article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "Standard pharmacologic closure of the patent ductus arteriosus currently involves the administration of 1 of 2 cyclooxygenase inhibitors: either indomethacin or ibuprofen. However, both of these drugs can be associated with potentially significant adverse effects. We present here the cases of 5 preterm infants (gestational age: 26-32 weeks; postnatal age: 3-35 days) with large, hemodynamically significant patent ductus arteriosus who had either failed or had contraindications to ibuprofen therapy. Each of these infants was treated with off-label oral paracetamol (15 mg/kg per dose every 6 hours). Ductal closure was achieved within 48 hours in all the treated infants. No toxicity was observed.",
"affiliations": "Department of Neonatology, Shaare Zedek Medical Center, Jerusalem, Israel. cathy@cc.huji.ac.il",
"authors": "Hammerman|Cathy|C|;Bin-Nun|Alona|A|;Markovitch|Einat|E|;Schimmel|Michael S|MS|;Kaplan|Michael|M|;Fink|Daniel|D|",
"chemical_list": "D000082:Acetaminophen",
"country": "United States",
"delete": false,
"doi": "10.1542/peds.2011-0359",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0031-4005",
"issue": "128(6)",
"journal": "Pediatrics",
"keywords": null,
"medline_ta": "Pediatrics",
"mesh_terms": "D000082:Acetaminophen; D004374:Ductus Arteriosus, Patent; D005260:Female; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D008297:Male",
"nlm_unique_id": "0376422",
"other_id": null,
"pages": "e1618-21",
"pmc": null,
"pmid": "22065264",
"pubdate": "2011-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ductal closure with paracetamol: a surprising new approach to patent ductus arteriosus treatment.",
"title_normalized": "ductal closure with paracetamol a surprising new approach to patent ductus arteriosus treatment"
} | [
{
"companynumb": "IL-STRIDES ARCOLAB LIMITED-2016SP016358",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional":... |
{
"abstract": "The development of a second primary malignancy in a patient with a preexisting diagnosis of metastatic cancer may be easily overlooked or misattributed to progression of disease. We report 3 patients with clear-cell renal cell carcinoma (RCC) metastatic to the lungs who were subsequently diagnosed with non-small-cell lung cancer (NSCLC). We examined the frequency of this occurrence within our institution and report on the radiographic findings that may help distinguish between metastatic RCC and primary lung cancers.\n\n\n\nPatients who received systemic targeted therapy for metastatic RCC at our institution between January 2006 and October 2013 were identified, and the proportion and incidence rate for developing NSCLC with preexisting metastatic RCC were calculated.\n\n\n\nTwo percent (3/151; 95% confidence interval [CI], 0.68%-5.68%) of patients treated for metastatic RCC with systemic targeted therapies at our institution were subsequently diagnosed with NSCLC, increasing to 3.5% (3/85; 95% CI, 1.21%-9.87%) among patients with known RCC pulmonary metastasis. The incident rate for development of NSCLC in patients with metastatic RCC was 0.87 per 100 person-years (95% CI, 0.22-2.4).\n\n\n\nThe subsequent diagnosis of a primary lung cancer in metastatic RCC patients occurred in 2% of patients at our institution and is underreported in the literature. Primary NSCLC may be underdiagnosed in patients with metastatic RCC. Both the radiographic appearance and clinical behavior of a lesion may hold clues that can help distinguish between a new primary and progression of metastatic disease.",
"affiliations": "Division of Hematology-Oncology, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX.;Department of Radiology, University of Texas Southwestern Medical Center, Dallas, TX; Advanced Imaging Research Center, University of Texas Southwestern Medical Center, Dallas, TX; Kidney Cancer Program, Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX.;Kidney Cancer Program, Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX; Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX.;Division of Hematology-Oncology, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX; Kidney Cancer Program, Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX. Electronic address: james.brugarolas@utsouthwestern.edu.",
"authors": "Bowman|Isaac A|IA|;Pedrosa|Ivan|I|;Kapur|Payal|P|;Brugarolas|James|J|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.clgc.2017.01.026",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1558-7673",
"issue": "15(4)",
"journal": "Clinical genitourinary cancer",
"keywords": "Metastatic renal cell carcinoma; NSCLC; Pulmonary nodule; Second primary tumor; ccRCC",
"medline_ta": "Clin Genitourin Cancer",
"mesh_terms": "D000368:Aged; D002289:Carcinoma, Non-Small-Cell Lung; D002292:Carcinoma, Renal Cell; D003937:Diagnosis, Differential; D018572:Disease-Free Survival; D006801:Humans; D007680:Kidney Neoplasms; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D016609:Neoplasms, Second Primary; D011379:Prognosis",
"nlm_unique_id": "101260955",
"other_id": null,
"pages": "e675-e680",
"pmc": null,
"pmid": "28258962",
"pubdate": "2017-08",
"publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural",
"references": "12607253;9595616;26645862;19826129;2014294;20378057;9751330;26406148;20035188;10561319;8517317;17646462;21502558;26443601;21496838;16536756;14974599;21890909",
"title": "Renal Cell Carcinoma With Pulmonary Metastasis and Metachronous Non-Small Cell Lung Cancer.",
"title_normalized": "renal cell carcinoma with pulmonary metastasis and metachronous non small cell lung cancer"
} | [
{
"companynumb": "PHHY2017US119783",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PAZOPANIB"
},
"drugadditional": null,
"druga... |
{
"abstract": "Abrupt alanine aminotransferase (ALT) elevation during direct-acting antiviral agents (DAA) treatment is an uncommon but noticeable adverse event in chronic hepatitis C (CHC) patients, which may lead to early termination of treatment. This study aims to investigate the incidence, outcome and predictors of the on-treatment ALT elevation during DAA therapy.CHC patients treated with DAA regimen in Chang Gung Memorial Hospital, Linkou branch during March 2015 to March 2019 were recruited. Prospective scheduled ALT assessment at baseline, 2nd, 4th, 8th, and 12th/24th weeks were recorded. Pretherapy host and viral factors were compared between patients with and without on-treatment ALT elevation. Multivariate logistic regression was used for independent factors for on-treatment ALT elevation.A total of 1563 CHC patients treated with grazoprevir/elbasvir, glecaprevir/pibrentasvir and sofosbuvir-based regimen were analyzed. On-treatment ALT elevation occurred in 10.9% patients while those treated with glecaprevir/pibrentasvir had the least possibility (5.4%). Only 1.4% patients had ≥grade 3 ALT elevation events. The presence of such events had no impact on sustained virological response 12 rates. Hepatitis B virus coinfection (aOR: 3.599, P < 0.001) and higher pretherapy ALT (1-5x, ≥5x upper limit of normal: aOR: 2.632, P = 0.024, aOR: 4.702, P = .011, respectively) were significant predictors for ALT elevation.On-treatment ALT elevation occurred in one-tenth CHC patients treated with preferred DAAs but had no impact on sustained virological response rate.",
"affiliations": "Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.;Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch.",
"authors": "Liu|Yen-Chun|YC|;Jeng|Wen-Juei|WJ|0000-0002-3706-1259;Cheng|Ya-Ting|YT|;Hsieh|Yi-Chung|YC|;Teng|Wei|W|;Chen|Yi-Cheng|YC|;Lin|Chun-Yen|CY|;Chien|Rong-Nan|RN|;Sheen|I-Shyan|IS|",
"chemical_list": "D000577:Amides; D000998:Antiviral Agents; D001562:Benzimidazoles; D002219:Carbamates; D003521:Cyclopropanes; D011759:Pyrrolidines; D011810:Quinoxalines; D013449:Sulfonamides; C000622691:pibrentasvir; C578009:grazoprevir; D000410:Alanine Transaminase; D000069474:Sofosbuvir",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000021898",
"fulltext": "\n==== Front\nMedicine (Baltimore)\nMedicine (Baltimore)\nMEDI\nMedicine\n0025-7974 1536-5964 Lippincott Williams & Wilkins Hagerstown, MD \n\nMD-D-20-03712\n10.1097/MD.0000000000021898\n21898\n4500\nResearch Article\nObservational Study\nIncidence and predictors for abnormal liver function during direct-acting antiviral agents in chronic hepatitis C patients\nLiu Yen-Chun MDab http://orcid.org/0000-0002-3706-1259Jeng Wen-Juei MDab∗ Cheng Ya-Ting MDab Hsieh Yi-Chung MDab Teng Wei MDab Chen Yi-Cheng MDab Lin Chun-Yen PhDab∗ Chien Rong-Nan MDab Sheen I-Shyan MDab Mubarak. Muhammed a Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital, Linkou branch\nb College of Medicine, Chang Gung University, Taiwan.\n∗ Correspondence: Wen-Juei Jeng, Chun-Yen Lin, Chang Gung Memorial Hospital, 199, Tung Hwa North Road, Taipei, 105, Taiwan (e-mail: rachel.jeng@gmail.com, chunyenlin@gmail.com).\n11 9 2020 \n11 9 2020 \n99 37 e2189823 4 2020 26 6 2020 24 7 2020 Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc.2020This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0Supplemental Digital Content is available in the text\n\nAbstract\nAbrupt alanine aminotransferase (ALT) elevation during direct-acting antiviral agents (DAA) treatment is an uncommon but noticeable adverse event in chronic hepatitis C (CHC) patients, which may lead to early termination of treatment. This study aims to investigate the incidence, outcome and predictors of the on-treatment ALT elevation during DAA therapy.\n\nCHC patients treated with DAA regimen in Chang Gung Memorial Hospital, Linkou branch during March 2015 to March 2019 were recruited. Prospective scheduled ALT assessment at baseline, 2nd, 4th, 8th, and 12th/24th weeks were recorded. Pretherapy host and viral factors were compared between patients with and without on-treatment ALT elevation. Multivariate logistic regression was used for independent factors for on-treatment ALT elevation.\n\nA total of 1563 CHC patients treated with grazoprevir/elbasvir, glecaprevir/pibrentasvir and sofosbuvir-based regimen were analyzed. On-treatment ALT elevation occurred in 10.9% patients while those treated with glecaprevir/pibrentasvir had the least possibility (5.4%). Only 1.4% patients had ≥grade 3 ALT elevation events. The presence of such events had no impact on sustained virological response 12 rates. Hepatitis B virus coinfection (aOR: 3.599, P < 0.001) and higher pretherapy ALT (1-5x, ≥5x upper limit of normal: aOR: 2.632, P = 0.024, aOR: 4.702, P = .011, respectively) were significant predictors for ALT elevation.\n\nOn-treatment ALT elevation occurred in one-tenth CHC patients treated with preferred DAAs but had no impact on sustained virological response rate.\n\nKeywords\ndrug related hepatitisglecaprevir/pibrentasvirgrazoprevir/elbasvirsofosbuvir/ledipasvirsofosbuvir/velpatasvirChang Gung Medical FoundationCMRPG3I0271-2Wen-Juei JengOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nDirect acting antiviral agents (DAAs) treatment greatly improved the sustained virological response (SVR) rate in chronic hepatitis C (CHC) patients from 70% by interferon-based regimen to >90%, with much less side effect and more tolerable in compensated and decompensated cirrhotic patients as well as the elderly.[1–5]\n\nIn 2015, severe liver injury and deterioration of liver function during ombitasvir/paritaprevir/ritonavir/dasabuvir (Viekirax, PrOD) treatment has been reported in 26 CHC patients with advanced liver disease by the US Food and Drug Administration (FDA). Ten of the 26 patients had hepatic failure resulting in transplantation or death.[6] In 2019, warning of liver decompensation during the use of grazoprevir/elbasvir (Zepatier, G/E), glecaprevir/pibrentasvir (Maviret, G/P) and sofosbuvir/velpatasvir/voxilaprevir (Vosevi) was issued by FDA with the interval of 22 days from start of therapy.[7] High grade, especially grade ≥3, liver biochemistry (LFT) abnormalities during treatment leading to adverse events and early termination were also reported in clinical trials.[8–12]\n\nLittle is known about the incidence of on-treatment alanine aminotransferase (ALT) elevation in real-world practice as well as its impact on treatment outcome such as DAA discontinuation rate and SVR rate. Thus, this study aims to investigate the incidence, predictors and outcome of the on-treatment ALT elevation during DAA therapy in CHC patients.\n\n2 Patients and methods\n2.1 Patient selection\nCHC patients, defined as persist anti- hepatitis C virus (HCV) antibody positive with viremia for more than 6 months, treated with interferon-free DAA regimen during March 2015 to March 2019 in Chang Gung Memorial Hospital, Linkou branch, Taiwan were prospectively registered with retrospective analyzed. This study was conducted adherence to the Declaration of Helsinki and approved by the Institutional review board (No. 1805240064) of Chang Gung Memorial Hospital. Patients older than 18-year-old with detectable HCV RNA at the time of antiviral therapy were eligible. Patients who did not complete the treatment course due to reasons other than abnormal LFT were excluded. Those with viable hepatocellular carcinoma (HCC) confirmed by ultrasound, CT scan or MRI within 3 months before screening were also excluded to avoid the cofounding effect on abnormal LFT secondary to HCC treatment.\n\n2.2 Antiviral therapy\nA 8 to 24 weeks course of DAA therapy was given depends on HCV genotype, liver fibrosis status, and DAA regimen chosen adherent to guideline suggestion.[13–15] Patients treated with preferred DAAs suggested by current guidelines including (Zepatier[Merck], G/E), (Maviret [AbbVie], G/P) and sofosbuvir-based regimens including sofosbuvir + ribavirin, sofosbuvir/velpatavir (Epclusa [Gilead]), and sofosbuvir/ledipasvir (Harvoni [Gilead]) were analyzed.\n\nAdditional 467 patients receiving ombitasvir/paritaprevir/ritonavir/dasabuvir (Viekirax, PrOD, N = 324) and asunaprevir/daclatasvir (ASV/DCV, N = 143) were compared for the incidence and timing of “on-treatment ALT elevation” in the supplementary analysis.\n\n2.3 Pretreatment characteristics and on-treatment monitoring and assessment\nThe pretreatment characteristics including age, sex, body mass index(BMI), steatosis, aspartate aminotransferase (AST), ALT, total bilirubin (T-bil.), albumin, international normalized ratio, alpha-fetoprotein (AFP), glycohemoglobin, total cholesterol, triglyceride, LDL, HDL, HOMA index, HCV genotype, HCV viral load and co-infected with hepatitis B virus were compared between patients with and without “on-treatment ALT elevation”.\n\nALT and T-bil. level were prospectively assessed by scheduled timepoints: baseline, 2nd, 4th, 8th, and 12th/24th weeks during DAA treatment. “On-treatment ALT elevation” was defined as ALT elevation ≥1.1 times(x) baseline or nadir value accompanied by ALT elevation ≥1.25x the upper limit of normal (ULN) values.[16,17] “Abnormal total bilirubin” was defined as T-bil. elevation ≥1.5 times(x) baseline or nadir accompanied by ≥1.1x the ULN values.[16] The severity of ALT elevation was categorized by 1.25x-3x ULN as grade 1, >3x-5x ULN as grade 2, >5x-20x ULN as grade 3, and >20x ULN as grade 4. The severity of T-bil. elevation was categorized by 1.1x-1.5x ULN as grade 1, >1.5x-3x ULN as grade 2, >3x-10x ULN as grade 3, and >10x ULN as grade 4.[16] SVR was defined as undetectable HCV RNA at post DAA treatment week 12 (SVR12). Liver cirrhosis was diagnosed by histological findings (N = 43), and/or consistent ultrasonographic features compatible with liver cirrhosis supplemented with splenomegaly and/or thrombocytopenia (N = 762), and/or endoscopy finding with varices (N = 151). Steatosis was identified by conventional ultrasonography.[18]\n\n2.4 Statistical analysis\nContinuous variables were summarized as means ± SD or median (range) and analyzed by Student's unpaired t test or Mann–Whitney U tests according to their normality distribution. Categorical variables were summarized using frequencies and analyzed the outcome by chi-squared or Fisher exact test. Logistic regression was applied to investigate independent predictors of on-treatment abnormal ALT. All analyses were 2-tailed tests based on a significance level of 0.05. The statistical analysis was conducted using SAS version 9.4 (SAS Institute, Inc, Cary, NC).\n\n3 Results\n3.1 Patient cohort and clinical characteristics\nA total of 1563 patients completing preferred DAA suggested by guidelines were enrolled into analysis [grazoprevir/elbasvir, N = 373; sofosbuvir-based, N = 967 (sofosbuvir ± ribavirin, N = 275; sofosbuvir/ledipasvir, N = 589; sofosbuvir/velpatasvir, N = 103), glecaprevir/pibrentasvir, N = 223]. There were 11 patients lost follow-up during therapy, 20 patients discontinued treatment due to other causes rather than LFT abnormality and 173 patients with viable HCC status (Fig. 1). Drug-drug interaction was surveyed and avoided as possible prior to the start of DAA therapy.\n\nFigure 1 Study consort diagram with patients’ recruitment.\n\nAmong these 1563 patients, the mean age was 64.1, 649 (41.5%) were male, 784 (50.2%) were cirrhotic, 1305 (83.5%) were treatment naïve, 865 (55.3%) were HCV genotype 1, and 100 (6.4%) had hepatitis B virus (HBV) coinfection (Table 1). “On treatment ALT elevation” was documented in 170 patients (10.9%). SVR 12 was achieved in 98.2% patients by preferred DAAs (99.4% with G/E, 97.4% with sofosbuvir-based regimens and 99.6% with G/P, Table 2). The SVR 12 rate was comparable to the preferred DAAs in patients treated with PrOD (98.8%) but much lower in those treated with ASV/DCV (90.9%) (Supplemental Table 1). None of these patients using preferred DAAs had hepatic failure or liver-related mortality secondary to on-treatment abnormal LFT events.\n\nTable 1 Pretherapy demographic comparison between patients with and without on-treatment ALT elevation.\n\nTable 2 SVR rate comparison between patients with and without on-treatment ALT elevation.\n\n3.2 Characteristics between patients with and without “on treatment ALT elevation”\nComparing to those without “on-treatment ALT elevation”, patients with cirrhosis (66.5% vs 48.2%, P < 0.001), HBV coinfection (12.4% vs 5.7%, P < .001), higher BMI (median: 25.5 vs 24 kg/m2, P < .001), HbA1c (median: 6.0 vs 5.8, P = .002), HOMA index (median: 2.8 vs 2.1, P < .001), triglyceride (median: 102 vs 90 mg/dL, P = .002), ALT (median: 93 vs 52 U/L, P < .001), AST (median: 86 vs 48 U/L, P < .001), AFP (median: 6 vs 4 ng/mL, P < .001), T-bil. (median: 0.8 vs 0.7 mg/dL, P = .001) and lower albumin level (median: 4.1 vs 4.2 g/dL, P = .026) at pretherapy were more frequent to have “on-treatment ALT elevation” (Table 1). The incidence of “on-treatment ALT elevation” was slightly higher in patients with pretherapy steatosis (34.1% vs 27.6%, P = .074) yet not reach statistical difference. Among patients co-infected with HBV, there's no difference of “on-treatment ALT elevation” rate between the 3 different DAA regimens (P = .737).\n\n3.3 Incidence of abnormal LFT during different DAA regimens\nThe frequency of “on-treatment ALT elevation” was highest in those treated with G/E (12.3%), followed by sofosbuvir-based regimen (11.6%) and least in G/P (5.4%) treated patients (P = 0.016) (Table 1), similar to those treated with PrOD (10.8%) but much lower than that during ASV/DCV (39.9%) (Supplemental Table 2). The median time to event from start of treatment was shorter in those treated with G/P and PrOD (4 weeks), followed by sofosbuvir-based (6 weeks), G/E (7 weeks) and longest in those by ASV/DCV (12 weeks) (Table 3, Fig. 2). None of the G/P patients had ALT elevation severity ≥grade 3 while 7%, 3.2%, 1.9% and 1% in ASV/DCV, G/E, PrOD, and sofosbuvir treated patients had ALT elevation ≥grade 3 respectively (Table 3; Supplemental Table 2).\n\nFigure 2 “On-treatment ALT elevation” events (%) and time of onset during grazoprevir/elbasvir, sofosbuvir-based, and glecaprevir/pibrentasvir treatment.\n\nTable 3 The onset timing and severity of abnormal liver biochemistry during G/E, Sofosbuvir based and G/P therapy.\n\nThe events of T-bil. elevation were observed in 13.2% patients treated with preferred DAA, highest in those treated by sofosbuvir-based regimen (16.4%) followed by G/P (8.5%) and G/E (7.8%), and much lower than those treated with ASV/DCV (23.1%) and PrOD (29.4%). Grade 3/4 abnormality occurred mainly in patients with PrOD (2.5%), followed by sofosbuvir-based (1.2%), G/P (0.9%), ASV/DCV (0.7%) and none with G/E.\n\n3.4 Outcomes and treatment efficacy in patients encountering on-treatment ALT elevation\nThe SVR12 rates between patients with and without on-treatment ALT elevation was significantly different in those receiving ASV/DCV (83.9%: 95.4%. P = .034) and borderline significant in those with PrOD (94.3% vs 99.3%, P = .059). However, it has no impact on SVR 12 in patients treated with G/E (P = .232), sofosbuvir (P = .520), and G/P (P = 1.000) (Table 2; Supplemental Table 1). One patient (0.27%) treated by G/E, 2 patients (1.4%) by ASV/DCV and 6 patients (1.8%) by PrOD regimens had early termination of DAA treatment due to abnormal liver function. Among these 9 patients, only 1 patient treated with PrOD had hepatic decompensation. The SVR12 rate in these 9 early treatment termination patients was much lower than those completing treatment (67%) (Table 3; Supplemental Table 2). These patients’ characteristics were listed as Supplemental Table 3.\n\n3.5 Predictive factors for on-treatment ALT elevation\nAmong patients treated with preferred DAAs, cirrhosis, HBV coinfection, BMI ≥25, HbA1c ≥6.5, HOMA index ≥2, triglyceride≥150 mg/dL, use of sofosbuvir-based or G/E regimens, pretherapy ALT ≥1xULN, higher AST, AFP, T-bil. and lower albumin level were associated with on-treatment ALT elevation. In multivariate regression analysis, HBV coinfection [adjusted OR (95%CI): 3.599 (1.781–7.272), P < .001] and higher baseline ALT [ALT 1–5x, ≥5x ULN, adjusted OR (95%CI): 2.632 (1.135–6.104), P = .024; 4.702 (1.424–15.530), P = .011, respectively] were the independent predictor for on-treatment ALT elevation (Table 4). In addition, higher baseline ALT level is the only independent factors for on-treatment ALT elevation when excluding the patients with HBV coinfection (Supplemental Table 4, http://links.lww.com/MD/E772 and Supplemental Table 5, http://links.lww.com/MD/E773).\n\nTable 4 Predictors of on-treatment ALT elevation in patients treated with G/E, sofosbuvir-based and G/P regimens.\n\n4 Discussion\nIn this large-scale real-world study, we reported the incidence rate of on-treatment ALT elevation and ≥grade 3 ALT elevation was 10.9% and 1.4%, respectively under currently recommended DAAs. Higher pretherapy ALT and HBV coinfection were the risk factor for on-treatment ALT elevation during preferred DAAs treatment, which has no impact on SVR rates and only 1 patient had early terminated treatment but still achieved SVR. To our knowledge, this is first real-world study addressing not only the incidence but time of onset, predictors and clinical impact of on-treatment ALT elevation among different DAAs.\n\nThe presence of abnormal LFT during DAA treatment may majorly owe to drug related events. It has been reported that drugs targeting the NS3/4 protease inhibitors may cause “on-treatment ALT elevation”. The incidence was higher in patients treated with ASV/DCV (17.8%) but lower with PrOD (<1.2%).[19,20] The incidence of ALT elevation ≥grade 3 during ASV/DCV and G/P treatment in current study was mostly compatible with previous reports (ASV/DCV: 6.7% vs. 8.9%[19] and G/P: 0% vs. 0%[21,22]). However, higher proportion of “on-treatment ALT elevation” was observed in patients treated with PrOD and G/E in current cohort compared to prior studies (PrOD: 1.2% vs 0.5%,[23] G/E: 2.4% vs 0.9%[10]). This phenomenon may be resulted from much higher cirrhotic patients’ proportion in our study comparing to others’. Although sofosbuvir, mainly blocking hepatitis C NS5B protein, was rarely reported with “on-treatment ALT elevation” events, there was still 1.6% of the 126 genotype 3 and 6 CHC patients reported with ≥grade 3 ALT elevation in a phase 2 trial treated with sofosbuvir/ledipasvir.[24] In our cohort which composed majorly genotype 1 and 2/3 CHC patients, there was 1% of 967 patients treated with sofosbuvir-based regimen observed with ≥grade 3 “on-treatment ALT elevation”. Patients with higher pretherapy HbA1c, co-infection with HBV and higher pretherapy ALT level have higher probability to encounter “on-treatment ALT elevation” during sofosbuvir-based therapy (Supplemental Table 6, http://links.lww.com/MD/E831).\n\nIn this study, the median time to “on-treatment ALT elevation” was earlier in PrOD and G/P (4 weeks), followed by sofosbuvir-based, GE and latest in ASV/DCV (12 weeks). About 40% and 33.3% of the event took place within the 1st month in PrOD and G/P treated patients respectively, while 74.1%, 84.8% and 94.7% of the event occurred after the 4th week in sofosbuvir-based, G/E and ASV/DCV treated cases. The reported incidence rate of ≥grade 3 T-bil. elevation during treatment was 0.9%, 4%, 4%, 0.3%, and 0.3% to 0.6% in ASV/DCV, PrOD, sofosbuvir-based, G/E and G/P, respectively,[9,10,19,22,25,26] which is comparable as 0.7%, 2.5%, 1.2%, 0, and 0.9% in the corresponding regimens in current study.\n\nSerum albumin levels was reported as a factor associated with severe ALT elevations in ASV/DCV treated patients.[27] In our study, pretherapy ALT rather than albumin level was the only independent factor associated with on-treatment ALT elevation. With regard to HBV coinfected patients, the risk of HBV reactivation in patients treated with DAA has been reported, and most patients had asymptomatic increases of HBV DNA with or without ALT elevation.[28,29] Although patients with the presence of ultrasonography steatosis are prone to encounter “on-treatment ALT elevation” in overall cohort (34.1% vs 27.6%, P = .074) and in those without HBV co-infection (35.6% vs 28.2%, P = .059), yet not reach statistically significant difference especially after multivariate adjustment. The “on-treatment ALT elevation” occurred in 21 of the 100 HBV co-infected CHC patients receiving G/E, sofosbuvir-based and G/P therapy in current study, similar to the reactivation rate of 24% from a recent systemic review and meta-analysis.[30]\n\nNotably, the abrupt ALT abnormality was not lasting in majority of cases, and only 0.06% of the preferred DAAs, 1.8% of PrOD and 1.4% of ASV/DCV treated patient terminated the treatment due to physician's concern but none liver-related mortality occurred. The SVR rate in our cohort was comparable to that reported in clinical trials (90.9% vs 90%, 98.8% vs 98%, 97.4% vs 97%, 99.4% vs 95% and 99.6% vs 99% in ASV/DCV, PrOD, sofosbuvir-based, G/E and G/P respectively).[9,10,21,25,31] The presence of ALT elevation did not influence the SVR rate in current preferred DAAs treated patients but lowered the SVR rate in ASV/DCV and PrOD treated patients to 83.9% (P = .034) and 94.3% (P = .059), respectively. This phenomenon was not mentioned in previous studies discussing the SVR factors in ASV/DCV treated patients. Moreover, the SVR rates was much lower as 67% in the 9 early termination patients due to abnormal liver function. From this result, patients who had abnormal LFT during preferred DAAs treatment without sign of hepatic decompensation shall complete their treatment instead of early termination.\n\nAlthough this is a prospective registered retrospective analysis study, there are several limitations: First, in spite of the pretherapy survey and avoidance of possible drug-drug interaction, the details of co-medication of these abnormal LFT patients at the onset of “on-treatment ALT elevation” are not complete from retrospective medical record; Second, the amount of alcohol consumption was not prospectively recorded in our cohort and difficult to assess its impact by retrospective analysis; Third, not all the HBV co-infection patients had pretherapy HBV DNA level which difficult to assess the exact proportion of HBV reactivation related to “on-treatment ALT elevation”; Fourth, this is a clinical study lacking the experimental investigation on the mechanisms how this abnormal LFT occurs.\n\nIn conclusion, on-treatment ALT elevation is not rare event and may take place in 10.9% during G/E, Sofosbuvir and G/P treated patients. Only 1.4% patients had ≥grade 3 ALT elevation events. Since such events did not lead to hepatic decompensation nor influence on SVR rates. Patients encountering abnormal LFT elevation during these 3 DAA regimens may not need to terminate the treatment early but complete the antiviral therapy as scheduled.\n\nAcknowledgment\nWe have to thank Ms Hui-Chuan Cheng, Ms Yi-Meng Chiang and Ms Pei-Chueh Li for their assistance in database establishment and maintains.\n\nAuthor contributions\nCritical revision: Jeng WJ.\n\nData acquisition: Cheng YT, Hsieh YC.\n\nDraft writing: Liu YC.\n\nStatistical analysis: Liu YC, Sheen IS.\n\nStudy design: Jeng WJ, Lin CY.\n\nSupplementary Material\nSupplemental Digital Content\n Supplementary Material\nSupplemental Digital Content\n Supplementary Material\nSupplemental Digital Content\n Abbreviations: AFP = alpha-fetoprotein, ALT = alanine aminotransferase, AST = aspartate aminotransferase, ASV/DCV = asunaprevir + daclatasvir, BMI = body mass index, CHC = chronic hepatitis C, DAA = direct acting antiviral, G/E = grazoprevir/elbasvir, G/P = glecaprevir/pibrentasvir, HBV = hepatitis B virus, HCC = hepatocellular carcinoma, HCV = hepatitis C virus, LFT = liver biochemistry, PrOD = ombitasvir/paritaprevir/ritonavir/dasabuvir, SVR = sustained virological response, T-bil. = total bilirubin, ULN = upper limit of normal.\n\nHow to cite this article: Liu YC, Jeng WJ, Cheng YT, Hsieh YC, Teng W, Chen YC, Lin CY, Chien RN, Sheen I. Incidence and predictors for abnormal liver function during direct-acting antiviral agents in chronic hepatitis C patients. Medicine. 2020;99:37(e21898).\n\nGrant support: CMRPG3I0271-2.\n\nThe authors have no conflicts of interest to disclose.\n\nAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\n==== Refs\nReferences\n[1] Pawlotsky J-M Feld JJ Zeuzem S \nFrom non-A, non-B hepatitis to hepatitis C virus cure\n. J Hepatol \n2015 ;62 :S87 99\n.25920094 \n[2] Liver EAfTSoT \nEASL recommendations on treatment of hepatitis C 2018\n. J Hepatol \n2018 ;69 :461 511\n.29650333 \n[3] Everson GT \nTreatment of chronic hepatitis C in patients with decompensated cirrhosis\n. Rev Gastroenterol Dis \n2004 ;4 :S31 8\n.\n[4] Cheung MC Walker AJ Hudson BE \nOutcomes after successful direct-acting antiviral therapy for patients with chronic hepatitis C and decompensated cirrhosis\n. J Hepatol \n2016 ;65 :741 7\n.27388925 \n[5] Foster GR Irving WL Cheung MC \nImpact of direct acting antiviral therapy in patients with chronic hepatitis C and decompensated cirrhosis\n. J Hepatol \n2016 ;64 :1224 31\n.26829205 \n[6] US Food and Drug Administration. FDA Drug Safety Communication: FDA warns of serious liver injury risk with hepatitis C treatments Viekira Pak and Technivie. Silver Spring, MD: FDA. 2015 .\n[7] FDA. FDA Drug Safety Communication: FDA warns about rare occurrence of serious liver injury with use of hepatitis C medicines Mavyret, Zepatier, and Vosevi in some patients with advanced liver disease. U.S. Food and Drug Administration. 2019 .\n[8] Suzuki Y Ikeda K Suzuki F \n Dual oral therapy with daclatasvir and asunaprevir for patients with HCV genotype 1b infection and limited treatment options\n. J Hepatol \n2013 ;58 :655 62\n.23183526 \n[9] Afdhal N Zeuzem S Kwo P \nLedipasvir and sofosbuvir for untreated HCV genotype 1 infection\n. N Eng J Med \n2014 ;370 :1889 98\n.\n[10] Zeuzem S Ghalib R Reddy KR \nGrazoprevir–elbasvir combination therapy for treatment-naive cirrhotic and noncirrhotic patients with chronic hepatitis C virus genotype 1, 4, or 6 infection: a randomized trial\n. Ann Int Med \n2015 ;163 :1 3\n.25909356 \n[11] Asselah T Kowdley KV Zadeikis N \nEfficacy of glecaprevir/pibrentasvir for 8 or 12 weeks in patients with hepatitis C virus genotype 2, 4, 5, or 6 infection without cirrhosis\n. Clin Gastroentero Hepatol \n2018 ;16 :417 26\n.\n[12] Puoti M Foster GR Wang S \nHigh SVR12 with 8-week and 12-week glecaprevir/pibrentasvir therapy: an integrated analysis of HCV genotype 1-6 patients without cirrhosis\n. J Hepatol \n2018 ;69 :293 300\n.29551706 \n[13] Pawlotsky J-M Aghemo A Back D \nEASL recommendations on treatment of hepatitis C 2015\n. J hepatol \n2015 ;63 :199 236\n.25911336 \n[14] Omata M Kanda T Wei L \nAPASL consensus statements and recommendation on treatment of hepatitis C\n. Hepatol Int \n2016 ;10 :702 26\n.27130427 \n[15] Panel A-IHG . Hepatitis C guidance 2018 update: AASLD-IDSA recommendations for testing, managing, and treating hepatitis C virus infection\n. Clin Infect Dis \n2018 ;67 :1477 92\n.30215672 \n[16] US Department of Health and Humen Sevices. Common Terminology Criteria for Adverse Events (CTCAE). Version 5.0. 2017. 2018 .\n[17] US Department of Health and Human Services. National Institute of Allergy and Infectious Diseases, Division of AIDS. Division of AIDS (DAIDS). Table for Grading the Severity of Adult and Pediatric Adverse Events, Version 2.0. 2017 .\n[18] Liver EAftSoT, Diabetes EAftSo . EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease\n. Obesity facts \n2016 ;9 :65 90\n.27055256 \n[19] Kumada H Suzuki Y Ikeda K \nDaclatasvir plus asunaprevir for chronic HCV genotype 1b infection\n. Hepatology \n2014 ;59 :2083 91\n.24604476 \n[20] Klibanov OM Gale SE Santevecchi B \nOmbitasvir/paritaprevir/ritonavir and dasabuvir tablets for hepatitis C virus genotype 1 infection\n. Ann Pharmacotherapy \n2015 ;49 :566 81\n.\n[21] Forns X Lee SS Valdes J \nGlecaprevir plus pibrentasvir for chronic hepatitis C virus genotype 1, 2, 4, 5, or 6 infection in adults with compensated cirrhosis (EXPEDITION-1): a single-arm, open-label, multicentre phase 3 trial\n. Lancet \n2017 ;17 :1062 8\n.28818546 \n[22] Zeuzem S Foster GR Wang S \nGlecaprevir–pibrentasvir for 8 or 12 weeks in HCV genotype 1 or 3 infection\n. N Eng J Med \n2018 ;378 :354 69\n.\n[23] Kumada H Chayama K Rodrigues L Jr \nRandomized phase 3 trial of ombitasvir/paritaprevir/ritonavir for hepatitis C virus genotype 1b–infected Japanese patients with or without cirrhosis\n. Hepatology \n2015 ;62 :1037 46\n.26147154 \n[24] Gane EJ Hyland RH An D \nEfficacy of ledipasvir and sofosbuvir, with or without ribavirin, for 12 weeks in patients with HCV genotype 3 or 6 infection\n. Gastroenterology \n2015 ;149 :1454 61.e1451\n.26261007 \n[25] Dore GJ Conway B Luo Y \nEfficacy and safety of ombitasvir/paritaprevir/r and dasabuvir compared to IFN-containing regimens in genotype 1 HCV patients: the MALACHITE-I/II trials\n. J hepatol \n2016 ;64 :19 28\n.26321288 \n[26] Liu CH Yang SS Peng CY \nGlecaprevir/pibrentasvir for patients with chronic hepatitis C virus infection and severe renal impairment\n. J Viral Hepat \n2020 ;27 :568 75\n.31981264 \n[27] Akuta N Sezaki H Suzuki F \nRelationships between serum asunaprevir concentration and alanine aminotransferase elevation during daclatasvir plus asunaprevir for chronic HCV genotype 1b infection\n. J Med Virol \n2016 ;88 :506 11\n.26292191 \n[28] Liu C-J Chuang W-L Sheen I-S \nEfficacy of ledipasvir and sofosbuvir treatment of HCV infection in patients coinfected with HBV\n. Gastroenterology \n2018 ;154 :989 97\n.29174546 \n[29] Collins JM Raphael KL Terry C \nHepatitis B virus reactivation during successful treatment of hepatitis C virus with sofosbuvir and simeprevir\n. Clin Infect Dis \n2015 ;61 :1304 6\n.26082511 \n[30] Mucke MM Backus LI Mucke VT \nHepatitis B virus reactivation during direct-acting antiviral therapy for hepatitis C: a systematic review and meta-analysis\n. Lancet Gastroenterol Hepatol \n2018 ;3 :172 80\n.29371017 \n[31] Manns M Pol S Jacobson IM \nAll-oral daclatasvir plus asunaprevir for hepatitis C virus genotype 1b: a multinational, phase 3, multicohort study\n. Lancet \n2014 ;384 :1597 605\n.25078304\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0025-7974",
"issue": "99(37)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000328:Adult; D000410:Alanine Transaminase; D000577:Amides; D000998:Antiviral Agents; D001562:Benzimidazoles; D002219:Carbamates; D003521:Cyclopropanes; D004359:Drug Therapy, Combination; D005260:Female; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D015994:Incidence; D008099:Liver; D008103:Liver Cirrhosis; D008111:Liver Function Tests; D016015:Logistic Models; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies; D011759:Pyrrolidines; D011810:Quinoxalines; D012189:Retrospective Studies; D000069474:Sofosbuvir; D013449:Sulfonamides; D000072230:Sustained Virologic Response",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e21898",
"pmc": null,
"pmid": "32925725",
"pubdate": "2020-09-11",
"publication_types": "D023362:Evaluation Study; D016428:Journal Article",
"references": null,
"title": "Incidence and predictors for abnormal liver function during direct-acting antiviral agents in chronic hepatitis C patients.",
"title_normalized": "incidence and predictors for abnormal liver function during direct acting antiviral agents in chronic hepatitis c patients"
} | [
{
"companynumb": "TW-GILEAD-2020-0497271",
"fulfillexpeditecriteria": "1",
"occurcountry": "TW",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEDIPASVIR\\SOFOSBUVIR"
},
"drugadditional": "3"... |
{
"abstract": "The spectrum of cutaneous eruptions associated with dihydropyridines is extensive, varying from exanthemas to severe adverse events. We report a case of bullous eruption, one month after starting nicardipine and lercanidipine. The same symptoms recurred few days after taking nitrendipine.",
"affiliations": "National Center of Pharmacovigilance, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.;National Center of Pharmacovigilance, Tunis, Tunisia - Tunis El Manar University, Faculty of Medicine, La Rabta, Tunis, Tunisia.",
"authors": "Charfi|Ons|O|;Lakhoua|Ghozlane|G|;Sahnoun|Rym|R|;Daghfous|Riadh|R|;El Aidli|Sihem|S|;Kastalli|Sarrah|S|;Zaïem|Ahmed|A|",
"chemical_list": "D000959:Antihypertensive Agents; D004095:Dihydropyridines; D009529:Nicardipine; C060343:lercanidipine",
"country": "France",
"delete": false,
"doi": "10.2515/therapie/2015023",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0040-5957",
"issue": "70(4)",
"journal": "Therapie",
"keywords": null,
"medline_ta": "Therapie",
"mesh_terms": "D000328:Adult; D000959:Antihypertensive Agents; D003429:Cross Reactions; D004095:Dihydropyridines; D003875:Drug Eruptions; D004347:Drug Interactions; D005260:Female; D006801:Humans; D006973:Hypertension; D009529:Nicardipine; D012872:Skin Diseases, Vesiculobullous",
"nlm_unique_id": "0420544",
"other_id": null,
"pages": "381-3",
"pmc": null,
"pmid": "25957434",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bullous Eruption Associated With Dihydropyridines With Cross Reactivity.",
"title_normalized": "bullous eruption associated with dihydropyridines with cross reactivity"
} | [
{
"companynumb": "PHHY2015US098050",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
"dr... |
{
"abstract": "We report the case of a 71-year-old female who was incidentally found to have nonoliguric acute kidney injury on a routine workup for new-onset visual hallucination. Further history revealed inadvertent usage of nitrofurantoin for 3 months for an anticipated urological procedure. Renal biopsy demonstrated acute granulomatous interstitial nephritis. The renal function significantly improved following discontinuation of nitrofurantoin and corticosteroid administration. We highlight a rare association of nitrofurantoin with acute granulomatous interstitial nephritis through this case report.",
"affiliations": "SUNY Upstate Medical University, Syracuse, NY, USA.;SUNY Upstate Medical University, Syracuse, NY, USA.;SUNY Upstate Medical University, Syracuse, NY, USA.",
"authors": "Anupama|B K|BK|0000-0002-6345-8153;Sampat|Parth|P|;Gambhir|Harvir S|HS|",
"chemical_list": "D009582:Nitrofurantoin",
"country": "United States",
"delete": false,
"doi": "10.1177/23247096211001659",
"fulltext": "\n==== Front\nJ Investig Med High Impact Case Rep\nJ Investig Med High Impact Case Rep\nHIC\nsphic\nJournal of Investigative Medicine High Impact Case Reports\n2324-7096\nSAGE Publications Sage CA: Los Angeles, CA\n\n33733898\n10.1177/23247096211001659\n10.1177_23247096211001659\nCase Report\nNitrofurantoin-Associated Acute Granulomatous Interstitial Nephritis\nhttps://orcid.org/0000-0002-6345-8153\nAnupama B. K. MBBS 1\nSampat Parth MBBS 1\nGambhir Harvir S. MD 1\n1 SUNY Upstate Medical University, Syracuse, NY, USA\nAnupama B. K., MBBS, Department of Internal Medicine, SUNY Upstate Medical University, 750 East Adams Street, Syracuse, NY 13210, USA. Email: bka@upstate.edu\n18 3 2021\nJan-Dec 2021\n9 2324709621100165911 2 2021\n11 2 2021\n17 2 2021\n© 2021 American Federation for Medical Research\n2021\nAmerican Federation for Medical Research\nThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).\nWe report the case of a 71-year-old female who was incidentally found to have nonoliguric acute kidney injury on a routine workup for new-onset visual hallucination. Further history revealed inadvertent usage of nitrofurantoin for 3 months for an anticipated urological procedure. Renal biopsy demonstrated acute granulomatous interstitial nephritis. The renal function significantly improved following discontinuation of nitrofurantoin and corticosteroid administration. We highlight a rare association of nitrofurantoin with acute granulomatous interstitial nephritis through this case report.\n\nnitrofurantoin\nacute interstitial nephritis\ngranulomatous interstitial nephritis\nacute kidney injury\ncover-dateJanuary-December 2021\ntypesetterts1\n==== Body\nIntroduction\n\nAcute interstitial nephritis (AIN) is one of the common causes of acute kidney injury (AKI) and is associated with the presence of inflammatory infiltrates within the renal interstitium.1 AIN has been associated with 15% to 27% of patients with kidney dysfunction.1,2 However, the true incidence of AIN remains largely unrecognized as biopsy might not be sent in cases of clinical suspicion, and milder cases of AIN go undetected.1 There are many causes of AIN, with drug-induced AIN being the most common cause accounting for approximately 70% of all cases.3 Granulomatous interstitial nephritis (GIN) is a rare pathological feature seen in only 0.5% to 0.9% of all kidney biopsies.4 Although nitrofurantoin is a common cause of AIN, GIN is a rare entity. To our knowledge, there are only 2 case reports in the literature describing this condition.5,6 The knowledge of GIN is primarily based on case reports and case series. We present a case of a 71-year-old female with AKI found to have acute GIN on renal biopsy attributed to nitrofurantoin use.\n\nCase Presentation\n\nA 71-year-old female with a past medical history of multiple sclerosis and stress incontinence secondary to cystocele initially presented to her primary care physician with complaints of worsening lower extremity spasms and a new-onset visual hallucination. Routine basal metabolic panel performed for her symptoms incidentally revealed acute renal failure with a serum creatinine of 8.18 mg/dL. She was referred to the nearby hospital where she received 2-L boluses followed by maintenance intravenous fluids without significant improvement of kidney function. The patient was subsequently transferred to our institution for further workup and evaluation by nephrology. The patient’s baseline renal function was reportedly normal 3 months ago. She denied fever, chills, shortness of breath, skin rash, decreased urination, and other urinary symptoms on presentation. She was on long-term amantadine for fatigue related to multiple sclerosis. The patient used to follow-up with an urologist in Arizona for stress incontinence. She was scheduled to undergo an elective urological procedure for stress incontinence and was instructed to take nitrofurantoin 100 mg twice daily for 7 days before the procedure for presumed urinary tract infection (UTI). However, due to the coronavirus disease 2019 pandemic, her elective procedure was canceled, but she continued to take nitrofurantoin 100 mg twice daily for over 3 months for unknown reason. Clinical examination was remarkable for lethargy and altered mental status. Lungs were clear to auscultation bilaterally. The patient was afebrile, and vitals were within normal limits.\n\nLaboratory workup confirmed AKI with a serum creatinine of 7.6 mg/dL and blood urea nitrogen of 60 mg/dL. Urine microscopy was bland without white blood cell, red blood cell, or protein, and urine cultures were negative for infection. Urine protein/creatinine ratio was 0.20 mg/mg. Liver function tests and serum albumin were within normal limits. Complete blood count demonstrated elevated absolute eosinophil count (1.8 × 103/µL). The serial laboratory tests and reference range are detailed in Table 1. Renal ultrasound was unremarkable with no evidence of renal calculi or hydronephrosis. Further workup including vasculitic screening, autoimmune panel, serum immunoglobulins, serum protein immunoelectrophoresis, complement level, hepatitis B and C, and parathyroid hormone level returned normal.\n\nTable 1. Serial Laboratory Values.\n\nLaboratory values (units)\tDay 1\tDay 7\tDay 14\tDay 16\tReference ranges\t\nSodium (mmol/L)\t140\t139\t143\t144\t136-145\t\nPotassium (mmol/L)\t4.5\t4.0\t3.5\t3.8\t3.4-5.1\t\nChloride (mmol/L)\t108\t101\t101\t106\t98-107\t\nBicarbonate (mmol/L)\t18\t27\t26\t26\t22-29\t\nBlood urea nitrogen (mg/dL)\t60\t58\t54\t39\t8-23\t\nCreatinine (mg/dL)\t7.64\t4.76\t3.16\t2.58\t0.7-1.2\t\nGlucose (mg/dL)\t109\t167\t115\t138\t70-140\t\nCalcium (mg/dL)\t8.4\t8.3\t8.0\t8.7\t8.8-10.2\t\nWBC count (10 × 3/µL)\t8.4\t14.1\t15.1\tNot obtained\t4-10\t\nHemoglobin (g/dL)\t9.5\t10.4\t9.5\tNot obtained\t13.5-18\t\nPlatelets (10 × 3/µL)\t309\t121\t245\tNot obtained\t150-400\t\nAbsolute eosinophil count (10 × 3/µL)\t1.48\t0.01\t0.21\tNot obtained\t0-0.5\t\n\nDespite stopping nitrofurantoin during admission, the patient’s creatinine remained elevated around 7.5 mg/dL, and nephrology was consulted. The patient exhibited features of uremia such as decreased appetite, nausea, and asterixis, warranting renal replacement therapy as per nephrology recommendation. The patient underwent 2 sessions of hemodialysis on day 4 and day 5 of admission and a percutaneous renal biopsy on day 4 to evaluate for etiology of renal failure. Renal biopsy revealed a moderately intense inflammatory infiltrate comprising predominantly of lymphocytes and histiocytes that were admixed with multifocal clusters of eosinophils and few plasma cells (Figure 1). Renal interstitium demonstrated a few scattered noncaseating granulomas with multinucleated giant cells consistent with acute GIN (Figures 2 and 3). There was mild to moderate interstitial fibrosis and tubular atrophy, admixed with interstitial edema, patchy acute tubular necrosis, and congestion of peritubular capillaries. Glomeruli were normal by light microscopy and immunofluorescent, and electron microscopy was negative for immune-complex deposits in the glomeruli. A Ziehl-Neelsen stain for acid-fast bacilli and Gomori methenamine silver stain for fungus was negative. Further testing included angiotensin-converting enzyme level, and the QuantiFERON tuberculosis test returned negative. Computed tomography scan of thorax and abdomen showed incidental small scarring, granulomas, and calcification in the right lung, intrathoracic lymph nodes, and spleen. Although the patient did not have known history of histoplasmosis, as per the infectious disease recommendation, those incidental findings were deemed to be secondary to old resolved histoplasmosis, which the patient might not have been aware of and did not warrant further evaluation and treatment in the absence of pulmonary or constitutional symptoms.\n\nFigure 1. Hematoxylin and eosin stain at ×200 magnification on light microscopy demonstrating dense interstitial inflammation consisting of eosinophils and lymphocytes surrounding the glomeruli and renal tubules.\n\nFigure 2. Hematoxylin and eosin stain at ×200 magnification on light microscopy demonstrating scattered noncaseating granulomas and well-developed granuloma in the renal interstitium. The surrounding interstitial space shows scattered eosinophils.\n\nFigure 3. Hematoxylin and eosin stain at ×400 magnification on light microscopy demonstrating multinucleated giant cells.\n\nThe patient was started on prednisone 60 mg on day 4 of admission with resultant significant improvement of her renal function, creatinine 2.8 mg/dL at discharge (Table 1). The patient’s visual hallucinations were attributed to amantadine toxicity from decreased renal excretion, which was gradually tapered and stopped leading to a subsequent visual hallucination resolution. The patient was discharged on a 30-day steroid taper with an outpatient nephrology follow-up. The patient’s most recent renal function test after 2 months showed a serum creatinine of 1.71 mg/dL. She has remained stable from nephrology standpoint.\n\nDiscussion\n\nThe clinical features associated with AIN are fever, rash, arthralgia, oliguria, and laboratory features include eosinophilia, proteinuria, and leukocyturia.1,3 Although our patient did not have all the systemic features associated with AIN, the presence of peripheral eosinophilia and a history of prolonged nitrofurantoin use were clinical clues that led to suspicion of AIN. The renal pathology further confirmed the diagnosis of AIN with granulomas. Moreover, the patients with granulomatous AIN tend to relatively lack the typical systemic manifestation as compared with the nongranulomatous counterpart.5\n\nOther causes of GIN excluding drugs include sarcoidosis, tuberculosis, fungal infections, and tubulointerstitial interstitial nephritis with uveitis.4 In our case, the special stains for fungus and tuberculosis were negative, which ruled out infectious causes. Even though there was an incidental finding of calcified granulomas in the lungs and spleen, the acute GIN was considered a separate process given the temporal association with nitrofurantoin use and improvement of renal function after discontinuation of nitrofurantoin and steroid administration. Sarcoidosis was considered as one of the differentials in our patient with noncaseating granulomas. However, the renal biopsy, showing the presence of eosinophilic infiltrate with peripheral eosinophilia, absence of pulmonary symptoms, normal serum calcium, and normal angiotensin-converting enzyme, made the diagnosis unlikely.4,6\n\nThe drug-induced AIN is believed to be pathologically associated with the immunological process given its association with features of hypersensitivity and the fact that only a few patients exposed to a particular drug develop AIN, with a tendency of recurrence after repeat exposure to the drug.1,4 The pathogenesis for the development of epithelioid granulomas is not well understood in drug-induced interstitial nephritis. Still, it has been attributed to a delayed-type hypersensitivity reaction, and cell-mediated type 1 helper T cells response.4,5 The definitive diagnosis of AIN is made by renal biopsy, which characteristically shows interstitial edema, interstitial infiltrates predominantly composed of macrophages, plasma cells, and eosinophils.1 In our patient, it was unclear if the patient was taking nitrofurantoin for presumed UTI or recurrent UTI as the patient used to follow-up with urologist in Arizona and the records were not readily available and the patient herself was not aware of the situation. It is also unclear why the prescription was written in such a way that would allow her to refill the medication for more than 3 months.\n\nThe mainstay management of acute drug-induced GIN is the discontinuation of the offending agent.1 No therapeutic trials exist to assess the efficacy of steroids.4,7 In 2 such cases of acute nitrofurantoin–associated GIN reported by Korzets et al5 and Namagondlu et al,6 the renal function recovered with the withdrawal of nitrofurantoin alone without administration of corticosteroids. In their retrospective study, González et al7 noted that the delayed onset of steroid treatment was associated with the risk of incomplete renal recovery, suggesting early administration of steroid treatment might be essential in patients with drug-induced AIN. Similarly, in another retrospective study, Joss et al8 reported that administration of a moderate dosage of steroids was associated with a favorable prognosis in GIN irrespective of the underlying etiology and the degree of interstitial fibrosis. Nevertheless, our patient had significant renal function improvement with the early administration of steroids as soon as the diagnosis of AIN was confirmed.\n\nConclusion\n\nWith this case report, we would like to report a rare association of acute GIN with nitrofurantoin use successfully treated with the withdrawal of this agent and corticosteroid administration. We want to reiterate the importance of drug-induced interstitial nephritis in AKI and the role of early renal biopsy on establishing the diagnosis of AIN.\n\nDeclaration of Conflicting Interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.\n\nFunding: The author(s) received no financial support for the research, authorship, and/or publication of this article.\n\nEthical Approval: Our institution does not require ethical approval for reporting individual cases or case series.\n\nInformed Consent: Informed consent for patient anonymized information to be published in this article was not obtained from the patient because our institution does not require informed consent for individual case reports.\n\nORCID iD: Anupama B. K. https://orcid.org/0000-0002-6345-8153\n==== Refs\nReferences\n\n1 Praga M González E . Acute interstitial nephritis. Kidney Int. 2010;77 :956-961. doi:10.1038/ki.2010.89 20336051\n2 Haas M Spargo BH Wit EJ Meehan SM . Etiologies and outcome of acute renal insufficiency in older adults: a renal biopsy study of 259 cases. Am J Kidney Dis. 2000;35 :433-447. doi:10.1016/s0272-6386(00)70196-x 10692269\n3 Muriithi AK Leung N Valeri AM , et al . Biopsy-proven acute interstitial nephritis, 1993-2011: a case series. Am J Kidney Dis. 2014;64 :558-566. doi:10.1053/j.ajkd.2014.04.027 24927897\n4 Shah S Carter-Monroe N Atta MG . Granulomatous interstitial nephritis. Clin Kidney J. 2015;8 :516-523. doi:10.1093/ckj/sfv053 26413275\n5 Korzets Z Elis A Bernheim J Bernheim J . Acute granulomatous interstitial nephritis due to nitrofurantoin. Nephrol Dial Transplant. 1994;9 :713-715. doi:10.1093/ndt/9.6.713 7970102\n6 Namagondlu G Low SE Seneviratne R Banerjee A . Acute renal failure from nitrofurantoin-induced acute granulomatous interstitial nephritis. QJM. 2010;103 :49-52. doi:10.1093/qjmed/hcp146 19828642\n7 González E Gutiérrez E Galeano C , et al . Early steroid treatment improves the recovery of renal function in patients with drug-induced acute interstitial nephritis. Kidney Int. 2008;73 :940-946. doi:10.1038/sj.ki.5002776 18185501\n8 Joss N Morris S Young B Geddes C . Granulomatous interstitial nephritis. Clin J Am Soc Nephrol. 2007;2 :222-230. doi:10.2215/CJN.01790506 17699417\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2324-7096",
"issue": "9()",
"journal": "Journal of investigative medicine high impact case reports",
"keywords": "acute interstitial nephritis; acute kidney injury; granulomatous interstitial nephritis; nitrofurantoin",
"medline_ta": "J Investig Med High Impact Case Rep",
"mesh_terms": "D058186:Acute Kidney Injury; D000368:Aged; D005260:Female; D006099:Granuloma; D006801:Humans; D009395:Nephritis, Interstitial; D009582:Nitrofurantoin",
"nlm_unique_id": "101624758",
"other_id": null,
"pages": "23247096211001659",
"pmc": null,
"pmid": "33733898",
"pubdate": "2021",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "20336051;26413275;18185501;24927897;19828642;7970102;10692269;17699417",
"title": "Nitrofurantoin-Associated Acute Granulomatous Interstitial Nephritis.",
"title_normalized": "nitrofurantoin associated acute granulomatous interstitial nephritis"
} | [
{
"companynumb": "US-CADILA HEALTHCARE LIMITED-US-ZYDUS-066367",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "NITROFURANTOIN"
},
"drugad... |
{
"abstract": "Merkel cell carcinoma (MCC) is a rare and aggressive neuroendocrine cancer with high rate to local relapse and metastasis. Its connection to immunosuppression is well known, with reported association to human immunodeficiency virus (HIV). The authors present an 87-year-old woman, infected by HIV type 2 at advanced stage of the disease, whom presented a painless papule on left cheek in 2011. After its total excision, the histopathology confirmed MCC \"in situ,\" with no regional or distant metastases. Simultaneously, she revealed a viral load of 2220 copies/mL and 224 CD4/mm3. Five months later, the patient presented a local and distance relapse with an aggressive behavior and positive regional lymph node. Stage IV disease was confirmed due to presence of liver metastases. Concurrently to the relapse, it was detected low CD4 levels. In our multidisciplinary team decision meeting, it has been decided conservative treatment due to low Karnofsky status, comorbidities, and stage of disease.",
"affiliations": "Service of Medical Oncology.;Service of Dermatology.;Service of Medical Oncology.;Unit of Clinical Immunology; Centro Hospitalar do Porto, Oporto, Portugal.;Service of Medical Oncology.",
"authors": "Coutinho|Filipe|F|;Horta|Miguel|M|;Rocha|Estrela|E|;Vasconcelos|Carlos|C|;Araújo|António|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.pbj.0000000000000011",
"fulltext": "\n==== Front\nPorto Biomed JPJ9Porto Biomedical Journal2444-86642444-8672PBJ-D-18-0001710.1016/j.pbj.000000000000001100011Original ArticleMerkel cell carcinoma and the challenge in its approach: a review based on a clinical context of immunosuppression Coutinho Filipe MDa∗Horta Miguel MDbRocha Estrela MDaVasconcelos Carlos PhDcAraújo António PhDaa Service of Medical Oncologyb Service of Dermatologyc Unit of Clinical Immunology; Centro Hospitalar do Porto, Oporto, Portugal∗ Corresponding author. Largo Prof. Abel Salazar, Porto 4099-001, Portugal. E-mail address: filipecoutinho184@hotmail.com (Filipe Coutinho).Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article\n\n03 7 2018 8 2018 3 1 e1124 4 2018 04 5 2018 Copyright © 2018 The Authors. Published by Wolters Kluwer Health, Inc. on behalf of PBJ-Associação Porto Biomedical/Porto Biomedical Society. All rights reserved.2018This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0Abstract\nMerkel cell carcinoma (MCC) is a rare and aggressive neuroendocrine cancer with high rate to local relapse and metastasis. Its connection to immunosuppression is well known, with reported association to human immunodeficiency virus (HIV).\n\nThe authors present an 87-year-old woman, infected by HIV type 2 at advanced stage of the disease, whom presented a painless papule on left cheek in 2011. After its total excision, the histopathology confirmed MCC “in situ,” with no regional or distant metastases. Simultaneously, she revealed a viral load of 2220 copies/mL and 224 CD4/mm3. Five months later, the patient presented a local and distance relapse with an aggressive behavior and positive regional lymph node. Stage IV disease was confirmed due to presence of liver metastases. Concurrently to the relapse, it was detected low CD4 levels.\n\nIn our multidisciplinary team decision meeting, it has been decided conservative treatment due to low Karnofsky status, comorbidities, and stage of disease.\n\nKeywords\ncarcinomaHIVimmunosuppressionMerkel cellvirusOPEN-ACCESSTRUE\n==== Body\nIntroduction\nMerkel cell carcinoma (MCC) is a rare and aggressive neuroendocrine skin cancer with a high rate of local recurrence and propensity for regional and distant metastases. It has a high mortality rate, which exceeds the melanoma rates, with a 5-year survival rate ranging from 30% to 64%. It affects predominantly elderly (7th and 8th decades) Caucasian subjects.1,2\n\nSeveral risk factors are being studied as enhancers for this cancer, such as the effect of sunrays exposition and immunosuppressive conditions like post-transplant status, human immunodeficiency virus (HIV) or Chronic Lymphoid Leukaemia.1\n\nFew studies correlate the increase of MCC expression with HIV; even though there is a rising evidence that HIV could increase by thirteen times the relative risk of the incidence of this neoplasm.2 Nowadays, there are enough data suggesting that Merkel cell polyomavirus (MCPyV) may play an important role in MCC oncogenesis.3\n\nWith the present case, it is intended to alert to this malignancy in HIV/AIDS patients and to provide clinical tool to its accurate diagnosis and for differential diagnosis with AIDS-related neoplasms.\n\nCase description\nThe authors present a case of an 87-year-old Portuguese female, Caucasian, with past risky sexual behavior, and multiple relevant comorbidities, such as Global Initiative on Obstructive Lung Disease stage III chronic obstructive pulmonary disease, cardiac insufficiency, noninsulin diabetes, a monoclonal gammopathy of undetermined significance that never evolved to multiple myeloma, and HIV type 2 infection diagnosed at stage A3 according to Centers for Disease Control and Prevention. She had been followed up in the outpatient ambulatory of the Clinical Immunology Unit since 2004 and had been under antiretroviral therapy (ART) with multiple combinations of drugs such as zidovudine plus lamivudine plus lopinavir/ritonavir, followed by tenofovir plus lamivudine plus atazanavir/ritonavir, and finally due to chronic renal insufficiency, tenofovir was switched to didanosine. The immunological response was not a good one—maximum of CD4 21%, 230/mm3—and since 2010 she was never virologically suppressed, translating a bad compliance to ART.\n\nIn November 2011, she had been referred by her family physician to a dermatology consultant due to an 8-mm, stiff and painless, erythematous-violaceous papule on left cheek with 2 months of development, without other findings. At first examination, it was difficult to establish a macroscopically identification, which led to consider the differential diagnosis of some AIDS-related neoplasms such as Kaposi Sarcoma or Pseudolymphoma. In an initial approach, it was performed a wide local excision instead of the lesion biopsy. The subsequent histology analysis suggested MCC (Fig. 1) with negative resection margin, and immunohistochemistry (Fig. 2) has confirmed the diagnosis. On clinical examination, it was not obvious lymph node disease and patient did not undergo into sentinel lymph node biopsy. Staging procedures were performed by thoracic, abdominal, and pelvic computed tomography (CT) scan without evidence of regional or distant disease. Thus, the disease was on stage 0. Immunological results detected a viral load of 2200 copies/mL and total CD4 cell of 224/mm3, 19%.\n\nFigure 1 H&E stain, ×40 magnification. The cells with a scant cytoplasm and vesicular nuclei with a salt-and-pepper-like chromatin. Mitotic and apoptotic figures are present.\n\nFigure 2 Immunohistochemistry stain, ×40 magnification. It showed positivity to synaptophysin (A), chromogranin A (B), neuron-specific enolase (C), and CAM5.2 (D).\n\nIn April 2012, the patient has shown recurrence of the lesion at the same location. She has presented local pain and tightness of the adjacent skin, demonstrating a significant local aggressiveness. It was confirmed a histological recurrence of MCC with positive margins, a positive cytology of regional lymph node revealing “salt-and-pepper-like” chromatin. A CT scan of the neck showed an infiltrative lesion (Fig. 3A), and the abdomen CT scan, diffuse liver metastases (Fig. 3B). The blood tests revealed falling of CD4 levels (64 cells/mm3). Due to lower Karnofsky performance status (about 50%) and stage IV disease, it was decided in our multidisciplinary team decision meeting that the patient was candidate for best supportive care. The patient died in August 2012 due to complications of her end-stage lung disease.\n\nFigure 3 CT scan images at relapse of disease (5 months after diagnosis). Head CT scan (A) showing local tumor aggressiveness with infiltrative pattern (∗). Abdominal CT scan with multiple liver metastases.\n\nDiscussion\nMCC is rare; however, its incidence is increasing partly due to a better life expectancy and higher survival rates in patients with chronic immunosuppressive diseases.4\n\nNowadays, the incidence of MCPyV is estimated to be present from 43% to 100% of MCC cases,1 and its DNA was found fully integrated into the genome of an individual tumor before clonally expansion suggesting a role as an enhancer.5 As it was demonstrated high levels of MCPyV in HIV-1 positive patients with MCC, the possibility of a connection between the grade of immunodeficiency, high levels of MCPyV and MCC oncogenesis is becoming more real.5,6 Wieland et al documented this as they showed significantly higher MCPyV DNA loads in HIV-positive men with poorly controlled HIV infection.7\n\nIn its clinical screening it is important to remember the acronym “AEIOU” (Asymptomatic, Expanding rapidly, Immunosuppression, Older than 50 years, and UV-exposed location).4 However, it is relevant to notice that is common that other lesions can have more than one of these characteristics.\n\nOn first instance in clinical observation, MCC can present with an unsuspicious shape and physician should make differential diagnosis with other malignancies such as amelanotic melanoma, cutaneous lymphoma, adnexal tumors, squamous cell carcinoma, pyogenic granuloma, or basal cell carcinoma. Thereafter, it is absolutely necessary to perform histological and immunohistochemistry analysis to confirm the diagnosis.1,4 If in a clinical evaluation it is difficult to make a diagnosis of MCC, the pathologic analysis is crucial for its identification in the presence of a positive staining for cytokeratin 20, neurofilaments and neuron-specific enolase, and a negative staining for vimentin, thyroid transcription factor 1, and leukocyte common antigen.1,8\n\nThe 5-year overall survival rate at presentation ranges from 81% at stage I until 11% at stage IV.9\n\nTreatment is individualized depending on clinical staging at presentation, and it can include wide surgical excision, Mohs micrographic surgery, radiotherapy, chemotherapy, or best supportive care. At early stages of disease (0, I, and II), a wide surgical excision should be done. Before definitive excision, a sentinel lymph node evaluation should be performed to exclude microscopic disease, particularly if there is no clinical suspicion of lymph node disease. In the presence of lymph node disease, its radiation or dissection should be done. Radiation therapy can be given in adjuvant setting, especially in some conditions such as tumor >1 cm, positive sentinel lymph node biopsy, underlying chronic immune suppression (eg, HIV disease), evidence of lymphovascular invasion, or positive microscopic margins after excision. In stage I, II, and III, it must be directed into previous lesion site and draining lymph node basin. Radiotherapy can also be given in palliative intent to relieve symptoms such as pain. The benefit of chemotherapy in adjuvant setting was not clearly demonstrated.8\n\nSupporting this concept, it was reported a cure of MCC lung metastases after restoration of the immune system with antiretroviral therapy and interleukin 2,10 reinforcing the relation between MCC oncogenesis and the immune system. This leads us to assume that the compromise of immunodeficiency control—after the absence of virologic control and immunological response to ART—in our clinical report may have increased the likelihood of progression of disease, regarding the literature.2\n\nThere is a growing evidence that as much higher the immunosuppressive condition is, more it can negatively influence MCC's survival, as Paulson et al11 showed in their regression analysis between immune suppressed and nonimmune suppressed patients.\n\nAs the immunotherapy is on progressive development in cancer treatment, it is peremptory that these patients should have their immune system restored to provide a viable therapeutic option; nowadays there are ongoing some clinical trials using anti-CTLA-4 drugs such as ipilimumab in nonimmunosuppressed patients.8\n\nSummary\nThis clinical report illustrates the possibility of the coexistence of MCC in HIV/AIDS patients, probably due to a viral pathway. Thus, it is important to think of it when we are faced with a skin lesion in these patients that AEIOU mnemonic in clinical examination combined by histology analysis is crucial to guide for a definitive diagnosis. The level of immunosuppression may have influence in MCC development and aggressiveness. Thus, the HIV/AIDS treatment efficacy, with good virologic and immunological response, is of most importance to optimize viral rates control and to prevent MCC relapse or progression, providing improved survival. Finally, a multidisciplinary team approach (Dermatology, Medical Oncology, Immunology and Pathology) should be considered to provide an improved clinical assessment to perform an accurate diagnosis, as well to choose the best treatment options.8\n\nAcknowledgments\nNone.\n\nConflicts of interest\nThe authors declare no conflicts of interest.\n==== Refs\nReferences\n1 National Comprehensive Cancer Network®. NCCN Clinical Practice Guidelines in Oncology™: merkel cell carcinoma: V.1.2016. Available at: http://www.nccn.org. 2015. Accessed July 23, 2016 .\n2 Engels EA Frisch M Goedert JJ \nMerkel cell carcinoma and HIV infection . Lancet \n2002 ; 359 :497 –498 .11853800 \n3 Amber K McLeod PM Nouri K \nThe Merkel cell polyomavirus and its involvement in Merkel cell carcinoma . Dermatol Surg \n2013 ; 39 :232 –238 .23387356 \n4 Wang TS Byrne PJ Jacobs LK \nMerkel cell carcinoma: update and review . Semin Cutan Med Surg \n2011 ; 30 :48 –56 .21540020 \n5 Fukumoto H Sato Y Hasegawa H \nFrequent detection of Merkel cell polyomavirus DNA in sera of HIV-1-positive patients . Virol J \n2013 ; 10 :84“ .23496956 \n6 Purgina B Pantanowitz L Seethala RR \nA review of carcinomas arising in the head and neck region in HIV-positive patients . Pathol Res Int \n2011 ; 1 –12 .\n7 Wieland U Silling S Scola N \nMerkel cell polyomavirus infection in HIV-positive men . Arch Dermatol \n2011 ; 147 :401 –406 .21482890 \n8 Prieto I de la Fuente TP Medina S \nMerkel cell carcinoma: an algorithm for multidisciplinary management and decision-making . Crit Rev Oncol Hematol \n2016 ; 98 :170 –179 .26597015 \n9 Allen PJ Bowne WB Jaques DP \nMerkel cell carcinoma: prognosis and treatment of patients from a single institution . J Clin Oncol \n2005 ; 23 :2300 –2309 .15800320 \n10 Burack J Altschuler EL \nSustained remission of metastatic Merkel cell carcinoma with treatment of HIV infection . J R Soc Med \n2003 ; 96 :238 –239 .12724438 \n11 Paulson KG Iyer JG Blom A \nSystemic immune suppression as a stage-independent predictor of diminished Merkel cell carcinoma-specific survival . J Invest Dermatol \n2013 ; 133 :642 –646 .23190897\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2444-8664",
"issue": "3(1)",
"journal": "Porto biomedical journal",
"keywords": "HIV; Merkel cell; carcinoma; immunosuppression; virus",
"medline_ta": "Porto Biomed J",
"mesh_terms": null,
"nlm_unique_id": "101707479",
"other_id": null,
"pages": "e11",
"pmc": null,
"pmid": "31595235",
"pubdate": "2018-08",
"publication_types": "D016428:Journal Article",
"references": "23496956;26597015;21540020;11853800;23190897;21660273;23387356;12724438;21482890;15800320",
"title": "Merkel cell carcinoma and the challenge in its approach: a review based on a clinical context of immunosuppression.",
"title_normalized": "merkel cell carcinoma and the challenge in its approach a review based on a clinical context of immunosuppression"
} | [
{
"companynumb": "PT-VIIV HEALTHCARE LIMITED-PT2018160231",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LAMIVUDINE"
},
"drugadditional"... |
{
"abstract": "BACKGROUND\nPemphigus vulgaris (PV) is a life-long IgG autoantibody-mediated blistering disease affecting the mucosal surfaces lined by the stratified epithelium (oral, nasal, genital) and sometimes also the skin. While corticosteroid treatment is life saving, the high dose and prolonged courses required for disease control are associated with significant adverse effects, including death. Although introduction of rituximab (RTX) provided for a favorable outcome, the high relapse rate, that is, up to 80%, precludes successful use of RTX as a monotherapy. Intravenous immunoglobulin (IVIg) is being increasingly utilized as off-label therapy for a variety of autoimmune and inflammatory diseases, including PV and pemphigus foliaceus (PF).\n\n\nOBJECTIVE\nThe goal of pemphigus research is to develop an effective treatment modality that would allow patients to achieve and maintain a stable clinical remission without the need for additional treatments, or cure.\n\n\nMETHODS\nThis article summarizes clinical outcome of 123 pemphigus patients treated with a combination of IVIg, an immunosuppressive cytotoxic drug (ICD) and mitochondrion-protecting drugs in the Blistering Disease Clinic at the University of California, Irvine from 2007 to 2017.\n\n\nRESULTS\nThe mean time to disease control was 0.2 months and time to complete remission - 1.7 months. Duration of complete remission on drugs until relapse or end of treatment was 19.3 months. The mean duration of complete remission off drugs until relapse was 15.8 months. That until end of follow up was 48.4 months, with a minimum of 14 and a maximum of 91 months. The overall complete remission rate off all drugs was 100%, with 12% overall relapse rate. Most relapses, 8.1 vs. 3.3%, occurred during the time of treatment, compared to posttreatment. No patients had more than a single relapse. The duration of the posttreatment follow-up ranged from 9 to 97 months with a mean of 64.8 months, or 5.4 years. The total number of IVIg cycles ranged from 26 in patients without a relapse to 37 in patients with a relapse. The clinical outcome in patients that received IVIg with RTX or another ICD were found to be very similar.\n\n\nCONCLUSIONS\nThus, the multidrug IVIg regimen allowed to achieve three principal treatment objectives: (i) rapid control of pemphigus symptoms; (ii) stable disease remission; and (iii) overall safety of treatment.\n\n\nCONCLUSIONS\nWhile the individualized therapeutic approaches to eradicate the autoreactive B cell clones causing disease in each particular PV or PF patient are being developed, all pemphigus patients can benefit from the treatment protocol described in this study.",
"affiliations": "Departments of Dermatology and Biological Chemistry and Institute for Immunology, University of California, Irvine, CA, USA.",
"authors": "Grando|Sergei A|SA|",
"chemical_list": "D003603:Cytotoxins; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D007166:Immunosuppressive Agents; D011245:Pregnadienes; D020011:Protective Agents; D013754:Tetracyclines; D014803:Vitamin B Complex",
"country": "England",
"delete": false,
"doi": "10.1111/ijd.14143",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0011-9059",
"issue": "58(1)",
"journal": "International journal of dermatology",
"keywords": null,
"medline_ta": "Int J Dermatol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D002648:Child; D003603:Cytotoxins; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D016756:Immunoglobulins, Intravenous; D007155:Immunologic Factors; D007166:Immunosuppressive Agents; D008297:Male; D008875:Middle Aged; D008928:Mitochondria; D010392:Pemphigus; D011245:Pregnadienes; D020011:Protective Agents; D012074:Remission Induction; D012189:Retrospective Studies; D013754:Tetracyclines; D016896:Treatment Outcome; D014803:Vitamin B Complex; D055815:Young Adult",
"nlm_unique_id": "0243704",
"other_id": null,
"pages": "114-125",
"pmc": null,
"pmid": "30047585",
"pubdate": "2019-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Retrospective analysis of a single-center clinical experience toward development of curative treatment of 123 pemphigus patients with a long-term follow-up: efficacy and safety of the multidrug protocol combining intravenous immunoglobulin with the cytotoxic immunosuppressor and mitochondrion-protecting drugs.",
"title_normalized": "retrospective analysis of a single center clinical experience toward development of curative treatment of 123 pemphigus patients with a long term follow up efficacy and safety of the multidrug protocol combining intravenous immunoglobulin with the cytotoxic immunosuppressor and mitochondrion protecting drugs"
} | [
{
"companynumb": "US-OCTA-LIT10617US",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "MINOCYCLINE\\MINOCYCLINE HYDROCHLORIDE"
},
"drugadd... |
{
"abstract": "Histological findings of kidney involvement have been rarely reported in pediatric patients with SARS-CoV-2 infection. Here, we describe clinical, laboratory, and histological findings of two pediatric cases with almost exclusive kidney involvement by SARS-CoV-2.\n\n\n\nA 10-year-old girl with IgA vasculitis nephritis underwent kidney biopsy, showing diffuse and segmental mesangial-proliferative glomerulonephritis, and steroid therapy was initiated. After the worsening of the clinical picture, including an atypical skin rash, she was diagnosed with SARS-CoV-2. The re-evaluation of initial biopsy showed cytoplasmatic blebs and virus-like particles in tubular cells at electron microscopy. Despite SARS-CoV-2 clearance and the intensification of immunosuppression, no improvement was observed. A second kidney biopsy showed a crescentic glomerulonephritis with sclerosis, while virus-like particles were no longer evident. The second patient was a 12-year-old girl with a 3-week history of weakness and weight loss. Rhinitis was reported the month before. No medications were being taken. Blood and urine analysis revealed elevated serum creatinine, hypouricemia, low molecular weight proteinuria, and glycosuria. A high SARS-CoV-2-IgG titre was detected. Kidney biopsy showed acute tubular-interstitial nephritis. Steroid therapy was started with a complete resolution of kidney involvement.\n\n\n\nWe can speculate that in both cases SARS-CoV-2 played a major role as inflammatory trigger of the kidney damage. Therefore, we suggest investigating the potential kidney damage by SARS-CoV-2 in children. Moreover, SARS-CoV-2 can be included among infectious agents responsible for pediatric acute tubular interstitial nephritis.",
"affiliations": "Pediatric Nephrology, Dialysis and Transplant Unit, Fondazione IRCCS Ca' Granda - Ospedale Maggiore Policlinico Di Milano, Via Commenda 9, 20122, Milan, Italy.;Pediatric Nephrology, Dialysis and Transplant Unit, Fondazione IRCCS Ca' Granda - Ospedale Maggiore Policlinico Di Milano, Via Commenda 9, 20122, Milan, Italy.;Pediatric Nephrology, Dialysis and Transplant Unit, Fondazione IRCCS Ca' Granda - Ospedale Maggiore Policlinico Di Milano, Via Commenda 9, 20122, Milan, Italy.;ATS Monza E Brianza, Lombardy, Italy.;ATS Bergamo, Lombardy, Italy.;Pathology Unit, ASST Fatebenfretalli-Sacco, Department of Biological and Clinical Sciences, University of Milan, Milan, Italy.;Pediatric Nephrology, Dialysis and Transplant Unit, Fondazione IRCCS Ca' Granda - Ospedale Maggiore Policlinico Di Milano, Via Commenda 9, 20122, Milan, Italy. giovanni.montini@unimi.it.",
"authors": "Serafinelli|Jessica|J|;Mastrangelo|Antonio|A|;Morello|William|W|;Cerioni|Valeria Fanny|VF|;Salim|Adib|A|;Nebuloni|Manuela|M|;Montini|Giovanni|G|http://orcid.org/0000-0002-7350-4475",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00467-021-05212-7",
"fulltext": "\n==== Front\nPediatr Nephrol\nPediatr Nephrol\nPediatric Nephrology (Berlin, Germany)\n0931-041X\n1432-198X\nSpringer Berlin Heidelberg Berlin/Heidelberg\n\n34406477\n5212\n10.1007/s00467-021-05212-7\nBrief Report\nKidney involvement and histological findings in two pediatric COVID-19 patients\nSerafinelli Jessica 1\nMastrangelo Antonio 1\nMorello William 1\nCerioni Valeria Fanny 2\nSalim Adib 3\nNebuloni Manuela 4\nhttp://orcid.org/0000-0002-7350-4475\nMontini Giovanni giovanni.montini@unimi.it\n\n15\n1 grid.414818.0 0000 0004 1757 8749 Pediatric Nephrology, Dialysis and Transplant Unit, Fondazione IRCCS Ca’ Granda - Ospedale Maggiore Policlinico Di Milano, Via Commenda 9, 20122 Milan, Italy\n2 ATS Monza E Brianza, Lombardy, Italy\n3 ATS Bergamo, Lombardy, Italy\n4 grid.4708.b 0000 0004 1757 2822 Pathology Unit, ASST Fatebenfretalli-Sacco, Department of Biological and Clinical Sciences, University of Milan, Milan, Italy\n5 grid.4708.b 0000 0004 1757 2822 Department of Clinical Sciences and Community Health, University of Milan, Milan, Italy\n18 8 2021\n18 8 2021\n2021\n36 11 37893793\n12 5 2021\n23 6 2021\n24 6 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.\nBackground\n\nHistological findings of kidney involvement have been rarely reported in pediatric patients with SARS-CoV-2 infection. Here, we describe clinical, laboratory, and histological findings of two pediatric cases with almost exclusive kidney involvement by SARS-CoV-2.\n\nResults\n\nA 10-year-old girl with IgA vasculitis nephritis underwent kidney biopsy, showing diffuse and segmental mesangial-proliferative glomerulonephritis, and steroid therapy was initiated. After the worsening of the clinical picture, including an atypical skin rash, she was diagnosed with SARS-CoV-2. The re-evaluation of initial biopsy showed cytoplasmatic blebs and virus-like particles in tubular cells at electron microscopy. Despite SARS-CoV-2 clearance and the intensification of immunosuppression, no improvement was observed. A second kidney biopsy showed a crescentic glomerulonephritis with sclerosis, while virus-like particles were no longer evident.\n\nThe second patient was a 12-year-old girl with a 3-week history of weakness and weight loss. Rhinitis was reported the month before. No medications were being taken. Blood and urine analysis revealed elevated serum creatinine, hypouricemia, low molecular weight proteinuria, and glycosuria. A high SARS-CoV-2-IgG titre was detected. Kidney biopsy showed acute tubular-interstitial nephritis. Steroid therapy was started with a complete resolution of kidney involvement.\n\nConclusion\n\nWe can speculate that in both cases SARS-CoV-2 played a major role as inflammatory trigger of the kidney damage. Therefore, we suggest investigating the potential kidney damage by SARS-CoV-2 in children. Moreover, SARS-CoV-2 can be included among infectious agents responsible for pediatric acute tubular interstitial nephritis.\n\nKeywords\n\nSARS-CoV-2\nKidney biopsy\nChildren\nTubular damage\nGlomerulonephritis\nUniversità degli Studi di MilanoOpen access funding provided by Università degli Studi di Milano within the CRUI-CARE Agreement.\n\nissue-copyright-statement© The Author(s), under exclusive licence to International Pediatric Nephrology Association 2021\n==== Body\npmcIntroduction\n\nThe novel coronavirus (SARS-CoV-2) infection has rapidly become a pandemic, with an aggressive and even fatal course in adults with comorbidities, and milder clinical manifestations in children [1]. Children with chronic kidney disease (CKD) or on immunosuppression for nephrotic syndrome, glomerular diseases, or transplantation show neither a more severe clinical course nor an increased risk of infection, compared to healthy peers [2–5]. SARS-CoV-2 nephropathy has been reported in both healthy adults and children. Most common features include acute kidney injury, tubular-interstitial damage, proteinuria, and/or hematuria [6]. The exact mechanism of kidney involvement is unclear, and probably multifactorial. SARS-CoV-2 could directly damage tubular epithelial cells and podocytes as a result of a specific kidney tropism, through the Angiotensin-converting enzyme (ACE) receptors, present in high concentrations in the kidney, or indirectly trigger a cytokine storm associated with multi-organ failure and thrombotic events [6, 7]. ACE polymorphisms and the high-risk apolipoprotein L1 (APOL1) genotype variants have been recently described as genetic modifiers associated with a higher proinflammatory state and podocyte damage in patients with coronavirus diseases (COVID-19) [6]. Kidney biopsies from adults usually reveal acute tubular necrosis or thrombotic microangiopathy, collapsing glomerulopathy, and acute endothelial injury [8, 9], while data are lacking in children. Here we report two pediatric cases of SARS-CoV-2-related kidney involvement, documented by kidney biopsies.\n\nCase 1\n\nIn February 2020, Henoch–Schönlein purpura (HSP) was diagnosed in a previously healthy 10-year-old girl, based on the typical cutaneous manifestations. Four weeks later, gross hematuria and nephrotic range proteinuria (urinary protein-to-creatinine ratio [uPCR] up to 8.7 g/g) appeared and a first kidney biopsy was performed (Fig. 1A–E). A diffuse and segmental mesangial-proliferative glomerulonephritis was detected. Immunofluorescence (IF) showed only a granular pattern of mesangial deposition of IgA (2 +), without signs of complement in situ activation. Two courses of intravenous methylprednisolone (15 mg/kg/day for 3 consecutive days) and oral prednisone (1 mg/kg on alternate days) were administered. Nevertheless, new evidence of skin vasculitic lesions, gross hematuria, mild kidney impairment (serum creatinine 0.78 mg/dl, eGFR 75 ml/min/1.73sqm) with hypoalbuminemia (serum albumin 2.29 g/dl), and proteinuria (uPCR 9.38 g/g) occurred. No concomitant infectious diseases were reported. Seven weeks after biopsy, the clinical conditions worsened with severe weight gain (up to 4 kg), persistence of nephritic-nephrotic syndrome, and the appearance of a distinct skin rash characterized by purpuric lesions and erythema pernio-like, mainly localized on feet and lower limbs. Because of the atypical presentation of the skin rash, and the growing awareness of skin involvement by COVID-19, a molecular nasopharyngeal swab test was performed, which tested positive for SARS-CoV-2. At admission, the patient was afebrile without clinical or radiological respiratory involvement. SARS-CoV-2 was undetectable on urinary samples. Parents were positive for SARS-CoV-2-IgG, with a negative swab test. Because of persistent nephrotic range proteinuria after clearance of SARS-CoV-2 infection, a third 3-daily pulse of methylprednisolone and oral cyclophosphamide (2 mg/kg/day for 10 weeks) were added to oral prednisone therapy.Fig. 1 A, B, C, D, E Histological finding of first biopsy in patient 1. A (light microscopy): diffuse and segmental mesangial proliferation with endocapillary proliferation without crescents or sclerosis (periodic acid Schiff stain). Electron microscopy: a tubular cell (B) contains rare intra-vacuolar virus-like particles (detail C, arrows) of about 80–90 nm in diameter, with rare preserved spikes (E), structure, and location suggestive of coronavirus infection. The cell also contains isolated vesicles delimited by a double membrane, similar to the viral replicative organelle DMV involved in viral-RNA replication, described in RNA-positive virus included SARS-CoV2. OM (original magnification): B × 4400, C × 20,000, D × 85,000. Bar: B 2micron, C 500 nm, D 200 nm. C Glomerular fine granular electron dense deposits, with mesangial and sub-endothelial localization. F, G, H, I, J Histological finding of second kidney biopsy in patient 1. Light microscopy: evidence of global mesangial proliferation with fibrocellular crescent in 30% of glomeruli (of the 33 glomeruli, fibrocellular crescents were present in 9, and fibrotic crescents in 6, of which 2 have complete floccular sclerosis), diffuse segmental glomerular sclerosis, and initial membranoproliferative pattern in association with interstitial fibrosis, suggestive of a worsening of kidney activity and an appearance of signs of chronic nephropathy. Trichrome stain (F). Electron microscopy: increase in the sclerotic component of matrix (G), widespread presence of finely granular electron dense deposits (H, I, J); presence of segmental GBM deposits mainly intramembrane, sometimes sub-endothelial and occasionally sub-epithelial (I). Lamellation and reticulation of the lamina densa (I). Features of reabsorption of immune deposits (H, I). Focal images of deposits associated with mesangial interpositions (membranoproliferative pattern) (G, J). Podocytes: alterations secondary to lesions of the basement membrane. Segmental monocytes and rare granulocytes sometimes with occlusion of the capillary lumen, sometimes associated with intraluminal fibrin aggregates (I, J). Widespread loss of fenestrations of the endothelial cells (I). No virus-like particles were evident. K, L, M Histological features of kidney biopsy in patient 2. Light microscopy: marked neutrophilic, and lympho-plasmacellular invasion of the interstitium with multi-focal tubular acute damage suggestive of tubulitis. Trichrome stain (K). Electron microscopy: mild secondary sclerotic-ischemic changes of the mesangial matrix associated with mild thickening of GBM and podocytes effacement (L, M). No images suggestive of immune deposits or virus-like particles were observed\n\nThe re-evaluation of electron microscopy (EM) on the kidney biopsy showed cytoplasmatic blebs and virus-like particles in tubular cells (Fig. 1C–E). Nonetheless, the RT-PCR for SARS-CoV-2 from the kidney tissue result was negative.\n\nFor the persistence of severe proteinuria (uPCR 2.81–3.4 g/g), 2 months later, a second kidney biopsy was performed, showing worsened active lesions with the appearance of crescents in almost 30% of the glomeruli (Fig. 1F–J), and chronic features including fibrocellular crescents, interstitial fibrosis, and diffuse segmental glomerular sclerosis. On EM, virus-like particles were no longer evident. RT-PCR for SARS-CoV-2 tested negative. Treatment with mycophenolate mofetil and ACE-inhibitors was started. At the last follow-up, 1 year after HSP-onset, the patient has normal kidney function (serum creatinine 0.65 mg/dl, eGFR 99 ml/min/1.73sqm) and low proteinuria (uPCR 0.36 g/g).\n\nCase 2\n\nA previously healthy 12-year-old girl was referred to our department in June 2020, because of a 3-week history of progressive lack of appetite, weakness and weight loss (5 kg), and evidence of moderate kidney impairment (serum creatinine 1.2 mg/dl, eGFR 59 ml/min/1.73sqm). A mild rhinitis, without use of medications, was reported the month before. Blood and urine analysis confirmed an elevated serum creatinine of 1.8 mg/dl associated with hypouricemia (1.8 mg/dl), severe tubular proteinuria (uPCR 0.5 mg/mg, urinary beta-2-microglobulin 19,793 ug/L), low urinary gravity (1008), glycosuria, and ketonuria. Before hospital admission, the girl and her mother underwent a routine nasopharyngeal swab test for SARS-CoV2: the mother tested positive while the patient twice tested negative. Nonetheless, the patient showed a high SARS-CoV-2-IgG titre (195 AU/ml, cut-off > 11.9 AU/ml). Adenovirus, mycoplasma spp, streptococcus, cytomegalovirus, and Epstein-Barr virus were negative. SARS-CoV-2 was undetectable on urine. Acute tubulointerstitial nephritis (aTIN) related to SARS-CoV-2 infection was clinically suspected and confirmed by a kidney biopsy, showing marked neutrophilic, and lympho-plasmacellular invasion of the interstitium with multi-focal tubular acute damage suggestive of tubulitis (Fig. 1K–M). IF was negative. On EM, no images suggestive of immune deposits or for virus-like particles were observed. SARS-CoV-2 RT-PCR on kidney tissue was negative. Oral prednisone (1 mg/kg/day) was started, and 10 days after the admission, the girl was discharged. During the following 2 weeks, kidney dysfunction and tubular abnormalities resolved. Three months after the onset, therapy was stopped, and protective SARS-CoV-2-IgG titre persisted (21.1 cut off > 0.99 AU/ml).\n\nDiscussion\n\nSARS-COV-2 infection usually runs asymptomatic both in previously healthy and nephropatic children [1, 3–5]. Published data highlight both direct and indirect virus-related kidney damage [7]. Nevertheless, kidney involvement is uncommon in pediatric patients and the related histological data are lacking. AKI is the most feared kidney complication in children with COVID-19, but there is no consensus regarding its best management. To date, kidney biopsies are reported only in two children with COVID-19-associated AKI [10], showing an acute necrotizing glomerulonephritis in both cases. EM was not available. Similar to our patients, RT-PCR for SARS-CoV-2 tested negative in kidney specimens, as well as in urine. We describe for the first time the comprehensive kidney histological framework from two young girls with SARS-CoV-2 infection. In both cases, the lack of typical respiratory involvement resulted in a delayed diagnosis. Regardless, we presume that the inflammatory reaction exclusively involved the kidney in both girls.\n\nIn case 1, failure to gain remission of the underlying kidney disease and the new appearance of an atypical cutaneous rash suggested a SARS-CoV-2 infection, confirmed by the nasopharyngeal swab test. Indeed, pernio-like, macular erythema and vasculitis skin lesions are described in COVID-19 children, usually considered a late manifestation, lasting about 14 days, and associated with a more severe clinical course [11]. Therefore, cutaneous involvement of patient 1 suggested an infection occurred at least 2–3 weeks earlier that could overlap with the time of the first biopsy. Indeed, the presence of virus-like particles at the EM evaluation of first biopsy may be related to the presence of SARS-CoV-2 infection before the modification of cutaneous lesions and the worsening of kidney function. The latency between the onset of SARS-CoV-2-related symptoms despite an early evidence of viral elements at the kidney biopsy could be associated with the impaired immunological response secondary to persistent nephrotic proteinuria and to immunosuppressive therapy.\n\nWe can speculate that, despite the ongoing therapy, the pre-existing IgA vasculitis might have worsened due to the inflammatory trigger played by SARS-CoV-2. The histological findings mimicking viral particles in the first kidney biopsy and the evidence of a global worsening of the histological features of the second one suggest an association between SARS-CoV-2 infection and the severity of kidney inflammation. An acute exacerbation of a pre-existing kidney disease following COVID-19 was hypothesized also in one of the 2 cases described by Basiratnia et al. [10]. The better prognosis of our case may be related to the absence of general and respiratory involvement.\n\nWhile different reports of COVID-19 in adults highlight the presence of SARS-CoV-2 on EM with distinctive spikes or virus-like particles in the tubular epithelium or podocytes [6–9, 12], this is the first description of similar features in children. However, viral inclusions are also reported as incidental findings, not necessarily implicated in kidney damage, and can be mimicked by many structures [6, 9, 13]. Despite indirect signs, SARS-CoV-2 RNA by RT-PCR in kidney tissue and urine were undetected in our patient. This is in line with the only other pediatric report by Basiratnia et al. [10]. However, the presence of the virus at a concentration level below the threshold of detection cannot be excluded.\n\nSARS-CoV2-related tubular damage has already been described in COVID-19 adults [8]. In case 2, we describe for the first time the clinical and histological features of SARS-CoV-2-related aTIN, which appeared around 4–6 weeks after the first symptoms. In fact, SARS-CoV-2-IgG were already present at the time of kidney biopsy. aTIN is rare in children, usually caused by drug toxicity or viral infections [14, 15]. Similar to other infectious agents, the pathogenesis of tubular injury is unclear and may be associated with immunological changes established after direct or indirect damage by SARS-CoV-2. In our case, the latency between mild respiratory manifestations and the development of aTIN may suggest an indirect damage mediated by inflammatory cells, as also highlighted by the lympho-plasmacellular invasion at the kidney biopsy. As reported with other virus-triggered aTIN, viral particles are cleared before the clinical onset of kidney disease, characterized by a sterile tubular-interstitial infiltrate [14]. In fact, we were not able to demonstrate viral-like particles on EM. Therefore, SARS-CoV-2 can be added to the list of etiological infectious agents associated with aTIN [14, 15]. In our case, the response to steroids was excellent, with complete kidney recovery in 2 weeks. Considering the recent approval by the European Medicines Agency of a SARS-CoV-2 mRNA vaccine in children older than 12 years, we do not foresee contraindications to the vaccination in this girl, in accordance with the standard schedule for patients with a previous infection.\n\nIn conclusion, this is the first complete description of kidney histological findings and relative clinical pictures in two children infected by SARS-CoV-2 with only extrapulmonary manifestation. We strongly suggest further investigation into the potential kidney damage done by SARS-CoV-2 in children with or without clear pulmonary disease when other alarm signs appear, because kidney involvement can be sneaky and latent.\n\nFunding\n\nOpen access funding provided by Università degli Studi di Milano within the CRUI-CARE Agreement.\n\nDeclarations\n\nConflict of interest\n\nThe authors declare no competing interests.\n\nPublisher's note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Hoang A Chorath K Moreira A Evans M Burmeister-Morton F Burmeister F Naqvi R Petershack M Moreira A COVID-19 in 7780 pediatric patients: a systematic review E Clinical Medicine 2020 24 100433 10.1016/j.eclinm.2020.100433\n2. Nicastro E Verdoni L Bettini LR Zuin G Balduzzi A Montini G Biondi A D’Antiga L COVID-19 in immunosuppressed children Front Pediatr 2021 9 629240 10.3389/fped.2021.629240 33996683\n3. Melgosa M Madrid A Alvárez O Lumbreras J Nieto F Parada E Perez-Beltrán V Association SPN SARS-CoV-2 infection in Spanish children with chronic kidney pathologies Pediatr Nephrol 2020 35 1521 1524 10.1007/s00467-020-04597-1 32435879\n4. Mastrangelo A Morello W Vidal E Guzzo I Petruzzelli LA Impact of COVID-19 pandemic in children with CKD or immunosuppression Clin J Am Soc Nephrol 2020 16 449 451 10.2215/CJN.13120820 33318026\n5. Morello W Mastrangelo A Guzzo I Cusinato L Petruzzelli LA Prevalence of SARS-CoV-2 IgG antibodies in children with CKD or immunosuppression Clin J Am Soc Nephrol 2021 10.2215/CJN.00330121 34099499\n6. Punj S Eng E Shetty AA Coronavirus disease 2019 and kidney injury Curr Opin Nephrol Hypertens 2021 30 444 449 10.1097/MNH.0000000000000718 34027906\n7. Farouk SS Fiaccadori E Cravedi P Campbell KN COVID-19 and the kidney: what we think we know so far and what we don’t J Nephrol 2020 33 1213 1218 10.1007/s40620-020-00789-y 32691342\n8. Akilesh S Nast CC Yamashita M Henriksen K Charu V Troxell ML Multicenter clinicopathologic correlation of kidney biopsies performed in COVID-19 patients with acute kidney injury or proteinuria Am J Kidney Dis 2021 77 82 93.e1 10.1053/j.ajkd.2020.10.001 33045255\n9. Sharma P Uppal NN Wanchoo R Shah HH Yang Y Parikh R Khanin Y Madireddy V Larsen CP Jhaveri KD Bijol V Northwell Nephrology COVID-19 Research Consortium COVID-19–associated kidney injury: a case series of kidney biopsy findings J Am Soc Nephrol 2020 31 1948 1958 10.1681/ASN.2020050699 32660970\n10. Basiratnia M Derakhshan D Yeganeh BS Derakhshan A Acute necrotizing glomerulonephritis associated with COVID-19 infection: report of two pediatric cases Pediatr Nephrol 2021 36 1019 1023 10.1007/s00467-021-04944-w 33495896\n11. Freeman EE McMahon DE Lipoff JB Rosenbach M Kovarik C Desai SR Harp J The spectrum of COVID-19eassociated dermatologic manifestations: an international registry of 716 patients from 31 countries J Am Acad Dermatol 2020 83 1118 1129 10.1016/j.jaad.2020.06.1016 32622888\n12. Su H Yang M Wan C Yi LX Tang F Zhu HY Yi F Yang HC Fogo AB Nie X Zhang C Renal histopathological analysis of 26 postmortem findings of patients with COVID-19 in China Kidney Int 2020 98 219 227 10.1016/j.kint.2020.04.003 32327202\n13. Calomeni E Satoskar A Ayoub I Brodsky S Rovin BH Nadasdy T Mutivesicular bodies mimicking SARS-CoV-2 in patients without COVID-19 Kidney Int 2020 98 233 234 10.1016/j.kint.2020.05.003 32437766\n14. Ulinski T Sellier-Leclerc AL Tudorache E Bensman A Aoun B Acute tubulointerstitial nephritis Pediatr Nephrol 2012 2 1051 1057 10.1007/s00467-011-1915-9\n15. Ruebner RL Fadrowski JJ Tubulointerstitial nephritis Pediatr Clin North Am 2019 66 111 119 10.1016/j.pcl.2018.08.009 30454737\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0931-041X",
"issue": "36(11)",
"journal": "Pediatric nephrology (Berlin, Germany)",
"keywords": "Children; Glomerulonephritis; Kidney biopsy; SARS-CoV-2; Tubular damage",
"medline_ta": "Pediatr Nephrol",
"mesh_terms": "D001706:Biopsy; D000086382:COVID-19; D002648:Child; D005260:Female; D005922:Glomerulonephritis, IGA; D006801:Humans; D007668:Kidney; D008854:Microscopy, Electron; D009395:Nephritis, Interstitial; D000086402:SARS-CoV-2",
"nlm_unique_id": "8708728",
"other_id": null,
"pages": "3789-3793",
"pmc": null,
"pmid": "34406477",
"pubdate": "2021-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "33996683;32435879;33318026;34099499;34027906;32691342;33045255;32660970;33495896;32622888;32327202;32437766;30454737",
"title": "Kidney involvement and histological findings in two pediatric COVID-19 patients.",
"title_normalized": "kidney involvement and histological findings in two pediatric covid 19 patients"
} | [
{
"companynumb": "IT-LUPIN PHARMACEUTICALS INC.-2022-03645",
"fulfillexpeditecriteria": "2",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugad... |
{
"abstract": "OBJECTIVE\nThis analysis assessed the safety of intravenous immunoglobulin (IVIg) in the treatment of patients with neuroimmunological and immunological disorders in a home-based setting.\n\n\nMETHODS\nAdverse reactions (ARs) were assessed in a retrospective review of 1176 patients receiving 28,677 home-based IVIg infusions between 1996 and 2013.\n\n\nRESULTS\nOf 1176 patients, 648 (55.1%) experienced IVIg-related ARs; 536 (45.6%) were mild, 78 (6.6%) moderate, and 34 (2.9%) severe. Thirty-seven (3.1%) patients were hospitalized because of ARs; of these, headache was most common (51.4%). Mean number of ARs per patient increased from 1.4 (low dose) to 3.6 (high dose). Incidence of ARs increased from 41% in the first 5-year moving average in 2003 to 65% in 2008. The number of ARs correlated with the number of infusions (ρ = 0.24; P < 0.001) and the average IVIg dose (ρ = 0.10; P < 0.001).\n\n\nCONCLUSIONS\nLow- and high-dose IVIg were safe and well tolerated with a few serious ARs in patients with neuroimmunological and immunological disorders.",
"affiliations": "Department of Neurology and Neurosciences, Rutgers New Jersey Medical School, Newark, NJ.;Innovative Research Associates, Philadelphia, PA.;Innovative Research Associates, Philadelphia, PA.;Innovative Research Associates, Philadelphia, PA.;Department of Neurology, New York University School of Medicine, New York, NY.",
"authors": "Souayah|Nizar|N|;Pahwa|Ankit|A|;Burawski|Lauren|L|;Opila|Tamara|T|;Sander|Howard W|HW|",
"chemical_list": "D007136:Immunoglobulins; D007155:Immunologic Factors",
"country": "United States",
"delete": false,
"doi": "10.1097/CND.0000000000000201",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1522-0443",
"issue": "19(4)",
"journal": "Journal of clinical neuromuscular disease",
"keywords": null,
"medline_ta": "J Clin Neuromuscul Dis",
"mesh_terms": "D061605:Administration, Intravenous; D000293:Adolescent; D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D002648:Child; D002675:Child, Preschool; D015897:Comorbidity; D003240:Connective Tissue Diseases; D004305:Dose-Response Relationship, Drug; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D018718:Home Infusion Therapy; D006801:Humans; D007154:Immune System Diseases; D007136:Immunoglobulins; D007155:Immunologic Factors; D008137:Longitudinal Studies; D008297:Male; D008875:Middle Aged; D020511:Neuromuscular Junction Diseases; D012189:Retrospective Studies; D055815:Young Adult",
"nlm_unique_id": "100887391",
"other_id": null,
"pages": "181-195",
"pmc": null,
"pmid": "29794573",
"pubdate": "2018-06",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "A Retrospective Analysis of the Safety Profile of Intravenous Immunoglobulin in 1176 Patients Receiving Home Infusion Therapy.",
"title_normalized": "a retrospective analysis of the safety profile of intravenous immunoglobulin in 1176 patients receiving home infusion therapy"
} | [
{
"companynumb": "US-OCTA-LIT16718US",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": "3",
... |
{
"abstract": "Appropriate management to prevent relapses of acquired, autoimmune thrombotic thrombocytopenic purpura (TTP) is not clear. Rituximab (375 mg/m2 /week × 4) is effective treatment for acute episodes but it is not consistently effective for prevention of relapses. Maintenance rituximab, 375 mg/m2 /3 months for 2 years, is commonly used to prevent progression of follicular lymphoma, but the outcome of maintenance rituximab to prevent TTP relapses has been rarely reported.\n\n\n\nAn 8-year-old girl was diagnosed with acquired TTP in 2008; her ADAMTS13 activity was less than 5%, with a functional inhibitor of greater than 8 Bethesda units/mL. She achieved remission with therapeutic plasma exchange, corticosteroids, and rituximab (375 mg/m2 /week × 4). During the following 6 years she had seven additional episodes. Each episode responded to therapeutic plasma exchange, sometimes requiring additional treatments (corticosteroids, rituximab, and cyclophosphamide). However, these treatments, as well as splenectomy and trials of cyclophosphamide and mycophenolate mofetil during clinical remissions, failed to prevent relapses. Her ADAMTS13 activity remained 8% or less throughout all of her remissions. Maintenance rituximab was begun in 2013: 500 mg (313 mg/m2 ) every 2-3 months × 5, then 600 mg (375 mg/m2 ) every 6 months × 2. After 1 year, her ADAMTS13 was 26%; after 2 years, 51%. During the past 3 years since stopping rituximab, she has remained well, with normal ADAMTS13 activity (70%-78%).\n\n\n\nMaintenance rituximab treatment may be effective for prevention of relapses in patients with acquired, autoimmune TTP, even when splenectomy and intensive immunosuppression, including multiple conventional courses of rituximab, fail to prevent subsequent relapses.",
"affiliations": "Department of Internal Medicine, College of Medicine, Department of Biostatistics & Epidemiology, College of Public Health, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma.;Division of Hematology/Oncology, Department of Pediatrics, The University of Texas Southwestern Medical Center, Dallas, Texas.;Hematology Division, Department of Pediatrics, New York-Presbyterian Hospital, Columbia University College of Physicians & Surgeons, New York, New York.;Department of Internal Medicine, College of Medicine, Department of Biostatistics & Epidemiology, College of Public Health, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma.",
"authors": "Saleem|Rabia|R|;Rogers|Zora R|ZR|;Neunert|Cindy|C|;George|James N|JN|",
"chemical_list": "D000069283:Rituximab; D003520:Cyclophosphamide; D000071120:ADAMTS13 Protein; C099604:ADAMTS13 protein, human; D009173:Mycophenolic Acid",
"country": "United States",
"delete": false,
"doi": "10.1111/trf.15093",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1132",
"issue": "59(3)",
"journal": "Transfusion",
"keywords": null,
"medline_ta": "Transfusion",
"mesh_terms": "D000071120:ADAMTS13 Protein; D002648:Child; D003520:Cyclophosphamide; D005260:Female; D006801:Humans; D009173:Mycophenolic Acid; D011697:Purpura, Thrombotic Thrombocytopenic; D000069283:Rituximab; D016896:Treatment Outcome",
"nlm_unique_id": "0417360",
"other_id": null,
"pages": "921-926",
"pmc": null,
"pmid": "30548440",
"pubdate": "2019-03",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Maintenance rituximab for relapsing thrombotic thrombocytopenic purpura: a case report.",
"title_normalized": "maintenance rituximab for relapsing thrombotic thrombocytopenic purpura a case report"
} | [
{
"companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2018-11554",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"druga... |
{
"abstract": "BACKGROUND\nVenlafaxine (VEN) is a serotonin-norepinephrine-dopamine reuptake inhibitor that causes usually a mild cardiotoxicity when ingested in overdose. We report a patient who developed acute heart failure following overdose. As the toxicokinetic data suggested a prolonged metabolism, genetic polymorphisms for cytochrome P450 isoenzymes CYP2D6 and CYP2C19 were also investigated.\n\n\nMETHODS\nA 34-year-old woman was admitted to the hospital 10 hours after the ingestion of an 11.25 g overdose of VEN. She was comatose and suffered two self-limited seizures. The electrocardiogram showed diffuse ST segment depression, but normal QRS and QTc duration. The plasma levels on admission were 18,015 and 3,846 ng/ml for VEN and the metabolite O-desmethylvenlafaxine (ODV), respectively. The patient developed severe cardiodepression. The left ventricular shortening fraction was only 9% on echocardiography. The patient was oliguric and required continuous venovenous hemofiltration. The administration of milrinone was required for 12 days, and norepinephrine for 10 days. Left ventricular function recovered. The calculated elimination half-life was 30.8 and 72.2 hours for VEN and ODV, respectively. The patient genotype was CYP2D6*1/*5, the *5 allele corresponding to a complete deletion of CYP2D6 gene.\n\n\nCONCLUSIONS\nSevere and sustained cardiotoxicity following VEN overdose may be related to the amount ingested, as well as to the genetic polymorphism for CYP2D6 leading to a delayed elimination of active metabolite.",
"affiliations": "Cliniques St-Luc, Université Catholique de Louvain, Intensive Care, Avenue Hippocrate 10, Brussels, 1200 Belgium.",
"authors": "Vinetti|Marco|M|;Haufroid|Vincent|V|;Capron|Arnaud|A|;Classen|Jean-François|JF|;Marchandise|Sebastien|S|;Hantson|Philippe|P|",
"chemical_list": "D003511:Cyclohexanols; D017367:Serotonin Uptake Inhibitors; D000069470:Venlafaxine Hydrochloride; D001189:Aryl Hydrocarbon Hydroxylases; C045793:CYP2C19 protein, human; D065731:Cytochrome P-450 CYP2C19; D019389:Cytochrome P-450 CYP2D6; D020105:Milrinone; D009638:Norepinephrine; D000069468:Desvenlafaxine Succinate",
"country": "England",
"delete": false,
"doi": "10.3109/15563650.2011.626421",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1556-3650",
"issue": "49(9)",
"journal": "Clinical toxicology (Philadelphia, Pa.)",
"keywords": null,
"medline_ta": "Clin Toxicol (Phila)",
"mesh_terms": "D000328:Adult; D001189:Aryl Hydrocarbon Hydroxylases; D009202:Cardiomyopathies; D003511:Cyclohexanols; D065731:Cytochrome P-450 CYP2C19; D019389:Cytochrome P-450 CYP2D6; D000069468:Desvenlafaxine Succinate; D062787:Drug Overdose; D005260:Female; D017353:Gene Deletion; D006207:Half-Life; D006333:Heart Failure; D006801:Humans; D020105:Milrinone; D009638:Norepinephrine; D011110:Polymorphism, Genetic; D017367:Serotonin Uptake Inhibitors; D000069470:Venlafaxine Hydrochloride",
"nlm_unique_id": "101241654",
"other_id": null,
"pages": "865-9",
"pmc": null,
"pmid": "22077251",
"pubdate": "2011-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Severe acute cardiomyopathy associated with venlafaxine overdose and possible role of CYP2D6 and CYP2C19 polymorphisms.",
"title_normalized": "severe acute cardiomyopathy associated with venlafaxine overdose and possible role of cyp2d6 and cyp2c19 polymorphisms"
} | [
{
"companynumb": "BE-RANBAXY-2012RR-52575",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VENLAFAXINE HYDROCHLORIDE"
},
"drugadditional":... |
{
"abstract": "OBJECTIVE\nIn the last decade several authors described a robust and clinically relevant alleviation of depressive symptoms after infusions of the uncompetitive N-methyl-D-aspartate (NMDA) glutamate receptor antagonist - ketamine. In the majority of published reports ketamine was administrated to patients with depression resistant to pharmacotherapy, but not to ECT. We present a series of 5 subjects suffering from multimodal treatment-resistant depression (including ECT or rTMS and various medications) treated with intravenous infusions of ketamine in a subanesthetic dose of 0.5 mg/kg in the naturalistic setting. To the best of our knowledge it is the first report on ketamine infusion in patient resistant to antidepressants and r\nTwo subjects have been diagnosed with MDD, one with BD, two with severe depressive episode. The efficacy and possible adverse events were monitored using psychometric scales. Basic life parameters and ECG were observed.\n\n\nRESULTS\nKetamine's infusions showed transient antidepressant efficacy. Improvement rate in our group was significant lower than in previously reported. Ketamine was generally well tolerated. We noted transient BP variations and appearance of mild and transient dissociative symptoms. Low early response rate may be correlated with resistance to previous multimodal treatment, high rate of somatization and anxiety comorbidity or heterogeneity of our group.\n\n\nCONCLUSIONS\nOur findings do not support the use of ketamine infusions as the monotherapy in the subgroup of patients with multimodal treatment resistant depression.",
"affiliations": null,
"authors": "Gosek|Paweł|P|;Chojnacka|Magdalena|M|;Bieńkowski|Przemysław|P|;Swiecicki|Łukasz|Ł|",
"chemical_list": "D000928:Antidepressive Agents; D007649:Ketamine",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0033-2674",
"issue": "48(1)",
"journal": "Psychiatria polska",
"keywords": null,
"medline_ta": "Psychiatr Pol",
"mesh_terms": "D000328:Adult; D000928:Antidepressive Agents; D003131:Combined Modality Therapy; D061218:Depressive Disorder, Treatment-Resistant; D004565:Electroconvulsive Therapy; D005260:Female; D006801:Humans; D007262:Infusions, Intravenous; D007649:Ketamine; D008297:Male; D008875:Middle Aged; D011569:Psychiatric Status Rating Scales; D050781:Transcranial Magnetic Stimulation; D016896:Treatment Outcome",
"nlm_unique_id": "0103314",
"other_id": null,
"pages": "49-58",
"pmc": null,
"pmid": "24946434",
"pubdate": "2014",
"publication_types": "D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Effectiveness of ketamine in depressed patients resistant to ECT or rTMS therapy.",
"title_normalized": "effectiveness of ketamine in depressed patients resistant to ect or rtms therapy"
} | [
{
"companynumb": "PL-MYLANLABS-2020M1100905",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "QUETIAPINE"
},
"drugadditional": "3",
... |
{
"abstract": "Enterococcus casseliflavus is a rare pathogen that usually causes urinary tract and abdominal infections. Its main characteristics are positive motility, yellow colonies and constitutive low-level resistance to vancomycin. We present a case of E. casseliflavus bacteraemia due to thrombophlebitis at the site of the central venous catheter used for hemodialysis in a renal patient. The biochemical identification of the microorganism was further corroborated by molecular detection of the vanC gene. The patient received antibiotic therapy initially with daptomycin and gentamicin, and then with ampicillin and ceftriaxone. The outcome was cure, and he was released from the hospital after seven weeks afebrile with negative blood cultures.",
"affiliations": "Laboratory of Clinical Microbiology, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.;Laboratory of Clinical Microbiology, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.;Laboratory of Clinical Microbiology, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.;4th Department of Internal Medicine, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.;4th Department of Internal Medicine, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.;Laboratory of Clinical Microbiology, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece.",
"authors": "Vasilakopoulou|Alexandra|A|;Vourli|Sophia|S|;Siafakas|Nikolaos|N|;Kavatha|Dimitra|D|;Tziolos|Nikolaos|N|;Pournaras|Spyros|S|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/idr12030015",
"fulltext": "\n==== Front\nInfect Dis Rep\nInfect Dis Rep\nidr\nInfectious Disease Reports\n2036-7430 2036-7449 MDPI \n\n33158120\n10.3390/idr12030015\nidr-12-00015\nCase Report\nEnterococcus casseliflavus Bacteraemia in a Patient with Chronic Renal Disease\nVasilakopoulou Alexandra 1* Vourli Sophia 1 Siafakas Nikolaos 1 Kavatha Dimitra 2 Tziolos Nikolaos 2 Pournaras Spyros 1 1 Laboratory of Clinical Microbiology, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece; svourli@med.uoa.gr (S.V.); nsiaf@med.uoa.gr (N.S.); spournaras@med.uoa.gr (S.P.)\n2 4th Department of Internal Medicine, Medical School, Attikon University General Hospital, National and Kapodistrian University of Athens, 124 62 Athens, Greece; dimitra.kavatha@gmail.com (D.K.); r-nikolaos.tziolos@hotmail.com (N.T.)\n* Correspondence: dralexandravasilakopoulou@gmail.com; Tel.: +30-697-483-0362; Fax: +30-210-532-6421\n04 11 2020 \n12 2020 \n12 3 70 73\n06 5 2020 02 6 2020 © 2020 by the authors.2020Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Enterococcus casseliflavus is a rare pathogen that usually causes urinary tract and abdominal infections. Its main characteristics are positive motility, yellow colonies and constitutive low-level resistance to vancomycin. We present a case of E. casseliflavus bacteraemia due to thrombophlebitis at the site of the central venous catheter used for hemodialysis in a renal patient. The biochemical identification of the microorganism was further corroborated by molecular detection of the vanC gene. The patient received antibiotic therapy initially with daptomycin and gentamicin, and then with ampicillin and ceftriaxone. The outcome was cure, and he was released from the hospital after seven weeks afebrile with negative blood cultures.\n\nEnterococcus casseliflavusbacteraemiathrombophlebitis\n==== Body\n1. Introduction\nEnterococcus casseliflavus is a member of the normal stool flora and has constitutive low-level resistance to vancomycin. It is rarely isolated from clinical specimens but may cause serious invasive infections [1,2,3]. An unusual case of septic thrombophlebitis and bacteraemia by E. casseliflavus is presented. \n\n2. Case Report\nA 72-year-old man was referred to our hospital from a suburban nephrology center because of prolonged fever and persistent enterococcal bacteremia. The patient was suffering from chronic renal failure, undergoing regular hemodialysis sessions three times per week through a permanent right internal jugular venous catheter. He was a chronic smoker with chronic obstructive pulmonary disease, and had been operated on for lung decortication because of amiantosis 18 years prior to admission (since then he was under methylprednisolone therapy). Furthermore, he had high blood pressure and single vessel coronary artery disease for which he was treated with successful angioplasty the previous year, and was compliant to antihypertension and anticoagulant therapy. \n\nThe patient had sought medical consultation 35 days before in the nephrology center where he was having hemodialysis, because he had high fever (up to 39 °C). Blood cultures were drawn and were processed in the nephrology center’s laboratory, resulting in the isolation of Enterococcus spp. from two culture vials with a susceptibility profile that included vancomycin: sensitive (MIC: 4 μg/mL), ampicillin: sensitive, daptomycin: sensitive, dalfopristin/quinopristin: resistant, gentamicin synergy: sensitive, ciprofloxacin: sensitive, and linezolid: sensitive. The patient received daptomycin and ciprofloxacin for 21 days. After the completion of antibiotic therapy he presented again with fever at the nephrology center, new blood cultures were drawn, and he started again receiving daptomycin. Two days later, during hemodialysis, he suffered from chills, and after completion of the session developed fever. In the next hemodialysis session, the same symptoms occurred (chills and fever), and gentamicin was added to his therapy. The nephrology clinic’s laboratory in the meantime isolated again Enterococcus spp. from the blood culture. He was treated with antibiotic lock therapy of the central venous catheter with gentamicin, and was referred to University General Hospital Attikon for further evaluation and treatment. \n\nOn the day of admission to our hospital, the following laboratory results were obtained: hemoglobin 10.4 g/dL, leukocytes 13,590/μL (Neutrophils 87%), platelets 295,000/μL, creatinine 3.8 mg/dL, C-reactive protein 61 mg/L, and procalcitonine 2.7 ng/mL. The physical examination was normal except for a holosystolic mitral valve murmur upon cardiac auscultation. Initially he continued the therapeutic regimen he had started at the nephrology center (antibiotics only on the haemodialysis days of Tuesday, Thursday and Saturday). On Tuesday and Thursday, he was receiving daptomycin 300 mg IV, and on Saturday the dose was 450 mg. On all haemodialysis days he was receiving gentamicin 240 mg IV before the haemodialysis session and gentamicin 80 mg IV after each session. On the first day at the hospital six blood cultures were drawn and two more on the following day, and all were incubated with the standard BACTEC system (Becton Dickinson, Sparks, NV, USA). On the second day of his hospital stay, five of the blood cultures were positive with Gram-positive coccus forming chains. On the third day, two more cultures were positive with the same coccus. The central venous catheter was removed on the third day of stay. The isolate from all seven blood culture bottles was identified as E. casseliflavus. The colonies in standard Columbia agar exhibited distinct yellow pigment, the coccus was positive for motility [4], and the biochemical profile examined by Phoenix (Becton Dickinson, Sparks, NY, USA) and Vitek 2 (BioMerieux, Marcy-l’Etoile, France) matched E. casseliflavus. The antibiotic susceptibility phenotype included vancomycin: sensitive (MIC: 4 μg/mL), ampicillin: sensitive (MIC: 1 μg/mL), daptomycin: sensitive (MIC: 2 μg/mL), dalfopristin/quinopristin: resistant (MIC: 8 μg/mL), gentamicin synergy: sensitive (MIC: 16 μg/mL), ciprofloxacin: sensitive (MIC: 1 μg/mL), and linezolid: sensitive (MIC: 4 μg/mL). The MICs were determined by Vitek 2, Phoenix and E-tests while following the EUCAST breakpoints for all antibiotics (with the sole exception of the daptomycin MIC which was compared to the CLSI breakpoint). Furthermore, a multiplex PCR detecting vanA, vanB, vanC, vanD, vanE and VanG genes was performed and was positive for vanC, further corroborating the biochemical diagnosis [5]. The central venous catheter was cultured but there was no growth of any pathogen. The urine cultures were also negative.\n\nThe transesophageal echocardiogram was negative for vegetations and the fundoscopy was negative for Roth spots in the retina. A colonoscopy revealed numerous diverticula mainly in the sigmoid colon. CT scans of the head, thorax and abdomen were performed revealing a thrombus in the anterior vena cava near the distal end of the central venous catheter, and a pulmonary embolus at the lower lobe of the right lung involving the respective lobar artery and segmental branches. \n\nAfter the fourth day in our hospital the patient’s antibiotic therapy was changed to a combination of ampicillin 2gr IV every 8 h and ceftriaxone 2gr IV every 12 h, which he received for a total of 6 weeks. He also received anticoagulant therapy for the pulmonary embolus. He was released from the hospital after a total stay of seven weeks, afebrile, with negative blood cultures. \n\n3. Discussion and Conclusions\nE. casseliflavus is a yellow motile enterococcus that can cause serious infections mainly in immunocompromised and chronically ill patients [6]. Our patient was particularly vulnerable because he was under methylprednisolone therapy and suffered from renal failure, coronary artery disease and chronic obstructive pulmonary disease. He carried a permanent central venous catheter that caused thromobophlebitis at the anterior vena cava, and since the patient suffered from fever and chills after the hemodialysis sessions it is presumed that he had septic thrombophlebitis.\n\nThe imaging findings in combination with the positive blood cultures suggested enterococcal thrombophlebitis and probable consequent septic pulmonary embolism. Since E. casseliflavus was not isolated from any other culture, we can only assume the primary source of infection. The three most probable sources would be the urinary tract, the central venous catheter and the gastrointestinal tract. The urine cultures where negative, thus excluding the urinary source. The culture of the catheter was negative, but this may be attributed to the antibiotic lock therapy. Another possible course of events would include, first, thrombophlebitis due to mechanical irritation by the catheter, and then colonization of the thrombus and the surrounding tissues by Enterococcus circulating in blood. Because the patient had numerous diverticula in the sigmoid, these could have served as the source of transient enterococcal bacteraemia leading to thrombus colonization. \n\nThe initial two isolates from the positive blood cultures in the suburban nephrology center, which were identified there as Enterococcus spp., had identical susceptibility profiles to the E. casseliflavus isolated in our hospital’s laboratory, suggesting the same strain caused all bacteraemic episodes. \n\nThe identification as E. casseliflavus in the university hospital was based on the biochemical profile of the microorganism, the detection of the vanC gene, the positive motility and the yellow pigment. The combination of all the above traits was conclusive for E. casseliflavus [7,8]. Previous studies have proven the importance of the last two properties for correct identification at the species level since E. casseliflavus is the only motile Enterococcus producing yellow pigment [9]. The yellow pigment of the colonies was more evident after 48 h of incubation, and by inspecting the color on a white cotton swab. The antibiotic susceptibility profile of the isolate, with a relatively high MIC for vancomycin and low MICs for teicoplanin and ampicillin, is also indicative of E. casseliflavus [6].\n\nE. casseliflavus is an unlikely pathogen but it can cause invasive infections. A review of the literature reveals numerous reports of E. casseliflavus bacteraemias mainly in patients with serious comorbidities, such as hematologic malignancy, receipt of organ transplant, renal failure, diabetes mellitus, and antithrombin III deficiency [6]. Cases of vascular and iv line-related infection have also been described [10,11].\n\nVarious studies have proven that E. casseliflavus colonizes the gastrointestinal tracts of both hospitalized and non-hospitalized healthy individuals, and no definite risk factors for colonization have been identified [1,6,12]. The previous use of vancomycin is not associated with the carriage of E. casseliflavus [1]. The source of E. casseliflavus is probably the food chain since it has been isolated from farm animals and vegetables [13,14].\n\nVancomycin therapy for enterococcal strains with MICs of 4 μg/mL or lower is regarded as adequate according to EUCAST. However, there have been cases in which the use of vancomycin for in vitro susceptible strains of E. casseliflavus has led to therapeutic failure or breakthrough bacteremia, therefore vancomycin is not recommended for the therapy of E. casseliflavus infection [2,6,15]. The correct species identification is crucial for the right choice of therapy. In our case, the patient was treated with a combination of daptomycin and gentamicin initially, and then ampicillin and ceftriaxone, according to the antibiotic susceptibility profile of the isolate.\n\nFurthermore, it is important to identify correctly the enterococcal species that have low level vancomycin resistance and may be misidentified as vanB, in order to prevent costly unwarranted infection control measures. E. casseliflavus has not been associated with nosocomial outbreaks, and it is not an infection control problem [6,16,17].\n\nE. casseliflavus is a rare pathogen but it has to be considered, especially in cases of infections in immunocompromised hosts, as early accurate diagnosis increases the rates of cure and survival.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor Contributions\nA.V.: laboratory diagnosis, manuscript writing, case-analysis, and literature review, S.V. molecular diagnosis, literature review, N.S., molecular diagnosis, manuscript review, D.K., treatment of the patient, manuscript review, N.T., treatment of the patient, case-analysis, S.P., case-analysis, manuscript review. All authors have read and agreed to the published version of the manuscript.\n\nFunding\nThis research received no external funding.\n\nConflicts of Interest\nThe authors declare no potential conflict of interest.\n\nEthics Approval\nOur institution does not require ethical approval for individual case reports.\n==== Refs\nReferences\n1. Toye B. Shymanski J. Bobrowska M. Woods W. Ramotar K. Clinical and epidemiological significance of enterococci intrinsically resistant to vancomycin (possessing the vanC genotype) J. Clin. Microbiol. 1997 35 3166 3170 10.1128/JCM.35.12.3166-3170.1997 9399514 \n2. Choi S. Lee S. Kim T.H. Chung J. Choo E.J. Kwak Y.G. Kim M. Kim Y.S. Woo J.H. Ryu J. Clinical features and outcomes of bacteremia caused by Enterococcus casseliflavus and Enterococcus gallinarum : Analysis of 56 Cases Clin. Infect. Dis. 2004 38 53 61 10.1086/380452 14679448 \n3. Koganemaru H. Hitomi S. Bacteremia caused by VanC-type Enterococci in a university hospital in Japan: A 6-year survey J. Infect. Chemother. 2008 14 413 417 10.1007/s10156-008-0644-X 19089554 \n4. Van Horn K. Tóth C. Kariyama R. Mitsuhata R. Kumon H. Evaluation of 15 motility media and a direct microscopic method for detection of motility in Enterococci J. Clin. Microbiol. 2002 40 2476 2479 10.1128/JCM.40.7.2476-2479.2002 12089265 \n5. Depardieu F. Perichon B. Courvalin P. Detection of the van alphabet and identification of Enterococci and Staphylococci at the species level by multiplex PCR J. Clin. Microbiol. 2004 42 5857 5860 10.1128/JCM.42.12.5857-5860.2004 15583325 \n6. Reid K.C. Cockerill F.R. Patel R. Clinical and Epidemiological Features of Enterococcus casseliflavus/flavescens and Enterococcus gallinarum Bacteremia: A Report of 20 Cases Clin. Infect. Dis. 2001 32 1540 1546 10.1086/320542 11340524 \n7. Murray B.E. The life and times of the Enterococcus Clin. Microbiol. Rev. 1990 3 46 65 10.1128/CMR.3.1.46 2404568 \n8. Cetinkaya Y. Falk P. Mayhall C.G. Vancomycin-resistant Enterococci Clin. Microbiol. Rev. 2000 13 686 707 10.1128/CMR.13.4.686 11023964 \n9. Cartwright C.P. Stock F. Fahle G.A. Gill V.J. Comparison of pigment production and motility tests with PCR for reliable identification of intrinsically vancomycin-resistant Enterococci J. Clin. Microbiol. 1995 33 1931 1933 10.1128/JCM.33.7.1931-1933.1995 7665675 \n10. Pompei R. Lampis G. Berlutti F. Thaller M.C. Characterization of yellow-pigmented Enterococci from severe human infections J. Clin. Microbiol. 1991 29 2884 2886 10.1128/JCM.29.12.2884-2886.1991 1757566 \n11. Patterson J.E. Sweeney A.H. Simms M. Carley N. Mangi R. Sabetta J. Lyons R.W. An analysis of 110 serious Enterococcal infections epidemiology, antibiotic susceptibility, and outcome Medicine 1995 74 191 200 10.1097/00005792-199507000-00003 7623654 \n12. Gordts B. Van Landuyt H. Ieven M. Vandamme P. Goossens H. Vancomycin-resistant Enterococci colonizing the intestinal tracts of hospitalized patients J. Clin. Microbiol. 1995 33 2842 2846 10.1128/JCM.33.11.2842-2846.1995 8576330 \n13. Thal L.A. Chow J.W. Mahayni R. Bonilla H. Perri M.B. Donabedian S.A. Silverman J. Taber S. Zervos M.J. Characterization of antimicrobial resistance in Enterococci of animal origin Antimicrob. Agents Chemother. 1995 39 2112 2115 10.1128/AAC.39.9.2112 8540725 \n14. Al-Kharousi Z.S. Guizani N. Al-Sadi A.M. Al-Bulushi I.M. Shaharoona B. Hiding in fresh fruits and vegetables: Opportunistic pathogens may cross geographical barriers Int. J. Microbiol. 2016 2016 1 14 10.1155/2016/4292417 26989419 \n15. Ratanasuwan W. Iwen P.C. Hinrichs S.H. Rupp M.E. Bacteremia due to motile Enterococcus species: Clinical features and outcomes Clin. Infect. Dis. 1999 28 1175 1177 10.1086/517774 10452665 \n16. Narciso-Schiavon J.L. Borgonovo A. Marques P.C. Tonon D. Bansho E.T.O. Maggi D.C. Dantas-Corrêa E.B. Schiavon L.D.L. Enterococcus casseliflavus and Enterococcus gallinarum as causative agents of spontaneous bacterial peritonitis Ann. Hepatol. 2015 14 270 272 10.1016/S1665-2681(19)30791-4 25671838 \n17. Van Horn K.G. Gedris C.A. Rodney K.M. Mitchell J.B. Evaluation of commercial vancomycin agar screen plates for detection of vancomycin-resistant Enterococci J. Clin. Microbiol. 1996 34 2042 2044 10.1128/JCM.34.8.2042-2044.1996 8818911\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2036-7430",
"issue": "12(3)",
"journal": "Infectious disease reports",
"keywords": "Enterococcus casseliflavus; bacteraemia; thrombophlebitis",
"medline_ta": "Infect Dis Rep",
"mesh_terms": null,
"nlm_unique_id": "101537203",
"other_id": null,
"pages": "70-73",
"pmc": null,
"pmid": "33158120",
"pubdate": "2020-11-04",
"publication_types": "D002363:Case Reports",
"references": "10452665;14679448;8818911;7623654;26989419;11340524;9399514;11023964;1757566;8540725;19089554;7665675;25671838;15583325;8576330;12089265;2404568",
"title": "Enterococcus casseliflavus Bacteraemia in a Patient with Chronic Renal Disease.",
"title_normalized": "enterococcus casseliflavus bacteraemia in a patient with chronic renal disease"
} | [
{
"companynumb": "GR-PFIZER INC-2020474693",
"fulfillexpeditecriteria": "1",
"occurcountry": "GR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "Objective: To evaluate the efficacy and tolerability of brivaracetam (BRV) in a severely drug refractory cohort of patients with epileptic encephalopathies (EE). Method: A multicenter, retrospective cohort study recruiting all patients treated with EE who began treatment with BRV in an enrolling epilepsy center between 2016 and 2017. Results: Forty-four patients (27 male [61%], mean age 29 years, range 6 to 62) were treated with BRV. The retention rate was 65% at 3 months, 52% at 6 months and 41% at 12 months. A mean retention time of 5 months resulted in a cumulative exposure to BRV of 310 months. Three patients were seizure free during the baseline. At 3 months, 20 (45%, 20/44 as per intention-to-treat analysis considering all patients that started BRV including three who were seizure free during baseline) were either seizure free (n = 4; 9%, three of them already seizure-free at baseline) or reported at least 25% (n = 4; 9%) or 50% (n = 12; 27%) reduction in seizures. An increase in seizure frequency was reported in two (5%) patients, while there was no change in the seizure frequency of the other patients. A 50% long-term responder rate was apparent in 19 patients (43%), with two (5%) free from seizures for more than six months and in nine patients (20%, with one [2 %] free from seizures) for more than 12 months. Treatment-emergent adverse events were predominantly of psychobehavioural nature and were observed in 16%. Significance: In this retrospective analysis the rate of patients with a 50% seizure reduction under BRV proofed to be similar to those seen in regulatory trials for focal epilepsies. BRV appears to be safe and relatively well tolerated in EE and might be considered in patients with psychobehavioral adverse events while on levetiracetam.",
"affiliations": "Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Department of Neuropediatrics, University of Rostock, Rostock, Germany.;Epilepsy Center Rotenburg, Agaplesion Diakonieklinikum Rotenburg, Rotenburg, Germany.;Centre of Pediatric Research, Hospital for Children and Adolescents, Leipzig, Germany.;Epilepsy Center Hessen and Department of Neurology, Philipps-University, Marburg, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Epilepsy Center Hessen and Department of Neurology, Philipps-University, Marburg, Germany.;Epilepsy Center Greifswald and Department of Neurology, Ernst-Moritz-Arndt-University, Greifswald, Germany.;Department of Neuropediatrics, Westfälische Wilhelms-University, Münster, Germany.;Epilepsy Center Münster-Osnabrück, Department of Neurology with Institute of Translational Neurology - Epileptology, Westfälische Wilhelms-University, Münster, Germany.;Epilepsy Center Münster-Osnabrück, Department of Neurology with Institute of Translational Neurology - Epileptology, Westfälische Wilhelms-University, Münster, Germany.;Epilepsy Center for Children, University Hospital Neuruppin, Brandenburg Medical School, Neuruppin, Germany.;Epilepsy Center Greifswald and Department of Neurology, Ernst-Moritz-Arndt-University, Greifswald, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Kork Epilepsy Center, Kehl-Kork, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.;Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany.",
"authors": "Willems|Laurent M|LM|;Bertsche|Astrid|A|;Bösebeck|Frank|F|;Hornemann|Frauke|F|;Immisch|Ilka|I|;Klein|Karl M|KM|;Knake|Susanne|S|;Kunz|Rhina|R|;Kurlemann|Gerhard|G|;Langenbruch|Lisa|L|;Möddel|Gabriel|G|;Müller-Schlüter|Karen|K|;von Podewils|Felix|F|;Reif|Philipp S|PS|;Steinhoff|Bernhard J|BJ|;Steinig|Isabel|I|;Rosenow|Felix|F|;Schubert-Bast|Susanne|S|;Strzelczyk|Adam|A|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fneur.2018.00569",
"fulltext": "\n==== Front\nFront NeurolFront NeurolFront. Neurol.Frontiers in Neurology1664-2295Frontiers Media S.A. 10.3389/fneur.2018.00569NeurologyOriginal ResearchEfficacy, Retention, and Tolerability of Brivaracetam in Patients With Epileptic Encephalopathies: A Multicenter Cohort Study From Germany Willems Laurent M. 1Bertsche Astrid 23Bösebeck Frank 4Hornemann Frauke 3Immisch Ilka 5Klein Karl M. 1Knake Susanne 5Kunz Rhina 6Kurlemann Gerhard 7Langenbruch Lisa 8Möddel Gabriel 8Müller-Schlüter Karen 9von Podewils Felix 6Reif Philipp S. 1Steinhoff Bernhard J. 10Steinig Isabel 1Rosenow Felix 15Schubert-Bast Susanne 111†Strzelczyk Adam 15*†1Epilepsy Center Frankfurt Rhine-Main and Department of Neurology, Goethe University Frankfurt, Frankfurt, Germany2Department of Neuropediatrics, University of Rostock, Rostock, Germany3Centre of Pediatric Research, Hospital for Children and Adolescents, Leipzig, Germany4Epilepsy Center Rotenburg, Agaplesion Diakonieklinikum Rotenburg, Rotenburg, Germany5Epilepsy Center Hessen and Department of Neurology, Philipps-University, Marburg, Germany6Epilepsy Center Greifswald and Department of Neurology, Ernst-Moritz-Arndt-University, Greifswald, Germany7Department of Neuropediatrics, Westfälische Wilhelms-University, Münster, Germany8Epilepsy Center Münster-Osnabrück, Department of Neurology with Institute of Translational Neurology - Epileptology, Westfälische Wilhelms-University, Münster, Germany9Epilepsy Center for Children, University Hospital Neuruppin, Brandenburg Medical School, Neuruppin, Germany10Kork Epilepsy Center, Kehl-Kork, Germany11Department of Neuropediatrics, Goethe University Frankfurt, Frankfurt, GermanyEdited by: Fernando Cendes, Universidade Estadual de Campinas, Brazil\n\nReviewed by: Dieter Schmidt, Epilepsy Research Group, Germany; Marino M. Bianchin, Universidade Federal do Rio Grande do Sul (UFRGS), Brazil\n\n*Correspondence: Adam Strzelczyk strzelczyk@med.uni-frankfurt.deThis article was submitted to Epilepsy, a section of the journal Frontiers in Neurology\n\n†These authors have contributed equally to this work.\n\n23 7 2018 2018 9 56908 5 2018 25 6 2018 Copyright © 2018 Willems, Bertsche, Bösebeck, Hornemann, Immisch, Klein, Knake, Kunz, Kurlemann, Langenbruch, Möddel, Müller-Schlüter, von Podewils, Reif, Steinhoff, Steinig, Rosenow, Schubert-Bast and Strzelczyk.2018Willems, Bertsche, Bösebeck, Hornemann, Immisch, Klein, Knake, Kunz, Kurlemann, Langenbruch, Möddel, Müller-Schlüter, von Podewils, Reif, Steinhoff, Steinig, Rosenow, Schubert-Bast and StrzelczykThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Objective: To evaluate the efficacy and tolerability of brivaracetam (BRV) in a severely drug refractory cohort of patients with epileptic encephalopathies (EE).\n\nMethod: A multicenter, retrospective cohort study recruiting all patients treated with EE who began treatment with BRV in an enrolling epilepsy center between 2016 and 2017.\n\nResults: Forty-four patients (27 male [61%], mean age 29 years, range 6 to 62) were treated with BRV. The retention rate was 65% at 3 months, 52% at 6 months and 41% at 12 months. A mean retention time of 5 months resulted in a cumulative exposure to BRV of 310 months. Three patients were seizure free during the baseline. At 3 months, 20 (45%, 20/44 as per intention-to-treat analysis considering all patients that started BRV including three who were seizure free during baseline) were either seizure free (n = 4; 9%, three of them already seizure-free at baseline) or reported at least 25% (n = 4; 9%) or 50% (n = 12; 27%) reduction in seizures. An increase in seizure frequency was reported in two (5%) patients, while there was no change in the seizure frequency of the other patients. A 50% long-term responder rate was apparent in 19 patients (43%), with two (5%) free from seizures for more than six months and in nine patients (20%, with one [2 %] free from seizures) for more than 12 months. Treatment-emergent adverse events were predominantly of psychobehavioural nature and were observed in 16%.\n\nSignificance: In this retrospective analysis the rate of patients with a 50% seizure reduction under BRV proofed to be similar to those seen in regulatory trials for focal epilepsies. BRV appears to be safe and relatively well tolerated in EE and might be considered in patients with psychobehavioral adverse events while on levetiracetam.\n\nlevetiracetamepileptic encephalopathiesepilepsyseizureanticonvulsants\n==== Body\nIntroduction\nBrivaracetam (BRV), the second substance in the racetam class of anti-epileptic drugs (AEDs), was approved in the EU and USA in 2016 as adjunct therapy for epilepsy with focal onset seizures whether or not secondary generalization is present. Promising results concerning efficacy, tolerability and safety of BRV were demonstrated in a number of clinical trials (1–7). Like levetiracetam (LEV) BRV primarily acts as inhibitory ligand at the synaptic vesicle protein 2A (SV2A). Compared to LEV, BRV shows a 30-fold increased affinity to its structural target (8–12). Switching patients from LEV to BRV at a ratio of 10:1 to 15:1 may reduce adverse drug events in patients who respond well to LEV but develop drug-related sedation or BAEs (behavioral adverse events) (1, 7, 13).\n\nEpileptic encephalopathies (EE) are a heterogeneous group of epilepsy syndromes (14, 15) in which epileptic activity leads to progressively greater levels of cognitive and behavioral impairment as it would be expected only as a result of the underlying structural or genetic pathology. According to ILAE guidelines (International League Against Epilepsy), common EE syndromes with characteristic electroclinical manifestations are Lennox-Gastaut Syndrome (LGS), Dravet Syndrome (DS), West Syndrome (WS) and EE with continuous spike-and-wave during sleep (CSWS). In addition, there is a heterogeneous group of diseases with metabolic, or structural aetiologies predisposing the development of EEs, such as Landau-Kleffner Syndrome (LKS), Tuberous Sclerosis Complex (TSC) or Unverricht-Lundborg Syndrome (UVR). Moreover, several epileptogenic mutations like SCN9A, KCN2A or GRIN-2B have been shown to be associated with EE in their course of disease. The majority of EE patients develop refractory epilepsies and suffer from relapsing seizures of heterogeneous semiologies. Frequent hospitalization associated with the need for extended medical and nursing care place major social, interpersonal, and economic burden on patients, caregivers and society (14–18).\n\nThe purpose of this multicenter study was to evaluate efficacy and tolerability of BRV in patients with EE.\n\nPatients and methods\nA retrospective data analysis with EE patients who received at least one dose of BRV between 2016 and 2017 was performed at eight German epilepsy centers (Frankfurt, Greifswald, Kork, Leipzig, Marburg, Münster, Neuruppin, and Rotenburg/Wümme). There is no third party funding or sponsoring to report. This study was approved by the ethics committee. STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) guidelines were followed (19).\n\nThe average seizure frequency of the last three months prior to the initiation of BRV was accepted as the baseline frequency. Three, 6 and 12 months retention rates were calculated. Terminal remission defined patients reaching seizure freedom throughout the subsequent follow up periods. For the purposes of this study, a 25% seizure reduction was assumed if seizure frequencies declined by 25 to 50% compared to the baseline whereas a 50% seizure reduction described a reduction of the seizure frequency above 50%. Patients who showed less than a 25% seizure reduction were assumed to be non-responders. A seizure increase was defined as any increase of seizure frequencies greater 25%. Further details of analysis and the definition of BAEs are available in Steinig et al. (20). Data acquisition was performed using anonymised, standardized reporting forms and statistical analysis by IBM SPSS Statistics, Version 22.0 (IBM Corp, Armonk, NY, U.S.A.). Kaplan-Meier survival curves were used to estimate retention time; Chi-Square and log-rank tests were used for statistical analysis with p-values < 0.05 treated as statistically significant.\n\nResults\nPatient characteristics at baseline\nForty-four patients (27 male; 61% male), mean age 28.8 years (±14.2, range 6-62, nine children or adolescents <18 years [21%]), were included in this study. The most frequent aetiologies of EE in our cohort were LGS (n = 20, 45.5%), TSC (n = 3, 6.8%), UVR (n = 2, 4.5%), and CSWS (n = 2, 4.5%). Moreover, several patients displayed other well-defined syndromes associated with EE, such as DS, AS and Neuronal Ceroid Lipofucinosis (each n = 1, 2%) or epileptogenic mutations, such as SCN9A, KCN2A and GRIN-2B (each n = 1, 2%). Mean epilepsy duration at baseline was 24.4 ± 15 years (median 23; range 0–57 years). Epilepsy onset was at a mean age of 4.4 ± 6.3 years (median 2; range 0–27 years). In 18 patients (40.9%), mRS (modified Rankin Scale) of 3–5 indicated moderate to severe impairment. Mean AED number at start of BRV was 2.9 ± 0.9 (median: 3, range: 1–4 AEDs). The most frequently prescribed drugs at baseline were: valproate (VPA, n = 27, 61%); LEV (n = 24, 55%); lamotrigine (LTG, n = 24, 55%); clobazam (CLB, n = 18, 41%); carbamazepine (CBZ, n = 14, 32%), topiramate (TPM, n = 14, 32%), and zonisamide (ZNS, n = 14, 32%). A drug refractory course was present in all patients, they have failed a mean number of 4.4 ± 4.3 AEDs in the past (median 3.5, range 0–17; current AEDs not included). A total of 37 patients (84.1%) had exposure to LEV during their lifetime. Details are presented in Table 1.\n\nTable 1 Clinical and sociodemographic characteristics of the cohort (n = 44).\n\nAge (years)\t\n Mean ± SD\t28.3 ± 14.5\t\n Median\t26.0\t\n Range\t3–62\t\nMean age at onset of epilepsy (years)\t\n Mean ± SD\t4.4 ± 6.2\t\n Median\t2.0\t\n Range\t0–27\t\nEpilepsy duration (years)\t\n Mean ± SD\t24.4 ± 15.0\t\n Median\t23.0\t\n Range\t0–57\t\nSex\tn (%)\t\n Male\t27 (61.4)\t\n Female\t17 (38.6)\t\nNumber of concomitant AEDs at start of BRV\t\n Mean ± SD\t2.9 ± 0.9\t\n Median\t3.0\t\n Range\t1–4\t\nPreviously failed AEDs (without current)\t\n Mean ± SD\t4.4 ± 4.3\t\n Median\t3.5\t\n Range\t0–17\t\nSeizure semiology\tn (%)\t\n Focal onset seizures with preserved awareness\t3 (6.8)\t\n Focal onset seizures with impaired awareness\t20 (45.5)\t\n Focal to bilateral tonic-clonic seizures\t27 (61.4)\t\n Myoclonic seizures\t18 (40.9)\t\n Atypical absence seizures\t14 (31.8)\t\n Other generalized seizures\t20 (45.5)\t\nSyndrome/etiology\tn (%)\t\n Lennox-Gastaut-Syndrome (LGS)\t20 (45.5)\t\n Tuberous sclerosis complex (TSC)\t3 (6.8)\t\n Unverricht-Lundborg-Syndrome (UVR)\t2 (4.5)\t\n Continuous Spike Waves in Sleep (CSWS)\t2 (4.5)\t\n Dravet-Syndrome\t1 (2.3)\t\n SCN9A mutation\t1 (2.3)\t\n Neuronal Ceroid Lipofuscinosis (NCL)\t1 (2.3)\t\n KCN2A mutation\t1 (2.3)\t\n GRIN-2B mutation\t1 (2.3)\t\n RBFOXI mutation\t1 (2.3)\t\n Angelman-Syndrome\t1 (2.3)\t\n other\t10 (22.7)\t\nAED, anti-epileptic drug; SD, standard deviation; BRV, brivaracetam.\n\nThe mean monthly seizure frequency during baseline period was 54.9 ± 76.9 (median 30, range 0–400). In three patients (6.8%) no seizures during baseline period were reported, however, they were switched due to TEAE (Treatment Emergent Adverse Event) under LEV or another AED. Focal onset seizures with preserved awareness were reported in three patients (7%), while 20 patients (46%) suffered from focal onset seizures with impaired awareness. 27 patients (61%) described focal onset seizures evolving into bilateral tonic-clonic seizures. Atypical absence seizures were reported by 14 (32%) and myoclonic seizures by 18 patients (41%). In addition, 20 patients (46%) described other generalized seizure types, such as tonic or atonic seizures.\n\nTreatment with brivaracetam\nThe initial daily dosage of BRV for patients who were not taking LEV at start of BRV varied between 25 mg and 100 mg (mean 66.3 mg ± 26.0 mg, median 50 mg). Median titration time was 6 days (mean 13.7 ± 15.8 days), the target dose ranged between 100 mg and 200 mg (mean 138.5 ± 50.6 mg, median 100 mg). The total number of patients switching from LEV to BRV at a median 15:1 ratio (mean 16.2:1, range 5:1 to 50:1) was 24 (55%), of whom 21 switched overnight and three overlapped LEV and BRV. Patients switched from LEV to BRV at an initial dose in the range 25 mg to 300 mg (mean 122.1 ± 72.1 mg, median 100 mg), with a target dose in the range 60 mg to 300 mg (mean 175.2 ± 70.1 mg, median 187.5 mg).\n\nRetention, responder rate, and seizure free patients\nThe probability that a patient would still be on BRV treatment after 3 months was 65%, respectively 52% after 6 months and 41% after 12 months. The most common reasons for discontinuing BRV were lack of efficacy (n = 12, 27%), adverse events (n = 5, 11%); or both (n = 2, 5%).\n\nAt 3 months, 20 (45%, 20/44 as per intention-to-treat analysis considering all patients that started BRV including three who were seizure free during baseline) were either seizure free (n = 4; 9%, three of them already seizure-free at baseline) or reported at least 25% (n = 4; 9%) or 50% (n = 12; 27%) reduction in seizures. There was no change in the frequency of seizures in 21 patients (48%), an increase in seizure frequency was reported in two (5%) patients. In one patient response was not well quantifiable. Table 2 shows the response according to clinical characteristics.\n\nTable 2 Clinical characteristics and outcome on 3-months-follow-up (n = 43, response in 1 patients not quantifiable).\n\n\tPatients\tNon responders\t>25% response\t>50% Response\tSubgroup of seizure free patients\t\n\tn\t\t\t% (n)\t\t\nTotal\t43\t53.5 (23)\t9.3 (4)\t37.2 (16)\t9.3 (4)\t\nSEX\t\nMale\t26\t50.0 (13)\t3.8 (1)\t46.2 (12)\t15.4 (4)\t\nFemale\t17\t52.6 (10)\t15.8 (3)\t21.1 (4)\t0.0 (0)\t\nAGE RANGE\t\n<18 years\t9\t44.4 (4)\t11.1 (1)\t44.4 (4)\t22.2 (2)\t\n≥18 years\t34\t55.9 (19)\t11.8 (4)\t32.3 (11)\t5.9 (2)\t\nINITIAL BRV DOSAGE\t\n≤ 100 mg\t21\t47.6 (10)\t19.0 (4)\t33.3 (7)\t9.5 (2)\t\n100–199 mg\t14\t57.1 (8)\t0.0 (0)\t42.9 (6)\t7.1 (1)\t\n>200 mg\t5\t60.0 (3)\t0.0 (0)\t40.0 (2)\t0.2 (1)\t\nLEV STATUS\t\nDirect switch from LEV to BRV\t23\t56.5 (13)\t4.3 (1)\t39.1 (9)\t17.4 (4)\t\nStart of BRV with previous exposure to LEV\t13\t61.5 (8)\t7.7 (1)\t30.8 (4)\t0.0 (0)\t\nStart of BRV without previous exposure to LEV\t7\t28.6 (2)\t28.6 (2)\t42.9 (3)\t0.0 (0)\t\nPREVIOUSLY FAILED AEDs (WITHOUT CURRENT)\t\n0–1\t14\t42.9 (6)\t0.0 (0)\t57.1 (8)\t21.4 (3)\t\n≥ 2\t25\t56.0 (14)\t16.0 (4)\t28.0 (7)\t0.04 (1)\t\nNUMBER OF AEDs AT START OF BRV\t\n0–1\t3\t66.6 (2)\t0.0 (0)\t33.3 (1)\t33.3 (1)\t\n2\t8\t62.5 (5)\t0.0 (0)\t37.5 (3)\t25.0 (2)\t\n≥3\t28\t46.4 (13)\t14.3 (4)\t39.3 (11)\t3.6 (1)\t\nSEIZURE SEMIOLOGY\t\nFocal onset seizures with or without preserved awareness\t19\t63.1 (12)\t10.5 (2)\t26.3 (5)\t5.3 (1)\t\nFocal to bilateral tonic-clonic seizures\t26\t42.3 (11)\t15.4 (4)\t42.3 (11)\t7.7 (2)\t\nOther generalized seizures\t31\t48.4 (15)\t6.5 (2)\t45.2 (14)\t3.2 (1)\t\nBRV, brivaracetam; LEV, levetiracetam; AEDs, antiepileptic drugs.\n\nA 50% long-term responder rate was apparent in 19 patients (43%), with two (5%) free from seizures for more than 6 months and in nine patients (20%, with one [2%] free from seizures) for more than 12 months. The mean exposure time to BRV was 211 days, ranging from one day to 24 months (median 140 days). The total exposure time to BRV in this study was 310 months. Retention rates were calculated and plotted using the Kaplan–Meier survival curves for all patients (Figure 1A) and depending on the LEV to BRV switch (Figure 1B). No significant difference was observed between patients who started on BRV and those who switched from LEV (log-rank p-value: 0.515). At the final follow-up, the daily BRV dose ranged from 50 mg to 300 mg (mean 131.5 ± 86.2 mg, median 150 mg); three patients (6.8%) had a daily dose greater than 200 mg.\n\nFigure 1 Retention of brivaracetam (BRV) in the complete cohort (A) and in patients with (LEV) or without levetiracetam upon start of brivaracetam (B) (w/o, without).\n\nTreatment-emergent adverse events\nTEAEs were reported in seven (16%) patients while being treated with BRV. There were six (14%) cases of BAE, one (2 %) of somnolence and one (2%) of bruxism. BAE were observed in four patients that had had BAE while exposed to LEV (n = 4/18), while two patients had BAE on BRV who had had no BAE on LEV or were not exposed to LEV in the past (n = 2/26, p = 0.35). Details are presented in Table 3.\n\nTable 3 Characteristics of treatment-emergent adverse events (TEAEs) and their frequency (n = 44).\n\nTEAE under BRV\tTEAE only under LEV*\tTEAE under LEV and BRV\t\n\treported n(%)\tleading to withdrawal n(%)\treported n(%)\treported n(%)\t\nOverall\t7 (15.9)\t4 (9.1)\t18 (40.9)\t3 (6.8)\t\nCNS related\t1 (2.3)\t1 (2.3)\t5 (11.4)\t1 (2.3)\t\n Sedation/somnolence\t1 (2.3)\t1 (2.3)\t\t\t\npsychiatric\t6 (13.6)\t4 (9.1)\t14 (31.8)\t2 (4.5)\t\n Irritability\t4 (9.1)\t2 (4.5)\t\t\t\n Aggression\t3 (6.8)\t2 (4.5)\t\t\t\nOther\t1 (2.3)\t0 (0.0)\t2 (4.5)\t1 (2.3)\t\n Bruxism\t1 (2.3)\t0 (0.0)\t\t\t\nBRV, brivaracetam; LEV, levetiracetam;\n\n* reported at switch or in the past while exposed to LEV.\n\nDiscussion\nThis multicenter retrospective study examined the efficacy of BRV and its tolerability in a cohort of 44 EE patients who represent a severely affected subgroup with usually drug refractory epilepsy and frequent seizures (15, 21). The burden placed on these patients, their caregivers and society makes outcome research in patients with EEs relevant and important. New AEDs including cannabidiol and fenfluramine are being developed for some EE patient subgroups (14–17) and there are few precision medicine approaches for single syndromes leading to EE, such as everolimus in TSC or ketogenic diet in Glut1-deficency. To date, there is only insufficient information on the efficacy and tolerability of BRV in this special subgroup. Data on this cohort, with aggregated 310 month exposure to BRV and follow-ups of up to 24 months, are informative in this respect.\n\nThe cohort showed retention rates of 65% at 3 months, 52% at 6 months and 41% at 12 months which is in line with other BRV post-marketing studies (13, 20, 22, 23), and compare with results from other AEDs in frequent use as eslicarbazepine acetate (ESL), LCM, LTG, LEV, perampanel (PER), topiramate (TPM), VPA, and ZNS in patients with focal epilepsies (20, 24–29). Unfortunately, only limited information is available on efficacy and tolerability of AEDs in EE patients. This cohort showed a 50% responder rate of 36% at the 3-month follow-up with additional four patients (9%) being seizure-free. Of these four patients three had been already seizure free during baseline period. The corresponding figures were 43% and 5% at the 6 months follow-up and were 20% and 2% at more than 12 months follow up. These results are in line with other studies using different AEDs in EE (for the most part LGS and DS) including LEV (47%) (30), TPM (40-48%) (31, 32), felbamate (FBM, 50%) (33, 34), ZNS (53 %) (35), and PER (46%) (36) at 3-month follow-up. Other AEDs, and particularly rufinamide (RUF) and cannabidiol (CBD), have been thought promising for EE, and both rendered comparable results with 50% responder rates of 31–48% for RUF (37–39) and 44–50% for CBD (40, 41). Currently, especially the use of CBD as an antiepileptic drug is the subject of some controversy and there is a need for randomized controlled trials (RCT) to verify these findings (42, 43). It has been demonstrated that neurostimulation via an implanted vagal nerve stimulator has similar efficacy with 50% responder rates of 43% (44). Overall, responder rates in EE of ≥50% can be achieved in 30% to 45% of EE patients. While results appear to be similar for different AEDs, there may be differential effects regarding seizure types. PER, for example, may be especially effective for myoclonic or bilateral tonic-clonic seizures (45–47).\n\nNo significant difference in efficacy was seen between patients who switched to BRV from LEV and those who either started BRV with LEV treatment at some point in the past or those who had not been treated with LEV before. These findings contrast with other publications that reported lower responder rates with previous exposure to LEV. The difference may result from the small size of our cohort (3, 4), with the limited number of EE patients precluding statistical analysis of possible clinical response predictors. Notwithstanding that, male patients who had a smaller number of previously failed AEDs and a generalized seizure semiology (generalized tonic clonic, myoclonic, absence seizures) trended toward a better response with 50% responder rates exceeding 50%. Rapid titration of BRV (mean 10 days, median 5.5 days) to a mean daily dose of 153.1 mg (median 135 mg) with three patients on a daily dose of more than 200 mg makes under-dosing very unlikely in this study.\n\nBRV was well tolerated in this often severely by BAEs affected subgroup, with only seven patients (16%) reporting TEAE and withdrawal of BRV from only four patients (9%). These findings compare with other post-marketing studies of BRV which showed TEAE in 37–38% (13, 20); the dominant BAEs were symptoms like irritability and aggression (16%). Taking into account of the possibility that this retrospective study may show reporting bias, a comparison with TEAE frequencies seen in trials of RUF (55–70%) (37, 38) and CBD (33–58%) (48, 49), it would seem that tolerance of BRV is good, but careful consideration should be given before using it in patients with a pre-existing intellectual disability (50). The most common reasons for discontinuing BRV were lack of efficacy (23%) and adverse drug events (11%) or both (5%).\n\nPsychobehavioral TEAE were closely followed-up and were present in six patients (14%) while on BRV, leading to discontinuation of BRV in four patients (9%). Psychobehavioral TEAE while on LEV were reported in 14 patients (32%) at switch or in the past while exposed to LEV, details Table 3. Therefore, patients who experience psychobehavioral TEAE associated with LEV might be offered a switch to BRV.\n\nAs the study depends on interviews, underreporting of TEAE cannot be ruled out, representing a possible weakness in this study, but all visits and interviews were conducted by epilepsy specialists and documented immediately, minimizing the risk of such bias. Other major limitations of the study are the retrospective chart review and the relatively low number of patients that might lead to unreliable findings and large variability regarding seizure control. The retention rate is a naturalistic functional endpoint encompassing efficacy, quality of life, tolerability, and safety, also no prospective baseline is required (51, 52). Measurement of retention might prove less prone to reporting bias as the prescription of medication is usually well documented.\n\nConclusions\nBRV is effective and well-tolerated in patients with EE and the pattern of TEAEs compares with other AEDs in frequent use. Efficacy of BRV does not seem to depend on whether patients have previously been exposed to LEV or not. A direct switch from LEV to BRV is feasible for patients with EE. Taken in conjunction with other post-marketing studies on focal or idiopathic generalized epilepsies, it seems that BRV is a reasonable treatment option for patients with epileptic encephalopathies.\n\nEthics statement\nThe study protocol is part of a retrosceptive analysis of efficacy anticonvulsants and was approved by the ethics commitee Frankfurt. Due to the retrosceptive nature of the study, written informed consent was not necessary.\n\nAuthor contributions\nLW, FR, SS-B, and AS generated the research idea, study design, and concept. LW, AB, FB, FH, II, KMK, SK, RK, GK, LL, GM, KM-S, FvP, PSR, BJS, IS, SS-B, and AS acquired the data. LW, SS-B, and AS analyzed the data and drafted the work. All authors made critical revisions for important intellectual content and interpreted the data. LW, SS-B, and AS wrote the manuscript. All authors approved the final manuscript.\n\nConflict of interest statement\nAB reports grants from UCB Pharma outside of the reported work and honoraria for speaking engagements from Desitin Arzneimittel, Eisai, and Viropharma. FB reports honoraria for speaking engagements from Desitin and UCB and Eisai. KMK reports personal fees from UCB Pharma, Novartis Pharma, Eisai, and GW Pharmaceuticals as well as grants from the Deutsche Forschungsgemeinschaft and The University of Melbourne. SK reports honoraria for speaking engagements from Desitin and UCB as well as educational grants from ADTech, Desitin Arzneimittel, Eisai, GW, Medtronic, Novartis, Siemens, and UCB. GK obtained honoraria for speaking engagements from Desitin Arzneimittel, Eisai, UCB, Viropharma, Shire, Dibropharma, and Novartis. LL reports industry-funded travel support from UCB Pharma. GM reports industry-funded travel support from Desitin Arzneimittel, Eisai Pharma, and UCB Pharma, as well as speaking honoraria from UCB Pharma. KM-S reports industry-funded travel support from Desitin Pharma, Novartis, Shire, Nutricia, UCB Pharma, and honoraria for speaking engagements Desitin Pharma, Shire, Novartis, Nutricia, Viropharma, Medice, and personal fees from Desitin Arzenimittel. FvP reports industry-funded travel with the support of Desitin Arzneimittel, Eisai Pharma, Bial, and UCB Pharma, honoraria obtained for speaking engagements from Desitin Arzneimittel, Eisai Pharma, Bial, and UCB Pharma, and as part of a speaker's bureau for Desitin Arzneimittel, Eisai Pharma, Bial, and UCB Pharma. BJS reports personal fees and grants from UCB, personal fees as speaking honoraria from Desitin Arzneimittel, Eisai, GW, Hiikma, and Novartis and fees for scientific or medical advice from B.Braun Melsungen. FR reports personal fees from Eisai, grants, and personal fees from UCB, grants and personal fees from Desitin Arzneimittel, Novartis, Medtronic, Cerbomed, ViroPharma, Sandoz, BayerVital, and Shire, research grants from the European Union and grants from Deutsche Forschungsgemeinschaft. SS-B reports personal fees from UCB, Eisai, Desitin Pharma, LivaNova, and Zogenix outside of the submitted work. AS reports personal fees and grants from Desitin Arzneimittel, Eisai, LivaNova, Sage Therapeutics, UCB Pharma, and Zogenix. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n==== Refs\nReferences\n1. Strzelczyk A Klein KM Willems LM Rosenow F Bauer S . Brivaracetam in the treatment of focal and idiopathic generalized epilepsies and of status epilepticus . Expert Rev Clin Pharmacol. (2016 ) 9 :637 –45 . 10.1586/17512433.2016.1156529 26891946 \n2. Strzelczyk A Steinig I Willems LM Reif PS Senft C Voss M . Treatment of refractory and super-refractory status epilepticus with brivaracetam: a cohort study from two German university hospitals . Epilepsy Behav. (2017 ) 70 :177 –81 . 10.1016/j.yebeh.2017.03.028 28427029 \n3. Ben-Menachem E Mameniskiene R Quarato PP Klein P Gamage J Schiemann J . Efficacy and safety of brivaracetam for partial-onset seizures in 3 pooled clinical studies . Neurology (2016 ) 87 :314 –23 . 10.1212/WNL.0000000000002864 27335114 \n4. Biton V Berkovic SF Abou-Khalil B Sperling MR Johnson ME Lu S . Brivaracetam as adjunctive treatment for uncontrolled partial epilepsy in adults: a phase III randomized, double-blind, placebo-controlled trial . Epilepsia (2014 ) 55 :57 –66 . 10.1111/epi.12433 24446953 \n5. Klein P Schiemann J Sperling MR Whitesides J Liang W Stalvey T . A randomized, double-blind, placebo-controlled, multicenter, parallel-group study to evaluate the efficacy and safety of adjunctive brivaracetam in adult patients with uncontrolled partial-onset seizures . Epilepsia (2015 ) 56 :1890 –8 . 10.1111/epi.13212 26471380 \n6. Kwan P Trinka E Van Paesschen W Rektor I Johnson ME Lu S . Adjunctive brivaracetam for uncontrolled focal and generalized epilepsies: results of a phase III, double-blind, randomized, placebo-controlled, flexible-dose trial . Epilepsia (2014 ) 55 :38 –46 . 10.1111/epi.12391 24116853 \n7. Yates SL Fakhoury T Liang W Eckhardt K Borghs S D'Souza J . An open-label, prospective, exploratory study of patients with epilepsy switching from levetiracetam to brivaracetam . Epilepsy Behav. (2015 ) 52 :165 –8 . 10.1016/j.yebeh.2015.09.005 26432008 \n8. Dupuis N Matagne A Staelens L Dournaud P Desnous B Gressens P . Anti-ictogenic and antiepileptogenic properties of brivaracetam in mature and immature rats . Epilepsia (2015 ) 56 :800 –5 . 10.1111/epi.12973 25818358 \n9. Wood MD Gillard M . Evidence for a differential interaction of brivaracetam and levetiracetam with the synaptic vesicle 2A protein . Epilepsia (2017 ) 58 :255 –62 . 10.1111/epi.13638 28012162 \n10. Matagne A Margineanu DG Kenda B Michel P Klitgaard H . Anti-convulsive and anti-epileptic properties of brivaracetam (ucb 34714), a high-affinity ligand for the synaptic vesicle protein, SV2A . Br J Pharmacol. (2008 ) 154 :1662 –71 . 10.1038/bjp.2008.198 18500360 \n11. Niespodziany I Andre VM Leclere N Hanon E Ghisdal P Wolff C . Brivaracetam differentially affects voltage-gated sodium currents without impairing sustained repetitive firing in neurons . Cns Neurosci Therapeut. (2015 ) 21 :241 –51 . 10.1111/cns.12347 25444522 \n12. Yang XF Bognar J He TY Mohammed M Niespodziany I Wolff C . Brivaracetam augments short-term depression and slows vesicle recycling . Epilepsia (2015 ) 56 :1899 –909 . 10.1111/epi.13223 26515103 \n13. Steinhoff BJ Bacher M Bucurenciu I Hillenbrand B Intravooth T Kornmeier R . Real-life experience with brivaracetam in 101 patients with difficult-to-treat epilepsy-A monocenter survey . Seizure (2017 ) 48 :11 –4 . 10.1016/j.seizure.2017.03.010 28364655 \n14. Kural Z Ozer AF . Epileptic encephalopathies in adults and childhood . Epilepsy Res Treat . (2012 ) 2012 :205131 . 10.1155/2012/205131 23056934 \n15. Khan S Al Baradie R . Epileptic encephalopathies: an overview . Epilepsy Res Treat . (2012 ) 2012 :403592 . 10.1155/2012/403592 23213494 \n16. Willems L Richter S Watermann N Bauer S Klein KM Reese JP . Trends in resource utilization and prescription of anticonvulsants for patients with active epilepsy in Germany from 2003 to 2013 — A ten-year overview . Epilepsy Behav. (2018 ) 83 :28 –35 . 10.1016/j.yebeh.2018.03.025 29649671 \n17. Strzelczyk A Griebel C Lux W Rosenow F Reese JP . The burden of severely drug-refractory epilepsy: a comparative longitudinal evaluation of mortality, morbidity, resource use, and cost using german health insurance data . Front Neurol. (2017 ) 8 :712 . 10.3389/fneur.2017.00712 29312132 \n18. Scheffer IE Berkovic S Capovilla G Connolly MB French J Guilhoto L . ILAE classification of the epilepsies: Position paper of the ILAE Commission for Classification and Terminology . Epilepsia (2017 ) 58 :512 –21 . 10.1111/epi.13709 28276062 \n19. von Elm E Altman DG Egger M Pocock SJ Gotzsche PC Vandenbroucke JP . Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statement: guidelines for reporting observational studies . BMJ (2007 ) 335 :806 –8 . 10.1136/bmj.39335.541782.AD 17947786 \n20. Steinig I von Podewils F Moddel G Bauer S Klein KM Paule E . Postmarketing experience with brivaracetam in the treatment of epilepsies: a multicenter cohort study from Germany . Epilepsia (2017 ) 58 :1208 –16 . 10.1111/epi.13768 28480518 \n21. McTague A Cross JH . Treatment of epileptic encephalopathies . CNS Drugs (2013 ) 27 :175 –84 . 10.1007/s40263-013-0041-6 23397290 \n22. Zahnert F Krause K Immisch I Habermehl L Gorny I Chmielewska I . Brivaracetam in the treatment of patients with epilepsy-first clinical experiences . Front Neurol . (2018 ) 9 :38 . 10.3389/fneur.2018.00038 29467714 \n23. Strzelczyk A Kay L Bauer S Immisch I Klein KM Knake S . Use of brivaracetam in genetic generalized epilepsies and for acute, intravenous treatment of absence status epilepticus . Epilepsia . [Epub ahead of print] (2018 ) 10.1111/epi.14476 . 29943451 \n24. Novy J Bartolini E Bell GS Duncan JS Sander JW \nLong term retention of lacosamide in a large cohort of people with medically refractory epilepsy: a single centre evaluation . Epilepsia (2013 ) 54 :74 \n10.1016/j.eplepsyres.2013.05.002 24001080 \n25. Flores L Kemp S Colbeck K Moran N Quirk J Ramkolea P . Clinical experience with oral lacosamide as adjunctive therapy in adult patients with uncontrolled epilepsy: a multicentre study in epilepsy clinics in the United Kingdom (UK) . Seizure (2012 ) 21 :512 –7 . 10.1016/j.seizure.2012.05.005 22698379 \n26. Marson AG Al-Kharusi AM Alwaidh M Appleton R Baker GA Chadwick DW . The SANAD study of effectiveness of carbamazepine, gabapentin, lamotrigine, oxcarbazepine, or topiramate for treatment of partial epilepsy: an unblinded randomised controlled trial . Lancet (2007 ) 369 :1000 –15 . 10.1016/S0140-6736(07)60460-7 17382827 \n27. Catarino CB Bartolini E Bell GS Yuen AWC Duncan JS Sander JW . The long-term retention of zonisamide in a large cohort of people with epilepsy at a tertiary referral centre . Epilepsy Res. (2011 ) 96 :39 –44 . 10.1016/j.eplepsyres.2011.04.012 21601427 \n28. Willems LM Zollner JP Paule E Schubert-Bast S Rosenow F Strzelczyk A \nEslicarbazepine acetate in epilepsies with focal and secondary generalised seizures: systematic review of current evidence . Expert Rev Clin Pharmacol . (2017 ) 2017 :1 –16 . 10.1080/17512433.2018.1421066 \n29. Betts T Yarrow H Greenhill L Barrett M . Clinical experience of marketed Levetiracetam in an epilepsy clinic-a one year follow up study . Seizure (2003 ) 12 :136 –40 . 10.1016/S1059-1311(02)00258-3 12651077 \n30. Lagae L Buyse G Deconinck A Ceulemans B . Effect of levetiracetam in refractory childhood epilepsy syndromes . Eur J Paediatr Neurol . (2003 ) 7 :123 –8 . 10.1016/S1090-3798(03)00041-2 12788038 \n31. Glauser TA Levisohn PM Ritter F Sachdeo RC . Topiramate in Lennox-Gastaut syndrome: open-label treatment of patients completing a randomized controlled trial. Topiramate YL Study Group . Epilepsia (2000 ) 41 (Suppl 1 ):S86 –90 . 10.1111/j.1528-1157.2000.tb02179.x 10768308 \n32. Coppola G Caliendo G Veggiotti P Romeo A Tortorella G De Marco P Pascotto A . Topiramate as add-on drug in children, adolescents and young adults with Lennox-Gastaut syndrome: an Italian multicentric study . Epilepsy Res. (2002 ) 51 :147 –53 . 10.1016/S0920-1211(02)00103-1 12350390 \n33. Dodson WE . Felbamate in the treatment of Lennox-Gastaut syndrome: results of a 12-month open-label study following a randomized clinical trial . Epilepsia (1993 ) 34 (Suppl 7 ):S18 –24 . 8243374 \n34. Jensen PK . Felbamate in the treatment of Lennox-Gastaut syndrome . Epilepsia (1994 ) 35 (Suppl 5 ):S54 –7 . 8039473 \n35. You SJ Kang HC Kim HD Lee HS Ko TS . Clinical efficacy of zonisamide in Lennox-Gastaut syndrome: Korean multicentric experience . Brain Dev . (2008 ) 30 :287 –90 . 10.1016/j.braindev.2007.09.004 17959327 \n36. Steinhoff B Bacher M Bast T Kornmeier R Kurth C Scholly J . First clinical experiences with perampanel-The Kork experience in 74 patients . Epilepsia (2014 ) 55 :16 –18 . 10.1111/epi.12492 24400693 \n37. Glauser T Kluger G Sachdeo R Krauss G Perdomo C Arroyo S . Rufinamide for generalized seizures associated with Lennox-Gastaut syndrome . Neurology (2008 ) 70 :1950 –8 . 10.1212/01.wnl.0000303813.95800.0d 18401024 \n38. Kluger G Glauser T Krauss G Seeruthun R Perdomo C Arroyo S . Adjunctive rufinamide in Lennox-Gastaut syndrome: a long-term, open-label extension study . Acta Neurol Scand. (2010 ) 122 :202 –8 . 10.1111/j.1600-0404.2010.01334.x 20199521 \n39. Coppola G Grosso S Franzoni E Veggiotti P Zamponi N Parisi P . Rufinamide in refractory childhood epileptic encephalopathies other than Lennox-Gastaut syndrome . Eur J Neurol. (2011 ) 18 :246 –51 . 10.1111/j.1468-1331.2010.03113.x 20666837 \n40. Thiele EA Marsh ED French JA Mazurkiewicz-Beldzinska M Benbadis SR Joshi C . Cannabidiol in patients with seizures associated with Lennox-Gastaut syndrome (GWPCARE4): a randomised, double-blind, placebo-controlled phase 3 trial . Lancet (2018 ) 391 :1085 –96 . 10.1016/S0140-6736(18)30136-3 29395273 \n41. Devinsky O Marsh E Friedman D Thiele E Laux L Sullivan J . Cannabidiol in patients with treatment-resistant epilepsy: an open-label interventional trial . Lancet Neurol . (2016 ) 15 :270 –8 . 10.1016/S1474-4422(15)00379-8 26724101 \n42. Mandelbaum DE . Cannabidiol in patients with treatment-resistant epilepsy . Lancet Neurol . (2016 ) 15 :544 –5 . 10.1016/S1474-4422(16)00118-6 27302117 \n43. Devinsky O Marsh E Friedman D . Cannabidiol in patients with treatment-resistant epilepsy - Authors' reply . Lancet Neurol. (2016 ) 15 :545 –6 . 10.1016/S1474-4422(16)00120-4 27302119 \n44. Frost M Gates J Helmers SL Wheless JW Levisohn P Tardo C . Vagus nerve stimulation in children with refractory seizures associated with Lennox-Gastaut syndrome . Epilepsia (2001 ) 42 :1148 –52 . 10.1046/j.1528-1157.2001.23900.x 11580762 \n45. French JA Krauss GL Wechsler RT Wang XF DiVentura B Brandt C . Perampanel for tonic-clonic seizures in idiopathic generalized epilepsy A randomized trial . Neurology (2015 ) 85 :950 –7 . 10.1212/WNL.0000000000001930 26296511 \n46. Strzelczyk A Willems LM Willig S Rosenow F Bauer S . Perampanel in the treatment of focal and idiopathic generalized epilepsies and of status epilepticus . Expert Rev Clin Pharmacol . (2015 ) 8 :733 –40 . 10.1586/17512433.2015.1091303 26436331 \n47. Schorlemmer K Bauer S Belke M Hermsen A Klein KM Reif PS . Sustained seizure remission on perampanel in progressive myoclonic epilepsy (Lafora disease) . Epilepsy Behav Case Rep . (2013 ) 1 :118 –21 . 10.1016/j.ebcr.2013.07.003 25667843 \n48. Wirrel EC Privitera M Bhathal H Wong MH Cross JH Sommerville K \nCannabidiol (CBD) Treatment Effect and Adverse Events (AEs) by Time in Patients with Lennox-Gastaut Syndrome (LGS): Pooled Results from 2 Trials (S19.006) . Neurology (2018 ) 90 (15 Supplement ):S19.006 .\n49. Halford J Marsh E Mazuriewicz-Beldzindska M Gunning B Checketts D Roberts C \nLong-term Safety and Efficacy of Cannabidiol (CBD) in Patients with Lennox-Gastaut Syndrome (LGS): results from open-label extension trial (GWPCARE5) (P1.264) . Neurology (2018 ) 90 (15 Supplement ):P1.264 .\n50. Andres E Kerling F Hamer H Winterholler M . Behavioural changes in patients with intellectual disability treated with brivaracetam . Acta Neurol Scand. [Epub ahead of print] (2018 ) 10.1111/ane.12943 . 29658982 \n51. Chung S Wang N Hank N . Comparative retention rates and long-term tolerability of new antiepileptic drugs . Seizure (2007 ) 16 :296 –304 . 10.1016/j.seizure.2007.01.004 17267243 \n52. Ben-Menachem E Sander JW Privitera M Gilliam F . Measuring outcomes of treatment with antiepileptic drugs in clinical trials . Epilepsy Behav. (2010 ) 18 :24 –30 . 10.1016/j.yebeh.2010.04.001 20462803\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1664-2295",
"issue": "9()",
"journal": "Frontiers in neurology",
"keywords": "anticonvulsants; epilepsy; epileptic encephalopathies; levetiracetam; seizure",
"medline_ta": "Front Neurol",
"mesh_terms": null,
"nlm_unique_id": "101546899",
"other_id": null,
"pages": "569",
"pmc": null,
"pmid": "30083127",
"pubdate": "2018",
"publication_types": "D016428:Journal Article",
"references": "27335114;8039473;28427029;23796862;29649671;25444522;29395273;26436331;26891946;10768308;28012162;11580762;22698379;17382827;12350390;25818358;23397290;24116853;27302119;29285947;23213494;26432008;28276062;25667843;12788038;21601427;29943451;20199521;27302117;28364655;18401024;17947786;18500360;29312132;20666837;23056934;12651077;26471380;26296511;28480518;26724101;26515103;20462803;17267243;24446953;29658982;8243374;24400693;29467714;17959327",
"title": "Efficacy, Retention, and Tolerability of Brivaracetam in Patients With Epileptic Encephalopathies: A Multicenter Cohort Study From Germany.",
"title_normalized": "efficacy retention and tolerability of brivaracetam in patients with epileptic encephalopathies a multicenter cohort study from germany"
} | [
{
"companynumb": "DE-UCBSA-2018038138",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BRIVARACETAM"
},
"drugadditional": "3",
"... |
{
"abstract": "Patients with borderline personality disorder (BPD) show significant impairment in functioning, particularly in the interpersonal and social domains. Prior reports suggest that clozapine may be effective in the management of BPD. We present the case of a patient with BPD who experienced persistent suicidal ideation and was treated with clozapine at a state psychiatric hospital. After treatment failure with other psychotropic medications, clozapine medication was initiated; not only did suicidal ideation cease, but social and professional functioning also greatly improved to the point of no longer requiring intensive levels of observation or restrictive procedures. Clozapine appears to be efficacious in the management of suicide attempts and self-injurious behavior. Moreover, it appears to be promising as a therapeutic measure for ameliorating the global functioning of patients with severe BPD. Larger, randomized, blinded, and controlled prospective studies are needed to confirm these findings and to determine optimal dosage.",
"affiliations": "Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.;Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, Tunisia.",
"authors": "Amamou|Badii|B|;Salah|Walid Bel Hadj|WB|;Mhalla|Ahmed|A|;Benzarti|Nejla|N|;Elloumi|Hend|H|;Zaafrane|Ferid|F|;Gaha|Lotfi|L|",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.9758/cpn.2016.14.2.226",
"fulltext": "\n==== Front\nClin Psychopharmacol NeurosciClin Psychopharmacol NeurosciClinical Psychopharmacology and Neuroscience1738-10882093-4327Korean College of Neuropsychopharmacology 2712143710.9758/cpn.2016.14.2.226cpn-14-226Case ReportUse of Clozapine for Borderline Personality Disorder: A Case Report Amamou Badii Salah Walid Bel Hadj Mhalla Ahmed Benzarti Nejla Elloumi Hend Zaafrane Ferid Gaha Lotfi Department of Psychiatry, Fattouma Bourguiba Hospital, Monastir, \nTunisiaAddress for correspondence: Badii Amamou, MD, Department of Psychiatry, Fattouma Bourguiba Hospital, Avenue Farhat HACHED 5000, Monastir, Tunisia, Tel: +216-73461141, Fax: +216-98475488, E-mail: amamoubadii@hotmail.fr5 2016 31 5 2016 14 2 226 228 01 6 2015 17 9 2015 01 12 2015 Copyright © 2016, Korean College of Neuropsychopharmacology2016This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Patients with borderline personality disorder (BPD) show significant impairment in functioning, particularly in the interpersonal and social domains. Prior reports suggest that clozapine may be effective in the management of BPD. We present the case of a patient with BPD who experienced persistent suicidal ideation and was treated with clozapine at a state psychiatric hospital. After treatment failure with other psychotropic medications, clozapine medication was initiated; not only did suicidal ideation cease, but social and professional functioning also greatly improved to the point of no longer requiring intensive levels of observation or restrictive procedures. Clozapine appears to be efficacious in the management of suicide attempts and self-injurious behavior. Moreover, it appears to be promising as a therapeutic measure for ameliorating the global functioning of patients with severe BPD. Larger, randomized, blinded, and controlled prospective studies are needed to confirm these findings and to determine optimal dosage.\n\nBorderline personality disorderSuicideSocial adjustmentClozapine\n==== Body\nINTRODUCTION\nPatients with borderline personality disorder (BPD) show significant impairment in the domain of interpersonal and social functioning and may be heavy users of health and social services resources, albeit with little beneficial outcome. BPD affects approximately 1% to 2% of the general population and up to 20% of psychiatric patients.1)\n\nBPD is a serious mental disorder that is difficult to treat; although BPD has been the focus of more medication trials than any other Axis II disorder, there are presently no clear guidelines in the literature regarding the use of pharmacotherapy in its management.\n\nClozapine is among the medications that have been evaluated for the treatment of severe BPD. Based on the scanty literature available in the form of case reports and small studies, there is some evidence that it is effective in the management of BPD.2–4)\n\nThe present study aims to describe the effectiveness of clozapine in a patient with severe BPD without psychotic features who had severe recurrent suicidal thoughts, repeated and prolonged periods of hospitalization, and was unsuccessfully treated with other psychotropic medications.\n\nWe used the Social Functioning Scale (Markers version) to assess the patient’s social functioning5); this scale is a generic questionnaire that measures social and professional functioning along six major dimensions (social withdrawal, relationships, recreational activities, independence [competence], independence [performance], and employment).\n\nCASE\nA male patient, 33 years of age and the youngest among five siblings, was born after a normal and accepted, though unplanned, pregnancy. His psychomotor development was normal, but during adolescence and early adulthood he exhibited instability in intimate relationships and in the professional sphere.\n\nHe had a brother 17 years his senior who, despite no known psychiatric history, died by hanging himself when the patient was five years old. The patient assisted at the scene, and later recounted that the memory of the event stayed with him as a recurring image.\n\nHe also has two sisters, both of whom are being regularly followed in our ward for recurrent depressive disorder, but who have never been hospitalized. One of the sisters relapsed mildly in March 2015 after cessation of anti-depressive medication.\n\nThe patient’s mother is regarded by our team of doctors as chronically depressed.\n\nThe patient has been followed for two years for major depressive disorder and BPD. He has attempted suicide three times. The first attempt involved electrocution in February 2013, and represented an impulsive and non-premeditated act without specific triggering factors, whereas the second and third attempts involved ingesting chloralose, a chemical used to exterminate rats.\n\nHe has been hospitalized twice as a consequence of these suicide attempts (one suicide attempt occurred while he was already admitted to the hospital; he was stopped by a team of nurses who noticed the chemical in his possession upon his return from an authorized visit to his father, who had recently suffered a stroke that rendered him quadriplegic). His last hospital admission was in August 2014, at which time he was clearly distressed and challenging in his behavior, exhibiting a lack of cooperation and an inability to express anything but a desire to be free either of his suicidal thoughts or of his life. He displayed no remorse following his intake of chloralose and expressed pessimism concerning the possibility of being helped, asserting that he still considered suicide to be the perfect solution in the absence of a medication that could eliminate his persistent thoughts of self-harm.\n\nHe displayed the same set of symptoms during each hospitalization period; impulsivity, irritability, sadness, and intrusive ideas of self-harm. In addition, he exhibited very poor social and professional functioning, with his scores on the Social Functioning Scale (Markers version) consistently falling below 30%.\n\nHe has received a variety of anti-depressive treatments including clomipramine, escitalopram, sertraline, paroxetine, venlafaxine and mood stabilizers (lithium, lamotrigine, olanzapine, risperidone and amisulpride). The dosage used was adequate and the period of treatment for each of these drugs was never shorter than eight weeks. Ultimately, only paroxetine offered some tangible, although partial, benefit: his score on the Hamilton Depression Scale dropped by six points from 25 to 19 points, but it remains unclear if the observed effect was partly due to the psychotherapy he had been undergoing for a period of three months prior to receiving paroxetine.\n\nGiven these unsatisfactory treatment results, the patient’s poor global functioning and the pressing risk of suicide, treatment with clozapine was initiated once the consent of the patient and the ethical committee of the hospital were obtained.\n\nThe patient responded to a dose of 300 mg per day (he continued to experience intrusive suicidal ideation at doses of 250 and 275 mg), with a bloodstream level of 392.8 ng/ml, along with paroxetine (40 mg/day; a relapse occurred each time the patient ceased taking paroxetine, even when treated with clozapine). This course of treatment resulted in rapid and significant changes for the patient both clinically and socially; he returned home and resumed searching for a job, expressing a desire to start a family.\n\nTable 1 presents the patient’s psychometric outcomes according to daily clozapine dose.\n\nThe patient has shown no signs of relapse in the more than six months since his discharge from the hospital.\n\nDISCUSSION\nThis case presents important findings consistent with the available literature regarding the effects of clozapine in nonpsychotic, self-injurious patients with BPD, showing improvement along multiple dimensions including symptom severity, impulsivity, self-mutilation, number of days of intensive observation and overall functioning.\n\nRecent Cochrane Reviews and guidelines from the National Centre for Clinical Excellence (NICE) suggest that the various non-clozapine medications commonly prescribed for individuals with BPD have little if any therapeutic effect6); thus far, there are no clear guidelines for the use of psychotropic drugs in treating BPD.\n\nThe American Psychiatric Association practice guidelines for BPD identify clozapine as a treatment that may be used when other treatments fail,7) although only a few open studies have assessed the efficacy of clozapine in BPD patients.\n\nIn 1993, a study involving 15 BPD patients indicated that clozapine improved psychotic symptoms and overall global functioning (according to the Brief Psychiatric Rating Scale [BPRS] and scores of Global Assessment Functioning [GAF]). A subsequent study conducted in 1998 confirmed these results with 12 BPD patients treated with low-dose clozapine (25–100 mg per day). After three weeks, BPRS and GAF scores improved, as did impulsivity and mood (as measured by the Hamilton Rating Scale).3) Other studies have demonstrated that clozapine can decrease aggressive behaviors (including self-mutilating behaviors), ameliorate relationships and decrease the frequency of hospitalization.8–11) Dosage varies widely among studies, ranging between 25 mg and 550 mg per day.\n\nThese data together with our present case study support the conclusion that clozapine may be effective in BPD, particularly in cases of persistent and invasive thoughts of self-harm and suicide and for patients who exhibit severe impairment in global functioning. The appropriate dosage must be gauged relative to symptoms, but a 2013 study by Frogley et al.10) suggests that a bloodstream level of between 360 and 430 ng/ml is needed, which was indeed the case for our patient.\n\nDespite the lack of clear evidence, pharmacological treatment is widely used for patients with BPD. This case report corroborates previous studies supporting the use of clozapine in BPD patients who do not respond to classical pharmacological treatments, particularly those with severe suicidal thoughts or significant impairment in global functioning. Clozapine may have beneficial effects along numerous dimensions including self-harm, suicidality, interpersonal relationships, number of days spent hospitalized, and the intensity of interventions required while in hospital.\n\nFurther controlled studies are needed to establish the effective therapeutic dosage and its correlation with bloodstream level.\n\nTable 1 Psychometric scales with the increase of clozpine dose\n\nDate\tHDS\tBPRS\tBarratt scale of impulsivity\tSofa (%)\tClozapine dose (mg)\t\nOctober 20, 2014\t21\t47\t87\t30\t25\t\nOctober 27, 2014\t21\t49\t87\t60\t50\t\nNovember 3, 2014\t17\t45\t83\t60\t75\t\nNovember 10, 2014\t14\t27\t79\t64\t100\t\nNovember 17, 2014\t08\t22\t74\t72\t125\t\nNovember 24, 2014\t03\t20\t70\t80\t150\t\nDecember 1, 2014\t01\t20\t64\t90\t175\t\nDecember 8, 2014\t03\t20\t62\t95\t200\t\nDecember 15, 2014\t03\t20\t57\t95\t225\t\nDecember 23, 2014\t01\t23\t51\t95\t250\t\nDecember 30, 2014\t02\t20\t45\t97\t275\t\nJanuary 6, 2015\t01\t20\t45\t97\t300\t\nApril 1, 2015\t0\t20\t41\t100\t300\t\nHDS, Hamilton Depression Scale; BPRS, Brief Psychiatric Rating Scale; Sofa, Social Functioning Scale (Markers version).\n==== Refs\nREFERENCES\n1 Gunderson JG Links PS Borderline personality disorder: a clinical guide 2nd ed Washington, DC American Psychiatric Pub 2008 \n2 Chengappa KN Ebeling T Kang JS Levine J Parepally H Clozapine reduces severe self-mutilation and aggression in psychotic patients with borderline personality disorder J Clin Psychiatry 1999 60 477 484 10.4088/JCP.v60n0710 10453803 \n3 Benedetti F Sforzini L Colombo C Maffei C Smeraldi E Low-dose clozapine in acute and continuation treatment of severe borderline personality disorder J Clin Psychiatry 1998 59 103 107 10.4088/JCP.v59n0302 9541151 \n4 Steinert T Schmidt-Michel PO Kaschka WP Considerable improvement in a case of obsessive-compulsive disorder in an emotionally unstable personality disorder, borderline type under treatment with clozapine Pharmacopsychiatry 1996 29 111 114 10.1055/s-2007-979555 8738316 \n5 Birchwood M Social Functioning Scale (Markers Version) [Internet] 2001 [cited at 2015 May 20]. Available from: http://www.researchgate.net/publictopics.PublicPostFileLoader.html?id=550b1918d4c118466e8b45f3&key=ae2b3e03-0675-4cb2-8e6d-aa745c85c510 \n6 Stoffers J Völlm BA Rücker G Timmer A Huband N Lieb K Pharmacological interventions for borderline personality disorder Cochrane Database Syst Rev 2010 6 CD005653 20556762 \n7 Oldham J Gabbard G Goin M Gunderson J Soloff P Spiege D Practice guideline for the treatment of patients with borderline personality disorder [Internet] Arlington (VA) American Psychiatric Association 2001 [cited at 2015 May 20]. Available from: http://psychiatryonline.org/pb/assets/raw/sitewide/practice_guidelines/guidelines/bpd.pdf \n8 Ferreri MM Loze JY Rouillon F Limosin F Clozapine treatment of a borderline personality disorder with severe self-mutilating behaviours Eur Psychiatry 2004 19 177 178 10.1016/j.eurpsy.2003.11.004 15158928 \n9 Zarzar T McEvoy J Clozapine for self-injurious behavior in individuals with borderline personality disorder Ther Adv Psychopharmacol 2013 3 272 274 10.1177/2045125313484323 24167702 \n10 Frogley C Anagnostakis K Mitchell S Mason F Taylor D Dickens G A case series of clozapine for borderline personality disorder Ann Clin Psychiatry 2013 25 125 134 23638443 \n11 Vohra AK Treatment of severe borderline personality disorder with clozapine Indian J Psychiatry 2010 52 267 269 10.4103/0019-5545.70989 21180415\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1738-1088",
"issue": "14(2)",
"journal": "Clinical psychopharmacology and neuroscience : the official scientific journal of the Korean College of Neuropsychopharmacology",
"keywords": "Borderline personality disorder; Clozapine; Social adjustment; Suicide",
"medline_ta": "Clin Psychopharmacol Neurosci",
"mesh_terms": null,
"nlm_unique_id": "101207332",
"other_id": null,
"pages": "226-8",
"pmc": null,
"pmid": "27121437",
"pubdate": "2016-05-31",
"publication_types": "D002363:Case Reports",
"references": "15158928;8738316;21180415;20556762;10453803;23638443;9541151;24167702",
"title": "Use of Clozapine for Borderline Personality Disorder: A Case Report.",
"title_normalized": "use of clozapine for borderline personality disorder a case report"
} | [
{
"companynumb": "TN-ACCORD-040741",
"fulfillexpeditecriteria": "1",
"occurcountry": "TN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VENLAFAXINE HYDROCHLORIDE"
},
"drugadditional": null,
... |
{
"abstract": "A 12-year-old girl with nonmetastatic osteogenic sarcoma received treatment with doxorubicin, methotrexate, cisplatin, cyclophosphamide, bleomycin, and dactinomycin. She developed unexplained persistent pancytopenia after completion of chemotherapy. Twenty-three months after the initial diagnosis of osteosarcoma an evaluation revealed a bone marrow pattern consistent with the diagnosis of refractory anemia with excess blasts, and karyotype analysis showed characteristic findings of therapy-related myelodysplasia (loss of chromosomes 5 and 7, as well as 12p and 17p deletions). Bone marrow transplantation from an human leukocyte antigen (HLA)-compatible sibling donor was performed 26 months after the diagnosis of the primary malignancy. Although it is unproven that the alkylating agents administered to this patient were responsible for the myelodysplastic syndrome, careful follow-up of osteosarcoma patients who receive alkylating agents is warranted.",
"affiliations": "Department of Pediatrics, University of Texas Southwestern Medical Center, Dallas 75235-9063.",
"authors": "Pappo|A|A|;Schneider|N R|NR|;Sanders|J M|JM|;Buchanan|G R|GR|",
"chemical_list": "D001761:Bleomycin; D003609:Dactinomycin; D004317:Doxorubicin; D003520:Cyclophosphamide; D002945:Cisplatin; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1002/1097-0142(19910915)68:6<1373::aid-cncr2820680631>3.0.co;2-s",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0008-543X",
"issue": "68(6)",
"journal": "Cancer",
"keywords": null,
"medline_ta": "Cancer",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001761:Bleomycin; D002648:Child; D002945:Cisplatin; D003520:Cyclophosphamide; D003609:Dactinomycin; D004317:Doxorubicin; D005260:Female; D006801:Humans; D008727:Methotrexate; D009190:Myelodysplastic Syndromes; D012516:Osteosarcoma",
"nlm_unique_id": "0374236",
"other_id": null,
"pages": "1373-5",
"pmc": null,
"pmid": "1714791",
"pubdate": "1991-09-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D013487:Research Support, U.S. Gov't, P.H.S.; D016454:Review",
"references": null,
"title": "Secondary myelodysplastic syndrome complicating therapy for osteogenic sarcoma.",
"title_normalized": "secondary myelodysplastic syndrome complicating therapy for osteogenic sarcoma"
} | [
{
"companynumb": "US-PFIZER INC-2019115705",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugadditional"... |
{
"abstract": "This study compared the risk of hospitalization among adults with schizophrenia being treated with equivalent dose ranges of lurasidone versus aripiprazole, olanzapine, quetiapine, or risperidone. Administrative claims data for this analysis came from the IBM MarketScan Commercial, Medicare Supplemental, and Multi-State Medicaid databases between January 2011 and June 2017. The study included adults with schizophrenia who initiated treatment with an antipsychotic and were continuously enrolled for 360 days prior to and following the date of the initial antipsychotic prescription. Risk of all-cause and schizophrenia-related hospitalization among patients who received lurasidone monotherapy versus aripiprazole, olanzapine, quetiapine, or risperidone in equivalent dose ranges were assessed. Marginal structural models that accounted for preindex characteristics, changes in antipsychotic treatment, and time-varying covariates assessed differences between lurasidone and other second-generation antipsychotics on all-cause and schizophrenia-related hospitalizations. A sensitivity analysis was conducted without the dose-equivalence requirement. A total of 20,212 patients met the study inclusion criteria. Compared with those treated with lurasidone monotherapy, the adjusted risk of all-cause hospitalization was significantly higher among patients treated with olanzapine (adjusted rate ratio [aRR], 1.49; P = .04), quetiapine (aRR, 1.64; P = .01), or risperidone (aRR, 1.47; P = .04), but not aripiprazole (aRR, 1.24; P = .28). A similar, non-statistically significant pattern of adjusted risks of schizophrenia-related hospitalizations was observed. A sensitivity analysis without the dose-equivalence requirement produced consistent results. As hospitalization is a major cost driver of direct healthcare cost, lurasidone may be a cost-saving treatment option for patients with schizophrenia.",
"affiliations": "Sunovion Pharmaceuticals, 84 Waterford Dr, Marlborough, MA 01752. Email: daisy.ng-mak@sunovion.com.",
"authors": "Ng-Mak|Daisy|D|;Messali|Andrew|A|;Huang|Ahong|A|;Wang|Li|L|;Loebel|Antony|A|",
"chemical_list": "D014150:Antipsychotic Agents; D000069348:Quetiapine Fumarate; D000068180:Aripiprazole; D018967:Risperidone; D000077152:Olanzapine; D000069056:Lurasidone Hydrochloride",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1088-0224",
"issue": "25(14 Suppl)",
"journal": "The American journal of managed care",
"keywords": null,
"medline_ta": "Am J Manag Care",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D014150:Antipsychotic Agents; D000068180:Aripiprazole; D005260:Female; D006760:Hospitalization; D006801:Humans; D000069056:Lurasidone Hydrochloride; D008297:Male; D008875:Middle Aged; D000077152:Olanzapine; D000069348:Quetiapine Fumarate; D012307:Risk Factors; D018967:Risperidone; D012559:Schizophrenia",
"nlm_unique_id": "9613960",
"other_id": null,
"pages": "S279-S286",
"pmc": null,
"pmid": "31365818",
"pubdate": "2019-07",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Hospitalization risk in patients with schizophrenia treated with dose-equivalent antipsychotics.",
"title_normalized": "hospitalization risk in patients with schizophrenia treated with dose equivalent antipsychotics"
} | [
{
"companynumb": "US-OTSUKA-2019_031005",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ARIPIPRAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nLow adherence to bisphosphonate therapy is associated with increased fracture risk. Factors associated with discontinuation of osteoporosis medications have not been studied in-depth. This study assessed medication discontinuation and switching patterns among Medicare beneficiaries who were new users of bisphosphonates and evaluated factors possibly associated with discontinuation.\n\n\nMETHODS\nWe identified patients initiating bisphosphonate treatment using a 5% random sample of Medicare beneficiaries with at least 24 months of traditional fee-for-service and part D drug coverage from 2006 through 2009. We classified medication status at the end of follow-up as: continued original bisphosphonate, discontinued without switching or restarting, restarted the same drug after a treatment gap (≥ 90 days), or switched to another anti-osteoporosis medication. We conducted logistic regression analyses to identify baseline characteristics associated with discontinuation and a case-crossover analysis to identify factors that precipitate discontinuation.\n\n\nRESULTS\nOf 21,452 new users followed respectively for 12 months, 44% continued their original therapy, 36% discontinued without switching or restarting, 8% restarted the same drug after a gap greater than 90 days, and 11% switched to another anti-osteoporosis medication. Factors assessed during the 12-month period before initiation were weakly associated with discontinuation. Several Factors measured during follow-up were associated with discontinuation, including more physician visits, hospitalization, having a dual-energy X-ray absorptiometry test, higher Charlson comorbidity index scores, higher out-of-pocket drug payments, and upper gastrointestinal problems. Patterns were similar for 4,738 new users followed for 30 months.\n\n\nCONCLUSIONS\nAmong new bisphosphonates users, switching within and across drug classes and extended treatment gaps are common. Robust definitions and time-varying considerations should be considered to characterize medication discontinuation more accurately.",
"affiliations": "Department of Epidemiology, University of Alabama at Birmingham, Birmingham 35294, AL, USA. yunn@uab.edu.",
"authors": "Yun|Huifeng|H|;Curtis|Jeffrey R|JR|;Guo|Lingli|L|;Kilgore|Meredith|M|;Muntner|Paul|P|;Saag|Kenneth|K|;Matthews|Robert|R|;Morrisey|Michael|M|;Wright|Nicole C|NC|;Becker|David J|DJ|;Delzell|Elizabeth|E|",
"chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates",
"country": "England",
"delete": false,
"doi": "10.1186/1471-2474-15-112",
"fulltext": "\n==== Front\nBMC Musculoskelet DisordBMC Musculoskelet DisordBMC Musculoskeletal Disorders1471-2474BioMed Central 1471-2474-15-1122468486410.1186/1471-2474-15-112Research ArticlePatterns and predictors of osteoporosis medication discontinuation and switching among Medicare beneficiaries Yun Huifeng 12yunn@uab.eduCurtis Jeffrey R 12jcurtis@uab.eduGuo Lingli 1liguo@uab.eduKilgore Meredith 3mkilgore@uab.eduMuntner Paul 1pmuntner@uab.eduSaag Kenneth 12ksaag@uab.eduMatthews Robert 1rsm@uab.eduMorrisey Michael 3morrisey@uab.eduWright Nicole C 1ncwright@uab.eduBecker David J 12dbecker@uab.eduDelzell Elizabeth 1edelzell@uab.edu1 Department of Epidemiology, University of Alabama at Birmingham, Birmingham 35294, AL, USA2 Division of Clinical Immunology and Rheumatology, University of Alabama at Birmingham, Birmingham, AL, USA3 Department of Health Care Organization and Policy, University of Alabama at Birmingham, Birmingham, AL, USA2014 1 4 2014 15 112 112 3 5 2013 21 3 2014 Copyright © 2014 Yun et al.; licensee BioMed Central Ltd.2014Yun et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.Background\nLow adherence to bisphosphonate therapy is associated with increased fracture risk. Factors associated with discontinuation of osteoporosis medications have not been studied in-depth. This study assessed medication discontinuation and switching patterns among Medicare beneficiaries who were new users of bisphosphonates and evaluated factors possibly associated with discontinuation.\n\nMethods\nWe identified patients initiating bisphosphonate treatment using a 5% random sample of Medicare beneficiaries with at least 24 months of traditional fee-for-service and part D drug coverage from 2006 through 2009. We classified medication status at the end of follow-up as: continued original bisphosphonate, discontinued without switching or restarting, restarted the same drug after a treatment gap (≥ 90 days), or switched to another anti-osteoporosis medication. We conducted logistic regression analyses to identify baseline characteristics associated with discontinuation and a case-crossover analysis to identify factors that precipitate discontinuation.\n\nResults\nOf 21,452 new users followed respectively for 12 months, 44% continued their original therapy, 36% discontinued without switching or restarting, 8% restarted the same drug after a gap greater than 90 days, and 11% switched to another anti-osteoporosis medication. Factors assessed during the 12-month period before initiation were weakly associated with discontinuation. Several Factors measured during follow-up were associated with discontinuation, including more physician visits, hospitalization, having a dual-energy X-ray absorptiometry test, higher Charlson comorbidity index scores, higher out-of-pocket drug payments, and upper gastrointestinal problems. Patterns were similar for 4,738 new users followed for 30 months.\n\nConclusions\nAmong new bisphosphonates users, switching within and across drug classes and extended treatment gaps are common. Robust definitions and time-varying considerations should be considered to characterize medication discontinuation more accurately.\n\nOsteoporosisBisphosphonatesMedication switchingDiscontinuation\n==== Body\nBackground\nAdherence to oral bisphosphonate therapy has been reported to be suboptimal, with about 50% of patients who initiate treatment stopping within one year [1-3]. This poor adherence is thought to increase the risk of consequent morbidity (e.g., fractures) and associated costs [4]. Adherence to osteoporosis medications has been evaluated in many studies in the United States (US) [5-10], and certain factors inversely related to adherence have been identified, including drug related side effects, having multiple comorbid conditions, inconvenient dosing, higher cost, and hospitalization during the one year period before the initiation of osteoporosis medications. However, our understanding of factors related to poor adherence may be incomplete due to methods used to define discontinuation. Once patients discontinue their specific osteoporosis medication, some will switch to another anti-osteoporotic treatment. However, most previous research did not address patients’ switching agents, either to a different agent within the same therapeutic class, or to an agent in a different therapeutic class. One of the few analyses addressing osteoporosis medication discontinuation reported that 30% of patients resumed their medication within six months of discontinuation, and 48% resumed their medication within one year [4].\n\nHence, the commonly used methods of measuring adherence, which classify patients as discontinued after a gap of at least 90 days even if they later restart the same therapy [11,12], or exclude patients if they switch to another anti-osteoporosis medication or different dosage [13,14], may underestimate overall treatment adherence and hinder understanding of the utilization of bisphosphonate therapy. For a study of the efficacy, effectiveness, and/or safety of a specific type, route, or dose of bisphosphonate (e.g., alendronate, risedronate, ibandronate), a narrow definition of discontinuation may be appropriate. However, research on factors associated more generally with adherence, adverse effects or effectiveness of being treated with any anti-osteoporosis medication may benefit from a broader definition. In addition, factors precipitating the discontinuation of anti-osteoporosis medications have not been studied in-depth. In the osteoporosis field, these issues are of key importance given the growing interest in a ‘drug holiday’ [15,16] during which time patients are instructed to cease bisphosphonate therapy for a time (e.g., 1–3 years), making additional work on methods for discontinuation of anti-osteoporosis drugs important and timely. Accordingly, we conducted a study to describe discontinuation and switching patterns of anti-osteoporosis medications in the national US Medicare population, to evaluate factors associated with discontinuation using a variety of definitions, and to identify factors precipitating discontinuation of all anti-osteoporosis therapy.\n\nMethods\nOverview of design and data sources\nTo assess anti-osteoporosis medication utilization patterns and to identify baseline factors associated with alternative definitions of discontinuation, we conducted a retrospective cohort study. To identify factors precipitating discontinuation among adherent patients, we conducted a case-crossover analysis, nested within the cohort study [17]. Both the cohort and the case-crossover analyses used 2006–2009 data on a national 5% random sample of Medicare beneficiaries, obtained from the Centers for Medicare and Medicaid Services (CMS) Chronic Condition Data Warehouse [18]. For each beneficiary, data included information on demographic and insurance coverage; claims for inpatient, outpatient, skilled nursing facility, noninstitutional provider, home health, hospice, durable medical equipment services; and claims for prescription drugs. The institutional review board of the University of Alabama at Birmingham approved the study.\n\nCohort study design\nEligible subjects for the cohort study were Medicare beneficiaries who were 65 years of age or older; lived in the US; were enrolled continuously in traditional Medicare fee-for-service and pharmacy coverage (Parts A, B and D) and not in a Medicare Advantage plan for at least 13 continuous months (12 months baseline and at least one month follow-up time); and were newly treated with a bisphosphonates. Bisphosphonate medications included infusion (IV) zoledronic acid, IV ibandronate, oral ibandronate, oral alendronate, or oral risedronate, during the period 2007 to 2009. We defined new treatment with a particular bisphosphonate as therapy initiated after a baseline period of 12 months during which no bisphosphonate prescription was filled and no administration of IV bisphosphonate occurred. We defined the “original” bisphosphonate as the one taken at initiation. We excluded patients who filled a prescription for raloxifene, calcitonin or teriparatide during baseline and for each beneficiary, follow-up began on the earliest treatment initiation date during the study period and ended on the earliest of first date of losing full Medicare coverage, the death date, or 12/31/2009.\n\nWe examined utilization patterns during a follow-up period of 12 months, during which full Medicare coverage was required. We classified patients’ medication status at the end of 12 months of follow-up into four mutually exclusive groups: 1) continued original bisphosphonate use without a treatment gap, 2) discontinued without switching to a different osteoporosis medication or restarting the original bisphosphonate, 3) restarted the same bisphosphonate after a treatment gap or 4) switched to another drug (a different bisphosphonate, raloxifene, calcitonin or teriparatide). We defined a treatment gap as a period of at least 90 days, occurring after the end of the days supplied by a prescription or administration of a particular bisphosphonate drug and during which there was no further prescription fill or administration of the drug. We assigned days supplied as 90 days for IV ibandronate (administered at three-month intervals) and 365 days for IV zolendronic acid (administered annually). Based on the medication status at the end of 12 months of follow-up, we defined discontinuation using two definitions in the analysis evaluating the association between baseline characteristics and discontinuation of bisphosphonate therapy (Figure 1). Definition I classified a beneficiary as discontinued only if s/he had discontinued all anti-osteoporosis drugs as of the end of follow up. Definition II classified a beneficiary as discontinued if s/he had discontinued all anti-osteoporosis drugs as of the end of follow up, or switched to another type of bisphosphonate, or switched to a non-bisphosphonate anti-osteoporosis medication, or restarted the same anti-osteoporosis drug after a treatment gap of ≥ 90 days. Calcitonin, raloxifene, teriparatide were considered as different anti-osteoporotic medications during follow-up. For example, if a patient restarted the same bisphosphonate after a treatment gap, and then switched to calcitonin until the end of follow-up, we classified the patient as not discontinued in definition I, but discontinued in definition II. To assess longer-term adherence and switching, we conducted similar analyses among patients who had at least 30 months of follow-up, classifying their medication status at the end of 30 months of follow-up using the same definitions of discontinuation (Additional file 1).\n\nFigure 1 Anti-osteoporotic medication discontinuation and switching among new bisphosphonate users at the end of 12 months of follow up. Discontinuation definition I: Totally discontinued all anti-osteoporosis drugs as of the end of follow up. The total percentage of discontinuation I at the 12 months of follow-up is 38%. Discontinuation definition II: Totally discontinued all anti-osteoporosis drugs as of the end of follow up, or switched to another anti-osteoporosis medication, or stopped then restarted the same anti-osteoporosis drugs. The total percentage of discontinuation II at the 12 months of follow-up is 52%. As permitted N (CMS does not allow reporting of N < 11). Alendronate, risedronate, ibandronate, zoledronic acid, calcitonin, raloxifene, teriparatide were considered as different anti-osteoporosis medications. Branded and generic alendronates were considered as the same medication.\n\nCase-crossover study design\nThe case-crossover design enables studying the association between transient exposure, and an acute event by comparing exposure in a period shortly before the event with the patient’s usual frequency of that exposure [19]. Because control information for each subject is based on his or her own past exposure experience in this design, results are not confounded by risk factors that are stable over time [19-21].\n\nTo identify and quantify factors that may precipitate discontinuation to anti-osteoporosis medication, we evaluated each cohort member’s adherence to bisphosphonates during the first 12 months of treatment using the medication possession ratio (MPR), calculated as the total days of bisphosphonate exposure during the first 12 months of follow-up divided by 365 days, and then classified a subject as adherent to bisphosphonate therapy if s/he had an MPR ≥ 80%. The case-crossover analysis included subjects from the cohort study who were adherent to their original bisphosphonate during the first 12 months after treatment initiation, without switching, stopping and/or restarting their original bisphosphonate at any time during the first 12 months follow-up, who then discontinued their original bisphosphonate therapy (i.e., experienced a gap of 90 days or longer) during the subsequent follow-up (i.e., > 12 months after treatment initiation). We excluded those who had a hospitalization or skilled nursing home stay in the first 90 days after discontinuation in order to minimize misclassification, because claims data may not accurately measure drugs used during inpatient and skilled nursing facility stays (21). The follow-up period for identifying discontinuation began 12 months after initiation and continued until the earliest of the loss of full Medicare coverage, discontinuation, death, or 12/31/2009. For each eligible subject, we defined the “case” (or “hazard”) period as the 30 days immediately before bisphosphonate discontinuation, and we specified five “control” periods as the five 30-day periods immediately before the hazard period (Figure 2) [17,21,22].\n\nFigure 2 The case-crossover design of identifying factors precipitating discontinuation of osteoporosis medications.\n\nFactors possibly related to discontinuation\nFactors measured during the baseline period for the cohort study and analyzed for possible association with different definitions of discontinuation included demographics, history of co-morbid conditions, history of preventive service and other medical service utilization, eligibility for a low income subsidy and use of prescription drugs other than anti-osteoporosis medications. Demographic characteristics included age, gender, race, geographic region and residential area-level income, all assessed as of the start of follow-up. We estimated income, as a proxy for socioeconomic status, using beneficiaries’ nine-digit ZIP codes linked to their 2000 Census block group of residence and the corresponding median household income [23]. We identified osteoporosis and history of fractures using International Classification of Disease (ICD)-9th revision diagnosis codes specific to the particular fracture sites from inpatient and physician encounter claims. ICD9 codes for osteoporosis included 733.0, 733.00, 733.01, 733.02, 733.03, 733.09, and for fracture included 800.xx-829.xx, and 733.1x. Other medical conditions, which may associated with fracture and consequently with anti-osteoporosis therapy patterns, included glucocorticoid-related and fall-related (predisposing to falls) conditions, diabetes, chronic kidney disease, depressive illness, acute myocardial infarction, other heart disease, metabolic bone disease and cancer [23]. We identified these conditions using the criterion of at least one diagnosis from inpatient or physician evaluation/management claims during baseline. Medications possibly associated with medication discontinuation or risk of fractures included anticonvulsants, antidepressants, antipsychotics, antihypertensives, lipid-lowering drugs, non-steroidal anti-inflammatory drugs, steroids, proton pump inhibitors, H2-receptor blockers, hormone replacement therapy, thiazolidinediones, and aromatase inhibitors. We identified these medications using the criterion of at least one claim for a prescription filled in Medicare Part D data during baseline.\n\nFactors considered as possibly precipitating medication discontinuation in the case-crossover analysis (see detailed algorithm codes in Additional file 2) included (DXA) testing, skilled nursing home stays, hospitalization for any cause, entering the part D coverage gap [24], having a rheumatologist or endocrinologist visit, having an oncologist visit, eligibility for a low income subsidy, the occurrence of fracture, malignancy, upper gastrointestinal disease, adverse events (including osteonecrosis of the jaw, atrial fibrillation, esophageal cancer, renal disease, subtrochanteric or femoral shaft fractures), total number of physician visits, number of different medications, the Charlson comorbidity index [25], total Medicare costs and out-of-pocket drug costs. The first eight factors were dichotomous, whereas the rest had multiple categories based on their distribution during the last 30 days of the first 12 months of treatment.\n\nFor analyses evaluating the effect of baseline factors on discontinuation, the outcomes were the two alternative definitions of discontinuation at the end of 12 months following bisphosphonate initiation. For the analysis of factors precipitating discontinuation of anti-osteoporosis therapy, we selected as cases only those who totally discontinued bisphosphonate use at the end of follow-up.\n\nAnalysis\nWe evaluated new bisphosphonate treatment patterns during 2007–2009 graphically for each bisphosphonate including branded alendronate without vitamin D, branded alendronate with vitamin D, generic alendronate, risedronate, oral ibandronate, IV ibandronate and IV zoledronic acid. We identified the number of new users of each specific bisphosphonate drug, calculated the proportion of each drug among all new users of bisphosphonates for each quarter of the study period, and calculated the proportion by medication status as of the end of 12 months of follow-up period.\n\nWe compared the baseline characteristics by medication status of new bisphosphonate users at the end of 12 months follow up and computed the standardized difference scores to evaluate the magnitude of differences between groups. We considered standardized difference scores that were less than 0.1 as clinically unimportant [26]. We conducted logistic regression analyses to identify baseline characteristics associated with the two different definitions of discontinuation at the end of 12 months of follow-up. Finally, we repeated all analyses to identify baseline characteristics associated with the two different definitions of discontinuation for patients who had at least 30 months of follow-up at the end of 30 months. These analyses used the odds ratio (OR) with its 95% confidence interval (CI) as the measure of association. Statistical significance was assessed at the alpha level of 0.05.\n\nIn the case-crossover analysis, we compared exposures in a subject’s hazard period (30 days immediately before discontinuation) and control periods (five 30-day periods immediately before the hazard period) [17,21,22]. In sensitivity analyses, we compared exposures in the 30 days immediately before discontinuation and four, three, two and one 30-day periods immediately before the hazard period respectively. We also carried out an additional sensitivity analysis in which the hazard and control time windows were extended to 60 days: that is, this analysis included one hazard period, consisting of the 60 days immediately before discontinuation, and two 60-day control periods immediately before the hazard period, so that the study period is as long as the main analysis We used conditional logistic regression models to compute ORs for the association between factors of interest and discontinuation for the case-crossover analysis. All statistical analyses were performed in SAS 9.3 (SAS institute).\n\nResults\nWe identified 30,990 Medicare beneficiaries in the 5% sample who initiated a bisphosphonate during 2007–2009 (Figure 3). The number of patients initiating each agent was 11,421 for generic alendronate, 6,173 for risedronate, 4,394 for oral ibandronate, 5,251 for branded alendronate without vitamin D, 1,794 for IV zoledronic acid, 1,532 for branded alendronate with vitamin D, and 425 for IV ibandronate. Overall, branded alendronate without vitamin D was the most commonly prescribed medication in 2007, whereas generic alendronate was the most commonly used drug in 2009.\n\nFigure 3 Proportion of Medicare beneficiaries starting specific types of bisphosphonates among all new users, by calendar quarter, 2007–2009.\n\nOf the 30,990 new users of bisphosphonates identified in 2007–2009, 21,452 were eligible for inclusion in analyses of medication status at the end of 12 months of follow-up. (i.e., they had at least 12 months of coverage after the earliest treatment initiation date) (Figure 1). Of these new users followed for 12 months, 44% continued the same therapy, 36% totally discontinued without switching or restarting after a treatment gap, 8% restarted the same drug after a gap of greater than 90 days after the end of the days’ supply, and 11% switched to another bisphosphonate or non- bisphosphonate drug. By the end of 12 months of follow-up, most of beneficiaries who restarted the same drug after a treatment gap continued taking the anti-osteoporosis medications until the end of follow-up, whereas 17% of beneficiaries who switched to another drug discontinued all anti-osteoporosis medications. Of 4,738 eligible new users followed for 30 months, 19% continued the same therapy, 45% totally discontinued, 12% restarted the same drug after a gap, and 24% switched to another osteoporosis drug without a gap. By the end of 30 months of follow-up, 30% beneficiaries who switched to another drug discontinued all anti-osteoporosis medications (Additional file 1).\n\nThe standardized difference scores indicated that baseline characteristics of these four groups were statistically comparable except for history of hospitalization, residency in long-term care and history of DXA (Table 1). Compared to beneficiaries who discontinued without switching or restarting at the end of 12 months follow-up, beneficiaries who continued the original bisphosphonates were more likely to have undergone DXA testing and to have been residing in long-term care; beneficiaries who switched to another drug were more likely to have had a DXA and hospitalization during baseline.\n\nTable 1 Baseline demographic and comorbidity characteristics by medication status of new bisphosphonate users at the end of 12 months follow up\n\nMedication status of new bisphosphonate users at the end of 12 months follow up\t\n \tContinued original bisphosphonate use\tDiscontinued without switching or restarting\tRestarted the same bisphosphonates after a treatment gap\tSwitched to another anti-osteoporosis medication\t\nN\t9,510\t7,827\t1,819\t2,296\t\nAge, years (SD)\t78 (6.8)\t78 (6.8)\t78 (6.7)\t78 (6.8)\t\nMedian Household Income, $ (SD)\t46,318 (22,808)\t44,415 (22,715)\t45,015 (23,123)\t45,142 (22,540)\t\nSex\t \t \t \t \t\nFemale\t8,562 (90.3)\t6,965 (89.0)\t1,639 (90.1)\t2,104 (91.6)\t\nMale\t948 (10.0)\t862 (11.0)\t180 (9.9)\t192 (8.4)\t\nRace/ethnicity\t \t \t \t \t\nBlack\t455 (4.8)\t455 (5.8)\t125 (6.9)\t94 (4.1)\t\nWhite\t8,194 (86.2)\t6,486 (82.9)\t1,456 (80.0)*\t1,920 (83.6)\t\nAsian\t360 (3.8)\t319 (4.1)\t92 (5.1)\t130 (5.7)\t\nHispanic\t285 (3.0)\t382 (4.9)\t95 (5.2)\t107 (4.7)\t\nOther\t216 (2.3)\t185 (2.4)\t51 (2.8)\t45 (2.0)\t\nGeographic region\t \t \t \t \t\nNortheast\t1,717 (18.1)\t1,340 (17.1)\t355 (19.5)\t382 (16.6)\t\nMidwest\t2,534 (26.6)\t1,805 (23.1)\t417 (22.9)\t568 (24.7)\t\nSouth\t3,540 (37.2)\t3,287 (42.0)\t701 (38.5)\t903 (39.3)\t\nWest\t1,719 (18.1)\t1,395 (17.8)\t346 (19.0)\t443 (19.3)\t\nCharlson score\t \t \t \t \t\n0\t3,945 (41.5)\t3,007 (38.4)\t712 (39.1)\t937 (40.8)\t\n1-3\t3,831 (40.3)\t3,222 (42.2)\t783 (43.0)\t931 (40.5)\t\n> 3\t1,734 (18.2)\t1,598 (20.4)\t324 (17.8)\t428 (18.6)\t\nHospitalizations\t2,350 (24,7)\t1,961 (25.1)\t448 (24.6)\t623 (27.1)*\t\nIn long-term care\t1,146 (12.1)*\t659 (8.4)\t156 (8.6)\t303 (13.2)\t\nHistory of any fractures\t1,051 (11.1)\t704 (9.0)\t162 (8.9)\t272 (11.8)\t\nHistory of DXA\t5,641 (59.3)*\t4,154 (53.1)\t883 (48.5)\t1,328 (57.8)\t\nDual Eligible\t2,807 (29.5)\t2,624 (33.5)\t650 (35.7)\t779 (33.9)\t\nEligible for low income subsidy\t3,011 (31.7)\t2,877 (36.8)\t690 (37.9)\t841 (36.6)\t\nEntered Medicare part D coverage gap\t1,826 (19.2)\t1,613 (20.6)\t367 (20.2)\t471 (20.5)\t\nProton pump inhibitors\t2,430 (25.6)\t2,070 (26.5)\t517 (28.4)\t709 (30.9)\t\nDoctor visit type\t \t \t \t \t\nInternal Medicine visits\t6,220 (65.4)\t5,085 (65.0)\t1,170 (64.3)\t1,564 (68.1)\t\nFamily Practice visits\t4,446 (46.8)\t3,654 (46.7)\t781 (42.9)\t1,107 (48.2)\t\nMedical Oncology visits\t940 (9.9)\t721 (9.2)\t159 (8.7)\t222 (9.7)\t\nRheumatology/Endo visits\t1,706 (17.9)\t1,150 (14.7)\t304 (16.7)\t430 (18.7)*\t\nNumber of Physician Visits\t \t \t \t \t\n0-5\t2,978 (31.3)\t2,305 (29.4)\t571 (31.4)\t579 (25.2)\t\n6-10\t2,516 (26.5)\t2,018 (25.8)\t462 (25.4)\t578 (25.2)\t\n11-15\t1,665 (17.5)\t1,379 (17.6)\t307 (16.9)\t438 (19.1)\t\n> 15\t2,351 (24.7)\t2,125 (27.1)\t479 (26.3)\t701 (30.5)\t\nNumbers in table are n (column percent) or mean (standard deviation).\n\n*Standardized difference score between current column and continued original bisphosphonate use column is greater than 0.1.\n\nWith 12 months of follow-up, factors associated with an increased ORs for total discontinuation of bisphosphonate therapy (definition I) included being male, being Hispanic versus non-Hispanic White, living in the South, having a Charlson score greater than zero, and having more than 10 physician visits during the baseline year (Table 2). Factors associated with a lower odds of total discontinuation included area income over $30,000, having a long-term care facility stay during baseline, having a DXA test during baseline, having rheumatologist or endocrinologist visit during baseline, having an oncologist visit during baseline, having history of osteoporosis and taking proton pump inhibitors during baseline All of these associations were weak, with positive associations having ORs below 1.5 and inverse associations having ORs of 0.8 or 0.9. Results were similar in the analysis that used discontinuation definition II after 12 months of follow-up and in analyses of both definitions of discontinuation after 30 months of follow-up (Additional file 3). The range of the c-statistics of the logistic regression models for these analyses was 0.58-0.61.\n\nTable 2 Odds ratios (ORs) and 95% confidence intervals (CIs) for the association between baseline factors and discontinuation of bisphosphonate therapy at 12 months of follow-up based on discontinuation definition I during the period 2006–2009, cohort analyses\n\n \tDiscontinuation definition I\na\n\t\nPatient baseline characteristics \tAdjusted\nb \nOR (95% CI)\t\nSex\tMale\tvs\tFemale\t1.1 (1.0-1.2)*\t\nRace\tBlack\tvs\tWhite\t1.1 (0.9-1.2)\t\n \tAsian\tvs\tWhite\t0.9 (0.8-1.0)\t\n \tHispanic\tvs\tWhite\t1.1 (1.0-1.3)*\t\n \tOther\tvs\tWhite\t1.0 (0.9-1.2)\t\nAge\t70-74\tvs\t65-69\t1.0 (0.9-1.1)\t\n \t75-79\tvs\t65-69\t1.0 (0.9-1.1)\t\n \t80-84\tvs\t65-69\t1.0 (0.9-1.1)\t\n \t85plus\tvs\t65-69\t1.0 (0.9-1.1)\t\nRegion\tMidwest\tvs\tNortheast\t0.9 (0.8-1.0)\t\n \tSouth\tvs\tNortheast\t1.1 (1.0-1.2)*\t\n \tWest\tvs\tNortheast\t1.0 (0.9-1.1)\t\nArea income 45000\t30000-\tvs\t< 30000\t0.9 (0.8-1.0)\t\n60000\t45000-\tvs\t< 30000\t0.9 (0.8-0.9)*\t\n75000\t60000-\tvs\t< 30000\t0.9 (0.8-0.9)*\t\n \t75000+\tvs\t< 30000\t0.8 (0.8-0.9)*\t\nCharlson score\t1-2\tvs\t0\t1.0 (0.9-1.1)\t\n \t> 2\tvs\t0\t1.1 (1.0-1.2)*\t\nNumber of physician visits\t6-10\tvs\t0-5\t1.1 (1.0-1.2)\t\n \t11-15\tvs\t0-5\t1.1 (1.0-1.2)*\t\n \t> 15\tvs\t0-5\t1.3 (1.1-1.4)*\t\nHospitalization at baseline\t \t \t \t1.0 (1.0-1.1)\t\nLong-term care stay at baseline\t \t \t \t0.6 (0.5-0.7)*\t\nFracture at baseline \t \t \t \t0.9 (0.8-1.0)*\t\nDual-energy X-ray absorptiometry at baseline\t \t \t \t0.8 (0.8-0.9)*\t\nInternal medicine physician visit at baseline\t \t \t \t1.0 (0.9-1.0)\t\nFamily practice physician visit at baseline\t \t \t \t1.0 (0.9-1.1)\t\nOncologist visit at baseline \t \t \t \t0.9 (0.8-1.0)*\t\nRheumatologist or endocrinologist visit at baseline\t \t \t \t0.8 (0.7-0.9)*\t\nOsteoporosis \t \t \t \t0.8 (0.8-0.9)*\t\nProton pump inhibitors\t \t \t \t0.8 (0.7-1.0)*\t\naDiscontinuation definition I: Totally discontinued all anti-osteoporosis drugs as of the end of follow up.\n\nbAdjusted for all factors listed in the table, and urban/rural residency, entering Medicare part D coverage gap at baseline, glucocorticoid-related and fall-related (predisposing to falls) conditions, diabetes, chronic kidney disease, depressive illness, acute myocardial infarction, other heart disease, metabolic bone disease, cancer, anticonvulsants, antidepressants, antipsychotics, antihypertensives, lipid-lowering drugs, non-steroidal anti-inflammatory drugs, steroids, H2-receptor blockers, hormone replacement therapy, thiazolidinediones, and aromatase inhibitors.\n\n*p < =0.05.\n\nAmong subjects in the cohort study with high adherence (MPR ≥ 80%) in their first 12 months following bisphosphonate initiation, 922 patients subsequently discontinued their bisphosphonate therapy (Table 3). Factors, measured in the 30 days immediately preceding discontinuation, associated with discontinuation were having a DXA test, hospitalization, upper gastrointestinal symptoms or conditions, having more than four physician visits, Charlson score greater than 2, total out-of-pocket drug payments ≥ $20. Taking ≥ 3 different medications was inversely associated with discontinuation. The results of the sensitivity analyses were qualitatively similar to those of the main analysis, regardless of the number of control periods or the duration of the hazard and control periods (30 days v. 60 days) (data not shown).\n\nTable 3 Odds ratios (ORs) and 95% confidence intervals (CIs) for the association between precipitating factors and discontinueation of bisphosphonate therapy, case-crossover analysis\n\nFactors potentially associated with discontinuation\na\n\tUnivariate analysis\tMultivariate analysis\t\n \tOR (95% CI)\tAdjusted\nb \nOR (95% CI)\t\nDual-energy X-ray absorptiometry\t2.0 (1.3-3.1)\t2.3 (1.4-3.6)\t\nAny hospitalization\t2.2 (1.5-3.1)\t1.7 (1.1-2.7)\t\nFracture\t0.7 (0.2-1.9)\t0.4 (0.1-1.3)\t\nCancer\t1.2 (0.7-1.9)\t1.0 (0.6-1.8)\t\nEntering Medicare part D coverage gap\t1.0 (0.8-1.3)\t0.9 (0.7-1.3)\t\nAdverse effects\t1.6 (1.1-2.3)\t1.0 (0.7-1.6)\t\nSkilled nursing home\t0.7 (0.2-2.1)\t0.4 (0.1-1.4)\t\nRheumatologist or endocrinologist visit\t1.1 (0.7-1.7)\t0.8 (0.5-1.4)\t\nUpper gastrointestinal disease\t3.2 (1.4-7.3)\t3.4 (1.5-7.7)\t\nEligible for low income subsidy\t4.9 (0.8-28.7)\t5.7 (1.0-32.4)\t\nNumber of ambulatory physician visits during each 30 day period\t \t \t\n0\tRef (1.0)\tRef (1.0)\t\n1-4\t1.2 (1.0-1.4)\t1.2 (1.0-1.5)\t\n> 4\t2.4 (1.4-4.1)\t2.5 (1.3-4.5)\t\nNumber of medications during each 30 day period\t \t \t\n0-2\tRef (1.0)\tRef (1.0)\t\n3-5\t0.8 (0.7-1.0)\t0.5 (0.4-0.6)\t\n> 5\t0.5 (0.4-0.7)\t0.3 (0.2-0.4)\t\nCharlson score during each 30 day period\t \t \t\n0\tRef (1.0)\tRef (1.0)\t\n1-2\t1.3 (0.8-1.9)\t1.4 (0.9-2.1)\t\n> 2\t1.7 (1.0-3.1)\t2.5 (1.3-4.7)\t\nTotal Medicare cost during each 30-day period\t \t \t\n$ 0-90\tRef (1.0)\tRef (1.0)\t\n$ 91-440\t0.9 (0.7-1.1)\t0.9 (0.7-1.1)\t\n$ > 440\t1.0 (0.8-1.3)\t0.9 (0.8-1.3)\t\nOut-of-pocket drug payments during each 30 day period\t \t \t\n$ 0-19\tRef (1.0)\tRef (1.0)\t\n$ 20-84\t1.6 (1.2-2.0)\t1.6 (1.3-2.1)\t\n$ > 84\t5.4 (4.4-6.7)\t6.6 (5.3-8.1)\t\naHazard period is defined as 30 days immediately before discontinuation. Control periods are defined as five 30-day periods immediately before the hazard period.\n\nbAdjusted all the factors listed in the table.\n\nDiscussion\nWe found large temporal changes in the pattern of use of several types of bisphosphonates in 2007–2009 among Medicare beneficiaries. Our analysis of factors associated with different definitions of discontinuation found factors measured at baseline were, at most, weakly associated with discontinuation and differed little according to the definitions of discontinuation. However, in the case-crossover analysis evaluating the effect of factors measured immediately before discontinuation, a DXA test, having upper gastrointestinal problems, having more physician visits, higher Charlson comorbidity scores, and higher out-of-pocket drug payments, were associated with total discontinuation of bisphosphonate therapy after one year of high adherence, whereas a higher total number of all types medications dispensed was associated inversely with discontinuation.\n\nStarting in 2008, we found the major increases in bisphosphonate utilization were for generic alendronate and IV zoledronic acid, and the major decreases were for branded alendronate products and risedronate. Our findings are consistent with a report from Medco Health Solutions, Inc (a healthcare company) indicating that branded alendronate lost 84% of its market share from retail stores and 94% of its market share from mail pharmacies during the first 30 days after the launch of generic products [27]. Several factors could explain the increase in IV/injection bisphosphonates utilization that we observed during the 2007–2009 time period. More aggressive marketing and perceptions of potentially better adherence with IV compared to oral bisphosphonates could lead to greater prescribing of IV therapies. Parenteral administration also may minimize certain side effects, such as gastrointestinal upset, and avoids the complex instructions required for proper administration of oral bisphosphonates [28].\n\nWe also found that switching within the bisphosphonates class, switching out of the bisphosphonate treatment class, and having treatment gaps were common among new bisphosphonate users. For our purposes, discontinuation was defined in two alternative ways: first, as total discontinuation of any osteoporosis medications; second, as total discontinuation, having a therapy gap then restarting the same bisphosphonate, or switching to another therapy during follow-up. Compared to the strict definition (I) of discontinuation, an additional 17-29% of people were classified as discontinued due to switching to other types of bisphosphonate or to non-bisphosphonate osteoporosis medications or due to a gap in therapy with a particular type of bisphosphonate.\n\nOur findings are consistent with those of prior studies showing that people are prone to switch or restart bisphosphonates after discontinuation [4,29]. Using 1996–2002 Pharmaceutical Assistance Contract for the Elderly (PACE) of Pennsylvania data, Brookhart et al. reported that among patients who stopped bisphosphonate therapy for at least 60 days, an estimated 30% restarted treatment within six months [4]. Their results are higher than the percentage restarting in our study, possibly because the prior analysis examined the therapeutic class of all bisphosphonates combined, while our analysis examined each form of bisphosphonate separately. Brookhart et al. also defined a gap as 60 days, whereas we used a gap length of 90 days. Another study, in a commercial health plan population during the period of 2006–2008, reported substantial discontinuation, restarting, and switching among new users of various anti-osteoporosis medications [29]. For example, 52-67% of new users of specific types of bisphosphonates discontinued their original medication within 12 months, 13-22% restarted their original medication after a greater than 90-day treatment gap, and 0.4-9.6% switched to another drug. Therefore, examining patterns of restarting and switching in future osteoporosis studies may generate a more complete definition and assessment of adherence, particularly in studies that include time periods when a major new anti-osteoporosis medication, such as generic alendronate, has been introduced.\n\nRegardless of length of follow-up or the definition of discontinuation, the factors that we assessed at baseline displayed generally weak associations or no relation with discontinuation. With area under the receiver operator curve as low as 0.58-0.60 in both multivariable logistic models, these results are consistent with those of prior studies reporting that baseline characteristics, measured only at treatment initiation, yielded a poor ability to discriminate osteoporosis patients with high adherence versus low adherence [30].\n\nOur case-crossover analysis was designed to identify factors emerging during follow-up that lead to discontinuation among adherent bisphosphonate users. The results indicated that events occurring during follow-up are likely to be more important as predictors of adherence and persistence than are characteristics measured at therapy initiation. Specifically, we identified six important factors that were positively associated with discontinuation – DXA, more than four ambulatory physician visits, hospitalization, upper gastrointestinal disorders, higher Charlson comorbidity index, and higher out-of-pocket drug payments.\n\nDXA is the gold standard for diagnosing osteoporosis, and it may play a role in monitoring response to osteoporosis treatment [31]. Our finding that after one year of high adherence, having a DXA was significantly associated with discontinuation, suggests that physicians and patients may consider discontinuing osteoporosis medications if DXA test results indicate a bone mineral density improvement treatment [32] or that patients may discontinue the therapy due to a lack of improvement in bone mineral density [33]. Unfortunately Medicare data do not include DXA test results, which would be required to confirm this interpretation. Our observation that having more than four ambulatory physician visits was strongly associated with discontinuation contrasts with another study that reported that physician visits were related to patients’ reinitiating therapy [4]. The discordant results may reflect differences in study populations: our case-crossover analysis was limited to people who had been adherent for at least one year and then experienced discontinuation, whereas the latter study was limited to new users. Also, it is possible that patients with more diseases tend to see physicians more often and stop taking drugs with fewer perceived beneficial effects [34,35].\n\nOur study confirms results from other investigations reporting that upper gastrointestinal conditions are significantly associated with bisphosphonate discontinuation [1,11]. Finally, our findings indicate that patients who have more comorbid conditions, pay more out-of-pocket for drugs, or stay in the hospital are much more likely to discontinue drug therapy. These associations are consistent with the phenomenon called the “sick stopper”, wherein patients who are getting sicker and spending more healthcare dollars maybe more likely to discontinue treatments for non-symptomatic conditions, such as osteoporosis [35].\n\nA major strength of our study was its assessment of factors possibly associated with discontinuation both at baseline and, in the case-crossover analysis, during follow-up. Other strengths include the study’s large size, generalizability to the entire US traditional fee-for-service Medicare population with Part D coverage, the use of prescription claims to define exposures instead of self-reported drug usage, and our sensitivity analyses. The methodological aspects to our work should grow in importance given increasing interest on drug holidays from bisphosphonate exposure. We varied the definition of discontinuation across a range of possible options and examined factors associated with discontinuation, which is expected to be useful for future analyses that examine new reasons for patients to stop therapy such as a drug holidays [15,16].\n\nThe main limitation was the study’s reliance on claims data to assess utilization and possible reasons for discontinuation. Claims data do not includes baseline or follow-up bone mineral density measures, which could have influenced the likelihood of adherence. Our case-crossover analysis was limited to patients who had been adherent to bisphosphonates for 12 months, whereas the cohort analysis used new users, therefore, the characteristics of subjects discontinuing included in the case-crossover analysis were not comparable to those totally discontinued in the cohort analysis. There also could be misclassification of safety outcomes without well validated claims-based algorithms (e.g., osteonecrosis of the jaw, atypical fracture, and upper gastrointestinal symptoms). The possibility that some patients may have filled their anti-osteoporosis prescriptions without submitting a claim to Medicare is another potential limitation. However, we recently reported that this may occur for a maximum of 15% of generic prescriptions, using alendronate as an example, available through low-cost pharmacy programs [36].\n\nFinally, our analyses included patients who had primary adherence (i.e., they filled a prescription for a bisphosphonate), but not patients with primary non-adherence (i.e., had anti-osteoporosis prescriptions but never have it filled or administrated), and our case-crossover analysis was further restricted to patients who were adherent for 12 months after initiation of therapy. Thus, the results may not be generalizable to all Medicare patients prescribed and taking bisphosphonate drugs.\n\nConclusions\nGeneric alendronate and IV zoledronic use among Medicare beneficiaries increased substantially during 2007–2009. Among new bisphosphonate users, switching among bisphosphonates, switching out of the bisphosphonate therapeutic class, and having treatment gaps were common. Factors measured at therapy initiation were at most weakly associated with discontinuation, regardless of varying the definition of discontinuation and the length of follow-up. In contrast, several factors measured during follow-up appeared to precipitate discontinuation within 12 months of initiating bisphosphonate therapy including DXA, more than six ambulatory physician visits, hospitalization, upper gastrointestinal disorders, higher Charlson comorbidity score, and higher out-of-pocket drug payments. Further studies are needed to characterize medication discontinuation more carefully with consideration of time-varying factors.\n\nAbbreviations\nCI: Confidence interval; CMS: Centers for medicare and medicaid services; DXA: Dual-energy X-ray absorptiometry; ICD: International classification of disease; IV: Infusion; MPR: Medication possession ratio; OR: Odds ratio; PACE: Assistance contract for the elderly; US: United States.\n\nAuthors’ contributions\nConception and design: HY, ED, KS, MK, PM, JRC. Acquisition of Data: HY, ED, KS, MK, MM, JRC. Analysis and interpretation of data: HY, ED, KS, MK, PM, MM, NCW, LG, RM, DJB, JRC. Drafting manuscript: HY. Critical revision of manuscript for important intellectual content: HY, JRC, KS, MK, MM, NCW, DJB, ED. Statistical analysis: HY, RM, LG. Obtaining Funding: JRC, KS, MK, MM, ED. Administrative, technical, or material support: RM, S, KS, MK, MM, ED, JRC. Study supervision: ED, KS, JRC. All authors read and approved the final manuscript.\n\nPre-publication history\nThe pre-publication history for this paper can be accessed here:\n\nhttp://www.biomedcentral.com/1471-2474/15/112/prepub\n\nSupplementary Material\nAdditional file 1\nAnti-osteoporotic medication use of new bisphosphonate users at the end of 30 months of follow up.\n\nClick here for file\n\n Additional file 2\n“Algorithms for identifying the possible trigger factors in the hazard and control period”. In the submitted version, it was in the first row of the table.\n\nClick here for file\n\n Additional file 3\nBaseline factors associated with discontinuation of bisphosphonate therapy at 30 of follow-up, based on discontinuation definition I during the period 2006-2009, cohort analyses.\n\nClick here for file\n\n Acknowledgements\nThis research was supported by a contract between UAB and Amgen, Inc. Only the authors had access to data. The analysis, presentation and interpretation of the results were solely the responsibility of the authors.\n\nDr Yun had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.\n\nDisclosure\nThis research was supported by a contract between UAB and Amgen, Inc. Only the authors had access to the Medicare data used. The analysis, presentation and interpretation of the results were solely the responsibility of the authors.\n\nFinancial competing interests\nNone of the authors received reimbursements, fees, funding, or salary from an organization that may in any way gain or lose financially from the publication of this manuscript, either now or in the future.\n\nNone of the authors hold any stocks or shares that may in any way gain or lose financially from the publication of this manuscript, either now or in the future.\n\nNone of the authors hold or apply for any patents.\n\nOther financial competing interests\nJRC: Grant support from the NIH (AR053351) and AHRQ (R01HS018517).\n\nResearch grant: Amgen, Eli Lilly, Merck, Novartis, Proctor & Gamble, Roche;\n\nConsulting fees: Merck, Amgen, Eli Lilly, Roche, Novartis\n\nKGS: Research grant: Eli Lilly, Novartis, Merck, Amgen;\n\nConsulting fees: Eli Lilly, Novartis, Merck, Amgen\n\nHY, LG, MLK, RM, MAM, NCW, DJB, and ESD received research from AMGEN.\n\nNon-financial competing interests\nNone of the authors had non-financial competing interests.\n==== Refs\nLo JC Pressman AR Omar MA Ettinger B Persistence with weekly alendronate therapy among postmenopausal women Osteoporos Int 2006 17 6 922 928 10.1007/s00198-006-0085-2 16609824 \nCurtis JR Westfall AO Cheng H Lyles K Saag KG Delzell E The benefit of adherence with bisphosphonates depends on Age and fracture type: results from an analysis of 101,038 New bisphosphonate users J Bone Miner Res 2008 23 9 1435 1441 10.1359/jbmr.080418 18442318 \nSeeman E Compston J Adachi J Brandi ML Cooper C Dawson-Hughes B Jonsson B Pols H Cramer JA Non-compliance: the Achilles’ heel of anti-fracture efficacy Osteoporos Int 2007 18 6 711 719 10.1007/s00198-006-0294-8 17245547 \nBrookhart MA Avorn J Katz JN Finkelstein JS Arnold M Polinski JM Patrick AR Mogun H Solmon DH Gaps in treatment among users of osteoporosis medications: the dynamics of noncompliance Am J Med 2007 120 3 251 256 10.1016/j.amjmed.2006.03.029 17349448 \nSiris ES Harris ST Rosen CJ Barr CE Arvesen JN Abbott TA Silverman S Adherence to bisphosphonate therapy and fracture rates in osteoporotic women: relationship to vertebral and nonvertebral fractures from 2 US claims databases Mayo Clin Proc 2006 81 8 1013 1022 10.4065/81.8.1013 16901023 \nSolomon DH Avorn J Katz JN Finkelstein JS Arnold M Polinski JM Brookhart MA Compliance with osteoporosis medications Arch Intern Med 2005 165 20 2414 2419 10.1001/archinte.165.20.2414 16287772 \nClowes JA Peel NF RE The impact of monitoring on adherence and persistence with antiresorptive treatment for postmenopausal osteoporosis: a randomized controlled trial J Clin Endocrinol Metab 2004 89 3 1117 1123 10.1210/jc.2003-030501 15001596 \nTosteson AN Do TP Wade SW Anthony MS Downs RW Persistence and switching patterns among women with varied osteoporosis medication histories: 12-month results from POSSIBLE US Oseoporos Int 2010 21 10 1769 1780 10.1007/s00198-009-1133-5 \nHuybrechts KF Ishak KJ Caro JJ Assessment of compliance with osteoporosis treatment and its consequences in a managed care population Bone 2006 38 6 922 928 10.1016/j.bone.2005.10.022 16330270 \nRossini M Bianchi G Di Munno O Giannini S Minisola S Sinigaglia L Adami S Determinants of adherence to osteoporosis treatment in clinical practice Osteoporos Int 2006 17 6 914 921 10.1007/s00198-006-0073-6 16538553 \nRabenda V Hiligsmann M Reginster JY Poor adherence to oral bisphosphonate treatment and its consequences: a review of the evidence Expert Opin Pharmacother 2009 10 14 2303 2315 10.1517/14656560903140533 19640210 \nKothawala P Badamgarav E Ryu S Systematic review and meta-analysis of real-world adherence to drug therapy for osteoporosis Mayo Clin Proc 2007 82 1493 1501 10.1016/S0025-6196(11)61093-8 18053457 \nRabenda V Mertens R Fabri V Vanoverloop J Sumkay F Vannecke C Deswaef A Verpooten GA Reginster JY Adherence to bisphosphonates therapy and hip fracture risk in osteoporotic women Osteoporos Int 2008 19 6 811 818 10.1007/s00198-007-0506-x 17999022 \nWeycker D Macarios D Edelsberg J Oster G Compliance with osteoporosis drug therapy and risk of fracture Osteoporos Int 2007 18 3 271 277 10.1007/s00198-006-0230-y 17021945 \nMcClung M Harris ST Miller PD Bauer DC Davison KS Dian L Hanley DA Kendler DL Yuen CK Lewiecki EM Bisphosphonate therapy for osteoporosis: benefits, risks, and drug holiday Am J Med 2013 126 1 13 20 10.1016/j.amjmed.2012.06.023 23177553 \nWatts NB Diab DL Long-term use of bisphosphonates in osteoporosis J Clin Endocrinol Metab 2010 95 4 1555 1565 10.1210/jc.2009-1947 20173017 \nMaclure M Mittleman MA Should we use a case-crossover design? Annu Rev Public Health 2000 21 193 221 10.1146/annurev.publhealth.21.1.193 10884952 \nCooper C Atkinson EJ Jacobsen SJ O’Fallon WM Melton LJ IIIPopulation-based survival after osteoporotic fractures Am J Epidemiol 1993 137 9 1001 1005 8317445 \nMaclure M The case-crossover design: a method for studying transient effects on the risk of acute events Am J Epidemiol 1991 133 2 144 153 1985444 \nMittleman MA Maclure M Tofler GH Sherwood JB Goldberg RJ Muller JE Triggering of acute myocardial infarction by heavy physical exertion. Protection against triggering by regular exertion. Determinants of myocardial infarction onset study investigators N Engl J Med 1993 329 23 1677 1683 10.1056/NEJM199312023292301 8232456 \nMittleman MA Maclure M Robins JM Control sampling strategies for case-crossover studies: an assessment of relative efficiency Am J Epidemiol 1995 142 1 91 98 7785679 \nSorock GS Lombardi DA Gabel CL Smith GS Mittleman MA Case-crossover studies of occupational trauma: methodological caveats Inj Prev 2001 7 Suppl 1 i38 42 11565970 \nTaylor A Gary L Arora T Becker DJ Curtis JR Kilgore ML Morrisey MA Clinical and demographic factors associated with fractures among older americans Osteoporos Int 2010 22 4 1263 1274 20559818 \nSun SX Lee KY The medicare part D doughnut hole: effect on pharmacy utilization Manag Care Interface 2007 20 9 51 55 59 18161394 \nKim MH Klingman D Lin J Battleman DS Patterns and predictors of discontinuation of rhythm-control drug therapy in patients with newly diagnosed atrial fibrillation Pharmacotherapy 2009 29 12 1417 1426 10.1592/phco.29.12.1417 19947801 \nRoland M Torgerson DJ What are pragmatic trials? Bmj 1998 316 7127 285 10.1136/bmj.316.7127.285 9472515 \nMedco Health Solutions Inc Drug trend report. The great Healthcare debates. Prescriptions for meaningful reform 2009 http://www.medco.com/art/drug_trend/pdf/DT_2009_Drug_Trend_Report.pdf, assessed March 25, 2014 \nCurtis JR Yun H Matthews R Saag KG Delzell E Adherence with intravenous zoledronate and IV ibandronate in the U.S. medicare population Arthritis Care Res (Hoboken) 2012 64 7 1054 1060 22328117 \nXu Y Viswanathan HN Ward MA Clay B Adams JL Stolshek BS Kallich JD Fine S Saag KG Patterns of osteoporosis treatment change and treatment discontinuation among commercial and medicare advantage prescription drug members in a national health plan J Eval Clin Pract 2013 19 1 50 59 10.1111/j.1365-2753.2011.01766.x 21914091 \nCurtis JR Xi J Westfall AO Cheng H Lyles K Saag KG Delzell E Improving the prediction of medication compliance: the example of bisphosphonates for osteoporosis Med Care 2009 47 3 334 341 10.1097/MLR.0b013e31818afa1c 19194337 \nLenchik L Kiebzak GM Blunt BA What is the role of serial bone mineral density measurements in patient management? J Clin Densitom 2002 5 Suppl S29 38 12464709 \nWinzenberg T Jones G Dual energy X-ray absorptiometry Aust Fam Physician 2011 40 1–2 43 44 21301693 \nDelmas PD Vrijens B Eastell R Roux C Pols HA Ringe JD Grauer A Cahall D Watts NB Improving measurements of persistence on actonel treatment I: effect of monitoring bone turnover markers on persistence with risedronate treatment of postmenopausal osteoporosis J Clin Endocrinol Metab 2007 92 4 1296 1304 10.1210/jc.2006-1526 17244788 \nStarfield B Lemke KW Herbert R Pavlovich WD Anderson G Comorbidity and the use of primary care and specialist care in the elderly Ann Fam Med 2005 3 3 215 222 10.1370/afm.307 15928224 \nGlynn RJ Knight EL Levin R Avorn J Paradoxical relations of drug treatment with mortality in older persons Epidemiology 2001 12 6 682 689 10.1097/00001648-200111000-00017 11679797 \nYun H Curtis JR Saag K Kilgore M Muntner P Smith W Matthews R Wright N Morrisey MA Delzell E Generic alendronate use among medicare beneficiaries: are part D data complete? Pharmacoepidemiol Drug Saf 2013 22 1 55 63 10.1002/pds.3361 23135758\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2474",
"issue": "15()",
"journal": "BMC musculoskeletal disorders",
"keywords": null,
"medline_ta": "BMC Musculoskelet Disord",
"mesh_terms": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D004334:Drug Administration Schedule; D057915:Drug Substitution; D017723:Drug Utilization Review; D006801:Humans; D016015:Logistic Models; D006278:Medicare; D016017:Odds Ratio; D010024:Osteoporosis; D058866:Osteoporotic Fractures; D010818:Practice Patterns, Physicians'; D012189:Retrospective Studies; D012307:Risk Factors; D013997:Time Factors; D016896:Treatment Outcome; D014481:United States",
"nlm_unique_id": "100968565",
"other_id": null,
"pages": "112",
"pmc": null,
"pmid": "24684864",
"pubdate": "2014-04-01",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "22328117;18053457;16609824;17999022;11565970;17021945;21301693;10884952;12464709;8232456;18161394;20173017;18442318;1985444;11679797;21914091;19640210;16901023;9472515;23135758;20559818;23177553;17244788;16330270;7785679;19947801;15001596;20101492;17245547;15928224;16538553;16287772;8317445;17349448;19194337",
"title": "Patterns and predictors of osteoporosis medication discontinuation and switching among Medicare beneficiaries.",
"title_normalized": "patterns and predictors of osteoporosis medication discontinuation and switching among medicare beneficiaries"
} | [
{
"companynumb": "US-ROCHE-1400943",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IBANDRONIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "A 58-year-old man received high-dose melphalan with autologous peripheral blood stem cell transplantation for multiple myeloma in stringent complete response (sCR). Relapse occurred 4 years after the transplantation, and he was placed on ixazomib, lenalidomide, and dexamethasone (IRd) and achieved sCR. On the 10th day of the 10th course of IRd, he developed fever followed by generalized skin eruption with vesicles, headache, and dizziness. Varicella-zoster virus (VZV) antigen from the vesicle and VZV-DNA from the cerebrospinal fluid were detected, and he was diagnosed with systemic VZV infection. He was placed on intravenous acyclovir (ACV), and the infection resolved completely. VZV infection has been recognized as an important complication associated with the use of proteasome inhibitors; however, to our knowledge, there have been no reported cases of serious systemic VZV infection associated with ixazomib. The clinical course of this case strongly suggests the importance of prophylaxis for VZV infection during treatment with ixazomib.",
"affiliations": "Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.;Division of Hematology, Department of Medicine, Keio University School of Medicine.",
"authors": "Nakayama|Hitomi|H|;Kato|Jun|J|;Kikuchi|Taku|T|;Okayama|Mikio|M|;Kamiya|Takahiro|T|;Mizuno|Kota|K|;Shimizu|Takayuki|T|;Okamoto|Shinichiro|S|;Mori|Takehiko|T|",
"chemical_list": "D001896:Boron Compounds; C548400:ixazomib; D005998:Glycine",
"country": "Japan",
"delete": false,
"doi": "10.11406/rinketsu.61.870",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0485-1439",
"issue": "61(8)",
"journal": "[Rinsho ketsueki] The Japanese journal of clinical hematology",
"keywords": "Acyclovir; Ixazomib; Multiple myeloma; Varicella-zoster virus",
"medline_ta": "Rinsho Ketsueki",
"mesh_terms": "D001896:Boron Compounds; D002644:Chickenpox; D005998:Glycine; D006562:Herpes Zoster; D006801:Humans; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma; D009364:Neoplasm Recurrence, Local",
"nlm_unique_id": "2984782R",
"other_id": null,
"pages": "870-873",
"pmc": null,
"pmid": "32908048",
"pubdate": "2020",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Systemic varicella-zoster infection during ixazomib-containing multiagent chemotherapy for multiple myeloma.",
"title_normalized": "systemic varicella zoster infection during ixazomib containing multiagent chemotherapy for multiple myeloma"
} | [
{
"companynumb": "JP-TAKEDA-2020TUS038987",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IXAZOMIB"
},
"drugadditional": "3",
"... |
{
"abstract": "Although fluoroquinolones (FQs) are generally well-tolerated antibiotics, increasing numbers of hypersensitivity reactions have been reported. These can be evaluated in vitro by basophil activation tests (BATs); however, sensitivity is not optimal. Many factors could influence sensitivity such as basophil activation markers. The objective of this study was to evaluate the influence of 2 different activations markers, CD63 and CD203c, on the sensitivity of BAT to FQ. We studied 17 patients with immediate allergic reactions to FQ. BAT was performed with moxifloxacin and ciprofloxacin using CD193 (CCR3) for basophil selection and CD203c or CD63 as activation markers. Stimulation with ciprofloxacin induced a significantly higher expression of CD63 in ciprofloxacin-allergic patients compared to moxifloxacin-allergic patients (P = 0.002). In patients allergic to moxifloxacin with anaphylactic shock, we have observed an increase in the percentage of cells that upregulate CD203c, whereas patients with anaphylaxis preferentially upregulate CD63. The best sensitivity-specificity was obtained using a cutoff of 3 and the culprit FQ, using CD203c for moxifloxacin-allergic patients (sensitivity = 36.4%; specificity = 94.4%), and CD63 for ciprofloxacin-allergic patients (sensitivity = 83.3%; specificity = 88.9%). A negative correlation was found between the upregulation of CD63 and CD203c and the time interval between the reaction occurrence and the performance of the test (Spearman r = -0.446; P < 0.001 for CD63 and Spearman r = -0.386; P < 0.001 for CD203c). The performance of BAT for FQ allergy must be optimized for each drug, taking into account possible differences in the stimulation mechanism that leads to the upregulation of different activation markers.",
"affiliations": "Research Unit for Allergic Diseases, IBIMA-Regional University Hospital of Malaga-UMA, Málaga, Spain. Allergy Unit, IBIMA-Regional University Hospital of Malaga-UMA, Málaga, Spain.",
"authors": "Fernández|Tahia D|TD|;Ariza|Adriana|A|;Palomares|Francisca|F|;Montañez|María I|MI|;Salas|María|M|;Martín-Serrano|Angela|A|;Fernández|Rubén|R|;Ruiz|Arturo|A|;Blanca|Miguel|M|;Mayorga|Cristobalina|C|;Torres|María J|MJ|",
"chemical_list": "D015415:Biomarkers; D024841:Fluoroquinolones",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000003679",
"fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 2728106910.1097/MD.0000000000003679036793600Research ArticleDiagnostic Accuracy StudyHypersensitivity to fluoroquinolones The expression of basophil activation markers depends on the clinical entity and the culprit fluoroquinoloneFernández Tahia D. PhDaAriza Adriana PhDaPalomares Francisca PhDaMontañez María I. PhDaSalas María MD, PhDbMartín-Serrano Angela BSaFernández Rubén BSaRuiz Arturo MDbBlanca Miguel MD, PhDbMayorga Cristobalina PhDab∗Torres María J. MD, PhDbEsaki Muthu. Shankar a Research Unit for Allergic Diseases, IBIMA-Regional University Hospital of Malaga-UMA, Málaga, Spain.b Allergy Unit, IBIMA-Regional University Hospital of Malaga-UMA, Málaga, Spain.∗ Correspondence: Cristobalina Mayorga, Research Unit for Allergic Diseases, IBIMA-Regional University Hospital of Malaga, Pl. Hospital Civil, 29009 Malaga, Spain (e-mail: mayorga.lina@gmail.com).6 2016 10 6 2016 95 23 e367928 12 2015 23 3 2016 21 4 2016 Copyright © 2016 Wolters Kluwer Health, Inc. All rights reserved.2016This is an open access article distributed under the Creative Commons Attribution License 4.0, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0Supplemental Digital Content is available in the text\n\nAbstract\nAlthough fluoroquinolones (FQs) are generally well-tolerated antibiotics, increasing numbers of hypersensitivity reactions have been reported. These can be evaluated in vitro by basophil activation tests (BATs); however, sensitivity is not optimal. Many factors could influence sensitivity such as basophil activation markers. The objective of this study was to evaluate the influence of 2 different activations markers, CD63 and CD203c, on the sensitivity of BAT to FQ. We studied 17 patients with immediate allergic reactions to FQ. BAT was performed with moxifloxacin and ciprofloxacin using CD193 (CCR3) for basophil selection and CD203c or CD63 as activation markers. Stimulation with ciprofloxacin induced a significantly higher expression of CD63 in ciprofloxacin-allergic patients compared to moxifloxacin-allergic patients (P = 0.002). In patients allergic to moxifloxacin with anaphylactic shock, we have observed an increase in the percentage of cells that upregulate CD203c, whereas patients with anaphylaxis preferentially upregulate CD63. The best sensitivity–specificity was obtained using a cutoff of 3 and the culprit FQ, using CD203c for moxifloxacin-allergic patients (sensitivity = 36.4%; specificity = 94.4%), and CD63 for ciprofloxacin-allergic patients (sensitivity = 83.3%; specificity = 88.9%). A negative correlation was found between the upregulation of CD63 and CD203c and the time interval between the reaction occurrence and the performance of the test (Spearman r = −0.446; P < 0.001 for CD63 and Spearman r = −0.386; P < 0.001 for CD203c). The performance of BAT for FQ allergy must be optimized for each drug, taking into account possible differences in the stimulation mechanism that leads to the upregulation of different activation markers.\n\nKeywords\nanaphylactic shockanaphylaxisbasophilsfluoroquinolonesimmediate hypersensitivity reactionsOPEN-ACCESSTRUE\n==== Body\n1 Introduction\nFluoroquinolones (FQs) are generally considered well-tolerated antibiotics[1] and have been used for over 30 years to treat a wide range of infections. Their consumption is increasing, particularly for certain derivatives like ciprofloxacin (CIP) and more recently moxifloxacin (MOX).[2] This has led to an increase in allergic reactions and they are now the non-betalactam antibiotics most frequently involved in allergic drug reactions.[3–6] Most of these reactions are thought to be IgE-mediated, being anaphylaxis and urticaria the most frequently reported,[7–12] but since the introduction of MOX, more severe reactions, such as anaphylactic shock, have been reported.[8,13] This FQ has been shown to be involved in >60% of severe reactions.[11]\n\nImmediate allergic reactions to FQs are difficult to diagnose, and the value of skin testing is controversial. Although some consider the test useful,[6,9,14,15] most studies show that FQs induce false-positive results,[7,10,16,17] probably because of the capacity of some FQs to directly induce histamine release.[10,14] Therefore, the only test available to diagnose these patients is the drug provocation test (DPT), which is not risk-free[7,11,12] especially for severe reactions and older patients. There is a strong need for a biological test with adequate sensitivity.\n\nTo this end, the sepharose radioimmunoassay (Sepharose-RIA) has been assessed by some groups for evaluating immediate reactions to FQs; however, sensitivity ranges from 30% to 55%,[7,11] results that can be explained by differences in the FQ involved and the severity of the reaction. More recently, studies have shown the utility of the basophil activation test (BAT) for evaluating FQ-allergic reactions[6,10,11,18,19] with sensitivity ranging from 50% to 100%,[11,18] which can be explained by different factors. One of these factors is the type of reaction that, as occurs with Sepharose-RIA, could influence the results, being in some studies mainly anaphylactic shock,[18] whereas in others, the reactions were less severe such as anaphylaxis and urticaria.[6,11] Sensitivity is also affected by both the FQs involved in the reaction and the FQs used for the test. It has been observed that basophil activation is higher with CIP than with MOX,[11] which was in part explained by the FQs that originally sensitized the patients.[11] However, it can also be explained by other intrinsic technical issues such as patient treatment, that is, systemic steroids and cyclosporin A.[20,21] In addition, it can be influenced by the fast photodegradation of MOX, even in laboratory conditions, which influences the formation of drug–protein conjugates interfering with basophil activation.[22] Finally, another factor that can influence the FQ BAT results could be the choice of activation markers, CD203c[18] and CD63,[10,11,22] as has been demonstrated for amoxicillin[23] and neuromuscular blocking agents.[24]\n\nOf the different basophil activation markers identified, CD63, a member of the transmembrane-4 superfamily anchored in the intracellular granules that are exposed in cellular surface after the degranulation process,[25] is the most highly validated,[25,26] although CD203c, constitutively expressed on the surface of resting basophils[27] and upregulated after stimulation,[28] has been also shown to be reliable.[23,29] Both markers are related with degranulation and histamine release, but with 2 different mechanisms proposed, anaphylactic and piecemeal. The former is characterized by the fusion of the granules to the plasma membrane to expel their contents and leads to the exposition of CD63[30]; in piecemeal degranulation, small vesicles are formed from the histamine-containing granules and gradually shuttled to the plasma membrane. This is associated with the upregulation of CD203c.[31] It is also possible that different drugs interact with basophils in different ways, activating 1 of these 2 pathways specifically. Another difference between these 2 markers is that CD203c is constitutively expressed in basophils and increases in expression after activation, whereas CD63 is expressed only after activation.[32] Both markers have advantages and disadvantages: CD203c is specific to basophils; however, the increase in its expression is sometimes difficult to assess, owing to low changes mainly when evaluating drug hypersensitivity, or the induction of nonspecific increases when using interleukin-3 for priming basophils,[33] as well as aspects of cells manipulation during the testing procedure.[30]\n\nOn the contrary, CD63 shows a bimodal expression, making it easier to measure; however, it is expressed not only in basophils but also in platelets.\n\nIn this study, we evaluated basophil response for 17 patients with confirmed immediate allergic reactions to FQs using 2 different activation markers CD63 and CD203c. We find that the upregulation of these markers depends on both the FQs used and the severity of the reaction.\n\n2 Methods\n2.1 Patients and controls\nIn this retrospective study, all patients referred to the Allergy Service of Regional University Hospital of Malaga, over a 3-year period (2013–2015) with an immediate allergic reaction after administration of a FQ derivative, were initially eligible for inclusion. Different clinical categories were established: anaphylaxis and anaphylactic shock, defined according to the criteria of Sampson,[34] and urticaria when manifestations were limited to the skin and consisted of pruritic, erythematous cutaneous elevations that blanched with pressure at various sites on the body. In the allergological work-up, skin testing was not performed because of its low sensitivity and specificity.[35] For ethical reasons, patients with anaphylaxis and anaphylactic shock were considered allergic from clinical history, once other possible causes were ruled out. In those with urticaria, a DPT was performed to confirm the diagnosis. The controls consisted of 18 cases with confirmed good tolerance to quinolones. None of the patients or controls received treatment with systemic corticoids or cyclosporine during the study.\n\nThe study was conducted according to the declaration of Helsinki and all patients and controls participating in the study gave their informed consent and protocols were approved by institutional ethical committees (Ethical Committee of Malaga).\n\n2.2 DPT\nSingle-blind placebo-controlled DPT was carried out using CIP (Ciprofloxacino Normon, Madrid, Spain) or MOX (Actira, Bayer, Barcelona, Spain) under strict hospital surveillance, as described.[11] The suspected quinolone was administered at 30-minute intervals in increasing doses until reaching the full therapeutic dose or symptoms of a drug reaction occurred. For CIP, the doses administered were 5, 50, 100, 150, and 200 mg (cumulative dose of 505 mg), followed by ambulatory therapeutical doses for 2 days and for MOX 5, 50, 100, 100, and 150 mg (cumulative dose of 405 mg), and followed by ambulatory therapeutical doses for 2 days.\n\n2.3 Basophil activation by flow cytometry\nBAT was a in-house-made test performed as previously described[36] with different concentrations of quinolones: MOX at 0.2 and 0.1 mg/mL, and CIP at 2 and 0.2 mg/mL (all from Sigma Aldrich, Saint Louis, MO). The optimal concentrations for each drug were chosen based on dose–response curves and cytotoxicity.[11] The samples were incubated while protected from light for 30 minutes at 37°C in a water bath to prevent FQ photodegradation.[22] Cells were stained with monoclonal antibodies, anti-CD63-FITC, CD203c-PE, CCR3-APC (Caltag Laboratories, Burlingame, CA) and acquired in a FACSCalibur flow cytometer (Becton-Dickinson Bioscience, San Jose, CA) by acquiring at least 500 to 1000 basophils per sample, selected as CCR3+ cells (Fig S1). Results were analyzed at blind by 2 independent well-trained researchers with FlowJo software (FlowJo LLC, Ashland, OR) and activation expressed as percentage of CD63 or percentage of CD203c and as stimulation index (SI). SI was calculated as the ratio between the percentage of activated basophils (CD63+ or CD203c+ cells) in samples stimulated with the different haptens and the unstimulated sample. The percentage of spontaneously activated basophils (unstimulated sample) was required to be ≥5% to calculate the SI, as previously described.[36]\n\n2.4 Statistical analysis\nComparisons of quantitative variables without a normal distribution were done by the Mann–Whitney and Kruskall–Wallis tests. Comparisons of qualitative variables were done by means of the χ2 test. Correlation was measured using Spearman rank correlation coefficient. All reported P values represent 2-tailed tests, with values <0.05 considered statistically significant. The R Project software 3.1.2 was used for the analysis.\n\n3 Results\nThe study included 17 patients with confirmed immediate allergic reactions to FQ (Table 1). Thirteen were women (76.5%) and the median age was 65 (interquartile range [IR]: 48–80) years. The median time interval between the reaction and the study was 11.12 (IR: 1–84) months. The drugs involved were MOX for 11 (64.7%) and CIP for 6 (35.3%) patients. The clinical entities observed were anaphylactic shock in 5 (29.4%), anaphylaxis in 7 (41.2%), and urticaria in 5 cases (29.4%). Significant differences in clinical manifestation were found in different groups depending on the culprit FQ (P = 0.006) as in all patients with anaphylactic shocks the culprit FQ was MOX (45.5%). In those cases with urticaria, the diagnosis was confirmed by a DPT. A control group of 18 sex- and age-matched tolerant subjects was also included.\n\nTable 1 Clinical characteristics of patients included in the study.\n\n3.1 CD63 and CD203c upregulation\nHigher expression of CD63 was observed for all FQs and concentrations tested, although differences were only significant at 0.2 mg/mL for CIP and MOX when data were analyzed in terms of percentage (P = 0.04 for MOX; P = 0.01 for CIP) (Fig. 1A) and SI (P = 0.03 for MOX; P = 0.04 for CIP) (Fig. 1C). In allergic patients, CIP could upregulate both CD63 and CD203c, although the percentage of cells expressing CD63hi was significantly higher compared to CD203chi (P = 0.005). These differences were not detected with MOX (Fig. 1B). Equivalent results were observed for SI (P = 0.01) (Fig. 1D).\n\nFigure 1 Basophil activation test (BAT) results in fluoroquinolone (FQ)-allergic patients and controls. Comparison of expression levels for CD63 and CD203c as (A) percentage of activated cells in controls; (B) stimulation index (SI) in controls; (C) percentage of activated cells in FQ-allergic patients; (D) SI in FQ-allergic patients, represented as individual data points. Lines represent the mean of all data. Wilcoxon matched-pair tests were performed.\n\nClassifying the patients according to the culprit FQ, we observed a significantly higher basophil expression of CD63 after CIP stimulation in patients allergic to this FQ (P = 0.002) compared with MOX-allergic patients (Fig. 2A), with similar results found using SI (P = 0.002) (Fig. 2B). Regarding CD203c, the highest values were obtained for MOX-allergic patients using the same FQ for the test, although the differences were not significant (Fig. 2A and B).\n\nFigure 2 Comparisons of BAT results in CIP and MOX allergic patients as (A) percentage of cells expressing CD63 or upregulating CD203c and (B) stimulation index (SI) calculated with %CD63 and %CD203c. Box plots represent the median and IQR. Statistical Mann-Whitney U tests were performed. (C) Differences in activation marker up-regulation in BAT positive MOX allergic patients. Bars represent the mean and SEM of the percentage of cells expressing CD63 or CD203c in MOX allergic patients with positive BAT, discriminating between the types of reaction: Anaphylactic Shock or Anaphylaxis.\n\nIn terms of the relation between the upregulated marker and the clinical entity, we analyzed MOX-allergic patients, the only group that included patients suffering from anaphylactic shock, anaphylaxis, and urticaria. We observed an increase in the percentage of cells that upregulate CD203c in the patients with anaphylactic shock and in the percentage of cells that upregulate CD63 in patients with anaphylaxis (Table 2), although these differences were not significant. However, when the same analysis was done including only positive patients, we observed a higher increase in CD203c in the anaphylactic shock patients compared with CD63, whereas in patients suffering from anaphylaxis, we observed an increase in CD63 cells (Fig. 2C). No positive BAT was found in urticaria patients. Moreover, we compared the expression of activation markers, CD63 and CD203c, in the 2 most frequent clinical entities, anaphylaxis and urticaria, obtained after incubation with their respective culprit FQ. Data showed a higher expression of CD63 independently of the clinical entities and the FQ involved in the reaction (Fig. S2).\n\nTable 2 BAT results in moxifloxacin and ciprofloxacin allergic patients. Data represent means ± SEM.\n\n3.2 Sensitivity and specificity\nWe assessed 2 different SI cutoff points, 2 and 3, with results showing a better sensitivity–specificity with a cutoff of 3 and using the culprit FQ. Using CD203c as activation marker for MOX-allergic patients gave sensitivity = 36.4%; specificity = 94.4%; using CD63 for CIP-allergic patients gave sensitivity = 83.3%; specificity = 88.9% (Table 3).\n\nTable 3 Sensitivity and specificity of BAT using 2 different stimulation index cutoffs.\n\n3.3 Correlation between CD63 and CD203c activation markers\nExpression of both markers, CD63 and CD203c, showed a positive correlation (Spearman r = 0.671; P < 0.001) in the whole group of FQ-allergic patients, indicating that both are valid markers in BAT (Fig. 3). Significant correlations between the 2 markers were also obtained for MOX-allergic patients (Spearman r = 0.725; P < 0.001) (Fig. S3A) for anaphylactic shock (Spearman r = 0.661; P = 0.007) (Fig. S3B) and anaphylaxis (Spearman r = 0.923; P < 0.001) (Fig. S3C). The slope was more pronounced in the anaphylactic shock patients showing the relevance of CD203c in this diagnosis.\n\nFigure 3 Correlation between CD63 and CD203c expression in FQ-allergic patients. Each point represents an individual patient for a given drug concentration.\n\nWe have also analyzed the effect of the time interval between the reaction occurrence and the performance of the test in the upregulation of basophil activation markers, finding a negative correlation for both markers (Spearman r = −0.446; P < 0.001 for CD63 and Spearman r = −0.386; P < 0.001 for CD203c) (Fig. S4A and S4B). This seems to be more important for MOX-allergic patients, and their best marker CD203c, with a higher negative correlation with the time interval (Spearman r = −0.646; P < 0.001) (Fig. S4C).\n\n4 Discussion\nIn the last decade, increased consumption of FQs has led to more allergic reactions to these drugs and increased severity.[3,8,11] Diagnosis is difficult owing to the low value of skin testing,[6,7,9,10,14–17] as some FQs have the capacity to induce direct histamine release.[17] In fact, it has been described that a mast cell receptor, MRGPRX2, can be activated nonspecifically by FQs, inducing degranulation and release of histamine, β-hexosaminidase, tumor necrosis factor, and PGD2 among others, being probably one of the reason for false-positive results in skin tests.[37] BAT with FQ[6,10,11,18] has been used for diagnosis with sensitivity ranging from 50%[19] to 100%[18] and specificity from 80%[11] to 100%.[6,18] These differences may be because of the number of patients,[10,18] culprit FQ, the clinical manifestations, with only 2 studies including patients with anaphylactic shock,[11,18] and the activation markers used. In this work, we have analyzed 2 different basophil activation markers, CD63 and CD203c, to diagnose immediate reactions to MOX and CIP in a well-characterized population with a high proportion of severe reactions, including anaphylaxis and anaphylactic shock (70.6% of cases). As reported in previous studies,[8,11,12] we have detected that anaphylactic shock only occurred in MOX-allergic patients (45.5% of these reactions). Interestingly, we have found that the use of each FQ, MOX, or CIP in the BAT mainly induces the upregulation of a specific activation marker, CD63 or CD203c, which could be related to the severity of the reaction; however, further analysis with larger number of patients should be carried out to confirm this observation.\n\nAlthough mast cells have been considered the primary effector cells in IgE-mediated reactions, basophils also play an important role in the development of an early immune response[38,39] and constitute an important target for the in vitro evaluation of these reactions. CD63, the most widely used activation marker,[25] is exposed at the cellular surface after the degranulation processes,[25] whereas CD203c is constitutively expressed on the surface of resting basophils[27] and upregulated after stimulation.[28] Although both markers were correlated in expression when considering all patients, our results showed differences related to the FQs used in the test. We found that CIP induced a greater upregulation of CD63, whereas MOX preferentially upregulated CD203c. A similar pattern can be found for other drugs: Abuaf et al[23] (2008) found that CD203c seems to have more sensitivity for the detection of amoxicillin-activated basophils, but CD63 had more sensitivity in patients with anaphylaxis to muscle relaxants.[24] Differences have also been described for allergens: CD203c is a better marker for latex allergy[40]; CD63 is more specific but CD203c more sensitive for bee or wasp allergy[32]; and both can be reliable markers for cat allergy diagnosis.[29] These studies suggest that different basophil activation pathways exist depending on the culprit.\n\nOther explanations for these differences could be based on the existence of different activation mechanisms related to the clinical entity. Analyzing MOX-allergic patients, the only group containing patients suffering from all 3 clinical entities, we have observed differences in the upregulated marker: in patients who suffered anaphylactic shock, an upregulation of CD203c was found, whereas patients with anaphylaxis showed a CD63 upregulation. These markers are differentially located in the cell, CD203c molecules in vesicles near the membrane, whereas CD63 is stored in granules.[32] These molecules might be related to the 2 potential degranulation pathways, piecemeal and anaphylactic. In piecemeal degranulation, small vesicles from the histamine-containing granules are formed and rapidly shuttled to the plasma membrane.[30,31] This process could lead to the upregulation of CD203c, present in other small vesicles distinct from histamine-containing granules,[33] and may be linked to stimulation by certain drugs and the development of severe reactions like anaphylactic shock.[18] In the second mechanism, anaphylactic degranulation, the main granules are fused to the plasma membrane, releasing the entire contents to the extracellular space. CD63, present in the membrane of these granules, is thus exposed on the surface of basophils.[33] This process is slower than piecemeal degranulation and could be related to the development of anaphylaxis or urticaria.[8]\n\nThe time interval between reaction occurrence and the BAT performance should also be considered. We have found negative correlations between the 2 markers, CD63 and CD203c, and the time interval. This agrees with results for other drugs, wherein a rapid negativization of the test has been found several months after the reaction occurred, owing to the loss of drug-specific IgE in non-reexposed patients,[41,42] and highlights the importance of performing BAT soon after the reaction.\n\nFinally, we found better results for sensitivity and specificity using an SI cutoff of 3 and using the culprit drug for the test. However, the activation marker must be different for each drug: CD203c for MOX- and CD63 for CIP-allergic patients. Moreover, it is important to take into account the type of reaction: it is important to include CD203c in addition to CD63 when evaluating anaphylactic shock, whereas CD63 seems to be more related to anaphylactic reactions, as has been previously reported.[11]\n\nIn conclusion, the performance of BAT for drug allergy must be optimized for each drug, taking into account the possible differences in the stimulation mechanism that leads to the upregulation of different activation markers, influencing BAT results.\n\nAcknowledgements\nThe authors thank James R Perkins for help with English language, Ana Molina for help with the laboratory work and IBIMA major statistics service for help with statistical analysis.\n\nSupplementary Material\nSupplemental Digital Content\n Abbreviations: BAT = basophil activation test, CIP = ciprofloxacin, DPT = drug provocation test, FQ = fluoroquinolones, MOX = moxifloxacin, SI = stimulation index.\n\nFunding: This work was supported by the Institute of Health “Carlos III” of the Ministry of Economy and Competitiveness (grants cofounded by European Regional Development Fund (ERDF): PI12/02529, Red de Reacciones Adversas a Alergenos y Farmacos (RD12/0013/0001). Andalusian Regional Ministry of Economy and Knowledge (grants cofounded by European Regional Development Fund (ERDF): (CTS-06603); Andalusian Regional Ministry Health (grants: PI-0545–2010, PI-0699-2011, and PI-0179-2014). AA holds an Andalucía Talent Hub Fellowship (TAHUB/II-004) cofunded by The Junta de Andalucia and the UE, VII Framework Programme of the European Commision (Grant Agreement n° 291780). TDF hold a ‘Ramon y Cajal’ research contract by Ministry of Economy and Competitiveness (RYC-2013-13138), MIM hold a Miguel Servet I’ research contract by Institute of Health “Carlos III” of the Ministry of Economy and Competitiveness (CP15/00103) (grants cofounded by European Social Fund (ESF): CP14/00034 and CP15/00103 respectively) and CM hold a ‘Nicolas Monardes’ research contract by Andalusian Regional Ministry Health: C-0044-2012.\n\nThe authors report no conflicts of interest.\n\nSupplemental Digital Content is available for this article.\n==== Refs\nReferences\n1 Van Bambeke F Tulkens PM \nSafety profile of the respiratory fluoroquinolone moxifloxacin: comparison with other fluoroquinolones and other antibacterial classes . Drug Safety \n2009 ; 32 :359 –378 .19419232 \n2 Ball P \nQuinolone generations: natural history or natural selection? \nJ Antimicrob Chemother \n2000 ; 46 \n(suppl T1) :17 –24 .10997595 \n3 Dona I Blanca-Lopez N Torres MJ \nDrug hypersensitivity reactions: response patterns, drug involved, and temporal variations in a large series of patients . J Investig Allergol Clin Immunol \n2012 ; 22 :363 –371 .\n4 Johannes CB Ziyadeh N Seeger JD \nIncidence of allergic reactions associated with antibacterial use in a large, managed care organisation . Drug Safety \n2007 ; 30 :705 –713 .17696583 \n5 Blanca-Lopez N Andreu I Torres Jaen MJ \nHypersensitivity reactions to quinolones . Curr Opin Allerg Clin Immunol \n2011 ; 11 :285 –291 .\n6 Lobera T Audicana MT Alarcon E \nAllergy to quinolones: low cross-reactivity to levofloxacin . J Investig Allergol Clin Immunol \n2010 ; 20 :607 –611 .\n7 Manfredi M Severino M Testi S \nDetection of specific IgE to quinolones . J Allergy Clin Immunol \n2004 ; 113 :155 –160 .14713922 \n8 Sachs B Riegel S Seebeck J \nFluoroquinolone-associated anaphylaxis in spontaneous adverse drug reaction reports in Germany: differences in reporting rates between individual fluoroquinolones and occurrence after first-ever use . Drug Safety \n2006 ; 29 :1087 –1100 .17061914 \n9 Venturini Diaz M Lobera Labairu T del Pozo Gil MD \nIn vivo diagnostic tests in adverse reactions to quinolones . J Investig Allergol Clin Immunol \n2007 ; 17 :393 –398 .\n10 Seitz CS Brocker EB Trautmann A \nDiagnostic testing in suspected fluoroquinolone hypersensitivity . Clin Exp Allerg \n2009 ; 39 :1738 –1745 .\n11 Aranda A Mayorga C Ariza A \nIn vitro evaluation of IgE-mediated hypersensitivity reactions to quinolones . Allergy \n2011 ; 66 :247 –254 .20722637 \n12 Blanca-Lopez N Ariza A Dona I \nHypersensitivity reactions to fluoroquinolones: analysis of the factors involved . Clin Exp Allergy \n2013 ; 43 :560 –567 .23600547 \n13 Lapi F Tuccori M Motola D \nSafety profile of the fluoroquinolones: analysis of adverse drug reactions in relation to prescription data using four regional pharmacovigilance databases in Italy . Drug Safety \n2010 ; 33 :789 –799 .20701411 \n14 Gonzalez I Lobera T Blasco A \nImmediate hypersensitivity to quinolones: moxifloxacin cross-reactivity . J Investig Allergol Clin Immunol \n2005 ; 15 :146 –149 .\n15 Sanchez-Morillas L Rojas Perez-Ezquerra P Reano-Martos M \nSystemic anaphylaxis caused by moxifloxacin . Allergol Immunopathol \n2010 ; 38 :226 –227 .\n16 Empedrad R Darter AL Earl HS \nNonirritating intradermal skin test concentrations for commonly prescribed antibiotics . J Allergy Clin Immunol \n2003 ; 112 :629 –630 .13679828 \n17 Scherer K Bircher AJ \nHypersensitivity reactions to fluoroquinolones . Curr Allergy Asthma Rep \n2005 ; 5 :15 –21 .15659258 \n18 Ben Said B Berard F Bienvenu J \nUsefulness of basophil activation tests for the diagnosis of IgE-mediated allergy to quinolones . Allergy \n2010 ; 65 :535 –536 .19845576 \n19 Rouzaire P Nosbaum A Denis L \nNegativity of the basophil activation test in quinolone hypersensitivity: a breakthrough for provocation test decision-making . Int Arch Allergy Immunol \n2012 ; 157 :299 –302 .22041525 \n20 Sturm GJ Kranzelbinder B Sturm EM \nThe basophil activation test in the diagnosis of allergy: technical issues and critical factors . Allergy \n2009 ; 64 :1319 –1326 .19243362 \n21 Iqbal K Bhargava K Skov PS \nA positive serum basophil histamine release assay is a marker for ciclosporin-responsiveness in patients with chronic spontaneous urticaria . Clin Transl Allergy \n2012 ; 2 :19 .23025508 \n22 Mayorga C Andreu I Aranda A \nFluoroquinolone photodegradation influences specific basophil activation . Int Arch Allergy Immunol \n2013 ; 160 :377 –382 .23183272 \n23 Abuaf N Rostane H Rajoely B \nComparison of two basophil activation markers CD63 and CD203c in the diagnosis of amoxicillin allergy . Clin Exp Allergy \n2008 ; 38 :921 –928 .18331364 \n24 Sudheer PS Hall JE Read GF \nFlow cytometric investigation of peri-anaesthetic anaphylaxis using CD63 and CD203c . Anaesthesia \n2005 ; 60 :251 –256 .15710010 \n25 De Week AL Sanz ML Gamboa PM \nDiagnostic tests based on human basophils: more potentials and perspectives than pitfalls. II. Technical issues . J Investig Allergol Clin Immunol \n2008 ; 18 :143 –155 .\n26 Erdmann SM Sachs B Kwiecien R \nThe basophil activation test in wasp venom allergy: sensitivity, specificity and monitoring specific immunotherapy . Allergy \n2004 ; 59 :1102 –1109 .15355470 \n27 Ghannadan M Hauswirth AW Schernthaner GH \nDetection of novel CD antigens on the surface of human mast cells and basophils . Int Arch Allergy Immunol \n2002 ; 127 :299 –307 .12021549 \n28 Platz IJ Binder M Marxer A \nHymenoptera-venom-induced upregulation of the basophil activation marker ecto-nucleotide pyrophosphatase/phosphodiesterase 3 in sensitized individuals . Int Arch Allergy Immunol \n2001 ; 126 :335 –342 .11815741 \n29 Ocmant A Peignois Y Mulier S \nFlow cytometry for basophil activation markers: the measurement of CD203c up-regulation is as reliable as CD63 expression in the diagnosis of cat allergy . J Immunol Methods \n2007 ; 320 :40 –48 .17275019 \n30 MacGlashan D Jr \nExpression of CD203c and CD63 in human basophils: relationship to differential regulation of piecemeal and anaphylactic degranulation processes . Clin Exp Allergy \n2010 ; 40 :1365 –1377 .20633031 \n31 MacGlashan D Jr \nMarked differences in the signaling requirements for expression of CD203c and CD11b versus CD63 expression and histamine release in human basophils . Int Arch Allergy Immunol \n2012 ; 159 :243 –252 .22722613 \n32 Buhring HJ Streble A Valent P \nThe basophil-specific ectoenzyme E-NPP3 (CD203c) as a marker for cell activation and allergy diagnosis . Int Arch Allergy Immunol \n2004 ; 133 :317 –329 .15031605 \n33 MacGlashan DW Jr \nBasophil activation testing . J Allergy Clin Immunol \n2013 ; 132 :777 –787 .23958648 \n34 Sampson HA Munoz-Furlong A Campbell RL \nSecond symposium on the definition and management of anaphylaxis: sum∗mary report—Second National Institute of Allergy and Infectious Disease/Food Allergy and Anaphylaxis Network symposium . J Allergy Clin Immunol \n2006 ; 117 :391 –397 .16461139 \n35 Brockow K Garvey LH Aberer W \nSkin test concentrations for systemically administered drugs—an ENDA/EAACI Drug Allergy Interest Group position paper . Allergy \n2013 ; 68 :702 –712 .23617635 \n36 Gomez E Campo P Rondon C \nRole of the basophil activation test in the diagnosis of local allergic rhinitis . J Allergy Clin Immunol \n2013 ; 132 :975 –976 .e1–5 .24001803 \n37 McNeil BD Pundir P Meeker S \nIdentification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions . Nature \n2015 ; 519 :237 –241 .25517090 \n38 Sokol CL Chu NQ Yu S \nBasophils function as antigen-presenting cells for an allergen-induced T helper type 2 response . Nat Immunol \n2009 ; 10 :713 –720 .19465907 \n39 Perrigoue JG Saenz SA Siracusa MC \nMHC class II-dependent basophil-CD4+ T cell interactions promote T(H)2 cytokine-dependent immunity . Nature Immunol \n2009 ; 10 :697 –705 .19465906 \n40 Boumiza R Monneret G Forissier MF \nMarked improvement of the basophil activation test by detecting CD203c instead of CD63 . Clin Exp Allergy \n2003 ; 33 :259 –265 .12580920 \n41 Fernandez TD Torres MJ Blanca-Lopez N \nNegativization rates of IgE radioimmunoassay and basophil activation test in immediate reactions to penicillins . Allergy \n2009 ; 64 :242 –248 .19178404 \n42 Torres MJ Ariza A Mayorga C \nClavulanic acid can be the component in amoxicillin-clavulanic acid responsible for immediate hypersensitivity reactions . J Allergy Clin Immunol \n2010 ; 125 :502 –505 .e2 .20159266\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0025-7974",
"issue": "95(23)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000368:Aged; D000369:Aged, 80 and over; D001491:Basophils; D015415:Biomarkers; D005260:Female; D005434:Flow Cytometry; D024841:Fluoroquinolones; D005500:Follow-Up Studies; D006801:Humans; D006969:Hypersensitivity, Immediate; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D013997:Time Factors",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e3679",
"pmc": null,
"pmid": "27281069",
"pubdate": "2016-06",
"publication_types": "D016428:Journal Article",
"references": "24001803;15659258;15031605;25517090;17696583;23025508;12021549;18564624;22041525;11815741;14713922;12580920;21314003;22722613;20089346;13679828;17275019;15710010;16047716;23958648;18331364;17061914;19178404;20701411;19419232;23617635;20159266;23101312;21659860;23183272;20633031;19465907;23600547;20722637;10997595;19845576;19735271;16461139;19465906;15355470;19243362;18088022",
"title": "Hypersensitivity to fluoroquinolones: The expression of basophil activation markers depends on the clinical entity and the culprit fluoroquinolone.",
"title_normalized": "hypersensitivity to fluoroquinolones the expression of basophil activation markers depends on the clinical entity and the culprit fluoroquinolone"
} | [
{
"companynumb": "ES-OTONOMY INC.-2016OTO00026",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CIPROFLOXACIN"
},
"drugadditional": "3",
... |
{
"abstract": "Milk-Alkali syndrome (MAS) consists of a triad of hypercalcemia, metabolic alkalosis, and acute renal failure. We hereby report a 75-year-old Indian gentleman who presented to our emergency department with a history of generalized weakness and easy fatigability. Investigations were consistent with MAS secondary to calcium carbonate and calcitriol treatment to prevent osteoporosis, aggravated by H1N1 influenza vaccine. The patient was treated with hemodialysis and zoledronate. To our knowledge, this is the first reported case of such association in the literature.",
"affiliations": "Department of Internal Medicine, Division of Nephrology, King Fahd Hospital of the University, Al-Khobar, Saudi Arabia.;Department of Internal Medicine, Division of Nephrology, King Fahd Hospital of the University, Al-Khobar, Saudi Arabia.;Department of Internal Medicine, Division of Nephrology, King Fahd Hospital of the University, Al-Khobar, Saudi Arabia.;Department of Internal Medicine, Division of Nephrology, King Fahd Hospital of the University, Al-Khobar, Saudi Arabia.;Department of Internal Medicine, Division of Nephrology, King Fahd Hospital of the University, Al-Khobar, Saudi Arabia.",
"authors": "Al-Hwiesh|Abdullah K|AK|;Abdul-Rahman|Ibrahiem Saeed|IS|;Al-Oudah|Nadia|N|;Al-Solami|Sana|S|;Al-Muhanna|Fahd A|FA|",
"chemical_list": "D015415:Biomarkers; D050071:Bone Density Conservation Agents; D007252:Influenza Vaccines; D002117:Calcitriol; D002119:Calcium Carbonate; D002118:Calcium",
"country": "Saudi Arabia",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1319-2442",
"issue": "28(4)",
"journal": "Saudi journal of kidney diseases and transplantation : an official publication of the Saudi Center for Organ Transplantation, Saudi Arabia",
"keywords": null,
"medline_ta": "Saudi J Kidney Dis Transpl",
"mesh_terms": "D000368:Aged; D015415:Biomarkers; D050071:Bone Density Conservation Agents; D002117:Calcitriol; D002118:Calcium; D002119:Calcium Carbonate; D006801:Humans; D006934:Hypercalcemia; D053118:Influenza A Virus, H1N1 Subtype; D007252:Influenza Vaccines; D008297:Male; D006435:Renal Dialysis; D012307:Risk Factors; D016896:Treatment Outcome; D015854:Up-Regulation",
"nlm_unique_id": "9436968",
"other_id": null,
"pages": "912-915",
"pmc": null,
"pmid": "28748897",
"pubdate": "2017",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Milk-Alkali syndrome induced by H1N1 influenza vaccine.",
"title_normalized": "milk alkali syndrome induced by h1n1 influenza vaccine"
} | [
{
"companynumb": "PHHY2019SA165430",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "HYDROCHLOROTHIAZIDE\\VALSARTAN"
},
"drugadditional": n... |
{
"abstract": "Background and purpose To retrospectively evaluate locoregional control (LRC), survival and toxicity in anal cancer patients treated with simultaneous integrated boost - intensity modulated radiation therapy (SIB-IMRT) ± concurrent chemotherapy. Methods and materials Patients with squamous cell anal carcinoma stage T1(≥1 cm)-4, N0-3, M0-1 were included. All patients were treated with SIB-IMRT to a total dose of 59.4 Gy delivered to the primary tumor and macroscopically involved lymph nodes and 49.5 Gy to elective lymph node areas. If macroscopic residual tumor was still present in the fifth week of irradiation, a sequential boost of 5.4 Gy was given. Concurrent chemotherapy was administered in locally advanced cases. Acute and late toxicity were scored. Results One hundred and six patients treated consecutively between April 2006 and December 2012 were included. Eighty-seven (82.1%) patients received concurrent chemotherapy. The median follow-up was 47 months (range 2-104 months). Ninety-eight patients reached a clinical complete response (92.5%). Four-year actuarial LRC rate, overall survival and colostomy-free survival were 79%, 77% and 77%, respectively. Acute grade ≥3 toxicity occurred in 67.9% of the patients. Late grade 3 toxicity was seen in 16 patients (15.1%). Conclusions SIB-IMRT ± concurrent chemotherapy for anal cancer was effective with acceptable toxicity.",
"affiliations": "a Department of Radiation Oncology , The Netherlands Cancer Institute , Amsterdam , The Netherlands ;;b Division of Clinical Pharmacology, Department of Medical Oncology , The Netherlands Cancer Institute , Amsterdam , The Netherlands ;;a Department of Radiation Oncology , The Netherlands Cancer Institute , Amsterdam , The Netherlands ;;d Division of Gastroenterology and Hepatology, Department of Medical Oncology , The Netherlands Cancer Institute , Amsterdam , The Netherlands.;a Department of Radiation Oncology , The Netherlands Cancer Institute , Amsterdam , The Netherlands ;",
"authors": "Tomasoa|Nathalie B|NB|;Meulendijks|Didier|D|;Nijkamp|Jasper|J|;Cats|Annemieke|A|;Dewit|Luc|L|",
"chemical_list": "D000069287:Capecitabine; D005472:Fluorouracil",
"country": "England",
"delete": false,
"doi": "10.3109/0284186X.2015.1124141",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0284-186X",
"issue": "55(6)",
"journal": "Acta oncologica (Stockholm, Sweden)",
"keywords": null,
"medline_ta": "Acta Oncol",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D001005:Anus Neoplasms; D000069287:Capecitabine; D002294:Carcinoma, Squamous Cell; D059248:Chemoradiotherapy; D005260:Female; D005472:Fluorouracil; D005500:Follow-Up Studies; D006801:Humans; D008297:Male; D050397:Radiotherapy, Intensity-Modulated; D016896:Treatment Outcome",
"nlm_unique_id": "8709065",
"other_id": null,
"pages": "760-6",
"pmc": null,
"pmid": "26878244",
"pubdate": "2016-06",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Clinical outcome in patients treated with simultaneous integrated boost - intensity modulated radiation therapy (SIB-IMRT) with and without concurrent chemotherapy for squamous cell carcinoma of the anal canal.",
"title_normalized": "clinical outcome in patients treated with simultaneous integrated boost intensity modulated radiation therapy sib imrt with and without concurrent chemotherapy for squamous cell carcinoma of the anal canal"
} | [
{
"companynumb": "NL-ACCORD-043760",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3",
"dru... |
{
"abstract": "BACKGROUND\nPenicillin skin testing has been validated in the evaluation of adult patients with penicillin allergy. However, the commercially available benzylpenicilloyl polylysine (Pre-Pen) is not indicated in the pediatric population. Moreover, the safety and validity of penicillin skin testing in the pediatric population has not been well studied.\n\n\nOBJECTIVE\nWe describe the safety and validity of penicillin skin testing in the evaluation of children with a history of penicillin allergy.\n\n\nMETHODS\nChildren (<18 years) with a history of penicillin allergy were evaluated with penicillin skin tests and were reviewed for basic demographics, penicillin skin test results, adverse drug reaction to penicillin after penicillin skin test, and adverse reaction to penicillin skin test. By using the χ(2) test, we compared the differences in the proportion of children and adults with a positive penicillin skin test. P value (<.05) was considered statistically significant. The institutional review board approved the study, and all the subjects signed written informed consents.\n\n\nRESULTS\nA total of 778 children underwent penicillin skin testing; 703 of 778 patients had a negative penicillin skin test (90.4%), 66 had a positive test (8.5%), and 9 had an equivocal test (1.1%). Children were more likely to have a positive penicillin skin test (P < .0001) compared with adults (64 of 1759 [3.6%]); 369 of 703 patients with negative penicillin skin test (52%) were challenged with penicillin, and 14 of 369 patients (3.8%) had an adverse drug reaction. No adverse reactions to penicillin skin testing were observed.\n\n\nCONCLUSIONS\nPenicillin skin testing was safe and effective in the evaluation of children with a history of penicillin allergy.",
"affiliations": "Division of Allergic Diseases, Mayo Clinic, Rochester, Minn.;Division of Allergic Diseases, Mayo Clinic, Rochester, Minn. Electronic address: park.miguel@mayo.edu.",
"authors": "Fox|Stephanie J|SJ|;Park|Miguel A|MA|",
"chemical_list": "D044482:Benzeneacetamides; D010406:Penicillins; C509029:benzylpenicilloyl G polylysine; D010400:Penicillin G",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "2(4)",
"journal": "The journal of allergy and clinical immunology. In practice",
"keywords": "Adverse drug reaction; Pediatric; Penicillin allergy; Penicillin skin testing; Safe",
"medline_ta": "J Allergy Clin Immunol Pract",
"mesh_terms": "D000368:Aged; D044482:Benzeneacetamides; D002648:Child; D002675:Child, Preschool; D000075202:Contraindications; D004342:Drug Hypersensitivity; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D008875:Middle Aged; D010400:Penicillin G; D010406:Penicillins; D012882:Skin Tests",
"nlm_unique_id": "101597220",
"other_id": null,
"pages": "439-44",
"pmc": null,
"pmid": "25017533",
"pubdate": "2014",
"publication_types": "D023362:Evaluation Study; D016428:Journal Article",
"references": null,
"title": "Penicillin skin testing is a safe and effective tool for evaluating penicillin allergy in the pediatric population.",
"title_normalized": "penicillin skin testing is a safe and effective tool for evaluating penicillin allergy in the pediatric population"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/14/0043391",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "AMOXICILLIN"
},
"drugadditional": null,... |
{
"abstract": "BACKGROUND\nCurrent first-line anti-proteinuric treatments for nephrotic syndrome (NS) do not produce an effective response in all patients and are not tolerated by some patients. Additional effective and tolerable treatment options in NS are strongly needed. This retrospective case series is the largest to date to examine Acthar gel (adrenocorticotropic hormone, ACTH) in patients with varied-etiology NS.\n\n\nMETHODS\nThis multicenter retrospective case series included adult patients with NS (N = 44) treated with Acthar gel at 6 clinical practices. NS etiologies included idiopathic focal segmental glomerulosclerosis (FSGS, 15), idiopathic membranous nephropathy (iMN, 11), IgA nephropathy (IgAN, 5), diabetic nephropathy (DN, 4), systemic lupus erythematosus class V membranous lupus nephritis (MLN, 2), minimal change disease (MCD, 2), membranoproliferative glomerulonephritis (MPGN, 1), fibrillary glomerulonephritis (FGN, 1), and unbiopsied NS (3). Proteinuria response was assessed as percent reduction from baseline and percent of patients meeting complete remission (final proteinuria <500 mg/d), partial remission (≥50 % reduction in proteinuria from baseline and final proteinuria 500-3500 mg/d), clinical response (≥30 % reduction in proteinuria from baseline that did not meet criteria for complete or partial remission), and no response (failed to meet remission or clinical response criteria) following Acthar gel therapy. Safety and tolerability were examined using adverse event (AE) frequency reported by patients or treating nephrologists and frequency of early discontinuation of treatment due to AEs.\n\n\nRESULTS\n68.2 % (30/44) of patients had received prior NS treatment with immunosuppressive or cytotoxic therapies. Thirty-seven patients completed Acthar gel treatment. Seven patients (15.9 %) had early termination due to AEs, including weight gain (2), hypertension (2), edema (1), fatigue (1), seizures (1) and for reasons not stated (2). Proteinuria reduction ≥30 % was shown in 81.1 % (30/37) of patients and 62.2 % (23/37) showed ≥50 % proteinuria reduction. Proteinuria responses were greatest in MCD (n = 2/2 complete remission), MLN (n = 2/2 partial remission), MPGN (n = 1/1 partial remission), FSGS (n = 12/15 [80.0 %] partial remission or clinical response), and iMN (n = 8/11 [72.7 %] complete remission, partial remission, or clinical response).\n\n\nCONCLUSIONS\nActhar gel may meet an important treatment need in patients with treatment-resistant NS in response to first-line therapies, patients unable to tolerate first-line therapies, and in patients with advanced disease.",
"affiliations": "Nephrology Associates of Central Florida, 3885 Oakwater Circle, Orlando, FL, 32806, USA.;Albany Medical College, Albany, NY, USA.;HCA Inc. Physician Services, Salem, NH, USA.;Lankenau Medical Center, Wynnewood, PA, USA.;Nephrology Associates of Central Florida, 3885 Oakwater Circle, Orlando, FL, 32806, USA.;Nephrology Practice, 3366 NW Expressway, Bldg D, Suite 280, Oklahoma City, OK, 73112, USA. akhastgir@khastgirmedical.com.",
"authors": "Madan|Arvind|A|;Mijovic-Das|Snezana|S|;Stankovic|Ana|A|;Teehan|Geoffrey|G|;Milward|Amber S|AS|;Khastgir|Anupa|A|",
"chemical_list": "D005782:Gels; D006728:Hormones; D000324:Adrenocorticotropic Hormone",
"country": "England",
"delete": false,
"doi": "10.1186/s12882-016-0241-7",
"fulltext": "\n==== Front\nBMC NephrolBMC NephrolBMC Nephrology1471-2369BioMed Central London 24110.1186/s12882-016-0241-7Research ArticleActhar gel in the treatment of nephrotic syndrome: a multicenter retrospective case series Madan Arvind 407-851-5600amadan@nacfla.com Mijovic-Das Snezana anamijovic@yahoo.com Stankovic Ana md@anastankovic.com Teehan Geoffrey gteehan@comcast.net Milward Amber S. amberstar3130@gmail.com Khastgir Anupa 405-942-0379akhastgir@khastgirmedical.com Nephrology Associates of Central Florida, 3885 Oakwater Circle, Orlando, FL 32806 USA Albany Medical College, Albany, NY USA HCA Inc. Physician Services, Salem, NH USA Lankenau Medical Center, Wynnewood, PA USA Nephrology Practice, 3366 NW Expressway, Bldg D, Suite 280, Oklahoma City, OK 73112 USA 31 3 2016 31 3 2016 2016 17 3731 8 2015 15 3 2016 © Madan et al. 2016\nOpen AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nCurrent first-line anti-proteinuric treatments for nephrotic syndrome (NS) do not produce an effective response in all patients and are not tolerated by some patients. Additional effective and tolerable treatment options in NS are strongly needed. This retrospective case series is the largest to date to examine Acthar gel (adrenocorticotropic hormone, ACTH) in patients with varied-etiology NS.\n\nMethods\nThis multicenter retrospective case series included adult patients with NS (N = 44) treated with Acthar gel at 6 clinical practices. NS etiologies included idiopathic focal segmental glomerulosclerosis (FSGS, 15), idiopathic membranous nephropathy (iMN, 11), IgA nephropathy (IgAN, 5), diabetic nephropathy (DN, 4), systemic lupus erythematosus class V membranous lupus nephritis (MLN, 2), minimal change disease (MCD, 2), membranoproliferative glomerulonephritis (MPGN, 1), fibrillary glomerulonephritis (FGN, 1), and unbiopsied NS (3). Proteinuria response was assessed as percent reduction from baseline and percent of patients meeting complete remission (final proteinuria <500 mg/d), partial remission (≥50 % reduction in proteinuria from baseline and final proteinuria 500–3500 mg/d), clinical response (≥30 % reduction in proteinuria from baseline that did not meet criteria for complete or partial remission), and no response (failed to meet remission or clinical response criteria) following Acthar gel therapy. Safety and tolerability were examined using adverse event (AE) frequency reported by patients or treating nephrologists and frequency of early discontinuation of treatment due to AEs.\n\nResults\n68.2 % (30/44) of patients had received prior NS treatment with immunosuppressive or cytotoxic therapies. Thirty-seven patients completed Acthar gel treatment. Seven patients (15.9 %) had early termination due to AEs, including weight gain (2), hypertension (2), edema (1), fatigue (1), seizures (1) and for reasons not stated (2). Proteinuria reduction ≥30 % was shown in 81.1 % (30/37) of patients and 62.2 % (23/37) showed ≥50 % proteinuria reduction. Proteinuria responses were greatest in MCD (n = 2/2 complete remission), MLN (n = 2/2 partial remission), MPGN (n = 1/1 partial remission), FSGS (n = 12/15 [80.0 %] partial remission or clinical response), and iMN (n = 8/11 [72.7 %] complete remission, partial remission, or clinical response).\n\nConclusions\nActhar gel may meet an important treatment need in patients with treatment-resistant NS in response to first-line therapies, patients unable to tolerate first-line therapies, and in patients with advanced disease.\n\nKeywords\nACTHActhar gelNephrotic syndromeProteinuriaMallinckrodt ARDissue-copyright-statement© The Author(s) 2016\n==== Body\nBackground\nPatients with nephrotic syndrome (NS) show a combination of clinical and laboratory features of renal diseases characterized by heavy proteinuria, hypoalbuminemia, and peripheral edema, with hyperlipidemia also frequently seen. Effective treatment in patients who experience treatment resistance or relapse following initial immunosuppressive treatment with steroids or cytotoxic drugs is an ongoing challenge across NS etiologies [1–8]. There remains a strong need for effective, tolerable treatments for patients with treatment-resistant NS, particularly without the renal and extra-renal toxicities associated with many first- and second-line therapies [9]. One such treatment is H.P. Acthar® Gel (adrenocorticotropic hormone, repository corticotropin injection, Mallinckrodt ARD Inc., Hazelwood, MO), FDA-approved in the US to induce diuresis or remission of proteinuria in NS without uremia of the idiopathic type or that due to lupus erythematosus [10].\n\nAdrenocorticotropic hormone (ACTH) treatment for NS emerged in the US in the 1950s and was shown to be effective for reduction or remission of proteinuria, depending on the dose and duration of ACTH treatment [11, 12]. However, by the late 1960s ACTH had largely been replaced by steroids in NS treatment due to the convenience of oral dosing and the belief that they had similar mechanisms of action and treatment effects [13]. Acthar gel treatment for NS, the only FDA-approved ACTH treatment in the US, has recently re-emerged [14–20].\n\nThough current clinical data are limited, proteinuria reduction resulting in complete or partial remission following Acthar gel treatment has been shown in patients with idiopathic membranous nephropathy (iMN), idiopathic focal segmental glomerulosclerosis (FSGS), IgA nephropathy (IgAN), minimal change disease (MCD), and diabetic nephropathy (DN) [14–20]. Treatment regimens of 80 U Acthar gel twice weekly for 6 months were commonly used. One exception involved patients with iMN who received either a 40 U or 80 U dose twice weekly for either 3 months or 6 months, showing that greater reduction in proteinuria was associated with greater cumulative Acthar gel dose [19]. Additionally, patients with advanced DN were treated with Acthar gel 16 U or 32 U daily for 6 months [17].\n\nOur retrospective case series is the largest published to date to examine the efficacy and safety of Acthar gel treatment in patients with varied-etiology NS who have typically failed multiple previous therapies. Proteinuria reduction as well as frequency of adverse events (AEs) in patients treated with Acthar gel within clinical practices were evaluated.\n\nMethods\nPatients\nPatients eligible for inclusion were diagnosed with NS, ≥18 years old, received Acthar gel treatment for ≥6 months, and had assessment of either 24-h proteinuria level (mg/d) or urine protein:creatinine ratio (UPCR; g/g converted to mg/d) prior to and following 6 months of Acthar gel treatment. Patients did not have to meet a pre-specified level of proteinuria at baseline to be included in the study. NS etiologies within the patient cohort included idiopathic NS due to FSGS, MN, IgAN, MCD, membranoproliferative glomerulonephritis (MPGN), fibrillary glomerulonephritis (FGN), and 3 unbiopsied NS patients. Additionally, patients with systemic lupus erythematosus (SLE) class V membranous lupus nephritis (MLN), and patients receiving off-label treatment for NS due to DN were included. With the exception of the 3 unbiopsied patients, all patients had biopsy-confirmed NS etiology. The patient cohort represents all patients treated with Acthar gel from the participating clinical practices who met the specified inclusion criteria.\n\nEthics\nThis multicenter, retrospective case series of prescription-based treatment with Acthar gel for NS included 6 US clinical practices. The study received institutional review board exemption from the New England Institutional Review Board. All data reported in this paper have be de-identified in order to protect patient confidentiality.\n\nData reviewed\nClinical records were reviewed for demographic and clinical characteristics, including NS etiology, prior immunosuppressive or cytotoxic treatments, and levels of proteinuria, serum albumin, and total cholesterol. Hypoalbuminemia was defined as <3.5 g/dL. Renal function was evaluated using serum creatinine (SCr) level and renal insufficiency was defined as SCr >1.3 mg/dL. Acthar gel treatment dosing regimen and concomitant medications, including angiotensin II receptor blockers (ARBs), angiotensin-converting-enzyme inhibitors (ACEIs), and immunosuppressive and cytotoxic drugs, were documented.\n\nPost-treatment proteinuria level and percentage reduction in proteinuria from baseline were examined. Consistent with prior studies, complete remission was defined as final proteinuria <500 mg/d, and partial remission was defined as ≥50 % reduction in proteinuria from baseline and final proteinuria 500–3500 mg/d, with examination of preserved or improved renal function as indicated by SCr that does not worsen >25 % from baseline [14–16]. Clinical response was defined as ≥30 % reduction in proteinuria from baseline that did not meet criteria for complete or partial remission. Inclusion of the clinical response outcome aligns with the treatment suggestion for calcineurin inhibitors (CNIs) in patients with iMN, stating therapy should be continued in patients showing an initial substantial proteinuria reduction of 30–50 % at 4–6 months treatment because the optimal treatment duration with calcineurin inhibitors is unknown and the patient’s response suggests possible further proteinuria improvement with continued therapy [2]. The clinical response definition is also consistent with the clinical practice of the current study’s treating nephrologists when determining the duration of a trial of treatment in patients. That is, treatment is extended following a ≥30 % reduction in proteinuria because this degree of improvement has been experienced as a clinically meaningful change for patients. Patients showing no response failed to meet remission or clinical response criteria.\n\nThe frequency of AEs and the frequency of early discontinuation of treatment due to AEs were documented. Patients with an early termination of treatment without a stated reason were included in the count of early termination due to AEs.\n\nData analysis\nCategorical variables were summarized using counts and percentages. Descriptive statistics summarized continuous variables. Paired t-tests examined change from baseline to post-Acthar gel therapy in proteinuria level, serum albumin, and total cholesterol. Between-group t-tests were used to compare percent reduction in proteinuria in patients who showed renal insufficiency at baseline versus patients who did not show renal insufficiency. Statistical analyses were performed using SAS (version 9.1; SAS Institute, Cary, NC).\n\nResults\nStudy participants\nCharacteristics of patients by NS etiology group are presented in Table 1. Cases included 44 patients across NS etiologies FSGS (n = 15), iMN (n = 11), IgAN (n = 5), DN (n = 4), MLN (n = 2), MCD (n = 2), MPGN (n = 1), FGN, (n = 1), and 3 unbiopsied NS patients. The majority (30/44; 68.2 %) had failed ≥1 prior immunosuppressive or cytotoxic therapy, and 20 of 44 (45.5 %) had failed ≥2 prior immunosuppressive and/or cytotoxic treatments. All patients received Acthar gel 80 U twice weekly, with the exception of 1 patient with iMN who received 40 U twice weekly. Continuing treatment with standard care ARB and/or ACEI maximum blockade was received by 36/44 (81.8 %) patients (Tables 2, 3, 4 and 5; 12/15 FSGS, 9/11 iMN, 5/5 IgAN, 4/4 DN, 2/2 MLN, 2/2 MCD, 1/1 MPGN, 0/1 FGN, 1/3 unbiopsied NS) and dosing was maintained throughout the Acthar gel treatment period unless the patient required dose modification due to AEs.Table 1 Demographic and clinical characteristics of NS patients (N = 44) treated with Acthar gel\n\nNS etiology\tAge ± SD, years\tGender, n (%) female\tRace/ethnicity, n (%) White\tPrevious IST/CT, n (%) yes\t\nFSGS (n = 15)\t53.3 ± 12.9\t7 (47)\t12 (80)\t12 (80)\t\niMN (n = 11)\t53.6 ± 18.9\t4 (36)\t10 (91)\t10 (91)\t\nIgAN (n = 5)\t35.0 ± 8.4\t2 (40)\t4 (80)\t1 (20)\t\nDN (n = 4)\t54.0 ± 19.9\t2 (50)\t4 (100)\t0\t\nMLN (n = 2)\t37.5 ± 4.9\t1 (50)\t0\t2 (100)\t\nMCD (n = 2)\t33.5 ± 13.4\t2 (100)\t2 (100)\t2 (100)\t\nFGN (n = 1)\t63.0\t0\t1 (100)\t1 (100)\t\nMPGN (n = 1)\t22.0\t1 (100)\t1 (100)\t0\t\nOthera (n = 3)\t55.7 ± 6.1\t2 (67)\t2 (67)\t2 (67)\t\n\nAbbreviations: CT cytotoxic therapy, DN diabetic nephropathy, FGN fibrillary glomerulonephritis, FSGS idiopathic focal segmental glomerulosclerosis, IgAN IgA nephropathy, iMN idiopathic membranous nephropathy, IST immunosuppressive therapy, MCD minimal change disease, MLN membranous lupus nephritis (class V), MPGN membranoproliferative glomerulonephritis, NS nephrotic syndrome\n\n\na“Other” includes 3 patients with unbiopsied NS\n\nTable 2 Proteinuria reduction and treatment response in patients with FSGS treated with Acthar gel\n\nPatient\tPrevious IST/CT\tConcurrent medications\tSerum albumin\tSCr\tProteinuria\tTreatment response\t\nPre-Acthar\tPre-Acthar\t\nPre-Acthar\tPost-Acthar % change (mg/dL)\tPost-Acthar % change (mg/d)\t\t\nPost-Acthar (g/dL)\t\t\n1\tPrednisone, cyclosporine, cyclophosphamide\tACEI, cyclosporine\t1.7\t1.7\t6700\tPartial remission\t\n2.7\t1.6\t3300\t\n−5.9\t−50.7\t\n2\tPrednisone, cyclosporine, MMF, tacrolimus, rituximab\tTacrolimus, MMF\t3.0\t0.9\t5800\tPartial remission\t\n3.4\t0.8\t2016\t\n−11.1\t−65.2\t\n3\tPrednisone\tNone\t3.2\t2.2\t5000\tClinical response\t\n3.8\t2.2\t3422\t\n0\t−31.6\t\n4\tNone\tARB\t3.9\t4.8\t7900\tPartial remission\t\n4.0\t6.7\t2300\t\n39.6\t−70.9\t\n5\tNone\tARB\t3.2\t3.2\t3840\tEarly termination\t\nNA\tNA\tNA\t\nNA\tNA\t\n6\tPrednisone, cyclosporine\tARB, ACEI cyclosporine\t2.8\t3.0\t7500\tPartial remission\t\n3.9\t2.5\t1768\t\n−16.7\t−76.4\t\n7\tPrednisone, cyclosporine\tARB, ACEI cyclosporine\t3.1\t1.1\t5280\tClinical response\t\n3.6\t1.3\t3560\t\n18.2\t−32.6\t\n8\tNone\tACEI\tNA\t1.2\t4000\tPartial remission\t\nNA\t1.1\t765\t\n−8.3\t−80.9\t\n9\tPrednisolone, methotrexate\tACEI, prednisolone\t3.1\t1.6\t9306\tPartial remission\t\n3.3\t2.0\t2773\t\n25.0\t−70.2\t\n10\tMMF\tACEI, MMF\tNA\t4.4\t2830\tClinical response\t\n4.0\t5.0\t1629\t\n13.6\t−42.4\t\n11\tPrednisone\tARB\t3.5\t2.4\t3500\tPartial remission\t\n3.7\t3.1\t750\t\n29.2\t−78.6\t\n12\tPrednisone\tACEI\t3.8\t1.5\t5700\tEarly termination (Partial remission)\t\n4.0\t1.2\t1500a\n\t\n−20.0\t−73.7\t\n13\tPrednisone, cyclosporine\tNone\t3.2\t3.1\t3250\tClinical response\t\n3.5\t4.1\t2073\t\n32.3\t−36.2\t\n14\tPrednisone, cyclosporine\tACEI\t3.7\t2.5\t2500\tPartial remission\t\nNA\t3.0\t1246\t\n20.0\t−50.2\t\n15\tPrednisone, cyclosporine, MMF\tACEI\t3.6\t1.4\t4070\tNo response\t\n3.3\t1.5\t3930\t\n7.1\t−3.4\t\n\nAbbreviations: ACEI angiotensin-converting-enzyme inhibitor, ARB angiotensin II receptor blockers, CT cytotoxic therapy, FSGS idiopathic focal segmental glomerulosclerosis, IST immunosuppressive therapy, MMF mycophenolate mofetil, NA not available\n\n\naPost-Acthar gel assessment occurred following 4 months of treatment\n\nTable 3 Proteinuria reduction and treatment response in patients with iMN treated with Acthar gel\n\nPatient\tPrevious IST/CT\tConcurrent medications\tSerum albumin\tSCr\tProteinuria\tTreatment response\t\nPre-Acthar\tPre-Acthar\t\nPre-Acthar\tPost-Acthar % change (mg/dL)\tPost-Acthar % change (mg/d)\t\nPost-Acthar (g/dL)\t\n1\tPrednisone, cyclophosphamide, rituximab\tARB, ACEI\t2.7\t1.3\t13,600\tClinical response\t\n3.2\t1.3\t6600\t\n0\t−51.5\t\n2\tPrednisone, IVMP\tPrednisone\t1.4\t1.2\t6354\tPartial remission\t\n3.3\t1.1\t1000\t\n−8.3\t−84.3\t\n3\tNone\tNone\t1.5\t2.5\t15,400\tPartial remission\t\n3.1\t1.9\t2376\t\n−24.0\t−84.6\t\n4\tPrednisone, cyclosporine\tACE\t1.6\t1.9\t10,000\tClinical response\t\n2.1\t1.9\t4000\t\n0\t−60.0\t\n5\tPrednisone\tARB, ACEI\t3.8\t1.9\t4000\tNo response\t\n3.7\t2.0\t3475\t\n5.3\t−13.1\t\n6\tTacrolimus\tACEI\t3.3\t1.0\t5500\tComplete remission\t\n3.4\t0.9\t349\t\n−10.0\t−93.7\t\n7\tPrednisone, tacrolimus, chlorambucil\tARB\t3.9\t0.9\t2400\tComplete remission\t\nTacrolimus\t4.0\t1.0\t163\t\n−11.1\t−93.2\t\n8\tPrednisone, cyclosporine\tACEI\t3.2\t1.3\t3070\tEarly termination\t\nNA\tNA\tNA\t\nNA\tNA\t\n9\tPrednisone, cyclosporine\tACEI\t3.8\t2.1\t1930\tPartial remission\t\n3.7\t2.2\t728\t\n4.8\t−62.3\t\n10\tPrednisone, tacrolimus, cyclophosphamide\tARB\t3.5\t1.3\t5210\tPartial remission\t\n3.7\t1.6\t1780\t\n23.1\t−65.8\t\n11\tPrednisone, IVMP, cyclophosphamide\tACEI\tNA\t3.3\t5132\tNo response\t\nNA\t3.8\t6600\t\n15.2\t28.6\t\n\nAbbreviations: ACEI angiotensin-converting-enzyme inhibitor, ARB angiotensin II receptor blockers, CT cytotoxic therapy, iMN idiopathic membranous nephropathy, IST immunosuppressive therapy, IVMP intravenous methylprednisolone, NA not available\n\nTable 4 Proteinuria reduction and treatment response in patients with IgA nephropathy/diabetic nephropathy treated with Acthar gel\n\nPatient\tPrevious IST/CT\tConcurrent medications\tSerum albumin\tSCr\tProteinuria\tTreatment response\t\nPre-Acthar\tPre-Acthar\tPre-Acthar\t\nPost-Acthar (g/dL)\tPost-Acthar % change (mg/dL)\tPost-Acthar % change (mg/d)\t\nIgAN\t\t\t\t\t\t\t\n 1\tNone\tARB, ACEI\t3.9\t2.8\t4000\tEarly termination\t\nNA\tNA\tNA\t\nNA\tNA\t\n 2\tNone\tARB, ACEI\t3.9\t1.4\t2674\tClinical response\t\nNA\t1.5\t1700\t\n7.1\t−36.4\t\n 3\tNone\tARB\t4.0\t1.3\t2439\tNo response\t\n3.6\t1.3\t2360\t\n0\t−3.2\t\n 4\tNone\tACEI\t3.0\t1.0\t10000\tEarly termination (Partial remission)\t\n4.0\t1.0\t800a\n\t\n0\t−92.0\t\n 5\tPrednisone, cyclophosphamide, azathioprine\tARB\tNA\t1.3\t2230\tPartial remission\t\n4.2\t1.3\t815\t\n0\t−63.5\t\nDN\t\t\t\t\t\t\t\n 1\tNone\tACEI\t2.0\t1.9\t25000\tNo response\t\n2.0\t4.9\t23000\t\n157.9\t−8.0\t\n 2\tNone\tARB, ACEI\t3.3\t3.4\t14000\tEarly termination\t\n3.3\t4.4\t11600a\n\t\n29.4\t−17.1\t\n 3\tNone\tACEI\t3.1\t4.8\t17570\tNo response\t\n2.8\t5.7\t18886\t\n18.8\t7.5\t\n 4\tNone\tACEI\t3.4\t2.5\t11000\tClinical response\t\n3.5\t2.5\t6895\t\n0\t−37.3\t\n\nAbbreviations: ACEI angiotensin-converting-enzyme inhibitor, ARB angiotensin II receptor blockers, CT cytotoxic therapy, DN diabetic nephropathy, IgAN IgA nephropathy, IST immunosuppressive therapy, MMF mycophenolate mofetil, NA not available\n\n\naPost-Acthar gel assessment occurred following 3 months of treatment\n\nTable 5 Proteinuria reduction and treatment response in patients treated with Acthar gel, by etiologic diagnosis\n\nPatient\tPrevious IST/CT\tConcurrent medications\tSerum albumin\tSCr\tProteinuria\tTreatment response\t\nPre-Acthar\tPre-Acthar\tPre-Acthar\t\nPost-Acthar (g/dL)\tPost-Acthar % change (mg/dL)\tPost-Acthar % change (mg/d)\t\nMLN\t\t\t\t\t\t\t\n 1\tPrednisone, cyclophosphamide\tACEI, prednisone\t1.8\t1.0\t8000\tPartial remission\t\n3.3\t0.8\t1089\t\n\t−20.0\t−86.4\t\n 2\tMMF\tACEI\t1.7\t1.0\t19890\tPartial remission\t\n2.4\t1.1\t2454\t\n10.0\t−87.7\t\nMCD\t\t\t\t\t\t\t\n 1\tPrednisone\tACEI\t3.7\t0.9\t2000\tComplete remission\t\n4.7\t1.2\t241\t\n33.0\t−88.0\t\n 2\tPrednisone, cyclosporine\tACEI\t2.1\t1.0\t15000\tComplete remission\t\n2.3\t0.7\t89\t\n−30.0\t−99.4\t\nFGN\tPrednisone, MMF, rituximab\tMMF\t1.4\t5.6\t13000\tNo response\t\n3.4\t9.0\t10000\t\n60.7\t−23.1\t\nMPGN\tNone\tACEI\t1.5\t0.7\t10000\tPartial remission\t\n3.3\t0.8\t2141\t\n14.3\t−78.6\t\nOTHERa\n\t\t\t\t\t\t\t\n 1 UNS\tPrednisone\tNone\t3.5\t1.6\t3000\tClinical response\t\n4.6\t2.2\t1600\t\n37.5\t−46.7\t\n 2 UNS\tPrednisone\tACEI\t3.5\t1.7\t4500\tPartial remission\t\n4.0\t1.9\t2000\t\n11.8\t−55.6\t\n 3 UNS\tNone\tNone\t3.1\t1.3\t5500\tEarly termination\t\n3.3\t1.3\tNA\t\n0\tNA\t\n\nAbbreviations: ACEI angiotensin-converting-enzyme inhibitor, ARB angiotensin II receptor blockers, FGN fibrillary glomerulonephritis, MCD minimal change disease, MLN membranous lupus nephritis (class V), MPGN membranoproliferative glomerulonephritis, NA not available, UNS unbiopsied nephrotic syndrome\n\n\na“Other” includes 3 patients with unbiopsied NS\n\n\n\nTotal group treatment response\nThere was significant proteinuria reduction from baseline to post-Acthar gel treatment (n = 40; mean reduction 3984.8 ± 4069.1 mg/d, P < 0.0001). Total cholesterol showed significant decline from baseline to post-Acthar gel therapy (n = 21; mean reduction 38.3 ± 58.8 mg/dL, P = 0.007). Mean serum albumin at baseline indicated hypoalbuminemia (n = 40, 3.0 ± 0.8 g/dL; range 1.4–4.0 g/dL), and significant improvement was shown post-Acthar gel therapy (n = 35; mean improvement 0.53 ± 0.6 g/dL, P < 0.0001).\n\nActhar gel treatment was completed by 37 patients, and 7 (15.9 %) patients had early termination of treatment due to AEs. Among the 37 treatment completers, 81.1 % (30/37) showed ≥30 % proteinuria reduction, and 62.2 % (23/37) showed ≥50 % proteinuria reduction. Proteinuria remission was shown by 56.8 % (21/37) of patients, either complete (n = 4, 10.8 %) or partial (n = 17, 45.9 %) remission. Inclusion of clinical response patients (n = 9) resulted in 81.1 % (30/37) of patients showing substantial proteinuria reduction. Of these patients, 80 % (24/30) had failed ≥1 and 53.3 % (16/30) had failed ≥2 prior immunosuppressive or cytotoxic therapies.\n\nAmong the 44 patients, 26 (59.1 %) showed SCr >1.3 mg/dL at baseline. There was a greater mean percent proteinuria reduction in patients with SCr ≤1.3 mg/dL (n = 14; 72.2 ± 26.9 % reduction) compared with patients showing SCr >1.3 mg/dL (n = 22; 41.0 ± 29.7 % reduction, P = 0.0031). Similarly, among patients showing complete or partial remission or clinical response, greater mean percent proteinuria reduction occurred in patients without renal function impairment (n = 13; 77.5 ± 19.0 % reduction) compared with SCr >1.3 mg/dL (n = 16; 55.6 ± 16.9 % reduction, P = 0.0029).\n\nTreatment response by NS etiology\nThe percentage of patients showing complete remission, partial remission, or clinical response to Acthar gel treatment varied across NS etiologies (Fig. 1). The highest proteinuria responses were seen in patients with MCD (n = 2/2 complete remission), MLN (n = 2/2 partial remission), MPGN (n = 1/1 partial remission), FSGS (n = 12/15 [80.0 %] partial remission or clinical response), and iMN (n = 8/11 [72.7 %] complete or partial remission or clinical response). Lower proteinuria responses were seen in patients with IgAN (n = 2/5 [40.0 %] partial remission or clinical response) and DN (n = 1/4 [25 %] clinical response). The single patient with FGN showed no response. Within the “Other” category of unbiopsied NS patients, 1 patient showed partial remission and 1 patient showed clinical response.Fig. 1 Treatment response in patients with NS treated with Acthar gel, by etiologic diagnosis. “Other” includes 3 patients with unbiopsied NS. Abbreviations: DN, diabetic nephropathy; FGN, fibrillary glomerulonephritis; FSGS, idiopathic focal segmental glomerulosclerosis; IgAN, IgA nephropathy; iMN, idiopathic membranous nephropathy; MCD, minimal change disease; MLN, membranous lupus nephritis (class V); MPGN, membranoproliferative glomerulonephritis\n\n\n\nFSGS\nFollowing Acthar gel, 86.7 % (13/15) of patients showed ≥30 % proteinuria reduction and 60 % (9/15) showed ≥50 % proteinuria reduction (Table 2). There was significant proteinuria reduction from baseline to post-Acthar gel treatment (n = 14; mean reduction 3021.7 ± 1970.6 mg/d, P < 0.0001). No patient showed complete remission; however, 9 (60 %) showed partial remission, and 4 (26.7 %) showed clinical responses ranging from 31.6–42.4 % proteinuria reduction. One patient showed no response, and 2 patients had early termination. The early termination for 1 patient was due to increased swelling; no reason was provided for the second patient, who achieved partial remission prior to termination of treatment. Renal insufficiency at baseline due to SCr >1.3 mg/dL was shown in 12/15 (80 %) patients. Among the Acthar gel treatment responders, worsening SCr >25 % was shown in 2 patients with partial remission and 1 patient with clinical response and all 3 patients had SCr >1.3 at baseline (Table 2). Total cholesterol significantly declined from baseline (n = 8; mean reduction 32.5 ± 28.9 mg/dL, P < 0.02), and serum albumin significantly increased (n = 11; mean increase 0.39 ± 0.4 g/dL, P = 0.009). Hypoalbuminemia was shown by 8/15 patients (53.3 %) at baseline (range 1.7–3.2 g/dL), and improved in 7 of these patients by post-treatment (range 2.7–3.9 g/dL).\n\niMN\nProteinuria reduction ≥50 % occurred in 72.7 % (8/11) of patients with iMN (Table 3). There was significant proteinuria reduction from baseline to post-Acthar gel treatment (n = 10; mean reduction 4245.5 ± 4085.5 mg/d, P = 0.009). Two patients (18.2 %) showed complete remission, 4 (36.4 %) showed partial remission, and 2 (18.2 %) showed clinical responses ranging from 51.5–60.0 % proteinuria reduction. Two patients showed no response (1 patient was diagnosed with iMN and FSGS), and 1 patient had early termination due to an AE involving fatigue. SCr >1.3 mg/dL was found in 5/11 patients (45.5 %) at baseline. The mean reduction in total cholesterol (n = 5; 9.4 ± 10.2 mg/dL) and increase in serum albumin (n = 9; 0.52 ± 0.7 g/dL) were not significant (P > 0.06). Hypoalbuminemia was shown by 6/11 patients (54.5 %) at baseline (range 1.4–3.3 g/dL), and 5 of these patients showed improvement post-treatment (range 2.1–3.4 g/dL).\n\nIgAN\nProteinuria reduction ≥30 % occurred in 60 % (3/5) of patients and 40 % (2/5) showed ≥50 % proteinuria reduction (Table 4). The mean proteinuria reduction (n = 4) was 2917.0 ± 4225.4 mg/d. Two patients showed partial remission and 1 patient showed clinical response (36.4 % proteinuria reduction). One patient showed no response and 2 patients had early termination. Early termination for 1 patient was due to AEs of weight gain and hypertension, and for 1 patient was stated as a patient decision. This latter patient showed partial remission, with 92 % proteinuria reduction before treatment termination. SCr >1.3 mg/dL occurred in 2/5 patients (40 %) at baseline. Total cholesterol and serum albumin were available for 2 patients. Total cholesterol decreased from 250 mg/dL to 230 mg/dL and serum albumin increased from 3.0 g/dL to 4.0 g/dL in 1 patient whereas the second patient had increased total cholesterol from 161 mg/dL to 242 mg/dL and decreased serum albumin from 4.0 g/dL to 3.6 g/dL. One patient showed hypoalbuminemia at baseline (3.0 g/dL) and improved post-treatment (4.0 g/dL).\n\nDN\nAmong 4 patients, 1 (25 %) showed ≥30 % proteinuria reduction (37.3 %, Table 4). The mean proteinuria reduction (n = 4) was 1797.3 ± 2267.3 mg/d. Two patients had no response to treatment, including 1 patient with DN and FSGS who progressed to renal replacement therapy. One patient had early termination due to AEs involving weight gain and hypertension. All 4 patients showed SCr >1.3 mg/dL. There was a mean reduction in total cholesterol (n = 2; 104.5 ± 13.4 mg/dL) and in serum albumin (n = 4; 0.05 ± 0.2 g/dL). Hypoalbuminemia was shown by all 4 patients at baseline (range 2.0–3.4 g/dL) and improved to 3.5 g/dL in 1 patient.\n\nMLN\nBoth patients with MLN showed ≥50 % proteinuria reduction (86.4 % and 87.7 %), and showed partial remission (Table 5). The mean proteinuria reduction (n = 2) was 12173.5 ± 7442.3 mg/d. The patients did not experience renal insufficiency, but they did show hypoalbuminemia at baseline (1.7 and 1.8 g/dL), which improved post-treatment (3.3 and 2.4 g/dL). There was a mean increase in serum albumin (n = 2; 1.10 ± 0.6 g/dL). Change in total cholesterol was not available for either patient.\n\nMCD\nBoth patients with MCD showed ≥50 % proteinuria reduction (88 % and 99.4 %), and showed complete remission (Table 5). The mean proteinuria reduction (n = 2) was 8335.0 ± 9299.9 mg/d. Renal insufficiency was not present but 1 patient showed a worsening of SCr from 0.9 at baseline to 1.2 mg/dL (33 %). One patient showed hypoalbuminemia at baseline (2.1 g/dL) with minimal improvement post-treatment (2.3 g/dL). There was mean total cholesterol reduction (n = 2; 81.5 ± 2.1 mg/dL) and mean serum albumin increase (n = 2; 0.60 ± 0.6 g/dL).\n\nFGN\nThe patient with FGN showed no response to treatment (Table 5). The patient had advanced disease that required renal replacement therapy, and dialysis was initiated before starting Acthar gel therapy.\n\nMPGN\nThe patient with MPGN showed partial remission, with 78.6 % proteinuria reduction (Table 5). This patient did not show renal insufficiency but did show hypoalbuminemia at baseline (1.5 g/dL) that improved post-treatment (3.3 g/dL). Total cholesterol was reduced from 360 mg/dL to 180.0 mg/dL.\n\nUnbiopsied NS\nAmong the 3 patients with unbiopsied NS, 1 patient showed partial remission (55.6 % proteinuria reduction), and 1 patient showed clinical response (46.7 % proteinuria reduction) (Table 5). The third patient had early termination of treatment due to an AE involving seizures. The patients with partial remission and clinical response showed renal insufficiency at baseline and the patient with a clinical response showed worsening of SCr >25 %. Hypoalbuminemia was present in the patient with early termination. The patient with partial remission had a total cholesterol reduction of 100 mg/dL.\n\nSafety and tolerability\nAEs during Acthar gel treatment were reported by 29.5 % (13/44) of patients and included increased swelling, weight gain, hypertension, hyperglycemia, fatigue, dizziness, hypokalemia, upper respiratory infection, seizures, and decreased bone mineralization (Table 6). Early termination due to treatment-related AEs occurred in 15.9 % (7/44) of patients. Among these 7 patients, 1 patient with IgAN terminated treatment early by “patient decision” and 1 patient with FSGS terminated treatment early without a specific reason provided. Both patients showed partial remission before early termination (Table 2, Table 4).Table 6 Adverse events and early termination of Acthar gel treatment in patients with NS\n\nNephrotic syndrome etiology\tPatients reporting treatment-related AEs, n (%)\tTreatment-related AEs\tEarly termination due to AEsa, n (%)\t\nFSGS (n = 15)\t3 (20 %)\tIncreased swelling (n = 1)\nHyperglycemia (n = 2)\nHypertension (n = 1)\nWeight gain (n = 1)\nUpper respiratory infections (n = 1)\t1 (6.7 %) Edema\n1 (6.7 %) Reason not given\t\niMN (n = 11)\t4 (36.4 %)\tFatigue (n = 1)\nDizziness (n = 1)\nWeight gain (n = 2)\nHypokalemia (n = 1)\t1 (9 %) Fatigue\t\nIgAN (n = 5)\t1 (20 %)\tWeight gain (n = 1)\nHypertension (n = 1)\t1 (20 %) Weight gain, hypertension\n1 (20 %) Patient decision\t\nDN (n = 4)\t3 (75 %)\tWeight gain (n = 2)\nHypertension (n = 1)\nHyperglycemia (n = 1)\nDecreased bone mineralization (n = 1)\t1 (25 %) Weight gain, hypertension\t\nMLN (n = 2)\t0\t\t0\t\nMCD (n = 2)\t0\t\t0\t\nFGN (n = 1)\t0\t\t0\t\nMPGN (n = 1)\t0\t\t0\t\nOtherb (n = 3)\t2 (66.7 %)\tSeizures (n = 1)\nHyperglycemia (n = 1)\nWeight gain (n = 1)\nHypertension (n = 1)\t1 (33.3 %) Seizures\t\n\nAbbreviations: AEs adverse events, DN diabetic nephropathy, FGN fibrillary glomerulonephritis, FSGS idiopathic focal segmental glomerulosclerosis, IgAN IgA nephropathy, iMN idiopathic membranous nephropathy, MCD minimal change disease, MLN membranous lupus nephritis (SLE class V), MPGN membranoproliferative glomerulonephritis, UNS unbiopsied nephrotic syndrome\n\n\naPatients without a specific reason given for early termination of treatment were included in the count of early termination due to AEs\n\n\nb“Other” includes 3 patients with unbiopsied NS\n\n\n\nDiscussion\nThis retrospective case series is the largest published to date to examine the efficacy and safety of Acthar gel in the treatment of patients with NS of varying etiologies, 68.2 % of whom had received prior NS treatment with immunosuppressive or cytotoxic therapies, who were receiving clinic-based prescription treatment. A significant proteinuria reduction was shown, and approximately 80 % of patients who completed Acthar gel treatment showed a substantial proteinuria reduction of ≥30 %, including patients who met criteria for complete remission, partial remission, or clinical response. Most patients tolerated Acthar gel therapy well. The AEs were consistent with prior studies of Acthar gel in patients with NS, in which AEs were typically steroid-like, with most being mild to moderate in severity and transient [14–17].\n\nThe relative rarity of NS etiologies has contributed to the scarcity of large-scale, prospective, randomized, controlled trials on which to base treatment recommendations [1]. As a result, the majority (67 %) of the recommendations provided by the comprehensive Kidney Disease: Improving Global Outcomes (KDIGO) 2012 Clinical Practice Guideline for Glomerulonephritis were graded as a suggestion rather than recommendation and with an evidence quality rating of C or D, indicating low to very low quality of evidence [1]. Evaluation of additional treatment options is urgently needed for patients with FSGS, iMN, IgAN, MCD, and MLN who are not responsive to the first-line treatments—typically corticosteroids, cyclophosphamide, CNIs, and mycophenolate mofetil (MMF)—or who are unable to tolerate the first-line treatments. For example, approximately 25 % of patients with MCD have been shown to be steroid-resistant and approximately 30 % of initial steroid responders show frequent relapses, and approximately one-third of MLN patients have been shown not to respond to the current American College of Rheumatology (ACR)-recommended initial treatment with prednisone plus MMF [4, 7, 8]. While acknowledging retrospective case series study design limitations, the current large case series provides much-needed Acthar gel treatment response information in diverse patients, including patients with advanced disease and treatment-resistant NS. Half (53.3 %) of the patients who showed proteinuria response to Acthar gel had failed ≥2 prior immunosuppressive or cytotoxic therapies, and approximately half had impaired renal function. Among all patients and among patients who showed proteinuria reduction, patients with preserved renal function showed greater percent proteinuria reduction following Acthar gel treatment, indicating earlier treatment with Acthar gel may be especially beneficial.\n\nImportantly, studies of patients with FSGS, iMN, and IgAN have indicated that partial remission and improved disease control are associated with better renal outcomes, even if patients relapse again [6, 21, 22]. Although complete remission is the ideal outcome, these studies suggest reduced proteinuria that does not meet complete remission criteria provides a meaningful treatment benefit compared with no improved disease control [6, 21, 22]. The optimal treatment duration for Acthar gel in patients with NS of varied etiology is not yet known. Our inclusion of the clinical response outcome identifying patients with substantial proteinuria reduction ≥30 % is consistent with the suggestion that longer-duration treatment beyond 6 months is indicated in iMN patients receiving CNIs who show proteinuria reduction of 30–50 %, with the goal of achieving partial or complete remission with longer-duration therapy [2]. Additionally, within the clinic, our experience with patients who show proteinuria reduction ≥30 % is clinically meaningful improvement in the patient’s report of feeling better. Longer-term treatment follow-up of these patients is needed to determine whether the proteinuria reduction is maintained, improves to remission or deteriorates to relapse.\n\nIn the two largest NS etiology patient groups, FSGS and iMN, the majority of patients showed proteinuria reduction ≥50 % following Acthar gel treatment, and the proteinuria reduction was significant. More than half of patients with FSGS showed partial remission and another quarter showed clinical response. Partial remission is a meaningful improvement for these patients, as significant improvement in kidney survival has been associated with partial remission of FSGS [14–16, 21]. Among patients with iMN, more than two-thirds of patients showed either complete or partial remission or clinical response to Acthar gel therapy. It has been stated that the recommended first-line therapy for patients with iMN, alkylating agents, should be restricted to patients who show a high risk of disease progression due to the toxicity associated with the agents [23]. Additionally, it has been shown that approximately 50 % of patients with iMN with persistent high-grade proteinuria will progress to end-stage renal disease (ESRD) [1]. The current case series findings, outcomes from previous studies examining Acthar gel in patients with iMN, and the finding that risk of progression is significantly reduced with at least partial remission suggest that Acthar gel may provide an important treatment option for patients with treatment-resistant iMN [14, 15, 19, 22].\n\nThe remaining NS etiology patient groups each had ≤5 patients, limiting conclusions about potential Acthar gel treatment efficacy. Proteinuria reduction to partial or complete remission was encouraging in patients with MCD or MLN and further study of Acthar gel therapy is warranted in these NS etiologies. Similarly, proteinuria response to Acthar gel therapy in 3 of the 5 patients with IgAN in our case series was consistent with prior single-case and small case series studies showing substantial proteinuria reduction [14, 15]. Compared with the 4 patients with DN in our case series, a stronger proteinuria response to Acthar gel therapy has been demonstrated in patients with DN using a treatment regimen of 16 U or 32 U daily for 6 months [17].\n\nPotential mechanisms of action of Acthar gel include steroid-independent effects through the melanocortin system and steroid-related effects [13, 24, 25]. Acthar gel in an animal model of progressive renal tubulointerstitial injury showed suppression of tubulointerstitial inflammation, tubular atrophy, and fibrosis through anti-inflammatory effects mediated by melanocortin receptor 1 (MC1R) on tubular epithelial cells [26]. MC1Rs have been shown in podocytes, glomerular endothelial cells, and mesangial cells, and an MC1R agonist resulted in significantly reduced proteinuria in the passive Heymann nephritis animal model [24]. Thus, Acthar gel steroid-independent effects may occur through melanocortin receptors, and more specifically MC1R, which may provide an explanation for the efficacy of Acthar gel in treatment-resistant and steroid-resistant patients [24, 26]. Additionally, the cumulative dose of Acthar gel, through the dosing regimen and treatment duration, may be an important factor. Among iMN patients, those receiving a greater cumulative dose of Acthar gel (2800 U) showed greater proteinuria reduction compared with lower cumulative doses (880 U and 1760 U) [19].\n\nThe current report is the largest case series to date to examine Acthar gel treatment of patients in real-world, clinical nephrology practices with an all-inclusive patient population. Strengths include the large patient sample with diverse NS etiologies and the inclusion of a majority of patients with prior NS treatment and with impaired renal function. The real-world clinical practice of Acthar gel treatment in patients with NS helps to elucidate the AEs that may be expected. Limitations include the small patient numbers in several of the NS etiologies, the retrospective design without a control group, and the possibility that concurrent therapy or long-term effects of prior immunosuppressive or cytotoxic therapy may have contributed to the proteinuria response during Acthar gel therapy in some patients. Patients in the current study were primarily White, which may limit the applicability of study findings in more racially diverse populations. Initiation of anti-proteinuria treatment was based on the treating clinician’s judgment within the clinical management of their patient’s changing NS symptoms. As a result, excluding patients with IgAN, 8 patients began treatment at a non-nephrotic proteinuria level <3500 mg/d. Proteinuria was used as a surrogate endpoint and the possible long-term benefit of Acthar gel in preventing ESRD was not examined. Additionally, longer treatment duration and follow-up may be needed for optimal treatment responses. The relapse rate following successful treatment with Acthar gel and possible use of other therapies post-Acthar gel treatment cessation are not yet known.\n\nConclusion\nThe current case series findings support a potential short-term benefit of Acthar gel therapy in patients with NS, particularly FSGS and iMN etiologies, and indicate Acthar gel treatment is well tolerated. Among the patients who completed ≥6 months of treatment, 80 % showed ≥30 % proteinuria reduction, and almost two-thirds showed ≥50 % proteinuria reduction. The majority of patients who showed proteinuria reduction had failed prior immunosuppressive and cytotoxic therapies, and approximately half showed impaired renal function prior to Acthar gel treatment. These findings indicate that Acthar gel may meet an important treatment need in patients with NS that is treatment-resistant in response to first-line therapies or who are unable to tolerate first-line therapies and in patients with advanced disease. Future research is needed to determine whether patients who show a proteinuria clinical response without remission benefit from longer-term treatment and show continued clinical improvement. Further research using prospective, controlled trials with longer-duration treatment and follow-up assessments to examine different Acthar gel regimens and cumulative dose effects in varied-etiology NS is warranted.\n\nAvailability of supporting data\nWith the exception of total cholesterol, all raw data used in study summary analyses are provided in Tables 2, 3, 4, 5 and 6. Total cholesterol raw data are available on request.\n\nAbbreviations\nACEIangiotensin-converting-enzyme inhibitor\n\nACRAmerican College of Rheumatology\n\nACTHadrenocorticotropic hormone\n\nAEadverse event\n\nARBangiotensin II receptor blocker\n\nCNIcalcineurin inhibitor\n\nDNdiabetic nephropathy\n\nESRDend-stage renal disease\n\nFGNfibrillary glomerulonephritis\n\nFSGSidiopathic focal segmental glomerulosclerosis\n\nIgANIgA nephropathy\n\niMNidiopathic membranous nephropathy\n\nKDIGOkidney disease: improving global outcomes\n\nMC1Rmelanocortin receptor 1\n\nMCDminimal change disease\n\nMLNmembranous lupus nephritis (SLE class V)\n\nMMFmycophenolate mofetil\n\nMPGNmembranoproliferative glomerulonephritis\n\nNSnephrotic syndrome\n\nSCrserum creatinine\n\nSLEsystemic lupus erythematosus\n\nUPCRurine protein:creatinine ratio\n\nArvind Madan and Anupa Khastgir are Co-first authors\n\nCompeting interests\n\nAM: Speaker for Mallinckrodt ARD Inc. (formerly Questcor).\n\nS M-D: Speaker for Mallinckrodt ARD Inc. (formerly Questcor).\n\nAS: Speaker for Mallinckrodt ARD Inc. (formerly Questcor).\n\nGT: Speaker for Mallinckrodt ARD Inc. (formerly Questcor).\n\nASM: No competing interests.\n\nAK: Advisor to Mallinckrodt ARD Inc. (formerly Questcor).\n\nAuthors’ contributions\n\nAM and AK contributed to study conception and design. All authors participated in data acquisition, data analysis, and data interpretation. Each author contributed important intellectual content during manuscript drafting or revision and accepts accountability for the overall work by ensuring that questions pertaining to the accuracy or integrity of any portion of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.\n\nAcknowledgements\nThe authors thank Dr. Sheldon M. Shore of Nephrology Consultants of GA for contributing patients to this study and Harvey Kushner, PhD, of the Biomedical Computer Research Institute for biostatistical analyses. The authors also thank Lynanne McGuire, PhD, of MedVal Scientific Information Services, LLC, for providing medical writing and editorial assistance. Funding to support the preparation of this manuscript was provided by Mallinckrodt ARD Inc. (formerly Questcor), to MedVal Scientific Information Services, LLC, Skillman, New Jersey. Mallinckrodt ARD did not have a role in the collection, analysis, or interpretation of the data; in writing the report; or in the decision to submit for publication. This manuscript was prepared according to the International Society for Medical Publication Professionals’ “Good Publication Practice for Communicating Company-Sponsored Medical Research: The GPP2 Guidelines.”\n==== Refs\nReferences\n1. Kidney Disease: Improving Global Outcomes (KDIGO) Glomerulonephritis Work Group KDIGO clinical practice guideline for glomerulonephritis Kidney Int Suppl 2012 2 139 274 10.1038/kisup.2012.9 \n2. Beck L Bomback AS Choi MJ Holzman LB Langford C Mariani LH Somers MJ Trachtman H Waldman M KDOQI US commentary on the 2012 KDIGO clinical practice guideline for glomerulonephritis Am J Kidney Dis 2013 62 403 441 10.1053/j.ajkd.2013.06.002 23871408 \n3. Segarra-Medrano A Jatem-Escalante E Agraz-Pamplona I Carnicer-Caceres C Ramos-Terrades N Ostos-Roldan E Quiles-Perez MT Arbos-Via MA Treatment of idiopathic focal segmental glomerulosclerosis: options in the event of resistance to corticosteroids and calcineurin inhibitors Nefrologia 2013 33 448 461 23897176 \n4. Waldman M Crew RJ Valeri A Busch J Stokes B Markowitz G D’Agati V Appel G Adult minimal-change disease: clinical characteristics, treatment, and outcomes Clin J Am Soc Nephrol 2007 2 445 453 10.2215/CJN.03531006 17699450 \n5. Manno C Torres DD Rossini M Pesce F Schena FP Randomized controlled clinical trial of corticosteroids plus ACE-inhibitors with long-term follow-up in proteinuric IgA nephropathy Nephrol Dial Transplant 2009 24 3694 3701 10.1093/ndt/gfp356 19628647 \n6. Reich HN Troyanov S Scholey JW Cattran DC Remission of proteinuria improves prognosis in IgA nephropathy J Am Soc Nephrol 2007 18 3177 3183 10.1681/ASN.2007050526 17978307 \n7. Hahn BH McMahon MA Wilkinson A Wallace WD Daikh DI Fitzgerald JD Karpouzas GA Merrill JT Wallace DJ Yazdany J Ramsey-Goldman R Singh K Khalighi M Choi SI Gogia M Kafaja S Kamgar M Lau C Martin WJ Parikh S Peng J Rastogi A Chen W Grossman JM American College of Rheumatology guidelines for screening, treatment, and management of lupus nephritis Arthritis Care Res (Hoboken) 2012 64 797 808 10.1002/acr.21664 22556106 \n8. Radhakrishnan J Moutzouris DA Ginzler EM Solomons N Siempos II Appel GB Mycophenolate mofetil and intravenous cyclophosphamide are similar as induction therapy for class V lupus nephritis Kidney Int 2010 77 152 160 10.1038/ki.2009.412 19890271 \n9. Philibert D Cattran D Remission of proteinuria in primary glomerulonephritis: we know the goal but do we know the price? Nat Clin Pract Nephrol 2008 4 550 559 10.1038/ncpneph0915 18725916 \n10. H.P. Acthar® Gel (repository corticotropin injection) [prescribing information]. Hazelwood: Mallinckrodt ARD Inc.; 2015.\n11. Rapoport M McCrory WW Barbero G Barnett HL Forman CW Effect of corticotropin (ACTH) on children with the nephrotic syndrome JAMA 1951 147 1101 1106 10.1001/jama.1951.03670290009004 \n12. Durand P DeToni E Jr Treatment of nephrotic syndrome in children An Paediatr 1955 185 225 235 \n13. Gong R Leveraging melanocortin pathways to treat glomerular diseases Adv Chronic Kidney Dis 2014 21 134 151 10.1053/j.ackd.2013.09.004 24602463 \n14. Bomback AS Tumlin JA Baranski J Bourdeau JE Besarab A Appel AS Radhakrishnan J Appel GB Treatment of nephrotic syndrome with adrenocorticotropic hormone (ACTH) gel Drug Des Devel Ther 2011 5 147 153 10.2147/DDDT.S17521 21448451 \n15. Bomback AS Canetta PA Beck LH Jr Ayalon R Radhakrishnan J Appel GB Treatment of resistant glomerular diseases with adrenocorticotropic hormone gel: a prospective trial Am J Nephrol 2012 36 58 67 10.1159/000339287 22722778 \n16. Hogan J Bomback AS Mehta K Canetta PA Rao MK Appel GB Radhakrishnan J Lafayette RA Treatment of idiopathic FSGS with adrenocorticotropic hormone gel Clin J Am Soc Nephrol 2013 8 2072 2081 10.2215/CJN.02840313 24009220 \n17. Tumlin JA Galphin CM Rovin BH Advanced diabetic nephropathy with nephrotic range proteinuria: a pilot study of the long-term efficacy of subcutaneous ACTH gel on proteinuria, progression of CKD, and urinary levels of VEGF and MCP-1 J Diabetes Res 2013 2013 489869 10.1155/2013/489869 24159603 \n18. Watson MJ Membranous glomerulopathy and treatment with Acthar®: a case study Int J Nephrol Renovasc Dis 2013 6 229 232 10.2147/IJNRD.S50660 24174881 \n19. Hladunewich MA Cattran D Beck LH Odutayo A Sethi S Ayalon R Leung N Reich H Fervenza FC A pilot study to determine the dose and effectiveness of adrenocorticotrophic hormone (H.P. Acthar® Gel) in nephrotic syndrome due to idiopathic membranous nephropathy Nephrol Dial Transplant 2014 29 1570 1577 10.1093/ndt/gfu069 24714414 \n20. Lieberman KV, Ettinger L, Picarelli C: Adrenocorticotropic hormone for steroid-resistant and oral steroid-intolerant children with minimal change nephrotic syndrome. J Clin Pediatr Nephrol 2014, 2: http://www.jpnephrology.com/index.php/FIRST/article/view/64.\n21. Troyanov S Wall CA Miller JA Scholey JW Cattran DC Focal and segmental glomerulosclerosis: definition and relevance of a partial remission J Am Soc Nephrol 2005 16 1061 1068 10.1681/ASN.2004070593 15716334 \n22. Troyanov S Wall CA Miller JA Scholey JW Cattran DC Idiopathic membranous nephropathy: definition and relevance of a partial remission Kidney Int 2004 66 1199 1205 10.1111/j.1523-1755.2004.00873.x 15327418 \n23. Hofstra JM Fervenza FC Wetzels JF Treatment of idiopathic membranous nephropathy Nat Rev Nephrol 2013 9 443 458 10.1038/nrneph.2013.125 23820815 \n24. Lindskog A Ebefors K Johansson ME Stefansson B Granqvist A Arnadottir M Berg AL Nystrom J Haraldsson B Melanocortin 1 receptor agonists reduce proteinuria J Am Soc Nephrol 2010 21 1290 1298 10.1681/ASN.2009101025 20507942 \n25. Gong R The renaissance of corticotropin therapy in proteinuric nephropathies Nat Rev Nephrol 2012 8 122 128 10.1038/nrneph.2011.190 22143333 \n26. Gong R Dworkin LD Adrenocorticotropin (ACTH) gel suppresses renal tubulointerstitial inflammation and injury by direct stimulation of the melanocortin 1 receptor (MC1R) [abstract] J Am Soc Nephrol 2011 22 suppl 136A\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2369",
"issue": "17()",
"journal": "BMC nephrology",
"keywords": "ACTH; Acthar gel; Nephrotic syndrome; Proteinuria",
"medline_ta": "BMC Nephrol",
"mesh_terms": "D000324:Adrenocorticotropic Hormone; D000328:Adult; D000368:Aged; D015331:Cohort Studies; D003928:Diabetic Nephropathies; D005260:Female; D005782:Gels; D005922:Glomerulonephritis, IGA; D015432:Glomerulonephritis, Membranoproliferative; D015433:Glomerulonephritis, Membranous; D005923:Glomerulosclerosis, Focal Segmental; D006728:Hormones; D006801:Humans; D008181:Lupus Nephritis; D008297:Male; D008875:Middle Aged; D009402:Nephrosis, Lipoid; D009404:Nephrotic Syndrome; D011507:Proteinuria; D012189:Retrospective Studies; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "100967793",
"other_id": null,
"pages": "37",
"pmc": null,
"pmid": "27036111",
"pubdate": "2016-03-31",
"publication_types": "D000068397:Clinical Study; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": "24174881;23871408;17978307;23897176;20507942;21448451;18725916;23820815;19628647;15327418;19890271;24159603;13283450;22143333;24602463;17699450;15716334;22722778;24009220;24714414;22556106;14873631",
"title": "Acthar gel in the treatment of nephrotic syndrome: a multicenter retrospective case series.",
"title_normalized": "acthar gel in the treatment of nephrotic syndrome a multicenter retrospective case series"
} | [
{
"companynumb": "US-MALLINCKRODT-T201700429",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CORTICOTROPIN"
},
"drugadditional": null,
... |
{
"abstract": "Atrial flutter (AFL) is the second most common type of tachyarrhythmia in the fetus and neonate. An atrial rate of 240 to 360 beats per minute, 2:1 atrioventricular conduction, and a \"saw tooth\" appearance on electrocardiogram (ECG) are characteristic. On echocardiogram, bilateral atrial dilatation is the most common finding. Treatment is dependent on the severity of symptoms; delivery is usually indicated in the case of fetal heart failure or hydrops fetalis, whereas postnatal AFL is most commonly treated with direct current cardioversion (DCC). This article presents an illustrative case in which the patient presented antenatally via abnormal nonstress testing and subsequent fetal echocardiogram that was concerning for AFL. Postnatal ECG confirmed this diagnosis and the patient received DCC on the day of birth, followed by digoxin and propranolol as maintenance therapy.",
"affiliations": null,
"authors": "Woo|Joyce|J|;Khan|Owais|O|;Caldarelli|Leslie|L|;Williams|Paula|P|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D004077:Digoxin; D011433:Propranolol",
"country": "United States",
"delete": false,
"doi": "10.3928/00904481-20151012-09",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0090-4481",
"issue": "44(10)",
"journal": "Pediatric annals",
"keywords": null,
"medline_ta": "Pediatr Ann",
"mesh_terms": "D000889:Anti-Arrhythmia Agents; D001282:Atrial Flutter; D004077:Digoxin; D004359:Drug Therapy, Combination; D004452:Echocardiography; D004554:Electric Countershock; D004562:Electrocardiography; D005260:Female; D005865:Gestational Age; D006801:Humans; D007231:Infant, Newborn; D007363:Intensive Care Units, Neonatal; D011247:Pregnancy; D011433:Propranolol; D013610:Tachycardia",
"nlm_unique_id": "0356657",
"other_id": null,
"pages": "e247-50",
"pmc": null,
"pmid": "26473427",
"pubdate": "2015-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tachycardia in the Neonate.",
"title_normalized": "tachycardia in the neonate"
} | [
{
"companynumb": "PHHY2015US157245",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PENICILLIN G SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nCytoreductive surgery (CRS) with hyperthermic intraperitoneal chemotherapy (HIPEC) is a curative treatment option for patients with peritoneal carcinomatosis. Total pelvic exenteration (TPE) is an established treatment option for locally advanced pelvic malignancy. These two procedures have high mortality and morbidity, and therefore, their combination is not currently recommended. Herein, we reported our experience on TPE associated with CRS/HIPEC with a critical analysis for rectal cancer with associate peritoneal metastases.\n\n\nMETHODS\nFrom March 2006 to August 2020, 319 patients underwent a CRS/HIPEC in our hospital. Among them, 16 (12 men and four women) underwent an associated TPE. The primary endpoints were perioperative morbidity and mortality.\n\n\nRESULTS\nThere was locally recurrent rectal cancer in nine cases, six locally advanced primary rectal cancer, and a recurrent appendiceal adenocarcinoma. The median Peritoneal Cancer Index (PCI) was 8. (4-16). Mean duration of the surgical procedure was 596 min (420-840). Complete cytoreduction (CC0) was achieved in all patients, while clear resection (R0) margins on the resected pelvic organs were achieved in 81.2% of cases. The median hospital stay was 46 days (26-129), and nine patients (56.2%) experienced severe complications (grade III to V) that led to death in two cases (12.5%). The total reoperation rate for patients was 6/16 (37.5%) and 3/16 (18.75%) with percutaneous radiological-guided drainage.\n\n\nCONCLUSIONS\nIn summary, TPE/extended TPE (ETPE) associated with CRS/HIPEC may be a reasonable procedure in selected patients at expert centers. Pelvic involvement should not be considered a definitive contraindication for CRS/HIPEC in patients with resectable peritoneal surface diseases if a R0 resection could be achieved on all sites. However, the morbidity and the mortality are high with this combination of treatment, and further research is needed to assess the oncologic benefit and quality of life before such a radical approach can be recommended.",
"affiliations": "Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Urology, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Anesthesiology and Critical Care, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Anesthesiology and Critical Care, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Pathology, Iron Group, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Digestive Oncology, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.;Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France.",
"authors": "Tuech|Jean-Jacques|JJ|;Pinson|Jean|J|0000-0002-4165-4233;Nouhaud|François-Xavier|FX|;Wood|Gregory|G|;Clavier|Thomas|T|;Sabourin|Jean-Christophe|JC|;Di Fiore|Frederic|F|;Monge|Matthieu|M|;Papet|Eloïse|E|;Coget|Julien|J|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3390/cancers12113478",
"fulltext": "\n==== Front\nCancers (Basel)\nCancers (Basel)\ncancers\nCancers\n2072-6694 MDPI \n\n33238384\n10.3390/cancers12113478\ncancers-12-03478\nArticle\nTotal Pelvic Exenteration, Cytoreductive Surgery, and Hyperthermic Intraperitoneal Chemotherapy for Rectal Cancer with Associate Peritoneal Metastases: Surgical Strategies to Optimize Safety\nTuech Jean-Jacques 1* Pinson Jean 1 Nouhaud François-Xavier 2 Wood Gregory 3 Clavier Thomas 3 Sabourin Jean-Christophe 4 Di Fiore Frederic 5 Monge Matthieu 1 Papet Eloïse 1 Coget Julien 1 1 Department of Digestive Surgery, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France; jean.pinson@chu-rouen.fr (J.P.); Matthieu.Monge@chu-rouen.fr (M.M.); eloise.papet@chu-rouen.fr (E.P.); julien.coget@chu-rouen.fr (J.C.)\n2 Department of Urology, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France; Francois-Xavier.Nouhaud@chu-rouen.fr\n3 Department of Anesthesiology and Critical Care, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France; Gregory.Wood@chu-rouen.fr (G.W.); thomas.clavier@chu-rouen.fr (T.C.)\n4 Department of Pathology, Iron Group, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France; Jean-Christophe.Sabourin@chu-rouen.fr\n5 Department of Digestive Oncology, Rouen University Hospital, 1 rue de Germont, F-76031 Rouen, France; Frederic.DiFiore@chu-rouen.fr\n* Correspondence: Jean-jacques.tuech@chu-rouen.fr; Tel.: +33-232-888-142; Fax: +33-232-8884\n23 11 2020 \n11 2020 \n12 11 347801 11 2020 20 11 2020 © 2020 by the authors.2020Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).Simple Summary\nCytoreductive surgery (CRS) with hyperthermic intraperitoneal chemotherapy (HIPEC) is a curative treatment for patients with peritoneal carcinomatosis. Pelvic exenteration is an established treatment option for locally advanced pelvic malignancy. Based on the argument that high-risk complications arise from each procedure, the majority of researchers do not recommend performing a CRS/HIPEC with pelvis exenteration. Herein, we critically analyzed the data from 16 patients treated by these two procedures for 15 rectal and one appendiceal adenocarcinomas. Clear resection (R0) margins were achieved in 81.2% of cases. The median hospital stay was 46 days (26–129), and nine patients (56.2%) experienced severe complications that led to death in two cases (12.5%). Survival rates were not clarified, since the follow-up is ongoing. Pelvis exenteration associated with CRS/HIPEC may be a reasonable procedure in selected patients at expert centers. Pelvic involvement should not be considered a definitive contraindication for CRS/HIPEC if a R0 resection could be achieved. However, the morbidity and the mortality are high with this combination of treatment, and further research is needed to assess the oncologic benefit and quality of life before such a radical approach can be recommended.\n\nAbstract\nBackground: Cytoreductive surgery (CRS) with hyperthermic intraperitoneal chemotherapy (HIPEC) is a curative treatment option for patients with peritoneal carcinomatosis. Total pelvic exenteration (TPE) is an established treatment option for locally advanced pelvic malignancy. These two procedures have high mortality and morbidity, and therefore, their combination is not currently recommended. Herein, we reported our experience on TPE associated with CRS/HIPEC with a critical analysis for rectal cancer with associate peritoneal metastases. Methods: From March 2006 to August 2020, 319 patients underwent a CRS/HIPEC in our hospital. Among them, 16 (12 men and four women) underwent an associated TPE. The primary endpoints were perioperative morbidity and mortality. Results: There was locally recurrent rectal cancer in nine cases, six locally advanced primary rectal cancer, and a recurrent appendiceal adenocarcinoma. The median Peritoneal Cancer Index (PCI) was 8. (4–16). Mean duration of the surgical procedure was 596 min (420–840). Complete cytoreduction (CC0) was achieved in all patients, while clear resection (R0) margins on the resected pelvic organs were achieved in 81.2% of cases. The median hospital stay was 46 days (26–129), and nine patients (56.2%) experienced severe complications (grade III to V) that led to death in two cases (12.5%). The total reoperation rate for patients was 6/16 (37.5%) and 3/16 (18.75%) with percutaneous radiological-guided drainage. Conclusions: In summary, TPE/extended TPE (ETPE) associated with CRS/HIPEC may be a reasonable procedure in selected patients at expert centers. Pelvic involvement should not be considered a definitive contraindication for CRS/HIPEC in patients with resectable peritoneal surface diseases if a R0 resection could be achieved on all sites. However, the morbidity and the mortality are high with this combination of treatment, and further research is needed to assess the oncologic benefit and quality of life before such a radical approach can be recommended.\n\ncytoreductive surgeryhyperthermic intraperitoneal chemotherapypelvic exenterationileal conduiturinary leakageempty pelvis syndromeperitoneal metastasesperitoneal carcinomatosis\n==== Body\n1. Introduction\nCytoreductive surgery (CRS) with hyperthermic intraperitoneal chemotherapy (HIPEC) is a curative treatment option for patients with peritoneal carcinomatosis (PC). It has a long-term survival benefit [1,2] but is associated with high rates of morbidity, ranging from 12% to 65% [3,4,5,6]. Pelvic exenteration is an established treatment option for locally advanced primary rectal cancer (LARC) and locally recurrent rectal cancer (LRRC), but it is associated with significant morbidity; therefore, many investigators do not recommend CRS-HIPEC with pelvic exenteration. Since the majority of researchers consider it as an exclusion criterion, only a few case reports [7,8,9] have been published to date. Herein, we reported our experience with total pelvic exenteration (TPE) associated with CRS and HIPEC with a critical analysis. We described the strategies developed over time to reduce the mortality and morbidity of this association in order to make it a safe surgical approach.\n\n2. Results\n2.1. Patients Characteristics\nFrom March 2006 to August 2020, 319 patients underwent a CRS and HIPEC in our hospital. Among them, 16 (12 men and four women) underwent an associated TPE or extended TPE (ETPE). The baseline patient characteristics are reported in Table 1. The main indication was rectal cancer in 15 cases: locally recurrent rectal cancer (LRCC) in nine cases and six locally advanced primary rectal cancer (LARC) cases. The remaining patient was operated on for a recurrent appendiceal adenocarcinoma. Next, 12 patients who had previously undergone pelvic surgery: 11 proctectomies and one posterior exenteration were already treated with HIPEC 77 months before ETPE.\n\n2.2. Peroperative Data\nDetailed information on the surgical resections is reported in Table 2. The median PCI was 8 (4–16); this calculation did not take into account the pelvic region; the median number of regions affected by peritoneal carcinoma was three (two–nine), and the pelvic region was also excluded for this calculation. The mean duration of the surgical procedure was 596 min (420–840). Six patients had TPE and 10 had ETPE. The lateral compartment required resection on both sides in five cases and on one side in four cases. The posterior compartment required resection in nine cases. Urinary reconstruction used an ileal conduit (Bricker procedure) in 10 cases, and bilateral ureterostomy was constructed in six cases. The empty pelvis was managed in 11 cases using different methods, but the filling was systematically carried out with patient 7. Complete cytoreduction (CC0) was achieved in all patients, while clear resection (R0) margins on the resected pelvic organ was achieved in 81.2% of cases. Three LRCC patients had R1 resection. The involved margin was on the posterior compartment despite the resection of the pre-sacral fascia.\n\n2.3. Postoperative Morbidity\nThe details of the postoperative course, the complications, the time to the first recurrence, and the follow-up are given in Table 3. The median hospital stay was 46 days (26–129), and nine patients (56.2%) experienced severe complications (grade III to V), which led to death in two cases (12.5%). The total reoperation rate for the patients was 6/16 (37.5%) and 3/16 (18.75%) with percutaneous radiological-guided drainage. The most common causes of surgical complications were urosepsis and pelvic abscess. Seven patients died during follow-up: in six cases, the cause of death was secondary to the progression of the oncological disease; patient 1 died from septic shock during chemotherapy treatment (the infection originated from the totally implanted venous access).\n\n3. Discussion\nPelvic exenteration for LARC or LRRC remains a surgical challenge associated with high mortality and significant morbidity [10,11,12,13]. Over the past two decades, there has been significant improvement in outcomes and survival rates. The expert center’s reports have shown a five-year survival rate of 36% to 46%, with a mortality rate of 0.6% and a perioperative morbidity rate of 27% [14]. The combination of complete CRS and HIPEC is gradually becoming the standard of care for patients with PC. This approach has been associated with an increased risk of surgical complications, due to the complexity of extensive surgery with multiple intra-abdominal organ resections and peritonectomies. Based on the argument of a high risk of complications from each procedure, the majority do not recommend performing a CRS and HIPEC with TPE or ETPE. To our knowledge, this series is the largest to report specifically on this association to treat patients with LARC or LLRC with associated peritoneal metastases.\n\nAchieving clear margins with an R0 resection has been shown to be the best predictor of long-term survival. Surgical exploration must be complete and meticulous. The presence of an unresectable disease in the abdomen and peritoneum would be a contraindication to perform a TPE. To perform such an extensive resection and have a residual disease at another site would defy the established oncological surgical principles.\n\nIn the present series, CCR0 could be achieved in all cases and R0 in 81% (13/15). This rate of R0 resection is consistent with the literature. Denost et al. [15], in an international benchmark trial of the management of LARC and LRRC in France and Australia between 2015 and 2017, demonstrated that the R0 resection rate was lower in France (61.3%) than Australia (91.6%). In our three R1 cases, the involved margin was the posterior one, despite a resection of the pre-sacral fascia. In the future, a more posterior plan (subcortical sacrectomy) could be discussed in this situation in order to obtain an R0 margin. This subcortical sacrectomy could be performed after the removal of the main specimen, with the aim of making this sacrectomy easier. The risk of tumor cell dissemination due to a non-en bloc resection could be managed by HIPEC.\n\nPostoperative complications after major surgical procedures have a negative impact on long-term survival [16,17,18,19,20]; therefore, the reduction of postoperative complications is essential for optimal short- and long-term outcomes. Major complications after CRS/HIPEC in established centers have ranged from 12% to 52% [21]. In the present study, major complications (Dindo > 3) occurred in 50%. Among the independent predictors of major complications, several studies have consistently identified the extent of the disease reflected by the number of organs resected and the duration of surgery [22,23,24]. Surgeons have progressed along a constant learning curve, and the management of peritoneal malignancies [25,26] and expected long-term survival associated with extensive CRS have improved, so expert teams have progressively expanded the indications for surgery, with acceptable morbidity rates [27,28,29]. CRS has been limited to a subset of selected patients likely to tolerate aggressive management [27]. Given the importance of complete CRS in optimizing oncological outcomes, Wagner et al. reported an approach of “cytoreduction at all costs” in appendiceal carcinomatosis [30]. Overall and major complications occurred, respectively, in 70% and 32% of patients after extensive CRS. In our study, patients underwent a median of five resections (range, four–seven), and, according to the definition of Wagner et al. [30], all patients underwent extensive CRS (>three organ resections or >two enteric anastomoses).\n\nSeveral authors have shown that the rate of postoperative complications increased in cases of CRC-HIPEC associated with urinary system intervention [31,32,33], despite the fact that these studies report only limited urinary resections. To the best of our knowledge, there is no study in the literature investigating the management of urinary tract reconstruction following TPE in the field of CRS and HIPEC procedures. Urologic leaks from a newly formed conduit are a considerable source of morbidity following TPE [34,35,36], leading to prolonged in- and outpatient management, as well as a shorter median survival [35]. Teixeira et al. [35] reported a 16% urine leak rate following TPE. In our study, four patients (25%) experienced a urine leak, which led to death in one case. Ongoing sepsis due to a urine leak is an unfavorable prognostic indicator similar to anastomotic bowel leaks. Brown et al. [34] compared 98 patients who underwent a cystectomy to 133 who underwent a cystectomy as part of a TPE procedure. Postoperative urological complications occurred in 33% of the cystectomy alone group and 59% of the PE group (p < 0.001). Urological leaks occurred in 3%, 6%, and 14% of patients who had cystectomy alone, TPE for primary malignancy, and TPE for recurrence, respectively. In the multivariate analysis, more than 5000-mL intraoperative blood loss and previous pelvic radiotherapy independently predicted conduit-associated complications in TPE patients (p = 0.002 and 0.035). In our study, nine patients (56%) belonged to this high-risk group (previous radiotherapy, major hemorrhage) of urinary leaks. It should not be overlooked that an ileal conduit led to the confection of three anastomoses. These two points, in order to reduce complications, led us to perform bilateral ureterostomies in five patients (31.2%) rather than an ileal conduit. A recent publication showed a significant reduction of complications [37] when a ureterostomy rather than an ileal conduit was fashioned (Nicola Longo) with an impaired quality of life (QOL). Arman et al. [38] compared patients’ QOL with single stoma cutaneous ureterostomy (SCU), bilateral standard cutaneous ureterostomy (BCU), and an ileal conduit (IC). The IC was associated with better quality of life scores compared to BCU and similar scores compared to SCU. In the future, SCU could be an alternative to BCU in HIPEC patients, but this procedure mobilizes the left ureter more widely to allow its transfer to the right side, which can lead to ischemic damage to the distal ureter. \n\nOne of the major causes of postoperative complications following TPE/ETPE is empty pelvis syndrome. Empty pelvis syndrome can be defined as an empty space or cavity following pelvic exenteration, which may result in fluid accumulation within the pelvic cavity, potentially increasing the risk of pelvic abscess, perineal fluid discharge with perineal wound dehiscence, and prolonged ileus. The irradiated small bowel loops (with an enterostomy following ileal conduit formation) may become adherent to the exposed pelvic surfaces, leading to bowel obstruction and the development of entero-perineal fistulas. This occurs in up to 15% of patients following exenteration, conferring a mortality rate close to 50% [39]. Several methods have been proposed to fill the pelvis and keep the small bowel out of the pelvis, such as breast prosthesis, yet there is a concern regarding prosthesis infection, Cecal pelvic transposition, a myocutaneous flap, and, more recently, implantation of degradable synthetic mesh [40,41,42,43]. In our study, the empty pelvis was managed in 11 cases—systematically, from the seventh patient—using different methods. Delayed coloanal anastomosis (six cases) was privileged when a supra-levator resection was performed. A rectus abdominis muscular flap was used in four cases, a cecal transposition in three cases, an omentoplasty in one, a biological prosthesis in one, and a breast prosthesis in one. In four cases, a combination of two methods was used to completely fill the pelvis. In patient four, we used an omentoplasty and a cecal transposition to fill the pelvis. An omentectomy was mandatory during cytoreductive surgery. We chose this option, because the omentum was macroscopically normal and the PCI was 4. In a recent publication, Bonnefoy et al. [44] demonstrated that, among the 96 patients who underwent a complete cytoreductive surgery with no macroscopic evidence of disease in the greater omentum during surgical exploration, 17 patients (17.70%) had microscopic evidence of a tumor in the omentum. We assumed that, if invisible cancer deposits were present at the surface of the omentum, they would be treated by HIPEC. During follow-up, this patient did not experience recurrence at the omentoplasty level.\n\nFinally, optimizing the patient before multiorgan resection is vital for reducing perioperative morbidity and requires a multi-specialist approach [45,46,47]. In our department, we improved the nutritional status and organized a physical rehabilitation by a physiotherapist for each patient before surgery. However, this was not enough. In the future, all areas for potential improvement must be identified and improve. Formal cardiopulmonary testing is an objective test to assess the fitness and diagnose cardiovascular and lung pathophysiology [48]. A management plan can then be determined for the patient’s perioperative care and pathway [49].\n\nThis study has several limitations. The sample size was small, and patients were enrolled for a long period of time, and there has been considerable progress in the perioperative management. Moreover, the quality of life was not assessed by means of dedicated questionnaires or assessments. Furthermore, our survival rates have not yet been clarified, since the follow-up is ongoing. However, despite these weaknesses, our study includes a homogenous group of patients in a single center, which provides useful insight for the challenging surgical strategy.\n\n4. Materials and Methods\n4.1. Patients and Inclusion Criteria\nA review of a prospectively maintained database was undertaken to identify and assess the outcomes of patients who underwent TPE, CRS, and HIPEC in the Department of Digestive Surgery, Rouen University Hospital, Rouen, France.\n\nAll patients undergoing TPE and HIPEC for any primary or recurrent pathology were included. The diagnosis and management of all malignancies was based on preoperative radiology (CT scan for chest, abdomen, and pelvis; MRI for pelvis; and FDG-PET. MRI for liver, where indicated) and clinical assessment. Indication for an associated HIPEC to TPE was discussed preoperatively for the available preoperative data. A preoperative nutrition assessment was performed, and nutrition support was provided pre- and postoperatively for all patients. The patency for both deep inferior epigastric vessels were analyzed using computed tomography angiography to anticipate the use of a vertical rectus abdominis myocutaneous flap for pelvic filling or perineal reconstruction. All patients received a preoperative mechanical bowel preparation, and preoperative antibiotherapy was given according to local protocols.\n\n4.2. Total Pelvic Exenteration and Other Definitions\nThe surgical principle of pelvic exenteration is a complete en bloc removal of all viscera or structures contiguously involved by tumors with a clear resection margin (R0 resection). To be classified as an R0 resection, a clear margin of >1 mm is required in the histopathological evaluation. Different classifications have evolved to describe different types of recurrence and exenteration; however, there is no universally accepted terminology. In fact, no classification will reflect with accuracy the possible varieties of exenteration procedures, because every procedure is different for every patient.\n\nWe used Magrina’s classification [50,51] in order to define the TPE. The TPE is an en bloc resection for pelvic organs, including the internal reproductive organs, bladder, and rectosigmoid. In the presence of upper lesions, adequate tumor resection can be obtained by dividing the viscera above or at the level of the levator muscles. In this procedure, the levator muscle, anus, and urogenital diaphragm are preserved. During low lesion, an infra-levator TPE requires a tailored resection of the levator muscles, urogenital diaphragm, anus, and perineal tissues. Extended TPE (ETPE) is a procedure requiring an additional resection of tissues (small bowel, bone, vessels, etc.). For ETPE, we used the classification proposed by Georgiou et al. [52]. TPE can be enlarged to the posterior compartment (coccyx, pre-sacral fascia, retro-sacral space, and sacrum up to the upper level of S1) or to the lateral compartment (external and internal iliac vessels, lateral pelvic lymph nodes, sciatic nerve, sciatic notch, S1 and S2 nerve roots, and the piriformis or obturator internus muscle).\n\n4.3. Cytoreduction and HIPEC \nCRS included the primary tumor removal, complete resection of the tumor nodule with intestinal resection, and peritonectomy. The extent of the peritoneal spread was assessed using the Peritoneal Cancer Index (PCI) [53,54]. The completeness of the cytoreduction (CCR) score was evaluated for each patient before performing HIPEC [55]. CC0 implied no residual macroscopic disease. CC 1, 2, and 3 implied residual disease less than 2.5 mm and 2.5 mm, as well as 2.5 cm and greater than 2.5 cm, respectively. CC 0/1 was macroscopically considered a complete resection, with the subsequent administration of HIPEC. CC 2/3 cases were deemed incomplete cytoreduction, and patients were not given HIPEC. HIPEC was conducted using the open abdominal “coliseum” technique. The technique for CRS/HIPEC has been described elsewhere and was based on Sugarbaker’s principles [55,56]. When the hyperthermic perfusion reached a steady state of 42 °C, the intraperitoneal drug was added to the perfusion. We mainly used two different chemotherapeutic regimens for intraperitoneal perfusion: mitomycin C or oxaliplatin. HIPEC was delivered with 35-mg/m2 mitomycin C over a 60-min period or with 460-mg/m2 oxaliplatin over a 30-min period. One hour before starting the HIPEC procedure with oxaliplatin, folinic acid 20 mg/m2 and 5-fluorouracil 400 mg/m2 (in 250-mL saline) were intravenously administered to enhance the effect of oxaliplatin. \n\nAll anastomosis were fashioned after the completion of HIPEC, including urinary reconstruction. Monitoring the urine output during the whole procedure and particularly during HIPEC was an important point for this purpose: bilateral urinary catheters were inserted after the transection of the ureter.\n\n4.4. Study Criteria\nStandardized clinical data on consecutive patients who underwent TPE/CRS/HIPEC were retrospectively retrieved from prospectively maintained databases. The following preoperative variables were recorded: the demographic characteristics, primary tumor site and histology, comorbidities, history of abdominal surgery, preoperative nutritional status, American Society of Anesthesiologists (ASA) preoperative score, and Eastern cooperative oncology group (ECOG) performance status. Surgery-specific data were collected, including the extent of peritoneal carcinomatosis, extent of TPE, number and type of resected organs, CCR score, duration of surgery, estimated blood loss (EBL), and red blood cell (RBC) transfusion. Clinical outcomes and postoperative complications were recorded, including the incidence of overall complications. The need for reoperation, postoperative length of stay, and mortality were also recorded. All complications were classified according to the Clavien–Dindo classifications [57], which define severe complications by a score of 3 or more. The criterion for complications and operative mortality occurred within 90 days of surgery or at any time during the postoperative hospital stay.\n\nPatients were followed up with, and all were reviewed at one month and then every four months with a physical examination, carcinoembryonic antigen CEA level measurements, and abdominal ultrasonography or a thoracoabdominal CT scan. Local recurrence was defined as a radiologically and/or a biopsy-proven tumor within the pelvis. Distant recurrence was defined as radiologic evidence of a tumor in any other area.\n\n4.5. Ethics\nThe current study was performed with the approval of the institutional ethics committee review board (E2020-72). The specific written informed consent of patients was not required for this observational consecutive case study.\n\n5. Conclusions\nIn summary, TPE/ETPE associated with CRS/HIPEC may be a reasonable procedure in selected patients at expert centers. Pelvic involvement should not be considered a definitive contraindication for CRS/HIPEC in patients with resectable peritoneal surface disease if a R0 resection could be achieved on all sites. A longer follow-up period should make it possible to assess the oncological benefits more surely. The morbidity and the mortality are high with this combination of treatments, and further research is needed to assess the oncologic benefits and quality of life before such a radical approach can be recommended.\n\nPublisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAuthor Contributions\nConceptualization and methodology: J.-J.T., J.C., and J.P.; software: J.-J.T. and E.P.; validation: J.-J.T., E.P., and J.C.; formal analysis: J.-J.T., M.M., and F.D.F.; investigation: J.P., F.-X.N., G.W., T.C., J.-C.S., F.D.F., M.M., and E.P.; resources: J.-J.T. and J.C.; data curation: J.-J.T. and J.C.; writing—original draft preparation: J.-J.T. and J.C.; writing—review and editing: J.-J.T., J.C., G.W., T.C., J.P., M.M., and E.P.; visualization: J.-J.T. and J.C.; project supervision: J.-J.T. and J.C.; and administration: J.-J.T. and J.C. All authors have read and agreed to the published version of the manuscript.\n\nFunding\nThis research received no external funding.\n\nConflicts of Interest\nThe authors declare no conflict of interest.\n\ncancers-12-03478-t001_Table 1Table 1 Baseline patient characteristics.\n\nPatient\tYear\nHIPEC\tGender\tAge (Y)\tBMI\tASA\tECOG PS\tDelay/Primary Tumor\tRadiochemotherapy (Primary Lesion)\tPrevious Surgical History\tACE\tNeoadjuvant Treatment\t\n1\t03/2010\tF\t61\t27.6\t2\t0\t12 months\nRectal adenocarcinoma\tno\tHysterectomy March 2008\nProctectomy Nov 2008\t59\tno\t\n2\t11/2011\tF\t46\t28\t2\t0\t14 months\nRectal adenocarcinoma\tno\tProctectomy July 2010\nOvariectomy July 2011 with packing for bleeding\tNA\tFolfirinox\t\n3\t05/2012\tM\t51\t23\t2\t1\t8.5 months\nRectal adenocarcinoma\tno\tR2 Low Hartman sept 2011\nRectal stump leakage\t1\tCap 50\t\n4\t09/2013\tF\t58\t22\t2\t0\t77 months\nAppendiceal carcinoma with carcinomatosis PCI 18\tno\tRight colectomy, posterior pelvectomy, HIPEC oxaliplatin\t7\tno\t\n5\t02/2014\tM\t69\t29.7\t2\t0\t56 months\nRectal adenocarcinoma\tno\tProctectomy 6/2009\t30\tFolfox avastin\t\n6\t05/2015\tM\t69\t26\t2\t0\t27 months\nRectal adenocarcinoma (leak, fecal peritonitis)\tY (2012) Cap 50\tProctectomy 02/2013\t2\tFolfox 4 vectibix\t\n7\t06/2016\tM\t41\t17\t2\t0\t6 months\nColon and rectal adenocarcinoma (Lynch Syndrome)\tno\tRight colectomy 04/2014\nLeft colectomy 09/2015\nProctectomy (R2) 01/2016\tNA\tno\t\n8\t01/2017\tM\t44\t18\t2\t0\t17 months\nrectal adenocarcinoma\tno\tProctectomy + partial cystectomy 07/2015\t21\tFolfiri Erbitux\t\n9\t02/2018\tM\t58\t21\t2\t0\tPrimary rectal adenocarcinoma\tno\tExplorative laparotomy 07-2017\t6\tfolfox\t\n10\t04/2018\tM\t57\t22\t2\t0\tPrimary rectal adenocarcinoma\tno\tExplorative laparotomy 05-2017\nExplorative laparotomy 10-2017\tNA\tFolfirinox\nCap 50\t\n11\t01/2019\tM\t39\t29\t1\t0\t24 months\nRectal adenocarcinoma\tno\tProctectomy 01-2017\t\n\tfolfiri\t\n12\t03/2019\tM\t45\t32.5\t1\t0\tPrimary rectal adenocarcinoma (signet ring cell)\tno\tnone\t3\tfolfirinox\t\n13\t03/2020\tH\t55\t20\t1\t0\tPrimary rectal adenocarcinoma\tno\tnone\t4.6\tCap 50\t\n14\t05/2020\tM\t67\t25\t2\t0\t18 months\nRectal adenocarcinoma\tno\tproctectomy + partial cystectomy 01-2019\t4\tFolfox\t\n15\t06/2020\tM\t65\t26\t2\t0\tRectal adenocarcinoma \n24 months\tY (2018) Cap 50\tProctectomy 06-2018\t11\tFolfiri avastin\t\n16\t07/2020\tF\t66\t27\t2\t0\tRectal adenocarcinoma \n8 months\tno\tProctectomy 12-2019\t14\tFolfiri avastin\t\nHIPEC: hyperthermic intraperitoneal chemotherapy, M: male, F: female, BMI: Body Mass Index, ASA: American Society of Anesthesiologists preoperative score, ECOG PS: Eastern Cooperative Oncology Group-Performance Status, PCI: Peritoneal Cancer Index, and Cap 50: 50 Gy irradiation and 1600-mg/m oral capecitabine.\n\ncancers-12-03478-t002_Table 2Table 2 Detailed information on the surgical resections.\n\nPatient\tPCI\tExenteration\tETPE\tAortic Clamping\tDuration, Blood Loss, Transfusion\tNumber of Resected Organs\tNumber of Anastomosis\tUrinary Reconstruction\tDigestive Reconstruction\tEmpty Pelvis Management\tCC/Radicality\tHIPEC\t\n1\t5\tSL TPE\tNo\tno\t600 min, 800 mL\n2 PRBC\t4\t3 + rectal stump\tBricker\tEC\tnone\tCC0 / R0\tOx\t\n2\t7\tSL ETPE\tLC both side, pre-sacral fascia, Small bowel\tY\n30 min\t640 min, NA\n12 PRBC, 6 FFP\t5\t4 + rectal stump\tBricker\tEC\tBreast prosthesis\nLeft VRAM\tCC0/ R0\tOx\t\n3\t8\tIL ETPE\tLC both side, pre-sacral fascia, Right colectomy, Small bowel\tY\n19 min\t660 min, 4000 mL\n6 RBC, 5 FFP\t6\t4\tBricker\n\tEC\tnone\tCC0/ R0\tMC\t\n4\t13\tSL ETPE\tLC one side, Obturator nerve, Small bowel\t\n\t710 min, 2200 mL\n8 PRBC, 8 FFP, 1 PC\t4\t4 + rectal stump\tBricker\tEC\tnone\tCC0/ R0\tMC\t\n5\t16\tSL ETPE\tLC one side, pre-sacral fascia, Small bowel, Caecum, Ext iliac artery prosthetic replacement\tno\t840 min, 6000 mL\n15 PRBC, 12 FFP, 2 PC\t7\t5 + rectal stump\tBricker\tEC\tnone\tCC0/ R1\tMC\t\n6\t6\tSL ETPE\tLC both side, pre-sacral fascia, Small bowel\tno\t630 min, NA\n7 PRBC, 7 FFP, 1 PC\t5\t4 + rectal stump\tBricker\tEC\tnone\tCC0/ R1\tMC\t\n7\t13\tSL ETPE\tLC both side, pre-sacral fascia, Small bowel\tY \n60 min\t660 min, 5500 mL\n7 PRBC, 4 FFP, 1 PC\t5\t4 + rectal stump\tBricker\tEC\tBiological prosthesis\tCC0 /R1\tMC\t\n8\t12\tSL ETPE\tLC one side, Ext iliac vein prosthetic replacement, Small bowel\tno\t600 min, 4000 mL\n8 PRBC, 8 FFP, 1PC\t6\t0\tBilateral ureterostomy\tDCAA\tDCAA\tCCO R0\tMC\t\n9\t4\tSL ETPE\nSplenectomy\tLC one side, Face lat G, Small bowel\tno\t420 min, 500 mL\n3 PRBC, 2 FFP\t5\t4\tBricker\tDCAA\tDCAA\n\tCC0 R0\tMC\t\n10\t4\tIL TPE\tNo\tY\n21 min\t440 min, 1500 mL\n4 PRBC, 2 FFP\t4\t0\tBilateral ureterostomy\tEC\tEpiplooplastie\nCaecum\tCC0 R0\tMC\t\n11\t6\tSL TPE\nPD for PM\tNo\tno\t500 mL\nNo transfusion\t7\t2 + wirsungostomy\tBilateral ureterostomy\tEC\tLeft VRAM\nCaecum\tCC0 R0\tMC\t\n12\t12\tSL TPE\nSmall bowel caecum\tNo\tno\t580 min, 750 mL\nNo transfusion\t6\t1\tBilateral ureterostomy\tDCAA\n\tDCAA\nLeft VRAM\tCC0 R0\tMC\t\n13\t3\tIL ETPE\tDistal sacrectomy\tno\t420 min, 750 mL\n4 PRBC, 1 FFP\t4\t3\tBricker\tEC\tRight VRAM\tCC0 R0\tMC\t\n14\t4\tSL TPE\tNo\tno\t600 min, 800 mL\nNo transfusion\t4\t3\tBricker\tDCAA\n\tDCAA\nCaecum\tCC0 R0\tMC\t\n15\t13\tSL ETPE\tLC both side, Small bowel, caecum\nThermoablation LM\tno\t600 min, 2300 mL\n3 PRBC, 2 FFP\t6\t3\tBricker\tDCAA\tDCAA\tCC0 R0\tMC\t\n16\t8\tSL TPE\t\n\tno\t540 min, 700 mL\n1 PRBC\t4\t0\tBilateral ureterostomy\tDCAA\tDCAA\tCC0 R0\tMC\t\nPCI: Peritoneal Cancer Index, TPE: total pelvic exenteration, ETPE: extended total pelvic exenteration, PD: pancreaticoduodenectomy: PM: pancreas metastasis, SL: supra-levator, IL: infra-levator, LC: lateral compartment, PRBC: packed red blood cells, FFP: fresh frozen plasma, PC: platelet concentrates, DCAA: Delayed Coloanal Anastomosis, EC: end colostomy CC: completeness of cytoreduction, HIPEC: hyperthermic intraperitoneal chemotherapy, Ox: oxaliplatin, MC: mitomycin C, R0: clear resection margins, and LM: liver metastasis.\n\ncancers-12-03478-t003_Table 3Table 3 Postoperative course, morbidity, recurrence, and follow-up.\n\nPatient\tICU Stay (Day)\tHospital Stay (Day)\tComplication\tNumber of re Laparotomy *\tDindo\tAdjuvant Treatment\tRecurrence\tStatus\t\n1\t3\t48\tPelvic abscess\t0\tII\t5FU\tPM at 27 months\tDead at 41 months\nSepsis following chemotherapy\t\n2\t3\t39\tBricker leakage (pod 17)\t1\tIIIB\tPelvic Cap 50\tPC at 9 months\tDead at 11 months\t\n3\t3\t41\tPelvic abscess\nRadiologic drainage\t0\tIIIA\tnone\tPC at 10 months\tDead at 13 months\t\n4\t4\t53\tPelvic abscess\nRadiologic drainage\nSeptic shock (urine) ICU 4 days\t0\tIVa\tnone\tVaginal recurrence at 11 months\tDead at 16 months\t\n5\t4\t75\tBricker leakage (pod 23)\t1\tIIIB\tnone\tPM at 29 months\tDead at 42 months\t\n6\t31\t31\tBricker leakage, urosepsis and peritonitis\t5\tV\tNR\tNR\tPostoperative death (31pod)\t\n7\t58 (4stay)\t129\tIterative pelvis bleeding\nBricker leakage, Urosepsis\nFungal Peritonitis\t8\tV\tNR\tNR\tPostoperative death\n(pod 129)\t\n8\t3\t45\tUrosepsis\t0\tII\tnone\tLM at 12 months\tAlive with LM at 44 months\t\n9\t3\t30\tFluid collection left flank\nRadiologic drainage\t0\tIIIa\tnone\t\n\tAlive at 32 months\t\n10\t3\t26\tUrosepsis\t0\tI\tfolfox\tLM and PC at 10 months\tDead at 15 months\t\n11\t3\t50\tBiliary leak, Septic shock (implantable port) ICU 8 days\t1\tIVa\tnone\tLM and PM at 12 months\tDead at 21 months\t\n12\t3\t60\turosepsis\t0\tII\tnone\tnone\tAlive at 19 months\t\n13\t3\t39\tUrosepsis\nFungal septicemia\t0\tII\tnone\tnone\tAlive at 7 months\t\n14\t3\t57\tUrosepsis\nsepticemia\t0\tII\tfolfox\tnone\tAlive at 5 months\t\n15\t3\t47\tUrosepsis\nWound dehiscence\t1\tIIIb\tfolfox\tnone\tAlive at 4 months\t\n16\t3\t37\tUrosepsis\nCOVID 19\t0\tII\tfolfox\tnone\tAlive at 3 months\t\nICU: Intensive Care Unit, pod: postoperative day, Cap 50: 50 Gy irradiation and 1600 mg/m oral capecitabine daily, PM: pulmonary metastasis, LM: liver metastasis, PC: peritoneal carcinomatosis, *: the second time of delayed coloanal anastomosis was not counted as a reoperation, Recurrence: the first recurrence site was only reported in this table, and NR: nonrelevant.\n==== Refs\nReferences\n1. Glehen O. Gilly F.N. Boutitie F. Bereder J.M. Quenet F. Sideris L. Mansvelt B. Lorimier G. Msika S. Elias D. French Surgical Association. Toward curative treatment of peritoneal carcinomatosis from nonovarian origin by cytoreductive surgery combined with perioperative intraperitoneal chemotherapy: A multi-institutional study of 1290 patients Cancer 2010 116 5608 5618 20737573 \n2. Moran B. Cecil T. Chandrakumaran K. Arnold S. Mohamed F. Venkatasubramaniam A. The results of cytoreductive surgery and hyperthermic intraperitoneal chemotherapy in 1200 patients with peritoneal malignancy Colorectal Dis. 2015 17 772 778 25880479 \n3. Chua T.C. Saxena A. Schellekens J.F. Liauw W. Yan T.D. Fransi S. Zhao J. Morris D.L. Morbidity and mortality outcomes of cytoreductive surgery and perioperative intraperitoneal chemotherapy at a single tertiary institution: Towards a new perspective of this treatment Ann. Surg. 2010 251 101 106 19838105 \n4. Verwaal V.J. van Tinteren H. Ruth S.V. Zoetmulder F.A. Toxicity of cytoreductive surgery and hyperthermic intra-peritoneal chemotherapy J. Surg. Oncol. 2004 85 61 67 14755505 \n5. Sugarbaker P.H. Alderman R. Edwards G. Marquardt C.E. Gushchin V. Esquivel J. Chang D. Prospective morbidity and mortality assessment of cytoreductive surgery plus perioperative intraperitoneal chemotherapy to treat peritoneal dissemination of appendiceal mucinous malignancy Ann. Surg. Oncol. 2006 13 635 644 16523363 \n6. Schwarz L. Votanopoulos K. Morris D. Yonemura Y. Deraco M. Piso P. Moran B. Levine E.A. Tuech J.J. Is the Combination of Distal Pancreatectomy and Cytoreductive Surgery with HIPEC Reasonable? Results of an International Multicenter Study Ann. Surg. 2016 263 369 375 25915913 \n7. Sugarbaker P.H. Total pelvic exenterative surgery in patients with peritoneal metastases from appendiceal neoplasms. A case series of 2 patients Int. J. Surg. Case Rep. 2019 65 279 283 31756689 \n8. Shinde R.S. Acharya R. Kumar N.A. Solanki S. Desouza A. Saklani A. Pelvic Exenteration with Cytoreductive Surgery and Hyperthermic Intraperitoneal Chemotherapy (CRS + HIPEC) for Rectal Cancer-Case Series with Review of Literature Indian J. Surg. Oncol. 2019 10 80 83 \n9. Bacalbasa N. Balescu I. Pelvic exenteration as part of cytoreductive surgery for advanced stage or relapsed ovarian cancer Eur. J. Surg. Oncol. 2016 42 S158 \n10. Rodriguwz-Bigas M.A. Petrelli N.J. Pelvic exenteration and its modifications Am. J. Surg. 1996 171 293 298 8619471 \n11. Lopez M.J. Standiford S.B. Skibba J.L. Total pelvic exenteration. A 50-year experience at the Ellis Fischel Cancer Center Arch. Surg. 1994 129 390 396 8154965 \n12. Tuech J.J. Lefebure B. Michot F. Teniere P. Pelvic exenteration for cancer J. Chir. 2005 142 367 374 \n13. Tuech J.J. Schwarz L. Coget J. Bridoux V. Difficult hemostasis during radical pelvic surgery J. Visc. Surg. 2015 152 119 124 25680627 \n14. Heriot A.G. Byrne C.M. Lee P. Dobbs B. Tilney H. Solomon M.J. Mackay J. Frizelle F. Extended radical resection: The choice for locally recurrent rectal cancer Dis. Colon. Rectum. 2008 51 284 291 18204879 \n15. Denost Q. Solomon M. Tuech J.J. Ghouti L. Cotte E. Panis Y. Lelong B. Rouanet P. Faucheron J.L. Jafari M. International variation in managing locally advanced or recurrent rectal cancer: Prospective benchmark analysis Br. J. Surg. 2020 107 1846 1854 10.1002/bjs.11854 32786027 \n16. Aoyama T. Oba K. Honda M. Sadahiro S. Hamada C. Mayanagi S. Kanda M. Maeda H. Kashiwabara K. Sakamoto J. Impact of postoperative complications on the colorectal cancer survival and recurrence: Analyses of pooled individual patients’ data from three large phase III randomized trials Cancer Med. 2017 6 1573 1580 28639738 \n17. Mrak K. Eberl T. Laske A. Jagoditsch M. Fritz J. Tschmelitsch J. Impact of postoperative complications on long-term survival after resection for rectal cancer Dis. Colon. Rectum. 2013 56 20 28 23222276 \n18. Slankamenac K. Slankamenac M. Schlegel A. Nocito A. Rickenbacher A. Clavien P.A. Turina M.I. Impact of postoperative complications on readmission and long-term survival in patients following surgery for colorectal cancer Int. J. Colorectal Dis. 2017 32 805 811 28411352 \n19. Schneider M.A. Eshmuminov D. Lehmann K. Major postoperative complications are a risk factor for impaired survival after CRS/HIPEC Ann. Surg. Oncol. 2017 24 2224 2232 28265776 \n20. Simkens G.A. van Oudheusden T.R. Luyer M.D. Nienhuijs S.W. Nieuwenhuijzen G.A. Rutten H.J. de Hingh I.H. Serious postoperative complications affect early recurrence after cytoreductive surgery and HIPEC for colorectal peritoneal carcinomatosis Ann. Surg. Oncol. 2015 22 2656 2662 25515200 \n21. Chua T.C. Yan T.D. Saxena A. Morris D.L. Should the treatment of peritoneal carcinomatosis by cytoreductive surgery and hyperthermic intraperitoneal chemotherapy still be regarded as a highly morbid procedure? A systematic review of morbidity and mortality Ann. Surg. 2009 249 900 907 19474692 \n22. Glehen O. Osinsky D. Cotte E. Kwiatkowski F. Freyer G. Isaac S. Trillet-Lenoir V. Sayag-Beaujard A.C. François Y. Vignal J. Intraperitoneal chemohyperthermia using a closed abdominal procedure and cytoreductive surgery for the treatment of peritoneal carcinomatosis: Morbidity and mortality analysis of 216 consecutive procedures Ann. Surg. Oncol. 2003 10 863 869 14527903 \n23. Kusamura S. Younan R. Baratti D. Costanzo P. Favaro M. Gavazzi C. Deraco M. Cytoreductive surgery followed by intraperitoneal hyperthermic perfusion: Analysis of morbidity and mortality in 209 peritoneal surface malignancies treated with closed abdomen technique Cancer 2006 106 1144 1153 16456817 \n24. Gusani N.J. Cho S.W. Colovos C. Seo S. Franko J. Richard S.D. Edwards R.P. Brown C.K. Holtzman M.P. Zeh H.J. Aggressive surgical management of peritoneal carcinomatosis with low mortality in a high-volume tertiary cancer center Ann. Surg. Oncol. 2008 15 754 763 18080166 \n25. Kusamura S. Baratti D. Virzì S. Bonomi S. Iusco D.R. Grassi A. Hutanu I. Deraco M. Learning curve for cytoreductive surgery and hyperthermic intraperitoneal chemotherapy in peritoneal surface malignancies: Analysis of two centres J. Surg. Oncol. 2013 107 312 319 22926536 \n26. Levine E.A. Stewart J.H. Shen P. Russell G.B. Loggie B.L. Votanopoulos K.I. Intraperitoneal chemotherapy for peritoneal surface malignancy: Experience with 1000 patients J. Am. Coll. Surg. 2014 218 573 585 24491244 \n27. Baratti D. Kusamura S. Mingrone E. Balestra M.R. Laterza B. Deraco M. Identification of a subgroup of patients at highest risk for complications after surgical cytoreduction and hyperthermic intraperitoneal chemotherapy Ann. Surg. 2012 256 334 341 22580946 \n28. Honoré C. Souadka A. Goéré D. Dumont F. Deschamps F. Elias D. HIPEC for peritoneal carcinomatosis: Does an associated urologic procedure increase morbidity? Ann. Surg. Oncol. 2012 19 104 109 21638092 \n29. Sugarbaker P.H. Chang D. Stuart O.A. Hyperthermic intraoperative thoracoabdominal chemotherapy Gastroenterol. Res. Pract. 2012 2012 623417 22654899 \n30. Wagner P.L. Austin F. Maduekwe U. Mavanur A. Ramalingam L. Jones H.L. Holtzman M.P. Ahrendt S.A. Zureikat A.H. Pingpank J.F. Extensive cytoreductive surgery for appendiceal carcinomatosis: Morbidity, mortality, and survival Ann. Surg. Oncol. 2013 20 1056 1062 23456385 \n31. Lyon T.D. Turner R.M.I.I. Nikonow T.N. Wang L. Uy J. Ramalingam L. Holtzman M.P. Pingpank J.F. Bartlett D.L. Davies B.J. Effect of a concomitant urologic procedure on outcomes following cytoreductive surgery with hyperthermic intraperitoneal chemotherapy J. Surg. Oncol. 2016 113 218 222 26775909 \n32. Morkavuk Ş.B. Güner M. Tez M. Ünal A.E. The outcomes of isolated ureteral resection and reconstruction in non-urologic cancer patients who underwent cytoreductive surgery (CRC) and hyperthermic intraperitoneal chemotherapy (HIPEC) World J. Surg. Oncol. 2019 26 230 236 \n33. Pinar U. Tremblay J.F. Passot G. Dazza M. Glehen O. Tuech J.J. Pocard M. BIG-RENAPE Working Group Reconstruction after ureteral resection during HIPEC surgery: Reimplantation with uretero-neocystostomy seems safer than end-to-end anastomosis J. Visc. Surg. 2017 154 227 230 28709979 \n34. Brown K.G. Solomon M.J. Latif E.R. Koh C.E. Vasilaras A. Eisinger D. Sved P. Urological complications after cystectomy as part of pelvic exenteration are higher than that after cystectomy for primary bladder malignancy J. Surg. Oncol. 2017 115 307 311 27859276 \n35. Teixeira S.C. Ferenschild F.T. Solomon M.J. Rodwell L. Harrison J.D. Young J.M. Vasilaras A. Eisinger D. Lee P. Byrne C. Urological leaks after pelvic exenterations comparing formation of colonic and ileal conduits Eur. J. Surg. Oncol. 2012 38 361 366 22265840 \n36. Brown K.G. Koh C.E. Vasilaras A. Eisinger D. Solomon M.J. Clinical algorithms for the diagnosis and management of urological leaks following pelvic exenteration Eur. J. Surg. Oncol. 2014 40 775 781 24144833 \n37. Longo N. Imbimbo C. Fusco F. Ficarra V. Mangiapia F. Di Lorenzo G. Creta M. Imperatore V. Mirone V. Complications and quality of life in elderly patients with several comorbidities undergoing cutaneous ureterostomy with single stoma or ileal conduit after radical cystectomy BJU Int. 2016 118 521 526 26935245 \n38. Arman T. Mher B. Varujan S. Sergey F. Ashot T. Health-related quality of life in patients undergoing radical cystectomy with modified single stoma cutaneous ureterostomy, bilateral cutaneous ureterostomy and ileal conduit Int. Urol. Nephrol. 2020 52 1683 1689 32306198 \n39. Orr JWJr Shingleton H.M. Hatch K.D. Taylor P.T. Partridge E.E. Soong S.J. Gastrointestinal complications associated with pelvic exenteration Am. J. Obstet. Gynecol. 1983 145 325 332 6824022 \n40. Tuech J.J. Chaudron V. Thoma V. Ollier J.C. Tassetti V. Duval D. Rodier J.F. Prevention of radiation enteritis by intrapelvic breast prosthesis Eur. J. Surg. Oncol. 2004 30 900 904 15336738 \n41. Micha J.P. Goldstein B.H. Rettenmaier M.A. Brown J.V. Cecal pelvic transposition following total pelvic exenteration Gynecol. Oncol. 2004 94 589 592 15297211 \n42. Tuech J.J. Bodin F. Bruant C. Rodier J.F. Rectus abdominis myocutaneous flap reconstruction after pelvic surgery for cancer J. Chir. 2002 139 339 342 \n43. Lee P. Tan W.J. Brown K.G.M. Solomon M.J. Addressing the empty pelvic syndrome following total pelvic exenteration: Does mesh reconstruction help? Colorectal Dis. 2019 21 365 369 30548166 \n44. Bonnefoy I. Mohamed F. Bonnot P.E. Benzerdjeb N. Isaac S. Cotte E. Glehen O. Passot G. Risk of Omental Metastases in Patients Undergoing Cytoreductive Surgery for Colorectal Peritoneal Metastases Dis. Colon Rectum. 2020 63 1251 1256 10.1097/DCR.0000000000001670 32618618 \n45. Bhangu A. Brown G. Akmal M. Tekkis P. Outcome of abdominosacral resection for locally advanced primary and recurrent rectal cancer Br. J. Surg. 2012 99 1453 1461 22961529 \n46. Smith J.D. Nash G.M. Weiser M.R. Temple L.K. Guillem J.G. Paty P.B. Multivisceral resections for rectal cancer Br. J. Surg. 2012 99 1137 1143 22696063 \n47. Beyond TME Collaborative Consensus statement on the multidisciplinary management of patients with recurrent and primary rectal cancer beyond total mesorectal excision planes Br. J. Surg. 2013 100 E1 E33 23901427 \n48. Wasserman K. Diagnosing cardiovascular and lung pathophysiology from exercise gas exchange Chest 1997 112 1091 1101 9377922 \n49. Older P. Hall A. Hader R. Cardiopulmonary exercise testing as a screening test for perioperative management of major surgery in the elderly Chest 1999 116 355 362 10453862 \n50. Magrina J.F. Types of pelvic exenterations: A reappraisal Gynecol. Oncol. 1990 37 363 366 2351320 \n51. Magrina J.F. Stanhope C.R. Weaver A.L. Pelvic exenterations: Supralevator, infralevator, and with vulvectomy Gynecol. Oncol. 1997 64 130 135 8995561 \n52. Georgiou P.A. Tekkis P.P. Constantinides V.A. Patel U. Goldin R.D. Darzi A.W. Nicholls R.J. Brown G. Diagnostic accuracy and value of magnetic resonance imaging (MRI) in planning exenterative pelvic surgery for advanced colorectal cancer Eur. J. Cancer 2013 49 72 81 23036847 \n53. Portilla A.G. Shigeki K. Dario B. Marcello D. The intraoperative staging systems in the management of peritoneal surface malignancy J. Surg. Oncol. 2008 98 228 231 18726882 \n54. Jacquet P. Sugarbaker P.H. Clinical research methodologies in diagnosis and staging of patients with peritoneal carcinomatosis Cancer Treat. Res. 1996 82 359 374 8849962 \n55. Sugarbaker P.H. Intraperitoneal chemotherapy and cytoreductive surgery for the prevention and treatment of peritoneal carcinomatosis and sarcomatosis Semin. Surg. Oncol. 1998 14 254 261 9548609 \n56. Sugarbaker P.H. Peritonectomy procedures Ann. Surg. 1995 221 29 42 7826158 \n57. Dindo D. Demartines N. Clavien P.-A. Classification of surgical complications: A new proposal with evaluation in a cohort of 6336 patients and results of a survey Ann. Surg. 2004 240 205 213 15273542\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2072-6694",
"issue": "12(11)",
"journal": "Cancers",
"keywords": "cytoreductive surgery; empty pelvis syndrome; hyperthermic intraperitoneal chemotherapy; ileal conduit; pelvic exenteration; peritoneal carcinomatosis; peritoneal metastases; urinary leakage",
"medline_ta": "Cancers (Basel)",
"mesh_terms": null,
"nlm_unique_id": "101526829",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "33238384",
"pubdate": "2020-11-23",
"publication_types": "D016428:Journal Article",
"references": "8619471;22926536;28639738;23222276;19838105;8849962;8995561;2351320;15297211;32618618;12538954;22961529;25515200;28709979;19474692;30886498;15336738;25680627;10453862;22580946;20737573;22654899;14527903;18080166;18204879;21638092;23901427;16456817;26935245;28411352;16555441;31756689;6824022;22696063;23456385;9377922;24491244;7826158;25915913;24144833;30548166;31878943;15273542;25880479;27859276;26775909;32786027;32306198;18726882;14755505;23036847;16523363;8154965;22265840;28265776;9548609",
"title": "Total Pelvic Exenteration, Cytoreductive Surgery, and Hyperthermic Intraperitoneal Chemotherapy for Rectal Cancer with Associate Peritoneal Metastases: Surgical Strategies to Optimize Safety.",
"title_normalized": "total pelvic exenteration cytoreductive surgery and hyperthermic intraperitoneal chemotherapy for rectal cancer with associate peritoneal metastases surgical strategies to optimize safety"
} | [
{
"companynumb": "FR-ROCHE-2786693",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CAPECITABINE"
},
"drugadditional": "3",
"dru... |
{
"abstract": "Hemocholecyst is defined as a hemorrhage into the gallbladder. It is a rare complication of anticoagulant therapies which can progress to spontaneous rupture of the gallbladder with hemorrhagic shock. We report the case of a 75-year old hypertensive, dyslipidemic man with hypertensive heart disease initially hospitalized for left hemiplegia. The patient received antiplatelet and anticoagulant therapy with low molecular weight heparin (LMWH) as prevention strategy. After 5 days of treatment the patient developed hemocholecyst and hemoperitoneum, confirmed by angio-abdominal computerized tomography scan in emergency assessment. The patient underwent cholecystectomy, hemostasis of the gallbladder fossa and evacuation of the hemoperitoneum.",
"affiliations": "Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.;Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie.",
"authors": "Rejab|Haithem|H|;Trigui|Aymen|A|;Ameur|Hazem Ben|HB|;Majdoub|Youssef|Y|;Daoud|Rahma|R|;Akrout|Amira|A|;Boujelbene|Salah|S|;Mzali|Rafik|R|",
"chemical_list": "D000925:Anticoagulants; D006495:Heparin, Low-Molecular-Weight",
"country": "Uganda",
"delete": false,
"doi": "10.11604/pamj.2019.34.45.18682",
"fulltext": "\n==== Front\nPan Afr Med JPan Afr Med JPAMJThe Pan African Medical Journal1937-8688The African Field Epidemiology Network PAMJ-34-4510.11604/pamj.2019.34.45.18682Case ReportHémocholécyste compliquée d’une rupture de la vésicule biliaire Hemocholecyst complicated by rupture of the gallbladder Rejab Haithem 1Trigui Aymen 1&Ameur Hazem Ben 1Majdoub Youssef 1Daoud Rahma 1Akrout Amira 1Boujelbene Salah 1Mzali Rafik 1\n1 Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie& Auteur correspondant: Aymen Trigui, Faculté de Médecine de Sfax, Service de Chirurgie Viscérale et Générale, Hôpital Habib Bourguiba, Sfax, Tunisie24 9 2019 2019 34 4515 3 2019 30 7 2019 © Haithem Rejab et al.2019The Pan African Medical Journal - ISSN 1937-8688. This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.L'hémocholécyste est défini par la présence d'une hémorragie au sein de la vésicule biliaire. C'est une complication rare des traitements anticoagulants, elle peut évoluer vers la rupture spontanée de la vésicule biliaire se traduisant par un état de choc hémorragique. Nous rapportons le cas d'un homme de 75 ans, hypertendu, dyslipidémique et porteur d'une cardiopathie hypertensive, qui a été hospitalisé initialement dans un tableau d'hémiplégie gauche. Le patient a été alors mis sous traitement antiagrégant plaquettaire et une anticoagulation par héparine de bas poids moléculaire (HBPM) à dose préventive. Compliqué au 5ème jour de traitement d'un hémocholécyste et hémopéritoine confirmé par un angio-tomodensitométrie abdominale faite en urgence. Le geste a consisté en une cholécystectomie, une hémostase du lit vésiculaire et une évacuation de l'hémopéritoine.\n\nHemocholecyst is defined as a hemorrhage into the gallbladder. It is a rare complication of anticoagulant therapies which can progress to spontaneous rupture of the gallbladder with hemorrhagic shock. We report the case of a 75-year old hypertensive, dyslipidemic man with hypertensive heart disease initially hospitalized for left hemiplegia. The patient received antiplatelet and anticoagulant therapy with low molecular weight heparin (LMWH) as prevention strategy. After 5 days of treatment the patient developed hemocholecyst and hemoperitoneum, confirmed by angio-abdominal computerized tomography scan in emergency assessment. The patient underwent cholecystectomy, hemostasis of the gallbladder fossa and evacuation of the hemoperitoneum.\n\nHémocholécystehémopéritoineanticoagulantHemocholecysthemoperitoneumanticoagulant\n==== Body\nIntroduction\nL'hémocholécyste est défini par la présence d'une hémorragie au sein de la vésicule biliaire. C'est une complication rare des traitements anticoagulants, elle peut évoluer vers la rupture spontanée de la vésicule biliaire se traduisant par un état de choc hémorragique. Avec l'imagerie en coupe, le diagnostic se fait précocement permettant ainsi une prise en charge chirurgicale rapide.\n\nPatient et observation\nNous rapportons le cas d'un homme de 75 ans, hypertendu, dyslipidémique et porteur d'une cardiopathie hypertensive, qui a été hospitalisé initialement dans un tableau d'hémiplégie gauche. Le diagnostic d'accident vasculaire cérébral (AVC) récent au territoire sylvien total droit a été confirmé par une tomodensitométrie (TDM) cérébrale. Le patient a été alors mis sous traitement antiagrégant plaquettaire type acide salicylique à la dose de 100 mg/j et une anticoagulation par héparine de bas poids moléculaire (HBPM) à dose préventive. Au cinquième jour de son hospitalisation, le patient a présenté brutalement un syndrome abdominal aigue. A l'examen, le patient était apyrétique, la tension artérielle était de 85/55 mmHg avec une fréquence cardiaque à 110 et une polypnée à 30 cycles/minute. La palpation abdominale a révélé une défense de l'hémi-abdomen droit et une douleur du reste de l'abdomen. Un bilan biologique fait en urgence a montré une baisse de l'hémoglobine de 13,2 à 11,7 g/dl, une numération plaquettaire normale, un taux de prothrombine (TP) à 70%, un temps de céphaline activée (TCA) correct. Par ailleurs, il n'y avait ni hyperleucocytose ni une élévation du « C-reactive protein (CRP) ».\n\nLe diagnostic évoqué, en premier lieu, était une ischémie mésentérique aigue. L'angio-TDM abdominale faite en urgence a montré une vésicule biliaire distendue, siège d'un contenu spontanément hyperdense (densité à 55-60 UH) fusant en intrapéritonéal et en péri hépatique à travers une large perforation de sa paroi latérale droite (Figure 1). Après injection intraveineuse de produit de contraste iodé (PDCI), on a noté dès le temps artériel, une extravasation active du PDCI, débutant au niveau du collet vésiculaire en regard de l'artère cystique et se propageant progressivement aux temps portal et tardif (Figure 2). L'étude de la voie biliaire principale notait également une hémobilie (Figure 3). Le diagnostic d'hémocholécyste compliqué d'une rupture de la vésicule biliaire et d'un hémopéritoine de grande abondance a été retenu. Le patient a été opéré en urgence. L'exploration per opératoire a montré la présence d'un hémopéritoine de grande abondance avec une vésicule biliaire partiellement décollé de son lit et perforée sur 2 cm au niveau de sa face antérieure. On a noté aussi que la présence d'un saignement actif venait de l'intérieur de la vésicule biliaire et à partir du lit vésiculaire décollé. Le geste a consisté en une cholécystectomie, une hémostase du lit vésiculaire et une évacuation de l'hémopéritoine. La vésicule biliaire était alithiasique. L'examen anatomopathologique a conclu à une cholécystite chronique modérée compliquée d'une poussée aiguë. L'évolution au cours des 4 premiers jours post opératoires a été marquée par une instabilité hémodynamique (alternance de pics hypertensifs et d'hypotension sévère) et une aggravation de l'état neurologique associant une altération de l'état de conscience et un passage en anisocorie droite. Une TDM cérébrale en urgence a montré une extension de l'AVC vers tout le territoire carotidien interne droit avec un engagement temporal interne homolatéral. Le patient est décédé à J4 post opératoire.\n\nFigure 1 TDM abdominale sans injection de produit de contraste iodé (PDCI) en coupes axiales (A et B) et coronale (C); hématome intravésiculaire spontanément hyperdense (astérix noire) fusant en intrapéritonéal (flèche blanche) par une large rupture de la paroi de la vésicule biliaire (têtes de flèches blanches)\n\nFigure 2 Angio-TDM abdominale sans injection de PDCI en coupes axiales respectivement aux temps artériel (A et B), portal (C) et tardif (D) et en coupe coronale (E) au temps portal; extravasation active du PDCI en intravésiculaire (flèche blanche) débutant dans le collet dès le temps artériel (A) avec propagation secondaire dans le corps et le fundus de la vésicule biliaire (B, C, D et E)\n\nFigure 3 TDM abdominale sans injection de PDCI en coupes axiale (A) et coronale (B); hémobilie: contenu spontanément hyperdense de la voie biliaire principale (flèche blanche)\n\nDiscussion\nC'est une pathologie très rare, environ 65 cas d'hémocholécyste sous anticoagulants ont été rapportés dans la littérature [1-4]. La particularité de notre observation est la survenue de l'hémocholécyste sous une dose préventive de HBPM. Elle est plus fréquente en cas de cholécystite chronique et souvent secondaire à une effraction de l'artère cystique par l'irritation d'un calcul enclavé au niveau du collet vésiculaire ou à une ulcération par des calculs qui érodent la paroi vésiculaire [5]. L'hypocoagulabilité, induite par les anticoagulants et les antiagrégants plaquettaires, aggrave l'hémorragie intra vésiculaire ce qui peut entrainer une perforation de la vésicule biliaire avec passage du sang dans la cavité péritonéale constituant un hémopéritoine souvent de grande abondance. La zone de perforation habituelle se situe au niveau du fundus, moins vascularisée et plus sensible à l'hyperpression intra vésiculaire [6]. L'hémocholécyste reste asymptomatique dans la majorité des cas [1, 2]. Il peut se présenter comme un tableau de cholécystite aigue ou plus rarement dans un tableau d'état de choc hémorragique avec douleur abdominale. La TDM abdominale est l'examen clé pour le diagnostic positif. Il montre souvent une masse sous hépatique prenant la forme d'une vésicule biliaire dilatée, présentant un contenu hémorragique. Il faut chercher une perforation, un épanchement intra-péritonéal ou une compression d'un organe de voisinage. L'injection de PDC permet d'étudier la paroi vésiculaire et chercher un saignement actif visible sous la forme d'une extravasation de PDC.\n\nConclusion\nMalgré la rareté de la traduction clinique des hémorragies intra vésiculaires, l'hémocholécyste doit être évoqué chez tout patient sous anticoagulants et/ou antiagrégant plaquettaire présentant un tableau douloureux abdominal. La perforation de la vésicule biliaire responsable d'un hémopéritoine et d'un choc hémorragique est la complication la plus redoutée.\n\nConflits d’intérêts\nLes auteurs ne déclarent aucun conflit d'intérêts.\n\nContributions des auteurs\nTous les auteurs ont lu et approuvé la version finale du manuscrit.\n==== Refs\nRéférences\n1 Sandblom P Mirkovitch V Saegesser F Formation and fate of fibrin clots in the biliary tract Ann Surg 1977 3 185 3 356 66 300235 \n2 Laloux S Mallet L Lefrere JJ Languille M Dubertret M Petite JP Un accident exceptionnel des antivitamines K: l'hémobilie Presse Med 1986 9 20 15 30 1423 4 \n3 Van Gossum A Meunier M Boisdenghien A Hémocholécyste. Complication rare d'une anticoagulation orale Gastroenterol Clin Biol 1983 2 7 1 98 6840453 \n4 Mikou MM Mouaffak Y Benyacob A Mosaddek A Faroudy M Ababou A Haemocholecyst: a rare complication of anticoagulant treatment Annales Françaises d'Anesthésie et de Réanimation 2004 7 23 7 733 6 \n5 Leblanc I Bokobza B Michot F Tenière P Hématome sous hépatique pour hémocholécyste lithiasique gangrené sous antivitamine K Ann Chir 1989 43 10 838 9 2619215 \n6 Noël JB Sauvage PJ Sommer V Kuperas C Naouri A Hémorragie intravésiculaire avec rupture intrapéritonéale J Radiol 1999 7 80 7 741 3 10431277\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "34()",
"journal": "The Pan African medical journal",
"keywords": "Hemocholecyst; anticoagulant; hemoperitoneum",
"medline_ta": "Pan Afr Med J",
"mesh_terms": "D000368:Aged; D000925:Anticoagulants; D002763:Cholecystectomy; D005705:Gallbladder Diseases; D006465:Hemoperitoneum; D006495:Heparin, Low-Molecular-Weight; D006801:Humans; D008297:Male; D012422:Rupture, Spontaneous; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "101517926",
"other_id": null,
"pages": "45",
"pmc": null,
"pmid": "31762912",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "2947066;300235;10431277;15324963;6840453;2619215",
"title": "Hemocholecyst complicated by rupture of the gallbladder.",
"title_normalized": "hemocholecyst complicated by rupture of the gallbladder"
} | [
{
"companynumb": "TN-SA-2020SA013550",
"fulfillexpeditecriteria": "1",
"occurcountry": "TN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HEPARIN SODIUM"
},
"drugadditional": "3",
... |
{
"abstract": "Background Denosumab therapy is commonly used for the prevention of skeletal-related events in patients with bone metastasis. However, a common side effect of denosumab is hypocalcemia. Objective The aim of the study is to determine the incidence of hypocalcemia in patients receiving denosumab for prevention of skeletal-related events in bone metastasis and evaluate risk factors for developing hypocalcemia. Methods This was a retrospective medication use evaluation reviewing the incidence of hypocalcemia in patients receiving outpatient denosumab for prevention of skeletal-related events at Yale-New Haven Hospital. Additionally, various risk factors were reviewed to determine their risk of developing hypocalcemia. Results As per Common Terminology Criteria for Adverse Events v4.03, of the 106 patients included in the study population, 37 (35%) patients had an incidence of hypocalcemia within 30 days of denosumab administration. Fourteen patients (13.2%) had an incidence of grade 1, 13 patients (12.3%) had an incidence of grade 2 hypocalcemia, and 7 patients (6.6%) had an incidence of grade 3 hypocalcemia. Grade 4 hypocalcemia occurred in three (2.8%) patients. Calcium supplementation did not decrease the risk of developing hypocalcemia. Patients who had one or more episodes of acute kidney insufficiency were at a higher risk of developing hypocalcemia (odds ratio = 7.5 (95% confidence interval = 1.8-36.3), p = 0.001). Conclusion This study found that the overall incidence of hypocalcemia and severe hypocalcemia was higher than reported in clinical trials. Additionally, calcium supplementation did not have an effect on incidence of hypocalcemia, while patients who experienced acute kidney insufficiency while on denosumab had a higher likelihood of developing hypocalcemia.",
"affiliations": "1 Department of Pharmacy, Yale-New Haven Hospital, USA.;1 Department of Pharmacy, Yale-New Haven Hospital, USA.;1 Department of Pharmacy, Yale-New Haven Hospital, USA.",
"authors": "Yerram|Prakirthi|P|;Kansagra|Shraddha|S|;Abdelghany|Osama|O|",
"chemical_list": "D050071:Bone Density Conservation Agents; D000069448:Denosumab",
"country": "England",
"delete": false,
"doi": "10.1177/1078155216628325",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "23(3)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Denosumab; bone metastasis; hypocalcemia",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D050071:Bone Density Conservation Agents; D001859:Bone Neoplasms; D000069448:Denosumab; D005260:Female; D006801:Humans; D006996:Hypocalcemia; D015994:Incidence; D008297:Male; D008875:Middle Aged; D016017:Odds Ratio; D012189:Retrospective Studies; D012307:Risk Factors",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "179-184",
"pmc": null,
"pmid": "26830549",
"pubdate": "2017-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Incidence of hypocalcemia in patients receiving denosumab for prevention of skeletal-related events in bone metastasis.",
"title_normalized": "incidence of hypocalcemia in patients receiving denosumab for prevention of skeletal related events in bone metastasis"
} | [
{
"companynumb": "US-AMGEN-USASP2017045843",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "CALCIUM"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThe prevalence of prescription opioid use disorders in the US has increased markedly in parallel with increases in opioid prescribing. Whilst an increase in opioid prescribing has also occurred in the UK, it remains unknown if there have been concurrent increases in opioid use disorders. The aim of this study was to examine national trends in the prevalence and incidence of physician-diagnosed opioid use disorders in the UK.\n\n\nMETHODS\nIn a retrospective electronic health care database analysis using data from the UK Clinical Practice Research Datalink (CPRD), we identified persons receiving a first opioid prescription between January 1, 2008 and December 31, 2012. Persons with an opioid use disorder were identified by Read codes assigned by patients' physicians within 6 months following an opioid prescription. We calculated prevalence and incidence rates by dividing the analysis population by the total number of patients exposed (prevalence) or the total patient-years of exposure (incidence) using the 'exact' Clopper-Pearson Binomial method.\n\n\nRESULTS\nOur analysis included 714,699 person-years of prescription opioid exposure. The 5-year period prevalence of opioid use disorders was 4.61 (95% CI 4.28-4.96) per 10,000 individuals, or 0.05%. The incidence rate of opioid use disorders was of 6.51 (95% CI 5.93-7.13) patients per 10,000 patient-years exposed. When examined by study year, there was no clear suggestion of a changing trend over time. When stratified by opioid drug, trends in the incidence rate during the study were either stable (i.e., codeine and tramadol), increasing (i.e., morphine) or decreasing (i.e., dihydrocodeine).\n\n\nCONCLUSIONS\nOur study demonstrates that despite the marked increase in overall opioid prescribing in the UK in the past decade, there has not been an increase in the incidence of physician-diagnosed opioid use disorders.",
"affiliations": "Mundipharma Research Ltd., Cambridge Science Park, Milton Road, Cambridge, CB4 0GW, UK. andrew.cooper@mundipharma-rd.eu.;Mundipharma Research Ltd., Cambridge Science Park, Milton Road, Cambridge, CB4 0GW, UK.;Mundipharma Research Ltd., Cambridge Science Park, Milton Road, Cambridge, CB4 0GW, UK.;Mundipharma Research GmbH & Co. KG, Höhenstraße 10, 65549, Limburg, Germany.;Mundipharma Research Ltd., Cambridge Science Park, Milton Road, Cambridge, CB4 0GW, UK.;Institute of Social Medicine, Epidemiology and Health Economics, Charité-Universitätsmedizin Berlin, Berlin, Germany.;QuintilesIMS, London, UK.;Berufsgenossenschaftliches Universitätsklinikum, Bergmannsheil gGmbH, Bürkle-de-la-Camp-Platz, Bochum, Germany.;School of Pharmacy, University of Nottingham, Nottingham, UK.",
"authors": "Cooper|Andrew J M|AJM|;Willis|Jenna|J|;Fuller|Janice|J|;Benecke|Heike|H|;Leighton-Scott|James|J|;Andersohn|Frank|F|;Kim|Joseph|J|;Maier|Christoph|C|;Knaggs|Roger D|RD|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.1007/s40122-017-0070-9",
"fulltext": "\n==== Front\nPain Ther\nPain Ther\nPain and Therapy\n2193-8237\n2193-651X\nSpringer Healthcare Cheshire\n\n28451867\n70\n10.1007/s40122-017-0070-9\nOriginal Research\nPrevalence and Incidence Trends for Diagnosed Prescription Opioid Use Disorders in the United Kingdom\nCooper Andrew J. M. andrew.cooper@mundipharma-rd.eu\n\n1\nWillis Jenna 1\nFuller Janice 1\nBenecke Heike 2\nLeighton-Scott James 1\nAndersohn Frank 34\nKim Joseph 5\nMaier Christoph 6\nKnaggs Roger D. 78\n1 grid.459800.0 Mundipharma Research Ltd., Cambridge Science Park, Milton Road, Cambridge, CB4 0GW UK\n2 0000 0004 0390 9594 grid.476538.b Mundipharma Research GmbH & Co. KG, Höhenstraße 10, 65549 Limburg, Germany\n3 0000 0001 2218 4662 grid.6363.0 Institute of Social Medicine, Epidemiology and Health Economics, Charité-Universitätsmedizin Berlin, Berlin, Germany\n4 Frank Andersohn Consulting and Research Services, Berlin, Germany\n5 QuintilesIMS, London, UK\n6 0000 0004 0551 2937 grid.412471.5 Berufsgenossenschaftliches Universitätsklinikum, Bergmannsheil gGmbH, Bürkle-de-la-Camp-Platz, Bochum, Germany\n7 0000 0004 1936 8868 grid.4563.4 School of Pharmacy, University of Nottingham, Nottingham, UK\n8 0000 0001 0440 1889 grid.240404.6 Pain Management Service, Nottingham University Hospitals NHS Trust, Nottingham, UK\n27 4 2017\n27 4 2017\n6 2017\n6 1 7384\n20 3 2017\n© The Author(s) 2017\nhttps://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.\nIntroduction\n\nThe prevalence of prescription opioid use disorders in the US has increased markedly in parallel with increases in opioid prescribing. Whilst an increase in opioid prescribing has also occurred in the UK, it remains unknown if there have been concurrent increases in opioid use disorders. The aim of this study was to examine national trends in the prevalence and incidence of physician-diagnosed opioid use disorders in the UK.\n\nMethods\n\nIn a retrospective electronic health care database analysis using data from the UK Clinical Practice Research Datalink (CPRD), we identified persons receiving a first opioid prescription between January 1, 2008 and December 31, 2012. Persons with an opioid use disorder were identified by Read codes assigned by patients’ physicians within 6 months following an opioid prescription. We calculated prevalence and incidence rates by dividing the analysis population by the total number of patients exposed (prevalence) or the total patient-years of exposure (incidence) using the ‘exact’ Clopper–Pearson Binomial method.\n\nResults\n\nOur analysis included 714,699 person-years of prescription opioid exposure. The 5-year period prevalence of opioid use disorders was 4.61 (95% CI 4.28–4.96) per 10,000 individuals, or 0.05%. The incidence rate of opioid use disorders was of 6.51 (95% CI 5.93–7.13) patients per 10,000 patient-years exposed. When examined by study year, there was no clear suggestion of a changing trend over time. When stratified by opioid drug, trends in the incidence rate during the study were either stable (i.e., codeine and tramadol), increasing (i.e., morphine) or decreasing (i.e., dihydrocodeine).\n\nConclusions\n\nOur study demonstrates that despite the marked increase in overall opioid prescribing in the UK in the past decade, there has not been an increase in the incidence of physician-diagnosed opioid use disorders.\n\nKeywords\n\nAbuse\nClinical Practice Research Datalink (CPRD)\nDependence\nIncidence\nMisuse\nOpioids\nOpioid use disorders\nPrescription\nPrevalence\nUK\nMundipharmaissue-copyright-statement© Springer Healthcare 2017\n==== Body\nIntroduction\n\nThe increase in the prescribing of opioid analgesics for the management of pain has been paralleled by increases in adverse outcomes associated with misuse and abuse, particularly in the United States [1]. Despite increased prescribing of opioid analgesics in Europe [2], few studies have sought to investigate the extent of this relationship [3]. In a recent review of prescription opioid use disorders by Vowles et al. [4], of the 38 studies included, only two were from Europe. Because the US is not comparable to most European countries in terms of the health care system and prescription practices [5], the strength of the relationship between prescription opioid use and subsequent risk of misuse and abuse seen in the US should not be assumed to be generalizable beyond North America.\n\nSimilar to the US, the UK has seen a marked increase in opioid prescribing in the past decade, especially of the stronger opioids [6]. In contrast to the US, however, there is limited information on the relationship between prescription opioid use and the development of opioid use disorders in the UK [4, 5]. As such, using data from the UK Clinical Practice Research Datalink (CPRD), the largest database of anonymized, longitudinal primary care records including approximately 4.4 million active patients, we aimed to describe the characteristics of patients with a diagnosis of prescription opioid use disorders and investigate the 5-year cumulative prevalence and trends in incidence rates of prescription opioid use disorders between 2008 and 2012. Additionally, we sought to examine the prevalence and incidence of opioid use disorders stratified by the different opioids available in the UK.\n\nMethods\n\nCPRD Database\n\nThis study was conducted using data from the UK CPRD database [7, 8]. In brief, CPRD is a computerized medical records database consisting of approximately 14 million patients, 4.4 million of which are active patients, from 674 primary care practices throughout the UK which have recorded anonymized data on clinical events, referrals to specialist and secondary care clinics, prescriptions issued in primary care and lifestyle information. The CPRD population has been shown to be representative of the UK population with regard to age, sex, and geographical distribution [9]. The validity of the diagnoses recorded in CPRD have repeatedly been demonstrated in previous studies [7, 10–12]. The present study uses the following variables recorded in UK routine general practice and which are recorded and available for public-benefiting medical research from CPRD [13]: anonymized patient identification number, age, sex, smoking status, mental health status, history of alcohol and substance abuse, and prescription medication information including specific opioid drug, dispensing date, pack size, number of packs, and prescription opioid use disorder medical codes.\n\nThis article is based on previously conducted studies, and does not involve any new studies of human subjects performed by any of the authors. Our study protocol was approved by the Independent Scientific Advisory Committee (ISAC) for Medicines and Healthcare Products Regulatory Agency (MHRA) database research (ISAC Protocol No.: 14_033R). For all observational research undertaken using anonymized CPRD data, ethical approval is granted by the National Research Ethics Service Committee (NRES).\n\nDefinitions of Problematic Opioid Use Disorders and Opioid Exposure Duration\n\nA list of medical codes (Read codes) specific for problematic opioid use disorders was created prior to study initiation. Read codes provide a hierarchical clinical coding system used in primary care in the UK for the purpose of reporting, research, decision-making, and to allow data to be shared reliably between different computer systems. Following processing and quality checking, these codes are then added to the CPRD database.\n\nFor this study, an opioid use disorder was identified by Read codes assigned by patients’ physicians. Read codes identified as indicative of an opioid use disorder are provided in Table 1. Cases were included in this study if they were ascribed an opioid use disorder Read code within 6 months following an opioid prescription. If a patient was ascribed an opioid use disorder Read code but did not receive an opioid prescription in the previous 6 months, then they did not contribute to this study so as to reduce the likelihood of including potential cases resulting from illicit opioid use.Table 1 Read codes used to identify opioid use disorders, CPRD: 2008–2012\n\nRead codes\tDescription\t\nE255. Nondependent opioid abuse\t\n E2550\tNondependent opioid abuse, unspecified\t\n E2551\tNondependent opioid abuse, continuous\t\n E2552\tNondependent opioid abuse, episodic\t\n E255z\tNondependent opioid abuse NOS\t\nE248. Combined opioid with other drug dependence\t\n E2480\tCombined opioid with other drug dependence, unspecified\t\n E2481\tCombined opioid with other drug dependence, continuous\t\n E2482\tCombined opioid with other drug dependence, episodic\t\n E2483\tCombined opioid with other drug dependence in remission\t\n E248z\tCombined opioid with other drug dependence NOS\t\nE240. Opioid type drug dependence\t\n E2400\tUnspecified opioid dependence\t\n E2401\tContinuous opioid dependence\t\n E2402\tEpisodic opioid dependence\t\n E240z\tOpioid drug dependence NOS (disorder)\t\nEu11. [X] Mental and behavioral disorders due to use of opioids\t\n Eu110\t[X] Mental and behavioral disorders due to use of opioids: acute intoxication\t\n Eu111\t[X] Mental and behavioral disorders due to use of opioids: harmful use\t\n Eu112\t[X] Mental and behavioral disorders due to use of opioids: dependence syndrome\t\n Eu113\t[X] Mental and behavioral disorders due to use of opioids: withdrawal state\t\n Eu114\t[X] Mental and behavioral disorders due to use of opioids: withdrawal state with delirium\t\n Eu115\t[X] Mental and behavioral disorders due to use of opioids: psychotic disorder\t\n Eu116\t[X] Mental and behavioral disorders due to use of opioids: amnesic syndrome\t\n Eu117\t[X] Mental and behavioral disorders due to use of opioids: residual and late-onset psychotic disorder\t\n Eu11y\t[X] Mental and behavioral disorders due to use of opioids: other mental and behavioral disorders\t\n Eu11z\t[X] Mental and behavioral disorders due to use of opioids: unspecified mental and behavioral disorder\t\n\nThe prescription opioids available in the UK, and included in this study, categorized by opioid strength, were: codeine, dihydrocodeine, metazinol, tramadol (weak opioids) and buprenorphine, diamorphine, dipipanone, fentanyl, hydromorphone, methadone, morphine, oxycodone, papaveretum, pentazocine, pethidine, and tapentadol (strong opioids).\n\nDuration of opioid exposure (calculated in days) was estimated based on each prescription date and the quantity of opioid prescribed, as recorded in the CPRD database. Long-term opioid use was defined as a patient having ≥3 consecutive opioid prescriptions within any 6-month period during the duration of the study.\n\nStudy Population\n\nPersons receiving a first opioid prescription between January 1, 2008 and December 31, 2012 were eligible for inclusion in these analyses (n = 1,613,465) (Fig. 1). We excluded patients who during the study period received an opioid prescription used for the purpose of substitution therapy (i.e., patients prescribed methadone powder or solution formulation, naltrexone, or buprenorphine oral or sublingual tablets of doses >1–<8 mg; n = 4021) (Fig. 1). We also excluded patients (n = 59,137) who received a first opioid prescription ≤6 months prior to the end of the study (i.e., December 31, 2012) to ensure sufficient follow-up for all persons. Following all exclusions, 1,550,307 patients were eligible for these analyses, 715 of which were identified as having been diagnosed with an opioid use disorder between January 1, 2008 and December 31, 2012. Of these 715 patients, hereon termed ‘diagnosed patients’, we then identified a subgroup of “true” ‘incident cases’, that is—patients who developed an opioid use disorder during the study and who had an available healthcare record ≥6 months prior to the start of the study with no evidence of a history of opioid use disorders (n = 465).Fig. 1 Flow diagram of persons prescribed opioids, diagnosed opioid use disorder patients, and incident cases, CPRD: 2008–2012\n\nStatistical Analysis\n\nDescriptive characteristics were summarized for: (1) the total population prescribed opioids who did not develop an opioid use disorder (n = 1,549,592), (2) all diagnosed patients (n = 715) and (3) incident cases (n = 465) using means with SDs, medians with interquartile ranges (IQR), or frequencies.\n\nWe calculated the 5-year period prevalence for diagnosed patients by dividing the total number of patients identified during the study (i.e., n = 715) by the total number of patients prescribed an opioid (i.e., n = 1,550,307). We also calculated the 5-year period prevalence stratified by opioid drug using the corresponding number of exposed patients as the denominator. For ease of comparison with other studies, prevalence was expressed as the number of diagnosed patients per 10,000 patients exposed.\n\nThe 5-year incidence rate of opioid use disorders, for all opioid drugs combined, was calculated for incident cases by dividing the total number of incident cases (i.e., n = 465) by the related total number of years of exposure to prescription opioids specific to incident cases (i.e., n = 714,699 person-years), expressed as the number of patients per 10,000 patient-years exposed. For the denominator, any time gaps in opioid prescriptions were subtracted from the number of patient-days exposed and expressed in patient-years. We additionally repeated the incidence rate calculation for diagnosed patients (i.e., n = 715) since all patients were assigned a ‘new/first’ opioid use disorder code during the study irrespective of a previous history of opioid use disorders; the denominator for this calculation was the total number of patient-years exposed for all patients (i.e., n = 729,556 person-years). In further analyses, we calculated incidence rates stratified by study year (i.e., n = 5 years) and opioid drug (i.e., n = 16) for diagnosed patients as one group to maximize study power. Consistent with the ISAC policy for MHRA database research using CPRD data [14], we do not present results for specific opioid drugs with ≤5 patients diagnosed with an opioid use disorder. Consequently, we did not calculate incidence rates and 95% confidence intervals (CIs) to determine trends for buprenorphine, oxycodone, fentanyl, metazinol, diamorphine, dipipanone, hydromorphone, methadone, papaveretum, pentazocine, pethidine, and tapentadol. An individual’s contribution to patient-years of exposure (calculated in days and expressed in years) ceased at the date of diagnosis of an opioid use disorder, December 31, 2012, the date of death or the date the participant left the general practice and no longer contributed data to CPRD, whichever came first. Estimates for incidence and prevalence, and their corresponding 95% CIs, were calculated using the ‘exact’ Clopper–Pearson Binomial method.\n\nTo examine prescription opioid use in further detail, we also described: (1) the median duration from first opioid prescription to being diagnosed with an opioid use disorder, (2) the most frequently prescribed opioid drugs at first prescription, (3) the opioid drugs which were most frequently prescribed in the 6-months prior to a diagnosis of an opioid use disorder, (4) concomitant prescription of benzodiazepines, and (5) long-term prescription opioid use. Finally, we described the frequency of use of the prescription opioid use disorder diagnostic codes. Data were expressed using means with SDs, medians with interquartile ranges (IQR) or frequencies.\n\nAll analyses were conducted using SAS 9.3 (SAS Institute Inc., Cary, NC, USA). Microsoft Excel was used in the production of Fig. 2.Fig. 2 Trends in prescription opioid use disorders, UK: 2008–2012. Data for all opioids combined is displayed for incident cases only (i.e., n = 465) whereas, to maximize study power due to small numbers, all other data is displayed for diagnosed patients as one group (i.e., n = 715). Data source for opioid prescriptions dispensed is available from the Health and Social Care Information Centre [19]\n\nResults\n\nStudy Population\n\nFrom January 1, 2008 to December 31, 2012, a total of 1,550,307 individuals received at least one opioid prescription and had a mean duration of opioid exposure of 0.47 years, culminating in 729,556 person-years of opioid exposure during the 5-year study. Of these, 715 individuals were identified as having an opioid use disorder (diagnosed patients), 465 of which were identified as incident cases. Compared to individuals who received an opioid prescription but who did not develop an opioid use disorder, diagnosed patients were more likely to be younger, male and to have a history of smoking and alcohol- and substance-abuse disorders. The baseline characteristics of incident cases were not dissimilar to diagnosed patients as one group (Table 2), except for the percentage of men and the percentage of ‘other substance abuse (including alcohol)’, both of which were lower among incident cases.Table 2 Characteristics of persons prescribed opioids, diagnosed opioid use disorder patients, and incident cases, CPRD: 2008–2012\n\n\tPatients without an opioid use disorder (n = 1,549,592)\tDiagnosed patients (n = 715)\tIncident cases (n = 465)\t\nAge at first opioid prescription, years\t\n Mean (SD)\t53.8 (19.9)\t38.6 (12.6)\t39.2 (13.8)\t\nSex, n (%)\t\n Male\t635 888 (41.0)\t401 (56.1)\t233 (50.1)\t\n Female\t913 679 (59.0)\t314 (43.9)\t232 (49.9)\t\n Unknown\t25 (<0.1)\t0 (0.0)\t0 (0.0)\t\nSmoking status, n (%)\t\n Current smoker\t799 115 (51.6)\t522 (73.0)\t333 (71.6)\t\n Previous smoker\t497 273 (32.1)\t118 (16.5)\t92 (19.8)\t\n Never smoker\t105 592 (6.8)\t14 (2.0)\t11 (2.4)\t\n Unknown\t147 612 (9.5)\t61 (8.5)\t29 (6.2)\t\nPrevious substance and alcohol abuse, n (%)\t\n Alcohol\t49 695 (3.2)\t118 (16.5)\t69 (14.8)\t\n Other substances (including alcohol)\t63 590 (4.1)\t307 (42.9)\t137 (29.5)\t\nMental health diagnoses, n (%)a\t\n All mental health disordersb\t288 343 (18.6)\t472 (66.0)\t346 (74.4)\t\n Mood affective disorders\t149 888 (9.7)\t203 (28.4)\t153 (32.9)\t\n Anxiety (neurotic, stress-related and somatoform disorders)\t110 590 (7.1)\t189 (26.4)\t132 (28.4)\t\n Behavioral syndromes associated with physiological disturbances and physical factors\t20 586 (1.3)\t56 (7.8)\t44 (9.5)\t\n Schizophrenia, schizotypal and delusional disorders\t5 196 (0.3)\t19 (2.7)\t12 (2.6)\t\n Behavioral and emotional disorders (onset usually occurring in childhood/adolescence)\t2 083 (0.1)\t5 (0.7)\t5 (1.1)\t\naPatients can contribute to multiple categories\n\nbAll mental health disorders are comprised of: mood affective disorders; anxiety (neurotic, stress-related and somatoform disorders); behavioral syndromes associated with physiological disturbances and physical factors; schizophrenia, schizotypal, and delusional disorders; and behavioral and emotional disorders (onset usually occurring in childhood/adolescence)\n\nPrevalence\n\nThe 5-year period prevalence of opioid use disorders among diagnosed patients was 4.61 (95% CI 4.28–4.96) per 10,000 individuals prescribed an opioid, or 0.05%. The prevalence of opioid use disorders was highest among men and those aged 25–34 years and lowest among women and those age 55 years or older (Table 3). When stratified by opioid drug, the 5-year period prevalence (per 10,000 patients exposed) among diagnosed patients was highest for oxycodone (14.29; 95% CI 10.06–19.69) followed by fentanyl (8.26; 95% CI 5.49–11.93), buprenorphine (7.98; 95% CI 5.80–10.71), morphine (6.94; 95% CI 5.37–8.83), dihydrocodeine (6.76; 95% CI 5.95–7.64), tramadol (4.32; 95% CI 3.69–5.03), and codeine (2.56; 95% CI 2.29–2.87).Table 3 5-year period prevalence and incidence rates of physician-diagnosed opioid use disorders in CPRD: 2008–2012\n\n\tPrevalence [per 10,000 patients exposed (95% CI)]a\tIncidence [per 10,000 patient-years exposed (95% CI)]b\t\nOverall\t4.61 (4.28, 4.96)\t9.80 (9.10, 10.55)\t\nAge group at index\t\n <18 years\t–\t–\t\n 18–24 years\t7.65 (5.98, 9.63)\t66.82 (52.32, 84.07)\t\n 25–34 years\t13.82 (12.14, 15.65)\t68.02 (59.81, 77.03)\t\n 35–44 years\t8.68 (7.52, 9.96)\t24.92 (21.60, 28.59)\t\n 45–54 years\t4.23 (3.46, 5.12)\t8.99 (7.35, 10.88)\t\n 55–64 years\t2.22 (1.68, 2.87)\t3.64 (2.76, 4.72)\t\n 65–74 years\t0.93 (0.59, 1.41)\t1.40 (0.88, 2.12)\t\n 75–84 years\t–\t–\t\n ≥85 years\t–\t–\t\nSex\t\n Male\t6.30 (5.70, 6.95)\t14.72 (13.31, 16.23)\t\n Female\t3.44 (3.07, 3.84)\t6.87 (6.13, 7.67)\t\nAll results are for the diagnosed patients i.e., n = 715\n\naNumerator: number of diagnosed patients during study period, denominator: total number of patients with a prescription opioid during study period\n\nbNnumerator: number of incident cases during study period, denominator: years of exposure to prescription opioids during the study period specific to incident cases i.e., 714,699 person-years. Total years of exposure to prescription opioids was calculated in days but reported in whole years\n\n– Robust prevalence and incidence rates, and their corresponding 95% CIs, could not be estimated due to too few cases (i.e., <5 cases)\n\nIncidence and Trends in Incidence\n\nA total of 465 patients were identified as incident cases, equating to an incidence rate of 6.51 (95% CI 5.93–7.13) patients per 10,000 patient-years exposed during the 5-year study duration. When examined by study year, there was no clear evidence of a changing trend over time (Fig. 2). If all diagnosed patients were considered as incident cases, the 5-year incidence rate as one group would be 9.80 (95% CI 9.10–10.55) per 10,000 patient-years exposed. Similar to the findings for prevalence, the incidence rate of opioid use disorders, for all diagnosed patients, was highest among men and those aged 25–34 years and lowest among women and those age 55 years or older (Table 3). When examined by study year for diagnosed patients as one group, there was a suggestion of a declining trend in the incidence of opioid use disorders over time [2.60 (95% CI 2.23–3.02) per 10,000 patient-years exposed in 2008 vs. 2.01 (95% CI 1.66–2.42) per 10,000 patient-years exposed in 2012]. As shown in Fig. 2, when stratified by opioid drug, trends in the incidence rate during the study were either stable (i.e., codeine and tramadol), increasing (i.e., morphine) or decreasing (i.e., dihydrocodeine).\n\nPrescription Patterns\n\nThe median duration from first opioid prescription to being diagnosed with an opioid use disorder was 0.6 (IQR 0.2–1.9) years for diagnosed patients and 1.1 (IQR 0.3–2.5) years for incident cases. The most frequently first prescribed opioid drug was codeine (40.6%) followed by dihydrocodeine (32.0%), tramadol (15.9%), buprenorphine (4.5%), morphine (4.3%), oxycodone (2.5%), and fentanyl (1.5%). Consistent with this, the opioid drug which was most frequently prescribed in the 6 months prior to a diagnosis of an opioid use disorder was codeine (43.4%) followed by dihydrocodeine (35.8%), tramadol (23.2%), morphine (9.2%), buprenorphine (6.2%), oxycodone (5.2%), and fentanyl (3.9%). Among diagnosed patients, a total of 185 (25.9%) were concomitantly prescribed benzodiazepines and 593 (82.9%) were long-term prescription opioid users. Among patients without a diagnosis of an opioid use disorder, 37.8% were identified as being long-term prescription opioid users.\n\nOpioid Use Disorder Diagnostic Coding\n\nThe most frequently ascribed prescription opioid use disorder diagnosis codes during the study were Eu11 (Mental and behavioral disorders due to use of opioids) (68.7%) and E240 (opioid type dependence) (31.3%).\n\nDiscussion\n\nIn this large population-based cohort study of prescription opioid users followed for up to 5 years, we found that the prevalence of opioid use disorders was low at 0.05% and that there was no obvious change in the incidence of newly diagnosed opioid use disorders over the duration of the study. These findings challenge the long-standing belief that increases in prescribing of opioids necessitates an increase in the incidence of problematic opioid use disorders. Our findings also demonstrate that it is the most commonly first-prescribed opioids, and not necessarily the more potent opioids, which are most frequently associated with an opioid use disorder in the 6 months leading up to diagnosis of an opioid use disorder.\n\nAs far as we are aware, this is the first nationally representative medical records database study which has sought to investigate the association between opioid use and risk of subsequent opioid use disorders in the UK. A recent systematic review of rates of opioid misuse, abuse, and addiction in chronic pain included a total of 38 studies conducted mostly in the primary care setting or pain clinics [4]. Across most of the calculations, rates of misuse averaged between 21% and 29% (range 95% CI 13%–38%). Of note, the majority of the included studies were not database studies and the definitions used for misuse were not consistent across studies. Furthermore, out of the 38 included studies, only two were from Europe (UK and Denmark), and neither of these studies included rates for misuse or abuse; only one of the 38 studies included an estimate of opioid abuse. A study using UK death data from the Office for National Statistics has shown an increasing trend in the number of deaths attributable to opioids from 2001 to 2011 [15]. However, the results in this study were expressed as absolute number of deaths and did not account for increases in opioid prescribing over the same duration. Furthermore, using mortality data as a proxy for rates of misuse/abuse is problematic given that many other factors other than misuse/abuse are known to influence risk of opioid overdose and death, e.g., opioid dose, co-prescription with benzodiazepines, time to administration of an opioid antagonist (i.e., naloxone) and response time by emergency services. A recent study has shown that the prevalence of past-year misuse/abuse of prescription opioids in Great Britain was 6.2% [16]. The high prevalence of opioid misuse/abuse found in that study should however be interpreted with caution since the participants were not drawn from a representative nationwide database but were purposely pre-selected for problematic use, i.e., they were aged 12–49 years, likely to use tobacco and marijuana, and were recruited from needle exchanges, homeless shelters, and parks.\n\nIn analyses stratified by opioid drug, we found that the relation between opioid use disorders and prescriptions of codeine and tramadol remained stable, whereas there was an increasing trend for morphine and a decreasing trend related to dihydrocodeine. In a previous study examining a cohort of new opioid users who started treatment with weak opioids (i.e., codeine, tramadol, and dextropropoxyphene), Skurtveit et al. [17] found that 0.08% of patients went on to develop prescription patterns indicative of an opioid use disorder. This is consistent with our observation for morphine which, despite being highlighted as being associated with an increasing incidence during the study, was 0.05%. Skurtveit et al. did not examine associations with more potent opioids or morphine, which limits direct comparison with our findings [17]. We were not able to examine for trends in opioid use disorders for buprenorphine, oxycodone, fentanyl, metazinol, diamorphine, dipipanone, hydromorphone, methadone, papaveretum, pentazocine, pethidine, and tapentadol due to too few cases. This is important because whilst our findings suggest that there is unlikely to be an abuse problem with these specific opioids at this time, it is not to say that this will not change in the future. This highlights the importance for ongoing surveillance of this important public health issue.\n\nImportant strengths of our study include use of a large representative population database with up to 5 years of follow-up data and diagnosis of opioid use disorders by family physicians. Additionally, use of a publicly available medical records database, inclusion of an in-depth statistical analysis strategy, and inclusion of a participant flow diagram, means that our findings can be replicated and repeated in future analyses to determine trends in opioid use disorders over extended durations of time.\n\nThere are a number of limitations of our study which warrant discussion. First, whilst a number of validation studies have demonstrated the high validity of the diagnoses codes recorded in CPRD, reporting strong measures of sensitivity and specificity [7, 10–12], this has not been undertaken for the codes related to problematic opioid use disorders. Secondly, data on medications given during hospitalization, medications provided in specialist care, and medications provided by a hospital following patient discharge are not recorded in patients’ medical records. The likely impact of this will have been an underestimation of drug use and, potentially, an underestimation of the extent of opioid use disorders. Nevertheless, under the assumption that these factors did not change during the study period, an examination of annual incidence rates does allow an accurate estimation of changes in trends over time even if the absolute number of patients is not estimated with precision. Thirdly, although we excluded patients who received an opioid prescription used for the purpose of substitution therapy, some of the opioid use disorder cases in our study may have received a diagnosis of an opioid use disorder based on illicit opioid use. This would, however, have led rather to an overestimation of prevalence and incidence. Finally, the possibility of significant under-diagnosis by patient’s physicians does mean that future research using alternative data sources is needed, such as the research being conducted by the RADARs group in the US who recently examined prescription opioid misuse and abuse using multiple data sources in a complimentary analysis approach e.g., drug-diversion investigations, poison centers and substance-abuse treatment centers [18].\n\nConclusions\n\nIn conclusion, despite the marked increase in overall opioid prescribing in the UK in the past decade, especially of the stronger opioids, this has not lead to an increase in the incidence of diagnosed opioid use disorders. Given the potential for under-reporting of prescription opioid use disorders in CPRD, and the likely important influence that differing prescribing patterns and health care systems might play in determining the development of opioid use disorders, future longitudinal studies using different data sources across Europe are needed to further our understanding of this important public health issue.\n\nSponsorship for this study and article processing charges was funded Mundipharma Research Ltd. All named authors meet the International Committee of Medical Journal Editors (ICMJE) criteria for authorship for this manuscript, take responsibility for the integrity of the work as a whole, and have given final approval to the version to be published.\n\nDisclosures\n\nA.J.M. Cooper is an employee of Mundipharma Research Ltd. J. Willis is an employee of Mundipharma Research Ltd. J. Fuller is an employee of Mundipharma Research Ltd. H. Benecke is an employee of Mundipharma Research Ltd. J. Leighton-Scott is an employee of Mundipharma Research Ltd. F. Andersohn received consultancy fees from Abbott, AstraZeneca, Bayer, Boehringer Ingelheim, GlaxoSmithKline, Lundbeck, Mundipharma, and Nordmark. J. Kim is an employee of QuintilesIMS. C. Maier is an employee of Berufsgenossenschaftliches Universitätsklinikum Bergmannsheil gGmbH and received payment from Mundipharma Research Limited for consultancy work. C. Maier also has a current financial interest of affiliation for grant/research support with Pfizer, MSD, Mundipharma, Grünenthal, Astellas, Lilly and is a member of the IMI “Europain” collaboration (industry members of this collaboration are: AstraZeneca, Pfizer, Esteve, UCB-Pharma, Sanofi Aventis, Grünenthal, Eli Lilly and Boehringer Ingelheim) and the German Federal Ministry of Education and Research (BMBF): German Research Network on Neuropathic Pain. C. Maier acts as a consultant for Mundipharma, Grünenthal, Astellas and AstraZeneca and is a Board Member for Epionics. R.D. Knaggs is an employee of the University of Nottingham, UK. A consultancy agreement for R.D. Knaggs was established with the University of Nottingham and all fees were donated directly to the University of Nottingham to further support academic research.\n\nCompliance with Ethics Guidelines\n\nThis article is based on previously conducted studies, and does not involve any new studies of human subjects performed by any of the authors.\n\nData Availability\n\nThe dataset analyzed during the current study is available from the UK Medicines and Healthcare Products Regulatory Agency (MHRA) at: https://www.cprd.com/dataAccess/.\n\nOpen Access\n\nThis article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.\n\nEnhanced content\n\nTo view enhanced content for this article go to http://www.medengine.com/Redeem/8818F06008E040C7.\n==== Refs\nReferences\n\n1. Han B Compton WM Jones CM Cai R Nonmedical prescription opioid use and use disorders among adults aged 18 through 64 years in the United States, 2003–2013 JAMA 2015 314 14 1468 1478 10.1001/jama.2015.11859 26461997\n2. Hastie BA Gilson AM Maurer MA Cleary JF An examination of global and regional opioid consumption trends 1980–2011 J Pain Palliative Care Pharmacother. 2014 28 3 259 275 10.3109/15360288.2014.941132\n3. Casati A Sedefov R Pfeiffer-Gerschel T Misuse of medicines in the European Union: a systematic review of the literature Eur Addict Res 2012 18 5 228 245 10.1159/000337028 22572594\n4. Vowles KE McEntee ML Julnes PS Frohe T Ney JP van der Goes DN Rates of opioid misuse, abuse, and addiction in chronic pain: a systematic review and data synthesis Pain 2015 156 4 569 576 10.1097/01.j.pain.0000460357.01998.f1 25785523\n5. van Amsterdam J van den Brink W The misuse of prescription opioids: a threat for Europe? Curr Drug Abuse Rev. 2015 8 1 3 14 10.2174/187447370801150611184218 26084418\n6. Zin CS, Chen LC, Knaggs RD. Changes in trends and pattern of strong opioid prescribing in primary care. Eur J Pain (London, England). 2014;18(9):1343–51.\n7. Herrett E Thomas SL Schoonen WM Smeeth L Hall AJ Validation and validity of diagnoses in the general practice research database: a systematic review Br J Clin Pharmacol 2010 69 1 4 14 10.1111/j.1365-2125.2009.03537.x 20078607\n8. Williams T van Staa T Puri S Eaton S Recent advances in the utility and use of the General Practice Research Database as an example of a UK Primary Care Data resource Ther Adv Drug Safe 2012 3 2 89 99 10.1177/2042098611435911\n9. Herrett E Gallagher AM Bhaskaran K Forbes H Mathur R van Staa T Data resource profile: Clinical Practice Research Datalink (CPRD) Int J Epidemiol 2015 44 3 827 836 10.1093/ije/dyv098 26050254\n10. Jick H Jick SS Derby LE Validation of information recorded on general practitioner based computerised data resource in the United Kingdom BMJ (Clinical Research ed). 1991 302 6779 766 768 10.1136/bmj.302.6779.766\n11. Jick SS Kaye JA Vasilakis-Scaramozza C Garcia Rodriguez LA Ruigomez A Meier CR Validity of the general practice research database Pharmacotherapy. 2003 23 5 686 689 10.1592/phco.23.5.686.32205 12741446\n12. Wurst KE Ephross SA Loehr J Clark DW Guess HA The utility of the general practice research database to examine selected congenital heart defects: a validation study Pharmacoepidemiol Drug Saf 2007 16 8 867 877 10.1002/pds.1431 17563909\n13. (MHRA) MaHPRA. Access to CPRD: medicines and healthcare products regulatory agency (MHRA) (cited 2017 16 February). Available from: https://www.cprd.com/dataAccess/.\n14. (MHRA) MaHPRA. Governance relating to the use of CPRD for research: Medicines and Healthcare Products Regulatory Agency (MHRA). Available from: https://www.cprd.com/isac/governance.asp.\n15. Giraudon I Lowitz K Dargan PI Wood DM Dart RC Prescription opioid abuse in the UK Br J Clin Pharmacol 2013 76 5 823 824 10.1111/bcp.12133 23594290\n16. Novak SP Hakansson A Martinez-Raga J Reimer J Krotki K Varughese S Nonmedical use of prescription drugs in the European Union BMC Psychiatry. 2016 16 274 10.1186/s12888-016-0909-3 27488186\n17. Skurtveit S Furu K Borchgrevink P Handal M Fredheim O To what extent does a cohort of new users of weak opioids develop persistent or probable problematic opioid use? Pain 2011 152 7 1555 1561 10.1016/j.pain.2011.02.045 21450405\n18. Dart RC Surratt HL Cicero TJ Parrino MW Severtson SG Bucher-Bartelson B Trends in opioid analgesic abuse and mortality in the United States N Engl J Med. 2015 372 3 241 248 10.1056/NEJMsa1406143 25587948\n19. Health and Social Care Information Centre. Prescription cost analysis, England 2016 (cited 2016 10 October). Available from: https://data.gov.uk/dataset/prescription-cost-analysis-england.\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": null,
"issue": "6(1)",
"journal": "Pain and therapy",
"keywords": "Abuse; Clinical Practice Research Datalink (CPRD); Dependence; Incidence; Misuse; Opioid use disorders; Opioids; Prescription; Prevalence; UK",
"medline_ta": "Pain Ther",
"mesh_terms": null,
"nlm_unique_id": "101634491",
"other_id": null,
"pages": "73-84",
"pmc": null,
"pmid": "28451867",
"pubdate": "2017-06",
"publication_types": "D016428:Journal Article",
"references": "22572594;27488186;21450405;24756859;25785523;25136898;2021768;12741446;23594290;26084418;26050254;20078607;25083228;26461997;25587948;17563909",
"title": "Prevalence and Incidence Trends for Diagnosed Prescription Opioid Use Disorders in the United Kingdom.",
"title_normalized": "prevalence and incidence trends for diagnosed prescription opioid use disorders in the united kingdom"
} | [
{
"companynumb": "GB-DEPOMED, INC.-GB-2017DEP001259",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TAPENTADOL HYDROCHLORIDE"
},
"drugadd... |
{
"abstract": "BACKGROUND\nThe INO-VATE study demonstrated efficacy and safety of inotuzumab ozogamicin versus standard care in adults with relapsed or refractory B-cell acute lymphoblastic leukaemia. Here, we report the frequency of, and potential risk factors for, hepatotoxicity in patients in this trial and after treatment and subsequent haemopoietic stem-cell transplantation (HSCT).\n\n\nMETHODS\nIn this open-label, phase 3, multicentre, international study, adults with relapsed or refractory, CD22-positive, Philadelphia chromosome (Ph)-positive or Ph-negative B-cell acute lymphoblastic leukaemia who were due to receive first or second salvage treatment were randomly assigned (1:1) via an interactive voice response system to receive inotuzumab ozogamicin (starting dose 1·8 mg/m2 per cycle [0·8 mg/m2 on day 1; 0·5 mg/m2 on days 8 and 15 of a 21-28 day cycle for ≤6 cycles]) or standard care (either fludarabine plus cytarabine plus granulocyte colony-stimulating factor, mitoxantrone plus cytarabine, or high-dose cytarabine). Stratification factors at randomisation were duration of first remission (<12 months vs ≥12 months), salvage treatment phase (first vs second), and age (<55 years vs ≥55 years). We present data up to March 8, 2016. At this cutoff date, all patients had been discontinued from treatment but 54 patients were continuing in long-term follow-up. Long-term follow-up has now been completed, with the final patient's last visit on Jan 4, 2017. This prespecified safety analysis describes investigator-assessed treatment-emergent hepatotoxicity, including sinusoidal obstruction syndrome (also known as veno-occlusive disease) in patients during study treatment or thereafter (without follow-up HSCT) and after study treatment and subsequent HSCT, for all patients who received at least one dose of study treatment. This study is registered with ClinicalTrials.gov, number NCT01564784.\n\n\nRESULTS\nBetween Aug 27, 2012, and and the data cutoff of March 8, 2016, 326 patients were randomly assigned to receive inotuzumab ozogamicin (n=164) or standard care (n=162). 164 patients in the inotuzumab ozogamicin group and 143 in the standard care group received at least one dose of study treatment and were included in the safety population. At data cutoff, median duration of treatment (induction) was 8·9 weeks (IQR 4·1-13·1) in the inotuzumab ozogamicin group and 0·9 weeks (0·9-1·1) in the standard care group. Treatment-emergent hepatotoxicities (of all grades) were more frequent in the inotuzumab ozogamicin group (83 [51%] of 164 patients) than in the standard care group (49 [34%] of 143 patients). The frequency of sinusoidal obstruction syndrome-comprising events occurring during treatment (or follow-up without HSCT) and after treatment and subsequent HSCT-was higher in the inotuzumab ozogamicin group (22 [13%]; 18 [82%] of which were grade 3 or worse) than in the standard care group (one [<1%]). During study therapy or follow-up without HSCT, five (3%) patients in the inotuzumab ozogamicin group developed sinusoidal obstruction syndrome compared with no patients in the standard care group. Of the 77 patients who received inotuzumab ozogamicin and proceeded to HSCT, 17 (22%) had sinusoidal obstruction syndrome; five events after follow-up HSCT were fatal. Of 32 patients who received standard care and proceeded to HSCT, one (3%) had (non-fatal) sinusoidal obstruction syndrome that was ongoing at the time of death due to septic shock. In multivariate analysis, conditioning with two alkylating agents (p=0·015 vs one alkylating agent) and last available pre-HSCT bilirubin concentration of greater than or equal to the upper limit of normal (ULN; p=0·009 vs <ULN) were associated with increased risk of sinusoidal obstruction syndrome in patients who received inotuzumab ozogamicin. The estimated hazard ratio for overall survival in patients with follow-up HSCT (inotuzumab ozogamicin vs standard care) was 1·227 (97·5% CI 0·656-2·292; one-sided stratified log-rank p=0·77); at 24 months, the estimated probability of survival was 38·9% (95% CI 27·6-50·0) in the inotuzumab ozogamicin group versus 28·7% (11·2-49·1) in the standard care group.\n\n\nCONCLUSIONS\nTreatment with inotuzumab ozogamicin is associated with increased hepatotoxicity, especially after follow-up HSCT, compared with standard care.\n\n\nBACKGROUND\nPfizer.",
"affiliations": "University of Texas MD Anderson Cancer Center, Houston, TX, USA. Electronic address: hkantarjian@mdanderson.org.;Dana-Farber Cancer Institute, Boston, MA, USA.;Cleveland Clinic Taussig Cancer Institute, Cleveland, OH, USA.;Universitätsklinikum Münster, Münster, Germany.;University of Texas MD Anderson Cancer Center, Houston, TX, USA.;University of Washington and Fred Hutchinson Cancer Research Center, Seattle, WA, USA.;University of Southern California, Los Angeles, CA, USA.;Akita University Hospital, Akita, Japan.;Japanese Red Cross Nagoya Daini Hospital, Nagoya, Japan.;Hospital Universitario Ramón y Cajal, Madrid, Spain.;Institute of Hematology and Transfusion Medicine, Warsaw, Poland.;University of California, Irvine Medical Center, Orange, CA, USA.;University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Pfizer, Shanghai, China.;Pfizer, Groton, CT, USA.;Pfizer, Cambridge, MA, USA.;University Hospitals Bristol NHS Foundation Trust, Bristol, UK.",
"authors": "Kantarjian|Hagop M|HM|;DeAngelo|Daniel J|DJ|;Advani|Anjali S|AS|;Stelljes|Matthias|M|;Kebriaei|Partow|P|;Cassaday|Ryan D|RD|;Merchant|Akil A|AA|;Fujishima|Naohito|N|;Uchida|Toshiki|T|;Calbacho|Maria|M|;Ejduk|Anna A|AA|;O'Brien|Susan M|SM|;Jabbour|Elias J|EJ|;Zhang|Hui|H|;Sleight|Barbara J|BJ|;Vandendries|Erik R|ER|;Marks|David I|DI|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000080045:Inotuzumab Ozogamicin",
"country": "England",
"delete": false,
"doi": "10.1016/S2352-3026(17)30103-5",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2352-3026",
"issue": "4(8)",
"journal": "The Lancet. Haematology",
"keywords": null,
"medline_ta": "Lancet Haematol",
"mesh_terms": "D000328:Adult; D061067:Antibodies, Monoclonal, Humanized; D005260:Female; D006801:Humans; D000080045:Inotuzumab Ozogamicin; D008099:Liver; D008297:Male; D008875:Middle Aged; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D012008:Recurrence; D017211:Treatment Failure",
"nlm_unique_id": "101643584",
"other_id": null,
"pages": "e387-e398",
"pmc": null,
"pmid": "28687420",
"pubdate": "2017-08",
"publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "Hepatic adverse event profile of inotuzumab ozogamicin in adult patients with relapsed or refractory acute lymphoblastic leukaemia: results from the open-label, randomised, phase 3 INO-VATE study.",
"title_normalized": "hepatic adverse event profile of inotuzumab ozogamicin in adult patients with relapsed or refractory acute lymphoblastic leukaemia results from the open label randomised phase 3 ino vate study"
} | [
{
"companynumb": "US-MYLANLABS-2017M1060120",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nThymic-enteric adenocarcinoma with positive expression of CDX2 and CK20 is rare in adults, with only 16 reported cases. However, standard treatment options for this type of thymic adenocarcinoma has not yet been established. Therefore, we report a case of stage IV thymic-enteric adenocarcinoma treated with radiotherapy, chemotherapy, and anti-angiogenesis therapy.\n\n\nMETHODS\nWe report a case of thymic-enteric adenocarcinoma occurring in a 44-year-old woman. The tumor was considered unresectable owing to its invasiveness. The patient was treated with six cycles of oxaliplatin (130 mg/m2, day 1) and capecitabine (1000 mg/m2 BID, days 1-14). During the first three cycles of chemotherapy, concurrent radiotherapy (60 Gy/30 fractions) and anti-angiogenic therapy using apatinib were recommended. The primary tumor achieved partial remission based on the Response Evaluation Criteria in Solid Tumors. During follow-up, there was no evidence of disease relapse, except a high serum CA19-9 level. The patient is alive and regularly followed. Based on the previous literature and the present case, we believe that early diagnosis of thymic-enteric adenocarcinoma is important.\n\n\nCONCLUSIONS\nXELOX (capecitabine plus oxaliplatin) combined with radiotherapy is an optional therapy for inoperable thymic-enteric adenocarcinoma.",
"affiliations": "Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China.;Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China.;Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China. drlhdong@163.com.;Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China.",
"authors": "Li|Man|M|;Pu|Xiao-Yu|XY|;Dong|Li-Hua|LH|;Chang|Peng-Yu|PY|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.12998/wjcc.v9.i7.1676",
"fulltext": "\n==== Front\nWorld J Clin Cases\nWJCC\nWorld Journal of Clinical Cases\n2307-8960\nBaishideng Publishing Group Inc\n\njWJCC.v9.i7.pg1676\n10.12998/wjcc.v9.i7.1676\nCase Report\nMetastatic thymic-enteric adenocarcinoma responding to chemoradiation plus anti-angiogenic therapy: A case report\nLi M et al. A case of metastatic thymic-enteric adenocarcinoma\nLi Man Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China\n\nPu Xiao-Yu Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China\n\nDong Li-Hua Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China. drlhdong@163.com\n\nChang Peng-Yu Department of Radiation Oncology, The First Hospital of Jilin University, Changchun 130021, Jilin Province, China\n\nAuthor contributions: Dong LH, Chang PY, Li M, and Pu XY were involved in case diagnosis, case report conception and design, and drafting and revising the manuscript; Dong LH and Chang PY reviewed the case, confirmed the diagnosis, and revised the paper in detail; all authors read and approved the final manuscript.\n\nCorresponding author: Li-Hua Dong, PhD, Chief Physician, Department of Radiation Oncology, The First Hospital of Jilin University, No. 71 Xinmin Street, Changchun 130021, Jilin Province, China. drlhdong@163.com\n\n6 3 2021\n6 3 2021\n9 7 16761681\n23 9 2020\n26 12 2020\n6 1 2021\n©The Author(s) 2021. Published by Baishideng Publishing Group Inc. All rights reserved.\n2021\nThis article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial.\nBACKGROUND\n\nThymic-enteric adenocarcinoma with positive expression of CDX2 and CK20 is rare in adults, with only 16 reported cases. However, standard treatment options for this type of thymic adenocarcinoma has not yet been established. Therefore, we report a case of stage IV thymic-enteric adenocarcinoma treated with radiotherapy, chemotherapy, and anti-angiogenesis therapy.\n\nCASE SUMMARY\n\nWe report a case of thymic-enteric adenocarcinoma occurring in a 44-year-old woman. The tumor was considered unresectable owing to its invasiveness. The patient was treated with six cycles of oxaliplatin (130 mg/m2, day 1) and capecitabine (1000 mg/m2 BID, days 1-14). During the first three cycles of chemotherapy, concurrent radiotherapy (60 Gy/30 fractions) and anti-angiogenic therapy using apatinib were recommended. The primary tumor achieved partial remission based on the Response Evaluation Criteria in Solid Tumors. During follow-up, there was no evidence of disease relapse, except a high serum CA19-9 level. The patient is alive and regularly followed. Based on the previous literature and the present case, we believe that early diagnosis of thymic-enteric adenocarcinoma is important.\n\nCONCLUSION\n\nXELOX (capecitabine plus oxaliplatin) combined with radiotherapy is an optional therapy for inoperable thymic-enteric adenocarcinoma.\n\nRadiotherapy\nChemotherapy\nCase report\nThymic adenocarcinoma\nAnti-angiogenic therapy\nThymic-enteric adenocarcinoma\n==== Body\nCore Tip: This report introduces the diagnosis and treatment of a metastatic thymic-enteric adenocarcinoma with positive expression of CDX2 and CK20. For the first time, radiotherapy and chemotherapy combined with anti-angiogenesis therapy were used. The tumor was partially remitted, and there was no sign of recurrence. XELOX (capecitabine plus oxaliplatin) combined with radiotherapy is an alternative treatment for inoperable metastatic thymic-enteric adenocarcinoma.\n\nINTRODUCTION\n\nThymic cancer is rare, accounting for only 0.06% of all thymic neoplasms[1]. It may be asymptomatic or associated with an intermittent cough, chest pain, or dyspnea. According to the 2015 World Health Organization thymic cancer classification, its histological types include squamous cell carcinoma, lymphoid epithelioid carcinoma, or basal-like carcinoma. However, the enteric type was first identified in 2003[2]. To date, a total of 16 cases of thymic adenocarcinoma with positive expression of CDX2 and CK20 have been reported (Table 1). However, standard treatment options for this type of thymic adenocarcinoma have not yet been established. We report a case of stage IV thymic-enteric adenocarcinoma treated with radiotherapy, chemotherapy, and anti-angiogenesis therapy. Our primary result demonstrated the effectiveness of a comprehensive approach.\n\nTable 1 Clinicopathologic features of 16 patients with thymic adenocarcinoma as reported in the literature\n\nCase No.\tAge\tGender\tKi-67\tTreatment\tOutcome\tRef.\t\n1\t70\tMale\t20%-30%\tSurgery\tAWD, 7 mo\t[2]\t\n2\t59\tFemale\tNA\tSurgery + chemoradiotherapy + radiotherapy\tAlive with disease, 11 mo (bone and lung metastasis)\t[8]\t\n3\t41\tFemale\t90%\tSurgery\tAWD, 18 mo\t[9]\t\n4\t39\tFemale\tNA\tSurgery\tAWD, 159 mo (recurrence +)\t[9]\t\n5\t28\tFemale\tNA\tSurgery + chemotherapy (GEMOX) + radiotherapy\tAWD, 30 mo (2 times recurrence)\t[10]\t\n6\t55\tMale\tNA\tSurgery + radiotherapy\tAWD, 14 mo\t[11]\t\n7\t36\tFemale\tNA\tSurgery + chemotherapy (Taxol/CDDP) + radiotherapy\tDOD, 15 mo\t[12]\t\n8\t66\tFemale\tNA\tSurgery\tAWD, 5 yr\t[13]\t\n9\tNA\tNA\tNA\tSurgery\tNA\t[14]\t\n10\t52\tFemale\tNA\tSurgery + chemotherapy (cisplatin + etoposide/carboplatin + paclitaxel) + radiotherapy\tAlive with disease, 11 mo (lung and lymph node metastasis)\t[15]\t\n11\t38\tMale\tNA\tSurgery + radiotherapy + chemotherapy (carboplatin + docetaxel)\tDOD, 12 mo (bone metastasis)\t[15]\t\n12\t55\tMale\tNA\tSurgery + chemotherapy (carboplatin + docetaxel/paclitaxel)\tDOD, 24 mo (bone, liver, lung, adrenal gland metastases)\t[15]\t\n13\t41\tMale\tNA\tSurgery\tAWD, 43 mo (lung metastasis+)\t[16]\t\n14\t34\tMale\tNA\tSurgery + chemotherapy (carboplatin, Adriamycin, cyclophosphamide, and vincristine) + radiotherapy\tDOD, 20 mo\t[17]\t\n15\t15\tMale\tNA\tSurgery + radiotherapy\tDOD, 26 mo\t[18]\t\n16\t29\tFemale\tNA\tSurgery\tAWD, 8 mo\t[19]\t\nPresent case\t44\tFemale\t70%\tConcurrent chemoradiotherapy + antiangiogenic therapy\tAWD\t\t\nAWD: Alive without disease; DOD: Died of disease; NA: Not available; NOS: Not otherwise specified.\n\nCASE PRESENTATION\n\nChief complaints\n\nA 44-year-old woman was admitted to our hospital for dyspnea with chest pain in April 2018.\n\nHistory of present illness\n\nThe patient had no history of present illness.\n\nHistory of past illness\n\nThe patient had no history of past illness.\n\nPersonal and family history\n\nThe patient had no personal and family history.\n\nPhysical examination\n\nNo obvious abnormalities were found on physical examination.\n\nLaboratory examinations\n\nLaboratory tests showed elevated levels of several serum tumor markers (CA19-9, 483.98 U/mL; CA125, 111.44 IU/mL; CA242, 138.50 IU/mL; cytokeratin-19 fragment, 5.34 ng/mL; and carcinoembryonic antigen, 20.07 ng/mL). Liver and kidney function tests were normal. The pericardial effusion was bloody, and tumor cells were detected. Mediastinal mass biopsy showed pathological adenocarcinoma infiltration (Figure 1A). Immunohistochemical staining showed that the tumor cells were positive for CK20 (Figure 1B), CDX2 (Figure 1C), villin, and EGFR; partially positive for CA15-3; and negative for lung cancer markers, including CK7, TTF-1, and Napsin A. The Ki-67 index was 70%. Moreover, wild types of KRAS, NRAS, and BRAF were detected. The pathological results suggested intestinal metastatic adenocarcinoma. However, no other primary tumor was found on systemic examination.\n\nFigure 1 Pathological and immunohistochemical features of puncture tissue of the mediastinal tumor (× 100). A: The tissue was infiltrated by adenocarcinoma cells; B: Neoplastic cells were positive for cytokeratin; C: CDX-2 20 (× 100).\n\nImaging examinations\n\nWhole-body positron emission computed tomography (CT) (Figure 2A) showed an anterior calcified mediastinal mass measuring approximately 43 mm × 38 mm with an increased edge radioactivity uptake [maximum standardized uptake value (SUV) of 6.4; CT value of 41.8 HU]; increased pericardial radioactive uptake and a fluid density shadow; and increased sternal spot-like radioactivity uptake (maximum SUV value of 3.4).\n\nFigure 2 Serial high-resolution computed tomography scans of the chest. A: The computed tomography (CT) scan on July 31, 2018 showing an anterior mediastinal mass with calcification; B: The CT scan on August 28, 2018 showing that the anterior mediastinal mass was improved during the treatment; C: The CT scan on September 26, 2018 showing that the anterior mediastinal mass decreased during the treatment; D: The CT scan on December 4, 2018 showing that the anterior mediastinal mass was stable after treatment.\n\nFINAL DIAGNOSIS\n\nAfter consultation with histopathologists in our institution, the tumor was diagnosed as a thymic adenocarcinoma (enteric type T4N0M1b stage IVb) with pericardial and sternal metastases according to the American Joint Committee on Cancer Staging Manual Eight Edition (2017).\n\nTREATMENT\n\nA comprehensive therapeutic regimen was administered. First, the patient underwent six cycles of oxaliplatin (130 mg/m2, day 1) and capecitabine (1000 mg/m2, BID, days 1-14) therapy. During the first three cycles of chemotherapy, concurrent radiotherapy (60 Gy/30 fractions) targeting the thymic mass was planned. Meanwhile, anti-angiogenic therapy using apatinib, a VEGFR2 inhibitor (Jiangsu Hengrui Pharmaceutical Company Limited, Jiangsu Province, China), was omitted. This elicited grade II myelosuppression and grade II radioactive esophagitis during the concurrent chemoradiotherapy.\n\nOUTCOME AND FOLLOW-UP\n\nThe patient’s chest pain and dyspnea were significantly relieved after chemo-radiotherapy. The thymus mass size was reduced after radiotherapy (30 Gy/15 fractions), but the patient occasionally experienced tachycardia. To reduce heart toxicity, we narrowed the irradiation field. During treatment, the tumor continued to shrink, as shown in Figure 2B and C. After six cycles of XELOX, chest CT showed that the tumor was approximately 37 mm × 20 mm (Figure 2D). Laboratory tests showed that only one serum tumor marker (CA19-9, 60.70 U/mL) remained elevated. The patient refused physical examination during her long-term follow-up; however, she was alive without recurrence for 16 mo when this paper was written.\n\nDISCUSSION\n\nDuring embryogenesis, the thymus and gut originate from the same arch endoderm. Intriguingly, tuft cells were found to be present in the adult thymus[3]. In fact, tuft cells are functional intestinal epithelial cells[3]. Moreover, mutations in tuft cells elicit gut carcinogenesis in humans. In this regard, thymic tuft cells' role as potential sources for thymic carcinogenesis should be investigated.\n\nTo the best of our knowledge, there is no standard of care for the thymic-enteric adenocarcinoma. Previously, patients were mainly treated surgically because the disease was localized. In this case, tumor resection was challenging because of pericardial involvement. Initially, the Ki-67 index was 70%, suggesting that the tumor cells expanded in number. Proliferative cells are sensitive to ionizing irradiation[4]. Therefore, we chose radiotherapy for controlling the primary tumor, thereby alleviating the patient’s symptoms. Meanwhile, systematic chemotherapy plus anti-angiogenic therapy was used as the main treatment. Based on the similarities between thymic-enteric adenocarcinoma and colorectal cancer in histologic phenotype, the XELOX regimen was selected. Capecitabine inhibits DNA synthesis[5], while oxaliplatin induces immunogenic cell death. Moreover, angiogenic factors such as VEGF were detected in the malignant effusion[6]. Secreted by tumor cells, VEGF is a potent inducer of angiogenesis[6]. In this process, VEGF can significantly increase vascular permeability. Inhibition of angiogenesis in tumors limits pericardial effusion[7]. Thus, apatinib was selected for this patient.\n\nCONCLUSION\n\nIn this case, the primary tumor achieved partial remission according to the Response Evaluation Criteria in Solid Tumors, and there was no evidence of relapse during follow-up, except for high serum CA19-9 levels. In addition, treatment-related toxicity was manageable. Only grade II myelosuppression and grade II radioactive esophagitis occurred during treatment, thus demonstrating that our treatment was effective in this patient.\n\nInformed consent statement: Informed written consent was obtained from the patient for publishing this report and any accompanying images.\n\nConflict-of-interest statement: The authors declare that they have no conflicts of interest related to this manuscript.\n\nCARE Checklist (2016) statement: The authors have read the CARE Checklist (2016), and the manuscript was prepared and revised according to the CARE Checklist (2016).\n\nManuscript source: Unsolicited manuscript\n\nPeer-review started: September 23, 2020\n\nFirst decision: December 14, 2020\n\nArticle in press: January 6, 2021\n\nSpecialty type: Oncology\n\nCountry/Territory of origin: China\n\nPeer-review report’s scientific quality classification\n\nGrade A (Excellent): 0\n\nGrade B (Very good): 0\n\nGrade C (Good): C\n\nGrade D (Fair): 0\n\nGrade E (Poor): 0\n\nP-Reviewer: Mohamed SY S-Editor: Zhang H L-Editor: Wang TQ P-Editor: Yuan YY\n==== Refs\n1 Greene MA Malias MA Aggressive multimodality treatment of invasive thymic carcinoma J Thorac Cardiovasc Surg 2003 125 434 436 12579125\n2 Choi WW Lui YH Lau WH Crowley P Khan A Chan JK Adenocarcinoma of the thymus: report of two cases, including a previously undescribed mucinous subtype Am J Surg Pathol 2003 27 124 130 12502935\n3 Miller CN Proekt I von Moltke J Wells KL Rajpurkar AR Wang H Rattay K Khan IS Metzger TC Pollack JL Fries AC Lwin WW Wigton EJ Parent AV Kyewski B Erle DJ Hogquist KA Steinmetz LM Locksley RM Anderson MS Thymic tuft cells promote an IL-4-enriched medulla and shape thymocyte development Nature 2018 559 627 631 30022164\n4 Shi X Yuan X Tao D Gong J Hu G Analysis of DNA ploidy, cell cycle and Ki67 antigen in nasopharyngeal carcinoma by flow cytometry J Huazhong Univ Sci Technolog Med Sci 2005 25 198 201 16116972\n5 Comella P A review of the role of capecitabine in the treatment of colorectal cancer Ther Clin Risk Manag 2007 3 421 431 18488072\n6 Zebrowski BK Yano S Liu W Shaheen RM Hicklin DJ Putnam JB Jr Ellis LM Vascular endothelial growth factor levels and induction of permeability in malignant pleural effusions Clin Cancer Res 1999 5 3364 3368 10589746\n7 Roviello G Ravelli A Polom K Petrioli R Marano L Marrelli D Roviello F Generali D Apatinib: A novel receptor tyrosine kinase inhibitor for the treatment of gastric cancer Cancer Lett 2016 372 187 191 26797419\n8 Wang L Wang D Qian K Lu D Chen L Zhao L Teng L Thymic adenocarcinoma associated with thymic cyst: a case report and review of literature Int J Clin Exp Pathol 2015 8 5890 5895 26191314\n9 Jung HY Cho H Chung JH Bae SB Lee JH Lee HJ Jang SH Oh MH A Rare Case of Primary Tubular Adenocarcinoma of the Thymus, Enteric Immunophenotype: A Case Study and Review of the Literature J Pathol Transl Med 2015 49 331 334 26040775\n10 Moser B Schiefer AI Janik S Marx A Prosch H Pohl W Neudert B Scharrer A Klepetko W Müllauer L Adenocarcinoma of the thymus, enteric type: report of 2 cases, and proposal for a novel subtype of thymic carcinoma Am J Surg Pathol 2015 39 541 548 25517960\n11 Maghbool M Ramzi M Nagel I Bejarano P Siebert R Saeedzadeh A Daneshbod Y Primary adenocarcinoma of the thymus: an immunohistochemical and molecular study with review of the literature BMC Clin Pathol 2013 13 17 23725376\n12 Teramoto K Kawaguchi Y Hori T Ishida M Hashimoto M Kitamura S Motoishi M Hanaoka J Tezuka N Okabe H Thymic papillo-tubular adenocarcinoma containing a cyst: report of a case Surg Today 2012 42 988 991 22407350\n13 Abdul-Ghafar J Yong SJ Kwon W Park IH Jung SH Primary thymic mucinous adenocarcinoma: a case report Korean J Pathol 2012 46 377 381 23110032\n14 Seon HJ Kim KH Choi YD Song SY Yoon HJ Kim YH Jeong MH Park JC Angina pectoris caused by the extrinsic compression of coronary artery by primary thymic mucinous adenocarcinoma Int J Cardiol 2012 156 e13 e15 21856024\n15 Weissferdt A Moran CA Thymic carcinoma, part 1: a clinicopathologic and immunohistochemical study of 65 cases Am J Clin Pathol 2012 138 103 114 22706865\n16 Maeda D Ota S Ikeda S Kawano R Hata E Nakajima J Mori M Fukayama M Mucinous adenocarcinoma of the thymus: a distinct variant of thymic carcinoma Lung Cancer 2009 64 22 27 18722686\n17 Yin YG Lu HZ Primary Mucinous Adenocarcinoma of the Thymus: A Case Report and Literature Review Chin Med Sci J 2017 32 201 203 28956749\n18 Sawai T Inoue Y Doi S Ikuta Y Kimino K Nakashima M Soda H Kohno S Tubular adenocarcinoma of the thymus: case report and review of the literature Int J Surg Pathol 2006 14 243 246 16959713\n19 Tamai M Ishida M Ebisu Y Okamoto H Miyasaka C Ohe C Uemura Y Saito T Murakawa T Tsuta K Thymic enteric type adenocarcinoma: A case report with cytological features Diagn Cytopathol 2018 46 92 97 28888068\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2307-8960",
"issue": "9(7)",
"journal": "World journal of clinical cases",
"keywords": "Anti-angiogenic therapy; Case report; Chemotherapy; Radiotherapy; Thymic adenocarcinoma; Thymic-enteric adenocarcinoma",
"medline_ta": "World J Clin Cases",
"mesh_terms": null,
"nlm_unique_id": "101618806",
"other_id": null,
"pages": "1676-1681",
"pmc": null,
"pmid": "33728312",
"pubdate": "2021-03-06",
"publication_types": "D002363:Case Reports",
"references": "22407350;28888068;23725376;26040775;12579125;10589746;18488072;22706865;25517960;30022164;18722686;26797419;12502935;21856024;26191314;16959713;28956749;16116972;23110032",
"title": "Metastatic thymic-enteric adenocarcinoma responding to chemoradiation plus anti-angiogenic therapy: A case report.",
"title_normalized": "metastatic thymic enteric adenocarcinoma responding to chemoradiation plus anti angiogenic therapy a case report"
} | [
{
"companynumb": "CN-ACCORD-220833",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "APATINIB"
},
"drugadditional": null,
"drugad... |
{
"abstract": "To compare 300 U versus 500 U of abobotulinumtoxinA (ABO) intravesical injections for the treatment of idiopathic overactive bladder (OAB) refractory to first and second-line treatments.\n\n\n\nA prospective, randomized, single blind study was performed in female patients with symptoms of OAB, who had failed conservative treatment. Patients were treated with 300 or 500 U of ABO injected into 30 sites, avoiding the trigone. All treatments were evaluated by voiding diary, ICIQ-OAB questionnaire, urodynamic test, visual analogue scale (VAS) for treatment satisfaction and patient global impression of improvement (PGI-I). The primary outcome was change in maximum cistometric capacity (MCC). Secondary outcome included changes in urgency, complete continence, subjective success (VAS and PGI-I), and adverse events (urinary retention, UTI, and CIC).\n\n\n\nTwenty-one patients were included. MCC has increased from 185.0 to 270.9 mL (300 U) and from 240.8 to 311.7 mL (500 U), comparing the baseline with 12 weeks, without statistical difference between the groups (P = 0.270). At 12 weeks, 91% of patients were dry in both groups. At 24 weeks, episodes of incontinence had returned in 50% (300 U) and 0% (500 U) (P = 0.013). Patients were better or much better (PGI-I) in70% (300 U) and 88.9% (500 U) at 12 w; and 50% (300 U) and 100% (500 U), at 24 w (P = 0.027). The peak of PVR was at 4 w, being 71.7 mL (300 U) and 96.5 mL (500 U). General UTI incidence was 35.7%. One patient (500 U) required CIC for 2 weeks.\n\n\n\nIntravesical ABO injection at 500 U improves symptoms and quality of life for longer period of time than 300 U for idiopathic OAB.",
"affiliations": "Department of Obstetrics and Gynecology Santa Casa de Sao Paulo School of Medical Sciences, SP, Brazil.;Department of Surgery, Division of Female Urology Santa Casa de Sao Paulo School of Medical Sciences, SP, Brazil.;Department of Obstetrics and Gynecology, Division of Urogynecology Santa Casa de Sao Paulo School of Medical Sciences, SP, Brazil.;Department of Surgery, Division of Female Urology Santa Casa de Sao Paulo School of Medical Sciences, SP, Brazil.;Department of Urology, Vanderbilt University, Nashville, Tennessee.;Department of Obstetrics and Gynecology, Division of Urogynecology Santa Casa de Sao Paulo School of Medical Sciences, SP, Brazil.",
"authors": "de Sá Dantas Bezerra|Danielle|D|0000-0003-1899-6355;de Toledo|Luis Gustavo Morato|LGM|;da Silva Carramão|Silvia|S|;Silva Rodrigues|Antonio F|AF|;Dmockowski|Roger|R|0000-0002-9838-9178;Auge|Antonio P F|APF|",
"chemical_list": "D064804:Urological Agents; D019274:Botulinum Toxins, Type A; C542869:abobotulinumtoxinA",
"country": "United States",
"delete": false,
"doi": "10.1002/nau.23884",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0733-2467",
"issue": "38(2)",
"journal": "Neurourology and urodynamics",
"keywords": "botulinum toxins; overactive; type A; urge; urinary bladder; urinary incontinence",
"medline_ta": "Neurourol Urodyn",
"mesh_terms": "D000283:Administration, Intravesical; D000328:Adult; D000368:Aged; D019274:Botulinum Toxins, Type A; D005260:Female; D006801:Humans; D008875:Middle Aged; D017060:Patient Satisfaction; D011446:Prospective Studies; D011788:Quality of Life; D016037:Single-Blind Method; D011795:Surveys and Questionnaires; D016896:Treatment Outcome; D053201:Urinary Bladder, Overactive; D014554:Urination; D014563:Urodynamics; D064804:Urological Agents; D064232:Visual Analog Scale",
"nlm_unique_id": "8303326",
"other_id": null,
"pages": "660-667",
"pmc": null,
"pmid": "30525226",
"pubdate": "2019-02",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "A prospective randomized clinical trial comparing two doses of AbobotulinumtoxinA for idiopathic overactive bladder.",
"title_normalized": "a prospective randomized clinical trial comparing two doses of abobotulinumtoxina for idiopathic overactive bladder"
} | [
{
"companynumb": "BR-IPSEN BIOPHARMACEUTICALS, INC.-2018-19608",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BOTULINUM TOXIN TYPE A"
},
... |
{
"abstract": "BACKGROUND\nTakotsubo cardiomyopathy is rare in pregnancy and is characterized by left ventricular dysfunction with apical ballooning. This transient cardiac dysfunction may affect women of childbearing age in the antepartum, intrapartum or postpartum period. Most patients respond well to medical management with resolution of cardiac dysfunction within weeks.\n\n\nMETHODS\nA 35-year-old female in her second pregnancy presented with severe preeclampsia at 31 weeks of gestation. She subsequently developed severe substernal chest pain and workup showed a stress induced cardiomyopathy prior to her delivery via caesarean section. She had full recovery of her cardiac function by 12 weeks postpartum after medical management.\n\n\nCONCLUSIONS\nStress induced cardiomyopathy, though rare, should be considered after acute myocardial infarction has been ruled out in gravid females presenting with acute chest pain. Management should involve a multidisciplinary team. Cardiac function recovery is common within 4 weeks although some patients may require long term heart failure management.",
"affiliations": "Department of Obstetrics and Gynecology, Aga Khan University, P.O. Box 30270-00100, Nairobi, Kenya. droindi@gmail.com.;Department of Obstetrics and Gynecology, Aga Khan University, P.O. Box 30270-00100, Nairobi, Kenya.;Department of Pulmonary and Critical Care Medicine, Norwalk Hospital/Yale University, Norwalk, CT, USA.;Department of Obstetrics and Gynecology, Aga Khan University, P.O. Box 30270-00100, Nairobi, Kenya.",
"authors": "Oindi|Felix Mwembi|FM|http://orcid.org/0000-0002-4224-2599;Sequeira|Evan|E|;Sequeira|Herman Ryan|HR|;Mutiso|Steve Kyende|SK|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12884-019-2233-7",
"fulltext": "\n==== Front\nBMC Pregnancy ChildbirthBMC Pregnancy ChildbirthBMC Pregnancy and Childbirth1471-2393BioMed Central London 223310.1186/s12884-019-2233-7Case ReportTakotsubo cardiomyopathy in pregnancy: a case report and literature review http://orcid.org/0000-0002-4224-2599Oindi Felix Mwembi +254 723 499 586droindi@gmail.com 1Sequeira Evan evan.sequeira@aku.edu 1Sequeira Herman Ryan herman.sequeira@yale.edu 2Mutiso Steve Kyende steve_mutiso@yahoo.com 11 grid.470490.eDepartment of Obstetrics and Gynecology, Aga Khan University, P.O. Box 30270-00100, Nairobi, Kenya 2 0000000419368710grid.47100.32Department of Pulmonary and Critical Care Medicine, Norwalk Hospital/Yale University, Norwalk, CT USA 12 3 2019 12 3 2019 2019 19 8926 3 2018 1 3 2019 © The Author(s). 2019Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nTakotsubo cardiomyopathy is rare in pregnancy and is characterized by left ventricular dysfunction with apical ballooning. This transient cardiac dysfunction may affect women of childbearing age in the antepartum, intrapartum or postpartum period. Most patients respond well to medical management with resolution of cardiac dysfunction within weeks.\n\nCase presentation\nA 35-year-old female in her second pregnancy presented with severe preeclampsia at 31 weeks of gestation. She subsequently developed severe substernal chest pain and workup showed a stress induced cardiomyopathy prior to her delivery via caesarean section. She had full recovery of her cardiac function by 12 weeks postpartum after medical management.\n\nConclusions\nStress induced cardiomyopathy, though rare, should be considered after acute myocardial infarction has been ruled out in gravid females presenting with acute chest pain. Management should involve a multidisciplinary team. Cardiac function recovery is common within 4 weeks although some patients may require long term heart failure management.\n\nKeywords\nTakotsubo cardiomyopathyPreeclampsiaPregnancyissue-copyright-statement© The Author(s) 2019\n==== Body\nBackground\nTakotsubo cardiomyopathy (TCM) also known as stress induced cardiomyopathy is characterized by new onset left ventricular dysfunction with variable wall motion abnormalities in the absence of significant coronary artery disease [1–3]. Cardiac function usually recovers spontaneously in most patients within days or weeks [4, 5]. The common triggers of TCM include emotional or psychological stressors with a higher incidence seen in patients with preexisting psychiatric conditions [6]. However, up to 20% of affected patients have no identifiable stressors [1, 7]. Majority of TCM cases in pregnancy are described in the peripartum period irrespective of the mode of delivery [8–10] making it difficult to differentiate TCM from peripartum cardiomyopathy [5].\n\nIn this article, we present a case of a 35-year-old female who presented with severe preeclampsia at 31 weeks of gestation and subsequently developed TCM during her hospitalization. We further review the current literature on stress-induced cardiomyopathy in pregnancy.\n\nCase report\nA 35-year-old Indian female, para 1 + 0 gravida 2, was admitted with severe preeclampsia at 31 weeks of gestation after complaints of anasarca for 1 week. She reported normal fetal movements with no epigastric discomfort, headaches or visual blurring. She had a blood pressure of 190/110 mmHg with a regular pulse rate at 70 beats/minute palpable on all extremities. She was afebrile at 36.7°C, had a respiratory rate of 18 breaths per minute and peripheral oxygen saturation of 99% on room air.\n\nSix years prior, she had had severe preeclampsia and a preterm delivery by caesarean section at 29 weeks of gestation. The baby died of infant respiratory distress syndrome shortly after birth causing the patient significant psychological distress requiring counselling. This made her defer the possibility of a pregnancy for years sighting psychological trauma.\n\nThis pregnancy, she presented in the first trimester for antenatal care. Her blood pressure was 110/70 mmHg and antenatal profile was unremarkable: Hemoglobin 13.0 g/dl; Hepatitis-B surface Antigen, H.I.V. and Venereal Disease Research Laboratory (VDRL) were negative. Her blood group was O with positive Rhesus factor. The dating scan confirmed a 12-week-old gestation and she was placed on aspirin 75 mg throughout her pregnancy. Subsequent antenatal visits at 16, 20, 24, 28 and 30 weeks were uneventful with normal blood pressures. An anomaly obstetric scan at 20 weeks gestation showed no fetal anomalies with subsequent growth scans at 24 and 28 weeks showing normal growth with normal umbilical and middle cerebral artery doppler flows.\n\nOn admission, she had macro albuminuria with elevated urine albumin creatinine ratio of 422 mg/mmol. Her hemoglobin was 12.1 g/dl and the platelet count was 194,000/ml. The renal and liver functions were normal.\n\nShe was started on intravenous (IV) magnesium sulphate infusion as per the Zuspan regime [11] (4 g slow IV bolus followed by 1 g/hour for 24 h) for maternal seizure prophylaxis and fetal neuro-protection [12]. She received multiple push doses of IV hydralazine for blood pressure control and was eventually placed on hydralazine infusion at 1 mg/hour. In addition, she received oral nifedipine and oral alpha methyldopa. Two doses of betamethasone 12 mg were administered intramuscularly 24 h apart for fetal lung maturation. She also received low molecular weight heparin (LMWH) for thromboprophylaxis and the total fluid intake was maintained at 80 ml/hr. to minimize the risk of pulmonary oedema.\n\nThirty hours post-admission, she developed worsening orthopnea with severe sub sternal left sided chest pain radiating to the left axilla without symptoms of diaphoresis, nausea or vomiting. Her blood pressure was 138/82 mmHg, pulse rate of 64 beats per minute, and peripheral oxygen saturation via pulse oximetry was 99% on room air. A chest x-ray revealed no features of pulmonary edema while an electrocardiogram (ECG) revealed a sinus rhythm with ST elevation in the anteroseptal leads (V1–4), Q waves in the septal leads (V1–2) and peaked T waves in V2–4 indicating an acute anteroseptal ST-Elevation Myocardial Infarction (STEMI) (Fig. 1). A transthoracic echocardiogram showed wall motion abnormalities with interventricular septum and anterior wall hypokinesia. The left ventricle (LV) was dilated with an ejection fraction of 48% (Fig. 2). The right ventricular size was normal whereas the peak pulmonary arterial pressure was elevated at 50 mm/Hg. Lower extremity dopplers revealed no venous thrombus while an assay of cardiac enzymes revealed elevated Troponin I levels of 0.51 ng/ml (normal ≤0.04 ng/ml) and Creatinine Kinase -MB (CK-MB) levels of 54 IU/l (reference range 5–25 IU/l).Fig. 1 ECG trace showing ST elevation in the antero-septal leads (V1–4), Q waves in the septal leads (V1–2) and peaked T waves in V2–4) indicating an acute antero-septal ST-Elevation Myocardial Infarction\n\nFig. 2 Transthoracic echocardiography showing apical ballooning of the left ventricle (LV: Left Ventricle; RV: Right Ventricle; LA: Left Atrium; RA: Right Atrium)\n\n\n\nFetal assessment ultrasound done on day 2 of admission revealed an abnormal cerebroplacental ratio (CPR) of 0.57 necessitating delivery by caesarean section. The infant weighed 1 .5kg with Apgar score of 9 at 1 min and 10 at 5 min. Left cardiac catheterization was subsequently done on day 3, approximately 18 h after the last dose of LMWH and showed left ventricular apical ballooning with no evidence of atherosclerosis in the coronaries.\n\nThe LMWH thromboprophylaxis (0 .5mg/kg once daily) was restarted 12 h post-delivery for one week. The blood pressure was controlled with amlodipine (10 mg once daily). Postpartum, she remained normotensive and anti-hypertensive medication was stopped after 6 weeks. Cardiac injury biomarkers normalized by the 10th postpartum day. The ECG done at 6 weeks postpartum showed frontal QRS complex of + 100 degrees with QS complexes from V1 to V3 consistent with recent antero-septal myocardial infarction (Fig. 3) while that done 6 weeks later showed no significant abnormalities (Fig. 4). The echocardiogram at 3 months post-delivery revealed normal cardiac chambers with no regional wall motion abnormalities with a left ventricle ejection fraction of 65%.Fig. 3 ECG trace showing frontal QRS complex of + 100 degrees. She had QS complexes from V1 to V3 consistent with prior antero-septal myocardial ischemia\n\nFig. 4 Normal ECG trace following recovery from cardiomyopathy\n\n\n\nDiscussion\nTakotsubo cardiomyopathy (TCM) is a rare life-threatening illness that can affect pregnant women. It should be considered a cardiac emergency as it mimics myocardial infarction, peripartum cardiomyopathy, acute myocarditis, and dilated cardiomyopathy and is a diagnosis of exclusion. Takotsubo cardiomyopathy (TCM) typically presents with acute retrosternal chest pain, palpitations and diaphoresis [5]. Affected patients may also have symptoms of left heart failure such as paroxysmal nocturnal dyspnea, orthopnea and dyspnea [1].\n\nThe common triggers of TCM include psychosocial stressors with greater occurrence in those with premorbid psychiatric illnesses [6, 13]. Our patient had a history of depressive illness due to a previous adverse pregnancy outcome which may have predisposed her to TCM. In addition, it is possible that the severe preeclampsia caused an acute elevation of blood pressure from the baseline triggering TCM. Increased afterload from hypertension may cause a demand-supply mismatch leading to a type 2 non- ST-elevation myocardial infarction (NSTEMI) [14].\n\nDiagnostic evaluation of TCM includes an electrocardiogram (ECG), cardiac biomarkers, echocardiography and left heart angiography. The ECG abnormalities commonly encountered include ST segment elevation in the anterior and precordial leads with some having ST segment depression [15, 16]. A few patients may have QT interval prolongation, T wave inversion, abnormal Q waves and non-specific abnormalities [15]. The majority of patients will have elevated cardiac troponin levels with normal to mildly elevated creatinine kinase. The natriuretic peptides (brain natriuretic peptide (BNP) and pro-BNP) may be elevated in up to 83% of cases indicating ventricular strain, though to a lesser extent than that seen in acute myocarditis [16].\n\nThe typical findings on transthoracic echocardiography include a large area of regional wall motion akinesia of the LV extending beyond the territory of a single coronary artery [17]. There is apical ballooning of the LV with normal basal contractility. The LV ejection fraction is often reduced ranging from 20 to 49% [18]. In addition, there may be mitral regurgitation with or without a systolic anterior motion of the anterior leaflet [17].\n\nThe diagnosis of TCM is based on the Mayo clinic diagnostic criteria [1]. This includes presence of transient akinesis, hypokinesis or dyskinesis of the left ventricle with or without apical involvement; this regional ventricular wall motion abnormality extends beyond a single epicardial vascular perfusion territory. Further there is absence of obstructive coronary disease or angiographic evidence of acute plaque rupture. The patient may also have ECG abnormalities (such as ST-segment elevation with or without T-wave inversion) or moderately elevated cardiac troponin levels. Lastly, myocarditis and phaechromocytoma need to be excluded [1, 16]. Our patient had transient ECG abnormalities and no angiographic evidence of acute plaque rupture or vessel occlusion fulfilling the Mayo criteria for TCM.\n\nUp to 25% of TCM cases may develop Left Ventricular Outflow Tract (LVOT) obstruction due to the increased contractility of the base of the heart [18, 19]. Prompt diagnosis by use of echocardiography and timely management results in outcomes comparable to those without LVOT [20]. The detection of LVOT obstruction is important as the patients usually present with hypotension and the use of ionotropic agents may increase the intraventricular pressure gradient and induce cardiogenic shock [18].\n\nMost patients recover normal cardiac function within 4 to 8 weeks [5, 16]. Our patient had resolution of heart failure symptoms with full recovery by 12 weeks post-delivery. Care of these patients is directed at managing their symptoms and medical cardiac optimization with diuretics, angiotensin-converting enzyme inhibitors and beta blockers. Due to association with fetal growth restriction, if on beta blockers, there is need to schedule ultrasounds for fetal growth every 4 weeks.\n\nThe resolution of physical or emotional stress usually results in rapid resolution of symptoms though some patients may develop acute complications such as acute heart failure and cardiogenic shock requiring coronary cardiac unit admission and need for invasive techniques such as intra-aortic balloon pump and cardiopulmonary support [10].\n\nThe decision on the timing and mode of delivery should be guided by obstetrical reasons. It should involve a multidisciplinary team of cardiologists, obstetricians, neonatologists and psychologists.\n\nRecurrence of TCM in premenopausal women is rare [21]. Close follow up upon discharge is required as some patients may deteriorate and develop major adverse cardiac and cerebrovascular events [1].\n\nIn conclusion, TCM is a rare cardiac condition especially in pregnancy. Management challenges for ongoing pregnancies are crowded by safety concerns of the drugs used for managing acute myocardial infarction. Longitudinal studies are needed to evaluate the reproductive history of women with TCM and further assess its association with preeclampsia. However, we strongly advocate for a multidisciplinary approach in order to optimize outcomes for the mother and child.\n\nAbbreviations\nECGElectrocardiogram\n\nLMWHLow Molecular Weight Heparin\n\nLVLeft ventricle\n\nLVOTLeft Ventricular Outflow Tract\n\nTCMTakotsubo cardiomyopathy\n\nAcknowledgements\nWe would like to thank our patient for allowing us to publish her medical condition. We also thank the International Federation of Gynecologists and Obstetricians (FIGO) for according us an opportunity to share this case as a poster presentation during the XXII FIGO world congress held from the 14th to 19th October 2018 in Rio de Janeiro, Brazil.\n\nFunding\nNot applicable.\n\nAvailability of data and materials\nData sharing is not applicable to this article as no datasets were generated or analyzed during the current study.\n\nAdherence to CARE guidelines\nCare guidelines were adhered to during the process of manuscript preparation.\n\nAuthors’ contributions\nFO managed the patient, analyzed the case report and wrote the manuscript. ES managed the patient and contributed to writing the manuscript. HS analyzed the case report and contributed in writing the manuscript. SM managed the patient and wrote the manuscript. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nNot applicable.\n\nConsent for publication\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Templin C Ghadri JR Diekmann J Napp LC Bataiosu DR Jaguszewski M Clinical features and outcomes of Takotsubo (stress) cardiomyopathy N Engl J Med 2015 373 10 929 938 10.1056/NEJMoa1406761 26332547 \n2. Minatoguchi M Itakura A Takagi E Nishibayashi M Kikuchi M Ishihara O Takotsubo cardiomyopathy after cesarean: a case report and published work review of pregnancy-related cases J Obstet Gynaecol Res 2014 40 6 1534 1539 10.1111/jog.12437 24888912 \n3. Salmoirago-Blotcher E Dunsiger S Swales HH Aurigemma GP Ockene I Rosman L Reproductive history of women with Takotsubo cardiomyopathy Am J Cardiol 2016 118 12 1922 1928 10.1016/j.amjcard.2016.08.083 27742423 \n4. Pelliccia F Kaski JC Crea F Camici PG Pathophysiology of Takotsubo syndrome Circulation. 2017 135 24 2426 2441 10.1161/CIRCULATIONAHA.116.027121 28606950 \n5. Yaqub Y Jenkins LA Nugent KM Chokesuwattanaskul W Postpartum depression and apical ballooning syndrome (takotsubo syndrome) J Obstet Gynaecol Can 2009 31 8 736 739 10.1016/S1701-2163(16)34279-7 19772707 \n6. Nayeri A, Rafla-Yuan E, Farber-Eger E, Blair M, Ziaeian B, Cadeiras M, et al. Pre-existing psychiatric illness is associated with increased risk of recurrent Takotsubo cardiomyopathy. Psychosomatics. 2017.\n7. Corrigan FE 3rd Kimmel MC Jayaram G Four cases of takotsubo cardiomyopathy linked with exacerbations of psychiatric illness Innov Clin Neurosci 2011 8 7 50 53 21860845 \n8. Virani SS Khan AN Mendoza CE Ferreira AC de Marchena E Takotsubo cardiomyopathy, or broken-heart syndrome Tex Heart Inst J 2007 34 1 76 79 17420797 \n9. Ruiz S Martinez-Marin M Luque P Nassar N Oros D Takotsubo cardiomyopathy after cesarean section: a case report and literature review J Obstet Gynaecol Res 2017 43 2 392 396 10.1111/jog.13212 27935217 \n10. Suzuki T Nemoto C Ikegami Y Yokokawa T Tsukada Y Abe Y Development of takotsubo cardiomyopathy with severe pulmonary edema before a cesarean section J Anesth 2014 28 1 121 124 10.1007/s00540-013-1677-6 23877950 \n11. Smith JM Lowe RF Fullerton J Currie SM Harris L Felker-Kantor E An integrative review of the side effects related to the use of magnesium sulfate for pre-eclampsia and eclampsia management BMC Pregnancy Childbirth. 2013 13 34 10.1186/1471-2393-13-34 23383864 \n12. Chollat C Le Doussal L de la Villeon G Provost D Marret S Antenatal magnesium sulphate administration for fetal neuroprotection: a French national survey BMC Pregnancy Childbirth 2017 17 1 304 10.1186/s12884-017-1489-z 28903747 \n13. Zdanowicz JA Utz AC Bernasconi I Geier S Corti R Beinder E \"broken heart\" after cesarean delivery. Case report and review of literature Arch Gynecol Obstet 2011 283 4 687 694 10.1007/s00404-010-1769-6 21136269 \n14. Picariello C Lazzeri C Attana P Chiostri M Gensini GF Valente S The impact of hypertension on patients with acute coronary syndromes Int J Hypertens 2011 2011 563657 10.4061/2011/563657 21747979 \n15. Otani Y Tokunaga K Kawauchi S Inoue S Watanabe K Kiriyama H Cerebral infarction arising from Takotsubo cardiomyopathy: case report and literature review NMC Case Rep J 2016 3 4 119 123 10.2176/nmccrj.cr.2016-0034 28664012 \n16. Rozema T Klein LR Takotsubo cardiomyopathy: a case report and literature review Cardiol Young 2016 26 2 406 409 10.1017/S1047951115001249 26175107 \n17. Gupta S Gupta MM Takotsubo syndrome Indian Heart J 2018 70 1 165 174 10.1016/j.ihj.2017.09.005 29455773 \n18. Roshanzamir S Showkathali R Takotsubo cardiomyopathy a short review Curr Cardiol Rev 2013 9 3 191 196 10.2174/1573403X11309030003 23642025 \n19. Yalta K Yilmaztepe M Zorkun C Left ventricular dysfunction in the setting of Takotsubo cardiomyopathy: a review of clinical patterns and practical implications Card Fail Rev 2018 4 1 14 20 10.15420/cfr.2018:24:2 29892470 \n20. De Backer O Debonnaire P Gevaert S Missault L Gheeraert P Muyldermans L Prevalence, associated factors and management implications of left ventricular outflow tract obstruction in takotsubo cardiomyopathy: a two-year, two-center experience BMC Cardiovasc Disord 2014 14 147 10.1186/1471-2261-14-147 25339604 \n21. Hefner J Csef H Frantz S Glatter N Warrings B Recurrent Tako-Tsubo cardiomyopathy (TCM) in a pre-menopausal woman: late sequelae of a traumatic event? BMC Cardiovasc Disord 2015 15 3 10.1186/1471-2261-15-3 25601763\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2393",
"issue": "19(1)",
"journal": "BMC pregnancy and childbirth",
"keywords": "Preeclampsia; Pregnancy; Takotsubo cardiomyopathy",
"medline_ta": "BMC Pregnancy Childbirth",
"mesh_terms": "D000328:Adult; D002585:Cesarean Section; D005260:Female; D006801:Humans; D011225:Pre-Eclampsia; D011247:Pregnancy; D011249:Pregnancy Complications, Cardiovascular; D013315:Stress, Psychological; D054549:Takotsubo Cardiomyopathy",
"nlm_unique_id": "100967799",
"other_id": null,
"pages": "89",
"pmc": null,
"pmid": "30866848",
"pubdate": "2019-03-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "17420797;19772707;21136269;21747979;21860845;23383864;23642025;23877950;24888912;25339604;25601763;26175107;26332547;27742423;27935217;28602445;28606950;28664012;28903747;29455773;29892470",
"title": "Takotsubo cardiomyopathy in pregnancy: a case report and literature review.",
"title_normalized": "takotsubo cardiomyopathy in pregnancy a case report and literature review"
} | [
{
"companynumb": "PHHY2019KE080415",
"fulfillexpeditecriteria": "1",
"occurcountry": "KE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHYLDOPA"
},
"drugadditional": null,
"drug... |
{
"abstract": "We describe a case of persistent cytomegalovirus (CMV) infection after allogeneic hematopoietic stem cell transplantation (allo-HSCT) with discordant and high-risk (D-/R+) constellation of CMV serostatus. Despite the use of different and innovative antiviral strategies, viral replication could not be suppressed successfully promoting a protracted CMV colitis associated with severe gastrointestinal graft-versus-host disease (GI GVHD). We illustrate that the development of multidrug viral resistance, the failure to mount a CMV-specific cellular immune response, as confirmed by QuantiFERON(®)-CMV (Qiagen) assay, and the refractory GVHD requiring prolonged immunosuppression were the main factors contributing to persistent viral replication and the fulminant unfavorable course.",
"affiliations": "Department of Internal Medicine I, University Hospital of Cologne, Cologne, Germany.;Institute of Virology, University Hospital of Cologne, Cologne, Germany.;Institute of Virology, University Hospital of Cologne, Cologne, Germany.;Department of Internal Medicine I, University Hospital of Cologne, Cologne, Germany.;Department of Internal Medicine I, University Hospital of Cologne, Cologne, Germany.;Institute of Virology, University Hospital of Cologne, Cologne, Germany.;Institute of Virology, University Hospital of Cologne, Cologne, Germany.;Department of Internal Medicine I, University Hospital of Cologne, Cologne, Germany.;Institute of Virology, University Hospital of Cologne, Cologne, Germany. Electronic address: veronica.di-cristanziano@uk-koeln.de.",
"authors": "Herling|Marco|M|;Schröder|L|L|;Awerkiew|Sabine|S|;Chakupurakal|Geothy|G|;Holtick|Udo|U|;Kaiser|Rolf|R|;Pfister|Herbert|H|;Scheid|Christof|C|;Di Cristanziano|Veronica|V|",
"chemical_list": "D000998:Antiviral Agents",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1386-6532",
"issue": "74()",
"journal": "Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology",
"keywords": "Allogeneic hematopoietic stem cell transplantation; Cytomegalovirus; Multidrug resistance; QuantiFERON(®)-CMV assay",
"medline_ta": "J Clin Virol",
"mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D003587:Cytomegalovirus; D003586:Cytomegalovirus Infections; D024921:Drug Resistance, Multiple, Viral; D005260:Female; D006086:Graft vs Host Disease; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007111:Immunity, Cellular; D016867:Immunocompromised Host; D014019:Tissue Donors; D066027:Transplant Recipients; D014184:Transplantation, Homologous",
"nlm_unique_id": "9815671",
"other_id": null,
"pages": "57-60",
"pmc": null,
"pmid": "26672492",
"pubdate": "2016-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Persistent CMV infection after allogeneic hematopoietic stem cell transplantation in a CMV-seronegative donor-to-positive recipient constellation: Development of multidrug resistance in the absence of anti-viral cellular immunity.",
"title_normalized": "persistent cmv infection after allogeneic hematopoietic stem cell transplantation in a cmv seronegative donor to positive recipient constellation development of multidrug resistance in the absence of anti viral cellular immunity"
} | [
{
"companynumb": "DE-SA-2016SA007417",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": null,
"... |
{
"abstract": "OBJECTIVE\nManagement of labor analgesia and post-cesarean delivery pain is challenging in the patient taking buprenorphine as opioid addiction maintenance therapy. We observed whether substituting clonidine for fentanyl in an epidural solution would provide adequate analgesia for labor and after cesarean delivery.\n\n\nMETHODS\nWe substituted our standard 2 µg/mL fentanyl in 0.0625% bupivacaine epidural solution with 2 µg/mL clonidine in 0.0625% bupivacaine, or 1.2 µg/mL clonidine in 0.1% bupivacaine, for labor and post-cesarean analgesia in parturients on buprenorphine therapy. All cesarean deliveries were performed with a combined spinal-epidural technique and the catheters maintained for immediate postoperative analgesia using an epidural infusion. Catheters were discontinued the next day and patients were then managed with other analgesics based on obstetric preference. We recorded pain scores during labor and in the immediate post-surgical period; and supplemental medications given after epidural catheter removal.\n\n\nRESULTS\nFourteen patients were included in the study, of whom seven presented in spontaneous labor and seven had elective cesarean delivery. All laboring patients achieved good analgesia, and five of seven avoided supplemental opioid use in the postpartum phase. Of the postsurgical patients, six of seven had pain scores less than 5/10 at epidural catheter removal and three of seven avoided supplemental opioids postoperatively.\n\n\nCONCLUSIONS\nThe combination of clonidine and bupivacaine appears effective in parturients on buprenorphine therapy for opioid addiction maintenance. As study numbers were small and several factors were not examined, further confirmatory research is needed, including to determine the ideal dose of epidural clonidine in this setting.",
"affiliations": "Anesthesiology Institute, Hillcrest Hospital, Cleveland Clinic Health System, 6870 Mayfield Road, Cleveland, OH 44124, United States. Electronic address: hoytm@ccf.org.;Department of Anesthesiology, Robert Wood Johnson University Hospital, 125 Paterson Street - CAB 3100, New Brunswick, NJ 08901, United States.;Department of Anesthesiology, University of Tennessee College of Medicine, Chandler Building, Suite 600, 877 Jefferson Avenue, Memphis, TN 38103, United States.;Department of Pharmacy, Hillcrest Hospital, Cleveland Clinic Health System, 6780 Mayfield Road, Cleveland, OH 44124, United States.",
"authors": "Hoyt|M R|MR|;Shah|U|U|;Cooley|J|J|;Temple|M|M|",
"chemical_list": "D000316:Adrenergic alpha-Agonists; D009294:Narcotics; D002047:Buprenorphine; D003000:Clonidine",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.ijoa.2018.01.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-289X",
"issue": "34()",
"journal": "International journal of obstetric anesthesia",
"keywords": "Analgesia; Buprenorphine; Clonidine; Epidural; Labor; Opioid addiction; Post-cesarean",
"medline_ta": "Int J Obstet Anesth",
"mesh_terms": "D000316:Adrenergic alpha-Agonists; D000328:Adult; D015360:Analgesia, Epidural; D016362:Analgesia, Obstetrical; D002047:Buprenorphine; D002404:Catheterization; D002585:Cesarean Section; D003000:Clonidine; D036861:Delivery, Obstetric; D005260:Female; D006801:Humans; D009294:Narcotics; D058850:Opiate Substitution Treatment; D009293:Opioid-Related Disorders; D059408:Pain Management; D010147:Pain Measurement; D010149:Pain, Postoperative; D011247:Pregnancy; D055815:Young Adult",
"nlm_unique_id": "9200430",
"other_id": null,
"pages": "67-72",
"pmc": null,
"pmid": "29486974",
"pubdate": "2018-05",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "Use of epidural clonidine for the management of analgesia in the opioid addicted parturient on buprenorphine maintenance therapy: an observational study.",
"title_normalized": "use of epidural clonidine for the management of analgesia in the opioid addicted parturient on buprenorphine maintenance therapy an observational study"
} | [
{
"companynumb": "US-UNICHEM PHARMACEUTICALS (USA) INC-UCM201810-000280",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CLONIDINE HYDROCHLORIDE"
},... |
{
"abstract": "Patients who have residual invasive carcinoma after the receipt of neoadjuvant chemotherapy for human epidermal growth factor receptor 2 (HER2)-negative breast cancer have poor prognoses. The benefit of adjuvant chemotherapy in these patients remains unclear.\n\n\n\nWe randomly assigned 910 patients with HER2-negative residual invasive breast cancer after neoadjuvant chemotherapy (containing anthracycline, taxane, or both) to receive standard postsurgical treatment either with capecitabine or without (control). The primary end point was disease-free survival. Secondary end points included overall survival.\n\n\n\nThe result of the prespecified interim analysis met the primary end point, so this trial was terminated early. The final analysis showed that disease-free survival was longer in the capecitabine group than in the control group (74.1% vs. 67.6% of the patients were alive and free from recurrence or second cancer at 5 years; hazard ratio for recurrence, second cancer, or death, 0.70; 95% confidence interval [CI], 0.53 to 0.92; P=0.01). Overall survival was longer in the capecitabine group than in the control group (89.2% vs. 83.6% of the patients were alive at 5 years; hazard ratio for death, 0.59; 95% CI, 0.39 to 0.90; P=0.01). Among patients with triple-negative disease, the rate of disease-free survival was 69.8% in the capecitabine group versus 56.1% in the control group (hazard ratio for recurrence, second cancer, or death, 0.58; 95% CI, 0.39 to 0.87), and the overall survival rate was 78.8% versus 70.3% (hazard ratio for death, 0.52; 95% CI, 0.30 to 0.90). The hand-foot syndrome, the most common adverse reaction to capecitabine, occurred in 73.4% of the patients in the capecitabine group.\n\n\n\nAfter standard neoadjuvant chemotherapy containing anthracycline, taxane, or both, the addition of adjuvant capecitabine therapy was safe and effective in prolonging disease-free survival and overall survival among patients with HER2-negative breast cancer who had residual invasive disease on pathological testing. (Funded by the Advanced Clinical Research Organization and the Japan Breast Cancer Research Group; CREATE-X UMIN Clinical Trials Registry number, UMIN000000843 .).",
"affiliations": "From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.;From the National Hospital Organization Osaka National Hospital, Osaka (N.M.), Hiroshima City Hiroshima Citizens Hospital, Hiroshima (S. Ohtani), Kyoto Prefectural University of Medicine (I.Y.), and Graduate School of Medicine, Kyoto University (M.T.), Kyoto, Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital (K.K.), and Chuo University (Y.O.), Tokyo, Gunma Prefectural Cancer Center, Ota (Y.Y.), National Hospital Organization Kyushu Cancer Center, Fukuoka (S. Ohno), Hyogo Cancer Center, Akashi (S.T.), National Hospital Organization Shikoku Cancer Center, Matsuyama (K.A.), Aichi Cancer Center Hospital, Nagoya (H.I.), and Tohoku University, Sendai (H.S.) - all in Japan; and Yeungnam University Hospital, Daegu (S.-J.L.), Samsung Medical Center, Sungkyunkwan University School of Medicine (Y.-H.I.), Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine (S.-A.I.), Severance Hospital (B.-W.P.) and Gangnam Severance Hospital (J.J.), Yonsei University College of Medicine, Asan Medical Center, University of Ulsan College of Medicine (S.-B.K.), Korea University Guro Hospital (A.K.), and Korea University Anam Hospital (K.-H.P.), Seoul, and National Cancer Center, Goyang-si (E.-S.L.) - all in South Korea.",
"authors": "Masuda|Norikazu|N|;Lee|Soo-Jung|SJ|;Ohtani|Shoichiro|S|;Im|Young-Hyuck|YH|;Lee|Eun-Sook|ES|;Yokota|Isao|I|;Kuroi|Katsumasa|K|;Im|Seock-Ah|SA|;Park|Byeong-Woo|BW|;Kim|Sung-Bae|SB|;Yanagita|Yasuhiro|Y|;Ohno|Shinji|S|;Takao|Shintaro|S|;Aogi|Kenjiro|K|;Iwata|Hiroji|H|;Jeong|Joon|J|;Kim|Aeree|A|;Park|Kyong-Hwa|KH|;Sasano|Hironobu|H|;Ohashi|Yasuo|Y|;Toi|Masakazu|M|",
"chemical_list": "D000964:Antimetabolites, Antineoplastic; D000069287:Capecitabine; C508053:ERBB2 protein, human; D018719:Receptor, ErbB-2",
"country": "United States",
"delete": false,
"doi": "10.1056/NEJMoa1612645",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0028-4793",
"issue": "376(22)",
"journal": "The New England journal of medicine",
"keywords": null,
"medline_ta": "N Engl J Med",
"mesh_terms": "D000328:Adult; D000368:Aged; D000964:Antimetabolites, Antineoplastic; D001943:Breast Neoplasms; D000069287:Capecitabine; D017024:Chemotherapy, Adjuvant; D005260:Female; D060831:Hand-Foot Syndrome; D006801:Humans; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D009367:Neoplasm Staging; D011300:Preoperative Care; D018719:Receptor, ErbB-2; D016019:Survival Analysis; D064726:Triple Negative Breast Neoplasms",
"nlm_unique_id": "0255562",
"other_id": null,
"pages": "2147-2159",
"pmc": null,
"pmid": "28564564",
"pubdate": "2017-06-01",
"publication_types": "D017428:Clinical Trial, Phase III; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": null,
"title": "Adjuvant Capecitabine for Breast Cancer after Preoperative Chemotherapy.",
"title_normalized": "adjuvant capecitabine for breast cancer after preoperative chemotherapy"
} | [
{
"companynumb": "JP-ROCHE-1417903",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CAPECITABINE"
},
"drugadditional": "3",
"dru... |
{
"abstract": "Polymyositis is a systemic and idiopathic inflammatory myopathy that, besides muscle manifestation, may occur with respiratory involvement, gastrointestinal tract and rarely renal involvement. In this latter, there are only two cases of IgA nephropathy, but both in dermatomyositis. On the other hand, we reported, for the first time, a case of IgA nephropathy in polymyositis.",
"affiliations": "Serviço de Reumatologia, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.;Serviço de Reumatologia, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.;Serviço de Patologia, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.;Serviço de Reumatologia, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.;Serviço de Reumatologia, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.",
"authors": "Barros|Thiago Bitar Moraes|TB|;de Souza|Fernando Henrique Carlos|FH|;Malheiros|Denise Maria Avancini Costa|DM|;Levy-Neto|Mauricio|M|;Shinjo|Samuel Katsuyuki|SK|",
"chemical_list": null,
"country": "Brazil",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0482-5004",
"issue": "54(3)",
"journal": "Revista brasileira de reumatologia",
"keywords": null,
"medline_ta": "Rev Bras Reumatol",
"mesh_terms": "D000328:Adult; D005922:Glomerulonephritis, IGA; D006801:Humans; D008297:Male; D017285:Polymyositis",
"nlm_unique_id": "0404256",
"other_id": null,
"pages": "231-3",
"pmc": null,
"pmid": "25054601",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "IgA nephropathy and polymyositis: a rare association.",
"title_normalized": "iga nephropathy and polymyositis a rare association"
} | [
{
"companynumb": "BR-ROXANE LABORATORIES, INC.-2015-RO-00433RO",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugaddi... |
{
"abstract": "Hepatitis C virus infection is common among patients on hemodialysis therapy and is an important cause of morbidity and mortality. We investigated the safety and effectiveness of a paritaprevir/ritonavir/ombitasvir/dasabuvir regimen in a group of 10 patients on hemodialysis therapy with genotype 1a, 1b, or 4 hepatitis C virus infection who had predictors of unfavorable response, such as compensated cirrhosis (7 patients) or advanced fibrosis and failure of previous therapy (3 patients). The treatment, with or without ribavirin, was administered daily for 12 or 24 weeks. Clinical and virologic assessment was performed every 4 weeks during the treatment and at posttreatment weeks 4 and 12. All patients achieved a sustained virologic response at posttreatment week 12. 80% of patients reported at least one adverse event: fatigue and anemia of mild intensity were the most common; a single episode of moderate liver decompensation was observed. The paritaprevir/ritonavir/ombitasvir/dasabuvir antiviral regimen is effective and well tolerated in genotype 1 or 4 hepatitis C virus-infected patients on hemodialysis therapy with compensated cirrhosis and/or failure of previous treatments.",
"affiliations": "Internal Medicine, Gastroenterology and Hepatology, Agostino Gemelli Hospital, Rome, Italy. Electronic address: francesca.ponziani@yahoo.it.;Internal Medicine, Gastroenterology and Hepatology, Agostino Gemelli Hospital, Rome, Italy.;Ward of Infectious Diseases Hepatology, IRCCS Lazzaro Spallanzani, Rome, Italy.;Infectious Diseases, S. Andrea Hospital, Rome, Italy.;Infectious Diseases, S. Andrea Hospital, Rome, Italy.;Ward of Infectious Diseases Hepatology, IRCCS Lazzaro Spallanzani, Rome, Italy.;Internal Medicine, Gastroenterology and Hepatology, Agostino Gemelli Hospital, Rome, Italy.;Internal Medicine, Gastroenterology and Hepatology, Agostino Gemelli Hospital, Rome, Italy.",
"authors": "Ponziani|Francesca Romana|FR|;Siciliano|Massimo|M|;Lionetti|Raffaella|R|;Pasquazzi|Caterina|C|;Gianserra|Laura|L|;D'Offizi|Gianpiero|G|;Gasbarrini|Antonio|A|;Pompili|Maurizio|M|",
"chemical_list": "D000813:Anilides; D000998:Antiviral Agents; D002219:Carbamates; D003521:Cyclopropanes; D047029:Lactams, Macrocyclic; D047028:Macrocyclic Compounds; D013449:Sulfonamides; C586094:ombitasvir; D014498:Uracil; D011392:Proline; D015081:2-Naphthylamine; C588260:dasabuvir; D014633:Valine; D019438:Ritonavir; C585405:paritaprevir",
"country": "United States",
"delete": false,
"doi": "10.1053/j.ajkd.2017.01.037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0272-6386",
"issue": "70(2)",
"journal": "American journal of kidney diseases : the official journal of the National Kidney Foundation",
"keywords": "HCV genotype; Hepatitis C virus (HCV); advanced liver fibrosis; adverse event; antiviral regimen; case reports; cirrhosis; dasabuvir; decreased kidney function; direct-acting antivirals; end-stage renal disease (ESRD); hemodialysis; ombitasvir; paritaprevir; ribavirin; ritonavir; sustained virological response",
"medline_ta": "Am J Kidney Dis",
"mesh_terms": "D015081:2-Naphthylamine; D000813:Anilides; D000998:Antiviral Agents; D002219:Carbamates; D003521:Cyclopropanes; D004359:Drug Therapy, Combination; D019698:Hepatitis C, Chronic; D006801:Humans; D007676:Kidney Failure, Chronic; D047029:Lactams, Macrocyclic; D008103:Liver Cirrhosis; D047028:Macrocyclic Compounds; D008297:Male; D008875:Middle Aged; D011392:Proline; D006435:Renal Dialysis; D019438:Ritonavir; D012720:Severity of Illness Index; D013449:Sulfonamides; D016896:Treatment Outcome; D014498:Uracil; D014633:Valine",
"nlm_unique_id": "8110075",
"other_id": null,
"pages": "297-300",
"pmc": null,
"pmid": "28258770",
"pubdate": "2017-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Effectiveness of Paritaprevir/Ritonavir/Ombitasvir/Dasabuvir in Hemodialysis Patients With Hepatitis C Virus Infection and Advanced Liver Fibrosis: Case Reports.",
"title_normalized": "effectiveness of paritaprevir ritonavir ombitasvir dasabuvir in hemodialysis patients with hepatitis c virus infection and advanced liver fibrosis case reports"
} | [
{
"companynumb": "IT-BAUSCH-BL-2017-007534",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RIBAVIRIN"
},
"drugadditional": "3",
... |
{
"abstract": "Background: Information is limited from real-life studies evaluating the efficacy and safety of brodalumab.Research design and methods: In this real-life study, we retrospectively examined a database of 90 patients with moderate-to-severe psoriasis treated with brodalumab (210 mg, s.c.) and followed for 1 year. Disease severity and treatment response were assessed by the Psoriasis Area and Severity Index (PASI) at baseline and after 4, 12, 24, 36, and 48 weeks. Predictors of a PASI response were evaluated by logistic regression.Results: After 48 weeks, 92.2% of patients (mean age 50.2 ± 15 years) treated with brodalumab achieved a PASI score of <3. PASI score decreased from 17.4 ± 10.3 at baseline to 1.7 ± 3.9 and 1.4 ± 3.7 at 12 and 24 weeks, and PASI 75, 90, and 100 response was achieved in 87.3%, 81.8%, and 72.7% of patients, respectively, at 48 weeks.Univariate regression revealed that previous exposure to anti-IL17A treatment was associated with poorer PASI response between 36 and 48 weeks. In difficult-to-treat cases previously having failed with other biologics, brodalumab significantly improved outcome, leading to complete remission.Conclusion: Brodalumab was observed to be effective and safe in patients with moderate-to-severe chronic psoriasis in a real-world setting.",
"affiliations": "Department of Experimental Medicine, University of Rome \"Tor Vergata\", Rome, Italy.;Dipartimento Scienze Mediche E Chirurgiche, Fondazione Policlinico Universitario A. Gemelli IRCCS, Dermatologia, Rome, Italy.;Dipartimento Scienze Mediche E Chirurgiche, Fondazione Policlinico Universitario A. Gemelli IRCCS, Dermatologia, Rome, Italy.;Dermatology Unit, Sapienza University of Rome, Latina, Italy.;Dermatology Unit, Istituto Dermopatico dell'Immacolata IDI-IRCCS, Rome, Italy.;Dermatology Unit, Istituto Dermopatico dell'Immacolata IDI-IRCCS, Rome, Italy.;Dermatology Unit, Fondazione Policlinico Tor Vergata, Rome, Italy.;Dermatology Unit, Fondazione Policlinico Tor Vergata, Rome, Italy.;Dipartimento Scienze Mediche E Chirurgiche, Fondazione Policlinico Universitario A. Gemelli IRCCS, Dermatologia, Rome, Italy.;Dermatology Unit, Sapienza University of Rome, Latina, Italy.;Dermatology Unit, Fondazione Policlinico Tor Vergata, Rome, Italy.;Dipartimento Scienze Mediche E Chirurgiche, Fondazione Policlinico Universitario A. Gemelli IRCCS, Dermatologia, Rome, Italy.",
"authors": "Galluzzo|M|M|0000-0002-3424-5175;Caldarola|G|G|0000-0002-8837-9232;De Simone|C|C|;Bernardini|N|N|;Moretta|G|G|0000-0002-8839-5961;Pallotta|S|S|0000-0003-4827-2892;Botti|E|E|;Campione|E|E|0000-0001-7447-6798;Pirro|F|F|0000-0001-6629-9613;Potenza|C|C|;Bianchi|L|L|0000-0001-8697-6896;Peris|K|K|0000-0002-5237-0463",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/14712598.2021.1941862",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1471-2598",
"issue": "21(9)",
"journal": "Expert opinion on biological therapy",
"keywords": "Anti-il17a; PASIpsoriasis; brodalumab; erythroderma; plaque psoriasis; pustular; real-life",
"medline_ta": "Expert Opin Biol Ther",
"mesh_terms": null,
"nlm_unique_id": "101125414",
"other_id": null,
"pages": "1299-1310",
"pmc": null,
"pmid": "34114515",
"pubdate": "2021-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Use of brodalumab for the treatment of chronic plaque psoriasis: a one-year real-life study in the Lazio region, Italy.",
"title_normalized": "use of brodalumab for the treatment of chronic plaque psoriasis a one year real life study in the lazio region italy"
} | [
{
"companynumb": "IT-MYLANLABS-2022M1016527",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "Cardiovascular diseases (CVDs) are a major issue in aging patients with hemophilia (PWHs). Antithrombotic agents are widely used in the general population for CVD treatment, but this recommendation is not fully applicable to PWHs. To improve treatment strategies, a prospective case-control study (COCHE) that analyzed CVD management and follow-up (2 years/patient) in PWHs was performed in France from 2011 to 2018. In total, 68 PWHs (median age: 65 years [39-89]; 48 mild, 10 moderate, and 10 severe hemophilia) were included (n = 50 with acute coronary syndrome, n = 17 with atrial fibrillation, n = 1 with both). They were matched with 68 control PWHs without antithrombotic treatment. In our series, bleeding was significantly influenced by (1) hemophilia severity, with a mean annualized bleeding ratio significantly higher in COCHE patients than in controls with basal clotting factor level up to 20%, (2) antihemorrhagic regimen (on-demand vs. prophylaxis) in severe (hazard ratio [HR] = 16.69 [95% confidence interval, CI: 8.2-47.26]; p < 0.0001) and moderate hemophilia (HR = 42.43 [95% CI: 1.86-966.1]; p = 0.0028), (3) type of antithrombotic treatment in mild hemophilia, with a significantly higher risk of bleeding in COCHE patients than in controls for dual-pathway therapy (HR = 15.64 [95% CI: 1.57-115.8]; p = 0.019), anticoagulant drugs alone (HR = 9.91 [95% CI: 1.34-73.47]; p = 0.0248), dual antiplatelet therapy (HR = 5.31 [95% CI: 1.23-22.92]; p = 0.0252), and single antiplatelet therapy (HR = 3.76 [95% CI: 1.13-12.55]; p = 0.0313); and (4) HAS-BLED score ≥3 (odds ratio [OR] = 33 [95% CI: 1.43-761.2]; p = 0.0065). Gastrointestinal bleeding was also significantly higher in COCHE patients than in controls (OR = 15 [95% CI: 1.84-268]; p = 0.0141). The COCHE study confirmed that antithrombotic treatments in PWHs are associated with increased bleeding rates in function of hemophilia-specific factors and also of known factors in the general population.",
"affiliations": "Centre Régional de Traitement des Maladies Hémorragiques, CHU de Rennes, et Université de Rennes 1, France.;Service de Cardiologie CHU de Nîmes, Université de Montpellier, Nimes, France.;Centre Régional de Traitement des Hémophiles, CHU de Clermont-Ferrand, France.;Centre Régional de Traitement des Hémophiles, CHU de Lille, France.;Centre Régional de Traitement des Hémophiles, CHU de Lille, France.;Centre Régional de Traitement des Hémophiles, CHU La Timone, Marseille, France.;Centre Régional de Traitement des Hémophiles, CHU de Bordeaux, France.;Centre Régional de Traitement des Hémophiles, CHU de Caen, France.;Centre Régional de Traitement des Hémophiles, CHU de Toulouse, France.;Centre Régional de Traitement des Hémophiles, Hôpital Saint-Eloi, CHRU de Montpellier, Montpellier, France.",
"authors": "Guillet|Benoît|B|;Cayla|Guillaume|G|;Lebreton|Aurélien|A|0000-0002-1650-0427;Trillot|Nathalie|N|;Wibaut|Bénédicte|B|;Falaise|Céline|C|;Castet|Sabine|S|;Gautier|Philippe|P|;Claeyssens|Ségolène|S|;Schved|Jean-François|JF|",
"chemical_list": "D000925:Anticoagulants; D005167:Factor VII",
"country": "Germany",
"delete": false,
"doi": "10.1055/s-0040-1718410",
"fulltext": "\n==== Front\nThromb Haemost\nThromb Haemost\n10.1055/s-00035024\nThrombosis and Haemostasis\n0340-6245 2567-689X Georg Thieme Verlag KG Rüdigerstraße 14, 70469 Stuttgart, Germany \n\n33099283\n10.1055/s-0040-1718410\n190349\nCoagulation and Fibrinolysis\nLong-Term Antithrombotic Treatments Prescribed for Cardiovascular Diseases in Patients with Hemophilia: Results from the French Registry\nGuillet Benoît 12* Cayla Guillaume 3* http://orcid.org/0000-0002-1650-0427Lebreton Aurélien 4 Trillot Nathalie 5 Wibaut Bénédicte 5 Falaise Céline 6 Castet Sabine 7 Gautier Philippe 8 Claeyssens Ségolène 9 Schved Jean-François 10 1 Centre Régional de Traitement des Maladies Hémorragiques, CHU de Rennes, et Université de Rennes 1, France\n2 CHU Rennes, Inserm, EHESP, Irset (Institut de recherche en santé, environnement et travail), Univ Rennes, UMR_S 1085, Rennes, France\n3 Service de Cardiologie CHU de Nîmes, Université de Montpellier, Nimes, France\n4 Centre Régional de Traitement des Hémophiles, CHU de Clermont-Ferrand, France\n5 Centre Régional de Traitement des Hémophiles, CHU de Lille, France\n6 Centre Régional de Traitement des Hémophiles, CHU La Timone, Marseille, France\n7 Centre Régional de Traitement des Hémophiles, CHU de Bordeaux, France\n8 Centre Régional de Traitement des Hémophiles, CHU de Caen, France\n9 Centre Régional de Traitement des Hémophiles, CHU de Toulouse, France\n10 Centre Régional de Traitement des Hémophiles, Hôpital Saint-Eloi, CHRU de Montpellier, Montpellier, France\nAddress for correspondence Jean-François Schved Laboratoire Central D'hématologie, CHRU de Montpellier – Hôpital Saint-Eloi80 Avenue Augustin Fliche, F-34295 MontpellierFrancejf@schved.fr\n3 2021 \n24 10 2020 \n121 3 287 296\n10 6 2019 28 8 2020 \nThe Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial-License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. (\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/\n).\n2020The Author(s).This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License, which permits unrestricted reproduction and distribution, for non-commercial purposes only; and use and reproduction, but not distribution, of adapted material for non-commercial purposes only, provided the original work is properly cited.\nCardiovascular diseases (CVDs) are a major issue in aging patients with hemophilia (PWHs). Antithrombotic agents are widely used in the general population for CVD treatment, but this recommendation is not fully applicable to PWHs. To improve treatment strategies, a prospective case–control study (COCHE) that analyzed CVD management and follow-up (2 years/patient) in PWHs was performed in France from 2011 to 2018. In total, 68 PWHs (median age: 65 years [39–89]; 48 mild, 10 moderate, and 10 severe hemophilia) were included (\nn\n = 50 with acute coronary syndrome,\nn\n = 17 with atrial fibrillation,\nn\n = 1 with both). They were matched with 68 control PWHs without antithrombotic treatment. In our series, bleeding was significantly influenced by (1) hemophilia severity, with a mean annualized bleeding ratio significantly higher in COCHE patients than in controls with basal clotting factor level up to 20%, (2) antihemorrhagic regimen (on-demand vs. prophylaxis) in severe (hazard ratio [HR] = 16.69 [95% confidence interval, CI: 8.2–47.26];\np <\n 0.0001) and moderate hemophilia (HR = 42.43 [95% CI: 1.86–966.1];\np\n = 0\n.\n0028), (3) type of antithrombotic treatment in mild hemophilia, with a significantly higher risk of bleeding in COCHE patients than in controls for dual-pathway therapy (HR = 15.64 [95% CI: 1.57–115.8];\np\n = 0\n.\n019), anticoagulant drugs alone (HR = 9.91 [95% CI: 1.34–73.47];\np\n = 0\n.\n0248), dual antiplatelet therapy (HR = 5.31 [95% CI: 1.23–22.92];\np\n = 0\n.\n0252), and single antiplatelet therapy (HR = 3.76 [95% CI: 1.13–12.55];\np\n = 0\n.\n0313); and (4) HAS-BLED score ≥3 (odds ratio [OR] = 33 [95% CI: 1.43–761.2];\np\n = 0\n.\n0065). Gastrointestinal bleeding was also significantly higher in COCHE patients than in controls (OR = 15 [95% CI: 1.84–268];\np\n = 0\n.\n0141). The COCHE study confirmed that antithrombotic treatments in PWHs are associated with increased bleeding rates in function of hemophilia-specific factors and also of known factors in the general population.\n\n\nKeywords\nantithrombotic treatmentatrial fibrillationcardiovascular diseasehemophiliableeding riskCSL Behring, FranceFunding\nThe publication was sponsored by CSL Behring, France.\n==== Body\nIntroduction\n\nHemophilia management has significantly improved in the last decades. Since the emergence of clotting factor concentrates in the 1970s,\n1\nthe life expectancy of patients with hemophilia (PWHs) has dramatically increased from less than 30 to over 60 years in high-income countries.\n2\n3\n4\n5\n6\n7\n8\nConsequently, aging PWHs are increasingly confronted with age-related conditions, such as cardiovascular diseases (CVDs), primarily acute coronary syndrome (ACS) and atrial fibrillation (AF).\n\n\n\nAntithrombotic treatments, mainly antiplatelet agents, play a central role in secondary CVD prevention. It is now well established that dual antiplatelet therapy (DAPT) with aspirin and P2Y12 inhibitors, such as clopidogrel, is required after drug-eluting stent (DES) implantation.\n9\nThere are also well-defined guidelines for AF management in function of the patient's CHA\n2\nD\n2\n-VASc score. This includes the long-term use of anticoagulant drugs, mainly vitamin K antagonists (VKAs) or direct oral anticoagulants (DOAs).\n10\nIn the case of high ischemic/thrombogenic risk, anticoagulant and antiplatelet drugs can be combined.\n11\nAlthough these drug combinations are expected to increase the bleeding risk in PWHs, this effect has not yet been demonstrated by studies with high levels of evidence. Evidence-based guidelines for the optimal management of acute CVD in PWHs or for secondary prevention are limited, as well as the published recommendations on how to handle the higher bleeding risk associated with invasive procedures that require hemostasis-interfering drugs.\n12\n13\n14\n15\n\n\nAs properly controlled randomized trials are not feasible in PWHs, we set up a case–control study in France to prospectively collect data on the management of coronary artery disease (CAD)/ACS or AF in PWHs, and on the consequences, particularly of antithrombotic treatments, during the 2-year follow-up.\n\nMethods\n\nThe COCHE study is a French prospective, noninterventional, multicenter case–control registry. The study was started in July 2011 and data were collected until December 2017. The COCHE group (i.e., the cases) included PWHs A or B who started an antithrombotic treatment for ACS/CAD or for nonvalvular AF, according to the recommendations for CVD management in the general population. For each included patient, a specially designed case report form was filled at inclusion, and then all treatment changes, new cardiovascular events, and bleeding events were recorded in a follow-up form at month 1 after inclusion, and every 6 months for 2 years. The collected data included demographic features and disease characteristics, cardiovascular risk factors and antecedents, ACS/CAD or AF treatment modalities, major and minor bleeding events, and factor replacement therapy before, during, and after any cardiovascular event. According to the International Society on Thrombosis and Haemostasis recommendations, major bleeds were defined as events that required pro-hemostatic substitutive treatment, hospitalization, transfusion, or surgical/radiological interventions.\n16\n17\n\n\nThe control group included PWHs followed at the Hemophilia Treatment Centre (HTC) of Rennes, France. Each control patient was matched with one patient of the COCHE group on the basis of age (±5 years), hemophilia type and severity (±5 and ± 2% of clotting factor level for mild and moderate forms, respectively), antifactor inhibitor status, and type (on-demand or prophylaxis) of clotting factor replacement therapy (only for patients with severe hemophilia). Data for the control group were retrospectively collected from February 2016 to January 2018, for the same number of months as for the matched case. These data were extracted from the HTC medical file, HTC comprehensive daily board of hospitalization, and each patient's hemophilia diary. This allowed collecting precise information on each clotting factor infusion, hospitalization, and emergency surgery in the control group.\n\nThe mean annualized bleeding rates (ABRs) and annualized cardiovascular event rates (ACvR) during the study follow-up were calculated for both groups. For each patient, the sum of all events was divided by the exact number of months (then transformed in years) of follow-up. The mean ABR and ACvR were compared between groups and also within the COCHE group in function of the used antithrombotic treatment, antihemorrhagic regimen (prophylaxis/on-demand), hemophilia severity, clotting factor levels, and HAS-BLED score for patients with AF. Number and causes of death were recorded.\n\nThis study did not affect the normal patient management and did not lead to specific treatments or investigations. The physicians' prescribing freedom was entirely maintained. Prior to inclusion, each patient was informed about the registry procedures and provided a written consent. For the study, only anonymized data were used. This study followed the Declaration of Helsinki and local legislation. In accordance with the European and French regulations, this study was approved by the Comité consultatif sur le traitement de l'information en matière de recherche and the Commission nationale informatique et libertés on April 7, 2011 and February 1, 2012, respectively. The registry was supervised by a scientific committee that included both hematologists and cardiologists.\n\n\nAll statistical analyses were performed with the GraphPad Prism software (version 7.00 for Windows, GraphPad Software, La Jolla, California, United States). Categorical variables were expressed as percentages, and continuous variables as means (with lower/upper 95% confidence intervals, CIs) or medians (with minimum and maximum values). The frequency and distribution of bleeding and cardiovascular events were computed with their 95% CI. The Fischer's exact\nt\n-test was used for qualitative variables, as appropriate, and odds ratios (ORs) were determined. Hazard ratios (HRs) were used to determine the risk of bleeding from different antithrombotic treatments over time. Significance was set at\np\n < 0.05 with 95% CI. Survival curves were drawn and analyzed using the Mantel–Cox log-rank test that computes also the chi square and HR values, including the 95% CI.\n\n\nResults\nCharacteristics of the Study Population\n\nBetween July 2011 and December 2017, 68 patients from 26 French HTCs were included in the COCHE registry (see study flowchart in\nFig. 1\nand\nTable 1\n). A total of 1,248 months of follow-up data were collected for both COCHE and control groups, corresponding to a median of 18 months (1–24) per patient. The patients' characteristics are described in\nTable 1\n. The reason for inclusion in the COCHE registry was ACS/CAD in 50 (73.5%) patients, AF in 17 (25%) patients, and both in one patient (simultaneous diagnosis at inclusion). Among the 50 patients with ACS/CAD, 22 had ACS (44%) (ST-elevation myocardial infarction\nn\n = 3; non-ST-elevation myocardial infarction\nn\n = 16; unstable angina\nn\n = 3), and 28 (56%) had CAD (stable angina or silent myocardial ischemia). The patient with both AF and ACS/CAD had silent myocardial ischemia without stent implantation. He had mild hemophilia (basal FVIII level: 20%). For the 18 patients with AF, the median CHA\n2\nD\n2\n-VASc score was 3 (1–7), and two patients had a score = 1. Their median HAS-BLED score was 2 (0–4). Factor VIII/IX (FVIII/FIX) replacement therapies included only standard concentrates for all patients, but for one who received recombinant activated factor VII due to presence of an anti-FVIII inhibitor. Neither extended half-life (EHL) clotting factor concentrates nor emicizumab was used because they were not available in France during this study.\n\n\nFig. 1 \nDescription of patients and controls included in the COCHE study. (\nA\n) COCHE study flow chart. (\nB\n) Changes in antithrombotic treatments during the 2-year follow-up. AC, anticoagulant drug alone; ASA, aspirin; CABG, coronary artery bypass grafting; Clopi, clopidogrel; DAPT, dual antiplatelet therapy; DAPT + one anticoagulant drug; DES, drug-eluting stent; DOA, direct oral anticoagulant; DPT, dual pathway therapy (antiplatelet + anticoagulant); HA, hemophilia A; HB, hemophilia B; mod, moderate; PCI, percutaneous coronary intervention; SAPT, single antiplatelet therapy; sev, severe; TT, triple therapy; VKA, vitamin K antagonist.\n\n\nTable 1 Characteristics of patients included in the COCHE study\n\tCOCHE group\tControl group\t\nTotal\tCAD\tAF\tCAD + AF\t\n\nN\npatients\n\t68\t50\t17\t1\t68\t\nMedian age, y [min–max]\t65 [39–85]\t64 [39–85]\t66 [51–75]\t68\t63 [42–87]\t\nHemophilia type\n\nn\npatients\n\tA\t60\t43\t16\t1\t60\t\nB\t8\t7\t1\t0\t8\t\nHemophilia severity\n\nn\npatients\n\tMild\nMedian factor level [min–max]\t48\n17% [5–36]\t32\n20.5% [5–36]\t15\n16% [6–35]\t1\n20%\t48\n18% [6–37]\t\nModerate\nMedian factor level [min–max]\t10\n3% [1–5]\t9\n3% [2–5]\t1\n(1%)\t0\t10\n3.5% (2–5)\t\nSevere\t10\n\n1 inhibitor +\n\t9\n\n1 inhibitor +\n\t1\t0\t10\t\nProphylaxis?\n\nn\npatients\n\tYES\t\nTotal\t18 (26.5%)\t16 (32%)\t2 (11.8%)\t0\t6 (8.8%)\t\nMild\t8 (16.7%)\t8 (17.3%)\t0\t\t0\t\nMod/sev\t10 (50%)\t8 (44.4%)\t2 (100%)\t\t6 (30%)\t\nNO\t\nTotal\t50 (73.5%)\t34 (68%)\t15 (88.2%)\t1 (100%)\t62 (91.2%)\t\nMild\t40 (83.3%)\t24 (32%)\t\t\t\t\nMod/sev\t10 (50%)\t10 (55.6%)\t15 (100%)\n0\t1 (100%)\n0\t48 (100%)\n14 (70%)\t\nAbbreviations: AF, atrial fibrillation; CAD, coronary artery disease; mod/sev, moderate and severe hemophilia.\n\nAntithrombotic Treatments and Antihemorrhagic Prophylaxis\n\nIn the COCHE group, antithrombotic treatments were started at diagnosis of ACS/CAD or AF (= inclusion) during hospitalization or consultation (\nFig. 1\n). Two patients stopped the early antithrombotic treatment during the month after inclusion because they had a CHA\n2\nD\n2\n-VASc score of 1 (one patient with AF and severe hemophilia) or because silent myocardial ischemia was detected by coronarography (one patient with CAD and mild hemophilia). The initial antithrombotic treatments comprised single antiplatelet therapy (SAPT,\nn\n = 37), DAPT (\nn\n = 18), anticoagulant treatment alone (AC,\nn\n = 10), dual pathway therapy (DPT) with one antiplatelet and one anticoagulant drug (\nn\n = 2), and triple therapy (TT) in which DPT was associated with another antiplatelet drug (\nn\n = 1) (see\nTable 1\nand\nSupplementary Table S1\n(available in the online version) for the characteristics of the patients with initial DPT and TT). Among the 18 patients with AF, 5 (\nn\n = 3 with mild hemophilia A, FVIII: 13–36%;\nn\n = 1 with mild hemophilia B, FIX: 28%; and\nn\n = 1 with moderate hemophilia A, FVIII: 1%) received SAPT (aspirin), as previously recommended for PWHs. During the follow-up, in 23 patients (\nn\n = 9 with moderate/severe and\nn\n = 14 with mild hemophilia) the initial antithrombotic treatment was changed to another antithrombotic treatment (\nn\n = 13) or completely stopped (\nn\n = 10) (\nTable 1\n).\n\n\n\nAntihemorrhagic prophylaxis (2–3 infusions per week for FVIII concentrates, or 1–2 infusions per week for FIX concentrates) was performed in 18 patients (\nFig. 1\nand\nTable 1\n). The cumulative duration of prophylaxis was 204 months: 108 months (mean: 11.1 months per patient) in patients with severe, 30 months (mean: 10 months per patient) in patients with moderate, and 66 months (mean: 5.5 months per patient) in patients with mild hemophilia. In patients with severe/moderate hemophilia, prophylaxis (\nn\n = 10) was started after the introduction of the antithrombotic treatment, or was already in place before the CVD diagnosis. Conversely, in patients with mild hemophilia, prophylaxis (\nn\n = 8) was mainly initiated after the occurrence of a bleeding event (\nn\n = 6/8; 75%). The other two patients continued the antihemorrhagic treatment initiated for the cardiovascular procedures during hospitalization. In controls, prophylaxis was only performed in patients with severe hemophilia (6/10, 60%).\n\n\nMajor Bleeding Complications during the Follow-Up\n\nThroughout the follow-up, 100 and 33 bleeding events occurred in the 68 COCHE patients and in the 68 controls, respectively. The number of patients who had at least one major bleeding event was higher in the COCHE group (29/68; 42.6%) than in the control group (14/68; 20.6%). Accordingly, the major bleeding-free survival curves were significantly different between the COCHE and control groups (\nFig. 2A\n), and between patients with mild hemophilia from these two groups (\nFig. 2B\n). Bleeding events were more frequent in patients receiving antiplatelet therapy (AT) than in controls regardless of the severity of hemophilia and the antithrombotic drug used, as described in\nTable 2\n. The types of major bleeding events in the COCHE group were hemarthrosis (\nn\n = 52; 52%) in 9 patients, hematoma (\nn\n = 30; 30%) in 16 patients, gastrointestinal bleeding (GIB;\nn\n = 10; 10%) in 8 patients, and others (\nn\n = 8) in 5 patients. In the control group, the 33 bleeding events were hemarthrosis (\nn\n = 23; 69.7%) in 10 patients, hematoma (\nn\n = 9; 27.3%) in 8 patients, and epistaxis (\nn\n = 1). GIB episodes were significantly more frequent in the COCHE group than in controls (8/68 patients vs. 0/68 patients; OR = 15.00 [95% CI: 1.84–268];\np\n = 0\n.\n0141). GIB always occurred during an antithrombotic treatment that included an antiplatelet drug: SAPT (\nn\n = 5 patients), TT (\nn\n = 1 patient), and DAPT (\nn\n = 1 patient). None of the patients with GIB received proton-pump inhibitors (PPIs).\n\n\nFig. 2 \nMajor bleeding-free survival curves for the COCHE and control groups. (\nA\n) In all patients. (\nB\n) In function of hemophilia severity.\n\n\nTable 2 Influence of antithrombotic treatments on the risk of major bleeding events in patients with hemophilia in the COCHE and control groups\n\tMean ABR (95% CI)\tHR for bleeding (95% CI)\t\np\n\tCumulative number of analyzed months\t\nn\nPatients\n\t\nIn all patients, whatever the hemophilia severity\t\nControl group\t0.317 (0.226–0.408)\t1\t\t1,248\t68\t\nCOCHE total\t0.961 (0.924–0.999)\t2.64 (1.78–3.92)\t<0.0001\t1,248\t68\t\nWith AT\t1.033 (0.996–1.07)\t2.73 (1.82–4.11)\t<0.0001\t1,104\t68\t\n\nWithout AT\na\n\t0.417 (0.089–0.744)\t1.78 (0.40–7.87)\t0.448\t144\t10\t\nIn patients with moderate/severe hemophilia\t\nControl group\t0.86 (0.77–0.94)\t1\t\t426\t20\t\nCOCHE total\t2.22 (2.10–2.31)\t1.96 (1.21–3.18)\t0.0061\t426\t20\t\nWith AT\t2.36 (2.17–2.53)\t2.04 (1.23–3.39)\t0.0058\t372\t20\t\n-SAPT\t2.76 (2.64–2.88)\t2.05 (1.16–3.62)\t0.0132\t306\t18\t\n-DAPT\t4.81 (2.42–13.63)\t5.58 (1.49–20.96)\t0.0109\t60\t7\t\nWithout AT\t0.889 (0.63–1.15)\t1.52 (0.25–9.12)\t0.6475\t54\t4\t\nIn patients with mild hemophilia\t\nControl group\t0.044 (0–0.09)\t1\t\t822\t48\t\nCOCHE total\t0.336 (0.273–0.432)\t4.93 (2.21–11)\t<0.0001\t822\t48\t\n\nWith AT\nb\n\t0.361 (0.293–0.463)\t4.97 (2.16–11.43)\t0.0002\t732\t48\t\n-SAPT\t0.232 (0.177–0.286)\t3.76 (1.13–12.55)\t0.0313\t472\t34\t\n\n-DAPT\nc\n\t0.517 (0.324–0.711)\t5.31 (1.23–22.92)\t0.0252\t116\t12\t\n-AC\t0.353 (0.01–0.606)\t9.91 (1.34–73.47)\t0.0248\t102\t10\t\n\n-DPT\nd\n\t1.143 (0.793–1.492)\t15.64 (1.57–115.80)\t0.019\t42\t2\t\nWithout AT\t0.133 (0–0.328)\t2.39 (0.15–37.24)\t0.3173\t90\t6\t\nAbbreviations: ABR, annualized bleeding rate; AC, anticoagulant drug alone; AT, antithrombotic treatment; DAPT, dual antiplatelet therapy; DPT, dual pathway therapy; HR, hazard ratio; SAPT, single antiplatelet therapy.\n\na All 68 patients enrolled in the study started antithrombotic treatment, but 10 discontinued it during the follow-up period.\n\nb In this group, only 1 patient received a tritherapy (DAPT + AC) during 6 months, therefore no statistical analysis was performed for this treatment.\n\nc \nThe occurrence of bleeding in patients receiving DAPT was significantly higher than in patients with SAPT (HR: 13.12; 95% CI: 2.99–57.48;\np\n = 0.0006).\n\n\nd \nThe occurrence of bleeding in patients receiving DPT was significantly higher than in patients with other antithrombotic treatments (HR: 8.63; 95% CI: 1.41–52.81;\np\n = 0.0198).\n\n\n\nIn patients with moderate/severe hemophilia receiving an AT (SAPT or DAPT), the risk of bleeding was significantly higher than in controls (\nTable 2\n). Furthermore, for severe hemophilia, COCHE patients without prophylaxis had a mean ABR significantly higher than COCHE patients with prophylaxis (6.875 [95% CI: 6.58–7.17] vs. 1.231 [95% CI: 0.966–1.496]; OR = 16.69 [8.20–47.26];\np <\n 0.0001). However, in COCHE patients with prophylaxis, the mean ABR remained threefold higher than in controls with prophylaxis (1.231 vs. 0.4 [95% CI: 0.031–0.769]; OR = 3.73 [1.11–12.56];\np\n = 0.0374). The beneficial effect of prophylaxis was also observed in COCHE patients with moderate hemophilia. Indeed, the mean ABR was 0.813 (95% CI: 0.6–1.03) and 0 in patients without and with prophylaxis, respectively (OR = 42.43 [1.86–966.1];\np\n = 0\n.\n0028).\n\n\n\nIn patients with mild hemophilia, more patients reported major bleeding events in the COCHE than in the control group: 17/48 patients (35.4%) and 2/48 patients (4.2%) (OR = 12.61 [95% CI: 2.72–58.52],\np\n = 0\n.\n0002). The risk of major bleeding events remained high whatever the AT (\nTable 2\n). Moreover, within the COCHE cohort, the risk of bleeding was significantly higher for patients taking DAPT than for patients taking SAPT (HR: 13.12; 95% CI: 2.99–57.48,\np =\n 0.0006), and for patients taking DPT than for all other patients taking AT (HR: 8.63; 95% CI: 1.41–52.81;\np =\n 0.0198) (\nSupplementary Table S2\n, available in the online version). Moreover, the mean ABR was slightly, but not significantly, higher (1.5-fold) in patients treated with AC than in those treated with SAPT. In the SAPT subgroup, the mean ABR values were comparable in patients taking aspirin and clopidogrel (0.273 and 0.2; see\nSupplementary Table S3\n, available in the online version). In the AC group, the mean ABR of patients taking VKA and DOA could not be compared, due to their limited number (\nn\n = 10). In the groups of patients with mild hemophilia and clotting factor levels from 6 to 20%, the percentages of patients with bleeding episodes (\nFig. 3A\n) and the mean ABR values (\nFig. 3B\n) were significantly higher in COCHE patients with AT but without prophylaxis than in their cross-matched controls. For basal FVIII/FIX levels >20%, no difference was observed between patients receiving an AT and controls.\n\n\nFig. 3 \nMajor bleeding events in function of hemophilia severity and basal clotting factor level. (\nA\n) Percentage of patients who reported at least one major bleeding episode during the 2-year follow-up period. (\nB\n) Mean annualized bleeding rate. CF: basal clotting factor; ABR: annualized bleeding rate.\n\n\n\nDespite the small number of patients with AF (\nn\n = 18), the number of patients who reported bleeding episodes was significantly higher in patients with HAS-BLED score ≥3 than in those with HAS BLED score <3 (5/8 patients vs. 0/10, respectively; OR = 33 [95% CI: 1.43–761.2];\np\n = 0\n.\n0065). The median clotting factor level of patients with HAS-BLED scores ≥3 and <3 was similar (16.5% [1–36] vs. 19.5% [0–34];\np >\n 0.05) as well as the proportion of patients on prophylaxis (2/8 [25%] vs. 3/10 [30%];\np >\n 0.05).\n\n\nCardiovascular Complications\n\nDuring the follow-up, a total of 13 cardiovascular events occurred in 11/68 COCHE patients (16.2%) versus only 1 in 1/68 controls (1.5%). This corresponded in COCHE patients to a mean ACvR of 0.125 (95% CI: 0.06–0.19). Cardiovascular event-free survival curves for the COCHE and control groups were significantly different (\nFig. 4\n). These cardiovascular events were ACS, recurrent or at another site (\nn\n = 8), and mesenteric ischemia (\nn\n = 1) in the ACS subgroup; stroke (\nn\n = 1) in the AF subgroup; aortic valve disease aggravation (\nn\n = 1); and cardiac decompensation (\nn\n = 2) soon after inclusion in the patients with ACS and AF. Valve disease aggravation and cardiac decompensation led to death during the first month after inclusion. The mean ACvR was similar in patients with severe (0.121), moderate (0.054), and mild hemophilia (0.143) (\np\n > 0.05). Prophylaxis with clotting factors did not influence the cardiovascular event occurrence. Indeed, the mean ACvR of COCHE patients was similar during periods of prophylaxis and of on-demand treatment: 0.154 (95% CI: 0–0.381) versus 0.125 (95% CI: 0–0.421) (\np\n = 1) for patients with severe hemophilia, and 0 versus 0.063 (95% CI: 0–0.196) (\np\n > 0.05) for individuals with moderate hemophilia.\n\n\nFig. 4 \nCardiovascular event-free survival curves for the COCHE and control groups.\n\n\nDiscussion\n\nThe COCHE study is the first case–control study to evaluate antithrombotic treatments for CVD management in PWHs. This is also the largest prospective series with a follow-up period of 2 years after treatment initiation. Indeed, up to now, the recommendations and expert opinions were based on small series of PWHs, case reports, and authors' experience.\n13\n14\n15\n18\n19\n20\nHowever, due to their increasing life expectancy, age-related diseases become more frequent in PWHs, including CVDs that require the administration of antithrombotic treatments, like in the general population.\n21\n22\n23\n24\nRecommendations for CVD management in the general population are reviewed annually by the world's leading scientific societies of cardiology, based on new high-level methodological studies.\n25\n26\n27\n28\nThey now take into account the patient's hemorrhagic profile, whatever the cause, and constitute a major support to guide antithrombotic treatment in PWHs. Therefore, studies in this population are needed to verify or test whether these general recommendations are adapted to their specific condition. Due to the rarity of such situations in a rare hereditary disease, several results need to be confirmed. However some data could help to improve the management of these patients.\n\n\n\nThe COCHE study confirmed that antithrombotic treatments significantly increase the risk of bleeding in PWHs, regardless of hemophilia severity (\nSupplementary Table S4\n, available in the online version). Without antithrombotic treatment, the risk of bleeding is correlated with hemophilia severity.\n29\nThis correlation is also observed with antithrombotic treatments. Indeed, the mean ABR progressively increased with hemophilia severity in both control and COCHE patients; however, the difference between groups was significant only up to a basal FVIII/FIX level of 20%. Above this level, the mean ABR tended to be higher in the COCHE group, but bleeding seemed mostly caused by trauma or invasive procedures. Therefore, in patients with mild hemophilia and FVIII/FIX level >20%, earlier substitution therapy after the trauma or a more systematic prophylaxis before invasive procedures (compared with the standard management of patients with mild hemophilia) could effectively prevent bleeding events. As expected, the mean ABR of COCHE patients with severe/moderate hemophilia without prophylaxis was approximately threefold higher than in controls. This result highlights the importance of prophylaxis in these patients as soon as an AT is prescribed and for the entire treatment duration.\n\n\n\nIn the subgroup of COCHE patients with AF, HAS-BLED scores ≥3 were associated with increased bleeding risk. The HAS-BLED score is an important tool to determine the basal hemorrhagic risk before and during antithrombotic treatment in the general population.\n26\nIn the “Birmingham 3-step therapeutic strategy,” this score is the second step to assess the risk of bleeding and to adapt antithrombotic treatment in patients with AF. Here, we found that the HAS-BLED score is suitable also for PWHs and therefore, the “Birmingham 3-step strategy” could be relevant also for this population.\n\n\n\nOver the past years, many studies demonstrated the direct influence of the antithrombotic treatment type on the bleeding risk in the general population.\n11\nThe COCHE study found a similar influence in PWHs. Specifically, DPT was significantly associated with two- to fourfold higher bleeding risk than the other antithrombotic treatments under study. DAPT also increased the risk of bleeding by about twice compared with SAPT. These results are in line with the recommendations for antithrombotic treatments in PWHs that insist on minimizing the prescription of two or more antithrombotic drugs, such as DPT and DAPT, when possible.\n13\nTherefore, DPT is recommended for patients with nonvalvular AF associated with ACS, for a minimum period of 1 to 3 months, depending on the type of stent implanted (bare metal stent or DES, respectively).\n11\n28\nThe stent choice is of primary importance in PWHs. Stents that require the shortest DPT duration should be favored.\n13\nTo reduce the bleeding risk, SAPT might be preferable to DAPT, but in the general population they are associated with higher stroke risk (1.6 times).\n11\nThe data collected in our study do not allow concluding on this point. For PWHs with nonvalvular AF, only ACs are recommended when the CHA\n2\nD\n2\n-VASc score is ≥2, like in the general population.\n25\n26\nVKAs are now replaced, with few exceptions, by DOAs that are associated with a twofold lower risk of fatal bleeding.\n30\nIn COCHE patients with mild hemophilia, the bleeding risk was approximately eightfold higher in patients taking AC than in controls. Although only VKA treatment was associated with major bleeding, the COCHE study did not include enough patients treated with AC to conclude on the difference between DOA and VKA in PWHs. For patients with AF and a CHA\n2\nD\n2\n-VASc score = 1, the Canadian Cardiovascular Society (CCS) allows the use of SAPT, but only when the HAS-BLED score is high in <65-year-old patients, due to the low levels of evidence.\n26\nThe recommendations published for all PWHs often prioritize SAPT in AF with CHA\n2\nD\n2\n-VASc score = 1, but do not take into account age and hemorrhagic score.\n13\n14\n15\n18\n19\n20\nIn the COCHE study, the small difference in the mean ABR between patients treated with AC and SAPT (∼1.5 times) suggests that both could be used in PWHs with CHA\n2\nD\n2\n-VASc = 1. However, when the HAS-BLED score is ≥3 or for patients with severe hemophilia without prophylaxis, SAPT should be preferred (as recommended by CCS).\n\n\n\nThe COCHE study confirmed that regular prophylaxis effectively protects patients with severe or moderate hemophilia from major bleeding. However, among patients with severe hemophilia receiving prophylaxis, the mean ABR was still threefold higher than among their cross-matched controls also on prophylaxis (1.231 vs. 0.4). PWHs on prophylaxis with standard FVIII concentrates, two to three times per week, have usually a FVIII trough level of 1 to 2%.\n31\nThe same FIX trough level is obtained with standard FIX concentrates administered once or twice per week. These trough levels are certainly insufficient to effectively protect against bleeding events during antithrombotic treatments, and should be increased at least above 5% or even 10%, depending on the antithrombotic treatment type. This suggestion is supported by the mean ABR values between 0.3 and 0.5 observed in our study for mild hemophilia with FVIII/FIX levels of 6 to 10% and 11 to 20%. FVIII/FIX EHL concentrates could help to achieve these trough target levels without increasing the number of infusions.\n31\n32\n33\nIn the recent guidelines for antithrombotic treatments in PWHs, the minimum FVIII/FIX trough levels for SAPT range from 1 to 5%.\n13\n14\n15\nFor AC (and DAPT), the recommended FVIII/FIX trough level is ≥30%. It seems difficult to maintain this target in the long term, even with EHL concentrates, because it would require daily injections (for FVIII) or every 2 days (for FIX). In our study, the major bleeding frequency was comparable in COCHE patients with basal FVIII/FIX levels ≥20% and in controls. This threshold could be a more realistic target. In any case, antithrombotic treatment in PWHs should always be combined with a specific education program to alert the patients about the increased risk of bleeding even after a minor trauma. Multidisciplinary management is also required, including information to the cardiologist and family physician.\n\n\n\nIn our study, gastrointestinal hemorrhages were significantly more frequent in patients taking antithrombotic treatments, namely antiplatelet drugs associated or not with AC, as observed in the general population.\n34\nIn PWHs, gastric protection with PPIs seems necessary as soon as the antiplatelet drugs are started.\n35\n36\nFinally, the COCHE study showed that in PWHs with ischemic or thrombogenic CVD, the risk of a new cardiovascular event was at least sixfold higher than in PWHs without CVD history. Conversely, this risk of cardiovascular recurrence was independent of hemophilia severity and of prophylaxis. Therefore, antithrombotic treatment is indicated in these PWHs and should be implemented according to cardiologic recommendations adapted to hemophilia.\n\n\nGiven the small number of patients enrolled, we acknowledge that our results should be replicated in new studies. Furthermore, although it was a case–control study with prospective inclusion of patients, the comparison with controls who were enrolled retrospectively could potentially generate a bias.\n\n\nWhat is known about this topic?\n\n\nAge-related cardiovascular diseases (CVDs) are increasing in patients with hemophilia (PWHs) due to their longer life expectancy.\n\nEvidence-based guidelines and medical experience on CVD optimal management in PWHs are limited, especially for antithrombotic treatments.\n\n\nWhat does this paper add?\n\n\nThe major bleeding event incidence significantly increases in all PWHs taking antithrombotic treatments.\n\nThe major bleeding event incidence is directly related to hemophilia severity, presence/absence of prophylaxis, HAS-BLED score, and antithrombotic treatment type.\n\nGastrointestinal bleeding events are frequent in PWHs receiving antithrombotic treatments.\n\nPWHs with CVD have an increased risk of additional cardiovascular events.\n\nThe risk of cardiovascular event recurrence in PWHs is not influenced by prophylaxis with factor VIII or IX concentrates.\n\nAcknowledgment\nThe authors would like to thank Hasan Catovic and Diane Bracquart for their assistance in data collection and logistical organization of the COCHE study; co-investigators from the 26 French HTCs; and Elisabetta Andermarcher for her help in editing and rewriting in English.\n\nConflict of Interest None declared.\n\nAuthors' Contributions\nAll authors contributed to the study concept and design. B.G., G.C., and J-F.S. recruited patients, analyzed and interpreted results, and wrote the manuscript. A.L., B.W., C.F., S.C., P.G., and S.C. recruited patients.\n\n* \nBenoît Guillet and Guillaume Cayla contributed equally to the present work.\n\n\nSupplementary Material\nSupplementary Material\n\nSupplementary Material\n==== Refs\nReferences\n1 Mannucci P M Back to the future: a recent history of haemophilia treatment\nHaemophilia 2008 14 0310 18\n\n2 Association of Hemophilia Clinic Directors of Canada Walker I R Julian J A Causes of death in Canadians with haemophilia 1980-1995\nHaemophilia 1998 4 05 714 720\n9873876 \n3 Larsson S A Life expectancy of Swedish haemophiliacs, 1831-1980\nBr J Haematol 1985 59 04 593 602\n3885998 \n4 Darby S C Kan S W Spooner R J Mortality rates, life expectancy, and causes of death in people with hemophilia A or B in the United Kingdom who were not infected with HIV\nBlood 2007 110 03 815 825\n17446349 \n5 Posthouwer D Yee T T Makris M Antiviral therapy for chronic hepatitis C in patients with inherited bleeding disorders: an international, multicenter cohort study\nJ Thromb Haemost 2007 5 08 1624 1629\n17663735 \n6 Ljung R Petrini P Lindgren A C Tengborn L Nilsson I M Factor VIII and factor IX inhibitors in haemophiliacs\nLancet 1992 339 (8808):1550 \n7 Hay C R The epidemiology of factor VIII inhibitors\nHaemophilia 2006 12 0623 28\n17123390 \n8 Franchini M Salvagno G L Lippi G Inhibitors in mild/moderate haemophilia A: an update\nThromb Haemost 2006 96 02 113 118\n16894451 \n9 Authors/Task Force members Windecker S Kolh P Alfonso F 2014 ESC/EACTS guidelines on myocardial revascularization: the Task Force on Myocardial Revascularization of the European Society of Cardiology (ESC) and the European Association for Cardio-Thoracic Surgery (EACTS) developed with the special contribution of the European Association of Percutaneous Cardiovascular Interventions (EAPCI)\nEur Heart J 2014 35 37 2541 2619\n25173339 \n10 ESC Scientific Document Group Kirchhof P Benussi S Kotecha D 2016 ESC guidelines for the management of atrial fibrillation developed in collaboration with EACTS\nEur Heart J 2016 37 38 2893 2962\n27567408 \n11 Andrade J G Deyell M W Wong G C Macle L Antithrombotic therapy for atrial fibrillation and coronary disease demystified\nCan J Cardiol 2018 34 11 1426 1436\n30404748 \n12 Cayla G Morange P E Chambost H Schved J F Management of cardiovascular disease in haemophilia\nThromb Res 2013 132 01 8 14\n23746627 \n13 Ferraris V A Boral L I Cohen A J Smyth S S White G C II Consensus review of the treatment of cardiovascular disease in people with hemophilia A and B\nCardiol Rev 2015 23 02 53 68\n25436468 \n14 Schutgens R EG van der Heijden J F Mauser-Bunschoten E P Mannucci P M New concepts for anticoagulant therapy in persons with hemophilia\nBlood 2016 128 20 2471 2474\n27670425 \n15 Jabbar A Y Baydoun H Janbain M Ferdinand K C Current concepts in the management of stable ischemic heart disease and acute coronary syndrome in patients with hemophilia\nAnn Transl Med 2018 6 15 299 30211187 \n16 Tosetto A Castaman G Rodeghiero F Bleeders, bleeding rates, and bleeding score\nJ Thromb Haemost 2013 11 01142 150\n\n17 Subcommittee on Control of Anticoagulation of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis Schulman S Kearon C Definition of major bleeding in clinical investigations of antihemostatic medicinal products in non-surgical patients\nJ Thromb Haemost 2005 3 04 692 694\n15842354 \n18 Mannucci P M Schutgens R E Santagostino E Mauser-Bunschoten E P How I treat age-related morbidities in elderly persons with hemophilia\nBlood 2009 114 26 5256 5263\n19837978 \n19 ADVANCE Working Group Staritz P de Moerloose P Schutgens R Dolan G Applicability of the European Society of Cardiology guidelines on management of acute coronary syndromes to people with haemophilia - an assessment by the ADVANCE Working Group\nHaemophilia 2013 19 06 833 840\n23710576 \n20 Martin K Key N S How I treat patients with inherited bleeding disorders who need anticoagulant therapy\nBlood 2016 128 02 178 184\n27106121 \n21 Triemstra M Rosendaal F R Smit C Van der Ploeg H M Briët E Mortality in patients with hemophilia. Changes in a Dutch population from 1986 to 1992 and 1973 to 1986\nAnn Intern Med 1995 123 11 823 827\n7486463 \n22 Plug I Van Der Bom J G Peters M Mortality and causes of death in patients with hemophilia, 1992–2001: a prospective cohort study\nJ Thromb Haemost 2006 4 03 510 516\n16460432 \n23 Tuinenburg A Mauser-Bunschoten E P Verhaar M C Biesma D H Schutgens R E Cardiovascular disease in patients with hemophilia\nJ Thromb Haemost 2009 7 02 247 254\n18983484 \n24 Sharathkumar A A Soucie J M Trawinski B Greist A Shapiro A D Prevalence and risk factors of cardiovascular disease (CVD) events among patients with haemophilia: experience of a single haemophilia treatment centre in the United States (US)\nHaemophilia 2011 17 04 597 604\n21323799 \n25 January C T Wann L S Calkins H 2019 AHA/ACC/HRS focused update of the 2014 AHA/ACC/HRS guideline for the management of patients with atrial fibrillation: a report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines and the Heart Rhythm Society\nJ Am Coll Cardiol 2019 74 01 104 132\n30703431 \n26 Proietti M Lane D A Boriani G Lip G YH Stroke prevention, evaluation of bleeding risk, and anticoagulant treatment management in atrial fibrillation contemporary international guidelines\nCan J Cardiol 2019 35 05 619 633\n31030864 \n27 ESC Scientific Document Group Knuuti J Wijns W Saraste A 2019 ESC guidelines for the diagnosis and management of chronic coronary syndromes\nEur Heart J 2019 00 1 71\n\n28 ESC Scientific Document Group Neumann F J Sousa-Uva M Ahlsson A 2018 ESC/EACTS guidelines on myocardial revascularization\nEur Heart J 2019 40 02 87 165\n30165437 \n29 Den Uijl I E Mauser Bunschoten E P Roosendaal G Clinical severity of haemophilia A: does the classification of the 1950s still stand?\nHaemophilia 2011 17 06 849 853\n21545376 \n30 Gómez-Outes A Lagunar-Ruíz J Terleira-Fernández A I Calvo-Rojas G Suárez-Gea M L Vargas-Castrillón E Causes of death in anticoagulated patients with atrial fibrillation\nJ Am Coll Cardiol 2016 68 23 2508 2521\n27931607 \n31 WAPPS co-investigators Yu J K Iorio A Edginton A N Using pharmacokinetics for tailoring prophylaxis in people with hemophilia switching between clotting factor products: a scoping review\nRes Pract Thromb Haemost 2019 3 03 528 541\n31294337 \n32 Mahlangu J rFVIIIFC for hemophilia A prophylaxis\nExpert Rev Hematol 2018 11 12 937 943\n30449223 \n33 Morfini M Gherardini S Pharmacokinetic-based prediction of real-life dosing of extended half-life clotting factor concentrates on hemophilia\nTher Adv Hematol 2018 9 06 149 162\n29899890 \n34 Fukushi K Tominaga K Nagashima K Gastroduodenal ulcer bleeding in elderly patients on low dose aspirin therapy\nWorld J Gastroenterol 2018 24 34 3908 3918\n30228784 \n35 Szabó I L Mátics R Hegyi P PPIs prevent aspirin-induced gastrointestinal bleeding better than H2RAs. A systematic review and meta-analysis\nJ Gastrointestin Liver Dis 2017 26 04 395 402\n29253055 \n36 COMPASS Investigators Moayyedi P Eikelboom J W Bosch J Safety of proton pump inhibitors based on a large, multi-year, randomized trial of patients receiving rivaroxaban or aspirin\nGastroenterology 2019 157 03 68200 69100\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0340-6245",
"issue": "121(3)",
"journal": "Thrombosis and haemostasis",
"keywords": null,
"medline_ta": "Thromb Haemost",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D002318:Cardiovascular Diseases; D016022:Case-Control Studies; D005167:Factor VII; D005260:Female; D005602:France; D006467:Hemophilia A; D006470:Hemorrhage; D006801:Humans; D008297:Male; D008875:Middle Aged; D011446:Prospective Studies",
"nlm_unique_id": "7608063",
"other_id": null,
"pages": "287-296",
"pmc": null,
"pmid": "33099283",
"pubdate": "2021-03",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": "3885998;23809118;31152740;29253055;18983484;9873876;18510516;25436468;31294337;1351234;29899890;27670425;17123390;19837978;7486463;30703431;27567408;23710576;27106121;30165437;17446349;30228784;21323799;16894451;16460432;27931607;21545376;30449223;30404748;17663735;25173339;23746627;30211187;15842354;31030864",
"title": "Long-Term Antithrombotic Treatments Prescribed for Cardiovascular Diseases in Patients with Hemophilia: Results from the French Registry.",
"title_normalized": "long term antithrombotic treatments prescribed for cardiovascular diseases in patients with hemophilia results from the french registry"
} | [
{
"companynumb": "FR-TAKEDA-2021TUS022913",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ANTIHEMOPHILIC FACTOR HUMAN"
},
"drugadditional... |
{
"abstract": "Ubrogepant is a novel, oral calcitonin gene-related peptide receptor antagonist currently under US Food and Drug Administration (FDA) review for the acute treatment of migraine attacks. This double-blind, four-period crossover study compared the cardiac repolarization effect of therapeutic (100 mg) and supratherapeutic (400 mg) ubrogepant doses vs. placebo in healthy adults. Moxifloxacin 400 mg was used as an open-label active control, and the primary end point was change from baseline in Fridericia-corrected QT intervals (ΔQTcF). Assay sensitivity was demonstrated via statistically significant QTcF prolongation with moxifloxacin vs. placebo. After single oral doses of ubrogepant, the least squares mean placebo-corrected ΔQTcF (ΔΔQTcF) and 90% confidence intervals (CIs) did not exceed the 10-millisecond regulatory threshold at any timepoint. The 90% CI upper bounds were 2.46 milliseconds and 2.69 milliseconds for ubrogepant 100 and 400 mg, respectively. Categorical and concentration-based analyses were consistent with the primary result, showing no significant impact of ubrogepant on cardiac repolarization.",
"affiliations": "Allergan plc, Madison, New Jersey, USA.;Allergan plc, Madison, New Jersey, USA.;Allergan plc, Madison, New Jersey, USA.;Allergan plc, Madison, New Jersey, USA.;Allergan plc, Madison, New Jersey, USA.;Allergan plc, Madison, New Jersey, USA.",
"authors": "Jakate|Abhijeet|A|;Boinpally|Ramesh|R|;Butler|Matthew|M|;Lu|Kaifeng|K|;McGeeney|Danielle|D|;Periclou|Antonia|A|",
"chemical_list": "D000077221:Calcitonin Gene-Related Peptide Receptor Antagonists; D011725:Pyridines; D011758:Pyrroles; C000615620:ubrogepant",
"country": "United States",
"delete": false,
"doi": "10.1002/cpt.1696",
"fulltext": "\n==== Front\nClin Pharmacol Ther\nClin. Pharmacol. Ther\n10.1002/(ISSN)1532-6535\nCPT\nClinical Pharmacology and Therapeutics\n0009-9236 1532-6535 John Wiley and Sons Inc. Hoboken \n\n31628854\n10.1002/cpt.1696\nCPT1696\nArticle\nResearch\nArticles\nSingle Therapeutic and Supratherapeutic Doses of Ubrogepant Do Not Affect Cardiac Repolarization in Healthy Adults: Results From a Randomized Trial\nJAKATE et al.Jakate Abhijeet \n1\nAbhijeet.Jakate@allergan.com Boinpally Ramesh \n1\n Butler Matthew \n1\n Lu Kaifeng \n1\n McGeeney Danielle \n1\n Periclou Antonia \n1\n \n1 \nAllergan plc\nMadison\nNew Jersey\nUSA\n\n* \nCorrespondence: Abhijeet Jakate (Abhijeet.Jakate@allergan.com)\n\n14 12 2019 \n4 2020 \n14 12 2019 \n107 4 10.1002/cpt.v107.4Data Science1014 1022\n21 5 2019 27 9 2019 © 2019 ALLERGAN plc. Clinical Pharmacology & Therapeutics published by Wiley Periodicals, Inc. on behalf of American Society for Clinical Pharmacology and Therapeutics.This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.Ubrogepant is a novel, oral calcitonin gene–related peptide receptor antagonist currently under US Food and Drug Administration (FDA) review for the acute treatment of migraine attacks. This double‐blind, four‐period crossover study compared the cardiac repolarization effect of therapeutic (100 mg) and supratherapeutic (400 mg) ubrogepant doses vs. placebo in healthy adults. Moxifloxacin 400 mg was used as an open‐label active control, and the primary end point was change from baseline in Fridericia‐corrected QT intervals (ΔQTcF). Assay sensitivity was demonstrated via statistically significant QTcF prolongation with moxifloxacin vs. placebo. After single oral doses of ubrogepant, the least squares mean placebo‐corrected ΔQTcF (ΔΔQTcF) and 90% confidence intervals (CIs) did not exceed the 10‐millisecond regulatory threshold at any timepoint. The 90% CI upper bounds were 2.46 milliseconds and 2.69 milliseconds for ubrogepant 100 and 400 mg, respectively. Categorical and concentration‐based analyses were consistent with the primary result, showing no significant impact of ubrogepant on cardiac repolarization.\n\nAllergan plc, Dublin, Ireland 10.13039/100007819 source-schema-version-number2.0cover-dateApril 2020details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.8.0 mode:remove_FC converted:14.04.2020\n==== Body\nStudy Highlights\n\n\nWHAT IS THE CURRENT KNOWLEDGE ON THE TOPIC?\n\n\n\n\n\n☑ The effect of ubrogepant on cardiac repolarization has not been evaluated in a thorough QT clinical study.\n\nWHAT QUESTION DID THIS STUDY ADDRESS?\n\n\n\n\n\n☑ This study assessed whether therapeutic (100 mg) and supratherapeutic (400 mg) doses of ubrogepant had any clinically relevant effect on cardiac repolarization in healthy adults.\n\nWHAT DOES THIS STUDY ADD TO OUR KNOWLEDGE?\n\n\n\n\n\n☑ The effects of therapeutic and supratherapeutic doses of ubrogepant on cardiac repolarization in healthy adult participants were not clinically relevant in comparison with placebo.\n\nHOW MIGHT THIS CHANGE CLINICAL PHARMACOLOGY OR TRANSLATIONAL SCIENCE?\n\n\n\n\n\n☑ Due to the poor cardiac safety profile of triptans, a commonly used acute treatment for migraine attacks, people with migraine may be concerned about the cardiac safety of new migraine medications. This study addresses the QT prolongation potential of therapeutic and supratherapeutic doses of ubrogepant and showed that cardiac repolarization is unlikely to be a safety concern associated with the use of ubrogepant. These results provide additional support for an overall favorable safety profile of ubrogepant for the acute treatment of migraine attacks.\n\n\n\n\nMigraine is a prevalent chronic disease with episodic attacks that are characterized by incapacitating neurological symptoms such as headache pain, sensitivity to light and sound, and nausea.1 An estimated 12.3% of adults in the United States experience migraine attacks, resulting in a great individual, familial, and societal burden.2, 3, 4, 5\n\n\nCommonly used acute treatments for migraine include triptans, opioids, nonsteroidal antiinflammatory drugs, combination analgesics, and barbiturates; however, the utility of these treatments is limited by inadequate efficacy, poor tolerability, and cardiovascular contraindications.6, 7, 8, 9, 10 Among these types of medications, only triptans were developed specifically for the acute treatment of migraine attacks, targeting the serotonin pathway in accordance with the vascular theory of migraine pathology.11, 12 Despite the widespread use of triptans in the treatment of migraine, the vasoconstrictive properties that drove their development are also the basis for their contraindication in patients with ischemic heart disease, uncontrolled hypertension, and cerebrovascular disease.12 The shortcomings of acute treatments for migraine attacks underscore the need for new options with improved efficacy and tolerability profiles.\n\nThe evolving understanding of migraine has led to a focus on the calcitonin gene–related peptide (CGRP), a potent vasodilatory neurotransmitter that is highly expressed in pain‐sensitive trigeminal sensory neurons that innervate the dural and meningeal blood vessels.13, 14, 15 Evidence of CGRP's role in migraine includes studies showing induction of headache and migraine via infusion of CGRP in people with a history of migraine, pathological release of CGRP during the headache phase of a migraine attack, and relief from attacks after treatment with oral CGRP receptor antagonists.16, 17, 18, 19\n\n\nUbrogepant is an orally delivered, potent, and specific CGRP receptor antagonist that is anticipated to be a first‐in‐class CGRP‐targeted medication for the acute treatment of migraine attacks. Clinical data have shown ubrogepant to be effective for the acute treatment of migraine attacks, providing patients with substantial symptomatic relief and enabling return to function. In phase III, randomized, multicenter studies (ACHIEVE I and II), ubrogepant was found to be a safe and effective oral treatment for migraine attacks.20, 21 The current study assessed whether therapeutic (100 mg) and supratherapeutic (400 mg) doses of ubrogepant had any clinically relevant effect on cardiac repolarization in comparison with placebo. In addition, the pharmacokinetics (PK), safety, and tolerability of single doses of ubrogepant (100 mg and 400 mg) were evaluated. Moxifloxacin 400 mg was chosen as an active control because it is known to produce an increase in QTc interval in healthy adult participants at a time to maximum plasma drug concentration (t\nmax) of approximately 2 hours postdose.22, 23, 24\n\n\nMethods\nStudy design\nIn accordance with the US Food and Drug Administration's (FDA's) E14 guidance regarding clinical evaluation of QT/QTc prolongation,25 this phase I, randomized, double‐blind, single‐center, single‐dose, placebo‐controlled and active‐controlled, four‐period crossover trial was conducted in healthy adults to evaluate the impact of ubrogepant on cardiac repolarization, as determined by measurement of the QT interval corrected for heart rate using the Fridericia formula (QTcF). Eligible participants were randomized to 1 of 12 treatment sequences (Table S1), with ubrogepant and placebo administered in a double‐blind manner and moxifloxacin administered in an open‐label fashion. There was a 7‐day washout period between each of the four treatments, with a total treatment period of 24 days (day −1 to day 23).\n\nThis study was conducted in conformance with the ICH E6 Guideline for Good Clinical Practice and the principles of the Declaration of Helsinki, or US laws and regulations, whichever afforded the greater protection to the individual. The investigator obtained approval of the study protocol from a properly constituted institutional review board prior to initiating the study, and written informed consent was required from participants before participating in any study‐related procedures.\n\nParticipants\nEnrolled participants were aged 18 through 45 years, were nonsmokers, had a body mass index of 18–30 kg/m2, and had a supine pulse rate of 50–100 beats per minute during the vital signs assessment at screening. Agreement to use an effective method of contraception as defined in the protocol was required from those with reproductive potential.\n\nThe exclusion criteria included hypersensitivity to CGRP receptor antagonists; clinically significant findings regarding disease state, physical examination, medical history, or standard clinical laboratory parameters; supine systolic blood pressure ≤ 90 or ≥140 mmHg or diastolic blood pressure ≤50 mmHg or ≥ 90 mmHg at screening; potentially clinically significant electrocardiography; history of cardiovascular disease, including but not limited to long QT syndrome (or family history of long QT syndrome), cardiac arrhythmia, orthostatic hypotension, and coronary artery or valvular disease; clinical condition or previous surgery that could affect absorption, distribution, biotransformation, or excretion of ubrogepant or moxifloxacin; concomitant medications within 14 days or hormonal drug products within 30 days before dosing; consumption of foods that could affect drug metabolizing enzymes and transporters within 14 days before dosing; consumption of caffeine‐containing or xanthine‐containing compounds within 48 hours before dosing; participation in a blood or plasma donation program within 60 or 30 days, respectively, before dosing; participation in any other clinical investigation requiring repeated blood or plasma draws within 60 days before dosing; and history of substance abuse within 5 years of screening or positive result at screening or admission for specific drugs of abuse. Furthermore, given the known sex differences in human electrocardiogram (ECG) measurements,26 in particular, the finding that women have longer QTc intervals than men, the exclusionary and safety ECG QTcF cutoff for women was set at a slightly higher range than for men (450 milliseconds for men vs. 470 milliseconds for women).\n\nThe study was conducted at a single clinical research center, where for each treatment participants were admitted and administered investigational products, underwent PK sample collections, Holter ECG recordings, and safety assessments, and were released after their 25‐hour Holter ECG recording in each study period. Participants had a follow‐up period for clinical chemistry assessments 30 (±2) days after the last dose.\n\nTreatments\nThe four treatments were a single 100 mg ubrogepant therapeutic dose administered as two tablets of 50 mg each plus six matching placebo tablets (double‐blind treatment), a single 400 mg ubrogepant supratherapeutic dose administered as eight tablets of 50 mg each (double‐blind treatment), a single placebo dose of eight matching tablets (double‐blind treatment), and a single 400 mg moxifloxacin dose administered as a single tablet (open‐label treatment). All treatments were administered orally in accordance with the randomization scheme with approximately 240 mL of water. Participants were required to undergo a 10‐hour fast prior to each dosing (days 1, 8, 15, and 22) and to maintain the fast for 4 hours postdose.\n\nOutcomes\nThe primary outcome was the change in QTcF interval from baseline (ΔQTcF) following administration of ubrogepant and placebo. For this pharmacodynamic (PD) analysis, continuous ECGs were obtained via 12‐lead Holter ECG readers. Holter ECG readers rendered continuous ECGs from approximately 30 minutes before dose to 25 hours postdose, with participants remaining supine for at least 10 minutes before each timepoint until approximately 5 minutes after the timepoint. ECG extractions were obtained at 0 hour (before dose) and 0.5, 1, 1.5, 2, 3, 4, 6, 8, 12, and 24 hours postdose. Example ECG recordings for a representative participant at 2 hours postdose is shown in Figure\n\nS1\n. At each timepoint, ECGs were extracted in triplicate within a 5‐minute window; the middle ECG was collected at the nominal timepoint. Baseline QTcF interval for each treatment period was calculated from the mean of nine predose measurements (triplicate readings taken 20 minutes, 10 minutes, and immediately before dosing) taken on days 1, 8, 15, and 22. A central ECG laboratory was employed to minimize variability. The ECG readers (n = 6) were blinded to all study and participant information. All the ECG readers were cardiologists, and the same blinded ECG reader interpreted and reviewed all study‐related ECGs for one participant.\n\nThe secondary outcomes were evaluated using plasma concentrations of ubrogepant and moxifloxacin and safety assessments. Blood samples (6 mL) were collected on days 1, 8, 15, and 22 at 0 hour (before dose) and postdose at 0.5, 1, 1.5, 2, 3, 4, 5, 6, 8, 12, 14, and 24 hours. Blood samples were centrifuged to obtain plasma samples, which were flash‐frozen and stored at −70°C until analysis. The limit of quantitation was 1 ng/mL for ubrogepant and 25 ng/mL for moxifloxacin. Plasma concentrations of ubrogepant and moxifloxacin were determined using validated liquid chromatography with tandem mass spectrometry methods.27\n\n\nSafety was assessed by monitoring adverse events (AEs), clinical laboratory tests, vital signs, safety ECGs, and physical examinations. The safety ECG was a standard 12‐lead ECG performed in the supine position to measure the following parameters in lead II or lead III: heart rate, PR interval, QRS duration, QT interval, and QTcF interval.\n\nRandomization and blinding\nEnrollment numbers were assigned sequentially to participants and randomization occurred via a computerized scheme that was blinded. The clinical site and study participants were blinded with respect to ubrogepant and placebo treatments. Moxifloxacin was administered in an open‐label fashion. The central ECG readers were blinded to all study and participant information (e.g., study design, study drug assignment, times and days of treatments and assessments, participant number and demographics). The bioanalytical team measuring plasma concentrations of ubrogepant and moxifloxacin as well as the sponsor's bioanalytical representatives were unblinded to the samples.\n\nStatistical analyses\nA sample size of 72 participants for enrollment was planned, assuming a 20% dropout rate, which would yield a total of 58 participants completing the study. A sample size of 58 would ensure at least a 90% probability that 90% confidence intervals (CIs) were below 10 milliseconds at all timepoints, assuming a true difference in QTcF interval change from baseline between ubrogepant doses and placebo of 3 milliseconds at all timepoints. A sample size of 58 participants completing would also ensure at least 80% probability of detecting a 5‐millisecond true mean difference between moxifloxacin and placebo for at least one timepoint after multiplicity adjustment, assuming a true difference in QTcF interval change from baseline between moxifloxacin and placebo of 9 milliseconds at the time of maximum moxifloxacin plasma concentrations (2 and 3 hours postdose).\n\nAdditional assumptions used in sample size determination were a standard deviation (SD) of 10 milliseconds for the change in QTcF interval from predose baseline, an average correlation of 0.40 among measurements in the same period, and an average correlation of 0.15 among measurements in different periods.\n\nThe PD population consisted of all participants who received study treatment and had nonmissing QTcF intervals at baseline and at least one postdose QTcF interval for at least one treatment period; the PK population consisted of all participants with evaluable PK parameters for ubrogepant and/or moxifloxacin; and the safety population consisted of all participants who received at least one dose of study treatment.\n\nA linear mixed‐effects model that included treatment, sequence, period, and gender as fixed factors, predose baseline for the period and mean predose baseline across periods as covariates, and participant as a random effect was used to determine the treatment effect of ubrogepant (each dose) vs. placebo and the treatment effect of moxifloxacin vs. placebo in QTcF interval change from predose baseline at each postdose timepoint (ΔΔQTcF). The least squares mean estimate of ΔΔQTcF and a two‐sided 90% CI for each postdose timepoint were calculated. The effect of ubrogepant on QTcF interval was evaluated by comparing the largest upper limit of the two‐sided 90% CI for each ubrogepant dose vs. placebo, compared with a threshold of 10 milliseconds.\n\nTo assess assay sensitivity, the time‐matched mean difference between moxifloxacin and placebo in QTcF interval change from baseline was determined, and the effect of moxifloxacin on QTcF interval was evaluated by comparing the largest lower limit of the ΔΔQTcF two‐sided 90% CIs at 2 and 3 hours, with a threshold value of 5 milliseconds. Assay sensitivity was established if the null hypothesis that the difference between moxifloxacin and placebo in QTcF interval change from baseline was < 5 milliseconds at both the 2‐hour and 3‐hour timepoints was rejected using the Hochberg procedure.\n\nTo enable categorical assessments, extreme QTcF intervals were defined as those greater than 450, 480, or 500 milliseconds, and changes from baseline in QTcF intervals were defined as those greater than 30 or 60 milliseconds. The number and percentage of participants that met the above criteria at scheduled ECG timepoints was summarized.\n\nDescriptive statistics were presented for each ubrogepant dose and for moxifloxacin for the following: plasma drug concentration at each timepoint, all PK parameters, and safety parameters (clinical laboratory variables, vital signs, and safety ECG parameters). The number of participants with potentially clinically significant postbaseline values was also summarized for the safety parameters. PK parameters were derived from plasma concentrations of ubrogepant and moxifloxacin: area under the plasma drug concentration‐time curve from time 0 to time t (AUC0‐t) and from time 0 to infinity (AUC0‐∞), maximum plasma drug concentration (C\nmax), time to reach C\nmax (t\nmax), terminal elimination half‐life (t\n1/2), and terminal elimination rate constant (λz). The following PK parameters were derived for ubrogepant only: apparent total body clearance (CL/F) and apparent volume of distribution (V\nz/F). Values for λz, AUC0‐∞, or t1/2 that exhibited a terminal log‐linear phase in the concentration‐vs.‐time profile or yielded an r\n2 value of the regression for λz of 0.8 or more were reported. AUC0‐∞, CL/F, and V\nz/F were reported if the extrapolated AUC was less than 20%. A linear mixed effects model with sequence, treatment, and period as fixed effects and participant nested within sequence as a random effect was used to evaluate dose proportionality between the ubrogepant 100 mg and 400 mg doses based on log‐transformed, dose‐normalized C\nmax, AUC0‐t, and AUC0‐∞ parameters. PK analyses were performed using Phoenix WinNonlin version 6.3 (Certara, L.P., Princeton, NJ, USA).\n\nTreatment‐emergent AEs were summarized by incidence and distribution. Descriptive statistics for clinical laboratory values and vital signs at all assessment points were compiled and evaluated for potential clinical significance.\n\nResults\nBaseline demographics and study flow\nA total of 84 participants (53 men and 31 women) were enrolled and received at least one dose of study treatment (Table \n1). Evaluable pharmacodynamic (PD) and PK assessments were available for 78 participants after administration of ubrogepant 100 mg, 76 participants after administration of ubrogepant 400 mg, and 72 participants after administration of moxifloxacin 400 mg, and there were 74 participants with evaluable PD assessments after placebo administration. Overall, 67 (79.8%) participants completed all treatment periods, with 17 participants discontinuing the trial: 9 due to protocol violations (positive urine drug screen), 3 due to adverse events (AEs), 2 due to consent withdrawal, 2 due to loss to follow‐up, and 1 due to investigator's decision.\n\nTable 1 Demographics and baseline characteristics\n\n\tPlacebo (n = 74)\tUbrogepant 100 mg (n = 78)\tUbrogepant 400 mg (n = 76)\tMoxifloxacin 400 mg (n = 72)\tTotal (N = 84)\t\nAgea (years)\t\nMean (SD)\t29.0 (7.5)\t29.2 (7.4)\t29.2 (7.3)\t29.1 (7.3)\t29.3 (7.5)\t\nSex, n (%)\t\nMale\t46 (62.2)\t50 (64.1)\t47 (61.8)\t44 (61.1)\t53 (63.1)\t\nFemale\t28 (37.8)\t28 (35.9)\t29 (38.2)\t28 (38.9)\t31 (36.9)\t\nRace, n (%)\t\nWhite\t32 (43.2)\t35 (44.9)\t30 (39.5)\t31 (43.1)\t36 (42.9)\t\nBlack or African‐American\t39 (52.7)\t40 (51.3)\t43 (56.6)\t38 (52.8)\t45 (53.6)\t\nAsian\t3 (4.1)\t3 (3.8)\t3 (3.9)\t3 (4.2)\t3 (3.6)\t\nEthnicity, n (%)\t\nHispanic or Latino\t9 (12.2)\t10 (12.8)\t8 (10.5)\t8 (11.1)\t10 (11.9)\t\nNot Hispanic or Latino\t65 (87.8)\t68 (87.2)\t68 (89.5)\t64 (88.9)\t74 (88.1)\t\nWeight (kg)\t\nMean (SD)\t73.5 (11.6)\t73.8 (11.6)\t74.1 (11.6)\t74.1 (11.5)\t73.5 (11.6)\t\nHeight (cm)\t\nMean (SD)\t171.0 (8.9)\t171.2 (8.9)\t171.3 (9.1)\t171.0 (9.0)\t171.0 (8.8)\t\nBMI (kg/m2)\t\nMean (SD)\t25.11 (3.1)\t25.14 (3.2)\t25.22 (3.1)\t25.32 (3.1)\t25.10 (3.1)\t\n\nN = number of participants in the safety population. n = number of participants in the specific category. BMI, body mass index; SD, standard deviation.\n\na Age relative to informed consent date.\n\nJohn Wiley & Sons, LtdAssay sensitivity\nThe least squares mean estimate of change from baseline in QTcF interval (ΔQTcF) after single‐dose moxifloxacin 400 mg, at the prespecified 2‐hour and 3‐hour timepoints, was statistically different from placebo, with the least squares mean differences from placebo (ΔΔQTcF) and lower bounds of the two‐sided 90% CIs (7.50 milliseconds at 2 hour, 7.91 milliseconds at 3 hour) above the 5‐millisecond threshold (Figure \n1 and Table S2).\n\nFigure 1 Placebo‐corrected least squares mean (90% confidence interval) change from predose baseline in time‐matched QTcF interval following moxifloxacin administration (pharmacodynamic population).\n\nPharmacodynamics\nAfter single oral doses of ubrogepant 100 or 400 mg, the least squares mean differences from placebo (ΔΔQTcF) and upper bounds of two‐sided 90% CIs were lower than the 10‐millisecond threshold at all timepoints (Figure \n2 and Table \n2). The values of the upper bounds of the two‐sided 90% CIs at the maximum ΔΔQTcF (2.46 milliseconds for ubrogepant 100 mg, 2.69 milliseconds for ubrogepant 400 mg at 24 hour) were below the 10‐millisecond threshold, demonstrating the absence of an effect of single‐dose ubrogepant 100 or 400 mg on QTcF interval. A scatterplot of least squares mean ΔΔQTcF intervals vs. plasma ubrogepant concentrations showed no trends in ΔΔQTcF with increasing plasma drug concentrations (Figure \n3).\n\nFigure 2 Placebo‐corrected least squares mean (90% confidence interval) change from predose baseline in time‐matched QTcF interval following ubrogepant (100 and 400 mg) administration (pharmacodynamic population).\n\nTable 2 Mean ΔΔQTcF interval at each timepoint following single doses of ubrogepant 100 mg or ubrogepant 400 mg (PD (pharmacodynamic) population)\n\nPostdose timepoint (hours)\tUbrogepant 100 mg (n = 78)\tUbrogepant 400 mg (n = 76)\t\nLS mean difference (90% CI)\t\n0.5\t−0.46 (−2.15, 1.23)\t−1.44 (−3.14, 0.27)\t\n1\t−1.21 (−3.11, 0.70)\t−2.20 (−4.12, −0.29)\t\n1.5\t−0.41 (−1.97, 1.15)\t−0.35 (−1.93, 1.22)\t\n2\t−0.58 (−2.49, 1.33)\t−0.05 (−1.97, 1.88)\t\n3\t−0.89 (−2.89, 1.11)\t−1.74 (−3.76, 0.27)\t\n4\t−1.00 (−2.66, 0.67)\t−1.65 (−3.33, 0.03)\t\n6\t−1.92 (−3.44, −0.41)\t−2.41 (−3.94, −0.89)\t\n8\t−2.25 (−3.90, −0.60)\t−3.60 (−5.27, −1.94)\t\n12\t0.31 (−1.53, 2.16)\t−0.67 (−2.53, 1.20)\t\n24\t0.85 (−0.75, 2.46)\t1.07 (−0.55, 2.69)\t\nΔΔQTcF, placebo‐corrected change from baseline in time‐matched QTcF interval; CI, confidence interval; LS, least squares.\n\nJohn Wiley & Sons, LtdFigure 3 Scatterplot of ΔΔQTcF vs. plasma ubrogepant concentrations (pharmacodynamic population). ΔΔQTcF, placebo‐corrected change from baseline in time‐matched QTcF interval.\n\nCategorical analyses\nIn the categorical analysis of QTcF, no participant had a QTcF interval greater than 500 milliseconds at any timepoint. An extreme value of QTcF interval change from baseline greater than 30 milliseconds was reported in one participant who received ubrogepant 100 mg, one participant who received ubrogepant 400 mg, and one participant who received moxifloxacin 400 mg. No participant had a QTcF interval change from baseline greater than 60 milliseconds.\n\nPharmacokinetics\nUbrogepant was rapidly absorbed: median t\nmax was 1.67 and 2.08 hours for the 100 and 400 mg doses, respectively. The mean elimination half‐life of ubrogepant was 4.41 and 5.06 hours for the 100 and 400 mg doses, respectively. Mean plasma concentration‐time profiles and PK parameters of ubrogepant following single‐dose administration of 100 or 400 mg ubrogepant are shown in Figure\n\nS2\n and Table \n3, respectively. Mean plasma concentration‐time profiles and PK parameters for moxifloxacin following single‐dose administration of moxifloxacin 400 mg are shown in Figure\n\nS3\n in and Table \n3, respectively. Ubrogepant maximum plasma concentration (C\nmax) and area under the plasma concentration‐time curve (AUC) increased in a dose‐proportional manner from 100 to 400 mg (Table S3).\n\nTable 3 Pharmacokinetic (PK) parameters following single‐dose administration of ubrogepant 100 mg, ubrogepant 400 mg, or moxifloxacin 400 mg (PK population)\n\nPK parameter, mean (SD)\tUbrogepant 100 mg (n = 78)\tUbrogepant 400 mg (n = 76)\tMoxifloxacin 400 mg (n = 72)\t\n\nC\nmax (ng/mL)\t274.25 (99.25)\t1029.75 (428.79)\t1660.40 (422.36)\t\nAUC0‐t (ng·h/mL)\t1220.57 (430.26)\t4998.22 (1935.06)\t18393.27 (4693.84)\t\nAUC0‐∞ (ng·h/mL)\t1249.39 (433.97)\t5127.06 (1979.76)\t25702.00 (5678.68)\t\n\nt\nmax (hour)a\n\t1.67 (1.08–6.08)\t2.08 (0.58–5.00)\t2.08 (0.58–8.08)\t\n\nt\n1/2 (hour)\t4.41 (1.11)\t5.06 (1.77)\t9.56 (0.83)\t\n\nV\nz/F (L)\t561.40 (238.88)\t662.67 (384.10)\t—\t\nCL/F (L/hour)\t88.95 (29.26)\t89.24 (34.05)\t—\t\nAUC0‐∞, area under the plasma drug concentration‐time curve from time 0 to infinity; AUC0‐t, area under the plasma drug concentration‐time curve from time 0 to time t; CL/F, apparent total body clearance; C\nmax, maximum plasma drug concentration; t\n1/2, terminal elimination half‐life; t\nmax, time to reach C\nmax; V\nz/F, apparent volume of distribution.\n\na Median (range).\n\nJohn Wiley & Sons, LtdSafety\nThere were no serious AEs or deaths during the study. The incidence of treatment‐emergent AEs (TEAEs) was low and generally comparable between treatment groups (Table \n4). The most commonly reported TEAEs (≥ 2% in any active treatment and with incidence greater than that for placebo) were gastrointestinal disorders such as nausea and upper abdominal pain (placebo, 2.7% (n = 2), ubrogepant 100 mg, 3.8% (n = 3), ubrogepant 400 mg, 3.9% (n = 3), moxifloxacin, 5.6% (n = 4)) and nervous system disorders such as headache and dizziness (placebo, 2.7% (n = 2), ubrogepant 100 mg, 3.8% (n = 3), ubrogepant 400 mg, 2.6% (n = 2), moxifloxacin, 5.6% (n = 4)). A summary of all TEAEs is provided in Table S4.\n\nTable 4 Summary of adverse events by treatment (safety population)\n\n\nn (%)\tPlacebo (n = 74)\tUbrogepant 100 mg (n = 78)\tUbrogepant 400 mg (n = 76)\tMoxifloxacin 400 mg (n = 72)\t\nTEAEsa\n\t11 (14.9)\t6 (7.7)\t11 (14.5)\t8 (11.1)\t\nTreatment‐related TEAEsa\n\t7 (9.5)\t4 (5.1)\t7 (9.2)\t7 (9.7)\t\nAEs leading to discontinuationb\n\t1 (1.4)\t1 (1.3)\t1 (1.3)\t0\t\nParticipants were counted only once within each category. A TEAE was assigned to the treatment before the onset of AE. AE, adverse event; TEAE, treatment‐emergent AE.\n\na Events that began or worsened on or after the treatment start date in the first period and within 30 days of the treatment start date in the last period. bDiscontinuation events that occurred within the treatment start date in the first period to 30 days after treatment start date in the last period.\n\nJohn Wiley & Sons, LtdTreatment‐related TEAEs were infrequent and balanced across the treatment groups. Three participants discontinued due to an AE, one for hypoesthesia and two for QT interval prolongation.\n\nOne event of QT prolongation was reported on day 15 (period 3, moxifloxacin dosing visit) in a 29‐year‐old male who received ubrogepant 100 mg in period 1 (day 1) and placebo in period 2 (day 8). QTcF at baseline was 436 milliseconds. At his period 3 visit (dosing with moxifloxacin), before moxifloxacin treatment, the participant was noted to have a QTcF of 460 milliseconds. One hour following dosing with moxifloxacin, the participant's QTcF was 468 milliseconds, with two repeat ECGs demonstrating QTcF values of 473 milliseconds and 466 milliseconds. The participant was treated with two infusions of 1000 mL of intravenous sodium chloride and the event was reported to have resolved by the following day. The subject subsequently was discontinued from the study.\n\nThe second event of QT prolongation was reported on day 15 (period 3, moxifloxacin dosing visit) in a 45‐year‐old female who received placebo in period 1 (day 1) and ubrogepant 400 mg in period 2 (day 8). QTcF at baseline was 429 milliseconds. At her period 3 visit (dosing with moxifloxacin), before moxifloxacin treatment, the participant was noted to have a QTcF of 443 milliseconds. One hour following treatment with moxifloxacin, the participant's QTcF was 480 milliseconds, and two repeat ECGs both demonstrated QTcF values of 473 milliseconds. The participant was treated with two infusions of 1000 mL of intravenous sodium chloride, and the event resolved the same day. The subject subsequently was discontinued from the study.\n\nThere were no clinically meaningful mean changes from baseline or relevant trends in any laboratory parameters, vital sign parameters, or safety ECG measurements.\n\nDiscussion\nThe results of this study, which was conducted in accordance with International Council for Harmonisation (ICH) requirements for safety evaluation of investigational medications, suggest that ubrogepant has no clinically relevant effect on cardiac repolarization. Ubrogepant is a novel, oral CGRP receptor antagonist that was developed to mitigate the pathological effects of CGRP in migraine without triggering vasoconstriction. It is intended for the acute treatment of migraine attacks and has demonstrated safety and efficacy in clinical trials.20, 21\n\n\nAssay sensitivity for the measurement of QTcF intervals in this study was demonstrated by a statistically significant prolongation of the baseline‐corrected QTcF interval of the active control (moxifloxacin 400 mg) vs. placebo based on the lower limit of the two‐sided 90% CIs being above the 5‐millisecond threshold at the prespecified timepoints of 2 and 3 hours postdose. Moxifloxacin PK parameters were consistent with values reported in the literature for mean AUC (20,300–44,600 ng·hour/mL)22, 23, 28 and mean C\nmax (1620–3800 ng/mL).22, 23, 28 The mean t1/2 of moxifloxacin (9.56 hours) was within the range reported in one study (9.0–12.8 hours)28 but below that reported in another (12.1–19.1 hours)22 and in the moxifloxacin labeling (11.5–15.6 hours).23 This is likely due to the fact that PK sampling in the current study was limited to 24 hours postdose.\n\nSystemic exposure to ubrogepant (AUC) and C\nmax increased in a dose‐proportional manner in the dose range of 100–400 mg. These results are in agreement with previous clinical studies in which ubrogepant was administered as single (100–400 mg) or daily (40–400 mg) doses.29, 30 Therapeutic (100 mg) and supratherapeutic (400 mg) doses of ubrogepant had no impact on cardiac repolarization in healthy adult participants, as demonstrated by the absence of any ΔΔQTcF reaching the 10‐millisecond threshold for the upper limit of the two‐sided 90% CIs. Both doses of ubrogepant were well tolerated in healthy adult participants; incidence of TEAEs was low and comparable among treatments, and no clinically meaningful changes from baseline were observed for laboratory or vital sign parameters.\n\nNonclinical studies evaluated ubrogepant for any effect on human Ether‐à‐go‐go‐Related Gene (hERG) channels heterologously expressed in Chinese hamster ovary K1 (CHO‐K1) cells using standard whole‐cell voltage‐clamp techniques (data on file, Allergan plc). Ubrogepant inhibited hERG current, with an half maximal inhibitory concentration (IC50) value of 63µM, suggesting no impact of ubrogepant on the hERG channel at clinically relevant concentrations (approximately 0.3µM). In addition, ubrogepant demonstrated no impact on arterial blood pressure parameters (systolic blood pressure, diastolic blood pressure, and mean blood pressure), heart rate, electrocardiograph parameters (PR, QRS, RR and QT/QTcI intervals), QT:RR interval relationship, respiratory parameters (rate and depth of respiration), and body temperature in a combined cardiovascular–respiratory telemetry study in rhesus monkeys (data on file, Allergan, plc). These results are further supported by the current study data in healthy adult participants.\n\nIn completed clinical trials, ubrogepant administered at doses of 50 or 100 mg (ACHIEVE I) or 25 or 50 mg (ACHIEVE II) to treat single migraine attacks was effective, safe, and generally well tolerated in adult patients with a history of migraine.20, 21 Patients in each study were allowed a second optional dose after 2 hours if needed to treat the migraine attack, resulting in the largest potential cumulative dose of 200 mg per day—half the 400 mg dose that showed no impact on cardiac repolarization in the current study. These trials also detected no clinically relevant changes in laboratory parameters, vital signs, or safety ECGs.\n\nA potential limitation of the study was the enrollment of healthy adult participants, a population that may not share the same cardiovascular conditions or comorbidities as the real‐world population of people with migraine. However, in accordance with ICH regulatory guidance, QTc studies are performed in healthy adult participants to minimize confounding variables.25\n\n\nAnother potential limitation was the substantially larger proportion of male participants vs. female participants (63.1% vs 36.9%), given the greater prevalence of migraine in females than males: males represented 17% of the study population in a large (N = 107,122), retrospective study of commercial and Medicare Supplemental–insured adults who had a prescription claim for a migraine medication from 2008 through 2011.31 Because the PK characteristics of ubrogepant are similar in males and females, however, the impact of this limitation is likely to be minimal. Furthermore, the E14 guidance from the FDA and the ICH of Technical Requirements for Registration of Pharmaceuticals for Human Use regarding clinical evaluation of QT/QTc prolongation encourages including both genders in a thorough QT study, and states that gender‐based analysis is not expected when the primary analysis is negative and there is no evidence suggesting gender differences.25 Finally, the upper bounds of the two‐sided 90% CIs at the maximum ΔΔQTcF for both ubrogepant doses were well below the 10‐millisecond threshold that would have indicated an effect of potential clinical significance, and a larger proportion of females would be unlikely to have affected this finding.\n\nIn conclusion, in this thorough QT study in which assay sensitivity was demonstrated with moxifloxacin, single doses of therapeutic (100 mg) and supratherapeutic (400 mg) ubrogepant did not affect cardiac repolarization and were safe and well tolerated in healthy adults. Furthermore, dose‐proportional increases in C\nmax and AUC were seen in the dose range of 100–400 mg of ubrogepant.\n\nFunding\nSupport provided by Allergan plc, Dublin, Ireland.\n\nConflict of Interests\nThis study was sponsored by Allergan plc, Dublin, Ireland. Medical writing and editorial assistance was provided to the authors by Peloton Advantage, LLC, an OPEN Health company, Parsippany, NJ, USA, and was funded by Allergan plc. All authors met the authorship criteria of the International Committee of Medical Journal Editors. Neither honoraria nor other form of payments were made for authorship.\n\nAbhijeet Jakate, PhD, Ramesh Boinpally, PhD, Matthew Butler, MD, Kaifeng Lu, PhD, Danielle McGeeney, BS, and Antonia Periclou, PhD are employees and stockholders of Allergan plc.\n\nAuthor Contributions\nA.J., R.B., M.B., K.L., D.M., and A.P. wrote the manuscript; A.J., A.P., and R.B. designed the research; A.J., K.L., and M.B. analyzed the data.\n\nSupporting information\n\nFigure S1\n. Individual ECG (electrocardiogram) recordings at 2 hours; for example, adult male participant following administration of (a) placebo, (b) moxifloxacin, (c) ubrogepant 100 mg, and (d) ubrogepant 400 mg.\n\nClick here for additional data file.\n\n \nFigure S2\n. Mean (SD) plasma ubrogepant concentration over time on (a) a linear scale and (b) a semi‐logarithmic scale (PK (pharmacokinetic) population).\n\nClick here for additional data file.\n\n \nFigure S3\n. Mean (SD) plasma moxifloxacin concentration over time on (a) a linear scale and (b) a semi‐logarithmic scale (PK (pharmacokinetic) population).\n\nClick here for additional data file.\n\n \nTable S1\n. Study treatments.\n\nClick here for additional data file.\n\n \nTable S2\n. Mean ΔΔQTcF interval over time following a single dose of 400 mg moxifloxacin (PD (pharmacodynamic) population).\n\nClick here for additional data file.\n\n \nTable S3\n. Dose proportionality results following single‐dose administration of ubrogepant 100 or 400 mg (PK (pharmacokinetic) population).\n\nClick here for additional data file.\n\n \nTable S4\n. Treatment‐emergent adverse events by treatment, system organ class, and preferred term (safety population).\n\nClick here for additional data file.\n\n Acknowledgments\nMedical writing and editorial support was provided by Peloton Advantage, LLC, an OPEN Health company, Parsippany, NJ, USA and funded by Allergan plc, Dublin, Ireland.\n\nData Availability Statement\nData reported in this manuscript are available within the article (and/or) its supplementary materials. Allergan will share de‐identified patient‐level data and/or study‐level data, including protocols and clinical study reports, for phase II–IV trials completed after 2008 that are registered on http://ClinicalTrials.gov or EudraCT. The indication studied in the trial must have regulatory approval in the United States and/or the European Union and the primary manuscript from the trial must be published prior to data sharing. To request access to the data, the researcher must sign a data use agreement. All shared data are to be used for noncommercial purposes only. More information can be found on http://www.allerganclinicaltrials.com/.\n==== Refs\n1 \nHeadache Classification Committee of the International Headache Society (IHS) \n. The international classification of headache disorders, 3rd edition\n. Cephalalgia \n38 , 1 –211\n (2018 ).\n2 \n\nBuse , D.C. \n\net al\nImpact of migraine on the family: Perspectives of people with migraine and their spouse/domestic partner in the CaMEO study\n. Mayo Clin. Proc. \n91 , 596 –611\n (2016 ).\n3 \n\nLampl , C. \n\net al\nInterictal burden attributable to episodic headache: findings from the Eurolight project\n. J. Headache Pain \n17 , 9 (2016 ).26879832 \n4 \n\nVos , T. \n\net al\nYears lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990–2010: a systematic analysis for the Global Burden of Disease Study 2010\n. Lancet \n380 , 2163 –2196\n (2012 ).23245607 \n5 \n\nBuse , D.C. \n\net al\nChronic migraine prevalence, disability, and sociodemographic factors: results from the American Migraine Prevalence and Prevention study\n. Headache \n52 , 1456 –1470\n (2012 ).22830411 \n6 \n\nBecker , W.J. \n\nAcute migraine treatment in adults\n. Headache \n55 , 778 –793\n (2015 ).25877672 \n7 \n\nHolland , S. \n, \nFanning , K.M. \n, \nSerrano , D. \n, \nBuse , D.C. \n, \nReed , M.L. \n & \nLipton , R.B. \n\nRates and reasons for discontinuation of triptans and opioids in episodic migraine: results from the American Migraine Prevalence and Prevention (AMPP) study\n. J. Neurol. Sci. \n326 , 10 –17\n (2013 ).23394974 \n8 \n\nMessali , A.J. \n\net al\nTreatment persistence and switching in triptan users: a systematic literature review\n. Headache \n54 , 1120 –1130\n (2014 ).24912394 \n9 \n\nSerrano , D. \n, \nBuse , D.C. \n, \nManack Adams , A. \n, \nReed , M.L. \n & \nLipton , R.B. \n\nAcute treatment optimization in episodic and chronic migraine: results of the American Migraine Prevalence and Prevention (AMPP) Study\n. Headache \n55 , 502 –518\n (2015 ).25881676 \n10 \n\nMartelletti , P. \n\nAcute treatment of migraine: quo vadis?\n\nExpert. Opin. Pharmacother. \n18 , 1035 –1037\n (2017 ).28514185 \n11 \n\nHumphrey , P.P. \n\nThe discovery of a new drug class for the acute treatment of migraine\n. Headache \n47 (suppl. 1 ), S10 –S19\n (2007 ).17425704 \n12 \n\nGoadsby , P.J. \n, \nLipton , R.B. \n & \nFerrari , M.D. \n\nMigraine—current understanding and treatment\n. N Engl. J. Med. \n346 , 257 –270\n (2002 ).11807151 \n13 \n\nGoadsby , P.J. \n, \nHolland , P.R. \n, \nMartins‐Oliveira , M. \n, \nHoffmann , J. \n, \nSchankin , C. \n & \nAkerman , S. \n\nPathophysiology of migraine: a disorder of sensory processing\n. Physiol. Rev. \n97 , 553 –622\n (2017 ).28179394 \n14 \n\nIyengar , S. \n, \nOssipov , M.H. \n & \nJohnson , K.W. \n\nThe role of calcitonin gene‐related peptide in peripheral and central pain mechanisms including migraine\n. Pain \n158 , 543 –559\n (2017 ).28301400 \n15 \n\nEftekhari , S. \n, \nSalvatore , C.A. \n, \nCalamari , A. \n, \nKane , S.A. \n, \nTajti , J. \n & \nEdvinsson , L. \n\nDifferential distribution of calcitonin gene‐related peptide and its receptor components in the human trigeminal ganglion\n. Neuroscience \n169 , 683 –696\n (2010 ).20472035 \n16 \n\nLassen , L.H. \n, \nHaderslev , P.A. \n, \nJacobsen , V.B. \n, \nIversen , H.K. \n, \nSperling , B. \n & \nOlesen , J. \n\nCGRP may play a causative role in migraine\n. Cephalalgia \n22 , 54 –61\n (2002 ).11993614 \n17 \n\nGoadsby , P.J. \n, \nEdvinsson , L. \n & \nEkman , R. \n\nVasoactive peptide release in the extracerebral circulation of humans during migraine headache\n. Ann. Neurol. \n28 , 183 –187\n (1990 ).1699472 \n18 \n\nHo , T.W. \n\net al\nEfficacy and tolerability of MK‐0974 (telcagepant), a new oral antagonist of calcitonin gene‐related peptide receptor, compared with zolmitriptan for acute migraine: a randomised, placebo‐controlled, parallel‐treatment trial\n. Lancet \n372 , 2115 –2123\n (2008 ).19036425 \n19 \n\nHewitt , D.J. \n\net al\nRandomized controlled trial of the CGRP receptor antagonist MK‐3207 in the acute treatment of migraine\n. Cephalalgia \n31 , 712 –722\n (2011 ).21383045 \n20 \n\nDodick , D.W. \n\net al\nUbrogepant for the acute treatment of migraine: efficacy, safety, tolerability, and functional impact outcomes from a single attack phase III study, ACHIEVE 1 [abstract IOR‐01LB]\n. Headache \n58 , 1287 –1288\n (2018 ).\n21 \n\nLipton , R.B. \n\net al\nEfficacy, safety, and tolerability of ubrogepant for the acute treatment of migraine: Results from a single attack phase III study, ACHIEVE II [abstract PS111LB]\n. Headache \n58 , 1315 –1316\n (2018 ).\n22 \n\nStass , H. \n & \nKubitza , D. \n\nPharmacokinetics and elimination of moxifloxacin after oral and intravenous administration in man\n. J. Antimicrob. Chemother. \n43 (suppl. B ), 83 –90\n (1999 ).\n23 \nAvelox [package insert].\n (Merck & Co., Inc. , Whitehouse Station, NJ , 2016 ).\n24 \n\nDémolis , J.L. \n, \nKubitza , D. \n, \nTennezé , L. \n & \nFunck‐Brentano , C. \n\nEffect of a single oral dose of moxifloxacin (400 mg and 800 mg) on ventricular repolarization in healthy subjects\n. Clin. Pharmacol. Ther. \n68 , 658 –666\n (2000 ).11180026 \n25 \nUS Food and Drug Administration \n. Guidance for Industry: E14 Clinical Evaluation of QT/QTc Interval Prolongation and Proarrhythmic Potential for Non‐Antiarrhythmic Drugs\n. <https://www.fda.gov/downloads/Drugs/GuidanceComplianceRegulatoryInformation/Guidances/ucm073153.pdf> (2005 ). Accessed October 9, 2019.\n26 \n\nSalama , G. \n & \nBett , G.C. \n\nSex differences in the mechanisms underlying long QT syndrome\n. Am. J. Physiol. Heart Circ. Physiol. \n307 , H640 –H648\n (2014 ).24973386 \n27 \n\nLi , C.C. \n\net al\nPopulation PK analyses of Ubrogepant (MK‐1602), a CGRP receptor antagonist: enriching in‐clinic plasma PK sampling with outpatient dried blood spot sampling\n. J. Clin. Pharmacol. \n58 , 294 –303\n (2018 ).29136283 \n28 \n\nBurkhardt , O. \n\net al\nSingle‐ and multiple‐dose pharmacokinetics of oral moxifloxacin and clarithromycin, and concentrations in serum, saliva and faeces\n. Scand. J. Infect. Dis. \n34 , 898 –903\n (2002 ).12587622 \n29 \n\nAnkrom , W. \n\net al\nMultiple, once‐daily, oral doses of 150 mg ubrogepant administered for 28 days are generally well tolerated, with no clinically significant elevation of alanine aminotransferase in healthy adult males [abstract]\n. Neurology \n92 (suppl. 15 ), P2.10‐024 (2019 ).\n30 \n\nBondiskey , P. \n\net al\nSingle and multiple doses of ubrogepant are not associated with a clinically significant elevation of alanine aminotransferase in healthy adult males [abstract]\n. Neurology \n92 (suppl. 15 ), P1.10.014 (2019 ).\n31 \n\nWoolley , J.M. \n, \nBonafede , M.M. \n, \nMaiese , B.A. \n & \nLenz , R.A. \n\nMigraine prophylaxis and acute treatment patterns among commercially insured patients in the United States\n. Headache \n57 , 1399 –1408\n (2017 ).28842990\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0009-9236",
"issue": "107(4)",
"journal": "Clinical pharmacology and therapeutics",
"keywords": null,
"medline_ta": "Clin Pharmacol Ther",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000077221:Calcitonin Gene-Related Peptide Receptor Antagonists; D018592:Cross-Over Studies; D004305:Dose-Response Relationship, Drug; D004311:Double-Blind Method; D005260:Female; D064368:Healthy Volunteers; D006339:Heart Rate; D006801:Humans; D008297:Male; D008875:Middle Aged; D011725:Pyridines; D011758:Pyrroles; D055815:Young Adult",
"nlm_unique_id": "0372741",
"other_id": null,
"pages": "1014-1022",
"pmc": null,
"pmid": "31628854",
"pubdate": "2020-04",
"publication_types": "D017426:Clinical Trial, Phase I; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": "1699472;28514185;23245607;11180026;25881676;23394974;11807151;22830411;28301400;10382880;24973386;28842990;21383045;26879832;19036425;29368949;12587622;17425704;20472035;29136283;25877672;24912394;11993614;27132088;28179394;16237860",
"title": "Single Therapeutic and Supratherapeutic Doses of Ubrogepant Do Not Affect Cardiac Repolarization in Healthy Adults: Results From a Randomized Trial.",
"title_normalized": "single therapeutic and supratherapeutic doses of ubrogepant do not affect cardiac repolarization in healthy adults results from a randomized trial"
} | [
{
"companynumb": "US-BAYER-2020-006230",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "MOXIFLOXACIN"
},
"drugadditional": null,
... |
{
"abstract": "A retrospective review was conducted to determine the safety and efficacy of ezetimibe as a treatment option for renal transplant recipients. We evaluated the medical records of 34 adult renal transplant recipients receiving ezetimibe as monotherapy or combination therapy. Fasting lipid profiles were obtained at baseline and at 1-6 months post-ezetimibe initiation. Twenty patients received cyclosporine, 12 patients received tacrolimus, 1 patient received either sirolimus or no calcineurin therapy at the time of ezetimibe initiation. Monotherapy was started in 8 patients, who had all previously failed statins, and combination therapy was utilized in 26 patients. Monotherapy or combination therapy resulted in a mean reduction in total cholesterol of 23.3%, triglycerides 40.2%, low-density lipoproteins 16.8% and high-density lipoproteins 4.8% after 3.1 months of therapy. Ezetimibe as combination or monotherapy is a safe and effective treatment option for dyslipidemia in renal transplant recipients without changes in calcineurin inhibitor levels or renal function.",
"affiliations": "University of Utah Hospitals and Clinics, Renal Transplant Program, Salt Lake City, Utah, USA. christie.buchanan@vanderbilt.edu",
"authors": "Buchanan|C|C|;Smith|L|L|;Corbett|J|J|;Nelson|E|E|;Shihab|F|F|",
"chemical_list": "D000924:Anticholesteremic Agents; D001384:Azetidines; D007166:Immunosuppressive Agents; D000069438:Ezetimibe",
"country": "United States",
"delete": false,
"doi": "10.1111/j.1600-6143.2006.01263.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1600-6135",
"issue": "6(4)",
"journal": "American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons",
"keywords": null,
"medline_ta": "Am J Transplant",
"mesh_terms": "D000328:Adult; D000368:Aged; D000924:Anticholesteremic Agents; D001384:Azetidines; D000069438:Ezetimibe; D005260:Female; D006084:Graft Rejection; D006801:Humans; D006949:Hyperlipidemias; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "100968638",
"other_id": null,
"pages": "770-4",
"pmc": null,
"pmid": "16539634",
"pubdate": "2006-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "A retrospective analysis of ezetimibe treatment in renal transplant recipients.",
"title_normalized": "a retrospective analysis of ezetimibe treatment in renal transplant recipients"
} | [
{
"companynumb": "US-UCBSA-2015035920",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ATORVASTATIN CALCIUM"
},
"drugadditional": null,
... |
{
"abstract": "Bacteriophage therapy (BT) uses bacteriophages to treat pathogenic bacteria and is an emerging strategy against multidrug-resistant (MDR) infections. Experience in solid organ transplant is limited. We describe BT in 3 lung transplant recipients (LTR) with life-threatening MDR infections caused by Pseudomonas aeruginosa (n = 2) and Burkholderia dolosa (n = 1). For each patient, lytic bacteriophages were selected against their bacterial isolates. BT was administered for variable durations under emergency Investigational New Drug applications and with patient informed consent. Safety was assessed using clinical/laboratory parameters and observed clinical improvements described, as appropriate. All patients received concurrent antibiotics. Two ventilator-dependent LTR with large airway complications and refractory MDR P. aeruginosa pneumonia received BT. Both responded clinically and were discharged from the hospital off ventilator support. A third patient had recurrent B. dolosa infection following transplant. Following BT initiation, consolidative opacities improved and ventilator weaning was begun. However, infection relapsed on BT and the patient died. No BT-related adverse events were identified in the 3 cases. BT was well tolerated and associated with clinical improvement in LTRs with MDR bacterial infection not responsive to antibiotics alone. BT may be a viable adjunct to antibiotics for patients with MDR infections.",
"affiliations": "Division of Infectious Diseases and Global Public Health, University of California San Diego, La Jolla, California.;Department of Pulmonary and Critical Care Medicine, University of Pennsylvania, Philadelphia, Pennsylvania.;Department of Infectious Diseases, Cleveland Clinic Foundation, Cleveland, Ohio.;AmpliPhi Biosciences, San Diego, California.;AmpliPhi Biosciences, San Diego, California.;AmpliPhi Biosciences, San Diego, California.;AmpliPhi Biosciences, San Diego, California.;Adaptive Phage Therapeutics, Gaithersburg, Maryland.;Adaptive Phage Therapeutics, Gaithersburg, Maryland.;Adaptive Phage Therapeutics, Gaithersburg, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Naval Medical Research Center, Biological Defense Research Directorate, Fort Detrick, Maryland.;Division of Infectious Diseases and Global Public Health, University of California San Diego, La Jolla, California.;Division of Infectious Diseases and Global Public Health, University of California San Diego, La Jolla, California.;Division of Pulmonary, Critical Care & Sleep Medicine, University of California San Diego, La Jolla, California.;Department of Pulmonary Medicine, Cleveland Clinic Foundation, Cleveland, Ohio.;Division of Infectious Diseases, University of Pennsylvania, Philadelphia, Pennsylvania.;Division of Infectious Diseases and Global Public Health, University of California San Diego, La Jolla, California.;Division of Infectious Diseases and Global Public Health, University of California San Diego, La Jolla, California.",
"authors": "Aslam|Saima|S|0000-0002-4051-5629;Courtwright|Andrew M|AM|;Koval|Christine|C|;Lehman|Susan M|SM|;Morales|Sandra|S|;Furr|Carrie-Lynn Langlais|CL|;Rosas|Francisco|F|;Brownstein|Michael J|MJ|;Fackler|Joseph R|JR|;Sisson|Brittany M|BM|;Biswas|Biswajit|B|;Henry|Matthew|M|;Luu|Truong|T|;Bivens|Brittany N|BN|;Hamilton|Theron|T|;Duplessis|Christopher|C|;Logan|Cathy|C|;Law|Nancy|N|;Yung|Gordon|G|;Turowski|Jason|J|;Anesi|Judith|J|0000-0001-6671-4557;Strathdee|Steffanie A|SA|;Schooley|Robert T|RT|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "United States",
"delete": false,
"doi": "10.1111/ajt.15503",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1600-6135",
"issue": "19(9)",
"journal": "American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons",
"keywords": "antibiotic drug resistance; antibiotic: antibacterial; clinical research/practice; infection and infectious agents - bacterial; infectious disease; lung disease: infectious; lung transplantation/pulmonology; translational research/science",
"medline_ta": "Am J Transplant",
"mesh_terms": "D000328:Adult; D000368:Aged; D000900:Anti-Bacterial Agents; D001424:Bacterial Infections; D019117:Burkholderia; D024901:Drug Resistance, Multiple, Bacterial; D005260:Female; D006801:Humans; D008171:Lung Diseases; D016040:Lung Transplantation; D008297:Male; D008875:Middle Aged; D000071059:Phage Therapy; D011183:Postoperative Complications; D011550:Pseudomonas aeruginosa; D012141:Respiratory Tract Infections; D066027:Transplant Recipients",
"nlm_unique_id": "100968638",
"other_id": null,
"pages": "2631-2639",
"pmc": null,
"pmid": "31207123",
"pubdate": "2019-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013486:Research Support, U.S. Gov't, Non-P.H.S.",
"references": "11259194;12072444;15737753;17304462;19066813;19661847;19673983;19709344;20001604;20214609;21410851;23275867;24798268;25285538;25605867;26213462;26464447;26706614;28329182;28807909;28992111;29588855;29915895;30279396;30548546;30661974;31068712;31102236",
"title": "Early clinical experience of bacteriophage therapy in 3 lung transplant recipients.",
"title_normalized": "early clinical experience of bacteriophage therapy in 3 lung transplant recipients"
} | [
{
"companynumb": "US-009507513-1909USA005517",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "POSACONAZOLE"
},
"drugadditional": null,
... |
{
"abstract": "Embolia cutis medicamentosa, also known as Nicolau's syndrome, is a rare complication due to i.m. injections. Its real incidence is actually underestimated. Many drugs have been associated with it, but at the time only a few studies showed a related pathogenetic mechanism. Symptoms consist of immediate local pain, edema and cutaneous, subcutaneous and even muscular necrosis occurring in the first 48 h. The type of treatment depends mostly on time of diagnosis. A medical resolution can be achieved through heparin and cortisone injections within the first 48 h. Surgical debridement has to be considered as the main treatment in case of late diagnosis. We present three cases of Nicolau's syndrome presenting to us in a short period of time that we treated with surgical debridement.",
"affiliations": "Plastic and Reconstructive Surgery, Campus Bio-Medico di Roma University, Rome, Italy. g.marangi@unicampus.it",
"authors": "Marangi|Giovanni Francesco|GF|;Gigliofiorito|Pierluigi|P|;Toto|Vito|V|;Langella|Marika|M|;Pallara|Tiziano|T|;Persichetti|Paolo|P|",
"chemical_list": "D004008:Diclofenac; D020910:Ketorolac",
"country": "England",
"delete": false,
"doi": "10.1111/j.1346-8138.2010.00864.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0385-2407",
"issue": "37(5)",
"journal": "The Journal of dermatology",
"keywords": null,
"medline_ta": "J Dermatol",
"mesh_terms": "D000368:Aged; D004008:Diclofenac; D005218:Fat Necrosis; D005260:Female; D006801:Humans; D007273:Injections, Intramuscular; D020910:Ketorolac; D008875:Middle Aged; D009336:Necrosis; D012867:Skin; D013577:Syndrome",
"nlm_unique_id": "7600545",
"other_id": null,
"pages": "488-92",
"pmc": null,
"pmid": "20536657",
"pubdate": "2010-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Three cases of embolia cutis medicamentosa (Nicolau's syndrome).",
"title_normalized": "three cases of embolia cutis medicamentosa nicolau s syndrome"
} | [
{
"companynumb": "PHHY2010IT29967",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DICLOFENAC"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "Alendronate is commonly used in the treatment of osteoporosis and other bone diseases. Its drug profile includes many recognized side effects, and the literature includes case reports of esophageal irritation and ulceration. However, little has been published about laryngeal effects. We describe the case of a 77-year-old man who presented with hemoptysis secondary to laryngeal ulceration caused by the inadvertent misuse of alendronate. This case highlights the need for otolaryngologists to be familiar with alendronate and its side effects.",
"affiliations": "Department of Otolaryngology, St. Peter's University Hospital, New Brunswick, NJ, USA.",
"authors": "Hanna|John|J|;Bee|Joseph|J|;Sataloff|Robert T|RT|",
"chemical_list": "D050071:Bone Density Conservation Agents; D019386:Alendronate",
"country": "United States",
"delete": false,
"doi": "10.1177/014556131209101109",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0145-5613",
"issue": "91(11)",
"journal": "Ear, nose, & throat journal",
"keywords": null,
"medline_ta": "Ear Nose Throat J",
"mesh_terms": "D000368:Aged; D019386:Alendronate; D050071:Bone Density Conservation Agents; D062787:Drug Overdose; D006469:Hemoptysis; D006801:Humans; D007818:Laryngeal Diseases; D008297:Male; D010024:Osteoporosis; D014456:Ulcer",
"nlm_unique_id": "7701817",
"other_id": null,
"pages": "484-5",
"pmc": null,
"pmid": "23288794",
"pubdate": "2012-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Laryngeal ulceration and hemoptysis secondary to inadvertent alendronate overdose: case report and review of the literature.",
"title_normalized": "laryngeal ulceration and hemoptysis secondary to inadvertent alendronate overdose case report and review of the literature"
} | [
{
"companynumb": "PHHY2013US142532",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": null,
"drugadm... |
{
"abstract": "The combination of verapamil or diltiazem with beta-blockers should be avoided because of potentially profound adverse effects on AV (atrioventricular) nodal conduction, heart rate, or cardiac contractility. This effect is unpredictable but may be enhanced due to CYP2D6 poor metabolizer status which could be a special vulnerability factor.",
"affiliations": "Department of Clinical Pharmacology Aarhus University Hospital and Aarhus University Aarhus C Denmark.;Department of Forensic Medicine Aarhus University Aarhus N Denmark.;Department of Forensic Medicine Aarhus University Aarhus N Denmark.;Department of Forensic Medicine Aarhus University Aarhus N Denmark.",
"authors": "Saedder|Eva A|EA|https://orcid.org/0000-0003-4905-1004;Thomsen|Asser Hedegård|AH|;Hasselstrøm|Jørgen Bo|JB|;Jornil|Jakob Ross|JR|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.2393",
"fulltext": "\n==== Front\nClin Case RepClin Case Rep10.1002/(ISSN)2050-0904CCR3Clinical Case Reports2050-0904John Wiley and Sons Inc. Hoboken 10.1002/ccr3.2393CCR32393Case ReportCase ReportsHeart insufficiency after combination of verapamil and metoprolol: A fatal case report and literature review SAEDDER et al.Saedder Eva A. https://orcid.org/0000-0003-4905-1004\n1\nea@biomed.au.dk Thomsen Asser Hedegård \n2\nHasselstrøm Jørgen Bo \n2\nJornil Jakob Ross \n2\n\n1 \nDepartment of Clinical Pharmacology\nAarhus University Hospital and Aarhus University\nAarhus C\nDenmark\n\n2 \nDepartment of Forensic Medicine\nAarhus University\nAarhus N\nDenmark\n* Correspondence\n\nEva A. Saedder, Department of Clinical Pharmacology, Aarhus University Hospital and Aarhus University, Vennelyst Boulevard 4, 8000 Aarhus C, Denmark.\n\nEmail: ea@farm.au.dk\n19 9 2019 11 2019 7 11 10.1002/ccr3.v7.112042 2048 21 12 2018 18 7 2019 06 8 2019 © 2019 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Abstract\nThe combination of verapamil or diltiazem with beta‐blockers should be avoided because of potentially profound adverse effects on AV (atrioventricular) nodal conduction, heart rate, or cardiac contractility. This effect is unpredictable but may be enhanced due to CYP2D6 poor metabolizer status which could be a special vulnerability factor.\n\nThe combination of verapamil or diltiazem with beta‐blockers should be avoided because of potentially profound adverse effects on AV nodal conduction, heart rate, or cardiac contractility. This effect is unpredictable but may be enhanced due to CYP2D6 poor metabolizer status which could be a special vulnerability factor.\n\n\ncardiac insufficiencycardiovascular toxicologyCYP2D6drug‐drug interactionmetoprololverapamilDepartment of Forensic MedicineDepartment of Clinical Pharmacology source-schema-version-number2.0component-idccr32393cover-dateNovember 2019details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.7.2 mode:remove_FC converted:26.11.2019\n\n\nSaedder \nEA \n, \nThomsen \nAH \n, \nHasselstrøm \nJB \n, \nJornil \nJR \n. Heart insufficiency after combination of verapamil and metoprolol: A fatal case report and literature review . Clin Case Rep . 2019 ;7 :2042 –2048 . 10.1002/ccr3.2393\n==== Body\n1 INTRODUCTION\nIn selected patients, the combination of nondihydropyrimidine calcium channel blockers with beta‐blockers might provide an effect superior to either drug alone; however, serious and sometimes fatal additive cardiovascular effects occur. This report indicates that CYP2D6 PM status could be a special vulnerability factor for the combination of verapamil and metoprolol.\n\nCalcium channel blockers (CCB) are prescribed for the treatment of arrhythmia and hypertension. Verapamil is a class IV antidysrhythmic drug, which acts by blocking voltage‐sensitive calcium channels. Verapamil is rapidly absorbed and undergoes extensive first‐pass degradation (10%‐20% bioavailability), primarily via O‐ and N‐dealkylation by hepatic cytochrome P450 (CYP) 3A4 forming norverapamil, a pharmacologically active metabolite of verapamil. Verapamil and its metabolite have the ability to inhibit transmembrane calcium flux in cardiac cells and smooth muscle cells. Its pharmacological effects are reduction in heart rate and myocardial contractility, slow atrioventricular (A–V) node conduction, and reduction in the peripheral vascular resistance.1 Verapamil inhibit CYP3A4 and P‐glycoprotein–mediated drug transport, which may alter the intestinal absorption of several drugs and their distribution into peripheral tissues and the central nervous system.1 During overdose, half‐life of verapamil may be greatly prolonged (up to 10 days); this may be due to saturation of the hepatic enzyme or rate‐limiting absorption.2\n\n\nBeta‐adrenergic blockers (BB) are used in the treatment of hypertension and heart failure. Metoprolol is a selective b1‐adrenergic blocking agent, and it is lipophilic and predominately metabolized in the liver via cytochrome CYP2D6. Blockade of the myocardial b1 receptor reduces heart rate, myocardial contractility, and cardiac output.3 Dizziness, bradycardia, and hypotension are observed as adverse reactions at therapeutic plasma levels.\n\nStudies from the 1980s suggested that in selected patients, the combination of nondihydropyrimidine CCBs like verapamil with BBs like metoprolol might provide an effect superior to either drug alone; however, many studies and case reports have provided data that confirm serious and sometimes fatal additive cardiovascular effects. Here we report a fatal case of heart insufficiency after the combination of verapamil and metoprolol and supply with an overview of the available literature.\n\n2 CASE REPORT\nA 76‐year‐old woman who was suffering from persistent atrial fibrillation, atrial hypertension, and chronic obstructive lung disease and who had previously been in treatment for ovarian cancer, colon cancer, and breast cancer was hospitalized due to an INR (international normalized ratio) above 9.0. At the time of hospitalization, she was in treatment with verapamil 120 mg daily and warfarin for persistent atrial fibrillation. A complete list of medicine at the time of hospitalization is available in Table 1.\n\nTable 1 List of medicine at the time of hospitalization\n\nDrug\tDose\tTimes daily\tIndication\t\nVerapamil\t120 mg\t1\tAtrial fibrillation\t\nWarfarin\t \t \tAtrial fibrillation\t\nPantoprazole\t40 mg\t1\tHeartburn\t\nPotassium\t40 mL\t1\tHypokalaemia\t\nLosartan/Thiazide\t100 + 25\t1\tAtrial hypertension\t\nFurosemide\t40 mg\t1\t \t\nPregabalin\t75 mg\t2\t \t\nZopiclone\t7.5 mg\tPrn, max × 1\tInsomnia\t\nSalbutamol\t0.2 mg\tprn\tCOPD\t\nFluticasone/Salmeterol\t50 + 500 µg\t2\tCOPD\t\nTiotropium\t5 mg\t1\tCOPD\t\nPovidone\t \t \t \t\nParacetamol\t1000 mg\t4\tPain\t\nFluconazole\t100 mg\t1\tFungal infection\t\nTramadol\t50 mg\t3\tPain\t\nPenicillin\t1.5 mi.e\t \tCystitis\t\nJohn Wiley & Sons, LtdThe patient had recently had a gastroscopy revealing a fungal infection and a high level of gastric acid. Her family physician therefore initiated a treatment with a short course of fluconazole and pantoprazole. After 2 days of treatment with fluconazole, her physician measured an INR of 5.6. After a control visit 2 days later, the INR had increased to eight and the patient was hospitalized.\n\nAt the time of hospitalization, her heart rate was 96 bpm. During the evening on the third day of hospitalization, an electrocardiogram (ECG) showed atrial fibrillation and a junior physician prescribed Selo‐zok® (metoprolol), 50 mg slow‐release tablet. According to the latest guideline from the European Society of Cardiology, a patient in need of acute rhythm control can have digoxin added to the treatment with verapamil, if the patient has a left ventricular ejection fraction of above 40 and the heart rate is above 110 bpm.4 The patient was not known with previous heart failure or reduced ventricular ejection fraction, and a suspicion of heart failure was not mentioned in the hospital records at this time. The next morning an experienced doctor discontinued metoprolol during the morning rounds, as she was aware of a potential interaction between metoprolol and verapamil. The patient was well and had no signs of acute illnesses. Only one tablet of metoprolol 50 mg had been administered to the patient. After lunch on the same day, the patient developed bradycardia and hypotension and infusion with isoprenaline was initiated (see Table 2 for details). An interaction between verapamil and metoprolol was suspected. The condition progressed and despite of isoprenaline, atropine, and external pacing, her blood pressure was immeasurable and her heart rate decreased (Figure 1).\n\nTable 2 A time schedule of events\n\nDay\tTime\tEvent\t\n1\t22:07\tPrescribed metoprolol 50 mg\t\n2\t09:35\tDiscontinued metoprolol after only 1 dose of 50 mg given on the night before\t\n \t15:23\tHypotension and low pulse (frequency of 30)\t\n \t \tIsoprenaline infusion 20‐60 mL/h\t\n \t15:36\tIntensive care due to cyanosis and no measureable pulse\t\n \t17:22\tIsoprenaline infusion 60 mL/h. Pulse 30. Decreased consciousness. No effect of atropine.\t\n \t18:15\tIntubation and mechanical respiration. Hypotensive, systolic blood pressure 90. pH 7.1. Transfer to other hospital planned.\t\n \t18:30\tDuring transportation: unconscious, cold, frequence on scope 20‐25, no palpable pulse, severely reduced ejection fraction, some effect of adrenalin 50 µg refracted doses, external pacing.\t\n \t18:45\tArrived at other hospital. Cold and cyanosis. Dilated pupils, infusion of dopamine 10 µg/kg/min. Adrenaline. No response on heart function.\t\n \t19:30\tThe patient dies.\t\nJohn Wiley & Sons, LtdFigure 1 The development in heart rate from day 1 to day 4, where the patient dies\n\nShe was transferred to another hospital for the insertion of a temporary pace wire. On arrival at the second hospital, the patient was completely unresponsive, she had been intubated in the ambulance and her pulse had decreased to ten beats per minute. Blood analysis showed serious metabolic acidosis. Further treatment was considered futile, and the patient was declared dead at 19.30 on the third day of hospitalization. A medicolegal autopsy was performed, and a standard forensic toxicological analysis was performed on blood withdrawn from the femoral vein at autopsy shortly after her death, see Table 3 for the blood concentrations of drugs. The autopsy showed right atrial dilatation, but otherwise normal right and left ventricles, normal heart valves, and no signs of acute coronary syndrome, and the liver was normal.\n\nTable 3 Concentration of drugs found in postmortem femoral blood\n\nDrug\tConcentration\t\nAtropine\t0.036 mg/kg\t\nFentanyl\t0.00080 mg/kg\t\nFluconazole\t9.1 mg/kg\t\nFurosemide\t1.3 mg/kg\t\nKetamine\t0.060 mg/kg\t\nLidocaine\t0.011 mg/kg\t\nLosartan\t0.032 mg/kg\t\nMetoprolol\t0.50 mg/kg\t\nMidazolam\t0.0082 mg/kg\t\nMorphine\t0.13 mg/kg\t\nOxycodone\t0.10 mg/kg\t\nParacetamol (acetaminophen)\t26 mg/kg\t\nPregabalin\t3.7 mg/kg\t\nSalbutamol\t0.0011 mg/kg\t\nTramadol\t0.038 mg/kg\t\nTramadol, O‐desmethyl\t0.0025 mg/kg\t\nTramadol, N‐desmethyl\t0.14 mg/kg\t\nVerapamil\t0.24 mg/kg\t\nWarfarin\t0.15 mg/kg\t\nZopiclone\t0.062 mg/kg\t\nJohn Wiley & Sons, Ltd3 DISCUSSION\nMost importantly, the toxicological analysis revealed a whole blood concentration of metoprolol of 0.50 mg/kg and verapamil of 0.24 mg/kg.\n\nMorphine, oxycodone, and fentanyl were not assessed to be of importance due to supportive treatment with respirator. Other drugs were found at levels normally seen in treatment or below.\n\nKnown therapeutic whole blood concentration ranges of verapamil are 0.015‐0.19 mg/kg and of metoprolol are 0.039‐0.55 mg/kg 5 (recalculated from plasma values using blood/plasma ratio 1.1 for metoprolol and 0.75 for verapamil 6). Known metoprolol whole blood concentrations from drug‐induced fatalities average 60 mg/kg (range 4.7‐142) and verapamil concentrations average 11 mg/kg (range 0.9‐85).6 In this case, one single tablet of metoprolol 50 mg was administered, and the blood concentration of metoprolol was found to be in the high end of the therapeutic concentration range almost 24 hours later, despite of an elimination half‐life of metoprolol slow‐release tablets of 3‐4 hours. Postmortem redistribution might have caused an increase in concentrations; however, the patient died from a serious cardiac insufficiency, which points in the direction of an interaction between metoprolol and verapamil.\n\nThe efficacy and safety data supporting the use of CCBs and BBs primarily comes from monotherapy, and clinical studies on the combined use mainly concern the treatment of angina pectoris in patients with chronic coronary heart disease.7, 8, 9 Worsening of myocardial function, such as hypotension, bradycardia, and AV block, might be expected to occur more often with combination therapy rather than therapy with either drug alone.7, 10 Some authors found that cardiac risk increases by left ventricular dysfunction, aortic stenosis, low‐pulse rate, or large doses of either drug 10, 11, 12, 13, 14; however, other authors describe cases in which the ventricular function was normal or near normal and incidents have often occurred at normal doses of both drugs (Table 4).15\n\n\nTable 4 Published case reports\n\nReference\tAge (y)\tGender\tDose (mg/d)\tSerum/blood level (mg/kg)\tSymptoms\tTreatment\t\nMills TA 200435\n\t61\tF\t\nVerapamil 360\n\nPropranolol 40\n\t \t\nSinus bradycardi (26/min)\n\nJunctional escape rhythm\n\tCessation of treatment\t\n58\tF\t\nAtenolol 100\n\nDiltiazem 360\n\t \t\nHypotension (87/45)\n\nAtrial bradycardia (12/min)\n\nJunctional escape rhythm\n\tAtropine, temporary pacing\t\n62\tF\t\nDiltiazem 240\n\nEnalapril\n\t \t\nSinus bradycardia (31/min)\n\nJunctional escape rhythm\n\tCessation of treatment\t\n73\tF\t\nDiltiazem 120\n\nAtenolol 25\n\t \t\nSinus arrest\n\nJunctional escape rhythm\n\tAtropine, dopamine, external pacing\t\n73\tF\t\nMetoprolol 50\n\nDiltiazem 180\n\t \t\nSinus bradycardia (34/min)\n\nJunctional escape rhythm\n\tStopped treatment\t\n61\tM\t\nNadolol 40\n\nDiltiazem 300\n\t \t\nSinus arrest\n\nJunctional escape rhythm\n\tAtropine, temporary pacemaker\t\n62\tM\t\nVerapamil 360\n\nAtenolol 25\n\t \tSinus bradycardia (54/min)\t\nCessation of treatment\n\nComplicated by chronic kidney disease and hemodialysis\n\t\n73\tF\t\nVerapamil 480\n\nMetoprolol 200\n\t \t\nHypotension (98/64)\n\nSinus bradycardia (39/min)\n\nJunctional escape rhythm\n\tCessation of treatment\t\n60\tM\t\nMetoprolol 150\n\nAmlodipine 20\n\t \tNo symptoms, sinus pause revealed by holter\tMetoprolol stopped\t\nSakurai H 200024\n\t54\tM\t\nVerapamil 360\n\nMetoprolol 200\n\t \t\nShock, Pulmonary edema, bradycardia (56/min)\n\nJunctional escape rhythm\n\tDopamine, furosemide\t\n69\tF\t\nVerapamil 240\n\nMetoprolol 100\n\t \tShock, pulmonary congestion, sinus bradycardia (44/min)\tIsoprenaline\t\n60\tF\t\nVerapamil 160\n\nPindolol 10\n\t \tHypotension, sinus bradycardia (40/min)\tCessation of treatment\t\n53\tM\t\nVerapamil 480\n\nPropranolol 160\n\t \tHypotension, bradycardia (32/min), AV nodal rhythm\tIsoproterenol, dopamine\t\n55\tF\t\nVerapamil 80\n\nPropranolol 80\n\t \tHypotension, bradycardia\tEpinephrine\t\n21\tF\t\nVerapamil NA\n\nAtenolol NA\n\t\n0.367\n\n0.65\n\tShock, bradycardia, AV nodal rhythm\tCalcium chloride\t\n42\tM\t\nVerapamil 120\n\nAtenolol 50\n\t \tShock, sinus arrest\tDopamine, temporary pacing\t\n57\tF\t\nVerapamil NA\n\nAtenolol NA\n\t\n0.45\n\n1.7\n\tShock, complete heart block\t\nDopamine, dobutamine, noradrenaline, temporary pacing, intraaortic balloon\n\t\n78\tF\t\nVerapamil 240\n\nMetoprolol 100\n\t \tShock, complete heart block\tCalcium gluconate\t\n72\tF\t\nVerapamil 160\n\nAtenolol 50\n\t \tShock, pulmonary congestion, electromechanical dissociation\tCalcium chloride\t\nRobson RH 198236\n\t60\tM\t\nNifedipine 60\n\nAtenolol 100\n\t \tCongestive heart failure\tCessation of treatment\t\nStaffurth JS 198120\n\t47\tM\t\nNifedipine 30\n\nPropranolol 640\n\t \tHypotension (unrecordable), pulse rate 48/min\tCessation of treatment\t\nEisenberg JNH 198423\n\t46\tM\t\nVerapamil 240\n\nMetoprolol 200\n\t \tBradycardia (44/min), Wenckebach AV block\tCessation of verapamil\t\nAnastassiades CJ 198022\n\t72\tM\t\nNifedipine 400\n\nAlprenolol 30\n\t \tDyspnoea, pulmonary edema\tCessation of nifedipine\t\n58\tM\t\nNifedipine 30\n\nPropranolol 120\n\t \tDyspnoea, edema of the legs, congestive heart failure\tCessation of treatment\t\nJohn Wiley & Sons, LtdThat the combined use of CCBs and BBs may cause adverse cardiovascular effects was seen in the clinical trials investigating combined use, and it has been clinically documented (Table 4).7, 12, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 The precise nature of the mechanism is uncertain, and it may be due to the combination of a number of actions, both pharmacokinetic and pharmacodynamic.\n\nAn existing interaction between metoprolol and verapamil is well documented. Verapamil has been shown to affect the clearance of the lipophilic BBs, propranolol, and metoprolol (both metabolized in the liver), but to have no effect on the pharmacokinetics of atenolol, a hydrophilic compound excreted unchanged in the urine.11, 25, 26, 27 McCourty et al investigated the effect of verapamil on the pharmacokinetics and pharmacodynamics of propranolol in six patients and found an increase in the area under the curve (AUC) of propranolol, that however, did not reach statistical significance.11 The six patients received the same doses, but AUC of propranolol differed statistically significantly between the subjects. One patient was withdrawn from the study as his ECG showed atrioventricular dissociation with a ventricular rate of 37 bpm. His AUC is not presented in the paper. Concomitant administration of metoprolol with verapamil produced a significant increase in peak plasma concentration and in the AUC of metoprolol by 85%, respectively 35%.25, 26 Keech et al investigated the pharmacokinetic interaction between metoprolol and verapamil in nine patients.26 One patient collapsed with profound sinus bradycardia and hypotension.\n\nThe inhibitory effects of six CCBs, including verapamil and diltiazem, on three major CYP isoenzymes, CYP2C9, CYP2D6, and CYP3A4, were examined in liver microsomes.27 All six compounds reversibly inhibited CYP2D6, CYP2C9, and with increasing potency, CYP3A4.\n\nFour metabolizer phenotypes characterize drug metabolism via CYP2D6 in vivo: ultrarapid metabolizer (UM), extensive metabolizer (EM), intermediate metabolizer (IM), and poor metabolizer (PM).28 Based on the genotype involved, the plasma concentration of metoprolol may range from subtherapeutic levels in the UM group to supratherapeutic and potentially toxic concentrations in the PM group, increasing the probability of adverse effects such as hypotension and bradycardia.29 A systematic review from 2013 found differences in peak plasma metoprolol concentration, AUC, elimination half‐life, and apparent oral clearance that were 2.3‐, 4.9‐, 2.3‐, and 5.9‐fold between EM and PM, respectively and 5.3‐, 13‐, 2.6‐, and 15‐fold between UM and PM (all P < .001), respectively.30\n\n\nThe ratio between tramadol (TRA) and the metabolite O‐desmethyltramadol (ODT) can for living individuals be used to estimate an individual's CYP2D6 phenotype.31 In a postmortem setting, the ratio has been used to estimate an individual's CYP2D6 genotype.32, 33 A TRA/ODT ratio above 15‐30 indicates CYP2D6 PM genotype. In this case, the TRA/ODT ratio was 15 indicating CYP2D6 PM genotype. The ratio TRA/ODT is not that specific in predicting CYP2D6 PM phenotype, but Fonseca et al found that a ratio between N‐desmethyltramadol (NDT) and ODT above seven was a more predictive ratio for CYP2D6 PM genotype.33 In this case, NDT/ODT = 56 gives a strong indication of our patient being CYP2D6 PM genotype.\n\nAnother possible interaction caused by verapamil could occur via inhibition of organic cation transporter OCT1 which would cause a reduced uptake of metoprolol into the hepatocytes, and thus, a decrease in metabolism.34 This means that individuals with CYP2D6 PM status who receive a combination of verapamil and metoprolol would be especially in risk of attaining high metoprolol concentrations and also have a slow elimination of metoprolol.\n\nIn the above case, a junior MD ordered one single tablet of metoprolol 50 mg, and for some reason, the blood concentration of metoprolol was much higher than expected almost 24 hours later. Even though postmortem redistribution might have caused an increase in concentrations, the patient died from a serious cardiac insufficiency, which points in the direction of an interaction between metoprolol and verapamil. This interaction might have been strong due to CYP2D6 PM status which could be a special vulnerability factor for the combination of verapamil and metoprolol.\n\nCONFLICT OF INTEREST\nNone declared.\n\nAUTHORS CONTRIBUTIONS\nEva A. Sædder: was responsible for writing the manuscript and for medical interpretation of blood samples and toxicology (first author). Asser Hedegård Thomsen: was the responsible forensic pathologist and performed the autopsy. Jørgen Bo Hasselstrøm: was responsible for the laboratory tests performed. Jakob Ross Jornil: was the responsible analytical chemist in the case. All authors: read, contributed to, and approved the final manuscript.\n==== Refs\nREFERENCES\n1 \n\nAbernethy \nDR \n, \nSchwartz \nJB \n. Calcium‐antagonist drugs . N Engl J Med . 1999 ;341 (19 ):1447 ‐1457 .10547409 \n2 \n\nBuckley \nCD \n, \nAronson \nJK \n. Prolonged half‐life of verapamil in a case of overdose: implications for therapy . Br J Clin Pharmacol . 1995 ;39 (6 ):680 ‐683 .7654488 \n3 \n\nAdams \nBD \n, \nBrowne \nWT \n. Amlodipine overdose causes prolonged calcium channel blocker toxicity . Am J Emerg Med . 1998 ;16 (5 ):527 ‐528 .9725975 \n4 \nCardiology ESo \n.2016 ESC Guidelines for the management of atrial fibrillation 2016 [cited 2018 23.07]. Available from: https://academic.oup.com/eurheartj/article/37/38/2893/2334964#110288881. Accessed July 23, 2018.\n5 \n\nSchulz \nM \n, \nIwersen‐Bergmann \nS \n, \nAndresen \nH \n, \nSchmoldt \nA \n. Therapeutic and toxic blood concentrations of nearly 1,000 drugs and other xenobiotics . Crit Care . 2012 ;16 (4 ):R136 .22835221 \n6 \n\nBaselt \nRC \n. Disposition of toxic drugs and chemicals in man (10 th edn). Seal Beach, California : Biomedical Publications ; 2014 .\n7 \n\nStrauss \nWE \n, \nParisi \nAF \n. Combined use of calcium‐channel and beta‐adrenergic blockers for the treatment of chronic stable angina. Rationale, efficacy, and adverse effects . Ann Intern Med . 1988 ;109 (7 ):570 ‐581 .2901816 \n8 \n\nVanhaleweyk \nGL \n, \nSerruys \nPW \n, \nHugenholtz \nPG \n. Anti‐anginal, electrophysiologic and hemodynamic effects of combined beta‐blocker/calcium antagonist therapy . Eur Heart J . 1983 ;4 :117 ‐128 .\n9 \n\nFox \nKM \n, \nJonathan \nA \n, \nSelwyn \nAP \n. The use of propranolol and nifedipine in the medical management of angina pectoris . Clin Cardiol . 1981 ;4 (3 ):125 ‐129 .7261486 \n10 \n\nPacker \nM \n, \nLeon \nMB \n, \nBonow \nRO \n, \nKieval \nJ \n, \nRosing \nDR \n, \nSubramanian \nVB \n. Hemodynamic and clinical effects of combined verapamil and propranolol therapy in angina pectoris . Am J Cardiol . 1982 ;50 (4 ):903 ‐912 .6751066 \n11 \n\nMcCourty \nJC \n, \nSilas \nJH \n, \nTucker \nGT \n, \nLennard \nMS \n. The effect of combined therapy on the pharmacokinetics and pharmacodynamics of verapamil and propranolol in patients with angina pectoris . Br J Clin Pharmacol . 1988 ;25 (3 ):349 ‐357 .3358897 \n12 \n\nZatuchni \nJ \n. Bradycardia and hypotension after propranolol HCl and verapamil . Heart Lung . 1985 ;14 (1 ):94 ‐95 .3844011 \n13 \n\nWinniford \nMD \n, \nFulton \nKL \n, \nHillis \nLD \n. Symptomatic sinus bradycardia during concomitant propranolol‐verapamil administration . Am Heart J . 1985 ;110 (2 ):498 .4025131 \n14 \n\nde Buitleir \nM \n, \nRowland \nE \n, \nKrikler \nDM \n. Hemodynamic effects of nifedipine given alone and in combination with atenolol in patients with impaired left ventricular function . The American journal of cardiology . 1985 ;55 (12 ):15e ‐20e .\n15 \n\nWayne \nVS \n, \nHarper \nRW \n, \nLaufer \nE \n, \nFederman \nJ \n, \nAnderson \nST \n, \nPitt \nA \n. Adverse interaction between beta‐adrenergic blocking drugs and verapamil–report of three cases . Aust N Z J Med . 1982 ;12 (4 ):285 ‐289 .6127992 \n16 \n\nWayne \nVS \n. Interaction of calcium channel and beta‐adrenergic blocking agents . J Am Coll Cardiol . 1983 ;2 (3 ):594 ‐595 .6135726 \n17 \n\nHenry \nM \n, \nKay \nMM \n, \nViccellio \nP \n. Cardiogenic shock associated with calcium‐channel and beta blockers: reversal with intravenous calcium chloride . Am J Emerg Med . 1985 ;3 (4 ):334 ‐336 .2860911 \n18 \n\nLee \nDW \n, \nCohan \nB \n. Refractory cardiogenic shock and complete heart block after verapamil SR and metoprolol treatment . A case report. Angiology . 1995 ;46 (6 ):517 ‐519 .7785794 \n19 \n\nHoward \nDC \nJr\n. Glucagon for reaction to combined calcium channel blocker and beta‐blocker use . J Emerg Nurs . 1996 ;22 (3 ):173 ‐175 .8949216 \n20 \n\nStaffurth \nJS \n, \nEmery \nP \n. Adverse interaction between nifedipine and beta‐blockade . BMJ . 1981 ;282 (6259 ):225 .\n21 \n\nLee \nTH \n, \nSalomon \nDR \n, \nRayment \nCM \n, \nAntman \nEM \n. Hypotension and sinus arrest with exercise‐induced hyperkalemia and combined verapamil/propranolol therapy . Am J Med . 1986 ;80 (6 ):1203 ‐1204 .3728515 \n22 \n\nAnastassiades \nCJ \n. Nifedipine and beta‐blocker drugs . Br Med J . 1980 ;281 (6250 ):1251 ‐1252 .\n23 \n\nEisenberg \nJN \n, \nOakley \nGD \n. Probable adverse interaction between oral metoprolol and verapamil . Postgrad Med J . 1984 ;60 (708 ):705 ‐706 .6494097 \n24 \n\nSakurai \nH \n, \nKei \nM \n, \nMatsubara \nK \n, et al. Cardiogenic shock triggered by verapamil and atenolol: a case report of therapeutic experience with intravenous calcium . Jpn Circ J . 2000 ;64 (11 ):893 ‐896 .11110438 \n25 \n\nMcLean \nAJ \n, \nKnight \nR \n, \nHarrison \nPM \n, \nHarper \nRW \n. Clearance‐based oral drug interaction between verapamil and metoprolol and comparison with atenolol . The American journal of cardiology . 1985 ;55 (13 Pt 1 ):1628 ‐1629 .4003307 \n26 \n\nKeech \nAC \n, \nHarper \nRW \n, \nHarrison \nPM \n, \nPitt \nA \n, \nMcLean \nAJ \n. Pharmacokinetic interaction between oral metoprolol and verapamil for angina pectoris . Am J Cardiol . 1986 ;58 (6 ):551 ‐552 .3529913 \n27 \n\nMa \nB \n, \nPrueksaritanont \nT \n, \nLin \nJH \n. Drug interactions with calcium channel blockers: possible involvement of metabolite‐intermediate complexation with CYP3A . Drug metab Dispos . 2000 ;28 (2 ):125 ‐130 .10640508 \n28 \n\nZanger \nUM \n, \nRaimundo \nS \n, \nEichelbaum \nM \n. Cytochrome P450 2D6: overview and update on pharmacology, genetics, biochemistry . Naunyn Schmiedebergs Arch Pharmacol . 2004 ;369 (1 ):23 ‐37 .14618296 \n29 \n\nRau \nT \n, \nWuttke \nH \n, \nMichels \nLM \n, et al. Impact of the CYP2D6 genotype on the clinical effects of metoprolol: a prospective longitudinal study . Clin Pharmacol Ther . 2009 ;85 (3 ):269 ‐272 .19037197 \n30 \n\nBlake \nCM \n, \nKharasch \nED \n, \nSchwab \nM \n, \nNagele \nP \n. A meta‐analysis of CYP2D6 metabolizer phenotype and metoprolol pharmacokinetics . Clin Pharmacol Ther . 2013 ;94 (3 ):394 ‐399 .23665868 \n31 \n\nPedersen \nRS \n, \nDamkier \nP \n, \nBrosen \nK \n. Tramadol as a new probe for cytochrome P450 2D6 phenotyping: a population study . Clin Pharmacol Ther . 2005 ;77 (6 ):458 ‐467 .15961977 \n32 \n\nLevo \nA \n, \nKoski \nA \n, \nOjanpera \nI \n, \nVuori \nE \n, \nSajantila \nA \n. Post‐mortem SNP analysis of CYP2D6 gene reveals correlation between genotype and opioid drug (tramadol) metabolite ratios in blood . Forensic Sci Int . 2003 ;135 (1 ):9 ‐15 .12893130 \n33 \n\nFonseca \nS \n, \nAmorim \nA \n, \nCosta \nHA \n, et al. Sequencing CYP2D6 for the detection of poor‐metabolizers in post‐mortem blood samples with tramadol . Forensic Sci Int . 2016 ;265 :153 ‐159 .26926096 \n34 \n\nBoxberger \nKH \n, \nHagenbuch \nB \n, \nLampe \nJN \n. Common drugs inhibit human organic cation transporter 1 (OCT1)‐mediated neurotransmitter uptake . Drug metab Dispos . 2014 ;42 (6 ):990 ‐995 .24688079 \n35 \n\nMills \nTA \n, \nKawji \nMM \n, \nCataldo \nVD \n, et al. Profound sinus bradycardia due to diltiazem, verapamil, and/or beta-adrenergic blocking drugs . J La State Med Soc . 2004 ;156 (6 ):327 –31 .15688675 \n36 \n\nRobson \nRH \n, \nVishwanath \nMC \n. Nifedipine and beta-blockade as a cause of cardiac failure . British medical journal (Clinical research ed) . 1982 ;284 (6309 ):104 .6797645\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-0904",
"issue": "7(11)",
"journal": "Clinical case reports",
"keywords": "CYP2D6; cardiac insufficiency; cardiovascular toxicology; drug‐drug interaction; metoprolol; verapamil",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "2042-2048",
"pmc": null,
"pmid": "31788248",
"pubdate": "2019-11",
"publication_types": "D002363:Case Reports",
"references": "3529913;2901816;6107167;24688079;7261486;11110438;4003284;4003307;3844011;19037197;10547409;15961977;3358897;6779963;6127992;3728515;22835221;7654488;6137370;8949216;14618296;6135726;26926096;4025131;6751066;12893130;6797645;15688675;23665868;6494097;7785794;9725975;2860911;10640508",
"title": "Heart insufficiency after combination of verapamil and metoprolol: A fatal case report and literature review.",
"title_normalized": "heart insufficiency after combination of verapamil and metoprolol a fatal case report and literature review"
} | [
{
"companynumb": "DK-BRISTOL-MYERS SQUIBB COMPANY-BMS-2019-121589",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PANTOPRAZOLE"
},
"druga... |
{
"abstract": "OBJECTIVE\nOur objective was to determine the safety, efficacy, and pharmacokinetics of telaprevir plus pegylated interferon alfa 2a and ribavirin for chronic, posttransplant genotype 1 hepatitis C virus infection.\n\n\nMETHODS\nA prospective, single-arm, multicenter, open-label, phase 2b study was conducted at 22 North American sites to assess the safety, efficacy, and pharmacokinetics of pegylated interferon alfa 2a, ribavirin, and twice daily telaprevir in liver transplant recipients with recurrent, chronic hepatitis C without cirrhosis. Baseline liver biopsies were read by a central pathologist. There were planned safety reviews after a sentinel cohort reached treatment weeks 4 and 16. Serial pharmacokinetic sampling was performed for calcineurin inhibitors, telaprevir, and ribavirin.\n\n\nRESULTS\nSixty-one patients were enrolled and received ≥ 1 dose of study medication; 37 (61%) achieved sustained virologic response. Thirteen of 18 treatment-naive patients (72%), 10 of 11 patients with no or minimal fibrosis (91%), 13 of 15 patients (87%) with interleukin 28B genotype CC, and 36 of 45 patients (80%) with either undetectable or unquantifiable hepatitis C virus RNA at treatment week 4 achieved sustained virologic response. Nine patients (15%) had ≥ 1 drug-related serious adverse event and 7 (11%) discontinued all study drugs due to an adverse event. There were no deaths or acute cellular rejection episodes. During telaprevir treatment, median doses of tacrolimus and cyclosporine were 0.5 mg weekly and 25 mg daily. Target exposures were achieved for telaprevir with twice daily dosing and for ribavirin with reduced initial dosing.\n\n\nCONCLUSIONS\nTelaprevir combination therapy for posttransplant hepatitis C virus infection yielded superior efficacy than historical controls. Adverse events were similar to, but exceeded, those in immunocompetent patients. Calcineurin inhibitor dosing levels were substantially reduced with telaprevir.",
"affiliations": "From the Piedmont Transplant Institute, Piedmont Hospital, Atlanta, Georgia, USA.",
"authors": "Rubin|Raymond A|RA|;Russo|Mark W|MW|;Brown|Kimberly A|KA|;Fontana|Robert J|RJ|;Levitsky|Josh|J|;Vargas|Hugo|H|;Yoshida|Eric M|EM|;Brown|Robert S|RS|",
"chemical_list": "D000998:Antiviral Agents; D065095:Calcineurin Inhibitors; D007166:Immunosuppressive Agents; D016898:Interferon-alpha; D009842:Oligopeptides; D012367:RNA, Viral; D011994:Recombinant Proteins; D011092:Polyethylene Glycols; D012254:Ribavirin; C486464:telaprevir; C100416:peginterferon alfa-2a",
"country": "Turkey",
"delete": false,
"doi": "10.6002/ect.2016.0251",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1304-0855",
"issue": "16(2)",
"journal": "Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation",
"keywords": null,
"medline_ta": "Exp Clin Transplant",
"mesh_terms": "D000328:Adult; D000368:Aged; D000998:Antiviral Agents; D065095:Calcineurin Inhibitors; D004334:Drug Administration Schedule; D004347:Drug Interactions; D004359:Drug Therapy, Combination; D005260:Female; D005838:Genotype; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D007166:Immunosuppressive Agents; D016898:Interferon-alpha; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D009656:North America; D009842:Oligopeptides; D010641:Phenotype; D011092:Polyethylene Glycols; D011446:Prospective Studies; D012367:RNA, Viral; D011994:Recombinant Proteins; D012254:Ribavirin; D000072230:Sustained Virologic Response; D016896:Treatment Outcome",
"nlm_unique_id": "101207333",
"other_id": null,
"pages": "182-190",
"pmc": null,
"pmid": "27855589",
"pubdate": "2018-04",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Twice-Daily Telaprevir for Posttransplant Genotype 1 Hepatitis C Virus: A Prospective Safety, Efficacy, and Pharmacokinetics Study.",
"title_normalized": "twice daily telaprevir for posttransplant genotype 1 hepatitis c virus a prospective safety efficacy and pharmacokinetics study"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2018SP008667",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PEGINTERFERON ALFA-2A"
},
"dru... |
{
"abstract": "Cryptosporidial diarrhea is uncommon in immunocompetent individuals, more often seen in severely immunocompromised patients. Severe refractory cases have been described in patients with HIV/AIDS before the advent of modern antiretroviral therapy due to an inability to mount an adequate cellular immune response. We describe an 85-year-old patient post-chimeric antigen receptor T-cell therapy relapsed lymphoma who developed refractory Cryptosporidium spp. diarrhea in the setting of persistent CD4+ cytopenia. Despite receiving multiple antiparasitic agents, including failure of a prolonged course of nitazoxanide, the patient experienced persistent symptoms for 9 months with repeatedly positivity stool Cryptosporidium spp. direct fluorescent antibody (DFA) test. We highlight this case of refractory Cryptosporidium spp. and the importance of recognizing the pathogen in a non-HIV-infected immunosuppressed host.",
"affiliations": "Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.;Division of Infectious Diseases, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.;Division of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.;Department of Medical Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.;Division of Hematology and Hematologic Malignancies, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.;Division of Infectious Diseases, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts.",
"authors": "Trottier|Caitlin A|CA|;Yen|Christina F|CF|;Malvar|Grace|G|;Arnason|Jon|J|;Avigan|David E|DE|;Alonso|Carolyn D|CD|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-9637",
"issue": null,
"journal": "The American journal of tropical medicine and hygiene",
"keywords": null,
"medline_ta": "Am J Trop Med Hyg",
"mesh_terms": null,
"nlm_unique_id": "0370507",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34237021",
"pubdate": "2021-07-08",
"publication_types": "D016428:Journal Article",
"references": "32888407;33625354;31648294;26495859;28925994;29226797;27207799;30139372;27166358;29800121;29038338;30003818;31959992;17967863;1889046;10632386;32759935",
"title": "Case Report: Refractory Cryptosporidiosis after CAR T-Cell Therapy for Lymphoma.",
"title_normalized": "case report refractory cryptosporidiosis after car t cell therapy for lymphoma"
} | [
{
"companynumb": "US-drreddys-LIT/USA/22/0151273",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN HYDROCHLORIDE"
},
"drugaddit... |
{
"abstract": "We report two cases of patients with relapsing-remitting multiple sclerosis with early-onset thrombocytopenia and autoimmune thyroid disease after the first treatment course with 60-mg alemtuzumab.\n\n\n\nCase series and review of the literature.\n\n\n\nBoth patients showed severe thrombocytopenia with platelet counts of 2 × 10(9) and 11 × 10(9)/L, respectively, as well as increased thyroid antibodies within only a few months after initiating alemtuzumab treatment (11 and 9 months). Both patients responded considerably well to medical therapy including corticosteroids and intravenous immunoglobulins with slow platelet recovery over several weeks. Interestingly, both patients were previously treated with fingolimod and showed a marked lymphocytopenia that led to discontinuation.\n\n\n\nThese cases emphasize the necessity of careful clinical surveillance and proper education of patients treated with alemtuzumab as proposed by the safety-monitoring program. Previous severe lymphocytopenia under therapy with other disease-modifying therapies may be a risk factor for the development of immune thrombocytopenia.",
"affiliations": "Center for Neurology, Asklepios Hospitals Schildautal, Seesen, Germany/Departments of Neurology and Haematology, University of Duisburg-Essen, Duisburg, Germany mark.obermann@uni-due.de.;Department of Neurology, University of Münster, Münster, Germany.;Department of Neurology, University of Münster, Münster, Germany.;Departments of Neurology and Haematology, University of Duisburg-Essen, Duisburg, Germany.;Department of Neurology, University of Münster, Münster, Germany.;Department of Neurology, University of Münster, Münster, Germany.",
"authors": "Obermann|Mark|M|;Ruck|Tobias|T|;Pfeuffer|Steffen|S|;Baum|Julia|J|;Wiendl|Heinz|H|;Meuth|Sven G|SG|",
"chemical_list": "D007166:Immunosuppressive Agents; D000074323:Alemtuzumab",
"country": "England",
"delete": false,
"doi": "10.1177/1352458516638558",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1352-4585",
"issue": "22(9)",
"journal": "Multiple sclerosis (Houndmills, Basingstoke, England)",
"keywords": "Alemtuzumab; adverse events; early-onset; immune thrombocytopenia; multiple sclerosis; risk factors; side effects; treatment safety",
"medline_ta": "Mult Scler",
"mesh_terms": "D000328:Adult; D000074323:Alemtuzumab; D001327:Autoimmune Diseases; D015551:Autoimmunity; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D020529:Multiple Sclerosis, Relapsing-Remitting; D016553:Purpura, Thrombocytopenic, Idiopathic; D012307:Risk Factors; D013959:Thyroid Diseases; D013997:Time Factors; D016896:Treatment Outcome",
"nlm_unique_id": "9509185",
"other_id": null,
"pages": "1235-41",
"pmc": null,
"pmid": "26980848",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Simultaneous early-onset immune thrombocytopenia and autoimmune thyroid disease following alemtuzumab treatment in relapsing-remitting multiple sclerosis.",
"title_normalized": "simultaneous early onset immune thrombocytopenia and autoimmune thyroid disease following alemtuzumab treatment in relapsing remitting multiple sclerosis"
} | [
{
"companynumb": "DE-SA-2016SA145299",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ALEMTUZUMAB"
},
"drugadditional": null,
"... |
{
"abstract": "DS-ALL has a higher rate of relapse and treatment-related mortality. The newer immunotherapies are potentially better options. Relapsed ALL with positive MRD has a poor prognosis. Transient long-term remission after ALL relapse due to partial chemotherapy combined severe infection is rare.",
"affiliations": "Department of Pediatrics Division of Pediatric Hematology Oncology Rainbow Babies and Children's Hospital at University Hospitals Cleveland Medical Center Cleveland OH USA.;Department of Pediatrics Division of Pediatric Hematology Oncology Rainbow Babies and Children's Hospital at University Hospitals Cleveland Medical Center Cleveland OH USA.;Department of Pediatrics Division of Pediatric Hematology Oncology Rainbow Babies and Children's Hospital at University Hospitals Cleveland Medical Center Cleveland OH USA.;Department of Pediatrics Division of Pediatric Hematology Oncology Rainbow Babies and Children's Hospital at University Hospitals Cleveland Medical Center Cleveland OH USA.",
"authors": "Hu|Zhongbo|Z|https://orcid.org/0000-0002-8935-0626;VanHeyst|Kristen A|KA|;Dalal|Jignesh|J|https://orcid.org/0000-0002-4418-4919;Hackney|Lisa|L|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.3678",
"fulltext": "\n==== Front\nClin Case Rep\nClin Case Rep\n10.1002/(ISSN)2050-0904\nCCR3\nClinical Case Reports\n2050-0904\nJohn Wiley and Sons Inc. Hoboken\n\n10.1002/ccr3.3678\nCCR33678\nCase Report\nCase Reports\nPatient with Down syndrome and relapsed acute lymphoblastic leukemia with sustained remission despite only partial R3 chemotherapy\nHU et al.\nHu Zhongbo https://orcid.org/0000-0002-8935-0626\n1\nVanHeyst Kristen A. 1\nDalal Jignesh https://orcid.org/0000-0002-4418-4919\n1\nHackney Lisa 1 lisa.hackney@uhhpitals.org\n\n1 Department of Pediatrics Division of Pediatric Hematology Oncology Rainbow Babies and Children’s Hospital at University Hospitals Cleveland Medical Center Cleveland OH USA\n* Correspondence\nLisa Hackney, Department of Pediatrics, Division of Pediatric Hematology Oncology, Rainbow Babies and Children’s Hospital at University Hospitals Cleveland Medical Center, Cleveland, OH, USA.\nEmail: lisa.hackney@uhhpitals.org\n\n12 2 2021\n3 2021\n9 3 10.1002/ccr3.v9.3 11181122\n13 11 2020\n05 9 2020\n27 11 2020\n© 2021 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.\nThis is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nDS‐ALL has a higher rate of relapse and treatment‐related mortality. The newer immunotherapies are potentially better options. Relapsed ALL with positive MRD has a poor prognosis. Transient long‐term remission after ALL relapse due to partial chemotherapy combined severe infection is rare.\n\nDS‐ALL has a higher rate of relapse and treatment‐related mortality. The newer immunotherapies are potentially better options. Relapsed ALL with positive MRD has a poor prognosis. Transient long‐term remission after ALL relapse due to partial chemotherapy combined severe infection is rare.\n\nALL R3\nDown syndrome\nRelapsed acute lymphoblastic leukemia\nremission\nsource-schema-version-number2.0\ncover-dateMarch 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.0 mode:remove_FC converted:21.03.2021\nHu Z , VanHeyst KA , Dalal J , Hackney L . Patient with Down syndrome and relapsed acute lymphoblastic leukemia with sustained remission despite only partial R3 chemotherapy. Clin Case Rep. 2021;9 :1118–1122. 10.1002/ccr3.3678\n==== Body\n1 INTRODUCTION\n\nDS‐ALL patients have a higher rate of relapse and treatment‐related mortality. We describe a DS‐ALL patient with late bone marrow relapse who was treated per British ALL R3 reinduction chemotherapy. The patient remained in remission for approximately two years after therapy was discontinued due to severe systemic infections.\n\nThe current treatment regimens for acute lymphoblastic leukemia (ALL) have successfully attained cure rates of approximately 90%‐95% in children, but still with poor overall long‐term survival in adults of about 40%. 1 , 2 , 3 It still remains a significant challenge to improve the survival of patients with relapsed ALL. Patients with relapsed ALL have a suboptimal prognosis. 1 , 4 Down syndrome patients (DS) with relapsed ALL have even worse outcomes. DS itself was proven to be an independent prognostic factor of outcome after ALL relapse. 5 ALL patients with DS have a higher rate of relapse and treatment‐related mortality, with an 8‐year cumulative incidence of relapse of 26% comparing with 15% in non‐DS patients and a 2‐year treatment‐related mortality of 7% with 2% in the latter. 6 There are several case reports of patients with leukemia who attained spontaneous remission after severe infection. 7 , 8 , 9 There are no reports of a patient with relapsed leukemia with sustained remission following cessation of therapy secondary to severe infections, except an older patient with relapsed FLT3 internal tandem duplication mutant acute myeloid leukemia whose disease underwent spontaneous remission for 35 days without precipitating cause. 10\n\nWe describe a case of a 37‐year‐old man with Down syndrome and ALL (DS‐ALL) who had a late bone marrow relapse and sustained remission for 2 years after only receiving two cycles of ALL R3 salvage chemotherapy due to severe systemic infections.\n\n2 CASE PRESENTATION\n\nA 30‐year‐old male with Down syndrome presented with fever, cough, and shortness of breath in November 2013. He was managed in our pediatric unit because of current favorable outcomes for Adolescents and Young Adults (AYA) with ALL treating with pediatric Children's Oncology Group (COG) protocols. 11 His complete blood count (CBC) showed pancytopenia with a white blood cell (WBC) count of 1.4 x 10^9/L, hemoglobin of 8.3 g/dL, and platelet count of 32 x 10^9/L with occasional circulating blasts. Bone marrow aspirate and biopsy confirmed the diagnosis of acute lymphoblastic leukemia with 73% blasts which co‐expressed CD34, CD19, CD10, and terminal deoxynucleotidyl transferase (TdT) with aberrant expression of dim CD33 by flow cytometry, which was consistent with B‐precursor ALL. Cytogenetic analysis was not successful but fluorescence in situ hydridization (FISH) from a bone marrow sample obtained on day 17 during Induction chemotherapy as per the COG study AALL1131 showed nuc ish (ETV6x2,RUNX1x3)[250] which was a normal signal pattern for constitutional trisomy 21 with two ETS Variant Transcription Factor 6 (ETV6) signals and three Runt‐related transcription factor 1 (RUNX1) signals. Diagnostic cerebrospinal fluid was negative for blasts.\n\nThe patient was treated per COG high‐risk protocol AALL1131, Down syndrome arm due to National Cancer institute (NCI) risk factor for age above 10 years old. He had a rapid early response with a M1 marrow at Day 17, and he achieved complete remission with complete haematological recovery for about six months after induction with negative minimal residual disease (MRD). Although, during induction phase he had a complicated treatment course including a few episodes of sepsis, one of which included multi‐organ failure for which he was in the Medical Intensive Care Unit (ICU), and peripherally inserted central catheter (PICC) line associated deep vein thrombosis (DVT). Following the end of his treatment, his platelet count never normalized and ranged between 90x10^9/L and 112x10^9/L. At his lowest level of thrombocytopenia to 48x10^9/L in September 2017, which was four years after the initial diagnosis, a repeat bone marrow aspirate and biopsy were obtained and showed a 90% cellular bone marrow with 82% blasts, consistent with late bone marrow relapse. FISH showed cytokine receptor like factor 2 (CRLF2) translocation positive in 63.5% of cells and was positive for deletion of CDKN2A on chromosome 9p beside his constitutional trisomy of chromosome 21. Central nervous system (CNS) was negative. This relapse was treated with Reinduction chemotherapy per ALL R3 protocol (Dexamethasone 20mg/m2/day day 1‐5 & 15‐19, Mitoxantrone 10mg/m2/dose day 1‐2, Vincristine 1.5mg/m2/dose from day 3, then weekly; PEG‐asparaginase 2500U/M2 day 3 and 18; Intrathecal Methotrexate day 1 and 8). Post‐reinduction day 29 MRD was 0.2% (Table 1).\n\nTable 1 Patient's bone marrow aspiration time points and characteristics\n\nDate\tBM time point\tblast %/ MRD\tImmunophenotype\tFISH\tCytogenetics\t\n11/21/2013\tInitial diagnosis\t73%\tCD34, 19, 10, TdT(+); CD33 dim\t\tNot sent\t\n12/2/2013\tDay 10 of induction\t9%\t\t\tfailed culture\t\n12/9/2013\tDay 17 of induction\t/0.1%\t\tnuc ish (ETV6x2,RUNX1x3)[250]\t\t\n12/24/2013\tDay 31 of induction\t/0.008%\t\t\tfailed culture\t\n3/25/2016\tFinished chemotherapy\t\t\t\t\t\n9/19/2017\tFound relapse\t82%\tCD34,19, 10, 304 (+)\t>Positive for CRLF2 translocation (63.5% of cells) (Univ of Cincinnati)\n\n>Positive for deletion of CDKN2A on chromosome 9p.\n\n>Positive for trisomy of chromosome 21 (constitutional).\n\n\t47,XY, +21c[25]\t\n10/23/2017\tDay 29 post‐reinduction\t/0.2%\t\t\t\t\n11/6/2017\tDay 43 post‐reinduction\t/0.03%\t\t\t\t\n1/2/2018\tpost‐consolidation of ALL R3\t0%\t/\tFISH negative for 9p deletion;\n\nnuc ish (CDKN2A,CEP9)x2 [250]\n\n\t47,XY, +21c[25]\t\n3/15/2018\t25 weeks after relapse\t0%\t/\tnot performed\t47,XY, +21c[25]\t\n8/30/2018\t50 weeks after relapse\t0%\t/\tnegative for 9p deletion;\n\nnuc ish (CDKN2A,CEP9)x2 [250]\n\n\t47,XY,\n\n+21c[25]\n\n\t\n2/3/2020\t2 years and 20 weeks after first relapse\t90%\tCD34, 19, 20, 10; 50% (+) for CD22; CD304 Dim‐moderate\t\t\t\nJohn Wiley & Sons, Ltd\n\nHe continued to receive Consolidation chemotherapy per ALL R3 protocol (Intrathecal Methotrexate day 1, Dexamethasone 6mg/m2/day day 1‐5, methotrexate 1000 mg/m2/dose day 8 with Leucovorin rescue, Vincristine 1.5 ng/m2/dose day 3, PEG‐asparaginase 2500 U/m2/dose day 9, Cyclophosphamide 440mg/m2/dose day 15‐19, Etoposide 100mg/m2/dose day 15‐19), after which his bone marrow had negative MRD. While hospitalized for Intensification chemotherapy, he developed sepsis, necrotizing pneumonia, and severe bilateral pleural effusions. Bronchoalveolar lavage (BAL) revealed Candida albicans. Computerized tomography (CT) imaging also revealed near complete splenic infarct, right renal perfusion deficits with signs of liquefaction and a segmental area of abnormal small bowel wall enhancement and concern for focal small bowel wall defect. He also developed delirium related to his severe illness and prolonged hospitalization. Due to severe illness, his chemotherapy was held during a three‐month period. A bone marrow after three months continued to demonstrate negative MRD. Once he became more clinically stable, chemotherapy was attempted with intermediate dosed Methotrexate but this hospital course was complicated by infection necessitating removal of his broviac, fluid overload, and a persistent cavitary lung lesion. At this point, a decision was made by his family and treatment team to stop chemotherapy. About 50 weeks after his diagnosis of relapsed disease, a repeat bone marrow continued to demonstrate negative MRD. He was followed closely as an outpatient. Unfortunately, he presented with acute onset psychosis and thrombocytopenia about 2 years after stopping his treatment and bone marrow was consistent with relapsed disease. Family opted for no further therapy, and unfortunately, the patient passed away 7 weeks later.\n\n3 DISCUSSION\n\nDespite current long‐term remission with leukemia‐free survival of ALL reaching above 90% in children, 1 , 12 relapsed ALL and adult cases are still the most important obstacles for the cure of ALL patients. The relapse rate is about 10%‐15% of ALL in children, but substantially higher (about 25%‐30%) in high‐risk subgroups. 13 , 14 Almost 50% of adult ALL patients experience relapse. 15 DS patients with ALL even have high relapse rate, 6 partially due to poor tolerance to anti‐leukemia drugs. 16 DS patients more frequently develop severe infectious complications. 16\n\nAlthough high‐dose Mitoxantrone plus Cytarabine was effective in achieving remission in refractory leukemia, the duration of the remission was only about half a year 17 and still about 50% of ALL patients do not respond to salvage therapy prior to the ALL R3 protocol. 18 The British ALL R3 protocol utilizes Mitoxantrone to confer a significant response in progression‐free and overall survival in children with relapsed ALL. 4 Our patient, who had a bone marrow relapse about 20 months after the completion of his initial chemotherapy, was considered to have late bone marrow relapse (defined as relapse occurring 36 months after the first diagnosis or more than 6 months after the end of front‐line therapy). He was treated as per the ALL R3 protocol and had positive MRD of 0.2% after Reinduction and negative MRD after Consolidation. Per the ALL R3 protocol, patients with B‐precursor ALL with late bone marrow relapse and low MRD (<0.01%) at the end of induction had favorable outcomes with chemotherapy without undergoing stem‐cell transplantation. Patients with higher MRD (>0.01%) required allogeneic stem‐cell transplantation. But after long‐term follow‐up of the late bone marrow relapse patients for 7 years, the second relapse rate was about 23% in the high MRD group even after stem‐cell transplant. We had discussed this as a group together with patient's parents. Both parents and all physicians thought that our patient's transplant‐related mortality (TRM) would be too high given his toxicities with initial chemotherapy and his Down syndrome status. We chose to continue chemotherapy per ALL R3. In the low MRD group with chemotherapy, second relapse rate was about 27%. 19 The progression‐free survival at 5 years was significantly lower in the high MRD group comparing with that in the low MRD with 56% versus 72%. 19 Our case is unique in that the patient was still complicated with several systemic infection after only receiving two phases of chemotherapy per the ALL R3 protocol for his first relapse, but remained in remission for nearly two years.\n\nPatients with Down syndrome are well‐known to have 10‐ to 20‐fold increased risk of developing B‐cell precursor ALL. 20 The Ponte di Legno study group showed that DS‐ALL patients had higher 8‐year cumulative incidence of relapse than non‐DS patients (26% vs 15%). 6 AYA patients with ALL have favorable outcomes when they are treated with pediatric protocols. 11 Treatment‐related mortality, primarily from infection, increased in all protocols in DS‐ALL, which made both the five‐year event‐free and overall survival inferior in patients with DS‐ALL. 21 , 22 Current COG protocols have made modifications to limit toxicities. Our patient had multiple infections during his initial chemotherapy per AALL1131. He also developed multiple severe infections after two phases of chemotherapy per the ALL R3 protocol following disease relapse. Given the significant toxicity that he experienced, a decision was made for cessation of therapy, which we thought would benefit the patient better and was approved by patient's parents. Over time, more options are becoming available for patients with relapsed ALL that confer less toxicity. Currently, antibody‐targeted therapies, such as bispecific (CD3/CD19) T‐cell‐engaging antibody Blinatumomab, Inotzumab, and CD19‐directed chimeric antigen receptor (CAR) T‐cell therapies, are major breakthroughs in the management of relapsed leukemia. 23\n\nSpontaneous or transient remission of acute lymphoblastic leukemia during severe infection has been described in a few cases and case series reports with averaged ten weeks in duration. 7 , 8 , 9 , 24 The proposed mechanism was due to increased cortisol production during stress or infection combined with an immune‐mediated process thereby generating anti‐leukemic effects. 7 , 8 , 25 Cytokines, including tumor necrosis factor‐alpha, interferon‐alpha, and interleukin‐2, released during infection can directly inhibit the residual blast proliferation or through increased activity of T lymphocytes, macrophages, and natural killer cells leading to an anti‐leukemia effect. 26 , 27 Similar phenomena and mechanisms have been discussed and reported in several cases and case series in acute myeloid leukemia patients. 28 , 29 Our patient's long‐term remission may be attributed to a combination of the two phases of chemotherapy per ALL R3 protocol with the systemic stress related to his multiple severe infections.\n\nCONFLICT OF INTEREST\n\nThe authors declare no conflicts of interest.\n\nAUTHORS’ CONTRIBUTIONS\n\nZH: gathered the patient data, performed a literature review, and wrote the manuscript. KAV and LH: reviewed, corrected patient data and revised the manuscript. JD: was involved in overall supervision of the paper. All authors: read and approved the final manuscript.\n\nACKNOWLEDGMENTS\n\nPublished with written consent of the patient.\n\nDATA AVAILABILITY STATEMENT\n\nThe data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.\n==== Refs\nREFERENCES\n\n1 Hunger SP , Mullighan CG . Acute Lymphoblastic Leukemia in Children. N Engl J Med. 2015;373 (16 ):1541‐1552.26465987\n2 Cooper SL , Brown PA . Treatment of pediatric acute lymphoblastic leukemia. Pediatr Clin North Am. 2015;62 (1 ):61‐73.25435112\n3 Pulte D , Jansen L , Gondos A , et al. Survival of adults with acute lymphoblastic leukemia in Germany and the United States. PLoS One. 2014;9 (1 ):e85554.24475044\n4 Parker C , Waters R , Leighton C , et al. Effect of mitoxantrone on outcome of children with first relapse of acute lymphoblastic leukaemia (ALL R3): an open‐label randomised trial. Lancet. 2010;376 (9757 ):2009‐2017.21131038\n5 Meyr F , Escherich G , Mann G , et al. Outcomes of treatment for relapsed acute lymphoblastic leukaemia in children with Down syndrome. Br J Haematol. 2013;162 (1 ):98‐106.23594030\n6 Buitenkamp TD , Izraeli S , Zimmermann M , et al. Acute lymphoblastic leukemia in children with Down syndrome: a retrospective analysis from the Ponte di Legno study group. Blood. 2014;123 (1 ):70‐77.24222333\n7 Iqbal A , Weinstein J , Angelova V , Dighe D , Giordano L . A Rare Case of Spontaneous Remission of Terminal Deoxynucleotidyl Transferase Negative B‐acute Lymphoblastic Leukemia. J Pediatr Hematol Oncol. 2018;40 (3 ):e176‐e178.28678092\n8 Yoruk A , Erguven M , Celiker E , et al. Spontaneous remission of acute lymphoblastic leukemia with mediastinal mass. Pediatr Hematol Oncol. 2008;25 (3 ):181‐186.18432500\n9 Hores T , Wendelin K , Schaefer‐Eckart K . Spontaneous remission of acute lymphoblastic leukemia: A case report. Oncol Lett. 2018;15 (1 ):115‐120.29285190\n10 Vachhani P , Mendler JH , Evans A , et al. Spontaneous Remission in an Older Patient with Relapsed FLT3 ITD Mutant AML. Case Rep Hematol. 2016;2016 :1259759.28127477\n11 Stock W , Luger SM , Advani AS , et al. A pediatric regimen for older adolescents and young adults with acute lymphoblastic leukemia: results of CALGB 10403. Blood. 2019;133 (14 ):1548‐1559.30658992\n12 Pal SK , Miller MJ , Agarwal N , et al. Clinical Cancer Advances 2019: Annual Report on Progress Against Cancer From the American Society of Clinical Oncology. J Clin Oncol. 2019;37 (10 ):834‐849.30702028\n13 Teachey DT , Hunger SP . Predicting relapse risk in childhood acute lymphoblastic leukaemia. Br J Haematol. 2013;162 (5 ):606‐620.23808872\n14 Bhojwani D , Pui CH . Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol. 2013;14 (6 ):e205‐e217.23639321\n15 Jabbour E , Pui CH , Kantarjian H . Progress and Innovations in the Management of Adult Acute Lymphoblastic Leukemia. JAMA Oncol. 2018;4 (10 ):1413‐1420.29931220\n16 Izraeli S , Vora A , Zwaan CM , Whitlock J . How I treat ALL in Down's syndrome: pathobiology and management. Blood. 2014;123 (1 ):35‐40.24235135\n17 Raanani P , Shpilberg O , Gillis S , et al. Salvage therapy of refractory and relapsed acute leukemia with high dose mitoxantrone and high dose cytarabine. Leuk Res. 1999;23 (8 ):695‐700.10456666\n18 Fuster J . Current approach to relapsed acute lymphoblastic leukemia in children. Review. World J Hematol. 2014;3 (3 ):49‐70.\n19 Parker C , Krishnan S , Hamadeh L , et al. Outcomes of patients with childhood B‐cell precursor acute lymphoblastic leukaemia with late bone marrow relapses: long‐term follow‐up of the ALLR3 open‐label randomised trial. Lancet Haematol. 2019;6 (4 ):e204‐e216.30826273\n20 Lange B . The management of neoplastic disorders of haematopoiesis in children with Down's syndrome. Br J Haematol. 2000;110 (3 ):512‐524.10997960\n21 Maloney KW , Carroll WL , Carroll AJ , et al. Down syndrome childhood acute lymphoblastic leukemia has a unique spectrum of sentinel cytogenetic lesions that influences treatment outcome: a report from the Children's Oncology Group. Blood. 2010;116 (7 ):1045‐1050.20442364\n22 Whitlock JA . Down syndrome and acute lymphoblastic leukaemia. Br J Haematol. 2006;135 (5 ):595‐602.17054672\n23 Paul S , Rausch CR , Nasnas PE , Kantarjian H , Jabbour EJ . Treatment of relapsed/refractory acute lymphoblastic leukemia. Clin Adv Hematol Oncol. 2019;17 (3 ):166‐175.30969955\n24 Bierman HR , Crile DM , Dod KS , et al. Remissions in leukemia of childhood following acute infectious disease: staphylococcus and streptococcus, varicella, and feline panleukopenia. Cancer. 1953;6 (3 ):591‐605.13042782\n25 Lynggaard LS , Marquart HV , Kjeldsen E , Madsen HO , Hasle H . Acute lymphoblastic leukemia presenting with pancytopenia followed by a 14‐month‐long period of transient remission possibly supporting the adrenal hypothesis of leukemogenesis. J Pediatr Hematol Oncol. 2016;38 (8 ):e271‐e273.27509378\n26 Jimemez C , Ribera JM , Abad E , et al. Increased serum tumour necrosis factor during transient remission in acute leukaemia. Lancet. 1993;341 (8860 ):1600.\n27 Musto P , D'Arena G , Melillo L , et al. Spontaneous remission in acute myeloid leukaemia: a role for endogenous production of tumour necrosis factor and interleukin‐2? Br J Haematol. 1994;87 (4 ):879‐880.7986737\n28 Helbig D , Quesada AE , Xiao W , Roshal M , Tallman MS , Knorr DA . Spontaneous Remission in a Patient With Acute Myeloid Leukemia Leading to Undetectable Minimal Residual Disease. J Hematol. 2020;9 (1–2 ):18‐22.32362981\n29 Rashidi A , Fisher SI . Spontaneous remission of acute myeloid leukemia. Leuk Lymphoma. 2015;56 (6 ):1727‐1734.25284494\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-0904",
"issue": "9(3)",
"journal": "Clinical case reports",
"keywords": "ALL R3; Down syndrome; Relapsed acute lymphoblastic leukemia; remission",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "1118-1122",
"pmc": null,
"pmid": "33768794",
"pubdate": "2021-03",
"publication_types": "D002363:Case Reports",
"references": "10456666;26465987;28127477;17054672;30826273;20442364;21131038;25435112;24475044;24222333;27509378;24235135;29285190;23594030;25284494;13042782;18432500;32362981;23639321;29931220;30658992;7986737;8099677;30702028;30969955;28678092;10997960;23808872",
"title": "Patient with Down syndrome and relapsed acute lymphoblastic leukemia with sustained remission despite only partial R3 chemotherapy.",
"title_normalized": "patient with down syndrome and relapsed acute lymphoblastic leukemia with sustained remission despite only partial r3 chemotherapy"
} | [
{
"companynumb": "US-SAGENT PHARMACEUTICALS-2021SAG001381",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugaddition... |
{
"abstract": "The study aims to identify clinical and pathological factors predictive of disease-free survival (DFS) and overall survival (OS) in locally advanced breast cancer (LABC) patients who do not have a pathologic complete response (no-pCR) of primary tumor after neoadjuvant chemotherapy (NC) with vinorelbine/epirubicin (VE) intravenous combination regimen. Retrospectively reviewed data of LABC patients in our Hospital. 97 patients who had no-pCR after NC were identified and enrolled in the study. All patients were treated with three cycles of VE intravenous administration before operation. Local-regional radiotherapy was offered to patients after the completion of chemotherapy followed by hormone therapy according to hormone receptor status. Neoadjuvant chemotherapy consisting of intravenous vinorelbine 25 mg/m on day 1 and 8 plus epirubicin 60 mg/m on day 1 was administered every 3 weeks. The relationship of survival with clinical and pathological factors was evaluated. Univariate analysis (log-rank tests) and multivariate analysis (Cox regression analysis) were performed to identify independent predictors for DFS and OS. Study was analyzed with a median follow-up of 65 months. The 5-year rates for DFS and OS were 58.0 and 68.5 %, respectively. Multivariate analysis revealed that three factors such as the estrogen receptor expression before NC (pre-ER), Ki-67 expression after NC (post-Ki-67), and pathological response of primary tumor (pRT) were independent prognostic factors of LABC patients (pre-ER and pRT for DFS, all three for OS). The DFS at 5 years was 73.8 % for patients without both factors, 51.5 % for patients with any one of both factors, and 10.3 % for patients with both factors. The OS at 5 years was 90.5 % for patients without these three factors, 64.3 % for patients with any one of these three factors, and 30.8 % for patients with any two of these three factors. Patients with all three factors died within 3 years. In LABC patients with no-pCR, three factors independently predicted of survival and, without those three high-risk factors, patients had the promising outcome.",
"affiliations": "Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiaotong University, Shanghai, 200025, People's Republic of China.",
"authors": "Huang|Ou|O|;Jiang|Min|M|;Chen|Xiao-song|XS|;Wu|Jia-yi|JY|;Chen|Wei-guo|WG|;Li|Ya-fei|YF|;Shen|Kun-wei|KW|",
"chemical_list": "D015251:Epirubicin; D014747:Vinblastine; D000077235:Vinorelbine",
"country": "United States",
"delete": false,
"doi": "10.1007/s12013-014-0327-4",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1085-9195",
"issue": "71(2)",
"journal": "Cell biochemistry and biophysics",
"keywords": null,
"medline_ta": "Cell Biochem Biophys",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D059186:Chemoradiotherapy, Adjuvant; D017024:Chemotherapy, Adjuvant; D002681:China; D018572:Disease-Free Survival; D015251:Epirubicin; D005260:Female; D006801:Humans; D015994:Incidence; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D009364:Neoplasm Recurrence, Local; D011379:Prognosis; D012307:Risk Factors; D015996:Survival Rate; D016896:Treatment Outcome; D014747:Vinblastine; D000077235:Vinorelbine",
"nlm_unique_id": "9701934",
"other_id": null,
"pages": "1181-90",
"pmc": null,
"pmid": "25427887",
"pubdate": "2015-03",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Prognostic factors of survival in pathologic incomplete response patients with locally advanced breast cancer after neoadjuvant chemotherapy.",
"title_normalized": "prognostic factors of survival in pathologic incomplete response patients with locally advanced breast cancer after neoadjuvant chemotherapy"
} | [
{
"companynumb": "CN-CIPLA LTD.-2014CN02343",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RADIATION THERAPY"
},
"drugadditional": null,... |
{
"abstract": "A 60-year-old male patient undergoing chemotherapy for multiple myeloma Stage II presented to our hospital with complaints of cough, haemoptysis, fever and loose stools. Sputum sample was sent for fungal culture. Fungal culture on Sabouraud dextrose agar yielded bluish-green velvety growth with orange-to-red diffusible pigment on the reverse. The isolate was identified as Penicillium species, probably Penicillium citrinum or Penicillium pinophilus. As the isolate did not exhibit thermal dimorphism, the possibility of the fungal isolate being Penicillium marneffei was ruled out. The isolate was sent for molecular identification and confirmation, which was identified as P. citrinum. His HIV status was negative. In this case, his immunocompromised state due to multiple myeloma and chemotherapy could have predisposed him to this fungal infection, which is an emerging infection and a rare manifestation seen in high-risk patients receiving targeted therapies.",
"affiliations": "Department of Microbiology, MS Ramaiah Medical College, Bengaluru, Karnataka, India.;Department of Microbiology, MS Ramaiah Medical College, Bengaluru, Karnataka, India. Electronic address: megsgrt@gmail.com.;Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Chennai, Tamil Nadu, India.",
"authors": "Beena|H|H|;Gupta|Megha|M|;Kindo|Anupma Jyoti|AJ|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ijmmb.2021.03.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0255-0857",
"issue": "39(2)",
"journal": "Indian journal of medical microbiology",
"keywords": "Immunocompromised; Multiple myeloma; Penicillium citrinum",
"medline_ta": "Indian J Med Microbiol",
"mesh_terms": null,
"nlm_unique_id": "8700903",
"other_id": null,
"pages": "259-261",
"pmc": null,
"pmid": "33814124",
"pubdate": "2021-04",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Pulmonary infection with Penicillium citrinum in a patient with multiple myeloma.",
"title_normalized": "pulmonary infection with penicillium citrinum in a patient with multiple myeloma"
} | [
{
"companynumb": "IN-drreddys-LIT/IND/22/0150989",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BORTEZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "We compared embolectomy (when available) with thrombolysis in patients with shock and massive pulmonary embolism. 13 patients were operated on, 10 (77%) of whom survived. The inferior vena cava was routinely clipped. The 24 medically treated patients were given alteplase until systemic and pulmonary artery pressures stabilised and heparin thereafter; 16 (67%) survived. Major haemorrhage occurred in 28% of medically treated patients, but was not fatal. 1 patient had a small cerebral haemorrhage that resolved without drainage. One-fifth of the medical group had a re-embolism, which suggests that temporary caval umbrellas are indicated in medically treated patients. Thrombolysis may provide a life-saving option and a randomised trial is warranted.",
"affiliations": "Department of Medicine, University of Hannover, Germany.",
"authors": "Gulba|D C|DC|;Schmid|C|C|;Borst|H G|HG|;Lichtlen|P|P|;Dietz|R|R|;Luft|F C|FC|",
"chemical_list": "D006493:Heparin; D010959:Tissue Plasminogen Activator",
"country": "England",
"delete": false,
"doi": "10.1016/s0140-6736(94)91523-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0140-6736",
"issue": "343(8897)",
"journal": "Lancet (London, England)",
"keywords": null,
"medline_ta": "Lancet",
"mesh_terms": "D000328:Adult; D000368:Aged; D004359:Drug Therapy, Combination; D005260:Female; D005500:Follow-Up Studies; D006470:Hemorrhage; D006493:Heparin; D006801:Humans; D008297:Male; D008875:Middle Aged; D011651:Pulmonary Artery; D011655:Pulmonary Embolism; D015996:Survival Rate; D015912:Thrombolytic Therapy; D010959:Tissue Plasminogen Activator; D016896:Treatment Outcome; D014682:Vena Cava, Inferior",
"nlm_unique_id": "2985213R",
"other_id": null,
"pages": "576-7",
"pmc": null,
"pmid": "7906331",
"pubdate": "1994-03-05",
"publication_types": "D016430:Clinical Trial; D003160:Comparative Study; D018848:Controlled Clinical Trial; D016428:Journal Article",
"references": null,
"title": "Medical compared with surgical treatment for massive pulmonary embolism.",
"title_normalized": "medical compared with surgical treatment for massive pulmonary embolism"
} | [
{
"companynumb": "DE-ROCHE-1597940",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ALTEPLASE"
},
"drugadditional": null,
"drug... |
{
"abstract": "\"Technical failure\" is still perceived to be a frequent cause of graft loss after pancreas transplantation. However, some early graft losses currently attributed to technical failure could be due to unrecognized acute pancreas rejection (APR).\n\n\n\nWe investigated the apparent incidence of APR in cases of early allograft pancreatectomy (EAP) that had previously been attributed to technical failure. We performed an analysis of 198 patients who underwent pancreas transplantation between January 2009 and January 2016 and identified all those with EAP within 90 days of transplantation. Explanted grafts of EAP recipients were re-examined histologically to evaluate for evidence of APR using current Banff criteria.\n\n\n\nTwenty-three EAPs were identified (11.6%; 23/198). APR was identified histologically in 9 out of the 15 recipients who lost their grafts due to duodenal leaks or recurrent peripancreatic collections, but was not identified in any of the patients whose grafts were lost due to thrombosis or ischemia.\n\n\n\nUnsuspected APR appears common in the explanted grafts of recipients who have undergone EAP for apparently \"technical\" reasons. We suggest that EAP should be defined as a technical failure only when APR of the pancreas (or duodenum) has been excluded by histological analysis.",
"affiliations": "Department of Health Services Research and Policy, London School of Hygiene and Tropical Medicine, London, UK.;Statistics and Clinical Studies, NHS Blood and Transplant, Bristol, UK.;Department of Cellular Pathology, Oxford University Hospitals NHS Foundation Trust, John Radcliffe Hospital, Oxford, UK.;Department of Nephrology and Transplantation, Guy's and St Thomas' NHS Foundation Trust, London, UK.;Department of Histopathology, Guy's and St Thomas' NHS Foundation Trust, London, UK.;Department of Nephrology and Transplantation, Guy's and St Thomas' NHS Foundation Trust, London, UK.",
"authors": "Wallace|David F|DF|0000-0002-8959-7741;Bunnett|Joanna|J|;Fryer|Eve|E|;Drage|Martin|M|;Horsfield|Catherine|C|;Callaghan|Chris J|CJ|0000-0003-3334-4152",
"chemical_list": null,
"country": "Denmark",
"delete": false,
"doi": "10.1111/ctr.13702",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-0063",
"issue": "33(10)",
"journal": "Clinical transplantation",
"keywords": "acute pancreas rejection; duodenal leak; pancreas transplant; peripancreatic collections; technical failure",
"medline_ta": "Clin Transplant",
"mesh_terms": "D000328:Adult; D064591:Allografts; D004322:Drainage; D005260:Female; D005500:Follow-Up Studies; D006084:Graft Rejection; D006085:Graft Survival; D006801:Humans; D008297:Male; D008875:Middle Aged; D016035:Pancreas Transplantation; D010180:Pancreatectomy; D011183:Postoperative Complications; D011379:Prognosis; D012189:Retrospective Studies; D012307:Risk Factors",
"nlm_unique_id": "8710240",
"other_id": null,
"pages": "e13702",
"pmc": null,
"pmid": "31452273",
"pubdate": "2019-10",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Early allograft pancreatectomy-Technical failure or acute pancreatic rejection?",
"title_normalized": "early allograft pancreatectomy technical failure or acute pancreatic rejection"
} | [
{
"companynumb": "NVSC2019GB022745",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drugadditional": "... |
{
"abstract": "Kaposi sarcoma (KS) is a vascular tumour of endothelial cell origin, associated with human herpes virus 8. It develops in one of four clinical settings, one of which is iatrogenic immunosuppression. We present the case of a 46year-old man with relapsing-remitting multiple sclerosis who developed KS in the context of fingolimod use. To our knowledge, this is the second reported case of KS in a fingolimod-treated individual. This case highlights potential risks associated with immunosuppression with this medicine and ongoing need for vigilance in assessing for such complications.",
"affiliations": "St. Vincent's Hospital, Neurology Department, 390 Victoria St, Darlinghurst, Sydney, NSW 2010, Australia. Electronic address: walkersuse@hotmail.com.;St. Vincent's Hospital, Neurology Department, 390 Victoria St, Darlinghurst, Sydney, NSW 2010, Australia.",
"authors": "Walker|Susan|S|;Brew|Bruce|B|",
"chemical_list": "D007166:Immunosuppressive Agents; D000068876:Fingolimod Hydrochloride",
"country": "Scotland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0967-5868",
"issue": "31()",
"journal": "Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia",
"keywords": "Adverse effect; Fingolimod; Kaposi sarcoma; Malignancy; Multiple sclerosis",
"medline_ta": "J Clin Neurosci",
"mesh_terms": "D000068876:Fingolimod Hydrochloride; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D008875:Middle Aged; D020529:Multiple Sclerosis, Relapsing-Remitting; D012514:Sarcoma, Kaposi",
"nlm_unique_id": "9433352",
"other_id": null,
"pages": "217-8",
"pmc": null,
"pmid": "27168454",
"pubdate": "2016-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Kaposi sarcoma in a fingolimod-treated patient with multiple sclerosis.",
"title_normalized": "kaposi sarcoma in a fingolimod treated patient with multiple sclerosis"
} | [
{
"companynumb": "AU-BIOGEN-2017BI00385607",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FAMCICLOVIR"
},
"drugadditional": null,
... |
{
"abstract": "Mucormycosis of the gastrointestinal tract is a life threatening infection most commonly seen in patients with severe immunosuppression. A 42-year-old male with history of choriocarcinoma was admitted to the intensive care unit with septic shock. He developed massive hematemesis requiring upper endoscopy which showed multiple deep gastric ulcers. Due to uncontrollable bleeding he underwent an emergent gastrectomy which revealed necrotic ulcers with evidence of angioinvasion in the ulcer bed with mucor organisms. The PCR revealed the mucor to be Mycotypha microspora which is extremely rare. We discuss the challenges involved in the diagnosis and treatment of gastric mucormycosis.",
"affiliations": "Division of Gastroenterology, Montefiore Medical Center, Wakefield Campus, Bronx, NY, USA.;Department of Internal Medicine, Montefiore Medical Center, Wakefield Campus, Bronx, NY, USA.;Department of Surgery, Montefiore Medical Center, Jack D Weiler Hospital, Bronx, NY, USA.;Division of Gastroenterology, Montefiore Medical Center, Wakefield Campus, Bronx, NY, USA.",
"authors": "Guddati|Harish|H|;Andrade|Christopher|C|;Muscarella|Peter|P|;Hertan|Hilary|H|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/omcr/omy135",
"fulltext": "\n==== Front\nOxf Med Case ReportsOxf Med Case ReportsomcrOxford Medical Case Reports2053-8855Oxford University Press 10.1093/omcr/omy135omy135Case ReportAn unusual cause of massive upper gastrointestinal bleeding—gastric mucormycosis Guddati Harish 1Andrade Christopher 2Muscarella Peter 3Hertan Hilary 11 Division of Gastroenterology, Montefiore Medical Center, Wakefield Campus, Bronx, NY, USA2 Department of Internal Medicine, Montefiore Medical Center, Wakefield Campus, Bronx, NY, USA3 Department of Surgery, Montefiore Medical Center, Jack D Weiler Hospital, Bronx, NY, USACorrespondence address. Division of Gastroenterology, Montefiore Medical Center, Wakefield Campus, 600 East 233rd St, 4th Floor, Bronx, NY 10466, USA. Tel: (718) 9209047; Fax: (718) 9206857; E-mail: hari.adiga@gmail.com2 2019 16 2 2019 16 2 2019 2019 2 omy13506 9 2018 26 11 2018 1 1 2019 © The Author(s) 2019. Published by Oxford University Press.2019This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comAbstract\nMucormycosis of the gastrointestinal tract is a life threatening infection most commonly seen in patients with severe immunosuppression. A 42-year-old male with history of choriocarcinoma was admitted to the intensive care unit with septic shock. He developed massive hematemesis requiring upper endoscopy which showed multiple deep gastric ulcers. Due to uncontrollable bleeding he underwent an emergent gastrectomy which revealed necrotic ulcers with evidence of angioinvasion in the ulcer bed with mucor organisms. The PCR revealed the mucor to be Mycotypha microspora which is extremely rare. We discuss the challenges involved in the diagnosis and treatment of gastric mucormycosis.\n==== Body\nINTRODUCTION\nMucormycosis is a fungal infection that produces varying symptoms depending on the organs involved. Within the gastrointestinal tract it causes ischemia, bowel infarction and deep ulcers which can lead to massive bleeding due to angioinvasion. It is ubiquitous in the environment.\n\nAngioinvasive infection develops in patients with risk factors such as hematological malignancy, diabetic ketoacidosis and immunosuppressant use. Prompt recognition and treatment of gastric mucormycosis with surgical resection of the infected tissue alongside antifungal therapy is imperative for successful outcomes.\n\nCASE REPORT\nA 42-year-old male with stage 1 S germ cell tumor of the mediastinum, hemorrhagic pituitary prolactinoma which was diagnosed incidentally on computed tomography of the chest and brain after he had a left middle cerebral artery thrombotic stroke 7 months prior, presented to emergency room with complaints of lethargy and extreme weakness. He was being treated with Etoposide, Ifosfamide, Cisplatin regimen for his germ cell tumor with last dose a week before his emergency room visit. His prolactinoma was well controlled on Cabergoline. He was admitted to the intensive care unit with febrile neutropenia (absolute neutrophil count of 33 cells/µL) and septic shock from Escherichia Coli bacteremia. Initial labs revealed severe anemia with hemoglobin of 5.1 g/dL and platelet count of 2 k/uL. He required multiple units of blood and platelet transfusions. His hospital course was complicated by respiratory failure requiring mechanical ventilation and blood pressure support with four vasopressors (norepinephrine, dobutamine, vasopressin and phenylephrine). He was given multiple doses of intravenous methylprednisolone for additional blood pressure support. He was started on meropenem with gradual improvement in his clinical condition.\n\nOn Day 20 of admission, he developed hematemesis and drop in hemoglobin unresponsive to blood transfusions. A pantoprazole drip was started and emergent bedside upper endoscopy revealed blood clots in the fundus and upper body, ulcers in the gastric antrum and body, and a normal esophagus and duodenum (Fig. 1). Biopsy of an ulcer showed chronic active gastritis and foveolar hyperplasia suggestive of adjacent ulceration. Repeat endoscopy following IV erythromycin revealed multiple ulcers and a large blood clot in the fundus which could not be evacuated precluding endoscopic therapy. The patient underwent mesenteric angiography without an identifiable source of bleeding and empiric left gastric artery embolization was done in an attempt to stop the bleeding. Despite the procedure, he continued to have hematemesis and dropping hemoglobin. Emergent exploratory laparotomy was subsequently done which revealed a distended, blood filled stomach with multiple deep ulcerations. Total gastrectomy was performed with esophagojejunostomy and jejunostomy tube placement.\n\nFigure 1: Upper gastrointestinal endoscopy revealing multiple deep ulcers in the body (yellow arrows) with fresh blood in the lumen of the stomach.\n\nGross pathology revealed multiple hemorrhagic, deep ulcerations in the stomach (Fig. 2). Within the necrotic tissue of two ulcers histopathology revealed broad aseptate fungi with variable angle branching concerning for mucormycosis. These organisms were noted to surround and invade into ghost outlines of vessels indicating angioinvasion (Figs 3 and 4). Warthin Starry stain and immunostaining were negative for Helicobacter pylori and Cytomegalovirus (CMV), respectively. Our patient remained hemodynamically stable without further blood transfusions; he was titrated off blood pressure support medications and eventually extubated. During the postoperative course his sputum cultures grew Aspergillus fumigatus. He was started on combination treatment with amphotericin B and voriconazole. Polymerase chain reaction (PCR) later revealed Mycotypha microspora as the fungus causing invasive gastric mucormycosis. In view of renal failure, amphotericin B and voriconazole were switched to isavuconazole. He was ultimately discharged to rehabilitation facility with a prolonged course of posaconazole and micafungin.\n\nFigure 2: Gross examination of gastrectomy specimen revealing multiple deep ulcers with necrotic base (yellow arrow).\n\nFigure 3: Hematoxylin and eosin staining at ×400 magnification showing a broad aseptate fungus with variable angle branching (yellow arrows) consistent with mucormycosis in a background of cell debris.\n\nFigure 4: Broad aseptate fungus (green arrow) consistent with mucormycosis surrounding and invading into ghost outline of blood vessel (yellow arrow) consistent with angioinvasion. Grocott’s methenamine silver stain (GMC stain) at ×400 magnification.\n\nDISCUSSION\nMucormycosis, also known as zygomycosis, is an infection caused by a fungus of the Mucorales order prevalent throughout the environment. Common fungi causing mucormycosis include Rhizopus species, Mucor and Lichtheimia. In our case the gastric PCR showed Microtypha microspora subtype which is very rarely known to cause angioinvasive infection in humans [1]. These fungi have an enzyme called ketone reductase which helps to promote its growth in high glucose acidic conditions. The tendency for angioinvasion is due to high oxygen content in blood. Angioinvasion causes local ischemia, ulceration, infarction and necrosis [2]. Risk factors for angioinvasion include people with immunosuppression especially steroid use, prolonged antibiotic therapy, diabetic ketoacidosis, deferoxamine use and hematological malignancies. The mode of entry is either from inhalation or direct inoculation of sporangiospores into disrupted epithelium, such as skin or mucosa.\n\nMucor infection occurs anywhere in the body but the most common sites are pulmonary (24%), rhinocerebral (21%), cutaneous (19%), gastrointestinal (7%), CNS and disseminated forms. Within the GI tract, the stomach is most commonly involved (57.5%), followed by the colon (32.3%), then ileum (6.9%) [3, 4]. The most common presentation with GI mucormycosis is upper GI bleeding or gastric ulcers with abdominal pain. Potential complications also include intestinal obstruction, perforation and peritonitis.\n\nThompson et al. [5] classified gastric mucormycosis into three groups: colonization, infiltration and vascular invasion types. Colonization usually occurs in preexisting gastric ulcers and is of little clinical significance. Infiltrative type is where the fungus invades healthy adjacent tissue with no evidence of angioinvasion. The vascular invasive type is characterized by deep invasion into the stomach wall especially into the wall of blood vessels. Both infiltrative and invasive types are serious forms of infection with infiltrative disease having a lower risk of mortality than the angioinvasive type. In our patient above, the prolonged complicated hospital course requiring vasopressors and mechanical ventilation probably led to development of multiple ischemic ulcers in the stomach with neutropenia, germ cell tumor, intravenous steroid and broad spectrum antibiotic use promoting development of angioinvasive mucormycosis. Diagnosis requires a high level of clinical suspicion as it usually occurs in very ill patients admitted to the intensive care unit. Endoscopy usually shows multiple deep necrotic ulcerations in the stomach [6] with high risk for bleeding, infarction and perforation. As in our patient above, surgical resection of affected tissue is vital for diagnosis and treatment of mucormycosis as isolation of the causative organism can lead to therapy directed towards the specific fungus. Identification of the organism by histopathology followed by culture is used to confirm the diagnosis. The invasive type of mucormycosis requires microscopic evidence of aseptate, 10–20 µm hyphae branched at right angles in tissue that infiltrate into the blood vessels. As these organisms are ubiquitous in the environment culture results must be interpreted with caution. Culture often results in no growth, but more recently PCR is commonly being performed in the biopsy tissue with promising results [7]. Imprint cytology is another established tool for rapid diagnosis of mucormycosis [8]. The diagnosis is made on recognition of characteristic mucorales fungal hyphae. In some cases it may be difficult to demonstrate the fungus due to the fragile nature of the organism, but the sensitivity and specificity can be as high as 95% with proper technique [9]. This technique is useful for early institution of antifungal therapy for this potentially fatal disease while waiting for histopathological confirmation.\n\nTreatment usually involves the combination of surgical resection of infected tissue, antifungal medications and control of the predisposing conditions. The aim of surgery is to resect all infected necrotic tissue. The antifungal of choice is amphotericin B given the favorable profile against many of the organisms within the Mucorales order. Posaconazole or isavuconazole is used as step-down therapy once adequate response is achieved with amphotericin B [10]. For patients who do not respond to amphotericin B, literature supports the use of posaconazole or isavuconazole as salvage therapy. Antifungal therapy is usually continued for several weeks until adequate control of infection is achieved. Early initiation of therapy is important, one retrospective study demonstrated delaying treatment (more than 6 days) resulted in an almost 2-fold increase in mortality at 12 weeks [11]. In summary, gastric mucormycosis is a potentially fatal disease that develops in critically ill patients with multiple challenges in diagnosis and management. Successful outcomes are achieved with early diagnosis, prompt resection of infected tissue and a prolonged course of antifungal therapy.\n\nCONFLICT OF INTEREST STATEMENT\nNone.\n\nAUTHOR CONTRIBUTIONS\nHarish Guddati, MD—Author of the case (third year Gastroenterology fellow in the Division of Gastroenterology, Montefiore Medical Center, Wakefield Campus). Christopher Andrade, MD—Coauthor of the case (Internist at Andrade Medical Center, Bronx, NY). Peter Muscarella, MD—Reviewer of the case (General Surgery Site Director, Montefiore Medical Center, Weiler Hospital). Hilary Hertan MD, FACG—Reviewer of the case (Chief of Gastroenterology, Montefiore Medical Center, Wakefield Campus).\n\nGUARANTOR OF THE ARTICLE\nHarish Guddati, MD.\n\nFUNDING\nNone.\n\nSTATEMENT OF INFORMED CONSENT\nInformed consent was obtained for this case report from the deceased patient’s next of kin.\n==== Refs\nREFERENCES\n1 \nLacroix C , Leblanc T , Feuilhade de Chauvin M \nIsolation of Mycotypha microspora from stool samples of a leukemic child . J Mycol Med 2007 ;17 :188 –90 .\n2 \nChow KL , McElmeel DP , Brown HG , Tabriz MS , Omi EC \nInvasive gastric mucormycosis: a case report of a deadly complication in an immunocompromised patient after penetrating trauma . Int J Surg Case Rep 2017 ;40 :90 –3 .28946029 \n3 \nSpellberg B \nGastrointestinal mucormycosis: an evolving disease . Gastroenterol Hepatol 2012 ;8 :140 –2 .\n4 \nRoden MM , Zaoutis TE , Buchanan WL \nEpidemiology and outcome of zygomycosis: a review of 929 reported cases . Clin Infect Dis 2005 ;41 :634 –53 .16080086 \n5 \nThomson SR , Bade PG , Taams M , Chrystal V \nGastric mucormycosis . Br J Surg 1991 ;78 :952 –4 .1913115 \n6 \nIsmail MH , Hodkinson HJ , Setzen G , Sofianos C , Hale MJ \nGastric mucormycosis . Trop Gastroenterol 1990 ;11 :103 .2219440 \n7 \nHammond SP , Bialek R , Milner DA , Petschnigg EM , Baden LR , Marty FM \nMolecular methods to improve diagnosis and identification of mucormycosis . J Clin Microbiol 2011 ;49 :2151 . Epub 2011 Apr 20.21508149 \n8 \nKamatchi V , Aravindha Babu N , Leena Sankari S , Rajesh E \nImprint cytology . J Pharm Bioallied Sci 2015 ;7 :S207 –8 .26015712 \n9 \nShilpa P , Tathe MD , Aarti A , Dani MD , Sanjay M , Chawhan MD , et al \nGastric mucormycosis: diagnosis by imprint cytology . Diagn Cytopathol 2016 ;Vol 44 :820 –2 .\n10 \nArendrup MC , Jensen RH , Meletiadis J \nIn vitro activity of isavuconazole and comparators against clinical isolates of the mucorales order . Anatimicrob Agents Chemother 2015 ;59 :7735 –42 . Epub 2015 Oct 5.\n11 \nChamilos G , Lewis RE , Kontoyiannis DP \nDelaying amphotericin B-based frontline therapy significantly increases mortality among patients with hematologic malignancy who have zygomycosis . Clin Infect Dis 2008 ;47 :503 .18611163\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "2053-8855",
"issue": "2019(2)",
"journal": "Oxford medical case reports",
"keywords": null,
"medline_ta": "Oxf Med Case Reports",
"mesh_terms": null,
"nlm_unique_id": "101642070",
"other_id": null,
"pages": "omy135",
"pmc": null,
"pmid": "30800331",
"pubdate": "2019-02",
"publication_types": "D002363:Case Reports",
"references": "16080086;18611163;1913115;21508149;2219440;22485085;26015712;26438494;27321416;28946029",
"title": "An unusual cause of massive upper gastrointestinal bleeding-gastric mucormycosis.",
"title_normalized": "an unusual cause of massive upper gastrointestinal bleeding gastric mucormycosis"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK201905221",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VASOPRESSIN"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nBisphosphonates (BP) are an established medication, e.g., for the prevention/therapy of osteoporosis. The effects of the changed bone metabolism for orthodontic treatments are unknown.\n\n\nMETHODS\nA 66-year-old woman underwent a total oral rehabilitation. The therapy included (1) tooth extractions, (2) periodontal treatment, (3) insertion of dental implants, (4) provisional implant restorations, (5) orthodontic treatment, and (6) definite implant restorations. The orthodontic tooth movements were in- and retrusion of the upper frontal teeth, intrusion of the lower front teeth, using the dental implants as skeletal anchorage. After implant insertion and one month before beginning the orthodontic treatment, osteoporosis was diagnosed in this patient and, without notification to our facility, BP treatment was initiated by her general practitioner (alendronate oral, 70 mg/week), with an overall duration of intake of 7 months. After 13 months, the orthodontic treatment was successfully accomplished; however enlarged periodontal gaps, sclerotic bone areas, and mild apical root resorptions of the upper frontal teeth were found in this patient.\n\n\nCONCLUSIONS\nCurrently, there are no recommendations for orthodontic patients undergoing BP therapy. Orthodontic tooth movement in this low-risk patient with a short duration of intake and a low-dose BP medication was possible. Because of the reduced bone metabolism and the higher amount of side effects, the treatment should be performed with extremely light forces and frequent monitoring.",
"affiliations": "Department of Orthodontics, Medical Center of Johannes Gutenberg University Mainz, Mainz, Germany. elena.krieger@unimedizin-mainz.de",
"authors": "Krieger|Elena|E|;d'Hoedt|Bernd|B|;Scheller|Herbert|H|;Jacobs|Collin|C|;Walter|Christian|C|;Wehrbein|Heinrich|H|",
"chemical_list": "D050071:Bone Density Conservation Agents; D015921:Dental Implants; D019386:Alendronate",
"country": "Germany",
"delete": false,
"doi": "10.1007/s00056-012-0120-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1434-5293",
"issue": "74(1)",
"journal": "Journal of orofacial orthopedics = Fortschritte der Kieferorthopadie : Organ/official journal Deutsche Gesellschaft fur Kieferorthopadie",
"keywords": null,
"medline_ta": "J Orofac Orthop",
"mesh_terms": "D000368:Aged; D019386:Alendronate; D050071:Bone Density Conservation Agents; D015921:Dental Implants; D005260:Female; D006801:Humans; D012391:Root Resorption; D014087:Tooth Movement Techniques; D016896:Treatment Outcome",
"nlm_unique_id": "9713484",
"other_id": null,
"pages": "28-39",
"pmc": null,
"pmid": "23299652",
"pubdate": "2013-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17346586;19840975;19268836;20546824;20362905;17346585;16456688;8074093;16873332;8952616;16383048;16314620;18022461;8422033;19121496;11879557;8739141;19577157;7691628;15536834;11709665;16243172;20078789;21055592",
"title": "Orthodontic treatment of patients medicated with bisphosphonates-a clinical case report.",
"title_normalized": "orthodontic treatment of patients medicated with bisphosphonates a clinical case report"
} | [
{
"companynumb": "DE-IMPAX LABORATORIES, INC-2017-IPXL-00652",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ALENDRONATE SODIUM"
},
"drug... |
{
"abstract": "We report a patient with therapy-related acute promyelocytic leukemia (APL) that may have been caused by regional radiation or hormonal therapy after surgery. A 36-year-old Japanese woman developed right breast cancer and underwent breast-conserving surgery and regional radiation to the right breast without adjuvant systemic therapy because she wished to preserve her fertility. Two years later, she developed multiple bone metastases of breast cancer and received hormonal therapy. During the second line hormonal therapy, she developed APL and received induction and consolidation chemotherapy with all-trans retinoic acid (ATRA) and a combination of anthracycline and cytarabine. After she achieved a complete remission (CR) of the APL, her bone metastases of breast cancer progressed. She received weekly paclitaxel treatments and her bone marrow function recovered. However, 9 months later, her APL relapsed; she achieved a second CR after undergoing ATRA therapy again. This patient is thought to be a rare case of secondary leukemia, since the leukemia might have been caused by hormonal therapy and regional radiation without chemotherapy.",
"affiliations": "Breast and Medical Oncology Division, National Cancer Center Hospital, Chuo-ku, Tokyo 104-0045, Japan.",
"authors": "Ono|Makiko|M|;Watanabe|Takashi|T|;Shimizu|Chikako|C|;Hiramoto|Nobuhiro|N|;Goto|Yasushi|Y|;Yonemori|Kan|K|;Kouno|Tsutomu|T|;Ando|Masashi|M|;Tamura|Kenji|K|;Katsumata|Noriyuki|N|;Fujiwara|Yasuhiro|Y|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/jjco/hyn057",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0368-2811",
"issue": "38(8)",
"journal": "Japanese journal of clinical oncology",
"keywords": null,
"medline_ta": "Jpn J Clin Oncol",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D001943:Breast Neoplasms; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D015473:Leukemia, Promyelocytic, Acute; D007953:Leukemia, Radiation-Induced; D009364:Neoplasm Recurrence, Local; D016609:Neoplasms, Second Primary",
"nlm_unique_id": "0313225",
"other_id": null,
"pages": "567-70",
"pmc": null,
"pmid": "18617535",
"pubdate": "2008-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Therapy-related acute promyelocytic leukemia caused by hormonal therapy and radiation in a patient with recurrent breast cancer.",
"title_normalized": "therapy related acute promyelocytic leukemia caused by hormonal therapy and radiation in a patient with recurrent breast cancer"
} | [
{
"companynumb": "JP-PFIZER INC-2018254420",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TAMOXIFEN"
},
"drugadditional": null,
... |
{
"abstract": "Acute pancreatitis has been described as potential complication of both abdominal and non-abdominal surgeries. The pathogenetic mechanism underlying acute pancreatitis in spine surgery may include intraoperative hemodynamic instability causing prolonged splanchnic hypoperfusion, as well as mechanical compression of the pancreas due to scoliosis correction, with a higher risk in cases of more extended fusions, especially in young adults with lower body mass index (BMI).\nWe report here a case of postoperative acute pancreatitis with benign evolution in a young female patient after the first and second surgery of a two-stage correction of right thoracic idiopathic scoliosis.In December 2017, the patient underwent first-stage T4-L3 posterior arthrodesis with T7-T12 osteotomies and temporary magnetic bar. Intraoperative blood loss required massive transfusion. In the immediate postoperative period, the patient started reporting nausea/vomiting, abdominal pain at pressure, moderate meteorism, abdominal distension, hypoactive bowel sounds, and fever. Laboratory tests indicated a progressive increase in aspartate aminotransferase, alanine aminotransferase, serum amylase, lipase, phospho-creatine kinase, and reactive C-protein. A CT scan showed free abundant abdominal fluid in the hepatic, renal, pancreatic, and pelvic regions. After the diagnosis, a hypolipidic diet was initiated, and good hydration per os was maintained. After gastroenterologic consultation, somatostatin, rifaximin, and ursodehoxycholic acid were initiated and maintained for 8 days. In the following days, laboratory tests showed a slow but consistent decrease in liver and pancreatic enzymes until normalization. In January 2018, the patient underwent second-stage surgery with removal of magnetic bar, definitive posterior fusion, and instrumentation T4-L3. Laboratory tests showed a second, even more significant, increase in the amylase and lipase level and a moderate increase in the reactive C-protein. Therapy was maintained until complete normalization of amylase and lipase levels.\nEarly recognition of symptoms plays a key role in preventing severe morbidity after scoliosis surgery. When symptoms suggest abdominal complication, pancreatic and liver enzymes are to be evaluated for posing prompt diagnosis. Gastroenterologic consultation and eventual imaging are further steps in differential diagnosis and treatment of this rare complication.",
"affiliations": "1Anesthesia, Intensive Care and Pain Therapy, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy.;1Anesthesia, Intensive Care and Pain Therapy, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy.;1Anesthesia, Intensive Care and Pain Therapy, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy.;2Department of Spinal Deformity Surgery, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy.;1Anesthesia, Intensive Care and Pain Therapy, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy.",
"authors": "Ghisi|Daniela|D|0000-0002-7972-4305;Ricci|Alessandro|A|;Giannone|Sandra|S|;Greggi|Tiziana|T|;Bonarelli|Stefano|S|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s13013-018-0170-2",
"fulltext": "\n==== Front\nScoliosis Spinal DisordScoliosis Spinal DisordScoliosis and Spinal Disorders2397-1789BioMed Central London 17010.1186/s13013-018-0170-2Case ReportAcute pancreatitis after major spine surgery: a case report and literature review http://orcid.org/0000-0002-7972-4305Ghisi Daniela +39 051 6366289ghisidan@gmail.comdaniela.ghisi@ior.it 1Ricci Alessandro alessandro.ricci@ior.it 1Giannone Sandra sandra.giannone@ior.it 1Greggi Tiziana tiziana.greggi@ior.it 2Bonarelli Stefano stefano.bonarelli@ior.it 11 0000 0001 2154 6641grid.419038.7Anesthesia, Intensive Care and Pain Therapy, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy 2 0000 0001 2154 6641grid.419038.7Department of Spinal Deformity Surgery, Istituto Ortopedico Rizzoli, via G. C. Pupilli 1, 40136 Bologna, Italy 8 11 2018 8 11 2018 2018 13 242 8 2018 18 10 2018 © The Author(s). 2018Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nAcute pancreatitis has been described as potential complication of both abdominal and non-abdominal surgeries. The pathogenetic mechanism underlying acute pancreatitis in spine surgery may include intraoperative hemodynamic instability causing prolonged splanchnic hypoperfusion, as well as mechanical compression of the pancreas due to scoliosis correction, with a higher risk in cases of more extended fusions, especially in young adults with lower body mass index (BMI).\n\nCase presentation\nWe report here a case of postoperative acute pancreatitis with benign evolution in a young female patient after the first and second surgery of a two-stage correction of right thoracic idiopathic scoliosis.\n\nIn December 2017, the patient underwent first-stage T4-L3 posterior arthrodesis with T7-T12 osteotomies and temporary magnetic bar. Intraoperative blood loss required massive transfusion. In the immediate postoperative period, the patient started reporting nausea/vomiting, abdominal pain at pressure, moderate meteorism, abdominal distension, hypoactive bowel sounds, and fever. Laboratory tests indicated a progressive increase in aspartate aminotransferase, alanine aminotransferase, serum amylase, lipase, phospho-creatine kinase, and reactive C-protein. A CT scan showed free abundant abdominal fluid in the hepatic, renal, pancreatic, and pelvic regions. After the diagnosis, a hypolipidic diet was initiated, and good hydration per os was maintained. After gastroenterologic consultation, somatostatin, rifaximin, and ursodehoxycholic acid were initiated and maintained for 8 days. In the following days, laboratory tests showed a slow but consistent decrease in liver and pancreatic enzymes until normalization. In January 2018, the patient underwent second-stage surgery with removal of magnetic bar, definitive posterior fusion, and instrumentation T4-L3. Laboratory tests showed a second, even more significant, increase in the amylase and lipase level and a moderate increase in the reactive C-protein. Therapy was maintained until complete normalization of amylase and lipase levels.\n\nConclusions\nEarly recognition of symptoms plays a key role in preventing severe morbidity after scoliosis surgery. When symptoms suggest abdominal complication, pancreatic and liver enzymes are to be evaluated for posing prompt diagnosis. Gastroenterologic consultation and eventual imaging are further steps in differential diagnosis and treatment of this rare complication.\n\nElectronic supplementary material\nThe online version of this article (10.1186/s13013-018-0170-2) contains supplementary material, which is available to authorized users.\n\nKeywords\nPancreatitisScoliosisProne positionAmylaseLipasePostoperative complicationsissue-copyright-statement© The Author(s) 2018\n==== Body\nBackground\nAcute pancreatitis has been described in literature as a potential complication of both abdominal and non-abdominal surgeries. A recent prospective study reported an incidence of 7.4% in 176 young patients after surgery for scoliosis correction [1].\n\nAlthough the incidence of this potential postoperative complication of spine surgery has decreased since 1991 [1–3], acute pancreatitis needs to be considered in patients showing at least two of the following criteria: (1) abdominal pain or nausea/vomiting, (2) at least threefold increase in serum lipase level compared with the upper limit of normal level, (3) characteristic findings of acute pancreatitis on transabdominal ultrasonography or computed tomography (CT) [4]. Patients with neuro-fibromatosis type 1, Marfan syndrome, and cerebral palsy are at higher risk [1].\n\nThe pathogenetic mechanisms underlying acute pancreatitis in spine surgery may include intraoperative hemodynamic instability causing prolonged splanchnic hypoperfusion [1, 3] as well as mechanical compression of the pancreas due to scoliosis correction [1], with a higher risk in cases of more extended fusions, especially in young adults with lower body mass index (BMI) [5].\n\nA two-stage technique for posterior arthrodesis has been introduced in severe scoliosis and advocated for reduction in perioperative complications [6].\n\nWe report here a case of postoperative acute pancreatitis in a young female patient after the first and second surgery of a two-stage correction of right thoracic idiopathic scoliosis.\n\nCase presentation\nBetween the 1st and the 23rd of December 2017, a 15-year-female patient (weight 66 kg, height 174 cm, body mass index (BMI) 21.85 kg/m2) was hospitalized in our institution for severe idiopathic scoliosis (thoracic right scoliosis of 95°, thoracic kyphosis for 70°, lumbar lordosis of 62°, Risser grade 3 for ossification of the iliac crest apophysis (Fig. 1). An additional image file shows a 3D CT scan of the column (see Additional file 1). The 70° kyphosis is measured on column X-rays (see Additional file 2) with indication for a two-stage posterior arthrodesis including first-stage instrumentation with growing magnetic rod and second-stage posterior fixation. Parents signed consent for clinical data management for scientific purposes.Fig. 1 X-rays of the patient before surgical correction of her thoracic right scoliosis of 95°, thoracic kyphosis of 70°, and lumbar lordosis of 62°\n\n\n\nPatient’s clinical history was significant only for allergic rhinitis due to environmental allergens.\n\nOn the 4th of December, the patient underwent first-stage T4-L3 posterior arthrodesis with T7-T12 osteotomies and temporary magnetic bar (Figs. 2 and 3). Intraoperative blood loss required transfusion with 630 ml of autologous blood from cell saver, three units of homologous blood, and 600 ml of fresh frozen plasma. Surgery went otherwise uneventfully, and patient was transferred in spontaneous breathing to the postoperative intensive care unit after awakening from general anesthesia for postoperative monitoring.Fig. 2 X-rays after first-stage T4-L3 posterior arthrodesis with T7-T12 osteotomies and temporary magnetic bar\n\nFig. 3 X-rays after second stage: removal of magnetic bar and definitive posterior fusion and instrumentation T4-L3\n\n\n\nThe day after surgery, the patient started complaining of nausea and mild abdominal pain during pressure. One episode of vomiting occurred on postoperative day 1. Moderate tympanites, abdominal distension, and hypoactive bowel sounds were also noted. Laboratory tests indicated an increase in aspartate aminotransferase (AST, 235 U/L) and alanine aminotransferase (ALT, 152 U/L) levels as well as elevated serum amylase (341 U/L), lipase (704 U/L), phospho-creatine kinase (CK, 2313 U/L), and reactive C-protein (RCP, 16.73 mg/dL).\n\nA first ultrasound scan of the abdomen was performed showing significant meteoric intestinal distension. The pancreatic region was therefore not explorable.\n\nDuring the second postoperative day, patient complained of more severe pain during pressure in the hypocondrium and mesogastrium. Bowel was open to gas. A CT scan was performed, showing free abundant abdominal fluid in the hepatic, renal, pancreatic, and pelvic regions. Temperature raised to 38 °C and RCP increased to 18.49 mg/dL. Liver and pancreatic enzymes decreased mildly (AST = 165 U/L, ALT = 135 U/L, amylase = 261 U/L, lipase = 319 U/L, CK = 1827 U/L).\n\nIn the following days, laboratory tests showed a slow but consistent decrease in liver and pancreatic enzymes and the second CT scan performed on the 6th postoperative day demonstrated only moderate Douglas pouch effusion. After the diagnosis, a hypolipidic diet was initiated; good hydration per os was maintained; and somatostatin 0.1 mg three times a day per os, rifaximin 400 mg twice a day per os, ursodehoxycholic acid 300 mg twice a day per os were suggested for 8 days by the gastroenterologist who evaluated the patient, posed the diagnosis of acute pancreatitis, and suggested second-stage surgery to be delayed.\n\nPatient was then transferred to the floor and discharged home 19 days after surgery.\n\nOn the 15th of January, after complete normalization of the laboratory tests and preoperative gastroenterologic evaluation, the patient underwent second-stage surgery with removal of magnetic bar, definitive posterior fusion, and instrumentation T4-L3. After surgery, the patient was transferred to the intensive care unit.\n\nOn postoperative day 1, laboratory tests showed a second, even more significant, increase in the amylase (569 U/L) and lipase level (2133 U/L) and a moderate increase in the CRP (9.93 mg/dL). Patient complained of mild pain at pressure in the abdomen. First defecation occurred on postoperative day 3 and abdominal pain resolved without further issues. In the following days, pancreatic enzymes gradually normalized and the patient was transferred to the floor on postoperative day 4 and then home 9 days after the procedure. Therapy with somatostatin, rifaximin, and ursodehoxycholic acid was maintained until complete normalization of amylase and lipase. Trend of hepatic enzymes (AST, ALT, GGT), pancreatic enzymes, and C-reactive protein before and after first- and second-stage surgeries is represented in Figs. 4, 5, and 6.Fig. 4 Trend of hepatic enzymes (AST, ALT, GGT) before and after first- and second-stage surgeries (arrows)\n\nFig. 5 Trend of pancreatic enzymes (amylase and lipase) and creatine kinase before and after first- and second-stage surgeries (arrows)\n\nFig. 6 Trend of C-reactive protein (CRP) before and after first- and second-stage surgeries (arrows)\n\n\n\nDiscussion and conclusions\nAs previously reported in literature [3, 7, 8], acute pancreatitis can occur after spine surgery, severely complicating the postoperative course for the patient. A prolonged number of fasting days and longer hospitalization are in fact to be expected in patients with postoperative pancreatitis [9].\n\nIncidence varies among previous studies between 0.2 [10] and 7.4% [1]. Children with cerebral palsy undergoing spine surgery for scoliosis are the most likely to develop postoperative acute pancreatitis after posterior spinal fusion, with an incidence up to 30–55% [10, 11]. Correlation with lower body mass index (BMI), severe bleeding, intraoperative hypotension, preoperative Cobb angle of the main curve, and correction rate has been reported [10]. In contrast with other literature, Laplaza et al. found only older age and lower body index mass to be related to postoperative pancreatitis in 80 adolescents undergoing surgery for idiopathic scoliosis, thus excluding intraoperative bleeding and hypotension among risk factors [3]. Nevertheless, the hypothesized pathogenic mechanism is somehow related to hypoperfusion of the pancreas, caused by intraoperative hemodynamic instability or aggressive intraoperative hypotensive regimens to minimize blood losses, together with prolonged prone position which reduces retroperitoneal perfusion, thus leading to pancreatic ischemia [10]. Another advocated etiology is represented by mechanical compression of the pancreas, which increases with the amount of surgical correction of scoliosis. It is however still debated whether longer segments of fusion, the inclusion of the first lumbar vertebrae L1-L2, and the degree of correction may be independent risk factors for acute pancreatitis following scoliosis surgery [3, 10], while a correlation between lower BMI and the incidence of this complication seems accepted throughout literature. Less retroperitoneal fat may in fact easily expose the pancreas to direct compression against the vertebral column as described for blunt pancreatic traumatic injuries which are in fact more common in children and young adults because of a thinner or absent layer of protective adipose tissue around the pancreas [5].\n\nAcute pancreatitis (AP) is characterized by the autolysis of the pancreas. Trypsinogen is converted to trypsin causing inflammatory changes and leading to benign pancreatic edema or to pancreatic or peripancreatic necrosis, with poorer prognosis. The Atlanta modified guidelines have been redacted for pancreatitis diagnosis in adults [4]. In 2012, the INSPPIRE (International Study Group of Paediatric Pancreatitis: In search of a cuRE) criteria were published to guide diagnosis of acute pancreatitis in children. According to these criteria, acute pancreatitis can be recognized when there are two of the following: clinical symptoms (abdominal pain of acute onset, nausea, vomiting, and back pain) and increased levels of serum amylase and/or lipase at least three times greater than the upper limit of normal and imaging finding characteristic [12]. As a result of inflammation, a recent retrospective review of 76 cases of acute pancreatitis in patients of 1–12 years of age found increased C-reactive protein level in 38% and leukocytosis in 33% of children. Diagnosis is mainly clinical [13]. Ultrasonography has a high rate of false negative, especially in the early phase or in mild cases [14]. Nevertheless, some typical findings in ultrasound examination may help the diagnosis of acute pancreatitis, including swelling, changes in echogenicity of the pancreas, or fluid collections. When suspected, a computed tomography (CT) scan of the abdomen may support the clinical diagnosis with findings of changes specific to pancreatitis [15]. According to the INSPPIRE group, if there are two criteria of acute pancreatitis, there is no indication to perform CT of the pancreas [4] due to low sensitivity (47–81%) [16], especially in the first phase of pancreatitis (edematous). A CT scan is instead recommended when necrosis is suspected [17] or to exclude hemorrhage in this context [10].\n\nWhen acute pancreatitis is suspected, consultation with a gastroenterologist is suggested [10] for both diagnosis confirmation and intervention. Fasting and abdominal decompression with nasogastric tube are suggested. Total parenteral nutrition could support feeding during the early phase. Pharmacological interventions include proton-pump inhibitors and somatostatin intravenously. Patients must be monitored accurately for vital signs and abdominal objectivity. Laboratory tests are required to follow up pancreatic and liver enzymes until normalization.\n\nOur case report presents some specific features. The patient presented only some of the risk factors associated with postoperative acute pancreatitis: she was proposed for high-grade correction surgery and long segments of fusion but in two stages, and her BMI was normal. The patient had conspicuous intraoperative blood losses and underwent massive transfusion.\n\nThe postoperative presentation of the complication allowed prompt diagnosis because two out of three INSPPIRE criteria were met on postoperative day 1 (mild abdominal pain during pressure, nausea and vomiting, elevated amylase, and lipase levels). Differential diagnosis with superior mesenteric artery syndrome (SMAS) [18] had to be clarified, and confirmation was obtained on postoperative day 2 with a CT scan showing abundant free fluid and no constriction of the duodenum.\n\nTo avoid aggressive immediate correction of scoliosis, patients with higher grade of deformity undergo two-stage posterior arthrodesis at our institution, including first-stage instrumentation with a growing magnetic bar and second-stage posterior fusion [19]. Although we waited for complete normalization of laboratory tests before scheduling the second stage procedure, the patient presented another elevation of pancreatic enzymes postoperatively after second surgery. The second procedure lasted 3 h and did not require any blood transfusion. Nevertheless, on postoperative day 1, the patient started complaining of abdominal pain during pressure and nausea and showed a greater than threefold increase in pancreatic enzymes in laboratory tests. The recurrence of the complication may testify a subjective predisposition to the complication after prone position surgery and stretching of the retroperitoneum or a partial clinical resolution of the first episode although laboratory tests normalized completely preoperatively and preoperative ultrasound scan excluded a residual pancreatic edema.\n\nThe gastroenterologist who evaluated the patient after the first surgical procedure described the ultrasound evidence of cholecystic sludge and referred sphincter contraction related to morphine administration as another possible etiology. The hypothesis of a cholecystic origin for the pancreatitis may be considered, especially when liver enzymes are elevated. Opioid consumption should be reduced to the minimum in cases of postoperative pancreatitis in scoliosis surgery in adolescents.\n\nThe benign evolution of the case here presented is consistent with prognosis of postoperative pancreatitis in this population in previous literature.\n\nIn conclusion, early recognition of symptoms (e.g., abdominal pain, tenderness, abdominal distension, nausea/vomiting, hypoactive bowel sounds, anorexia) plays a key role in preventing severe morbidity after scoliosis surgery. When symptoms suggest abdominal complication, pancreatic and liver enzymes are to be evaluated for posing prompt diagnosis. Gastroenterologic consultation and eventual imaging are further steps in differential diagnosis and treatment of this rare complication.\n\nAdditional files\n\nAdditional file 1: Three-dimensional CT scan of the column. The image shows a 3D CT scan of the patient’s column. (JPG 316 kb)\n\n \nAdditional file 2: Column X-rays. The image shows the 70° kyphosis. (JPG 205 kb)\n\n \n\n\nAcknowledgements\nWe would like to thank Dr. Antonio Scarale for his support with the additional material and figures.\n\nFunding\nNot applicable\n\nAvailability of data and materials\nNot applicable\n\nAuthors’ contributions\nDG was responsible for the manuscript draft. AR conceived the idea of writing the case report and reviewed the patient’s chart. SG helped to draft the manuscript. TG and SB revised the manuscript. All authors read and approved the final manuscript.\n\nEthics approval and consent to participate\nNot applicable\n\nConsent for publication\nParents expressed and signed consent for patient data publication for scientific purposes.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nPublisher’s Note\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n1. Feng F, Tan H, Li X, Qiao Y, Chen C, Lin Y, Li Z, Shen J. Incidence and risk factors of acute pancreatitis following scoliosis surgery: a prospective study. Spine. 2017; [Epub ahead of print].\n2. Leichtner AM Banta JV Etienne N Pancreatitis following scoliosis surgery in children and young adults J Pediatr Orthop 1991 11 594 598 10.1097/01241398-199109000-00006 1717507 \n3. Laplaza FJ Widmann RF Fealy S Pancreatitis after surgery in adolescent idiopathic scoliosis: incidence and risk factors J Pediatr Orthop 2002 22 80 83 11744859 \n4. Banks PA Bollen TL Dervenis C Classification of acute pancreatitis--2012: revision of the Atlanta classification and definitions by international consensus Gut 2013 62 102 111 10.1136/gutjnl-2012-302779 23100216 \n5. Debi U Kaur R Prasad KK Pancreatic trauma: a concise review World J Gastroenterol 2013 19 9003 9011 10.3748/wjg.v19.i47.9003 24379625 \n6. Choi E Yaszay B Mundis G Hosseini P Pawelek J Alanay A Berk H Cheung K Demirkiran G Ferguson J Greggi T Helenius I La Rosa G Senkoylu A Akbarnia BA Implant complications after magnetically controlled growing rods for early onset scoliosis: a multicenter retrospective review J Pediatr Orthop 2017 37 e588 e592 10.1097/BPO.0000000000000803 27328123 \n7. Thompson JS Bragg LE Hodgson PE Rikkers LF Postoperative pancreatitis Surg Gynecol Obstet 1988 167 377 380 2459789 \n8. Rajaraman V Heary RF Livingston DH Acute pancreatitis complicating anterior lumbar interbody fusion Eur Spine J 2000 9 171 173 10.1007/s005860050230 10823436 \n9. Borkhuu B Nagaraju D Miller F Moamed Ali MH Pressel D Adelizzi-Delany J Miccolis M Dabney K Holmes L Jr Prevalence and risk factors in postoperative pancreatitis after spine fusion in patients with cerebral palsy J Pediatr Orthop 2009 29 256 262 10.1097/BPO.0b013e31819bcf0a 19305276 \n10. Feng F Tan H Li X Qiao Y Chen C Lin Y Li Z Shen J Incidence and risk factors of acute pancreatitis after scoliosis surgery: a prospective study Spine 2018 43 630 636 10.1097/BRS.0000000000002389 29016446 \n11. Abousamra O Nishnianidze T Rogers KJ Risk factors for pancreatitis after posterior spinal fusion in children with cerebral palsy J Pediatr Orthop B 2018 27 163 167 27509481 \n12. Morinville VD Husain SZ Bai H Definitions of pediatric pancreatitis and survey of present clinical practices J Pediatr Gastroenterol Nutr 2012 55 261 265 10.1097/MPG.0b013e31824f1516 22357117 \n13. El Bouyousfi M Leveque C Miladi L Acute pancreatitis following scoliosis surgery: description and clinical course in 14 adolescents Eur Spine J 2016 25 3316 3323 10.1007/s00586-016-4595-0 27155826 \n14. Restrepo R Hagerott HE Kulkarni S Acute pancreatitis in pediatric patients: demographics, etiology, and diagnostic imaging AJR Am J Roentgenol 2016 206 632 644 10.2214/AJR.14.14223 26901022 \n15. Grzybowska-Chlebowczyk U Jasielska M Flak-Wancerz A Więcek S Gruszczyńska K Chlebowczyk W Woś H Acute pancreatitis in children Gastroenterology Rev 2018 13 69 75 10.5114/pg.2017.70470 \n16. Park A Latif SU Shah AU Changing referral trends of acute pancreatitis in children: a 12-year single-center analysis J Pediatr Gastroenterol Nutr 2009 49 316 322 10.1097/MPG.0b013e31818d7db3 19503003 \n17. Bai HX Lowe ME Husain SZ What have we learned about acute pancreatitis in children? J Pediatr Gastroenterol Nutr 2011 52 262 270 10.1097/MPG.0b013e3182061d75 21336157 \n18. Altiok H Lubicky JP DeWald CJ The superior mesenteric artery syndrome in patients with spinal deformity Spine 2005 30 2164 2170 10.1097/01.brs.0000181059.83265.b2 16205341 \n19. Greggi T Maredi E Vommaro F Lolli F Martikos K Giacomini S Di Silvestre M Baioni A Scarale A Morigi A Bacchin MR Innovative method of gradual temporary distraction using magnetic growing rods (MCGR) for surgical treatment of severe kyphoscoliosis: mini-case series J Spine 2016 5 280\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2397-1789",
"issue": "13()",
"journal": "Scoliosis and spinal disorders",
"keywords": "Amylase; Lipase; Pancreatitis; Postoperative complications; Prone position; Scoliosis",
"medline_ta": "Scoliosis Spinal Disord",
"mesh_terms": null,
"nlm_unique_id": "101675716",
"other_id": null,
"pages": "24",
"pmc": null,
"pmid": "30456306",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "26901022;19305276;27328123;22357117;27509481;16205341;19503003;23100216;21336157;1717507;27155826;24379625;2459789;11744859;29657614;10823436;29016446",
"title": "Acute pancreatitis after major spine surgery: a case report and literature review.",
"title_normalized": "acute pancreatitis after major spine surgery a case report and literature review"
} | [
{
"companynumb": "IT-ALLERGAN-1856680US",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MORPHINE SULFATE"
},
"drugadditional": "3",
... |
{
"abstract": "Cutaneous Leishmaniasis (CL) is endemic in French Guiana but cases are usually sporadic. An outbreak signal was issued on May 15th 2020 with 15 suspected cases after a military training course in the rainforest. An outbreak investigation was carried out.\n\n\n\nThirty cases were confirmed. Leishmania guyanensis was the most frequent species (90%). The most frequent presentation was ulcerative (90%). Lesions on the face and hands were frequent (40% each). Eight cases (26%) presented a poor outcome after treatment with pentamidine and required a second line with amphotericin B. Three of them required further treatments with meglumine antimoniate or miltefosine. Two spots within the training area were deemed as likely sites of contamination, due to illegal logging. The isolated Leishmania strains did not form a separate cluster. Participation in Week 13 of year 2020 was associated with infection (OR = 4.59 [1.10-19.83]; p = 0.016) while undergoing only the \"Fighting\" exercise was protective (OR = 0.1 [0-0.74]; p = 0.021). There was no association between infection and other risk factors at the individual level. The attack rate of Regiment B (14/105 = 13.3%) was significantly higher (OR = 4.22 [1.84-9.53], p = 0.0001) compared to Regiment A (16/507 = 3.2%). The attack rate during this training course (30/858 = 3.5%) was significantly higher (OR 2.29 [1.28-4.13]; p = 0.002) than for other missions in French Guiana during the same period (22/1427 = 1.5%).\n\n\n\nThis outbreak could be explained by a combination of factors: climatic conditions around week 13, at-risk activities including night trainings, absence of impregnation, a lesser experience of rainforest duties in Regiment B and illegal logging attracting sandflies on military training grounds.",
"affiliations": "Laboratory of Parasitology-Mycology, Centre Hospitalier de Cayenne, Cayenne, French Guiana.;French Military Health Service-Armed Forces Epidemiology and Public Health Center, Marseille, France.;Laboratory of Parasitology-Mycology, Centre Hospitalier de Cayenne, Cayenne, French Guiana.;French Military Health Service-Kourou Medical Center, Kourou, French Guiana.;French Military Health Service-Kourou Medical Center, Kourou, French Guiana.;French Military Health Service-Cayenne Medical Center, Cayenne, French Guiana.;French Military Health Service-Inter Army Directorate of the Armed Forces Health Service, Cayenne, French Guiana.;French Military Health Service-Armed Forces Epidemiology and Public Health Center, Marseille, France.;UMR 1019 Tropical Biomes and Immuno-Physiopathology, University of French Guiana, Cayenne, French Guiana.;UMR 1019 Tropical Biomes and Immuno-Physiopathology, University of French Guiana, Cayenne, French Guiana.;National Reference Center for Leishmaniasis, associate laboratory, Cayenne, French Guiana.;Laboratory of Parasitology-Mycology, Centre Hospitalier de Cayenne, Cayenne, French Guiana.;National Reference Center for Leishmaniasis, associate laboratory, Cayenne, French Guiana.",
"authors": "Henry|Kim|K|;Mayet|Aurélie|A|;Hernandez|Miguel|M|0000-0002-9960-0561;Frechard|Guillaume|G|;Blanc|Pierre-Antoine|PA|;Schmitt|Marion|M|;André|Nathalie|N|;Loreau|Jean-Marie|JM|;Ginouves|Marine|M|;Prévot|Ghislaine|G|0000-0002-7268-4953;Couppié|Pierre|P|;Demar|Magalie|M|0000-0003-3414-0821;Blaizot|Romain|R|0000-0003-3695-6824",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1371/journal.pntd.0009938",
"fulltext": "\n==== Front\nPLoS Negl Trop Dis\nPLoS Negl Trop Dis\nplos\nPLoS Neglected Tropical Diseases\n1935-2727\n1935-2735\nPublic Library of Science San Francisco, CA USA\n\n34797836\n10.1371/journal.pntd.0009938\nPNTD-D-21-00902\nResearch Article\nMedicine and Health Sciences\nEpidemiology\nMedical Risk Factors\nMedicine and Health Sciences\nMedical Conditions\nInfectious Diseases\nDisease Vectors\nInsect Vectors\nSand Flies\nBiology and Life Sciences\nSpecies Interactions\nDisease Vectors\nInsect Vectors\nSand Flies\nBiology and Life Sciences\nOrganisms\nEukaryota\nProtozoans\nParasitic Protozoans\nLeishmania\nMedicine and Health Sciences\nMedical Conditions\nTropical Diseases\nNeglected Tropical Diseases\nLeishmaniasis\nMedicine and Health Sciences\nMedical Conditions\nParasitic Diseases\nProtozoan Infections\nLeishmaniasis\nMedicine and Health Sciences\nMedical Conditions\nInfectious Diseases\nZoonoses\nLeishmaniasis\nMedicine and Health Sciences\nClinical Medicine\nSigns and Symptoms\nLesions\nBiology and Life Sciences\nEcology\nEcosystems\nForests\nRainforests\nEcology and Environmental Sciences\nEcology\nEcosystems\nForests\nRainforests\nEcology and Environmental Sciences\nTerrestrial Environments\nForests\nRainforests\nMedicine and Health Sciences\nPharmacology\nDrugs\nAntimicrobials\nAntifungals\nAmphotericin\nBiology and Life Sciences\nMicrobiology\nMicrobial Control\nAntimicrobials\nAntifungals\nAmphotericin\nBiology and Life Sciences\nMycology\nAntifungals\nAmphotericin\nBiology and Life Sciences\nEvolutionary Biology\nEvolutionary Systematics\nPhylogenetics\nPhylogenetic Analysis\nBiology and Life Sciences\nTaxonomy\nEvolutionary Systematics\nPhylogenetics\nPhylogenetic Analysis\nComputer and Information Sciences\nData Management\nTaxonomy\nEvolutionary Systematics\nPhylogenetics\nPhylogenetic Analysis\nOutbreak of Cutaneous Leishmaniasis among military personnel in French Guiana, 2020: Clinical, phylogenetic, individual and environmental aspects\nOutbreak of Cutaneous Leishmaniasis in soldiers, French Guiana\nHenry Kim Data curation Formal analysis Investigation Writing – original draft 1\nMayet Aurélie Investigation Methodology Resources Writing – original draft 2 3\nhttps://orcid.org/0000-0002-9960-0561\nHernandez Miguel Formal analysis Software Writing – original draft 1 4\nFrechard Guillaume Investigation 5\nBlanc Pierre-Antoine Investigation 5\nSchmitt Marion Investigation 6\nAndré Nathalie Investigation 7\nLoreau Jean-Marie Investigation 2\nGinouves Marine Resources Validation 8\nhttps://orcid.org/0000-0002-7268-4953\nPrévot Ghislaine Conceptualization Project administration Resources 8 9\nCouppié Pierre Investigation Resources Validation 4 8 10\nhttps://orcid.org/0000-0003-3414-0821\nDemar Magalie Supervision Validation 1 4 8\nhttps://orcid.org/0000-0003-3695-6824\nBlaizot Romain Conceptualization Investigation Methodology Supervision Writing – original draft 4 8 10 *\n1 Laboratory of Parasitology-Mycology, Centre Hospitalier de Cayenne, Cayenne, French Guiana\n2 French Military Health Service—Armed Forces Epidemiology and Public Health Center, Marseille, France\n3 Aix Marseille University, INSERM, IRD, SESSTIM, Economic and Social Sciences of Health and Medical Information Processing, Marseille, France\n4 National Reference Center for Leishmaniasis, associate laboratory, Cayenne, French Guiana\n5 French Military Health Service—Kourou Medical Center, Kourou, French Guiana\n6 French Military Health Service—Cayenne Medical Center, Cayenne, French Guiana\n7 French Military Health Service—Inter Army Directorate of the Armed Forces Health Service, Cayenne, French Guiana\n8 UMR 1019 Tropical Biomes and Immuno-Physiopathology, University of French Guiana, Cayenne, French Guiana\n9 Univ. Lille, CNRS, Inserm, CHU Lille, Institut Pasteur de Lille, U1019—UMR 9017—CIIL—Center for Infection and Immunity of Lille, Lille, France\n10 Dermatology Department, Centre Hospitalier de Cayenne, Cayenne, French Guiana\nBrodskyn Claudia Ida Editor\nCentro de Pesquisa Gonçalo Moniz-FIOCRUZ/BA, BRAZIL\nThe authors have declared that no competing interests exist.\n\n* E-mail: blaizot.romain@gmail.com\n19 11 2021\n11 2021\n15 11 e000993819 6 2021\n21 10 2021\n© 2021 Henry et al\n2021\nHenry et al\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\n\nBackground\n\nCutaneous Leishmaniasis (CL) is endemic in French Guiana but cases are usually sporadic. An outbreak signal was issued on May 15th 2020 with 15 suspected cases after a military training course in the rainforest. An outbreak investigation was carried out.\n\nMethodology/Principal findings\n\nThirty cases were confirmed. Leishmania guyanensis was the most frequent species (90%). The most frequent presentation was ulcerative (90%). Lesions on the face and hands were frequent (40% each). Eight cases (26%) presented a poor outcome after treatment with pentamidine and required a second line with amphotericin B. Three of them required further treatments with meglumine antimoniate or miltefosine. Two spots within the training area were deemed as likely sites of contamination, due to illegal logging. The isolated Leishmania strains did not form a separate cluster. Participation in Week 13 of year 2020 was associated with infection (OR = 4.59 [1.10–19.83]; p = 0.016) while undergoing only the “Fighting” exercise was protective (OR = 0.1 [0–0.74]; p = 0.021). There was no association between infection and other risk factors at the individual level. The attack rate of Regiment B (14/105 = 13.3%) was significantly higher (OR = 4.22 [1.84–9.53], p = 0.0001) compared to Regiment A (16/507 = 3.2%). The attack rate during this training course (30/858 = 3.5%) was significantly higher (OR 2.29 [1.28–4.13]; p = 0.002) than for other missions in French Guiana during the same period (22/1427 = 1.5%).\n\nConclusions\n\nThis outbreak could be explained by a combination of factors: climatic conditions around week 13, at-risk activities including night trainings, absence of impregnation, a lesser experience of rainforest duties in Regiment B and illegal logging attracting sandflies on military training grounds.\n\nAuthor summary\n\nCutaneous Leishmaniasis is caused by parasites of the Leishmania genus and infects humans after a sandfly bite. Outbreaks are rare and hard to investigate in isolated tropical areas. In this study, the authors explored the different possible origins of an outbreak of cutaneous leishmaniasis among soldiers training in the rainforest of French Guiana. The outbreak occurred in March 2020. Concerning the symptoms, several patients presented resistant infections and multiple lines of treatment, raising the issue of resistant Leishmania strains. The different strains isolated during the outbreak were not genetically closed, as far as routine PCR techniques would indicate. The authors looked for individual behaviours exposing soldiers to sandfly bites but none was significantly associated with infection. The authors found two spots in the military training areas where illegal logging probably increased the density of sandflies and put service members at risk. The 13th week of 2020 was associated to a higher risk of infection due to climatic conditions. This study shows how interactions between humans and the rainforest can increase the risk of parasitic outbreaks.\n\nThe author(s) received no specific funding for this work. PLOS Publication Stagevor-update-to-uncorrected-proof\nPublication Update2021-12-03\nData AvailabilityAll relevant data are within the manuscript.\nData Availability\n\nAll relevant data are within the manuscript.\n==== Body\npmcIntroduction\n\nCutaneous Leishmaniasis (CL) is a Neglected Tropical Disease (NTD) affecting 91 countries throughout the world. Three quarters of all cases are reported in the Eastern Mediterranean Region and 18% in the Americas region (46 265 cases/year) [1]. More than 26000 cases are reported each year in Brazil [2]. In French Guiana, between 200 and 300 cases are reported annually [3,4]. In this French territory, five Leishmania species are reported: Leishmania guyanensis, L. braziliensis, L. naiffi, L. lainsoni, and L. amazonensis [3,5,6]. L. guyanensis is the most frequent species and usually represents more than 80% of cases each year [3]. This species is transmitted by the female phlebotomine sandfly Nyssomyia umbratilis, which has a sylvatic cycle [7]. Choloepus didactylus, or two-toed sloth, is the main reservoir for L. guyanensis in French Guiana [4,8]. L. braziliensis is the second most frequent species (10%] and is characterized by a high risk of mucosal infection [3].\n\nThe diagnosis of CL relies on clinical signs and microbiological confirmation. Smear is commonly used in French Guiana but does not provide species identification. As treatment differs between L. guyanensis and L. braziliensis, this identification is paramount for proper clinical care [3] Species identification is usually performed through Matrix Assisted Laser Desorption Ionization—Time of Flight (MALDI-TOF) or Polymerase Chain Reaction (PCR) followed by DNA Sanger Sequencing obtained from parasites cultured from skin biopsy or impregnate on cotton swabs [9]. Most contaminations occur during professional forest activities in farmers, gold miners and soldiers [3]. Most cases are sporadic and seen between November and May [3,6], though explanations for this apparent seasonality remain controversial. A decrease in rainfall during the dry season has been linked to an increase in CL cases two months later, possibly due to frequent forest activities during the dry months.[10]\n\nOnly three CL outbreaks have been described in French Guiana so far. Two occurred in military personnel in 1998 [11] and 2002 [12] and a third one in scientists infected with L. braziliensis during a forest trip [13]. This latter study was the only one involving phylogenetic analysis. Indeed, strains are rarely isolated during outbreaks due to the technical difficulties of collecting samples on the field. Besides, these outbreaks were limited in size and environmental on-field investigation was not performed.\n\nWe report here a large outbreak of Cutaneous Leishmaniasis occurring in military personnel in French Guiana. We discuss clinical presentations and treatment response, microbiological characteristics and factors associated with contamination such as environmental triggers or human behaviors.\n\nMethods\n\nEthics statement\n\nThis study (under the name CEFELEISH) was authorized by the Strasbourg Comité de Protection des Personnes (CPP) Est IV (1 Place de l’Hôpital—Bât PGIL 1 er étage– 67091 Strasbourg, France), with the identification number 2020-A02327-32. All patients gave their vocal assent to be included in the study. All symptomatic cases had provided previous written assent for routine clinical data collection while being treated at the Cayenne Hospital Center. No medical data were recorded from the controls and written assent was therefore unnecessary, according to the current French law.\n\nOn May 15th 2020, the Cayenne Inter-Army Medical Center referred 15 suspected cases of CL to the Dermatology Department of the Cayenne Hospital. In the following weeks, 36 others suspected cases of CL in service members were also referred by the Cayenne and Kourou military medical centers. Most patients belonged to two military units which will be named A and B in the present article. Medical histories suggested a common source of contamination during military training in the CEFE (Training Center in Equatorial Forest).\n\nThe CEFE is a French military training ground set in deep rainforest on the commune of Regina, 80 km away from the nearest town (Saint-Georges). This center welcomes all kind of military personnel and provides them with specialized training for survival and fighting in the Guyanese rainforest. However, personnel from units A and B represent most of trainees, due to their role in defending the territory of French Guiana and fighting illegal gold mining. Many different trainings are offered in the CEFE. At the time of this outbreak, the two most frequent courses were entitled Fighting (Combat) and Survival (Survie). The former lasts between one and two weeks while the latter usually lasts a week. A longer course (Jaguar) is sometimes also offered. Some of the instructors are permanently stationed in the CEFE.\n\nThis outbreak investigation was divided in four parts.\n\nClinical study\n\nIn order to investigate the clinical pattern of this outbreak, we gathered information on all cases of military personnel with suspected CL seen during the first semester of 2020 in the Cayenne Hospital or the Inter-Armies Medical Centers of Cayenne and Kourou. We excluded military personnel who did not undertake a CEFE course or did so before January 1st 2020 or after June 30th 2020. We also excluded service members with cutaneous leishmaniasis if the symptoms began more than 3 months after their CEFE course AND if they had performed other forest missions in the meanwhile, as the relationship between infection and the CEFE was deemed unlikely. A confirmed case of CL was defined as compatible clinical presentation AND at least one positive laboratory test (smear, culture on skin biopsy, MALDI-TOF on biopsy culture, PCR on cotton swab) OR complete response after empirical therapy with pentamidine.\n\nPatients were always seen one month after treatment: good response was then defined as decrease in lesions size by at least 50%, with no new lesions. Patients were then seen after a three-months follow-up: good response was then defined as healing of all lesions, with no new lesion. These clinical criteria are those usually used in our Dermatology Department [14].\n\nPhylogenetic comparisons\n\nA phylogenetic comparison was made between the different strains isolated during the outbreak. PCR on cotton swabs was performed according to previously published protocols [9]. QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany), was used to extract the parasite genomic DNA from cotton swabs, according to the manufacturer’s instructions. The Hsp70 gene then subsequently amplified by PCR using primers Hsp70senM (5’-GACGGTGCCTGCCTACTTCAA-3’) and Hsp70ant (5’CCGCCCATGCTCTGGTACATC 3’). PCR was performed using the following mixture: 0.112μM primers, 10 μL 5x HOT FIREPol Blend Master Mix (Solis BioDyne, Tartu, Estonia) and 10 μL of DNA template, for a final volume of 50 μL. Reaction cycles included initial denaturation for 14 min at 95°C, then 40 cycles of 30s at 95°C; followed by cycles of 45s at 60°C and 1.5 min at 72°C; and a final 5 min extension step at 72°C. Amplified products (»1500 bp) were visualized by electrophoresis on 1% agarose gels, and were sent to Genoscreen (Lille, France) for DNA sequencing.\n\nChromatograms obtained from DNA Hsp70 sequence were visualized using Chromas software, (version 2.6.5, Technelysium Pty. Ltd., Tewantin, Queensland, Australia), corrections were made by visualization. Consensus Hsp70 sequences were obtained using Bioedit version 7.2. Consensus sequences were then subjected to BLASTn on GenBank (NCBI web site) to look for similarity with Leishmania reference sequences and achieve correct species identification.\n\nConsensus sequences were aligned by using T-coffee software (http://tcoffee.crg.cat/apps/tcoffee/index.html). A phylogenetic tree was then built for each gene Using MEGA software 7.0.26 (Penn State University, PA, USA). Distances from nucleotide sequences were estimated with the Kimura-2 parameter model, and trees were built with the maximum likelihood (ML) method and bootstrap resembling was used across 1000 replicates. Phylogenetic trees were built using all confirmed cases of CL with positive PCR and available clinical data. Comparison was made by using reference strains from the literature and 25 cases of CL observed in civilians throughout French Guiana during the study period.\n\nEpidemiological study\n\nA case-control study was performed to evaluate behavioural patterns associated with the occurrence of CL infection. Cases were patients included in the clinical study who also agreed to answer supplementary questions. Controls were randomly selected service members who undertook a CEFE course between January 1st 2020 and 30th June 2020 without symptomatic CL infection and agreed to be included. Cases and controls were called and interviewed by phone by the same investigator (KH).\n\nEnvironmental investigation\n\nAn on-field investigation was performed in August 2020 on the CEFE site. A team was dispatched to review the military gear used during CEFE courses, the different training spots and places of encampment. The team notably looked for spots where sandflies could be drawn into contact with humans, like streams, recently cleared or forested areas, encampments … We also looked for climatic factors which could explain the increased number of cases in this period of 2020.\n\nStatistics\n\nThe relationship between individual risk factors and Leishmania infection was analyzed using Fisher’s exact test or χ2 test, as appropriate. Statistical analyses were performed using Stata Software (StataCorp, College Station, USA) with a significance bilateral threshold of 0.05.\n\nResults\n\nClinical study\n\nBetween January 1st 2020 and June 30th 2020, 51 service members were referred to our Department or to the Inter-Army Medical Center of Kourou with suspected CL. Twenty-one were excluded (Fig 1). In total, we included 30 soldiers with confirmed CL who had undertaken a CEFE course during the first semester of 2020. Among them, 22 were included in the case-control study, 26 in the phylogenetic study. Inclusions the three arms of the study are summed up in this flow-chart (Fig 1).\n\n10.1371/journal.pntd.0009938.g001 Fig 1 Flow chart of patients respectively included in the clinical description of cases, phylogenetic analysis and case-control study, CEFE outbreak, French Guiana, 2020.\n\nThe clinical characteristics of the thirty included cases are presented in Table 1.\n\n10.1371/journal.pntd.0009938.t001 Table 1 General characteristics of confirmed cases of Cutaneous Leishmaniasis, CEFE outbreak, French Guiana, 2020 (n = 30).\n\n\tNumber of patients, (%)\t\nMean age (year)\t32\t\nGender: male\t30 (100%)\t\nMilitary unit\t\t\nA\t16 (53.3%)\t\nB\t14 (46.7%)\t\nCEFE period (2020 calendar weeks)\t\t\nInstructor (always present)\t1 (3.3%)\t\nWeek 4 to Week 12\t1 (3.3%)\t\nWeeks 6–7\t1 (3.3%)\t\nWeek 13–14\t20 (66.7%)\t\nWeek 16–17\t4 (13.3%)\t\nWeek 17–20\t2 (6.7%)\t\nWeek 19–20\t1 (3.3%)\t\nCEFE activity\t\t\nFighting\t24 (80.0)\t\nOther trainees\t4 (13.3%)\t\nRainforest specialist\t2 (6.67%)\t\nInternational training course « Jaguar »\t2 (6.67%)\t\nInstructor\t2 (6.67%)\t\nPrevious history of CL\t0\t\nLesion location\t\t\nUpper limbs\t19 (63.3%)\t\nHands\t12 (40%)\t\nLower limbs\t13 (43.3%)\t\nTrunk\t7 (23.3%)\t\nFace\t12 (40%)\t\nNeck\t6 (20%)\t\nScalp\t2 (6.7%)\t\nLesion type\t\t\nUlceration\t27 (90%)\t\nNodule\t6 (20%)\t\nPapule\t5 (16.7%)\t\nOther\t1 (3.3%)\t\nMean number of lesions (1–30)\t4.33\t\nMedian number of lesions\t3 (1–6)\t\nMucosal lesion\t0\t\nLymphadenopathy\t4 (13.3%)\t\nLymphangitis\t1 (3.3%)\t\nLaboratory tests\t\t\nPositive smear\t16 (53.3%)\t\nPositive culture\t11 (36.7%)\t\nIncluding MALDI-TOF identification\t11 (36.7%)\t\nPositive PCR\t26 (86.7%)\t\nParasite species:\t\t\nLeishmania guyanensis\t27 (90%)\t\nLeishmania spp\t1 (3.3%)\t\nUnknown (no PCR or negative PCR)\t2 (6.6%)\t\nTreatment: 1st line (n = 30)\t\t\nPentamidine\t30 (100%)\t\nResponse at 1 month (n = 30)\t\t\nGood response\t15 (50%)\t\nBad response/failure\t10 (33.3%)\t\nLost to follow-up\t5 (16.7%)\t\nTreatment: 2nd line (n = 8)\t8 (26.7%)\t\nPentamidine (2nd injection)\t2 (25%)\t\nAmphotericin B\t6 (75%)\t\nResponse at 3 months (n = 8)\t8\t\nGood response\t2 (25%)\t\nBad response\t3 (37.5%)\t\nLost to follow-up\t3 (37.5%)\t\n\nAll of them were men, with a median age of 31 (IQR [26–51]). Regarding medical histories and outcomes, there was no recorded comorbidity such as HIV infection, diabetes, renal failure, overweight or immunosuppressive therapy. The most frequent location of lesions was upper limbs in 19 patients (63.33%), followed by lower limbs (13, 43.3%). The face and hands were frequently involved (12 patients each, 40%). The most frequent type of lesion was ulceration (27 patients, 90%). We recorded no mucosal involvement.\n\nConcerning laboratory tests, 26 patients (86.7%) had a positive PCR on cotton swabs, 16 (53.3%) had a positive smear, 11 (36.7%) had a positive culture which allowed MALDI-TOF for species identification. The infecting Leishmania species was identified for 90% of cases (27 patients) and was always Leishmania guyanensis. Among these 27 patients, species identification was allowed by PCR and confirmed by MALDI-TOF in 9 of them, by PCR only in 17 patients (56.7%), and by MALDI-TOF only for two patients. In the Cayenne Hospital Centre, PCR on cotton swabs and parasitological cultures on skin biopsy are performed in parallel. MALDI-TOF on culture is impossible when cultures are contaminated by bacteria or fungi, but sometimes yields a species identification while PCR in the same patient is negative.\n\nAll thirty patients received a first-line treatment with pentamidine isethionate. Due to different protocols in the Military Center and the Cayenne Hospital, 17 of them (56.7%) received three intravenous injections of 4mg/kg/d [15] while 12 patients (40%) received one intramuscular injection of 7mg/kg/d [3]. One was treated in mainland France with pentamidine but it is not known which protocol was used. Half of cases (15 patients) presented a complete response after this first line of treatment, regardless of the regimen used (one or three injection). Five patients (16.7%) were lost to follow-up.\n\nOne third of cases (10) did not present a good response to this first line of treatment, and eight patients (26.7%) received a second line with amphotericin B (4mg/kg/d for five days) [14] while the two others were lost to follow-up. Among these 10 patients who presented a bad outcome after the first scheme, five had received three IV injections and five had received one IM injection. There was no significant difference in bad outcome between these two groups (OR 0.58 [0.09–3.62], p = 0.49).\n\nAmong the eight patients who received a second line of treatment, three were lost to follow-up, two presented a good response, and three were not healed and needed a third line of treatment. The clinical history of these three patients is summed up in Figs 2 and 3.\n\n10.1371/journal.pntd.0009938.g002 Fig 2 Clinical evolution of patient 1, CEFE outbreak, French Guiana, 2020: initial lesion of the left cheek (2a), which improved after pentamidine; new lesion on the opposite cheek (2b) improved after amphotericin B (2c); new relapse occurred on the right ear and the forehead (2d); after another unsuccessful amphotericin B course and three weeks of meglumine antimoniate (75mg/kg/d), improvement was seen on the face (2e) but disseminated new lesions appeared. Healing was obtained after one month of oral miltefosine (50mg tid).\n\n10.1371/journal.pntd.0009938.g003 Fig 3 Clinical evolution of patient 2 and 3, CEFE outbreak, French Guiana, 2020: patient 2 presented an ulceration on the ear and papules of the adjacent cheek (3a); improvement after pentamidine (3b) followed by relapses (3c), requiring a course of amphotericin B, then a second scheme in association with miltefosine (3d), with partial response (3e) followed by a relapse. The patient was then treated with 3 weeks of meglumine antimoniate. Patient 3 presented a similar history with a pseudo-verrucous plaque of the neck (3f), which first improved (3g), and then relapsed (3h) motivating a further line of treatment with amphotericin B, amphotericin B and miltefosine then finally meglumine antimoniate.\n\nThe temporal repartition of confirmed cases is presented in Fig 4 with the likely time of contamination corresponding to the week of CEFE training for each individual. A peak was observed during week 13 of the calendar year.\n\n10.1371/journal.pntd.0009938.g004 Fig 4 Number of confirmed cases of cutaneous leishmaniasis for each calendar week between February and June 2020, CEFE training site, French Guiana, 2020.\n\nPhylogenetic comparisons\n\nConcerning the phylogenetic analysis, no specific cluster was identified for the whole set of strains isolated during this outbreak (Fig 5). In total, 26 patients had a positive PCR yielding L. guyanensis and suitable for phylogenetic analysis. These strains are presented in Fig 5. Two pseudo-clusters are visible and framed in orange, gathering all the 26 outbreak strains (green dots) but also several samples from civilian patients gathered during the same period throughout French Guiana (red squares). These civilian samples included patients infected in the commune of Regina where the CEFE is located (20-05-20 2025, 30-05-20 2040, 13-05-20 2049, 02-04-20 2041) but also many strains from distant areas such as the Maroni (23-06-20 2037, 07-05-20 2008) or Oyapock (15-05-20 2011) rivers. These pseudo-clusters were, however, well differentiated from reference strains belonging to other species such as L. braziliensis, L. peruviana, L. naiffi or L. lainsoni, which are underlined in blue on the right side of the tree. Only two samples of L. panamensis (KX574010.1 KX573981.1), known to be genetically very close to L. guyanensis, were included in the orange pseudo-clusters, along with two reference strains of L. guyanensis (KX574011.1 and HF584406.1).\n\n10.1371/journal.pntd.0009938.g005 Fig 5 Phylogenetic tree of isolated strains and samples used for comparison, CEFE outbreak, French Guiana, 2020; green dots indicate the 26 strains isolated during the outbreak; red squares indicate 25 other strains isolated in French Guiana during the same period; blue triangles indicate 15 references strains used for species identification.\n\nEpidemiological study\n\nAmong the thirty confirmed CL cases of the outbreak, eight could not be reached after their clinical follow-up and were not included in the case-control study (Fig 1). In order to recruit controls, we recovered randomly and anonymously a total of 80 phone numbers of CEFE trainees during the same study period who did not present any sign of Cutaneous Leishmaniasis. Among them, 58 were excluded (Fig 1). A total of 22 controls were included. The results of this case-control study are presented in Table 2.\n\n10.1371/journal.pntd.0009938.t002 Table 2 Risk factors of Cutaneous Leishmaniasis, case-control study, univariate analysis, confirmed cases of the CEFE outbreak and military controls, French Guiana, 2020.\n\n\tCases\tControls\tOR (95%CI)\tp-value\t\nGeneral data\t\t\t\t\t\nAge (years)\t\t\t\t\t\n• <30\t9 (40.9%)\t10 (45.45%)\t0.83 (0.22–3.22)\t0.761\t\n• ≥30\t13 (59.1%)\t12 (54.6%)\t-\t\t\nRank\t\t\t\t\t\n• Private\t19 (86.4%)\t13 (59.1%)\t4.38 (0.84–29.03)\t0.088\t\n• Non-commissioned officer\t2 (3.9%)\t6 (27.3%)\t-\t\n• Officer\t1 (4.6%)\t3 (13.6%)\t\nMilitary unit\t\t\t\t\t\n• A\t13 (59.1%)\t19 (86.36%)\t0.24 (0.03–1.18)\t0.088\t\n• B\t9 (40.9%)\t3 (13.64%)\t-\t\t\nFirst time in CEFE\t\t\t\t\t\n• Yes\t10 (45.45%)\t6 (27.3%)\t2.2 (0.54–9.56)\t0.210\t\n• No\t12 (54.6%)\t16 (72.7%)\t-\t\t\nType of training\t\t\t\t\t\n• Fighting\t16 (72.7%)\t22 (100%)\t0.1 (0–0.74)\t0.021\t\n• Rainforest specialist\t2 (9.1%)\t0\t-\t\n• Jaguar\t2 (9.1%)\t0\t\n• No training: instructor\t2 (9.1%)\t0\t\nCEFE period\t\t\t\t\n• Week 4 to Week 12\t2 (9.1%)\t0\t-\t\n• Week 6 to Week 7\t1 (4.5%)\t9 (40.9%)\t\n• Week 13 to Week 14\t15 (68.2%)\t7 (31.8%)\t4.59 (1.1–19.83)\t0.016\t\n• Week 16 to Week 17\t3 (13.6%)\t4 (18.2%)\t-\t\n• Week 19 to Week 20\t1 (4.5%)\t0\t\n• Week 21 to Week 22\t0\t2 (9.1%)\t\nAdditional survival exercise\t\t\t\t\t\n• Yes\t5 (22.7%)\t0\t5.95 (0.58–305.73)\t0.185\t\n• No\t17 (77.3%)\t22 (100%)\t-\t\t\nKnowledge of the disease\t\t\t\t\t\nKnows that leishmaniasis is transmitted by a sandfly\t\t\t\t\t\n• Yes\t21 (95.45%)\t19 (86.4%)\t3.23 (0.24–182.19)\t0.607\t\n• No\t1 (4.55%)\t3 (13.6%)\t-\t\t\nKnows the most at-risk hours of the day\t\t\t\t\t\n• Yes\t19 (86.4%)\t17 (77.3%)\t1.84 (0.30–13.64)\t0.698\t\n• No\t3 (13.6%)\t5 (22.7%)\t-\t\t\nKnows that lights attract sandflies\t\t\t\t\t\n• Yes\t21 (95.5%)\t21 (95.5%)\t1 (0.01–82.18)\t1\t\n• No\t1 (4.5%)\t1 (4.5%)\t-\t\t\nCan mention three means of prevention against leishmaniasis\t\t\t\t\t\n• Yes\t18 (81.8%)\t21 (95.5%)\t3.32 (0.24–182.18)\t0.345\t\n• No\t4 (18.2%)\t1 (4.5%)\t-\t\t\nBehavior during training\t\t\t\t\t\nWearing long clothes\t\t\t\t\t\n• Daily\t18 (81.8%)\t19 (86.4%)\t0.72 (0.092–4.89)\t1.000\t\n• Sometimes\t4 (18.2%)\t3 (13.6%)\t-\t\t\nType of hammock used\t\t\t\t\t\n• Provided by the army\t15 (68.2%)\t11 (50%)\t2.14 (0.54–8.78)\t0.220\t\n• Personal\t7 (31.8%)\t11 (50%)\t-\t\t\nUse of mosquito net\t\t\t\t\t\n• Yes\t22 (100%)\t22 (100%)\t-\t\t\n• No\t0\t0\t-\t\t\nDaily use of mesh hammock\t\t\t\t\t\n• Yes\t3 (13.6%)\t2 (9.1%)\t1.58 (0.16–20.65)\t1.000\t\n• No\t19 (86.4%))\t20 (90.9%)\t-\t\t\nClothes impregnation by soldiers\t\t\t\t\t\n• Yes\t3 (13.6%)\t2 (9.1%)\t1.58 (0.16–20.65)\t1.000\t\n• No\t19 (86.4%)\t20 (90.9%)\t-\t-\t\nSkin repellent, frequency of use\t\t\t\t\t\n• Daily\t13 (59.1%)\t16 (72.7%)\t-\t\t\n• Sometimes\t8 (36.4%)\t3 (13.6%)\t1.18 (0–2.59)\t0.163\t\n\nMosquito nets provided to trainees systematically benefited from long-lasting impregnation. Clothes were also pre-impregnated but this impregnation became less effective after several washings and under the damp tropical conditions of forest trainings. Soldiers were advised to regularly perform a new impregnation with an appropriate repellent, but few of them followed this advice (three in the cases group and two in the control group). However the impregnation of clothes was not a significant protective factor. Soldiers undertaking only the “Fighting” course had a lower risk of infection compared with those undertaking longer courses such as “Jaguar” or “Rainforest specialist” or instructors permanently stationed in the CEFE (OR = 0.1 [0–0.74]; p = 0.021). No other individual behaviour was statistically associated with a higher risk of CL. Undertaking a course during week 13 or 14 was associated with a higher risk of infection (OR = 4.59; [1.1–19.83]; p = 0.0159).\n\nDuring the study period 2285 military personnel were deployed in French Guiana. Among them, 858 took part in the CEFE (Table 3). Taking part in a CEFE course was significantly associated with a higher risk of CL infection (OR 2.29 [1.28–4.13], p = 0.0023). The attack rate among the 105 members of unit B undertaking a course was significantly higher (OR = 4,22 [1.84–9.53], p = 0.0001) than in Regiment A (whose 507 members all took part in one of the CEFE courses) (Table 3).\n\n10.1371/journal.pntd.0009938.t003 Table 3 Comparison of attack rates of CL in French Guiana during the study period, according to attendance of a CEFE course and regiment, 2020.\n\n\tCases of CL\tTotal\tAttack rate\tOR (95%IC)\tp-value\t\nAttack rates with or without CEFE training\t\t\t\t\t\t\n• French Guiana, CEFE excluded\t22\t1427\t1.54%\t-\t\t\n• CEFE\t30\t858\t3.5%\tOR 2.29 (1.28–4.13)\t0.0023\t\nAttack rates according to regiment\t\t\t\t\t\t\n• Military unit A\t16\t507\t3.16%\t-\t\t\n• Military unit B\t14\t105\t13.33%\tOR 4.22 (1.84–9.53)\t0.0001\t\n\nEnvironmental investigation\n\nThe whole CEFE area extends over 60km2, between the Approuague and Mataroni rivers (Fig 6).\n\n10.1371/journal.pntd.0009938.g006 Fig 6 Map of Training Center in Equatorial Forest, CEFE outbreak, French Guiana, 2020, layer from a Guiana Amazonian Park (Parc Amazonien de Guyane) map available at http://cartotheque.parc-amazonien-guyane.fr/index.php/view/map/?repository=pag&project=Limites_PAG.\n\nConcerning awareness of CL, we performed interviews with officers responsible for the training courses. It appeared that all trainees received information and prevention advices on several tropical diseases, including CL, on the first day of every course. Pieces of advice included protection against small, non-visible mosquitoes; wearing long sleeves and using repellent; holding headlamps with the hand and not wearing it on the forehead. A slight misconception was noted as a focus was given to a local tree named “Bois-cathédrale” (Chimarrhis turbinate). This tree was considered by officers as the main shelter for sandflies and soldiers were advised to avoid it but were also falsely reassured if no C. turbinate was spotted.\n\nConcerning the military gear provided to trainees, it included a Brazilian-model hammock with tight mosquito net and a repellent containing 4% of permethrin. This repellent is normally used for clothing protection but most soldiers misused it and put it on their skin.\n\nConcerning the different exercises performed by the trainees, we looked for activities that could put vectors in contact with humans. Night activities had been stopped in 2016, but started again in 2017. Many exercises were performed close to rivers or streams.\n\nDuring our tour of the 6000-hectares site, we inspected all zones of encampment or bivouac. Most of them were cleaned and dry areas with only a few well-trimmed trees (Fig 6). Only two sites came to our attention as bearing specific high risk for contact with sandflies. The first one was a fighting place nicknamed “Fighting Village” (Village Combat) (Fig 6). This decoy village is located on the right bank of the Mataroni, about 300 meters from a legal gold mine of 40 hectares. Civilian forest work on the outskirts of this mine were reported by officers and could have increased the population of sandflies in the surroundings of the village. Different platoons are charged with the defence or attack of the position. Service members had to keep a watch during whole nights, sometimes laying on the ground or creeping in the underbrush.\n\nThe second high-risk site was nicknamed “Curotel” (Fig 6) and formed the ending stage of every training. It is located about 500 meters from headquarters, a few meters away from a small stream (Fig 6). Three deforestation places were spotted less than 300 meters from Curotel: an açaï palm farm in expansion; a traditional corn field on slash-and-burn ground; an illegal timber extraction site were dozen of fallen tree trunks were observed.\n\nConcerning the weather during the end of 2019, November appeared to be drier than other years with -52% of rainfall in Regina (compared to normal between 1981 and 2010) [16], followed by a wetter December (+22%) [17] and a very dry January (-67%) [18]. March 2020 was described as the hottest one since 1955, with a mean temperature of 31,7°C and a 32% decrease in rainfall in Regina [19]. These climatic conditions with sharp variations correspond to the highest risk for contaminations [20].\n\nDiscussion\n\nThis study explores four aspects of a CL outbreak (clinical, phylogenetic, epidemiological and environmental) in order to explore all possible factors explaining these grouped cases.\n\nRegarding the clinical data, the features observed in this outbreak, such as predominance of L. guyanensis, ulcerative lesions (90%) or absence of mucosal infection, are in line with usual features observed in French Guiana [3]. However, lesions were more frequently located on the face and the upper limbs (notably the hands), while lower limbs are usually more involved in civilians of French Guiana [3]. This difference is probably explained by the use of uniforms with longs pants. Despite similar species and clinical presentations, ten patients presented a bad outcome, compared to the other 20. Three patients were particularly difficult to heal and needed at least four different schemes. This poor therapeutic response may question the possible resistance of the parasite to the usual treatment by pentamidine. In vitro sensitivity to pentamidine has been studied and identified on promastigote culture in French Guiana, with a strong correlation with patient outcome [21].\n\nTherapeutic failure can also be caused by host factors. Th1 immune response is necessary for the control of Leishmania infection [22] but an exacerbation can induce severe CL disease [23]. Th1 response is crucial in the initiation of protection while Th2 response allows parasites to survive by downregulating the Th1 way [24]. Therefore, these failures could be explained by a non-adapted host response to infection.\n\nThe presence of RNA viruses in Leishmania parasites has been correlated with disease severity and could be an explanation for the occurrence of so many symptomatic cases in a limited period of time [25]. High level of LRV-1 (Leishmania RNA Virus 1) has been linked to highly metastasizing L. guyanensis strains and consequent mucosal clinical presentation [26]. The presence of LRV-1 is also associated with increased intra-lesional inflammatory markers, linked to a first-line treatment failure and symptomatic relapse [27]. But this effect is controversial, as in a more recent study neither the presence nor the genotype of LRV-1 in L. guyanensis lesions was correlated to treatment failure with pentamidine [28]. Therefore, a systematic search of LRV was not carried out in this outbreak study.\n\nThe efficiency of pentamidine as a treatment of CL is not perfect, as shown in Brazil [29]. However, it is usually close to 90% on L. guyanensis strains observed in French Guiana, as previously published [30]. It is uncommon in this territory to see several patients with treatment failures after pentamidine and amphotericin B, let alone after three different schemes. The efficiency of amphotericin B in CL is a matter of debate and varies importantly between the different published studies [14,31,32]. However, it is the first time that so many treatment schemes are met with failure in French Guiana. This kind of clinical failures should be closely monitored in the future.Five patients were unfortunately lost to follow-up after one month, however this proportion (16.7%) is usually much higher in civilian patients treated in French Guiana.\n\nRegarding the phylogenetic study, we looked for a clonal strain of Leishmania which could be responsible for these grouped cases. However, no such clonal infection was observed. Similar results were observed during the small L. braziliensis outbreak in Saül in 2013 with 5 distinct and non-clustered genotypes [13]. We used the Hsp70 as a target gene for sequencing, as this gene is deemed the best marker for New World CL phylogenetics [33] and is routinely used for species identification in French Guiana [9]. RNA Pol II was once used as a target for routine diagnosis of CL in French Guiana but replaced with Hsp 70 in February 2020. Due to the emergency conditions of this study and the logistical hardships imposed by the Covid-19 pandemics during the study period, we were not able to use other techniques than the routine Hsp70 PCR. Indeed, though Hsp70 allowed us to highlight intra-species differences and geographical clusters for Leishmania lainsoni and naiffi in a previous study, [5] this gene is known to be highly conserved and is primarily used for differentiation between Leishmania species and not as an intra-species marker. Therefore, we could not find correlations between genetic characteristics and clinical or geographical features. Microsatellite markers and/or whole-genome sequencing should be made available for prospective use in future outbreaks. This diversity in isolated strains could also result from the large diversity of species of vectors and reservoirs which can be observed in French Guiana [34,35]. Ny. umbratilis is the main vector for L. guyanensis in this region and is usually a canopy-feeding sandfly [36]. However, a study performed along the Brazilian border showed the presence of Ny. umbratilis carrying L. guyanensis both on the forest floor and the canopy. It increased the number of possible hosts [37], usually more abundant in the canopy than at the ground level [38]. An important diversity of blood sources for Ny. umbratilis have been found in this area, such as birds, dogs, armadillo, opossum and humans [34]. Beside Ny. umbratilis, other phlebotomine species have been associated with L. guyanensis in French Guiana and neighbouring Brazilian localities: Psathyromyia dendrophyla [39], Ny. whitmani, Ny. anduzei [35], Bichromomyia flaviscutellata [40], Evandromyia infraspinosa [34]. These data highlight the possibility that more reservoirs and vectors are involved in CL transmission than originally presumed.\n\nIndeed, concerning the hosts of L. guyanensis, C. didactylus is known as the main reservoir [8], while the anteater Tamandua tetradactyla and marsupials or rodents play a smaller role [41]. Other mammals such as dogs or monkeys could also be involved [42,43]. Very few trainees reported an encounter or a close contact with animals in CEFE. Therefore, the role played by traditional hosts such as the two-toed sloth seems minimal in this outbreak. L. guyanensis has also been found in a Rhipicephalus microplus tick isolated from a peccary [44]. Interestingly, peccaries were the most frequent animal seen by soldiers in our study. Capture and identification of vectors, measurement of infection rates and identification of infecting species should be prospectively conducted during future training courses to demonstrate the involvement of multiple vectors in infections occurring on the CEFE grounds.\n\nThe case-control study did not incriminate any specific individual behavior, as in another military outbreak in 2003 [12]. This could reflect some social desirability bias (military culture is associated with exemplarity and discipline) and a trend to hide non-compliance with prevention measures during interviews. During this 2020 outbreak, we showed that taking part in a CEFE course was associated with a significant higher attack rate than other missions in French Guiana. Therefore, though all service members take part in risky activities such as fighting illegal gold miners in the forest (so-called “Harpie” operations), these activities appear less likely to provide CL infections than a CEFE training. This important risk can be explained by nocturne activities, intense trainings with close contacts with sandflies in fixed stations, compared to longer but itinerant and diurnal missions in the Harpie operations. Being part of unit B was also associated with a significant higher attack rate, which could reflect a better compliance with prevention measures in unit A. Taking part in the “Fighting” course and not in harder courses such as “Jaguar” or “Rainforest specialist” was a significant protective factor, which can be explained by the length and hardships of these exercises. However, the “Survival” exercise, which comes as an extra after ending another course and includes nights in mesh hammock and isolation in the remotest areas of the forest was not associated with infection.\n\nDuring the environmental investigation, we highlighted two zones which seemed linked with most contaminations: the “Fighting village” and the “Curotel” rest area (Fig 6). These areas were surrounded by areas of illegal logging. The flight range of sandflies is around 300 meters, which corresponds to the risky perimeter of CL around deforestation activities [45]. Deforestation appears to be the main trigger for increased CL cases in South America [46]. Human activities play an even more important part than climate in shaping the risk of CL occurrence throughout the different ecosystems of the continent [47]. Extensive literature has described how logging puts humans in contact with sylvatic sandflies, particularly in the absence of local wild reservoirs [46,48,49]. Therefore, a good prevention mean would be to implement a ban on logging in the outskirts of the military area. A geospatial treatment would have provided a better analysis, but soldiers were unable to determine the precise spots on which they were contaminated. We assumed that the favorable conditions of the “Fighting Village” and “Curotel” were the most likely places of contamination but this did not allow us to perform a proper geospatial treatment.\n\nRegarding the information provided to trainees before CEFE courses, a misconception was noted concerning the local tree named “Bois-cathédrale” (Chimarrhis turbinate) which was deemed as the main shelter for sandflies, despite the absence of supporting data. This often led the soldiers to disregard other shelters such as creeks or other trees.\n\nTemporal and climatic risk factors are also important. As highlighted in the literature [4,10], the end of the long dry season and the whole period of the short dry season (March) are the more likely periods of infection. In our study, undertaking a CEFE course during the 13th calendar week was associated with a higher risk of infection (OR = 4.59 [1.1–19.83]; p = 0.0159). The nocturnal activity of sandflies [45] make night and dusk exercises particularly dangerous. These activities should be avoided during these annual risky periods of climatic shifts from hot and dry to rainy weather. Hot and dry years of El Niño Southern Oscillation are known to yield high number of CL infections and should be feared as risky periods for such trainings [50,51].\n\nWhen looking for other grouped cases of CL in the literature, a similar investigation can be found concerning an outbreak among military personnel in Peru in 2010 [52]. Very interestingly, many of the findings mirror those of our study: two specific spots in the large training area were incriminated, as well as deforestation and recent land changes. As in our study, the authors raised the hypothesis of multiple exposures and bites but could not confirm it due to the absence of vector captures [52]. The attack rate was much higher (25%) but very few prevention measures against sandfly bites were used before the outbreak (long clothes were not always used and soldiers slept in open rooms). A smaller outbreak (12 cases) was investigated in 2003 in French soldiers infected in French Guiana after taking part in the CEFE and other missions [12]. Military exercises in the forest in a period of high transmission risk was found as a significant risk factor, as in our study. A young age was also incriminated, which was not reported in our findings, though the experience of tropical forest appeared associated with a lower attack rate. As in our study, vector control measures were not statistically significant, maybe due to a small sample size. Conversely, the non-use of repellents and wearing short-sleeves clothes were incriminated as significant risk factors of CL infection among soldiers in Sri Lanka. However, 5000 individuals were screened for this study which was not an outbreak investigation but a large prospective cross-sectional study, which explains how statistical significance could be reached [53]. Among US military forces in Irak, the establishment of a sandfly surveillance program confirmed the presence of high density of infected sandflies on military bases [54]. A vector control program provided less convincing results as insecticides spraying failed to significantly decrease the sandflies populations. Personal protective measures were initially insufficient and consequently targeted by a specific education program. In a military outbreak in the jungle of Panama in 1984, the attack rate was particularly high after a specific exercise on a mortar firing site while other spots were less at-risk [55]. Prevention measures such as repellents were poorly implemented and did not offer efficient protection.\n\nMilitary outbreaks of CL are associated with very different risk factors than civilian ones. For example in an 2018 study in Yemen, risk factors of infection (agricultural activities of women, malnutrition, proximity of plantations and animals) were mostly linked to the poor living conditions and rural habits of the studied community [56]. A civilian outbreak in the Communidad Valenciana (Spain) led to the implementation of several vector control measures and personal protection against sandfly bites. Dogs were suspected to be the main reservoir of the outbreak but without solid evidence. The only risk factors involved seemed to outdoor activities such as hunting, or the presence of dogs or landfills [57]. Large civilian outbreaks have also been reported in displaced populations, therefore associated with very different causes [58]. Thousands of suspected cases were also reported in Ghana, in an area until then deemed as non-endemic [59]. However, the triggers of this outbreak remain unclear, as in many Sub-Saharan countries where the dynamics of CL infections are poorly studied.\n\nThis study has several limitations. As a retrospective study, it can involve a memory bias as military personnel could forget events occurring during the training course. Besides, the small number of cases and controls might explain the absence of significant association between infection and individual behaviors. However, one should bear in mind that large case-controls studies are hard to perform in emergency situations. Moreover, as cases and controls were phoned simultaneously, any memory bias in the case-control study should be evenly shared. Concerning biological tests, immunological studies on biopsies and resistance tests could provide useful data for future investigations. Whole genome sequencing or microsatellite markers would have been very useful. However, neither of microsatellite markers nor whole sequencing are routinely used in the Cayenne Hospital Centre and the implementation of new molecular biology protocols during the pandemics was not achievable. On the other hand Hsp70 was used as a routine marker in samples from all patients but did not allow us to look for geographical or clinical correlations. Whole genome sequencing would have required skin biopsies, which we did not possess for all soldiers, modifying the ethical scope of the study. Sandflies captures were first contemplated on the CEFE site. However, as this investigation was performed several months after the outbreak, and as the long dry season had begun, these data would not have been relevant. However, prospective collections of phlebotomine samples could be contemplated during future CEFE courses.\n\nConclusion\n\nThis study presents a transdisciplinary approach of a CL outbreak in French Guiana. This investigation highlights the combined risks posed by night exercises, illegal logging and military trainings during at-risk months. Insufficient knowledge of cutaneous leishmaniasis and prevention means might play a role, though no individual behaviour was specifically incriminated. Military training should be adapted to at-risk areas and months of the year. From the clinical point of view, the presence of pentamidine-resistant strains of L. guyanensis represents a therapeutic challenge which should be closely monitored.\n==== Refs\nReferences\n\n1 Santé WHO = O mondiale de la. Global leishmaniasis surveillance, 2017–2018, and first report on 5 additional indicators–Surveillance mondiale de la leishmaniose, 2017–2018, et premier rapport sur 5 indicateurs supplémentaires. Weekly Epidemiological Record = Relevé épidémiologique hebdomadaire. 2020 Jun 19;95 (25 ):265–79.\n2 Alvar J , Vélez ID , Bern C , Herrero M , Desjeux P , Cano J , et al . Leishmaniasis worldwide and global estimates of its incidence. PLoS One. 2012;7 (5 ):e35671. doi: 10.1371/journal.pone.0035671 22693548\n3 Loiseau R , Nabet C , Simon S , Ginouves M , Brousse P , Blanchet D , et al . American cutaneous leishmaniasis in French Guiana: an epidemiological update and study of environmental risk factors. Int J Dermatol. 2019 Nov;58 (11 ):1323–8. doi: 10.1111/ijd.14625 31524286\n4 Dedet JP , Pradinaud R , Gay F . Epidemiological aspects of human cutaneous leishmaniasis in French Guiana. Trans R Soc Trop Med Hyg. 1989 Oct;83 (5 ):616–20. doi: 10.1016/0035-9203(89)90375-1 2617622\n5 Ducharme O , Simon S , Ginouves M , Prévot G , Couppie P , Demar M , et al . Leishmania naiffi and lainsoni in French Guiana: Clinical features and phylogenetic variability. PLoS Negl Trop Dis. 2020;14 (8 ):e0008380. doi: 10.1371/journal.pntd.0008380 32797078\n6 Simon S , Nacher M , Carme B , Basurko C , Roger A , Adenis A , et al . Cutaneous leishmaniasis in French Guiana: revising epidemiology with PCR-RFLP. Trop Med Health [Internet]. 2017 Feb 28 [cited 2020 Jun 27];45. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5331739/ doi: 10.1186/s41182-017-0045-x 28265182\n7 Le Pont R , Pajot FX , Reguer R . Preliminary observations on the silvatic cycle of leishmaniasis in French Guiana. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1980 Jan;74 (1 ):133. doi: 10.1016/0035-9203(80)90032-2 7434410\n8 Gentile B , Le Pont F , Pajot FX , Besnard R . Dermal leishmaniasis in French Guiana: the sloth (Choloepus didactylus) as a reservoir host. Trans R Soc Trop Med Hyg. 1981;75 (4 ):612–3. doi: 10.1016/0035-9203(81)90223-6 7324144\n9 Blaizot R , Simon S , Ginouves M , Prévot G , Blanchet D , Ravel C , et al . Validation of swab sampling and SYBR Green-based real-time PCR for the diagnosis of Cutaneous Leishmaniasis in French Guiana. J Clin Microbiol. 2020 Nov 4;JCM.02218-20, jcm;JCM.02218-20v1.\n10 Vasconcelos-dos-Santos T , Chaves RCG , Prévot G , Silveira FT , Póvoa MM , Rangel EF , et al . Binational burden of American cutaneous leishmaniasis in Oiapoque, Amapá State, Brazil, bordering French Guiana. Revista da Sociedade Brasileira de Medicina Tropical [Internet]. 2019 [cited 2020 Jun 27];52. Available from: http://www.scielo.br/scielo.php?script=sci_abstract&pid=S0037-86822019000100626&lng=en&nrm=iso&tlng=en doi: 10.1590/0037-8682-0256-2018 30942256\n11 Banzet S . [Epidemics of cutaneous leishmaniasis in military personnel working in French Guiana]. Med Trop (Mars). 2000;60 (3 ):297–302.11258067\n12 Berger F , Romary P , Brachet D , Rapp C , Imbert P , Garrabé E , et al . [Outbreak of cutaneous leishmaniasis in military population coming back from French Guiana]. Rev Epidemiol Sante Publique. 2006 Jun;54 (3 ):213–21. doi: 10.1016/s0398-7620(06)76717-7 16902382\n13 Martin-Blondel G , Iriart X , El Baidouri F , Simon S , Mills D , Demar M , et al . Outbreak of Leishmania braziliensis Cutaneous Leishmaniasis, Saül, French Guiana. Emerg Infect Dis. 2015 May;21 (5 ):892–4. doi: 10.3201/eid2105.141181 25897573\n14 Senchyna A , Simon S , Cissé H , Ginouves M , Prevot G , Alcoba G , et al . American cutaneous leishmaniasis in French Guiana: a retrospective comparison between liposomal amphotericin B and meglumine antimoniate. Br J Dermatol. 2020 Aug;183 (2 ):389–91. doi: 10.1111/bjd.18964 32078162\n15 Christen J-R , Bourreau E , Demar M , Lightburn E , Couppié P , Ginouvès M , et al . Use of the intramuscular route to administer pentamidine isethionate in Leishmania guyanensis cutaneous leishmaniasis increases the risk of treatment failure. Travel Med Infect Dis. 2018 Aug;24 :31–6. doi: 10.1016/j.tmaid.2018.02.010 29482012\n16 BCMOM_973_201911.pdf [Internet]. [cited 2021 Mar 18]. Available from: https://donneespubliques.meteofrance.fr/donnees_libres/bulletins/BCMOM/BCMOM_973_201911.pdf\n17 BCMOM_973_201912.pdf [Internet]. [cited 2021 Mar 18]. Available from: https://donneespubliques.meteofrance.fr/donnees_libres/bulletins/BCMOM/BCMOM_973_201912.pdf\n18 BCMOM_973_202001.pdf [Internet]. [cited 2021 Jun 19]. Available from: https://donneespubliques.meteofrance.fr/donnees_libres/bulletins/BCMOM/BCMOM_973_202001.pdf\n19 BCMOM_973_202003.pdf [Internet]. [cited 2021 Jun 19]. Available from: https://donneespubliques.meteofrance.fr/donnees_libres/bulletins/BCMOM/BCMOM_973_202003.pdf\n20 Roger A , Nacher M , Hanf M , Drogoul AS , Adenis A , Basurko C , et al . Climate and Leishmaniasis in French Guiana. Am J Trop Med Hyg. 2013 Sep 4;89 (3 ):564–9. doi: 10.4269/ajtmh.12-0771 23939706\n21 Ginouvès M , Simon S , Nacher M , Demar M , Carme B , Couppié P , et al . In Vitro Sensitivity of Cutaneous Leishmania Promastigote Isolates Circulating in French Guiana to a Set of Drugs. Am J Trop Med Hyg. 2017 May;96 (5 ):1143–50. doi: 10.4269/ajtmh.16-0373 28167598\n22 Conceição-Silva F , Leite-Silva J , Morgado FN . The Binomial Parasite-Host Immunity in the Healing Process and in Reactivation of Human Tegumentary Leishmaniasis. Front Microbiol. 2018;9 :1308. doi: 10.3389/fmicb.2018.01308 29971054\n23 dos Santos Meira C , Gedamu L . Protective or Detrimental? Understanding the Role of Host Immunity in Leishmaniasis. Microorganisms. 2019 Dec 13;7 (12 ):695. doi: 10.3390/microorganisms7120695 31847221\n24 Maspi N , Abdoli A , Ghaffarifar F . Pro- and anti-inflammatory cytokines in cutaneous leishmaniasis: a review. Pathog Glob Health. 2016 Sep;110 (6 ):247–60. doi: 10.1080/20477724.2016.1232042 27660895\n25 Ginouvès M , Simon S , Bourreau E , Lacoste V , Ronet C , Couppié P , et al . Prevalence and Distribution of Leishmania RNA Virus 1 in Leishmania Parasites from French Guiana. Am J Trop Med Hyg. 2016 Jan 6;94 (1 ):102–6. doi: 10.4269/ajtmh.15-0419 26598572\n26 dos Santos Meira C , Gedamu L . Protective or Detrimental? Understanding the Role of Host Immunity in Leishmaniasis. Microorganisms [Internet]. 2019 Dec 13 [cited 2021 Mar 22];7 (12 ). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6956275/ doi: 10.3390/microorganisms7120695 31847221\n27 Bourreau E , Ginouves M , Prévot G , Hartley M-A , Gangneux J-P , Robert-Gangneux F , et al . Presence of Leishmania RNA Virus 1 in Leishmania guyanensis Increases the Risk of First-Line Treatment Failure and Symptomatic Relapse. J Infect Dis. 2016 Jan 1;213 (1 ):105–11. doi: 10.1093/infdis/jiv355 26123564\n28 Ginouvès M , Couppié P , Simon S , Bourreau E , Rogier S , Brousse P , et al . Leishmaniavirus genetic diversity is not related to leishmaniasis treatment failure. Clin Microbiol Infect. 2021 Feb;27 (2 ):286.e1–286.e5.\n29 Neves LO , Talhari AC , Gadelha EPN , Silva Júnior RM da , Guerra JA de O , Ferreira LC de L , et al . A randomized clinical trial comparing meglumine antimoniate, pentamidine and amphotericin B for the treatment of cutaneous leishmaniasis by Leishmania guyanensis. An Bras Dermatol. 2011 Dec;86 (6 ):1092–101. doi: 10.1590/s0365-05962011000600005 22281895\n30 Nacher M , Carme B , Sainte Marie D , Couppié P , Clyti E , Guibert P , et al . Influence of clinical presentation on the efficacy of a short course of pentamidine in the treatment of cutaneous leishmaniasis in French Guiana. Ann Trop Med Parasitol. 2001 Jun;95 (4 ):331–6. doi: 10.1080/00034980120064355 11454242\n31 Guery R , Henry B , Martin-Blondel G , Rouzaud C , Cordoliani F , Harms G , et al . Liposomal amphotericin B in travelers with cutaneous and muco-cutaneous leishmaniasis: Not a panacea. PLoS Negl Trop Dis. 2017 Nov;11 (11 ):e0006094. doi: 10.1371/journal.pntd.0006094 29155816\n32 Solomon M , Pavlotzky F , Barzilai A , Schwartz E . Liposomal amphotericin B in comparison to sodium stibogluconate for Leishmania braziliensis cutaneous leishmaniasis in travelers. J Am Acad Dermatol. 2013 Feb;68 (2 ):284–9. doi: 10.1016/j.jaad.2012.06.014 22858005\n33 Montalvo AM , Fraga J , Tirado D , Blandón G , Alba A , Van der Auwera G , et al . Detection and identification of Leishmania spp.: application of two hsp70-based PCR-RFLP protocols to clinical samples from the New World. Parasitol Res. 2017 Jul;116 (7 ):1843–8. doi: 10.1007/s00436-017-5454-6 28573463\n34 Vasconcelos Dos Santos T , Prévot G , Ginouvès M , Duarte R , Silveira FT , Póvoa MM , et al . Ecological aspects of Phlebotomines (Diptera: Psychodidae) and the transmission of American cutaneous leishmaniasis agents in an Amazonian/ Guianan bordering area. Parasit Vectors. 2018 Nov 29;11 (1 ):612. doi: 10.1186/s13071-018-3190-0 30497528\n35 de Souza AAA , da Rocha Barata I , das Graças Soares Silva M , Lima JAN , Jennings YLL , Ishikawa EAY , et al. Natural Leishmania (Viannia) infections of phlebotomines (Diptera: Psychodidae) indicate classical and alternative transmission cycles of American cutaneous leishmaniasis in the Guiana Shield, Brazil. Parasite. 2017;24 :13. doi: 10.1051/parasite/2017016 28508745\n36 Rotureau B . ECOLOGY OF THE LEISHMANIA SPECIES IN THE GUIANAN ECOREGION COMPLEX. The American Journal of Tropical Medicine and Hygiene. 2006 Jan 1;74 (1 ):81–96. 16407350\n37 Vasconcelos Dos Santos T , de Pita-Pereira D , Araújo-Pereira T , Britto C , Silveira FT , Póvoa MM , et al . Leishmania DNA detection and species characterization within phlebotomines (Diptera: Psychodidae) from a peridomicile-forest gradient in an Amazonian/Guianan bordering area. PLoS One. 2019;14 (7 ):e0219626. doi: 10.1371/journal.pone.0219626 31306447\n38 Dedet JP . Cutaneous leishmaniasis in French Guiana: a review. Am J Trop Med Hyg. 1990 Jul;43 (1 ):25–8. doi: 10.4269/ajtmh.1990.43.25 2200289\n39 Freitas RA , Naiff RD , Barrett TV . Species Diversity and Flagellate Infections in the Sand Fly Fauna near Porto Grande, State of Amapá, Brazil (Diptera: Psychodidae. Kinetoplastida: Trypanosomatidae). Mem Inst Oswaldo Cruz. 2002 Jan;97 :53–9.\n40 Fouque F , Gaborit P , Issaly J , Carinci R , Gantier J-C , Ravel C , et al . Phlebotomine sand flies (Diptera: Psychodidae) associated with changing patterns in the transmission of the human cutaneous leishmaniasis in French Guiana. Mem Inst Oswaldo Cruz. 2007 Feb;102 :35–40. doi: 10.1590/s0074-02762007000100005 17293996\n41 Lainson R , Shaw JJ , Silveira FT , de Souza AA , Braga RR , Ishikawa EA . The dermal leishmaniases of Brazil, with special reference to the eco-epidemiology of the disease in Amazonia. Mem Inst Oswaldo Cruz. 1994 Sep;89 (3 ):435–43. doi: 10.1590/s0074-02761994000300027 7476229\n42 Medkour H , Davoust B , Levasseur A , Mediannikov O . Molecular Evidence of Leishmania infantum and Leishmania guyanensis in Red Howler Monkey (Alouatta seniculus) from French Guiana. Vector Borne Zoonotic Dis. 2019 Dec;19 (12 ):896–900. doi: 10.1089/vbz.2019.2459 31314697\n43 Kent A , Ramkalup P , Mans D , Schallig H . Is the dog a possible reservoir for cutaneous leishmaniasis in suriname? J Trop Med. 2013;2013 :324140. doi: 10.1155/2013/324140 24194768\n44 Rojas-Jaimes JE , Correa-Nuñez GH , Rojas N , Cáceres-Rey O . Detection of Leishmania (V) guyanensis in Rhipicephalus (Boophilus) microplus (Acari: Ixodidae) collected from Pecari tajacu. Biomedica. 2017 Mar 29;37 (0 ):208–14. doi: 10.7705/biomedica.v37i0.3435 29161493\n45 Maroli M , Feliciangeli MD , Bichaud L , Charrel RN , Gradoni L . Phlebotomine sandflies and the spreading of leishmaniases and other diseases of public health concern. Medical and Veterinary Entomology. 2013;27 (2 ):123–47. doi: 10.1111/j.1365-2915.2012.01034.x 22924419\n46 Ellwanger JH , Kulmann-Leal B , Kaminski VL , Valverde-Villegas JM , Veiga ABGD , Spilki FR , et al . Beyond diversity loss and climate change: Impacts of Amazon deforestation on infectious diseases and public health. An Acad Bras Cienc. 2020;92 (1 ):e20191375. doi: 10.1590/0001-3765202020191375 32321030\n47 Chavy A , Ferreira Dales Nava A , Luz SLB , Ramírez JD , Herrera G , Vasconcelos dos Santos T , et al . Ecological niche modelling for predicting the risk of cutaneous leishmaniasis in the Neotropical moist forest biome. Werneck GL , editor. PLoS Negl Trop Dis. 2019 Aug 14;13 (8 ):e0007629. doi: 10.1371/journal.pntd.0007629 31412022\n48 Rodrigues MG de A , Sousa JD de B , Dias ÁLB , Monteiro WM , Sampaio V de S . The role of deforestation on American cutaneous leishmaniasis incidence: spatial-temporal distribution, environmental and socioeconomic factors associated in the Brazilian Amazon. Tropical Medicine & International Health. 2019;24 (3 ):348–55.30578585\n49 Walsh JF , Molyneux DH , Birley MH . Deforestation: effects on vector-borne disease. Parasitology. 1993;106 Suppl :S55–75. doi: 10.1017/s0031182000086121 8488073\n50 Ropelewski CF , Halpert MS . Global and Regional Scale Precipitation Patterns Associated with the El Niño/Southern Oscillation. Monthly Weather Review. 1987 Aug 1;115 (8 ):1606–26.\n51 Kiladis GN , Diaz HF . Global Climatic Anomalies Associated with Extremes in the Southern Oscillation. Journal of Climate. 1989 Sep 1;2 (9 ):1069–90.\n52 Oré M , Sáenz E , Cabrera R , Sanchez JF , De Los Santos MB , Lucas CM , et al . Outbreak of Cutaneous Leishmaniasis in Peruvian Military Personnel Undertaking Training Activities in the Amazon Basin, 2010. Am J Trop Med Hyg. 2015 Aug;93 (2 ):340–6. doi: 10.4269/ajtmh.15-0107 26078320\n53 Gunathilaka N , Chandrasena N , Udayanga L . Prevalence of Ectoparasitic Infections and Other Dermatological Infections and Their Associated Factors among School Children in Gampaha District, Sri Lanka. Can J Infect Dis Med Microbiol. 2019;2019 :5827124. doi: 10.1155/2019/5827124 31019612\n54 Coleman RE , Burkett DA , Putnam JL , Sherwood V , Caci JB , Jennings BT , et al . Impact of phlebotomine sand flies on U.S. Military operations at Tallil Air Base, Iraq: 1. background, military situation, and development of a “Leishmaniasis Control Program.” J Med Entomol. 2006 Jul;43 (4 ):647–62. doi: 10.1603/0022-2585(2006)43[647:iopsfo]2.0.co;2 16892621\n55 Sanchez JL , Diniega BM , Small JW , Miller RN , Andujar JM , Weina PJ , et al . Epidemiologic investigation of an outbreak of cutaneous leishmaniasis in a defined geographic focus of transmission. Am J Trop Med Hyg. 1992 Jul;47 (1 ):47–54. doi: 10.4269/ajtmh.1992.47.47 1636883\n56 Nassar AA , Abdelrazzaq MH , Almahaqri AH , Al-Amad MA , Al Serouri AA , Khader YS . Cutaneous Leishmaniasis Outbreak Investigation in Hajjah Governorate, Yemen, in 2018: Case-Control Study. JMIR Public Health Surveill. 2021 May 14;7 (5 ):e27442. doi: 10.2196/27442 33988521\n57 Roth-Damas P , Sempere-Manuel M , Mialaret-Lahiguera A , Fernández-García C , Gil-Tomás JJ , Colomina-Rodríguez J , et al . Community outbreak of cutaneous leishmaniasis in La Ribera region of Valencia, Spain: Public Health measures. Enferm Infecc Microbiol Clin. 2017 Jul;35 (6 ):338–43. doi: 10.1016/j.eimc.2016.04.006 27236236\n58 Abdulla QB , Shabila NP , Al-Hadithi TS . An An outbreak of cutaneous leishmaniasis in Erbil governorate of Iraqi Kurdistan Region in 2015. J Infect Dev Ctries. 2018 Aug 31;12 (8 ):600–7. doi: 10.3855/jidc.10306 31958321\n59 Kweku MA , Odoom S , Puplampu N , Desewu K , Nuako GK , Gyan B , et al . An outbreak of suspected cutaneous leishmaniasis in Ghana: lessons learnt and preparation for future outbreaks. Glob Health Action. 2011;4. doi: 10.3402/gha.v4i0.5527 21765823\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1935-2727",
"issue": "15(11)",
"journal": "PLoS neglected tropical diseases",
"keywords": null,
"medline_ta": "PLoS Negl Trop Dis",
"mesh_terms": null,
"nlm_unique_id": "101291488",
"other_id": null,
"pages": "e0009938",
"pmc": null,
"pmid": "34797836",
"pubdate": "2021-11",
"publication_types": "D016428:Journal Article",
"references": "33148706;31306447;27236236;21765823;16902382;32321030;31524286;24194768;17293996;8488073;32380286;28265182;23939706;22858005;31958321;32078162;28508745;30942256;31019612;7434410;2200289;26123564;28167598;26598572;27660895;11992148;29155816;25897573;30497528;29971054;29482012;31314697;22693548;33988521;31412022;32797078;2617622;31847221;11454242;16407350;11258067;30578585;16892621;26078320;29161493;22281895;28573463;1636883;22924419;7324144;7476229",
"title": "Outbreak of Cutaneous Leishmaniasis among military personnel in French Guiana, 2020: Clinical, phylogenetic, individual and environmental aspects.",
"title_normalized": "outbreak of cutaneous leishmaniasis among military personnel in french guiana 2020 clinical phylogenetic individual and environmental aspects"
} | [
{
"companynumb": "GF-GILEAD-2021-0558311",
"fulfillexpeditecriteria": "1",
"occurcountry": "GF",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMPHOTERICIN B"
},
"drugadditional": "3",
... |
{
"abstract": "We report a 40-year-old male who self-administered sildenafil for 10 years, in progressively increasing doses from 100 mg per occasion in the 1(st) year to 1300 mg per occasion in the 9(th)-10(th) years of (ab)use. The frequency of abuse was 2-3/week. The only adverse effect of concern that was reported was transient (up to about 12 h), self-limited blurring of vision in the last 2 years, especially in the last 2 months at the highest dose. The patient was otherwise normal. This report is unique because it describes what may be the highest dose of sildenafil reported in literature, abused across a protracted period of time. We discuss issues related to dose and safety of and tolerance to the drug.",
"affiliations": "Department of Psychiatry, JSS Medical College and Hospital, JSS University, Mysore, Karnataka, India.;Department of Psychiatry, JSS Medical College and Hospital, JSS University, Mysore, Karnataka, India.;Department of Psychiatry, JSS Medical College and Hospital, JSS University, Mysore, Karnataka, India.;Department of Psychopharmacology, National Institute of Mental Health and Neurosciences, Bengaluru, Karnataka, India.",
"authors": "Sathyanarayana Rao|T S|TS|;Kumar|V Arun|VA|;Raman|Rajesh|R|;Andrade|Chittaranjan|C|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.4103/0019-5545.166626",
"fulltext": "\n==== Front\nIndian J PsychiatryIndian J PsychiatryIJPsyIndian Journal of Psychiatry0019-55451998-3794Medknow Publications & Media Pvt Ltd India IJPsy-57-31110.4103/0019-5545.166626Case ReportProlonged, longstanding, ultra-high-dose abuse of sildenafil Sathyanarayana Rao T. S. Kumar V. Arun Raman Rajesh Andrade Chittaranjan 1Department of Psychiatry, JSS Medical College and Hospital, JSS University, Mysore, Karnataka, India1 Department of Psychopharmacology, National Institute of Mental Health and Neurosciences, Bengaluru, Karnataka, IndiaAddress for correspondence: Dr. T. S. Sathyanarayana Rao, Department of Psychiatry, JSS Medical College and Hospital, JSS University, Mysore - 570 004, Karnataka, India. E-mail: tssrao19@yahoo.comJul-Sep 2015 57 3 311 312 Copyright: © Indian Journal of Psychiatry2015This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.We report a 40-year-old male who self-administered sildenafil for 10 years, in progressively increasing doses from 100 mg per occasion in the 1st year to 1300 mg per occasion in the 9th–10th years of (ab)use. The frequency of abuse was 2–3/week. The only adverse effect of concern that was reported was transient (up to about 12 h), self-limited blurring of vision in the last 2 years, especially in the last 2 months at the highest dose. The patient was otherwise normal. This report is unique because it describes what may be the highest dose of sildenafil reported in literature, abused across a protracted period of time. We discuss issues related to dose and safety of and tolerance to the drug.\n\nErectile dysfunctionphosphodiesterase type 5 inhibitorssildenafil citrate\n==== Body\nINTRODUCTION\nErectile dysfunction (ED) is defined as the inability to achieve and sustain an erection of adequate rigidity for satisfactory sexual intercourse. Sildenafil citrate is a potent, competitive, phosphodiesterase type 5 isoenzyme inhibitor; it was the first in a class of effective oral treatments for ED of varying etiologies, including ED associated with drugs, diabetes, other general medical conditions, and spinal cord injury.\n\nThe safety and adverse effect (AE) profile of sildenafil is well documented.[1] Common AEs at therapeutic doses include headache, facial flushing, dyspepsia, dizziness, nasal congestion, abnormal vision, and palpitation. These AEs are generally mild, dose-related, transient, and self-limiting, and rarely warrant a change in therapy.\n\nSildenafil has been approved for use in ED in the maximum dose of 100 mg per occasion; however, higher doses of up to 240 mg/day up to a year have also been safely used in patients with severe ED, ejaculatory delay, or pulmonary hypertension.[234]\n\nWe herein report a patient with prolonged abuse of high doses (1300 mg per occasion) of sildenafil with clinically significant but reversible AEs.\n\nCASE REPORT\nL, a 40-year-old illiterate farmer, presented with a 12-year history of inability to sustain an erection for more than a minute. He described normal functioning in regular sexual activity in many premarital relationships from his late teenage years to age 28, at which point his ability to sustain an erection markedly and rapidly diminished across a period of a few months.\n\nHe married at age 30 and neither he nor his partner experienced sexual satisfaction despite normal levels of interest and drive. A psychiatrist whom he consulted prescribed sildenafil (100 mg) prior to intercourse. With the use of sildenafil, his ability to sustain an erection improved from 1 to 5 min. However, the benefits waned within 2 months, as a result of which he augmented the dose of sildenafil by approximately 100 mg per occasion per year.\n\nBy age 38, he was self-medicating with 8–9 tablets of sildenafil (100 mg, each) per occasion, and since then to the time of current consultation, he had been self-medicating at a dose of 1300 mg per occasion. At this level of dosing, he was able to sustain an erection for 5 min.\n\nThe reason for the present consultation was that, for the past 2 years and especially for the past 2 months, he had begun to experience blurring of vision starting within 20 min of sildenafil ingestion until about 8 a.m. the next day. These symptoms were present only on the days of sildenafil use. He was anxious about the possible risks associated with his high-dose sildenafil use; otherwise, there was nothing to suggest past or present medical or psychiatric illness. His use of alcohol and tobacco was small and infrequent.\n\nPhysical examination and a comprehensive laboratory workup were within normal limits. A complete clinical ophthalmological examination which included examination of fundus, visual acuity, and near vision identified no abnormalities, and no further ophthalmological study was considered indicated. No organic reason for the ED could be elicited to the extent that he was investigated in a routine hematological and metabolic work-up.\n\nDISCUSSION\nThis case is noteworthy for two reasons:First, the use of what might be the highest dose of sildenafil on record, and second, the use of ultra-high dosing for a decade, with 2 years at the highest dose of 1300 mg per occasion, at a frequency of 2–3 occasions per week. Importantly, there was no reported or identifiable adverse consequence except for transient and self-limited blurring of vision.\n\nMany patients have used sildenafil daily for years with no apparent ill effects.[5] A single case report cannot testify to the safety of regular, ultra-high doses of sildenafil; this experience must be tempered by the data on the use of sildenafil in high doses and sildenafil overdose. In this context, doses of up to 240 mg/day for up to 12 weeks have been used in patients with pulmonary hypertension; AEs observed include flushing, dyspepsia, and diarrhea. In this study, patients who completed 12 weeks of treatment could also enter a 1-year extension phase at 240 mg/day.[4] Single doses of 800 mg have been administered to normal volunteers, and all that was observed was an increased risk of the usual adverse events.[1] The highest first dose on record may be 2400 mg; the patient was a 33-year-old man, and the overdose resulted in annular scotoma, defective color vision, vascular retinal dilatation, visual field defect, and papilledema. Recovery was observed in all regards except for the visual field defect and the annular scotoma.[1]\n\nTolerance to sildenafil has been reported,[6] but so has efficacy for up to 4 years without requirement for dose increase.[7] It is possible that tolerance, if any, is due to progression in the organic pathology responsible for the ED. Our patient was only partially investigated, and so we do not know whether there was an identifiable pathology responsible for his ED, and whether there was progression in this pathology, necessitating higher doses for maintained efficacy.\n\nOn a concluding note, it is an indictment of the dispensing system that allows patients such easy access to prescription drugs over such a long period.\n\nFinancial support and sponsorship\nNil.\n\nConflicts of interest\nThere are no conflicts of interest.\n==== Refs\nREFERENCES\n1 Giuliano F Jackson G Montorsi F Martin-Morales A Raillard P Safety of sildenafil citrate: Review of 67 double-blind placebo-controlled trials and the postmarketing safety database Int J Clin Pract 2010 64 240 55 19900167 \n2 McMahon CG High dose sildenafil citrate as a salvage therapy for severe erectile dysfunction Int J Impot Res 2002 14 533 8 12494291 \n3 Seidman SN Pesce VC Roose SP High-dose sildenafil citrate for selective serotonin reuptake inhibitor-associated ejaculatory delay: Open clinical trial J Clin Psychiatry 2003 64 721 5 12823089 \n4 Galiè N Ghofrani HA Torbicki A Barst RJ Rubin LJ Badesch D Sildenafil citrate therapy for pulmonary arterial hypertension N Engl J Med 2005 353 2148 57 16291984 \n5 Zoumalan CI Zamanian RT Doyle RL Marmor MF ERG evaluation of daily, high-dose sildenafil usage Doc Ophthalmol 2009 118 225 31 18818963 \n6 El-Galley R Rutland H Talic R Keane T Clark H Long-term efficacy of sildenafil and tachyphylaxis effect J Urol 2001 166 927 31 11490248 \n7 McMurray JG Feldman RA Auerbach SM Deriesthal H Wilson N Multicenter Study Group Long-term safety and effectiveness of sildenafil citrate in men with erectile dysfunction Ther Clin Risk Manag 2007 3 975 81 18516312\n\n",
"fulltext_license": "CC BY-NC-SA",
"issn_linking": "0019-5545",
"issue": "57(3)",
"journal": "Indian journal of psychiatry",
"keywords": "Erectile dysfunction; phosphodiesterase type 5 inhibitors; sildenafil citrate",
"medline_ta": "Indian J Psychiatry",
"mesh_terms": null,
"nlm_unique_id": "0013255",
"other_id": null,
"pages": "311-2",
"pmc": null,
"pmid": "26600589",
"pubdate": "2015",
"publication_types": "D016428:Journal Article",
"references": "19900167;18516312;16291984;18818963;12494291;12823089;11490248",
"title": "Prolonged, longstanding, ultra-high-dose abuse of sildenafil.",
"title_normalized": "prolonged longstanding ultra high dose abuse of sildenafil"
} | [
{
"companynumb": "IN-PFIZER INC-2017133593",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SILDENAFIL CITRATE"
},
"drugadditional": "3",
... |
{
"abstract": "A patient with systemic lupus erythematosus had chills, fever, and headache on four separate occasions after ibuprofen ingestion. One such episode was accompanied by cerebrospinal fluid findings compatible with meningitis. Drug rechallenge under controlled conditions established the relationship between ibuprofen ingestion and meningitis.",
"affiliations": null,
"authors": "Widener|H L|HL|;Littman|B H|BH|",
"chemical_list": "D000974:Antibodies, Antinuclear; D007052:Ibuprofen",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0098-7484",
"issue": "239(11)",
"journal": "JAMA",
"keywords": null,
"medline_ta": "JAMA",
"mesh_terms": "D000328:Adult; D000974:Antibodies, Antinuclear; D001168:Arthritis; D005260:Female; D006801:Humans; D007052:Ibuprofen; D008180:Lupus Erythematosus, Systemic; D008581:Meningitis; D008582:Meningitis, Aseptic",
"nlm_unique_id": "7501160",
"other_id": null,
"pages": "1062-4",
"pmc": null,
"pmid": "304902",
"pubdate": "1978-03-13",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Ibuprofen-induced meningitis in systemic lupus erythematosus.",
"title_normalized": "ibuprofen induced meningitis in systemic lupus erythematosus"
} | [
{
"companynumb": "US-STRIDES ARCOLAB LIMITED-2016SP017397",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "IBUPROFEN"
},
"drugadditional"... |
{
"abstract": "Candida lusitaniae is usually susceptible to echinocandins. Beta-1,3-glucan synthase encoded by FKS genes is the target of echinocandins. A few missense mutations in the C. lusitaniae FKS1 hot spot 1 (HS1) have been reported. We report here the rapid emergence of antifungal resistance in C. lusitaniae isolated during therapy with amphotericin B (AMB), caspofungin (CAS), and azoles for treatment of persistent candidemia in an immunocompromised child with severe enterocolitis and visceral adenoviral disease. As documented from restriction fragment length polymorphism (RFLP) and random amplified polymorphic DNA (RAPD) analysis, the five C. lusitaniae isolates examined were related to each other. From antifungal susceptibility and molecular analyses, 5 different profiles (P) were obtained. These profiles included the following: profile 1 (P1) (CAS MIC [μg/ml], 0.5; fluconazole [FLC] MIC, 0.25), determined while the patient was being treated with liposomal AMB for 3 months; P2 (FLC MIC [μg/ml], 0.25; CAS MIC, 4), while the patient was being treated with CAS for 2 weeks; P3 (CAS MIC [μg/ml], 0.5; FLC MIC, 32), while the patient was being treated with azoles and CAS initially followed by azoles alone for a week; P4 (CAS MIC [μg/ml], 8; FLC MIC, 8), while the patient was being treated with both drugs for 3 weeks; and P5 (AMB MIC [μg/ml], 0.125; CAS MIC, 8), while the patient was being treated with AMB and FLC for 2 weeks. CAS resistance was associated with resistance not only to micafungin and anidulafungin but also to AMB. Analysis of CAS resistance revealed 3 novel FKS1 mutations in CAS-resistant isolates (S638Y in P2; S631Y in P4; S638P in P5). While S638Y and -P are within HS1, S631Y is in close proximity to this domain but was confirmed to confer candin resistance using a site-directed mutagenesis approach. FLC resistance could be linked with overexpression of major facilitator gene 7 (MFS7) in C. lusitaniae P2 and P4 and was associated with resistance to 5-flurocytosine. This clinical report describes resistance of C. lusitaniae to all common antifungals. While candins or azole resistance followed monotherapy, multidrug antifungal resistance emerged during combined therapy.",
"affiliations": "Pediatric Infectious Diseases and Vaccinology Unit, Department of Paediatrics, University Hospital Center, Lausanne, Switzerland Service of Infectious Diseases, Department of Internal Medicine, University Hospital Center, Lausanne, Switzerland.;Service of Infectious Diseases, Department of Internal Medicine, University Hospital Center, Lausanne, Switzerland.;Pediatric Haematology and Oncology Unit, Department of Pediatrics, University Hospital Center Lausanne, Switzerland.;Service of Infectious Diseases, Department of Internal Medicine, University Hospital Center, Lausanne, Switzerland.;Institute of Microbiology, Department of Laboratory, University of Lausanne and University Hospital Center, Lausanne, Switzerland dominique.sanglard@chuv.ch.",
"authors": "Asner|Sandra A|SA|;Giulieri|Stefano|S|;Diezi|Manuel|M|;Marchetti|Oscar|O|;Sanglard|Dominique|D|http://orcid.org/0000-0002-5244-4178",
"chemical_list": "D000935:Antifungal Agents; D004271:DNA, Fungal; D008351:Mannans; D047071:beta-Glucans; C012990:galactomannan; D005690:Galactose",
"country": "United States",
"delete": false,
"doi": "10.1128/AAC.02204-15",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0066-4804",
"issue": "59(12)",
"journal": "Antimicrobial agents and chemotherapy",
"keywords": null,
"medline_ta": "Antimicrob Agents Chemother",
"mesh_terms": "D000595:Amino Acid Sequence; D000935:Antifungal Agents; D002175:Candida; D002177:Candidiasis; D004271:DNA, Fungal; D016903:Drug Monitoring; D026141:Drug Resistance, Multiple, Fungal; D005260:Female; D005690:Galactose; D006801:Humans; D016867:Immunocompromised Host; D007223:Infant; D015470:Leukemia, Myeloid, Acute; D008351:Mannans; D008826:Microbial Sensitivity Tests; D008969:Molecular Sequence Data; D009154:Mutation; D012150:Polymorphism, Restriction Fragment Length; D047071:beta-Glucans",
"nlm_unique_id": "0315061",
"other_id": null,
"pages": "7715-22",
"pmc": null,
"pmid": "26438490",
"pubdate": "2015-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "10515900;11901654;12967746;1360476;15673750;16048935;16464893;16597887;16723566;17060521;17325225;17468115;17569573;18448691;18462102;18577180;18591282;18998768;19070454;19180749;19414575;19884370;20038613;20145084;20855739;21050800;21115790;21143834;21353623;21408004;21490186;21927034;22875889;22930834;23077122;23629718;24403302;24861617;24890592;24982316;25304391;25340258;25550394;25743786;29780439;8891134;9371329",
"title": "Acquired Multidrug Antifungal Resistance in Candida lusitaniae during Therapy.",
"title_normalized": "acquired multidrug antifungal resistance in candida lusitaniae during therapy"
} | [
{
"companynumb": "CH-PFIZER INC-2017219852",
"fulfillexpeditecriteria": "1",
"occurcountry": "CH",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CASPOFUNGIN"
},
"drugadditional": null,
... |
{
"abstract": "Excessive weight (EW) gain is common after solid organ transplantation, but there is little information concerning obesity after pancreas transplantation. The study goal was to characterize EW gain after kidney-pancreas (KP) transplantation.\n\n\n\nThis was a retrospective single-center review of 100 KP recipients transplanted between September 2007 and June 2015.\n\n\n\nThe median percent weight gain for all recipients at 1 year posttransplant was 10% (interquartile range, 2.7%-19.3%) of baseline weight. EW gain, defined as greater than or equal to a 19% 1-year increase in weight, included all recipients (n = 26) above the upper limit of interquartile range for weight gain at 1 year. In multivariate analysis, recipient age <40 years, the use of tacrolimus/mammalian target of rapamycin immunosuppression, and an acute rejection event were independent risk factors for EW gain. At a mean follow-up of 43±23 months, there was no difference in patient or graft survival between the EW and non-EW cohorts. Although mean hemoglobin A1c levels between groups were equivalent, the EW versus non-EW cohort displayed a significant increase in mean insulin levels and a trend towards higher C-peptide levels. Criteria for posttransplant metabolic syndrome was met in 34.6% of EW versus 17.6% of non-EW cohorts (P = 0.07).\n\n\n\nAt intermediate-term follow-up, EW gain after KP transplantation was not associated with an increased risk of death or graft loss, although there was a trend toward a greater risk of posttransplant metabolic syndrome. There may be a metabolic consequence of successful pancreas transplantation that results in EW gain in a proportion of recipients, leading to an increased risk of long-term cardiovascular complications.",
"affiliations": "Department of Surgery, Houston Methodist Hospital, Houston, TX.;Department of Surgery, University of Texas Southwestern Medical Center, Dallas, TX.;Department of Pharmacy, Houston Methodist Hospital, Houston, TX.;Department of Pathology and Genomic Medicine, Houston Methodist Hospital, Houston, TX.;Department of Pathology and Genomic Medicine, Houston Methodist Hospital, Houston, TX.;Department of Surgery, Houston Methodist Hospital, Houston, TX.;Houston Kidney Consultants, Houston, TX.;Department of Internal Medicine, Houston Methodist Hospital, Houston, TX.;Department of Surgery, Houston Methodist Hospital, Houston, TX.;Department of Surgery, Houston Methodist Hospital, Houston, TX.",
"authors": "Knight|Richard J|RJ|;Islam|Ana K|AK|;Pham|Christine|C|;Graviss|Edward A|EA|;Nguyen|Duc T|DT|;Moore|Linda W|LW|;Kagan|Anna|A|;Sadhu|Archana R|AR|;Podder|Hemangshu|H|;Gaber|A Osama|AO|",
"chemical_list": "D006442:Glycated Hemoglobin A; D007166:Immunosuppressive Agents; D007328:Insulin; C517652:hemoglobin A1c protein, human",
"country": "United States",
"delete": false,
"doi": "10.1097/TP.0000000000002862",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1337",
"issue": "104(3)",
"journal": "Transplantation",
"keywords": null,
"medline_ta": "Transplantation",
"mesh_terms": "D000328:Adult; D003924:Diabetes Mellitus, Type 2; D005260:Female; D005500:Follow-Up Studies; D006442:Glycated Hemoglobin A; D006084:Graft Rejection; D006085:Graft Survival; D006801:Humans; D007166:Immunosuppressive Agents; D007328:Insulin; D016030:Kidney Transplantation; D008297:Male; D024821:Metabolic Syndrome; D008875:Middle Aged; D009765:Obesity; D016035:Pancreas Transplantation; D011184:Postoperative Period; D012189:Retrospective Studies; D015430:Weight Gain",
"nlm_unique_id": "0132144",
"other_id": null,
"pages": "632-639",
"pmc": null,
"pmid": "31335775",
"pubdate": "2020-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Weight Gain After Simultaneous Kidney and Pancreas Transplantation.",
"title_normalized": "weight gain after simultaneous kidney and pancreas transplantation"
} | [
{
"companynumb": "US-ROCHE-2613444",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SIROLIMUS"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "We present the case of a 39-year-old man with a severe glottis stenosis. The saddle nose, images of laryngotracheal stenosis and the (FDG) positron-emission tomography/computed tomography lead to a final diagnosis of relapsing polychondritis. In the patient a coexistent myelodysplastic syndrome was diagnosed. Moreover, the elevated total IgG4 exceeding 135 ml/dl requested additional immunochemistry for detection of IgG4-bearing plasma cells in the biopsies. The patient underwent an allogenic stem cell transplantation and died on day 40 after the transplantation because of an acute steroid-resistent graft vs host.",
"affiliations": "a Department of Immunology, Allergology, Rheumatology , University of Antwerp and Antwerp University Hospital , Antwerp , Belgium.;b ENT, Head and Neck Surgery , University of Antwerp and Antwerp University Hospital , Antwerp , Belgium.;c Nuclear Medicine , University of Antwerp and Antwerp University Hospital , Antwerp , Belgium.;b ENT, Head and Neck Surgery , University of Antwerp and Antwerp University Hospital , Antwerp , Belgium.;a Department of Immunology, Allergology, Rheumatology , University of Antwerp and Antwerp University Hospital , Antwerp , Belgium.",
"authors": "Sabato|Vito|V|;Vanderveken|Olivier M|OM|;Van den Wyngaert|Tim|T|;Van Laer|Carl|C|;Ebo|Didier|D|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1080/17843286.2015.1111657",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1784-3286",
"issue": "72(2)",
"journal": "Acta clinica Belgica",
"keywords": "IgG4-related diseases; Saddle nose; glottic stenosis; relapsing polychondritis",
"medline_ta": "Acta Clin Belg",
"mesh_terms": "D000328:Adult; D003251:Constriction, Pathologic; D005931:Glottis; D006801:Humans; D008297:Male; D009666:Nose; D011081:Polychondritis, Relapsing",
"nlm_unique_id": "0370306",
"other_id": null,
"pages": "130-132",
"pmc": null,
"pmid": "27075792",
"pubdate": "2017-04",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A patient with a severe glottic stenosis and saddle nose.",
"title_normalized": "a patient with a severe glottic stenosis and saddle nose"
} | [
{
"companynumb": "BE-BAUSCH-BL-2017-009564",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": null,
... |
{
"abstract": "Background: Recent genome-wide association screening (GWAS) studies have linked Alzheimer's disease (AD) neuropathology to gene networks that regulate immune function. Kan et al. recently reported that Arg1 (an anti-inflammatory gene that codes for arginase-1) is expressed in parts of the brain associated with amyloidosis prior to the onset of neuronal loss, suggesting that chronic brain arginine deprivation promotes AD-related neuropathology. They blocked arginine catabolism in their mouse AD model by administration of eflornithine (DFMO) to juvenile animals, effectively blocking the expression of AD-related amyloid pathology as the mice aged. We report results from a single-case study in which DFMO was administered, for the first time, in an attempt to slow progression of AD in a single woman with multi-domain, amnestic MCI who was unable to tolerate an acetylcholinesterase inhibitor. Methods: Patient C.S. is a 74-year old female with a 5-year history of cognitive decline who was placed on DFMO (500 mg b.i.d.) for 12 months, with amyloid PET scans (baseline and 12-months), APOE genotyping and neuropsychological exams at baseline, 3, 9, and 12 months. Results: C.S. suffered continued cognitive decline over 12 months, including progressive worsening of orientation, social functions and ability to engage in IADL's. She also showed progressive decline on measures of episodic memory and executive function. Florbetapir PET imaging yielded elevated total neocortical SUVr scores at both baseline (SUVr = 1.55) and at 12 months (SUVr = 1.69). Conclusions: We report a first attempt at using DFMO to slow AD progression. This 12-month single-case trial did not halt continued amyloidosis nor cognitive decline. Although this trial was predicated on data reported by Kan et al. (2015) showing that DFMO administered to juvenile AD-prone mice led to diminished amyloid aggregation, this attempt to treat an older mild AD patient may not be a fair test of Kan et al.'s model and results. A future trial might seek to block amyloidosis in young adults who are autosomal gene carriers for early onset AD, or perhaps in adults who are very clearly in the pre-clinical disease stage. Trial Registration: This trial was registered as a Compassionate Use IND #128888 with the United States Food and Drug Administration (FDA).",
"affiliations": "Department of Psychiatry and Human Behavior, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States.;Division of General Internal Medicine, Department of Medicine, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States.;Department of Radiology, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States.;Department of Neurology, Warren Alpert Medical School of Brown University, Providence, RI, United States.",
"authors": "Alber|Jessica|J|;McGarry|Kelly|K|;Noto|Richard B|RB|;Snyder|Peter J|PJ|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.3389/fnagi.2018.00060",
"fulltext": "\n==== Front\nFront Aging NeurosciFront Aging NeurosciFront. Aging Neurosci.Frontiers in Aging Neuroscience1663-4365Frontiers Media S.A. 10.3389/fnagi.2018.00060NeuroscienceCase ReportUse of Eflornithine (DFMO) in the Treatment of Early Alzheimer's Disease: A Compassionate Use, Single-Case Study Alber Jessica 12McGarry Kelly 3Noto Richard B. 4Snyder Peter J. 256*1Department of Psychiatry and Human Behavior, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States2Department of Neurology, Warren Alpert Medical School of Brown University, Providence, RI, United States3Division of General Internal Medicine, Department of Medicine, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States4Department of Radiology, Warren Alpert Medical School of Brown University & Rhode Island Hospital, Providence, RI, United States5Interdisciplinary Neuroscience Program, University of Rhode Island, Kingston, RI, United States6Ryan Institute for Neurosciences, University of Rhode Island, Kingston, RI, United StatesEdited by: Ashok Kumar, University of Florida, United States\n\nReviewed by: Sarat C. Vatsavayai, University of California, San Francisco, United States; William Edmund Renehan, University of Rhode Island, United States\n\n*Correspondence: Peter J. Snyder peter.j.snyder@gmail.com06 3 2018 2018 10 6028 8 2017 20 2 2018 Copyright © 2018 Alber, McGarry, Noto and Snyder.2018Alber, McGarry, Noto and SnyderThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Background: Recent genome-wide association screening (GWAS) studies have linked Alzheimer's disease (AD) neuropathology to gene networks that regulate immune function. Kan et al. recently reported that Arg1 (an anti-inflammatory gene that codes for arginase-1) is expressed in parts of the brain associated with amyloidosis prior to the onset of neuronal loss, suggesting that chronic brain arginine deprivation promotes AD-related neuropathology. They blocked arginine catabolism in their mouse AD model by administration of eflornithine (DFMO) to juvenile animals, effectively blocking the expression of AD-related amyloid pathology as the mice aged. We report results from a single-case study in which DFMO was administered, for the first time, in an attempt to slow progression of AD in a single woman with multi-domain, amnestic MCI who was unable to tolerate an acetylcholinesterase inhibitor.\n\nMethods: Patient C.S. is a 74-year old female with a 5-year history of cognitive decline who was placed on DFMO (500 mg b.i.d.) for 12 months, with amyloid PET scans (baseline and 12-months), APOE genotyping and neuropsychological exams at baseline, 3, 9, and 12 months.\n\nResults: C.S. suffered continued cognitive decline over 12 months, including progressive worsening of orientation, social functions and ability to engage in IADL's. She also showed progressive decline on measures of episodic memory and executive function. Florbetapir PET imaging yielded elevated total neocortical SUVr scores at both baseline (SUVr = 1.55) and at 12 months (SUVr = 1.69).\n\nConclusions: We report a first attempt at using DFMO to slow AD progression. This 12-month single-case trial did not halt continued amyloidosis nor cognitive decline. Although this trial was predicated on data reported by Kan et al. (2015) showing that DFMO administered to juvenile AD-prone mice led to diminished amyloid aggregation, this attempt to treat an older mild AD patient may not be a fair test of Kan et al.'s model and results. A future trial might seek to block amyloidosis in young adults who are autosomal gene carriers for early onset AD, or perhaps in adults who are very clearly in the pre-clinical disease stage.\n\nTrial Registration: This trial was registered as a Compassionate Use IND #128888 with the United States Food and Drug Administration (FDA).\n\nmild cognitive impairmentAlzheimer's diseasecase studyeflornithine (DFMO)amyloid pathology\n==== Body\nBackground\nAlzheimer's disease (AD) is a neurodegenerative condition associated with the accumulation of parenchymal β-amyloid (Aβ) and hyperphosphorylated tau tangles in the neurons. The pathogenesis of AD is a complicated process that occurs as a result of a combination of downstream interactions between DNA-sequence variants and non-genetic (biological risk factors such as vascular health and psychosocial risks) contributors that act through molecular networks to affect disease risk (Schadt, 2009). The exact mechanism of AD pathogenesis remains unknown despite decades of careful research. To date, there are no preventative or disease-modifying AD therapies, despite the projected more than doubling of the incidence of AD by the year 2050 (Alzheimer's Association Strategic Plan, 2017). Currently, one dominant etiologic model of AD is the referred to as the “amyloid hypothesis” (Hardy and Allsop, 1991; Selkoe, 1991; Hardy and Higgins, 1992; Jack et al., 2013), which states that parenchymal Aβ builds up decades prior to the onset of clinical symptoms, resulting in a silent period termed preclinical AD (Sperling et al., 2011), followed by neurodegeneration and the accumulation of hyperphosphorylated tau. Therapeutic interventions now focus on this preclinical AD period, with the aim of eliminating the accumulation of parenchymal Aβ early in the pathological process of the disease.\n\nThe apolipoprotein E (APOE) gene is the AD susceptibility gene that has been most extensively researched, and accounts for an estimated 30% of the genetic variability in AD (Corder et al., 1993; Saunders et al., 1993). Despite recent developments indicating other genetic contributions to AD such as APP and TREM2 (Jonsson et al., 2012, 2013; Guerreiro et al., 2013), a large proportion of the genetic variance in AD remains unaccounted for. In addition to APOE, genome wide association studies (GWAS) have linked AD pathology to gene networks that regulate immune function and microglial expression (Kamboh et al., 2012; Zhang et al., 2013).\n\nMost animal models of AD involve transgenic expression of mutated amyloid precursor protein (APP), which leads to parenchymal Aβ deposition but does not usually invoke tau pathology and associated neuronal cell death. Consequently, these models have been criticized as incomplete models of AD pathology (Irizarry et al., 1997; Radde et al., 2008). In a recently developed CVN-AD mouse model, immune-mediated nitric oxide (iNOS) was lowered to mimic human levels, resulting in a model that demonstrates the complete pathological course of AD, including parenchymal amyloidosis, gradual spread of hyperphosphorlyated tau, episodic memory impairment, and significant hippocampal neuronal degeneration (Colton et al., 2008, 2014; Wilcock et al., 2014). These mice are mNos2 -deficient and transgenic for the Swedish K670N/M671L vasculotropic Dutch/Iowa E693Q/D694N mutant (APPSwDI) APP (Kan et al., 2015), which prevents the expression of inducible nitric oxide synthase protein, thus lowering the level of nitric oxide production (for a detailed description of this model, see Colton et al., 2008, 2014; Wilcock et al., 2014).\n\nUsing this model, Kan et al first found that these CVN-AD mice followed the pathological progression of human AD (Kan et al., 2015). In an additional study, they found that Arg1 (an anti-inflammatory gene that codes for arginase1, an arginine utilization enzyme) was expressed in the parts of the animal brain with high levels of amyloidosis prior to the onset of neuronal degeneration and cell death, an indication that chronic brain arginine deprivation could be the cause of neuronal cell death in AD, and the subsequent cascade of AD pathology. Based on this information, they administered eflornithine (DFMO; an arginase inhibitor) to juvenile animals, which effectively blocked the expression of Aβ and other AD related pathology, immunosuppression, and spatial memory impairments. Moreover, the DFMO mice had higher arginine expression in the hippocampus and subiculum, areas that are associated with early neuronal loss in AD pathology. In other words, inhibition of abnormal arginine utilization and resultant arginine expression resulted in marked improvement in pathology and cognitive function when administered to juvenile CVN-AD mice (Kan et al., 2015).\n\nIn response to a special request by a family member of a patient, who happened to be a pediatric oncologist with clinical experience in the use of DFMO for the treatment of pediatric neuroblastomas and who also was aware of the Kan et al. (2015) publication, one of us (K.M.) applied for—and received approval for—a compassionate use Investigation New Drug (IND) application to administer DFMO to a single woman with multi-domain, amnestic mild cognitive impairment (MCI) who was unable to tolerate an acetylcholinesterase inhibitor. DFMO is an Food and Drug Administration (FDA) approved treatment of Trypanosoma brucei gambiense encephalitis (“African sleeping sickness”), has been used in clinical trials for neuroblastoma in children, and has a favorable safety and tolerability profile. It is unknown whether or not DFMO would slow or reverse amyloid pathology, or improve cognitive outcomes in a human subject with MCI.\n\nMethods\nCase presentation\nThe participant (C.S.) is a 74 year old, left-handed female with 16 years of education. Her past medical history is notable for hypertension, gastric reflux, osteoarthritis, headaches, benign essential tremor, glaucoma, anxiety, and depression. Concurrent medications upon initiation of the trial were omeprazole, sertraline, trazadone, Miralax, calcium, fish oil, and baby aspirin. The researchers had access to the participants' medical records and previous neuropsychological evaluations in 2011 and 2013, which were negative for neurodegenerative disease diagnosis but noted mild cognitive changes due to anxiety and depression. Family history was positive for Alzheimer's disease in both parents, with onset in her father in the early 80s and onset in her mother in mid-80's.\n\nThe participant presented with a 5-year gradually progressive history of cognitive decline and in 2015 she received a diagnosis of multi-domain amnestic MCI due to possible Alzheimer's disease. Symptoms included disorientation to time, repetitive speech, mild word finding difficulty, difficulty following conversations, confusability, and difficulties with attention and concentration. The patient had mild, stable symptoms of depression and anxiety and had very minor dilapidation of instrumental activities of daily living (IADL's) such as driving and financial management. The patient had also become more socially withdrawn as a result of conversational difficulties and lost ~25 pounds over the 2 years preceding presentation. After diagnosis, the participant began a regimen of donepezil 5 mg, but this was discontinued due to GI problems and excessive weight loss. The patient's inability to tolerate a cholinesterase inhibitor resulted in application for a compassionate use IND for eflornithine (DFMO).\n\nProcedure\nScreening\nBaseline screening assessments included medical history, physical exam, vital signs (blood pressure, pulse, temperature), and complete blood count (CBC) with differential and comprehensive metabolic panel (CMP). Prior to baseline dosing, the participant completed an amyloid PET scan and neuropsychological evaluation.\n\nTreatment\nThe participant was administered eflornithine (DFMO) 500 mg (2 tabs) PO BID (morning and evening), concomitant with safe therapeutic dosing in the United States for colon cancer prevention and neuroblastoma. DFMO was prescribed by KM (primary care physician) as oral capsules, taken morning and evening with water. Dosing and medication instructions were explained verbally to the participant and her caregiver, and written instructions were also provided regarding dosing and timing of dose.\n\nSafety monitoring\nSafety monitoring involved a CBC with differential and a CMP every 2 weeks for four results, then once a month for four results, then once every 2 months for four results. Additionally, repeat medical history, physical exam, vital signs, and blood tests were conducted once per month for 6 months, and then once every 2 months for 6 months.\n\nOutcome measures\nNeuropsychological evaluation\nComprehensive neuropsychological evaluation was conducted at baseline, 3, 9, and 12 months. Neuropsychological evaluation included the domains and tests described in Table 1. A clinical interview was conducted with the participant and her caregiver prior to each neuropsychological session to assess changes in medications, medical history, changes in health, functional changes, and current symptoms of depression/anxiety. Clinical interview and neuropsychological tests were administered by a post-doctoral research fellow with extensive training in neuropsychological assessment and reviewed by a licensed clinical neuropsychologist.\n\nTable 1 Neuropsychological outcome measures used in a compassionate use IND trial of DFMO in a single case.\n\nNeuropsychological Domain\tTests Administered\t\nGlobal cognition\tMini Mental Status Exam (MMSE) (Folstein et al., 1975)\n Alzheimer's disease assessment scale-cognitive subscale (ADAS-Cog;11 item) (Rosen et al., 1993)\t\nVerbal episodic memory\tLogical Memory I (WMS-R) Immediate and Delayed Recall (Wechsler, 1997)\n International Shopping List Test (ISLT; Cogstate) (Lim et al., 2009)\t\nVisual episodic memory\tGroton Maze Learning Test (GMLT; Cogstate) delayed recall (Snyder et al., 2005; Fredrickson et al., 2008)\t\nLanguage\tCategory Fluency (animals) (Borkowski et al., 1967)\t\nExecutive function\tGMLT (Cogstate Ltd.) Learning (Snyder et al., 2005; Fredrickson et al., 2008)\n One Card-Learning Task (OCL; Cogstate Ltd.) (Maruff et al., 2013)\n Phonemic Fluency (FAS) (Borkowski et al., 1967; Tombaugh et al., 1999)\t\nWorking memory\tGroton Maze Learning Test (GMLT; Cogstate Ltd.) (Snyder et al., 2005; Fredrickson et al., 2008)\n One-back Task (OBK; Cogstate Ltd.) (Maruff et al., 2013)\t\nProcessing speed\tGMLT Chase Test (Cogstate Ltd.) (Snyder et al., 2005; Fredrickson et al., 2008)\t\nSubjective cognitive complaints\tSubjective Cognitive Decline (SCD) (Gifford et al., 2015)\t\nDepression\tGeriatric Depression Scale (GDS) (Yesavage and Sheikh, 1986)\t\nPrimary endpoints included reported decline in instrumental activities of daily living as assessed via clinical interview, change in score on the Mini Mental Status Examination (MMSE; Folstein et al., 1975), the ADAS-Cog (Rosen et al., 1993), delayed recall on Logical Memory (Wechsler, 1997), and change in amyloid PET burden as measured by Florbetapir PET scan. Secondary endpoints included change in score on the GMLT (Snyder et al., 2005; Fredrickson et al., 2008), verbal fluency (phonemic and category fluency; Borkowski et al., 1967; Tombaugh et al., 1999), OCL (Maruff et al., 2013), OBK (Maruff et al., 2013), and ISLT (Lim et al., 2009).\n\nAmyloid PET imaging\nAmyloid positron emission tomography (PET) imaging was conducted at baseline and after 12 months. At each scan, a 370 MBq (10 mCi ± 10%) bolus injection of 18F-florbetapir was administered intravenously. Approximately 50 min post-injection, a 20-min PET scan was performed with head computerized tomography (CT) scan for attenuation and correction purposes. Images were obtained using a 128 x 128 matrix reconstructed using iterative or row action maximization likelihood algorithms. PET standardized uptake value (SUV) data were summed and normalized to the whole cerebellum SUV, resulting in a region-to-cerbellum ratio termed SUV ratio (SUVr). SUVr calculation was performed using the MIMneuro software, with a normative database of 74 individuals (48 males, 26 females) between the ages of 18 and 50 years who met the eligibility criteria for inclusion; that is, individuals needed to be in good general health, score within normal range for standard clinical neurologic and cognitive testing, and have a negative amyloid scan on visual assessment (Clark et al., 2011). Amyloid positivity was confirmed by consensus of two board-certified radiologists who were also board certified in nuclear medicine.\n\nResults\nResults from primary and secondary outcome measures are summarized in Table 2. For cognitive reasons, the participant was unable to complete the delayed recall portion of the GMLT in the baseline visit, exam 2 (3 months), and exam 3 (9 months). Additionally, she was unable to complete the GMLT reverse recall at the baseline visit and exam 2 (3 months).\n\nTable 2 Scores on all outcome measures for patient CS, age 74, over 12 month DFMO treatment period.\n\nMeasure\tExam 1 (baseline)\tExam 2 (3 months)\tExam 3 (9 Months)\tExam 4 (12 months)\t\nMMSE (/30)\t26\t26\t24\t22\t\nADAS-Cog (/70)\t30\t34\t31\t33\t\nLogical Memory, Immediate Recall (/25)\t9\t4\t6\t6\t\nLogical Memory, Delayed Recall (/25)\t3\t3\t3\t6\t\nPhonemic Fluency (FAS)\t38\t41\t22\t32\t\nPhonemic Fluency (animals)\t9\t9\t5\t9\t\nGDS (/15)\t4\t1\t2\t2\t\nSubjective Cognitive Decline (/9)\t6\t6.5\t4\t5\t\nChase Test mps\t0.167\t0.133\t0.233\t0.366\t\nChase Test total errors\t14\t11\t5\t8\t\nChase Test feedback errors\t14\t11\t5\t8\t\nGMLT mpsa\t0.162\t0.195\t0.131\t0.187\t\nGMLT total errorsa\t31.67\t37.75\t30.00\t37.00\t\nGMLT feedback errorsa\t13.33\t18.50\t14.67\t19.50\t\nGMLT delayed recall: mps\tb\tb\tb\t0.125\t\nGMLT delayed recall: total errors\tb\tb\tb\t30\t\nGMLT delayed recall: feedback errors\tb\tb\tb\t20\t\nGMLT reverse recall: mps\tb\tb\t0.141\t0.163\t\nGMLT reverse recall: total errors\tb\tb\t30\t67\t\nGMLT reverse recall: feedback errors\tb\tb\t12\t44\t\nOne Card Learning: accuracy\t0.964\t0.891\t0.904\t0.785\t\nOne Card Learning: total errors\t26\t32\t31\t41\t\nOne Back Task: accuracy\t\t0.860\t0.747\t0.927\t\nOne Back Task: total Errors\t6\t20\t21\t18\t\nISLT Total Learning (3 trials, /36)\tc\t15\t9\t18\t\nISLT Delayed Recall (/12)\tc\t2\t1\t2\t\nFlorbetapir PET SUVr\t1.55\t\t\t1.69\t\na Averaged across 5 learning trials.\n\nb Patient did not complete for cognitive reasons.\n\nc Patient did not complete for technological reasons.\n\nThroughout the 1 year trial period, the participant did not experience any clinical increase in depression or anxiety symptoms, assessed via self-report (GDS; Yesavage and Sheikh, 1986), caregiver report, and clinical interview. There were no significant changes in her level of subjective complaints, as measured by the Subjective Cognitive Decline scale (Gifford et al., 2015).\n\nPrimary endpoints\nThe results for all four primary endpoints are summarized in Figure 1. There was no significant improvement in scores on the MMSE, ADAS-Cog, or Logical Memory delayed recall tests over the 1 year treatment period. The patient declined from an MMSE of 26/30 to an MMSE of 22/30 during this time. ADAS-Cog scores increased slightly during the treatment period, indicating cognitive decline. Learning and memory was severely impaired on the Logical Memory stories. Although the participant improved in terms of number of items recalled and percentage retained at the final visit, this was not corroborated by other memory tests, such as the word-list learning subtest of the ADAS-Cog and the ISLT.\n\nFigure 1 Results on primary outcome measures for patient CS over 12 months of DFMO therapy. (A) Results on the Mini-Mental Status Exam (MMSE)/30 at baseline, 3, 6, and 12 month exams. CS' MMSE score declined 4 points over the 12 month treatment period, from 26/30 to 22/30, indicating generalized cognitive decline. (B) Results on the Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog) 11—item at baseline, 3, 6, and 12 month exams. Patient CS' ADAS-Cog score increased by 3 points over the 12 month treatment period, from 30/70 to 33/70. Higher scores on this test indicate increased cognitive impairment. (C) Results on the delayed recall portion of the Logical Memory stories at baseline, 3, 6, and 12 month exams. The patient showed impaired verbal learning and episodic memory throughout the 12 month treatment period. Although the patient recalled 6/25 items at the 12 month visit, this was not concurrent with results on other episodic memory tests such as the ADAS-Cog word list learning and recall (0/10 words at delayed recall) and the ISLT (2/12 shopping items at delayed recall). (D) SUVr on Florbetapir PET scan at baseline (1.55) and after 12 month treatment period (1.69).\n\nThe patient suffered significant functional decline during the 1 year treatment period. This included complete cessation of driving and inability to prepare complex meals or perform financial management activities. Additionally, the patient and/or her caregiver reported difficulty with orientation to time and place, multi-tasking, increased confusability, and inability to complete multi-step commands. The patient is no longer able to be home independently without supervision. Given this, the family has employed a caregiver to work with the patient once per week for respite care for her spouse, who is her full-time caretaker.\n\nHer florbetapir PET scan was positive on visual read for both the baseline and 12 month visits. Her SUVr increased from 1.55 to 1.69 during the 1 year treatment period, indicating clinically increased neocortical amyloidosis commensurate with advancing Alzheimer's disease.\n\nSecondary endpoints\nAs seen in Table 2, there were no improvements on the patient's scores on any of the secondary endpoint measures.\n\nEfficacy assessment\nPatient CS demonstrated continued symptomatic progression, both cognitively and functionally, over the 1 year treatment period on DFMO 500 mg p.o. BID, and there was an increase in cerebral amyloidosis as measured by Florbetapir PET imaging during this time. After the 1 year treatment period, she no longer met criteria for MCI, but rather met criteria for a diagnosis of mild-moderate dementia of the Alzheimer's type.\n\nDiscussion\nThis report details what we believe is the first known administration of eflornithine (DFMO) as a therapeutic intended to slow mild AD progression in a single individual. The participant was a 74-year-old female with a diagnosis of multi-domain amnestic MCI, who could not tolerate cholinesterase inhibitors due to gastrointestinal irritation and subsequent weight loss. After 12 months of DFMO therapy, the participant declined on neuropsychological tests measuring global cognitive function, episodic memory, executive function, language, processing speed, and working memory. She showed no measurable improvement on the MMSE or ADAS-Cog. Additionally, the participants' cortical amyloidosis increased over the 12 month treatment period from a Florbetapir PET amyloid SUVr of 1.55 to 1.69. Functionally, she suffered decline in instrumental activities of daily living and some decline in basic activities of daily living. Taken together, these results indicate that treatment with DFMO was not effective in reducing or halting cortical amyloidosis, and did not lead to positive cognitive or functional outcomes in a patient with MCI. Over the 12 month period, the participant declined clinically and her diagnosis was changed from MCI to mild AD, commensurate with amyloid PET results, functional decline and neuropsychological test scores.\n\nThis 12 month, single-case study was predicated on a mouse model of AD (the CVN-AD model; Colton et al., 2008, 2014; Wilcock et al., 2014; Kan et al., 2015), which reduced the levels of iNOS in mice to mimic human levels, resulting in a mouse model that mirrored the course of human AD, beginning with asymptomatic amyloidosis and followed by hyperphosphorlyated tau, age-dependent hippocampal neuronal loss, and behavioral changes in episodic memory and executive function. This model showed that the pathological cascade of cortical amyloidosis in CVN-AD knockout mice is associated with increased arginine utilization, which is immune regulated, and decreased cerebral arginine bioavailability, particularly in areas affected early by AD such as the hippocampus. Additionally, they found that DFMO (a partial inhibitor of arginase, an enzyme that metabolizes arginine) administered to juvenile CVN-AD knockout mice led to reduced cortical amyloidosis and recovery of cognitive function (episodic memory) via the reduction of arginine catabolism by the enzyme arginase 1 (Arg1) and subsequent reduction of immunosuppression by cerebral microglia.\n\nThere are several potential factors contributing to the lack of efficacy of DFMO in this single case study. The primary contributor is that Kan et al. (Kan et al., 2015) administered DFMO beginning at 6–8 weeks of age in their CVN-AD knockout mice, and they had treatment dosage of 10 mg/kg via oral gavage 3 times per week for 14 weeks. CVN-AD knockout mice show Aβ accumulation at 6 weeks of age, hyperphosphorylated tau at 12 weeks of age, and behavior deficits at 24 weeks of age (Colton et al., 2014). The administration of DFMO in the CVN-AD knockout mice began concurrently with accumulation of cerebral Aβ, and the therapeutic window spanned the entire length of expected pathological changes in these juvenile mice. In our case, the participant had a Florbetapir PET SUVr of 1.55 at baseline, an indication of significant cortical amyloidosis. Visual inspection of the amyloid PET scan by a board-certified nuclear medicine specialist indicated a positive visual read, indicating increased uptake of Aβ in at least two separate neocortical areas. In our case, unlike Kan et al. (2015), the participant already had significant Aβ accumulation at baseline, which could have caused significant pathological changes resistant to change from DFMO therapy. We suspect that administration of DFMO in the very early stages of cerebral amyloidosis (preclinical AD) would have been a more accurate and reliable assessment of whether or not this therapeutic translates from mouse to human models.\n\nThere are still several unknowns regarding the mechanism by which immune suppression, particularly arginine deprivation, could prompt the initiation of the AD pathological cascade in this mouse model. We do know that there is direct evidence supporting that dysregulated arginine utilization may contribute to human AD pathology. Autopsy studies have shown an increase in arginase mRNA expression and enzymatic activity in human AD brain samples (Colton et al., 2006; Hansmannel et al., 2010; Liu et al., 2014). However, the exact cell type that is associated with increased arginine utilization and consumption remains unclear. There are several cell types capable of expressing arginase-1, and one particular cell type or a combination of these cell types could be driving arginine deprivation in AD. Kan et al. (2015) make a strong case for microglia, basing this assumption on the appearance of a particular type of microglial cell (CD11c+) very early in AD pathology that was highly correlated with AD pathology and concentrations of extracellular arginase. Complicating this story, arginine is the target of two opposing, immune regulated, enzyme systems: the iNOS pathway and the arginase pathway. These pathways co-exist, but competition between these two enzymes favors arginase in humans (Wu et al., 2009; Yi et al., 2009; Guo et al., 2012), and iNOS activity is decreased in human AD, resulting in upregulation of the arginase pathway (Colton et al., 2006; Yi et al., 2009; Liu et al., 2014). Further research elucidating the exact neurochemical mechanism by which immune arginine deprivation affects AD pathology will provide insight into next steps for potential translation to a usable therapeutic for preclinical AD patients.\n\nMore broadly, research has suggested a role for arginine in AD via interactions with atherosclerosis (Cooke and Creager, 1991; Boger et al., 1996), glucose metabolism (Schmidt et al., 1992; Smuckler et al., 2002), and neurogenesis (Ciani et al., 2006; Torroglosa et al., 2007). Further exploration of the role of arginine in these processes, which contribute to AD, will help to elucidate the peripheral effects of arginine on AD pathology.\n\nConcluding remarks\nThese unknowns notwithstanding, we have completed the first ever single case clinical trial of eflornithine (DFMO), a partial inhibitor of arginase, in a patient with multi-domain, amnestic MCI. After 12 months of DFMO treatment, the participant showed cognitive, functional, and pathological progression, and was diagnosed with mild AD. DFMO did not halt or reduce cerebral amyloidosis as measured by Florbetapir PET scan, and the participant's cognitive and functional outcomes decreased over a 12 month period at a rate commensurate with the normal course of neurodegenerative progression in AD. However, we believe that targeting immunosuppressive genes is still a reasonable scientific line of inquiry. Mouse models to date have targeted juvenile animals at the onset of cortical amyloidosis, while our participant already had a high cortical amyloid burden at onset of treatment as shown by Florbetapir PET scan.\n\nBecause DFMO is an FDA approved drug and has a favorable safety and tolerability profile, this therapeutic should be further explored as a potential target for preventative therapy in the very early stages of preclinical AD. Additionally, patients with autosomal dominant AD may be ideal targets for such therapy, as these patients are often relatively young, and age of onset tends to be in mid-late life and can be more accurately predicted.\n\nEthics statement\nThis study was carried out in accordance with the recommendations of Institutional Review Board (IRB) at the Rhode Island Hospital (Providence, RI), and the patient described in this report provided written informed consent in accordance with the Declaration of Helsinki. This trial was registered as a Compassionate Use IND #128888 with the United States Food and Drug Administration (FDA).\n\nAuthor contributions\nKM: Requested and acquired the compassionate use IND from FDA, administered medication, and completed all safety monitoring; JA and PS: Conducted all neuropsychological evaluations, analyzed all data, arranged amyloid PET scans and prepared the manuscript; RN: Analyzed amyloid PET results. All authors read and approved the final manuscript.\n\nConflict of interest statement\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nThe authors would like to acknowledge the participant, C.S., and her family, for their contributions to this study and AD research. The authors also wish to acknowledge Janice Muratori, APRN CNP, for her exceptional contributions to human subjects protection at our institution.\n\nFunding. This case study was internally funded by PJS and the Department of Radiology, Rhode Island Hospital.\n\nAbbreviations\nAββ-amyloid\n\nADAlzheimer's disease\n\nADAS-CogAlzheimer's Disease Assessment Scale-Cognitive Subscale\n\nADLactivities of daily living\n\nAPOEapolipoprotein\n\nAPPamyloid precursor protein\n\nArg1Arginase 1\n\nBIDtwice per day\n\nCBCcomplete blood count\n\nCMPcomprehensive metabolic panel\n\nCTcomputerized tomography\n\nDFMOeflornithine\n\nDNAdeoxyribonucleic acid\n\nFDAFood and Drug Administration\n\nGDSGeriatric Depression Scale\n\nGMLTGroton Maze Learning Test\n\nGWASgenome-wide association studies\n\nIADLinstrumental activities of daily living\n\nINDInvestigational New Drug\n\niNOSimmune-mediated nitric oxide\n\nISLTInternational Shopping List Test\n\nMCImild cognitive impairment\n\nMMSEMini-Mental Status Exam\n\nOBKOne-Back Task\n\nOCLOne-Card Learning Task\n\nPETpositron emission tomography\n\nPOby mouth\n\nSCDSubjective Cognitive Decline\n\nSUVstandardized uptake value\n\nSUVrstandard uptake value ratio\n\nTREM-2Triggering Receptor Expressed on Myeloid Cells-2.\n==== Refs\nReferences\nAlzheimer's Association Strategic Plan (2017 ). Available online at: https://www.alz.org/about_us_strategic_plan.asp (Accessed June 25, 2017).\nBoger B. H. Bode-Boger S. M. Frolich J. C. (1996 ). The L-arginine – nitric oxide pathway: role in atherosclerosis and therapeutic implications . Atherosclerosis \n127 , 1 –11 . 9006798 \nBorkowski J. G. Benton A. L. Spreen O. (1967 ). Word fluency and brain damage . Neuropsychologia \n5 , 135 –140 .\nCiani E. Calvanese V. Crochemore C. Bartesaghi R. Contestabile A. (2006 ). Proliferation of cerebellar precursor cells is negatively regulated by nitric oxide in newborn rat . J. Cell Sci . 119 , 3161 –3170 . 10.1242/jcs.03042 16835271 \nClark C. M. Schneider J. A. Bedell B. B. Beach T. G. Bilker W. G. Mintun M. A. (2011 ). Use of Florbetapir PET imaging amyloid-β pathology . JAMA \n305 , 275 –283 . 10.1001/jama.2010.2008 21245183 \nColton C. A. Mott R. T. Sharpe H. Xu Q. Van Nostrand W. E. Vitek M. P. (2006 ). Expression profiles for macrophage alternative activation genese in AD and in mousemodels of AD . J. Neuroinflamm. \n3 :27 . 10.1186/1742-2094-3-27 17005052 \nColton C. A. Wilcock D. M. Wink D. A. Davis J. Van Nostrand W. E. Vitek M. P. (2008 ). The effects of NOS2 gene deletion on mice expression mutated human AβPP . J. Alzheimer Dis . 15 , 571 –587 . 10.3233/JAD-2008-15405 \nColton C. A. Wilson J. G. Everhart A. Wilcock D. M. Puolivali J. Heikkinen T. . (2014 ). mNos2 deletion and human NOS2 replacement in Alzheimer disease models . J. Neuropathol. Exp. Neurol . 73 , 752 –769 . 10.1097/NEN.0000000000000094 25003233 \nCooke J. P. Creager A. (1991 ). Endothelial dysfunction in hypercholesterolemia is corrected by L-arginine . Basic Res. Cardiol . 86 (Suppl. 2 ), 173 –181 . 1953609 \nCorder E. H. Saunders A. M. Strittmatter W. J. Schmechel D. E. Gaskell P. C. Small G. W. . (1993 ). Gene dose of apoplipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families . Science \n261 , 921 –923 . 8346443 \nFolstein M. F. Folstein S. F. McHugh P. R. (1975 ). Mini-mental state: a practical method for grading the cognitive state of patients for the clinician . J. Psychiatr. Res . 12 , 189 –198 . 1202204 \nFredrickson A. Snyder P. J. Cromer J. Thomas E. Lewis M. Maruff P. (2008 ). The use of effect sizes to characterize the nature of cognitive change in psychopharmacological studies: an example with scopolamine . Hum. Psychopharmacol . 23 , 425 –436 . 10.1002/hup.942 18421801 \nGifford K. A. Liu D. Romano R. R. Jones R. N. Jefferson A. L. (2015 ). Development of a subjective cognitive decline questionnaire using item response theory: a pilot study . Alzheimers Dement. \n1 , 429 –439 . 10.1016/j.dadm.2015.09.004 26878034 \nGuerreiro R. Wojtas A. Bras J. Carrasquillo M. Rogeva E. Majounie E. . (2013 ). TREM2 variants in Alzheimer's disease . N. Engl. J. Med . 368 , 117 –127 . 10.1056/NEJMoa1211851 23150934 \nGuo Z. Shao L. Zhen L. Du Q. Li P. John B. (2012 ). miRNA-939 regulates human inducible nitric oxide synthase posttransciptional gene expression in human hepatocytes . Proc. Natl. Acad. Sci. U.S.A. \n109 , 5826 –5831 . 10.1073/pnas.1118118109 22451906 \nHansmannel F. Sillaire A. Kamboh M. I. Lendon C. Pasquier F. Hannequin D. Amouyel P. . (2010 ). Is the urea cycle involved in Alzheimer's disease? \nJ. Alzheimer Dis . 21 , 1013 –1021 . 10.3233/JAD-2010-100630 20693631 \nHardy J. Allsop D. (1991 ). Amyloid deposition as the central event in the aetiology of Alzheimer's disease . Trends Pharmacol. Sci . 12 , 383 –388 . 1763432 \nHardy J. Higgins G. A. (1992 ). Alzheimer's disease: the Alzheimer's cascade hypothesis . Science \n256 :184 . 1566067 \nIrizarry M. C. McNamara M. Fedorchak K. Hsaio K. Hyman B. T. (1997 ). APPSw transgenic mice develop age-related A beta deposits and neuropil abnormalities, but no neuronal loss in CA1 . J. Neuropathol. Exp. Neurol. \n56 , 965 –973 . 9291938 \nJack C. R. Knopman D. S. Jagust W. J. Petersen R. C. Weiner M. W. Aisen P. S. . (2013 ). Tracking pathophysiological processes in Alzheimer's disease: an updated hypothetical model of dynamic biomarkers . Lancet Neurol . 12 , 207 –216 . 10.1016/S1474-4422(12)70291-0 23332364 \nJonsson T. Atwal K. Steinberg S. Snaedal J. Jonsson P. V. Bjmosson S. . (2012 ). A mutation in APP protects against Alzheimer's disease and age-related cognitive decline . Nature \n488 , 96 –99 . 10.1038/nature11283 22801501 \nJonsson T. Stefansson H. Steinberg S. Jonsdottir I. Jonsson P. V. Snaedal J. . (2013 ). Variant of TREM2 associated with the risk of Alzheimer's disease . N. Engl. J. Med . 368 , 107 –116 . 10.1056/NEJMoa1211103 23150908 \nKamboh M. I. Demirci F. Y. Wang X. Minster R. L. Carrasquillo M. M. Pankratz V. S. . (2012 ). Genome-wide association study of Alzheimer's disease . Transl. Psychiatr . 2 :e117 . 10.1038/tp.2012.45 22832961 \nKan M. J. Lee J. E. Wilson J. G. Everhart A. L. Brown C. M. Hoofnagle A. N. . (2015 ). Arginine deprivation and immune suppression in a mouse model of Alzheimer's Disease . Neurobiol dis . 35 , 5969 –5982 . 10.1523/JNEUROSCI.4668-14.2015 25878270 \nLim Y. Y. Prang K. H. Cysique L. Pietrzak R. Snyder P. J. Maruff P. (2009 ). A method for cross-cultural adaptation of a verbal memory assessment . Behav Res Methods . 41 , 1190 –1200 . 10.3758/BRM.41.4.1190 19897828 \nLiu P. Fleete M. S. Jing Y. Collie N. D. Curtis M. A. Waldvogel H. J. . (2014 ). Altered arginine metabolism in Alzheimer's disease brains . Neurobiol. Aging \n35 , 1992 –2003 . 10.1016/j.neurobiolaging.2014.03.013 24746363 \nMaruff P. Lim Y. Y. Darby D. Ellis K. A. Pietrzak R. H. Snyder P. J. . (2013 ). Clincial utility of the Cogstate Brief Battery in identifying cognitive impairment in mild cognitive impairment and Alzheimer's disease . BMC Psychol . 1 :30 . 10.1186/2050-7283-1-30 25566378 \nRadde R. Duma C. Goedert M. Jucker M. (2008 ). The value of incomplete mouse models of Alzheimer's disease . Eur. J. Nucl. Med. Mol. Imaging \n35 (Suppl. 1 ), S70 –S74 . 10.1007/s00259-007-0704-y 18270700 \nRosen W. G. Mohs R. C. Davis K. L. Ihl R. Weyer G. (1993 ). Alzheimer's Disease Assessment Scale (ADAS) . Gottingen : Hogrefe .\nSaunders A. M. Strittmatter M. D. Schemechel D. St. George-Hyslop P. H. Pericak-Vance M. D. Joo S. H. (1993 ). Association of apolipoprotein E allele ε4 with late-onset familial and sporadic Alzheimer's disease . Neurol . 48 :1467 .\nSchadt E. E. (2009 ). Molecular networks as sensors and drivers of common human diseases . Nature \n461 , 218 –223 . 10.1038/nature08454 19741703 \nSchmidt H. H. Warner T. D. Ishii K. Sheng H. Murad F. (1992 ). Insulin secretion from pancreatic B cells caused by L-arginine derived nitrogen oxide . Science \n255 , 721 –723 . 1371193 \nSelkoe D. (1991 ). The molecular pathology of Alzheimer's disease . Neuron . 6 :, 487 –498 . 1673054 \nSmuckler S. R. Tang L. Wheeler M. B. Salapatek A. M. F. (2002 ). Exogenous nitric oxide and endogenous glucose-stimulated β-Cell nitric oxide augment insulin release . Diabetes \n51 , 3450 –3460 . 10.2337/diabetes.51.12.3450 12453899 \nSnyder P. J. Bednar M. M. Cromer J. R. Thomas E. Lewis M. Maruff P. (2005 ). Reversal of scopolamine-induced deficits with a single dose of donepezil, an acetylcholinesterase inhibitor . Alzheimers Dement . 1 , 126 –135 . 10.1016/j.jalz.2005.09.004 19595845 \nSperling R. A. Aisen P. S. Beckett L. A. Bennett D. A. Craft S. Fagan A. M. . (2011 ). Toward defining the preclinical stages of Alzheimer's disease: Recommendations from the National Institute on Aging-Alzheimer's Association workgroups on diagnostic guidelines for Alzheimer's disease . Alzheimers Dement . 7 , 280 –292 . 10.1016/j.jalz.2011.03.003 21514248 \nTombaugh T. N. Kozakb J. Reesc L. (1999 ). Normative data stratified by age and education for two measures of verbal fluency: FAS and animal naming . Arch. Clin. Neuropsychol . 14 , 167 –177 . 14590600 \nTorroglosa A. Murillo-Carretero M. Romero-Grimaldi C. Materredona E. R. Campos-Caro A. Estrada C. (2007 ). Nitric oxide decreases subventricular zone stem cell proliferation by inhibition of dermal growth factor receptor and phosphoinositide-3-kinase/Akt pathway . Stem Cells \n25 , 88 –97 . 10.1634/stemcells.2006-0131 16960136 \nWechsler D. (1997 ). Wechsler Memory Scale, III. \nSan Antonio, TX : Psychological Corporation .\nWilcock W. M. Lewis M. R. Van Nostrand W. E. Davis J. Previti M. L. Garkholonarehe N. (2014 ). Progression of amyloid pathology to Alzheimer's disease pathology in an amyloid precursor protein transgenic mouse model by removal of nitric oxide synthase 2 . J. Neurosci . 28 , 1537 –1545 . 10.1523/JNEUROSCI.5066-07.2008 18272675 \nWu G. Bazer F. W. Davis T. A. Kim S. W. Li P. Rhoads M. J. . (2009 ). Arginine metabolism and nutrition in growh, health and disease . Amino Acids \n37 , 153 –168 . 10.1007/s00726-008-0210-y 19030957 \nYesavage J. A. Sheikh J. I. (1986 ). Geriatric Depression Scale (GDS) recent evidence and development of a shorter version . Clin. Gerontol . 5 , 165 –173 .\nYi J. Horky L. L. Friedlich A. L. Shi Y. Rogers J. T. Huang X. (2009 ). L-arginine and Alzheimer's disease . Int. J. Clin. Exp. Pathol . 3 , 211 –238 .\nZhang B. Gaiteri C. Boadea L. G. Wang Z. McElwee J. Podtelezhnikov A. A. . (2013 ). Integrated systems approach identifies genetic nodes and networks in late onset Alzheimer's disease . Cell \n153 , 707 –720 . 10.1016/j.cell.2013.03.030 23622250\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1663-4365",
"issue": "10()",
"journal": "Frontiers in aging neuroscience",
"keywords": "Alzheimer's disease; amyloid pathology; case study; eflornithine (DFMO); mild cognitive impairment",
"medline_ta": "Front Aging Neurosci",
"mesh_terms": null,
"nlm_unique_id": "101525824",
"other_id": null,
"pages": "60",
"pmc": null,
"pmid": "29559907",
"pubdate": "2018",
"publication_types": "D002363:Case Reports",
"references": "19741703;19897828;1566067;18270700;18272675;22801501;23150908;22832961;1371193;23150934;19096157;24746363;25878270;22451906;19030957;9006798;1202204;25003233;25566378;14590600;9291938;1763432;20693631;19595845;16835271;1673054;12453899;1953609;8346443;16960136;21245183;18421801;17005052;26878034;21514248;23332364;19079617;23622250",
"title": "Use of Eflornithine (DFMO) in the Treatment of Early Alzheimer's Disease: A Compassionate Use, Single-Case Study.",
"title_normalized": "use of eflornithine dfmo in the treatment of early alzheimer s disease a compassionate use single case study"
} | [
{
"companynumb": "US-TEVA-2018-US-882671",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FISH OIL"
},
"drugadditional": "3",
"d... |
{
"abstract": "Pembrolizumab (Keytruda®) is an anti-programmed cell death 1-specific monoclonal antibody that has become the standard second-line chemotherapy for unresectable advanced microsatellite instability-high colorectal cancer. Several immune-related adverse events (irAEs), particularly endocrinopathy, are linked to the administration of pembrolizumab. We report here a case of pembrolizumab-induced isolated adrenocorticotropic hormone deficiency in a patient with metastatic colon cancer. A 65-year-old woman visited our hospital for complaints of fatigue with a recent history of primary resection of cecal mucinous cancer and hepatectomy for liver metastasis 3 years ago. Peritoneal dissemination was detected 2 years after surgery. Several chemotherapeutic regimens of cytotoxic and molecular targeted drugs were administered; however, the metastases progressed gradually. Pembrolizumab monotherapy was started because of resistance to treatment. After 2 cycles of pembrolizumab, the patient was severely fatigued. Laboratory data demonstrated that the cortisol level was extremely low. All the other values were within the normal range. Magnetic resonance imaging indicated no mass in the pituitary gland. From multiple tolerance tests, we diagnosed isolated adrenocorticotropic hormone deficiency caused by pembrolizumab. The patient's symptoms improved promptly with cortisol treatment. An abdominal contrast-enhanced computed tomography scan after 5 cycles of pembrolizumab demonstrated that the size of the peritoneal dissemination remained unchanged. However, her serum level of carcinoembryonic antigen had decreased to normal levels. Endocrine disorders are very rarely seen as irAEs. Careful laboratory data follow-up is required to inhibit the progression of severe endocrine disorders.",
"affiliations": "Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Endocrinology and Diabetic Medicine, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Endocrinology and Diabetic Medicine, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Endocrinology and Diabetic Medicine, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.;Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan.",
"authors": "Bekki|Tomoaki|T|;Takakura|Yuji|Y|;Kochi|Masatoshi|M|;Konemori|Yoko|Y|;Oki|Kenji|K|;Yoneda|Masayasu|M|;Egi|Hiroyuki|H|;Ohdan|Hideki|H|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1159/000505687",
"fulltext": "\n==== Front\nCase Rep Oncol\nCase Rep Oncol\nCRO\nCase Reports in Oncology\n1662-6575 S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.com \n\n10.1159/000505687\ncro-0013-0200\nCase Report\nA Case of Isolated Adrenocorticotropic Hormone Deficiency Caused by Pembrolizumab\nBekki Tomoaki a Takakura Yuji a* Kochi Masatoshi a Konemori Yoko b Oki Kenji b Yoneda Masayasu b Egi Hiroyuki a Ohdan Hideki a aDepartment of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan\nbDepartment of Endocrinology and Diabetic Medicine, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan\n*Yuji Takakura, MD, PhD, Department of Gastroenterological and Transplant Surgery, Applied Life Sciences, Institute of Biomedical and Health Sciences, Hiroshima University, Kasumi 1-2-3 Minami-ku, Hiroshima 734-8551 (Japan), takakura@hiroshima-u.ac.jp or ytaka0621@gmail.com\nJan-Apr 2020 \n5 3 2020 \n5 3 2020 \n13 1 200 206\n18 12 2019 20 12 2019 2020 Copyright © 2020 by S. Karger AG, Basel2020This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.Pembrolizumab (Keytruda®) is an anti-programmed cell death 1-specific monoclonal antibody that has become the standard second-line chemotherapy for unresectable advanced microsatellite instability-high colorectal cancer. Several immune-related adverse events (irAEs), particularly endocrinopathy, are linked to the administration of pembrolizumab. We report here a case of pembrolizumab-induced isolated adrenocorticotropic hormone deficiency in a patient with metastatic colon cancer. A 65-year-old woman visited our hospital for complaints of fatigue with a recent history of primary resection of cecal mucinous cancer and hepatectomy for liver metastasis 3 years ago. Peritoneal dissemination was detected 2 years after surgery. Several chemotherapeutic regimens of cytotoxic and molecular targeted drugs were administered; however, the metastases progressed gradually. Pembrolizumab monotherapy was started because of resistance to treatment. After 2 cycles of pembrolizumab, the patient was severely fatigued. Laboratory data demonstrated that the cortisol level was extremely low. All the other values were within the normal range. Magnetic resonance imaging indicated no mass in the pituitary gland. From multiple tolerance tests, we diagnosed isolated adrenocorticotropic hormone deficiency caused by pembrolizumab. The patient's symptoms improved promptly with cortisol treatment. An abdominal contrast-enhanced computed tomography scan after 5 cycles of pembrolizumab demonstrated that the size of the peritoneal dissemination remained unchanged. However, her serum level of carcinoembryonic antigen had decreased to normal levels. Endocrine disorders are very rarely seen as irAEs. Careful laboratory data follow-up is required to inhibit the progression of severe endocrine disorders.\n\nKeywords\nAnti-programmed cell death 1-specific monoclonal antibodyMicrosatellite instability-high cancerImmune-related adverse eventsIsolated adrenocorticotropic hormone deficiency\n==== Body\nIntroduction\nConventionally, the treatment of unresectable advanced colorectal carcinoma is systemic chemotherapy. Immune checkpoint inhibitors (ICIs) are now recognized as a treatment option. Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) and programmed cell death 1 (PD-1) are the first well-recognized checkpoints that negatively regulate T-cell immune responses [1, 2]. The Food and Drug Administration (FDA) approved pembrolizumab (Keytruda®), a PD-1 inhibitor, for patients with unresectable or metastatic solid tumors positive for microsatellite instability (MSI)-high or DNA mismatch repair-deficient biomarkers [3].\n\nThis is the first example of an FDA approval of a treatment based on a tumor biomarker and not the type of tumor. Pembrolizumab has shown antitumor activity in a variety of tumors such as non-small cell lung carcinoma, renal carcinoma, urothelial carcinoma, Hodgkin's lymphoma, head and neck carcinoma, and mismatch repair-deficient colorectal carcinoma [4, 5, 6, 7, 8]. ICIs have shown autoimmune and inflammatory effects due to increased T-cell activation, which are defined as immune-related adverse events (irAEs) [9, 10, 11]. Pembrolizumab has become a mainstay in the treatment for unresectable and advanced MSI-high colorectal carcinoma. Therefore, the frequency with which irAEs will be experienced is also likely to increase. Various organ measurements reveal that organs such as the gastrointestinal tract, endocrine glands, skin, and liver are influenced by ICIs [12].\n\nThe incidence of endocrine disorders is low for anti-PD-1 monotherapy [13]. In addition, cases of isolated adrenocorticotropic hormone deficiency are very rare. We present a case of isolated adrenocorticotropic hormone deficiency caused by pembrolizumab in a patient with peritoneal dissemination of mucinous adenocarcinoma of the cecum.\n\nCase Report\nA 65-year-old Japanese woman had previously undergone multiple treatments for metastatic cecal cancer. Her original lesion was discovered 3 years earlier when she had laparoscopic ileocecal resection with D3 lymph node dissection for the primary site. After surgery, adjuvant chemotherapy with CAPOX (capecitabine/oxaliplatin) was administered because of the final stage III diagnosis. Abdominal contrast-enhanced computed tomography (CT) after 3 months detected a solitary liver metastasis despite the adjuvant chemotherapy; hence, she had laparoscopic partial hepatectomy for liver metastasis. Then, 1.5 years after the hepatectomy, peritoneal metastases were detected by abdominal contrast-enhanced CT (Fig. 1).\n\nTherefore, several lines of chemotherapy with anti-vascular endothelial growth factor antibody were administered for 1 year. However, as her disease progressed despite these treatments (Fig. 2), she was started on pembrolizumab at 200 mg because the primary resected specimen revealed that the tumor was MSI-high. After 2 cycles of pembrolizumab, the patient experienced severe fatigue. She had no other complaints such as nausea, anorexia, or abdominal pain. Laboratory data showed a decrease in cortisol (0.5 μg/dL) and adrenocorticotrophic hormone (ACTH) levels (3.0 pg/mL). Although the patient did not show any signs of anemia and neutropenia, additional examinations were performed during hospitalization due to suspected irAEs. She was suspected with having secondary adrenal insufficiency because of basal blood test findings including low ACTH and cortisol levels.\n\nThe magnetic resonance imaging (MRI) findings revealed no remarkable findings in the pituitary gland or hypothalamus (Fig. 3). An anterior pituitary function test by combined intravenous administration of the four hypothalamic releasing hormones showed that the levels were within the normal range, except for the corticotropin-releasing hormone load. ACTH and cortisol showed no response to corticotropin-releasing hormone loading, while the insulin tolerance test demonstrated not only ACTH hyposecretion but also a normal reaction of the growth hormone. The patient was diagnosed with an isolated adrenocorticotropic hormone deficiency. An irAE induced by pembrolizumab was the most likely cause of this condition. The patient started hydrocortisone therapy, which immediately relieved her fatigue. She was discharged on the thirteenth day after admission as her fatigue was reduced.\n\nAfter 5 cycles of pembrolizumab, carcinoembryonic antigen levels were within the normal range, and CT showed that the size of the peritoneal dissemination had progressed slightly (Fig. 4). Pembrolizumab therapy for peritoneal dissemination is still ongoing at the outpatient clinic without relapse of fatigue.\n\nDiscussion\nUsually, irAEs develop within a few weeks to months after the first administration of ICIs. Up to 29% of patients who have been treated with ICIs show signs of an endocrine disorder [14], which tends to occur after the sixth or seventh week, with a median time to onset of 7–20 weeks [15]. Although the likelihood of irAEs is higher in some patients with autoimmune disease, organ or hematopoietic stem cell transplants, chronic viral infection, organ dysfunction, or advanced age, the influences of these conditions remain controversial [16]. However, adrenal insufficiency was found to be very rare. According to past reports, the incidence of adrenal insufficiency was <4.3% [17, 18]. Some case reports have demonstrated adrenal insufficiency caused by nivolumab treatment. However, we could only find 3 previous case reports on adrenal insufficiency during treatment with pembrolizumab. The following search terms were used in PubMed and Google Scholar: “pembrolizumab and adrenal insufficiency.” One case was breast cancer treated with pembrolizumab as neoadjuvant chemotherapy [19]. The other cases were stage IV lung cancer treated with pembrolizumab as systemic chemotherapy [20, 21]. There are no case reports showing isolated adrenocorticotropic hormone deficiency caused by pembrolizumab.\n\nAdrenal insufficiency presents with nonspecific symptoms such as nausea, vomiting, weakness, fatigue, anorexia, abdominal pain, hypotension, fever, headache, and weight loss. Fatigue, especially, is the most common symptom reported by 16–24% of patients who were treated with an anti-PD-1-specific monoclonal antibody [13, 22, 23, 24]. Careful follow-up is required because of the relationships between dose and irAEs that have been demonstrated for CTLA-4, whereas toxicities of PD-1 antibodies are reported to be independent of dose [25, 26, 27]. In our case study, the onset of fatigue from the first administration was 7 weeks, occurring after only 2 cycles of pembrolizumab. Early diagnosis and starting treatment of irAEs are important to prevent life-threatening complications such as an adrenal crisis [28, 29].\n\nIf adrenal insufficiency due to ICIs is suspected, it is important to confirm serum cortisol, ACTH, aldosterone, and renin levels. Adrenal insufficiency should be suspected when early morning serum cortisol levels are <3 μg/dL [30]. Adrenal insufficiency can be classified into two types, primary and secondary. The main differential diagnosis of primary adrenal insufficiency is the appearance of brain metastasis during the treatment of colorectal cancers. MRI with gadolinium contrast is very useful to diagnose the brain metastasis [31]. Other hormone levels − for example, thyroid-stimulating hormone, free thyroxine, free tri-iodothyronine, gonadotrophins, and testosterone − should be checked for an accurate diagnosis [10].\n\nTreatment of adrenal insufficiency consists of systemic corticosteroids. Although most irAEs resolve within weeks to months after starting administration of ICIs [12], they may become severe. Thus, an appropriate treatment should be established. As an example, an initial high dose of corticosteroid of 12 mg/kg/day for 3 days could be administered, after which the dose would be reduced gradually over a period of at least 1 month [32]. When irAEs do not improve despite the use of adequate steroid medication, treatment can be supplemented with immunosuppressive medicine such as anti-tumor necrosis factor-α, mycophenolate mofetil, and antithymocyte immunoglobulins [33]. Endocrine-related AEs are irreversible, and it is important to continue administration of corticosteroids to patients who have developed adrenal insufficiency [34, 35]. Longer-term glucocorticoid therapy may lead to additional complications such as cushingoid features, osteoporosis, glaucoma, debilitating proximal muscle weakness, and opportunistic infections [36] including Aspergillus fumigatus pneumonia, cytomegalovirus hepatitis, and Pneumocystis pneumonia [37, 38, 39]. Thus, it is very important for patients being treated with ICIs to be under careful observation.\n\nWe could not find any previous reports on isolated adrenocorticotropic hormone deficiency that is caused by pembrolizumab; hence, to the best of our knowledge, this is the first reported case.\n\nConclusions\nWe experienced a rare case of isolated adrenocorticotropic hormone deficiency caused by pembrolizumab. One report showed a positive response from ICI-treated patients who have experienced high-grade irAEs [35]. Additionally, accurate diagnosis and starting treatment early are important to prevent the adrenal insufficiency from becoming severe.\n\nStatement of Ethics\nThe patient consented to the reporting of this case in publication.\n\nDisclosure Statement\nWe declare no conflicts of interest for this article.\n\nFunding Sources\nThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\n\nAuthor Contributions\nT.B., Y.T., K.O., and H.E. wrote the manuscript; Y.T., Y.K., K.O., and M.Y. made the diagnosis and performed treatment. All the authors read and approved the final manuscript.\n\nFig. 1 a, b Abdominal contrast-enhanced CT findings before chemotherapy with cytotoxic and molecular targeted drugs. Low-density areas (white arrows) suspected of being peritoneal dissemination were detected.\n\nFig. 2 a, b Abdominal contrast-enhanced CT findings after 5 cycles of chemotherapy with cytotoxic and molecular targeted drugs. The size of peritoneal dissemination (white arrows) had increased.\n\nFig. 3 Head MRI findings. There was no tumor in the pituitary gland (white arrow).\n\nFig. 4 a, b Abdominal contrast-enhanced CT findings after 5 cycles of chemotherapy with pembrolizumab. The size of peritoneal dissemination (white arrows) was unchanged.\n==== Refs\nReferences\n1 Chambers CA Kuhns MS Egen JG Allison JP CTLA-4-mediated inhibition in regulation of T cell responses: mechanisms and manipulation in tumor immunotherapy Annu Rev Immunol 2001 19 565 94 11244047 \n2 Ribas A Tumor immunotherapy directed at PD-1 N Engl J Med 2012 366 2517 9 22658126 \n3 Brahmer JR Tykodi SS Chow LQ Hwu WJ Topalian SL Hwu P Safety and activity of anti-PD-L1 antibody in patients with advanced cancer N Engl J Med 2012 366 2455 65 22658128 \n4 Motzer RJ Rini BI McDermott DF Redman BG Kuzel TM Harrison MR Nivolumab for metastatic renal cell carcinoma: results of a randomized phase II trial J Clin Oncol 2015 33 1430 7 25452452 \n5 Powles T Eder JP Fine GD Braiteh FS Loriot Y Cruz C MPDL3280A (anti-PD-L1) treatment leads to clinical activity in metastatic bladder cancer Nature 2014 515 558 62 25428503 \n6 Ansell SM Lesokhin AM Borrello I Halwani A Scott EC Gutierrez M PD-1 blockade with nivolumab in relapsed or refractory Hodgkin's lymphoma N Engl J Med 2015 372 311 9 25482239 \n7 Segal NH Ou SH Balmanoukian AS Fury MG Massarelli E Brahmer JR, et al Safety and efficacy of MEDI4736, an anti-PD-L1 antibody, in patients from a squamous cell carcinoma of the head and neck (SCCHN) expansion cohort J Clin Oncol 2015 33 (15 Suppl) 3011 \n8 Le DT Uram JN Wang H Bartlett BR Kemberling H Eyring AD PD-1 blockade in tumors with mismatch-repair deficiency N Engl J Med 2015 372 2509 20 26028255 \n9 Postow MA Callahan MK Wolchok JD Immune checkpoint blockade in cancer therapy J Clin Oncol 2015 33 1974 82 25605845 \n10 Postow MA Managing immune checkpoint-blocking antibody side effects Am Soc Clin Oncol Educ Book 2015 76 83 25993145 \n11 Boutros C Tarhini A Routier E Lambotte O Ladurie FL Carbonnel F Safety profiles of anti-CTLA-4 and anti-PD-1 antibodies alone and in combination Nat Rev Clin Oncol 2016 13 473 86 27141885 \n12 Weber JS Hodi FS Wolchok JD Topalian SL Schadendorf D Larkin J Safety profile of nivolumab monotherapy: a pooled analysis of patients with advanced melanoma J Clin Oncol 2017 35 785 92 28068177 \n13 Robert C Schachter J Long GV Arance A Grob JJ Mortier L Pembrolizumab versus ipilimumab in advanced melanoma N Engl J Med 2015 372 2521 32 25891173 \n14 González-Rodríguez E Rodríguez-Abreu D Spanish Group for Cancer Immuno-Biotherapy (GETICA) Immune checkpoint inhibitors: review and management of endocrine adverse events Oncologist 2016 21 804 16 27306911 \n15 Weber JS Dummer R de Pril V Lebbé C Hodi FS MDX010-20 Investigators. Patterns of onset and resolution of immune-related adverse events of special interest with ipilimumab: detailed safety analysis from a phase 3 trial in patients with advanced melanoma Cancer 2013 119 1675 82 23400564 \n16 Johnson DB Sullivan RJ Menzies AM Immune checkpoint inhibitors in challenging populations Cancer 2017 123 1904 11 28241095 \n17 Doi T Piha-Paul SA Jalal SI Mai-Dang H Yuan S Csiki MK Pembrolizumab (MK-3475) for patients (pts) with advanced esophageal carcinoma: preliminary results from KEYNOTE-028 J Clin Oncol 2015 33 (15 Suppl) 4010 \n18 Ribas A Puzanov I Dummer R Schadendorf D Hamid O Robert C Pembrolizumab versus investigator-choice chemotherapy for ipilimumab-refractory melanoma (KEYNOTE-002): a randomised, controlled, phase 2 trial Lancet Oncol 2015 16 908 18 26115796 \n19 Oristrell G Bañeras J Ros J Muñoz E Cardiac tamponade and adrenal insufficiency due to pembrolizumab: a case report Eur Heart J Case Rep 2018 2 yty038 31020118 \n20 Hanna RM Selamet U Bui P Sun SF Shenouda O Nobakht N Acute kidney injury after pembrolizumab-induced adrenalitis and adrenal insufficiency Case Rep Nephrol Dial 2018 8 171 7 30197906 \n21 Boudjemaa A Rousseau-Bussac G Monnet I Late-onset adrenal insufficiency more than 1 year after stopping pembrolizumab J Thorac Oncol 2018 13 e39 e40 29472057 \n22 Garon EB Rizvi NA Hui R Leighl N Balmanoukian AS Eder JP Pembrolizumab for the treatment of non-small-cell lung cancer N Engl J Med 2015 372 2018 28 25891174 \n23 Borghaei H Paz-Ares L Horn L Spigel DR Steins M Ready NE Nivolumab versus docetaxel in advanced nonsquamous non-small-cell lung cancer N Engl J Med 2015 373 1627 39 26412456 \n24 Robert C Long GV Brady B Dutriaux C Maio M Mortier L Nivolumab in previously untreated melanoma without BRAF mutation N Engl J Med 2015 372 320 30 25399552 \n25 Maker AV Yang JC Sherry RM Topalian SL Kammula US Royal RE Intrapatient dose escalation of anti-CTLA-4 antibody in patients with metastatic melanoma J Immunother 2006 29 455 63 16799341 \n26 Brahmer JR Drake CG Wollner I Powderly JD Picus J Sharfman WH Phase I study of single-agent anti-programmed death-1 (MDX-1106) in refractory solid tumors: safety, clinical activity, pharmacodynamics, and immunologic correlates J Clin Oncol 2010 28 3167 75 20516446 \n27 Topalian SL Hodi FS Brahmer JR Gettinger SN Smith DC McDermott DF Safety, activity, and immune correlates of anti-PD-1 antibody in cancer N Engl J Med 2012 366 2443 54 22658127 \n28 Weber JS Yang JC Atkins MB Disis ML Toxicities of immunotherapy for the practitioner J Clin Oncol 2015 33 2092 9 25918278 \n29 Brahmer JR Lacchetti C Schneider BJ Atkins MB Brassil KJ Caterino JM National Comprehensive Cancer Network. Management of immune-related adverse events in patients treated with immune checkpoint inhibitor therapy: American Society of Clinical Oncology clinical practice guideline J Clin Oncol 2018 36 1714 68 29442540 \n30 Hägg E Asplund K Lithner F Value of basal plasma cortisol assays in the assessment of pituitary-adrenal insufficiency Clin Endocrinol (Oxf) 1987 26 221 6 3311477 \n31 Moses AM Clayton B Hochhauser L Use of T1-weighted MR imaging to differentiate between primary polydipsia and central diabetes insipidus AJNR Am J Neuroradiol 1992 13 1273 7 1414815 \n32 Champiat S Lambotte O Barreau E Belkhir R Berdelou A Carbonnel F Management of immune checkpoint blockade dysimmune toxicities: a collaborative position paper Ann Oncol 2015 27 559 74 26715621 \n33 Naidoo J Page D Li B Connell LC Schindler K Lacouture ME Toxicities of the anti-PD-1 and anti-PD-L1 immune checkpoint antibodies Ann Oncol 2015 26 2375 91 26371282 \n34 Lemiale V Meert AP Vincent F Darmon M Bauer PR Van de Louw A Groupe de Recherche en Reanimation Respiratoire du patient d'Onco-Hématologie (Grrr-OH). Severe toxicity from checkpoint protein inhibitors: what intensive care physicians need to know? Ann Intensive Care 2019 9 25 30707321 \n35 Weber JS Postow M Lao CD Schadendorf D Management of adverse events following treatment with anti-programmed death-1 agents Oncologist 2016 21 1230 40 27401894 \n36 Huscher D Thiele K Gromnica-Ihle E Hein G Demary W Dreher R Dose-related patterns of glucocorticoid-induced side effects Ann Rheum Dis 2009 68 1119 24 18684744 \n37 Kyi C Hellmann MD Wolchok JD Chapman PB Postow MA Opportunistic infections in patients treated with immunotherapy for cancer J Immunother Cancer 2014 2 19 24991413 \n38 Arriola E Wheater M Krishnan R Smart J Foria V Ottensmeier C Immunosuppression for ipilimumab-related toxicity can cause Pneumocystis pneumonia but spare antitumor immune control Oncoimmunology 2015 4 e1040218 26451305 \n39 Uslu U Agaimy A Hundorfean G Harrer T Schuler G Heinzerling L Autoimmune colitis and subsequent CMV-induced hepatitis after treatment with ipilimumab J Immunother 2015 38 212 5 25962110\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1662-6575",
"issue": "13(1)",
"journal": "Case reports in oncology",
"keywords": "Anti-programmed cell death 1-specific monoclonal antibody; Immune-related adverse events; Isolated adrenocorticotropic hormone deficiency; Microsatellite instability-high cancer",
"medline_ta": "Case Rep Oncol",
"mesh_terms": null,
"nlm_unique_id": "101517601",
"other_id": null,
"pages": "200-206",
"pmc": null,
"pmid": "32308578",
"pubdate": "2020",
"publication_types": "D002363:Case Reports",
"references": "1414815;25452452;28241095;26715621;22658126;24991413;25918278;3311477;27401894;16799341;22658128;26028255;25962110;25605845;27141885;30707321;27306911;29442540;29472057;22658127;25399552;28068177;18684744;31020118;23400564;30197906;11244047;25891174;25993145;26115796;26412456;26371282;26451305;25428503;25891173;25482239;20516446",
"title": "A Case of Isolated Adrenocorticotropic Hormone Deficiency Caused by Pembrolizumab.",
"title_normalized": "a case of isolated adrenocorticotropic hormone deficiency caused by pembrolizumab"
} | [
{
"companynumb": "JP-009507513-1910JPN003745J",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "PEMBROLIZUMAB"
},
"drugadditional": null,
... |
{
"abstract": "Trekkers going to high altitude can suffer from several ailments both during and after their treks. Gastro-intestinal symptoms including nausea, vomiting, and abdominal pain are common in high altitude areas of Nepal due to acute mountain sickness or due to a gastro-intestinal illness. Occasionally, complications of common conditions manifest at high altitude and delay in diagnosis could be catastrophic for the patient presenting with these symptoms. We present two rare cases of duodenal and gastric perforations in trekkers who were evacuated from the Everest trekking region. Both of them had to undergo emergency laparotomy and repair of the perforation using modified Graham's patch in the first case and distal gastrectomy that included the perforated site, followed by two-layer end-to-side gastrojejunostomy and two-layer side-to-side jejunostomy in the second case. Perforation peritonitis at high-altitude, though rare, can be life threatening. Timely evacuation from high altitude, proper diagnosis and prompt treatment are essential for taking care of such patients. Keywords: duodenal ulcer; Everest; hypoxia; mountaineering; trekking.",
"affiliations": "CIWEC Hospital and Travel Medicine Center, Lainchaur, Kathmandu, Nepal.;Institute of Medicine, Tribhuvan University, Kathmandu, Nepal.;CIWEC Hospital and Travel Medicine Center, Lainchaur, Kathmandu, Nepal.",
"authors": "Amatya|Bhawana|B|;Lakhey|Paleswan Joshi|PJ|;Pandey|Prativa|P|",
"chemical_list": null,
"country": "Nepal",
"delete": false,
"doi": null,
"fulltext": "\n==== Front\nJNMA J Nepal Med Assoc\nJNMA J Nepal Med Assoc\nJ Nepal Med Assoc\nJNMA\nJNMA: Journal of the Nepal Medical Association\n0028-2715\n1815-672X\nJournal of the Nepal Medical Association\n\n30376009\nJNMA.v56.i210.pg625\nCase Report\nPerforation Peritonitis at High Altitude\nAmatya Bhawana 1\nLakhey Paleswan Joshi 2\nPandey Prativa 1\n1 CIWEC Hospital and Travel Medicine Center, Lainchaur, Kathmandu, Nepal\n2 Institute of Medicine, Tribhuvan University, Kathmandu, Nepal\nCorrespondence: Dr. Bhawana Amatya, CIWEC Hospital and Travel Medicine Center, Lainchaur, Kathmandu, Nepal. Email: bhawanaz@gmail.com, Phone: +977-9849944888.\nMar-Apr 2018\n30 4 2018\n56 210 625628\nJournal of the Nepal Medical Association\n2018\nhttps://creativecommons.org/licenses/by-nc/3.0/ This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.\nABSTRACT\n\nTrekkers going to high altitude can suffer from several ailments both during and after their treks. Gastro-intestinal symptoms including nausea, vomiting, and abdominal pain are common in high altitude areas of Nepal due to acute mountain sickness or due to a gastro-intestinal illness. Occasionally, complications of common conditions manifest at high altitude and delay in diagnosis could be catastrophic for the patient presenting with these symptoms. We present two rare cases of duodenal and gastric perforations in trekkers who were evacuated from the Everest trekking region. Both of them had to undergo emergency laparotomy and repair of the perforation using modified Graham's patch in the first case and distal gastrectomy that included the perforated site, followed by two-layer end-to-side gastrojejunostomy and two-layer side-to-side jejunostomy in the second case. Perforation peritonitis at high-altitude, though rare, can be life threatening. Timely evacuation from high altitude, proper diagnosis and prompt treatment are essential for taking care of such patients.\n\nKeywords\n\nduodenal ulcer\nEverest\nhypoxia\nmountaineering; trekking\n==== Body\npmcINTRODUCTION\n\nThe extreme altitude in the Himalayas of Nepal lure trekkers and tourists every year to challenge themselves to new realms. While high altitude can affect virtually all systems of the body, trekkers rescued from high-altitude can present with a myriad of symptoms apart from the usual altitude illness. In this case series, we highlight the stories of two Everest trekkers who had to curtail their treks due to acute abdomen, namely perforation peritonitis.\n\nAt a constant temperature, the volume of gas is inversely proportional to the pressure it receives according to Boyle's Law.1 Decreased barometric pressure at high-altitude2 causes hyper-inflation of the hollow viscera, which may cause them to perforate.3,4 Perforation peritonitis, though unusual after trekking can be a life-threatening condition, hence demands immediate attention.\n\nThis article focuses on the gravity of this illness so as to spread awareness about the spectrum of disorders that increasing altitude can generate.\n\nCASE REPORT\n\nA 45-year-old Korean male had been trekking in the Everest region for seven days when he developed severe nausea and vomiting at Lobuche (4900m). He took buscopan and ascended to Gorakshep (5140 m). While in Gorakshep, he had further episodes of vomiting, ongoing nausea and severe abdominal cramps. He was given Prednisolone 10mg, Sildenafil, Acetazolamide 250mg and Ibuprofen 400mg by a trekker doctor friend with concern of altitude illness. As his symptoms continued, he was carried down on the back of a horse from Gorakshep to Pheriche (4200 m). After an overnight rest, a helicopter brought him to Lukla and then to Kathmandu (1330m).\n\nAt CIWEC Hospital in Kathmandu, he continued to have repeated vomiting and upper abdominal pain of severity 10/10. He had pulse of 62/min, blood pressure of 160/90 mmHg, temperature of 37.3°C and oxygen saturation on room air of 99%. He was ill looking and appeared dehydrated. Lungs were clear and cardiac examination was normal. Abdominal examination initially revealed epigastric tenderness which was later followed by guarding and rigidity. Upright X-ray chest showed gas under both hemi-diaphragms (Figure 1). He was referred to surgery and emergency exploratory laparotomy was done. He was found to have a solitary perforation in the anterior wall of the first part of the duodenum which was repaired using modified Graham's Patch (Figure 2). Helicobacter pylori (H. pylori) antibody in the serum was positive and he was given triple therapy for H. pylori eradication. Post-operative recovery was uneventful and he returned to Korea.\n\nFigure 1. X-ray chest erect showing gas under both hemi-diaphragms.\n\nFigure 2. Intraoperative findings of perforation in anterior wall of the first part of the duodenum.\n\nCASE REPORT 2\n\nA 70-year-old previously healthy American male trekker was seen after helicopter evacuation from Deboche (3800m) in the Everest trekking region. He had been trekking for thirteen days, climbing up the Kala Pathar (5580m) and reaching the Everest Base Camp (5364m). On the twelfth night of his trek, he initially developed shoulder pain then woke up early in the morning with severe abdominal pain. The abdominal pain was aggravated by sudden movement, touching or deep breathing. He had been having diarrhoea until 5 days ago but had no bowel movement for the last 3 days. He had been taking Tab. Ciprofloxacin 500 mg twice daily for 5 days, which he had stopped 5 days ago, Cap Loperamide, Ibuprofen 600 mg twice as well as Hydrocodone 10 mg to relieve his pain. However, the pain had not subsided and he had to be helicopter evacuated to Kathmandu.\n\nUpon arrival at CIWEC, his vitals were blood pressure 120/80 mmHg, pulse 88/min, temperature 36.7°C, respiratory rate 22/min, spO2 98% in room air. He appeared dehydrated. His abdominal examination revealed diffuse severe tenderness with rigidity and sluggish bowel sounds. Chest, cardiovascular, and neurological examinations were normal. Chest X-ray erect with both domes of diaphragms showed gas under the right dome of diaphragm suggestive of pneumo-peritoneum (Figure 3). Emergency surgical consultation was followed by emergency laparotomy at another facility. One litre of sero-purulent fluid was present in the peritoneal cavity with large perforation in the pre-pyloric region in the anterior wall (~2 cm) with surrounding induration (Figure 4). Thorough lavage of the peritoneal cavity was done with 5 litres of warm saline. He underwent distal gastrectomy that included the perforated site, followed by two-layer end-to-side gastrojejunostomy and two-layer side to side jejunostomy. Two drains were placed- one in Morrison's pouch and the other in the pelvis.\n\nPost-surgery, he was kept in the intensive care unit at CIWEC, required inotropic support with Noradrenaline which was later tapered and stopped on third postoperative day. He was also kept under antibiotics Piperacillin/Tazobactam, oxygen and pain management. He developed pneumonia on the second post-operative day. He was hospitalized for ten days, then returned to his home country after his condition was stable. About three weeks post his arrival in the US, he developed an abscess on the site of the surgical incision. He was hospitalized there for a week and was treated with several different antibiotics for a month. Thereafter, he recovered and has remained in good health.\n\nFigure 3. Plain radiograph of chest erect view showing gas under right dome of diaphragm.\n\nFigure 4. Intra-operative findings of perforation on the pylorus of the stomach.\n\nDISCUSSION\n\nSymptoms of acute mountain sickness including headache, nausea and vomiting are common in trekkers to high altitude areas of Nepal where rates of AMS can be up to 50%.5 These symptoms are equally common due to a gastro-intestinal infection which is the most common ailment in travellers to Nepal.6,7 Our first patient had symptoms of nausea, vomiting initially with later development of abdominal pain. He was initially treated for AMS with steroid and Ibuprofen both of which could have made the duodenal ulcer worse. Helicobacter pylori infection is known to be associated with peptic ulcer disease8 and this patient was positive for this infection. He was evacuated to Kathmandu promptly where he was noted to have a surgical abdomen. Prompt treatment of perforated duodenal ulcer led to a speedy recovery. H. Pylori infection, combined with NSAIDs and steroid use at high altitude most likely led to the DU with perforation. He did well following surgery. In our second patient, it is possible that NSAID use had a role in causing gastric perforation. Although perforation peritonitis was recognized quickly in our facility, his advanced age might have led to a complicated course post operatively.9\n\nMedical facilities for performing surgeries do not exist in high altitude areas of Nepal and patients have to be evacuated to lower altitudes for prompt diagnosis and treatment. Helicopter rescues from the mountains are readily available in Nepal and this may be the reason patients survive life threatening conditions.10,11\n\nDid hypoxia at high altitude have a role in causing perforation in these patients? Increased incidence of gastric ulcers and bleeding have been described in Chinese lowlanders who moved to high altitude to work on a railroad project.12 The risk increased in persons who consumed large amounts of alcohol, took aspirin or dexamethasone.12,13 Gastric mucosal lesions and gastrointestinal bleeding from peptic ulcers have also been noted in Japanese mountaineers.14 Perforation of duodenal ulcer was noted in pilgrims from India during ‘Shri Amarnath Ji Yatra’ where devotees do a difficult trek of 40 km to reach a holy cave at 4200 m.15 Although increased incidence of gastric mucosal lesions have been noted in trekkers and mountaineers from the eastern cultures, this has not been a prominent finding in the Western literature. If one looks at the various organ systems of the body at extreme altitudes, most of them show some impairment attributable to hypoxia for example reduced gastrointestinal absorption.16\n\nCase reports from patients returning from air travel, which exemplify high altitude, have shown that high altitude predisposes to causing gaseous expansion and sometimes perforation in the digestive tract.3,17\n\nHealthcare providers and trekkers should be aware of the wide array of illnesses that may appear in the extreme conditions of high-altitude.\n\nAbdominal cramps and vomiting can also be symptoms of acute mountain sickness but as in these cases, with wide differentials in mind, life-threatening emergencies can be recognized and treated promptly.\n\nConflict of Interest\n\nNone.\n\nConsent\n\nJNMA Case report consent form was signed by the patient and the original is attached with the patient chart.\n==== Refs\nREFERENCES\n\n1. West JB Robert Boyle's landmark book of 1660 with the first experiments on rarified air Journal of Applied Physiology 2005 98 1 31 9 10.1152/japplphysiol.00759.2004 15591301\n2. B West J Lahiri S Maret K Peters R J Pizzo C Barometric pressures at extreme altitudes on Mt. Everest: Physiological significance 1983\n3. Kenfack R Debaize S Sztern B Joukovsky P [Perforation of a hiatal hernia after a high altitude flight] Rev Med Liege 2007 62 3 144 6 17511380\n4. Morgan J Sadler MA Yeghiayan P Spontaneous pneumomediastinum in a patient with recent air travel Emergency Radiology 2007 14 6 457 9 17458570\n5. Hackett PH Rennie D Levine HD The incidence, importance, and prophylaxis of acute mountain sickness Lancet 1976 2 7996 1149 55 10.1016/s0140-6736(76)91677-9 62991\n6. Greenwood Z Black J Weld L O'Brien D Leder K Von Sonnenburg F et al Gastrointestinal infection among international travelers globally J Travel Med 2008 15 4 221 8 10.1111/j.1708-8305.2008.00203.x 18666921\n7. Pandey P Bodhidatta L Lewis M Murphy H Shlim DR Cave W et al Travelers' diarrhea in Nepal: an update on the pathogens and antibiotic resistance J Travel Med 2011 18 2 102 8 10.1111/j.1708-8305.2010.00475.x 21366793\n8. Bashinskaya B Nahed BV Redjal N Kahle KT Walcott BP Trends in Peptic Ulcer Disease and the Identification of Helicobacter Pylori as a Causative Organism: Population-based Estimates from the US Nationwide Inpatient Sample J Glob Infect Dis 2011 3 4 366 70 10.4103/0974-777X.91061 22224001\n9. Christiansen P Jensen HE Amdrup E Fenger C Lindskov J Nielsen J et al Gastric ulcer in old age Acta Chir Scand 1978 144 7–8 491 4 747069\n10. Shlim DR Houston R Helicopter rescues and deaths among trekkers in Nepal JAMA 1989 261 7 1017 9 2578027\n11. Williams KL Exped 2010--the challenges of an expedition doctor J R Army Med Corps 2011 157 1 121 3 10.1136/jramc-157-01-20 21465922\n12. Wu TY Ding SQ Liu JL Jia JH Dai RC Zhu DC et al High-altitude gastrointestinal bleeding: An observation in Qinghai-Tibetan railroad construction workers on Mountain Tanggula World J Gastroenterol 2007 13 5 774 80 10.3748/wjg.v13.i5.774 17278202\n13. Subedi BH Pokharel J Goodman TL Amatya S Freer L Banskota N et al Complications of steroid use on Mt Everest. Wilderness Environ Med 2010 21 4 345 8 10.1016/j.wem.2010.09.006 21168788\n14. Sugie T Adachi M Jin-Nouchi Y Matsubayasi K Gastroduodenal mucosal lesion at high altitude Japanese journal of mountain medicine 1991 11 1 55 8\n15. Mir IS Mir M Ahmed M Profile of non traumatic surgical disorders found in the pilgrims/trekkers travelling to Shri Amarnath Ji cave Indian J Med Res 2008 128 6 740 3 19246798\n16. West JB Tolerance to severe hypoxia: lessons from Mt. Everest Acta Anaesthesiol Scand Suppl 1990 94 18 23 10.1111/j.1399-6576.1990.tb03216.x 2127151\n17. Blumen IJ Rinnert KJ Altitude physiology and the stresses of flight Air Medical Journal 1995 14 2 87 100 10.1016/s1067-991x(95)90102-7 10143549\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0028-2715",
"issue": "56(210)",
"journal": "JNMA; journal of the Nepal Medical Association",
"keywords": null,
"medline_ta": "JNMA J Nepal Med Assoc",
"mesh_terms": "D000006:Abdomen, Acute; D000368:Aged; D000531:Altitude; D003937:Diagnosis, Differential; D004386:Duodenum; D005743:Gastrectomy; D015390:Gastric Bypass; D006801:Humans; D007416:Intestinal Perforation; D007813:Laparotomy; D008297:Male; D008875:Middle Aged; D009051:Mountaineering; D009390:Nepal; D013275:Stomach Rupture; D016896:Treatment Outcome",
"nlm_unique_id": "0045233",
"other_id": null,
"pages": "625-628",
"pmc": null,
"pmid": "30376009",
"pubdate": "2018",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Perforation Peritonitis at High Altitude.",
"title_normalized": "perforation peritonitis at high altitude"
} | [
{
"companynumb": "NP-SUN PHARMACEUTICAL INDUSTRIES LTD-2019RR-205297",
"fulfillexpeditecriteria": "1",
"occurcountry": "NP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HYDROCODONE"
},
"dru... |
{
"abstract": "We herein report the case of a 69-year-old woman with rheumatoid arthritis (RA) and malignant lymphoma who developed Helicobacter cinaedi bacteremia after starting rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy. She had a recurrent fever and painful erythema for 13 months before the diagnosis was made. This delayed diagnosis was attributable to the underlying RA, which typically presents with various cutaneous manifestations and elevated C-reactive protein levels. The erythema on the thighs, abdomen, and left forearm improved following treatment with intravenous aminobenzyl penicillin; she received antibiotics for six weeks. This case emphasizes the importance of recognizing this opportunistic infection in immunocompromised patients.",
"affiliations": "Department of Rheumatology, Kawasaki Medical School, Japan.;Department of Dermatology, Kawasaki Medical School, Japan.;Department of Rheumatology, Kawasaki Medical School, Japan.;Department of Rheumatology, Kawasaki Medical School, Japan.;Department of Rheumatology, Kawasaki Medical School, Japan.",
"authors": "Fujita|Shunichi|S|;Hayashi|Hiroaki|H|;Kodama|Shoko|S|;Mukai|Tomoyuki|T|;Morita|Yoshitaka|Y|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000667:Ampicillin",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.1196-18",
"fulltext": "\n==== Front\nIntern MedIntern. MedInternal Medicine0918-29181349-7235The Japanese Society of Internal Medicine 3014658010.2169/internalmedicine.1196-18Case ReportBacteremia Possibly Caused by Helicobacter cinaedi and Associated with Painful Erythema in Rheumatoid Arthritis with Malignant Lymphoma Fujita Shunichi 1Hayashi Hiroaki 2Kodama Shoko 1Mukai Tomoyuki 1Morita Yoshitaka 1\n1 Department of Rheumatology, Kawasaki Medical School, Japan\n2 Department of Dermatology, Kawasaki Medical School, JapanCorrespondence to Dr. Yoshitaka Morita, morita@med.kawasaki-m.ac.jp\n\n24 8 2018 15 12 2018 57 24 3663 3666 15 3 2018 5 6 2018 Copyright © 2018 by The Japanese Society of Internal Medicine2018The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/by-nc-nd/4.0/).We herein report the case of a 69-year-old woman with rheumatoid arthritis (RA) and malignant lymphoma who developed Helicobacter cinaedi bacteremia after starting rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy. She had a recurrent fever and painful erythema for 13 months before the diagnosis was made. This delayed diagnosis was attributable to the underlying RA, which typically presents with various cutaneous manifestations and elevated C-reactive protein levels. The erythema on the thighs, abdomen, and left forearm improved following treatment with intravenous aminobenzyl penicillin; she received antibiotics for six weeks. This case emphasizes the importance of recognizing this opportunistic infection in immunocompromised patients. \n\nHelicobacter cinaedipainful erythemarheumatoid arthritismalignant lymphoma\n==== Body\nIntroduction\nPatients with rheumatoid arthritis (RA) may develop a variety of specific or nonspecific cutaneous manifestations. When rheumatologists encounter RA patients with painful erythema on the extremities, the differential diagnosis for this cutaneous condition can be particularly challenging. It may include cellulitis, neutrophilic panniculitis, diffuse fasciitis, or neutrophilic dermatosis with Sweet's syndrome (1-5). However, it is also necessary to consider Helicobacter cinaedi bacteremia-associated erythema in rheumatoid disease (6-9), even though this opportunistic infectious disease is rare. Indeed, there are very few reports of this complication in the rheumatology literature.\n\nWe herein report a case of RA with malignant lymphoma in a patient with recurrent painful erythema associated with H. cinaedi bacteremia.\n\nCase Report\nA 69-year-old woman with a 7-year history of RA was admitted to our hospital in October 2015 for recurrent painful swelling and redness of both thighs and the abdomen. She had received a diagnosis of gastric diffuse large B-cell lymphoma (DLBCL) in March 2014, and the methotrexate (12 mg/week) she had been taking was stopped because of the possibility of methotrexate-associated lymphoproliferative disorder. Since discontinuation of methotrexate failed to lead to remission of the gastric DLBCL, she was then started on rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy in September 2014. Two weeks after the first administration of R-CHOP, she developed painful erythematous swelling of the left thigh (Fig. 1). Laboratory findings were C-reactive protein (CRP) 2.26 mg/dL and white cell count 6,400/μL. A skin biopsy revealed inflammatory infiltrate of lymphocytes in the dermis and subcutaneous adipose tissue without evidence of vasculitis (Fig. 2). No bacteria were observed microscopically in the tissue specimen.\n\nFigure 1. Painful erythema on the left thigh, with the area of erythema marked in black ink to assess the clinical progress.\n\nFigure 2. A skin biopsy specimen shows inflammatory infiltrate of lymphocytes in the dermis and subcutaneous adipose tissue without evidence of vasculitis.\n\nThe erythema improved spontaneously two weeks later, so the second round of R-CHOP was administered. However, three weeks after the second round of R-CHOP, she developed painful erythema on both thighs. The serum CRP level was 4.22 mg/dL, so she was treated empirically with moxifloxacin for 5 days. After a brief improvement, the third round of R-CHOP was administered. R-CHOP chemotherapy was repeated every three to four weeks for four cycles, and a subsequent two cycles of rituximab monotherapy were added. During these cycles, she received 14 days' treatment of garenoxacin twice in December 2014 and March 2015 for her fever and chronic painful erythema on both thighs. However, despite these treatments, she did not show a marked response, and her CRP level remained high.\n\nPositron emission tomography-computed tomography was performed in April 2015 after the last rituximab administration. This showed an increased 18F-fluoro-2-deoxyglucose uptake in the right thigh (Fig. 3), with no other abnormalities in the visceral organs. Given that the painful erythema in the thigh might have been associated with RA, she underwent a trial of prednisolone 20 mg/day but was only partially responsive, and she developed new painful erythematous lesions on the skin of the abdomen and left forearm and was thus admitted for a further investigation in October 2015.\n\nFigure 3. Positron emission tomography-computed tomography images show an increased 18F-fluoro-2-deoxyglucose uptake in the right thigh.\n\nOn an examination, her temperature was 36.3℃, blood pressure 142/99 mmHg, and pulse 87 beats/min. A skin examination revealed painful erythema on both thighs, the abdomen, and the left forearm. A physical examination of the chest was unremarkable. Laboratory investigations revealed a CRP level of 6.25 mg/dL, hemoglobin of 12.2 g/dL, white blood cell count of 9,400/μL, and platelet count of 9.3×104/μL. Rheumatoid factor and anti-cyclic citrullinated peptide antibody were both positive at 21 IU/mL and 32.9 U/mL, respectively. Serum complement C3 and C4 were elevated at 125.6 mg/dL and 36.7 mg/dL, respectively. Hep-2 antinuclear antibody and antineutrophil cytoplasmic antibodies were negative. An interferon gamma release assay for tuberculosis was negative.\n\nTwo sets of blood culture tests were performed, and aerobic bottles from both sets were positive for growth of a Gram-negative spiral bacillus after four days' incubation. A thinly spread colony was found 4 days after the start of subcultures, consisting of growth on 5% sheep blood agar plates upon immediate incubation under wet microaerophilic conditions. Growth occurs at 35℃ but not at 25 or 42℃. The bacteria isolated was presumed to be H. cinaedi based on the morphology and growth features. Treatment with intravenous aminobenzyl penicillin (ABPC) at 8 g/day improved the erythema on the thighs, abdomen, and left forearm. This bacterium was not detected in the blood culture nine days after starting ABPC, and the patient received antibiotics for six weeks. Two years later, she remains clinically well without recurrence of the infection or malignant lymphoma.\n\nDiscussion\n\nH. cinaedi is a Gram-negative enterohepatic spiral bacillus that inhabits the intestinal tracts of mammals (10). Several cases of human H. cinaedi infections have been reported in immunocompromised patients, such as those following organ transplantation or with human immunodeficiency virus infection or cancer (10-12). Although the exact mechanism has not been identified, H. cinaedi bacteremia is often accompanied by skin manifestations, such as cellulitis and erythema nodosum-like eruptions (11), which have been reported to develop through bacterial translocation from the intestines into the circulation (13).\n\nIt is likely that R-CHOP chemotherapy was associated with the onset of this opportunistic infection in our patient, although recently there have been some reports describing patients with rheumatic diseases who developed H. cinaedi infection as an opportunistic pathogen (7, 8, 11). Therefore, RA itself or the previous treatment with methotrexate might have been involved in the development of disease in our case.\n\nWe should note that a definitive diagnosis of H. cinaedi infection should be based on a gene analysis (14). Since nucleotide sequencing or species-specific polymerase chain reaction was not performed in our case, the isolated Gram-negative spiral bacterium was not identified as a specific bacterium within the genus Helicobacter. However, the organism had several morphological and growth features characteristic of H. cinaedi. It appeared as a thinly spread colony and showed no hemolysis on sheep blood agar. Furthermore, the bacterium grew at 35℃ and but not 25℃ or 42℃ (15). Based on these morphological and growth features, we suspected that the isolated bacterium was very likely H. cinaedi.\n\nThe unique but regrettable point of this case is that it took an extremely long time before a diagnosis of H. cinaedi bacteremia could be made. Our patient developed painful erythema in September 2014, which was two weeks after the first administration of R-CHOP chemotherapy. She was diagnosed with H. cinaedi infection in October 2015. Since she had been having a recurrent fever and chronic skin manifestations during this period, it is likely that the bacteremia had been ongoing for 13 months. We should have considered H. cinaedi infection as the cause of the recurrent fever and erythema earlier in the course of the disease. However, her underlying RA, which can present with various skin manifestations and elevated CRP (1-5), as well as the short-term use of oral antibiotics resulted in a delayed diagnosis. Since H. cinaedi is a low-virulence bacterium (16, 17), our patient fortunately did not develop serious complications. Infectious aortic aneurysm has been reported in some patients with H. cinaedi bacteremia (17, 18), although this fortunately did not occur in our case.\n\nThe ideal duration or choice of antibiotic therapy for H. cinaedi bacteremia has not been established. This organism is reportedly resistant to various antibiotics, including macrolides and quinolones (6). Furthermore, frequent cases of recurrence after stopping antibiotics have been reported (16). We therefore treated our patient with intravenous antibiotics for a sufficiently long period of six weeks, which proved successful. This case emphasizes the importance of recognizing this opportunistic infection in patients with rheumatic disease. Infection with this pathogen should be suspected in cases of painful erythema of unidentified etiology.\n\n\nThe authors state that they have no Conflict of Interest (COI).\n==== Refs\n1. \nChua-Aguilera CJ , Moller B , Yawalkar N \nSkin manifestations of rheumatoid arthritis, juvenile idiopathic arthritis, and spondyloarthritides . Clin Rev Allergy Immunol \n53 : 371 -393 , 2017 .28752373 \n2. \nYoshida Y , Kiryu H , Furue M , Nakayama J , Matsuda T \nRheumatoid neutrophilic dermatitis . J Dermatol \n30 : 255 -256 , 2003 .12692368 \n3. \nGay-Crosier F , Dayer JM , Chavaz P , Hauser C \nRheumatoid neutrophilic dermatitis/sweet's syndrome in a patient with seronegative rheumatoid arthritis . Dermatology \n201 : 185 -187 , 2000 .11053935 \n4. \nIwata K , Arinuma Y , Nakayama H , et al \nAn autopsy case of necrotizing fasciitis with rapidly progressive purpura caused by hemolytic streptococcal infection in a patient with rheumatoid arthritis . Mod Rheumatol \n21 : 669 -672 , 2011 .21499909 \n5. \nYamamoto T \nCutaneous necrobiotic conditions associated with rheumatoid arthritis: important extra-articular involvement . Mod Rheumatol \n23 : 617 -622 , 2013 .23053722 \n6. \nKawamura Y , Tomida J , Morita Y , Fujii S , Okamoto T , Akaike T \nClinical and bacteriological characteristics of Helicobacter cinaedi infection . J Infect Chemother \n20 : 517 -526 , 2014 .25022901 \n7. \nKikuchi H , Asako K , Tansho S , et al \nRecurrent Helicobacter cinaedi cellulitis and bacteremia in a patient with systemic lupus erythematosus . Intern Med \n51 : 3185 -3188 , 2012 .23154730 \n8. \nNishida R , Shimono N , Miyake N , et al \nHelicobacter cinaedi bacteremia mimicking a flare of systemic lupus erythematosus . Intern Med \n56 : 725 -728 , 2017 .28321078 \n9. \nMinauchi K , Takahashi S , Sakai T , et al \nThe nosocomial transmission of Helicobacter cinaedi infections in immunocompromised patients . Intern Med \n49 : 1733 -1739 , 2010 .20720350 \n10. \nKiehlbauch JA , Tauxe RV , Baker CN , Wachsmuth IK \nHelicobacter cinaedi-associated bacteremia and cellulitis in immunocompromised patients . Ann Intern Med \n121 : 90 -93 , 1994 .8017741 \n11. \nShimizu S , Shimizu H \nCutaneous manifestations of Helicobacter cinaedi: a review . Br J Dermatol \n175 : 62 -68 , 2016 .26678698 \n12. \nMatsumoto T , Goto M , Murakami H , et al \nMulticenter study to evaluate bloodstream infection by Helicobacter cinaedi in Japan . J Clin Microbiol \n45 : 2853 -2857 , 2007 .17596362 \n13. \nAraoka H , Baba M , Okada C , et al \nFirst evidence of bacterial translocation from the intestinal tract as a route of Helicobacter cinaedi bacteremia . Helicobacter \n23 , 2018 [Epub ahead of print].\n14. \nOyama K , Khan S , Okamoto T , et al \nIdentification of and screening for human Helicobacter cinaedi infections and carriers via nested PCR . J Clin Microbiol \n50 : 3893 -3900 , 2012 .23015666 \n15. \nAraoka H , Baba M , Kimura M , Abe M , Inagawa H , Yoneyama A \nClinical characteristics of bacteremia caused by Helicobacter cinaedi and time required for blood cultures to become positive . J Clin Microbiol \n52 : 1519 -1522 , 2014 .24574294 \n16. \nUckay I , Garbino J , Dietrich PY , Ninet B , Rohner P , Jacomo V \nRecurrent bacteremia with Helicobacter cinaedi: case report and review of the literature . BMC Infect Dis \n6 : 86 , 2006 .16719920 \n17. \nKushimoto K , Yonekura R , Umesue M , et al \nInfected thoracic aortic aneurysm caused by Helicobacter cinaedi . Ann Vasc Dis \n10 : 139 -142 , 2017 .29034040 \n18. \nUnosawa S , Niino T \nAn infected abdominal aortic aneurysm caused by Helicobacter cinaedi . Ann Vasc Dis \n8 : 318 -320 , 2015 .26730258\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0918-2918",
"issue": "57(24)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": "Helicobacter cinaedi; malignant lymphoma; painful erythema; rheumatoid arthritis",
"medline_ta": "Intern Med",
"mesh_terms": "D000368:Aged; D000667:Ampicillin; D000900:Anti-Bacterial Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D001172:Arthritis, Rheumatoid; D016470:Bacteremia; D004890:Erythema; D005260:Female; D016998:Helicobacter; D016481:Helicobacter Infections; D006801:Humans; D016867:Immunocompromised Host; D008223:Lymphoma; D009894:Opportunistic Infections; D010146:Pain; D012008:Recurrence",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "3663-3666",
"pmc": null,
"pmid": "30146580",
"pubdate": "2018-12-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "11053935;12692368;16719920;17596362;20720350;21499909;23015666;23053722;23154730;24574294;25022901;26678698;26730258;28321078;28752373;29034040;29218758;8017741",
"title": "Bacteremia Possibly Caused by Helicobacter cinaedi and Associated with Painful Erythema in Rheumatoid Arthritis with Malignant Lymphoma.",
"title_normalized": "bacteremia possibly caused by helicobacter cinaedi and associated with painful erythema in rheumatoid arthritis with malignant lymphoma"
} | [
{
"companynumb": "JP-ACCORD-101100",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "RITUXIMAB"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "Although donor-specific antibodies are regarded as a contraindication for kidney transplantation, the data available for combined liver and kidney transplantation (cLKTx) are scarce, and there is no established therapeutic approach for this category of transplant recipients. De novo use of everolimus and a reduced dose of calcineurin inhibitor reportedly provides excellent kidney function compared with a standard regimen containing a calcineurin inhibitor. This strategy, however, has been applied in only some recipient categories. Here we report a case of A highly sensitized male patient who underwent a cLKTx and received everolimus with low-dose tacrolimus (once-daily prolonged-release formulation) as ab initio immunosuppressive treatment. The pretransplant panel-reactive antibody estimate was 97%, and multiple anti-HLA antibodies were detected at the time of transplantation. Thus far, patient and allograft survival have reached 2 years, with the recipient remaining on a regimen of immunosuppression with everolimus and low-dose tacrolimus, with no episodes of rejection.",
"affiliations": "Liver and Kidney Transplant Centre, Policlinico \"Tor Vergata\", University of Rome \"Tor Vergata\", Rome, Italy. Electronic address: laura.tariciotti@gmail.com.;Liver and Kidney Transplant Centre, Policlinico \"Tor Vergata\", University of Rome \"Tor Vergata\", Rome, Italy.;Liver and Kidney Transplant Centre, Policlinico \"Tor Vergata\", University of Rome \"Tor Vergata\", Rome, Italy.;Liver and Kidney Transplant Centre, Policlinico \"Tor Vergata\", University of Rome \"Tor Vergata\", Rome, Italy.;Liver and Kidney Transplant Centre, Policlinico \"Tor Vergata\", University of Rome \"Tor Vergata\", Rome, Italy.",
"authors": "Tariciotti|L|L|;Manzia|T M|TM|;Sforza|D|D|;Anselmo|A|A|;Tisone|G|G|",
"chemical_list": "D000906:Antibodies; D000961:Antilymphocyte Serum; D065095:Calcineurin Inhibitors; D006680:HLA Antigens; D007166:Immunosuppressive Agents; D000068338:Everolimus; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1016/j.transproceed.2016.07.021",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0041-1345",
"issue": "48(9)",
"journal": "Transplantation proceedings",
"keywords": null,
"medline_ta": "Transplant Proc",
"mesh_terms": "D000906:Antibodies; D000961:Antilymphocyte Serum; D065095:Calcineurin Inhibitors; D051799:Delayed Graft Function; D004359:Drug Therapy, Combination; D000068338:Everolimus; D006084:Graft Rejection; D006680:HLA Antigens; D006801:Humans; D007166:Immunosuppressive Agents; D007668:Kidney; D016030:Kidney Transplantation; D008099:Liver; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D016559:Tacrolimus; D014019:Tissue Donors; D066027:Transplant Recipients; D014181:Transplantation Immunology",
"nlm_unique_id": "0243532",
"other_id": null,
"pages": "3109-3111",
"pmc": null,
"pmid": "27932158",
"pubdate": "2016-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Everolimus and Advagraf Ab Initio in Combined Liver and Kidney Transplant With Donor-Specific Antibodies: A Case Report.",
"title_normalized": "everolimus and advagraf ab initio in combined liver and kidney transplant with donor specific antibodies a case report"
} | [
{
"companynumb": "IT-ASTELLAS-2016US049031",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "Intramedullary spinal cord metastasis of non-small cell lung cancer is rare, and it has a short prognosis. We report a 53-year-old man diagnosed with cT4N0M0, stage IIIA squamous cell lung cancer. Ten months after left pneumonectomy (pT4N0M0), an intramedullary spinal cord tumor developed at the axis level. The intramedullary spinal cord tumor was resected, and he was diagnosed with metastatic squamous cell lung cancer. Radiotherapies and another tumor resection were conducted, as he had a good performance status and the discrete lesion was associated with the risk of brain stem compression. Multimodal local treatments for intramedullary spinal cord metastasis caused the tumor to shrink, and he lived for 25 months after the spinal metastasis occurred.",
"affiliations": "Department of Internal Medicine, National Hospital Organization Kinki-chuo Chest Medical Center, Osaka, Japan ;;Department of Psychosomatic Internal Medicine, National Hospital Organization Kinki-chuo Chest Medical Center, Osaka, Japan ;;Department of Surgery, National Hospital Organization Kinki-chuo Chest Medical Center, Osaka, Japan ;;Department of Neurosurgery, Osaka Rosai Hospital, Osaka, Japan; ; Department of Neurosurgery, Osaka University Graduate School of Medicine, Osaka, Japan;",
"authors": "Minomo|Shojiro|S|;Tokoro|Akihiro|A|;Utsumi|Tomoki|T|;Ishihara|Masahiro|M|;Akira|Masanori|M|;Atagi|Shinji|S|",
"chemical_list": null,
"country": "China",
"delete": false,
"doi": "10.21037/jtd.2016.06.58",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2072-1439",
"issue": "8(8)",
"journal": "Journal of thoracic disease",
"keywords": "Lung neoplasms; multimodal treatment; neoplasm metastasis; spinal cord; squamous cells",
"medline_ta": "J Thorac Dis",
"mesh_terms": null,
"nlm_unique_id": "101533916",
"other_id": null,
"pages": "E681-3",
"pmc": null,
"pmid": "27621899",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports",
"references": "11244733;18930587;4052974;6323364;18520813;17403628;15526223;23585962;11165413;8402479;25846908;26424338",
"title": "A case of long-term survival after multimodal local treatments of intramedullary spinal cord metastasis of squamous cell lung cancer.",
"title_normalized": "a case of long term survival after multimodal local treatments of intramedullary spinal cord metastasis of squamous cell lung cancer"
} | [
{
"companynumb": "JP-SA-2016SA202351",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "GIMERACIL\\OTERACIL\\TEGAFUR"
},
"drugadditional": n... |
{
"abstract": "BACKGROUND\nTamoxifen may occasionally precipitate serious and potentially life-threatening hypercalcemia. However, to date, this has not been documented with aromatase inhibitors.\n\n\nMETHODS\nA 65-year-old Japanese woman with liver metastasis from breast cancer was admitted to our hospital with vomiting, anorexia, fatigue, arthralgia, muscle pain and dehydration. She had started a course of letrozole five weeks earlier. Our patient's calcium level was 11.6 mg/dL. She was rehydrated and elcatonin was administered. Our patient's parathyroid hormone and parathyroid hormone-related protein levels were not increased and a bone scintigram revealed no evidence of skeletal metastasis. After our patient's serum calcium level returned to within the normal range, letrozole was restarted at one-half of the previous dose (1.25 mg). There were no episodes of hypercalcemia. However, 84 days after restarting letrozole, our patient again complained of arthralgia and treatment was changed to toremifene. During these periods, repeated ultrasonograms revealed no progression of liver metastasis.\n\n\nCONCLUSIONS\nTo the best of our knowledge, this is the first case report of flare hypercalcemia after treatment with letrozole in a patient with metastatic breast cancer.",
"affiliations": "Department of Surgery, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677, Japan. kurochan@dd.iij4u.or.jp.",
"authors": "Kuroi|Katsumasa|K|;Yamashita|Toshinari|T|;Aruga|Tomoyuki|T|;Horiguchi|Kazumi|K|;Kitagawa|Dai|D|;Sekine|Susumu|S|;Tokita|Hiromi|H|;Hirashima|Yuka|Y|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/1752-1947-5-495",
"fulltext": "\n==== Front\nJ Med Case ReportsJournal of Medical Case Reports1752-1947BioMed Central 1752-1947-5-4952197071510.1186/1752-1947-5-495Case ReportFlare hypercalcemia after letrozole in a patient with liver metastasis from breast cancer: a case report Kuroi Katsumasa 1kurochan@dd.iij4u.or.jpYamashita Toshinari 1tyamashita@cick.jpAruga Tomoyuki 1aruga@cick.jpHoriguchi Kazumi 1kazumi.horiguchi@gmail.comKitagawa Dai 1moon1121diver@yahoo.co.jpSekine Susumu 1susumu.0420wb@mac.comTokita Hiromi 1h-tokita@mtf.biglobe.ne.jpHirashima Yuka 2Yuka_Hirashima@member.metro.tokyo.jp1 Department of Surgery, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677, Japan2 Department of Pharmacy, Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8677, Japan2011 4 10 2011 5 495 495 15 6 2011 4 10 2011 Copyright ©2011 Kuroi et al; licensee BioMed Central Ltd.2011Kuroi et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Introduction\nTamoxifen may occasionally precipitate serious and potentially life-threatening hypercalcemia. However, to date, this has not been documented with aromatase inhibitors.\n\nCase presentation\nA 65-year-old Japanese woman with liver metastasis from breast cancer was admitted to our hospital with vomiting, anorexia, fatigue, arthralgia, muscle pain and dehydration. She had started a course of letrozole five weeks earlier. Our patient's calcium level was 11.6 mg/dL. She was rehydrated and elcatonin was administered. Our patient's parathyroid hormone and parathyroid hormone-related protein levels were not increased and a bone scintigram revealed no evidence of skeletal metastasis. After our patient's serum calcium level returned to within the normal range, letrozole was restarted at one-half of the previous dose (1.25 mg). There were no episodes of hypercalcemia. However, 84 days after restarting letrozole, our patient again complained of arthralgia and treatment was changed to toremifene. During these periods, repeated ultrasonograms revealed no progression of liver metastasis.\n\nConclusion\nTo the best of our knowledge, this is the first case report of flare hypercalcemia after treatment with letrozole in a patient with metastatic breast cancer.\n==== Body\nIntroduction\nFlare reaction, a transient exacerbation of symptoms, has been described primarily in breast cancer treatment with tamoxifen and in prostate cancer following therapy with luteinizing hormone-releasing hormone analogues [1,2]. However, the association between a flare reaction and aromatase inhibitors (AIs) has not been documented. We report a case of hypercalcemia that occurred 37 days after initiation of letrozole in a patient with liver metastasis from breast cancer.\n\nCase presentation\nA 65-year-old Japanese woman was admitted to our hospital one year ago with vomiting, anorexia, fatigue, arthralgia, muscle pain, and dehydration (Figure 1). Our patient had undergone a right mastectomy 30 years previously and received adjuvant chemoendocrine therapy (doxifluridine and tamoxifen) without complications. Five years after that surgery, she developed a tumor in her liver and a needle biopsy revealed metastatic adenocarcinoma from breast cancer (estrogen-receptor positive, progesterone-receptor positive, Her2 negative). Since then, our patient has been treated with taxanes and capecitabine, followed by doxifluridine and medroxyprogesterone acetate. Using doxifluridine and medroxyprogesterone acetate, she remained well and achieved a complete response without an increase of carcinoembryonic antigen (CEA) or carbohydrate antigen (CA) 15-3 for eight years. However, three months before this current admission, CEA and CA 15-3 had increased to 6.3 ng/mL (normal value < 5 ng/mL) and 30.6 IU/mL (normal value < 23 IU/mL) respectively and an abdominal ultrasonogram revealed recurrence of liver metastasis. A computed tomography (CT) scan was normal. Letrozole was initiated with alendronate (T score -2.8) and withdrawn three weeks later due to severe muscle pain and arthralgia. Two weeks after the onset of these symptoms, the severity increased and our patient was admitted to our hospital. Her serum calcium level was 11.6 mg/dL. She was rehydrated and elcatonin was administered. Parathyroid hormone (PTH) and parathyroid hormone-related protein (PTHrP) levels were not increased and a bone scintigram, CT and thoracolumbar survey revealed no evidence of skeletal metastasis. Intravenous bisphosphonate was not administered as our patient had been undergoing dental treatment. She was discharged when symptoms subsided on day 11. One week later, after the completion of her dental treatment, our patient was administered zoledronate for persistent hypercalcemia. Thereafter, our patient was readmitted due to hypocalcemia. After our patient's serum calcium levels returned to within normal range, letrozole was restarted at one-half dose (1.25 mg) with no reoccurrence of hypercalcemia. Unfortunately, 84 days after the restart, letrozole was withheld due to intolerable arthralgia and our patient's therapy was changed to toremifene. Although she complained of mild arthralgia while on toremifene, the symptom gradually subsided and she has remained well. Repeated ultrasonograms revealed no progression of liver metastasis. Our patient's CEA and CA 15-3 have again increased to pretreatment levels but have remained stable.\n\nFigure 1 Changes in serum calcium level and tumor markers before and after flare hypercalcemia. The normal range of serum calcium level was 8.4 mg/dL to 9.7 mg/dL (this was changed to 8.5 mg/dL to 10.2 mg/dL at midstream), and the calcium level was corrected with albumin by a standard calculation.\n\nDiscussion\nA flare reaction was first observed during the treatment of postmenopausal women with high-dose estrogen and has been frequently documented with tamoxifen [1,3]. This reaction comprises two different manifestations: tumor flare and flare hypercalcemia [2]. The former includes an increase in swelling, erythema, itching, or pain in soft-tissue metastasis, the development of new lesions, an increase of tumor markers and an increase in skeletal pain in patients with bone metastasis. Tumor flare can be accompanied by flare hypercalcemia.\n\nThe distinction between spontaneous hypercalcemia and flare hypercalcemia is sometimes difficult to ascertain. Although both occur most often in patients with widespread bone metastases [4,5], flare hypercalcemia can be seen in patients without apparent bone involvement [6,7], as in the case of our patient. Moreover, flare hypercalcemia has a rapid onset that characteristically occurs within several days of starting therapy; symptoms are usually short-lived and serum calcium levels return to normal when the offering agent is withdrawn. In contrast, spontaneous hypercalcemia is generally slow in onset and, accordingly, symptoms develop gradually [1,8]. In general, the following three criteria are used to prove a causal relation between drug and symptom: the symptom should develop after drug administration, reverse when it is withdrawn, and be reinduced by rechallenge [9]. In this respect, flare hypercalcemia could meet two of these three criteria. Similar to other reports of flare hypercalcemia [5,6,8-11], the third criterion is not met in the case of our patient; however, the temporary relation of the onset of hypercalcemia and administration of letrozole strongly suggests a causal role for the drug.\n\nOur review of the literature did not reveal any description of flare hypercalcemia by AIs with the exception of one report of tumor flare and tumor lysis syndrome by letrozole. In a study by Zigrossi et al. [12], a 61-year-old woman experienced tumor flare (pleural and pericardial effusion) and tumor lysis syndrome on the second day of letrozole administration and subsequently recovered from critical condition, notwithstanding continuation of letrozole. Tumor lysis syndrome is characterized by the rapid death of neoplastic cells that develops soon after effective therapy. The biochemical and clinical features of this syndrome include hyperazotemia, hyperuricemia, hyperkalemia, hypocalcemia, elevated lactate dehydrogenase, hypotension and acute renal failure. The patient in the study did not develop hypercalcemia.\n\nThe exact mechanism of flare hypercalcemia remains uncertain, and it is believed that estrogenic properties of tamoxifen may precipitate hypercalcemia in tamoxifen-induced hypercalcemia. Although this does not account for AIs, it is interesting to note that flare hypercalcemia could occur in estrogen-receptor negative patients [9]. Thus, it might be plausible to consider that flare hypercalcemia is due to increased osteoclast activities and bone resorption caused by the increased release of various factors from the tumor or host cells by the offending drug [7,11,13]. Importantly, normal PTH and/or PTHrP levels in our patient exclude the possibility of coexisting primary hyperparathyroidism and ectopic secretion of PTH and/or PTHrP caused by tumor cells. Another cause of hypercalcemia might include inappropriately increased production of 1, 25-hydroxyvitamin D3 typically seen in patients with lymphomas or sarcoidosis [7]. However, the vitamin D3 levels were not assessed and CT and clinical findings did not suggest the possibility of these conditions as a cause of flare hypercalcemia in our patient.\n\nIt is difficult to predict and to prevent flare hypercalcemia, but life-threatening hypercalcemia should be treated intensively by stopping the offending drug, rehydration and bisphosphonate treatment [13,14]. As for rechallenge of the offending drug, it is usually suggested that, if necessary, tamoxifen be resumed temporarily at a lower dosage in tamoxifen-induced hypercalcemia. This is because tumor regression could occur after the flare reaction subsides and the survival of patients with tamoxifen-induced hypercalcemia is reported to be longer than that of patients with spontaneous hypercalcemia [1,2,8,15]. This strategy also appears to apply to AIs [12].\n\nConclusion\nOur experience suggests that AIs may precipitate serious and potentially life-threatening hypercalcemia in the early stages of treatment. If this occurs, AIs could be restarted cautiously with therapeutic benefit. To our knowledge, the association of hypercalcemia and AIs has not been previously reported.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nAuthors' contributions\nTY, TA, KH, DK, SS, HT analyzed and interpreted the patient data regarding the hypercalcemia. YH collected the clinical data and reviewed the literature about flare. KK was the doctor in charge and was a major contributor in writing the manuscript. All authors read and approved the final manuscript.\n==== Refs\nEllis MJ Hays DF Ellis LM Harris JR, Lippman ME, Morrow M, Osborne CK Treatment of metastatic breast cancer Disease of the breast 2004 Philadelphia: Lippincott Williams & Wilkins 1101 1159 \nClarysse A Hormone-induced tumor flare Eur J Cancer Clin Oncol 1985 21 5 545 547 10.1016/0277-5379(85)90077-X 4007020 \nPlotkin D Lechner JJ Jung WE Rosen PJ Tamoxifen flare in advanced breast cancer JAMA 1978 240 24 2644 2646 10.1001/jama.240.24.2644 712982 \nDavis HL JrWiseley AN Ramirez G Ansfield FJ Hypercalcemia complicating breast cancer. Clinical features and management Oncology 1973 28 2 126 137 10.1159/000224810 4270379 \nPatterson JS Furr BJ Battersby LA Tamoxifen and hypercalcemia Ann Intern Med 1978 89 6 1013 717984 \nBezwoda WR Derman D Zaltzman M de Moor NG Lange M Tamoxifen and hypercalcaemia. A case report S Afr Med J 1980 58 20 821 822 6255614 \nSantarpia L Koch CA Sarlis NJ Hypercalcemia in cancer patients: pathobiology and management Horm Metab Res 2010 42 3 153 164 10.1055/s-0029-1241821 19960404 \nLegha SS Powell K Buzdar AU Blumenschein GR Tamoxifen-induced hypercalcemia in breast cancer Cancer 1981 47 12 2803 2806 10.1002/1097-0142(19810615)47:12<2803::AID-CNCR2820471208>3.0.CO;2-A 7260871 \nPritchard KI Clark RM Fine S Meakin JW Perrault DJ Sutherland DJ Tamoxifen and hypercalcemia Ann Intern Med 1978 89 3 423 424 686559 \nSpooner D Evans BD Tamoxifen and life-threatening hypercalcaemia Lancet 1979 2 8139 413 414 89466 \nArumugam GP Sundravel S Shanthi P Sachdanandam P Tamoxifen flare hypercalcemia: an additional support for gallium nitrate usage J Bone Miner Metab 2006 24 3 243 247 10.1007/s00774-005-0678-4 16622738 \nZigrossi P Brustia M Bobbio F Campanini M Flare and tumor lysis syndrome with atypical features after letrozole therapy in advanced breast cancer. A case report Ann Ital Med Int 2001 16 2 112 117 11688358 \nNikolic-Tomasevic Z Jelic S Popov I Radosavljevic D Mitrovic L Tumor 'flare' hypercalcemia--an additional indication for bisphosphonates? Oncology 2001 60 2 123 126 10.1159/000055308 11244326 \nLumachi F Brunello A Roma A Basso U Medical treatment of malignancy-associated hypercalcemia Curr Med Chem 2008 15 4 415 421 10.2174/092986708783497346 18288996 \nde Wit S Cleton FJ Hypercalcemia in patients with breast cancer: a survival study J Cancer Res Clin Oncol 1994 120 10 610 614 10.1007/BF01212816 7929533\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1752-1947",
"issue": "5()",
"journal": "Journal of medical case reports",
"keywords": null,
"medline_ta": "J Med Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101293382",
"other_id": null,
"pages": "495",
"pmc": null,
"pmid": "21970715",
"pubdate": "2011-10-04",
"publication_types": "D016428:Journal Article",
"references": "18288996;11688358;11244326;717984;19960404;7260871;686559;4270379;7929533;712982;16622738;4007020;6255614;89466",
"title": "Flare hypercalcemia after letrozole in a patient with liver metastasis from breast cancer: a case report.",
"title_normalized": "flare hypercalcemia after letrozole in a patient with liver metastasis from breast cancer a case report"
} | [
{
"companynumb": "PHHY2011JP88428",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LETROZOLE"
},
"drugadditional": "1",
"drugadm... |
{
"abstract": "With cardiovascular disease being the leading cause of morbidity and mortality in the United States, cholesterol-lowering medications have become a prominent focus of medical management and cardiovascular risk reduction, including the use of statins making them the most widely prescribed class of medications in the United States and are the cornerstone of management of hyperlipidemia. This case report describes a 29-year-old female with probable familial hypercholesterolemia (FH) who had allergic reactions to statin therapy on two separate occasions. She required statin therapy based on her elevated carotid intima media thickness test, historic LDL-C ≥ 190 mg/dL, elevated Lp(a), and family history significant for premature coronary heart disease. In this report, we document a case of successful oral desensitization to rosuvastatin and propose a replicable statin desensitization protocol.\nThe patient was admitted for rosuvastatin desensitization following predetermined protocols, utilizing an interdisciplinary team, and monitored for 24 hours following completion of administration prior to discharge. She successfully completed desensitization to rosuvastatin 10mg by mouth daily without anaphylactic reaction. She continued to tolerate rosuvastatin 10mg daily through most recent follow-up, and with this addition, significant improvement in lipid levels was achieved.\n\n\nCONCLUSIONS\nThis case report presented a patient with probable FH who was previously intolerant to other statin therapies that underwent successful desensitization to rosuvastatin with subsequent achievement of therapy goals.",
"affiliations": "The Ohio State University Wexner Medical Center, Columbus, OH, USA.;The Ohio State University Wexner Medical Center, Columbus, OH, USA. Electronic address: Melissa.Snider@osumc.edu.;The Ohio State University Wexner Medical Center, Columbus, OH, USA.;The Ohio State University Wexner Medical Center, Columbus, OH, USA.",
"authors": "Schultz|Amy E|AE|;Snider|Melissa J|MJ|;Blais|Danielle M|DM|;Gulati|Martha|M|",
"chemical_list": "D008078:Cholesterol, LDL; D000068718:Rosuvastatin Calcium",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1876-4789",
"issue": "9(4)",
"journal": "Journal of clinical lipidology",
"keywords": "Cardiovascular disease; Hydroxymethylglutaryl-CoA reductase inhibitors; Hyperlipidemias; Hyperlipoproteinemia type II; Hypersensitivity; Primary prevention",
"medline_ta": "J Clin Lipidol",
"mesh_terms": "D000328:Adult; D002318:Cardiovascular Diseases; D059168:Carotid Intima-Media Thickness; D008078:Cholesterol, LDL; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D006801:Humans; D006938:Hyperlipoproteinemia Type II; D012206:Rhabdomyolysis; D012307:Risk Factors; D000068718:Rosuvastatin Calcium; D014481:United States",
"nlm_unique_id": "101300157",
"other_id": null,
"pages": "597-601",
"pmc": null,
"pmid": "26228679",
"pubdate": "2015",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Statin desensitization in a patient with probable familial hypercholesterolemia.",
"title_normalized": "statin desensitization in a patient with probable familial hypercholesterolemia"
} | [
{
"companynumb": "US-LUPIN PHARMACEUTICALS INC.-2015-02703",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "ROSUVASTATIN"
},
"drugaddition... |
{
"abstract": "A 24-year-old active duty soldier was evacuated from Afghanistan to the United States after persistent upper respiratory tract infection. His course was complicated by an exfoliative rash, diffuse muscle aches, and elevated creatine kinase following trimethoprim-sulfamethoxazole exposure that persisted despite withdrawal of the medication. Dermatomyositis was strongly considered, but the patient had a negative muscle biopsy and had positive serologies for acute Epstein-Barr virus infection. We present a case of acute Epstein-Barr virus infection and possible trimethoprim-sulfamethoxazole reaction mimicking dermatomyositis.",
"affiliations": "Department of Rheumatology, Brooke Army Medical Center, 3551 Roger Brooke Drive, Fort Sam Houston, TX 78234-6272.;Department of Medicine, Brooke Army Medical Center, 3551 Roger Brooke Drive, Fort Sam Houston, TX 78234-6200.;Department of Rheumatology, Brooke Army Medical Center, 3551 Roger Brooke Drive, Fort Sam Houston, TX 78234-6272.",
"authors": "Schmidt|Thomas W|TW|;Garfinkle|Mark|M|;Battafarano|Daniel F|DF|",
"chemical_list": "D000890:Anti-Infective Agents; D015662:Trimethoprim, Sulfamethoxazole Drug Combination; D003402:Creatine Kinase",
"country": "England",
"delete": false,
"doi": "10.7205/MILMED-D-13-00357",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0026-4075",
"issue": "179(2)",
"journal": "Military medicine",
"keywords": null,
"medline_ta": "Mil Med",
"mesh_terms": "D055826:Afghan Campaign 2001-; D000890:Anti-Infective Agents; D003402:Creatine Kinase; D003882:Dermatomyositis; D003937:Diagnosis, Differential; D003875:Drug Eruptions; D005076:Exanthema; D006801:Humans; D007244:Infectious Mononucleosis; D008297:Male; D008889:Military Personnel; D063806:Myalgia; D010612:Pharyngitis; D012206:Rhabdomyolysis; D015662:Trimethoprim, Sulfamethoxazole Drug Combination; D014481:United States; D055815:Young Adult",
"nlm_unique_id": "2984771R",
"other_id": null,
"pages": "e245-8",
"pmc": null,
"pmid": "24491625",
"pubdate": "2014-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "15742118;18166218;17396745;16966018;18840267;21444021;21729964;12452866;18402564;20561303;22824134;23504386;18625683;7622260;23589810;16775445",
"title": "Rash and elevated creatine kinase in a deployed soldier.",
"title_normalized": "rash and elevated creatine kinase in a deployed soldier"
} | [
{
"companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2015US-97095",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
... |
{
"abstract": "BACKGROUND\nEndotracheal intubation is an essential basic skill for emergency physicians. The procedure can cause complications that should be recognized. Awareness and early identification of complications are needed to allow early intervention to optimize outcomes. The risk factors for tracheal perforation during intubation are typically related to the physician skill and experience and to the patient's comorbidities, including body habitus and chronic use of certain medications.\n\n\nMETHODS\nWe report a case of a 45-year-old man with renal transplant on tacrolimus and prednisolone for 16 years. He presented with decreased level of consciousness due to an acute intracranial hemorrhage and was intubated for airway protection. Post intubation, a significant subcutaneous emphysema was noted on the patient's neck and chest, which was subsequently determined to be caused by a tracheal perforation. The management of tracheal injury depends on the size and location of the tear, as well as the patient's clinical status and comorbidities. In this case, the tracheal perforation was treated conservatively and was successful. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: This case has been reported to increase awareness about this rare and potentially life-threatening event. The prevention of this rare injury can be difficult but use of a slightly smaller endotracheal tube in a high-risk patient can be of benefit. In addition, early consideration of this complication when there is an acute change in physiologic status will allow for rapid facilitated management.",
"affiliations": "Department of Emergency Medicine, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.;UC San Diego Health System, San Diego, California; North County Dispatch Joint Powers Authority, Santa Fe, California.;Emergency Medicine Department, Aseer Central Hospital, Abha City, Kingdom of Saudi Arabia.;Department of Emergency Medicine, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.;Department of Emergency Medicine, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.;Department of Emergency Medicine, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.;Department of Emergency Medicine, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.;Intensive Care Unit, Security Forces Hospital, Riyadh City, Kingdom of Saudi Arabia.",
"authors": "Akeely|Yahia|Y|;Vilke|Gary M|GM|;Alzahrani|Hassan|H|;Alshowaihi|Ibrahim|I|;Alsaadani|Ashraf|A|;Rabah|Abdulrahman|A|;Turkistani|Abdulrahman|A|;Abosamak|Mohammad F|MF|",
"chemical_list": "D013256:Steroids",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jemermed.2020.11.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0736-4679",
"issue": "60(3)",
"journal": "The Journal of emergency medicine",
"keywords": "intubation complications; steroid use; tracheal injury; tracheal laceration; tracheal penetration; tracheal perforation",
"medline_ta": "J Emerg Med",
"mesh_terms": "D006801:Humans; D007442:Intubation, Intratracheal; D022125:Lacerations; D008297:Male; D008875:Middle Aged; D012421:Rupture; D013256:Steroids; D013352:Subcutaneous Emphysema; D014132:Trachea",
"nlm_unique_id": "8412174",
"other_id": null,
"pages": "380-383",
"pmc": null,
"pmid": "33308913",
"pubdate": "2021-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Postintubation Tracheal Perforation While on Long-Term Steroid Therapy: A Case Report.",
"title_normalized": "postintubation tracheal perforation while on long term steroid therapy a case report"
} | [
{
"companynumb": "SA-BAUSCH-BL-2020-039030",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SUCCINYLCHOLINE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nCladribine tablets were recently approved for the treatment of Relapsing-Remitting Multiple Sclerosis (RRMS), reducing B cells and T cells, followed by reconstitution of the adaptive immune system, with transient and mild effects on the innate one. Cladribine is also the standard first-line and subsequent treatment for Hairy-Cell Leukemia (HCL), frequently complicated by neutropenic fever. Recombinant human Granulocyte Colony-Stimulating Factor (G-CSF; Filgrastim) has been proved to reduce neutropenia by increasing neutrophil count.\n\n\nMETHODS\nTo the best of our knowledge, we report the first case of early and persistent high grade non febrile neutropenia after oral cladribine therapy in a 49-year-old RR-MS patient, successfully treated with Filgrastim.\n\n\nCONCLUSIONS\nThis report suggests that in selected cases, cladribine requires early monitoring of blood sample as it may be responsible for early neutropenia, requiring specific treatment.",
"affiliations": "Multiple Sclerosis Center \"A. Cardarelli \"Hospital, Naples, Italy; Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy. Electronic address: gtmaniscalco@libero.it.;Hematology Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Multiple Sclerosis Center \"A. Cardarelli \"Hospital, Naples, Italy.;Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.;Department of Public Health, University of Naples Federico II, Naples, Italy.;Multiple Sclerosis Center \"A. Cardarelli \"Hospital, Naples, Italy; Neurological Clinic and Stroke Unit \"A. Cardarelli \"Hospital, Naples, Italy.",
"authors": "Maniscalco|Giorgia T|GT|;Annunziata|Mario|M|;Ranieri|Angelo|A|;Alfieri|Gennaro|G|;Renna|Rosaria|R|;Iorio|Walter Di|WD|;Guarcello|Giovanni|G|;Cerillo|Ilaria|I|;Improta|Giovanni|G|;Florio|Ciro|C|",
"chemical_list": "D007166:Immunosuppressive Agents; D011994:Recombinant Proteins; D017338:Cladribine; D000069585:Filgrastim",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.msard.2020.102151",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2211-0348",
"issue": "43()",
"journal": "Multiple sclerosis and related disorders",
"keywords": "Cladribine; Filgrastim; Multiple Sclerosis; Neutropenia",
"medline_ta": "Mult Scler Relat Disord",
"mesh_terms": "D017338:Cladribine; D000069585:Filgrastim; D006801:Humans; D007166:Immunosuppressive Agents; D008875:Middle Aged; D009103:Multiple Sclerosis; D020529:Multiple Sclerosis, Relapsing-Remitting; D009503:Neutropenia; D011994:Recombinant Proteins",
"nlm_unique_id": "101580247",
"other_id": null,
"pages": "102151",
"pmc": null,
"pmid": "32417665",
"pubdate": "2020-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Remission of early persistent cladribine-induced neutropenia after filgrastim therapy in a patient with Relapsing - Remitting Multiple Sclerosis.",
"title_normalized": "remission of early persistent cladribine induced neutropenia after filgrastim therapy in a patient with relapsing remitting multiple sclerosis"
} | [
{
"companynumb": "IT-EMD SERONO-9164596",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "CLADRIBINE"
},
"drugadditional": null,
... |
{
"abstract": "Resistance to novel androgen signaling inhibition and metastatic castration-resistant prostate cancer (mCRPC) progression is likely dependent on tumor microenvironment interactions. The Src pathway and neoangiogenesis have been implicated in prostate cancer progression. We studied the effect of adding the targeted agents dasatinib and sunitinib to abiraterone acetate (AA) in men with mCRPC.\n\n\n\nIn this open-label randomized phase 2 study, mCRPC patients received AA. At resistance to AA, they were randomized 1:1 to combination with dasatinib or sunitinib. At second progression, patients crossed over. The primary end point was time to treatment failure (TTF), defined as time to progression or death. Secondary end points included overall survival and safety.\n\n\n\nFrom March 2011 to February 2015, a total of 179 patients were enrolled and 132 subsequently randomized. Median TTF was 5.7 months in the dasatinib group and 5.5 months in the sunitinib group. There was no difference between the two groups in terms of TTF (hazard ratio, 0.85; 95% confidence interval, 0.59-1.22). Median overall survival from study entry was 26.3 months in the dasatinib group and 27.7 months in the sunitinib group (hazard ratio, 1.02; 95% confidence interval, 0.71-1.47). Grade 3 or higher adverse events related to study medication were more frequent with sunitinib (n = 44, 46%) compared to dasatinib (n = 26, 24%). At data cutoff, 7 patients were experiencing a continuous response to AA, with a median duration of treatment of 5.7 years.\n\n\n\nThere is no difference in overall survival and TTF between dasatinib and sunitinib combined with abiraterone in the treatment of patients with bone mCRPC.",
"affiliations": "Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, TX.;Department of Biostatistics, West Virginia University School of Public Health, Morgantown, WV.;Department of Genitourinary Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX. Electronic address: eefstathiou@mdanderson.org.",
"authors": "Spetsieris|Nicholas|N|;Boukovala|Myrto|M|;Weldon|Justin A|JA|;Tsikkinis|Alexandros|A|;Hoang|Anh|A|;Aparicio|Ana|A|;Tu|Shi-Ming|SM|;Araujo|John C|JC|;Zurita|Amado J|AJ|;Corn|Paul G|PG|;Pagliaro|Lance|L|;Kim|Jeri|J|;Wang|Jennifer|J|;Subudhi|Sumit K|SK|;Tannir|Nizar M|NM|;Logothetis|Christopher J|CJ|;Troncoso|Patricia|P|;Wang|Xuemei|X|;Wen|Sijin|S|;Efstathiou|Eleni|E|",
"chemical_list": "D000736:Androstenes; D000069501:Abiraterone Acetate; C089740:abiraterone; D000069439:Dasatinib; D000077210:Sunitinib; D011241:Prednisone",
"country": "United States",
"delete": false,
"doi": "10.1016/j.clgc.2020.05.013",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1558-7673",
"issue": "19(1)",
"journal": "Clinical genitourinary cancer",
"keywords": "Androgen-signaling inhibition; Neoangiogenesis; Src pathway; Targeted agents; Tumor microenvironment",
"medline_ta": "Clin Genitourin Cancer",
"mesh_terms": "D000069501:Abiraterone Acetate; D000736:Androstenes; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069439:Dasatinib; D006801:Humans; D008297:Male; D011241:Prednisone; D064129:Prostatic Neoplasms, Castration-Resistant; D011897:Random Allocation; D000077210:Sunitinib; D016896:Treatment Outcome; D059016:Tumor Microenvironment",
"nlm_unique_id": "101260955",
"other_id": null,
"pages": "22-31.e5",
"pmc": null,
"pmid": "32675015",
"pubdate": "2021-02",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016449:Randomized Controlled Trial; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "A Phase 2 Trial of Abiraterone Followed by Randomization to Addition of Dasatinib or Sunitinib in Men With Metastatic Castration-Resistant Prostate Cancer.",
"title_normalized": "a phase 2 trial of abiraterone followed by randomization to addition of dasatinib or sunitinib in men with metastatic castration resistant prostate cancer"
} | [
{
"companynumb": "US-PFIZER INC-2011261687",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SUNITINIB MALATE"
},
"drugadditional": null,
... |
{
"abstract": "A 45-year-old woman was admitted with headache following sudden disturbance of consciousness that occurred two hours beforehand. A neurological examination identified disorientation, left homonymous hemianopia, left hemiplegia, and sensory disturbance in the left limbs. Brain MRI DWI showed acute infarcts in the right occipital lobe and bilateral thalami, and MRA poorly depicted right vertebral artery and right posterior cerebral artery. Anticoagulation was started to treat acute ischemic stroke, but her consciousness level deteriorated at 12 hours after onset. MRI revealed a double lumen in the basilar artery, indicating a diagnosis of vertebrobasilar artery dissection. Serial MRA findings showed that images of the basilar artery and posterior cerebral artery changed over time, suggesting vertebral artery dissection extension to the posterior cerebral artery.",
"affiliations": "Department of Neurology, Kyoto Second Red Cross Hospital.;Department of Neurology, Kyoto Second Red Cross Hospital.;Department of Neurology, Kyoto Second Red Cross Hospital.;Department of Neurology, Kyoto Second Red Cross Hospital.;Department of Neurology, Kyoto Second Red Cross Hospital.;Department of Neurology, Kyoto Second Red Cross Hospital.",
"authors": "Ashida|Shinji|S|;Nagakane|Yoshinari|Y|;Makino|Masahiro|M|;Tomonaga|Kei|K|;Makita|Naoki|N|;Yamamoto|Yasumasa|Y|",
"chemical_list": null,
"country": "Japan",
"delete": false,
"doi": "10.5692/clinicalneurol.cn-001047",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0009-918X",
"issue": "57(8)",
"journal": "Rinsho shinkeigaku = Clinical neurology",
"keywords": "MRI; arterial dissection; brain infarction",
"medline_ta": "Rinsho Shinkeigaku",
"mesh_terms": "D001488:Basilar Artery; D038524:Diffusion Magnetic Resonance Imaging; D005260:Female; D006801:Humans; D018810:Magnetic Resonance Angiography; D008875:Middle Aged; D020521:Stroke; D014711:Vertebral Artery; D020217:Vertebral Artery Dissection",
"nlm_unique_id": "0417466",
"other_id": null,
"pages": "446-450",
"pmc": null,
"pmid": "28740066",
"pubdate": "2017-08-31",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Ischemic stroke with vertebrobasilar artery dissection extended to posterior cerebral artery.",
"title_normalized": "ischemic stroke with vertebrobasilar artery dissection extended to posterior cerebral artery"
} | [
{
"companynumb": "JP-OTSUKA-2017_018919",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CILOSTAZOL"
},
"drugadditional": "1",
"... |
{
"abstract": "Drug reaction with eosinophilia and systemic symptom (DRESS) is a serious idiosyncratic drug reaction. It is characterized by skin eruption, fever, hematologic abnormalities, and multi-organ involvement. Diagnosis is challenging because of the wide clinical spectrum. Its association with aromatic antiepileptic drugs, such as phenytoin, phenobarbital, and carbamazepine, has been well described in adults. There are few reports of DRESS syndrome in children, and knowledge about the relationship between new antiepileptic drugs such as oxcarbazepine and this syndrome is limited. The DRESS syndrome is a challenging entity and probably underdiagnosed because many of its clinical findings can mimic those of other serious systemic disorders such as infections and hematologic disorders. Virus reactivation and use of some drugs together with suspected drugs, such as amoxicillin, can trigger the symptoms of DRESS syndrome. This is a case report of a 4-year-old boy with oxcarbazepine-induced DRESS syndrome possibly triggered by amoxicillin; hematologic malignancy was included in the differential diagnosis.",
"affiliations": "From the Departments of *Pediatrics and †Pediatric Neurology, Goztepe Training and Research Hospital, Istanbul Medeniyet University, Istanbul, Turkey.",
"authors": "Besli|Gulser Esen|GE|;Yildirim|Sema|S|;Yilmaz|Kutluhan|K|;Yuksel|Elif|E|",
"chemical_list": "D000900:Anti-Bacterial Agents; D000927:Anticonvulsants; D005938:Glucocorticoids; D002220:Carbamazepine; D000658:Amoxicillin; D000078330:Oxcarbazepine",
"country": "United States",
"delete": false,
"doi": "10.1097/PEC.0000000000000489",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0749-5161",
"issue": "33(7)",
"journal": "Pediatric emergency care",
"keywords": null,
"medline_ta": "Pediatr Emerg Care",
"mesh_terms": "D000658:Amoxicillin; D000900:Anti-Bacterial Agents; D000927:Anticonvulsants; D002220:Carbamazepine; D002675:Child, Preschool; D003937:Diagnosis, Differential; D063926:Drug Hypersensitivity Syndrome; D005938:Glucocorticoids; D019337:Hematologic Neoplasms; D006801:Humans; D008297:Male; D000078330:Oxcarbazepine",
"nlm_unique_id": "8507560",
"other_id": null,
"pages": "494-496",
"pmc": null,
"pmid": "28665895",
"pubdate": "2017-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "DRESS Syndrome or Hematologic Malignancy?: A Case Report of a 4-Year-Old Boy.",
"title_normalized": "dress syndrome or hematologic malignancy a case report of a 4 year old boy"
} | [
{
"companynumb": "TR-GLENMARK PHARMACEUTICALS-2017GMK028200",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMOXICILLIN\\CLAVULANIC ACID"
},
... |
{
"abstract": "Organ transplant recipients are not routinely included in clinical trials, and as a result there is a paucity of data to guide clinicians in the treatment of malignancies in this unique patient population. This is a case report and focused review of the treatment of hepatocellular carcinoma in patients with orthotopic liver transplants. We describe a single patient's treatment over a period of 4 years from the time of diagnosis to submission of this case report. We submit evidence that the anti-CTLA-4 antibody ipilimumab can produce a durable response, with a tolerable adverse event profile and without associated allograft rejection.",
"affiliations": "Department of Internal Medicine, New York University School of Medicine, NYU Langone Health, 550 1st Avenue, New York, NY 10016, USA.;Department of Medicine, NYU Langone Health, Perlmutter Cancer Center, New York, NY 10016, USA.",
"authors": "Pandey|Abhishek|A|;Cohen|Deirdre J|DJ|",
"chemical_list": "D000082082:Immune Checkpoint Inhibitors; D000074324:Ipilimumab; D000509:alpha-Fetoproteins",
"country": "England",
"delete": false,
"doi": "10.2217/imt-2020-0014",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1750-743X",
"issue": "12(5)",
"journal": "Immunotherapy",
"keywords": "hepatocellular carcinoma; immune checkpoint inhibitor; ipilimumab; liver transplant",
"medline_ta": "Immunotherapy",
"mesh_terms": "D006528:Carcinoma, Hepatocellular; D005260:Female; D006085:Graft Survival; D006801:Humans; D000082082:Immune Checkpoint Inhibitors; D007167:Immunotherapy; D000074324:Ipilimumab; D008103:Liver Cirrhosis; D008113:Liver Neoplasms; D016031:Liver Transplantation; D008875:Middle Aged; D008991:Monitoring, Physiologic; D012074:Remission Induction; D014184:Transplantation, Homologous; D000509:alpha-Fetoproteins",
"nlm_unique_id": "101485158",
"other_id": null,
"pages": "287-292",
"pmc": null,
"pmid": "32248723",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Ipilumumab for hepatocellular cancer in a liver transplant recipient, with durable response, tolerance and without allograft rejection.",
"title_normalized": "ipilumumab for hepatocellular cancer in a liver transplant recipient with durable response tolerance and without allograft rejection"
} | [
{
"companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2020-042594",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadd... |
{
"abstract": "BACKGROUND\nEradication rates of Helicobacter pylori (H pylori) with standard triple therapy are gradually decreasing all over the world, including in children, due to the development of strains resistant to antimicrobials. Sequential therapy can be used as an alternative method to increase eradication rates.\n\n\nMETHODS\nA total of 75 patients ≥ 8 years of age with H pylori gastritis were included in the study. According to Rome IV criteria, 38 patients had functional abdominal pain and dyspepsia, and 37 patients had alarm findings suggesting organic disease. Patients were treated with a novel sequential therapy consisting of the proton pump inhibitor (PPI)-lansoprazole (1 mg/kg/day, maximum 30 mg daily), amoxicillin (50 mg/kg/d in two doses, maximum 2 × 1000 mg) for 7 days followed by PPI-lansoprazole (1 mg/kg/d, maximum 30 mg daily), metronidazole (20 mg/kg/day in two doses, maximum 2 x 500 mg), tetracycline (50 mg/kg/d divided into four equal doses, maximum 4 x 500 mg), and bismuth subsalicylate (262 mg QID in patients ≤ 10 years of age, 524 mg QID in patients > 10 years of age in days 8-14). Eradication status was evaluated by H pylori stool antigen test 8 weeks after the completion of treatment.\n\n\nRESULTS\nThe mean age of the patients was 15.1 ± 2.4 years and 51 (68%) were female. No patient discontinued therapy due to side effects. All patients had antral gastritis (76.0%) or pangastritis (24.0%). The peptic ulcer rate was 6.6%. Eradication therapy was given to all patients with or without peptic ulcer. H pylori eradication was achieved in 69 (92.0%) patients and symptoms improved in 61 of those eradicated.\n\n\nCONCLUSIONS\nAs a first-line treatment for H pylori eradication in children, administering a novel sequential therapy including bismuth for 14 days provides a high rate of eradication.",
"affiliations": "Division of Pediatric Gastroenterology, Department of Pediatrics, University of Health Sciences, Gülhane Training and Research Hospital, Ankara, Turkey.;Division of Pediatric Gastroenterology, Department of Pediatrics, University of Health Sciences, Gülhane Training and Research Hospital, Ankara, Turkey.;Department of Pathology, University of Health Sciences, Gülhane Training and Research Hospital, Ankara, Turkey.",
"authors": "Arslan|Melike|M|https://orcid.org/0000-0002-0107-4699;Balamtekin|Necati|N|;Günal|Armağan|A|",
"chemical_list": "D000900:Anti-Bacterial Agents; D008795:Metronidazole; D000658:Amoxicillin; D017291:Clarithromycin; D001729:Bismuth",
"country": "England",
"delete": false,
"doi": "10.1111/hel.12757",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1083-4389",
"issue": "25(6)",
"journal": "Helicobacter",
"keywords": "\nHelicobacter pylori\n; bismuth; childhood gastritis; eradication therapy",
"medline_ta": "Helicobacter",
"mesh_terms": "D000293:Adolescent; D000658:Amoxicillin; D000900:Anti-Bacterial Agents; D001729:Bismuth; D002648:Child; D017291:Clarithromycin; D004359:Drug Therapy, Combination; D005260:Female; D016481:Helicobacter Infections; D016480:Helicobacter pylori; D006801:Humans; D008795:Metronidazole; D016896:Treatment Outcome; D014421:Turkey",
"nlm_unique_id": "9605411",
"other_id": null,
"pages": "e12757",
"pmc": null,
"pmid": "32939900",
"pubdate": "2020-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Efficacy of a novel sequential treatment regimen containing bismuth for Helicobacter pylori eradication in Turkish children.",
"title_normalized": "efficacy of a novel sequential treatment regimen containing bismuth for helicobacter pylori eradication in turkish children"
} | [
{
"companynumb": "TR-TOLMAR, INC.-20TR023192",
"fulfillexpeditecriteria": "2",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "TETRACYCLINE"
},
"drugadditional": null,
... |
{
"abstract": "Tuberculosis is an airborne multisystemic disease which primarily infects the lungs. Isolated tuberculous arthritis is rare. We present a case of a 41-year-old woman with a known case of lupus nephritis class IV who complained of pain and swelling over her left ankle joint for several months. She was treated for rheumatoid arthritis and was started with immunosuppressive agents. However, she did not improve with treatment and was later diagnosed with tuberculous arthritis based on a molecular study from joint aspiration. She was started on antituberculosis medication and showed improvement. We highlight the challenges in reaching the diagnosis and the importance of including tuberculous arthritis in differential diagnoses in cases with persistent ankle swelling.",
"affiliations": "Hospital Sultanah Nur Zahirah, Terengganu, Malaysia muhammadnoor.ismail@gmail.com.;Hospital Sultanah Nur Zahirah, Terengganu, Malaysia.",
"authors": "Ismail|Mohd N Bin|MNB|;Rahim|Siti M Ab|SMA|",
"chemical_list": "D000995:Antitubercular Agents",
"country": "England",
"delete": false,
"doi": "10.7861/clinmed.2020-0882",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1470-2118",
"issue": "21(1)",
"journal": "Clinical medicine (London, England)",
"keywords": "ankle joint; extrapulmonary TB,; rheumatoid arthritis; tuberculosis; tuberculous arthritis",
"medline_ta": "Clin Med (Lond)",
"mesh_terms": "D000328:Adult; D000843:Ankle Joint; D000995:Antitubercular Agents; D001172:Arthritis, Rheumatoid; D005260:Female; D006801:Humans; D008181:Lupus Nephritis; D014394:Tuberculosis, Osteoarticular",
"nlm_unique_id": "101092853",
"other_id": null,
"pages": "e108-e109",
"pmc": null,
"pmid": "33479090",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "29438163;12787528;16300038;22711012;12960476;19843752",
"title": "Tuberculous arthritis of the ankle joint masquerading as rheumatoid arthritis in a patient with lupus nephritis.",
"title_normalized": "tuberculous arthritis of the ankle joint masquerading as rheumatoid arthritis in a patient with lupus nephritis"
} | [
{
"companynumb": "MY-TEVA-2021-MY-1955211",
"fulfillexpeditecriteria": "1",
"occurcountry": "MY",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AZATHIOPRINE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nSweet syndrome is a neutrophilic dermatosis and is often idiopathic, although its onset may be drug-induced or paraneoplastic. The purpose of this case report is to describe the very first occurrence of Sweet syndrome following erlotinib intake in a patient diagnosed with lung adenocarcinoma.\n\n\nMETHODS\nWe observed Sweet syndrome, as assessed by clinical, laboratory and histological examination, in a middle-aged female patient presenting lung adenocarcinoma diagnosed three years prior to her cutaneous symptoms.\n\n\nCONCLUSIONS\nGiven the extremely long time between the diagnosis of lung cancer and the onset of Sweet syndrome, as well as the occurrence of skin lesions during administration of the medication and their subsidence after drug withdrawal, we suggest a possible link between this particular EGFR tyrosine kinase inhibitor and the patient's neutrophilic dermatological signs. To our knowledge this association has not previously been described in the medical literature.",
"affiliations": "Service de dermatologie, grand hôpital de Charleroi (GHDC), Charleroi, Belgique; Rue de Villers, 1, 6280 Loverval, Belgique. Electronic address: darioahangari@gmail.com.;Service d'anatomopathologie, Institut de pathologie et génétique (IPG), avenue Georges-Lemaitre, 25, 6041 Charleroi, Belgique.;Service de pneumologie, grand hôpital de Charleroi (GHDC), Grand'rue 3, 6000 Charleroi, Belgique.;Service de dermatologie, grand hôpital de Charleroi (GHDC), Charleroi, Belgique; Rue de Villers, 1, 6280 Loverval, Belgique.",
"authors": "Ahangari|D|D|;Ngendahayo|P|P|;Colinet|B|B|;Roquet-Gravy|P-P|PP|",
"chemical_list": "D047428:Protein Kinase Inhibitors; D000069347:Erlotinib Hydrochloride",
"country": "France",
"delete": false,
"doi": "10.1016/j.annder.2019.10.030",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0151-9638",
"issue": "147(3)",
"journal": "Annales de dermatologie et de venereologie",
"keywords": "Adénocarcinome bronchique; Erlotinib; Lung adenocarcinoma; Sweet syndrome; Syndrome de Sweet",
"medline_ta": "Ann Dermatol Venereol",
"mesh_terms": "D000077192:Adenocarcinoma of Lung; D020405:Dermis; D000069347:Erlotinib Hydrochloride; D005260:Female; D006801:Humans; D008175:Lung Neoplasms; D008875:Middle Aged; D020556:Neutrophil Infiltration; D047428:Protein Kinase Inhibitors; D016463:Sweet Syndrome; D013997:Time Factors",
"nlm_unique_id": "7702013",
"other_id": null,
"pages": "202-206",
"pmc": null,
"pmid": "32029299",
"pubdate": "2020-03",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "A case of Sweet syndrome in a patient receiving erlotinib for lung adenocarcinoma.",
"title_normalized": "a case of sweet syndrome in a patient receiving erlotinib for lung adenocarcinoma"
} | [
{
"companynumb": "BE-SUN PHARMACEUTICAL INDUSTRIES LTD-2020R1-238284",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ERLOTINIB"
},
"druga... |
{
"abstract": "A new progression pattern, hyperprogressive disease (HPD), has been recently acknowledged in cancer patients accepted immune checkpoint inhibitors (ICIs). We report a unique case of cervical small cell carcinoma which showed primary resistance to pembrolizumab and was with a rapid radiological progression after the initiate of ICIs treatment. However, the detection results of multiple predictive biomarkers suggested that the patient was eligible for ICIs treatment. The whole exome sequencing showed that AKT1 E17K mutation was high (26.316%) in tumor tissue, and dynamic monitoring of circulating tumor DNA indicated that AKT1 E17K mutation rate was increasing successively and highly consistent with tumor growth in peripheral blood. Therefore, the correlation between AKT1 E17K mutation and HPD, and the role of AKT1 E17K mutation in identifying patients who might not benefit from ICIs treatment need to be further studied.",
"affiliations": "Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.;Cancer Institute of People's Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People's Republic of China.",
"authors": "Xu|Zihan|Z|;Chen|Liying|L|;Zheng|Linpeng|L|;Yang|Qiao|Q|;Chen|Mingjing|M|;Wang|Jianmin|J|;Zhu|Guangkuo|G|;Chen|Zhengtang|Z|;Sun|Jianguo|J|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/OTT.S213436",
"fulltext": "\n==== Front\nOnco Targets TherOnco Targets TherOTTottOncoTargets and therapy1178-6930Dove 21343610.2147/OTT.S213436Case ReportHyperprogressive Disease In Cervical Small Cell Carcinoma Treated By Immune Checkpoint Inhibitor Xu et alXu et alXu Zihan 1Chen Liying 1Zheng Linpeng 1Yang Qiao 1Chen Mingjing 1Wang Jianmin 1Zhu Guangkuo 1Chen Zhengtang 1Sun Jianguo 11 Cancer Institute of People’s Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People’s Republic of ChinaCorrespondence: Jianguo Sun Cancer Institute of People’s Liberation Army, Xinqiao Hospital, Army Medical University, Chongqing, People’s Republic of ChinaTel +86 23 6877 4490Fax +86 23 6877 4631 Email sunjg09@aliyun.com* These authors contributed equally to this work\n\n30 10 2019 2019 12 8873 8877 25 4 2019 25 9 2019 © 2019 Xu et al.2019Xu et al.This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).Abstract\nA new progression pattern, hyperprogressive disease (HPD), has been recently acknowledged in cancer patients accepted immune checkpoint inhibitors (ICIs). We report a unique case of cervical small cell carcinoma which showed primary resistance to pembrolizumab and was with a rapid radiological progression after the initiate of ICIs treatment. However, the detection results of multiple predictive biomarkers suggested that the patient was eligible for ICIs treatment. The whole exome sequencing showed that AKT1 E17K mutation was high (26.316%) in tumor tissue, and dynamic monitoring of circulating tumor DNA indicated that AKT1 E17K mutation rate was increasing successively and highly consistent with tumor growth in peripheral blood. Therefore, the correlation between AKT1 E17K mutation and HPD, and the role of AKT1 E17K mutation in identifying patients who might not benefit from ICIs treatment need to be further studied.\n\nKeywords\nhyperprogressive diseasecervical small cell carcinomaimmune checkpoint inhibitorNational Natural Science Foundation of China10.13039/5011000018098160268881773245The present study was supported by the National Natural Science Foundation of China (No. 81602688, 81773245).\n==== Body\nIntroduction\nCervical cancer represents the fourth most common malignancy affecting women around the world.1 Despite the improvements in screening and treatment of early-stage disease, a proportion of patients will be diagnosed with persistent, advanced stage, or recurrent cervical cancer. For this subgroup of patients, including small cell carcinoma subtype, systemic chemotherapy is still the base of treatment.2,3 Besides, as for vaginal recurrences, radiotherapy and/or pelvic exenteration represent the most frequently adopted treatment, but unfortunately, the prognosis remains poor.4,5\n\nImmune checkpoint inhibitors (ICIs), especially programmed cell death-1/programmed death-ligand 1 (PD-1/PD-L1), have exploited a promising field for cancer treatment.6,7 However, a small part of patients seems to not benefit from ICIs and, on the contrary, these treatments are likely to accelerate tumor growth. In fact, Champiat et al reported a new progression pattern, hyperprogressive disease (HPD), in patients treated with ICIs. These patients experienced disease progression by RECIST criteria with a ≥2-fold increase in the tumor growth rate (TGR) between the experimental periods (from baseline to the first tumor evaluation) and the reference period (prior to treatment onset).8 At present, there was no idea about the predictors for HPD. Biomarkers for outcomes during ICIs treatment are also not available, therefore, developing predictive biomarkers for ICIs is greatly necessary.9\n\nCase Report And Genetic Analysis\nAn otherwise healthy 49-year-old woman with irregular vaginal bleeding was referred to Department of Gynecology and Obstetrics on May 27, 2016. The schematic course of diagnosis and treatment of the patient was shown in Figure 1A. Cervical biopsy suggested cervical malignancy with poor differentiation. The patient underwent extensive excision of cervical tumor on July 21, 2016. Postoperative pathological examination demonstrated small cell carcinoma infiltrating the full thickness of the cervix and involving the full layer of vaginal fornix (Figure 1B). On September 14, 2016, radiological examination with positron emission tomography-computed tomography (PET-CT) scan indicated multiple lesions of increased FDG metabolism, including the field of operation (residual tumor), the sites of multiple bones, the left lateral psoas muscle and the right groin district (bone and lymph node metastases) (Figure 1C).Figure 1 Histologic and radiographic findings, and immunohistochemical staining for CD3+ TILs, PD-L1, and MLH1, MSH2, MSH6 and PMS2 expression in cervical small cell carcinoma tissue before PD-1 inhibitor treatment. (A) Clinical course of the patient. (B) Immunohistochemical staining of excisional tumor tissue demonstrated small cell cervical carcinoma, infiltrating the full-thickness cervix. (C) FDG-PET/CT overview showed multiple lesions of increased FDG metabolism in the field of operation, left lateral psoas muscle, right groin district lymph nodes, and multiple bones throughout the body. (D) Abundant CD3+ TILs infiltrated in cervical small cell carcinoma tissue. (E) Missing immunohistochemical staining for PD-L1 in tumor cells. (F) Representative immunohistochemical staining for MLH1 in tumor cells, and missing immunohistochemical staining of MSH2 (G), MSH6 (H), and PMS2 (I) in tumor cells. Original magnification ×400.\n\nAbbreviations: PD-1, programmed death-receptor 1; TILs, tumor-infiltrating lymphocytes; PD-L1, programmed death ligand 1; FDG-PET/CT, 18F-fluorodeoxyglucose (FDG)-positron emission tomography (PET)/computed tomography (CT).\n\n\n\nThe patient received adjuvant chemotherapy with one cycle of etoposide combined with nedaplatin and two cycles of paclitaxel combined with cisplatin after surgery according to the standard. However, after chemotherapy, serious adverse events have appeared, including nausea, vomiting, fatigue, abdominal pain, and III-IV° myelosuppression. Meanwhile, magnetic resonance imaging (MRI) showed multiple tiny bony metastases. As the patient could not tolerate the drug-induced toxicity and the efficacy was evaluated as progressive disease (PD), ICIs was then considered. Analysis of biomarkers for ICIs efficacy prediction showed that the patient had dMMR tumors with the loss of MSH2, MSH6, and PMS2 expression. Tumor-infiltrating lymphocytes were abundant. Although PD-L1 IHC (SP 142, Roche) in tumor tissue was negative (< 1%), but PD-L1 mRNA in tumor tissue was 33.9% (Figure 1D–I). For further analysis, tumor tissue and blood of the patient were used for extracting DNA by Maxwell® RSC Instrument according to the manufacturer’s instruction of the Maxwell RSC Tissue DNA Kit and Maxwell RSC Blood DNA Kit (Promega, Madison, WI, USA) for whole-exome sequencing (WES). Based on an analysis of reads that uniquely aligned to the reference genome and for which the potential PCR duplicates were removed, an average coverage of 75.24X and 118.8X was achieved with 91.76% and 87.89% of the targeted bases being covered at 10X or greater read depth for normal tissue and tumor, respectively. WES of tumor tissue found 1257 tumor gene mutations, 53.5% of the chromosome copy number abnormalities, and 0.58% microsatellite instability, suggesting that the patient was eligible for and could benefit from ICIs treatment.\n\nTherefore, the patient received six cycles of pembrolizumab, a PD-1 inhibitor, 150mg q3w, from November 2016 to March 2017. Meanwhile, monitoring of circulating tumor DNA (ctDNA) mutation abundance, detection of circulating tumor cells (CTCs) amount and tumor markers, and imaging evaluation were performed every two cycles. Throughout the course of treatment, no obvious drug-related adverse events were observed except for mild hyperthyroidism, which was controlled after methimazole treatment. Monitoring of the efficacy during the course of treatment showed that the mutation abundance of ctDNA in peripheral blood and the amount of CTCs had successively increased, and the tumor volume had rapidly increased. MRI showed that the increase of pelvic lesions was greater than 50% in the first efficacy evaluation (two months after ICIs treatment compared to pre-treatment), and new metastases appeared. Chest computer tomography (CT) revealed pulmonary nodules, indicating tumor pulmonary metastases (Figure 2).Figure 2 Radiographic changes pre- and post-immunotherapy and variation tendency of immunity indexes and tumor markers during immunotherapy. (A) MRI of pelvic cavity pre- and post-immunotherapy: The target tumor volume increased, and new metastases appeared. Arrows indicate the tumor lesions pre- (yellow arrows) and post-immunotherapy (green arrows). (B) The mutation abundance of ctDNA in peripheral blood and the amount of CTCs increased successively. (C) Variation tendency of tumor markers was observed during process of diagnosis and treatment: tumor markers gradually decreased after surgery, and then returned to normal; after the start of immunotherapy, tumor markers continued to rise above the normal.\n\nAbbreviations: ctDNA, circulating tumor DNA; CTCs, circulating tumor cells.\n\n\n\nThe WES and ctDNA mutation analysis showed that AKT1 E17K mutation was high (26.316%) in tumor tissue, and the mutation rate increasing successively and highly consistent with tumor growth in peripheral blood (Table 1).\nTable 1 The WES And ctDNA Mutation Analysis During Immunotherapy\n\nDetection Time\tGene\tMutation Site\tMutation Frequency In Tumor Tissue\tMutation Frequency Of ctDNA Detection\t\n2017.1.17\tAKT1\tp.E17K\t26.316%\t11.344%\t\n\tPIK3CA\tp.E545K\t5.000%\t0.141%\t\n\tJak1\tNon\t0\t0\t\n\tJak2\tNon\t0\t0\t\n\tB2M\tNon\t0\t0\t\n2017.3.4\tAKT1\tp.E17K\t26.316%\t29.982%\t\n\tPIK3CA\tp.E545K\t5.000%\t0.031%\t\n\tJak1\tNon\t0\t0\t\n\tJak2\tNon\t0\t0\t\n\tB2M\tNon\t0\t0\t\n2017.4.8\tAKT1\tp.E17K\t26.316%\t42.340%\t\n\tPIK3CA\tp.E545K\t5.000%\t0.102%\t\n\tJak1\tNon\t0\t0\t\n\tJak2\tNon\t0\t0\t\n\tB2M\tNon\t0\t0\t\nAbbreviations: WES, whole exome sequencing; ctDNA, circulating tumor DNA.\n\n\n\nDiscussion\nThe clinical application of ICIs has exploited an encouraging era of anticancer therapy.10 But, a new pattern of progression, HPD which was observed in 9% of patients treated with anti-PD-1/PD-L1, has drawn extensive attention.8 It is related to worse overall survival.\n\nThis case showed dramatic hyperprogressive disease after the initiate of pembrolizumab according to Kato’s criteria, as time-to-treatment failure (TTF) <2 months, >50% increase in tumor burden compared to pre-immunotherapy imaging, and >2-fold increase in TGR.11 Recently HPD was observed in some patients who accepted ICIs treatment, which is relative to older age (> 65 years old) and slower-growing tumors at baseline.8 Besides, some activation mutations may also be relative to the occurrence of HPD. Accelerated tumor growth could be associated with the blockade of PD-1/PD-L1 signaling pathway in combination with genetic mutations such as MDM2 family amplification. Kato et al reported, among 155 patients treated with anti-PD1/PDL1 monotherapy, all six individuals with TTF <2 months existed MDM2/MDM4 amplification.11 However, the mechanism of HPD in this patient is unclear. It may be related to the gene mutation leading to the activation of the corresponding signaling pathway. The WES and ctDNA mutation analysis indicated that the mutation rate of AKT1 E17K was high in tumor tissue and the mutation frequency of ctDNA increased successively and was highly consistent with tumor growth in peripheral blood, suggesting that AKT1 E17K activation mutation is likely to be an important molecular mechanism underlying HPD.\n\nAs for adverse events, it’s only occurred mild hyperthyroidism which was controlled after methimazole treatment. However, sleep apnea-hypopnea syndrome occurred repeatedly after six cycles of ICIs, and eventually led to the patient’s death. The patient had a history of snoring, which is the leading cause of sleep apnea-hypopnea syndrome. Meanwhile, pulmonary metastatic lesions also affected respiratory function, aggravated sleep apnea-hypopnea syndrome.\n\nIn summary, this is the first description of genomic profiles of ICIs treated cervical small cell carcinoma with HPD. The case occurred synchronously with clinical deterioration and the radiological finding of HPD. We can’t confirm the correlation between the AKT1 E17K mutation and the occurrence of HPD. Prospective studies are needed to demonstrate the specific role of AKT1 E17K mutation during ICIs treatment and to verify if the AKT1 E17K mutation may be a predictive factor of ICIs failure and HPD.\n\nAcknowledgments\nThe authors sincerely thank Juan Li and Yongxin Yu for collecting tissue specimens, English teacher Xiewan Chen (Medical English Department, Army Medical University) for the linguistic modification.\n\nEthics Approval And Consent For Publication\nBecause the patient has died, written informed consent for publication of the clinical details and images was obtained from the family of the patient. The patient’s identification has been protected and any information which could be used to reveal the identity of the patient has been removed. The case details and images were approved for publication by Xinqiao Hospital, Army Medical University.\n\nAvailability Of Data And Materials\nThe datasets analyzed during the current study are available from the corresponding authors on reasonable request.\n\nAuthor Contributions\nAll authors contributed to conception and design, selection and acquisition of data, or analysis and interpretation of data; participated in drafting and revising the article; gave final approval of the version to be published; and agree to be accountable for all aspects of the work.\n\nDisclosure\nThe authors report no conflicts of interest in this work.\n==== Refs\nReferences\n1. Bray \nF , Ferlay \nJ , Soerjomataram \nI , Siegel \nRL , Torre \nLA , Jemal \nA . Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries . CA Cancer J Clin . 2018 ;68 (6 ):394 –424 . doi:10.3322/caac.21492 30207593 \n2. Eskander \nRN , Tewari \nKS . Chemotherapy in the treatment of metastatic, persistent, and recurrent cervical cancer . Curr Opin Obstet Gynecol . 2014 ;26 (4 ):314 –321 . doi:10.1097/GCO.0000000000000042 24979076 \n3. Monk \nBJ , Tewari \nKS . Evidence-based therapy for recurrent cervical cancer . J Clin Oncol . 2014 ;32 (25 ):2687 –2690 . doi:10.1200/JCO.2014.56.8733 25071120 \n4. Kim \nHJ , Chang \nJS , Koom \nWS , Lee \nKC , Kim \nGE , Kim \nYB . Radiotherapy is a safe and effective salvage treatment for recurrent cervical cancer . Gynecol Oncol . 2018 ;151 (2 ):208 –214 . doi:10.1016/j.ygyno.2018.08.029 30195468 \n5. Benedetti \nPP , Manci \nN , Bellati \nF , et al. Vaginectomy: a minimally invasive treatment for cervical cancer vaginal recurrence . Int J Gynecol Cancer . 2009 ;19 (9 ):1625 –1631 . doi:10.1111/IGC.0b013e3181a80a0a 19955949 \n6. Chen \nL , Han \nX . Anti-PD-1/PD-L1 therapy of human cancer: past, present, and future . J Clin Invest . 2015 ;125 (9 ):3384 –3391 . doi:10.1172/JCI80011 26325035 \n7. Sharma \nP , Allison \nJP . The future of immune checkpoint therapy . Science . 2015 ;348 (6230 ):56 –61 . doi:10.1126/science.aaa8172 25838373 \n8. Champiat \nS , Dercle \nL , Ammari \nS , et al. Hyperprogressive disease is a new pattern of progression in cancer patients treated by anti-PD-1/PD-L1 . Clin Cancer Res . 2017 ;23 (8 ):1920 –1928 . doi:10.1158/1078-0432.CCR-16-1741 27827313 \n9. George \nS , Miao \nD , Demetri \nGD , et al. Loss of PTEN is associated with resistance to anti-PD-1 checkpoint blockade therapy in metastatic uterine leiomyosarcoma . Immunity . 2017 ;46 (2 ):197 –204 . doi:10.1016/j.immuni.2017.02.001 28228279 \n10. Gibney \nGT , Weiner \nLM , Atkins \nMB . Predictive biomarkers for checkpoint inhibitor-based immunotherapy . Lancet Oncol . 2016 ;17 (12 ):e542 –e551 . doi:10.1016/S1470-2045(16)30406-5 27924752 \n11. Kato \nS , Goodman \nA , Walavalkar \nV , Barkauskas \nDA , Sharabi \nA , Kurzrock \nR . Hyperprogressors after immunotherapy: analysis of genomic alterations associated with accelerated growth rate . Clin Cancer Res . 2017 ;23 (15 ):4242 –4250 . doi:10.1158/1078-0432.CCR-16-3133 28351930\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1178-6930",
"issue": "12()",
"journal": "OncoTargets and therapy",
"keywords": "cervical small cell carcinoma; hyperprogressive disease; immune checkpoint inhibitor",
"medline_ta": "Onco Targets Ther",
"mesh_terms": null,
"nlm_unique_id": "101514322",
"other_id": null,
"pages": "8873-8877",
"pmc": null,
"pmid": "31802899",
"pubdate": "2019",
"publication_types": "D002363:Case Reports",
"references": "25071120;27924752;24979076;19955949;28351930;26325035;27827313;28228279;30207593;30195468;25838373",
"title": "Hyperprogressive Disease In Cervical Small Cell Carcinoma Treated By Immune Checkpoint Inhibitor.",
"title_normalized": "hyperprogressive disease in cervical small cell carcinoma treated by immune checkpoint inhibitor"
} | [
{
"companynumb": "CN-ACCORD-168049",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": "3",
"drugad... |
{
"abstract": "The Nephrology Quiz and Questionnaire remains an extremely popular session for attendees of the Annual Kidney Week Meeting of the American Society of Nephrology. Once again, in 2014 the conference hall was overflowing with audience members and eager quiz participants. Topics covered by the expert discussants included electrolyte and acid-base disorders, glomerular disease, ESRD/dialysis, and transplantation. Complex cases from each of these categories along with single-best-answer questions were prepared and submitted by the panel of experts. Before the meeting, program directors of United States nephrology training programs and nephrology fellows answered the questions using an Internet-based questionnaire. During the live session, members of the audience tested their knowledge and judgment on a series of case-oriented questions prepared and discussed by the experts. They compared their answers in real time using audience response devices with the answers of the nephrology fellows and training program directors. The correct and incorrect answers were then discussed after the audience responses and the results of the questionnaire were displayed. As always, the audience, lecturers, and moderators enjoyed this educational session. This article recapitulates the acid-base and electrolyte disorders portion of the session and reproduces its educational value for the readers of the Clinical Journal of the American Society of Nephrology. Enjoy the clinical cases and expert discussions.",
"affiliations": "Chairman, Department of Medicine, Division of Nephrology, University of Virginia Health System, Charlottesville, Virginia; mhr9r@virginia.edu.;Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut; and mhr9r@virginia.edu.;Division of Nephrology, Department of Medicine, Johns Hopkins University, Baltimore, Maryland mhr9r@virginia.edu.",
"authors": "Rosner|Mitchell H|MH|;Perazella|Mark A|MA|;Choi|Michael J|MJ|",
"chemical_list": "D018696:Neuroprotective Agents; D000077236:Topiramate; D005632:Fructose",
"country": "United States",
"delete": false,
"doi": "10.2215/CJN.10911114",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1555-9041",
"issue": "10(3)",
"journal": "Clinical journal of the American Society of Nephrology : CJASN",
"keywords": "chronic metabolic acidosis; drug metabolism; drug nephrotoxicity; hypokalemia",
"medline_ta": "Clin J Am Soc Nephrol",
"mesh_terms": "D000136:Acid-Base Equilibrium; D000137:Acid-Base Imbalance; D000141:Acidosis, Renal Tubular; D000328:Adult; D004347:Drug Interactions; D004521:Educational Measurement; D005260:Female; D005632:Fructose; D006261:Headache; D006801:Humans; D008297:Male; D008875:Middle Aged; D009398:Nephrology; D018696:Neuroprotective Agents; D051436:Renal Insufficiency, Chronic; D012859:Sjogren's Syndrome; D011795:Surveys and Questionnaires; D000077236:Topiramate",
"nlm_unique_id": "101271570",
"other_id": null,
"pages": "530-9",
"pmc": null,
"pmid": "25617429",
"pubdate": "2015-03-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "15701764;22913907;24670404;15554746;19916989;11867944;24353429;24969386;6016545;3344005;15199293;10768298;1912400;18608282;23607332;1553972;15778079;1234340;11474784;18465457;25171149;5101785;22212410;23146540;7891811;1391725;23087292;17497454;8546137;15694905;6078521;17275585;20586571;16389357;7579099;17622741;9154449;18085734;2314529;1552995;1335804;16997051;5444301;4097906;10556265;5101297;24614592;24682397;17557941;11978160;21921151;16240705;23612758;1736498",
"title": "American Society of Nephrology quiz and questionnaire 2014: acid-base and electrolyte disorders.",
"title_normalized": "american society of nephrology quiz and questionnaire 2014 acid base and electrolyte disorders"
} | [
{
"companynumb": "US-ZYDUS-010522",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CALCITRIOL"
},
"drugadditional": null,
"druga... |
{
"abstract": "A 38-year-old healthy male presented with vomiting and profuse diarrhea, associated with blurry and yellow coloration of the vision (xanthopsia). Laboratory workup was unremarkable, except for hyperkalemia (K 5.2 mEq/L) and mildly elevated troponin level 0.11 ng/mL (cut-off value 0.08). An electrocardiogram showed sinus bradycardia with deep scooping of the T waves. Although the patient denied intake of any drugs, herbs, consumption of plants, a digoxin level was drawn and was significantly elevated >5ng/mL (therapeutic range 0.8-2.0). Further questioning revealed that the patient was a pharmacist mixing raw material to fabricate medication, and that he could have incidentally ingested contaminated water. His symptoms improved with parallel improvement in the electrocardiogram T wave abnormalities. An echocardiogram was normal. The positive troponin was felt to be secondary to severe digoxin toxicity. Review of the literature however showed no report of elevated troponin in the setting of digoxin toxicity.",
"affiliations": "Division of Cardiology, Lebanese University, Faculty of Medical Sciences, Hadath, Lebanon; Division of Cardiovascular Medicine, Clemenceau Medical Center, Beirut, Lebanon.;Division of Gastroenterology, Clemenceau Medical Center, Beirut, Lebanon.;Division of Cardiology, Lebanese University, Faculty of Medical Sciences, Hadath, Lebanon; Division of Cardiovascular Medicine, Clemenceau Medical Center, Beirut, Lebanon.;Division of Cardiovascular Medicine, Clemenceau Medical Center, Beirut, Lebanon.;Division of Cardiovascular Medicine, Clemenceau Medical Center, Beirut, Lebanon.;Division of Cardiovascular Medicine, Clemenceau Medical Center, Beirut, Lebanon. Electronic address: wael.jaroudi@cmc.com.lb.",
"authors": "Mansour|Mohamad Jihad|MJ|;Kalaoui|Maher|M|;Chammas|Elie|E|;Hamoui|Omar|O|;Fawaz|Tarek|T|;AlJaroudi|Wael A|WA|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D004077:Digoxin",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jelectrocard.2017.07.013",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-0736",
"issue": "50(6)",
"journal": "Journal of electrocardiology",
"keywords": "Digitalis; Digoxin; Intoxication; Myocardial injury; Positive troponin; Toxicity",
"medline_ta": "J Electrocardiol",
"mesh_terms": "D000328:Adult; D000889:Anti-Arrhythmia Agents; D001919:Bradycardia; D003937:Diagnosis, Differential; D004077:Digoxin; D004562:Electrocardiography; D005440:Fluid Therapy; D006335:Heart Injuries; D006801:Humans; D006947:Hyperkalemia; D008297:Male; D016273:Occupational Exposure",
"nlm_unique_id": "0153605",
"other_id": null,
"pages": "909-911",
"pmc": null,
"pmid": "28807352",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Unusual digoxin toxicity with myocardial injury.",
"title_normalized": "unusual digoxin toxicity with myocardial injury"
} | [
{
"companynumb": "LB-COVIS PHARMA B.V.-2018COV00173",
"fulfillexpeditecriteria": "1",
"occurcountry": "LB",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DIGOXIN"
},
"drugadditional": null,
... |
{
"abstract": "Pure erythroid leukaemia is a rare subtype of acute myeloid leukaemia (AML) and its occurrence at acute lymphoblastic leukaemia (ALL) relapse has not been reported earlier. A 39-year-old man received chemotherapy for Philadelphia-negative B cell ALL. Subsequently, he developed pure erythroid leukaemia with >80% immature erythroid precursors in bone marrow showing block positivity on periodic acid-Schiff stain, expressing CD71, CD34 but lacking CD235a. The interval between exposure to multidrug chemotherapy including cyclophosphamide and AML diagnosis was 2 years and 9 months. No cytogenetic abnormality was detected at the time of relapse. The patient died 2 weeks after starting AML chemotherapy. The relatively narrow time interval (usually 5-10 years) between chemotherapy and AML development and normal karyotype at relapse raises a possibility of lineage switch besides therapy-related AML as the likely pathogenesis. Further exploration of such cases may unravel the pathways responsible for lineage assignment in pluripotent stem cells.",
"affiliations": "Laboratory Oncology Unit, Dr B.R.A. Institute Rotary Cancer Hospital (IRCH), All India Institute of Medical Sciences (AIIMS), Delhi, India.;Laboratory Oncology Unit, Dr B.R.A. Institute Rotary Cancer Hospital (IRCH), All India Institute of Medical Sciences (AIIMS), Delhi, India.;Laboratory Oncology Unit, Dr B.R.A. Institute Rotary Cancer Hospital (IRCH), All India Institute of Medical Sciences (AIIMS), Delhi, India.;Department of Medical Oncology, All India Institute of Medical Sciences (AIIMS), Delhi, India.",
"authors": "Gupta|Sanjeev Kumar|SK|;Kumar|Rajive|R|;Chharchhodawala|Taher|T|;Kumar|Lalit|L|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2014()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D001803:Blood Transfusion; D001853:Bone Marrow; D019070:Cell Lineage; D002471:Cell Transformation, Neoplastic; D018450:Disease Progression; D017809:Fatal Outcome; D006801:Humans; D015470:Leukemia, Myeloid, Acute; D008297:Male; D009361:Neoplasm Invasiveness; D009364:Neoplasm Recurrence, Local; D009367:Neoplasm Staging; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D012074:Remission Induction",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "24842350",
"pubdate": "2014-05-19",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "21655072;12454741;22852088;18094559;12623843;6590097;20066454",
"title": "Secondary pure erythroid leukaemia in relapsed acute lymphoblastic leukaemia: lineage switch or chemotherapy effect?",
"title_normalized": "secondary pure erythroid leukaemia in relapsed acute lymphoblastic leukaemia lineage switch or chemotherapy effect"
} | [
{
"companynumb": "IN-MYLANLABS-2017M1002257",
"fulfillexpeditecriteria": "1",
"occurcountry": "IN",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "Risperidone and paliperidone palmitate are two antipsychotic drugs well tolerated in the management of schizophrenia and other psychiatric conditions. There have been few reports of tachycardia induced by either drugs. Here, we report on a 21-year-old man, with a history of schizophrenia, and who developed persistent sinus tachycardia after he was restarted on risperidone, which later worsened after administration of paliperidone palmitate for long-term management. He had no cardiovascular risk factors other than obesity, and a prior well-tolerated risperidone treatment. Clinicians must be aware of the possibility of patients developing sinus tachycardia due to autonomic instability from a prior risperidone treatment, even though overall, these drugs are well tolerated.",
"affiliations": "Department of Family Medicine, NYMC Saint Joseph Hospital Family Medicine Residency program, New York, USA.",
"authors": "Tagne Nouemssi|Alain Bruno|AB|http://orcid.org/0000-0003-1247-5401",
"chemical_list": "D014150:Antipsychotic Agents; C033563:haloperidol decanoate; D006220:Haloperidol; D018967:Risperidone; D000068882:Paliperidone Palmitate",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-221771",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "drug interactions; psychiatry (drugs and medicines); schizophrenia",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D014150:Antipsychotic Agents; D001341:Autonomic Nervous System; D002318:Cardiovascular Diseases; D003937:Diagnosis, Differential; D004305:Dose-Response Relationship, Drug; D004359:Drug Therapy, Combination; D006220:Haloperidol; D006801:Humans; D008297:Male; D000068882:Paliperidone Palmitate; D018967:Risperidone; D012559:Schizophrenia; D013616:Tachycardia, Sinus; D016896:Treatment Outcome; D055815:Young Adult",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29680794",
"pubdate": "2018-04-21",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "21299844;7249508;17283292;7542676;25709354;19941696;17466492",
"title": "Risperidone-associated sinus tachycardia potentiated by paliperidone palmitate in a patient with no prior cardiovascular disease: role of risperidone-related autonomic instability.",
"title_normalized": "risperidone associated sinus tachycardia potentiated by paliperidone palmitate in a patient with no prior cardiovascular disease role of risperidone related autonomic instability"
} | [
{
"companynumb": "US-HIKMA PHARMACEUTICALS USA INC.-US-H14001-18-04274",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PALIPERIDONE PALMITATE"
},
... |
{
"abstract": "BACKGROUND\nMaternal obesity is associated with increased birthweight, and obesity and premature mortality in adult offspring. The mechanism by which maternal obesity leads to these outcomes is not well understood, but maternal hyperglycaemia and insulin resistance are both implicated. We aimed to establish whether the insulin sensitising drug metformin improves maternal and fetal outcomes in obese pregnant women without diabetes.\n\n\nMETHODS\nWe did this randomised, double-blind, placebo-controlled trial in antenatal clinics at 15 National Health Service hospitals in the UK. Pregnant women (aged ≥16 years) between 12 and 16 weeks' gestation who had a BMI of 30 kg/m(2) or more and normal glucose tolerance were randomly assigned (1:1), via a web-based computer-generated block randomisation procedure (block size of two to four), to receive oral metformin 500 mg (increasing to a maximum of 2500 mg) or matched placebo daily from between 12 and 16 weeks' gestation until delivery of the baby. Randomisation was stratified by study site and BMI band (30-39 vs ≥40 kg/m(2)). Participants, caregivers, and study personnel were masked to treatment assignment. The primary outcome was Z score corresponding to the gestational age, parity, and sex-standardised birthweight percentile of liveborn babies delivered at 24 weeks or more of gestation. We did analysis by modified intention to treat. This trial is registered, ISRCTN number 51279843.\n\n\nRESULTS\nBetween Feb 3, 2011, and Jan 16, 2014, inclusive, we randomly assigned 449 women to either placebo (n=223) or metformin (n=226), of whom 434 (97%) were included in the final modified intention-to-treat analysis. Mean birthweight at delivery was 3463 g (SD 660) in the placebo group and 3462 g (548) in the metformin group. The estimated effect size of metformin on the primary outcome was non-significant (adjusted mean difference -0·029, 95% CI -0·217 to 0·158; p=0·7597). The difference in the number of women reporting the combined adverse outcome of miscarriage, termination of pregnancy, stillbirth, or neonatal death in the metformin group (n=7) versus the placebo group (n=2) was not significant (odds ratio 3·60, 95% CI 0·74-17·50; p=0·11).\n\n\nCONCLUSIONS\nMetformin has no significant effect on birthweight percentile in obese pregnant women. Further follow-up of babies born to mothers in the EMPOWaR study will identify longer-term outcomes of metformin in this population; in the meantime, metformin should not be used to improve pregnancy outcomes in obese women without diabetes.\n\n\nBACKGROUND\nThe Efficacy and Mechanism Evaluation (EME) Programme, a Medical Research Council and National Institute for Health Research partnership.",
"affiliations": "Tommy's Centre for Maternal and Fetal Health, Medical Research Council (MRC) Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh, UK.;British Heart Foundation Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh, UK.;Tommy's Centre for Maternal and Fetal Health, Medical Research Council (MRC) Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh, UK.;British Heart Foundation Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh, UK.;British Heart Foundation Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh, UK.;Chancellor's Building, Royal Infirmary of Edinburgh, Edinburgh, UK.;British Heart Foundation Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh, UK.;Division of Reproductive Health, Warwick Medical School, University of Warwick, Coventry, UK.;Faculty of Health and Life Sciences, First Floor, Liverpool Women's Hospital, Liverpool, UK.;Faculty of Health and Life Sciences, First Floor, Liverpool Women's Hospital, Liverpool, UK.;Academic Unit of Reproductive and Developmental Medicine, The Jessop Wing, Sheffield, UK.;Centre for Population Health Sciences, Teviot Place, Edinburgh, UK.;Centre for Population Health Sciences, Teviot Place, Edinburgh, UK.;Tommy's Centre for Maternal and Fetal Health, Medical Research Council (MRC) Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh, UK.;Tommy's Centre for Maternal and Fetal Health, Medical Research Council (MRC) Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh, UK. Electronic address: jane.norman@ed.ac.uk.",
"authors": "Chiswick|Carolyn|C|;Reynolds|Rebecca M|RM|;Denison|Fiona|F|;Drake|Amanda J|AJ|;Forbes|Shareen|S|;Newby|David E|DE|;Walker|Brian R|BR|;Quenby|Siobhan|S|;Wray|Susan|S|;Weeks|Andrew|A|;Lashen|Hany|H|;Rodriguez|Aryelly|A|;Murray|Gordon|G|;Whyte|Sonia|S|;Norman|Jane E|JE|",
"chemical_list": "D007004:Hypoglycemic Agents; D008687:Metformin",
"country": "England",
"delete": false,
"doi": null,
"fulltext": "\n==== Front\nLancet Diabetes EndocrinolLancet Diabetes EndocrinolThe Lancet. Diabetes & Endocrinology2213-85872213-8595The Lancet, Diabetes & Endocrinology S2213-8587(15)00219-310.1016/S2213-8587(15)00219-3ArticlesEffect of metformin on maternal and fetal outcomes in obese pregnant women (EMPOWaR): a randomised, double-blind, placebo-controlled trial Chiswick Carolyn MBChBaReynolds Rebecca M ProfPhDbDenison Fiona MDaDrake Amanda J PhDbForbes Shareen PhDbNewby David E ProfDSccWalker Brian R ProfMDbQuenby Siobhan ProfMDdWray Susan ProfPhDeWeeks Andrew ProfMDeLashen Hany MDfRodriguez Aryelly MScgMurray Gordon ProfPhDgWhyte Sonia MScaNorman Jane E ProfMDjane.norman@ed.ac.uka*a Tommy's Centre for Maternal and Fetal Health, Medical Research Council (MRC) Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh, UKb British Heart Foundation Centre for Cardiovascular Science, Queen's Medical Research Institute, Edinburgh, UKc Chancellor's Building, Royal Infirmary of Edinburgh, Edinburgh, UKd Division of Reproductive Health, Warwick Medical School, University of Warwick, Coventry, UKe Faculty of Health and Life Sciences, First Floor, Liverpool Women's Hospital, Liverpool, UKf Academic Unit of Reproductive and Developmental Medicine, The Jessop Wing, Sheffield, UKg Centre for Population Health Sciences, Teviot Place, Edinburgh, UK* Correspondence to: Prof Jane E Norman, Tommy's Centre for Maternal and Fetal Health, MRC Centre for Reproductive Health, Queen's Medical Research Institute, Edinburgh EH16 4TJ, UKCorrespondence to: Prof Jane E NormanTommy's Centre for Maternal and Fetal HealthMRC Centre for Reproductive HealthQueen's Medical Research InstituteEdinburghEH16 4TJUK jane.norman@ed.ac.uk1 10 2015 10 2015 3 10 778 786 © 2015 Chiswick et al. Open Access article distributed under the terms of CC BY2015This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/3.0/).Summary\nBackground\nMaternal obesity is associated with increased birthweight, and obesity and premature mortality in adult offspring. The mechanism by which maternal obesity leads to these outcomes is not well understood, but maternal hyperglycaemia and insulin resistance are both implicated. We aimed to establish whether the insulin sensitising drug metformin improves maternal and fetal outcomes in obese pregnant women without diabetes.\n\nMethods\nWe did this randomised, double-blind, placebo-controlled trial in antenatal clinics at 15 National Health Service hospitals in the UK. Pregnant women (aged ≥16 years) between 12 and 16 weeks' gestation who had a BMI of 30 kg/m2 or more and normal glucose tolerance were randomly assigned (1:1), via a web-based computer-generated block randomisation procedure (block size of two to four), to receive oral metformin 500 mg (increasing to a maximum of 2500 mg) or matched placebo daily from between 12 and 16 weeks' gestation until delivery of the baby. Randomisation was stratified by study site and BMI band (30–39 vs ≥40 kg/m2). Participants, caregivers, and study personnel were masked to treatment assignment. The primary outcome was Z score corresponding to the gestational age, parity, and sex-standardised birthweight percentile of liveborn babies delivered at 24 weeks or more of gestation. We did analysis by modified intention to treat. This trial is registered, ISRCTN number 51279843.\n\nFindings\nBetween Feb 3, 2011, and Jan 16, 2014, inclusive, we randomly assigned 449 women to either placebo (n=223) or metformin (n=226), of whom 434 (97%) were included in the final modified intention-to-treat analysis. Mean birthweight at delivery was 3463 g (SD 660) in the placebo group and 3462 g (548) in the metformin group. The estimated effect size of metformin on the primary outcome was non-significant (adjusted mean difference −0·029, 95% CI −0·217 to 0·158; p=0·7597). The difference in the number of women reporting the combined adverse outcome of miscarriage, termination of pregnancy, stillbirth, or neonatal death in the metformin group (n=7) versus the placebo group (n=2) was not significant (odds ratio 3·60, 95% CI 0·74–17·50; p=0·11).\n\nInterpretation\nMetformin has no significant effect on birthweight percentile in obese pregnant women. Further follow-up of babies born to mothers in the EMPOWaR study will identify longer-term outcomes of metformin in this population; in the meantime, metformin should not be used to improve pregnancy outcomes in obese women without diabetes.\n\nFunding\nThe Efficacy and Mechanism Evaluation (EME) Programme, a Medical Research Council and National Institute for Health Research partnership.\n==== Body\nIntroduction\nThe adverse effects of maternal obesity on short- term pregnancy complications include pre-eclampsia,1 caesarean section, increased duration of maternal and neonatal hospital stay, maternal haemorrhage, infant mortality,2 and stillbirth.3 Maternal obesity during pregnancy is also associated with raised birthweight and neonatal fat mass.3, 4\n\nAccumulating data suggest that maternal obesity might predispose offspring to later life obesity, with high birthweight being a marker for increased risk. Correlations between high birthweight and adult obesity have been reported in large epidemiological studies,5, 6 a systematic review,7 and a validated prediction model.8 The rapid rise in the prevalence of both high birthweight9 and maternal obesity mean that their links with later life obesity are a major concern. Indeed, in a record linkage study,10 we showed that maternal obesity was associated with a 35% increase in the hazard of all-cause offspring mortality in adulthood, even after adjustment for confounders. As such, an effective intervention applied during pregnancy could have a major effect on interruption of the cycle of maternal obesity and offspring obesity and ill health, thus helping to reverse the upward secular trend in obesity prevalence.\n\nMuch evidence implicates insulin resistance (ie, when a defined concentration of insulin does not effect a predictable metabolic response) and hyperglycaemia as the mechanism by which maternal obesity causes excessive neonatal birthweight. Obese pregnant women are significantly more insulin resistant and hyperglycaemic than are pregnant women of a normal weight,11 and several large studies, including the Camden study12 and the HAPO study,13 show a positive association between high glucose concentrations and macrosomia, even at glucose concentrations regarded as normal during pregnancy. Additionally, a Cochrane review protocol14 has outlined additional potential benefits on mother and baby of metformin in obese pregnant women.\n\nResearch in context\nEvidence before this study\n\nWe searched Medline between Jan 1, 1980, and April 30, 2015, with the terms “metformin”, “pregnancy”, “birthweight”, and “randomised trial”. Four reports were identified: three focused on women with gestational diabetes (ie, a different study population to our study) and one was the protocol for the EMPOWaR study. Birthweight was a secondary outcome in one study (Vanky et al, 2010), in which pregnant women with a history of polycystic ovary syndrome were randomly assigned to receive metformin or placebo.\n\nAdded value of this study\n\nTo our knowledge, this is the first placebo-controlled study designed to establish the effect of metformin on birthweight in obese pregnant women.\n\nImplications of all the available evidence\n\nMetformin given to normally glucose tolerant obese pregnant women from 12– 16 weeks' gestation until delivery has no significant effect on gestational age, parity, or sex-standardised birthweight percentile. Further follow-up of babies born to mothers in the EMPOWaR study will identify longer-term outcomes of metformin in this population. In the meantime, metformin should not be used to improve pregnancy outcomes in obese women without diabetes.\n\n\n\nIn view of these findings, we did this EMPOWaR study15 to test the hypothesis that the insulin sensitising drug metformin would reduce birthweight when given to obese women during pregnancy. On the basis of findings from other epidemiological studies5, 6, 16 a reduction in birthweight would be expected to result in a reduction in future life risk of obesity and metabolic syndrome in the offspring.\n\nMethods\nStudy design and participants\nWe did this randomised, double-blind, placebo-controlled trial in antenatal clinics at 15 National Health Service (NHS) hospitals in the UK. Eligible women were aged 16 years or older, had a BMI of 30 kg/m2 or more, and were between 12 and 16 weeks' gestation. We excluded non-white women and those with: pre-existing diabetes; gestational diabetes in a previous pregnancy; gestational diabetes diagnosed in the index pregnancy before randomisation; systemic disease at the time of trial entry (requiring either regular drugs or treatment with systemic corticosteroids in the past 3 months); previous delivery of a baby smaller than the 3rd percentile for weight; previous pregnancy with pre-eclampsia prompting delivery before 32 weeks' gestation; known hypersensitivity to metformin hydrochloride or any of the excipients; known liver failure; known renal failure; acute disorders at the time of trial entry with the potential to change renal function, such as dehydration sufficient to require intravenous infusion, severe infection, shock, intravascular administration of iodinated contrast agents, or acute or chronic diseases that might cause tissue hypoxia (eg, cardiac or respiratory failure, recent myocardial infarction, hepatic insufficiency, acute alcohol intoxication, or alcoholism); lactating women; and women with multiple pregnancy.\n\nThe study was approved by the Scotland A research ethics committee (reference number 10/MRE00/12) and the Medicines and Healthcare products Regulatory Agency (EudraCT number 2009-017134-47). All participants provided written information consent. The protocol has been published elsewhere15 and is available online.\n\nRandomisation and masking\nWe randomly assigned participants (1:1), via a web-based computer-generated block randomisation procedure (block size of two to four), to receive metformin or placebo. Randomisation was stratified by study site and BMI band (30–39 vs ≥40 kg/m2). Participants, caregivers, and study personnel were masked to treatment assignment. Members of the independent Data Monitoring Committee had access to unmasked data reports, but had no contact with study participants.\n\nProcedures\nDemographics, medical history, and maternal anthropometry were recorded at baseline. A formal 75 g oral glucose tolerance test was done in addition to screening for liver and renal function. We excluded participants with impaired renal function (urea >6·6 mmol/L, creatinine >85 μmol/L, sodium >145 mmol/L, potassium >5·0 mmol/L), or liver function (bilirubin >16 μmol/L, alanine transferase >60 IU/L), or with abnormal lactate (according to local laboratory reference range) or gestational diabetes defined by WHO criteria (fasting glucose ≥7·0 mmol/L and 2 h glucose ≥7·8 mmol/L), or any other local hospital criteria (eg, International Association of Diabetes and Pregnancy Study Groups [IADPSG]17).\n\nParticipants received oral metformin 500 mg or matched placebo tablets, in a dose of up to five tablets daily in two to three divided doses. Treatment was initiated at 12–16 weeks' gestation and continued until delivery of the baby. Treatment started at one 500 mg tablet once a day at week 1, and escalated by one tablet a day each week over 5 weeks, to reach either the maximum tolerable dose or the maximum permitted dose of 2500 mg, whichever was lower. In the case of side-effects, participants were advised to reduce the current dose to that of the previous week, and wait for 1 week before increasing the dose again. The local investigator was allowed to change the treatment regimen at their discretion, as long as the maximum daily dose did not exceed 2500 mg in three divided doses. Participants were asked to keep a diary of drug intake and to bring all drugs to each study visit to monitor compliance.\n\nRandomised participants were reviewed face to face or by telephone at 18–20, 28, 36, and 40 weeks' gestation; around the time of delivery; and 3 months postnatally. Pregnancy complications were recorded and women were asked to complete a side-effect questionnaire at each review visit until delivery. Maternal anthropometry was repeated at 36 weeks' gestation and 3 months postnatally. The glucose tolerance test was repeated at 28 and 36 weeks' gestation, and blood was stored for measurement of inflammatory and metabolic indices. The protocol recommended that women who developed gestational diabetes should be given insulin whilst maintaining study treatment and blinding. The baby's weight and anthropometry were recorded at delivery and at the 3 month postnatal visit.\n\nOutcomes\nThe primary outcome was Z score corresponding to the gestational age, parity, and sex-standardised birthweight percentile of liveborn babies delivered at 24 or more weeks' gestation. The main secondary outcome was maternal insulin resistance at 36 weeks' gestation. Other secondary outcomes included maternal fasting glucose and insulin and 2 h glucose at 36 weeks; maternal anthropometry and body composition; baby anthropometry and body composition; maternal inflammatory and metabolic outcomes at 36 weeks, including C-reactive protein (CRP), cholesterol, HDL, LDL, triglycerides, interleukin (IL)-6, leptin, serum cortisol, non-esterified fatty acids, and the ratio of plasminogen activator inhibitor 1 to 2; incidence of low birthweight percentile (<3rd and <10th); incidence of other adverse maternal and neonatal outcomes, including maternal symptoms; maternal plasma metformin concentration to explore tablet taking in the metformin group; and the maternal metabolic (fasting glucose and insulin and 2 h glucose) and inflammatory markers at 28 weeks. The methods for detection of the blood analytes have been described elsewhere.15 Secondary mechanistic outcomes as outlined in the published protocol15 were obtained in a subset of participants and will be reported elsewhere.\n\nWe made some changes to the protocol after recruitment began, but before generation of the statistical analysis plan, publication of the protocol,15 and unmasking and analysis. Specifically, maternal insulin resistance at 36 weeks' gestation was originally a co-primary outcome, but was relegated to a secondary outcome when a substantial proportion of participants did not provide a blood sample at 36 weeks. Additionally, we used patient self-reporting of tablet taking to establish treatment compliance and inform the per-protocol analysis.\n\nStatistical analysis\nWe calculated that a sample size of 143 women in each group would provide 80% power, and a sample size of 163 women in each group would provide 85% power, to detect a difference in mean birthweight percentile of SD 0·33 (equivalent to the difference between a placebo mean of 4·0 kg18 and a metformin mean of 3·8 kg) at a two-sided 5% significance level with a two-group t test. We initially aimed to randomise 400 women based on anticipated high compliance and follow-up rates, but in a protocol amendment increased our sample size to 450 women when anecdotal evidence (without formal testing) suggested that compliance was lower than anticipated.\n\nWe did our primary analysis in the modified intention-to-treat population. We also did per-protocol analyses, in which we compared outcomes amongst participants who were compliant with treatment. Compliance was determined before review of the data or unmasking. To measure compliance we calculated the number of weeks from randomisation to delivery for each woman; participants reporting (via their study diary) that they took at least one tablet on at least 4 days per week for at least half of those weeks were deemed to have been compliant. We did not use plasma metformin to measure compliance as no such measure of compliance could be done for placebo.\n\nWe did exploratory analyses of secondary outcomes. No formal adjustment was made to any p values to allow for the large number of secondary endpoints analysed, and thus p values for secondary analyses need to be interpreted conservatively. We also did post-hoc analyses of safety outcomes of all reported serious adverse events and the combined adverse outcome of stillbirth, neonatal death, termination of pregnancy, or miscarriage.\n\nWe derived birthweight percentiles and Z scores of birthweight percentiles (livebirths only) for each patient after adjustment for sex, gestational age, and parity (nulliparous vs multiparous) with population-derived charts.19 We used a linear regression model adjusted for treatment centre and BMI band (30–39 vs ≥40 kg/m2) to compare Z scores between the groups and to obtain the adjusted mean difference with 95% CI. This method was also used for other continuous outcomes including glucose and insulin and homeostatic model assessment of insulin resistance (HOMA-IR). When necessary, we did log transformations to achieve normal distribution of data before statistical testing. For assessment of CRP concentration in the umbilical cord, we used Kruskal–Wallis one-way analysis of variance because this variable could not be transformed into a normal distribution. We used unadjusted logistic regression for binary outcomes and Fisher's exact test when the event counts were small. Relevant denominators were either all participants randomised for whom information was available, or those having a livebirth for whom information was available.\n\nWe did analyses with SAS (version number 9.3). A trial steering and a data and safety monitoring committee oversaw the study. The trial was registered, ISRCTN number 51279843.\n\nRole of the funding source\nThe funder of the study had no role in study design, data collection, data analysis, data interpretation, or writing of the report. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.\n\nResults\nBetween Feb 3, 2011, and Jan 16, 2014, inclusive, we randomly assigned 449 participants to the placebo group (n=223) or the metformin group (n=226), of whom 434 (97%) were included in the modified intention-to-treat analysis (figure). The most common reasons for non-participation were a concern that study drugs might be harmful to the baby, and low awareness about the adverse effects of obesity on pregnancy outcome. Baseline demographics, medical history, and maternal anthropometry were similar between groups (table 1).\n\nFrom diary returns and analysis with predefined criteria, 118 (67%) of 177 women in the placebo group and 109 (65%) of 167 women in the metformin group were deemed compliant. Subsequent analysis of metformin concentrations showed that detectable concentrations were present in the blood of 80 (61%) of 131 women in the metformin group who gave a blood sample at 36 weeks' gestation. To explore dosage, we identified the proportion of drug-taking days when 2500 mg or 2000 mg of study drug was taken. In the placebo group, for 56% of all possible tablet-taking days, the top dose of 2500 mg was taken, and for 68% of these days a dose of 2000 mg or more was taken; the corresponding values in the metformin group were 38% and 62%, respectively.\n\nMean birthweight at delivery was 3463 g (SD 660) in the placebo group and 3462 g (548) in the metformin group (table 2). Mean birthweight percentile was high in both groups (table 2); the proportion of liveborn babies weighing more than the 90th percentile was similar between the placebo group and the metformin group (38 [17%] of 220 and 31 [14%] of 214 babies, respectively). The primary outcome of Z score of birthweight percentile for babies liveborn at 24 weeks or more of gestation, standardised for sex, parity and gestation at delivery, was similar between the metformin and placebo groups, and the estimated effect size of metformin on the primary outcome was non-significant (table 2).\n\nWe recorded no evidence of a reduction in the main secondary outcome of HOMA-IR at 36 weeks' gestation, nor any evidence of a clinically or statistically significant effect of metformin on fasting or 2 h glucose (after a 75 g oral glucose challenge) or fasting insulin at 36 weeks' gestation (table 3). By contrast, fasting glucose and HOMA-IR score at 28 weeks' gestation was lower in women in the metformin group than in those in the placebo group (appendix). Metformin had no significant effect on the anthropometric variables of maternal weight gain in pregnancy or neonatal ponderal index (table 3).\n\nPlasma IL-6 and CRP concentrations were both significantly lower in women given metformin, but no differences were shown in other biochemical outcomes (table 3). Metformin did not seem to prevent gestational diabetes, as proportions of women fulfilling either IADSPG (table 4) or WHO (data not shown) criteria for gestational diabetes at any time in pregnancy were similar between the two groups (table 4). Furthermore, metformin did not delay the onset of gestational diabetes (IADPSG criteria): 26 women in the placebo group were diagnosed at 28 weeks' gestation and ten women were diagnosed at 36 weeks compared with 11 women diagnosed at 28 weeks and 15 women at 36 weeks in the metformin group (p=0·0718, Mantel-Haenszel χ2; post-hoc analysis).\n\nMaternal symptoms of diarrhoea and vomiting were more common in women in the metformin group (table 4). The incidence of other adverse outcomes, including preterm birth and low birthweight, caesarean section, and postpartum haemorrhage were similar in the two groups (table 4). We recorded no adverse effects of metformin in post-hoc safety analyses comparing the proportion of women with a recordable serious adverse event between the two groups (table 4). The increase in the combined adverse outcome of miscarriage, termination of pregnancy, stillbirth or neonatal death in women in the metformin group was not significant (table 2). Admission to the neonatal unit was less common in the metformin group than the placebo group (table 4). We noted no differences in outcomes at other timepoints between the two groups (appendix), with the exception of fasting glucose and HOMA-IR score, as mentioned above.\n\nFurther analyses of the data on a per-protocol basis resulted in similar findings to the modified intention-to-treat analysis, with the exception of vomiting and CRP concentration, in which the direction of differences was maintained but the results were no longer significant (appendix), and in 2 h glucose (estimated mean difference −0312 mmol/L, 95% CI −0·620 to −0·004; p=0·0471) and fasting insulin (6·04 pmol/L, 5·40–6·78; p=0·0173) at 28 weeks' gestation, which were significantly lower in the metformin group than in the placebo group.\n\nDiscussion\nTo our knowledge, EMPOWaR is the first trial of a pharmacological intervention to reduce the risk of ill health in later life, using birthweight as a surrogate marker, in the offspring of obese pregnant women. By contrast with our original hypothesis, metformin given at a median dose of 2000 mg daily to obese and severely obese pregnant women (mean BMI 37·7 kg/m2) without diabetes, from 12–16 weeks' gestation until delivery, had no effect on birthweight or neonatal or maternal anthropometry. On the basis of the study being powered to detect a clinically meaningful effect size, we conclude that this finding shows a true absence of effect of metformin on birthweight rather than a type 2 error. The absence of effect was apparent in both intention-to-treat and per-protocol analyses. We conclude that metformin does not have a role in reducing the birthweight of offspring of obese pregnant women.\n\nThe strengths of this study are its multicentre randomised controlled design, making the study robust and generalisable, and that, despite women's natural reluctance to take medication during pregnancy, we were able to recruit to our target sample size, generating adequate power to address our hypothesis.\n\nAlthough compliance was lower than anticipated, this was balanced by the SD for birthweight also being lower. As such, the 95% CI for the primary comparison in both the intention-to-treat and per-protocol analyses both exclude the prespecified minimum clinically relevant effect size of 0·33. We conclude that the failure to detect a significant difference between the groups is a strong negative finding rather than a result of the trial being underpowered.\n\nStudies of other interventions aimed at reducing birthweight in obese pregnant women, including diet and lifestyle interventions,20, 21, 22 have likewise shown no significant effects. Our data showing that metformin has no effect on birthweight in obese and severely obese pregnant women are in line with secondary outcome data from a smaller study of metformin in non-obese (mean 29·5 kg/m2 [SD 7·0]) pregnant women with a history of polycystic ovary syndrome.23 We are aware of two other ongoing studies of the effect of metformin in obese pregnant women (Clinicaltrials.gov, number NCT01273584 and Australian New Zealand Clinical Trials registry, ACTRN 12612001277831).\n\nWe believe that metformin had its expected pharmacodynamic effects. Fasting glucose and insulin were lower in the metformin group than the placebo group at 28 weeks in the intention-to-treat analysis, and fasting and 2 h glucose, insulin, and HOMA-IR were lower in the metformin group at 28 weeks in the per-protocol analysis. The subsequent lack of effect of metformin at 36 weeks is initially surprising, but might indicate changes in glucose homoeostasis throughout pregnancy in obese women.\n\nAlthough metformin had no effect on the primary outcome, the metformin-associated reduction in inflammatory markers CRP and IL-6 might be beneficial. These markers are found at higher concentrations in obese pregnant women than in pregnant women of a normal weight19 and have been associated with adverse outcomes such as preterm birth and pre-eclampsia.24, 25 Our findings are consistent with those in non-pregnant individuals, in whom metformin reduces concentrations of CRP26 and (variably) IL-6.27\n\nAbsence of efficacy of metformin in reducing mean birthweight, despite lowering maternal glucose and insulin in mid-pregnancy, casts doubt on the 1952 Pedersen hypothesis28 that maternal hyperglycaemia drives fetal hyperglycaemia, and hence fetal hyperinsulinaemia and fetal overgrowth. Other investigators have hypothesised, by contrast with Pedersen, that excess maternal lipids might be as, or even more important than, excess maternal glucose in fetal fat accumulation, particularly in the presence of maternal obesity.29 The present study provides the first experimental evidence that factors other than maternal glucose are important in fetal overgrowth, challenging conventional thinking about the factors linking maternal obesity and offspring macrosomia.\n\nMetformin might have a beneficial effect on future life risk of obesity and metabolic syndrome in offspring, even in the absence of an effect on birthweight percentile. In an animal study,30 prenatal metformin improved glucose tolerance, and reduced accumulation of bodyweight, and fat mass in adulthood of the offspring, despite having only marginal effects on birthweight. Additionally, in the Metformin in Gestational diabetes (MiG) study,31 children of women randomised to the metformin group had lower visceral body fat at 2 years than did children of women randomised to insulin, despite similarities in birthweight. Further follow-up of babies born to mothers in the EMPOWaR trial is planned to explore this possibility and will identify longer-term outcomes on offspring of obese women given metformin in pregnancy. In the meantime, metformin should not be used to improve pregnancy outcomes in obese women.\n\nSupplementary Material\nSupplementary appendix\n \n\nAcknowledgments\nThis study was funded by the Efficacy and Mechanism Evaluation (EME) Programme, an MRC and NIHR partnership (grant reference number 08/246/09). The EME Programme is funded by the MRC and NIHR, with contributions from the Chief Scientist Office in Scotland, the National Institute for Social Care and Health Research in Wales, and the Health and Social Care Research and Development Division of the Public Health Agency in Northern Ireland. We thank Merck KGaA for supplying active and placebo treatment without charge; the supplier had no role in study design, data collection, data analysis, data interpretation, or writing of the report. The joint study sponsor in terms of the EU Clinical Trials Directive was the University of Edinburgh and NHS Lothian and had no role in analysis of the data. The views expressed in this publication are those of the authors and not necessarily those of the MRC, NHS, NIHR or the Department of Health. This study would not have been possible without the commitment of the pregnant women who participated, and we are enormously grateful to them. We thank members of the Trial Steering Committee (Siladitya Bhattacharya [Chair], Robert Lindsay, and Gary Mires) and the Data Monitoring Committee (Peter Brocklehurst [Chair], Graeme MacLennan, Andrew Thomson, and Catherine Williamson); the Principal Investigators (Derek Tuffnell [Bradford], Aamod Nawathe [Chelsea and Westminster]); Janet Cresswell and Santhi Chidambaram (Chesterfield); George Bugg (Nottingham); Fiona Crosfill (Preston); Tom Farrell (Sheffield); Cally Nwosu, Sandhya Rao, Nidhi Srivastava, and Victoria Cording (Whiston); study midwives (Julie Grindey [Arrowe Park], Diane Farrar, Vicky Jones, Jennifer Syson, Gillian Butterfield, Rebecca Palethorpe, and Tracey Germaine-Rylance [Bradford]); Kathryn McCormick and Sarah Ladd (Chelsea and Westminster); Mary Kelly-Baxter, Louise Underwood, and Claire Wood (Chesterfield); Lynsdey Prue and Natasha Kaba (University Hospitals Coventry and Warwickshire); Jennifer Devlin, Yvonne Grieg, Hayley Moir, Alice Keely, and Mary Simpson (Edinburgh); Falak Diab, Caroline Cunningham, and Katherine Day (Liverpool Women's Hospital); Natasha Singh, Katey Rescigno, and Suzanne Ridley (Imperial College London); Yvonne Toomassi, Yvette Davis, and Yvette Gunn (Nottingham); Katrina Rigby (Preston); Hilary Rosser, Siobhan Gillespie, Sarah Senbeto, Alison Carey, and Anne Chamberlain (Sheffield); Jane Hillen and Debbie Bullen (University Hospitals Coventry and Warwickshire); Lauren Lacey (University College London); Zoe Grindlay (Whitson); pharmacists Kathryn Hayes (Blackburn), Martin Shepherd (Chestefield), Hazel Milligan (Edinburgh), Elaine Willis (Liverpool Women's Hospital), Margaret Hargreaves (Whitson), and Louise Hough (Preston); Nanette Hibbert, Graham Harold, Rosemary Leask, Ana Calarrao, Forbes Howie, and Linda Nicol for providing expert technical assistance; Ruth Andrew and Natalie Homer for expertise in gas chromatography mass spectrometry; Allan Walker and Garry Milne for their help in generating the database; Lorraine Adamson, Tariq Derdeb, and Carolyn Newton for excellent administrative assistance; and the administrators in participating NHS research and development departments, and all the others who have helped with the study but who we have been unable to name.\n\nContributors\nJEN conceived the study and drafted the paper. JEN, RMR, FD, AJD, SF, DEN, BRW, SQ, SWr, GM, and SWh designed the study. CC, JEN, RMR, FD, AJD, SF, DEN, BRW, SQ, AW, HL, and SWh acquired the data. GM and AR analysed the data. All authors interpreted the data, revised the paper critically for important intellectual content, and approved the final version.\n\nDeclaration of interests\nJEN received grant funding from the Medical Research Council (MRC) and National Institute of Health Research (NIHR) for this study, and has funding from Tommy's, the baby charity, to undertake research into the consequences of obesity in pregnancy. All authors declare no competing interests.\n\nFigure Trial profile\n\n*Change in eligibility from screening of notes to recruitment visit (unable to arrange recruitment visit before 16 weeks [n=26]), recruitment stopped before screening appointment (n=14), miscarriage (n=2), moved out of area (n=1), unable to provide informed consent because of difficulties with spoken English (n=5), own doctor or midwife advised against participation (n=4), duplicate note screening number issued in error (n=4). †3 months after birth.\n\nTable 1 Baseline characteristics\n\n\t\tPlacebo group\tMetformin group\t\n\t\tMean (SD) or n (%)\tN\tMean (SD) or n (%)\tN\t\nDemographics and lifestyle\t\nAge (years)\t28·9 (5·1)\t223\t28·7 (5·8)\t226\t\nCurrently smokes\t31 (14%)\t223\t40 (18%)\t226\t\nCurrently drinks alcohol\t9 (4%)\t223\t3 (1%)\t226\t\nIllicit drug use\t1 (<1%)\t223\t0\t226\t\nHighest educational qualification\t\n\tSchool for ≤16 years\t79 (35%)\t223\t75 (33%)\t226\t\n\tSchool for ≥16 years\t144 (65%)\t223\t151 (67%)\t226\t\nAt least one previous pregnancy ≥12 weeks' gestation\t161 (73%)\t220\t147 (65%)\t226\t\nSystolic blood pressure (mm Hg)\t119·4 (10·4)\t223\t117·6 (10·8)\t226\t\nDiastolic blood pressure (mm Hg)\t68·9 (7·3)\t223\t68·0 (7·8)\t226\t\nGestation at baseline (days)\t98·9 (8·7)\t223\t99·1 (8·1)\t226\t\nMedical history\t\nPre-eclampsia or pregnancy induced hypertension\t7 (3%)\t223\t10 (4%)\t226\t\nPre-pregnancy hypertension requiring treatment\t2 (1%)\t223\t1 (<1%)\t226\t\nPolycystic ovary syndrome\t21 (9%)\t223\t28 (12%)\t226\t\nDepression requiring treatment\t71 (32%)\t223\t48 (21%)\t226\t\nAnxiety requiring treatment\t20 (9%)\t223\t15 (7%)\t226\t\nFamily history\t\nCardiovascular disease\t69 (31%)\t223\t71 (31%)\t226\t\nPre-eclampsia\t22 (10%)\t223\t19 (8%)\t226\t\nDiabetes\t101 (45%)\t223\t99 (44%)\t226\t\nOther\t96 (43%)\t223\t109 (48%)\t226\t\nAnthropometry\t\nHeight (cm)\t165·1 (5·9)\t223\t165·5 (5·9)\t226\t\nWeight (kg)\t102·9 (17·0)\t223\t103·6 (15·5)\t226\t\nBMI (kg/m2)\t37·7 (5·6)\t223\t37·8 (4·9)\t226\t\nWaist (cm)\t108·7 (13·5)\t222\t110·1 (11·9)\t225\t\nHip (cm)\t126·4 (12·1)\t222\t127·4 (11·8)\t225\t\nMid-arm (cm)\t36·3 (5·0)\t220\t36·7 (4·7)\t221\t\nMid-thigh (cm)\t64·1 (7·7)\t219\t64·2 (6·9)\t222\t\nTricep skinfold (mm)\t31·2 (9·7)\t222\t31·9 (10·8)\t222\t\nBicep skinfold (mm)\t25·7 (10·0)\t222\t27·4 (10·9)\t222\t\nSubscapular skinfold (mm)\t32·0 (12·2)\t222\t32·6 (11·8)\t220\t\nMaternal fat (%)*\t46·8 (5·6)\t48\t48·2 (5·2)\t53\t\nBlood tests\t\nFasting glucose (mmol/L)\t4·39 (0·34)\t223\t4·41 (0·40)\t226\t\n2 h glucose (mmol/L)†\t5·50 (1·09)\t223\t5·20 (1·08)\t226\t\nFasting insulin (pmol/L)\t153·35 (70·84)\t189\t152·44 (85·15)\t188\t\nHOMA-IR score‡\t4·36 (2·16)\t189\t4·36 (2·76)\t188\t\nC-reactive protein (mg/L)\t11·1 (7·4)\t221\t10·7 (6·9)\t223\t\nCholesterol (mmol/L)\t4·87 (1·15)\t216\t4·88 (1·09)\t214\t\nHDL (mmol/L)\t1·67 (0·39)\t215\t1·64 (0·38)\t214\t\nLDL (mmol/L)\t2·91 (0·78)\t194\t2·89 (0·86)\t191\t\nTriglycerides (mmol/L)\t1·51 (0·53)\t216\t1·43 (0·56)\t214\t\nInterleukin-6 (mmol/L)\t2·77 (5·50)\t189\t2·63 (4·37)\t188\t\nLeptin (ng/mL)\t93·6 (42·1)\t189\t98·5 (40·3)\t188\t\nSerum cortisol (nmol/L)\t396·4 (143·6)\t189\t431·0 (178·8)\t188\t\nNEFA (mmol/L)\t0·52 (0·20)\t189\t0·48 (0·18)\t188\t\nPAI-1 to PAI-2 ratio\t1·48 (1·39)\t131\t1·77 (5·22)\t128\t\nPutative father details\t\nHeight (cm)\t178·5 (8·3)\t204\t177·1 (13·7)\t202\t\nWeight (kg)\t92·3 (22·5)\t187\t93·5 (25·8)\t188\t\nEthnic origin\t\n\tWhite\t214 (96%)\t223\t210 (94%)\t224\t\n\tMixed\t4 (2%)\t223\t4 (2%)\t224\t\n\tAsian\t0\t223\t3 (1%)\t224\t\n\tBlack\t4 (2%)\t223\t6 (3%)\t224\t\n\tChinese\t0\t223\t0\t224\t\n\tOther\t1 (<1%)\t223\t1 (<1%)\t224\t\n(Table 1 continues on next page)\t\nHOMA-IR= homeostatic model assessment of insulin resistance. NEFA=non-esterified fatty acids. PAI=plasminogen activator inhibitor.\n\n* Measured only in Edinburgh participants.\n\n† After a 75 g oral glucose challenge.\n\n‡ Fasting glucose (mmol/L) x insulin (μIU/L).\n\nTable 2 Primary and birth outcomes\n\n\tPlacebo group\tMetformin group\tAdjusted mean difference or OR (95 % CI)\tp value\t\n\tMean (SD) or n (%)\tN\tMean (SD) or n (%)\tN\t\t\t\nPrimary outcome\t\nZ score of birthweight percentile*\t0·2680 (1·0055)\t220\t0·2464 (1·0179)\t214\t−0·029 (−0·217 to 0·158)\t0·76\t\nBirth outcome (all births)\t\nLivebirth at ≥24 weeks' gestation\t220 (99%)\t222\t214 (97%)\t221\t..\t..\t\nStillbirth at ≥24 weeks' gestation, miscarriage, or termination of pregnancy\t2 (1%)†\t222\t7 (3%)‡\t221\t3·597 (0·739 to 17·504)§\t0·11\t\nBirth outcome (liveborn babies at ≥24 weeks' gestation)\t\nGestational age at delivery (days)\t275·9 (15·9)\t220\t276·6 (11·7)\t214\t..\t..\t\nMale sex\t109 (50%)\t220\t109 (51%)\t214\t..\t..\t\nBirthweight at delivery (g)\t3463 (660)\t220\t3462 (548)\t214\t..\t..\t\nBirthweight percentile\t57·3 (27·9)\t220\t56·9 (28·6)\t214\t..\t..\t\nOR=odds ratio.\n\n* Percentile by gestational age, sex, and parity for livebirths at ≥24 weeks' gestation.\n\n† Two terminations of pregnancy, one for fetal abnormality (split hand and foot syndrome) and one after a spontaneous membrane rupture at 18 weeks' gestation.\n\n‡ Of the two stillbirths, one was at 31 weeks of a baby with a known cardiac anomaly and severe hydrops fetalis and one was an intrauterine death of a normally formed baby born at 38 weeks with a birthweight less than the third percentile for gestation. Of the four miscarriages, one was after a road traffic accident and three were spontaneous. One termination of pregnancy was done after a diagnosis of trisomy 21. None of the women returned diaries nor provided a blood sample for analysis of metformin.\n\n§ OR from post-hoc analysis.\n\nTable 3 Secondary outcomes\n\n\tPlacebo group\tMetformin group\tAdjusted mean difference or ratio (95% CI)\tp value\t\n\tMean (SD)\tN\tMean (SD)\tN\t\t\t\nMaternal biochemistry at 36 weeks' gestation\t\nFasting glucose (mmol/L)\t4·42 (0·48)\t151\t4·35 (0·45)\t143\t−0·060 (−0·163 to 0·043)\t0·25\t\n2 h glucose (mmol/L)*\t5·96 (1·46)\t148\t5·70 (1·32)\t142\t−0·251 (−0·565 to 0·062)\t0·12\t\nFasting insulin (pmol/L)\t208·98 (91·12)\t131\t227·73 (170·50)\t127\t1·005 (0·901 to 1·120)\t0·93\t\nHOMA-IR score†\t5·98 (2·89)\t131\t6·30 (4·78)\t123\t0·974 (0·865 to 1·097)\t0·67\t\nC-reactive protein (mg/L)\t9·20 (7·10)\t150\t7·47 (4·62)\t140\t0·860 (0·743 to 0·996)\t0·04\t\nCholesterol (mmol/L)\t6·32 (1·44)\t144\t6·33 (1·74)\t139\t1·004 (0·954 to 1·056)\t0·88\t\nHDL (mmol/L)\t1·70 (0·38)\t145\t1·76 (0·43)\t138\t0·051 (−0·040 to 0·142)\t0·27\t\nLDL (mmol/L)\t3·57 (1·13)\t126\t3·77 (1·25)\t118\t1·064 (0·982 to 1·152)\t0·13\t\nTriglycerides (mmol/L)\t2·79 (0·84)\t146\t2·76 (0·88)\t140\t0·993 (0·926 to 1·064)\t0·83\t\nInterleukin-6 (mmol/L)\t3·86 (4·10)\t131\t2·93 (1·37)\t127\t0·847 (0·754 to 0·952)\t0·01\t\nLeptin (ng/mL)\t105·0 (52·4)\t131\t106·6 (58·8)\t127\t1·005 (0·902 to 1·120)\t0·93\t\nSerum cortisol (nmol/L)\t821·7 (232·9)\t131\t867·0 (225·5)\t127\t1·062 (0·999 to 1·128)\t0·05\t\nNEFA (mmol/L)\t0·47 (0·18)\t131\t0·46 (0·19)\t127\t0·947 (0·859 to 1·044)\t0·27\t\nPAI-1 to PAI-2 ratio\t3·20 (2·61)\t131\t2·97 (2·79)\t128\t0·913 (0·771 to 1·081)\t0·29\t\nCord-blood biochemical outcomes\t\nGlucose (mmol/L)\t3·89 (1·24)\t79\t4·06 (1·08)\t74\t1·067 (0·974 to 1·170)\t0·16\t\nInsulin (pmol/L)\t76·05 (52·02)\t47\t79·24 (61·12)\t57\t1·060 (0·767 to 1·463)\t0·72\t\nHOMA-IR score†\t1·92 (1·39)\t38\t1·91 (2·00)\t41\t1·012 (0·701 to 1·462)\t0·95\t\nC-reactive protein (mg/L)‡\t4·32 (19·55)\t78\t2·36 (2·29)\t73\t..\t0·74\t\nAnthropometric variables\t\nMaternal weight gain during pregnancy (kg)\t7·23 (4·91)\t156\t6·70 (6·00)\t143\t−0·680 (−1·863 to 0·503)\t0·26\t\nPonderal index (mass [g]/height3 [cm])§\t2·60 (0·41)\t143\t2·67 (0·50)\t130\t1·032 (0·996 to 1·069)\t0·08\t\nAll variables, except for maternal glucose and HDL, and neonatal C-reactive protein, were log-transformed for the statistical analysis and converted back to original scale for this table. HOMA-IR=homeostatic model assessment of insulin resistance. NEFA=non-esterified fatty acids. PAI=plasminogen activator inhibitor.\n\n* After a 75 g oral glucose challenge.\n\n† Fasting glucose (mmol/L) x insulin (μIU/L)/22·5.\n\n‡ Kruskal–Wallis non-parametric test used.\n\n§ Livebirths only; we removed outliers outside SD 6 and log-transformed data for the statistical analysis; results were back-transformed for this table.\n\nTable 4 Adverse outcomes\n\n\t\tPlacebo group\tMetformin group\tOR (95% CI)\tp value\t\nWomen or their babies with a recorded serious adverse event\t41/222 (18%)\t37/225 (16%)\t0·869 (0·533–1·417)\t0·57\t\nMaternal delivery and postnatal\t\n\tAny caesarean section in index pregnancy\t76/222 (34%)\t65/219 (30%)\t0·811 (0·543–1·211)*\t0·31\t\n\tPrimary caesarean section\t46/222 (21%)\t42/219 (19%)\t0·908 (0·569–1·449)\t0·69\t\n\tPostpartum haemorrhage >1000 mL\t21/216 (10%)\t20/212 (9%)\t0·967 (0·508–1·842)\t0·92\t\n\tPreterm birth†\t14/220 (6%)\t18/214 (8%)\t1·345 (0·651–2·777)\t0·47\t\n\tDevelopment of gestational diabetes‡\t36/153 (24%)\t26/142 (18%)\t0·728 (0·414–1·283)\t0·27\t\n\tPregnancy induced hypertension\t14/222 (6%)\t21/221 (10%)\t1·56 (0·772–3·152)\t0·22\t\n\tPre-eclampsia\t3/222 (1%)\t7/221 (3%)\t2·39 (0·61–9·36)\t0·21\t\nFetal and neonatal outcomes (livebirths only)\t\n\tAdmission to the neonatal unit\t29/219 (13%)\t14/213 (7%)\t0·461 (0·236–0·899)*\t0·02\t\n\tCongenital anomaly\t8/217 (4%)\t7/209 (3%)\t0·905 (0·322–2·543)\t0·85\t\n\tNeonatal death in the delivery room\t0/220\t0/214\t..\t..\t\n\tNeonatal death at a later stage\t2/220 (1%)\t1/214 (<1%)\t..\t1·00*§\t\n\tIncidence of low birthweight <10th percentile\t11/220 (5%)\t14/214 (7%)\t1·330 (0·590–2·999)\t0·49\t\n\tIncidence of low birthweight <3rd percentile\t3/220 (1%)\t3/214 (1%)\t..\t1·00§\t\nMaternal symptoms up to 36 weeks' gestation¶\t\n\tTaste disturbance\t32/198 (16%)\t25/199 (13%)\t0·745 (0·424–1·311)\t0·31\t\n\tSkin reactions\t39/198 (20%)\t36/199 (18%)\t0·900 (0·545–1·489)\t0·68\t\n\tAbdominal pain\t42/198 (21%)\t49/199 (25%)\t1·213 (0·759–1·940)\t0·42\t\n\tFlatulence\t44/198 (22%)\t51/199 (26%)\t1·206 (0·760–1·915)\t0·43\t\n\tConstipation\t57/198 (29%)\t57/199 (29%)\t0·993 (0·643–1·534)\t0·98\t\n\tDiarrhoea\t37/198 (19%)\t83/199 (42%)\t3·113 (1·975–4·908)\t<0·0001\t\n\tNausea\t79/198 (40%)\t97/199 (49%)\t1·432 (0·962–2·132)\t0·08\t\n\tVomiting\t43/198 (22%)\t63/199 (32%)\t1·670 (1·064–2·621)\t0·03\t\n\tHeadache\t66/198 (33%)\t65/199 (33%)\t0·970 (0·638–1·474)\t0·89\t\nData are n/N (%), unless otherwise indicated. OR=odds ratio.\n\n* Post-hoc analysis.\n\n† Livebirths only; four (29%) of 14 preterm births in the placebo group and three (17%) of 18 in the metformin group were spontaneous preterm births after preterm labour.\n\n‡ International Association of Diabetes and Pregnancy Study Groups criteria: fasting glucose of 5·1 mmol/L or more or 2 h glucose of 8·5 mmol/L or more at either 28 or 36 weeks.\n\n§ Fisher's exact test reported.\n\n¶ For all symptoms, categories are none, mild, moderate, or severe. If a participant had any mild, moderate, or severe symptom at any time, this was recorded as “yes” for presence of maternal symptoms.\n==== Refs\nReferences\n1 O'Brien TE Ray JG Chan WS Maternal body mass index and the risk of preeclampsia: a systematic overview Epidemiology 14 2003 368 374 12859040 \n2 Johansson S Villamor E Altman M Bonamy AK Granath F Cnattingius S Maternal overweight and obesity in early pregnancy and risk of infant mortality: a population based cohort study in Sweden BMJ 349 2014 g6572 25467170 \n3 Heslehurst N Simpson H Ells LJ The impact of maternal BMI status on pregnancy outcomes with immediate short-term obstetric resource implications: a meta-analysis Obes Rev 9 2008 635 683 18673307 \n4 Starling AP Brinton JT Glueck DH Associations of maternal BMI and gestational weight gain with neonatal adiposity in the Healthy Start study Am J Clin Nutrit 101 2015 302 309 25646327 \n5 Curhan GC Willett WC Rimm EB Spiegelman D Ascherio AL Stampfer MJ Birth weight and adult hypertension, diabetes mellitus, and obesity in US men Circulation 94 1996 3246 3250 8989136 \n6 Curhan GC Chertow GM Willett WC Birth weight and adult hypertension and obesity in women Circulation 94 1996 1310 1315 8822985 \n7 Parsons TJ Power C Logan S Summerbell CD Childhood predictors of adult obesity: a systematic review Int J Obes Relat Metab Disord 23 suppl 8 1999 S1 107 10641588 \n8 Graversen L Sorensen TI Gerds TA Prediction of adolescent and adult adiposity outcomes from early life anthropometrics Obesity 23 2015 162 169 25354480 \n9 Surkan PJ Hsieh CC Johansson AL Dickman PW Cnattingius S Reasons for increasing trends in large for gestational age births Obstet Gynecol 104 2004 720 726 15458892 \n10 Reynolds RM Allan KM Raja EA Maternal obesity during pregnancy and premature mortality from cardiovascular event in adult offspring: follow-up of 1 323 275 person years BMJ 347 2013 f4539 23943697 \n11 Catalano PM Ehrenberg HM The short- and long-term implications of maternal obesity on the mother and her offspring BJOG 113 2006 1126 1133 16827826 \n12 Scholl TO Sowers M Chen X Lenders C Maternal glucose concentration influences fetal growth, gestation, and pregnancy complications Am J Epidemiol 154 2001 514 520 11549556 \n13 Metzger BE Lowe LP Dyer AR Hyperglycemia and adverse pregnancy outcomes N Engl J Med 358 2008 1991 2002 18463375 \n14 Eames AJ Grivell RM Deussen AR Hague W Dodd JM Metformin for women who are obese during pregnancy for improving maternal and infant outcomes Cochrane Database Syst Rev 6 2013 CD010564 \n15 Chiswick CA Reynolds RM Denison FC Efficacy of metformin in pregnant obese women: a randomised controlled trial BMJ Open 5 2015 e006854 \n16 Boney CM Verma A Tucker R Vohr BR Metabolic syndrome in childhood: association with birth weight, maternal obesity, and gestational diabetes mellitus Pediatrics 115 2005 e290 e296 15741354 \n17 International Association of Diabetes Pregnancy Study Groups Consensus Panel Metzger BE Gabbe SG Persson B International Association of Diabetes and Pregnancy Study Groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy Diabetes Care 33 2010 676 682 20190296 \n18 Stewart FM Freeman DJ Ramsay JE Greer IA Caslake M Ferrell WR Longitudinal assessment of maternal endothelial function and markers of inflammation and placental function throughout pregnancy in lean and obese mothers J Clin Endocrinol Metab 92 2007 969 975 17192290 \n19 Bonellie S Chalmers J Gray R Greer I Jarvis S Williams C Centile charts for birthweight for gestational age for Scottish singleton births BMC Pregnancy Childbirth 8 2008 5 18298810 \n20 Thangaratinam S Rogozinska E Jolly K Effects of interventions in pregnancy on maternal weight and obstetric outcomes: meta-analysis of randomised evidence BMJ 344 2012 e2088 22596383 \n21 Dodd JM Cramp C Sui Z for the Limit Randomised Trial Group The effects of antenatal dietary and lifestyle advice for women who are overweight or obese on maternal diet and physical activity: the LIMIT randomised trial BMC Med 12 2014 161 25315237 \n22 Poston L Bell R Croker H Effect of a behavioural intervention in obese pregnant women (the UPBEAT study): a multicentre, randomised controlled trial Lancet Diabetes Endocrinol 2015 published online July 10. http://dx.doi.org/10.1016/S2213-8587(15)00227-2 \n23 Vanky E Stridsklev S Heimstad R Metformin versus placebo from first trimester to delivery in polycystic ovary syndrome: a randomized, controlled multicenter study J Clin Endocrinol Metab 95 2010 E448 E455 20926533 \n24 Catov JM Bodnar LM Ness RB Barron SJ Roberts JM Inflammation and dyslipidemia related to risk of spontaneous preterm birth Am J Epidemiol 166 2007 1312 1319 17906337 \n25 Xu L Lee M Jeyabalan A Roberts JM The relationship of hypovitaminosis D and IL-6 in preeclampsia Am J Obstet Gynecol 210 2014 149 e1–7. 24080305 \n26 Goldberg RB Temprosa MG Mather KJ Orchard TJ Kitabchi AE Watson KE Diabetes Prevention Program Research Group Lifestyle and metformin interventions have a durable effect to lower CRP and tPA levels in the diabetes prevention program except in those who develop diabetes Diabetes Care 37 2014 2253 2260 24824548 \n27 Xu X Du C Zheng Q Peng L Sun Y Effect of metformin on serum interleukin-6 levels in polycystic ovary syndrome: a systematic review BMC Womens Health 14 2014 93 25096410 \n28 Pedersen J Diabetes and pregnancy: blood sugar of newborn infants 1952 Danish Science Press Copenhagen \n29 Catalano PM Hauguel-De Mouzon S Is it time to revisit the Pedersen hypothesis in the face of the obesity epidemic? Am J Obstet Gynecol 204 2011 479 487 21288502 \n30 Salomaki H Heinaniemi M Vahatalo LH Prenatal metformin exposure in a maternal high fat diet mouse model alters the transcriptome and modifies the metabolic responses of the offspring PLoS One 9 2014 e115778 25541979 \n31 Rowan JA Hague WM Gao W Battin MR Moore MP Metformin versus insulin for the treatment of gestational diabetes N Engl J Med 358 2008 2003 2015 18463376\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2213-8587",
"issue": "3(10)",
"journal": "The lancet. Diabetes & endocrinology",
"keywords": null,
"medline_ta": "Lancet Diabetes Endocrinol",
"mesh_terms": "D000022:Abortion, Spontaneous; D000328:Adult; D016640:Diabetes, Gestational; D004311:Double-Blind Method; D005260:Female; D005320:Fetal Macrosomia; D006801:Humans; D007004:Hypoglycemic Agents; D008687:Metformin; D056128:Obesity, Abdominal; D011247:Pregnancy; D011248:Pregnancy Complications; D011256:Pregnancy Outcome; D050497:Stillbirth; D055815:Young Adult",
"nlm_unique_id": "101618821",
"other_id": null,
"pages": "778-86",
"pmc": null,
"pmid": "26165398",
"pubdate": "2015-10",
"publication_types": "D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": "10641588;11549556;12859040;14958933;15458892;15741354;16827826;17192290;17906337;18298810;18463375;18463376;18673307;20190296;20926533;21288502;22596383;23943697;24080305;24824548;25096410;25315237;25354480;25467170;25541979;25588785;25646327;26165396;30039871;8822985;8989136",
"title": "Effect of metformin on maternal and fetal outcomes in obese pregnant women (EMPOWaR): a randomised, double-blind, placebo-controlled trial.",
"title_normalized": "effect of metformin on maternal and fetal outcomes in obese pregnant women empowar a randomised double blind placebo controlled trial"
} | [
{
"companynumb": "EG-ALKEM LABORATORIES LIMITED-EG-ALKEM-2019-03438",
"fulfillexpeditecriteria": "1",
"occurcountry": "EG",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METFORMIN HYDROCHLORIDE"
},
... |
{
"abstract": "Background: Idiopathic interstitial pneumonia (IIP) is associated with increased risk of acute exacerbation after lung surgery, which has a poor prognosis and can be fatal. Although some studies have investigated acute exacerbation of IIP after lung surgery, the incidence and risks of acute exacerbation of IIP after nonpulmonary surgery have not been reported. The aim of present study to evaluate the characteristics and risk factors for acute exacerbation of IIP after nonpulmonary surgery. Methods: We retrospectively reviewed the clinical characteristics of 2908 consecutive patients (1620 men, 1288 women; mean age, 61.7) who underwent nonpulmonary surgery under general anesthesia between April 2008 to April 2013. Using preoperative chest computed tomography images, we identified IIP cases and compared preoperative characteristics, laboratory findings, and anesthesia conditions among patients who did and did not develop AE. Results: We extracted 103 IIP patients who underwent nonpulmonary surgery; postoperative acute exacerbation of IIP developed in 8 (7.8%). Univariate analysis identified several risk factors, namely, emergency surgery, preoperative prednisolone use, high serum C-reactive protein, lactate dehydrogenase, white blood cell count, low serum albumin and propofol use during anesthesia. Conclusion: The results suggest that the incidences of postoperative acute exacerbation of IIP are similar after nonpulmonary and pulmonary surgery. In addition, propofol use during anesthesia is a possible risk factor for acute exacerbation of IIP after nonpulmonary surgery. (Sarcoidosis Vasc Diffuse Lung Dis 2017; 34: 156-164).",
"affiliations": "Division of Respiratory Medicine, Toho University Omori Medical Center.;Division of Respiratory Medicine, Toho University Omori Medical Center.;Division of Respiratory Medicine, Toho University Omori Medical Center.;Division of Anesthesiology, Toho University Omori Medical Center.;Division of Radiology, Toho University Omori Medical Center.;Division of Respiratory Medicine, Toho University Omori Medical Center.",
"authors": "Furuya|Kenta|K|;Sakamoto|Susumu|S|;Takai|Yujiro|Y|;Sato|Nobukazu|N|;Matsumoto|Keiko|K|;Homma|Sakae|S|",
"chemical_list": null,
"country": "Italy",
"delete": false,
"doi": "10.36141/svdld.v34i2.5366",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1124-0490",
"issue": "34(2)",
"journal": "Sarcoidosis, vasculitis, and diffuse lung diseases : official journal of WASOG",
"keywords": "acute exacerbation; idiopathic interstitial pneumonia; propofol; risk factors",
"medline_ta": "Sarcoidosis Vasc Diffuse Lung Dis",
"mesh_terms": null,
"nlm_unique_id": "9610928",
"other_id": null,
"pages": "156-164",
"pmc": null,
"pmid": "32476837",
"pubdate": "2017",
"publication_types": "D016428:Journal Article",
"references": "24267779;20595144;17721330;17678775;17453156;20935110;19417610;15296027;14566260;15658905;9817725;21245629;22543997;22334036;21860222;4948324;21637373;22446955;12830051;12502975;11334116;21319592;21307008;23903809;21471066;2661160;17400667",
"title": "Acute exacerbation of idiopathic interstitial pneumonia after nonpulmonary surgery under general anesthesia: a retrospective study.",
"title_normalized": "acute exacerbation of idiopathic interstitial pneumonia after nonpulmonary surgery under general anesthesia a retrospective study"
} | [
{
"companynumb": "JP-FRESENIUS KABI-FK201708701",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "PROPOFOL"
},
"drugadditional": null,
... |
{
"abstract": "Diluted epinephrine is often locally used to provide hemostasis and improve visualization. However, rapid absorption or inadvertent intravascular injection of epinephrine can cause unexpected cardiovascular effects. A 28-year-old man was scheduled to undergo a nasal septoplasty. After local application of 0.01% epinephrine-soaked nasal pledgets and infiltration of 3 mL 0.001% epinephrine, the patient developed a severe hypertension of 205/126 mmHg, followed by ventricular tachycardia. Cardiac arrest ensued after intravenous injection of lidocaine and esmolol in an attempt to control ventricular arrhythmia. After successful resuscitation, the patient was transferred to the intensive care unit (ICU) and fully recovered in 5 days. While another two epinephrine-induced hypertension cases were treated smoothly without β-blockers. Although the plausible explanation of this precipitating event is the usage of β-blocker, we reviewed the previous published similar clinical reports and proposed other possible explanations and differential diagnosis. It is important to recognize this potential cardiovascular side-effect in patients administrated with topical and/or submucosal epinephrine. Drugs used to treat hypertension and/or arrhythmia needed to be appreciated.",
"affiliations": "Department of Anesthesiology, Daping Hospital, Army Medical University, Chongqing, China.;Department of Anesthesiology, Daping Hospital, Army Medical University, Chongqing, China.;Department of Anesthesiology, Daping Hospital, Army Medical University, Chongqing, China.;Department of Anesthesiology, Daping Hospital, Army Medical University, Chongqing, China.;Department of Anesthesiology, Daping Hospital, Army Medical University, Chongqing, China.",
"authors": "Ren|Yunqin|Y|;Wang|Yao|Y|;Yan|Hong|H|;Chen|Liyong|L|;Mao|Qingxiang|Q|",
"chemical_list": null,
"country": "China",
"delete": false,
"doi": "10.21037/acr-20-161",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2523-1995",
"issue": "5()",
"journal": "AME case reports",
"keywords": "Epinephrine; cardiac arrest; case report; hypertension; ventricular tachycardia",
"medline_ta": "AME Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101730832",
"other_id": null,
"pages": "31",
"pmc": null,
"pmid": "34805750",
"pubdate": "2021",
"publication_types": "D002363:Case Reports",
"references": "6314140;19575117;11375836;28652958;18094670;10876433;21286460;22732314;9230324;2275910;9753960;19906451;18438267;19184069;20502771;4025861;21603379;8677878;17283269;20584206;30663992;19779368;7527511;31504179;1524174;18566202;2405744",
"title": "Cardiovascular crisis after use of epinephrine: a case report and review of the literature.",
"title_normalized": "cardiovascular crisis after use of epinephrine a case report and review of the literature"
} | [
{
"companynumb": "CN-ALVOGEN-2021-ALVOGEN-117865",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LIDOCAINE"
},
"drugadditional": "3",
... |
{
"abstract": "Individuals with cystic fibrosis (CF) are at high risk for depression and anxiety, which are associated with worse medical outcomes. Novel therapies for CF hold great promise for improving physical health, but the effects of these therapies on mental health remain poorly understood.\n\n\n\nThis review aims to familiarize psychiatrists with the potential effect of novel CF therapies on depression and anxiety.\n\n\n\nWe discuss novel therapies that directly target the mutant CF protein, the CF transmembrane regulator (CFTR), which are called CFTR modulators. We summarize depression and anxiety screening and treatment guidelines under implementation in accredited CF centers. Case vignettes highlight the complexities of caring for individuals with CF with comorbid depression and anxiety, including patients experiencing worsening depression and anxiety proximate to initiation of CFTR modulator therapy, and management of drug-drug interactions.\n\n\n\nAlthough CFTR modulator therapies provide hope for improving clinical outcomes, worsening depression and anxiety occurs in some patients when starting these novel agents. This phenomenon may be multifactorial, with hypothesized contributions from CFTR modulator-psychotropic medication interactions, direct effects of CFTR modulators on central nervous system function, the psychologic effect of starting a potentially life-altering drug, and typical triggers of depression and anxiety such as stress, pain, and inflammation. The medical and psychiatric complexity of many individuals with CF warrants more direct involvement of mental health specialists on the multidisciplinary CF team. Inclusion of mental health variables in patients with CF registries will facilitate further examination at an epidemiologic level.",
"affiliations": "Department of Internal Medicine, Yale School of Medicine, New Haven, CT; Department of Pediatrics, Yale School of Medicine, New Haven, CT. Electronic address: jaideep.talwalkar@yale.edu.;Department of Internal Medicine, Yale School of Medicine, New Haven, CT.;Department of Psychiatry, Yale School of Medicine, New Haven, CT.;Department of Internal Medicine, Yale School of Medicine, New Haven, CT.;Department of Internal Medicine, Yale School of Medicine, New Haven, CT.;Department of Psychiatry, Massachusetts General Hospital, Boston, MA.",
"authors": "Talwalkar|Jaideep S|JS|;Koff|Jonathan L|JL|;Lee|Hochang B|HB|;Britto|Clemente J|CJ|;Mulenos|Arielle M|AM|;Georgiopoulos|Anna M|AM|",
"chemical_list": "D065101:Chloride Channel Agonists; D019005:Cystic Fibrosis Transmembrane Conductance Regulator",
"country": "England",
"delete": false,
"doi": "10.1016/j.psym.2017.04.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0033-3182",
"issue": "58(4)",
"journal": "Psychosomatics",
"keywords": "Anxiety; CFTR modulators; Cystic fibrosis; Depression; Lumacaftor-ivacaftor",
"medline_ta": "Psychosomatics",
"mesh_terms": "D001008:Anxiety Disorders; D001294:Attitude to Health; D065101:Chloride Channel Agonists; D003550:Cystic Fibrosis; D019005:Cystic Fibrosis Transmembrane Conductance Regulator; D003866:Depressive Disorder; D006801:Humans; D016896:Treatment Outcome",
"nlm_unique_id": "0376506",
"other_id": null,
"pages": "343-354",
"pmc": null,
"pmid": "28576305",
"pubdate": "2017",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Cystic Fibrosis Transmembrane Regulator Modulators: Implications for the Management of Depression and Anxiety in Cystic Fibrosis.",
"title_normalized": "cystic fibrosis transmembrane regulator modulators implications for the management of depression and anxiety in cystic fibrosis"
} | [
{
"companynumb": "US-VERTEX PHARMACEUTICALS-2017-003119",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ESCITALOPRAM OXALATE"
},
"drugadd... |
{
"abstract": "OBJECTIVE\nAdjuvant chemotherapy (AC) improves survival of patients with resected non-small cell lung cancer (NSCLC). However, the cisplatin-vinorelbine regimen has been associated with a significant risk of clinically relevant toxicity. We sought to evaluate the effectiveness, safety, and feasibility of AC for NSCLC patients in a real-world setting.\n\n\nMETHODS\nThis was a single-center, retrospective cohort study of patients with stage I-III NSCLC undergoing surgery with curative intent between 2009 and 2018. AC was administered at the discretion of physicians. The patients were divided into two groups: AC group and no AC (control) group. Study outcomes included overall survival (OS) and recurrence-free survival (RFS), as well as the safety profile and feasibility of the cisplatin-vinorelbine regimen in a real-world setting.\n\n\nRESULTS\nThe study involved 231 patients, 80 of whom received AC. Of those, 55 patients received the cisplatin-vinorelbine regimen. Survival analyses stratified by tumor stage showed that patients with stage II NSCLC in the AC group had better RFS (p = 0.036) and OS (p = 0.017) than did those in the no AC group. Among patients with stage III NSCLC in the AC group, RFS was better (p < 0.001) and there was a trend toward improved OS (p = 0.060) in comparison with controls. Of those who received the cisplatin-vinorelbine regimen, 29% had grade 3-4 febrile neutropenia, and 9% died of toxicity.\n\n\nCONCLUSIONS\nThese results support the benefit of AC for NSCLC patients in a real-world setting. However, because the cisplatin-vinorelbine regimen was associated with alarming rates of toxicity, more effective and less toxic alternatives should be investigated.",
"affiliations": "Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Institut Jules Bordet, Université Libre de Bruxelles, Bruxelles, Belgique.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.;Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.",
"authors": "Harada|Guilherme|G|http://orcid.org/0000-0003-4012-3251;Neffa|Maria Fernanda Batistuzzo Vicentini|MFBV|http://orcid.org/0000-0001-8727-6680;Bonadio|Renata Colombo|RC|http://orcid.org/0000-0001-5818-922X;Mendoza|Elizabeth Zambrano|EZ|http://orcid.org/0000-0002-0061-9407;Caparica|Rafael|R|http://orcid.org/0000-0001-5573-0711;Lauricella|Letícia Leone|LL|http://orcid.org/0000-0002-8378-7704;Takagaki|Teresa Yae|TY|http://orcid.org/0000-0003-2277-2100;Roitberg|Felipe Santa Rosa|FSR|http://orcid.org/0000-0003-2546-543X;Terra|Ricardo Mingarini|RM|http://orcid.org/0000-0001-8577-8708;Castro|Gilberto De|G|http://orcid.org/0000-0001-8765-3044",
"chemical_list": "D002945:Cisplatin; D000077235:Vinorelbine",
"country": "Brazil",
"delete": false,
"doi": "10.36416/1806-3756/e20200378",
"fulltext": "\n==== Front\nJ Bras Pneumol\nJ Bras Pneumol\njbpneu\nJornal Brasileiro de Pneumologia\n1806-3713\n1806-3756\nSociedade Brasileira de Pneumologia e Tisiologia\n\n33656100\n10.36416/1806-3756/e20200378\n00000\nOriginal Article\nEffectiveness and toxicity of adjuvant chemotherapy in patients with non-small cell lung cancer\nEficácia e toxicidade da quimioterapia adjuvante em pacientes com câncer de pulmão de células não pequenashttp://orcid.org/0000-0003-4012-3251\nHarada Guilherme 1\nhttp://orcid.org/0000-0001-8727-6680\nNeffa Maria Fernanda Batistuzzo Vicentini 1\nhttp://orcid.org/0000-0001-5818-922X\nBonadio Renata Colombo 1\nhttp://orcid.org/0000-0002-0061-9407\nMendoza Elizabeth Zambrano 1\nhttp://orcid.org/0000-0001-5573-0711\nCaparica Rafael 2\nhttp://orcid.org/0000-0002-8378-7704\nLauricella Letícia Leone 1\nhttp://orcid.org/0000-0003-2277-2100\nTakagaki Teresa Yae 1\nhttp://orcid.org/0000-0003-2546-543X\nRoitberg Felipe Santa Rosa 1\nhttp://orcid.org/0000-0001-8577-8708\nTerra Ricardo Mingarini 1\nhttp://orcid.org/0000-0001-8765-3044\nCastro Gilberto De Jr 1\n1 . Instituto do Cancer do Estado de Sao Paulo, Faculdade de Medicina da Universidade de Sao Paulo (SP) Brasil.\n2 . Institut Jules Bordet, Université Libre de Bruxelles, Bruxelles, Belgique.\nCorrespondence to: Guilherme Harada. Instituto do Câncer do Estado de São Paulo, Avenida Dr. Arnaldo, 251, CEP 01246-000, São Paulo, SP, Brasil. Tel.: 55 11 3893-2000. E-mail: guiarada@hotmail.com\nAUTHOR CONTRIBUTIONS: MFVN, RCB, GH, EZM, RC, LLL, TYT, RMT, FSRR, and GCJ: study design and research. MFVN, RCB, GH, EZM, RC, LLL, TYT, RMT, FSRR, and GCJ: data analysis. MFVN, RCB, GH, FSRR, and GCJ: drafting of the manuscript. MFVN, RCB, GH, EZM, RC, LLL, TYT, RMT, FSRR, and GCJ: critical revision of the manuscript for important intellectual content and approval of the final version.\n\nMay-Jun 2021\nMay-Jun 2021\n47 3 e2020037804 8 2020\n22 10 2020\n© 2021 Sociedade Brasileira de Pneumologia e Tisiologia\n2021\nSociedade Brasileira de Pneumologia e Tisiologia\nhttps://creativecommons.org/licenses/by-nc/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License\nABSTRACT\n\nObjective:\n\nAdjuvant chemotherapy (AC) improves survival of patients with resected non-small cell lung cancer (NSCLC). However, the cisplatin-vinorelbine regimen has been associated with a significant risk of clinically relevant toxicity. We sought to evaluate the effectiveness, safety, and feasibility of AC for NSCLC patients in a real-world setting.\n\nMethods:\n\nThis was a single-center, retrospective cohort study of patients with stage I-III NSCLC undergoing surgery with curative intent between 2009 and 2018. AC was administered at the discretion of physicians. The patients were divided into two groups: AC group and no AC (control) group. Study outcomes included overall survival (OS) and recurrence-free survival (RFS), as well as the safety profile and feasibility of the cisplatin-vinorelbine regimen in a real-world setting.\n\nResults:\n\nThe study involved 231 patients, 80 of whom received AC. Of those, 55 patients received the cisplatin-vinorelbine regimen. Survival analyses stratified by tumor stage showed that patients with stage II NSCLC in the AC group had better RFS (p = 0.036) and OS (p = 0.017) than did those in the no AC group. Among patients with stage III NSCLC in the AC group, RFS was better (p < 0.001) and there was a trend toward improved OS (p = 0.060) in comparison with controls. Of those who received the cisplatin-vinorelbine regimen, 29% had grade 3-4 febrile neutropenia, and 9% died of toxicity.\n\nConclusions:\n\nThese results support the benefit of AC for NSCLC patients in a real-world setting. However, because the cisplatin-vinorelbine regimen was associated with alarming rates of toxicity, more effective and less toxic alternatives should be investigated.\n\nRESUMO\n\nObjetivo:\n\nA quimioterapia adjuvante melhora a sobrevida de pacientes com câncer pulmonar de células não pequenas (CPCNP) ressecado. No entanto, o esquema cisplatina-vinorelbina está relacionado com risco significativo de toxicidade clinicamente relevante. Nosso objetivo foi avaliar a eficácia, segurança e viabilidade da quimioterapia adjuvante para pacientes com CPCNP em um cenário de mundo real.\n\nMétodos:\n\nEstudo retrospectivo de coorte realizado em um único centro com pacientes com CPCNP em estágio I-III submetidos a cirurgia com intuito curativo entre 2009 e 2018. A quimioterapia adjuvante foi administrada a critério dos médicos. Os pacientes foram divididos em dois grupos: quimioterapia adjuvante e sem quimioterapia adjuvante (grupo controle). Os desfechos estudados foram sobrevida global (SG) e sobrevida livre de recidiva (SLR), bem como o perfil de segurança e viabilidade do esquema cisplatina-vinorelbina em um cenário de mundo real.\n\nResultados:\n\nO estudo envolveu 231 pacientes, 80 dos quais receberam quimioterapia adjuvante. Destes, 55 receberam o esquema cisplatina-vinorelbina. As análises de sobrevida estratificadas pelo estágio do tumor mostraram que os pacientes com CPCNP em estágio II que receberam quimioterapia adjuvante apresentaram melhor SLR (p = 0,036) e SG (p = 0,017) do que os do grupo controle. Entre os pacientes com CPCNP em estágio III que receberam quimioterapia adjuvante, a SLR foi melhor (p < 0,001) e houve uma tendência a melhor SG do que no grupo controle (p = 0,060). Dos que receberam o esquema cisplatina-vinorelbina, 29% apresentaram neutropenia febril de grau 3-4, e 9% morreram em virtude de toxicidade.\n\nConclusões:\n\nOs resultados confirmam o efeito benéfico da quimioterapia adjuvante em pacientes com CPCNP em um contexto real. No entanto, o esquema cisplatina-vinorelbina relacionou-se com taxas alarmantes de toxicidade e alternativas mais eficazes e menos tóxicas devem ser investigadas.\n\nKeywords:\n\nLung neoplasms\nChemotherapy, adjuvant\nCisplatin/toxicity\nVinorelbine/toxicity\nDescritores:\n\nNeoplasias pulmonares\nQuimioterapia adjuvante\nCisplatino/toxicidade\nVinorelbina/toxicidade\n==== Body\nINTRODUCTION\n\nLung cancer is one of the most common cancers and the leading cause of cancer-related deaths both in men and women worldwide, with an estimated 1.7 million deaths in 2018. 1 Non-small cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancers. 2 Clinical outcomes and treatment strategies for NSCLC are directly related to stage at diagnosis. Unfortunately, only 25% of the patients with NSCLC have non-metastatic disease at diagnosis, and recurrence rates are often high even when patients are treated with curative intent. 3\n\nIn order to improve patient outcomes, adjuvant cisplatin-based chemotherapy after surgical resection has been extensively studied in the last decades. 4 - 8 The Adjuvant Navelbine International Trialist Association (ANITA) trial 4 demonstrated that cisplatin and vinorelbine significantly improve five-year survival rates (by 8,6%; p = 0,017) in patients with stage IB-IIIA NSCLC. However, a subgroup analysis indicated that the benefit is mainly seen in patients with stage II or IIIA disease. 4 )\n\nThe benefit of adjuvant chemotherapy in NSCLC was confirmed in a meta-analysis evaluating more than 4.500 patients in five clinical trials. 5 It showed that platinum-based adjuvant chemotherapy resulted in a 5.4% absolute improvement in overall survival (OS) in patients with stage II or III NSCLC (hazard ratio [HR] = 0.89; 95% CI: 0.82-0.96; p = 0.005). 5 Based on these results, platinum-based adjuvant chemotherapy has become the standard of care for patients with completely resected stage II or IIIA NSCLC, and the most commonly used regimen is a combination of cisplatin and vinorelbine. 4 - 8\n\nAlthough effectiveness of the cisplatin-vinorelbine regimen has been well established, the combination of cisplatin and vinorelbine is associated with clinically relevant toxicity. High rates of grade 3-4 adverse events can compromise treatment adherence, leading to dose reductions and delays, as well as to treatment discontinuation, which is known to be associated with worse outcomes. 4 - 8 Studies providing real-world data on long-term efficacy and safety of adjuvant chemotherapy in NSCLC are scarce and have heterogeneous methods and outcomes. Therefore, the primary objective of the present study was to evaluate the effectiveness and safety of adjuvant chemotherapy for NSCLC patients in a real-world setting.\n\nMETHODS\n\nStudy design and participants\n\nIn this retrospective cohort study, patients undergoing surgical treatment for localized NSCLC were consecutively evaluated and treated between June of 2009 and January of 2018 at the Instituto do Câncer do Estado de São Paulo (ICESP), located in the city of São Paulo, Brazil. The ICESP has a dedicated multidisciplinary thoracic oncology team responsible for evaluating and discussing the cases of patients considered candidates for surgery with curative intent.\n\nWe included patients with histologically confirmed NSCLC and TNM stage I-III NSCLC 3 undergoing surgery with curative intent. In accordance with the institutional guidelines, all patients were submitted to pre-operative staging with CT or PET/CT to exclude metastases and with mediastinoscopy or EBUS for mediastinal staging, when indicated. Exclusion criteria included metastatic disease, primary tumor not amenable to complete resection, and a concurrent diagnosis of other malignancies. Data on clinical and demographic characteristics, as well as on treatment received, toxicity, and oncologic outcomes were obtained from electronic medical records. The study was approved by the local research ethics committee (ID 1011/16).\n\nTreatment\n\nThe thoracic surgery team defined the type of surgery required to achieve a tumor-free resection margins (lobectomy or pneumonectomy and lymph node dissection) by using an open surgery or video-assisted thoracic surgery, in accordance with the International Association for the Study of Lung Cancer recommendations. 2 , 3\n\nAdjuvant chemotherapy, radiation therapy, or both were prescribed at the discretion of the physicians involved, in accordance with institutional guidelines or by tumor board consensus. At our institution during the study period, adjuvant chemotherapy was recommended for patients with completely resected stage II-III NSCLC and was considered on a case-by-case basis in patients with stage IB NSCLC. In addition, patients must have an ECOG performance status of 0-1 and adequate hepatic, renal, and hematological function. Standard adjuvant chemotherapy as defined by institutional guidelines is cisplatin (80 mg/m2 on day 1) and vinorelbine (30 mg/m2 on days 1, 8, and 15) every three weeks for four cycles. Alternative platinum-based chemotherapy regimens are allowed in specific settings. Although adjuvant radiation therapy is not part of our routine protocol, it was considered on a case-by-case basis in patients with positive margins or N2 lymph node status.\n\nStatistical analysis\n\nPatient characteristics and treatment-related toxicities were summarized by descriptive statistics. Continuous variables were expressed as median and range, whereas categorical variables were presented as absolute numbers and proportions. Differences in continuous variables between the groups were evaluated by Student’s t-test. Categorical variables were compared between groups with the use of Fisher’s exact test.\n\nThe Kaplan-Meier method was used in order to estimate survival function, and curves were compared by the log-rank test. The primary outcome was OS, defined as the time from the date of surgery to the date of death from any cause or the date of the last medical visit. Recurrence-free survival (RFS) was also analyzed and defined as the time from surgery to disease recurrence or death. Patients presenting with no events of interest were censored at the last follow-up date.\n\nPotential prognostic factors were evaluated by univariate and multivariate analysis with Cox proportional hazards regression, which provided the HR and 95% CI. Prognostic factors evaluated in the univariate analysis included age, gender, TNM stage, lymph node status, histology, and use of adjuvant chemotherapy. For the multivariate model, we included the use of adjuvant chemotherapy and factors showing p ≤ 0.10 in the univariate analysis as long as they were not associated with each other. The chi-square test was used in order to evaluate the association between variables.\n\nStatistical analyses were conducted with the Stata statistical software package, version 15.1 (StataCorp LP, College Station, TX, USA). The level of significance was set at 5% (p < 0.05).\n\nRESULTS\n\nPatient characteristics\n\nThe study included 231 consecutive patients who met the eligibility criteria. The median follow-up time was 24 months. Of the 231 patients, 80 patients received adjuvant chemotherapy, and 151 were followed after surgical treatment (controls). Of the 80 patients who received adjuvant chemotherapy, 55 patients (68%) received the cisplatin-vinorelbine regimen. Alternative regimens included carboplatin and paclitaxel (n = 17; 21.2%), cisplatin and gemcitabine (n = 5; 6.2%), cisplatin and paclitaxel (n = 1; 1.2%), and carboplatin and vinorelbine (n = 1; 1.2%). Among the patients who received cisplatin and vinorelbine, the median cumulative dose of cisplatin was 286 mg/m2 (range: 72-320 mg/m2), and that of vinorelbine was 292 mg/m2 (range: 60-360 mg/m2).\n\nPatients in the adjuvant chemotherapy group were younger than those in the control group (median age: 63.0 years vs. 67.6 years; p < 0.001) and more frequently underwent pneumonectomy (15.0% vs. 7.9%; p < 0.005). The proportion of early stage disease was higher in the control group, with stage I NSCLC in 56.3% (p < 0.001) and negative lymph nodes (N0) in 67.5% (p < 0.001). Of the patients who received adjuvant chemotherapy, only 2.5% had stage I NSCLC, and 31.2% had negative lymph nodes (N0). Table 1 summarizes the characteristics of the study participants.\n\nTable 1 Characteristics of the patients included in the study (N = 231).a\n\nCharacteristic\tGroup\tP\t\nAdjuvant chemotherapy\tNo adjuvant chemotherapy\t\n(n = 80)\t(n = 151)\t\nAge, years\t63.0 [45.3-79.1]\t68.3 [34.0-87.9]\t< 0.001*\t\nSex\nMale\nFemale\t\n36 (45.0)\n44 (55.0)\t\n73 (48.3)\n78 (51.7)\t0.388†\t\nType of surgery\nPneumonectomy\nLobectomy\nOther\t\n12 (15.0)\n61 (76.2)\n7 (8.7)\t\n12 (7.9)\n134 (88.7)\n5 (3.3)\t0.005†\t\nHistology\nSCC\nAdenocarcinoma\nOther\nNot available\t\n21 (26.2)\n53 (66.2)\n6 (7.5)\n0 (0)\t\n48 (31.8)\n92 (60.9)\n10 (6.6)\n1 (0.7)\t0.747†\t\nStage\nI\nII\nIII\nNot available\t\n2 (2.5)\n44 (54.9)\n34 (42.5)\n0 (0)\t\n85 (56.3)\n41 (27.1)\n24 (15.9)\n1 (0.7)\t< 0.001†\t\nLymph node status\nN0\nN1\nN2\nNot available\t\n25 (31.2)\n27 (33.7)\n27 (33.7)\n1 (1.2)\t\n102 (67.5)\n17 (11.3)\n14 (9.3)\n18 (11.9)\t< 0.001†\t\nECOG-PS before chemotherapy\n0\n1\n2\nNot available\t\n22 (27.5)\n48 (60.0)\n1 (1.2)\n9 (11.2)\t\n-\n-\t\t\nRadiation therapy\nYes\t\n13 (16.2)\t\n5 (3.3)\t\t\nSCC: squamous cell carcinoma; and PS: performance status. aValues expressed as median [range] or n (%). *Student’s t-test. †Fisher’s exact test.\n\nEffectiveness\n\nIn the univariate analysis, factors associated with shorter OS were TNM stage (stage II vs. stage I: HR = 2.57; 95% CI: 1.40-4.71; p = 0.002; and stage III vs. stage I: HR = 3.81; 95% CI: 2.06-7.07; p < 0.001) and lymph node status (N2 vs. N0: HR = 1.82; 95% CI: 1.07-3.11; p = 0.027). Adjuvant chemotherapy use and TNM stage were included in the multivariate model. Lymph node status was not included, because it is part of the TNM stage (p < 0.001).\n\nThe multivariate analysis confirmed that TNM stage was a negative prognostic factor for OS (stage II vs. stage I: HR = 3.93; 95% CI: 2.06-7.49; p < 0.001; and stage III vs. stage I: HR = 6.31; 95% CI: 3.23-12.35; p < 0.001), whereas adjuvant chemotherapy use was associated with longer OS in comparison with the control group (HR = 0.43; 95% CI: 0.25-0.72; p = 0.001). The results of univariate and multivariate Cox regression analyses are presented in Table 2.\n\nTable 2 Factors associated with overall survival after surgery for resection of non-small cell lung cancer (Cox regression).\n\nFactor\tUnivariate analysis\tMultivariate analysis\t\nHR (95% CI)\tp\tHR (95% CI)\tp\t\nAdjuvant chemotherapy (yes vs. no)\t0.97 (0.60-1.55)\t0.909\t0.43 (0.25-0.72)\t0.001\t\nAge (> 60 years vs. ≤ 60 years)\t1.26 (0.76-2.08)\t0.367\t\t\t\nSex (male vs. female)\t1.44 (0.90-2.29)\t0.123\t\t\t\nTNM stage\nI\nII\nIII\t\nReference\n2.57 (1.40-4.71)\n3.81 (2.06-7.07)\t\n\n0.002\n0.000\t\nReference\n3.93 (2.06-7.49)\n6.31 (3.23-12.35)\t\n\n< 0.001\n< 0.001\t\nLymph node status\nN0\nN1\nN2\t\nReference\n0.93 (0.48-1.82)\n1.82 (1.07-3.11)\t\n\n0.854\n0.027\t\n\t\t\nHistology (SCC vs. adenocarcinoma)\t1.38 (0.84-2.27)\t0.192\t\t\t\nHR: hazard ratio; and SCC: squamous cell carcinoma.\n\nDuring the study follow-up period, 97 patients (67%) had disease recurrence or died. Given the discrepancy between the study groups regarding tumor stage and the importance of this factor for oncologic outcomes, survival analyses were carried out according to tumor stage. Among stage II NSCLC patients, those who received adjuvant chemotherapy had longer RFS than did those who did not (median RFS: not reached vs. 25.5 months; HR = 0.50; 95% CI: 0.26-0.95; p = 0.036). Adjuvant chemotherapy was also associated with longer OS. The median OS was not reached in the adjuvant chemotherapy group, whereas, in the control group, it was 33.8 months (HR = 0.42; 95% CI: 0.21-0.85; p = 0.017). Five-year OS rates were 62.1% (95% CI: 42.5-76.7%) and 12.3% (95% CI: 0.8-39.4%) in the adjuvant chemotherapy and control groups, respectively. The Kaplan-Meier curves for RFS and OS in stage II NSCLC patients are shown in Figure 1.\n\nFigure 1 Recurrence-free survival (A) and overall survival (B) curves in patients with stage II non-small cell lung cancer, comparing those who received adjuvant chemotherapy with those who did not (controls). HR: hazard ratio; and CT: chemotherapy.\n\nPatients with stage III NSCLC who received adjuvant chemotherapy had longer RFS than did those in the control group, the absolute difference in the median RFS between the two groups being approximately 30 months (median RFS: 36.5 months vs. 6.9 months; HR = 0.32; 95% CI: 0.16-0.64; p < 0.001). There was a trend toward longer OS in the adjuvant chemotherapy group in comparison with the control group (median OS: 36.5 months vs. 20.5 months; HR = 0.48; 95% CI: 0.22-1.03; p = 0.060). Five-year OS rates were 37.9% (95% CI: 17.0-58.8%) and 31.8% (95% CI: 10.8-55.4%) in the adjuvant chemotherapy and control groups, respectively. Figure 2 presents the RFS and OS curves for patients with stage III NSCLC.\n\nFigure 2 Recurrence-free survival (A) and overall survival (B) curves in patients with stage III non-small cell lung cancer, comparing those who received adjuvant chemotherapy with those who did not (controls). HR: hazard ratio; and CT: chemotherapy.\n\nPatients who received adjuvant chemotherapy with cisplatin and vinorelbine were compared with controls, and RFS and OS were found to be similar between the two (Figures S1 and S2 in the supplementary material).\n\nSafety\n\nBecause the cisplatin and vinorelbine regimen is considered an acceptable chemotherapy regimen and because it was used by most of the patients who received adjuvant chemotherapy in the present study, the safety profile of this regimen was evaluated. Moreover, previous randomized studies and clinical experience have suggested a high toxicity rate. 4 - 8\n\nOf the patients who received adjuvant chemotherapy with cisplatin and vinorelbine, 49 (89%) experienced grade 3-4 toxicities, hospitalization being required in 27 (49%). Sixteen patients (29%) had grade 3-4 febrile neutropenia. In addition, 5 patients (9%) died of treatment toxicity (grade 5 toxicity; Table 3).\n\nTable 3 Characteristics of the patients who died of adjuvant treatment toxicity.\n\nPatient\tSex\tAge, years\tECOG-PS\tStaging\tChemotherapy regimen\tToxicity\t\n1\tMale\t71\t1\tIIIA\tcisplatin + vinorelbine\tFN\t\n2\tFemale\t61\t0\tIIA\tcisplatin + vinorelbine\tFN + AKI\t\n3\tMale\t70\t1\tIIIA\tcisplatin + vinorelbine\tFN + AKI\t\n4\tMale\t72\t1\tIIB\tcisplatin + vinorelbine\tFN + AKI\t\n5\tMale\t63\t1\tIIB\tcisplatin + vinorelbine\tFN + AKI\t\nPS: performance status; FN: febrile neutropenia; and AKI: acute kidney injury.\n\nTwenty-five patients discontinued the adjuvant cisplatin and vinorelbine regimen, treatment toxicity being the main reason for treatment discontinuation (in 68%). Table 4 summarizes the safety profile of adjuvant cisplatin and vinorelbine regimen in comparison with the safety results of the pivotal ANITA trial. 4\n\nTable 4 Safety profile of adjuvant chemotherapy with cisplatin and vinorelbine in patients with non-small cell lung cancer after surgery.\n\nProfile\tPresent study\tANITA triala\t\nGrade 3-4 toxicity\t89%\tN/A\t\nGrade 5 toxicity\t9%\t2%\t\nGrade 3-4 febrile neutropenia\t29%\t9%\t\nToxicity as reason for chemotherapy discontinuation\t68%\t34%\t\nHospitalization due to toxicity\t49%\tN/A\t\na Results based on Douillard et al. 4 ) ANITA: Adjuvant Navelbine International Trialist Association.\n\nDISCUSSION\n\nOur findings reinforce the survival benefit of adjuvant chemotherapy in patients with NSCLC, both in terms of OS and RFS. A meaningful OS benefit was observed in patients with stage II or III NSCLC. The benefit of adjuvant chemotherapy in NSCLC patients has already been demonstrated in various randomized phase III trials. 4 , 6 - 8 In addition, a meta-analysis evaluating 5,584 patients of five clinical trials showed a 5.4% absolute OS gain with cisplatin-based chemotherapy. Among different chemotherapy regimens, cisplatin plus vinorelbine was marginally better than other drug combinations. Furthermore, the cisplatin-vinorelbine combination was the most commonly used regimen, being the largest (41%) and most homogenous study subgroup. 5 When this regimen was separately analyzed, a significant survival benefit was found (absolute benefit, 8.9% at five years; HR = 0.80; 95% CI: 0.70-0.91; p < 0.001). 9 However, among 6,430 patients of 16 clinical trials included in another meta-analysis, 10 which evaluated the role of adjuvant cisplatin-based chemotherapy in NSCLC patients, an increased risk of non-lung cancer-related deaths was observed in those receiving chemotherapy (relative risk = 1.3, p = 0.002).\n\nMore recently, Kenmotsu et al. 11 evaluated adjuvant cisplatin-pemetrexed vs. cisplatin-vinorelbine in the NSCLC setting, and, although the superiority of the pemetrexed-containing regimen over the vinorelbine-containing regimen was not demonstrated, both regimens had similar RFS and OS, pemetrexed showing better tolerability and less toxicity. Therefore, the benefits and risks associated with cisplatin-based adjuvant chemotherapy should be taken into account. Although predictive biomarkers of OS benefits from adjuvant treatments (chemotherapy and, possibly in the future, immunotherapy and targeted therapies) are of utmost importance for patient selection, they have yet to be identified and validated.\n\nNotably, randomized phase III trials generally enroll a carefully selected population; only a small number of elderly patients are included, with few comorbidities and good performance status, and this does not represent a real-world setting. Therefore, studies addressing real-world evidence are required to evaluate the benefits and risks of the interventions used in clinical trials. 12 . Kolek et al. 13 reported better survival with adjuvant treatment in this setting, with the longest survival in the cisplatin-vinorelbine cohort. Morgensztern et al. 14 presented the results of 19,691 patients with NSCLC and showed a 4.2% treatment-related mortality rate in six months, reinforcing the importance of and need for real-world data.\n\nAnother important issue to be discussed is that, although effectiveness was similar, the incidence of toxicity and hospital admissions was consistently higher in the patients treated with the cisplatin-vinorelbine combination. The outcomes in real-world studies should be carefully analyzed. In the ANITA trial, 4 9% of the patients presented with grade 3-4 febrile neutropenia, and 2% died of treatment-related toxicity, in contrast to a 29% incidence of febrile neutropenia and a 9% mortality rate in our study, which were excessively high for an adjuvant treatment setting. Given that the aim of adjuvant treatment is to improve OS, the difference in the mortality rate between the two studies is noteworthy and potentially exceeds the OS benefit yielded by this treatment. It is of note that 60% of our patients had an ECOG performance status of 1, whereas, in the ANITA trial, 47% had an ECOG performance status of 1, 4 a difference that could explain the higher toxicity observed in our study.\n\nGiven the retrospective nature of the present study, selection bias cannot be ruled out. Chemotherapy was prescribed at the discretion of the physicians involved, and the patients who did not receive adjuvant chemotherapy after surgery could have had a worse prognosis a priori. Nevertheless, an indirect comparison reveals that chemotherapy-treated patients show median OS similar to that seen in historical controls. 4 - 8 Despite the retrospective design and the small sample size, which is prone to treatment bias, our analysis has important strengths. The median cumulative doses of cisplatin and vinorelbine in our study were very similar to those in the ANITA trial. 4 Moreover, our patients were treated at a large cancer center by skilled thoracic oncologists, following standard guidelines and tumor board discussion. These high standards were maintained in patient selection, with 90% of the patients receiving chemotherapy having an ECOG performance status of 0-1. In addition, real-world evidence can validate and extend the results of randomized prospective studies to determine whether they are generalizable. Even regulatory agencies, such as the U.S. Food and Drug Administration, are progressively becoming more interested in data based on real-world evidence. 15\n\nIn conclusion, our study shows that adjuvant chemotherapy improves both OS and RFS in patients with NSCLC in a real-world setting. However, the cisplatin-vinorelbine regimen was not only associated with alarming rates of treatment-related grade 3-4 toxicity but also with a remarkably high risk of treatment-related deaths. Our results endorse the relevance of real-world data to current daily practices and public health policies in patients with NSCLC, especially for treatment with curative intent.\n\nFinancial support: None.\n\n2 Study carrried out at the Instituto do Câncer do Estado de São Paulo, Faculdade de Medicina, Universidade de São Paulo, São Paulo (SP) Brasil.\n==== Refs\nREFERENCES\n\n1 Siegel RL Miller KD Jemal A Cancer statistics, 2020 CA Cancer J Clin 2020 70 1 7 30 10.3322/caac.21590 31912902\n2 Zheng M Classification and Pathology of Lung Cancer Surg Oncol Clin N Am 2016 25 3 447 468 10.1016/j.soc.2016.02.003 27261908\n3 Goldstraw P Chansky K Crowley J Rami-Porta R Asamura H Eberhardt WE The IASLC Lung Cancer Staging Project Proposals for Revision of the TNM Stage Groupings in the Forthcoming (Eighth) Edition of the TNM Classification for Lung Cancer J Thorac Oncol 2016 11 1 39 51 10.1016/j.jtho.2015.09.009 26762738\n4 Douillard JY Rosell R De Lena M Carpagnano F Ramlau R Gonzáles-Larriba JL Adjuvant vinorelbine plus cisplatin versus observation in patients with completely resected stage IB-IIIA non-small-cell lung cancer (Adjuvant Navelbine International Trialist Association [ANITA]) a randomised controlled trial [published correction appears in Lancet Oncol 2006 7 10 797 797 10.1016/S1470-2045(06)70804-X\n5 Pignon JP Tribodet H Scagliotti GV Douillard JY Shepherd FA Stephens RJ Lung adjuvant cisplatin evaluation a pooled analysis by the LACE Collaborative Group J Clin Oncol 2008 26 21 3552 3559 10.1200/JCO.2007.13.9030 18506026\n6 Arriagada R Bergman B Dunant A Le Chevalier T Pignon JP Vansteenkiste J Cisplatin-based adjuvant chemotherapy in patients with completely resected non-small-cell lung cancer N Engl J Med 2004 350 4 351 360 10.1056/NEJMoa031644 14736927\n7 Scagliotti GV Fossati R Torri V Crinò L Giaccone G Silvano G Randomized study of adjuvant chemotherapy for completely resected stage I, II, or IIIA non-small-cell Lung cancer J Natl Cancer Inst 2003 95 19 1453 1461 10.1093/jnci/djg059 14519751\n8 Winton T Livingston R Johnson D Rigas J Johnston M Butts C Vinorelbine plus cisplatin vs observation in resected non-small-cell lung cancer N Engl J Med 2005 352 25 2589 2597 10.1056/NEJMoa043623 15972865\n9 Douillard JY Tribodet H Aubert D Shepherd FA Rosell R Ding K Adjuvant cisplatin and vinorelbine for completely resected non-small cell lung cancer subgroup analysis of the Lung Adjuvant Cisplatin Evaluation J Thorac Oncol 2010 5 2 220 228 10.1097/JTO.0b013e3181c814e7 20027124\n10 Petrelli F Barni S Non-cancer-related mortality after cisplatin-based adjuvant chemotherapy for non-small cell lung cancer a study-level meta-analysis of 16 randomized trials Med Oncol 2013 30 3 641 641 10.1007/s12032-013-0641-5 23813019\n11 Kenmotsu H Yamamoto N Yamanaka T Yoshiya K Takahashi T Ueno T Randomized Phase III Study of Pemetrexed Plus Cisplatin Versus Vinorelbine Plus Cisplatin for Completely Resected Stage II to IIIA Nonsquamous Non-Small-Cell Lung Cancer J Clin Oncol 2020 38 19 2187 2196 10.1200/JCO.19.02674 32407216\n12 de Lusignan S Crawford L Munro N Creating and using real-world evidence to answer questions about clinical effectiveness J Innov Health Inform 2015 22 3 368 373 10.14236/jhi.v22i3.177 26577427\n13 Kolek V Losse S Kultan J Jakubec P Jaromir Z Sova M Real life adjuvant chemotherapy uptake and survival in patients with non-small cell lung cancer after complete resection Curr Med Res Opin 2018 34 9 1687 1694 10.1080/03007995.2018.1490254 29912578\n14 Morgensztern D Samson PS Waqar SN Devarakonda S Robinson CG Govindan R Early Mortality in Patients Undergoing Adjuvant Chemotherapy for Non-Small Cell Lung Cancer J Thorac Oncol 2018 13 4 543 549 10.1016/j.jtho.2018.01.010 29410127\n15 Sherman RE Anderson SA Dal Pan GJ Gray GW Gross T Hunter NL Real-World Evidence - What Is It and What Can It Tell Us N Engl J Med 2016 375 23 2293 2297 10.1056/NEJMsb1609216 27959688\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1806-3713",
"issue": "47(3)",
"journal": "Jornal brasileiro de pneumologia : publicacao oficial da Sociedade Brasileira de Pneumologia e Tisilogia",
"keywords": null,
"medline_ta": "J Bras Pneumol",
"mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D002289:Carcinoma, Non-Small-Cell Lung; D017024:Chemotherapy, Adjuvant; D002945:Cisplatin; D006801:Humans; D008175:Lung Neoplasms; D009367:Neoplasm Staging; D012189:Retrospective Studies; D000077235:Vinorelbine",
"nlm_unique_id": "101222274",
"other_id": null,
"pages": "e20200378",
"pmc": null,
"pmid": "33656100",
"pubdate": "2021",
"publication_types": "D016428:Journal Article",
"references": "32407216;23813019;20027124;16945766;27959688;26577427;15972865;27261908;29912578;31912902;29410127;18506026;14736927;14519751;26762738",
"title": "Effectiveness and toxicity of adjuvant chemotherapy in patients with non-small cell lung cancer.",
"title_normalized": "effectiveness and toxicity of adjuvant chemotherapy in patients with non small cell lung cancer"
} | [
{
"companynumb": "BR-ACCORD-219802",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CISPLATIN"
},
"drugadditional": null,
"druga... |
{
"abstract": "Spinal dural arteriovenous fistula (DAVF) is an acquired vascular malformation of the spinal cord that presents as a congestive myelopathy resulting from venous hypertension, edema, and ischemia within the cord. Acute clinical exacerbations have been demonstrated in a variety of clinical settings. We report a unique presentation of a 45-year-old male with progressive paraplegia that acutely worsened following three independent treatments with oral and intravenous steroid administration. Spinal angiogram revealed a spinal DAVF at L3 and the patient underwent successful surgical repair. This report highlights the clinical presentation of spinal DAVF and emphasizes the unique and important potential relationship between steroid administration and clinical deterioration.",
"affiliations": "Department of Neurology, Wake Forest Baptist Health, Medical Center Boulevard, Winston Salem, NC 27157, USA. rstrowd@wfubmc.edu",
"authors": "Strowd|Roy E|RE|;Geer|Carol|C|;Powers|Alexander|A|;Abou-Zeid|Nuhad|N|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D013256:Steroids; D011241:Prednisone",
"country": "Scotland",
"delete": false,
"doi": "10.1016/j.jocn.2011.07.027",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0967-5868",
"issue": "19(3)",
"journal": "Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia",
"keywords": null,
"medline_ta": "J Clin Neurosci",
"mesh_terms": "D000707:Anaphylaxis; D000792:Angiography; D000818:Animals; D000893:Anti-Inflammatory Agents; D001164:Arteriovenous Fistula; D004388:Dura Mater; D004576:Electromyography; D005512:Food Hypersensitivity; D006801:Humans; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D009460:Neurologic Examination; D020335:Paraparesis; D011241:Prednisone; D017747:Seafood; D013122:Spinal Diseases; D013256:Steroids; D014656:Vascular Surgical Procedures",
"nlm_unique_id": "9433352",
"other_id": null,
"pages": "466-8",
"pmc": null,
"pmid": "22249021",
"pubdate": "2012-03",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "A unique presentation of a spinal dural arteriovenous fistula exacerbated by steroids.",
"title_normalized": "a unique presentation of a spinal dural arteriovenous fistula exacerbated by steroids"
} | [
{
"companynumb": "US-MYLANLABS-2016M1058751",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "3",
... |
{
"abstract": "Central nervous system (CNS) relapse is a critical issue while treating Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph-positive ALL). A 58-year-old woman with Ph-positive ALL who relapsed after bone marrow transplantation for meningeal leukemia was treated with high-dose methotrexate, which resulted in remission. She underwent allogeneic cord blood transplantation followed by reduced intensity conditioning chemotherapy with imatinib; however, she experienced CNS relapse and developed an extramedullary mass on the right side of the temporal region. We treated 40 mg of dasatinib once daily, which had to be temporarily discontinued because she developed grade 2 pleural effusion and grade 2 hematemesis. After reinitiation of dasatinib, the extramedullary mass disappeared and meningeal leukemia ameliorated almost immediately. With 40 mg dasatinib administered once daily, its trough level and cerebrospinal fluid (CSF) concentration were 32 ng/mL and below the sensitivity threshold of 1 ng/mL, respectively. Treatment was continued, and the patient remained in complete remission until she died of pneumonia 7 years after the initial diagnosis of ALL. Dasatinib can be an effective treatment for Ph-positive ALL with CNS relapse. Although the concentration in the CSF seems low, it may be sufficient to exert anti-leukemic effects in the human CNS.",
"affiliations": "Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Department of Clinical Pharmaceutics, Faculty of Pharmaceutical Sciences, Doshisha Women's College of Liberal Arts, Kodo, Kyotanabe, Kyoto, 610-0395 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Department of Clinical Pharmaceutics, Faculty of Pharmaceutical Sciences, Doshisha Women's College of Liberal Arts, Kodo, Kyotanabe, Kyoto, 610-0395 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.;Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan.",
"authors": "Kondo|Toshinori|T|;Tasaka|Taizo|T|;Matsumoto|Kana|K|;Matsumoto|Rui|R|;Koresawa|Lisa|L|;Sano|Fuminori|F|;Tokunaga|Hirotoshi|H|;Matsuhashi|Yoshiko|Y|;Nakanishi|Hidekazu|H|;Morita|Kunihiko|K|;Wada|Hideho|H|;Sugihara|Takashi|T|",
"chemical_list": null,
"country": "Switzerland",
"delete": false,
"doi": "10.1186/2193-1801-3-177",
"fulltext": "\n==== Front\nSpringerplusSpringerplusSpringerPlus2193-1801Springer International Publishing Cham 90310.1186/2193-1801-3-177Case StudyPhiladelphia chromosome-positive acute lymphoblastic leukemia with extramedullary and meningeal relapse after allogeneic hematopoietic stem cell transplantation that was successfully treated with dasatinib Kondo Toshinori kondot@med.kawasaki-m.ac.jp Tasaka Taizo taizo@med.kawasaki-m.ac.jp Matsumoto Kana kmatsumo@dwc.doshisha.ac.jp Matsumoto Rui ruiko@med.kawasaki-m.ac.jp Koresawa Lisa lisa.lisa.lisa.0412@gmail.com Sano Fuminori s.fuminori@gmail.com Tokunaga Hirotoshi tokusan@med.kawasaki-m.ac.jp Matsuhashi Yoshiko matsuhashi@med.kawasaki-m.ac.jp Nakanishi Hidekazu nakanisi@med.kawasaki-m.ac.jp Morita Kunihiko kmorita@dwc.doshisha.ac.jp Wada Hideho hideho@med.kawasaki-m.ac.jp Sugihara Takashi sugit@med.kawasaki-m.ac.jp Division of Hematology, Kawasaki Medical School, 577, Matsushima, Kurashiki, Okayama, 701-0192 Japan Department of Clinical Pharmaceutics, Faculty of Pharmaceutical Sciences, Doshisha Women’s College of Liberal Arts, Kodo, Kyotanabe, Kyoto, 610-0395 Japan 5 4 2014 5 4 2014 2014 3 17726 11 2013 17 3 2014 © Kondo et al.; licensee Springer. 2014This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (\nhttp://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.Central nervous system (CNS) relapse is a critical issue while treating Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph-positive ALL). A 58-year-old woman with Ph-positive ALL who relapsed after bone marrow transplantation for meningeal leukemia was treated with high-dose methotrexate, which resulted in remission. She underwent allogeneic cord blood transplantation followed by reduced intensity conditioning chemotherapy with imatinib; however, she experienced CNS relapse and developed an extramedullary mass on the right side of the temporal region. We treated 40 mg of dasatinib once daily, which had to be temporarily discontinued because she developed grade 2 pleural effusion and grade 2 hematemesis. After reinitiation of dasatinib, the extramedullary mass disappeared and meningeal leukemia ameliorated almost immediately. With 40 mg dasatinib administered once daily, its trough level and cerebrospinal fluid (CSF) concentration were 32 ng/mL and below the sensitivity threshold of 1 ng/mL, respectively. Treatment was continued, and the patient remained in complete remission until she died of pneumonia 7 years after the initial diagnosis of ALL. Dasatinib can be an effective treatment for Ph-positive ALL with CNS relapse. Although the concentration in the CSF seems low, it may be sufficient to exert anti-leukemic effects in the human CNS.\n\nKeywords\nPhiladelphia chromosome-positive acute lymphoblastic leukemiaMeningeal leukemiaExtramedullary relapseHematopoietic stem cell transplantationDasatinibissue-copyright-statement© The Author(s) 2014\n==== Body\nBackground\nPhiladelphia chromosome-positive acute lymphoblastic leukemia (Ph-positive ALL) is a serious hematological malignancy that usually requires combination chemotherapy to achieve complete remission. Patients with Ph-positive ALL often develop resistance to chemotherapy, which leads to relapse and death. Even with intensive consolidation and maintenance therapies, many patients who achieve remission relapse after a short period of time. Previous studies on Ph-positive ALL patients reported a median disease-free survival (DFS) and 3-year DFS rate of 8.7 months and 24%, respectively, while the 5-year overall survival (OS) rate remained low at 24%–34% (Yanada et al. \n2009; Iida et al. \n2004; Thomas et al. \n2004). Adult ALL patients rarely present with meningeal leukemia at initial diagnosis (only approximately 5% of ALL patients), and central nervous system (CNS) relapse occurs in 5%–10% patients who receive routine CNS-directed prophylactic therapy (Lazarus et al. \n2006; Pfeifer et al. \n2003). The outcome of patients with meningeal leukemia is worse than that of patients without, despite CNS-directed therapy (Lazarus et al. \n2006). In recent years, the oral tyrosine kinase inhibitors (TKIs) imatinib and dasatinib have been prescribed for the treatment of relapsed Ph-positive ALL after hematopoietic stem cell transplantation (HSCT) (Ishida et al. \n2010; Czyz et al. \n2010; Millot et al. \n2009; Takami et al. \n2006). TKI combined with conventional chemotherapy and incorporated into the transplantation strategy has improved the long-term survival of patients with Ph-positive ALL and has allowed the de-escalation of chemotherapy. This combination treatment strategy has prolonged DFS and OS (Thyagu et al. \n2012; Tanguy-Schmidt et al. \n2013) beyond the current rates. Dasatinib is an active agent in heavily pretreated Ph-positive ALL patients, including those who have undergone prior HSCT or those who have been treated previously with imatinib-containing therapy (Takami et al. \n2006; Sakamaki et al. \n2009; Ottmann et al. \n2007; Tachibana et al. \n2011). Dasatinib appears to reach the cerebrospinal fluid (CSF) better than other TKIs according to recent reports that claimed stabilization and regression of CNS disease in a small series of patients (Alimena et al. \n2009; Porkka et al. \n2008; Abdelhalim et al. \n2007). The CSF concentration of dasatinib after oral administration in humans is poorly understood. Here we describe the case of a Ph-positive ALL patient who developed extramedullary relapse with CNS involvement after imatinib-based treatment and subsequent HSCT. The patient exhibited a complete response to dasatinib-based therapy, which resulted in long-term survival. We also investigated the dasatinib concentrations in this patient’s plasma and CSF.\n\nCase description\nA 58-year-old woman presented with loss of appetite and general fatigue. Blood examination revealed marked leukocytosis (37.6 × 109/L) with 81.5% lymphoblasts. Bone marrow aspiration showed that 95% lymphoblastic cells were positive for B-cell markers, including CD10, CD19, CD34, and human leukocyte antigen (HLA)-DR, while cytogenetic analysis reported a complex karyotype including t(9;22) (q34;q11). Real-time quantitative polymerase chain reaction (RT-qPCR) detected 3.1 × 105 copies/μg of RNA p210 bcr-abl transcripts in the marrow specimen. The patient was diagnosed with Ph-positive precursor B-cell ALL in April 2005, when imatinib-combined induction therapy was initiated (Yanada et al. \n2006).\n\nShe exhibited complete hematological and cytogenetic responses, and bcr-abl transcripts were negative according to RT-qPCR. In July 2005, after receiving high-dose methotrexate (MTX) therapy as CNS prophylaxis, she underwent bone marrow transplantation (BMT) using an allogeneic bone marrow graft from an HLA-matched sibling donor after a conditioning regimen with fludarabine (25 mg/m2/day for 5 days), busulfan (2mg/kg/day for 2 days), and melphalan (80 mg/m2/day for 1 day). Cyclosporine A and short-term MTX were used as prophylaxis against graft-versus-host disease (GVHD). The patient exhibited rapid and sustained engraftment, with a neutrophil count higher than 0.5 × 109/L and a platelet count higher than 50 × 109/L on day +16. However, 3 months after BMT, she relapsed with meningeal leukemia, despite being treated with prophylactic intrathecal chemotherapy before BMT. She was subsequently administered high-dose MTX therapy and 6 cycles of MTX-based intrathecal chemotherapy. This regimen eliminated lymphoblastic cells from her CSF, but 1.6 × 105 copies/μg of RNA p210 bcr-abl transcripts were still detected in her marrow blood. In July 2006, she underwent allogeneic cord blood transplantation (CBT) after a conditioning regimen that included fludarabine (30 mg/m2/day for 5 days), cytarabine (1.5 g/m2/day for 4 days), melphalan (80 mg/m2/day for 1 day), and total body irradiation with 4 Gy. Prophylaxis against GVHD was performed with continuous infusion of tacrolimus.\n\nNeutrophil engraftment was observed on day +18, but acute GVHD was not observed. The patient developed a limited type of chronic GVHD on day +165; nevertheless, she responded well to treatment with prednisolone. However, 7 months after CBT, she relapsed again, developing meningeal leukemia accompanied by headache. Imatinib and intrathecal chemotherapies were initiated again, and whole-brain irradiation (24 Gy in total) was added to her treatment regimen. She achieved remission, and imatinib therapy was continued to prevent CNS relapse. In April 2009, she again complained of headache, and cranial magnetic resonance imaging revealed an extramedullary mass on the right side of the temporal region (Figure \n1a).Figure 1 \nMRI images of the head. a The extra-medullary mass of right temporal region before dasatinib treatment. b Forty-six days after initial dasatinib treatment.\n\n\n\nThe clinical course of the patient after relapse is shown in Figure \n2. Because of molecular resistance against imatinib, the patient was treated with 100 mg of dasatinib daily and was administered 2 cycles of intrathecal chemotherapy. While on dasatinib therapy, the patient, despite receiving adequate supportive therapy, experienced grade 2 pleural effusion and grade 2 hematemesis according to the National Cancer Institute Common Terminology Criteria (NCI-CTC). Dasatinib was discontinued because of these adverse events and reinitiated at a daily dose of 40 mg once she recovered. The extramedullary mass in her temporal region disappeared (Figure \n1b), and meningeal leukemia was ameliorated almost immediately. During the course of treatment, we investigated the dasatinib concentrations in the patient’s plasma and CSF using high-performance liquid chromatography coupled with electrospray mass spectrometry (HPLC-MS) as described previously (De Francia et al. \n2009), albeit with some modifications. The trough level and CSF concentration of dasatinib administered at a daily dose of 40 mg were 32 ng/mL and below the sensitivity threshold of 1 ng/mL, respectively. Two months after the initiation of dasatinib treatment, large granular lymphocytosis was observed in the peripheral blood. These large granular lymphocytes were CD3, CD8, CD56, and CD57 positive, and PCR revealed an oligoclonal pattern of T-cell receptor gene rearrangement (data not shown). Until April 2011, the patient remained in complete remission while taking 40 mg of dasatinib once daily; however, meningeal relapse was revealed after close investigation of vertigo. Bone marrow examination showed the presence of 73 copies/μg of RNA p210 bcr-abl transcripts that were detected by RT-qPCR. In addition, the lymphoblasts in her CSF harbored an E255K ABL tyrosine kinase domain mutation, which is known to be moderately resistant to both dasatinib and nilotinib. On the basis of these results, we increased the dose of dasatinib to 100 mg once daily and administered one cycle of intrathecal chemotherapy. Three weeks after the initiation of this treatment, the patient achieved complete molecular remission in the bone marrow, and lymphoblasts were undetectable in the CSF. Seven years after the initial diagnosis of Ph-ALL, the patient died of pneumonia. Until the time of her death, no evidence of ALL recurrence was observed.Figure 2 \nClinical course of the patient after diagnosis. X-axis shows months after diagnosis. MTX; methotrexate, BMT; allogeneic bone marrow transplantation, CBT; allogeneic cord blood transplantation, cGVHD; chronic graft versus host disease.\n\n\n\nDiscussion and Evaluation\nCNS leukemia in patients with adult ALL is an uncommon finding at initial diagnosis, affecting only approximately 5% of adult ALL patients. The 5-year OS rate of these patients is lower than that of adult ALL patients without CNS leukemia (29% vs 35%, respectively) (Lazarus et al. \n2006), and allogeneic HSCT is considered the only curative option for these high-risk patients. However, relapse remains the main cause of treatment failure. The relapse rate of ALL patients with CNS leukemia who achieve complete remission after allogeneic HSCT was reported to be approximately 20%. A third of these patients develop recurrent CNS leukemia if they relapse (Lazarus et al. \n2006). Although relapse after HSCT, particularly in the CNS, is a major problem in the management of Ph-positive ALL, effective therapeutic modalities for the prevention of CNS relapse have not been established till date. We observed the long-term survival of a patient with Ph-positive ALL who had been treated with dasatinib for relapsed meningeal leukemia after HSCT. Recently, encouraging reports for the treatment of Ph-positive ALL with TKIs combined with chemotherapy or HSCT were published (Ishida et al. \n2010; Czyz et al. \n2010; Millot et al. \n2009; Takami et al. \n2006; Thyagu et al. \n2012; Tanguy-Schmidt et al. \n2013; Sakamaki et al. \n2009; Ottmann et al. \n2007; Tachibana et al. \n2011; Abdelhalim et al. \n2007; Yanada et al. \n2006; Nishii et al. \n2007; Foa et al. \n2011). These reports suggest that dasatinib has strong anti-leukemic activity against Ph-positive ALL, without the prevention of donor hematopoiesis. Therefore, the use of dasatinib as salvage therapy as well as prophylaxis against relapse may be effective for Ph-positive ALL patients who undergo allogeneic HSCT. Dasatinib has been shown to be effective in the treatment of extramedullary leukemia with CNS involvement in Ph-positive leukemia patients (Alimena et al. \n2009; Abdelhalim et al. \n2007). Porkka et al. reported that dasatinib exerts antitumor effects in a mouse model of intracranial chronic myeloid leukemia and that this drug has substantial benefits for patients with CNS Ph-positive leukemia (Porkka et al. \n2008). Dasatinib is thought to penetrate the blood–brain barrier better than imatinib, and this can result in dasatinib having better antileukemic effects against CNS leukemia compared with imatinib. In addition, dasatinib is active at lower concentrations (Porkka et al. \n2008), and because the CSF has a lower protein concentration compared with blood, this drug is likely to exist as a free drug in the CNS. However, few reports have examined the concentration of dasatinib in human CSF samples (Porkka et al. \n2008). The concentrations of dasatinib in our patient’s plasma and CSF were 32 ng/mL and less than the sensitivity threshold value, respectively, when she was treated with a daily dose of 40 mg. The plasma concentration of 32 ng/mL at trough was higher than that previously reported (Wang et al. \n2013), and the discrepancy may be caused by the companion agents administered to our patient, such as azoles, which interfere with the metabolism of dasatinib. Previous studies reported that the dasatinib concentration in the CSF varies between 5% and 28% of the plasma concentration (Porkka et al. \n2008). At the oral dasatinib dose of 140 mg once daily or 70 mg twice daily, the CNS concentration was undetectable in 87% patients, even if the samples were collected in the absorptive phase, that is, at 1–4 h after consuming the drug (Porkka et al. \n2008). The undetectable dasatinib concentration in the CNS fluid in our patient may indicate a low concentration and an inadequate sampling time at trough. Careful considerations for the timing of sampling of CNS specimens should be made in future studies. Taken together, these results suggest that the concentration of dasatinib in the CSF is usually maintained in a low range, but this low concentration may be enough to exert an anti-leukemic effect in the human CNS. The validity of prophylactic or preemptive therapy with dasatinib after allogeneic HSCT for Ph-positive ALL remains unclear. Till date, 2 studies, each with a small number of cases, have reported encouraging results (Caocci et al. \n2012; Teng et al. \n2013), suggesting that dasatinib is highly effective in preventing molecular relapse and eradicating Ph-positive ALL after HSCT. At least, prophylactic and preemptive dasatinib therapy should be considered for high-risk patients who do not exhibit molecular responses before or after HSCT and for patients who have extramedullary leukemia with CNS involvement at the time of diagnosis. Prospective and randomized studies aiming to identify the appropriate dasatinib treatment regimen for Ph-positive ALL after allogeneic HSCT are required.\n\nConclusion\nDasatinib can be an effective treatment for Ph-positive ALL with CNS relapse.\n\nConsent\nWritten informed consent was obtained from the patient for the publication of this report and any accompanying images.\n\nCompeting interests\n\nThe authors declare that they have no conflicts of interest.\n\nAuthors’ contributions\n\nKM and KM carried out the measurement of dasatinib concentration. FS, LK, RM and HT drafted the case description. HN, HW and TS participated in the discussion part of the manuscript. YM edited the manuscript. TK and TT participated for the design and concept of this manuscript also drafting and editing of the manuscript. All authors read and approved the final manuscript.\n==== Refs\nReferences\nAbdelhalim A Barcos M Block AW Sait SN Starostik P Wetzler M Wang ES Remission of Philadelphia chromosome-positive central nervous system leukemia after dasatinib therapy Leuk Lymphoma 2007 48 1053 1056 10.1080/10428190701258370 17487757 \nAlimena G Breccia M Latagliata R Grammatico S Matturro A Capria S De Propris MS Diverio D Meloni G Dasatinib in the management of lymphoid blast crisis of Philadelphia-positive chronic myeloid leukemia with multiple extra-medullary and intracranial localization Leuk Res 2009 33 e134 e136 10.1016/j.leukres.2009.02.018 19286256 \nCaocci G Vacca A Ledda A Murgia F Piras E Greco M Arras M Atzeni S Littera R La Nasa G Prophylactic and preemptive therapy with dasatinib after hematopoietic stem cell transplantation for Philadelphia chromosome-positive acute lymphoblastic leukemia Biol Blood Marrow Transplant 2012 18 652 654 10.1016/j.bbmt.2011.12.587 22240733 \nCzyz A Lewandowski K Kroll R Komarnicki M Dasatinib-induced complete molecular response after allogeneic hematopoietic stem cell transplantation in Philadelphia chromosome-positive acute lymphoblastic leukemia resistant to prior imatinib-containing regimen: a case report and discussion Med Oncol 2010 27 1123 1126 10.1007/s12032-009-9347-0 19885746 \nDe Francia S D’Avolio A De Martino F Pirro E Baietto L Siccardi M Simiele M Racca S Saglio G Di Carlo F Di Perri G New HPLC-MS method for the simultaneous quantification of the antileukemia drugs imatinib, dasatinib, and nilotinib in human plasma J Chromatogr B Analyt Technol Biomed Life Sci 2009 877 1721 1726 10.1016/j.jchromb.2009.04.028 \nFoa R Vitale A Vignetti M Meloni G Guarini A Propris MS Elia L Paoloni F Fazi P Cimino G Nobile F Ferrara F Castagnola C Sica S Leoni P Zuffa E Fozza C Luppi M Candoni A Iacobucci I Soverini S Mandelli F Martinelli G Baccarani M GIMEMA Acute Leukemia Working Party Dasatinib as first-line treatment for adult patients with Philadelphia chromosome-positive acute lymphoblastic leukemia Blood 2011 118 6521 6528 10.1182/blood-2011-05-351403 21931113 \nIida H Sao H Kitaori K Gotoh S Yazaki M Kojima S Wakita A Morishima Y Kodera Y Morishita Y Twenty Years’ Experience in Allogeneic Hematopoietic Stem Cell Transplantation for Philadelphia Chromosome–Positive Acute Lymphoblastic Leukemia in the Nagoya Blood and Marrow Transplantation Group Int J Hematol 2004 79 79 84 10.1007/BF02983538 14979483 \nIshida Y Terasako K Oshima K Sakamoto K Ashizawa M Sato M Kikuchi M Kimura S Nakasone H Okuda S Kako S Yamazaki R Nishida J Kanda Y Dasatinib followed by second allogeneic hematopoietic stem cell transplantation for relapse of Philadelphia chromosome-positive acute lymphoblastic leukemia after the first transplantation Int J Hematol 2010 92 542 546 10.1007/s12185-010-0678-6 20824399 \nLazarus HM Richards SM Chopra R Litzow MR Burnett AK Wiernik PH Franklin IM Tallman MS Cook L Buck G Durrant IJ Rowe JM Goldstone AH Medical Research Council (MRC)/National Cancer Research Institute (NCRI) Adult Leukaemia Working Party of the United Kingdom and the Eastern Cooperative Oncology Group. Central nervous system involvement in adult acute lymphoblastic leukemia at diagnosis: results from the international ALL trial MRC UKALL XII/ECOG E2993 Blood 2006 108 465 472 10.1182/blood-2005-11-4666 16556888 \nMillot F Cividin M Brizard F Chomel JC Méchinaud F Guilhot F Successful second allogeneic stem cell transplantation in second remission induced by dasatinib in a child with Philadelphia chromosome positive acute lymphoblastic leukemia Pediatr Blood Cancer 2009 52 891 892 10.1002/pbc.21938 19202569 \nNishii K Sakakura M Tsukada T Ryuu H Katayama N Successful Treatment with Imatinib Combined with Less Intensive Chemotherapy (Vincristine and Dexamethasone) as Induction Therapy in a Very Elderly Patient with Philadelphia Chromosome–Positive Acute Lymphoblastic Leukemia Int J Hematol 2007 85 273 274 10.1532/IJH97.06216 17483068 \nOttmann O Dombret H Martinelli G Simonsson B Guilhot F Larson RA Rege-Cambrin G Radich J Hochhaus A Apanovitch AM Gollerkeri A Coutre S Dasatinib induces rapid hematological and cytogenetic responses in adult patients with Philadelphia chromosome-positive acute lymphoblastic leukemia with resistance or intolerance to imatinib : Interim results of a phase 2 study Blood 2007 110 2309 2315 10.1182/blood-2007-02-073528 17496201 \nPfeifer H Wassmann B Hofmann WK Komor M Scheuring U Brück P Binckebanck A Schleyer E Gökbuget N Wolff T Lübbert M Leimer L Gschaidmeier H Hoelzer D Ottmann OG Risk and Prognosis of Central Nervous System Leukemia in Patients with Philadelphia Chromosome-Positive Acute Leukemias Treated with Imatinib Mesylate Clinical Cancer Research 2003 9 4674 4681 14581336 \nPorkka K Koskenvesa P Lundán T Rimpiläinen J Mustjoki S Smykla R Wild R Luo R Arnan M Brethon B Eccersley L Hjorth-Hansen H Höglund M Klamova H Knutsen H Parikh S Raffoux E Gruber F Brito-Babapulle F Dombret H Duarte RF Elonen E Paquette R Zwaan CM Lee FY Dasatinib crosses the blood–brain barrier and is an efficient therapy for central nervous system Philadelphia chromosome-positive leukemia Blood 2008 112 1005 1012 10.1182/blood-2008-02-140665 18477770 \nSakamaki H Ishizawa K Taniwaki M Fujisawa S Morishima Y Tobinai K Okada M Ando K Usui N Miyawaki S Utsunomiya A Uoshima N Nagai T Naoe T Motoji T Jinnai I Tanimoto M Miyazaki Y Ohnishi K Iida S Okamoto S Seriu T Ohno R Phase 1/2 clinical study of dasatinib in Japanese patients with chronic myeloid leukemia or Philadelphia chromosome-positive acute lymphoblastic leukemia Int J Hematol 2009 89 332 341 10.1007/s12185-009-0260-2 19263190 \nTachibana T Numata A Tanaka M Motohashi K Gujisawa S Fujita H Sakai R Tomita N Maruta A Ishigatsubo Y Kanamori H Successful treatment with dasatinib and allogeneic peripheral blood stem cell transplant for imatinib-resistant Philadelphia chromosome-positive acute lymphoblastic leukemia relapsing after bone marrow transplant and donor lymphocyte infusion Leuk Lymphoma 2011 52 1376 1379 10.3109/10428194.2011.566395 21438838 \nTakami A Shimadoi S Sugimori C Takemoto K Shibayama M Yoshida T Murayama T Nagai K Miyamura K Asakura H Nakao S Successful treatment of minimal residual disease–positive Philadelphia chromosome–positive acute lymphoblastic leukemia with imatinib followed by reduced-intensity unrelated cord blood transplantation after allogeneic peripheral blood stem cell transplantation Int J Hematol 2006 84 170 173 10.1532/IJH97.06066 16926141 \nTanguy-Schmidt A Rousselot P Chalandon Y Cayuela JM Hayette S Vekemans MC Escoffre M Huguet F Réa D Delannoy A Cahn JY Vernant JP Ifrah N Dombret H Thomas X Long-term follow-up of the imatinib GRAAPH-2003 study in newly diagnosed patients with de novo Philadelphia chromosome-positive acute lymphoblastic leukemia: a GRAALL study Biol Blood Marrow Transpl 2013 19 150 155 10.1016/j.bbmt.2012.08.021 \nTeng CL Yu JT Chen HC Hwang WL Maintenance therapy with dasatinib after allogeneic hematopoietic stem cell transplantation in Philadelphia chromosome-positive acute lymphoblastic leukemia Ann Hematol 2013 11 1137 1139 10.1007/s00277-012-1670-4 23307602 \nThomas X Boiron JM Huguet F Dombret H Bradstock K Vey N Kovacsovics T Delannoy A Fegueux N Fenaux P Stamatoullas A Vernant JP Tournilhac O Buzyn A Reman O Charrin C Boucheix C Gabert J Lhéritier V Fiere D Outcome of Treatment in Adults With Acute Lymphoblastic Leukemia: Analysis of the LALA-94 Trial J Clin Oncol 2004 20 4075 4086 10.1200/JCO.2004.10.050 15353542 \nThyagu S Minden MD Gupta V Yee KW Schimmer AD Schuh AC Lipton JH Messner HA Xu W Brandwein JM Treatment of Philadelphia chromosome-positive acute lymphoblastic leukaemia with imatinib combined with a paediatric-based protocol Br J Haematol 2012 158 506 514 10.1111/j.1365-2141.2012.09182.x 22650180 \nWang X Roy A Hochhaus A Kantarjian HM Chen TT Shah NP Differential effects of dosing regimen on the safety and efficacy of dasatinib: retrospective exposure-response analysis of a Phase III study Clin Pharmacol 2013 10 5 85 97 23788844 \nYanada M Takeuchi J Sugiura I Akiyama H Usui N Yagasaki F Kobayashi T Ueda Y Takeuchi M Miyawaki S Maruta A Emi N Miyazaki Y Ohtake S Jinnai I Matsuo K Naoe T Ohno R Japan Adult Leukemia Study Group High complete remission rate and promising outcome by combination of imatinib and chemotherapy for newly diagnosed BCR–ABL-positive acute lymphoblastic leukemia: a phase II study by the Japan Adult Leukemia Study Group J Clin Oncol 2006 24 460 466 10.1200/JCO.2005.03.2177 16344315 \nYanada M Ohno R Naoe T Recent advances in the treatment of Philadelphia chromosome-positive acute lymphoblastic leukemia Int J Hematol 2009 89 3 13 10.1007/s12185-008-0223-z 19093166\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2193-1801",
"issue": "3()",
"journal": "SpringerPlus",
"keywords": "Dasatinib; Extramedullary relapse; Hematopoietic stem cell transplantation; Meningeal leukemia; Philadelphia chromosome-positive acute lymphoblastic leukemia",
"medline_ta": "Springerplus",
"mesh_terms": null,
"nlm_unique_id": "101597967",
"other_id": null,
"pages": "177",
"pmc": null,
"pmid": "24790822",
"pubdate": "2014",
"publication_types": "D016428:Journal Article",
"references": "23307602;19286256;16556888;19263190;14979483;17487757;17483068;22240733;19202569;16344315;16926141;15353542;14581336;17496201;23788844;20824399;22650180;21931113;18477770;22960387;21438838;19093166;19428316;19885746",
"title": "Philadelphia chromosome-positive acute lymphoblastic leukemia with extramedullary and meningeal relapse after allogeneic hematopoietic stem cell transplantation that was successfully treated with dasatinib.",
"title_normalized": "philadelphia chromosome positive acute lymphoblastic leukemia with extramedullary and meningeal relapse after allogeneic hematopoietic stem cell transplantation that was successfully treated with dasatinib"
} | [
{
"companynumb": "PHHY2015JP104710",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUDARABINE PHOSPHATE"
},
"drugadditional": null,
... |
{
"abstract": "A few direct antiviral agents have been studied in difficult-to-treat patients infected by hepatitis C virus (HCV) genotype 4 (GT4). The efficacy of daclatasvir (DCV), asunaprevir (ASV), pegylated interferon and ribavirin (Peg-IFN/RBV) association was investigated in these patients.\n\n\n\nThis open-label, single-arm, phase 2 study was conducted in HCV GT4 patients who were null or partial responders to Peg-IFN/RBV. Patients received 24 weeks of DCV (60 mg, once daily), ASV (100 mg, twice daily) and Peg-IFN/RBV. The primary endpoint was sustained virologic response at post-treatment week 12 [sustained virologic response (SVR)12].\n\n\n\nSixty patients were included; 45 (75%) were previous null responders and 27 (45%) had cirrhosis. The most frequent subtypes were GT4a (48%) and GT4d (27%) with 25% of the patients being infected with other subtypes such as 4c, 4r, 4f, 4k, 4j and 4q. The global SVR12 was 95% (90% confidence interval: 90.4-99.6) and 96.3% (90% confidence interval: 87.5-99.5) in cirrhotic patients. All patients achieving SVR12 also achieved SVR24. Previous Peg-IFN/RBV response, IL28b genotype, cirrhosis status or GT4 subtypes did not influence SVR12 rates. Serious adverse events occurred in 13% of the patients, four being cirrhotic and four noncirrhotic. Three (5%) patients stopped HCV therapy prematurely: one because of virologic breakthrough and two because of serious adverse events. Grade 3/4 laboratory abnormalities included leukopenia (33%), neutropenia (27%), thrombocytopenia (4%) and transaminases increase (2%).\n\n\n\nAssociation of DCV plus ASV and peg-IFN/RBV for 24 weeks demonstrated a high rate of SVR12 in HCV GT4-infected prior nonresponders, independently of the cirrhotic status or the GT4 subtype. The safety profile was acceptable, even in cirrhotic patients.",
"affiliations": "Hepatology Unit.;Virology Department.;Pharmacology Unit, Pontchaillou Hospital.;Hepatology Department, Cochin Hospital, Paris.;Hepatology Department, Brabois Hospital, Nancy.;Hepatology Department, Beaujon Hospital, Clichy.;Hepatology Department, St Joseph Hospital, Marseille.;Hepatology and Gastroenterology Department, Claude Huriez Hospital, Lille.;Hepatology Department, Albert Michallon Hospital, Grenoble.;Hepatology Department, Dupuytren Hospital, Limoges.;Hepatology Unit, Arnault Tzank Institut, St Laurent du Var.;Hepatology Unit, Croix-Rousse Hospital, Lyon.;Biochemistry Department, Avicenne Hospital, Bobigny.;Pharmacology Unit, Pontchaillou Hospital.;Pharmacology Unit, Pontchaillou Hospital.;ANRS (France REcherche Nord & Sud Sida-hiv Hépatites).;ANRS (France REcherche Nord & Sud Sida-hiv Hépatites).;Pharmacology Unit, Pontchaillou Hospital.;Hepatology Department, St Antoine Hospital, Paris, France.",
"authors": "Roulot|Dominique|D|;Thibault|Vincent|V|;Laforest|Claire|C|;Fontaine|Hélène|H|;Bronowicki|Jean-Pierre|JP|;Asselah|Tarik|T|;Bourlière|Marc|M|;Canva|Valérie|V|;Leroy|Vincent|V|;Loustaud-Ratti|Véronique|V|;Ouzan|Denis|D|;Zoulim|Fabien|F|;Schischmanoff|Olivier|O|;Rousseau|Chloé|C|;Renault|Alain|A|;Petrov-Sanchez|Ventzislava|V|;Diallo|Alpha|A|;Bellissant|Eric|E|;Serfaty|Lawrence|L|;|||",
"chemical_list": "D000998:Antiviral Agents; D002219:Carbamates; D007093:Imidazoles; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D007546:Isoquinolines; D011759:Pyrrolidines; D012367:RNA, Viral; D011994:Recombinant Proteins; D013449:Sulfonamides; D012254:Ribavirin; D014633:Valine; C549273:daclatasvir; C571889:asunaprevir",
"country": "England",
"delete": false,
"doi": "10.1097/MEG.0000000000001035",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0954-691X",
"issue": "30(3)",
"journal": "European journal of gastroenterology & hepatology",
"keywords": null,
"medline_ta": "Eur J Gastroenterol Hepatol",
"mesh_terms": "D000328:Adult; D000998:Antiviral Agents; D002219:Carbamates; D004359:Drug Therapy, Combination; D005260:Female; D005838:Genotype; D016174:Hepacivirus; D019698:Hepatitis C, Chronic; D006801:Humans; D007093:Imidazoles; D000077190:Interferon alpha-2; D016898:Interferon-alpha; D007546:Isoquinolines; D008103:Liver Cirrhosis; D008297:Male; D008875:Middle Aged; D010865:Pilot Projects; D011759:Pyrrolidines; D012367:RNA, Viral; D011994:Recombinant Proteins; D012254:Ribavirin; D013449:Sulfonamides; D000072230:Sustained Virologic Response; D017211:Treatment Failure; D016896:Treatment Outcome; D014633:Valine; D019562:Viral Load",
"nlm_unique_id": "9000874",
"other_id": null,
"pages": "302-309",
"pmc": null,
"pmid": "29271782",
"pubdate": "2018-03",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Efficacy of daclatasvir-based quadruple therapy in nonresponder patients infected by hepatitis C virus genotype 4: the ANRS HC32 QUATTRO study.",
"title_normalized": "efficacy of daclatasvir based quadruple therapy in nonresponder patients infected by hepatitis c virus genotype 4 the anrs hc32 quattro study"
} | [
{
"companynumb": "FR-KADMON PHARMACEUTICALS, LLC-KAD201804-000180",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "DACLATASVIR"
},
"drugad... |
{
"abstract": "Case Kaposi's sarcoma (KS) is a malignant vascular tumor that occurs commonly in patients with acquired immunodeficiency syndrome. KS associated with Cushing's syndrome (CS) is unusual, especially in endogenous CS. Here, we report a case of KS associated with glucocorticoid-replacement therapy after surgical treatment for adrenal CS. A 70-year-old man presented with symptoms and signs of CS with a left adrenal mass. Adrenal CS was confirmed by biochemical studies. After left adrenalectomy, he took oral prednisolone (15 mg/day) to prevent adrenal insufficiency. Ten weeks later, numerous raised purple plaques on the lower extremities were newly detected. The biopsy findings were compatible with KS, but anti-HIV antibodies were negative. After withdrawal of glucocorticoid therapy, the skin lesions regressed completely.\n\n\nCONCLUSIONS\nIn this case, KS developed after the use of exogenous corticosteroid but not during endogenous hypercortisolism. This finding suggests that endogenous and exogenous corticosteroid play different roles in the development of KS.",
"affiliations": "Department of Internal Medicine, Jeju National University Hospital, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea.;Department of Internal Medicine, Jeju National University Hospital, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea.;Department of Internal Medicine, Jeju National University Hospital, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea.;Department of Internal Medicine, Jeju National University Hospital, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea.;Department of Pathology, Jeju National University School of Medicine, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea.;Department of Internal Medicine, Jeju National University Hospital, 15, Aran 13-gil, Jeju-Si, Jeju-do, 690-767, Korea. okdom@jejunu.ac.kr.",
"authors": "Yoo|Soyeon|S|;Moon|Shinhang|S|;Chin|Sang-Ouk|SO|;Lee|Sang-Ah|SA|;Hyun|Changlim|C|;Koh|Gwanpyo|G|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D011239:Prednisolone",
"country": "Netherlands",
"delete": false,
"doi": "10.1007/s11096-015-0181-5",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "37(6)",
"journal": "International journal of clinical pharmacy",
"keywords": "Corticosteroid; Cushing’s syndrome; Glucocorticoid; Kaposi’s sarcoma",
"medline_ta": "Int J Clin Pharm",
"mesh_terms": "D000305:Adrenal Cortex Hormones; D000315:Adrenalectomy; D000368:Aged; D003480:Cushing Syndrome; D020249:Hormone Replacement Therapy; D006801:Humans; D008297:Male; D011239:Prednisolone; D012514:Sarcoma, Kaposi; D012867:Skin",
"nlm_unique_id": "101554912",
"other_id": null,
"pages": "988-91",
"pmc": null,
"pmid": "26286339",
"pubdate": "2015-12",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "11793390;10096517;15153155;20110636;23271139;10749966;7887453;2719427;25077599;8445054",
"title": "A case of exogenous corticosteroid-induced Kaposi's sarcoma that developed after a cure of endogenous hypercortisolism.",
"title_normalized": "a case of exogenous corticosteroid induced kaposi s sarcoma that developed after a cure of endogenous hypercortisolism"
} | [
{
"companynumb": "BAUSCH-BL-2015-027350",
"fulfillexpeditecriteria": "1",
"occurcountry": null,
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": null,
... |
{
"abstract": "Dasatinib has been associated with an increased risk of bleeding, with the most prominent risk noted in patients with advanced-stage chronic myeloid leukemia and thrombocytopenia. We herein report two cases of Philadelphia chromosome-positive acute lymphoblastic leukemia in which a subdural hematoma developed in association with low-dose (40-50 mg/day) dasatinib treatment and lumbar puncture for intrathecal methotrexate injection. Both patients were in complete remission, with normal platelet counts and coagulation status. We suggest that dasatinib, even at a low dose, may impair platelet aggregation and that lumbar puncture may increase the risk of a subdural hematoma (occasionally bilateral) in patients receiving dasatinib.",
"affiliations": "Division of Hematology, Respiratory Medicine and Oncology, Department of Internal Medicine, Faculty of Medicine, Saga University, Japan.",
"authors": "Ureshino|Hiroshi|H|;Nishioka|Atsujiro|A|;Kojima|Kensuke|K|;Kizuka|Haruna|H|;Sano|Haruhiko|H|;Shindo|Takero|T|;Kubota|Yasushi|Y|;Ando|Toshihiko|T|;Kimura|Shinya|S|",
"chemical_list": "D000970:Antineoplastic Agents; D000069439:Dasatinib; D008727:Methotrexate",
"country": "Japan",
"delete": false,
"doi": "10.2169/internalmedicine.55.6966",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0918-2918",
"issue": "55(18)",
"journal": "Internal medicine (Tokyo, Japan)",
"keywords": null,
"medline_ta": "Intern Med",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D000069439:Dasatinib; D005260:Female; D006408:Hematoma, Subdural; D006801:Humans; D007278:Injections, Spinal; D008727:Methotrexate; D010677:Philadelphia Chromosome; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma",
"nlm_unique_id": "9204241",
"other_id": null,
"pages": "2703-6",
"pmc": null,
"pmid": "27629971",
"pubdate": "2016",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Subdural Hematoma Associated with Dasatinib and Intrathecal Methotrexate Treatment in Philadelphia Chromosome-positive Acute Lymphoblastic Leukemia.",
"title_normalized": "subdural hematoma associated with dasatinib and intrathecal methotrexate treatment in philadelphia chromosome positive acute lymphoblastic leukemia"
} | [
{
"companynumb": "JP-PFIZER INC-2016465643",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE SODIUM"
},
"drugadditional": "3",... |
{
"abstract": "OBJECTIVE\nAlthough normal endoscopic findings are, as a rule, part of the diagnosis of microscopic colitis, sev-eral cases of macroscopic lesions (MLs) have been reported in collagenous colitis, but hardly in lymphocytic colitis (LC). The aim of this study was to investigate the endoscopic, clini-cal, and histopathologic features of LC with MLs.\n\n\nMETHODS\nA total of 14 patients with LC who were diagnosed between 2005 and 2010 were enrolled in the study. Endoscopic, clini-cal, and histopathologic findings were compared retrospec-tively according to the presence or absence of MLs.\n\n\nRESULTS\nMLs were observed in seven of the 14 LC cases. Six of the MLs exhibited hypervascularity, three exhibited exudative bleeding and one exhibited edema. The patients with MLs had more severe diarrhea and were taking aspirin or pro-ton pump inhibitors. More intraepithelial lymphocytes were observed during histologic examination in the patients with MLs compared to the patients without MLs, although this difference was not significant. The numbers of mononuclear cells and neutrophils in the lamina propria were independent of the presence or absence of MLs.\n\n\nCONCLUSIONS\nLC does not always present with normal endoscopic findings. Hyper-vascularity and exudative bleeding are frequent endoscopic findings in patients with MLs. (Gut Liver, 2015;9197-201).",
"affiliations": "Department of Internal Medicine, Hanyang University Guri Hospital, Guri, Korea.;Department of Internal Medicine, Hanyang University Guri Hospital, Guri, Korea.;Department of Internal Medicine, Hanyang University Guri Hospital, Guri, Korea.;Department of Internal Medicine, Hanyang University Guri Hospital, Guri, Korea.;Department of Internal Medicine, Hanyang University Guri Hospital, Guri, Korea.",
"authors": "Park|Hye Sun|HS|;Han|Dong Soo|DS|;Ro|Young Ouk|YO|;Eun|Chang Soo|CS|;Yoo|Kyo Sang|KS|",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.5009/gnl13373",
"fulltext": "\n==== Front\nGut LiverGut LiverGut and Liver1976-22832005-1212Gut and Liver 2516780010.5009/gnl13373gnl-09-197Original ArticleDoes Lymphocytic Colitis Always Present with Normal Endoscopic Findings? Park Hye Sun Han Dong Soo Ro Youngouk Eun Chang Soo Yoo Kyo-Sang Department of Internal Medicine, Hanyang University Guri Hospital, Guri, \nKoreaCorrespondence to: Dong Soo Han, Department of Internal Medicine, Hanyang University Guri Hospital, 153 Gyeongchun-ro, Guri 471-701, Korea Tel: +82-31-560-2226, Fax: +82-31-555-2998, E-mail: hands@hanyang.ac.kr3 2015 18 6 2014 9 2 197 201 26 9 2013 28 12 2013 08 1 2014 Copyright © 2015 by The Korean Society of Gastroenterology, the Korean Society of Gastrointestinal Endoscopy, the Korean Society of Neurogastroenterology and Motility, Korean College of Helicobacter and Upper Gastrointestinal Research, Korean Association for the Study of Intestinal Diseases, the Korean Association for the Study of the Liver, Korean Pancreatobiliary Association, and Korean Society of Gastrointestinal Cancer.2015This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Background/Aims\nAlthough normal endoscopic findings are, as a rule, part of the diagnosis of microscopic colitis, several cases of macroscopic lesions (MLs) have been reported in collagenous colitis, but hardly in lymphocytic colitis (LC). The aim of this study was to investigate the endoscopic, clinical, and histopathologic features of LC with MLs.\n\nMethods\nA total of 14 patients with LC who were diagnosed between 2005 and 2010 were enrolled in the study. Endoscopic, clinical, and histopathologic findings were compared retrospectively according to the presence or absence of MLs.\n\nResults\nMLs were observed in seven of the 14 LC cases. Six of the MLs exhibited hypervascularity, three exhibited exudative bleeding and one exhibited edema. The patients with MLs had more severe diarrhea and were taking aspirin or proton pump inhibitors. More intraepithelial lymphocytes were observed during histologic examination in the patients with MLs compared to the patients without MLs, although this difference was not significant. The numbers of mononuclear cells and neutrophils in the lamina propria were independent of the presence or absence of MLs.\n\nConclusions\nLC does not always present with normal endoscopic findings. Hypervascularity and exudative bleeding are frequent endoscopic findings in patients with MLs.\n\nLymphocytic colitisHypervascularityExudativeHemorrhage\n==== Body\nINTRODUCTION\nLymphocytic colitis (LC) together with collagenous colitis (CC) is a type of microscopic colitis (MC) characterized by chronic diarrhea and increased intraepithelial lymphocyte (IEL) infiltration.1,2 Most cases of LC have a grossly normal-appearing colonic mucosa, sometimes accompanied by nonspecific findings such as mild erythema or edema. However, several types of macroscopic lesion (ML) have been noted in association with CC, such as longitudinal ulcers,3,4 hypervascularity,5 loss of normal vascularity,6 and exudative bleeding.6 Although the etiology and pathogenesis of MLs of MC is unknown, several kinds of medications, such as proton pump inhibitors (PPIs) and nonsteroidal anti-inflammatory drugs (NSAIDs), have been suggested to be associated with such endoscopic abnormalities.3,7 However, the endoscopic features of LC have not been well described. The aim of this study was to investigate the endoscopic, clinical, and histopathologic features of LC associated with MLs.\n\nMATERIALS AND METHODS\nThe study was approved by the Institutional Review Board of Hanyang University Guri Hospital and was performed in accordance with the Declaration of Helsinki as revised in 1989. We reviewed the medical records of 120 patients with chronic diarrhea in Hanyang University Guri Hospital between January 2005 and December 2010. Of these patients, 14 cases were diagnosed with lymphocytic colitis.\n\nEach patient underwent total colonoscopy with multiple biopsies, in most cases from both right and left colon, and macroscopic appearance during endoscopy was registered. Endoscopic abnormalities were categorized into hypervascularity (Fig. 1), exudative bleeding (Fig. 2), longitudinal ulcer, and loss of normal vascularity (Fig. 3), according to findings in collagenous colitis.3–6 To evaluate the distribution of these findings, we divided the mucosal lesions into those in the right colon (including cecum, ascending colon, and transverse colon) and those in the left colon (including splenic flexure, descending colon, sigmoid colon, and rectum).\n\nTwo expert pathologists reviewed 66 biopsy slides obtained from the colonic segments of the patients with LC. A diagnosis of LC was established if the following two conditions were fulfilled: presence of IEL ≥20 per 100 surface epithelial cells, and lamina propria with chronic inflammatory infiltration of cells such as lymphocytes. Inflammation of the lamina propria was classified and scored as 0 to 3 (0, none; 1, mild; 2, moderate; 3, severe) according to the extent of mononuclear cell and neutrophil infiltration.1,8\n\nDemographic data, medical history, family history, drug use, severity of diarrhea (frequency/day), duration of diarrhea (days) and routine laboratory tests were collected, and patients were excluded if diagnoses other than LC were given, such as infection, graft-versus-host disease, and autoimmune disease.\n\nData are expressed as numbers (percentages) of patients, and means±standard deviations of variables. Categorical variables were analyzed with Fisher exact test or the chi-square test. For continuous variables, Student t-test was used where appropriate. All statistical analyses were performed with SPSS statistical software version 13.0 (SPSS Inc., Chicago, IL, USA). p-values <0.05 were considered to be statistically significant.\n\nRESULTS\nTable 1 presents the clinical, colonoscopic, and histologic findings for patients with and without ML. There were no significant differences of age or gender between two groups. All the patients complained of watery diarrhea, and the average number of diarrheal events was significantly higher in the patients with ML (11.1±6.3 times/day vs 3.6±1.2 times/day, p=0.019). In addition, the duration from diagnosis to symptom improvement was not significantly different in the two groups; however, there was a tendency for it to be slightly longer in the patients with ML (3.1±2.5 weeks vs 1.8±1.6 weeks, p=0.301). There was no difference in the duration of diarrhea before diagnosis between the two groups (p=0.605) (Table 2). In this study, there were no patients with a history of smoking or autoimmune disease such as Graves disease and rheumatoid arthritis. On the other hand, there were no diagnostic differences between right and left colon on the pathologic review.\n\nOf the LC-associated drugs reported, NSAIDs were the most frequently used (four of 14 cases, 28.6%), followed by PPI and aspirin (three cases each, 21.4%), statins (two of 14 cases, 14.2%), ticlopidine (one of 14 cases, 7.1%), bisphosphonate (one of 14 cases, 7.1%). Of these medications, aspirin and PPI were taken only by patients with ML. As treatment, discontinuing the use of drugs that might have caused the diarrhea was effective. If diarrhea persisted, 5-aminosalicylic acid (5-ASA) or steroids were prescribed. In three of the patients with ML, diarrhea improved after taking steroids (Table 1).\n\nOn colonoscopic examination, hypervascularity was seen in six of the seven patients with ML (86%). ML was mainly observed in the descending colon, and it was characterized by crowded, tortuous vascularity of the colonic mucosa. Exudative bleeding was found in three patients (43%), mostly in the transverse colon. However, the presentation of ML did not differ significantly between right and left colon (Table 3).\n\nOn histologic examination, numbers of IEL infiltrated were higher in the patients with ML than in those without ML (62.86±25.63 per 100 epithelial cells vs 47.85±26.74 per 100 epithelial cells, p=0.885), although the difference did not reach statistical significance. Numbers of mononuclear cells and neutrophils infiltrated into the lamina propria did not differ significantly between two groups (mononuclear cell, p=0.356; neutrophils, p=0.730) (Table 2).\n\nDISCUSSION\nIn this study, abnormal endoscopic findings including hypervasculary, exudative bleeding, and loss of normal vascularity were observed in half (seven of 14 cases) of all LC patients. The pathogenesis of CC is similar to that of LC, and in several studies of CC about 30% of cases were accompanied by MLs, with characteristic longitudinal ulcers associated with the use of lansoprazole.3,4,6,7 However, in the present study there was no evidence of longitudinal ulcers, and neovasulcarization was the most common and prominent finding, occurring in six of the seven LCs with MLs. The frequency of endoscopic abnormalities was somewhat higher than in previous studies.7 The reason for this may be strict application in the previous studies of the diagnostic criterion stating that normal or nonsignificant endoscopic findings are required for a diagnosis of LC. However, chronic diarrhea that has persisted for over a month and pathologic findings of IEL ≥20 per 100 surface epithelial cells must be present in order to diagnose LC,9 and recently several groups have suggested that LC can be accompanied by a variety of different endoscopic findings.7 In addition, because we excluded conditions that may increase IEL infiltration or be accompanied by endoscopic abnormalities such as hypervascularity or exudative bleeding, LC is less likely to have been misdiagnosed.\n\nAlthough there was no significant difference in the frequency of endoscopic abnormalities between the right and left colons (hypervascularity, p=0.266; exudative bleeding, p=1.000), hypervascularity was mostly seen in the descending or transverse colon while exudative bleeding were more prominent in the cecum, ascending and transverse colon. In view of this variation, colonoscopy of the entire colon is essential in order to diagnose LC in clinical practice.\n\nThe mean age of LC patients enrolled in this study was 65.8 years, and females predominated with a male to female ratio of 4:10. These findings are similar to previous reports in which the mean age of LC patients was between 53 and 59 years, and the male to female ratio was between 3:1 and 9:1.10–12 In the present study, the incidence of diarrhea was three times higher in the LC with ML than without ML (p=0.019). Although the difference was not statistically significant, the duration from onset of therapy to symptom improvement was longer in the LC with ML than in the LC without ML. Again there was also a tendency for there to be more IEL infiltration in the LC with ML.\n\nThe diarrhea that develops in LC is due to reduced absorption or increased secretion of electrolytes, which is caused by increased epithelial permeability due to inflammation of the epithelial cells or weakening of intraepithelial cell tight junctions. All of these effects are known to be related to the degree of inflammation of the lamina propria.10,13,14 In the present study, the score for mononuclear cell infiltration in the lamina propria of the LC with ML was 2.14±0.38. Although the difference was not significant, it was relatively higher compared to the score (1.86±0.69) for the LC with ML (p=0.356). The increase in the severity of diarrhea in the LC with ML is understandable since the degree of intraepithelial cell inflammation was more severe.\n\nAnother possible reason may be use of PPIs. In our study, the patients who complained of persistent diarrhea and who also had evidence of mucosal lesions (patients 8 and 9) were taking PPIs. Since diarrhea manifests as a side effect in 2.9% to 7.6% of patients taking PPIs, it is possible that the medication may have caused the severe clinical symptoms.15,16 However, medications such as PPIs, NSAIDs, and aspirin are reported to be associated with CC with abnormal endoscopic findings.3,17 In this study, too, there were a number of patients taking PPIs or aspirin who also had endoscopic abnormalities. It should be noted that the number of patients enrolled was too small and a sizable proportion of the patients were taking multiple medications that could cause LC, and therefore exactly which medication had how much effect cannot be determined. However, as in the case of CC, it is possible that some mucosal changes are related to use of medication and a large scale study would be desirable to examine this matter.\n\nThe limitations of the study include the following: first, the study was conducted in a single center and involved only a small number of patients. In the present study, 14 out of 120 chronic diarrhea patients (11.7%) were diagnosed with LC, which showed a higher diagnostic percentage of LC compared to previous published studies.10 This study was a retrospective study performed in a single university hospital with a relatively small number of patients enrolled, which might have been the reason for a higher diagnostic rate of LC. Secondly, there were no specific diagnostic criteria for the LC cases in which endoscopic abnormalities were evaluated, and third, subjective assessment by the endoscopist cannot be completely excluded. However, the endoscopic abnormalities were assessed based on the findings of CC,3–6 and two endoscopists both with more than 10 years of experience in this field assessed and interpreted the findings. Therefore, these limitations may not be a problem. Finally, there was no endoscopic follow up in the LC with ML. However, all but one of the patients attended the outpatient clinic regularly for at least 6 months and their symptoms improved after discontinuation of their medication so that none required antidiarrheal drugs or 5-ASA, etc. These points suggest that even though endoscopic follow-up was not performed, the possibility of patients with inflammatory bowel disease or other forms of colitis having been included in the study is low.\n\nIn conclusion, atypical features may be seen in some cases although endoscopic findings in LC are generally normal. This study is unique in that it is the first to suggest that in older diarrheal patients with MLs such as hypervascularity or exudative bleeding who have a history of taking medication such as PPIs or aspirin, the endoscopic findings may be suggestive of LC as well as CC. Since more and more elderly patients are taking medications that can induce LC, and the incidence of LC is ever-increasing, it is important to recognize the existence of LC with ML. We suggest that a large-scale prospective study should be carried out to establish the clinical characteristics and risk factors of LC.\n\nACKNOWLEDGEMENTS\nThis study was supported by a grant of the Korean Health Technology R&D Project, Ministry of Health & Welfare, Republic of Korea (A120176).\n\nSee editorial on page 137.\n\nCONFLICTS OF INTEREST\n\nNo potential conflict of interest relevant to this article was reported.\n\nFig. 1 A crowded vascular pattern, defined as “hypervascularity” is evident (patients 8, 13).\n\nFig. 2 Multiple areas of hemorrhage or oozing, defined as “exudative bleeding” can be seen (patient 8).\n\nFig. 3 Loss of normal vascular marking is evident (patient 9).\n\nTable 1 Characteristics of Patients with Lymphocytic Colitis\n\nPatients\tAge, yr\tSex\tSymptom\tSymptom frequency (per day)\tSymptom duration (wk)\tConcomitant drugs (duration, mo)\tConcurrent disease\tTreatment\t\n\n\t\nPPI\tAspirin\tNSAIDs\tStatin\tBSP\tTiclopidine\t\nPatients without mucosal lesions\t\n 1\t77\tM\tDiarrhea\t4\t4\t\t\tO (48)\t\t\t\tHLD\t5-ASA\t\n 2\t25\tF\tDiarrhea\t3\t12\t\t\t\t\t\t\tNone\t5-ASA\t\n 3\t66\tF\tDiarrhea\t5\t4\t\t\t\t\t\t\tThyroiditis\tNone\t\n 4\t64\tF\tDiarrhea\t2\t48\t\t\tO (4)\tO (24)\t\t\tHLD, HL\t5-ASA\t\n 5\t68\tF\tDiarrhea\t3\t4\t\t\t\t\t\t\tNone\tNone\t\n 6\t76\tF\tDiarrhea\t5\t4\t\t\tO (48)\tO (24)\t\t\tHTN, OA, HL\t5-ASA\t\n 7\t51\tM\tDiarrhea\t3\t8\t\t\t\t\t\t\tTB\tNone\t\nPatients with mucosal lesions\t\n 8\t75\tM\tDiarrhea\t20\t12\tLPZ (12)\t\t\t\t\t\tDM, GERD\tSteroid\t\n 9\t63\tM\tDiarrhea\t20\t5\tLPZ (8)\tO (2)\t\t\t\t\tDM, HTN, GERD\tSteroid\t\n 10\t55\tF\tDiarrhea\t10\t12\t\t\t\t\t\t\tNone\t5-ASA\t\n 11\t77\tF\tDiarrhea\t7\t8\t\tO (12)\t\t\t\t\tHTN\tNone\t\n 12\t74\tF\tDiarrhea\t10\t8\t\t\t\t\t\t\tNone\tSteroid\t\n 13\t78\tF\tDiarrhea\t5\t8\tLPZ (4)\tO (20)\t\t\tO (20)\tO (20)\tHTN, GERD\tNone\t\n 14\t72\tF\tDiarrhea\t6\t8\t\t\tO (2)\t\t\t\tOA\t5-ASA\t\nPPI, proton pump inhibitor; NSAIDs, nonsteroidal anti-inflammatory drugs; BSP, bisphosphonate; M, male; HLD, herniated lumbar disc; 5-ASA, 5-aminosalicylic acid; F, female; HL, hyperlipidemia; HTN, hypertension; OA, osteoarthritis; TB, pulmonary tuberculosis; LPZ, lansoprazole; DM, diabetes mellitus; GERD, gastroesophageal reflux disease.\n\nTable 2 Comparison of Clinical and Pathologic Findings in Lymphocytic Colitis with and without Mucosal Lesions\n\n\tLC without mucosal lesions (n=7)\tLC with mucosal lesions (n=7)\tp-value\t\nClinical findings\t\n Age, yr\t61.0±18.1\t70±8.5\tNS\t\n Male:female\t2:5\t2:5\tNS\t\n Severity of diarrhea, frequency/day\t3.6±1.2\t11.1±6.3\t0.019\t\n Diarrhea duration, day\t12.0±6.17\t8.71±2.50\t0.605\t\n Duration from diagnosis to symptom improvement, wk\t1.8±1.6\t3.1±2.5\t0.301\t\nPathologic findings\t\n IEL, %\t37.86±14.09\t62.86±25.63\t0.885\t\n Mononuclear cell infiltration\t1.86±0.69\t2.14±0.38\t0.356\t\n Neutrophil infiltration\t1.14±0.69\t1.00±0.82\t0.730\t\nData are presented as mean±SD.\n\nLC, lymphocytic colitis; NS, not significant; IEL, intraepithelial lymphocyte infiltration.\n\nTable 3 Frequencies of Abnormal Endoscopic Findings in the Right and Left Colon\n\nEndoscopic finding\tRight colon (n=7)\tLeft colon (n=7)\tp-value\t\nHypervascularity\t3 (43)\t6 (86)\t0.266\t\nExudative bleeding\t3 (43)\t1 (14)\t1.000\t\nLoss of vascular marking\t1 (14)\t1 (14)\t1.000\t\nLongitudinal ulcer\t0\t0\t1.000\t\nData are presented as number (%).\n==== Refs\nREFERENCES\n1 Lazenby AJ Yardley JH Giardiello FM Jessurun J Bayless TM Lymphocytic (“microscopic”) colitis: a comparative histopathologic study with particular reference to collagenous colitis Hum Pathol 1989 20 18 28 10.1016/0046-8177(89)90198-6 2912870 \n2 Tremaine WJ Diagnosing collagenous colitis: does it make a difference? Eur J Gastroenterol Hepatol 1999 11 477 479 10.1097/00042737-199905000-00002 10755248 \n3 Nomura E Kagaya H Uchimi K Linear mucosal defects: a characteristic endoscopic finding of lansoprazole-associated collagenous colitis Endoscopy 2010 42 Suppl 2 E9 E10 10.1055/s-0029-1214795 20066608 \n4 Couto G Bispo M Barreiro P Monteiro L Matos L Unique endoscopy findings in collagenous colitis Gastrointest Endosc 2009 69 1186 1188 10.1016/j.gie.2008.06.010 19152884 \n5 Sato S Matsui T Tsuda S Endosocopic abnormalities in a Japanese patient with collagenous colitis J Gastroenterol 2003 38 812 813 10.1007/s00535-003-1151-6 14505141 \n6 Giardiello FM Bayless TM Yardley JH Collagenous colitis Compr Ther 1989 15 49 54 2647387 \n7 Capurso G Marignani M Attilia F Lansoprazole-induced microscopic colitis: an increasing problem? Results of a prospecive case-series and systematic review of the literature Dig Liver Dis 2011 43 380 385 10.1016/j.dld.2010.11.015 21195042 \n8 Veress B Löfberg R Bergman L Microscopic colitis syndrome Gut 1995 36 880 886 10.1136/gut.36.6.880 7615277 \n9 Read NW Krejs GJ Read MG Santa Ana CA Morawski SG Fordtran JS Chronic diarrhea of unknown origin Gastroenterology 1980 78 264 71 7350049 \n10 Pardi DS Kelly CP Microscopic colitis Gastroenterology 2011 140 1155 1165 10.1053/j.gastro.2011.02.003 21303675 \n11 Pardi DS Smyrk TC Tremaine WJ Sandborn WJ Microscopic colitis: a review Am J Gastroenterol 2002 97 794 802 10.1111/j.1572-0241.2002.05595.x 12003412 \n12 Pardi DS Loftus EV Jr Smyrk TC The epidemiology of microscopic colitis: a population based study in Olmsted County, Minnesota Gut 2007 56 504 508 10.1136/gut.2006.105890 17135309 \n13 Bürgel N Bojarski C Mankertz J Zeitz M Fromm M Schulzke JD Mechanisms of diarrhea in collagenous colitis Gastroenterology 2002 123 433 443 10.1053/gast.2002.34784 12145796 \n14 Protic M Jojic N Bojic D Mechanism of diarrhea in microscopic colitis World J Gastroenterol 2005 11 5535 5539 16222750 \n15 Colin-Jones DG Safety of lansoprazole Aliment Pharmacol Ther 1993 7 Suppl 1 56 60 10.1111/j.1365-2036.1993.tb00590.x 8490081 \n16 Freston JW Long-term acid control and proton pump inhibitors: interactions and safety issues in perspective Am J Gastroenterol 1997 92 51S 55S 9127627 \n17 Kakar S Pardi DS Burgart LJ Colonic ulcers accompanying collagenous colitis: implication of nonsteroidal anti-inflammatory drugs Am J Gastroenterol 2003 98 1834 1837 10.1111/j.1572-0241.2003.07579.x 12907340\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1976-2283",
"issue": "9(2)",
"journal": "Gut and liver",
"keywords": "Exudative; Hemorrhage; Hypervascularity; Lymphocytic colitis",
"medline_ta": "Gut Liver",
"mesh_terms": "D000328:Adult; D000368:Aged; D046729:Colitis, Collagenous; D046730:Colitis, Lymphocytic; D003106:Colon; D003113:Colonoscopy; D003937:Diagnosis, Differential; D003967:Diarrhea; D005260:Female; D006801:Humans; D007413:Intestinal Mucosa; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies",
"nlm_unique_id": "101316452",
"other_id": null,
"pages": "197-201",
"pmc": null,
"pmid": "25167800",
"pubdate": "2015-03",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "7615277;14505141;8490081;2647387;21195042;17135309;2912870;12907340;21303675;16222750;10755248;12003412;20066608;7350049;9127627;12145796;19152884",
"title": "Does lymphocytic colitis always present with normal endoscopic findings?",
"title_normalized": "does lymphocytic colitis always present with normal endoscopic findings"
} | [
{
"companynumb": "KR-BAYER-2016-245952",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "LANSOPRAZOLE"
},
"drugadditional": null,
... |
{
"abstract": "OBJECTIVE\nWe investigated delayed outcomes of patients with minor head injury, warfarin, and a normal initial head computer tomographic (CT) scan finding.\n\n\nMETHODS\nWe conducted a single-center, retrospective study on such patients who were admitted. A second CT was not mandatory. International normalized ratios were classified into subtherapeutic, therapeutic, and supratherapeutic ranges. We traced them 2 weeks after discharge for delayed intracranial hemorrhage (ICH). Primary outcomes were proportions with ICH on second CT, fresh-frozen plasma (FFP) and/or vitamin K administration, and neurosurgical intervention. Secondary outcomes were hospital length of stay and the proportion with ICH 2 weeks after discharge. We explored differences in proportions of ICH during hospital stay among different strata (age ≥65 years, antiplatelet therapy, supratherapeutic international normalized ratio ranges, and FFP administration). Data were analyzed using descriptive statistics. P values less than .05 were considered statistically significant.\n\n\nRESULTS\nWe recruited 298 patients. Of admissions (N = 295), 11 (3.7%) had a second CT, with one (0.3%) abnormality. There were 7 (2.4%) and 8 (2.7%) patients who received FFP and vitamin K, respectively. One patient (0.3%) required neurosurgical intervention. The median hospital length of stay was 3 (interquartile range, 2) days. No patients reattended 2 weeks after discharge. There were no statistically significant differences in the proportions of ICH during hospital stay among the 4 strata.\n\n\nCONCLUSIONS\nDelayed ICH was rare with no predictive factors. Clinical monitoring before deciding on second CT was safe. The optimal period and mode of observation had yet to be determined.",
"affiliations": "Emergency Department, Jurong Health Services, Singapore. Electronic address: Beng_Leong_Lim@Juronghealth.com.sg.;Emergency Department, Tan Tock Seng Hospital, Singapore. Electronic address: charmaine_manauis@Ttsh.com.sg.;Emergency Department, Jurong Health Services, Singapore. Electronic address: Marxengel_L_Asinas@Juronghealth.com.sg.",
"authors": "Lim|Beng Leong|BL|;Manauis|Charmaine|C|;Asinas-Tan|Marxengel L|ML|",
"chemical_list": "D000925:Anticoagulants; D014859:Warfarin",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0735-6757",
"issue": "34(1)",
"journal": "The American journal of emergency medicine",
"keywords": null,
"medline_ta": "Am J Emerg Med",
"mesh_terms": "D000368:Aged; D000925:Anticoagulants; D006259:Craniocerebral Trauma; D005260:Female; D006801:Humans; D019934:International Normalized Ratio; D020300:Intracranial Hemorrhages; D008297:Male; D012189:Retrospective Studies; D012307:Risk Factors; D013997:Time Factors; D014057:Tomography, X-Ray Computed; D014859:Warfarin",
"nlm_unique_id": "8309942",
"other_id": null,
"pages": "75-8",
"pmc": null,
"pmid": "26458530",
"pubdate": "2016-01",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Outcomes of warfarinized patients with minor head injury and normal initial CT scan.",
"title_normalized": "outcomes of warfarinized patients with minor head injury and normal initial ct scan"
} | [
{
"companynumb": "SG-IPCA LABORATORIES LIMITED-IPC201602-000056",
"fulfillexpeditecriteria": "1",
"occurcountry": "SG",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "WARFARIN"
},
"drugadditio... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.