2 disease and 17 had stage IIB disease; the rate of IIB disease was significantly higher in the NAIAC group than that in the PRH group (67.0% vs. 34.7%, p<0.01). Histologically, 68 (77.3%) patients had squamous cell carcinoma, and 20 (22.7%) had adenocarcinoma in the NAIAC group. In contrast, 28 (57.1%) patients had squamous cell carcinoma, and 21 (42.9%) had adenocarcinoma in the PRH group; the rate of adenocarcinoma was significantly lower in the NAIAC group than that in the PRH group (22.7% vs. 42.9%, p=0.04). The mean pretreatment tumor size for MRI was not significantly different between the two groups (45 ± 12 vs. 44 ± 14 mm, p=0.6). In the NAIAC group, 27 patients underwent RT or CCRT, and 30 patients underwent chemotherapy after RH. The other 31 patients did not undergo adjuvant therapy. In the PRH group, 25 patients underwent RT or CCRT, and 19 patients underwent chemotherapy after RH. The other five patients did not undergo adjuvant therapy; the rate of no adjuvant therapy was lower in the NAIAC group than that in the PRH group (35.2% vs. 10.2%, p<0.01). One of 31 patients with no adjuvant therapy in the NAIAC group experienced recurrence on the vaginal stump. In contrast, two of five patients with no adjuvant therapy in the PR group had recurrence in the lung and pelvic cavity. Median follow up was shorter in the NAIAC group than that in the PRH group (30 vs. 48 months, p<0.01). The three-year disease free survival rate was significantly higher in the NAIAC group than that in the PRH group (64% vs. 52%, p=0.02). Figure 3 shows the disease free survival rate and overall survival rate for both groups. Those patients in the NAIAC group had a longer disease free survival than those in the PRH group (p=0.02). However, overall survival was not significantly different between the two groups. Figure 4 shows the results of multivariant analysis for the risk of recurrence. Lymph node metastasis (RR, 4.31; 95%CI, 2.23-8.43) and NAIAC (RR, 0.30; 95%CI 0.14-0.68) were independent factors for recurrence. Other factors, including histological type, lymphovascular involvement, deep stromal invasion (more than half myometrial invasion), bulky tumor (more than 4 cm), positive cut end and parametrial invasion, were not independent risk factors on multivariant analysis. Statistically, parametrial invasion was not an independent factor for recurrence (RR, 0.40; 95% CI, 0.14-1.02); however, this result suggested that those patients with parametrial invasion were less likely to experience recurrence. Most patients with risk factors including lymph node metastasis, LVI, deep stromal invasion, bulky tumor, positive cut end, and parametrial invasion received adjuvant chemotherapy or radiotherapy. Most patients with parametrial invasion received adjuvant radiotherapy, thus adjuvant radiotherapy may bring better DFS.\n\nFigure 2 Among the 143 patients with locally advanced cervical cancer, 94 patients received neoadjuvant intraarterial chemotherapy (NAIAC), and 49 patients underwent primary radical hysterectomy (PRH)\nAmong the 94 patients who receive NAIAC, 88 patients receive two courses of NAIAC. The other 6 patients receive one course of NAIAC because two patients had progressive disease (PD), one patient had no tumor regression, one patient had serious neuropathy, and one patient had general fatigue. Among the 88 patients who received two courses of NAIAC, 85 patients underwent radical hysterectomy (RH) after NAIAC. The other three patients receive CCRT after NAIAC because one patient had progression of the disease, one patient had no tumor regression, and one patient experienced serious weight loss. Among the six patients who received one course of NAIAC, three underwent RH, and three receive CCRT after NAIAC.\n\nTable 1 Patients with locally advanced cervical cancer who received NAIAC\nTotal number of patients\t94\t\nAge (years old)\t49.4 ± 11.4\t\nFIGO stage\t\t\n IB2\t13\t\n IIA2\t17\t\n IIB\t64\t\nHistology\t\t\n Squamous cell carcinoma\t73\t\n Adenocarcinoma\t21\t\nNAIAC\t\t\n Two courses\t88\t\n One course\t6\t\nTreatment after chemotherapy\t\t\n Radical hysterectomy\t88\t\n CCRT\t6\t\nTumor size\t\t\n Before NAIAC (mm)\t46 ± 13\t\n After NAIAC (mm)\t14 ± 16\t\nSide effect (grade3 or more)\t\t\n Leukopenia\t46\t\n Thrombocytopenia\t1\t\n Anemia\t7\t\nNAIAC, neoadjuvant intra-arterial chemotherapy; FIGO, The International Federation of Obstetricians and Gynecologists; CCRT, concurrent chemoradiotherapy.\n\nTable 2 Response to NAIAC\nResponse to NAIAC\tResponse to NAIAC followed by RH\t\n\tNumber of patients\tResponse for MRI\tRR\tNumber of patients\tPathological response\t\n\t\tCR\tPR\tSD\tPD\t\t\t0\t1a\t1b\t2\t3\t\nTotal\t94\t37\t50\t4\t3\t92.6\t88\t1\t9\t23\t41\t14\t\nHistological type\t\t\t\t\t\t\t\t\t\t\t\t\t\nSCC\t73\t29\t39\t3\t2\t93.2\t68\t1\t5\t18\t31\t13\t\nAD\t21\t8\t11\t1\t1\t90.5\t20\t0\t4\t5\t10\t1\t\nNAIAC, neoadjuvant intra-arterial chemotherapy; RH, radical hysterectomy; MRI, magnetic resonance imaging; SCC, squamous cell carcinoma; AD, adenocarcinoma; CR, complete response; PR, partial response; SD, stable disease; PD, progressive disease.\n\nTable 3 Characteristics of patients with locally invasive cervical cancer who underwent a radical hysterectomy\n\tNAIAC (n=88)\tPrimary RH (n=49)\tp value\t\nAge (years old)\t49.0 ± 11.4\t50.5 ± 11.5\t\t\nFIGO stage\t\t\t\t\n IB2\t12\t15\t0.04\t\n IIA2\t17\t17\t0.1\t\n IIB\t59\t17\t<0.01\t\nHistology\t\t\t\t\n Squamous cell carcinoma\t68\t28\t\t\n Adenocarcinoma\t20\t21\t0.04\t\nTumor size (mm)\t45 ± 12\t44 ± 14\t0.6\t\nAdjuvant therapy\t\t\t\t\n RT or CCRT\t27\t25\t0.07\t\n Chemotherapy\t30\t19\t0.9\t\n None\t31\t5\t<0.01\t\nMedian follow up (months)\t30\t48\t<0.01\t\n3.y. disease free survival\t64%\t52%\t0.02\t\nNAIAC, neoadjuvant intra-arterial chemotherapy; RH, radical hysterectomy; FIGO, The International Federation of Obstetricians and Gynecologists, RT, radiotherapy; CCRT, concurrent chemoradiotherapy.\n\nFigure 3 Those patients in the neoadjuvant intraarterial chemotherapy (NAIAC) group had a longer disease free survival rate than those in the primary radical hysterectomy (PRH) group (p=0. 02)\nHowever, overall survival was not signigicantly different between the two groups.\n\nFigure 4 The results of multivariant analysis for risk of recurrence\nLymph node metastasis and NAIAC were independent factors for recurrence. Other factors including histological type, lymphovascular involvement, deep stromal invasion (more than half myometrial invasion), bulky tumor (more than 4 cm), positive cut end, and parametrial invasion were not independent risk factors on multi variant analysis.\n\nDISCUSSION\nNAIAC using a 4L-DB with intravenous irinotecan and intra-arterial cisplatin was feasible and effective on locally advanced cervical adenocarcinoma as well as squamous cell carcinoma. The NAIAC group had excellent DFS, compared with the PRH group. However, overall survival was not significantly different between the two groups. Moreover, the NAIAC group required less frequent adjuvant therapy than the PRH group.\n\nThe 4L-DB is an original catheter for intra-arterial chemotherapy which allows for a high concentration anticancer drug to be directly delivered to tumors through the uterine artery [1]. We previously reported NAIAC using a 4L-DB with platinum, mitomycin, and pirarubicin for cervical squamous cell carcinomas. The results revealed a 96.7% response rate with a 20% pathological CR [1]. The current study revealed a 93.2% RR with a 19.1% pathological CR for squamous cell carcinomas and a 90.5% PR with a 5% pathological CR for adenocarcinomas. The 4L-DB has been used not only for uterine cervical cancer but also for bladder cancer [2–8]. The Bladder preservation therapy combining intra-arterial chemotherapy using a 4L-DB and radiotherapy has already been performed.\n\nThere have been several literatures about NAC with platinum and CPT-11 for treatment of cervical cancer. Sugiyama et al. reported about NAC followed by a radical hysterectomy for stage of IB2 to IIIB cervical cancer. In this report, 23 patients were treated with intravenous CPT-11 (60 mg/m2, day1, 8 and 15) and cisplatin (60 mg/m2, day1) for 2 to 3 courses followed by a radical hysterectomy. The RR was 78% [20]. Syoji et al. also reported about NAC followed by a radical hysterectomy for stage of IB2 to IIIB cervical cancer. In this report, 42 patients were treated with intravenous CPT-11 (70 mg/m2, day1 and 8) and cisplatin (70 mg/m2, day1) for two courses followed by a radical hysterectomy. The RR in this report was 83.3% [24]. Moreover, Syoji et al. also compared neoadjuvant chemotherapy plus radical hysterectomy with radical hysterectomy alone in patients with stage II cervical squamous cell carcinoma presenting as a bulky mass. In this setting, there were no statistically significant differences between the two groups in operative time and the volume of intraoperative blood loss, and the patients in the NAC group were discharge earlier. The hazard ratio for disease-free survival (DFS) in the NAC group, as compared with that in the surgery alone group, was 0.36 (95% CI 0.08-0.91) [25]. Matsumura et al. reported about NAC follow by a radical hysterectomy for stage of IB2 to IIB cervical cancer. In this report, 48 patients were treated with intravenous CPT-11 (60 mg/m2, day 1 and 8) and nedaplatin (80 mg/m2, day 1) for 1 to 3 courses followed by a radical hysterectomy. The RR was 75.0% [23]. Yang et al. also reported about NAC follow by a radical hysterectomy for stage of IB2 to IIB cervical cancer. Among a total of 219 patients, 50 patients received intravenous irinotecan (60 mg/m2, day 1, 8 and 15) plus cisplatin (70 mg/m2, day 1) for two courses followed by a radical hysterectomy, 59 patients received intravenous paclitaxel (175 mg/m2, day1) plus cisplatin (70 mg/m2, day 1), and 110 patients received primary surgery. The RR in those patients who received irinotecan plus cisplatin was 67.3%, and survival analysis revealed no significant difference in disease-free-survival or OS between the NAC group and the primary surgery group [26]. In these literatures described above, anticancer agents were injected intravenously, and the RR was 67.3-83.3% [20, 23–26]. In our study, cisplatin was injected intra-arterialy using a 4L-DB, and the resulting RR was 92.6%, thus indicating that the RR in our study was higher than that in other previously published literatures. We believe that a high concentrate anticancer drug could be directly delivered to tumors through the uterine artery using a 4L-DB, thus yielding better results.\n\nThere have been several other literatures about intra-arterial chemotherapy. Gui et al. reported the comparison of intra-arterial and intravenous NAC in locally advanced cervical cancer. In the study, patients received three cycles of NAC every 3 weeks (cisplatin 70 mg/m2 on day 1, 5-fluouracil 1000 mg/m2 on day 1-4). Intra-arterial interventional chemotherapy was administered via right femoral artery catheterization. Each side of the uterine artery received half of the cisplatin dosage. The catheter was retained on the more severe side, maintaining a 24-hour infusion of 5-fluouracil for 4 consecutive days. The overall response rate was 84.9% vs. 88.2%, and the operability rate was 77.4% vs. 81.4% for intravenous vs. intra-arterial. There were no significant differences in toxicities, surgical duration, perioperative blood loss, and operative complications between the two groups. The intra-arterial group had a significantly lower parametrial infiltration for postoperative pathological examination. Moreover, the positive vaginal margin, lymph node metastasis and intravascular tumor embolism showed no significant differences. The recurrence, distant metastasis, and 5-year survival rates did not show any significant differences between the two groups [27]. Wen et al. reported a prospective randomized controlled study on multiple neoadjuvant treatment for patients with stage IB2 to IIA cervical cancer. One hundred and twenty-three patients were enrolled and randomly assigned to receive one of the following four treatments: radical surgery, brachytherapy with a total dose of 5Gy to point A followed by radical surgery, intravenous chemotherapy with cisplatin 50 mg/m2 plus 5-fluoroucil 750 mg/m2 at a 2-weeks interval for two courses followed by radical surgery, or intra-arterial chemotherapy with the same regimen as the intravenous chemotherapy followed by radical surgery. The clinical overall response rates were 61.3%, 42.9% and 79.3% in brachytherapy, intravenous chemotherapy and intra-arterial chemotherapy, respectively. The 3-year progression-free survival rates were 70.7%, 66.3%, 81.5% and 79.7% in surgery alone, brachytherapy, intravenous chemotherapy and intra-arterial chemotherapy, respectively. Three-year overall survival rates were 73.3%, 68.3%, 82.9% and 80.4% in the surgery alone, brachytherapy, intravenous chemotherapy and intra-arterial chemotherapy, respectively. Multivariate analysis also showed that only lymph node status correlated with progression-free survival [28]. Tsubamoto et al. reported on neoadjuvant transuterine arterial chemotherapy followed by radical hysterectomy in patients with locally advanced cervical cancer. Seventy-three patients received transuterine arterial chemotherapy combined with intravenous nedaplatin, irinotecan, paclitaxel, or etoposide administration. The radiological response rate was 96%. Multivariate analysis revealed that a tumor size of more than 60 mm and lymph node metastasis were negative prognostic factors for overall survival. Intra-arterial chemotherapy is still controversial and is not convenient compared to intravenous chemotherapy. However, several literatures have shown that intra-arterial chemotherapy had a higher response rate than the intravenous chemotherapy described above. Moreover, intra-arterial chemotherapy using a 4L-DB could deliver a high concentration of anticancer drug to the tumor - in theory. In our previous report about intra-arterial chemotherapy using a 4L-DB, the platinum concentration was significantly higher in the tumors with a CR to NAIAC than those with a PR and SD (p<0.0001, CR; 11.5 ± 0.8 μg/g, PR; 7.3 ± 0.5μg/g, SD; 4.5 ± 0.1 μg/g) [1]. Therefore, intra-arterial chemotherapy, especially via a 4L-DB, may be inconvenient. However, it may have advantages compared with intravenous chemotherapy.\n\nMaking comparison between NAC plus radical surgery and primary radiotherapy, a meta-analysis of randomized trials including 872 patients with locally advanced cervical cancer showed that NAC obtained a better DFS (HR = 0.68, 95% CI = 0.56-0.82) and OS (HR = 0.65, 95% CI = 0.53-0.80) [29] [29]. A recent study by Gupta et al. indicated that cisplatin-based CCRT resulted in superior DFS compared with NAC followed by radical surgery in locally advanced cervical cancer. OS was not significantly different between the two groups. In the subgroup analysis, DFS was significantly inferior in the NAC plus surgery group in stage IIB disease. In stage IB2 and II disease, DFS was not significantly different between the NAC and CCRT groups. However, a lot of patient in this study did not receive complete surgery. 21.5% of patients crossed over (presurgery crossover and intraoperative unresectable disease) to receive definitive CCRT [30]. In our study, only 6 patients (6.4%) receive presurgical CCRT. Furthermore, all patients who underwent radical surgery received complete surgery.\n\nMeta-analysis showed that NAC followed by radical surgery had no prognostic advantage in patients with stage 1B1 to IIA cervical cancer, compared to primary radical surgery. NAC was related with a lower rate of tumor size and lymph node metastasis than primary radical surgery. Furthermore, NAC reduced the need for adjuvant radiotherapy and decreased the rate of distant metastasis [11]. The multicenter retrospective study showed that recurrence-free survival was significantly longer in stage IB2 to IIB patients who achieved an overall optimal response to NAC than in those who did not. The authors concluded that optimal responders after NAC followed by radical surgery did not need further treatment. Although this study compared responders with no responders who underwent NAC followed by radical surgery, the sensitivity for NAC may be an important prognostic factor [12]. Other meta-analysis also showed the sensitivity of NAC could be an important prognostic factor in patients with stage IB1 to IV cervical cancer [13]. JCOG0102, which is a prospective randomized control trial for NAC in stage IB1 to IIB cervical cancer in Japan, showed that NAC had no prognostic advantage; however, it did reduce the need for adjuvant radiotherapy [31]. In our study, DFS was significantly longer in those patients who received NAIAC than in those who underwent primary radical surgery. Furthermore, NAIAC was an independent prognostic factor in multivariant analysis, and 35% patients who received NAIAC did not need any adjuvant therapy. Although further examination is needed, we believe that our 4L-DB could provide excellent results.\n\nThis study is associated with several important limitations that may potentially decrease its value. First, the sample size was not large enough for complete analysis. Second, there was selection bias in choosing the primary treatment, as the surgeon tended to choose NAIAC when they felt that it would be difficult to perform a radical hysterectomy due to a large tumor size or parametrial invasion. Third, the results were conducted through those patients who underwent a radical hysterectomy; patients who underwent NAIAC followed by radiotherapy were not considered. Fourth, we did not compare NAIAC plus radical surgery to CCRT. From this point of view, the conclusion is not definitive.\n\nIn conclusion, NAIAC using a 4L-DB with intravenous irinotecan and intra-arterial cisplatin is feasible and effective on locally advanced cervical cancer. The NAIAC group had an excellent DFS, as opposed to that in the PRH group. However, overall survival was not significantly different between the groups. The NAIAC group, as well, needed less frequent adjuvant therapy than the PRH group. Therefore, NAIAC using a 4L-DB with intravenous irinotecan and intra-arterial cisplatin followed by radical hysterectomy might be a useful strategy for locally advanced cervical cancer.\n\nMATERIALS AND METHODS\nParticipants\nThe present study included 143 Japanese patients with cervical cancer who were treated at Osaka Medical College between April 2006 and April 2017. Patients were eligible for inclusion in the study when they met the following criteria: (1) patients with an International Federation of Obstetricians and Gynecologists (FIGO) stage IB2, IIA2 or IIB cervical squamous cell carcinoma or adenocarcinoma who were treated by NAIAC with cisplatin and irinotecan using a 4L-DB or a radical hysterectomy with salpingo-oophorectomy as an initial treatment. The surgeon chose NAIAC when the patients had a seriously restricted uterus for cancer invasion. In contrast, PRH was performed when the patient had no seriously restricted uterus; (2) age less than 70 years; (3) a World Health Organization (WHO) performance status of 0 to 2; (4) fulfillment of pretreatment laboratory requirements, including a leukocyte count more than 3000/mm3, a platelet count more than 100 000/mm3, serum creatinine less than 1.5 mg/dl, serum bilirubin less than 1.5 mg/dl, and normal serum aspartate transaminase (AST) and serum alanine transaminase (ALT); (5) patients without any other major organ disease; and (6) the patient had sufficient clinical data regarding the oncologic outcome, including the date of recurrence. All patients were staged according to FIGO criteria, and the histological subtype was assigned according to the criteria of the WHO classification. The present study was approved by the institutional review board (IRB) of Osaka Medical College. Written informed consent was obtained from all patients for NAIAC and for the use of clinical records in the present study. Those patients who underwent a primary radical hysterectomy provided their written informed consent at the time of the primary surgery to use their clinical records for an IRB-approved study, and the IRB approved this consent procedure.\n\nIntra-arterial chemotherapy\nFor intra-arterial infusion therapy, we developed an original 4L-DB catheter (Clinical Supply Japan) for the simple and efficient injection of an anticancer agent at a high concentration to target spots in patients with advanced uterine cervical cancer [1]. Under local anesthesia, following Seldinger's technique, polyethylene catheters of 6-French diameter were inserted through both femoral arteries. Each catheter tip was placed in the internal iliac artery. While the guidewire was detained in the peripheral artery of the internal iliac artery, the catheter was passed through the junction of the uterine artery, which was the target vessel, just distal to the branching out of the superior gluteal artery. To confirm the correct position of the catheter and effective perfusion, pelvic arteriography was performed during catheterization procedures. Each time after the completion of treatment, the catheters were removed, and sandbags were used to apply firm pressure over each groin area for 6h. The regimen included the following: intravenous irinotecan (CPT-11) (70 mg/m2, day1 and 8) and intra-arterial cisplatin (75 mg/m2, day2) using the 4L-DB for two courses every 21 days. Cisplatin was administered intra-arterially within 30min in divided doses via the bilateral internal iliac arteries. Hydration with normal saline and 5% dextrose began 3h before chemotherapy, with careful monitoring of urine volume.\n\nTreatment response\nComplete blood cell counts and renal and hepatic function tests were repeated before each course. Toxicity was graded according to the WHO criteria. The tumor was monitored with magnetic resonance imaging (MRI; SIGNA MR/i; GE, Slough, UK). Response was measured as the product of the two largest perpendicular diameters of the cervical mass lesion. Patients were evaluated for response with a physical examination and MRI after two courses of therapy. A CR was defined as the complete disappearance of all clinically detectable disease. A 50% or more decrease in tumor size constituted a partial PR. A SD was defined as no significant change, and a PD was defined as a more than 25% increase in tumor size or the appearance of new lesions or hydronephrosis.\n\nIn addition, histological changes were also evaluated in surgical specimens using the following criteria set by the Japan Society for Cancer Therapy: grade 0 was defined as the absence of degenerative or necrotic change after chemotherapy; grade 1a was defined as degeneration, necrosis, or cytolysis in less than one-third of the cancer cells; grade 1b was defined as degeneration, necrosis, or cytolysis in more than one-third but less than two-thirds of the cancer cells; grade 2 was defined as remarkable degeneration, necrosis, cytolysis, or the disappearance of cancer cells in more than two-thirds of the cancer cells; grade 3 was defined as all cancer cells becoming necrotic, the occurrence of cytolysis, or the presence of granulomatous tissue or fibrosis.\n\nLocal therapy\nFollowing NAIAC, a radical hysterectomy with pelvic lymphadenectomy was performed on patients responding to the NAIAC, if possible. After surgery, patients with any poor prognostic factors, including lymph node metastasis, parametrial infiltration, vaginal invasion, or ovarian metastasis received postoperative adjuvant radiotherapy (RT) [Linac, 40 to 50 Gy; and/or RALS (Remote After Loading System), 30 to 40 Gy] or chemotherapy. Patients who did not respond to NAIC received CCRT, which was external-beam radiation (Linac, 50–60 Gy) with Cisplatin 40 mg/m2/week and brachytherapy delivered by remote control after loading the system using 60CO (RALS, 40 to 50 Gy).\n\nStatistical analysis\nAll of the statistical analyses were performed using the JMP software package (version. 11.1.1). Continuous variables are expressed as the mean ± standard deviation. The Student T-test was used to compare continuous variables, and Pearson's Chi-square test was used to compare frequencies. Overall survival curves and DFS curves were plotted according to the Kaplan-Meier method and were analyzed by the log-rank test. Relative risk was calculated by Cox's proportional hazards model. P values of <0.05 were considered to indicate statistical significance.\n\nMr. Niinobe Shigefumi (Osaka Medical College Biomedical Computation Center) attributed to the artwork design.\n\nAuthor contributions\n\nT.T., and M.O. designed study; T.T., Y.Te., S.F., Y.Ta. and H.S. performed data collection and analysis; T.T., Y.Te, Y.Ta., and T.Y. made diagnosis of histological analyses; T.T., S.T., and K.Y. made diagnosis of image analyses; K.Y performed NAIAC; T.T., and M.O. wrote the paper.\n\nCONFLICTS OF INTEREST\n\nThe authors declare that they have no conflicts of interest.\n\nFUNDING\n\nThe authors have received no funding for this article.\n\nAbbreviations\n4L-DBfour-lumen double-balloon catheter\n\nNAIACneoadjuvant intra-arterial chemotherapy\n\nPRHprimary radical hysterectomy\n\nRHradical hysterectomy\n\nRRrelative risk\n\nNCCNNational Comprehensive Cancer Network's\n\nNACneoadjuvant chemotherapy\n\nCCRTconcurrent chemoradiotherapy\n\nRTradiotherapy\n\nSDstandard deviation\n\nFIGOInternational Federation of Obstetricians and Gynecologists\n\nCRcomplete response\n\nPRpartial response\n\nSDstable disease\n\nPDprogressive disease\n\nDFSdisease-free survival\n==== Refs\nREFERENCES\n1 Terai Y Kanemura M Sasaki H Tsunetoh S Tanaka Y Yamashita Y Yamamoto K Narabayashi I Ohmichi M Long-term follow-up of neoadjuvant intraarterial chemotherapy using an original four-lumen double-balloon (4L-DB) catheter for locally advanced uterine cervical cancer Int J Clin Oncol 2009 14 56 62 10.1007/s10147-008-0801-3 19225926 \n2 Azuma H Inamoto T Ibuki N Ubai T Kotake Y Takahara K Kiyama S Nomi H Uehara H Komura K Yamamoto K Narumi Y Katsuoka Y Novel bladder preservation therapy for locally invasive bladder cancer: combined therapy using balloon-occluded arterial infusion of anticancer agent and hemodialysis with concurrent radiation Int J Oncol 2010 37 773 85 20811698 \n3 Azuma H Inamoto T Ibuki N Ubai T Kotake Y Takahara K Kiyama S Nomi H Uehara H Komura K Yamamoto K Narumi Y Katsuoka Y Utility of the novel bladder preservation therapy, BOAI-CDDP-radiation (OMC-regimen), for elderly patients with invasive bladder cancer Int J Oncol 2011 38 13 24 21109921 \n4 Azuma H Inamoto T Takahara K Nomi H Hirano H Ibuki N Uehara H Komura K Minami K Uchimoto T Saito K Takai T Tanda N The novel bladder preservation therapy BOAI-CDDP-radiation (OMC-regimen): a new treatment option for invasive bladder cancer patients with lymph node metastasis Int J Oncol 2014 44 1895 903 10.3892/ijo.2014.2378 24728124 \n5 Azuma H Inamoto T Takahara K Nomi H Hirano H Uehara H Komura K Minami K Kouno J Kotake Y Abe H Takagi S Ibuki N A great option for elderly patients with locally invasive bladder cancer, BOAI-CDDP-radiation (OMC regimen) Int J Oncol 2013 43 1087 94 10.3892/ijo.2013.2058 23934264 \n6 Azuma H Inamoto T Takahara K Nomi H Uehara H Komura K Minami K Kouno J Kotake Y Abe H Takagi S Yamamoto K Narumi Y Effect of a novel bladder preservation therapy, BOAI-CDDP-radiation (OMC-regimen) Int J Oncol 2013 43 79 87 10.3892/ijo.2013.1923 23624911 \n7 Azuma H Kotake Y Yamamoto K Sakamoto T Kiyama S Ubai T Inamoto T Takahara K Matsuki M Segawa N Shibahara N Katsuoka Y Effect of combined therapy using balloon-occluded arterial infusion of cisplatin and hemodialysis with concurrent radiation for locally invasive bladder cancer Am J Clin Oncol 2008 31 11 21 10.1097/COC.0b013e318136e27a 18376222 \n8 Azuma H Yamamoto K Inamoto T Ibuki N Kotake Y Sakamoto T Kiyama S Ubai T Takahara K Segawa N Narumi Y Katsuoka Y Total cystectomy versus bladder preservation therapy for locally invasive bladder cancer: effect of combined therapy using balloon-occluded arterial infusion of anticancer agent and hemodialysis with concurrent radiation Am J Clin Oncol 2009 32 592 606 10.1097/COC.0b013e318199fb42 19593084 \n9 Landoni F Maneo A Colombo A Placa F Milani R Perego P Favini G Ferri L Mangioni C Randomised study of radical surgery versus radiotherapy for stage Ib-IIa cervical cancer Lancet 1997 350 535 40 10.1016/s0140-6736(97)02250-2 9284774 \n10 National Comprehensive Cancer Network Cervical Cancer (Version 1.2018) \n11 Kim HS Sardi JE Katsumata N Ryu HS Nam JH Chung HH Park NH Song YS Behtash N Kamura T Cai HB Kim JW Efficacy of neoadjuvant chemotherapy in patients with FIGO stage IB1 to IIA cervical cancer: an international collaborative meta-analysis Eur J Surg Oncol 2013 39 115 24 10.1016/j.ejso.2012.09.003 23084091 \n12 Landoni F Sartori E Maggino T Zola P Zanagnolo V Cosio S Ferrari F Piovano E Gadducci A Is there a role for postoperative treatment in patients with stage Ib2-IIb cervical cancer treated with neo-adjuvant chemotherapy and radical surgery? An Italian multicenter retrospective study Gynecol Oncol 2014 132 611 7 10.1016/j.ygyno.2013.12.010 24342439 \n13 Ye Q Yuan HX Chen HL Responsiveness of neoadjuvant chemotherapy before surgery predicts favorable prognosis for cervical cancer patients: a meta-analysis J Cancer Res Clin Oncol 2013 139 1887 98 10.1007/s00432-013-1509-y 24022086 \n14 Young RH Clement PB Endocervical adenocarcinoma and its variants: their morphology and differential diagnosis Histopathology 2002 41 185 207 12207781 \n15 Eifel PJ Morris M Oswald MJ Wharton JT Delclos L Adenocarcinoma of the uterine cervix. Prognosis and patterns of failure in 367 cases Cancer 1990 65 2507 14 2337867 \n16 Lai CH Hsueh S Hong JH Chang TC Tseng CJ Chou HH Huang KG Lin JD Are adenocarcinomas and adenosquamous carcinomas different from squamous carcinomas in stage IB and II cervical cancer patients undergoing primary radical surgery? Int J Gynecol Cancer 1999 9 28 36 11240740 \n17 Shingleton HM Bell MC Fremgen A Chmiel JS Russell AH Jones WB Winchester DP Clive RE Is there really a difference in survival of women with squamous cell carcinoma, adenocarcinoma, and adenosquamous cell carcinoma of the cervix? Cancer 1995 76 1948 55 8634986 \n18 Thigpen T The role of chemotherapy in the management of carcinoma of the cervix Cancer J 2003 9 425 32 14690318 \n19 Tsuda H Hashiguchi Y Nishimura S Miyama M Nakata S Kawamura N Negoro S Phase I-II study of irinotecan (CPT-11) plus nedaplatin (254-S) with recombinant human granulocyte colony-stimulating factor support in patients with advanced or recurrent cervical cancer Br J Cancer 2004 91 1032 7 10.1038/sj.bjc.6602076 15292935 \n20 Sugiyama T Nishida T Kumagai S Nishio S Fujiyoshi K Okura N Yakushiji M Hiura M Umesaki N Combination therapy with irinotecan and cisplatin as neoadjuvant chemotherapy in locally advanced cervical cancer Br J Cancer 1999 81 95 8 10.1038/sj.bjc.6690656 10487618 \n21 Shoji T Takatori E Hatayama S Omi H Kagabu M Honda T Kumagai S Morohara Y Miura F Yoshizaki A Sugiyama T Phase II study of tri-weekly cisplatin and irinotecan as neoadjuvant chemotherapy for locally advanced cervical cancer Oncol Lett 2010 1 515 9 10.3892/ol_00000091 22966335 \n22 Abou-Taleb HA Koshiyama M Matsumura N Baba T Yamaguchi K Hamanishi J Abiko K Yamanoi K Murakami R Horikawa N Taha AA Kitamura S Konishi I Clinical efficacy of neoadjuvant chemotherapy with irinotecan (CPT-11) and nedaplatin followed by radical hysterectomy for locally advanced cervical cancer J Int Med Res 2016 44 346 56 10.1177/0300060515591858 26831404 \n23 Matsumura M Takeshima N Ota T Omatsu K Sakamoto K Kawamata Y Umayahara K Tanaka H Akiyama F Takizawa K Neoadjuvant chemotherapy followed by radical hysterectomy plus postoperative chemotherapy but no radiotherapy for Stage IB2-IIB cervical cancer--irinotecan and platinum chemotherapy Gynecol Oncol 2010 119 212 6 10.1016/j.ygyno.2010.07.031 20709382 \n24 Shoji T Takatori E Furutake Y Takada A Nagasawa T Omi H Kagabu M Honda T Miura F Takeuchi S Kumagai S Yoshizaki A Sato A Phase II clinical study of neoadjuvant chemotherapy with CDDP/CPT-11 regimen in combination with radical hysterectomy for cervical cancer with a bulky mass Int J Clin Oncol 2016 21 1120 7 10.1007/s10147-016-1008-7 27342833 \n25 Takatori E Shoji T Takada A Nagasawa T Omi H Kagabu M Honda T Miura F Takeuchi S Sugiyama T A retrospective study of neoadjuvant chemotherapy plus radical hysterectomy versus radical hysterectomy alone in patients with stage II cervical squamous cell carcinoma presenting as a bulky mass Onco Targets Ther 2016 9 5651 7 10.2147/ott.s101146 27695343 \n26 Yang Z Chen D Zhang J Yao D Gao K Wang H Liu C Yu J Li L The efficacy and safety of neoadjuvant chemotherapy in the treatment of locally advanced cervical cancer: A randomized multicenter study Gynecol Oncol 2016 141 231 9 10.1016/j.ygyno.2015.06.027 26115978 \n27 Gui T Shen K Xiang Y Pan L Lang J Wu M Huang H Cao D Yang J Neoadjuvant chemotherapy in locally advanced cervical carcinoma: which is better, intravenous or intra-arterial? Onco Targets Ther 2014 7 2155 60 10.2147/ott.s67633 25473297 \n28 Wen H Wu X Li Z Wang H Zang R Sun M Huang X Zhang Z Cai S A prospective randomized controlled study on multiple neoadjuvant treatments for patients with stage IB2 to IIA cervical cancer Int J Gynecol Cancer 2012 22 296 302 10.1097/IGC.0b013e31823610a1 22274319 \n29 Hu T Li S Chen Y Shen J Li X Huang K Yang R Wu L Chen Z Jia Y Wang S Cheng X Han X Matched-case comparison of neoadjuvant chemotherapy in patients with FIGO stage IB1-IIB cervical cancer to establish selection criteria Eur J Cancer 2012 48 2353 60 10.1016/j.ejca.2012.03.015 22503395 \n30 Gupta S Maheshwari A Parab P Mahantshetty U Hawaldar R Sastri Chopra S Kerkar R Engineer R Tongaonkar H Ghosh J Gulia S Kumar N Shylasree TS Neoadjuvant Chemotherapy Followed by Radical Surgery Versus Concomitant Chemotherapy and Radiotherapy in Patients With Stage IB2, IIA, or IIB Squamous Cervical Cancer: A Randomized Controlled Trial J Clin Oncol 2018 36 1548 55 10.1200/jco.2017.75.9985 29432076 \n31 Katsumata N Yoshikawa H Kobayashi H Saito T Kuzuya K Nakanishi T Yasugi T Yaegashi N Yokota H Kodama S Mizunoe T Hiura M Kasamatsu T Phase III randomised controlled trial of neoadjuvant chemotherapy plus radical surgery vs radical surgery alone for stages IB2, IIA2, and IIB cervical cancer: a Japan Clinical Oncology Group trial (JCOG 0102) Br J Cancer 2013 108 1957 63 10.1038/bjc.2013.179 23640393\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1949-2553",
"issue": "9(102)",
"journal": "Oncotarget",
"keywords": "locally advanced uterine cervical cancer; neoadjuvant chemotherapy; radical hysterectomy; uterine cervical cancer",
"medline_ta": "Oncotarget",
"mesh_terms": null,
"nlm_unique_id": "101532965",
"other_id": null,
"pages": "37766-37776",
"pmc": null,
"pmid": "30701030",
"pubdate": "2018-12-28",
"publication_types": "D016428:Journal Article",
"references": "10487618;11240740;12207781;14690318;15292935;18376222;19225926;19593084;20709382;20811698;21109921;22274319;22503395;22966335;23084091;2337867;23624911;23640393;23934264;24022086;24342439;24728124;25473297;26115978;26831404;27342833;27695343;29432076;8634986;9284774",
"title": "Neoadjuvant intra-arterial chemotherapy using an original four-lumen double-balloon catheter for locally advanced uterine cervical cancer.",
"title_normalized": "neoadjuvant intra arterial chemotherapy using an original four lumen double balloon catheter for locally advanced uterine cervical cancer"
} | [
{
"companynumb": "JP-ACCORD-106961",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "Cytomegalovirus (CMV) disease caused by genetically resistant CMV poses a major challenge in solid organ transplant recipients, and the development of resistance is associated with increased morbidity and mortality. Antiviral resistance affects 5%-12% of patients following ganciclovir (GCV) therapy, but is more common in individuals with specific underlying risk factors. These include the CMV D+R- serostatus, type of transplanted organ, dose and duration of (Val)GCV ([V]GCV) prophylaxis, peak viral loads, and the intensity of immunosuppressive therapy. Guideline recommendations for the management of GCV resistance (GanR) in solid organ transplant recipients are based on expert opinion as there is a lack of data from controlled trials. Second-line options to treat GanR include foscarnet (FOS) and cidofovir (CDV), but these drugs are often poorly tolerated due to high rates of toxicity, such as renal dysfunction and neutropenia. Here, we report seven cardiothoracic transplant recipients with GCV resistance CMV infection from our centre treated with CMV immunoglobulin (CMVIG) +/- leflunomide (LEF) and reviewed the literature on the use of these agents in this therapeutic setting.",
"affiliations": "Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.;Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.;Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.;Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.;Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.;Transplant Department, Wythenshawe Hospital, Manchester University NHS Foundation Trust, Manchester, UK.",
"authors": "Santhanakrishnan|Karthik|K|https://orcid.org/0000-0002-4499-847X;Yonan|Nizar|N|;Iyer|Kapil|K|;Callan|Paul|P|;Al-Aloul|Mohamed|M|;Venkateswaran|Rajamiyer|R|",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.13733",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": null,
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "CMV; CMVIG; heart transplant; lung transplant; resistance",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": null,
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "e13733",
"pmc": null,
"pmid": "34534396",
"pubdate": "2021-09-17",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Management of ganciclovir resistance cytomegalovirus infection with CMV hyperimmune globulin and leflunomide in seven cardiothoracic transplant recipients and literature review.",
"title_normalized": "management of ganciclovir resistance cytomegalovirus infection with cmv hyperimmune globulin and leflunomide in seven cardiothoracic transplant recipients and literature review"
} | [
{
"companynumb": "GB-MYLANLABS-2022M1015933",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GANCICLOVIR"
},
"drugadditional": "3",
... |
{
"abstract": "Common variable immunodeficiency is a chronic illness plagued with recurrent infections and the potential to develop autoimmune disease. These patients may manifest a spectrum of complications ranging from hematologic malignancy to chronic parenchymal lung disease. Regular immunoglobulin replacement therapy improves immunologic debility but does not mitigate other features of this disease. Here, we discuss a complication of common variable immunodeficiency not previously characterized in the literature. We present two cases of advanced pulmonary vascular disease associated with common variable immunodeficiency treated with pulmonary vasodilators.",
"affiliations": "Division of Cardiovascular Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, USA.;Department Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, USA.;Division of Allergy, Pulmonary and Critical Care Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, USA.;Division of Allergy, Pulmonary and Critical Care Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, USA.",
"authors": "Huston|Jessica|J|;Johnson|Joyce|J|;Hemnes|Anna|A|;Pugh|Meredith|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/2045894020922792",
"fulltext": "\n==== Front\nPulm Circ\nPulm Circ\nPUL\nsppul\nPulmonary Circulation\n2045-8932 2045-8940 SAGE Publications Sage UK: London, England \n\n10.1177/2045894020922792\n10.1177_2045894020922792\nCase Report\nEvidence of pulmonary arterial hypertension in two patients with common variable immunodeficiency\nHuston Jessica 1 Johnson Joyce 2 Hemnes Anna 3 Pugh Meredith 3 1 Division of Cardiovascular Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, USA\n2 Department Pathology, Microbiology and Immunology, Vanderbilt University Medical Center, Nashville, USA\n3 Division of Allergy, Pulmonary and Critical Care Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, USA\nJessica Huston, Cardiovascular Medicine, Vanderbilt University Medical Center, 2220 Pierce Ave, 383 Preston Research Building, Nashville, TN 37232, USA. Email: Jessica.h.huston@vumc.org\n1 5 2020 \nApr-Jun 2020 \n10 2 204589402092279212 3 2020 8 4 2020 © The Author(s) 20202020SAGE Publications Ltd, or Pulmonary Vascular Research Institute, unless otherwise noted. Manuscript content on this site is licensed under Creative Commons LicensesCreative Commons Non Commercial CC BY-NC: This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Common variable immunodeficiency is a chronic illness plagued with recurrent infections and the potential to develop autoimmune disease. These patients may manifest a spectrum of complications ranging from hematologic malignancy to chronic parenchymal lung disease. Regular immunoglobulin replacement therapy improves immunologic debility but does not mitigate other features of this disease. Here, we discuss a complication of common variable immunodeficiency not previously characterized in the literature. We present two cases of advanced pulmonary vascular disease associated with common variable immunodeficiency treated with pulmonary vasodilators.\n\nimmunologypathologypulmonary arterial hypertensionright ventricle function and dysfunctioncover-dateApril-June 2020typesetterts2\n==== Body\nIntroduction\nCommon Variable Immunodeficiency (CVID) is a severe primary immunodeficiency caused by antibody production failure and characterized by recurrent bacterial infections.1 Prior registries have found no association between CVID and pulmonary arterial hypertension (PAH), although patients with CVID and severe hypoxic lung disease may develop pulmonary hypertension (PH).2 The literature on CVID-associated PH is limited to case reports attributing pulmonary vascular disease to destructive lung disease or development of secondary amyloidosis due to chronic, ongoing inflammation; a proportion develop autoimmunity as well.3,4 Here, we present two cases of pre-capillary PH with pathologic changes in pulmonary arteries and veins of intimal hyperplasia, with near-occlusive arterial remodeling. Both patients had clinical improvement with PAH-specific therapies. These findings are consistent with a pulmonary vasculopathy and remodeling, out of proportion to the severity of Granulomatous and Lymphocytic Interstitial Lung Disease (GL-ILD) in these two CVID patients.\n\nCase presentations\nCase 1\nA 42-year-old man with Stage V chronic kidney disease and CVID with hyperimmunoglobulin M was evaluated for PH during a hospital admission for acute right heart failure. He was diagnosed with CVID at 19 years old and was treated with intravenous immunoglobulin (IVIg) since age 38. An echocardiogram showed a severely dilated right ventricle (RV), RV hypertrophy, severe RV systolic dysfunction with an estimated RV systolic pressure (RVSP) of 73 mmHg. His brain natriuretic peptide (BNP) was 1789 pg/mL. Right heart catheterization (RHC) revealed RA pressure of 14 mmHg, mean PA pressure of 54 mmHg, pulmonary capillary wedge pressure (PCWP) of 8 mmHg with a Fick of cardiac output of 3.05 L/min/m2 and pulmonary vascular resistance (PVR) of 15 Woods Units. Chest computed tomography (CT) showed enlarged pulmonary arteries, ground glass opacities in the bilateral lower lobes, no findings of chronic thromboembolic disease (Fig. 1a). Pulmonary function testing (PFT) revealed mild restriction and severely reduced diffusion capacity (forced expiratory volume 2.6 L, 71% predicted; forced vital capacity 3.5 L, 76%; FEV1/FVC 75%; total lung capacity 4.8 L, 78% predicted; diffusing capacity for carbon monoxide 48% predicted). He started sildenafil and ambrisentan but developed worsening RV failure and renal failure prompting admission for dialysis and inhaled epoprostenol. He transitioned to IV epoprostenol therapy with improvement to mild RV systolic dysfunction and BNP normalized to 58 pg/nL.\nFig. 1. Diagnostic images. Case 1: A chest CT (a) at the time of pulmonary arterial hypertension diagnosis showing ground-glass opacities in the bilateral lower lobes. (b) Hematoxylin and Eosin staining of lung biopsy specimen showing organizing pneumonia on a background pattern of non-specific interstitial pneumonia (NSIP), cellular pattern, and pneumocyte hyperplasia. (c) Elastin stain of lung biopsy specimens demonstrating a cross-sectioned pulmonary artery with reduplication of the elastin lamina, intimal hyperplasia, and luminal narrowing. (d) Elastin stain of lung biopsy specimen showing a cross-sectional view of a pulmonary vein with luminal obliteration. Case 2: A chest CT (e) at the time of PAH diagnosis showed inter- and intralobar septal thickening with bilateral bronchiectatic changes as well as ground glass opacities and nodular densities. (f) Hematoxylin and Eosin staining of lung biopsy specimen showing non-specific interstitial pneumonia, fibrosing pattern. (g) Elastin staining of lung biopsy specimen demonstrating pulmonary veins with intimal proliferation and significant luminal narrowing. (h) Elastin stain of a pulmonary artery showing duplication of the elastic lamina and non-occlusive intimal proliferative.\n\n\n\nTwo years later, he developed worsening dyspnea, cough, and hypoxemia, with a chest CT showed multifocal pulmonary infiltrates. Spirometry was stable with worsening diffusion capacity (30% predicted). His echocardiogram showed RVSP 50 mmHg and mildly depressed RV systolic function. Lung biopsy revealed a complex pattern of follicular bronchiolitis/hyperplastic bronchus-associated lymphoid tissue, nonspecific interstitial pneumonitis (NSIP)-like, and lymphoid interstitial pneumonitis (LIP)-like areas, scattered histiocyte aggregates consistent with poorly formed granulomas, and occasional foci of bronchiolitis obliterans-organizing pneumonia (Fig. 1b). Significant fibrosis was also present. Elastin stains demonstrated advanced hypertensive remodeling of both arteries and veins, with intimal hyperplasia (frequently occlusive) and reduplication of the elastic laminae; arterial changes were equivalent to Heath-Edwards grade 3 (no plexiform lesions were present) (Fig. 1c and d). There were no findings of amyloid deposition on pathologic specimens. He was diagnosed with GL-ILD and started on corticosteroids with rapid improvement in hypoxemia and resolution of radiographic abnormalities. He continues on IV epoprostenol for PAH.\n\nCase 2\nA 41-year-old woman with CVID diagnosed at age 27, on chronic IVIg, was admitted for dyspnea and exertional hypoxia. Six years prior to this presentation, she was found to have bronchiectasis, septal thickening, ground glass opacities, and nodular densities on chest CT (Fig. 1e). Lung biopsy revealed follicular bronchiolitis with occasional LIP-like areas, variable bronchiolectasis, a few histiocyte aggregates consistent with poorly formed granulomas, and foci of NSIP-like pattern, both cellular and fibrotic (Fig. 1f). Elastin stains showed mild to moderate arterial hypertensive remodeling, with occasional non-occlusive intimal proliferative lesions and variable reduplication of the elastic laminae, equivalent to Heath-Edwards early grade 2; small veins had frequent mild intimal proliferation (Fig. 1g and h). No evidence of amyloid involvement was seen on pathology. Echocardiogram showed normal RVSP and RV function. She was diagnosed with GL-ILD and treated with corticosteroids with clinical improvement. Spirometry improved to mild-moderate obstruction (FEV1 1.98 L, 64% predicted) and moderately reduced diffusion capacity (50% predicted) and was stable for several years. At the current presentation, she had a new dilated, hypertrophied RV with moderately depressed RV systolic function and estimated RVSP of 87 mmHg on echocardiogram with a BNP of 894 pg/nL. Her PFTs showed similar degree of obstruction with severely reduced diffusion capacity (DLCO 7.1 mL/mmHg/min, 29% predicted). Chest CT showed a dilated PA but was otherwise unchanged compared to prior CT scans. An RHC revealed RA pressure of 7 mmHg, mean PA pressure of 58 mmHg, PCWP of 9 mmHg with a Fick of cardiac output of 4.02 L/min/m2 and PVR of 9.2 Woods Units. Based on advanced pre-capillary PAH with stable, mild parenchymal lung disease, she was offered PAH-directed therapies. She declined parenteral prostacyclin therapy and is currently on tadalafil and ambrisentan, with improvement in clinical symptoms and normalization of BNP (39 pg/nL).\n\nDiscussion\nHere, we present two patients with CVID with pre-capillary PH by invasive hemodynamics and treated with pulmonary vasodilators. Our first case had no evidence of parenchymal lung disease at the time of PH diagnosis, whereas the second case had stable chronic lung disease with a new diagnosis of PH and RV failure. Examination of lung biopsy specimens showed marked pulmonary vascular remodeling involving both the pulmonary arterial and venous system. These pulmonary vascular findings have not yet been reported in this patient population and demonstrate a degree of pulmonary vascular remodeling disproportionate to degree of lung disease.\n\nEchocardiographic evidence of PH and RV dilation has been reported in primary antibody deficiencies.2 A small study found 20% of CVID patients had RV dilation and 45% had echocardiographic evidence of PH, the severity of which correlated with time to CVID diagnosis. Most of these patients had severe lung disease marked by obstruction on pulmonary function tests, hypoxia, and imaging abnormalities. This cohort had one patient with relatively minor pulmonary parenchymal findings and significant PH, like our patients. Cor pulmonale is a frequent cause of death in these patients; however, little data exist about the development of pulmonary vascular disease in this population.5\n\nBoth of our patients were diagnosed with GL-ILD on biopsy. This variety of interstitial lung disease (ILD) is characterized by a non-infectious reaction with nodular peribronchial inflammation and non-necrotizing granulomas.6,7 These granulomas are seen along bronchovascular structures; however, little is published about associated pathology in the pulmonary vasculature of this condition. While both of our patients had parenchymal lung disease, the degree of pre-capillary PH with both venous and arterial vascular remodeling was out of proportion to the severity of ILD at the time of PAH diagnosis and is a finding not previously reported in CVID. Both of our patients had a beneficial response to PAH specific therapies with normalization of BNP and improvement of RV systolic function, this would not be expected with PH primarily related to chronic lung disease, as these therapies do not modify that pathology. The vascular lesions found in these patients indicate a discrete pulmonary vascular disease associated with CVID and warrants PAH specific therapies.\n\nLastly, both of our patients had been treated with long-term intravenous IVIg therapy, raising the question of whether the therapy, instead of the disease, could be implicated in development of PH. Administration of IVIg was problematic for both patients due to infusion volume, prompting transition to more frequent subcutaneous delivery. It is important to consider this variable in patients with RV dysfunction even if related to PH related to chronic lung disease. The literature is devoid of IVIg therapy-associated PH.\n\nThese cases demonstrate the importance of recognizing this vascular complication of CVID, especially in the setting of contemporary prolonged survival due to immunoglobulin and antibiotic therapy. In our experience, these patients have done well with PAH specific therapies.\n\nConflict of interest\nThe author(s) declare that there is no conflict of interest.\n\nFunding\nDr. Hemnes is funded by NIH/NHLBI grant P01HL108800-10.\n==== Refs\nReferences\n1 Chapel H Lucas M Lee M , et al.\nCommon variable immunodeficiency disorders: division into distinct clinical phenotypes\n. Blood \n2008 ; 112 : 277 –286\n.18319398 \n2 Johnston SL Hill SJ Lock RJ , et al.\nEchocardiographic abnormalities in primary antibody deficiency\n. Postgrad Med J \n2004 ; 80 : 214 –218\n.15082842 \n3 Daniil Z Karetsi E Zakynthinos E , et al.\nPulmonary arterial hypertension in a patient with common variable immunodeficiency and unilateral bronchiectasis: Successful treatment with iloprost\n. Eur J Intern Med \n2007 ; 18 : 333 –335\n.17574112 \n4 Arslan S Ucar R Yavsan DM , et al.\nCommon variable immunodeficiency and pulmonary amyloidosis: a case report\n. J Clin Immunol \n2015 ; 35 : 344 –347\n.25773572 \n5 Cunningham-Rundles C Bodian C \nCommon variable immunodeficiency: clinical and immunological features of 248 patients\n. Clin Immunol \n1999 ; 92 : 34 –48\n.10413651 \n6 Bates CA Ellison MC Lynch DA , et al.\nGranulomatous-lymphocytic lung disease shortens survival in common variable immunodeficiency\n. J Allergy Clin Immunol \n2004 ; 114 : 415 –421\n.15316526 \n7 Rao N Mackinnon AC Routes JM \nGranulomatous and lymphocytic interstitial lung disease: a spectrum of pulmonary histopathologic lesions in common variable immunodeficiency–histologic and immunohistochemical analyses of 16 cases\n. Hum Pathol \n2015 ; 46 : 1306 –1314\n.26138782\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2045-8932",
"issue": "10(2)",
"journal": "Pulmonary circulation",
"keywords": "immunology; pathology; pulmonary arterial hypertension; right ventricle function and dysfunction",
"medline_ta": "Pulm Circ",
"mesh_terms": null,
"nlm_unique_id": "101557243",
"other_id": null,
"pages": "2045894020922792",
"pmc": null,
"pmid": "32426112",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "15316526;10413651;17574112;15082842;26138782;25773572;18319398",
"title": "Evidence of pulmonary arterial hypertension in two patients with common variable immunodeficiency.",
"title_normalized": "evidence of pulmonary arterial hypertension in two patients with common variable immunodeficiency"
} | [
{
"companynumb": "US-ACTELION-A-CH2020-206092",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SILDENAFIL"
},
"drugadditional": null,
... |
{
"abstract": "Chagas disease (CD) is a protozoan zoonosis caused by Trypanosoma cruzi. Reactivation of CD occurs via drug-induced immunosuppression before and during transplantation. Here, we report the case of a 62-year-old man diagnosed with classic Hodgkin lymphoma who received highly aggressive conditioning chemotherapy before undergoing stem cell transplantation (SCT). The patient tested positive for CD in pre-transplantation evaluation. The patient exhibited persistent fever and elevated C-reactive protein levels before and after SCT, and was treated with antibiotics. Micro-Strout test showed evidence of trypomastigotes and he was treated with benznidazole until tested negative. Post-transplantation seropositive patients should be screened for possible reactivation.",
"affiliations": "Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Clínica FOSCAL, Hematopoietic and Stem Cell Transplantation Unit, Floridablanca, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.;Clínica FOSCAL, Department of Infectious Diseases, Floridablanca, Santander, Colombia.;Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia.",
"authors": "Chalela|Claudia Marcela|CM|;Peña|Angela Maria|AM|;Roa|Angela Maria|AM|;Reyes|David L|DL|;Rueda|Jennifer Paola|JP|;Salazar|Luis Antonio|LA|;Rosales|Manuel|M|;Gomez|Edgar David|ED|;Bernal|Edgar Augusto|EA|;Melo|Claudia Lucia Sossa|CLS|http://orcid.org/0000-0001-9876-222X",
"chemical_list": null,
"country": "Brazil",
"delete": false,
"doi": "10.1590/0037-8682-0143-2020",
"fulltext": "\n==== Front\nRev Soc Bras Med Trop\nRev Soc Bras Med Trop\nrsbmt\nRevista da Sociedade Brasileira de Medicina Tropical\n0037-8682 1678-9849 Sociedade Brasileira de Medicina Tropical - SBMT \n\n10.1590/0037-8682-0143-2020\n00705\nCase Report\nReactivation of Chagas disease after autologous hematopoietic stem cell transplantation\nChalela Claudia Marcela \n1\n Peña Angela Maria \n1\n\n2\n Roa Angela Maria \n1\n Reyes David L. \n1\n Rueda Jennifer Paola \n1\n Salazar Luis Antonio \n1\n\n2\n Rosales Manuel \n2\n Gomez Edgar David \n1\n\n3\n Bernal Edgar Augusto \n4\n http://orcid.org/0000-0001-9876-222XMelo Claudia Lucia Sossa \n1\n\n2\n \n1 Universidad Autónoma de Bucaramanga, Faculty of Health Sciences, Bucaramanga, Santander, Colombia. \n\n2 Clínica FOSCAL, Hematopoietic and Stem Cell Transplantation Unit, Floridablanca, Santander, Colombia. \n\n3 Clínica FOSCAL, Department of Internal Medicine, Floridablanca, Santander, Colombia. \n\n4 Clínica FOSCAL, Department of Infectious Diseases, Floridablanca, Santander, Colombia. \nCorresponding author: Dr. Claudia Lucia Sossa Melo. e-mail:claudiasossa@gmail.com\nAuthors’ contribution: CLSM: Conception of the study, Acquisition of data, Analysis and interpretation of data, Drafting the article, Final approval of the version to be submitted; CMC: Acquisition of data, Drafting the article, Final approval of the version to be submitted; AMR: Acquisition of data, Drafting the article, Final approval of the version to be submitted; JPR: Acquisition of data, Drafting the article, Final approval of the version to be submitted; AMP: Conception of the study, Analysis and interpretation of data, Final approval of the version to be submitted; SIJ: Conception of the study, Analysis and interpretation of data, Final approval of the version to be submitted; MR: Conception of the study, Analysis and interpretation of data, Final approval of the version to be submitted; LAS: Conception of the study, Analysis and interpretation of data, Final approval of the version to be submitted; DLR: Acquisition of data, Drafting the article; EDG: Acquisition of data, Drafting the article, Final approval of the version to be submitted; EAB: Conception of the study, Analysis and interpretation of data, Final approval of the version to be submitted. \n\n\nConflict of Interest: The authors have no conflict of interest to declare.\n\n\n21 12 2020 \n2021 \n54 e2020014311 5 2020 24 9 2020 This is an open-access article distributed under the terms of the Creative Commons Attribution LicenseAbstract\nChagas disease (CD) is a protozoan zoonosis caused by Trypanosoma cruzi. Reactivation of CD occurs via drug-induced immunosuppression before and during transplantation. Here, we report the case of a 62-year-old man diagnosed with classic Hodgkin lymphoma who received highly aggressive conditioning chemotherapy before undergoing stem cell transplantation (SCT). The patient tested positive for CD in pre-transplantation evaluation. The patient exhibited persistent fever and elevated C-reactive protein levels before and after SCT, and was treated with antibiotics. Micro-Strout test showed evidence of trypomastigotes and he was treated with benznidazole until tested negative. Post-transplantation seropositive patients should be screened for possible reactivation. \n\nKeywords:\nStem cell transplantationChagas diseaseTrypanosoma cruzi\n==== Body\nINTRODUCTION\nChagas disease (CD), a protozoan zoonosis caused by Trypanosoma cruzi (T. cruzi), is responsible for the highest morbidity and mortality related to parasitic infections in the Western Hemisphere, affecting approximately 7 million people worldwide\n1\n. CD is currently an endemic in Latin America with approximately 6 million infected individuals, and is a major public health concern in Central and South America, with an incidence rate of 28,000 cases per year\n2\n. In Colombia, approximately 437,960 people are infected with an estimated T. cruzi infection prevalence of 0.956 per 100 habitants\n1\n.\n\nCD typically occurs in two stages, namely an acute stage and a chronic stage. An acute stage usually lasts for four to eight weeks and is characterized by high parasitemia and parasitic load in tissues. The symptoms include fever, hepatosplenomegaly, palpebral edema, and myocarditis. The chronic stage comprises two different distinguishable phases: a latent or indeterminate phase in which anti-T. cruzi antibodies are present, but no signs or symptoms of Chagas cardiomyopathy or gastrointestinal involvement are identified, followed by a determinate or clinical phase with prevalent cardiac, digestive, and cardiodigestive pathologies\n3\n. Reactivation of the disease occurs when the immune system of a chronically infected host is suppressed or compromised, thereby reducing their ability to control the infection and cause reappearance of acute symptoms. Reactivation of CD observed after transplantation may be related to immunosuppression post-transplantation\n4\n.\n\nCASE REPORT\nA 62-year-old Colombian male diagnosed with classic Hodgkin lymphoma (HL) in October 2014 was treated with six cycles of ABVD (doxorubicin, bleomycin, vinblastine, and dacarbazine) until complete remission was achieved. After disease relapsed in January 2016, the next implementable management strategy was autologous hematopoietic stem cell transplantation (HSCT). In pre-transplant evaluation, the patient tested positive for CD upon serological testing, but no cardiac abnormalities were observed in his electrocardiogram or echocardiogram. The patient received salvage chemotherapy with three cycles of ESHAP (etoposide, methylprednisolone, cytarabine, and cisplatin) followed by a conditioning regimen of BEAM (carmustine, etoposide, cytarabine, and melphalan). In June 2016, three days prior to the transplantation, the patient was found to exhibit fever with elevated C-reactive protein levels, with no clinical evidence of any infection and negative blood cultures. Treatment with meropenem was initiated and three days later, on June 9, 2016, hematopoietic stem cells (11.14 × 106/kg) were infused. On day 2 post-HSCT, after another episode of fever, vancomycin was added to the treatment therapy. Blood and urine cultures were negative, and imaging studies showed no evidence of infection. Despite empiric antibiotic treatment for 10 days, the patient presented persistent fever and elevated C-reactive protein levels. Management strategy included increased administration of meropenem, tigecycline, amikacin, and caspofungin. Myeloid engraftment occurred on day 12 post-HSCT. On day 17 post-HSCT, fever persisted and polymyxin B antibiotic was administered instead. Unfortunately, screening for reactivation of CD was not performed during the first two weeks post-transplantation. Thereafter, micro-Strout test was performed and showed evidence of trypomastigotes (Figure 1). No cutaneous alterations, such as nodules, papules, ulcers, or panniculitis were present. Neurological examination was also normal. Electrocardiography revealed a normal sinus rhythm and echocardiogram showed mild pleural effusion without any evidence of prolongation of isovolumic contraction and relaxation times, or dilation of the heart chambers. Chest CT scan was normal, and abdominal computed tomography showed mild splenomegaly, but no liver enlargement. Blood count, liver function tests, myelogram, and bone marrow biopsy results were also normal. Once the reactivation of CD was confirmed, therapy with nifurtimox at a dosage of 120 mg/day was initiated. Parasitological follow-up was performed with weekly micro-Strout tests, until the patient tested negative, which was observed after three weeks. Additionally, the patient presented primary graft failure requiring several platelet transfusions. Outpatient management with nifurtimox was continued for the patient until completing 60 days of treatment.\n\n\nFIGURE 1: Micro-Strout test of the patient depicting trypomastigotes in peripheral blood sample.\n\n\n\nIn October 2016, 54 days after completion of treatment with nifurtimox, the patient was admitted to the hospital for symptoms, such as general weakness, fatigue, intermittent fever, facial edema, and the patient tested positive in the micro-Strout test. Treatment was initiated with benznidazole at a dosage of 300 mg/day for 60 days, and the follow-up micro-Strout test was found to be negative three weeks later. Further parasitological controls were also negative. The patient has not presented present positive micro-Strout tests or symptoms suggestive of disease reactivation since then.\n\nIn January 2017, the patient presented with early relapse of HL, which was confirmed by positron emission tomography (PET scan) showing markedly hypermetabolic ganglion followed by positive axillary ganglion biopsy. Currently, he is on treatment for HL; however, there is no evidence of CD reactivation or complications associated with the disease.\n\nDISCUSSION\nReactivation of CD is usually associated with the state of immunosuppression. Several cases of reactivation following solid organ or hematopoietic stem cell transplantation, chronic use of immunosuppressants, or immunosuppression due to chronic diseases, such as HIV infection, have been reported. In Latin America, studies have reported reactivation rates in autologous and allogeneic HSCT cases between 17% and 40%\n5\n. Induced immunosuppression to prevent organ rejection in transplant patients causes a disruption in the immune system, which may result in reactivation of chronic CD\n6\n.\n\nDuring the latent or undetermined phase of CD, the balance between T cell responses in the host maintains an equilibrium controlling the infection and destroys both trypomastigotes and intracellular amastigotes, thus limiting tissue damage and consequent symptoms\n7\n. CD4 lymphocytes are the predominant cells which induce protective immunity in Chagas infection\n8\n. Studies in both mice and humans have shown that type 1 T helper cells direct elicitation of antibody response, activation of other T cells, such as CD8 lymphocytes, and activation of phagocytes for parasite killing\n8\n\n,\n\n9\n. CD8 T cells can control infection by secreting cytokines that induce host-cell microbicidal and lytic activity\n9\n. These mechanisms are crucial for controlling parasitemia and infection. \n\nHighly aggressive chemotherapy, which is administered to transplantation patients prior to the procedure, induces severe immunosuppression which causes depletion of CD4 and CD8 lymphocytes. Deficiency of the cells that are essential for induction of immune response disrupts the balance to avoid progression from the indeterminate to the symptomatic chronic form in a chronically infected individual\n10\n. This imbalance leads to an increased parasite load and eventually causes the reactivation of CD.\n\nReactivation of CD can occur as a febrile syndrome that resembles acute graft failure. Clinical manifestations of disease reactivation in immunosuppressed patients also include myocarditis, cutaneous symptoms, such as subcutaneous nodules, papules, ulcers or panniculitis, anemia, jaundice, hepatitis, and meningoencephalitis\n3\n. In the present case, cellular exhaustion induced through long immunosuppressive therapies resulted in reactivation of latent CD that occurred as a febrile syndrome.\n\nAlthough the diagnosis of chronic CD relies on serologic methods, immunosuppressed patients or patients who have received or who continue to receive immunosuppressive therapy may test negative in antibody detection analysis. To diagnose the reactivation of CD in immunocompromised patients, it is recommended to perform parasitological diagnosis using direct methods, such as the Strout test or microhematocrit and, if possible, quantitative PCR\n11\n. Although qualitative PCR is more sensitive than other parasitological methods, positive results of qualitative PCR as well as indirect parasitological methods (hemocultures) can also be considered in chronic disease in the absence of reactivation. Conversely, quantitative PCR can detect and differentiate low-level parasitemia observed in chronic CD from the high parasitemia levels observed during CD reactivation\n12\n\n,\n\n13\n. Therefore, diagnosis of CD reactivation should be based on quantitative PCR and/or microscopic examination of the buffy coat or fresh blood\n3\n\n,\n\n12\n.\n\nIn 2011, a research group with experts in Chagas disease published evidence-based recommendations for donor screening, follow-up testing, and treatment of organ recipients from infected donors (Chin-Hong et al., 2011). Reactivation of CD can be treated with benznidazole or nifurtimox, as they are the only two drugs with proven efficacy against CD\n14\n. The consensus recommends benznidazole as the first-line treatment since it is better tolerated by the transplant recipients and has fewer drug interactions than nifurtimox. Nifurtimox is administered in patients who cannot tolerate benznidazole or if a previous therapy has failed\n14\n. Nifurtimox was administered as the first-line treatment to the patient discussed in this case report since benznidazole was not available in the hospital at the time of diagnosis.\n\nIn a prospective study conducted by Altclas et al. in Argentina, the effect of preemptive therapy in a cohort of 22 patients with CD who underwent bone marrow transplantation was evaluated, and the authors recommended treatment with benznidazole when subclinical or clinical manifestations of CD are present. They found that therapy with benznidazole for at least 30 days in reactivated CD recipients was the most appropriate strategy to clear parasitemia and to prevent new episodes of reactivation in HSCT patients with latent CD\n6\n. \n\nAdditionally, a systematic review assessing the diagnosis and treatment of CD in the United States concluded that patients who underwent transplantation and presented reactivation of the infection were treated with standard doses of benznidazole for 30 to 180 days, which eventually resulted in the resolution of symptoms and reduced parasitemia\n3\n. \n\nPhysicians have not reached a consensus on the use of prophylactic treatment to prevent CD reactivation in immunocompromised patients. Data on the efficacy of prophylactic treatment are insufficient, and the benefits of secondary prophylaxis have not been established thus far\n3\n. \n\nCurrent recommendations for monitoring of post-transplantation seropositive patients propose usage of systematic parasitological controls along with routine examination for detection of signs or symptoms of reactivation\n6\n. Laboratory testing includes basal pre-transplantation and weekly examination of blood smears by microscopy or quantitative molecular testing for two months, followed by bimonthly checks between two and six months post-transplantation, and annually thereafter\n6\n. Moreover, urgent parasitological screening should be performed in case of febrile syndrome or suspected reactivation of chronic CD. \n\nOur case report highlights the importance of considering the reactivation of chronic CD as a highly probable diagnosis in cases of febrile syndrome in a post-transplantation patient with a history of CD. Patients undergoing HSCT are at an increased risk of CD reactivation since their immune system is compromised, which results in the suppression of the pathways involved in controlling the infection. It is crucial to screen patients for CD who opt for stem cell transplantation in endemic countries, and to continue close systematic parasitological testing in post-transplantation patients with latent disease. Moreover, further research is warranted to study the implications of prophylactic treatment in bone marrow transplant recipients with latent CD.\n==== Refs\nREFERENCES\n1 WHO Chagas disease in Latin America: an epidemiological update based on 2010 estimates Wkly Epidemiol Rec 2015 90 6 33 43 25671846 \n2 Tovar-Acero C Negrete-Peñata J González C León C Ortiz M Chacón-Pacheco J New Scenarios of Chagas Disease Transmission in Northern Colombia J Parasitol Res 2017 2017 3943215 3943215 29082037 \n3 Bern C Montgomery SP Herwaldt BL Rassi A Marin-Nieto JA Dantas RO Evaluation and treatment of chagas disease in the United States: a systematic review JAMA 2007 298 18 2171 2181 18000201 \n4 Perez CJ Lymbery AJ Thompson RCA Reactivation of Chagas Disease: Implications for Global Health Trends Parasitol 2015 31 11 595 603 26458782 \n5 Altclas J Sinagra A Dictar M Luna C Verón MT De Rissio AM Chagas disease in bone marrow transplantation: an approach to preemptive therapy Bone Marrow Transplant 2005 36 2 123 129 15908978 \n6 Guiang KM Cantey P Montgomery SP Ailawadhi S Qvarnstrom Y Price T Reactivation of Chagas disease in a bone marrow transplant patient: case report and review of screening and management Transpl Infect Dis 2013 15 6 E264 E267 24147999 \n7 de Morais CG Castro Lima AK Terra R dos Santos RF Da-Silva SA Dutra PM The Dialogue of the Host-Parasite Relationship: Leishmania spp. and Trypanosoma cruzi Infection Biomed Res Int 2015 2015 324915 324915 26090399 \n8 Brener Z Gazzinelli RT Immunological control of Trypanosoma cruzi infection and pathogenesis of Chagas' disease Int Arch Allergy Immunol 1997 114 2 103 110 9338602 \n9 Martin D Tarleton R Generation, specificity, and function of CD8+ T cells in Trypanosoma cruzi infection Immunol Rev 2004 201 304 317 15361249 \n10 Lattes R Lasala MB Chagas disease in the immunosuppressed patient Clin Microbiol Infect 2014 20 4 300 309 24602129 \n11 Piron M Fisa R Casamitjana N López-Chejade P Puig L Vergés M Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples Acta Trop 2007 103 3 195 200 17662227 \n12 Burgos JM Begher SB Freitas JM Bisio M Duffy T Altcheh J Molecular diagnosis and typing of Trypanosoma cruzi populations and lineages in cerebral chagas disease in a patient with AIDS Am J Trop Med Hyg 2005 73 6 1016 1018 16354804 \n13 de Freitas VL da Silva SC Sartori AM Bezerra RC Westphalen EV Molina TD Real-time PCR in HIV/Trypanosoma cruzi coinfection with and without Chagas disease reactivation: association with HIV viral load and CD4 level PLoS Negl Trop Dis 2011 5 8 e1277 21912712 \n14 Chin-Hong PV Schwartz BS Bern C Montgomery SP Kontak S Kubak B Screening and treatment of chagas disease in organ transplant recipients in the United States: recommendations from the chagas in transplant working group Am J Transplant 2011 11 4 672 680 21401868\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0037-8682",
"issue": "54()",
"journal": "Revista da Sociedade Brasileira de Medicina Tropical",
"keywords": null,
"medline_ta": "Rev Soc Bras Med Trop",
"mesh_terms": "D000818:Animals; D014355:Chagas Disease; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007165:Immunosuppression Therapy; D008297:Male; D008875:Middle Aged; D014349:Trypanosoma cruzi; D015047:Zoonoses",
"nlm_unique_id": "7507456",
"other_id": null,
"pages": "e20200143",
"pmc": null,
"pmid": "33338116",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "15361249;21401868;17662227;15908978;18000201;26090399;16354804;24602129;25671846;26458782;9338602;24147999;21912712;29082037",
"title": "Reactivation of Chagas disease after autologous hematopoietic stem cell transplantation.",
"title_normalized": "reactivation of chagas disease after autologous hematopoietic stem cell transplantation"
} | [
{
"companynumb": "CO-TILLOMED LABORATORIES LTD.-2020-EPL-002363",
"fulfillexpeditecriteria": "1",
"occurcountry": "CO",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CYTARABINE"
},
"drugaddit... |
{
"abstract": "About 3% of all cancer patients suffer from carcinoma of unknown primary site (CUP). In spite of its rarity, we will encounter them. While CUPs manifest a wide variety of clinical presentations, they have often resulted in poor prognosis. Although platinum/taxane combination chemotherapy, e.g. carboplatin (CBDCA) + paclitaxel (PTX) is widely used for patients suffering from CUP, the response rate is only about 30-40% and the median overall survival (OS) is only 9 months, which means that improvement is needed. Among the new regimens, the combination of CBDCA, PTX, bevacizumab (BEV) and erlotinib is thought to be highly promising. Herein, we report a case with CUP treated with this regimen and his maintenance therapy. Our patient was a 75-year-old man who was admitted with a left neck lump. CT revealed systemic massive lymphadenopathy. In spite of various investigations for primary origin, he was diagnosed with CUP and treated with CBDCA + PTX + BEV + erlotinib (AUC 6 + 175 mg/m(2) + 15 mg/kg + 150 mg). Since the evaluation of the efficacy indicated partial response, maintenance chemotherapy (BEV and erlotinib) was performed. Chemotherapy was continued for 9 months until the patient was in a progressive disease state with meningeal dissemination. He died 12 months after the initiation of chemotherapy, which is a longer period than the previously reported OS. Of note, according to our case, CBDCA + PTX + BEV + erlotinib and its maintenance chemotherapy are feasible and well tolerated for CUP.",
"affiliations": "Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Otorhinolaryngology, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Clinical Pathology, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.;Departments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, Japan.",
"authors": "Yasui|Hirotoshi|H|;Sato|Kazuhide|K|;Takeyama|Yoshihiro|Y|;Kato|Toshio|T|;Hashimoto|Hiroyuki|H|;Fukui|Yasutaka|Y|;Yoshihisa|Nagashima|N|;Maeda|Matsuyoshi|M|;Gonda|Hideo|H|;Suzuki|Ryujiro|R|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000366268",
"fulltext": "\n==== Front\nCase Rep OncolCase Rep OncolCROCase Reports in Oncology1662-6575S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.ch 10.1159/000366268cro-0007-0583Published online: August, 2014Carcinoma of Unknown Primary Site Treated with Carboplatin + Paclitaxel + Bevacizumab + Erlotinib and Its Maintenance Chemotherapy Yasui Hirotoshi aSato Kazuhide a*Takeyama Yoshihiro aKato Toshio aHashimoto Hiroyuki aFukui Yasutaka aYoshihisa Nagashima bMaeda Matsuyoshi cGonda Hideo aSuzuki Ryujiro aaDepartments of Respiratory Medicine, Toyohashi Municipal Hospital, Toyohashi, JapanbDepartments of Otorhinolaryngology, Toyohashi Municipal Hospital, Toyohashi, JapancDepartments of Clinical Pathology, Toyohashi Municipal Hospital, Toyohashi, Japan*Kazuhide Sato, MD, PhD, Toyohashi Municipal Hospital, 50 Aza-hachiken-nishi, Aotake-cho, Toyohashi, Aichi 441-8570 (Japan) E-Mail kazuhydesato@yahoo.co.jpMay-Aug 2014 20 8 2014 20 8 2014 7 2 583 590 Copyright © 2014 by S. Karger AG, Basel2014This is an Open Access article licensed under the terms of the Creative Commons Attribution-NonCommercial 3.0 Unported license (CC BY-NC) (www.karger.com/OA-license), applicable to the online version of the article only. Users may download, print and share this work on the Internet for noncommercial purposes only, provided the original work is properly cited, and a link to the original work on http://www.karger.com and the terms of this license are included in any shared versions.About 3% of all cancer patients suffer from carcinoma of unknown primary site (CUP). In spite of its rarity, we will encounter them. While CUPs manifest a wide variety of clinical presentations, they have often resulted in poor prognosis. Although platinum/taxane combination chemotherapy, e.g. carboplatin (CBDCA) + paclitaxel (PTX) is widely used for patients suffering from CUP, the response rate is only about 30–40% and the median overall survival (OS) is only 9 months, which means that improvement is needed. Among the new regimens, the combination of CBDCA, PTX, bevacizumab (BEV) and erlotinib is thought to be highly promising. Herein, we report a case with CUP treated with this regimen and his maintenance therapy. Our patient was a 75-year-old man who was admitted with a left neck lump. CT revealed systemic massive lymphadenopathy. In spite of various investigations for primary origin, he was diagnosed with CUP and treated with CBDCA + PTX + BEV + erlotinib (AUC 6 + 175 mg/m2 + 15 mg/kg + 150 mg). Since the evaluation of the efficacy indicated partial response, maintenance chemotherapy (BEV and erlotinib) was performed. Chemotherapy was continued for 9 months until the patient was in a progressive disease state with meningeal dissemination. He died 12 months after the initiation of chemotherapy, which is a longer period than the previously reported OS. Of note, according to our case, CBDCA + PTX + BEV + erlotinib and its maintenance chemotherapy are feasible and well tolerated for CUP.\n\nKey Words\nCarcinoma of unknown primary siteBronchoscopyImmunohistochemistryCarboplatin + paclitaxel + bevacizumab + erlotinibMaintenance chemotherapy\n==== Body\nIntroduction\nCarcinoma of unknown primary (CUP) currently accounts for approximately 3% of all cancer diagnoses. Although empiric chemotherapy with taxane/platinum regimens, e.g. carboplatin (CBDCA) + paclitaxel (PTX) is widely used for CUP patients, no clear evidence exists on the superiority to any other administered regimens. Taxane/platinum regimens yield response rates of 30–40%; the median overall survival (OS) and the median progression-free survival are 9.0 and 6.0 months with 1- and 2-year survival rates of approximately 40 and 20%, respectively [1].\n\nDuring the last several years, new drugs targeting either the angiogenic pathway or the cancer cell proliferation pathway have been used for a variety of cancers, including lung, colon, breast, and pancreatic cancer. Because the lung, colon, and pancreas are often identified as the primary sites by autopsy in CUP patients, it seems that these new drugs are also pertinent in the empiric treatment for such patients. A phase II trial of PTX/CBDCA + bevacizumab (BEV)/erotinib regimen for CUP patients was reported in 2009 [1]. This regimen produced a response rate of 53%, the median OS was 12.6 months, the median progression-free survival was 8 months, and the 1- and 2-year survival rates were 51 and 27%, respectively [1, 2]. Both the median progression-free survival and a 2-year survival rate are the best of the previously reported empiric chemotherapy regimens. Thus, this regimen seems to be promising for CUP patients. We herein report the case of a CUP patient treated with CBDCA, PTX, BEV and erlotinib and his maintenance therapy.\n\nCase Presentation\nA 60-year-old man presented to his primary care physician with cervical lymphadenopathy persisting for 1 month and was referred to an otolaryngologist at our hospital. The patient did not complain about any other symptoms (performance status: PS 0). He had suffered from a colon polyp, which was treated by endoscopic resection 7 years ago, and had a 40-year smoking history of 1.5 packs per day.\n\nHis whole-body contrast-enhanced CT showed lymphadenopathy of the right cervix, bilateral supraclavicule and mediastinum, emphysema and a small nonspecific node in the right upper lung (fig. 1a, b). His head MRI showed multiple ring and solid enhancing lesions, suggesting brain metastasis (fig. 1c, d). 18F-FDG PET/CT demonstrated FDG accumulation in the lymph nodes and a pulmonary node (fig. 1e–g). Serum levels of carcinoembryonic antigen (CEA) were elevated at 16.8 ng/ml (normal values <5 ng/ml), and no other abnormalities were found (table 1) when investigating for tumor markers.\n\nIn order to find a clue for the primary lesion pathologically, needle biopsy of the cervical lymph node was performed. Cytological examination revealed poorly differentiated adenocarcinoma, and immunohistochemistry (IHC) showed the following: cytokeratin (CK) 7 (+), CK20 (+), MUC1 (+), MUC2 (–), SP-A (–), TTF-1 (–), CD5 (–), CDX2 (–), human gastric mucin (–), ALK mutation (–), and EGFR mutation (–) (fig. 2). Bronchoscopy was performed but cytological examination was negative for bronchial lavage fluid, and upper and lower gastroscopy did not show any abnormality. In spite of these diagnostic approaches for detecting the primary site, it remained unclear, and the patient was diagnosed with CUP.\n\nAfter approval by the Intramural Ethics Committee and written informed consent had been given, the patient was treated with CBDCA + PTX + BEV + erlotinib (AUC 6 + 175 mg/m2 + 15 mg/kg + 150 mg). After the chemotherapy had started, the serum level of CEA decreased (fig. 3). Since his whole-body CT revealed a decrease in lymph node size after five cycles of the regimen, the patient achieved partial response (fig. 1h–k). With this result, he was treated with maintenance chemotherapy of BEV + erlotinib (15 mg/kg + 150 mg). No clear side effect was detected in blood chemistry after five cycles (table 2). After six cycles of maintenance chemotherapy (i.e. 8 months after the initial chemotherapy), the patient complained of left facial paralysis. We diagnosed that meningeal dissemination caused this facial paralysis, based on the result of a CT/MRI scan which showed a new contrast-enhanced area in the left internal auditory canal (fig. 1l–o). This result was suggestive of progressive disease, and thus chemotherapy was stopped. Treatment-related toxicity was grade 3 peripheral neuropathy and grade 1 alanine aminotransferase (ALT) elevation as well as stomatitis, skin rash, and dysgeusia; he did not have any hematologic toxicity. Peripheral neuropathy was considered to be possibly related to PTX and indeed improved after CBCDA and PTX treatment was finished.\n\nFurther chemotherapy could not be performed due to the patient's worsening performance states (PS 3). In order to palliate his facial paralysis, neck pain and facial edema due to jugular venous distention by lymphadenopathy, cranial irradiation and radiation therapy for neck lymphadenopathy were performed. Our patient died of CUP 12 months after the initial chemotherapy (fig. 3).\n\nDiscussion\nA primary tumor may not be detected because of its extremely small size or possible local regression due to antitumor immune defenses as well as its protracted clinical latency [3]. Since it is difficult to detect the organs where the primary tumor is located, investigation with imaging, tumor marker and IHC markers is performed to at least classify the type of carcinomas. CUP is classified into four major histopathological subtypes: well- or moderately differentiated adenocarcinomas (50%); undifferentiated or poorly differentiated adenocarcinomas or carcinomas (30%); squamous cell carcinomas (15%), and undifferentiated neoplasms (5%) [4]. In our case, neither CT, MRI and PET images nor endoscopy detected the primary site. IHC examinations showed adenocarcinoma, and positivity of CK7/CK20 suggested transient cell carcinoma, pancreatic ductal carcinoma, cholangiocellular carcinoma and gastric adenocarcinoma. MUC1 overexpresses in serous-type adenocarcinoma, such as breast or pancreatic cancer, MUC2 tends to overexpress in mucinous adenocarcinoma, such as colon, small intestine and bronchus carcinoma. CK7/CK20 results and MUC1 positivity and MUC2 negativity might indicate that our patient's primary tumor was pancreatic adenocarcinoma. Because other IHCs and examinations were not consistent in determining the primary tumor site, the patient was diagnosed with CUP.\n\nTreatments for CUP patients have so far been empirical. Although data from phase III trials are lacking, regimens with new chemotherapeutic agents (e.g. taxanes, gemcitabine, irinotecan) show a modest improvement; most of these new regimens report response rates of 30–50% and a median OS of 8–10 months [5, 6]. CBDCA, PTX, BEV and erlotinib regimens attempt to incorporate molecular targeted agents with the existing empirical first treatment for CUP. BEV, a monoclonal antibody targeting vascular epithelial growth factor (VEGF), which inhibits neoangiogenesis, is used alone or in combination with other anticancer drugs in patients with advanced colon, lung, breast, renal, and ovarian cancer [7, 8, 9, 10]. Erlotinib, an intracellular EGFR tyrosine kinase inhibitor, prolongs survival in lung and pancreatic cancer [11, 12]. Preclinical studies suggested that inhibition of EGFR also resulted in the suppression of VEGF levels and might allow the additional inhibition of the angiogenesis pathway. Moreover, blocking of VEGF receptor and EGFR signaling could lead to the primary tumor overcoming its acquired resistance to EGFR inhibitors [2, 13]. Clinically, anti-EGFR and anti-VEGF combination therapy is well tolerated and effective in several malignancies [2, 13, 14, 15]. The combination regimen seemed to be tolerable and more effective than general CUP prognosis. However, the use of these four agents resulted in an expensive treatment. Further study is necessary regarding the cost-benefit of this treatment.\n\nConclusions\nWe reported the case of a CUP patient treated with CBDCA, PTX, BEV and erlotinib and its maintenance chemotherapy. According to our case, CBDCA + PTX + BEV + erlotinib and its maintenance chemotherapy are feasible and well tolerated for CUP.\n\nDisclosure Statement\nThe authors have no conflicts of interest to declare.\n\nAcknowledgement\nWe are grateful to Dr. Suganuma, Dr. Mashimo and Dr. Mitake for their writing advice. This work was supported by CJLSG (Central Japan Lung Study Group).\n\nFig. 1 a, b Lymphadenopathy of the right cervix and a small nonspecific node in the right upper lung on CT. c, d Metastasis in the right frontal and parietal lobe and no lesion in the internal auditory canals on head MRI. e–g Multiple metastatic lesions in the cervical lymph nodes, a pulmonary node, and accumulation in cervical and mediastinal lymph nodes on PET-CT. No other accumulation was observed except a pulmonary node. h–k Response on CT after five cycles of CBDCA, PTX, BEV, and erlotinib. Cervical lymph nodes decreased in size (h), but the pulmonary node did not change (i). Head metastasis was reduced (j) and no new lesion was observed (k). l–o Evaluation after six cycles of maintenance with BEV and erlotinib. CT and MRI (T1 weighted with gadolinium) showed no specific changes in each of the lesions except the appearance of a contrast-enhanced area in the left internal auditory canal (arrow).\n\nFig. 2 Cytological examination of cervical lymph node needle biopsy. Original magnifications. ×400. a HE stain; the arrow indicates the duct of the gland. IHC staining was positive for CK7 (b), CK20 (c), and MUC1 (d).\n\nFig. 3 Overview of the therapy and change of CEA. The arrows show chemotherapies (CBDCA, PTX, and BEV) and the bar shows erlotinib.\n\nTable 1 Blood biochemistry and tumor markers before the therapy; CEA was elevated, and no other abnormalities were found\n\nWBC\t6,900/μl\tTP\t7.0 g/dl\tCEA\t16.8 ng/ml\t\nNeutrophils\t60.6%\tAST\t25 U/l\tSCC\t0.9 ng/ml\t\nLymphocytes\t30.0%\tALT\t36 U/l\tSLX\t36.1 U/ml\t\nMonocytes\t7.0%\tLDH\t267 U/l\tNSE\t9.8 ng/ml\t\nEosinophils\t2.0%\tALP\t233 U/l\tAFP\t3.2 ng/ml\t\nBasophils\t0.4%\tγGTP\t32 U/l\tCA19-9\t12.9 U/ml\t\n\t\tT-Bil\t0.6 mg/dl\tPSA\t0.853 ng/ml\t\nRBC\t486 × 104/μl\tBUN\t20 mg/dl\tsIL2-R\t443 U/ml\t\nHb\t15.2 g/dl\tCre\t0.82 mg/dl\t\t\t\nHt\t45.3%\tNa\t142 mEq/l\t\t\t\nPlt\t23.2 × 104/μl\tK\t4.6 mEq/l\t\t\t\n\t\tCl\t105 mEq/l\t\t\t\n\t\tCRP\t0.22 mg/dl\t\t\t\nTP = total protein; ALP = alkaline phosphatase; γGTP = γ-glutamyl transpeptidase; T-Bil = total bilirubin; SCC = squamous cell carcinoma antigen; SLX =sialyl lewis X-i antigen; NSE = neuron-specific γ-enolase; AFP = α-fetoprotein.\n\nTable 2 Blood biochemistry after five cycles of CBDCA + PTX + BEV + erlotinib; no side effects and abnormalities were detected\n\nWBC\t7,890/μl\tTP\t6.3 g/dl\t\nNeutrophils\t73.0%\tAST\t23 U/l\t\nLymphocytes\t21.0%\tALT\t38 U/l\t\n\t\tT-Bil\t0.8 mg/dl\t\nRBC\t288 × 104/μl\tBUN\t24 mg/dl\t\nHb\t10.7 g/dl\tCre\t0.99 mg/dl\t\nHt\t34.1%\tNa\t141 mEq/l\t\nPlt\t19.1 × 104/μl\tK\t4.5 mEq/l\t\n\t\tCl\t103 mEq/l\t\n\t\tCRP\t0.03 mg/dl\t\nFor the abbreviations used, refer to table 1.\n==== Refs\nReferences\n1 Huebner G Link H Kohne CH Paclitaxel and carboplatin vs gemcitabine and vinorelbine in patients with adeno- or undifferentiated carcinoma of unknown primary: a randomised prospective phase II trial Br J Cancer 2009 100 44 49 19066607 \n2 Hainsworth JD Spiqel DR Thompson DS Paclitaxel/carboplatin plus bevacizumab/erlotinib in the first-line treatment of patients with carcinoma of unknown primary site Oncologist 2009 14 1189 1197 19965914 \n3 Alberti C Carcinoma of unknown primary (CUP); some considerations about pathogenesis and diagnostic strategy, particularly focusing on CUPS pertaining to the Urology G Chir 2012 33 41 46 22357439 \n4 Pavilidis N Pentheroudakis G Cancer of unknown primary site: 20 questions to be answered Ann Oncol 2010 21 suppl 7 vii303 vii307 20943633 \n5 Creco FA Rodriguez GI Shaffer DW Carcinoma of unknown primary site: sequential treatment with paclitaxel/carboplatin/etoposide and gemcitabine/irinotecan: a Minnie Pearl Cancer Research Network phase II trial Oncologist 2004 9 644 652 15561808 \n6 Pouessel D Culine S Becht C Gemcitabine and docetaxel as frontline chemotherapy in patients with carcinoma of unknown primary site Cancer 2004 100 1257 1261 15022294 \n7 Yang JC Haworth L Sherry RM A randomized trial of bevacizumab, an anti-vascular endothelial growth factor antibody, for metastatic renal cancer N Engl J Med 2003 349 427 434 12890841 \n8 Hurwitz H Fehrenbacher L Novotny W Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer N Engl J Med 2004 350 2335 2342 15175435 \n9 Sandler AB Gray R Perry MC Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer N Engl J Med 2006 355 2542 2550 17167137 \n10 Miller KD Wang M Gralow J Paclitaxel plus bevacizumab versus paclitaxel alone for metastatic breast cancer N Engl J Med 2007 357 2666 2676 18160686 \n11 Moore MJ Goldstein D Hamm J Erlotinib plus gemcitabine compared with gemcitabine alone in patients with advanced pancreatic cancer: a phase III trial of the National Cancer Institute of Canada Clinical Trials Group J Clin Oncol 2007 25 1960 1966 17452677 \n12 Rosell R Carcereny E Gervalis R Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicenter, open-label, randomized phase 3 trial Lancet Oncol 2012 13 239 246 22285168 \n13 Herbst RS Ansari R Bustin F Efficacy of bevacizumab plus erlotinib versus erlotinib alone in advanced non-small-cell lung cancer after failure of standard first-line chemotherapy (BeTa): a double-blind, placebo-controlled, phase 3 trial Lancet 2011 377 1846 1854 21621716 \n14 Tournigand C Samson B Scheithauer W Bevacizumab (Bev) with or without erlotinib as maintenance therapy, following induction first-line chemotherapy plus Bev, in patients (pts) with metastatic colorectal cancer (mCRC): efficacy and safety results of International GERCOR GREAM Phase III trial (abstract) J Clin Oncol 2012 30 suppl 18 LBA3500 \n15 Van Cutsem E Vervenne WL Bennouna J Phase III trial of bevacizumab in combination with gemcitabine and erlotinib in patients with metastatic pancreatic cancer J Clin Oncol 2009 27 2231 2237 19307500\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-6575",
"issue": "7(2)",
"journal": "Case reports in oncology",
"keywords": "Bronchoscopy; Carboplatin + paclitaxel + bevacizumab + erlotinib; Carcinoma of unknown primary site; Immunohistochemistry; Maintenance chemotherapy",
"medline_ta": "Case Rep Oncol",
"mesh_terms": null,
"nlm_unique_id": "101517601",
"other_id": null,
"pages": "583-90",
"pmc": null,
"pmid": "25298764",
"pubdate": "2014-05",
"publication_types": "D002363:Case Reports",
"references": "19965914;17452677;18160686;15561808;19066607;21621716;12890841;20943633;22357439;19307500;17167137;15175435;15022294;22285168",
"title": "Carcinoma of unknown primary site treated with Carboplatin + Paclitaxel + bevacizumab + erlotinib and its maintenance chemotherapy.",
"title_normalized": "carcinoma of unknown primary site treated with carboplatin paclitaxel bevacizumab erlotinib and its maintenance chemotherapy"
} | [
{
"companynumb": "JP-TEVA-554584ISR",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ERLOTINIB"
},
"drugadditional": null,
"drug... |
{
"abstract": "BACKGROUND\nPembrolizumab (P) is an anti-PD-1 antibody that blocks the interaction between programmed cell death protein 1 (PD-1) on T-cells and PD-L1 and PD-L2 on tumour cells. A phase Ib trial of P plus chemotherapy was undertaken to evaluate the safety and efficacy.\n\n\nMETHODS\nPatients with advanced, metastatic solid tumours were enrolled onto one of six treatment arms. Pembrolizumab was given: with gemcitabine (G), G+docetaxel (D), G+nab-paclitaxel (NP), G+vinorelbine (V) or irinotecan (I) until progression or toxicity, or with liposomal doxorubicin (LD) for up to 15 cycles, progression or toxicity. Safety monitoring and response assessments were conducted.\n\n\nRESULTS\nForty-nine patients were enrolled and treated. The most common adverse events were transaminitis, cytopenias, rash, diarrhoea, fatigue, nausea and vomiting. Arm 2 was closed due to poor accrual. The recommended phase II dose (RP2D) was determined for Arms 1, 3a, 4, 5 and 6. There were eight partial responses across multiple tumour types.\n\n\nCONCLUSIONS\nStandard dose P can be safely combined with G, G+NP, G+V, I and LD. Efficacy was observed in multiple tumour types and evaluation to determine if response and duration of response are more robust than what would be expected for chemotherapy or immunotherapy alone requires further validation.",
"affiliations": "Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.;Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA.",
"authors": "Weiss|Glen J|GJ|;Waypa|Jordan|J|;Blaydorn|Lisa|L|;Coats|Jessica|J|;McGahey|Kayla|K|;Sangal|Ashish|A|;Niu|Jiaxin|J|;Lynch|Cynthia A|CA|;Farley|John H|JH|;Khemka|Vivek|V|",
"chemical_list": "C520255:130-nm albumin-bound paclitaxel; D000418:Albumins; D061067:Antibodies, Monoclonal, Humanized; D043823:Taxoids; C506643:liposomal doxorubicin; D003841:Deoxycytidine; D000077143:Docetaxel; D011092:Polyethylene Glycols; D014747:Vinblastine; D000077146:Irinotecan; D004317:Doxorubicin; C056507:gemcitabine; C582435:pembrolizumab; D017239:Paclitaxel; D000077235:Vinorelbine; D002166:Camptothecin",
"country": "England",
"delete": false,
"doi": "10.1038/bjc.2017.145",
"fulltext": "\n==== Front\nBr J CancerBr. J. CancerBritish Journal of Cancer0007-09201532-1827Nature Publishing Group bjc201714510.1038/bjc.2017.14528588322Clinical StudyA phase Ib study of pembrolizumab plus chemotherapy in patients with advanced cancer (PembroPlus) PembroPlus in advanced cancerWeiss Glen J 1*Waypa Jordan 1Blaydorn Lisa 1Coats Jessica 1McGahey Kayla 1Sangal Ashish 1Niu Jiaxin 1Lynch Cynthia A 1Farley John H 1Khemka Vivek 11 Western Regional Medical Center, Cancer Treatment Centers of America, 14200 W Celebrate Life Way, Goodyear, AZ 85338, USA* E-mail: drglenweiss@outlook.com27 06 2017 06 06 2017 117 1 33 40 06 01 2017 25 04 2017 26 04 2017 Copyright © 2017 Cancer Research UK2017Cancer Research UKFrom twelve months after its original publication, this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 4.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/Background:\nPembrolizumab (P) is an anti-PD-1 antibody that blocks the interaction between programmed cell death protein 1 (PD-1) on T-cells and PD-L1 and PD-L2 on tumour cells. A phase Ib trial of P plus chemotherapy was undertaken to evaluate the safety and efficacy.\n\nMethods:\nPatients with advanced, metastatic solid tumours were enrolled onto one of six treatment arms. Pembrolizumab was given: with gemcitabine (G), G+docetaxel (D), G+nab-paclitaxel (NP), G+vinorelbine (V) or irinotecan (I) until progression or toxicity, or with liposomal doxorubicin (LD) for up to 15 cycles, progression or toxicity. Safety monitoring and response assessments were conducted.\n\nResults:\nForty-nine patients were enrolled and treated. The most common adverse events were transaminitis, cytopenias, rash, diarrhoea, fatigue, nausea and vomiting. Arm 2 was closed due to poor accrual. The recommended phase II dose (RP2D) was determined for Arms 1, 3a, 4, 5 and 6. There were eight partial responses across multiple tumour types.\n\nConclusions:\nStandard dose P can be safely combined with G, G+NP, G+V, I and LD. Efficacy was observed in multiple tumour types and evaluation to determine if response and duration of response are more robust than what would be expected for chemotherapy or immunotherapy alone requires further validation.\n\npembrolizumabimmunotherapychemotherapyclinical trialphase Iadvanced/metastatic solid tumours\n==== Body\nIn recent years, there has been fervor over the potential promise of immunotherapy for treating advanced solid tumours. Interest was piqued by the first reports of single agent activity of checkpoint inhibitors in low immunogenic cancers such as non-small cell lung cancer (NSCLC) (Herzberg et al, 2016). Since 2014, there are now three FDA approved inhibitors of programmed cell death protein 1 (PD-1) and PD-1 ligand (PD-L1) with indications across a number of solid tumours, including NSCLC. Yet, for many patients with advanced cancers under those approved indications and many more patients with other types of tumours, the responses and durability of those responses have significant room for improvement.\n\nCancers may possess multiple modalities to evade immune response including secreting cytokines such as TGF-β and IL-10 or other molecules such as PD-L1 and forming an immune suppressive microenvironment populated with T-regulatory cells (Tregs), macrophages and myeloid-derived suppressor cells (MDSCs) (Duffy and Greten, 2014). By causing apoptotic cell death of cancer cells, chemotherapy can be immunogenic by stimulating anticancer immune effectors directly or mitigating immunosuppressive mechanisms (Zitvogel et al, 2011). Systemic chemotherapy may stimulate immunosurveillance by antigenicity, immunogenicity or susceptibility (Zitvogel et al, 2013). Antigenicity is the result of increasing the expression or presentation of tumour-associated antigens on the cell surface of cancer cells. Immunogenicity is causing tumour cells to emit ‘danger’ signals that trigger innate immune responses by operating as adjuvants. Susceptibility is enhancing the likelihood that tumour cells will be recognised and killed by immune effectors.\n\nOne means to improve on the efficacy of this approach potentially involves the combination of checkpoint inhibition with agents or tools of different mechanisms of action in the hopes of a deliverance of a windfall of synergism (e.g., chemotherapy, radiotherapy, targeted therapy or other types of immunotherapy). There have been recent clinical data on synergetic effects of cytotoxic chemotherapy given in combination with checkpoint inhibitors (Langer et al, 2016; Rizvi et al, 2016). We hypothesise that with sufficient tumour cell kill with the combination of systemic cytotoxic and pembrolizumab (P), a PD-1 inhibitor, the response may be enhanced to achieve long durable complete responses. This phase Ib study was designed to identify the recommended phase II dose (RP2D) for several systemic chemotherapies in combination with P.\n\nMaterials and methods\nStudy design\nThis Phase Ib, open-label trial included six separate treatment arms for adults with advanced solid tumours and was performed at a single centre in the United States. Enrolment on the phase Ib portion was between 19 December 2014 and 22 July 2015. Prior to initiating any protocol-related activities, signed written informed consent was obtained from each patient. The study protocol, amendments to the protocol and the sample informed consent file were reviewed and approved by the Western Institutional Review Board (WIRB) and the study was registered on clinicaltrials.gov (NCT02331251). The study conformed to Good Clinical Practice guidelines and in accordance with the ethical principles set forth in the Declaration of Helsinki.\n\nP 2 mg kg−1 was administered intravenously over 30 min every 21 days and infused prior to the start of the assigned chemotherapy arm. No dose reductions of P were permitted. The starting dose levels for each treatment arm were as follows:\nArm 1: Gemcitabine 1000 mg m−2 on day 1 and day 8 every 21 days.\n\nArm 2: Gemcitabine 900 mg m−2 on day 1 and day 8 and docetaxel 75 mg m−2 on day 8 every 21 days.\n\nArm 3: Gemcitabine 1000 mg m−2 and nab-paclitaxel 125 mg m−2 on day 1 and day 8 every 21 days.\n\nArm 4: Gemcitabine 1000 mg m−2 and vinorelbine 25 mg m−2 on day 1 and day 8 every 21 days.\n\nArm 5: Irinotecan 300 mg m−2 on day 1 every 21 days.\n\nArm 6: Liposomal doxorubicin 30 mg m−2 on day 1 every 21 days (note: the total cumulative dose of liposomal doxorubicin allowed on this protocol is 450 mg m−2 or 15 cycles if there are no dose reductions).\n\n\n\nCriteria for inclusion in and exclusion from the study are listed in Section 1 of the Supplementary Section. Patients remained on treatment until disease progression (PD), refusal, withdrawal of consent or occurrence of unacceptable toxicity.\n\nStudy end points\nThe primary objective of the study was to determine the RP2D of chemotherapy in combination with P in subjects with advanced cancer. Secondary objectives included determining (i) the frequency of grade 3 or higher treatment-related adverse events, (ii) the response rate by immune-related response criteria (irRECIST) (Nishino et al, 2013) and response evaluation criteria in solid tumours (RECIST) 1.1 criteria (Eisenhauer et al, 2009) and (iii) the overall survival and progression-free survival for enrolled patients.\n\nAssignment of study participants to treatment groups and dose de-escalation modalities\nThe dose de-escalation scheme (Le Tourneau et al, 2009) was initiated whereby standard doses for cytotoxic chemotherapy were based or modified to conform with an every 21-day dosing cycle to coincide with standard P dosing at the time of study launch. For example, Arm 3 omitted day 15 gemcitabine and nab-paclitaxel dosing, and on Arm 6 liposomal doxorubicin was based on routine medical oncology practice dosing of 40 mg m−2 on a 28-day schedule and converted to 30 mg m−2 on a 21-day schedule. If on any of the treatment arms, ⩽1 of 3 patients experienced first cycle DLT, up to 3 more patients were enrolled. If ⩾2 or more patients on a dose level experienced first cycle DLTs, the MTD was considered to have been exceeded and 3 patients were treated at the predefined lower dose level. To be declared the RP2D, the dose level being explored would require no more than one of six patients with a DLT.\n\nToxicity was graded according to the NCI CTCAE version 4.03, with DLT being defined in this study as any event for which the relationship to study treatment could not be definitely excluded. Events that can classify a DLT are provided in Section 2 of the Supplementary Section.\n\nSubjects were replaced if they do not complete the planned dose on cycle 1 day 1 because of an infusion reaction, provided that the infusion reaction was not grade 3 or higher.\n\nTreatment\nNo more than two intrapatient dose de-escalations were allowed. Initially, dexamethasone premedication was not allowed. However, upon observation of increased nausea, vomiting (despite use of other antiemetic agents), as well as rash and oedema in the extremities due to the systemic chemotherapy, the protocol was amended in September 2015 to require dexamethasone 12 mg intravenous premedication on the days of systemic chemotherapy administration. This decision was also based on observations that safety and efficacy from other ongoing immunotherapy plus chemotherapy trials at the time were not impeded by steroid premedication. Recommended dose modifications in Supplementary Table S1 were only applied to toxicities observed during or after the first and subsequent cycles of treatment.\n\nRemoval of participants from treatment or assessment\nPatients could continue therapy unless there was PD at any time, they experienced unacceptable toxicity dictating cessation of treatment, there was a change in their medical status (including pregnancy) such that the investigator believed that their safety was compromised or that it was in their best interest to stop treatment, they withdrew consent, they were non-compliant with protocol requirements or were lost to follow-up.\n\nEfficacy assessments\nDetermination of antitumour efficacy was based on objective tumour assessments performed according to RECIST 1.1 (Eisenhauer et al, 2009) and irRECIST (Nishino et al, 2013), and treatment decisions by the investigator were based on these assessments. A clinically stable patient meeting criteria for PD on RECIST 1.1 but with stable disease (SD) or better by irRECIST was permitted to continue on protocol until there was clinical deterioration, significant toxicity or PD by irRECIST.\n\nSafety assessments\nSeverity of AEs was graded according to NCI CTCAE version 4.03. For each event, the highest severity grade attained was reported. The causality between each AE and study treatment was classified according to the following terms: definitely not related, unlikely related, likely related and definitely related.\n\nStatistical and analytical plans\nFor the evaluation of the primary end point (i.e., RP2D), all treated patients were considered, except those who had failed to receive a complete first cycle of treatment for reasons other than DLTs. In this case, these patients were replaced with additional patients at the same dose level, in accordance with the protocol. All patients who were evaluable for the primary end point were displayed in the study outputs.\n\nResults\nA total of 50 patients were enrolled and 49 patients were dosed on the Phase Ib study. One patient was enrolled but never treated due to an acute GI bleed prior to initiation of treatment. Two patients were unevaluable for DLT assessment and were replaced. At the time of data-cutoff on 1 December 2016, all patients were off study treatment.\n\nThe median age at study entry was 55 years and 36 were women (Tables 1 and 2). All but one patient had a KPS performance status of 80% or better at the time of enrolment. The most common cancer types included breast cancer (12 patients), pancreatic adenocarcinoma (PDAC) (11 patients), NSCLC (8 patients), sarcoma (7 patients), small cell lung cancer (SCLC) (5 patients) and ovarian cancer (2 patients). At study entry, all patients were pathologically confirmed to have advanced metastatic disease. Thirty-seven patients (75.6%) including all patients in arms 1, 2, 4 and 5 had been pretreated (having received at least one prior systemic therapy (e.g., chemotherapy, targeted therapy or hormonal therapy) that had been used mostly in the metastatic setting). The number of treatment cycles per patient per treatment arm is provided in Supplementary Table S2.\n\nDose de-escalation by arm and first cycle DLTs\nIn Arm 1, there was one DLT (received less than 25% planned dose due to grade 4 neutropenia), and RP2D is gemcitabine 1000 mg m−2 days 1 and 8 every 21 days with P on day 1. Arm 2 enrolled one patient and was closed for futility after observing that several prescreened patients would not be eligible for this treatment arm and it would not accrue in an adequate time frame. Arm 3 initially enrolled treatment naïve and previously treated PDAC patients. There were two DLTs (grade 3 thrombocytopenia) observed in the first five patients. Upon further review, these DLTs were seen only in previously treated PDAC patients. The protocol was amended to split this arm into 3a (treatment naïve PDAC) and 3b (previously treated PDAC), where Arm 3b was dose reduced to gemcitabine 800 mg m−2 and nab-paclitaxel 100 mg m−2 on days 1 and 8 every 21 days with P on day 1. The RP2D for Arm 3a is gemcitabine 1000 mg m−2 and nab-paclitaxel 125 mg m−2 on days 1 and 8 every 21 days with P on day 1. On dose level 1 on Arm 4, there were two DLTs in six patients (received less than 25% planned dose due to grade 3 and grade 4 neutropenia, respectively). On dose level −1, there was one DLT in six patients (grade 3 thrombocytopenia) and the RP2D for Arm 4 is gemcitabine 800 mg m−2 and vinorelbine 20 mg m−2 on days 1 and 8 every 21 days with P on day 1. On dose level 1 on Arm 5 there were two DLTs in five patients (grade 3 fatigue and grade 3 nausea, vomiting, and diarrhoea). On dose level −1, one patient withdrew consent and was not evaluable for DLT. At this dose level, there was one DLT in six patients (grade 3 rash and papilloedema), and the RP2D for Arm 5 is irinotecan 250 mg m−2 with P on day 1 every 21 days. Arm 6 had one patient that developed a grade 2 infusion reaction within the first 2 min of liposomal doxorubicin infusion and because of safety concerns with drug re-challenging, she was removed from the study and replaced. Going forward, premedication with diphenhydramine was mandatory on Arm 6 and there were no DLTs in the subsequent six patients. The RP2D for Arm 6 is liposomal doxorubicin 30 mg m−2 with P on day 1 every 21 days (Table 3).\n\nSafety results by treatment arm\nAll (100%) receiving study treatment experienced at least one treatment-emergent AE (TEAE), with 28 patients (57.1%) experiencing TEAEs of grade 3–4 (Table 4). Once dexamethasone premedication was introduced to all subsequent patients (affecting Arms 3–5), the incidence of gastrointestinal AEs (e.g., nausea, vomiting) and oedema in the extremities and rash decreased.\n\nImmune-related adverse events (irAEs) (likely or definitely related) were reported in 50%, 100%, 77.8%, 0%, 33.3%, 33.3% and 57.1% of patients on Arms 1, 2, 3a, 3b, 4, 5 and 6, respectively. Of these, two irAEs led to a dose reduction (both DLTs, one in Arm 4 for grade 3 hypoxia with grade 2 nausea and vomiting and the other in Arm 5 for grade 3 rash and papilloedema). Patient level TEAEs are provided in Supplementary Table S2.\n\nAfter mandatory premedication with dexamethasone was initiated (see Supplementary Table S2), the frequency of grade 3/4 events appears to have decreased. The average number of grade 3/4 events per patient that enrolled prior to this amendment was 1.1 vs 0.75 grade 3/4 events per patient, respectively. The incidence of likely or definitely related irAEs for patients was also higher prior to the amendment at 20 of 37 (54.1%) compared with 4 of 12 (33.3%).\n\nTwo patients died during the study (i.e., within 30 days of coming off study) due to PD (one case each of PDAC and NSCLC, respectively), but these deaths were deemed not to be related to the study medication.\n\nEfficacy results by treatment arm\nForty-five of 49 patients (92%) treated on the study were evaluable for efficacy. On Arm 1, the best response was PD. On Arm 2, the best response was SD. On Arm 3a, the best response was partial response (PR) for two patients and SD for six patients. On Arm 3b, the best response was PD. On Arm 4, the best response was PR for one patient, SD for three patients, and PD for 7 patients. On Arm 5, the best response was PR for four patients, SD for one patient and PD for six patients. On Arm 6, the best response was PR for 1 patient, SD for two patients, and PD for three patients (Table 5). Representative responders for Arms 3a, 4, 5 and 6 are displayed in Supplementary Figures S1–S4.\n\nDiscussion\nIn 2016, nearly 600 000 individuals diagnosed with cancer will die from their disease (Cancer Facts & Figures 2016 | American Cancer Society). While some may have long-term disease-free intervals, for most individuals who are diagnosed with metastatic disease, the survival rate is less than 5 years. For primary cancers of the lung, connective tissue or pancreas, few individuals will live 2 years with metastatic disease. Patients with metastatic disease are usually treated with systemic chemotherapy, with the intent of prolonging survival and palliate symptoms (e.g., pain, weight loss and decreased performance status). For the most common advanced stage cancer, there are consensus guideline first- and/or second-line systemic treatment recommendations. Year after year, randomised trials are designed and launched to try and improve on median overall survival outcomes. In oncology, the success rate from phase I to FDA approval is a dismal 11% (Hay, 2011). Even with the successful phase III clinical trials, the improvement in overall survival is modest, increasing the median by weeks to several months. For common non-haematologic cancers (and many rare cancers), there are no design strategies that are primarily seeking to attain complete (and hopefully durable) responses.\n\nThere have been promising results with checkpoint inhibitors across multiple tumours, including in melanoma, renal cell carcinoma and NSCLC (Topalian et al, 2012; Robert et al, 2014). There is now accumulating data on the presence of PD-L1 expression across a number of tumour types, including SCLC, PDAC and sarcoma (Bigelow et al, 2013; Kim et al, 2013; Yu et al, 2017). While PD-L1 and/or mutational tumour burden appear to be useful for identifying those most likely to benefit from single-agent checkpoint inhibition, when combination therapy is considered this biomarker does not appear to have a definitive role (Topalian et al, 2012; Wolchok et al, 2013; Le et al, 2015). Additionally, the functional state of the host immune system and/or its interaction with microbiota can have an impact on the therapeutic efficacy of systemic treatment (Sivan et al, 2015; Vetizou et al, 2015).\n\nThe present study is one of the first reported multi-arm systemic chemotherapy in combination with PD-1 inhibitors across diverse advanced solid tumours. Several systemic chemotherapy agents have been implicated in having immunotherapeutic-enhancing properties. For the agents evaluated in this study, we briefly outline the reported effects of gemcitabine, docetaxel, paclitaxel, vinorelbine, irinotecan and doxorubicin (Galluzzi et al, 2012; Duffy and Greten, 2014). Gemcitabine can increase class I HLA expression, enhance tumour antigen cross-presentation and selectively kill MDSCs. Docetaxel can decrease MDSCs. Paclitaxel can stimulate antigen-presenting dendritic cells and increase tumour cell permeability to granzyme B. Vinorelbine can facilitate the bystander death of immune cells. Irinotecan can decrease MDSC and Tregs. Doxorubicin can induce immunogenic cell death, increase tumour cell permeability to granzyme B and stimulate antigen presentation dendritic cells.\n\nOverall, 50 patients with advanced/metastatic solid tumours were enrolled and 47 were evaluable for the primary endpoint. Each completed treatment arm has a RP2D. Arm 3b is unlikely to complete accrual for RP2D. Main toxicities observed were transaminitis, cytopenias, rash, diarrhoea, fatigue, nausea and vomiting. There do not appear to be a signal for increased immune-related AEs, particularly once dexamethasone premedication was administered on the days of systemic chemotherapy infusion. There were multiple responses observed and a few appear to be supra-normal and may be a signal of potential synergy. The phase II portions of the arms with a RP2D are ongoing and subsequent future reporting of those results are planned.\n\nThere are ongoing studies involving a variety of immunotherapy plus targeted or chemotherapy agents now across a number of different cancer types and it remains to be seen which of these combinations will be true game changers and deliver long lasting responses with manageable or minimal toxicity. In conclusion, this study was successful in identifying the RP2D of multiple systemic chemotherapies in combination with P and in characterising the safety profile of these combinations on a 21-day treatment cycle.\n\nWe thank the cancer patients who participated and all clinical staff who assisted. This study was sponsored by Western Regional Medical Center, Inc.\n\nAuthor contributions\n\nConception and design: VK and GJW; acquisition of data: all authors; analysis and interpretation of data: VK and GJW; writing, review and/or revision of the manuscript: all authors; administrative, technical or material support (e.g., reporting or organising data, constructing databases): LB, JC, JW, KG and GJW; study supervision: VK and GJW.\n\nSupplementary Information accompanies this paper on British Journal of Cancer website (http://www.nature.com/bjc)\n\nThis work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 4.0 Unported License.\n\nGJW: Consultant for Blend Therapeutics, Pharmatech, Viomics and Paradigm; Speakers' Bureau: Medscape, Merck, Novartis; Travel/accommodations: NantWorks. JN: Consultant for Astrazeneca and Eisai; JHF: Genentech speaker’s bureau; and VK: Consultant for Axcess Oncology. The remaining authors declare no conflict of interest.\n\nSupplementary Material\nSupplementary Figure Legends Click here for additional data file.\n\n Supplementary Material Click here for additional data file.\n\n Supplementary Tables Click here for additional data file.\n\n Supplementary Figures Click here for additional data file.\n\n Table 1 Demographic, baseline and other patient characteristics\n \tTreated patients (N=49)\t\nVariable\tn\t%\t\nDemographic characteristics\t\n Age (years)\t \t \t\n Median (range)\t \t55 (27–74)\t\n Sex\t \t \t\n Male\t13\t26.5\t\n Female\t36\t73.5\t\n Performance status (KPS)\t \t \t\n 100\t2\t4.1\t\n 90\t19\t37.8\t\n 80\t27\t55.1\t\n 70\t1\t2\t\nDisease characteristics\t\n Primary diagnosis\t \t \t\n Breast cancer\t12\t24.5\t\n Pancreatic cancer\t11\t22.4\t\n NSCLC\t8\t16.3\t\n Sarcoma\t7\t14.3\t\n SCLC\t5\t10.2\t\n Ovarian cancer\t2\t4.1\t\n Other\t3\t6.1\t\nPrior anticancer therapies for metastatic disease\t\n Type of prior therapiesa,b\t \t \t\n Systemic only\t19\t38.8\t\n Surgery+Systemic\t2\t4.1\t\n Systemic+Radiotherapy\t16\t32.7\t\n Surgery+Systemic+Radiotherapy\t1\t2\t\nAbbreviations: KPS=Karnofsky Performance Status; NSCLC=non-small cell lung cancer; SCLC=small cell lung cancer.\n\na Including chemotherapy, targeted therapy or hormone therapy.\n\nb A patient may have received more than one type of therapy.\n\nTable 2 Treatment arms and first cycle DLT\nStudy number\tAge at entry\tGender\tCancer type\tPrior tx for mets disease\tPrior brain mets\tKPS at start (%)\tTime on Tx (months)\tBest response\tSurvival status\tOverall survival (months)\t\n1-0001\t31\tF\tSCC cervix\t2 lines CT, XRT\tNo\t90\t2.1\tPD\tDeceased\t10.4\t\n1-0002\t62\tF\tTNBC\t2 lines CT, XRT\tNo\t80\t2.2\tPD\tDeceased\t6.1\t\n1-0003\t60\tF\tER/PR+BC\tXRT\tNo\t100\t2.1\tPD\tDeceased\t14.1\t\n1-0004\t46\tF\tER/PR+BC\t1 line CT, 1 line HT\tNo\t80\t2\tPD\tDeceased\t8.6\t\n1-0005\t74\tF\tSCLC\t1 line CT, 1 line TT\tNo\t80\t0.7\tPD\tDeceased\t1.7\t\n1-0006\t62\tF\tER/PR+BC\t2 lines CT, 1 line HT, 1 line TT, XRT\tNo\t90\t0.7\tPD\tDeceased\t9\t\n2-0001\t61\tM\tNSCLC-adenocarcinoma EGFR, KRAS, ALK, ROS1 wt\t2 lines CT, XRT\tNo\t80\t4\tSD\tDeceased\t11.6\t\n3-0001\t63\tM\tPDAC\tSX\tNo\t80\t9.1\tSD\tDeceased\t10.3\t\n3-0002\t47\tF\tPDAC\t1 line CT\tNo\t90\t5\tSD\tDeceased\t14.1\t\n3-0003\t55\tF\tPDAC\t1 line CT\tNo\t80\t4.9\tSD\tDeceased\t8\t\n3-0004\t55\tF\tPDAC\tNone\tNo\t80\t15.3\tPR\tAlive\t17.5\t\n3-0005\t57\tM\tPDAC\t1 line CT\tNo\t80\t0.9\tNE\tDeceased\t3.3\t\n3-0007\t62\tM\tPDAC\tSX\tNo\t90\t10.8\tPR\tDeceased\t15\t\n3-0008\t63\tF\tPDAC\tNone\tNo\t100\t4.4\tSD\tAlive\t11.3\t\n3-0009\t57\tF\tPDAC\tNone\tNo\t80\t4.9\tSD\tDeceased\t6.7\t\n3-0010\t61\tF\tPDAC\tNone\tNo\t80\t4.9\tSD\tDeceased\t7.1\t\n3-0011\t52\tF\tPDAC\t1 line CT, XRT\tNo\t80\t2\tPD\tDeceased\t2.9\t\n3-0013\t46\tF\tPDAC\t1 line CT\tNo\t80\t2.1\tPD\tDeceased\t4.1\t\n4-0001\t64\tF\tNSCLC-adenocarcinoma EGFR, KRAS, ALK, ROS1 wt\t1 line CT, 1 line another PD-1 inhibitor\tNo\t80\t3\tSD\tDeceased\t5.7\t\n4-0002\t56\tF\tTNBC\t1 line CT\tNo\t80\t1.6\tPD\tDeceased\t12.8\t\n4-0003\t67\tF\tUterine leiomyosarcoma\t4 lines CT, 2 lines TT, XRT\tNo\t90\t0.9\tNE\tDeceased\t10.3\t\n4-0004\t32\tF\tER/PR+BC\t4 lines CT, XRT\tNo\t70\t2.3\tPD\tDeceased\t3.7\t\n4-0005\t49\tM\tFibromyxoid sarcoma\t3 lines CT, 1 line TT, XRT, SX\tNo\t90\t2.1\tPD\tAlive\t19.2\t\n4-0006\t55\tF\tER/PR/HER2+BC\t1 line CT, 1 line HT, 2 lines TT, SX\tNo\t80\t5.6\tPR\tAlive\t11.4\t\n4-0007\t39\tF\tSynovial sarcoma\t1 line CT\tNo\t90\t2.1\tPD\tAlive\t17.8\t\n4-0008\t55\tF\tER/PR+BC\t1 line CT, 2 lines HT, 1 line TT, SX\tNo\t80\t4.9\tSD\tDeceased\t14.9\t\n4-0009\t27\tF\tSynovial sarcoma\t1 line CT, XRT\tNo\t90\t2.6\tPD\tAlive\t13.3\t\n4-0010\t58\tF\tER/PR+BC\t1 line CT, 3 lines HT, 1 line TT, XRT\tNo\t90\t2.1\tPD\tDeceased\t5.1\t\n4-0011\t46\tF\tER/PR+BC\t3 lines CT, 2 lines HT\tNo\t90\t3\tPD\tAlive\t8.4\t\n4-0012\t61\tF\tER/PR+BC\t2 lines CT\tNo\t90\t6.5\tSD\tAlive\t7.9\t\n5-0001\t57\tM\tSCLC\t1 line CT, XRT\tNo\t90\t10.6\tPR\tDeceased\t23.3\t\n5-0002\t44\tF\tSCLC\t1 line CT\tNo\t90\t10.5\tPR\tAlive\t23.4\t\n5-0003\t33\tF\tNSCLC-adenocarcinoma EGFR+\t1 line CT, 2 lines TT, 1 line another PD-1 inhibitor, XRT\tYes\t80\t2.1\tPD\tDeceased\t3.7\t\n5-0004\t48\tF\tNSCLC-adenocarcinoma KRAS+\t2 lines CT\tNo\t80\t2\tPD\tDeceased\t2.4\t\n5-0005\t45\tM\tNSCLC-adenocarcinoma KRAS+\t2 lines CT\tNo\t80\t0.2\tPD\tDeceased\t1.6\t\n5-0006\t60\tM\tNSCLC-adenocarcinoma EGFR+\t4 lines CT, 2 lines TT, XRT\tYes\t80\t4.4\tSD\tDeceased\t6.5\t\n5-0007\t59\tM\tNSCLC-adenocarcinoma KRAS+\t2 lines CT, XRT\tYes\t90\t11.8\tPR\tAlive\t17.5\t\n5-0008\t51\tF\tSCLC\t1 line CT, XRT\tNo\t90\t1.7\tPD\tDeceased\t2.9\t\n5-0009\t61\tF\tNSCLC-adenocarcinoma EGFR, KRAS, ALK, ROS1 wt\t1 line CT\tNo\t80\t0.7\tNE\tDeceased\t6.1\t\n5-0010\t60\tM\tSCLC\t1 line CT, XRT\tNo\t90\t13.7\tPR\tAlive\t13.8\t\n5-0011\t49\tM\tColorectal cancer-MSI+\t1 line CT\tNo\t80\t2.7\tPD\tDeceased\t9.5\t\n5-0012\t41\tM\tEsophageal-HER2 negative\t1 line CT\tNo\t80\t15.4\tPD\tDeceased\t15.4\t\n6-0001\t55\tF\tEndometrial\tNone\tNo\t80\t0\tNE\tDeceased\t7.3\t\n6-0002\t50\tF\tLiposarcoma\tNone\tNo\t80\t6.9\tSD\tAlive\t23.1\t\n6-0003\t52\tM\tMalignant fibrious histiocytoma (sarcoma)\tSX\tNo\t80\t2.6\tPD\tDeceased\t13.1\t\n6-0004\t59\tF\tOC\t4 lines CT\tNo\t90\t15.5\tSD\tAlive\t22.4\t\n6-0005\t32\tF\tClear cell sarcoma\tSX\tNo\t90\t4.7\tPD\tDeceased\t6.9\t\n6-0006\t56\tF\tOC\t1 line CT\tNo\t90\t10.5\tPR\tAlive\t17.3\t\n6-0007\t58\tF\tER/PR+BC\t1 line CT, 1 line HT, 1 line TT, XRT\tYes\t80\t2.1\tPD\tDeceased\t4.1\t\nAbbreviations: ALK=anaplastic lymphoma kinase; BC=breast cancer; CT=chemotherapy; EGFR=epidermal growth factor receptor; ER/PR=oestrogen receptor/progesterone receptor; F=female; HT=hormonal therapy; KPS=Karnofsky Performance Status; KRAS=Kirsten rat sarcoma viral oncogene; M=male; mets=metastatic; MSI=microsatellite instability; NE=not evaluable; NSCLC=non-small cell lung cancer; OC=ovarian carcinoma; PD=disease progression; PDAC=pancreatic adenocarcinoma; PR=partial response; ROS1=ROS proto-oncogene 1; SCC=squamous cell carcinoma; SCLC=small cell lung cancer; SD=stable disease; SX=surgery; TNBC=triple negative breast cancer; TT=targeted therapy; wt=wild type; XRT=radiotherapy; Tx=treatment.\n\nTable 3 Treatment arms and first cycle DLT\nTreatment arm\tNumber of treated patients\tNo of patients with cycle 1 DLT\tDLT\t\n1\t6\t1\tGrade 4 neutropenia leading to ⩾25% missed planned dose of treatment\t\n2\t1\t0\tNone\t\n3\t11\t2\tTwo with grade 3 thrombocytopenia leading to ⩾25% missed planned dose of treatment (both patients were previously treated with systemic chemotherapy for advanced disease)\t\n4\t12\t3\tDose level 1: Grade 3 and grade 4 neutropenia, respectively, leading to ⩾25% missed planned dose of treatment\t\n \t \t \tDose level −1: Grade 3 thrombocytopenia leading to ⩾25% missed planned dose of treatment\t\n5\t12\t3\tDose level 1: Grade 3 fatigue and grade 3 nausea, vomiting and diarrhoea, respectively.\t\n \t \t \tDose level −1: Grade 3 rash and papilloedema\t\n6\t7\t0\tNone\t\nAbbreviation: DLT=dose limiting toxicity.\n\nTable 4 Treatment emergent adverse events (>20% all grades, >10% for grades 3–4)\n \t \tArm 1 (N=6)\tArm 2 (N=1)\tArm 3a (N=9)\tArm 3b (N=2)\tArm 4 (N=12)\tArm 5 (n=12)\tArm 6 (n=7)\t\nPreferred term\tCTC grade\tn\t%\tn\t%\tn\t%\tn\t%\tn\t%\tn\t%\tn\t%\t\nAny term\t1–4\t6\t100\t1\t100\t9\t100\t2\t200\t12\t100\t12\t100\t7\t100\t\n \t3–4\t5\t83.3\t1\t100\t6\t66.7\t1\t50\t8\t75\t3\t25\t4\t57.1\t\nThrombocytopenia\t1–4\t2\t33.3\t1\t100\t4\t44.4\t1\t50\t7\t58.3\t \t \t \t \t\n \t3–4\t \t \t \t \t3\t33.3\t \t \t \t \t \t \t \t \t\nNeutropenia\t1–4\t3\t50\t1\t100\t3\t33.3\t \t \t8\t75\t3\t25\t \t \t\n \t3–4\t3\t50\t1\t100\t2\t22.2\t \t \t4\t33.3\t \t \t \t \t\nAnaemia NOS\t1–4\t2\t33.3\t1\t100\t8\t88.9\t1\t50\t8\t75\t \t \t2\t28.6\t\n \t3–4\t \t \t \t \t \t \t \t \t2\t16.7\t \t \t \t \t\nAST elevation\t1–4\t5\t83.3\t \t \t4\t44.4\t \t \t7\t58.3\t \t \t \t \t\n \t3–4\t2\t33.3\t \t \t1\t11.1\t \t \t2\t16.7\t \t \t \t \t\nALT elevation\t1–4\t4\t66.7\t \t \t6\t66.7\t \t \t7\t58.3\t \t \t \t \t\n \t3–4\t2\t33.3\t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nFatigue\t1–4\t2\t33.3\t1\t100\t5\t55.5\t \t \t4\t33.3\t5\t41.7\t2\t28.6\t\n \t3–4\t1\t16.7\t \t \t \t \t \t \t \t \t \t \t \t \t\nHyponatraemia\t1–4\t \t \t1\t100\t3\t33.3\t \t \t \t \t \t \t \t \t\n \t3–4\t \t \t \t \t2\t22.2\t \t \t \t \t \t \t \t \t\nWhite blood cell count decreased\t1–4\t4\t66.7\t1\t100\t \t \t \t \t9\t75\t \t \t \t \t\n \t3–4\t3\t50\t1\t100\t \t \t \t \t3\t25\t \t \t \t \t\nThrombolic event\t1–4\t \t \t \t \t3\t33.3\t \t \t \t \t \t \t \t \t\n \t3–4\t \t \t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nALK increased\t1–4\t \t \t \t \t \t \t2\t100\t3\t25\t \t \t \t \t\n \t3–4\t \t \t \t \t \t \t1\t50\t \t \t \t \t \t \t\nDiarrhoea\t1–4\t \t \t \t \t3\t33.3\t \t \t \t \t9\t75\t3\t42.9\t\n \t3–4\t \t \t \t \t \t \t \t \t \t \t \t \t1\t14.3\t\nPruritus\t1–4\t \t \t \t \t2\t22.2\t \t \t3\t25\t \t \t2\t28.6\t\n \t3–4\t \t \t \t \t \t \t \t \t \t \t \t \t1\t14.3\t\nPalmar-plantar erythrodysesthesia\t1–4\t \t \t \t \t \t \t \t \t \t \t \t \t2\t28.6\t\n \t3–4\t \t \t \t \t \t \t \t \t \t \t \t \t1\t14.3\t\nPeripheral sensory neuropathy\t1–4\t \t \t \t \t4\t44.4\t \t \t \t \t \t \t \t \t\n \t3–4\t \t \t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nNausea\t1–2\t \t \t \t \t2\t22.2\t1\t50\t5\t41.7\t8\t75\t2\t28.6\t\nVomiting\t1–2\t3\t50\t \t \t3\t33.3\t1\t50\t3\t25\t4\t33.3\t2\t28.6\t\nRash NOS\t1–2\t2\t33.3\t1\t100\t4\t44.4\t1\t50\t \t \t3\t25\t5\t71.4\t\nConstipation\t1–2\t \t \t \t \t1\t11.1\t1\t50\t4\t33.3\t \t \t \t \t\nWeight loss\t1–2\t \t \t1\t100\t2\t22.2\t \t \t \t \t \t \t \t \t\nDysgeusia\t1–2\t \t \t1\t100\t2\t22.2\t \t \t \t \t \t \t \t \t\nOedema in limbs\t1–2\t \t \t1\t100\t2\t22.2\t \t \t \t \t \t \t \t \t\nTracheal hemorrhage\t1–2\t \t \t1\t100\t \t \t \t \t \t \t \t \t \t \t\nHaematoma\t1–2\t \t \t1\t100\t \t \t \t \t \t \t \t \t \t \t\nPain in extremities\t1–2\t \t \t1\t100\t3\t33.3\t1\t50\t4\t33.3\t4\t33.3\t \t \t\nHypertension\t1–2\t \t \t1\t100\t \t \t \t \t \t \t \t \t \t \t\nPleural effusion\t1–2\t \t \t1\t100\t \t \t \t \t \t \t \t \t \t \t\nMucositis oral\t1–2\t \t \t \t \t3\t33.3\t \t \t \t \t \t \t3\t42.9\t\nHypoalbuminaemia\t1–2\t \t \t \t \t3\t33.3\t \t \t4\t33.3\t \t \t \t \t\nDehydration\t1–2\t \t \t \t \t3\t33.3\t \t \t \t \t \t \t \t \t\nFever\t1–2\t \t \t \t \t5\t55.5\t \t \t \t \t \t \t \t \t\nInsomnia\t1–2\t \t \t \t \t4\t44.4\t \t \t \t \t \t \t \t \t\nCough\t1–2\t \t \t \t \t \t \t1\t50\t \t \t \t \t \t \t\nEpistaxis\t1–2\t \t \t \t \t2\t22.2\t \t \t \t \t \t \t \t \t\nHyperphosphataemia\t1–2\t \t \t \t \t \t \t \t \t3\t25\t \t \t2\t28.6\t\nHeadache\t1–2\t \t \t \t \t \t \t \t \t4\t33.3\t \t \t \t \t\nAnorexia\t1–2\t \t \t \t \t \t \t \t \t \t \t3\t25\t \t \t\nSkin infection\t1–2\t \t \t \t \t \t \t \t \t \t \t \t \t2\t28.6\t\nRectal and vaginal hemorrhage\t1–2\t \t \t \t \t \t \t1\t50\t \t \t \t \t \t \t\nHot flashes\t1–2\t \t \t \t \t2\t22.2\t \t \t \t \t \t \t \t \t\nChills\t1–2\t \t \t \t \t2\t22.2\t \t \t \t \t \t \t \t \t\nAbdominal pain\t1–2\t \t \t \t \t \t \t1\t50\t \t \t \t \t \t \t\nHypokalaemia\t1–2\t \t \t \t \t2\t22.2\t \t \t \t \t \t \t \t \t\nHypoxia\t3–4\t \t \t \t \t \t \t \t \t2\t16.7\t \t \t \t \t\nPneumonia NOS\t3–4\t \t \t \t \t1\t11.1\t \t \t2\t16.7\t \t \t \t \t\nSyncope\t3–4\t \t \t1\t100\t \t \t \t \t \t \t \t \t \t \t\nDyspnoea\t3–4\t \t \t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nCapillary leak syndrome\t3–4\t \t \t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nDevice infection\t3–4\t \t \t \t \t1\t11.1\t \t \t \t \t \t \t \t \t\nAbbreviations: ALK=alkaline phosphatase; AST, aspartate aminotransferase; NOS=not otherwise specified.\n\nTable 5 Best tumour response\n \tTreatment arm\t\nBest tumour response by irRECIST and RECIST 1.1\tArm 1 (N=6)\tArm 2 (N=1)\tArm 3a (N=9)\tArm 3b (N=2)\tArm 4 (N=12)\tArm 5 (N=12)\tArm 6 (N=7)\t\nPartial response\t0\t0\t2\t0\t1\t4\t1\t\nStable disease\t0\t1\t6\t0\t3\t1\t2\t\nProgressive disease\t6\t0\t0\t2\t7\t6\t3\t\nNot evaluable\t0\t0\t1\t0\t1\t1\t1\n==== Refs\nBigelow E, Bever KM, Xu H, Yager A, Wu A, Taube J, Chen L, Jaffee EM, Anders RA, Zheng L (2013 ) Immunohistochemical staining of B7-H1 (PD-L1) on paraffin-embedded slides of pancreatic adenocarcinoma tissue . J Vis Exp \n71 : 4059 .\nCancer Facts & Figures 2016 | American Cancer Society. http://www.cancer.org/research/cancerfactsstatistics/cancerfactsfigures2016/ (accessed: 28 December 2016).\nDuffy AG, Greten TF (2014 ) Immunological off-target effects of standard treatments in gastrointestinal cancers . Ann Oncol \n25 : 24 –32.24201974 \nEisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R, Dancey J, Arbuck S, Gwyther S, Mooney M, Rubinstein L, Shankar L, Dodd L, Kaplan R, Lacombe D, Verweij J (2009 ) New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1) . Eur J Cancer \n45 : 228 –247.19097774 \nGalluzzi L, Senovilla L, Zitvogel L, Kroemer G (2012 ) The secret ally: immunostimulation by anticancer drugs . Nat Rev Drug Discov \n11 : 215 –233.22301798 \nHay M (2011 ) BIO/BioMedTracker Clinical Trial Success Rates Study.\nHerzberg B, Campo MJ, Gainor JF (2016 ) Immune checkpoint inhibitors in non-small cell lung cancer . Oncologist \n22 (1): 81 –88.27534574 \nKim JR, Moon YJ, Kwon KS, Bae JS, Wagle S, Kim KM, Park HS, Lee H, Moon WS, Chung MJ, Kang MJ, Jang KY (2013 ) Tumor infiltrating PD1-positive lymphocytes and the expression of PD-L1 predict poor prognosis of soft tissue sarcomas . PLoS One \n8 : e82870 .24349382 \nLanger CJ, Gadgeel SM, Borghaei H, Papadimitrakopoulou VA, Patnaik A, Powell SF, Gentzler RD, Martins RG, Stevenson JP, Jalal SI, Panwalkar A, Yang JC-H, Gubens M, Sequist L V, Awad MM, Fiore J, Ge Y, Raftopoulos H, Gandhi L KEYNOTE-021 investigators (2016 ) Carboplatin and pemetrexed with or without pembrolizumab for advanced, non-squamous non-small-cell lung cancer: a randomised, phase 2 cohort of the open-label KEYNOTE-021 study . Lancet Oncol \n17 : 1497 –1508.27745820 \nLe DT, Uram JN, Wang H, Bartlett BR, Kemberling H, Eyring AD, Skora AD, Luber BS, Azad NS, Laheru D, Biedrzycki B, Donehower RC, Zaheer A, Fisher GA, Crocenzi TS, Lee JJ, Duffy SM, Goldberg RM, de la Chapelle A, Koshiji M, Bhaijee F, Huebner T, Hruban RH, Wood LD, Cuka N, Pardoll DM, Papadopoulos N, Kinzler KW, Zhou S, Cornish TC, Taube JM, Anders RA, Eshleman JR, Vogelstein B, Diaz LA (2015 ) PD-1 blockade in tumors with mismatch-repair deficiency . N Engl J Med \n372 : 2509 –2520.26028255 \nLe Tourneau C, Lee JJ, Siu LL (2009 ) Dose escalation methods in phase I cancer clinical trials . J Natl Cancer Inst \n101 : 708 –720.19436029 \nNishino M, Giobbie-Hurder A, Gargano M, Suda M, Ramaiya NH, Hodi FS (2013 ) Developing a common language for tumor response to immunotherapy: immune-related response criteria using unidimensional measurements . Clin Cancer Res \n19 : 3936 –3943.23743568 \nRizvi NA, Hellmann MD, Brahmer JR, Juergens RA, Borghaei H, Gettinger S, Chow LQ, Gerber DE, Laurie SA, Goldman JW, Shepherd FA, Chen AC, Shen Y, Nathan FE, Harbison CT, Antonia S (2016 ) Nivolumab in combination with platinum-based doublet chemotherapy for first-line treatment of advanced non-small-cell lung cancer . J Clin Oncol \n34 : 2969 –2979.27354481 \nRobert C, Ribas A, Wolchok JD, Hodi FS, Hamid O, Kefford R, Weber JS, Joshua AM, Hwu W-J, Gangadhar TC, Patnaik A, Dronca R, Zarour H, Joseph RW, Boasberg P, Chmielowski B, Mateus C, Postow MA, Gergich K, Elassaiss-Schaap J, Li XN, Iannone R, Ebbinghaus SW, Kang SP, Daud A (2014 ) Anti-programmed-death-receptor-1 treatment with pembrolizumab in ipilimumab-refractory advanced melanoma: a randomised dose-comparison cohort of a phase 1 trial . Lancet \n384 (9948): 1109 –1117.25034862 \nSivan A, Corrales L, Hubert N, Williams JB, Aquino-Michaels K, Earley ZM, Benyamin FW, Man Lei Y, Jabri B, Alegre M-L, Chang EB, Gajewski TF (2015 ) Commensal Bifidobacterium promotes antitumor immunity and facilitates anti-PD-L1 efficacy . Science \n350 : 1084 –1089.26541606 \nTopalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, Powderly JD, Carvajal RD, Sosman JA, Atkins MB, Leming PD, Spigel DR, Antonia SJ, Horn L, Drake CG, Pardoll DM, Chen L, Sharfman WH, Anders RA, Taube JM, McMiller TL, Xu H, Korman AJ, Jure-Kunkel M, Agrawal S, McDonald D, Kollia GD, Gupta A, Wigginton JM, Sznol M (2012 ) Safety, activity, and immune correlates of anti-PD-1 antibody in cancer . N Engl J Med \n366 : 2443 –2454.22658127 \nVetizou M, Pitt JM, Daillere R, Lepage P, Waldschmitt N, Flament C, Rusakiewicz S, Routy B, Roberti MP, Duong CPM, Poirier-Colame V, Roux A, Becharef S, Formenti S, Golden E, Cording S, Eberl G, Schlitzer A, Ginhoux F, Mani S, Yamazaki T, Jacquelot N, Enot DP, Berard M, Nigou J, Opolon P, Eggermont A, Woerther P-L, Chachaty E, Chaput N, Robert C, Mateus C, Kroemer G, Raoult D, Boneca IG, Carbonnel F, Chamaillard M, Zitvogel L (2015 ) Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota . Science \n350 : 1079 –1084.26541610 \nWolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, Segal NH, Ariyan CE, Gordon R-A, Reed K, Burke MM, Caldwell A, Kronenberg SA, Agunwamba BU, Zhang X, Lowy I, Inzunza HD, Feely W, Horak CE, Hong Q, Korman AJ, Wigginton JM, Gupta A, Sznol M (2013 ) Nivolumab plus ipilimumab in advanced melanoma . N Engl J Med \n369 : 122 –133.23724867 \nYu H, Batenchuk C, Badzio A, Boyle TA, Czapiewski P, Chan DC, Lu X, Gao D, Ellison K, Kowalewski AA, Rivard CJ, Dziadziuszko R, Zhou C, Hussein M, Richards D, Wilks S, Monte M, Edenfield W, Goldschmidt J, Page R, Ulrich B, Waterhouse D, Close S, Jassem J, Kulig K, Hirsch FR (2017 ) PD-L1 expression by two complementary diagnostic assays and mRNA in situ hybridization in small cell lung cancer . J Thorac Oncol \n12 : 110 –120.27639678 \nZitvogel L, Galluzzi L, Smyth MJ, Kroemer G (2013 ) Mechanism of action of conventional and targeted anticancer therapies: reinstating immunosurveillance . Immunity \n39 : 74 –88.23890065 \nZitvogel L, Kepp O, Kroemer G (2011 ) Immune parameters affecting the efficacy of chemotherapeutic regimens . Nat Rev Clin Oncol \n8 : 151 –160.21364688\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0007-0920",
"issue": "117(1)",
"journal": "British journal of cancer",
"keywords": null,
"medline_ta": "Br J Cancer",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000368:Aged; D000418:Albumins; D061067:Antibodies, Monoclonal, Humanized; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D002166:Camptothecin; D002289:Carcinoma, Non-Small-Cell Lung; D003841:Deoxycytidine; D003967:Diarrhea; D000077143:Docetaxel; D004317:Doxorubicin; D003875:Drug Eruptions; D005221:Fatigue; D005260:Female; D006801:Humans; D000077146:Irinotecan; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D009325:Nausea; D009369:Neoplasms; D010051:Ovarian Neoplasms; D017239:Paclitaxel; D010190:Pancreatic Neoplasms; D011092:Polyethylene Glycols; D012509:Sarcoma; D055752:Small Cell Lung Carcinoma; D043823:Taxoids; D016896:Treatment Outcome; D014747:Vinblastine; D000077235:Vinorelbine; D014839:Vomiting",
"nlm_unique_id": "0370635",
"other_id": null,
"pages": "33-40",
"pmc": null,
"pmid": "28588322",
"pubdate": "2017-06-27",
"publication_types": "D017426:Clinical Trial, Phase I; D016428:Journal Article",
"references": "23724867;26541610;24201974;25034862;22658127;23890065;21364688;19436029;23743568;27639678;24349382;23328703;26541606;19097774;27354481;27745820;22301798;27534574;26028255",
"title": "A phase Ib study of pembrolizumab plus chemotherapy in patients with advanced cancer (PembroPlus).",
"title_normalized": "a phase ib study of pembrolizumab plus chemotherapy in patients with advanced cancer pembroplus"
} | [
{
"companynumb": "US-CIPLA (EU) LIMITED-2018US17298",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "IRINOTECAN"
},
"drugadditional": null... |
{
"abstract": "OBJECTIVE\nSystemic failure remains the major challenge in management of locally advanced rectal cancer (LARC). To optimize the timing of neoadjuvant treatment and enhance systemic control, we initiated a phase 2 trial to evaluate a new strategy of neoadjuvant sandwich treatment, integrating induction chemotherapy, concurrent chemoradiation therapy, and consolidation chemotherapy. Here, we present preliminary results of this trial, reporting the tumor response, toxicities, and surgical complications.\n\n\nMETHODS\nFifty-one patients with LARC were enrolled, among which were two patients who were ineligible because of distant metastases before treatment. Patients were treated first with one cycle of induction chemotherapy consisting of oxaliplatin, 130 mg/m² on day 1, with capecitabine, 1000 mg/m² twice daily for 14 days every 3 weeks (the XELOX regimen), followed by chemoradiation therapy, 50 Gy over 5 weeks, with the modified XELOX regimen (oxaliplatin 100 mg/m²), and then with another cycle of consolidation chemotherapy with the XELOX regimen. Surgery was performed 6 to 8 weeks after completion of radiation therapy. Tumor responses, toxicities, and surgical complications were recorded.\n\n\nRESULTS\nAll but one patent completed the planned schedule of neoadjuvant sandwich treatment. Neither life-threatening blood count decrease nor febrile neutropenia were observed. Forty-five patents underwent optimal surgery with total mesorectal excision (TME). Four patients refused surgery because of clinically complete response. There was no perioperative mortality in this cohort. Five patients (11.1%) developed postoperative complications. Among the 45 patients who underwent TME, pathologic complete response (pCR), pCR or major regression, and at least moderate regression were achieved in 19 (42.2%), 37 (82.2%), and 44 patients (97.8%), respectively.\n\n\nCONCLUSIONS\nPreliminary results suggest that the strategy of neoadjuvant sandwich treatment using XELOX regimen as induction, concomitant, and consolidation chemotherapy to the conventional radiation is well tolerated. The strategy is highly effective in terms of pCR and major regression, which warrants further investigation.",
"affiliations": "State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Radiation Oncology, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Medical Oncology, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Pathology, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Medical Imaging and Interventional Radiology, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China.;State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, PR China; Department of Colorectal Surgery, Sun Yat-sen University Cancer Center, Guangzhou, PR China. Electronic address: dingpr@mail.sysu.edu.cn.",
"authors": "Gao|Yuan-Hong|YH|;Lin|Jun-Zhong|JZ|;An|Xin|X|;Luo|Jie-Lin|JL|;Cai|Mu-Yan|MY|;Cai|Pei-Qiang|PQ|;Kong|Ling-Heng|LH|;Liu|Guo-Chen|GC|;Tang|Jing-Hua|JH|;Chen|Gong|G|;Pan|Zhi-Zhong|ZZ|;Ding|Pei-Rong|PR|",
"chemical_list": "D010071:Oxaloacetates; D003841:Deoxycytidine; D000069287:Capecitabine; D005472:Fluorouracil",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0360-3016",
"issue": "90(5)",
"journal": "International journal of radiation oncology, biology, physics",
"keywords": null,
"medline_ta": "Int J Radiat Oncol Biol Phys",
"mesh_terms": "D000230:Adenocarcinoma; D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069287:Capecitabine; D017024:Chemotherapy, Adjuvant; D060830:Consolidation Chemotherapy; D003841:Deoxycytidine; D005240:Feasibility Studies; D005260:Female; D005472:Fluorouracil; D006801:Humans; D060828:Induction Chemotherapy; D008297:Male; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D010071:Oxaloacetates; D011446:Prospective Studies; D012004:Rectal Neoplasms",
"nlm_unique_id": "7603616",
"other_id": null,
"pages": "1153-60",
"pmc": null,
"pmid": "25442042",
"pubdate": "2014-12-01",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Neoadjuvant sandwich treatment with oxaliplatin and capecitabine administered prior to, concurrently with, and following radiation therapy in locally advanced rectal cancer: a prospective phase 2 trial.",
"title_normalized": "neoadjuvant sandwich treatment with oxaliplatin and capecitabine administered prior to concurrently with and following radiation therapy in locally advanced rectal cancer a prospective phase 2 trial"
} | [
{
"companynumb": "CN-ROCHE-1488966",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CAPECITABINE"
},
"drugadditional": null,
"dr... |
{
"abstract": "Herpes simplex virus (HSV)-associated erythema multiforme (HAEM) is an acute and self-limiting mucocutaneous hypersensitivity reaction triggered by herpes virus infections. We reported a patient with HAEM after hematopoietic stem cell transplantation (HSCT). A 55-year-old man received HSCT 7 months ago. He suffered from chronic graft versus host disease 4 months after HSCT and was treated with prednisone and tacrolimus. One week ago, he developed generalized macules with leukopenia. Dermatological examination revealed multiple iris-like erythemas on his trunk and extremities. The skin lesions and leukopenia resolved upon anti-HSV treatment.",
"affiliations": "Peking University People's Hospital, Beijing, China.;Peking University People's Hospital, Beijing, China.;Peking University People's Hospital, Beijing, China.",
"authors": "Gu|Ying|Y|0000-0001-8900-1381;Sun|Jing|J|;Zhang|Jianzhong|J|0000-0002-5485-682X",
"chemical_list": "D000077595:Famciclovir",
"country": "United States",
"delete": false,
"doi": "10.1111/dth.13066",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1396-0296",
"issue": "32(5)",
"journal": "Dermatologic therapy",
"keywords": "HSV-associated erythema multiforme; hematopoietic stem cell transplantation",
"medline_ta": "Dermatol Ther",
"mesh_terms": "D001707:Biopsy, Needle; D004892:Erythema Multiforme; D000077595:Famciclovir; D005500:Follow-Up Studies; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006561:Herpes Simplex; D006801:Humans; D007150:Immunohistochemistry; D008297:Male; D008875:Middle Aged; D009190:Myelodysplastic Syndromes; D018570:Risk Assessment; D018139:Simplexvirus; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "9700070",
"other_id": null,
"pages": "e13066",
"pmc": null,
"pmid": "31414706",
"pubdate": "2019-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "HSV-associated erythema multiforme in a patient after hematopoietic stem cell transplantation.",
"title_normalized": "hsv associated erythema multiforme in a patient after hematopoietic stem cell transplantation"
} | [
{
"companynumb": "CN-GYP-000023",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "3",
"drugadmi... |
{
"abstract": "An understanding of the behavior of SARS-CoV-2 in pediatric hematology-oncology patients is essential to the optimal management of these patients during the COVID-19 pandemic. This study describes the characteristics and outcomes of COVID-19 disease in children with cancer or hematologic disorders treated at a large children's hospital. A retrospective cohort study was conducted at Texas Children's Cancer and Hematology Center from January 1, 2020 to September 30, 2020. All patients with a primary hematology-oncology diagnosis and SARS-CoV-2 positivity by reverse transcription polymerase chain reaction were identified. Clinical and laboratory data were obtained from the medical record. Descriptive analyses were performed to evaluate COVID-19-related outcomes and risk factors for severe disease in this population. We identified 109 patients with COVID-19 disease, including 52 hematology, 51 oncology, and 6 HSCT patients; median age was 10.3 years (IQR 4.4-15.9), and 58.7% were male. Seventy-four percent of the patients were managed in the outpatient setting. Patients with sickle cell disease were more likely to require hospitalization. ICU care was needed in 8% (n = 9) of the entire cohort, and mechanical ventilation was required in 6.4% (6 oncology patients, 1 hematology patient). COVID-19 contributed to the deaths of two cancer patients. No deaths occurred in hematology or HSCT patients. In conclusion, the risk of severe COVID-19 complications is slightly higher in pediatric hematology-oncology patients than in the general pediatric population but lower than initially feared. For most asymptomatic patients, primary disease management may continue as planned, but treatment decisions must be individualized.",
"affiliations": "Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.;Texas Children's Cancer and Hematology Center and Baylor College of Medicine, Department of Pediatrics, Section of Hematology-Oncology, Houston, Texas, USA.",
"authors": "Kamdar|Kala Y|KY|;Kim|Taylor O|TO|;Doherty|Erin E|EE|;Pfeiffer|Thomas M|TM|;Qasim|Shawki L|SL|;Suell|Mary Nell|MN|;Yates|Amber M|AM|;Blaney|Susan M|SM|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/08880018.2021.1924327",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0888-0018",
"issue": "38(8)",
"journal": "Pediatric hematology and oncology",
"keywords": "COVID-19; Childhood cancer; SARS-CoV-2; pediatric hematology; pediatric oncology; sickle cell disease",
"medline_ta": "Pediatr Hematol Oncol",
"mesh_terms": null,
"nlm_unique_id": "8700164",
"other_id": null,
"pages": "695-706",
"pmc": null,
"pmid": "34032552",
"pubdate": "2021-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "COVID-19 outcomes in a large pediatric hematology-oncology center in Houston, Texas.",
"title_normalized": "covid 19 outcomes in a large pediatric hematology oncology center in houston texas"
} | [
{
"companynumb": "US-GILEAD-2022-0571747",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "REMDESIVIR"
},
"drugadditional": "3",
... |
{
"abstract": "Here, we report on a rare case of gastric hyperplastic polyps which disappeared after the discontinuation of proton pump inhibitor (PPI). The patient was an 83-year-old woman with liver cirrhosis and portal hypertension, along with gastroesophageal reflux disease treated by PPI. An initial upper gastrointestinal endoscopy showed unique polypoid lesions in the greater curvature of the stomach. Biopsy specimens of the lesions were diagnosed as hyperplastic polyps and she was followed. One year later, a second endoscopy showed that the lesions had increased in number and size, and an endoscopic mucosal resection (EMR) was performed for the main polyps. The resected specimens indicated a proliferation of foveolar epithelium cells with an increase of capillary ectasia and parietal cell hyperplasia, which was thought to be induced by hypergastrinemia from the PPI. Three months after the EMR, she was admitted because of bleeding from the remaining polyps along with an increase in new polyps. After conservative treatment, PPI was stopped and rebamipide was used. One year and 6 months later, an endoscopy showed the complete disappearance of all gastric polyps.",
"affiliations": "Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.;Department of Pathology, Kawasaki Medical School General Medical Center, Okayama, Japan.;Fujita Hospital, Okayama, Japan.;Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan.",
"authors": "Yasugi|Kengo|K|;Haruma|Ken|K|;Kawanaka|Miwa|M|;Suehiro|Mitsuhiko|M|;Nakamura|Jun|J|;Urata|Noriyo|N|;Tanikawa|Tomohiro|T|;Oka|Takahito|T|;Monobe|Yasumasa|Y|;Fujita|Takuya|T|;Kawamoto|Hirofumi|H|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000511885",
"fulltext": "\n==== Front\nCase Rep Gastroenterol\nCase Rep Gastroenterol\nCRG\nCase Reports in Gastroenterology\n1662-0631\nS. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.com\n\n10.1159/000511885\ncrg-0015-0202\nSingle Case\nDisappearance of Gastric Hyperplastic Polyps after the Discontinuation of Proton Pump Inhibitor in a Patient with Liver Cirrhosis\nYasugi Kengo a*\nHaruma Ken a\nKawanaka Miwa a\nSuehiro Mitsuhiko a\nNakamura Jun a\nUrata Noriyo a\nTanikawa Tomohiro a\nOka Takahito a\nMonobe Yasumasa b\nFujita Takuya c\nKawamoto Hirofumi a\naDepartment of Internal Medicine 2, Kawasaki Medical School General Medical Center, Okayama, Japan\nbDepartment of Pathology, Kawasaki Medical School General Medical Center, Okayama, Japan\ncFujita Hospital, Okayama, Japan\n*Kengo Yasugi, Department of Internal Medicine 2, Kawasaki Medical School General Medical Center, 2–6-1 Nakasange, Kita-ku, Okayama 700-8505 (Japan), ppur0jyn@s.okayama-u.ac.jp\nJan-Apr 2021\n18 2 2021\n18 2 2021\n15 1 202209\n4 9 2020\n18 9 2020\n2021\nCopyright © 2021 by S. Karger AG, Basel\n2021\nThis article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.\nHere, we report on a rare case of gastric hyperplastic polyps which disappeared after the discontinuation of proton pump inhibitor (PPI). The patient was an 83-year-old woman with liver cirrhosis and portal hypertension, along with gastroesophageal reflux disease treated by PPI. An initial upper gastrointestinal endoscopy showed unique polypoid lesions in the greater curvature of the stomach. Biopsy specimens of the lesions were diagnosed as hyperplastic polyps and she was followed. One year later, a second endoscopy showed that the lesions had increased in number and size, and an endoscopic mucosal resection (EMR) was performed for the main polyps. The resected specimens indicated a proliferation of foveolar epithelium cells with an increase of capillary ectasia and parietal cell hyperplasia, which was thought to be induced by hypergastrinemia from the PPI. Three months after the EMR, she was admitted because of bleeding from the remaining polyps along with an increase in new polyps. After conservative treatment, PPI was stopped and rebamipide was used. One year and 6 months later, an endoscopy showed the complete disappearance of all gastric polyps.\n\nKeywords\n\nGastric hyperplastic polyp\nProton pump inhibitor\nHypergastrinemia\n==== Body\nIntroduction\n\nThe pathogenesis of gastric hyperplastic polyps is still unknown, but it is suggested that the exaggerated repair of mucosal damage, antral hypercontraction, and hypergastrinemia may play a role in the development of polyps. In general, gastric hyperplastic polyps develop from the atrophic gastric mucosa with inflammation induced by Helicobacter pylori (HP) infection [1] or autoimmune gastritis [2]. Moreover, several recent studies have reported that the long-term use of proton pump inhibitor (PPI) may cause not only fundic gland polyps [3, 4] but also hyperplastic polyps through hypergastrinemia [5]. The clinical significance of gastric hyperplastic polyps is whether they have malignant potential and cause anemia or not [6].\n\nAlthough large or hemorrhagic gastric hyperplastic polyps can be removed endoscopically, endoscopic therapy is not a fundamental treatment for gastric hyperplastic polyps because the cause of the polyps has not been eliminated. Outside of endoscopic therapy, several recent studies have demonstrated that a regression or disappearance of gastric hyperplastic polyps is found after HP eradication therapy and/or the discontinuation of PPI [7, 8, 9].\n\nHere, we report on a rare case of gastric hyperplastic polyps and show the unique endoscopic and pathological findings in which the gastric polyps disappeared naturally after the discontinuation of PPI in a patient with liver cirrhosis and portal hypertension.\n\nCase Presentation\n\nAn 83-year-old woman had been treated for liver cirrhosis due to nonalcoholic steatohepatitis (NASH) and autoimmune hepatitis (AIH), with essential hypertension and gastro-esophageal reflux (GERD) at our hospital and at another outside hospital. In March 2014, an initial upper gastrointestinal endoscopy (UGE) showed multiple reddish polypoid lesions in the greater curvature of the stomach. The endoscopic finding of main polyps was unique, and a part of the mucosal folds of the greater curvature was swollen like a sausage, with a reddish surface. A red ridge on the fold beside the main lesion was also recognized. Two consecutive raised lesions on the fold beside the main lesion were also recognized. In addition, a broad-based reddish polypoid lesion was observed on the anterior wall side next to the two lesions, with a clot adhering to part of it. In addition, two small fundic gland polyps were noted (Fig. 1a).\n\nBiopsy specimens of the lesion indicated hyperplasia of the foveolar epithelium and was diagnosed as gastric hyperplastic polyps (Fig. 1b). We suspected that those hyperplastic polyps were associated with PPI because no atrophic change was found in the stomach as a whole, all HP tests (Ig G antibody, rapid urease test, and urea breath test) were negative, and she had a long-term history of PPI use (rabeprazole 10 mg/day). Her fasting serum gastrin level was 776 pg/dL (normal range: 50–150 pg/dL).\n\nOne year later, she was diagnosed with pneumonia and admitted to our hospital. At that time, she had an additional diagnosis of autoimmune hemolytic anemia (Hb, 8.0 g/dL). More than 2 years after that, she was admitted to our hospital with appetite loss, dizziness, and severe anemia (Hb, 5.0 g/dL). A UGE indicated multiple gastric polyps with a granular surface and natural bleeding in the curvature, the number and size of the polyps had increased compared to previous exams. In addition, new adjacent polypoid lesions were found in the greater curvature of the antrum (Fig. 2a).\n\nAn EMR was performed on the main gastric polyps and she was followed. Pathological findings of the resected polyps showed the crypt hyperplasia with an edematous lamina propria containing prominent ectasia in the vessels of the surface epithelium (Fig. 2b). In addition, there was cystic dilation of the fundic glands and a remarkable hyperplasia of the parietal cells deep in the hyperplastic polyps (Fig. 2c).\n\nThree months after the EMR, she was admitted with hematemesis, and an emergency endoscopy revealed bleeding from the remaining gastric polyps and also from renewed polyps (Fig. 3a, b). After conservative treatment, the PPI rabeprazole (10 mg/day) was stopped and the mucoprotective agent rebamipide (300 mg/day) was started. She was followed at another outside hospital and her anemia was stable (Hb, 7.0∼9.0 g/dL) for the next 1 year and 6 months.\n\nShe was re-admitted due to uncontrolled ascites and hepatic encephalopathy from cirrhosis. A UGE showed a post-EMR scar in the middle of the corpus and all polyps in the antrum and the lower part of the corpus had completely disappeared (Fig. 3c, d). She was treated for liver failure but died of progression of the disease 28 days after admission.\n\nDiscussion/Conclusion\n\nHere, we reported on a rare case of gastric hyperplastic polyps with unique endoscopic and pathological findings which disappeared completely after the discontinuation of PPI. Furthermore, it was possible to stop the refractory anemia which was thought to be caused by the bleeding from the gastric polyps.\n\nThe gastric polyps in this case showed unique endoscopic findings of a sausage-like swelling of parts of the mucosal folds and broad-based reddish polyps with a relatively smooth surface. The sub-pedunculated and pedunculated dome-shaped forms were different from other more common gastric hyperplastic polyps.\n\nGastric hyperplastic polyps in patients with portal hypertension are known as portal hypertensive polyps or portal hypertension associated polyps. Published endoscopic findings of portal hypertensive polyps show them to be reddish, slender, with a tendency for tandem lesions with an earthworm-like swelling on the surface [10]. In general, the most common locations are in the antrum or the greater curvature; however, they are also found in the lower corpus [11]. One specific pathological finding of portal hypertensive polyps is a remarkable increase of capillary vessels in the surface of the polyp [10]. In this case, the polyps were located in the greater curvature and showed a remarkable increase of capillary vessels in the surface of the hyperplastic polyps that corresponded to those of portal hypertensive polyps.\n\nIn this case, the gastric polyps developed from non-atrophic mucosa without HP infection and disappeared completely after the discontinuation of PPI and the use of rebamipide. In general, gastric hyperplastic polyps arise from the atrophic gastric mucosa with inflammation induced by HP infection or autoimmune gastritis [1, 2]. Recently, several reports have demonstrated the development of gastric hyperplastic polyps as well as fundic gland polyps in patients with long-term PPI use [5]. The polyps are suspected to be associated to hypergastrinemia induced by the prolonged use of PPI [3, 12, 13]. In our case, HP infection was negative, and the endoscopy found no hypergastrinemia-related gastric mucosa atrophy (776 pg/dL). Our previous studies about the pathogenesis of gastric hyperplastic and other types of polyps demonstrated that hypergastrinemia induced by severe atrophic gastritis of the corpus or the prolonged use of PPI might play a role in the development of gastric hyperplastic polyps [14]. It is well known that gastrin has a trophic effect on gastrointestinal mucosa [12]. The rebamipide was used to decrease the gastrin level in the blood as well as to assist in repairing the gastric mucosal tissue [15].\n\nIt is well known that the disappearance or regression of fundic gland polyps is found in patients after the discontinuation of prolonged PPI use [13]. Moreover, two reports from Japan have demonstrated a similar phenomenon in patients with gastric hyperplastic polyps caused by PPI [7, 8]. Okazaki et al. [7]reported that gastric hyperplastic polyps disappeared 1 year after switching from PPI to an H2 receptor antagonist in an HP-negative patient with GERD. While the serum gastrin level was not indicated, Anjiki et al. [8] also reported on an HP-positive case of multiple hyperplastic polyps with adenocarcinoma. In that case, hypergastrinemia induced by PPI was found and after discontinuing PPI, the gastric polyps disappeared with the normalization of gastrin level. HP eradication therapy was also performed after discontinuing PPI. It is well known that HP eradication therapy normalizes serum gastrin levels which allows gastric hyperplastic polyps to disappear. Therefore, it is difficult to conclude whether the eradication of HP or the discontinuation of PPI might be responsible for the disappearance of gastric polyps.\n\nIn general practice, PPI is commonly used for long periods of time as therapy for reflux esophagitis, peptic ulcer diseases and their prevention, and HP eradication therapy. If gastric hyperplastic polyps with complications, such as bleeding or anemia are observed, as they were in this case, it is necessary to consider whether hypergastrinemia is being caused by PPI, and to decide to decrease the dose of PPI, switch to an H2 receptor antagonist, or discontinue the PPI altogether.\n\nStatement of Ethics\n\nWe have reported this case in compliance with the Declaration of Helsinki. Written informed consent was obtained from the patient and her next of kin for publication of this case report and any accompanying images.\n\nConflict of Interest Statement\n\nThe authors have no conflicts of interest to declare.\n\nFunding Sources\n\nNo authors have declared any specific grant for this article.\n\nAcknowledgements\n\nWe would like to thank Ayumi Iwata for revising this article, including English expressions.\n\nFig. 1 A part of the mucosal folds of the greater curvature of the stomach was swollen like a sausage, with a red surface (arrows). A red ridge on the fold beside the main lesion was also recognized. Two consecutive raised lesions on the fold beside the main lesion were also recognized. In addition, a broad-based reddish polypoid lesion was observed on the anterior wall side next to the two lesions, with a clot adhering to part of it. In addition, two small fundic gland polyps were noted (a). Biopsy specimens of gastric polyps show hyperplasia of the foveolar epithelium cells with edema of lamina propria and an increase of capillaries (H&E stain, ×100) (b).\n\nFig. 2 Compared with the previous findings, the morphology of the polypoid lesions has obviously changed. The swelling has increased, the number of lesions has also increased, and there are white mossy surface nodules with clots attached. Additionally, ridged lesions were found on the pylorus side in line with the mucosal folds (a). Pathological findings of the resected polyps showed the crypt hyperplasia with an edematous lamina propria containing prominent ectasia in the vessels of the surface epithelium (arrows) (H&E stain, ×200) (b). The deep layer of the resected polyps shows cystic dilation of the fundic glands and a remarkable hyperplasia of the parietal cells (H&E stain, ×400) (c).\n\nFig. 3 The area resected by EMR scarred and no ridge formation was observed (a). However, the ridge on the fold side on the pylorus side increased, and there were many raised lesions with blood clots on the pylorus side (b). Endoscopic findings 1 year and 6 months after the discontinuation of PPI and with the use of rebamipide are shown. Although post-EMR scarring with conversing folds is found in the middle of corpus (c), the welling of mucosal folds and surface redness are not found. All previous polypoid lesions in the antrum completely disappeared (d).\n==== Refs\nReferences\n\n1 Abraham SC Singh VK Yardley JH Wu TT Hyperplastic polyps of the stomach: associations with histologic patterns of gastritis and gastric atrophy Am J Surg Pathol 2001 4 25 (4) 500 7 11257625\n2 Yamanaka K Miyatani H Yoshida Y Ishii T Asabe S Takada O Malignant transformation of a gastric hyperplastic polyp in a context of Helicobacter pylori-negative autoimmune gastritis: a case report BMC Gastroenterol 2016 10 16 (1) 130 27729029\n3 Hongo M Fujimoto K Gastric Polyps Study Group Incidence and risk factor of fundic gland polyp and hyperplastic polyp in long-term proton pump inhibitor therapy: a prospective study in Japan J Gastroenterol 2010 6 45 (6) 618 24 20177714\n4 Zelter A Fernández JL Bilder C Rodríguez P Wonaga A Dorado F Fundic gland polyps and association with proton pump inhibitor intake: a prospective study in 1,780 endoscopies Dig Dis Sci 2011 6 56 (6) 1743 8 21127978\n5 Miyamoto S Kato M Matsuda K Abiko S Tsuda M Mizushima T Gastric hyperplastic polyps associated with proton pump inhibitor use in a case without a history of Helicobacter pylori infection Intern Med 2017 56 (14) 1825 9 28717077\n6 Stockbrügger RW Menon GG Beilby JO Mason RR Cotton PB Gastroscopic screening in 80 patients with pernicious anaemia Gut 1983 12 24 (12) 1141 7 6642278\n7 Okazaki Y Kotani K Higashi Y Vanishing gastric hyperplastic polyps BMJ Case Rep 2019 12e231341 10.1136/bcr-2019-231341\n8 Anjiki H Mukaisho KI Kadomoto Y Doi H Yoshikawa K Nakayama T Adenocarcinoma arising in multiple hyperplastic polyps in a patient with Helicobacter pylori infection and hypergastrinemia during long-term proton pump inhibitor therapy Clin J Gastroenterol 2017 4 10 (2) 128 36 28160247\n9 Ji F Wang ZW Ning JW Wang QY Chen JY Li YM Effect of drug treatment on hyperplastic gastric polyps infected with Helicobacter pylori: a randomized, controlled trial World J Gastroenterol 2006 3 12 (11) 1770 3 16586550\n10 Amarapurkar AD Amarapurkar D Choksi M Bhatt N Amarapurkar P Portal hypertensive polyps: distinct entity Indian J Gastroenterol 2013 5 32 (3) 195 9 23512212\n11 Kara D Hüsing-Kabar A Schmidt H Grünewald I Chandhok G Maschmeier M Portal hypertensive polyposis in advanced liver cirrhosis: the unknown entity? Can J Gastroenterol Hepatol 2018 8 2018 2182784 30155451\n12 Haruma K Kamada T Manabe N Suehiro M Kawamoto H Shiotani A Haruma k, Kamada T, Manabe N,Suehiro M, Kawamoto H, and Shiotani A. Old and new gut hormone, gastrin and acid suppressive therapy Digestion 2018 97 (4) 340 4 29587283\n13 Tanaka M Kataoka H Yagi T Proton-pump inhibitor-induced fundic gland polyps with hematemesis Clin J Gastroenterol 2019 4 12 (2) 193 5 30251013\n14 Haruma K Yoshihara M Sumii K Tari A Watanabe C Kodoi A Gastric acid secretion, serum pepsinogen I, and serum gastrin in Japanese with gastric hyperplastic polyps or polypoid-type early gastric carcinoma Scand J Gastroenterol 1993 7 28 (7) 633 7 8362219\n15 Haruma K Ito M Review article: clinical significance of mucosal-protective agents: acid, inflammation, carcinogenesis and rebamipide Aliment Pharmacol Ther 2003 7 18 Suppl 1 153 9 12925154\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-0631",
"issue": "15(1)",
"journal": "Case reports in gastroenterology",
"keywords": "Gastric hyperplastic polyp; Hypergastrinemia; Proton pump inhibitor",
"medline_ta": "Case Rep Gastroenterol",
"mesh_terms": null,
"nlm_unique_id": "101474819",
"other_id": null,
"pages": "202-209",
"pmc": null,
"pmid": "33790706",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "31511271;21127978;8362219;12925154;28160247;16586550;23512212;30251013;29587283;20177714;6642278;11257625;27729029;28717077;30155451",
"title": "Disappearance of Gastric Hyperplastic Polyps after the Discontinuation of Proton Pump Inhibitor in a Patient with Liver Cirrhosis.",
"title_normalized": "disappearance of gastric hyperplastic polyps after the discontinuation of proton pump inhibitor in a patient with liver cirrhosis"
} | [
{
"companynumb": "JP-LUPIN PHARMACEUTICALS INC.-2021-19563",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RABEPRAZOLE"
},
"drugadditiona... |
{
"abstract": "Cytoreductive surgery and hyperthermic intra-peritoneal chemotherapy (CRS-HIPEC) for peritoneal malignancies are complex surgeries marked with hemodynamic perturbations, temperature fluctuations, blood loss and metabolic disturbances in the intra-operative and post-operative period. In this report, we highlighted perioperative factors which may have led to cardiac arrest in immediate postoperative period and subsequent successful resuscitation in two patients with high volume peritoneal cancers who underwent CRS-HIPEC.\nBoth patients had a similar clinical course, characterized by massive blood and fluid loss, metabolic derangement, hemodynamic instability, long duration of surgery, post HIPEC rebound hypothermia and hypokalemia which need to be anticipated.\nWe reviewed the literature related to postoperative hypothermia and other major complications after CRS-HIPEC and correlated the available literature with our findings.",
"affiliations": "Department of Anesthesiology, Critical Care and Pain, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India.;Department of Anesthesiology, Critical Care and Pain, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India.;Gastro-Intestinal Services, Department of Surgical Oncology, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India.",
"authors": "Solanki|Sohan Lal|SL|https://orcid.org/0000-0003-4313-7659;Jhingan|Mrida A K|MAK|;Saklani|Avanish P|AP|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1515/pp-2020-0126",
"fulltext": "\n==== Front\nPleura Peritoneum\nPleura Peritoneum\npp\npp\npp\nPleura and Peritoneum\n2364-7671 2364-768X De Gruyter \n\npp-2020-0126\n10.1515/pp-2020-0126\nCase Report\nRebound hypothermia after cytoreductive surgery with hyperthermic intraperitoneal chemotherapy (CRS-HIPEC) and cardiac arrest in immediate postoperative period: a report of two cases and review of literature\nhttps://orcid.org/0000-0003-4313-7659Solanki Sohan Lal me_sohans@yahoo.co.in Jhingan Mrida A. K. Saklani Avanish P. \nDepartment of Anesthesiology, Critical Care and Pain, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India\n\n\nGastro-Intestinal Services, Department of Surgical Oncology, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India\n\nCorresponding author: Sohan Lal Solanki M.D., Department of Anesthesiology, Critical Care and Pain, Tata Memorial Hospital, Homi Bhabha National Institute, Mumbai, India. Phone: +91 9869253201, Fax: +91 22 24146937, E-mail: me_sohans@yahoo.co.in\n27 8 2020 \n9 2020 \n5 3 2020012624 4 2020 29 7 2020 © 2020 Sohan Lal Solanki et al., published by De Gruyter, Berlin/Boston2020Sohan Lal Solanki et al., published by De Gruyter, Berlin/BostonThis work is licensed under the Creative Commons Attribution 4.0 International License.Abstract\nObjectives\nCytoreductive surgery and hyperthermic intra-peritoneal chemotherapy (CRS-HIPEC) for peritoneal malignancies are complex surgeries marked with hemodynamic perturbations, temperature fluctuations, blood loss and metabolic disturbances in the intra-operative and post-operative period. In this report, we highlighted perioperative factors which may have led to cardiac arrest in immediate postoperative period and subsequent successful resuscitation in two patients with high volume peritoneal cancers who underwent CRS-HIPEC.\n\nCase presentation\nBoth patients had a similar clinical course, characterized by massive blood and fluid loss, metabolic derangement, hemodynamic instability, long duration of surgery, post HIPEC rebound hypothermia and hypokalemia which need to be anticipated.\n\nConclusions\nWe reviewed the literature related to postoperative hypothermia and other major complications after CRS-HIPEC and correlated the available literature with our findings.\n\nKeywords\ncancercardiac arrestcytoreductive surgeryhyperthermic chemotherapy\n==== Body\nIntroduction\nCytoreductive surgery and hyperthermic intraperitoneal chemotherapy (CRS-HIPEC) is an established treatment modality for peritoneal tumors, both primary and metastatic in origin [1], [2]. The peri-operative period is marked with varying blood loss, hemodynamic, and temperature fluctuations, electrolyte and acid-base imbalances and coagulation abnormalities and can be a challenge for perioperative physicians [3], [4]. In addition, during the HIPEC phase, these patients are treated with heated chemotherapeutic agents instilled in the abdominal cavity, predisposing them to the deleterious effects of hyperthermia along with the potential toxicity of the chemotherapeutic drugs [4], [5].\n\nDuring CRS, intra-operative fluid losses may be as high as 8–12 mL/kg/h in addition to the ongoing blood loss [3], [6]. Due to the extensive nature of the surgical resection, blood and ascitic fluid loss, fluid exudation and coagulation abnormalities, the amount of fluid required to maintain normovolemia is increased [7]. This increased fluid requirement extends well into the post-operative period, as drain output continues to be high due to the severely wounded and exuding peritoneal surfaces. In addition, there is significant protein loss which is a key component of this fluid [7].\n\nPerioperative hypothermia poses significant clinical implications of its own, leading to a threefold increase in incidence of adverse myocardial events [8]. It has been hypothesized that hypothermia induced hypertension increases plasma norepinephrine levels in the elderly which can increase cardiac irritability and predispose the patient to develop ventricular arrythmias [8]. In addition, there is a significant increase in blood loss and blood transfusion requirement, coagulopathies, wound infection, chances of prolonged post-operative recovery, and mild hypokalemia [8], [9]. Literature is limited about the effects of immediate post-operative hypothermia on patients undergoing major surgical procedures such as CRS-HIPEC and their effect on the deranged internal milieu as indicated by the hemodynamic instability encountered.\n\nWe would like to report two cases of CRS-HIPEC with similar perioperative course, wherein both patients had cardiac arrest in the immediate post-operative period and were successfully resuscitated. This report and review of literature aims to identify perioperative factors that led to the cardiac arrest and thus prevent similar occurrences of such life threatening complications in future patients posted for CRS-HIPEC.\n\nThe consent for publication of data has been taken from both patients and this data has been correlated with available literature for better understanding of the mechanism and consequences of postoperative hypothermia and its possible interactions with other major complications that occurred.\n\nCase presentation\nTwo patients were posted for CRS-HIPEC for malignant peritoneal mesothelioma and pseudomyxoma peritonei respectively. Both patients were assessed and optimized in the pulmonary rehabilitation and nutritional clinics in the pre-operative period apart from proper pre-operative evaluation including cardio-pulmonary evaluation and preoperative laboratory investigations. In both patients, general anesthesia with thoracic epidural analgesia (T8–T9) was used. Electrocardiography, pulse oximetry, non-invasive blood pressure, end tidal carbon dioxide, temperature monitoring along with advanced hemodynamic monitoring with invasive blood pressure, central venous pressure and cardiac output monitoring with FloTrac were used for both the patients. Anesthesia was maintained with sevoflurane in oxygen and nitrous oxide. Goal directed fluid therapy was administered, to achieve target values of mean arterial pressure (MAP)>70 mm Hg, cardiac index (CI) >2.5 L/min/m2, stroke volume index (SVI)>35 mL/m2 and stroke volume variability (SVV)<12. A target urine output of 0.5 mL/kg/h in the CRS phase, 2– 4 mL/kg/h during HIPEC and 1 mL/kg/h in the reconstructive phase was targeted. Intraoperative and postoperative parameters, blood gases and cardiac output parameters of both patients are mentioned and compared in Tables 1 and 2.\n\nTable 1: Intra-operative and post-operative findings in both cases.\n\n\tCase 1\tCase 2\t\nDuration of surgery, (h)\t16\t19\t\nBlood loss, (L)\t3.8\t9.4\t\nAscitic fluid loss, (L)\t12\tMinimal\t\nIntra-operative transfusion requirement\t\n Packed red blood cell units\t3\t13\t\n Fresh frozen plasma units\t3\t7\t\n Single donor platelet units\t0\t1\t\nIntra-operative fluid requirement, (L)\t\n Crystalloids\t15\t11.5\t\n Colloids (albumin 4%)\t3.5\t4\t\nIntra-operative noradrenaline requirement,(mcg/kg/min)\t0.1–0.3\t0.01–0.6\t\nIntra-operative urine output, (L)\t2.5\t2.5\t\nIntra-operative coagulation parameters: End of CRS, (s)\t\n PT\t19.9\t30.3\t\n INR\t1.48\t2.34\t\n aPTT\t29.7\t54\t\nPost-operative coagulation parameters, (s)\t\n PT\t26.0\t33.4\t\n INR\t2.0\t2.6\t\n aPTT\t51.3\t52.5\t\nLowest core body temperature, (°C) before starting HIPEC\t34.3\t35.1\t\nHighest core body temperature, (°C) during HIPEC\t37.7\t37.1\t\nDelta temperature\t3.4\t2.0\t\nCore body temperature on shifting to ICU, (°C)\t34.0\t34.4\t\nNoradrenaline requirement on shifting to ICU, (mcg/kg/min)\t0.3\t0.16\t\nTiming of cardiac arrest after shifting to ICU, (min)\t240\t45\t\nReturn of spontaneous circulation (ROSC), (min)\t2.5\t20\t\nDrain output at the end of POD-1, (L)\t6.3\t2.7\t\naPTT, activated partial thromboplastin time; HIPEC, hyperthermic intraperitoneal chemotherapy; ICU, intensive care unit;INR, international normalized ratio; POD, postoperative day; PT, prothrombin time.\n\nTable 2: Perioperative arterial blood gas and central venous blood gas analyses and cardiac output parameters for both cases.\n\n\tABG\tcVBG\tCardiac output monitor parameters\t\nCase\tpH\tCO2 (mm Hg)\tBase excess (mmoL/L)\tK (mmoL/L)\tLactates (mmoL/L)\tScvO2 (%)\tCI (L/min/m2)\tSVI (mL/m2)\tSVV\n%\t\nEnd of CRS\tCase 1\t7.20\t43.5\t−11.2\t3.84\t4.99\t85\t2.5\t25\t8\t\nCase 2\t7.39\t34.7\t−4\t3.63\t5.22\t78.3\t2.6\t35\t14\t\nDuring HIPEC\tMid-way\tCase 1\t7.19\t44.8\t−11.1\t3.75\t6.18\t76.2\t2.5\t32\t7\t\nCase 2\t7.34\t39.3\t−4.6\t3.77\t6.2\t55.6\t3.1\t34\t10\t\nEnd\tCase 1\t7.17\t47.7\t−11.1\t3.47\t6.01\t79.1\t3.6\t37\t15\t\nCase 2\t7.32\t39.8\t−5.3\t3.98\t6.37\t59.2\t3.6\t26\t7\t\nAt the time of shifting to the ICU\tCase 1\t7.16\t44\t−13.1\t2.99\t5.39\t85.2\t2.1\t13\t27\t\nCase 2\t7.32\t22.9\t−13\t2.61\t3.01\t53.2\t3.9\t61\t9\t\nPost resuscitation\tCase 1\t7.29\t24.3\t−15\t3.98\t8.42\t–\t2.6\t18\t53\t\nCase 2\t6.95\t69.5\t−17.7\t–\t12.59\t–\t4.1\t69\t13\t\nABG, arterial blood gas; cVBG, central venous blood gas; K, serum potassium; ScvO2, central venous oxygen saturation; CI, cardiac index; SVI, stroke volume index; SVV, stroke volume variation.\n\nCase 1\nA 53-year-old man, American Society of Anesthesiologists (ASA) physical status I, with malignant peritoneal mesothelioma, underwent extensive resection, involving total peritonectomy, bilateral diaphragmatic stripping, mesenteric, and meso-colic omentectomy and cholecystectomy. The Peritoneal Carcinomatosis Index (PCI) was 26 and a completeness of clearance (CC) score 0 was achieved, which was followed by HIPEC with Mitomycin 20 mg and Cisplatin 75 mg at 42 °C for 60 min. The HIPEC phase was delayed due to hemodynamic instability necessitating fluid resuscitation and noradrenaline infusion. Noradrenaline requirement went up from 0.1 to 0.3 μg/kg/min by the end of surgery.\n\nOn admission to the surgical intensive care unit (ICU), patient was hypothermic (34 °C) with cold clammy extremities, heart rate (HR) 157/min, MAP 75 mm Hg and noradrenaline infusion ongoing at 0.3 mcg/kg/min. Serum potassium in arterial blood was 2.99 mmoL/L. Fluid boluses of 1.5 L crystalloid and 1 L albumin 4% were given. A bolus dose of 1 mEq/kg of sodium bicarbonate was given in view of severe worsening high anion gap metabolic acidosis (pH−7.16) on the arterial blood gas (ABG), followed by an infusion at the rate of 0.5 mEq/kg/h. After 4 h, blood pressure began to drop and 1 L crystalloid bolus was given. The patient then went into cardiac arrest, cardio-pulmonary resuscitation (CPR) was started and patient was successfully resuscitated with return of spontaneous circulation (ROSC) after 150 s. Echocardiography showed a collapsing inferior vena cava, for which 3 L of crystalloid and 1 L albumin 4% was rushed. Drain output was high in the immediate post-operative period and was serous in nature, along with deranged coagulation parameters and required aggressive fluid resuscitation including crystalloids, albumin, packed red blood cells and fresh frozen plasma. Noradrenaline support was slowly tapered and tracheal extubation was done over non-invasive ventilation (NIV) on second post-operative day (POD). He required intermittent NIV and oxygenation by high flow nasal cannula (HFNC) for 3 days and was shifted to the ward on POD 5.\n\nCase 2\nA 36-year-old woman, case of pseudomyxoma peritonei, ASA physical status II, hypothyroid, who underwent total peritonectomy, near total gastrectomy, total abdominal hysterectomy, bilateral salpingo-oophorectomy, omentectomy, splenectomy, appendicular stump revision, loop sigmoid colostomy, and an accidental inferior vena cava rent which necessitated inferior vena cava repair, with bilateral intercostal drain placement followed by HIPEC with Doxorubicin 20 mg and Mitomycin-C 20 mg for 45 min. The PCI was 26 and a CC-0 was achieved. Noradrenaline infusion was started during CRS, requirement increasing up to 0.6 µg/kg/min during IVC repair, which was gradually tapered. Coagulopathy correction was started intra-operatively due to massive blood loss (9.4 L), abnormal coagulation parameters and oozing in the surgical field. Fluid management was goal directed as in case 1. The HIPEC phase was shortened to 45 min because of hemodynamic instability.\n\nOn shifting to the surgical ICU, patient had a HR of 93/min, MAP: 81 mm Hg, with cold clammy extremities, oropharyngeal temperature of 34.4 °C and noradrenaline infusion ongoing at 0.16 mcg/kg/min. Serum potassium in arterial blood was 2.61 mmoL/L. Subsequently, she developed tachycardia (HR 160/min), hypotension and required fluid boluses (500 mL crystalloid, 250 mL 4% albumin). After 45 min of shifting, patient had cardiac arrest, CPR was given and ROSC was attained after 20 min. Fluid resuscitation and coagulopathy correction was continued in the post-operative period including crystalloids, albumin, blood, and fresh frozen plasma. She was weaned from mechanical ventilation gradually and trachea was extubated on POD 6, required HFNC for 4 days and was shifted to ward on POD 11.\n\nDiscussion\nSince its introduction in the 1990s, HIPEC with time has become the standard of care for peritoneal mesotheliomas and appendicular, colorectal, gastric cancers with peritoneal metastases, while showing promising results in ovarian carcinomas [1]. With careful patient selection and optimal post-operative management, the morbidity and mortality associated with these surgeries has now been shown to be comparable with other major gastrointestinal surgeries such as Whipple’s procedure, with mortality rates ranging from 0.9 to 5.8% in high volume centers and major morbidity (grade III/IV) ranging from 12 to 52% [10]. Kim et al. reported an overall hospital mortality rate of 1.67% with median time to death being 41 days, infection and subsequent sepsis being the most significant cause [11].\n\nIn the peri-operative period, longer durations of surgery, higher PCI, massive blood loss with increased resuscitative fluid requirement and lower PaO2/FiO2 ratios were found to be associated with increased requirement of post-operative ventilation for >24 h and ICU stay for >5 days [5]. Increased transfusion requirements (≥6 units) have also been associated with increased hospital mortality [11]. Much research has been done to study the contributing factors increasing the risk of morbidity and mortality and have found to include patient factors such as age, performance status and hypoalbuminemia and surgical factors such as the PCI, bowel resection, diaphragmatic involvement, distal pancreatectomy, histology of tumor and surgeon’s experience [12].\n\nThe common intra-operative findings in both our cases included major fluid and blood losses, acute volume depletion, systemic inflammatory response syndrome, and subsequent hemodynamic instability necessitating vasopressor requirement, metabolic acidosis, raised arterial lactate levels, higher delta temperatures followed by post HIPEC rebound hypothermia, and low serum potassium levels which collectively may have resulted in the cardiac arrest.\n\nBoth our cases were primary peritoneal malignancies having a high pre-procedure tumor load indicated by a PCI of 26. The surgeries were of long duration (≥16 h). Hemodynamic instability necessitating noradrenaline infusion was first encountered during CRS. Metabolic acidosis encountered towards the end of CRS along with increased lactate levels (4.99 and 5.22 mmoL/L respectively in case 1 and case 2) could be explained by hypovolemia, hypoperfusion and extensive cytoreduction. Arterial lactate levels further rose to 6.01 and 6.37 mmoL/L respectively, at the end of HIPEC, and could be explained by the rise in core body temperature. At the time of shifting the patient to ICU, ABGs were consistent with metabolic acidosis (pH 7.16 and 7.32 respectively), high lactate levels (5.39 and 3.01 mmoL/L respectively) and significant base deficit (13.1 and 13 mmoL/L respectively). This could be attributed to multiple factors such as prolonged duration of surgery, effect of volume and blood loss and tissue hypoxia despite volume resuscitation including blood and blood products. Sodium bicarbonate therapy was instituted in case 1 in the ICU in view of severe metabolic acidosis on ABG (pH:7.16), it’s use being restricted to cases with severe persistent metabolic acidosis with pH≤7.1, to avoid risk of potential side effects of bicarbonate therapy including hypercapnia, hypokalemia, ionized hypocalcemia, increased lactate levels and QTc prolongation with no definitive proven benefits in terms of clinical outcome and mortality [13]. Mixed central venous oxygen saturation (ScvO2) was low in case 2 throughout the HIPEC and post HIPEC phase which could suggest an increased tissue oxygen demand. Although the serum potassium levels were in the normal range in CRS and HIPEC phases of surgery, at the time of shifting, both patients were hypokalemic (2.99 and 2.61 mmoL/L respectively) which may have added to the insult.\n\nBoth the patients were hypothermic in the immediate post-operative period (≤34.4 °C) and required active rewarming measures. Despite using warming devices on the upper part of the body during reconstructive phase, the extensive surgical field, removal of warm fluids from the surgical site, and abdominal wash may have caused persistent rebound hypothermia. This post HIPEC hypothermia may have been exaggerated by active cooling measures initiated prior to HIPEC phase, resulting in a subsequently higher delta temperature intraoperatively, which has also been found to be an independent predictor of post-operative morbidity after CRS-HIPEC [4]. Shorter duration of HIPEC and thus shorter exposure to warming measures in these cases may have also contributed to post HIPEC hypothermia. Mild hypothermia has been associated with an increase in systemic vascular resistance leading to peripheral vasoconstriction and an initial tachycardia which could lead to an increase in cardiac output [14]. With active rewarming measures, it is a possibility that the subsequent vasodilatation caused could have unmasked an underlying hypovolemia which further exacerbated the hemodynamic instability [15]. Relative hypovolemia caused due to vasodilatation primarily, venodilation, encountered during anesthesia has been attributed to multiple factors, such as the effect of anesthetic agents, loss of compensatory mechanisms, metabolic or respiratory acidosis, traumatic or surgically mediated inflammation and sepsis [16]. Kim et al. in their study showed an increase in one year mortality in post-operative patients having an increase or decrease in axillary temperatures (taking median temperature as 36.6 degree Celsius) on admission to the ICU [17]. In addition, other known complications of hypothermia, such as increased risks of cardiac events, perioperative hemorrhage, blood loss and transfusion requirements and infection rates, make it essential to maintain normothermia in the peri-operative period [18].\n\nBoth patients were successfully resuscitated after cardiac arrest and discharged from ICU and hospital with no neurological complications. In case 2, it took 20 min to attain ROSC and it is a possibility that the hypothermia may have had a protective effect against cerebral hypoxia. High drain (abdominal and intercostal drains) output also contributed to hemodynamic instability and required volume replacement along with thromoboelastography guided coagulopathy correction.\n\nNon-invasive cardiac output monitoring like arterial pressure based cardiac output monitoring has been recommended and used regularly for CRS-HIPEC with high tumor load (PCI>15) or in cases of hemodynamic instability [3], [4], [19] and has shown improved outcome in terms of reduced post-operative complications and ICU stay [20]. These non-invasive cardiac output monitors help to assess volume status and predict fluid responsiveness. Any indication of hypovolemia intra-operatively was adequately treated with fluid boluses and further assessed in response to the fluid bolus, such that a uniform CI≥2.5 L/min/m2 was maintained throughout the surgery, indicating a seemingly adequate intravascular volume. SVI was however low and SVV was high in case 1 from end of HIPEC phase extending into postoperative period indicating either a volume depleted state or a peripherally vasodilated state due to the anesthetic agents as the cause of the hemodynamic instability. This highlight the challenges of goal directed fluid therapy in such cases, with varied cardiovascular compensatory mechanisms in response to extensive volume loss, anesthetic agents, temperature fluctuations, and ongoing inflammatory mechanisms [21] and thus limits its reliability. Volume replacement was carried out in a way to ensure that colloids along with blood and blood products were used to replace surgical volume loss and crystalloids were primarily used for maintenance, their requirement being grossly increased due to the ongoing inflammatory cascade.\n\nIn conclusion, we would like to reiterate that, patients undergoing extensive CRS-HIPEC can pose with significant peri-operative hemodynamic fluctuations due to massive blood and fluid losses. Undetected and uncorrected hypovolemia leading to hypoperfusion can lead to disastrous consequences. This hypovolemia may be masked by the hyperdynamic circulation caused during HIPEC and exacerbated by the peripherally vasodilated state after HIPEC attributed to anesthetic agents or rewarming measures carried out to treat hypothermia. It becomes imperative to maintain a state of normovolemia with adequate fluid replacement which must be goal directed, taking into consideration other factors such as hypothermia which may mask the underlying hypovolemia. Rebound hypothermia after HIPEC which is not commonly studied, can add to the already compromised hemodynamics with or without electrolyte abnormalities, and lead to disastrous complications like cardiac arrest. Reducing delta temperature intraoperatively by keeping constant normothermia can help prevent such complications.\n\n\nResearch funding: None declared.\n\n\nAuthor contributions: SLS: Conduction of cases, idea of manuscript, data analysis, manuscript writing, proof reading and final approval. MJ: Conduction of cases, data analysis, manuscript writing, proof reading and final approval. APS: Conduction of cases, data analysis, proof reading and final approval. All authors have accepted responsibility for the entire content of this manuscript and approved its submission.\n\n\nInformed consent: Informed consent was obtained from all individuals included in this study.\n\n\nEthical approval: Research involving human subjects complied with all relevant national regulations, institutional policies and is in accordance with the tenets of the Helsinki Declaration (as revised in 2013), and has been approved by the authors’ Institutional Review Board.\n\n\nCompeting interests: Authors state no conflict of interest.\n==== Refs\nReferences\n1. \nSugarbaker PH , Van der Speeten K \nSurgical technology and pharmacology of hyperthermic perioperative chemotherapy\n. J Gastrointest Oncol \n2016 ; 7 : 29 –44\n. 10.3978/j.issn.2078-6891.2015.105 .26941982 \n2. \nFoster JM , Sleightholm R , Patel A , Shostrom V , Hall B , Neilsen B , \nMorbidity and mortality rates following cytoreductive surgery combined with hyperthermic intraperitoneal chemotherapy compared with other high-risk surgical oncology procedures\n. JAMA Netw Open \n2019 ; 2 : e186847 \n10.1001/jamanetworkopen.2018.6847 .30646202 \n3. \nSolanki SL , Mukherjee S , Agarwal V , Thota RS , Balakrishnan K , Shah BS , \nSociety of onco-anaesthesia and perioperative care consensus guidelines for perioperative management of patients for cytoreductive surgery and hyperthermic intraperitoneal chemotherapy (CRS-HIPEC)\n. Indian J Anaesth \n2019 ; 63 : 972 –87\n. 10.4103/ija.ija_765_19 .31879421 \n4. \nSolanki SL , Bajaj JS , Rahman F , Saklani AP \nPerioperative management of cytoreductive surgery and hyperthermic intraoperative thoraco-abdominal chemotherapy (HITAC) for pseudomyxoma peritonei\n. Indian J Anaesth \n2019 ; 63 : 134 –7\n. 10.4103/ija.IJA_825_18 .30814751 \n5. \nBalakrishnan KP , Survesan S \nAnaesthetic management and perioperative outcomes of cytoreductive surgery with hyperthermic intraperitoneal chemotherapy: a retrospective analysis\n. Indian J Anaesth \n2018 ; 62 : 188 –96\n. 10.4103/ija.ija_39_18 .29643552 \n6. \nGupta N , Kumar V , Garg R , Bharti SJ , Mishra S , Bhatnagar S \nAnesthetic implications in hyperthermic intraperitoneal chemotherapy\n. J Anaesthesiol Clin Pharmacol \n2019 ; 35 : 3 –11\n. 10.4103/joacp.joacp_259_17 .31057232 \n7. \nPadmakumar AV \nIntensive care management of patient after cytoreductive surgery and HIPEC-a concise review\n. Indian J Surg Oncol \n2016 ; 7 : 244 –8\n. 10.1007/s13193-016-0511-7 .27065716 \n8. \nSessler DI \nComplications and treatment of mild hypothermia\n. Anesthesiology \n2001 ; 95 : 531 –43\n. 10.1097/00000542-200108000-00040 .11506130 \n9. \nSessler DI \nPerioperative thermoregulation and heat balance\n. Lancet \n2016 ; 387 : 2655 –64\n. 10.1016/s0140-6736(15)00981-2 .26775126 \n10. \nChua TC , Yan TD , Saxena A , Morris DL \nShould the treatment of peritoneal carcinomatosis by cytoreductive surgery and hyperthermic intraperitoneal chemotherapy still be regarded as a highly morbid procedure?: a systematic review of morbidity and mortality\n. Ann Surg \n2009 ; 249 : 900 –7\n. 10.1097/sla.0b013e3181a45d86 .19474692 \n11. \nKim B , Alzahrani N , Valle SJ , Liauw W , Morris DL \nTreatment-related post-operative mortality after cytoreductive surgery and perioperative intraperitoneal chemotherapy\n. J Peritoneum (and other serosal surfaces) \n2017 ; 2 : 71 –9\n. 10.4081/joper.2017.65 .\n12. \nNewton AD , Bartlett EK , Karakousis GC \nCytoreductive surgery and hyperthermic intraperitoneal chemotherapy: a review of factors contributing to morbidity and mortality\n. J Gastrointest Oncol \n2016 ; 7 : 99 –111\n. 10.3978/j.issn.2078-6891.2015.100 .26941988 \n13. \nAdeva-Andany MM , Fernández-Fernández C , Mouriño-Bayolo D , Castro-Quintela E , Domínguez-Montero A \nSodium bicarbonate therapy in patients with metabolic acidosis\n. Sci World J \n2014 ; 2014 : 627673 \n10.1155/2014/627673 .\n14. \nMallet ML \nPathophysiology of accidental hypothermia\n. QJM \n2002 ; 95 : 775 –85\n. 10.1093/qjmed/95.12.775 .12454320 \n15. \nOhri S , Tang A , Stephenson L \nKey topics in cardiac surgery . USA : CRC Press ; 2004 .\n16. \nNoel-Morgan J , Muir WW \nAnesthesia-associated relative hypovolemia: mechanisms, monitoring, and treatment considerations\n. Front Vet Sci \n2018 ; 5 : 53 \n10.3389/fvets.2018.00053 .29616230 \n17. \nKim J , Oh TK , Lee J , Kim S , Song IA \nAssociation of immediate postoperative temperature in the surgical intensive care unit with one year mortality: retrospective analysis using digital axillary thermometers\n. Acute Crit Care \n2019 ; 34 : 53 –9\n. 10.4266/acc.2019.00255 .31723905 \n18. \nKim D \nPostoperative hypothermia\n. Acute Crit Care \n2019 ; 34 : 79 –80\n. 10.4266/acc.2018.00395 .31723908 \n19. \nGarg R \nCytoreductive surgery and hyperthermic intraperitoneal chemotherapy: fluid and temperature remain the culprit!\n\nIndian J Anaesth \n2018 ; 62 : 162 –5\n. 10.4103/ija.ija_170_18 .29643548 \n20. \nColantonio L , Claroni C , Fabrizi L , Marcelli ME , Sofra M , Giannarelli D , \nA randomized trial of goal directed vs. standard fluid therapy in cytoreductive surgery with hyperthermic intraperitoneal chemotherapy\n. J Gastrointest Surg \n2015 ; 19 : 722 –9\n. 10.1007/s11605-015-2743-1 .25595308 \n21. \nKendrick JB , Kaye AD , Tong Y , Belani K , Urman RD , Hoffman C , \nGoal-directed fluid therapy in the perioperative setting\n. J Anaesthesiol Clin Pharmacol \n2019 ; 35 : S29 –34\n. 10.1017/cbo9780511733253.012 .31142956\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2364-768X",
"issue": "5(3)",
"journal": "Pleura and peritoneum",
"keywords": "cancer; cardiac arrest; cytoreductive surgery; hyperthermic chemotherapy",
"medline_ta": "Pleura Peritoneum",
"mesh_terms": null,
"nlm_unique_id": "101710063",
"other_id": null,
"pages": "20200126",
"pmc": null,
"pmid": "33364341",
"pubdate": "2020-09",
"publication_types": "D002363:Case Reports",
"references": "26775126;19474692;29643548;30814751;27065716;30646202;31879421;31057232;12454320;29643552;26941982;31723905;25595308;31142956;25405229;26941988;31723908;29616230;11506130",
"title": "Rebound hypothermia after cytoreductive surgery with hyperthermic intraperitoneal chemotherapy (CRS-HIPEC) and cardiac arrest in immediate postoperative period: a report of two cases and review of literature.",
"title_normalized": "rebound hypothermia after cytoreductive surgery with hyperthermic intraperitoneal chemotherapy crs hipec and cardiac arrest in immediate postoperative period a report of two cases and review of literature"
} | [
{
"companynumb": "IN-PFIZER INC-2020499830",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "NOREPINEPHRINE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThese data compare the efficacy and safety of highly purified human-derived follicle-stimulating hormone (Bravelle) and recombinant follitropin-beta (Follistim) in women undergoing in vitro fertilization.\n\n\nMETHODS\nThis report describes the pooled data from two, nearly identical, randomized, controlled, parallel-group, multicenter studies conducted in a total of 19 academic and private IVF-ET centers in the United States. Infertile premenopausal women underwent pituitary down-regulation using leuprolide acetate followed by a maximum of 12 days of subcutaneous Bravelle (n = 120) or Follistim (n = 118), followed by administration of human chorionic gonadotropin, oocyte retrieval and embryo transfer. The primary efficacy measure was the mean number of oocytes retrieved; secondary efficacy measures included the total dose and duration of gonadotropin treatment; peak serum estradion levels; embryo transfer and implantation rates; chemical, clinical and continuing pregnancies; and live birth rates. All adverse events were recorded and injection site pain was recorded daily using a patient, self-assessment diary.\n\n\nRESULTS\nSimilar efficacy responses were observed for all outcome parameters in the two treatment groups. Although patients receiving Bravelle consistently reported a greater number of chemical, clinical and continuing pregnancies, as well as an increased rate of live birth, the data did not attain statistical significance (P > 0.05). The overall incidence of adverse events was similar in both groups, but compared to Follistim, injections of Bravelle were reported by patients to be significantly less painful (P < 0.001).\n\n\nCONCLUSIONS\nBravelle and Follistim had comparable efficacy in controlled ovarian hyperstimulation in women undergoing IVF-ET. There were no differences in the nature or number of adverse events between the treatment groups although Bravelle injections were reported to be significantly less painful.",
"affiliations": "Fertility Institute of New Orleans, New Orleans, LA, USA. renee@fertilityinstitute.com",
"authors": "Dickey|Richard P|RP|;Nichols|John E|JE|;Steinkampf|Michael P|MP|;Gocial|Benjamin|B|;Thornton|Melvin|M|;Webster|Bobby W|BW|;Bello|Sandra M|SM|;Crain|Jack|J|;Marshall|Dennis C|DC|;|||",
"chemical_list": "D006063:Chorionic Gonadotropin; D043373:Follicle Stimulating Hormone, Human; D005640:Follicle Stimulating Hormone; D016729:Leuprolide",
"country": "England",
"delete": false,
"doi": "10.1186/1477-7827-1-63",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1477-7827",
"issue": "1()",
"journal": "Reproductive biology and endocrinology : RB&E",
"keywords": null,
"medline_ta": "Reprod Biol Endocrinol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D006063:Chorionic Gonadotropin; D004624:Embryo Transfer; D005260:Female; D005307:Fertilization in Vitro; D005640:Follicle Stimulating Hormone; D043373:Follicle Stimulating Hormone, Human; D006801:Humans; D007247:Infertility, Female; D016729:Leuprolide; D009865:Oocytes; D010062:Ovulation Induction; D010146:Pain; D011247:Pregnancy; D011256:Pregnancy Outcome; D016896:Treatment Outcome",
"nlm_unique_id": "101153627",
"other_id": null,
"pages": "63",
"pmc": null,
"pmid": "14609434",
"pubdate": "2003-10-03",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": "7805928;11499322;10813100;9402268;12773438;11209534;12571166;9714028;5952830;13611018;11334903;11591255;12413994;12057729;8293846;10783345",
"title": "Highly purified human-derived follicle-stimulating hormone (Bravelle) has equivalent efficacy to follitropin-beta (Follistim) in infertile women undergoing in vitro fertilization.",
"title_normalized": "highly purified human derived follicle stimulating hormone bravelle has equivalent efficacy to follitropin beta follistim in infertile women undergoing in vitro fertilization"
} | [
{
"companynumb": "US-009507513-2005-126324-NL",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEUPROLIDE ACETATE"
},
"drugadditional": n... |
{
"abstract": "Dupilumab is a monoclonal antibody that is used for the treatment of atopic dermatitis (AD) in adults. However, increasing reports of ocular complications including conjunctivitis and dry eye disease have been documented. In this report, we describe a case of a patient who developed limbal stem cell deficiency (LSCD) after prolonged Dupilumab use. A 56-year-old Caucasian male with a history of AD presented with gradual onset cloudy vision and extensive diffuse symblepharon resulting from Dupilumab treatment. He was diagnosed with cicatrizing blepharoconjunctivitis and secondary LSCD after slit lamp examination. In conclusion, LSCD secondary to cicatricial disease is a severe adverse ocular complication caused from long-term Dupilumab treatment.",
"affiliations": "Gavin Herbert Eye Institute, Department of Ophthalmology, University of California, Irvine, CA, 92697, USA.;Gavin Herbert Eye Institute, Department of Ophthalmology, University of California, Irvine, CA, 92697, USA.",
"authors": "Mehta|Urmi|U|;Farid|Marjan|M|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/IMCRJ.S308583",
"fulltext": "\n==== Front\nInt Med Case Rep J\nInt Med Case Rep J\nimcrj\nimcrj\nInternational Medical Case Reports Journal\n1179-142X\nDove\n\n308583\n10.2147/IMCRJ.S308583\nCase Report\nDupilumab Induced Limbal Stem Cell Deficiency\nMehta and Farid\nMehta and Farid\nMehta Urmi 12\nFarid Marjan 1\n1 Gavin Herbert Eye Institute, Department of Ophthalmology, University of California, Irvine, CA, 92697, USA\n2 Western University of Health Sciences, Pomona, CA, 91766, USA\nCorrespondence: Marjan Farid Gavin Herbert Eye Institute, University of California, Irvine, CA, USATel +1 949 824-2020 Email mfarid@hs.uci.edu\n05 5 2021\n2021\n14 275278\n04 3 2021\n22 3 2021\n© 2021 Mehta and Farid.\n2021\nMehta and Farid.\nhttps://creativecommons.org/licenses/by-nc/3.0/ This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).\nAbstract\n\nDupilumab is a monoclonal antibody that is used for the treatment of atopic dermatitis (AD) in adults. However, increasing reports of ocular complications including conjunctivitis and dry eye disease have been documented. In this report, we describe a case of a patient who developed limbal stem cell deficiency (LSCD) after prolonged Dupilumab use. A 56-year-old Caucasian male with a history of AD presented with gradual onset cloudy vision and extensive diffuse symblepharon resulting from Dupilumab treatment. He was diagnosed with cicatrizing blepharoconjunctivitis and secondary LSCD after slit lamp examination. In conclusion, LSCD secondary to cicatricial disease is a severe adverse ocular complication caused from long-term Dupilumab treatment.\n\nKeywords\n\nlimbal stem cell disease\nsymblepharon\ncicatrizing blepharoconjunctivitis\nDupilumab\ndupixent\nRPB unrestricted grant The authors acknowledge departmental support from an RPB unrestricted grant.\n==== Body\nIntroduction\n\nDupilumab is a human monoclonal antibody that works by inhibiting interleukin (IL)-4 and IL-13 signaling by binding to the shared IL-4 alpha subunit.1,2 It is efficacious in treating moderate to severe atopic dermatitis (AD) in adults whose disease has been refractory to or inadequately managed by other immunosuppressive agents.3\n\nThe most common adverse ophthalmic complication from Dupilumab treatment is conjunctivitis.4,5 Although most cases of conjunctivitis are mild and self-limiting, few cases have required drug cessation due to severe ocular surface disease.6 Other reported adverse reactions include eye irritation, blepharitis,7 blepharoconjunctivitis,6,8 periocular dermatitis,6 cicatricial ectropion,6,8 keratitis,7,8 limbitis,9 and limbal stem cell deficiency (LSCD).3\n\nIn this report, we present a case of a healthy 56-year-old male who developed bilateral LSCD with extensive diffuse symblepharon affecting his extraocular movements after prolonged Dupilumab therapy for AD.\n\nCase Presentation\n\nA 56-year-old Caucasian male with a history of AD, LASIK OU (2000), trauma induced corneal flap removal (2010) and SK of the left eye (2020) presented to the ophthalmology clinic with bilateral “shrinking of his eyes” that gradually developed after starting Dupilumab treatment. He was started on bimonthly Dupilumab injections (300 mg SC q2wk) in January 2015. About one year after starting the medication, he started noticing ocular complications, including peeling and burning of his eyelid margins (360 degree involvement) that extended beyond the palpebral fissures, clouding and blurring of his vision, and trichiasis. Symptoms gradually worsened, and by 2018, he developed diffuse bilateral symblepharon that led to gaze restriction in extreme lateral gazes and forniceal shortening causing his scleral lens to no longer fit.\n\nHe discontinued Dupilumab in September 2019 due to worsening ocular complications, including double vision in extreme lateral gaze, worsening vision of both eyes, and chronic eyelid and ocular surface inflammation. After discontinuation of the Dupilumab, he reported a gradual improvement in his vision and skin around his eyelids.\n\nOn physical exam, BCVA at distance with RGP lenses was 20/30 OU. Slit lamp exam showed bilateral eyelid edema, inflammation, and extensive severe symblepharon throughout the inferior, nasal, and temporal regions (Figure 1), causing restriction of extreme lateral gaze and forniceal shortening. Anterior corneal scarring with subepithelial haze, obscured limbal architecture, and poor corneal epithelial cell health with whorled pattern epitheliopathy was seen bilaterally (Figure 2A and B). However, the left eye was more severe, showing more corneal neovascularization and temporal conjunctivalization of cornea (Figure 2B).Figure 1 Arrows point to symblepharon formation seen inferiorly in the right (A) and left (B) eyes.\n\nFigure 2 Limbal stem cell deficiency in the right (A) and left (B) eye. Arrows point to neovascularization and conjunctivalization of the cornea. Whorled keratopathy, obscured limbal architecture, subepithelial haze, and conjunctival hyperemia are also present bilaterally.\n\nHe was started on autologous serum eyedrops 75% (q2hour) to be used in conjunction with fluorometholone 0.1% (BID), which he had been using prior to his visit to the clinic. Further topical immunomodulators such as cyclosporine or lifitegrast will be added to minimize ocular inflammation. He is also being closely monitored for progression as systemic immunosuppression may be required as well.\n\nDiscussion\n\nOur patient presented with bilateral diffuse LSCD after chronic Dupilumab therapy for AD. Only one other report documents this rare adverse complication in a patient with a history of pellucid marginal degeneration who discontinued Dupilumab 12 weeks after initiating therapy due to the development of LSCD. Our patient was on Dupilumab therapy for 57 months before discontinuing, which could explain the severity of his ocular manifestations.\n\nDupilumab exerts its effects by binding to the IL-4 alpha subunit, preventing IL-4 and IL-13 signaling. In mice studies, IL-13 has been shown to stimulate conjunctival goblet cell production. Goblet cells regulate inflammation, stimulate mucin production, and maintain the overall health of the ocular surface epithelium.10 Therefore, blocking IL-13 signaling would theoretically lead to goblet cell hypoplasia, resulting in increased ocular inflammation, decreased mucin production, tear film instability, and mucosal epithelial barrier dysfunction.7,11 A recent study published by Bakker et al confirmed this finding in humans. In this study, conjunctival biopsies taken from patients who developed new or worsening conjunctivitis after treatment with Dupilumab for at least 16 weeks showed decreased intraepithelial mucus-containing goblet cells compared to the control group.11 A separate study published by Barnett and Afshari (2020) evaluated mucin 5ac (Muc5AC), a specific marker of goblet cells, in patients treated with Dupilumab. Compared with the control group, patients taking Dupilumab showed decreased mucin production and decreased or absent goblet cells on conjunctival biopsies. Subjects reported a significantly increased occurrence of ocular fatigue, pain, redness, and pruritus and were diagnosed with varying degrees of conjunctivitis, keratitis, and blepharitis.7\n\nIn addition to goblet cell loss, Dupilumab associated conjunctivitis has been hypothesized to be due to heightened OX40 ligand activity from IL-4 and IL-13 signaling inhibition, eosinophilia, and increased Demodex infestation due to changes in the ocular surface environment.6–8,12 Ocular surface inflammation has been shown to develop 1 to 8 months after initiating Dupilumab therapy, with an average onset of 3.5 months.9 A prior study showed that those who developed mild conjunctivitis were adequately treated with warm compresses and preservative free artificial tears. Those who developed severe follicular conjunctivitis often had a history of allergic conjunctivitis that was either triggered or worsened by Dupilumab treatment.9 Blepharitis, conjunctival hyperemia, and limbitis often developed in these patients, which resolved with either steroid treatment or discontinuation of Dupilumab.9 Steroid treatment5 using either prednisolone 0.5%, fluorometholone 0.1%, or dexamethasone 0.1% and cyclosporine 0.05% has been the mainstay of therapy.6 Cyclosporine is a calcineurin inhibitor that has the potential to increase goblet cell numbers by inhibiting T-cell mediated immune responses.6\n\nRecent studies demonstrated a subset of patients with severe conjunctivitis12 and limbitis5 that did not improve with anti-inflammatory treatment. Severe chronic inflammation can stress limbal stem cells, leading to LSCD. It is reasonable to have patients see their eye care provider before initiating treatment since a large percentage of patients with AD considering Dupilumab treatment have undiagnosed ocular surface inflammation.6 Ocular surface disease can therefore be treated aggressively before initiation of Dupilumab. These patients should also have regular follow-ups with their eye care provider especially if they begin noticing new onset or worsening vision, ocular pain, redness, burning, and dryness to prevent long-term irreversible complications from the medication.\n\nRisk factors for developing Dupilumab-induced ocular surface disease include severe AD at baseline and a prior history of conjunctivitis.6,8,12 At baseline, our patient was reported to have severe AD. He noticed ocular irritation and discomfort 12 months after starting therapy. In addition to developing chronic blepharoconjunctivitis, he developed diffuse cicatrizing conjunctival disease that led to extensive symblepharon and forniceal shortening, indicative of severe goblet cell loss. He also developed severe chronic ocular surface and periocular inflammation, leading to limbal architecture loss, poor corneal epithelial cell health with whorled keratopathy, and subepithelial haze, consistent with limbal stem cell burnout and LSCD. His symptoms did improve after discontinuing the medication. However, the long-term effects from limbal stem cell deficiency and cicatrizing symblepharon are irreversible sequelae that need life-long management and care.\n\nConclusion\n\nDupilumab can cause adverse ocular complications ranging from conjunctivitis to LSCD. As a result, patients should be monitored routinely before irreversible damage occurs.\n\nPatient Consent\n\nConsent to publish this case report has been obtained from the patient(s) in writing.\n\nInstitutional approval was not required to publish the case details.\n\nDisclosure\n\nThe authors have no financial or other conflicts of interest.\n==== Refs\nReferences\n\n1. Ivert LU, Wahlgren C, Ivert L, et al. Eye complications during dupilumab treatment for severe atopic dermatitis. Acta Derm Venereol. 2019;99 (4 ):375–378. doi:10.2340/00015555-3121 30653240\n2. Albader SS, Alharbi AA, Alenezi RF, et al. Dupilumab side effect in a patient with atopic dermatitis: a Case Report Study. Biologics. 2019;13 :79–82. doi:10.2147/BTT.S195512 31190731\n3. Ariens LFM, Schaft J, Bakker DS, et al. Dupilumab is very effective in a large cohort of difficult-to-treat adult atopic dermatitis patients: first clinical and biomarker results from the BioDay registry. Allergy. 2020;75 (1 ):116–126. doi:10.1111/all.14080 31593343\n4. Fukuda K, Ishida W, Kishimoto T, et al. Development of conjunctivitis with a conjunctival proliferative lesion in a patient treated with dupilumab for atopic dermatitis. Allergol Int. 2019;68 (3 ):383–384. doi:10.1016/j.alit.2018.12.012 30718036\n5. Achten R, Bakker D, Ariens L, et al. Long-term follow-up and treatment outcomes of conjunctivitis during dupilumab treatment in patients with moderate-to-severe atopic dermatitis. J Allergy Clin Immunol Pract. 2021;9 (3 ):1389–1392.e2. doi:10.1016/j.jaip.2020.09.042 33038589\n6. Popiela MZ, Barbara R, Turnbull AMJ, et al. Dupilumab-associated ocular surface disease: presentation, management and long-term sequelae. Eye. 2021. doi:10.1038/s41433-020-01379-9\n7. Barnett BP, Afshari NA. Dupilumab-associated mucin deficiency (DAMD). Transl Vis Sci Technol. 2020;9 (3 ):29. doi:10.1167/tvst.9.3.29\n8. Nahum Y, Mimouni M, Livny E, et al. Dupilumab-induced ocular surface disease (DIOSD) in patients with atopic dermatitis: clinical presentation, risk factors for development and outcomes of treatment with tacrolimus ointment. Br J Ophthalmol. 2019;104 (6 ):776–779. doi:10.1136/bjophthalmol-2019-315010 31554632\n9. Maudinet A, Law-Koune S, Duretz C, et al. Ocular surface diseases induced by dupilumab in severe atopic dermatitis. Ophthalmol Ther. 2019;8 (3 ):485–490. doi:10.1007/s40123-019-0191-9 31230264\n10. Tukler Henriksson J, Coursey TG, Corry DB, et al. IL-13 stimulates proliferation and expression of mucin and immunomodulatory genes in cultured conjunctival goblet cells. Invest Ophthalmol Vis Sci. 2015;56 (8 ):4186–4197. doi:10.1167/iovs.14-15496 26132778\n11. Bakker DS, Ariens LFM, Luijk C, et al. Goblet cell scarcity and conjunctival inflammation during treatment with dupilumab in patients with atopic dermatitis. Br J Dermatol. 2019;180 (5 ):1248–1249. doi:10.1111/bjd.17538 30597515\n12. Treister AD, Kraff-Cooper C, Lio PA. Risk factors for dupilumab-associated conjunctivitis in patients with atopic dermatitis. JAMA Dermatol. 2018;154 (10 ):1208–1211. doi:10.1001/jamadermatol.2018.2690 30167653\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1179-142X",
"issue": "14()",
"journal": "International medical case reports journal",
"keywords": "Dupilumab; cicatrizing blepharoconjunctivitis; dupixent; limbal stem cell disease; symblepharon",
"medline_ta": "Int Med Case Rep J",
"mesh_terms": null,
"nlm_unique_id": "101566269",
"other_id": null,
"pages": "275-278",
"pmc": null,
"pmid": "33981166",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "30653240;30718036;33038589;26132778;31593343;32742759;31230264;30167653;33504973;31554632;31190731;30597515",
"title": "Dupilumab Induced Limbal Stem Cell Deficiency.",
"title_normalized": "dupilumab induced limbal stem cell deficiency"
} | [
{
"companynumb": "US-SA-2021SA165315",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DUPILUMAB"
},
"drugadditional": "1",
"drug... |
{
"abstract": "The most common sites of invasive breast cancer metastasis are the lungs, liver, bones and brain. Less frequent sites include the gastrointestinal tract, pancreas, spleen, thyroid, adrenals, kidneys, heart and female genital tract. The uterus is reported as a rare site for metastasis, and even more so for an isolated metastasis. Other sites of extra-genital sources for uterine metastases include the colon, stomach, pancreas, gallbladder, lung, cutaneous melanoma, urinary bladder and thyroid. The rarity of breast cancer metastasis to the uterine cervix could be explained by the fact that the cervix has a small blood supply and an afferent lymph drainage system alone. It is rare to diagnose a cervical metastasis prior to eliciting the primary breast disease. Invasive lobular carcinoma metastasises to the female reproductive system more frequently than invasive ductal carcinoma. This paper presents a case of breast cancer metastasis to the cervix.",
"affiliations": null,
"authors": "Abdalla|A Saad|AS|;Lazarevska|Anita|A|;Omer|Mohammed Murwan|MM|;Tan|Elizabeth|E|;Asaad|Amira|A|;Sathananthan|Sharlini|S|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "Romania",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1221-9118",
"issue": "113(4)",
"journal": "Chirurgia (Bucharest, Romania : 1990)",
"keywords": "Cytokeratin7; breastadenocarcinoma; cervicalcancer",
"medline_ta": "Chirurgia (Bucur)",
"mesh_terms": "D000970:Antineoplastic Agents; D001943:Breast Neoplasms; D005260:Female; D006801:Humans; D002583:Uterine Cervical Neoplasms; D014592:Uterine Hemorrhage",
"nlm_unique_id": "9213031",
"other_id": null,
"pages": "564-570",
"pmc": null,
"pmid": "30183588",
"pubdate": "2018",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Metastatic Breast Cancer to the Cervix Presenting with Abnormal Vaginal Bleeding During Chemotherapy: A Case Report and Literature Review.",
"title_normalized": "metastatic breast cancer to the cervix presenting with abnormal vaginal bleeding during chemotherapy a case report and literature review"
} | [
{
"companynumb": "GB-BAYER-2018-175153",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LEVONORGESTREL"
},
"drugadditional": null,
... |
{
"abstract": "We report the case of a 15-year-old girl with a large gluteal and perineal rhabdomyosarcoma diagnosed at 24 weeks of pregnancy, whose management posed a great clinical dilemma for us. The patient refused to consider a therapeutic abortion, so we opted for a customized treatment with mild doses of chemotherapy administered weekly to control tumor growth while minimizing fetal and perinatal complications. After the delivery of a healthy female, we adopted a more intensive chemotherapy regimen plus irradiation. Despite an initially good response, the disease unfortunately progressed and the patient died of her disease.",
"affiliations": "Pediatric Oncology Unit, Fondazione IRCCS Istituto Nazionale Tumori, Milan, Italy. cristina.meazza@istitutotumori.mi.it",
"authors": "Meazza|Cristina|C|;Casanova|Michela|M|;Zaffignani|Elena|E|;Clerici|Carlo Alfredo|CA|;Favini|Francesca|F|;Vasquez|Roberto|R|;Ferrari|Andrea|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-8916",
"issue": "94(3)",
"journal": "Tumori",
"keywords": null,
"medline_ta": "Tumori",
"mesh_terms": "D000293:Adolescent; D000971:Antineoplastic Combined Chemotherapy Protocols; D002081:Buttocks; D017024:Chemotherapy, Adjuvant; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D008207:Lymphatic Metastasis; D010502:Perineum; D011247:Pregnancy; D011252:Pregnancy Complications, Neoplastic; D018714:Radiotherapy, Adjuvant; D012208:Rhabdomyosarcoma",
"nlm_unique_id": "0111356",
"other_id": null,
"pages": "431-3",
"pmc": null,
"pmid": "18705416",
"pubdate": "2008",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "An adolescent with rhabdomyosarcoma during pregnancy.",
"title_normalized": "an adolescent with rhabdomyosarcoma during pregnancy"
} | [
{
"companynumb": "IT-RECORDATI RARE DISEASES-IT-R13005-16-00175",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "DACTINOMYCIN"
},
"drugad... |
{
"abstract": "BACKGROUND\nStill's disease is a rare systemic inflammatory disease with frequent but generally mild liver involvement. The most common cause of acute liver failure in western countries is drug-induced liver injury, while it has rarely been reported in subjects suffering from Still's disease.\n\n\nMETHODS\nWe report a case of a young woman presenting with SD reactivation in pregnancy and acute liver failure after delivery with a possible triggering role of drug induced liver injury.\n\n\nCONCLUSIONS\nThe prompt recognition of Still's disease reactivation allowed early introduction of steroid therapy and resolution of the clinical picture. We discuss potential factors precipitating ALF in this case, and implications for the diagnosis and management of such patients.",
"affiliations": "Transplant Hepatology Unit - CEMAD Digestive Disease Center, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Largo A. Gemelli 8, 00168, Rome, Italy. giuseppe.marrone@policlinicogemelli.it.;Transplant Hepatology Unit - CEMAD Digestive Disease Center, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Largo A. Gemelli 8, 00168, Rome, Italy.;Transplant Hepatology Unit - CEMAD Digestive Disease Center, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Largo A. Gemelli 8, 00168, Rome, Italy.;FY2 Intensive Care Medicine, Epsom & St Helier University Hospitals NHS Trust, Epsom, UK.;Obstetrics and Obstetric Pathology Unit, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Rome, Italy.;Osteo-articular Disease Unit, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Rome, Italy.;Transplant Hepatology Unit - CEMAD Digestive Disease Center, Fondazione Policlinico Universitario \"A. Gemelli\" IRCCS, Università Cattolica del Sacro Cuore, Largo A. Gemelli 8, 00168, Rome, Italy.",
"authors": "Marrone|Giuseppe|G|http://orcid.org/0000-0002-9475-3948;Galati|Francesco|F|;Biolato|Marco|M|;Oddy|Christopher|C|;De Carolis|Sara|S|;Zoli|Angelo|A|;Grieco|Antonio|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12876-021-01878-3",
"fulltext": "\n==== Front\nBMC Gastroenterol\nBMC Gastroenterol\nBMC Gastroenterology\n1471-230X\nBioMed Central London\n\n1878\n10.1186/s12876-021-01878-3\nCase Report\nAcute liver failure in Still’s disease relapse during pregnancy: case report and discussion of a possible trigger role of DILI\nhttp://orcid.org/0000-0002-9475-3948\nMarrone Giuseppe giuseppe.marrone@policlinicogemelli.it\n\n1\nGalati Francesco 1\nBiolato Marco 1\nOddy Cristopher 2\nDe Carolis Sara 3\nZoli Angelo 4\nGrieco Antonio 1\n1 grid.8142.f 0000 0001 0941 3192 Transplant Hepatology Unit - CEMAD Digestive Disease Center, Fondazione Policlinico Universitario “A. Gemelli” IRCCS, Università Cattolica del Sacro Cuore, Largo A. Gemelli 8, 00168 Rome, Italy\n2 grid.419496.7 FY2 Intensive Care Medicine, Epsom & St Helier University Hospitals NHS Trust, Epsom, UK\n3 grid.8142.f 0000 0001 0941 3192 Obstetrics and Obstetric Pathology Unit, Fondazione Policlinico Universitario “A. Gemelli” IRCCS, Università Cattolica del Sacro Cuore, Rome, Italy\n4 grid.8142.f 0000 0001 0941 3192 Osteo-articular Disease Unit, Fondazione Policlinico Universitario “A. Gemelli” IRCCS, Università Cattolica del Sacro Cuore, Rome, Italy\n6 8 2021\n6 8 2021\n2021\n21 31730 3 2021\n6 7 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nStill's disease is a rare systemic inflammatory disease with frequent but generally mild liver involvement. The most common cause of acute liver failure in western countries is drug-induced liver injury, while it has rarely been reported in subjects suffering from Still’s disease.\n\nCase presentation\n\nWe report a case of a young woman presenting with SD reactivation in pregnancy and acute liver failure after delivery with a possible triggering role of drug induced liver injury.\n\nConclusions\n\nThe prompt recognition of Still's disease reactivation allowed early introduction of steroid therapy and resolution of the clinical picture. We discuss potential factors precipitating ALF in this case, and implications for the diagnosis and management of such patients.\n\nKeywords\n\nAcute onset Still’s disease\nAcute liver failure\nDrug induced liver failure\nALF case report\nissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\n\nAcute Liver Failure (ALF) refers to a specific syndrome characterized by abnormal liver function tests, coagulopathy and altered level of consciousness due to hepatic encephalopathy (HE) in a patient with recent onset liver damage (< 26 weeks) [1]. ALF has numerous potential causes, among which the most frequent are: acute viral and alcoholic hepatitis, drug induced liver injury (DILI), cryptogenic liver failure, hepatic vascular disease (including Budd-Chiari syndrome), Wilson’s disease and pregnancy associated acute liver disease (PAALD) [2, 3]. ALF may also develop as a result of acute presentation of autoimmune liver disease, rarely in cases of Systemic-Onset Juvenile Idiopathic Arthritis (SOJIA) [4, 5].\n\nSOJIA is a systemic inflammatory disorder characterized by fever and arthritis, accompanied by at least one of the following: rash, generalized lymphadenopathy, hepatomegaly ± splenomegaly, and serositis (Table 1). However, the classic features are not always present at disease onset [6]. Contemporary opinion considers SOJIA and Adult-Onset Still’s Disease (AOSD) as a disease continuum with different ages of onset (before or after 16 years of age), but with the same main characteristics and extremely similar gene-expression, clinical course, prognosis, and responsiveness to therapy [7–11].Table 1 Yamaguchi criteria for diagnosis of adult-onset Still’s disease\n\nYamaguchi criteria\t\nMajor criteria\t\n Fever of at least 39 °C for at least a week\t√\t\n Arthralgia or arthritis for at least 2 weeks\t√\t\n Non-pruritic salmon colored rash on trunk/extremities\t√\t\n Granulocytic leukocytosis (10,000/µL or greater)\t√\t\nMinor criteria\t\n Sore throat\t\n Lymphadenopathy\t\n Hepatomegaly or splenomegaly\t\t\n Abnormal liver function tests\t√\t\n Negative tests for RF and ANA\t√\t\nThe diagnosis requires at least 5 features, two of which being major diagnostic criteria. √ indicates the criteria met in the presented case\n\nIn some published series, a higher frequency of liver damage has been reported in the adult form [12].\n\nWe present a case of ALF during pregnancy in a young woman with previous history of SOJIA with a potential concomitant DILI which may have acted as a trigger for severe SD reactivation.\n\nCase presentation\n\nA 20-year-old woman, with previous history of SOJIA, was referred to our Centre in January 2019 for management of ALF that developed following a preterm delivery. SOJIA was diagnosed when she was three years old after which she experienced several remissions and exacerbations—characterized by arthralgias, fevers and rashes—until the age of 14. Subsequently, she started anakinra therapy achieving stable remission of the disease, with treatment discontinuation at the age of 16. She had her first pregnancy at the age of 18, with term delivery and no obstetric complications or disease exacerbations.\n\nDuring the fourth month of her second pregnancy, because of the development of widespread arthralgias and fevers (up to 40 °C), steroids were prescribed (prednisone 15 mg/day, later tapered to 7.5 mg/day). Following initiation of steroids there was resolution of her fevers but little improvement in her joint pain. This prompted self-administration of high dose acetaminophen (5–6 g/day) for at least 45 days.\n\nAt 22-weeks gestation, subcutaneous certolizumab pegol (twice monthly) was added with clinical improvement in her symptoms and reduction of acetaminophen dosage to 1–2 g/day. Blood tests revealed normal transaminases and bilirubin levels. INR value was not assessed at this point, but it was normal in the early gestation.\n\nAt 28-weeks gestation, she was hospitalized because of development of jaundice. Blood tests revealed raised transaminases (AST 1499 IU/L, ALT to 1085 IU/L), hyperbilirubinemia (total bilirubin 7.3 mg/dl, unconjugated bilirubin 6.9 mg/dl) and coagulopathy (INR 1.68) (Fig. 1). In addition to prednisone, treatment with glutathione, ursodexoxycholic acid and N-acetylcysteine was started. There was improvement of transaminases (AST 555 IU/L. ALT 554 IU/L), slight reduction of bilirubin levels (5.8 mg/dl) but worsening of coagulopathy (INR 2.3, coagulative factor V 59%). Ammonia levels were still within the normal range (Fig. 1).Fig. 1 Trends of blood chemistry during hospital stay and in relation to relevant clinical events and treatments. Abbreviations: MP methylprednisolone, HE hepatic encephalopathy according to West Haven criteria, HE I WE Grade I Hepatic Encephalopathy according to West Haven criteria, ICU intensive care unit\n\n7 days after hospitalization, at 29 weeks gestation, she gave birth spontaneously by vaginal delivery to a male child weighing 1180 g. Soon after delivery she developed fever and a facial rash. At this point she was transferred to our hospital with the suspicion of an evolution towards ALF. On admission the patient was alert and febrile (> 39 °C), with no neurological impairment. A salmon coloured maculo-papular skin rash involving the trunk, back and neck was present. She complained about widespread arthralgias.\n\nLaboratory work-up demonstrated reduction of transaminases (AST 170 IU/L, ALT 248 IU/L), worsening of hyperbilirubinemia (total bilirubin 15.2 mg/dl), stable coagulopathy (INR 2.3), mild hyperferritinemia (327 ng/ml) and increase in white blood cell count (21.5/mm3) with neutrophils 86.7% and absence of ANA, ASMA, AMA, anti-LKM, anti-dsDNA, and ANCA serum antibodies (Table 1). Abdominal CT was also normal. Within the first 48 h of admission at our centre the patient remained stable with no clinical signs of HE, falling transaminases and stable bilirubin levels.\n\nGiven her history of SOJIA, and both clinical and laboratory findings suggesting a SD reactivation (Table 1), methylprednisolone therapy was initiated at 20 mg TID with remission of fever but persistence of her rash. After three days, laboratory tests showed an increasing INR (2.9). Coagulation factor V was 44.5%, bilirubin levels were stable (15 mg/dl) and transaminases were decreasing (ALT 190 IU/L), but venous ammonia levels were increasing (190 ug/dl) (Fig. 1). A progressive worsening in neurological function occurred with psychomotor agitation, confusion and inappropriate speech attributed to a grade III hepatic encephalopathy (HE) [13]. A cerebral CT scan was performed and was broadly unremarkable. EEG showed signs of global encephalopathy.\n\nThe daily dosage of methylprednisolone was further increased (500 mg QD), antibiotic therapy with meropenem was started and the patient was moved to ICU. Her neurological condition worsened to grade IV HE, without the need for mechanical ventilation. During her ICU stay the patient did not meet the King's College Criteria for emergency liver transplant [13, 14]. High dose corticosteroid therapy was continued for three days and subsequently tapered following progressive spontaneous recovery of her neurological condition and laboratory data. Antibiotic therapy was stopped after neurological improvement. The patient was moved to a regular ward after six days.\n\nAfter resolution of coagulation parameters, a percutaneous liver biopsy was performed. Liver histology revealed severe necro-inflammatory activity with large areas of confluent hepatocytic necrosis and cholestatic/cholangitic aspects and mild fibrosis. A marked Kupffer cell activation was also observed without plasma cell infiltrate. An eosinophilic portal infiltrate was also present. The fibrosis was scored as mild-to moderate. Perls staining for hemosiderin was negative (Fig. 2). In the following days, the patient progressively improved and was discharged on the 20th day (Fig. 1). The patient started an outpatient follow-up program on low dose oral steroids. A transient relapse with a contemporaneous increase in transaminases and back rash was effectively treated with increase in steroid dosage. The patient continued low dose steroid therapy with clinical benefit and was subsequently lost to follow-up after six months.Fig. 2 ×20 Liver histology image. Liver sample was obtained at the normalization of coagulation parameters. 1—confluent hepatocyte necrosis; 2—cholestasis with ductular reaction; 3—eosinophilic granulocyte infiltrate. Masson's trichrome staining documented the presence of mild to moderate fibrosis. Immunohistochemistry showed marked activation of Kupffer cells but without plasma cell infiltrate (image not shown)\n\nDiscussion and conclusions\n\nA peculiar case of ALF with associated SD relapse after delivery, with a possible component of DILI, is reported.\n\nAt presentation, PAALD (hyperemesis gravidarum, intrahepatic cholestasis of pregnancy, HELLP syndrome) was considered but was ruled out during the initial clinical assessment. Acute fatty liver of pregnancy (AFLP) was later excluded due to the complete absence of steatosis at liver biopsy.\n\nThe relationship between SD and pregnancy has been insufficiently examined, and much of the data is conflicting. Recently, a review by De Carolis et al. [15] clarified that an increase in relapses can occur in the first and second trimester of pregnancy with an increased risk of obstetric complications, such as preterm delivery, intrauterine growth restriction and neonatal hemophagocytic lymphohistyocytosis, while other reports in women with a previous diagnosis of SOJIA reported a relatively stable disease activity during pregnancy with postpartum exacerbation [16].\n\nThe reported history of long-term (approximately 45 days) consumption of high daily dose of acetaminophen (4–6 g/day) during pregnancy was considered among the cause of ALF. Most of the acetaminophen overdoses in pregnancy described in the literature are of single episodes of consumption, it is quite rare to find a staggered overdose [17]. Single episode acetaminophen overdose occurs when a single supratherapeutic dose of paracetamol (> 4 g) is taken [18]. A staggered overdose, as in our case, is the ingestion of two or more supratherapeutic doses over a time interval longer than 8 h [19, 20]. In this case the Roussel Uclaf Causality Assessment Method (RUCAM) calculated for acetaminophen toxicity gave a score of 5, classifying DILI as a “possible” aetiology. It is, however, worth noting that symptoms appeared when drug dosage had already been reduced. Moreover, a few weeks before the development of acute liver injury (ALI) the patient was started certolizumab pegol, with reduction of daily paracetamol amount. Certolizumab, therefore, may also be implicated.\n\nCertolizumab is a monoclonal anti-TNFα antibody. This class of drugs is known to cause DILI or drug induced autoimmune hepatitis (DIAIH) [21–24]. In our case DIAIH is unlikely based on liver histology and the negativity of autoantibodies [25]. Anti-TNFα-induced ALF is a rare occurrence and has been reported for infliximab, and less frequently, for adalimumab [22–29] while only one case of DILI by certolizumab has been described in the literature, but no case of ALF [30]. The RUCAM calculated for certolizumab is 6, placing a diagnosis of DILI by certolizumab as \"probable\". Although certolizumab may have contributed to liver injury, the presence of symptoms of SD reactivation at the time of clinical worsening and improvement after high dosage steroids treatment make us consider SD reactivation as the principal cause of ALF.\n\nA further hypothesis we considered is whether DILI may have caused the reactivation of SD. Recent evidence has highlighted the role of the immune system in idiosyncratic DILI [31–33] and it would therefore be plausible to speculate a role of DILI in SD reactivation, even if this is not described in the literature so far. Considering the two involved drugs, certolizumab was certainly administered at non-toxic doses and the temporal latency of liver injury may be possibly compatible with an idiosyncratic DILI. However, although expected, no drug-induced hepatic autoimmune manifestations were observed in liver histology. In our case, pregnancy can certainly be considered the most important triggering factor of SD reactivation, which occurred prior to the administration of the two drugs. Onset and reactivation of SD during pregnancy have been described in various reports, with different courses and different rates of obstetric complications [15]. In our patient, after long a period of clinical remission without the need of pharmacological treatment, a reactivation of the disease occurred during the second trimester. Data regarding SD and pregnancy are conflicting in the literature and it is difficult to compare the course of the disease in subjects in clinical remission during medical treatment and untreated subjects, as in our patient [16, 34, 35]. Although pregnancy may have caused the initial reactivation of the disease in the 2nd trimester, other factors came into play determining the clinical picture of ALF. Considering the time course of the disease, we must note that ALI was improving at the time of SD exacerbation during delivery. It is well known that transaminases reduction during ALI is not always a good news, as it may correspond to an exhaustion of the hepatic functional mass [36], but, in our case, the rapid subsequent functional recovery runs counter to such an interpretation. We can therefore speculate that DILI caused ALI and, in a clinical context of impaired immunity, DILI itself exacerbated SD which acted as a “second hit” on liver function, precipitating the picture towards a frank ALF. Moreover, the peculiar immunological peri-partum condition could have influenced the clinical course of the disease. SD exacerbation occurred during delivery and progression to ALF in the following days, when the pregnancy-related immunological deviation stopped, and post-partum immune rebound was starting. Our patient may therefore have faced a multifactorial immunological storm condition, causing an extremely severe SD reactivation. In most of the reported cases of ALF in SD, a macrophage activation syndrome (MAS) was observed [37]. In our case MAS criteria were not satisfied [38] but the synergic combination of still-related liver damage superimposed on DILI resulted in ALF.\n\nSkin lesions are also described during DILI with immune-allergic mechanism, but in our case, the absence of eosinophilia or other allergic manifestations, such as itching, angioedema or wheeze, and the typical aspect of the rash (salmon coloured, maculo-papular, non-pruritic), consistent with SD, makes the rheumatological nature of the lesions more likely.\n\nHepatic involvement in the course of SD is frequent and it is among Yamaguchi's minor criteria for the diagnosis of SD [39], but usually presents as only a mild increase in transaminases [40]. The occurrence of ALF is a very rare occurrence and few cases have been reported in the literature [41–46], with 7 of them (46.7%) [41–47] requiring liver transplantation (LT).\n\nThe value of liver biopsy in the diagnosis of SD remains a topic for debate [48] as highly variable histological features have been described. The most common histological finding is Kupffer cell hyperplasia accompanied by periportal inflammatory infiltrates, but the presence of portal fibrosis, hepatocytic necrosis and peliosis has also been described [5, 49, 50]. Considering the results of liver biopsy in our patient, whilst a non-specific pattern was found, it was considered not incompatible with a diagnosis of a SD-induced acute liver damage. The observed histological picture could be also attributable to DILI which, as discussed above, may have played a role in the reactivation and worsening of SD-induced liver damage. The described histological picture is not exclusive of either SD or DILI therefore, this data alone does not allow to attribute the observed damage to one of the two conditions. The execution of liver biopsy instead allowed to rule out some conditions which come in differential diagnosis in the described case, as AFLP and Autoimmune Hepatitis (AIH). Notably, liver biopsy was performed several days after the critical phase of the disease, following administration of high dose steroids, and thus we observed a histological picture that might have been influenced by this treatment.\n\nReactivation of SD during pregnancy is a crucial clinical condition that should always be kept in mind in the presence of a history of known SOJIA. Liver injury is frequent during SD reactivation and it can occasionally evolve to ALF. The use of drugs with potential hepatotoxic effect in the treatment of SD reactivation can make it difficult to determine the cause of liver injury. In the case of SD-induced liver injury, prompt diagnosis and administration of high dose steroids is essential to alter the clinical course of the disease, avoiding the need of an emergency LT.\n\nAbbreviations\n\nAFLP Acute fatty liver of pregnancy\n\nAIH Autoimmune hepatitis\n\nALF Acute liver failure\n\nALI Acute liver injury\n\nAOSD Adult-onset Still’s disease\n\nDIAIH Drug induced autoimmune hepatitis\n\nDILI Drug induced liver injury\n\nHE Hepatic encephalopathy\n\nLT Liver transplantation\n\nMAS Macrophage activation syndrome\n\nPAALD Pregnancy associated acute liver disease\n\nRUCAM Roussel Uclaf Causality Assessment Method\n\nSOJIA Systemic-Onset Juvenile Idiopathic Arthritis\n\nAcknowledgements\n\nNot applicable.\n\nAuthors' contributions\n\nFG and GM collected the patient's clinical data and performed the initial draft of the paper; MB contributed to data collection, CO performed language editing and a critical review of the paper, he was a major contributor of the discussion section; SDC analysed and interpreted the patient data regarding obstetric aspects; AZ analysed rheumatological aspects of the case; AG, AZ and SDC performed a global revision of the paper. All authors read and approved the final manuscript.\n\nFunding\n\nNot applicable.\n\nAvailability of data and materials\n\nData sharing is not applicable to this article as no datasets were generated or analysed during the current study.\n\nDeclarations\n\nEthics approval and consent to participate\n\nNot applicable.\n\nConsent for publication\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nPublisher's note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Association E EASL Clinical Practical Guidelines on the management of acute (fulminant) liver failure J Hepatol 2017 66 1047 1081 10.1016/j.jhep.2016.12.003 28417882\n2. Bernal W Auzinger G Dhawan A Wendon J Acute liver failure Lancet 2010 376 190 201 10.1016/S0140-6736(10)60274-7 20638564\n3. Chalasani N Fontana RJ Bonkovsky HL Watkins PB Davern T Serrano J Yang H Rochon J Causes, clinical features, and outcomes from a prospective study of drug-induced liver injury in the United States Gastroenterology 2008 10.1053/j.gastro.2008.09.011 18955056\n4. Ferro F Cioffi E Elefante E AB0925 liver involvement in adult onset Still’s disease: retrospective analysis of 18 cases Ann Rheum Dis 2014 73 11062 1106 10.1136/annrheumdis-2014-eular.4541\n5. Lim KBL Schiano TD Still disease and the liver-an underappreciated association Gastroenterol Hepatol N Y 2011 7 844 846 22347828\n6. Lee JJY Schneider R Systemic Juvenile Idiopathic Arthritis Pediatr Clin N Am 2018 65 691 709 10.1016/j.pcl.2018.04.005\n7. Cabane J Michon A Ziza JM Bourgeois P Blétry O Godeau P Kahn MF Comparison of long term evolution of adult onset and juvenile onset Still’s disease, both followed up for more than 10 years Ann Rheum Dis 1990 49 283 285 10.1136/ard.49.5.283 2344206\n8. Jamilloux Y Gerfaud-Valentin M Martinon F Belot A Henry T Sève P Pathogenesis of adult-onset Still’s disease: new insights from the juvenile counterpart Immunol Res 2014 61 53 62 10.1007/s12026-014-8561-9\n9. Nirmala N Brachat A Feist E Blank N Specker C Witt M Zernicke J Martini A Junge G Gene-expression analysis of adult-onset Still’s disease and systemic juvenile idiopathic arthritis is consistent with a continuum of a single disease entity Pediatr Rheumatol 2015 13 50 10.1186/s12969-015-0047-3\n10. Feist E Mitrovic S Fautrel B Mechanisms, biomarkers and targets for adult-onset Still’s disease Nat Rev Rheumatol 2018 14 603 618 10.1038/s41584-018-0081-x 30218025\n11. Luthi F Zufferey P Hofer MF So AK “Adolescent-onset Still’s disease”: characteristics and outcome in comparison with adult-onset Still’s disease Clin Exp Rheumatol 2002 20 427 430 12102485\n12. Nuran SP Mukaddes T İsmail K A multicenter study of patients with adult-onset Still’s disease compared with systemic juvenile idiopathic arthritis Clin Rheumatol 2006 25 639 644 10.1007/s10067-005-0138-5 16365690\n13. O’Grady J Alexander G Hayllar K Williams R Early indicators of prognosis in fulminant hepatic failure Gastroenterology 1989 97 439 445 10.1016/0016-5085(89)90081-4 2490426\n14. McPhail MJW Wendon JA Bernal W Meta-analysis of performance of Kings’s College Hospital Criteria in prediction of outcome in non-paracetamol-induced acute liver failure J Hepatol 2010 53 492 499 10.1016/j.jhep.2010.03.023 20580460\n15. De Carolis S Cianci F Del Sordo G Garofalo S Garufi C Lanzone A Zoli A Gremese E Adult onset Still’s disease and pregnancy Autoimmun Rev 2019 18 1 4 10.1016/j.autrev.2019.102356 30408580\n16. Ursin K Lydersen S Skomsvoll JF Wallenius M Disease activity of juvenile idiopathic arthritis during and after pregnancy: a prospective multicenter study J Rheumatol 2018 45 257 265 10.3899/jrheum.161410 29196380\n17. Thornton SL Minns AB Unintentional chronic acetaminophen poisoning during pregnancy resulting in liver transplantation J Med Toxicol 2012 8 176 178 10.1007/s13181-012-0218-2 22415886\n18. Zimmerman HJ Maddrey WC Acetaminophen (paracetamol) hepatotoxicity with regular intake of alcohol: analysis of instances of therapeutic misadventure Hepatology 1995 22 767 773 10.1002/hep.1840220312 7657281\n19. Craig DGN Bates CM Davidson JS Martin KG Hayes PC Simpson KJ Staggered overdose pattern and delay to hospital presentation are associated with adverse outcomes following paracetamol-induced hepatotoxicity Br J Clin Pharmacol 2012 73 285 294 10.1111/j.1365-2125.2011.04067.x 22106945\n20. Larson AM Polson J Fontana RJ Acetaminophen-induced acute liver failure: results of a United States multicenter, prospective study Hepatology 2005 42 1364 1372 10.1002/hep.20948 16317692\n21. Andrade RJ Aithal GP Björnsson ES Kaplowitz N Kullak-Ublick GA Larrey D Karlsen TH EASL Clinical Practice Guidelines: drug-induced liver injury J Hepatol 2019 70 1222 1261 10.1016/j.jhep.2019.02.014 30926241\n22. Ghabril M Bonkovsky HL Kum C Davern T Hayashi PH Kleiner DE Serrano J Rochon J Fontana RJ Bonacini M Liver injury from tumor necrosis factor-α antagonists: analysis of thirty-four cases Clin Gastroenterol Hepatol 2013 10.1016/j.cgh.2012.12.025 24362054\n23. Efe C Purnak T Ozaslan E Wahlin S Drug-induced autoimmune hepatitis caused by anti-tumor necrosis factor α agents Hepatology 2010 52 2246 2247 10.1002/hep.23834 20715094\n24. Lopetuso LR Mocci G Marzo M D’aversa F, Rapaccini GL, Guidi L, Armuzzi A, Gasbarrini A, Papa A, Harmful effects and potential benefits of anti-tumor necrosis factor (TNF)-α on the liver Int J Mol Sci 2018 19 1 22 10.3390/ijms19082199\n25. Mack CL Adams D Assis DN Kerkar N Manns MP Mayo MJ Vierling JM Alsawas M Murad MH Czaja AJ Diagnosis and management of autoimmune hepatitis in adults and children: 2019 practice guidance and guidelines from the American Association for the study of liver diseases Hepatology 2020 72 671 722 10.1002/hep.31065 31863477\n26. Tobon GJ Cañas C Jaller JJ Restrepo JC Anaya JM Serious liver disease induced by infliximab Clin Rheumatol 2007 26 578 581 10.1007/s10067-005-0169-y 16547695\n27. Hagel S Bruns T Theis B Herrmann A Stallmach A Subacute liver failure induced by adalimumab Int J Clin Pharmacol Ther 2011 49 38 40 10.5414/CPP49038 21176723\n28. Kinnunen U Färkkilä M Mäkisalo H A case report: Ulcerative colitis, treatment with an antibody against tumor necrosis factor (infliximab), and subsequent liver necrosis J Crohn’s Colitis 2012 6 724 727 10.1016/j.crohns.2012.02.004 22398069\n29. Kok B Lester ELW Lee WM Hanje AJ Stravitz RT Girgis S Patel V Peck JR Esber C Karvellas CJ Acute liver failure from tumor necrosis factor-α antagonists: report of four cases and literature review Dig Dis Sci 2018 63 1654 1666 10.1007/s10620-018-5023-6 29564668\n30. Ling C Gavin M Hanson J McCarthy DM Progressive epigastric pain with abnormal liver tests in a patient with Crohn’s disease: don’t DILI Dally Dig Dis Sci 2018 63 1751 1755 10.1007/s10620-018-5135-z 29934698\n31. Fontana RJ Pathogenesis of idiosyncratic drug-induced liver injury and clinical perspectives Gastroenterology 2014 146 914 928 10.1053/j.gastro.2013.12.032 24389305\n32. Kullak-Ublick GA Andrade RJ Merz M End P Benesic A Gerbes AL Aithal GP Drug-induced liver injury: recent advances in diagnosis and risk assessment Gut 2017 66 1154 1164 10.1136/gutjnl-2016-313369 28341748\n33. Yokoi T Oda S Models of idiosyncratic drug-induced liver injury Annu Rev Pharmacol Toxicol 2021 10.1146/annurev-pharmtox-030220-015007 32976738\n34. Gerfaud-Valentin M Hot A Huissoud C Durieu I Broussolle C Seve P Adult-onset Still’s disease and pregnancy: about ten cases and review of the literature Rheumatol Int 2014 34 867 871 10.1007/s00296-013-2765-5 23624554\n35. Remaeus K Johansson K Askling J Stephansson O Juvenile onset arthritis and pregnancy outcome: a population-based cohort study Ann Rheum Dis 2017 76 1809 1814 10.1136/annrheumdis-2016-210879 28663309\n36. EASL EASL Clinical Practical Guidelines on the management of acute (fulminant) liver failure J Hepatol 2017 66 1047 1081 10.1016/j.jhep.2016.12.003 28417882\n37. Ravelli A Grom AA Behrens EM Cron RQ Macrophage activation syndrome as part of systemic juvenile idiopathic arthritis: diagnosis, genetics, pathophysiology and treatment Genes Immun 2012 13 289 298 10.1038/gene.2012.3 22418018\n38. Ravelli A Minoia F Davì S 2016 Classification criteria for macrophage activation syndrome complicating systemic juvenile idiopathic arthritis: a European league against Rheumatism/American college of Rheumatology/Paediatric rheumatology international trials organisation collaborat Ann Rheum Dis 2016 75 481 489 10.1136/annrheumdis-2015-208982 26865703\n39. Yamaguchi M Ohta A Tsunematsu T Kasukawa R Mizushima Y Kashiwagi H Kashiwazaki S Tanimoto K Matsumoto Y Ota T Preliminary criteria for classification of adult Still’s disease J Rheumatol 1992 19 424 30 1578458\n40. Zhu G Liu G Liu Y Xie Q Shi G Liver abnormalities in adult onset still’s disease: a retrospective study of 77 chinese patients J Clin Rheumatol 2009 15 284 288 10.1097/RHU.0b013e3181b57199 19734733\n41. Terán Á Casafont F Fábrega E Martínez-Taboada VM Rodríguez-Valverde V Pons-Romero F Enfermedad de Still del adulto con desarrollo de insuficiencia hepática que precisa trasplante hepático Gastroenterol Hepatol 2009 32 681 686 10.1016/j.gastrohep.2009.06.009 19783075\n42. Dino O Provenzano G Giannuoli G Sciarrino E Pouyet M Pagliaro L Fulminant hepatic failure in adult onset Still’s disease J Rheumatol 1996 23 784 785 8730149\n43. Yamanaka J Saito S Kuroda N Hirano T Fujimoto J Successful living related liver transplantation for adult still’s disease [1] J Gastroenterol Hepatol 2003 18 1109 1110 10.1046/j.1440-1746.2003.03060.x 12911674\n44. Liese J Schreckenbach T Wahle M Welker MW Ulrich F Bechstein WO Moench C Seltene Ursache eines akuten Leberversagens Chirurg 2012 83 732 735 10.1007/s00104-012-2314-x 22733222\n45. Mcfarlane M Harth M Wall WJ Liver transplant in adult Still’s disease J Rheumatol 1997 24 2038 2041 9330951\n46. Taccone FS Lucidi V Donckier V Bourgeois N Decaux G Vandergheynst F Fulminant hepatitis requiring MARS and liver transplantation in a patient with Still’s disease Eur J Intern Med 2008 10.1016/j.ejim.2007.06.025 18848162\n47. Ogata A Kitano M Yamanaka J Yamasaki T Hashimoto N Iwasaki T Hamano T Fujimoto J Kakishita E Interleukin 18 and hepatocyte growth factor in fulminant hepatic failure of adult onset Still’s disease J Rheumatol 2003 30 1093 1096 12734913\n48. Andres E Liver biopsy is not useful in the diagnosis of adult Still’s disease Qjm 2001 94 568 569 10.1093/qjmed/94.10.568 11588218\n49. Valluru N Tammana VS Windham M Mekonen E Begum R Sanderson A Rare manifestation of a rare disease, acute liver failure in adult onset Still’s disease: dramatic response to methylprednisolone pulse therapy—a case report and review Case Rep Med 2014 10.1155/2014/375035 24991218\n50. Kim HA Kwon JE Yim H Suh CH Jung JY Han JH The pathologic findings of skin, lymph node, liver, and bone marrow in patients with adult-onset still disease Medicine 2015 94 e787 10.1097/MD.0000000000000787 25929927\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-230X",
"issue": "21(1)",
"journal": "BMC gastroenterology",
"keywords": "ALF case report; Acute liver failure; Acute onset Still’s disease; Drug induced liver failure",
"medline_ta": "BMC Gastroenterol",
"mesh_terms": "D002908:Chronic Disease; D005260:Female; D006801:Humans; D017114:Liver Failure, Acute; D011247:Pregnancy; D012008:Recurrence; D016706:Still's Disease, Adult-Onset",
"nlm_unique_id": "100968547",
"other_id": null,
"pages": "317",
"pmc": null,
"pmid": "34362307",
"pubdate": "2021-08-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "20638564;18955056;22347828;2344206;30218025;12102485;2490426;20580460;29196380;22415886;7657281;22106945;4065228;16547695;21176723;29564668;29934698;26865703;19734733;12734913;11588218;24991218;25929927",
"title": "Acute liver failure in Still's disease relapse during pregnancy: case report and discussion of a possible trigger role of DILI.",
"title_normalized": "acute liver failure in still s disease relapse during pregnancy case report and discussion of a possible trigger role of dili"
} | [
{
"companynumb": "IT-UCBSA-2021042827",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nWe herein present a case of venous thrombosis that developed more than 20 years after diagnosis of granulomatosis with polyangiitis (GPA), although many reports of GPA have described venous thrombosis within 1 year of diagnosis.\n\n\nMETHODS\nA 73-year-old man with GPA was admitted for lower extremity swelling and diagnosed with venous thrombosis and pulmonary embolism. On the second day, catheter-based thrombolysis was unsuccessful, and inferior vena cava filter insertion and anticoagulation were performed. On the third day, respiratory disturbance and loss of consciousness appeared and progressed. The patient died on the fifth day. The autopsy revealed a large thrombus in the inferior vena cava filter, and death of progressive venous thrombosis was suspected.\n\n\nCONCLUSIONS\nWe experienced a case of venous thrombosis that developed 20 years after diagnosis of GPA, although GPA is frequently associated with venous thrombosis immediately after diagnosis. The thrombosis progressed rapidly and was resistant to treatment.",
"affiliations": "Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan. ysyaoki27@gmail.com.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.;Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka, 431-3192, Japan.",
"authors": "Wakuda|Chiharu|C|;Aoki|Yoshitaka|Y|http://orcid.org/0000-0002-3750-4160;Sugimura|Sho|S|;Katsuragawa|Takayuki|T|;Obata|Yukako|Y|;Mimuro|Soichiro|S|;Doi|Matsuyuki|M|;Nakajima|Yoshiki|Y|",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1186/s40981-021-00478-0",
"fulltext": "\n==== Front\nJA Clin Rep\nJA Clin Rep\nJA Clinical Reports\n2363-9024\nSpringer Berlin Heidelberg Berlin/Heidelberg\n\n34599670\n478\n10.1186/s40981-021-00478-0\nCase Report\nTreatment-resistant venous thrombosis and pulmonary embolism in a patient with granulomatosis with polyangiitis: a case report\nWakuda Chiharu\nhttp://orcid.org/0000-0002-3750-4160\nAoki Yoshitaka ysyaoki27@gmail.com\n\nSugimura Sho\nKatsuragawa Takayuki\nObata Yukako\nMimuro Soichiro\nDoi Matsuyuki\nNakajima Yoshiki\ngrid.505613.4 Department of Anesthesiology and Intensive Care Medicine, Hamamatsu University School of Medicine, 1-20-1 Handayama, Higashi-Ku, Hamamatsu, Shizuoka 431-3192 Japan\n2 10 2021\n2 10 2021\n12 2021\n7 733 9 2021\n26 9 2021\n28 9 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.\nBackground\n\nWe herein present a case of venous thrombosis that developed more than 20 years after diagnosis of granulomatosis with polyangiitis (GPA), although many reports of GPA have described venous thrombosis within 1 year of diagnosis.\n\nCase presentation\n\nA 73-year-old man with GPA was admitted for lower extremity swelling and diagnosed with venous thrombosis and pulmonary embolism. On the second day, catheter-based thrombolysis was unsuccessful, and inferior vena cava filter insertion and anticoagulation were performed. On the third day, respiratory disturbance and loss of consciousness appeared and progressed. The patient died on the fifth day. The autopsy revealed a large thrombus in the inferior vena cava filter, and death of progressive venous thrombosis was suspected.\n\nConclusions\n\nWe experienced a case of venous thrombosis that developed 20 years after diagnosis of GPA, although GPA is frequently associated with venous thrombosis immediately after diagnosis. The thrombosis progressed rapidly and was resistant to treatment.\n\nKeywords\n\nGranulomatosis with polyangiitis\nVenous thrombosis\nPulmonary embolism\nVena cava filters\nCase report\nissue-copyright-statement© The Author(s) 2021\n==== Body\npmcBackground\n\nGranulomatosis with polyangiitis (GPA) is a type of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, previously known as Wegener’s granulomatosis. The incidence of venous thrombosis in patients with GPA is reportedly higher than that in the general population and in patients with systematic lupus erythematosus and rheumatoid arthritis [1]. Venous thrombosis associated with GPA is more common in the active phase, especially within the first year after the diagnosis of GPA [2]. However, few reports have described rapid progression of venous thrombosis as a late complication of GPA.\n\nWe herein describe a patient who developed pulmonary embolism from venous thrombosis more than 20 years after the diagnosis of GPA. Despite appropriate treatment in the intensive care unit, including endovascular and anticoagulation therapy, the patient’s symptoms progressed and he died 5 days after admission.\n\nCase presentation\n\nA 73-year-old man (body weight, 72.2 kg; height, 158 cm) had been diagnosed with GPA 20 years previously based on optic narrowing, upper respiratory symptoms, multiple nodules in the lungs, and positive proteinase 3 (PR3)-ANCA (41 U/mL) and was treated with prednisolone and methotrexate; he did not receive heparin therapy. His PR3-ANCA level was 48.9 U/mL 2 years before admission to our hospital, 53.6 U/mL 6 months before admission, and 83.8 U/mL immediately before admission; despite this increasing trend, however, he showed no subjective symptoms. Before admission, he was being treated with prednisolone (13 mg/day), methotrexate (8 mg/day), and azathioprine (25 mg/day). His medical history otherwise included coronary angina pectoris, hypertension, type 2 diabetes mellitus, Hashimoto’s disease, benign prostatic hyperplasia, thoracolumbar compression fracture associated with osteoporosis, and glaucoma.\n\nOn day 1, the patient was admitted to the hospital for right lower extremity pain. Physical examination revealed muscle weakness and edema in the right lower leg, resulting in emergency admission (Fig. 1a). Computed tomography showed a thrombus in the right common iliac vein (Fig. 2a) and a micro-thromboembolism in the right pulmonary artery within the right inferior lobe (Fig. 2b). His PR3-ANCA level was elevated before admission, but acute progression of GPA was not suspected based on his physical examination findings and computed tomography images. The patient was diagnosed with pulmonary embolism due to deep vein thrombosis and began oral treatment with rivaroxaban (30 mg/day). His creatine kinase level (26 U/L) and creatinine level (0.77 mg/dL) were not elevated. However, his soluble fibrin and D-dimer levels were elevated due to the venous thrombosis (Table 1).Fig. 1 Clinical appearance of the right lower leg. a Redness and edema were present on day 1. b The redness and edema worsened with blister formation on day 4\n\nFig. 2 Computed tomographic images. Computed tomography revealed a thrombosis in the common iliac vein, causing dilation and occlusion of the vein, and b micro-thromboembolism in the pulmonary artery within the right lower lobe\n\nTable 1 Changes in markers of coagulation and fibrinolysis\n\n\tEntering a hospital (Day 1)\tDay 2\tEntering the intensive care unit (Day 2)\tDay 3\tDay 4\tDay 5\t\nPlatelets (×10,000/μl)\t13.4\t14\t10.4\t8.3\t6.8\t4.8\t\nSoluble fibrin (μg/ml)\t61.1\t41.7\t20.1\t10.8\t16.6\t19.2\t\nD-dimer (μg/ml)\t14\t14.6\t5.8\t3.3\t2.6\t1.2\t\nProthrombin time (s)\t11.7\t20.5\t39.3\t51.4\t30.5\t23.8\t\nActivated partial thromboplastin time (s)\t23.9\t31.6\t50.7\t>200\t>200\t>200\t\nFibrinogen (mg/dl)\t311\t350\t265\t273\t398\t392\t\nAntithrombins (%)\t96\t-\t98\t91\t54\t61\t\nThrombin–antithrombin complex (ng/mL)\t23.6\t-\t-\t-\t-\t-\t\nPlasmin–α2-plasmin inhibitor complex (μg/mL)\t6.5\t-\t-\t-\t-\t-\t\nProtein S antigen level (%)\t100\t-\t-\t-\t-\t-\t\nProtein C antigen level (%)\t98\t-\t-\t-\t-\t-\t\n\nOn day 2, the patient’s leg pain and motor deficits worsened, and his creatine kinase level (435 U/L) and creatinine level (2.03 mg/dL) became elevated. Therefore, urgent inferior vena cava filter placement and catheter-based thrombolysis were performed. Interventional radiology techniques allowed an inferior vena cava filter to establish in the inferior renal vein approaching the right internal jugular vein. As the catheter for thrombolysis was about to be placed through the right lower extremity, pulseless ventricular tachycardia suddenly occurred, and cardiopulmonary resuscitation was performed. The patient’s heartbeat resumed, but the surgery was aborted and he was admitted to the intensive care unit on an emergency basis. Tracheal intubation was not performed at this time because his level of consciousness had improved entirely. The cause of the intraoperative ventricular tachycardia was hyperkalemia (6.3 mmol/L) with myonephropathic metabolic syndrome due to severe reflux to the right lower extremity secondary to the venous thrombosis. Continuous renal replacement therapy was started to treat the acute kidney injury and hyperkalemia, and heparin therapy was started for the thrombus. The medical team discussed whether to perform a right thigh amputation, but surgery was considered contraindicated because of the patient’s poor general condition. Additionally, the patient began treatment with continuous noradrenaline administration for hypotension, albumin preparation administration for hypoalbuminemia, and thrombomodulin alpha for disseminated intravascular coagulation syndrome.\n\nAnticoagulation with heparin prolonged the activated partial thromboplastin time to more than 200 seconds after day 3 (Table 1), but the patient’s symptoms gradually worsened. On the morning of day 4, noninvasive positive-pressure ventilation was performed for hypoxemia, but the patient became progressively unconscious and unable to speak in the afternoon. His right lower extremity showed obvious blistering (Fig. 1b). His soluble fibrin level decreased once with anticoagulation therapy but subsequently increased again (Table 1). He also showed an increased fibrinogen level, decreased antithrombin level, and decreased platelet count, suggesting a hypercoagulable state. On day 5, after discussion with the family, it was decided not to attempt to operate or resuscitate the patient. The patient died on day 5.\n\nAfter the patient’s death, his family provided written consent for pathological autopsy and publication of the present case report. The pathological autopsy showed no thrombus in the femoral artery, but it revealed severe stenosis and occlusion from the right common iliac vein to the junction of the right and left iliac veins (Fig. 3a) and a thrombus in the inferior vena cava filter (Fig. 3b). There was no GPA-associated granulomatous inflammation with necrosis, necrotizing vasculitis, or necrotizing glomerulonephritis. Additionally, there were no tumors that could cause venous thrombosis.Fig. 3 Pathological specimen of a right femoral vein and b inferior vena cava filter. Note the embolism and occlusion in the right femoral vein and inferior vena cava, in contrast to the intact femoral artery\n\nDiscussion\n\nWe experienced a case in which a patient with GPA developed venous thrombosis and pulmonary embolism as late complications. His condition progressed and he died despite anticoagulation and insertion of an inferior vena cava filter. The notable characteristics of this case are that venous thrombosis and pulmonary embolism developed late in the course of GPA and that the disease progressed rapidly regardless of treatment.\n\nIn this case, venous thrombosis and pulmonary embolism occurred more than 20 years after the diagnosis of GPA, which is very unusual. We suspected sepsis, cancer-related thrombosis (Trousseau’s syndrome), heparin-induced thrombocytopenia, or antiphospholipid antibody syndrome as the differential diagnoses of acquired hypercoagulability and decreased fibrinolysis; however, the imaging and blood test results were not supportive of these diagnoses. Therefore, we considered delayed complications of GPA as a diagnosis of exclusion. GPA is reportedly associated with a high incidence of venous thrombosis (8–18%) [1–5]. However, the incidence of venous thrombosis is higher in the active phase of the disease early after GPA diagnosis. Stassen et al. [4] reported that the incidence of venous thrombosis during the active disease stage was 6.7 per 100 person-years, and that during the inactive disease stage was 1.0 per 100 person-years (P < 0.0001). Additionally, Liapi et al. [6] reported that the incidence decreased over time from diagnosis: 20.4 per 100 person-years by 3 months post-diagnosis, 8.9 per 100 person-years at 4 to 6 months, and 1.5 per 100 person-years at 7 to 12 months. Based on our report, venous thrombosis and pulmonary embolism should be kept in mind as possible late complications of GPA, even in the absence of other symptoms of GPA.\n\nThe second notable characteristic of this case is the rapid progression of venous thrombosis. We initially suspected that the rapid progression of consciousness impairment was due to GPA-induced cerebral neuropathy and that the progression of renal failure was due to GPA-induced glomerulonephritis. However, the pathological autopsy revealed no apparent lesions in the brain or kidney. Therefore, we concluded that this case purely involved progression of a treatment-resistant thrombus. The patient’s plasma levels of protein C and protein S were normal. His plasma antithrombin level was relatively well maintained until death, suggesting that he had not developed severe endothelial damage that could have caused abnormal vascular permeability. Additionally, his activated partial thromboplastin time was markedly prolonged, indicating a sufficient pharmacological effect of heparin. Despite this anticoagulant state, the plasma soluble fibrin concentration (which directly reflects hypercoagulability) remained abnormally high, while the D-dimer concentration (which indicates fibrinolytic activity) decreased to near normal. The laboratory data showed that coagulation was abnormally enhanced while fibrinolysis was suppressed. The concentration of plasma fibrinogen, one of the acute-phase reactants induced by inflammation, remained high, suggesting that plasminogen activator inhibitor-1 was also induced as an acute-phase reactant. The degree of fibrinolysis suppression was strong, and a gene polymorphism may have induced the development of a large amount of plasminogen activator inhibitor-1 by stimuli such as inflammation. The cause of the increased risk of venous thrombosis in patients with ANCA-associated vasculitis, especially when the disease is active, is unknown. Hilhorst et al. [7] reported that patients with ANCA-associated vasculitis in remission are in a more coagulable state than healthy controls and that elevated factor VIII levels measured in these patients suggest persistent endothelial activation and dysfunction. Berden et al. [8] reported that 24% of patients with ANCA-associated vasculitis had anti-plasminogen antibodies, 18% had anti-tissue plasminogen activator antibodies, and tissue plasminogen activator alterations were more common in patients with anti-plasminogen antibodies. Therefore, altered endothelial function, increased coagulability, and decreased fibrinolysis may increase the risk of venous thrombosis.\n\nConclusion\n\nWe experienced a case of venous thrombosis and pulmonary embolism that occurred 20 years after GPA onset. The venous thrombosis did not respond to treatment, the condition progressed, and the patient died. Venous thrombosis associated with GPA often occurs immediately after diagnosis, but the onset in the present case occurred during the remission phase. Hypercoagulability and decreased fibrinolysis in patients with GPA in remission may contribute to the rapid progression of treatment-resistant venous thrombosis.\n\nAbbreviations\n\nGPA Granulomatosis with polyangiitis\n\nANCA Anti-neutrophil cytoplasmic autoantibody\n\nPR3 Proteinase 3\n\nAcknowledgements\n\nWe thank Angela Morben, DVM, ELS, from Edanz (https://jp.edanz.com/ac), for editing a draft of this manuscript.\n\nAuthors’ contributions\n\nCW, YA, SS, TK, YO, SM, MD, and YN helped write and edit the manuscript. The author(s) read and approved the final manuscript.\n\nFunding\n\nNone.\n\nAvailability of data and materials\n\nThe datasets used in the current study are available from the corresponding author on reasonable request.\n\nDeclarations\n\nEthics approval and consent to participate\n\nNot applicable.\n\nConsent for publication\n\nWritten informed consent was obtained from the patient’s family to publish this case report and accompanying images.\n\nCompeting interests\n\nNone.\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Merkel PA Lo GH Holbrook JT Tibbs AK Allen NB Davis JC Brief communication: high incidence of venous thrombotic events among patients with Wegener granulomatosis: the Wegener’s Clinical Occurrence of Thrombosis (WeCLOT) Study Ann Intern Med 2005 142 620 626 10.7326/0003-4819-142-8-200505030-00011 15838068\n2. Borowiec A Hadzik-Błaszczyk M Kowalik I Rusinowicz T Krupa R Jankowski J High incidence of venous thromboembolism but not of coronary artery disease in granulomatosis with polyangiitis in first years after diagnosis Sarcoidosis Vasc Diffuse Lung Dis 2019 36 202 208 32476955\n3. Kronbichler A Leierer J Shin JI Merkel PA Spiera R Seo P Association of pulmonary hemorrhage, positive proteinase 3, and urinary red blood cell casts with venous thromboembolism in antineutrophil cytoplasmic antibody-associated vasculitis Arthritis Rheumatol 2019 71 1888 1893 10.1002/art.41017 31216123\n4. Stassen PM Derks RPH Kallenberg CGM Stegeman CA Venous thromboembolism in ANCA-associated vasculitis--incidence and risk factors Rheumatology (Oxford) 2008 47 530 534 10.1093/rheumatology/ken035 18356178\n5. Allenbach Y Seror R Pagnoux C Teixeira L Guilpain P Guillevin L High frequency of venous thromboembolic events in Churg-Strauss syndrome, Wegener’s granulomatosis and microscopic polyangiitis but not polyarteritis nodosa: a systematic retrospective study on 1130 patients Ann Rheum Dis 2009 68 564 567 10.1136/ard.2008.099051 19015208\n6. Liapi M, Jayne D, Merkel PA, Segelmark M, Mohammad AJ. Venous thromboembolism in ANCA-associated vasculitis. A population-based cohort study. Rheumatology (Oxford). 2021. 10.1093/rheumatology/keab057.\n7. Hilhorst M Winckers K Wilde B van Oerle R ten Cate H Tervaert JWC Patients with antineutrophil cytoplasmic antibodies associated vasculitis in remission are hypercoagulable J Rheumatol 2013 40 2042 2046 10.3899/jrheum.130200 24128780\n8. Berden AE Nolan SL Morris HL Bertina RM Erasmus DD Hagen EC Anti-plasminogen antibodies compromise fibrinolysis and associate with renal histology in ANCA-associated vasculitis J Am Soc Nephrol 2010 21 2169 2179 10.1681/ASN.2010030274 20847144\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2363-9024",
"issue": "7(1)",
"journal": "JA clinical reports",
"keywords": "Case report; Granulomatosis with polyangiitis; Pulmonary embolism; Vena cava filters; Venous thrombosis",
"medline_ta": "JA Clin Rep",
"mesh_terms": null,
"nlm_unique_id": "101682121",
"other_id": null,
"pages": "73",
"pmc": null,
"pmid": "34599670",
"pubdate": "2021-10-02",
"publication_types": "D016428:Journal Article",
"references": "19015208;32476955;24128780;20847144;15838068;18356178;31216123;33506869",
"title": "Treatment-resistant venous thrombosis and pulmonary embolism in a patient with granulomatosis with polyangiitis: a case report.",
"title_normalized": "treatment resistant venous thrombosis and pulmonary embolism in a patient with granulomatosis with polyangiitis a case report"
} | [
{
"companynumb": "JP-BIOLOGICAL E. LTD-2124726",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "4",
... |
{
"abstract": "Buprenorphine has been used in pain and opioid addiction management for nearly 25 years. Compared to methadone, buprenorphine is thought to exhibit less side effects and respiratory depression in case of accidental or suicidal overdose. The aim was to describe the characteristics of exposures reported to a French Poison Control Center (PCC). We conducted a retrospective study including all buprenorphine exposures for which advice of our PCC was required between 2009 and 2018. After data extraction from the electronic medical files and anonymous transfer to an Access base, a statistical descriptive analysis was performed focusing on adolescents over 10 years old and adults. One hundred and ninety-nine cases were analyzed. The major circumstances of exposure were suicide attempts and overdoses in patients with previously identified substance abuse. Buprenorphine exposures have been reduced by 50% between 2009 and 2018. Coingestions, often with benzodiazepines or antidepressants, were almost systematic and 79% of all the series exhibited at least one symptom. Among the symptomatic cases, neurological effects were the most frequent (83%) and respiratory symptoms occurred in 13%. No deaths were registered. Severity did not exceed PSS1 in 80% of all the cases. Treatment was mainly symptomatic even though naloxone was required in at least 5% of the symptomatic cases. Within 24 h after exposure, 120 patients were discharged from the emergency department. Despite loss to follow-up, our results suggest that buprenorphine is relatively safe.",
"affiliations": "Service de Pharmacologie Clinique, Centre antipoison-Toxicovigilance, Hopital Sainte Marguerite, APHM, Aix-Marseille Universite, Marseille, France.;Service de Pharmacologie Clinique, Centre antipoison-Toxicovigilance, Hopital Sainte Marguerite, APHM, Marseille, France.;Service de Pharmacologie Clinique, Centre antipoison-Toxicovigilance, Hopital Sainte Marguerite, APHM, Marseille, France.;Service de Pharmacologie Clinique, Centre antipoison-Toxicovigilance, Hopital Sainte Marguerite, APHM, Marseille, France.;INSERM, IRD, SESSTIM, Service de Pharmacologie Clinique, Centre antipoison-Toxicovigilance, Hopital Sainte Marguerite, APHM, Aix-Marseille Universite, Marseille, France.",
"authors": "Boulamery|Audrey|A|https://orcid.org/0000-0002-7883-3219;von Fabeck|Katharina|K|https://orcid.org/0000-0002-6805-027X;Glaizal|Mathieu|M|https://orcid.org/0000-0002-5373-1507;de Haro|Luc|L|https://orcid.org/0000-0003-2250-6312;Simon|Nicolas|N|https://orcid.org/0000-0003-4393-2257",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1111/fcp.12630",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0767-3981",
"issue": "35(4)",
"journal": "Fundamental & clinical pharmacology",
"keywords": "adults; benzodiazepines; buprenorphine; poison control center; poisoning",
"medline_ta": "Fundam Clin Pharmacol",
"mesh_terms": null,
"nlm_unique_id": "8710411",
"other_id": null,
"pages": "764-770",
"pmc": null,
"pmid": "33174237",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Buprenorphine exposures in adolescents and adults: a 10-year experience of a French Poison Control Center.",
"title_normalized": "buprenorphine exposures in adolescents and adults a 10 year experience of a french poison control center"
} | [
{
"companynumb": "FR-TEVA-2020-FR-1863105",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BUPRENORPHINE"
},
"drugadditional": null,
... |
{
"abstract": "Most patients with cancer-related pain are managed using opioids; cancer-related pain in the setting of pregnancy can be challenging to address owing to risk to the fetus associated with in utero opioid exposure. Buprenorphine is a unique opioid with potential benefits over other opioids for use in pregnancy and is often used for management of cancer-related pain in nonpregnant adults. There are limited data on cancer-related pain management in pregnant patients and no data supporting the use of buprenorphine for cancer-related pain in pregnant patients. This case describes a rapid buprenorphine induction using a microdosing regimen in a pregnant patient and highlights the potential of buprenorphine for cancer-related pain in this population.",
"affiliations": "Department of Pharmacy Services, Michigan Medicine, Ann Arbor, Michigan, USA.;Department of Family Medicine, Michigan Medicine, Ann Arbor, Michigan, USA.;Department of Pharmacy Services, Michigan Medicine, Ann Arbor, Michigan, USA.",
"authors": "Irwin|Madison|M|;Petersen|Ketti S|KS|;Smith|Michael A|MA|",
"chemical_list": "D000701:Analgesics, Opioid; D002047:Buprenorphine",
"country": "United States",
"delete": false,
"doi": "10.1089/jpm.2020.0524",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1557-7740",
"issue": "24(8)",
"journal": "Journal of palliative medicine",
"keywords": "buprenorphine; cancer pain; pregnancy",
"medline_ta": "J Palliat Med",
"mesh_terms": "D000328:Adult; D000701:Analgesics, Opioid; D002047:Buprenorphine; D000072716:Cancer Pain; D005260:Female; D006801:Humans; D009369:Neoplasms; D009293:Opioid-Related Disorders; D059408:Pain Management; D011247:Pregnancy; D011248:Pregnancy Complications",
"nlm_unique_id": "9808462",
"other_id": null,
"pages": "1257-1262",
"pmc": null,
"pmid": "33275857",
"pubdate": "2021-08",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Rapid Buprenorphine Induction for Cancer Pain in Pregnancy.",
"title_normalized": "rapid buprenorphine induction for cancer pain in pregnancy"
} | [
{
"companynumb": "US-PFIZER INC-202101090613",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugadditiona... |
{
"abstract": "Bevacizumab is an anti-angiogenic monoclonal antibody targeting Vascular Endothelial Growth Factor (VEGF) that induces the proliferation and migration of vascular endothelial cells thus, promoting vasculogenesis. Bevacizumab inhibits cancer angiogenesis, which is fundamental for either tumor development, exponential growth, or metastatic spread by supplying nutrients and oxygen. We report a new possible adverse event of bevacizumab, a Cerebral Amyloid Angiopathy-Related Inflammation (CAARI), in a 72-year-old woman with metastatic cervical cancer. After six cycles every three weeks of chemotherapy (cisplatin, paclitaxel, bevacizumab) and following two maintenance bevacizumab administrations, the patient presented a worsening confusional state. The MRI scan showed bilateral asymmetric temporo-parieto-occipital hyperintensity with numerous cortical microbleeds indicative of a CAARI. After stopping bevacizumab treatment, steroid therapy was administered resulting in rapid clinical improvement. The subsequent neurological and oncological follow-up was negative for recurrence. The patient was a heterozygote carrier for apolipoprotein-E ε4 that increases the risk of sporadic Cerebral Amyloid Angiopathy (CAA), which is characterized by beta-amyloid accumulation and fibrinoid necrosis in cerebral vasculature leading to micro/macrohemorrhages and dementia. Moreover, CAA is present in 30% of people aged over 60 years without dementia. In the brains of CAA patients, there is a proinflammatory state with cerebrovascular endothelial cell alteration and elevated levels of either adhesion molecules or inflammatory interleukins that increase the blood-brain barrier permeability. Moreover, CAARI is an inflammatory form of CAA. Inhibition of VEGF, which has anti-apoptotic, anti-inflammatory, and pro-survival effects on endothelial cells, impairs their regenerative capacity and increases expression of proinflammatory genes leading to weakened supporting layers of blood vessels and, hence, to damaged vascular integrity. In our patient, bevacizumab administration may have further increased permeability of cerebral microvasculature likely impaired by an underlying, asymptomatic CAA. To our knowledge, this is the first case reporting on the development of probable CAARI during bevacizumab treatment, which should alert the clinicians in case of neurological symptom onset in older patients under anti-angiogenic therapy.",
"affiliations": "Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy.;Department of Human Neurosciences, Sapienza University of Rome, Rome, Italy.;Department of Research, Advanced Diagnostics and Technological Innovation, IRCCS Regina Elena National Cancer Institute, IFO, Rome, Italy.;Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy.;Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy.;Clinical Pathology and Microbiology, IRCCS San Gallicano Dermatologic Institute, IFO, Rome, Italy.;Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy.;Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy.;Unità Operativa Complessa (UOC) Neurology, San Giovanni-Addolorata Hospital, Rome, Italy.",
"authors": "Koudriavtseva|Tatiana|T|;Lorenzano|Svetlana|S|;Anelli|Vincenzo|V|;Sergi|Domenico|D|;Stefanile|Annunziata|A|;Di Domenico|Enea Gino|EG|;Maschio|Marta|M|;Galiè|Edvina|E|;Piantadosi|Carlo|C|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fonc.2021.669753",
"fulltext": "\n==== Front\nFront Oncol\nFront Oncol\nFront. Oncol.\nFrontiers in Oncology\n2234-943X\nFrontiers Media S.A.\n\n10.3389/fonc.2021.669753\nOncology\nCase Report\nCase Report: Probable Cerebral Amyloid Angiopathy-Related Inflammation During Bevacizumab Treatment for Metastatic Cervical Cancer\nKoudriavtseva Tatiana 1 *\n\nLorenzano Svetlana 2\n\nAnelli Vincenzo 3\nSergi Domenico 1\nStefanile Annunziata 1\n\nDi Domenico Enea Gino 4\n\nMaschio Marta 1\n\nGaliè Edvina 1\n\nPiantadosi Carlo 5\n1Department of Clinical Experimental Oncology, IRCCS Regina Elena National Cancer Institute, Istituti Fisioterapici Ospitalieri (IFO), Rome, Italy\n2Department of Human Neurosciences, Sapienza University of Rome, Rome, Italy\n3Department of Research, Advanced Diagnostics and Technological Innovation, IRCCS Regina Elena National Cancer Institute, IFO, Rome, Italy\n4Clinical Pathology and Microbiology, IRCCS San Gallicano Dermatologic Institute, IFO, Rome, Italy\n5Unità Operativa Complessa (UOC) Neurology, San Giovanni-Addolorata Hospital, Rome, Italy\nEdited by: Paul Mathew, Tufts Medical Center, United States\n\nReviewed by: Hu Liu, Anhui Provincial Cancer Hospital, China; Bindu Setty, Boston University, United States\n\n*Correspondence: Tatiana Koudriavtseva, tatiana.koudriavtseva@ifo.gov.it; orcid.org/0000-0001-9984-1827\nThis article was submitted to Pharmacology of Anti-Cancer Drugs, a section of the journal Frontiers in Oncology\n\n27 7 2021\n2021\n11 66975305 3 2021\n09 7 2021\nCopyright © 2021 Koudriavtseva, Lorenzano, Anelli, Sergi, Stefanile, Di Domenico, Maschio, Galiè and Piantadosi\n2021\nKoudriavtseva, Lorenzano, Anelli, Sergi, Stefanile, Di Domenico, Maschio, Galiè and Piantadosi\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nBevacizumab is an anti-angiogenic monoclonal antibody targeting Vascular Endothelial Growth Factor (VEGF) that induces the proliferation and migration of vascular endothelial cells thus, promoting vasculogenesis. Bevacizumab inhibits cancer angiogenesis, which is fundamental for either tumor development, exponential growth, or metastatic spread by supplying nutrients and oxygen. We report a new possible adverse event of bevacizumab, a Cerebral Amyloid Angiopathy-Related Inflammation (CAARI), in a 72-year-old woman with metastatic cervical cancer. After six cycles every three weeks of chemotherapy (cisplatin, paclitaxel, bevacizumab) and following two maintenance bevacizumab administrations, the patient presented a worsening confusional state. The MRI scan showed bilateral asymmetric temporo-parieto-occipital hyperintensity with numerous cortical microbleeds indicative of a CAARI. After stopping bevacizumab treatment, steroid therapy was administered resulting in rapid clinical improvement. The subsequent neurological and oncological follow-up was negative for recurrence. The patient was a heterozygote carrier for apolipoprotein-E ε4 that increases the risk of sporadic Cerebral Amyloid Angiopathy (CAA), which is characterized by beta-amyloid accumulation and fibrinoid necrosis in cerebral vasculature leading to micro/macrohemorrhages and dementia. Moreover, CAA is present in 30% of people aged over 60 years without dementia. In the brains of CAA patients, there is a proinflammatory state with cerebrovascular endothelial cell alteration and elevated levels of either adhesion molecules or inflammatory interleukins that increase the blood–brain barrier permeability. Moreover, CAARI is an inflammatory form of CAA. Inhibition of VEGF, which has anti-apoptotic, anti-inflammatory, and pro-survival effects on endothelial cells, impairs their regenerative capacity and increases expression of proinflammatory genes leading to weakened supporting layers of blood vessels and, hence, to damaged vascular integrity. In our patient, bevacizumab administration may have further increased permeability of cerebral microvasculature likely impaired by an underlying, asymptomatic CAA. To our knowledge, this is the first case reporting on the development of probable CAARI during bevacizumab treatment, which should alert the clinicians in case of neurological symptom onset in older patients under anti-angiogenic therapy.\n\ncase report\nbevacizumab\nmetastatic cervical cancer\ncerebral amyloid angiopathy-related inflammation\nmicrohemorrhages 3\n==== Body\nIntroduction\n\nBevacizumab is a recombinant humanized monoclonal antibody selectively binding to and neutralizing the biologic activity of human Vascular Endothelial Growth Factor (VEGF).\n\nVEGF is a key factor of the angiogenesis physiologically occurring during embryonic development and in adult wound healing. In particular, VEGF induces the proliferation and migration of vascular endothelial cells and therefore, promotes vasculogenesis and angiogenesis by binding two VEGF receptors (VEGFR-1 and VEGFR-2) expressed on vascular endothelial cells. Furthermore, angiogenesis supplies nutrients and oxygen which are fundamental for either cancer development, exponential growth, or metastatic spread (1, 2). Indeed, VEGF is produced by the cancer cells in the “angiogenic switch” and upregulated by either oncogene expression, growth factors, or hypoxia.\n\nBevacizumab has been available in Europe since 2005 providing multiple indications including cervical advanced cancer (3). It was assumed that bevacizumab inhibits cancer growth supposedly impacting only tumor vessels without damaging other vessels (4). However, in the safety profile of bevacizumab, cerebrovascular events and bleeding are reported among the common adverse events (≥1 and <10%) and hypertensive encephalopathy and reversible posterior leukoencephalopathy syndrome (RPLS) are reported as uncommon adverse events (<1%) (5). There are no cases reported in literature regarding the association between bevacizumab therapy and other encephalopathies such as Cerebral Amyloid Angiopathy (CAA) or CAA-Related Inflammation (CAARI). CAARI is the inflammatory form of CAA that is characterized by beta-amyloid accumulation and fibrinoid necrosis in cerebral vasculature with micro/macrohemorrhages and dementia (6).\n\nTo our knowledge, this is the first case reporting on the development of probable CAARI during bevacizumab maintenance monotherapy in a patient affected by metastatic cervical neoplasia. This could be considered as a new side event of bevacizumab, which should alert the clinicians in case of neurological symptomatology onset in older patients under anti-angiogenic therapy.\n\nCase Description\n\nIn November 2016, a 70-year-old Russian female patient with metrorrhagia was diagnosed with a moderately differentiated cervical carcinoma in a Russian hospital. Her previous family and medical history was negative. In that period, no metastases were found. In December, she underwent chemoembolization with cisplatin of the cervical neoformation. In January 2017, she underwent both hysterectoannexectomy and pelvic lymphadenectomy for local recurrence. The scheduled radiochemotherapy was not performed due to the development of a vesicovaginal fistula as a post-surgical complication. After her arrival in Italy in July 2017, the PET/CT scans detected liver and para-aortic and iliac lymph node metastases as well as dubious lung lesions that a subsequent CT total body better defined as pulmonary consolidations of a probable inflammatory nature.\n\nIn September, the patient started chemotherapy with bevacizumab, cisplatin, and paclitaxel (six cycles every 3 weeks) with both good tolerance profile and clinical outcome. In fact, in December her CT scan showed a prominent reduction of liver, para-aortic, and iliac lymph node metastases. After the 6th cycle of chemotherapy, the patient had to continue with bevacizumab maintenance therapy but after two administrations of the drug (February 21 and March 14, 2018) she began to experience mild weakness in the right arm and show signs of cognitive impairment.\n\nDiagnostic Assessment, Therapeutic Intervention, and Follow-Up\n\nThe brain MRI scan showed a large left temporo-parieto-occipital subcortical and deep white matter hyperintensity (WMH) as well as a small area of WMH in the right inferioromedial temporal lobe on FLAIR sequences (Figure 1A1-A3) with no gadolinium enhancement (Figure 1A4, A5). Both gradient-echo (GRE) and susceptibility-weighted imaging (SWI) sequences were not performed initially as they are not used as routine procedures in our Institute.\n\nFigure 1 MRI follow up. (A) March 2018: FLAIR sequences showed a left temporo-parieto-occipital and a right temporal hyperintensity (A1, A2, A3); no gadolinium enhancement (A4, A5). (B) April 2018: FLAIR sequences showed an extension of the white matter (WM) hyperintensity (B1, B2, B3); gradient-echo sequences showed microbleeds (B4, B5). (C) June 2018: FLAIR sequences showed a reduction of the WM alterations (C1, C2, C3); susceptibility-weighted imaging (SWI) sequences confirmed microbleeds (C4, C5). (D) February 2019: FLAIR sequences showed a further reduction of the WM alterations (D1, D2, D3); SWI sequences corroborated microbleeds (D4, D5).\n\nThe MRI features resembled a RPLS or hypertensive encephalopathy that may occur as a rare side effect of bevacizumab. However, the blood pressure values of the patient were normal. Routine blood tests together with either inflammation indices such as erythrocyte sedimentation rate, serum autoantibodies (antinuclear antibodies, anti-ssa, -ssb, -sm, -RNP, -scl 70, -Jo1, -ANCA, -MPO, -PR3; IgG, and IgM of either anti-cardiolipin, anti-beta2-glycoprotein I, anti-annexin V, or anti-prothrombin) or serum onconeural antibodies (anti-HU, anti-YO, anti-RI, anti-amphiphysin, anti-CV2, anti-Ma2/Ta, anti-recoverin, anti-sox1, anti-titin, anti-XIC4, anti-GAD65, anti-Tr) tested negative. Virology screening (anti-EBV, anti-herpes simplex 1 e 2, anti-zoster, anti-cytomegalovirus, anti-hepatitis B and C, anti-measles, anti-toxoplasma) was not indicative of ongoing infection. PET/CT scans showed a reduction of focal hypermetabolism in the para-aortic and iliac lymph nodes confirming the findings of the CT total body scan performed in December 2018, along with the disappearance of focal hypermetabolism in the liver. Due to a misunderstanding, the patient did not show up the day she had to perform the EEG.\n\nOver a month, the cognitive impairment of the patient evolved into spatial-temporal disorientation, and then it deteriorated into a confusional state. In April 2018, the MRI revealed an extension of WMH with contralateral involvement, a 4-mm midline shift, and a diffuse venous leptomeningeal stasis (Figure 1B1-B3). Numerous cortical microbleeds were also observed on GRE sequences (Figure 1B4, B5) mostly in bi-temporal regions. All these findings along with the clinical picture of the patients were suggestive of probable CAARI according to established clinical and radiological criteria. The previous MRI performed in March 2018 was revised in light of these findings, and it actually already evidenced an initial formation of bi-temporal microbleeds, less easily visible on FLAIR sequences (Figure 1A3) with their subsequent increase in the month of April (Figure 1B3).\n\nLumbar puncture was not performed for the presence of prominent cerebral edema. However, we had reserved to perform it in case the pathology did not respond to steroid therapy. Therefore, under the hypothesis that this probable CAARI could be related to bevacizumab-induced origin, the drug administration scheduled for April was not performed, and the treatment was interrupted definitely. Intravenous methylprednisolone (120 mg/day for 7 days) was started and was followed by oral prednisone (25 mg/day with gradual tapering over a two week period) leading to rapid improvement of symptoms already after the first few administrations of methylprednisolone. The patient resulted to be heterozygote (ε3/ε4) for apolipoprotein-E (APOE) ε4.\n\nIn June 2018, a remarkable reduction of WM lesions with edema resolution was observed (Figure 1C1-C3) with persisting multiple microbleeds on SWI sequences (Figure 1C4, C5). Consistently with the first MRI (Figure 1A4, A5), gadolinium-enhanced lesions were never observed on MRIs at any time-point. In February 2019, patient was cognitively normal while the MRI showed a further reduction of WMH (Figure 1D1-D3) with standing microbleeds (Figure 1D4, D5).\n\nDespite interrupting anti-cancer therapy as early as in April 2018, the PET/CT scans of the patient in July 2018 did not demonstrate areas of hypermetabolism attributable to neoplastic lesions in addition to the CT total body scan performed in January 2019 which did not show any suspicious lesions of neoplastic nature. The subsequent 2-year clinical and radiological oncologic (with CT and PET/CT scans) follow-up was negative for both recurrence and metastasis. The neurological and cognitive status of the patient remained normal. The timeline of the clinical course and interventions of the patient is summarized in Figure 2.\n\nFigure 2 Timeline of clinical course and interventions.\n\nDiscussion\n\nThis case report is suggestive of a specific inflammatory form of CAA i.e., CAARI, in a patient with a possibly underlying CAA or at least with a predisposition to this disease that the treatment with bevacizumab might have uncovered or acutely worsened. To our knowledge, this is the first study reporting on the potential link between treatment with bevacizumab and the development of CAARI.\n\nThe probable diagnosis of CAARI was formed based on the classic or modified clinicoradiological diagnostic criteria (6, 7) since the biopsy was not carried out due to a prompt and complete response to cortisone therapy, whose dosage was even much lower than that widely used (methylprednisolone 1 gr/day for 5 days). Given the optimal response to steroid treatment, it was deemed unethical for our patient to undergo an invasive procedure like brain biopsy even if the pathological examination represents a definitive diagnostic tool for CAARI. In fact, the diagnostic criteria indicate reconsidering a brain biopsy when failure of the empiric high-dose steroid therapy occurs within 3 weeks (6). Moreover, it should be pointed out that in some cases the diagnosis of CAARI could be missed by the biopsy due to sampling error, reflecting the patchy segmental inflammatory nature of this condition. As proof of this, in the study by Aurel et al. aiming to validate the clinicoradiological criteria of probable CAARI, one individual with a negative histological examination was subsequently diagnosed with a probable CAARI according to these criteria, and the diagnosis was confirmed by both clinicoradiological response to steroid therapy and subsequent follow-up (7). Similarly, in one of the largest cohorts of 48 patients with probable CAARI based on clinicoradiological features, only 24 individuals underwent pathologic evaluation, and of these 13% patients had no inflammation (8).\n\nAPOE ε4 allele, especially in homozygosity (ε4/ε4), increases the risk not only of sporadic CAA (9) but also of CAARI (6). Our patient has APOE ε3/ε4 genotype, which is a second more frequent genotype of CAARI (30%) after the APOE ε4/ε4 one (45%) as reported in some large studies (8).\n\nOther factors that supported our diagnostic hypothesis of CAARI was the age of the patient in the seventh decade, which is the mean age of CAARI onset, as well as her very fast clinical response to steroid therapy (6). However, the most important aspect that guided the diagnostic process was the presence of multiple lobar microhemorrhages (asymmetrically distributed predominantly on the side with more edema) and patchy or confluent asymmetric WMHs on her neuroimaging scans which readily regressed in response to steroid therapy and highly specific for CAARI (8).\n\nCAA is a disorder characterized by beta-amyloid (Aβ peptide) accumulation and fibrinoid necrosis in cerebral vasculature often leading to micro/macrohemorrhages and dementia (10). Furthermore, it is also present in 30% of patients without dementia who are over 60 years old. In the brain of CAA patients, there is a proinflammatory state with cerebrovascular endothelial cell alteration and elevated levels of either adhesion molecules (for example vascular cell adhesion protein 1, intercellular adhesion molecule 1, endothelial leukocyte adhesion molecule-1), inflammatory interleukins or other molecules such as tumor necrosis factor alpha, transforming growth factor beta, monocyte chemoattractant protein-1 that all increase the blood–brain barrier (BBB) permeability (11). Aβ peptide is a derivative from amyloid precursor protein (APP), which is a large type I transmembrane protein (11). APP is expressed in the brain and in peripherally circulating cells such as lymphocytes, monocytes, and platelets. In particular, thrombocytes have very high APP levels contributing to over 90% of the circulating APP. Aβ, a peptide derived and released from APP of activated platelets, produces the formation of vascular amyloid deposits, and this vascular infiltration induces a damage of thinner vessel walls due to a cellular replacement specifically in media and adventitia layers. Aβ peptide also activates and promotes thrombocyte adhesion and aggregation. However, our patient had a normal number of thrombocytes.\n\nCAARI has been reported in a minority of patients with CAA as a newly recognized syndrome of reversible encephalopathy, which presents large areas of inflammation and edema via imaging scans (6). Its clinical features were described for the first time by Eng et al. in 2004. The most frequent are: acute/subacute encephalopathy (76%), headache (41%), seizures (31%), and stroke-like signs such as focal neurologic signs (46%) (12). The diagnostic criteria of probable CAARI were defined by Chung et al. in 2011 as follows: acute/subacute onset of symptoms; age ≥40 years; at least one symptom among headache, acute/subacute cognitive decline, mental/behavioral change, focal neurological signs, seizures; MRI showing patchy or confluent asymmetric T2WI or FLAIR WMH (with/without mass effect and with/without leptomeningeal or parenchymal enhancement); recent or past lobar intracerebral hemorrhage and/or multiple cortical/subcortical microbleeds on GRE or SWI; absence of neoplastic, infectious, or other causes (6). Definitive diagnosis of CAARI requires a brain biopsy. The modified clinicoradiological criteria, developed with the aim to spare brain biopsy at least in some cases and compared to the classic diagnostic criteria, have included other possible features useful for diagnosis of probable CAARI with good sensitivity and excellent specificity: 1) clinical symptoms could be also chronic; 2) WMH pattern could extend to the immediate subcortical WM in addition to being asymmetric; and 3) superficial siderosis could be considered as a bleeding manifestation of CAARI (7).\n\nThe differential diagnoses include infections (in particular progressive multifocal leucoencephalopathy), neurosarcoidosis, disimmune pathologies and neoplastic processes (primary CNS lymphoma, carcinomatous meningitis, and gliomatosis cerebri) representing, therefore, the conditions to be excluded for the diagnosis of CAARI (6).\n\nIndeed, for our patient, differential diagnosis included RPLS, acute disseminated encephalomyelitis, primary vasculitis of the central nervous system, autoimmune encephalitis, malignancy, and infection. Hypertensive vasculopathy was excluded based on clinical history, examination, and imaging studies that did not demonstrate focal lesions in the basal ganglia, thalamus, cerebellum, and/or brainstem. Even other conditions were excluded based on the negativity of blood chemistry and radiological investigations, especially the prompt response to steroid therapy after discontinuing bevacizumab. Cerebrospinal fluid (CSF) abnormalities such as mildly elevated protein and presence of leukocytes are usually found in CAARI but appear to be neither sensitive nor specific for this diagnosis whereas CSF anti-β-amyloid antibodies are not yet commercially available and where their cut-off values are not defined in being variable according to the clinical course (7, 13).\n\nAn autoimmune mechanism of inflammation underlying CAARI has been hypothesized for the similarity to the autoimmune inflammation observed after anti-amyloid peptide vaccine and the finding of elevated autoantibodies against Aβ peptide in CSF (14). A case of pathologically confirmed CAARI attributable to anti-PD-1 (Programmed Death-1 receptor) immunotherapy with nivolumab for metastatic melanoma was recently reported as its immune-related adverse event, with a complete response to methylprednisolone therapy (15). PD-1s are important regulators of the threshold of immune response and peripheral immune tolerance that maintain immune homeostasis and prevent autoimmunity. Their inhibition could predispose a proinflammatory state in the brain.\n\nOn the other hand, a case of CAARI corroborated through biopsy was described also in a patient with chronic immunosuppression with disseminated mycobacterial infection after orthotopic heart transplantation for sarcoid cardiomyopathy (16). In this case, high-dose intravenous therapy followed by oral steroids led to significant clinical and radiographic improvement.\n\nTherefore, it is important to recognize CAARI early because steroid and immunosuppressive treatment usually leads to clinical and radiological improvement within a few weeks; although CAARI clinical course is variable, improving prognosis and reducing the risk of recurrence is possible (13).\n\nInhibition of VEGF, which has anti-apoptotic, anti-inflammatory and pro-survival effects on endothelial cells, impairs their regenerative capacity and increases expression of proinflammatory genes leading to weakened supporting layers of blood vessels and hence, to damaged vascular integrity (4). Increased risk of either stroke, transient ischemic attack, or subarachnoid hemorrhage was reported with bevacizumab therapy (4, 5). Predisposition to thrombosis and bleeding under bevacizumab underlines multiple functions of VEGF not only in both endothelial and vascular smooth muscle cells but also in coagulation components (4). Moreover, VEGF increases the production of nitric oxide and prostacyclin having a vasodilator effect; therefore, its inhibition leads to vasoconstriction with both increased peripheral resistance and blood pressure (4). In fact, another rare adverse event of bevacizumab on the brain, an RPLS, which manifests with either BBB breakdown, localized cerebral edema or vasospasm, is ascribed to hypertensive encephalopathy and endothelial dysfunction.\n\nIn our case bevacizumab may have been a precipitating factor for CAARI acting on a cerebral microvasculature likely impaired by an underlying, asymptomatic CAA (as suggested by the APOE ε3/ε4 genotype of the patient) through different mechanisms but mainly due to depriving the brain of anti-inflammatory function of VEGF in a CAA-related proinflammatory environment. Moreover, it should be taken into account that beta-amyloid accumulation and fibrinoid necrosis in cerebral vasculature is present in 30% of patients without dementia who are over 60 years old.\n\nPatient Perspective\n\nThis new probable bevacizumab-related adverse event should alert the clinicians in case neurological symptoms develop in older patients under anti-angiogenic therapy and should lead to further investigations via performing specific neuroimaging sequences for detecting microbleeds in order to rule out a possible CAARI. In turn, an early diagnosis of CAARI allows for rapidly starting an effective intervention with steroids or, more rarely, immunosuppressive therapy which usually determines a rapid resolution of symptoms. In regard to our patient, prompt steroid therapy resolved acute symptoms, and no neurological worsening was observed during the three years of follow-up. Four and a half years from her diagnosis, our patient has still not experienced any recurrence nor metastasis. Thus, she could fall into the 16.5% of the 5-year survival rate for metastatic cervical cancer (17). She will continue oncological and neurological follow-ups.\n\nData Availability Statement\n\nThe data analyzed in this study is subject to the following licenses/restrictions: The datasets are available from the corresponding author on reasonable request. Requests to access these datasets should be directed to tatiana.koudriavtseva@ifo.gov.it.\n\nEthics Statement\n\nWritten informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article. The patient has provided her written informed consent for the publication of this case report.\n\nAuthor Contributions\n\nTK and CP contributed to the study conception and design. Material preparation, data collection, and analysis were performed by VA, DS, AS, ED, MM, and EG. The first draft of the manuscript was written by SL and all authors commented on previous versions of the manuscript. All authors contributed to the article and approved the submitted version.\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nPublisher’s Note\n\nAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.\n\nAcknowledgments\n\nWe thank the patient for giving her written informed consent for the publication of this case report.\n==== Refs\nReferences\n\n1 Hicklin DJ Ellis LM . Role of the Vascular Endothelial Growth Factor Pathway in Tumor Growth and Angiogenesis. J Clin Oncol (2005) 23 (5 ):1011–27. 10.1200/JCO.2005.06.081\n2 Carmeliet P . VEGF as a Key Mediator of Angiogenesis in Cancer. Oncology (2005) 69 Suppl 3 :4–10. 10.1159/000088478 16301830\n3 Minion L Tewari KS . The Safety and Efficacy of Bevacizumab in the Treatment of Patients With Recurrent or Metastatic Cervical Cancer. Expert Rev Anticancer Ther (2017) 17 (3 ):191–8. 10.1080/14737140.2016.1246187\n4 Kamba T McDonald DM . Mechanisms of Adverse Effects of Anti-VEGF Therapy for Cancer. Br J Cancer (2007) 96 (12 ):1788–95. 10.1038/sj.bjc.6603813\n5 Available at: http://www.bccancer.bc.ca/drug-database-site/Drug%20Index/Bevacizumab_monograph.pdf.\n6 Chung KK Anderson NE Hutchinson D Synek B Barber PA . Cerebral Amyloid Angiopathy Related Inflammation: Three Case Reports and a Review. J Neurol Neurosurg Psychiatry (2011) 82 (1 ):20–6. 10.1136/jnnp.2009.204180\n7 Auriel E Charidimou A Gurol ME Ni J Van Etten ES Martinez-Ramirez S . Validation of Clinicoradiological Criteria for the Diagnosis of Cerebral Amyloid Angiopathy-Related Inflammation. JAMA Neurol (2016) 73 (2 ):197–202. 10.1001/jamaneurol.2015.4078 26720093\n8 Regenhardt RW Thon JM Das AS Thon OR Charidimou A Viswanathan A . Association Between Immunosuppressive Treatment and Outcomes of Cerebral Amyloid Angiopathy-Related Inflammation. JAMA Neurol (2020) 77 (10 ):1261–9. 10.1001/jamaneurol.2020.1782\n9 Ringman JM Sachs MC Zhou Y Monsell SE Saver JL Vinters HV . Clinical Predictors of Severe Cerebral Amyloid Angiopathy and Influence of APOE Genotype in Persons With Pathologically Verified Alzheimer Disease. JAMA Neurol (2014) 71 (7 ):878–83. 10.1001/jamaneurol.2014.681\n10 Weller RO Preston SD Subash M Carare RO . Cerebral Amyloid Angiopathy in the Aetiology and Immunotherapy of Alzheimer Disease. Alzheimer’s Res Ther (2009) 1 1 . 10.1111/nan.12042\n11 Espinosa-Parrilla Y Gonzalez-Billault C Fuentes E Palomo I Alarcón M . Decoding the Role of Platelets and Related MicroRNAs in Aging and Neurodegenerative Disorders. Front Aging Neurosci (2019) 11 :151. 10.3389/fnagi.2019.00151 31312134\n12 Eng JA Frosch MP Choi K Rebeck GW Greenberg SM . Clinical Manifestations of Cerebral Amyloid Angiopathy-Related Inflammation. Ann Neurol (2004) 55 (2 ):250–6. 10.1002/ana.10810\n13 Chwalisz BK . Cerebral Amyloid Angiopathy and Related Inflammatory Disorders. J Neurol Sci (2021) 424 :117425. 10.1016/j.jns.2021.117425 33840507\n14 Piazza F Greenberg SM Savoiardo M Gardinetti M Chiapparini L Raicher I . Anti-Amyloid Beta Autoantibodies in Cerebral Amyloid Angiopathy-Related Inflammation: Implications for Amyloid-Modifying Therapies. Ann Neurol (2013) 73 (4 ):449–58. 10.1002/ana.23857\n15 Lasocki A Kee D . Clinical and Radiological Evolution of Cerebral Amyloid Angiopathy-Related Inflammation in the Context of Anti-PD-1 Immunotherapy. Melanoma Res (2020) 30 (6 ):608–12. 10.1097/CMR.0000000000000683\n16 Nelson T Leung B Bannykh S Shah KS Patel J Dumitrascu OM . Cerebral Amyloid Angiopathy-Related Inflammation in the Immunosuppressed: a Case Report. Front Neurol (2019) 10 :1283. 10.3389/fneur.2019.01283 31866934\n17 Ferlay J Steliarova-Foucher E Lortet-Tieulent J Rosso S Coebergh JW Comber H . Cancer Incidence and Mortality Patterns in Europe: Estimates for 40 Countries in 2012. Eur J Cancer (2013) 49 (6 ):1374–403. 10.1016/j.ejca.2012.12.027\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2234-943X",
"issue": "11()",
"journal": "Frontiers in oncology",
"keywords": "bevacizumab; case report; cerebral amyloid angiopathy-related inflammation; metastatic cervical cancer; microhemorrhages 3",
"medline_ta": "Front Oncol",
"mesh_terms": null,
"nlm_unique_id": "101568867",
"other_id": null,
"pages": "669753",
"pmc": null,
"pmid": "34386418",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "14755729;17519900;23625526;15585754;19822028;20935328;33840507;31866934;32568365;31312134;26720093;24797962;23485231;16301830;27748633;32590413",
"title": "Case Report: Probable Cerebral Amyloid Angiopathy-Related Inflammation During Bevacizumab Treatment for Metastatic Cervical Cancer.",
"title_normalized": "case report probable cerebral amyloid angiopathy related inflammation during bevacizumab treatment for metastatic cervical cancer"
} | [
{
"companynumb": "IT-ROCHE-2892837",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "1",
"drug... |
{
"abstract": "BACKGROUND\nInvasive infections due to carbapenem-resistant Enterobacteriaceae (CRE) are becoming increasingly more prevalent and provide significant morbidity and mortality. Providing curative therapy and overcoming bacterial resistance are difficult tasks with limited antibiotic options. Alternative antibiotics and approaches to therapy are required, with often a compromise in patient outcome.\n\n\nOBJECTIVE\nTo demonstrate the effective use of therapeutic drug monitoring (TDM) in difficult-to-treat infections due to multiresistant gram-negative bacteria.\n\n\nMETHODS\nA case of an elderly woman with an invasive cervical spine infection due to CRE is presented. Her protracted therapeutic course was complicated by multiple treatment failures and severe cervical spine instability. Therapeutic success, as determined by wound healing, cervical spine stability, and continued suppression of inflammatory markers, was obtained by continuous daily ertapenem infusions with TDM guiding the optimal drug dosing.\n\n\nCONCLUSIONS\nIn this unusual setting, TDM was utilized successfully to achieve favorable serum antibiotic concentrations and lead to control of the infection. TDM may be a useful tool in difficult-to-treat infections caused by multiresistant bacteria.",
"affiliations": "1 Unit of Infectious Diseases, Royal Brisbane and Women's Hospital , Herston, Queensland, Australia .;1 Unit of Infectious Diseases, Royal Brisbane and Women's Hospital , Herston, Queensland, Australia .;1 Unit of Infectious Diseases, Royal Brisbane and Women's Hospital , Herston, Queensland, Australia .;1 Unit of Infectious Diseases, Royal Brisbane and Women's Hospital , Herston, Queensland, Australia .;1 Unit of Infectious Diseases, Royal Brisbane and Women's Hospital , Herston, Queensland, Australia .",
"authors": "Stewart|Adam|A|;Graves|Bianca|B|;Hajkowicz|Krispin|K|;Ta|Kim|K|;Paterson|David L|DL|",
"chemical_list": "D000900:Anti-Bacterial Agents; D013845:Thienamycins; D047090:beta-Lactams; D005578:Fosfomycin; D000583:Amikacin; D002097:C-Reactive Protein; D000077731:Meropenem; D000077727:Ertapenem",
"country": "United States",
"delete": false,
"doi": "10.1089/mdr.2015.0006",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1076-6294",
"issue": "21(6)",
"journal": "Microbial drug resistance (Larchmont, N.Y.)",
"keywords": null,
"medline_ta": "Microb Drug Resist",
"mesh_terms": "D000583:Amikacin; D000900:Anti-Bacterial Agents; D002097:C-Reactive Protein; D016903:Drug Monitoring; D024901:Drug Resistance, Multiple, Bacterial; D016972:Enterobacter cloacae; D004756:Enterobacteriaceae Infections; D000077727:Ertapenem; D005260:Female; D005578:Fosfomycin; D006801:Humans; D000077731:Meropenem; D008875:Middle Aged; D010019:Osteomyelitis; D013203:Staphylococcal Infections; D013212:Staphylococcus epidermidis; D013845:Thienamycins; D047090:beta-Lactams",
"nlm_unique_id": "9508567",
"other_id": null,
"pages": "631-5",
"pmc": null,
"pmid": "26171974",
"pubdate": "2015-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "The Use of Therapeutic Drug Monitoring to Optimize Treatment of Carbapenem-Resistant Enterobacter Osteomyelitis.",
"title_normalized": "the use of therapeutic drug monitoring to optimize treatment of carbapenem resistant enterobacter osteomyelitis"
} | [
{
"companynumb": "PHHY2016AU002620",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RIFAMPIN"
},
"drugadditional": null,
"drugad... |
{
"abstract": "OBJECTIVE\nHepatic encephalopathy is an adverse event resulting from lenvatinib use in patients with hepatocellular carcinoma (HCC). We analyzed the influence of lenvatinib on portal venous flow velocity (PVV) and serum ammonia concentration.\n\n\nMETHODS\nEleven patients with unresectable HCC were enrolled, including three with modified albumin-bilirubin (mALBI) grade 1, three with grade 2a, and five with grade 2b. PVV was measured by Doppler ultrasound sonography before and on day 2 of administration.\n\n\nRESULTS\nOut of 11 patients, one developed hepatic encephalopathy. PVV was reduced in 10 patients, and the change from baseline was significantly correlated with lenvatinib dosage. The increase in serum ammonia concentration was affected by lenvatinib dose and baseline hepatic function as a threshold between mALBI grade 2a and 2b statistically. There was no correlation between changes in PVV and serum ammonia concentration.\n\n\nCONCLUSIONS\nLenvatinib might directly disturb hepatocyte metabolism to result in increased serum ammonia concentration.",
"affiliations": "Department of Hepato-Biliary-Pancreatic Internal Medicine, Oita Red Cross Hospital, Oita, Japan narita@oita-rc-hp.jp.;Department of Hepato-Biliary-Pancreatic Internal Medicine, Hara Sanshin Hospital, Fukuoka, Japan.;Department of Hepato-Biliary-Pancreatic Internal Medicine, Oita Red Cross Hospital, Oita, Japan.;Department of Hepato-Biliary-Pancreatic Internal Medicine, Oita Red Cross Hospital, Oita, Japan.;Third Department of Internal Medicine, University of Occupational and Environmental Health, Japan, School of Medicine, Kitakyushu, Japan.",
"authors": "Narita|Ryoichi|R|;Kotoh|Kazuhiro|K|;Yoneda|Akitoshi|A|;Motomura|Mitsuteru|M|;Harada|Masaru|M|",
"chemical_list": "D000970:Antineoplastic Agents; D010671:Phenylurea Compounds; D047428:Protein Kinase Inhibitors; D011804:Quinolines; C531958:lenvatinib; D001663:Bilirubin",
"country": "Greece",
"delete": false,
"doi": "10.21873/anticanres.14531",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0250-7005",
"issue": "40(9)",
"journal": "Anticancer research",
"keywords": "Hepatocellular carcinoma; hepatic encephalopathy; lenvatinib; portal vein flow velocity",
"medline_ta": "Anticancer Res",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000970:Antineoplastic Agents; D001663:Bilirubin; D006528:Carcinoma, Hepatocellular; D004198:Disease Susceptibility; D005260:Female; D006501:Hepatic Encephalopathy; D006801:Humans; D022124:Hyperammonemia; D008111:Liver Function Tests; D008113:Liver Neoplasms; D008297:Male; D008875:Middle Aged; D060787:Neoplasm Grading; D009367:Neoplasm Staging; D010671:Phenylurea Compounds; D011169:Portal Vein; D047428:Protein Kinase Inhibitors; D011804:Quinolines; D012307:Risk Factors",
"nlm_unique_id": "8102988",
"other_id": null,
"pages": "5271-5276",
"pmc": null,
"pmid": "32878816",
"pubdate": "2020-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Factors Raising Serum Ammonia Level During Lenvatinib Treatment of Patients With Hepatocellular Carcinoma.",
"title_normalized": "factors raising serum ammonia level during lenvatinib treatment of patients with hepatocellular carcinoma"
} | [
{
"companynumb": "JP-EISAI MEDICAL RESEARCH-EC-2020-082825",
"fulfillexpeditecriteria": "2",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LENVATINIB"
},
"drugadditional... |
{
"abstract": "The aim of this observational cohort study was to specify the risk of the vitamin K antagonist (VKA) phenprocoumon during first trimester of pregnancy, in particular to estimate the risk of birth defects and spontaneous fetal loss. Four hundred eight pregnancies with phenprocoumon exposure were compared to 1,642 pregnancies neither exposed to VKA nor to other major teratogens or fetotoxicants. There was no typical warfarin embryopathy in our exposed cohort. However, the overall rate of major birth defects was significantly increased (7.4 % vs 2.3 %; adjusted odds ratio [ORadj] 2.14; 95 % confidence interval [CI] 1.4-3.4). With early cessation until five completed gestational weeks the birth defect risk was similar to the comparison cohort (2.4 % vs 2.3 %; ORadj 1.07; 95 % CI 0.2-3.6). With treatment duration exceeding seven gestational weeks the rate of major birth defects increased up to five-fold (10.8 % vs 2.3 %; ORadj 5.18; 95 % CI 2.0-11.6). The overall risk of spontaneous abortion (SAB) was 38.0 % vs 17.5 % in the comparison cohort (adjusted hazard ratio [HRadj] 2.9; 95 % CI 2.2-3.9). The treatment duration had a significant effect on the hazard of SAB (HRadj 1.12; 95 % CI 1.01-1.25 per each additional exposure week). Phenprocoumon and other VKA carry an embryotoxic risk. This risk seems to be time-dependent with a steep risk increase for birth defects and also for fetal loss after week 5. If maternal disease permits, VKA therapy should be switched to safer alternatives such as heparins immediately after early recognition of pregnancy.",
"affiliations": "Eleanor Hüttel, Pharmakovigilanz- und Beratungszentrum für Embryonaltoxikologie, Charité - Universitätsmedizin, Augustenburger Platz 1, 13353 Berlin, Germany, Tel.: +49 30 450 525 702, Fax: + 49 30 450 525 902, E-mail: eleanor.huettel@charite.de.",
"authors": "Hüttel|Eleanor|E|;Padberg|Stephanie|S|;Meister|Reinhard|R|;Beck|Evelin|E|;Schaefer|Christof|C|",
"chemical_list": "D000925:Anticoagulants; D014812:Vitamin K; D010644:Phenprocoumon",
"country": "Germany",
"delete": false,
"doi": "10.1160/TH16-11-0838",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0340-6245",
"issue": "117(5)",
"journal": "Thrombosis and haemostasis",
"keywords": "Time-dependence; congenital malformation; observational cohort study; spontaneous abortion; thrombosis prophylaxis",
"medline_ta": "Thromb Haemost",
"mesh_terms": "D000014:Abnormalities, Drug-Induced; D000022:Abortion, Spontaneous; D000032:Abortion, Therapeutic; D000328:Adult; D000925:Anticoagulants; D001724:Birth Weight; D001777:Blood Coagulation; D004334:Drug Administration Schedule; D057915:Drug Substitution; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D016015:Logistic Models; D016017:Odds Ratio; D010644:Phenprocoumon; D011247:Pregnancy; D011261:Pregnancy Trimester, First; D047928:Premature Birth; D016016:Proportional Hazards Models; D011446:Prospective Studies; D018570:Risk Assessment; D012307:Risk Factors; D013997:Time Factors; D016896:Treatment Outcome; D014812:Vitamin K; D055815:Young Adult",
"nlm_unique_id": "7608063",
"other_id": null,
"pages": "870-879",
"pmc": null,
"pmid": "28229160",
"pubdate": "2017-05-03",
"publication_types": "D016428:Journal Article; D064888:Observational Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Pregnancy outcome of first trimester exposure to the vitamin K antagonist phenprocoumon depends on duration of treatment.",
"title_normalized": "pregnancy outcome of first trimester exposure to the vitamin k antagonist phenprocoumon depends on duration of treatment"
} | [
{
"companynumb": "DE-GLAXOSMITHKLINE-DE2017GSK092676",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CEFUROXIME"
},
"drugadditional": nul... |
{
"abstract": "OBJECTIVE\nHyperprolactinemia is common in acromegaly and in these patients, insulin-like growth factor (IGF)-1 level may decrease with dopamine agonist. We report a series of patients with prolactinoma and a paradoxical increase of IGF-1 levels during cabergoline treatment.\n\n\nMETHODS\nClinical characteristics and response to treatment of patients with prolactinomas, in whom normal or slightly elevated baseline IGF-1 levels increased with cabergoline.\n\n\nRESULTS\nThe cohort consisted of ten prolactinoma patients (nine males, mean age 48 ± 14 years). Mean adenoma size was 23.8 ± 16.2 mm, with cavernous sinus invasion in eight. In five patients baseline IGF-1 levels were normal and in four levels were 1.2-1.5-fold the upper limit of the normal (ULN). One patient had IGF-1 measured shortly after initiating cabergoline and it was 1.4 × ULN. During cabergoline treatment (dose range 0.5-2 mg/week) PRL normalization was achieved in all and tumor shrinkage occurred in seven patients. The mean IGF-1 increase on cabergoline was 1.7 ± 0.4 × ULN. Cabergoline dose reduction or interruption was attempted in five patients and resulted in decreased IGF-1 levels in all, including normalization in two patients. Three patients were eventually diagnosed with acromegaly, one was referred for pituitary surgery followed by complete remission, another patient was switched to somatostatin analogue, and the third was treated by combination of somatostatin analogues with pegvisomant, with reduction of IGF-1 in all these patients.\n\n\nCONCLUSIONS\nIGF-1 levels may increase to clinically significant levels during cabergoline treatment for PRL-adenoma. We suggest IGF-1 monitoring in all patients treated with dopamine agonists and not only in those presenting symptoms of acromegaly.",
"affiliations": "Institute of Endocrinology, Rabin Medical Center, Beilinson Hospital, 4941492, Petach Tikva, Israel. amit.akirov@gmail.com.;Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel.;Endocrinology and Metabolism Service, Hadassah-Hebrew University Medical Center, 91120, Jerusalem, Israel.;Clalit Health Care Services, Tel Aviv, Israel.;Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel.;Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel.;Institute of Endocrinology, Rabin Medical Center, Beilinson Hospital, 4941492, Petach Tikva, Israel.;Institute of Endocrinology, Rabin Medical Center, Beilinson Hospital, 4941492, Petach Tikva, Israel.",
"authors": "Akirov|Amit|A|http://orcid.org/0000-0002-9376-344X;Greenman|Yona|Y|;Glaser|Benjamin|B|;S'chigol|Irena|I|;Mansiterski|Yossi|Y|;Eizenberg|Yoav|Y|;Shraga-Slutzky|Ilana|I|;Shimon|Ilan|I|",
"chemical_list": "D018491:Dopamine Agonists; D004873:Ergolines; D007334:Insulin-Like Growth Factor I; D000077465:Cabergoline",
"country": "United States",
"delete": false,
"doi": "10.1007/s11102-018-0891-5",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1386-341X",
"issue": "21(4)",
"journal": "Pituitary",
"keywords": "Acromegaly; Dopamine agonist; IGF-1; Prolactinoma",
"medline_ta": "Pituitary",
"mesh_terms": "D000172:Acromegaly; D000236:Adenoma; D000328:Adult; D000368:Aged; D000077465:Cabergoline; D018491:Dopamine Agonists; D004873:Ergolines; D005260:Female; D006801:Humans; D007334:Insulin-Like Growth Factor I; D008297:Male; D008875:Middle Aged; D015175:Prolactinoma",
"nlm_unique_id": "9814578",
"other_id": null,
"pages": "406-413",
"pmc": null,
"pmid": "29728863",
"pubdate": "2018-08",
"publication_types": "D016428:Journal Article",
"references": "20857059;20887127;14602782;19945024;10221989;25356808;25253414;6261917;16886971;19033371;6149116;27855229;21296991;11200946;12824861;17167139",
"title": "IGF-1 levels may increase paradoxically with dopamine agonist treatment for prolactinomas.",
"title_normalized": "igf 1 levels may increase paradoxically with dopamine agonist treatment for prolactinomas"
} | [
{
"companynumb": "IL-MYLANLABS-2018M1055762",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CABERGOLINE"
},
"drugadditional": "1",
... |
{
"abstract": "The objective of this study was to report the tolerability and toxicity of a regimen consisting of intravenous (IV) docetaxel and intraperitoneal (IP) cisplatin and paclitaxel with granulocyte colony-stimulating factor support.\n\n\n\nWe conducted a retrospective cohort study of patients with surgical stage II-IV epithelial ovarian, fallopian tube or primary peritoneal carcinoma treated with an outpatient IP chemotherapy regimen consisting of docetaxel 75 mg/m IV and cisplatin 75 mg/m IP day 1 followed by paclitaxel 60 mg/m IP day 8 every 21 days. Grade 3 and 4 toxicity, dose delays and reductions, port complications, and tolerability are reported. Outcomes, including response rate, progression-free survival (PFS), overall survival (OS) are also reported.\n\n\n\nA total of 60 patients received this IP regimen. Most common toxicities included neutropenia (47%), gastrointestinal (28%), and anemia (25%). Most patients (85%) experienced no IP port complications. Dose delay or reduction was required in 30% of patients. Two-thirds completed all prescribed cycles, with 80% of total planned cycles completed. Complete response was achieved for 88%, and 43% are currently without evidence of disease. Median PFS for all patients was 25.5 months (95% confidence interval [CI], 20.4-30.5 mo) while OS for all patients was 56.8 months (95% CI, 47.7-65.9 mo). For the 44 patients with stage III disease, median PFS was 22.1 months (95% CI, 16.3-28.0 mo), while median OS was 56.8 months (95% CI, 47.3-66.3 mo).\n\n\n\nThis docetaxel-based IP chemotherapy regimen demonstrates an improved tolerability profile compared with GOG172. Additional evaluations on alternative IP regimens remain warranted. Short follow-up time limits survival assessment, but results are encouraging.",
"affiliations": "Department of Obstetrics & Gynecology.;Division of Gynecologic Oncology, University of Alabama at Birmingham, Birmingham, AL.;Division of Gynecologic Oncology, University of Alabama at Birmingham, Birmingham, AL.;Department of Obstetrics & Gynecology.;Division of Gynecologic Oncology, University of Alabama at Birmingham, Birmingham, AL.",
"authors": "Becker|David A|DA|;Leath|Charles A|CA|;Walters-Haygood|Christen L|CL|;Smith|Brentley Q|BQ|;Bevis|Kerri S|KS|",
"chemical_list": "D000077143:Docetaxel; D017239:Paclitaxel; D002945:Cisplatin",
"country": "United States",
"delete": false,
"doi": "10.1097/COC.0000000000000468",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0277-3732",
"issue": "42(1)",
"journal": "American journal of clinical oncology",
"keywords": null,
"medline_ta": "Am J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D002945:Cisplatin; D018572:Disease-Free Survival; D000077143:Docetaxel; D005185:Fallopian Tube Neoplasms; D005260:Female; D006801:Humans; D008875:Middle Aged; D010051:Ovarian Neoplasms; D017239:Paclitaxel; D010534:Peritoneal Neoplasms; D016896:Treatment Outcome",
"nlm_unique_id": "8207754",
"other_id": null,
"pages": "12-16",
"pmc": null,
"pmid": "29782365",
"pubdate": "2019-01",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "24457572;11161372;29186319;8960474;19767092;19110303;11181662;15590954;18336395;16394300;15547181;11600607;26933849;16368440;22330607;19201457;23948349;28055103;22017885",
"title": "Utilization of an Alternative Docetaxel-based Intraperitoneal Chemotherapy Regimen in Patients With Ovarian, Fallopian Tube or Primary Peritoneal Carcinoma: A Continued Need for Ovarian Cancer Patients.",
"title_normalized": "utilization of an alternative docetaxel based intraperitoneal chemotherapy regimen in patients with ovarian fallopian tube or primary peritoneal carcinoma a continued need for ovarian cancer patients"
} | [
{
"companynumb": "US-TEVA-2019-US-1027067",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nLidocaine is an effective therapy for neonatal seizures; however, it is not widely used, presumably due to the risk of cardiac events.\n\n\nOBJECTIVE\nTo investigate the incidence of cardiac events in full-term and preterm infants receiving lidocaine for seizures.\n\n\nMETHODS\nFull-term (n = 368) and preterm (n = 153) infants, admitted to a level 3 neonatal intensive care unit from 1992 to 2012, who received lidocaine for seizures were retrospectively studied. The causal relation between reported cardiac events and lidocaine administration was evaluated based on expected plasma concentrations, symptoms and relevant interactions during cardiac events.\n\n\nRESULTS\nCardiac events were reported in 11/521 infants (2.1%; 9 full-term, 2 preterm). In 7/11 infants the causal relation was considered plausible, in 3/11 questionable and in 1/11 implausible. The incidence was calculated to be 1.3-1.9% (n = 7-10/521), but was only 0.4% (n = 1/246, p = 0.02) when using reduced-dose regimens. Important risk factors for cardiac events were unstable potassium, (congenital) cardiac dysfunction and concurrent phenytoin use.\n\n\nCONCLUSIONS\nLidocaine-associated cardiac events were rare in our cohort, especially since the introduction of new reduced-dose regimens. This indicates that lidocaine is safe to use as an antiepileptic drug in full-term and preterm infants.",
"affiliations": "Department of Neonatology, Wilhelmina Children's Hospital, University Medical Centre Utrecht, Utrecht, The Netherlands.",
"authors": "Weeke|Lauren C|LC|;Schalkwijk|Stein|S|;Toet|Mona C|MC|;van Rooij|Linda G M|LG|;de Vries|Linda S|LS|;van den Broek|Marcel P H|MP|",
"chemical_list": "D000927:Anticonvulsants; D008012:Lidocaine",
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000430767",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1661-7800",
"issue": "108(2)",
"journal": "Neonatology",
"keywords": null,
"medline_ta": "Neonatology",
"mesh_terms": "D000927:Anticonvulsants; D001724:Birth Weight; D001919:Bradycardia; D016208:Databases, Factual; D005260:Female; D005865:Gestational Age; D006339:Heart Rate; D006801:Humans; D007035:Hypothermia; D007231:Infant, Newborn; D007234:Infant, Premature; D007363:Intensive Care Units, Neonatal; D008012:Lidocaine; D008297:Male; D009426:Netherlands; D012189:Retrospective Studies; D012307:Risk Factors; D012640:Seizures; D047929:Term Birth",
"nlm_unique_id": "101286577",
"other_id": null,
"pages": "130-6",
"pmc": null,
"pmid": "26111505",
"pubdate": "2015",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Lidocaine-Associated Cardiac Events in Newborns with Seizures: Incidence, Symptoms and Contributing Factors.",
"title_normalized": "lidocaine associated cardiac events in newborns with seizures incidence symptoms and contributing factors"
} | [
{
"companynumb": "NL-FRESENIUS KABI-FK201600271",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PHENYTOIN"
},
"drugadditional": null,
... |
{
"abstract": "Infectious complications represent an important cause of morbidity and death in patients with transplant. Parasitic infections are less frequent than viral and bacterial agents, and are often overlooked. We describe the case of a 13-year-old adolescent, born in São Tomé Island, who was under immunosuppressive therapy after a cardiac transplant. The patient had an intermittent course of diarrhoea, abdominal pain and vomiting. She was admitted dehydrated, and Strongyloides stercoralis, Schistosoma intercalatum and Cystoisospora belli were isolated in her stools. The patient was treated with ivermectin, albendazole, praziquantel and ciprofloxacin with clinical and microbiological resolution. Her immunosuppressive therapy was reduced during hospitalisation. We believe that the parasitic infection was a result of a recrudescence of dormant infections acquired in her homeland. To the best of our knowledge, there are no reports of cystoisosporiasis or schistosomiasis in heart transplant recipients.",
"affiliations": "Department of Pediatrics, Hospital Garcia de Orta, Almada, Portugal.;Department of Pediatrics, Hospital Espírito Santo, Évora, Portugal.;Department of Pediatric Cardiology, Hospital Santa Cruz, Lisbon, Portugal.;Department of Pediatric Cardiology, Hospital Santa Cruz, Lisbon, Portugal.",
"authors": "Sanches|Bruno Fernandes|BF|;Morgado|Joana|J|;Carvalho|Nuno|N|;Anjos|Rui|R|",
"chemical_list": "D000871:Anthelmintics; D011223:Praziquantel; D007559:Ivermectin; D015766:Albendazole",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2015()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D015746:Abdominal Pain; D000293:Adolescent; D015766:Albendazole; D000818:Animals; D000871:Anthelmintics; D003967:Diarrhea; D005243:Feces; D005260:Female; D016027:Heart Transplantation; D006801:Humans; D007559:Ivermectin; D011223:Praziquantel; D012547:Schistosoma; D012552:Schistosomiasis; D017171:Strongyloides stercoralis; D013322:Strongyloidiasis; D066027:Transplant Recipients; D016896:Treatment Outcome; D014839:Vomiting",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "26109619",
"pubdate": "2015-06-24",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "18983416;16941042;18954367;14726461;19302281;17610082;17580223;21504049;16315308;8863042;17953900;17605735;19807271;15261189;22691685;16249752;19357635;17662320;17594646;21504529;17940124;18094380;15689061;18089421;16297809;9436132;14700588",
"title": "Multiple parasitic infections in a cardiac transplant recipient.",
"title_normalized": "multiple parasitic infections in a cardiac transplant recipient"
} | [
{
"companynumb": "PT-MYLANLABS-2015M1047845",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "EVEROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "Pregabalin is a novel anticonvulsive and analgesic drug that has been marketed in Europe for more than a year. The typical side effects are dizziness, somnolence and weight gain. We present a patient who, after unintended rapid up-titration of pregabalin, experienced psychotic symptoms associated with rhythmic EEG-changes resolving completely after discontinuation of pregabalin and benzodiazepine administration.",
"affiliations": "Department of Neurology, University Hospitals Münster, Albert-Schweitzer-Street 33, 48149 Münster, Germany.",
"authors": "Olaizola|Itziar|I|;Ellger|Tanja|T|;Young|Peter|P|;Bösebeck|Frank|F|;Evers|Stefan|S|;Kellinghaus|Christoph|C|",
"chemical_list": "D000927:Anticonvulsants; D000069583:Pregabalin; D005680:gamma-Aminobutyric Acid",
"country": "England",
"delete": false,
"doi": "10.1016/j.seizure.2006.02.004",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1059-1311",
"issue": "15(3)",
"journal": "Seizure",
"keywords": null,
"medline_ta": "Seizure",
"mesh_terms": "D000208:Acute Disease; D000328:Adult; D000927:Anticonvulsants; D004305:Dose-Response Relationship, Drug; D004569:Electroencephalography; D005260:Female; D006801:Humans; D009128:Muscle Spasticity; D000069583:Pregabalin; D011605:Psychoses, Substance-Induced; D005680:gamma-Aminobutyric Acid",
"nlm_unique_id": "9306979",
"other_id": null,
"pages": "208-10",
"pmc": null,
"pmid": "16530431",
"pubdate": "2006-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Pregabalin-associated acute psychosis and epileptiform EEG-changes.",
"title_normalized": "pregabalin associated acute psychosis and epileptiform eeg changes"
} | [
{
"companynumb": "DE-PFIZER INC-2019442557",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREGABALIN"
},
"drugadditional": "1",
... |
{
"abstract": "Dipeptidyl peptidase 4 (DPP-4) inhibitors are increasingly used these days in management of diabetes. There has been reported in a few case reports of increasing association between DPP-4 inhibitor use and bullous pemphigoid (BP). We report a case of association between linagliptin use and BP and subsequent treatment with rituximab.",
"affiliations": "Internal Medicine, Marshfield Clinic, Eau Claire, Wisconsin, USA.;Ascension Health Care, Dermatology, Stevens Point, Wisconsin, USA.;Oncology, Marshfield Clinic Weston Center, Weston, Wisconsin, USA.",
"authors": "Mani|Hariharasudan|H|http://orcid.org/0000-0003-4591-7202;Safo|Patrick|P|;Onitilo|Adedayo A|AA|",
"chemical_list": "D000900:Anti-Bacterial Agents; D054873:Dipeptidyl-Peptidase IV Inhibitors; D000069476:Linagliptin; D000069283:Rituximab; D002990:Clobetasol; D008911:Minocycline; D011241:Prednisone",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2019-229902",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "12(9)",
"journal": "BMJ case reports",
"keywords": "contraindications and precautions; dermatology; drug interactions; endocrine system",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000368:Aged; D000900:Anti-Bacterial Agents; D002990:Clobetasol; D054873:Dipeptidyl-Peptidase IV Inhibitors; D003875:Drug Eruptions; D006801:Humans; D000069476:Linagliptin; D008297:Male; D008911:Minocycline; D010391:Pemphigoid, Bullous; D011241:Prednisone; D000069283:Rituximab; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "31570343",
"pubdate": "2019-09-30",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "19566661;29920976;28520234;26465961;20682680;26820308;21527361;22519906;28762465;27714780;8710911;17981653;23969034;10677092;20944650;21605808;21923615;29563098;30002201;23475323;30090931;29682739;18606664;29881377;23960039;27868192",
"title": "Linagliptin-associated bullous pemphigoid treated with rituximab.",
"title_normalized": "linagliptin associated bullous pemphigoid treated with rituximab"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-290007",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CLOBETASOL"
},
"drug... |
{
"abstract": "To examine idarucizumab use via the emergency department (ED), Christchurch Hospital; adherence to Hospital Medicines List (HML) criteria, licensed dosing and local coagulation monitoring guidelines.\n\n\n\nAll patients given idarucizumab were recorded over three months. Data collected included demographics, coagulation tests, dabigatran dosing and timing of idarucizumab administration.\n\n\n\nTwelve patients received idarucizumab. The median age (range) was 73 (56-83) years and male:female was 4:8. HML criteria were met in 11 patients. Eleven patents had idarucizumab administered within licence. Coagulation tests were taken pre-idarucizumab in all patients and post-idarucizumab in eight patients. The median thrombin clotting times pre- and post-idarucizumab were 153 and 16 seconds respectively.\n\n\n\nThe indications for idarucizumab use were within HML criteria and administration was as per licensed dosing regimen in 11 of 12 patients. Appropriate monitoring of coagulation parameters was carried out in all patients as per local guidelines prior to idarucizumab administration, and thrombin clotting times pre and post were as expected for all but one patient.",
"affiliations": "Pharmacist, Emergency Department, Christchurch Hospital, Christchurch.;Clinical Pharmacist, Pharmacy Department, Christchurch Hospital, Christchurch.",
"authors": "Sowerby|Louisa J|LJ|;Vella-Brincat|Jane|J|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C000594745:idarucizumab",
"country": "New Zealand",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-8446",
"issue": "132(1499)",
"journal": "The New Zealand medical journal",
"keywords": null,
"medline_ta": "N Z Med J",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D061067:Antibodies, Monoclonal, Humanized; D001281:Atrial Fibrillation; D001780:Blood Coagulation Tests; D004632:Emergency Medical Services; D004636:Emergency Service, Hospital; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009520:New Zealand; D017410:Practice Guidelines as Topic; D020246:Venous Thrombosis",
"nlm_unique_id": "0401067",
"other_id": null,
"pages": "18-22",
"pmc": null,
"pmid": "31352470",
"pubdate": "2019-07-26",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Three-month use of idarucizumab at Christchurch Hospital through the emergency department and MedChartTM.",
"title_normalized": "three month use of idarucizumab at christchurch hospital through the emergency department and medcharttm"
} | [
{
"companynumb": "GB-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2019-BI-032253",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "BACKGROUND\nDirect oral anticoagulants are commonly used instead of vitamin K antagonists in patients needing long-term anticoagulant treatment. As their use has become more popular, there is an increase possibility to perform a major surgery on an urgent or emergency basis on patients under nonvitamin-K antagonist oral anticoagulants.\n\n\nMETHODS\nWe report a case of a ruptured abdominal aortic aneurysm on a male patient under rivaroxaban and clopidogrel. Emergency open repair of the aneurysm was performed. No anti-Xa antidote was administered. The patient had an uneventful recovery.\n\n\nCONCLUSIONS\nAn open repair of a ruptured abdominal aortic aneurysm under rivaroxaban is feasible. However, an antidote should be available in cases of uncontrolled diffused bleeding. To the best of our knowledge, this is the first reported case of successful open repair of a ruptured abdominal aortic aneurysm on a patient under rivaroxaban and clopidogrel.",
"affiliations": "Vascular Surgery Department, Attikon University Hospital, National and Kapodistrian University of Athens, Athens, Greece.;Vascular Surgery Department, Attikon University Hospital, National and Kapodistrian University of Athens, Athens, Greece.;Vascular Surgery Department, Attikon University Hospital, National and Kapodistrian University of Athens, Athens, Greece.;Vascular Surgery Department, Attikon University Hospital, National and Kapodistrian University of Athens, Athens, Greece. Electronic address: andreaslazaris@hotmail.com.",
"authors": "Poulou|Aikaterini|A|;Alexiou|Evangelos|E|;Geroulakos|George|G|;Lazaris|Andreas M|AM|",
"chemical_list": "D065427:Factor Xa Inhibitors; D010975:Platelet Aggregation Inhibitors; D000069552:Rivaroxaban; D000077144:Clopidogrel",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.avsg.2018.09.042",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0890-5096",
"issue": "58()",
"journal": "Annals of vascular surgery",
"keywords": null,
"medline_ta": "Ann Vasc Surg",
"mesh_terms": "D017544:Aortic Aneurysm, Abdominal; D001019:Aortic Rupture; D001027:Aortography; D001807:Blood Vessel Prosthesis; D019917:Blood Vessel Prosthesis Implantation; D000077144:Clopidogrel; D000072226:Computed Tomography Angiography; D004334:Drug Administration Schedule; D004630:Emergencies; D065427:Factor Xa Inhibitors; D006801:Humans; D008297:Male; D008875:Middle Aged; D009203:Myocardial Infarction; D062645:Percutaneous Coronary Intervention; D010975:Platelet Aggregation Inhibitors; D000069552:Rivaroxaban; D016896:Treatment Outcome",
"nlm_unique_id": "8703941",
"other_id": null,
"pages": "379.e5-379.e8",
"pmc": null,
"pmid": "30684617",
"pubdate": "2019-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Open Repair of a Ruptured Abdominal Aortic Aneurysm on a Patient Under Rivaroxaban and Clopidogrel.",
"title_normalized": "open repair of a ruptured abdominal aortic aneurysm on a patient under rivaroxaban and clopidogrel"
} | [
{
"companynumb": "GR-MYLANLABS-2019M1122141",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RIVAROXABAN"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nRhabdomyosarcoma (RMS) occasionally occurs in a context of a predisposition syndrome. The most common predisposition syndromes include germline TP53 mutations and constitutive alterations in RAS pathway activation, such as Costello syndrome, Noonan syndrome and neurofibromatosis type 1. We report a national retrospective series of 16 RMS occurring in neurofibromatosis type 1 (NF1) patients during childhood, within a 20-year period.\n\n\nRESULTS\nThe mean age at diagnosis of the cancer was 2.5 years. All were embryonal subtype. Most tumours developed in the pelvis. One was metastatic. Chemotherapy and radiotherapy were normally scheduled without any specific toxicity. The 5-year event-free survival and overall survival were 67% and 87%, respectively. Long-term sequel related to chemotherapy consisted in two chronic tubulopathies, hence not obviously different from non-NF1 patients. No second cancer was reported so far with a median follow-up of 9.7 years. The genomic analysis performed on six samples revealed the abnormalities commonly observed in sporadic RMS: gain of chromosome 2 (5/6), 8 (6/6) and chromosome 11p loss of heterozygosity (5/6). Interestingly, we identified small deletions in tumour suppressor genes that may synergize with NF1 inactivation.\n\n\nCONCLUSIONS\nPatients with neurofibromatosis are prone to develop embryonal-type RMS that require the same treatment as sporadic cases.",
"affiliations": "Hopital Necker Enfants-Malades, Service de Reanimation pédiatrique, Paris, France.;INSERMU830, Laboratoire de génétique et biologie des cancers, Institut Curie, Paris, France.;Département d'Oncologie de l'Enfant et l'Adolescent, Institut Gustave Roussy, Villejuif, France.;Institut d'hemato-oncologiePediatrique, Centre Léon Berard, Lyon, France.;CHU de Rouen,, Service d'hémato-oncologie pédiatrique, Rouen, France.;CHU de Saint-Etienne, Service d'hémato-oncologie pédiatrique, Saint-Etienne, France.;CHU de Grenoble, Service d'hémato-oncologie pédiatrique, Grenoble, France.;CHU d'Amiens, Service d'hémato-oncologie pédiatrique, Amiens, France.;CHU de Nantes, Service d'hémato-oncologie pédiatrique, Nantes, France.;Registre national des tumeurs solides de l'enfant, CESP INSERM, Vandoeuvre-les-Nancy, France.;Département d'Oncologie de l'Enfant et l'Adolescent, Institut Gustave Roussy, Villejuif, France.;Université Paris Rene Descartes, Paris, France.;Centre Leon Berard, Service d'anatomie Pathologique, Lyon, France.;INSERMU830, Laboratoire de génétique et biologie des cancers, Institut Curie, Paris, France.;INSERMU830, Laboratoire de génétique et biologie des cancers, Institut Curie, Paris, France.",
"authors": "Crucis|Anne|A|;Richer|Wilfrid|W|;Brugières|Laurence|L|;Bergeron|Christophe|C|;Marie-Cardine|Aude|A|;Stephan|Jean-Louis|JL|;Girard|Pauline|P|;Corradini|Nadege|N|;Munzer|Martine|M|;Lacour|Brigitte|B|;Minard-Colin|Veronique|V|;Sarnacki|Sabine|S|;Ranchere-Vince|Dominique|D|;Orbach|Daniel|D|;Bourdeaut|Franck|F|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1002/pbc.25556",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1545-5009",
"issue": "62(10)",
"journal": "Pediatric blood & cancer",
"keywords": "NF1; neurofibromatosis; predisposition; rhabdomyosarcoma",
"medline_ta": "Pediatr Blood Cancer",
"mesh_terms": "D002675:Child, Preschool; D015331:Cohort Studies; D018572:Disease-Free Survival; D005260:Female; D006801:Humans; D007223:Infant; D053208:Kaplan-Meier Estimate; D008297:Male; D009456:Neurofibromatosis 1; D012189:Retrospective Studies; D020133:Reverse Transcriptase Polymerase Chain Reaction; D012208:Rhabdomyosarcoma",
"nlm_unique_id": "101186624",
"other_id": null,
"pages": "1733-8",
"pmc": null,
"pmid": "25893277",
"pubdate": "2015-10",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Rhabdomyosarcomas in children with neurofibromatosis type I: A national historical cohort.",
"title_normalized": "rhabdomyosarcomas in children with neurofibromatosis type i a national historical cohort"
} | [
{
"companynumb": "FR-TEVA-595317ISR",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EPIRUBICIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "Cyanide toxicity is a rare complication of sodium nitroprusside that can be difficult to diagnose in critically ill patients. We describe a case of cyanide toxicity after cardiac surgery that presented as lactic acidosis after discontinuation of nitroprusside.",
"affiliations": "Anesthesiology Institute, Cleveland Clinic, Cleveland, Ohio. Electronic address: udehc@ccf.org.;Anesthesiology Institute, Cleveland Clinic, Cleveland, Ohio.;Department of Pharmacy, Cleveland Clinic, Cleveland, Ohio.;Department of Cardiovascular Surgery, Cleveland Clinic, Cleveland, Ohio.",
"authors": "Udeh|Chiedozie I|CI|;Ting|Michael|M|;Arango|Matthew|M|;Mick|Stephanie|S|",
"chemical_list": "D003486:Cyanides; D009599:Nitroprusside",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-4975",
"issue": "99(4)",
"journal": "The Annals of thoracic surgery",
"keywords": null,
"medline_ta": "Ann Thorac Surg",
"mesh_terms": "D000140:Acidosis, Lactic; D058186:Acute Kidney Injury; D000368:Aged; D006348:Cardiac Surgical Procedures; D016638:Critical Illness; D003486:Cyanides; D057210:Delayed Diagnosis; D003937:Diagnosis, Differential; D004305:Dose-Response Relationship, Drug; D005260:Female; D005500:Follow-Up Studies; D006333:Heart Failure; D006801:Humans; D007262:Infusions, Intravenous; D009599:Nitroprusside; D006435:Renal Dialysis; D018570:Risk Assessment; D012720:Severity of Illness Index; D016896:Treatment Outcome",
"nlm_unique_id": "15030100R",
"other_id": null,
"pages": "1432-4",
"pmc": null,
"pmid": "25841829",
"pubdate": "2015-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Delayed presentation of nitroprusside-induced cyanide toxicity.",
"title_normalized": "delayed presentation of nitroprusside induced cyanide toxicity"
} | [
{
"companynumb": "US-MYLANLABS-2015M1015932",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SODIUM NITROPRUSSIDE"
},
"drugadditional": n... |
{
"abstract": "Verapamil intoxication is a life-threatening condition that often presents with severe hemodynamic instability and requires vasopressor support. There are also documented case reports of the development of non-cardiogenic pulmonary oedema after verapamil overdose. However, the exact mechanisms responsible for pulmonary oedema remain unclear. Here, we describe a 36-year-old woman who was admitted to the intensive care unit after ingesting high-dose verapamil and subsequently developed acute respiratory distress syndrome soon after hemodynamic stabilization. Possible mechanisms are presented after taking into account findings in the current literature. Acute respiratory distress syndrome should be considered early during the evaluation of patients with verapamil intoxication.",
"affiliations": null,
"authors": "Izdes|S|S|;Altintas|N D|ND|;Soykut|C|C|",
"chemical_list": "D014700:Verapamil",
"country": "England",
"delete": false,
"doi": "10.1179/2295333714Y.0000000007",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1784-3286",
"issue": "69(2)",
"journal": "Acta clinica Belgica",
"keywords": "Adult respiratory distress syndrome; Intoxication,; Verapamil,",
"medline_ta": "Acta Clin Belg",
"mesh_terms": "D000328:Adult; D062787:Drug Overdose; D005260:Female; D006801:Humans; D008297:Male; D012128:Respiratory Distress Syndrome; D014700:Verapamil; D055815:Young Adult",
"nlm_unique_id": "0370306",
"other_id": null,
"pages": "116-9",
"pmc": null,
"pmid": "24724751",
"pubdate": "2014-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Acute respiratory distress syndrome after verapamil intoxication: case report and literature review.",
"title_normalized": "acute respiratory distress syndrome after verapamil intoxication case report and literature review"
} | [
{
"companynumb": "PHHY2014TR077896",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "VERAPAMIL HYDROCHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "Cognitive, affective, and sleep disturbances can be found in patients with Huntington's disease (HD), and medications used to treat these HD-related sequela can also impact HD-related movement disorders. We present the case of a 52-year-old Caucasian man with previously undiagnosed HD who exhibited significant choreoathetoid movements that improved with discontinuation of fluoxetine and lisdexamfetamine upon hospital admission. Following diagnosis of HD through genetic testing, he was administered 5mg of oral melatonin on two consecutive evenings, which resulted in worsening choreoathetosis. We calculated Naranjo adverse event scores of 5, 5, and 2 for fluoxetine, lisdexamfetamine, and melatonin, respectively, based on our assessment, review of outpatient medical records, and available literature. We review the literature surrounding these possible adverse drug events and their mechanisms regarding dopaminergic modulation in early-middle stages of HD. Our report indicates that caution should be exercised when initiating psychostimulants, fluoxetine, and melatonin in patients with early-middle stage HD. Screening for HD might be warranted for patients who develop choreoathetosis after initiation of the aforementioned medications. We recommend ascertaining baseline level of chorea before initiating these medications in patients with known HD and closely monitoring for exacerbation during therapy.",
"affiliations": "Dr. Hamilton is with the Department of Pharmacy, Veteran's Affairs Montana Medical Center-Fort Harrison, in Helena, Montana.;Dr. Hamilton is with the Department of Pharmacy, Veteran's Affairs Montana Medical Center-Fort Harrison, in Helena, Montana.;Dr. Hamilton is with the Department of Pharmacy, Veteran's Affairs Montana Medical Center-Fort Harrison, in Helena, Montana.;Dr. Hamilton is with the Department of Pharmacy, Veteran's Affairs Montana Medical Center-Fort Harrison, in Helena, Montana.;Dr. Hamilton is with the Department of Pharmacy, Veteran's Affairs Montana Medical Center-Fort Harrison, in Helena, Montana.",
"authors": "Hamilton|Clayton J|CJ|;Timmer|Tysen K|TK|;Munjal|Robert C|RC|;Cardozo-Pelaez|Fernando|F|;Mcgrane|Ian R|IR|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2158-8333",
"issue": "15(7-8)",
"journal": "Innovations in clinical neuroscience",
"keywords": "Fluoxetine; Huntington’s disease; amphetamine; antidepressant; chorea; dopamine; melatonin; psychostimulant",
"medline_ta": "Innov Clin Neurosci",
"mesh_terms": null,
"nlm_unique_id": "101549695",
"other_id": null,
"pages": "27-31",
"pmc": null,
"pmid": "30254797",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "9159735;20972477;23340221;11205429;17903675;9839535;23847463;24509309;11176966;8458085;24968783;20686158;7249508;21861097;12649776;6656879;22397915;22883290;18394562;18658080;17066255;2935747;26185277;17178819",
"title": "Worsening Choreoathetosis in Huntington's Disease with Fluoxetine, Lisdexamfetamine, and Melatonin: A Case Report.",
"title_normalized": "worsening choreoathetosis in huntington s disease with fluoxetine lisdexamfetamine and melatonin a case report"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/19/0106741",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "MELATONIN"
},
"drugadditional": "1",
... |
{
"abstract": "OBJECTIVE\nThe study aimed to evaluate the effects of inhaled iloprost on oxygenation indices in neonates with persistent pulmonary hypertension of the newborn (PPHN).\n\n\nMETHODS\nWe conducted a retrospective chart review of 30 patients with PPHN from January 2014 to November 2018, who did not respond to inhaled nitric oxide (iNO) alone and received inhaled iloprost. Twenty-two patients met the inclusion criteria and eight patients were excluded from the study (complex cardiac disease and extreme prematurity). Patients were categorized as responders or nonresponders (patients who required extracorporeal membrane oxygenation or died). Oxygenation index, mean airway pressure (MAP), and arterial partial pressure of oxygen (PaO2) were recorded.\n\n\nRESULTS\nAmong a total of 22 patients who were included in the study, 10 were classified as nonresponders as they required either extracorporeal membrane oxygenation or died. Gestational age and gender did not differ between responders and nonresponders. The median PaO2 was lower (37 vs. 42 mm Hg; p < 0.05) and median MAP was higher (20 vs. 17 cm H2O; p < 0.02) in nonresponders compared with responders just prior to initiating iloprost. Iloprost responders had a significant increase in median PaO2 and decrease in median oxygenation index in the 24 hours after initiating treatment (p < 0.05), with no significant change in required mean airway pressure over that same period. There was no change in vasopressor use or clinically significant worsening of platelets count, liver, and kidney functions after initiating iloprost.\n\n\nCONCLUSIONS\nInhaled iloprost is well tolerated and seems to have beneficial effects in improving oxygenation indices in neonates with PPHN who do not respond to iNO. There is a need of well-designed prospective trials to further ascertain the benefits of using inhaled iloprost as an adjunct treatment in neonates with PPHN who do not respond to iNO alone.\n\n\nCONCLUSIONS\n· Inhaled iloprost seems to have beneficial effects in improving oxygenation indices in PPHN.. · Inhaled iloprost is generally well tolerated in newborns with PPHN.. · There is a need for prospective RCTs to further ascertain the benefits of using inhaled iloprost..",
"affiliations": "Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Department of Pediatrics, NYU Grossman School of Medicine, New York, New York.;Division of Neonatology, Departments of Pediatrics and Molecular Medicine, University of South Florida, Tampa, Florida.",
"authors": "Verma|Sourabh|S|0000-0002-5584-7773;Lumba|Rishi|R|;Kazmi|Sadaf H|SH|;Vaz|Michelle J|MJ|;Prakash|Shrawani Soorneela|SS|;Bailey|Sean M|SM|;Mally|Pradeep V|PV|;Randis|Tara M|TM|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1055/s-0040-1722653",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0735-1631",
"issue": null,
"journal": "American journal of perinatology",
"keywords": null,
"medline_ta": "Am J Perinatol",
"mesh_terms": null,
"nlm_unique_id": "8405212",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33477175",
"pubdate": "2021-01-21",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Effects of Inhaled Iloprost for the Management of Persistent Pulmonary Hypertension of the Newborn.",
"title_normalized": "effects of inhaled iloprost for the management of persistent pulmonary hypertension of the newborn"
} | [
{
"companynumb": "US-JNJFOC-20210228033",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ILOPROST"
},
"drugadditional": null,
"d... |
{
"abstract": "A 63-year-old man with chronic myelomonocytic leukemia was admitted to our hospital with miliary tuberculosis. He received anti-tuberculosis drugs: isoniazid (INH), rifampicin (RFP), ethambutol (EB), and pyrazinamide (PZA). His condition clearly and immediately improved after the therapy, but he experienced a high fever of about 38°C every day from 1 month after the initiation of the therapy. Drug-induced fever and tumor fever were suspected as causes, but the etiology could not be determined. The tuberculosis was identified as an INH-resistant strain, so INH was stopped and levofloxacin (LVFX) was introduced, with streptomycin (SM), in addition to RFP, EB, and PZA. At 2 months after the initiation of the therapy (about one week after the change in the anti-tuberculosis drug regimen), his spinal fluid was examined, given his complaints of headache and vomiting. The spinal fluid analysis revealed invasion of lymphocytic inflammatory cells and high adenosine deaminase activity; the patient was thus diagnosed with tuberculous meningitis. His condition gradually improved after the changing of the anti-tuberculosis drugs. Thus, to summarize, the tuberculous meningitis had worsened paradoxically despite his systemic improvement, although it was successfully treated by the addition of LVFX and SM. We must keep in mind that a potential cause of fever during anti-tuberculosis therapy may be INH-resistant tuberculous meningitis.",
"affiliations": "Department of Respiratory Medicine, National Hospital Organization Omuta National Hospital, 1044-1 Tachibana, Omuta, Fukuoka 837-0911, Japan. ikegame-s@oomuta-h.com",
"authors": "Ikegame|Satoshi|S|;Wakamatsu|Kentaro|K|;Fujita|Masaki|M|;Nakanishi|Yoichi|Y|;Harada|Mine|M|;Kajiki|Akira|A|",
"chemical_list": "D000995:Antitubercular Agents; D007538:Isoniazid",
"country": "Netherlands",
"delete": false,
"doi": "10.1007/s10156-011-0218-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1341-321X",
"issue": "17(5)",
"journal": "Journal of infection and chemotherapy : official journal of the Japan Society of Chemotherapy",
"keywords": null,
"medline_ta": "J Infect Chemother",
"mesh_terms": "D000995:Antitubercular Agents; D002555:Cerebrospinal Fluid; D024881:Drug Resistance, Bacterial; D006801:Humans; D007538:Isoniazid; D015477:Leukemia, Myelomonocytic, Chronic; D008297:Male; D008826:Microbial Sensitivity Tests; D008875:Middle Aged; D009169:Mycobacterium tuberculosis; D014390:Tuberculosis, Meningeal; D014391:Tuberculosis, Miliary",
"nlm_unique_id": "9608375",
"other_id": null,
"pages": "689-93",
"pmc": null,
"pmid": "21327690",
"pubdate": "2011-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A case of isoniazid-resistant miliary tuberculosis in which tuberculous meningitis paradoxically developed despite systemic improvement.",
"title_normalized": "a case of isoniazid resistant miliary tuberculosis in which tuberculous meningitis paradoxically developed despite systemic improvement"
} | [
{
"companynumb": "PHHY2018JP016955",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ETHAMBUTOL HYDROCHLORIDE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nThe majority of nontyphoid Salmonella infection is identified in children. When an invasive or severe Salmonella infection is encountered, ceftriaxone is recommended for such patients. A 2-year-old girl was hospitalized for the treatment of Salmonella bacteremia and discharged with standard ceftriaxone treatment. She was readmitted to the hospital after 2 days due to the recurrence of the Salmonella bacteremia. The study aimed to unveil the mechanism for the relapse.\n\n\nMETHODS\nSix isolates (4 blood and 2 stool) were recovered from the patient, with the last two blood isolates being ceftriaxone-resistant. Pulsed-field gel electrophoresis was used for genotyping. Ceftriaxone resistance genes and transferability of the resistance plasmid were examined by molecular methods.\n\n\nRESULTS\nAll isolates were identified as Salmonella enterica serotype Oranienburg. Five isolates demonstrated almost identical electrophoresis patterns, except that in the two ceftriaxone-resistant isolates an extra band (>100 kb) was noted. A blaCMY-2 gene, carried by a 120-kb conjugative IncI1 plasmid of the sequence type 53, was identified in the two ceftriaxone-resistant isolates. Transfer of the resistance plasmid from one blood isolate to Escherichia coli J53 resulted in the increase of ceftriaxone minimum inhibitory concentration from 0.125 μg/mL to 32 μg/mL in the recipient.\n\n\nCONCLUSIONS\nCeftriaxone is the standard therapeutic choice for invasive or serious Salmonella infections in children. Pediatricians should be aware of the possibility of resistance development during therapy, especially in areas with a widespread of ceftriaxone resistance genes that are carried by a self-transferrable plasmid, such as the blaCMY-2-carrying IncI1 plasmid identified herein.",
"affiliations": "Division of Pediatric Gastroenterology, Department of Pediatrics, Chang Gung Children's Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan.;Division of Pediatric Gastroenterology, Department of Pediatrics, Chang Gung Children's Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan.;Department of Laboratory Medicine, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan.;Molecular Infectious Disease Research Centre, Chang Gung Memorial Hospital, Taoyuan, Taiwan.;Department of Laboratory Medicine, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan; Molecular Infectious Disease Research Centre, Chang Gung Memorial Hospital, Taoyuan, Taiwan; Department of Medical Biotechnology and Laboratory Science, Chang Gung University College of Medicine, Taoyuan, Taiwan. Electronic address: sulinhui@gmail.com.;Molecular Infectious Disease Research Centre, Chang Gung Memorial Hospital, Taoyuan, Taiwan; Division of Pediatric Infectious Diseases, Department of Pediatrics, Chang Gung Children's Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan. Electronic address: chchiu@adm.cgmh.org.tw.",
"authors": "Yang|Wei-Chiun|WC|;Chan|Oi-Wa|OW|;Wu|Tsu-Lan|TL|;Chen|Chyi-Liang|CL|;Su|Lin-Hui|LH|;Chiu|Cheng-Hsun|CH|",
"chemical_list": "D000900:Anti-Bacterial Agents; D002443:Ceftriaxone",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1684-1182",
"issue": "49(1)",
"journal": "Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi",
"keywords": "Ceftriaxone resistance; IncI1 plasmid; Relapse bacteremia; Salmonella enterica serotype Oranienburg",
"medline_ta": "J Microbiol Immunol Infect",
"mesh_terms": "D000900:Anti-Bacterial Agents; D016470:Bacteremia; D002443:Ceftriaxone; D024881:Drug Resistance, Bacterial; D016521:Electrophoresis, Gel, Pulsed-Field; D005260:Female; D022761:Gene Transfer, Horizontal; D006801:Humans; D008826:Microbial Sensitivity Tests; D058889:Molecular Typing; D012008:Recurrence; D012480:Salmonella Infections; D019779:Salmonella enterica; D017211:Treatment Failure",
"nlm_unique_id": "100956211",
"other_id": null,
"pages": "41-5",
"pmc": null,
"pmid": "24657069",
"pubdate": "2016-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Development of ceftriaxone resistance in Salmonella enterica serotype Oranienburg during therapy for bacteremia.",
"title_normalized": "development of ceftriaxone resistance in salmonella enterica serotype oranienburg during therapy for bacteremia"
} | [
{
"companynumb": "TW-ROCHE-1715927",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CEFTRIAXONE"
},
"drugadditional": null,
"dru... |
{
"abstract": "Introduction: Our objective is to highlight the value of the neurophenomenological classification of complex visual hallucinations (VHs). This approach enabled the authors to successfully treat VHs of uncertain aetiology with cholinesterase inhibitors because the content of the hallucinations suggested dysfunction in cholinergic modulated networks.Methods: We utilise the single case report to describe the nature and content of chronic VHs experienced by a 49-year-old woman following a prolonged admission to ITU. Despite extensive investigation, no clear cause was identified for these hallucinations and the patient did not respond to rationalisation of medications or trials of antipsychotics. We therefore adopted the neurophenomenological approach to classifying and treating her VHs.Results: After several years of distressing visual hallucinations, a course of Rivastigmine was trialed despite no evidence suggestive of a Parkinsonian syndrome. Nevertheless, the patient reported a dose-effect response with significant reduction in the frequency and intensity of her hallucinations, almost to complete resolution.Conclusions: At present there is limited evidence about the medical management of visual hallucinations. This case report suggests that cholinesterase inhibitors may be of benefit, even in the absence of clear parkinsonsian features, if the form and content of the VHs suggest dysfunction in cholinergic modulated attentional networks.",
"affiliations": "Department of Neuropsychiatry, South West London & St George's NHS Mental Health Trust, London, UK.;Department of Neuropsychiatry, South West London & St George's NHS Mental Health Trust, London, UK.;Department of Neuropsychiatry, South West London & St George's NHS Mental Health Trust, London, UK.",
"authors": "Salih|Y|Y|;De Angelis|A|A|;Poole|N A|NA|",
"chemical_list": "D014150:Antipsychotic Agents; D002800:Cholinesterase Inhibitors",
"country": "England",
"delete": false,
"doi": "10.1080/13546805.2021.1941832",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1354-6805",
"issue": "26(5)",
"journal": "Cognitive neuropsychiatry",
"keywords": "Visual hallucinations; cholinergic system; rivastigmine",
"medline_ta": "Cogn Neuropsychiatry",
"mesh_terms": "D014150:Antipsychotic Agents; D002800:Cholinesterase Inhibitors; D005260:Female; D006212:Hallucinations; D006801:Humans; D008875:Middle Aged",
"nlm_unique_id": "9713497",
"other_id": null,
"pages": "335-342",
"pmc": null,
"pmid": "34142635",
"pubdate": "2021-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Imagine that: cholinesterase inhibitor treatment of complex visual hallucinations of unknown aetiology.",
"title_normalized": "imagine that cholinesterase inhibitor treatment of complex visual hallucinations of unknown aetiology"
} | [
{
"companynumb": "GB-MYLANLABS-2022M1008301",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OLANZAPINE"
},
"drugadditional": null,
... |
{
"abstract": "Staphylococcus pseudintermedius is a well known commensal organism of dogs but also a canine opportunistic pathogen. Reports of this organism being recovered from specimens from humans might suggest an increase prevalence in human infections and/or improved diagnostic leading to more accurate identification. Here we report a case of persistent S. pseudintermedius infection in an adult female oncology patient including colonization of the tip of an indwelling catheter. Diligence by laboratories in correctly isolating and identifying this pathogen (including susceptibility testing) is essential for optimal patient care.",
"affiliations": "University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;Veterinary Microbiology, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;Medicine, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;Surgery, University of Saskatchewan, Saskatoon, Saskatchewan, Canada.;University of Saskatchewan, Saskatoon, Saskatchewan, Canada.",
"authors": "Blondeau|L D|LD|http://orcid.org/0000-0003-3396-0334;Rubin|J E|JE|;Deneer|H|H|;Kanthan|R|R|;Morrison|B|B|;Sanche|S|S|http://orcid.org/0000-0003-3643-5973;Rypien|C|C|;Dueck|D|D|;Beck|G|G|;Blondeau|J M|JM|",
"chemical_list": "D000970:Antineoplastic Agents",
"country": "England",
"delete": false,
"doi": "10.1080/1120009X.2020.1735142",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1120-009X",
"issue": "32(3)",
"journal": "Journal of chemotherapy (Florence, Italy)",
"keywords": "Staphylococcus pseudintermedius; dog; oncology; persistent infection; transmission",
"medline_ta": "J Chemother",
"mesh_terms": "D000818:Animals; D000970:Antineoplastic Agents; D000086966:Bacterial Zoonoses; D002408:Catheters, Indwelling; D004285:Dogs; D005260:Female; D006801:Humans; D008875:Middle Aged; D009362:Neoplasm Metastasis; D057805:Pets; D012004:Rectal Neoplasms; D013203:Staphylococcal Infections; D013210:Staphylococcus",
"nlm_unique_id": "8907348",
"other_id": null,
"pages": "151-155",
"pmc": null,
"pmid": "32124685",
"pubdate": "2020-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Persistent infection with Staphylococcus pseudintermedius in an adult oncology patient with transmission from a family dog.",
"title_normalized": "persistent infection with staphylococcus pseudintermedius in an adult oncology patient with transmission from a family dog"
} | [
{
"companynumb": "CA-TEVA-2020-CA-1510258",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "OXALIPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nTo collect data of all patients admitted to hospital with a positive test to Bordetella bronchiseptica between 2001 and 2015.\n\n\nMETHODS\nWe performed a retrospective monocentric study of all hospitalized patients over the past 15 years with a positive test to B. bronchiseptica.\n\n\nRESULTS\nNine patients were included between 2001 and 2015; two presented with infectious relapses, i.e. a total of 14 positive test samples were observed. Age, induced immunodeficiency, and preexisting respiratory illnesses are risk factors. All patients showed symptoms at sample collection and the infection was exclusively respiratory. The diagnosis was obtained through a cytobacteriological test of sputum, bronchial aspiration, or bronchial fibroscopy with a bronchoalveolar lavage. The drug susceptibility test revealed a natural resistance to cephalosporins including ceftazidime, monobactam, and fosfomycin. There were cases of resistance to penicillin A and to the trimethoprim/sulfamethoxazole association. The classically used antibiotic treatment for community-acquired pneumonia is based on probability and may thus fail. Four patients died. The duration and nature of the antibiotics to use have not been codified.\n\n\nCONCLUSIONS\nB. bronchiseptica infection mainly affects the elderly. All patients should be treated, regardless of the importance of the inoculum, and all infected animals should be treated.",
"affiliations": "Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France. Electronic address: ducours.mailys@orange.fr.;Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.;Laboratoire de bactériologie, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.;Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.;Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.;Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.;Service de médecine interne 2, centre hospitalier d'Agen, route de Villeneuve-sur-Lot, 47000 Agen, France.",
"authors": "Ducours|M|M|;Rispal|P|P|;Danjean|M P|MP|;Imbert|Y|Y|;Dupont|E|E|;Traissac|E M|EM|;Grosleron|S|S|",
"chemical_list": null,
"country": "France",
"delete": false,
"doi": "10.1016/j.medmal.2017.05.012",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0399-077X",
"issue": "47(7)",
"journal": "Medecine et maladies infectieuses",
"keywords": "Bordetella bronchiseptica; Immunodeficiency; Immunodépression; Zoonose; Zoonosis",
"medline_ta": "Med Mal Infect",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D001884:Bordetella; D001885:Bordetella Infections; D017714:Community-Acquired Infections; D003428:Cross Infection; D004198:Disease Susceptibility; D004352:Drug Resistance, Microbial; D005260:Female; D006801:Humans; D016867:Immunocompromised Host; D008297:Male; D008875:Middle Aged; D009369:Neoplasms; D012189:Retrospective Studies; D012307:Risk Factors",
"nlm_unique_id": "0311416",
"other_id": null,
"pages": "453-458",
"pmc": null,
"pmid": "28943167",
"pubdate": "2017-11",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Bordetella bronchiseptica infection.",
"title_normalized": "bordetella bronchiseptica infection"
} | [
{
"companynumb": "FR-MYLANLABS-2018M1035531",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TETRACYCLINE"
},
"drugadditional": "3",
... |
{
"abstract": "Anti-rituximab antibodies (ARA) are associated not only with adverse events, such as infusion reactions (IR) and serum sickness, but also with rituximab efficacy. However, the clinical relevance of ARA in children with steroid-dependent nephrotic syndrome (SDNS) remains unknown.\n\n\n\nWe retrospectively reviewed clinical outcomes of 13 children with complicated SDNS receiving repeated single-dose rituximab treatments at 375 mg/m2 to assess whether ARA formation could impact toxicity and efficacy of additional rituximab. Pre-rituximab 22 samples collected from patients who developed IR during the second or subsequent rituximab doses were measured by electrochemiluminescence analysis.\n\n\n\nARA were identified in 5 of 13 patients (9 of 22 samples). Median time to recovery of CD19+ B cells to > 1% of total lymphocytes and median relapse-free time after rituximab treatment were significantly shorter in the 9 ARA-positive samples than the 13 ARA-negative samples (41 vs. 100 days, p < 0.01 and 119 vs. 308 days, p < 0.05, respectively). Kaplan-Meier analysis showed that time to CD19+ B cell recovery after rituximab was significantly shorter in ARA-positive samples than in ARA-negative samples (p < 0.005). Severe IR developed in two ARA-positive patients and serum sickness in one ARA-positive patient.\n\n\n\nThe incidence of ARA formation was high in the pre-rituximab samples of patients with complicated SDNS who developed IR during the second or subsequent rituximab doses, suggesting that ARA formation might have an unfavorable impact on the toxicity and efficacy of additional rituximab doses in these patients.",
"affiliations": "Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan. f_shuich@d2.dion.ne.jp.;Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan.;Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan.;Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan.;Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan.;Division of Nephrology, Saitama Children's Medical Center, 1-2 Shintoshin, Chuo-ku, Saitama, 330-8777, Japan.",
"authors": "Fujinaga|Shuichiro|S|0000-0002-2957-3705;Nishino|Tomohiko|T|;Endo|Shota|S|;Umeda|Chisato|C|;Watanabe|Yoshitaka|Y|;Nakagawa|Mayu|M|",
"chemical_list": "D000906:Antibodies; D018941:Antigens, CD19; D005938:Glucocorticoids; D000069283:Rituximab",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00467-020-04629-w",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0931-041X",
"issue": "35(10)",
"journal": "Pediatric nephrology (Berlin, Germany)",
"keywords": "Anti-rituximab antibody; Electrochemiluminescence analysis; Infusion reactions; Rituximab; Serum sickness; Steroid-dependent nephrotic syndrome",
"medline_ta": "Pediatr Nephrol",
"mesh_terms": "D000906:Antibodies; D018941:Antigens, CD19; D001402:B-Lymphocytes; D002648:Child; D002675:Child, Preschool; D004342:Drug Hypersensitivity; D004351:Drug Resistance; D005260:Female; D005938:Glucocorticoids; D006801:Humans; D015994:Incidence; D007223:Infant; D007262:Infusions, Intravenous; D008297:Male; D009404:Nephrotic Syndrome; D012189:Retrospective Studies; D000069283:Rituximab; D012720:Severity of Illness Index",
"nlm_unique_id": "8708728",
"other_id": null,
"pages": "2003-2008",
"pmc": null,
"pmid": "32556955",
"pubdate": "2020-10",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Unfavorable impact of anti-rituximab antibodies on clinical outcomes in children with complicated steroid-dependent nephrotic syndrome.",
"title_normalized": "unfavorable impact of anti rituximab antibodies on clinical outcomes in children with complicated steroid dependent nephrotic syndrome"
} | [
{
"companynumb": "JP-MYLANLABS-2020M1095696",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "We report the case of a 76-year-old man presenting with reactive haemophagocytic lymphohistiocytosis (rHLH) in the setting of disseminated prostate cancer. This often fatal syndrome must be diagnosed early in order to maximize survival. Treatment should be initiated whenever the clinical diagnosis is suspected, even if the HLH-2004 criteria are not met. The HScore is a useful diagnostic tool for rHLH. In case of neurological symptoms, an extensive assessment must be performed. The goal of this case report is to raise awareness of this rare syndrome among oncologists.\nThe association of prostate cancer and reactive haemophagocytic lymphohistiocytosis (rHLH) has rarely been described.This often fatal syndrome must be recognized early in order to start specific treatment and maximize survival.Specific treatment for rHLH must be accompanied by treatment of the triggering factors.",
"affiliations": "Medical Oncology Department, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium.;Department of Hematology, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium.;Medical Oncology Department, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium.;Medical Oncology Department, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium.;Medical Oncology Department, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium.",
"authors": "Dumont|Laura|L|;Salaroli|Adriano|A|;Dal Lago|Lissandra|L|;Gil|Thierry|T|;Pepersack|Thierry|T|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.12890/2021_002425",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2284-2594",
"issue": "8(4)",
"journal": "European journal of case reports in internal medicine",
"keywords": "HScore; Prostate cancer; hyperferritinemia; hypertriglyceridemia; pancytopenia; reactive hemophagocytic lymphohistiocytosis",
"medline_ta": "Eur J Case Rep Intern Med",
"mesh_terms": null,
"nlm_unique_id": "101648453",
"other_id": null,
"pages": "002425",
"pmc": null,
"pmid": "33987121",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "12187236;2458866;24782338;28935695;21936755;29064197",
"title": "Prostate Cancer and Reactive Haemophagocytic Lymphohistiocytosis.",
"title_normalized": "prostate cancer and reactive haemophagocytic lymphohistiocytosis"
} | [
{
"companynumb": "BE-ASTELLAS-2021US027715",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TINZAPARIN"
},
"drugadditional": null,
... |
{
"abstract": "INTRODUCTION AND OBJECTIVE: Social media has been suggested as a source for safety information, supplementing existing safety surveillance data sources. This article summarises the activities undertaken, and the associated challenges, to create a benchmark reference dataset that can be used to evaluate the performance of automated methods and systems for adverse event recognition.\n\n\n\nA retrospective analysis of public English-language Twitter posts (Tweets) was performed. We sampled 57,473 Tweets out of 5,645,336 Tweets created between 1 March, 2012 and 1 March, 2015 that mentioned at least one of six medicinal products of interest (insulin glargine, levetiracetam, methylphenidate, sorafenib, terbinafine, zolpidem). Products, adverse events, indications, product-event combinations, and product-indication combinations were extracted and coded by two independent teams of safety reviewers.\n\n\n\nThe benchmark reference dataset consisted of 1056 positive controls (\"adverse event Tweets\") and 56,417 negative controls (\"non-adverse event Tweets\"). The 1056 adverse event Tweets contained 1396 product-event combinations referring to personal adverse event experiences, comprising 292 different MedDRA® Preferred Terms. The 1171 product-event combinations (83.9%) were confined to four MedDRA® System Organ Classes. The 195 Tweets (18.5%) contained indication information, comprising 25 different Preferred Terms.\n\n\n\nA manually curated benchmark reference dataset based on Twitter data has been created and is made available to the research community to evaluate the performance of automated methods and systems for adverse event recognition in unstructured free-text information.",
"affiliations": "Pharmacovigilance, Bayer AG, Müllerstr. 170, 13353, Berlin, Germany. juergen.dietrich@bayer.com.;Uppsala Monitoring Centre, Uppsala, Sweden.;Pharmacovigilance, Bayer AG, Müllerstr. 170, 13353, Berlin, Germany.;Global Patient Safety Pharmacovigilance Operations, Amgen Limited, Cambridge, UK.;Lenolution GmbH, Berlin, Germany.;Uppsala Monitoring Centre, Uppsala, Sweden.;Global Regulatory Affairs, Patient Safety and Quality Assurance, Global Medicines Development, AstraZeneca, Cambridge, UK.",
"authors": "Dietrich|Juergen|J|0000-0002-5494-3499;Gattepaille|Lucie M|LM|;Grum|Britta Anne|BA|;Jiri|Letitia|L|;Lerch|Magnus|M|;Sartori|Daniele|D|;Wisniewski|Antoni|A|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.1007/s40264-020-00912-9",
"fulltext": "\n==== Front\nDrug Saf\nDrug Saf\nDrug Safety\n0114-5916 1179-1942 Springer International Publishing Cham \n\n912\n10.1007/s40264-020-00912-9\nOriginal Research Article\nAdverse Events in Twitter-Development of a Benchmark Reference Dataset: Results from IMI WEB-RADR\nhttp://orcid.org/0000-0002-5494-3499Dietrich Juergen juergen.dietrich@bayer.com 1 Gattepaille Lucie M. 2 Grum Britta Anne 1 Jiri Letitia 3 Lerch Magnus 4 Sartori Daniele 2 Wisniewski Antoni 5 1 grid.420044.60000 0004 0374 4101Pharmacovigilance, Bayer AG, Müllerstr. 170, 13353 Berlin, Germany \n2 grid.420224.20000 0001 2153 0703Uppsala Monitoring Centre, Uppsala, Sweden \n3 Global Patient Safety Pharmacovigilance Operations, Amgen Limited, Cambridge, UK \n4 Lenolution GmbH, Berlin, Germany \n5 grid.417815.e0000 0004 5929 4381Global Regulatory Affairs, Patient Safety and Quality Assurance, Global Medicines Development, AstraZeneca, Cambridge, UK \n29 1 2020 \n29 1 2020 \n2020 \n43 5 467 478\n© The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License, which permits any non-commercial use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc/4.0/.Introduction and Objective\nSocial media has been suggested as a source for safety information, supplementing existing safety surveillance data sources. This article summarises the activities undertaken, and the associated challenges, to create a benchmark reference dataset that can be used to evaluate the performance of automated methods and systems for adverse event recognition.\n\nMethods\nA retrospective analysis of public English-language Twitter posts (Tweets) was performed. We sampled 57,473 Tweets out of 5,645,336 Tweets created between 1 March, 2012 and 1 March, 2015 that mentioned at least one of six medicinal products of interest (insulin glargine, levetiracetam, methylphenidate, sorafenib, terbinafine, zolpidem). Products, adverse events, indications, product-event combinations, and product-indication combinations were extracted and coded by two independent teams of safety reviewers.\n\nResults\nThe benchmark reference dataset consisted of 1056 positive controls (“adverse event Tweets”) and 56,417 negative controls (“non-adverse event Tweets”). The 1056 adverse event Tweets contained 1396 product-event combinations referring to personal adverse event experiences, comprising 292 different MedDRA® Preferred Terms. The 1171 product-event combinations (83.9%) were confined to four MedDRA® System Organ Classes. The 195 Tweets (18.5%) contained indication information, comprising 25 different Preferred Terms.\n\nConclusions\nA manually curated benchmark reference dataset based on Twitter data has been created and is made available to the research community to evaluate the performance of automated methods and systems for adverse event recognition in unstructured free-text information.\n\nElectronic supplementary material\nThe online version of this article (10.1007/s40264-020-00912-9) contains supplementary material, which is available to authorized users.\n\nissue-copyright-statement© Springer Nature Switzerland AG 2020\n==== Body\nKey Points\n\nA manually curated benchmark reference dataset containing positive and negative controls has been created and is made available to the research community\t\nThe benchmark reference dataset can be used to evaluate the performance of automated methods and systems for adverse event recognition in unstructured free-text information\t\nFor the six substances investigated in this study, overall, Twitter posts were mainly about drug ineffectiveness, nervous system/psychiatric disorders, or usage problems (e.g. intentional product misuse). Although the limitation to six substances might limit the generalisability of the dataset, it could provide deeper insights into the real-life usage of these medicinal products and in the use of Twitter regarding adverse events\t\n\n\n\nIntroduction\nTraditional methods of safety signal detection in licensed pharmaceutical products rely on patients and healthcare professionals to report suspected adverse drug reactions (ADRs) to regulatory agencies or the pharmaceutical companies. Significant under-reporting is well known [1] despite successive efforts to increase reporting. The vast and ever-increasing online presentation of unstructured human experience in social media and a corresponding growth of new technologies offer the opportunity to collect patient perspectives of medication use that might not be otherwise communicated, as well as, at least in theory, the possibility to detect previously unknown ADRs sooner than by traditional methods.\n\nThe Innovative Medicines Initiative (IMI) Web-Recognizing Adverse Drug Reactions (WEB-RADR) project was a European Union-funded 3-year project designed to recommend policies, frameworks, tools and methodologies to support reporting of ADRs through mobile applications and the identification of ADRs from social media. Several WEB-RADR activities targeted the acquisition of new insights into drug safety not available with established pharmacovigilance methods. One of the IMI WEB-RADR Work Packages focused on methods to enable signal detection in social media [2]. This work included researching statistical methods for signal detection and methods to enhance automated detection of adverse events (AEs) via entity recognition and mapping of medicinal product and AE terms.\n\nDozens of automated AE recognition systems have been developed over the past 10 years, with great variability in methodology (e.g. rule based, machine learning, manual curation), source data (e.g. Twitter, Reddit, health-related forums), task solved (e.g. AE span detection, relation extraction, classification of posts as containing AE-related information) and reported performance. We recommend Tricco et al. for a detailed review of those systems [3]. In their article, Tricco et al. state that a direct comparison of the systems is hard to perform, owing to the scarcity of publicly available datasets. However, recent efforts have been made in this direction. In 2017, a shared task on the classification and normalisation of health-related text from social media was performed at the Social Media Mining for Health workshop, involving three subtasks: (1) ADR detection; (2) medication intake classification; and (3) normalisation of ADR expressions [4]. Datasets with training and validation examples were given to teams to train and test their systems, and the final evaluation was made using hold-out hidden test samples, allowing for a fair comparison of performance between the 55 system runs from the 13 participating teams.\n\nDespite its great value for training AE recognition systems, the Social Media Mining for Health dataset cannot be used directly to solve the comprehensive task of finding the products and events mentioned in the text, map them to terminologies, and classify the association between the products and AEs in the given social media text. The Social Media Mining for Health subtask 1 focused on the classification of posts as containing an AE or not, subtask 3 focused on the mapping of short text extracts to MedDRA Preferred Terms (PTs), while the classification of the association between the products and the AEs was not assessed at all. In contrast, the CADEC [5] and the TwiMed [6] corpora are both resources that can be used to train systems to perform the entire AE recognition task described above.\n\nIn the ‘ADR Recognition’ work package of IMI WEB-RADR, a large dataset of manually curated Twitter posts (Tweets) was created to aid identification of medicinal product names, AEs, indications, and their associations in social media and to establish a dataset to act as a benchmark reference for method evaluation and comparison. Not intended for training, but rather testing, of AE recognition systems, this dataset represents a novel resource to evaluate the performance of such systems and should be useful to provide measures of their usability when applied to new data.\n\nThis article describes the approach taken for selection, collection, sampling, annotation, and quality assurance, and provides descriptive statistics and characteristics of this ‘benchmark reference dataset’. The dataset is publicly available for download [see the Electronic Supplementary Material (ESM) 1].\n\nMethods\nProduct Selection\nThe activities described in this article were part of the WEB-RADR project. The WEB-RADR consortium decided to focus these activities on six “drugs of interests” (DOIs), i.e. substances that are manufactured by one of the companies participating in the WEB-RADR consortium (Bayer, Novartis, Sanofi, UCB). For each DOI, a list of product search terms was created using the WHO Drug Global lexicon of global drug names. The product search terms included the products’ generic names, trade names, abbreviations and common misspellings. This resulted in a list of 880 product search terms (between 12 and 418 per DOI) that were used for the Twitter data extraction. Key characteristics of the six DOIs are given in Table 1.Table 1 Key characteristics of the six “drugs of interest” (DOIs) used for the development of the benchmark reference dataset\n\nSubstance name (INN)\tManufacturer\tPrimary trade name (indications per SmPC)\tNumber of product search terms (%)\t10 examples of product search terms\tNumber of product search term hits in Twitter data extract (%)\tNumber of DOI hits in Twitter data extract (%)\tNumber of AE Tweets per DOI (%)\t\nInsulin glargine\tSanofi\tLantus (diabetes mellitus)\t32 (3.6)\tLantus, Lantas, Toujeo, Abasria, Lants, Glargine, Lanus, Basalin, Basalog, Basugine\t1593 (2.0)\t1503 (2.6)\t73 (6.9)\t\nLevetiracetam\tUCB\tKeppra (partial-onset seizures with epilepsy)\t165 (18.8)\tKeppra, Kredit, Laurak, Iracet, Cetam, Vetira, Levetiracetam, Epixx, Kepra, Letram\t9979 (12.4)\t5995 (10.4)\t255 (24.1)\t\nMethylphenidate\tNovartis\tRitalin (attention-deficit hyperactivity disorder)\t80 (9.1)\tRitalin, Concerta, Phenida, Methylpheni, Daytrana, Biphentin, Methylin, Quillivant, Concentra, Rubifen\t9361 (11.6)\t4006 (6.9)\t357 (33.8)\t\nSorafenib\tBayer\tNexavar (hepatocellular carcinoma, renal cell carcinoma, differentiated thyroid carcinoma)\t12 (1.4)\tSorafenib, Nexavar, Sorafenat, Soranib, Nexavir, Nexaver, Nevaxar, Naxavar, Nexivar, Sorenic\t2298 (2.9)\t2188 (3.8)\t14 (1.3)\t\nTerbinafine\tNovartis\tLamisil (fungal infections such as Tinea corporis, Tinea cruris and Tinea pedis, onychomycosis)\t418 (47.5)\tNafin, Erfin, Terbin, Lamisil, Silka, Terbit, Viras, Binter, Tacna, Finex\t32,867 (40.9)\t24,781 (42.8)\t37 (3.5)\t\nZolpidem\tSanofi\tStilnox (insomnia)\t173 (19.7)\tAmbien, Zolp, Intermezzo, Nocte, Maycle, Zopim, Nasen, Durnit, Zleep, Zolman\t24,331 (30.3)\t19,403 (33.5)\t320 (30.3)\t\nTotal\t\t\t880 (100.0)\t\t80,429 (100.0)\t57,876a (100.0)\t1056 (100.0)\t\nAE adverse event, INN International nonproprietary name, SmPC summary of product characteristics\n\na403 Tweets contain two different DOIs; therefore, this sum is respectively higher than the total of 57,473 Tweets in the benchmark reference dataset\n\n\n\nTwitter Data Extraction, Deduplication and Sampling\nThe social media data analysed in this report were acquired via an Application Programming Interface from publicly available English-language Twitter posts (Tweets) created between 1 March, 2012 and 1 March, 2015. At the time of data acquisition, Tweets were limited to 140 characters. The data retrieval query that was used to extract data from Twitter contained the 880 product search terms identified in the product selection phase (see Sect. 2.1) and yielded a total of 5,645,336 Tweets. Each of these Tweets potentially contained at least one of the DOIs but not necessarily an AE. The review and annotation of the Tweets later revealed that some Tweets did not contain any DOIs but were included in the data extract as they matched product search terms with alternative connotations (e.g. “ambien”, “concentra”, “freederm”, “intermezzo”).\n\nTo remove potentially redundant data, locality-sensitive hashing [7] was applied to the 5,645,336 Tweets resulting in the removal of approximately 80% Tweets identified as duplicates or near-duplicates. The largest single cluster of duplicate Tweets identified by this method contained around 11,000 near-identical Tweets, mostly re-tweets. The remaining subset contained approximately 1.1 million Tweets, and these were grouped by substance name.\n\nFrom this subset of Tweets, posts were randomly sampled until a target number of at least 1500 posts per DOI was reached. The resulting dataset contained a total of 57,473 Tweets (1–2228 Tweets per product search term). Figure 1 shows the selection and filtering of Tweets through the data extraction, deduplication and sampling process.Fig. 1 Selection and filtering of Tweets through the data extraction, deduplication and sampling process\n\n\n\nIndicator Score\nThe Tweets selected in the previous step (see Sect. 2.2) underwent classification by a Bayesian classifier that was previously developed by Epidemico, Inc. (now part of Booz Allen Hamilton) for mining AE discussions in social media data [8], based on Robinson’s method for filtering e-mail spam [9]. The classifier has been trained to identify vernacular language that may describe a suspected ADR or resembles an AE (sometimes referred to as a “Proto-AE”) and calculates an indicator score with values from 0.0 to 1.0. The score indicates the probability that a social media post contains at least one AE (0: low probability, 1: high probability). A penalty of 0.2 is deducted from the indicator score if the post does not contain any identifiable symptom [8].\n\nTo avoid any bias on the manual annotation of the Tweets (see Sect. 2.4), the indicator score was not shown to the annotators and was also not used to define the order in which the Tweets went into the annotation process. However, the indicator score was used to define the route a Tweet took through the annotation and quality assurance processes. This is described in Sects. 2.4.4 and 2.4.5.\n\nAnnotation\nSetting up the Annotation Environment\nTo facilitate human review and annotation of the Twitter data, a graphical user interface was developed (Insight Explorer) [10]. Two separate environments were set up, each with a copy of the 57,473 Tweets, to allow two teams to annotate the Tweets independently and in parallel.\n\nAnnotation Guideline, Teams and Training\nBefore the annotation of Tweets started, an annotation guideline was developed that included guidance on how to distinguish between “AE Tweets” and “Non-AE Tweets” and how to extract and code medicinal products and AEs. Two independent teams of annotators were created. Each team (nine people in total per team) worked in one of the annotation environments, and could not see the annotations made by members of the other annotation team. The members of the teams were pharmacovigilance experts with experience in processing individual case safety reports, including coding of medicinal products and AEs.\n\nEach annotator was trained in the annotation guideline and in the use of the tool used to perform the annotation (Insight Explorer). Weekly meetings were held to support the annotators in case of post-training questions regarding the annotation tool, the annotation guideline, or Tweets containing inconclusive or ambiguous content.\n\nEssentials of the Annotation Guideline\nEach Tweet was evaluated as an independent Tweet. Therefore, other Tweets from the same user, related Tweets from other users (re-Tweets or replies) or information outside of the Twitter dataset pointing to hyperlinks within the Tweets were not considered for annotation.\n\nTweets with at least one DOI and at least one AE reported as a personal experience associated with the reported DOI(s) were classified as “AE Tweets”. In those Tweets, all identifiable DOIs and AEs were extracted and mapped to standard dictionary terms, i.e. product name as reported and International Nonproprietary Name for products, and MedDRA PTs for AEs and indications. Furthermore, details about product-event combinations and product-indication combinations, e.g. causal attribution, were evaluated. If a Tweet contained multiple AEs, it was assumed that the AEs occurred over the same period unless the Tweet contained useable information to the contrary.\n\nTweets containing at least one DOI but no AE, or a DOI with no AE reported as a personal experience, were classified as “Non-AE Tweets”. Tweets without any DOI were also classified as Non-AE Tweets. For Non-AE Tweets, the DOIs, non-DOI products, AEs and indications were not annotated or mapped to standard dictionary terms.\n\nPlease note Due to Twitter’s policy, we are not allowed to publish the complete Tweet contents. Therefore, for demonstration purposes in this article, original substance names were substituted by “<substance name>”. In ESM 1 of the online version of this article, the completely evaluated benchmark reference dataset is available, but without the Tweets’ content. Please use the Twitter ID and available programmes (see the link listed in ESM 1) for accessing the Tweets’ content.\n\nExample of an “AE Tweet” and its annotation:”my doc wanted to give me < substance name 1 > . I said no because I knew I would like it too much. Tried < substance name 2 > but I was sleepwalking/amnesia”\n\n\n\nIn this example, only < substance name 2 > was identified as a DOI and, therefore, only data for this substance were subsequently annotated. Of note, even if < substance name 1 > would have been a DOI, the Tweet does not contain a personal experience of an AE associated with < substance name 1 > and hence, no product-event combination would have been annotated for it.\n\nAnnotation result:\n\nClassification: AE Tweet\n\nProduct(s) as reported: < substance name 2>\n\nProduct coded (International Nonproprietary Name): < substance name 2 coded>\n\nEvent(s) as reported: amnesia; sleepwalking\n\nEvent(s) coded (PT): Amnesia; Somnambulism\n\nProduct event(s): < substance name 2 > : Amnesia; < substance name 2 > : Somnambulism\n\nIndication(s) as reported:\n\n\nIndication(s) coded (PT):\n\nProduct indication(s):\n\n\nPlease note: In this example, no indication is reported. Therefore, those fields are left blank.\n\nTwo typical examples of “Non-AE Tweets”:\n”? < substance name > is a pill that works through the bloodstream to target and attack the infection at its source underneath the nail.?“\n\n\n“<substance name > , which was priced at Rs 2.28 lakh per month is now available for Rs 6,600“\n\n\n\n\nAnnotation Process\nThe annotation process is outlined in Fig. 2. The two different Insight Explorer database instances are labelled as “IE#1” and “IE#2”. The indicator scores of the Tweets were not displayed to the annotation teams to avoid bias on their manual annotation.Fig. 2 Annotation process. AE adverse event, IE#1 Insight Explorer instance 1, IE#2 Insight Explorer instance 2\n\n\n\nThe original goal was that all 57,473 Tweets would be reviewed manually by the two annotation teams. However, it was found that the annotation took longer than anticipated and would not be completed within the timeline defined by the WEB-RADR project. Hence, an exploratory analysis was performed to investigate the potential for annotation automation of “Non-AE Tweets”.\n\nAt the time of the exploratory analysis, 15,195 Tweets had been reviewed and, within those, 91 “AE Tweets” had been identified. For Tweets with an indicator score below 0.3, only five AE Tweets were found compared with 5982 Non-AE Tweets. Based on this finding, it was determined that Tweets with an indicator score below 0.3 could be considered Non-AE Tweets and be excluded from manual annotation without significant loss of precision and recall. Applying this filter to the entire dataset of 57,473 Tweets resulted in the classification of 24,311 Tweets as Non-AE Tweets, leaving 33,162 Tweets for manual human curation.\n\nThe 33,162 Tweets with an indicator score ≥ 0.3 were manually curated by the two independent annotation teams. Both annotation teams agreed on the classification of 31,340 Non-AE Tweets and 507 AE Tweets (see Fig. 2). For 1315 Tweets, the classification by the two annotation teams differed, illustrating the difficulty of interpreting the content of Tweets (see Sect. 4 for details).\n\nTweets with indicator scores between 0.3 and 0.7 and classified by both teams as Non-AE Tweets were not processed any further (n = 30,303). For the remaining Tweets with an indicator score ≥ 0.3 (n = 2859), a 100% quality control was performed by a team of experienced MedDRA coders to propose the annotations for the benchmark reference dataset. As shown in Fig. 2, these 2859 Tweets comprised the concordantly classified Non-AE Tweets with an indicator score ≥ 0.7 (n = 1037), the discordantly classified Tweets with an indicator score ≥ 0.3 (n = 1315) and the concordantly classified AE Tweets (n = 507). This quality control process resulted in the identification of 991 AE Tweets. Finally, two quality assurance measures were performed to make final refinements to the benchmark reference dataset.\n\nQuality Assurance\nTwo quality assurance measures were defined and performed to yield the best quality of the benchmark reference dataset under the given circumstances of this project.\n\nQuality Assurance #1 Of 600 randomly selected Tweets (300 AE Tweets and 300 Non-AE Tweets) with an indicator score ≥ 0.3, were independently evaluated by a team not involved in the prior annotation process (see Quality Assurance #1 in Fig. 2). Among the 300 AE Tweets, a total of 46 Tweets with issues were found: non-DOI products were wrongly identified as DOIs (n = 14); AEs were coded to the wrong PT (n = 25); one Tweet was wrongly identified as an AE Tweet (n = 1); and misspellings were identified (n = 6). Among the 300 Non-AE Tweets, eight were found with AEs (i.e. AE Tweets) [2.7%].\n\nThe identified issues were resolved in the benchmark reference dataset.\n\nQuality Assurance #2 Tweets were sorted by descending indicator scores, a total of 1200 Non-AE Tweets were assigned to batches of 100 each (n = 12 batches), and a 100% Tweet content check was performed to identify potentially missed additional AE Tweets (see Quality Assurance #2 in Fig. 2). Among all Tweets (both AE Tweets and Non-AE Tweets together) within the range of an indicator score defined by each batch, the proportion of missed AE Tweets (annotated as Non-AE Tweets but identified as AE Tweets in the second quality assurance) was computed. This proportion was found to vary between 0.9% [batch 12: one missed AE Tweet/(100 Non-AE Tweets + 15 AE Tweets)] and 6.7% [batch 2: 12 missed AE Tweets/(100 Non-AE Tweets + 80 AE Tweets)]. In this quality assurance step, a total of 58 additional AE Tweets were identified and annotated, and the benchmark reference dataset updated accordingly.\n\nResults\nCharacteristics of the Benchmark Reference Dataset\nFormat and Accessibility\nThe benchmark reference dataset is publicly available for download in XLSX format in the online version of this article as ESM 1. The file includes a table that describes the content of the dataset, i.e. column names and descriptions.\n\nPositive and Negative Controls\nThe benchmark reference dataset contains 57,473 Tweets, with 1056 AE Tweets (1.8%; positive controls) and 56,417 Non-AE Tweets (98.2%; negative controls).\n\nEffect of the Quality Control and Quality Assurance Measures\nThe comparison of the benchmark reference dataset with the dataset from before the quality steps revealed the following: from the discordantly classified Tweets (n = 1315), and the concordantly classified AE Tweets (n = 507), the quality control process resulted in the identification of 991 AE Tweets. In quality assurance step #1, one Non-AE Tweet was removed and eight AE Tweets were added. In step #2, 58 additional AE Tweets were added, resulting in total of 1056 AE Tweets.\n\nNumber of Adverse Events (AEs) per AE Tweet\nThe AE Tweets in the benchmark reference dataset contain between one and eight AEs per Tweet: 74.6% contain one AE, 20.1% two AEs, 4.3% three AEs, 0.9% four AEs, 0.1% five AEs and 0.1% eight AEs. Thus, around 95% of all AE Tweets contain a maximum of two AEs. This distribution of AEs per Tweet is comparable to results published by Patel et al. [11].\n\nDistribution of Substances in Tweets\nWithin the 57,473 Tweets of benchmark reference dataset, 80,429 product search terms were found (see Table 1). There were 7704 Tweets with more than one product search term and 403 Tweets with two different DOIs. About 76% of all Tweets contained the two most frequently mentioned DOIs: terbinafine (24,781 Tweets, 42.8%) and zolpidem (19,403 Tweets, 33.5%).\n\nThe analysis of the 1056 AE Tweets shows that the DOIs are heterogeneously distributed (see Table 1). At the lower end, sorafenib was only mentioned in 14 AE Tweets (1.3%), whereas at the upper end, methylphenidate was mentioned in 357 Tweets (33.8%). Of the AE Tweets (n = 932), 88.3% refer to the three most mentioned DOIs (methylphenidate, zolpidem, levetiracetam).\n\nAn interesting finding is the divergent occurrences of DOIs in the 57,473 Tweets vs the 1056 AE Tweets, most pronounced for methylphenidate and terbinafine: while the percentage increased for methylphenidate from 6.9 to 33.8%, it decreased for terbinafine from 42.8 to 3.5%. The cause of this difference in prevalence in all Tweets vs AE Tweets has not yet been analysed.\n\nDistribution of Event Terms in AE Tweets\nIn the 1056 AE Tweets in the benchmark reference dataset, 1396 AEs were identified, annotated and coded to MedDRA PTs comprising 292 different PTs (see ESM 1). A total of 83.9% (n = 1171) of these AEs map to just four primary System Organ Classes (SOCs): SOC General disorders and administration site conditions (37.2%, n = 519), SOC Psychiatric disorders (26.5%, n = 370), SOC Nervous system disorders (11.5%, n = 161), and SOC Injury, poisoning and procedural complications (8.7%, n = 121) [see Table 2; see ESM 2 for the table showing all SOCs].Table 2 Distribution of substances in the most frequent System Organ Classes (SOCs) in adverse event Tweets\n\nSOC\tSubstance\tCount\tPercent\t\nGeneral disorders and administration site conditions\tZolpidem\t182\t13.0\t\nMethylphenidate\t151\t10.8\t\nLevetiracetam\t118\t8.5\t\nInsulin glargine\t45\t3.2\t\nTerbinafine\t18\t1.3\t\nSorafenib\t5\t0.4\t\nSum\t519\t37.2\t\nPsychiatric disorders\tZolpidem\t149\t10.7\t\nMethylphenidate\t134\t9.6\t\nLevetiracetam\t81\t5.8\t\nTerbinafine\t4\t0.3\t\nSorafenib\t1\t0.1\t\nInsulin glargine\t1\t0.1\t\nSum\t370\t26.5\t\nNervous system disorders\tLevetiracetam\t62\t4.4\t\nMethylphenidate\t42\t3.0\t\nZolpidem\t42\t3.0\t\nTerbinafine\t7\t0.5\t\nInsulin glargine\t4\t0.3\t\nSorafenib\t4\t0.3\t\nSum\t161\t11.5\t\nInjury, poisoning and procedural complications\tMethylphenidate\t55\t3.9\t\nZolpidem\t27\t1.9\t\nInsulin glargine\t21\t1.5\t\nLevetiracetam\t15\t1.1\t\nTerbinafine\t3\t0.2\t\nSum\t121\t8.7\t\nOther SOCs\tSum\t225\t16.1\t\nTotal\t1396\t100.0\t\n\n\nTable 2 also shows the distributions of the six DOIs in the four most frequently reported SOCs. Except for SOC Nervous system disorder where levetiracetam appears on top of the table, zolpidem and methylphenidate are the most frequent DOIs in the top SOCs.\n\nTable 3 shows the most frequently reported PTs within the top four SOCs. In SOC General disorders and administration site conditions, PT Drug ineffective and rather unspecific AE terms dominate the list. In SOC Psychiatric disorders and SOC Nervous system disorders, PTs hint at the use of psychotropic substances or psychotropic events, respectively. The PTs in SOC Injury, poisoning and procedural complications mainly refer to administration and dose errors and intentional product misuse.Table 3 Distribution of most frequent adverse event Preferred Terms (PTs) in the most frequent System Organ Classes (SOCs) in adverse event Tweets\n\nSOC\tPT\tCount\tPercent\t\nGeneral disorders and administration site conditions\tDrug ineffective\t133\t9.5\t\nFeeling abnormal\t74\t5.3\t\nAdverse event\t57\t4.1\t\nFatigue\t40\t2.9\t\nAdverse drug reaction\t37\t2.7\t\nDrug effect decreased\t20\t1.4\t\nOther PTs\t158\t11.3\t\nSum\t519\t37.2\t\nPsychiatric disorders\tInsomnia\t59\t4.2\t\nHallucination\t27\t1.9\t\nDrug dependence\t21\t1.5\t\nAnger\t20\t1.4\t\nEuphoric mood\t20\t1.4\t\nAbnormal dreams\t18\t1.3\t\nOther PTs\t205\t14.7\t\nSum\t370\t26.5\t\nNervous system disorders\tSomnolence\t29\t2.1\t\nHeadache\t17\t1.2\t\nMemory impairment\t16\t1.1\t\nAmnesia\t12\t0.9\t\nDizziness\t11\t0.8\t\nConvulsion\t7\t0.5\t\nOther PTs\t69\t4.9\t\nSum\t161\t11.5\t\nInjury, poisoning and procedural complications\tDrug dose omission\t24\t1.7\t\nOverdose\t23\t1.6\t\nIntentional product misuse\t21\t1.5\t\nIncorrect route of drug administration\t8\t0.6\t\nExtra dose administered\t6\t0.4\t\nExposure during pregnancy\t4\t0.3\t\nOther PTs\t35\t2.5\t\nSum\t121\t8.7\t\nOther SOCs\tSum\t225\t16.1\t\nTotal\t1396\t100.0\t\n\n\nDistribution of Indications in AE Tweets\nWithin the 1056 AE Tweets, 195 Tweets (18.5%) contain indication information. One Tweet contains two different indications. Hence, a total of 196 indications were identified in the AE Tweets and coded to MedDRA PTs. In 117 of 195 Tweets (60.0%), indications were identified by Twitter hashtags (e.g. #ADHD) or references (e.g. @epilepsyaction), which comprise 49 different hash tags/references (see ESM 3). In the remaining 78 Tweets (40.0%), indications were identified by the explicit description of the purpose of use, e.g. “I’ve had athletes foot for two years now lol… < substance name > … dont work.”.\n\nTable 4 shows the MedDRA PTs of the 25 different indications that were identified and coded. Please note that one indication (PT Sleep disorder) occurs twice, i.e. for zolpidem and for levetiracetam. The top five indications account for 161 of 196 indications (82.1%), whereas 168 of 196 indications (85.7%) were reported for the top three substances (levetiracetam n = 96, zolpidem n = 37, methylphenidate n = 35).Table 4 Distribution of indications and substances in adverse event Tweets\n\nIndication PT\tSubstance\tCount\tPercent\tPotential off-label use\t\nEpilepsy\tLevetiracetam\t75\t38.3\tNo\t\nAttention-deficit/hyperactivity disorder\tMethylphenidate\t29\t14.8\tNo\t\nInsomnia\tZolpidem\t25\t12.8\tNo\t\nConvulsion\tLevetiracetam\t17\t8.7\tYes\t\nDiabetes mellitus\tInsulin glargine\t15\t7.7\tNo\t\nSleep disorder\tZolpidem\t9\t4.6\tYes\t\nType 1 diabetes mellitus\tInsulin glargine\t3\t1.5\tNo\t\nNarcolepsy\tMethylphenidate\t3\t1.5\tNo\t\nSleep disorder therapy\tZolpidem\t2\t1.0\tYes\t\nOnychomycosis\tTerbinafine\t2\t1.0\tNo\t\nAnxiety\tLevetiracetam\t1\t0.5\tYes\t\nBiopsy brain abnormal\tLevetiracetam\t1\t0.5\tYes\t\nBlood glucose increased\tInsulin glargine\t1\t0.5\tNo\t\nCircadian rhythm sleep disorder\tZolpidem\t1\t0.5\tYes\t\nDesmoid tumour\tSorafenib\t1\t0.5\tYes\t\nDisturbance in attention\tMethylphenidate\t1\t0.5\tYes\t\nFatigue\tMethylphenidate\t1\t0.5\tYes\t\nFungal skin infection\tTerbinafine\t1\t0.5\tNo\t\nMood swings\tMethylphenidate\t1\t0.5\tYes\t\nMuscle twitching\tLevetiracetam\t1\t0.5\tYes\t\nPruritus\tTerbinafine\t1\t0.5\tYes\t\nRash\tTerbinafine\t1\t0.5\tYes\t\nSleep disorder\tLevetiracetam\t1\t0.5\tYes\t\nTinea infection\tTerbinafine\t1\t0.5\tNo\t\nTinea pedis\tTerbinafine\t1\t0.5\tNo\t\nTinea versicolour\tTerbinafine\t1\t0.5\tNo\t\nSum\t\t196\t100.0\t\t\nPT preferred term\n\n\n\nOf note, the values in column “Potential off-label use” in Table 4 are the result of the comparison of the reported indication against the respective DOI’s Summary of Product Characteristics, not against country-specific labels. An example of a potential off-label use reported in a Tweet is as follows: “We asked < reference > what she does to help her sleep. Her answer? 1,500 mg of < substance name > and a small amount of (legal) cannabis”.\n\nDiscussion\nThe process employed to create the benchmark reference dataset, summarised as follows, was designed to achieve the best-possible quality given the time and resources available in this project:Set up of two independent annotation teams and provision of annotation guidelines\n\nExecution of training for the annotation teams, weekly team meetings and independent issue discussions with both teams\n\nPerforming independent quality control and assurance steps\n\nFinal review and, as required, revision of the AE Tweets in the benchmark reference dataset by a senior medical case evaluator\n\n\n\nHowever, despite careful planning, we faced organisational challenges because of staff turnover and especially, challenges related to the often-ambiguous content of Tweets that sometimes resulted in discordant interpretation and annotation of Tweets:The duration of the Tweet annotation was around 10 months (November 2015–September 2016) and the staff turnover within the annotation teams was high. This meant continued efforts in onboarding and training new team members, and a mix of annotators that already had gained experience with Tweet annotation or were new to this task\n\nIn social media posts, vernacular language is used, which can be interpreted differently by different people reading the posts\n\nDiscrepant identification of DOI due to:Use of abbreviations (e.g. “zolpi” instead of “zolpidem”)\n\nUse of ambiguous terms (e.g. “intermezzo”)\n\nUse of the same trade names for different medications [e.g. “freederm” (Terbinafine) vs “freederm” (nicotinamide)]\n\n\n\nRoom for interpretation of the reported AEs as personal experience vs a general statement, e.g.:\n\n“This medication < substance name > every hours makes you hungry”\n\n“<substance name > dont make me hungry leh. but it might be relaxing u from anxiety and thus ur appetite return”\n\n“Ok, Must be immune to < substance name 1 > . < substance name 2 > it is then or < substance name 3 > to you Americans”\n\n\n\nThe decision for this study to annotate a single Tweet as is (i.e. without reviewing prior or later Tweets of the same Twitter user and without the means to follow-up with the user to clarify what he/she meant by the Tweet) made the annotation susceptible to a high degree of discordant interpretation by the two annotation teams. These discordances were then reviewed and resolved in the quality control and quality assurance steps, as described in Sects. 2.4.4 and 2.4.5.\n\nIn terms of product scope, the benchmark reference dataset is limited, as it includes only six different DOIs. Thus, this dataset, used alone, would not be very useful as input for training of AEs and/or indication classification and a mapping system. However, it can be very useful for testing such systems and comparing the performance of different systems. The benchmark reference dataset has, to our knowledge, a unique combination of features that make it a worthwhile addition to existing reference datasets:It contains both positive and negative controls (AE Tweets and Non-AE Tweets, respectively), which allows calculating performance indicators for a tested system, such as precision and recall\n\nBesides the classification of AE Tweet vs Non-AE Tweet, it also contains the details of all product-event combinations and product-indication combinations identified in each AE Tweet, including verbatims and dictionary mappings for DOIs, AEs and indications. This allows testing of narrow-scoped classifiers and wide-ranged entity recognition and mapping systems\n\nThe annotated AEs refer to personal experiences of drug effects with an explicitly reported, or reasonably assumed, timely or causal association between drug use and AE\n\nBoth AEs and indications have been annotated and coded to MedDRA. This allows testing of algorithms that are designed to identify indications, or to distinguish between AEs and indications, respectively\n\n\n\nOn the topic of identifying indications and non-ADR medical conditions in social media, only a small number of publications were found [8, 12–15] of which one refers to French language [12] and one to Spanish language social media content [15]. Sarker et al. proposed a concept of identifying indications by the frequency of the occurrence of drug-ADR pairs mentioned in close proximity within posts [14], while Nikfarjam et al. [13] reported that the majority of false-positive errors “… were caused by mentions that were confused with indications or non-ADR clinical mentions …”, which indicates that AEs and indications could currently not satisfactorily be separated from each other by automated means and are still a challenge for automated systems and a field for future studies. As the benchmark reference dataset contains both AE and indication annotations and mappings, it should be helpful as a reference for such studies and for improving methods that are capable of identifying both AEs and indications.\n\nWhen 15,195 Tweets had been reviewed by both annotation teams, we conducted an exploratory analysis and discovered we can use Epidemico’s indicator score < 0.3 to automatically flag Tweets as Non-AE Tweets, accepting the loss of a limited number of potential AE Tweets. Five AE Tweets, which were identified in the exploratory analysis and quality control and assurance steps, had an indicator score even below 0.3; these Tweets mainly contained rare PTs (e.g. PT Maternal exposure during pregnancy, PT Condition aggravated, PT Petit mal epilepsy, PT Cardiotoxicity).\n\nFor the detection of AE Tweets, some publications reported an indicator score threshold of ≥ 0.65 or ≥ 0.7 to automatically distinguish between so-called “Proto-AE” (which resembles what is called “AE Tweet” in this article) and Non-AE Tweets [8, 11, 16]. According to our results in the benchmark reference dataset, only 775 of 1056 AE Tweets (73.4%) had an indicator ≥ 0.65, and 662 of 1056 AE Tweets (62.7%) had an indicator score ≥ 0.7. Hence, for the dataset of 57,473 Tweets: applying an indicator score threshold ≥ 0.65 would have missed 26.6% and for a threshold ≥ 0.7, 37.3% of the benchmark AE Tweets. A detailed analysis of the performance of Epidemico’s indicator score against the benchmark reference dataset is beyond the scope of this article and hence, is not included here.\n\nConclusions\nThe proper identification, extraction and mapping of product-event and product-indication combinations in free text is still a challenge. The IMI WEB-RADR project established a publicly available benchmark reference dataset that can be used to test and compare the performance of entity recognition methods targeted at the automated identification and mapping of personal experiences of AEs and indications reported in social media, especially Twitter. Therefore, it hopefully contributes to the improvement of existing and the development of new methods and systems thus contributing to the advancement of pharmacovigilance.\n\nElectronic supplementary material\nBelow is the link to the electronic supplementary material.\nSupplementary material 1 Web-Recognizing Adverse Drug Reactions (WEB-RADR) benchmark reference dataset (XLSX 3847 kb)\n\n Supplementary material 2 System Organ Class distribution (DOCX 16 kb)\n\n Supplementary material 3 Indications assigned per hash tags/references (DOCX 17 kb)\n\n \n\nAcknowledgements\nThe authors are indebted to the following colleagues, past or present, within the WEB-RADR consortium who provided technical support that enabled the research presented in this paper: Tim Casperson, Johan Ellenius, Geoffry Gipson, Daniela Victoria Grohmann, Johnny Gunn, Karin Hace, Simon Maskell, Paul Murphy, Victoria Newbould, the Novartis annotation team, Sheila O’Brien, Jeffery Painter, Carrie Pierce, Sue Rees, Erik Scalfaro, Tata Consultancy Services on behalf of the Bayer AG and Miguel Texeira. The opinions and conclusions of this study are not necessarily those of the national centres which make up the WHO Programme for International Drug Monitoring nor of the WHO. MedDRA® (the Medical Dictionary for Regulatory Activities) terminology is the international medical terminology developed under the auspices of the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). The MedDRA® trademark is owned by the International Federation of Pharmaceutical Manufacturers and Associations on behalf of ICH.\n\nCompliance with Ethical Standards\nFunding\nAll research presented here was conducted by the authors listed. This collaborative effort is provided via the WEB-RADR project (http://www.web-radr.eu), which is supported by the Innovative Medicines Initiative Joint Undertaking under Grant Agreement No. 115632, resources of which comprise financial contributions from the European Union’s Seventh Framework Programme (FP7/2007-2013) and European Federation of Pharmaceutical Industries and Associations companies’ in-kind contribution (http://www.imi.europa.eu). In addition, general support for the development of the social media listening platform was provided by GlaxoSmithKline, independent of the research presented herein.\n\nConflict of Interest\nJuergen Dietrich, Lucie M. Gattepaille, Britta Anne Grum, Letitia Jiri and Daniele Sartori have no conflicts of interest that are directly relevant to the content of this article. Antoni Wisniewski is an employee of AstraZeneca and shareholder of AstraZeneca and GlaxoSmithKline. Magnus Lerch provided scientific advice and support to Bayer AG within the WEB-RADR project and has received compensation for his work from Bayer AG.\n\nEthics Approval\nAll human subject data used in this analysis were publicly available and used in a de-identified format whenever possible.\n\nData Sharing\nData generated or analysed during this study are included in this published article (and its supplementary information files).\n==== Refs\nReferences\n1. Hazell L Shakir SA Under-reporting of adverse drug reactions : a systematic review Drug Saf 2006 29 5 385 396 10.2165/00002018-200629050-00003 16689555 \n2. Caster O Dietrich J Kurzinger ML Lerch M Maskell S Noren GN Assessment of the utility of social media for broad-ranging statistical signal detection in pharmacovigilance: results from the WEB-RADR Project Drug Saf 2018 41 12 1355 1369 10.1007/s40264-018-0699-2 30043385 \n3. Tricco AC Zarin W Lillie E Jeblee S Warren R Khan PA Utility of social media and crowd-intelligence data for pharmacovigilance: a scoping review BMC Med Inform Decis Mak 2018 18 1 38 10.1186/s12911-018-0621-y 29898743 \n4. Sarker A Belousov M Friedrichs J Hakala K Kiritchenko S Mehryary F Data and systems for medication-related text classification and concept normalization from Twitter: insights from the Social Media Mining for Health (SMM4H)-2017 shared task J Am Med Inform Assoc 2018 25 10 1274 1283 10.1093/jamia/ocy114 30272184 \n5. Karimi S Metke-Jimenez A Kemp M Wang C Cadec: a corpus of adverse drug event annotations J Biomed Inform 2015 55 73 81 10.1016/j.jbi.2015.03.010 25817970 \n6. Alvaro N Miyao Y Collier N TwiMed: Twitter and PubMed comparable corpus of drugs, diseases, symptoms, and their relations JMIR Public Health Surveill. 2017 3 2 e24 10.2196/publichealth.6396 28468748 \n7. Gionis A, Indyk P, Motwani R. Similarity search in high dimensions via hashing. Proceedings of the 25th International Conference on Very Large Data Bases. Morgan Kaufmann Publishers Inc.; 1999: p. 518–29.\n8. Pierce CE Bouri K Pamer C Proestel S Rodriguez HW Van Le H Evaluation of Facebook and Twitter monitoring to detect safety signals for medical products: an analysis of recent FDA safety alerts Drug Saf 2017 40 4 317 331 10.1007/s40264-016-0491-0 28044249 \n9. Robinson G A statistical approach to the spam problem Linux J. 2003 2003 107 3 \n10. Casperson TA, Painter JL, Dietrich J. Strategies for distributed curation of social media data for safety and pharmacovigilance. Proceedings of the International Conference on Data Mining (DMIN), The Steering Committee of The World Congress in Computer Science, Computer Engineering and Applied Computing (WorldComp). 2016:118.\n11. Patel RBM, Jani M, Dasgupta N, Winakor C, Nenadic G, Dixon W. Frequent discussion of insomnia and weight gain with glucorticoid therapy: an analysis of Twitter posts. npj Digital Medicine. 2018.\n12. Morlane-Hondère F, Grouin C, Zweigenbaum P. Identification of drug-related medical conditions in social media. Portorož: European Language Resources Association (ELRA); 2016 May: p. 2022–8.\n13. Nikfarjam A Sarker A O’Connor K Ginn R Gonzalez G Pharmacovigilance from social media: mining adverse drug reaction mentions using sequence labeling with word embedding cluster features J Am Med Inform Assoc 2015 22 3 671 681 25755127 \n14. Sarker A Ginn R Nikfarjam A O’Connor K Smith K Jayaraman S Utilizing social media data for pharmacovigilance: a review J Biomed Inform 2015 54 202 212 10.1016/j.jbi.2015.02.004 25720841 \n15. Segura-Bedmar I de la Peña González S Martínez P Extracting drug indications and adverse drug reactions from Spanish health social media 2014 Baltimore (MD) Association for Computational Linguistics 98 106 \n16. Powell GE Seifert HA Reblin T Burstein PJ Blowers J Menius JA Social media listening for routine post-marketing safety surveillance Drug Saf 2016 39 5 443 454 10.1007/s40264-015-0385-6 26798054\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0114-5916",
"issue": "43(5)",
"journal": "Drug safety",
"keywords": null,
"medline_ta": "Drug Saf",
"mesh_terms": "D016907:Adverse Drug Reaction Reporting Systems; D019985:Benchmarking; D016208:Databases, Factual; D064420:Drug-Related Side Effects and Adverse Reactions; D006801:Humans; D060735:Pharmacovigilance; D061108:Social Media; D014481:United States",
"nlm_unique_id": "9002928",
"other_id": null,
"pages": "467-478",
"pmc": null,
"pmid": "31997289",
"pubdate": "2020-05",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "30272184;29898743;25817970;16689555;28468748;25720841;25755127;30043385;26798054;28044249;30740536",
"title": "Adverse Events in Twitter-Development of a Benchmark Reference Dataset: Results from IMI WEB-RADR.",
"title_normalized": "adverse events in twitter development of a benchmark reference dataset results from imi web radr"
} | [
{
"companynumb": "DE-JNJFOC-20200606939",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHYLPHENIDATE HYDROCHLORIDE"
},
"drugadditional... |
{
"abstract": "Apremilast (Otezla®) is a relatively novel orally administered non-biologic disease-modifying anti-rheumatic drug (DMARD) extensively used in the management of psoriasis and psoriasis arthritis, lately approved for treating oral ulcerations in Behçets disease. Its advantageous side effect profile together with its uncomplicated follow-up and monitoring when compared to other DMARDs facilitates even a broad off-label prescribing. Here, the first case of laryngeal pseudotumor in a patient treated with apremilast for plaque psoriasis is presented.",
"affiliations": "Department of Ear Nose and Throat, Faculty of Medicine and Health, Örebro University, Örebro, Sweden.;Department of Ear Nose and Throat, Faculty of Medicine and Health, Örebro University, Örebro, Sweden.",
"authors": "Ntouniadakis|Eleftherios|E|;Landström|Fredrik|F|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000511697",
"fulltext": "\n==== Front\nCase Rep Dermatol\nCase Rep Dermatol\nCDE\nCase Reports in Dermatology\n1662-6567 S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.com \n\n10.1159/000511697\ncde-0012-0275\nSingle Case\nPseudotumor of the Larynx: A Previously Unreported Side Effect of Apremilast\nNtouniadakis Eleftherios * Landström Fredrik Department of Ear Nose and Throat, Faculty of Medicine and Health, Örebro University, Örebro, Sweden\n*Eleftherios Ntouniadakis, Department of Ear Nose and Throat, Faculty of Medicine, Örebro University, SE–70182 Örebro (Sweden), eleftherios.ntouniadakis@oru.se\nSep-Dec 2020 \n16 12 2020 \n16 12 2020 \n12 3 275 281\n28 7 2020 20 9 2020 2020 Copyright © 2020 by S. Karger AG, Basel2020This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.Apremilast (Otezla®) is a relatively novel orally administered non-biologic disease-modifying anti-rheumatic drug (DMARD) extensively used in the management of psoriasis and psoriasis arthritis, lately approved for treating oral ulcerations in Behçets disease. Its advantageous side effect profile together with its uncomplicated follow-up and monitoring when compared to other DMARDs facilitates even a broad off-label prescribing. Here, the first case of laryngeal pseudotumor in a patient treated with apremilast for plaque psoriasis is presented.\n\nKeywords\nLaryngeal pseudotumorLaryngeal obstructionSide effectApremilast\n==== Body\nIntroduction\nApremilast (Otezla®) is an orally administered phosphodiesterase 4 inhibitor. Phosphodiesterase 4 is an enzyme involved in degrading cAMP, thereby stimulating the production of pre-inflammatory mediators and suppressing the anti-inflammatory response [1]. Apremilast is widely used in psoriasis and psoriasis arthritis reducing inflammation, thus eliminating cutaneous manifestations and improving joint functionality, lately approved for treating oral ulcerations in Behçets disease [1, 2, 3]. Considering that it is generally well tolerated by the patients, apremilast is also used in other inflammatory conditions when conventional treatment induces too many side effects, proves to be unsuccessful or the patient is not eligible for other available drugs [3, 4]. Alopecia areata, atopic dermatitis, hidradenitis suppurativa, cutaneous sarcoidosis and discoid lupus are examples of off-label prescribing [2, 5, 6, 7].\n\nApremilast is a relatively novel non-biologic disease modifying anti-rheumatic drug (DMARD) with an advantageous safety: when compared to other DMARDs, apremilast has a favourable side effect profile, is not contraindicated for use in women in fertile age [3], exhibits a good profile of efficacy and safety even among elderly patients [8] and is linked with lower risk for myocardial infarction and stroke among other approved psoriasis treatments [9]. No other monitoring is required apart from weight controls, a follow-up of neuropsychiatric adverse events or the commonly self-limited gastrointestinal symptoms when compared to other non-biologic DMARDs such as methotrexate (i.e., liver toxicity, interstitial lung disease, bone marrow suppression) and cyclosporine (i.e., renal toxicity) [10]. Furthermore, monitoring therapy in biologic DMARDs (e.g., inflixaimab) is rather demanding when considering inter alia elevated risk for establishing malignancy, autoimmunity, heart failure and severe infections due to neutropenia [10].\n\nWe present a rare complication in a 74-year-old female patient with severe plaque psoriasis treated with apremilast.\n\nCase Report\nWith a medical history of hypertension, atrial fibrillation, and spirometry findings of chronic obstructive pulmonary disease, although a nonsmoker, the patient was diagnosed with extensive plaque psoriasis 10 years ago. She was initially treated with UVB phototherapy, however with a rapid relapse of the cutaneous plaques and severe pruritus. A subsequent treatment attempt with methotrexate resulted in liver toxicity despite the successful elimination of the plaques and the pruritus. The patient continued with dense phototherapy sessions until October 2017 when exacerbated symptoms, mainly severe pruritus prompted a reassessment of the treatment strategy. Considering the patient's age and cardiovascular comorbidities, treatment with biological agents (e.g., infliximab) was assessed by the dermatologist as inappropriate, thus a standard dose of apremilast (60 mg twice a day) was prescribed. Except for severe transient diarrhea and a slight abdominal pain during the first 2 weeks, the treatment was well tolerated by the patient with a near-complete resolution of the psoriasis lesions.\n\nThe patient was referred to the Otolaryngology Department in October 2018 with a 3-month history of dysphagia, unilateral odynophagia and dyspnea. An oral contrast swallow examination had shown an expansive lesion in the right side of the hypopharynx. The clinical examination revealed a supraglottic submucosal mass without mucosal engagement, under the right aryepiglottic fold, extending posteriorly to hypopharynx, medially to false vocal cord and laterally to the lateral wall of the pharynx displacing epiglottis to the left side (Fig. 1a). The laryngeal vestibulum was partially occluded thus causing a mild inspiratory stridor. The only slightly abnormal values within the extensive laboratory test performed were C-reactive protein (13 mg/L, reference <4 mg/mL) and white blood cell count (10.0 ×109/L, reference interval: 3.5–8.8 ×109/L). Further investigation with computed tomography showed a 2.5-cm mass arising from the lateral wall of the pharynx, loading contrast irregularly, suggesting a possibly malignant tumor (Fig. 1b, c).\n\nCore needle biopsy from the lesion under general anesthesia showed fibrosis with chronic nonspecific inflammation and hyperplastic squamous epithelial fragments. A second suspension laryngoscopy was performed to obtain more representative specimens for pathology assessment. Despite the combination of CO2 laser dissection together with cold instruments, it was impossible to reveal a demarcated mass; however, deep cold forceps biopsies were obtained. Because of the progress of the expansive lesion within a few days and the risk for a compromised airway due to an unstable aryepiglottic fold with a tilting right arytenoid cartilage in the laryngeal vestibule, a tracheostomy was performed concurrently. Again, the biopsies were not conclusive, showing unspecific acute and chronic inflammation with fibrosis. Complementary pathological examination showed no signs of vasculitis, IgG4-related disease or amyloidosis. In a parallel immunological workup including ANA, ANCA, anti-CCP, a marginal increase in ANA was found not regarded though as diagnostic. Apremilast medication was discontinued in December 2018 following a suspicion that the pseudotumor could be a side effect of the treatment.\n\nIn January 2019, the patient presented to the Emergency Department due to dislodgement of the tracheostomy tube. Laryngoscopy revealed a substantial reduction of the pseudotumor (Fig. 2) allowing for safe decannulation. Subsequent follow-up showed an almost complete remission of the pseudotumor, both clinically and radiologically (Fig. 3). The patient recovered almost completely after 6 months having just a mild functional dysphonia. This previously unknown side effect was reported to the Swedish Medical Products Agency.\n\nDiscussion\nWith only a few mild to moderate adverse events reported, apremilast is a safe and effective approved medication in patients with psoriasis, psoriasis arthritis and Behçet's disease. Discontinuation of treatment due to common side effects is rare [5]. According to Langley and Beecker [5], diarrhea and nausea are frequently mild and self-resolving within 1 month, headache could be handled with conventional painkillers, whereas nasopharyngitis is not a reason for treatment termination and is regularly managed with nasal irrigation, antihistamines and antibiotics upon culture-proven bacterial infection [5]. A PubMed search identified several previously reported unusual side effects of apremilast such as severe bitter taste, chronic diarrhea with malnutrition, cutaneous hyperpigmentation, chronic tearing, recurrence of melanoma and purpura annularis telangiectodes of Majocchi [11, 12, 13, 14, 15, 16]. An association with an elevated suicidality risk was also found during the clinical trials [17].\n\nTo our knowledge, this is the first reported case identifying a pseudotumor of the larynx associated with apremilast treatment leading to a potentially life-threatening, severely compromised airway. When the medication was discontinued the pseudotumor had a complete remission.\n\nIn conclusion, the process of a broad-minded medication review is always of importance to assess potential interactions or adverse events in patients presenting with signs or symptoms of unclear cause.\n\nStatement of Ethics\nThe authors have no ethical conflicts to disclose. The patient has given written informed consent to publish this case (including publication of images). The study has been done according to the Declaration of Helsinki.\n\nConflict of Interest Statement\nThe authors have no conflicts of interest to declare.\n\nFunding Sources\nThis study was funded by the Research Committee in Region Örebro Council.\n\nAuthor Contributions\nAll named authors meet the International Committee of Medical Journal Editors (ICMJE) criteria for authorship for the manuscript, take responsibility for the integrity of the work as a whole, and gave final approval to the version to be published.\n\nFig. 1 Supraglottic submucosal mass on the right side of the larynx, inferior to the right aryepiglottic fold and piriform sinus, October 2018. a Flexible video laryngoscopy. b Axial computed tomography scan of the neck. c Coronal computed tomography scan of the neck.\n\nFig. 2 Substantial regress of the pseudotumor within 1.5 months after discontinuation of apremilast, January 2019. a Flexible video laryngoscopy. b Axial computed tomography scan of the neck. c Coronal computed tomography scan of the neck.\n\nFig. 3 Complete regress 4 months after the discontinuation of apremilast, April 2019. a Flexible video laryngoscopy. b Axial computed tomography scan of the neck. c Coronal computed tomography scan of the neck.\n==== Refs\nReferences\n1 Keating GM Apremilast: A Review in Psoriasis and Psoriatic Arthritis Drugs 2017 3 77 (4) 459 72 28213862 \n2 Maloney NJ Zhao J Tegtmeyer K Lee EY Cheng K Off-label studies on apremilast in dermatology: a review J Dermatolog Treat 2020 3 31 (2) 131 40 30935262 \n3 Shavit E Shear NH An update on the safety of apremilast for the treatment of plaque psoriasis Expert Opin Drug Saf 2020 4 19 (4) 403 8 32182143 \n4 Dattola A Del Duca E Saraceno R Gramiccia T Bianchi L Safety evaluation of apremilast for the treatment of psoriasis Expert Opin Drug Saf 2017 3 16 (3) 381 5 28132578 \n5 Langley A Beecker J Management of Common Side Effects of Apremilast J Cutan Med Surg 2018 Jul-Aug 22 (4) 415 21 29290125 \n6 Estébanez A Estébanez N Martín JM Montesinos E Apremilast in Refractory Alopecia Areata Int J Trichology 2019 Sep-Oct 11 (5) 213 5 31728104 \n7 Hatemi G Mahr A Ishigatsubo Y Song YW Takeno M Kim D Trial of Apremilast for Oral Ulcers in Behçet's Syndrome N Engl J Med 2019 11 381 (20) 1918 28 31722152 \n8 Megna M Fabbrocini G Camela E Cinelli E Apremilast efficacy and safety in elderly psoriasis patients over a 48-weeks period Journal of the European Academy of Dermatology and Venereology: JEADV 2020 Apr 10 \n9 Persson R Hagberg KW Qian Y Vasilakis-Scaramozza C Jick S The risk of myocardial infarction, stroke, and revascularization among patients with psoriasis treated with apremilast compared with biologics and disease-modifying antirheumatic drugs: A cohort study in the US MarketScan database J Am Acad Dermatol 2020 7 83 (1) 271 4 32222448 \n10 Gladman DD Ritchlin C Romain P Treatment of psoriatic arthritis Up to date 2018 Waltham, MA UpToDate \n11 Kalik JA Friedman H Bechtel MA Gru AA Kaffenberger BH Purpura Annularis Telangiectodes of Majocchi Associated With the Initiation and Rechallenge of Apremilast for Psoriasis Vulgaris JAMA Dermatol 2017 11 153 (11) 1197 8 28793154 \n12 Salopek TG Recurrence of Melanoma after Starting Apremilast for Psoriasis Case Rep Dermatol 2017 8 9 (2) 108 11 \n13 Mallick B Praharaj DL Nath P Panigrahi SC Apremilast induced chronic diarrhea and malnutrition Drug Discov Ther 2018 12 (6) 379 80 30674774 \n14 Norris MR Bielory L Chronic tearing induced by apremilast. Annals of allergy, asthma & immunology: official publication of the American College of Allergy, Asthma, & Immunology 2018 9 121 (3) 375 \n15 Damiani G Bragazzi NL Grossi E Petrou S Radovanovic D Rizzi M Severe bitter taste associated with apremilast Dermatol Ther (Heidelb) 2019 5 32 (3) e12876 \n16 Vazquez B Gonzalez V Molina I Montesinos E Ramon MD Monteagudo C Multiple lentigines arising on resolving psoriatic plaques after treatment with apremilast Clin Exp Dermatol 2019 1 44 (1) 66 7 29926507 \n17 Vakharia PP Orrell KA Lee D Rangel SM Lund E Laumann AE Apremilast and suicidality - a retrospective analysis of three large databases: the FAERS, EudraVigilance and a large single-centre US patient population J Eur Acad Dermatol Venereol 2017 10 31 (10) e463 4 28380251\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-6567",
"issue": "12(3)",
"journal": "Case reports in dermatology",
"keywords": "Apremilast; Laryngeal obstruction; Laryngeal pseudotumor; Side effect",
"medline_ta": "Case Rep Dermatol",
"mesh_terms": null,
"nlm_unique_id": "101517685",
"other_id": null,
"pages": "275-281",
"pmc": null,
"pmid": "33568982",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "29033813;31722152;32222448;32277507;28213862;28793154;29969663;28132578;32182143;30674774;31728104;28380251;30882959;29926507;29290125;30935262",
"title": "Pseudotumor of the Larynx: A Previously Unreported Side Effect of Apremilast.",
"title_normalized": "pseudotumor of the larynx a previously unreported side effect of apremilast"
} | [
{
"companynumb": "SE-MYLANLABS-2021M1049350",
"fulfillexpeditecriteria": "1",
"occurcountry": "SE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "APREMILAST"
},
"drugadditional": "1",
... |
{
"abstract": "This monocentric retrospective study included 70 consecutive relapsed/refractory Hodgkin lymphoma (RR-HL) patients receiving reduced-intensity allogeneic stem cell transplantation (alloSCT). We evaluated overall and progression-free survival (OS, PFS), graft-versus host disease/relapse-free survival (GFRS), and chronic GVHD-free OS (cGVHD-free OS) defined as OS without moderate-to-severe cGVHD. Patients had a median age of 33 years (range, 18-60 years), 23% had refractory disease (SD/PD). Donors were HLA identical (39%), unrelated (30%), or haploidentical (31%). Median follow-up was 6.2 years. Five-year OS was 59% and PFS was 49%. NRM was 16% at 1 year. 44% of patients had cGVHD, and 14% moderate-to-severe cGVHD at last follow-up. GFRS and cGVHD-free OS were 26 and 48% at 5 years. In multivariate analysis, resistant disease at alloSCT impacted survival and GFRS. In conclusion, disease response before alloSCT impacts survival and GFRS. GVHD outcomes may help comparing the long-term effects of the new salvage treatments that bridge patients to alloSCT.",
"affiliations": "a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.;a Division of Hematology , Fondazione IRCCS Istituto Nazionale Tumori , Milan , Italy.",
"authors": "Spina|Francesco|F|;Radice|Tommaso|T|;De Philippis|Chiara|C|;Soldarini|Martina|M|;Di Chio|Maria Chiara|MC|;Dodero|Anna|A|;Guidetti|Anna|A|;Viviani|Simonetta|S|;Corradini|Paolo|P|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1080/10428194.2018.1459607",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1026-8022",
"issue": "60(1)",
"journal": "Leukemia & lymphoma",
"keywords": "GFRS; Hodgkin lymphoma; allogeneic transplantation; cGVHD-free survival; long-term survival",
"medline_ta": "Leuk Lymphoma",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D002648:Child; D019008:Drug Resistance, Neoplasm; D005260:Female; D005500:Follow-Up Studies; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006689:Hodgkin Disease; D006801:Humans; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D000077982:Progression-Free Survival; D011788:Quality of Life; D012189:Retrospective Studies; D016879:Salvage Therapy; D012720:Severity of Illness Index; D016019:Survival Analysis; D013997:Time Factors; D019172:Transplantation Conditioning; D014184:Transplantation, Homologous; D055815:Young Adult",
"nlm_unique_id": "9007422",
"other_id": null,
"pages": "101-109",
"pmc": null,
"pmid": "29716416",
"pubdate": "2019-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Allogeneic transplantation for relapsed and refractory Hodgkin lymphoma: long-term outcomes and graft-versus-host disease-free/relapse-free survival.",
"title_normalized": "allogeneic transplantation for relapsed and refractory hodgkin lymphoma long term outcomes and graft versus host disease free relapse free survival"
} | [
{
"companynumb": "IT-ADIENNEP-2019AD000147",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUDARABINE PHOSPHATE"
},
"drugadditional": "3... |
{
"abstract": "An elderly woman presented with a 3-month history of nonhealing, tender ulcers involving the right calf and both forearms. She denied any history of similar lesions or trauma. Two trials of oral antibiotics had led to no improvement. Her medical history was significant for rheumatoid arthritis treated with methotrexate, hydroxychloroquine, and prednisone. A review of clinical manifestations was otherwise negative for disease. Physical examination of the patient's right calf revealed two punched-out ulcers with central necrotic black eschars, underlying retiform purpuric pattern, and mild fibrinopurulent drainage (Figure 1). Similar lesions were present on her forearms (Figures 2 and 3). No other remarkable skin changes were noted. The differential diagnosis included polyarteritis nodosa, cutaneous necrosis secondary to antiphospholipid syndrome, cryoglobulinemic vasculitis, and an atypical presentation of pyoderma gangernosum.",
"affiliations": "Department of Dermatology, University of Colorado, Aurora, CO, University of South Florida Morsani College of Medicine, Tampa, FL; michael.cameron@ucdenver.edu.;Department of Dermatology and Cutaneous Surgery, University of South Florida Morsani College of Medicine, Tampa, FL.;Department of Internal Medicine, University of South Florida Morsani College of Medicine, Tampa, FL.;Department of Internal Medicine, University of South Florida Morsani College of Medicine, Tampa, FL.;Department of Dermatology and Cutaneous Surgery, University of South Florida Morsani College of Medicine, Tampa, FL.",
"authors": "Cameron|Michael C|MC|;Katayama|Mitsuya|M|;Patel|Nishit S|NS|;Shenefelt|Philip D|PD|;Somboonwit|Charurut|C|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1540-9740",
"issue": "15(2)",
"journal": "Skinmed",
"keywords": null,
"medline_ta": "Skinmed",
"mesh_terms": "D000368:Aged; D016736:Antiphospholipid Syndrome; D001707:Biopsy, Needle; D003937:Diagnosis, Differential; D005260:Female; D005542:Forearm; D006801:Humans; D007150:Immunohistochemistry; D035002:Lower Extremity; D010488:Polyarteritis Nodosa; D017511:Pyoderma Gangrenosum; D012720:Severity of Illness Index; D012883:Skin Ulcer",
"nlm_unique_id": "101168327",
"other_id": null,
"pages": "149-151",
"pmc": null,
"pmid": "28528615",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Chronic Tender Ulcers on the Calf and Both Forearms.",
"title_normalized": "chronic tender ulcers on the calf and both forearms"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2019R1-215231",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drug... |
{
"abstract": "The olfactory bulbs and tracts are central nervous system white matter tracts maintained by central neuroglia. Although rare, gliomas can originate from and progress to involve the olfactory apparatus. Through a Health Insurance Portability and Accountability Act-compliant retrospective review of the institutional teaching files and brain MR imaging reports spanning 10 years, we identified 12 cases of gliomas involving the olfactory bulbs and tracts, including 6 cases of glioblastoma, 2 cases of anaplastic oligodendroglioma, and 1 case each of pilocytic astrocytoma, diffuse (grade II) astrocytoma, anaplastic astrocytoma (grade III), and diffuse midline glioma. All except the pilocytic astrocytoma occurred in patients with known primary glial tumors elsewhere. Imaging findings of olfactory tumor involvement ranged from well-demarcated enhancing masses to ill-defined enhancing infiltrative lesions to nonenhancing masslike FLAIR signal abnormality within the olfactory tracts. Familiarity with the imaging findings of glioma involvement of the olfactory nerves is important for timely diagnosis and treatment of recurrent gliomas and to distinguish them from other disease processes.",
"affiliations": "From the Department of Radiology and Imaging Sciences (X.W.), Emory University, Atlanta, Georgia xin.wu@emory.edu.;Departments of Clinical Radiology (Y.L., C.M.G.).;Departments of Clinical Radiology (Y.L., C.M.G.).;Radiology (S.C.).",
"authors": "Wu|X|X|0000-0001-5952-3402;Li|Y|Y|0000-0001-8535-2168;Glastonbury|C M|CM|0000-0002-9611-1287;Cha|S|S|0000-0002-5924-5876",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.3174/ajnr.A6471",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0195-6108",
"issue": "41(4)",
"journal": "AJNR. American journal of neuroradiology",
"keywords": null,
"medline_ta": "AJNR Am J Neuroradiol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D001932:Brain Neoplasms; D002648:Child; D005260:Female; D005910:Glioma; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D009830:Olfactory Bulb; D009833:Olfactory Pathways; D012189:Retrospective Studies",
"nlm_unique_id": "8003708",
"other_id": null,
"pages": "712-717",
"pmc": null,
"pmid": "32165363",
"pubdate": "2020-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "26949582;21484358;23904351;20376552;20886597;10350200;15664571;25247328;26405082;26874814;29188212;24744944;29872547;29040722;15185758",
"title": "Involvement of the Olfactory Apparatus by Gliomas.",
"title_normalized": "involvement of the olfactory apparatus by gliomas"
} | [
{
"companynumb": "US-AMGEN-USASP2021011299",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nExtensively drug-resistant tuberculosis has been reported in 45 countries, including countries with limited resources and a high burden of tuberculosis. We describe the management of extensively drug-resistant tuberculosis and treatment outcomes among patients who were referred for individualized outpatient therapy in Peru.\n\n\nMETHODS\nA total of 810 patients were referred for free individualized therapy, including drug treatment, resective surgery, adverse-event management, and nutritional and psychosocial support. We tested isolates from 651 patients for extensively drug-resistant tuberculosis and developed regimens that included five or more drugs to which the infecting isolate was not resistant.\n\n\nRESULTS\nOf the 651 patients tested, 48 (7.4%) had extensively drug-resistant tuberculosis; the remaining 603 patients had multidrug-resistant tuberculosis. The patients with extensively drug-resistant tuberculosis had undergone more treatment than the other patients (mean [+/-SD] number of regimens, 4.2+/-1.9 vs. 3.2+/-1.6; P<0.001) and had isolates that were resistant to more drugs (number of drugs, 8.4+/-1.1 vs. 5.3+/-1.5; P<0.001). None of the patients with extensively drug-resistant tuberculosis were coinfected with the human immunodeficiency virus (HIV). Patients with extensively drug-resistant tuberculosis received daily, supervised therapy with an average of 5.3+/-1.3 drugs, including cycloserine, an injectable drug, and a fluoroquinolone. Twenty-nine of these patients (60.4%) completed treatment or were cured, as compared with 400 patients (66.3%) with multidrug-resistant tuberculosis (P=0.36).\n\n\nCONCLUSIONS\nExtensively drug-resistant tuberculosis can be cured in HIV-negative patients through outpatient treatment, even in those who have received multiple prior courses of therapy for tuberculosis.",
"affiliations": "Harvard Medical School, Boston, USA.",
"authors": "Mitnick|Carole D|CD|;Shin|Sonya S|SS|;Seung|Kwonjune J|KJ|;Rich|Michael L|ML|;Atwood|Sidney S|SS|;Furin|Jennifer J|JJ|;Fitzmaurice|Garrett M|GM|;Alcantara Viru|Felix A|FA|;Appleton|Sasha C|SC|;Bayona|Jaime N|JN|;Bonilla|Cesar A|CA|;Chalco|Katiuska|K|;Choi|Sharon|S|;Franke|Molly F|MF|;Fraser|Hamish S F|HS|;Guerra|Dalia|D|;Hurtado|Rocio M|RM|;Jazayeri|Darius|D|;Joseph|Keith|K|;Llaro|Karim|K|;Mestanza|Lorena|L|;Mukherjee|Joia S|JS|;Muñoz|Maribel|M|;Palacios|Eda|E|;Sanchez|Epifanio|E|;Sloutsky|Alexander|A|;Becerra|Mercedes C|MC|",
"chemical_list": "D000995:Antitubercular Agents",
"country": "United States",
"delete": false,
"doi": "10.1056/NEJMoa0800106",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-4793",
"issue": "359(6)",
"journal": "The New England journal of medicine",
"keywords": null,
"medline_ta": "N Engl J Med",
"mesh_terms": "D000328:Adult; D000553:Ambulatory Care; D000995:Antitubercular Agents; D003131:Combined Modality Therapy; D023801:Directly Observed Therapy; D004359:Drug Therapy, Combination; D054908:Extensively Drug-Resistant Tuberculosis; D005260:Female; D018023:HIV Seronegativity; D006801:Humans; D008297:Male; D009169:Mycobacterium tuberculosis; D010568:Peru; D012189:Retrospective Studies; D012944:Social Support; D013183:Sputum; D018088:Tuberculosis, Multidrug-Resistant",
"nlm_unique_id": "0255562",
"other_id": null,
"pages": "563-74",
"pmc": null,
"pmid": "18687637",
"pubdate": "2008-08-07",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "15664227;17253901;17690121;9167461;16546546;17914919;15732737;10459906;17084757;8708745;10529902;10713001;11467371;12076553;15971391;15581210;9848607;11450868;15273133;17990220;17968823;17599311;16088472;18094133;11185410;16562709;14962530;10815117;8443300;17990221;16928717;12519922;17301295;17015625;17822187;16941364;12190884;17083413;9603145;17412727;12837348;17552090;15246180;11409587;17964351;16557213;8849750;17321178;12535403;15182146",
"title": "Comprehensive treatment of extensively drug-resistant tuberculosis.",
"title_normalized": "comprehensive treatment of extensively drug resistant tuberculosis"
} | [
{
"companynumb": "US-BAYER-2018-126298",
"fulfillexpeditecriteria": "1",
"occurcountry": "PE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Cytomegalovirus infection, which can occur as a result of reactivation due to immunosuppressive treatment in patients with granulomatosis with polyangiitis, is a serious condition that should be kept in mind because of its fatal course. In this article, we report a 49-year-old male patient with a diagnosis of granulomatosis with polyangiitis who developed a life-threatening colonic ulcer due to cytomegalovirus colitis and a shrunken spleen with irregular contours that was detected on abdominal computed tomography. This is a rare case of cytomegalovirus disease in a patient with granulomatosis with polyangiitis and splenic necrosis.",
"affiliations": "Department of Rheumatology, Katip Çelebi University Atatürk Training and Research Hospital, İzmir, Turkey.;Department of Rheumatology, Katip Çelebi University Atatürk Training and Research Hospital, İzmir, Turkey.;Department of Radiology, Katip Çelebi University Atatürk Training and Research Hospital, İzmir, Turkey.;Department of Pathology, Katip Çelebi University Atatürk Training and Research Hospital, İzmir, Turkey.;Department of Rheumatology, Katip Çelebi University Atatürk Training and Research Hospital, İzmir, Turkey.",
"authors": "Gerçik|Önay|Ö|;Solmaz|Dilek|D|;Karasu|Şebnem|Ş|;Ekinci|Neşe|N|;Akar|Servet|S|",
"chemical_list": null,
"country": "Turkey",
"delete": false,
"doi": "10.5606/ArchRheumatol.2019.7306",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2148-5046",
"issue": "34(4)",
"journal": "Archives of rheumatology",
"keywords": "Antineutrophil cytoplasmic antibody-associated vasculitis; Wegener granulomatosis; cytomegalovirus; granulomatosis with polyangiitis; infarct; splenic",
"medline_ta": "Arch Rheumatol",
"mesh_terms": null,
"nlm_unique_id": "101639000",
"other_id": null,
"pages": "447-450",
"pmc": null,
"pmid": "32010895",
"pubdate": "2019-12",
"publication_types": "D002363:Case Reports",
"references": "29302827;7829690;17827845;11146314;9431585;1646834;15567122;23435132;1933181;11760178;18577548;8215005;17889260;27682069",
"title": "Cytomegalovirus Disease in a Patient With Granulomatosis With Polyangiitis Who Also Has Splenic Necrosis.",
"title_normalized": "cytomegalovirus disease in a patient with granulomatosis with polyangiitis who also has splenic necrosis"
} | [
{
"companynumb": "TR-FRESENIUS KABI-FK202000804",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "Chronic pain is frequently comorbid with opioid abuse and severe depression, a combination that greatly compounds suicide risk. In addition to the therapeutic value of buprenorphine in addiction and analgesia, growing evidence suggests potential use as an antidepressant. Data supporting buprenorphine antisuicidal properties are scarce. We aim to contribute to the discussion of buprenorphine antisuicidal potential in patients with significant psychiatric and medical comorbidity.\n\n\n\nWe performed a chart review of suicidal adult depressed patients with comorbid chronic pain and opioid use disorder who received off-label buprenorphine in outpatient and inpatient settings in a university hospital between 2013 and 2016.\n\n\n\nFour of the patients had an early positive response. However, only three continue to adhere to treatment for six months or longer.\n\n\n\nMore severe opioid use disorder seems to more negatively influence clinical outcome, independently of cluster b personality traits. Identification of patients who could benefit from buprenorphine will require further studies.",
"affiliations": "Western Psychiatric Institute and Clinic, University of Pittsburgh Medical Center, Pittsburgh, PA, USA.;Psychiatric Research Institute, University of Arkansas for Medical Sciences, Little Rock, AR, USA.;Psychiatric Research Institute, University of Arkansas for Medical Sciences, Little Rock, AR, USA.;Psychiatric Research Institute, University of Arkansas for Medical Sciences, Little Rock, AR, USA.;Department of Psychiatry, Stony Brook University, Stony Brook, NY, USA.",
"authors": "Gibbs|Hunter M|HM|;Price|Daniel|D|;Delgado|Pedro L|PL|;Clothier|Jeffrey L|JL|;Cáceda|Ricardo|R|0000-0001-6434-488X",
"chemical_list": "D000701:Analgesics, Opioid; D000928:Antidepressive Agents; D002047:Buprenorphine",
"country": "United States",
"delete": false,
"doi": "10.1177/0091217420913396",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0091-2174",
"issue": "55(6)",
"journal": "International journal of psychiatry in medicine",
"keywords": "buprenorphine; depression; pain; personality; suicide",
"medline_ta": "Int J Psychiatry Med",
"mesh_terms": "D000328:Adult; D000701:Analgesics, Opioid; D000928:Antidepressive Agents; D002047:Buprenorphine; D059350:Chronic Pain; D003866:Depressive Disorder; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D059408:Pain Management; D012189:Retrospective Studies; D059020:Suicidal Ideation",
"nlm_unique_id": "0365646",
"other_id": null,
"pages": "387-396",
"pmc": null,
"pmid": "32216493",
"pubdate": "2020-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Buprenorphine use for pain and suicidal ideation in severely suicidal patients.",
"title_normalized": "buprenorphine use for pain and suicidal ideation in severely suicidal patients"
} | [
{
"companynumb": "US-TEVA-2020-US-1856324",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "BUPRENORPHINE"
},
"drugadditional": null,
... |
{
"abstract": "Activated prothrombin complex concentrates factor eight inhibitor bypassing activity (FEIBA) has been recommended for reversing novel oral anticoagulants (NOAC) in the context of intracerebral hemorrhage (ICH), though few clinical studies report its use.\n\n\n\nA prospective study of patients with spontaneous ICH was conducted from May 2013 to May 2015. Hospital complications including hemorrhage (gastrointestinal bleeding, anemia requiring transfusion, and surgical site bleeding) and thrombosis (pulmonary embolus, deep vein thrombosis, ischemic stroke, and myocardial infarction) were recorded. All ICH patients underwent baseline head CT and a follow-up stability scan in 6 h. NOAC taken within 48 h of presentation was reversed with FEIBA (50 u/kg) per protocol. Three-month outcomes were assessed using the modified rankin score (mRS).\n\n\n\nOf 127 ICH patients enrolled, 6 (5 %) had NOAC-related ICH including: oral factor XA inhibitor N = 5 (4 %; N = 4 rivaroxaban, N = 1 apixaban] and direct thrombin inhibitor N = 1 (0.8 %; dabigatran). The indication for NOAC was atrial fibrillation in all patients and the median CHADS2-VASC score was 4 (range 2-5). The median admission NIHSS was 2 (range 0-14) and the median ICH volume was 8 mL (range 1-20). Five patients (3 rivaroxaban, 1 apixaban, 1 dabigatran) presented within 48 h and received FEIBA within a median of 13 h (range 10-29 h) from their last NOAC dose and 8 h (range 4.5-20) from the time last known well. None of the patients had ICH expansion, hemorrhagic, or thrombotic complications. Three-month median mRS was 1 (range 0-6).\n\n\n\nIn this small case series, reversal of NOAC with FEIBA was not associated with ICH expansion or any thrombotic or hemorrhagic complications.",
"affiliations": "Cerebrovascular Center of the Neurological Institute, Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH, 44195, USA.;Cerebrovascular Center of the Neurological Institute, Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH, 44195, USA.;Cerebrovascular Center of the Neurological Institute, Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH, 44195, USA.;Cerebrovascular Center of the Neurological Institute, Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH, 44195, USA.;Cerebrovascular Center of the Neurological Institute, Cleveland Clinic, 9500 Euclid Ave., Cleveland, OH, 44195, USA. frontej@ccf.org.",
"authors": "Dibu|Jamil R|JR|;Weimer|Jonathan M|JM|;Ahrens|Christine|C|;Manno|Edward|E|;Frontera|Jennifer A|JA|",
"chemical_list": "D000991:Antithrombins; D001779:Blood Coagulation Factors; D003029:Coagulants; D065427:Factor Xa Inhibitors; C065655:anti-inhibitor coagulant complex",
"country": "United States",
"delete": false,
"doi": "10.1007/s12028-015-0213-y",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1541-6933",
"issue": "24(3)",
"journal": "Neurocritical care",
"keywords": "Activated prothrombin complex concentrate; Anticoagulant-related intracerebral hemorrhage reversal; Intracerebral hemorrhage; Novel oral anticoagulants",
"medline_ta": "Neurocrit Care",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D000991:Antithrombins; D001779:Blood Coagulation Factors; D002543:Cerebral Hemorrhage; D003029:Coagulants; D065427:Factor Xa Inhibitors; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D017063:Outcome Assessment, Health Care; D012189:Retrospective Studies",
"nlm_unique_id": "101156086",
"other_id": null,
"pages": "413-9",
"pmc": null,
"pmid": "26545367",
"pubdate": "2016-06",
"publication_types": "D016428:Journal Article",
"references": "12435257;24296541;17961169;25926585;7703054;7631356;23625942;26022637;23584314;26095746;15385040;24383848;12010424;24166666;24529498;21309657;22042927;19717844;25371966;22315263;24617554;23020832;25596769;21830957;23455714;22627883",
"title": "The Role of FEIBA in Reversing Novel Oral Anticoagulants in Intracerebral Hemorrhage.",
"title_normalized": "the role of feiba in reversing novel oral anticoagulants in intracerebral hemorrhage"
} | [
{
"companynumb": "US-BAYER-2016-122676",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "APIXABAN"
},
"drugadditional": null,
"d... |
{
"abstract": "A group of 158 patients with small cell carcinoma of the lung were followed for 174.5 person-years of observation to determine the risk of acute leukemia. Three cases of acute nonlymphocytic leukemia were observed at 2.3, 2.7, and 3.0 years. The relative risk of developing leukemia was 316 (95% confidence limit, 76-818) and the actuarial risk was 25% +/- 13% at 3.1 years. The relative risk for leukemia was significantly increased in these patients (p less than 0.0001).",
"affiliations": null,
"authors": "Chak|L Y|LY|;Sikic|B I|BI|;Tucker|M A|MA|;Horns|R C|RC|;Cox|R S|RS|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1200/JCO.1984.2.5.385",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0732-183X",
"issue": "2(5)",
"journal": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"keywords": null,
"medline_ta": "J Clin Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D018288:Carcinoma, Small Cell; D002986:Clinical Trials as Topic; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D007938:Leukemia; D007953:Leukemia, Radiation-Induced; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D011878:Radiotherapy; D011897:Random Allocation; D012306:Risk; D013997:Time Factors",
"nlm_unique_id": "8309333",
"other_id": null,
"pages": "385-90",
"pmc": null,
"pmid": "6327924",
"pubdate": "1984-05",
"publication_types": "D002363:Case Reports; D016430:Clinical Trial; D003160:Comparative Study; D016428:Journal Article; D013487:Research Support, U.S. Gov't, P.H.S.",
"references": null,
"title": "Increased incidence of acute nonlymphocytic leukemia following therapy in patients with small cell carcinoma of the lung.",
"title_normalized": "increased incidence of acute nonlymphocytic leukemia following therapy in patients with small cell carcinoma of the lung"
} | [
{
"companynumb": "US-PFIZER INC-2019059858",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThe small cell lung cancer (SCLC) is a rapidly progressive malignancy with a poor prognosis. Its chemosensitivity mandates prompt treatment. Hyponatremia occurs frequently in patients with small cell lung cancer due to the syndrome of inappropriate antidiuretic hormone (SIADH). We report a case of severe hyponatremia induced by chemotherapy that required management in intensive care.\n\n\nMETHODS\nA 68-year-old patient was undergoing treatment for small cell cancer, invading the right lung. On the second day of the first cycle of treatment (cisplatine-vepeside), the patient became comatose and required transfer to an intensive care unit. The coma was due to severe hyponatremia (107 mmol/L) and improved with specific treatment. The patient had similar episodes on the second day of each chemotherapy treatment but with less and less severe clinical manifestations. Hyponatremia due to chemotherapy in SCLC is not commonly known; a relation between hyponatremia intensity and the tumor size is suspected.\n\n\nCONCLUSIONS\nThis clinical case highlights the possibility of severe hyponatremia during small cell lung cancer chemotherapy. Hyponatremia may be related to the reduction in tumor size. Monitoring of electrolytes on day 2 of chemotherapy is advised.",
"affiliations": "Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France.;Service de pneumologie - maladies infectieuses et tropicales, centre hospitalier de Saint-Quentin, 1, avenue Miche-de -l'Hospital, BP 608, 02321 Saint-Quentin cedex, France. Electronic address: dayen.charles@live.fr.",
"authors": "Garoute|C|C|;Plouvier|N|N|;Iacob|E|E|;Cotrel|R|R|;Suguenot|R|R|;Lecuyer|E|E|;Bentayeb|H|H|;Douadi|Y|Y|;Dayen|C|C|",
"chemical_list": "D005047:Etoposide; D002945:Cisplatin",
"country": "France",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0761-8425",
"issue": "32(1)",
"journal": "Revue des maladies respiratoires",
"keywords": "Cancer bronchique à petites cellules; Chemotherapy; Chimiothérapie; Hyponatremia; Hyponatrémie; Small cell lung cancer; Syndrome de sécrétion inappropriée d’hormone antidiurétique; Syndrome of inappropriate antidiuretic hormone secretion",
"medline_ta": "Rev Mal Respir",
"mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D018288:Carcinoma, Small Cell; D002945:Cisplatin; D003128:Coma; D005047:Etoposide; D006801:Humans; D007010:Hyponatremia; D007177:Inappropriate ADH Syndrome; D008175:Lung Neoplasms; D008297:Male; D012008:Recurrence; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "8408032",
"other_id": null,
"pages": "52-7",
"pmc": null,
"pmid": "25618205",
"pubdate": "2015-01",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Severe hyponatremia during chemotherapy for small cell carcinoma.",
"title_normalized": "severe hyponatremia during chemotherapy for small cell carcinoma"
} | [
{
"companynumb": "FR-CORDEN PHARMA LATINA S.P.A.-FR-2015COR000236",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugad... |
{
"abstract": "We describe 2 human immunodeficiency virus-infected patients who developed hypertension and severe neurological abnormalities while receiving successful antiretroviral therapy. Neuroimaging findings were characteristic of reversible posterior leukoencephalopathy syndrome, a brain-capillary leak syndrome with hypertension and endothelial damage. We discuss the role of antiretroviral therapy-associated metabolic alterations in endothelial damage, hypertension, and reversible posterior leukoencephalopathy syndrome.",
"affiliations": "Department of Clinical Sciences, Section of Infectious Diseases and Immunopathology, University of Milan, Milan, Italy.",
"authors": "Ridolfo|Anna Lisa|AL|;Resta|Federico|F|;Milazzo|Laura|L|;Caramma|Ilaria|I|;Matacena|Giovanni|G|;Antinori|Spinello|S|;Galli|Massimo|M|",
"chemical_list": "D044966:Anti-Retroviral Agents",
"country": "United States",
"delete": false,
"doi": "10.1086/524740",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1058-4838",
"issue": "46(2)",
"journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America",
"keywords": null,
"medline_ta": "Clin Infect Dis",
"mesh_terms": "D000328:Adult; D044966:Anti-Retroviral Agents; D004730:Endothelium, Vascular; D015658:HIV Infections; D006801:Humans; D006973:Hypertension; D008297:Male; D008875:Middle Aged; D054038:Posterior Leukoencephalopathy Syndrome",
"nlm_unique_id": "9203213",
"other_id": null,
"pages": "e19-22",
"pmc": null,
"pmid": "18171242",
"pubdate": "2008-01-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Reversible posterior leukoencephalopathy syndrome in 2 HIV-infected patients receiving antiretroviral therapy.",
"title_normalized": "reversible posterior leukoencephalopathy syndrome in 2 hiv infected patients receiving antiretroviral therapy"
} | [
{
"companynumb": "IT-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-029068",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "STAVUDINE"
},
"drugaddi... |
{
"abstract": "A 73-year-old woman with rheumatoid arthritis treated with methotrexate and prednisolone was admitted with dyspnea and ground-glass opacity on chest CT. We diagnosed her with Pneumocystis jirovecii pneumonia (PCP) based on a positive PCR analysis of Pneumocystis jirovecii and the presence of cysts in bronchoalveolar lavage fluid. The PaO2 was 74.7 Torr on room air, and treatment with sulfamethoxazole-trimethoprim only was initiated. The hypoxemia and ground-glass opacity increased on hospital day 3, and the administration of adjunctive steroid therapy resulted in an improvement in the patient's condition. Although patients with PCP with HIV infection and hypoxemia are often treated with adjunctive steroid therapy to prevent adverse immune reactions, the efficacy of additive steroid administration in case of non-HIV PCP has not been established.",
"affiliations": "Department of Respiratory Medicine, Saitama Cardiovascular and Respiratory Center, Japan.",
"authors": "Gochi|Mina|M|;Takayanagi|Noboru|N|;Ishiguro|Takashi|T|;Miyahara|Yosuke|Y|;Yanagisawa|Tsutomu|T|;Shimizu|Yoshihiko|Y|;Sugita|Yutaka|Y|",
"chemical_list": "D000890:Anti-Infective Agents; D005938:Glucocorticoids; D015662:Trimethoprim, Sulfamethoxazole Drug Combination; D011239:Prednisolone; D008775:Methylprednisolone; D008727:Methotrexate",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.53.1505",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0918-2918",
"issue": "53(11)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000368:Aged; D000890:Anti-Infective Agents; D001172:Arthritis, Rheumatoid; D017024:Chemotherapy, Adjuvant; D005260:Female; D005938:Glucocorticoids; D006801:Humans; D008168:Lung; D008727:Methotrexate; D008775:Methylprednisolone; D045363:Pneumocystis carinii; D011020:Pneumonia, Pneumocystis; D016133:Polymerase Chain Reaction; D011239:Prednisolone; D011859:Radiography; D015662:Trimethoprim, Sulfamethoxazole Drug Combination",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "1137-41",
"pmc": null,
"pmid": "24881737",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Deterioration of the immune response induced by sulfamethoxazole-trimethoprim in a rheumatoid arthritis patient with Pneumocystis jirovecii pneumonia.",
"title_normalized": "deterioration of the immune response induced by sulfamethoxazole trimethoprim in a rheumatoid arthritis patient with pneumocystis jirovecii pneumonia"
} | [
{
"companynumb": "PHHY2014JP078350",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drugadditional": n... |
{
"abstract": "This randomized, double-blind study compared the efficacy and safety of blonanserin and risperidone to treat Chinese schizophrenia patients aged ≥18 and < 65 years. Patients with Positive and Negative Syndrome Scale (PANSS) total scores ≥70 and ≤ 120 were randomized to receive blonanserin or risperidone using a gradual dose-titration method (blonanserin tablets: 8-24 mg/day; risperidone tablets: 2-6 mg/day), twice daily. Treatment populations consisted of 128 blonanserin-treated patients and 133 risperidone-treated patients. Intention-to-treat analysis was performed using the last observation carried forward method. Reductions of PANSS total scores by blonanserin and risperidone treatment were -30.59 and -33.56, respectively. Risperidone treatment was associated with elevated levels of serum prolactin (67.16% risperidone versus 52.31% blonanserin) and cardiac-related abnormalities (22.39% risperidone versus 12.31% blonanserin), and blonanserin patients were more prone to extrapyramidal side effects (48.46% blonanserin versus 29.10% risperidone). In conclusion, blonanserin was as effective as risperidone for the treatment of Chinese patients with schizophrenia. The overall safety profiles of these drugs are comparable, although blonanserin was associated with a higher incidence of EPS and risperidone was associated with a higher incidence of prolactin elevation and weight gain. Thus, blonanserin is useful for the treatment of Chinese schizophrenia patients.",
"affiliations": "Department of Psychiatry, Shanghai Mental Health Center, Shanghai, 200030, China. Electronic address: lhlh_5@163.com.;Peking University Clinical Research Institute, Beijing, 100191, China. Electronic address: yaoc301@qq.com.;Department of Psychiatry, Xi'an Mental Health Center, Xi'an, 710061, China. Electronic address: sjgysh@sohu.com.;Department of Psychiatry, Beijing Huilongguan Hospital, Beijing, 100096, China. Electronic address: yandf@126.com.;Department of Psychiatry, Wuxi Mental Health Center, Wuxi, 214000, China. Electronic address: shuguangqi0208@126.com.;Department of Psychiatry, Tianjin Anding Hospital, Tianjin, 300222, China. Electronic address: 13920084798@163.com.;Department of Psychiatry, Brains Hospital of Hunan Province, Changsha, 410007, China. Electronic address: gen571@126.com.;Department of Psychiatry, Guangzhou Brain Hospital, Guangzhou, 510370, China. Electronic address: biglijie@163.com.;Department of Psychiatry, Beijing Anding Hospital of Capital Medical University, Beijing, 100088, China. Electronic address: w.cy@163.net.;Department of Psychiatry, Henan Provincial Mental Hospital, Xinxiang, 453002, China. Electronic address: chuansonwang@126.com.;Department of Psychiatry, Sixth Hospital of Peking University, Beijing, 100191, China. Electronic address: liucui0723@hotmail.com.;Department of Psychiatry, Second Xiangya Hospital of Central South University, Changsha, 410000, China. Electronic address: llyyz2006@126.com.;Department of Psychiatry, West China Hospital of Sichuan University, Chengdu, 610041, China. Electronic address: wangqiang130@hotmail.com.;Department of Psychiatry, Hebei Mental Health Center, Baoding, 071000, China. Electronic address: like1002@sina.com.;Medical Division, Sumitomo Pharma(Suzhou) Co., Ltd. Beijing, 100007, China. Electronic address: luo@dsmpharm.com.cn.;Department of Psychiatry, Shanghai Mental Health Center, Shanghai, 200030, China. Electronic address: guniufan@outlook.com.",
"authors": "Li|Huafang|H|;Yao|Chen|C|;Shi|Jianguo|J|;Yang|Fude|F|;Qi|Shuguang|S|;Wang|Lili|L|;Zhang|Honggeng|H|;Li|Jie|J|;Wang|Chuanyue|C|;Wang|Chuansheng|C|;Liu|Cui|C|;Li|Lehua|L|;Wang|Qiang|Q|;Li|Keqing|K|;Luo|Xiaoyan|X|;Gu|Niufan|N|",
"chemical_list": "D014150:Antipsychotic Agents; D010879:Piperazines; D010880:Piperidines; D011388:Prolactin; C079310:blonanserin; D018967:Risperidone",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-3956",
"issue": "69()",
"journal": "Journal of psychiatric research",
"keywords": "Antipsychotic agents; Blonanserin; Randomized controlled trial; Risperidone; Schizophrenia",
"medline_ta": "J Psychiatr Res",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D014150:Antipsychotic Agents; D044466:Asians; D002681:China; D004311:Double-Blind Method; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D010879:Piperazines; D010880:Piperidines; D011388:Prolactin; D011569:Psychiatric Status Rating Scales; D018967:Risperidone; D012559:Schizophrenia; D012565:Schizophrenic Psychology; D016896:Treatment Outcome; D015430:Weight Gain; D055815:Young Adult",
"nlm_unique_id": "0376331",
"other_id": null,
"pages": "102-9",
"pmc": null,
"pmid": "26343601",
"pubdate": "2015-10",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Comparative study of the efficacy and safety between blonanserin and risperidone for the treatment of schizophrenia in Chinese patients: A double-blind, parallel-group multicenter randomized trial.",
"title_normalized": "comparative study of the efficacy and safety between blonanserin and risperidone for the treatment of schizophrenia in chinese patients a double blind parallel group multicenter randomized trial"
} | [
{
"companynumb": "CN-AJANTA PHARMA USA INC.-1042844",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RISPERIDONE"
},
"drugadditional": nul... |
{
"abstract": "Mycosis fungoides (MF) represents the most common type of cutaneous T-cell lymphoma (CTCL). CTCL often progresses through patch, plaque and tumor stages but can also manifest with varied clinical presentations. MF rarely presents in vesiculobullous fashion, in which vesicles or bullae develop in pre-existing plaques or on the trunk or proximal extremities. We report a patient who presented with a vesiculobullous eruption on the palms and soles, resembling dyshidrotic dermatitis, which we believe represents dyshidrotic MF.",
"affiliations": "Division of Dermatology, Department of Medicine, David Geffen School of Medicine at the University of California, Los Angeles, CA 90095, USA.",
"authors": "Diehl|Joseph|J|;Sarantopoulos|G Peter|GP|;Chiu|Melvin W|MW|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1111/j.1600-0560.2011.01682.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0303-6987",
"issue": "38(7)",
"journal": "Journal of cutaneous pathology",
"keywords": null,
"medline_ta": "J Cutan Pathol",
"mesh_terms": "D000368:Aged; D001768:Blister; D003922:Diabetes Mellitus, Type 1; D005260:Female; D006801:Humans; D006973:Hypertension; D009182:Mycosis Fungoides; D012878:Skin Neoplasms",
"nlm_unique_id": "0425124",
"other_id": null,
"pages": "590-2",
"pmc": null,
"pmid": "21352261",
"pubdate": "2011-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Dyshidrotic mycosis fungoides.",
"title_normalized": "dyshidrotic mycosis fungoides"
} | [
{
"companynumb": "TW-SUN PHARMACEUTICAL INDUSTRIES LTD-2020R1-263811",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
... |
{
"abstract": "BACKGROUND\nDocetaxel and vinorelbine as combined treatment for metastatic breast cancer can have the dose-limiting toxic effects of mucositis and neutropenic fever. We report unexpected ischaemic colitis in six patients associated with docetaxel-based therapy, three of whom were treated in a phase I study designed to establish the maximum tolerated dose of this combination with the prophylactic use of granulocyte-colony-stimulating factor.\n\n\nMETHODS\nBetween August, 1997, and December, 1998, 14 patients with metastatic breast cancer were treated with vinorelbine, docetaxel, and granulocyte-colony-stimulating factor in a phase I study. Three patients developed colitis similar to that seen in typhlitis. Three additional patients were identified during scheduled review of toxic effects in patients participating in clinical trials involving docetaxel.\n\n\nRESULTS\nThree patients on combined vinorelbine and docetaxel developed colitis-like symptoms. Two patients died, one from necrotic bowel and the other from neutropenic fever and colitis. Two of the patients presented on day 7 and day 8 of chemotherapy, respectively, with neutropenic fever and abdominal pain; the third patient developed neutropenia without fever and abdominal pain on day 8. The other three patients were treated with docetaxel, docetaxel and pamidronate disodium, or docetaxel and cyclophosphamide. All three patients presented with abdominal pain on days 10, 5, and 4, respectively. One had non-neutropenic fever, another had neutropenic fever, and the third was afebrile and non-neutropenic at the time of presentation with abdominal pain. Three patients had blood in their diarrhoea, abdominal tenderness, or both. Computed tomography of the abdomen and pelvis showed features of colitis in three patients.\n\n\nCONCLUSIONS\nThis serious complication may result from the use of docetaxel and may be exacerbated by its combination with vinorelbine. Study of hospital-based patients treated with taxane-based chemotherapy is underway to find out the frequency of such complications.",
"affiliations": "Department of Breast Medical Oncology, University of Texas M D Anderson Cancer Center, Houston 77030, USA. nibrahim@mdanderson.org",
"authors": "Ibrahim|N K|NK|;Sahin|A A|AA|;Dubrow|R A|RA|;Lynch|P M|PM|;Boehnke-Michaud|L|L|;Valero|V|V|;Buzdar|A U|AU|;Hortobagyi|G N|GN|",
"chemical_list": "D000972:Antineoplastic Agents, Phytogenic; D043823:Taxoids; D016179:Granulocyte Colony-Stimulating Factor; D000077143:Docetaxel; D014747:Vinblastine; D017239:Paclitaxel; D000077235:Vinorelbine",
"country": "England",
"delete": false,
"doi": "10.1016/S0140-6736(99)06195-4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0140-6736",
"issue": "355(9200)",
"journal": "Lancet (London, England)",
"keywords": null,
"medline_ta": "Lancet",
"mesh_terms": "D000368:Aged; D000972:Antineoplastic Agents, Phytogenic; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D000077143:Docetaxel; D004761:Enterocolitis, Pseudomembranous; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D006801:Humans; D008875:Middle Aged; D017239:Paclitaxel; D043823:Taxoids; D014747:Vinblastine; D000077235:Vinorelbine",
"nlm_unique_id": "2985213R",
"other_id": null,
"pages": "281-3",
"pmc": null,
"pmid": "10675076",
"pubdate": "2000-01-22",
"publication_types": "D016430:Clinical Trial; D017426:Clinical Trial, Phase I; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Colitis associated with docetaxel-based chemotherapy in patients with metastatic breast cancer.",
"title_normalized": "colitis associated with docetaxel based chemotherapy in patients with metastatic breast cancer"
} | [
{
"companynumb": "US-PFIZER INC-2019261328",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VINORELBINE\\VINORELBINE TARTRATE"
},
"drugadd... |
{
"abstract": "Objectives: Daptomycin (DAP) resistance in Staphylococcus aureus is uncommon but there are increasing reports of the emergence of resistance during DAP therapy. Most clinical DAP-resistant S. aureus isolates investigated carried mutations in the mprF gene. The aim of this study was to identify mutations between a clinical pair of methicillin-susceptible S. aureus (MSSA) isolates (DAP-susceptible and DAP-resistant). Additionally, the activity of genes previously associated with DAP resistance was assessed. Materials and Methods: Two MSSA isolates from patient with left-sided endocarditis were analyzed by whole genome sequencing (WGS) and reverse transcription-quantitative real-time PCR (RT-qPCR). The first isolate, DAP-susceptible, was obtained before initiation of treatment and the second isolate, DAP-resistant, was recovered after 4 weeks of DAP therapy. Results: Comparison of complete genomes of DAP-susceptible and its DAP-resistant variant identified two non-synonymous and one synonymous mutations. The non-synonymous mutations consisted of a S829L substitution in mprF and a T331I substitution in vraS. The RT-qPCR experiments revealed an increased expression of vraS, dltA, mprF, and sceD genes in DAP-resistant variant. Strikingly, the expression of dltA and mprF genes was significantly downregulated by DAP. Conclusion: The mprF and vraS genes were previously associated with DAP resistance, however, none of the mutations described in this study had been previously identified and linked to DAP resistance. Moreover, we provide a new insight into the DAP action on S. aureus, in which the expression of key genes in DAP resistance is decreased by the antibiotic.",
"affiliations": "Department of Medical Microbiology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands.;Division of Infectious and Tropical Diseases, Hospital of Lodi, Lodi, Italy.;Department of Medical Microbiology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands.;Department of Medical Microbiology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands.;Department of Infectious Diseases, Istituto Superiore di Sanità, Rome, Italy.;Department of Infectious Diseases, Istituto Superiore di Sanità, Rome, Italy.;Department of Infectious Diseases, Istituto Superiore di Sanità, Rome, Italy.;Department of Infectious Diseases, Istituto Superiore di Sanità, Rome, Italy.;Department of Medical Microbiology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands.",
"authors": "Sabat|Artur J|AJ|;Tinelli|Marco|M|;Grundmann|Hajo|H|;Akkerboom|Viktoria|V|;Monaco|Monica|M|;Del Grosso|Maria|M|;Errico|Giulia|G|;Pantosti|Annalisa|A|;Friedrich|Alexander W|AW|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fmicb.2018.02705",
"fulltext": "\n==== Front\nFront MicrobiolFront MicrobiolFront. Microbiol.Frontiers in Microbiology1664-302XFrontiers Media S.A. 10.3389/fmicb.2018.02705MicrobiologyOriginal ResearchDaptomycin Resistant Staphylococcus aureus Clinical Strain With Novel Non-synonymous Mutations in the mprF and vraS Genes: A New Insight Into Daptomycin Resistance Sabat Artur J. 1Tinelli Marco 2Grundmann Hajo 13Akkerboom Viktoria 1Monaco Monica 4Del Grosso Maria 4Errico Giulia 4Pantosti Annalisa 4Friedrich Alexander W. 1*1Department of Medical Microbiology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands2Division of Infectious and Tropical Diseases, Hospital of Lodi, Lodi, Italy3Institute for Infection Prevention and Hospital Epidemiology, Medical Center – University of Freiburg, Faculty of Medicine, University of Freiburg, Freiburg, Germany4Department of Infectious Diseases, Istituto Superiore di Sanità, Rome, ItalyEdited by: Miklos Fuzi, Semmelweis University, Hungary\n\nReviewed by: Abiodun David Ogunniyi, University of South Australia, Australia; Joanna Nakonieczna, Intercollegiate Faculty of Biotechnology of University of Gdańsk and Medical University of Gdańsk, Poland\n\n*Correspondence: Alexander W. Friedrich, alex.friedrich@umcg.nlThis article was submitted to Antimicrobials, Resistance and Chemotherapy, a section of the journal Frontiers in Microbiology\n\n06 11 2018 2018 9 270529 6 2018 23 10 2018 Copyright © 2018 Sabat, Tinelli, Grundmann, Akkerboom, Monaco, Del Grosso, Errico, Pantosti and Friedrich.2018Sabat, Tinelli, Grundmann, Akkerboom, Monaco, Del Grosso, Errico, Pantosti and FriedrichThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Objectives: Daptomycin (DAP) resistance in Staphylococcus aureus is uncommon but there are increasing reports of the emergence of resistance during DAP therapy. Most clinical DAP-resistant S. aureus isolates investigated carried mutations in the mprF gene. The aim of this study was to identify mutations between a clinical pair of methicillin-susceptible S. aureus (MSSA) isolates (DAP-susceptible and DAP-resistant). Additionally, the activity of genes previously associated with DAP resistance was assessed.\n\nMaterials and Methods: Two MSSA isolates from patient with left-sided endocarditis were analyzed by whole genome sequencing (WGS) and reverse transcription-quantitative real-time PCR (RT-qPCR). The first isolate, DAP-susceptible, was obtained before initiation of treatment and the second isolate, DAP-resistant, was recovered after 4 weeks of DAP therapy.\n\nResults: Comparison of complete genomes of DAP-susceptible and its DAP-resistant variant identified two non-synonymous and one synonymous mutations. The non-synonymous mutations consisted of a S829L substitution in mprF and a T331I substitution in vraS. The RT-qPCR experiments revealed an increased expression of vraS, dltA, mprF, and sceD genes in DAP-resistant variant. Strikingly, the expression of dltA and mprF genes was significantly downregulated by DAP.\n\nConclusion: The mprF and vraS genes were previously associated with DAP resistance, however, none of the mutations described in this study had been previously identified and linked to DAP resistance. Moreover, we provide a new insight into the DAP action on S. aureus, in which the expression of key genes in DAP resistance is decreased by the antibiotic.\n\nwhole-genome sequencingStaphylococcus aureusdaptomycinSNP analysisMprF\n==== Body\nIntroduction\nDaptomycin (DAP) is an alternative to vancomycin for invasive methicillin-resistant Staphylococcus aureus (MRSA) infections or for serious methicillin-susceptible S. aureus (MSSA) infections in patients who are allergic to beta-lactams. The DAP non-susceptibility in S. aureus (referred to as DAP resistance in this study for the ease of presentation) is an increasing problem and several reports have described the emergence of resistance during DAP therapy (Lee et al., 2010; Mammina et al., 2010). The current knowledge suggests that DAP resistance in S. aureus is complex and results from mutational changes in a number of different genes. Most clinical DAP-resistant S. aureus isolates (MICs of >1 μg/ml) investigated to date, harbored mutations in mprF, typically in the form of single-nucleotide polymorphisms (SNPs) (Jones et al., 2008; Ernst et al., 2009; Mishra and Bayer, 2013). The mprF gene encodes a bifunctional membrane protein that catalyzes the synthesis and translocation (flipping) of the positively charged phospholipid lysyl-phosphatidylglycerol within its cell membrane. The amino acid substitutions in the MprF protein identified in the strains showing resistance to DAP lead to altered cell membrane phospholipid profiles. It results in a cell membrane positive charge increase and changes in cell membrane fluidity (Mishra et al., 2009). The dltABCD operon is involved in the addition of D-alanine to teichoic acids in many Gram-positive bacteria (Ernst et al., 2009). Mutations in the dlt operon and/or altered expression of its genes lead to a cell surface positive charge increase, as in the case of the mprF mutations. Data from numerous studies have suggested that charge repulsion arising from the mprF- and dlt-mediated enhancement of positive surface charge is mainly responsible for DAP-resistant phenotype among S. aureus strains (Jones et al., 2008; Patel et al., 2011; Peleg et al., 2012; Gasch et al., 2013; Yang et al., 2013; Cafiso et al., 2014; Kang et al., 2017; Ma et al., 2018). It has recently been discovered that deletion of the clpX gene caused a small reduction in DAP susceptibility (Bæk et al., 2014). The highly conserved ClpX chaperone facilitates protein folding and with the ClpP protease, forming the ClpXP protease, controls cell size and is required for growth of S. aureus at low temperature (Stahlhut et al., 2017). Other determinants involved in DAP resistance include genes that encode enzymes associated with phospholipid metabolism, such as phosphatidylglycerol and cardiolipin synthetases (pgsA and cls, respectively) (Fischer et al., 2011). There are also two-component regulatory systems like WalKR also known as YycFG, VraSR or GraRS that directly or indirectly modulate transcription of a number of genes encoding proteins involved in wall metabolism and permeability (Tran et al., 2015). The emergence of mutations in these regulatory genes have been also associated with DAP resistance in S. aureus (Friedman et al., 2006; Mehta et al., 2012).\n\nThe main purpose of this study was to apply whole genome sequencing (WGS) to a clinical pair of MSSA isolates (DAP-susceptible and DAP-resistant) to detect genome-wide DNA sequence polymorphisms associated with DAP resistance. Additionally, the gene expression profiles of determinants previously linked with DAP resistance were investigated. Furthermore, the net cell-surface charge as the main mechanism responsible for the DAP-resistant phenotype in MSSA was assessed.\n\nMaterials and Methods\nIsolates\nThe isolates were obtained from a 50-year-old male, with a history of alcohol abuse and several comorbidities, who had a mitral valve replacement and in the following 6 months experienced two episodes of left-sided endocarditis, diagnosed according to current guidelines (Habib et al., 2009). In the last episode, Enterococcus faecalis and MSSA (isolate IT1-S) were obtained from blood cultures. As the patient had previously shown an allergic reaction to penicillins, treatment was instituted with gentamycin (discontinued after 2 weeks) and DAP at the dose of 500 mg daily. After 4 weeks the patient’s conditions remained serious, with no improvement. Blood culture yield an MSSA (isolate IT4-R) that was resistant to DAP (Table 1).\n\nTable 1 Characteristics of the study isolates.\n\nS. aureus isolate\tIsolation\tSource\tInfection\tMIC μg/ml (broth microdilution method) of selected antibiotics\tspa type\tMLST\t\n\t\t\t\t\t\t\t\n\t\t\t\tVancomycin\tDaptomycin\tClindamycin\t\t\t\nIT1-S\t30-04-2013\tBlood\tEndocarditis\t1\t0.5\t0.5\tt223\tST22\t\nIT4-R\t01-06-2013\tBlood\tEndocarditis\t1\t2\t0.25\tt223\tST22\t\n\t\nAntimicrobial Susceptibility Testing\nAntimicrobial susceptibility was tested by the broth microdilution method using the customized microplates ITGPOSF2 (Biomedical Service s.r.l., Scorzé, Venice, Italy) according to the manufacturer’s instructions. The antibiotics tested were ampicillin, ampicillin/sulbactam, cefoxitin, ceftaroline, clindamycin, DAP, erythromycin, fusidic acid, gentamicin, levofloxacin, mupirocin, oxacillin, rifampicin, tigecycline, trimethoprim/sulfamethoxazole and vancomycin. The breakpoints indicated by the EUCAST guidelines were applied1.\n\nNext-Generation Sequencing (NGS)\nNext-generation sequencing (NGS) was carried out on the Illumina MiSeq system using 300 × 2 paired-end reads. Sequence libraries were created using the standard Illumina Nextera XT library creation kit. The SeqMan NGen software version 11.2.1 (DNASTAR) was used for de novo assembly of the reads and the resulting contigs were ordered by Mauve Contig Mover. The remaining gaps between contigs were closed by PCR amplification and Sanger sequencing allowing for the analysis of fully closed chromosomes and plasmids. Manual sequence editing was conducted using the SeqBuilder software (DNASTAR). The DNA sequences were aligned using the MegAlign (DNASTAR) and BLASTn software.\n\nspa Typing and MLST\nThe procedure was conducted as previously described (Aires-de-Sousa et al., 2006). The spa types were assigned using Ridom StaphType software version 1.4.6 (Ridom GmbH, Würzburg, Germany). The MLST STs were assigned through the publicly available MLST server2 on the basis of WGS data.\n\nRNA Sample Collection and Gene Expression Analysis Using Reverse Transcription and Quantitative Real-Time PCR (RT-qPCR)\nEach isolate was grown in triplicate in Mueller Hinton Broth (MHB) in the absence or presence of DAP. The overnight cultures were diluted to produce an inoculum concentration of approximately 108 cfu/ml. The inoculum was then diluted 1:100 in MHB supplemented with 50 μg/ml CaCl2 or in MHB supplemented with 0.08 μg/ml DAP and 50 μg/ml CaCl2. It resulted in starting number of the cells approximately 106 cfu/ml in each culture. Cells were then harvested from the IT1-S and IT4-R cultures grown to mid exponential (∼108 cfu/ml, after 5.5 h and 4 h, respectively), late exponential (∼109 cfu/ml, after 8 h and 6 h, respectively) and stationary (∼1010 cfu/ml, after 14 h and 12 h, respectively) phase. The cell concentration was confirmed by colony counting after plating and incubation onto blood agar plates. Total RNA was isolated using the RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. RNA was quantified using Qubit (Thermo Fisher Scientific) and the quality of the RNA extracted was assessed by TapeStation 2200 (Agilent Technologies). The Agilent TapeStation 2200 system, which is an automated instrument for nucleic acid gel electrophoresis, assigns RNA Integrity Number (RIN) values ranging from 1 to 10, with 10 being the highest quality. Only samples with preserved 16S and 23S peaks and RIN values >8 were selected for gene expression analyses. The RIN values >8 indicate intact, high quality RNA samples for downstream applications (Fleige and Pfaffl, 2006). Total RNA was further treated with Baseline-ZERO DNase (Epicentre) followed by the RNeasy MinElute Cleanup kit (Qiagen) according to the manufacturer’s instructions. The absence of contaminating DNA was verified by PCR. For RT-qPCR analyses, an iTaq Universal SYBR Green One-Step Kit (Bio-Rad Laboratories) was used. Each reaction mix with a volume of 20 μl was prepared with 300 nM each primer (final concentration) and 20 ng of template RNA. A CFX96 Touch Real-Time PCR detection system (Bio-Rad Laboratories) was used for the measurements using a protocol with the following thermal cycling conditions: reverse transcription reaction at 50°C for 10 min and polymerase activation and DNA denaturation at 95°C for 1 min, followed by 35 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s. After the last amplification cycle, a melting curve analysis was carried out by heating from 65 to 95°C in increments of 0.5°C/s. Negative controls (without template or reverse transcriptase enzyme) were included in each run. Gene-specific primers (Table 2) for the genes used in RT-qPCR experiments were designed using SeqBuilder software (version 15.0.1) from DNASTAR. Calculations of primer efficiencies were performed using the software CFX Manager version 3.1 (Bio-Rad Laboratories). Fold changes in the expression levels of the investigated genes were normalized in relation to the levels of gyrB mRNA. The relative changes in gene expression were quantified using the Pfaffl method (Pfaffl, 2001): gene expression ratio = (Etarget)ΔCt\ntarget(control\n-\nsample)/(Ereference)ΔCt\nreference(control\n-\nsample), where Etarget is the amplification efficiency of target (gene of interest), Ereference is the amplification efficiency of reference (gyrB), Ct is the point at which the fluorescence rises above the background fluorescence, ΔCt target is the Ct deviation of the control minus the sample of the target gene transcript, and ΔCt reference is the Ct deviation of the control minus the sample of the reference gene transcript. The statistical significance of differences in the results was analyzed with the Student t-test and P-values of ≤0.05 were considered significant.\n\nTable 2 Primers used in the RT-qPCR study.\n\nGene description (designation)\tGene position in the chromosome\tPrimer sequence\tPrimer position in the gene\t\nDNA gyrase subunit B (gyrB)\t5034–6968\tF: TGAAGCATTAGCTGGTTATG\t5204–5223\t\n\t\tR: ACGTTTTCTTCATCACGTTC\t5679–5698\t\nTwo-component sensor histidine kinase (vraS)\t1894439–1895482 (complement)\tF: TGGTTCAATGCTCATCTTAG\t1895440–1895459\t\n\t\tR: CTTTGATAGCAGATAGCATC\t1894960–1894979\t\nBifunctional lysyl-phosphatidylglycerol flippase/synthetase (mprF)\t1322308–1324830\tF: ATCAACCGTATGTCCCTTG\t1322449–1322467\t\n\t\tR: ATGAGCGTCAACAATTACAC\t1322960–1322979\t\nTransglycosylase (sceD)\t2103087–2103782 (complement)\tF: GCAGTAGGTTTAGGAATCG\t2103734–2103752\t\n\t\tR: GATGTTGGATTTACAGCATG\t2103250–2103269\t\nD-Alanine–poly(phosphoribitol) ligase subunit 1 (dltA)\t844667–846124\tF: GATGATAGGTGCCATTAAAG\t844858– 844877\t\n\t\tR: CAAATGTTAATCGGTGTTGC\t845339–845358\t\nCell wall metabolism sensor histidine kinase (walK)\t25652–27478\tF: GAGGTAACTATACGCAACG\t26316–26334\t\n\t\tR: GGTGTACGTAACTCATGTG\t26802–26820\t\nDNA-binding response regulator (graR)\t663682–664356\tF: TGGGATTTTAATGTTGCTGG\t663748–663767\t\n\t\tR: ATCACTAACAAATGCTTCATC\t664228–664248\t\nCardiolipin synthase (cls)\t1273147–1274628\tF: TGTTAATGGATCAAGATGGC\t1273499–1273518\t\n\t\tR: TCTAAAATAAATCGCAACTGC\t1273983–1274003\t\nCDP-diacylglycerol–glycerol-3-phosphate 3-phosphatidyltransferase (pgsA)\t1227992–1228570\tF: TTAGAGTAGTGTTAATACCAG\t1228020–1228040\t\n\t\tR: TATTCAATACCAGATAAGATAG\t1228512–1228533\t\nATP-dependent Clp protease ATP-binding subunit (clpX)\t1658527–1659789 (complement)\tF: GCGATTACAGAATTACCTAC\t1659602–1659621\t\n\t\tR: TTCTTGGTTTGGATGTTTGC\t1659094–1659113\t\n\t\nRelative Positive Surface Charge Determination\nThe cells were grown overnight (16 h) in Tryptic Soy Broth (TSB) medium in the absence of DAP, washed twice with 20 mM morpholinepropanesulfonic acid (MOPS) buffer (pH 7.0), and resuspended in the same buffer at an optical density at 600 nm (OD600) of 1.0. The cells were incubated with cytochrome c (Sigma) dissolved in 20 mM MOPS buffer (pH 7.0) using three different concentrations: 50 μg/ml, 100 μg/ml, and 500 μg/ml. Moreover, the cells incubated in 20 mM MOPS buffer (pH 7.0) without cytochrome c were used as a negative control. After 15 min of incubation, the cells were pelleted by centrifugation and absorbance of the supernatants was measured at 530 nm. The amount of remaining (unbound) cytochrome c in the supernatant was determined by comparison to a standard curve (serially diluted cytochrome c). Cytochrome c is a cationic peptide and there is a direct correlation between the amount of unbound cytochrome c detected in the supernatant and the positive charge of the bacterial surface (Peschel et al., 1999). The data were converted and shown as the percent amount of bound cytochrome c. Independent runs were performed in triplicate on separate days. Changes in cytochrome c binding were compared by the Student t-test. A P-value of ≤0.05 was considered significant. Statistical analysis was performed using the GraphPad software.\n\nMembrane Potential Assay\nDAP-induced bacterial membrane depolarization was performed essentially as described previously (Silverman et al., 2003) by using the membrane potential-sensitive fluorescent dye 3,3-dipropylthiacarbocyanine [DiSC3(5); Thermo Fisher Scientific] with the following modifications. Briefly, isolates were grown at 37°C to early exponential phase (OD600, 0.2 to 0.3) in 50 ml of MHB. Cells were harvested by centrifugation, washed twice with 5 mM HEPES buffer (pH 7.2) supplemented with 50 μg/ml CaCl2 and resuspended in the same buffer (containing 50 μg/ml CaCl2) to an OD600 of 0.2. The dye DiSC3(5) was added to cell suspension to make a final concentration of 0.18 μM. The cells were incubated with the dye DiSC3(5) for 15 min at room temperature. Then KCl was added (100 mM final concentration) to equilibrate the cytoplasmic and external potassium ions (K+) concentrations. The 200-μl cell suspension aliquots were transferred to the wells of a white 96-well microplate. The desired DAP concentrations were subsequently added to the microplate wells and an increase in the fluorescence intensity at a wavelength of 670 nm was measured over 60 min using a Synergy HTX multimode microplate reader (BioTek). The fluorescence leakage (FL) was determined using equation as previously described by Cheng et al. (2014): FL = (FF -FB) - (FI -FB), where FF was the fluorescence intensity of the cell suspension over 60 min of treatment with DAP, FI was the initial fluorescence intensity of the cell suspension with DAP, and FB was the fluorescence intensity of the blank (only cells and the dye). Data were normalized relative to the maximum fluorescence leakage (expressed as 100%). Results were shown as the mean of triplicate measurements. Changes in membrane depolarization were compared by the Student t-test. A P-value of ≤0.05 was considered significant. Statistical analysis was performed using the GraphPad software.\n\nNucleotide Sequence Accession Numbers\nChromosome and plasmid sequence data of the two S. aureus isolates were annotated using the NCBI Prokaryotic Genome Annotation Pipeline and deposited in GenBank3 under accession numbers CP028468–CP028471.\n\nResults\nAntibiotic Resistance\nThe first aim of our investigations was to determine the antibiotic susceptibility of the isolates recovered before and after treatment with DAP. The MIC values for selected antibiotics are presented in Table 1. Antibiotic susceptibility testing showed that isolate IT1-S (recovered before the DAP treatment) was susceptible to all the antibiotics tested with the exception of clindamycin that showed intermediate resistance (MIC = 0.5 μg/ml). MIC value for DAP was 0.5 μg/ml. Isolate IT4-R (recovered after the DAP treatment) was resistant to DAP (MIC = 2 μg/ml) and susceptible to all other antibiotics tested. Therefore, the mechanism conferring DAP resistance in IT4-R did not confer resistance to other antibiotics, including vancomycin, for which the two isolates showed the same MIC (Table 1).\n\nMolecular Characterization\nThis part of the study aimed at molecular typing of the isolates and comparing their virulence potential. The characteristics of the isolates are shown in Table 1. spa typing assigned spa type t223 to both isolates. From the WGS data, in silico MLST identified the isolates belonged to single sequence type (ST) 22. Moreover, the isolates were positive for toxic shock syndrome toxin-1, enterotoxin N, enterotoxin O and enterotoxin P. The full virulence profile of the IT1-S and IT4-R isolates is presented in Table 3. Both isolates showed exactly the same virulence potential as they carried the same set of the genes.\n\nTable 3 Virulence profile of the IT1-S and IT4-R isolates.\n\nVirulence factor\tPosition in chromosome\tProtein function\t\nAdhesins\t\nspa\t75928–77478\tImmunoglobulin G binding protein A\t\nsdrC\t560282–563191\tSer-Asp rich fibrinogen-binding protein C\t\nsdrE\t567737–571072\tSer-Asp rich fibrinogen-binding protein E\t\nvwb\t806446–807954\tvon Willebrand factor-binding protein\t\neap\t900239–900673\tExtracellular adherence protein\t\natl\t976444–980217\tBifunctional autolysin Atl\t\nfib\t1082735–1083064\tFibrinogen-binding protein\t\nefb\t1087580–1087957\tExtracellular fibrinogen-binding protein\t\nebpS\t1477847–1479277\tCell surface elastin binding protein\t\neap/map\t1951015–1953063\tExtracellular adherence protein\t\nsdrH\t2025520–2026779\tSer-Asp rich fibrinogen-binding portein H\t\neap\t2227772–2228197\tExtracellular adherence protein\t\nsbi\t2437079–2438389\tImmunoglobulin-binding protein\t\nfnbA\t2529493–2532540\tFibronectin-binding protein A\t\nclfB\t2677709–2680114\tClumping factor ClfB, fibrinogen binding protein\t\ncna\t2750354–2753344\tCollagen adhesin precursor\t\nToxins\t\nhla\t1090201–1091160\tAlpha-hemolysin precursor\t\nSEntP\t1591838–1592542\tEnterotoxin P\t\nSEntG\t1822884–1823660\tExtracellular enterotoxin type G precursor\t\nSEntN\t1823943–1824698\tEnterotoxin N\t\nSEntI\t1825661–1826389\tExtracellular enterotoxin type I precursor\t\nSEntO\t1827424–1828188\tEnterotoxin O\t\ntsst\t2010878–2011582\tToxic shock syndrome toxin-1\t\nhld\t2031459–2031593\tDelta-hemolysin\t\nhlgA\t2438880–2439808\tGamma-hemolysin chain II precursor\t\nhlgC\t2440376–2441323\tGamma-hemolysin component C\t\nhlgB\t2441325–2442302\tGamma-hemolysin component B precursor\t\nExoenzymes\t\ncoa\t211498–212859\tStaphylocoagulase precursor\t\ngeh\t314970–317045\tGlycerol ester hydrolase\t\nnuc\t810521–811207\tThermonuclease\t\nsspB\t970467–971648\tCysteine protease staphopain B\t\nsspA\t971730–972776\tSerine V8 protease\t\nnucI\t1278542–1279075\tThermonuclease\t\nscpA\t1923362–1924528\tCysteine protease staphopain A\t\nscn\t1957164–1957377\tComplement inhibitor SCIN\t\nsak\t1959588–1960079\tStaphylokinase\t\nhysA\t2220411–2222837\tHyaluronate lyase\t\nlip\t2733778–2735820\tTriacylglycerol lipase\t\n\t\nThe S. aureus IT4-R Genome Carries Mutations That Can Be Linked to DAP Resistance\nSubsequently, the genome sequences of the two isolates were compared to identify mutational changes responsible for the DAP resistance of the IT4-R isolate. The analyzed S. aureus isolates, IT1-S and IT4-R, had identical genomes in length, which included a 2,774,523-bp circular chromosome (32.8% G+C content) and a 34,104-bp circular plasmid (30.3% G+C content). The NCBI annotation pipeline revealed 2,895 genes in total in each genome. Whole-genome comparison of both isolates, DAP-susceptible and its DAP-resistant variant, identified three single nucleotide polymorphisms (SNPs), one in each of three genes. Two of the mutations were non-synonymous (leading to a change in the amino acid sequence in the translated gene product) while the third mutation was synonymous (without change in amino acid sequence). The non-synonymous mutations consisted of (i) a S829L substitution in mprF and (ii) a T331I substitution in vraS. The synonymous mutation was found in sceD (A→G at the nucleotide 105), the gene involved in cell wall turnover, growth and cell separation (Howden et al., 2010). Although mprF and vraS genes were previously associated with DAP resistance, none of the SNPs that we identified had been previously described and linked to DAP resistance.\n\nComparison of Gene Expression Between the IT1-S and IT-4 Isolates\nWe wanted to know if the mutations, which arose in genomic DNA during DAP therapy had an influence on gene expression. The gene expression levels of IT4-R were compared to that of its parent strain IT1-S during mid-exponential, late exponential and stationary growth phases using RT-qPCR (Figure 1). All three genes, in which the SNPs were identified in this study (mprF, sceD and vraS) and the genes previously linked with DAP resistance (dltA, walK, graR, cls, pgsA and clpX) were investigated. The vraS gene showed significantly increased expression (P value ≤ 0.05) in IT4-R relative to IT1-S in all growth phases in both the absence and presence of DAP (Figure 1 and Supplementary Table S1). Likewise, dltA, mprF and sceD were upregulated in IT4-R but the differences between the two isolates were not always statistically significant (Supplementary Table S1). Other genes showed no difference in regulation between the two isolates. In conclusion, the increased expression of the vraS, dltA, mprF, and sceD genes was observed in the DAP-resistant variant compared to its parent DAP-susceptible strain.\n\nFIGURE 1 Expression analysis of genes previously linked with DAP resistance. Transcript levels of the analyzed genes were determined by RT-qPCR in relation to gyrB expression. Values represent the mean of results obtained for three replicates independently grown cultures for each isolate. Error bars indicate the standard deviation of comparisons between three replicates. IT1-S – isolate IT1-S grown in the absence of DAP, IT1-S-DAP – isolate IT1-S grown in the presence of 0.08 μg/ml daptomycin, IT4-R – isolate grown in the absence of daptomycin, IT4-R-DAP – isolate IT1-S grown in the presence of 0.08 μg/ml daptomycin. Mid-log, mid-exponential growth phase; Late Exp, late exponential growth phase; Plateau, stationary growth phase.\n\nInfluence of DAP on Gene Expression\nIt was shown previously that concentrations of some antibiotics below the MIC were able to modulate the expression of virulence-associated genes in S. aureus (Bernardo et al., 2004; Stevens et al., 2007; Turner and Sriskandan, 2015). However, DAP seemed to have no significant effects on virulence factor expression by S. aureus (Otto et al., 2013). In the current study, we wanted to explore if subinhibitory concentration of DAP could influence the expression of the genes linked with DAP resistance. Therefore, the expression levels of mprF, sceD, vraS, dltA, walK, graR, cls, pgsA and clpX were compared in IT1-S or in IT4-R in the absence and presence of DAP during different stages of growth (Figure 1). DAP significantly downregulated the expression of the dltA gene. With the exception of the stationary phase in IT4-R, the mprF gene was also downregulated in the presence of DAP. However, the difference was not significant for the mid-exponential phase in IT1-S (Supplementary Table S2). Based on these observations we could conclude that DAP downregulates the expression of dltA and mprF genes.\n\nThe Effect of Growth Phase on Gene Expression\nThroughout bacterial growth, the cell density, nutrient conditions, pH, and other factors are changing. Therefore, we analyzed the growth phase-dependent gene expression profiles (Figure 1). In both isolates in the absence or presence of DAP, the sceD gene showed the highest transcript level in the mid-exponential phase and during further growth its transcriptional activity was decreasing, while the highest and lowest transcriptional activity of cls was found in late exponential and mid-exponential growth phases, respectively (Figure 1). However, the differences between the growth phases were not always statistically significant (Supplementary Table S3). Moreover, dltA and graR were always the most active in the late exponential growth phase and clpX in the mid-exponential phase. In case of dltA and graR the differences were always statistically significant. In conclusion, independently on mutational changes during DAP therapy as well as presence or absence of DAP in medium, strong impact of the growth phase on gene expression was observed in case of sceD and cls.\n\nRelative Positive Surface Charge\nThe emergence of DAP-resistant S. aureus strains can occur by way of several different mechanisms involving the cell membrane and/or cell wall. Recent analysis of a panel of clinical DAP-resistant MSSA isolates showed that enhancement of positive surface charge, reducing DAP binding, may be the main mechanism of DAP resistance among the MSSA strains (Kang et al., 2017). To test this hypothesis the cytochrome c binding analysis was performed. Cytochrome c binding assay revealed that DAP-resistant isolate IT4-R had significantly decreased positive surface charge compared to its DAP-susceptible parental isolate IT1-S (Figure 2).\n\nFIGURE 2 Binding analysis of cytochrome c to surface of S. aureus cells. The graph shows percentage of cytochrome c bound after incubation of S. aureus cells with different concentrations of cytochrome c. The data represent the means from three technical replicates. Error bars indicate the standard deviation of comparisons between three technical replicates. A P-value of ≤0.05 was considered significant.\n\nDAP-Induced Membrane Depolarization\nThe target of DAP is the bacterial cell membrane (Silverman et al., 2003). Once inside the membrane, DAP aggregates (Pogliano et al., 2012) leading to rapid depolarization and loss of membrane potential, and thus to bacterial cell death. We compared depolarization of the cell membrane of the IT1-S and IT4-R isolates to identify differences, which could explain higher resistance of the mutant to DAP. Changes in membrane depolarization were determined by membrane potential assay using a fluorescence dye, DiSC3(5). The fluorescence of DiSC3(5) decreases as it incorporates into polarized membranes because at high concentration the dye aggregates and self-quenches. With the addition of a membrane-disrupting agent, such as DAP, the dye is released from cells into the media, which in turn leads to fluorescence dequenching. DAP concentrations that were used in the membrane potential assay were 1 μg/ml and 4 μg/ml that corresponded to twice the DAP MIC for IT1-S and IT4-R, respectively. The addition of DAP into the assay medium gradually depolarized the membrane of the isolates (Figure 3). The rate of membrane depolarization was reduced in DAP-resistant isolate compared to that of DAP-susceptible isolate. However, statistically significant differences (p < 0.05) between IT1-S and IT4-R at the same time points were observed only between 10 and 40 min at the DAP concentration of 1 μg/ml, and between 10 and 30 min at the DAP concentration of 4 μg/ml. At the DAP concentration of 1 μg/ml, a maximum depolarization (100%) of the IT1-S membrane was observed after 50 min, while the antibiotic depolarized the membrane of IT4-R by 85.6% (compared to the maximum depolarization of IT1-S) after 60 min. At the DAP concentration of 4 μg/ml, the time to reach the maximum of depolarization was shorter for IT1-S (30 min), than for IT4-R (40 min). However, the peak of depolarization for IT4-R was lower than that of IT1-S (91.2% versus 100%). This assay demonstrated that both the total amount of membrane depolarization and the rate of depolarization were reduced in DAP-resistant isolate, which can explain higher resistance of the mutant to the antibiotic.\n\nFIGURE 3 DAP-induced membrane depolarization. The graph shows percentage of membrane depolarization after 10, 20, 30, 40, 50, and 60 min of the antibiotic treatment. DAP concentrations in brackets. The data represent the means from three technical replicates. Error bars indicate the standard deviation of comparisons between three technical replicates.\n\nDiscussion\nThe MprF protein consists of an N-terminal transmembrane flippase domain, C-terminal catalytic synthase domain, and a central bifunctional domain bridging the flippase and synthase domains. The changes in amino acid sequence linked to DAP resistance of S. aureus were identified in all domains of MprF: G61V in the flippase domain (Peleg et al., 2012); S295L, P314L, S337L, T345A, and T345I in a central bifunctional domain (Friedman et al., 2006; Mehta et al., 2012; Peleg et al., 2012); and I420N and L826F in synthase domain (Peleg et al., 2012). Taking into account a frequency of above mutations they occur most often in a central bifunctional domain both in clinical and in vitro obtained isolates. Our study revealed a novel amino acid substitution in C-terminal catalytic synthase domain of the MprF protein at amino acid residue 829 (S829L), which was found in a clinical isolate with the DAP-resistant phenotype after prolonged treatment of a patient with endocarditis initially infected with a fully susceptible strain.\n\nAlthough several molecular mechanisms of resistance to DAP have been proposed, mainly associated with phenotypic changes in cell wall and cell membrane, the basis of DAP resistance in S. aureus is still incompletely understood (Tran et al., 2015). This results from the fact that DAP resistance in S. aureus appears to be multi-factorial and strain specific. It has been proposed that charge repulsion of the DAP antibiotic molecule from the cell surface, which is associated with the increased positive charge of cell membrane and cell wall may be the main mechanism to explain DAP resistance in S. aureus strains (Jones et al., 2008; Patel et al., 2011; Peleg et al., 2012; Gasch et al., 2013; Yang et al., 2013; Cafiso et al., 2014; Kang et al., 2017; Ma et al., 2018). During the emergence of DAP resistance in S. aureus, the first SNPs in the genomic DNA appear most often in the mprF gene and are associated with a gain of enzymatic function, resulting in an increase in the positive charge of the cell membrane (Bayer et al., 2014). The mutant in this study displayed an amino acid substitution in the MprF protein and increased expression of the mprF gene. These two factors possibly reduced dissipation of membrane potential of the mutant in the presence of DAP, promoting resistance to the antibiotic molecules by electrostatic repulsion.\n\nAnother strategy utilized by S. aureus to enhance the positive surface charge is increased expression of the dlt operon (Bertsche et al., 2013; Cafiso et al., 2014; Mishra et al., 2014). The dltABCD gene products are involved in the incorporation of D-alanine into cell wall teichoic acids. Although in the RT-qPCR experiments we observed increased expression of the dltA gene in IT4-R, this isolate had higher capacity to bind cytochrome c than IT1-S. However, the test with cytochrome c measures the overall cell surface charge and not the membrane charge itself. Moreover, it has been previously shown that some DAP-resistant isolates with mprF mutations did not show significantly altered net surface charge (Bayer et al., 2015). It will be interesting to compare more clinical DAP-resistant S. aureus strains with non-increased surface charge relative to their respective isogenic susceptible strains by DAP-induced cell membrane potential assay to explore further the mechanisms of DAP resistance in S. aureus.\n\nSecond non-synonymous mutation identified in the genome of IT4-R was found in vraS, a gene of the two-component system VraSR, which positively modulates the regulation of cell-wall biosynthesis pathway in S. aureus. Moreover, the expression levels of vraS were significantly increased in IT4-R compared to that of DAP-susceptible counterpart. In a study recently published by Chen et al. (2018), the authors showed results indicating a causal relationship between the L431F substitution in the MprF protein and increased expression of the vraSR genes in the DAP-resistant strain leading concurrently to vancomycin resistance. But how the mutant MprF protein affected expression of vraSR and the cell wall-related genes was not elucidated. We can assume that in the IT4-R isolate the amino acid substitution in the MprF synthase domain (S829L) can lead not only to changes in the cell membrane of but also to pleiotropic effects, including upregulation of the VraSR system and the transglycosylase gene sceD, a feature involved in cell-wall turnover, resulting in increased resistance to DAP.\n\nA previous study showed that the mprF sequence variations within the same clonal complex were not only associated with the DAP-resistant S. aureus strains but also with DAP-susceptible strains (Bayer et al., 2014). There is an increasing interest to use WGS for genotypic prediction of antimicrobial resistance, which has the potential to reduce bed-to-diagnosis time by eliminating culture-based antimicrobial susceptibility testing. However, accuracy of predictions depends on a priori knowledge of mutations in mprF as well as in other genes that are conferring the DAP-resistant phenotype in S. aureus. Our study identified two novel SNPs leading to the amino acid substitutions (S829L in MprF and T331I in VraS), which can be linked to S. aureus DAP resistance, improving our recognition of resistance signatures within core genomic determinants.\n\nThis study provided a new insight into the DAP action on S. aureus by way of decreasing the expression of mprF and dltA. The dltABCD operon, like the mprF gene, contributes to the staphylococcal net positive surface charge. It will be important to identify the mechanism by which DAP reduces transcriptional activity of the genes, which contribute to positive surface charge since our study showed that the antibiotic did not influence the expression of two-component systems, VraSR, GraSR, and WalKR, associated with resistance of S. aureus to DAP.\n\nConclusion\nWe identified the new point mutation in the mprF gene leading to the amino acid substitution in the MprF protein that counteracts DAP antibiotic activity. Our results support the suggestion that vraSR contributes directly or indirectly to DAP resistance in S. aureus. Description of new mutations in the core genome, which can be linked with S. aureus resistance to DAP will allow development of better and more rapid diagnostic methods for identifying of drug resistance. The membrane potential assay demonstrated that both the total amount of membrane depolarization and the rate of depolarization were reduced in DAP-resistant isolate, possibly resulting in resistance to the antibiotic molecules by electrostatic repulsion. However, the reduced effect of DAP on membrane depolarization in DAP-resistant isolate, compared to its DAP-susceptible parent, was not associated with increased positive net cell surface charge, which warrants further investigation of a higher number of such isolates to better understand the mechanisms of DAP resistance in S. aureus. Finally, we shed a new light on the DAP action in S. aureus, in which the expression of key genes in DAP resistance is decreased by the antibiotic.\n\nAuthor Contributions\nAS, MT, HG, AP, and AF designed the project. MT and AP provided the isolates, clinical and epidemiological data. VA, MM, MDG, and GE performed the experiments. AS wrote the manuscript. All authors interpreted the data and reviewed the manuscript.\n\nConflict of Interest Statement\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nFunding. This project was financed in part by funds granted by the European Regional Development Fund within the EurHealth-1Health project (EU/INTERREG VA-681377 to AS, VA, and AF).\n\n1 http://www.eucast.org/\n\n2 www.cbs.dtu.dk/services/MLST\n\n3 www.ncbi.nlm.nih.gov/nucleotide\n\nSupplementary Material\nThe Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02705/full#supplementary-material\n\n Click here for additional data file.\n==== Refs\nReferences\nAires-de-Sousa M. Boye K. de Lencastre H. Deplano A. Enright M. C. Etienne J. (2006 ). High interlaboratory reproducibility of DNA sequence-based typing of bacteria in a multicenterstudy. \nJ. Clin. Microbiol. \n44 \n619 –621 . 10.1128/JCM.44.2.619-621.2006 \n16455927 \nBayer A. S. Mishra N. N. Chen L. Kreiswirth B. N. Rubio A. Yang S. J. (2015 ). Frequency and distribution of single-nucleotide polymorphisms within mprF in methicillin-resistant Staphylococcus aureus clinical isolates and their role in cross-resistance to daptomycin and host defense antimicrobial peptides. \nAntimicrob. Agents Chemother. \n59 \n4930 –4937 . 10.1128/AAC.00970-15 \n26055370 \nBayer A. S. Mishra N. N. Sakoulas G. Nonejuie P. Nast C. C. Pogliano J. (2014 ). Heterogeneity of mprF sequences in methicillin-resistant Staphylococcus aureus clinical isolates: role in cross-resistance between daptomycin and host defense antimicrobial peptides. \nAntimicrob. Agents Chemother. \n58 \n7462 –7467 . 10.1128/AAC.03422-14 \n25288091 \nBernardo K. Pakulat N. Fleer S. Schnaith A. Utermöhlen O. Krut O. (2004 ). Subinhibitory concentrations of linezolid reduce Staphylococcus aureus virulence factor expression. \nAntimicrob. Agents Chemother. \n48 \n546 –555 . 10.1128/AAC.48.2.546-555.2004 \n14742208 \nBertsche U. Yang S. J. Kuehner D. Wanner S. Mishra N. N. Roth T. (2013 ). Increased cell wall teichoic acid production and D-alanylation are common phenotypes among daptomycin-resistant methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates. \nPLoS One \n8 :e67398 . 10.1371/journal.pone.0067398 \n23785522 \nBæk K. T. Gründling A. Mogensen R. G. Thøgersen L. Petersen A. Paulander W. (2014 ). β-Lactam resistance in methicillin-resistant Staphylococcus aureus USA300 is increased by inactivation of the ClpXP protease. \nAntimicrob. Agents Chemother. \n58 \n4593 –4603 . 10.1128/AAC.02802-14 \n24867990 \nCafiso V. Bertuccio T. Purrello S. Campanile F. Mammina C. Sartor A. (2014 ). dltA overexpression: a strain-independent keystone of daptomycin resistance in methicillin-resistant Staphylococcus aureus. \nInt. J. Antimicrob. Agents \n43 \n26 –31 . 10.1016/j.ijantimicag.2013.10.001 \n24183798 \nChen F. J. Lauderdale T. L. Lee C. H. Hsu Y. C. Huang I. W. Hsu P. C. (2018 ). Effect of a point mutation in mprf on susceptibility to daptomycin, vancomycin, and oxacillin in an MRSA clinical strain. \nFront. Microbiol. \n9 :1086 . 10.3389/fmicb.2018.01086 \n29887848 \nCheng M. Huang J. X. Ramu S. Butler M. S. Cooper M. A. (2014 ). Ramoplanin at bactericidal concentrations induces bacterial membrane depolarization in Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n58 \n6819 –6827 . 10.1128/AAC.00061-14 \n25182650 \nErnst C. M. Staubitz P. Mishra N. N. Yang S. J. Hornig G. Kalbacher H. (2009 ). The bacterial defensin resistance protein mprf consists of separable domains for lipid lysinylation and antimicrobial peptide repulsion. \nPLoS Pathog. \n5 :e1000660 . 10.1371/journal.ppat.1000660 \n19915718 \nFischer A. Yang S. J. Bayer A. S. Vaezzadeh A. R. Herzig S. Stenz L. (2011 ). Daptomycin resistance mechanisms in clinically derived Staphylococcus aureus strains assessed by a combined transcriptomics and proteomics approach. \nJ. Antimicrob. Chemother. \n66 \n1696 –1711 . 10.1093/jac/dkr195 \n21622973 \nFleige S. Pfaffl M. W. (2006 ). RNA integrity and the effect on the real-time qRT-PCR performance. \nMol. Aspects Med. \n27 \n126 –139 . 10.1016/j.mam.2005.12.003 \n16469371 \nFriedman L. Alder J. D. Silverman J. A. (2006 ). Genetic changes that correlate with reduced susceptibility to daptomycin in Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n50 \n2137 –2145 . 10.1128/AAC.00039-06 \n16723576 \nGasch O. Pillai S. K. Dakos J. Miyakis S. Moellering R. C. Jr.Eliopoulos G. M. (2013 ). Daptomycin in vitro activity against methicillin-resistant Staphylococcus aureus is enhanced by d-cycloserine in a mechanism associated with a decrease in cell surface charge. \nAntimicrob. Agents Chemother. \n57 \n4537 –4539 . 10.1128/AAC.00799-13 \n23796933 \nHabib G. Hoen B. Tornos P. Thuny F. Prendergast B. Vilacosta I. (2009 ). Guidelines on the prevention, diagnosis, and treatment of infective endocarditis (new version 2009): the task force on the prevention, diagnosis, and treatment of infective endocarditis of the european society of cardiology (ESC). Endorsed by the European Society of Clinical Microbiology and Infectious Diseases (ESCMID) and the International Society of Chemotherapy (ISC) for Infection and Cancer. \nEur. Heart J. \n30 \n2369 –2413 . 10.1093/eurheartj/ehp285 \n19713420 \nHowden B. P. Davies J. K. Johnson P. D. Stinear T. P. Grayson M. L. (2010 ). Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications. \nClin. Microbiol. Rev. \n23 \n99 –139 . 10.1128/CMR.00042-09 \n20065327 \nJones T. Yeaman M. R. Sakoulas G. Yang S. J. Proctor R. A. Sahl H. G. (2008 ). Failures in clinical treatment of Staphylococcus aureus infection with daptomycin are associated with alterations in surface charge, membrane phospholipid asymmetry, and drug binding. \nAntimicrob. Agents Chemother. \n52 \n269 –278 . 10.1128/AAC.00719-07 \n17954690 \nKang K. M. Mishra N. N. Park K. T. Lee G. Y. Park Y. H. Bayer A. S. (2017 ). Phenotypic and genotypic correlates of daptomycin-resistant methicillin-susceptible Staphylococcus aureus clinical isolates. \nJ. Microbiol. \n55 \n153 –159 . 10.1007/s12275-017-6509-1 \n28120188 \nLee C. H. Wang M. C. Huang I. W. Chen F. J. Lauderdale T. L. (2010 ). Development of daptomycin nonsusceptibility with heterogeneous vancomycin-intermediate resistance and oxacillin susceptibility in methicillin-resistant Staphylococcus aureus during high-dose daptomycin treatment. \nAntimicrob. Agents Chemother. \n54 \n4038 –4040 . 10.1128/AAC.00533-10 \n20585116 \nMa Z. Lasek-Nesselquist E. Lu J. Schneider R. Shah R. Oliva G. (2018 ). Characterization of genetic changes associated with daptomycin nonsusceptibility in Staphylococcus aureus. \nPLoS One \n13 :e0198366 . 10.1371/journal.pone.0198366 \n29879195 \nMammina C. Bonura C. di Carlo P. Calà C. Aleo A. Monastero R. (2010 ). Daptomycin non-susceptible, vancomycin intermediate methicillin-resistant Staphylococcus aureus ST398 from a chronic leg ulcer, Italy. \nScand. J. Infect. Dis. \n42 \n955 –957 . 10.3109/00365548.2010.524662 \n20942775 \nMehta S. Cuirolo A. X. Plata K. B. Riosa S. Silverman J. A. Rubio A. (2012 ). VraSR two-component regulatory system contributes to mprF-mediated decreased susceptibility to daptomycin in in vivo-selected clinical strains of methicillin-resistant Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n56 \n92 –102 . 10.1128/AAC.00432-10 \n21986832 \nMishra N. N. Bayer A. S. (2013 ). Correlation of cell membrane lipid profiles with daptomycin resistance in methicillin-resistant Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n57 \n1082 –1085 . 10.1128/AAC.02182-12 \n23254419 \nMishra N. N. Bayer A. S. Weidenmaier C. Grau T. Wanner S. Stefani S. (2014 ). Phenotypic and genotypic characterization of daptomycin-resistant methicillin-resistant Staphylococcus aureus strains: relative roles of mprF and dlt operons. \nPLoS One \n9 :e107426 . 10.1371/journal.pone.0107426 \n25226591 \nMishra N. N. Yang S. J. Sawa A. Rubio A. Nast C. C. Yeaman M. R. (2009 ). Analysis of cell membrane characteristics of in vitro-selected daptomycin-resistant strains of methicillin-resistant Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n53 \n2312 –2318 . 10.1128/AAC.01682-08 \n19332678 \nOtto M. P. Martin E. Badiou C. Lebrun S. Bes M. Vandenesch F. (2013 ). Effects of subinhibitory concentrations of antibiotics on virulence factor expression by community-acquired methicillin-resistant Staphylococcus aureus. \nJ. Antimicrob. Chemother. \n68 \n1524 –1532 . 10.1093/jac/dkt073 \n23508621 \nPatel D. Husain M. Vidaillac C. Steed M. E. Rybak M. J. Seo S. M. (2011 ). Mechanisms of in-vitro-selected daptomycin-non-susceptibility in Staphylococcus aureus. \nInt. J. Antimicrob. Agents. \n38 \n442 –446 . 10.1016/j.ijantimicag.2011.06.010 \n21840181 \nPeleg A. Y. Miyakis S. Ward D. V. Earl A. M. Rubio A. Cameron D. R. (2012 ). Whole genome characterization of the mechanisms of daptomycin resistance in clinical and laboratory derived isolates of Staphylococcus aureus. \nPLoS One \n7 :e28316 . 10.1371/journal.pone.0028316 \n22238576 \nPeschel A. Otto M. Jack R. W. Kalbacher H. Jung G. Götz F. (1999 ). Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. \nJ. Biol. Chem. \n274 \n8405 –8410 . 10.1074/jbc.274.13.8405 \n10085071 \nPfaffl M. W. (2001 ). A new mathematical model for relative quantification in real-time RT-PCR. \nNucleic Acids Res. \n29 :e45 \n10.1093/nar/29.9.e45 \nPogliano J. Pogliano N. Silverman J. A. (2012 ). Daptomycin-mediated reorganization of membrane architecture causes mislocalization of essential cell division proteins. \nJ. Bacteriol. \n194 \n4494 –4504 . 10.1128/JB.00011-12 \n22661688 \nSilverman J. A. Perlmutter N. G. Shapiro H. M. (2003 ). Correlation of daptomycin bactericidal activity and membrane depolarization in Staphylococcus aureus. \nAntimicrob. Agents Chemother. \n47 \n2538 –2544 . 10.1128/AAC.47.8.2538-2544.2003 \n12878516 \nStahlhut S. G. Alqarzaee A. A. Jensen C. Fisker N. S. Pereira A. R. Pinho M. G. (2017 ). The ClpXP protease is dispensable for degradation of unfolded proteins in Staphylococcus aureus. \nSci. Rep. \n7 :11739 . 10.1038/s41598-017-12122-y \n28924169 \nStevens D. L. Ma Y. Salmi D. B. McIndoo E. Wallace R. J. Bryant A. E. (2007 ). Impact of antibiotics on expression of virulence-associated exotoxin genes in methicillin-sensitive and methicillin-resistant Staphylococcus aureus. \nJ. Infect. Dis. \n195 \n202 –211 . 10.1086/510396 \n17191165 \nTran T. T. Munita J. M. Arias C. A. (2015 ). Mechanisms of drug resistance: daptomycin resistance. \nAnn. N. Y. Acad. Sci. \n1354 \n32 –53 . 10.1111/nyas.12948 \n26495887 \nTurner C. E. Sriskandan S. (2015 ). Panton-valentine leucocidin expression by Staphylococcus aureus exposed to common antibiotics. \nJ. Infect. \n71 \n338 –346 . 10.1016/j.jinf.2015.05.008 \n26028260 \nYang S. J. Mishra N. N. Rubio A. Bayer A. S. (2013 ). Causal role of single nucleotide polymorphisms within the mprF gene of Staphylococcus aureus in daptomycin resistance. \nAntimicrob. Agents Chemother. \n57 \n5658 –5664 . 10.1128/AAC.01184-13 \n24002096\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1664-302X",
"issue": "9()",
"journal": "Frontiers in microbiology",
"keywords": "MprF; SNP analysis; Staphylococcus aureus; daptomycin; whole-genome sequencing",
"medline_ta": "Front Microbiol",
"mesh_terms": null,
"nlm_unique_id": "101548977",
"other_id": null,
"pages": "2705",
"pmc": null,
"pmid": "30459746",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "26495887;23508621;19915718;25288091;10085071;23785522;19332678;29879195;28120188;21986832;20942775;19713420;26055370;21840181;24183798;26028260;16469371;25226591;25182650;11328886;20065327;21622973;23254419;23796933;20585116;17954690;16723576;28924169;24867990;12878516;24002096;16455927;29887848;22238576;17191165;14742208;22661688",
"title": "Daptomycin Resistant Staphylococcus aureus Clinical Strain With Novel Non-synonymous Mutations in the mprF and vraS Genes: A New Insight Into Daptomycin Resistance.",
"title_normalized": "daptomycin resistant staphylococcus aureus clinical strain with novel non synonymous mutations in the mprf and vras genes a new insight into daptomycin resistance"
} | [
{
"companynumb": "NL-MYLANLABS-2018M1090541",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "GENTAMICIN"
},
"drugadditional": null,
... |
{
"abstract": "Interstitial lung disease (ILD) management guidelines support lung biopsy-guided therapy. However, the high mortality associated with thoracoscopic lung biopsy using general anesthesia (GA) in patients with ILD has deterred physicians from offering this procedure and adopt a diagnostic approach based on high-resolution CT. Here we report that thoracoscopy under regional anesthesia could be a safer alternative for lung biopsy and effectively guide ILD treatment.\n\n\n\nThis was a single-center retrospective review of prospectively maintained database and consisted of patients who underwent thoracoscopic lung biopsy between March 2016 and March 2018. Patients were divided into two groups: (A) GA, and (B) regional anesthesia using monitored anesthesia care (MAC) and thoracic epidural anesthesia (TEA).\n\n\n\nDuring the study period, 44 patients underwent thoracoscopic lung biopsy. Of these, 15 underwent MAC/TEA. There were no significant differences between the two groups with regard to pulmonary function test and clinicodemographic profile. However, operative time and hospital stay were shorter in MAC/TEA group (32.5±18.5 min vs 50.8±18.4; p=0.004, 1.0±1.3 days vs 10.0±34.7 days; p<0.001, respectively). Eight patients in the GA group, but none in the MAC/TEA group, experienced worsening of ILD after lung biopsy (p=0.03). Additionally, one patient in the GA group died due to acute ILD worsening. No cases of MAC/TEA group had to be converted to GA. In all cases a pathological diagnosis could be made.\n\n\n\nThoracoscopy using regional anesthesia might be a safer alternative to lung biopsy in patients with ILD.",
"affiliations": "Department of Surgery, Division of Thoracic Surgery, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA chitaru1207@gmail.com.;Department of Medicine, Division of Anesthesiology and Critical Care Medicine, Northwestern University, Chicago, Illinois, USA.;Department of Medicine, Division of Anesthesiology and Critical Care Medicine, Northwestern University, Chicago, Illinois, USA.;Department of Medicine, Division of Anesthesiology and Critical Care Medicine, Northwestern University, Chicago, Illinois, USA.;Department of Surgery, Division of Thoracic Surgery, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA.;Department of Surgery, Division of Thoracic Surgery, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA.;Department of Medicine, Division of Pulmonary and Critical Care Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA.;Department of Medicine, Division of Pulmonary and Critical Care Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA.;Department of Surgery, Division of Thoracic Surgery, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA.",
"authors": "Kurihara|Chitaru|C|;Tolly|Brian|B|;DeWolf|Andre|A|;Nader|Antoun|A|;Kim|Samuel|S|;Odell|David D|DD|;Argento|Angela C|AC|;Budinger|G R Scott|GRS|;Bharat|Ankit|A|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/rapm-2019-100686",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1098-7339",
"issue": "45(4)",
"journal": "Regional anesthesia and pain medicine",
"keywords": "acute pain; alternative therapies; intravenous regional anesthesia",
"medline_ta": "Reg Anesth Pain Med",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000758:Anesthesia; D000765:Anesthesia, Conduction; D000767:Anesthesia, Epidural; D001706:Biopsy; D015331:Cohort Studies; D005260:Female; D006801:Humans; D008168:Lung; D017563:Lung Diseases, Interstitial; D008297:Male; D008875:Middle Aged; D010149:Pain, Postoperative; D012189:Retrospective Studies; D012307:Risk Factors; D013906:Thoracoscopy; D016896:Treatment Outcome",
"nlm_unique_id": "9804508",
"other_id": null,
"pages": "255-259",
"pmc": null,
"pmid": "32066592",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article",
"references": "23235524;15510251;23026172;27195134;20558924;23337416;28962712;21471066;26766966;25896196;30345103;16547427;17418586;23245450;17307476;16192502;24455173;19559230;30174869;25093084;27401707",
"title": "Thoracoscopic lung biopsy under regional anesthesia for interstitial lung disease.",
"title_normalized": "thoracoscopic lung biopsy under regional anesthesia for interstitial lung disease"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK202004287",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nCardiovascular dysfunction is a recognized complication of HIV infection in children. Cardiac complications of HIV usually occur late in the course of the disease; they may be associated with drug therapy, and hence become more common as therapy and survival improve. Left ventricular (LV) dysfunction at baseline is a risk factor for death independent of the CD4 cell count, HIV viral load, and neurological disease.\n\n\nMETHODS\nWe present the case of a 15 year old girl with HIV who developed left ventricular dysfunction while non-compliant on highly active antiretroviral therapy (HAART). She presented with features of heart failure over a course of two months. Her laboratory evaluation was significant for leucopenia with a low CD4 count, high viral load, elevated ESR and CRP. The ECG showed a sinus tachycardia with diffuse ST-T segment changes and LVH with strain. Initial echo revealed dilated left heart chambers with poor LV systolic function and a small pericardial effusion with the development of an LV thrombus on follow up echo evaluation. She was started on heart failure medicines and had anticoagulation for the LV thrombus. She received adherence counseling and her HAART regimen was changed. Six months after presentation she became asymptomatic with higher CD4 counts and a normal LV size and function on echo.\n\n\nCONCLUSIONS\nImmunological recovery following a switch of a failing or potentially cardiotoxic HAART in addition to improved HAART adherence may result in resolution of left ventricular dysfunction. Early and regular cardiology evaluation may improve outcomes in these patients.",
"affiliations": "Department of Paediatrics and Child Health, Gulu University ; Uganda Heart Institute, Mulago Hospital Complex.;Uganda Heart Institute, Mulago Hospital Complex.;Uganda Heart Institute, Mulago Hospital Complex.",
"authors": "Aliku|Twalib Olega|TO|;Lubega|Sulaiman|S|;Lwabi|Peter|P|",
"chemical_list": "D000925:Anticoagulants",
"country": "Uganda",
"delete": false,
"doi": "10.4314/ahs.v15i1.39",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1680-6905",
"issue": "15(1)",
"journal": "African health sciences",
"keywords": "Dilated Cardiomyopathy; HAART",
"medline_ta": "Afr Health Sci",
"mesh_terms": "D000293:Adolescent; D000925:Anticoagulants; D023241:Antiretroviral Therapy, Highly Active; D018791:CD4 Lymphocyte Count; D006332:Cardiomegaly; D002311:Cardiomyopathy, Dilated; D003376:Counseling; D004562:Electrocardiography; D005260:Female; D015658:HIV Infections; D006801:Humans; D055118:Medication Adherence; D011859:Radiography; D012307:Risk Factors; D016896:Treatment Outcome; D018487:Ventricular Dysfunction, Left; D016277:Ventricular Function, Left; D019562:Viral Load",
"nlm_unique_id": "101149451",
"other_id": null,
"pages": "288-92",
"pmc": null,
"pmid": "25834562",
"pubdate": "2015-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "19564432;21217185;22781228;23608879;11182983;18566318;12870527;12870528;8388521;9570194;16245992;12742303",
"title": "Resolution of dilated cardiomyopathy in an adolescent with change of a failing highly active antiretroviral drug therapy.",
"title_normalized": "resolution of dilated cardiomyopathy in an adolescent with change of a failing highly active antiretroviral drug therapy"
} | [
{
"companynumb": "UG-MYLANLABS-2015M1039504",
"fulfillexpeditecriteria": "1",
"occurcountry": "UG",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NEVIRAPINE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nUse of the vasodilator midodrine for the treatment of treprostinil-induced hypotension is reported.\n\n\nCONCLUSIONS\nIntradialytic hypotension is a common complication of dialysis that increases patient mortality due to suboptimal ultrafiltration and interruption of hemodialysis. Midodrine is an α1 vasoconstrictor commonly used for the treatment of pulmonary arterial hypertension (PAH) and intradialytic hypotension. The safety of midodrine dosing at greater than 30 mg daily has not been established to date. A 49-year-old African-American man with a history of PAH and end-stage renal disease (ESRD) was receiving hemodialysis (HD) 3 times weekly. Subcutaneous treprostinil infusions were initiated for PAH, subsequently causing hypotension, with predialysis blood pressure values as low as 60/50 mm Hg. During a 6-month follow-up period, 38 of 62 dialysis sessions were interrupted or discontinued due to severe intradialytic hypotension. Counteraction of treprostinil effects was achieved by increasing the total daily midodrine dose from 30 mg to 90 mg over 6 months, with no remarkable adverse effects. In previously reported cases, maximum midodrine daily doses of 30 mg in nondialysis patients and 25 mg in patients with ESRD receiving hemodialysis were reported. The patient described here received a total daily dose of 90 mg, including 60 mg administered in divided doses for daily maintenance and 30-mg intradialytic doses; this was the highest daily midodrine dose reported to date.\n\n\nCONCLUSIONS\nA 49-year-old patient tolerated 60-mg daily doses of midodrine along with 30-mg intradialytic doses for the management of treprostinil-induced hypotension and prevention of HD interruption, without adverse effects.",
"affiliations": "Department of Pharmacy Practice, University of Illinois at Chicago College of Pharmacy, Chicago, IL.;University of Illinois at Chicago College of Pharmacy, Chicago, IL.;University of Illinois at Chicago College of Pharmacy, Chicago, IL.",
"authors": "Drambarean|Beatrice|B|;Bielnicka|Paula|P|;Alobaidi|Ali|A|",
"chemical_list": "D000959:Antihypertensive Agents; D008879:Midodrine; D011464:Epoprostenol; C427248:treprostinil",
"country": "England",
"delete": false,
"doi": "10.1093/ajhp/zxy001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1079-2082",
"issue": "76(1)",
"journal": "American journal of health-system pharmacy : AJHP : official journal of the American Society of Health-System Pharmacists",
"keywords": "hemodialysis; intradialytic hypotension; midodrine; treprostinil-induced hypotension",
"medline_ta": "Am J Health Syst Pharm",
"mesh_terms": "D000959:Antihypertensive Agents; D004305:Dose-Response Relationship, Drug; D011464:Epoprostenol; D006801:Humans; D007022:Hypotension; D007676:Kidney Failure, Chronic; D008297:Male; D008875:Middle Aged; D008879:Midodrine; D000081029:Pulmonary Arterial Hypertension; D006435:Renal Dialysis",
"nlm_unique_id": "9503023",
"other_id": null,
"pages": "13-16",
"pmc": null,
"pmid": "31381098",
"pubdate": "2019-01-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Midodrine treatment in a patient with treprostinil-induced hypotension receiving hemodialysis.",
"title_normalized": "midodrine treatment in a patient with treprostinil induced hypotension receiving hemodialysis"
} | [
{
"companynumb": "PHHY2019US033280",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "WARFARIN SODIUM"
},
"drugadditional": "3",
"... |
{
"abstract": "Snake bites are an uncommon injury requiring intervention by hand surgeons. While counteracting the effects of snake venom is the initial and urgent concern following a bite, infection caused by retention of a foreign body can present in a delayed fashion and may lead to increased morbidity. Standard radiographs of the injury should be carefully examined for foreign bodies, noting that retained snake teeth are somewhat radiolucent due to less mineralization as compared to bone and can be difficult to visualize. In our subject, a retained rattlesnake fang was found in association with a septic interphalangeal joint despite appropriate radiographic evaluation and thorough surgical irrigation and debridement upon initial presentation. This case report highlights a potential complication of snake bites, the importance of aggressive management, and the importance of increased suspicion for retained foreign bodies. Augmenting plain radiographs with additional imaging modalities, such as ultrasound, dark-field, and phase-contrast imaging, may aid in the diagnosis of retained foreign bodies after snake bites.",
"affiliations": "Brooke Army Medical Center, Department of Orthopaedic Surgery, Fort Sam Houston, TX. Electronic address: Gelman.d.e@gmail.com.;Brooke Army Medical Center, Department of Orthopaedic Surgery, Fort Sam Houston, TX.;Brooke Army Medical Center, Department of Orthopaedic Surgery, Fort Sam Houston, TX.",
"authors": "Gelman|Daniel|D|;Bates|Taylor|T|;Nuelle|Julia A V|JAV|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.jhsa.2021.04.004",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0363-5023",
"issue": null,
"journal": "The Journal of hand surgery",
"keywords": "Rattlesnake; dark-field; foreign body; phase-contrast; septic arthritis",
"medline_ta": "J Hand Surg Am",
"mesh_terms": null,
"nlm_unique_id": "7609631",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34049730",
"pubdate": "2021-05-25",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Septic Arthritis of the Proximal Interphalangeal Joint After Rattlesnake Bite.",
"title_normalized": "septic arthritis of the proximal interphalangeal joint after rattlesnake bite"
} | [
{
"companynumb": "US-BTGSP-US-BTGSP-22-0080",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CROTALIDAE POLYVALENT IMMUNE FAB (OVINE)"
},
... |
{
"abstract": "Breast cancer is the most common type of cancer in women. However, it is very rarely manifested as hematologic disorders. A 35-year-old woman was admitted because of disseminated intravascular coagulation. Examinations revealed the presence of breast cancer in her left breast; therefore, paclitaxel was administered weekly. Although disseminated intravascular coagulation was controlled, pulmonary dysfunction due to lymphangitis carcinomatosa suddenly occurred 10 weeks after treatment. Pulmonary dysfunction was effectively treated with epirubicin and cyclophosphamide. Twenty-three weeks after treatment, the patient developed liver dysfunction accompanied with jaundice due to progressive metastatic lesions in the liver; liver dysfunction improved after the administration of vinorelbine. Subsequently, because of the recurrence of pulmonary dysfunction, rechallenge with epirubicin and cyclophosphamide was performed and was effective; however, this therapy was discontinued because of its adverse effects. She expired of liver failure 33 weeks after the occurrence of disseminated intravascular coagulation. Metastatic tumors in the bone marrow, lung, and liver showed different sensitivities to different anti-cancer agents. We report a case of breast cancer manifested by hematologic disorders which was treated by a sequential chemotherapy.",
"affiliations": "Department of Breast and Thyroid Surgery Yokohama City University Medical Center, 4-57 Urafune-cho, Minami-ku, Yokohama 232-0024, Japan;",
"authors": "Ishikawa|Takashi|T|;Shimizu|Daisuke|D|;Kito|Ayako|A|;Ota|Ikuko|I|;Sasaki|Takeshi|T|;Tanabe|Mikiko|M|;Yamada|Akimitsu|A|;Arioka|Hitoshi|H|;Shimizu|Satoru|S|;Wakasugi|Junichi|J|;Mori|Ryutaro|R|;Chishima|Takashi|T|;Ichikawa|Yasushi|Y|;Endo|Itaru|I|",
"chemical_list": null,
"country": "China",
"delete": false,
"doi": "10.3978/j.issn.2072-1439.2012.10.17",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2072-1439",
"issue": "4(6)",
"journal": "Journal of thoracic disease",
"keywords": "Breast cancer; disseminated intravascular coagulation; multiple organ metastases",
"medline_ta": "J Thorac Dis",
"mesh_terms": null,
"nlm_unique_id": "101533916",
"other_id": null,
"pages": "650-4",
"pmc": null,
"pmid": "23205295",
"pubdate": "2012-12",
"publication_types": "D002363:Case Reports",
"references": "3757360;19487818;18188722;12897334;7284973;10683084;10203599;18971340;11583315",
"title": "Breast cancer manifested by hematologic disorders.",
"title_normalized": "breast cancer manifested by hematologic disorders"
} | [
{
"companynumb": "PHHY2013JP110818",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "EPIRUBICIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "Staphylococcus aureus myocarditis is a rare diagnosis with a high mortality rate, usually seen in people who are immunocompromised. Here, we report a case of a 44-year-old man on methotrexate for rheumatoid arthritis who presented in septic shock and was diagnosed with staphylococcus aureus myocarditis. The myocarditis was associated with a left ventricular apical thrombus, with normal systolic function. The myocarditis and associated thrombus were characterised on transthoracic echocardiogram and subsequently on cardiac magnetic resonance imaging. Cardiac magnetic resonance (CMR) imaging showed oedema in the endomyocardium, consistent with acute myocarditis, associated with an apical mural thrombus. Repeat CMR 3 weeks following discharge from hospital showed marked improvement in endomyocardial oedema and complete resolution of the apical mural thrombus. He was treated with a 12-week course of antibiotics and anticoagulated with apixaban. The patient was successfully managed with intravenous antibiotics and anticoagulation with complete recovery.",
"affiliations": "Cardiovascular Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.;Infectious Diseases Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.;Cardiovascular Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.;Cardiovascular Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.;Infectious Diseases Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.;Cardiovascular Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia.",
"authors": "McGee|Michael|M|0000-0002-9713-0826;Shiel|Emily|E|;Brienesse|Stephen|S|;Murch|Stuart|S|;Pickles|Robert|R|;Leitch|James|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2018/7017286",
"fulltext": "\n==== Front\nCase Rep CardiolCase Rep CardiolCRICCase Reports in Cardiology2090-64042090-6412Hindawi 10.1155/2018/7017286Case Report\nStaphylococcus aureus Myocarditis with Associated Left Ventricular Apical Thrombus http://orcid.org/0000-0002-9713-0826McGee Michael mcgee.michael.j@gmail.com\n1\nShiel Emily \n2\nBrienesse Stephen \n1\n\n3\nMurch Stuart \n1\nPickles Robert \n2\n\n3\nLeitch James \n1\n\n3\n\n1Cardiovascular Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia\n2Infectious Diseases Department, John Hunter Hospital, Lookout Road, New Lambton Heights, NSW 2305, Australia\n3Department of Medicine, University of Newcastle, Newcastle, NSW, AustraliaAcademic Editor: Ertugrul Ercan\n\n2018 23 5 2018 2018 70172867 4 2018 16 5 2018 Copyright © 2018 Michael McGee et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nStaphylococcus aureus myocarditis is a rare diagnosis with a high mortality rate, usually seen in people who are immunocompromised. Here, we report a case of a 44-year-old man on methotrexate for rheumatoid arthritis who presented in septic shock and was diagnosed with staphylococcus aureus myocarditis. The myocarditis was associated with a left ventricular apical thrombus, with normal systolic function. The myocarditis and associated thrombus were characterised on transthoracic echocardiogram and subsequently on cardiac magnetic resonance imaging. Cardiac magnetic resonance (CMR) imaging showed oedema in the endomyocardium, consistent with acute myocarditis, associated with an apical mural thrombus. Repeat CMR 3 weeks following discharge from hospital showed marked improvement in endomyocardial oedema and complete resolution of the apical mural thrombus. He was treated with a 12-week course of antibiotics and anticoagulated with apixaban. The patient was successfully managed with intravenous antibiotics and anticoagulation with complete recovery.\n==== Body\n1. Introduction\n\nStaphylococcus aureus is widely reported to be the most common bacterial cause of myocarditis and usually occurs in the setting of bacteraemia and sepsis. Rarely, it occurs without associated infective endocarditis [1, 2]. Furthermore, difficulty in determining the diagnosis, prevalence, and aetiology of myocarditis is complicated by the infrequent use of endomyocardial biopsy (EMB), the diagnostic gold standard [2, 3].\n\nNoninvasive imaging such as cardiac magnetic resonance (CMR) imaging has been shown to be reliable in the diagnosis and monitoring of disease progression in acute myocarditis [4, 5]. Despite the advances of noninvasive imaging, the sensitivity and specificity of CMR for acute myocarditis are reported at 81% and 71% and 63% and 40% in chronic myocarditis [6]. Ideally, CMR and EMB are both obtainable and are complimentary, overcoming limitations of either technique alone [4].\n\nHere, we present a case of Staphylococcus aureus myocarditis with associated left ventricular apical thrombus.\n\n2. Case History\nA 44-year-old male was admitted to the intensive care unit (ICU) critically unwell with septic shock. On the day prior to admission, he had complained of lethargy, diffuse body aches, epigastric pain, nausea, and vomiting and had experienced rigors. He had a medical background significant for rheumatoid arthritis, treated with methotrexate 10 mg weekly for the last five years and had recently travelled to Fiji.\n\nOn arrival of paramedics, the patient was nonresponsive, febrile, and tachycardic, with an unrecordable blood pressure and mottled appearance of the skin. He was drowsy and confused on arrival to the emergency department and had prolonged capillary refill of five seconds, a lactate of 6.8. There was no clear focus of infection on examination, and cardiovascular examination was normal at this time. He was found to have an acute kidney injury, hepatic impairment, and coagulopathy, see Table 1. Blood cultures returned positive in 11 hours for methicillin-sensitive Staphylococcus aureus, and antibiotics were changed to intravenous (IV) flucloxacillin. He was culture positive for 48 hours.\n\nHis course was further complicated by development of left olecranon bursitis, treated by open drainage. The bursitis was culture negative but presumed septic. He also had several episodes of atypical chest pain. Electrocardiogram at the time of pain revealed sinus tachycardia, with lateral T wave inversion, and high-sensitivity troponin was elevated at 139 ng/L (NR < 26 ng/L). Transthoracic echocardiogram revealed normal left ventricular systolic function, with an echo-dense mass in the apex, no valvular abnormality, and mild left atrial dilatation. The patient proceeded to cardiac magnetic resonance (CMR) imaging which showed increased wall thickness in the mid to apical wall segments and high signal intensity in the mid to apical endocardium on short tau inversion recovery (STIR) imaging. There was late gadolinium enhancement in the same area, consistent with oedema in the apical endomyocardium (Figure 1). There was also a nonenhancing mass in the left ventricular apex consistent with thrombus and small bilateral pleural effusions (Figure 2).\n\nAnticoagulation with therapeutic dose enoxaparin was commenced, which was subsequently changed to apixaban 5 mg twice daily prior to discharge.\n\nA repeat echocardiogram was performed 10 days after the initial echocardiogram, which did not reveal any interval change. The patient was discharged with IV flucloxacillin to continue via a peripherally inserted central catheter (PICC) line and ongoing anticoagulation with apixaban. Repeat CMR was performed 3 weeks following discharge and revealed normal left ventricular cavity size, with mildly increased wall thickness in the mid to apical wall segments. Tissue characterisation was consistent with apical wall oedema, which had reduced significantly in size since the previous CMR, and complete resolution of the left ventricular apical mural thrombus and pleural effusions (Figure 3). He completed a 6-week course of IV flucloxacillin, followed by a 6-week course of oral dicloxacillin, and remained clinically well throughout this time.\n\n3. Discussion\nThe majority of published cases of bacterial myocarditis are autopsy studies and predate the use of antibiotics [1]. Flaxman in 1943 described 17 cases of staphylococcal myocardial abscesses without endocarditis [7]. Sanders in 1963 reported nine similar cases [8]. A further seven cases of staphylococcal myocarditis have been reported, six of which died with diagnosis confirmed at autopsy [9–14]. One case had aortic valve insufficiency requiring valve replacement secondary to a massive intramyocardial abscess [15]. All cases developed septic shock as a result of staphylococcal bacteraemia, and one case died as a result of ventricular rupture [10]. Risk factors for infection were identified in four cases including end-stage renal disease on haemodialysis [12], steroid-dependent Crohn's disease, and initiation of infliximab [15] and two cases with AIDS [13].\n\nThis case demonstrates two aspects of myocarditis that are unusual: firstly, isolated staphylococcus aureus myocarditis with no evidence of valvular involvement and secondly, left ventricular apical thrombus formation in a patient with normal left ventricle systolic function.\n\nIsolated staphylococcus aureus myocarditis remains a rare condition. There have been case reports of both methicillin-sensitive and methicillin-resistant infections. As distinct from endocarditis and device infections, these cases of myocarditis are almost exclusively described in individuals who are immunocompromised.\n\nSeveral conditions can present with thrombus or thrombus-like formation in the left ventricular apex, including dilated cardiomyopathy, Loeffler's endocarditis, myxoma, Chagas disease, and aneurysms. Factors that influence thrombus formation include blood stagnation, endothelial injury, and hypercoagulable states [16, 17].\n\nIn this case, the predominant force of Virchow's triad is likely endothelial injury and inflammation secondary to myocarditis. Echocardiography demonstrated the apical mass but was not able to define the thrombus or associated inflammation in the myocardium, whereas CMR was useful for tissue characterisation but not able to identify the aetiology.\n\nAnticoagulation in cases of left ventricular thrombus, especially in the context of normal systolic function, has limited evidence but is used to reduce the risk of embolisation. Warfarin has historically been used due to familiarity and lack of evidence with direct acting oral anticoagulants (DOACs). Several cases of successful treatment with DOACs have been described [18], but to our knowledge, this is the first case of thrombus treatment with apixaban in the context of normal systolic function.\n\nConflicts of Interest\nThere are no conflicts of interest to disclose for any of the authors.\n\nFigure 1 Cardiac magnetic resonance imaging 4-chamber-view post gadolinium injection revealing late gadolinium enhancement of the endomyocardium at the left ventricular apex.\n\nFigure 2 Cardiac magnetic resonance imaging 4-chamber view (still frame from a steady-state free precession (SSFP) cine sequence) with the left ventricular apical mass taken shortly after presentation.\n\nFigure 3 Cardiac magnetic resonance imaging 4-chamber view (still frame from a steady-state free precession (SSFP) cine sequence) taken 3 weeks after the previous study and on treatment (apixaban and antibiotics) demonstrating resolution of the apical mass.\n\nTable 1 Blood work on presentation to hospital and peak values.\n\n\tPresentation\tPeak\tLaboratory reference\t\nWhite blood cell count\t12.5\t15.4\t109/L 4–11\t\nNeutrophils\t8.2\t12.7\t109/L 2–8\t\nHaemoglobin\t162\t162\tg/L 130–180\t\nPlatelets\t87\t466\t109/L 150–400\t\nBicarbonate\t17\t25\tmmol/L 22–32\t\nUrea\t16.3\t16.3\tmmol/L 3.5–8\t\nCreatinine\t290\t290\t\nμmol/L 60–110\t\nBilirubin\t69\t69\t\nμmol/L < 20\t\nGGT\t70\t70\tU/L 5–50\t\nALP\t76\t105\tU/L 30–100\t\nALT\t69\t69\tU/L < 50\t\nAST\t74\t92\tU/L < 45\t\nC-reactive protein\t339\t348\tmg/L < 5\t\nHS troponin\t\t139\tNg/L < 26\n==== Refs\n1 Wasi F. Shuter J. Primary bacterial infection of the myocardium Frontiers in Bioscience 2003 8 s228 s231 10.2741/1021 12700039 \n2 Caforio A. L. P. Pankuweit S. Arbustini E. Current state of knowledge on aetiology, diagnosis, management, and therapy of myocarditis: a position statement of the European Society of Cardiology Working Group on Myocardial and Pericardial Diseases European Heart Journal 2013 34 33 2636 2648 10.1093/eurheartj/eht210 2-s2.0-84883746417 23824828 \n3 Leone O. Veinot J. P. Angelini A. 2011 consensus statement on endomyocardial biopsy from the Association for European Cardiovascular Pathology and the Society for Cardiovascular Pathology Cardiovascular Pathology 2012 21 4 245 274 10.1016/j.carpath.2011.10.001 2-s2.0-84863722410 22137237 \n4 Baccouche H. Mahrholdt H. Meinhardt G. Diagnostic synergy of non-invasive cardiovascular magnetic resonance and invasive endomyocardial biopsy in troponin-positive patients without coronary artery disease European Heart Journal 2009 30 23 2869 2879 10.1093/eurheartj/ehp328 2-s2.0-71549115804 19696191 \n5 Gutberlet M. Spors B. Thoma T. Suspected chronic myocarditis at cardiac MR: diagnostic accuracy and association with immunohistologically detected inflammation and viral persistence Radiology 2008 246 2 401 409 10.1148/radiol.2461062179 2-s2.0-39549083887 18180335 \n6 Lurz P. Eitel I. Adam J. Diagnostic performance of CMR imaging compared with EMB in patients with suspected myocarditis JACC: Cardiovascular Imaging 2012 5 5 513 524 10.1016/j.jcmg.2011.11.022 2-s2.0-84861122683 22595159 \n7 Flaxman N. Myocardial Abscess JAMA 1943 122 12 804 806 10.1001/jama.1943.72840290001008 2-s2.0-0004198486 \n8 Sanders V. Viral myocarditis American Heart Journal 1963 66 5 707 713 10.1016/0002-8703(63)90328-4 2-s2.0-33746056651 14083793 \n9 Sikary A. K. Mridha A. R. Behera C. Sudden death of a child due to pyogenic bacterial myocarditis Medico-Legal Journal 2017 85 2 105 107 10.1177/0025817216682187 27899697 \n10 LeLeiko R. M. Bower D. J. Larsen C. P. MRSA-associated bacterial myocarditis causing ruptured ventricle and tamponade Cardiology 2008 111 3 188 190 10.1159/000121602 2-s2.0-52949093866 18434723 \n11 Lee Y. P. Hoi W. H. Wong R. C. A case of myopericarditis in a patient with methicillin-resistant Staphylococcus aureus community-acquired pneumonia Annals of the Academy of Medicine, Singapore 2008 37 3 243 242 18392307 \n12 Khan B. Strate R. W. Hellman R. \nASDIN Original Investigations : Myocardial abscess and fatal cardiac arrhythmia in a hemodialysis patient with an arterio-venous fistula infection Seminars in Dialysis 2007 20 5 452 454 10.1111/j.1525-139X.2007.00247.x 2-s2.0-34748896693 17897252 \n13 Hofman P. Michiels J. F. Rosenthal E. Acute Staphylococcus aureus myocarditis in AIDS. 2 cases Archives des Maladies du Coeur et des Vaisseaux 1993 86 12 1765 1768 8024379 \n14 Jariwala P. Punjani A. Mirza S. Harikishan B. Madhawar D. B. Myocardial abscess secondary to staphylococcal septicemia: diagnosis with 3D echocardiography Indian Heart Journal 2013 65 1 124 125 10.1016/j.ihj.2012.12.005 2-s2.0-84874517620 23438629 \n15 Reichardt P. Dahnert I. Tiller G. Hausler H. J. Possible activation of an intramyocardial inflammatory process (Staphylococcus aureus ) after treatment with infliximab in a boy with Crohn disease European Journal of Pediatrics 2002 161 5 281 283 10.1007/s00431-002-0925-9 2-s2.0-0036255224 12012225 \n16 Delewi R. Zijlstra F. Piek J. J. Left ventricular thrombus formation after acute myocardial infarction Heart 2012 98 23 1743 1749 10.1136/heartjnl-2012-301962 2-s2.0-84869209782 23151669 \n17 Solheim S. Seljeflot I. Lunde K. Prothrombotic markers in patients with acute myocardial infarction and left ventricular thrombus formation treated with pci and dual antiplatelet therapy Thrombosis Journal 2013 11 1 p. 1 10.1186/1477-9560-11-1 2-s2.0-84872133382 23311309 \n18 Mano Y. Koide K. Sukegawa H. Kodaira M. Ohki T. Successful resolution of a left ventricular thrombus with apixaban treatment following acute myocardial infarction Heart and Vessels 2016 31 1 118 123 10.1007/s00380-014-0562-z 2-s2.0-84952982408 25081096\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-6404",
"issue": "2018()",
"journal": "Case reports in cardiology",
"keywords": null,
"medline_ta": "Case Rep Cardiol",
"mesh_terms": null,
"nlm_unique_id": "101576452",
"other_id": null,
"pages": "7017286",
"pmc": null,
"pmid": "29951322",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "22595159;27899697;23438629;23151669;17897252;12012225;22137237;25081096;12700039;8024379;14083793;18434723;18392307;23311309;18180335;23824828;19696191",
"title": "Staphylococcus aureus Myocarditis with Associated Left Ventricular Apical Thrombus.",
"title_normalized": "staphylococcus aureus myocarditis with associated left ventricular apical thrombus"
} | [
{
"companynumb": "AU-PFIZER INC-2019003802",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nTo compare standard-of-care grid laser photocoagulation versus intravitreal ranibizumab (IVR) versus a combination of both in the treatment of chronic (>3 months) macular oedema secondary to branch retinal vein occlusion.\n\n\nMETHODS\nProspective, randomized, multicentre clinical trial. Thirty patients with a best-corrected visual acuity (BCVA) between 20/320 and 20/40 were randomized 1:1:1 to receive grid laser or three monthly injections of 0.5 mg IVR or both followed by 3 months of observation.\n\n\nRESULTS\nMean change from baseline BCVA at month 6 was +2 letters [laser; 0.04 logMAR, 95% confidence interval (-0.17; 0.25)], +17 letters [IVR; 0.34 (0.19; 0.5)] and +6 letters [combination; 0.12 (0.01; 0.24)] (IVR versus laser p = 0.02 and IVR versus combination p = 0.02). At month 3, mean improvement in central retinal thickness (CRT) was 90.6 μm (laser) (-18.65; 199.8), 379.5 μm (IVR) (204.2; -554.8), and 248 μm (167.2; -328.8) (combination) (IVR versus laser p = 0.005, laser versus combination p = 0.02). During the observation period, CRT improved in laser [37.6 μm (-66.82; 142.0)], but deteriorated in IVR [-142.4 μm (-247.6; -37.16)] and combination [-171.7 μm (-250.4; -92.96)] (laser versus IVR p = 0.01, laser versus combination p = 0.002) indicating recurrent oedema. Less laser retreatments (at 8 weeks) were required in combination group (2/10) than grid group (7/10).\n\n\nCONCLUSIONS\nSix-month results suggest that ranibizumab may be superior to grid laser in improving visual acuity. Grid combined with IVR neither enhanced functional and morphological improvement of IVR nor did it prevent or prolong recurrence of oedema. In IVR groups, CRT increased slowly after stopping injections, whereas improvement in visual acuity was sustained, indicating that morphological changes occur prior to functional impairment.",
"affiliations": "Eye Center, Albert-Ludwigs-University of Freiburg, Freiburg, Germany; Eye Hospital, Hannover Medical School, Hannover, Germany.",
"authors": "Pielen|Amelie|A|;Mirshahi|Alireza|A|;Feltgen|Nicolas|N|;Lorenz|Katrin|K|;Korb|Christina|C|;Junker|Bernd|B|;Schaefer|Caroline|C|;Zwiener|Isabella|I|;Hattenbach|Lars-Olof|LO|;|||",
"chemical_list": "D020533:Angiogenesis Inhibitors; D061067:Antibodies, Monoclonal, Humanized; C467484:VEGFA protein, human; D042461:Vascular Endothelial Growth Factor A; D000069579:Ranibizumab",
"country": "England",
"delete": false,
"doi": "10.1111/aos.12488",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1755-375X",
"issue": "93(1)",
"journal": "Acta ophthalmologica",
"keywords": "anti-VEGF; branch retinal vein occlusion; grid laser; intravitreal injections; macular oedema; ranibizumab",
"medline_ta": "Acta Ophthalmol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D020533:Angiogenesis Inhibitors; D061067:Antibodies, Monoclonal, Humanized; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D058449:Intravitreal Injections; D017075:Laser Coagulation; D054023:Lasers, Semiconductor; D008269:Macular Edema; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D000069579:Ranibizumab; D012008:Recurrence; D012170:Retinal Vein Occlusion; D042461:Vascular Endothelial Growth Factor A; D014792:Visual Acuity",
"nlm_unique_id": "101468102",
"other_id": null,
"pages": "e29-37",
"pmc": null,
"pmid": "25042729",
"pubdate": "2015-02",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Ranibizumab for Branch Retinal Vein Occlusion Associated Macular Edema Study (RABAMES): six-month results of a prospective randomized clinical trial.",
"title_normalized": "ranibizumab for branch retinal vein occlusion associated macular edema study rabames six month results of a prospective randomized clinical trial"
} | [
{
"companynumb": "DE-ROCHE-1435466",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "RANIBIZUMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "BACKGROUND\nEndothelial cell coverage along the Pipeline embolization device (PED) is 1 of 2 primary proposed mechanisms of action of the device, along with induction of intra-aneurysmal thrombosis. The temporal course of endothelialization following device deployment is poorly understood in human patients.\n\n\nMETHODS\nA 63-year-old female with a persistent aneurysm in the communicating segment of the internal carotid artery was treated with a second PED 14 months after the deployment of a first PED and subsequently developed a fatal intraparenchymal hemorrhage at 3 weeks postimplantation. Histopathological analysis at autopsy showed evidence of endothelialization along the second PED at this time, as well as neointimal growth between both devices. Patency of the vessel lumen with no intraluminal thrombus but thrombus showing early organization (endothelial cell ingrowth) was observed within the aneurysm dome. To our knowledge, this case represents the earliest demonstration of intimal cell growth along the PED.\n\n\nCONCLUSIONS\nAneurysm healing via endothelialization following flow diverter treatment may occur subacutely and not chronically as previously stipulated.",
"affiliations": "Neurosurgical Service, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Department of Cardiology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Neurosurgical Service, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Neurosurgical Service, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA.;Neurosurgical Service, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA; Department of Neurosurgery, National Neuroscience Institute, King Fahad Medical City, Riyadh, Saudi Arabia. Electronic address: dr.alturki.neurosurgery@gmail.com.",
"authors": "Ravindran|Krishnan|K|;DiStasio|Marcello|M|;Laham|Roger|R|;Ogilvy|Christopher S|CS|;Thomas|Ajith J|AJ|;VanderLaan|Paul A|PA|;Alturki|Abdulrahman Y|AY|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.wneu.2018.07.090",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1878-8750",
"issue": "118()",
"journal": "World neurosurgery",
"keywords": "Endothelialization; Flow diverting stent; Intracranial aneurysm; Pipeline embolization device",
"medline_ta": "World Neurosurg",
"mesh_terms": "D002343:Carotid Artery, Internal; D002533:Cerebral Angiography; D004621:Embolization, Therapeutic; D005260:Female; D006801:Humans; D002532:Intracranial Aneurysm; D008875:Middle Aged; D019233:Retreatment; D016896:Treatment Outcome",
"nlm_unique_id": "101528275",
"other_id": null,
"pages": "156-160",
"pmc": null,
"pmid": "30031197",
"pubdate": "2018-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Histopathological Demonstration of Subacute Endothelialization Following Aneurysm Retreatment with the Pipeline Embolization Device.",
"title_normalized": "histopathological demonstration of subacute endothelialization following aneurysm retreatment with the pipeline embolization device"
} | [
{
"companynumb": "SA-BAYER-2018-156003",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CLOPIDOGREL BISULFATE"
},
"drugadditional": null,... |
{
"abstract": "RAS wild-type (wt) status is necessary but not sufficient for response to anti-epidermal growth factor receptor (EGFR) agents in advanced colorectal cancer (aCRC). RNA expression of EGFR ligands epiregulin (EREG) and amphiregulin (AREG) may correlate with EGFR-targeted therapy efficacy in aCRC, so may represent a much-needed additional predictive marker for these drugs.\nTo examine a novel ligand model in a randomized clinical trial of panitumumab, irinotecan, and ciclosporin in colorectal cancer (PICCOLO) with with the a priori hypothesis that high tumor expression of either AREG or EREG would predict panitumumab therapy benefit in RAS-wt patients; and low expression, lack of efficacy.\nProspectively planned retrospective biomarker study from the PICCOLO trial, which tested the addition of panitumumab to irinotecan therapy in patients with KRAS wt aCRC who experienced failure with prior fluoropyrimidine treatment. The analysis was conducted between 2012 and 2014. A predefined dichotomous model classified tumors as \"high expressor\" (either EREG or AREG in top tertile for messenger RNA level) or \"low expressor\" (neither EREG nor AREG in top tertile). Ligand expression was assessed as a prognostic and predictive biomarker. Expression of AREG/EREG and RAS and BRAF mutations were assessed in archival tumor tissue.\nPrimary end point was progression-free survival (PFS); secondary end points were response rate and overall survival (OS).\nOf the 696 PICCOLO trial patients in the irinotecan-vs-irinotecan with panitumumab randomization, 331 had sufficient tumor tissue available and measurement of ligand expression was successful in 323. High ligand expression was not prognostic for OS (hazard ratio [HR], 0.79 [95% CI, 0.58-1.09]; P = .15) or PFS (HR, 0.93 [95% CI, 0.68-1.27]; P = .64). The primary population had RAS wt aCRC (n = 220); for RAS wt patients with high ligand expression, median (interquartile range [IQR]) PFS was 8.3 [4.0-11.0] months (irinotecan with panitumumab) vs 4.4 [2.8-6.7] months (irinotecan alone); HR, 0.38 [95% CI, 0.24-0.61]; P < .001). In RAS wt patients with low ligand expression, median (IQR) PFS was 3.2 [2.7-8.1] months (irinotecan with panitumumab) vs 4.0 [2.7-7.5] months (irinotecan); HR, 0.93 [95% CI, 0.64-1.37]; P = .73; interaction test results were significant [P = .01]). Less marked effects were seen for response rate (interaction P = .17) and OS (interaction P = .11).\nHigh ligand expression is a predictive marker for panitumumab therapy benefit on PFS in RAS wt patients; conversely, patients with low ligand expression gained no benefit. The current \"opt-in\" strategy for anti-EGFR therapy in all patients with RAS wt aCRC should be questioned. Expression of EREG/AREG is a useful biomarker for anti-EGFR therapy; optimization for clinical use is indicated.\nisrctn Identifier: ISRCTN93248876.",
"affiliations": "Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Digestive Oncology Unit, University Hospital Gasthuisberg, Herestraat 49, B-3000 Leuven, Belgium.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Clinical Trials Research Unit, University of Leeds, Leeds, United Kingdom.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Digestive Oncology Unit, University Hospital Gasthuisberg, Herestraat 49, B-3000 Leuven, Belgium.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.;Leeds Institute of Cancer and Pathology, University of Leeds, St James's University Hospital, Leeds, United Kingdom.",
"authors": "Seligmann|Jenny F|JF|;Elliott|Faye|F|;Richman|Susan D|SD|;Jacobs|Bart|B|;Hemmings|Gemma|G|;Brown|Sarah|S|;Barrett|Jennifer H|JH|;Tejpar|Sabine|S|;Quirke|Philip|P|;Seymour|Matthew T|MT|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1001/jamaoncol.2015.6065",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2374-2437",
"issue": "2(5)",
"journal": "JAMA oncology",
"keywords": null,
"medline_ta": "JAMA Oncol",
"mesh_terms": null,
"nlm_unique_id": "101652861",
"other_id": null,
"pages": "633-642",
"pmc": null,
"pmid": "26867820",
"pubdate": "2016-05-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Combined Epiregulin and Amphiregulin Expression Levels as a Predictive Biomarker for Panitumumab Therapy Benefit or Lack of Benefit in Patients With RAS Wild-Type Advanced Colorectal Cancer.",
"title_normalized": "combined epiregulin and amphiregulin expression levels as a predictive biomarker for panitumumab therapy benefit or lack of benefit in patients with ras wild type advanced colorectal cancer"
} | [
{
"companynumb": "GB-AMGEN-GBRSP2022065170",
"fulfillexpeditecriteria": "2",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PANITUMUMAB"
},
"drugadditional": "4",
... |
{
"abstract": "BACKGROUND\nThe purpose of this study was to test the efficacy and safety of daclizumab (DZM) versus anti-thymocyte globulin (ATG) as a component of induction therapy in heart transplant recipients.\n\n\nMETHODS\nThirty heart transplant patients were randomized to receive either ATG or DZM during induction therapy. Patients in the DZM group received an initial dose of 2 mg/kg intravenous (IV) at the time of transplant and 1 mg/kg IV on postoperative day 4.\n\n\nCONCLUSIONS\nRecipient, donor, and intraoperative variables did not differ significantly between groups. The cost of induction therapy, total drug cost, and hospital ward costs were significantly less for the DZM group. Average absolute lymphocyte and platelet counts were significantly higher in the DZM group. There were no significant differences in the incidence of rejection, infection, malignancy, or steroid-induced diabetes. One year survival was excellent in both groups (87%, P = 0.1). Daclizumab is a safe component of induction therapy in heart transplantation.",
"affiliations": "Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada ; Division of Cardiac Surgery, University of Alberta Hospital, 2D2.18 WMC, 8440 112 Street, Edmonton, AB T6G 2B7, Canada.;Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada.;Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada.;Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada.;Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada.",
"authors": "Mullen|John C|JC|;Kuurstra|Emily J|EJ|;Oreopoulos|Antigone|A|;Bentley|Michael J|MJ|;Wang|Shaohua|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/2047-1440-3-14",
"fulltext": "\n==== Front\nTransplant ResTransplant ResTransplantation Research2047-1440BioMed Central 2047-1440-3-142509307710.1186/2047-1440-3-14ResearchA randomized controlled trial of daclizumab versus anti-thymocyte globulin induction for heart transplantation Mullen John C 12jmullen@ualberta.caKuurstra Emily J 1emily.kuurstra@albertahealthservices.caOreopoulos Antigone 1antigone.oreopoulos@albertahealthservices.caBentley Michael J 1mike.bentley@albertahealthservices.caWang Shaohua 1shaohua.wang@albertahealthservices.ca1 Division of Cardiac Surgery, University of Alberta Hospital, Edmonton, AB, Canada2 Division of Cardiac Surgery, University of Alberta Hospital, 2D2.18 WMC, 8440 112 Street, Edmonton, AB T6G 2B7, Canada2014 30 7 2014 3 14 14 12 3 2014 18 7 2014 Copyright © 2014 Mullen et al.; licensee BioMed Central Ltd.2014Mullen et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nThe purpose of this study was to test the efficacy and safety of daclizumab (DZM) versus anti-thymocyte globulin (ATG) as a component of induction therapy in heart transplant recipients.\n\nMethods\nThirty heart transplant patients were randomized to receive either ATG or DZM during induction therapy. Patients in the DZM group received an initial dose of 2 mg/kg intravenous (IV) at the time of transplant and 1 mg/kg IV on postoperative day 4.\n\nDiscussion\nRecipient, donor, and intraoperative variables did not differ significantly between groups. The cost of induction therapy, total drug cost, and hospital ward costs were significantly less for the DZM group. Average absolute lymphocyte and platelet counts were significantly higher in the DZM group. There were no significant differences in the incidence of rejection, infection, malignancy, or steroid-induced diabetes. One year survival was excellent in both groups (87%, P = 0.1). Daclizumab is a safe component of induction therapy in heart transplantation.\n\nHeart transplantationInduction therapyImmunosuppressionDaclizumabAnti-thymocyte globulin\n==== Body\nBackground\nCardiac transplantation remains a definitive treatment option for patients with end-stage heart disease. Survival rates have improved dramatically. Nonetheless, progress in immunosuppression has been slower, partly because the heart is a fundamental organ and acute allograft rejection can include hemodynamic compromise, irreversible graft injury, and death. Furthermore, the immunosuppressive therapy used to prevent rejection increases the risk of infection, which continues to be a leading cause of death in the first year after cardiac transplantation\n[1,2]. A common immunosuppression protocol for cardiac transplantation includes cyclosporine, mycophenolate mofetil, and corticosteroids (triple therapy). An alternative to standard triple therapy at the time of cardiac transplantation has been the use of augmented immunosuppression, commonly termed ‘induction therapy’. Induction agents consist of antibodies that exhibit protective effects from allograft rejection; they are administered during the immediate postoperative period when the risk of rejection is highest due to a high donor leukocyte load\n[3]. Data from the International Society of Heart and Lung Transplant (ISHLT) show that 47% of adult heart transplant patients in the first 6 months of 2012 received some type of induction therapy\n[1]. Either a polyclonal anti-lymphocyte/anti-thymocyte globulin or an interleukin-2 (IL-2) receptor antagonist was utilized in most protocols; however, the type of product used, its dosage, and the duration of administration varied greatly. At present, there is no general consensus on the best method of induction. This fact has prompted the development of new immunosuppressive agents designed to reduce the incidence of acute rejection.\n\nDaclizumab (DZM) is a novel compound for use as a component of induction therapy. This agent is a murine monoclonal antibody, directed at the alpha subunit of the interleukin-2 receptor (IL-2R) expressed on activated T-lymphocytes\n[4]. Ninety percent of the murine protein structures have been replaced with human amino acid sequences through genetic engineering. It therefore does not induce a clinically relevant response by the host immune system. DZM was approved by Health Canada and the Federal Drug Administration (FDA) for prophylactic use of acute organ rejection in patients receiving renal transplants. Our induction therapy included T-lymphocyte inactivation through the administration of polyclonal anti-thymocyte globulin (ATG). There have been no reported randomized controlled trials comparing DZM to ATG induction in heart transplantation. The purpose of this study was to compare these therapies in heart transplant recipients.\n\nMethods\nAll adults listed for heart transplantation between June 2001 and April 2005 were considered for the study. Exclusion criteria included emergent surgery, previous transplant, multiple-organ transplant including heart-lung transplant, active infection, hepatitis C, high positive panel reactive antibodies (>15%), known sensitivity to DZM, ATG, or mouse antigens, expected inability to be followed at the study center for a full year, and inability to give informed consent. Ethical approval was obtained from the University of Alberta Health Research Ethics Board.\n\nA total of 30 adult heart transplant recipients were randomized to receive either DZM (Hoffman-La Roche Ltd., ON, Canada) or ATG (Pharmacia & Upjohn Inc., ON, Canada) as part of induction therapy. Randomization was generated by computer. Enrolment and assessment of outcomes were performed by two research assistants. Only patients were blinded to the treatment. The primary endpoints of this study were the number and severity of infection episodes post-transplant. Secondary endpoints included incidence of rejection, survival, and cost.\n\nImmunosuppressive regimen\nPatients in the control group received 10 mg/kg intravenous (IV) ATG beginning postoperatively and infused continuously for 5 to 7 days until cyclosporine or tacrolimus reached therapeutic levels. Patients in the treatment group received DZM IV at 2 mg/kg within 4 h postoperatively followed by a single 1 mg/kg dose on postoperative day 4. Patients in both groups received methylprednisolone (Solu-Medrol®, Novopharm, ON, Canada) 1 g IV intraoperatively, followed postoperatively by 2 mg/kg IV every 12 h for three doses. This was followed by prednisone or methylprednisolone (depending on whether the patient could tolerate oral medication) 1 mg/kg daily. This was tapered by 2 mg/day to 0.3 mg/kg/day. Mycophenolate mofetil (CellCept®, Hoffman La-Roche, ON, Canada) was given preoperatively 1,000 mg per oral or IV followed by 1,000 mg IV twice daily postoperatively until the patient could tolerate oral medication. At this time the patient was switched to mycophenolate mofetil 1,000 mg per oral twice daily, with a target dose of 3 g daily. Patients treated with cyclosporine received cyclosporin A (Neoral®, Novartis Pharmaceuticals Canada Inc., QB, Canada) 150 mg to 300 mg per oral twice daily until therapeutic levels were reached (250 μg/L to 400 μg/L). Patients treated with tacrolimus (Prograf®, Astellas Pharma Canada, Inc., ON, Canada) received tacrolimus 2 mg to 5 mg per oral twice daily until therapeutic levels were reached (10 mg/mL to 15 mg/mL). Patients in the ATG group received a pulse of methylprednisolone 2 mg/kg IV every 12 h for three doses starting at the point of ATG discontinuation.\n\nInfection prophylaxis\nPatients with Epstein-Barr virus (EBV) or cytomegalovirus (CMV) donor-seropositive/recipient-seronegative received 900 mg each day for 14 weeks of oral ganciclovir (Cytovene®, Hoffman-La Roche Ltd., ON, Canada) or valgancyclovir (Valcyte®, Hoffman-La Roche Ltd, ON, Canada) therapy. Patients who were CMV donor seropositive/recipient seropositive or donor seronegative/recipient seropositive received 2 weeks of 900 mg twice per day of oral ganciclovir or valganciclovir therapy.\n\nDiagnosis and treatment of acute and chronic rejection\nAcute rejection was defined as either biopsy-proven as defined by ISHLT grade 3R (3A or 3B) or higher histology\n[5], suspected and subsequently treated rejection in the presence of hemodynamic compromise, or grade 1A or 1B with symptoms (reduced ejection fraction, shortness of breath, decreased voltages or a gallop rhythm). Treatment of acute rejection typically consisted of intravenous methylprednisolone 500 g to 1,000 g for 3 days. Severe high grade or humoral rejection was treated with plasmaphoresis, intravenous immune globulin, ATG, or RATGAM (ATG made from rabbits). Grade 2 rejection or symptomatic low grade (1A or 1B) rejection was treated with a 50 mg to 80 mg prednisone tapering dose. Heart transplant patients at our centre receive 13 biopsies during the first year post transplant.\n\nDiagnosis of infection\nInfection was considered significant if it resulted in symptoms and/or a change in medical management. An infection was also considered to be severe if it appeared to prolong hospitalization, required re-admission to hospital, or was treated with intravenous antibiotics after initial hospitalization.\n\nCost analysis\nCost data were determined by calculating total drug cost, ICU cost, and ward cost. Drug costs were obtained directly from the pharmacy department. ICU and ward costs were based on a study by Hamilton et al.\n[6], in which hospital costs were acquired from patient resource consumption profiles. This accounting method was developed at our center. It included nursing costs, the direct and indirect labor and supply costs related to nursing, laboratory, radiological, and rehabilitative medicine costs, and all direct and indirect labor and supply costs required to perform tests or procedures. Physician fees were not included.\n\nStatistics\nStatistical analysis was performed using SPSS software (SPSS Inc., Chicago, IL, USA). All analysis was based upon an intention to treat principle. Continuous variables were compared between groups by an independent t-test or Mann-Whitney U where non-parametric analysis was appropriate. Discrete variables were compared between groups using chi-squared and Fisher’s exact tests where appropriate. Survival curves were created with the Kaplan-Meier method with log-rank comparisons between groups. Results of continuous variables are presented as mean ± standard error. The alpha level was set at P ≤0.05. A study by Sarris et al.\n[7] revealed a 73% 1-year infection rate in heart transplant recipients. A sample size of 14 patients per group was determined to detect a 43% reduction in infection rate with an alpha error of 5% and a power of 80%.\n\nResults\nThe flow of participants through the study is presented in Figure \n1. One hundred and ninety-nine patients were assessed for eligibility: 130 were deemed ineligible due to exclusion criteria, seven declined, 32 did not participate because they did not receive a transplant during the study period, and the remaining 30 were randomized. There were no drop-outs.\n\nFigure 1 CONSORT diagram.\n\nA summary of recipient demographics and perioperative outcomes are presented in Table \n1. There were no significant differences in preoperative recipient demographics. The incidence of cytomegalovirus (CMV) and Epstein-Barr virus (EBV) mismatch was similar between groups. Patients in the DZM group tended to require more inotropic support postoperatively (higher inotropic severity score: DZM 65 ± 5, ATG 49 ± 6, P = 0.07). No other statistically significant differences were observed in intraoperative and immediate postoperative outcomes. There were also no significant differences in donor demographics between groups (Table \n2).\n\nTable 1 Recipient demographics and perioperative outcomes\n\n \tATG (n = 15)\tDZM (n = 15)\tP value\t\nAge (years)\t58 ± 3\t57 ± 3\t0.9\t\nSex (male/female)\t11/4\t12/3\t1.0\t\nDiagnosis\t \t \t \t\n Idiopathic cardiomyopathy\t11 (73%)\t10 (67%)\t1.0\t\n Other\t4 (27%)\t5 (33%)\t1.0\t\nHeight (cm)\t172 ± 2\t172 ± 3\t0.9\t\nWeight (kg)\t78 ± 3\t83 ± 5\t0.4\t\nBody mass index (kg/m2)\t26 ± 1\t28 ± 2\t0.4\t\nStatus\t \t \t \t\n 1: Stable and waiting out of hospital\t8 (53%)\t9 (60%)\t1.0\t\n 2: Stable and waiting in hospital\t3 (20%)\t2 (13%)\t1.0\t\n 3: In hospital on Inotropic support\t4 (27%)\t3 (20%)\t1.0\t\n 4: Intubated\t0 (0%)\t1 (7%)\t1.0\t\nDiabetes mellitus\t0 (0%)\t2 (13%)\t0.5\t\nLymphocytotoxic crossmatch\t \t \t \t\n Negative\t15 (100%)\t15 (100%)\t1.0\t\nCMV mismatch\t \t \t \t\n Negative recipient/Positive donor\t1 (7%)\t1 (7%)\t1.0\t\nEBV mismatch\t \t \t \t\n Negative recipient/Positive donor\t0 (0%)\t0 (0%)\t-\t\nOperative time (min)\t333 ± 18\t351 ± 20\t0.5\t\nCardiopulmonary bypass time (min)\t187 ± 10\t194 ± 16\t0.7\t\nIntubation time (h)\t96 ± 47\t130 ± 55\t0.7\t\nIntensive care unit time (h)\t264 ± 102\t289 ± 96\t0.9\t\nInotropic severity score\t49 ± 6\t65 ± 5\t0.07\t\nTotal hospital length of stay (days)\t29 ± 8\t26 ± 6\t0.8\t\nCMV: cytomegalovirus; EBV: Epstein-Barr virus.\n\nTable 2 Donor characteristics\n\n \tATG (n = 15)\tDZM (n = 15)\tP value\t\nAge (years)\t35 ± 5\t35 ± 4\t0.9\t\nSex (male/female)\t11/4\t10/5\t1.0\t\nHeight (cm)\t172 ± 3\t172 ± 3\t0.9\t\nWeight (kg)\t78 ± 5\t86 ± 4\t0.2\t\nBody mass index (kg/m2)\t26 ± 1\t29 ± 1\t0.1\t\nDonor/recipient weight ratio\t1.01 ± 0.05\t1.08 ± 0.09\t0.5\t\nDonor ischemic time (min)\t254 ± 22\t249 ± 24\t0.9\t\nPostoperative laboratory and drug administration values averaged over a 10-day post-transplant period are presented in Table \n3. Average absolute lymphocyte counts were significantly higher in the DZM group (0.89 × 109/L vs. 0.45 × 109/L, P <0.0001), as well as average platelet count (153 per mm3vs. 114 per mm3, P = 0.004). In addition, average chloride was higher in the DZM group (103 ± 1 mmol/L vs. 101 ± 1 mmol/L, P = 0.05). In the control group, ATG was infused for 7 ± 2 days. As expected, volume of ATG given intravenously was significantly higher than DZM (5,934 ± 669 mL vs. 942 ± 152 mL, P <0.0001), and methylprednisolone dose was significantly less in the DZM group (495 ± 38 mg vs. 1,242 ± 278 mg, P <0.0001). Other drug dosages and volumes were similar between groups.\n\nTable 3 Postoperative laboratory data and drug administration\n\n \tATG (n = 15)\tDZM (n = 15)\tp value\t\nAverage white blood cells (×109/L)\t16.6 ± 1.3\t16.4 ± 1.2\t0.9\t\nAverage neutrophils (×109/L)\t13.9 ± 1.0\t13.8 ± 0.9\t0.9\t\nAverage absolute lymphocytes (×109/L)\t0.45 ± 0.04\t0.89 ± 0.09\t<0.0001\t\nAverage red blood cells (×109/L)\t3.3 ± 0.1\t3.2 ± 0.1\t0.2\t\nAverage platelet count (per mm3)\t114 ± 9\t153 ± 8\t0.004\t\nAverage hemoglobin (g/L)\t10.3 ± 0.2\t9.9 ± 0.2\t0.2\t\nAverage sodium (mmol/L)\t136 ± 1\t137 ± 1\t0.6\t\nAverage potassium (mmol/L)\t4.2 ± 0.1\t4.2 ± 0.1\t0.7\t\nAverage chloride (mmol/L)\t101 ± 1\t103 ± 1\t0.05\t\nAverage CO2 (mmol/L)\t25 ± 1\t24 ± 1\t0.2\t\nAverage glucose (mmol/L)\t8.4 ± 0.4\t8.7 ± 0.7\t0.6\t\nAverage urea (mmol/L)\t16.2 ± 1.3\t16.8 ± 1.2\t0.7\t\nAverage ionized calcium (mmol/L)\t1.25 ± 0.21\t1.16 ± 0.02\t0.09\t\nAverage creatinine (mmol/L)\t143 ± 10\t178 ± 21\t0.1\t\nPlatelet units given\t8 ± 2\t7 ± 4\t0.9\t\nRed blood cell units given\t9 ± 2\t8 ± 3\t0.8\t\nStudy drug induction volume (mL)\t5,934 ± 669\t942 ± 152\t<0.0001\t\nMethylprednisolone (mg)\t1,242 ± 278\t495 ± 38\t<0.0001\t\nPrednisone (mg)\t552 ± 38\t626 ± 53\t0.2\t\nIV Mycophenolate Mofetil (mg)\t6,017 ± 788\t6,000 ± 1005\t1.0\t\np.o. Mycophenolate Mofetil (mg)\t14,983 ± 1025\t16,317 ± 1145\t0.4\t\nPatients receiving cyclosporin A only\t12\t11\t1.0\t\nPatients receiving tacrolimus only\t2\t1\t1.0\t\nPatients converted from cyclosporin A to tacrolimus\t0\t3\t0.2\t\nPatients converted from tacrolimus to cyclosporin A\t1\t0\t1.0\t\nCyclosporin A (mg)\t2,532 ± 348\t2,621 ± 333\t0.8\t\nTacrolimus (mg)\t40 ± 14\t40 ± 6\t1.0\t\nInsulin (units)\t502 ± 80\t724 ± 202\t0.3\t\nTotal steroids for 1 year (mg)\t4,631 ± 638\t3,846 ± 434\t0.2\t\nThe cost analysis is illustrated in Figure \n2. Induction cost (cost of DZM vs. cost of ATG) was significantly lower in the DZM group (Figure \n2, $5,337 ± 308, CI ± 604.17 vs. $7,384 ± 799, CI ± 1,565.84, P = 0.03). Total drug cost (induction cost plus methylprednisolone, mycophenalate mofetil, cyclosporine A and/or tacrolimus, and prednisone) was also significantly lower in the DZM group (Figure \n2, $6,044 ± 328, CI ± 642.28 vs. $8,133 ± 828, CI ± 1,622.97, P = 0.03). In addition, hospital ward (step-down unit) cost was lower in the DZM group (Figure \n2, $11,353 ± 3,320, CI ± 6,507.38 vs. $14,376 ± 3,526, CI ± 6,911.53, P <0.05). Intensive care unit stay and total hospital costs were not significantly different between groups (Figure \n2).\n\nFigure 2 Cost analysis: total hospital cost (P = 0.8).\n\nThe incidence of rejection is presented in Table \n4. Mean biopsy grade was lower in the DZM group, but not statistically different (0.3 vs. 0.4, P = 0.09). Allograft rejection occurred in two patients, both in the ATG group. One of these patients had confirmed humoral rejection 19 days post transplant, and was treated with IV immune globulin. The second patient experienced an episode of hypotension 6 days post transplant with right ventricular dysfunction and right bundle branch block with decreased voltages. This was felt to be due to acute rejection, and the patient was subsequently treated with pentaspan, inotropes, IV cyclosporine A, and pulse steroids.\n\nTable 4 Rejection, infection, and other outcomes\n\n \tATG (n = 15)\tDZM (n = 15)\tp value\t\nMean biopsy grade\t0.4\t0.3\t0.09\t\nPatients experiencing rejection\t2 (13%)\t0\t0.5\t\nTotal number of acute rejections\t2\t0\t0.2\t\nTime to first rejection episode (days)\t84\t-\t-\t\nPatients experiencing infection\t10 (67%)\t10 (67%)\t1.0\t\nTotal number of infections\t25\t21\t0.7\t\nInfections/patient\t1.7\t1.4\t0.7\t\nPatients experiencing severe infection\t4 (27%)\t5 (33%)\t1.0\t\nNumber of severe infections\t7\t7\t1.0\t\nSevere infections/patient\t0.5\t0.5\t1.0\t\nNumber of CMV infections\t1\t2\t1.0\t\nMalignancy\t0\t1\t1.0\t\nSteroid-induced diabetes\t2\t2\t1.0\t\nRe-transplant\t0\t0\t-\t\nICU length of stay (days)\t11 ± 4\t12 ± 4\t09\t\nTotal hospital length of stay (days)\t29 ± 8\t27 ± 6\t0.8\t\nOne-month survival\t93%\t100%\t0.1\t\nOne-year survival\t87%\t87%\t0.1\t\nThe number of patients experiencing at least one episode of infection was the same between groups (Table \n4, 67% in both groups). Time to first infection and other infectious complications were also similar between the two groups.\n\nNo patient had any acute side effect or allergic reaction to either study drug. There was no significant difference for incidence of steroid induced-diabetes. None of the study patients were re-transplanted. One of the patients in the DZM group had an incidence of malignancy: a basal cell carcinoma lesion on the ear which was treated successfully.An actuarial survival curve is presented in Figure \n3. Survival at 1 month and 1 year was 100% and 87% in the DZM group, and 93% and 87% in the ATG group, respectively. There were two patients who died in the ATG group. The first patient in the ATG group died 5 days post transplant due to intestinal ischemia. The second patient in the ATG group died 49 days post transplant due to fungal sepsis. Two patients also died in the DZM group. The first patient died 72 days post transplant due to sepsis. The second patient in the DZM group died 267 days post transplant of a stroke.\n\nFigure 3 Actuarial survival. Log rank comparison, P = 0.1.\n\nDiscussion\nInfection and rejection have been identified as risk factors for morbidity and mortality after heart transplantation\n[1]. In order to improve patient survival and quality of life, strategies have been developed to minimize these risk factors for infection and rejection, including induction agents as part of the immunosuppression regimen in the early postoperative period. This study compared the results of using DZM versus ATG during induction therapy after heart transplantation.\n\nThe use of DZM in addition to a triple immunosuppressive regimen was well tolerated in heart transplant recipients, with one adverse reaction to the drug. There were no differences in the incidence of rejection, steroid-induced diabetes or malignancy compared to patients who received ATG. In addition, average absolute lymphocytes and average platelet count were significantly higher in the DZM group. One-year survival was excellent in both groups (87%) and was similar to the experience from the ISHLT Data Registry (1-year survival 81% based on survival rates for heart transplants performed between 1982 and 2011\n[1].\n\nThe efficacy and safety of DZM has been demonstrated in a large number of kidney\n[8-28], kidney-pancreas\n[29,30], liver\n[31-36], and lung clinical trials\n[37,38]. There have been few studies involving DZM in cardiac transplantation\n[39-45], despite the observation that almost 50% of patients undergoing cardiac transplantation receive anti-body-based induction therapy\n[1].\n\nIn our previous study of ATG and DZM in lung transplant recipients\n[37], both agents were also equally effective in rejection outcomes, however, the time to first rejection tended to be more prolonged with DZM (ATG: 138 days, DZM: 220 days, P = 0.06).\n\nThe incidence of overall infection in the present study is similar to other reports in heart transplantation\n[7]. DZM has not been found to alter infection rates in kidney\n[9,12,15,21,23,46], kidney-pancreas\n[28-30], heart\n[42,45], lung\n[37,38,47,48] or liver\n[31,34,35,49,50] transplant recipients.\n\nThe results of this study support the efficacy of a two dose DZM regimen which is simpler in that patients need not return to hospital for treatment every 2 weeks. The ATG regimen is more complex than our DZM regimen, requiring 5 to 7 days of continuous intravenous infusion and more steroid administration. In addition, ATG may have limited use due to the formation of antibodies; therefore, treatment of future rejection episodes may not be possible with ATG.\n\nIn this study, both average absolute lymphocyte count and platelet count were significantly reduced in the ATG group compared to the DZM group (Table \n3). This finding is consistent with our previous study of the two agents in lung transplant recipients\n[37]. Brock and colleagues\n[38] noted that in lung transplantation, patients receiving ATG induction most commonly develop thrombocytopenia, with 74% developing a platelet count of <100,000/mm3[38]. In our current study, one patient in the ATG group developed severe thrombocytopenia, however, not in response to the ATG infusion.\n\nThe exact mechanism of effect of DZM is unknown; however, the efficacy of DZM is likely related to its selective targeting of active T-lymphocytes. DZM readily binds to the alpha subunit of the IL-2 receptor of circulating active T-lymphocytes, preventing activation of inactive T-lymphocytes by stimulation of the IL-2 receptor and possibly causing down regulation of IL-2 receptor expression\n[51,52]. This allows DZM to specifically target the active lymphocytes, leaving the immune system otherwise intact. This is consistent with our results of higher average absolute lymphocytes in the DZM group. DZM has also been genetically engineered to contain 90% human determinants. This reduces the immunogenicity of the molecule and lengthens its circulating half-life (20 days). An advantage of DZM’s long half-life is that T-cell rebound after discontinuation of DZM does not occur. Patients receiving ATG at our center receive a pulse of methylprednisolone at the point of ATG discontinuation to prevent this T-cell rebound. Patients in the ATG group therefore required a significantly higher dose of methylprednisolone compared to the DZM group. Furthermore, because only a fraction of the antibodies from ATG are directed against T-lymphocytes, a large amount of volume (10 mg/kg for 5 to 7 days) must be administered. This extra volume may lead to excess fluid balances which we normally try to avoid after heart transplantation.\n\nA cost analysis revealed that the cost of DZM induction was significantly lower than ATG induction in heart transplant recipients. Total drug cost and hospital ward cost was also less in the DZM group. The use of DZM induction could thus lead to a cost savings of between $2,000 and $3,000 in some heart transplant recipients.\n\nOur study has demonstrated that DZM was a safe component of induction therapy in heart transplantation. Our study highlights the advantages of DZM, including ease of administration, lower cost, higher lymphocyte count, and freedom from excessive platelet destruction. Both methods of induction therapy worked well with excellent 1-year survival. Daclizumab was a useful induction agent in our immunosuppression protocol for heart transplant recipients.\n\nCompeting interests\nThis study was funded by an unrestricted research grant from Hoffmann-La Roche. Data collection, analysis, and manuscript preparation was conducted by the investigators in compliance with the protocol and was independent of the sponsor. The authors declare that they have no competing interests.\n\nAuthors’ contributions\nJCM, AO, and MJB participated in research design. JCM, AO, MJB, and SW participated in acquisition of data. EJK, AO, and MJB, participated in data analysis. JCM, EJK, AO, and MJB participated in writing of the manuscript. All authors read and approved the final manuscript.\n\nAcknowledgements\nThe authors wish to thank Dennis L. Modry, MD, Arvind Koshal, MD, Jeffery R. Burton, MD, Ilene Burton, RN, Wayne J. Tymchak, MD, Karen Doucette, MD, Jutta Preiksaitis, MD, and Phil F. Halloran, MD for their support and assistance with this research.\n\nPresented in part at the 25th Annual Meeting of the International Society of Heart and Lung Transplantation, April 2005, Philadelphia, PA, USA.\n==== Refs\nLund LH Edwards LB Kucheryavaya AY Dipchand AI Benden C Christie JD Dobbels F Kirk R Rahmel AO Yusen RD Stehlik J International Society for Heart and Lung Transplantation The Registry of the International Society for Heart and Lung Transplantation: thirtieth official adult heart transplant report–2013; focus theme: age J Heart Lung Transplant 2013 32 951 964 24054804 \nMiller LW Naftel DC Bourge RC Kirklin JK Brozenca SC Jarcho J Hobbs RE Mills RM Infection after heart transplantation: a multi-institutional study J Heart Lung Transplant 1994 13 381 393 8061013 \nAbramowicz D Wissing KM Broeders N Induction with anti-CD3 antibodies Curr Opin Organ Transplant 1999 4 312 317 \nZenapax product monograph Roche Pharmaceuticals 1998 1 Basel, Switzerland: F. Hoffmann - La Roche Ltd \nBillingham M Cary NRB Hammond ME Kemnitz J Marboe C McHallister HA Snovar DC Winters GL Zerbe A A working formulation for the standardization of nomenclature in the diagnosis of heart and lung rejection: heart rejection study group J Heart Lung Transplant 1990 9 587 593 \nHamilton A Norris C Wensel R Koshal A Cost reduction in cardiac surgery Can J Cardiol 1994 10 721 727 7922827 \nSarris GE Moore KA Schroeder JS Hunt SA Fowler MB Valantine HB Vagelos RH Billingham ME Oyer PE Stinson EB Cardiac transplantation: the Stanford experience in the cyclosporine era J Thorac Cardiovasc Surg 1994 108 240 252 8041172 \nAsher JF Wilson CH Gupta A Gok MA Talbot D Use of daclizumab in preventing delayed graft function in non-heart beating donor kidney transplantation in Newcastle upon Tyne Transplantationsmedizin: Organ Der Deutschen Transplantationsgesellschaft 2004 16 96 100 \nAbou-Jaoude MM Ghantous I Almawi WY Comparison of daclizumab, an interleukin 2 receptor antibody, to anti-thymocyte globulin-Fresenius induction therapy in kidney transplantation Mol Immunol 2003 39 1083 1088 12835081 \nEkberg H Bäckman L Tufveson G Tydén G Zenapax (daclizumab) reduces the incidence of acute rejection episodes and improves patient survival following renal transplantation Transplant Proc 1999 31 267 268 10083102 \nWilson CH Brook NR Gok MA Asher JF Nicholson ML Talbot D Randomized clinical trial of daclizumab induction and delayed introduction of tacrolimus for recipients of non-heart-beating kidney transplants Br J Surg 2005 92 681 687 15856479 \nNashan B Light S Hardie IR Lin A Johnson JR Reduction of acute allograft rejection by daclizumab Transplantation 1999 67 110 115 9921806 \nHengster P Pescovitz MD Hyatt D Margreiter R Cytomegalovirus infections after treatment with daclizumab, an anti IL-2 receptor antibody, for prevention of renal allograft rejection Transplantation 1999 68 310 313 10440409 \nKandus A Grego K Bren AF Prevention of early acute rejection with daclizumab and triple immunosuppression in cadaveric renal allograft recipients Ther Apyher Dial 2005 9 262 264 \nOsuna A Gentil MA Capdevila L Cantarell C Mazuecos A Pereira P Rodriguez-Alarra G Gonzalez-Molina M Spanish Kidney Transplant of Elderly Donor Study Group Two doses of daclizumab with delayed introduction of low-dose tacrolimus in elderly recipients of cadaveric renal transplants from donors >55 years of age Transplant Proc 2005 37 1438 1440 15866630 \nRostaing L Cantarovich D Mourad G Budde K Rigotti P Mariat C Margreiter R Capdevilla L Lang P Vialtel P Ortuno-Mirete J Charpentier B Legendre C Sanchez-Plumed J Oppenheimer F Kessler M CARMEN Study Group Corticosteroid-free immunosuppression with tacrolimus, mycophenolate mofetil, and daclizumab induction in renal transplantation Transplantation 2005 79 807 814 15818323 \nSoltero L Carbajal H Sarkissian N Khan AJ Brennan S Gonzalez JM Truong LD Suki WN A truncated-dose regimen of daclizumab for prevention of acute rejection in kidney transplant recipients: a single-center experience Transplantation 2004 78 1560 1563 15599323 \nPoorrezagholi F Einollahi B Firoozan A Nafar M Yadegari H Moghaddam SM Simforoosh N Basiri A Farhangi S Effect of daclizumab (zenapax) on prevention of acute rejection of renal transplantation Transplant Proc 2003 35 3735 3736 \nBumgardner GL Hardie I Johnson RW Lin A Nashan B Pescovitz MD Ramos E Vincenti F Phase III Daclizumab Study Group Results of 3-year phase III clinical trials with daclizumab prophylaxis for prevention of acute rejection after renal transplantation Transplantation 2001 72 839 845 11571447 \nNair MP Nampoory MRN Johny KV Costandi JN Abdulhalim M El-Reshaid W Al-Muzairai I Ninan VT Samhan M Al-Mousawi M Induction immunosuppression with interleukin-2 receptor antibodies (basiliximab and daclizumab) in renal transplant recipients Transplant Proc 2001 33 2767 2769 11498153 \nEkberg H Bäckman L Tufveson G Tydén G Nashan B Vincenti F Daclizumab prevents acute rejection and improves patient survival post transplantation: 1 year pooled analysis Transpl Int 2000 13 151 159 10836653 \nVincenti F Daclizumab: novel biologic immunoprophylaxis for prevention of acute rejection in renal transplantation Transplant Proc 1999 31 2206 2207 10500546 \nVincenti F Kirkman R Light S Bumgardner G Pescovitz M Halloran P Neylan J Wilkinson A Ekberg H Gaston R Backman L Burdick J Interleukin-2-receptor blockade with daclizumab to prevent acute rejection in renal transplantation N Engl J Med 1998 338 161 165 9428817 \nAbou-Jaoude MM Ghantous I Najm R Afif C Almawi WY Daclizumab versus anti-thymocyte globulin-fresenius as induction therapy for low-risk kidney transplant recipients Transplant Proc 2003 35 2731 2732 14612096 \nAbramowicz D Vanrenterghem Y Squifflet JP Kuypers D Mourad M Meurisse M Wissing M Efficacy and cardiovascular safety of daclizumab, mycophenolate mofetil, tacrolimus, and early steroid withdrawal in renal transplant recipients: a multicenter, prospective, pilot trial Clin Transplant 2005 19 475 482 16008591 \nMeier-Kriesche H-U Kaza H Palekar SS Friedman GS Mulgaonkar SP Ojo AO Kaplan B The effect of Daclizumab in a high-risk renal transplant population Clin Transplant 2000 14 509 513 11048998 \nEkberg H Persson NH Källen R Gül-Baykurt N Two doses of daclizumab in conjunction with low-dose cyclosporine, mycophenolate mofetil and Steroids resulted in a low incidence of acute rejection after renal transplantation Scand J Immunol 2003 58 670 677 14636424 \nCiancio G Burke GW Suzart K Roth D Kupin W Rosen A Olson L Esquenazi V Miller J Daclizumab induction, tacrolimus, mycophenolate mofetil and steroids as an immunosuppression regimen for primary kidney transplant recipients Transplantation 2002 73 1100 1106 11965039 \nStratta RJ Alloway RR Lo A Hodge EE PIVOT Study Group One-year outcomes in simultaneous kidney-pancreas transplant recipients receiving an alternative dosing regimen of daclizumab Transplant Proc 2004 36 1080 1081 15194375 \nRasaiah SB Light JA Sasaki TM Currier CB A comparison of daclizumab to ATGAM induction in simultaneous pancreas-kidney transplant recipients on triple maintenance immunosuppression Clin Transplant 2000 14 409 412 10946780 \nBoillot O Mayer DA Boudjema K Salizzoni M Gridelli B Filipponi F Trunecka P Krawczyk M Clavien PA Ducerf C Margarit C Margreiter R Pallardo JM Corticosteroid-free immunosuppression with tacrolimus following induction with daclizumab: a large randomized clinical study Liver Transpl 2005 11 61 67 15690537 \nInnocenti F Humeres R Zamboni M Sanhueza E Zapata R Hepp J Rius M IL-2 receptor blockers in liver transplantation: initial experience with daclizumab in Chile Transplant Proc 2003 35 2520 2521 14612001 \nFahlke J Wolff S Mantke R Pross M Weiss G Buerger T Lippert H Staggered immunosuppression with the interleukin-2 receptor antagonist daclizumab combined with tacrolimus, prednisolone, and mycophenolate mofetil after orthotopic liver transplantation: a pilot efficacy and safety study Transplant Proc 2002 34 1242 1244 12072328 \nNiemeyer G Koch M Light S Kuse ER Nashan B Long-term safety, tolerability and efficacy of daclizumab (zenapax) in a two-dose regimen in liver transplant recipients Am J Transplant 2002 2 454 460 12123212 \nEmre S Gondolesi G Polat K Ben-Haim M Artis T Fishbein TM Sheiner PA Kim-Schluger L Schwartz ME Miller CM Use of daclizumab as initial immunosuppression in liver transplant recipients with impaired renal function Liver Transpl 2001 7 220 225 11244163 \nFigueras J Bernardos A Prieto M Gomez M Rimola A Ortiz de Urbina J Cuervas-Mons V de la Mata M Dominguez-Granados R Steroid-free regimen with daclizumab, mycophenolate mofetil, and tacrolimus in liver transplant recipients Transplant Proc 2002 34 1511 1513 12176461 \nMullen J Oreopoulos A Lien D Bentley MJ Modry DL Stewart K Winton TL Jackson K Doucette K Preiksaitis J Halloran PF A randomized controlled trial of daclizumab versus anti-thymocyte globulin induction for lung transplantation J Heart Lung Transplant 2007 26 504 510 17449421 \nBrock MV Borja MC Ferber L Orens JB Anzcek RA Krishnan J Yang SC Conte JV Induction therapy in lung transplantation: a prospective, controlled clinical trial comparing OKT3, anti-thymocyte globulin, and daclizumab J Heart Lung Transplant 2001 20 1282 1289 11744411 \nBeniaminovitz A Itescu S Lietz K Donovan M Burke EM Groff BD Edwards N Mancini DM Prevention of rejection in cardiac transplantation by blockade of the interleukin-2 receptor with a monoclonal antibody N Eng J Med 2000 342 613 619 \nHershberger RE Starling RC Eisen HJ Bergh CH Kormos RL Love RB Van Bakel A Gordon RD Popat R Cockey L Mamelok RD Daclizumab to prevent rejection after cardiac transplantation N Eng J Med 2005 352 2705 2713 \nLietz K John R Beniaminovitz A Burke EM Suciu-Foca N Mancini DM Edwards NM Itescu S Interleukin-2 receptor blockade in cardiac transplantation: influence of HLA-DR locus incompatibility on treatment efficacy Transplantation 2003 75 781 787 12660501 \nKobashigawa J David K Morris J Chu AH Steffen BJ Gotz VP Gordon RD Daclizumab is associated with decreased rejection and no increased mortality in cardiac transplant patients receiving MMF, cyclosporine, and corticosteroids Transplant Proc 2005 37 1333 1339 15848713 \nJoyal D Cantarovich M Cecere R Giannetti N Early experience with two-dose daclizumab in the prevention of acute rejection in cardiac transplantation Clin Transplant 2004 18 493 496 15344949 \nChin C Pittson S Luikart H Bernstein D Robbins R Reitz B Oyer P Valantine H Induction therapy for pediatric and adult heart transplantation: comparison between OKT3 and daclizumab Transplantation 2005 80 477 481 16123721 \nCarlsen J Johansen M Boesgaard S Andersen CB Arendrup H Aldershvilet J Mortensen SA Induction therapy after cardiac transplantation: a comparison of anti-thymocyte globulin and daclizumab in the prevention of acute rejection J Heart Lung Transplant 2005 24 296 302 15737756 \nMorris JA Hanson JE Steffen BJ Chu AH Chi-Burris KS Gotz P Gordon RD Daclizumab is associated with decreased rejection and improved patient survival in renal transplant recipients Clin Transplant 2005 19 340 345 15877795 \nBhorade SM Jordan A Villanueva J Yu A Kramer H Vigneswaran WT Garrity ER Comparison of three tacrolimus-based immunosuppressive regimens in lung transplantation Am J Transplant 2003 3 1570 1575 14629288 \nGarrity ER Villanueva J Bhorade SM Husain AN Vigneswaran WT Low rate of acute lung allograft rejection after the use of daclizumab, an interleukin 2 receptor antibody Transplantation 2001 71 773 777 11330541 \nSellers MT McGuire BM Haustein SV Bynon JS Hunt SL Eckhoff DE Two-dose daclizumab induction therapy in 209 liver transplants: a single-center analysis Transplantation 2004 78 1212 1217 15502722 \nYan LN Wang W Li B Lu SC Wen TF Lin QY Zeng Y Cheng NS Zhao JC Dai YM Single-dose daclizumab induction therapy in patients with liver transplantation World J Gastroenterol 2003 9 1881 1883 12918145 \nSavo AM Book BK Henson S Hakimi J Pescovitz MD Daclizumab rapidly saturates interleukin-2 receptor-alpha (CD25) on lymph node lymphocytes in children Transplant Proc 1999 31 1182 1183 10083528 \nVincenti F Nashan B Light S Daclizumab: outcome of phase III trials and mechanism of action Transplant Proc 1998 30 2155 2158 9723424\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2047-1440",
"issue": "3()",
"journal": "Transplantation research",
"keywords": "Anti-thymocyte globulin; Daclizumab; Heart transplantation; Immunosuppression; Induction therapy",
"medline_ta": "Transplant Res",
"mesh_terms": null,
"nlm_unique_id": "101597592",
"other_id": null,
"pages": "14",
"pmc": null,
"pmid": "25093077",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": "10836653;15818323;11744411;16123721;24054804;15690537;12123212;10699160;15194375;9428817;10946780;14636424;7922827;11498153;14612096;10500546;11048998;10083528;15344949;9723424;11965039;15967003;15866630;15987919;15848713;11244163;14629288;8061013;2277293;16008591;17449421;12835081;15599323;10083102;15877795;8041172;15856479;15502722;9921806;10440409;12176461;15737756;14612001;11571447;12918145;12660501;14612098;12072328;11330541",
"title": "A randomized controlled trial of daclizumab versus anti-thymocyte globulin induction for heart transplantation.",
"title_normalized": "a randomized controlled trial of daclizumab versus anti thymocyte globulin induction for heart transplantation"
} | [
{
"companynumb": "CA-ROCHE-1454528",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DACLIZUMAB"
},
"drugadditional": null,
"drug... |
{
"abstract": "Bendamustine is a multifunctional alkylating agent with single agent activity in myeloma. We designed the current phase 1/2 trial to determine the maximum tolerated doses (MTD) of bendamustine that can be safely combined with lenalidomide and dexamethasone and to assess the safety and efficacy of the combination. Patients with relapsed MM following at least 1 prior therapy, but no more than four lines of prior therapy and with measurable disease were enrolled. Bendamustine 75 mg/m(2) given on days 1 and 2, lenalidomide 25 mg given days 1-21 and dexamethasone 40 mg on days 1, 8, 15, and 22, was the recommended Phase 2 dose. Seventy-one patients were accrued: 21 on Phase 1 and 50 on Phase 2. The median age was 62.3 years; patients had a median of three prior lines of therapy (range 1-4), with over 70% of the patients having received prior lenalidomide, bortezomib, and/or peripheral blood stem cell transplant. Thirty-four of 70 (49%) patients had a confirmed partial response or better, including 20 patients (29%) with a very good partial response or better. An additional 4 patients had a minor response, translating to an overall 55% clinical benefit rate. Grade 3 or higher toxicity was seen in 96% of patients, with ≥grade 3 hematologic in 94% and nonhematologic in 50%. The median progression free survival was 11.8 months and the median duration of response was 23 months. The combination of bendamustine, lenalidomide, and dexamethasone is very effective in relapsed multiple myeloma with high response rates and durable responses",
"affiliations": "Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, City of Hope, Duarte, California.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology and Oncology, Mayo Clinic, Jacksonville, Florida.;Division of Hematology, Univerity of Chicago, Chicago, Illinois.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, Mayo Clinic, Rochester, Minnesota.;Division of Hematology, Washington University, St.Louis, Missouri.;Division of Hematology, City of Hope, Duarte, California.;Division of Hematology and Oncology, Mayo Clinic, Jacksonville, Florida.;Multiple Myeloma Research Consortium, Norwalk, Connecticut.;Division of Hematology, Washington University, St.Louis, Missouri.",
"authors": "Kumar|Shaji K|SK|;Krishnan|Amrita|A|;LaPlant|Betsy|B|;Laumann|Kristina|K|;Roy|Vivek|V|;Zimmerman|Todd|T|;Gertz|Morie A|MA|;Buadi|Francis K|FK|;Stockerl Goldstein|Keith|K|;Birgin|Ann|A|;Fiala|Mark|M|;Duarte|Lupe|L|;Maharaj|Michelle|M|;Levy|Joan|J|;Vij|Ravi|R|",
"chemical_list": "D013792:Thalidomide; D003907:Dexamethasone; D000069461:Bendamustine Hydrochloride; D000077269:Lenalidomide",
"country": "United States",
"delete": false,
"doi": "10.1002/ajh.24181",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0361-8609",
"issue": "90(12)",
"journal": "American journal of hematology",
"keywords": null,
"medline_ta": "Am J Hematol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069461:Bendamustine Hydrochloride; D003907:Dexamethasone; D005260:Female; D006801:Humans; D000077269:Lenalidomide; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D013792:Thalidomide",
"nlm_unique_id": "7610369",
"other_id": null,
"pages": "1106-10",
"pmc": null,
"pmid": "26331432",
"pubdate": "2015-12",
"publication_types": "D017426:Clinical Trial, Phase I; D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Bendamustine, lenalidomide, and dexamethasone (BRD) is highly effective with durable responses in relapsed multiple myeloma.",
"title_normalized": "bendamustine lenalidomide and dexamethasone brd is highly effective with durable responses in relapsed multiple myeloma"
} | [
{
"companynumb": "US-CELGENE-USA-2015093917",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nIt is unknown whether the reduction in HIV-1 reservoirs seen after allogeneic hematopoietic stem cell transplantation (HSCT) with susceptible donor cells is sufficient to achieve sustained HIV-1 remission.\n\n\nOBJECTIVE\nTo characterize HIV-1 reservoirs in blood and tissues and perform analytic antiretroviral treatment interruptions to determine the potential for allogeneic HSCT to lead to sustained, antiretroviral-free HIV-1 remission.\n\n\nMETHODS\nCase report with characterization of HIV-1 reservoirs and immunity before and after antiretroviral interruption.\n\n\nMETHODS\nTertiary care center.\n\n\nMETHODS\nTwo men with HIV with undetectable HIV-1 after allogeneic HSCT for hematologic tumors.\n\n\nMETHODS\nQuantification of HIV-1 in various tissues after HSCT and the duration of antiretroviral-free HIV-1 remission after treatment interruption.\n\n\nRESULTS\nNo HIV-1 was detected from peripheral blood or rectal mucosa before analytic treatment interruption. Plasma HIV-1 RNA and cell-associated HIV-1 DNA remained undetectable until 12 and 32 weeks after antiretroviral cessation. Both patients experienced rebound viremia within 2 weeks of the most recent negative viral load measurement and developed symptoms consistent with the acute retroviral syndrome. One patient developed new efavirenz resistance after reinitiation of antiretroviral therapy. Reinitiation of active therapy led to viral decay and resolution of symptoms in both patients.\n\n\nCONCLUSIONS\nThe study involved only 2 patients.\n\n\nCONCLUSIONS\nAllogeneic HSCT may lead to loss of detectable HIV-1 from blood and gut tissue and variable periods of antiretroviral-free HIV-1 remission, but viral rebound can occur despite a minimum 3-log10 reduction in reservoir size. Long-lived tissue reservoirs may have contributed to viral persistence. The definition of the nature and half-life of such reservoirs is essential to achieve durable antiretroviral-free HIV-1 remission.\n\n\nBACKGROUND\nFoundation for AIDS Research and National Institute of Allergy and Infectious Diseases.",
"affiliations": null,
"authors": "Henrich|Timothy J|TJ|;Hanhauser|Emily|E|;Marty|Francisco M|FM|;Sirignano|Michael N|MN|;Keating|Sheila|S|;Lee|Tzong-Hae|TH|;Robles|Yvonne P|YP|;Davis|Benjamin T|BT|;Li|Jonathan Z|JZ|;Heisey|Andrea|A|;Hill|Alison L|AL|;Busch|Michael P|MP|;Armand|Philippe|P|;Soiffer|Robert J|RJ|;Altfeld|Marcus|M|;Kuritzkes|Daniel R|DR|",
"chemical_list": "D004279:DNA, Viral; D012367:RNA, Viral",
"country": "United States",
"delete": false,
"doi": "10.7326/M14-1027",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0003-4819",
"issue": "161(5)",
"journal": "Annals of internal medicine",
"keywords": null,
"medline_ta": "Ann Intern Med",
"mesh_terms": "D023241:Antiretroviral Therapy, Highly Active; D004279:DNA, Viral; D015658:HIV Infections; D015497:HIV-1; D018380:Hematopoietic Stem Cell Transplantation; D006689:Hodgkin Disease; D006801:Humans; D007413:Intestinal Mucosa; D008297:Male; D009190:Myelodysplastic Syndromes; D012367:RNA, Viral; D012007:Rectum; D012074:Remission Induction; D014766:Viremia",
"nlm_unique_id": "0372351",
"other_id": null,
"pages": "319-27",
"pmc": null,
"pmid": "25047577",
"pubdate": "2014-09-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "22479384;10954555;23671416;10362285;22974526;14532178;17135583;24319163;9144289;22226108;23516360;20962613;2512828;18600229;23460751;15526059;16078913;20001856;19265012;19213682;18698002;17690564;21148083;23852128;16061962;17076840;10770542;11773372;17413704;20921575;12545079;8136753;22890763;20939732;20711481;18490657;19470482;1823118;10371167",
"title": "Antiretroviral-free HIV-1 remission and viral rebound after allogeneic stem cell transplantation: report of 2 cases.",
"title_normalized": "antiretroviral free hiv 1 remission and viral rebound after allogeneic stem cell transplantation report of 2 cases"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/14/0043575",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SIROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "There is a paucity of literature on renal diseases associated with HIV infection in Asian countries. Renal disease in HIV-infected children can involve the glomerulus, interstitium, tubules or blood vessels of the kidney. In this case series, five HIV-infected children with various forms of renal disease are reported. The renal pathology included HIV-associated nephropathy, collapsing focal segmental glomerulosclerosis without tubular changes, tubule-interstitial nephritis and minimal change disease (MCD). Case five fulfilled the classification criteria for childhood polyarteritis nodosa (PAN). It is important to screen all HIV-infected children for renal disease to enable detection at an early stage.",
"affiliations": "a Allergy Immunology Unit, Department of Pediatrics, Advanced Pediatrics Centre , PGIMER , Chandigarh , India.;a Allergy Immunology Unit, Department of Pediatrics, Advanced Pediatrics Centre , PGIMER , Chandigarh , India.;a Allergy Immunology Unit, Department of Pediatrics, Advanced Pediatrics Centre , PGIMER , Chandigarh , India.;b Department of Immunopathology , PGIMER , Chandigarh , India.;b Department of Immunopathology , PGIMER , Chandigarh , India.;c Department of Histopathology , PGIMER , Chandigarh , India.;c Department of Histopathology , PGIMER , Chandigarh , India.;a Allergy Immunology Unit, Department of Pediatrics, Advanced Pediatrics Centre , PGIMER , Chandigarh , India.",
"authors": "Tiewsoh|Karalanglin|K|;Kumar Jindal|Ankur|A|;Sharma|Dhrubajyoti|D|;Arora|Sunil|S|;Minz|Ranjana W|RW|;Agrawal|Parimal|P|;Nada|Ritambhra|R|;Suri|Deepti|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/20469047.2018.1463126",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2046-9047",
"issue": "38(4)",
"journal": "Paediatrics and international child health",
"keywords": "ATN, acute tubular necrosis; Collapsing focal segmental glomerulosclerosis; EULAR/PRINTO/PRES, European League Against Rheumatism/Paediatric Rheumatology International Trials Organisation/Paediatric Rheumatology European Society; HIV-associated nephropathy; HIVAN, HIV-associated nephropathy; HVICK, HIV immune complex kidney disease; NACO, National AIDS Control Organization; NGAL, neutrophil gelatinase associated lipocalin; NHL, non-Hodgkin lymphoma; PAH, pulmonary artery hypertension; PAN, polyarteritis nodosa; TIN, tubule-interstitial nephritis; cART, combination anti-retroviral therapy; eGFR, estimated glomerular filtration rate; interstitial nephritis; minimal change disease; non-Hodgkin lymphoma; proteinuria",
"medline_ta": "Paediatr Int Child Health",
"mesh_terms": "D001208:Asia; D002648:Child; D002675:Child, Preschool; D005260:Female; D015658:HIV Infections; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D007674:Kidney Diseases; D008297:Male; D012189:Retrospective Studies",
"nlm_unique_id": "101582666",
"other_id": null,
"pages": "271-276",
"pmc": null,
"pmid": "29726752",
"pubdate": "2018-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Spectrum of renal disease in HIV-infected children: report of five cases.",
"title_normalized": "spectrum of renal disease in hiv infected children report of five cases"
} | [
{
"companynumb": "IN-GLAXOSMITHKLINE-IN2018GSK230006",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ZIDOVUDINE"
},
"drugadditional": "3"... |
{
"abstract": "No effective treatment has been developed for bone-metastatic breast cancer. We found 3 cases with clinical complete response (cCR) of the bone metastasis and longer overall survival of the retrospectively examined cohort treated comprehensively including autologous formalin-fixed tumor vaccine (AFTV).\nAFTV was prepared individually for each patient from their own formalin-fixed and paraffin-embedded breast cancer tissues.\nThree patients maintained cCR status of the bone metastasis for 17 months or more. Rate of cCR for 1 year or more appeared to be 15% (3/20) after comprehensive treatments including AFTV. The median overall survival time (60.0 months) and the 3- to 8-year survival rates after diagnosis of bone metastasis were greater than those of historical control cohorts in Japan (1988-2002) and in the nationwide population-based cohort study of Denmark (1999-2007).\nBone-metastatic breast cancer may be curable after comprehensive treatments including AFTV, although larger scale clinical trial is required.",
"affiliations": "Department of Surgery, Innoshima-Ishikai Hospital, Innoshima, Onomichi, Hiroshima 722-2211, Japan.;Department of Surgery, Innoshima-Ishikai Hospital, Innoshima, Onomichi, Hiroshima 722-2211, Japan.;Department of Surgery, Innoshima-Ishikai Hospital, Innoshima, Onomichi, Hiroshima 722-2211, Japan.;Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, Japan.;Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, Japan.;Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, Japan.;Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, Japan.;Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, Japan.",
"authors": "Kuranishi|Fumito|F|0000-0001-5472-9903;Imaoka|Yuki|Y|;Sumi|Yuusuke|Y|;Uemae|Yoji|Y|;Yasuda-Kurihara|Hiroko|H|;Ishihara|Takeshi|T|;Miyazaki|Tsubasa|T|;Ohno|Tadao|T|",
"chemical_list": null,
"country": "Egypt",
"delete": false,
"doi": "10.1155/2018/4879406",
"fulltext": "\n==== Front\nInt J Breast CancerInt J Breast CancerIJBCInternational Journal of Breast Cancer2090-31702090-3189Hindawi 10.1155/2018/4879406Clinical StudyRate of Clinical Complete Response for 1 Year or More in Bone-Metastatic Breast Cancer after Comprehensive Treatments including Autologous Formalin-Fixed Tumor Vaccine http://orcid.org/0000-0001-5472-9903Kuranishi Fumito ishikai@beach.ocn.ne.jp\n1\nImaoka Yuki \n1\nSumi Yuusuke \n1\nUemae Yoji \n2\nYasuda-Kurihara Hiroko \n2\nIshihara Takeshi \n2\nMiyazaki Tsubasa \n2\nOhno Tadao \n2\n\n1Department of Surgery, Innoshima-Ishikai Hospital, Innoshima, Onomichi, Hiroshima 722-2211, Japan\n2Cell-Medicine, Inc., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0074, JapanAcademic Editor: Mattia Capulli\n\n2018 22 1 2018 2018 487940628 9 2017 12 12 2017 20 12 2017 Copyright © 2018 Fumito Kuranishi et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Introduction\n No effective treatment has been developed for bone-metastatic breast cancer. We found 3 cases with clinical complete response (cCR) of the bone metastasis and longer overall survival of the retrospectively examined cohort treated comprehensively including autologous formalin-fixed tumor vaccine (AFTV).\n\n Patients and Methods\n AFTV was prepared individually for each patient from their own formalin-fixed and paraffin-embedded breast cancer tissues.\n\n Results\n Three patients maintained cCR status of the bone metastasis for 17 months or more. Rate of cCR for 1 year or more appeared to be 15% (3/20) after comprehensive treatments including AFTV. The median overall survival time (60.0 months) and the 3- to 8-year survival rates after diagnosis of bone metastasis were greater than those of historical control cohorts in Japan (1988–2002) and in the nationwide population-based cohort study of Denmark (1999–2007).\n\n Conclusion\n Bone-metastatic breast cancer may be curable after comprehensive treatments including AFTV, although larger scale clinical trial is required.\n==== Body\n1. Introduction\nBone metastases of breast cancer are frequently found in the rib, sternum, vertebrae, or pelvis and are refractory to radiation therapy combined with standardized HER2-binding monoclonal antibody and/or endocrine treatments and, if necessary, cytotoxic chemotherapy comprising a widespread regimen such as cyclophosphamide, epirubicin, and 5-fluorouracil (CEF) [1]. Severe pain from bone metastasis limits the mobility of breast cancer patients and compromises their quality of life. A nationwide population-based cohort study in Denmark (1999–2007) revealed that the 5-year survival rate was only 8.3% for patients with bone metastasis, 2.5% for those with bone metastasis and skeletal-related events (SREs), and 23% for those with bone metastasis but no SREs, whereas the survival was 75.8% for breast cancer patients without bone metastasis [2]. Therefore, bone metastasis strongly influences survival of the breast cancer patients.\n\nHowever, no effective method has been developed for treatment of bone metastasis. For example, agents such as zoledronate and aromatase inhibitors are effective in limiting further progression of the cancer and can significantly improve overall survival [3] and disease-free survival [4], yet they are not expected to completely cure breast cancer with bone metastasis. To date it is widely believed that bone-metastatic breast cancer is incurable, as Mundy has described: “once tumor cells become housed in the skeleton, cure is no longer possible and only palliative therapy is available” [5].\n\nAutologous formalin-fixed tumor vaccine (AFTV) is the ultimately personalized drug, custom-made after resection of the tumor against the patient's own residual tumor. It has been used to treat patients with chemorefractory tumors since 2002 [6]. The efficacy of AFTV has been reported in a randomized clinical study on hepatocellular carcinoma (HCC) [7], a pilot study and two subsequent phase I/IIa studies on glioblastoma multiforme [8–10], and case reports on advanced glioblastoma [11], malignant fibrous histiocytoma [12], recurrent HCC [13], recurrent peritoneal serous carcinoma [14], uterine cervical small cell carcinoma [15], upper tract urothelial carcinoma [16], and gall bladder cancer and colon cancer [17]. AFTV has been shown to induce cytotoxic T lymphocytes specific to glypican-3, the protein frequently expressed in HCC [18].\n\nIn parallel with these small-scale clinical settings, we searched retrospectively patients treated with AFTV in the course of comprehensive treatments for bone-metastatic breast cancer since 2004 in two nearby regional hospitals in Onomichi city, Hiroshima, Japan, in both of which one of the authors (FK) has been working. We encountered an advanced case of breast cancer with bone metastasis in a patient who had shown strong uptake of 99mTc at the location of vertebra Th7 in August 2006. After combined treatments with AFTV, palliative radiation therapy, and adjuvant chemotherapy, the patient's vertebra revealed no uptake of 99mTc in December 2010 [20]; therefore we diagnosed eradication of the bone-metastatic breast cancer. However, our case report attracted the criticism that bone scintigraphy sometimes leads to a false conclusion.\n\nHere we report 20 cases of bone-metastatic breast cancer patients followed in August 2017, including their survival indices which were apparently greater than those of the Denmark study [2] and follow-up confirmation by single-photon emission computed tomography combined with X-ray computed tomography (SPECT-CT) or by positron-emission tomography combined with CT (PET-CT) of the clinical complete response (cCR) of three breast cancer cases showing long-term cCR of metastatic bone cancer after comprehensive treatments including AFTV. To our knowledge, the rate of cCR maintained for 1 year or more has not been documented in breast cancer patients with bone metastasis.\n\n2. Patients and Methods\nBreast cancers are normally treated according to established guidelines [1]. After resection of the primary cancerous tissue and according to the expression level of HER2, estrogen receptor (ER), and progesterone receptor (PgR) in the carcinoma cells, we treated patients with anti-HER2 antibody, endocrine treatments or aromatase inhibitors, combined with cytotoxic agents, and if applicable X-ray irradiation. The dose of radiation was selected case-by-case, with 50–60 Gy administered to the main target lesion and/or 30–36 Gy to any bone-metastatic lesions to suppress bone-derived pain and to avoid induction of further skeletal-related adverse events. Regular screening of bone metastasis of breast cancer depends on 99mTc bone scintigraphy. The precise locations of advanced bone metastases were determined by single-photon emission computed tomography combined with X-ray computed tomography (SPECT-CT) or by positron-emission tomography combined with CT (PET-CT). If patients required any extra-standard treatments, frequently required in bone-metastatic breast cancer cases or in the cases with high probability of bone metastasis that was estimated by the skilled medical doctor (FK), we introduced AFTV treatment.\n\nThe AFTV was prepared individually for each patient from their own formalin-fixed and paraffin-embedded breast cancer tissues as has been described for cases of glioblastoma multiforme [8]. The prepared AFTV was injected intradermally during the course of comprehensive treatment, whenever possible before the start of fractionated bone-irradiation. Each course of AFTV treatment consists of three intradermal injections every 2 weeks. To prepare AFTV for one course, we need 2.0 g of paraffin-removed breast cancer tissue specimen. If the amount of resected primary tumor was sufficient to prepare AFTV for multiple courses, two or more courses of treatment with AFTV were administered. Adverse effects of treatment with AFTV were graded according to the National Cancer Institute Common Toxicity Criteria version 2 [21] or, later, according to the Common Terminology Criteria for Adverse Events (CTCAE) v3.0.\n\nThe present treatment with AFTV has been approved by the ethics authorities of JA Onomichi General Hospital and Innoshima-Ishikai Hospital, both of which are located in Onomichi city, Hiroshima, Japan. Informed consent was provided by all of the patients for the treatment with AFTV and publication of the clinical data. The present retrospective study was registered to the UMIN clinical trials registry, Japan, as UMIN000029726.\n\n3. Results\nAmong 119 breast cancer patients so far given comprehensive treatment including AFTV between 2004 and 2013, 20 bone-metastatic cases were screened, 16 of which bore bone metastasis before AFTV treatment and four revealed bone metastasis after AFTV treatment (Cases #10, #15, #17, and #18) (Table 1). The eradication of a 3 cm diameter bone metastasis in vertebra Th7 of Case #6 was previously reported based on the simple observation of whole body 99mTc bone scintigraphy [20]. We confirmed maintenance of her cCR status by SPECT-CT after more than 6 years as described in the Case Presentations. Two new cases (Cases #17 and #20) are shown in Table 1 who maintained long cCR status. They remain well with no evidence of recurrence or new metastasis, the former for 18 months and the latter for 17 months. These 3 cases, all showing solitary bone metastasis, are described more fully in the following section.\n\nIn Case #18, complete local control of the metastatic vertebra L5 was successful for 22 months. However we observed parallel multiple metastases in lymph nodes. Case #19 achieved cCR after AFTV therapy and radiation therapy (36 Gy) and maintained their cCR status for 11 months (bone metastases in both of the vertebrae L3 and L5 disappeared on PET-CT), but then new lymph node metastasis was found, though after irradiation to the new lesion the patient remains well in February 2017 without any signs of lumbago and recurrence. We also found six cases with long-term stable disease (SD) in the metastatic bone(s) but without any new lesions. Local SD status was maintained for variable times, from the shortest one at 5 months (Case #1) to the longest one at more than 80 months (Case #16). Notably, Cases #4, #11, #13, and #16 bore multiple bone metastases before treatment with AFTV but have since maintained SD for longer than a year. The other nine cases were classified as progressive disease (PD), because AFTV showed no effect on growth of their bone metastases.\n\nIf “1-year cCR,” defined as whole body cCR maintained for 12 months or more, is acceptable, the rate of 1-year cCR reached 15% (3/20) among breast cancer patients with bone metastasis given comprehensive treatment including AFTV. In addition, adding to 1-year cCR cases, those with SD of 1-year duration in the metastatic bones, the control rate of bone metastasis reached 45% (9/20).\n\nAs shown in Figure 1, the overall survival (OS) after first diagnosis of bone metastasis was calculated and plotted on a Kaplan-Meier curve for all patients listed in Table 1. Median OS and 5-year survival rate were 60.0 months and 50.0% (95% CI: 48.8–71.3 months), respectively. We compared the Kaplan-Meier curve with those of historical controls (gray lines in Figure 1) reported by Koizumi et al. [19] whose patients have been treated comprehensively but have never been treated with AFTV since AFTV was not available for breast cancer patients before 2003 in Japan. Our curve (line 1) looks more favorable than line 2 (Koizumi et al.'s patients with solitary sternal metastasis, n = 98), line 3 (solitary metastatic bone lesion other than sternum, n = 191), and of course line 4 (multiple metastatic bone lesions, n = 414), all taken from Figure 2 of [19]. Since there was no difference in survival between line 2 and line 3, we combined the number of patients at risk each year for these two Koizumi et al.'s cohorts available in the Table 5 of [19] and then compared with the patients at risk in the present cohort. Differences of population ratio of survival at each year were statistically significant between the present and Koizumi et al.'s combined cohort, at least from 3 to 8 years of survival (Table 2).\n\nAlso, the data compare favorably with those described from a nationwide population-based cohort study in Denmark [2]. In patients after diagnosis of bone metastasis but no SREs during the follow-up in Denmark, median OS and 5-year survival rate were 17 months and 23%, respectively (read-out data from Figure 2 of [2], n = 772 for bone-metastatic breast cancer patients without SREs). Both of these concrete data are located outside of the lower 95% CI line of the Kaplan-Meier curve of our present cohort. There is a difference between, for example, the two sets of 5-year survival data (the present 50% versus the 23% reported in the Figure 2 of the Denmark study, p = 0.0052 by Chi square test).\n\nNone of the patients in Table 1 experienced any severe complication closely related to AFTV treatment. The adverse events observed consisted of local erythema, induration, and swelling at the injection sites. These effects corresponded to Grade 1 toxicity in all cases. The low grade adverse events directly associated with the AFTV treatment were quite similar to those reported in cases of glioblastoma multiforme treated with AFTV [9, 10].\n\n4. Case Presentations\n4.1. Case #6\nCase #6, a 52-year-old woman, was first treated with one course of AFTV and concomitant palliative radiation therapy (36 Gy) in August–December 2006, followed by adjuvant chemotherapy comprising six courses of CEF, zoledronate, and aromatase inhibitors (anastrozole and exemestane) [20]. To our surprise, however, the original breast carcinoma was classified as “triple negative” by the primary surgeon. Apparently the aromatase inhibitors were misprescribed, something that also happened in Case # 10 in Table 1.\n\nTo confirm whether or not there was any recurrence, Case #6 was precisely examined, not by regular 99mTc bone scintigraphy, by SPECT-CT in December 2012 and again in January 2017. No sign of recurrence or new metastasis in the patient's bone (Figure 2) or blood tumor markers was reported, showing that her cCR status was maintained for 50 months. We therefore assigned this case as tomographically confirmed cCR Case 1.\n\n4.2. Case #17\nA 50-year-old woman was found to have a 2.5 cm mass of tubular carcinoma in her left breast by magnetic resonance imaging (MRI). The carcinoma was resected in March 2009. No accompanying lymph node metastasis was observed. We found the tumor was HER2(−), ER(+), and PgR(−). Four months after resection, the patient agreed with one course of AFTV as the first-line adjuvant therapy. The response in delayed-type hypersensitivity test to her own carcinoma became strongly positive (40 × 35 mm erythema with 5 × 5 mm induration). We then treated her with the aromatase inhibitor, anastrozole. Six years later, in March 2015, PET-CT revealed bone metastasis to the sternum (Figure 3, left) which was confirmed by aspiration biopsy cytology as class V metastatic ductal carcinoma. We treated her again with a second course of AFTV and palliative radiation therapy (36 Gy/12 fractions/19 days) together with treatment with another aromatase inhibitor, letrozole (2.5 mg/day) in combination with zoledronate (4 mg/month), and an additional 2 shots of nivolumab (a vial, 40 mg, per 48 kg body weight) in October and November 2015. She was diagnosed as cCR by PET-CT in February 2016. We confirmed her cCR status in August 2016 and again in August 2017 (Figure 3). Alteration of her blood CEA level (Figure 4) suggests that the combined treatments probably eradicated the metastatic breast carcinoma. Up to date she has maintained her cCR status for 18 months; thus we assigned this case as cCR Case 2.\n\n4.3. Case #20\nA 46-year-old woman with stage II breast cancer (scirrhous ductal carcinoma) was operated on in July 2000. She had been treated with toremifene citrate, 40 mg/day. Left axillar recurrence was found 13 years later by ultrasonography and biopsy. PET-CT revealed a huge bone metastasis in the sternum (Figure 5, left). She was treated with radiation (60 Gy) and concurrently with three AFTV injections (one course) between October and December 2013, one additional AFTV injection (1/3 course) in September 2015, and then zoledronate (4 mg/month) and tamoxifen (20 mg/day) or letrozole (2.5 mg/day). Follow-up PET-CT (September 2014) showed no sign of residual carcinoma (Figure 5, middle); therefore we consider that the patient entered into cCR status which was reconfirmed in August 2015. To avoid possible recurrence, she received nivolumab administration (a vial, 40 mg, per 51 kg body weight) three times at 3-week intervals during October-November 2015. However, a small hot spot was observed in the sternum in a PET-CT image taken in February 2016 (Figure 5, right) and local recurrence in the sternum was confirmed by MRI in March 2016, suggesting that cCR status had been maintained for 17 months by the time of local recurrence in the sternum. Therefore we assigned this case as cCR Case 3, since she maintained the cCR status for more than a year. Additional pin-point irradiation (60 Gy) to the sternum soon suppressed the recurrence and she remains well at present (confirmed by February 2017).\n\n5. Discussion\nBefore encountering Case #6, assigned as cCR Case 1 (Figure 2), we previously observed approximately 300 cases of mammary carcinoma with bone metastasis over a period of 10 years up to the end of 2006. All these patients showed a downhill course resulting in fatality despite administration of intensive chemoendocrine-radiation therapy. Eradication of bone-metastatic breast carcinoma had never been successfully achieved in any of our patients, although we have observed in a separate retrospective study that AFTV treatment, added after 2004 on the standardized treatments for breast cancer patients without bone metastasis, increased significantly the number of white blood cells and lymphocytes, CD3+ T cells, percentage of Th1 in CD4+ T cells, and ratio of Th1 and regulatory T cells (Supplementary Table (available here)). As is well-known, X-ray irradiation of bone metastasis is a palliative treatment, a conclusion drawn from the results of 16 randomized trials, 20 prospective studies, 5 retrospective studies, and 22 other articles, involving a total of 8,051 patients [22]. Therefore, it is extremely rare to observe eradication of skeletal metastasis of breast cancer which is refractory to standardized treatment. Particularly in the trunk area, conventional full dose irradiation (60 Gy), which may cause late radiation injury to major organs, has been avoided, and lower doses such as 36 Gy used for pain reduction are unable to eradicate the skeletal metastasis. Moreover, no adjuvant therapeutic regimen has been found which can effectively treat bone metastasis of breast cancer.\n\nHowever, following the introduction of AFTV in the comprehensive treatment of advanced breast cancer, we have become aware that at least some of the breast cancer patients with bone metastasis may escape the fateful downhill course as shown in Table 1. Although transient shrinkage of the bone-metastatic lesion could be observed by 99mTc bone scintigraphy, we classified partial-response (PR, assumed) into stable disease (SD) in the column of Table 1, “best response of bone-meta after AFTV treatment,” because of unreliable quantification of the size of the bone metastasis by 99mTc bone scintigraphy. For example, in Case #1, the metastasis in vertebra Th4 was almost diminished when analyzed by bone scintigraphy after treatment with three courses of AFTV, docetaxel, and aromatase inhibitors (possibly entered into PR status). The patient maintained this status for 5 months and then developed two new metastases in right ribs 3 and 4. Case #2 with multiple bone metastases of triple-negative papillotubular carcinoma was unable to undergo treatment with any cytotoxic agents because of renal failure. We resected the rib with metastatic lesion. She developed recurrence in the remaining ribs and new metastases in the cervical spine, but short-term transient CR of the recurrent bone metastases was revealed by bone scintigraphy after two courses of AFTV treatment and irradiation (36 Gy). After these complicated experiences, we encountered Case #6 which we reported previously based on the results of 99mTc bone scintigraphy [20]. This time we were able to confirm continuation of her cCR status on her follow-up SPECT-CT up to 50 months (Figure 2).\n\nAll three of the cCR cases had carried solitary bone metastases, two cases (Case #6 and #20) before treatment with AFTV and one case (Case #17) after treatment with AFTV (Table 1). Although it has been reported that “a solitary bone metastasis can often be successfully treated, and long-lasting complete remission is not unusual” in a review of oligometastatic breast cancer [23], no numerical percentage values appeared in the original report [19] cited in the review. In the literature up to 2013, we recently found one case report describing complete response in breast cancer metastatic to liver and bone [24]. Together with our previous experience up to the end of 2006 on approximately 300 bone-metastatic breast cancer cases, this rare case report implies that the percentage of patients who experience complete response of bone-metastatic breast cancer is likely to be less than 1% in our bone-metastatic historical cohort.\n\nSimilar to Case #6, we observed that in Case #18, complete local control of the initial bone metastasis was achieved and lasted for 13 months but was accompanied in parallel with metastases to lymph nodes and other bones. Case #19 maintained complete remission of the bone metastasis for 11 months, but a new lymph node metastasis appeared after this period (Table 1). We did not count, of course, Case #18 or Case #19, as cCR cases, since medical doctors in the regional hospitals did not positively evaluate complete local control of the initial bone metastases but rather pointed out the new metastases appearing in other organs within a year, saying that a cCR term of less than a year is too short to convince their patients that the treatment is effective. Therefore, we defined cCR as “1-year cCR” as described in Results. In the treatment with AFTV, we did not adopt the common positive criterion, pathological complete response, since it is usually impossible to obtain a biopsy sample from metastatic bone.\n\nThe Kaplan-Meier curve from the data of OS after the first diagnosis of bone metastasis (Figure 1) was apparently different from that described in the nationwide population-based cohort study in Denmark (1999–2007) in which 35,912 newly diagnosed breast cancer patients were identified from January 1, 1999, to December 31, 2007, in the Danish National Patient Registry. Of these, 1,494 developed bone metastases and of these a further 722 developed both bone metastases and SREs and 772 bore bone metastases without SREs [2]. Therefore, we consider the Kaplan-Meier curve of OS and 5-year survival rate from diagnosis of bone metastasis without SREs (Figure 2 in [2]) is concrete data derived from the huge cohort.\n\nAnother set of concrete data was reported from 703 patients with bone metastasis in which the median survival time from the onset of skeletal metastasis was 3.3–3.6 years for patients with solitary sternal metastasis or solitary metastatic bone lesions other than sternum and 2 years for patients bearing multiple metastatic bone lesions. These data are presented in Figure 2 of the paper by Koizumi et al. [19], as cited in Figure 1. The present cohort shown in Table 1 and in Figure 1 revealed longer median OS and higher 5-year survival rate when compared to these two concrete datasets in [2, 19], although results from the present cohort do not necessarily prove the efficacy of AFTV since the present cohort is small and therefore probably includes unnoticed patient selection bias. For example, all the patients in Table 1 have undergone resection of breast cancer at an appropriate time, but in Cases #1 and #6 they were surgically operated on after the first diagnosis of bone metastasis, even though resection of metastatic breast cancer is not recommended for advanced stage IV patients. These records therefore imply that ad hoc selection has occurred at the time of obtaining informed consent from the breast cancer patients with bone metastasis. A larger scale clinical study with appropriate control patients will be desirable to confirm the efficacy of AFTV treatment on bone metastases of breast cancer. Nevertheless, our data suggest that AFTV therapy should have contributed at least partly through the three cCR cases to the long median OS, 60 months from the diagnosis of bone metastasis, of the present cohort. Statistically significant differences of population ratio of survival at each year between the present cohort and Koizumi et al.'s combined cohort in Japan (Table 2) are fairly meaningful for the estimation that treatment of bone-metastatic breast cancer with additional immunotherapy using AFTV is considered to be well justified.\n\nWith regard to examining the reduction curve of blood CEA level (Figure 4), the effect of the 2 additional shots of nivolumab, the potent immune check-point inhibitor, was unclear. Also the effect of additional treatment with nivolumab for Case #20 apparently did not suppress the recurrence in the sternum (Figure 5). From these two poor experiences, it is too early to estimate the efficacy of the immune check-point inhibitor on bone metastasis of breast cancer. Much more experience must be accumulated of the use of the immune check-point inhibitor to evaluate its effect on breast cancer, as in melanoma and lung carcinoma [25].\n\n6. Conclusion\nThe rate of 1-year cCR of 15% suggests that bone-metastatic breast cancer may be partly curable after comprehensive treatments including AFTV. The probable contribution of AFTV to OS should be taken into consideration when planning comprehensive therapeutic courses for the treatment of advanced breast cancer patients with bone metastasis, although a larger scale clinical study is required.\n\nAcknowledgments\nThe authors would like to thank all participant patients and clinical staffs in Onomichi General Hospital and Innoshima-Ishikai Hospital.\n\nAbbreviations\nAFTV:Autologous formalin-fixed tumor vaccine\n\ncCR:Clinical complete response\n\nCEF:Cyclophosphamide, epirubicin, and 5-fluorouracil\n\nCT:X-ray computed tomography\n\nHCC:Hepatocellular carcinoma\n\nMRI:Magnetic resonance imaging\n\nPET-CT:Positron-emission tomography combined with CT\n\nSPECT-CT:Single-photon emission computed tomography combined with CT\n\nSREs:Skeletal-related events.\n\nConflicts of Interest\nNo conflicts of interest are declared by the authors.\n\nAuthors' Contributions\nFumito Kuranishi treated mainly the patients with AFTV. Yuki Imaoka and Yuusuke Sumi gave the patients additional treatments. Yoji Uemae, Hiroko Yasuda-Kurihara, Takeshi Ishihara, Tsubasa Miyazaki, and Tadao Ohno manufactured AFTV on request.\n\nSupplementary Materials\nSupplementary Materials Supplementary Table: peripheral blood cell counts in breast cancer patients before and after the first course of AFTV vaccination.\n\nClick here for additional data file.\n\n Figure 1 Overall survival (OS) of the present cohort treated comprehensively including AFTV and the historical control cohorts in Japan. Line 1, the present cohort (n = 20) with median OS, 60.0 months. Lines 2, 3, and 4, Japanese historical controls taken from Koizumi et al., Figure 2 in [19]. Line 2, patients with solitary sternal metastasis (n = 98), median OS, 39.5 months. Line 3, patients with solitary metastatic bone lesion other than sternum (n = 191), median OS, 41.4 months. Line 4, patients with multiple metastatic bone lesions (n = 414), median OS, 22.6 months.\n\nFigure 2 Follow-up SPECT-CT of vertebra Th7 of Case #6 (assigned as cCR Case 1) [20]. No recurrence in vertebra Th7 was observed.\n\nFigure 3 PET-CT of the sternum of Case #17 (assigned as cCR Case 2). The cCR status has been maintained for 18 months to date.\n\nFigure 4 Alteration of blood CEA level of Case #17 after comprehensive treatments including AFTV. 2nd cr AFTV, 2nd course of AFTV treatment; RT, radiation therapy. Dotted line indicates basal level of blood CEA in normal subjects.\n\nFigure 5 PET-CT of the sternum of Case #20 (assigned as cCR Case 3). A huge bone metastasis of breast carcinoma was observed. The length of cCR status was calculated between the reconfirmation of disease-free status on September 3, 2014, and the diagnosis of local recurrence on February 9, 2016.\n\nTable 1 Characteristics of the present cohort (cut-off, August 31, 2017).\n\nCase #\tAge, at diagnosis\tPrimary resection\tFirst diagnosis of bone metastasis\tReceptor status\tAny metastasis before AFTV treatment\tTreatments after primary resection and before diagnosis of PD\tBest response of bone metastasis after AFTV treatment\tOutcome by Feb & Aug 2017\tOS after the first diagnosis of bone metastasis (months)\t\n1\t59\t2004/4/21\t2004/2/9\tHER2(−), ER(++), PgR(++)\tMultiple bones (more than 30), liver\tChemo, AFTV 4 cr, chemo, RT (30 Gy), aromatase inhib\tSD for 5 months\tDead\n2008/02/21\t49\t\n\n\n\t\n2\t74\t2001/2/2\t2003/1/15\tHER2(−), ER(−), PgR(−)\tRib, neck, sacrum\tRib resec, RT (30 Gy), chemo, AFTV 2 cr\tPD\tDead\n2009/01/15\t73\t\n\n\n\t\n3\t50\t1999/5/10\t2005/7/11\tNot tested\tBrain, pelvis, sacrum\tBrain operation, RT to brain (35 Gy), AFTV 1 cr, aromatase inhib, RT to sacrum (30 Gy)\tSD for 12 months\tDead\n2008/05/07\t34\t\n\n\n\t\n4\t56\t1999/6/18\t2003/3/6\tHER2(+), ER(+), PgR(−)\tLymph node (19/20), sternum, lung (multiple), liver, brain (multiple), pelvis\tRT (50 Gy), resec, aromatase inhib, chemo, resect, RT (35 Gy to pelvis, 35 Gy to brain), AFTV 1 cr + chemo\tSD for 13 months\tDead\n2007/07/28\t54\t\n\n\n\t\n5\t52\t2003/7/8\t2004/11/10\tHER2(−), ER(−), PgR(−)\tLymph node, bone (multiple), lung\tRT (30 + 30 Gy), chemo, AFTV 4 cr + RT (Th6 30 Gy, Th11 30 Gy)\tPD\tDead\n2009/8/30\t58\t\n\n\n\t\n6\t52\t2006/8/7\t2006/7/31\tHER2(−), ER(−), PgR(−)\tVertebra Th7\tAFTV 1 cr, RT (36 Gy), chemo, aromatase inhib (misprescription), zoledronate\tCR for 50 months or more\tOngoing\t128+\t\n\n\n\t\n7\t42\t2004/3/5\t2006/6/24\tHER2(−), ER(+), PgR(+)\tLiver, lung, chest wall, lymph nodes, pelvis\tRT (30 Gy), chemo, resec, chemo + aromatase inhib, RT (35 Gy), zoledronate, AFTV 3 cr, chemo\tPD\tDead\n2007/11/18\t17\t\n\n\n\t\n8\t45\t2001/3/9\t2007/3/1\tHER2(−), ER(−), PgR(++)\tBone (multiple)\tResec, aromatase inhib, zoledronate, AFTV 3 cr, RT (30 Gy)\tPD\tDead\n2012/11/16\t70\t\n\n\n\t\n9\t71\t2004/3/23\t2006/12/15\tHER2(−), ER(+), PgR(−)\tBone (multiple), skin, lymph node, chest wall\tChemo, aromatase inhib, AFTV 1 cr, chemo\tPD\tDead\n2008/7/28\t20\t\n\n\n\t\n10\t62\t2007/6/16\t2010/1/28\tHER2(−), ER(−), PgR(−)\tLymph node (2/7) [bone (multiple) after AFTV]\tChemo, AFTV 1 cr, chemo, aromatase inhib (misprescription), zoledronate\tPD\tDead\n2010/9/20\t8\t\n\n\n\t\n11\t46\t2004/3/10\t2007/5/14\tHER2(−), ER(++), PgR(++)\tLymph node, lung, rib (2 sites), pedicle of thoracic vertebra\tAFTV 4 cr, zoledronate, aromatase inhib, chemo\tSD for 55 months\tOngoing, bearing bone-meta\t118+\t\n\n\n\t\n12\t75\t1992/10/7\t2007/5/25\tHER2(−), ER(−), PgR(−)\tRib\tChemo, resec, AFTV 1 cr\tPD\tDead\n2008/5/23\t12\t\n\n\n\t\n13\t64\t1998/5/12\t2006/6/14\tHER2(+++), ER(+++), PgR(+++)\tChest wall, bone (multiple)\tResec, chemo, aromatase inhib, RT (28 Gy, 30 Gy, 30 Gy), zoledronate\tSD for 25 months\tOngoing\t130+\t\n\n\n\t\n14\t61\t1999/6/28\t2004/12/16\tHER2(+++), ER(+), PgR(−)\tLung, vertebra Th10\tResec, AFTV 1 cr, TAE, chemo, zoledronate\tPD\tDead\n2015/4/4\t125\t\n\n\n\t\n15\t39\t2007/11/9\t2008/12/9\tHER2(−), ER(−), PgR(+++)\tLymph node (23/24), pelvis\tChemo, AFTV 1 cr, zoledronate, RT (30 Gy)\tPD\tDead\n2013/11/12\t60\t\n\n\n\t\n16\t52\t2000/6/30\t2007/9/27\tHER2(+), ER(−), PgR(++)\tLymph node (1/26), bone (multiple)\tRT (60 Gy), AFTV 1 cr, zoledronate\tSD for more than 80 months\tOngoing\t114+\t\n\n\n\t\n17\t50\t2009/3/18\t2015/6/18\tHER2(−), ER(+), PgR(−)\tSternum\tAFTV 2 cr, aromatase inhib, RT (36 Gy), zoledronate, anti-PD-1 Ab\tCR for 18 months or more\tOngoing\t26+\t\n\n\n\t\n18\t56\t2011/3/11\t2013/8/9\tHER2(++), ER(+++), PgR(+++)\tVertebra L5, lymph node (1/5)\tAFTV 2 cr, RT (30 Gy to vertebra + 50 Gy to axilla), chemo, zoledronate, tumorectomy of chest wall meta, aromatase inhib, RT (40 Gy) to lymph node\tBone local control for 22 months, but clinically PD\tDead\n2016/10/17\t39\t\n\n\n\t\n19\t64\t2004/12/2\t2013/9/4\tHER2(+++), ER(−), PgR(−)\tLymph node (4/5), vertebrae L3, L5\tChemo, G-CSF, RT (60 Gy to neck lymph node), trastuzumab, AFTV 1 cr, RT (36 Gy) to vertebra L3, vertebra L5, zoledronate, resect (chest wall), RT (60 Gy) to chest wall, RT (60 Gy) to lymph node\tCR for 11 months, then PD\tOngoing\t42+\t\n\n\n\t\n20\t46\t2000/7/14\t2013/10/20\tHER2(−), ER(+), PgR(++)\tSternum, lymph node\tToremifene, RT (60 Gy), AFTV 2 cr, zoledronate, anti-PD-1 Ab\tCR for 17 months, then PD\tOngoing\t40+\t\nAFTV, autologous formalin-fixed tumor vaccine; chemo, chemotherapy; CR, complete response; cr, course; inhib, inhibitor; meta, metastasis; OS, overall survival; PD, progressive disease; resec, resection; RT, radiation therapy; SD, stable disease.\n\nTable 2 Comparison between the present cohort and the historical control, Koizumi et al.'s combined cohort, in Japan.\n\nSurvival (years)\t0\t1\t2\t3\t4\t5\t6\t7\t8\t9\t10\t\nPresent cohort\t \t \t \t \t \t \t \t \t \t \t \t\n Number at risk\t20\t18\t16\t14\t11\t8\t6\t5\t5\t5\t3\t\n Koizumi et al.'s combined cohort\t \t \t \t \t \t \t \t \t \t \t \t\n Number at risk (solitary, sternum + other, from Table 5 of [19])\t289\t222\t157\t106\t75\t53\t38\t19\t8\t4\t2\t\nDifference of population ratio at each year\t \t \t \t \t \t \t \t \t \t \t \t\n Chi square test, p =\t \t \t \t0.003\t0.005\t0.019\t0.037\t0.003\t<0.0001\t \t \n==== Refs\n1 NCCN NCCN Clinical Practice Guidelines in Oncology, Breast Cancer, Version 3.2015 2015 NCCN.org \n2 Yong M. Jensen A. Ø. Jacobsen J. B. Nørgaard M. Fryzek J. P. Sørensen H. T. Survival in breast cancer patients with bone metastases and skeletal-related events: a population-based cohort study in Denmark (1999–2007) Breast Cancer Research and Treatment 2011 129 2 495 503 10.1007/s10549-011-1475-5 2-s2.0-80052611748 21461730 \n3 Lipton A. Cook R. J. Major P. Smith M. R. Coleman R. E. Zoledronic acid and survival in breast cancer patients with bone metastases and elevated markers of osteoclast activity The Oncologist 2007 12 9 1035 1043 2-s2.0-35548960086 10.1634/theoncologist.12-9-1035 17914073 \n4 Howell A. Cuzick J. Baum M. Results of the ATAC (anastrozole, tamoxifen, alone or in combination) trial after completion of 5 years’ adjuvant treatment for breast cancer The Lancet 2005 365 9453 60 62 10.1016/S0140-6736(04)17666-6 \n5 Mundy G. R. Mechanisms of bone metastasis Cancer 1997 80 8 1546 1556 2-s2.0-0030879065 10.1002/(SICI)1097-0142(19971015)80:8+<1546::AID-CNCR4>3.0.CO;2-I 9362421 \n6 Peng B. G. Liu S. Q. Kuang M. Autologous fixed tumor vaccine: a formulation with cytokine-microparticles for protective immunity against recurrence of human hepatocellular carcinoma Japanese Journal of Cancer Research 2002 93 4 363 368 10.1111/j.1349-7006.2002.tb01265.x 2-s2.0-18344392456 11985784 \n7 Kuang M. Peng B. G. Lu M. D. Phase II randomized trial of autologous formalin-fixed tumor vaccine for postsurgical recurrence of hepatocellular carcinoma Clinical Cancer Research 2004 10 5 1574 1579 10.1158/1078-0432.CCR-03-0071 2-s2.0-12144286051 15014006 \n8 Ishikawa E. Tsuboi K. Yamamoto T. Clinical trial of autologous formalin-fixed tumor vaccine for glioblastoma multiforme patients Cancer Science 2007 98 8 1226 1233 2-s2.0-34347238993 10.1111/j.1349-7006.2007.00518.x 17517052 \n9 Muragaki Y. Maruyama T. Iseki H. Phase I/IIa trial of autologous formalin-fixed tumor vaccine concomitant with fractionated radiotherapy for newly diagnosed glioblastoma Journal of Neurosurgery 2011 115 2 248 255 10.3171/2011.4.jns10377 2-s2.0-79961118475 21568657 \n10 Ishikawa E. Muragaki Y. Yamamoto T. Phase I/IIa trial of fractionated radiotherapy, temozolomide, and autologous formalin-fixed tumor vaccine for newly diagnosed glioblastoma Journal of Neurosurgery 2014 121 3 543 553 10.3171/2014.5.JNS132392 2-s2.0-84907327423 24995786 \n11 Sakamoto N. Ishikawa E. Yamamoto T. Pathological changes after autologous formalin-fixed tumor vaccine therapy combined with temozolomide for glioblastoma Neurologia medico-chirurgica 2011 51 4 319 325 2-s2.0-79955487265 10.2176/nmc.51.319 21515959 \n12 Todoroki T. Kondo T. Sugahara S. Morishita Y. Mori K. Ohno T. Long-term survivor of relapsed MFH on the thigh treated with autologous formalin-fixed tumor vaccine (AFTV) combined with limb-sparing surgery and radiotherapy World Journal of Surgical Oncology 2011 9, article no. 96 2-s2.0-80052033660 10.1186/1477-7819-9-96 \n13 Inui T. Ohno T. Autologous formalin-fixed tumor vaccine suppressedre-recurrence of HCV-related hepatocellularcarcinoma following 29 unsuccessful treatments withextensive conventional therapy: a case report World Journal of Surgical Oncology 2012 p. 144 10.1186/1477-7819-10-144 2-s2.0-84863643249 \n14 Chen J. Ohno T. Recurrent peritoneal serous carcinoma that was unmanageable with paclitaxel-carboplatin therapy responded to autologous formalin-fixed tumor vaccine Clinical Case Reports 2015 3 10 823 826 10.1002/ccr3.353 26509016 \n15 Miyoshi T. Kataoka T. Asahi A. A transient increase and subsequent sharp decrease of chemo-refractory liver-metastasized uterine cervical small cell carcinoma to autologous formalin-fixed tumor vaccine plus anti-PD-1 antibody Clinical Case Reports 2016 4 7 687 691 10.1002/ccr3.596 27386130 \n16 Miyoshi T. Kashiwabara T. Asahi A. Complete remission of chemo-refractory multiple-metastatic upper tract urothelial carcinoma by autologous formalin-fixed tumor vaccine Clinical Case Reports 2017 5 11 1780 1784 10.1002/ccr3.1179 29152270 \n17 Imaoka Y. Kuranishi F. Miyazaki T. Yasuda H. Ohno T. Long-lasting complete response status of advanced stage IV gall bladder cancer and colon cancer after combined treatment including autologous formalin-fixed tumor vaccine: two case reports World Journal of Surgical Oncology 2017 15 1 10.1186/s12957-017-1245-x \n18 Kawashima I. Kawashima Y. Matsuoka Y. Suppression of postsurgical recurrence of hepatocellular carcinoma treated with autologous formalin-fixed tumor vaccine, with special reference to glypican-3 Clinical Case Reports 2015 3 6 444 447 10.1002/ccr3.279 26185646 \n19 Koizumi M. Yoshimoto M. Kasumi F. Ogata E. Comparison between solitary and multiple skeletal metastatic lesions of breast cancer patients Annals of Oncology 2003 14 8 1234 1240 2-s2.0-0041508749 10.1093/annonc/mdg348 12881385 \n20 Kuranishi F. Ohno T. Eradication of breast cancer with bone metastasis by autologous formalin-fixed tumor vaccine (AFTV) combined with palliative radiation therapy and adjuvant chemotherapy: a case report World Journal of Surgical Oncology 2013 11, article no. 127 10.1186/1477-7819-11-127 2-s2.0-84878414141 \n21 Trotti A. Byhardt R. Stetz J. Common toxicity criteria: version 2.0. an improved reference for grading the acute effects of cancer treatment: impact on radiotherapy International Journal of Radiation Oncology, Biology, and Physics 2000 47 1 13 47 10.1016/S0360-3016(99)00559-3 2-s2.0-0034176245 \n22 Falkmer U. Järhult J. Wersäll P. Cavallin-Ståhl E. A systematic overview of radiation therapy effects in skeletal metastases Acta Oncologica 2003 42 5-6 620 633 2-s2.0-0141636523 10.1080/02841860310014895 14596519 \n23 Di Lascio S. Pagani O. Oligometastatic breast cancer: a shift from palliative to potentially curative treatment? Breast Care 2014 9 1 7 14 10.1159/000358750 2-s2.0-84897035523 24803881 \n24 Kobrinsky B. Andreopoulou E. Mourtzikos K. Muggia F. Documentation of complete response in metastatic breast cancer to liver and bone achieved with trastuzumab and pegylated liposomal doxorubicin Clinical Medicine: Oncology 2008 2 469 470 2-s2.0-84911903380 21892319 \n25 Sharabi A. B. Lim M. DeWeese T. L. Drake C. G. Radiation and checkpoint blockade immunotherapy: radiosensitisation and potential mechanisms of synergy The Lancet Oncology 2015 16 13 e498 e509 10.1016/S1470-2045(15)00007-8 2-s2.0-84953874197 26433823\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-3189",
"issue": "2018()",
"journal": "International journal of breast cancer",
"keywords": null,
"medline_ta": "Int J Breast Cancer",
"mesh_terms": null,
"nlm_unique_id": "101568103",
"other_id": null,
"pages": "4879406",
"pmc": null,
"pmid": "29576883",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "22789008;21515959;21461730;27386130;23734861;28893260;26185646;15639680;26509016;24803881;11985784;21892319;29152270;15014006;24995786;9362421;17914073;21568657;17517052;10758303;12881385;21864347;14596519;26433823",
"title": "Rate of Clinical Complete Response for 1 Year or More in Bone-Metastatic Breast Cancer after Comprehensive Treatments including Autologous Formalin-Fixed Tumor Vaccine.",
"title_normalized": "rate of clinical complete response for 1 year or more in bone metastatic breast cancer after comprehensive treatments including autologous formalin fixed tumor vaccine"
} | [
{
"companynumb": "JP-CIPLA LTD.-2018JP09629",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TRASTUZUMAB"
},
"drugadditional": "3",
... |
{
"abstract": "To investigate the potential effect of intracoronary administration of the glycoprotein IIb/IIIa inhibitor tirofiban on the microvascular obstruction (MVO) assessed by cardiac magnetic resonance (CMR) imaging compared to the intravenous route in patients with ST-segment-elevation myocardial infarction undergoing primary percutaneous coronary intervention (PCI). Two hundred eight patients were randomized into two groups (tirofiban i.v. and tirofiban i.c.). CMR was completed within 3-7 days after ST-segment-elevation myocardial infarction. One hundred thirty-two patients had a follow-up CMR at 6 months after discharge. The primary end point was the CMR measurements including myocardium strain, myocardial perfusion index, final infarct size, prevalence and extent of MVO, and the change of left ventricular end-diastolic volume (LVEDV) at six months follow-up. The second endpoint was major adverse cardiovascular events (composite of all-cause death, nonfatal reinfarction and congestive heart failure) in one year. The MVO prevalence and extent [56% versus 36%, p = 0.004; 2.08 (IQR: 1.18-5.07) g versus 1.68 (IQR: 0.30-3.28) g, p = 0.041] showed a significant difference between the intravenous and intracoronary groups. Global left ventricular peak longitudinal strain was significantly different in intracoronary groups compared to intravenous groups, - 12.5 [IQR: - 13.4 to - 10.9] versus - 12.3 [IQR: - 13.4 to - 10.4], respectively (P = 0.042). Infarcted myocardial perfusion index was significantly different in intracoronary groups compared to intravenous groups, 0.11 [IQR: 0.08 to 0.15] versus 0.09 [IQR: 0.07 to 0.14], respectively (P = 0.026). Intracoronary tirofiban was associated with a higher change in LVEDV compared with intravenous group (- 10.2% [IQR: - 13.7% to - 2.6%] versus 1.3% [IQR: - 5.6% to 6.1%], p < 0.001). Intracoronary tirofiban application showed no benefit on the occurrence of major adverse cardiovascular events during follow-up compared to intravenous administration. This CMR study in ST-segment-elevation myocardial infarction patients showed a benefit in MVO and left ventricular remodeling for intracoronary tirofiban administration compared to intravenous administration in patients undergoing PCI.",
"affiliations": "Department of Radiology, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004, Liaoning, People's Republic of China.;Department of Radiology, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004, Liaoning, People's Republic of China.;Department of Radiology, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004, Liaoning, People's Republic of China.;Department of Radiology, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Cardiology, Shengjing Hospital of China Medical University, Shenyang, Liaoning, People's Republic of China.;Department of Radiology, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004, Liaoning, People's Republic of China. houyang_1973@sina.com.",
"authors": "Ma|Quanmei|Q|https://orcid.org/0000-0002-5660-8264;Ma|Yue|Y|https://orcid.org/0000-0002-4117-0319;Wang|Xiaonan|X|;Li|Shanshan|S|;Yu|Tongtong|T|https://orcid.org/0000-0001-7525-6164;Duan|Weili|W|;Wu|Jiake|J|;Wen|Zongyu|Z|;Jiao|Yundi|Y|;Sun|Zhaoqing|Z|https://orcid.org/0000-0002-1608-7396;Hou|Yang|Y|https://orcid.org/0000-0002-9184-5441",
"chemical_list": "D010975:Platelet Aggregation Inhibitors; D019039:Platelet Glycoprotein GPIIb-IIIa Complex; D000077466:Tirofiban",
"country": "United States",
"delete": false,
"doi": "10.1007/s10554-020-01800-0",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1569-5794",
"issue": "36(6)",
"journal": "The international journal of cardiovascular imaging",
"keywords": "Acute myocardial infarction; Glycoprotein IIb/IIIa inhibitor; Magnetic resonance imaging; Microvascular obstruction; Tirofiban",
"medline_ta": "Int J Cardiovasc Imaging",
"mesh_terms": "D061605:Administration, Intravenous; D000328:Adult; D002681:China; D003326:Coronary Circulation; D005260:Female; D006801:Humans; D019028:Magnetic Resonance Imaging, Cine; D008297:Male; D008833:Microcirculation; D008875:Middle Aged; D015428:Myocardial Reperfusion Injury; D062645:Percutaneous Coronary Intervention; D010975:Platelet Aggregation Inhibitors; D019039:Platelet Glycoprotein GPIIb-IIIa Complex; D011237:Predictive Value of Tests; D011446:Prospective Studies; D000072657:ST Elevation Myocardial Infarction; D013997:Time Factors; D000077466:Tirofiban; D016896:Treatment Outcome; D016277:Ventricular Function, Left; D020257:Ventricular Remodeling",
"nlm_unique_id": "100969716",
"other_id": null,
"pages": "1121-1132",
"pmc": null,
"pmid": "32078096",
"pubdate": "2020-06",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "Intracoronary compared with intravenous bolus tirofiban on the microvascular obstruction in patients with STEMI undergoing PCI: a cardiac MR study.",
"title_normalized": "intracoronary compared with intravenous bolus tirofiban on the microvascular obstruction in patients with stemi undergoing pci a cardiac mr study"
} | [
{
"companynumb": "CN-AGG-02-2020-2201",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TIROFIBAN HYDROCHLORIDE"
},
"drugadditional": null... |
{
"abstract": "The incidences of dystonic reactions to metoclopramide and prochlorperazine have not been well characterized in children.\n\n\n\nMedical record data were reviewed for patients at a tertiary care pediatric hospital who received metoclopramide or prochlorperazine for treatment of headache.\n\n\n\nA total of 4588 clinical encounters were identified, 2542 with prochlorperazine and 2046 with metoclopramide. One patient had a dystonic reaction with metoclopramide (0.049%). Eleven patients had a dystonic reaction with prochlorperazine (0.43%). The relative risk of a dystonic reaction with prochlorperazine over metoclopramide is 8.85 (95% confidence interval 1.15 to 68.5). There were differences between groups of patients who received metoclopramide versus prochlorperazine in terms of age, number of doses, and coadministration of diphenhydramine. In a logistic regression, administration of prochlorperazine over metoclopramide (P = 0.019) and greater number of doses (P < 0.001) remained associated with acute dystonic reactions.\n\n\n\nDystonic reactions are rare events among pediatric patients treated for acute headache, but are more common with prochlorperazine than metoclopramide.",
"affiliations": "Division of Child Neurology, UPMC Children's Hospital of Pittsburgh, Pittsburgh, Pennsylvania. Electronic address: laura.kirkpatrick2@chp.edu.;Division of Child Neurology, UPMC Children's Hospital of Pittsburgh, Pittsburgh, Pennsylvania.;Division of Child Neurology, UPMC Children's Hospital of Pittsburgh, Pittsburgh, Pennsylvania.",
"authors": "Kirkpatrick|Laura|L|;Sogawa|Yoshimi|Y|;Cleves|Catalina|C|",
"chemical_list": "D018492:Dopamine Antagonists; D008787:Metoclopramide; D011346:Prochlorperazine",
"country": "United States",
"delete": false,
"doi": "10.1016/j.pediatrneurol.2020.01.013",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0887-8994",
"issue": "106()",
"journal": "Pediatric neurology",
"keywords": "Dopamine receptor antagonists; Extrapyramidal side effects; Migraine cocktail",
"medline_ta": "Pediatr Neurol",
"mesh_terms": "D000293:Adolescent; D002648:Child; D018492:Dopamine Antagonists; D064420:Drug-Related Side Effects and Adverse Reactions; D004421:Dystonia; D005260:Female; D051270:Headache Disorders, Primary; D006776:Hospitals, Pediatric; D006801:Humans; D008297:Male; D008787:Metoclopramide; D011346:Prochlorperazine; D012189:Retrospective Studies; D062606:Tertiary Care Centers",
"nlm_unique_id": "8508183",
"other_id": null,
"pages": "63-64",
"pmc": null,
"pmid": "32098684",
"pubdate": "2020-05",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Acute Dystonic Reactions in Children Treated for Headache With Prochlorperazine or Metoclopramide.",
"title_normalized": "acute dystonic reactions in children treated for headache with prochlorperazine or metoclopramide"
} | [
{
"companynumb": "US-JNJFOC-20200501519",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METOCLOPRAMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nThere is a need to prevent or minimize bone loss associated with antiretroviral treatment (ART) initiation. We compared maraviroc (MVC)- to tenofovir disoproxil fumarate (TDF)-containing ART.\n\n\nMETHODS\nThis was a double-blind, placebo-controlled trial. ART-naive subjects with human immunodeficiency virus type 1 RNA load (viral load [VL]) >1000 copies/mL and R5 tropism were randomized to MVC 150 mg or TDF 300 mg once daily (1:1), stratified by VL <100 000 or ≥100 000 copies/mL and age <30 or ≥30 years. All subjects received darunavir 800 mg, ritonavir 100 mg, and emtricitabine 200 mg daily. Dual-energy X-ray absorptiometry scanning was done at baseline and week 48. The primary endpoint was percentage change in total hip bone mineral density (BMD) from baseline to week 48 in the as-treated population.\n\n\nRESULTS\nWe enrolled 262 subjects. A total of 259 subjects (130 MVC, 129 TDF) contributed to the analyses (91% male; median age, 33 years; 45% white, 30% black, 22% Hispanic). Baseline median VL was 4.5 log10 copies/mL and CD4 count was 390 cells/µL. The decline in hip BMD (n = 115 for MVC, n = 109 for TDF) at week 48 was less with MVC (median [Q1, Q3] of -1.51% [-2.93%, -0.11%] vs -2.40% [-4.30%, -1.32%] for TDF (P < .001). Lumbar spine BMD decline was also less with MVC (median -0.88% vs -2.35%; P < .001). Similar proportions of subjects in both arms achieved VL ≤50 copies/mL in as-treated and ITT analyses.\n\n\nCONCLUSIONS\nMVC was associated with less bone loss at the hip and lumbar spine compared with TDF. MVC may be an option to attenuate ART-associated bone loss.\n\n\nBACKGROUND\nNCT01400412.",
"affiliations": "Division of Infectious Diseases, Northwestern University, Chicago, Illinois.;Statistical and Data Analysis Center, Harvard School of Public Health, Boston, Massachusetts.;Division of Infectious Diseases, University of Cincinnati, Ohio.;Statistical and Data Analysis Center, Harvard School of Public Health, Boston, Massachusetts.;Division of Infectious Diseases, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts.;HIV Research Branch, Division of AIDS, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland.;Departments of Infectious Diseases.;Division of Infectious Diseases, Northwestern University, Chicago, Illinois.;Neurology, University of North Carolina at Chapel Hill.;Department of Immunology/Microbiology, Rush University Medical Center, Chicago, Illinois.;Division of Infectious Diseases, Department of Medicine, Emory University, Atlanta, Georgia.;Division of Endocrinology, Diabetes, and Metabolism, Johns Hopkins University, Baltimore, Maryland.",
"authors": "Taiwo|Babafemi O|BO|;Chan|Ellen S|ES|;Fichtenbaum|Carl J|CJ|;Ribaudo|Heather|H|;Tsibris|Athe|A|;Klingman|Karin L|KL|;Eron|Joseph J|JJ|;Berzins|Baiba|B|;Robertson|Kevin|K|;Landay|Alan|A|;Ofotokun|Igho|I|;Brown|Todd|T|;|||",
"chemical_list": "D019380:Anti-HIV Agents; D003510:Cyclohexanes; D014230:Triazoles; D000068698:Tenofovir; D000077592:Maraviroc",
"country": "United States",
"delete": false,
"doi": "10.1093/cid/civ455",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1058-4838",
"issue": "61(7)",
"journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America",
"keywords": "bone; darunavir; maraviroc; tenofovir",
"medline_ta": "Clin Infect Dis",
"mesh_terms": "D000328:Adult; D019380:Anti-HIV Agents; D015519:Bone Density; D003510:Cyclohexanes; D005260:Female; D015658:HIV Infections; D006801:Humans; D008297:Male; D000077592:Maraviroc; D008875:Middle Aged; D010384:Pelvic Bones; D000068698:Tenofovir; D014230:Triazoles",
"nlm_unique_id": "9203213",
"other_id": null,
"pages": "1179-88",
"pmc": null,
"pmid": "26060295",
"pubdate": "2015-10-01",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "22174038;20169035;12598771;15718270;19512937;20617176;19363330;19424051;20949133;23589670;25397560;18832244;23943825;11369623;18285417;17610528;11937496;15730850;20722752;20828304;24002093;19704163;23899468;12619938;23152485;22301411;15254587;24652492;21606537;21383098;22740718;15249568;16251317;16810109;24144899;14746813",
"title": "Less Bone Loss With Maraviroc- Versus Tenofovir-Containing Antiretroviral Therapy in the AIDS Clinical Trials Group A5303 Study.",
"title_normalized": "less bone loss with maraviroc versus tenofovir containing antiretroviral therapy in the aids clinical trials group a5303 study"
} | [
{
"companynumb": "US-CIPLA LTD.-2016US05441",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "EMTRICITABINE"
},
"drugadditional": null,
... |
{
"abstract": "A 31-year-old female, with 22 weeks of pregnancy, presented with sudden onset of severe headache. CT scan showed diffuse subarachnoid hemorrhage. A cerebral angiogram showed dissecting aneurysm of right cerebral artery. To obliterate the aneurysm and prevent rupture, the patient underwent coil embolization via an endovascular approach under general anesthesia because the procedure under sedation with local anesthesia was too risky for re-bleeding. The patient has been diagnosed as PAPA syndrome. Although the arthritis was now stable and she was taking no drug, remarkable osteoarthritis was observed. The cervical spine X ray demonstrated no cervical ankylosis. As patient was sedated with propofol, airway examination could not be done except noticing thyromental distance of seven centimeters. Patient's trachea was intubated using Macintosh size #3 laryngoscope blade and a 7.0 non-styletted tracheal tube at the first attempt without any problems (Cormack grade I). Anesthesia was maintained with sevoflurane, fentanyl and remifentanil. After the end of endovascular surgery, the patient was transferred to the intensive care unit under mechanical ventilation. She was weaned from mechanical ventilation 2 days later but consciousness was unclear. Right incomplete paralysis was also observed. MRI revealed vasospasm on the bilateral internal carotid artery. The patient underwent percutaneous tansluminalangioplasty coil and intraarterial injection of fasudil hydrochloride under local anesthesia. The consciousness recovered fully and the paralysis was improved. The patient delivered the baby by Caesarean sections under combined spinal and epidural anesthesia at 36 weeks without any problems with both the mother and baby.",
"affiliations": null,
"authors": "Ohno|Seika|S|;Ariyama|Jun|J|;Tsujita|Miki|M|;Ueshima|Hironobu|H|;Imanishi|Hirokazu|H|;Terao|Kazuhisa|K|;Mieda|Tsutomu|T|;Kitamura|Akira|A|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0021-4892",
"issue": "63(8)",
"journal": "Masui. The Japanese journal of anesthesiology",
"keywords": null,
"medline_ta": "Masui",
"mesh_terms": "D000152:Acne Vulgaris; D000328:Adult; D000767:Anesthesia, Epidural; D000768:Anesthesia, General; D000773:Anesthesia, Obstetrical; D000775:Anesthesia, Spinal; D000784:Aneurysm, Dissecting; D017542:Aneurysm, Ruptured; D017130:Angioplasty; D001170:Arthritis, Infectious; D002585:Cesarean Section; D004621:Embolization, Therapeutic; D057510:Endovascular Procedures; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D002532:Intracranial Aneurysm; D019990:Perioperative Care; D011247:Pregnancy; D011248:Pregnancy Complications; D011256:Pregnancy Outcome; D017511:Pyoderma Gangrenosum; D013577:Syndrome",
"nlm_unique_id": "0413707",
"other_id": null,
"pages": "921-3",
"pmc": null,
"pmid": "25199334",
"pubdate": "2014-08",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "General anesthesia for a pregnant patient with PAPA syndrome.",
"title_normalized": "general anesthesia for a pregnant patient with papa syndrome"
} | [
{
"companynumb": "JP-BAXTER-2014BAX065323",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SEVOFLURANE"
},
"drugadditional": null,
... |
{
"abstract": "Hashimoto encephalopathy remains a Rubik's cube for the present generation of clinical research. Myriad presentations have been noted, and observations recorded in few subgroups of patients have gone on only to be trashed by a second group of patients with a completely different clinical profile. Steroids have been traditionally held to be the treatment for this condition, but long-term side effects associated with it limits its use. Although multiple drugs have been tried, yet there exists no data for their long-term efficacy in maintaining remission. No radiological findings have been consistently associated with this condition. We report the use of azathioprine in maintaining long-term remission in one such patient with Hashimoto encephalopathy and the presence of lactate peak in magnetic resonance spectroscopy of the patient, which showed dramatic regression with institution of immunosuppression.",
"affiliations": "Department of Medicine, Pt. B.D.S. PGIMS, Rohtak, Haryana, India.",
"authors": "Singh|Harpreet|H|;Ray|Sucharita|S|;Agarwal|Shalini|S|;Verma|Raj Pal|RP|;Talapatra|Paulomi|P|;Gupta|Vikas|V|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/0972-2327.116936",
"fulltext": "\n==== Front\nAnn Indian Acad NeurolAnn Indian Acad NeurolAIANAnnals of Indian Academy of Neurology0972-23271998-3549Medknow Publications & Media Pvt Ltd India AIAN-16-44310.4103/0972-2327.116936Case ReportSpectroscopic correlation and role of Azathioprine in long-term remission in patients of Hashimoto encephalopathy Singh Harpreet Ray Sucharita Agarwal Shalini 1Verma Raj Pal Talapatra Paulomi Gupta Vikas Department of Medicine, Pt. B.D.S. PGIMS, Rohtak, Haryana, India1 Department of Radiology, Pt. B.D.S. PGIMS, Rohtak, Haryana, IndiaFor correspondence: Dr. Harpreet Singh, 881/23, DLF Colony, Rohtak, Haryana, India. E-mail: drhps1@rediffmail.comJul-Sep 2013 16 3 443 446 05 3 2012 10 6 2012 19 8 2012 Copyright: © Annals of Indian Academy of Neurology2013This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Hashimoto encephalopathy remains a Rubik's cube for the present generation of clinical research. Myriad presentations have been noted, and observations recorded in few subgroups of patients have gone on only to be trashed by a second group of patients with a completely different clinical profile. Steroids have been traditionally held to be the treatment for this condition, but long-term side effects associated with it limits its use. Although multiple drugs have been tried, yet there exists no data for their long-term efficacy in maintaining remission. No radiological findings have been consistently associated with this condition. We report the use of azathioprine in maintaining long-term remission in one such patient with Hashimoto encephalopathy and the presence of lactate peak in magnetic resonance spectroscopy of the patient, which showed dramatic regression with institution of immunosuppression.\n\nAnti-thyreoperoxidaseazathioprineencephalopathylactate peakmethylprednisoloneMRI-spectroscopy\n==== Body\nIntroduction\nAbout a hundred cases have been reported in adult and pediatric age group. Even fewer with treatment options. Presentation of a patient with myoclonic movements and delirious behavior sets off a train of investigations with several possibilities. However, when the movements persist despite use of anti-convulsants and no organic cause seems to be evident on routine laboratory investigations and imaging studies, one needs to look beyond the obvious findings. Hashimoto encephalopathy has been a controversial, rare neuro-endocrinologic disorder that is often misdiagnosed as a psychiatric problem in view of the patients presenting with confusion and hallucinations. The usual association with a thyroid disorder may not be evident at the outset, and patients are usually found to be clinically euthyroid. Less than 120 reports have been published so far, and varied clinical and laboratory findings have been seen to be associated with it. This raises the barriers to diagnose this challenging yet potentially curable condition. Magnetic resonance spectroscopy and titers of anti-thyroperoxidase antibodies were both seen to correlate with the clinical presentation of this patient with a characteristic lactate peak in the spectroscopy, which disappeared when the patient entered clinical remission. Anti-thyroperoxidase levels peaked during the symptomatic phase of the disease and decreased as the patient entered clinical remission. Azathioprine was seen to induce long-term remission in this patient when oral glucocorticoids were not tolerated.\n\nCase Report\nDev Raj, a 45-year-old healthy male presented with abnormal brief shock-like movements of the body for 20 days with confused behavior for 1 week. The abnormal movements developed insidiously over 2 days without any stimulating factors and did not remit with sleep or anti-epileptics (valproate 1.5 gm and clobazam 40 mg divided doses), which he had been prescribed for approximately 2 weeks before seeking an admission at our institute. They occurred without any periodicity with a frequency of about 8-10 per minute and incapacitated the patient. There was no loss of consciousness or bowel and bladder tone. He gave no history of addictions of any kind.\n\nPatient was obese with a BMI of 34 kg/m2 and was seen to have loss of lateral third of eyebrows with dry and eczematous skin. Blood pressure was 170/100 mmHg. He had severe cognitive impairment on admission, scoring about 4/30 in MMSE. Speech was fluent and articulate but lacked insight and consistency. Cerebellar signs, motor and sensory examination could not be performed consistently, but reflexes were slow with a delayed relaxation phase observed in the ankle jerk. Plantar response was extensor in both limbs. There were no signs of meningeal or cranial nerve involvement.\n\nThere were no similar episodes noted in the patient in the past or any history of trauma. He did not suffer from any chronic cardiovascular, pulmonary, or neurologic conditions.\n\nSerum electrolytes, blood sugar, liver and renal function tests, and hematology profile were seen to be within normal range. However, his thyroid hormone levels were abnormal with an initial TSH of 46.04 IU/ml. MRI of brain was normal, but on spectroscopy, there was an evidence of a lactate peak corresponding to 1.3 μm in the right occipital area, suggestive of a focus of anaerobic metabolism in the brain. [Figures 1, 2] There was a corresponding dip of N-acetyl aspartate in the corresponding area. There were no areas of hypoperfusion in the brain. EEG and brain mapping showed a background α activity with a 6-7 Hz slowing in the delta region with frontal predominance β-fast activity. [Figure 3] The Anti-TPO (Thyroid peroxidase) antibody levels were 3195.70 units (normal values below 60.00 units). A lumbar puncture revealed mildly raised protein levels in cerebrospinal fluid at 95 mg%, with a sugar level of 84 mg%, and a total leukocyte count of 5/cumm. CSF sent for serology against common viruses did not reveal any viral titers and involvement, and Gram stain and oligo-clonal bands were negative. He was sero-negative for HIV, HBSAg, and anti-HCV. An ultrasonogram for thyroid showed bilateral lobes of thyroid to be small and atrophic with altered echotexture. The biopsy for thyroid tissue did not reveal any functional thyroid follicles.\n\nFigure 1 MRI Brain of the patient with Hashimoto encephalopathy showing normal study during the initial presentation\n\nFigure 2 MR spectroscopy of the brain showing lactate peak at 1.3 micrometer during symptomatic stage of the disease with probe placed at right occipital region\n\nFigure 3 Electroencephalography of the patient during symptomatic stage of the disease showing background alpha activity with a 6-7 Hz slowing in the delta region with frontal predominance and #946;-fast activity\n\nWith the provisional diagnosis of Hashimoto Encephalopathy in mind, he was started on levothyroxine 150 μgm/day along with I.V. methylprednisolone. With this treatment, the seizures were controlled completely on the second day itself. Repeat assessments of thyroid hormone levels were done weekly. T3, T4, and TSH levels normalized, with second TSH at 7.52 IU/ml and anti-TPO antibodies were 1457 units after 2 weeks and 40 units at 2 months of treatment. A repeat EEG was normal, and a follow-up MRI showed no abnormality. He was started on oral prednisolone 60 mg/day but he developed one episode of hematemesis, after which oral steroids were stopped and he was started on azathioprine 100 mg in divided doses. He was also prescribed telmisartan for hypertension at a dose of 40 mg per day.\n\nHe was in remission for up to 4 months after the initial episode and discontinued his medications. His symptoms recurred, and this time they consisted of vague tingling sensations on the face with slurring of speech and loss of attention. Anti-thyroperoxidase levels were elevated at about 400 U/ml. An MR angiogram was repeated with spectroscopy, which revealed a lactate peak corresponding to 1.3 μm in the left temporal area. However, a probe placed on the right occipital are showed no activity, suggesting new onset activity. [Figure 4] He was not given steroids this time and merely started on azathioprine at 100 mg, and symptoms remitted as before. He was discharged on oral azathioprine with telmisartan, atorvastatin, and oral calcium supplements. Patient continues to stay in remission till today after about one and half years of therapy.\n\nFigure 4 MR spectroscopy of the brain showing a normalized lactate peak during clinical remission of the disease with probe in right occipital region\n\nDiscussion\nHashimoto encephalopathy is an autoimmune process that involves formation of antibodies, possibly resulting in an acute encephalomyelitis like picture. Various pathogenic hypotheses, that include autoimmune vasculitis,[123] autoimmune reaction to antigens shared by thyroid and the CNS,[4] cerebral hypoperfusion,[5] and toxic effects of thyrotropin-releasing hormone.[4] The majority of patients with this condition are euthyroid and do not have a goiter. Anti-thyroid peroxidase antibodies have been found in high titers, although their role in the manifestation of CNS symptoms seems to be limited, with the hypothesis of the formation of a putative antigen complex eliciting an immune response in CNS. A raised level of the antibody may itself be the first clue to diagnosis. There are yet no evidence of any shared antigens between the brain and the thyroid.[4] Also, the antibody titers have generally been found to have no correlation with disease severity.[1]\n\nIt has been seen to encompass a broad age group between 14 to 78 years. Two types of clinical presentation have been observed, depending on which Hashimoto Encephalopathy has been subdivided into two classes. However, mostly the disease follows a sub-acute, relapsing-remitting, steroid-responsive encephalopathy characterized by protean neurologic and neuropsychiatric symptoms, diffuse electroencephalographic abnormalities, and increased titers of anti-thyroid antibodies in serum and/or in cerebrospinal fluid. The first type is characterized by acute stroke-like episodes with transient focal neurologic deficits and even epileptic seizures. The second form has a more insidious onset, progressing to dementia, psychosis, and coma over several weeks. No focal neurologic deficits are seen in the latter type, although neuropsychologic testing reveals severe cognitive deficits. Tremors are the most commonly observed symptom, followed by transient aphasia, myoclonus, gait ataxia, seizures, and sleep abnormalities.[6]\n\nSince this condition shows a dramatic response to steroids, it has been renamed as steroid-responsive encephalopathy associated with Hashimoto thyroiditis (SREAT) instead of the conventional Hashimoto encephalopathy (HE).[15] However, several cases have been reported when the patients have not responded to steroids and alternative drugs have been tried in them. Several studies have suggested the role of intravenous immunoglobulins in the management of this condition.[7] However, patients have often respond to steroids and stay in remission as long as treatment is continued and relapse once they discontinue the drug. The most common reasons for discontinuation of steroids are intolerance and adverse effects related to steroids. Repeated administration with IVIg in this setting is not a practical and affordable option for this subset of patients, and it is desirable to look for alternative drugs patients can continue to take, which will act as steroid-sparing agents while being as effective in maintenance of remission. Several drugs including aspirin, azathioprine, mycophenolate mofetil have been tried in this setting and found to be variously successful. No long-term data exists on the effectiveness of these drugs in maintaining remission in these patients.[89]\n\nShaw et al. reported 5 cases with Hashimoto encephalopathy, in which response to various treatment options was observed. He treated one patient with a combination of steroids and azathioprine and ventriculo-peritoneal shunt and reported a substantial improvement with medications. The CT-head of that patient showed ventricular dilatation, and EEG showed diffuse slowing. However, the patient relapsed upon discontinuation of the drug.[1]\n\nSpiegel et al. similarly used azathioprine after induction of remission with intravenous methylprednisolone and reported a remission period that lasted 5 months.[10]\n\nAzathioprine is an imidazolyl derivative of 6-mercaptopurine. Following exposure to nucleophiles such as glutathione, azathioprine is cleaved to 6-mercaptopurine, which in turn is converted to additional metabolites that inhibit de novo purine synthesis in the body. 6-Thio-IMP, a fraudulent nucleotide, is converted to 6-thio-GMP and finally to 6-thio-GTP, which is incorporated into DNA. Cell proliferation is thereby inhibited, impairing a variety of lymphocyte functions. The mechanism of azathioprine in Hashimoto encephalopathy is supposed to be the same as that of steroids in suppressing inflammation and auto-reactive antibodies.\n\nOur patient showed a complete remission with the use of azathioprine and continues to remain in remission for the last one and half years. A flare-up of the disease activity upon drug discontinuation was also well controlled with reinstitution of azathioprine. In addition, the follow-up anti-thyroperoxidase levels have shown a consistent decrease with improvement in patient status, an observation that hitherto differs from the published reports where clinical status of the patient has no relation with the levels of anti-thyroperoxidase levels observed.\n\nThe spectroscopy findings in our patient showed a lactate peak during both the times the patient was symptomatic and were normal with institution of immunosuppressants and clinical improvement of the patient. Presence of lactate in the areas of the brain usually indicates the areas where anaerobic metabolism is taking place. Lactate has been seen in spectroscopy of patients suffering from post-necrotic encephalopathy and acute necrotizing encephalopathy and in others like HIV encephalopathy. It has also been reported in patients suffering from brain abscesses and vascular tumors. It is usually seen in spectroscopy as a peak corresponding to 1.3 μm, and its presence in one particular area signifies an focus of anaerobic metabolism.[11] It was seen in the right occipital area of the brain during the first presentation of the patient and subsequently in the left temporal area during the relapse and disappeared completely upon treatment when the patient was in remission. Hence, future determination of a lactate peak may prove to be useful in corroborating with clinical picture in patients suffering from this disease.\n\nAn increasing number of cases are being diagnosed with Hashimoto encephalopathy due to unknown and multiple genetic susceptibility. Long-term oral steroids have been established as a means to suppress the symptoms and to keep the patient in remission. However, with the passage of time, the side-effects of steroids accumulate and lead to their own set of complications. Azathioprine could be used in this setting as an effective steroid sparing agent, useful not only in induction of remission but also in avoiding the morbidities associated with long-term steroid use. The corroboration observed from the presence of a lactate peak and its disappearance with improvement in disease activity could further enhance our understanding of the disease process that still presents a challenge to the medical community.\n\nSource of Support: Nil\n\nConflict of Interest: Nil\n==== Refs\n1 Shaw PJ Walls TJ Newman PK Cleland PG Cartlidge NE Hashimoto's encephalopathy: A steroid-responsive disorder associated with high anti-thyroid antibody titres—report of 5 cases Neurology 1991 41 228 33 1992366 \n2 Watemberg N Willis D Pellock J Encephalopathy as the presenting symptom of Hashimoto's thyroiditis J Child Neurol 2000 15 66 9 10641616 \n3 Shibata N Yamamoto Y Sunami N Suga M Yamashita Y Isolated angiitis of the CNS associated with Hashimoto's disease Rinsho Shinkeigaku 1992 32 191 8 1611779 \n4 Nolte KW Unbehaun A Sieker H Kloss TM Paulus W Hashimoto encephalopathy: A brainstem vasculitis? Neurology 2000 54 769 70 10680826 \n5 Latinville D Bernardi O Cougoule JP Bioulac B Henry P Loiseau P Thyroidite d’Hashimoto et encéphalopatie myoclonique: Hypothèses pathogéniques Rev Neurol (Paris) 1985 141 55 8 3920744 \n6 Brain L Jellinek EH Ball K Hashimoto's disease and encephalopathy Lancet 1966 2 512 4 4161638 \n7 Jacob S Rajabally YA Hashimoto's encephalopathy: Steroid resistance and response to intravenous immunoglobulins J Neurol Neurosurg Psychiatry 2005 76 455 6 15716552 \n8 Ghika-Schmid F Ghika J Regli F Dworak N Bogousslavsky J Städler C Hashimoto's myoclonic encephalopathy: An underdiagnosed treatable condition? Mov Disord 1996 11 555 62 8866497 \n9 Korthbauer-Margreiter I Sturzenegger M Komor J Baumgarter R Hess CW Encephalopathy associated with Hashimoto thyroiditis: Diagnosis and treatment J Neurol 1996 243 585 93 8865025 \n10 Spiegel J Hellwig D Becker G Muller M Progressive dementia caused by Hashimoto's encephalopathy - report of two cases Eur J Neurol 2004 11 711 3 15469458 \n11 Luiz Ramin S Tagnola WA Spotti AR Proton magnetic resonance spectroscopy: Clinical applications in patients with brain lesions Sao Paulo Med J 2003 121 254 9 14989143\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0972-2327",
"issue": "16(3)",
"journal": "Annals of Indian Academy of Neurology",
"keywords": "Anti-thyreoperoxidase; MRI-spectroscopy; azathioprine; encephalopathy; lactate peak; methylprednisolone",
"medline_ta": "Ann Indian Acad Neurol",
"mesh_terms": null,
"nlm_unique_id": "101273955",
"other_id": null,
"pages": "443-6",
"pmc": null,
"pmid": "24101841",
"pubdate": "2013-07",
"publication_types": "D002363:Case Reports",
"references": "3920744;15469458;10641616;14989143;1611779;8866497;10680826;1992366;8865025;15716552;4161638",
"title": "Spectroscopic correlation and role of Azathioprine in long-term remission in patients of Hashimoto encephalopathy.",
"title_normalized": "spectroscopic correlation and role of azathioprine in long term remission in patients of hashimoto encephalopathy"
} | [
{
"companynumb": "PHHY2015IN018199",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
"dr... |
{
"abstract": "Hematopoietic cell transplantation (HCT) has now been shown to be safe and effective for selected HIV-infected patients with hematological malignancies. Autologous HCT is now the standard of care for patients with HIV-related lymphomas who otherwise meet standard transplant criteria. Limited data also support use of allogeneic HCT (alloHCT) in selected HIV-infected patients who meet standard transplant criteria. We recommend enrolling patients in clinical trials that offer access to CCR5Δ32 homozygous donors, if available. HIV-infected patients requiring HCT may also be considered for participation in trials evaluating the activity of gene-modified hematopoietic stem cells in conferring resistance to HIV infection. To be considered for HCT, patients must have HIV infection that is responsive to combination antiretroviral therapy (cART). Careful planning for the peri-HCT management of the cART can avoid risk of significant drug interactions and development of cART-resistant HIV. In general, we recommend against the use of boosted proteasome inhibitors and nonnucleotide reverse transcriptase inhibitors in the cART regimen, in favor of nucleoside reverse transcriptase inhibitors and integrase inhibitors (without cobicistat). After HCT, patients must be closely monitored for development of opportunistic infections (OI), such as cytomegalovirus. Prevention of OI should include prophylactic and pre-emptive antimicrobials.",
"affiliations": "Hematological Malignancies and Hematopoietic Stem Cell Transplantation Institute, City of Hope, Duarte, CA.;Hematological Malignancies and Hematopoietic Stem Cell Transplantation Institute, City of Hope, Duarte, CA.;Hematological Malignancies and Hematopoietic Stem Cell Transplantation Institute, City of Hope, Duarte, CA.",
"authors": "Alvarnas|Joseph C|JC|;Zaia|John A|JA|;Forman|Stephen J|SJ|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1182/blood-2017-04-551606",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0006-4971",
"issue": "130(18)",
"journal": "Blood",
"keywords": null,
"medline_ta": "Blood",
"mesh_terms": "D000328:Adult; D015316:Genetic Therapy; D015658:HIV Infections; D019337:Hematologic Neoplasms; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D008297:Male; D008875:Middle Aged; D014184:Transplantation, Homologous",
"nlm_unique_id": "7603509",
"other_id": null,
"pages": "1976-1984",
"pmc": null,
"pmid": "28882882",
"pubdate": "2017-11-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "How I treat patients with HIV-related hematological malignancies using hematopoietic cell transplantation.",
"title_normalized": "how i treat patients with hiv related hematological malignancies using hematopoietic cell transplantation"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK201711247",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
... |
{
"abstract": "As immune checkpoint inhibitors (ICIs) are increasingly used, clinicians are more frequently encountering the side effects of these therapies. ICIs have been implicated in numerous adverse effects against healthy tissues. We present a case of a patient who developed treatment refractory checkpoint inhibitor colitis. Following colonoscopy, it was discovered that this patient had cytomegalovirus (CMV) coinfection. This case report highlights the importance of undertaking an appropriate assessment, including endoscopic and histologic investigation, of patients with presumed ICI colitis. Accurately diagnosing a superimposed CMV colitis changes clinical management and can improve patient outcomes.",
"affiliations": "Department of Internal Medicine, Cleveland Clinic Foundation, Cleveland, Ohio, USA harrisk5@ccf.org.;Department of Hematology and Oncology, Cleveland Clinic Foundation, Cleveland, Ohio, USA.;Department of Gastroenterology and Hepatology, Cleveland Clinic Foundation, Cleveland, Ohio, USA.",
"authors": "Harris|Kevin B|KB|http://orcid.org/0000-0002-3515-7476;Funchain|Pauline|P|;Baggott|Brian B|BB|",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000082082:Immune Checkpoint Inhibitors",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2019-233519",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(5)",
"journal": "BMJ case reports",
"keywords": "gastroenterology; hepatitis and other GI infections; oncology",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000368:Aged; D000074322:Antineoplastic Agents, Immunological; D003092:Colitis; D003113:Colonoscopy; D015897:Comorbidity; D003587:Cytomegalovirus; D003586:Cytomegalovirus Infections; D006801:Humans; D000082082:Immune Checkpoint Inhibitors; D008297:Male; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32434876",
"pubdate": "2020-05-19",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "CMV coinfection in treatment refractory immune checkpoint inhibitor colitis.",
"title_normalized": "cmv coinfection in treatment refractory immune checkpoint inhibitor colitis"
} | [
{
"companynumb": "US-TEVA-2021-US-1887788",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BUDESONIDE"
},
"drugadditional": null,
... |
{
"abstract": "Purpose: Primary central nervous system posttransplant lymphoproliferative disorder (PCNS-PTLD) is a complication of solid organ transplantation with a poor prognosis and typically associated with Epstein-Barr virus (EBV). We hypothesized EBV lytic-phase protein expression would allow successful treatment with antiviral therapy.Patients and Methods: Thirteen patients were treated with zidovudine (AZT), ganciclovir (GCV), dexamethasone, and rituximab in EBV+ PCNS-PTLD. Twice-daily, intravenous AZT 1,500 mg, GCV 5 mg/kg, and dexamethasone 10 mg were given for 14 days. Weekly rituximab 375 mg/m2 was delivered for the first 4 weeks. Twice-daily valganciclovir 450 mg and AZT 300 mg started day 15. Lytic and latent protein expression was assessed using in situ hybridization and immunohistochemistry. Immunoblot assay assessed lytic gene activation. Cells transfected with lytic kinase vectors were assessed for sensitivity to our therapy using MTS tetrazolium and flow cytometry.Results: The median time to response was 2 months. Median therapy duration was 26.5 months. Median follow-up was 52 months. The estimated 2-year overall survival (OS) was 76.9% (95% CI, 44.2%-91.9%). Overall response rate (ORR) was 92% (95% CI, 64%-100%). BXLF1/vTK and BGLF4 expression was found in the seven tumor biopsies evaluated. Lytic gene expression was induced in vitro using the four-drug regimen. Transfection with viral kinase cDNA increased cellular sensitivity to antiviral therapy.Conclusions: EBV+ PCNS-PTLD expressed lytic kinases and therapy with AZT, GCV, rituximab and dexamethasone provided durable responses. Induction of the lytic protein expression and increased cellular sensitivity to antiviral therapy after transfection with viral kinase cDNA provides a mechanistic rationale for our approach. Clin Cancer Res; 24(14); 3273-81. ©2018 AACR.",
"affiliations": "Division of Hematology, University of Colorado, Aurora, Colorado.;Division of Hematology, University of Colorado, Aurora, Colorado.;Department of Internal Medicine, Mt Sinai School of Medicine, New York, New York.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Division of Infectious Disease, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Department of Pathology, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Department of Neurosurgery, The Ohio State University, Columbus, Ohio.;University of Massachusetts Medical School, Worcester MA.;University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin.;Johns Hopkins School of Medicine, Baltimore, Maryland.;Department of Neurosurgery, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio.;Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, Ohio. robert.baiocchi@osumc.edu.",
"authors": "Dugan|James P|JP|;Haverkos|Bradley M|BM|0000-0002-3872-0615;Villagomez|Lynda|L|;Martin|Ludmila K|LK|;Lustberg|Mark|M|;Patton|John|J|;Martin|Marisa|M|;Huang|Ying|Y|;Nuovo|Gerard|G|;Yan|Fengting|F|;Cavaliere|Robert|R|;Fingeroth|Joyce|J|;Kenney|Shannon C|SC|;Ambinder|Richard F|RF|;Lozanski|Gerard|G|;Porcu|Pierluigi|P|;Caligiuri|Michael A|MA|;Baiocchi|Robert A|RA|",
"chemical_list": "D015215:Zidovudine; D000069283:Rituximab; D003907:Dexamethasone; D015774:Ganciclovir",
"country": "United States",
"delete": false,
"doi": "10.1158/1078-0432.CCR-17-2685",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-0432",
"issue": "24(14)",
"journal": "Clinical cancer research : an official journal of the American Association for Cancer Research",
"keywords": null,
"medline_ta": "Clin Cancer Res",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001706:Biopsy; D002493:Central Nervous System Diseases; D003907:Dexamethasone; D020031:Epstein-Barr Virus Infections; D005260:Female; D015774:Ganciclovir; D006801:Humans; D007150:Immunohistochemistry; D053208:Kaplan-Meier Estimate; D008232:Lymphoproliferative Disorders; D008297:Male; D008875:Middle Aged; D016377:Organ Transplantation; D011379:Prognosis; D000069283:Rituximab; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome; D015215:Zidovudine",
"nlm_unique_id": "9502500",
"other_id": null,
"pages": "3273-3281",
"pmc": null,
"pmid": "29632007",
"pubdate": "2018-07-15",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": "11408227;22895585;7849294;22357272;15827204;16640817;7911241;2999595;17242396;12615710;22042694;20052713;10563431;2904703;14747554;20872273;17119113;24162244;7839447;10357467;14508356;22969425;16149091;10944566;23444168;16474161;23685504;23721553;2725874;22432089;12239141;23837493;17707260;2970594;20181711;2536518;16254143;10563434;25130212;20466055;17049062;24319169;7007303;6125777;18024631",
"title": "Complete and Durable Responses in Primary Central Nervous System Posttransplant Lymphoproliferative Disorder with Zidovudine, Ganciclovir, Rituximab, and Dexamethasone.",
"title_normalized": "complete and durable responses in primary central nervous system posttransplant lymphoproliferative disorder with zidovudine ganciclovir rituximab and dexamethasone"
} | [
{
"companynumb": "US-VIIV HEALTHCARE LIMITED-US2018143518",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ZIDOVUDINE"
},
"drugadditional"... |
{
"abstract": "The study is to investigate the extent of alcohol/drug(s) use among selected drivers, i.e. fatally injured drivers from traffic accidents (2006-2015), drink driving (2006-2015) and drug driving (2010-2015) cases, in Hong Kong. Between 2006 and 2015, specimens from a total of 223 fatally injured drivers were received for toxicological examination. Except for one driver, all other drivers with positive findings were male. Alcohol and/or drugs were detected in 60 (27%) cases where alcohol alone was detected in 40 cases (18%) while drugs with/without alcohol were detected in 20 cases (9%). A decreasing trend is observed for cases with blood/breath alcohol concentrations above the prescribed limits in both fatally injured drivers and drivers from drink driving cases in 2006-2015. Out of the 20 cases with positive findings in drugs, 8 of them were found with alcohol in which only one case found at level above the prescribed limit. The frequency of drugs encountered that are known to affect driving in blood is 31, representing an average of about 1.7 drugs per individual. Ketamine was the most frequently detected drug in fatally injured drivers. Sedatives/hypnotics (i.e. diazepam/nordiazepam, midazolam, 7-aminonimetazepam, 7-aminonitrazepam and zopiclone), morphine/monoacetylmorphine, cocaine/benzoylecgonine, methamphetamine, methadone and codeine were also detected. There has been a sharp increase in the submission of blood/urine specimens for toxicological analysis related to drug driving cases since 2010 with a total of 48 cases received in 2010-2011. With the introduction of legislative amendment of drug driving law since 2012, 154 cases were received in 2012-2015. The positive rates for drug driving cases examined were found to be 90% (43 out of 48 cases) in 2010-2011 and 89% (137 out of 154 cases) in 2012-2015. Drivers with single drug use were more frequently detected (40 cases in 2010-2011 and 82 cases in 2012-2015) than multiple drug use (3 cases in 2010-2011 and 55 cases in 2012-2015) but an increase in the use of more than one drug in driving population is noted. Ketamine was detected in the majority of cases (34 cases in 2010-2011 and 104 cases in 2012-2015). However, drug driving cases in recent years revealed that increase usages of methamphetamine, cocaine and zopiclone were observed. The mean, median and range of ketamine concentrations for 134 blood samples taken from drivers in drug driving cases were 0.34, 0.27, 0.01-1.8μg/mL respectively.",
"affiliations": "Forensic Science Division, Government Laboratory, 88 Chung Hau Street, Homantin Government Offices, Homantin, Kowloon, Hong Kong Special Administrative Region, People's Republic of China. Electronic address: wccheng@govtlab.gov.hk.;Forensic Science Division, Government Laboratory, 88 Chung Hau Street, Homantin Government Offices, Homantin, Kowloon, Hong Kong Special Administrative Region, People's Republic of China.",
"authors": "Cheng|Wing-Chi|WC|;Dao|Kwok-Leung|KL|",
"chemical_list": "D002492:Central Nervous System Depressants; D013287:Illicit Drugs; D011619:Psychotropic Drugs; D000431:Ethanol",
"country": "Ireland",
"delete": false,
"doi": "10.1016/j.forsciint.2017.03.022",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0379-0738",
"issue": "275()",
"journal": "Forensic science international",
"keywords": "Alcohol; Drink driving; Drug driving; Drugs",
"medline_ta": "Forensic Sci Int",
"mesh_terms": "D000063:Accidents, Traffic; D000328:Adult; D002492:Central Nervous System Depressants; D002853:Chromatography, Liquid; D000066448:Driving Under the Influence; D000431:Ethanol; D005260:Female; D008401:Gas Chromatography-Mass Spectrometry; D006723:Hong Kong; D006801:Humans; D013287:Illicit Drugs; D008297:Male; D011619:Psychotropic Drugs; D012189:Retrospective Studies; D017678:Sex Distribution; D015813:Substance Abuse Detection; D019966:Substance-Related Disorders; D014822:Vitreous Body; D055815:Young Adult",
"nlm_unique_id": "7902034",
"other_id": null,
"pages": "242-253",
"pmc": null,
"pmid": "28412576",
"pubdate": "2017-06",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "The occurrence of alcohol/drugs by toxicological examination of selected drivers in Hong Kong.",
"title_normalized": "the occurrence of alcohol drugs by toxicological examination of selected drivers in hong kong"
} | [
{
"companynumb": "HK-PFIZER INC-2018009213",
"fulfillexpeditecriteria": "1",
"occurcountry": "HK",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "1-HYDROXYMIDAZOLAM"
},
"drugadditional": null,... |
{
"abstract": "Brain atrophy is related to clinical deterioration in multiple sclerosis (MS) but its association with intrathecal markers of inflammation or neurodegeneration is unclear. Our aim was to investigate whether cerebrospinal fluid (CSF) markers of inflammation or neurodegeneration are associated with brain volume change in natalizumab-treated MS and whether this change is reflected in non-lesional white matter metabolites.\n\n\n\nAbout 25 patients with natalizumab-treated MS were followed for 3 years with assessment of percentage brain volume change (PBVC) and absolute quantification of metabolites with proton magnetic resonance spectroscopy (1 H MRS). Analyses of inflammatory [interleukin 1β (IL-1β), IL-6, C-X-C motif chemokine 8 (CXCL8), CXCL10, CXCL11, C-C motif chemokine 22] and neurodegenerative [neurofilament light protein (NFL), glial fibrillary acidic protein, myelin basic protein, tau proteins] markers were done at baseline and 1-year follow-up.\n\n\n\nThe mean decline in PBVC was 3% at the 3-year follow-up, although mean 1 H MRS metabolite levels in non-lesional white matter were unchanged. CSF levels of NFL and tau at baseline correlated negatively with PBVC over 3 years (r = -0.564, P = 0.012, and r = -0.592, P = 0.010, respectively).\n\n\n\nA significant 3-year whole-brain atrophy was not reflected in mean metabolite change of non-lesional white matter. In addition, our results suggest that CSF levels of NFL and tau correlate with brain atrophy development and may be used for evaluating treatment response in inflammatory active MS.",
"affiliations": "Department of Neurology and Department of Clinical and Experimental Medicine, Linköping University, Linköping, Sweden.;Department of Radiation Physics and Department of Medical and Health Sciences, Linköping University, Linköping, Sweden.;Center for Medical Image Science and Visualization (CMIV), Linköping University, Linköping, Sweden.;Department of Radiation Physics and Department of Medical and Health Sciences, Linköping University, Linköping, Sweden.;Clinical Neurochemistry Laboratory, Institution of Neuroscience and Physiology, Department of Psychiatry and Neurochemistry, Sahlgrenska Academy, University of Gothenburg, Mölndal, Sweden.;Clinical Neurochemistry Laboratory, Institution of Neuroscience and Physiology, Department of Psychiatry and Neurochemistry, Sahlgrenska Academy, University of Gothenburg, Mölndal, Sweden.;Department of Clinical Immunology and Transfusion Medicine and Department of Clinical and Experimental Medicine, Linköping University, Linköping, Sweden.;Department of Neurology and Department of Clinical and Experimental Medicine, Linköping University, Linköping, Sweden.;Department of Radiation Physics and Department of Medical and Health Sciences, Linköping University, Linköping, Sweden.;Department of Clinical Immunology and Transfusion Medicine and Department of Clinical and Experimental Medicine, Linköping University, Linköping, Sweden.",
"authors": "Mellergård|J|J|;Tisell|A|A|;Blystad|I|I|;Grönqvist|A|A|;Blennow|K|K|;Olsson|B|B|;Dahle|C|C|;Vrethem|M|M|;Lundberg|P|P|;Ernerudh|J|J|",
"chemical_list": "D015415:Biomarkers; D007155:Immunologic Factors; D000069442:Natalizumab; D016875:tau Proteins",
"country": "England",
"delete": false,
"doi": "10.1111/ene.13162",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1351-5101",
"issue": "24(1)",
"journal": "European journal of neurology",
"keywords": "brain atrophy; magnetic resonance spectroscopy; multiple sclerosis; natalizumab; neurofilament; quantitative magnetic resonance imaging; tau",
"medline_ta": "Eur J Neurol",
"mesh_terms": "D000328:Adult; D001284:Atrophy; D001369:Axons; D015415:Biomarkers; D001921:Brain; D005260:Female; D006801:Humans; D007155:Immunologic Factors; D007382:Intermediate Filaments; D009682:Magnetic Resonance Spectroscopy; D008297:Male; D008875:Middle Aged; D009103:Multiple Sclerosis; D000069442:Natalizumab; D016896:Treatment Outcome; D055815:Young Adult; D016875:tau Proteins",
"nlm_unique_id": "9506311",
"other_id": null,
"pages": "112-121",
"pmc": null,
"pmid": "27699930",
"pubdate": "2017-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Cerebrospinal fluid levels of neurofilament and tau correlate with brain atrophy in natalizumab-treated multiple sclerosis.",
"title_normalized": "cerebrospinal fluid levels of neurofilament and tau correlate with brain atrophy in natalizumab treated multiple sclerosis"
} | [
{
"companynumb": "PHHY2016SE136729",
"fulfillexpeditecriteria": "1",
"occurcountry": "SE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FINGOLIMOD HYDROCHLORIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Intoxication caused by propafenone is very rare, and there is no case reported before propafenone and captopril intoxication together. There are few case reports in the literature about intoxication with more than 6 g of propafenone. We present the clinical manifestation and successfully treatment of 9 g of propafenone and 1 g captopril intoxication in an 18-year-old female. An 18-year-old female was brought to the emergency department approximately half an hour after she committed suicide with 30 propafenone tablets, 300 mg each, and 20 captopril tablets, 50 mg each. Her fist electrocardiography (ECG) shows a chaotic ventricular rhythm with a prolonged QRS complex. After fluid and sodium bicarbonate infusion and permanent pacemaker implantation, sinus rhythm was achieved. This case, to our knowledge, is the first in that it describes the successful recovery of a patient who ingested extensively large doses of propafenone (9 g) and captopril (1 g), both of which are known to have severe cardiac side effects.",
"affiliations": "Selcuklu Tip Fakultesi, Kardiyoloji AD, Selcuk Universitesi, 42075, Kampus, Konya, Turkey.",
"authors": "Avci|Ahmet|A|;Yilmaz|Ahmet|A|;Celik|Mustafa|M|;Demir|Kenan|K|;Keles|Fikret|F|",
"chemical_list": "D000806:Angiotensin-Converting Enzyme Inhibitors; D000889:Anti-Arrhythmia Agents; D011405:Propafenone; D017693:Sodium Bicarbonate; D002216:Captopril",
"country": "United States",
"delete": false,
"doi": "10.1007/s12012-013-9201-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1530-7905",
"issue": "13(3)",
"journal": "Cardiovascular toxicology",
"keywords": null,
"medline_ta": "Cardiovasc Toxicol",
"mesh_terms": "D000293:Adolescent; D000806:Angiotensin-Converting Enzyme Inhibitors; D000889:Anti-Arrhythmia Agents; D001145:Arrhythmias, Cardiac; D002216:Captopril; D016887:Cardiopulmonary Resuscitation; D004562:Electrocardiography; D004632:Emergency Medical Services; D005260:Female; D005440:Fluid Therapy; D015600:Glasgow Coma Scale; D006439:Hemodynamics; D006801:Humans; D007441:Intubation, Gastrointestinal; D008133:Long QT Syndrome; D010138:Pacemaker, Artificial; D011405:Propafenone; D017693:Sodium Bicarbonate; D013406:Suicide, Attempted",
"nlm_unique_id": "101135818",
"other_id": null,
"pages": "230-3",
"pmc": null,
"pmid": "23397376",
"pubdate": "2013-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Successful treatment of suicide attempt by megadose of propafenone and captopril.",
"title_normalized": "successful treatment of suicide attempt by megadose of propafenone and captopril"
} | [
{
"companynumb": "PHHY2013TR117081",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PROPAFENONE"
},
"drugadditional": null,
"dru... |
{
"abstract": "BACKGROUND\nMany emergency physicians use an intravenous fluid bolus as part of a 'cocktail' of therapies for patients with headache, but it is unclear if this is beneficial. The objective of this study was to determine if an intravenous fluid bolus helps reduce pain or improve other outcomes in patients who present to the ED with a benign headache.\n\n\nMETHODS\nThis was a randomised, single-blinded, clinical trial performed on patients aged 10-65 years old with benign headaches who presented to a single ED in Las Vegas, Nevada, from May 2017 to February 2019. All patients received prochlorperazine and diphenhydramine, and they were randomised to also receive either 20 mL/kg up to 1000 mL of normal saline (the fluid bolus group) or 5 mL of normal saline (the control group). The primary outcome was the difference between groups in mean pain reduction 60 min after the initiation of treatment. Secondarily, we compared groups with regards to pain reduction at 30 min, nausea scores, the use of rescue medications and disposition.\n\n\nRESULTS\nWe screened 67 patients for enrolment, and 58 consented. Of those, 35 were randomised to the fluid bolus group and 23 to the control group. The mean pain score dropped by 48.3 mm over 60 min in the fluid bolus group, compared with 48.7 mm in the control group. The between groups difference of 0.4 mm (95% CI -16.5 to 17.3) was not statistically significant (p=0.96). Additionally, no statistically significant difference was found between groups for any secondary outcome.\n\n\nCONCLUSIONS\nThough our study lacked statistical power to detect small but clinically significant differences, ED patients who received an intravenous fluid bolus for their headache had similar improvements in pain and other outcomes compared with those who did not.\n\n\nBACKGROUND\nNCT03185130.",
"affiliations": "Department of Emergency Medicine, Kendall Regional Medical Center, Miami, Florida, USA zitek10@gmail.com.;Department of Emergency Medicine, Mike O'Callaghan Federal Medical Center, Nellis Afb, Nevada, USA.;Department of Emergency Medicine, University of Nevada, Las Vegas School of Medicine, Las Vegas, Nevada, USA.;Department of Emergency Medicine, University Medical Center of Southern Nevada, Las Vegas, Nevada, USA.;Department of Emergency Medicine, University Medical Center of Southern Nevada, Las Vegas, Nevada, USA.",
"authors": "Zitek|Tony|T|http://orcid.org/0000-0002-4357-6611;Sigal|Tiffany|T|;Sun|Gina|G|;Martin Manuel|Chris|C|;Tran|Khanhha|K|",
"chemical_list": "D018492:Dopamine Antagonists; D006634:Histamine H1 Antagonists; D004155:Diphenhydramine; D011346:Prochlorperazine",
"country": "England",
"delete": false,
"doi": "10.1136/emermed-2019-209389",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1472-0205",
"issue": "37(8)",
"journal": "Emergency medicine journal : EMJ",
"keywords": "headache",
"medline_ta": "Emerg Med J",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D002648:Child; D004155:Diphenhydramine; D018492:Dopamine Antagonists; D005260:Female; D005440:Fluid Therapy; D006261:Headache; D006634:Histamine H1 Antagonists; D006801:Humans; D008297:Male; D008875:Middle Aged; D009505:Nevada; D059408:Pain Management; D010147:Pain Measurement; D011346:Prochlorperazine; D016037:Single-Blind Method",
"nlm_unique_id": "100963089",
"other_id": null,
"pages": "469-473",
"pmc": null,
"pmid": "32620543",
"pubdate": "2020-08",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "I-FiBH trial: intravenous fluids in benign headaches-a randomised, single-blinded clinical trial.",
"title_normalized": "i fibh trial intravenous fluids in benign headaches a randomised single blinded clinical trial"
} | [
{
"companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-20-04431",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "SODIUM CHLORIDE"
},
... |
{
"abstract": "Metastatic pheochromocytoma and paraganglioma (mPHEO/PGL) are frequently associated with succinate dehydrogenase B (SDHB) mutations. Cyclophosphamide-dacarbazine-vincristine (CVD) regimen is recommended as standard chemotherapy for advanced mPHEO/PGL. There is limited evidence to support the role of metronomic schemes (MS) of chemotherapy in mPHEO/PGL treatment. We report 2 patients with SDHB-related mPGL who received a regimen consisting of MS temozolomide (TMZ) and high-dose lanreotide after progression on both CVD chemotherapy and high-dose lanreotide. Molecular profiling of the tumor tissue from both patients revealed hypermethylation of the O6-methylguanine-DNA-methyltransferase (MGMT) promoter. In one patient, progression-free survival was 13 months and the second patient remained under treatment after 27 months of stabilization of metabolic response of his disease. Treatment was well tolerated, and adverse effects were virtually absent. A modification in the scheme of TMZ from standard schemes to MS is safe and feasible and can be considered in patients with progressive mPHEO/PGL refractory to dacarbazine in standard doses.",
"affiliations": "Department of Medical Oncology, Castellon Provincial Hospital, Castellón, Spain.;Section on Medical Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA.;Department of Medical Oncology, Castellon Provincial Hospital, Castellón, Spain.;Medical Oncology Department, Virgen del Rocío University Hospital, Seville, Spain.;University Hospital La Fe, Valencia, Spain.;Medical Oncology Department, Virgen del Rocío University Hospital, Seville, Spain.;Section on Medical Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA.;University Hospital La Fe, Valencia, Spain.;Department of Medical Oncology, Arnau de Vilanova Hospital, Valencia, Spain.;Department of Medical Oncology, Castellon Provincial Hospital, Castellón, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;University Hospital La Fe, Valencia, Spain.;Department of Medical Oncology, Arnau de Vilanova Hospital, Valencia, Spain.;Department of Medical Oncology, Castellon Provincial Hospital, Castellón, Spain.;Section on Medical Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA.",
"authors": "Tena|Isabel|I|;Gupta|Garima|G|;Tajahuerce|Marcos|M|;Benavent|Marta|M|;Cifrián|Manuel|M|;Falcon|Alejandro|A|;Fonfria|María|M|;Del Olmo|Maribel|M|;Reboll|Rosa|R|;Conde|Antonio|A|;Moreno|Francisca|F|;Balaguer|Julia|J|;Cañete|Adela|A|;Palasí|Rosana|R|;Bello|Pilar|P|;Marco|Alfredo|A|;Ponce|José Luis|JL|;Merino|Juan Francisco|JF|;Llombart|Antonio|A|;Sanchez|Alfredo|A|;Pacak|Karel|K|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/1179554918763367",
"fulltext": "\n==== Front\nClin Med Insights OncolClin Med Insights OncolONCsponcClinical Medicine Insights. Oncology1179-5549SAGE Publications Sage UK: London, England 10.1177/117955491876336710.1177_1179554918763367ONC-0043131Case ReportSuccessful Second-Line Metronomic Temozolomide in Metastatic Paraganglioma: Case Reports and Review of the Literature Tena Isabel 12Gupta Garima 2Tajahuerce Marcos 1Benavent Marta 3Cifrián Manuel 4Falcon Alejandro 3Fonfria María 2del Olmo Maribel 4Reboll Rosa 5Conde Antonio 1Moreno Francisca 4Balaguer Julia 4Cañete Adela 4Palasí Rosana 4Bello Pilar 4Marco Alfredo 4Ponce José Luis 4Merino Juan Francisco 4Llombart Antonio 5Sanchez Alfredo 1Pacak Karel 21 Department of Medical Oncology, Castellon Provincial Hospital, Castellón, Spain2 Section on Medical Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, USA3 Medical Oncology Department, Virgen del Rocío University Hospital, Seville, Spain4 University Hospital La Fe, Valencia, Spain5 Department of Medical Oncology, Arnau de Vilanova Hospital, Valencia, SpainIsabel Tena, Section on Medical Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, 10 Center Drive, Building 10, Room 1E-1-3140, Bethesda, MD 20892-0001, USA. Email: isabel.tenagarcia@nih.gov09 4 2018 2018 12 117955491876336720 7 2017 4 2 2018 © The Author(s) 20182018SAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons LicensesThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (http://www.creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).Metastatic pheochromocytoma and paraganglioma (mPHEO/PGL) are frequently associated with succinate dehydrogenase B (SDHB) mutations. Cyclophosphamide-dacarbazine-vincristine (CVD) regimen is recommended as standard chemotherapy for advanced mPHEO/PGL. There is limited evidence to support the role of metronomic schemes (MS) of chemotherapy in mPHEO/PGL treatment. We report 2 patients with SDHB-related mPGL who received a regimen consisting of MS temozolomide (TMZ) and high-dose lanreotide after progression on both CVD chemotherapy and high-dose lanreotide. Molecular profiling of the tumor tissue from both patients revealed hypermethylation of the O6-methylguanine-DNA-methyltransferase (MGMT) promoter. In one patient, progression-free survival was 13 months and the second patient remained under treatment after 27 months of stabilization of metabolic response of his disease. Treatment was well tolerated, and adverse effects were virtually absent. A modification in the scheme of TMZ from standard schemes to MS is safe and feasible and can be considered in patients with progressive mPHEO/PGL refractory to dacarbazine in standard doses.\n\nParagangliomaSDHBmetastatictemozolomidemetronomiccover-dateJanuary-December 2018\n==== Body\nBackground\nPheochromocytomas (PHEOs) and paragangliomas (PGLs) are rare, frequently heritable and highly vascularized neuroendocrine tumors (NETs) that originate from chromaffin cells of the adrenal medulla or paraganglia located outside of the adrenal gland, respectively. Although they are usually benign, PHEO/PGL can exhibit malignant behavior. This rate of malignancy has long been cited as 10%,1 although some authors point at a higher percentage of 26%,2 which would be specially higher in patients with secretive PGLs.3 Patients with mPHEO/PGLs, defined by the presence of metastases, have a 5-year overall survival rate of 60%.4 Approximately 40% of PGLs are ascribed to germline mutations in 1 of more than 12 well-identified genes including succinate dehydrogenase (SDH) type A, B, C, or D; SDH complex assembly factor 2 (SDHAF2); fumarate hydratase (FH); von Hippel-Lindau (VHL); malate dehydrogenase (MDH) type 2; endothelial pas domain protein 1/hypoxia-inducible factor type 2A (EPAS1/HIF2A); prolyl hydroxylase (PHD) type 1 and 2; rearranged during transfection (RET); neurofibromatosis type 1 (NF1); transmembrane protein 127 (TMEM127); and MYC-associated factor X (MAX).5–7 Mutations in the SDHB gene are associated with mPHEO/PGL in up to 83% of cases.8,9\nSDH-related tumorigenesis is characterized by a pseudo(hypoxic) pathway signature and stabilization of the hypoxia-inducible factor,10,11 which results in activation of target genes involved in angiogenesis, proliferation, invasiveness, and metastasis.12,13 More specifically, SDHB-mutated PGLs exhibit a pronounced hypermethylator phenotype14 resulting in decreased expression of target genes involved in neuroendocrine differentiation.15 This mechanism leads to activation of the epithelial-to-mesenchymal transition pathway and explains the invasive phenotype of these tumors.14,15 In patients with progressive mPHEO/PGL, the treatment goals are to manage hormone-related symptoms, control tumor growth, and prolong the overall survival (OS) of patients. Treatment options are limited to debulking surgery, localized radiotherapy, and tumor-specific systemic therapies. Combination treatment with cyclophosphamide-dacarbazine-vincristine (CVD; cyclophosphamide 750 mg/m2 vincristine 1.4 mg/m2, and dacarbazine 600 mg/m2 on day 1 and dacarbazine 600 mg/m2 on day 2) is considered the standard first-line chemotherapy regimen in patients with inoperable and progressive mPHEO/PGL based on 6 retrospective studies.16–22 However, the results may be overestimated and have not been confirmed by randomized controlled trials. Molecular targeted chemotherapies with mammalian target of rapamycin (mTOR) inhibitors (NCT01152827) and tyrosine kinase inhibitors with strong antiangiogenic activity such as pazopanib (NCT01340794) and axitinib (NCT01967576) have not shown any clear benefit in mPHEO/PGL in phase 2 clinical trials. Ongoing clinical trials are testing the efficacy of vascular endothelial growth factor (VEGF) pathway inhibitors, such as sunitinib (NCT01371201) and lenvatinib (NCT03008369); VEGF/MET (VEGF/hepatocyte growth factor receptor) pathway inhibitors, such as cabozantinib (NCT02302833); and the immune-modulating antibodies against the PD-1/PDL-1 pathway, such as pembrolizumab (NCT02721732).\n\nTemozolomide (TMZ) is an alkylating agent and an oral chemotherapy alternative to intravenous dacarbazine, which historically has been used both as monotherapy and in combination with other antitumoral agents. In a recent study, TMZ, when administered at a mean dose of 172 mg/m2/d for 5 days in 28-day cycles, resulted in clinical benefit in 67% of the enrolled patients with progressive mPHEO/PGL.23 Interestingly, 80% of these responders exhibited low tumor levels of O6-methylguanine-DNA methyltransferase (MGMT).23 A similar pattern has been previously reported in patients with glioblastomas and gastroenteropancreatic NETs.24,25 Furthermore, this study reported a correlation between SDHB-mutated tumors and hypermethylation of the MGMT promoter region.23\n\nIn this report, we detail the outcomes for 2 patients with SDHB-related PGL progressive metastatic disease, who had been already treated and progressed on both intravenous dacarbazine-based chemotherapy and high doses of lanreotide (Table 1). At the time of progression (TTP), standard scheme (SS) of chemotherapy was rotated to metronomic schemes (MS) with TMZ 75 mg/m2 (21/28-day regimen).26 Both patients responded well. The administration of MS in our 2 patients was based on further genetic profiling of metastatic tumor tissue in both patients who revealed methylation of the MGMT promoter. This epigenetic silencing pattern23 and the theoretical possibility to overcome chemotherapy resistance to conventional SS were considered compelling molecular findings to recommend rechallenging with TMZ and to explore MS dosing of the same.\n\nTable 1. Clinical characteristics of patients treated with metronomic TMZ and high-dose lanreotide.\n\nPatient no.\tSex\tAge at diagnosis\nPrimary\tKi 67 index, %\tAge at mPGL diagnosis\tSite of metastases\tSDHB mutation\tMGMT methylation\tTreatment cycles, n\tBiochemical response\tTherapies\tPFS to prior therapies, mo\tBest response to prior therapies\tPERCIST 1.0\tPFS, mo\tSurvival status\t\n1\tM\t58\t20\t60\tBone, soft tissue\tYes\tYes\t27\tPRa\tSurgery\t24\t\tPMRb\tNR\tAlive\t\n\t\t\t\t\t\t\t\t\t\tThermoablation\t\t\t\t\t\t\n\t\t\t\t\t\t\t\t\t\tSunitinib\t2\tPMD\t\t\t\t\n\t\t\t\t\t\t\t\t\t\t2 monthly lanreotide + CVD\t6\tPMR\t\t\t\t\n2\tF\t46\t5\t46\tBone, soft tissue\tYes\tYes\t13\tCRa\tCVD\t8\tPMR\tPMRb\t13\tAlive\t\n\t\t\t\t\t\t\t\t\t\tHigh-dose lanreotide\t15\tPMR\t\t\t\t\n\t\t\t\t\t\t\t\t\t\tSurgery\t\t\t\t\t\t\n\t\t\t\t\t\t\t\t\t\tThermoablation\t\t\t\t\t\t\nAbbreviations: CR, complete response; CVD, cyclophosphamide, vincristine, and dacarbazine; F, female; M, male; MGMT, O6-methylguanine-DNA methyltransferase; mPGL, malignant pheochromocytoma and paraganglioma; PERCIST, positron emission tomography response criteria in solid tumors; PFS, progression-free survival; PMD, progressive metabolic disease; PMR, partial metabolic response; PR, partial response; SDHB, succinate dehydrogenase subunit B; TMZ, temozolomide; NR, not reached.\n\na Biochemical response in patient 1 was based on urinary normetanephrine levels obtained at baseline and after 4 and 11 cycles of chemotherapy. Urinary normetanephrine levels were used to monitor disease progression because the biochemical phenotype of the tumor was noradrenergic (mainly producing norepinephrine and normetanephrine). In patient 2, biochemical response was based on plasma chromogranin A levels. Other biochemical markers were not available at regular time intervals.\n\nb Both patients demonstrated PMR as their best response to this treatment regimen on PERCIST 1.0 criteria. While patient 1 continued to demonstrate a stabilized PMR after 21 cycles, patient 2 demonstrated progressive metabolic disease (PMD) after 13 cycles with dissociated response.\n\nIn general, the administration of optimal MS chemotherapy can result in an improved OS compared with SS27,28 with relatively low toxicity in various solid malignancies,28–30 even in heavily pretreated patients.28,29 As a consequence, chemotherapy paradigms are shifting to focus on MS.31–33 Metronomic scheme targets the proliferating tumor endothelial cells34 and theoretically can result in a significant antiangiogenic effect31–34 and may implicate immunologic host effects32,35 as treatment outcome seems to rely on the immune environment.33 However, the antiproliferative pathways of MS are not fully elucidated.\n\nExperimental Methods and Data Analysis\nAfter pathological review, formalin-fixed paraffin-embedded (FFPE) metastatic tissues were macrodissected and DNA was extracted using the Qiagen DNA FFPE Tissue Kit (Qiagen, Valencia, CA, USA) and measured using the Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). To identify somatic alterations, an AmpliSeq custom panel (OncoDNA, Gosselies, Belgium) was designed to amplify by next-generation sequencing (NGS) 207 amplicons covering hotspot mutations of 65 genes (OncoDEEP). Briefly, the targeted sequencing libraries were generated using the Ion AmpliSeq Library Kit 2.0 according to the manufacturer’s instructions (Thermo Fisher Scientific). The starting material consisted of 10 ng DNA from FFPE. The primers used for amplification were partially digested by the Pfu enzyme and the product of digestion was then ligated with corresponding barcoded adapters and purified using Ampure Beads (Agilent Genomics Inc., Santa Clara, CA, USA). The product of purification was amplified for 5 more cycles and subsequently purified using Ampure Beads. The quality of the libraries was assessed using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific). About 10 pM of each library was loaded into the Ion Chef System (Thermo Fisher Scientific) for the emulsion polymerase chain reaction. An average coverage of 1000× was targeted to be able to detect variants down to 5%. Ion PGM (Personal Genome Machine) System was used for primary processing of NGS data and identification of putative somatic mutations. The data generated were aligned to the human reference sequence and annotated using the consensus coding DNA sequences, RefSeq, and Ensembl databases. The NGS data were first analyzed using the Torrent Suite Software (Thermo Fisher Scientific).\n\nThen, somatic mutations were identified using the Variant Caller 4.0 software using the somatic high-stringency parameters (Thermo Fisher Scientific). Mutations were separated into those associated with a described biological impact on the function of the proteins and those common germline mutations found in the NCBI dbSNP human variation sets in VCF (variant call format) version 138 (https://www.ncbi.nlm.nih.gov/variation/docs/human_variation_vcf/). For immunohistochemistry (IHC), each IHC was analyzed by microscopy in a double-blind fashion. A score was calculated based on a predefined ISO-accredited scoring method (which is IHC dependent). MGMT promoter methylation was determined using pyrosequencing. To assess clinical relevance of the analyses, a literature search was performed to identify published official guidelines, retrospective, and prospective clinical studies, pertaining to genomic alterations of each gene and their association with outcomes in patients with cancer, and to remove variants known to be benign or likely to be benign. The same analysis was performed for the results of the IHC and methylation test. The treatments recommended for each assay fell into 3 different categories: associated with “Potential clinical benefit,” “Lack of potential clinical benefit,” and “Unknown.” In both cases, the methylation of the MGMT promoter was revealed as the main target for personalized treatment (Table 2).\n\nTable 2. Results of exhaustive genomic profiling, next-generation sequencing (NGS) of 65 genes (Ion Torrent technology [Life Technologies, Carlsbad, CA, USA]), methylation profiling, and immunohistochemistry (IHC) of the tumor tissue (OncoDEEP) from both patients.\n\n\t\tPatient 1\tPatient 2\t\nNGS\t\nVariants\tN\t\t\t\t\nVariants of uncertain significance (VUS)\t\t\t1\tKDR p.R961Q\t\nProbably polymorphism\t1\tPIK3CA p.I391M\t1\tDPYD p.S534N\t\nIHC\t\nProtein/biomarker\tExpression\tClinical impact\t\t\t\nP16\tPositive\tPotential lack of clinical benefits of CDK4/6 inhibitors\tNegative\tPotential lack of clinical benefits of CDK4/6 inhibitors\t\nCDK4\tNegative\tPotential lack of clinical benefits of CDK4 inhibitors\tModerate\tPotential clinical benefits of CDK4 inhibitors\t\nPhospho-Rb\tNegative\tPotential lack of clinical benefits of CDK4/6 inhibitors\tPositive\tPotential clinical benefits of CDK4/6 inhibitors\t\nFusion panel (ALK/ROS1/RET)\tNegative\tPotential lack of clinical benefits of Crizotinib\tNegative\tPotential lack of clinical benefits of Crizotinib\t\n\nMGMT methylation\n\t\nPositive\n\t\nPotential clinical benefits of temozolomide\n\t\nPositive\n\t\nPotential clinical benefits of temozolomide\n\t\nCD8\tNegative\tPotential lack of clinical benefits of PD-1/PD-L1 inhibitors\tNegative\tPotential lack of clinical benefits of PD-1/PD-L1 inhibitors\t\nPD-L1\tLow\tPotential lack of clinical benefits of PD-1/PD-L1 inhibitors\tLow\tPotential lack of clinical benefits of PD-1/PD-L1 inhibitors\t\np4EBP1\tLow\tPotential lack of clinical benefits of mTOR inhibitors\tLow\tPotential lack of clinical benefits of mTOR inhibitors\t\nPTEN\tPositive\tPotential lack of clinical benefits of PIK3CA and/or mTOR inhibitors\tPositive\tPotential lack of clinical benefits of PIK3CA and/or mTOR inhibitors\t\nVEGF\tPositive\tTreatment based on angiogenesis inhibitors associated with undetermined clinical benefit in paraganglioma\tNegative\tPotential lack of clinical benefits of angiogenesis inhibitors\t\nVEGFR2\tLow\tPotential lack of clinical benefits of VEGFR2 inhibitors\t\t\t\nEGFR\tNegative\tPotential lack of clinical benefits of EGFR inhibitors\tNegative\tPotential lack of clinical benefits of EGFR inhibitors\t\nCase Reports\nPatient 1\nIn January 2017, a 63-year-old man with a history of SDHB (c.637dupA)-related mPGL presented to the National Institutes of Health. In November 2012, he presented with a 5-year history of profuse sweating at night, hypertension, and diffuse abdominal pain. Imaging studies revealed a 7.5 cm × 5 cm paraaortic mass, which was resected and was confirmed to be PGL. Immunohistochemistry demonstrated positivity for chromogranin (CgA), synaptophysin, S-100, and Ki-67 index of 20%. After a disease-free survival period of 2 years, the patient developed severe cervical pain and was found to have multifocal bone lesions on 18F-fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT). First-line systemic treatment with sunitinib 25 mg daily was initiated, increasing the dose to 37.5 mg after 1 week. Treatment was continued for 62 days with poor tolerability and progression of the disease. Thus, during the treatment, the patient developed profuse sweating due to worsening hypertension, severe bone pain, and myalgia with increased analgesic requirement, asthenia grade 2, and lost 44 lbs with Eastern Cooperative Oncology Group performance status (ECOG PS) of 4. Restaging studies in January 2015, after 69 days of treatment, showed progression of metabolic disease (PMD) based on positron emission tomography response criteria in solid tumors (PERCIST) 1.0 criteria. Hypertension and pain and control were achieved with a combination of olmesartan 20 mg and hydrochlorothiazide 12.5 mg daily and high-dose transdermal fentanyl patches (200 µg every 3 days), reaching an ECOG PS of 2.\n\nIn February 2015, the patient started second-line systemic treatment with a combination regimen of extended-release lanreotide (Somatuline Autogel) at a dose of 120 mg every 14 days, zoledronic acid 4 mg every 28 days, and SS chemotherapy with CVD (cyclophosphamide 750 mg/m2, vincristine 1.4 mg/m2, and dacarbazine 600 mg/m2 on day 1 and dacarbazine 600 mg/m2 on day 2) every 21 days. Although a partial metabolic response (PMR) was noted after 4 cycles, the 18F-FDG PET CT after 6 cycles showed PMD with clinical worsening (ECOG PS 3). The CVD chemotherapy was discontinued, and the patient remained on the same doses of lanreotide and zoledronic acid.\n\nIn December 2015, genomic profiling of the tumor tissue revealed methylation of the MGMT promoter. Based on this epigenetic silencing pattern, MS TMZ was added to lanreotide and zoledronic acid at a dose of 75 mg/m2/d with a schedule of 3 weeks on treatment followed by 1 week off treatment (21/28-day regimen).26 After 17 cycles, treatment was discontinued in February 2017 due to grade 3 lymphopenia according to Common Terminology Criteria for Adverse Events v3.0 (CTCAE) and restarted after 2 weeks, in March 2017, at the same dose but with prolongation of the courses to 5 weeks (3 weeks on treatment followed by 2 weeks off treatment).26 Currently, the patient remains under treatment after 27 cycles.\n\nThe treatment regimen was being well tolerated with improvement in ECOG PS 0-1 with significant improvement in pain control as noted by progressive strength reductions in fentanyl analgesia. In June 2016, the patient achieved complete control pain without analgesia. Continuous daily TMZ can cause lymphopenia, potentially increasing the risk of opportunistic infections. Expected hematological toxicity with grade 1-2 lymphopenia from the fourth cycle of therapy onward required addition of oral prophylactic TMP/SMX (trimethoprim/sulfamethoxazole) to prevent Pneumocystis carinii pneumonia.36 Patient’s blood pressure and heart rate remain in the normal range without need for antihypertensive medications. Biochemical response was noted after 14 cycles, evaluated with both CgA and urinary normetanephrine (NMN) levels, at 47% and 63% from baseline, respectively. Restaging 18F-FDG PET CTs performed in May 2016, after 5 cycles, and in March 2017, after 15 cycles, demonstrated a PMR and a stabilized PMR, respectively (Figure 1). On his latest 18FDG-PET/CT of September 2017 after 22 cycles, the patient continued to demonstrate prolonged stabilized PMR and currently he continues under 28th course of treatment (Figure 1).\n\nFigure 1. This image demonstrates the metabolic changes observed on the 18F-FDG PET/CT at baseline (prior to initiating MS with TMZ in September 2015), restaging studies performed after 5 cycles, in May 2016, and 15 cycles, in March 2017, of the chemotherapy regimen consisting of MS with TMZ and high-dose lanreotide. In September 2015, maximum standardized uptake value (SUVmax) normalized to lean body mass (SULmax) of the most active lesion (marked in orange) was 23.12. In May 2016, a PMR was noted (SULmax) of the target lesion = 12.49, which is 45.9% reduction). In March and September 2017, there was stabilization of the PMR and no new lesions were detected on either of the studies. 18F-FDG PET/CT: 18F-fluorodeoxyglucose positron emission tomography/computed tomography; PMR: partial metabolic response; TMZ: temozolomide.\n\nPatient 2\nIn May 2016, a 49-year-old woman with an SDHB (del ex 6-8)-related mPGL presented to the National Institutes of Health. She was originally diagnosed at age 46, when she reported a 3-month history of debilitating hip pain, flushing profuse sweating as well as a 3-year history of palpitations, hypertension, and progressive deterioration of ECOG to status 3. The patient endorsed a family history of neck PGL, 18F-FDG PET CT showed a 6.8 cm × 7.5 cm × 8.5 cm hypermetabolic mass subjacent to the area of the third portion of the duodenum and multifocal lytic bone lesions. Biochemical testing showed elevated urinary norepinephrine, as well as plasma NMN and CgA levels, with a high degree of suspicion for a diagnosis of mPGL. Systemic treatment with CVD was prioritized and commenced chemotherapy in May 2013. An initially deferred biopsy of a right iliac bone lesion performed after 2 courses confirmed the diagnosis of mPGL. Restaging following 3 cycles of therapy showed no evidence of clinical response, with stable disease based on response evaluation criteria in solid tumors (RECIST) 1.1 and PMR based on PERCIST 1.0 criteria.\n\nFollowing a fifth course of therapy, the patient underwent somatostatin receptor scintigraphy evaluation with 111In-pentetreotide ([111In-DTPA0]-octreo-tide), which demonstrated a positive uptake. Based on this finding, extended-release lanreotide (Somatuline Autogel) at a dose of 120 mg was administered alongside 6 cycles of CVD chemotherapy, starting September 2013. This regimen was discontinued in February 2014 (after 4 cycles of CVD monotherapy and 4 cycles of combination therapy) due to worsening symptoms and biochemical markers; lanreotide dosing intervals were shortened fortnightly to 2 weeks. Following 6 cycles of lanreotide monotherapy, the patient demonstrated a pronounced clinical response, with improvement in self-care activities and symptoms to ECOG PS 0, and a biochemical response with normalization of plasma CgA levels. Restaging 18F-FDG PET CT in May 2014 revealed a PMR based on PERCIST 1.0 criteria. A maximal cytoreductive debulking surgery with complete resection of the primary retroperitoneal PGL was performed in October 2014. Lanreotide was continued at the same dose until July 2015.\n\nA year and half later, in May 2015, the patient presented with symptomatic progression of a painful soft tissue mass located at the level of T9-T10 vertebrae, which was treated with external beam radiation (30 cGy daily for 10 days, total dose of 300 Gy). At the same time, a 6.5-cm femoral lesion, extending into the diaphysis and with noted endosteal resorption, was identified consistent with disease progression. Second line of SS chemotherapy following Strosberg et al (capecitabine 750 mg/m2 twice a day, on days 1-14 and TMZ 200 mg/m2 daily, on days 1-5 in 28-day cycles)37 and monthly denosumab 120 mg, was initiated. Lanreotide was continued at the same dose. However, in July 2015, patient underwent thermoablation and cementoplasty to stabilize the femur that was complicated by a fourth-degree skin burn with full thickness ulceration. As a result, chemotherapy was discontinued due to the associated risk of infection. During this period, the patient’s biochemical markers continued to worsen. In addition, genetic and molecular profiling of the tumor tissue revealed methylation of the MGMT promoter. Following consideration of the NGS findings, in September 2015, the chemotherapy regimen was rotated to MS TMZ 75 mg/m2 (21/28-day regimen),26 denosumab 120 mg, and lanreotide 120 mg every 14 days with excellent tolerability.\n\nFollowing 6 courses of treatment, the patient achieved a complete biochemical response with normalization of CgA levels. Restaging 18F-FDG PET CT after 4 cycles demonstrated PMR of >40% in target metastatic bone lesions. The patient did not develop any adverse effects apart from grade 2 lymphopenia, which was managed with prophylactic antibiotics. 18F-FDG PET CT in October 2016 demonstrated a dissociated metabolic response and no new lesions were detected (Figure 2). Despite this, the regimen was continued due to limited available treatment options while other therapies were being considered. Patient completed 17 cycles of this chemotherapy regimen in March 2017. 18F-FDG PET CT in March 2017 revealed PMD and this treatment regimen was discontinued (Figure 2). The patient was started on peptide receptor radionuclide therapy with Lutetium-177 (177Lu)-DOTA0-Tyr3-octreotate (DOTATATE) in April 2017.\n\nFigure 2. This image demonstrates the metabolic changes observed on the 18F-FDG PET CT 1 month after initiating TMZ in September 2015, restaging studies performed after 4 cycles, in January 2016, after 13 cycles, in October 2016, and after 17 cycles, in March 2017, of the chemotherapy regimen consisting of MS TMZ, denosumab, and high-dose lanreotide. In October 2015, maximum standardized uptake values (SUVmax) of the most active lesions located at the right iliac crest and the left third rib (marked in red) were 16.0 and 13.6, respectively. In January 2016, a PMR was noted of the right iliac crest lesion and of the left third rib lesion (SUVmax of 9.2 and of 7.9), showing a 42.5% and 41.9% of SUVmax reduction, respectively. In October 2016, there was a dissociated metabolic response. While the SUVmax of the right iliac lesion increased to 21.62, the SUVmax of the left third rib lesion decreased by 19.8% to 6.33. No new lesions were noted in either restaging studies. New lesions and increased metabolic activity were noted in the 18F-FDG PET CT performed in March 2017, indicating PMD. 18F-FDG PET/CT indicates 18F-fluorodeoxyglucose positron emission tomography/computed tomography; PMD, progressive metabolic disease; PMR, partial metabolic response; TMZ, temozolomide.\n\nDiscussion\nTemozolomide is a DNA alkylating agent, which primarily exerts its cytotoxic effect by causing methylation of the O6 position of guanine, resulting in DNA adduction. These DNA adducts represent 9% of the total DNA methylation events caused by TMZ,38–40 inducing DNA mismatch repair. The resulting double-strand breaks ultimately drive the cell to undergo apoptosis.41,42 The only cellular mechanism capable of repairing these adducts is the MGMT enzyme, which is irreversibly inactivated in this process, such that new MGMT protein synthesis is required.43,44 The cellular levels of MGMT affect the cytotoxicity of TMZ and play an important role in response to this chemotherapy agent. MGMT expression in tumor cells is regulated by epigenetic silencing of the gene, via hypermethylation of its promoter region. Both succinate45 and d-2-hydroxyglutarate46 are considered oncometabolites. Increased levels of succinate or d-2-hydroxyglutarate derive in epigenetic remodeling.47 As a consequence, the hypermethylator phenotypes of SDH-related PGL14 and IDH-related glioblastoma (GBM)46 result in overlapping. In both, hypermethylation of the promoter of the MGMT gene is frequently observed. However, MGMT is also depleted in normal cells, particularly hematopoietic stem cells, resulting in hematologic toxicity. Thus, the therapeutic window is largest in tumor cells with hypermethylated MGMT promoter, which effectively silences the gene.48,49 The benefit of MGMT gene silencing in patients with glioma undergoing chemotherapy with TMZ is well elucidated.26\n\nEfforts to deplete MGMT activity to increase the cytotoxic potential of alkylating agents led to exploration of metronomic TMZ schedules in patients with glioma26,50,51 with the goal of improving antitumor activity and overcoming resistance.52–55 Several regimens consisting of MS TMZ in both newly diagnosed and recurrent gliomas as well as in melanoma have been investigated.52–56 In patients with GBM, retreatment with MS was shown to be safe and active at various doses including the 7/14-day regimen,51 the 21/28-day regimen,26 and the daily TMZ at 50 mg/m2/d.50 Among these, Brandes et al26 were the first to try to show correlation between MGMT promoter methylation status and treatment outcome. Unexpectedly, no significant difference was found between MGMT promoter methylation status and median progression-free survival (PFS) outcomes at 6 months in this trial (15.6 weeks and 20% for MGMT promoter methylation and unmethylation vs 11.9 weeks and 21.4%, respectively). In addition, the authors suggested that MGMT depletion achieved with extended TMZ increased the sensitivity of the unmethylated tumor. Subsequently, Wick et al52 obtained similar results and speculated that the negative findings were due to the effect of MS TMZ in the tumor microenvironment rather than the cytotoxic effect of TMZ. More recently, MS TMZ schedules showed also to improve survival in newly diagnosed GBMs56 were, again, no additional benefit has been observed in patients with methylated MGMT. However, these observations were based on a small number of patients26 and there were no functional investigations conducted in any of these 3 studies.\n\nThe increase in MS TMZ efficacy has been effectively clarified in other reports and can be explained by the activation of several mechanisms. These would include the inhibition of angiogenesis,57 MGMT activity depletion,58 or downregulation of nuclear factor κB (NF-κB)/p65 binding activity in epidermal growth factor receptor (EGFR)-overexpressing GBMs, independently of MGMT methylation status.59 This mechanism is even more evident in GBMs with phosphatase and tensin homolog (PTEN) loss59 as PTEN represents a major inhibitor of the EGFR/phosphoinositide 3-kinase/protein kinase B (EGFR/PI3K/Akt) pathway.\n\nRegarding MS efficacy in mPHEO/PGL, one prior publication reported 2 patients who responded to metronomic doses of cyclophosphamide.60 Of these, only 1 patient was screened and was found positive for a germline VHL mutation, although no additional translational information was reported.60\n\nTo our knowledge, these are the first case reports showing the efficacy of metronomic TMZ in patients with mPGL who have been previously pretreated with SS dacarbazine-based chemotherapy and had progressed on it. Both patients responded well to therapy, with notable increases in PFS for both patients. In addition to the clinical benefit with complete resolution of symptoms, a continuous metabolic response after at least 12 months of treatment was noted. One patient remains under treatment with a 4 times durable response compared with previous conventional CVD. Whether the concomitant high doses of lanreotide played a synergistic role remains unclear. The combination proved to be safe and no adverse effects attributed to the addition of the second agent were noted. In our opinion, this regimen has promising activity and offers a judicious possibility of retreatment with TMZ in patients progressing on CVD chemotherapy or conventional TMZ.\n\nThis report highlights the efficacy of this regimen, even in patients with poor performance status, and opens new treatment scenarios for patients with mPHEO/PGL. Whether patients without MGMT methylation could also benefit from metronomic TMZ remains unelucidated and should be evaluated considering the results for patients with GBM. Therefore, we think that metronomic TMZ should be explored in MGMT promoter–unmethylated patients in prospective studies with patients stratified according to methylation status.\n\nAs mentioned above, MS TMZ efficacy relies also in the inhibition of angiogenesis57 and the downregulation of NF-κB/p65 binding activity in EGFR-overexpressing GBMs independently of MGMT methylation status.59 It is worthy to say that in our 2 patients, EGFR expression was negative (Figure 1). However, if patients with unmethylated MGMT mPHEO/PGL could present with EGFR-overexpressing tumors and could respond to MS TMZ remains something worthy to explore.\n\nMetronomic treatment has some advantages over other salvage chemotherapies for progressive mPHEO/PGL as it offers better compliance than other intravenous treatments. In addition, treatment-related toxicities in our report were only related to manageable lymphopenia.\n\nConclusions\nFew cases of mPHEO/PGL treated with MS have been described so far. This report suggests that a modification in the scheme of TMZ to MS is feasible and safe in patients with mPHEO/PGL refractory to conventional regimens with intravenous dacarbazine or oral TMZ.\n\nWe postulate that MS TMZ should be considered as a second-line regimen in patients with methylated MGMT mPHEO/PGL at the TTP to standard CVD chemotherapy or conventional TMZ schedules.\n\nWhether patients without MGMT methylation could also benefit from metronomic TMZ remains unclear and should be explored in well-designed clinical trials.\n\nSupplemental Material\nSupplementary_data – Supplemental material for Successful Second-Line Metronomic Temozolomide in Metastatic Paraganglioma: Case Reports and Review of the Literature\nClick here for additional data file.\n\nSupplemental material, Supplementary_data for Successful Second-Line Metronomic Temozolomide in Metastatic Paraganglioma: Case Reports and Review of the Literature by Isabel Tena, Garima Gupta, Marcos Tajahuerce, Marta Benavent, Manuel Cifrián, Alejandro Falcon, María Fonfria, Maribel del Olmo, Rosa Reboll, Antonio Conde, Francisca Moreno, Julia Balaguer, Adela Cañete, Rosana Palasí, Pilar Bello, Alfredo Marco, José Luis Ponce, Juan Francisco Merino, Antonio Llombart, Alfredo Sanchez and Karel Pacak in Clinical Medicine Insights: Oncology\n\n The authors would like to thank the PHEiPAS Alliance and the NIH for their support with patient care. They thank BioSequence SL, Valencia, Spain, for using the OncoDEEP solution (OncoDNA SA, Gosselies, Belgium) for performing genomic profiling of the paraffin-embedded metastatic tumor tissue from the 2 patients.\n\nFunding:The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Spanish Society of Medical Oncology (SEOM grant for 2 years in a foreign reference center, 2015) and the PHEiPAS patient Alliance (2016).\n\nDeclaration of Conflicting Interests:The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nAuthors Contributions: IT and GG analyzed the data, wrote the first draft of the manuscript, and jointly developed the structure and arguments for the paper. IT, GG, and KP contributed to the writing of the manuscript. IT, GG, MT, MB, MC, AF, MF, MdO, RR, AC, FM, JB, AC, RP, AM, JP, JFM, AS, AL, and KP agree with manuscript results and conclusions and made critical revisions and approved final version. All authors reviewed and approved the final manuscript.\n==== Refs\nReferences\n1 \nEisenhofer G Bornstein SR Brouwers FM et al \nMalignant pheochromocytoma: current status and initiatives for future progress . Endocr Relat Cancer . 2004 ;11 :423 –436 .15369446 \n2 \nGimenez-Roqueplo AP Favier J Rustin P et al \nMutations in the SDHB gene are associated with extra-adrenal and/or malignant phaeochromocytomas . Cancer Res . 2003 ;63 :5615 –5621 .14500403 \n3 \nAyala-Ramirez M Feng L Johnson MM et al \nClinical risk factors for malignancy and overall survival in patients with pheochromocytomas and sympathetic paragangliomas: primary tumor size and primary tumor location as prognostic indicators . J Clin Endocrinol Metab . 2011 ;96 :717 –725 .21190975 \n4 \nJimenez C Rohren E Habra MA et al \nCurrent and future treatments for malignant pheochromocytoma and sympathetic paraganglioma . Curr Oncol Rep . 2013 ;15 :356 –371 .23674235 \n5 \nBurnichon N Buffet A Gimenez-Roqueplo AP. \nPheochromocytoma and paraganglioma: molecular testing and personalized medicine . Curr Opin Oncol . 2016 ;28 :5 –10 .26599293 \n6 \nGimenez-Roqueplo AP Dahia PL Robledo M. \nAn update on the genetics of paraganglioma, pheochromocytoma, and associated hereditary syndromes . Horm Metab Res . 2012 ;44 :328 –333 .22328163 \n7 \nMercado-Asis LB Wolf KI Jochmanova I Taieb D. \nPheochromocytoma: a genetic and diagnostic update . Endocr Pract . 2017 ;24 :78 –90 .29144820 \n8 \nAmar L Bertherat J Baudin E et al \nGenetic testing in pheochromocytoma or functional paraganglioma . J Clin Oncol . 2005 ;23 :8812 –8818 .16314641 \n9 \nNeumann HP Pawlu C Peczkowska M et al \nDistinct clinical features of paraganglioma syndromes associated with SDHB and SDHD gene mutations . JAMA . 2004 ;292 :943 –951 .15328326 \n10 \nSelak MA Armour SM MacKenzie ED et al \nSuccinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase . Cancer Cell . 2005 ;7 :77 –85 .15652751 \n11 \nPollard PJ Briere JJ Alam NA et al \nAccumulation of Krebs cycle intermediates and over-expression of HIF1alpha in tumours which result from germline FH and SDH mutations . Hum Mol Genet . 2005 ;14 :2231 –2239 .15987702 \n12 \nShweiki D Itin A Soffer D Keshet E. \nVascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis . Nature . 1992 ;359 :843 –845 .1279431 \n13 \nForsythe JA Jiang BH Iyer NV et al \nActivation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1 . Mol Cell Biol . 1996 ;16 :4604 –4613 .8756616 \n14 \nLetouze E Martinelli C Loriot C et al \nSDH mutations establish a hypermethylator phenotype in paraganglioma . Cancer Cell . 2013 ;23 :739 –752 .23707781 \n15 \nLoriot C Burnichon N Gadessaud N et al \nEpithelial to mesenchymal transition is activated in metastatic pheochromocytomas and paragangliomas caused by SDHB gene mutations . J Clin Endocrinol Metab . 2012 ;97 :E954 –E962 .22492777 \n16 \nTanabe A Naruse M Nomura K Tsuiki M Tsumagari A Ichihara A. \nCombination chemotherapy with cyclophosphamide, vincristine, and dacarbazine in patients with malignant pheochromocytoma and paraganglioma . Horm Cancer . 2013 ;4 :103 –110 .23361939 \n17 \nPatel SR Winchester DJ Benjamin RS. \nA 15-year experience with chemotherapy of patients with paraganglioma . Cancer . 1995 ;76 :1476 –1480 .8620426 \n18 \nHuang H Abraham J Hung E et al \nTreatment of malignant pheochromocytoma/paraganglioma with cyclophosphamide, vincristine, and dacarbazine: recommendation from a 22-year follow-up of 18 patients . Cancer . 2008 ;113 :2020 –2028 .18780317 \n19 \nDeutschbein T Fassnacht M Weismann D Reincke M Mann K Petersenn S. \nTreatment of malignant phaeochromocytoma with a combination of cyclophosphamide, vincristine and dacarbazine: own experience and overview of the contemporary literature . Clin Endocrinol (Oxf) . 2015 ;82 :84 –90 .25143180 \n20 \nAyala-Ramirez M Feng L Habra MA et al \nClinical benefits of systemic chemotherapy for patients with metastatic pheochromocytomas or sympathetic extra-adrenal paragangliomas: insights from the largest single-institutional experience . Cancer . 2012 ;118 :2804 –2812 .22006217 \n21 \nAverbuch SD Steakley CS Young RC et al \nMalignant pheochromocytoma: effective treatment with a combination of cyclophosphamide, vincristine, and dacarbazine . Ann Intern Med . 1988 ;109 :267 –273 .3395037 \n22 \nAsai S Katabami T Tsuiki M Tanaka Y Naruse M. \nControlling tumor progression with cyclophosphamide, vincristine, and dacarbazine treatment improves survival in patients with metastatic and unresectable malignant pheochromocytomas/paragangliomas . Horm Cancer . 2017 ;8 :108 –118 .28108930 \n23 \nHadoux J Favier J Scoazec JY et al \nSDHB mutations are associated with response to temozolomide in patients with metastatic pheochromocytoma or paraganglioma . Int J Cancer . 2014 ;135 :2711 –2720 .24752622 \n24 \nKulke MH Hornick JL Frauenhoffer C et al \nO6-methylguanine DNA methyltransferase deficiency and response to temozolomide-based therapy in patients with neuroendocrine tumors . Clin Cancer Res . 2009 ;15 :338 –345 .19118063 \n25 \nHegi ME Diserens AC Gorlia T et al \nMGMT gene silencing and benefit from temozolomide in glioblastoma . N Engl J Med . 2005 ;352 :997 –1003 .15758010 \n26 \nBrandes AA Tosoni A Cavallo G et al \nTemozolomide 3 weeks on and 1 week off as first-line therapy for recurrent glioblastoma: phase II study from gruppo italiano cooperativo di neuro-oncologia (GICNO) . Br J Cancer . 2006 ;95 :1155 –1160 .17024124 \n27 \nPiedbois P Rougier P Buyse M et al ; Meta-analysis Group in Cancer . Efficacy of intravenous continuous infusion of fluorouracil compared with bolus administration in advanced colorectal cancer . J Clin Oncol . 1998 ;16 :301 –308 .9440757 \n28 \nMuthusamy P Chary KV Nalini GK. \nMetronomic chemotherapy: seems prowess to battle against cancer in current scenario . J Clin Diagn Res . 2016 ;10 :FC09 –FC13 .\n29 \nKelley RK Hwang J Magbanua MJ et al \nA phase 1 trial of imatinib, bevacizumab, and metronomic cyclophosphamide in advanced colorectal cancer . Br J Cancer . 2013 ;109 :1725 –1734 .24022191 \n30 \nJellvert A Lissbrant IF Edgren M et al \nEffective oral combination metronomic chemotherapy with low toxicity for the management of castration-resistant prostate cancer . Exp Ther Med . 2011 ;2 :579 –584 .22977543 \n31 \nKlement G Baruchel S Rak J et al \nContinuous low-dose therapy with vinblastine and VEGF receptor-2 antibody induces sustained tumor regression without overt toxicity . J Clin Invest . 2000 ;105 :R15 –R24 .10772661 \n32 \nHao YB Yi SY Ruan J Zhao L Nan KJ. \nNew insights into metronomic chemotherapy-induced immunoregulation . Cancer Lett . 2014 ;354 :220 –226 .25168479 \n33 \nBissell MJ Hines WC. \nWhy don’t we get more cancer? a proposed role of the microenvironment in restraining cancer progression . Nat Med . 2011 ;17 :320 –329 .21383745 \n34 \nKim JJ Tannock IF. \nRepopulation of cancer cells during therapy: an important cause of treatment failure . Nature reviews Cancer . 2005 ;5 :516 –525 .15965493 \n35 \nKaneno R Shurin GV Kaneno FM Naiditch H Luo J Shurin MR. \nChemotherapeutic agents in low noncytotoxic concentrations increase immunogenicity of human colon cancer cells . Cell Oncol (Dordr) . 2011 ;34 :97 –106 .21290210 \n36 \nKovacs JA Masur H. \nProphylaxis against opportunistic infections in patients with human immunodeficiency virus infection . N Engl J Med . 2000 ;342 :1416 –1429 .10805828 \n37 \nStrosberg JR Fine RL Choi J et al \nFirst-line chemotherapy with capecitabine and temozolomide in patients with metastatic pancreatic endocrine carcinomas . Cancer . 2011 ;117 :268 –275 .20824724 \n38 \nTrivedi RN Almeida KH Fornsaglio JL Schamus S Sobol RW. \nThe role of base excision repair in the sensitivity and resistance to temozolomide-mediated cell death . Cancer Res . 2005 ;65 :6394 –6400 .16024643 \n39 \nTentori L Graziani G. \nPharmacological strategies to increase the antitumor activity of methylating agents . Curr Med Chem . 2002 ;9 :1285 –1301 .12052167 \n40 \nLiu L Taverna P Whitacre CM Chatterjee S Gerson SL. \nPharmacologic disruption of base excision repair sensitizes mismatch repair-deficient and -proficient colon cancer cells to methylating agents . Clin Cancer Res . 1999 ;5 :2908 –2917 .10537360 \n41 \nRoos WP Batista LF Naumann SC et al \nApoptosis in malignant glioma cells triggered by the temozolomide-induced DNA lesion O6-methylguanine . Oncogene . 2007 ;26 :186 –197 .16819506 \n42 \nBignami M O’Driscoll M Aquilina G Karran P. \nUnmasking a killer: DNA O(6)-methylguanine and the cytotoxicity of methylating agents . Mutat Res . 2000 ;462 :71 –82 .10767619 \n43 \nPegg AE Dolan ME Moschel RC. \nStructure, function, and inhibition of O6-alkylguanine-DNA alkyltransferase . Prog Nucleic Acid Res Mol Biol . 1995 ;51 :167 –223 .7659775 \n44 \nHegi ME Liu L Herman JG et al \nCorrelation of O6-methylguanine methyltransferase (MGMT) promoter methylation with clinical outcomes in glioblastoma and clinical strategies to modulate MGMT activity . J Clin Oncol . 2008 ;26 :4189 –4199 .18757334 \n45 \nYang M Pollard PJ. \nSuccinate: a new epigenetic hacker . Cancer Cell . 2013 ;23 :709 –711 .23763995 \n46 \nNoushmehr H Weisenberger DJ Diefes K et al \nIdentification of a CpG island methylator phenotype that defines a distinct subgroup of glioma . Cancer Cell . 2010 ;17 :510 –522 .20399149 \n47 \nHanahan D Weinberg RA. \nHallmarks of cancer: the next generation . Cell . 2011 ;144 :646 –674 .21376230 \n48 \nWatts GS Pieper RO Costello JF Peng YM Dalton WS Futscher BW. \nMethylation of discrete regions of the O6-methylguanine DNA methyltransferase (MGMT) CpG island is associated with heterochromatinization of the MGMT transcription start site and silencing of the gene . Mol Cell Biol . 1997 ;17 :5612 –5619 .9271436 \n49 \nEsteller M Hamilton SR Burger PC Baylin SB Herman JG. \nInactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia . Cancer Res . 1999 ;59 :793 –797 .10029064 \n50 \nPerry JR Belanger K Mason WP et al \nPhase II trial of continuous dose-intense temozolomide in recurrent malignant glioma: RESCUE study . J Clin Oncol . 2010 ;28 :2051 –2057 .20308655 \n51 \nGalldiks N Berhorn T Blau T Dunkl V Fink GR Schroeter M. \n“One week on-one week off”: efficacy and side effects of dose-intensified temozolomide chemotherapy: experiences of a single center . J Neurooncol . 2013 ;112 :209 –215 .23299464 \n52 \nWick A Felsberg J Steinbach JP et al \nEfficacy and tolerability of temozolomide in an alternating weekly regimen in patients with recurrent glioma . J Clin Oncol . 2007 ;25 :3357 –3361 .17664483 \n53 \nSu YB Sohn S Krown SE et al \nSelective CD4+ lymphopenia in melanoma patients treated with temozolomide: a toxicity with therapeutic implications . J Clin Oncol . 2004 ;22 :610 –616 .14726505 \n54 \nMiddleton MR Lee SM Arance A Wood M Thatcher N Margison GP. \nO6-methylguanine formation, repair protein depletion and clinical outcome with a 4 hr schedule of temozolomide in the treatment of advanced melanoma: results of a phase II study . Int J Cancer . 2000 ;88 :469 –473 .11054678 \n55 \nLee SM Thatcher N Crowther D Margison GP. \nInactivation of O6-alkylguanine-DNA alkyltransferase in human peripheral blood mononuclear cells by temozolomide . Br J Cancer . 1994 ;69 :452 –456 .8123472 \n56 \nClarke JL Iwamoto FM Sul J et al \nRandomized phase II trial of chemoradiotherapy followed by either dose-dense or metronomic temozolomide for newly diagnosed glioblastoma . J Clin Oncol . 2009 ;27 :3861 –3867 .19506159 \n57 \nKerbel RS Kamen BA. \nThe anti-angiogenic basis of metronomic chemotherapy . Nat Rev Cancer . 2004 ;4 :423 –436 .15170445 \n58 \nTolcher AW Gerson SL Denis L et al \nMarked inactivation of O6-alkylguanine-DNA alkyltransferase activity with protracted temozolomide schedules . Br J Cancer . 2003 ;88 :1004 –1011 .12671695 \n59 \nCominelli M Grisanti S Mazzoleni S et al \nEGFR amplified and overexpressing glioblastomas and association with better response to adjuvant metronomic temozolomide . J Nat Cancer Inst . 2015 ;107 :djv041 .25739547 \n60 \nGillon P Godbert Y Dupin C Bubien V Italiano A Roubaud G. \nLong clinical benefit achieved in two patients with malignant paraganglioma treated by metronomic cyclophosphamide . Future Oncol . 2014 ;10 :2121 –2125 .25471026\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1179-5549",
"issue": "12()",
"journal": "Clinical Medicine Insights. Oncology",
"keywords": "Paraganglioma; SDHB; metastatic; metronomic; temozolomide",
"medline_ta": "Clin Med Insights Oncol",
"mesh_terms": null,
"nlm_unique_id": "101525771",
"other_id": null,
"pages": "1179554918763367",
"pmc": null,
"pmid": "29720885",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "16819506;9440757;12671695;12052167;10805828;18780317;11054678;18757334;25739547;20308655;17024124;25471026;16314641;15965493;15369446;16024643;22492777;29144820;14726505;22977543;15328326;23299464;10537360;14500403;10772661;21376230;10767619;8620426;20824724;26599293;21290210;8756616;19506159;23361939;20399149;25143180;21383745;15652751;1279431;23674235;23707781;17664483;8123472;22328163;24022191;7659775;9271436;21190975;22006217;15758010;24752622;28050393;15170445;10029064;15987702;28108930;23763995;3395037;25168479;19118063",
"title": "Successful Second-Line Metronomic Temozolomide in Metastatic Paraganglioma: Case Reports and Review of the Literature.",
"title_normalized": "successful second line metronomic temozolomide in metastatic paraganglioma case reports and review of the literature"
} | [
{
"companynumb": "ES-MYLANLABS-2018M1075308",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TEMOZOLOMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Sunitinib, an oral vascular endothelial growth factor receptor, is a first-line option for metastatic renal cell carcinoma and widely used in clinical practice. Despite the proven benefit of sunitnib in metastatic renal cell carcinoma, patients may suffer from a variety of adverse events including hypertension, fatigue, hypothyroidism, hand-foot skin reactions, rash, depigmentation, and myelosuppression. Myelosuppression is usually mild, transient and resolves during the two weeks at the end of each cycle where no drug is taken. We present a case of severe and early grade 3 neutropenia and thrombocytopenia occurring two weeks into a six-week cycle. Because of the extreme nature of the toxicity, CYP 3A4 polymorphisms were explored. The patient was found to be heterozygous for CYP 3A4*22, at least partially explaining the early-onset and severity of myelosuppression. This pharmacogenetics information resulted in a rechallenge of dose-reduced sunitinib, which was well tolerated by the patient. The current state of pharmacogenomics concerning sunitinb is also presented, and the need for greater research in this area is highlighted.",
"affiliations": "1 Quillen College of Medicine, East Tennessee State University, Johnson City, TN, USA.;2 Division of Hematology/Oncology, Department of Internal Medicine, Quillen College of Medicine, East Tennessee State University, Johnson City, TN, USA.;3 Owensboro Health, Owensboro, KY, USA.;2 Division of Hematology/Oncology, Department of Internal Medicine, Quillen College of Medicine, East Tennessee State University, Johnson City, TN, USA.;4 Department of Pharmacy Practice, Gatton College of Pharmacy, East Tennessee State University, Johnson City, TN, USA.",
"authors": "Patel|Nirav D|ND|;Chakrabory|Kanishka|K|;Messmer|Garrett|G|;Krishnan|Koyamangalath|K|;Bossaer|John B|JB|",
"chemical_list": "D000970:Antineoplastic Agents; D051544:Cytochrome P-450 CYP3A; C510163:CYP3A4 protein, human; D000077210:Sunitinib",
"country": "England",
"delete": false,
"doi": "10.1177/1078155217724863",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "24(8)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "CYP 3A4; Sunitinib; myelosuppression; pharmacogenetic; polymorphism",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000970:Antineoplastic Agents; D002292:Carcinoma, Renal Cell; D051544:Cytochrome P-450 CYP3A; D005260:Female; D006801:Humans; D007680:Kidney Neoplasms; D008875:Middle Aged; D009503:Neutropenia; D012720:Severity of Illness Index; D000077210:Sunitinib",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "623-626",
"pmc": null,
"pmid": "28782406",
"pubdate": "2018-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe sunitinib-induced myelosuppression in a patient with a CYP 3A4 polymorphism.",
"title_normalized": "severe sunitinib induced myelosuppression in a patient with a cyp 3a4 polymorphism"
} | [
{
"companynumb": "US-PFIZER INC-2017346280",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CHOLECALCIFEROL"
},
"drugadditional": null,
... |
{
"abstract": "Uterine serous carcinoma is a rare, high-risk histological subtype of endometrial cancer, and use of adjuvant treatment in early stage IA disease is inconsistent, especially when the tumor is confined entirely within an endometrial polyp. We herein present a case of extrauterine recurrence in a 67-year-old female with polyp-confined, stage IA uterine serous endometrial cancer. She underwent comprehensive surgical staging with the pathology returning a 5 cm uterine serous carcinoma confined completely to a 7 cm polyp with negative margins, negative myometrial and lymphovascular space invasion, and twenty-nine negative para-aortic and pelvic lymph nodes. She went on to complete six cycles of adjuvant carboplatin and paclitaxel. She presented with a new pleural effusion approximately 20 months after receiving definitive treatment, and a diagnosis of recurrent, metastatic uterine serous carcinoma was confirmed through cytology. A review of the literature suggests practice patterns involving adjuvant treatment for polyp-confined stage IA uterine serous carcinoma are highly variable. Prospective studies clarifying the utility of adjuvant treatment for polyp-confined disease in comprehensively staged patients, especially pertaining to the impact this pathology has on recurrence risk, are needed for these patients.",
"affiliations": "Virginia Commonwealth University School of Medicine, Richmond, VA 23219, United States.;Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Anne Arundel Medical Center, Annapolis, MD 21401, United States.;Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Virginia Commonwealth University Health System, Richmond, VA 23219, United States.",
"authors": "Welp|Annalyn|A|;Temkin|Sarah|S|;Sullivan|Stephanie|S|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.gore.2019.100512",
"fulltext": "\n==== Front\nGynecol Oncol RepGynecol Oncol RepGynecologic Oncology Reports2352-5789Elsevier S2352-5789(19)30101-810.1016/j.gore.2019.100512100512Case ReportDistant recurrence in a patient with polyp-confined stage IA serous endometrial carcinoma treated with adjuvant chemotherapy: A case report and review of literature Welp Annalyn aTemkin Sarah cSullivan Stephanie stephanie.a.sullivan@vcuhealth.orgb⁎a Virginia Commonwealth University School of Medicine, Richmond, VA 23219, United Statesb Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Virginia Commonwealth University Health System, Richmond, VA 23219, United Statesc Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Anne Arundel Medical Center, Annapolis, MD 21401, United States⁎ Corresponding author at: Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Virginia Commonwealth University Medical Center, 1250 E. Marshall Street, Richmond, VA 23219, United States. stephanie.a.sullivan@vcuhealth.org05 11 2019 2 2020 05 11 2019 31 10051210 9 2019 15 10 2019 20 10 2019 © 2019 The Authors2019This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Highlights\n• Uterine serous carcinoma is a high-risk endometrial cancer; adjuvant treatment in stage IA disease is controversial.\n\n• Patients with stage IA polyp-confined disease are inconsistently managed.\n\n• The impact of adjuvant treatment on recurrence outcomes for polyp-confined stage IA disease is unclear.\n\n\n\nUterine serous carcinoma is a rare, high-risk histological subtype of endometrial cancer, and use of adjuvant treatment in early stage IA disease is inconsistent, especially when the tumor is confined entirely within an endometrial polyp. We herein present a case of extrauterine recurrence in a 67-year-old female with polyp-confined, stage IA uterine serous endometrial cancer. She underwent comprehensive surgical staging with the pathology returning a 5 cm uterine serous carcinoma confined completely to a 7 cm polyp with negative margins, negative myometrial and lymphovascular space invasion, and twenty-nine negative para-aortic and pelvic lymph nodes. She went on to complete six cycles of adjuvant carboplatin and paclitaxel. She presented with a new pleural effusion approximately 20 months after receiving definitive treatment, and a diagnosis of recurrent, metastatic uterine serous carcinoma was confirmed through cytology. A review of the literature suggests practice patterns involving adjuvant treatment for polyp-confined stage IA uterine serous carcinoma are highly variable. Prospective studies clarifying the utility of adjuvant treatment for polyp-confined disease in comprehensively staged patients, especially pertaining to the impact this pathology has on recurrence risk, are needed for these patients.\n\nKeywords\nUterusSerousMetastasisAdjuvant treatmentPolyp\n==== Body\n1 Introduction\nEndometrial cancers are the most common gynecologic malignancy in the United States. Uterine serous carcinoma (USC), a high-risk histological subtype “type II” endometrial cancer represents approximately 10% of endometrial cancers yet portends a significantly poorer prognosis than other subtypes. Adjuvant treatment after comprehensive surgical staging for early stage disease is controversial, though conclusions drawn from limited studies and guidelines from professional societies urge providers to carefully consider systemic therapy irrespective of age or stage (Boruta Ii et al., 2009, NCCN Guidelines, 2019). Despite this many women fail to receive adjuvant therapy (Liang et al., 2016, Chang-Halpenny et al., 2013).\n\nUSC involved or confined within endometrial polyps in a comprehensively staged patient are a rarer clinical scenario. Unsurprisingly, balancing treatment morbidity with the disease control and survival benefits of adjuvant chemotherapy in a stage IA polyp-confined aggressive cancer has proven difficult owning to the lack of prospective studies, low incidence, heterogenous adjuvant treatment regimens, and variable recurrence data. Therefore, it is not uncommon for providers and patients to decide upon expectant management for such cases (Liang et al., 2016, Chang-Halpenny et al., 2013). However, here we describe the unusual presentation of a patient B.G. with stage IA polyp-confined USC treated with adjuvant chemotherapy who presented with distant recurrent disease.\n\n2 Case report\nIn 2016, our then 67-year-old patient presented to her gynecologic oncologist for postmenopausal bleeding and had undergone a work-up resulting in the diagnosis of serous endometrial carcinoma. Her past medical history was notable for colon cancer, status post resection in 2005 with negative genetic testing for microsatellite instability; essential hypertension, and obesity. She has no known first-degree family history of colon, breast, ovarian, or endometrial cancers.\n\nIn 10/2016, she underwent comprehensive cancer staging with a robotic-assisted total laparoscopic hysterectomy, bilateral salpingo-oophorectomy, pelvic and para-aortic lymphadenectomy. Her initial pathology returned a 5 cm high-grade serous carcinoma contained completely within a 7 cm endometrial polyp. Notably, no lymphovascular or myometrial invasion was identified, all margins were negative, and all of the pathologic specimens, including 24 pelvic and 5 para-aortic lymph nodes, were negative for tumor. She was consequently diagnosed with International Federation of Gynecology and Obstetrics (FIGO) stage IA (T1aN0MX) USC confined to a uterine polyp, and began adjuvant treatment with 6 cycles of carboplatin and paclitaxel, completing her final cycle in 1/2017. In 9/2018, she returned to her gynecologic oncologist with complaints of shortness of breath. A PET scan shortly thereafter noted a new right pleural effusion, and a CA-125 drawn at this time was notable for an increase to 205. She was diagnosed with presumed recurrence and her gynecologic oncologist began salvage treatment with paclitaxel, carboplatin, and bevacizumab. She completed 3 cycles of therapy with moderate toxicity and follow up CT scans of the chest, abdomen and pelvis were performed. These scans were negative for any residual disease, and decision was made for observation, follow-up, and repeat imaging in 3 months. She was also referred to cardiology to rule out cardiac etiologies for the pleural effusion, and was subsequently diagnosed with heart failure and started on the appropriate medications. Her next scan in 2/2019 was suspicious for progression with mediastinal adenopathy, but aspirate samples taken from the lymph node were negative for malignant cells. Again, tumor board advised continued expectant management and follow-up scans in 3 months.\n\nWhen she returned in 5/2019, her repeat scans noted an enlarging right pleural effusion and a thoracentesis was performed. Cytology returned positive for recurrent metastatic high-grade USC. She proceeded with 3 cycles of carboplatin and paclitaxel administered from 5 to 7/2019, complicated by an infusion reaction to carboplatin, transaminitis, grade 2 neuropathy, and unchanged CA-125 levels - overall poorly tolerated. She is currently receiving single agent bevacizumab with stable disease on recent 10/2019 CT scans.\n\n3 Discussion\nThe adjuvant treatment of endometrial cancer is determined by stage and uterine factors, with early stage, low risk endometrial cancers not requiring adjuvant therapy (Boruta Ii et al., 2009). Advanced stage or high risk histology frequently require adjuvant therapy in the form of chemotherapy, radiation therapy or both. The presence of lymph node metastasis is the most important prognostic factor for endometrial cancer, thus staging with lymph node evaluation is critical to adjuvant treatment planning. Despite the importance of this information, there is evidence of incomplete staging in routine practice (Mandato et al., 2019). USC is unique from endometrioid histology in that the significance of uterine factors such as depth of myometrial invasion and primary tumor size are less reliable for predicting lymph node metastasis (Boruta Ii et al., 2009). Overall, USC demonstrate higher rates of recurrence and a tendency for distant, extrauterine metastases compared to other subtypes of endometrial cancers (Boruta Ii et al., 2009, Chang-Halpenny et al., 2013). Beyond surgical staging, there is no consensus on standard adjuvant treatment for stage IA USC, and patients are usually treated variably with observation, platinum/taxane-based adjuvant chemotherapy, radiation, or multimodal therapy (Boruta Ii et al., 2009, NCCN Guidelines, 2019). USC confined within an endometrial polyp with comprehensive staging complicates an already controversial treatment paradigm.\n\nA literature review was undertaken to identify outcomes reported in patients with stage IA polyp-limited USC. A literature search was performed by querying PubMed articles published through August 2019 using the search term “uterine AND serous AND polyp,” yielding 66 articles. Titles and abstracts were reviewed to identify publications for a full text review, and bibliographies of included studies were assessed for literature that may have been missed in the initial search. Studies were included if they provided staging information, adjuvant treatment and outcome details for polyp-confined stage IA USC.\n\nSeven investigations were identified as reporting on stage IA, polyp-limited USC, with 160 patients included. Of these, three studies required complete comprehensive staging in their inclusion criteria, while the remaining four reported rates of complete surgical staging ranging from 9 to 63% (Table 1) with about half of the cohort having had complete surgical staging. The study that reported the lowest rate of complete staging required inclusion of an omentectomy, which is generally seen as unnecessary in routine surgical staging of USC given the high sensitivity of a visually negative omentum (Mandato et al., 2019, Gehrig et al., 2019). Adjuvant treatment varied between investigation; 30.6–80% of patients underwent observation only, 6–36% of patients received chemotherapy alone, 12–100% of patients received some form of chemoradiation, and 2–24.5% of patients received radiation therapy alone (Table 1). The proportion of patients receiving chemoradiation is likely inflated, as three of the studies did not differentiate between patients who received radiation in addition to chemotherapy, and one study incorporated receipt of chemoradiation into its inclusion criteria.Table 1 Summary of study characteristics and use of adjuvant treatment in Stage IA polyp-limited uterine serous carcinoma.\n\nAuthor (Year)\tLocation & date range\tStudy population\tStage I (# polyp-limited Stage IA USC)\tComprehensively staged, n (%)a\tAdjuvant treatment in polyp-limited stage IA patients, n (%)\tRecurrence by adjuvant treatmentb, n (%)\t\nFader et al. (2009)\tMulti-institution;1993–2006\tStage I patients who were comprehensively staged with at least 10% USC in pathology\t142 (n = 19)\t142 (100)\tOBS: 9 (47.4)\nCT ± RT: 7 (36.8)\nRT (WPRT, VBT, both): 3 (15.8)\tOBS: n = 1/19 (5.3)\t\nKiess et al. (2012)\tSingle Institution;2000–2009\tStage I-II patients with USC who underwent comprehensive staging, treated w/ carboplatin + paclitaxel and VBT\t34 (n = 5)\t34 (100)\tCT + VBT: 5 (100)\t0\t\nSemaan et al. (2013)\tMulti-institution;1992–2011\tAll patients with USC confined to the endometrium without MMI\t44 (n = 11)\tComplete: 33 (60)\nIncomplete/None: 22 (40)c\tOBS: 4 (36.4)\nCT: 4 (36.4)\nUnavailable info: 3 (27.2)\t0\t\nChang-Halpenny et al. (2013)\tSingle institution;1997–2011\tStage IA patients with USC or clear cell carcinoma confined to or involving a polyp\t51 (n = 32)\tComplete: 32 (63)\nIncomplete: 10 (20)\nNone: 9 (18)\tOBS: 41 (80)\nCT + RT: 6 (12)\nCT: 3 (6)\nVBT: 1 (2)d\tOBS: n = 3/32 (9.4)\t\nHanley, et al. (2016)\tMulti-institution;2000–2013\tStage IA patients with USC confined to polyp with no LVSI/MMI\t33 (n = 33)\tComplete: 3 (9)\nIncomplete: 27 (82)\nNone: 3 (9)\tOBS: 11 (33.3)\nCT: 13 (39.4)\nRT: 7 (21.2)\nCT + RT: 2 (6)\tOBS: n = 3/33 (9)\nRT: n = 1/33 (3)\nCT + RT: n = 2/33 (6)\t\nLiang et al. (2016)\tSingle institution;1995–2012\tStage IA polyp-limited or endometrium-limited Type IIe cancers with no LVSI/MMI\t85 (n = 49)f\t85 (100)\tOBS: 15 (30.6)\nCT ± RT: 22 (44.9)\nRT (WPRT or VBT): 12 (24.5)\tCT + VBT: n = 2/49 (4.1)\nVBT: n = 1/49 (2)\t\nMandato et al. (2019)\tMulti-institution;2003–2013\tAll patients with USC confined to or involving a polyp\t66 (n = 11)\tComplete: 27 (41)\nIncomplete: 29 (44)\nNone: 10 (15)\tOBS: 6 (54.5)\nCT ± RT: 5 (45.5)\tOBS: n = 2/11 (18.2)g\t\nAbbreviations: CT, chemotherapy; OBS, observation; LVSI, lymphovascular space invasion; MMI, myometrial invasion; RT, radiation therapy; USC, uterine serous carcinoma; VBT, vaginal brachytherapy; WPRT, whole pelvic radiation therapy.\n\na “Comprehensively staged” defined as hysterectomy, bilateral salpingo-oophorectomy, and pelvic and para-aortic lymph node assessment (Guidelines, 2019), numbers provided indicate proportions of patients who were comprehensively staged over the total cohort, not just IA polyp-limited disease.\n\nb Recurrence by adjuvant treatment is only reported for patients with study-confirmed stage IA polyp-limited disease.\n\nc Proportion of comprehensively staged patients for the entire study cohort (n = 55); this study did not stratify staging by stage, though n = 44 were stage I.\n\nd This study did not stratify type of adjuvant treatment by polyp-limited versus polyp-involved disease.\n\ne Type II cancers include Grade 3 endometroid, serous, clear cell, or high-grade mixed histology.\n\nf Of the patients with polyp-limited Stage IA disease, this paper did not specify how many polyp-limited patients were USC histology. Of note, 65.9% of the study’s cohort was pure serous histology (Liang et al., 2016).\n\ng Both patients who developed a recurrence had not undergone comprehensive staging.\n\n\n\nOf the patients similar to our patient B.G. with polyp confined, surgically staged USC, thirteen of these patients developed recurrence, with six patients recurring despite receipt of adjuvant treatment (Table 2). The recurrence data for the patients cited in the study by Mandato and colleagues was not detailed in Table 2 because these patients had not been surgically staged (Mandato et al., 2019). Additionally, a majority of the patients that did recur presented with extra-pelvic metastases. Recurrence rates among all stage IA patients have been reported ranging from 9.3 to 15.8%, and one study examining USC across all stages failed to find any significant difference in overall survival or progression-free survival between tumors confined to a polyp versus tumors confined to the endometrium (Mandato et al., 2019, Fader et al., 2009, Semaan et al., 2013). The significance of polyp-limited disease in comprehensively staged patients and adjuvant treatment on outcomes in USC represents an important opportunity for future study.Table 2 Treatment and recurrence details in surgically-staged patients with Stage IA polyp-limited USC.\n\nStudy\tAdjuvant treatment\tDFS\tTTR\tLocation of recurrence\t\nFader et al. (Fader et al., 2009)\tObs\t\t\tExtrapelvic\t\nChang-Halpenny et al. (Chang-Halpenny et al., 2013)\tObs\t3.40 yrs\t2.87 yrs\tPelvic side-wall\t\nChang-Halpenny et al. (Chang-Halpenny et al., 2013)\tObs\t4.48 yrs\t2.71 yrs\tPelvic and abdominal carcinomatosis, ascites\t\nChang-Halpenny et al. (Chang-Halpenny et al., 2013)\tObs\t7.92 yrs\t6.83 yrs\tPelvic & retroperitoneal lymphadenopathy, colon implants\t\nHanley et al. (Hanley et al., 2016)\tObs\t\t62 mo.\tUnknown\t\nHanley et al. (Hanley et al., 2016)\tObs\t\t13 mo.\tUnknown\t\nHanley et al. (Hanley et al., 2016)\tObs\t\t25 mo.\tUnknown\t\nHanley et al. (Hanley et al., 2016)\tRT\t\t35 mo.\tUnknown\t\nHanley et al. (Hanley et al., 2016)\tCT + RT\t\t26 mo.\tUnknown\t\nHanley et al. (Hanley et al., 2016)\tCT + RT\t\t25 mo.\tUnknown\t\nLiang et al. (Liang et al., 2016)\tCT + VBT\t\t9.9 mo\tLung\t\nLiang et al. (Liang et al., 2016)\tVBT\t\t6.4 mo\tMediastinal lymph nodes\t\nLiang et al. (Liang et al., 2016)\tCT + VBT\t\t69.8 mo\tHilar and aorto-pulmonary lymph nodes\t\nAbbreviations: CT, chemotherapy; DFS, disease-free survival; mo, months; Obs, observation; RT, radiation therapy; TTR, time to recurrence; USC, uterine serous carcinoma; VBT, vaginal brachytherapy; yrs, years.\n\na“Surgically-staged” patients include any patient who underwent surgical staging, including patients who were completely or incompletely staged.\n\n\n\nThere were several limitations appreciated in our analysis of the included studies. All the sample sizes were small; the largest analysis examined 49 patients with stage IA polyp-limited disease, but this study included clear cell histology (Liang et al., 2016). One additional study also included other high-grade histology in their analysis (Liang et al., 2016, Chang-Halpenny et al., 2013). However all of the chosen studies provided detailed information about recurrence, ensuring the data included in Table 2 was limited to Stage IA, polyp-limited USC. Four studies differed in their reporting of surgical staging; two papers required the inclusion of an omentectomy for comprehensive staging, and the remaining two studies reported only the proportions of their patients who had received a pelvic and/or para-aortic lymphadenectomy in addition to their hysterectomy and bilateral salpingo-oophorectomy (Mandato et al., 2019, Semaan et al., 2013, Kiess et al., 2012, Hanley et al., 2016). Finally, the authors acknowledge despite our best attempt to conduct a thorough and comprehensive review of the literature, there may be studies that were overlooked.\n\n4 Conclusion\nThis case report describes presentation of a patient with stage IA polyp-limited USC who was comprehensively staged with recurrence after adjuvant chemotherapy. A review of the literature demonstrates inconsistent management of patients with polyp-limited stage IA disease, with higher rates of recurrence observed in those who opt for expectant management versus adjuvant treatment, though the statistical significance of this association remains to be seen. Given a majority of the patients in the cohort of interest developed distant metastasis, treating polyp-confined patients as a “lower risk” subgroup of stage IA USC may be a mischaracterization of their disease. While the utility of adjuvant treatment may be controversial, comprehensive surgical staging should be offered to all women with this pathologic finding given the high risk of lymphatic involvement. This review highlights the inconsistent practice patterns and uncertainties that providers are faced with when making difficult treatment decisions with these patients. Quality research is needed to clarify optimal adjuvant treatment for all stage IA USC, and whether the presence of polyp-confined disease should alter management.\n\nAuthor contribution\nAnnalyn Welp: Investigation, Writing (Original Draft), Review & Editing; Stephanie Sullivan: Writing, Review & Editing, Supervision, Resources; Sarah Temkin: Review & Editing, Supervision.\n\nDeclaration of Competing Interest\nWe have no conflict of interest to declare.\n==== Refs\nReferences\nBoruta Ii, D.M., Gehrig, P.A., Fader, A.N., Olawaiye, A.B., 2009. Management of women with uterine papillary serous cancer: A Society of Gynecologic Oncology (SGO) review ☆. [cited 2019 Jun 17]; Available from: https://www.sgo.org/wp-content/uploads/2012/11/Management-of-Women-with-Uterine-Papillary-Serous-Cancer.pdf.\nChang-Halpenny C.N. Natarajan S. Hwang-Graziano J. Early stage papillary serous or clear cell carcinoma confined to or involving an endometrial polyp: outcomes with and without adjuvant therapy Gynecol. Oncol. [Internet] 131 3 2013 598 603 Dec [cited 2019 Jun 17]; Available from: http://www.ncbi.nlm.nih.gov/pubmed/24135679 \nFader A.N. Drake R.D. O’Malley D.M. Gibbons H.E. Huh W.K. Havrilesky L.J. Platinum/taxane-based chemotherapy with or without radiation therapy favorably impacts survival outcomes in stage I uterine papillary serous carcinoma Cancer [Internet] 115 10 2009 2119 2127 May 15 [cited 2019 Aug 4]; Available from: http://doi.wiley.com/10.1002/cncr.24247 \nGehrig P.A. Van Le L. Fowler W.C. The role of omentectomy during the surgical staging of uterine serous carcinoma Int. J. Gynecol. Cancer [Internet] 13 2 2019 212 215 [cited 2019 Aug 6]; Available from: http://www.ncbi.nlm.nih.gov/pubmed/12657126 \nHanley K.Z. Fadare O. Fisher K.E. Atkins K.A. Mosunjac M.B. Clinical significance of positive pelvic washings in uterine papillary serous carcinoma confined to an endometrial polyp Int. J. Gynecol. Pathol. [Internet] 35 3 2016 249 255 May [cited 2019 Aug 19]; Available from: http://www.ncbi.nlm.nih.gov/pubmed/26535985 \nKiess A.P. Damast S. Makker V. Kollmeier M.A. Gardner G.J. Aghajanian C. Five-year outcomes of adjuvant carboplatin/paclitaxel chemotherapy and intravaginal radiation for stage I–II papillary serous endometrial cancer Gynecol. Oncol. [Internet] 127 2 2012 321 325 Nov [cited 2019 Aug 4]; Available from: http://www.ncbi.nlm.nih.gov/pubmed/22850412 \nLiang L.W. Perez A.R. Cangemi N.A. Zhou Q. Iasonos A. Abu-Rustum N. An assessment of prognostic factors, adjuvant treatment, and outcomes of stage IA polyp-limited versus endometrium-limited type II endometrial carcinoma Int. J. Gynecol. Cancer [Internet] 26 3 2016 497 504 Mar [cited 2019 Jun 17], Available from: http://www.ncbi.nlm.nih.gov/pubmed/26825840 \nMandato V.D. Torricelli F. Palomba S. Uccella S. Pirillo D. Ciarlini G. Uterine papillary serous carcinoma arising in a polyp Am. J. Clin. Oncol. [Internet] 42 5 2019 472 480 May [cited 2019 Aug 4]; Available from: http://insights.ovid.com/crossref?an=00000421-201905000-00010 \nNCCN Guidelines, 2019. Uterine Neoplasms [Internet]. [cited 2019 Jun 18]. Available from: https://www.nccn.org/professionals/physician_gls/pdf/uterine.pdf.\nSemaan A. Mert I. Munkarah A.R. Bandyopadhyay S. Mahdi H.S. Winer I.S. Clinical and pathologic characteristics of serous carcinoma confined to the endometrium Int. J. Gynecol. Pathol. [Internet] 32 2 2013 181 187 Mar [cited 2019 Jun 18]; Available from: https://insights.ovid.com/crossref?an=00004347-201303000-00009\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2352-5789",
"issue": "31()",
"journal": "Gynecologic oncology reports",
"keywords": "Adjuvant treatment; Metastasis; Polyp; Serous; Uterus",
"medline_ta": "Gynecol Oncol Rep",
"mesh_terms": null,
"nlm_unique_id": "101652231",
"other_id": null,
"pages": "100512",
"pmc": null,
"pmid": "31890830",
"pubdate": "2020-02",
"publication_types": "D002363:Case Reports",
"references": "12657126;26535985;19306417;22850412;23370657;26825840;24135679;30973371",
"title": "Distant recurrence in a patient with polyp-confined stage IA serous endometrial carcinoma treated with adjuvant chemotherapy: A case report and review of literature.",
"title_normalized": "distant recurrence in a patient with polyp confined stage ia serous endometrial carcinoma treated with adjuvant chemotherapy a case report and review of literature"
} | [
{
"companynumb": "US-TEVA-2020-US-1178894",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Epidermolysis bullosa is a heterogeneous group of hereditary diseases characterised by extreme fragility of skin and mucosa, with blister and lesion formation spontaneously or in response to trauma. Anaesthetic management of these patients is challenging with respect to positioning, monitoring, use of medical devices and airway management. These challenges are increased when managing labour. We report an elective caesarean delivery in a nulliparous woman with autosomal recessive dystrophic epidermolysis bullosa, managed successfully with spinal anaesthesia.",
"affiliations": "Centro Hospitalar do Porto, Largo Prof. Abel Salazar, Porto, Portugal. Electronic address: martaclaudiaaraujo@gmail.com.;Centro Hospitalar do Porto, Largo Prof. Abel Salazar, Porto, Portugal.;Centro Hospitalar do Porto, Largo Prof. Abel Salazar, Porto, Portugal.;Centro Hospitalar do Porto, Largo Prof. Abel Salazar, Porto, Portugal.;Centro Hospitalar do Porto, Largo Prof. Abel Salazar, Porto, Portugal.",
"authors": "Araújo|M|M|;Brás|R|R|;Frada|R|R|;Guedes-Martins|L|L|;Lemos|P|P|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.ijoa.2017.01.010",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-289X",
"issue": "30()",
"journal": "International journal of obstetric anesthesia",
"keywords": "Caesarean delivery; Epidermolysis bullosa; Regional anaesthesia",
"medline_ta": "Int J Obstet Anesth",
"mesh_terms": "D000328:Adult; D000740:Anemia; D000773:Anesthesia, Obstetrical; D001768:Blister; D002585:Cesarean Section; D016108:Epidermolysis Bullosa Dystrophica; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D009407:Nerve Block; D010149:Pain, Postoperative; D011247:Pregnancy; D011248:Pregnancy Complications; D012867:Skin",
"nlm_unique_id": "9200430",
"other_id": null,
"pages": "68-72",
"pmc": null,
"pmid": "28258944",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Caesarean delivery in a pregnant woman with epidermolysis bullosa: anaesthetic challenges.",
"title_normalized": "caesarean delivery in a pregnant woman with epidermolysis bullosa anaesthetic challenges"
} | [
{
"companynumb": "PHHY2017PT095166",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METOCLOPRAMIDE"
},
"drugadditional": "3",
"d... |
{
"abstract": "Primary infected abdominal aortic aneurysm (AAA) is an uncommon presentation which can be associated with significant morbidity and mortality. In this report, we present 2 cases of infected AAAs less than 10 days after a transrectal ultrasound-guided (TRUS) prostate biopsy. A 63-year-old male presenting with sepsis and back pain 9 days after TRUS biopsy was found to have a 27-mm ectatic abdominal aorta which expanded to 59 mm in the course of a week, despite antibiotic therapy. He underwent successful surgical excision of the infected aortic aneurysm and reconstruction using a vein. A 55-year-old male presented similarly, 7 days after prostate biopsy with a 60-mm aortic aneurysm. His aneurysm ruptured 2 days before planned intervention-he did not survive an emergency repair. In both cases, aortic tissue biopsies confirmed growth of Escherichia coli. Preexistence of an aortic aneurysm was not known in either case as neither patient had imaging of the abdominal aorta. We postulate the pathophysiology was due to hematogenous spread.",
"affiliations": "Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand.;Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand. Electronic address: manar.khashram@gmail.com.;Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand.;Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand.;Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand.;Department of Vascular Surgery, Auckland City Hospital, Auckland, New Zealand.",
"authors": "Al-Ani|Haya Husam|HH|;Khashram|Manar|M|;Dean|Anastasia|A|;Bourchier|Russell|R|;Bhamidipaty|Venu|V|;Hill|Andrew|A|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.avsg.2019.05.021",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0890-5096",
"issue": "61()",
"journal": "Annals of vascular surgery",
"keywords": null,
"medline_ta": "Ann Vasc Surg",
"mesh_terms": "D000785:Aneurysm, Infected; D017544:Aortic Aneurysm, Abdominal; D001019:Aortic Rupture; D001416:Back Pain; D004927:Escherichia coli Infections; D017809:Fatal Outcome; D006801:Humans; D061705:Image-Guided Biopsy; D008297:Male; D008875:Middle Aged; D011467:Prostate; D012307:Risk Factors; D018805:Sepsis; D016896:Treatment Outcome; D018084:Ultrasonography, Interventional",
"nlm_unique_id": "8703941",
"other_id": null,
"pages": "469.e1-469.e4",
"pmc": null,
"pmid": "31382000",
"pubdate": "2019-11",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Infected Abdominal Aortic Aneurysm After Transrectal Ultrasound-Guided Biopsy of the Prostate: A Report of Two Cases.",
"title_normalized": "infected abdominal aortic aneurysm after transrectal ultrasound guided biopsy of the prostate a report of two cases"
} | [
{
"companynumb": "NZ-BAYER-2019-230053",
"fulfillexpeditecriteria": "1",
"occurcountry": "NZ",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Calciphylaxis is a life-threatening complication of end-stage kidney disease (ESKD) and leads to cutaneous necrosis and gangrene. Various risk factors for calciphylaxis have been reported, and warfarin therapy is a particularly strong trigger. Here we report the case of 50-year-old woman with ESKD and systemic lupus erythematosus who developed calciphylaxis after anti-thrombotic therapy, including warfarin, for ischemic skin ulcers due to arteriosclerosis obliterans and anti-phospholipid antibody syndrome. Although warfarin improved the thrombotic skin ulcers, it might also be a trigger for calciphylaxis. Discontinuation of the warfarin and the addition of low-density lipoprotein apheresis and sodium thiosulfate infusion failed to improve the gangrene; eventually, her legs had to be amputated to prevent lethal infection. The histology of the dermal and soft tissue obtained from the amputated legs showed typical findings of calciphylaxis. Warfarin is a vitamin K antagonist with inhibitory effects on the calcification of regulatory proteins, such as matrix Gla protein and fetuin-A. Therefore, the warfarin therapy might have induced calciphylaxis in our patient.",
"affiliations": "Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan. kfuruichi@m-kanazawa.jp.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Gastroenterology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.;Division of Nephrology, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa, 920-8641, Japan.",
"authors": "Shinozaki|Yasuyuki|Y|;Furuichi|Kengo|K|;Sagara|Akihiro|A|;Kitajima|Shinji|S|;Toyama|Tadashi|T|;Hara|Akinori|A|;Iwata|Yasunori|Y|;Sakai|Norihiko|N|;Shimizu|Miho|M|;Kaneko|Shuichi|S|;Wada|Takashi|T|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.1007/s13730-014-0161-y",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2192-4449",
"issue": "4(2)",
"journal": "CEN case reports",
"keywords": "Calciphylaxis; Sodium thiosulfate; Warfarin",
"medline_ta": "CEN Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101636244",
"other_id": null,
"pages": "169-173",
"pmc": null,
"pmid": "28509094",
"pubdate": "2015-11",
"publication_types": "D016428:Journal Article",
"references": "16507806;20601388;20636917;23291368;21744266;20716935;15504939;23036228;22121234;22962622",
"title": "Calciphylaxis induced by warfarin therapy in a patient with anti-phospholipid antibody syndrome associated with systemic lupus erythematosus.",
"title_normalized": "calciphylaxis induced by warfarin therapy in a patient with anti phospholipid antibody syndrome associated with systemic lupus erythematosus"
} | [
{
"companynumb": "JP-TEVA-622910ISR",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "WARFARIN"
},
"drugadditional": null,
"druga... |
{
"abstract": "BACKGROUND\nTrastuzumab-related cardiotoxicity has been reported in patients receiving trastuzumab concurrently with other agents, especially with anthracyclines. Cardiac function damage is generally rare, precox and mild with trastuzumab alone.\n\n\nMETHODS\nWe report the case of a 49 year-old woman affected by metastatic breast cancer who developed trastuzumab-related cardiogenic shock due to pump failure (with LVEF of about 15%) after three months of treatment. After a long hospitalization in the cardiac intensive care unit and a proper treatment, LVEF increased to 50% and, due to a severe progression of disease, trastuzumab was resumed and continued for more than one year.\n\n\nCONCLUSIONS\nThis is a case of particularly severe cardiotoxicity related to trastuzumab treatment, which was recovered with pharmacological treatment and the temporary discontinuation of the treatment. Trastuzumab was safely resumed after clinical and echocardiographic parameters improvement.",
"affiliations": "SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy. med.minichillo@hotmail.it.;Cardiovascular Department of the University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;Cardiovascular Department of the University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;Cardiovascular Department of the University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.;SSD Oncologia Medica Istituto \"F.Addarii\", Sant'Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138, Bologna, Italy.",
"authors": "Minichillo|Santino|S|http://orcid.org/0000-0002-8733-1763;Gallelli|Ilaria|I|;Barbieri|Elena|E|;Cubelli|Marta|M|;Rubino|Daniela|D|;Quercia|Sara|S|;Dall'Olio|Massimo|M|;Rapezzi|Claudio|C|;Zamagni|Claudio|C|",
"chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000068878:Trastuzumab",
"country": "England",
"delete": false,
"doi": "10.1186/s12885-017-3712-8",
"fulltext": "\n==== Front\nBMC CancerBMC CancerBMC Cancer1471-2407BioMed Central London 29115937371210.1186/s12885-017-3712-8Case ReportTrastuzumab resumption after extremely severe cardiotoxicity in metastatic breast cancer patient: a case report http://orcid.org/0000-0002-8733-1763Minichillo Santino +390512144626med.minichillo@hotmail.it 1Gallelli Ilaria ilariagallelli@libero.it 2Barbieri Elena elena_barbieri@aosp.bo.it 1Cubelli Marta marta7@libero.it 1Rubino Daniela daniela.rubino@aosp.bo.it 1Quercia Sara sara.quercia@aosp.bo.it 1Dall’Olio Massimo massimo.dall'olio@aosp.bo.it 2Rapezzi Claudio claudio.rapezzi@aosp.bo.it 2Zamagni Claudio claudio.zamagni@aosp.bo.it 11 SSD Oncologia Medica Istituto “F.Addarii”, Sant’Orsola-Malpighi Hospital, University of Bologna, Via Massarenti, 9, 40138 Bologna, Italy 2 0000 0004 1757 1758grid.6292.fCardiovascular Department of the University of Bologna, Via Massarenti, 9, 40138 Bologna, Italy 7 11 2017 7 11 2017 2017 17 72210 2 2016 30 10 2017 © The Author(s). 2017\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nTrastuzumab-related cardiotoxicity has been reported in patients receiving trastuzumab concurrently with other agents, especially with anthracyclines. Cardiac function damage is generally rare, precox and mild with trastuzumab alone.\n\nCase presentation\nWe report the case of a 49 year-old woman affected by metastatic breast cancer who developed trastuzumab-related cardiogenic shock due to pump failure (with LVEF of about 15%) after three months of treatment. After a long hospitalization in the cardiac intensive care unit and a proper treatment, LVEF increased to 50% and, due to a severe progression of disease, trastuzumab was resumed and continued for more than one year.\n\nConclusion\nThis is a case of particularly severe cardiotoxicity related to trastuzumab treatment, which was recovered with pharmacological treatment and the temporary discontinuation of the treatment. Trastuzumab was safely resumed after clinical and echocardiographic parameters improvement.\n\nKeywords\nTrastuzumabCardiotoxicityMonoclonal antibodyBreast cancerEjection fractionHeart failureissue-copyright-statement© The Author(s) 2017\n==== Body\nBackground\nTrastuzumab is a humanized monoclonal antibody that links the extracellular domain of the HER-2 protein (HER-2/neu or erbB2) overexpressed in about 20% to 25% of breast cancers. This antibody mediates signaling pathways leading to increased proliferation. It is approved for the treatment of early and metastatic breast cancer [1–3]. In HER-2 positive breast cancer, trastuzumab administered concurrently with chemotherapy has deeply modified the natural history of the disease by significantly improving response rates and survival in patients receiving chemotherapy and trastuzumab (CT + TR) compared to those receiving chemotherapy alone (CT) (median survival 25.1 months in CT + TR group versus 20.3 months in CT group, P 0.046) [3].\n\nHowever, trastuzumab use has been found to be associated with an high incidence of cardiotoxicity which varies in the available literature from 0.6% to 4.5% reaching up to 34% when associated with anthracyclines [4].\n\nThe pathogenesis of trastuzumab-associated cardiac function decrease is still unknown and its mechanism of action is under investigation in small clinical studies. Several trials have described potential risk factors such as age, weight and high body mass index (BMI), history of coronary artery disease and hypertension, cumulative doxorubicin dose, HER2 expression level, previous treatment, radiation of the chest and negative hormonal receptor status [5]. However, among these, only age and concomitant doxorubicin therapy result to correlate with an increased risk of cardiotoxicity [3]. Moreover, despite the publication of clinical guidelines for the management of trastuzumab-induced cardiomyopathy, the choice to resume trastuzumab therapy after a decline in left ventricular ejection fraction remains a clinical decision based on expected risks and benefits.\n\nHere we report the case of a metastatic breast cancer patient treated with trastuzumab associated to chemotherapy. She developed extremely severe congestive heart failure requiring complex specialized treatment. After full resolution of symptoms and left- ventricle ejection fraction (LVEF) recovery with appropriate therapy, she resumed, because of disease progression, trastuzumab treatment without any further cardiologic complications.\n\nFew similar cases have been reported in the scientific literature but this case report is particularly interesting because the patient never received anthracyclines and, after resumption, trastuzumab was continued for about two years without LVEF alterations, resulting in complete remission of visceral neoplastic disease.\n\nCase presentation\nIn December 2000, a 49 year-old woman underwent left mastectomy for a stage IIA invasive ductal breast carcinoma with low proliferative activity (Ki 67 < 5%), negative hormone receptors and HER2 overexpressed (score 3+ at immunochemistry). In her medical history there were no cardiovascular comorbidities and she had no family history of cardiovascular disease.\n\nFrom February to July 2001 she received an adjuvant chemotherapy with cyclophosphamide 600 mg/sqm, methotrexate 40 mg/sqm and 5-fluorouracyl 600 mg/sqm days 1,8. Subsequent follow-up was negative until September 2005 when a local left axillary relapse was resected. Histological and biological features of the relapse did not change. Surgical resection was followed, from January to February 2006, by radiation therapy on the left chest wall (5000 cGy with fractioned dose of 200 cGy/day). In November 2010, a PET-CT scan was performed to test for progressive increase in serum biomarkers. It showed multiple secondary localizations: lymph-nodal metastases (left axillary, mediastinic, iliac and lombo-aortic), liver metastases (third segment), and bone lesions (left seventh rib and left femur acetabulum). Liver biopsy confirmed hormone receptors negativity and HER2 overexpression (score 3+). The patient was absolutely asymptomatic (ECOG 0). A screening echocardiogram (January 2011) found no pathological findings and a normal left ventricular ejection fraction (LVEF 64%). At that point, first line chemotherapy with weekly paclitaxel (80 mg/sqm) associated with weekly trastuzumab (loading dose of 4 mg/kg followed by maintenance dose of 2 mg/Kg) was initiated and paclitaxel was withdrawn at the second administration because of hypersensitivity reaction and replaced with docetaxel (100 mg/sqm every three weeks). A supportive therapy with bisphophonates (zoledronic acid 4 mg i.v. every 28 days) was also administered for bone metastases. In March 2011, after three months of treatment (fourteen administrations of weekly trastuzumab), the patient referred asthenia, tachycardia, increasing dyspnea for mild efforts and palpitations. Within few days clinical conditions rapidly worsened and the patient was admitted to the emergency room for cardiogenic shock (heart rate 150 beats per minute, blood pressure 70/50 mmHg, severe oliguria, pulmonary congestion, NYHA 4, AHA D). An angio-CT scan excluded a pulmonary thromboembolism and the patient was admitted to a cardiac intensive care unit where an echocardiogram revealed a severe global biventricular dilatation and dysfunction (LVEF about 15%). Despite a maximal supportive therapy with inotropic agents and diuretics, shock persisted. Therefore an intraortic balloon pump was implanted with a very slow but progressive hemodynamic improvement and a resumption of diuresis. In absence of previous clinical experiences or data from the literature describing of similar serious clinical presentation using trastuzumab alone (without current or previous history of anthracyclines exposure), a myocardium biopsy was performed finding inflammatory areas of uncertain etiology but not compatible with a myocarditis. After approximately two months of hospitalization the patient was progressively weaned by inotropic agents and infusional diuretic therapy, and a heart failure pharmacological treatment was orally introduced (bisoprolol 2,5 mg, enalapril 2,5 mg, ivabradine 15 mg, canreonate 50 mg, furosemide 100 mg). After four months and with a slow pharmacological up-titration, we observed a progressive clinical improvement and an increase and stabilization of biventricular function (LVEF 45% on September 2011). In May 2012, a PET-CT scan showed lymph-nodal, liver and skeletal disease progression, at which point a second line chemotherapy with vinorelbine (25 mg/sqm, days 1,8) was initiated. In July 2012, after two cycles of chemotherapy, a further tumor assessment documented visceral disease progression. Therefore, with awareness of the high risk due to recent severe cardiogenic shock and after discussion with the patient and her family, we decided to resume trastuzumab therapy along with cardiac therapy. Weekly trastuzumab (2 mg/kg) was resumed with a clinical and echocardiographic cardiac monitoring. Soon thereafter, radiological evaluations (PET-CT scan and total body CT scan) showed a partial response of visceral disease. Trastuzumab and vinorelbine therapy was continued until June 2013 when, considering the positive response and the appearance of grade 2 neuropathy, vinorelbine was interrupted and trastuzumab was continued every 21 days (6 mg/Kg) until April 2014 with no further signs or symptoms of heart failure. External beam radiotherapy on left ileo-pubic branch (March 2012, 30 Gy) and on the second cervical vertebra (January 2013, 2000 cGy for 5 fractions) were performed for palliative purpose. Zoledronic acid every 28 days was continued during the whole period. Serial echocardiograms performed during trastuzumab treatment did not reveal LVEF drop maintaining in the range of 50–55%.\n\nIn January 2014 the patient presented diplopia, left eye squint, postural instability and leg weakness. A CT scan and MRI (February 2014) revealed the presence of four cerebral and cerebellar lesions (right cerebellar tonsil, left frontal and parietal lobe, quadrigeminal plate). The patient underwent stereotactic gamma-knife radiosurgery on February 2014 followed by whole brain irradiation for suspected leptomeningeal involvement (3000 cGy for 12 fractions). In April 2014 trastuzumab was interrupted and a new line of chemotherapy with capecitabine 3000 mg/day (1–14 every 21 days) associated with tyrosine kinase inhibitor (TKI) lapatinib 250 mg 4 tb/day was started. Subsequent radiological assessment (August 2015) documented a complete remission of lymph-nodal and liver neoplastic disease and radiologic stability of bone metastases.\n\nIn November 2014 the patient was hospitalized for acute renal failure secondary to dehydration, fainting and recurrent vomiting. After discharge, she complained of severe asthenia, anorexia and weight loss. Consequently, chemotherapy with capecitabine was suspended and lapatinib was continued as monotherapy for about a year during which she never reported cough, dyspnea, chest pain and other symptoms suggestive of heart failure (NYHA II, AHA C). In November 2015, echocardiographic examination showed no relevant changes compared to the previous ones. We found an interesting pattern of LVEF trend along with trastuzumab treatment – discontinuation – and resumption (Fig. 1).Fig. 1 Left ventricular ejection fraction values in the treatment period. T: trastuzumab, D: docetaxel, VNR: vinorelbine, C: capecitabine, L: lapatinib\n\n\n\n\nOver the following three months, the patient experienced a rapid deterioration of general clinical conditions, with progressive and definitive bedrest and altered conscience, suggesting a meningeal disease progression. In January 2016, the last ultrasound examination showed a progressive liver disease. The patient died on February 24, 2016 from neoplastic disease progression.\n\nDiscussion\nIn this case report we described the case of a patient treated with trastuzumab who developed a severe congestive heart failure during treatment and who resumed trastuzumab therapy after proper cardiac management and left ventricular ejection fraction recovery.\n\nSimilarly to our case, Castells and colleagues reported the case of a breast cancer patient who developed a severe heart failure (LVEF 23%) after adjuvant treatment with doxorubicin and trastuzumab. Her cardiac function improved after positioning of a left ventricular axial pump. She fully recovered after 135 days of support therapy and the axial pump was successfully removed [6]. Conversely to our experience this patient did not need any further trastuzumab treatment.\n\nThe literature includes three cases similar to our experience. In the first report Hermann and colleagues described two breast cancer patients who had received trastuzumab monotherapy and were hospitalized for a rapidly worsening heart failure following hypertensive crisis, in one case due to the interruption of antihypertensive drugs and in the other case to an underlying sclerodermia. In both cases trastuzumab therapy was safely resumed after adequate treatment of the underlying causes of the heart failure [7].\n\nMartin and colleagues reported on a patient with a left ventricular ejection fraction drop from 76% to 55% during adjuvant sequential anthracycline-containing chemotherapy followed by trastuzumab-based therapy; ejection fraction was restored after starting therapy with the ACE-inhibitor captopril, and trastuzumab was resumed without complications [8].\n\nUnlike anthracycline-induced cardiotoxicity, trastuzumab cardiotoxicity has some peculiar features: 1) the risk does not seem to be dose related [9]; 2) there is no evidence that cardiac damage is associated with ultrastructural changes in myocytes and 3) it is fully reversible after treatment suspension [10]. Acute congestive heart failure due to anthracycline-induced cardiotoxicity is often serious and require a long-term hospitalization with a multidisciplinary approach. In contrast, trastuzumab-related cardiotoxicity is less severe and at least partially reversible in many cases [3].\n\nCardiotoxicity occurs more frequently in patients with preexisting hypertension and obesity, former or current smokers, with cardiologic comorbidities and with a family history of cardiovascular disease. Our patient had no cardiological comorbidities, she had not received anthracycline-based therapies although radiation therapy on the left chest wall was performed five years before. Tumor hormonal receptors, another risk factor, were also negative.\n\nTypically, there is a rapid improvement in clinical conditions and ejection fraction after trastuzumab discontinuation and standard treatment allowing resumption of trastuzumab, as we did for our patient.\n\nIn the present report our patient developed cardiogenic shock due to a severe biventricular dysfunction probably caused by trastuzumab four months after the beginning of the treatment. One year later, after a full recovery from heart failure, because of disease progression, and with consideration of the clinical benefits from anti-HER2 treatment and the absence of absolute cardiologic contraindications (LVEF was significantly improved with proper treatment), therapy with full dose trastuzumab was resumed along with a close monitoring program of left ventricular function for about two years without any further cardiovascular complications. In summary, our patient completed a line of chemotherapy with trastuzumab. Subsequently, we performed 12 cycles with trastuzumab (6 mg/Kg) alone which led to a complete remission of visceral disease.\n\nThe question of how best to prevent trastuzumab-related cardiotoxicity continues to be debated. Since the exposure to both trastuzumab and an anthracycline leads to the greatest risk, guidelines recommend avoiding concurrent exposure to these two agents. Another strategy could be to identify patients who are at greater risk of cardiac complications from trastuzumab therapy by using a radiolabeled trastuzumab (111In-DTPA-trastuzumab) and by evaluating scintigraphic myocardial uptake [11]. Other than a study by Cardinale et al., there is little data from the literature on the utility of cardiac biomarkers for trastuzumab, such as TnI [12]. Increase of TnI was found exclusively in patients pre-treated with anthracyclines and in seven patients was reported prior to trastuzumab exposure, suggesting possible additional effects on a previous anthracycline-induced myocyte injury.\n\nAlthough this is only a single case-report we believe it to be valuable because the cardiac function of our patient recovered, despite the severity of heart failure without a previous exposure to anthracyclines, following adequate cardiac management, allowing her to benefit from prolonged trastuzumab treatment followed by additional anti-HER2 agent lapatinib treatment.\n\nConclusions\nTrastuzumab can lead to a severe cardiac toxicity, including in patients never previously exposed to anthracyclines and irrespective of other risk factors. It is usually reversible and, when recognized early, responds to the discontinuation of the antibody and to standard heart failure treatment, providing the opportunity for resumption of therapy if necessary.\n\nAbbreviations\nACEAngiotensin converting enzyme\n\nAHAAmerican Heart Asssociation\n\nBNPB-type natriuretic peptide\n\nCGyCentigrays\n\nCKCreatinchinase\n\nCK-MBCreatinchinase MB\n\nCTComputed tomography\n\nDTPADiethylene triamine pentaacetic acid\n\nGyGrays\n\nLVEFLeft ventricular ejection fraction\n\nMRIMagnetic resonance imaging\n\nMUGAMulti gated acquisition scan\n\nNYHANew York Heart Association\n\nPETPositron emission tomoscintigraphy\n\nTnII troponin\n\nTnTT troponin\n\nAcknowledgements\nThe authors wish to thank the patient for her kind permission to present this case. We wish to thank IG and all the Cardiovascular Department of Sant’Orsola – Malpighi Hospital for clinical and ultrasound assessment.\n\nFunding\nNeither author received any source of funding for this paper.\n\nAvailability of data and materials\nFor patients’ privacy, the patient information is publicly inaccessible.\n\nAuthors’ contributions\nSM wrote the work; SM, EB, MC, DR, SQ, IG, MDO, CR and CZ contributed to writing and revising the work for important intellectual content and have given final approval of the version to be published. All authors made substantial contributions to the conception of the work and have given agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nThe authors declare they have observed appropriate ethical guidelines and legislation in writing the case report. Consent to participate was obtained from the patient.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this Case Report. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Marinko T Dolenc J Bilban-Jakopin Cvetka. Cardiotoxicity of concomitant radiotherapy and trastuzumab for early breast cancer. Radio Oncologia 2014 48 2 105 112 \n2. Telli Melinda L Hunt Sharon A Carlson Robert W Guardino AE Trastuzumab-related cardiotoxicity: calling into question the concept of reversibility J Clin Oncol 2007 25 3525 3533 10.1200/JCO.2007.11.0106 17687157 \n3. Keefe Deborah L. Trastuzumab-associated cardiotoxicity. CANCER October 1, 2002 / Volume 95 / Number 7.\n4. Martín M, Esteva FJ, Alba E, Khandheria B, Pérez-Isla L, García-Sáenz JA, Márquez A, Sengupta P, Zamorano J. Minimizing cardiotoxicity while optimizing treatment efficacy with trastuzumab: review and expert recommendations. Oncologist. 2009 Jan;14(1):1–11. doi: 10.1634/theoncologist.2008-0137. Epub 2009 Jan 15.\n5. Huzno J Les D Sarzyczny-Slota D Nowara E Cardiac side effects of trastuzumab in breast cancer patients – single centers experiences Wspolczesna Onkol 2013 17 2 190 195 10.5114/wo.2013.34624 \n6. Castells E Roca J Miralles A Recovery of ventricular function with a left ventricular axial pump in a patient with end-stage toxic cardiomyopathy not a candidate for heart transplantation: first experience in Spain Transplant Proc 2009 41 2237 2239 10.1016/j.transproceed.2009.06.029 19715885 \n7. Herrmann J Herrmann SM Haddad TC New-onset heart failure in association with severe hypertension during trastuzumab therapy Mayo Clin Proc 2014 89 12 1734 1739 10.1016/j.mayocp.2014.08.011 25441402 \n8. Martins JS, Dos Santos VM, Thommen Teles L, Alves Leite V. Reversible cardiotoxicity in a 54-year-old woman treated with trastuzumab. Rev Med Chile 2012; 140: 763–766.\n9. Walker JR Singal OK Jassal DS The art of healing broken hearts in breast cancer patients: Trastuzumab and heart failure Exp Clin Cardiol Vol 2009 3 14 \n10. Floyd JD Nguyen DT Lobins RL Bashir Q Doll DC Perry MC Cardiotoxicity of cancer therapy J Clin Oncol 2005 23 7685 7696 10.1200/JCO.2005.08.789 16234530 \n11. Perik PJ, et al. Indium-111-labeled Trastuzumab Scintigraphy in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer. J Clin Oncol. 24:2276–28.\n12. Cardinale D, Colombo A, Torrisi R, Sandri MT, Civelli M, Salvatici M, Lamantia G, Colombo N, Cortinovis S, Dessanai MA, Nolè F, Veglia F, Cipolla CM. Trastuzumab-induced cardiotoxicity: clinical and prognostic implications of troponin I evaluation. J Clin Oncol. 2010 Sep 1;28(25):3910–3916. doi: 10.1200/JCO.2009.27.3615. Epub 2010 Aug 2.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2407",
"issue": "17(1)",
"journal": "BMC cancer",
"keywords": "Breast cancer; Cardiotoxicity; Ejection fraction; Heart failure; Monoclonal antibody; Trastuzumab",
"medline_ta": "BMC Cancer",
"mesh_terms": "D000074322:Antineoplastic Agents, Immunological; D001943:Breast Neoplasms; D066126:Cardiotoxicity; D005260:Female; D006801:Humans; D008875:Middle Aged; D009362:Neoplasm Metastasis; D012770:Shock, Cardiogenic; D013318:Stroke Volume; D000068878:Trastuzumab",
"nlm_unique_id": "100967800",
"other_id": null,
"pages": "722",
"pmc": null,
"pmid": "29115937",
"pubdate": "2017-11-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "25441402;19147689;16234530;19715885;17687157;20098570;20679614;24991199;23282614;23788989;16710024",
"title": "Trastuzumab resumption after extremely severe cardiotoxicity in metastatic breast cancer patient: a case report.",
"title_normalized": "trastuzumab resumption after extremely severe cardiotoxicity in metastatic breast cancer patient a case report"
} | [
{
"companynumb": "IT-ACCORD-061889",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PACLITAXEL"
},
"drugadditional": "1",
"druga... |
{
"abstract": "We report two cases in which amnestic sleep related eating disorder (SRED) occurred with extended-release zolpidem but not with the immediate-release formulation. These cases illustrate how even relatively small differences such as formulation can affect the likelihood of experiencing such events.",
"affiliations": "Division of Pulmonary and Critical Care Medicine, Duke University Medical Center, Durham, NC 27710, USA. ambrose.chiang@duke.edu",
"authors": "Chiang|Ambrose|A|;Krystal|Andrew|A|",
"chemical_list": "D003692:Delayed-Action Preparations; D006993:Hypnotics and Sedatives; D011725:Pyridines; D000077334:Zolpidem",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1550-9389",
"issue": "4(2)",
"journal": "Journal of clinical sleep medicine : JCSM : official publication of the American Academy of Sleep Medicine",
"keywords": null,
"medline_ta": "J Clin Sleep Med",
"mesh_terms": "D000368:Aged; D000647:Amnesia; D003692:Delayed-Action Preparations; D020920:Dyssomnias; D001068:Feeding and Eating Disorders; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D006993:Hypnotics and Sedatives; D011725:Pyridines; D000077334:Zolpidem",
"nlm_unique_id": "101231977",
"other_id": null,
"pages": "155-6",
"pmc": null,
"pmid": "18468314",
"pubdate": "2008-04-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "14592194;7973318;9491060;1759095;453369",
"title": "Report of two cases where sleep related eating behavior occurred with the extended-release formulation but not the immediate-release formulation of a sedative-hypnotic agent.",
"title_normalized": "report of two cases where sleep related eating behavior occurred with the extended release formulation but not the immediate release formulation of a sedative hypnotic agent"
} | [
{
"companynumb": "US-VIVIMED-2018SP005426",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ATORVASTATIN"
},
"drugadditional": null,
... |
{
"abstract": "A 76-year-old woman was treated with oral bisphosphonate, alendronate, for osteoporosis in an outpatient clinic. Routine blood tests 4 months after alendronate prescription surprisingly revealed severe hypophosphataemia. The patient was hospitalised and treated with intravenous and oral phosphate supplements. Alendronate was later reintroduced as treatment for osteoporosis and the patient once again presented with severe hypophosphataemia in subsequent routine blood tests. The patient had only presented with lower extremity pain, muscle weakness and difficulty walking. Blood tests in the emergency department both times reconfirmed severe hypophosphataemia. Plasma (p-)ionised calcium levels were normal or slightly elevated and p-parathyroid hormone levels were normal or slightly suppressed. The p-25-hydroxyvitamin-D and p-creatine were in the normal range. Critical illness, malabsorption, nutritional issues and genetics were reviewed as potential causes but considered unlikely. Phosphate levels were quickly restored each time on replacement therapy and the case was interpreted as bisphosphonate-induced severe hypophosphataemia.",
"affiliations": "Department of Internal Medicine M, Geriatric Section, Amager Hvidovre Hospital, Glostrup, Denmark louisewc@hotmail.com.;Department of Internal Medicine M, Geriatric Section, Amager Hvidovre Hospital, Glostrup, Denmark.;Department of Endocrinology, Rigshospitalet, Copenhagen, Denmark.;Department of Internal Medicine M, Geriatric Section, Amager Hvidovre Hospital, Glostrup, Denmark.",
"authors": "Bagger|Louise Wulff|LW|;Hansen|Per Kim Dyhr|PKD|;Schwarz|Peter|P|;Nielsen|Barbara Rubek|BR|",
"chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D010281:Parathyroid Hormone; D014807:Vitamin D; C104450:25-hydroxyvitamin D; D002118:Calcium; D019386:Alendronate",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2020-235083",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(10)",
"journal": "BMJ case reports",
"keywords": "calcium and bone; drugs: endocrine system; geriatric medicine; unwanted effects / adverse reactions",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000368:Aged; D019386:Alendronate; D050071:Bone Density Conservation Agents; D002118:Calcium; D003937:Diagnosis, Differential; D004164:Diphosphonates; D005260:Female; D015577:Geriatric Assessment; D006801:Humans; D017674:Hypophosphatemia; D010024:Osteoporosis; D010281:Parathyroid Hormone; D016896:Treatment Outcome; D014807:Vitamin D",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33033001",
"pubdate": "2020-10-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe hypophosphataemia following oral bisphosphonate treatment in a patient with osteoporosis.",
"title_normalized": "severe hypophosphataemia following oral bisphosphonate treatment in a patient with osteoporosis"
} | [
{
"companynumb": "DK-JUBILANT CADISTA PHARMACEUTICALS-2020JUB00323",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METFORMIN HYDROCHLORIDE"
},
... |
{
"abstract": "A case of acute dyskinesia in a 42-year-old man with a history of cocaine use and schizophrenia is described. He had discontinued clozapine approximately 1 month before presenting to the emergency department displaying signs of psychosis, with generalised choreiform and dystonic movements. Urinary toxicology was positive for cocaine. Clozapine treatment was reinitiated, and within 2 weeks the dyskinesia had subsided. Review of his records revealed two previous episodes of similar dyskinesia, both of which were temporally associated with cocaine use. Dyskinesia occurring in the context of cocaine use, and clozapine withdrawal-associated dyskinesia were considered to be the main differential diagnoses. A range of differential diagnoses should be considered in patients presenting with an acute-onset movement disorder who have a history of long-term exposure to antipsychotic medication.",
"affiliations": "Department of Psychiatry, Camden and Islington NHS Foundation Trust, London, UK.",
"authors": "Berry|Alex James|AJ|",
"chemical_list": "D014150:Antipsychotic Agents; D016578:Crack Cocaine; D003024:Clozapine",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-225251",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "11(1)",
"journal": "BMJ case reports",
"keywords": "drug misuse (including addiction); psychiatry; psychiatry (drugs and medicines)",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000328:Adult; D014150:Antipsychotic Agents; D003024:Clozapine; D019970:Cocaine-Related Disorders; D016578:Crack Cocaine; D004409:Dyskinesia, Drug-Induced; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D059906:Neuroimaging; D012559:Schizophrenia; D013375:Substance Withdrawal Syndrome; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30567212",
"pubdate": "2018-12-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "9812136;10376125;18408681;8474485;11294937;17415801;8164838;8580223;24953830;29506749;18779773;9771818;18024776;20814350;9771763",
"title": "Acute dyskinesia in a patient with schizophrenia.",
"title_normalized": "acute dyskinesia in a patient with schizophrenia"
} | [
{
"companynumb": "GB-MYLANLABS-2019M1001258",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CLOZAPINE"
},
"drugadditional": null,
... |
{
"abstract": "A 26-year-old woman developed symptoms of acute toxicity during cyclosporine (CsA) therapy for graft-versus-host disease prophylaxis. The standard regimen included CsA in a dose of 1.5 mg/kg (120 mg) every 12 h, but, as a medication error, she received a high dose of 500 mg of oral CsA. After 2 h, she developed nausea and vomiting and, subsequently, flushing, chest tightness, tremor and vertigo. Laboratory and clinical examinations revealed high blood CsA concentrations (1000 ng/mL after 12 h) with a mild increase in blood pressure. Therefore, the patient was diagnosed with an acute CsA overdose. Before confirmation of the overdose by measurement of drug concentrations, the second dose was administered at its routine time because of uncertainty about the aetiology of the symptoms. The third dose was withheld, and the patient was monitored closely for clinical and laboratory presentations until the time when the abnormalities were relieved. CsA administration was then resumed with the correct prescription. The patient was discharged with successful engraftment and normal biochemical laboratory results after 1 month. Evaluation with the Naranjo assessment score indicated a probable relationship between the patient's symptoms and overdosage with the suspected drug. Currently, detailed presentations of acute CsA toxicity cases due to overdose are limited in the medical literature. Evaluation of the patient's medical and laboratory records, with cooperation of all responsible clinical staff, along with a review of the literature, were very helpful in discovery of the toxicity incident. Vigilance of health care providers with regard to medication errors and early detection of toxicity symptoms can decrease CsA-related morbidity and mortality in the future.",
"affiliations": "Department of Clinical Pharmacy, Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, PO Box 14155/6153, Tehran, Iran. tafazoli.m.a@gmail.com.",
"authors": "Tafazoli|Ali|A|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1007/s40800-015-0023-3",
"fulltext": "\n==== Front\nDrug Saf Case RepDrug Saf Case RepDrug Safety - Case Reports2199-11622198-977XSpringer International Publishing Cham 2310.1007/s40800-015-0023-3Case ReportAccidental Overdose of Oral Cyclosporine in Haematopoietic Stem Cell Transplantation: A Case Report and Literature Review Tafazoli Ali +98-21-88209625tafazoli.m.a@gmail.coma.tafazzolimoghaddam@sbmu.ac.ir 121 Department of Clinical Pharmacy, Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, PO Box 14155/6153, Tehran, Iran 2 Taleghani Bone Marrow Transplantation Center, Taleghani Hospital, Shahid Beheshti University of Medical Sciences, PO Box 14155/6153, Tehran, Iran 8 12 2015 8 12 2015 12 2015 2 1 20© The Author(s) 2015\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.A 26-year-old woman developed symptoms of acute toxicity during cyclosporine (CsA) therapy for graft-versus-host disease prophylaxis. The standard regimen included CsA in a dose of 1.5 mg/kg (120 mg) every 12 h, but, as a medication error, she received a high dose of 500 mg of oral CsA. After 2 h, she developed nausea and vomiting and, subsequently, flushing, chest tightness, tremor and vertigo. Laboratory and clinical examinations revealed high blood CsA concentrations (1000 ng/mL after 12 h) with a mild increase in blood pressure. Therefore, the patient was diagnosed with an acute CsA overdose. Before confirmation of the overdose by measurement of drug concentrations, the second dose was administered at its routine time because of uncertainty about the aetiology of the symptoms. The third dose was withheld, and the patient was monitored closely for clinical and laboratory presentations until the time when the abnormalities were relieved. CsA administration was then resumed with the correct prescription. The patient was discharged with successful engraftment and normal biochemical laboratory results after 1 month. Evaluation with the Naranjo assessment score indicated a probable relationship between the patient’s symptoms and overdosage with the suspected drug. Currently, detailed presentations of acute CsA toxicity cases due to overdose are limited in the medical literature. Evaluation of the patient’s medical and laboratory records, with cooperation of all responsible clinical staff, along with a review of the literature, were very helpful in discovery of the toxicity incident. Vigilance of health care providers with regard to medication errors and early detection of toxicity symptoms can decrease CsA-related morbidity and mortality in the future.\n\nissue-copyright-statement© The Author(s) 2015\n==== Body\nKey Points\nThe possibility of occurrence of cyclosporine toxicity should always be kept in mind in transplantation settings, because cyclosporine has a narrow therapeutic index, unpredictable pharmacokinetics and considerable probability of medication errors.\t\nAfter administration of high-dose cyclosporine in the form of an oral formulation, infusion-reaction-like symptoms can occur. These symptoms are helpful in early detection of toxicity cases.\t\n\n\nIntroduction\nCyclosporine (CsA) is one of the most frequently used medications for immunosuppressive therapy to prevent graft-versus-host disease (GVHD), which is a life-threatening event for allogeneic haematopoietic stem cell recipients. The clinical response to CsA can be unpredictable, because of the complicated pharmacokinetics of CsA and the characteristics of the recipients [1]. Considering the widespread application of this drug, accidental overdoses and subsequent toxicities are highly probable, but, unfortunately, there are currently few case reports of acute CsA overdose in the literature, and only a small number of them have occurred in the setting of haematopoietic stem cell transplantation (HSCT). Patients undergoing HSCT generally have medical problems such as haematological malignancies or genetic immune disorders. In addition, co-medications used in HSCT are totally different from those used in solid organ transplantation or autoimmune disorders. Notably, the conditioning regimen in HSCT puts the patient at risk of a unique spectrum of CsA toxicities. Because of different underlying diseases, concurrent therapies and risk factors, the presentation of CsA toxicities in HSCT may be very different from those in other settings.\n\nThe aim of this report is to describe a patient with an iatrogenic CsA overdose in detail and the situation in which it happened. A literature review of similar cases, particularly in the setting of HSCT, has also been included in order to provide more awareness of early detection and management of such cases.\n\nCase Report\nA 26-year-old woman was admitted to an HSCT centre with acute myeloid leukaemia (AML). She weighed 79 kg and was 1.56 m tall (ideal body weight 48.8 kg; body mass index 32.5 kg/m2). She had a history of postpartum fever, fatigue, anaemia and high C-reactive protein (CRP) levels, and consequently received a diagnosis of AML with maturation (AML M2). After the first complete remission with a ‘7 + 3’ regimen, involving 7 days of cytarabine and 3 days of daunorubicin, with a full-match sibling donor, she became a candidate for allogeneic HSCT. The conditioning regimen consisted of busulfan from days −6 to −3 and cyclophosphamide on days −2 and −1. GVHD prophylaxis included intravenous CsA 1.5 mg/kg every 12 h (120 mg per dose) from day −2, and methotrexate 10 mg on days +1, +3, +6 and +11. An antibiotic prophylactic regimen comprised acyclovir, trimethoprim/sulfamethoxazole, fluconazole and ciprofloxacin, started on day −8, all administered orally. The prescribed ciprofloxacin dosage was 500 mg twice daily.\n\nOn day −3, the patient mistakenly received 500 mg of CsA as an oral soft gelatin capsule of a lipid micro-emulsion formulation, which was excessive, considering her ideal body weight. The patient had no mucositis nor gastrointestinal symptoms before that time. After about 2 h, the patient experienced nausea and vomiting (50 mL). In the next 16 h, the patient had nausea without another episode of vomiting, with reluctance regarding oral feeding, but had normal defaecation (no diarrhoea). The most annoying symptom described by the patient was a feeling of flushing and chest tightness from about 3 h after administration until the patient’s bedtime (15 h later); then gradually it faded out and disappeared by the end of the first 24 h, with initial sublingual temperature and respiratory rate elevations of about 0.5 °C and 5 breaths/min, respectively. The patient’s (systolic/diastolic) blood pressure was around 115/85 mmHg within 4–6 h of the overdosage, showing a mild increase from baseline (105/70 mmHg), which was transient. Cardiac markers were normal. An electrocardiogram (ECG) was recorded for the patient at the start of the chest symptoms, repeated every 12 h and checked by a cardiologist, with no detectable pathological alterations (not even tachycardia). The third noticeable complaint was dizziness, which was remembered by the patient after the vomiting and occurred with the same pattern as the flushing. On clinical neurological examination, the only findings were a transient mild upper limb tremor and benign paroxysmal positional vertigo. Other findings, including deep tendon reflexes, plantar reflexes, and other sensory-motor and cranial nerve examinations, were normal.\n\nA complete blood cell count and biochemistry profile were requested for the patient from the time of the start of symptoms and after 9 h, then as a 12 h routine schedule. Some markers, such as CRP, were monitored at longer intervals, as per our centre’s policies. The patient’s laboratory test values are summarized in Table 1. Because none of the laboratory results explained the symptoms (they were generally normal values for the patient), a clinical pharmacy consultation was requested for possible drug-related complications after 6 h post-administration.Table 1 Timetable of clinical events in relation to the first and second cyclosporine (CsA) exposures\n\nParameter\tCsA exposures\tResumption of routine GVHD prophylaxis\t\nFirst exposure (oral dosing, medication error)\tSecond exposure (intravenous dosing, scheduled administration)\t\nTime post-administration of CsA\t0 h: day −3 pre-Tx\t2 h\t3 h\t4 h\t6 h\t12 h\t18 h\t24 h: day −2 pre-Tx\t36 h\t48 h: day −1 pre-Tx\t\nVital signs\t\n T (°C)\t37\t\t37.5\t37.5\t37.2\t37.3\t37.2\t37\t37\t37\t\n PR (beats/min)\t69\t72\t72\t69\t69\t69\t69\t69\t69\t\n RR (breaths/min)\t14\t19\t15\t14\t14\t14\t14\t14\t14\t\n BP (mmHg; systolic/diastolic)\t105/70\t–\t115/90\t115/80\t115/80\t115/80\t115/80\t110/70\t105/70\t\nRelevant observations\t–\tN, V, Di\tN, Di, Ch, F, normal ECG, normal CardEnz, normal ABG\tN, Di, Ch, F\tN, Di, Ch, F, neuro examination\tN, Di, Ch, F, normal ECG, normal CardEnz, normal ABG\tPatient slept\tResolution of symptoms, normal ECG\t1 dose withheld\t–\t\nLaboratory test valuesa\n\t\n WBCC (103/µL) [3.5–10.5]\t8.7\t\t8.3\t\t7.5\t\t8\t8.7\t9.6\t\n RBCC (103/µL) [3.9–5.7]\t4.72\t4.6\t4.65\t4.78\t4.7\t4.2\t\n BS (mg/dL)\t86\t102\t145\t200\t162\t141\t\n Na (meq/L) [135–145]\t140\t141\t139\t141\t136\t149\t\n K (meq/L) [3.5–5]\t4.2\t4.1\t4.2\t4.8\t4.8\t4.2\t\n Ca (mg/dL) [8.5–10.5]\t9.8\t–\t9.5\t9.6\t8.8\t8.5\t\n Cr (mg/dL) [0.5–1.3]\t0.7\t0.7\t0.7\t0.7\t0.7\t0.7\t\n CRP (mg/L) [<10]\t1.5\t–\t–\t1.5\t–\t1.5\t\n ALT (IU/L) [<40]\t24\t22\t26\t25\t28\t21\t\n Bili-T (mg/dL) [0.3–2]\t0.3\t0.4\t0.4\t0.4\t0.3\t0.5\t\n Drug conc (ng/mL) [100–300]\t\t\t\t\t1000\t600\t410\t276\t\n\nABG arterial blood gases, ALT alanine aminotransferase, Bili-T total bilirubin, BP blood pressure, BS blood sugar, Ca calcium, CardEnz cardiac enzymes, Ch chest tightness, conc concentration, Cr serum creatinine, CRP C-reactive protein, Di dizziness, ECG electrocardiogram, F flushing, GVHD graft-versus-host disease, K potassium, N nausea, Na sodium, neuro neurological, PR pulse rate, pre-Tx pre-transplantation, RBCC red blood cell count, RR respiratory rate, T temperature, V vomiting, WBCC white blood cell count\n\n\naThe values listed in [square brackets] are the normal ranges\n\n\n\nAfter a thorough interview with the patient and the responsible nursing staff who had observed her continuously during this period, and after investigation of her medical record and medication chart, it was found that the ciprofloxacin prescription was hardly readable, and the most probable drug name mistakenly substituted for ‘ciprofloxacin’ was ‘cyclosporine’. After 12 h post-administration, a whole-blood sample for measurement of the CsA concentration was sent for evaluation of hypothetical trough concentrations. The next morning was day −2 pre-transplantation, so, despite a recommendation from the clinical pharmacy service for a CsA stop order until the CsA concentration results became available (the turnaround time is about 12–24 h at our centre), 120 mg of intravenous CsA was administered as per the routine GVHD prophylaxis schedule because of uncertainty about the extent of exposure and the low probability of a medication error; however, another blood sample was sent for drug concentration measurement just prior to its administration. After 4 h, the result for the first sample was reported as 1000 ng/mL (12 h post-dose). The second sample showed a 600 ng/mL CsA concentration at 24 h after administration of the mistaken dose. Consequently, another drug concentration measurement was requested 12 h after the first intravenous dose, and the next dose was withheld. The patient had no flare of symptoms after administration of the first intravenous dose. After 12 and 24 h of intravenous dosing, the drug concentrations were 410 and 276 ng/mL, respectively, and the patient was symptom free; therefore, routine administration of CsA 120 mg every 12 h was resumed. Afterwards, during the admission, CsA trough concentrations were checked twice weekly and, on all occasions, the values were between 200 and 400 ng/mL without any dose modification, except for one subtherapeutic concentration.\n\nWe had the chance to calculate the area under the blood concentration–time curve (AUC) of CsA and the consequent pharmacokinetic profile of CsA for this patient after 5 days of transition to the oral dosage form on post-transplantation day +18 (but unfortunately not during the intoxication phase). With 250 mg dosing, the AUC, peak concentration (Cmax), time to reach Cmax (tmax), clearance, bioavailability and half-life were 3777.5 ng·h/mL, 800 ng/mL, 2 h, 22.5 L/h, 34 % and 3.85 h, respectively.\n\nThe patient was discharged with successful engraftment and normal biochemical laboratory results on day +31. On follow-up assessments, she was diagnosed with Glucksberg grade IV acute GVHD on day +43, which resulted in readmission. It was treated successfully with antithymocyte globulin, methylprednisolone and mycophenolate mofetil.\n\nMethods\nTo find detailed information about presentations of patients with CsA overdose in the literature, two accredited scientific databases, PubMed and ScienceDirect, were explored. Searching PubMed with a (‘cyclosporine’[Majr]) AND ‘toxicity’[Subheading] or ‘drug overdose’[Majr:NoExp] command, and filtering the results by ‘case reports’, yielded only 11 and 5 journal articles, respectively. In addition, the Medical Subject Heading (MeSH) terms ‘cyclosporine’ and ‘medication errors’ were applied to obtain more data on this issue, but only one article was found. To avoid overlooking other relevant data, the author also tried using a (‘Cyclosporine/adverse effects’[Majr] OR ‘Cyclosporine/poisoning’[Majr] OR ‘Cyclosporine/toxicity’[Majr]) AND ‘Hematopoietic Stem Cell Transplantation’[Majr] search command, which identified 24 journal articles. The ScienceDirect database was also explored in the ‘advanced search’ mode with a TITLE-ABSTR-KEY(cyclosporine) and TITLE-ABSTR-KEY(toxicity) command, which yielded 925 outputs after 1983—the year in which CsA received approval from the US Food and Drug Administration for use in transplantation. A similar search process using the terms ‘cyclosporine’ and ‘overdose’ resulted in 855 journal articles. After screening, it was determined that most of these articles were irrelevant to the scope of this report. From them, the author chose only 15 cases, on the basis of their relevance, to build this review on CsA overdose. Also, some other useful articles were added to provide further explanation about the reports.\n\nResults and Discussion\nThe 26-year-old female allogeneic HSCT recipient presented here mistakenly received a high CsA dose of 500 mg on day −3, instead of a 120 mg intravenous dose, because the medication prescription was hardly readable and it was mistaken for another commonly used peri-transplantation drug with a similar name. This overdosage caused signs and symptoms of acute adverse reactions and toxicity. To our knowledge, the demonstrated constellation of symptoms, as we observed collectively in this case and in this specific setting, seems to be unique in the medical literature.\n\nSymptoms\nIt has been stated frequently that signs and symptoms of CsA acute adverse reactions or toxicities can present both with therapeutic doses and with overdoses. However, the probabilities of some reactions, such as neurotoxicity or nephrotoxicity, are higher with higher CsA doses and blood concentrations [1]. As mentioned, our patient’s symptoms generally were of a gastrointestinal, cardiovascular and neurological nature. Gastrointestinal intolerance has been identified as one of the most important CsA side effects, which is preventable by a ‘go low, go slow’ strategy—contrary to what happened to our patient [2]. Such complications are commonly reported with oral CsA overdose and are highly predictable with the first dose—and this was the first complaint of our patient as well. Sensations of increased abdominal girth, taste disturbance, anorexia and mild stomach upset were reported in a multiple sclerosis case after unintentional overdosing of oral CsA for 8 days. After discontinuation, the stomach upset was relieved within a day, but it took 2 weeks for the anorexia and the sensation of increased abdominal girth [3] to disappear.\n\nGastroparesis accompanied by nausea, vomiting, bloating and early satiety have been associated with CsA administration in bone marrow transplant patients [4]. In our patient, the onset of the gastrointestinal adverse reaction was consistent with the timing of the estimated Cmax values in the pharmacokinetic evaluations.\n\nAccording to our search results, nephrotoxicity is one of the most frequently reported toxicities of CsA even in acute circumstances. Besides numerous other aetiologies, CsA has been implicated as the main cause of renal failure after HSCT [5]. It has been shown that such damage can be either reversible or irreversible. Acute kidney injury (creatinine levels increased from 1.1 to 1.4 mg/dL) has been reported with a CsA overdose, which was corrected about 1 day after withdrawal [3]. Conversely, in a 29-year-old lung transplant recipient who received a 30 mg/kg/day dose instead of 3 mg/kg/day by mistake, progressive anuria and a subicteric status presented with blood CsA concentrations of 4100 ng/mL after 18 h. CsA was stopped but then resumed after 4 days with detection of 80 ng/mL blood concentrations. After 10 days, the icterus had disappeared, but renal failure with proteinuria necessitated continued use of haemodialysis for 6 weeks post-transplantation. The patient’s final creatinine clearance measurement was 18 mL/min, without further improvement, and he died of endocarditis–septic shock after 14 weeks [6]. Generally, it could be stated that dose dependency, or pharmacokinetic allowable of this adversity, is not a constant finding [7, 8]. In our case, an episode of an increase in serum creatinine was observed around day +15, but this was after several days of administration of an aminoglycoside (amikacin) for a new-onset fever. This makes CsA overdose a less relevant aetiology. Serum creatinine levels are routinely measured for this adverse effect at our centre, as at other centres, but it should be kept in mind that the possibility of a temporal delay between an initial CsA insult and the onset of biochemically detectable renal impairment has been proposed in the literature [9].\n\nNeurotoxicity could be the most prominent acute symptom observed with CsA overdose [10]. CsA neurotoxicity is an annoying—but common—complication in HSCT, with a wide spectrum of presentations ranging from tremors, restlessness, dysesthesias of the palms and soles, paraesthesia, headache, depression, confusion and somnolence to Parkinsonism, seizures, altered mental status with confusion, visual or auditory hallucinations, cortical blindness, encephalopathy, and coma. Specifically, symptoms such as a burning sensation in the mouth, plus feet and hand hyperaesthesia, have been reported with CsA overdose, and disappeared 1 week after withdrawal [3].\n\nIn the first published case report of a fatal CsA overdose in an adult, a 51-year-old man with a lung transplant received a 30 mg/h CsA infusion (instead of 3 mg/h) for 13 h; this resulted in massive cerebral oedema and death. The first symptoms were bilateral, reactive mydriasis and absence of cutaneous and tendinous reflexes. Diffuse cerebral oedema was detected by computed tomography. Then, through development of severe intracranial hypertension, progressive, non-reactive, bilateral mydriasis and disappearance of cephalic reflexes also occurred, which ended in the patient’s death. An important finding of this report was that the CsA concentration after 7 h of the toxic infusion was 1256 ng/mL despite recordings of therapeutic concentrations in routine daily measures, because of missing Cmax measurements. Just like our patient, this patient had serum creatinine and hepatic enzyme levels within normal ranges [11].\n\nIn the setting of HSCT, a 34-year-old woman with myelodysplastic syndrome was described as having a severe occipital headache immediately after transplantation, development of acute-onset left-sided weakness, blurred vision in the right eye, confusion, incomprehensible speech and seizure activity on the left side of the body on day +5, which was related to CsA neurotoxicity concurrent with therapeutic concentrations (279 ng/mL) [12]. Acute (early-onset) posterior encephalopathy has also been reported 36 h after initiation of CsA infusion for GVHD prophylaxis. The symptoms, which included a seizure, headache, visual disturbances and altered mental status, were reversible after CsA withdrawal [13]. Although these two instances occurred at therapeutic doses and therapeutic blood concentrations, they were concomitant with the start and increased concentrations of CsA.\n\nTremor is one of the most alarming and easily detectable symptoms of CsA toxicity. This presentation is referred to as ‘toxic transplant tremor’. It generally arises from severely elevated blood drug concentrations [14]. The occurrence of a synergistic and deteriorating effect has also been proposed when CsA is co-administered with other neurotoxic drugs [15], which is a prevalent occasion in HSCT conditioning. Our patient had significant neurological complications, including tremor and vertigo. Considering the time proximity of the overdosage and symptoms, it could be stated that there was a high probability that the patient presentation’s was caused by CsA. The Naranjo assessment score was 6, as there have been previous conclusive reports on the reaction (+1 point); the adverse event occurred just after the drug administration (+2 points); the adverse reaction was improved by withholding a dose and decreasing blood concentrations (+1 point); the same administration did not reoccur for the patient (0 points); there were alternative possible causes, such as the conditioning regimen, for the reaction (−1 point); no placebo was given for checking (0 points); high blood concentrations were detected (+1 point); the reaction was undetectable when the dose was decreased (+1); it was the first exposure for the patient (0 point); and the adverse event was confirmed by objective laboratory and clinical examinations (+1 point). If possible, neuroimaging studies should be implemented in such instances, but, because of the subtle clinical picture with rapid resolution, a clinical decision was made not to break the patient’s microbial isolation. In many similar observations, a neurotoxic syndrome has been detected at therapeutic blood CsA concentrations. Therefore, the presence of a complicated drug–effect correlation, and a possible role of numerous intruding factors of the patient’s peri-transplantation status, could be proposed.\n\nCsA can induce a range of cardiovascular effects, from mild complications to life-threatening adverse effects. Low-level hypertension is a common finding in CsA recipients. The occurrence of a transient increase in blood pressure through complex mechanisms soon after administration of CsA has been suggested [16]. Even the coronary and cerebral vascular systems are affected by this medication, which can result in hazardous outcomes. Also, direct cardiotoxic effects have been reported with CsA, such as sinus bradycardia [17] or decreased myocardial contractile force [18]. In a report of a 61-year-old candidate for kidney transplantation, inadvertent preoperative administration of CsA 1000 mg instead of mycophenolate caused atrial fibrillation. Besides heart rhythm problems, the patient showed no other abnormality on clinical and laboratory examinations. Serum CsA concentrations at 1 and 18 h after ingestion were 2438 and 123 ng/mL, respectively. The ECG was normalized to sinus rhythm within 1 h. After 24 h, the patient was asymptomatic and was discharged [19]. Peripheral symptoms such as flushing of the face and foot swelling have also been reported with CsA overdose [3].\n\nInterestingly, our patient demonstrated an infusion-reaction-like syndrome, including flushing and chest tightness with the solid oral product. This could be explained by acute release of a relatively large amount of the drug into the bloodstream in the first CsA exposure. Despite previous observations of similar reactions to intravenous CsA [20], our report proposes that ‘first’ and ‘high’ exposure would also be considerable factors for such complications, besides the dosage form. At our centre, blood pressure is measured every 6 h in all transplant patients, and on seven consecutive occasions (at 4, 6, 12, 18, 24, 30 and 36 h after dosing), the patient’s blood pressure was higher than at baseline although this required no therapy, but such a rapid effect on the cardiovascular system was considerable (and this finding was inconsistent with an anaphylactoid reaction). According to the above-mentioned studies, performance of an ECG and cardiac enzyme monitoring (due to the chest symptoms of the patient) were rational and recommendable approaches in such circumstances.\n\nManagement\nIt could be stated that currently there is no globally accredited guideline for management of CsA overdose especially in the setting of HSCT, but gathering the sparse data available from several case reports would be helpful in achieving a consensus.\n\nIn one of the foremost reports of CsA overdose, a 32-year-old kidney transplant recipient received CsA 5000 mg instead of 750 mg. The medication error was discovered 3 h after ingestion. For management of the situation, practitioners administered activated charcoal 60 g followed by two 30 g doses every 4 h, with two doses of magnesium citrate between the charcoal doses. The plasma drug concentrations were 6700, 675 and 50 ng/mL at 4, 13 and 47 h after ingestion, respectively. The authors calculated the CsA apparent half-lives as being much shorter during charcoal administration [21].\n\nAmong the paediatric population, acute overdose with 30 mL (300 mg or 170 mg/kg) of a CsA liquid formulation has been reported in a 4.5-year-old, 17 kg renal transplant recipient. Gastric decontamination was undertaken with ipecac syrup 1 mL/kg 20 min after ingestion, which was ineffective, and this was repeated 40 min after ingestion, with successful emesis. One hour after ingestion, activated charcoal 2 g/kg plus sorbitol was administered in the emergency department. Measurement of blood CsA concentrations after 2 h showed therapeutic concentrations. After 4 h, the patient was stable without an intoxicated appearance, so he was discharged and, on medical instructions, only his next CsA dose was skipped [22].\n\nBesides gastrointestinal decontamination, enhancement of metabolic elimination with pharmacological enzyme inducers, such as rifampin, phenytoin or phenobarbital, has been tried with partial success in some instances [23]. In a 61-year-old man, after administration of 75 mL of CsA emulsion (7500 mg) via a feeding tube in hospital, the CsA trough concentration was 3687 ng/mL. When intravenous phenytoin was started for management of central nervous system symptoms, the CsA trough concentration decreased to 171 ng/mL after about 5 days [10].\n\nAlso, a 68-year-old man with a transplanted kidney received a 100-fold oral overdose of CsA, which was discovered within 2 h. Measurements showed plasma CsA concentrations over 1500 ng/mL. Detoxification therapy started with intensive gastric lavage followed by suction and instillation of cholestyramine (4000 mg/bag) but after 8 h, the concentrations were only slightly decreased. Considering CsA pharmacokinetics and distributive characteristics, whole-blood exchange (WBE) was performed. For management of CsA-related acute renal failure, continuous haemofiltration was applied 2 h after WBE. No considerable change in serum CsA concentrations was found after WBE. However, plasma CsA concentrations were rapidly decreased after haemofiltration was started, falling to 802 ng/mL after 2 h and to 159 ng/mL after 72 h of continued haemofiltration, respectively. After 5 days of haemofiltration for anuria, the patient recovered and was finally discharged. On the basis of pharmacokinetic calculations, the authors raised doubt that the CsA elimination during haemofiltration could also have been a consequence of its original elimination rate; therefore, they suggested hemofiltration only for patients with fully formed renal impairment [24].\n\nA 55-year-old cardiac transplant patient received a 50-fold oral overdose of CsA (35 mL instead of 0.7 mL), which was mistakenly administered via an L-tube after the medication prescription was changed from a solid oral form to a syrup dosage form. Only transient deterioration of renal and hepatic function was noted. Because of the delay in detection, without gastrointestinal decontamination, the patient was treated with WBE by the apheresis method. The blood concentration decreased from 8900 ng/mL to 285.7 ng/mL after 3 days of the process, with normal serum creatinine and bilirubin levels [25].\n\nSince our major focus is on HSCT patients, our review of the literature includes a report in which a 38-year-old female allogeneic transplant recipient, after an intensive care unit admission and recovery, was prescribed a CsA oral suspension in a dosage of 125 mg twice daily via a nasogastric tube. However, the patient received an inadvertent overdose of 5000 mg on the first administration. The CsA overdose was discovered about 6.5 h after ingestion, and a blood concentration of 1797 ng/mL was recorded. After lavage, 50 g of activated charcoal and acetylcysteine were administered about 7.5 and 8 h after the CsA dose, respectively. Presentation of seizure-like activities was managed with phenobarbital. Serial magnetic resonance imaging (MRI) was performed for detection of posterior reversible encephalopathy syndrome. To help reduce the patient’s CsA concentrations, both plasma exchange and red blood cell (RBC) exchange were performed sequentially. In contrast to the previous report, at first the plasma exchange was initiated to avoid a delay in procurement of red cells. The CsA concentration was 782 ng/mL at the end of the plasma exchange, which was remarkable. After RBC exchange, the CsA concentration was reduced to 691 ng/mL. Another plasma exchange was also performed about 23 h after the overdose, after which the patient’s CsA concentration had reached the upper limit of the normal therapeutic range. Over the next week, the patient’s condition stabilized, and MRI showed clearance of mild white matter changes [26].\n\nAs we can see in these chronologically ordered case reports, therapeutic approaches have evolved a little from the earlier reports, yet it seems that a straightforward treatment method with proven efficacy has not been achieved.\n\nMedication Errors\nAcute CsA overdose has been reported more frequently with oral formulations but more severely with parenteral administration [27], and this may imply a lack of adequate outpatient education, besides more frequent use of oral formulations. In a report from the Swiss Toxicological Information Centre, iatrogenic errors were incriminated in about 46 % of overdose cases [28]. As stated in the above-mentioned case reports, acute CsA intoxication due to overdoses at medical centres can originate from ‘prescribing errors’ such as illegible handwriting, ‘medication errors’ including administration of the wrong doses due to peri-transplantation poly-pharmacy, misreading of decimals or zeros, miscalculation of the dose from one formulation to another and, finally, ‘negligence’ of the involved staff, making errors such as transcription errors in wards and pharmacies. A major challenge in such fields is medication error in substitution of solid oral formulations with liquid formulations [29]. Different amounts of drug per dose, different bioavailability, and different units of measurement may cause confusion, especially for administrators with less experience. In our case, a misreading of the ciprofloxacin prescription, resulting in erroneous administration of a ‘ciprofloxacin-sized’ dose of CsA, resulted in the overdose event. This fact underscores the roles of poly-pharmacy, prescribing error and medication errors in overdose cases. It should also be noted that the drug name ‘cyclosporine’ has different variants, including ‘ciclosporin’, which augments the potential for error through the similarity of this name to the drug name ‘ciprofloxacin’.\n\nConclusion\nWidespread use of CsA in the transplantation setting potentially has resulted in numerous cases of overdose and intoxication, but the number of reports in the medical literature is very small. In HSCT, the role of correct CsA dosing is very prominent because of the very high mortality rate associated with GVHD, the weakened state of patients after conditioning chemo-radiation without a successful transplant, and lack of suitable alternative therapeutic options. Therefore, both prevention and management of CsA overdose in HSCT are of great importance. These patients have different underlying diseases, co-medications, risk factors for toxicity and pharmacokinetic profiles for CsA, so different presentations of CsA overdose may occur in the HSCT population.\n\nFor prevention of such instances, use of typewritten prescriptions and labels, double-checking and use of more experienced staff for administration of peri-transplantation medications are highly recommended. Also, use of educational pamphlets or training classes on ‘drug name similarities’ would be helpful. At our centre, we have instituted a new policy that every physician’s prescription should be double-checked by two nurses (one of them should be the shift head nurse) before administration. Also, emergency contact with the physician about any suspicious handwriting is now obligatory for every drug-administering nurse.\n\nFor treatment, according to the above-mentioned reports, drug withdrawal and gastrointestinal decontamination are the first steps and seem to be the most effective strategy for management of CsA overdose. In light of this fact, early detection of the overdose is very important. Therefore, knowledge of the major and distinctive signs and symptoms of acute CsA intoxication in each specific population is very useful, and this is the main goal of this report. In our review of the relevant literature, common presentations of CsA intoxication have been summarized, but, because of the scarcity of data in the setting of HSCT, some informative case reports from other settings have also been included. Although it has been stated that measurement of blood CsA concentrations may have limited value in management of an acute CsA overdose [27], quantification of ‘on the spot’ CsA concentrations, instead of routine scheduled monitoring, would be very informative for discovering the extent of the overdose and decision making about the best therapeutic approach. The ‘golden hour’ for gastrointestinal decontamination—especially for induction of emesis or lavage and suction—is short, but currently no guideline for the best timing is available. Similar uncertainty exists for implementation of the second step, including more invasive approaches such as WBE. Use of enzyme inducers suffers from lack of adequate experience, unproven efficacy and an increased risk of unexpected peri-transplantation complications, especially in HSCT patients with complex pharmacokinetic and metabolic features. Also, it should be noted that enzyme induction is a time-consuming process [30], so, in acute cases, it should not hinder or replace implementation of more vital measures. Therefore, its place in treatment protocols should be just as an adjunctive therapy. However, if the patient has specific co-morbidities, such as seizure or infection, administration of phenytoin or rifampin, respectively, could be justified. Considering the pharmacokinetic variability of the HSCT population, ‘toxicokinetic’ studies on early-detected accidental overdose cases in this population would be very enlightening for development of practice guidelines. In comparison with the mean values of the pharmacokinetic parameters that have been calculated for this centre’s patients [unpublished data], for our intoxicated patient, clearance of the drug was (fortunately) faster, the half-life was shorter, and the bioavailability was about half the estimated mean value, with similar products. This may, to some extent, explain the short duration and mild presentation of our patient’s symptoms. On the other hand, these could have been related to the occurrence of high-grade GVHD in the outpatient setting when our patient was receiving oral CsA dosing. In this patient’s toxic state, the drug’s half-life was over 12 h, whereas the drug’s half-life in a normal situation is 3.85 h. This finding may imply that CsA pharmacokinetics are altered in overdose states.\n\nBesides goal-directed therapies for intoxication—which generally has shown controversial results—supportive care for maintaining organ function or for reversal of dysfunction, such as administration of antioxidants, respiratory support and dialysis, can have a major role in survival of overdosed patients. This fact underscores the importance of frequent monitoring of biomedical and biochemical markers, as was done in our case.\n\nCsA is a critical agent used extensively for immunomodulation in the stem cell transplantation setting, and it has a narrow therapeutic index, so constant awareness on the part of health care providers regarding the possibility of medication errors and detection of toxicity symptoms could possibly decrease CsA-related morbidity and mortality in the future.\n\nThe author wishes to acknowledge the assistance of Radan English Edit for the editing of this manuscript, and Dr. M. Tavakoli and Mr. A. Sharifi Sistani for their supportive supervision.\n\nCompliance with Ethical Standards\nFunding\nNo sources of funding were used in the preparation of this report.\n\nConflict of interest\nAli Tafazoli has no conflicts of interest that are directly relevant to the content of this report.\n\nEthical approval\nWritten informed consent was obtained from the patient, with a promise for anonymous data publication for the purpose of improvement of clinical care for transplant patients. All activities related to this manuscript were conducted in accordance with the Shahid Beheshti University of Medical Sciences ethical regulations.\n==== Refs\nReferences\n1. Tafazoli A Cyclosporine use in hematopoietic stem cell transplantation: pharmacokinetic approach Immunotherapy. 2015 7 7 811 836 10.2217/imt.15.47 26250413 \n2. Dijkmans B van Rijthoven A Goei Thè H Boers M Cats A Cyclosporine in rheumatoid arthritis Semin Arthritis Rheum. 1992 22 1 30 36 10.1016/0049-0172(92)90046-G 1411580 \n3. Baumhefner RW Myers LW Ellison GW Tourtellote WW Belendiuk GW Wilkinson A Huge cyclosporin overdose with favourable outcome Lancet. 1987 2 8554 332 10.1016/S0140-6736(87)90916-0 2886787 \n4. Eagle D Gian V Lauwers G Manivel J Moreb J Mastin S Gastroparesis following bone marrow transplantation Bone Marrow Transplant. 2001 28 1 59 62 10.1038/sj.bmt.1703084 11498745 \n5. Piñana J Valcárcel D Martino R Barba P Moreno E Sureda A Study of kidney function impairment after reduced-intensity conditioning allogeneic hematopoietic stem cell transplantation: a single-center experience Biol Blood Marrow Transplant. 2009 15 1 21 29 10.1016/j.bbmt.2008.10.011 19135939 \n6. Dussol B Reynaud-Gaubert M Saingra Y Daniel L Berland Y Acute tubular necrosis induced by high level of cyclosporine A in a lung transplant Transplantation. 2000 70 8 1234 1236 10.1097/00007890-200010270-00018 11063346 \n7. Banner N Yacoub M Cyclosporine in thoracic organ transplantation Transplant Proc. 2004 36 2 Suppl 302S 308S 10.1016/j.transproceed.2004.01.031 15041358 \n8. Zager R O’Quigley J Zager B Alpers C Shulman H Gamelin L Acute renal failure following bone marrow transplantation: a retrospective study of 272 patients Am J Kidney Dis. 1989 13 3 210 216 10.1016/S0272-6386(89)80054-X 2645771 \n9. Trull A Hue K Tan K Gore S Whitewood S Smyth R Cross-correlation of cyclosporine concentrations and biochemical measures of kidney and liver function in heart and heart–lung transplant recipients Clin Chem. 1990 36 8 Pt 1 1474 1478 2387045 \n10. Nghiem DD Role of pharmacologic enhancement of p-450 in cyclosporine overdose Transplantation. 2002 74 9 1355 1356 10.1097/00007890-200211150-00027 12451279 \n11. de Perrot M Spiliopoulos A Cottini S Nicod L Ricou B Massive cerebral edema after IV cyclosporin overdose Transplantation. 2000 70 8 1259 1260 10.1097/00007890-200010270-00025 11063353 \n12. Shbarou R Chao N Morgenlander J Cyclosporin A-related cerebral vasculopathy Bone Marrow Transplant. 2000 26 7 801 804 10.1038/sj.bmt.1702603 11042665 \n13. Torelli G Natalino F Barberi W Iori A Andreoli C Valle V Early onset of posterior reversible encephalopathy syndrome (PRES) during cyclosporine A infusion Leuk Res. 2011 35 10 1423 1424 10.1016/j.leukres.2011.02.022 21397327 \n14. Eisenberg S The case of the toxic transplant tremors ONS Connect. 2013 28 3 41 24028048 \n15. Barbui T Rambaldi A Parenzan L Zucchelli M Perico N Remuzzi G Neurological symptoms and coma associated with doxorubicin administration during chronic cyclosporin therapy Lancet. 1992 339 8806 1421 10.1016/0140-6736(92)91246-5 1350835 \n16. Taler S Textor S Canzanello V Schwartz L Cyclosporin-induced hypertension: incidence, pathogenesis and management Drug Saf. 1999 20 5 437 449 10.2165/00002018-199920050-00004 10348094 \n17. Fujisaki G Kami M Murashige N Kishi Y Inokuchi C Tanosaki R Sinus bradycardia associated with cyclosporine following allogeneic hematopoietic stem cell transplantation Bone Marrow Transplant. 2005 35 2 211 212 10.1038/sj.bmt.1704747 15531900 \n18. Kingma I Harmsen E ter Keurs H Benediktsson H Paul L Cyclosporine-associated reduction in systolic myocardial function in the rat Int J Cardiol. 1991 31 1 15 22 10.1016/0167-5273(91)90262-N 2071246 \n19. LoVecchio FA Goltz HR Atrial fibrillation following acute overdose with oral cyclosporine Ann Pharmacother. 2000 34 3 405 10.1345/aph.19156 10917394 \n20. van Hooff J Bessems P Beuman G Leunissen K The absence of an allergic reaction to cyclosporine capsules in a patient allergic to standard oral and intravenous solutions of cyclosporine Transplant Proc. 1988 20 2 Suppl 2 640 3363660 \n21. Honcharik N Anthone S Activated charcoal in acute cyclosporin overdose Lancet. 1985 1 8436 1051 10.1016/S0140-6736(85)91660-5 2859506 \n22. Anderson AB Primack W Treatment of a child with acute cyclosporine overdose Pediatr Nephrol (Berlin, Germany). 1992 6 2 222 10.1007/BF00866326 \n23. Lucey MR Kolars JC Merion RM Campbell DA Aldrich M Watkins PB Cyclosporin toxicity at therapeutic blood levels and cytochrome P-450 IIIA Lancet. 1990 335 8680 11 15 10.1016/0140-6736(90)90137-T 1967328 \n24. Leitner GC Hiesmayr M Hoecker P Jilma B Therapeutic approaches in the management of oral cyclosporine A intoxication Transplantation. 2003 75 10 1764 1765 10.1097/01.TP.0000063935.20334.4B 12777877 \n25. Kwon SU Lim SH Rhee I Kim SW Kim JK Kim DW Successful whole blood exchange by apheresis in a patient with acute cyclosporine intoxication without long-term sequelae J Heart Lung Transplant. 2006 25 4 483 485 10.1016/j.healun.2005.11.440 16563982 \n26. Moorman M Epstein R Smith J O’Neal C Holter J Management of cyclosporine overdose in a hematopoietic stem cell transplant patient with sequential plasma exchange and red blood cell exchange J Clin Apher. 2011 26 3 156 158 10.1002/jca.20277 21647954 \n27. Arellano F Monka C Krupp PF Acute cyclosporin overdose: a review of present clinical experience Drug Saf. 1991 6 4 266 276 10.2165/00002018-199106040-00004 1888442 \n28. Ceschi A Rauber-Luthy C Kupferschmidt H Banner NR Ansari M Krahenbuhl S Acute calcineurin inhibitor overdose: analysis of cases reported to a national poison center between 1995 and 2011 Am J Transplant. 2013 13 3 786 795 10.1111/j.1600-6143.2012.04347.x 23279718 \n29. Fahimi F Baniasadi S Najafi Zadeh K Dose switch to another dosage form of Neoral increase the risk of medication error? Ann Transplant. 2009 14 4 58 60 20009157 \n30. von Bahr C Steiner E Koike Y Gabrielsson J Time course of enzyme induction in humans: effect of pentobarbital on nortriptyline metabolism Clin Pharmacol Ther. 1998 64 1 18 26 10.1016/S0009-9236(98)90018-2 9695715\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2199-1162",
"issue": "2(1)",
"journal": "Drug safety - case reports",
"keywords": null,
"medline_ta": "Drug Saf Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101674544",
"other_id": null,
"pages": "20",
"pmc": null,
"pmid": "27747732",
"pubdate": "2015-12",
"publication_types": "D016428:Journal Article",
"references": "12777877;2071246;24028048;21647954;10917394;26250413;1411580;1967328;1888442;11063353;11063346;16563982;15041358;2645771;20009157;11498745;23279718;12451279;15531900;2387045;3363660;1350835;21397327;10348094;1571226;11042665;19135939;9695715;2886787;2859506",
"title": "Accidental Overdose of Oral Cyclosporine in Haematopoietic Stem Cell Transplantation: A Case Report and Literature Review.",
"title_normalized": "accidental overdose of oral cyclosporine in haematopoietic stem cell transplantation a case report and literature review"
} | [
{
"companynumb": "IR-WATSON-2016-05572",
"fulfillexpeditecriteria": "1",
"occurcountry": "IR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "Acquired factor V inhibitor is an acquired coagulation disorder that is rare. We report the case of a patient who was treated with apixaban and developed acquired factor V inhibitor. The patient was a 76-year-old man who has been on long-term treatment with aspirin and clopidogrel after undergoing percutaneous coronary intervention (PCI) and carotid artery stenting. In June, he developed a cerebral infarction six days after the second PCI. Apixaban was added to his treatment regimen for cariogenic cerebral embolism. Three months later, intramuscular hemorrhage occurred in his left leg after a fall. However, the hemorrhage improved upon aspirin withdrawal. Unexpectedly, subcutaneous and intramuscular hemorrhage recurred three months after the patient commenced anticoagulation therapy. At this time, the APTT was 242.5 seconds and the PT was over the reference range. Although clopidogrel and apixaban were discontinued, these abnormalities did not improve. However, a cross-mixing test showed an inhibitor pattern, with factor V activity being less than 1% and its inhibitor level being 8.0 BU/ml. Based on these findings, the patient was finally diagnosed of acquired factor V inhibitor. One month after prednisolone administration at 20 mg/day, the PT and APTT were normalized, and prednisolone was tapered off. Although the use of dabigatran has been associated with iatrogenic acquired factor V inhibitor, we describe the first case of acquired factor V inhibitor associated with direct Xa inhibitor.",
"affiliations": "Department of Hematology/Oncology, Wakayama Medical University.;Department of Hematology/Oncology, Wakayama Medical University.;Department of Hematology/Oncology, Wakayama Medical University.;Department of Cardiology, Kinan Hospital.;Department of Cardiology, Kinan Hospital.;Departmentof Central Clinical Laboratory, Kinan Hospital.;Departmentof Central Clinical Laboratory, Kinan Hospital.;Department of Clinical Laboratory, Wakayama Medical University Hospital.;Department of Clinical Laboratory, Wakayama Medical University Hospital.;Department of Hematology/Oncology, Wakayama Medical University.;Department of Internal Medicine, Kinan Hospital.;Department of Hematology/Oncology, Wakayama Medical University.",
"authors": "Tochino|Yuichi|Y|;Mushino|Toshiki|T|;Hori|Yoshikazu|Y|;Miyamoto|Yoshiyuki|Y|;Miyamoto|Masaoki|M|;Koyama|Asumi|A|;Shiotani|Chieko|C|;Hirayasu|Kazuhiro|K|;Minoura|Naoto|N|;Tamura|Shinobu|S|;Nakano|Yoshio|Y|;Sonoki|Takashi|T|",
"chemical_list": "D065427:Factor Xa Inhibitors; D011720:Pyrazoles; D011728:Pyridones; C522181:apixaban; D005165:Factor V",
"country": "Japan",
"delete": false,
"doi": "10.11406/rinketsu.61.1660",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0485-1439",
"issue": "61(12)",
"journal": "[Rinsho ketsueki] The Japanese journal of clinical hematology",
"keywords": "Acquired factor V inhibitor; Apixaban; Cross mixing test",
"medline_ta": "Rinsho Ketsueki",
"mesh_terms": "D000368:Aged; D005165:Factor V; D065427:Factor Xa Inhibitors; D006801:Humans; D008297:Male; D062645:Percutaneous Coronary Intervention; D011720:Pyrazoles; D011728:Pyridones",
"nlm_unique_id": "2984782R",
"other_id": null,
"pages": "1660-1666",
"pmc": null,
"pmid": "33441517",
"pubdate": "2020",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acquired factor V inhibitor associated with apixaban.",
"title_normalized": "acquired factor v inhibitor associated with apixaban"
} | [
{
"companynumb": "JP-PFIZER INC-2019267773",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CANDESARTAN"
},
"drugadditional": null,
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.