article dict | reports listlengths 1 3.97k |
|---|---|
{
"abstract": "The use of a once-yearly IV infusion of 5 mg zoledronic acid has become more common, as the drug is being reported as safe, with few to minimal adverse reactions. This one-time annual administration has a favorable outcome for patients with osteoporosis and spares the burden of taking daily oral bisphosphonates. The present literature search found 10 well-documented cases of bisphosphonate-related osteonecrosis of the jaw (BRONJ) associated with annual administration of 5 mg zoledronic acid for the treatment of osteoporosis. Two new cases are also described, with underlying risk factors similar to previous reports. These include prior dental surgical procedures, the presence of diabetes, autoimmune conditions, past use of bisphosphonate and steroids, and concomitant immunosuppression. Although the reported incidence of BRONJ related to once-a-year IV administered zoledronic acid is low, it may be plausible. Both medical and dental clinicians should be aware of its manifestation.",
"affiliations": null,
"authors": "Katz|Joseph|J|;Ordoveza|Patrisha A|PA|",
"chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D007093:Imidazoles; D000077211:Zoledronic Acid",
"country": "Germany",
"delete": false,
"doi": "10.3290/j.qi.a32242",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0033-6572",
"issue": "45(8)",
"journal": "Quintessence international (Berlin, Germany : 1985)",
"keywords": null,
"medline_ta": "Quintessence Int",
"mesh_terms": "D000368:Aged; D059266:Bisphosphonate-Associated Osteonecrosis of the Jaw; D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D005260:Female; D006801:Humans; D007093:Imidazoles; D007262:Infusions, Intravenous; D008297:Male; D008875:Middle Aged; D000077211:Zoledronic Acid",
"nlm_unique_id": "0342677",
"other_id": null,
"pages": "685-90",
"pmc": null,
"pmid": "25019116",
"pubdate": "2014-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Bisphosphonate-related osteonecrosis of the jaw (BRONJ) associated with a once-yearly IV infusion of zoledronic acid (Reclast) 5 mg: two cases and review of the literature.",
"title_normalized": "bisphosphonate related osteonecrosis of the jaw bronj associated with a once yearly iv infusion of zoledronic acid reclast 5 mg two cases and review of the literature"
} | [
{
"companynumb": "PHHY2016US115272",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ALENDRONATE SODIUM"
},
"drugadditional": null,
... |
{
"abstract": "Quetiapine, an atypical antipsychotic, has been the subject of a series of case reports that suggest a potential for misuse/abuse. The available cases indicate a male predominance; oral, intranasal, or intravenous routes of administration; misuse/abuse in jail or inpatient psychiatric settings; and subjects with extensive histories of polysubstance abuse. While possible pharmacological explanations have been proffered, compared to the other atypical antipsychotics, there is no clear explanation for an alleged higher risk of misuse/abuse with quetiapine. Likewise, there are no available animal or human empirical studies to evaluate risk. At this juncture, clinicians in psychiatric and primary care settings can only remain alert to a potential risk, particularly in patients who meet the current demographic profile.",
"affiliations": "Dr. R. Sansone is a professor in the Departments of Psychiatry and Internal Medicine at Wright State University School of Medicine in Dayton, Ohio, and Director of Psychiatry Education at Kettering Medical Center in Kettering, Ohio.",
"authors": "Sansone|Randy A|RA|;Sansone|Lori A|LA|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1550-5952",
"issue": "7(1)",
"journal": "Psychiatry (Edgmont (Pa. : Township))",
"keywords": "Quetiapine; abuse; misuse",
"medline_ta": "Psychiatry (Edgmont)",
"mesh_terms": null,
"nlm_unique_id": "101484252",
"other_id": null,
"pages": "13-6",
"pmc": null,
"pmid": "20386631",
"pubdate": "2010-01",
"publication_types": "D016428:Journal Article",
"references": "17384357;18425995;16259542;18983220;16001094;16135642;18344735;18312052;17202567;17122696;17713313;16696579;17267808;15337673;15349010;18359967;18593794;15967975;15644986;15560324;17202569;17656426;18577126;18770092;18196687",
"title": "Is seroquel developing an illicit reputation for misuse/abuse?",
"title_normalized": "is seroquel developing an illicit reputation for misuse abuse"
} | [
{
"companynumb": "US-ALKEM LABORATORIES LIMITED-PL-ALKEM-2018-01329",
"fulfillexpeditecriteria": "1",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "QUETIAPINE FUMARATE"
},
... |
{
"abstract": "A three-year-old girl was found altered with an unknown timeline. Gas chromatography mass spectrometry was positive for hydromorphone, dihydrocodeine, and hydrocodone. Initial computed tomography and magnetic resonance imaging suggested a malignant cerebellar edema not confined to a vascular distribution. She received fentanyl boluses on hospital days 0 and 1 before receiving a continuous infusion on day 1. On day 3, she had an episode of acute hypertension and bradycardia. Emergent computed tomography showed an evolving hydrocephalus and similar diffuse edema throughout both cerebellar hemispheres. External ventricular drain was placed to relieve the increased intracranial pressure. Following drain placement and fentanyl discontinuation, the patient recovered, though not without fine- and gross-motor deficits at the four-month follow-up. Our case adds to a handful of case reports of opioid toxicity in pediatric patients that present as toxic leukoencephalopathy. Though the mechanism is poorly understood, it has been suggested to be a consequence of the neurotoxic effects of the drug, which has particular affinity for µ opioid receptors-the primary opioid receptor found in the cerebellum. Clinicians would do well to recognize that this syndrome is primarily caused by direct toxicity rather than ischemia. This case adds insight by suggesting that lipophilic opioid analgesics may worsen this neurotoxicity. When intervening with mechanical ventilation, clinicians should consider avoiding lipophilic opioid drugs for analgesia until the pathogenesis of cerebellar edema is better understood.",
"affiliations": "1 School of Medicine, University of Mississippi, USA.;1 School of Medicine, University of Mississippi, USA.;2 Department of Radiology, University of Mississippi Medical Center, USA.;3 Department of Radiology, University of Virginia Health System, USA.",
"authors": "Chen|Cathy H|CH|;Mullen|Alexander J|AJ|https://orcid.org/0000-0003-3769-3923;Hofstede|Dustin|D|https://orcid.org/0000-0002-3805-0850;Rizvi|Tanvir|T|",
"chemical_list": "D000701:Analgesics, Opioid; D005283:Fentanyl",
"country": "United States",
"delete": false,
"doi": "10.1177/1971400919863713",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1971-4009",
"issue": "32(5)",
"journal": "The neuroradiology journal",
"keywords": "CT scan; Fentanyl toxicity; MRI; cytotoxic edema; pediatric opioid overdose; toxic leukoencephalopathy",
"medline_ta": "Neuroradiol J",
"mesh_terms": "D000701:Analgesics, Opioid; D001929:Brain Edema; D002531:Cerebellum; D002675:Child, Preschool; D062787:Drug Overdose; D005260:Female; D005283:Fentanyl; D006801:Humans; D056784:Leukoencephalopathies; D016896:Treatment Outcome",
"nlm_unique_id": "101295103",
"other_id": null,
"pages": "386-391",
"pmc": null,
"pmid": "31328634",
"pubdate": "2019-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "10208600;10978659;11151694;15965216;16249600;16970857;17541658;17952429;18349449;18440072;19337601;19574554;19808992;21197314;2169964;21926884;22078910;22784117;23132396;23177581;24949049;25300594;26339960;27480352;27606309;28320869;28790973;29853621;30792768;6128545;8319480",
"title": "Malignant cerebellar edema in three-year-old girl following accidental opioid ingestion and fentanyl administration.",
"title_normalized": "malignant cerebellar edema in three year old girl following accidental opioid ingestion and fentanyl administration"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/19/0115200",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "FENTANYL CITRATE"
},
"drugadditional": "... |
{
"abstract": "We examined the effectiveness of plasma exchange (PE) therapy to reduce the mortality of rapidly progressive interstitial lung disease (RP-ILD) in patients positive for anti-melanoma differentiation-associated gene 5 (MDA5) antibodies.\n\n\n\nAmong 142 patients newly diagnosed with PM/DM or clinically amyopathic DM from 2008 to 2019 at our hospital, 10 were diagnosed with refractory RP-ILD and were positive for anti-MDA5 antibodies. PE was used as an adjunct to standard therapy and consisted of fresh frozen plasma as replacement solution. The primary outcome was non-disease-specific mortality.\n\n\n\nAnti-MDA5 antibodies were detected in 28 patients, of whom 21 were diagnosed with RP-ILD and 10 were refractory to intensive immunosuppressive therapy. Six patients received PE (PE group) and four did not (non-PE group). The 1-year survival rate of the PE group was higher than that of the non-PE group (100% and 25%, respectively, P = 0.033). Regarding adverse events associated with PE, two patients had anaphylactic shock, one had high fever due to fresh frozen plasma allergy and one had a catheter infection. All adverse events resolved with appropriate treatment.\n\n\n\nWe evaluated the association between 1-year survival rate and PE for refractory RP-ILD in patients positive for anti-MDA5 antibodies. Intensive immunosuppressive therapy improved the survival rate in RP-ILD patients with anti-MDA5 antibodies, but 20-30% of cases were still fatal. PE could be administered to patients with active infectious disease who were immunocompromised by intensive immunosuppressive therapy. PE may be considered in refractory RP-ILD patients positive for anti-MDA5 antibodies.",
"affiliations": "Department of Internal Medicine and Rheumatology, Juntendo University School of Medicine, Tokyo, Japan.;Department of Internal Medicine and Rheumatology, Juntendo University School of Medicine, Tokyo, Japan.;Department of Internal Medicine and Rheumatology, Juntendo University School of Medicine, Tokyo, Japan.;Department of Internal Medicine and Rheumatology, Juntendo University School of Medicine, Tokyo, Japan.;Department of Internal Medicine and Rheumatology, Juntendo University School of Medicine, Tokyo, Japan.",
"authors": "Abe|Yoshiyuki|Y|;Kusaoi|Makio|M|;Tada|Kurisu|K|;Yamaji|Ken|K|;Tamura|Naoto|N|",
"chemical_list": "D001323:Autoantibodies; D007166:Immunosuppressive Agents; C452815:IFIH1 protein, human; D000072640:Interferon-Induced Helicase, IFIH1",
"country": "England",
"delete": false,
"doi": "10.1093/rheumatology/kez357",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1462-0324",
"issue": "59(4)",
"journal": "Rheumatology (Oxford, England)",
"keywords": "anti-MDA5 antibody; plasma exchange; rapidly progressive interstitial lung disease; single-filtration plasmapheresis",
"medline_ta": "Rheumatology (Oxford)",
"mesh_terms": "D000328:Adult; D000368:Aged; D000707:Anaphylaxis; D001323:Autoantibodies; D003882:Dermatomyositis; D004351:Drug Resistance; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D000072640:Interferon-Induced Helicase, IFIH1; D017563:Lung Diseases, Interstitial; D008297:Male; D008875:Middle Aged; D010949:Plasma; D010951:Plasma Exchange; D010956:Plasmapheresis; D015996:Survival Rate; D065227:Transfusion Reaction; D016896:Treatment Outcome",
"nlm_unique_id": "100883501",
"other_id": null,
"pages": "767-771",
"pmc": null,
"pmid": "31504956",
"pubdate": "2020-04-01",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Successful treatment of anti-MDA5 antibody-positive refractory interstitial lung disease with plasma exchange therapy.",
"title_normalized": "successful treatment of anti mda5 antibody positive refractory interstitial lung disease with plasma exchange therapy"
} | [
{
"companynumb": "JP-TEVA-2020-JP-1242088",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CYCLOPHOSPHAMIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Perivascular epithelioid cell tumors (PEComas) form a family of rare mesenchymal neoplasms that typically display myomelanocytic differentiation. Upregulation of mTOR signaling due the inactivation of TSC1/2 (Tuberous Sclerosis 1 and 2) is believed to be a key oncogenic driver in this disease. Recently, a subgroup of PEComas harboring TFE3 (Transcription Factor E3) rearrangements and presenting with a distinctive morphology has been identified. TSC1/2 and TFE3 aberrations are deemed to be mutually exclusive in PEComa, with two different pathogenic mechanisms assumed to lead to tumorigenesis. Here, we challenge this dichotomy by presenting a case of a clinically aggressive TCS1-mutated PEComa displaying a TFE3-altered phenotype. FISH analysis was suggestive of a TFE3 inversion; however, RNA and whole genome sequencing was ultimately unable to identify a fusion involving the gene. However, a copy number increase of the chromosomal region encompassing TFE3 was detected and transcriptome analysis confirmed upregulation of TFE3, which was also seen at the protein level. Therefore, we believe that the TSC1/2-mTOR pathway and TFE3 overexpression can simultaneously contribute to tumorigenesis in PEComa. Our comprehensive genetic analyses add to the understanding of the complex pathogenic mechanisms underlying PEComa and harbor insights for clinical treatment options.",
"affiliations": "Department of Hematology, Oncology, and Tumor Immunology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Hematology, Oncology, and Tumor Immunology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Institute of Medical Genetics and Human Genetics, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Institute of Pathology, DRK Kliniken Berlin Westend, Berlin, Germany.;Institute of Pathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Institute of Pathology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Institute of Pathology, Friedrich-Alexander-University Erlangen-Nürnberg, University Hospital Erlangen, Erlangen, Germany.;Institute of Pathology, Friedrich-Alexander-University Erlangen-Nürnberg, University Hospital Erlangen, Erlangen, Germany.;Institute of Pathology, Friedrich-Alexander-University Erlangen-Nürnberg, University Hospital Erlangen, Erlangen, Germany.;Institute of Medical Genetics and Human Genetics, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Nephrology and Medical Intensive Care, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Urology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Surgery, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Center for Musculoskeletal Surgery, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Hematology, Oncology, and Tumor Immunology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Hematology, Oncology, and Tumor Immunology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.;Department of Hematology, Oncology, and Tumor Immunology, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Berlin, Germany.",
"authors": "Schmiester|Maren|M|;Dolnik|Anna|A|;Kornak|Uwe|U|;Pfitzner|Berit|B|;Hummel|Michael|M|;Treue|Denise|D|;Hartmann|Arndt|A|;Agaimy|Abbas|A|;Weyerer|Veronika|V|;Lekaj|Anja|A|;Brakemeier|Susanne|S|;Peters|Robert|R|;Öllinger|Robert|R|;Märdian|Sven|S|;Bullinger|Lars|L|;Striefler|Jana Käthe|JK|;Flörcken|Anne|A|",
"chemical_list": "D051778:Basic Helix-Loop-Helix Leucine Zipper Transcription Factors; D014408:Biomarkers, Tumor; C069203:TFE3 protein, human; C000624650:TSC1 protein, human; D000077004:Tuberous Sclerosis Complex 1 Protein",
"country": "England",
"delete": false,
"doi": "10.1002/cjp2.187",
"fulltext": "\n==== Front\nJ Pathol Clin Res\nJ Pathol Clin Res\n10.1002/(ISSN)2056-4538\nCJP2\nThe Journal of Pathology: Clinical Research\n2056-4538 John Wiley & Sons, Inc. Hoboken, USA \n\n33180365\n10.1002/cjp2.187\nCJP2187\nBrief Report\nBrief Report\n\nTFE3 activation in a TSC1‐altered malignant PEComa: challenging the dichotomy of the underlying pathogenic mechanisms\nTFE3 activation in a TSC1‐altered malignant PEComaM Schmiester et alSchmiester Maren \n1\n\n2\nmaren.schmiester@charite.de Dolnik Anna \n1\n Kornak Uwe \n3\n\n4\n Pfitzner Berit \n5\n Hummel Michael \n6\n Treue Denise \n6\n Hartmann Arndt \n7\n Agaimy Abbas \n7\n Weyerer Veronika \n7\n Lekaj Anja \n3\n Brakemeier Susanne \n8\n Peters Robert \n9\n Öllinger Robert \n10\n Märdian Sven \n11\n Bullinger Lars \n1\n\n12\n Striefler Jana Käthe \n1\n\n†\n Flörcken Anne \n1\n\n†\n \n1 \nDepartment of Hematology, Oncology, and Tumor Immunology\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n2 \nBerlin Institute of Health (BIH)\nBerlin\nGermany\n\n\n3 \nInstitute of Medical Genetics and Human Genetics\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n4 \nInstitute of Human Genetics\nUniversity Medical Center Göttingen\nGöttingen\nGermany\n\n\n5 \nInstitute of Pathology\nDRK Kliniken Berlin Westend\nBerlin\nGermany\n\n\n6 \nInstitute of Pathology\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n7 \nInstitute of Pathology\nFriedrich‐Alexander‐University Erlangen‐Nürnberg, University Hospital Erlangen\nErlangen\nGermany\n\n\n8 \nDepartment of Nephrology and Medical Intensive Care\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n9 \nDepartment of Urology\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n10 \nDepartment of Surgery\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n11 \nCenter for Musculoskeletal Surgery\nCharité‐Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin, Humboldt‐Universität zu Berlin, and Berlin Institute of Health\nBerlin\nGermany\n\n\n12 \nGerman Cancer Consortium (DKTK), Partner Site Berlin, and German Cancer Research Center (DKFZ)\nHeidelberg\nGermany\n\n* \nCorrespondence: Maren Schmiester, Department of Hematology, Oncology, and Tumor Immunology, Maren Schmiester, Charité‐Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany. E‐mail: maren.schmiester@charite.de\n† These authors contributed equally to this work.\n\n\n12 11 2020 \n1 2021 \n7 1 10.1002/cjp2.v7.13 9\n02 7 2020 25 9 2020 30 9 2020 © 2020 The Authors. The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland & John Wiley & Sons, Ltd.This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Abstract\nPerivascular epithelioid cell tumors (PEComas) form a family of rare mesenchymal neoplasms that typically display myomelanocytic differentiation. Upregulation of mTOR signaling due the inactivation of TSC1/2 (Tuberous Sclerosis 1 and 2) is believed to be a key oncogenic driver in this disease. Recently, a subgroup of PEComas harboring TFE3 (Transcription Factor E3) rearrangements and presenting with a distinctive morphology has been identified. TSC1/2 and TFE3 aberrations are deemed to be mutually exclusive in PEComa, with two different pathogenic mechanisms assumed to lead to tumorigenesis. Here, we challenge this dichotomy by presenting a case of a clinically aggressive TCS1‐mutated PEComa displaying a TFE3‐altered phenotype. FISH analysis was suggestive of a TFE3 inversion; however, RNA and whole genome sequencing was ultimately unable to identify a fusion involving the gene. However, a copy number increase of the chromosomal region encompassing TFE3 was detected and transcriptome analysis confirmed upregulation of TFE3, which was also seen at the protein level. Therefore, we believe that the TSC1/2‐mTOR pathway and TFE3 overexpression can simultaneously contribute to tumorigenesis in PEComa. Our comprehensive genetic analyses add to the understanding of the complex pathogenic mechanisms underlying PEComa and harbor insights for clinical treatment options.\n\nPEComaTFE3TSC1whole genome sequencingRNA sequencingFISHGerman Cancer Consortium (DKTK) 10.13039/501100012353 source-schema-version-number2.0cover-dateJanuary 2021details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.9.5 mode:remove_FC converted:15.12.2020No conflicts of interest were declared.\n==== Body\nIntroduction\nPEComas are a family of mesenchymal tumors that demonstrate immunoreactivity for both melanocytic and smooth muscle markers [1, 2]. They form a biological continuum ranging from benign to overtly malignant aggressive neoplasms. Malignant PEComas are exceedingly rare, with only about 100 cases described in the literature. Radical resection remains the favored treatment option in localized tumors. In locally advanced or metastatic disease, single case studies report short‐lived responses to chemotherapy containing doxorubicin, ifosfamide or gemcitabine [3].\n\nGermline or somatic mutations of the genes TSC1 or TSC2 (TSC1/2) are a driving factor in PEComa development, resulting in activation of the mammalian target of rapamycin (mTOR) pathway [4, 5]. These alterations are the basis for palliative therapy with mTOR inhibitors [3].\n\nA subset of PEComas harboring TFE3 gene fusions has recently been identified, adding them to the group of Xp11 translocation cancers. Here, the introduction of a constitutively active promotor causes oncogenic upregulation of the TFE3 transcription factor [6, 7]. Beside Xp11 translocations, several other causative genomic alterations for TFE3 activation likely exist [8].\n\nCurrent consensus is that TFE3 and TSC1/2 alterations define distinct biological PEComa subgroups and are mutually exclusive [6, 9, 10]. Here, we report for the first time a malignant PEComa with TFE3 activation and heterozygous loss of TSC1. This case challenges the molecular dichotomy in this tumor entity.\n\nMaterials and methods\nStudied case\nAnalyses were performed on tumor samples obtained from a 47‐year‐old woman diagnosed with PEComa in 2017. Written informed consent for the analyses was provided by the patient and posthumously by her husband according to local ethical guidelines.\n\nImmunohistochemical staining and fluorescence in situ hybridization\nSamples of the primary tumor and metastases were formalin‐fixed and paraffin‐embedded. H&E stained slides were evaluated by specialized pathologists at Charité‐Universitätsmedizin Berlin and the reference center for urogenital and soft tissue pathology at the Institute of Pathology of the University Erlangen‐Nürnberg in Erlangen, Germany. Immunohistochemistry was performed as described in Supplementary materials and methods using antibodies listed in supplementary material, Table S1.\n\nMolecular analyses\nQuantitative PCR, targeted exome sequencing, RNA sequencing (RNA‐Seq) and nanopore long‐read whole‐genome sequencing was performed as described in Supplementary materials and methods.\n\nResults and discussion\nCase description\nIn 2017, a 47‐year‐old woman with known tuberous sclerosis complex (TSC) due to a heterozygous germline TSC1 deletion presented with abdominal pain. A CT scan revealed a mass in the right kidney, leading to the clinical diagnosis of angiomyolipoma. Everolimus was initiated at a low dose of 2.5 mg once daily in accordance with the patient's wishes, resulting in trough levels of 2.5–4 ng/ml.\n\nFour months later, imaging showed rapid growth of the mass. With suspicion of renal cell carcinoma, a radical nephrectomy was performed. Histopathological examination led to the diagnosis of a PEComa, which was 120 × 110 × 110 mm in size and resected to R0. A CT scan of the lungs showed no pulmonary metastases and the tumor board recommended no adjuvant therapy.\n\nFour months later, recurrence was seen in a follow‐up CT scan in the region T12‐L4. The patient reported no symptoms at this time. Everolimus was re‐initiated at 5 mg twice daily. In addition, sorafenib was administered at 200 mg twice daily but had to be discontinued after 2 months due to intolerable gastrointestinal side effects. The patient also received radiation therapy of the painful paravertebral mass (39–45.5 Gy), leading to pronounced tumor regression.\n\nHowever, hepatic masses appeared after 12 weeks and histopathology confirmed the diagnosis of metastatic malignant PEComa. The patient underwent surgery with R1 resection and did not return to our clinic for 4 months. By then, multiple hepatic, osseous and pulmonary metastases had developed. Chemotherapy with doxorubicin (75 mg/m2) could only be administered once and the patient died of the disease in 2018.\n\nDistinctive TFE3‐rearranged phenotype in a TSC1‐altered PEComa\n\nHistomorphologically, conventional PEComas (so called epithelioid angiomyolipomas) display a monophasic pattern of predominantly epithelioid cells and lack adipose tissue and dysmorphic blood vessels [11]. TFE3‐rearranged PEComas show epithelioid cells arranged into a distinctive nested and pseudoalveolar pattern [6, 10]. The PEComa presented here matched the latter description, displaying a solid, partially nested‐alveolar architecture with extensive tumor necrosis as well as hemorrhage. Adipose tissue and spindle cells were completely absent. The tumor cells contained voluminous, eosinophilic and partially clear cytoplasm with prominent nucleoli and pleomorphic nuclei. Marked nuclear atypia was present (Figure 1A).\n\nFigure 1 PEComa histology and immunohistochemistry (IHC). (A) Representative image of the histomorphological appearance of the presented case (100‐fold total magnification, H&E staining). (B) TFE3 expression in tumor cells (200‐fold total magnification). (C) No MiTF expression in tumor cells from primary tumor (200‐fold total magnification). (D) MiTF expression in tumor cells from hepatic metastasis (200‐fold total magnification).\n\nImmunohistochemical examination of the vital tumor cells revealed partial patchy expression of HMB45, focal expression of Melan A and weak positivity for Cathepsin K, which was mirrored at the RNA level (see supplementary material, Figure S1). There was no immunoreactivity for PAX8, smooth muscle actin and desmin and strong nuclear positivity for TFE3 was observed, again matching the phenotype of TFE3‐altered PEComas (Figure 1B) [6, 10]. As opposed to the primary tumor, MiTF positivity was seen in hepatic metastases (Figure 1C,D), while pulmonary metastases displayed only weak MiTF mRNA expression (see supplementary material, Figure S1). Many TFE3‐rearranged PEComas are MiTF‐nonimmunoreactive and it has been suggested that the TFE3 fusion protein substitutes for MiTF [6]. We consider tumor heterogeneity a possible explanation for the differential MiTF expression, with perhaps only a subset of tumor cells exhibiting TFE3 activation.\n\nEvidence for a dual pathogenic mechanism involving TFE3 and TSC1 in our PEComa case\nThe known heterozygous germline TSC1 deletion was verified by real‐time PCR (see supplementary material, Figure S2) and only residual TSC1 expression was seen in the transcriptome (see supplementary material, Figure S1). The tumor morphology and TFE3 immunoreactivity, however, were suggestive of a TFE3 fusion. Therefore, fluorescence in situ hybridization (FISH) analysis was performed on the primary tumor. Out of 50 tumor cells, only three showed a translocated break‐apart signal (Figure 2A). The other examined cells did not meet the break‐apart cutoff values, but several cells displayed one co‐localization signal and one small separation of the 5′TFE3 and 3′TFE3 probes (Figure 2B). Similar subtle break‐apart patterns have been described in tumors harboring TFE3 inversions rather than translocations [12, 13, 14]. However, RNA‐Seq analysis performed on a pulmonary PEComa lesion was unable to identify any gene fusions involving TFE3. In order to find aberrations missed by RNA‐Seq, we next performed long‐read whole genome sequencing. Structural variant calling also did not detect TFE3 fusions. However, multiple copy number gains were found, including a large 36 Mbp region encompassing TFE3 on chrX:22015149‐58073962 (Figures 3 and 4). Transcriptome analysis detected an increase in levels of TFE3 mRNA in tumor cells compared to dermal fibroblast controls after normalization for expression of housekeeping genes (see supplementary material, Figure S1). Therefore, similar to Xp11 translocation cancers, TFE3 overexpression is one likely oncogenic driver in this tumor [15].\n\nFigure 2 Interphase FISH with TFE3 break‐apart probe. (A) Break‐apart signal as seen in 6% of cells (arrow). (B) Small separation of the TFE3 probes (arrow).\n\nFigure 3 Genomic profiling by an Oxford Nanopore Sequencing‐based assay of PEComa chromosomes 1‐22 finds multiple copy number variations. 2‐Fold genome coverage was achieved; counts averaged over 0.5 MB. Chromosome X is not analyzed or depicted here due to the algorithm used.\n\nFigure 4 Genomic profiling by an Oxford Nanopore Sequencing‐based assay of PEComa chromosome X finds copy number gain at chrX:22015149‐58073962. 2‐Fold genome coverage was achieved. Copy number variation for chromosome X (top left panel) and enlarged view of copy number changes for TFE3 (lower right panel).\n\nIn addition, targeted exome sequencing revealed a coexistent TP53 mutation. The variant NM_000546.5:c.614A>G (p.Y205C) found was classified as pathogenic. TP53 mutations do occur concurrently with TSC1/2 mutations [10] but have not been described in TFE3‐altered PEComas until now. No additional pathogenic mutations were detected in the other genes tested in our panel (see supplementary material, Table S2).\n\nConclusion and clinical remarks\nIn the case presented here, it is clear that the heterozygous loss of TSC1 predisposed to PEComa development, but we believe that the sequential gain of TFE3 contributed to tumorigenesis. Interestingly, the observed TFE3 activation was not due to a TFE3 gene fusion, analogous to reports on TFE3‐expressing/nontranslocated renal cell carcinomas. These tumors are hypothesized to share a biological mechanism with their translocated counterparts based on a similar morphology, immunolabeling and increased expression of a common RNA read‐through molecule [16, 17]. In some of these neoplasms, TFE3 amplification leads to increased gene expression, but other mechanisms resulting in elevated TFE3 levels likely also exist [8, 18]. The same presumably holds true for PEComas like the one presented here. Regarding the TFE3 expression in our case, clonal tumor evolution appears to have played an additional role during the course of disease. At initial diagnosis, FISH analysis was unable to detect a TFE3 amplification in the primary tumor, although genomic profiling of metastases later revealed a copy number gain. Perhaps the additional TP53 mutation, which presumably also contributed to the complex karyotypic changes, promoted the selection of a TFE3‐expressing PEComa subclone in which genomic material on chromosome X was consecutively gained. Indeed, the differential MiTF expression observed here suggests tumor heterogeneity and supports our hypothesis of clonal tumor evolution.\n\nTo our knowledge, this is the first case with confirmed heterozygous deletion in a TSC gene and concomitant TFE3 activation with a distinctive malignant epithelioid phenotype. This finding challenges the biological distinction of TFE3‐ and TCS1/2‐altered PEComas. The notion that both the TSC1/2‐mTOR pathway and TFE3 overexpression can simultaneously contribute to tumorigenesis in PEComa is of translational clinical importance. TSC1/2‐mutated PEComas sometimes respond to mTOR‐inhibition therapy [19], but these drugs are mechanistically believed to be inefficient in TFE3‐altered PEComa. MET‐inhibitors, on the other hand, are active in alveolar soft part sarcoma with TFE3 rearrangement [20], a rare subtype of soft‐tissue sarcoma, and could constitute a therapeutic option for TFE3 overexpressing PEComas. Importantly, when there is evidence of dual pathway activation, it appears reasonable to combine both drugs.\n\nAuthor contributions statement\nAF, LB, AD, UK and MS designed the research. AD, DT and AL performed the experiments. LB, AD, UK, BMP, VW, AH, AA and MS analyzed and interpreted the data. MS and JKS wrote the manuscript. AF, LB, AD, UK, DT, MH, BP, VW, AH, AA, SB, RP, RÖ and SM critically commented on and edited the manuscript. All authors have read and approved the manuscript.\n\nSupporting information\n\nSupplementary materials and methods\n\n\n\nFigure S1. Expression levels of candidate genes in tumor tissue detected by RNA‐Seq compared to dermal fibroblasts\n\n\nFigure S2. Results of quantitative PCR for determination of TSC1 copy number compared to the autosomal ALB and the X‐chromosomal F8 gene loci\n\n\nTable S1. Antibodies used for immunohistochemical staining\n\n\nTable S2. Genes covered in the NGS panel developed for clinical service at Charité – Universitätsmedizin Berlin\n\nClick here for additional data file.\n\n Acknowledgements\nThis study was supported by the German Cancer Consortium (DKTK). MS is a participant in the BIH‐Charité Clinician Scientist Program funded by the Charité‐Universitätsmedizin Berlin and Berlin Institute of Health. Open access funding enabled and organized by Projekt DEAL.\n==== Refs\nReferences\n1 \n\nFolpe \nAL \n, \nKwiatkowski \nDJ \n. Perivascular epithelioid cell neoplasms: pathology and pathogenesis\n. Hum Pathol \n2010 ; 41: \n1 –15\n.19604538 \n2 \n\nThway \nK \n, \nFisher \nC \n. PEComa: morphology and genetics of a complex tumor family\n. Ann Diagn Pathol \n2015 ; 19: \n359 –368\n.26144278 \n3 \n\nSobiborowicz \nA \n, \nCzarnecka \nAM \n, \nSzumera‐Ciećkiewicz \nA \n, et al\nDiagnosis and treatment of malignant PEComa tumours\n. Oncol Clin Pract \n2020 ; 16: \n22 –33\n.\n4 \n\nPan \nCC \n, \nChung \nMY \n, \nNg \nKF \n, et al\nConstant allelic alteration on chromosome 16p (TSC2 gene) in perivascular epithelioid cell tumour (PEComa): genetic evidence for the relationship of PEComa with angiomyolipoma\n. J Pathol \n2008 ; 214: \n387 –393\n.18085521 \n5 \n\nHenske \nEP \n, \nNeumann \nHP \n, \nScheithauer \nBW \n, et al\nLoss of heterozygosity in the tuberous sclerosis (TSC2) region of chromosome band 16p13 occurs in sporadic as well as TSC‐associated renal angiomyolipomas\n. Genes Chromosomes Cancer \n1995 ; 13: \n295 –298\n.7547639 \n6 \n\nArgani \nP \n, \nAulmann \nS \n, \nIllei \nPB \n, et al\nA distinctive subset of PEComas harbors TFE3 gene fusions\n. Am J Surg Pathol \n2010 ; 34: \n1395 –1406\n.20871214 \n7 \n\nKauffman \nEC \n, \nRicketts \nCJ \n, \nRais‐Bahrami \nS \n, et al\nMolecular genetics and cellular features of TFE3 and TFEB fusion kidney cancers\n. Nat Rev Urol \n2014 ; 11: \n465 –475\n.25048860 \n8 \n\nMacher‐Goeppinger \nS \n, \nRoth \nW \n, \nWagener \nN \n, et al\nMolecular heterogeneity of TFE3 activation in renal cell carcinomas\n. Mod Pathol \n2012 ; 25: \n308 –315\n.22037260 \n9 \n\nMalinowska \nI \n, \nKwiatkowski \nDJ \n, \nWeiss \nS \n, et al\nPerivascular epithelioid cell tumors (PEComas) harboring TFE3 gene rearrangements lack the TSC2 alterations characteristic of conventional PEComas: further evidence for a biological distinction\n. Am J Surg Pathol \n2012 ; 36: \n783 –784\n.22456611 \n10 \n\nAgaram \nNP \n, \nSung \nYS \n, \nZhang \nL \n, et al\nDichotomy of genetic abnormalities in PEComas with therapeutic implications\n. Am J Surg Pathol \n2015 ; 39: \n813 –825\n.25651471 \n11 \n\nBao \nL \n, \nShi \nY \n, \nZhong \nJ \n, et al\nHistopathologic characteristics and immunotypes of perivascular epithelioid cell tumors (PEComa)\n. Int J Clin Exp Pathol \n2019 ; 12: \n4380 –4389\n.31933841 \n12 \n\nArgani \nP \n, \nZhang \nL \n, \nSung \nYS \n, et al\nA novel RBMX‐TFE3 gene fusion in a highly aggressive pediatric renal perivascular epithelioid cell tumor\n. Genes Chromosomes Cancer \n2020 ; 59: \n58 –63\n.\n13 \n\nMcGregor \nSM \n, \nAlikhan \nMB \n, \nJohn \nRA \n, et al\nMelanotic PEComa of the sinonasal mucosa with NONO‐TFE3 fusion: an elusive mimic of sinonasal melanoma\n. Am J Surg Pathol \n2017 ; 41: \n717 –722\n.28009605 \n14 \n\nKato \nI \n, \nFuruya \nM \n, \nBaba \nM \n, et al\nRBM10‐TFE3 renal cell carcinoma characterised by paracentric inversion with consistent closely split signals in break‐apart fluorescence in‐situ hybridisation: study of 10 cases and a literature review\n. Histopathology \n2019 ; 75: \n254 –265\n.30908700 \n15 \n\nYin \nX \n, \nWang \nB \n, \nGan \nW \n, et al\nTFE3 fusions escape from controlling of mTOR signaling pathway and accumulate in the nucleus promoting genes expression in Xp11.2 translocation renal cell carcinomas\n. J Exp Clin Cancer Res \n2019 ; 38: \n119 .30849994 \n16 \n\nPflueger \nD \n, \nSboner \nA \n, \nStorz \nM \n, et al\nIdentification of molecular tumor markers in renal cell carcinomas with TFE3 protein expression by RNA sequencing\n. Neoplasia \n2013 ; 15: \n1231 –1240\n.24339735 \n17 \n\nGreen \nWM \n, \nYonescu \nR \n, \nMorsberger \nL \n, et al\nUtilization of a TFE3 break‐apart FISH assay in a renal tumor consultation service\n. Am J Surg Pathol \n2013 ; 37: \n1150 –1163\n.23715164 \n18 \n\nDurinck \nS \n, \nStawiski \nEW \n, \nPavía‐Jiménez \nA \n, et al\nSpectrum of diverse genomic alterations define non‐clear cell renal carcinoma subtypes\n. Nat Genet \n2015 ; 47: \n13 –21\n.25401301 \n19 \n\nDickson \nMA \n, \nSchwartz \nGK \n, \nAntonescu \nCR \n, et al\nExtrarenal perivascular epithelioid cell tumors (PEComas) respond to mTOR inhibition: clinical and molecular correlates\n. Int J Cancer \n2013 ; 132: \n1711 –1717\n.22927055 \n20 \n\nSchoffski \nP \n, \nWozniak \nA \n, \nKasper \nB \n, et al\nActivity and safety of crizotinib in patients with alveolar soft part sarcoma with rearrangement of TFE3: European Organization for Research and Treatment of Cancer (EORTC) phase II trial 90101 ‘CREATE’\n. Ann Oncol \n2018 ; 29: \n758 –765\n.29216400\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2056-4538",
"issue": "7(1)",
"journal": "The journal of pathology. Clinical research",
"keywords": "FISH; PEComa; RNA sequencing; TFE3; TSC1; whole genome sequencing",
"medline_ta": "J Pathol Clin Res",
"mesh_terms": "D051778:Basic Helix-Loop-Helix Leucine Zipper Transcription Factors; D014408:Biomarkers, Tumor; D056915:DNA Copy Number Variations; D018450:Disease Progression; D017809:Fatal Outcome; D005260:Female; D005784:Gene Amplification; D020869:Gene Expression Profiling; D020022:Genetic Predisposition to Disease; D006801:Humans; D017404:In Situ Hybridization, Fluorescence; D007680:Kidney Neoplasms; D008875:Middle Aged; D009154:Mutation; D054973:Perivascular Epithelioid Cell Neoplasms; D010641:Phenotype; D015533:Transcriptional Activation; D016896:Treatment Outcome; D000077004:Tuberous Sclerosis Complex 1 Protein; D000073336:Whole Genome Sequencing",
"nlm_unique_id": "101658534",
"other_id": null,
"pages": "3-9",
"pmc": null,
"pmid": "33180365",
"pubdate": "2021-01",
"publication_types": "D002363:Case Reports; D013485:Research Support, Non-U.S. Gov't",
"references": "19604538;18085521;25651471;7547639;22927055;24339735;26144278;30849994;22037260;31408245;30908700;29216400;28009605;20871214;25401301;31933841;23715164;25048860;22456611",
"title": "TFE3 activation in a TSC1-altered malignant PEComa: challenging the dichotomy of the underlying pathogenic mechanisms.",
"title_normalized": "tfe3 activation in a tsc1 altered malignant pecoma challenging the dichotomy of the underlying pathogenic mechanisms"
} | [
{
"companynumb": "DE-MYLANLABS-2021M1039815",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "EVEROLIMUS"
},
"drugadditional": null,
... |
{
"abstract": "Still disease is a rare systemic connective tissue disease of unknown etiology, which due to nonspecific symptoms, requires thorough diagnostics. Steroids are the basis treatment, while other immunosuppressive drugs should be applied for patients who are resistant to standard therapy.\nA 36-year-old woman was admitted to the Department of Rheumatology due to a month history of persisting fever, arthralgia, cervical lymphadenopathy, soar throat, cutaneous lesions, liver transaminases elevation, hyperferritinemia and elevated inflamatory markers. Basing on the clinical presentation and additional diagnostic examinations the adult-onset Still's disease (AOSD) was diagnosed. Initially the patient was placed on steroids and cyclosporine but due to the severe clinical course requiring high doses of steroids and relapses triggered by the tapering of the dose, the decision to initate the treatment with cyclophosphamide was made. It eventually led to the fast and lasting remission and allowed tapering and subsequent discontinuation of the steroids.\n\n\nCONCLUSIONS\nTreatment with cyclophosphamide may be a viable and efficient therapeutic option in severe and refractory cases of AOSD.",
"affiliations": "Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.;Division of Rheumatology, Masovian Specialist Hospital, Radom.;Department of Internal Medicine and Rheumatology, Military Institute of Medicinie, Warsaw.",
"authors": "Przybyszewska|Weronika|W|;Geisler|Piotr|P|;Kisiel|Bartlomiej|B|;Raczkiewicz|Anna|A|;Elert-Kopec|Sylwia|S|;Malczuk|Ewa|E|;Choros|Danuta|D|;Tlustochowicz|Witold|W|",
"chemical_list": "D007166:Immunosuppressive Agents; D003520:Cyclophosphamide",
"country": "Poland",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1426-9686",
"issue": "49(293)",
"journal": "Polski merkuriusz lekarski : organ Polskiego Towarzystwa Lekarskiego",
"keywords": "Still disease; cyclophosphamide",
"medline_ta": "Pol Merkur Lekarski",
"mesh_terms": "D000328:Adult; D003520:Cyclophosphamide; D005260:Female; D005334:Fever; D006801:Humans; D007166:Immunosuppressive Agents; D016706:Still's Disease, Adult-Onset",
"nlm_unique_id": "9705469",
"other_id": null,
"pages": "317-373",
"pmc": null,
"pmid": "34800027",
"pubdate": "2021-10-22",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "The use of cyclophosphamide in the treatment of Still's disease - a case report.",
"title_normalized": "the use of cyclophosphamide in the treatment of still s disease a case report"
} | [
{
"companynumb": "PL-LUPIN PHARMACEUTICALS INC.-2021-26674",
"fulfillexpeditecriteria": "2",
"occurcountry": "PL",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugad... |
{
"abstract": "The oncological treatment for advanced stage head and neck cancer is based on a combination of cisplatin and cetuximab, and radiotherapy. However, very few data are available on this multimodal approach for this type of cancer in pancreas and renal recipients. We report the case of a pancreas and renal recipient being treated with combined chemoradiotherapy for a locally advanced squamous cancer of the larynx. The patient was under treatment with ciclosporin-based immunosuppressive therapy at the time of cancer diagnosis, which was then replaced by everolimus. After 4 years of follow-up, the patients is still free from disease, with a local complete response, only mild residual dysphonia, and with edema of the chin. Cetuximab plus radiation could be an adequate option for cancer treatment in solid organ transplant recipients affected by locally advanced head and neck cancer; the concomitant use of mammalian target of rapamycin pathway inhibitors may have a synergistic effect in enhancing tumor control in these patients; however, further dedicated studies are warranted.",
"affiliations": "aRadiotherapy Department, ASST Cremona bUnit of Molecular Therapy and Pharmacogenomics, ASST Cremona cDepartment of Molecular and Translational Medicine, Section of Pharmacology and University Center DIFF-Drug Innovation Forward Future, University of Brescia, Brescia dDepartment of Medical, Surgery, and Health Sciences, University of Trieste, Piazza Ospitale 1, Trieste, Italy.",
"authors": "Bonetta|Alberto|A|;Bandera|Laura|L|;Roviello|Giandomenico|G|;Cafaro|Ines|I|;Bottini|Alberto|A|;Generali|Daniele|D|",
"chemical_list": "D000970:Antineoplastic Agents; D000068818:Cetuximab",
"country": "England",
"delete": false,
"doi": "10.1097/CAD.0000000000000352",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-4973",
"issue": "27(5)",
"journal": "Anti-cancer drugs",
"keywords": null,
"medline_ta": "Anticancer Drugs",
"mesh_terms": "D000970:Antineoplastic Agents; D000068818:Cetuximab; D059248:Chemoradiotherapy; D006801:Humans; D016030:Kidney Transplantation; D007822:Laryngeal Neoplasms; D008297:Male; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D018307:Neoplasms, Squamous Cell; D016035:Pancreas Transplantation",
"nlm_unique_id": "9100823",
"other_id": null,
"pages": "470-3",
"pmc": null,
"pmid": "26908347",
"pubdate": "2016-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Neoadjuvant chemotherapy and radical radiotherapy associated with cetuximab for laryngeal cancer in a pancreas and renal recipient.",
"title_normalized": "neoadjuvant chemotherapy and radical radiotherapy associated with cetuximab for laryngeal cancer in a pancreas and renal recipient"
} | [
{
"companynumb": "IT-ACCORD-041289",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": null,
"dr... |
{
"abstract": "OBJECTIVE\nHodgkin's lymphoma (HL) is a well-curable disease. The treatment usually includes combined multiagent conventional chemotherapy and radiotherapy. One-fifth of the patients need repeated treatments because of relapse or primary progressive disease. Those HL patients, who cannot be cured at least with salvage therapy (including autologous haemopoietic stem cell transplantation (auto-HSCT)), have really unfavourable prognosis.\n\n\nMETHODS\nFor this heavily pretreated subset of HL patients, novel but less toxic treatment strategies should be considered. Brentuximab-vedotin (BV) is a novel targeted treatment option, which was administered after the failure of two different regimens in patients, who were ineligible for auto-HSCT or after the failure of auto-HSCT. Moreover, there are favourable data with chemotherapeutical regimens supplemented with rituximab not only in relapsed but also in newly diagnosed classical HL patients. Bendamustine, an almost forgotten 50-year-old drug, lives its renaissance in the twenty-first century, which can be administered in refractory HL as well. Combination of the 'new' and 'old' drugs might be also helpful.\n\n\nCONCLUSIONS\nOur data suggest that rituximab plus bendamustine (supplemented with or without BV) could be a suitable alternative bridging salvage therapy for heavily pretreated HL patients.",
"affiliations": "a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;b Scanomed Ltd , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.;a Department of Hematology , Institute for Internal Medicine, Faculty of Medicine, University of Debrecen , Debrecen , Hungary.",
"authors": "Magyari|Ferenc|F|;Barna|Sándor|S|;Husi|Kata|K|;Simon|Zsófia|Z|;Miltényi|Zsófia|Z|;Váróczy|László|L|;Udvardy|Miklós|M|;Illés|Árpád|Á|",
"chemical_list": "D018796:Immunoconjugates; D000069283:Rituximab; D000079963:Brentuximab Vedotin",
"country": "England",
"delete": false,
"doi": "10.1080/10245332.2015.1115192",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1024-5332",
"issue": "21(7)",
"journal": "Hematology (Amsterdam, Netherlands)",
"keywords": "18FDG-PET/CT; Bendamustine; Brentuximab-vedotin; Classical HL; Rituximab",
"medline_ta": "Hematology",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D000079963:Brentuximab Vedotin; D005260:Female; D006689:Hodgkin Disease; D006801:Humans; D018796:Immunoconjugates; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D000069283:Rituximab; D016879:Salvage Therapy; D055815:Young Adult",
"nlm_unique_id": "9708388",
"other_id": null,
"pages": "404-10",
"pmc": null,
"pmid": "26907830",
"pubdate": "2016-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Alternative salvage regimens for relapsed/refractory classical Hodgkin's lymphoma.",
"title_normalized": "alternative salvage regimens for relapsed refractory classical hodgkin s lymphoma"
} | [
{
"companynumb": "HU-PFIZER INC-2016393147",
"fulfillexpeditecriteria": "1",
"occurcountry": "HU",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": null,
... |
{
"abstract": "Imatinib is generally well tolerated in the treatment of advanced gastrointestinal stromal tumors (GIST). Gastrointestinal vascular ectasia (GIVE) and gastric antral vascular ectasia (GAVE), while rare, are significant under-reported complications of imatinib therapy.\n\n\n\nWe present one patient with GIVE complicating imatinib therapy with a literature review of this rare side-effect.\n\n\n\nA 68-year-old woman was diagnosed with advanced GIST, wild-type CKIT. After 3 months of treatment with imatinib, she had partial response. However, she was diagnosed with GAVE and, later, also with GIVE. During her 3-year imatinib treatment, she suffered from severe anemia and required blood transfusions. Conservative treatments were not helpful and the ectatic lesions resolved only with cessation of imatinib.\n\n\n\nThis confirms a causal relationship between GIVE and imatinib. GIVE and GAVE should be considered possible causes of anemia and upper gastrointestinal bleeding in patients receiving imatinib therapy.",
"affiliations": "Division of Oncology, Rambam-Health Care Campus and Faculty of Medicine, Technion-Israel Institute of Technology, Haifa, Israel.;Department of Gastroenterology, Rambam-Health Care Campus and Faculty of Medicine, Technion-Israel Institute of Technology, Haifa, Israel.;Division of Oncology, Rambam-Health Care Campus and Faculty of Medicine, Technion-Israel Institute of Technology, Haifa, Israel g_barsela@rambam.health.gov.il.",
"authors": "Abu-Amna|Mahmoud|M|;Awadie|Halim|H|;Bar-Sela|Gil|G|",
"chemical_list": "D000970:Antineoplastic Agents; D000068877:Imatinib Mesylate",
"country": "Greece",
"delete": false,
"doi": "10.21873/anticanres.11206",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0250-7005",
"issue": "36(11)",
"journal": "Anticancer research",
"keywords": "Gastric antral vascular ectasia; gastrointestinal hemorrhage; gastrointestinal stromal tumors; gastrointestinal vascular ectasia; imatinib",
"medline_ta": "Anticancer Res",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D005260:Female; D020252:Gastric Antral Vascular Ectasia; D046152:Gastrointestinal Stromal Tumors; D006801:Humans; D000068877:Imatinib Mesylate; D064847:Multimodal Imaging; D049268:Positron-Emission Tomography; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "8102988",
"other_id": null,
"pages": "6151-6154",
"pmc": null,
"pmid": "27793944",
"pubdate": "2016-11",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Imatinib-induced Gastrointestinal Vascular Ectasia in a Patient with Advanced GIST: Case Report and Literature Review.",
"title_normalized": "imatinib induced gastrointestinal vascular ectasia in a patient with advanced gist case report and literature review"
} | [
{
"companynumb": "IL-SUN PHARMACEUTICAL INDUSTRIES LTD-2016RR-129735",
"fulfillexpeditecriteria": "1",
"occurcountry": "IL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "IMATINIB MESYLATE"
},
... |
{
"abstract": "BACKGROUND\nLiver transplanted patients have excellent survival rates, but infectious complications are a major cause of morbidity and mortality. Diagnosis and treatment of tuberculosis (TB) in liver recipients are very challenging. Specific recommendations for anti-TB treatment in liver transplanted patients are lacking.\nA 22-year-old male liver transplanted patient because of biliary atresia showed unexpected acute hemoptysis while he was on immunosuppressive therapy with tacrolimus and mycophenolate mofetil. Computed tomography (CT) identified a pulmonary arteriovenous malformation (PAVM) successfully treated with endovascular embolization. A post-embolization thoracic CT revealed pulmonary cavitation and miliary pattern suggesting pulmonary TB causing PAVM. TB diagnosis was confirmed by microbiological assays and genetic amplification techniques.\n\n\nMETHODS\nAnti-TB 4-drug regimen was started. Following the beginning of treatment, liver enzymes increased. In order to clarify if liver cytolysis was due to hepatotoxicity or hepatic rejection linked to the reduction of immunosuppression or a worsening of pre-existing graft hepatitis, a liver biopsy was performed. A mild graft rejection was found so that tacrolimus doses were increased despite the risk of tubercular dissemination.\n\n\nRESULTS\nThe patient completed anti-TB therapy in 8 months with resolution of TB disease and stable liver disease.\n\n\nCONCLUSIONS\nTB management in liver transplanted patients is challenging and needs to be individualized especially if chronic graft hepatitis is present.",
"affiliations": "Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II.;Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II.;Pediatric Emergency Department, Azienda Ospedaliera di Rilievo Nazionale Santobono-Pausilipon, Naples, Italy.;Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II.;Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II.",
"authors": "Di Dato|Fabiola|F|;Nunziata|Francesco|F|;Rosa|Margherita|M|;Iorio|Raffaele|R|;Spagnuolo|Maria Immacolata|MI|",
"chemical_list": "D000995:Antitubercular Agents",
"country": "United States",
"delete": false,
"doi": "10.1097/MD.0000000000016761",
"fulltext": "\n==== Front\nMedicine (Baltimore)Medicine (Baltimore)MEDIMedicine0025-79741536-5964Wolters Kluwer Health 31415374MD-D-19-0160010.1097/MD.0000000000016761167614500Research ArticleClinical Case ReportTubercular hemoptysis in a young liver transplanted patient Case reportDi Dato Fabiola MDaNunziata Francesco MDaRosa Margherita MDbIorio Raffaele MDa∗Spagnuolo Maria Immacolata MD, PhDaNA. \na Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II\nb Pediatric Emergency Department, Azienda Ospedaliera di Rilievo Nazionale Santobono-Pausilipon, Naples, Italy.∗ Correspondence: Raffaele Iorio, Department of Translational Medical Science, Section of Pediatrics, University of Naples Federico II, Via Pansini n° 5, 80131 Naples, Italy (e-mail: riorio@unina.it).8 2019 16 8 2019 98 33 e1676122 2 2019 5 6 2019 16 7 2019 Copyright © 2019 the Author(s). Published by Wolters Kluwer Health, Inc.2019This is an open access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0\nAbstract\nRationale:\nLiver transplanted patients have excellent survival rates, but infectious complications are a major cause of morbidity and mortality. Diagnosis and treatment of tuberculosis (TB) in liver recipients are very challenging. Specific recommendations for anti-TB treatment in liver transplanted patients are lacking.\n\nPatient concerns and diagnosis:\nA 22-year-old male liver transplanted patient because of biliary atresia showed unexpected acute hemoptysis while he was on immunosuppressive therapy with tacrolimus and mycophenolate mofetil. Computed tomography (CT) identified a pulmonary arteriovenous malformation (PAVM) successfully treated with endovascular embolization. A post-embolization thoracic CT revealed pulmonary cavitation and miliary pattern suggesting pulmonary TB causing PAVM. TB diagnosis was confirmed by microbiological assays and genetic amplification techniques.\n\nIntervention:\nAnti-TB 4-drug regimen was started. Following the beginning of treatment, liver enzymes increased. In order to clarify if liver cytolysis was due to hepatotoxicity or hepatic rejection linked to the reduction of immunosuppression or a worsening of pre-existing graft hepatitis, a liver biopsy was performed. A mild graft rejection was found so that tacrolimus doses were increased despite the risk of tubercular dissemination.\n\nOutcome:\nThe patient completed anti-TB therapy in 8 months with resolution of TB disease and stable liver disease.\n\nLessons:\nTB management in liver transplanted patients is challenging and needs to be individualized especially if chronic graft hepatitis is present.\n\nKeywords\ndrug-induced liver toxicitygraft rejectionimmunocompromised patientorthotopic liver transplantation (OLT)pulmonary arteriovenous malformation (PAVM)tuberculosis (TB)OPEN-ACCESSTRUE\n==== Body\n1 Introduction\nYoung adults with liver transplant have excellent survival rates, over 80% of them surviving more than 10 years. Graft loss is most often associated with complications such as chronic rejection, hepatic artery thrombosis, and biliary complications. However, outcomes after transplantation are favorable for the majority of recipients.[1] Infectious complications are a major cause of morbidity and mortality following transplantation.[1] Prevention of infections and an aggressive diagnostic strategy are cornerstones in solid organ transplanted (SOT) patient management. The risk for active tuberculosis (TB) in these patients is estimated to be 20 to 74 times higher than in the general population.[2] Diagnosis of TB in SOT recipients is harder than in general population because of higher frequency of extrapulmonary and disseminated disease, subtle presentation, obscure locations and presence of coinfections. Furthermore, screening test for TB by tuberculin skin test (TST) and interferon-gamma related assays (IGRA) may not be reliable in SOT recipients because test sensitivity is diminished by immunosuppressants use and, in liver transplanted patients by chronic liver disease.[3,4] As a result, TB diagnosis must be considered on the basis of multiple parameters, such as anamnesis, clinical and radiographic features, microbiological assays and molecular amplification techniques from cultures. If the usual techniques cannot confirm the clinical suspicion, invasive diagnostic procedures should be considered.[5] Furthermore, clear indications are not available about management of anti-TB treatment in liver transplanted subjects, especially in those with chronic graft disease.[1,5,6]\n\n\nHemoptysis is often a self-limiting event but in fewer than 5% it may be severe or massive, representing a life-threatening condition.[7] The differential diagnosis of hemoptysis is broad and the relative frequency of possible etiologies varies significantly. Acute respiratory tract infections, asthma, chronic obstructive pulmonary disease, malignancy, and bronchiectasis are the most common causes of hemoptysis. The likelihood of TB infection associated with hemoptysis varies throughout the world with the lowest incidence in the United States and highest incidence in South Africa. Uncommon but well-known causes of hemoptysis include pulmonary embolism, pulmonary endometriosis, Goodpasture syndrome, foreign body aspiration, and arteriovenous malformations.[8] Pulmonary arteriovenous malformations (PAVMs) were first described in 1897 and consist of abnormal communications between pulmonary veins and arteries.[9] PAVMs of the lung are congenital in the majority of case and hereditary hemorrhagic telangiectasia causes up to 85% of all PAVMs.[10,11] PAVMs have also been described in acquired conditions; association between pulmonary TB and PAVMs has been reported and it was hypothesized that inflammatory processes surrounding a tubercular focus may help recruit local vessels causing a PAVM.[12,13,14]\n\n\nIn this case report, we describe a liver transplanted immunosuppressed young man who showed hemoptysis because of a PAVM as first sign of TB infection. The difficulties of anti-TB therapy in a SOT patient with an underlying chronic liver disease are addressed.\n\n2 Case presentation\nWe report the case of a 22 year-old male presenting with an unexpected episode of large-volume hemoptysis. He was followed for orthotopic liver transplantation (OLT) received at the age of 1 year because of biliary atresia not resolved by Kasai-intervention. Liver biopsy performed at the age of 17 years showed mild graft hepatitis and fibrosis for which mycophenolate mofetil was added to tacrolimus therapy, as suggested.[1,15,16,17]\n\n\nA slight and intermittent increase in liver enzymes was present in the previous 12 months (alanine-aminotransferase [ALT] maximum 2-times normal values with average values of 54 ± 14 U/L, gamma-glutamyltraspeptidase [GGT] maximum 1.8-times normal values with average values of 94 ± 15 U/L), and attributed to the mild graft hepatitis, with levels of immunosuppressive drugs in the reference range for the posttransplant period. During previous 6 months the patient presented 4 episodes of fever without localization, with a short duration and spontaneous defervescence in 2 times and after empiric antibiotic treatment the other times. There was no history of hemoptysis or gastrointestinal bleeding, chest radiography was negative and no portal hypertension neither esophageal varices were present. When hemoptysis occurred, the patient was examined at emergency department: dyspnea, pallor, and tachycardia were observed and blood pressure levels were at lower limits. After initial clinical stabilization, a thoraco-abdominal contrast-enhanced computed tomography (CT) with angiographic-sequences was performed, revealing a complex PAVM in the right lung upper lobe, involving intercostal artery and pulmonary vein, which caused a massive endoalveolar bleeding (Fig. 1). Transcatheter endovascular embolization was successfully performed resulting in resolution of symptoms.\n\nFigure 1 Complex pulmonary arteriovenous malformation in the right lung upper lobe, involving intercostal artery and pulmonary vein, surrounded by endoalveolar bleeding; thoracic contrast-enhanced computed tomography with angiographic sequences, sagittal scansion.\n\nSince multiple malformations may be associated with biliary atresia, a noninvasive malformation screening, including cerebral neuroimaging, was performed but no other anomalies were found. Meanwhile, follow-up CT performed 12 days after embolization revealed an alveolar consolidation with central cavitation in the area of PAVM and a diffuse miliary pattern, suggesting an infectious-inflammatory process likely caused by pulmonary TB (Fig. 2). TST by Mantoux intradermal reaction and IGRA test (Enzyme-Linked ImmunoSpot assay) were performed under immunosuppressive therapy and gave negative results, but genetic amplification techniques by PCR and cultures of sputum and of bronchoalveolar lavage identified a Mycobacterium tuberculosis complex with rifampicin-sensitivity. A revaluation of the first pulmonary CT revealed suggesting features of pulmonary TB that had not been previously identified, probably because the radiological picture was dominated by the massive pulmonary hemorrhage. Diagnosis of pulmonary TB was made and treatment with isoniazid, rifampicin, pyrazinamide, and ethambutol was promptly started.\n\nFigure 2 Consolidation area in the central upper region of the right lung due to a likely specific tubercular complex, associated with bilateral signs of miliary infection, more extensive to the right lung; thoracic computed tomography, axial scansion.\n\nAfter the beginning of treatment, a further increase in liver enzymes occurred (ALT maximum 4-times normal values with average values of 106 ± 49 U/L, GGT maximum 6-times normal values with average values of 149 ± 111 U/L) with normality of bilirubin, albumin, cholinesterase, and international normalized ratio (INR). Viral infection serology and assessment for autoimmune hepatitis were negative.\n\nPyrazinamide and ethambutol were suspended (+2 months of treatment) according to anti-TB treatment standard guidelines.[18] Subsequently, since an improvement in the biochemical trend described above was not observed, a liver biopsy was performed at +3 months of treatment, which found a mild inflammatory infiltrate in the minority of the triads, confined within the portal spaces and associated with slight signs of endothelitis (Banff stage 1), suggesting a late-onset mild acute rejection.[17]\n\n\nThis histopathological picture was attributable to the reduction in blood levels of tacrolimus since the first weeks of treatment, likely due to interaction with antitubercular drugs. We progressively continued to increase tacrolimus dose (until 3 times basal dose) in order to lead it to the upper limit of reference recommended range for the time of transplantation. Careful clinical and laboratory checks were performed, finding substantially stable values of liver enzymes (ALT maximum 4, 7-times normal values with average values of 149 ± 33 U/L, GGT maximum 8-times normal values with average values of 327 ± 74 U/L), normality of albumin and INR, tacrolimus blood levels in the reference range while the patient remained asymptomatic in good clinical conditions without showing threatening evolution of the infectious disease. Liver enzymes and tacrolimus levels’ profile is reported in (Fig. 3).\n\nFigure 3 Profiles of ALT, GGT, and FK levels during antitubercular treatment. ALT = alanine-aminotransferase, ETH = ethambutole, FK = tacrolimus, GGT = gamma-glutamyltraspeptidase, ISH = isoniazid, PYR = pyrazinamide, RIF = rifampicin.\n\nIsoniazid and rifampicin were continued until +8 months; negativity of several sputum smears and cultures for M. Tuberculosis were registered since the second month of therapy; pulmonary CT at the end of anti-TB treatment described a substantial regression of the infectious lung involvement with a residual small fibrotic area in the right upper lobe.\n\nClinical, biochemical, and radiological follow-up of our patient at +36 months from discontinuation of TB treatment reveals an encouraging balance, with persistent remission from tubercular disease and satisfying liver biochemical parameters which were substantially comparable to the baseline.\n\n3 Discussion\nOur case emphasizes the challenges existing in both diagnostic evaluation and therapeutic management of TB in liver transplanted patients with underlying chronic graft hepatitis pre-existing to TB infection.\n\nTB is considered as a serious complication for organ transplant recipients; prevalence of infection range from 1% to 6% and active TB can be diagnosed in 0.47% to 2.3% of liver transplanted patients, mostly in the first 12 months after OLT.[19,20] Clinical presentation of TB in immunosuppressed patients is insidious and often causing delay in diagnosis and resulting in a poor prognosis.[3,21] In our patient, who was liver transplanted for more than 20 years, before hemoptysis pulmonary TB probably presented as some episodes of fever without localization, which did not lead to a suspect of TB considering the spontaneous resolution and the absence of other peculiar features of the disease included a negative chest X-Ray. As it usually happens in OLT patients, in our case TST and IGRA yield falsely negative results due to anergy secondary to pharmacological immunosuppression and chronic liver disease.[22] In this case, TB infection was suggested only by CT images. Furthermore, diagnosis of TB was made even more difficult because it clinically appeared with an acute hemoptysis associated with a PAVM that could be interpreted as malformation in a patient with biliary atresia. In fact, several congenital malformations have been described in patients with biliary atresia.[23]\n\n\nAs for causal relationship between pulmonary TB and PAVM in our patient, PAVM seemed to be more likely related to the inflammatory tubercular process rather than a congenital PAVM, on which TB process was subsequently implanted.\n\nPharmacological management of TB in OLT recipients is often challenging for clinicians because of liver toxicity of most first-line anti-TB drugs and their pharmacokinetic interaction with chronic anti-rejection immunosuppressive therapy.[21,24] The present case underlines the main problems that can be observed in the liver transplanted patient suffering from TB: the potential hepatotoxicity of most anti-TB drugs; the lack of definite indications on composition and duration of anti-TB therapy; the need to continually adjust the immunosuppressive levels avoiding the progression of TB infection and at the same time graft rejection; the drugs interactions between antituberculars and immunosuppressants. As for the persistent increase in aminotransferases and gamma-glutamil transpeptidase levels, observed soon after the start of anti-TB treatment and persisting even after pyrazinamide withdrawal, it was difficult to establish if it was due to pre-existing chronic liver disease or to reduction in tacrolimus levels probably due to rifampicin mediated CYP3A4 induction[25,26] or to antitubercular drugs toxicity. Liver biopsy suggested a late-onset mild acute rejection we treated increasing baseline immunosuppression for 2 reasons: it was a histologically mild case of cellular rejection; a short course of increased immunosuppression with steroids could be dangerous for TB progression in our case.[6]\n\n\nAlthough guidelines for OLT recipients suggest that, for localized or non-severe forms of TB and no suspicion or evidence of resistance to isoniazid, rifampicin is not recommended,[1,24] our patient received rifampicin for his history of life-threatening hemoptysis and presence of diffuse miliary pattern.\n\nAnother critical point was duration of anti-tubercular treatment. Although there are no controlled trials assessing the optimal schedule and duration of therapy in SOT recipients, the Guidelines of the Expert Group in Renal Transplantation[27] suggest a standard 6-month regimen including rifampicin, as suggested in general population. Nevertheless, it is reasonable to use a prolonged course of treatment in the immunosuppressed SOT population.[24] Moreover, several studies have observed a higher risk of death and relapse in patients receiving short duration treatments, in particular lasting less than 9 months.[3,28]\n\n\nFor our patient, considering the good microbiological and radiological response of pulmonary TB and the vulnerability of liver during therapy, we decided to stop anti-tubercular treatment after 8 months. Our patient reached complete remission from pulmonary TB maintaining a good respiratory function and a good liver balance.\n\nOur hypothesis is that liver biochemical and histological picture of the patient was the result of a complex interaction between inadequate immunosuppression (caused by rifampicin's cytochrome-induction on tacrolimus metabolism) and a multi-drug induced liver toxicity, inscribed into a pre-existing context of chronic graft hepatitis. Furthermore, we registered a significative reduction in liver cytolysis and cholestasis parameters after suspension of TB therapy; nevertheless, the values did not return to reference range, maybe due to the pre-existing mild chronic graft disease, which is well-described in the literature and is congruous with our patients history of long time from transplant.\n\nIn conclusion, our report suggests that the complex setting of the immunocompromised patient usually offers diagnostic and therapeutic questions, whose solutions are not always explicitly coded in the literature and may rather be the result of an individualized physician's weigh up of risks and benefits.\n\nAuthor contributions\n\nConceptualization: Fabiola Di Dato, Margherita Rosa, Raffaele Iorio.\n\n\nData curation: Fabiola Di Dato, Francesco Nunziata.\n\n\nWriting – original draft: Fabiola Di Dato, Margherita Rosa.\n\n\nWriting – review and editing: Raffaele Iorio, Maria Immacolata Spagnuolo.\n\nAbbreviations: CT = computed tomography, IGRA = interferon-gamma related assays, OLT = orthotopic liver transplantation, PAVM = pulmonary arteriovenous malformation, SOT = solid-organ transplanted, TB = tuberculosis, TST = tuberculin skin test.\n\nThe patient provided written informed consent authorizing use of his protected health information for publication of this report and any accompanying images.\n\nThe authors have no conflicts of interest to disclose.\n==== Refs\nReferences\n[1] \nEuropean Association for the Study of the Liver . EASL clinical practice guidelines: liver transplantation . J Hepatol \n2016 ;64 :433 –85 .26597456 \n[2] \nHorne DJ Narita M Spitters CL \nChallenging issues in tuberculosis in solid organ transplantation . Clin Infect Dis \n2013 ;57 :1473 –82 .23899676 \n[3] \nYehia BR Blumberg EA \nMycobacterium tuberculosis infection in liver transplantation . Liver Transpl \n2010 ;16 :1129 –35 .20879011 \n[4] \nMarquez M Fernandez-Gutierrez C Montes-de-Oca M \nChronic antigenic stimuli as a possible explanation for the immunodepression caused by liver cirrhosis . Clin Exp Immunol \n2009 ;158 :219 –29 .19737142 \n[5] \nAguado JM Silva JT Samanta P \nTuberculosis and transplantation . Microbiol Spectr \n2016 ;4 : DOI: 10.1128/microbiolspec.TNMI7-0005-2016 .\n[6] \nLucey MR Terrault N Ojo L \nLong-term management of the successful adult liver transplant: 2012 practice guideline by the American Association for the study of liver diseases and the American Society of Transplantation . Liver Transpl \n2013 ;19 :3 –26 .23281277 \n[7] \nLordan JL Gascoigne A Corris PA \nThe pulmonary physician in critical care ∗ illustrative case 7: assessment and management of massive haemoptysis . Thorax \n2003 ;58 :814 –9 .12947147 \n[8] \nEarwook JS Thompson TD \nHemoptysis: evaluation and management . Am Fam Physician \n2015 ;91 :243 –9 .25955625 \n[9] \nChurton T \nMultiple aneurysms of pulmonary artery . Br Med J \n1897 ;1 :1223 .\n[10] \nFaughnan ME Palda VA Garcia-Tsao G \nInternational guidelines for the diagnosis and management of hereditary haemorrhagic telangiectasia . J Med Genet \n2011 ;48 :73 –87 .19553198 \n[11] \nSaboo SS Chamarthy M Bhalla S \nPulmonary arteriovenous malformations: diagnosis . Cardiovasc Diagn Ther \n2018 ;8 :325 –37 .30057879 \n[12] \nShovlin CL \nPulmonary arteriovenous malformations . Am J Respir Crit Care Med \n2014 ;190 :1217 –28 .25420112 \n[13] \nGossage JR Kanj G \nPulmonary arteriovenous malformations. a state of the art review . Am J Respir Crit Care Med \n1998 ;58 :643 –61 .\n[14] \nCartin-Ceba R Swanson KL Krowka MJ \nPulmonary arteriovenous malformation . Chest \n2013 ;144 :1033 –44 .24008954 \n[15] \nEvans HM Kelly DA McKiernan PJ \nProgressive histological damage in liver allografts following pediatric liver transplantation . Hepatology \n2006 ;43 :1109 –17 .16628633 \n[16] \nKelly D Verkade HJ Rajanayagam J \nLate graft hepatitis and fibrosis in pediatric liver allograft recipients: current concepts and future developments . Liver Transpl \n2016 ;22 :1593 –602 .27543906 \n[17] \nSpada M Riva S Maggiore G \nPediatric liver transplantation . World J Gastroenterol \n2009 ;15 :648 –74 .19222089 \n[18] \nNahid P Dorman SE Alipanah N \nExecutive summary: Official American Thoracic Society/Centers for disease control and prevention/infectious diseases Society of America Clinical Practice Guidelines: treatment of drug-susceptible tuberculosis . Clin Infect Dis \n2016 ;63 :853 –67 .27621353 \n[19] \nHolty JE Gould MK Meinke L \nTuberculosis in liver transplant recipients: a systematic review and meta-analysis of individual patient data . Liver Transpl \n2009 ;15 :894 –906 .19642133 \n[20] \nMunoz P Rodriguez C Bouza E \nMycobacterium tuberculosis infection in recipients of solid organ transplants . Clin Infect Dis \n2005 ;40 :581 –7 .15712081 \n[21] \nBodro M Sabé N Santín M \nClinical features and outcomes of tuberculosis in solid organ transplant recipients . Transplant Proc \n2012 ;44 :2686 –9 .23146494 \n[22] \nAbad CLR Razonable RR \nMycobacterium tuberculosis after solid organ transplantation: a review of more than 2000 cases . Clin Transplant \n2018 ;32 :e13259 .29656530 \n[23] \nSchwarz KB Haber BH Rosenthal P \nExtra-hepatic anomalies in infants with biliary atresia: results of a large prospective North American multi-center study . Hepatology \n2013 ;58 :1724 –31 .23703680 \n[24] \nMeije Y Piersimoni C Torre-Cisneros J \nESCMID study group of infection in compromised hosts. Mycobacterial infections in solid organ transplant recipients . Clin Microbiol Infect \n2014 ;20 :89 –101 .24707957 \n[25] \nChenhsu RY Loong CC Chou MH \nRenal allograft dysfunction associated with rifampin-tacrolimus interaction . Ann Pharmacother \n2000 ;34 :27 –31 .10669182 \n[26] \nHa YE Joo EJ Park SY \nTacrolimus as a risk factor for tuberculosis and outcome of treatment with rifampicin in solid organ transplant recipients . Transpl Infect Dis \n2012 ;14 :626 –34 .22372581 \n[27] \nEBPG Expert Group on Renal Transplantation . European best practice guidelines for renal transplantation. Section IV: long-term management of the transplant recipient. IV.7.2. Late infections . Tuberculosis Nephrol Dial Transplant \n2002 ;17 :39 –43 .12091644 \n[28] \nPark YS Choi JY Cho CH \nClinical outcomes of tuberculosis in renal transplant recipients . Yonsei Med J \n2004 ;45 :865 –72 .15515197\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "0025-7974",
"issue": "98(33)",
"journal": "Medicine",
"keywords": null,
"medline_ta": "Medicine (Baltimore)",
"mesh_terms": "D000995:Antitubercular Agents; D003937:Diagnosis, Differential; D005260:Female; D006084:Graft Rejection; D006469:Hemoptysis; D006801:Humans; D016867:Immunocompromised Host; D016031:Liver Transplantation; D014057:Tomography, X-Ray Computed; D014397:Tuberculosis, Pulmonary; D055815:Young Adult",
"nlm_unique_id": "2985248R",
"other_id": null,
"pages": "e16761",
"pmc": null,
"pmid": "31415374",
"pubdate": "2019-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Tubercular hemoptysis in a young liver transplanted patient: Case report.",
"title_normalized": "tubercular hemoptysis in a young liver transplanted patient case report"
} | [
{
"companynumb": "IT-PBT-000014",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PYRAZINAMIDE"
},
"drugadditional": "1",
"drugad... |
{
"abstract": "BACKGROUND\nThe contraceptive implant, Implanon NXT, was introduced in South Africa (SA) in 2014 and, although it offers multiple advantages, users may request to have it removed early for several reasons. The number of insertions of Implanon NXT has declined in SA and there have been concerns about early removals.\n\n\nOBJECTIVE\nTo gain an understanding of patterns of Implanon NXT use, reasons for requesting removal and duration of use at the time of requesting removal.\n\n\nMETHODS\nThis was a cross-sectional study conducted at an urban public-sector reproductive health clinic in the eThekwini District of KwaZulu-Natal, SA. A total of 120 women ≥18 years of age requesting removal of Implanon NXT completed an interviewer-administered questionnaire that probed experiences of use and reasons for removal. Data were collected electronically on Wits REDCap (Research Electronic Data Capture) and analysed using Stata 14 (StataCorp, USA). The study was conducted from 2017 to 2018.\n\n\nRESULTS\nA total of 120 women were interviewed. Their mean age was 28 (range 19 - 44) years and most women (n=103; 85.8%) had completed secondary school. The majority were black (n=115; 95.8%) and unmarried (n=102; 85%). Implants had been inserted primarily by nurses (n=110; 91.7%) at public-sector clinics (n=91; 75.8%). Three-quarters of the women (n=91; 75.8%) requested removal of Implanon NXT because it had reached the intended 3-year duration. Reasons for early removal were mainly due to side-effects, e.g. bleeding problems (n=19; 15.8%), weight gain (n=7; 5.8%), loss of libido (n=2; 1.7%), headaches (n=5; 4.2%), dizziness (n=4; 3.3%) and pain/numbness in the arm (n=2; 1.7%). Just more than half (57.1%) of the women who had received the implant for the intended 3-year duration had requested reinsertion of Implanon NXT.\n\n\nCONCLUSIONS\nThe main reason for requesting removal was that Implanon NXT had reached its intended 3-year duration, and more than half of the women requested reinsertion of the device following removal. Implanon NXT is a highly effective, safe, acceptable, long-acting contraceptive and important in the SA contraceptive method mix.",
"affiliations": "MatCH Research Unit (MRU), Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa. ibeesham@mru.ac.za.",
"authors": "Beesham|I|I|;Smit|J|J|;Beksinska|M|M|;Panday|M|M|;Makatini|V|V|;Evans|S|S|",
"chemical_list": "D003271:Contraceptive Agents, Female; D004343:Drug Implants; C044815:etonogestrel; D017135:Desogestrel",
"country": "South Africa",
"delete": false,
"doi": "10.7196/SAMJ.2019.v109i10.00012",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "109(10)",
"journal": "South African medical journal = Suid-Afrikaanse tydskrif vir geneeskunde",
"keywords": null,
"medline_ta": "S Afr Med J",
"mesh_terms": "D000328:Adult; D003271:Contraceptive Agents, Female; D003430:Cross-Sectional Studies; D017135:Desogestrel; D020878:Device Removal; D004343:Drug Implants; D005260:Female; D006801:Humans; D017060:Patient Satisfaction; D013019:South Africa; D013997:Time Factors; D014505:Urban Population; D055815:Young Adult",
"nlm_unique_id": "0404520",
"other_id": null,
"pages": "750-755",
"pmc": null,
"pmid": "31635572",
"pubdate": "2019-09-30",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Reasons for requesting removal of the hormonal implant, Implanon NXT, at an urban reproductive health clinic in KwaZulu-Natal, South Africa.",
"title_normalized": "reasons for requesting removal of the hormonal implant implanon nxt at an urban reproductive health clinic in kwazulu natal south africa"
} | [
{
"companynumb": "ZA-009507513-1910ZAF016374",
"fulfillexpeditecriteria": "1",
"occurcountry": "ZA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ETONOGESTREL"
},
"drugadditional": null,
... |
{
"abstract": "Malignant Pleural mesothelioma (MPM) is a rare disease which is associated with a poor prognosis. Front line chemotherapy represents the cornerstone in the management of MPM, and the place of radical surgery is controversial and reserve in early-stage disease. However prolonged survival (more than 24 months) can be observed in rare cases and only in the context of multimodal treatment including surgical management. We report the case of a patient suffering from an epithelial MPM with a 14-years progression-free survival after trimodal treatment including extrapleural pneumonectomy followed by chemotherapy and radiotherapy. This case illustrates that despite being an aggressive disease, multimodal management including radical surgery may allow a prolonged response in MPM but requires a whole-life surveillance.",
"affiliations": "Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France.;Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France.;Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France.;Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France.;Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France.",
"authors": "Guinde|Julien|J|;Chollet|Bertrand|B|;Laroumagne|Sophie|S|;Dutau|Hervé|H|;Astoul|Philippe|P|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1016/j.amsu.2020.11.034",
"fulltext": "\n==== Front\nAnn Med Surg (Lond)\nAnn Med Surg (Lond)\nAnnals of Medicine and Surgery\n2049-0801 Elsevier \n\nS2049-0801(20)30462-3\n10.1016/j.amsu.2020.11.034\nCase Report\nProlonged survival after multimodal therapy for pleural mesothelioma: Don't give up the follow-up. A case report\nGuinde Julien a Chollet Bertrand a Laroumagne Sophie a Dutau Hervé a Astoul Philippe pastoul@ap-hm.frab∗ a Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Hôpital Nord, Aix-Marseille University, Marseille, France\nb Aix-Marseille University, Marseille, France\n∗ Corresponding author. Department of Thoracic Oncology, Pleural Diseases, and Interventional Pulmonology, Chemin des Bourrely, 13915, Marseille, France. pastoul@ap-hm.fr\n11 11 2020 \n12 2020 \n11 11 2020 \n60 442 444\n31 8 2020 6 11 2020 7 11 2020 © 2020 Published by Elsevier Ltd on behalf of IJS Publishing Group Ltd.2020This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).Malignant Pleural mesothelioma (MPM) is a rare disease which is associated with a poor prognosis. Front line chemotherapy represents the cornerstone in the management of MPM, and the place of radical surgery is controversial and reserve in early-stage disease. However prolonged survival (more than 24 months) can be observed in rare cases and only in the context of multimodal treatment including surgical management. We report the case of a patient suffering from an epithelial MPM with a 14-years progression-free survival after trimodal treatment including extrapleural pneumonectomy followed by chemotherapy and radiotherapy. This case illustrates that despite being an aggressive disease, multimodal management including radical surgery may allow a prolonged response in MPM but requires a whole-life surveillance.\n\nHighlights\n• Malignant pleural mesothelioma (MPM) is a rare disease.\n\n• Prognosis of MPM is very poor despite new therapeutic agents.\n\n• The place of radical surgery still remains controversial.\n\n• Prolonged survival can be obtained by multimodal therapy including radical surgery.\n\n• Complete remission after treatment requires a whole-life surveillance.\n\n\n\nKeywords\nMesotheliomaTrimodal therapyLong survivalRecurrence\n==== Body\n1 Introduction\nMalignant mesothelioma is a rare disease of the pleura with a poor prognosis despite various treatments. Among them radical surgery remains controversial even in the setting of multimodal approach. However, the patients with prolonged survival are those managed with multimodal approach including extrapleural pneumonectomy (EPP) or pleurectomy/decortication (P/D). Usually these patients are macroscopically considered with complete tumoral resection (R0) and the challenge is the design of post therapeutic follow-up in terms of frequency and duration. Here we present, after his informed consent and according to SCARE criteria [1], the case of a patient who underwent EPP follow by adjuvant chemotherapy and radiotherapy with an extended survival and a disease recurrence 14 years after the completion of trimodal treatment.\n\n2 Presentation of case\nA 68-year-old man with a past-history of asbestos exposure was diagnosed in august 2004 with a malignant mesothelioma by pleuroscopy carried out for a left pleural effusion. Histology showed mesothelioma of epithelial type consisting of papillary and tubular structures (Fig. 1A). The tumor expressed the mesothelial markers of Calretinin, CK 5/6 and WT1. Confirmation of the diagnosis was obtained from the MESOPATH National Reference Center [2]. The patient was in excellent shape without major co-morbidity. Thoraco-abdominal CT and brain MRI showed no metastasis. Pulmonary function tests and cardio-vascular work-up were normal. The IMIG clinical stage was considered II [3]. Our MDT found the patient fitting for a multimodal treatment combining Extra Pleural Pneumonectomy (EPP) followed by chemotherapy and radiotherapy. After patient's informed consent the patient underwent an EPP in October 2004 which confirmed the stage of the disease (T2N0). The resection was considered R0. Four weeks after the surgery, a first cycle of chemotherapy, combining raltitrexed (3 mg/m2) and oxaliplatin (130 mg/m2), was administered followed three weeks after by radiotherapy with 65 Gy of the involved hemithorax for 6 weeks. Three other cycles of chemotherapy was administered starting four weeks after the completion of radiotherapy with mild hematologic toxicity and no alopecia [4]. The patient's follow-up began in June 2015 with a quarterly clinical examination and thoracic CT-scan assessment during the first year, same biannual assessment the next two years and after annual evaluation. At the start of 2018 a 18F-fluorodeoxyglucose (FDG) PET showed a metabolic nodular thickening of the left costo-diaphragmatic junction (Fig. 2). Histology obtained by percutaneous needle biopsy was consistent with a malignant mesothelioma of epithelial sub-type (Fig. 1B). The patient, 81 years-old, had an ECOG Performance Status 0 and no other co-morbidity. Our MDT indicated chemotherapy with carboplatin and pemetrexed every 21 days for 6 cycles with a stabilization of the disease for 10 months before a new progression. Palliative care was decided.Fig. 1 Histology at the initial diagnosis (A) and at the time of the recurrence (B).\n\nA. MPM epithelial sub-type consisting of papillary (Image 1) and tubular structures with myxoid stromal feature (*).\n\nB. Epithelial Malignant Mesothelioma recurrence in a more acinar pattern (arrow) (HES).\n\nFig. 1Fig. 2 18F-fluorodeoxyglucose (FDG)- PET with computed tomography show a metabolic nodular localized (A) and diffuse (B) thickening of the left costo-diaphragmatic junction.\n\nFig. 2\n\n3 Discussion\nThe standard of care since the early 2000s is a platinum-based chemotherapy regimen [4,5]. A recent study showed that the addition of bevacizumab to pemetrexed plus cisplatin significantly improved overall survival in malignant pleural mesothelioma at the cost of expected manageable toxic effects [6]. However, in this setting, prolonged progression-free survival are very scarce. Surgery for MPM, EPP or extended P/D, is usually indicated in multimodal approaches and ideally in clinical trial settings despite the outcomes of MARS trial providing no evidence of benefit, for survival or quality of life, from EPP within trimodal therapy over chemotherapy alone [7]. Reports for local recurrence rates after EPP and RT (with or without neoadjuvant or adjuvant chemotherapy) range from 9% to 41%. The common site of recurrence after extrapleural pneumonectomy and planned multimodality therapy remains the ipsilateral hemithorax (including mediastinum), and true distant failure (other than the abdomen or contralateral hemithorax) remains unusual. These results impact the modality of the surgery arguing that extended P/D which is a less radical procedure, although with higher local recurrences, might be a best surgical option. In maintaining a good PS, the patients could receive post recurrence treatment with less complications which is a significant prognostic factor for post recurrence survival, yielding long-term outcomes after recurrence. In an effort to decrease the local recurrence rate after surgery, radiation therapy (RT) has been considered after surgery. However if hemithoracic RT may be offered to patients after EPP, it is a challenge after extended P/D, even the last technological developments in this field such as IMRT which is associated with low rates of locoregional recurrence but life-threatening lung toxicity for some patients [8]. In the current case, a trimodality approach was decided. At that time (2004) a preoperative work-up combining CT scan of the chest and upper abdomen, laboratory blood tests and pulmonary function tests was done according to the IMIG [3]. Interestingly the clinical classification was in accordance to the pathological classification. A correct staging of MPM is a major step in determining which treatment modalities would be the most appropriate when a surgery is discussed. For mesothelioma patients operated on, there are no validated recommendations regarding the follow-up. Our MDT decided a close surveillance the first 3 years mainly based, beside clinical examination, on CT-scan followed by annual CT-scan after taking into account that it is likely that many recurrences are asymptomatic and detected by imaging alone. The British Thoracic Society guidelines recommend patients should be offered 3 to 4 monthly follow-up appointments with an oncologist and/or respiratory physician according to their treatment plan [9].\n\n4 Conclusion\nOur case illustrates that: first, multimodal approach including radical surgery for the treatment of MPM can lead to a complete and prolonged response. Radical surgery must remain an option for operable patient in particular at the era of new therapeutic agents (biotherapy, immunotherapy). Second, a recurrence can happened after a prolonged period leading to the necessity of whole-life surveillance. To our knowledge, it is the first case concerning a 15-year prolonged progression-free survival in patient suffering from a stage II malignant pleural mesothelioma.\n\nFunding\nNone.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.\n\nEthical approval\nNot applicable.\n\nAuthor contribution\nJG and PA collected the clinical data and wrote the paper.\n\nPA followed the patient for 14 years.\n\nBC, SL, HD approved the draft and contribute to this report.\n\nProvenance and peer review\nNot commissioned, externally peer-reviewed.\n\nGuarantor\nPhilippe ASTOUL is the guarantor of this work.\n\nDeclaration of competing interest\nNone.\n\nAppendix A Supplementary data\nThe following is the supplementary data related to this article:Multimedia component 1\nMultimedia component 1 \n\nAppendix A Supplementary data related to this article can be found at https://doi.org/10.1016/j.amsu.2020.11.034.\n==== Refs\nReferences\n1 Agha R.A. Borrelli M.R. Farwana R. Koshy K. Fowler A.J. Orgill D.P. for the SCARE Group The SCARE 2018 statement: updating consensus Surgical Case Report (SCARE) guidelines Int. J. Surg. 60 2018 132 136 30342279 \n2 Scherpereel A. Astoul P. Baas P. Guidelines of the European respiratory society and the European society of thoracic surgeons for the management of malignant pleural mesothelioma Eur. Respir. J. 35 2010 479 495 19717482 \n3 Rusch V.W. A proposed new international TNM staging system for malignant pleural mesothelioma. From the International Mesothelioma Interest Group Chest 108 1995 1122 1128 7555126 \n4 van Meerbeeck J.P. Gaafar R. Manegold C. Randomized phase III study of cisplatin with or without raltitrexed in patients with malignant pleural mesothelioma: an intergroup study of the European organisation for research and treatment of cancer lung cancer group and the national cancer institute of Canada J. Clin. Oncol. 23 2005 6881 6889 16192580 \n5 Vogelzang N.J. Rusthoven J.J. Symanowski J. Phase III study of pemetrexed in combination with cisplatin versus cisplatin alone in patients with malignant pleural mesothelioma J. Clin. Oncol. 21 2003 2636 2644 12860938 \n6 Zalcman G. Mazieres J. Margery J. Bevacizumab for newly diagnosed pleural mesothelioma in the Mesothelioma Avastin Cisplatin Pemetrexed Study (MAPS): a randomised, controlled, open-label, phase 3 trial Lancet 387 2016 1405 1414 26719230 \n7 Treasure T. Lang-Lazdunski L. Waller D. Extra-pleural pneumonectomy versus no extra-pleural pneumonectomy for patients with malignant pleural mesothelioma: clinical outcomes of the Mesothelioma and Radical Surgery (MARS) randomised feasibility study Lancet Oncol. 12 2011 763 772 21723781 \n8 Gomez D.R. Hong D.S. Allen P.K. Patterns of failure, toxicity, and survival after extrapleural pneumonectomy and hemithoracic intensity-modulated radiation therapy for malignant pleural mesothelioma J. Thorac. Oncol. 8 2013 238 245 23247629 \n9 Woolhouse I. Bishop L. Darlison L. BTS guideline for the investigation and management of malignant pleural mesothelioma BMJ Open Respir. Res. 5 2018 e000266\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2049-0801",
"issue": "60()",
"journal": "Annals of medicine and surgery (2012)",
"keywords": "Long survival; Mesothelioma; Recurrence; Trimodal therapy",
"medline_ta": "Ann Med Surg (Lond)",
"mesh_terms": null,
"nlm_unique_id": "101616869",
"other_id": null,
"pages": "442-444",
"pmc": null,
"pmid": "33251003",
"pubdate": "2020-12",
"publication_types": "D002363:Case Reports",
"references": "23247629;7555126;19717482;26719230;12860938;16192580;30342279;21723781;29531746",
"title": "Prolonged survival after multimodal therapy for pleural mesothelioma: Don't give up the follow-up. A case report.",
"title_normalized": "prolonged survival after multimodal therapy for pleural mesothelioma don t give up the follow up a case report"
} | [
{
"companynumb": "FR-PFIZER INC-2021747781",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "OXALIPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "A 53-year-old male, without any prior history of psychosis, developed schizophrenia 4 days after starting low-dose bromocriptine therapy for a macroprolactinoma. Five days after discontinuation of this medication his mental status returned to normal. This case is reported in support of the dopamine hypothesis for the etiology of schizophrenia.",
"affiliations": "Department of Medicine, St Mary's Hospital of Brooklyn, New York 11213.",
"authors": "Peter|S A|SA|;Autz|A|A|;Jean-Simon|M L|ML|",
"chemical_list": "D001971:Bromocriptine",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0027-9684",
"issue": "85(9)",
"journal": "Journal of the National Medical Association",
"keywords": null,
"medline_ta": "J Natl Med Assoc",
"mesh_terms": "D001971:Bromocriptine; D006801:Humans; D008297:Male; D008875:Middle Aged; D010911:Pituitary Neoplasms; D015175:Prolactinoma; D012559:Schizophrenia",
"nlm_unique_id": "7503090",
"other_id": null,
"pages": "700-1",
"pmc": null,
"pmid": "8120934",
"pubdate": "1993-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "626865;6812691;6343126;1746267;2866952;2692761;1681750;6431121",
"title": "Bromocriptine-induced schizophrenia.",
"title_normalized": "bromocriptine induced schizophrenia"
} | [
{
"companynumb": "US-VALIDUS PHARMACEUTICALS LLC-US-2016VAL000083",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "BROMOCRIPTINE MESYLATE"
},
... |
{
"abstract": "OBJECTIVE\nThe aim of this study is to assess international guidelines implementation concerning thromboprophylaxis strategy in myeloma patients treated with immunomodulatory drugs.\n\n\nMETHODS\nThis retrospective study includes multiple myeloma patients treated with immunomodulatory drugs between 2014 and 2017 in the Hematology department of a teaching hospital (Hospices Civils de Lyon, France) and followed by the multidisciplinary care plan for cancer outpatients ONCORAL (ONCological care for outpatients with ORAL anticancer drugs). Data from immunomodulatory drugs administration, thromboprophylaxis strategy and thrombotic events were collected from medical files. Adherence to 2010 International Myeloma Working Group (IMWG) guidelines was assessed.\n\n\nRESULTS\n213 patients received at least one immunomodulatory drug: lenalidomide (60.9%), pomalidomide (24.0%) and thalidomide (15.1%). About two third of treatment lines (66.2%) were in accordance with IMWG recommendations. Among the others, 30.5% and 69.5% had thromboprophylaxis, respectively, superior or inferior to IMWG recommendations. 37 venous thrombotic events and 4 arterial thromboembolisms (one patient experienced both a stroke and deep venous thrombosis simultaneously) were reported.\n\n\nCONCLUSIONS\nThromboprophylaxis was systematically performed in myeloma patients treated with immunomodulatory drugs in this real-life retrospective cohort. However, the choice of anticoagulant or anti-platelet agent remains debatable, as adherence to existing guidelines was variable.",
"affiliations": "Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Department of Hematology, Hospices Civils de Lyon, Groupement Hospitalier Sud, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Centre Régional de Pharmacovigilance de Lyon, Hospices Civils de Lyon, Lyon, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Department of Hematology, Hospices Civils de Lyon, Groupement Hospitalier Sud, Pierre-Bénite, France.;Department of Hematology, Hospices Civils de Lyon, Groupement Hospitalier Sud, Pierre-Bénite, France.;Department of Hematology, Hospices Civils de Lyon, Groupement Hospitalier Sud, Pierre-Bénite, France.;Department of Hematology, Hospices Civils de Lyon, Groupement Hospitalier Sud, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France.;Clinical Oncology Pharmacy Department, Hospices Civils de Lyon, Groupement Hospitalier Sud, 165 Chemin du Grand Revoyet, 69495 Pierre Bénite cedex, Pierre-Bénite, France. florence.ranchon@chu-lyon.fr.",
"authors": "Leclerc|V|V|;Karlin|L|L|;Herledan|C|C|;Marchal|L|L|;Baudouin|A|A|;Gouraud|A|A|;Caffin|A G|AG|;Larbre|V|V|;Lazareth|A|A|;Bachy|E|E|;Salles|G|G|;Ghesquières|H|H|;Rioufol|C|C|;Ranchon|F|F|http://orcid.org/0000-0002-9181-4231",
"chemical_list": null,
"country": "Germany",
"delete": false,
"doi": "10.1007/s00432-021-03693-5",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0171-5216",
"issue": null,
"journal": "Journal of cancer research and clinical oncology",
"keywords": "Anticoagulants; Immunomodulatory drugs; Multiple myeloma; Thromboprophylaxis; Thrombosis",
"medline_ta": "J Cancer Res Clin Oncol",
"mesh_terms": null,
"nlm_unique_id": "7902060",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34143239",
"pubdate": "2021-06-18",
"publication_types": "D016428:Journal Article",
"references": "22998589;21720994;29486638;28198064;30097228;23216532;21255254;30656281;30873378;11521808;19626046;30957573;15377478;30040996;16687729;33417149;26432650;23026667;23903204;27632640;31319391;23669224;21849487;25838345;28198064;25083240;18094721;24419113;30859608;18371113;12409330;19853510;19471019;20385792;31379000;30450656;30673940;27177742;12888931;12837152",
"title": "Thromboembolic events and thromboprophylaxis associated with immunomodulators in multiple myeloma patients: a real-life study.",
"title_normalized": "thromboembolic events and thromboprophylaxis associated with immunomodulators in multiple myeloma patients a real life study"
} | [
{
"companynumb": "FR-AMGEN-FRASP2022059966",
"fulfillexpeditecriteria": "2",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARFILZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "Immune checkpoint inhibitors (ICIs) are highly efficacious for treating many solid tumor types. Because of their immune-activating mechanism of action, ICIs can trigger various immune-mediated toxicities. We present three cases: i) a woman with anti-Ri brainstem encephalitis; ii) a man with anti-Hu sensory neuronopathy; and iii) a woman with suspected combined anti-Hu and anti-NMDA paraneoplastic syndromes associated with the initiation of the ICIs pembrolizumab and nivolumab. These cases suggest that ICIs can induce both humoral and cell-mediated paraneoplastic neurologic syndromes. Identifying biomarkers that predict risk of developing ICI-associated paraneoplastic syndromes and the development of efficacious treatment strategies for neurologic ICI-toxicities are critical unmet needs.",
"affiliations": "Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America. Electronic address: alexander.gill2@uphs.upenn.edu.;Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America.;Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America.;Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America.;Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America.;Department of Neurology, Hospital of the University of Pennsylvania, Philadelphia, PA 19104, United States of America.",
"authors": "Gill|AlexanderJ|A|;Perez|Michael A|MA|;Perrone|Christopher M|CM|;Bae|Charles J|CJ|;Pruitt|Amy A|AA|;Lancaster|Eric|E|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; C105992:PDCD1 protein, human; D061026:Programmed Cell Death 1 Receptor; D000077594:Nivolumab; C582435:pembrolizumab",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.jneuroim.2019.576980",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0165-5728",
"issue": "334()",
"journal": "Journal of neuroimmunology",
"keywords": "Antibodies; Autoimmune; Immune checkpoint inhibitors; Nivolumab; Paraneoplastic; Pembrolizumab",
"medline_ta": "J Neuroimmunol",
"mesh_terms": "D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D000074322:Antineoplastic Agents, Immunological; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D000077594:Nivolumab; D020361:Paraneoplastic Syndromes, Nervous System; D061026:Programmed Cell Death 1 Receptor",
"nlm_unique_id": "8109498",
"other_id": null,
"pages": "576980",
"pmc": null,
"pmid": "31195181",
"pubdate": "2019-09-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "A case series of PD-1 inhibitor-associated paraneoplastic neurologic syndromes.",
"title_normalized": "a case series of pd 1 inhibitor associated paraneoplastic neurologic syndromes"
} | [
{
"companynumb": "US-BEH-2019103682",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,
... |
{
"abstract": "Methotrexate, a methyl derivative of aminopterin, is a folic acid antagonist and a known human teratogen; misoprostol is a synthetic prostaglandin E1 analog that causes uterine contractions. Recently, there has been resurgence in the use of methotrexate in combination with misoprostol or of methotrexate alone for the treatment of unwanted or ectopic pregnancies, respectively. This report documents the findings in four infants who were exposed prenatally to methotrexate alone or in combination with misoprostol in a failed attempt at medical abortion or treatment of ectopic pregnancy. All patients demonstrated growth deficiency, with growth parameters <10th centile, and all displayed features consistent with methotrexate and/or misoprostol embryopathy. Since an increasing number of medical abortions are being performed, it is important for physicians to recognize the associated teratogenic effects of these abortifacients. Data from the patients herein described should prompt obstetricians and other health care practitioners who prescribe these medications to counsel their patients regarding these risks, especially if the treatment regimen fails to induce an abortion.",
"affiliations": "Division of Medical Genetics, Department of Pediatrics, Stanford University School of Medicine, Stanford, California 94305-5208, USA. mlp@stanford.edu",
"authors": "Adam|Margaret P|MP|;Manning|Melanie A|MA|;Beck|Anita E|AE|;Kwan|Andrea|A|;Enns|Gregory M|GM|;Clericuzio|Carol|C|;Hoyme|H Eugene|HE|",
"chemical_list": "D000020:Abortifacient Agents, Nonsteroidal; D016595:Misoprostol; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1002/ajmg.a.20503",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1552-4825",
"issue": "123A(1)",
"journal": "American journal of medical genetics. Part A",
"keywords": null,
"medline_ta": "Am J Med Genet A",
"mesh_terms": "D000015:Abnormalities, Multiple; D000020:Abortifacient Agents, Nonsteroidal; D000028:Abortion, Induced; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D008727:Methotrexate; D016595:Misoprostol; D011247:Pregnancy; D011271:Pregnancy, Ectopic",
"nlm_unique_id": "101235741",
"other_id": null,
"pages": "72-8",
"pmc": null,
"pmid": "14556250",
"pubdate": "2003-11-15",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Methotrexate/misoprostol embryopathy: report of four cases resulting from failed medical abortion.",
"title_normalized": "methotrexate misoprostol embryopathy report of four cases resulting from failed medical abortion"
} | [
{
"companynumb": "US-PFIZER INC-HQWYE700017DEC03",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "METHOTREXATE SODIUM"
},
"drugadditional"... |
{
"abstract": "Metastatic pancreatic cancer is characterised by poor prognosis. High toxicity of chemotherapy limits its use in elderly patients with severe comorbidities. Meanwhile, in metastatic disease, local treatment did not show the positive effect on life expectancy. We present a clinical case of a 72-year-old woman with metastatic pancreatic adenocarcinoma tumour, node, metastases (T3N0M1) (according to the seventh TNM classification of the International Union Against Cancer). Chemotherapy led to partial response, but later was stopped due to severe toxicity. Thereafter, consolidating radiosurgical treatment was performed. Dose to pancreatic and liver lesions was 35 Gy in five fractions. After 9 months, only one liver lesion and primary pancreatic tumour, stable in size were determined by MRI. At present time, the patient is alive and in good condition, the disease is stable 50 months after stereotactic body radiation therapy (SBRT). SBRT provides a high level of local control and in combination with systemic treatment can potentially increase survival.",
"affiliations": "Radiation Oncology, Medical Institute n.a. Berezin Sergey, Saint Petersburg, Russia.;Oncology, Saint Peterburg State University, Saint-Petersburg, Russia.;Oncology, Saint Peterburg State University, Saint-Petersburg, Russia.;Surgery, Medical Institute n.a. Berezin Sergey, Saint Petersburg, Russia.",
"authors": "Vorobyov|Nikolay|N|;Rykov|Ivan|I|;Orlova|Rashida|R|;Cherkashin|Mikhail|M|http://orcid.org/0000-0002-5113-9569",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-225846",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "cancer intervention; pancreatic cancer; radiotherapy",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000230:Adenocarcinoma; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D003131:Combined Modality Therapy; D005260:Female; D006801:Humans; D008113:Liver Neoplasms; D008279:Magnetic Resonance Imaging; D010190:Pancreatic Neoplasms; D016634:Radiosurgery; D014057:Tomography, X-Ray Computed",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30219780",
"pubdate": "2018-09-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "18755555;21561347;27856064;23993401;26742998;9196156;27048934",
"title": "Chemotherapy in combination with stereotactic body radiation therapy (SBRT) for oligometastatic pancreatic cancer.",
"title_normalized": "chemotherapy in combination with stereotactic body radiation therapy sbrt for oligometastatic pancreatic cancer"
} | [
{
"companynumb": "RU-TEVA-2018-RU-966454",
"fulfillexpeditecriteria": "1",
"occurcountry": "RU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "OXALIPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Epidermolysis bullosa (EB) is an inherited skin disease with four main subtypes that cannot be distinguished clinically at birth. All subtypes may present with widespread life-threatening blisters and fragile skin, making treatment and handling of the newborn with EB challenging. The prognosis of EB depends on the subtype, and therefore maximum treatment is necessary until the final diagnosis is known. In this case, it took 2 weeks before a final diagnosis was reached. In the meantime, we had several ethical discussions on the treatment level. The most important issues were management of pain and nutrition. For immediate pain relief, intranasal fentanyl worked best and gabapentin was successfully used for chronic pain. The feeding difficulties were handled first by a nasogastric feeding tube. Later a normal feeding bottle proved to be adequate.",
"affiliations": "Department of Paediatric, Hospital of Southern Denmark, Aabenraa, Aabenraa, Denmark.;Department of Dermatology and Allergy Center, University Hospital of Odense, Odense, Denmark.;Department of Clinical Genetics, University Hospital of Odense, Odense, Denmark.;Neonatal Intensive Care Unit, HC Andersen Child Hospital, Odense, Denmark.",
"authors": "Boesen|Martin Lehmann|ML|;Bygum|Anette|A|;Hertz|Jens Michael|JM|;Zachariassen|Gitte|G|",
"chemical_list": "D000588:Amines; D003509:Cyclohexanecarboxylic Acids; D005680:gamma-Aminobutyric Acid; D000077206:Gabapentin; D005283:Fentanyl",
"country": "England",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2016()",
"journal": "BMJ case reports",
"keywords": null,
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000588:Amines; D001768:Blister; D059350:Chronic Pain; D003509:Cyclohexanecarboxylic Acids; D004820:Epidermolysis Bullosa; D016109:Epidermolysis Bullosa, Junctional; D005283:Fentanyl; D000077206:Gabapentin; D006801:Humans; D007231:Infant, Newborn; D008297:Male; D018529:Nutritional Support; D059408:Pain Management; D012720:Severity of Illness Index; D012867:Skin; D005680:gamma-Aminobutyric Acid",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "27118747",
"pubdate": "2016-04-26",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "23480923;22512697;23419761;18374450;17147951;9036937;23403253;16439965;24884811;20507384",
"title": "Newborn with severe epidermolysis bullosa: to treat or not to treat?",
"title_normalized": "newborn with severe epidermolysis bullosa to treat or not to treat"
} | [
{
"companynumb": "DK-PURDUE PHARMA-GBR-2016-0036781",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "KETAMINE"
},
"drugadditional": null,... |
{
"abstract": "Vemurafenib (Zelboraf; Genentech, CA) is a highly effective oral chemotherapy agent for patients with metastatic melanoma who carry the BRAF V600E mutation. Side effects of this protein kinase inhibitor (PKI) include arthralgia, rash, and fatigue, which are reported in up to one third of treated patients. Mild abnormalities in liver biochemistries were reported with vemurafenib use in 30% of subjects, 11% developed severe laboratory abnormalities, and acute liver failure has been reported (Table ). Herein, a case of severe vemurafenib-induced granulomatous hepatitis leading to chronic cholestasis is reported along with a review of the hepatotoxicity of other PKIs.",
"affiliations": "Division of Gastroenterology and Hepatology, University of Michigan, Ann Arbor, MI.;Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD.;Division of Gastroenterology and Hepatology, University of Michigan, Ann Arbor, MI.",
"authors": "Spengler|Erin K|EK|;Kleiner|David E|DE|;Fontana|Robert J|RJ|",
"chemical_list": "D007093:Imidazoles; D007211:Indoles; D010091:Oximes; D013449:Sulfonamides; D000077484:Vemurafenib; C561627:dabrafenib",
"country": "United States",
"delete": false,
"doi": "10.1002/hep.28692",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0270-9139",
"issue": "65(2)",
"journal": "Hepatology (Baltimore, Md.)",
"keywords": null,
"medline_ta": "Hepatology",
"mesh_terms": "D000368:Aged; D001707:Biopsy, Needle; D056486:Chemical and Drug Induced Liver Injury; D004305:Dose-Response Relationship, Drug; D004334:Drug Administration Schedule; D005500:Follow-Up Studies; D006099:Granuloma; D006801:Humans; D007093:Imidazoles; D007150:Immunohistochemistry; D007211:Indoles; D008297:Male; D008545:Melanoma; D010091:Oximes; D019233:Retreatment; D018570:Risk Assessment; D012878:Skin Neoplasms; D013449:Sulfonamides; D000077484:Vemurafenib",
"nlm_unique_id": "8302946",
"other_id": null,
"pages": "745-748",
"pmc": null,
"pmid": "27335285",
"pubdate": "2017-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": "23550685;23620168",
"title": "Vemurafenib-induced granulomatous hepatitis.",
"title_normalized": "vemurafenib induced granulomatous hepatitis"
} | [
{
"companynumb": "US-ROCHE-1892096",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ATENOLOL"
},
"drugadditional": null,
"druga... |
{
"abstract": "Infectious complications are a major cause of morbidity and mortality in patients with chronic lymphocytic leukemia (CLL) due to impaired immunity secondary to the disease itself and to the immunosuppressive therapies administered to these patients. We report a 78-year-old woman with CLL who was treated with steroids for autoimmune hemolytic anemia (AIHA). A few weeks later, she was admitted for severe acute hepatitis with disseminated intravascular coagulation (DIC). Despite the symptomatic treatment of DIC, standard reanimation and probabilistic antibiotics, the patient died within 24h with severe hepatic failure. Autopsy was in favor of a disseminated viral infection with esophageal, hepatic and pulmonary cytopathologic lesions with acidophilic intranuclear inclusions suggestive of herpes virus, even though HSV 1 and 2, CMV and HHV6 PCRs were negative. This case of severe viral hepatitis with esophagitis occurring three weeks after the introduction of high-dose steroid treatment for AIHA in a CLL patient calls for anti-herpetic prophylaxis in such patients, immunodepressed by their diseases and the treatment they receive.",
"affiliations": "CHU Angers, Service des Maladies du Sang, Angers, France.;CHU Angers, Laboratoire de virologie, Angers, France.;CHU Angers, Département de pathologie cellulaire et tissulaire, Angers, France.;CHU Angers, Département de pathologie cellulaire et tissulaire, Angers, France.;CHU Angers, Service d'hépato-gastroentérologie, Angers, France.;CHU Angers, Service des Maladies du Sang, Angers, France; INSERM U892, France.;CHU Angers, Service des Maladies du Sang, Angers, France; INSERM U892, France. Electronic address: alschmidt@chu-angers.fr.",
"authors": "Orvain|Corentin|C|;Ducancelle|Alexandra|A|;Eymerit-Morin|Caroline|C|;Rousselet|Marie-Christine|MC|;Oberti|Frederic|F|;Hunault-Berger|Mathilde|M|;Tanguy-Schmidt|Aline|A|",
"chemical_list": "D007166:Immunosuppressive Agents; D013256:Steroids",
"country": "Netherlands",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1386-6532",
"issue": "62()",
"journal": "Journal of clinical virology : the official publication of the Pan American Society for Clinical Virology",
"keywords": "Autoimmune hemolytic anemia (AIHA); Chronic lymphocytic leukemia (CLL); Viral hepatitis",
"medline_ta": "J Clin Virol",
"mesh_terms": "D000368:Aged; D000744:Anemia, Hemolytic, Autoimmune; D001706:Biopsy; D017809:Fatal Outcome; D005260:Female; D006525:Hepatitis, Viral, Human; D006801:Humans; D007166:Immunosuppressive Agents; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D008099:Liver; D013256:Steroids",
"nlm_unique_id": "9815671",
"other_id": null,
"pages": "66-8",
"pmc": null,
"pmid": "25542474",
"pubdate": "2015-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Severe viral hepatitis in a patient with chronic lymphocytic leukemia (CLL) complicated with autoimmune hemolytic anemia (AIHA), treated with steroids.",
"title_normalized": "severe viral hepatitis in a patient with chronic lymphocytic leukemia cll complicated with autoimmune hemolytic anemia aiha treated with steroids"
} | [
{
"companynumb": "FR-SUN PHARMACEUTICAL INDUSTRIES LTD-2015R1-109344",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drug... |
{
"abstract": "BACKGROUND\nTapentadol is a novel atypical opioid. Anecdotal evidence suggests that tapentadol has a lower toxicity than conventional opioids.\n\n\nOBJECTIVE\nTo evaluate all single-drug mortality due to tapentadol and assess serious adverse events caused by tapentadol.\n\n\nMETHODS\nThe Preferred Reporting Items for Systematic review and Meta-Analysis Protocols (PRISMA-P) reporting guidelines, an evidence-based minimum set of items for reporting in systematic reviews, were followed in this systematic review.\n\n\nRESULTS\n24 peer-reviewed papers were identified. They indicate that tapentadol toxicity can cause mortality and serious adverse effects.\n\n\nCONCLUSIONS\nAt least four confirmed fatalities, and serious adverse effects have been documented for individuals abusing or using tapentadol as prescribed. Serious adverse effects of tapentadol use may include respiratory depression, confusion, coma, hallucination/delusion, seizures, tachycardia, hypertension, agitation, tremor, miosis, hypotension, dyspnea, electrolyte abnormality, atrial fibrillation or severe upper abdominal pain. Tapentadol is unlikely to cause serotonin syndrome. The toxicity of tapentadol is significantly less than pure mu opioids, such as oxycodone.",
"affiliations": "Medical School, The University of Western Australia, Perth, Western Australia.;Medical School, The University of Western Australia, Perth, Western Australia.",
"authors": "Channell|Jessie S|JS|;Schug|Stephan|S|",
"chemical_list": "D000701:Analgesics, Opioid; D010636:Phenols; D000077432:Tapentadol",
"country": "England",
"delete": false,
"doi": "10.2217/pmt-2018-0027",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1758-1869",
"issue": "8(5)",
"journal": "Pain management",
"keywords": "Nucynta; Palexia; adverse event; adverse-effect; mortality; overdose; poison; safety; tapentadol; toxicity",
"medline_ta": "Pain Manag",
"mesh_terms": "D000701:Analgesics, Opioid; D064420:Drug-Related Side Effects and Adverse Reactions; D006801:Humans; D010636:Phenols; D000077432:Tapentadol",
"nlm_unique_id": "101555934",
"other_id": null,
"pages": "327-339",
"pmc": null,
"pmid": "30079795",
"pubdate": "2018-09-01",
"publication_types": "D016428:Journal Article; D016454:Review; D000078182:Systematic Review",
"references": null,
"title": "Toxicity of tapentadol: a systematic review.",
"title_normalized": "toxicity of tapentadol a systematic review"
} | [
{
"companynumb": "AU-COLLEGIUM PHARMACEUTICAL, INC.-US-2019COL000084",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TAPENTADOL"
},
"drug... |
{
"abstract": "BACKGROUND\nWe report the case of a multiple drug interaction involving clozapine, antifungals and oral contraceptives, which resulted in an increased clozapine plasma level, pericarditis with pericardial effusion and eosinophilia in a young Caucasian woman. These symptoms and signs disappeared a few days after discontinuation of clozapine. At present, we are not aware of reports of clozapine-antifungals interaction, whereas there is only one other case report on the interaction between oral contraceptives and clozapine. The purpose of this case report is to show the risk of potentially serious adverse effects stemming from drug interactions involving medications routinely used in clinical practice.\n\n\nMETHODS\nA 29-year-old Caucasian woman diagnosed with a schizoaffective disorder was admitted to a psychiatric unit for acute psychosis (hallucinations, delusions and catatonic behavior). She denied smoking tobacco products and was on long-term oral contraceptives. During the first month of hospitalization she was treated with antipsychotics and for 1 week she took simultaneously fluconazole and miconazole gel, after being diagnosed with oral candidiasis. On the last day of antifungals treatment, 29 days after admission, clozapine was started with resolution of psychotic symptoms. After 3 weeks, her clozapine plasma level had increased to 542 ng/mL and eosinophilia was observed. She complained of nausea, vomiting and palpitations; echocardiography showed echocardiographic abnormalities and pericardial effusion. Oral contraceptives were discontinued and after 1 week clozapine was interrupted, with a complete resolution of side effects and pericardial effusion within 4 days.\n\n\nCONCLUSIONS\nClozapine is metabolized by cytochrome P450. The use of inhibitors or other substrates of cytochrome P450, such as antifungals and oral contraceptives, can cause long-lasting interactions and clozapine toxicity. The Naranjo algorithm shows clozapine is a definite cause of pericarditis (score 9) and both clozapine-antifungals and clozapine-contraceptives interactions resulted probable (score 5) in Drug Interaction Probability Scale. A good knowledge on drugs that act as substrates, inhibitors or inducers of cytochrome P450 is mandatory. When those drugs are used in patients taking clozapine, blood level monitoring of clozapine should be recommended, since a lower dose of clozapine might be required to prevent clozapine toxicity.",
"affiliations": "Section of Neuroscience and Clinical Pharmacology, Department of Biomedical Sciences, University of Cagliari, SP8, Km. 0,700, 09042, Monserrato, CA, Italy. giovanna.cadeddu@yahoo.it.;Sardinian Regional Center of Pharmacovigilance, Unit of Clinical Pharmacology, AOUCA, \"San Giovanni di Dio Hospital\", Via Ospedale 54, 09124, Cagliari, Italy. arianna.deidda@unica.it.;Sardinian Regional Center of Pharmacovigilance, Unit of Clinical Pharmacology, AOUCA, \"San Giovanni di Dio Hospital\", Via Ospedale 54, 09124, Cagliari, Italy. mimmastoc@hotmail.it.;Center of Mental Health, ASL8, Via Raffaello 5, 09032, Assemini, CA, Italy. nicolavelluti@gmail.com.;Psychiatric Unit, ASL 8, \"SS. Trinità\" Hospital, Via Is Mirrionis 92, 09121, Cagliari, Italy. caterinaburrai@asl8cagliari.it.;Section of Neuroscience and Clinical Pharmacology, Department of Biomedical Sciences, University of Cagliari, SP8, Km. 0,700, 09042, Monserrato, CA, Italy. delzompo@unica.it.",
"authors": "Cadeddu|Giovanna|G|;Deidda|Arianna|A|;Stochino|Maria Erminia|ME|;Velluti|Nicola|N|;Burrai|Caterina|C|;Del Zompo|Maria|M|",
"chemical_list": "D000935:Antifungal Agents; D014150:Antipsychotic Agents; D003276:Contraceptives, Oral; D003024:Clozapine",
"country": "England",
"delete": false,
"doi": "10.1186/s13256-015-0547-2",
"fulltext": "\n==== Front\nJ Med Case RepJ Med Case RepJournal of Medical Case Reports1752-1947BioMed Central London 54710.1186/s13256-015-0547-2Case ReportClozapine toxicity due to a multiple drug interaction: a case report Cadeddu Giovanna giovanna.cadeddu@yahoo.it Deidda Arianna arianna.deidda@unica.it Stochino Maria Erminia mimmastoc@hotmail.it Velluti Nicola nicolavelluti@gmail.com Burrai Caterina caterinaburrai@asl8cagliari.it Del Zompo Maria delzompo@unica.it Section of Neuroscience and Clinical Pharmacology, Department of Biomedical Sciences, University of Cagliari, SP8, Km. 0,700, 09042 Monserrato, CA Italy Sardinian Regional Center of Pharmacovigilance, Unit of Clinical Pharmacology, AOUCA, “San Giovanni di Dio Hospital”, Via Ospedale 54, 09124 Cagliari, Italy Center of Mental Health, ASL8, Via Raffaello 5, 09032 Assemini, CA Italy Psychiatric Unit, ASL 8, “SS. Trinità” Hospital, Via Is Mirrionis 92, 09121 Cagliari, Italy 2 4 2015 2 4 2015 2015 9 7731 7 2014 18 2 2015 © Cadeddu et al.; licensee BioMed Central. 2015This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Introduction\nWe report the case of a multiple drug interaction involving clozapine, antifungals and oral contraceptives, which resulted in an increased clozapine plasma level, pericarditis with pericardial effusion and eosinophilia in a young Caucasian woman. These symptoms and signs disappeared a few days after discontinuation of clozapine. At present, we are not aware of reports of clozapine–antifungals interaction, whereas there is only one other case report on the interaction between oral contraceptives and clozapine. The purpose of this case report is to show the risk of potentially serious adverse effects stemming from drug interactions involving medications routinely used in clinical practice.\n\nCase presentation\nA 29-year-old Caucasian woman diagnosed with a schizoaffective disorder was admitted to a psychiatric unit for acute psychosis (hallucinations, delusions and catatonic behavior). She denied smoking tobacco products and was on long-term oral contraceptives. During the first month of hospitalization she was treated with antipsychotics and for 1 week she took simultaneously fluconazole and miconazole gel, after being diagnosed with oral candidiasis. On the last day of antifungals treatment, 29 days after admission, clozapine was started with resolution of psychotic symptoms. After 3 weeks, her clozapine plasma level had increased to 542ng/mL and eosinophilia was observed. She complained of nausea, vomiting and palpitations; echocardiography showed echocardiographic abnormalities and pericardial effusion. Oral contraceptives were discontinued and after 1 week clozapine was interrupted, with a complete resolution of side effects and pericardial effusion within 4 days.\n\nConclusions\nClozapine is metabolized by cytochrome P450. The use of inhibitors or other substrates of cytochrome P450, such as antifungals and oral contraceptives, can cause long-lasting interactions and clozapine toxicity. The Naranjo algorithm shows clozapine is a definite cause of pericarditis (score 9) and both clozapine–antifungals and clozapine–contraceptives interactions resulted probable (score 5) in Drug Interaction Probability Scale. A good knowledge on drugs that act as substrates, inhibitors or inducers of cytochrome P450 is mandatory. When those drugs are used in patients taking clozapine, blood level monitoring of clozapine should be recommended, since a lower dose of clozapine might be required to prevent clozapine toxicity.\n\nKeywords\nClozapineDrugs interactionPericarditisissue-copyright-statement© The Author(s) 2015\n==== Body\nIntroduction\nClozapine is an atypical antipsychotic, known for life-threatening side effects, such as agranulocytosis and cardiac complications, but also for its role in the treatment of resistant psychoses when other therapies have failed [1].\n\nThe most serious cardiac complications caused by clozapine, such as cardiomyopathy, myocarditis and pericarditis, are characterized by shortness of breath, heart palpitations/pains and thoracic pain. In most cases, electrocardiographic changes, pericardial effusion, and nonspecific signs of inflammation are observed. However, only a few cases of pericarditis and pericardial effusion induced by clozapine, even when used at low dosage, are reported in the literature [2].\n\nA review by Wehmeier et al. reported 65 cases of myocarditis, 52 cases of cardiomyopathy and only six cases of pericarditis occurring during clozapine treatment [3]. The dose used is a poor predictor of clinical response, and there is little correlation between dose and plasma level, due to individual differences in metabolism, pharmacokinetic differences, gender, age, drug interactions and the smoking of tobacco products.\n\nAntifungal drugs, including fluconazole and miconazole, are widely used in the treatment of systemic candidal infections and mycoses. Multiple drug therapy is a common therapeutic practice and many drug–drug interactions involving metabolic inhibition are reported in the literature. Clozapine is metabolized by the hepatic cytochrome P450 (CYP) microsomal system. The contribution of these isoenzymes to clozapine metabolism differs between individuals, leading to the wide inter-patient variability found in clozapine plasma concentration. The drug is converted to norclozapine by CYP3A4 and 1A2 and to clozapine N-oxide by CYP3A4 [4,5]. However, CYP2C19 is also important at clozapine therapeutic concentration (24%) whereas the contributions of CYP2C9 (12%) and 2D6 (6%) are more modest. CYP1A2 is the most important form at therapeutic concentration (30%), while CYP3A4 plays a more important role at a high concentration (37%) than at therapeutic concentration (22%) [6].\n\nThe use of inhibitors or other substrates of P450, such as oral contraceptive (OCs) and antifungals, can cause unfavorable and long-lasting interactions and clozapine toxicity: in vitro, miconazole and ketoconazole may cause an inhibition of more than 50% of clozapine metabolism [7].\n\nIt has been reported that fluconazole and miconazole competitively inhibit CYP3A4 activities.\n\nIn particular, CYP3A4, CYP2C9, CYP2C19 and CYP1A2 are more strongly inhibited by miconazole than fluconazole [8], and this inhibition may last several days, due to antifungals long half-life and wash-out, allowing clozapine accumulation and toxicity. In this way, miconazole and fluconazole may inhibit clozapine metabolism determining an increase and/or prolongation of both therapeutic and adverse effects. At present, we are not aware of reports of clozapine–antifungals interaction; however, drug–drug interactions involving other classes of antipsychotics and antifungals are reported in the literature [9], whereas there is only one other case report on the interaction between OCs and clozapine [10]. The purpose of this case report is to show the risk of potentially serious adverse effects stemming from drug interactions involving medications routinely used in clinical practice. Learning how to predict and monitor drug–drug interactions may help reduce the incidence of clinically significant adverse drug events.\n\nCase presentation\nA 29-year-old Caucasian woman affected by a schizoaffective disorder, treated with haloperidol 2mg per day and olanzapine 10mg per day, was admitted at a Psychiatric Unit for a reacutization of her psychotic symptoms (hallucinations, delusions and catatonic behavior), due to a lack of medications adherence. Her past medical history was characterized by a previous hospitalization for acute psychosis 1 year earlier, incomplete right bundle branch block (RBBB) and ovarian cysts. Her family medical history revealed that her mother had an anxiety disorder and her grandmother had a major depression. She was on long-term OCs, ethinyl estradiol/drospirenone 0.03mg/3mg per day and denied smoking tobacco products and any substance use.\n\nA physical examination showed a temperature of 37.2°C and blood pressure of 150/100mmHg, whereas all the other parameters were within normal range. The results of blood tests and electrocardiography (ECG) were normal, except for RBBB. Her hospitalization lasted 3 months and during the first month she was treated orally with olanzapine 20mg per day and haloperidol 9mg per day for 23 days. On the 23rd day of hospitalization, since a poor response to treatment was observed, antipsychotics were interrupted and aripiprazole 30mg per day was administered for 6 days. In addition, on the same day, she was diagnosed with oral candidiasis and treated simultaneously for a week orally with fluconazole 100mg per day and miconazole oral gel 2% 20mg, two times per day. Since her psychotic symptoms did not seem to improve, 29 days after admission and on the last day of antifungal treatment, aripiprazole was replaced by clozapine.\n\nClozapine was started at 25mg per day orally and was gradually increased, within 16 days, to 225mg per day with the resolution of psychotic symptoms. After 3 weeks the plasma level of clozapine was 542ng/mL (range 350 to 450ng/mL) and the level of its active metabolite norclozapine was 216ng/mL. Blood tests showed eosinophilia and an increase of C-reactive protein (5.73mg/L). She experienced the first symptoms (nausea, vomiting, palpitations) 5 days before the plasma level of clozapine was measured, while she was being treated with clozapine and OCs. At that point, long-term OCs treatment was discontinued and no other form of contraception was administered to her. She was referred to a cardiologist.\n\nA physical examination showed tachycardia and gallop rhythm and she complained of nausea and vomiting. An ECG revealed sinus tachycardia (135 beats/minute), QTc 0.43 seconds, and S-T segment depression and inversion of T-waves in inferior and lateral leads. An echocardiography showed a small pericardial effusion suggestive of iatrogenic pericarditis.\n\nDue to those findings, 1 week after discontinuing OCs, clozapine was also interrupted and she was not rechallenged. Within 4 days, she showed resolution of clozapine side effects, normalization of ECG and complete recovery of pericardial effusion. Her symptoms continued to improve and 6 days after discontinuing clozapine she was discharged. The plasma level of clozapine, measured 1 week after discontinuing clozapine (2 weeks after interruption of OCs) was undetectable. At 1 month follow-up, transthoracic echocardiography and inflammatory markers were normal (Figure 1).Figure 1 \nClinical case timeline. The figure reports the most important clinical aspects, interventions, diagnosis and follow up with the outcomes. Abbreviations: ECG, electrocardiography; min, minutes; OCs, oral contraceptives.\n\n\n\nDiscussion\nWe report the case of a multiple drug interaction involving clozapine, OCs and antifungals, which resulted in an increased clozapine plasma level, pericarditis and eosinophilia. Although clozapine toxicity is usually linked with clozapine serum levels higher than 1000ng/mL, at the moment there is no evidence of a clear toxicity range in the literature [11] and we cannot exclude that the patient might have experienced an adverse reaction at a lower serum level of clozapine (542ng/mL). Pericarditis is an insidious disease which may debut with nonspecific symptoms, therefore a high level of diagnostic suspicion is always needed when clozapine is being used. In this case, the most common causes of pericardial illness were ruled out with the possible exception of a viral pericarditis, since cardiac symptoms began 1 month after clozapine was started, quickly resolved after discontinuation and did not return again. Clozapine-induced myocarditis was also excluded since echocardiography, cardiac necrosis markers and brain natriuretic peptide were all negative.\n\nClozapine was a definite causative agent (score of 9) according to the Naranjo probability scale [12], which evaluates single-drug adverse events, and according to the Drug Interaction Probability Scale (DIPS) [13], a probable causative agent, since both clozapine–antifungals and clozapine–OCs interactions scored 5.\n\nThe ranking differences between these two assessment tools involve the questions used in DIPS to evaluate drug–drug interactions; in multiple drug interactions DIPS is the most accurate tool. A positive rechallenge with the precipitant drug is a strong indicator of causation. Unfortunately, the patient was not rechallenged with clozapine, and previous plasma levels of the drug were not measured, so we are not able to rule out the presence of clozapine toxicity prior to the first measurement.\n\nAt present, we are not aware of reports of clozapine–antifungals interaction, but drug–drug interactions involving other classes of antipsychotics and antifungals are reported in the literature [9]. 17α-Ethinyl estradiol (EE) is a CYP3A4 substrate and an inhibitor of CYP1A1 in vitro; moreover, there is evidence of a time-dependent inhibition of CYP3A4 and CYP3A5 by OCs [14]. Drospirenone is partially metabolized by CYP3A4 and is also an inhibitor of CYP2C19 and CY2C9. Therefore, both OCs’ components can inhibit different CYPs, although at higher clozapine concentrations CYP3A4 is the most active; thus the greater inhibition is more probably determined by EE.\n\nThere is less information about the effect of OCs on other drugs, but clinically relevant pharmacokinetic interactions are known to occur. A possible OCs–clozapine interaction mechanism could be a competitive enzyme inhibition, as both drugs are partially metabolized by CYP3A4, and OCs are considered mild inhibitors of CYP3A4. Moreover, several studies have shown that OCs impair the metabolism of CYP1A2 substrates in vivo [15], which might represent another possible mechanism (Table 1).Table 1 \nDrugs’ metabolism\n\n\n\nMedication\n\t\nMetabolism\n\t\nInducers\n\t\nInhibitors\n\t\n\nClozapine\n\tCYP1A2, 3A4, 2C19, 2C9, 2D6\t–\t–\t\n\nFluconazole\n\tHepatic\t–\tCYP3A4, 2C9\t\n\nMiconazole\n\tHepatic\t–\tCYP3A4, 2C9, 2C19, 1A2\t\n\nEthinyl estradiol\n\tCYP3A4, 1A2\t–\tCYP1A2, 2B6, 2C19, 3A4\t\n\nDrospirenone\n\tCYP3A4\t–\tCYP1A1, 2C9, 2C19\t\n\n\nTo the best of our knowledge, there is only one report of a possible drug interaction between clozapine (at a dose of 550mg per day) and OCs, in a 47-year-old woman who was a heavy smoker of tobacco products, resulting in elevated clozapine plasma levels (736, 770, and 792ng/mL) and onset of adverse effects, after which OCs treatment was discontinued. Side effects disappeared within a few days and normalization of clozapine blood levels was observed over the next 6 weeks [10].\n\nFinally, the inhibition of CYPs is compatible with the pharmacokinetics of antifungals and OCs, allowing the elevation of clozapine plasma levels which occurred 2 weeks after antifungals interruption. Miconazole and fluconazole half-life and wash-out are 24 hours and 10 days, and 28 hours and 12 days, respectively. In this case, we must take into account not only the single antifungals–clozapine interaction but also the contribution of OCs (half-life 20 hours, wash-out 8 days) which might have impaired CYPs metabolism for 26 days, while the patient was simultaneously treated with clozapine (Figure 2). Since OCs were administered for a longer time, compared to antifungals, we think that they might have contributed more significantly to the increase of the blood concentration of clozapine.Figure 2 \nDrugs’ interaction timeline and pharmacokinetics. The figure reports the four drugs administered to the patient at the same time (ethinyl estradiol/drospirenone, clozapine, fluconazole, miconazole) and the onset and duration of the adverse drug reactions. The peak of clozapine plasma level (542ng/mL) was observed after 18 days. Adverse drug reactions were observed 2 days after clozapine peak and lasted 14 days. Abbreviation: ADRs, adverse drug reactions.\n\n\n\nConclusions\nTo conclude, this report suggests a possible multiple drug interaction between clozapine, antifungals and OCs, which resulted in an elevated clozapine blood level, eosinophilia and pericarditis with pericardial effusion.\n\nBased on the case report described here, we can make the following recommendations:In patients taking clozapine, detecting ECG and echocardiography abnormalities is highly recommended, and clozapine must be stopped if patients develop pericardial involvement.\n\nBlood level monitoring of clozapine is essential when inhibitors or substrates of CYP3A4 and CYP1A2, such as antifungals or OCs, are being used, since a lower dose of clozapine might be required to prevent adverse effects.\n\nA good knowledge of drugs that act as substrates, inhibitors or inducers of P450 is essential for doctors to take appropriate cautions, and a close monitoring for potential drug interactions when using drugs with a narrow therapeutic range such as clozapine is always recommendable.\n\n\n\nConsent\nWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nAbbreviations\nCYPCytochrome P450\n\nDIPSDrug Interaction Probability Scale\n\nECGElectrocardiography\n\nEE17α-Ethinyl estradiol\n\nOCsOral contraceptives\n\nRBBBRight bundle branch block\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\n\nGC analyzed and interpreted the patient data, and drafted the manuscript. AD and MES participated in data collection and data interpretation and performed the literature search. NV is the specialist who was following the patient. CB signaled the case. MDZ supervised and contributed in writing the manuscript. All authors read and approved the final manuscript.\n\nAcknowledgements\nThis work was partly supported by the Sardinian Regional Councillorship of Health with a grant dedicated to “The development of a Pharmacovigilance Network in Sardinia”, 2011. The authors wish to acknowledge Ms Enrica Mosca for drafting and editing the manuscript.\n==== Refs\nReferences\n1. Baldessarini RJ Frankenburg FR Clozapine. A novel antipsychotic agent N Engl J Med 1991 324 746 54 10.1056/NEJM199103143241107 1671793 \n2. Rathore S Masani ND Callaghan PO Clozapine-induced effuso-constrictive pericarditis. Case report and review of the literature Cardiology. 2007 108 183 5 10.1159/000096666 17085936 \n3. Wehmeier PM Heiser P Remschmidt H Myocarditis, pericarditis and cardiomyopathy in patients treated with clozapine J Clin Pharm Ther. 2005 30 91 6 10.1111/j.1365-2710.2004.00616_1.x 15659009 \n4. Buur-Rasmussen B Brosen K Cytochrome P450 and therapeutic drug monitoring with respect to clozapine Eur Neuropsychopharmacol. 1999 9 453 9 10.1016/S0924-977X(99)00033-4 10625111 \n5. Eiermann B Engel G Johansson I Zanger UM Bertilsson L The involvement of CYP1A2 and CYP3A4 in the metabolism of clozapine Br J Clin Pharmacol. 1997 44 439 46 10.1046/j.1365-2125.1997.t01-1-00605.x 9384460 \n6. Olesen OV Linnet K Contribution of five human cytochrome P450 isoforms to the N-demethylation of clozapine in vitro at low and high concentration J Clin Pharmacol. 2001 41 823 32 10.1177/00912700122010717 11504269 \n7. Bun H Disdier B Aubert C Catalin J Interspecies variability and drug interactions of clozapine metabolism by microsomes Fundam Clin Pharmacol. 1999 13 577 8 10.1111/j.1472-8206.1999.tb00364.x 10520731 \n8. Niwa T Shiraga T Takagi A Effect of antifungal drugs on cytochrome P450 (CYP) 2C9, CYP2C19, and CYP3A4 activities in human liver microsomes Biol Pharm Bull. 2005 28 1805 8 10.1248/bpb.28.1805 16141567 \n9. Mahatthanatrakul W Sriwiriyajan S Ridtitid W Boonleang J Wongnawa M Rujimamahasan N Effect of cytochrome P450 3A4 inhibitor ketoconazole on risperidone pharmacokinetics in healthy volunteers J Clin Pharm Ther. 2012 37 221 5 10.1111/j.1365-2710.2011.01271.x 21518375 \n10. Gabbay V O’Dowd MA Mamamtavrishvili M Asnis GM Clozapine and oral contraceptives: a possible drug interaction J Clin Psychopharmacol. 2002 22 621 2 10.1097/00004714-200212000-00013 12454563 \n11. Greenwood-Smith C Lubman DI Castle DJ Serum clozapine levels: a review of their clinical utility J Psychopharmacol. 2003 17 234 8 10.1177/0269881103017002014 12870573 \n12. Naranjo CA Busto U Sellers EM Sandor P Ruiz I Roberts EA A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther. 1981 30 239 45 10.1038/clpt.1981.154 7249508 \n13. Horn JR Hansten PD Chan LN Proposal for a new tool to evaluate drug interaction cases Ann Pharmacother. 2007 41 674 80 10.1345/aph.1H423 17389673 \n14. Chang SY Chen C Yang Z Rodrigues AD Further assessment of 17alpha-ethinyl estradiol as an inhibitor of different human cytochrome P450 forms in vitro Drug Metab Dispos. 2009 37 1667 75 10.1124/dmd.109.026997 19454483 \n15. Karjalainen MJ Neuvonen PJ Backman JT In vitro inhibition of CYP1A2 by model inhibitors, anti-inflammatory analgesics and female sex steroids: predictability of in vivo interactions Basic Clin Pharmacol Toxicol. 2008 103 157 65 10.1111/j.1742-7843.2008.00252.x 18816299\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1752-1947",
"issue": "9()",
"journal": "Journal of medical case reports",
"keywords": null,
"medline_ta": "J Med Case Rep",
"mesh_terms": "D000328:Adult; D000935:Antifungal Agents; D014150:Antipsychotic Agents; D003024:Clozapine; D003276:Contraceptives, Oral; D004347:Drug Interactions; D004802:Eosinophilia; D005260:Female; D006801:Humans; D010490:Pericardial Effusion; D010493:Pericarditis; D011618:Psychotic Disorders; D013616:Tachycardia, Sinus",
"nlm_unique_id": "101293382",
"other_id": null,
"pages": "77",
"pmc": null,
"pmid": "25890012",
"pubdate": "2015-04-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "10520731;15659009;16141567;17389673;17085936;18816299;19454483;21518375;10625111;11504269;12454563;12870573;7249508;1671793;9384460",
"title": "Clozapine toxicity due to a multiple drug interaction: a case report.",
"title_normalized": "clozapine toxicity due to a multiple drug interaction a case report"
} | [
{
"companynumb": "IT-PFIZER INC-2015132548",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "CLOZAPINE"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nDrug-induced urolithiasis falls into two categories: drug-induced and metabolically-induced. Certain antimicrobials are associated with each; sulfonamides are associated with drug- or metabolite-containing calculi when taken in large doses over a long period of time. Trimethoprim-sulfamethoxazole, a member of the sulfonamide family, is a rare cause of drug-induced calculi. Cases of sulfonamide urolithiasis occurring in patients with known stone disease have rarely been reported.\n\n\nMETHODS\nWe report a case of a patient with a brief history of recurrent calcium oxalate nephrolithiasis requiring 2 ureteroscopic procedures whose existing 6 mm lower pole renal stone more than quadrupled in size to form a 4 cm renal staghorn after 4 months of high-dose treatment for Nocardia pneumonia with trimethoprim-sulfamethoxazole. After ureteroscopy with laser lithotripsy and basketing of fragments, the stone was found to be predominantly composed of N4-acetyl-sulfamethoxazole, a metabolite of sulfamethoxazole.\n\n\nCONCLUSIONS\nStones composed of sulfamethoxazole or its metabolites are rare but have known associated risk factors that should be considered when prescribing this antibiotic. This case report illustrates additional risk factors for consideration, including pre-existing urinary calculi that may serve as a nidus for sulfamethoxazole deposition, and reviews treatment and prevention methods.",
"affiliations": "Wisconsin Academy for Rural Medicine, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA.;Department of Urology, University of Wisconsin School of Medicine and Public Health, 1685 Highland Avenue, 3258 Medical Foundation Centennial Building, Madison, WI, 53705-2281, USA.;Department of Urology, University of Wisconsin School of Medicine and Public Health, 1685 Highland Avenue, 3258 Medical Foundation Centennial Building, Madison, WI, 53705-2281, USA. penn@urology.wisc.edu.",
"authors": "Roedel|Megan M|MM|;Nakada|Stephen Y|SY|;Penniston|Kristina L|KL|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12894-021-00894-5",
"fulltext": "\n==== Front\nBMC Urol\nBMC Urol\nBMC Urology\n1471-2490\nBioMed Central London\n\n894\n10.1186/s12894-021-00894-5\nCase Report\nSulfamethoxazole-induced sulfamethoxazole urolithiasis: a case report\nRoedel Megan M. 1\nNakada Stephen Y. 23\nPenniston Kristina L. penn@urology.wisc.edu\n\n2\n1 grid.14003.36 0000 0001 2167 3675 Wisconsin Academy for Rural Medicine, University of Wisconsin School of Medicine and Public Health, Madison, WI USA\n2 grid.14003.36 0000 0001 2167 3675 Department of Urology, University of Wisconsin School of Medicine and Public Health, 1685 Highland Avenue, 3258 Medical Foundation Centennial Building, Madison, WI 53705-2281 USA\n3 grid.14003.36 0000 0001 2167 3675 Department of Radiology, University of Wisconsin School of Medicine and Public Health, Madison, WI USA\n17 9 2021\n17 9 2021\n2021\n21 13329 7 2021\n8 9 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nDrug-induced urolithiasis falls into two categories: drug-induced and metabolically-induced. Certain antimicrobials are associated with each; sulfonamides are associated with drug- or metabolite-containing calculi when taken in large doses over a long period of time. Trimethoprim-sulfamethoxazole, a member of the sulfonamide family, is a rare cause of drug-induced calculi. Cases of sulfonamide urolithiasis occurring in patients with known stone disease have rarely been reported.\n\nCase presentation\n\nWe report a case of a patient with a brief history of recurrent calcium oxalate nephrolithiasis requiring 2 ureteroscopic procedures whose existing 6 mm lower pole renal stone more than quadrupled in size to form a 4 cm renal staghorn after 4 months of high-dose treatment for Nocardia pneumonia with trimethoprim-sulfamethoxazole. After ureteroscopy with laser lithotripsy and basketing of fragments, the stone was found to be predominantly composed of N4-acetyl-sulfamethoxazole, a metabolite of sulfamethoxazole.\n\nConclusion\n\nStones composed of sulfamethoxazole or its metabolites are rare but have known associated risk factors that should be considered when prescribing this antibiotic. This case report illustrates additional risk factors for consideration, including pre-existing urinary calculi that may serve as a nidus for sulfamethoxazole deposition, and reviews treatment and prevention methods.\n\nKeywords\n\nDrug-induced urolithiasis\nTrimethoprim-sulfamethoxazole\nNocardia\nCase report\nissue-copyright-statement© The Author(s) 2021\n==== Body\npmcBackground\n\nDrug-induced kidney stones account for up to 2% of all urinary tract calculi [1]. Typically, these drugs fall into one of two categories: (1) drugs that have high renal excretion and are poorly soluble in urine; and (2) drugs that induce metabolic changes that favor urinary stone formation. Drugs in the first category, or metabolites thereof, are identified as components of calculi whereas drugs in the second category lead to formation of calcium- and/or uric acid-containing stones. Select drugs within the drug-containing calculi category, including the antihypertensive diuretic triamterene and the nonsteroidal analgesic glafenine, are now used less frequently due to their lithogenic potential; others continue to be used due to their treatment efficacy—these include indinavir and other protease inhibitors used in the treatment of HIV [1]. Metabolically-induced calculi containing calcium can be caused by hypercalciuria from excessive calcium and vitamin D supplementation. Other metabolism-altering drugs, such as carbonic anhydrase inhibitors (e.g., acetazolamide, topiramate) contribute to calcium oxalate and calcium phosphate stone formation by dramatically lowering urinary citrate excretion. Because they significantly raise urine pH, the risk for calcium phosphate stones in particular is increased. Uric acid-containing metabolic calculi can be induced by laxative abuse or by uricosuric agents such as benzbromarone used to treat gout [1].\n\nSeveral antimicrobial agents are associated with urinary tract calculi [1, 2]. Some act by altering the gut microbiome and its ability to degrade oxalate [3], leading to the formation of hyperoxaluria and calcium oxalate stones. Others, especially when taken in large doses over a long period of time, are known to form urinary crystals and calculi that contain the drug itself or its metabolite(s); these include ciprofloxacin, ceftriaxone, and sulfonamides [1]. Trimethoprim-sulfamethoxazole (TMP-SMX) is a combination antibiotic of the sulfonamide family used to treat a wide variety of commonly encountered infections, including those affecting the urinary tract, respiratory system, and gastrointestinal tract. It is also indicated in the treatment and prophylaxis of opportunistic infections by Pneumocystis carinii and Nocardia spp [4]. While first-generation sulfonamides were well-known to provoke drug-induced urolithiasis, it is significantly less common with newer sulfonamides and even less common with TMP-SMX [1]. Cases of sulfonamide urolithiasis occurring in patients with known stone disease have rarely been reported.\n\nHere we present a case of a patient with a known kidney stone who was subsequently treated with a long course of high-dose TMP-SMX for Nocardia pneumonia. After 4 months of TMP-SMX therapy, the patient’s known renal stone more than quadrupled in size to form a 4 cm staghorn stone with an accompanying obstructive conglomerate of ureteral stones. From fragments obtained during surgical stone removal, composition was predominantly N4-acetyl-sulfamethoxazole.\n\nCase presentation\n\nThe patient was a 64-year-old woman with gastroesophageal reflux disease, asthma (treated with inhaled but not systemic steroids), obesity, and type II diabetes mellitus (treated with metformin extended release 500 mg and glipizide 5 mg twice daily). Her stone onset was characterized by presentation to emergency care for nausea, vomiting, diarrhea, and lower left quadrant abdominal pain. While awaiting computed tomography (CT), she acutely became febrile and tachycardic. Labs were significant for white blood cell count of 20,000 K/uL, lactate of 2.2 mmol/L, creatinine of 1.98 mg/dL (baseline 1.06), and concurrent infection on urinalysis. CT scan revealed a 1 cm obstructive proximal ureteral stone. She was diagnosed with sepsis and acute kidney injury and was admitted for decompression and antibiotic therapy; she was discharged after 3 days. Immediate left ureteroscopy (URS) was scheduled but then postponed due to the COVID-19 pandemic. Ultimately, 2 months post presentation, she underwent left URS with laser lithotripsy (LL). Stone composition was unknown. A 24-h urine collection demonstrated high oxalate and low citrate; other risk parameters were within normal limits. She initiated medical management in our multidisciplinary stone prevention clinic for these risk factors. Further assessment revealed positive family history for nephrolithiasis (sister), history of prior ascorbic acid supplementation, very low calcium intake, and high suspicion for antibiotic-induced dysbiosis. The regimen for reducing urine oxalate was to: (1) not re-start ascorbic acid supplement to protect against higher oxalate biosynthesis; (2) pair calcium-containing foods or beverages with every meal to reduce bioavailability of dietary oxalate and, hence, its urinary excretion; and (3) increase intake of prebiotics from fruits and vegetables in effort to enhance colonization and proliferation of oxalate-degrading probiotics (bacteria) in the digestive tract. The regimen for raising urine citrate was to increase intake of fruits and vegetables because they provide bicarbonate precursors that reduce renal citrate reabsorption and thus increase its excretion. Three months later she was found in follow-up to have an 8 mm left renal calculus which was removed within 2 weeks by URS with LL.\n\nShortly thereafter she was evaluated by infectious disease for a worsening productive cough over several months and was found to have Nocardia pneumonia with pulmonary nodules seen on CT scan. She was subsequently started on a six-month course of twice daily TMP-SMX 2DS and cefpodoxime 200 mg. Prior to starting the antibiotic regimen, a non-contrast CT scan showed a new 6 mm non-obstructing stone in the left lower renal pole. A repeat CT scan three months later (2 months after starting TMP-SMX) revealed interval growth of the renal stone to 9 mm; intervention with URS was scheduled. But in the interim, the patient became symptomatic and presented for emergency treatment. Physical exam was significant for mild pelvic tenderness. Labs were significant for creatinine of 1.58 mg/dL and hematuria but no infection. Her pain was managed, and she was discharged. Repeat CT, now 4 months after starting TMP-SMX, revealed a developing staghorn calculus in the left renal pelvis measuring up to 4 cm (Fig. 1) and an obstructing conglomerate of calculi in the left lower ureter measuring up to 7 mm with mild upstream hydroureteronephrosis. Within 2 days, the patient underwent left URS and LL of the renal pelvis and ureteral stones. During the procedure, stone fragments were retrieved via basket and sent for analysis; results demonstrated 80% N4-acetyl-sulfamethoxazole with remaining constituents calcium oxalate (12% monohydrate and 5% dihydrate) and 3% calcium phosphate carbonate apatite (composition was assessed by Fourier transform infrared spectroscopy at Dianon Systems in Oklahoma City, OK). The origin of the fragments that were analyzed, whether from the larger renal pelvis stone or from the ureteral conglomerate of stones, was not documented and is thus unknown. Afterward, the patient passed multiple amber-colored stone fragments (Fig. 2).Fig. 1 Radiographic images of left renal pelvis stone (red arrow) in the axial (a), sagittal (b), and coronal (c) on non-contrast CT abdomen and pelvis. The stone was demonstrated on imaging to have a density of 194.46 Hounsfield Units\n\nFig. 2 Jagged, amber-colored stone fragments passed and collected by patient after ureteroscopy\n\nThe patient completed 6 months of antibiotics with resolution of lung nodules seen on CT and improvement of respiratory status to baseline. TMP-SMX and cefpodoxime were thus discontinued. A repeat CT a few months later showed clearance of post-URS fragments and no new urolithiasis bilaterally. She continues to follow in our stone prevention clinic.\n\nDiscussion and conclusions\n\nSulfamethoxazole is a member of the sulfonamide family, a group of short-acting antibiotics given via orally or parenterally. They are readily absorbed systemically, partially acetylated in the liver, and eliminated by the kidney [4, 5]. The first generation sulfonamides developed in the late 1930s had low urine solubility and were known to cause drug-induced crystalluria resulting in acute renal injury or obstructive urolithiasis [5]. Sulfonamides with higher urine solubility have since been developed, and sulfonamide crystalluria has become a rare occurrence. According to a study by Albala et al., sulfonamide stones make up less than 1% of all stones analyzed [2].\n\nSulfamethoxazole and its metabolite, N4-acetyl-sulfamethoxazole, have particularly low lithogenic potential due to the losangic shape of the crystals, which are not readily retained in the kidney [1]. There have been few reports of N4-acetyl-sulfamethoxazole-induced urolithiasis over time except in recent years, during which TMP-SMX has been used for long-term prophylactic treatment of HIV-associated infections [6]. According to Barnes and Kawaichi, the most important factors in urinary precipitation of sulfonamides include concentration of the drug in the urine, degree of acetylation, urinary stasis, urine pH, and urine temperature [7]. The patient in this case was undergoing prolonged treatment with TMP-SMX at high doses for Nocardia pneumonia, which likely led to a high urine drug concentration. Her history of type II diabetes mellitus and the associated insulin resistance may have contributed to a more acidic urine pH at baseline [8]. She also had a change in urine pH from 6.5 prior to beginning the antibiotics to 5.5 at the time of symptomatic presentation. In addition, the pre-antibiotic 6 mm lower left renal stone (which was presumably calcium oxalate) may have acted as a nidus for sulfamethoxazole crystal deposition. It is not clear if this is the case as the stone was submitted for analysis in fragment form with no discernable core.\n\nThe patient had a known renal calculus at the time of starting TMP-SMX, which is a relatively rare finding. Albala et al. identified 40 people who developed sulfonamide stones, four of whom had a history of prior urolithiasis; however, none had a known stone at the time of treatment [2]. Siegel described a patient who presented with oliguria while on a 2-week course of TMP-SMX for prostatitis who was found with bilateral ureteral stone obstruction; analysis revealed a pure N4-acetyl-sulfamethoxazole stone on one side and a calcium oxalate stone contralaterally [9]. However, unlike our patient, he had no prior history of nephrolithiasis; presence of his stone was unknown until presentation.\n\nThe treatment and prevention of sulfonamide crystalluria and urolithiasis has not changed significantly since the 1940s and, given the rarity of cases, no standard regimen is established. The mainstays of treatment include discontinuation of the sulfonamide if possible, diuresis, and urinary alkalization, as sulfonamides have greater solubility at alkaline pH. Prevention techniques include avoiding sulfonamides if alternative treatments are available, encouraging patients to increase fluid intake when taking sulfonamides, and urinary alkalization with sodium bicarbonate or other alkali [1, 2, 5]. The presence of known renal stones or other foreign bodies such as indwelling catheters should be considered when selecting a sulfonamide for long-term use, as these may be reasons to avoid this family of antibiotics in such patients.\n\nStones composed of sulfamethoxazole or its metabolites are rare as they do not readily precipitate in urine. Factors such as high drug concentration in urine, urinary stasis, and low urine pH increase this risk. Findings from our report suggest that additional risk factors are prior stone history, pre-existing metabolic (urinary) risk factors, and pre-existing urinary calculi that may serve as a nidus for sulfamethoxazole deposition. Treatment and prevention include diuresis, urinary alkalization, treatment of underlying metabolic and urinary stone risk factors, and use of an alternative antibiotic if possible.\n\nAbbreviations\n\nCT Computed tomography\n\nHIV Human immunodeficiency virus\n\nLL Laser lithotripsy\n\nTMP-SMX Trimethoprim-sulfamethoxazole\n\nURS Ureteroscopy\n\nAcknowledgements\n\nNone.\n\nAuthors' contributions\n\nMMR analyzed the patient data and wrote the preliminary draft, SYN and KLP provided expertise and edited the manuscript. All authors read and approved the final manuscript.\n\nFunding\n\nNo funding to declare for this article.\n\nAvailability of data and materials\n\nData sharing is not applicable to this article as no datasets were generated or analyzed during the current study.\n\nDeclarations\n\nEthics approval and consent to participate\n\nWritten informed consent to participate was obtained from the patient of this case report. A copy of the written consent is available for review by the Editor of this journal.\n\nConsent for publication\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Daudon M, Frochot V, Bazin D, Jungers P. Drug-induced kidney stones and crystalline nephropathy: pathophysiology, prevention and treatment [Internet]. Drugs. Springer International Publishing; 2018 [cited 2021 Jun 1]. p. 163–201. Available from: 10.1007/s40265-017-0853-7\n2. Albala DM, Galal HA, Prien EL. Urolithiasis as a hazard of sulfonamide therapy. J Endourol [Internet]. 1994 [cited 2021 May 8];8:401–3. Available from: https://www.liebertpub.com/doi/abs/10.1089/end.1994.8.401\n3. Miller AW, Orr T, Dearing D, Monga M. Loss of function dysbiosis associated with antibiotics and high fat, high sugar diet. ISME J [Internet]. Nature Publishing Group; 2019 [cited 2021 Jun 2];13:1379–90. Available from: http://www.nature.com/articles/s41396-019-0357-4\n4. Cockerill FR, Edson RS. Trimethoprim-sulfamethoxazole. Mayo Clin Proc [Internet]. Mayo Clin Proc; 1991 [cited 2021 May 25];66:1260–9. Available from: https://pubmed.ncbi.nlm.nih.gov/1749295/\n5. Dorfman LE Smith JP Sulfonamide crystalluria: a forgotten disease J Urol 1970 104 482 483 10.1016/S0022-5347(17)61764-6 5459983\n6. DeMasi MS, Bernstein AP, Schulster M, Silva M V. 100% N4-acetyl-sulfamethoxazole stone induced by trimethoprim-sulfamethoxazole in an HIV patient being treated for toxoplasmosis. Urol Case Reports [Internet]. Elsevier Inc.; 2021;34:101453. Available from: 10.1016/j.eucr.2020.101453\n7. Barnes RW Kawaichi GK Factors influencing the formation of sulfonamide urinary concretions J Urol Ovid Technologies (Wolters Kluwer Health) 1943 49 324 330\n8. Maalouf NM, Cameron MA, Moe OW, Sakhaee K. Metabolic basis for low urine pH in type 2 diabetes. Clin J Am Soc Nephrol [Internet]. Am Soc Nephrol.; 2010;5:1277. Available from: /pmc/articles/PMC2893060/\n9. Siegel WH. Unusual complication of therapy with sulfamethoxazole trimethoprim. J. Urol. No longer published by Elsevier; 1977. p. 397.\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2490",
"issue": "21(1)",
"journal": "BMC urology",
"keywords": "Case report; Drug-induced urolithiasis; Nocardia; Trimethoprim-sulfamethoxazole",
"medline_ta": "BMC Urol",
"mesh_terms": null,
"nlm_unique_id": "100968571",
"other_id": null,
"pages": "133",
"pmc": null,
"pmid": "34535099",
"pubdate": "2021-09-17",
"publication_types": "D016428:Journal Article",
"references": "20413437;5459983;839614;33163365;7703990;29264783",
"title": "Sulfamethoxazole-induced sulfamethoxazole urolithiasis: a case report.",
"title_normalized": "sulfamethoxazole induced sulfamethoxazole urolithiasis a case report"
} | [
{
"companynumb": "US-TEVA-2021-US-1966681",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SULFAMETHOXAZOLE\\TRIMETHOPRIM"
},
"drugadditio... |
{
"abstract": "Outcomes continue to improve in relapsed myeloma as more effective treatment options emerge. We report a multicenter single-arm phase 2 trial evaluating toxicity and efficacy of the histone deacetylase (HDAC) inhibitor vorinostat in combination with bortezomib and dexamethasone.\n\n\n\nSixteen patients who had received a median of 1 prior treatment line received bortezomib subcutaneously 1.3 mg/m2 days 1, 4, 8, and 11; dexamethasone 20 mg orally days 1-2, 4-5, 8-9, and 11-12; vorinostat 400 mg orally days 1-4, 8-11, and 15-18 of a 21-day cycle. After receipt of a minimum of 3 cycles of therapy, participants received maintenance vorinostat (400 mg days 1-4 and 15-18 of a 28-day cycle).\n\n\n\nOverall response was 81.3%: complete response occurred in 4 of 16, very good partial response in 2 of 16, and partial response 7 of 16. Clinical benefit response rate was 100%; median progression-free survival was 11.9 months. A total of 75% patients experienced a dose reduction or stopped treatment as a result of intolerability.\n\n\n\nAlthough toxicity and dose reductions were observed, this study demonstrates that the combination of vorinostat, bortezomib, and dexamethasone is effective in relapsed myeloma with good response rates, suggesting there is an ongoing rationale for further optimization of HDAC inhibitor-based combinations in the treatment of myeloma to improve tolerability and enhance efficacy.",
"affiliations": "Clinical Trials Research Unit, Leeds Institute of Clinical Trials Research, University of Leeds, Leeds, UK. Electronic address: S.Brown@leeds.ac.uk.;Myeloma Laboratory, The Institute of Cancer Research, Sutton, UK.;Clinical Trials Research Unit, Leeds Institute of Clinical Trials Research, University of Leeds, Leeds, UK.;Clinical Trials Research Unit, Leeds Institute of Clinical Trials Research, University of Leeds, Leeds, UK.;Clinical Trials Research Unit, Leeds Institute of Clinical Trials Research, University of Leeds, Leeds, UK.;Myeloma UK, Edinburgh, UK.;Perlmutter Cancer Center, NYU Langone Health, New York, NY.;Centre for Clinical Haematology, Nottingham University Hospitals, Nottingham, UK.;Myeloma Laboratory, The Institute of Cancer Research, Sutton, UK.;Perlmutter Cancer Center, NYU Langone Health, New York, NY.;Department of Haematology, Southampton General Hospital, Southampton, UK. Electronic address: matthew.jenner@uhs.nhs.uk.",
"authors": "Brown|Sarah|S|;Pawlyn|Charlotte|C|;Tillotson|Avie-Lee|AL|;Sherratt|Debbie|D|;Flanagan|Louise|L|;Low|Eric|E|;Morgan|Gareth J|GJ|;Williams|Cathy|C|;Kaiser|Martin|M|;Davies|Faith E|FE|;Jenner|Matthew W|MW|;|||",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.clml.2020.11.019",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2152-2669",
"issue": "21(3)",
"journal": "Clinical lymphoma, myeloma & leukemia",
"keywords": "Clinical trial; HDAC inhibitor; MM; Proteasome inhibitor",
"medline_ta": "Clin Lymphoma Myeloma Leuk",
"mesh_terms": null,
"nlm_unique_id": "101525386",
"other_id": null,
"pages": "154-161.e3",
"pmc": null,
"pmid": "33478922",
"pubdate": "2021-03",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Bortezomib, Vorinostat, and Dexamethasone Combination Therapy in Relapsed Myeloma: Results of the Phase 2 MUK four Trial.",
"title_normalized": "bortezomib vorinostat and dexamethasone combination therapy in relapsed myeloma results of the phase 2 muk four trial"
} | [
{
"companynumb": "GB-TAKEDA-2021TUS005691",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BORTEZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nTo report a case of increases in vancomycin concentrations without additional vancomycin doses being given.\n\n\nMETHODS\nA 64 year-old morbidly obese female received three total doses of vancomycin for surgical prophylaxis and for ventilator-associated pneumonia. Subsequent vancomycin concentrations from the patient's central venous catheter (CVC) demonstrated increasing drug levels from 27.1 to 45.9mcg/mL despite no additional vancomycin being given and proper line flushing prior to sample collection. There is no clear explanation for the increase in the patient's vancomycin concentration. Drug leaching from the CVC, enterohepatic recycling, drug redistribution from adipose or other tissues, and assay cross-reactivity with other medications are all potential explanations for the increased vancomycin concentrations.\n\n\nCONCLUSIONS\nThis case report describes an unexplained increase in vancomycin concentrations and reinforces both the fallibility of laboratory testing and that unusual circumstances do occur. Several potential causes are hypothesised with CVC drug leaching being the most likely. Nurses and other healthcare providers with similar scenarios should consider a peripheral blood sample to rule out the potential for CVC drug leaching as a possible explanation.",
"affiliations": "Department of Pharmacy Practice, Rosalind Franklin University of Medicine and Science, North Chicago, IL, United States; Critical Care Clinical Pharmacist, Advocate Condell Medical Center, Libertyville, IL, United States. Electronic address: sean.kane@rosalindfranklin.edu.;Department of Pharmacy Practice, Rosalind Franklin University of Medicine and Science, North Chicago, IL, United States. Electronic address: scott.hanes@rosalindfranklin.edu.",
"authors": "Kane|Sean P|SP|;Hanes|Scott D|SD|",
"chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.iccn.2016.08.004",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0964-3397",
"issue": "39()",
"journal": "Intensive & critical care nursing",
"keywords": "Central venous catheters; Critical care; Drug monitoring; Infectious disease; Medication safety; Vancomycin",
"medline_ta": "Intensive Crit Care Nurs",
"mesh_terms": "D000900:Anti-Bacterial Agents; D003429:Cross Reactions; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D006801:Humans; D008875:Middle Aged; D009767:Obesity, Morbid; D053717:Pneumonia, Ventilator-Associated; D014640:Vancomycin",
"nlm_unique_id": "9211274",
"other_id": null,
"pages": "55-58",
"pmc": null,
"pmid": "27899248",
"pubdate": "2017-04",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": null,
"title": "Unexplained increases in serum vancomycin concentration in a morbidly obese patient.",
"title_normalized": "unexplained increases in serum vancomycin concentration in a morbidly obese patient"
} | [
{
"companynumb": "US-AXELLIA-001018",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VANCOMYCIN"
},
"drugadditional": null,
"dru... |
{
"abstract": "Pulmonary Mycobacterium abscessus infection in cystic fibrosis (CF) patients is difficult to treat and considered a contra-indication for lung transplantation in most centers. We present four CF patients with chronic pulmonary M abscessus infection, in whom lung transplantation was performed. Through intensive treatment before transplantation, we achieved control of the infection in all but one patient. After a mean of 16 months of follow up, 3 patients are doing well, without evidence of local or disseminated recurrence. One patient died early post-transplant due to an unrelated cause. These findings support the possibility of lung transplantation with favorable outcome in CF patients with M abscessus infection.",
"affiliations": "Department of Pneumology, University Hospitals Leuven, Leuven, Belgium.;Department of Pneumology, University Hospitals Leuven, Leuven, Belgium.;Department of Laboratory Medicine, University Hospitals Leuven, Leuven, Belgium.;Department of Pneumology, University Hospitals Leuven, Leuven, Belgium.;Department of Medical Microbiology, Radboud University Medical Center, Nijmegen, The Netherlands.;Department of Pneumology, University Hospitals Leuven, Leuven, Belgium.;Department of Thoracic surgery, University Hospitals Leuven, Leuven, Belgium.;Department of Pneumology, University Hospitals Leuven, Leuven, Belgium.",
"authors": "Raats|Daan|D|https://orcid.org/0000-0002-1230-0620;Lorent|Natalie|N|;Saegeman|Veroniek|V|;Vos|Robin|R|;van Ingen|Jakko|J|;Verleden|Geert|G|;Van Raemdonck|Dirk|D|;Dupont|Lieven|L|",
"chemical_list": "D000900:Anti-Bacterial Agents",
"country": "Denmark",
"delete": false,
"doi": "10.1111/tid.13046",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1398-2273",
"issue": "21(2)",
"journal": "Transplant infectious disease : an official journal of the Transplantation Society",
"keywords": "\nMycobacterium abscessus\n; cystic fibrosis; lung transplantation",
"medline_ta": "Transpl Infect Dis",
"mesh_terms": "D000328:Adult; D000900:Anti-Bacterial Agents; D002908:Chronic Disease; D003550:Cystic Fibrosis; D005260:Female; D006801:Humans; D008168:Lung; D016040:Lung Transplantation; D008297:Male; D009165:Mycobacterium Infections, Nontuberculous; D009170:Nontuberculous Mycobacteria; D055815:Young Adult",
"nlm_unique_id": "100883688",
"other_id": null,
"pages": "e13046",
"pmc": null,
"pmid": "30597699",
"pubdate": "2019-04",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Successful lung transplantation for chronic Mycobacterium abscessus infection in advanced cystic fibrosis, a case series.",
"title_normalized": "successful lung transplantation for chronic mycobacterium abscessus infection in advanced cystic fibrosis a case series"
} | [
{
"companynumb": "BE-FRESENIUS KABI-FK201905418",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "IMIPENEM"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nPreoperative chemoradiotherapy and local excision via transanal endoscopic surgery (TEM) in T2-3s,N0,M0 rectal cancer achieve promising results in selected patients. We describe our long-term follow-up experience with this combination, and evaluate complete clinical and pathological responses, local recurrence and overall survival.\n\n\nMETHODS\nThe prospective observational follow-up study carried out since 2007. Out of 476 consecutive patients treated with TEM, we selected those with adenocarcinoma of low or moderate grade of differentiation, clinical stages T2-superficial T3,N0,M0, who refused radical surgery. Preoperative chemoradiotherapy comprised 5-fluorouracil or capecitabine combined with radiotherapy at a dose of 50.4 Gy. TEM was performed after 8 weeks. Complications were recorded and long-term follow-up was conducted.\n\n\nRESULTS\nFifteen patients undergoing preoperative chemoradiotherapy and TEM (median age 76 years, 95 % CI 70.3-80.4, and median follow-up 38 months, 95 % CI 20-44) were studied. No local recurrence was observed, and only one patient (6.7 %) presented systemic relapse. The overall survival was 76 %. Complete clinical response was achieved in seven patients (46.7 %) and complete pathological response in four (26.7 %). With regard to toxicity associated with neoadjuvant treatment, four patients (26.7 %) developed grade 3 adverse effects; no grade 4 or 5 adverse effects were observed. There was no postoperative mortality.\n\n\nCONCLUSIONS\nThe results of our study, with a response rate of 26.7 % and without local relapse, support the treatment of T2-3s,N0,M0 of rectal cancer with preoperative chemoradiotherapy and local excision (TEM).",
"affiliations": "Medical Oncology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Parc Tauli, no. 1, 08208, Sabadell, Barcelona, Spain. cpericay@gmail.com.;Coloproctology Unit, General and Digestive Surgery Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Sabadell, Barcelona, Spain.;Medical Oncology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Parc Tauli, no. 1, 08208, Sabadell, Barcelona, Spain.;Coloproctology Unit, General and Digestive Surgery Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Sabadell, Barcelona, Spain.;Medical Oncology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Parc Tauli, no. 1, 08208, Sabadell, Barcelona, Spain.;Pathology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Sabadell, Barcelona, Spain.;Medical Oncology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Parc Tauli, no. 1, 08208, Sabadell, Barcelona, Spain.;Medical Oncology Service, Parc Tauli University Hospital, Universidad Autonoma de Barcelona, Parc Tauli, no. 1, 08208, Sabadell, Barcelona, Spain.",
"authors": "Pericay|C|C|;Serra-Aracil|X|X|;Ocaña-Rojas|J|J|;Mora-López|L|L|;Dotor|E|E|;Casalots|A|A|;Pisa|A|A|;Saigí|E|E|",
"chemical_list": "D000970:Antineoplastic Agents; D000069287:Capecitabine; D005472:Fluorouracil",
"country": "Italy",
"delete": false,
"doi": "10.1007/s12094-015-1415-7",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1699-048X",
"issue": "18(7)",
"journal": "Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico",
"keywords": "Preoperative chemoradioterapy; Rectal cancer; TEM",
"medline_ta": "Clin Transl Oncol",
"mesh_terms": "D000230:Adenocarcinoma; D000368:Aged; D000369:Aged, 80 and over; D000970:Antineoplastic Agents; D000069287:Capecitabine; D059248:Chemoradiotherapy; D059186:Chemoradiotherapy, Adjuvant; D005260:Female; D005472:Fluorouracil; D005500:Follow-Up Studies; D006801:Humans; D053208:Kaplan-Meier Estimate; D008297:Male; D008875:Middle Aged; D020360:Neoadjuvant Therapy; D011446:Prospective Studies; D012004:Rectal Neoplasms; D000067368:Transanal Endoscopic Surgery; D016896:Treatment Outcome",
"nlm_unique_id": "101247119",
"other_id": null,
"pages": "666-71",
"pmc": null,
"pmid": "26497352",
"pubdate": "2016-07",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": "22529255;25206260;23849272;6510078;8244804;9486606;23774094;19847569;8416784;17252286;10705009;23222272;18163173;11920483;24799484;16252312;15273550;19231466;12732695;22067180;11686527;15496622;15273542;10950004;11848629;22864880;15383798;21755378;23222274;23813055",
"title": "Further evidence for preoperative chemoradiotherapy and transanal endoscopic surgery (TEM) in T2-3s,N0,M0 rectal cancer.",
"title_normalized": "further evidence for preoperative chemoradiotherapy and transanal endoscopic surgery tem in t2 3s n0 m0 rectal cancer"
} | [
{
"companynumb": "ES-ROCHE-1797225",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3",
"dru... |
{
"abstract": "The number of transmen seeking gender-confirming surgery has risen steadily throughout the last decade. Pathologists are increasingly confronted with transmale mastectomy specimens. It is not clear whether routine histopathological examination is useful. This study explored the possible benefit of routine investigation through detailed description of lesions encountered in mastectomy specimens after female-to-male gender-confirming surgery.\n\n\n\nBreast tissue from a cohort of transmen was reviewed. The presence of benign and malignant breast lesions was recorded. The number of terminal duct-lobule units (TDLUs) per ten low-power fields (LPFs) was quantified. Information on hormone therapy and morphometry was retrieved for selected patients.\n\n\n\nThe cohort included 344 subjects with a mean age of 25·8 (range 16-61) years at the time of surgery; the age at surgery decreased significantly over time. Older individuals presented with a significantly higher number of breast lesions. The number of TDLUs per LPF was lower in heavier breasts, but did not correlate with age. Breast lesions, either benign or malignant, were present in 166 individuals (48·3 per cent). Invasive breast cancer was found in two (0·6 per cent); one tumour was an unexpected finding. The number of breast lesions encountered on histopathological examination increased significantly when more tissue blocks were taken.\n\n\n\nThe discovery of an unexpected breast cancer in a 31-year-old transman emphasizes the importance of thorough routine histopathological examination of mastectomy specimens. The number of tissue blocks taken should be based on age and breast weight.",
"affiliations": "Department of Pathology, Ghent University Hospital, Ghent, Belgium.;Department of Pathology, Ghent University Hospital, Ghent, Belgium.;Department of Endocrinology, Ghent University Hospital, Ghent, Belgium.;Centre for Sexology and Gender, Ghent University Hospital, Ghent, Belgium.;Department of Endocrinology, Ghent University Hospital, Ghent, Belgium.;Department of Pathology, Ghent University Hospital, Ghent, Belgium.;Department of Pathology, Ghent University Hospital, Ghent, Belgium.;Centre for Sexology and Gender, Ghent University Hospital, Ghent, Belgium.;Department of Pathology, Ghent University Hospital, Ghent, Belgium.",
"authors": "Van Renterghem|S M J|SMJ|;Van Dorpe|J|J|;Monstrey|S J|SJ|;Defreyne|J|J|;Claes|K E Y|KEY|;Praet|M|M|;Verbeke|S L J|SLJ|;T'Sjoen|G G R|GGR|;Van Bockstal|M R|MR|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/bjs.10794",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-1323",
"issue": "105(7)",
"journal": "The British journal of surgery",
"keywords": null,
"medline_ta": "Br J Surg",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000367:Age Factors; D001940:Breast; D001943:Breast Neoplasms; D005260:Female; D000068116:Gender Dysphoria; D006801:Humans; D008297:Male; D008408:Mastectomy; D008875:Middle Aged; D009929:Organ Size; D012307:Risk Factors; D057830:Sex Reassignment Surgery; D014189:Transsexualism; D055815:Young Adult",
"nlm_unique_id": "0372553",
"other_id": null,
"pages": "885-892",
"pmc": null,
"pmid": "29623678",
"pubdate": "2018-06",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Routine histopathological examination after female-to-male gender-confirming mastectomy.",
"title_normalized": "routine histopathological examination after female to male gender confirming mastectomy"
} | [
{
"companynumb": "BE-ENDO PHARMACEUTICALS INC-2020-005518",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TESTOSTERONE"
},
"drugadditiona... |
{
"abstract": "Calcinosis cutis results from the deposition of insoluble calcium salts in the skin and subcutaneous tissue. Herein, we report a case of extensive metastatic calcinosis cutis in an 18-year-old woman with stage IV Hodgkin lymphoma with skeletal involvement. With combination therapy including radiation directed at her lymphoma and diltiazem, her lesions improved dramatically. This case demonstrates the previously unreported association between calcinosis cutis and Hodgkin lymphoma.",
"affiliations": "Northwestern University, Department of Dermatology, Chicago, Illinois. Emily.Keimig@nm.org.",
"authors": "Dennin|Margaret H|MH|;Dulmage|Brittany O|BO|;Yazdan|Pedram|P|;Keimig|Emily|E|",
"chemical_list": "D002121:Calcium Channel Blockers; D004110:Diltiazem",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1087-2108",
"issue": "24(11)",
"journal": "Dermatology online journal",
"keywords": null,
"medline_ta": "Dermatol Online J",
"mesh_terms": "D000293:Adolescent; D000971:Antineoplastic Combined Chemotherapy Protocols; D001859:Bone Neoplasms; D002114:Calcinosis; D002121:Calcium Channel Blockers; D004110:Diltiazem; D005260:Female; D006689:Hodgkin Disease; D006801:Humans; D006934:Hypercalcemia; D009367:Neoplasm Staging; D012875:Skin Diseases, Metabolic",
"nlm_unique_id": "9610776",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "30695977",
"pubdate": "2018-11-15",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Metastatic calcinosis cutis in a patient with Hodgkin's lymphoma.",
"title_normalized": "metastatic calcinosis cutis in a patient with hodgkin s lymphoma"
} | [
{
"companynumb": "US-TEVA-2019-US-1067933",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ETOPOSIDE"
},
"drugadditional": "3",
... |
{
"abstract": "As part of a retrospective study on bronchoscopies performed at the Clinic of Pneumonology and Phthisiatry of the University Hospital - Pleven by autofluorescence bronchoscopy we found 3 cases diagnosed with carcinoma in situ. They were treated in different ways - endobronchial electrocoagulation, extraction by forceps biopsy and open surgery, but the result was the same - clinical healing. The paper presents the three clinical cases and the analysis of the treatment.",
"affiliations": "Clinic of Pneumonology and Phthisiatry, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Clinic of Pneumonology and Phthisiatry, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Clinic of Pneumonology and Phthisiatry, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Department of Pathological Anatomy, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Department of Pathological Anatomy, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Department of Pathological Anatomy, Dr. G. Stranski University Hospital, Pleven, Bulgaria.;Department of Social and Preventive Medicine, Medical Statistics, Pedagogics and Psychology, Medical University of Pleven, Pleven, Bulgaria.;Clinic of Pneumonology and Phthisiatry, Dr. G. Stranski University Hospital, Pleven, Bulgaria.",
"authors": "Andreev|Valeri Y|VY|;Yanev|Nikolay A|NA|;Stanimirov|Stefan K|SK|;Mircheva|Temenuzhka V|TV|;Ivanov|Ivan N|IN|;Popovska|Savelina|S|;Hristova|Petkana A|PA|;Ivanov|Yavor Y|YY|",
"chemical_list": null,
"country": "Bulgaria",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0204-8043",
"issue": "60(1)",
"journal": "Folia medica",
"keywords": "autofluorescence bronchoscopy; carcinoma in situ",
"medline_ta": "Folia Med (Plovdiv)",
"mesh_terms": "D000368:Aged; D002283:Carcinoma, Bronchogenic; D004564:Electrocoagulation; D006801:Humans; D008168:Lung; D008175:Lung Neoplasms; D008297:Male; D008875:Middle Aged; D011013:Pneumonectomy",
"nlm_unique_id": "2984761R",
"other_id": null,
"pages": "164-169",
"pmc": null,
"pmid": "29668447",
"pubdate": "2018-03-01",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Diagnosis and Treatment of Three Cases of Bronchial Carcinoma In Situ.",
"title_normalized": "diagnosis and treatment of three cases of bronchial carcinoma in situ"
} | [
{
"companynumb": "BG-ASTRAZENECA-2018SE60479",
"fulfillexpeditecriteria": "1",
"occurcountry": "BG",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BUDESONIDE\\FORMOTEROL FUMARATE DIHYDRATE"
},
... |
{
"abstract": "A 55-year-old woman with concurrent active thyroid orbitopathy and B-cell lymphoma developed acute exacerbation of thyroid orbitopathy after receiving Rituximab, cyclophosphamide, hydroxydaunorubicin, Prednisone (R-CHOP) chemotherapy, presenting with subtotal loss of vision and severe eyelid edema. Intravenous methylprednisolone was fully effective within several hours. Further exacerbations of her orbitopathy were seen following every subsequent chemotherapeutic treatment, but responded well to oral prednisone. This case shows that thyroid orbitopathy may severely and acutely progress after chemotherapy for concurrent B-cell lymphoma. Clinical awareness of this potential complication may prevent blindness in this rare subset of patients.",
"affiliations": "a The Rotterdam Eye Hospital , Rotterdam , the Netherlands.;b Departments of Internal Medicine and Immunology , Erasmus Medical Center , Rotterdam , The Netherlands.;b Departments of Internal Medicine and Immunology , Erasmus Medical Center , Rotterdam , The Netherlands.;c Department of Internal Medicine and Hematology , Ikazia Hospital , Rotterdam , The Netherlands.;a The Rotterdam Eye Hospital , Rotterdam , the Netherlands.",
"authors": "Liu|C|C|;Dalm|V A S H|VASH|;van Hagen|P M|PM|;Croon-de Boer|F|F|;Paridaens|D|D|",
"chemical_list": "D058846:Antibodies, Monoclonal, Murine-Derived; D005938:Glucocorticoids; C571759:R-CHOP protocol; D000069283:Rituximab; D014750:Vincristine; D004317:Doxorubicin; D003520:Cyclophosphamide; D011239:Prednisolone; D011241:Prednisone",
"country": "England",
"delete": false,
"doi": "10.1080/01676830.2017.1423086",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0167-6830",
"issue": "37(4)",
"journal": "Orbit (Amsterdam, Netherlands)",
"keywords": "B-cell lymphoma; Graves’ orbitopathy; R-CHOP; Rituximab; immunochemotherapy; thyroid orbitopathy",
"medline_ta": "Orbit",
"mesh_terms": "D000284:Administration, Oral; D058846:Antibodies, Monoclonal, Murine-Derived; D000971:Antineoplastic Combined Chemotherapy Protocols; D003520:Cyclophosphamide; D004317:Doxorubicin; D005260:Female; D005938:Glucocorticoids; D049970:Graves Ophthalmopathy; D006801:Humans; D016393:Lymphoma, B-Cell; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D009916:Orbital Diseases; D011239:Prednisolone; D011241:Prednisone; D000069283:Rituximab; D014750:Vincristine",
"nlm_unique_id": "8301221",
"other_id": null,
"pages": "299-302",
"pmc": null,
"pmid": "29300515",
"pubdate": "2018-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Chemotherapy-induced exacerbations of thyroid orbitopathy in a patient with B-cell lymphoma.",
"title_normalized": "chemotherapy induced exacerbations of thyroid orbitopathy in a patient with b cell lymphoma"
} | [
{
"companynumb": "NL-MYLANLABS-2018M1029216",
"fulfillexpeditecriteria": "1",
"occurcountry": "NL",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "PREDNISONE"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nCentral diabetes insipidus is a heterogeneous condition characterized by decreased release of antidiuretic hormone by the neurohypophysis resulting in a urine concentration deficit with variable degrees of polyuria. The most common causes include idiopathic diabetes insipidus, tumors or infiltrative diseases, neurosurgery and trauma. Temozolomide is an oral DNA-alkylating agent capable of crossing the blood-brain barrier and used as chemotherapy primarily to treat glioblastoma and other brain cancers.\n\n\nMETHODS\nTwo men (aged 38 and 54 years) suddenly developed polyuria and polydispsia approximately four weeks after the initiation of temozolomide for a glioblastoma. Plasma and urine parameters demonstrated the presence of a urinary concentration defect.\n\n\nRESULTS\nThe clinical and laboratory abnormalities completely resolved with intranasal desmopressin therapy, allowing the continuation of temozolomide. The disorder did not relapse after cessation of temozolomide and desmopressin and relapsed in one patient after rechallenge with temozolomide.\n\n\nCONCLUSIONS\nOur report highlights the importance of a quick recognition of this exceptional complication, in order to initiate promptly treatment with desmopressin and to maintain therapy with temozolomide.",
"affiliations": "Department of Oncology, Clinique Saint-Pierre, Ottignies, Belgium.;Department of Nephrology, Cliniques universitaires Saint-Luc, Brussels, Belgium.;Department of Medical Imaging, Cliniques universitaires Saint-Luc, Brussels, Belgium.;Department of Oncology, Clinique Saint-Pierre, Ottignies, Belgium.;Department of Oncology, Clinique Saint-Pierre, Ottignies, Belgium.;Department of Nephrology, Cliniques universitaires Saint-Luc, Brussels, Belgium.",
"authors": "Mahiat|Cédric|C|https://orcid.org/0000-0002-7253-8235;Capes|Antoine|A|;Duprez|Thierry|T|;Whenham|Nicolas|N|;Duck|Lionel|L|;Labriola|Laura|L|https://orcid.org/0000-0003-4133-881X",
"chemical_list": "D018906:Antineoplastic Agents, Alkylating; D014667:Vasopressins; D003894:Deamino Arginine Vasopressin; D000077204:Temozolomide",
"country": "England",
"delete": false,
"doi": "10.1177/1078155220961551",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "27(4)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Diabetes insipidus; desmopressin; polyuria polydipsia; temozolomide",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000328:Adult; D018906:Antineoplastic Agents, Alkylating; D001932:Brain Neoplasms; D003894:Deamino Arginine Vasopressin; D020790:Diabetes Insipidus, Neurogenic; D017809:Fatal Outcome; D005909:Glioblastoma; D006801:Humans; D008297:Male; D008875:Middle Aged; D000077204:Temozolomide; D014667:Vasopressins",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "1040-1045",
"pmc": null,
"pmid": "32990192",
"pubdate": "2021-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Central diabetes insipidus induced by temozolomide: A report of two cases.",
"title_normalized": "central diabetes insipidus induced by temozolomide a report of two cases"
} | [
{
"companynumb": "BE-Accord-205254",
"fulfillexpeditecriteria": "1",
"occurcountry": "BE",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "TEMOZOLOMIDE"
},
"drugadditional": "1",
"dru... |
{
"abstract": "Treatment with asfotase alfa has transformed the prognosis of hypophosphatasia in children and improves the bone and muscle signs in adults. The doses used in adults are the same as in children, whereas bone remodeling is different between them. We report on the cases of two patients treated with 1 mg/kg/day of asfotase alfa who developed spinal cord compression from spinal ossifications during treatment. The first patient, 50 years old, presented after 2 years of treatment with quadraparesis secondary to an increase in ossifications of the cervical vertebral ligaments. The neurological damage was resolved after laminectomy, and the patient was then treated for 18 months with doses of 80 mg per week, without recurrence of the bone and muscle signs. The second patient, 26 years old, 78 kg, developed pain and cervical stiffness with pyramidal tract irritation secondary to ossifications of the vertebral ligaments. This improved with a reduction of doses to 80 mg/week, which then, after 6 months of follow-up, enabled maintained improvement of the bone and muscle pain that was initially obtained. To our knowledge, these are the first reported cases of increased spinal ligamentous ossifications with neurological complications. Biological monitoring in adults does not seem to enable asfotase alfa doses to be adjusted. The levels of serum alkaline phosphatase (ALP) while on the recommended treatment of 1 mg/kg/day are significantly supraphysiological (5000 to 20,000 IU) and the assays of pyrophosphate and pyridoxal phosphate are not correlated with clinical efficacy. In both of our patients, the treatment with 80 mg of asfotase alfa per week, which was proposed after the occurrence of spinal complications, seemed as effective, after a follow-up of 18 months and 6 months, as the initial treatment for improving the bone and muscle signs, and could be provided as \"attack\" doses after healing of the pseudoarthroses. © 2021 American Society for Bone and Mineral Research © 2020 The Authors. JBMR Plus published by Wiley Periodicals LLC. on behalf of American Society for Bone and Mineral Research.",
"affiliations": "Centre de Rhumatologie du Centre Hospitalo-Universitaire de Toulouse [Rheumatology Center of Toulouse University Hospital] Toulouse France.;Centre de Rhumatologie du Centre Hospitalo-Universitaire de Toulouse [Rheumatology Center of Toulouse University Hospital] Toulouse France.;Service de Radiologie du Centre Hospitalo-Universitaire de Toulouse [Department of Radiology of Toulouse University Hospital] Toulouse France.;Centre de Rhumatologie du Centre Hospitalo-Universitaire de Toulouse [Rheumatology Center of Toulouse University Hospital] Toulouse France.;Endocrinologie, Maladies Osseuses, Hôpital des Enfants, Centre de Référence des Maladies Rares du Métabolisme du Calcium et Phosphate, European Reference Network on rare bone diseases, Centre Hospitalo-Universitaire de Toulouse Toulouse France.;Endocrinologie, Maladies Osseuses, Hôpital des Enfants, Centre de Référence des Maladies Rares du Métabolisme du Calcium et Phosphate, European Reference Network on rare bone diseases, Centre Hospitalo-Universitaire de Toulouse Toulouse France.;Centre de Rhumatologie du Centre Hospitalo-Universitaire de Toulouse [Rheumatology Center of Toulouse University Hospital] Toulouse France.",
"authors": "Laroche|Michel|M|https://orcid.org/0000-0003-2319-6686;Couture|Guillaume|G|;Faruch|Marie|M|;Ruyssen-Witrand|Adeline|A|;Porquet-Bordes|Valérie|V|;Salles|Jean Pierre|JP|;Degboe|Yannick|Y|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/jbm4.10449",
"fulltext": "\n==== Front\nJBMR Plus\nJBMR Plus\n10.1002/(ISSN)2473-4039\nJBM4\nJBMR Plus\n2473-4039\nJohn Wiley & Sons, Inc. Hoboken, USA\n\n10.1002/jbm4.10449\nJBM410449\nOriginal Article\nOriginal Articles\nHypophosphatasia: A Case of Two Patients With Spinal Cord Compression From Increase in Ligamentous Ossifications During Treatment\nHYPOPHOSPHATASIA: SPINAL CORD COMPRESSION ON ASFOTASE ALFA\nLaroche et al.\nLaroche Michel https://orcid.org/0000-0003-2319-6686\n1 laroche.m@chu-toulouse.fr\n\nCouture Guillaume 1\nFaruch Marie 2\nRuyssen‐Witrand Adeline 1\nPorquet‐Bordes Valérie 3\nSalles Jean Pierre 3 4\nDegboe Yannick 1 4\n1 Centre de Rhumatologie du Centre Hospitalo‐Universitaire de Toulouse [Rheumatology Center of Toulouse University Hospital] Toulouse France\n2 Service de Radiologie du Centre Hospitalo‐Universitaire de Toulouse [Department of Radiology of Toulouse University Hospital] Toulouse France\n3 Endocrinologie, Maladies Osseuses, Hôpital des Enfants, Centre de Référence des Maladies Rares du Métabolisme du Calcium et Phosphate, European Reference Network on rare bone diseases, Centre Hospitalo‐Universitaire de Toulouse Toulouse France\n4 INSERM UMR 1043 CNRS5825, Centre de Physiopathologie de Toulouse Purpan, Centre de Physiopathology Toulouse Purpan, Université de Toulouse Toulouse France\n* Address correspondence to: Prof. Michel Laroche, Rheumatology Center, Pierre Paul Riquet Hospital, 1 place du Dr Baylac, 31059, Toulouse cedex, France. E‐mail: laroche.m@chu-toulouse.fr\n\n05 3 2021\n4 2021\n5 4 10.1002/jbm4.v5.4 e1044913 10 2020\n08 11 2020\n© 2020 The Authors. JBMR Plus published by Wiley Periodicals LLC. on behalf of American Society for Bone and Mineral Research.\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nABSTRACT\n\nTreatment with asfotase alfa has transformed the prognosis of hypophosphatasia in children and improves the bone and muscle signs in adults. The doses used in adults are the same as in children, whereas bone remodeling is different between them. We report on the cases of two patients treated with 1 mg/kg/day of asfotase alfa who developed spinal cord compression from spinal ossifications during treatment. The first patient, 50 years old, presented after 2 years of treatment with quadraparesis secondary to an increase in ossifications of the cervical vertebral ligaments. The neurological damage was resolved after laminectomy, and the patient was then treated for 18 months with doses of 80 mg per week, without recurrence of the bone and muscle signs. The second patient, 26 years old, 78 kg, developed pain and cervical stiffness with pyramidal tract irritation secondary to ossifications of the vertebral ligaments. This improved with a reduction of doses to 80 mg/week, which then, after 6 months of follow‐up, enabled maintained improvement of the bone and muscle pain that was initially obtained. To our knowledge, these are the first reported cases of increased spinal ligamentous ossifications with neurological complications. Biological monitoring in adults does not seem to enable asfotase alfa doses to be adjusted. The levels of serum alkaline phosphatase (ALP) while on the recommended treatment of 1 mg/kg/day are significantly supraphysiological (5000 to 20,000 IU) and the assays of pyrophosphate and pyridoxal phosphate are not correlated with clinical efficacy. In both of our patients, the treatment with 80 mg of asfotase alfa per week, which was proposed after the occurrence of spinal complications, seemed as effective, after a follow‐up of 18 months and 6 months, as the initial treatment for improving the bone and muscle signs, and could be provided as “attack” doses after healing of the pseudoarthroses. © 2021 American Society for Bone and Mineral Research © 2020 The Authors. JBMR Plus published by Wiley Periodicals LLC. on behalf of American Society for Bone and Mineral Research.\n\nBONE DISEASES, OTHER\nTHERAPEUTICS, OTHER\nDISEASES AND DISORDERS OF/RELATED TO BONE\nDISORDERS OF CALCIUM/PHOSPHATE METABOLISM\nsource-schema-version-number2.0\ncover-dateApril 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.2 mode:remove_FC converted:14.04.2021\n==== Body\nIntroduction\n\nHypophosphatasia is a very rare metabolic disease that is caused by a loss of function of the ALPL gene, which codes for the alkaline phosphatase enzyme. Several mutations have been reported, with relationships variable between genotypes and phenotypes.( 1 , 2 , 3 , 4 )\n\nThe reduction of alkaline phosphatase (ALP) and its bone fraction (bone alkaline phosphatase [BAP]) result in bone mineralization disturbances related to the deficiency of ALP itself and especially to an accumulation of substrates degraded by ALP: pyridoxal 5‐phosphate (PLP), inorganic pyrophosphate (PPi), and phosphoethanolamine.( 5 , 6 , 7 , 8 , 9 ) The clinical signs typically begin in childhood and include, with varying severity, craniostenosis, bone pain, spontaneous fractures with pseudoarthrosis, muscle pain, loss of muscle strength, calcium deposits on the ligaments and on the articular cartilage, and decidual tooth loss. Asfotase alfa is a recombinant human enzyme that has been provided over the past several years as a treatment for hypophosphatasia in children.( 10 , 11 , 12 ) The indication has been extended to certain forms of adult hypophosphatasia. The efficacy of asfotase alfa was demonstrated in the study by Kishnani and colleagues.( 13 ) Other publications concerning isolated cases confirmed this efficacy( 14 , 15 ) and the need to continue treatment given the risk of recurrence of bone signs.( 16 ) The same treatment regimen and the same doses were provided in adults and children, although bone remodeling is completely different in adults, and in 2017, Shapiro and Lewiecki pointed out the lack of guidelines in adults.( 11 , 17 )\n\nApart from skin reactions at the injections site, which are frequent but benign, the side effects concerning three patients from Kishnani and colleagues'( 13 ) series were ocular and renal calcifications. The absence of vascular or cardiac calcification is noted in a recent publication.( 18 )\n\nWe report on the first two case reports of patients treated with 1 mg/kg/day of asfotase alfa, who had increased or modified structuring of spinal ligamentous ossifications with spinal cord compression while on treatment.\n\nCase reports\n\nMs. X, born in 1965, 1.60 m, 50 kg, presented with a severe form of hypophosphatasia. Her disease was diagnosed at the age of 20 years in the presence of infantile craniosynostosis, pseudoarthroses, and bone pain.\n\nTesting for the ALPL mutation confirmed the diagnosis (heterozygous: N4611, exon 12).\n\nThe pseudoarthroses required rodding of both femurs. Pseudoarthrosis also concerned the right humerus, three ribs, the right fibula, and two metatarsals. Treatment with teriparatide, which was discontinued after 6 months for increased bone pain, was ineffective for consolidating these fractures. The pseudarthroses were associated with chondrocalcinosis of the hips, knees, and shoulders, and with ligamentous ossifications (hyperostosis) in association with intradiscal calcifications.\n\nIn September 2016, as part of the AA‐HPP 405 protocol, the patient received treatment with asfotase alfa, 80 mg three times weekly. Before treatment, the total ALP was 7 IU, and the BAP was <2 IU. The serum calcium, serum phosphorous, urinary calcium, and glomerular filtration rate (GFR) were normal, as were the bone turnover markers (CTX: 300 pg/mL [normal = 150–700 pg/mL], osteocalcin: 35 pg/mL [normal = 20–55 pg/mL]). PLP was 150 ng/mL (normal = 15–35 ng/mL).\n\nBone pain and functional disability improved dramatically in several weeks: the pain visual analogue scale (pain VAS) went from 8/10 to 2/10, and the quality of life visual scale (quality of life VAS) went from 4/10 to 7/10. At 6 months, the pseudoarthroses were consolidated (Figs. 1 and 2).\n\nFig 1 Right side humerus X‐rays: previous pseudarthrosis.\n\nFig 2 Right side humerus X‐rays after 3 months of asfotase treatment: pseudoarthrosis consolidation.\n\nIn March 2017, after 6 months of treatment, the patient presented neck pain with limited movement of the cervical spine (chin‐sternum distance: 8 cm, lateral tilts: 20 degrees, head rotations: 20 degrees), for which a CT scan and an MRI of the cervical spine were done. These exams showed ligamentous ossifications of the anterior longitudinal ligaments (Figs. 3 and 4). C1–C2 arthrosis was present with crowned dens syndrome. The pain was relieved with diclofenac and physical therapy sessions.\n\nFig 3 MRI of the cervical spine (March 2017). Sagittal sections, T2‐weighted sequences: extensive ossifications of the posterior longitudinal ligament and the annular ligament with a “crowned dens” appearance.\n\nFig 4 CT scan of the cervical spine (March 2017). Sagittal sections: diffuse bone sclerosis, predominant on the vertebral bodies at the cervical level, sites of biconcave compression. Hyperostosis with enthesopathy and more pronounced discal‐ligamentous ossifications on the anterior and posterior longitudinal ligaments. Ossification of the annular ligament with a “crowned dens” appearance. C0–C1 and C1–C2 degenerative modifications.\n\nIn November 2018, the patient described a sensation of numbness in glove distribution to the upper limb extremities in association with clumsiness with gripping and writing. She also mentioned fatigability of the lower limbs. There was then a pyramidal tract syndrome to all limbs, predominantly in the upper limbs, with abolishment of vibratory and arthrokinetic sensitivity.\n\nAnother cervical MRI showed compression of the cervical spinal cord predominant in C3 and C4, with structural modification of ossifications of the anterior vertebral ligaments and thickening of the adjacent soft tissue (Fig. 5).\n\nFig 5 MRI of the cervical spine (December 2018). Sagittal sections, T2‐weighted sequence: Increased ossifications of the posterior longitudinal ligament and the yellow ligaments responsible for narrowing of the vertebral canal, which causes spinal cord compression, as shown by the presence of a C3–C4 intramedullary hypersignal.\n\nAn increase in measurable bone mineral density was noted only in the spine (L2–L4) due to the rodding of the femurs: 1.245 g/cm2 versus 1.038 g/cm2 in 2015, which corresponds to a normal T‐score at 0.5.\n\nOn treatment the ALP was 10.679 IU, BAP was 1400 IU, and the PLP was below the threshold of 5 ng/mL.\n\nTreatment with asfotase alfa was discontinued; a decompressive laminectomy was performed. After stopping the treatment for 21 days, the ALP level was still 4500 IU.\n\nTwo months later, the motor and sensory signs were fully resolved. A CT scan seemed to show modification of the calcific density of the ligamentous ossifications (Fig. 6).\n\nFig 6 Postoperative CT scan of the cervical spine (March 2019). Sagittal sections: sequelae of posterior laminectomy, decrease in density and thickness of anterior and posterior discal‐ligamentous ossifications.\n\nThe asfotase treatment was resumed at much lower doses: 80 mg every 21 days. The ALP levels at this dosage were 920 IU 2 days after the injection, 200 IU before that, and PLP was 145 ng/mL the day before the injection.\n\nAfter 6 months of this treatment regimen, Ms. V said she had recurrence of the initial bone and muscle pain, without fractures, and without radiological modifications.\n\nAsfotase alfa was then administered at 80 mg/week. The patient was seen every month. The pain had disappeared at the end of 2 months on this regimen. The clinical condition was stable after 1 year of follow‐up, with the pain and quality of life VAS identical to those obtained at the start of treatment when the asfotase alfa was 80 mg three times per week. The ALP was 2500 IU 2 days after the injection, 811 IU before that, and the BAP the day before the injection was 250 IU. PLP was 75 ng/mL after the injection, and 155 ng/mL before that.\n\nA CT scan of the chest and an ultrasound exam of the vascular walls did not show calcifications of the coronary arteries or the large vessels. The follow‐up kidney ultrasound was normal, as was the annual ophthalmology follow‐up.\n\nMs. Y, born in 1990, was managed in the pediatrics department for genetically‐confirmed (heterozygous composite V111M and A115V) hypophosphatasia that had expressed during the neonatal period.\n\nThe clinical description of this patient has been described.( 8 ) At the end of the pediatric period she developed intense spinal pain, with no origin defined on MRI examinations, and secondarily bilateral subtrochanteric non‐union. Treatment with teriperatide instituted after the end of growth has been shown to be ineffective in pain. She then developed morbid obesity and no longer works. At the age of 27 years, in 2007, we noted an intake of 30 kg in 5 years, a BMI at 39 kg/m2, a weight of 78 kg for a height 1.41 m. She continued to suffer from non‐union of the femurs and left wrist, chest deformity, and kyphosis of the back.\n\nHer phosphate‐calcium test was normal, as were the bone turnover markers: CTX 170 pg/mL, osteocalcin: 25 pg/mL. Her ALP was 5 IU, the BAP was below 2 IU, and the PLP was 100 ng/mL.\n\nIn September 2016, treatment with asfotase (80 mg, 6/7 days) was started. The patient gradually described decreased bone and muscle pain, and she could walk again with a walker. The pain VAS went from 9/10 to 5/10, and the quality of life VAS from 2/10 to 5/10. The pseudoarthroses consolidated. A simultaneous weight loss of 15 kg was noted.\n\nThe treatment was continued at the same doses until January 2019. On treatment the ALP was 20.565 IU, BAP was 6.410 IU, and the pyridoxal phosphate was below 5 ng/mL. The patient reported gradual limitation in mobility of the cervical spine and the lumbar spine. Neck extension was limited (chin‐sternum distance = 10 cm, occiput‐wall distance = 10 cm), as was that of the lumbar spine (Schober's test = 0 cm). Due to considerable pain in these positions the patient could no longer lie down flat on her back and was obliged to sleep in a lateral position despite anti‐inflammatory treatment for 15 days. Although muscle strength was normal, the reflexes to the four limbs were brisk, with spread, with a positive Hoffman's sign bilaterally and Babinski sign on the left. A CT scan done under hypnosis showed major ossification of the posterior longitudinal ligament (Fig. 7). The anesthesiologist refused to sedate the patient to perform an MRI. The follow‐up bone density scan was impossible to perform as the supine position could not be maintained. The follow‐up kidney ultrasound was normal, as was the ophthalmology follow‐up. Treatment with asfotase alfa was then reduced to 80 mg/week. Two months later, Ms. G received daily rehabilitation at a specialized center lasting for 1 month. She was seen again 6 months after the dosage reduction and the rehabilitation. The initial bone pain had not reappeared, there was no pathological fracture (X‐rays unchanged) and the spinal mobility gradually improved to where the supine position could be achieved. The reflexes were still brisk and with spread, but the Hoffman's and Babinski signs were gone. At these doses, on the day following the injection the ALP was 2540 IU, BAP 1200 IU, and PLP 67 ng/mL; on the day before the injection these were, respectively, 1166 IU, 800 IU, and 312 ng/mL.\n\nFig 7 CT scan of the cervical spine, sagittal sections: ossifications of the yellow ligament, more pronounced in C3–C4.\n\nDiscussion\n\nOur two patients subsequently recovered rapidly from their pseudarthrosis and significantly improved their bone and muscle pain while on asfotase alfa administered at 1 mg/kg/day, but they paradoxically increased and modified the structure of preexisting vertebral and epidural ligamentous ossifications. For one of them this led to cervical spinal cord compression with quadriparesis, which quickly resolved after surgical decompression and temporary discontinuation of the treatment. The other had very painful cervical and lumbar spinal stiffness associated with pyramidal tract irritation, which improved after dose reduction of asfotase alfa to 1 mg/kg per week.\n\nThe bone mineralization disorders and extra‐ligamentous and cartilaginous calcium deposits that are responsible for the symptoms of hypophosphatasia are most likely related to the accumulation of PLP and PPi, which the missing ALP cannot degrade.( 3 , 4 , 19 ) The direct action of ALP seems less likely.( 9 ) The phenotypes are quite varied and are associated with genetic mutations that are also quite diverse.( 1 , 2 , 3 ) The pathophysiology of the muscle signs is poorly understood; however, the PLP could participate in their pathophysiology.( 7 )\n\nAntiresorptive agents, biphosphonates or denosumab, worsen bone lesions and are contraindicated( 20 ) in osteoporosis secondary to hypophosphatasia. Some patients could be successfully treated with teriparatide, though this may be ineffective in other cases, as it was for our two patients.( 21 )\n\nThe efficacy of asfotase alfa (1 mg/kg/day 6 times weekly or 2 mg/kg/day 3 times weekly) has been clearly demonstrated in infantile hypophosphatasia. Compared with the natural history of the disease, it improves life expectancy: 95% survival at 1 year versus 42% without treatment, 84% at 5 years versus 27% without treatment.( 11 , 12 ) Asfotase alfa improved growth, respiratory function, and muscular function. The same doses were provided in adults, and one study by Kishnani and colleagues.( 13 ) demonstrated more moderate efficacy in adults. Thirteen patients, with a mean age of 55 years, were treated for 5 years and compared with six patients who had been treated with placebo. There was no significant difference in the densitometry measurements or in the histomorphometry parameters in the different groups. The walking perimeter increased significantly but moderately, going from 350 to 450 m in the group treated with asfotase alfa. Muscle strength improved but pain did not. The decrease in the PPi level was not significant: +0.2 μm (−6.8 to +1.1) in the control group versus –2.2 μm (−4.4 to +0.3) in the treated group (p = 0.071), whereas that of the PLP was significant in patients treated with asfotase: +11 ng/mL (−374 to +346) versus −245 ng/mL (−1467 to −17.2) (p = 0.028). The ALP levels were very high: 6819 IU (3047–12,630 IU) in patients treated.\n\nThe side effects were mainly benign or moderate skin reactions (erythema, pruritis, skin discoloration, lipodystrophy at the injection sites). Two patients had ocular calcifications and one had nephrocalcinosis.\n\nBased on this study therefore, treatment with asfotase alfa was authorized in France in adult patients whose symptoms of hypophosphatasia had started in their childhood. The proposed doses were those used in this study. Our first patient, weighing 50 kg, was treated with 80 mg of asfotase alfa subcutaneously three times weekly. The second patient, 80 kg, was treated with 80 mg subcutaneously 6 out of 7 days. These patients had a rapid decrease in their bone pain, within 6 months, and there was consolidation of the pseudoarthroses, which concerned in one patient the right fibula, the right humerus, the ribs, the metatarsals, and for the other, both femurs and the left wrist. The neurological disorders started in the first patient after 2 years of treatment. Morphological exams showed a significant increase in epidural and vertebral ligamentous ossifications which caused spinal compression. The treatment was then discontinued for 6 weeks, the time of the surgery and the time for neurological recovery; it was then resumed at lower doses: 80 mg every 21 days for 6 months, and then 80 mg every week. During the treatment with 80 mg every 21 days, the bone pain recurred; it then disappeared and did not return at the dose of 80 mg/week after 1 year of follow‐up. In the second patient, very painful cervical and lumbar stiffness occurred gradually after a year and a half of treatment, which prevented the supine position. Cervical spine and lumbar spine mobility was nearly nonexistent. The treatment was decreased to 80 mg/week, with gradual improvement of the pain and mobility in 6 months. It is possible that the reduction in the dosage of afostase led to a change in the structure of the ligamentous ossifications, explaining the improvement in clinical signs without surgery. For this patient, however, the lack of prior CT scan or MRI did not allow this hypothesis to be formally confirmed.\n\nA panel of experts that met to define the monitoring of patients with treated hypophosphatasia pointed out the difficulty of current PPi determination and the interferences between recombinant ALP in the tube and the PLP that degrades it.( 22 ) There is therefore no recommended biological follow‐up, except for ALP determinations, only to verify compliance with treatment. Experts recommend clinical follow‐up based on the assessment of bone pain, muscle strength, functional parameters, and screening for ophthalmological and renal complications with repeated annual ultrasound examinations.( 23 )\n\nOur two case reports demonstrate potential toxicity of the treatment at the doses recommended in the study by Whyte and Kishnani, paradoxically resulting in hyperostosis with enthesopathy and more marked discal‐ligamentous ossification on the anterior and posterior longitudinal ligaments.( 13 ) The mechanism for this worsening of ectopic ossifications is unknown, which is also the case, in some treated patients, for ocular or renal ossifications.\n\nOur two case reports could lead to the suggestion to perform an MRI of the spine before starting treatment with aafostase, then every year if ligament ossifications are found on the first MRI.\n\nIn addition, after a follow‐up of 18 months for one and 9 months for the other, our two case reports show the clinical efficacy of much lower doses of asfotase: 1.5 mg/kg per week for the first; 1 mg/kg per week for the second. At these doses, the ALP level was 2000 and 2500 IU/L the day after the injection, and 1000 and 1200 IU/L until the day before the injection. The PLP varied from 79 ng/mL after the injection to 155 ng/mL before the injection for the first patient, and from 67 to 312 ng/mL for the second patient.\n\nIt seems conceivable to us to provide a 6‐month “attack” treatment at doses of 1 mg/kg/day, as recommended by Kishnani and Whyte, to heal the pseudarthrosis: radiological target very easy to define, followed by a maintenance treatment at much more moderate doses, of around 1 to 1.5 mg/kg per week, to be adjusted based on whether or not there are bone and/or muscular clinical signs, maintaining ALP levels between 1000 and 2500 IU/L.( 13 ) The immunogenicity of such a dose spacing strategy should be assessed.\n\nThis strategy would allow the cost of treatment, borne in France by the French health insurance fund, to be considerably reduced, which for our two patients was initially 1,000,000 euros per year for the first and 1,500,000 euros for the second.\n\nConsidering the rarity of this condition, observational multicenter studies should be conducted to confirm this proposal.\n\nIn addition, careful screening of the ALP levels in assessments of idiopathic osteoporosis has enabled in the past several years the diagnosis of subclinical forms of hypophosphatasia, genetically confirmed, in which osteoporosis, expressed through “classic” mainly vertebral fractures, is the only complication.( 2 ) In these benign forms, probably 10 to 20 times more common than the severe forms of pediatric onset, bisphosphonates and denosumab are theoretically contraindicated, and teriparatide or romososumab, although they are effective, can only be administered over a limited period (12 to 24 months). It seems inconceivable, due to the public health cost that this would entail, to consider treatments with asfotase alfa at doses of 1 mg/kg/day. Prospective, randomized, multicenter studies are essential in this indication for defining the minimum effective, and nontoxic dose of asfotase alfa.\n\nConclusion\n\nTreatment of the serious forms of hypophosphatasia in adults at the recommended doses of 1 mg/kg/day, based on the studies by Whyte, can lead to modifications in the volume and structure of spinal ossifications with spinal cord compression.( 13 ) Following consolidation of pseudarthroses, long‐term treatment with asfotase alfa may be considerably reduced: doses of 1 and 1.5 mg/kg per week were sufficient in our two patients for maintaining a satisfactory bone and muscle status.\n\nDisclosures\n\nThe authors declare that they have no conflict of interest about this work.\n\nAUTHOR CONTRIBUTIONS\n\nMichel Laroche: Conceptualization; writing‐original draft; writing‐review and editing. Guillaume Couture: Visualization. Marie Faruch: Supervision. Adeline Ruyssen‐Witrand: Supervision. Valérie Porquet‐Bordes: Supervision. Jean‐Pierre Salles: Supervision. Yannick Degboe: Conceptualization; supervision; validation.\n\nPEER REVIEW\n\nThe peer review history for this article is available at https://publons.com/publon/10.1002/jbm4.10449.\n==== Refs\nReferences\n\n1 Taillandier A , Domingues C , De Cazanove C , et al. Molecular diagnosis of hypophosphatasia and differential diagnosis by targeted next generation sequencing. Mol Genet Metab. 2015;116 (3 ):215–20.26432670\n2 Taillandier A , Domingues C , Dufour A , et al. Burden of disease in adults patients with hypophosphatasia: results from two patient‐report surveys. Metabolism. 2016;65 :1522–30.27621187\n3 Mornet E . Hypophosphatasia. Metabolism. 2018;82 :142–55.28939177\n4 der Burgt I , Muti C , Simon‐Bouy B , Mornet E . Genetic analysis of adults heterozygous for ALPL mutations. J Bone Miner Metab. 2018;36 (6 ):723–33.29236161\n5 Szabo TM , Szabo SM , Tomazos IC , et al. Frequency and age at occurrence of clinical manifestations of disease in patients with hypophosphatasia: a systematic literature review. Orphanet J Rare Dis. 2019;14 (1 ):85–95.31023354\n6 Whyte MP . Hypophosphatasia—aetiology, nosology, pathogenesis, diagnosis and treatment. Nat Rev Endocrinol. 2016;12 (4 ):233–46.26893260\n7 Salles JP . Clinical forms and animal models of hypophosphatasia. Subcell Biochem. 2015;76 :3–24.26219704\n8 Salles JP . Hypophosphatasia: biological and Clinical aspects, avenues for therapy. Clin Biochem Rev. 2020;41 (1 ):13–27.32158059\n9 Glowacki J . Mechanisms of biomineralization. In Coe FL , Favus MJ , eds. Disorders of bone and mineral metabolism. Philadelphia: Lippincot Williams and Wilkins; 2002 pp 227–34.\n10 Whyte MP , Greenberg CR , Salman NJ , et al. Enzyme replacement therapy in life‐threatening hypophosphatasia. N Engl J Med. 2012;366 :904–13.22397652\n11 Whyte MP , Rockman‐Greenberg C , Ozono K , et al. Asfotase alfa treatment improves survival for perinatal and infantile hypophosphatasia. J Clin Endocrinol Metab. 2016;101 :334–42.26529632\n12 Whyte MP , Simmons JH , Moseley S , et al. Asfotase alpha for infants and young children with hypophosphatasia: 7 years outcomes of a single arm, open‐label, phase 2 extension trial. Lancet Diabetes Endocrinol. 2019;2 :93–105.\n13 Kishnani PS , Rockmann‐Greeberg C , Rauch F , et al. Five‐years efficacy and safety of asfotase alpha therapy for adults and adolescents with hypophosphatasia. Bone. 2019;121 :149–62.30576866\n14 Klidaras P , Severt J , Aggers D , Payne J , Miller PD , Ing SW . Fracture healing in two adults patients with hypophosphatasia after asfotase alpha therapy. JBMR Plus. 2018;2 :304–7.30283912\n15 Freitas TQ , Franco AS , Pereira RMR . Improvement of bone microarchitecture parameters after 12 months of treatment with asfotase alfa in adult patient with hypophosphatasia: case report. Medicine (Baltimore). 2018;97 :48–50.\n16 Bowden SA , Bowden BH . Reappearance of hypomineralized bone after discontinuation of asfotase alfa treatment for severe childwood hypophosphatasia. Osteoporosis Int. 2018;29 :2155–6.\n17 Shapiro JR , Lewiecki EM . Hypophosphatasia in adults: clinical assessment and treatment consideration. J Bone Miner Res. 2017;10 :1977–80.\n18 Whyte MP , McAlister WH , Mumm S , Bierhals AJ . No vascular calcification on cardiac computed tomography spanning asfotase alfa treatment for an elderly woman with hypophosphatasia. Bone. 2019;122 :231–6.30825650\n19 Walden M , Tian L , Ross RL , et al. Metabolic control of BRISC‐SHMT2 assembly regulates immune signalling. Nature. 2019;570 (7760 ):194–9.31142841\n20 Rassie K , Dray M , Michigami T , Cundy T . Bisphosphonate use and fractures in adults with hypophosphatasia. JBMR Plus. 2019;3 (10 ):e10223.31687651\n21 Laroche M . Failure of teriparatide in a patient with adult hypophosphatasia. Calcif Tissue Int. 2012;90 :250.22218563\n22 Bianchi ML , Bishop NJ , Guañabens N , et al. Hypophosphatasia in adolescents and adults: overview of diagnosis and treatment. Osteoporosis Int. 2020;31 :1445–60. 10.1007/s00198-020-05345-9.\n23 Kishnani PS , Rush ET , Arundel P , et al. Monitoring guidance for patients with hypophosphatasia treated with asfotase alfa. Mol Genet Metab. 2017;122 :4–17.28888853\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2473-4039",
"issue": "5(4)",
"journal": "JBMR plus",
"keywords": "BONE DISEASES, OTHER; DISEASES AND DISORDERS OF/RELATED TO BONE; DISORDERS OF CALCIUM/PHOSPHATE METABOLISM; THERAPEUTICS, OTHER",
"medline_ta": "JBMR Plus",
"mesh_terms": null,
"nlm_unique_id": "101707013",
"other_id": null,
"pages": "e10449",
"pmc": null,
"pmid": "33869986",
"pubdate": "2021-04",
"publication_types": "D016428:Journal Article",
"references": "22397652;32162014;30508901;30825650;32158059;28888853;22218563;31687651;30283912;29236161;26219704;30576866;30558909;26893260;31023354;28731215;27621187;26529632;26432670;29967930;28939177;31142841",
"title": "Hypophosphatasia: A Case of Two Patients With Spinal Cord Compression From Increase in Ligamentous Ossifications During Treatment.",
"title_normalized": "hypophosphatasia a case of two patients with spinal cord compression from increase in ligamentous ossifications during treatment"
} | [
{
"companynumb": "FR-ALXN-A202018357",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "ASFOTASE ALFA"
},
"drugadditional": "1",
"... |
{
"abstract": "Tuberculosis (TB) is a common post-transplant infection with high prevalence in developing countries due to reactivation. Post-transplant TB involves the respiratory system in 50% of patients, followed by disseminated involvement in 30%. The risk of tuberculosis of renal allograft post-transplantation is determined by disease endemicity in the donor population and the immunosuppressant regimen. TB can cause allograft rejection and graft loss due to delayed diagnosis or reduced immunosuppressant drug efficacy. A 23-year-old lady was seen 40 days after cadaveric unrelated renal transplantation from China. She was on immunosuppression with tacrolimus, mycophenolate, and prednisolone. Examination showed low-grade fever and infected surgical site in the right iliac fossa draining pus. Imaging showed fluid pockets, parenchymal micro-abscesses, and perinephric collections in the right iliac fossa communicating with skin. A diagnosis of renal allograft TB without dissemination was made after TB polymerase chain reaction (PCR) from early morning urine was positive. She was started on anti-TB therapy. The sinus tract healed, and renal parameters improved after six months of therapy. Follow-up magnetic resonance imaging (MRI) showed resolution of the micro-abscesses as well as the surrounding fluid collection. Renal angiogram demonstrated well-perfused, normally functioning, non-obstructed renal transplant. Tuberculosis of renal allograft should be considered in a transplant recipient with pyrexia of unknown origin and persistent discharge from the surgical site, not responding to antimicrobials. Tuberculosis of transplant kidney can cause graft loss due to allograft rejection when there is a delayed diagnosis, or as anti-TB drugs reduce the efficacy of immunosuppressant medications. The index of suspicion should be high when donor status is unknown or if the donor is from an endemic tuberculosis area. Timely diagnosis and treatment helped to save the transplanted kidney of our patient without rejection.",
"affiliations": "Internal Medicine, Hamad Medical Corporation, Doha, QAT.;Infectious Diseases, Hamad Medical Corporation, Doha, QAT.;Infectious Diseases, Hamad Medical Corporation, Doha, QAT.;Infectious Diseases, Hamad Medical Corporation, Doha, QAT.;Infectious Diseases, Hamad Medical Corporation, Doha, QAT.",
"authors": "Sasi|Sreethish|S|;Varghese|Manoj K|MK|;Nair|Arun P|AP|;Hashim|Samar|S|;Al Maslamani|Muna|M|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.11661",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184 Cureus Palo Alto (CA) \n\n10.7759/cureus.11661\nInternal Medicine\nInfectious Disease\nNephrology\nTuberculosis in an Allogeneic Transplant Kidney: A Rare Case Report and Review of Literature\nMuacevic Alexander Adler John R Sasi Sreethish 1 Varghese Manoj K 2 Nair Arun P 2 Hashim Samar 2 Al Maslamani Muna 2 \n1 \nInternal Medicine, Hamad Medical Corporation, Doha, QAT \n\n2 \nInfectious Diseases, Hamad Medical Corporation, Doha, QAT \n\nSreethish Sasi ssasi7@hamad.qa\n23 11 2020 \n11 2020 \n12 11 e1166123 11 2020 Copyright © 2020, Sasi et al.2020Sasi et al.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.This article is available from https://www.cureus.com/articles/44327-tuberculosis-in-an-allogeneic-transplant-kidney-a-rare-case-report-and-review-of-literatureTuberculosis (TB) is a common post-transplant infection with high prevalence in developing countries due to reactivation. Post-transplant TB involves the respiratory system in 50% of patients, followed by disseminated involvement in 30%. The risk of tuberculosis of renal allograft post-transplantation is determined by disease endemicity in the donor population and the immunosuppressant regimen. TB can cause allograft rejection and graft loss due to delayed diagnosis or reduced immunosuppressant drug efficacy. A 23-year-old lady was seen 40 days after cadaveric unrelated renal transplantation from China. She was on immunosuppression with tacrolimus, mycophenolate, and prednisolone. Examination showed low-grade fever and infected surgical site in the right iliac fossa draining pus. Imaging showed fluid pockets, parenchymal micro-abscesses, and perinephric collections in the right iliac fossa communicating with skin. A diagnosis of renal allograft TB without dissemination was made after TB polymerase chain reaction (PCR) from early morning urine was positive. She was started on anti-TB therapy. The sinus tract healed, and renal parameters improved after six months of therapy. Follow-up magnetic resonance imaging (MRI) showed resolution of the micro-abscesses as well as the surrounding fluid collection. Renal angiogram demonstrated well-perfused, normally functioning, non-obstructed renal transplant. Tuberculosis of renal allograft should be considered in a transplant recipient with pyrexia of unknown origin and persistent discharge from the surgical site, not responding to antimicrobials. Tuberculosis of transplant kidney can cause graft loss due to allograft rejection when there is a delayed diagnosis, or as anti-TB drugs reduce the efficacy of immunosuppressant medications. The index of suspicion should be high when donor status is unknown or if the donor is from an endemic tuberculosis area. Timely diagnosis and treatment helped to save the transplanted kidney of our patient without rejection.\n\nrenal transplanttuberculosisimmunosuppressionThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\nTuberculosis (TB) is a common post-transplant infection with high prevalence in developing countries due to reactivation. The prevalence of post-transplant TB is 3.1% to 15% in Asia, 1.5% to 3.5% in the Middle East, 1.7% to 5% in Europe, and 1.5% in the United States [1]. TB in transplant recipients is either due to reactivation of latent infection in the recipient, unrecognized infection in the allograft, or acquisition of new infection post-transplantation [1]. Post-transplant tuberculosis involves the respiratory system in 50% of the cases followed by disseminated involvement in 30%, lymph nodes in 5%, skin and soft tissue in 4%, the genitourinary system in 4%, intestine in 3%, the central nervous system in 2%, and bones in 1%. In 16% of the cases, it presents as pyrexia of unknown origin (PUO) [2]. The prevalence of post-transplant renal TB is quite low, and only a few cases have been reported. In a study by Torre-Cisneros et al., the median onset of TB was 183 days after transplantation (range 28-499 days). Donor-derived TB occurs earlier than reactivation of latent TB in the recipient [3]. Symptoms of post-transplant TB depend on the type of solid organ transplanted. Fever, night sweats, and weight loss occur in the majority of the patients [1]. TB should be considered in all transplant recipients with unexplained fevers, night sweats, and weight loss. Diagnosis may require invasive procedures such as bronchoscopy or biopsy.\n\nRenal TB occurs by mycobacterial seeding of the urogenital tract via hematogenous spread. Renal parenchymal lesions, including interstitial nephritis and glomerulonephritis, rarely occur, resulting in granulomas that heal by fibrosis or rupture into the tubule years later excreted in the urinary tract resulting in the spread of infection [4]. Common symptoms are persistent pyuria, microscopic hematuria, low back pain, increased urinary frequency, and urgency. Systemic symptoms, such as fever and weight loss, occur less frequently [5]. The diagnosis is established by demonstrating tubercle bacilli in the urine by culture or urine polymerase chain reaction (PCR). Positive urine acid-fast stain is not diagnostic for TB since nontuberculous mycobacteria may be present [6]. Radiographic imaging, in the form of computed tomography (CT), high-resolution ultrasound, or magnetic resonance imaging (MRI), is indicated for patients with suspected renal TB [4]. Radiographic evidences strongly suggestive of TB are strictures in the collecting system, asymmetric caliectasis, calcification, and hydronephrosis [4].\n\nCase presentation\nA 23-year-old lady was seen in the infectious diseases’ clinic, 40 days after a renal transplant for routine evaluation. She had end-stage renal disease (ESRD) because of unknown cause and was on continuous ambulatory peritoneal dialysis (CAPD) for two years. The donor's kidney was from an unrelated cadaveric source in China, whose personal information and medical history were unknown. The patient was human leukocyte antigen (HLA)-antibody negative, and her immunological risk status was determined to be low/moderate risk. She was not given any initial induction therapy and was started on triple immunosuppressant maintenance therapy with tacrolimus, mycophenolate mofetil (MMF), and prednisolone. She was on antimicrobial prophylaxis with valganciclovir and trimethoprim-sulfamethoxazole. The immediate post-operative period was complicated with urinary tract and wound infections, treated with a short course of intravenous ampicillin-sulbactam, showing a good response. There were no sick contacts or household exposure to pets. The only recent travel was to China for transplantation. Physical examination showed that she was febrile, but other vital signs were stable. Local inspection of the surgical site showed an infected wound in the right iliac fossa draining pus. There was tenderness on palpation over the surgical site. Systemic examination was otherwise unremarkable. There was no organomegaly or free fluids in the abdomen. The hernial orifices were intact.\n\nHer initial laboratory evaluation results were unremarkable except for elevated urea, creatinine, and C-reactive protein (Table 1). Pus culture from surgical wound culture grew candida species, while urine showed Citrobacter braakii and extended-spectrum beta-lactamase (ESBL) resistant Escherichia coli. Serology for cytomegalovirus (CMV) showed a PCR titer of 194 IU/ml. Quantiferon test for tuberculosis was negative twice, before and after transplant. She was treated with a course of ertapenem 1 gram daily for seven days and anidulafungin 100 milligrams daily for two weeks. However, she continued to have a low-grade fever and persistent pus discharge from the wound, even though the repeated urine and wound cultures were negative.\n\nTable 1 Table showing results of relevant laboratory tests on initial presentation\nµL, microliters; gm/dL, grams/deciliter; µmol/L, micromoles per liter; U/L, International units per liter; mg/dl, milligrams per deciliter; mg/L, milligrams per liter; ng/ml, nanograms per milliliter.\n\nDetail\tResults\tNormal Range\t\nWhite Blood Cells (x103/µL)\t6.2\t4-10\t\nAbsolute Neutrophil Count (ANC)%\t86\t55-70\t\nLymphocytes%\t6.9\t20-40\t\nMonocytes%\t5.1\t2-8\t\nEosinophils%\t0.4\t1-4\t\nBasophils%\t0.6\t0.5-1\t\nPlatelets (x103/µL)\t220\t150-400\t\nHemoglobin (gm/dL)\t10\t12.0-15.0\t\nUrea (mmol/L)\t9.96\t2.5-6.7\t\nCreatinine (µmol/L)\t107\t50-98\t\nTotal Bilirubin (µmol/L)\t13.7\t3.4-20.5\t\nAlkaline Phosphatase (U/L)\t69.4\t40-150\t\nAlanine Aminotransferase (U/L)\t23\t0-55\t\nAspartate Aminotransferase (U/L)\t23\t5-34\t\nFK-506 Level (ng/mL)\t13.2\t7-21\t\nC-Reactive Protein, CRP (mg/L)\t80\t0-5\t\nProcalcitonin (ng/ml)\t0.14\t<0.5\t\nThe initial ultrasound of the transplanted kidney showed normal echogenicity and cortical thickness without any peri-graft collections. There was no evidence of any anastomotic stenosis, and all duplex parameters were normal. Mild hydroureteronephrosis of the transplanted kidney with suboptimal distention of urinary bladder was seen. No definite calculus was identified. The same imaging was repeated after two weeks as there was persistent pus discharge from the surgical site. It showed two echogenic foci of size 4 mm in the lower pole of the transplanted kidneys, representing parenchymal calcifications or stones. Multiple, small, poorly localized fluid pockets were noted in the right iliac fossa along the subcutaneous plane of the surgical site, largest measuring 1.5 cm x 0.7 cm. In conclusion, there were new-onset parenchymal calcifications associated with peri-graft collection communicating with the outside as sinus (Figure 1).\n\nFigure 1 Ultrasound of transplanted kidney\nTransplanted kidney is seen in the right iliac fossa measuring 9.4 cm x 5.9 cm x 5.4 cm with volume of 160 ml (white arrows). It shows normal echogenicity and cortical thickness with mild hydronephrosis and trace of perinephric fluid. No evidence of anastomotic stenosis. Duplex parameters are all within normal limits.\n\nCT of the abdomen and pelvis showed the transplanted kidney with multiple stones and surrounding perinephric fat stranding. MRI of the abdomen showed mild to moderate hydronephrosis of the transplanted kidney with parenchymal micro-abscesses. There was a poorly localized perinephric collection with pockets along the posterior aspect of the transplanted kidney extending into the subcutaneous fat with surrounding edema and a cutaneous opening (Figures 2, 3). \n\nFigure 2 Magnetic resonance imaging (MRI) of the abdomen and pelvis\nThe figure shows heterogeneous pockets of fluid collections along the posterior aspect of the transplanted kidney (red arrows), tracking along the lateral aspect into the right anterior pelvic wall (blue arrows), which contains another collection measuring approximately 4 cm x 1.5 cm (yellow arrow), with surrounding extensive inflammatory changes and possible external opening. The non-localized collection posterior to the transplanted kidney measures approximately 4.5 cm x 1.2 cm and demonstrates restricted diffusion suggesting abscess.\n\nFigure 3 Magnetic resonance imaging (MRI) of the abdomen and pelvis\nThe figure shows mild to moderate hydroureteronephrosis with the presence of calyceal clubbing and tiny cystic areas around the calyces, especially in the lower pole (yellow arrows). Multiple small parenchymal T2 bright cystic regions were also identified with few such areas demonstrating restricted diffusion, suggesting parenchymal micro-abscesses. Differential diagnosis of the possible etiology is graft site candidiasis, actinomycosis, mycobacterium tuberculosis, Citrobacter braakii, and cytomegalovirus (CMV).\n\nMicroscopy of the smear from the pus revealed a Ziehl-Neelsen stain-positive organism, with 2500 acid-fast bacilli (AFB) per 100 fields. TB PCR was also positive from the discharge, and the mycobacterium was rifampicin sensitive. Two sets of early morning urine samples were positive for TB PCR. Chest x-ray was normal, and TB workup from sputum was negative. A diagnosis of renal tuberculosis in allogeneic renal transplant kidney without dissemination was made. Anti-TB therapy was immediately started with rifampicin 150 mg, isoniazid 75 mg, pyrazinamide 400 mg, ethambutol 250 mg, and pyrazinamide 40 mg daily. The therapeutic levels of tacrolimus were regularly monitoring, targeting 3-7 ng/mL, and its dose was gradually increased from 6 to 10 mg (in two divided daily doses), considering interaction with rifampicin. There was a regular follow-up, and significant clinical improvement was seen after six months of therapy. The sinus tract healed, and renal parameters normalized. Repeated MRI abdomen revealed resolution of the micro-abscesses and surrounding fluid collection. A renal angiogram showed a well-perfused, normally functioning, non-obstructed transplant kidneys.\n\nDiscussion\nGenitourinary tuberculosis is the second most common form (20% to 40%) of extra pulmonary tuberculosis in developing countries and third most common in developed countries. The prevalence of TB of the transplanted kidney is quite low (<4%) [1]. Genitourinary TB in kidney transplant patients commonly occurs secondary to reactivation in the setting of immunosuppression. In such cases, kidneys get involved as part of disseminated TB. In rare cases where TB involves renal allograft alone without dissemination, it is donor-derived and related to the transplanted organ [7]. A systematic search of PubMed, Scopus, and Google Scholar for case reports of isolated tuberculosis of renal allografts without disseminated involvement published in the last 20 years revealed that renal allograft TB without disseminated involvement was reported in six cases, summarized in Table 2 [8-11]. Our case had the shortest time frame from transplant to the diagnosis of allograft TB. Two of the cases were diagnosed by urine TB PCR, whereas four others were diagnosed by biopsy of transplant kidney.\n\nTable 2 Summary of case reports of isolated tuberculosis of renal allografts without disseminated involvement published in the last 20 years compared to our case\nTx, transplantation; AFB, acid-fast bacilli; TB, tuberculosis; PCR, polymerase chain reaction; CsA, cyclosporin; AZA, azathioprine; MMF, mycopheolate mofetil; Tac, tacrolimus; US, ultrasound; CT, computed tomography; MRI, magnetic resonance imaging; PUO, pyrexia of unknown origin; M, male; F, female; CGN, chronic glomerulonephritis; DN, diabetic nephropathy; PKD, polycystic kidney disease; HRZE, isoniazid (H), rifampicin (R), pyrazinamide (Z), and ethambutol (E).\n\nS. No.\tAuthor\tYear\tSex/Age\tDonor Type\tCountry of Tx\tIndication for Tx\tImmunosuppressant Used\tTime From Tx to Diagnosis of Allograft TB\tClinical Presentation\tDiagnosis\tTreatment\tOutcome\t\nInduction\tMaintenance\tUrine\tImaging\tBiopsy\t\nAFB Smear\tTB PCR\tTB Culture\t\n1\tKhaira et al. [8]\t2004\tF/30\tLive unrelated (Husband)\tIndia\tUnknown\tNo\tCsA, AZA steroids\t40 months\tPUO\t-ve\t-ve\t-ve\tUS of transplant kidney showed necrotizing granulomas\tPositive AFB smear from granulomas\tHZE Ofloxacin\tCured\t\n2\tKhaira et al. [8]\t1997\tM/55\tLive unrelated (Wife)\tIndia\tUnknown\tNo\tCsA, AZA steroids\t120 months\tPUO\t+ve\t+ve\t+ve\tNone\tNone\tHZE Ofloxacin\tCured\t\n3\tKhaira et al. [8]\t1995\tM/36\tLive related (Father)\tIndia\tCGN\tNo\tCsA, AZA steroids\t84 months\tPUO\t-ve\t-ve\t-ve\tNone\tGranulomatous interstitial nephritis\tHRZE\tImproved\t\n4\tAl-Nesf et al. [9]\t2005\tF/53\tLive unrelated\tPhilippines\tDN\tNo\tCsA, MMF steroids\t2 months\tPUO\t-ve\t-ve\t-ve\tUS, CT, and MRI abdomen showing large lymphocele surrounding transplant kidney\tGraft biopsy showing caseating granuloma, with AFB seen on Z-N staining. lymphocele\tHRZE\tFailure with allograft nephrectomy\t\n5\tMalone et al. [10]\t2003\tM/53\tCadaveric unrelated\tIreland\tAdult PKD\tNo\tTac, MMF steroids\t29 months\tNausea, worsening of GFR\t+ve\t+ve\t+ve\tNone\tNone\tHRZE\tCured\t\n6\tSiu et al. [11]\t2000\tM/39\tCadaveric unrelated\tChina\tCGN\tNo\tCsA, MMF steroids\t3 months\tPUO\t-ve\t-ve\t-ve\tUS of graft kidney was grossly normal, and CT of the abdomen showed mild ascites only\tGranulomatous inflammation of the interstitium with epithelioid cells and lymphocytes. Ziehl–Nielsen stain was positive for AFB.\tHRZE\tFailure with allograft nephrectomy \t\n7\tOur Case\t2016\tF/23\tCadaveric unrelated\tChina\tUnknown\tNo\tTac, MMF steroids\t1.5 months\tPUO, Non-healing surgical wound\t+ve\t+ve\t+ve\tHydronephrosis and echogenic collections with cutaneous opening\tNot done\tHRZE\tCured\t\nImmunosuppression following solid organ transplants increases the chance of contracting TB. This complicates the post-transplant period as the antibiotics used to treat TB interact with immunosuppressants and cause toxicities. TB can cause transplant rejection and increase overall morbidity. The disease endemicity in the population and the type of immunosuppressant regimen determine tuberculosis incidence after renal transplantation [12]. Tuberculosis of transplant kidney can cause graft loss due to allograft rejection when there is a delayed diagnosis, or as anti-TB drugs reduce the efficacy of immunosuppressant medications. Agarwal et al. showed that the use of tacrolimus compared to cyclosporine significantly decreases post-transplant TB [13]. Apart from immunosuppressants, other risk factors include diabetes mellitus, chronic liver disease, use of corticosteroids more than 10 milligrams/day, or high-dose pulse therapy. The number of rejection episodes and the duration of hemodialysis are also associated with an increased incidence of tuberculosis [12]. Rifampicin increases the catabolism of glucocorticoids and tacrolimus as it is a potent CYP3A4 isoenzyme inducer, thus decreasing their serum levels. The dose requirement of tacrolimus may be increased up to 10 times when used with rifampicin [14]. It reduces mycophenolate mofetil action by induction of mycophenolic acid (MPA) glucuronidation and possibly rifampin-associated alterations in multidrug resistance-associated protein 2 (MRP2)-mediated transport of mycophenolic acid glucuronide (MPAG) and acyl-MPAG [11]. Quantiferon and other interferon gamma release assays (IGRAs) cannot be used to exclude latent tuberculosis infections (LTBI) in chronic immunosuppressive therapy [9]. A meta-analysis of 709 patients from four randomized controlled trials showed that isoniazid prophylaxis reduces the risk of TB in post-transplant patients, without an increase in hepatitis. However, there is a marked discrepancy among national renal transplant units within the United Kingdom (UK) in pharmacologic prophylaxis for TB and the selection of individuals for this treatment [15]. MRI is a sensitive modality for demonstrating features of renal TB, including tissue edema, asymmetric perinephric fat stranding, and thickening of Gerota's fascia, all of which may be clues to focal pyelonephritis of tuberculous origin [4]. In our case, the transmission of TB from the donor is suggested by the presence of micro-abscesses in the transplanted kidney, which ruptured involving the perinephric tissue, followed by communication with the exterior in the form of a sinus draining pus. At the same time, our patient did not have any recognized risk factors for TB, including previous exposure, malnutrition, or living in an endemic area. TB transmission from the donor should be suspected when there is no evidence of inactive tuberculosis in the pre-transplant workup, and risk factors for getting tuberculosis post-transplant are eliminated. Both of these risk factors were not present in our patient. The diagnosis of TB was made in the first 40 days post-transplantation suggests that it may be donor origin.\n\nConclusions\nMany cases of PUO post-renal transplant are due to TB of the engrafted kidney. However, such cases are underdiagnosed and seldom reported. TB of the renal allograft should be considered in any post-transplant patient with PUO and persistent discharge from the surgical site not responding to conventional antimicrobials. A high index of suspicion should be entertained if the donor TB status is unknown or if the donor is from an endemic area of tuberculosis. Microcalcifications in the MRI of the transplanted kidney indicate healed TB granulomas, which may be re-activated in the setting of immunosuppression. A timely intervention in the form of diagnosis and treatment can help prevent graft loss and further morbidity.\n\nThe authors have declared that no competing interests exist.\n\nHuman Ethics\nConsent was obtained by all participants in this study. Medical Research Centre issued approval Not Applicable. The publication of this case was approved by the Medical Research Center at Hamad Medical Corporation. Written informed consent was given by the patient to publish his case information, images, and details. The consent is available with the corresponding author and can be produced on request from the editors. The research was conducted ethically in accordance with the World Medical Association Declaration of Helsinki.\n\nThe authors would like to acknowledge the Department of Infectious Diseases and Internal Medicine Residency Program of Hamad Medical Corporation for scientific support.\n==== Refs\nReferences\n1 Mycobacterium tuberculosis infection in recipients of solid organ transplants Clin Infect Dis Muñoz P Rodríguez C Bouza E 581 587 40 2005 15712081 \n2 Black race, sex, and extrapulmonary tuberculosis risk: an observational study BMC Infect Dis Fiske CT Griffin MR Erin H Warkentin J Lisa K Arbogast PG Sterling TR 16 10 2010 20096113 \n3 Tuberculosis after solid-organ transplant: incidence, risk factors, and clinical characteristics in the RESITRA (Spanish Network of Infection in Transplantation) cohort Clin Infect Dis Torre-Cisneros J Doblas A Aguado JM 1657 1665 48 2009 19445585 \n4 Tuberculosis of the genitourinary system-urinary tract tuberculosis: renal tuberculosis-part I Indian J Radiol Imaging Merchant S Bharati A Merchant N 46 63 23 2013 23986618 \n5 Renal tuberculosis in the modern era Am J Trop Med Hyg Daher Ede F da Silva GB Jr Barros EJG 54 64 88 2013 23303798 \n6 Review of genitourinary tuberculosis with focus on end-stage renal disease Rev Inst Med Trop Sao Paulo Lima NA Vasconcelos CC Filgueira PHO 57 60 54 2012 22370756 \n7 Tuberculosis in kidney transplant recipients: a case series World J Transplant Anand M Nayyar E Concepcion B Salani M Schaefer H 213 221 7 2017 28698838 \n8 Renal allograft tuberculosis: report of three cases and review of literature Clin Exp Nephrol Khaira A Bagchi S Sharma A 392 396 13 https://doi.org/10.1007/s10157-009-0158-6 \n9 Renal allograft tuberculosis with infected lymphocele transmitted from the donor Saudi J Kidney Dis Transpl Al-Nesf MA Al-Ani OI Al-Ani AAR Rashed AH 370 375 25 2014 24626006 \n10 Mycobacterium tuberculosis in a renal transplant transmitted from the donor Ir J Med Sci Malone A McConkey S Dorman A Lavin P Gopthanian D Conlon P 233 235 176 2007 17624503 \n11 Successful kidney re-transplantation in a patient with previous allograft kidney tuberculosis Transpl Infect Dis Siu YP Tong MKH Leung KT Yung CY 132 135 6 2004 15569231 \n12 Risk factors for post-transplant tuberculosis Kidney Int John GT Shankar V Abraham AM Mukundan U Thomas PP Jacob CK 1148 1153 60 2001 11532111 \n13 Impact of type of calcineurin inhibitor on post-transplant tuberculosis: single-center study from India Transpl Infect Dis Agarwal SK Bhowmik D Mahajan S Bagchi S 19 2017 \n14 Renal allograft dysfunction associated with rifampin-tacrolimus interaction Ann Pharmacother Chenhsu RY Loong CC Chou MH Lin MF Yang WC 27 31 34 2000 10669182 \n15 Tuberculosis in renal transplant recipients: the evidence for prophylaxis Transplantation Currie AC Knight SR Morris PJ 695 704 90 2010 20647975\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "12(11)",
"journal": "Cureus",
"keywords": "immunosuppression; renal transplant; tuberculosis",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e11661",
"pmc": null,
"pmid": "33391900",
"pubdate": "2020-11-23",
"publication_types": "D002363:Case Reports",
"references": "23986618;10669182;20647975;11532111;15569231;17624503;19445585;20096113;27775825;15712081;19288286;24626006;28698838;22370756;23303798",
"title": "Tuberculosis in an Allogeneic Transplant Kidney: A Rare Case Report and Review of Literature.",
"title_normalized": "tuberculosis in an allogeneic transplant kidney a rare case report and review of literature"
} | [
{
"companynumb": "QA-ACCORD-215154",
"fulfillexpeditecriteria": "1",
"occurcountry": "QA",
"patient": {
"drug": [
{
"actiondrug": "3",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": null,
"drug... |
{
"abstract": "We report the case of a 57-year-old Caucasian woman with AIDS-related disseminated Kaposi sarcoma (KS) characterised by the combination of several unusual features. The chylous nature of the pleural effusions, the documented parietal pleural involvement at thoracoscopy and the marked clinical worsening through an immune reconstitution syndrome following antiretroviral therapy initiation represent several rare situations that occurred in the same female patient. In addition, the use of indwelling pleural catheters for dyspnoea palliation also represents a rare therapeutic intervention. This case is a reminder of the possibility of AIDS-related pleural KS, now uncommon in the era of antiretroviral therapy.",
"affiliations": "Medicine, Division of Pulmonary, Critical Care, and Allergy, Chiang Mai University, Chiang Mai, Thailand.;Department of Pathology, McGill University Health Centre, Montreal, Québec, Canada.;Research Institute, McGill University Health Centre, Montreal, Québec, Canada.;Division of Respirology, McGill University Health Centre, Montreal, Québec, Canada stephane.beaudoin@mcgill.ca.",
"authors": "Tajarernmuang|Pattraporn|P|;Fiset|Pierre-Olivier|PO|;Routy|Jean-Pierre|JP|;Beaudoin|Stéphane|S|",
"chemical_list": "D044966:Anti-Retroviral Agents",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2019-233335",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(2)",
"journal": "BMJ case reports",
"keywords": "HIV / AIDS; malignant disease and immunosuppression; palliative procedures",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D017088:AIDS-Related Opportunistic Infections; D044966:Anti-Retroviral Agents; D000971:Antineoplastic Combined Chemotherapy Protocols; D002408:Catheters, Indwelling; D005260:Female; D006801:Humans; D008875:Middle Aged; D010996:Pleural Effusion; D012514:Sarcoma, Kaposi",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32111711",
"pubdate": "2020-02-28",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Intractable pleural effusion in Kaposi sarcoma following antiretroviral therapy in a Caucasian female infected with HIV.",
"title_normalized": "intractable pleural effusion in kaposi sarcoma following antiretroviral therapy in a caucasian female infected with hiv"
} | [
{
"companynumb": "CA-GILEAD-2020-0456430",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "RALTEGRAVIR"
},
"drugadditional": null,
... |
{
"abstract": "Bile reflux into the gastric stump and then into the oesophagus is a common event after distal gastrectomy and Billroth II reconstruction. In addition to typical symptoms of nausea, epigastric pain and bile vomiting, acid reflux can also occur in patients with concomitant hiatus hernia and lower oesophageal sphincter incompetency. Diverting the bile away from the oesophagus by conversion into a Roux-en-Y anastomosis or by completion gastrectomy and Roux-en-Y esophagojejunostomy have so far represented the mainstay of treatment. We report the first case of magnetic sphincter augmentation to relieve refractory reflux symptoms after Billroth II gastrectomy. The procedure was performed through a laparoscopic approach and proved very effective at 1-year follow-up.",
"affiliations": "Department of Surgery, Universita degli Studi di Milano, Milano, Italy.;Department of Surgery, Universita degli Studi di Milano, Milano, Italy.;Department of Surgery, IRCCS Policlinico San Donato, San Donato Milanese, Lombardia, Italy.;Department of Surgery, Universita degli Studi di Milano, Milano, Italy.",
"authors": "Melloni|Matteo|M|;Lazzari|Veronica|V|;Asti|Emanuele|E|;Bonavina|Luigi|L|http://orcid.org/0000-0002-4880-1670",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2018-225364",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "gastro-oesophageal reflux; gastrointestinal surgery",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000713:Anastomosis, Roux-en-Y; D049630:Esophageal Sphincter, Lower; D005743:Gastrectomy; D005764:Gastroesophageal Reflux; D006801:Humans; D010535:Laparoscopy; D060328:Magnetic Phenomena; D008297:Male; D008875:Middle Aged; D010437:Peptic Ulcer; D016896:Treatment Outcome",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29884671",
"pubdate": "2018-06-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "25171881;23856355;29471155;28430558;29364013;18846406;6347313;28012332;26044316;19212169;28936790;27163959",
"title": "Magnetic sphincter augmentation is an effective option for refractory duodeno-gastro-oesophageal reflux following Billroth II gastrectomy.",
"title_normalized": "magnetic sphincter augmentation is an effective option for refractory duodeno gastro oesophageal reflux following billroth ii gastrectomy"
} | [
{
"companynumb": "IT-ALLERGAN-1833365US",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "SUCRALFATE"
},
"drugadditional": "3",
"... |
{
"abstract": "Part B of this phase 1b study (ClinicalTrials.gov number, NCT02283775) evaluated safety and efficacy of a fixed-volume infusion of isatuximab, an anti-CD38 monoclonal antibody, in combination with pomalidomide and dexamethasone (Pd) in relapsed/refractory multiple myeloma patients. Isatuximab (10 mg/kg weekly for 4 weeks, then every other week) was administered as a fixed-volume infusion of 250 mL (mL/h infusion rate) with standard doses of Pd on 28-day cycles. Patients (N = 47) had a median of three prior treatment lines (range, 1-8). Median duration of exposure was 36.9 weeks and median duration of first, second, and 3+ infusions were 3.7, 1.8, and 1.2 h, respectively. The most common non-hematologic treatment-emergent adverse events were fatigue (63.8%), infusion reactions (IRs), cough, and upper respiratory tract infection (40.4% each). IRs were all grade 2 and occurred only during the first infusion. The overall response rate was 53.2% in all patients (55.5% in response-evaluable population, 60.0% in daratumumab-naïve patients). Efficacy and safety findings were consistent with data from the isatuximab plus Pd infusion schedule in Part A of this study and also from the phase 3 ICARIA-MM study, and these new data confirm the safety, efficacy, and feasibility of fixed-volume infusion of isatuximab.",
"affiliations": "Levine Cancer Institute/Atrium Health, Charlotte, NC, USA. Saad.Usmani@atriumhealth.org.;City of Hope National Medical Center, Duarte, CA, USA.;Myeloma & Transplant Program, Swedish Cancer Institute, Seattle, WA, USA.;Medical College of Wisconsin, Milwaukee, WI, USA.;Massachusetts General Hospital, Boston, MA, USA.;Division of Hematology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA.;Division of Hematology & Hematologic Malignancies, University of Utah, Salt Lake City, UT, USA.;Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA.;Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA.;Sanofi R&D, Vitry-Alfortville, France.;Sanofi, Cambridge, MA, USA.;Sanofi R&D, Vitry-Alfortville, France.;Sanofi, Cambridge, MA, USA.;Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, USA.",
"authors": "Usmani|Saad Z|SZ|http://orcid.org/0000-0002-5484-8731;Karanes|Chatchada|C|;Bensinger|William I|WI|;D'Souza|Anita|A|http://orcid.org/0000-0002-1092-5643;Raje|Noopur|N|;Tuchman|Sascha A|SA|http://orcid.org/0000-0003-2109-1573;Sborov|Douglas|D|;Laubach|Jacob P|JP|http://orcid.org/0000-0001-7565-2052;Bianchi|Giada|G|http://orcid.org/0000-0003-3673-0104;Kanagavel|Dheepak|D|;Saleem|Rao|R|;Dubin|Franck|F|;Campana|Frank|F|;Richardson|Paul G|PG|http://orcid.org/0000-0002-7426-8865",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1038/s41375-021-01262-w",
"fulltext": "\n==== Front\nLeukemia\nLeukemia\nLeukemia\n0887-6924\n1476-5551\nNature Publishing Group UK London\n\n34050260\n1262\n10.1038/s41375-021-01262-w\nArticle\nFinal results of a phase 1b study of isatuximab short-duration fixed-volume infusion combination therapy for relapsed/refractory multiple myeloma\nhttp://orcid.org/0000-0002-5484-8731\nUsmani Saad Z. Saad.Usmani@atriumhealth.org\n\n1\nKaranes Chatchada 2\nBensinger William I. 3\nhttp://orcid.org/0000-0002-1092-5643\nD’Souza Anita 4\nRaje Noopur 5\nhttp://orcid.org/0000-0003-2109-1573\nTuchman Sascha A. 6\nSborov Douglas 7\nhttp://orcid.org/0000-0001-7565-2052\nLaubach Jacob P. 8\nhttp://orcid.org/0000-0003-3673-0104\nBianchi Giada 8\nKanagavel Dheepak 9\nSaleem Rao 10\nDubin Franck 9\nCampana Frank 1011\nhttp://orcid.org/0000-0002-7426-8865\nRichardson Paul G. 8\n1 grid.468189.a Levine Cancer Institute/Atrium Health, Charlotte, NC USA\n2 grid.410425.6 0000 0004 0421 8357 City of Hope National Medical Center, Duarte, CA USA\n3 grid.281044.b 0000 0004 0463 5388 Myeloma & Transplant Program, Swedish Cancer Institute, Seattle, WA USA\n4 grid.30760.32 0000 0001 2111 8460 Medical College of Wisconsin, Milwaukee, WI USA\n5 grid.32224.35 0000 0004 0386 9924 Massachusetts General Hospital, Boston, MA USA\n6 grid.10698.36 0000000122483208 Division of Hematology, University of North Carolina at Chapel Hill, Chapel Hill, NC USA\n7 grid.223827.e 0000 0001 2193 0096 Division of Hematology & Hematologic Malignancies, University of Utah, Salt Lake City, UT USA\n8 grid.38142.3c 000000041936754X Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA USA\n9 Sanofi R&D, Vitry-Alfortville, France\n10 grid.417555.7 0000 0000 8814 392X Sanofi, Cambridge, MA USA\n11 grid.419849.9 0000 0004 0447 7762 Present Address: Takeda Pharmaceuticals, Cambridge, MA USA\n28 5 2021\n28 5 2021\n2021\n35 12 35263533\n27 10 2020\n8 4 2021\n26 4 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.\nPart B of this phase 1b study (ClinicalTrials.gov number, NCT02283775) evaluated safety and efficacy of a fixed-volume infusion of isatuximab, an anti-CD38 monoclonal antibody, in combination with pomalidomide and dexamethasone (Pd) in relapsed/refractory multiple myeloma patients. Isatuximab (10 mg/kg weekly for 4 weeks, then every other week) was administered as a fixed-volume infusion of 250 mL (mL/h infusion rate) with standard doses of Pd on 28-day cycles. Patients (N = 47) had a median of three prior treatment lines (range, 1–8). Median duration of exposure was 36.9 weeks and median duration of first, second, and 3+ infusions were 3.7, 1.8, and 1.2 h, respectively. The most common non-hematologic treatment-emergent adverse events were fatigue (63.8%), infusion reactions (IRs), cough, and upper respiratory tract infection (40.4% each). IRs were all grade 2 and occurred only during the first infusion. The overall response rate was 53.2% in all patients (55.5% in response-evaluable population, 60.0% in daratumumab-naïve patients). Efficacy and safety findings were consistent with data from the isatuximab plus Pd infusion schedule in Part A of this study and also from the phase 3 ICARIA-MM study, and these new data confirm the safety, efficacy, and feasibility of fixed-volume infusion of isatuximab.\n\nSubject terms\n\nMyeloma\nDrug development\nissue-copyright-statement© The Author(s), under exclusive licence to Springer Nature Limited 2021\n==== Body\npmcIntroduction\n\nMultiple myeloma (MM) is a plasma cell disorder characterized by the excess production of a monoclonal immunoglobulin protein causing end-organ damage [1, 2]. The disease is considered incurable and the majority of patients will relapse during their lifetime, thus long-term disease control is the pragmatic goal for most MM patients [1, 3]. Proteasome inhibitors (PIs), immunomodulatory drugs (IMiDs), and autologous stem cell transplantation have extended overall survival [3–5], however, the majority of patients will develop disease that is refractory to these treatments and the prognosis of relapsed/refractory MM (RRMM) patients remains poor [6, 7].\n\nRecently, monoclonal antibodies have dramatically improved the MM treatment landscape [2]. CD38 is a surface antigen that is abundantly expressed on plasma cells, making it an attractive MM therapeutic target [8–10]. Isatuximab, a monoclonal, anti-CD38 antibody that targets a unique CD38 epitope, has antitumor activity through multiple mechanisms of action, including antibody-dependent cellular-mediated cytotoxicity, complement-dependent cytotoxicity, antibody-dependent cellular phagocytosis, and direct induction of apoptosis [9, 11, 12]. Furthermore, isatuximab inhibits CD38 ADP ribosyl-cyclase enzymatic activity, altering the immunotolerant bone marrow milieu [13]. Finally, isatuximab also induces indirect antitumor activity through the elimination of CD38+ immunosuppressive Treg cells [9] and an “in vivo vaccination” effect against CD38 as well as other MM-associated antigens [14].\n\nIsatuximab has shown promise in treatment of MM as monotherapy and in combination with other therapies [15–19]. To date, isatuximab (Sarclisa®) has been approved in the United States, Europe, Switzerland, Canada, Australia, Japan, and Russia for use in combination with pomalidomide and dexamethasone (Pd) to treat adults with RRMM who have received at least two prior therapies, including lenalidomide and a PI [20–23]. While the addition of pomalidomide to dexamethasone improves survival in patients with MM [24], long-term outcomes with this regimen remain poor for patients who are heavily pretreated or who have refractory disease [4]. Isatuximab enhances the anti-MM activity of standard therapies, including IMiDs like pomalidomide [25] and IMiDs plus anti-CD38 therapies have been shown to lengthen progression-free survival (PFS) [26, 27]. The pivotal phase 3 ICARIA-MM study (ClinicalTrials.gov number, NCT02990338) compared treatment of isatuximab plus Pd (Isa-Pd) with Pd alone [6, 28]. The addition of isatuximab to Pd resulted in a significant and clinically meaningful benefit in PFS in heavily treated patients with RRMM with a manageable safety profile.\n\nThe potential for infusion reactions (IRs) with isatuximab requires premedication and careful attention to infusion rates. This phase 1b, open-label, multicenter, non-comparative study (ClinicalTrials.gov number, NCT02283775) [29] evaluated Isa-Pd in patients with RRMM who had been treated with lenalidomide and a PI. Part A was a dose escalation to assess the safety and efficacy of Isa-Pd in 45 patients with a median of three prior lines of treatment including lenalidomide and a PI [29]. Patients received isatuximab at 5, 10, or 20 mg/kg in four weekly doses (cycle 1), and every other week after. Initial isatuximab infusion rate was 87.5 mg/h for 5 mg/kg cohort and 175 mg/h for the 10 and 20 mg/kg cohorts. Every 30 min, infusion rate increased by 50 mg/h (first infusion) or 100 mg/h (subsequent infusions) to a maximum of 400 mg/h, in the absence of IRs. In an expansion cohort, 22 patients were treated at the selected dose of 10 mg/kg. To allow for a reduction in the infusion time, the infusion rate (mg/hour) was increased following the first infusion. The median infusion time for the first infusion was 3.3 h and 2.9 h for subsequent infusions. Of the IRs reported (42% of patients), all were grade 1/2 in severity, except for one grade 3 IR. The majority of IRs occurred during the first infusion (42%), with 6.7% occurring with later infusions. The combination of isatuximab with Pd was well tolerated by heavily pretreated patients with RRMM. The overall response rate (ORR) was 64.5% for Isa-Pd and median PFS was 17.6 months (95% confidence interval [CI], 6.8–20.5).\n\nThe goal of Part B (reported here) is to evaluate the feasibility and safety of fixed-volume infusion of isatuximab 10 mg/kg plus Pd in patients with RRMM. We hypothesized that a one-step infusion process using a fixed-volume infusion (expressed in mL/h) could have a similarly favorable efficacy and safety profile as was demonstrated with the infusion volume based on patient weight used in Part A, while reducing the duration of infusions.\n\nMethods\n\nThis was a multicenter, open-label, non-comparative, phase 1b study comprised of two parts, of which Part A has been previously described [29]. Eligible patients were at least 18 years of age with RRMM and had received at least two prior lines of therapy including lenalidomide and a PI. Patients demonstrated disease progression during or after completion of their last therapy, had adequate bone marrow function and an Eastern Cooperative Oncology Group (ECOG) performance status (PS) score of ≤2. Prior exposure to pomalidomide and CD38 monoclonal antibody was permitted. Patients were to have measurable disease defined as at least one of the following: serum M protein ≥0.5 g/dL (≥5 g/L), urine M protein ≥200 mg/24 h, or serum free light chain (FLC) assay with involved FLC concentration of ≥10 mg/dL (≥100 mg/L) and an abnormal serum FLC ratio (<0.26 or >1.65).\n\nPatients in Part B were administered isatuximab (10 mg/kg) intravenously (IV) in a fixed-volume infusion of 250 mL, with infusion rate expressed in mL/h. Pd was given at standard doses (pomalidomide 4 mg on days 1–21 and dexamethasone 40 mg [20 mg if ≥75 years] on days 1, 8, 15, and 22 per 28-day cycle). For the first infusion of isatuximab, the initial infusion rate was 25 mL/h. In the absence of IRs after 1 h of infusion, the infusion rate was increased in 25-mL increments every 30 min, to a maximum of 150 mL/h. In the second infusion, the initial infusion rate was 50 mL/h regardless of whether grade ≤2 IRs had occurred during first infusion. In the absence of grade ≥2 IRs after 30 min of infusion, the rate was increased to 100 mL/h for 30 min, then to 200 mL/h for 30 min, and then to 300 mL/h until the total volume was infused. For the third and subsequent infusions, the initial fixed-volume infusion rate was 200 mL/h regardless of whether grade ≤2 IRs had occurred during previous infusions, until the total volume was infused, resulting in a target total infusion time of 75 min (Fig. 1).Fig. 1 Treatment schedule.\n\nd dexamethasone, IR infusion reaction, Isa isatuximab, IV intravenous, P pomalidomide, PO orally, QW weekly, Q2W every other week.\n\nIn cases of infusion interruption due to grade 2 IRs, isatuximab administration was resumed at one-half of the initial infusion rate after IR improved to grade ≤1. If symptoms did not recur after 30 min, the infusion rate was increased in 25 mL/h (for the first infusion) or 50 mL/h (for subsequent infusions) increments every 30 min, until the total volume was infused. In cases of grade ≥3 IRs, isatuximab administration was permanently discontinued, and appropriate supportive therapy was administered.\n\nAll patients received premedication with diphenhydramine 25–50 mg IV (or equivalent), 40 mg dexamethasone IV or orally (or equivalent; 20 mg if ≥75 years), ranitidine 50 mg IV (or equivalent), and acetaminophen 650–1000 mg orally, 15–30 min (but no longer than 60 min) prior to the start of the isatuximab infusion. Dexamethasone was used both as premedication and as part of study treatment. No prophylactic post infusion steroids or bronchodilators were required.\n\nThe primary objective was to evaluate the feasibility of isatuximab administered as a fixed-volume infusion in combination with Pd as assessed by the occurrence of grade ≥3 IRs. The primary endpoint was the incidence of grade ≥3 IRs during the first six isatuximab infusions in patients treated for ≥2 cycles. Secondary endpoints were infusion duration, safety profile, immunogenicity, and efficacy. Efficacy endpoints included ORR (complete response [CR] + very good partial response [VGPR] + partial response [PR]), clinical benefit rate ([CBR], CR + VGPR + PR + minimal response [MR]), best overall response, duration of response (DOR), time to first response, PFS, duration of follow-up, and overall survival (OS). Response evaluations were performed by investigators on a monthly basis using the updated International Myeloma Working Group response criteria [30]. Responses (≥PR) and progression were confirmed on two consecutive disease assessments.\n\nThe statistical evaluation for all analyses was descriptive and included patients who gave informed consent and received at least one dose (even incomplete) of study treatment. Interphase fluorescent in situ hybridization (FISH) assessment was performed using cytoplasmic immunoglobulin staining followed by FISH (cIg-FISH) from whole bone marrow white blood cells in one central lab. Local FISH results were used when the central lab results were unavailable or inconclusive. An IR adverse event was defined as a treatment-related adverse event occurring within 24 h of each isatuximab administration, however, there was no specific period of time of monitoring after infusions; patients were monitored during isatuximab administration and when clinically indicated. PFS (time from the date of first study treatment administration to the date of first documentation of confirmed progressive disease, symptomatic deterioration, or death), DOR, and OS (time from the date of first study treatment administration to the date of death) were analyzed by the Kaplan–Meier method.\n\nQualified researchers can request access to patient-level data and related study documents including the clinical study report, study protocol with any amendments, blank case report forms, statistical analysis plan, and dataset specifications. Patient-level data will be anonymized, and study documents will be redacted to protect the privacy of trial participants. Further details on Sanofi’s data-sharing criteria, eligible studies, and process for requesting access are at: https://www.clinicalstudydatarequest.com.\n\nResults\n\nPatients\n\nIn total, 47 patients were enrolled and treated between March 30, 2018 and December 27, 2018 and all 47 patients received Isa-Pd. The patient baseline characteristics are presented in Table 1. All patients had previously received lenalidomide and 48.9% had received prior pomalidomide treatment. All 23 patients who received prior pomalidomide were refractory to it. Prior daratumumab exposure was reported for 14.9% of patients; prior elotuzumab exposure was reported for 19.1% of patients. All patients with prior daratumumab exposure were refractory to daratumumab; none of the patients received daratumumab as last regimen, six out of seven also received prior pomalidomide. At the time of data cut-off (November 18, 2019), 22 patients (46.8%) remained on treatment and 25 patients (53.2%) had discontinued treatment. Of the 47 patients, 15 (31.9%) discontinued because of disease progression, five (10.6%) because of adverse events, and five (10.6%) because of other reasons. One patient (2.1%) prematurely discontinued pomalidomide treatment due to an adverse event, and no patient prematurely discontinued dexamethasone treatment.Table 1 Patient demographics and disease characteristics.\n\nCharacteristic\tAll patients (N = 47)\t\nMedian age, years (range)\t65 (45–85)\t\nMedian time since initial diagnosis, years (range)\t6.2 (1.1–22.7)\t\nGender, male, n (%)\t27 (57.4)\t\nRace, n (%)\t\n White\t42 (89.4)\t\n Black or African American\t3 (6.4)\t\n Asian\t1 (2.1)\t\n Other\t1 (2.1)\t\nISS stage at study entry, n (%)\t\n I\t23 (48.9)\t\n II\t12 (25.5)\t\n III\t7 (14.9)\t\n Unknown\t5 (10.6)\t\nECOG performance status, n (%)\t\n 0\t5 (31.9)\t\n 1\t30 (63.8)\t\n 2\t2 (4.3)\t\nRespiratory disorders at baseline, n (%)\t\n Asthma\t8 (17.0)\t\n Bronchial hyperreactivity\t1 (2.1)\t\n COPD\t2 (4.3)\t\nAt least 1 transplant, n (%)\t32 (68.1)\t\n Autologous stem cell transplant\t31 (66.0)\t\n Allogenic stem cell transplant\t2 (4.3)\t\nNumber of prior linesa, median (range)\t3 (1–8)\t\nPrior treatments\t\n Lenalidomide\t47 (100)\t\n Pomalidomide\t23 (48.9)\t\n Bortezomib\t46 (97.9)\t\n Carfilzomib\t11 (23.4)\t\n Daratumumab\t7 (14.9)\t\n Elotuzumab\t9 (19.1)\t\nRefractory status, n (%)\t\n Last regimen\t41 (87.2)\t\n Lenalidomide\t41 (87.2)\t\n Pomalidomide\t23 (48.9)\t\n Bortezomib\t26 (55.3)\t\n Carfilzomib\t7 (14.9)\t\n Daratumumab\t7 (14.9)\t\n Elotuzumab\t9 (19.1)\t\n Immunomodulatory drug, proteasome inhibitor, and daratumumab\t7 (14.9)\t\n Lenalidomide, pomalidomide, bortezomib, carfilzomib, and daratumumab\t2 (4.3)\t\nHigh-risk cytogeneticsb, n (%)\t10 (21.3)\t\nMedian number of cycles receivedc (range)\t9 (1–19)\t\nOverall median duration of exposure, weeks (range)\t36.9 (1–77)\t\nCOPD chronic obstructive pulmonary disease, ECOG Eastern Cooperative Oncology Group, ISS International Staging System\n\na1 patient (2.1%) received 1 prior line of treatment and 17 patients (36.2%) received 2 prior lines of treatment.\n\nbEither del(17p), or t(4;14), or t (14;16).\n\nc31 patients (66.0%) started at least 6 cycles and 18 patients (38.3%) started at least 12 cycles.\n\nThe median age was 65 years. All patients had an ECOG PS of 0 or 1, except two patients (4.3%) who had an ECOG PS of 2. The median number of prior treatment lines was three (range, 1–8) with one patient (2.1%) having received one prior line of treatment and 17 patients (36.2%) having received two prior lines of treatment. All patients had received an IMiD, a PI, and corticosteroid in prior lines of treatment. There were 10 patients (21.3%) with high-risk cytogenetic characteristics, including del(17p) in seven patients (14.9%), t(4;14) in three patients (6.4%), and t(14;16) in one patient (2.1%). Most patients (33 patients, 70.2%) had bone lesions at baseline, and 12 (25.5%) patients had soft-tissue plasmacytoma present at baseline. The median number of cycles of study treatment received was nine (range, 1–19), with 31 patients (66.0%) having started at least 6 cycles and 18 patients (38.3%) having started at least 12 cycles. The overall median duration of exposure was 36.9 weeks (range, 1–77).\n\nSafety\n\nThe primary endpoint was the incidence of grade ≥3 IRs during the first six isatuximab infusions in patients treated for ≥2 cycles. Overall, IRs of any grade were reported in 19 patients (40.4%), and in 20 episodes of 871 infusions (2.3%). There were no grade ≥3 IRs. IRs were all grade 2 in severity, occurred only during the first isatuximab infusion, and recovered on the day of onset. Of note, in Part A, 48.3% of patients who received isatuximab 10 mg/kg experienced an IR, including one (3.2%) with grade 3 IRs [29]. IRs were managed with dose interruption in 18 patients (38.3%), while the dose was not interrupted in one patient (2.1%). Additional medications were administered to 17/19 patients (89.5%) experiencing an IR, and consisted of one or more of the following: H1/H2 blockers, acetaminophen, montelukast, steroids, and bronchodilators. Of the seven patients with prior exposure to daratumumab, three experienced IRs. Across all treated patients, the median duration of the first infusion was 3.7 h (range, 1.0–6.1 [222 min; range, 60–366]), 1.85 h (range, 1.5–3.9 [111 min; range, 90–234]) for the second infusion, and 1.25 h (range, 0.8–3.4 [75 min; range, 48–204]) for 3+ infusions (Fig. 2). A post-hoc analysis comparing the duration of infusion for weight-based volume (Part A) to that of fixed-volume isatuximab infusion (Part B) demonstrated that the duration of infusion for fixed volume is significantly longer at first infusion, but significantly shorter from second infusion onwards (Table 2).Fig. 2 Fixed-volume infusion of isatuximab.\n\nDuration of isatuximab infusion, by infusion number for Part A (weight-based infusion volume; mg/h) and Part B (fixed-volume infusion; mL/h).\n\nTable 2 Duration of infusion in the all treated population: weight-based volume infusion (Part A) versus fixed-volume infusion (Part B).\n\nMedian duration of infusion, ha\tIsa-Pd (10 mg/kg)\t\nPart A [29] N = 31\tPart B N = 47\tTwo-sided p-valueb\t\n1st Infusion\t3.32\t3.70\t0.0007\t\n2nd Infusion\t2.88\t1.85\t<0.0001\t\n3rd Infusion\t2.89\t1.25\t<0.0001\t\n4th Infusion\t2.71\t1.25\t<0.0001\t\n5th Infusion\t2.67\t1.25\t<0.0001\t\n6th Infusion\t2.81\t1.25\t<0.0001\t\n≥2nd Infusion\t2.87\t1.25\t<0.0001\t\n≥3rd Infusion\t2.87\t1.25\t<0.0001\t\nd dexamethasone, h hours, Isa isatuximab, P pomalidomide\n\naDuration of infusion is defined from the start time of infusion to the end time of infusion including interruption time (if any).\n\nbA Mann–Whitney U test has been performed.\n\nAll patients had at least one treatment-emergent adverse event (TEAE; any grade) and 35 patients (74.5%) had grade ≥3 TEAEs, regardless of relationship to study treatment (Table 3). Five patients (10.6%) discontinued treatment because of TEAEs; one patient (2.1%) experienced TEAEs leading to premature discontinuation of pomalidomide. The most common non-hematologic TEAEs of any grade were fatigue (63.8%), IRs, cough, and upper respiratory tract infection (40.4% each). In addition, 70.2% of patients had grade 3 or 4 laboratory neutropenia (34.0% and 36.2%, respectively). Febrile neutropenia was reported in nine patients (19.1%), with 4.3% being grade ≥3. The most frequently reported grade ≥3 non-hematologic TEAE was pneumonia (five patients [10.6%]). Treatment-related TEAEs were experienced by 45 patients (95.7%), with 28 (59.6%) experiencing treatment-related TEAEs of grade ≥3. Serious TEAEs were observed in 27 patients (57.4%), which were treatment-related in 14 patients (29.8%). Six patients (12.8%) died within 30 days from their last study treatment administration, three because of adverse events not related to study treatment (acute myocardial infarction, sepsis, and rectal hemorrhage and sepsis), two because of disease progression, and one because of other reasons (sudden death, adjudicated as not related to study drug). Five patients (10.6%) discontinued study treatment due to TEAEs. In addition to the three patients with fatal events described above, there was one patient with serious grade 3 spinal cord compression, which was considered not related to study treatment. One patient selectively discontinued pomalidomide, while continuing treatment with isatuximab and dexamethasone, because of non-serious grade 1 events of tremor, gait disturbance, and flushing.Table 3 Most common TEAEs occurring in ≥20% of patients, all grades.\n\nTEAE\tIsa-Pd N = 47\t\nAll grades n (%)\tGrade ≥ 3 n (%)\t\nAny\t47 (100)\t35 (74.5)\t\nFatigue\t30 (63.8)\t2 (4.3)\t\nInfusion reactions\t19 (40.4)\t0\t\nCough\t19 (40.4)\t0\t\nUpper respiratory tract infection\t19 (40.4)\t3 (6.4)\t\nNeutropenia\t18 (38.3)\t18 (38.3)\t\nDiarrhea\t16 (34.0)\t2 (4.3)\t\nDyspnea\t16 (34.0)\t2 (4.3)\t\nNausea\t16 (34.0)\t0\t\nInsomnia\t15 (34.0)\t1 (2.1)\t\nBack pain\t14 (29.8)\t2 (4.3)\t\nConstipation\t14 (29.8)\t1 (2.1)\t\nArthralgia\t13 (27.7)\t3 (6.4)\t\nPeripheral sensory neuropathy\t10 (21.3)\t3 (6.4)\t\nPneumonia\t10 (21.3)\t5 (10.6)\t\nd dexamethasone, Isa isatuximab, P pomalidomide, TEAE treatment-emergent adverse event\n\nHematologic laboratory abnormalities of anemia and decreased lymphocyte and white blood cell counts (all grades) were reported in all 46 (100.0%) patients. Grade ≥3 hematologic laboratory abnormalities were common (Table 4). Grade 3 and grade 4 neutropenia was reported in 34.8% and 37.0% of patients, respectively. Grade 3 anemia was reported in 21.7% of the patients, and no patient reported grade 4 anemia.Table 4 Grade 3–4 hematologic laboratory abnormalities.\n\nHematologic laboratory abnormalitya, n (%)\tIsa-Pd\nN = 46b\t\nGrade 3\tGrade 4\t\nLymphocyte count decreased\t25 (54.3)\t5 (10.9)\t\nWhite blood cell decreased\t24 (52.2)\t7 (15.2)\t\nNeutrophil count decreased\t16 (34.8)\t17 (37.0)\t\nAnemia\t10 (21.7)\t0\t\nPlatelet count decreased\t9 (19.6)\t4 (8.7)\t\nd dexamethasone, Isa isatuximab, P pomalidomide\n\naHematological laboratory abnormalities were assessed during the study (Table 2) and were recorded as TEAEs only if they were serious or led to study treatment modification or discontinuation.\n\nbThe number of patients who had that parameter assessed post-baseline (not missing) during the TEAE period.\n\nEfficacy\n\nAt a median follow-up duration of 9.9 months (range, 0–17.3), the ORR was 53.2% (95% CI, 38.1–67.9), including 12 PRs, 11 VGPRs, and 2 CRs. The CBR was 72.3%. The ORR was 60.0% for patients without prior daratumumab exposure and 14.3% (one patient) in seven patients who had previous exposure to daratumumab. In six patients evaluable for response who had prior daratumumab exposure, one had PR, two had MR, and three had stable disease. The ORR in patients with prior pomalidomide treatment and those without prior pomalidomide or daratumumab was 52.2% (12 of 23 patients) and 56.5% (13 of 23 patients), respectively. Of the 13 patients who had received >3 prior lines of therapy, two had VGPR and four had PR. In the 10 patients with high-risk cytogenetics, the ORR was 40.0% (95% CI, 12.2–73.8), including one PR, two VGPRs, and one CR.\n\nThe median time to first response was 0.95 months (range, 0.9–3.4) and the median time to best response was 1.3 months (range, 1.0–8.3). In 25 patients, DOR was assessed and 21 responding patients who had an ongoing response were censored. Median DOR has not been reached. At the time of analysis, 20 patients (42.6%) were reported to have had a PFS event, and 27 patients (57.4%) were censored. The median PFS has not been reached; the 6-month probability of PFS was 65.0% (95% CI, 49.3–76.9) and the 12-month probability was 55.7% (95% CI, 40.1–68.8). Likewise, the median OS has not been reached; the 6-month probability of survival was 84.5% (95% CI, 70.1–92.3) and the 12-month probability of survival was 70.6% (95% CI, 53.7–82.3).\n\nDiscussion\n\nThis was a phase 1b study comprising two parts, of which the objective of Part B was to evaluate the feasibility, safety, and efficacy of isatuximab 10 mg/kg administered with a 250 mL fixed-volume infusion (rate in mL/h) in combination with Pd in RRMM, with the aim of reducing the infusion time starting with the second infusion. Overall, this combination was well tolerated, with no grade ≥3 IRs observed. All IRs were grade 2, occurred during the first infusion, and resolved on the same day. Because of the risk of IRs inherent with monoclonal antibody infusion, premedications were administered to minimize this risk, and the infusion rate was increased during the first infusions. No prophylactic post infusion steroids or bronchodilators were required. The median infusion time for isatuximab decreased from 3.7 h during the first infusion to 1.85 h during the second infusion, and to 1.25 h (75 min) for 3+ infusions. This is considerably shorter than the infusion time from Part A of this study when isatuximab was administered as mg/hour, with the first and subsequent infusions lasting 3.3 and 2.9 h, respectively [29]. The safety and efficacy data with fixed-volume infusion are consistent with those observed with the infusion schedule used in Part A of the study. Both reported 19 patients with IRs (Part B: 40.4% of patients; Part A: 42.2% of patients). The ORR in all subjects who received any study treatment on Part B was 53.2% and 62.2% in Part A, with similar VGPR and CR rates (23.4% and 4.3% in Part B versus 22.2% and 2.2% in Part A, respectively). Responses were durable, with the median DOR not reached in Part B compared with 18.7 months in Part A.\n\nThe safety profile of Pd in combination with isatuximab administered as fixed-volume infusion on this study appears to be consistent with the safety profile of the pivotal ICARIA-MM study (NCT02990338) [6]. The median number of cycles patients received in this trial was 9, compared with 10 cycles in the ICARIA-MM study. IRs were similar at 40.4%, compared with 38.2% in the ICARIA-MM study. Grade ≥3 TEAEs and serious AEs (74.5% and 57.4%, respectively) were slightly lower in this trial compared with the ICARIA-MM study (86.8% and 61.8%, respectively). Similarly, TEAEs leading to treatment discontinuation or death were consistent in this study (10.6% and 12.8%, respectively), compared with the ICARIA-MM study (7.2% and 7.9%, respectively). Median DOR, PFS, and OS data appear very promising, however, these data are still maturing, with a median duration of follow-up of 9.9 months and 46.8% of patients still on treatment. Nonetheless, these preliminary efficacy data so far resemble those observed in the ICARIA-MM study. The ORR in patients not exposed to daratumumab was 60.0% compared with 60.4% in ICARIA-MM. The 1-year probability of PFS and OS were 55.7% and 70.6%, respectively, compared with 47.6% and 72.0% in ICARIA-MM.\n\nPatients in the current study had been heavily pretreated, with a median of 3 prior lines of therapy, with some patients receiving up to 8 prior lines of therapy, and all patients were previously treated with a PI and an IMiD. In addition, most were refractory to the current standard of care therapies (lenalidomide: 87.2%; PIs: 74.5%; and both IMiDs and PIs: 74.5%). Likewise, 21.3% of the patient population had high-risk cytogenetic characteristics. The presence of high-risk cytogenetic abnormalities is associated with reduced survival of patients with CD38 antibody-refractory MM [31]. Although the patient numbers are small in this study, the robust response rate (40.0%) in this group is promising, and especially given the relapsed and refractory setting in which patients were multi-agent resistant [32]. In the ICARIA-MM trial, the observed PFS benefit in patients treated with Isa-Pd was maintained across patients with high-risk cytogenetics and was similar to patients with standard risk cytogenetics (hazard ratio [HR], 0.66 [95% CI, 0.33–1.28] and HR 0.62 [95% CI, 0.42–0.93], respectively) [6]. Also, of note, the ORR was 14.3% and CBR was 42.9% in the seven patients who had previous exposure to daratumumab, compared with 60.0% and 77.5% for patients without prior daratumumab. Despite the small sample, this suggests that the Isa-Pd combination is less active in patients with prior daratumumab exposure. Daratumumab treatment has been linked to a reduction in CD38 expression levels on MM cells within hours after treatment start [33], but further mechanistic investigations are required to dissect this highly clinically relevant issue.\n\nThe results from Part B of this two-part, phase 1b study confirm the safety, efficacy, and feasibility of isatuximab administered by a fixed-volume infusion method. Efficacy and safety were consistent with Part A of this study and the pivotal ICARIA-MM study. The fixed-volume infusion administration of isatuximab reduced time of infusion by >60 min for the second infusion and >90 min for subsequent infusions, compared with the weight-based infusion of isatuximab in Part A. The results of this study led to the approval of Isa-Pd accelerated infusion and serves as the basis for how standard of care isatuximab is dosed, as described in the United States Prescribing Information and the European Union Summary of Product Characteristics. These reduced infusion times for isatuximab are the shortest IV infusion times of any approved anti-CD38 monoclonal antibody [26, 27, 34, 35], thus improving patient convenience while maintaining safety and simplifying infusion schedules to reduce administration errors, thus facilitating real-world practice [36]. The combination of daratumumab IV with Pd has twice the infusion time compared with Isa-Pd and is currently approved in the United States but not Europe. A subcutaneous (SC) formulation of daratumumab (DARZALEX FASPRO™, daratumumab co-formulated with hyaluronidase-fihj) was recently approved in the United States and in Europe; however, not in combination with Pd. A SC formulation of isatuximab is being developed and tested in combination with Pd in a phase 1b study (ClinicalTrials.gov, NCT04045795). These data support the use of isatuximab 10 mg/kg administered with a 250 mL fixed-volume infusion, with a target total infusion time of 75 min in combination with Pd in heavily pretreated RRMM patients.\n\nAcknowledgements\n\nThis study was sponsored by Sanofi. The authors thank the participating patients and their families, and the study centers and investigators, for their contributions to the study. Medical writing support was provided by Kerry K. Brinkman, PhD and Camile Semighini Grubor, PhD of Elevate Medical Affairs, contracted by Sanofi Genzyme for publication support services.\n\nAuthor contributions\n\nAll authors revised the work for important intellectual content and assume responsibility for data integrity and the decision to submit this paper for publication; had full access to the study data; and edited, and reviewed paper drafts, and approved the final version for submission.\n\nCompliance with ethical standards\n\nConflict of interest\n\nSZU: Research funding from Amgen, Array, BioPharma, Bristol Myers Squibb, Celgene, GSK, Janssen, Merck, Pharmacyclics, Sanofi, Seattle Genetics, SkylineDX, and Takeda; Consulting fees from Amgen, Bristol Myers Squibb, Celgene, GSK, Janssen, Merck, Sanofi, SkylineDX, and Takeda; Speaking fees from Amgen, Celgene, Janssen, and Takeda. CK: Nothing to disclose. WIB: Grant funding from Amgen, Bristol Myers Squibb, Janssen, and Sanofi; Personal fees from Amgen, Bristol Myers Squibb, Janssen, and Takeda. ADS: Research funding from Merck, Mundipharma EDO, Prothena, Sanofi, Takeda, and TeneoBio; Consulting fees from Akcea, Imbrium, Janssen, and Pfizer. NR: Consulting fees from Bristol Myers Squibb and Celgene. SAT: Research funding from Celgene, Janssen, Karyopharm, and Sanofi; Consulting fees from Alnylam, Caelum, Celgene, Karyopharm, and Oncopeptides; Speaking fees from Celgene. DS: Consulting fees from Celgene and Janssen. JL: Nothing to disclose. GB: Consulting fees from Pfizer. DK, RS, FD, and FC: Employed by Sanofi. PGR: Grant funding from Bristol Myers Squibb, Celgene, Oncopeptides, and Takeda; Personal fees from Celgene, Janssen, Karyopharm, Oncopeptides, Sanofi, and Takeda.\n\nPublisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Kumar SK Rajkumar V Kyle RA van Duin M Sonneveld P Mateos MV Multiple myeloma Nat Rev Dis Primers 2017 3 Jul 17046 10.1038/nrdp.2017.46 28726797\n2. Varga C Laubach JP Anderson KC Richardson PG Investigational agents in immunotherapy: a new horizon for the treatment of multiple myeloma Br J Haematol 2018 181 May 433 46 10.1111/bjh.15116 29748955\n3. D’Agostino M, Bertamini L, Oliva S, Boccadoro M, Gay F. Pursuing a curative approach in multiple myeloma: a review of new therapeutic strategies. Cancers (Basel). 2019;11(Dec):2015.\n4. Usmani S Ahmadi T Ng Y Lam A Desai A Potluri R Analysis of real-world data on overall survival in multiple myeloma patients with ≥3 prior lines of therapy including a proteasome inhibitor (PI) and an immunomodulatory drug (IMiD), or double refractory to a PI and an IMiD Oncologist 2016 21 Nov 1355 61 10.1634/theoncologist.2016-0104 27486203\n5. Castaneda-Avila MA Ortiz-Ortiz KJ Torres-Cintron CR Birmann BM Epstein MM Trends in cause of death among patients with multiple myeloma in Puerto Rico and the United States SEER population, 1987-2013 Int J Cancer 2020 146 Jan 35 43 10.1002/ijc.32232 30802944\n6. Attal M Richardson PG Rajkumar SV San-Miguel J Beksac M Spicka I Isatuximab plus pomalidomide and low-dose dexamethasone versus pomalidomide and low-dose dexamethasone in patients with relapsed and refractory multiple myeloma (ICARIA-MM): a randomised, multicentre, open-label, phase 3 study Lancet 2019 394 Dec 2096 107 10.1016/S0140-6736(19)32556-5 31735560\n7. Morandi F Horenstein AL Costa F Giuliani N Pistoia V Malavasi F CD38: a target for immunotherapeutic approaches in multiple myeloma Front Immunol 2018 9 2722 10.3389/fimmu.2018.02722 30546360\n8. Deaglio S Mehta K Malavasi F Human CD38: a (r)evolutionary story of enzymes and receptors Leuk Res 2001 25 Jan 1 12 10.1016/S0145-2126(00)00093-X 11137554\n9. Feng X Zhang L Acharya C An G Wen K Qiu L Targeting CD38 suppresses induction and function of T regulatory cells to mitigate immunosuppression in multiple myeloma Clin Cancer Res 2017 23 Aug 4290 300 10.1158/1078-0432.CCR-16-3192 28249894\n10. Lin P Owens R Tricot G Wilson CS Flow cytometric immunophenotypic analysis of 306 cases of multiple myeloma Am J Clin Pathol 2004 121 Apr 482 8 10.1309/74R4TB90BUWH27JX 15080299\n11. Deckert J Wetzel MC Bartle LM Skaletskaya A Goldmacher VS Vallee F SAR650984, a novel humanized CD38-targeting antibody, demonstrates potent antitumor activity in models of multiple myeloma and other CD38+ hematologic malignancies Clin Cancer Res 2014 20 Sep 4574 83 10.1158/1078-0432.CCR-14-0695 24987056\n12. Moreno L Perez C Zabaleta A Manrique I Alignani D Ajona D The mechanism of action of the anti-CD38 monoclonal antibody isatuximab in multiple myeloma Clin Cancer Res 2019 25 May 3176 87 10.1158/1078-0432.CCR-18-1597 30692097\n13. Martin TG, Corzo K, Chiron M, Velde HV, Abbadessa G, Campana F, et al. Therapeutic opportunities with pharmacological inhibition of CD38 with isatuximab. Cells. 2019;8(Nov):1522.\n14. Atanackovic D Yousef S Shorter C Tantravahi SK Steinbach M Iglesias F In vivo vaccination effect in multiple myeloma patients treated with the monoclonal antibody isatuximab Leukemia 2020 34 Jan 317 21 10.1038/s41375-019-0536-3 31409922\n15. Martin T Baz R Benson DM Lendvai N Wolf J Munster P A phase 1b study of isatuximab plus lenalidomide and dexamethasone for relapsed/refractory multiple myeloma Blood 2017 129 Jun 3294 303 10.1182/blood-2016-09-740787 28483761\n16. Martin T Strickland S Glenn M Charpentier E Guillemin H Hsu K Phase I trial of isatuximab monotherapy in the treatment of refractory multiple myeloma Blood Cancer J 2019 9 Mar 41 10.1038/s41408-019-0198-4 30926770\n17. Chari A Richter JR Shah N Wong SWK Jagganath S Cho HJ Phase Ib study of isatuximab + carfilzomib in relapsed and refractory multiple myeloma (RRMM) [abstract] J Clin Oncol 2018 36 8014 10.1200/JCO.2018.36.15_suppl.8014\n18. Dimopoulos MA Bringhen S Anttila P Capra M Cavo M Cole CE Results from a phase II study of isatuximab as a single agent and in combination with dexamethasone in patients with relapsed/refractory multiple myeloma [abstract] Blood 2018 132 155 10.1182/blood-2018-155\n19. Richter JR Martin T Vij R Cole CE Atanackovic D Zonder J Updated data from a dose finding phase II trial of single agent isatuximab (anti-CD38 mAb) in relapsed/refractory multiple myeloma [abstract] J Clin Oncol 2016 34 8005 10.1200/JCO.2016.34.15_suppl.8005\n20. Sarclisa® (isatuximab-irfc) [package insert]. Bridgewater, NJ: sanofi-aventis U.S. LLC; 2020.\n21. Sanofi. European Commission approves Sarclisa® (isatuximab) for adults with relapsed and refractory multiple myeloma [press release]. June 2, 2020 [cited June 10, 2020]; Available from: https://www.sanofi.com/en/media-room/press-releases/2020/2020-06-02-12-47-38.\n22. Sanofi Japan. Sarclisa® 100 mg/500 mg IV infusion approved for relapsed or refractory myeloma [press release]. June 29, 2020 [cited July 23, 2020]; Available from: https://www.sanofi.co.jp/-/media/Project/One-Sanofi-Web/Websites/Asia-Pacific/Sanofi-JP/Home/press-releases/PDF/2020/200629-02.pdf?la=ja.\n23. Sarclisa® (isatuximab) registration certificate in the Russian Federation. August 27, 2020 [cited September 10, 2020]; Available from: http://grls.rosminzdrav.ru/Grls_View_v2.aspx?routingGuid=c754e935-ad28-4c1d-a643-0564811a2a00&t.\n24. Dimopoulos MA Weisel KC Song KW Delforge M Karlin L Goldschmidt H Cytogenetics and long-term survival of patients with refractory or relapsed and refractory multiple myeloma treated with pomalidomide and low-dose dexamethasone Haematologica 2015 100 Oct 1327 33 10.3324/haematol.2014.117077 26250580\n25. Jiang H Acharya C An G Zhong M Feng X Wang L SAR650984 directly induces multiple myeloma cell death via lysosomal-associated and apoptotic pathways, which is further enhanced by pomalidomide Leukemia 2016 30 Feb 399 408 10.1038/leu.2015.240 26338273\n26. Chari A Suvannasankha A Fay JW Arnulf B Kaufman JL Ifthikharuddin JJ Daratumumab plus pomalidomide and dexamethasone in relapsed and/or refractory multiple myeloma Blood 2017 130 Aug 974 81 10.1182/blood-2017-05-785246 28637662\n27. Dimopoulos MA Oriol A Nahi H San-Miguel J Bahlis NJ Usmani SZ Daratumumab, lenalidomide, and dexamethasone for multiple myeloma N Engl J Med. 2016 375 Oct 1319 31 10.1056/NEJMoa1607751 27705267\n28. Richardson PG Attal M Campana F Le-Guennec S Hui AM Risse ML Isatuximab plus pomalidomide/dexamethasone versus pomalidomide/dexamethasone in relapsed/refractory multiple myeloma: ICARIA phase III study design Future Oncol. 2018 14 May 1035 47 10.2217/fon-2017-0616 29268619\n29. Mikhael J Richardson P Usmani SZ Raje N Bensinger W Karanes C A phase 1b study of isatuximab plus pomalidomide/dexamethasone in relapsed/refractory multiple myeloma Blood 2019 134 Jul 123 33 10.1182/blood-2019-02-895193 30862646\n30. Rajkumar SV Dimopoulos MA Palumbo A Blade J Merlini G Mateos MV International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma Lancet Oncol 2014 15 Nov e538 48 10.1016/S1470-2045(14)70442-5 25439696\n31. van de Donk NWCJ Usmani SZ CD38 antibodies in multiple myeloma: mechanisms of action and modes of resistance Front Immunol 2018 9 2134 10.3389/fimmu.2018.02134 30294326\n32. Laubach J Garderet L Mahindra A Gahrton G Caers J Sezer O Management of relapsed multiple myeloma: recommendations of the International Myeloma Working Group Leukemia 2016 30 May 1005 17 10.1038/leu.2015.356 26710887\n33. Krejcik J Frerichs KA Nijhof IS van Kessel B van Velzen JF Bloem AC Monocytes and granulocytes reduce CD38 expression levels on myeloma cells in patients treated with daratumumab Clin Cancer Res. 2017 23 Dec 7498 511 10.1158/1078-0432.CCR-17-2027 29025767\n34. Lonial S Weiss BM Usmani SZ Singhal S Chari A Bahlis NJ Daratumumab monotherapy in patients with treatment-refractory multiple myeloma (SIRIUS): an open-label, randomised, phase 2 trial Lancet. 2016 387 Apr 1551 60 10.1016/S0140-6736(15)01120-4 26778538\n35. Palumbo A Chanan-Khan A Weisel K Nooka AK Masszi T Beksac M Daratumumab, bortezomib, and dexamethasone for multiple myeloma N Engl J Med. 2016 375 Aug 754 66 10.1056/NEJMoa1606038 27557302\n36. Richardson PG San Miguel JF Moreau P Hajek R Dimopoulos MA Laubach JP Interpreting clinical trial data in multiple myeloma: translating findings to the real-world setting Blood Cancer J 2018 8 Nov 109 10.1038/s41408-018-0141-0 30413684\n\n",
"fulltext_license": "CC BY",
"issn_linking": "0887-6924",
"issue": "35(12)",
"journal": "Leukemia",
"keywords": null,
"medline_ta": "Leukemia",
"mesh_terms": null,
"nlm_unique_id": "8704895",
"other_id": null,
"pages": "3526-3533",
"pmc": null,
"pmid": "34050260",
"pubdate": "2021-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Final results of a phase 1b study of isatuximab short-duration fixed-volume infusion combination therapy for relapsed/refractory multiple myeloma.",
"title_normalized": "final results of a phase 1b study of isatuximab short duration fixed volume infusion combination therapy for relapsed refractory multiple myeloma"
} | [
{
"companynumb": "US-CELGENEUS-USA-20210601016",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "POMALIDOMIDE"
},
"drugadditional": null,
... |
{
"abstract": "A 60-year-old woman was referred to the otolaryngologist for 18 months of left-sided tongue pain and taste changes. Surgeon-performed ultrasound of the submandibular region revealed a hyperechoic mass. Wharton's duct was dilated proximally and the submandibular gland demonstrated normal vascularity. While these findings were highly suspicious for submandibular gland sialolith, an in-office attempt at sialolithotomy suggested an alternate process or mass. After imaging failed to further elucidate an aetiology, surgical exploration revealed a well-circumscribed submandibular mass associated with the lingual nerve. The mass was removed en-bloc and pathology revealed a schwannoma of the lingual nerve.",
"affiliations": "Division of Otolaryngology - Head and Neck Surgery, Department of Surgery, George Washington University School of Medicine and Health Sciences, Washington, DC, USA AStraughan@gwmail.gwu.edu.;Division of Otolaryngology - Head and Neck Surgery, Department of Surgery, George Washington University School of Medicine and Health Sciences, Washington, DC, USA.;Division of Neuroradiology, Department of Radiology, George Washington University School of Medicine and Health Sciences, Washington, DC, USA.;Department of Otolaryngology, University of Alabama School of Medicine, Birmingham, Alabama, USA.;Division of Otolaryngology - Head and Neck Surgery, Department of Surgery, George Washington University School of Medicine and Health Sciences, Washington, DC, USA.",
"authors": "Straughan|Alexander J|AJ|http://orcid.org/0000-0001-9967-546X;Badger|Christopher|C|http://orcid.org/0000-0002-3714-0272;Javan|Ramin|R|;Fuson|Andrew|A|;Joshi|Arjun S|AS|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2019-233759",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "13(6)",
"journal": "BMJ case reports",
"keywords": "ear, nose and throat/otolaryngology; head and neck cancer",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D005260:Female; D006801:Humans; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D018317:Nerve Sheath Neoplasms; D013363:Submandibular Gland; D013365:Submandibular Gland Neoplasms",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "32595129",
"pubdate": "2020-06-28",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Unusual presentation of submandibular lingual nerve sheath tumour as sublingual stone.",
"title_normalized": "unusual presentation of submandibular lingual nerve sheath tumour as sublingual stone"
} | [
{
"companynumb": "US-APOTEX-2020AP014909",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "GABAPENTIN"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nResults from clinical trials and observational studies suggest that lamivudine plus dolutegravir (3TC+DTG) could be an effective and tolerated option for simplification in human immunodeficiency virus (HIV)-1-positive patients.\n\n\nMETHODS\nThis observational study enrolled HIV-1-infected, virologically suppressed patients switching to 3TC+DTG. Kaplan-Meyer survival analysis was performed to evaluate time to virological failure (VF; defined by a single HIV-RNA determination ≥1000 copies/mL or by two consecutive HIV-RNA determinations ≥50 copies/mL) and time to treatment discontinuation (TD; defined as interruption of either 3TC or DTG), Cox regression was performed to assess predictors, and linear mixed model was performed for repeated measures to measure changes in immunological and metabolic parameters.\n\n\nRESULTS\nFive hundred and fifty-six patients were eligible for analysis. Their median CD4+ count at baseline was 668 cells/mm3 and median time of virological suppression was 88 months. Estimated probabilities of maintaining virological suppression at 96 and 144 weeks of follow-up were 97.5% [standard deviation (SD) 0.8] and 96.5% (SD 1.0), respectively. Years since HIV diagnosis was the only predictor of VF. In patients with time of virological suppression <88 months, the rate of VF was higher in the presence of the M184V mutation. Estimated probabilities of remaining on 3TC+DTG at 96 and 144 weeks of follow-up were 79.2% (SD 1.9) and 75.2% (SD 2.2), respectively. A significant increase in CD4 cell count (+44 cells/mm3, P=0.015), CD4/CD8 ratio (+0.10, P=0.002) and high-density lipoprotein cholesterol (+5.4 mg/dL, P=0.036) was found at 144 weeks of follow-up; meanwhile, total cholesterol (-9.1 mg/dL, P=0.007) and triglycerides (-2.7, P=0.009) decreased significantly.\n\n\nCONCLUSIONS\nThese findings confirm the efficacy and tolerability of 3TC+DTG in virologically suppressed patients.",
"affiliations": "Institute of Infectious Diseases, Catholic University of the Sacred Heart, Rome, Italy; Mater Olbia Hospital, Olbia, Italy.;Institute of Infectious Diseases, Catholic University of the Sacred Heart, Rome, Italy. Electronic address: arturo.ciccullo@gmail.com.;Infectious Diseases Unit, DIBIC Luigi Sacco, University of Milan, Milan, Italy.;Division of Infectious Diseases, Department of Infectious Diseases, Luigi Sacco University Hospital, Milan, Italy.;Infectious Diseases Unit, Department of Clinical and Experimental Medicine, University of Florence, Florence, Italy.;Infectious Dermatology and Allergology Unit, IFO S. Gallicano Institute (IRCCS), Rome, Italy.;Department of Public Health and Infectious Diseases, Azienda Policlinico Umberto I, Rome, Italy.;Clinic of Infectious Diseases, Department of Biomedical Sciences and Public Health, Polytechnic University of Marche, Ancona, Italy.;Division of Infectious Diseases, Department of Infectious Diseases, Luigi Sacco University Hospital, Milan, Italy.;Fondazione Policlinico Universitario Agostino Gemelli IRCCS, UOC Malattie Infettive, Rome, Italy.;Azienda Ospedaliero Universitaria di Modena Laboratorio di Microbiologia e Virologia, Modena, Italy.;Azienda Ospedaliero Universitaria di Modena, Clinica Malattie Infettive e Tropicali, Modena, Italy.;Azienda Ospedaliero Universitaria di Modena, Clinica Malattie Infettive e Tropicali, Modena, Italy.;Institute of Infectious Diseases, Catholic University of the Sacred Heart, Rome, Italy; Fondazione Policlinico Universitario Agostino Gemelli IRCCS, UOC Malattie Infettive, Rome, Italy.",
"authors": "Baldin|Gianmaria|G|;Ciccullo|Arturo|A|;Rusconi|Stefano|S|;Capetti|Amedeo|A|;Sterrantino|Gaetana|G|;Colafigli|Manuela|M|;d'Ettorre|Gabriella|G|;Giacometti|Andrea|A|;Cossu|Maria Vittoria|MV|;Borghetti|Alberto|A|;Gennari|William|W|;Mussini|Cristina|C|;Borghi|Vanni|V|;Di Giambenedetto|Simona|S|",
"chemical_list": "D019380:Anti-HIV Agents; D006575:Heterocyclic Compounds, 3-Ring; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; D019259:Lamivudine; C562325:dolutegravir",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.ijantimicag.2019.09.002",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0924-8579",
"issue": "54(6)",
"journal": "International journal of antimicrobial agents",
"keywords": "ART; Dolutegravir; HIV; Lamivudine; Simplification; Two-drug regimen",
"medline_ta": "Int J Antimicrob Agents",
"mesh_terms": "D000328:Adult; D019380:Anti-HIV Agents; D015331:Cohort Studies; D005260:Female; D015658:HIV Infections; D015497:HIV-1; D006575:Heterocyclic Compounds, 3-Ring; D006801:Humans; D019259:Lamivudine; D008297:Male; D008875:Middle Aged; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; D012189:Retrospective Studies",
"nlm_unique_id": "9111860",
"other_id": null,
"pages": "728-734",
"pmc": null,
"pmid": "31521809",
"pubdate": "2019-12",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "Long-term data on the efficacy and tolerability of lamivudine plus dolutegravir as a switch strategy in a multi-centre cohort of HIV-1-infected, virologically suppressed patients.",
"title_normalized": "long term data on the efficacy and tolerability of lamivudine plus dolutegravir as a switch strategy in a multi centre cohort of hiv 1 infected virologically suppressed patients"
} | [
{
"companynumb": "IT-MYLANLABS-2020M1017817",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "TENOFOVIR DISOPROXIL"
},
"drugadditional": nu... |
{
"abstract": "Tumor lysis syndrome is a constellation of metabolic disturbances commonly seen during therapy of bulky, rapidly proliferative tumors. Multiple myeloma is a low proliferation tumor with rare incidence of tumor lysis syndrome in the pre-Bortezomib era. Post Bortezomib use, a rise in the incidence of tumor lysis has been noted. We present seven cases of tumor lysis syndrome with three patients in spontaneous tumor lysis and four developing the same after chemotherapy. In the previous studies, elevated LDH and deletion of chromosome 13 has been associated with risk of TLS. In our study, we noted several abnormal karyotpes including del 9p13, del 17 and monosomy 13 were more frequently found but larger studies are needed to explore the causative nature of these associations. Prognosis in these patients is relatively poor reflecting the higher tumor burden. However, further studies are needed to learn about other poor prognostic markers.",
"affiliations": "Department of Internal Medicine, St Vincent Hospital, 123 Summer street, Worcester, MA 01608 USA.;Department of Hematology-Oncology, John H Stroger Jr Hospital of Cook County, Chicago, IL 60612 USA.;Department of Hematology-Oncology, John H Stroger Jr Hospital of Cook County, Chicago, IL 60612 USA.;Department of Internal Medicine, John H Stroger Jr Hospital of Cook County, Chicago, IL 60612 USA.",
"authors": "Singh|Abhijai|A|0000-0003-0273-8650;Gupta|Shweta|S|;Yim|Barbara|B|;Thekkekara|Romy|R|",
"chemical_list": null,
"country": "India",
"delete": false,
"doi": "10.1007/s12288-016-0731-6",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0971-4502",
"issue": "33(1)",
"journal": "Indian journal of hematology & blood transfusion : an official journal of Indian Society of Hematology and Blood Transfusion",
"keywords": "Bortezomib; Multiple myeloma; Tumor lysis",
"medline_ta": "Indian J Hematol Blood Transfus",
"mesh_terms": null,
"nlm_unique_id": "9425818",
"other_id": null,
"pages": "41-44",
"pmc": null,
"pmid": "28194054",
"pubdate": "2017-03",
"publication_types": "D016428:Journal Article",
"references": "17229340;12393500;22490464;18360602;19052991;18166779;16424647;10554803;25689664;24799821;23589740;16986718;15449188",
"title": "Tumor Lysis Syndrome in Multiple Myeloma: An Increasingly Recognized Risk-A Report of Seven Cases.",
"title_normalized": "tumor lysis syndrome in multiple myeloma an increasingly recognized risk a report of seven cases"
} | [
{
"companynumb": "US-TAKEDA-2016MPI009194",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "3",
... |
{
"abstract": "Pharmacological stimulant therapies are routinely administered to promote recovery in patients with subacute and chronic disorders of consciousness (DoC). However, utilization rates and adverse drug event (ADE) rates of stimulant therapies in patients with acute DoC are unknown. We aimed to determine the frequency of stimulant use and associated ADEs in intensive care unit (ICU) patients with acute DoC caused by traumatic brain injury (TBI).\nWe retrospectively identified patients with TBI admitted to the ICU at 2 level 1 trauma centers between 2015 and 2018. Patients were included if they were stimulant naive at baseline and received amantadine, methylphenidate, or modafinil during ICU admission. Stimulant dose reduction or discontinuation during ICU admission was considered a surrogate marker of an ADE. Targeted chart review was performed to identify reasons for dose reduction or discontinuation.\nForty-eight of 608 patients with TBI received pharmacological stimulant therapy (7.9%) during the study period. Most patients were diagnosed with severe TBI at presentation (60.4%), although stimulants were also administered to patients with moderate (14.6%) and mild (25.0%) TBI. The median time of stimulant initiation was 11 days post-injury (range: 2-28 days). Median Glasgow Coma Scale score at the time of stimulant initiation was 9 (range: 4-15). Amantadine was the most commonly prescribed stimulant (85.4%) followed by modafinil (14.6%). Seven (14.6%) patients required stimulant dose reduction or discontinuation during ICU admission. The most common ADE resulting in therapy modification was delirium/agitation (n = 2), followed by insomnia (n = 1), anxiety (n = 1), and rash (n = 1); the reason for therapy modification was undocumented in 2 patients.\nPharmacological stimulant therapy is infrequently prescribed but well tolerated in ICU patients with acute TBI at level 1 trauma centers. These retrospective observations provide the basis for prospective studies to evaluate the safety, optimal dose range, and efficacy of stimulant therapies in this population.",
"affiliations": "Department of Pharmacy, 2348Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA.;Department of Neurology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA.;Department of Neurology, Brigham and Women's Hospital, Harvard Medical School, Boston, MA, USA.;Department of Physical Medicine and Rehabilitation, 2348Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA.;Department of Physical Medicine and Rehabilitation, 2348Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA.;Department of Neurology, Center for Neurotechnology and Neurorecovery, 2348Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA.",
"authors": "Barra|Megan E|ME|https://orcid.org/0000-0002-7696-1540;Izzy|Saef|S|;Sarro-Schwartz|Aliyah|A|;Hirschberg|Ronald E|RE|;Mazwi|Nicole|N|;Edlow|Brian L|BL|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/0885066619841603",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0885-0666",
"issue": "35(11)",
"journal": "Journal of intensive care medicine",
"keywords": "coma; consciousness; intensive care unit; pharmacological stimulant; traumatic brain injury",
"medline_ta": "J Intensive Care Med",
"mesh_terms": "D001930:Brain Injuries; D000070642:Brain Injuries, Traumatic; D015600:Glasgow Coma Scale; D006801:Humans; D011446:Prospective Studies; D012189:Retrospective Studies; D014193:Trauma Centers",
"nlm_unique_id": "8610344",
"other_id": null,
"pages": "1196-1202",
"pmc": null,
"pmid": "30966863",
"pubdate": "2020-11",
"publication_types": "D016428:Journal Article",
"references": "17671503;21219405;25285395;21846248;30142098;10839333;19818909;11588737;22036859;30349060;9497016;23303129;7249508;24090192;2892477;8831468;23770277;12105999;15057520;24574549;17215475;22375973;28816834;28243098;14660226;29790790;21876014;29707422;16127964;16226371;28858394",
"title": "Stimulant Therapy in Acute Traumatic Brain Injury: Prescribing Patterns and Adverse Event Rates at 2 Level 1 Trauma Centers.",
"title_normalized": "stimulant therapy in acute traumatic brain injury prescribing patterns and adverse event rates at 2 level 1 trauma centers"
} | [
{
"companynumb": "NVSC2021US167181",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "AMANTADINE HYDROCHLORIDE"
},
"drugadditional": "3",
... |
{
"abstract": "Intratumoral or intraperitoneal hemorrhage is a recognized complication of liver adenomatosis. We report a case of multifocal massive liver adenomatosis presenting as chronic iron deficiency anemia. Clinicians' awareness about this atypical presentation not highlighted in the literature is important to allow timely diagnosis and surgical intervention to prevent fatal complications.",
"affiliations": "Clínica Universitária de Medicina II Centro Hospitalar Lisboa Norte Lisboa Portugal.;Clínica Universitária de Medicina II Centro Hospitalar Lisboa Norte Lisboa Portugal.;Clínica Universitária de Medicina II Centro Hospitalar Lisboa Norte Lisboa Portugal.;Clínica Universitária de Medicina II Centro Hospitalar Lisboa Norte Lisboa Portugal.;Clínica Universitária de Medicina II Centro Hospitalar Lisboa Norte Lisboa Portugal.",
"authors": "Mota|Catarina|C|0000-0001-8835-6527;Carvalho|Ana Margarida|AM|;Fonseca|Válter|V|;Silva|Marisa Teixeira|MT|;Victorino|Rui M M|RMM|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1002/ccr3.814",
"fulltext": "\n==== Front\nClin Case RepClin Case Rep10.1002/(ISSN)2050-0904CCR3Clinical Case Reports2050-0904John Wiley and Sons Inc. Hoboken 2846985210.1002/ccr3.814CCR3814Case ReportCase ReportsExuberant liver adenomatosis presenting with iron deficiency anemia C. Mota et al.Mota Catarina http://orcid.org/0000-0001-8835-6527catarina.mot@gmail.com \n1\nCarvalho Ana Margarida \n1\nFonseca Válter \n1\nSilva Marisa Teixeira \n1\nVictorino Rui M. M. \n1\n1 Clínica Universitária de Medicina IICentro Hospitalar Lisboa NorteLisboaPortugal* Correspondence\n\nCatarina Mota, Clínica Universitária de Medicina II, Av. Professor Egas Moniz‐ Hospital de Santa Maria, 1649‐035 Lisboa, Portugal. Tel: 00351 919914001; Fax: +351 217805000; E‐mail: catarina.mot@gmail.com\n16 3 2017 5 2017 5 5 10.1002/ccr3.2017.5.issue-5574 577 10 6 2016 30 8 2016 01 9 2016 © 2017 The Authors. Clinical Case Reports published by John Wiley & Sons Ltd.This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Key Clinical Message\nIntratumoral or intraperitoneal hemorrhage is a recognized complication of liver adenomatosis. We report a case of multifocal massive liver adenomatosis presenting as chronic iron deficiency anemia. Clinicians’ awareness about this atypical presentation not highlighted in the literature is important to allow timely diagnosis and surgical intervention to prevent fatal complications.\n\nHepatocellular adenomaintratumoral hemorrhageiron deficiency anemialiver adenomatosis source-schema-version-number2.0component-idccr3814cover-dateMay 2017details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:5.0.9 mode:remove_FC converted:18.05.2017\n==== Body\nIntroduction\nHepatocellular adenoma is an uncommon benign hepatic tumor, with an increased incidence in women of reproductive age with a history of oral contraceptives 1, 2, men taking anabolic steroids 3, or patients with glycogen storage disease or iron‐overload disorders 4, 5. The majority of hepatic adenomas are solitary, although the occasional occurrence of two or three adenomas is well recognized in the literature 6, 7.\n\nLiver adenomatosis, defined by the presence of multiple adenomas (arbitrarily, defined by more than 10) in a normal hepatic parenchyma, was described in 1985 by Flejou et al. as a distinct entity 8. Subsequently, case reports and small series have documented multiple adenomas in an otherwise normal liver, both in men and women, in the absence of glycogen storage disease or association with steroid medication 9, 10, 11, 12. Nevertheless, the role of estrogen intake in the outcome and progression of liver adenomatosis is still controversial, in contrast to solitary adenomas where the association with estrogens is well established 13.\n\nThe pathogenesis and natural history of liver adenomatosis are still unclear. Some reports show that hepatic adenomatosis occurs more often in patients who have coexistent vascular tumors, portal vein absence, or occlusion or portohepatic venous shunts, leading to a speculative association between this entity and congenital or acquired abnormalities of the hepatic vasculature 14, 15, 16. Germline mutation of hepatocyte nuclear factor‐1 alpha, which is associated with maturity‐onset diabetes of the young type 3, has been also recently implicated in some reported cases 17, 18.\n\nAlthough considered a benign entity, liver adenomatosis has been associated with an increased risk of malignant transformation and hemorrhage, both potentially fatal 8, 13. Complications of adenomatous lesions, such as intraperitoneal bleeding, intratumoral hemorrhage, or necrosis‐producing acute pain, often reveal a frequently silent disease 8, 9, 19, 20, 21, 22.\n\nWe describe a rare case of massive and multifocal liver adenomatosis, who presented clinically as a chronic iron deficiency anemia due to chronic intratumoral bleeding that illustrates an unreported presentation of this condition.\n\nCase Report\nA 37‐year‐old woman with no relevant clinical background, on oral contraception with desogestrel/etinilestradiol, was admitted with fatigue on moderate exertion and anemia detected in routine laboratory tests.\n\nPhysical examination revealed pallor, with reasonable general condition, blood pressure 122/70 mmHg, pulse rate 95/min, and respiratory rate 16/min. There were no rashes or skin lesions nor palpable lymphadenopathy. Cardiovascular and pulmonary examination was normal. The abdomen was normal and the remaining examination unremarkable.\n\nThe blood tests revealed an iron deficiency anemia with hemoglobin of 9.0 g/dL, mean corpuscular volume of 67.7 fl, iron of 17.6 mg/dL, and ferritin of 17 ng/dL, normal transaminases, alkaline phosphatase of 250 U/L (reference range 45–129 U/L), gamma‐glutamyl transferase of 91 U/L (reference range <73 U/L), normal bilirubin, C‐reactive protein of 4.78 mg/dL (reference range <0.4 mg/dL), and sedimentation rate of 81 mm/h (reference range <12 mm/h).\n\nConsidering the differential diagnosis of iron deficiency anemia, menstrual blood loss was normal, with no evidence of menorrhagia. The patient was not vegetarian, with a diversified diet without restrictions. The endoscopy and the colonoscopy revealed no abnormalities. Abdominal ultrasound and CT scan showed hepatomegaly with bilateral focal lesions, namely a proliferative, solid lesion 12.5 × 12.3 × 6 cm contacting the gastric wall, a lesion occupying almost the entire segment VI (6 cm anteroposterior diameter), and a smaller lesion in the eighth segment with 20 mm (Fig. 1).\n\nFigure 1 Abdominal CT: multiple hepatic adenomas.\n\nMultifocal hepatic lesions and iron deficiency anemia in a young woman under oral contraception favored a benign etiology, particularly hepatic adenomas, focal nodular hyperplasia, nodular regenerative hyperplasia, and hemangiomatosis, although focal liver lesions in malignant context had also to be considered.\n\nAdditional investigation revealed negative CEA, α‐fetoprotein, and CA 19.9, β2microglobuline of 2.48 mg/L, and negative viral serology. The abdominal magnetic resonance confirmed hepatomegaly with multiple focal lesions of solid nature, well above the limit of ten that defines liver adenomatosis, the larger in the left lobe. Biopsy of the major lesion showed marked sinusoidal ectasia, focal lymphocytic inflammatory infiltrate, ductular reaction, prominent vessels with thin wall, mild perivascular fibrosis, and positivity for GS‐6, beta‐catenin, and amyloid A, favoring the diagnosis of hepatocellular adenoma of inflammatory/telangiectasic type. The patient was diagnosed with hepatic adenomatosis and probable chronic intratumoral hemorrhage.\n\nAtypical resection of segment III and enucleation of VI segment lesion with Cavitron ultrasonic surgical aspirator were performed. Histology of the resected lesions revealed hepatic adenomas with local steatosis, areas of hemorrhage and sinusoidal dilation and scarce ductular reaction. The patient was discharged after 6 days postoperatively, with the diagnosis of hepatic adenomatosis with intratumoral hemorrhage.\n\nOne month after surgery, the patient remained asymptomatic, with a gradual recovery in exercise tolerance. The blood tests revealed a progressive improvement of hemoglobin (10.2 g/dL), iron, and ferritin, with concomitant decrease in alkaline phosphatase and gamma‐glutamyl transferase. There was a marked reduction in inflammatory parameters, suggesting that they were in part attributed to the inflammatory syndrome associated with this particular histological type of adenomas, as previously described in the literature 23. Given the initial clinical presentation, the complementary investigation, and the observed evolution, iron deficiency anemia was interpreted as the inaugural presentation of liver adenomatosis as a result of chronic intratumoral hemorrhage.\n\nDiscussion\nLiver adenomatosis, defined as at least 10 adenomas in an otherwise normal liver, has been historically associated with an increased risk of malignant transformation and hemorrhage 8. Two forms have been described in the literature: the massive form, with liver enlargement and unilobar commitment, and the multifocal form, where the liver is not enlarged and one or two of the disseminated adenomas may be larger and produce complications. In the previous reported cases of liver adenomatosis, the diagnosis was made following complications of adenomas – intraperitoneal bleeding 8, 9, 19, intratumoral hemorrhage or necrosis determining acute pain 15, 20, 21, 22, symptomatic or asymptomatic hepatomegaly 8, 24 or as an incidental discovery. The therapeutic management of this entity ranges from conservative monitoring or medical therapy to aggressive surgery and even orthotopic liver transplantation, according to the size, number, localization, and predictable complications of the tumors 8, 9, 12, 18.\n\nSpontaneous hemorrhage has been recognized as the most common complication of liver adenomatosis, particularly with large and subcapsular adenomas 12. The histologic features of liver adenomas, with a proliferation of hepatocytes and sinusoids and weak connective tissue support, predispose them to hemorrhage, particularly because these lesions are perfused almost exclusively by high‐pressure arterial flow 12. The exact frequency of hemorrhage is uncertain, because asymptomatic patients usually do not seek medical attention. Dokmak et al. reported that hemorrhage (as identified on imaging) was present in 21% of 122 patients with single or multiple hepatocellular adenomas and was related to the size of the tumor 2. In a small series of eight patients, Chiche et al. reported that the disease was revealed by intraperitoneal bleeding in two patients. One died before laparotomy, the diagnosis was made at necropsy, and the other underwent urgent surgery 13. Additionally, three patients were admitted for acute abdominal pain corresponding to intratumoral bleeding or necrosis of one of the adenomas 13. These findings emphasize the risk of hemorrhage as a major concern of this benign entity.\n\nNotwithstanding the well‐recognized possibility of intratumoral or intraperitoneal hemorrhage, there are no reports of iron deficiency anemia as sole presentation of multifocal and massive hepatic adenomatosis. This case illustrates a rare unreported form of massive and multifocal liver adenomatosis clinical presentation that should be considered as the early diagnosis and surgical intervention can prevent possible fatal consequences of a benign entity.\n\nAuthorship\nCM: involved in conception of the work, data collection, data analysis and interpretation, drafting the article, critical revision of the article. AMC: involved in data collection, data analysis and interpretation, drafting the article, critical revision of the article. VF: involved in data collection, data analysis and interpretation, drafting the article, critical revision of the article. MTS: involved in data analysis and interpretation, drafting the article, critical revision of the article. RMMV: involved in data analysis and interpretation, drafting the article, critical revision of the article.\n\nConflict of Interest\nThe authors declare that they have no conflict of interests.\n==== Refs\nReferences\n1 \n\nRooks , J. B. \n, \nH. W. \nOry \n, \nK. G. \nIshak \n, et al. 1979 \nEpidemiology of hepatocellular adenoma: the role of oral contraceptive use . JAMA \n242 :644 –648 .221698 \n2 \n\nDokmak , S. \n, \nV. \nParadis \n, \nV. \nVilgrain \n, \nA. \nSauvanet \n, \nO. \nFarges \n, \nD. \nValla \n, et al. 2009 \nA single‐center surgical experience of 122 patients with single and multiple hepatocellular adenomas . Gastroenterology \n137 :1698 –1705 .19664629 \n3 \n\nSale , G. E. \n, and \nK. G. \nLerner \n. 1977 \nMultiple tumors after androgen therapy . Arch. Pathol. Lab. Med. \n101 :600 –603 .199136 \n4 \n\nHowell , R. R. \n, \nR. E. \nStevenson \n, \nY. \nBen Menachem \n, \nR. L. \nPhyliky \n, and \nD. H. \nBerry \n. 1976 \nHepatic adenomata with type 1 glycogen storage disease . JAMA \n236 :1481 –1484 .183026 \n5 \n\nRosenberg , L. \n\n1991 \nThe risk of liver neoplasia in relation to combined oral contraceptive use . Contraception \n43 :643 –652 .1651205 \n6 \n\nIchikawa , T. \n, \nM. P. \nFederle \n, \nL. \nGrazioli \n, and \nM. \nNalesnick \n. 2000 \nHepatocellular adenoma: multiphasic CT and histopathologic findings in 25 patients . Radiology \n214 :861 –868 .10715059 \n7 \n\nKarkar , A. M. \n, et al. 2013 \nManagement of hepatocellular adenoma: comparison of resection, embolization and observation . HPB (Oxford) \n5 :235 –243 .\n8 \n\nFlejou , J. F. \n, \nJ. \nBarge \n, \nY. \nMenu \n, et al. 1985 \nLiver adenomatosis: an entity distinct from liver adenoma? \nGastroenterology \n83 :1132 –1138 .\n9 \n\nRibeiro , A. \n, \nL. J. \nBurgart \n, \nD. M. \nNagorney \n, and \nG. J. \nGores \n. 1998 \nManagement of liver adenomatosis: results with a conservative surgical approach . Liver Transpl. Surg. \n4 :388 –398 .9724476 \n10 \n\nChoi , B. I. \n, \nJ. K. \nHan \n, \nS. H. \nKim \n, and \nM. C. \nHan \n. 1991 \nMR findings in liver adenomatosis . Gastrointest Radiol. \n16 :234 –236 .1879639 \n11 \n\nKhan , S. S. \n, \nM. \nFink \n, and \nS. \nKing \n. 1992 \nCase report: liver adenomatosis presenting as multiple calcified masses . Clin. Radiol. \n45 :206 –207 .1555377 \n12 \n\nGrazioli , L. \n, et al. 2000 \nLiver adenomatosis: clinical, histopathologic, and imaging findings in 15 patients . Radiology \n216 :395 –402 .10924560 \n13 \n\nChiche , L. \n, et al. 2000 \nLiver adenomatosis: reappraisal, diagnosis, and surgical management . Ann. Surg. \n231 :74 .10636105 \n14 \n\nKawakatsu , M. \n, \nV. \nVilgrain \n, \nJ. \nBelghiti \n, et al. 1994 \nAssociation of multiple liver cell adenomas with spontaneous intrahepatic portohepatic shunt . Abdom. Imaging \n19 :438 –440 .7950822 \n15 \n\nChen , K. T. \n, and \nJ. J. \nBocian \n. 1983 \nMultiple hepatic adenomas . Arch. Pathol. Lab. Med. \n107 :274 –275 .6301400 \n16 \n\nOberti , F. \n, \nH. \nRifflet \n, \nJ. F. \nFlejou \n, et al. 1997 \nAssociation d'une adénomatose hépatique et d'unesclérose hépatopotale chez une femme atteinte d'incontinentia pigmenti . Gastroenterol. Clin. Biol. \n21 :147 –151 .9161481 \n17 \n\nCantu , S. \n, \nJ. \nKrier \n, and \nN. \nHashemi \n. 2016 \nHepatocyte nuclear factor 1α mutation‐associated MODY‐3 and familial liver adenomatosis . J. Clin. Gastroenterol. \n50 :181 –182 .\n18 \n\nHirata , E. \n, \nS. \nShimizu \n, \nS. \nUmeda \n, \nT. \nKobayashi \n, \nM. \nNakano \n, \nH. \nHiguchi \n, et al. 2015 \nHepatocyte nuclear factor 1α‐inactivated hepatocellular adenomatosis in a patient with maturity‐onset diabetes of the young type 3: case report and literature review . Nihon Shokakibyo Gakkai Zasshi \n112 :1696 –1704 .26346360 \n19 \n\nLeborgne , J. \n, \nP. A. \nLehur \n, \nJ. M. \nHoreau \n, et al. 1990 \nProblémes thérapeutiques liés aux ruptures de volumineux adénomes hépatiques de siége central: a propos de trois observations . Chirurgie \n116 :454 –460 .2096049 \n20 \n\nLeese , T. \n, \nO. \nFarges \n, and \nH. \nBismuth \n. 1988 \nLiver cell adenomas . Ann. Surg. \n208 :558 –564 .3190282 \n21 \n\nPropst , A. \n, \nT. \nPropst \n, \nP. \nWaldenberg \n, et al. 1995 \nA case of hepatocellular adenomatosis with a follow‐up of 11 years . Am. J. Gastroenterol. \n90 :1345 –1346 .7639246 \n22 \n\nArsenault , T. M. \n, \nC. D. \nJohnson \n, \nB. \nGorman \n, et al. 1996 \nHepatic adenomatosis . Mayo Clin. Proc. \n71 :478 –480 .8628028 \n23 \n\nCunha , A. S. \n, \nJ. F. \nBlanc \n, \nE. \nLazaro \n, \nL. \nMellottee \n, \nB. \nLe Bail \n, \nJ. \nZucman‐Rossi \n, et al. 2007 \nInflammatory syndrome with liver adenomatosis: the beneficial effects of surgical management . Gut \n56 :307 –309 .\n24 \n\nBarcet , S. \n, \nV. \nFrering \n, and \nC. \nPartensky \n. 1996 \nRésection hépatique pour adénome et adénomatose hépatique . Lyon Chir. \n92 :6 –12 .\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-0904",
"issue": "5(5)",
"journal": "Clinical case reports",
"keywords": "Hepatocellular adenoma; intratumoral hemorrhage; iron deficiency anemia; liver adenomatosis",
"medline_ta": "Clin Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101620385",
"other_id": null,
"pages": "574-577",
"pmc": null,
"pmid": "28469852",
"pubdate": "2017-05",
"publication_types": "D002363:Case Reports",
"references": "6301400;10636105;183026;7639246;3190282;1879639;199136;1651205;9161481;19664629;1555377;23374365;26346360;10924560;9724476;17303609;7950822;8628028;2412930;2096049;221698;10715059;26646800",
"title": "Exuberant liver adenomatosis presenting with iron deficiency anemia.",
"title_normalized": "exuberant liver adenomatosis presenting with iron deficiency anemia"
} | [
{
"companynumb": "PT-MYLANLABS-2018M1005566",
"fulfillexpeditecriteria": "1",
"occurcountry": "PT",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DESOGESTREL\\ETHINYL ESTRADIOL"
},
"drugaddit... |
{
"abstract": "Cerebral aneurysms associated with systemic lupus erythematosus (SLE) are more likely to grow rapidly and rupture, compared to those found in the general population. The main underlying pathology of intracranial aneurysm and its rupture is presumed to be SLE-related intracranial vasculitis and fragility of blood vessels due to prolonged use of steroid. For these reasons, both surgical and endovascular options are challenging. On the other hand, given the possibility that SLE may predispose to growth and rupture of intracranial aneurysm, early intervention for cerebral aneurysms associated with SLE may be more necessary and beneficial than other cerebral aneurysms in the general population. Here we would like to report on the unexpected complications that occurred during or after endovascular treatment of an SLE patient with multiple aneurysms. The complications include intraprocedural rupture of unruptured aneurysm, coil stretching, contrast-induced encephalopathy, and delayed ipsilateral intraparenchymal hemorrhage after stent-assisted coiling. Our unique case highlights that the SLE patient with multiple intracranial aneurysms had a higher risk of endovascular procedure-related complications, which might be due to the increased bleeding tendency and fragility of blood vessels.",
"affiliations": "Department of Neurosurgery, Medical Research Institute, Pusan National University Hospital, Busan, Korea.;Department of Neurosurgery, Medical Research Institute, Pusan National University Yangsan Hospital, Yangsan, Korea.;Department of Neurosurgery, Medical Research Institute, Pusan National University Hospital, Busan, Korea.;Department of Neurosurgery, Medical Research Institute, Pusan National University Hospital, Busan, Korea. redcheek09@naver.com.",
"authors": "Lee|Jung Hwan|JH|https://orcid.org/0000-0002-1393-7105;Lee|Sang Weon|SW|https://orcid.org/0000-0002-3199-7072;Choi|Chang Hwa|CH|https://orcid.org/0000-0001-6430-1396;Ko|Jun Kyeung|JK|https://orcid.org/0000-0002-5652-7659",
"chemical_list": null,
"country": "Korea (South)",
"delete": false,
"doi": "10.3349/ymj.2020.61.5.441",
"fulltext": "\n==== Front\nYonsei Med J\nYonsei Med. J\nYMJ\nYonsei Medical Journal\n0513-5796 1976-2437 Yonsei University College of Medicine \n\n10.3349/ymj.2020.61.5.441\nCase Report\nNeurology & Neurosciences\nDoes Systemic Lupus Erythematosus Increase the Risk of Procedure-Related Complication in Endovascular Treatment of Intracranial Aneurysm?\nhttps://orcid.org/0000-0002-1393-7105Lee Jung Hwan 1 https://orcid.org/0000-0002-3199-7072Lee Sang Weon 2 https://orcid.org/0000-0001-6430-1396Choi Chang Hwa 1 https://orcid.org/0000-0002-5652-7659Ko Jun Kyeung 1 1 Department of Neurosurgery, Medical Research Institute, Pusan National University Hospital, Busan, Korea.\n2 Department of Neurosurgery, Medical Research Institute, Pusan National University Yangsan Hospital, Yangsan, Korea.\nCorresponding author: Jun Kyeung Ko, MD, PhD, Department of Neurosurgery, Pusan National University Hospital, 179 Gudeok-ro, Seo-gu, Busan 49241, Korea. Tel: 82-51-240-7257, Fax: 82-51-244-0282, redcheek09@naver.com\n01 5 2020 \n24 4 2020 \n61 5 441 444\n22 1 2020 16 3 2020 16 3 2020 © Copyright: Yonsei University College of Medicine 20202020Yonsei University College of MedicineThis is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.Cerebral aneurysms associated with systemic lupus erythematosus (SLE) are more likely to grow rapidly and rupture, compared to those found in the general population. The main underlying pathology of intracranial aneurysm and its rupture is presumed to be SLE-related intracranial vasculitis and fragility of blood vessels due to prolonged use of steroid. For these reasons, both surgical and endovascular options are challenging. On the other hand, given the possibility that SLE may predispose to growth and rupture of intracranial aneurysm, early intervention for cerebral aneurysms associated with SLE may be more necessary and beneficial than other cerebral aneurysms in the general population. Here we would like to report on the unexpected complications that occurred during or after endovascular treatment of an SLE patient with multiple aneurysms. The complications include intraprocedural rupture of unruptured aneurysm, coil stretching, contrast-induced encephalopathy, and delayed ipsilateral intraparenchymal hemorrhage after stent-assisted coiling. Our unique case highlights that the SLE patient with multiple intracranial aneurysms had a higher risk of endovascular procedure-related complications, which might be due to the increased bleeding tendency and fragility of blood vessels.\n\nCerebral aneurysmendovascular treatmentsystemic lupus erythematosus\n==== Body\nINTRODUCTION\nSystemic lupus erythematosus (SLE) is an autoimmune chronic multisystemic inflammatory disease of unknown etiology. The main underlying pathology of intracranial aneurysm and its rupture is presumed to be SLE-related vasculitis and fragility of blood vessels due to prolonged use of steroid. Arterial inflammation causes lumen vessel narrowing and cerebral flow reduction, leading to ischemia and hemodynamic stress, which are cofactors for aneurysmal genesis.12 Therefore, patients who have undergone successful clipping of intracranial aneurysms often experience complications of SLE. Here we would like to report on the unexpected complications that occurred during or after endovascular treatment (EVT) of an SLE patient with multiple aneurysms.\n\nCASE REPORT\nThe patient's informed consent was obtained for this case report. A 44-year-old woman with hypertension and a 17-year history of SLE was referred to our department with fluctuant left ptosis, chemosis, and ocular pain for 2 months. At the time of hospitalization, she met four criteria of the 2012 Systemic Lupus Collaborating Clinics criteria for SLE, including chronic cutaneous lupus erythematosus, positive ANA titer, positive anti-dsDNA Ab on two occasions, and positive antiphospholipid Ab.3 Recent SLE activity was mild, and the patient had been taking low-dose oral prednisone as maintenance therapy. Brain magnetic resonance angiography revealed a 7.0 mm-sized aneurysm of the left anterior choroidal artery. Relapse and remission of Tolosa-Hunt syndrome resulting from that aneurysm was assumed to be the cause of the present symptoms. After loading 300 mg of clopidogrel and 300 mg of acetylsalicylic acid at 12 hours before the procedure, EVT was performed under intravenous sedation. Intraprocedural aneurysmal rupture was identified by the angiographic visualization of contrast agent extravasation without a rapid change in her vital signs (Fig. 1). However, the angiographic evidence of coil perforation was not observed. To prevent continuous leaking of contrast material, protamine sulfate was given for heparin reversal and additional coils were deployed for dome protection. After the entire procedure, both the condition and computed tomography (CT) finding of the patient were intact, indicating that intraprocedural aneurysmal rupture led to minimal extravasation of blood, fortunately. The postoperative course was uneventful, and the patient was maintained on dual antiplatelet therapy.\n\nA month after the previous procedure, the patient was readmitted to our hospital for coiling of another aneurysm located on the right paraclinoid internal carotid artery (ICA). During right ICA angiography, just before coiling, the patient developed rapidly worsening confusion and left hemiparesis on the table. Right ICA angiography revealed no abnormal findings. A total of 40 mL of Iopromide (Ultravist 300, Bayer Healthcare Pharmaceuticals, Wayne, NJ, USA), a low osmolar non-ionic contrast agent, was administered and the procedure was abandoned. Non-contrast CT showed marked enhancement throughout the right cerebral cortex and right basal ganglia with concordant diffuse swelling of the right cerebral hemisphere, which are indicative of contrast-induced encephalopathy (CIE) (Fig. 2A). Magnetic resonance imaging was then performed to exclude the possibility of other mimicking conditions, including an acute ischemic complication, and it showed no abnormal findings. Twenty-four hours later, repeat brain CT scan revealed no enhancement on cerebral cortex and basal ganglia (Fig. 2B). The patient gradually recovered after supportive care, and was discharged after 3 days with a modified Rankin scale score of 0.\n\nDespite concerns about the side effect of contrast material, EVT was retried for the treatment of the aneurysm 3 months later. To prevent contrast-induced adverse reaction, another type of contrast medium (iobitridol, Xenetix® 300, Guerbet, Sulzbach, Germany) was selected, and adequate hydration was performed with intra-arterial saline infusion and intravenous fluids during and before the procedure. The procedure using stent-assisted coiling was uneventful, and the patient was well-recovered; however, remote intracerebral hemorrhage (ICH) occurred after 2 days with a generalized tonic-clonic seizure (Fig. 3). Hematoma was well-absorbed after conservative treatment. However, the patient experienced two more seizure attacks despite taking anti-epileptic medication, and she is currently on anti-epileptic medication without any neurological deficits.\n\nDISCUSSION\nCerebral aneurysms associated with SLE are more likely to grow rapidly and consequently rupture, compared to cerebral aneurysms in the general population.4 Therefore, when an aneurysm is present and requires occlusion in patients with SLE, it should be considered for more aggressive treatment, especially if a growth or related symptom of aneurysm is observed, as in our case.\n\nTherapeutic management of intracranial aneurysm and subarachnoid hemorrhage in these patients is not well-established and depends highly on the patient's clinical condition. Successful surgical clipping and EVT of aneurysm have been previously reported in patients with SLE.4567 However, unexpectedly fragile intracranial arterial walls due to multifocal disease spread make them difficult to handle, and could prompt a rupture during both surgical and endovascular procedures. In the case of this study, intraprocedural aneurysmal rupture and delayed ipsilateral ICH that occurred during or after aneurysm coiling are assumed to be related to lupus vasculitis and fragility of blood vessels due to prolonged use of steroid, although the patient was found to have neither hematologic abnormalities nor angiographically proven vasculitis at the time. The incidence of remote ICH after EVT of unruptured intracranial aneurysms has been reported as 0.46%.8 Another study reported that the incidence of remote ICH after stent-assisted coiling of intracranial aneurysms was 2.2%.9 This event occurred mostly in patients with stents, hypertension, and unruptured intracranial aneurysms on the ICA.8 Our patient had all of the risk factors mentioned above. This case suggests that SLE may also predispose to this complication after aneurysm coiling. Therefore, in order to avoid these hemorrhagic complications, it seems necessary to limit the use of stents and antiplatelet medication in EVT for SLE patients.\n\nIodinated CIE is a rare complication of angiography. Iodinated contrast media are reported to temporarily disrupt the blood-brain barrier, causing an encephalopathy that is usually self-limiting. Based on current knowledge, this complication appears to be an idiosyncratic reaction to contrast.10 This makes avoidance of CIE challenging. Although it is difficult to establish a direct correlation between SLE and CIE, SLE pathology may have contributed in part to the occurrence of this complication, which should be always considered and prepared for.\n\nBased on our experience, when a cerebral aneurysm associated with SLE requires endovascular occlusion, increased risk of procedural complication should be noted and high degree of individual tailoring will be demanded.\n\nThe authors have no potential conflicts of interest to disclose.\n\nAUTHOR CONTRIBUTIONS:\nConceptualization: Chang Hwa Choi.\n\nData curation: Jun Kyeung Ko.\n\nFormal analysis: Sang Weon Lee.\n\nFunding acquisition: Jun Kyeung Ko.\n\nInvestigation: Chang Hwa Choi.\n\nMethodology: Chang Hwa Choi.\n\nProject administration: Jun Kyeung Ko.\n\nResources: Jun Kyeung Ko.\n\nSoftware: Jung Hwan Lee.\n\nSupervision: Sang Weon Lee.\n\nValidation: Sang Weon Lee.\n\nVisualization: Jung Hwan Lee.\n\nWriting—original draft: Jun Kyeung Ko.\n\nWriting—review & editing: Jung Hwan Lee.\n\nApproval of final manuscript: all authors.\n\n\n\n\nFig. 1 (A) Left internal carotid artery angiography showing a symptomatic unruptured aneurysm at the origin of the left anterior choroidal artery. (B) Leak of contrast agent surrounding aneurysm neck indicates intraprocedural aneurysm rupture.\nFig. 2 (A) Postangiographic brain computed tomography showing marked enhancement throughout the right cerebral cortex and right basal ganglia, indicative of contrast-induced encephalopathy. (B) Repeat brain computed tomography obtained after 24 hours demonstrating no enhancement on cerebral cortex and basal ganglia.\nFig. 3 (A and B) Right ICA angiographies before and after endovascular treatment showing another aneurysm located on the right paraclinoid ICA and uneventful stent-assisted coiling. (C) Non-contrast computed tomography showing a right frontal hematoma. ICA: internal carotid artery.\n==== Refs\n1 Chang YS Liu CJ Chen WS Lai CC Wang SH Chen TJ Increased risk of subarachnoid hemorrhage in patients with systemic lupus erythematosus: a nationwide population-based study Arthritis Care Res (Hoboken) 2013 65 601 606 22965820 \n2 Kelley RE Stokes N Reyes P Harik SI Cerebral transmural angiitis and ruptured aneurysm: a complication of systemic lupus erythematosus Arch Neurol 1980 37 526 527 7417048 \n3 Petri M Orbai AM Alarcón GS Gordon C Merrill JT Fortin PR Derivation and validation of the Systemic Lupus International Collaborating Clinics classification criteria for systemic lupus erythematosus Arthritis Rheum 2012 64 2677 2686 22553077 \n4 Graffeo CS Tanweer O Nieves CF Belmont HM Izmirly PM Becske T Rapid aneurysm growth and rupture in systemic lupus erythematosus Surg Neurol Int 2015 6 9 25657862 \n5 Nakai Y Hyodo A Yanaka K Akutsu H Nose T Distal superior cerebellar artery aneurysm in a patient with systemic lupus erythematosus: case report Surg Neurol 2000 54 73 76 11024510 \n6 Ikeda N Nishizaki T Abiko M Sakakura T Nakano S [Abducens palsy due to unruptured aneurysms of the internal carotid artery in a patient with systemic lupus erythematosus] No Shinkei Geka 2012 40 429 435 22538285 \n7 Torné R Rodríguez-Hernández A Bernard T Arikan Abelló F Vilalta Castan J Sahuquillo J Subarachnoid hemorrhage in systemic lupus erythematosus: systematic review and report of three cases Clin Neurol Neurosurg 2015 128 17 24 25462090 \n8 Sim SY Song J Oh SY Kim MJ Lim YC Park SK Incidence and characteristics of remote intracerebral hemorrhage after endovascular treatment of unruptured intracranial aneurysms World Neurosurg 2016 95 335 340 27565469 \n9 Kayan Y Delgado Almandoz JE Fease JL Tran K Milner AM Scholz JM Incidence of delayed ipsilateral intraparenchymal hemorrhage after stent-assisted coiling of intracranial aneurysms in a high-volume single center Neuroradiology 2016 58 261 266 26615534 \n10 Leong S Fanning NF Persistent neurological deficit from iodinated contrast encephalopathy following intracranial aneurysm coiling: a case report and review of the literature Interv Neuroradiol 2012 18 33 41 22440599\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "0513-5796",
"issue": "61(5)",
"journal": "Yonsei medical journal",
"keywords": "Cerebral aneurysm; endovascular treatment; systemic lupus erythematosus",
"medline_ta": "Yonsei Med J",
"mesh_terms": "D000328:Adult; D001921:Brain; D002343:Carotid Artery, Internal; D057510:Endovascular Procedures; D005260:Female; D006801:Humans; D002532:Intracranial Aneurysm; D008180:Lupus Erythematosus, Systemic; D011183:Postoperative Complications; D012307:Risk Factors; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome",
"nlm_unique_id": "0414003",
"other_id": null,
"pages": "441-444",
"pmc": null,
"pmid": "32390369",
"pubdate": "2020-05",
"publication_types": "D002363:Case Reports",
"references": "25657862;22965820;22553077;7417048;26615534;22538285;11024510;27565469;25462090;22440599",
"title": "Does Systemic Lupus Erythematosus Increase the Risk of Procedure-Related Complication in Endovascular Treatment of Intracranial Aneurysm?",
"title_normalized": "does systemic lupus erythematosus increase the risk of procedure related complication in endovascular treatment of intracranial aneurysm"
} | [
{
"companynumb": "NVSC2020KR170638",
"fulfillexpeditecriteria": "1",
"occurcountry": "KR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": "3",
"drugadmi... |
{
"abstract": "Despite numerous case reports, the incidence of a secondary diagnosis of head and neck squamous cell carcinoma (HNC) following pegylated liposomal doxorubicin (PLD) treatment is unknown. Computerized pharmacy records were searched at a large, multi-center healthcare system for patients who received PLD. Electronic medical records were searched to identify the patient's age at treatment initiation of PLD, diagnosis for which they were treated with PLD, number of courses and total cumulative dose of PLD (TCDPLD) and secondary malignancies. Published PLD associated HNC was utilized to determine the lowest and median TCDPLD doses associated with HNC. One thousand two hundred ninety eligible patients who had been treated with PLD were identified. The lowest TCDPLD associated HNC in the literature is 405 mg/m2. In our healthcare system, 275 patients received more than 400 mg/m2 yielding a risk of 0.004%. One hundred fifty-one patients received the lowest TCDPLD associated with HNC cancer in our series which was 640 mg/m2 yielding a risk of 0.007%. Four of 30 patients (13.3%) developed HNC who received the median TCDPLD associated with HNC in the literature of 1440 mg/m2. Five of 20 patients (25%) receiving 1650 mg/m2 developed HNC in our healthcare system. Prolonged therapy with PLD is associated with an increased risk of HNC. This risk appears to be related to the cumulative dose varying from 0.004 to 13.3% at the lowest and median TCDPLD of reported cases in the literature, respectively. Oncologists need to be aware of this risk and to screen patients appropriately.",
"affiliations": "Section of Gynecologic Oncology, Women's Health Institute, Cleveland Clinic.;Department of Pharmacy, Cleveland Clinic.;Section of Gynecologic Oncology, Women's Health Institute, Cleveland Clinic.;Section of Gynecologic Oncology, Women's Health Institute, Cleveland Clinic.;Section of Gynecologic Oncology, Women's Health Institute, Cleveland Clinic.;Section of Head and Neck Surgery, Cleveland Clinic, Cleveland, Ohio, USA.;Section of Head and Neck Surgery, Cleveland Clinic, Cleveland, Ohio, USA.",
"authors": "Rose|Peter G|PG|;Fu|Frances|F|;Chambers|Laura M|LM|;Mei|Lin|L|;De Bernardo|Robert|R|;Prendes|Brandon L|BL|;Lamarre|Eric|E|",
"chemical_list": "D000903:Antibiotics, Antineoplastic; C506643:liposomal doxorubicin; D011092:Polyethylene Glycols; D004317:Doxorubicin",
"country": "England",
"delete": false,
"doi": "10.1097/CAD.0000000000000950",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0959-4973",
"issue": "31(7)",
"journal": "Anti-cancer drugs",
"keywords": null,
"medline_ta": "Anticancer Drugs",
"mesh_terms": "D000328:Adult; D000368:Aged; D000903:Antibiotics, Antineoplastic; D004317:Doxorubicin; D057286:Electronic Health Records; D005185:Fallopian Tube Neoplasms; D005260:Female; D006258:Head and Neck Neoplasms; D006801:Humans; D015994:Incidence; D008297:Male; D008875:Middle Aged; D016609:Neoplasms, Second Primary; D010051:Ovarian Neoplasms; D011092:Polyethylene Glycols; D012189:Retrospective Studies; D000077195:Squamous Cell Carcinoma of Head and Neck",
"nlm_unique_id": "9100823",
"other_id": null,
"pages": "747-750",
"pmc": null,
"pmid": "32697468",
"pubdate": "2020-08",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Incidence of squamous cell carcinomas of the head and neck following prolonged pegylated liposomal doxorubicin.",
"title_normalized": "incidence of squamous cell carcinomas of the head and neck following prolonged pegylated liposomal doxorubicin"
} | [
{
"companynumb": "US-MYLANLABS-2020M1097377",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "DOXORUBICIN"
},
"drugadditional": null,
... |
{
"abstract": "To better understand this cancer, we here report the case of a 43-year old patient diagnosed with localized and isolated primary colonic NK/T-cell lymphoma without associated enteropathy, treated wih 3 cycles of AspaMetDex with a poor response who died during treatment with a clinical picture of acute abdomen. Primary intestinal NK/T-cell lymphoma most commonly affects the young subject with poor prognosis. It is difficult to distinguish between intestinal NK/T-cell lymphoma and inflammatory or infectious intestinal disorders because of its non-specific clinical and endoscopic features. The histopathological and immunohistochemical data as well as the study of DNA allow to adjust the diagnosis and to classify this lymphoma according the European Enteropathy type T-cell lymphoma (ETL).",
"affiliations": "Service d'Hématologie et d'Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.;Service d'Hématologie et d'Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.;Service d'Hématologie et d'Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.;Service de Radiologie de l'Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.;Service de Radiologie de l'Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.;Service Central d'Anatomie Pathologique, CHU Ibn Rochd, Casablanca, Maroc.;Service Central d'Anatomie Pathologique, CHU Ibn Rochd, Casablanca, Maroc.;Service d'Hématologie et d'Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc.",
"authors": "Fares|Salma|S|;Lamchahab|Mouna|M|;Aniba|Myriem|M|;Lembarki|Ghizlane|G|;Mousalli|Nadia|N|;Regragui|Meriem|M|;Karkouri|Mehdi|M|;Quessar|Asmaa|A|",
"chemical_list": "D003907:Dexamethasone; D001215:Asparaginase; D008727:Methotrexate",
"country": "Uganda",
"delete": false,
"doi": "10.11604/pamj.2017.26.112.10304",
"fulltext": "\n==== Front\nPan Afr Med JPan Afr Med JPAMJThe Pan African Medical Journal1937-8688The African Field Epidemiology Network PAMJ-26-11210.11604/pamj.2017.26.112.10304Case ReportLymphome T/NK extra-nasal à localisation colique primitif: à propos d’un cas Primary colonic extranasal NK/T-cell lymphoma: about a case Fares Salma 1&Lamchahab Mouna 1Aniba Myriem 1Lembarki Ghizlane 2Mousalli Nadia 2Regragui Meriem 3Karkouri Mehdi 3Quessar Asmaa 11 Service d’Hématologie et d’Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc2 Service de Radiologie de l’Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc3 Service Central d’Anatomie Pathologique, CHU Ibn Rochd, Casablanca, Maroc& Corresponding author: Salma Fares, Service d’Hématologie et d’Oncologie Pédiatrique, Hôpital 20 Août 1953, CHU Ibn Rochd, Casablanca, Maroc01 3 2017 2017 26 11212 7 2016 09 2 2017 © Salma Fares et al.2017The Pan African Medical Journal - ISSN 1937-8688. This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Le lymphome T/NK intestinal primitif est une entité extrêmement rare dont le diagnostic précoce est souvent difficile. Pour mieux comprendre cette entité, nous rapportons le cas d’un patient de 43 ans diagnostiqué avec un lymphome T/NK colique primitif localisé et isolé sans entéropathie associée, ayant été traité par 3 cycles (AspaMetDex) avec un échec à l’évaluation et la survenue du décès au cours du traitement dans le tableau d’un abdomen aigu. Le lymphome T/NK intestinal primitif atteint le plus souvent le sujet jeune avec un pronostic péjoratif. En raison des caractères cliniques et endoscopiques non spécifiques, il est difficile de distinguer entre un lymphome T/NK intestinal et les troubles intestinaux inflammatoires ou infectieuses. Les données histopathologiques et immunohistochimiques ainsi que l’étude de l’ADN permettent de redresser le diagnostic et de classer ce lymphome selon l’EuropeanEnteropathy-Type Intestinal T-CellLymphoma (ETL).\n\nTo better understand this cancer, we here report the case of a 43-year old patient diagnosed with localized and isolated primary colonic NK/T-cell lymphoma without associated enteropathy, treated wih 3 cycles of AspaMetDex with a poor response who died during treatment with a clinical picture of acute abdomen. Primary intestinal NK/T-cell lymphoma most commonly affects the young subject with poor prognosis. It is difficult to distinguish between intestinal NK/T-cell lymphoma and inflammatory or infectious intestinal disorders because of its non-specific clinical and endoscopic features. The histopathological and immunohistochemical data as well as the study of DNA allow to adjust the diagnosis and to classify this lymphoma according the European Enteropathy type T-cell lymphoma (ETL).\n\nLymphome T/NKextra-nasalcoliqueentéropathieT/NK lymphomaextra-nasalcolicenteropathy\n==== Body\nIntroduction\nSelon l’OMS, la classification des lymphomes englobe un large éventail d’entités pathologiques. Le lymphome à cellules T/NK représente environ 3% de la totalité des lymphomes non hodgkiniens (LNH) [1]. En Asie, le lymphome à cellules T/NK représente entre 2 et 8% de l’ensemble des LNH [2–4] alors qu’en Europe sa prévalence ne dépasse pas 2% [2]. Le lymphome à cellules T/NK extra-nodal est un sous-groupe de lymphomes T cytotoxiques ou à cellules NK ayant un spectre morphologique multiple qui provient de l’extérieur du ganglion lymphatique. Les cellules NK sont des cellules non B/non T avec un rôle bien reconnu dans l’immunité innée. Leur nature cytotoxique leur permet d’éradiquer les différents types de virus ainsi que les cellules tumorales. Récemment, leur rôle dans l’immunité adaptative a été bien élucidé à travers leur fonction d’effecteur de production des cytokines [5]. Le lymphome à cellules T/NK est un lymphome agressif caractérisé par une prolifération lymphoïde atypique angiocentrique ou angiodestructive associée à une nécrose [6]. Ces lésions sont presque toujours associées à l’EBV et montrent une positivité au marqueur CD56. Selon leur site, ils sont classés en lymphome à cellules T/NK nodal (NNTCL) et extranodal (ENTCL) [1]. Le lymphome à cellules T/NK intestinal primitif est défini comme un lymphome extra-nodal à développement intestinal avec la majorité de la masse tumorale localisée en intestinal ; cette entité est extrêmement rare. Depuis le diagnostic précoce de ce lymphome, il présente toujours des difficultés pour les cliniciens, le traitement approprié pourrait être retardé. Le diagnostic différentiel de tels cas comprennent habituellement : le lymphome à cellules T associé à une entéropathie (EATL) [7], le lymphome à cellules T gamma-delta [8] et le lymphome anaplasique à grandes cellules (ALCL) [9]. Le traitement de ce lymphome agressif consiste en une polychimiothérapie systémique et éventuellement un traitement myéloablatif. Objectif: pour mieux comprendre cette entité, nous rapportons le cas d’un lymphome à cellules T/NK intestinal primitif avec des caractéristiques pathologiques d’une entéropathie sans association à une maladie cœliaque.\n\nPatient et observation\nUn homme âgé de 43 ans, sans notion de maladie de malabsorption ou de maladie cœliaque diagnostiquées auparavant, admis au service d’Hématologie pour une symptomatologie qui semble remonter à 7 mois par l’installation de douleurs abdominales, de diarrhées glairosanglantes, associées à une fièvre, sueurs et à un amaigrissement chiffré à 18 kg en 2 mois. L’examen physique retrouvait un patient avec un ECOG PS à 2, un abdomen sensible sans masse palpable et un toucher rectal qui retrouvait des stigmates de rectorragies. La TDM abdominale a montré un processus du colon transverse mesurant 6 cm de hauteur avec une carcinose péritonéale localisée et présence d’adénopathies locorégionales (Figure 1). La colonoscopie avait montré une masse bourgeonnante irrégulière, hautement suspecte de malignité au niveau du colon transverse. La biopsie colique avait montré un LNH T/NK colique CD3+ cytoplasmique, CD4+, CD8+, CD56+, Granzyme B+, EBV+ (Figure 2, Figure 3, Figure 4, Figure 5). Le bilan d’extension incluant une TDM cervico-thoraco-abdomino-pelvienne n’avait pas montré de localisations en dehors de la masse colique; la biopsie ostéo-médullaire n’a pas montré d’infiltration lymphomateuse; le taux de LDH était normal; les sérologies de l’EBV ont montré une immunisation antérieure avec une positivité des IgG et une négativité des IgM. L’examen ORL ainsi que les scanners cérébral et facial étaient normaux. La recherche d’une entéropathie notamment la recherche des anticorps anti-gliadines et anti-endomysium type IgA et IgG s’est révélée négative, et la biopsie colique a montré un aspect de rectite inflammatoire sans arguments suffisants pour évoquer une entéropathie. Le bilan pré-thérapeutique notamment l’échocardiographie n’a pas montré d’anomalies. Le patient a été classé Stade IIE selon la classification Ann Arbor avec un International Pronostic Index (IPI) à 0. Sur le plan thérapeutique, le patient a reçu 3 cycles (AspaMetDex) (J1-J21) avec Méthotrexate à 3g/m2 (J1)-Dexaméthasone 40 mg/j (J1-J4)- L-asparaginase 6000 UI/m2 (J2, J4, J6, J8). Durant le traitement, le patient a développé un diabète cortico-induit pour lequel il a été mis sous insulinothérapie et une toxicité hématologique et muqueuse grade IV secondaire au Méthotrexate. Sur le plan clinique, le patient gardait toujours les douleurs abdominales avec une légère régression des diarrhées glairo-sanglantes. Le scanner abdominal réalisé à 2 cures de chimiothérapie a montré un aspect stable de la lésion colique et la biopsie colique a montré le LNH T/NK colique déjà diagnostiqué. L’évolution a été marquée par la survenue du décès dans le tableau d’un abdomen aigu probablement secondaire à une perforation au 10ème jour de la 3ème cure de chimiothérapie.\n\nFigure 1 Épaississement pariétal circonférenciel irrégulier du colon transverse, étendu sur 6 cm de hauteur, avec infiltration nodulaire et en flammèche de la graisse mésocolique. Il s’y associe la présence d’adénopathies péricoliques transverses\n\nFigure 2 Biopsie colique colorée à l’hématoxyline- éosine: A (*100) Revêtement partiellement ulcéré, infiltrat lymphoïde diffus. B (*400) Infiltrat lymphoïde fait de cellules atypiques de taille moyenne à grande à noyaux irréguliers hyperchromatiques\n\nFigure 3 Immunohistochimie par l’anticorps antiCD3: C (*100) D (*400): Marquage cytoplasmique diffus et intense\n\nFigure 4 Immunohistochimie par le CD56: E (*100) F (*400): Marquage membranaire des cellules atypiques\n\nFigure 5 Immunohistochimie par l’anticorps anti Granzyme B: Marquage cytoplasmique G (*100) H (*400)\n\nDiscussion\nLes lymphomes intestinaux à cellules T et à cellules NK représente 5.2 à 14.7% de l’ensemble des lymphomes primitifs du tractus gastro-intestinal [10, 11]. Cette entité inclus le lymphome à cellules T associé à une entéropathie (EATL), le lymphome anaplasique à grandes cellules (ALCL), le lymphome à cellules T/NK extra-nodal (ENTCL) et le lymphome à cellules T périphérique (NOS) [12]. Le lymphome à cellules T/NK extra-nodal (ENTCL) est prédominant en Asie et en Amérique centrale et du Sud et atteint surtout les sujets jeunes avec un pic de morbidité à l’âge de 31-40 ans comme ce qui est le cas de notre patient avec un pronostic souvent pauvre [4], alors que sa prévalence reste relativement faible en Europe et en Amérique du Nord et survient chez les sujets plus âgés [9]. La présentation clinique chez notre patient était compatible avec ceux rapportés dans la littérature [13, 14]. Les symptômes révélateurs peuvent être subdivisés en signes secondaires au processus tumoral (douleur abdominale, diarrhée, occlusion intestinale), à la destruction tissulaire (perforation intestinale, péritonite et rectorragies) et en signes généraux (fièvre et amaigrissement).La colonoscopie chez notre patient a montré une masse bourgeonnante irrégulière au niveau du colon transverse, dans une étude chinoise sur 25 cas, 16 patients avaient une localisation colique et 4 patients avaient des masses tumorales [15]. En raison de la disparité des observations cliniques et endoscopiques des lymphomes intestinaux primitifs à cellules T/NK, la distinction entre les troubles inflammatoires, infectieux, granulomateux et lymphomateux restent difficile. Le diagnostic histologique de cette entité peut être confondu avec un désordre inflammatoire ou infectieux. Par conséquent, une forte suspicion clinique de malignité avec une histologie négative ne doit écarter le diagnostic et d’autres biopsies répétées et profondes sont fortement recommandées au cours du traitement et du suivi, et dans le cas échéant une laparotomie exploratrice qui peut être indiquée dans les diagnostics précoces. L’immunohistochimie a retrouvé l’expression des antigènes CD3+ cytoplasmique, CD56+, Granzyme B+, EBV+, ce phénotype concorde avec les données de la littérature [16]. Une étude a reporté que les patients ayant le statut EBV négatif avaient une survie globale un peu plus longue que ceux EBV positif, ce qui indique que l’infection à l’EBV peut être considéré comme un facteur pronostique négatif indépendant dans les lymphomes à cellules T/NK [17], deux autres études ont démontré dans le même sens que l’infection à l’EBV peut être supposée comme un facteur de risque de déclenchement de la genèse tumorale [18, 19]. Les données du suivi de la série de Zheng et al, ont indiqué que le lymphome primitif à cellules T/NK avait un pronostic péjoratif avec une survie médiane de 7 mois, 64% des patients ont été diagnostiqués à un stade avancé et 60% des patients avaient une altération des capacités de vie par le lymphome avant le traitement [15]. Chez notre patient, le lymphome était localisé avec un IPI à 0 mais le patient est décédé après 5 mois de la date du diagnostic, ce qui suggère l’existence d’autres facteurs de risque indépendants de l’IPI dans ce type de lymphome. Une étude japonaise sur 30 cas a suggéré que la morphologie cellulaire ainsi que l’invasion angiocentrique peuvent avoir une conséquence sur le pronostic du lymphome intestinal primitif à cellules T/NK [19]. Dans notre cas, le patient a reçu des cycles (AspaMetDex) en première ligne avec un échec à 3 cycles du fait de la toxicité importante du protocole SMILE (Dexaméthasone, Méthotrexate, Ifosfamide, L-asparaginase, Etoposide) et de la précarité de son état général. Un essai clinique phase II chez 19 patients avec un lymphome à cellules T/NK type nasal en rechute ou réfractaire ont reçu le protocole (AspaMetDex) avec une rémission complète à 61% et une rechute chez 4 patients, la survie globale médiane était estimée à 1 an avec une durée médiane de réponse à 12 mois [20].\n\nConclusion\nLe lymphome T/NK intestinal primitif atteint le plus souvent les sujets jeunes avec pronostic péjoratif. En raison des caractères cliniques et endoscopiques non spécifiques, il est difficile de distinguer entre un lymphome T/NK intestinal et les troubles intestinaux inflammatoires ou infectieuses. L’histopathologie, l’immunohistochimie et l’étude de l’ADN jouent un rôle clé dans le diagnostic différentiel et permet de classer le lymphome selon l’EuropeanEnteropathy-Type Intestinal T-CellLymphoma (ETL).\n\nConflits d’intérêts\nLes auteurs ne déclarent aucun conflit d’intérêt.\n\nContributions des auteurs\nTous les auteurs ont lu et approuvé la version finale du manuscrit.\n==== Refs\nRéférences\n1 Au WY Weisenburger DD Intragumtornchai T Nakamura S Kim WS Sng I Vose J Armitage JO Liang R International Peripheral T-CellLymphoma Project: clinical differences between nasal and extranasalnatural killer/Tcell lymphoma: A study of 136 cases from the international peripheral T-cell lymphoma project Blood. 2009 4 23 113 17 3931 7 19029440 \n2 Anderson JR Armitage JO Weisenburger DD Epidemiology of the non-Hodgkin’s lymphomas: distributions of the major subtypes differ by geographic locations - Non-Hodgkin’s Lymphoma Classification Project Ann Oncol. 1998 7 9 7 717 20 9739436 \n3 Chuang SS Lin CN Li CY Malignant lymphoma in southern Taiwan according to the revised European American classification of lymphoid neoplasms Cancer. 2000 10 1 89 7 1586 92 11013375 \n4 Lymphoma Study Group of Japanese Pathologists The World Health Organization classification of malignant lymphomas in Japan: incidence of recently recognized entities Pathol Int. 2000 9 50 9 696 702 11012982 \n5 Vivier E Tomasello E Baratin M Walzer T Ugolini S Functions of natural killer cells Nat Immunol. 2008 5 9 5 503 10 18425107 \n6 Campo E Swerdlow SH Harris NL Pileri S Stein H Jaffe E WHO classification of Tumors of Haematopoietic and Lymphoid Tissues Blood. 2011 117 19 5019 5032 21300984 \n7 Bagdi E Diss TC Munson P Isaacson PG Mucosal intra-epithelial lymphocytes in enteropathy-associated T-cell lymphoma, ulcerative jejunitis, and refractory celiac disease constitute a neoplastic population Blood. 1999 94 260 264 10381521 \n8 Arnulf B Copie-Bergman C Delfau-Larue MH Lavergne-Slove A Bosq J Wechsler J Wassef M Matuchansky C Epardeau B Stern M Bagot M Reyes F Gaulard P Nonhepatosplenic gamma-delta Tcell lymphoma: a subset of cytotoxic lymphomas with mucosal or skin localization Blood. 1998 91 1723 1731 9473239 \n9 Chott A Haedicke W Mosberger I Födinger M Winkler K Mannhalter C Müller-Hermelink HK Most CD56+ intestinal lymphomas are CD8 + CD5-T-cell lymphomas of monomorphic small to medium size histology Am J Pathol. 1998 11 153 5 1483 90 9811340 \n10 Nakamura S Matsumoto T Iida M Yao T Tsuneyoshi M Primary gastrointestinal lymphoma in Japan: A clinicopathologic analysis of455 patients with special reference to its time trends Cancer. 2003 5 15 97 10 2462 73 12733145 \n11 Chott A Dragoscic B Radaszkiewicz T Peripheral T-cell lymphoma of the intestine Am J Pathol. 1992 12 141 6 1361 71 1466400 \n12 Feller AC Diebold J Feller AC Diebold J Extranodal lymphoma Histopathology of Nodal and Extranodal Non-Hodgkin‘s Lymphomas. 2004 Berlin; Germany Springer 205 213 \n13 Zhang WY Li GD Liu WP Ouyang Q Ren XC Li FY Xu H Features of intestinal T-cell lymphomas in Chinese population without evidence of celiac disease and their close association with Epstein-Barr virus infection Chin Med J (Engl). 2005 118 1542 1548 16232331 \n14 Tung CL Hsieh PP Chang JH Chang JH Chen RS Chen YJ Wang JS Intestinal T-cell and natural killer-cell lymphomas in Taiwan with special emphasis on 2 distinct cellular types: Natural killer-like cytotoxic T cell and true natural killer cell Human Pathology. 2008 7 39 7 1018 25 18482744 \n15 Shumei Z Qin O Gandi L Hui X Mingde J Dejun C Linyun X Jinnan L Primary intestinal NK/T Cell Lymphoma: a clinicopathologic study of 25 chinese cases Arch Iran Med. 2012 15 1 36 42 22208442 \n16 Takenaka K Shinagawa K Maeda Y Makita M Kozuka T Ashiba A Yamamoto K Fujii N Nawa Y Hiramatsu Y Sunami K Ishimaru F Yoshimo T Kiura K Harada M High- dose chemotherapy with hematopoietic stem cell transplantation is effective for nasal-type CD56+ natural killer cell lymphoma Leuk Lymphoma. 2001 Nov-Dec 42 6 1297 303 11911411 \n17 Ko YH Cho EY Kim JE Lee SS Huh JR Chang HK Yang WI Kim CW Kim SW Ree HJ NK and NK-like T-cell lymphoma in extranasal sites: a comparative clinicopathological study according to site and EBV status Histopathology. 2004 5 44 5 480 9 15139996 \n18 Yang QP Zhang WY Yu JB Zhao S Xu H Wang WY Bi CF Zuo Z Wang XQ Huang J Dai L Liu WP Subtype distribution of lymphomas in Southwest China: analysis of 6,382 cases using WHO classification in a single institution Diagn Pathol. 2011 8 22 6 77 21854649 \n19 Kanemitsu N Isobe Y Masuda A Momose S Higashi M Tamaru J Sugimoto K Komatsu N Expression of Epstein-Barr virus-encoded proteins in extranodal NK/T-cell lymphoma, nasal type (ENKL):differences in biologic and clinical behaviors of LMP1-positive and –negative ENKL Clin Cancer Res. 2012 4 15 18 8 2164 72 22371452 \n20 Jaccard A Gachard N Marin B Rogez S Audrain M Suarez F Tilly H Morschhauser F Thieblemont C Ysebaert L Devidas A Petit B de Leval L Gaulard P Feuillard J Bordessoule D Hermine O GELA and GOELAMS Intergroup - Efficacy of L- asparaginase with methotrexate and dexamethasone (AspaMetDex regimen) in patients with refractory or relapsing extranodal NK/T-cell lymphoma, a phase 2 study Blood. 2011 2 10 117 6 1834 9 21123825\n\n",
"fulltext_license": "CC BY",
"issn_linking": null,
"issue": "26()",
"journal": "The Pan African medical journal",
"keywords": "T/NK lymphoma; colic; enteropathy; extra-nasal",
"medline_ta": "Pan Afr Med J",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D001215:Asparaginase; D003110:Colonic Neoplasms; D003907:Dexamethasone; D006801:Humans; D054391:Lymphoma, Extranodal NK-T-Cell; D008297:Male; D008727:Methotrexate; D011379:Prognosis",
"nlm_unique_id": "101517926",
"other_id": null,
"pages": "112",
"pmc": null,
"pmid": "28533835",
"pubdate": "2017",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "1466400;22371452;18482744;9811340;21854649;22208442;21123825;9739436;15139996;12733145;11911411;18425107;11012982;19029440;11013375;16232331;21300984;9473239;10381521",
"title": "Primary colonic extranasal NK/T-cell lymphoma: about a case.",
"title_normalized": "primary colonic extranasal nk t cell lymphoma about a case"
} | [
{
"companynumb": "MA-BAUSCH-BL-2017-022828",
"fulfillexpeditecriteria": "1",
"occurcountry": "MA",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHOTREXATE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nSusac's Syndrome (SS) consists of the triad of encephalopathy, branch retinal artery occlusions (BRAO) and hearing loss (HL). Histopathologically, SS is characterised by a microangiopathy, and some observations suggest that an immune-mediated damage of endothelial cells might play a role. These findings also implicate a similarity between SS and other autoimmune diseases, most notably juvenile dermatomyositis (JDM). However, SS and JDM are commonly thought to affect distinct and non-overlapping sets of organs, and it is currently not clear how these specificities arise. Moreover, in the absence of clinical trials, some authors suggest that therapeutic approaches in SS should rely on the model of other autoimmune diseases such as JDM.\n\n\nMETHODS\nHere, we report a case of SS in a 32-year-old pregnant woman. She initially was admitted to the hospital with subacute severe encephalopathy and multifocal neurologic signs. As cranial magnetic resonance imaging (MRI) revealed multifocal white matter lesions including the corpus callosum, erroneously a diagnosis of multiple sclerosis (MS) was made, and intravenous methylprednisolone (IVMP) therapy was initiated. A few days later, an exanthema appeared on the trunk and extremities, which was diagnosed as livedo racemosa (LR). Several weeks later, the patient was readmitted to the clinic with an obscuration of her left visual hemifield and a bilateral HL. Ophthalmologic examination revealed extensive ischemic damage to both retinae. Now the correct diagnosis of SS was established, based on the above triad of clinical symptoms in conjunction with typical MRI and fundoscopic findings. When SS was diagnosed, the standard therapy with intravenous cyclophosphamide (IVCTX) was not instituted because of a significant risk of permanent infertility. Instead, sustained control of disease activity could be achieved with a therapeutic regime combining prednisolone, intravenous immunoglobulins (IVIG), mycophenylate mofetil (MM), and methotrexate (MTX).\n\n\nCONCLUSIONS\nAn association with LR has only been described in very few cases of SS before and further underlines the pathogenetic relationship between SS and other autoimmune diseases such as JDM. In young women with SS and the desire for a child the combination of MM and MTX may represent a reasonable alternative to IVCTX.",
"affiliations": "Department of Neurology and Hertie Institute for Clinical Brain Research, Hoppe-Seyler-Str, 3, 72076 Tübingen, Germany. maik.engeholm@uni-tuebingen.de.",
"authors": "Engeholm|Maik|M|;Leo-Kottler|Beate|B|;Rempp|Hansjörg|H|;Lindig|Tobias|T|;Lerche|Holger|H|;Kleffner|Ilka|I|;Henes|Melanie|M|;Dihné|Marcel|M|",
"chemical_list": "D000893:Anti-Inflammatory Agents; D007166:Immunosuppressive Agents; D003520:Cyclophosphamide; D008775:Methylprednisolone",
"country": "England",
"delete": false,
"doi": "10.1186/1471-2377-13-185",
"fulltext": "\n==== Front\nBMC NeurolBMC NeurolBMC Neurology1471-2377BioMed Central 1471-2377-13-1852427474110.1186/1471-2377-13-185Case ReportEncephalopathic Susac’s Syndrome associated with livedo racemosa in a young woman before the completion of family planning Engeholm Maik 1maik.engeholm@uni-tuebingen.deLeo-Kottler Beate 2beate.leo-kottler@med.uni-tuebingen.deRempp Hansjörg 3hansjoerg.rempp@med.uni-tuebingen.deLindig Tobias 4tobias.lindig@med.uni-tuebingen.deLerche Holger 1holger.lerche@uni-tuebingen.deKleffner Ilka 5kleffnil@uni-muenster.deHenes Melanie 6Melanie.Henes@med.uni-tuebingen.deDihné Marcel 1marcel.dihne@uni-tuebingen.de1 Department of Neurology and Hertie Institute for Clinical Brain Research, Hoppe-Seyler-Str. 3, 72076 Tübingen, Germany2 Center for Ophthalmology, Schleichstr. 12, 72076 Tübingen, Germany3 Department of Diagnostic and Interventional Radiology, Hoppe-Seyler-Str. 3, 72076 Tübingen, Germany4 Department of Diagnostic and Interventional Neuroradiology, Hoppe-Seyler-Str. 3, 72076 Tübingen, Germany5 Department of Neurology, Albert-Schweitzer-Campus 1, 48149 Münster, Germany6 Department of Gynecology and Obstetrics, Calwerstr. 7, 72076 Tübingen, Germany2013 25 11 2013 13 185 185 8 7 2013 20 11 2013 Copyright © 2013 Engeholm et al.; licensee BioMed Central Ltd.2013Engeholm et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background\nSusac’s Syndrome (SS) consists of the triad of encephalopathy, branch retinal artery occlusions (BRAO) and hearing loss (HL). Histopathologically, SS is characterised by a microangiopathy, and some observations suggest that an immune-mediated damage of endothelial cells might play a role. These findings also implicate a similarity between SS and other autoimmune diseases, most notably juvenile dermatomyositis (JDM). However, SS and JDM are commonly thought to affect distinct and non-overlapping sets of organs, and it is currently not clear how these specificities arise. Moreover, in the absence of clinical trials, some authors suggest that therapeutic approaches in SS should rely on the model of other autoimmune diseases such as JDM.\n\nCase presentation\nHere, we report a case of SS in a 32-year-old pregnant woman. She initially was admitted to the hospital with subacute severe encephalopathy and multifocal neurologic signs. As cranial magnetic resonance imaging (MRI) revealed multifocal white matter lesions including the corpus callosum, erroneously a diagnosis of multiple sclerosis (MS) was made, and intravenous methylprednisolone (IVMP) therapy was initiated. A few days later, an exanthema appeared on the trunk and extremities, which was diagnosed as livedo racemosa (LR). Several weeks later, the patient was readmitted to the clinic with an obscuration of her left visual hemifield and a bilateral HL. Ophthalmologic examination revealed extensive ischemic damage to both retinae. Now the correct diagnosis of SS was established, based on the above triad of clinical symptoms in conjunction with typical MRI and fundoscopic findings. When SS was diagnosed, the standard therapy with intravenous cyclophosphamide (IVCTX) was not instituted because of a significant risk of permanent infertility. Instead, sustained control of disease activity could be achieved with a therapeutic regime combining prednisolone, intravenous immunoglobulins (IVIG), mycophenylate mofetil (MM), and methotrexate (MTX).\n\nConclusions\nAn association with LR has only been described in very few cases of SS before and further underlines the pathogenetic relationship between SS and other autoimmune diseases such as JDM. In young women with SS and the desire for a child the combination of MM and MTX may represent a reasonable alternative to IVCTX.\n==== Body\nBackground\nSS consists of the triad of encephalopathy, BRAO and HL [1,2]. The clinical presentation is highly variable. In particular, any of the above symptoms can occur first and dominate the clinical picture [2-4]. Accordingly, it has been proposed to distinguish between an encephalopathic form of SS and a recurrent BRAO subset [5]. Between the two, the former is typically more severe and shows a monophasic clinical course over a period of usually no longer than two years, during which disease activity may fluctuate widely. In MRI SS is associated with a number of rather specific signs including snowball- and spoke-like lesions on sagittal images, which correspond to microinfarcts in the centre of the corpus callosum and are deemed pathognomonic of SS [5,6]. More recently, MRI at 7 Tesla has been shown to permit a better differentiation between white matter lesions in SS and those in MS [7].\n\nHistopathologically, SS is associated with a microangiopathy of the brain, retina and cochlea [1,3,4]. Although a detailed pathomechanism remains to be elucidated, antibody-mediated damage of endothelial cells is discussed as an important step. This includes the demonstration of activated complement components in the capillaries of SS brain biopsies [8,9]. Moreover, anti-endothelial cell antibodies (AECA) of the IgG variety have been described in the serum of patients with SS [9,10]. Although the exact specificity of these antibodies is still unknown, they have been shown to recognize a distinctive protein of 50 kDa in Western blotting which is not bound by AECA of other autoimmune diseases, including dermatomyositis (DM) [9]. More generally, the notion of an immunopathogenesis of SS is supported by the typical inflammatory constellation in cerebrospinal fluid (CSF) studies and the response to immunosuppressive treatment.\n\nIndeed, SS is in principle amenable to immunosuppressive therapy, although in some cases disease activity has proven difficult to control [8]. Due to the absence of clinical trials, therapeutic approaches are largely based on anecdotal reports and on models of other autoimmune diseases, most notably JDM. Therapeutic regimes usually rely on a combination of corticosteroids and IVIG over an extended period of time (minimum 6 months). In more severe cases, an additional immunosuppressive therapy is recommended, preferably in the form of IVCTX pulse therapy. The combination of MM and MTX is considered an alternative, but is usually reserved for cases with less threatening disease [8].\n\nHere, we report a case of SS that initially presented with acute encephalopathy and LR. This at first directed diagnostic considerations towards systemic lupus erythematosus (SLE) or a primary vasculitis syndrome, and the correct diagnosis of SS was established only several weeks later when the full clinical triad became manifest. Because of a risk of permanent infertility the standard immunosuppressive therapy with IVCTX was not given, but sustained control of disease activity was achieved with a combination of IVIG, MM and MTX. Our case illustrates that SS should always be considered as a differential diagnosis in a patient with acute encephalopathy, especially in the presence of additional skin manifestations, and that a therapeutic regime without CTX may be effective even in some patients with an aggressive course of the disease.\n\nCase presentation\nA 32-year-old woman of European descent was in week 32 of her first, uncomplicated pregnancy when a subtle change in personality including a neglect of her daily duties was noticed. One week later, while on a holiday in Austria, she developed an unsteadiness of gait and slurred speech and was admitted to the hospital. Clinical examination revealed dysarthria and a hemispasticity with positive Babinski sign on the left side. While neuropsychologically still adequate on the evening of admission, she became severely confused and disoriented overnight. She did not complain of headaches at any time. Cranial MRI showed multiple small T2-intense lesions in both supra- and infratentorial locations, some of which exhibited diffusion restriction. Several lesions were found in the corpus callosum. CSF examination demonstrated a mild lymphocytic pleocytosis (13 cells/ μl) and a markedly elevated protein concentration (1,800 mg/l) in the absence of oligoclonal bands. Otherwise, routine laboratory tests were normal. She delivered her child by emergency caesarean section and received antiviral therapy until negative results of virus PCR arrived. An extensive serological diagnostic did not yield evidence of viral, bacterial or protozoal infection. A diagnosis of MS was made, and a pulse of IVMP was given (5×500 mg). Several days after completion of IVMP therapy an exanthema appeared on the trunk and extremities, which was diagnosed as LR by a consultant dermatologist. A therapy with oral prednisolone was initiated, under which the exanthema resolved quickly and neurological symptoms improved gradually.\n\nDue to a misunderstanding, medication was not continued upon discharge from hospital. Two days later, having returned to Germany, the patient again became severely confused and apathetic and was admitted to our clinic. On neurological examination, she had an ataxic stance and gait, dysmetria, dysarthria and bilaterally hyperactive tendon reflexes. MRI demonstrated several small T2-intense lesions, some of which showed contrast enhancement and others diffusion restriction (Figure 1a-e). Some lesions were located in the centre of the corpus callosum or connected to its roof (Figure 1c). Overall, the corpus callosum appeared atrophic (Figure 1d). Since cerebral vasculitis was considered a differential diagnosis, a digital subtraction angiography was performed, but was unremarkable. Laboratory tests for anti-nuclear antibodies, anti-neutrophil cytoplasmic antibodies, anti-thyroid, anti-neuronal and paraneoplastic antibodies, viral hepatitis and human immunodeficiency virus were all negative. There was also no evidence of antiphospholipid antibodies, lupus anticoagulant or inherited thrombophilia. On admission, a bluish, net-like exanthema on the trunk and legs was noticed and diagnosed as LR. Biopsy conformation was attempted, but when a punch biopsy was performed two days after the start of another IVMP pulse (5×500 mg), the skin changes had almost vanished and the biopsy showed normal dermis. A therapy with oral prednisolone was re-initiated, and cognitive deficits and gait disorder gradually improved.\n\nFigure 1 MRI, DSA and funduscopic studies.a) Axial fluid-attenuated inversion recovery image showing multiple small white matter lesions. b) Diffusion-weighted image with multiple small lesions exhibiting diffusion restriction (arrows) and correspondingly decreased ADC values (not shown). c) Sagittal T2 image showing centrally located corpus callosum lesions (arrow) and one lesion with spoke-like morphology (tailed arrow). d) Near-median sagittal T2 image demonstrating atrophy of the corpus callosum. e) Contrast-enhanced T1 image with multiple small contrast-enhancing lesions (arrows). f) Large ischemic area in the lower half of the left retina (arrow) and smaller infarct in the top left quadrant (tailed arrow).\n\nSix weeks later (when prednisolone had been tapered to 40 mg/d) the patient was readmitted to our clinic. She reported a slow worsening of her gait over the past two weeks, and two days before admission she had noticed an obscuration in her left visual hemifield. Clinical examination revealed an additional proximal weakness of the right leg and bilateral hypacusis. Ophthalmologic examination demonstrated extensive ischemic damage to both retinae with corresponding visual field deficits (Figure 1f). Audiometry showed bilateral asymmetric low-frequency sensorineural hearing loss. At this point SS was diagnosed based on the presence of the clinical triad of encephalopathy, visual disturbances and hearing loss, in conjunction with typical MRI findings (snowball lesions, callosal atrophy), CSF and fundoscopic studies. Further ophthalmologic investigations such as fluoresceine angiography (FAG) and optical coherence tomography were nor performed at this stage.\n\nSS was diagnosed and immunosuppressive treatment initiated. This included another IVMP pulse (5×500 mg) followed by oral prednisolone (4 weeks 60 mg/d; 2 weeks 50 mg/d; 2 weeks 40 mg/d; 2 weeks 30 mg/d; 3 weeks 20 mg/d; 3 weeks 15 mg/d; 3 weeks 10 mg/d; 4 weeks 5 mg/d; 4 weeks 2.5 mg/d). IVIG were given at monthly intervals at a dose of 2 g/kg over five consecutive days for six months. In addition, a long-term therapy with MM (2000 mg/d) and MTX (15 mg weekly s.c.) was initiated. Under this regime no further relapse occurred. One year after disease onset the patient was well. Her gait and cognitive performance had markedly improved. MRI and FAG showed no evidence of disease activity.\n\nConclusions\nThe case presented here illustrates several important aspects of SS. To start with, skin involvement in terms of LR has only been described in very few out of more than 300 patients reported in the literature so far [1,11,12]. In most cases, similar to the one presented here, the exanthema quickly resolved under immunosuppressive therapy. In one case [11], skin biopsy showed signs of complement-mediated damage to endothelial cells in upper dermis capillaries, analogous to the histopathological changes in brain biopsies of SS [9]. In combination with the case presented here, these observations strongly suggest that LR can be part of SS, and that SS is an important differential diagnosis in an encephalopathic patient with skin involvement compatible with LR.\n\nThe spectrum of differential diagnosis of LR in neurological patients has been comprehensively reviewed by Kraemer et al. [13]. In addition to Sneddon’s syndrome, the authors mention neuropsychiatric SLE and antiphospholipid antibody syndrome. To distinguish SS from these differential diagnoses can be a challenge, especially if only encephalopathy is present. In our case, the typical findings on MRI could have given an indication of the correct diagnosis SS. Specifically, lesions located in the centre or the roof of the corpus callosum are considered specific for SS because they are not found in MS or Acute Disseminated Encephalomyelitis [5]. In addition, a reduced volume of the corpus callosum as well as meningeal contrast enhancement are more frequently encountered in SS than MS [5,7]. Although it is currently less clear how well other differential diagnoses such as SLE and CNS vasculitis can be distinguished from SS by these criteria, the above MRI findings should always prompt further diagnostic procedures including FAG, which frequently reveals subclinical involvement of the retina in SS, a finding that can strongly support the diagnosis [12].\n\nThe notion of skin involvement in SS is not only relevant for clinical purposes, but may also contribute to a better understanding of the relationship between SS and other autoimmune diseases. Similarities between SS and JDM have been emphasized by some authors [8]. Both syndromes are characterized by a widely fluctuating, largely unpredictable disease activity with either a monophasic or polycyclic clinical course. Moreover, in the pathogenesis of either disease, AECA have been described [9,10]. Traditionally, it was held that, despite these commonalities, in each disease the microvasculature of a distinct set of organs was affected (i.e. brain, retina and cochlea in SS versus skin, muscle and gastrointestinal tract in DM/JDM). However, several results suggest that such a strict organ specificity does not exist. On one hand, involvement of the brain or retina has been documented in rare cases of JDM [14,15]. On the other hand, in SS a histological involvement of skeletal muscle can be observed [3,4], and the case presented here in combination with the report by Turc et al. demonstrate a skin involvement with similar features as in DM. Altogether these findings further underline a pathogenetic relationship between SS and DM/JDM.\n\nThe case presented here further exemplifies a therapeutic dilemma that may be commonly encountered in SS. On one hand, in the case of threatening disease activity, prompt and sustained aggressive immunosupression is warranted to prevent severe sequelae such as dementia, vision loss and hearing loss. On the other hand, every long-term immunosuppressive therapy is likely to have significant adverse effects, and for this reason any unnecessarily aggressive treatment must be avoided. In the context of autoimmune disease, IVCTX pulse therapy causes premature ovarian failure in a relatively high proportion of premenopausal women, especially in those older than 30 years [16,17]. Various strategies of fertility preservation treatment have been evaluated, but all are associated with a significant residual risk of infertility. In contrast, immunosuppressive therapy with MM and MTX is not expected to have long-term adverse effects on fertility once therapy has been completed [18].\n\nGiven the overall severe clinical presentation in our patient, including a tendency to relapse when tapering prednisolone, most physicians would probably have started an IVCTX pulse therapy when the diagnosis of SS was eventually made. However, this was not wanted by the patient and her family, primarily because they intended to have further children. Instead, a long-term immunosuppressive therapy with MM and MTX was initiated, and at the same time an IVIG pulse therapy was newly started. Interestingly, from this point on the clinical course was much more benign, and even relatively quick tapering of prednisolone because of a severe Cushing’s syndrome was tolerated well. Although it is impossible to know whether this reflects the natural course of the disease or a therapeutic effect of MM/MTX and/or IVIG, our case suggests that even in patients with an initially threatening presentation of SS, disease activity can sometimes be controlled by immunosuppresive treatment that does not rely upon IVCTX. Given that SS often occurs in young women before the completion of family planning, the value of such treatment options should be systematically compared to the standard therapy including IVCTX.\n\nConsent\nWritten informed consent was obtained from the patient for publication of this Case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nAbbreviations\nAECA: Anti-endothelial cell antibodies; BRAO: Branch retinal artery occlusions; CSF: Cerebrospinal fluid; DM: Dermatomyositis; FAG: Fluoresceine angiography; HL: Hearing loss; IVCTX: Intravenous cyclophosphamide; IVIG: Intravenous immunoglobulins; IVMP: Intravenous methylprednisolone; JDM: Juvenile dermatomyositis; LR: Livedo racemosa; MM: Mycophenylate mofetil; MRI: Magnetic resonance imaging; MS: Multiple sclerosis; MTX: Methotrexate; SLE: Systemic lupus erythematosus; SS: Susac’s Syndrome.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\nME, HL, IK and MD saw the patient, diagnosed SS and conducted the immunosuppressive therapy; BLK performed the ophthalmologic examination; HR and TL performed neuroradiologic studies; and MH gave advise with respect to immunosuppressive therapy. ME and MD wrote the manuscript with contributions from all other authors. All authors read and approved the final version of the manuscript.\n\nPre-publication history\nThe pre-publication history for this paper can be accessed here:\n\nhttp://www.biomedcentral.com/1471-2377/13/185/prepub\n\nAcknowledgements\nThe authors would like to thank Ryan Timothy Price for proofreading an earlier version of the manuscript.\n==== Refs\nSusac JO Hardman JM Selhorst JB Microangiopathy of the brain and retina Neurology 1979 29 3 313 316 10.1212/WNL.29.3.313 571975 \nSusac JO Susac’s syndrome: the triad of microangiopathy of the brain and retina with hearing loss in young women Neurology 1994 44 4 591 593 10.1212/WNL.44.4.591 8164809 \nPetty GW Engel AG Younge BR Duffy J Yanagihara T Lucchinetti CF Bartleson JD Parisi JE Kasperbauer JL Rodriguez M Retinocochleocerebral vasculopathy Medicine (Baltimore) 1998 77 12 40 10.1097/00005792-199801000-00003 9465861 \nO’Halloran HS Pearson PA Lee WB Susac JO Berger JR Microangiopathy of the brain, retina, and cochlea (Susac syndrome). A report of five cases and a review of the literature Ophthalmology 1998 105 6 1038 1044 http://dx.doi.org/10.1016/S0161-6420(98)96005-5 10.1016/S0161-6420(98)96005-5 9627654 \nRennebohm R Susac JO Egan RA Daroff RB Susac’s syndrome–update J Neurol Sci 2010 299 1–2 86 91 http://dx.doi.org/10.1016/j.jns.2010.08.032 20855088 \nSusac JO Murtagh FR Egan RA Berger JR Bakshi R Lincoff N Gean AD Galetta SL Fox RJ Costello FE Lee AG Clark J Layzer RB Daroff RB MRI findings in Susac’s syndrome Neurology 2003 61 12 1783 1787 10.1212/01.WNL.0000103880.29693.48 14694047 \nWuerfel J Sinnecker T Ringelstein EB Jarius S Schwindt W Niendorf T Paul F Kleffner I Dörr J Lesion morphology at 7 Tesla MRI differentiates Susac syndrome from multiple sclerosis Mult Scler 2012 18 11 1592 1599 http://dx.doi.org/10.1177/1352458512441270 10.1177/1352458512441270 22711711 \nRennebohm RM Susac JO Treatment of Susac’s syndrome J Neurol Sci 2007 257 1–2 215 220 http://dx.doi.org/10.1016/j.jns.2007.01.031 17324441 \nMagro CM Poe JC Lubow M Susac JO Susac syndrome: an organ-specific autoimmune endotheliopathy syndrome associated with anti-endothelial cell antibodies Am J Clin Pathol 2011 136 6 903 912 http://dx.doi.org/10.1309/AJCPERI7LC4VNFYK 10.1309/AJCPERI7LC4VNFYK 22095376 \nJarius S Neumayer B Wandinger KP Hartmann M Wildemann B Anti-endothelial serum antibodies in a patient with Susac’s syndrome J Neurol Sci 2009 285 1–2 259 261 http://dx.doi.org/10.1016/j.jns.2009.07.002 19643446 \nTurc G Monnet D Dupin N Beuvon F Guiraud V Amor MB Touzé E Skin involvement in Susac’s syndrome J Neurol Sci 2011 305 1–2 152 155 http://dx.doi.org/10.1016/j.jns.2011.03.001 21440909 \nDörr J Krautwald S Wildemann B Jarius S Ringelstein M Duning T Aktas O Ringelstein EB Paul F Kleffner I Characteristics of Susac syndrome: a review of all reported cases Nat Rev Neurol 2013 9 6 307 316 http://dx.doi.org/10.1038/nrneurol.2013.82 10.1038/nrneurol.2013.82 23628737 \nKraemer M Linden D Berlit P The spectrum of differential diagnosis in neurological patients with livedo reticularis and livedo racemosa. A literature review J Neurol 2005 252 10 1155 1166 http://dx.doi.org/10.1007/s00415-005-0967-9 10.1007/s00415-005-0967-9 16133722 \nJimenez C Rowe PC Keene D Cardiac and central nervous system vasculitis in a child with dermatomyositis J Child Neurol 1994 9 3 297 300 10.1177/088307389400900315 7930410 \nElst EF Kamphuis SSM Prakken BJ Wulffraat NM van der Net J Peters ACB Kuis W Case report: severe central nervous system involvement in juvenile dermatomyositis J Rheumatol 2003 30 9 2059 2063 12966616 \nBoumpas DT Austin HA Vaughan EM Yarboro CH Klippel JH Balow JE Risk for sustained amenorrhea in patients with systemic lupus erythematosus receiving intermittent pulse cyclophosphamide therapy Ann Intern Med 1993 119 5 366 369 10.7326/0003-4819-119-5-199309010-00003 8338289 \nIoannidis JPA Katsifis GE Tzioufas AG Moutsopoulos HM Predictors of sustained amenorrhea from pulsed intravenous cyclophosphamide in premenopausal women with systemic lupus erythematosus J Rheumatol 2002 29 10 2129 2135 12375322 \nHenes M Henes JC Neunhoeffer E Wolff MV Schmalzing M Kötter I Lawrenz B Fertility preservation methods in young women with systemic lupus erythematosus prior to cytotoxic therapy: experiences from the FertiPROTEKT network Lupus 2012 21 9 953 958 http://dx.doi.org/10.1177/0961203312442753 10.1177/0961203312442753 22438026\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2377",
"issue": "13()",
"journal": "BMC neurology",
"keywords": null,
"medline_ta": "BMC Neurol",
"mesh_terms": "D000328:Adult; D000893:Anti-Inflammatory Agents; D001921:Brain; D003520:Cyclophosphamide; D005260:Female; D005654:Fundus Oculi; D006801:Humans; D007166:Immunosuppressive Agents; D054068:Livedo Reticularis; D008279:Magnetic Resonance Imaging; D008775:Methylprednisolone; D011247:Pregnancy; D011856:Radiographic Image Enhancement; D055955:Susac Syndrome",
"nlm_unique_id": "100968555",
"other_id": null,
"pages": "185",
"pmc": null,
"pmid": "24274741",
"pubdate": "2013-11-25",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "8164809;9465861;12375322;16133722;22095376;12966616;22438026;8338289;23628737;21440909;20855088;19643446;17324441;14694047;7930410;571975;22711711;9627654",
"title": "Encephalopathic Susac's Syndrome associated with livedo racemosa in a young woman before the completion of family planning.",
"title_normalized": "encephalopathic susac s syndrome associated with livedo racemosa in a young woman before the completion of family planning"
} | [
{
"companynumb": "DE-MYLANLABS-2021M1064309",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "HUMAN IMMUNOGLOBULIN G"
},
"drugadditional": ... |
{
"abstract": "Background: Enoxaparin is not recommended for venous thromboembolism (VTE) prophylaxis in the end-stage renal disease (ESRD) on hemodialysis (HD) population due to concerns for drug accumulation and increased bleeding risk. Due to the paucity of literature with clinical outcomes to support this theoretical safety concern, the purpose of this study was to compare the risks of bleeding of enoxaparin and unfractionated heparin (UFH) in hospitalized, HD-dependent patients. Methods: This retrospective cohort study examined ESRD on HD patients who received either subcutaneous enoxaparin or UFH for VTE prophylaxis and were admitted for at least 48 hours. The primary outcome was major bleeding or clinically relevant non-major bleeding (CRNMB) as guided by definitions from the International Society of Thrombosis and Haemostasis. Results: A total of 322 enoxaparin and 10 UFH patients were analyzed. All enoxaparin patients were dosed 30 mg subcutaneous daily. Twenty-two (6.8%) enoxaparin and zero UFH patients experienced major or CRNMB (P = .498). Three enoxaparin patients suffered fatal hemorrhages. Multiple logistic regression demonstrated thrombocytopenia was associated with bleeding (odds ratio 4.23, P = .004). Conclusion: The difference in major or CRNMB rates between both anticoagulants was not statistically significant. However, the 6.8% bleed rate is concerning for inpatient enoxaparin usage, and caution should be applied when considering this drug for VTE prophylaxis in the ESRD on HD population.",
"affiliations": "Broward Health Medical Center, Fort Lauderdale, FL, USA.;Broward Health Medical Center, Fort Lauderdale, FL, USA.",
"authors": "Sacks|Jamie|J|;Luc|Stanley A|SA|https://orcid.org/0000-0002-1294-7985",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/0018578720954151",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0018-5787",
"issue": "56(6)",
"journal": "Hospital pharmacy",
"keywords": "anticoagulants; medication safety; nephrology",
"medline_ta": "Hosp Pharm",
"mesh_terms": null,
"nlm_unique_id": "0043175",
"other_id": null,
"pages": "718-724",
"pmc": null,
"pmid": "34732929",
"pubdate": "2021-12",
"publication_types": "D016428:Journal Article",
"references": "29276299;19878532;24718051;26764429;9684701;19996401;23677243;21232002;21627788;29856817;15985543;14671052;28592259;30354950",
"title": "Evaluation of Enoxaparin for Inpatient Venous Thromboembolism Prophylaxis in End-Stage Renal Disease Patients on Hemodialysis.",
"title_normalized": "evaluation of enoxaparin for inpatient venous thromboembolism prophylaxis in end stage renal disease patients on hemodialysis"
} | [
{
"companynumb": "US-BAYER-2022A033021",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ASPIRIN"
},
"drugadditional": null,
"dr... |
{
"abstract": "We present the case of an 18-year-old woman who suffered from complications of Ehlers-Danlos syndrome (EDS). Her pain was poorly controlled despite being on a myriad of analgesic medications at the time. On initiating cannabinoid-based treatment, her pain was drastically reduced, immediately enhancing the patient's quality of life. As the patient continued to self-administer, she was able to eliminate her opioid requirement. Considering the recent legalisation, we underline the need for physicians to be educated regarding the use of cannabinoids. In this case, specifically for chronic pain stemming from hypermobile EDS. Furthermore, we review the various impediments preventing ease of access to this potentially beneficial treatment.",
"affiliations": "University College London Medical School, London, UK zchaarx@ucl.ac.uk.",
"authors": "Dar|Sabeera|S|http://orcid.org/0000-0002-5557-180X",
"chemical_list": "D000700:Analgesics; D064086:Medical Marijuana",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2021-242568",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "14(7)",
"journal": "BMJ case reports",
"keywords": "connective tissue disease; disability; health economics; musculoskeletal syndromes; physiotherapy (rehabilitation)",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000293:Adolescent; D000700:Analgesics; D059350:Chronic Pain; D004535:Ehlers-Danlos Syndrome; D005260:Female; D006801:Humans; D064086:Medical Marijuana; D011788:Quality of Life",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34301703",
"pubdate": "2021-07-22",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Treating pain related to Ehlers-Danlos syndrome with medical cannabis.",
"title_normalized": "treating pain related to ehlers danlos syndrome with medical cannabis"
} | [
{
"companynumb": "GB-MYLANLABS-2022M1032473",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FENTANYL"
},
"drugadditional": "3",
... |
{
"abstract": "Some studies have shown that a high neutrophil/lymphocyte ratio (NLR) ≥4 before initiating ipilimumab treatment is an independent prognostic indicator of poor survival in patients with metastatic melanoma (MM). To determine whether the NLR before starting BRAF inhibitor (BRAFi) treatment in patients with (MM) is associated with progression-free survival (PFS). This retrospective study included 49 patients consecutively receiving BRAFi for MM between July 2012 and December 2014. Cox proportional hazards regression was used to analyse the relationship between NLR and other factors, such as lactate dehydrogenase (LDH), performance status, BRAFi as first- or second-line therapy, and corticosteroid intake with PFS. The NLR before starting BRAFi was significantly associated with PFS based on univariate analysis and multivariate analysis adjusted for potential confounding factors, such as LDH activity, ulceration, performance status, first-line therapy, and corticosteroid intake. A high NLR (continuous variable) was associated with short PFS (HR: 1.35; 95% CI: 1.07-1.70; p = 0.01), and NLR ≥4 was associated with shorter PFS (HR: 3.24; 95% CI: 1.30-8.12; p = 0.01). Corticosteroid intake was not associated with short PFS based on multivariate analysis. An NLR >4, before starting BRAFi treatment, is an independent prognostic indicator of poor progression-free survival.",
"affiliations": "Department of Dermatology, CHRU, Tours, France.;Department of Dermatology, CHRU, Tours, France, PRES Centre, Val de Loire University, University Francois Rabelais de Tours, Tours, France.;Department of Dermatology, CHR Le Mans, France.;Department of Dermatology, CHR Le Mans, France.;Department of Dermatology, CHR Orléans, France.;Department of Dermatology, CHRU, Tours, France, PRES Centre, Val de Loire University, University Francois Rabelais de Tours, Tours, France.;PRES Centre, Val de Loire University, University Francois Rabelais de Tours, Tours, France, INSERM CIC 1415, CHRU Tours, France.;Department of Dermatology, CHRU, Tours, France, PRES Centre, Val de Loire University, University Francois Rabelais de Tours, Tours, France, Inserm U 930, University Francois Rabelais, Tours, France.",
"authors": "Finon|Antoine|A|;Zaragoza|Julia|J|;Maillard|Hervé|H|;Beneton|Nathalie|N|;Bens|Guido|G|;Samimi|Mahtab|M|;Caille|Agnès|A|;Machet|Laurent|L|",
"chemical_list": "D000970:Antineoplastic Agents; D004791:Enzyme Inhibitors; D007093:Imidazoles; D007211:Indoles; D010091:Oximes; D013449:Sulfonamides; D000077484:Vemurafenib; C482119:BRAF protein, human; D048493:Proto-Oncogene Proteins B-raf; C561627:dabrafenib",
"country": "France",
"delete": false,
"doi": "10.1684/ejd.2017.3167",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1167-1122",
"issue": "28(1)",
"journal": "European journal of dermatology : EJD",
"keywords": "BRAF; corticosteroid; melanoma; neutrophil/lymphocyte ratio; prognostic factor; progression-free survival",
"medline_ta": "Eur J Dermatol",
"mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D018572:Disease-Free Survival; D004791:Enzyme Inhibitors; D005260:Female; D006801:Humans; D007093:Imidazoles; D007211:Indoles; D007958:Leukocyte Count; D018655:Lymphocyte Count; D008214:Lymphocytes; D008297:Male; D008545:Melanoma; D008875:Middle Aged; D009504:Neutrophils; D010091:Oximes; D011379:Prognosis; D048493:Proto-Oncogene Proteins B-raf; D012189:Retrospective Studies; D013449:Sulfonamides; D000077484:Vemurafenib",
"nlm_unique_id": "9206420",
"other_id": null,
"pages": "38-43",
"pmc": null,
"pmid": "29336315",
"pubdate": "2018-02-01",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study",
"references": null,
"title": "A high neutrophil to lymphocyte ratio prior to BRAF inhibitor treatment is a predictor of poor progression-free survival in patients with metastatic melanoma.",
"title_normalized": "a high neutrophil to lymphocyte ratio prior to braf inhibitor treatment is a predictor of poor progression free survival in patients with metastatic melanoma"
} | [
{
"companynumb": "FR-ROCHE-2117981",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "VEMURAFENIB"
},
"drugadditional": "3",
"drug... |
{
"abstract": "OBJECTIVE\nTo compare the efficacy, safety, and tolerability of 6 dosages of oral tofacitinib (CP-690,550) with placebo for the treatment of active rheumatoid arthritis (RA) in patients receiving a stable background regimen of methotrexate (MTX) who have an inadequate response to MTX monotherapy.\n\n\nMETHODS\nIn this 24-week, double-blind, phase IIb study, patients with active RA (n = 507) were randomized to receive placebo or tofacitinib (20 mg/day, 1 mg twice daily, 3 mg twice daily, 5 mg twice daily, 10 mg twice daily, or 15 mg twice daily). All patients continued to receive a stable dosage of MTX. The primary end point was the American College of Rheumatology 20% improvement criteria (ACR20) response rate at week 12.\n\n\nRESULTS\nAt week 12, ACR20 response rates for patients receiving all tofacitinib dosages ≥3 mg twice daily (52.9% for 3 mg twice daily, 50.7% for 5 mg twice daily, 58.1% for 10 mg twice daily, 56.0% for 15 mg twice daily, and 53.8% for 20 mg/day) were significantly (P ≤ 0.05) greater than those for placebo (33.3%). Improvements were sustained at week 24 for the ACR20, ACR50, and ACR70 responses, scores for the Health Assessment Questionnaire disability index, the 3-variable Disease Activity Score in 28 joints using the C-reactive protein level (DAS28-CRP), and a 3-variable DAS28-CRP of <2.6. The most common treatment-emergent adverse events occurring in >10% of patients in any tofacitinib group were diarrhea, upper respiratory tract infection, and headache; 21 patients (4.1%) experienced serious adverse events. Sporadic increases in transaminase levels, increases in cholesterol and serum creatinine levels, and decreases in neutrophil and hemoglobin levels were observed.\n\n\nCONCLUSIONS\nIn patients with active RA in whom the response to MTX has been inadequate, the addition of tofacitinib at a dosage ≥3 mg twice daily showed sustained efficacy and a manageable safety profile over 24 weeks.",
"affiliations": "Albany Medical College, Albany, New York 12206, USA. jkremer@joint-docs.com",
"authors": "Kremer|Joel M|JM|;Cohen|Stanley|S|;Wilkinson|Bethanie E|BE|;Connell|Carol A|CA|;French|Jonathan L|JL|;Gomez-Reino|Juan|J|;Gruben|David|D|;Kanik|Keith S|KS|;Krishnaswami|Sriram|S|;Pascual-Ramos|Virginia|V|;Wallenstein|Gene|G|;Zwillich|Samuel H|SH|",
"chemical_list": "D018501:Antirheumatic Agents; D010880:Piperidines; D011743:Pyrimidines; D011758:Pyrroles; C479163:tofacitinib; D008727:Methotrexate",
"country": "United States",
"delete": false,
"doi": "10.1002/art.33419",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0004-3591",
"issue": "64(4)",
"journal": "Arthritis and rheumatism",
"keywords": null,
"medline_ta": "Arthritis Rheum",
"mesh_terms": "D000328:Adult; D000368:Aged; D018501:Antirheumatic Agents; D001172:Arthritis, Rheumatoid; D004305:Dose-Response Relationship, Drug; D004311:Double-Blind Method; D004359:Drug Therapy, Combination; D005260:Female; D006801:Humans; D008297:Male; D008727:Methotrexate; D008875:Middle Aged; D010880:Piperidines; D011743:Pyrimidines; D011758:Pyrroles; D016896:Treatment Outcome",
"nlm_unique_id": "0370605",
"other_id": null,
"pages": "970-81",
"pmc": null,
"pmid": "22006202",
"pubdate": "2012-04",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "A phase IIb dose-ranging study of the oral JAK inhibitor tofacitinib (CP-690,550) versus placebo in combination with background methotrexate in patients with active rheumatoid arthritis and an inadequate response to methotrexate alone.",
"title_normalized": "a phase iib dose ranging study of the oral jak inhibitor tofacitinib cp 690 550 versus placebo in combination with background methotrexate in patients with active rheumatoid arthritis and an inadequate response to methotrexate alone"
} | [
{
"companynumb": "BG-PFIZER INC-2008029097",
"fulfillexpeditecriteria": "1",
"occurcountry": "BG",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "FOLIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "To review the pathophysiology of rhabdomyomas and the emerging option of prenatal treatment of fetal cardiac rhabdomyomas.\n\n\n\nWe present a case of fetal rhabdomyomas causing significant hemodynamic compromise that received in utero treatment of maternal sirolimus. Genetic amniocentesis confirmed a TSC2 mutation. A treatment program was initiated with a 10-mg loading dose titrated to a goal maternal trough of 10 to 15 ng/dL. In order to follow fetal cardiac function, a sophisticated method of speckle tracking echocardiography was used before and after treatment. Obstetric ultrasound was used to monitor fetal growth, and clinical surveillance, echocardiography, and brain MRI were used to monitor postnatal growth and development through 6 months of neonatal life.\n\n\n\nSirolimus was initiated from 28 to 36 weeks of gestation with improvement of cardiac status. During this period, intrauterine growth restriction developed. Postnatally, the infant has had stable rhabdomyomas and cardiac function without reinitiating sirolimus. Brain MRI demonstrated scattered cortical tubers and subependymal nodules, and the infant has not had seizure-like activity. At 6 months of age, the infant has achieved appropriate developmental milestones.\n\n\n\nIn counseling cases of prenatal onset large obstructing rhabdomyomas and cardiac compromise, in utero sirolimus treatment can be considered.",
"affiliations": "Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.;Department of Pediatrics, UCLA, Mattel Children's Hospital, David Geffen School of Medicine at UCLA, Los Angeles, CA.;Division of Pediatric Neurology, Department of Pediatrics, University of California at Los Angeles, Los Angeles, CA.;Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.;Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.;Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.;Walden OBGYN, Los Angeles, CA.;Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.;Department of Obstetrics and Gynecology, University of California at Los Angeles, Los Angeles, CA.",
"authors": "Pluym|Ilina D|ID|0000-0003-4891-3354;Sklansky|Mark|M|;Wu|Joyce Y|JY|;Afshar|Yalda|Y|;Holliman|Kerry|K|;Devore|Greggory R|GR|0000-0001-8814-572X;Walden|Ayanna|A|;Platt|Lawrence D|LD|;Krakow|Deborah|D|0000-0001-9906-4968",
"chemical_list": "C000624653:TSC2 protein, human; D000077005:Tuberous Sclerosis Complex 2 Protein; C546842:MTOR protein, human; D058570:TOR Serine-Threonine Kinases; D020123:Sirolimus",
"country": "England",
"delete": false,
"doi": "10.1002/pd.5613",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0197-3851",
"issue": "40(3)",
"journal": "Prenatal diagnosis",
"keywords": null,
"medline_ta": "Prenat Diagn",
"mesh_terms": "D000328:Adult; D000649:Amniocentesis; D004452:Echocardiography; D005260:Female; D005820:Genetic Testing; D005865:Gestational Age; D006338:Heart Neoplasms; D006801:Humans; D009154:Mutation; D011247:Pregnancy; D011296:Prenatal Diagnosis; D012207:Rhabdomyoma; D020123:Sirolimus; D058570:TOR Serine-Threonine Kinases; D016896:Treatment Outcome; D000077005:Tuberous Sclerosis Complex 2 Protein",
"nlm_unique_id": "8106540",
"other_id": null,
"pages": "358-364",
"pmc": null,
"pmid": "31742705",
"pubdate": "2020-02",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Fetal cardiac rhabdomyomas treated with maternal sirolimus.",
"title_normalized": "fetal cardiac rhabdomyomas treated with maternal sirolimus"
} | [
{
"companynumb": "US-NVP-000039",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "SIROLIMUS"
},
"drugadditional": "1",
"drugadmin... |
{
"abstract": "Management of patients with relapsed or refractory (R/R) AL amyloidosis is complex. Some initial reports have shown positive results with daratumumab in heavily pre-treated AL amyloidosis patients. In this retrospective multicentric study, 38 patients (mean age 64 ± 9 years) with R/R AL amyloidosis treated with daratumumab were included. Cardiac and renal involvement was present in 76 and 74% of patients, and 42% had ≥3 organs involved. Median number of previous lines of therapy was 2 (range 1-8). Overall hematological response was 72%, including 28% complete responses. The median time to first hematological response was 2 weeks. A high-quality response (≥very good partial response) was obtained in 65% of patients who had never achieved such depth of response previously. Hematological responses were more frequent among patients receiving daratumumab as second-line therapy compared to subsequent therapies (92 vs. 61%). Cardiac and renal organ response rates were 37 and 59%. At 12 months, overall and progression-free survival were 59% (95%CI: 0.36-0.77) and 52% (95%CI: 0.29-0.70), respectively. Daratumumab is a safe and effective drug in the treatment of R/R AL amyloidosis and should be considered early in the course of the disease.",
"affiliations": "Hematology Department, Clínica Universidad de Navarra, Pamplona, Spain.;Hematology Department, Hospital Puerta de Hierro, Madrid, Spain.;Hematology Department, Hospital Universitario Fundación Jiménez Díaz, Madrid, Spain.;Hematology Department, Hospital Universitario Donostia, San Sebastián, Spain.;Hematology Department, Hospital Clínico Universitario de Santiago-CHUS, Santiago de Compostela, Spain.;Hematology Department, Complejo Asistencial Universitario de León, León, Spain.;Hematology Department, Hospital Universitario Quirón, Madrid, Spain.;Hematology Department, Clínica Universidad de Navarra, Pamplona, Spain.;Hematology Department, Hospital Clinic, Barcelona, Spain.;Hematology Department, Hospital Universitario La Princesa, Madrid, Spain.;Hematology Department, Hospital Universitario Vall d'Hebron, Barcelona, Spain.;Hematology Department, Hospital Universitario de Cabueñes, Gijón, Spain.;Hematology Department, Hospital Infanta Leonor, Madrid, Spain.;Hematology Department, Hospital Universitario de Canarias, Tenerife, Spain.;Hematology Department, Hospital Universitario Galdakao-Usansolo, Vizcaya, Spain.;Hematology Department, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain.;Hematology Department, Hospital Universitario Central de Asturias, Oviedo, Spain.;Hematology Department, Hospital Universitario Joan XXIII, Tarragona, Spain.;Hematology Department, Hospital Clinic, Barcelona, Spain.",
"authors": "Lecumberri|Ramón|R|http://orcid.org/0000-0002-8850-8866;Krsnik|Isabel|I|http://orcid.org/0000-0002-2912-5072;Askari|Elham|E|;Sirvent|Maialen|M|;González-Pérez|Marta S|MS|;Escalante|Fernando|F|;Pradillo|Virginia|V|;Tamariz|Luis E|LE|;Cánovas|Verónica|V|;Alegre|Adrián|A|;Gironella|Mercedes|M|;González-García|María E|ME|;Infante|María S|MS|;Lakhwani|Sunil|S|;Martínez-Bilbao|Cristina|C|;Dourdil|Victoria|V|;Ramírez-Payer|Ángel|Á|;Sarrá|José|J|;Cibeira|M Teresa|MT|http://orcid.org/0000-0002-4036-754X",
"chemical_list": "D000911:Antibodies, Monoclonal; C556306:daratumumab",
"country": "England",
"delete": false,
"doi": "10.1080/13506129.2020.1730791",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1350-6129",
"issue": "27(3)",
"journal": "Amyloid : the international journal of experimental and clinical investigation : the official journal of the International Society of Amyloidosis",
"keywords": "AL amyloidosis; daratumumab; outcome; refractory; relapsed",
"medline_ta": "Amyloid",
"mesh_terms": "D000368:Aged; D000911:Antibodies, Monoclonal; D019008:Drug Resistance, Neoplasm; D005260:Female; D006801:Humans; D000075363:Immunoglobulin Light-chain Amyloidosis; D008297:Male; D008875:Middle Aged; D000077982:Progression-Free Survival; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "9433802",
"other_id": null,
"pages": "163-167",
"pmc": null,
"pmid": "32106714",
"pubdate": "2020-09",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial",
"references": null,
"title": "Treatment with daratumumab in patients with relapsed/refractory AL amyloidosis: a multicentric retrospective study and review of the literature.",
"title_normalized": "treatment with daratumumab in patients with relapsed refractory al amyloidosis a multicentric retrospective study and review of the literature"
} | [
{
"companynumb": "ES-TAKEDA-2020TUS035308",
"fulfillexpeditecriteria": "1",
"occurcountry": "ES",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BORTEZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "Limited data exist on intravenous (IV) posaconazole dosing and the risk for hepatotoxicity it confers to children. In this study, we evaluated dosing and resulting trough levels in 10 pediatric patients on IV posaconazole. A therapeutic level in these patients was achieved 95% of the time. We found a median minimum effective dose of 6.55 mg/kg of body weight. No correlation was found between the duration or posaconazole trough level and an increased alanine transaminase level.",
"affiliations": "Department of Pharmacy, Seattle Children's Hospital, Washington.;Department of Pharmacy, Seattle Children's Hospital, Washington.;Department of Pediatrics, Division of Infectious Diseases, University of Washington School of Medicine, Seattle Children's Hospital, Washington.;Department of Pharmacy, Seattle Children's Hospital, Washington.",
"authors": "Nickless|Jenna R|JR|;Bridger|Kathryn E|KE|;Vora|Surabhi B|SB|;Brothers|Adam W|AW|",
"chemical_list": "D000935:Antifungal Agents; D014230:Triazoles; C101425:posaconazole; D000410:Alanine Transaminase",
"country": "England",
"delete": false,
"doi": "10.1093/jpids/piy094",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2048-7193",
"issue": "8(4)",
"journal": "Journal of the Pediatric Infectious Diseases Society",
"keywords": "child; hepatotoxicity; intravenous; level; posaconazole",
"medline_ta": "J Pediatric Infect Dis Soc",
"mesh_terms": "D061605:Administration, Intravenous; D000293:Adolescent; D000410:Alanine Transaminase; D000935:Antifungal Agents; D002648:Child; D002675:Child, Preschool; D016903:Drug Monitoring; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D012189:Retrospective Studies; D014230:Triazoles",
"nlm_unique_id": "101586049",
"other_id": null,
"pages": "365-367",
"pmc": null,
"pmid": "30299489",
"pubdate": "2019-09-25",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Evaluation of Intravenous Posaconazole Dosing and Pharmacokinetic Target Attainment in Pediatric Patients.",
"title_normalized": "evaluation of intravenous posaconazole dosing and pharmacokinetic target attainment in pediatric patients"
} | [
{
"companynumb": "US-009507513-1810USA008466",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "POSACONAZOLE"
},
"drugadditional": "3",
... |
{
"abstract": "Corticosteroid hypersensitivity is a complex phenomenon in which many factors interact, such as idiosyncrasy, intolerance or allergic reactions. The prevalence of immediate hypersensitivity reactions to corticosteroids is 0.2%-0.5%. Corticosteroids have major therapeutic implications; thus, when hypersensitivity is suspected, in-vitro and/or in-vivo testing can be performed to confirm diagnosis, being the drug challenge the gold standard. After definitive diagnosis, cross-reactivity among the different corticosteroid groups should be considered, to choose wisely if corticosteroid therapy is still required. In Coopman classification, steroids belonging to groups A, B and D2 have high cross-reactivity, however, more studies are needed to determine the degree of cross-reaction among these drugs. This paper presents the case of a woman, in who hypersensitivity to hydrocortisone succinate was confirmed by drug challenge test.",
"affiliations": "Servicio de Alergia e Inmunología Clínica, Hospital de Especialidades Dr. Bernardo Sepúlveda, Centro Médico Nacional Siglo XXI, IMSS, México, DF. adelaamaya@hotmail.com.",
"authors": "Amaya-Mejía|Adela Sisy|AS|;Galindo-Pacheco|Lucy Vania|LV|;O'Farrill-Romanillos|Patricia María|PM|;Rodríguez-Mireles|Karen Alicia|KA|;Campos-Romero|Freya Helena|FH|;del Rivero-Hernández|Leonel|L|",
"chemical_list": "D000305:Adrenal Cortex Hormones; D006241:Haptens; C007133:hydrocortisone hemisuccinate; D006854:Hydrocortisone",
"country": "Mexico",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0002-5151",
"issue": "61(1)",
"journal": "Revista alergia Mexico (Tecamachalco, Puebla, Mexico : 1993)",
"keywords": "Corticosteroids; Cross-reactivity; Drug challenge test; Hypersensitivity",
"medline_ta": "Rev Alerg Mex",
"mesh_terms": "D000284:Administration, Oral; D000305:Adrenal Cortex Hormones; D000328:Adult; D000707:Anaphylaxis; D000799:Angioedema; D003429:Cross Reactions; D004305:Dose-Response Relationship, Drug; D004342:Drug Hypersensitivity; D005260:Female; D006241:Haptens; D006801:Humans; D006854:Hydrocortisone; D006969:Hypersensitivity, Immediate; D015394:Molecular Structure; D013329:Structure-Activity Relationship",
"nlm_unique_id": "9438824",
"other_id": null,
"pages": "32-7",
"pmc": null,
"pmid": "24913000",
"pubdate": "2014",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Utility of challenge test in immediate hypersensitivity to hydrocortisone sodium succinate.",
"title_normalized": "utility of challenge test in immediate hypersensitivity to hydrocortisone sodium succinate"
} | [
{
"companynumb": "MX-ACTAVIS-2014-18475",
"fulfillexpeditecriteria": "1",
"occurcountry": "MX",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": null,
... |
{
"abstract": "Worldwide eight children have been born as a result of transplanting frozen/thawed ovarian tissue. Two of these children were born in Denmark following transport of the ovarian tissue for a period of 5 h prior to cryopreservation. One of these women, who was originally transplanted with six pieces of ovarian cortex, after having experienced a period of menopause has now conceived again following natural conception. She gave birth to a healthy girl on 23 September 2008 and is therefore the first woman in the world to have had two children, from separate pregnancies, born as a result of transplanting frozen/thawed ovarian tissue. This result encourages further development of cryopreservation of ovarian tissue for fertility preservation as a clinical procedure for girls and young women facing gonadotoxic treatment.",
"affiliations": "Department of Gynecology and Obstetrics, Aarhus University Hospital, Aarhus, Denmark.",
"authors": "Ernst|Erik|E|;Bergholdt|Stinne|S|;Jørgensen|Jan Stener|JS|;Andersen|Claus Yding|CY|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/humrep/deq033",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0268-1161",
"issue": "25(5)",
"journal": "Human reproduction (Oxford, England)",
"keywords": null,
"medline_ta": "Hum Reprod",
"mesh_terms": "D000328:Adult; D015925:Cryopreservation; D003718:Denmark; D005260:Female; D005298:Fertility; D006801:Humans; D007231:Infant, Newborn; D010053:Ovary; D011247:Pregnancy; D011252:Pregnancy Complications, Neoplastic; D011256:Pregnancy Outcome; D012512:Sarcoma, Ewing; D013997:Time Factors; D014182:Transplantation, Autologous",
"nlm_unique_id": "8701199",
"other_id": null,
"pages": "1280-1",
"pmc": null,
"pmid": "20172869",
"pubdate": "2010-05",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "The first woman to give birth to two children following transplantation of frozen/thawed ovarian tissue.",
"title_normalized": "the first woman to give birth to two children following transplantation of frozen thawed ovarian tissue"
} | [
{
"companynumb": "DK-BAXTER-2018BAX030582",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DOXORUBICIN"
},
"drugadditional": "3",
... |
{
"abstract": "We describe a group of 26 children with no prior history of seizures consistent with benign rolandic epilepsy who had rolandic spikes found coincidentally on EEG. A retrospective chart review as well as phone and email follow-ups with families were completed to assess long-term outcomes. A subset of this group (n=7) with reported comorbid language or learning difficulties was then given an empiric trial of levetiracetam. Seven (27%) children eventually developed seizures, with a median of 14months after the abnormal EEG. Of the 7 children ever treated with levetiracetam, 5 exhibited beneficial effects on learning, speech, or behavior. Side effects reported were mild and included irritability and headache. Incidental rolandic spikes may represent a discrete neurologic condition, with approximately one-quarter of the patients later developing epilepsy. Some of these children may experience improved intellectual functioning with levetiracetam.",
"affiliations": "Division of Child Neurology, Department of Pediatrics, Johns Hopkins University School of Medicine, USA; Division of Child Neurology, Department of Neurology, Johns Hopkins University School of Medicine, USA.;Division of Child Neurology, Department of Pediatrics, Johns Hopkins University School of Medicine, USA; Division of Child Neurology, Department of Neurology, Johns Hopkins University School of Medicine, USA. Electronic address: ekossoff@jhmi.edu.",
"authors": "McNally|Melanie A|MA|;Kossoff|Eric H|EH|",
"chemical_list": "D000927:Anticonvulsants; D000077287:Levetiracetam; D010889:Piracetam",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1525-5050",
"issue": "43()",
"journal": "Epilepsy & behavior : E&B",
"keywords": "Cognition; EEG; Epilepsy; Levetiracetam; Rolandic",
"medline_ta": "Epilepsy Behav",
"mesh_terms": "D000927:Anticonvulsants; D002648:Child; D002675:Child, Preschool; D004569:Electroencephalography; D019305:Epilepsy, Rolandic; D005260:Female; D005500:Follow-Up Studies; D006261:Headache; D006801:Humans; D007508:Irritable Mood; D007805:Language Development Disorders; D007859:Learning Disabilities; D000077287:Levetiracetam; D008137:Longitudinal Studies; D008297:Male; D010889:Piracetam; D012189:Retrospective Studies; D016896:Treatment Outcome",
"nlm_unique_id": "100892858",
"other_id": null,
"pages": "135-8",
"pmc": null,
"pmid": "25623811",
"pubdate": "2015-02",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Incidental rolandic spikes: long-term outcomes and impact of treatment.",
"title_normalized": "incidental rolandic spikes long term outcomes and impact of treatment"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/15/0050394",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": null... |
{
"abstract": "Perry syndrome, also recognized as Perry disease, is a rare autosomal dominant disorder characterized by midlife-onset atypical parkinsonism, apathy or depression, respiratory failure and weight loss caused by a mutation in the Dynactin (DCTN1) gene.\n\n\n\nA fifty-six years-old adopted male presented with atypical parkinsonism with bradykinesia and postural instability, apathy, weight loss, and recurrent respiratory failure due to central hypoventilation requiring tracheostomy.\n\n\n\nClinical workup revealed a novel DCTN1 p.Tyr78His variant. Using bioinformatic protein structure modeling, we compare our patient's variant to known DCTN1 mutations and predict protein stability of each variant at the CAP-Gly domain of p150Glued. All eight variants causing Perry syndrome, as well as Tyr78His, are located at site expected to interact with MAPRE1 tail and are predicted to be destabilizing. Variants causing atypical parkinsonism with incomplete Perry syndrome phenotype (K56R and K68E) are not significantly destabilizing in silico.\n\n\n\nWe propose p.Tyr78His as the ninth pathogenic DCTN1 variant causing Perry syndrome. Bioinformatic protein modeling may provide additional window to understand and interpret DCTN1 variants, as we observed non-destabilizing variants to have different phenotype than destabilizing variants.",
"affiliations": "Department of Neurology, Medical College of Wisconsin, Milwaukee, WI, USA. Electronic address: m.cierny@mail.muni.cz.;Department of Neurology, Medical College of Wisconsin, Milwaukee, WI, USA.;Department of Neurology, Medical College of Wisconsin, Milwaukee, WI, USA.;Precision Medicine Simulation Unit, Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwaukee, WI, 53226, USA.;Precision Medicine Simulation Unit, Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwaukee, WI, 53226, USA.;Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwaukee, WI, USA.;Precision Medicine Simulation Unit, Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwaukee, WI, 53226, USA; Bioinformatics Research and Development Laboratory, Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Milwaukee, WI, 53226, USA; Clinical and Translational Sciences Institute, Medical College of Wisconsin, Milwaukee, WI, 53226, USA.;Department of Neurology, Medical College of Wisconsin, Milwaukee, WI, USA.",
"authors": "Čierny|Marek|M|;Hooshmand|Sam I|SI|;Fee|Dominic|D|;Tripathi|Swarnendu|S|;Dsouza|Nikita R|NR|;La Pean Kirschner|Alison|A|;Zimmermann|Michael T|MT|;Brennan|Ryan|R|",
"chemical_list": "C000606360:DCTN1 protein, human; D000072159:Dynactin Complex",
"country": "England",
"delete": false,
"doi": "10.1016/j.parkreldis.2020.06.006",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1353-8020",
"issue": "77()",
"journal": "Parkinsonism & related disorders",
"keywords": "Atypical parkinsonism; Autophagy; DCTN1; Dynactin; EB1; Genetics; Microtubule associated protein RP/EB family member 1; Microtubules; Nocturnal hypopnea; Perry disease; Perry syndrome; Predicted folding free energy; Protein modeling; Protein stability; Type 2 respiratory failure; p150(Glued)",
"medline_ta": "Parkinsonism Relat Disord",
"mesh_terms": "D003863:Depression; D000072159:Dynactin Complex; D006801:Humans; D007040:Hypoventilation; D008297:Male; D008875:Middle Aged; D009154:Mutation; D020734:Parkinsonian Disorders; D010641:Phenotype",
"nlm_unique_id": "9513583",
"other_id": null,
"pages": "110-113",
"pmc": null,
"pmid": "32712562",
"pubdate": "2020-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Novel destabilizing Dynactin variant (DCTN1 p.Tyr78His) in patient with Perry syndrome.",
"title_normalized": "novel destabilizing dynactin variant dctn1 p tyr78his in patient with perry syndrome"
} | [
{
"companynumb": "US-009507513-2008USA008867",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "CARBIDOPA\\LEVODOPA"
},
"drugadditional": nu... |
{
"abstract": "Reports of crizotinib-induced pleural effusion in non-small cell lung cancer (NSCLC) are limited. A 35-year-old Japanese woman was diagnosed with ROS1-rearranged lung adenocarcinoma (primary left lower lobe, cT4N3M1c). Crizotinib was administered as first-line therapy, and the primary and mediastinal hilar lymph node metastases rapidly shrank. On the fourth day of treatment, chest X-ray demonstrated contralateral pleural effusion. On the 41st day of treatment, crizotinib was discontinued because of grade 3 neutropenia. Examination including surgical thoracoscopy did not reveal causative findings, and the continued cessation of drug administration enabled the right pleural effusion to decrease gradually and disappear, suggesting that this event was a side effect of crizotinib. The disease did not progress even though the drug was withdrawn for more than one year. In conclusion, crizotinib was considered to cause pleural effusion as an adverse event in a case of ROS1-rearranged lung adenocarcinoma with a complete response.",
"affiliations": "Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Thoracic Surgery, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Thoracic Surgery, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Pathology, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.;Department of Respiratory Medicine, Hitachi General Hospital, Hitachi Ltd., Hitachi City, Japan.",
"authors": "Tachi|Hiroaki|H|0000-0001-9801-6016;Nishino|Kengo|K|;Nakaizumi|Taisuke|T|;Kuramoto|Kenya|K|;Shimizu|Kei|K|;Yamamoto|Yusuke|Y|;Kobayashi|Keisuke|K|;Ichimura|Hideo|H|;Sakata|Akiko|A|;Nawa|Takeshi|T|",
"chemical_list": "D000970:Antineoplastic Agents; D011518:Proto-Oncogene Proteins; D000077547:Crizotinib; D011505:Protein-Tyrosine Kinases; C062333:ROS1 protein, human",
"country": "Singapore",
"delete": false,
"doi": "10.1111/1759-7714.13496",
"fulltext": "\n==== Front\nThorac Cancer\nThorac Cancer\n10.1111/(ISSN)1759-7714\nTCA\nThoracic Cancer\n1759-7706 1759-7714 John Wiley & Sons Australia, Ltd Melbourne \n\n10.1111/1759-7714.13496\nTCA13496\nCase Report\nCase Reports\nA case of ROS1‐rearranged lung adenocarcinoma exhibiting pleural effusion caused by crizotinib\nCrizotinib‐induced pleural effusionH. Tachi et al.Tachi Hiroaki https://orcid.org/0000-0001-9801-6016\n1\nabc39soccer7@yahoo.co.jp Nishino Kengo \n1\n Nakaizumi Taisuke \n1\n Kuramoto Kenya \n1\n Shimizu Kei \n1\n Yamamoto Yusuke \n1\n Kobayashi Keisuke \n2\n Ichimura Hideo \n2\n Sakata Akiko \n3\n Nawa Takeshi \n1\n \n1 \nDepartment of Respiratory Medicine\nHitachi General Hospital, Hitachi Ltd.\nHitachi City\nJapan\n\n\n2 \nDepartment of Thoracic Surgery\nHitachi General Hospital, Hitachi Ltd.\nHitachi City\nJapan\n\n\n3 \nDepartment of Pathology\nHitachi General Hospital, Hitachi Ltd.\nHitachi City\nJapan\n\n* \nCorrespondence\n\nHiroaki Tachi, Department of Respiratory Medicine, Hitachi General Hospital, Hitachi, Ltd. 2‐1‐1, Jonan, Hitachi City, Ibaraki, Japan.\n\nTel.: +81‐294‐23‐1111\n\nFax: +81‐294‐23‐8767\n\nEmail: abc39soccer7@yahoo.co.jp\n\n20 5 2020 \n7 2020 \n11 7 10.1111/tca.v11.72063 2066\n14 3 2020 30 4 2020 02 5 2020 © 2020 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, LtdThis is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.Reports of crizotinib‐induced pleural effusion in non‐small cell lung cancer (NSCLC) are limited. A 35‐year‐old Japanese woman was diagnosed with ROS1‐rearranged lung adenocarcinoma (primary left lower lobe, cT4N3M1c). Crizotinib was administered as first‐line therapy, and the primary and mediastinal hilar lymph node metastases rapidly shrank. On the fourth day of treatment, chest X‐ray demonstrated contralateral pleural effusion. On the 41st day of treatment, crizotinib was discontinued because of grade 3 neutropenia. Examination including surgical thoracoscopy did not reveal causative findings, and the continued cessation of drug administration enabled the right pleural effusion to decrease gradually and disappear, suggesting that this event was a side effect of crizotinib. The disease did not progress even though the drug was withdrawn for more than one year. In conclusion, crizotinib was considered to cause pleural effusion as an adverse event in a case of ROS1‐rearranged lung adenocarcinoma with a complete response.\n\nComplete responsecrizotiniblung adenocarcinomapleural effusionROS1 rearrangement source-schema-version-number2.0cover-dateJuly, 2020details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:5.8.5 mode:remove_FC converted:01.07.2020\n==== Body\nIntroduction\nROS1 rearrangement has been estimated to be present in 1% to 2% of patients with non‐small cell lung cancer (NSCLC).1, 2 Crizotinib, an inhibitor of anaplastic lymphoma kinase (ALK), is known to have marked antitumor activity in patients with ROS1‐positive advanced NSCLC\n3\n because ROS1 is considered to have a high homology with the tyrosine kinase region of ALK due to its protein structure.\n4\n\n\n\nPleural disorder is one of the clinical phenotypes of drug‐induced lung injury. Although pleural effusion and pleurisy are listed as adverse events for many drugs, they are rarely observed in clinical practice. This report describes a case of ROS1‐rearranged lung adenocarcinoma exhibiting contralateral pleural effusion caused by crizotinib.\n\nCase report\nA 35‐year‐old Japanese woman was referred to our hospital for evaluation of a mass in the left lower lung field (Fig 1a) with a complaint of dry cough for six months. She had a smoking history of 15 pack‐years but no notable past medical history or drug allergy. Chest computed tomography demonstrated a large mass in the left lower lobe of her lung, and enlarged lymph nodes in the left hilum and right mediastinum. Solid adenocarcinoma was detected by bronchial biopsy from the mass in the left lower lobe (Fig 2a). The cancer stage was determined to be cT4N3M1c, stage IVB, isolated right cervical lymph node metastasis. Molecular testing of the biopsied specimen revealed ROS1 rearrangement.\n\nFigure 1 Chest X‐ray findings. (a) Pretreatment. A large mass shadow was observed in the left lower lung field, and enlarged lymph nodes were found in the left hilum and right mediastinum. (b) Day 4 of treatment. Right pleural effusion and ground‐glass appearance of the bilateral lungs distributed dominantly on the side of the hilum were observed.\n\nFigure 2 Histopathological findings. (a) Bronchial biopsy findings from the mass in the left lower lobe (HE staining ×400). The tumor grew solidly without glandular structure, being composed of neoplastic cells with irregularly enlarged and strongly atypical nuclei. (b) Parietal pleural biopsy findings (HE staining ×200). Only lymphocytes, plasma cells, and reactive mesothelial cells were found, and there was no malignancy.\n\nCrizotinib was introduced as the first‐line therapy (250 mg twice daily). The primary lesion and mediastinal hilar lymph node metastases both shrank rapidly. However, right pleural effusion was observed on chest X‐ray on the fourth day of treatment (Fig 1b). The right pleural effusion was exudative and predominantly composed of lymphocytes, but cytology and culture were both negative (Table 1). For autoimmune markers, only antinuclear antibody and anti‐ds‐DNA IgG were measured, both of which were negative. Cardiac ultrasonography demonstrated normal cardiac function and no evidence of heart failure. During crizotinib administration, right pleural effusion continued to increase, but after 41 days of treatment, crizotinib was discontinued due to grade 3 neutropenia, followed by a gradual decrease in pleural effusion. Surgical thoracoscopy was performed one month after the cessation of crizotinib. There were no causative findings of pleural effusion in the right pleura within the visible range. Biopsy of the parietal pleura and partial resection of the collapsed right middle lobe were performed. On pathology, there were no malignant findings. Lymphocytes, plasma cells, and reactive mesothelial cells were observed (Fig. 2b). As right pleural effusion disappeared and did not recur during continued drug withdrawal, it was considered to be an adverse event due to crizotinib. Even without medication for more than one year, both the primary lesion and mediastinal hilar lymph node metastases disappeared, and no new lesions developed (Fig 3).\n\nTable 1 Laboratory findings (blood test and pleural fluid analysis)\n\nBlood test\t\t\t\t\t\t\tPleural fluid analysis\t\nCBC\t\t\t\tSerum chemistry\t\t\tColor\tPale yellow\t\t\nWBC\t116\t×102/μL\t\tTP\t7.1\tg/dL\t\tS.G.\t1.025\t\t\nNeu\t80\t%\t\tALB\t3.8\tg/dL\t\tCells\t5676\t/μL\t\nEos\t4\t%\t\tAST\t18\tU/L\t\t\t(only lymphocyte)\t\nBas\t0\t%\t\tALT\t18\tU/L\t\tProtein\t3.5\tg/dL\t\nMono\t5\t%\t\tLDH\t345\tU/L\t\tLDH\t127\tU/L\t\nLym\t11\t%\t\tALP\t189\tU/L\t\tGlucose\t106\tmg/dL\t\nRBC\t444\t×104/μL\t\tT‐Bil\t0.3\tmg/dL\t\tADH\t11.3\t\t\nHb\t12.7\tg/dL\t\tBUN\t10.8\tmg/dL\t\tCulture\tnegative\t\t\nPLT\t30.8\t×104/μL\t\tCre\t0.66\tmg/dl\t\tCytology\tnegative\t\t\n\t\t\t\tNa\t141\tmmol/L\t\t\t\t\t\nTumor marker\t\t\tK\t4.3\tmmol/L\t\t\t\t\t\nCEA\t3.8\tng/mL\t\tCl\t105\tmmol/L\t\t\t\t\t\nCYFRA\t4.8\tng/mL\t\tCa\t8.5\tmg/dL\t\t\t\t\t\nPRO GRP\t43.8\tpg/mL\t\tCRP\t0.6\tmg/dL\t\t\t\t\t\nSLX\t34.0\tU/mL\t\tBNP\t<5.80\tpg/mL\t\t\t\t\t\nSCC\t53.0\tng/mL\t\t\t\t\t\t\t\t\t\nNSE\t25.0\tng/mL\t\tAutoimmume marker\t\t\t\t\t\t\n\t\t\t\tAntinuclear antibody\t<40\t\t\t\t\t\n\t\t\t\tAnti ds‐DNA IgG\t<10\t\t\t\t\t\nFigure 3 Chest computed tomography (CT) findings. (a) Eight weeks after starting treatment although the large mass shadow significantly disappeared, right pleural effusion was observed without pleural dissemination nodules. (b) One year after withdrawal and the right pleural effusion gradually decreased and disappeared. Moreover, no regrowth of the primary lesion was observed.\n\nDiscussion\nTo the best of our knowledge, this is the first report of ROS1‐rearranged lung adenocarcinoma exhibiting pleural effusion caused by crizotinib with a complete response.\n\nA diffuse alveolar damage (DAD) pattern5, 6, 7, 8 and hypersensitivity pneumonia pattern7, 9 have been reported as lung adverse events caused by crizotinib for lung adenocarcinoma with ALK rearrangement. However, we found no case reports describing noncardiogenic pleural effusion due to crizotinib.\n\nCrizotinib has inhibitory activity against CYP3A4 and may increase the blood concentration of other drugs. In this case, although the patient had been taking other medications (eg, morphine sulfate hydrate, acetaminophen, celecoxib, esomeprazole magnesium hydrate, metoclopramide, magnesium oxide, and levocetirizine hydrochloride), it is unlikely that they were the causative agents because there have been no reports of pleural effusion caused by these drugs and none whose metabolism is completely dependent on CYP3A4 were included. As the pleural effusion decreased and disappeared after the cessation of crizotinib, it was thought to be the causative agent. However, the involvement of concomitant medications was unable to be excluded because the pleural effusion began to decrease after withdrawing crizotinib and these drugs were subsequently discontinued as the patient's condition improved.\n\nRegarding the mechanism of pleural effusion, Gemma et al.\n8\n previously reported that crizotinib‐induced lung injury with pulmonary edema‐like shadows may be accompanied by bilateral pleural effusion. In our case, a ground‐glass appearance of the bilateral lungs distributed dominantly in the hilum was observed on chest X‐ray on the fourth day of treatment, but it was difficult to consider it to be the same mechanism because a similar shadow, suggesting carcinomatous lymphangiomatosis, was noted the day before starting treatment.\n\nIn addition, a stable course without recurrence for more than one year after the discontinuation of crizotinib is considered to be markedly rare. According to a previous clinical study,\n3\n the complete response rate was 6%. On the other hand, a Japanese study\n10\n reported that the objective response rate of ROS1‐rearranged NSCLC to crizotinib was 80%. Crizotinib was reported to bind significantly more strongly to ROS1 than to ALK,\n11\n which may lead to effective target suppression and lasting therapeutic effects. One basic study suggested that the combination of cisplatin and high‐dose crizotinib induces immunogenic cell death in NSCLC.\n12\n\n\n\nIn conclusion, crizotinib was considered to cause pleural effusion as an adverse event in a patient with ROS1‐rearranged lung adenocarcinoma.\n\nDisclosure\nThe authors have no conflicts of interest to declare.\n\nAcknowledgments\nNone.\n==== Refs\nReferences\n1 \n\nBergethon \nK \n, \nShaw \nAT \n, \nOu \nSH \n\net al\nROS1 rearrangements define a unique molecular class of lung cancers\n. J Clin Oncol \n2012 ; 30 (8 ): 863 –70\n.22215748 \n2 \n\nDavies \nKD \n, \nLe \nAT \n, \nTheodoro \nMF \n\net al\nIdentifying and targeting ROS1 gene fusions in non‐small cell lung cancer\n. Clin Cancer Res \n2012 ; 18 (17 ): 4570 –9\n.22919003 \n3 \n\nShaw \nAT \n, \nOu \nSH \n, \nBang \nYJ \n\net al\nCrizotinib in ROS1‐rearranged non‐small‐cell lung cancer\n. N Engl J Med \n2014 ; 371 (21 ): 1963 –71\n.25264305 \n4 \n\nRobinson \nDR \n, \nWu \nYM \n, \nLin \nSF \n. The protein tyrosine kinase family of the human genome\n. Oncogene \n2000 ; 19 : 5548 –57\n.11114734 \n5 \n\nTamiya \nA \n, \nOkamoto \nI \n, \nMiyazaki \nM \n, \nShimizu \nS \n, \nKitaichi \nM \n, \nNakagawa \nK \n. Severe acute interstitial lung disease after crizotinib therapy in a patient with EML4‐ALK‐positive non‐small‐cell lung cancer\n. J Clin Oncol \n2013 ; 31 (1 ): e15 –7\n.23169500 \n6 \n\nWatanabe \nN \n, \nNakahara \nY \n, \nTaniguchi \nH \n\net al\nCrizotinib‐induced acute interstitial lung disease in a patient with EML4‐ALK positive non‐small cell lung cancer and chronic interstitial pneumonia\n. Acta Oncol \n2014 ; 53 (1 ): 158 –60\n.23750540 \n7 \n\nCrequit \nP \n, \nWislez \nM \n, \nFleury Feith \nJ \n\net al\nCrizotinib associated with ground‐glass opacity predominant pattern interstitial lung disease: A retrospective observational cohort study with a systematic literature review\n. J Thorac Oncol \n2015 ; 10 (8 ): 1148 –55\n.26200268 \n8 \n\nGemma \nA \n, \nKusumoto \nM \n, \nKurihara \nY \n\net al\nInterstitial lung disease onset and its risk factors in Japanese patients with ALK‐positive NSCLC after treatment with Crizotinib\n. J Thorac Oncol \n2019 ; 14 (4 ): 672 –82\n.30521972 \n9 \n\nTachihara \nM \n, \nKobayashi \nK \n, \nIshikawa \nY \n\net al\nSuccessful crizotinib rechallenge after crizotinib‐induced interstitial lung disease\n. Jpn J Clin Oncol \n2014 ; 44 (8 ): 762 –4\n.24872405 \n10 \n\nMasuda \nK \n, \nFujiwara \nY \n, \nShinno \nY \n\net al\nEfficacy and safety of crizotinib in patients with ROS1 rearranged non‐small cell lung cancer: A retrospective analysis\n. J Thorac Dis \n2019 ; 11 (7 ): 2965 –72\n.31463126 \n11 \n\nHuber \nKV \n, \nSalah \nE \n, \nRadic \nB \n\net al\nStereospecific targeting of MTH1 by (S)‐crizotinib as an anticancer strategy\n. Nature \n2014 ; 508 : 222 –7\n.24695225 \n12 \n\nLiu \nP \n, \nZhao \nL \n, \nPol \nJ \n\net al\nCrizotinib‐induced immunogenic cell death in non‐small cell lung cancer\n. Nat Commun \n2019 ; 10 (1 ): 1 –17\n.30602773\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1759-7706",
"issue": "11(7)",
"journal": "Thoracic cancer",
"keywords": "Complete response; ROS1 rearrangement; crizotinib; lung adenocarcinoma; pleural effusion",
"medline_ta": "Thorac Cancer",
"mesh_terms": "D000077192:Adenocarcinoma of Lung; D000328:Adult; D000970:Antineoplastic Agents; D000077547:Crizotinib; D005260:Female; D015321:Gene Rearrangement; D006801:Humans; D008175:Lung Neoplasms; D010996:Pleural Effusion; D011379:Prognosis; D011505:Protein-Tyrosine Kinases; D011518:Proto-Oncogene Proteins",
"nlm_unique_id": "101531441",
"other_id": null,
"pages": "2063-2066",
"pmc": null,
"pmid": "32433811",
"pubdate": "2020-07",
"publication_types": "D002363:Case Reports",
"references": "22215748;26200268;24872405;30996258;22919003;25264305;24695225;23169500;23750540;30521972;31463126;11114734",
"title": "A case of ROS1-rearranged lung adenocarcinoma exhibiting pleural effusion caused by crizotinib.",
"title_normalized": "a case of ros1 rearranged lung adenocarcinoma exhibiting pleural effusion caused by crizotinib"
} | [
{
"companynumb": "JP-MYLANLABS-2020M1066204",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ACETAMINOPHEN"
},
"drugadditional": "1",
... |
{
"abstract": "An adult lymphoma patient developed Cushing syndrome after short-term, high-dose dexamethasone administration and presented with a distinctive Cushingoid fat redistribution pattern and associated increased 18F-FDG uptake in white adipose tissue. Recognition of the unique 18F-FDG uptake manifestation may aid in the diagnosis of this iatrogenic syndrome and avoid image misinterpretation.",
"affiliations": "Department of Radiology, Mayo Clinic, Scottsdale, Arizona.;Department of Hematology/Oncology, Mayo Clinic, Scottsdale, Arizona; and.;Division of Endocrinology, Mayo Clinic, Scottsdale, Arizona.;Department of Radiology, Mayo Clinic, Scottsdale, Arizona yang.ming@mayo.edu.",
"authors": "Staack|Sasha O|SO|;Rosenthal|Allison C|AC|;Cook|Curtiss B|CB|;Yang|Ming|M|",
"chemical_list": "D005938:Glucocorticoids; D019788:Fluorodeoxyglucose F18",
"country": "United States",
"delete": false,
"doi": "10.2967/jnmt.119.237545",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0091-4916",
"issue": "48(3)",
"journal": "Journal of nuclear medicine technology",
"keywords": "Cushing syndrome; FDG; PET/CT; glucocorticoids; white fat",
"medline_ta": "J Nucl Med Technol",
"mesh_terms": "D052436:Adipose Tissue, White; D001692:Biological Transport; D003480:Cushing Syndrome; D005260:Female; D019788:Fluorodeoxyglucose F18; D005938:Glucocorticoids; D006801:Humans; D008875:Middle Aged; D049268:Positron-Emission Tomography",
"nlm_unique_id": "0430303",
"other_id": null,
"pages": "285-286",
"pmc": null,
"pmid": "31811068",
"pubdate": "2020-09",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Glucocorticoid-Induced Hypermetabolism in White Adipose Tissue in Cushing Syndrome.",
"title_normalized": "glucocorticoid induced hypermetabolism in white adipose tissue in cushing syndrome"
} | [
{
"companynumb": "US-BAUSCH-BL-2021-022916",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "2",
"activesubstance": {
"activesubstancename": "DEXAMETHASONE"
},
"drugadditional": "1",
... |
{
"abstract": "Retinoblastoma is the prototypic genetic tumor. Caused by mutations in the RB1 gene, retinoblastomas are heritable in 40% of the cases and, in such cases, tumors are bilateral in 80%, unilateral in 15%, and trilateral in 5% of the cases. Trilateral retinoblastoma is a term that describes bilateral retinoblastomas plus a midline suprasellar or pineal neuroectodermal tumor. Patients with a germline RB1 mutation have 45% chance of having an offspring with retinoblastoma. Prenatal diagnosis is important because the doubling time is fast, ranging from 7 to 15 days. Thus, late diagnosis during infancy is associated with larger tumors and increased risk of death, need for globe enucleation and vision loss. We report a case of bilateral retinoblastomas diagnosed by targeted high-resolution ultrasonography of the orbits at 32 weeks of gestation in a patient at risk. This report demonstrates the feasibility of accurately detecting even tiny retinoblastomas by ultrasound with current technology. We also review prenatally published cases to date and comment on the technical strengths and limitations of ultrasound and fetal MRI for prenatal diagnosis of retinoblastomas.",
"affiliations": "Phoenix Children's Hospital, Department of Radiology, United States of America; University of Arizona School of Medicine, Department of Child Health, United States of America; University of Arizona School of Medicine, Department of Radiology, United States of America; Mayo Clinic, Department of Radiology, United States of America; Creighton University, Department of Radiology, United States of America. Electronic address: lgoncalves@phoenixchildrens.com.;Phoenix Children's Hospital, Department of Ophthalmology, United States of America; University of Arizona School of Medicine, Department of Child Health, United States of America.;Phoenix Children's Hospital, Department of Genetics, United States of America; University of Arizona School of Medicine, Department of Child Health, United States of America.;Phoenix Children's Hospital, Department of Radiology, United States of America.;Phoenix Children's Hospital, Department of Radiology, United States of America.;Phoenix Children's Hospital, Department of Radiology, United States of America; University of Arizona School of Medicine, Department of Child Health, United States of America; University of Arizona School of Medicine, Department of Radiology, United States of America; Mayo Clinic, Department of Radiology, United States of America; Creighton University, Department of Radiology, United States of America.",
"authors": "Goncalves|Luis F|LF|;Ramasubramanian|Aparna|A|;Grebe|Theresa|T|;Riemann|Monique|M|;Moncrief|Dawn|D|;Cornejo|Patricia|P|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.clinimag.2021.03.023",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0899-7071",
"issue": "78()",
"journal": "Clinical imaging",
"keywords": "Bilateral retinoblastoma; Fetal MRI; Fetal ultrasound; Prenatal diagnosis; Retinoblastoma",
"medline_ta": "Clin Imaging",
"mesh_terms": "D005260:Female; D006801:Humans; D007223:Infant; D008279:Magnetic Resonance Imaging; D010870:Pineal Gland; D011247:Pregnancy; D011296:Prenatal Diagnosis; D019572:Retinal Neoplasms; D012175:Retinoblastoma",
"nlm_unique_id": "8911831",
"other_id": null,
"pages": "121-126",
"pmc": null,
"pmid": "33774578",
"pubdate": "2021-10",
"publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review",
"references": null,
"title": "Prenatal diagnosis of bilateral retinoblastomas by multimodality fetal imaging: case report and review of the literature.",
"title_normalized": "prenatal diagnosis of bilateral retinoblastomas by multimodality fetal imaging case report and review of the literature"
} | [
{
"companynumb": "US-FRESENIUS KABI-FK202105556",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARBOPLATIN"
},
"drugadditional": "3",
... |
{
"abstract": "The use of granulocyte-colony stimulating factor (G-CSF) with or without chemotherapy to mobilize hematopoietic progenitor cells (HPCs) can result in significant morbidity in light chain (AL) amyloidosis patients. Plerixafor, a strong inducer and mobilizer of HPCs, can be used as an adjunct to G-CSF to improve mobilization efficiency. We describe the outcomes for combined G-CSF/plerixafor mobilized patients with AL amyloidosis. We reviewed data of 53 consecutive AL amyloidosis patients who underwent combined G-CSF/plerixafor HPC mobilization between May 2011 and October 2017 at our institution. We evaluated patients for HPC collection efficiency, perimobilization toxicity and postautologous hematopoietic cell transplantation (autoHCT) outcomes. Median CD34+ cell collection was 12.4 × 106 cells/kg (range 2.5 × 106 to 34.1 × 106 cells/kg) and 45 (85%) patients had collections of ≥5.0 × 106 CD34+ cells/kg. There were no mobilization failures or perimobilization mortality. During mobilization, 37 (70%) patients had weight gain (median 1.3 kg, range 0.1-4) but none >10% body weight, 5 (10%) patients had diarrhea, and one patient each had hypotension and cardiac arrhythmia. Among the 31 patients analyzed for CD34 collection efficiency (CE), the median CD34 CE was 47% (range 36-62). At 5 years follow-up 82% and 84% of patients were progression-free and alive, respectively. Our results suggest that G-CSF/plerixafor mobilization is safe, well tolerated, and effective in AL amyloidosis.",
"affiliations": "BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;Institute for Health and Equity, Division of Biostatistics, Medical College of Wisconsin, Milwaukee, Wisconsin.;Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin.;Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin.;Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.;BMT and Cellular Therapy Program, Division of Hematology/Oncology, Department of Medicine, Medical College of Wisconsin, Milwaukee, Wisconsin.",
"authors": "Badar|Talha|T|https://orcid.org/0000-0003-1548-918X;Dhakal|Binod|B|;Szabo|Aniko|A|;Padmanabhan|Anand|A|;Johnson|Bryon D|BD|;Heidtke|Sarah|S|;Esselmann|Jean|J|;Chhabra|Saurabh|S|;Hamadani|Mehdi|M|;Hari|Parameswaran|P|;D'Souza|Anita|A|https://orcid.org/0000-0002-1092-5643",
"chemical_list": "D018952:Antigens, CD34; D001596:Benzylamines; D000080027:Cyclams; D006571:Heterocyclic Compounds; D016179:Granulocyte Colony-Stimulating Factor; C088327:plerixafor",
"country": "United States",
"delete": false,
"doi": "10.1002/jca.21747",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0733-2459",
"issue": "34(6)",
"journal": "Journal of clinical apheresis",
"keywords": "amyloidosis; mobilization; plerixafor",
"medline_ta": "J Clin Apher",
"mesh_terms": "D000328:Adult; D018952:Antigens, CD34; D001596:Benzylamines; D000080027:Cyclams; D005260:Female; D016179:Granulocyte Colony-Stimulating Factor; D019650:Hematopoietic Stem Cell Mobilization; D018380:Hematopoietic Stem Cell Transplantation; D006571:Heterocyclic Compounds; D006801:Humans; D000075363:Immunoglobulin Light-chain Amyloidosis; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D016019:Survival Analysis; D014182:Transplantation, Autologous; D016896:Treatment Outcome",
"nlm_unique_id": "8216305",
"other_id": null,
"pages": "686-691",
"pmc": null,
"pmid": "31566813",
"pubdate": "2019-12",
"publication_types": "D016428:Journal Article",
"references": "17855669;22475872;29223373;19617578;11948701;16271097;22331953;24779777;22080973;20067838;25621807;19363221;25111581;9838936;18523146;17599916;24933207;11493732;26371138;17554795;21060030;20636438;12748660;22738220",
"title": "An updated single center experience with plerixafor and granulocyte colony-stimulating factor for stem cell mobilization in light chain amyloidosis.",
"title_normalized": "an updated single center experience with plerixafor and granulocyte colony stimulating factor for stem cell mobilization in light chain amyloidosis"
} | [
{
"companynumb": "US-AMGEN-USASP2019214398",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "ANHYDROUS CITRIC ACID\\DEXTROSE MONOHYDRATE\\SODIUM CITRATE"
... |
{
"abstract": "BACKGROUND\nDrug reaction with eosinophilia and systemic symptoms (DRESS) [also called drug-induced hypersensitivity syndrome (DIHS)] includes severe reactions to drugs that need to be promptly recognized by physicians.\n\n\nOBJECTIVE\nTo explore heterogeneity in the clinical presentation of DRESS/DIHS at a large academic hospital in Latin America, using the criteria defined by the European Registry of Severe Cutaneous Adverse Reactions (RegiSCAR) scoring system.\n\n\nMETHODS\nA retrospective medical record review of 60 patients with diagnostic suspicion of DRESS/DIHS admitted to our hospital between July 2008 and April 2012 was performed, including demographic data, clinical features, laboratory findings and treatment.\n\n\nRESULTS\nOf the 60 patients, 27 fulfilled the criteria for DRESS/DIHS. Maculopapular exanthema (85.1%), fever (96.2%) and hepatic involvement (85.1%) were the most common features. Anticonvulsants were the most common causal drugs (77.7%); Phenytoin was the most common individual drug (44.4%), followed by carbamazepine (29.6%). All patients were treated initially with prednisone 1 mg/kg/day. Mortality rate was 4%.\n\n\nCONCLUSIONS\nThe major findings of this study (to our knowledge the largest collection of data on DRESS/DIHS in Latin America) include a positive statistical association between presence of atypical lymphocytes and higher levels of alanine aminotransferase (P < 0.001) and reinforce the importance of anticonvulsants in the pathogenesis of this severe reaction.",
"affiliations": "Department of Dermatology, University of São Paulo, São Paulo, Brazil.;Department of Dermatology, University of São Paulo, São Paulo, Brazil.;Department of Dermatology, University of São Paulo, São Paulo, Brazil.;Department of Dermatology, University of São Paulo, São Paulo, Brazil.",
"authors": "Avancini|J|J|;Maragno|L|L|;Santi|C G|CG|;Criado|P R|PR|",
"chemical_list": "D000890:Anti-Infective Agents; D000927:Anticonvulsants; D018894:Reverse Transcriptase Inhibitors; D000410:Alanine Transaminase",
"country": "England",
"delete": false,
"doi": "10.1111/ced.12682",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0307-6938",
"issue": "40(8)",
"journal": "Clinical and experimental dermatology",
"keywords": null,
"medline_ta": "Clin Exp Dermatol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000368:Aged; D000410:Alanine Transaminase; D000890:Anti-Infective Agents; D000927:Anticonvulsants; D002648:Child; D063926:Drug Hypersensitivity Syndrome; D004802:Eosinophilia; D005076:Exanthema; D005260:Female; D005334:Fever; D006801:Humans; D008297:Male; D008875:Middle Aged; D012189:Retrospective Studies; D018894:Reverse Transcriptase Inhibitors; D055815:Young Adult",
"nlm_unique_id": "7606847",
"other_id": null,
"pages": "851-9",
"pmc": null,
"pmid": "26271788",
"pubdate": "2015-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Drug reaction with eosinophilia and systemic symptoms/drug-induced hypersensitivity syndrome: clinical features of 27 patients.",
"title_normalized": "drug reaction with eosinophilia and systemic symptoms drug induced hypersensitivity syndrome clinical features of 27 patients"
} | [
{
"companynumb": "BR-IPCA LABORATORIES LIMITED-IPC201512-000872",
"fulfillexpeditecriteria": "1",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "NIMESULIDE"
},
"drugaddit... |
{
"abstract": "Natural killer (NK) cell-mediated antibody-dependent toxicity is a potent mechanism of action of the anti-GD2 murine monoclonal antibody 3F8 (m3F8). Killer immunoglobulin-like receptor (KIR) and HLA genotypes modulate NK activity and are key prognostic markers in m3F8-treated patients with neuroblastoma. Endogenous NK-cells are suppressed in the setting of high tumor burden and chemotherapy. Allogeneic NK-cells however, demonstrate potent anti-neuroblastoma activity. We report on the results of a phase I clinical trial of haploidentical NK-cells plus m3F8 administered to patients with high-risk neuroblastoma after conditioning chemotherapy. The primary objective was to determine the maximum tolerated NK-cell dose (MTD). Secondary objectives included assessing anti-neuroblastoma activity and its relationship to donor-recipient KIR/HLA genotypes, NK function, and donor NK chimerism. Patients received a lymphodepleting regimen prior to infusion of haploidentical CD3-CD56+ NK-cells, followed by m3F8. Overall and progression free survival (PFS) were assessed from the time of first NK-cell dose. Univariate Cox regression assessed relationship between dose and outcomes. Thirty-five patients received NK-cells at one of five dose levels ranging from <1×106 to 50×106 CD3-CD56+cells/kg. One patient experienced grade 3 hypertension and grade 4 pneumonitis. MTD was not reached. Ten patients (29%) had complete or partial response; 17 (47%) had no response; and eight (23%) had progressive disease. No relationship was found between response and KIR/HLA genotype or between response and FcγRIII receptor polymorphisms. Patients receiving >10×106 CD56+cells/kg had improved PFS (HR: 0.36, 95%CI: 0.15-0.87, p = 0.022). Patient NK-cells displayed high NKG2A expression, leading to inhibition by HLA-E-expressing neuroblastoma cells. Adoptive NK-cell therapy in combination with m3F8 is safe and has anti-neuroblastoma activity at higher cell doses.",
"affiliations": "Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Immunology Program, Sloan-Kettering Institute for Cancer Research, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Epidemiology and Biostatistics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Epidemiology and Biostatistics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY.;Immunology Program, Sloan-Kettering Institute for Cancer Research, New York, NY.",
"authors": "Modak|Shakeel|S|;Le Luduec|Jean-Benoit|JB|;Cheung|Irene Y|IY|0000-0002-1427-514X;Goldman|Debra A|DA|;Ostrovnaya|Irina|I|;Doubrovina|Ekaterina|E|;Basu|Ellen|E|;Kushner|Brian H|BH|;Kramer|Kim|K|;Roberts|Stephen S|SS|;O'Reilly|Richard J|RJ|;Cheung|Nai-Kong V|NV|0000-0001-6323-5171;Hsu|Katharine C|KC|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1080/2162402X.2018.1461305",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2162-4011",
"issue": "7(8)",
"journal": "Oncoimmunology",
"keywords": "NK Cells; adoptive immunotherapy; m3F8; neuroblastoma",
"medline_ta": "Oncoimmunology",
"mesh_terms": null,
"nlm_unique_id": "101570526",
"other_id": null,
"pages": "e1461305",
"pmc": null,
"pmid": "30221057",
"pubdate": "2018",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't; D052061:Research Support, N.I.H., Extramural",
"references": "22869886;15048706;14734455;28236454;23890779;27555472;8336186;10854660;27655849;28733263;25786176;28236750;19179302;25604432;16297863;21328522;24644014;22279576;17586306;20935224;15632206;16079848;20700504;20581313;18268541;17947671;28972044;16901727;15728129;22863621;20085940;11107135;20879881;23552990;12391228;28549783;25786175;19934297;28939747;28210257;22203761;22754766;9217189;26140243;18198346;17100882;10914706;25403209",
"title": "Adoptive immunotherapy with haploidentical natural killer cells and Anti-GD2 monoclonal antibody m3F8 for resistant neuroblastoma: Results of a phase I study.",
"title_normalized": "adoptive immunotherapy with haploidentical natural killer cells and anti gd2 monoclonal antibody m3f8 for resistant neuroblastoma results of a phase i study"
} | [
{
"companynumb": "US-MYLANLABS-2018M1077562",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TOPOTECAN HYDROCHLORIDE"
},
"drugadditional":... |
{
"abstract": "BACKGROUND\nSpontaneous reporting of adverse drug reactions (ADRs) is used for continuous risk-benefit evaluation of marketed pharmaceutical products and for signal detection. The Adverse Drug Event Manager (ADEM) is a service offered to clinicians employed at hospitals in the Capital Region of Denmark. The ADEM assists healthcare professionals in reporting suspected ADRs to the Danish Health Authority. The aim of this retrospective observational study was to quantify and describe ADRs reported via the ADEM in 2014.\n\n\nMETHODS\nAll ADR reports handled by the ADEM in 2014 were recorded anonymously and analysed descriptively.\n\n\nRESULTS\nA total of 484 ADRs were reported through the ADEM in 2014 (the median number of reports per month was 37; range: 17-78). The majority of the reports came from departments of internal medicine (61%), psychiatry (14%) and dermatology, ophthalmology or otorhinolaryngology (11%). The drugs most frequently reported were lisdexamphetamine (n = 40), rivaroxaban (n = 16) and warfarin (n = 15) (vaccines excluded). In 13 out of 484 reports, the ADR was associated with a fatal outcome.\n\n\nCONCLUSIONS\nThe findings of this study indicate that an ADEM promotes and facilitates spontaneous ADR reporting and helps raise awareness about ADRs, including how and why they should be reported. Hopefully, this will assist national and European spontaneous reporting systems in their work to increase patient safety nationally and abroad.\n\n\nBACKGROUND\nnone.\n\n\nBACKGROUND\nnot relevant. .",
"affiliations": "espen.jimenez.solem@regionh.dk.",
"authors": "Vinther|Siri|S|;Klarskov|Pia|P|;Borgeskov|Hanne|H|;Darsø|Perle|P|;Christophersen|Anette Kvindebjerg|AK|;Borck|Bille|B|;Christensen|Catrine|C|;Hansen|Melissa Voigt|MV|;Halladin|Natalie Monica Løvland|NM|;Christensen|Mikkel Bring|MB|;Harboe|Kirstine Moll|KM|;Lund|Marie|M|;Jimenez-Solem|Espen|E|",
"chemical_list": "D000925:Anticoagulants; D000697:Central Nervous System Stimulants; D065427:Factor Xa Inhibitors; D014859:Warfarin; D000069552:Rivaroxaban; D000069478:Lisdexamfetamine Dimesylate",
"country": "Denmark",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2245-1919",
"issue": "64(1)",
"journal": "Danish medical journal",
"keywords": null,
"medline_ta": "Dan Med J",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D016907:Adverse Drug Reaction Reporting Systems; D000368:Aged; D000369:Aged, 80 and over; D000925:Anticoagulants; D000697:Central Nervous System Stimulants; D002648:Child; D002675:Child, Preschool; D003718:Denmark; D003880:Dermatology; D065427:Factor Xa Inhibitors; D005260:Female; D006748:Hospital Departments; D006761:Hospitals; D006801:Humans; D007223:Infant; D007231:Infant, Newborn; D007388:Internal Medicine; D000069478:Lisdexamfetamine Dimesylate; D008297:Male; D008875:Middle Aged; D009885:Ophthalmology; D010036:Otolaryngology; D011358:Product Surveillance, Postmarketing; D011567:Psychiatric Department, Hospital; D012189:Retrospective Studies; D000069552:Rivaroxaban; D014859:Warfarin; D055815:Young Adult",
"nlm_unique_id": "101576205",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "28007050",
"pubdate": "2017-01",
"publication_types": "D016428:Journal Article; D064888:Observational Study",
"references": null,
"title": "An adverse drug event manager facilitates spontaneous reporting of adverse drug reactions.",
"title_normalized": "an adverse drug event manager facilitates spontaneous reporting of adverse drug reactions"
} | [
{
"companynumb": "PHHY2017DK023965",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "ZOLEDRONIC ACID"
},
"drugadditional": null,
... |
{
"abstract": "Transarterial chemoembolization with irinotecan loaded beads (DEBIRI-TACE) represents an investigative treatment option for patients with metastatic colorectal cancer (mCRC). The present study examined DEBIRI-TACE with concomitant mFOLOFX6-bevacizumab as a first-line treatment for mCRC and explored the clinical value of circulating cell-free DNA (cfDNA). Patients with limited mCRC of the liver who had not been treated with chemotherapy received up to 4 biweekly DEBIRI-TACE treatments. The endpoints examined included the response rate, survival, toxicity and translational analysis. Due to toxicity and lack of feasibility, the study closed prematurely. Total cfDNA was measured with a direct fluorescent assay. Between December 2012 and February 2014, 14 patients underwent a total of 49 DEBIRI-TACE treatments. With a median follow-up of 1.7 years, the median progression free survival and overall survival (OS) were 240 days [95% confidence interval (CI): 161-357] and 522 days (95% CI: 174-1,054), respectively. The response rate was 50%. Twelve patients experienced grade 3 toxicity or above. Dynamics of cfDNA showed biological variations in relation to therapy. To conclude, the present results indicated a response rate of 50% and median OS of 522 days for 14 patients with mCRC undergoing DEBIRI-TACE, but unacceptable toxicity and lack of feasibility with the applied schedule. The findings suggest that the level of cfDNA may be associated with the disease course, response to treatment and outcome.\n\n\nBACKGROUND\nThe European Clinical Trials database (EudraCT no. 2012-000987-11) at 05-14-2012.",
"affiliations": "Department of Oncology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Oncology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Radiology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Surgical Gastroenterology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Experimental Clinical Oncology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Oncology, Aarhus University Hospital, 8000 Aarhus C, Denmark.;Department of Oncology, Aarhus University Hospital, 8000 Aarhus C, Denmark.",
"authors": "Boysen|Anders Kindberg|AK|;Jensen|Martin|M|;Nielsen|Dennis Tønner|DT|;Mortensen|Frank Viborg|FV|;Sørensen|Brita Singers|BS|;Jensen|Anni Ravnsbæk|AR|;Spindler|Karen-Lise|KL|",
"chemical_list": null,
"country": "Greece",
"delete": false,
"doi": "10.3892/ol.2018.8925",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1792-1074",
"issue": "16(2)",
"journal": "Oncology letters",
"keywords": "cell free DNA; chemo-embolization; colorectal cancer; liver metastases",
"medline_ta": "Oncol Lett",
"mesh_terms": null,
"nlm_unique_id": "101531236",
"other_id": null,
"pages": "2654-2660",
"pmc": null,
"pmid": "30013661",
"pubdate": "2018-08",
"publication_types": "D016428:Journal Article",
"references": "25220842;17094403;25583567;19470929;18875018;18210761;19137310;19729503;28778958;25654990;6306721;19097774;3806280;27380959;22493375;24798213;26149602;29110585;22842404;837366;29253083;6226917;25337750;25851626",
"title": "Cell-free DNA and chemoembolization in patients with liver metastases from colorectal cancer.",
"title_normalized": "cell free dna and chemoembolization in patients with liver metastases from colorectal cancer"
} | [
{
"companynumb": "DK-PFIZER INC-2018287491",
"fulfillexpeditecriteria": "1",
"occurcountry": "DK",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "OXALIPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "Differentiating between anaphylaxis and hypotension during general anaesthesia is difficult, especially when patients present with only hypotension and without any of the other classical features of anaphylaxis. We report the successful management of an anaphylactic reaction to rocuronium that presented as isolated hypotension in a 45-year-old Indonesian man presented with lacerations on the scalp and right pinna caused by an assault to the head after the induction of general anaesthesia, refractory to fluids and high doses of vasopressors. This case highlights that a possible indicator of anaphylaxis can be the presence of isolated hypotension during.",
"affiliations": "Hospital Bintulu, Department of Anaesthesiology & Critical Care, Bintulu, Sarawak, Malaysia. shinf22@gmail.com.;Hospital Bintulu, Department of Anaesthesiology & Critical Care, Bintulu, Sarawak, Malaysia.",
"authors": "Mok|C S|CS|;Vanessa|L|L|",
"chemical_list": "D000077123:Rocuronium",
"country": "Malaysia",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0300-5283",
"issue": "76(2)",
"journal": "The Medical journal of Malaysia",
"keywords": null,
"medline_ta": "Med J Malaysia",
"mesh_terms": "D000707:Anaphylaxis; D000768:Anesthesia, General; D006801:Humans; D007022:Hypotension; D007214:Indonesia; D008297:Male; D008875:Middle Aged; D000077123:Rocuronium",
"nlm_unique_id": "0361547",
"other_id": null,
"pages": "267-269",
"pmc": null,
"pmid": "33742644",
"pubdate": "2021-03",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Isolated hypotension after the induction of general anesthesia refractory to fluids and vasopressors: An indicator of anaphylaxis.",
"title_normalized": "isolated hypotension after the induction of general anesthesia refractory to fluids and vasopressors an indicator of anaphylaxis"
} | [
{
"companynumb": "MY-FRESENIUS KABI-FK202110743",
"fulfillexpeditecriteria": "1",
"occurcountry": "MY",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "PROPOFOL"
},
"drugadditional": "4",
... |
{
"abstract": "At present, intrahepatic cholangiocarcinoma is a contraindication for liver transplantation. However, previous studies in this field did not preselect patients on the basis of chemosensitivity or disease trajectory after neoadjuvant therapy. Experience with hilar cholangiocarcinoma has indicated that neoadjuvant therapy followed by liver transplantation in patients without disease progression results in a long-term survival benefit. We aimed to establish the potential efficacy of liver transplantation in patients with biologically responsive intrahepatic cholangiocarcinoma who have had sustained tumour stability or regression with neoadjuvant therapy.\n\n\n\nIn this prospective case-series, patients with locally advanced, unresectable intrahepatic cholangiocarcinoma, without extrahepatic disease or vascular involvement, were treated at a single liver transplant centre according to a non-randomised, centre-approved clinical management protocol with neoadjuvant chemotherapy followed by liver transplantation. Neoadjuvant therapy consisted of gemcitabine-based chemotherapy, such as gemcitabine-cisplatin or gemcitabine-capecitabine, with second-line or third-line therapies given per institutional standards. Patients with a minimum of 6 months of radiographic response or stability were listed for liver transplantation. The primary endpoints were overall survival and recurrence-free survival after liver transplantation, assessed with Kaplan-Meier analysis. This report includes interim data from the initial case-series treated under this ongoing clinical management protocol, censored on Dec 1, 2017.\n\n\n\nBetween Jan 1, 2010, and Dec 1, 2017, 21 patients were referred for evaluation and 12 patients were accepted, of whom six patients have undergone liver transplantation for intrahepatic cholangiocarcinoma. Three patients received livers from extended criteria deceased donors that would otherwise have been discarded, two from domino living donors, and one from a standard criteria liver donor. Median duration from diagnosis to transplantation was 26 months (IQR 17-33) and median follow-up from transplantation was 36 months (29-51). All patients received neoadjuvant chemotherapy while awaiting liver transplantation. Overall survival was 100% (95% CI 100-100) at 1 year, 83·3% (27·3-97·5) at 3 years, and 83·3% (27·3-97·5) at 5 years. Three patients developed recurrent disease at a median of 7·6 months (IQR 5·8-8·6) after transplantation, with 50% (95% CI 11·1-80·4) recurrence-free survival at 1, 3, and 5 years. Adverse events after liver transplantation included one patient with postoperative ileus (grade 3) and one patient with acute kidney injury requiring temporary dialysis (grade 4).\n\n\n\nSelected patients with locally advanced intrahepatic cholangiocarcinoma who show pre-transplant disease stability on neoadjuvant therapy might benefit from liver transplantation.\n\n\n\nNone.",
"affiliations": "J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Department of Gastrointestinal Medical Oncology, Division of Cancer Medicine, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Oncology, Houston Methodist Hospital, Houston, TX, USA.;Department of Gastrointestinal Medical Oncology, Division of Cancer Medicine, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Gastrointestinal Medical Oncology, Division of Cancer Medicine, University of Texas MD Anderson Cancer Center, Houston, TX, USA; Department of Clinical Oncology, Assiut University, Assiut, Egypt.;Department of Radiology, Houston Methodist Hospital, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Department of Pathology and Genomic Medicine, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Department of Pathology and Genomic Medicine, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Department of Gastrointestinal Medical Oncology, Division of Cancer Medicine, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Hepato-Pancreato-Biliary Section, Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Hepato-Pancreato-Biliary Section, Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA.;Hepato-Pancreato-Biliary Section, Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, TX, USA.;J C Walter Jr Transplant Center, Sherrie and Alan Conover Center for Liver Disease and Transplantation, Weill Cornell Medical College, Houston Methodist Hospital and Research Institute, Houston, TX, USA. Electronic address: rmghobrial@houstonmethodist.org.",
"authors": "Lunsford|Keri E|KE|;Javle|Milind|M|;Heyne|Kirk|K|;Shroff|Rachna T|RT|;Abdel-Wahab|Reham|R|;Gupta|Nakul|N|;Mobley|Constance M|CM|;Saharia|Ashish|A|;Victor|David W|DW|;Nguyen|Duc T|DT|;Graviss|Edward A|EA|;Kaseb|Ahmed O|AO|;McFadden|Robert S|RS|;Aloia|Thomas A|TA|;Conrad|Claudius|C|;Li|Xian C|XC|;Monsour|Howard P|HP|;Gaber|A Osama|AO|;Vauthey|Jean-Nicolas|JN|;Ghobrial|R Mark|RM|;|||",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/S2468-1253(18)30045-1",
"fulltext": null,
"fulltext_license": null,
"issn_linking": null,
"issue": "3(5)",
"journal": "The lancet. Gastroenterology & hepatology",
"keywords": null,
"medline_ta": "Lancet Gastroenterol Hepatol",
"mesh_terms": "D000328:Adult; D000971:Antineoplastic Combined Chemotherapy Protocols; D001650:Bile Duct Neoplasms; D017024:Chemotherapy, Adjuvant; D018281:Cholangiocarcinoma; D018572:Disease-Free Survival; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D053208:Kaplan-Meier Estimate; D016031:Liver Transplantation; D008297:Male; D008875:Middle Aged; D009154:Mutation; D020360:Neoadjuvant Therapy; D011183:Postoperative Complications; D011446:Prospective Studies; D011859:Radiography; D012008:Recurrence",
"nlm_unique_id": "101690683",
"other_id": null,
"pages": "337-348",
"pmc": null,
"pmid": "29548617",
"pubdate": "2018-05",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Liver transplantation for locally advanced intrahepatic cholangiocarcinoma treated with neoadjuvant therapy: a prospective case-series.",
"title_normalized": "liver transplantation for locally advanced intrahepatic cholangiocarcinoma treated with neoadjuvant therapy a prospective case series"
} | [
{
"companynumb": "US-ACCORD-065275",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE"
},
"drugadditi... |
{
"abstract": "BACKGROUND\nAdenomyosis remains an enigma for the reproductive endocrinologist. It is thought to contribute to sub-fertility, and its only curative treatment is hysterectomy. However, studies have documented increased live birth rates in women with adenomyosis who were treated with gonadotropin releasing hormone agonist (GnRHa).\n\n\nMETHODS\nHere we present a case of a 52-year-old woman with adenomyosis who had three failed frozen embryo transfers (FETs) prior to initiating a 6-month trial of GnRHa. GnRHa therapy resulted in a decrease in uterine size from 11.5 × 7.9 × 7.0 cm to 7.8 × 6.2 × 5.9 cm and a decrease in the junctional zone (JZ) thickness from 19 to 9 mm. Subsequently, she underwent her fourth FET, which resulted in live birth of twins. The delivery was complicated by expansive accretas of both placentas requiring cesarean hysterectomy. The final pathology of the placentas demonstrated an extensive lack of decidualized endometrium that was even absent outside the basal plate.\n\n\nCONCLUSIONS\nGnRHa therapy in patients with adenomyosis may improve implantation rates after FET. Previous molecular studies indicate that genetic variance in the expression of the gonadotropin releasing hormone receptor (GnRHR) could explain the expansive lack of decidualized endometrium after GnRHa therapy. Further investigations are needed to determine if GnRHa therapy contributes to the pathologic process of placenta accreta.",
"affiliations": "Department of Obstetrics and Gynecology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX, 77030, USA. Agrawala.Shilpi@gmail.com.;Department of Obstetrics and Gynecology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX, 77030, USA.;Department of Obstetrics and Gynecology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX, 77030, USA.;Department of Obstetrics and Gynecology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX, 77030, USA.",
"authors": "Agrawala|Shilpi|S|;Patil|Jeevitha|J|;Campbell|Sukhkamal|S|;Woodard|Terri Lynn|TL|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s40738-021-00097-4",
"fulltext": "\n==== Front\nFertil Res Pract\nFertil Res Pract\nFertility Research and Practice\n2054-7099 BioMed Central London \n\n97\n10.1186/s40738-021-00097-4\nCase Report\nA rare case of extensive placenta accreta in twin pregnancy after GnRH agonist treatment of adenomyosis\nAgrawala Shilpi Agrawala.Shilpi@gmail.com 1 Patil Jeevitha 1 Campbell Sukhkamal 1 Woodard Terri Lynn 12 1 grid.39382.330000 0001 2160 926XDepartment of Obstetrics and Gynecology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030 USA \n2 grid.240145.60000 0001 2291 4776Department of Gynecologic Oncology and Reproductive Medicine, M.D. Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030 USA \n3 3 2021 \n3 3 2021 \n2021 \n7 55 10 2020 15 2 2021 © The Author(s) 2021Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nAdenomyosis remains an enigma for the reproductive endocrinologist. It is thought to contribute to sub-fertility, and its only curative treatment is hysterectomy. However, studies have documented increased live birth rates in women with adenomyosis who were treated with gonadotropin releasing hormone agonist (GnRHa).\n\nCase\nHere we present a case of a 52-year-old woman with adenomyosis who had three failed frozen embryo transfers (FETs) prior to initiating a 6-month trial of GnRHa. GnRHa therapy resulted in a decrease in uterine size from 11.5 × 7.9 × 7.0 cm to 7.8 × 6.2 × 5.9 cm and a decrease in the junctional zone (JZ) thickness from 19 to 9 mm. Subsequently, she underwent her fourth FET, which resulted in live birth of twins. The delivery was complicated by expansive accretas of both placentas requiring cesarean hysterectomy. The final pathology of the placentas demonstrated an extensive lack of decidualized endometrium that was even absent outside the basal plate.\n\nConclusions\nGnRHa therapy in patients with adenomyosis may improve implantation rates after FET. Previous molecular studies indicate that genetic variance in the expression of the gonadotropin releasing hormone receptor (GnRHR) could explain the expansive lack of decidualized endometrium after GnRHa therapy. Further investigations are needed to determine if GnRHa therapy contributes to the pathologic process of placenta accreta.\n\nKeywords\nAdenomyosisGnRH agonistPlacenta accretaLive birthFrozen embryo transferissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\nAdenomyosis is a pathologic condition characterized by the presence of endometrial glands and stroma within the myometrium. While histopathology is the gold standard for diagnostic confirmation, improved ultrasound and MRI technology has led to highly sensitive and specific alternative modalities for diagnosis. A recent systematic review showed that the sensitivities for ultrasound and MRI, respectively, were 72 and 77% [1]. MRI specificity is slightly higher at 89% compared to 81% for ultrasound. When diagnosing adenomyosis using either imaging modality, physicians focus on the junctional zone, the heterogeneity of the uterine wall, and asymmetry in the thickness of the uterine walls [2–4].\n\nThe growing utilization of non-invasive diagnostic imaging in patients undergoing infertility workup has led to an increased recognition of adenomyosis in this population. Due to its association with sub-fertility and the definitive treatment being hysterectomy, adenomyosis has presented a clinical dilemma for reproductive endocrinologists. Thus far, there are no formal guidelines for fertility-sparing treatment of adenomyosis, and current methods are largely based on retrospective case series and case reports [5–9]. Surgical resection, typically reserved for focal lesions, carries an increased risk of uterine rupture [6, 9]. Fertility centers can also treat focal and diffuse adenomyosis with medical therapy, which typically consists of gonadotropin releasing hormone agonist (GnRHa) for 3 to 6 months prior to fresh or frozen embryo transfer [5, 6, 10]. By inducing apoptosis and reducing angiogenesis, GnRHa is thought to decrease the size of the ectopic endometrial glands constituting adenomyosis [5, 11]. Here we present a successful twin live birth in a 52-year-old patient with three prior failed frozen embryo transfers (FETs) who, after GnRHa therapy, underwent FET and achieved clinical pregnancy.\n\nCase description\nThe patient presented to our fertility clinic at age 48 as a nulligravida desiring pregnancy. She had a history of fibroids for which she had undergone a myomectomy at an outside institution. The patient reported that the surgeon removed nine fibroids. Of note, the operative report was unavailable for review so the type of myomectomy, size of myomas, and depth of myometrial invasion were unable to be confirmed. After surgery, she was told that she would require pre-labor cesarean delivery if she became pregnant. She reported regular monthly menses and no medical comorbidities. Initial evaluation at our clinic included transvaginal ultrasound (TVUS), antral follicle count (AFC) as well as anti-Mullerian hormone measurement (AMH) and assessment for metabolic syndrome. TVUS revealed three intramural fibroids (the largest 2.5 cm in diameter), none of which appeared to be impacting the endometrial cavity. Her AFC was 3, AMH was 0.52 ng/mL, thyroid function and insulin resistance testing were normal.\n\nAt her follow-up visit, a saline-infused sonohysterogram (SIS) was attempted but only partially successful due to cervical stenosis. A left hydrosalpinx was visualized, and diagnostic laparoscopy was pursued. In the operating room, cervical dilation was performed. Subsequently, chromotubation revealed non-patent fallopian tubes, and due to extensive adhesive disease, bilateral Filshie clips were placed in lieu of salpingectomy. No evidence of endometriosis was seen during her laparoscopy, and the adhesive disease was thought to be due to her prior myomectomy. She had a repeat SIS which was successful and a normal endometrial cavity was seen. None of the previously seen fibroids were noted to have a submucosal component. A mock embryo transfer was performed without complication.\n\nIn spite of our recommendation to pursue donor eggs, the patient highly desired a trial of in-vitro fertilization (IVF) using autologous oocytes. She underwent ovarian stimulation using 450 IU of Bravelle (urofollitopin) and 150 IU of Menopur (menotropin) daily. GnRH antagonist 0.25 mg was started on stimulation day (SD) 4 to prevent premature follicle maturation. She was triggered on SD8 with 10,000 units of human chorionic gonadotropin when there were 3 follicles > 17 mm in size and estradiol peaked at 922 pg/mL. Four oocytes were retrieved from this cycle, but only one was mature. Intracytoplasmic sperm injection (ICSI) was performed on the mature oocyte; however, there was failed fertilization. After this outcome, the patient desired an emotional break from the IVF process.\n\nFifteen months later, the patient returned to our clinic to resume fertility treatment. At this point, she agreed to use fresh donor oocytes and undergo FET. The 24 year-old donor underwent an uncomplicated ovarian stimulation and oocyte retrieval. A total of 45 mature oocytes were retrieved. Following ICSI, there were 39 two pronuclear embryos that fertilized normally and were cultured to blastocyst-stage in single step media. Eighteen blastocysts were biopsied and vitrified. Fifteen of the 18 embryos were euploid. The patient underwent another SIS and mock ET, both of which were normal. She started 3 estradiol 0.1 mg patches every other day in preparation for FET. During her ultrasound for a lining check, her endometrial stripe (EMS) was 10 mm, so she started 90 mg of 8% vaginal gel twice daily and 50 mg of intramuscular progesterone daily. Six days after progresterone supplementation, she had her first FET of 1 euploid blastocyst. Her pregnancy test 10 days later was negative.\n\nShe decided to pursue another cycle, and after extensive counseling regarding the risks associated with twin pregnancy, the decision was made to proceed with transfer of 2 euploid blastocysts. This transfer resulted in an anembryonic pregnancy, diagnosed by abnormally rising B-HCG and ultrasounds done 2 weeks apart which demonstrated a gestational sac without interval development of a fetal pole. Over the next 2 weeks, her B-HCG was serially monitored, as patient desired expectant management, and her levels were trending downward. The pregnancy failed to evacuate completely after expectant management, and she consented to a suction dilation and curettage. The pathology results were confirmatory of an anembryonic pregnancy.\n\nThe patient wished to proceed with another embryo transfer. Prior to this transfer, a pelvic MRI was completed to evaluate if any of her fibroids (described previously) impacted the endometrial cavity. The MRI only showed evidence of adenomyosis as characterized by thickened junction zone (JZ) at 19 mm with multiple 1-2 mm myometrial junctional zone cysts (Fig. 1). Since the endometrial cavity was clear on MRI, the patient underwent a third FET of 2 euploid embryos. Her subsequent pregnancy test was negative.\nFig. 1 An axial T-1 weighted MRI image shows multiple 1-2 cm myometerial junctional zone cysts (arrowheads) and a thickened junctional zone (arrows)\n\n\n\nAfter the third unsuccessful FET, the patient was counseled that her adenomyosis could be contributing to the multiple failed FETs. She was counseled on the options of using a gestational carrier vs. medical management. She decided to pursue medical management using leuprolide acetate (GnRHa) for 6 months prior to another FET. She received monthly intramuscular injections of 3.75 mg of leuprolide acetate. Three weeks after the last injection, another MRI was completed which showed a decrease in the JZ from 19 to 9 mm. Uterine size also decreased from 11.5 × 7.9 × 7.0 cm to 7.8 × 6.2 × 5.9 cm (Figs. 2 and 3). Prior to her next FET, the patient was counseled on the number of embryos to transfer. While single embryo transfer (sET) was recommended, we decided to proceed with double embryo transfer due to her history of multiple failed transfers and personal preference. The same protocol for FET preparation was used, and she underwent her fourth FET of 2 euploid blastocysts after an EMS of 10.2 mm was confirmed.\nFig. 2 Sagital T-2 images before and after GnRHa therapy showing a decrease in junctional zone thickness. a Before GnRHa therapy, the junctional zone is thickened at 19 mm (arrows). b After GnRHa therapy for 6 months, the junctional zone has decreased to 9 mm (arrows)\n\nFig. 3 Axial T-2 fat-suppresed images of the uterus before and after GnRHa therapy demonstrating a decrease in cystic spaces in the junctional zone. a Cystic spaces (arrows) within the junctional zone consistent with adenomyosis prior to GnRHa therapy. b After GnRHa therapy, the cystic spaces (arrow) and junctional zone have decreased in size\n\n\n\nHer initial B-HCG of 1010.3 collected 10 days after FET confirmed pregnancy, and subsequent TVUS several weeks later confirmed viable intrauterine twin pregnancy. She was followed by our fertility center until 10 weeks gestational age (GA) and then transferred to a general obstetrician. Her dichorionic-diamniotic pregnancy was complicated by placenta previa in Twin A for which she had serial ultrasounds. At 27 weeks GA, Twin B was noted to have intrauterine growth restriction (IUGR) < 5th percentile for which she had weekly biophysical profiles. At 31 weeks GA, the patient started developing elevated blood pressures and was transferred to a tertiary care center as the estimated fetal weight of Twin B was less than 1800 g. She was diagnosed with pre-eclampsia without severe features and discharged home after receiving betamethasone for fetal lung maturity. She followed up with the maternal fetal medicine specialists as an outpatient. At 32 weeks, she was admitted for extended maternal fetal monitoring due to worsening pre-eclampsia, IUGR of Twin B < 5th percentile, and placenta previa of Twin A. The patient developed pre-eclampsia with severe features at 33 weeks and was expectantly managed until 34 weeks. She was delivered at 34 weeks via planned primary cesarean due to placenta previa and history of open myomectomy. Cesarean delivery was complicated by extensive accretas of both placentas, which necessitated a supracervical hysterectomy. The patient did not sustain any post-operative complications and has since resumed her daily activities. The neonates also had an uncomplicated hospital stay and are currently meeting all their developmental milestones.\n\nDiscussion and conclusions\nThis case demonstrates that GnRHa therapy for 6 months in patients with adenomyosis may improve implantation rates after FET, which is consistent with prior studies [7, 8]. Through pituitary downregulation, long-term GnRHa therapy has been shown to decrease the size of adenomyotic lesions [11, 12]. Our patient also had a decrease in her uterine size and a decrease in her JZ from 19 mm to 9 mm on MRI. This decrease in JZ could have facilitated implantation as a thickened JZ prior to FET has been associated with low implantation rates [13]. One study showed that a JZ > 12 mm was associated with an implantation rate of 5% during FET whereas JZ < 10 mm was associated with a 45% implantation rate [14]. Thus, one plausible theory for how GnRHa treatment facilitated pregnancy in our patient was through decreasing the JZ.\n\nThe question remains if GnRHa treatment for 6 months also led to the extensive lack of decidualized endometrium, which subsequently led to the development of expansive accretas of both placentas. The patient did have other risk factors for placenta accreta such as IVF treatment, advanced maternal age (AMA), and prior myomectomy [15–19]. The degree of her placental disease raises concern for a a global change to the endometrial stratum basalis, as opposed to the focal changes often seen with IVF pregnancies and a history of myomectomy. The description in the pathology report was that the uterus had no decidualized endometrium on the implantation site of placenta A and the implantation site of placenta B only had a focal area of decidualized endometrium. Within the remainder of the uterine specimen, there was only one other focal area of decidualized endometrium, and it was located within the myometrium, consistent with adenomyosis. There was no histologic evidence of placental invasion past the myometrium nor was there any histologic evidence of endometriosis. Although her prior myomectomy could have contributed to the development of a placenta accreta, it is unlikely to be the sole cause as myomectomies tend to cause focal accretas at the endomyometrial incision site [18, 19]. While undergoing IVF treatments and being of AMA are also risk factors for placenta accreta, neither has been associated with an expansive placenta accreta such as this one. The encompassing surface area of affected endometrium indicates a more systemic defect in decidualization.\n\nAlthough no studies have investigated whether GnRHa therapy can affect endometrial decidualization, molecular studies have demonstrated that GnRHa also directly exerts anti-proliferative effects on the target organ through the gonadotropin releasing hormone receptor (GnRHR) [11, 20]. In these studies, the direct effect of GnRHa was highly variable between different samples which was attributed to the genetic variance in GnRHR capacity and affinity for GnRHa. We hypothesize that our patient had a genetic variance in GnRHR that could be associated with an increased response to GnRHa. Thus, GnRHa downregulated cellular function at the level of the endometrium so profoundly that it subsequently inhibited or delayed the process of endometrial decidualization. Since this may only affect a small subset of the population, it could explain why other studies of GnRHa therapy in patients with adenomyosis have not shown an increased risk for placenta accreta.\n\nFurther investigation is necessary since GnRHa therapy is a widely used medication both in IVF protocols, in treatment of endometriosis, and more recently in patients with adenomyosis. Pregnancies conceived after IVF do have an increased risk for subsequent placenta accreta [15, 16]. These studies did not compare GnRH agonist vs GnRH antagonist protocols, but that could be a potential area of study in the future [15, 16, 21, 22]. Although larger studies have shown that endometriosis is associated with increased risk for placenta accreta, smaller studies did not find an association as it was a rare outcome [23–25]. None of these studies reported whether the patients were treated with GnRHa prior to pregnancy. Case literature has reported that adenomyosis could be a pre-disposing factor for placenta accreta; however, larger studies have not validated that finding [26–29]. Thus, larger studies on patients who receive GnRHa therapy prior to conception for any condition (endometriosis, adenomyosis, or IVF) may be able to demonstrate that there is an increased risk of abnormal placentation with GnRHa therapy.\n\nLastly, in patients with adenomyosis who receive GnRHa therapy prior to FET, we would recommend single embryo transfer and MFM consultation. We discussed with our patient on multiple occasions that sET is the standard of care when transferring euploid embryos. However, given her multiple rounds of IVF and personal preference, a shared decision was made to transfer two euploid embryos. In addition, we would recommend MFM consultation in patients that achieve pregnancy after GnRHa therapy to monitor for the development of abnormal placentation with serial ultrasounds. Targetted monitoring has been shown to increase rates of detection as well as decrease estimated blood loss and maternal hospital stay [30].\n\nAbbreviations\nGnRHaGonadotropin releasing hormone agonist\n\nFETsFrozen embryo transfers\n\nJZJunctional zone\n\nTVUSTransvaginal ultrasound\n\nAFCAntral follicle count\n\nAMHAnti-Mullerian hormone\n\nSISSaline-infused sonohysterogram\n\nIVFIn-vitro fertilization\n\nSDStimulation day\n\nICSIIntracytoplasmic sperm injection\n\nEMSEndometrial stripe\n\nGAGestational age\n\nIUGRIntrauterine growth restriction\n\nGnRHRGonadotropin releasing hormone receptor\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nWe would like to acknowledge Dr. Popek, Director of Perinatal and Placental Pathology, who shared her insight and expertise regarding the unique findings of this case. Also, we would like to thank Dr. Jewel Appleton who provided the images for this case report.\n\nCode availability\nN/A\n\nAuthors’ contributions\nAll the authors actively participated in the production of this manuscript. The author(s) read and approved the final manuscript.\n\nFunding\nNone.\n\nAvailability of data and materials\nN/A\n\nEthics approval and consent to participate\nNot applicable in case reports or case series. Our institution only requires that written consent be obtained prior to publication. This consent has been obtained.\n\nInformed consent was obtained for this case report from the participant.\n\nConsent for publication\nThe participant has consented to the submission of the case report to the journal.\n\nCompeting interests\nThe authors declare that they have no conflict of interest.\n==== Refs\nReferences\n1. Champaneria R Abedin P Daniels J Balogun M Khan KS Ultrasound scan and magnetic resonance imaging for the diagnosis of adenomyosis: systematic review comparing test accuracy Acta Obstet Gynecol Scand 2010 89 11 1374 1384 10.3109/00016349.2010.512061 20932128 \n2. Reinhold C McCarthy S Bret PM Mehio A Atri M Zakarian R Glaude Y Liang L Seymour RJ Diffuse adenomyosis: comparison of endovaginal US and MR imaging with histopathologic correlation Radiology 1996 199 1 151 158 10.1148/radiology.199.1.8633139 8633139 \n3. Dueholm M Lundorf E Transvaginal ultrasound or MRI for diagnosis of adenomyosis Curr Opin Obstet Gynecol 2007 19 6 505 512 10.1097/GCO.0b013e3282f1bf00 18007126 \n4. Meredith SM Sanchez-Ramos L Kaunitz AM Diagnostic accuracy of transvaginal sonography for the diagnosis of adenomyosis: systematic review and metaanalysis Am J Obstet Gynecol 2009 201 1 107 1e1 10.1016/j.ajog.2009.03.021 19398089 \n5. Younes G Tulandi T Effects of adenomyosis on in vitro fertilization treatment outcomes: a meta-analysis Fertil Steril 2017 108 3 483 490 10.1016/j.fertnstert.2017.06.025 28865548 \n6. Maheshwari A Gurunath S Fatima F Bhattacharya S Adenomyosis and subfertility: a systematic review of prevalence, diagnosis, treatment and fertility outcomes Hum Reprod Update 2012 18 4 374 392 10.1093/humupd/dms006 22442261 \n7. Silva PD Perkins HE Schauberger CW Live birth after treatment of severe adenomyosis with a gonadotropin-releasing hormone agonist Fertil Steril 1994 61 1 171 172 10.1016/S0015-0282(16)56471-1 8293832 \n8. Niu Z Chen Q Sun Y Feng Y Long-term pituitary downregulation before frozen embryo transfer could improve pregnancy outcomes in women with adenomyosis Gynecol Endocrinol 2013 29 12 1026 1030 10.3109/09513590.2013.824960 24006906 \n9. Wang CJ Yuen LT Chang SD Lee CL Soong YK Use of laparoscopic cytoreductive surgery to treat infertile women with localized adenomyosis Fertil Steril 2006 86 2 462 4e5 16806205 \n10. Pontis A D'Alterio MN Pirarba S De Angelis C Tinelli R Angioni S Adenomyosis: a systematic review of medical treatment Gynecol Endocrinol 2016 32 9 696 700 10.1080/09513590.2016.1197200 27379972 \n11. Khan KN Kitajima M Hiraki K Fujishita A Nakashima M Ishimaru T Masuzaki H Cell proliferation effect of GnRH agonist on pathological lesions of women with endometriosis, adenomyosis and uterine myoma Hum Reprod 2010 25 11 2878 2890 10.1093/humrep/deq240 20829343 \n12. Yamamoto T Noguchi T Tamura T Kitawaki J Okada H Evidence for estrogen synthesis in adenomyotic tissues Am J Obstet Gynecol 1993 169 3 734 738 10.1016/0002-9378(93)90654-2 8372890 \n13. Campo S Campo V Benagiano G Adenomyosis and infertility Reprod BioMed Online 2012 24 1 35 46 10.1016/j.rbmo.2011.10.003 22116070 \n14. Piver P Uterine factors limiting ART coverage J Gynecol Obstet Bio R 2005 34 7 Pt 2 5S30 5S33 \n15. Esh-Broder E Ariel I Abas-Bashir N Bdolah Y Celnikier DH Placenta accreta is associated with IVF pregnancies: a retrospective chart review BJOG Int J Obstet Gynaecol 2011 118 9 1084 1089 10.1111/j.1471-0528.2011.02976.x \n16. Kyozuka H Yamaguchi A Suzuki D Fujimori K Hosoya M Yasumura S Yokoyama T Sato A Hashimoto K Risk factors for placenta accreta spectrum: findings from the Japan environment and Children’s study BMC Pregnancy Childbirth 2019 19 1 447 10.1186/s12884-019-2608-9 31775687 \n17. Miller DA Chollet JA Goodwin TM Clinical risk factors for placenta previa–placenta accreta Am J Obstet Gynecol 1997 177 1 210 214 10.1016/S0002-9378(97)70463-0 9240608 \n18. Tantbirojn P Crum CP Parast MM Pathophysiology of placenta creta: the role of decidua and extravillous trophoblast Placenta 2008 29 7 639 645 10.1016/j.placenta.2008.04.008 18514815 \n19. Jauniaux E Collins S Burton GJ Placenta accreta spectrum: pathophysiology and evidence-based anatomy for prenatal ultrasound imaging Am J Obstet Gynecol 2018 218 1 75 87 10.1016/j.ajog.2017.05.067 28599899 \n20. Borroni R Di Blasio AM Gaffuri B Santorsola R Busacca M Viganò P Vignali M Expression of GnRH receptor gene in human ectopic endometrial cells and inhibition of their proliferation by leuprolide acetate Mol Cell Endocrinol 2000 159 1–2 37 43 10.1016/S0303-7207(99)00199-9 10687850 \n21. Kaser DJ Melamed A Bormann CL Myers DE Missmer SA Walsh BW Racowsky C Carusi DA Cryopreserved embryo transfer is an independent risk factor for placenta accreta Fertil Steril 2015 103 5 1176 1184 10.1016/j.fertnstert.2015.01.021 25747133 \n22. Saito K Kuwahara A Ishikawa T Morisaki N Miyado M Miyado K Fukami M Miyasaka N Ishihara O Irahara M Saito H Endometrial preparation methods for frozen-thawed embryo transfer are associated with altered risks of hypertensive disorders of pregnancy, placenta accreta, and gestational diabetes mellitus Hum Reprod 2019 34 8 1567 1575 10.1093/humrep/dez079 31299081 \n23. Berlac JF Hartwell D Skovlund CW Langhoff-Roos J Lidegaard Ø Endometriosis increases the risk of obstetrical and neonatal complications Acta Obstet Gynecol Scand 2017 96 6 751 760 10.1111/aogs.13111 28181672 \n24. Shmueli A Salman L Hiersch L Ashwal E Hadar E Wiznitzer A Yogev Y Aviram A Obstetrical and neonatal outcomes of pregnancies complicated by endometriosis J Matern Fetal Neonatal Med 2019 32 5 845 850 10.1080/14767058.2017.1393513 29037097 \n25. Zullo F Spagnolo E Saccone G Acunzo M Xodo S Ceccaroni M Berghella V Endometriosis and obstetrics complications: a systematic review and meta-analysis Fertil Steril 2017 108 4 667 672 10.1016/j.fertnstert.2017.07.019 28874260 \n26. Matsunaga S Uotani T Ohara K Takai Y Baba K Seki H Two cases of placenta accreta identified during pregnancy after laparoscopic myomectomy and resection of adenomyosis Hypertens Res Pregnancy 2015 3 1 38 41 10.14390/jsshp.3.38 \n27. Vigano P Corti L Berlanda N Beyond infertility: obstetrical and postpartum complications associated with endometriosis and adenomyosis Fertil Steril 2015 104 4 802 812 10.1016/j.fertnstert.2015.08.030 26348274 \n28. Hashimoto A Iriyama T Sayama S Nakayama T Komatsu A Miyauchi A Nishii O Nagamatsu T Osuga Y Fujii T Adenomyosis and adverse perinatal outcomes: increased risk of second trimester miscarriage, preeclampsia, and placental malposition J Matern Fetal Neonatal Med 2018 31 3 364 369 10.1080/14767058.2017.1285895 28110584 \n29. Tamura H Kishi H Kitade M Asai-Sato M Tanaka A Murakami T Minegishi T Sugino N Complications and outcomes of pregnant women with adenomyosis in Japan Reprod Med Biol 2017 16 4 330 336 10.1002/rmb2.12050 29259486 \n30. Melcer Y Jauniaux E Maymon S Tsviban A Pekar-Zlotin M Betser M Maymon R Impact of targeted scanning protocols on perinatal outcomes in pregnancies at risk of placenta accreta spectrum or vasa previa Am J Obstet Gynecol 2018 218 4 443 4e1 10.1016/j.ajog.2018.01.017 29353034\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2054-7099",
"issue": "7(1)",
"journal": "Fertility research and practice",
"keywords": "Adenomyosis; Frozen embryo transfer; GnRH agonist; Live birth; Placenta accreta",
"medline_ta": "Fertil Res Pract",
"mesh_terms": null,
"nlm_unique_id": "101671668",
"other_id": null,
"pages": "5",
"pmc": null,
"pmid": "33658071",
"pubdate": "2021-03-03",
"publication_types": "D016428:Journal Article",
"references": "28110584;28865548;22116070;8372890;20829343;31775687;29353034;18007126;8633139;16806205;28599899;21585640;29037097;28181672;27379972;20932128;8293832;22442261;16340902;26348274;9240608;28874260;31299081;10687850;25747133;18514815;29259486;24006906;19398089",
"title": "A rare case of extensive placenta accreta in twin pregnancy after GnRH agonist treatment of adenomyosis.",
"title_normalized": "a rare case of extensive placenta accreta in twin pregnancy after gnrh agonist treatment of adenomyosis"
} | [
{
"companynumb": "US-ORGANON-O2105USA002258",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "BETAMETHASONE ACETATE\\BETAMETHASONE SODIUM PHOSPHATE"
... |
{
"abstract": "Dabigatran is a direct thrombin inhibitor used to reduce the risk of stroke in patients with nonvalvular atrial fibrillation. For patients who present with an acute stroke despite dabigatran therapy, clinical data on the use of intravenous tissue plasminogen activator (IV-tPA) is limited. There is an anticipated increased risk of symptomatic intracranial hemorrhage (sICH) when using IV-tPA in patients on dabigatran therapy. In 2015, the humanized monoclonal antibody fragment idarucizumab was approved for rapid (minutes) reversal of anticoagulant effects of dabigatran. Dabigatran reversal with idarucizumab before administration of IV-tPA might reduce the risk of sICH. We report a case of a 69-year-old stroke patient on dabigatran for paroxysmal atrial fibrillation who presented with an initial National Institutes of Health Stroke Scale (NIHSS) of 12. There was no early evidence of ischemic stroke or hemorrhage on head computed tomography, and coagulation studies implied therapeutic dabigatran levels. After controlling blood pressure, dabigatran was reversed with idarucizumab, and IV-tPA was administrated beginning 197 minutes after he was last seen at his baseline. Subsequent brain magnetic resonance imaging showed 2 punctate infarcts in the left temporal lobe and occipital lobe with no evidence of hemorrhage. The patient was discharged with an NIHSS of 1. Telephone follow-up 2 months later indicated that he was at his prestroke baseline, except for a complaint of worsened short-term memory. Idarucizumab reversal of dabigatran may reduce the risk of sICH and should be considered for acute stroke patients arriving in the IV-tPA time window.",
"affiliations": "Department of Neurology, University of California Davis, Sacramento, California.;Department of Internal Medicine, University of California Davis, Sacramento, California.;Department of Pharmacy, University of California Davis, Sacramento, California.;Department of Neurology, University of California Davis, Sacramento, California.;Department of Neurology, University of California Davis, Sacramento, California. Electronic address: klng@ucdavis.edu.",
"authors": "Bissig|David|D|;Manjunath|Rashmi|R|;Traylor|Brittany R|BR|;Richman|David P|DP|;Ng|Kwan L|KL|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000991:Antithrombins; D003029:Coagulants; D005343:Fibrinolytic Agents; C000594745:idarucizumab; D010959:Tissue Plasminogen Activator; D000069604:Dabigatran",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jstrokecerebrovasdis.2016.12.037",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1052-3057",
"issue": "26(6)",
"journal": "Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association",
"keywords": "acute stroke; anticoagulation; dabigatran; idarucizumab; ischemic stroke; tPA; tissue plasminogen activator",
"medline_ta": "J Stroke Cerebrovasc Dis",
"mesh_terms": "D061605:Administration, Intravenous; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D000991:Antithrombins; D001777:Blood Coagulation; D003029:Coagulants; D000069604:Dabigatran; D038524:Diffusion Magnetic Resonance Imaging; D005343:Fibrinolytic Agents; D006801:Humans; D020300:Intracranial Hemorrhages; D008297:Male; D020521:Stroke; D015912:Thrombolytic Therapy; D010959:Tissue Plasminogen Activator; D016896:Treatment Outcome",
"nlm_unique_id": "9111633",
"other_id": null,
"pages": "e102-e104",
"pmc": null,
"pmid": "28416406",
"pubdate": "2017-06",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Acute Stroke Despite Dabigatran Anticoagulation Treated with Idarucizumab and Intravenous Tissue Plasminogen Activator.",
"title_normalized": "acute stroke despite dabigatran anticoagulation treated with idarucizumab and intravenous tissue plasminogen activator"
} | [
{
"companynumb": "US-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2017-BI-022966",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "DABIGATRAN ETEXILATE MESYLATE"
... |
{
"abstract": "We evaluated the efficacy of combination enzastaurin (LY317615) and bevacizumab for recurrent malignant gliomas and explored serologic correlates. We enrolled 81 patients with glioblastomas (GBM, n = 40) and anaplastic gliomas (AG, n = 41). Patients received enzastaurin as a loading dose of 1125 mg, followed by 500 or 875 mg daily for patients on non-enzyme-inducing or enzyme-inducing antiepileptics, respectively. Patients received bevacizumab 10 mg/kg intravenously biweekly. Clinical evaluations were repeated every 4 weeks. Magnetic resonance imaging was obtained at baseline and every 8 weeks from treatment onset. Phosphorylated glycogen synthase kinase (GSK)-3 levels from peripheral blood mononuclear cells (PBMCs) were checked with each MRI. Median overall survival was 7.5 and 12.4 months for glioblastomas and anaplastic glioma cohorts, with median progression-free survivals of 2.0 and 4.4 months, respectively. Of GBM patients, 3/40 (7.5 %) were not evaluable, while 8/37 (22 %) had partial or complete response and 20/37 (54 %) had stable disease for 2+ months. Of the 39 evaluable AG patients, 18 (46 %) had an objective response, and 16 (41 %) had stable disease for 2+ months. The most common grade 3+ toxicities were lymphopenia (15 %), hypophosphatemia (8.8 %) and thrombotic events (7.5 %). Two (2.5 %) GBM patients died suddenly; another death (1.3 %) occurred from intractable seizures. Phosphorylated GSK-3 levels from PBMCs did not correlate with treatment response. A minimally important improvement in health-related quality of life was self-reported in 7-9/24 (29.2-37.5 %). Early response based on Levin criteria was significantly associated with significantly longer progression free survival for glioblastomas. Enzastaurin (LY317615) in combination with bevacizumab for recurrent malignant gliomas is well-tolerated, with response and progression-free survival similar to bevacizumab monotherapy.",
"affiliations": "Neuro-Oncology Division, Neurological Institute of New York, Columbia University College of Physicians and Surgeons, 710 West 168th Street, 9th Floor, NI 9-017, New York, NY, 10032, USA. yo2240@cumc.columbia.edu.;Neuro-Oncology Division, Neurological Institute of New York, Columbia University College of Physicians and Surgeons, 710 West 168th Street, 9th Floor, NI 9-017, New York, NY, 10032, USA.;University of Vermont Medical Center, 89 South Williams Street, Burlington, VT, 05401, USA.;Mallinckrodt Institute of Radiology, Washington University School of Medicine, Campus Box 8131, 510 S. Kingshighway Blvd., Saint Louis, MO, 63110, USA.;University of Maryland School of Medicine, 655 West Baltimore Street, Baltimore, MD, 21201, USA.;Center for Cancer Research, National Cancer Institute, Building 37, Room 1142, Bethesda, MD, 20892, USA.;Neuro-Oncology Division, Neurological Institute of New York, Columbia University College of Physicians and Surgeons, 710 West 168th Street, 9th Floor, NI 9-017, New York, NY, 10032, USA.;Federal Drug Administration, 10903 New Hampshire Ave, Bldg WO22 Rm 2331, Silver Spring, MD, 20993, USA.;Department of Radiology, National Institutes of Health Clinical Center, Building 10, Clinical Center 10 Center Drive, MSC 1074, Bethesda, MD, 20892, USA.;Division of Neuro-Oncology, Director of the Brain Tumor Center, New York-Presbyterian Hospital/Weill Cornell Medical Center, 1305 York Avenue, 9th Floor, New York, NY, 10021, USA.",
"authors": "Odia|Yazmin|Y|;Iwamoto|Fabio M|FM|;Moustakas|Argirios|A|;Fraum|Tyler J|TJ|;Salgado|Carlos A|CA|;Li|Aiguo|A|;Kreisl|Teri N|TN|;Sul|Joohee|J|;Butman|John A|JA|;Fine|Howard A|HA|",
"chemical_list": "D007211:Indoles; D000068258:Bevacizumab; D038362:Glycogen Synthase Kinase 3; C504878:enzastaurin",
"country": "United States",
"delete": false,
"doi": "10.1007/s11060-015-2020-x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0167-594X",
"issue": "127(1)",
"journal": "Journal of neuro-oncology",
"keywords": "Bevacizumab; Enzastaurin; Glioblastoma; Glioma; Trial",
"medline_ta": "J Neurooncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000068258:Bevacizumab; D001932:Brain Neoplasms; D005260:Female; D005500:Follow-Up Studies; D005910:Glioma; D038362:Glycogen Synthase Kinase 3; D006801:Humans; D007211:Indoles; D007963:Leukocytes, Mononuclear; D008297:Male; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D009367:Neoplasm Staging; D011379:Prognosis; D011788:Quality of Life; D015996:Survival Rate",
"nlm_unique_id": "8309335",
"other_id": null,
"pages": "127-35",
"pmc": null,
"pmid": "26643807",
"pubdate": "2016-03",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D052060:Research Support, N.I.H., Intramural; D013485:Research Support, Non-U.S. Gov't",
"references": "20124186;21432029;10485491;13576192;18043132;19672263;19114704;17671132;8709095;16111571;17947719;23095881;18669428;8614835;16103100;20231676;9287049;9377574;17618441;26124478;16443947;10440921;12242114;22086614;8903320;9422557;18667747;9430559;1705174;21865400;10561324;8107827;15851772;1279432;10804084;7850714;10641743;16943527;9299537;21870118;7896817;11817706;15758009",
"title": "A phase II trial of enzastaurin (LY317615) in combination with bevacizumab in adults with recurrent malignant gliomas.",
"title_normalized": "a phase ii trial of enzastaurin ly317615 in combination with bevacizumab in adults with recurrent malignant gliomas"
} | [
{
"companynumb": "US-ROCHE-1688585",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "BEVACIZUMAB"
},
"drugadditional": null,
"dru... |
{
"abstract": "Bacteremia causes considerable morbidity among children with acute leukemia and those undergoing hematopoietic stem cell transplantation (HSCT). There are limited data on the effect of antibiotic prophylaxis in children.\n\n\n\nTo determine the efficacy and risks of levofloxacin prophylaxis in children receiving intensive chemotherapy for acute leukemia or undergoing HSCT.\n\n\n\nIn this multicenter, open-label, randomized trial, patients (6 months-21 years) receiving intensive chemotherapy were enrolled (September 2011-April 2016) in 2 separate groups-acute leukemia, consisting of acute myeloid leukemia or relapsed acute lymphoblastic leukemia, and HSCT recipients-at 76 centers in the United States and Canada, with follow-up completed September 2017.\n\n\n\nPatients with acute leukemia were randomized to receive levofloxacin prophylaxis for 2 consecutive cycles of chemotherapy (n = 100) or no prophylaxis (n = 100). Those undergoing HSCT were randomized to receive levofloxacin prophylaxis during 1 HSCT procedure (n = 210) or no prophylaxis (n = 214).\n\n\n\nThe primary outcome was the occurrence of bacteremia during 2 chemotherapy cycles (acute leukemia) or 1 transplant procedure (HSCT). Secondary outcomes included fever and neutropenia, severe infection, invasive fungal disease, Clostridium difficile-associated diarrhea, and musculoskeletal toxic effects.\n\n\n\nA total of 624 patients, 200 with acute leukemia (median [interquartile range {IQR}] age, 11 years [6-15 years]; 46% female) and 424 undergoing HSCT (median [IQR] age, 7 years [3-14]; 38% female), were enrolled. Among 195 patients with acute leukemia, the likelihood of bacteremia was significantly lower in the levofloxacin prophylaxis group than in the control group (21.9% vs 43.4%; risk difference, 21.6%; 95% CI, 8.8%-34.4%, P = .001), whereas among 418 patients undergoing HSCT, the risk of bacteremia was not significantly lower in the levofloxacin prophylaxis group (11.0% vs 17.3%; risk difference, 6.3%; 95% CI, 0.3%-13.0%; P = .06). Fever and neutropenia were less common in the levofloxacin group (71.2% vs 82.1%; risk difference, 10.8%; 95% CI, 4.2%-17.5%; P = .002). There were no significant differences in severe infection (3.6% vs 5.9%; risk difference, 2.3%; 95% CI, -1.1% to 5.6%; P = .20), invasive fungal disease (2.9% vs 2.0%; risk difference, -1.0%; 95% CI, -3.4% to 1.5%, P = .41), C difficile-associated diarrhea (2.3% vs 5.2%; risk difference, 2.9%; 95% CI, -0.1% to 5.9%; P = .07), or musculoskeletal toxic effects at 2 months (11.4% vs 16.3%; risk difference, 4.8%; 95% CI, -1.6% to 11.2%; P = .15) or at 12 months (10.1% vs 14.4%; risk difference, 4.3%; 95% CI, -3.4% to 12.0%; P = .28) between the levofloxacin and control groups.\n\n\n\nAmong children with acute leukemia receiving intensive chemotherapy, receipt of levofloxacin prophylaxis compared with no prophylaxis resulted in a significant reduction in bacteremia. However, there was no significant reduction in bacteremia for levofloxacin prophylaxis among children undergoing HSCT.",
"affiliations": "The Hospital for Sick Children, Toronto, Ontario, Canada.;Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;St Jude Children's Research Hospital, Memphis, Tennessee.;University of California, San Francisco, Benioff Children's Hospital, San Francisco.;Children's Oncology Group, Monrovia, California.;University of Southern California, Los Angeles, California.;City of Hope, Duarte, California.;Children's Hospital of Pittsburgh of University of Pittsburgh Medical Center, Pittsburg, Pennsylvania.;Moffitt Cancer Center and Research Institute, Tampa, Florida.;Children's Healthcare of Atlanta, Egleston, Atlanta, Georgia.;Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;McMaster Children's Hospital, Hamilton, Ontario, Canada.;The Hospital for Sick Children, Toronto, Ontario, Canada.",
"authors": "Alexander|Sarah|S|;Fisher|Brian T|BT|;Gaur|Aditya H|AH|;Dvorak|Christopher C|CC|;Villa Luna|Doojduen|D|;Dang|Ha|H|;Chen|Lu|L|;Green|Michael|M|;Nieder|Michael L|ML|;Fisher|Beth|B|;Bailey|L Charles|LC|;Wiernikowski|John|J|;Sung|Lillian|L|;|||",
"chemical_list": "D000900:Anti-Bacterial Agents; D000970:Antineoplastic Agents; D064704:Levofloxacin",
"country": "United States",
"delete": false,
"doi": "10.1001/jama.2018.12512",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0098-7484",
"issue": "320(10)",
"journal": "JAMA",
"keywords": null,
"medline_ta": "JAMA",
"mesh_terms": "D000293:Adolescent; D000900:Anti-Bacterial Agents; D019072:Antibiotic Prophylaxis; D000970:Antineoplastic Agents; D016470:Bacteremia; D002648:Child; D002675:Child, Preschool; D005260:Female; D018380:Hematopoietic Stem Cell Transplantation; D006801:Humans; D007223:Infant; D015470:Leukemia, Myeloid, Acute; D064704:Levofloxacin; D008297:Male; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D055815:Young Adult",
"nlm_unique_id": "7501160",
"other_id": null,
"pages": "995-1004",
"pmc": null,
"pmid": "30208456",
"pubdate": "2018-09-11",
"publication_types": "D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D052061:Research Support, N.I.H., Extramural",
"references": "12364372;18462102;26936664;22001945;22052170;22102612;25359519;22987086;29020310;24677028;17901790;18459178;25804192;29319209;15390313;16148283;24415457;22258955;27216385;24918220;23460123;17901792",
"title": "Effect of Levofloxacin Prophylaxis on Bacteremia in Children With Acute Leukemia or Undergoing Hematopoietic Stem Cell Transplantation: A Randomized Clinical Trial.",
"title_normalized": "effect of levofloxacin prophylaxis on bacteremia in children with acute leukemia or undergoing hematopoietic stem cell transplantation a randomized clinical trial"
} | [
{
"companynumb": "CA-JNJFOC-20181014224",
"fulfillexpeditecriteria": "1",
"occurcountry": "CA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "LEVOFLOXACIN"
},
"drugadditional": "3",
... |
{
"abstract": "We describe the case of a 41-year-old male that underwent laser in situ keratomileusis (LASIK) complicated by Urrets-Zavalia syndrome with interface fluid syndrome and epithelial ingrowth.\nThe patient presented at our institution with headache and blurred vision three weeks after a right microkeratome-assisted LASIK procedure. On examination, the visual acuity was hand movements and the intraocular pressure (IOP) was 45 mmHg with fluid in the flap interface, a fixed pupil in moderate mydriasis, iris transillumination and cells in the anterior chamber. A Baerveldt tube implant was necessary to control the IOP. After three months, the corrected visual acuity was 20/40 with normal IOP and an early cataract.\nTo our knowledge this is the first report of a case of combined Urrets-Zavalia syndrome and interface fluid syndrome after LASIK. We speculate that steroid induced ocular hypertension was the primary cause.",
"affiliations": "Cornea and External Disease Department, Moorfields Eye Hospital NHS Foundation Trust, 162 City Road, EC1V 2PD, London, UK.;Cornea and External Disease Department, Moorfields Eye Hospital NHS Foundation Trust, 162 City Road, EC1V 2PD, London, UK.;Cornea and External Disease Department, Moorfields Eye Hospital NHS Foundation Trust, 162 City Road, EC1V 2PD, London, UK.;Cornea and External Disease Department, Moorfields Eye Hospital NHS Foundation Trust, 162 City Road, EC1V 2PD, London, UK.",
"authors": "Vasquez-Perez|Alfonso|A|;Aiello|Francesco|F|;Muthusamy|Kirithika|K|;Tuft|Stephen|S|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.ajoc.2018.12.015",
"fulltext": "\n==== Front\nAm J Ophthalmol Case RepAm J Ophthalmol Case RepAmerican Journal of Ophthalmology Case Reports2451-9936Elsevier S2451-9936(18)30300-110.1016/j.ajoc.2018.12.015Case reportUrrets-Zavalia syndrome with interface fluid syndrome following laser in situ keratomileusis Vasquez-Perez Alfonso aAiello Francesco francesco.aiello@ptvonline.itab∗1Muthusamy Kirithika aTuft Stephen aa Cornea and External Disease Department, Moorfields Eye Hospital NHS Foundation Trust, 162 City Road, EC1V 2PD, London, UKb Department of Experimental Medicine, University of Rome “Tor Vergata”, Viale Oxford 81, 00133, Rome, Italy∗ Corresponding author. Moorfields Eye Hospital, 162 City Road, London, EC1V 2PD, UK. francesco.aiello@ptvonline.it1 Present address: University of Rome “Tor Vergata”, Viale Oxford 81, 00133, Rome, Italy.\n\n18 12 2018 3 2019 18 12 2018 13 96 98 12 7 2018 13 11 2018 17 12 2018 © 2019 The Authors. Published by Elsevier Inc.2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Purpose\nWe describe the case of a 41-year-old male that underwent laser in situ keratomileusis (LASIK) complicated by Urrets-Zavalia syndrome with interface fluid syndrome and epithelial ingrowth.\n\nObservation\nThe patient presented at our institution with headache and blurred vision three weeks after a right microkeratome-assisted LASIK procedure. On examination, the visual acuity was hand movements and the intraocular pressure (IOP) was 45 mmHg with fluid in the flap interface, a fixed pupil in moderate mydriasis, iris transillumination and cells in the anterior chamber. A Baerveldt tube implant was necessary to control the IOP. After three months, the corrected visual acuity was 20/40 with normal IOP and an early cataract.\n\nConclusion and importance\nTo our knowledge this is the first report of a case of combined Urrets-Zavalia syndrome and interface fluid syndrome after LASIK. We speculate that steroid induced ocular hypertension was the primary cause.\n\nKeywords\nInterface fluid syndromeLASIKUrrets-ZavaliaLASIK complications\n==== Body\n1 Introduction\nInterface fluid syndrome (IFS) occurs in less than 0.2% of eyes after laser in situ keratomileusis (LASIK).1,2 Interface fluid syndrome was first described by Lyle in 1999 as a collection of fluid at the flap interface.3 It is commonly associated with an acute steroid-induced ocular hypertension response, hence the alternative name of pressure-induced stromal keratitis (PISK).4 Urrets-Zavalia syndrome (UZS) is characterised by an anterior uveitis or fibrinous exudate, elevated intraocular pressure (IOP) and a dilated pupil in the early postoperative period. It has most frequently been reported following penetrating keratoplasty for keratoconus,5 but can also occur after cataract surgery, trabeculectomy or lamellar keratoplasty.6,7 Although IFS is a specific complication of laser-assisted in-situ keratomileusis (LASIK), to the best of our knowledge there are no reports of this complication developing in association with Urrets-Zavalia syndrome. Therefore, we report a case that developed Urrets-Zavalia syndrome in which IFS was further complicated by epithelial ingrowth. A persistently elevated IOP required tube drainage surgery for control.\n\n2 Case report\nA 41 year-old male had an uneventful right LASIK for anisometropia performed in another country with the flap formed using a microkeratome. The right pre-operative refraction was −3.50/-1.25 × 5 with a corrected visual acuity of 20/17. The preoperative examination reported a normal IOP in both eyes (13 mmHg in the right and 12 mmHg in the left eye) with normal fundoscopy. There was no prior history of eye disease. Postoperatively, he was prescribed dexamethasone 1mg/ml and tobramycin 3mg/ml eye drops (Tobradex®, Alcon Laboratories Inc. Fort Worth, Texas, USA) two hourly for five days and then three times a day for one month after the procedure. He was reviewed five days after surgery with no signs of complications and he returned to the United Kingdom the following day. Twenty-one days after LASIK he developed pain in the eye, blurred vision and a headache that had increased over three days. On first examination, the visual acuity was hand movements. There was conjunctival hyperaemia and diffuse corneal oedema. There was a fluid interface beneath the flap (Fig. 1). The IOP (Icare® PRO) was 45 mmHg when measured superior to the LASIK flap. There was an intense anterior uveitis with flare and cells and fine pigmented keratic precipitates on the endothelium. There was also epithelial ingrowth in the nasal and inferior margin of the flap. The pupil was unreactive and mid-dilated (6.5 mm). Fundoscopy was within normal limits. The left eye examination was normal. There were no guttae or evidence of corneal dystrophy; the IOP was within normal limit (13 mmHg) and there was no evidence of pigment dispersion syndrome. The flap thickness measured with Optical Coherence Tomography (Tomey Casia OCT SS-1000) was 178 microns inferiorly. The initial management included oral acetazolamide (one initial dose of 500 mg and then 250 mg four times a day), topical timolol 5 mg/ml with dorzolamide 20 mg/ml (Cosopt® Merck Sharp & Dohme-Chibret, Clermont-Ferrand Cedex, France) twice a day, bimatoprost 0.3 mg/ml (Lumigan®, Allergan, Irvine, CA, USA) once a day and apraclonidine 1 mg/ml (Iopidine ®, Alcon laboratories, inc. Fort Worth, Texas, USA) three times a day. On this regime, the IOP decreased to 24 mmHg and his headache reduced. Iris transillumination defects were then noted after the cornea clarity improved. The initial diagnosis was steroid-induced ocular hypertension and the dexamethasone was substituted with fluorometholone 1 mg/ml eye drops (FML® Allergan, Irvine, CA, USA) twice a day while the other medications were continued. However, although the IOP reduced, the anterior uveitis increased. He was therefore restarted on dexamethasone 0.1% two hourly. After one week, the interface fluid had resolved and the epithelial ingrowth was removed after lifting the flap and applying 20% alcohol. However, when the steroid was again tapered his IOP increased to 55 mmHg with evidence of optic disc excavation, and a Baerveldt drainage tube was implanted. Postoperatively his IOP decreased to normal and he continued with topical timolol 5 mg/ml with dorzolamide 20 mg/ml twice a day. A recurrence of the epithelial ingrowth was again removed as before without significant further subsequent recurrence. Four weeks after glaucoma surgery his ocular inflammation had resolved and topical steroids was discontinued. At four months, the IOP was normal, the pupil was mid-dilated and unreactive to light. The OCT this time revealed an irregular flap thickness that was measured 86 microns at the thinnest point inferiorly. The refraction was +2.75/-2.50 × 85 but his corrected visual acuity only improved to 20/40 due to a residual interface haze and early cataract (Fig. 2).Fig. 1 Initial presentation three weeks after LASIK. A. Inferior fluid cleft separating the anterior flap from the posterior stroma (arrow). B. Anterior segment OCT scan showing interface fluid (arrow). C. Mid-dilated pupil with cells and pigment in the anterior chamber with iris transillumination (D).\n\nFig. 1Fig. 2 Final outcome at three months. A. Baerveldt tube opening into the anterior chamber. B. Anterior segment OCT scan showing a residual haze in the interface. Corneal flap thickness measurements at different levels with resolution of flap's oedema.\n\nFig. 2\n\n3 Discussion\nIt has been reported that a clinically significant rise in IOP (6–15 mmHg) occurs in 29% of individuals when they use topical steroid.8 It is also thought that most cases of IFS are the result of an acute rise in intraocular pressure secondary to the use of topical steroid,1,4 and thus an alternative name is pressure-induced stromal keratitis (PISK).4,7 However, as there is no evidence of an inflammatory cell infiltrate, which is a feature of diffuse lamellar keratitis (DLK),9 pressure-induced keratopathy may be a more accurate name.10 Although IFS/PISK is an uncommon complication of LASIK, with a reported incidence of <0.2%,1 we believe that a steroid induced elevation in IOP was the most likely trigger for the subsequent complications in this case.\n\nThe depth of the fluid interface in IFS may be relatively small1,4 and OCT can be useful to confirm its presence. The pressure within the fluid interface is thought to be low and this can lead to a misleadingly low IOP measurement when using Goldmann applanation tonometry.1,11 Contact pneumotonometry and rebound tonometry are less affected1 and we also obtained measurements from the superior cornea where there was no fluid. The clinical signs of IFS are distinct from DLK or central toxic keratopathy (CTK) following LASIK,1,9,12,13 but the differential diagnosis should include DLK, CTK or microbial infection. In addition, the onset of signs with DLK are usually within the first days following surgery.1,2 Iris ischaemia is the likely mechanism of the pupil paresis and iris atrophy of Urrets-Zavalia syndrome.6,7 Most patients with Urrets-Zavalia syndrome have an elevated IOP in the acute phase and this pressure may occlude the trans-scleral blood supply to the iris leading to a secondary uveitis.14 Avadhani et al.15 previously reported a case of Urrets-Zavalia syndrome after unilateral LASIK although they did not document an elevated IOP or subsequent iris atrophy.\n\nTherefore, we speculate that in the present case an elevation in IOP secondary to topical steroid lead both to the pupil paresis as well as IFS. In our case the patient was prescribed combined topical dexamethasone 1nmg/ml and tobramycin 3 mg/ml eye drops 2 hourly for 5 days and then tapered to 3 times a day for a month. We believe that post-operative steroid and antibiotic is not required after one week following LASIK treatment, not least because of the risk of steroid associated glaucoma.\n\nAn anterior uveitis can occur in isolation following LASIK, with an incidence of 0.18% reported in one retrospective case series.16 The mechanism may be the result of a sudden change in IOP associated with the use of the suction ring and a mechanical microkeratome, which can cause a transient pressure increase up to 90 mmHg.16 This may release pro-inflammatory cytokines as occurs after a closed eye injury.17 There was no record of multiple attempts of microtome suction or the application of suction for a prolonged period. The patient said that the procedure was short and painless, and he was unaware of any intra-operative problems. Also, the patient did not receive a systemic fluoroquinolone in the perioperative treatment, which has been reported as a potential cause for anterior uveitis with iris transillumination.18\n\nEpithelial ingrowth after femtosecond laser assisted LASIK flap creation has been reported to be as low as 0.03% for first LASIK procedure19 compared to between 0.420 and 9.1%21 when a microkeratome is used. This complication is more frequent following hyperopic corrections and enhancements.22 It is thought to result either from epithelial cells swept under the flap edge at the time of surgery, or ingrowth due to flap edge misalignment.21 Elevated IOP is not a clinical feature of epithelial ingrowth. In our case there was the added risk of a fluid space and the subsequent flap edge gap formation may have facilitated the growth of the epithelial layer under the flap. To the best of our knowledge this is the first report of combined IFS and Urrets-Zavalia syndrome following LASIK. It potentially highlights the multiple downstream consequences (iris ischaemia, interface fluid, epithelial ingrowth) that can ensue from steroid induced ocular hypertension following LASIK, and the role of the flap in modifying the clinical picture of corneal disease.\n\nPatient consent\nWritten consent to publish case details has been obtained from patient.\n\nFunding\nNo funding or grant support\n\nConflicts of interest\nThe following authors have no financial disclosures: AVP, FA, KM, ST.\n\nAuthorship\nAll authors attest that they meet the current ICMJE criteria for Authorship.\n\nAppendix A Supplementary data\nThe following is the Supplementary data to this article:Data Profile\nData Profile \n\nAcknowledgements\nNone.\n\nAppendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.ajoc.2018.12.015.\n==== Refs\nReferences\n1 Randleman J.B. Shah R.D. LASIK interface complications: etiology, management, and outcomes J Refract Surg (Thorofare, NJ: 1995) 28 8 2012 575 586 \n2 Stulting R.D. Randleman J.B. Couser J.M. Thompson K.P. The epidemiology of diffuse lamellar keratitis Cornea 23 7 2004 680 688 15448493 \n3 Lyle W.A. Jin G.J. Interface fluid associated with diffuse lamellar keratitis and epithelial ingrowth after laser in situ keratomileusis J Cataract Refract Surg 25 7 1999 1009 1012 10404381 \n4 Belin M.W. Hannush S.B. Yau C.W. Schultze R.L. Elevated intraocular pressure-induced interlamellar stromal keratitis Ophthalmology 109 10 2002 1929 1933 12359617 \n5 Spierer O. Lazar M. Urrets-Zavalia syndrome (fixed and dilated pupil following penetrating keratoplasty for keratoconus) and its variants Surv Ophthalmol 59 3 2014 304 310 24560126 \n6 Jain R. Assi A. Murdoch I.E. Urrets-Zavalia syndrome following trabeculectomy Br J Ophthalmol 84 3 2000 338 339 10744383 \n7 Bozkurt K.T. Acar B.T. Acar S. Fixed dilated pupilla as a common complication of deep anterior lamellar keratoplasty complicated with Descemet membrane perforation Eur J Ophthalmol 23 2 2013 164 170 23065856 \n8 Maurino V. Aiello F. Glaucoma risks in advanced corneal surgery Prog Brain Res 221 2015 271 295 26518083 \n9 Tourtas T. Kopsachilis N. Meiller R. Kruse F.E. Cursiefen C. Pressure-induced interlamellar stromal keratitis after laser in situ keratomileusis Cornea 30 8 2011 920 923 21734483 \n10 Tourtas T. Cursiefen C. “PISK-itis” or “PISK-opathy”? Cornea 31 2 2012 107 22138586 \n11 Fogla R. Rao S.K. Padmanabhan P. Interface fluid after laser in situ keratomileusis J Cataract Refract Surg 27 9 2001 1526 1528 11566545 \n12 Kurian M. Shetty R. Shetty B.K. Devi S.A. In vivo confocal microscopic findings of interlamellar stromal keratopathy induced by elevated intraocular pressure J Cataract Refract Surg 32 9 2006 1563 1566 16931274 \n13 Jutley G. Aiello F. Robaei D. Maurino V. Central toxic keratopathy after laser in situ keratomileusis J Cataract Refract Surg 40 12 2014 1985 1993 25465684 \n14 Tuft S.J. Buckley R.J. Iris ischaemia following penetrating keratoplasty for keratoconus (Urrets-Zavalia syndrome) Cornea 14 6 1995 618 622 8575186 \n15 Avadhani K. Prakash G. Srivastava D. Shakunthala A. Urrets-Zavalia syndrome after laser-assisted in situ keratomileusis (LASIK) BMJ Case Rep 2015 July 8 \n16 Suarez E. Torres F. Vieira J.C. Ramirez E. Arevalo J.F. Anterior uveitis after laser in situ keratomileusis J Cataract Refract Surg 28 10 2002 1793 1798 12388030 \n17 Hernandez-Verdejo J.L. Teus M.A. Roman J.M. Bolivar G. Porcine model to compare real-time intraocular pressure during LASIK with a mechanical microkeratome and femtosecond laser Invest Ophthalmol Vis Sci 48 1 2007 68 72 17197518 \n18 Wefers Bettink-Remeijer M. Brouwers K. van Langenhove L. Uveitis-like syndrome and iris transillumination after the use of oral moxifloxacin Eye (London, England) 23 12 2009 2260 2262 \n19 Kamburoglu G. Ertan A. Epithelial ingrowth after femtosecond laser-assisted in situ keratomileusis Cornea 27 10 2008 1122 1125 19034125 \n20 Walker M.B. Wilson S.E. Incidence and prevention of epithelial growth within the interface after laser in situ keratomileusis Cornea 19 2 2000 170 173 10746448 \n21 Stulting R.D. Carr J.D. Thompson K.P. Waring G.O. 3rd Wiley W.M. Walker J.G. Complications of laser in situ keratomileusis for the correction of myopia Ophthalmology 106 1 1999 13 20 9917775 \n22 Wang M.Y. Maloney R.K. Epithelial ingrowth after laser in situ keratomileusis Am J Ophthalmol 129 6 2000 746 751 10926983\n\n",
"fulltext_license": "CC BY-NC-ND",
"issn_linking": "2451-9936",
"issue": "13()",
"journal": "American journal of ophthalmology case reports",
"keywords": "Interface fluid syndrome; LASIK; LASIK complications; Urrets-Zavalia",
"medline_ta": "Am J Ophthalmol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101679941",
"other_id": null,
"pages": "96-98",
"pmc": null,
"pmid": "30619971",
"pubdate": "2019-03",
"publication_types": "D002363:Case Reports",
"references": "10404381;10744383;10746448;10926983;11566545;12359617;12388030;15448493;16931274;17197518;19034125;19851342;21734483;22138586;22869235;23065856;24560126;25465684;26156840;26518083;8575186;9917775",
"title": "Urrets-Zavalia syndrome with interface fluid syndrome following laser in situ keratomileusis.",
"title_normalized": "urrets zavalia syndrome with interface fluid syndrome following laser in situ keratomileusis"
} | [
{
"companynumb": "GB-MYLANLABS-2019M1006232",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TOBRAMYCIN"
},
"drugadditional": "3",
... |
{
"abstract": "This study prospectively compared immunoprophylaxis with a single intraoperative dose (2 mg/kg) of monoclonal interleukin-2 receptor (IL-2R) antibody vs. noninduction in kidney transplant recipients treated with tacrolimus (FK 506), mycophenolate mofetil (MMF) and a prednisone-based immunosuppression regimen. One hundred recipients of first-kidney transplant were enrolled into the study to receive either anti-IL-2R monoclonal antibody, daclizumab (2 mg/kg intraoperatively, limited anti-IL-2R) or no induction (control). Each patient also received oral tacrolimus (dosed to target trough level 10-15 ng/mL), MMF (500 mg bid) and prednisone. The primary efficacy end-point was the incidence of biopsy proven acute rejection during the first 6 months post-transplant. The patients were also followed for 12-month graft function, and graft and patient survival rates. Other than the donor's age being significantly lower in the control group, both groups were comparable with respect to age, weight, gender, race, human leukocyte antigen (HLA)-DR mismatch, panel reactive antibody (%PRA), cold ischemic time, cytomegalovirus (CMV) status, causes of renal failure, and duration and modes of renal replacement therapy (RRT). During the first 6 months, episodes of first biopsy confirmed acute rejection was 3/50 (6%) in the limited anti-IL-2R group and 8/50 (16%) in the controls (p < 0.05). Twelve-month patient 100/98 (%) and graft survival 100/96 (%) were not statistically different. The group receiving limited anti-IL-2R did not have any adverse reactions. Our study demonstrates that a limited (single) 2 mg/kg immunoprophylaxis dose with monoclonal IL-2R antibody (daclizumab) when combined with tacrolimus/MMF/steroid allows significant reduction in early renal allograft rejection to the single digit level. The therapy with anti-IL-2R antibody is simple and is well tolerated.",
"affiliations": "Nephrology and Transplant Division, University of Medicine and Dentistry of New Jersey, New Brunswick 08904, USA. ahsanna@umdnj.edu",
"authors": "Ahsan|Nasimul|N|;Holman|Michael J|MJ|;Jarowenko|Mark V|MV|;Razzaque|Mohammad S|MS|;Yang|Harold C|HC|",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D007074:Immunoglobulin G; D007166:Immunosuppressive Agents; D015375:Receptors, Interleukin-2; D000077561:Daclizumab; D009173:Mycophenolic Acid; D016559:Tacrolimus",
"country": "United States",
"delete": false,
"doi": "10.1034/j.1600-6143.2002.20612.x",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1600-6135",
"issue": "2(6)",
"journal": "American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons",
"keywords": null,
"medline_ta": "Am J Transplant",
"mesh_terms": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D000077561:Daclizumab; D004306:Dose-Response Relationship, Immunologic; D004359:Drug Therapy, Combination; D005260:Female; D005500:Follow-Up Studies; D006084:Graft Rejection; D006801:Humans; D007074:Immunoglobulin G; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D009173:Mycophenolic Acid; D011446:Prospective Studies; D015375:Receptors, Interleukin-2; D016019:Survival Analysis; D016559:Tacrolimus",
"nlm_unique_id": "100968638",
"other_id": null,
"pages": "568-73",
"pmc": null,
"pmid": "12118902",
"pubdate": "2002-07",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D016449:Randomized Controlled Trial",
"references": null,
"title": "Limited dose monoclonal IL-2R antibody induction protocol after primary kidney transplantation.",
"title_normalized": "limited dose monoclonal il 2r antibody induction protocol after primary kidney transplantation"
} | [
{
"companynumb": "US-ROCHE-1884152",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "3",
"druga... |
{
"abstract": "Plasma cell leukemia (PCL) is a rare disease and is the least common variant of multiple myeloma accounting for 2-3% of all plasma cell dyscrasias. We report a patient who was diagnosed with multiple myeloma, 12 months earlier; he was treated with VBCMP, VCMP regime, and after 12 months he presented of high grade fever, weakness, palpitations, loss of appetite, bone pains, dyspnea. Initial evaluation revealed plasmacytosis with blood plasma cell count of 13 860/mm³. His hemoglobin (Hb) was 8.4 mg/dL, platelets were 45 000/mm³ and total leukocyte count (TLC) was 23 100/mm³ (60% plasma cells). Bone marrow examination revealed 90% plasmablastic cells. Serum LDH was high at 3117 U/L and serum calcium was also elevated at 9.1 mg/dL. A diagnosis of PCL was made and the patient was started on treatment with VAD regime along with supportive care. Patient condition deteriorated very quickly, despite treatment and he died on the third day. A detailed report of this case and a review of PCL is presented here.",
"affiliations": "Department of Hematology, Faculty of Medicine, University of Medicine and Pharmacy of Craiova, Craiova, Romania. rodirot@yahoo.com",
"authors": "Rotaru|Ionela|I|;Găman|G|G|;Dumitrescu|Daniela|D|;Foarfă|Camelia|C|",
"chemical_list": null,
"country": "Romania",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1220-0522",
"issue": "53(4)",
"journal": "Romanian journal of morphology and embryology = Revue roumaine de morphologie et embryologie",
"keywords": null,
"medline_ta": "Rom J Morphol Embryol",
"mesh_terms": "D005260:Female; D006801:Humans; D007952:Leukemia, Plasma Cell; D008875:Middle Aged; D009101:Multiple Myeloma",
"nlm_unique_id": "9112454",
"other_id": null,
"pages": "1073-6",
"pmc": null,
"pmid": "23303035",
"pubdate": "2012",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Secondary plasma cell leukemia.",
"title_normalized": "secondary plasma cell leukemia"
} | [
{
"companynumb": "US-009507513-1705USA001829",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARFILZOMIB"
},
"drugadditional": "3",
... |
{
"abstract": "OBJECTIVE\nThe BCR-ABL mutation, T315I, is a common mutation and is resistant to both imatinib and second-generation Abl kinase inhibitors. Although strategies to overcome resistance-mediated T315I mutation may improve the survival of BCR-ABL-positive leukemia patients, there is little information on cell-based studies.\n\n\nMETHODS\nWe established a new human BCR-ABL-positive acute lymphoblastic leukemia (ALL) cell line, SK-9 with the T315I mutation, from the peripheral blood of a 36-year-old female patient.\n\n\nRESULTS\nGrowth kinetic studies revealed an approximate population doubling time of 48 hours. The common B-cell phenotype is a feature of the SK-9 cell line. Cells have the Philadelphia chromosome (Ph) with many structural abnormalities, as well as the T315I mutation in the BCR-ABL gene. Insertion of SK-9 cells into athymic nude mice induced the formation of tumors in the lymph node that infiltrated into the spleen and bone marrow. We examined the drug sensitivity of imatinib, dasatinib, and nilotinib using a cell proliferation assay and an immunoblot assay. Cell proliferation did not decrease after imatinib, dasatinib, or nilotinib treatment as compared to the BCR-ABL-positive chronic myeloid leukemia cell line K562. Because phosphorylation of BCR-ABL and Crk-L did not decrease after imatinib and dasatinib treatment, it is suggested that SK-9 is resistant to imatinib, dasatinib, and nilotinib.\n\n\nCONCLUSIONS\nThis cell line may provide a useful model for in vitro and in vivo cellular and molecular studies of BCR-ABL-positive ALL with T315I mutation.",
"affiliations": "First Department of Internal Medicine, Tokyo Medical University, Shinjuku-ku, Tokyo, Japan. okabe@tokyo-med.ac.jp",
"authors": "Okabe|Seiichi|S|;Tauchi|Tetsuzo|T|;Ohyashiki|Kazuma|K|",
"chemical_list": "D000970:Antineoplastic Agents; D016044:Fusion Proteins, bcr-abl",
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.exphem.2010.04.017",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0301-472X",
"issue": "38(9)",
"journal": "Experimental hematology",
"keywords": null,
"medline_ta": "Exp Hematol",
"mesh_terms": "D019943:Amino Acid Substitution; D000818:Animals; D000970:Antineoplastic Agents; D045744:Cell Line, Tumor; D049109:Cell Proliferation; D004195:Disease Models, Animal; D005260:Female; D016044:Fusion Proteins, bcr-abl; D006801:Humans; D008198:Lymph Nodes; D051379:Mice; D008819:Mice, Nude; D020125:Mutation, Missense; D009368:Neoplasm Transplantation; D010677:Philadelphia Chromosome; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D014183:Transplantation, Heterologous",
"nlm_unique_id": "0402313",
"other_id": null,
"pages": "765-72",
"pmc": null,
"pmid": "20471447",
"pubdate": "2010-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Establishment of a new Philadelphia chromosome-positive acute lymphoblastic leukemia cell line (SK-9) with T315I mutation.",
"title_normalized": "establishment of a new philadelphia chromosome positive acute lymphoblastic leukemia cell line sk 9 with t315i mutation"
} | [
{
"companynumb": "PHHY2018JP138180",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "VINCRISTINE"
},
"drugadditional": null,
"dru... |
{
"abstract": "OBJECTIVE\nCancer can escape the immune system through different mechanisms. One such mechanism is the expression of program death ligand-1 which binds to PD-1 receptor on activated T cells, subsequently leading to inhibition of the immune response against cancer cells. Nivolumab is a novel antibody that binds to PD-1 and prevents such immune tolerance. Two recently published controlled clinical trials confirmed the clinical efficacy of single-agent nivolumab in pretreated patients with classical Hodgkin lymphoma.\n\n\nMETHODS\nWe treated 10 heavily pretreated patients with classical Hodgkin lymphoma with the new novel PD-1 inhibitor nivolumab. We report on the outcome and safety of this agent in these patients.\n\n\nRESULTS\nAfter four cycles, the response rate was 80%. Seven of 10 gained complete metabolic remission. No serious adverse events were observed. The available literature is being reviewed.\n\n\nCONCLUSIONS\nPretreated classical Hodgkin lymphoma is amenable to novel immunotherapy. Nivolumab induces clinically meaningful responses with excellent tolerability. The drug enriches our treatment options by reviving the response of the immune system against cancer. Further controlled studies are needed to determine the effectiveness on a large patient cohort.",
"affiliations": "1 King Faisal Specialist Hospital and Research Centre, Jeddah, Kingdom of Saudi Arabia.;3 College of Medicine, King Saud Bin Abdulaziz University for Health Sciences, Jeddah, Kingdom of Saudi Arabia.",
"authors": "Dada|Reyad|R|https://orcid.org/0000-0002-8221-9342;Zabani|Yazeed|Y|",
"chemical_list": "D061026:Programmed Cell Death 1 Receptor; D000077594:Nivolumab",
"country": "England",
"delete": false,
"doi": "10.1177/1078155218800150",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1078-1552",
"issue": "25(7)",
"journal": "Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners",
"keywords": "Hodgkin lymphoma; Nivolumab; program death ligand-1",
"medline_ta": "J Oncol Pharm Pract",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D015331:Cohort Studies; D006689:Hodgkin Disease; D006801:Humans; D008297:Male; D000077594:Nivolumab; D061026:Programmed Cell Death 1 Receptor; D055815:Young Adult",
"nlm_unique_id": "9511372",
"other_id": null,
"pages": "1586-1589",
"pmc": null,
"pmid": "30253728",
"pubdate": "2019-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Nivolumab induces impressive responses in relapsed/refractory classic Hodgkin lymphoma: Single institutional experience.",
"title_normalized": "nivolumab induces impressive responses in relapsed refractory classic hodgkin lymphoma single institutional experience"
} | [
{
"companynumb": "SA-SUN PHARMACEUTICAL INDUSTRIES LTD-2019R1-225417",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "GEMCITABINE"
},
"dru... |
{
"abstract": "Orlistat is a gastrointestinal lipase inhibitor used for weight reduction in obese individuals. Enteric hyperoxaluria caused by orlistat leads to oxalate absorption. Acute oxalate nephropathy is a rare complication of treatment with orlistat. Herein we report a patient presenting with acute renal failure which improved minimal with intravenous hydration. She was found to have oxalate crystals on renal biopsy. Patient admitted orlistat use over the counter for weight reduction on further questioning. The purpose of this case review is to increase awareness among patients since they are more focused on losing weight. This case also calls for the provider attention to educate patients regarding side effects of orlistat because of easy availability of orlistat over the counter.",
"affiliations": "Department of Internal Medicine, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA.;Department of Nephrology, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA.;Department of Pathology, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA.;Department of Pathology, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA.",
"authors": "Chaudhari|Dhara|D|0000-0002-0144-7053;Crisostomo|Conchitina|C|;Ganote|Charles|C|;Youngberg|George|G|0000-0003-3578-627X",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1155/2013/124604",
"fulltext": "\n==== Front\nCase Rep NephrolCase Rep NephrolCRIM.NEPHROLOGYCase Reports in Nephrology2090-66412090-665XHindawi Publishing Corporation 10.1155/2013/124604Case ReportAcute Oxalate Nephropathy Associated with Orlistat: A Case Report with a Review of the Literature http://orcid.org/0000-0002-0144-7053Chaudhari Dhara \n1\n*Crisostomo Conchitina \n2\nGanote Charles \n3\nhttp://orcid.org/0000-0003-3578-627XYoungberg George \n3\n1Department of Internal Medicine, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA2Department of Nephrology, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA3Department of Pathology, East Tennessee State University, Quillen College of Medicine, Johnson City, TN 37615, USA*Dhara Chaudhari: chaudharidhara@yahoo.comAcademic Editors: C.-T. Lee, G. V. R. Prasad, A. K. Saxena, and A. Segarra\n\n2013 8 5 2013 2013 12460419 2 2013 17 4 2013 Copyright © 2013 Dhara Chaudhari et al.2013This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Orlistat is a gastrointestinal lipase inhibitor used for weight reduction in obese individuals. Enteric hyperoxaluria caused by orlistat leads to oxalate absorption. Acute oxalate nephropathy is a rare complication of treatment with orlistat. Herein we report a patient presenting with acute renal failure which improved minimal with intravenous hydration. She was found to have oxalate crystals on renal biopsy. Patient admitted orlistat use over the counter for weight reduction on further questioning. The purpose of this case review is to increase awareness among patients since they are more focused on losing weight. This case also calls for the provider attention to educate patients regarding side effects of orlistat because of easy availability of orlistat over the counter.\n==== Body\n1. Introduction\nOrlistat, a gastrointestinal lipase inhibitor, is used for weight reduction in obese patients with BMI > 30 kg/m2 and BMI > 28 kg/m2 with associated risk factors such as diabetes mellitus hypertension. The majority of the side effects associated with orlistat involve gastrointestinal tract. The rare but serious adverse effect of orlistat treatment is acute oxalate nephropathy caused by increased fat malabsorption. It is diagnosed by evidence of oxalate crystals in renal biopsy specimen under polarized light. We report a case of obese patient consuming orlistat for weight reduction presented with acute oxalate nephropathy manifesting as acute renal failure.\n\n2. Case\nA 56-year-old woman presented with fatigue to her primary doctor. She was sent to the hospital for acute kidney injury with a serum creatinine (Cr) of 6.6 mg/dL as compared to Cr of 0.9 mg/dL 1 year ago. The patient also had anemia with a hemoglobin of 7.4 g/dL. She denied having any previous medical problems but reported having intentionally lost 70 lbs over the last 18 months. She denied the use of any regular medications during her hospitalization and denied the use of nonsteroidal anti-inflammatory drugs (NSAIDs). Her physical examination was unremarkable. A urinalysis performed at admission was negative for urinary protein or eosinophils, with 2–5 WBCs per high powered field (hpf) and 0–2 RBCs/hpf, hemoglobin 7.4. The rest of complete blood count and basic metabolic panel was within normal limits. A renal ultrasound suggests medullary nephrocalcinosis. Her serum Cr improved with intravenous hydration to 5.7 mg/dL. She did not require hemodialysis and further clinical follow-up was performed on an outpatient basis. Her renal function failed to improve significantly over the next three months, which prompted a renal biopsy. The renal biopsy revealed severe interstitial fibrosis with associated tubular atrophy. On polarized light examination of the biopsy specimen, the renal pathologist detected moderate presence of oxalate crystals in tubular lumen (Figures 1 and 2). A 24-hour urine collection was analyzed and demonstrated normal oxalate levels and hypocitraturia. During a later follow-up appointment, the patient admitted to the use of orlistat. \n\n3. Discussion\nAcute oxalate nephropathy is a form of kidney damage caused by oxalate crystal deposition in the renal tubular lumen. Acute oxalate nephropathy can be associated with primary or secondary hyperoxaluria. Oxalate is usually absorbed in the colon and oxalate absorption is limited by its binding to calcium forming insoluble calcium oxalate. There have been case reports of oxalate nephropathy attributed to the ingestion of high doses of vitamin C for a prolonged period [1]. Excessive ingestion of star fruit juice [2] and ethylene glycol [3] have also been implicated in oxalate nephropathy. Orlistat, a gastrointestinal and pancreatic lipase inhibitor, is a synthetic derivative of lipstatin used for weight reduction in patients with a BMI > 30 kg/m2. The beneficial effects of orlistat have extended beyond weight reduction to include an observed 37% reduction in the cumulative incidence of new onset diabetes mellitus [4]. Orlistat is associated with gastrointestinal side effects such as abdominal cramps, oily spotting, and fecal incontinence [5, 6]. The literature review revealed three cases associated with acute oxalate nephropathy with use of orlistat in obese patients [5, 7]. Proposed predisposing factors for acute oxalate nephropathy are dehydration, preexisting renal disease, and the simultaneous use of nephrotoxic drugs. The efficacy of orlistat is secondary to induction of fat malabsorption. The state of fat malabsorption created by orlistat can result in calcium binding to free fatty acids. Because of calcium and free fatty acids complex, a state of enteric hyperoxaluria is created which increases absorption of oxalate in the colon, thereby causing oxalate crystalluria and acute nephropathy. This mimics the mechanism of enteric hyperoxaluria in gastrointestinal conditions as can be found in Crohn's disease, postsmall bowel resection, and after intestinal bypass for morbid obesity [8]. A study done by Ferraz et al. on male rats after administration of Orlistat showed a 30% increase in urinary oxalate excretion [9]. Ferraz et al. hypothesized that Orlistat has the potential to increase the incidence of renal stone formation. Sarica et al. studied the effects of orlistat on intestinal oxalate absorption and urinary oxalate excretion in 95 overweight patients treated with Orlistat [10]. This study suggested that increased intestinal absorption contributes to urinary oxalate excretion which leads to renal stone formation. Karamadoukis et al. retrospectively reviewed 855 renal biopsies performed for tubular necrosis and crystals between 1997 and 2007. Two patients within the review were found to have acute tubular necrosis and calcium oxalate crystals; both patients were treated with orlistat [11]. In our case, even though 24-hour urine oxalate level was normal, renal biopsy under polarized light revealed oxalate crystals of moderate amount in tubular lumen. These oxalate crystals showed suggestion of “fan” like morphology on objective measurement of high power (40x) (Figure 2). The patient had reported using orlistat upon further questioning. Interventions that can potentially prevent a hyperoxaluric state include instituting a diet low in oxalate and calcium, increasing oral and intravenous fluid intake, and treatment with pyridoxine [7].\n\nConflict of Interests\nThe authors have no funding resources or conflict of interests to disclose.\n\nFigure 1 Hematoxylin and eosin stain of renal biopsy under polarized light (20x magnification) showing oxalate crystals in tubular lumen.\n\nFigure 2 Hematoxylin and eosin stain of renal biopsy under polarized light (40x objective magnification) showing oxalate crystals with suggestion of “fan” like morphology (blue arrow).\n==== Refs\n1 Winearls CG Iatrogenic acute oxalate nephropathy Nephrology, Dialysis, Transplantation 1995 10 12 p. 2171 2-s2.0-0029421570 \n2 Chen CL Fang HC Chou KJ Wang JS Chung HM Acute oxalate nephropathy after ingestion of star fruit American Journal of Kidney Diseases 2001 37 2 418 422 2-s2.0-0035147489 11157385 \n3 Keiran S Bhimani B Dixit A Ethylene glycol toxicity American Journal of Kidney Diseases 2005 46 3 e31 e33 2-s2.0-26944446631 16134263 \n4 Ahmed MH Orlistat and calcium oxalate crystalluria: an association that needs consideration Renal Failure 2010 32 8 1019 1021 2-s2.0-77955937777 20722574 \n5 Singh A Sarkar SR Gaber LW Perazella MA Acute oxalate nephropathy associated with orlistat, a gastrointestinal lipase inhibitor American Journal of Kidney Diseases 2007 49 1 153 157 2-s2.0-33845591394 17185156 \n6 Rössner S Sjöström L Noack R Meinders AE Noseda G Weight loss, weight maintenance, and improved cardiovascular risk factors after 2 years treatment with orlistat for obesity Obesity Research 2000 8 1 49 61 2-s2.0-0033629936 10678259 \n7 Karamadoukis L Shivashankar GH Ludeman L Williams AJ An unusual complication of treatment with orlistat Clinical Nephrology 2009 71 4 430 432 2-s2.0-66649105221 19356376 \n8 Nelson WK Houghton SG Milliner DS Lieske JC Sarr MG Enteric hyperoxaluria, nephrolithiasis, and oxalate nephropathy: potentially serious and unappreciated complications of Roux-en-Y gastric bypass Surgery for Obesity and Related Diseases 2005 1 5 481 485 2-s2.0-33646464366 16925274 \n9 Ferraz RRN Tiselius HG Heiberg IP Fat malabsorption induced by gastrointestinal lipase inhibitor leads to an increase in urinary oxalate excretion Kidney International 2004 66 2 676 682 2-s2.0-3242774579 15253722 \n10 Sarica K Akarsu E Erturhan S Yagci F Aktaran S Altay B Evaluation of urinary oxalate levels in patients receiving gastrointestinal lipase inhibitor Obesity 2008 16 7 1579 1584 2-s2.0-46249116726 18451780 \n11 Karamadoukis L Ludeman L Williams AJ Is there a link between calcium oxalate crystalluria, orlistat and acute tubular necrosis? Nephrology Dialysis Transplantation 2008 23 5 1778 1779 2-s2.0-44449086837\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2090-665X",
"issue": "2013()",
"journal": "Case reports in nephrology",
"keywords": null,
"medline_ta": "Case Rep Nephrol",
"mesh_terms": null,
"nlm_unique_id": "101598418",
"other_id": null,
"pages": "124604",
"pmc": null,
"pmid": "24527242",
"pubdate": "2013",
"publication_types": "D016428:Journal Article",
"references": "15253722;11157385;20722574;17185156;16925274;18451780;10678259;18272781;16134263;19356376;8808202",
"title": "Acute oxalate nephropathy associated with orlistat: a case report with a review of the literature.",
"title_normalized": "acute oxalate nephropathy associated with orlistat a case report with a review of the literature"
} | [
{
"companynumb": "US-ROCHE-1351791",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "ORLISTAT"
},
"drugadditional": "3",
"drugadm... |
{
"abstract": "BACKGROUND\nThe 4H syndrome (hypomyelination, hypodontia, hypogonadotropic hypogonadism) is a newly recognized leukodystrophy. The classical form is characterized by the association of hypomyelination, abnormal dentition, and hypogonadotropic hypogonadism, but the recent identification of two genes (POLR3A and POLR3B) responsible for the syndrome demonstrates that these three main characteristics can be variably combined among \"Pol-III (polymerase III)-related leukodystrophies.\"\n\n\nMETHODS\nWe report on the clinical, neuroradiological and endocrinological follow-up of a male affected by 4H syndrome with confirmed POLR3B mutations (c.1568 T > A/p.V523E variant in exon 15 and the novel c.1988C > T/p.T663I mutation in exon 19). Spastic-ataxic gait with worsening of motor performance, progressive moderate intellectual disability and language difficulties were the main neurological findings observed. The first six years of substantial stability of the clinical and imaging features were followed by additional six years that showed a progressive worsening of motor, language and learning disabilities in relation to a progression of the cerebellar involvement. Hypogonadotropic hypogonadism and growth hormone deficiency followed by central hypocortisolism became part of the patient's phenotype. Thyroid function resulted unaffected during follow up.\n\n\nCONCLUSIONS\nA novel mutation in POLR3B in a patient with an analogue phenotype than those previously described but with more extensive endocrinological features, including hypogonadotropic hypogonadism, growth hormone deficiency and hypocortisolism, was described. These findings permit to better define the clinical spectrum of the disease, to direct specific genetic tests and to tailor clinical management.",
"affiliations": "Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, , Calambrone, Pisa, Italy. r.battini@fsm.unipi.it.;Department of Obstetrics, Gynecology, and Pediatrics, Pediatric Division, Santa Chiara University Hospital, Pisa, Italy. s.bertelloni@med.unipi.it.;Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, , Calambrone, Pisa, Italy. g.astrea@fsm.unipi.it.;Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, , Calambrone, Pisa, Italy. m.casarano@fsm.unipi.it.;Laboratory of Molecular Medicine, Ospedale Bambino Gesù Research Chidren's Hospital, Rome, Italy. lorena.travaglini@opbg.net.;Department of Obstetrics, Gynecology, and Pediatrics, Pediatric Division, Santa Chiara University Hospital, Pisa, Italy. g.baroncelli@med.unipi.it.;Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, , Calambrone, Pisa, Italy. robrain76@virgilio.it.;Laboratory of Molecular Medicine, Ospedale Bambino Gesù Research Chidren's Hospital, Rome, Italy. enricosilvio.bertini@opbg.net.;Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, , Calambrone, Pisa, Italy. g.cioni@fsm.unipi.it.",
"authors": "Battini|Roberta|R|;Bertelloni|Silvano|S|;Astrea|Guja|G|;Casarano|Manuela|M|;Travaglini|Lorena|L|;Baroncelli|Giampiero|G|;Pasquariello|Rosa|R|;Bertini|Enrico|E|;Cioni|Giovanni|G|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1186/s12881-015-0203-0",
"fulltext": "\n==== Front\nBMC Med GenetBMC Med. GenetBMC Medical Genetics1471-2350BioMed Central London 2620495620310.1186/s12881-015-0203-0Case ReportLongitudinal follow up of a boy affected by Pol III-related leukodystrophy: a detailed phenotype description Battini Roberta r.battini@fsm.unipi.it Bertelloni Silvano s.bertelloni@med.unipi.it Astrea Guja g.astrea@fsm.unipi.it Casarano Manuela m.casarano@fsm.unipi.it Travaglini Lorena lorena.travaglini@opbg.net Baroncelli Giampiero g.baroncelli@med.unipi.it Pasquariello Rosa robrain76@virgilio.it Bertini Enrico enricosilvio.bertini@opbg.net Cioni Giovanni g.cioni@fsm.unipi.it Department of Developmental Neuroscience, IRCCS Stella Maris, Viale del Tirreno 331, 56128, Calambrone Pisa, Italy Department of Obstetrics, Gynecology, and Pediatrics, Pediatric Division, Santa Chiara University Hospital, Pisa, Italy Laboratory of Molecular Medicine, Ospedale Bambino Gesù Research Chidren’s Hospital, Rome, Italy Department of Clinical and Experimental Medicine, University of Pisa, Pisa, Italy 25 7 2015 25 7 2015 2015 16 5317 11 2014 14 7 2015 © Battini et al. 2015This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nThe 4H syndrome (hypomyelination, hypodontia, hypogonadotropic hypogonadism) is a newly recognized leukodystrophy. The classical form is characterized by the association of hypomyelination, abnormal dentition, and hypogonadotropic hypogonadism, but the recent identification of two genes (POLR3A and POLR3B) responsible for the syndrome demonstrates that these three main characteristics can be variably combined among “Pol-III (polymerase III)-related leukodystrophies.”\n\nCase presentation\nWe report on the clinical, neuroradiological and endocrinological follow-up of a male affected by 4H syndrome with confirmed POLR3B mutations (c.1568 T > A/p.V523E variant in exon 15 and the novel c.1988C > T/p.T663I mutation in exon 19). Spastic-ataxic gait with worsening of motor performance, progressive moderate intellectual disability and language difficulties were the main neurological findings observed. The first six years of substantial stability of the clinical and imaging features were followed by additional six years that showed a progressive worsening of motor, language and learning disabilities in relation to a progression of the cerebellar involvement. Hypogonadotropic hypogonadism and growth hormone deficiency followed by central hypocortisolism became part of the patient’s phenotype. Thyroid function resulted unaffected during follow up.\n\nConclusions\nA novel mutation in POLR3B in a patient with an analogue phenotype than those previously described but with more extensive endocrinological features, including hypogonadotropic hypogonadism, growth hormone deficiency and hypocortisolism, was described. These findings permit to better define the clinical spectrum of the disease, to direct specific genetic tests and to tailor clinical management.\n\nKeywords\n4H leukodystrophyPOLR3B geneHypomyelinationHypogonadotropic hypogonadismGrowth impairmentPanhypopituitarismRecombinant GHissue-copyright-statement© The Author(s) 2015\n==== Body\nBackground\nLeukodystrophy is a heterogeneous group of inherited neurodegenerative disorders characterized by abnormal central-nervous-system (CNS) white matter at brain imaging [1]. Congenital hypomyelinating disorders are the largest sub-group of leukodystrophies [2]; among these, the 4H syndrome (hypomyelination, hypodontia, hypogonadotropic hypogonadism) (HLD7, OMIM 607694 and HLD8, OMIM 614381) has been recently characterized genetically with manifestations of hypomyelination of the brain and of the peripheral nervous system [1–4], associated, in the classical form, with abnormal dentition (hypodontia) [5] and hypogonadotropic hypogonadism [1–7].\n\nTwo causative genes encoding the largest subunits of human RNA polymerase III (Pol III) -POLR3A and POLR3B- have been identified [8, 9] and mutations in these genes may cause four overlapping hypomyelinating leukodystrophy phenotypes: 1) tremor-ataxia with central hypomyelination or TACH; 2) 4H syndrome; 3) leukodystrophy with oligodontia (LO); 4) diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum (HCAHC) [6–10].\n\nTo date, the largest series described consists of 105 patients, of whom 43 have mutations in POLR3A gene and 62 in POLR3B gene. Except for French Canadian patients, affected individuals from European backgrounds were more likely to have POLR3B mutations than other populations [9, 11].\n\nRegarding the imaging studies, Takanashi et al. [12], but also Wolff et al. [11], suggested that the Magnetic Resonance Imaging (MRI) pattern of hypomyelination and cerebellar abnormality may be distinct between patients with POLR3A and 3B mutations. Cerebellar atrophy was found almost in all patients with 4H syndrome [11, 13, 14], but the cerebellar anomalies were more severe in patients with POLR3B while the pattern of hypomyelinization was more evident in the MRI of POLR3A mutated patients [11, 12].\n\nWe report on the longitudinal clinical and MRI study of a new patient with Pol III-related leukodystrophy. The patient was firstly diagnosed as an undefined hypomyelination leukodystrophy and reached the final genetically confirmed diagnosis ten years later, following the description of POLR3A and POLR3B as disease genes.\n\nPatient’s endocrinological profile in adolescence was evaluated in order to define the endocrine phenotype of this disorder and to give better indications for clinical management.\n\nCase presentation\nGenotyping\nAfter obtaining informed consent, genomic DNA was extracted from peripheral blood following the manufacturer’s instructions (Qiagen, Hilden, Germany). The entire coding sequence and intron–exon boundaries of POLR3A (NM_007055) and POLR3B (NM_018082) genes were amplified by PCR using intronic primers designed to flank coding exons. Amplimers were purified using Exo-SAP (GE Healthcare) and directly sequenced using BigDye 3.1 chemistry (Applied Biosystems, Foster City, CA, USA) with an ABI Prism 3130 xl automatic sequencer (Applied Biosystems). Mutations were confirmed in independent reactions by sequencing both strands and segregation analysis of the identified mutations was performed by sequencing the corresponding amplicons in family members.\n\nEndocrinological methods\nCentiles of birth weight and length were calculated according to Italian reference standards [15]; postnatal height was expressed as raw measured values and as standard deviation scores (SDs) according to Tanner et al. [16]. Bone age was assessed according to the method of Greulich and Pyle [17]; mid parental height (MPH) was calculated using measured parental heights adjusted for male sex [(father height + mother height)/2) + 6.5 cm]. Baseline blood samples were obtained in the fasting state between 8.00 and 9.00 a.m.; GH secretion in response to GHRH (1 μg/kg i.v.) plus arginine provocative test (0.5 mg/kg/i.v.) was assessed with sampling at 0, 30, 60, 90, 120 min (normal response = GH peak > 20 ng/ml). Serum levels of LH, FSH, Δ4-androstenedione, testosterone, dihydrotestosterone (DHT), cortisol, and ACTH were measured by commercially kits. All serum samples were kept at −80 °C up till to laboratory assessment. Serum levels of GH and IGF1 (reference values for prepubertal children 277 ± 93 ng/ml) were determined as previously reported [18].\n\nNeurological examination\nAt each evaluation a senior neurologist examined the patient using the Brief Ataxia Rating Scale (BARS). This instrument was selected as it could be rapidly administered during the clinical setting without special appliances or equipment; its feasibility and reliability have been well documented in ataxic patients [19].\n\nFindings\nAn Italian boy has been referred to our Department at age 6 years for evaluation of developmental delay and because of mild ataxic gait from the beginning of unsupported walking; he was followed overtime until to age 20 years. He was born from an uneventful pregnancy by dystocic delivery [birth weight g 3300 (−0.43 SDS), birth length cm 49 (−0.98 SDS), birth head circumference cm 35 (0.22 SDS)]. His motor and mental developmental milestones were delayed: he was able to walk unsupported at the age of 16 months, however, he was described as “clumsy” and unstable; he spoke with meaningful words at 18 months and brief sentences at 24 months with following speech word by word. Dentition was also delayed: front incisor teething was presented at 4 years and successively normal teeth progression continued. Attention deficit and mild learning impairment were also reported since his primary school attendance.\n\nAt the age of 7 years, cerebellum signs as ataxic gait, mild tremor of upper limb, nystagmus, ocular motor abnormalities, such as hypometric saccades, and dysarthric language were the prominent clinical manifestations.\n\nBrain MRI was characterized by a diffusely hyperintense signal on T2-weighted images of the cerebral white matter with sparing of optic radiation. The cerebellar vermis was atrophic (Fig. 1a).Fig. 1 Hypomyelination with cerebellar atrophy: long term follow-up evaluation. a (7 years). b (10 year). c (13 years). d (15 years). e (19 years): Axial and coronal T2-weighted images show extensive cerebral white matter (WM) abnormalities with predominant involvement of the deep and subcortical WM; note the sparing of optic radiation (arrows), perirolandic WM and partial splenum corpus callosum. The head arrows (a-e), instead, indicate small hypointense dot in the posterior limb of the internal capsule. Mild abnormal hyperintensity involves the cerebellar WM. Sagittal T1-weighted images show a thin corpus callosum and shrunken cerebellar cortex with enlarged fissures. The pons is normal. At age of 13 years MRI (c) revealed a mildly increased cortical atrophy of cerebellar hemispheres that remained stable in the following MRI exams. No significative changes were observed during the yrs on WM abnormalies\n\n\n\nIn order to make a differential diagnosis between the known leukodystrophies, serum levels of aminoacids, alfa-fetoprotein, carcinoembryonic antigen, lysosomal enzyme (arilsulfatase, betaesasominidase, betagalactocerobrosidase), fitanic and pristanic acid, very-long chain fatty acids, sialic acid and isoelectric focussing of transferrin were performed and all of them were within normal limits. In addition, molecular genetics ruled out mutations in PLP1, GJC2/GJA12 and HSPD1.\n\nEEG recording showed mild occipital anomalies that disappeared with time, showing only a low amplitude of background activity. Serial electrophysiological studies showed that auditory brain-stem responses (ABR) have always been normal; upper limb somato-sensory evoked potential (SSEP) were abnormal but remained stable with time; nerve velocity conduction showed a sensory peripheral delay, while the motor component was normal. Lower leg motor evoked potentials (MEP) were not detectable while upper limb stimulation was normal.\n\nFlash visual evoked potentials (F-VEP) and electro-retinogram (ERG), instead, showed a slow deterioration with progressive reduced amplitude during the follow-up, consistently the boy developed low visual acuity.\n\nNeurophysiological studies performed during the follow-up are shown in Table 1.Table 1 Neurophysiological data of the patient during follow-up\n\nAge\tEEG\tABR\tSSEP\tmNCV\tsNCV\tF-VEP/ERG\tMEP\t\n\t\t\tUpper Limbs (UL)\tUL\tLower Limbs (LL)\tUL\tLL\tP100\tERG\tUL\tLL\t\n7 years\toccipital anomalies\tN\tN9:8.2 ms\tN\tN\tN\tN\t141 ms\tN\t----\t-----\t\nN13:9.8 ms\t18.7 μV\t\nN20:18 ms\t\n13 years\t------\tN\tN9: 8.6 ms\tN\tN\t50 μV\t50 μV\t145 ms\tN\t----\t-----\t\nN13:11.3 ms\t2.8 ms\t4.3 ms\t11.4 μV\t\nN20:19 ms\t35 m/s\t26 m/s\t\n17 years\tLow amplitude background activity\tN\t-----\t----\t----\t-----\t-----\t142 ms\tN\tN\tn.d.\t\n−2.8 μV\t\n19 years\tLow amplitude background activity\tN\tN9: 8.6 ms\tN\tN\t50 μV\t50 μV\tn.d.\tN\tN\tn.d.\t\nN13:13.3 ms\t\t\t3.1 ms\t4.9 ms\t\nN20:2 ms\t37 m/s\t28 m/s\t\n\nEEG electroencephalogram, ABR auditory brainstem response, SSEP somatosensitive evoked potentials, NCV nerve conduction velocity (m: motor; s: sensitive), F-VEP flash visual evoked potentials, ERG electroretinogramm, MEP motor evoked potentials\n\n-----not done, N normal, n.d not detectable\n\n\n\nAround the age of 10 years intention tremor increased and at age of 13 years, the boy showed progressive gait abnormalities due to spasticity associated with ataxia and slow cognitive regression without discrepancy between verbal and performance quotient (Total IQ 62) became clear. Despite the absence of subjective sensory troubles at lower limbs, the patient showed an electroclinical sensory neuropathy, not reported until now in other patients [3, 11], even if peripheral nerve hypomyelination on electron microscopy in sural nerve biopsy were already described in three patients, despite their normal nerve-conduction studies [3] and a mild lack of myelin was observed also in the nerve biopsy of a patient of Wolf series [11]. These nerve pathology observations seem to be in agreement with the findings on nerve conduction studies of the lower limbs in our patients.\n\nComparing to the 7 years brain MRI, the important cerebral white matter hyperintensity remained substantially stable in the sequential examinations at 10-13-15 years of age (Fig. 1b, c and d respectively), with the exception of a worsening in the atrophy of cerebellar hemispheres that became evident from age 13 years (Fig. 1c).\n\nAt 15 years, the coding region and the flanking exon/intron boundaries of POLR3A and/or POLR3B genes were amplified and sequenced. Two compound heterozygous missense mutations in POLR3B gene were identified: the common V523E variant in exon 15 [9, 11], inherited from his mother and the novel T663I mutation in exon 19, inherited from his father.\n\nAt 19 years, the adolescent presented a clear spastic-ataxic gait with worsening of motor performance that included upper limb functions; he could walk autonomously but he needed a wheelchair when walking for long distances.\n\nHis cognitive profile worsened, revealing a moderate intellectual disability (Total IQ 32), language became progressively worse and slow and the comprehension of his speech was increasingly difficult.\n\nBrain MRI showed extensive white matter abnormalities with predominant involvement of the deep and subcortical white matter; the cerebellum was shrunken, with thin folia and enlarged fissures that were moderately abnormal in the hemispheres and severely abnormal in the vermis (Fig. 1e). Proton single voxel Magnetic Resonance Spectroscopy (1H MRS) was added to serial MRI follow-up, acquired from the posterior centrum semiovale white matter and interhemispheric parieto-occipital gray matter. MRS evaluations during the follow-up showed a relative decrease of choline peak, related to the N Acetil Aspartate and Creatine peaks, involving the white matter and slightly the gray matter as well, probably related to the abnormal myelination. These data remained stable during overtime, as demonstrated when comparing between the last examination (Fig. 2a and b) and the first one (Fig. 2c and d).Fig. 2 \na-d. Single voxel short TE (35 ms) 1H-MRS acquired from posterior centrum semiovale (WM) and interhemispheric parieto-occipital gray matter (GM) at 19 years (a-b). Single voxel short TE (35 ms) 1H MRS acquired from posterior centrum semiovale (WM) and interhemispheric parieto-occipital (GM) at 19 years (a - b); a comparison with the first 1H-MRS acquisition (7 years) was shown (c-d). In WM was present a decreased Choline (Cho) that is slightly reduced also in GM; no changes in proton MRS have been observed over the time\n\n\n\nThe neuroradiological pattern of this patient is similar to those reported in patients with POL3B gene mutations with a 4H syndrome, particularly related to the cerebellar involvement. Our patient showed, in fact, severe hypomyelination from the beginning of the disease and mild progression of the cerebellar atrophy that was particularly marked in the vermis [2, 13]. As in the large series of patients reported [11] the optic radiation (Fig. 1, arrows) and the dentate nucleus also in our patient were spared; indeed a small hypointense dot in the posterior limb of the internal capsule was seen in our patient too (Fig. 1, head arrows). The last MRI evaluation at 19 years did not show a significative supratentorial atrophy although the cognitive decline could suggest that feature, as reported in literature [11].\n\nThe disease progression was very slow at the beginning and progressively accelerated both from a clinical and imaging point of view: in the adolescent age the boy showed worsening of motor disabilities and language, particularly of dysarthria and gait disability, and learning abilities in relation to progression of the cerebellar involvement (Fig. 1a-e).\n\nBARS scale was used to assess the clinical picture and the score of each BARS test designed the longitudinal evolution during the follow-up (Fig. 3). Clinical signs of our patient in association to other outcome measures (Wechsler scale for intellectual quotient and MRI data) were considered to show the outcome grading of disease severity (Fig. 3).Fig. 3 Longitudinal evolution of the disease emerged considering BARS scores (column) and full-scale IQ at Wechsler scale\n\n\n\nClinical examination at 19 years showed severe short stature [height, cm 151.0 (−3.6 SDs); MPH, cm: 168.5 (−0.9 SDs)], overweight [kg: 60.5 (weight for height excess: 47.6 %)], and severe puberty delay [G1, Ph2; mean testicular volume, ml: 2 (−8.4 SDs)]. Assessment of reproductive axis was performed and low testosterone concentrations as well as low values of basal and stimulated LH and FSH were found (Table 2), concluding for the diagnosis of hypogonadotropic hypogonadism. Due to height impairment, GH-IGF1 axis was also explored, showing subnormal GH secretion and low IGF1 values, permitting the diagnosis of GH deficiency (GHD). The remaining of the pituitary axis was not affected, but low normal values of both ACTH and cortisol were found (Table 2). Reduced bone mineral density (BMD) was found at both lumbar spine (BMD area: −2.1 SDs; BMD volume −0.9 SDs) and femoral neck (BMD area: −4.6 SDS; BMD volume −5.0 SDs). Treatment with recombinant GH was started (0.25 mg/kg/week), while testosterone administration was delayed to improve the severe growth delay. At 6 and 12 months of GH therapy, growth velocity increased to 7.7 cm/year and to 6.0 cm/year; IGF1 levels normalized (Table 2), but overt central hyposurrenalism was detected after 6 months of GH administration (Table 2) and substitutive treatment with long-acting hydrocortisone (Plenadren®, 20 mg/daily) was started. Transdermal testosterone (Tostrex®, 10 mg/daily) was added after 12 months of GH administration.Table 2 Endocrinological data at the age 19 years\n\nParameter\tBaseline\t6 month GH therapy\tNormal values\t\nGH basal, ng/ml\t0.3\t—\t—\t\nGH peak, ng/ml\t2.0\t—\t>9.1\t\nIGF1, ng/ml\t84.6\t349.0\t127-424\t\nLH basal, UI/L\t0.6\t—\t1.4-12.7\t\nLH peak, UI/L\t1.1\t—\t>5\t\nFSH basal, UI/L\t1.0\t—\t1.3 – 19.5\t\nFSH peak, UI/L\t1.4\t—\t—\t\nTestosteone, ng/ml\t<0.1\t<01\t1.7-7.8\t\nACTH, pg/ml\t14\t12\t<50\t\nAntimüllerian hormone, ng/ml\t30.0\t—\t1.2-15.0\t\nCortisol, μg/dla\n\t7.0\t0.6\t6.7-22.6\t\nTSH, μU/ml\t1.9\t1.8\t0.4-3.4\t\nfT3, pg/ml\t4.4\t4.0\t2.7-5.7\t\nfT4, ng/dl\t1.2\t1.1\t0.7-1.7\t\n\naconfirmed in multiple samples in different days and also by reduced values of urinary 24 h cortisol\n\n\n\nThus, hypogonadotropic hypogonadism as a part of the phenotypic spectrum of 4H syndrome was confirmed [4, 6, 20, 21]; however, in our patient, pituitary function resulted more largely affected than usually described, as suggested by the presence of GHD and hyposurrenalism. Normal thyroid function was found in the present adolescent as well as in other patients [11].\n\nGHD has been suspected in another young adult patient, but he showed normal adult stature and dynamic assessment of GH secretion was not performed [20, 22]; thus, diagnosis relied only on low IGF1 values [20]. We explored GH status by a potent test because of a negative impact of adipose tissue on GH secretion [23]. An other adolescent patient with short stature and partial GHD has been described [21] and, recently, additional 5 subjects with 4H syndrome and GHD have been reported in the large series of Wolf et al. [11], but endocrine data to support the diagnosis have been not shown [21]. However, only 10 patients were tested for GHD and the effective number of those with short stature was not shown in the Wolf’s series [11].\n\nConversely, normal GH-IGF1 axis has been described in an adolescent boy with 4H syndrome and growth delay [6].\n\nIn addition, impaired ACTH-cortisol axis developed in this boy in late adolescence. Start of GH therapy may have unmasked a latent hypocortisolism as well known in panhypopituitarism.\n\nReduced BMD values have been found in the present patient, determining an increase in fracture risk. This is an unreported, but not unexpected, finding of the 4H syndrome, since both GHD and hypogonadism may impair bone health [24, 25]; reduced BMD might be, moreover, related to the poor physical activity, as reported in other neurological diseases [26, 27].\n\nConclusions\nWe report on longitudinal follow-up of Pol III-related leukodystrophy in a boy who manifested the combination of the major clinical findings (hypomyelination, motor dysfunction, abnormal dentition and hypogonadotropic hypogonadism) related to the 4H syndrome [1–7]. The clinical phenotype of our patient shares some features with the four overlapping clinical syndromes described before the identification of the mutations in POLR3A and POLR3B genes, confirming that the various allelic hypomyelinating disorders do not represent distinct clinical entities but a continuous spectrum. Our patient with early presentation, so far remains ambulant; initial ataxic gait has become progressively spastic; he did not present a true hypodontia but only delayed eruption of his deciduous teeth and a mild intellectual disability with slow cognitive regression, a peripheral neuropathy and multiple pituitary deficiencies associated with low BMD represent additional unusual features, suggesting an intermediate phenotype.\n\nAbnormal smooth pursuit and nystagmus remain the main ocular features without signs of optic atrophy so far that have to be investigated during the follow up.\n\nGHD might be a more common finding than usually considered [11], but the true GH secretory status in patients with 4H syndrome remains unclear till homogeneous and large series of patients will be assessed. Indeed, GH secretory status should be adequately assessed when impaired linear growth is present and GH treatment should be started when GHD was confirmed, considering the efficacy of the GH therapy also at the late age of our subject.\n\nPituitary pathology may be progressive in the 4H syndrome and hypophyseal function should be monitored during lifespan, to warrant an adequate substitutive therapy patients if pituitary abnormalities will develop, mainly regarding lifesaving therapies as hydrocortisone, because abnormal adrenal function may be implicated in the reduced survival rate reported in these patients [11] in addition to deterioration of neurological functions.\n\nBMD values should be followed during hormonal substitutive therapies to verify its improvement. Regarding bone features, mild osteopetrosis has been reported in 3 patients of Wolf’s series [11], but we did not performed X-ray examination of the skeleton in this patient.\n\nIn addition, adequate follow-up should be done during substitutive therapies not only regarding the physical features, but also regarding neurological abnormalities. In fact, experimental data indicated that both GHD and testosterone deficiency may be involved in impairing myelinisation process [28–30].\n\nOur findings expand the clinical spectrum of allelic variants in “Pol-III-related leukodystrophies” and suggest that these mutations are probably under diagnosed in congenital hypomyelinating disorders. For the clinicians, it is important to observe the additional findings of the syndrome to optimize long term management. A better definition of the phenotypic involvement with the aid of a neurophysiologic assessment allows a better understanding of functional deficits and helps in the management of this disorder. In addition, this report supports a progressive hypophyseal endocrine dysfunction with ageing that should be highlighted in larger series of patients.\n\nConsent\nWe have obtained the written informed consent from the patient for pubblication of this case report and any accompanying images. A copy of the written consent is available for review from the Editor of this journal.\n\nAbbreviations\nCNSCentral-nervous-system\n\nTACHTremor-ataxia with central hypomyelination\n\nLOLeukodystrophy with oligodontia\n\nHCAHCCerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum\n\nMRIMagnetic resonance imaging\n\nABRBrainstem auditory responses\n\nSSEPSomatosensory evoked potential\n\nF-VEPFlash visual evoked potential\n\nERGElectroretinogram\n\nIQIntellectual Quotient\n\n1H MRSProton single voxel magnetic resonance spectroscopy\n\nMPHMidparental height\n\nGHDGrowth hormon deficiency\n\nBMDBone mineral density\n\nSDsStandard deviation scores\n\nDHTDihydrotestosterone\n\nBARSBrief Ataxia Rating Scale\n\nEnrico Bertini and Giovanni Cioni contributed equally to this work.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\n\nStudy concept and design: RB, SB, GA. Acquisition of data: RB, MC, GA, SB, GB, LT, RP. Analysis and interpretation of data: RB, SB, GA, MC, GB, RP, LT. Drafting of the manuscript: RB, SB, GA, EB. Critical revision of the manuscript for important intellectual content: EB, GC. Study supervision: RB, GC. All authors read and approved the final manuscript.\n\nAcknowledgements\nWe are thankful to Doctor Michela Tosetti and to MRI laboratory for imaging and MRS data acquisitions and analysis. Finally we would like to thanks the family for participation in our study.\n==== Refs\nReferences\n1. Wolf NI Harting I Innes AM Patzer S Zeitler P Schneider A Ataxia, delayed dentition and hypomyelination: a novel leukoencephalopathy Neuropediatrics 2007 38 64 70 10.1055/s-2007-985137 17712733 \n2. Bekiesinska-Figatowska M Mierzewska H Kuczynska-Zardzewialy A Szczepanik E Obersztyn E Hypomyelination, hypogonadotropic hypogonadism, hypodontia - First Polish patient Brain Dev 2010 32 574 8 10.1016/j.braindev.2009.07.008 19700253 \n3. Timmons M Tsokos M Asab MA Seminara SB Zirzow GC Kaneski CR Peripheral and central hypomyelination with hypogonadotropic hypogonadism and hypodontia Neurology 2006 67 2066 9 10.1212/01.wnl.0000247666.28904.35 17159124 \n4. Vázquez-López M Ruiz-Martín Y de Castro-Castro P Garzo-Fernández C Martín-del Valle F Márquez-de la Plata L Central hypomyelination, hypogonadotrophic hypogonadism and hypodontia: A new leukodystrophy Rev Neurol 2008 47 204 8 18671210 \n5. Atrouni S Darazé A Tamraz J Cassia A Caillaud C Mégarbané A Leukodystrophy associated with oligodontia in a large inbred family: fortuitous association or new entity? Am J Med Genet A 2003 118A 76 81 10.1002/ajmg.a.10019 12605447 \n6. Orcesi S Tonduti D Uggetti C Larizza D Fazzi E Balottin U New case of 4H syndrome and a review of the literature Pediatr Neurol 2010 42 359 64 10.1016/j.pediatrneurol.2010.01.015 20399393 \n7. Tétreault M Choquet K Orcesi S Tonduti D Balottin U Teichmann M Recessive mutations in POL3B, encoding the second largest subunit of Pol III, cause a rare hypomyelinating leukodystrophy Am J Hum Genet 2011 89 652 5 10.1016/j.ajhg.2011.10.006 22036172 \n8. Bernard G Chouery E Putorti ML Tétreault M Takanohashi A Carosso G Mutations of POLR3A encoding a catalytic subunit of RNA polymerase Pol III cause a recessive hypomyelinating leukodystrophy Am J Hum Genet 2011 89 415 23 10.1016/j.ajhg.2011.07.014 21855841 \n9. Daoud H Tétreault M Gibson W Guerrero K Cohen A Gburek-Augustat J Mutations in POLR3A and POLR3B are a major cause of hypomyelinating leukodystrophies with or without dental abnormalities and/or hypogonadotropic hypogonadism J Med Genet 2013 50 3 194 7 10.1136/jmedgenet-2012-101357 23355746 \n10. Saitsu H Osaka H Sasaki M Takanashi J Hamada K Yamashita A Mutations in POLR3A and POLR3B Encoding RNA Polymerase III Subunits Cause an Autosomal-Recessive Hypomyelinating Leukoencephalopathy Am J Hum Genet 2011 89 644 51 10.1016/j.ajhg.2011.10.003 22036171 \n11. Wolff NI Vanderver A van Spaendonk Rosalina ML Shiffman R Braiss B Bugiani M Clinical spectrum of 4H leukodystrophy caused by POLR3A and POLR3B mutations Neurology 2014 83 1898 905 10.1212/WNL.0000000000001002 25339210 \n12. Takanashi J Osaka H Saitsu H Sasaki M Mori H Shibayama H Different patterns of cerebellar abnormality and hypomyelination between POLR3A and POLR3B mutations Brain Dev 2014 36 3 259 63 10.1016/j.braindev.2013.03.006 23643445 \n13. Sasaki M Takanashi J Tada H Sakuma H Furushima W Sato N Diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum Brain Dev 2009 31 582 7 10.1016/j.braindev.2008.09.003 18851904 \n14. Steenweg ME Vanderver A Blaser S Bizzi A de Koning TJ Mancini GM Magnetic resonance imaging pattern recognition in hypomyelinating disorders Brain 2010 133 2971 82 10.1093/brain/awq257 20881161 \n15. Bertino E Spada E Occhi L Coscia A Giuliani F Gagliardi L Neonatal anthropometric charts: the Italian neonatal study compared with velocity, weight velocity, and stages of puberty Arch Dis Child 2010 51 170 9 \n16. Tanner JM Whitehouse RH Clinical longitudinal standards for height, weight, height velocity, weight velocity, and stages of puberty Arch Dis Child 1976 51 170 9 10.1136/adc.51.3.170 952550 \n17. Greulich WW Pyle SI Radiographic atlas of skeletal development of the hand and wrist 1959 2 Stanford Stanford University Press \n18. Bertelloni S Baroncelli GI Dati E Ghione S Baldinotti F Toschi B IGF-I generation test in prepubertal children with Noonan syndrome due to mutations in the PTPN11 gene Hormones (Athens) 2013 12 86 92 23624134 \n19. Schmahmann JD Gardner R MacMore J Vangel MG Development of a brief ataxia rating scale (BARS) based on a modified form of the ICARS Mov Disord 2009 24 12 1280 8 10.1002/mds.22681 19425059 \n20. Potic A Brais B Choquet K Schiffmann R Bernard G 4H syndrome with late-onset growth hormone deficiency caused by POLR3A mutations Arch Neurol 2012 69 920 3 10.1001/archneurol.2011.1963 22451160 \n21. Outteryck O Devos D Jissendi P Boespflug-Tanguy O Hopes L Renard D 4H syndrome: a rare cause of leukodystrophy J Neurol 2010 257 10 1759 61 10.1007/s00415-010-5598-0 20512583 \n22. Markkanen HM Pekkarinen T Välimäki MJ Alfthan H Hämäläinen E Stenman UH Comparison of two growth hormone stimulation tests and their cut-off limits in healthy adults at an outpatient clinic Growth Horm IGF Res 2013 23 5 165 9 10.1016/j.ghir.2013.06.002 23835226 \n23. Carrillo AA Bao Y Lifshitz F Hormonal dynamic tests and genetic tests used in pediatric endocrinology Pediatric Endrocrinology, 5th ed, chapt. 33 2007 New York, NY Informa Healthcare USA, Inc 737 67 \n24. Bazarra-Castro MÁ Sievers C Schwarz HP Pozza SB Stalla GK Changes in BMI and management of patients with childhood onset growth hormone deficiency in the transition phase Exp Clin Endocrinol Diabetes 2012 120 9 507 10 10.1055/s-0032-1327599 23070828 \n25. Baroncelli GI Bertelloni S Orwell E The effects of sex steroids on bone growth Osteoporosis in men 2009 New York Elsevier Inc 105 18 \n26. Zacharin M Current advances in bone health of disabled children Curr Opin Pediatr. 2004 16 545 51 10.1097/01.mop.0000138679.70932.90 15367849 \n27. Baroncelli GI Battini R Bertelloni S Brunori E de Terlizzi F Vierucci F Analysis of quantitative ultrasound graphic trace and derived variables assessed at proximal phalanges of the hand in healthy subjects and in patients with cerebral palsy or juvenile idiopathic arthritis. A pilot study Bone 2010 46 182 9 10.1016/j.bone.2009.09.010 19772958 \n28. Juraska JM Sisk CL DonCarlos LL Sexual differentiation of the adolescent rodent brain: hormonal influences and developmental mechanisms Horm Behav 2013 64 203 10 10.1016/j.yhbeh.2013.05.010 23998664 \n29. Patel R Moore S Crawford DK Hannsun G Sasidhar MV Tan K Attenuation of corpus callosum axon myelination and remyelination in the absence of circulating sex hormones Brain Pathol 2013 23 462 75 10.1111/bpa.12029 23311751 \n30. Regalado-Santiago C López-Meraz ML Santiago-García J Fernández-Pomares C Juárez-Aguilar E Growth hormone (GH) is a survival rather than a proliferative factor for embryonic striatal neural precursor cells Growth Horm IGF Res 2013 23 179 86 10.1016/j.ghir.2013.07.002 23891194\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1471-2350",
"issue": "16()",
"journal": "BMC medical genetics",
"keywords": null,
"medline_ta": "BMC Med Genet",
"mesh_terms": "D000848:Anodontia; D001259:Ataxia; D001921:Brain; D002648:Child; D005500:Follow-Up Studies; D006801:Humans; D007006:Hypogonadism; D056784:Leukoencephalopathies; D008279:Magnetic Resonance Imaging; D008297:Male; D064926:Neurophysiological Monitoring; D010641:Phenotype",
"nlm_unique_id": "100968552",
"other_id": null,
"pages": "53",
"pmc": null,
"pmid": "26204956",
"pubdate": "2015-07-25",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "15367849;23070828;20512583;20399393;20881161;23355746;23624134;23891194;17159124;19772958;22036172;12605447;20601901;25339210;23311751;952550;17712733;18851904;21855841;22036171;23643445;18671210;23835226;19562773;22451160;23998664;19700253",
"title": "Longitudinal follow up of a boy affected by Pol III-related leukodystrophy: a detailed phenotype description.",
"title_normalized": "longitudinal follow up of a boy affected by pol iii related leukodystrophy a detailed phenotype description"
} | [
{
"companynumb": "IT-ROCHE-1624439",
"fulfillexpeditecriteria": "1",
"occurcountry": "IT",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "SOMATROPIN"
},
"drugadditional": null,
"drug... |
{
"abstract": "OBJECTIVE\nCarfilzomib-lenalidomide-dexamethasone therapy yields deep responses in patients with newly diagnosed multiple myeloma (NDMM). It is important to gain an understanding of this combination's tolerability and impact on minimal residual disease (MRD) negativity because this end point has been associated with improved survival.\n\n\nOBJECTIVE\nTo assess the safety and efficacy of carfilzomib-lenalidomide-dexamethasone therapy in NDMM and high-risk smoldering multiple myeloma (SMM).\n\n\nMETHODS\nClinical and correlative pilot study at the National Institutes of Health Clinical Center. Patients with NDMM or high-risk SMM were enrolled between July 11, 2011, and October 9, 2013. Median follow-up was 17.3 (NDMM) and 15.9 months (SMM).\n\n\nMETHODS\nEight 28-day cycles were composed of carfilzomib 20/36 mg/m2 on days 1, 2, 8, 9, 15, and 16; lenalidomide 25 mg on days 1 through 21; and dexamethasone 20/10 mg (cycles 1-4/5-8) on days 1, 2, 8, 9, 15, 16, 22, and 23. Patients who achieved at least stable disease subsequently received 24 cycles of lenalidomide extended dosing.\n\n\nMETHODS\nPrimary end points were neuropathy of grade 3 or greater (NDMM) and at least very good partial response rates (SMM). Minimal residual disease was also assessed.\n\n\nRESULTS\nOf 45 patients with NDMM, none had neuropathy of grade 3 or greater. Of 12 patients with high-risk SMM, the most common of any-grade adverse events were lymphopenia (12 [100%]) and gastrointestinal disorders (11 [92%]). All patients with SMM achieved at least a very good partial response during the study period. Among the 28 patients with NDMM and the 12 with SMM achieving at least a near-complete response, MRD negativity was found in 28 of 28 (100% [95% CI, 88%-100%]), 11 of 12 (92% [95% CI, 62%-100%]) (multiparametric flow cytometry), 14 of 21 (67% [95% CI, 43%-85%]), and 9 of 12 (75% [95% CI, 43%-94%]) (next-generation sequencing), respectively. In patients with NDMM, 12-month progression-free survival for MRD-negative vs MRD-positive status by flow cytometry and next-generation sequencing was 100% vs 79% (95% CI, 47%-94%; P < .001) and 100% vs 95% (95% CI, 75%-99%; P = .02), respectively.\n\n\nCONCLUSIONS\nCarfilzomib-lenalidomide-dexamethasone therapy is tolerable and demonstrates high rates of MRD negativity in NDMM, translating into longer progression-free survival in patients achieving MRD negativity. Carfilzomib-lenalidomide-dexamethasone therapy also demonstrates efficacy in high-risk SMM.",
"affiliations": "Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York2Myeloma Service, Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York3Department of Lymphoma and Myeloma, University of Texas MD Anderson Cancer Center, Houston.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York4Medical Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland5Department of Hemato.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York4Medical Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York4Medical Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York.;Hematology Service, Department of Laboratory Medicine, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland.;Department of Pharmacokinetics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Department of Pharmacokinetics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Hematology Service, Department of Laboratory Medicine, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland.;Hematology Service, Department of Laboratory Medicine, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland.;Hematology Service, Department of Laboratory Medicine, Center for Cancer Research, National Institutes of Health, Bethesda, Maryland.;Lab of Pathology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Lab of Pathology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Lab of Pathology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Sequenta Inc, San Francisco, California.;Sequenta Inc, San Francisco, California.;Sequenta Inc, San Francisco, California.;Molecular Imaging Program, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Molecular Imaging Program, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Molecular Imaging Program, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Biostatistics and Data Management Section, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Department of Pharmacokinetics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland.;Multiple Myeloma Section, Lymphoid Malignancies Branch, National Cancer Institute, National Institutes of Health, New York, New York2Myeloma Service, Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, New York.",
"authors": "Korde|Neha|N|;Roschewski|Mark|M|;Zingone|Adriana|A|;Kwok|Mary|M|;Manasanch|Elisabet E|EE|;Bhutani|Manisha|M|;Tageja|Nishant|N|;Kazandjian|Dickran|D|;Mailankody|Sham|S|;Wu|Peter|P|;Morrison|Candis|C|;Costello|Rene|R|;Zhang|Yong|Y|;Burton|Debra|D|;Mulquin|Marcia|M|;Zuchlinski|Diamond|D|;Lamping|Liz|L|;Carpenter|Ashley|A|;Wall|Yvonne|Y|;Carter|George|G|;Cunningham|Schuyler C|SC|;Gounden|Verena|V|;Sissung|Tristan M|TM|;Peer|Cody|C|;Maric|Irina|I|;Calvo|Katherine R|KR|;Braylan|Raul|R|;Yuan|Constance|C|;Stetler-Stevenson|Maryalice|M|;Arthur|Diane C|DC|;Kong|Katherine A|KA|;Weng|Li|L|;Faham|Malek|M|;Lindenberg|Liza|L|;Kurdziel|Karen|K|;Choyke|Peter|P|;Steinberg|Seth M|SM|;Figg|William|W|;Landgren|Ola|O|",
"chemical_list": "D020533:Angiogenesis Inhibitors; D014408:Biomarkers, Tumor; D009842:Oligopeptides; D061988:Proteasome Inhibitors; D013792:Thalidomide; C524865:carfilzomib; D003907:Dexamethasone; D000077269:Lenalidomide",
"country": "United States",
"delete": false,
"doi": "10.1001/jamaoncol.2015.2010",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2374-2437",
"issue": "1(6)",
"journal": "JAMA oncology",
"keywords": null,
"medline_ta": "JAMA Oncol",
"mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D020533:Angiogenesis Inhibitors; D000971:Antineoplastic Combined Chemotherapy Protocols; D014408:Biomarkers, Tumor; D003907:Dexamethasone; D018572:Disease-Free Survival; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D000077269:Lenalidomide; D008297:Male; D008396:Maryland; D008875:Middle Aged; D009101:Multiple Myeloma; D009316:National Institutes of Health (U.S.); D018365:Neoplasm, Residual; D009842:Oligopeptides; D010865:Pilot Projects; D061988:Proteasome Inhibitors; D012307:Risk Factors; D013792:Thalidomide; D013997:Time Factors; D016896:Treatment Outcome; D014481:United States",
"nlm_unique_id": "101652861",
"other_id": null,
"pages": "746-54",
"pmc": null,
"pmid": "26181891",
"pubdate": "2015-09",
"publication_types": "D016430:Clinical Trial; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "12826635;17576818;17942755;18669875;20385792;21292775;21900189;22495321;22529291;22665938;23065428;23074282;23733781;23782936;23817176;23902483;23929839;24342950;24429703;24646471;25101266;25132630;25482145;25622976",
"title": "Treatment With Carfilzomib-Lenalidomide-Dexamethasone With Lenalidomide Extension in Patients With Smoldering or Newly Diagnosed Multiple Myeloma.",
"title_normalized": "treatment with carfilzomib lenalidomide dexamethasone with lenalidomide extension in patients with smoldering or newly diagnosed multiple myeloma"
} | [
{
"companynumb": "US-CELGENE-163-21880-14011623",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "CARFILZOMIB"
},
"drugadditional": null,
... |
{
"abstract": "We report a multicenter controlled trial comparing renal recovery and tolerance profile of doublet versus triplet bortezomib-based regimens in patients with initial myeloma cast nephropathy (CN) and acute kidney injury (AKI) without need for dialysis.\n\n\n\nAfter symptomatic measures and high-dose dexamethasone, patients were randomly assigned to receive bortezomib plus dexamethasone (BD), or BD plus cyclophosphamide (C-BD). In patients with < 50% reduction of serum free light chains (sFLCs) after 3 cycles, chemotherapy was reinforced with either cyclophosphamide (BD group) or thalidomide (C-BD group).\n\n\n\nNinety-two patients were enrolled in each group. At random assignment, characteristics of the 2 groups were similar, including median age (68 years) and serum creatinine level (305.5 and 273.5 µmol/L in BD and C-BD group, respectively). At 3 months, renal response rate (primary end point) was not different (41 v 47 responders in the BD and C-BD groups, respectively; relative risk [RR], 0.87; P = .46). Very good partial response (free light chain reduction ≥ 90%) or more was achieved in 36 and 47 patients, respectively (RR, 0.76; P = .10). After 1 cycle of chemotherapy, 69 in the BD group and 67 patients in the C-BD group had achieved sFLC level ≤ 500 mg/L. Serious adverse events were recorded in 30 and 40 patients, respectively. At 12 months, 19 patients had died (9 in the BD group v 10 in the C-BD group), including 10 (6 in the BD group and 4 in the C-BD group) from myeloma progression and 3 (0 in the BD group and 3 in the C-BD group) from infection. Within median follow-up of 27 months, 43 and 42 patients switched to new therapy, respectively. Overall, 50 patients (24 in the BD group and 26 in the C-BD group) had died.\n\n\n\nThis randomized study did not show any benefit of C-BD compared with BD on renal recovery of patients with initial CN not requiring dialysis. Adding cyclophosphamide did not sufficiently improve the efficacy-toxicity balance. Patients with myeloma with AKI are fragile, and indication for doublet or triplet regimen should be adapted to frailty.",
"affiliations": "Department of Nephrology, Centre Hospitalier Universitaire de Poitiers, INSERM CIC 1402, Poitiers University, France.;Department of Hematology and Immunology, Hôpital Saint Louis, Assistance Publique-Hôpitaux de Paris, INSERM UMR 1126, Paris, France.;Department of Clinical Hematology, Centre Hospitalier Universitaire Lyon Sud, Hospices Civils de Lyon, Pierre-Benite, France.;Department of Hematology, Centre Hospitalier Universitaire de Nantes, Nantes, France.;Department of Nephrology and Clinical Immunology, Hôpital Bretonneau, Centre Hospitalier Universitaire de Tours, Tours, France.;Department of Hematology, Centre Hospitalier Universitaire de Caen, Caen, France.;Department of Nephrology and Renal Transplantation, Hôpital Henri Mondor, Créteil, Assistance Publique-Hôpitaux de Paris, INSERM U955, Université Paris Est Créteil, Créteil, France.;Department of Hematology, Hôpital Henri Mondor, Assistance Publique-Hôpitaux de Paris, Université Paris Est Créteil, Créteil, France.;Department of Hematology, Centre Hospitalier Universitaire de Grenoble, Grenoble, France.;Department of Nephrology, Centre Hospitalier Avignon, and Clinique Rhône Durance, Avignon, France.;Department of Nephrology, Centre Hospitalier Universitaire de Brest, INSERM U1078, Université de Brest, Brest, France.;Department of Hematology, Centre Hospitalier Sud Francilien, Corbeil-Essonnes, France.;Department of Nephrology, Hôpital Européen Georges Pompidou, Assistance Publique-Hôpitaux de Paris, Université Paris Descartes Sorbonne Paris Cité, Paris, France.;Centre de référence maladies rares \"amylose AL et autres maladies par dépôt d'immunoglobulines monoclonales,\" Centre Hospitalier Universitaire de Poitiers, Poitiers, France.;Department of Hematology, Institut de Cancérologie Lucien Neuwirth, Saint-Priest-en-Jarez, France.;Department of Hematology, Centre Hospitalier Universitaire de Lille, INSERM UMR-S1172, University of Lille, Lille, France.;Department of Hematology, Centre Hospitalier Universitaire d'Amiens, Amiens, France.;Department of Clinical Hematology, Centre Hospitalier Universitaire de Dijon, Dijon, France.;Department of Clinical Hematology, Centre Hospitalier de Vendée, La Roche sur Yon, France.;Department of Nephrology, Centre Hospitalier La Rochelle, La Rochelle, France.;Department of Hematology, Hôpital Necker, Assistance Publique-Hôpitaux de Paris, Paris, France.;Department of Nephrology, Centre Hospitalier Universitaire Pontchaillou, Rennes, France.;Department of Nephrology and Transplantation, Centre Hospitalier Universitaire de Strasbourg, Strasbourg, France.;Department of Clinical Hematology and Cellular Therapy, Centre Hospitalier Régional d'Orléans, Orléans, France.;Department of Clinical Hematology, Hôpital Pitié-Salpêtrière, Assistance Publique-Hôpitaux de Paris, Paris, France.;Department of Biostatistics and Medical Information, UMR 1153, ECSTRRA Team, Inserm, Paris Diderot University, Hôpital Saint Louis, Assistance Publique-Hôpitaux de Paris, Paris, France.;Department of Hematology and Immunology, Hôpital Saint Louis, Assistance Publique-Hôpitaux de Paris, INSERM UMR 1126, Paris, France.",
"authors": "Bridoux|Frank|F|;Arnulf|Bertrand|B|;Karlin|Lionel|L|;Blin|Nicolas|N|;Rabot|Nolwenn|N|;Macro|Margaret|M|;Audard|Vincent|V|;Belhadj|Karim|K|;Pegourie|Brigitte|B|;Gobert|Pierre|P|;Cornec Le Gall|Emilie|E|;Joly|Bertrand|B|;Karras|Alexandre|A|;Jaccard|Arnaud|A|;Augeul-Meunier|Karine|K|;Manier|Salomon|S|;Royer|Bruno|B|;Caillot|Denis|D|;Tiab|Mourad|M|;Delbes|Sébastien|S|;Suarez|Felipe|F|;Vigneau|Cécile|C|;Caillard|Sophie|S|;Arakelyan-Laboure|Nina|N|;Roos-Weil|Damien|D|;Chevret|Sylvie|S|;Fermand|Jean Paul|JP|;|||",
"chemical_list": "D000069286:Bortezomib; D003907:Dexamethasone; D003520:Cyclophosphamide",
"country": "United States",
"delete": false,
"doi": "10.1200/JCO.20.00298",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0732-183X",
"issue": "38(23)",
"journal": "Journal of clinical oncology : official journal of the American Society of Clinical Oncology",
"keywords": null,
"medline_ta": "J Clin Oncol",
"mesh_terms": "D058186:Acute Kidney Injury; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000069286:Bortezomib; D003520:Cyclophosphamide; D003907:Dexamethasone; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009101:Multiple Myeloma",
"nlm_unique_id": "8309333",
"other_id": null,
"pages": "2647-2657",
"pmc": null,
"pmid": "32574117",
"pubdate": "2020-08-10",
"publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Randomized Trial Comparing Double Versus Triple Bortezomib-Based Regimen in Patients With Multiple Myeloma and Acute Kidney Injury Due to Cast Nephropathy.",
"title_normalized": "randomized trial comparing double versus triple bortezomib based regimen in patients with multiple myeloma and acute kidney injury due to cast nephropathy"
} | [
{
"companynumb": "FR-TAKEDA-2020TUS036576",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "METHYLPREDNISOLONE"
},
"drugadditional": null,... |
{
"abstract": "A 70-year-old man presented with left loin pain without urinary symptoms. Initial investigations with CT showed enlarged para-aortic, mediastinal lymph nodes, right-side renal mass and enlarged prostate. A prostatic-specific antigen (PSA) was alarmingly high at 4750 μg/L (normal <4.0 μg/L). Further investigations included positron emission tomography (PET); both prostate-specific membrane antigen and 18-fluorodeoxyglucose as well as bone scan and bone marrow examination confirmed dual malignancies with B-cell non-Hodgkin's lymphoma (B-NHL) and wide spread metastatic prostatic adenocarcinoma (PA) to the skull, spine, pelvis, liver and lungs. The patient was treated with six cycles of rituximab, etoposide, prednisone, vincristine, cyclophosphamide and doxorubicin(R-EPOCH) containing regimen for B-NHL and goserelin hormonal therapy for PA. Restaging with PET scans thereafter showed complete remission of NHL with disappearance of his metastatic PA and normalisation of PSA levels. R-EPOCH regimen and antiandrogen therapy resulted in a good outcome and remission of both malignancies.",
"affiliations": "Faculty of Health Sciences, University of Tasmania, Launceston, Tasmania, Australia.;Haematology, Tasmanian Medical Laboratory, Launceston, Tasmania, Australia.;Haematology Department, Specialist Care Australia, Launceston, Tasmania, Australia.;Faculty of Health Sciences, University of Tasmania, Launceston, Tasmania, Australia.",
"authors": "Hanna|Fayez|F|;Prakash|Ajay|A|;Allan|Ebony|E|;Khalafallah|Alhossain A|AA|http://orcid.org/0000-0002-2399-3311",
"chemical_list": "D000069283:Rituximab; D014750:Vincristine; D005047:Etoposide; D004317:Doxorubicin; D003520:Cyclophosphamide; D017430:Prostate-Specific Antigen; D011241:Prednisone",
"country": "England",
"delete": false,
"doi": "10.1136/bcr-2017-223637",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1757-790X",
"issue": "2018()",
"journal": "BMJ case reports",
"keywords": "malignant and benign haematology; malignant disease and immunosuppression; prostate cancer",
"medline_ta": "BMJ Case Rep",
"mesh_terms": "D000230:Adenocarcinoma; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001859:Bone Neoplasms; D003520:Cyclophosphamide; D004317:Doxorubicin; D005047:Etoposide; D006801:Humans; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D009378:Neoplasms, Multiple Primary; D049268:Positron-Emission Tomography; D011241:Prednisone; D017430:Prostate-Specific Antigen; D011471:Prostatic Neoplasms; D000069283:Rituximab; D014750:Vincristine",
"nlm_unique_id": "101526291",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "29549134",
"pubdate": "2018-03-16",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "23086753;26991851;20215802;7538247;15832096;28651567;25159097;26537613;25663879;28413397;17635240;25386194;26881561;476306;14531272;27042152;28411962;16902677;21713081",
"title": "Successful treatment of concomitant metastatic prostate cancer and B-cell non-Hodgkin's lymphoma with R-EPOCH chemotherapy regimen and antiandrogen therapy.",
"title_normalized": "successful treatment of concomitant metastatic prostate cancer and b cell non hodgkin s lymphoma with r epoch chemotherapy regimen and antiandrogen therapy"
} | [
{
"companynumb": "AU-MYLANLABS-2018M1025646",
"fulfillexpeditecriteria": "1",
"occurcountry": "AU",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "DOXORUBICIN"
},
"drugadditional": "1",
... |
{
"abstract": "BACKGROUND\nHyperekplexia is a rare neurologic disorder characterized by pronounced startle responses to tactile or acoustic stimuli and increase tone. Acquired hyperekplexia is usually seen in brainstem pathologies and when it develops acutely it can be easily misdiagnosed as a convulsive seizure.\n\n\nMETHODS\nA 38-year-old man presented with acute onset generalized brief involuntary jerky movements and a decreased level of consciousness. He was initially diagnosed with convulsive status epilepticus for which he received multiple antiseizure medications without any improvement. Further investigations revealed abnormal oculocephalic reflex response and that his movements were in fact hyperkeplexia caused by brainstem infarction with basilar artery thrombus secondary to right vertebral artery dissection. Emergent thrombectomy was performed and he was eventually discharged to a rehabilitation facility. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: Emergency physicians should be aware of hyperekplexia and how to differentiate it from convulsive stats epilepticus because the pathology and the emergent treatment of these 2 serious conditions are different. An underlying acquired brainstem pathology (especially basilar artery thromboembolism) should be suspected in any patient with untypical convulsive like movements along with focal neurologic signs compatible with brain stem pathology even when computed tomography imaging is normal. © 2020 Elsevier Inc.",
"affiliations": "Department of Neurology University of Oklahoma Medical Center, Oklahoma City, Oklahoma.;Department of Neurology University of Oklahoma Medical Center, Oklahoma City, Oklahoma.;Department of Neurology University of Oklahoma Medical Center, Oklahoma City, Oklahoma.",
"authors": "Bourmaf|Mohammad|M|;Katyal|Roohi|R|;Al-Awwad|Ahmad|A|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1016/j.jemermed.2020.04.038",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0736-4679",
"issue": "59(2)",
"journal": "The Journal of emergency medicine",
"keywords": "acquired hyperekplexia; basilar artery thromboembolism; brainstem; convulsions; epilepsy; hyperekplexia; infarction; rostral brain stem infarction; startle syndromes; top of the basilar syndrome",
"medline_ta": "J Emerg Med",
"mesh_terms": "D000328:Adult; D006801:Humans; D000071017:Hyperekplexia; D008297:Male; D013216:Reflex, Startle; D012640:Seizures; D013226:Status Epilepticus; D013577:Syndrome",
"nlm_unique_id": "8412174",
"other_id": null,
"pages": "e53-e56",
"pmc": null,
"pmid": "32451184",
"pubdate": "2020-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Top of Basilar Syndrome Presenting With Hyperekplexia Initially Diagnosed as a Convulsive Status Epilepticus.",
"title_normalized": "top of basilar syndrome presenting with hyperekplexia initially diagnosed as a convulsive status epilepticus"
} | [
{
"companynumb": "US-UCBSA-2020041592",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditional": "4",
... |
{
"abstract": "BACKGROUND\nBiologic therapies with anti-tumor necrosis factor agents are promising treatments for hidradenitis suppurativa (HS).\n\n\nOBJECTIVE\nWe assessed the efficacy and safety of infliximab (IFX) for the treatment of moderate to severe HS.\n\n\nMETHODS\nA prospective double-blind treatment phase of 8 weeks where patients received IFX or placebo was followed by an open-label phase where patients taking placebo were given the opportunity to cross over to IFX, and an observational phase. Primary treatment efficacy was based on HS Severity Index. Secondary end points included Dermatology Life Quality Index, visual analog scale, and Physician Global Assessment scores. Inflammatory markers erythrocyte sedimentation rate and C-reactive protein were also assessed.\n\n\nRESULTS\nMore patients in the IFX than in the placebo group showed a 50% or greater decrease from baseline HS Severity Index score. In addition, statistically and clinically significant improvement from baseline was observed at week 8 in Dermatology Life Quality Index score, visual analog scale score, erythrocyte sedimentation rate, and C-reactive protein compared with placebo. Patients in the placebo group treated with IFX after week 8 (crossover) responded similarly to the original IFX group. Many patients withdrew during the observational phase to continue anti-tumor necrosis factor-alfa therapy. No unexpected serious adverse events were observed.\n\n\nCONCLUSIONS\nResults are representative of a single center, patients were treated by a single physician, some patients did not return after their last infusion, and the HS Severity Index requires validation.\n\n\nCONCLUSIONS\nThis clinical study represents the first formal assessment of IFX for treatment of moderate to severe HS. IFX was well tolerated, no unexpected safety issues were identified, and improvements in pain intensity, disease severity, and quality of life were demonstrated with concomitant reduction in clinical markers of inflammation.",
"affiliations": "Florida Academic Dermatology Centers, Miami, Florida 33136, USA.",
"authors": "Grant|Annika|A|;Gonzalez|Tayler|T|;Montgomery|Michael O|MO|;Cardenas|Vanessa|V|;Kerdel|Francisco A|FA|",
"chemical_list": "D000911:Antibodies, Monoclonal; D002097:C-Reactive Protein; D000069285:Infliximab",
"country": "United States",
"delete": false,
"doi": "10.1016/j.jaad.2009.06.050",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0190-9622",
"issue": "62(2)",
"journal": "Journal of the American Academy of Dermatology",
"keywords": null,
"medline_ta": "J Am Acad Dermatol",
"mesh_terms": "D000293:Adolescent; D000328:Adult; D000911:Antibodies, Monoclonal; D002097:C-Reactive Protein; D018592:Cross-Over Studies; D004311:Double-Blind Method; D005260:Female; D017497:Hidradenitis Suppurativa; D006801:Humans; D000069285:Infliximab; D008297:Male; D008875:Middle Aged; D011788:Quality of Life; D012720:Severity of Illness Index",
"nlm_unique_id": "7907132",
"other_id": null,
"pages": "205-17",
"pmc": null,
"pmid": "20115947",
"pubdate": "2010-02",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Infliximab therapy for patients with moderate to severe hidradenitis suppurativa: a randomized, double-blind, placebo-controlled crossover trial.",
"title_normalized": "infliximab therapy for patients with moderate to severe hidradenitis suppurativa a randomized double blind placebo controlled crossover trial"
} | [
{
"companynumb": "US-JNJFOC-20200615192",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "3",
"... |
{
"abstract": "Osteonecrosis has been well-documented in the past. We present an example of this complication that we recently saw in our department which on initial presentation appeared to be squamous cell carcinoma. This case is particularly important as the condition will become more and more prevalent and therefore it is imperative that GDPs in primary care are aware of it.",
"affiliations": "OMFS, Royal Blackburn Hospital, Haslingden Road, Blackburn, BB2 3HH. mpancholi@talk21.com",
"authors": "Pancholi|M|M|;Edwards|A|A|;Langton|S|S|",
"chemical_list": "D000900:Anti-Bacterial Agents; D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D002981:Clindamycin",
"country": "England",
"delete": false,
"doi": "10.1038/bdj.2007.634",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-0610",
"issue": "203(2)",
"journal": "British dental journal",
"keywords": null,
"medline_ta": "Br Dent J",
"mesh_terms": "D000900:Anti-Bacterial Agents; D050071:Bone Density Conservation Agents; D001943:Breast Neoplasms; D002294:Carcinoma, Squamous Cell; D002981:Clindamycin; D003937:Diagnosis, Differential; D004164:Diphosphonates; D005260:Female; D006801:Humans; D008439:Maxillary Diseases; D008441:Maxillary Neoplasms; D008875:Middle Aged; D010020:Osteonecrosis",
"nlm_unique_id": "7513219",
"other_id": null,
"pages": "87-9",
"pmc": null,
"pmid": "17660778",
"pubdate": "2007-07-28",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Bisphosphonate induced osteochemonecrosis of the jaw mimicking a tumour.",
"title_normalized": "bisphosphonate induced osteochemonecrosis of the jaw mimicking a tumour"
} | [
{
"companynumb": "GB-PFIZER INC-2008008107",
"fulfillexpeditecriteria": "1",
"occurcountry": "GB",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "FLUOROURACIL"
},
"drugadditional": "3",
... |
{
"abstract": "There have been important advances in the treatment of severe forms of ulcerative colitis (UC). They include biologic therapy and immunomodulators such as cyclosporine. The primary end-point of these therapies is to avoid colectomy in patients with severe disease when intravenous steroids have failed. Cyclosporine has been successful for induction of remission in severe UC, but undesirable side effects present quickly after intravenous delivery. We report two cases with severe UC that were successfully treated with oral microemulsion form of cyclosporine.",
"affiliations": "Clínica de Enfermedad Inflamatoria Intestinal, Departamento de Gastroenterología, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, México, D. F. ecossmex@hotmail.com",
"authors": "Coss-Adame|E|E|;Barahona-Garrido|J|J|;Yamamoto-Furusho|J K|JK|",
"chemical_list": "D004655:Emulsions; D005938:Glucocorticoids; D016572:Cyclosporine; D011241:Prednisone",
"country": "Mexico",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0375-0906",
"issue": "74(4)",
"journal": "Revista de gastroenterologia de Mexico",
"keywords": null,
"medline_ta": "Rev Gastroenterol Mex",
"mesh_terms": "D000284:Administration, Oral; D000328:Adult; D002908:Chronic Disease; D003093:Colitis, Ulcerative; D016572:Cyclosporine; D004655:Emulsions; D005938:Glucocorticoids; D006801:Humans; D008297:Male; D011241:Prednisone; D012720:Severity of Illness Index; D017211:Treatment Failure",
"nlm_unique_id": "0404271",
"other_id": null,
"pages": "379-82",
"pmc": null,
"pmid": "20423773",
"pubdate": "2009",
"publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article",
"references": null,
"title": "Oral cyclosporine microemulsion for the treatment of severe chronic idiopathic ulcerative colitis refractory to intravenous steroids: experience in two cases..",
"title_normalized": "oral cyclosporine microemulsion for the treatment of severe chronic idiopathic ulcerative colitis refractory to intravenous steroids experience in two cases"
} | [
{
"companynumb": "MX-WATSON-2014-15719",
"fulfillexpeditecriteria": "1",
"occurcountry": "MX",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "MESALAMINE"
},
"drugadditional": null,
"... |
{
"abstract": "BACKGROUND\nCompression of the internal carotid artery (ICA) in the cavernous sinus area is a rare event and is mostly associated with pituitary adenomas and meningiomas. Other causes of ICA compression are less well known. We present a rare case of granulomatous hypophysitis causing compression of the ICA, which was treated successfully with immune-suppressive agents.\n\n\nMETHODS\nThe electronic database MEDLINE (PubMed) was searched systematically and other cases with ICA compression were identified and analyzed.\n\n\nRESULTS\nA female patient with a history of two previous transsphenoidal operations for suspected pituitary adenoma and post-operative complete pituitary insufficiency presented with severe headaches, nausea, fatigue, and diplopia. Pituitary MRI scan suggested relapse of the pituitary lesion with atypical bilateral infiltration of cavernous sinuses and compression of ICAs. After histological reevaluation of her previous pituitary operations, granulomatous hypophysitis was diagnosed. Treatment was started with high doses of prednisolone. With decreasing doses of prednisolone, symptoms recurred, and azathioprine was started, followed by administration of rituximab resulting in clinical recovery and regression of ICA compression. Literature analysis disclosed 36 case reports with ICA compression in the cavernous sinus region (12 pituitary adenoma, 6 meningioma, 7 hypophysitis, 5 other tumors, and 4 other etiologies). Two cases of hypophysitis recovered completely; five cases improved only partly.\n\n\nCONCLUSIONS\nIn the case of ICA compression, clinical signs, onset of symptoms, radiological findings and pituitary insufficiencies should be thoroughly evaluated, and hypophysitis should be considered as a possible cause. In our patient, treatment with azathioprine and, finally, rituximab was successful.",
"affiliations": "Endocrinology in Charlottenburg, Stuttgarter Platz 1, 10627, Berlin, Germany.;Department for Neurosurgery, University Hospital Tübingen, 72076, Tübingen, Germany.;Endocrinology in Charlottenburg, Stuttgarter Platz 1, 10627, Berlin, Germany. marcusquinkler@t-online.de.",
"authors": "Gendreitzig|Pauline|P|;Honegger|Jürgen|J|;Quinkler|Marcus|M|http://orcid.org/0000-0003-4028-1671",
"chemical_list": "D000970:Antineoplastic Agents; D000069283:Rituximab; D011239:Prednisolone; D001379:Azathioprine",
"country": "United States",
"delete": false,
"doi": "10.1007/s11102-019-01005-2",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1386-341X",
"issue": "23(2)",
"journal": "Pituitary",
"keywords": "Azathioprine; Meningioma; Pituitary adenoma; Prednisolone; Rituximab",
"medline_ta": "Pituitary",
"mesh_terms": "D000818:Animals; D000970:Antineoplastic Agents; D001379:Azathioprine; D002343:Carotid Artery, Internal; D006801:Humans; D008579:Meningioma; D010911:Pituitary Neoplasms; D011239:Prednisolone; D000069283:Rituximab",
"nlm_unique_id": "9814578",
"other_id": null,
"pages": "103-112",
"pmc": null,
"pmid": "31748928",
"pubdate": "2020-04",
"publication_types": "D016428:Journal Article; D016454:Review",
"references": "25224140;14617725;28626085;2594138;19119461;2716937;11988627;22543347;22307822;28122885;21470998;16793955;18958393;21666339;26262437;6463839;2401911;1280778;24322037;15309917;25078410;11763422;19628625;29880706;7133301;24211140;22443503;15634713;26963662;26091204;27503372;27376431;8848074;21273745;22560235;29850864;903813;22795167;23990347;25948046",
"title": "Granulomatous hypophysitis causing compression of the internal carotid arteries reversible with azathioprine and rituximab treatment.",
"title_normalized": "granulomatous hypophysitis causing compression of the internal carotid arteries reversible with azathioprine and rituximab treatment"
} | [
{
"companynumb": "DE-TEVA-2020-DE-1224830",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "PREDNISOLONE"
},
"drugadditional": "3",
... |
{
"abstract": "BACKGROUND\nBleeding remains a common occurrence in surgery. Data describing the burden of difficult-to-control bleeding and topical absorbable hemostat use are sparse. This study was conducted to estimate the clinical and economic impact that remains associated with uncontrolled surgical bleeding, even when hemostats are used during surgery.\n\n\nMETHODS\nThis US retrospective analysis used the Premier Perspectives Database. Hospital discharges from 2012 were used to identify patients treated with hemostats during eight surgery types. Patients were included if they were ≥18 years, had an inpatient hospitalization with one of the eight surgeries, and received a hemostat on the day of surgery. Patients were stratified by procedure and presence or absence of major bleeding (uncontrolled) despite hemostat use. Outcomes were all-cause hospitalization costs, hemostat costs, length of stay, reoperation, and surgery-related complications (eg, mortality). Statistical significance was tested through chi-square or t-tests. Multivariate analyses were conducted for all-cause costs and length of stay using analysis of covariance.\n\n\nRESULTS\nAmong 25,048 procedures, major bleeding events occurred in 14,251 cases. Despite treatment with hemostats, major bleeding occurred in 32%-68% of cases. All-cause costs were significantly higher in patients with uncontrolled bleeding despite hemostat use versus controlled bleeding (US$24,203-$61,323 [uncontrolled], US$14,420-$45,593 [controlled]; P<0.001). Hemostat costs were significantly greater in the uncontrolled bleeding cohort for all surgery types except cystectomy and pancreatic surgery. Reoperation and mortality rates were significantly higher in the uncontrolled bleeding cohort in all surgical procedures except cystectomy and radical hysterectomy.\n\n\nCONCLUSIONS\nUncontrolled intraoperative bleeding despite hemostat use is prevalent and associated with significantly higher hospital costs and worse clinical outcomes across several surgical procedures compared to controlled bleeding. There is an unmet need for newer hemostats that can more effectively control bleeding, improve outcomes, and reduce hospital resource use.",
"affiliations": "Ethicon Biosurgery, Somerville, NJ, USA.;Cornerstone Research Group, Burlington, ON, Canada.;Cornerstone Research Group, Burlington, ON, Canada.;Partnership for Health Analytic Research, Beverly Hills, CA, USA.;Partnership for Health Analytic Research, Beverly Hills, CA, USA.",
"authors": "Corral|Mitra|M|;Ferko|Nicole|N|;Hollmann|Sarah|S|;Broder|Michael S|MS|;Chang|Eunice|E|",
"chemical_list": null,
"country": "New Zealand",
"delete": false,
"doi": "10.2147/CEOR.S86369",
"fulltext": "\n==== Front\nClinicoecon Outcomes ResClinicoecon Outcomes ResClinicoEconomics and Outcomes ResearchClinicoEconomics and Outcomes Research: CEOR1178-6981Dove Medical Press 10.2147/CEOR.S86369ceor-7-409Original ResearchHealth and economic outcomes associated with uncontrolled surgical bleeding: a retrospective analysis of the Premier Perspectives Database Corral Mitra 1Ferko Nicole 2Hollmann Sarah 2Broder Michael S 3Chang Eunice 31 Ethicon Biosurgery, Somerville, NJ, USA2 Cornerstone Research Group, Burlington, ON, Canada3 Partnership for Health Analytic Research, Beverly Hills, CA, USACorrespondence: Nicole Ferko, Cornerstone Research Group, Suite 204, 3228 South Service Road, Burlington, ON L7N3H8, Canada, Tel +1 905 637 6231 (ext 236), Fax +1 905 637 5014, Email nferko@cornerstone-research.com2015 22 7 2015 7 409 421 © 2015 Corral et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License2015The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed.Background\nBleeding remains a common occurrence in surgery. Data describing the burden of difficult-to-control bleeding and topical absorbable hemostat use are sparse. This study was conducted to estimate the clinical and economic impact that remains associated with uncontrolled surgical bleeding, even when hemostats are used during surgery.\n\nMethods\nThis US retrospective analysis used the Premier Perspectives Database. Hospital discharges from 2012 were used to identify patients treated with hemostats during eight surgery types. Patients were included if they were ≥18 years, had an inpatient hospitalization with one of the eight surgeries, and received a hemostat on the day of surgery. Patients were stratified by procedure and presence or absence of major bleeding (uncontrolled) despite hemostat use. Outcomes were all-cause hospitalization costs, hemostat costs, length of stay, reoperation, and surgery-related complications (eg, mortality). Statistical significance was tested through chi-square or t-tests. Multivariate analyses were conducted for all-cause costs and length of stay using analysis of covariance.\n\nResults\nAmong 25,048 procedures, major bleeding events occurred in 14,251 cases. Despite treatment with hemostats, major bleeding occurred in 32%–68% of cases. All-cause costs were significantly higher in patients with uncontrolled bleeding despite hemostat use versus controlled bleeding (US$24,203–$61,323 [uncontrolled], US$14,420–$45,593 [controlled]; P<0.001). Hemostat costs were significantly greater in the uncontrolled bleeding cohort for all surgery types except cystectomy and pancreatic surgery. Reoperation and mortality rates were significantly higher in the uncontrolled bleeding cohort in all surgical procedures except cystectomy and radical hysterectomy.\n\nConclusion\nUncontrolled intraoperative bleeding despite hemostat use is prevalent and associated with significantly higher hospital costs and worse clinical outcomes across several surgical procedures compared to controlled bleeding. There is an unmet need for newer hemostats that can more effectively control bleeding, improve outcomes, and reduce hospital resource use.\n\nKeywords\nhemostatcostsbleedingPremiersurgeryburden\n==== Body\nBackground\nIntraoperative and postoperative bleeding remains a common major complication of surgery.1–5 An aging population with growing comorbidities and high anticoagulant use are important factors that contribute to high surgical bleeding risks.6–8 Surgical bleeding can range from mild or moderate in intensity to severe or traumatic. There are a number of conventional surgical methods (eg, suture, ligature, compression, and cautery) and topical absorbable hemostats (TAHs) available to achieve hemostasis in mild to moderate bleeding scenarios.9–13 Hemostatic agents in particular have become a growing treatment option over the past couple of decades, and have been associated with improved surgical and clinical outcomes.14\n\nMild or moderate surgical bleeding may be straightforward to manage; however, bleeding may also be problematic or difficult to control, depending on several factors including bleeding severity, visibility and access to the bleeding source, anatomic location of the bleeding, patient coagulation status, and surgical skill.12 These types of bleeding scenarios are often referred to in the literature using several common bleeding terms including severe,1 major,5 or excessive.15 For example, diffuse bleeding from broad surface areas in patients who are coagulopathic may be particularly difficult to manage which may lead to additional procedures such as blood transfusion.9,12 Traumatic bleeding may be placed at the top of this spectrum where patients have severe bleeding from injured tissues and often traditional methods of hemostasis are ineffective, necessitating multiple units of transfused blood.16,17\n\nIn more problematic and difficult bleeding, there is often no single solution that can allow surgeons to rapidly stop bleeding.18–20 As a result, these situations often involve combinational use of hemostatic products in addition to conventional methods, which may be cumbersome, time-consuming, and costly.12,21 Furthermore, several studies describe the substantial clinical and economic burden with such bleeding.15,16,22–24 Bleeding can lengthen, interrupt, or complicate the surgery as well as increase likelihood of transfusion, reoperation, and associated complications.22,25–28 Furthermore, it has been reported that severe, excessive, or uncontrolled bleeding during surgery can increase mortality rates to 20%.1,3 It has also been estimated that uncontrollable bleeding accounts for approximately 40% of trauma-related deaths.29\n\nDespite available data describing the burden of difficult or uncontrollable bleeding, there is still a need to understand how hemostat use impacts the incidence of such bleeding, and the risk of associated complications. Currently, no studies have explicitly assessed the burden of surgical bleeding in relation to hemostat use. Consequently, this retrospective analysis of the Premier database was conducted to estimate the hospital resources and costs that remain associated with uncontrolled surgical bleeding, even when hemostatic agents are used during surgery.\n\nMethods\nStudy design and data source\nA retrospective analysis was conducted using data from the Premier Perspectives Database (PPD). Information contained within the PPD is de-identified making it fully compliant with the Health Insurance Portability and Accountability Act (HIPAA). The PPD includes data on more than 600 participating hospitals and 47 million hospital discharges in the US. Participating hospitals submit data on patient demographic and payer information as captured on the hospital billing record. Before the information is added to the database, all data go through quality assurance and validation checks. Available data include all billed items by the cost-accounting department, including medications; laboratory, diagnostic, and therapeutic services; and primary and secondary diagnoses for each patient. Further, hospital information, such as geographical location, bed size, and teaching hospital status, is also included within the PPD.\n\nPatient population\nAll hospital discharges with admission dates in 2012 were used to identify patients who were treated with hemostatic agents during select surgeries. Eight major surgeries were selected that were deemed by surgeons to be commonly associated with major bleeding and included cardiac revascularization, cardiac valve surgery, cholecystectomy, cystectomy, pancreatic, partial hepatic resection, pulmonary, and radical abdominal hysterectomy. Surgeries of interest were identified using the International Classification of Diseases, 9th Revision, Clinical Modification (ICD-9-CM) procedure codes (Table S1). Specific hemostatic agents used in surgery included mechanical, thrombin, flowable, and fibrin sealant agents (Table S2). Patients were identified for inclusion if they were admitted to a hospital in 2012, underwent an inpatient surgery of interest as the primary procedure, and received a hemostatic agent on the day of the surgery. Patients were excluded if they were less than 18 years old or had received an additional major surgical procedure on a different body system on the same day as the index procedure. For patients with multiple hospitalizations, only the first was included for analysis.\n\nMajor bleeding events\nWithin each of the eight surgery subgroups, patients were further stratified by the presence or absence of a major bleeding (ie, uncontrolled bleeding) event despite hemostat use. Major bleeding events were identified by following the ICD-9-CM diagnosis and procedure codes: hemorrhage or hematoma complicating a procedure (998.11 and 998.12); interventions to control bleeding (34.09, 39.98, 44.44, 44.49, 54.19, 39.41, 34.03, 54.12, 57.93); charges billed for use of hemovac drainage devices; charges billed for use of erythropoietin; blood product transfusions (99.00–99.09); and charges billed for cryoprecipitates, fresh frozen plasma, red blood cells, plasma, platelets, and whole blood. A detailed listing of these major bleeding events is outlined in Table S3.\n\nStudy outcomes\nThe main study outcomes included in the study were the all-cause costs incurred during hospitalization, the cost of hemostatic agents, length of stay (LOS) between surgery and discharge, intensive care unit (ICU) stay, operation time, reoperation, and potential surgery-related complications (eg, mortality, infection, transfusions, ventilator use). Total all-cause costs included room and board, surgery, professional fees, supplies, pharmacy services, and laboratory services. Reoperation was defined as procedures on the same body system as the original procedure, performed during the same hospitalization. Additionally, both infections and transfusions were defined according to specific ICD-9-CM codes, which are summarized in Tables S4 and S5, respectively. Other study measures included were patient demographics, payment source, admitting hospital characteristics, type of hemostatic agents used (eg, mechanical, active, flowable, fibrin sealant), and the all payer refined-diagnosis related groups (APR-DRGs). The APR-DRG simultaneously evaluates the interactions of multiple comorbidities, age, and primary and secondary discharge diagnoses.\n\nStatistical analyses\nAll data transformations and statistical analyses were performed using SAS® version 9.4 (SAS Institute, Cary, NC, USA). Patient demographics and hospital characteristics were evaluated for all surgical subgroups combined. Descriptive statistics (eg, means, patient counts) were stratified by the presence or absence of major (ie, uncontrolled) bleeding events. All statistical analyses on outcome measures were conducted separately for each surgical subgroup. Chi-square or t-tests were used to test for statistical significance whenever applicable; all tests were two-sided with a significance level of 0.05. Multivariate analyses were conducted to compare all-cause costs and LOS between patients with and without uncontrolled bleeding. Patient demographics and admitting hospital characteristics thought to have an impact on costs and LOS were included into the multivariate analysis, including age, race, sex, payment source, hospital geographic region, hospital location (rural vs urban), surgical admission type (elective vs emergent), teaching hospital status, and bed size. Analysis of covariance (ANCOVA) was used to adjust for these baseline characteristics.\n\nResults\nA total of 50,696 patients were identified within the Premier database that underwent a selected surgery in 2012, of which 25,155 were excluded because no hemostatic agent was used during surgery (Figure 1). Of the remaining 25,541 patients, 125 were excluded as they were younger than 18 years, and 368 were further excluded because they required additional surgery on a different body system on the same day. Thus, 25,048 patients were included in the analysis (cardiac revascularization: 12,799; cardiac valve surgery: 8,016; cholecystectomy: 1,576; cystectomy: 423; pancreatic: 464; partial hepatic: 620; pulmonary: 954; radical abdominal hysterectomy: 196).\n\nPatient demographics and admitting hospital characteristics are presented in Tables 1 and 2. There were some notable differences between controlled and uncontrolled bleeding patients. In particular, there was a larger percentage of urgent cases in the uncontrolled versus controlled bleeding group (ie, 52% vs 40%), as well as a higher proportion of extreme APR-DRG disease severity in uncontrolled versus controlled bleeding (ie, 28% vs 8.4%).\n\nAmong 25,048 procedures, 14,251 uncontrolled bleeding events were recorded. The prevalence of uncontrolled bleeding events within each surgical subgroup is presented in Figure 2. Despite the use of hemostatic agents, uncontrolled bleeding events occurred in 32%–68% of patients, depending on the type of procedure. The most common type of event was use of a blood product, which occurred in 49.0% of all patients. Within the uncontrolled bleeding cohort, 25%–71% of patients required transfusions, with 5.8%–32.8% of patients receiving platelets, and up to 3.2% receiving coagulation factors. By definition, patients in the controlled bleeding cohort did not require transfusions.\n\nMortality for each surgical subgroup, stratified by the presence of uncontrolled bleeding despite hemostat use, is presented in Figure 3. Mortality was statistically significantly higher in the uncontrolled versus controlled bleeding cohort in all surgical subgroups except cystectomy and radical hysterectomy. Mortality rates ranged from 1.2% to 7.3% for uncontrolled bleeding and 0% to 1.2% for controlled bleeding cohorts.\n\nResults pertaining to hospital resource use and costs are presented in Tables 3 and 4 for each surgical group, stratified by the presence or absence of uncontrolled bleeding despite hemostat use. All-cause costs were statistically significantly greater in patients with uncontrolled bleeding versus controlled bleeding for all surgery subgroups (uncontrolled bleeding: US$24,203–$61,323 vs controlled bleeding: US$14,420–$45,593; P<0.001). Similarly, LOS was also statistically significantly greater with uncontrolled bleeding patients for all subgroups (uncontrolled bleeding: 7.1–17 days vs controlled bleeding: 4.1–10 days; P<0.001). After adjusting for baseline differences, results for all-cause costs and LOS were consistent with unadjusted values (Table 4).\n\nThe cost of hemostatic agents was also statistically significantly greater in the uncontrolled bleeding cohort for all surgical groups, except pancreatic surgery and cystectomy (uncontrolled bleeding: US$287–$799 vs controlled bleeding: US$203–$451) (Table 3). Furthermore, ICU stay and infection were always statistically significantly greater in the uncontrolled versus controlled bleeding cohorts, across surgery subgroups. Reported infections included urinary tract infections, septicemia, fever, and pneumonia. Reoperation rates were also statistically significantly greater in uncontrolled bleeding patients, with the exception of radical abdominal hysterectomy. Ventilator use was also more common in uncontrolled bleeding in all surgery cohorts except cystectomy. Finally, operating time was typically higher in uncontrolled versus controlled bleeding cohorts by 13.3–37.6 minutes, but differences were only statistically significant for cardiac revascularization, cardiac valve surgery, pulmonary surgery, and radical hysterectomy (Table 3).\n\nDiscussion\nUsing a sample of over 25,000 patients, we found that a substantial proportion of patients have uncontrolled surgical bleeding despite current hemostat use, with rates ranging from 32% to 68% depending on the procedure. Both infection rate and mortality were statistically significantly higher for uncontrolled versus controlled bleeding cohorts for all surgery types. Resource use, including length of hospital stay, ICU stay, ventilator use, operation time, and reoperation were often higher in patients with uncontrolled bleeding. These results were consistent with adjusted all-cause costs, which were always significantly greater in uncontrolled versus controlled bleeding cohorts.\n\nSeveral studies have reported on the risk of surgical bleeding; however, reported rates span a wide range, which may be due to varying definitions of bleeding, differences in study design and geographic location, as well as variations in surgical procedures studied.1,5,15,24 For example, a recent study by Dyke et al1 reported a major (ie, moderate or severe/massive) bleeding rate of 33.8% in cardiac surgery. Classification of major bleeding in this study depended on the amount of total blood loss, transfusion units, need for surgical re-exploration, and whether there was delayed sterna closure. This rate is reportedly lower than the observed rate of 56%–68% in cardiac revascularization or valve surgery in this study. Another study by Stone et al5 reported a major bleeding rate in the US cardiac surgery patients of 52.9% where the bleeding definition encompassed decrease in hemoglobin levels, reoperation for bleeding, access site hemorrhage requiring intervention, ≥5 cm hematoma, or transfusion. Other studies reported major or excessive bleeding rates of lower than 10%; however, those studies used a more restrictive definition, which specified the number of transfusion units needed to qualify under the bleeding definition24 or the amount of postoperative bleeding drainage in cardiac surgery.15 Our study included more liberal definitions of uncontrolled bleeding as well as several additional surgery types relative to these latter studies. Also, our study included eight surgery types deemed by surgeons to be commonly associated with major bleeding. Furthermore, unlike our study which focused solely on surgeries involving hemostat use, it is unclear to what extent hemostats were used in most of these published studies reporting bleeding risk.\n\nThese current study findings are aligned with studies that have quantified resource use and costs associated with surgical bleeding. An earlier 2011 US study by Stokes et al23 reported that patients with bleeding-related complications (eg, transfusions) across different surgery types had significantly greater hospital costs and longer LOS. Our current study adds additional granularity in the types of resources comprising greater hospital costs in uncontrolled bleeding patients, such as reoperation, infection treatment, and ICU stay. Further, our study uniquely shows that these additional resources and costs are still high despite single or multiple hemostat product use. From the European perspective, Christensen et al15 demonstrated that hospital costs and resources including ICU stay, ventilator, and reoperation were significantly higher in patients with excessive postoperative bleeding compared to patients without.\n\nThe uptake of hemostats has been rapid over the last several years. A study by Wright et al14 showed that hemostat use continues to rise even for surgical procedures that are associated with very low bleeding complication and transfusion risk. Reviews of randomized trials demonstrate that hemostats can improve hemostasis and certain resource outcomes (eg, transfusions); however, benefits may vary by patient population type and hemostat product used.30–34 In surgical situations where bleeding is more difficult to control, combined use of multiple hemostats is sometimes undertaken to try to achieve hemostasis.12,21 In our study, hemostat costs have been observed to be significantly higher in patients with uncontrolled bleeding, which may be partially explained by more combination hemostat use. Despite these additional hemostat costs, uncontrolled bleeding rates and associated resource use remained high, signifying the suboptimal benefit that some currently approved hemostats may have. Limitations with such hemostats, including insufficient adhesion strength, lack of efficacy in a wet field, and inability to withstand forces of brisk hemorrhage, may explain the continued risk of uncontrolled bleeding in many surgery types.9,12,18–20\n\nTo address the prevalent problem of difficult-to-control surgical bleeding, a multifaceted approach is required. Essentially, methods to better assess appropriateness of operation technique and use of the various surgical methods for hemostasis are needed. Optimizing the use of right hemostatic technique (or product) with the right procedure can be an important goal for continuing education. Furthermore, new hemostats becoming available on the market that are targeted to problematic bleeding situations may help to alleviate this burden. The EVARREST® fibrin sealant patch is one novel bioabsorbable combination product composed of human fibrinogen and thrombin along with a flexible composite patch that provides mechanical integrity and supports clot formation.35 EVARREST® is supported by several clinical studies across challenging bleeding populations demonstrating rapid onset of action with high hemostasis efficacy.27,36 A recent economic evaluation also showed that this new fibrin sealant patch was predicted to be cost saving in problematic surgical bleeding for hospital stakeholders due to hospital resources averted, such as transfusions and bleeding retreatment, versus standard of care.37 Such results are particularly relevant in light of the findings of the current study showing significantly greater hemostat costs in uncontrolled bleeding cohorts. Several additional new hemostatic agents have also been developed that are currently undergoing clinical trials. Examples of these products include Veriset™ hemostatic patch (Covidien Inc., Mansfield, MA, USA), Fibrocaps™ (ProFibrix, Leiden, the Netherlands), and Hemopatch Sealing Hemostat (Baxter International, Deerfield, IL, USA). These products have numerous ongoing trials for the treatment of surgical bleeding across a wide range of surgery types with demonstrated effectiveness in some trials.38–41 No economic evaluations have been published to date with these products.\n\nLimitations\nThis study is not without limitations. First, it was retrospective; therefore, it was not possible to control for all potential confounding variables as can be done within a randomized controlled trial. Second, limitations of this study include those common to all claims-based studies. Specifically, the data for this study were derived from hospital discharge records designed to be used for billing rather than research. There is some degree of miscoding that is common in these records, and the records were not independently validated. Furthermore, data such as these miss clinical details that ideally would be used to further explain study results. For example, there are no disease-specific measures of severity, no clinical assessments of preoperative risk (eg, hematocrit levels), and no data on surgeon’s skill level and techniques used. This information could not be captured and could not be evaluated or controlled for, as this was a retrospective database analysis. However, the potential impact of several patient and hospital characteristics was controlled for in adjusted multivariate analyses for the all-cause hospital costs as well as length of hospital stay, with adjustment having little impact on overall conclusions. Third, data are limited to the index hospitalization, so pre-existing comorbidities are not well captured. Fourth, data were only collected on hemostat class (eg, active, fibrin sealant, mechanical), and therefore it was not possible to conduct analyses on the association between specific hemostat products and bleeding control. Such information would have been useful for assessing the extent to which multiple product use or more expensive products contributed to the significantly higher total hemostat cost per patient in the uncontrolled bleeding cohort.\n\nConclusion\nDespite the use of hemostatic agents, uncontrolled bleeding is common and is associated with significantly higher costs; longer hospitalization; and higher rates of reoperation and mortality in multiple major surgical procedures compared to controlled bleeding. There is an unmet need for newer hemostats that can improve clinical outcomes in surgery and minimize the economic burden to hospitals and payers. Future studies need to assess the clinical and economic impact of newer, highly efficacious hemostats in real-world, difficult-to-control bleeding populations.\n\nSupplementary materials\nTable S1 Selected primary surgical procedures\n\nICD-9-CM procedure code\tDescription\t\nCardiac revascularization surgery\t\n 36.03\tOpen chest coronary artery angioplasty\t\n 36.1x\tBypass anastomosis for heart revascularization\t\n 36.2\tHeart revascularization by arterial implant\t\n 36.32\tOther transmyocardial revascularization\t\n 36.39\tOther heart revascularization\t\nCardiac valve surgery\t\n 35.1x\tOpen heart valvuloplasty without replacement\t\n 35.2x\tReplacement of heart valve\t\n 35.3x\tOperations on structures adjacent to heart valves\t\n 35.99\tOther operations on valves of heart\t\nCholecystectomy\t\n 51.21\tOther partial cholecystectomy (revision of prior cholecystectomy)\t\n 51.22\tCholecystectomy (open)\t\nCystectomy\t\n 57.71\tRadical cystectomy\t\n 57.79\tOther total cystectomy\t\nPancreatic surgery\t\n 52.51\tProximal pancreatectomy\t\n 52.52\tDistal pancreatectomy\t\n 52.53\tRadical subtotal pancreatectomy\t\n 52.59\tOther partial pancreatectomy\t\n 52.6\tTotal pancreatectomy\t\n 52.7\tRadical pancreaticoduodenectomy (Whipple procedure)\t\nPartial hepatic resection\t\n 50.22\tPartial hepatectomy (wedge resection of liver)\t\n 50.3\tLobectomy of liver\t\nPulmonary surgery\t\n 32.39\tOther and unspecified segmental resection of lung\t\n 32.49\tOther lobectomy of lung\t\n 32.59\tOther and unspecified pneumonectomy\t\nRadical abdominal hysterectomy\t\n 68.69\tOther and unspecified radical abdominal hysterectomy\t\n Table S2 Hemostatic agents\n\nCategory\tProducts\t\nMechanical\tGelfoam®, Gelfoam Plus®, Surgifoam®, Avitene™ sheets, Avitene Ultrafoam™ collagen sponges, HELISTAT® & HELITENE®, INSTAT® MCH, Surgicel®, Surgicel Fibrillar™, Surgicel Nu-Knit®, Arista®AH, Hemostase MPH®, Vitasure™\t\nActive\tThrombin-JMI®, Evithrom®, Recothrom®\t\nFlowable\tFloseal®, Surgiflo®\t\nFibrin sealant\tEvicel®, Beriplast®, TachoSil®, Tisseel™, Artiss, Vitagel™, Vivostat®\t\n Table S3 Major bleeding events\n\nICD-9-CM diagnosis or procedure code\tDescription\t\nDiagnosis of bleeding\t\n 998.11\tHemorrhage complicating a procedure\t\n 998.12\tHematoma complicating a procedure\t\nProcedures to control bleeding\t\n 34.09\tOther incision of pleura, including creation of pleural window for drainage, intercostal stab, open chest drainage\t\n 39.98\tControl of hemorrhage not otherwise specified\t\n 44.44\tTranscatheter embolization for gastric or duodenal bleeding\t\n 44.49\tOther control of hemorrhage of stomach or duodenum – that with gastronomy\t\n 54.19\tOther laparotomy: drainage of intraperitoneal abscess or hematoma\t\n 39.41\tControl of hemorrhage following vascular surgery\t\n 34.03\tReopening of recent thoracotomy site\t\n 54.12\tReopening of recent laparotomy site for: control of hemorrhage, exploration, incision of hematoma\t\n 57.93\tControl of (postoperative) hemorrhage of bladder\t\n Charges billed for\tHemovac drainage devices\t\nErythropoietin\t\n Charges billed for\tEpogen, Procrit, Aranesp, Darbepoetin\t\nBlood products\t\n 99.00\tPerioperative autologous transfusion of whole blood or blood components\t\n 99.02\tTransfusion of previously collected autologous blood\t\n 99.03\tOther transfusion of whole blood\t\n 99.04\tTransfusion of packed cells\t\n 99.05\tTransfusion of platelets\t\n 99.07\tTransfusion of other serum\t\n 99.08\tTransfusion of blood expander\t\n 99.09\tTransfusion of other substance\t\nCharges billed for\tCryoprecipitates, fresh frozen plasma, red blood cells, plasma, platelets, whole blood\t\n Table S4 Infections\n\nICD-9-CM diagnosis code\tDescription\t\nPostoperative infections\t\n 998.5x\tPostoperative infection\t\n 996.6x\tInfection and inflammatory reaction due to internal prosthetic device, implant, and graft\t\nInfection due to medical care\t\n 999.3x\tOther infection: infection due to central venous catheter; infection following other infusion, injection, transfusion, or vaccination\t\nSepticemia\t\n 038.x\tSepticemia\t\n 785.52\tSeptic shock\t\n 995.91\tSepsis\t\n 995.92\tSevere sepsis\t\n 998.0\tPostoperative shock\t\nOther bacterial infections\t\n 040.0\tGas gangrene\t\n 040.8x\tOther specified bacterial diseases\t\n 041.x\tBacterial infection in conditions classified elsewhere and of unspecified site\t\n 790.7\tBacteremia\t\nSkin infections\t\n 682.x\tOther cellulitis and abscess\t\n 686.x\tOther local infections of skin and subcutaneous tissue\t\nUrinary tract infections\t\n 112.2\tCandidiasis of other urogenital sites\t\n 590.1\tAcute pyelonephritis\t\n 590.3\tPyeloureteritis cystica\t\n 590.8x\tOther pyelonephritis or pyonephrosis, not specified as acute or chronic\t\n 590.9\tInfection of kidney, unspecified\t\n 595.0\tAcute cystitis\t\n 595.3\tTrigonitis\t\n 599.0\tUrinary tract infection, site not specified\t\n 996.64\tInfection due to indwelling urinary catheter\t\nPneumonia\t\n 039.1\tPulmonary actinomycotic infections\t\n 112.4\tCandidiasis of lung\t\n 117.9\tOther and unspecified mycoses\t\n 136.3\tPneumocystosis\t\n 466.19\tAcute bronchiolitis due to other infectious organisms\t\n 480.x\tViral pneumonia\t\n 481\tPneumococcal pneumonia (Streptococcus pneumoniae pneumonia)\t\n 482.x\tOther bacterial pneumonia\t\n 483.x\tPneumonia due to other specified organism\t\n 484.x\tPneumonia in infectious diseases classified elsewhere\t\n 485\tBronchopneumonia, organism unspecified\t\n 486\tPneumonia, organism unspecified\t\n 487.0\tWith pneumonia\t\n 507.x\tPneumonitis due to solids and liquids\t\n 513.0\tAbscess of lung\t\n 516.8\tOther specified alveolar and parietoalveolar pneumonopathies\t\n 997.3x\tRespiratory complications\t\nGynecological infections\t\n 614.0\tAcute salpingitis and oophoritis\t\n 614.2\tSalpingitis and oophoritis not specified as acute, subacute, or chronic\t\n 614.3\tAcute parametritis and pelvic cellulitis\t\n 614.4\tChronic or unspecified parametritis and pelvic cellulitis\t\n 614.5\tAcute or unspecified pelvic peritonitis, female\t\n 614.6\tPelvic peritoneal adhesions, female (postoperative) (postinfection)\t\n 614.8\tOther specified inflammatory disease of female pelvic organs and tissues\t\n 614.9\tUnspecified inflammatory disease of female pelvic organs and tissues\t\n 615.0\tAcute inflammatory diseases of uterus, except cervix\t\n 615.9\tUnspecified inflammatory disease of uterus\t\n 670.0x\tMajor puerperal infection\t\n 672.0x\tPyrexia of unknown origin during the puerperium\t\nSeptic embolism\t\n 673.3x\tObstetrical pyemic and septic embolism\t\nFever\t\n 780.6x\tFever and other physiologic disturbances of temperature regulation\t\n Table S5 Transfusion coding descriptions\n\nICD-9-CM procedure or standard charge code\tDescription\t\nTransfusion of platelets\t\n 99.05\tTransfusion of platelets\t\nTransfusion of coagulation factors\t\n 99.06\tTransfusion of coagulation factors\t\nOther transfusion\t\n 99.00\tPerioperative autologous transfusion of whole blood or blood components\t\n 99.01\tAutologous whole blood transfusion\t\n 99.02\tTransfusion of previously collected autologous blood\t\n 99.03\tOther transfusion of whole blood\t\n 99.04\tTransfusion of packed cells\t\n 99.07\tTransfusion of other serum\t\n 99.08\tTransfusion of blood expander\t\n 99.09\tTransfusion of other substance\t\n V58.2\tBlood transfusion, no diagnosis\t\n 380381000010000\tRed Cells Packed 1 Unit\t\n 380381000010007\tRed Cells Packed 7 Units\t\n 380381000010008\tRed Cells Packed 8 Units\t\n 380381000010009\tRed Cells Packed 9 Units\t\n 380381000010010\tRed Cells Packed 10 Units\t\n 380381000020000\tRed Cells Packed 2 Units\t\n 380381000030000\tRed Cells Packed 3 Units\t\n 380381000040000\tRed Cells Packed 4 Units\t\n 380381000050000\tRed Cells Packed 5 Units\t\n 380381000060000\tRed Cells Packed 6 Units\t\n 380381000210000\tRed Cells Autologous 1 Unit\t\n 380381000210005\tRed Cells Autologous 5 Units\t\n 380381000210006\tRed Cells Autologous 6 Units\t\n 380381000210007\tRed Cells Autologous 7 Units\t\n 380381000210008\tRed Cells Autologous 8 Units\t\n 380381000210009\tRed Cells Autologous 9 Units\t\n 380381000210010\tRed Cells Autologous 10 Units\t\n 380381000220000\tRed Cells Autologous 2 Units\t\n 380381000230000\tRed Cells Autologous 3 Units\t\n 380381000240000\tRed Cells Autologous 4 Units\t\n 380381000310000\tRed Cells Leukocyte Poor 1 Unit\t\n 380381000310005\tRed Cells Leukocyte Poor 5 Units\t\n 380381000310006\tRed Cells Leukocyte Poor 6 Units\t\n 380381000310007\tRed Cells Leukocyte Poor 7 Units\t\n 380381000310008\tRed Cells Leukocyte Poor 8 Units\t\n 380381000310009\tRed Cells Leukocyte Poor 9 Units\t\n 380381000310010\tRed Cells Leukocyte Poor 10 Units\t\n 380381000320000\tRed Cells Leukocyte Poor 2 Units\t\n 380381000330000\tRed Cells Leukocyte Poor 3 Units\t\n 380381000340000\tRed Cells Leukocyte Poor 4 Units\t\n 380381000410000\tRed Cells Washed 1 Unit\t\n 380381000410003\tRed Cells Washed 3 Units\t\n 380381000410004\tRed Cells Washed 4 Units\t\n 380381000410005\tRed Cells Washed 5 Units\t\n 380381000410006\tRed Cells Washed 6 Units\t\n 380381000410007\tRed Cells Washed 7 Units\t\n 380381000410008\tRed Cells Washed 8 Units\t\n 380381000410009\tRed Cells Washed 9 Units\t\n 380381000410010\tRed Cells Washed 10 Units\t\n 380381000420000\tRed Cells Washed 2 Units\t\n 380381000510000\tRed Cells Deglycerolized 1 Unit\t\n 380381000510003\tRed Cells Deglycerolized 3 Units\t\n 380381000510004\tRed Cells Deglycerolized 4 Units\t\n 380381000510005\tRed Cells Deglycerolized 5 Units\t\n 380381000510006\tRed Cells Deglycerolized 6 Units\t\n 380381000510007\tRed Cells Deglycerolized 7 Units\t\n 380381000510008\tRed Cells Deglycerolized 8 Units\t\n 380381000510009\tRed Cells Deglycerolized 9 Units\t\n 380381000510010\tRed Cells Deglycerolized 10 Units\t\n 380381000520000\tRed Cells Deglycerolized 2 Units\t\n 380381000610000\tRed Cells Directed 1 Unit\t\n 380381000610002\tRed Cells Directed 2 Units\t\n 380381000610003\tRed Cells Directed 3 Units\t\n 380381000610004\tRed Cells Directed 4 Units\t\n 380381000610005\tRed Cells Directed 5 Units\t\n 380381000610006\tRed Cells Directed 6 Units\t\n 380381000610007\tRed Cells Directed 7 Units\t\n 380381000610008\tRed Cells Directed 8 Units\t\n 380381000610009\tRed Cells Directed 9 Units\t\n 380381000610010\tRed Cells Directed 10 Units\t\n 380382000010000\tWhole Blood 1 Unit\t\n 380382000010002\tWhole Blood 2 Units\t\n 380382000010003\tWhole Blood 3 Units\t\n 380382000010004\tWhole Blood 4 Units\t\n 380382000010005\tWhole Blood 5 Units\t\n 380382000010006\tWhole Blood 6 Units\t\n 380382000010007\tWhole Blood 7 Units\t\n 380382000010008\tWhole Blood 8 Units\t\n 380382000010009\tWhole Blood 9 Units\t\n 380382000010010\tWhole Blood 10 Units\t\n 380382000210000\tWhole Blood Autologous 1 Unit\t\n 380382000210005\tWhole Blood Autologous 5 Units\t\n 380382000210006\tWhole Blood Autologous 6 Units\t\n 380382000210007\tWhole Blood Autologous 7 Units\t\n 380382000210008\tWhole Blood Autologous 8 Units\t\n 380382000210009\tWhole Blood Autologous 9 Units\t\n 380382000210010\tWhole Blood Autologous 10 Units\t\n 380382000220000\tWhole Blood Autologous 2 Units\t\n 380382000230000\tWhole Blood Autologous 3 Units\t\n 380382000240000\tWhole Blood Autologous 4 Units\t\n 380382000310000\tWhole Blood Irradiated 1 Unit\t\n 380382000310002\tWhole Blood Irradiated 2 Units\t\n 380382000310003\tWhole Blood Irradiated 3 Units\t\n 380382000310004\tWhole Blood Irradiated 4 Units\t\n 380382000310005\tWhole Blood Irradiated 5 Units\t\n 380382000310006\tWhole Blood Irradiated 6 Units\t\n 380382000310007\tWhole Blood Irradiated 7 Units\t\n 380382000310008\tWhole Blood Irradiated 8 Units\t\n 380382000310009\tWhole Blood Irradiated 9 Units\t\n 380382000310010\tWhole Blood Irradiated 10 Units\t\n Acknowledgments\nCornerstone Research Group (SH, NF) received funding from Ethicon Inc., to conduct the study and prepare the manuscript. The Partnership for Health Analytic Research (PHAR) (MSB, EC) also received funding from Ethicon Inc., to conduct this study. MC is an employee of Ethicon Inc. The authors would like to acknowledge Gordon Sun for assisting in the study design and results interpretation, and Bryanna Tibensky for assisting with the drafting of the manuscript.\n\nAuthor contributions\n\nMC was involved in the study protocol design and development, data acquisition, and critical review of the manuscript. NF and SH were involved in data analysis/interpretation and development of the manuscript draft. MSB was involved in study protocol design and development, data analysis/interpretation, and critical review of the manuscript. EC was involved in study protocol design and development, data analysis/interpretation, and critical review of the manuscript. All authors have given final approval for the manuscript and agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.\n\nDisclosure\n\nThe authors report no conflicts of interest in this work.\n\nFigure 1 Patient identification flow chart.\n\nFigure 2 Percentage of patients with a major bleeding event despite hemostat use, stratified by surgery group.\n\nNotes: Major bleeding (ie, uncontrolled bleeding) events were defined as: hemorrhage or hematoma complicating a procedure; interventions to control bleeding; charges billed for use of hemovac drainage devices; charges billed for use of erythropoietin; blood product transfusions; and charges billed for cryoprecipitates, fresh frozen plasma, red blood cells, plasma, platelets, and whole blood.\n\nFigure 3 Patient mortality, stratified by surgery type and presence or absence of uncontrolled bleeding despite hemostat use.\n\nNote: *Statistically significant (P<0.001).\n\nTable 1 Baseline patient demographics and admitting hospital characteristics\n\n1.1\tBleeding not controlled despite hemostat use\n(N=14,251)\tBleeding controlled with hemostat\n(N=10,797)\tP-value\t\nAge, mean (SD)\t67 (11.9)\t63.9 (12.0)\t<0.001\t\nFemale, N (%)\t5,359 (37.6)\t3,143 (29.1)\t<0.001\t\nRace, N (%)\t\t\t<0.001\t\n White\t10,541 (74.0)\t7,983 (73.9)\t\t\n Black\t1,085 (7.6)\t702 (6.5)\t\t\n Other\t2,625 (18.4)\t2,112 (19.6)\t\t\nPayment source, N (%)\t\t\t<0.001\t\n Managed care/commercial\t3,373 (23.7)\t3,642 (33.7)\t\t\n Medicare\t8,817 (61.9)\t5,517 (51.1)\t\t\n Other\t2,061 (14.5)\t1,638 (15.2)\t\t\nAdmission type, N (%)\t\t\t<0.001\t\n Elective\t6,840 (48.0)\t6,469 (59.9)\t\t\n Urgent/emergent\t7,411 (52.0)\t4,328 (40.1)\t\t\nType of hemostatic agent, N (%)\t\t\t<0.001\t\n Active\t1,774 (12.4)\t1,604 (14.9)\t\t\n Fibrin sealant\t2,287 (16.0)\t1,401 (13.0)\t\t\n Mechanical\t5,295 (37.2)\t5,057 (46.8)\t\t\n Multiple categories*\t4,895 (34.3)\t2,735 (25.3)\t\t\n APR-DRG disease severity, N (%)\t\t\t<0.001\t\n Minor\t593 (4.2)\t1,196 (11.1)\t\t\n Moderate\t3,582 (25.1)\t4,812 (44.6)\t\t\n Major\t6,040 (42.4)\t3,884 (36.0)\t\t\n Extreme\t4,036 (28.3)\t905 (8.4)\t\t\nNote:\n\n* More than one hemostat used per patient.\n\nAbbreviations: N, number of patients; SD, standard deviation; APR-DRG, all payer refined-diagnosis related groups.\n\nTable 2 Hospital characteristics\n\n1.2\tBleeding not controlled despite hemostat use\n(N=14,251)\tBleeding controlled with haemostat\n(N=10,797)\tP-value\t\nHospital region (US), N (%)\t\t\t<0.001\t\n Northeast\t3,057 (21.5)\t1,848 (17.1)\t\t\n Midwest\t1,829 (12.8)\t2,382 (22.1)\t\t\n West\t2,177 (15.3)\t2,210 (20.5)\t\t\n South\t7,188 (50.4)\t4,357 (40.4)\t\t\nTeaching hospital, N (%)\t\t\t<0.001\t\n Yes\t8,178 (57.4)\t5,488 (50.8)\t\t\n No\t6,073 (42.6)\t5,309 (49.2)\t\t\nLocation of hospital, N (%)\t\t\t<0.001\t\n Rural\t1,176 (8.3)\t1,206 (11.2)\t\t\n Urban\t13,075 (91.7)\t9,591 (88.8)\t\t\nBed size, N (%)\t\t\t<0.001\t\n <750\t10,903 (76.5)\t9,428 (87.3)\t\t\n 750+\t3,348 (23.5)\t1,369 (12.7)\t\t\nAbbreviation: N, number of patients.\n\nTable 3 Unadjusted mean (SD) costs and resource use, stratified by surgical procedure and presence or absence of uncontrolled bleeding despite hemostat use\n\nSurgery type\tAll-cause cost, US$ (SD)\tCost of hemostatic agent, US$ (SD)\tLOS, days (SD)\tICU stay, days (SD)\tOperation time, minutes (SD)\tReoperation, N (%)\tInfection, N (%)\tVentilator use, N (%)\t\nCardiac revascularization\t\nUncontrolled\t44,327 (30,565)\t406 (531)\t7.8 (6.4)\t5.7 (6.4)\t332.3 (129.0)\t989 (13.9)\t1,818 (25.5)\t6,841 (95.9)\t\nControlled\t35,125 (17,601)\t254 (329)\t5.7 (3.4)\t3.6 (3.8)\t312.5 (143.5)\t372 (6.6)\t641 (11.3)\t5,177 (91.4)\t\nP-value\t<0.001\t<0.001\t<0.001\t<0.001\t,.0001\t<0.001\t<0.001\t<0.001\t\nCardiac valve surgery\t\n Uncontrolled\t61,323 (44,151)\t508 (692)\t10 (8.2)\t6.8 (8.8)\t376.1 (168.1)\t1,464 (27.0)\t1,613 (29.8)\t5,219 (96.3)\t\n Controlled\t45,593 (25,559)\t311 (395)\t6.8 (4.5)\t4.0 (4.6)\t342.5 (179.9)\t365 (14.1)\t350 (13.5)\t2,426 (93.4)\t\n P-value\t<0.001\t<0.001\t<0.001\t<0.001\t<0.001\t<0.001\t<0.001\t<0.001\t\nCholecystectomy\t\n Uncontrolled\t29,582 (27,167)\t287 (387)\t8.7 (8.3)\t5.6 (6.9)\t196.0 (431.8)\t104 (17.1)\t260 (42.7)\t181 (29.7)\t\n Controlled\t17,180 (13,448)\t203 (275)\t5.0 (3.5)\t3.1 (3.3)\t173.7 (129.6)\t71 (7.3)\t207 (21.4)\t79 (8.2)\t\n P-value\t<0.001\t<0.001\t<0.001\t<0.001\t0.222\t<0.001\t<0.001\t<0.001\t\nCystectomy\t\n Uncontrolled\t40,238 (62,047)\t314 (372)\t12 (12.6)\t4.4 (5.1)\t389.7 (150.2)\t36 (14.3)\t70 (27.8)\t47 (18.7)\t\n Controlled\t29,717 (18,431)\t352 (533)\t9.0 (4.9)\t3.0 (2.9)\t484.3 (1320.8)\t11 (6.4)\t26 (15.2)\t20 (11.7)\t\n P-value\t0.012\t0.424\t<0.001\t0.010\t0.358\t0.012\t0.002\t0.055\t\nPancreatic surgery\t\n Uncontrolled\t58,891 (49,789)\t457 (618)\t17 (13.2)\t7.0 (9.1)\t450.5 (155.0)\t63 (27.2)\t95 (40.9)\t96 (41.4)\t\n Controlled\t37,001 (28,276)\t368 (377)\t10 (8.4)\t3.5 (6.9)\t437.2 (168.6)\t16 (6.9)\t57 (24.6)\t31 (13.4)\t\n P-value\t<0.001\t0.063\t<0.001\t<0.001\t0.378\t<0.001\t<0.001\t<0.001\t\nPartial hepatic resection\t\n Uncontrolled\t42,819 (54,515)\t674 (899)\t9.9 (10.4)\t5.9 (8.5)\t319.2 (140.4)\t25 (10.7)\t59 (25.3)\t65 (27.9)\t\n Controlled\t21,035 (10,874)\t451 (411)\t5.5 (2.7)\t2.1 (1.9)\t294.9 (233.1)\t18 (4.7)\t46 (11.9)\t24 (6.2)\t\n P-value\t<0.001\t<0.001\t<0.001\t<0.001\t0.107\t0.004\t<0.001\t<0.001\t\nPulmonary surgery\t\n Uncontrolled\t40,211 (33,239)\t799 (1,053)\t11 (9.6)\t8.5 (11.6)\t270.8 (118.2)\t83 (27.5)\t116 (38.4)\t120 (39.7)\t\n Controlled\t24,361 (14,893)\t347 (592)\t7.1 (4.3)\t3.6 (3.7)\t249.3 (94.7)\t57 (8.7)\t106 (16.3)\t122 (18.7)\t\n P-value\t<0.001\t<0.001\t<0.001\t<0.001\t0.006\t<0.001\t<0.001\t<0.001\t\nRadical abdominal hysterectomy\t\n Uncontrolled\t24,203 (17,854)\t592 (625)\t7.1 (5.8)\t5.2 (6.4)\t280.4 (116.9)\t4 (5.8)\t26 (37.7)\t10 (14.5)\t\n Controlled\t14,420 (7,444)\t361 (515)\t4.1 (2.5)\t2.2 (2.1)\t242.8 (100.2)\t3 (2.4)\t24 (18.9)\t4 (3.1)\t\n P-value\t<0.001\t0.006\t<0.001\t<0.001\t<0.001\t0.245\t0.004\t0.007\t\nAbbreviations: Controlled, controlled bleeding despite hemostat use; uncontrolled, uncontrolled bleeding despite hemostat use; ICU, intensive care unit; LOS, length of stay; N, number of patients; SD, standard deviation.\n\nTable 4 Mean adjusted all-cause costs (95% CI) and mean adjusted hospital LOS (95% CI) for controlled versus uncontrolled bleeding in patients treated with hemostatic agents, stratified by surgical procedure\n\nSurgical category\tAdjusted all-cause cost, US$ (95% CI)\n\tAdjusted length of stay, days (95%CI)\n\t\nBleeding not controlled despite HA\tBleeding controlled with HA\tP-value\tBleeding not controlled despite HA\tBleeding controlled with HA\tP-value\t\nCardiac revascularization\t44,198 (43,610–44,785)\t35,288 (34,624–35,951)\t<0.001\t7.7 (7.5–7.8)\t5.9 (5.8–6.1)\t<0.001\t\nCardiac valve Surgery\t60,531 (59,510–61,552)\t47,245 (45,746–48,745)\t<0.001\t9.7 (9.5–9.9)\t7.2 (7.0–7.5)\t<0.001\t\nCholecystectomy\t29,101 (27,532–30,670)\t17,483 (16,248 –18,718)\t<0.001\t8.4 (7.9–8.9)\t5.2 (4.8–5.5)\t<0.001\t\nCystectomy\t41,708 (35,541–47,876)\t27,551 (19,976–35,126)\t0.006\t12.5 (11.2–13.7)\t8.8 (7.2–10.3)\t<0.001\t\nPancreatic surgery\t58,853 (53,503–64,203)\t37,039 (31,689–42,389)\t<0.001\t16.2 (14.7–17.7)\t10.8 (9.3–12.3)\t<0.001\t\nPartial hepatic resection\t43,649 (39,188–48,111)\t20,535 (17,106 –23,964)\t<0.001\t9.8 (8.9–10.7)\t5.6 (4.9–6.2)\t<0.001\t\nPulmonary surgery\t40,416 (37,886–42,946)\t24,266 (22,564–25,968)\t<0.001\t11.3 (10.5–12.0)\t7.1 (6.6–7.6)\t<0.001\t\nRadical abdominal hysterectomy\t23,266 (20,458–26,075)\t14,929 (12,891–16,967)\t<0.001\t6.8 (5.8–7.7)\t4.3 (3.6–5.0)\t<0.001\t\nNote: Values presented as mean (95% CI).\n\nAbbreviations: CI, confidence interval; LOS, length of stay; HA, hemostatic agent.\n==== Refs\nReferences\n1 Dyke C Aronson S Dietrich W Universal definition of perioperative bleeding in adult cardiac surgery J Thorac Cardiovasc Surg 2014 147 5 1458 1463.e1 24332097 \n2 Ercan M Bostanci EB Ozer I Postoperative hemorrhagic complications after elective laparoscopic cholecystectomy in patients receiving long-term anticoagulant therapy Langenbecks Arch Surg 2010 395 3 247 253 19294412 \n3 Marietta M Facchini L Pedrazzi P Busani S Torelli G Pathophysiology of bleeding in surgery Transplant Proc 2006 38 3 812 814 16647479 \n4 Shander A Financial and clinical outcomes associated with surgical bleeding complications Surgery 2007 142 4 Suppl S20 S25 18019945 \n5 Stone GW Clayton TC Mehran R Impact of major bleeding and blood transfusions after cardiac surgery: analysis from the Acute Catheterization and Urgent Intervention Triage strategY (ACUITY) trial Am Heart J 2012 163 3 522 529 22424026 \n6 Levy JH Dutton RP Hemphill JC 3rd Multidisciplinary approach to the challenge of hemostasis Anesth Analg 2010 110 2 354 364 20007735 \n7 Parekh AK Barton MB The challenge of multiple comorbidity for the US health care system JAMA 2010 303 13 1303 1304 20371790 \n8 United Nations World Population Ageing 1950–2050 Division DoEaSA-P New York United Nations Publications 2001 1 45 \n9 Boucher BA Traub O Achieving hemostasis in the surgical field Pharmacotherapy 2009 29 7 Pt 2 2S 7S 19558278 \n10 Gabay M Absorbable hemostatic agents Am J Health Syst Pharm 2006 63 13 1244 1253 16790576 \n11 Kulkarni R Alternative and topical approaches to treating the massively bleeding patient Clin Adv Hematol Ooncol 2004 2 7 428 431 \n12 Samudrala S Topical hemostatic agents in surgery: a surgeon’s perspective AORN J 2008 88 3 S2 S11 18790097 \n13 Voils S Pharmacologic interventions for the management of critical bleeding Pharmacotherapy 2007 27 9 Pt 2 69S 84S 17723110 \n14 Wright JD Ananth CV Lewin SN Patterns of use of hemostatic agents in patients undergoing major surgery J Surg Res 2014 186 1 458 466 23993203 \n15 Christensen MC Krapf S Kempel A von Heymann C Costs of excessive postoperative hemorrhage in cardiac surgery J Thorac Cardiovasc Surg 2009 138 3 687 693 19698857 \n16 Marietta M Pedrazzi P Girardis M Luppi M Massive bleeding: are we doing our best? Transfus Apher Sci 2011 45 3 287 290 22071225 \n17 Rossaint R Cerny V Coats TJ Key issues in advanced bleeding care in trauma Shock 2006 26 4 322 331 16980877 \n18 Schreiber MA Neveleff DJ Achieving hemostasis with topical hemostats: making clinically and economically appropriate decisions in the surgical and trauma settings AORN J 2011 94 5 S1 S20 22035823 \n19 Spotnitz WD Efficacy and safety of fibrin sealant for tissue adherence in facial rhytidectomy Clin Cosmet Investig Dermatol 2012 5 43 51 \n20 Spotnitz WD Burks S Hemostats, sealants, and adhesives: components of the surgical toolbox Transfusion 2008 48 7 1502 1516 18422855 \n21 Rossaint R Bouillon B Cerny V Management of bleeding following major trauma: an updated European guideline Crit Care (London, England) 2010 14 2 R52 \n22 Claridge JA Sawyer RG Schulman AM McLemore EC Young JS Blood transfusions correlate with infections in trauma patients in a dose-dependent manner Am Surg 2002 68 7 566 572 12132734 \n23 Stokes ME Ye X Shah M Impact of bleeding-related complications and/or blood product transfusions on hospital costs in inpatient surgical patients BMC Health Serv Res 2011 11 135 21627788 \n24 Lauzier F Arnold DM Rabbat C Risk factors and impact of major bleeding in critically ill patients receiving heparin thromboprophylaxis Intensive Care Med 2013 39 12 2135 2143 23942857 \n25 Bochicchio GV Napolitano L Joshi M Bochicchio K Meyer W Scalea TM Outcome analysis of blood product transfusion in trauma patients: a prospective, risk-adjusted study World J Surg 2008 32 10 2185 2189 18575931 \n26 Doussau A Perez P Puntous M Fresh-frozen plasma transfusion did not reduce 30-day mortality in patients undergoing cardiopulmonary bypass cardiac surgery with excessive bleeding: the PLASMACARD multicenter cohort study Transfusion 2014 54 4 1114 1124 24117772 \n27 Fischer CP Bochicchio G Shen J Patel B Batiller J Hart JC A prospective, randomized, controlled trial of the efficacy and safety of fibrin pad as an adjunct to control soft tissue bleeding during abdominal, retroperitoneal, pelvic, and thoracic surgery J Am Coll Surg 2013 217 3 385 393 23969113 \n28 Saif R Jacob M Robinson S Use of fibrin-based sealants and gelatin-matrix hemostats in laparoscopic liver surgery Surg Laparosc Endosc Percutan Tech 2011 21 3 131 141 21654294 \n29 Spahn DR Rossaint R Coagulopathy and blood component transfusion in trauma BrJ Anaesth 2005 95 2 130 139 15964891 \n30 Aubourg R Putzolu J Bouche S Surgical hemostatic agents: assessment of drugs and medical devices J Visc Surg 2011 148 6 e405 e408 22136914 \n31 Carless PA Henry DA Anthony DM Fibrin sealant use for minimising peri-operative allogeneic blood transfusion Cochrane Database Syst Rev 2003 2 CD004171 12804501 \n32 Rousou JA Use of fibrin sealants in cardiovascular surgery: a systematic review J Card Surg 2013 28 3 238 247 23578196 \n33 Sanjay P Watt DG Wigmore SJ Systematic review and meta-analysis of haemostatic and biliostatic efficacy of fibrin sealants in elective liver surgery J Gastrointest Surg 2013 17 4 829 836 23086450 \n34 Wang H Shan L Zeng H Sun M Hua Y Cai Z Is fibrin sealant effective and safe in total knee arthroplasty? A meta-analysis of randomized trials J Orthop Surg Res 2014 16 9 36 24884626 \n35 Hunt BJ Bleeding and coagulopathies in critical care N Engl J Med 2014 370 9 847 859 24571757 \n36 Koea JB Batiller J Patel B A phase III, randomized, controlled, superiority trial evaluating the fibrin pad versus standard of care in controlling parenchymal bleeding during elective hepatic surgery HPB (Oxford) 2013 15 1 61 70 23216780 \n37 Corral MFN Hollmann S Cost analysis of a fibrin sealant patch for mild, moderate, and problematic soft tissue surgical bleeding: a hospital perspective Value in Health 2013 A380.PSY315 \n38 Ollinger R Mihaljevic AL Schuhmacher C A multicentre, randomized clinical trial comparing the Veriset haemostatic patch with fibrin sealant for the management of bleeding during hepatic surgery HPB (Oxford) 2013 15 7 548 558 23458162 \n39 Verhoef C Singla N Moneta G Fibrocaps for surgical hemostasis: two randomized, controlled phase II trials J Surg Res Epub 12 10 2014 \n40 Bochicchio GV Gupta N Porte RJ The FINISH-3 trial: a phase 3, international, randomized, single-blind, controlled trial of topical fibrocaps in intraoperative surgical hemostasis J Am Coll Surg 2015 220 1 70 81 25458801 \n41 Fingerhut A Uranues S Ettorre GM European Initial Hands-On Experience with HEMOPATCH, a Novel Sealing Hemostatic Patch: Application in General, Gastrointestinal, Biliopancreatic, Cardiac, and Urologic Surgery Surg Technol Int 2014 25 29 35 25433173\n\n",
"fulltext_license": "CC BY-NC",
"issn_linking": "1178-6981",
"issue": "7()",
"journal": "ClinicoEconomics and outcomes research : CEOR",
"keywords": "Premier; bleeding; burden; costs; hemostat; surgery",
"medline_ta": "Clinicoecon Outcomes Res",
"mesh_terms": null,
"nlm_unique_id": "101560564",
"other_id": null,
"pages": "409-21",
"pmc": null,
"pmid": "26229495",
"pubdate": "2015",
"publication_types": "D016428:Journal Article",
"references": "21654294;23086450;17723110;22035823;22071225;22424026;19294412;18790097;23578196;22791995;21627788;24117772;24884626;23216780;25458801;16980877;24332097;24571757;12804501;20371790;16647479;23969113;23458162;15964891;23993203;18422855;23942857;25586331;18019945;19558278;12132734;20007735;20370902;19698857;16790576;16163216;18575931;25433173;22136914",
"title": "Health and economic outcomes associated with uncontrolled surgical bleeding: a retrospective analysis of the Premier Perspectives Database.",
"title_normalized": "health and economic outcomes associated with uncontrolled surgical bleeding a retrospective analysis of the premier perspectives database"
} | [
{
"companynumb": "US-JNJFOC-20150912194",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "UNSPECIFIED INGREDIENT"
},
"drugadditional": nul... |
{
"abstract": "OBJECTIVE\nTo evaluate the efficacy and safety of infliximab in the treatment of Crohn's disease in children.\n\n\nMETHODS\nThirteen children who were diagnosed with Crohn's disease and received routine comprehensive treatment and infliximab (5 mg/kg) between January 2011 and December 2014 were enrolled. The changes in their clinical manifestations, laboratory indices, and Pediatric Crohn's Disease Activity Index (PCDAI) after the 30-week treatment were analyzed retrospectively. Meanwhile, endoscopy was performed to evaluate therapeutic effects.\n\n\nRESULTS\nThe symptoms such as abdominal pain, diarrhea, and bloody stool were relieved soon after infliximab treatment, with no recurrence observed; after the 30-week treatment, the white blood cell count, erythrocyte sedimentation rate, C-reactive protein, and the PCDAI decreased, while the hemoglobin increased significantly compared with those before treatment (P<0.05). After infliximab treatment, two children underwent endoscopy. The endoscopy showed that one child was cured, and the other child failed to respond to the treatment. No adverse drug reactions were seen in all patients.\n\n\nCONCLUSIONS\nInfliximab treatment has significant clinical effects in children with Crohn's disease, with no obvious adverse reactions, and therefore, it can be applied as one of the preferred alternatives for treatment of Crohn's disease in children.",
"affiliations": "Department of Pediatric Gastroenterology, Shengjing Hospital of China Medical University, Shenyang 110004, China. sunm@sj-hospital.org.",
"authors": "Teng|Xu|X|;Xu|Ling-Fen|LF|;Sun|Mei|M|;Guo|Jing|J|",
"chemical_list": "D000069285:Infliximab",
"country": "China",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1008-8830",
"issue": "17(10)",
"journal": "Zhongguo dang dai er ke za zhi = Chinese journal of contemporary pediatrics",
"keywords": null,
"medline_ta": "Zhongguo Dang Dai Er Ke Za Zhi",
"mesh_terms": "D000293:Adolescent; D002648:Child; D002675:Child, Preschool; D003424:Crohn Disease; D005260:Female; D006801:Humans; D000069285:Infliximab; D008297:Male",
"nlm_unique_id": "100909956",
"other_id": null,
"pages": "1088-92",
"pmc": null,
"pmid": "26483230",
"pubdate": "2015-10",
"publication_types": "D004740:English Abstract; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": null,
"title": "Efficacy of infliximab in the treatment of Crohn's disease in children.",
"title_normalized": "efficacy of infliximab in the treatment of crohn s disease in children"
} | [
{
"companynumb": "CN-JNJFOC-20151022841",
"fulfillexpeditecriteria": "1",
"occurcountry": "CN",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": null,
... |
{
"abstract": "Hidradenitis suppurativa (HS) is a chronic inflammatory disease characterised by pain, inflamed nodules, abscess, sinus tract, and fistula. HS is more common in patients with axial spondyloarthritis and Familial Mediterranean Fever (FMF) compared to the normal population. Mediterranean fever gene mutations are thought to be responsible for the relationship between these three diseases. Case reports of secukinumab treatment in HS have been reported. In this article, a case of successful treatment of HS with secukinumab in a patient with ankylosing spondylitis and FMF is presented.",
"affiliations": "Rheumatology, Ordu State Hospital, Ordu, Turkey.;Dermatology and Venereology, Ordu State Hospital, Ordu, Turkey.",
"authors": "Unal Enginar|Ayse|A|0000-0003-0273-6268;Gundogdu|Mustafa|M|",
"chemical_list": null,
"country": "England",
"delete": false,
"doi": "10.1093/mrcr/rxab008",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "2472-5625",
"issue": null,
"journal": "Modern rheumatology case reports",
"keywords": "Familial Mediterranean Fever; Hidradenitis suppurativa; MEFV mutation; ankylosing spondylitis; secukinumab",
"medline_ta": "Mod Rheumatol Case Rep",
"mesh_terms": null,
"nlm_unique_id": "101761026",
"other_id": null,
"pages": null,
"pmc": null,
"pmid": "34508267",
"pubdate": "2021-09-10",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Successful treatment of hidradenitis suppurativa with secukinumab in a patient with ankylosing spondylitis and Familial Mediterranean Fever.",
"title_normalized": "successful treatment of hidradenitis suppurativa with secukinumab in a patient with ankylosing spondylitis and familial mediterranean fever"
} | [
{
"companynumb": "TR-PFIZER INC-202200186075",
"fulfillexpeditecriteria": "2",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "ETANERCEPT"
},
"drugadditional": "1",
... |
{
"abstract": "To evaluate ocular disease characteristics and successful therapeutic regimens in patients with scleritis associated with relapsing polychondritis (RP). To compare these features with those seen in patients with scleritis associated with other systemic immune-mediated diseases (SIMD).\n\n\n\nElectronic health records of 13 scleritis patients associated with RP were analysed and compared with those of 113 scleritis patients associated with other SIMD seen at two tertiary referral centres.\n\n\n\nScleritis in patients with RP was often bilateral (92.3%), diffuse (76.9%), recurrent (84.6%), sometimes with decreased vision (46.2%), anterior uveitis (38.5%), peripheral keratitis (15.4%) and ocular hypertension (30.8%). Patients with scleritis associated with RP more often had bilateral scleritis (p=0.001), necrotising scleritis (23.1%; p=0.02), recurrences (p=0.001) and decreased vision (three of the six with legal blindness; p=0.012), as compared with patients who had scleritis associated with other SIMD. Nine patients (69.2%) had one or more SIMD other than RP, including systemic vasculitis (4) or other autoimmune disease (8); they antedated RP by 9 years (range 2-21 years). Successful therapy included cyclophosphamide (5), methotrexate (3), azathioprine (3), mycophenolate mofetil (2), infliximab (2) and adalimumab (1).\n\n\n\nScleritis may be the first manifestation whose study leads to the diagnosis of RP. Scleritis associated with RP is more often bilateral, necrotising, recurrent and associated with decrease of vision than scleritis associated with other SIMD. About 69.2% of patients will have an additional SIMD disorder. Scleritis associated with RP most often will require immunomodulatory therapy. Occasionally, scleritis with RP may appear while using antitumor necrosis factor α agents.",
"affiliations": "Institute Clinic of Ophthalmology, Hospital Clinic of Barcelona, Barcelona, Spain.;Institute Clinic of Ophthalmology, Hospital Clinic of Barcelona, Barcelona, Spain.;Massachusetts Eye Research and Surgery Institution (MERSI), Cambridge, MA, USA Ocular Immunology and Uveitis Foundation, Cambridge, Massachusetts, USA.;BayView Clinic, Mumbai, India.;Tauber Eye Center, Kansas City, Missouri, USA.;Massachusetts Eye Research and Surgery Institution (MERSI), Cambridge, MA, USA Ocular Immunology and Uveitis Foundation, Cambridge, Massachusetts, USA Harvard Medical School, Boston, Massachusetts, USA.",
"authors": "Sainz-de-la-Maza|Maite|M|;Molina|Nicolas|N|;Gonzalez-Gonzalez|Luis Alonso|LA|;Doctor|Priyanka P|PP|;Tauber|Joseph|J|;Foster|C Stephen|CS|",
"chemical_list": "D007155:Immunologic Factors",
"country": "England",
"delete": false,
"doi": "10.1136/bjophthalmol-2015-306902",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0007-1161",
"issue": "100(9)",
"journal": "The British journal of ophthalmology",
"keywords": "Anterior chamber; Diagnostic tests/Investigation; Immunology; Inflammation; Sclera and Episclera",
"medline_ta": "Br J Ophthalmol",
"mesh_terms": "D000328:Adult; D000368:Aged; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007155:Immunologic Factors; D008297:Male; D008875:Middle Aged; D011081:Polychondritis, Relapsing; D012008:Recurrence; D012189:Retrospective Studies; D015423:Scleritis; D055815:Young Adult",
"nlm_unique_id": "0421041",
"other_id": null,
"pages": "1290-4",
"pmc": null,
"pmid": "26888976",
"pubdate": "2016-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Scleritis associated with relapsing polychondritis.",
"title_normalized": "scleritis associated with relapsing polychondritis"
} | [
{
"companynumb": "US-JNJFOC-20181004099",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "INFLIXIMAB"
},
"drugadditional": "2",
"... |
{
"abstract": "Hepatic arterial infusion (HAI) of chemotherapy can be performed in cases of liver-confined metastatic disease, resulting in increased local drug concentrations. Here we report the case of a 61-year-old man who presented with an isolated large unresectable liver metastasis of colon cancer after failure of surgery and multiple administration of systemic chemotherapy. The patient was treated with a combination of gemcitabine and oxaliplatin using HAI. The tolerance was excellent and a radiological complete response was obtained after 8 cycles of HAI. The rationale for the use of gemcitabine and oxaliplatin as well as that for the combination of the 2 drugs is discussed in this paper. HAI of gemcitabine-oxaliplatin should be evaluated in further clinical trials.",
"affiliations": "Department of Radiology, INSERM U866, University of Burgundy, University Hospital, Dijon, BP 87900 F-21079, France. boris.guiu@chu-dijon.fr",
"authors": "Guiu|Boris|B|;Vincent|Julie|J|;Guiu|Séverine|S|;Ladoire|Sylvain|S|;Ortega-Deballon|Pablo|P|;Cercueil|Jean-Pierre|JP|;Chauffert|Bruno|B|;Ghiringhelli|François|F|",
"chemical_list": "D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D003841:Deoxycytidine; C056507:gemcitabine",
"country": "United States",
"delete": false,
"doi": "10.3748/wjg.v16.i9.1150",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1007-9327",
"issue": "16(9)",
"journal": "World journal of gastroenterology",
"keywords": null,
"medline_ta": "World J Gastroenterol",
"mesh_terms": "D000230:Adenocarcinoma; D000971:Antineoplastic Combined Chemotherapy Protocols; D017115:Catheter Ablation; D003110:Colonic Neoplasms; D003841:Deoxycytidine; D006499:Hepatic Artery; D006801:Humans; D007261:Infusions, Intra-Arterial; D008113:Liver Neoplasms; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D009944:Organoplatinum Compounds; D000077150:Oxaliplatin; D014057:Tomography, X-Ray Computed; D016896:Treatment Outcome",
"nlm_unique_id": "100883448",
"other_id": null,
"pages": "1150-4",
"pmc": null,
"pmid": "20205288",
"pubdate": "2010-03-07",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "10944126;18065736;11432616;12628850;14981990;15205611;15274406;8626887;8893876;9541691;10412945;13197542;13879776;16009952;16858591;17219143;17896145;19556122;11034810",
"title": "Hepatic arterial infusion of gemcitabine-oxaliplatin in a large metastasis from colon cancer.",
"title_normalized": "hepatic arterial infusion of gemcitabine oxaliplatin in a large metastasis from colon cancer"
} | [
{
"companynumb": "FR-MYLANLABS-2021M1018958",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "4",
"activesubstance": {
"activesubstancename": "OXALIPLATIN"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nOver 50% of colorectal cancer (CRC) patients develop metastases. The aim of this study was to evaluate efficacy and tolerance of first-line FOLFIRI® + bevacizumab (B) treatment for metastatic CRC, and to assess genetic polymorphisms as potential markers.\n\n\nMETHODS\nAdult patients with histologically-proven, non-resectable metastatic CRC and ECOG ≤ 2 were included. 14-day cycles consisted of bevacizumab (5 mg/kg), irinotecan (180 mg/m2), bolus FU (400 mg/m2) and leucovorin (400 mg/m2), followed by 46-hour FU infusions (2400 mg/m2). Primary endpoint was response rate according to RECIST criteria. Secondary endpoints were overall (OS) and progression-free (PFS) survivals, response duration, and toxicity. Associations between clinical data, UGT1A1, thymidylate synthase, VEGFA polymorphisms and PFS, OS and toxicity were analyzed.\n\n\nRESULTS\nSixty-two patients were enrolled (median age 68y). 59/62 patients were eligible and evaluable for response at 6 months: 28 showed partial response (47.5%; 95% CI; 34.3-60.9), 20 stable disease (33.9%) and 11 progression (18.6%). Grade 3/4 toxicities were as follows: neutropenia 16.1%; diarrhea 11.3%; nausea-vomiting 1.6%. Median response duration was 9.5 months (range 2.7-20); median PFS 10.3 months (range 8.8-11.7); and median OS 25.7 months (range 20.2-29.7). 11/59 initially unresectable patients were resectable after treatment. VEGFA polymorphism (rs25648) was associated with better OS (HR: 3.61; 95% CI: 1.57-8.30).\n\n\nCONCLUSIONS\nFOLFIRI® + bevacizumab is active with good response rate, long median OS, and a good safety profile. A VEGFA polymorphism might have a prognostic value in this malignancy.\n\n\nBACKGROUND\nClinicaltrials.gov: NCT00467142 (registration date: April 25, 2007).",
"affiliations": "Department of Digestive Oncology, Institut Bergonié, Comprehensive Cancer Centre, 229 cours de l'Argonne, F-33000 Bordeaux, France. y.becouarn@bordeaux.unicancer.fr.",
"authors": "Bécouarn|Yves|Y|;Cany|Laurent|L|;Pulido|Marina|M|;Beyssac|Richard|R|;Texereau|Patrick|P|;Le Morvan|Valérie|V|;Béchade|Dominique|D|;Brunet|René|R|;Aitouferoukh|Sofiane|S|;Lalet|Caroline|C|;Mathoulin-Pélissier|Simone|S|;Fonck|Marianne|M|;Robert|Jacques|J|",
"chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000068258:Bevacizumab; D002955:Leucovorin; D005472:Fluorouracil; D002166:Camptothecin",
"country": "England",
"delete": false,
"doi": "10.1186/1756-0500-7-260",
"fulltext": "\n==== Front\nBMC Res NotesBMC Res NotesBMC Research Notes1756-0500BioMed Central 1756-0500-7-2602475852710.1186/1756-0500-7-260Research ArticleFOLFIRI® and Bevacizumab in first-line treatment for colorectal cancer patients: safety, efficacy and genetic polymorphisms Bécouarn Yves 1y.becouarn@bordeaux.unicancer.frCany Laurent 2l.cany@oncoradio24.comPulido Marina 34M.Pulido@bordeaux.unicancer.frBeyssac Richard 5r.beyssac@mspb.comTexereau Patrick 6patrick.texereau@ch-mt-marsan.frLe Morvan Valérie 7V.LeMorvan@bordeaux.unicancer.frBéchade Dominique 1D.Bechade@bordeaux.unicancer.frBrunet René 1R.Brunet@bordeaux.unicancer.frAitouferoukh Sofiane 7aitouferoukh@bordeaux.unicancer.frLalet Caroline 3C.Lalet@bordeaux.unicancer.frMathoulin-Pélissier Simone 38S.Mathoulin@bordeaux.unicancer.frFonck Marianne 1M.Fonck@bordeaux.unicancer.frRobert Jacques 78j.robert@bordeaux.unicancer.fr1 Department of Digestive Oncology, Institut Bergonié, Comprehensive Cancer Centre, 229 cours de l’Argonne, F-33000 Bordeaux, France2 Polyclinique Francheville, Périgueux, France3 Clinical and Epidemiological Research Unit, Institut Bergonié, Comprehensive Cancer Centre, 229 cours de l’Argonne, F-33000 Bordeaux, France4 CIC-EC7 (Clinical Investigation Centre – Clinical Epidemiology), Bordeaux, France5 Maison de Santé Protestante Bagatelle, Talence, France6 Centre Hospitalier Layné, Mont de Marsan, France7 INSERM U916, Institut Bergonié, Comprehensive Cancer Centre, 229 cours de l’Argonne, F-33000 Bordeaux, France8 Univ. Bordeaux, F-33000 Bordeaux, France2014 23 4 2014 7 260 260 26 3 2014 3 4 2014 Copyright © 2014 Bécouarn et al.; licensee BioMed Central Ltd.2014Bécouarn et al.; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Background\nOver 50% of colorectal cancer (CRC) patients develop metastases. The aim of this study was to evaluate efficacy and tolerance of first-line FOLFIRI® + bevacizumab (B) treatment for metastatic CRC, and to assess genetic polymorphisms as potential markers.\n\nMethods\nAdult patients with histologically-proven, non-resectable metastatic CRC and ECOG ≤ 2 were included. 14-day cycles consisted of bevacizumab (5 mg/kg), irinotecan (180 mg/m2), bolus FU (400 mg/m2) and leucovorin (400 mg/m2), followed by 46-hour FU infusions (2400 mg/m2). Primary endpoint was response rate according to RECIST criteria. Secondary endpoints were overall (OS) and progression-free (PFS) survivals, response duration, and toxicity. Associations between clinical data, UGT1A1, thymidylate synthase, VEGFA polymorphisms and PFS, OS and toxicity were analyzed.\n\nResults\nSixty-two patients were enrolled (median age 68y). 59/62 patients were eligible and evaluable for response at 6 months: 28 showed partial response (47.5%; 95% CI; 34.3-60.9), 20 stable disease (33.9%) and 11 progression (18.6%). Grade 3/4 toxicities were as follows: neutropenia 16.1%; diarrhea 11.3%; nausea-vomiting 1.6%. Median response duration was 9.5 months (range 2.7-20); median PFS 10.3 months (range 8.8-11.7); and median OS 25.7 months (range 20.2-29.7). 11/59 initially unresectable patients were resectable after treatment. VEGFA polymorphism (rs25648) was associated with better OS (HR: 3.61; 95% CI: 1.57-8.30).\n\nConclusions\nFOLFIRI® + bevacizumab is active with good response rate, long median OS, and a good safety profile. A VEGFA polymorphism might have a prognostic value in this malignancy.\n\nTrial registration\nClinicaltrials.gov: NCT00467142 (registration date: April 25, 2007)\n\nBevacizumabChemotherapyClinical trial, phase IIColorectal neoplasmsFOLFIRI® protocol\n==== Body\nBackground\nColorectal cancer (CRC) is a major public health problem. Its incidence in France is increasing [1] with approximately 40 000 new cases per year [2] and prognosis remains poor [3]. Over 50% of patients will develop metastases and will be candidates for palliative chemotherapy [4]. Bevacizumab is a monoclonal antibody directed against the vascular endothelial growth factor (VEGF). It has proven efficacy in the treatment of metastatic CRC when combined with chemotherapy [5-7]. Irinotecan, infusional 5-fluorouracil (FU), leucovorin (LV) (FOLFIRI®) and bevacizumab (FOLFIRI® + B) offered better outcomes when compared to irinotecan plus infusional fluorouracil (FU)/leucovorin (LV) (FOLFIRI®), irinotecan plus bolus FU/LV (mIFL), and irinotecan plus oral capecitabine (CapeIRI) in a randomized trial [5]. However, a relatively high rate of ≥ Grade 3 hypertension was observed.\n\nSeveral gene polymorphisms may interfere with anticancer drug activity, and thus affect drug efficacy and toxicity. For FU, a thymidylate synthase promoter 28-bp tandem repeat (rs34743033) is associated with lower efficacy and increased toxicity [8]. For irinotecan, a UGT1A1 promoter TA repeat (rs8175347) is a risk factor for toxicity [9]. For Bevacizumab, several VEGFA single nucleotide polymorphisms (SNP) are known to influence VEGFA plasma concentrations [10] and to be associated with CRC risk [11]. In addition, prognostic [12,13] and predictive [14,15] roles of VEGFA variants have been identified in various studies.\n\nThe principal objective of this phase II trial was to evaluate efficacy of first-line treatment with FOLFIRI® + B for metastatic CRC patients in terms of response rates. Secondary objectives were to assess overall and progression-free (PFS) survivals, response duration, and toxicity. We also explored common gene polymorphisms known to interfere with the metabolism and/or activity of FOLFIRI® + B, located respectively in the thymidylate synthase (TYMS), UDP-glucuronosyltransferase 1A1 (UGT1A1) and VEGFA genes, looking for associations between these polymorphisms and the clinical parameters of toxicity and efficacy of the treatment.\n\nMethods\nPatients for this open-label, single arm, phase II trial were recruited from Institut Bergonié, the University Hospital of Bordeaux, and five general hospitals and private clinics in South-West France.\n\nInclusion criteria were: histopathologically-proven adenocarcinoma of the colon or rectum, non-resectable metastatic disease; no prior chemotherapy other than adjuvant chemotherapy (provided it had been discontinued > 6 months before study entry); Eastern Cooperative Oncology Group (ECOG) performance status ≤ 2; age ≥ 18 years; measurable metastatic disease per Response Evaluation Criteria in Solid Tumors (RECIST Version 3.0) [16]; adequate hematological function [hemoglobin ≥10 g/dl, absolute neutrophils count ≥1.5 × 109/l, platelets ≥100 × 109/l]; adequate renal function [no proteinuria and creatinine ≤1.25 × the upper limit of the normal value (ULN)]; adequate hepatic functions [total bilirubin ≤1.25 × ULN, aspartate amino-transferase (AST) and alanine aminotransferase (ALT) ≤3 × ULN, in case of liver metastases, total bilirubin ≤1.5 × ULN and AST and ALT ≤5 × ULN]; intervals since inclusion of 4 weeks for eventual surgery or radiotherapy; ability to comply with scheduled follow-up and management of toxicity.\n\nExclusion criteria included: histology other than adenocarcinoma; non-measurable disease; adjuvant chemotherapy within 6 months or containing Bevacizumab; unresolved bowel or partial bowel obstruction; history of chronic diarrhea; severe gastrointestinal toxicity while receiving FU; current uncontrolled infection; serious illness or medical condition; previous abdominopelvic radiation therapy; known Gilbert’s syndrome; arterial thromboembolism accident or myocardial infarction within preceding 6 months; history of cancer other than colorectal, except for curatively treated non-melanoma skin cancer or in-situ cervical cancer; concomitant treatment with any other investigational drug; and pregnancy.\n\nThe protocol was approved by the regional Ethics Review Committee (Comité de Protection des Personnes du Sud-Ouest et d’Outre-Mer) and registered with clinicaltrials.gov (NCT00467142, registration date April 25, 2007). Each patient provided written informed consent. For the complementary pharmacogenetic study, patients were enrolled on a voluntary basis and gave specific consent.\n\nTreatment\nFOLFIRI® + B treatment consisted of a 90-min I.V. infusion of bevacizumab (5 mg/kg) followed by a 90-min I.V. infusion of irinotecan (180 mg/m2) followed by a simplified LV5FU2 regimen [leucovorin (400 mg/m2) and bolus fluorouracil (400 mg/m2) on day 1 and a 46-h infusion of fluorouracil (2400 mg/m2)]. Treatment was delivered biweekly.\n\nFOLFIRI® doses were adjusted in the event of toxic effects (National Cancer Institute Common Terminology Criteria for Adverse Events, NCI–CTCAE, version 3.0 [17], according to the following guidelines. Hematological toxicity was evaluated during each cycle. In the event of myelosuppression (i.e. absolute neutrophils count <1.5 × 109/l and/or platelets <75 × 109/l) at the planned date for the next cycle of chemotherapy, treatment was postponed for 1 to 3 weeks until recovery. After a 4-week delay with no recovery, the patient left the study. In the event of recovery, the FU bolus at day 1 was deleted if the toxicity was related to the neutrophils count. The continuous FU infusion at day 1 and 2 was reduced by 25% if the toxicity was related to the platelet count. The same dose reductions were implemented in the event of grade 4 neutropenia or thrombocytopenia, or grade 3 neutropenia associated with fever. After two dose reductions, patients left the study. In the event of grade 3 or 4 diarrhea, the irinotecan dose was reduced to 150 mg/m2 and the FU bolus was deleted at day 1. In the event of a second episode of severe diarrhea, the continuous FU infusion was reduced by 25%. In the event of grade 3 or 4 mucositis or hand-foot syndrome, a 25% dose reduction of FU bolus and FU continuous infusion was carried out.\n\nBevacizumab dose was not reduced. For severe drug-induced toxicities, treatment was stopped, either temporarily or indefinitely. In the case of gastrointestinal perforation, grade 3 or 4 hemorrhage, thromboembolic accidents, severe hypertension or grade 4 proteinuria, bevacizumab was stopped indefinitely.\n\nAssessment methods\nPre-inclusion work-up included an initial radiologic assessment within the 3 weeks before treatment onset, and clinical and biological evaluations conducted in the week before inclusion. The first administration occurred within 8 days of inclusion. During treatment, clinical and biological assessments were conducted on day 1 of each 14-day cycle. Radiologic assessment was carried out every four cycles (8 weeks) with centralized external secondary review. Treatment toxicity was evaluated before each cycle (NCI–CTCAE v3). Treatment was discontinued in the event of disease progression, unacceptable toxicity or patient refusal. Patients were followed-up every 3 months after treatment discontinuation.\n\nGenotyping\nDNA was extracted from blood samplings obtained after patient inclusion and collection of informed consent. We used the kit QIAamp® DNA purchased from Qiagen according to the instructions of the manufacturer. Genotyping of DNA extracts was performed using a customized platform, SNPChip484, enabling simultaneous determination of 384 selected SNP from a DNA extract. It consists of a collection of kits containing the primers specific for each SNP, prepared upon demand by Illumina and used according to the BeadXpress Goldengate-Veracode technology. Rough genotyping results were treated and analyzed using the Genome Studio software from Illumina, which enables the individual determination for each DNA sample of the genotype of all 384 SNPs. Although we genotyped 384 different SNPs, we analyzed only the results concerning the three VEGFA polymorphisms that were scheduled in the protocol: rs699947 (-2578C > A), rs2010963 (-634G > C), rs25648 (S178S, formerly known as -7C > T) in order to avoid statistical problems associated with multiple testing.\n\nGenotyping of UGT1A1 and TYMS\nThe variations in the TYMS gene were determined using RFLP techniques [18]. The TA repeat in the UGT1A1 promoter (UGT1A1-28 genotype, rs8175347) was determined by pyrosequencing performed after PCR amplification with the following primers: sense: 5′GAACTCCCTGCTACCTTTGTG3′), antisense (biotinylated): 5′TTTGCTCCTGCCAGA GGTT3′. PCR products were analyzed without further purification on a Pyrosequencer PyroMark ID system (Qiagen, Courtaboeuf, France) according to the instructions of the manufacturer with the following sequencing primer: 5′ TCGATTGGTTTTTGC3′. The SQA mode was used to analyze the TA repeat. The variations in the TYMS gene were determined using RFLP techniques as follows: for the 3′UTR insdel polymorphism (rs16430), PCR was performed using the following primers: sense: 5′- CAAATCTGAGGGAGCTGAGT-3′; antisense: 5′-CAGATAAGTGGCAGTACAGA-3′. The PCR products were digested by DraI, which specifically cleaves the +6 allele, and subjected to polyacrylamide gel electrophoresis. For the 5′UTR tandem repeat variation in the TYMS gene promoter (rs34743033), PCR was performed using the following primers: sense: 5′-AGGCGCGCGGAAGGGGTCCT-3′; antisense: 5′-TCCGAGCCGGCCACAGGCAT-3′. The 2R/3R variation was first identified by direct electrophoresis of the PCR products on 12% polyacrylamide gels; the PCR products were then digested by HaeIII, which specifically cleaves the 3G allele, and subjected to polyacrylamide gel electrophoresis.\n\nStatistical considerations\nA two-stage Simon’s design was used. Using unacceptable and acceptable response rates of 50% and 70% respectively, a 5% type I error rate and a 10% type II error rate (90% power), the total sample size for this trial was 61 assessable patients over two stages, with 24 assessable subjects recruited during the first stage. At the end of the first stage, 14 PR/CR were required to continue. At the end of the second stage, 37 PR/CR were required to conclude efficacy.\n\nThe primary endpoint of this study was the response rate (RR) at 6 months (both partial [PR] and complete [CR]), evaluated according to RECIST as reviewed by an independent expert committee. Secondary endpoints were progression-free survival (PFS), response duration, overall survival (OS) and toxicity. PFS was calculated from the time of inclusion to disease progression or death of any cause, and duration of the time of the documented response to the progression date. OS was calculated from the first treatment cycle to death (of any cause). PFS and OS were calculated by the Kaplan-Meier method. Median follow-up was calculated with the reverse Kaplan-Meier method. Univariate analyses were performed to determine factors associated with higher OS, PFS and toxicity from clinical and pharmacogenetic data. A Fisher’s exact test was used to evaluate the association of investigated genotypes, clinical data and toxicity. The associations between genotypes, clinical data and survival were tested using the log-rank test. The effects on OS and PFS were estimated by hazard ratios (HRs) (Cox proportional hazards regression model), with adjustment for clinical and pathological factors. All tests were two-sided, and a P value of less than 0.05 was considered statistically significant. In order to take into account the multiple testing that was performed, the final P-values are adjusted to control for a False Discovery Rate (FDR) of 5% [19]. All variables significant at P = 0.05 (after adjustment for polymorphisms) were included in the multivariate models. Statistical analysis was carried out using SAS V9.2 (Cary, NY).\n\nThree populations were defined for analysis: for the primary response criteria, this included all eligible patients with tumoral evaluation by scan and review at six months, for toxicity this included all patients receiving at least one dose of the FOLFIRI® + B treatment and for survival, this included all eligible patients without major protocol deviations.\n\nResults\nPatient characteristics\nSixty-two patients were enrolled in this trial between January 2007 and August 2009 (Table 1). One patient who had been treated 2 years earlier for a squamous cell vocal cords tumor was considered a major protocol violation and excluded from the survival and response analyses. Two other patients were not evaluable for the primary response endpoint (one was lost to follow-up before the CT scan evaluation; the second stopped treatment due to a cause not related to the trial). They all received at least one dose of the FOLFIRI® + B treatment and are included for toxicity analyses.\n\nTable 1 Patient and tumor characteristics at baseline (N = 62)\n\n \t\nN\n\t(%)\t\nAge (years)\t \t \t\n Median\t67.9\t \t\n Range\t60.4–75.4\t \t\nSex\t \t \t\n Male\t25\t(40.3)\t\n Female\t37\t(59.7)\t\nECOG performance status\t \t \t\n 0\t20\t(32.3)\t\n 1\t39\t(62.9)\t\n 2\t3\t(4.8)\t\nPrimary tumor location\t \t \t\n Colon\t53\t(84.5)\t\n Rectum\t9\t(14.5)\t\nMetastases\t \t \t\n Liver\t54\t(87.1)\t\n Lung\t28\t(45.2)\t\n Lymph nodes\t16\t(25.8)\t\n Peritoneum\t17\t(27.4)\t\n Others\t14\t(22.5)\t\nNumber of organs involved (measurable)\t \t \t\n 1\t8\t(12.9)\t\n 2\t12\t(19.3)\t\n ≥ 3\t42\t(66.1)\t\nAdjuvant chemotherapy\t17\t(27.4)\t\nRadiotherapy\t8\t(12.9)\t\nSurgery\t50\t(80.6)\t\nResponse and survival\nAt the cut-off date of December 2011, median follow-up was 43.6 months (range: 26.3–45 months) and no patient was still receiving treatment. Responses were evaluated at 6 months for 59 eligible and assessable patients, with 28 patients achieving a partial response (objective response rate 47.5%, 95% CI; 34.3-60.9), 20 with stable disease (33.9%), and 11 with progressive disease (18.6%). The median duration of response was 9.5 months (range: 2.7-20). Median OS was 25.7 months (95% CI; 20.2-29.7) and median PFS was 10.3 months (95% CI; 8.8-11.7). At one year, survival was 85% (95% CI; 73.2-91.9%), and PFS was 35% (95% CI; 23.3-47]) (Figures 1–2). Eleven patients could subsequently be resected following treatment.\n\nFigure 1 Overall survival for colorectal cancer patients treated with FOLFIRI® and bevacizumab in first-line treatment (with 95% confidence interval, CI).\n\nFigure 2 Progress-free survival for colorectal cancer patients treated with FOLFIRI® and bevacizumab in first-line treatment (with 95% confidence interval, CI).\n\nTolerance\nChemotherapy administration was generally compliant. Relative dose intensity was higher than 90% for each drug (Irinotecan 94.5%, FU 93.8% and bevacizumab 94.5%). A total of 1058 cycles were administered (median 13, range 3–62) with median cumulative doses of 2200.5 mg/m2 for irinotecan, 34.624 g/m2 for FU and 60.9 mg/kg for bevacizumab. Cycle delays (i.e. delay in schedule ≥ 8 days) were observed for 28 patients (43.5%), for toxicity in all cases but one (mainly hematological or diarrhea). Five patients (8%) stopped treatment for toxicities. Fourteen patients (22.6%) stopped therapy for surgical procedures. Nine serious adverse events linked to treatment were observed for seven patients (11.3%): (3 diarrhea, 2 colitis, 1 renal failure, 1 gastritis, 1 phlebitis, and 1 leukocytes).\n\nAll 62 patients were assessable for toxicity. No toxic deaths occurred (Table 2). A toxic effect (of any grade) led to dose modifications for 32 patients (51.6%) over the first 20 cycles of treatment.\n\nTable 2 Drug-related toxicity per patient for colorectal cancer patients treated with FOLFIRI® and bevacizumab in first-line treatment (n = 62)\n\n \tNCI-CTCAE* Grade 1–2\tNCI-CTCAE Grade 3–4\t\n \t\nN\n\t(%)\t\nN\n\t(%)\t\nNeutropenia\t11\t(17.7)\t10\t(16.1)\t\nFebrile neutropenia\t0\t–\t0\t–\t\nAnemia\t4\t(6.5)\t0\t–\t\nThrombocytopenia\t1\t(1.6)\t0\t–\t\nNausea\t20\t(32.3)\t1\t(1.6)\t\nVomiting\t6\t(9.7)\t0\t–\t\nDiarrhea\t19\t(30.6)\t7\t(11.3)\t\nStomatitis/mucositis\t16\t(25.8)\t2\t(3.2)\t\nNeurosensory\t1\t(1.6)\t1\t(1.6)\t\nAsthenia\t3\t(4.8)\t4\t(6.4)\t\nGastrointestinal perforation\t0\t–\t0\t–\t\nHypertension\t1\t(1.6)\t0\t–\t\nVenous thromboembolism\t3\t(4.8)\t0\t–\t\nProteinuria\t8\t(12.9)\t0\t–\t\nBleeding\t7\t(11.3)\t0\t–\t\nAlopecia\t10\t(16.1)\t0\t–\t\n*NCI-CTCAE - National Cancer Institute Common Terminology Criteria for Adverse Events v3.0.\n\nGenotyping\nFifty eight patients (94%) agreed to participate in the pharmacogenetic study and material was received for 46 patients. One major protocol exclusion was observed leaving 45 eligible patients for genotyping. The detailed results of genotyping are presented in Additional file 1. No significant deviations from the Hardy-Weinberg equilibrium were noticed for any. Concerning the VEGFA genotype, it was possible to detect a significant linkage disequilibrium between the two promoter polymorphisms, but the exonic SNP (rs25648) was not in linkage disequilibrium with the two other SNPs. Concerning the TYMS genotype, there was a linkage disequilibrium between the 3′UTR insdel variation and the 5′UTR tandem repeat, which was of borderline significance. After correction for multiple testing, not one of the polymorphisms studied was associated with toxicity or PFS but the S178S synonymous variation (rs25648) was significantly associated with OS (rough P-value = 0.0013, corrected P-value = 0.0104, HR = 0.605, 95% CI, 1.57-8.30) (Figure 3). Looking back at its association with PFS, it appeared significant (P-value = 0.049) only before correction for multiple testing.\n\nFigure 3 Overall survival for genotypes C and H of the rs25648 polymorphism for colorectal cancer patients with FOLFIRI® and bevacizumab in first-line treatment (with 95% confidence interval, CI).\n\nIn univariate analysis VEGFA rs25648 polymorphism, sex, serum alkaline phosphatase (ALP) and lactate dehydrogenase (LDH) were significantly associated with OS. In multivariate analysis, sex (P = 0.0136), serum ALP (P = 0.0085) and the VEGFA rs25648 polymorphism (P = 0.0041) remained significant (Table 3).\n\nTable 3 Univariate and multivariate analyses for demographic, clinical and genetic data with overall survival for colorectal cancer patients treated with FOLFIRI® and bevacizumab (n = 45)\n\n \tUnivariate\tMultivariate\t\n \t\nN \n(45)\tHR [95% CI]\t\nP\n\tHR [95% CI]\t\nP \n(Wald)\t\nSex: Male\t16 (35.6)\tref.\t \tref.\tref.\t\nFemale\t29 (64.4)\t0.43 [0.20; 0.90]\t0.02\t0.38 [0.18; 0.82]\t0.01\t\nAge, y: <=65\t20 (44.4)\tref.\t \t \t \t\n> 65\t25 (55.6)\t1.09 [0.52; 2.28]\t0.81\t-\t-\t\nECOG/PS: 0\t16 (35.6)\tref.\t \t \t \t\n1-2\t29 (64.4)\t1.26 [0.60; 2.70]\t0.55\t-\t-\t\nPrimary tumor: Colon\t28 (62.2)\tref.\t \t \t \t\nRectum\t17 (37.8)\t1.16 [0.56; 2.40]\t0.69\t-\t-\t\nNon-mucinous: No\t5 (11.1)\tref.\t \t \t \t\nYes\t40 (88.9)\t0.45 [0.15; 1.36]\t0.15\t-\t-\t\nMetastatic sites: 1\t13 (28.9)\tref.\t \t \t \t\n>1\t32 (71.1)\t0.77 [0.36; 1.65]\t0.50\t-\t-\t\nLiver-only metas.: No\t33 (73.3)\tref.\t \t \t \t\nYes\t12 (26.7)\t1.14 [0.52; 2.52]\t0.74\t-\t-\t\nResected primary tumor: No\t10 (22.2)\tref.\t \t \t \t\nYes\t35 (77.8)\t0.67 [0.29; 1.51]\t0.33\t-\t-\t\nPrevious adjuvant CT*: No\t34 (75.6)\tref.\t \t \t \t\nYes\t11 (24.4)\t0.85 [0.36; 1.98]\t0.70\t-\t-\t\nHigh ALP†: No\t23 (51.1)\tref.\t \tref.\tref.\t\nYes\t19 (42.2)\t2.80 [1.25; 6.26]\t<0.009\t4.21 [1.44; 12.31]\t0.008\t\nHigh LDH§: No\t16 (35.6)\tref.\t \t \t \t\nYes\t13 (28.9)\t4.73 [1.42; 15.81]\t<0.006\t1.46 [0.62; 3.43]\t0.39\t\nHigh ACE††: No\t17 (37.8)\tref.\t \t \t \t\nYes\t22 (48.9)\t2.07 [0.91; 4.72]\t0.08\t-\t-\t\nrs25648: C\t34 (75.6)\tref.\t \tref.\tref.\t\nH/V\t11 (24.4)\t3.605 [1.57;8.30]\t0.01**\t3.58 [1.50; 8.57]\t0.004\t\nrs2010963: C\t17 (37.8)\tref.\t \t \t \t\nH/V\t28 (62.2)\t1.228 [0.59;2.56]\t0.58\t-\t-\t\nrs699947: C\t34 (75.6)\tref.\t \t \t \t\nH/V\t11 (24.4)\t1.324 [0.59;2.99]\t0.50\t-\t-\t\nrs8175347: C\t15 (33.3)\tref.\t \t \t \t\nH/V\t30 (66.7)\t0.632 [0.30;1.35]\t0.23\t-\t-\t\n3′UTR: C\t23 (51.1)\tref.\t \t \t \t\nH/V\t22 (48.9)\t1.298 [0.64;2.63]\t0.47\t-\t-\t\n5′UTR: V\t11 (24.4)\tref.\t \t \t \t\nC/H\t33 (73.3)\t0.972 [0.44;2.13]\t0.94\t-\t-\t\n5′UTR: C\t13 (28.9)\tref.\t \t \t \t\nH/V\t31 (68.9)\t0.886 [0.41;1.91]\t0.76\t-\t-\t\n*CT = chemotherapy.\n\n**P-value corrected to false discovery rate of 5% [19].\n\n†ALP = alkaline phosphatase, Missing: 3 (6.7).\n\n§LDH = lactate Dehydrogenase, Missing: 16 (35.6).\n\n††ACE = angiotensin-converting Enzyme, Missing: 6 (13.3).\n\nDiscussion\nThe primary objective of this trial was to assess the objective response rate after treatment with FOLFIRI® + B in metastatic CRC. We observed 47.5% objective partial responses with no complete responses at six months. These results appear slightly higher than the most recent phase III trial report with 142 patients showing a response rate of 40.1% [20], similar to as reported by Souglakos et al. [21] (45.5%), and higher than reported in a recent phase III trial (36.8% [22], although they are lower than in previous studies (eg. BICC-C [5] or Kopetz et al. [23]) with 59% and 65% objective responses respectively.\n\nWith a median follow-up time of 43.6 months, the median PFS was 10.3 months, and one-year PFS was 35%. This supports previous reports after FOLFIRI® + B treatment with PFS reported between 9 [24] to 11.6 months [25], and 12.8 months [23]. The median OS in the present trial was 25.7 months, with a one-year survival of 85%. Once again, these rates support previously and recently published rates with OS reported between 22 months [22] 23.7 months [25], 25.7 [21], 28 months (one-year OS of 87%) [26] and 31.3 months [23]. In a recent observational report involving over 240 patients, median PFS was reported at 10.2 months and median OS at 25.5 months, once again providing further support for these patterns [27]. Our results show that a curative hepatic surgery could be carried out for 11 patients (18.6%) that were judged to be unresectable before FOLFIRI + B treatment. The rate of hepatic surgery with FOLFIRI® + B was not reported in the BICC-C study [5,26], and it was 6.5% in the Beat Study Cohort and 9.3% in Kopetz et al.’s study [23].\n\nIn randomized trials in patients with metastatic CRC, bevacizumab has been shown to improve response rates, OS and PFS when combined with chemotherapy regimens like bolus FU/LV [28], irinotecan plus bolus FU/LV (IFL) [6] and oxaliplatin plus infusional FU/LV (FOLFOX) [29]. In a systematic review for patients with advanced CRC receiving first- or second-line fluoropyrimidine-based chemotherapy, the addition of bevacizumab improved PFS and OS, although toxicity was also increased [30]. A more recent systematic review and meta-analysis including over 3000 patients from randomized trial [31] shows a distinct advantage for PFS when bevacizumab is added. In subgroup analyses, the effect was strongest for FU- and irinotecan-based chemotherapy regimens and less marked in oxaliplatin-based regimens.\n\nSevere toxic effects were mainly hematologic and less frequently gastrointestinal. The rate of grade ≥3 toxicities was low. At 19.4%, neutropenia was the most frequent severe toxicity, as has been described in other trials [20], although the rate was lower than described in other studies at (53.6%) [5] or (40%) [23]. The rate of severe diarrhea (11.3%) was similar to the BICC-C study (10.7%) [5] and higher than in Kopetz’s study (2%) [23]. Considering adverse events which could be related to bevacizumab, we had no gastrointestinal perforation compared to 0% [5,23] to 2% [25] reported in the literature; no severe bleeding compared to 0% [5,23] -3% [25], no Grade 3/4 proteinuria, similar to 1% in Van Cutsem et al. [25]; no severe hypertension, lower than reported in the literature at 5% [25] to 12.5% [5] and 19% [23]; and 1.6% Grade 3/4 venous thromboembolism events compared to 1% [25] and 19% [23]. It should be noted that for the 11 patients who were operated on in this trial, no delayed wound healing was noted, with bevacizumab being stopped six weeks before surgery.\n\nAssociations between TYMS polymorphisms and FU efficacy and toxicity in CRC have been reported in several studies [32-35] but not all [36]. In our study, no influence of TYMS polymorphisms on the efficacy or toxicity of the treatment was demonstrated. The limited size of the population tested as well as the fact that the patients did not receive exclusively FU probably explain the lack of associations. The toxicity of irinotecan has been associated with a polymorphism of the SN-38-detoxifying enzyme, UGT1A1, located in the promoter of the gene [37]. However, the risk of experiencing irinotecan-induced hematological toxicity appears to be a function of the dose administered [37]; the risk is higher at the dose usually prescribed in the US (340 mg/m2 every 3 weeks) than at the dose prescribed in Europe (180 mg/m2 every two weeks). This may also explain the lack of associations in our study.\n\nWe found an association between OS and the presence of a polymorphic exonic synonymous variation in the VEGFA gene. Interestingly, the rs25648 variation is one of the three SNPs influencing VEGF serum levels [38], as well as VEGFA mRNA levels in colorectal adenocarcinoma [39]. One could hypothesize that the higher levels of VEGFA produced by the variant allele limits the efficacy of the anti-VEGF antibody and, therefore, has an impact on patient survival. However, the association of this polymorphism with outcome was only significant for OS and not for PFS, which would indicate a general prognostic impact rather than a predictive role for bevacizumab efficiency. Studies involving a larger number of patients should be undertaken with a special focus on this polymorphism which has not been studied extensively up to now.\n\nThe fact that a synonymous polymorphism in the coding sequence of VEGFA exerts an effect on VEGF levels in plasma may be explained by a difference in the 3-dimension structure or the half-life of the transcribed mRNA, which may introduce differences in its handling by the translation machinery. Alternatively, the difference in tRNA availability because of the use of a rare codon may lead to a decrease in translation rate, and thus to a reduced production of the protein.\n\nSome limits should be taken into account when interpreting this data. Firstly, the non-comparative nature of this non-randomized phase II trial should be kept in mind when comparing efficacy results. It should also be noted that although we found a significant effect for the primary endpoint of objective response, no complete responses were observed.\n\nConclusions\nThe present results support the growing body of evidence from phase II [24], phase III and observational studies indicating that FOLFIRI® + B is an active and safe treatment for first-line treatment of metastatic colorectal cancer, with almost half of patients showing an objective response and comparatively long median OS. Further, almost 1/5 initially unresectable patients became resectable after treatment, offering potential for longer survival. It has a good safety profile, with relatively low rates of thromboembolism compared to other alternative chemotherapy associations. The association between the genetic polymorphism rs25648 and improved OS is encouraging, but needs to be confirmed in further trials.\n\nAbbreviations\nCRC: Colorectal cancer; VEGF: Vascular endothelial growth factor; FOLFIRI + B: Irinotecan, leucovorin, fluororacil + bevacizumab; FU: Infusional 5-fluorouracil; OS: Overall survival; PFS: Progression-free survival; RECIST: Response Evaluation Criteria In Solid Tumors; DNA: Deoxyribonucleic acid.\n\nCompeting interests\nThe authors declare that they have no competing interests.\n\nAuthors’ contributions\nYB conceived of the study and drafted the manuscript. CL and SMP participated in the design and coordination of the study and statistical analysis. MP participated in the design of the study, performed the statistical analysis and helped to draft the final manuscript. RB, PT and LC recruited patients to the study. VLM and SA carried out the molecular genetic studies and participated in the sequence alignment. DB, RBr and MF participated in the design of the study. JR carried out the molecular genetic studies, participated in the sequence alignment, and drafted the manuscript. All authors read and approved the final manuscript.\n\nSupplementary Material\nAdditional file 1\nDistribution of the genotypes of the 6 polymorphisms determined in 46 patients for colorectal cancer patients treated with FOLFIRI® and bevacizumab in first-line treatment.\n\nClick here for file\n\n Acknowledgements\nThe authors thank Pippa McKelvie-Sebileau of Institut Bergonié for medical writing assistance in English, the Centre de Traitement de Données, Bordeaux and an independent expert committee for secondary radiological review (Stéphane Ferron and Edouard Descat).\n\nFunding\nThis work was supported by Pfizer laboratories, France. The sponsor had no role in the statistical analysis, drafting of the manuscript or the decision to publish.\n==== Refs\nChauvenet M Cottet V Lepage C Jooste V Faivre J Bouvier AM Trends in colorectal cancer incidence: a period and birth-cohort analysis in a well-defined French population BMC Cancer 2011 11 282 10.1186/1471-2407-11-282 21718477 \nLa situation du cancer en France 2010 http://www.e-cancer.fr/ Collection Rapports et synthèses, edited by INCa, Boulogne-Biflancourt, november 2010 \nColonna M Hedelin G Esteve J Grosclaude P Launoy G Buemi A Arveux P Tretarre B Chaplain G Lesec’h JM Raverdy N Carli PM Menegoz F Faivre J National cancer prevalence estimation in France Int J Cancer 2000 87 301 304 10.1002/1097-0215(20000715)87:2<301::AID-IJC24>3.0.CO;2-Y 10861491 \nBécouarn Y Brunet R Ravaud A Bussières E Lagarde P [Systemic chemotherapy in metastatic colorectal adenocarcinomas] Gastroenterol Clin Biol 1992 16 166 176 1568545 \nFuchs CS Marshall J Mitchell E Wierzbicki R Ganju V Jeffery M Schulz J Richards D Soufi-Mahjoubi R Wang B Barrueco J Randomized, controlled trial of irinotecan plus infusional, bolus, or oral fluoropyrimidines in first-line treatment of metastatic colorectal cancer: results from the BICC-C Study J Clin Oncol 2007 25 4779 4786 10.1200/JCO.2007.11.3357 17947725 \nHurwitz H Fehrenbacher L Novotny W Cartwright T Hainsworth J Heim W Berlin J Baron A Griffing S Holmgren E Ferrara N Fyfe G Rogers B Ross R Kabbinavar F Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer N Engl J Med 2004 350 2335 2342 10.1056/NEJMoa032691 15175435 \nSaltz LB Clarke S Diaz-Rubio E Scheithauer W Figer A Wong R Koski S Lichinitser M Yang TS Rivera F Couture F Sirzén F Cassidy J Bevacizumab in combination with oxaliplatin-based chemotherapy as first-line therapy in metastatic colorectal cancer: a randomized phase III study J Clin Oncol 2008 26 2013 2019 10.1200/JCO.2007.14.9930 18421054 \nKawakami K Watanabe G Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene Cancer Res 2003 63 6004 6007 14522928 \nIyer L Das S Janisch L Wen M Ramirez J Karrison T Fleming GF Vokes EE Schilsky RL Ratain MJ UGT1A1-28 polymorphism as a determinant of irinotecan disposition and toxicity Pharmacogenomics J 2002 2 43 47 10.1038/sj.tpj.6500072 11990381 \nMohammadi M Ollier WE Hutchinson IV A functional association study of VEGF gene promoter polymorphisms with VEGF expression by stimulated PBM cells Hum Immunol 2003 64 S125 10.1016/j.humimm.2003.08.234 \nHansen TF Jakobsen A Clinical implications of genetic variations in the VEGF system in relation to colorectal cancer Pharmacogenomics 2011 12 1681 1693 10.2217/pgs.11.118 22118052 \nKjaer-Frifeldt S Fredslund R Lindebjerg J Hansen TF Spindler KL Jakobsen A Prognostic importance of VEGF-A haplotype combinations in a stage II colon cancer population Pharmacogenomics 2012 13 763 770 10.2217/pgs.12.38 22594508 \nDassoulas K Gazouli M Rizos S Theodoropoulos G Christoni Z Nikiteas N Karakitsos P Common polymorphisms in the vascular endothelial growth factor gene and colorectal cancer development, prognosis, and survival Mol Carcinog 2009 48 563 569 10.1002/mc.20495 19009560 \nHansen TF Garm Spindler KL Andersen RF Lindebjerg J Brandslund I Jakobsen A The predictive value of genetic variations in the vascular endothelial growth factor A gene in metastatic colorectal cancer Pharmacogenomics J 2011 11 53 60 10.1038/tpj.2010.4 20125120 \nFormica V Palmirotta R Del MG Savonarola A Ludovici G De Marchis ML Grenga I Schirru M Guadagni F Roselli M Predictive value of VEGF gene polymorphisms for metastatic colorectal cancer patients receiving first-line treatment including fluorouracil, irinotecan, and bevacizumab Int J Colorectal Dis 2011 26 143 151 10.1007/s00384-010-1108-1 21188390 \nTherasse P Arbuck SG Eisenhauer EA Wanders J Kaplan RS Rubinstein L Verweij J Van Glabbeke M van Oosterom AT Christian MC Gwyther SG New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada J Natl Cancer Inst 2000 92 205 216 10.1093/jnci/92.3.205 10655437 \nTrotti A Colevas D Setser A Rusch V Jaques D Budach V Langer C Murphy B Cumberlin R Coleman CN Rubin P CTCAE v3.0: Development of a Comprehensive Grading System for the Adverse Effects of Cancer Treatment Semin Radiat Oncol 2003 13 176 181 10.1016/S1053-4296(03)00031-6 12903007 \nNief N Le MV Robert J Involvement of gene polymorphisms of thymidylate synthase in gene expression, protein activity and anticancer drug cytotoxicity using the NCI-60 panel Eur J Cancer 2007 43 955 962 10.1016/j.ejca.2006.12.012 17317154 \nHochberg Y Benjamini Y More powerful procedures for multiple significance testing Stat Med 1990 9 811 818 10.1002/sim.4780090710 2218183 \nPectasides D Papaxoinis G Kalogeras KT Eleftheraki AG Xanthakis I Makatsoris T Samantas E Varthalitis I Papakostas P Nikitas N Papandreou CN Pentheroudakis G Timotheadou E Koutras A Sgouros J Bafaloukos D Klouvas G Economopoulos T Syrigos KN Fountzilas G XELIRI-bevacizumab versus FOLFIRI-bevacizumab as first-line treatment in patients with metastatic colorectal cancer: a Hellenic Cooperative Oncology Group phase III trial with collateral biomarker analysis BMC Cancer 2012 12 271 10.1186/1471-2407-12-271 22748098 \nSouglakos J Ziras N Kakolyris S Boukovinas I Kentepozidis N Makrantonakis P Xynogalos S Christophyllakis C Kouroussis C Vamvakas L Georgoulias V Polyzos A Randomised phase-II trial of CAPIRI (capecitabine, irinotecan) plus bevacizumab vs FOLFIRI (folinic acid, 5-fluorouracil, irinotecan) plus bevacizumab as first-line treatment of patients with unresectable/metastatic colorectal cancer (mCRC) Br J Cancer 2012 106 453 459 10.1038/bjc.2011.594 22240792 \nStathopoulos GP Batziou C Trafalis D Koutantos J Batzios S Stathopoulos J Legakis J Armakolas A Treatment of colorectal cancer with and without bevacizumab: a phase III study Oncology 2010 78 376 381 10.1159/000320520 20798560 \nKopetz S Hoff PM Morris JS Wolff RA Eng C Glover KY Adinin R Overman MJ Valero V Wen S Lieu C Yan S Tran HT Ellis LM Abbruzzese JL Heymach JV Phase II trial of infusional fluorouracil, irinotecan, and bevacizumab for metastatic colorectal cancer: efficacy and circulating angiogenic biomarkers associated with therapeutic resistance J Clin Oncol 2010 28 453 459 10.1200/JCO.2009.24.8252 20008624 \nDucreux M Adenis A Pignon JP Francois E Chauffert B Ichante JL Boucher E Ychou M Pierga JY Montoto-Grillot C Conroy T Efficacy and safety of bevacizumab-based combination regimens in patients with previously untreated metastatic colorectal cancer: final results from a randomised phase II study of bevacizumab plus 5-fluorouracil, leucovorin plus irinotecan versus bevacizumab plus capecitabine plus irinotecan (FNCLCC ACCORD 13/0503 study) Eur J Cancer 2013 49 1236 1245 10.1016/j.ejca.2012.12.011 23352604 \nVan Cutsem E Rivera F Berry S Kretzschmar A Michael M DiBartolomeo M Mazier MA Canon JL Georgoulias V Peeters M Bridgewater J Cunningham D First BEAT investigators Safety and efficacy of first-line bevacizumab with FOLFOX, XELOX, FOLFIRI and fluoropyrimidines in metastatic colorectal cancer: the BEAT study Ann Oncol 2009 20 1842 1847 10.1093/annonc/mdp233 19406901 \nFuchs CS Marshall J Barrueco J Randomized, controlled trial of irinotecan plus infusional, bolus, or oral fluoropyrimidines in first-line treatment of metastatic colorectal cancer: updated results from the BICC-C study J Clin Oncol 2008 26 689 690 10.1200/JCO.2007.15.5390 18235136 \nBendell JC Bekaii-Saab TS Cohn AL Hurwitz HI Kozloff M Tezcan H Roach N Mun Y Fish S Flick ED Dalal D Grothey A Treatment patterns and clinical outcomes in patients with metastatic colorectal cancer initially treated with FOLFOX-bevacizumab or FOLFIRI-bevacizumab: results from ARIES, a bevacizumab observational cohort study Oncologist 2012 17 1486 1495 10.1634/theoncologist.2012-0190 23015662 \nKabbinavar FF Hambleton J Mass RD Hurwitz HI Bergsland E Sarkar S Combined analysis of efficacy: the addition of bevacizumab to fluorouracil/leucovorin improves survival for patients with metastatic colorectal cancer J Clin Oncol 2005 23 3706 3712 10.1200/JCO.2005.00.232 15867200 \nGiantonio BJ Catalano PJ Meropol NJ O’Dwyer PJ Mitchell EP Alberts SR Schwartz MA Benson AB IIIBevacizumab in combination with oxaliplatin, fluorouracil, and leucovorin (FOLFOX4) for previously treated metastatic colorectal cancer: results from the Eastern Cooperative Oncology Group Study E3200 J Clin Oncol 2007 25 1539 1544 10.1200/JCO.2006.09.6305 17442997 \nWelch S Spithoff K Rumble RB Maroun J Bevacizumab combined with chemotherapy for patients with advanced colorectal cancer: a systematic review Ann Oncol 2010 21 1152 1162 10.1093/annonc/mdp533 19942597 \nMacedo LT Lima AB Sasse AD Addition of bevacizumab to first-line chemotherapy in advanced colorectal cancer: a systematic review and meta-analysis, with emphasis on chemotherapy subgroups BMC Cancer 2012 12 89 10.1186/1471-2407-12-89 22414244 \nIacopetta B Grieu F Joseph D Elsaleh H A polymorphism in the enhancer region of the thymidylate synthase promoter influences the survival of colorectal cancer patients treated with 5-fluorouracil Br J Cancer 2001 85 827 830 10.1054/bjoc.2001.2007 11556832 \nLurje G Manegold PC Ning Y Pohl A Zhang W Lenz HJ Thymidylate synthase gene variations: predictive and prognostic markers Mol Cancer Ther 2009 8 1000 1007 19383851 \nMartinez-Balibrea E Abad A Martinez-Cardus A Gines A Valladares M Navarro M Aranda E Marcuello E Benavides M Massuti B Carrato A Layos L Manzano JL Moreno V UGT1A and TYMS genetic variants predict toxicity and response of colorectal cancer patients treated with first-line irinotecan and fluorouracil combination therapy Br J Cancer 2010 103 581 589 10.1038/sj.bjc.6605776 20628391 \nPullarkat ST Stoehlmacher J Ghaderi V Xiong YP Ingles SA Sherrod A Warren R Tsao-Wei D Groshen S Lenz HJ Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy Pharmacogenomics J 2001 1 65 70 10.1038/sj.tpj.6500012 11913730 \nVignoli M Nobili S Napoli C Putignano AL Morganti M Papi L Valanzano R Cianchi F Tonelli F Mazzei T Mini E Genuardi M Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil Pharmacol Res 2011 64 242 248 10.1016/j.phrs.2011.04.006 21536130 \nHoskins JM Goldberg RM Qu P Ibrahim JG McLeod HL UGT1A1-28 genotype and irinotecan-induced neutropenia: dose matters J Natl Cancer Inst 2007 99 1290 1295 10.1093/jnci/djm115 17728214 \nRuggiero D Dalmasso C Nutile T Sorice R Dionisi L Aversano M Broet P Leutenegger AL Bourgain C Ciullo M Genetics of VEGF serum variation in human isolated populations of cilento: importance of VEGF polymorphisms PLoS One 2011 6 e16982 10.1371/journal.pone.0016982 21347390 \nYamamori M Sakaeda T Nakamura T Okamura N Tamura T Aoyama N Kamigaki T Ohno M Shirakawa T Gotoh A Kuroda Y Matsuo M Kasuga M Okumura K Association of VEGF genotype with mRNA level in colorectal adenocarcinomas Biochem Biophys Res Commun 2004 325 144 150 10.1016/j.bbrc.2004.10.005 15522212\n\n",
"fulltext_license": "CC BY",
"issn_linking": "1756-0500",
"issue": "7()",
"journal": "BMC research notes",
"keywords": null,
"medline_ta": "BMC Res Notes",
"mesh_terms": "D000328:Adult; D000368:Aged; D061067:Antibodies, Monoclonal, Humanized; D000971:Antineoplastic Combined Chemotherapy Protocols; D000068258:Bevacizumab; D002166:Camptothecin; D015179:Colorectal Neoplasms; D003710:Demography; D018572:Disease-Free Survival; D005260:Female; D005472:Fluorouracil; D060005:Genotyping Techniques; D006801:Humans; D002955:Leucovorin; D008297:Male; D015999:Multivariate Analysis; D011110:Polymorphism, Genetic; D016896:Treatment Outcome",
"nlm_unique_id": "101462768",
"other_id": null,
"pages": "260",
"pmc": null,
"pmid": "24758527",
"pubdate": "2014-04-23",
"publication_types": "D017427:Clinical Trial, Phase II; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "19009560;11913730;23352604;20008624;12903007;18421054;20628391;19942597;11990381;15175435;17442997;17317154;22594508;20798560;22240792;17947725;17728214;19383851;22748098;21347390;15522212;21536130;2218183;15867200;22118052;11556832;22414244;10861491;10655437;19406901;20125120;23015662;21188390;14522928;18235136;1568545;21718477",
"title": "FOLFIRI® and bevacizumab in first-line treatment for colorectal cancer patients: safety, efficacy and genetic polymorphisms.",
"title_normalized": "folfiri and bevacizumab in first line treatment for colorectal cancer patients safety efficacy and genetic polymorphisms"
} | [
{
"companynumb": "FR-CIPLA LTD.-2016FR17088",
"fulfillexpeditecriteria": "1",
"occurcountry": "FR",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "LEUCOVORIN"
},
"drugadditional": null,
... |
{
"abstract": "A 66-year-old woman with no relevant medical history presented at the emergency department with new-onset atrial fibrillation. We initiated intravenous amiodarone therapy. At 20 hours, the patient experienced severe neurologic symptoms, hyponatremia, and syndrome of inappropriate antidiuretic hormone. We discontinued amiodarone, infused saline solution, and restricted the patient's fluid intake. She recovered in 3 days. This case illustrates that amiodarone-induced syndrome of inappropriate antidiuretic hormone with hyponatremia can occur far earlier than expected during acute amiodarone therapy.",
"affiliations": "Tulane Heart and Vascular Institute, Tulane University School of Medicine, New Orleans, Louisiana 70112.;Tulane Heart and Vascular Institute, Tulane University School of Medicine, New Orleans, Louisiana 70112.;University of Central Florida College of Medicine, Orlando, Florida 32827.;Tulane Heart and Vascular Institute, Tulane University School of Medicine, New Orleans, Louisiana 70112.",
"authors": "Qi|Andrea|A|;Moscona|John C|JC|;Reed|Justin|J|;Le Jemtel|Thierry H|TH|",
"chemical_list": "D000889:Anti-Arrhythmia Agents; D000638:Amiodarone",
"country": "United States",
"delete": false,
"doi": "10.14503/THIJ-18-6849",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0730-2347",
"issue": "47(3)",
"journal": "Texas Heart Institute journal",
"keywords": "Amiodarone/adverse effects/therapeutic use; hyponatremia/chemically induced/etiology; iatrogenic disease; inappropriate ADH syndrome/chemically induced/complications; sodium/blood; treatment outcome",
"medline_ta": "Tex Heart Inst J",
"mesh_terms": "D000368:Aged; D000638:Amiodarone; D000889:Anti-Arrhythmia Agents; D001281:Atrial Fibrillation; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D007010:Hyponatremia; D007361:Intelligence Tests; D008603:Mental Health; D013997:Time Factors",
"nlm_unique_id": "8214622",
"other_id": null,
"pages": "229-232",
"pmc": null,
"pmid": "32997783",
"pubdate": "2020-06-01",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": "17710795;12000975;10573050;21317626;18199281;28794867;1985357;17878423;12013366;21426247;28714083;24818037;29151494;27400984;23687510;9382118;24109195;8679841;28571241;15189547;17066625",
"title": "Altered Mental Status and Hyponatremia After 20 Hours of Amiodarone Therapy.",
"title_normalized": "altered mental status and hyponatremia after 20 hours of amiodarone therapy"
} | [
{
"companynumb": "US-DRREDDYS-USA/USA/20/0128452",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "AMIODARONE HYDROCHLORIDE"
},
"drugadditi... |
{
"abstract": "Treatment of drug-resistant tuberculosis requires extended use of more toxic and less effective drugs and may result in retreatment cases due to failure, abandonment or disease recurrence. It is therefore important to understand the evolutionary process of drug resistance in Mycobacterium tuberculosis. We here in describe the microevolution of drug resistance in serial isolates from six previously treated patients. Drug resistance was initially investigated through phenotypic methods, followed by genotypic approaches. The use of whole-genome sequencing allowed the identification of mutations in the katG, rpsL and rpoB genes associated with drug resistance, including the detection of rare mutations in katG and mixed populations of strains. Molecular docking simulation studies of the impact of observed mutations on isoniazid binding were also performed. Whole-genome sequencing detected 266 single nucleotide polymorphisms between two isolates obtained from one patient, suggesting a case of exogenous reinfection. In conclusion, sequencing technologies can detect rare mutations related to drug resistance, identify subpopulations of resistant strains, and identify diverse populations of strains due to exogenous reinfection, thus improving tuberculosis control by guiding early implementation of appropriate clinical and therapeutic interventions.",
"affiliations": "Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil. Electronic address: jaciara_1988@hotmail.com.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Hospital Sanatório Partenon, Secretaria Estadual de Saúde do Rio Grande do Sul (HSP SES/RS), Porto Alegre, Rio Grande do Sul, Brazil.;Centro de Desenvolvimento Científico e Tecnológico, Porto Alegre, Rio Grande do Sul, Brazil.;Programa de Pós-graduação em Biologia Celular e Molecular, Universidade Luterana do Brasil, Porto Alegre, Brazil.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Combi-Lab - Grupo de Biologia Computacional, Centro de Ciências Computacionais C3, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;London School of Hygiene and Tropical Medicine, Keppel Street, London, WC1E 7HT, United Kingdom.;London School of Hygiene and Tropical Medicine, Keppel Street, London, WC1E 7HT, United Kingdom.;London School of Hygiene and Tropical Medicine, Keppel Street, London, WC1E 7HT, United Kingdom.;Combi-Lab - Grupo de Biologia Computacional, Centro de Ciências Computacionais C3, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Combi-Lab - Grupo de Biologia Computacional, Centro de Ciências Computacionais C3, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.;Pathogen Genomics Laboratory, BESE Division, King Abdullah University of Science and Technology (KAUST), Thuwal, Saudi Arabia; Research Center for Zoonosis Control, Global Institution for Collaborative Research and Education (GI-CoRE), Hokkaido University, Sapporo, Japan.;London School of Hygiene and Tropical Medicine, Keppel Street, London, WC1E 7HT, United Kingdom.;Research Institute for Medicines - iMed.ULisboa, Faculdade de Farmácia, Universidade de Lisboa, Lisboa, Portugal.;Unidade de Microbiologia Médica, Global Health and Tropical Medicine, GHTM, Instituto de Higiene e Medicina Tropical, IHMT, Universidade Nova de Lisboa, UNL, Lisboa, Portugal.;Research Institute for Medicines - iMed.ULisboa, Faculdade de Farmácia, Universidade de Lisboa, Lisboa, Portugal.;Núcleo de Pesquisa em Microbiologia Médica, Faculdade de Medicina, Universidade Federal do Rio Grande, Rio Grande, Rio Grande do Sul, Brazil.",
"authors": "de Lourdes do Carmo Guimarães Diniz|Jaciara|J|;von Groll|Andrea|A|;Unis|Gisela|G|;Dalla-Costa|Elis Regina|ER|;Rosa Rossetti|Maria Lúcia|ML|;Vianna|Júlia Silveira|JS|;Ramos|Daniela Fernandes|DF|;Reis|Ana Júlia|AJ|;Bartolomeu Halicki|Priscila Cristina|PC|;Rheingantz Scaini|João Luis|JL|;Castillos de Ibrahim das Neves|Yasmin|Y|;Phelan|Jody|J|;Gomes|Ana Rita|AR|;Campino|Susana|S|;Machado|Karina Dos Santos|KDS|;Werhli|Adriano Velasque|AV|;Pain|Arnab|A|;Clark|Taane Gregory|TG|;Perdigão|João|J|;Viveiros|Miguel|M|;Portugal|Isabel|I|;Almeida Silva|Pedro Eduardo|PE|",
"chemical_list": null,
"country": "Scotland",
"delete": false,
"doi": "10.1016/j.tube.2021.102137",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1472-9792",
"issue": "131()",
"journal": "Tuberculosis (Edinburgh, Scotland)",
"keywords": "Catalase assay; Exogenous reinfection; Microevolution; Resistance; Whole-genome sequencing",
"medline_ta": "Tuberculosis (Edinb)",
"mesh_terms": null,
"nlm_unique_id": "100971555",
"other_id": null,
"pages": "102137",
"pmc": null,
"pmid": "34673379",
"pubdate": "2021-12",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Whole-genome sequencing as a tool for studying the microevolution of drug-resistant serial Mycobacterium tuberculosis isolates.",
"title_normalized": "whole genome sequencing as a tool for studying the microevolution of drug resistant serial mycobacterium tuberculosis isolates"
} | [
{
"companynumb": "BR-LUPIN PHARMACEUTICALS INC.-2022-05144",
"fulfillexpeditecriteria": "2",
"occurcountry": "BR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "RIFAMPIN"
},
"drugadditional":... |
{
"abstract": "Familial Mediterranean fever (FMF) is an autoinflammatory disease characterized by recurrent serosal inflammation with fever, which can result in amyloid deposition. Anti-interleukin-1 drugs emerge as a therapeutic option for colchicine-resistant patients. In this study, we aimed to document our experience with canakinumab use in kidney transplant recipients who developed AA amyloidosis due to FMF.\n\n\n\nA total of nine patients with FMF amyloidosis treated with canakinumab were enrolled. Laboratory and clinical data were collected from the patient files, electronic database of the hospital and with interviews.\n\n\n\nFive of the patients were male and four were female (median age: 33, range: 27-62 years). All of the patients had rapid or gradual disappearance of FMF attacks. The following changes in the laboratory parameters were observed before and after the treatment: C-reactive protein: 18.31 ± 13.58 mg/L vs 9.98 ± 11.66 mg/L, creatinine clearance: 45.27 ± 21.5 mL/min vs 50.71 ± 22.48 mL/min, and 24-hour proteinuria: 2381.8 ± 3910.4 mg vs 710.0 ± 1117.5 mg; there were no statistically significant differences on those parameters. One patient developed a reaction to injection while another showed symptoms of Cytomegalovirus pneumonia.\n\n\n\nCanakinumab can be considered as a safe and efficient drug in preventing the FMF attacks in kidney transplant recipients.",
"affiliations": "Division of Nephrology, Department of Internal Medicine, Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey.;Department of Internal Medicine, Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey.;Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey.;Division of Nephrology, Department of Internal Medicine, Cerrahpasa Medical Faculty, Istanbul University, Istanbul, Turkey.",
"authors": "Trabulus|Sinan|S|;Korkmaz|Merve|M|;Kaya|Eda|E|;Seyahi|Nurhan|N|0000-0001-7427-618X",
"chemical_list": "D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D007375:Interleukin-1; C541220:canakinumab",
"country": "Denmark",
"delete": false,
"doi": "10.1111/ctr.13345",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0902-0063",
"issue": "32(8)",
"journal": "Clinical transplantation",
"keywords": "kidney transplantation; living donor; patient education; patient safety; side effects",
"medline_ta": "Clin Transplant",
"mesh_terms": "D000328:Adult; D000686:Amyloidosis; D000911:Antibodies, Monoclonal; D061067:Antibodies, Monoclonal, Humanized; D003430:Cross-Sectional Studies; D010505:Familial Mediterranean Fever; D005260:Female; D005500:Follow-Up Studies; D005919:Glomerular Filtration Rate; D006084:Graft Rejection; D006085:Graft Survival; D006801:Humans; D007375:Interleukin-1; D007676:Kidney Failure, Chronic; D007677:Kidney Function Tests; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D011183:Postoperative Complications; D011379:Prognosis; D012307:Risk Factors; D066027:Transplant Recipients",
"nlm_unique_id": "8710240",
"other_id": null,
"pages": "e13345",
"pmc": null,
"pmid": "29981275",
"pubdate": "2018-08",
"publication_types": "D002363:Case Reports; D016428:Journal Article",
"references": null,
"title": "Canakinumab treatment in kidney transplant recipients with AA amyloidosis due to familial Mediterranean fever.",
"title_normalized": "canakinumab treatment in kidney transplant recipients with aa amyloidosis due to familial mediterranean fever"
} | [
{
"companynumb": "TR-ALKEM LABORATORIES LIMITED-TR-ALKEM-2019-03048",
"fulfillexpeditecriteria": "1",
"occurcountry": "TR",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "COLCHICINE"
},
"druga... |
{
"abstract": "When coupled with classical clinical signs and symptoms, magnetic resonance imaging can significantly aid in the diagnosis of multiple sclerosis (MS). However, the differential diagnosis of multiple sclerosis is large and, in the absence of pathognomonic clinical features, can be challenging to diagnose initially. Some conditions, such as primary central nervous system lymphoma (PCNSL) and progressive multifocal leukoencephalopathy (PML), can mimic clinically some of the symptoms prominent in multiple sclerosis. Early treatment with corticosteroids can dramatically improve patient symptoms in MS and PCNSL. We report a case of a man diagnosed with histologically confirmed relapsing remitting multiple sclerosis who subsequently developed histologically confirmed primary central nervous system lymphoma. Immunosuppressant therapy in the treatment of multiple sclerosis may be a potential catalyst in the development of central nervous system lymphoma. The course of his disease and treatment are presented and the current literature reviewed.",
"affiliations": "Department of Neurological Surgery, Mayo Clinic Arizona, Phoenix, AZ, USA.",
"authors": "Lyons|Mark K|MK|;Boucher|Orland K|OK|;Birch|Barry D|BD|;Patel|Naresh P|NP|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.1177/1941875211401751",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "1941-8744",
"issue": "1(3)",
"journal": "The Neurohospitalist",
"keywords": "brain biopsy; interferon; magnetic resonance imaging; multiple sclerosis; primary central nervous system lymphoma",
"medline_ta": "Neurohospitalist",
"mesh_terms": null,
"nlm_unique_id": "101558199",
"other_id": null,
"pages": "133-6",
"pmc": null,
"pmid": "23983847",
"pubdate": "2011-07",
"publication_types": "D016428:Journal Article",
"references": "9048709;14759636;15642740;14748776;18420778;2262803;20144466;8558135;7722546;17685133;1681364;15754125;11794488;20354045;7818255;15177781;2668784;703928",
"title": "The development of primary central nervous system B-cell lymphoma in multiple sclerosis.",
"title_normalized": "the development of primary central nervous system b cell lymphoma in multiple sclerosis"
} | [
{
"companynumb": "US-BIOGEN-2013BI007297",
"fulfillexpeditecriteria": "1",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": null,
"activesubstance": {
"activesubstancename": "GLATIRAMER ACETATE"
},
"drugadditional": null,
... |
{
"abstract": "BACKGROUND\nChemotherapy in childhood leukemia potentially induces brain lesions and neurological sequelae. Paroxysmal sympathetic hyperactivity (PSH) is known as a treatment-associated complication; however, the full clinical spectra of PSH remain to be elusive.\n\n\nMETHODS\nA 5-year-old girl was diagnosed of acute myeloid leukemia (AML) M5. After the intensification therapy, she developed recurrent symptoms of episodic tachycardia, hypertension and perspiration lasting for several hours per day. The low-frequency-high-frequency ratio on Holter electrocardiography was rapidly increased from 0.84 to 2.24 at the onset of the paroxysmal event, whereas the video-monitoring electroencephalography (EEG) never identified ictal patterns of epileptiform discharges during the episodes. Thus, the diagnosis of PSH was given at 7 years of age. Myoclonic and generalized tonic-clonic seizures frequently appeared from 10 years of age, which poorly responded to anticonvulsants. EEG showed diffuse slow-wave bursts with multifocal spikes. Serial head magnetic resonance imaging (MRI) revealed diffuse cerebral and hippocampal atrophy, but not inflammatory lesions in the limbic system.\n\n\nCONCLUSIONS\nWe first demonstrate a pediatric case with PSH who developed drug-resistant epilepsy 3 years after the onset of PSH. Our data suggest the pathophysiological link of persistent PSH with chemotherapy-associated brain damage.",
"affiliations": "Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan; Department of Perinatal and Pediatric Medicine, Kyushu University, Fukuoka, Japan.;Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Hospital, Fukuoka, Japan.;Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Hospital, Fukuoka, Japan.;Department of Clinical Chemistry and Laboratory Medicine, Kyushu University Hospital, Fukuoka, Japan.;Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.;Department of Pediatrics, National Hospital Organization Kumamoto Saishun Medical Center, Kumamoto, Japan.;Department of Pediatrics, Japanese Red Cross Kumamoto Hospital, Kumamoto, Japan.;Department of Neurology and Geriatrics, Kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan.;Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan; Department of Perinatal and Pediatric Medicine, Kyushu University, Fukuoka, Japan.;Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan. Electronic address: ysakai22q13@gmail.com.;Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.",
"authors": "Taira|Ryoji|R|;Yamamura|Kenichiro|K|;Maeda|Tomoko|T|;Sakata|Ayumi|A|;Watanabe|Eriko|E|;Shimogawa|Takafumi|T|;Mukae|Nobutaka|N|;Ikeda|Chizuru|C|;Migita|Masahiro|M|;Watanabe|Osamu|O|;Koga|Yuhki|Y|;Sakai|Yasunari|Y|;Ohga|Shouichi|S|",
"chemical_list": null,
"country": "Netherlands",
"delete": false,
"doi": "10.1016/j.braindev.2021.07.001",
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0387-7604",
"issue": "43(10)",
"journal": "Brain & development",
"keywords": "Chemotherapy; Encephalitis; Epilepsy; Leukemia; Paroxysmal sympathetic hyperactivity",
"medline_ta": "Brain Dev",
"mesh_terms": null,
"nlm_unique_id": "7909235",
"other_id": null,
"pages": "1044-1050",
"pmc": null,
"pmid": "34301435",
"pubdate": "2021-11",
"publication_types": "D002363:Case Reports",
"references": null,
"title": "Paroxysmal sympathetic hyperactivity and the later development of epilepsy in a chemotherapy-associated brain damage.",
"title_normalized": "paroxysmal sympathetic hyperactivity and the later development of epilepsy in a chemotherapy associated brain damage"
} | [
{
"companynumb": "JP-LUPIN PHARMACEUTICALS INC.-2022-04857",
"fulfillexpeditecriteria": "1",
"occurcountry": "JP",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "LEVETIRACETAM"
},
"drugadditio... |
{
"abstract": "Polyethylene glycol with electrolytes (PEG-ELS, Golytely) is a widely used osmotic solution for colonic preparation in adults who are undergoing colonoscopy or colon surgeries. In pediatric patients, It is approved for the same indications and as a treatment for severe chronic constipation. PEG-ELS has an acceptable safety profile and minimal side effects. The most common adverse effects are nausea and abdominal cramps. Golytely is known to cause minimal electrolyte disturbances with no major sequelae. A few case reports have been published describing the effect of PEG-ELS on the electrolytes. In this report, we present a case of an inappropriate preparation of Golytely administered to a pediatric patient leading to severe electrolyte disturbances and death.",
"affiliations": "Pediatric Critical Care Medicine, Dr. Sulaiman AL Habib Medical Group, Riyadh, SAU.;Pediatric Critical Care Medicine, King Faisal Specialist Hospital and Research Center, Riyadh, SAU.",
"authors": "Skaff|Chahdah|C|;Alayed|Tareq|T|",
"chemical_list": null,
"country": "United States",
"delete": false,
"doi": "10.7759/cureus.13713",
"fulltext": "\n==== Front\nCureus\nCureus\n2168-8184\nCureus\n2168-8184\nCureus Palo Alto (CA)\n\n10.7759/cureus.13713\nPediatrics\nGastroenterology\nLethal Complication From Inappropriately Prepared Polyethylene Glycol (Golytely) in a Pediatric Patient\nMuacevic Alexander\nAdler John R\nSkaff Chahdah 1\nAlayed Tareq 2\n1 Pediatric Critical Care Medicine, Dr. Sulaiman AL Habib Medical Group, Riyadh, SAU\n2 Pediatric Critical Care Medicine, King Faisal Specialist Hospital and Research Center, Riyadh, SAU\nTareq Alayed tayaed@kfshrc.edu.sa\n5 3 2021\n3 2021\n13 3 e1371324 2 2021\nCopyright © 2021, Skaff et al.\n2021\nSkaff et al.\nThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.\nThis article is available from https://www.cureus.com/articles/50540-lethal-complication-from-inappropriately-prepared-polyethylene-glycol-golytely-in-a-pediatric-patient\nPolyethylene glycol with electrolytes (PEG-ELS, Golytely) is a widely used osmotic solution for colonic preparation in adults who are undergoing colonoscopy or colon surgeries. In pediatric patients, It is approved for the same indications and as a treatment for severe chronic constipation. PEG-ELS has an acceptable safety profile and minimal side effects. The most common adverse effects are nausea and abdominal cramps. Golytely is known to cause minimal electrolyte disturbances with no major sequelae. A few case reports have been published describing the effect of PEG-ELS on the electrolytes.\n\nIn this report, we present a case of an inappropriate preparation of Golytely administered to a pediatric patient leading to severe electrolyte disturbances and death.\n\n\npediatric\npolyethylene glycol\nesophageal atresia repair\ncolonic interposition\nThe content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.\n==== Body\nIntroduction\n\nPolyethylene glycol with electrolytes (PEG-ELS, Golytely) is an osmotically balanced, high-volume, non-absorbable electrolytes solution. It is commonly used in pediatric patients as a treatment for chronic severe constipation [1] and in the preparation for colonoscopy [2]. Its safety profile encourages pediatricians to use it widely. The main reported side effects are nausea, vomiting, and abdominal pain [3]. Golytely causes minimal electrolytes shifting when prepared and administered appropriately.\n\nIn this report, we discuss the case of a child who was known to have had a complicated post-esophageal atresia repair. He had undergone many corrective surgeries but ended up with severe esophageal strictures. He was scheduled for colonic interposition surgery. One of the main preoperative preparations involved colonic cleansing using an osmotic agent. Inadvertently, the child received an inappropriately made Golytely preparation. This led to severe diarrhea and serious hypernatremic dehydration. Unfortunately, the child's condition deteriorated rapidly, leading to multiorgan dysfunction and brain death.\n\nCase presentation\n\nOur patient was a five-year-old boy who was known to have esophageal atresia and tracheoesophageal fistula post multiple surgical repairs. His course of therapy had been complicated by recurrent tracheoesophageal fistulae, which had required different modalities of surgical therapy. He ended up with a proximal esophagectomy and a closed distal esophagus.\n\nA year later, he was scheduled to undergo colonic interposition for esophageal replacement. He was admitted to a non-surgical adult unit due to the unavailability of pediatric beds. The plan was to start bowel preparation overnight using Golytely and bisacodyl. The approved protocol was to administer 25 ml/kg/hour of diluted Golytely the night before the surgery. This dose could be repeated until the output was clear. During this time, the child would be fasting and intravenous fluids (IVF) would be started. Inadvertently, at 22:00 on 9/12, an undiluted 375 ml of Golytely was administered over one hour through a gastrostomy. IVF was started four hours after starting the laxative. Six hours after the administration, at 04:00 on 10/12, the child passed a large amount of watery stool. An hour later, he became lethargic, had poor peripheral perfusion, and became tachycardic.\n\nHis vital signs before starting Golytely and at the time of the event are presented in Table 1.\n\nTable 1 Vital signs before and during the event\n\nVitals\tBefore Golytely (9/12, 20:00)\tAt the time of the event (10/12, 04:00)\t\nTemperature (degree celsius)\t36.6\t37.5\t\nHeart rate (beats per minute)\t91\t210\t\nRespiratory rate (breaths per minute)\t22\t52\t\nSaturation (%)\t98\t99\t\nBlood pressure, mmHg\t105/61\t90/70\t\n\nHis condition deteriorated rapidly and his level of consciousness dropped, requiring the caregivers to secure his airway. His heart rate was persistently high and he developed high-grade fever (39.9 °C). His ECG showed evidence of supraventricular tachycardia, for which he received three doses of adenosine and two synchronized cardioversion. During the resuscitation, he received a total of 100 ml/kg of crystalloids and colloids. He was then shifted to the pediatric intensive care unit (PICU) with the following vitals: temperature: 37.5 °C, heart rate 159 beats per minute, and blood pressure: 91/54 mmHg.\n\nThe trend of his blood gas levels is shown in Table 2.\n\nTable 2 Blood gas parameters\n\nABG: arterial blood gas; VBG: venous blood gas; HCO3: bicarbonate\n\nParameters\tABG (10/12, 04:15)\tVBG (two hours later: 06:15)\tVBG (six hours later: 13:00)\t\npH\t7.4 (7.35-7.45)\t7.14 (7.33-7.43)\t7.21 (7.33-7.43)\t\npCO2 (kPa)\t3.7 (4-5)\t8.6 (6-6.8)\t4.2 (6-6.8)\t\npO2 (kPa)\t12.7 (10-13)\t5.4 (4.7-5.3)\t8.2 (4.7-5.3)\t\nHCO3 (mmol/L)\t17.3 (22-26)\t22.1 (24-28)\t12.4 (24-28)\t\nLactate (mmol/L)\t3.9 (0.5-1)\t4.9 (0.5-1)\t5.7 (0.5-1)\t\n\nThe labs before and after the event are presented in Table 3.\n\nTable 3 Laboratory values before and after the event\n\nCBC: complete blood count; WBC: white blood cells; Hb: hemoglobin; HCT: hematocrit; ALT: alanine aminotransferase; AST: aspartate aminotransferase; ALP: alkaline phosphatase\n\nLabs\tBefore the event (9/12, 11:30)\tAfter the event (10/12, 04:20)\t\nCBC\t \t \t\n WBC (103/mL) (5-15)\t4.85\t22.4\t\n Hb (mg/dL) (110-140)\t143\t185\t\n HCT (33-42%)\t0.423\t0.547\t\n Platelets (103/mL) (150-400)\t265\t504\t\nRenal function\t\n Urea (mmol/L) (2.5-8)\t5\t7\t\n Creatinine (mmol/L) (28-52)\t22\t35\t\n Sodium (mmol/L) (136-145)\t137\t171\t\n Chloride (mmol/L) (98-107)\t101\t131\t\n Potassium (mmol/L) (3.5-5)\t4.7\t4.1\t\n Bicarbonate (mmol/L) (20-28)\t18\t15\t\n Phosphate (mmol/L) (1.05-1.85)\t--\t0.75\t\nLiver function\t\n ALT (IU/L) (<55)\t15.1\t22.4\t\n AST (IU/L) (5-34)\t30\t51.1\t\n ALP (IU/L) (142-335)\t144\t186\t\n Albumin (g/L) (38-54)\t41.6\t48\t\n\nThe patient's initial labs showed significant hemoconcentration and severe hypernatremia. His plasma osmolality was 409 mOsm/Kg (normal range: 275-290 mOsm/Kg) and his urine osmolality was 220 (normal range: 50-1200 mOsm/Kg), 12 hours after the event. The inflammatory markers were benign: procalcitonin of 0.23 and CRP of 5, and no positive cultures were reported. The child was empirically started on broad-spectrum antibiotics to cover the possibility of sepsis. His condition continued to deteriorate and he developed multiorgan dysfunction syndrome (MODS). The striking features of his labs at that time were the progressive increment in sodium, chloride, lactate, and the decline in phosphate despite optimizing his intravascular volume. The trends of sodium, chloride, lactate, and phosphate over 24 hours are presented below (Figure 1, Figure 2, Figure 3).\n\nFigure 1 Trend of sodium and chloride\n\nThis figure demonstrates the progressive elevation in sodium and chloride over 36 hours\n\nFigure 2 Trend of lactate\n\nThis figure shows the lactate levels over 36 hours. It shows a progressive elevation of lactate within the first 12 hours, followed by gradual improvement, and then re-elevation\n\nFigure 3 Trend of phosphate\n\nThe figure represents the trend of phosphate over a period of 26 hours. The phosphate level reached its nadir within 12 hours from the event; it was difficult to correct initially and then started to improve with replacement\n\nSix hours later, the child developed pulseless electrical activity (PEA); effective cardiopulmonary resuscitation (CPR) was performed, and restoration of spontaneous circulation (ROSC) was achieved after nine minutes. Afterward, he required high inotropic supports. Four hours later, he developed bilateral dilated, non-reactive pupils. An urgent CT scan was done and showed severe brain edema with tonsillar herniation. Neuroprotective measures were applied. But unfortunately, his condition kept deteriorating, and the child developed ventricular tachycardia and passed away.\n\nDiscussion\n\nAppropriate bowel preparation is an important step in any major colon surgery, such as colonic interposition in complicated esophageal atresia in pediatric patients. The ideal substance for colonic cleanout should be safe and effective, and should not cause any changes in the colonic structure or any electrolytes derangements [4].\n\nIn 1980, Davis et al. developed PEG-ELS-based laxatives (Golytely), which later became the most commonly used solution for colonic cleanout in both adults and pediatric patients [5]. PEG-ELS is a balanced preparation that travels through the gastrointestinal tract without absorption or secretion of electrolytes or fluids. Hence, colonic cleansing happens due to the mechanical drag of stool by fluid load [5]. In 1988, Schiller et al. studied the osmotic effect of PEG and concluded that it exhibits a greater osmotic effect than can be accounted for by the number of PEG molecules found in the preparation [6].\n\nHammer et al. compared osmotic diarrhea induced by PEG vs. lactulose. They concluded that the higher osmotic loads of PEG resulted in a near-linear increment in stool weight and water output. They also found that PEG-induced diarrhea was associated with minimal enteral loss of sodium, potassium, and chloride [7]. Since PEG does not cause major electrolytes and fluid derangement, it gradually became the preferred agent for colonic preparation in pediatric patients. In a survey conducted by the NASPGHAN group in 2014, 80% of responders reported using PEG with or without a stimulant for bowel cleanout. The most common stimulants used were bisacodyl and Senna. In the same survey, it was observed that there were wide differences in the dosage of PEG prescribed by different physicians [8]. The usual protocol in pediatrics is to give 25 ml/kg of Golytely per hour, with a maximum dose of 450 ml per hour, until the stool is clear. It usually takes four hours to complete the preparation [8,9]. Golytely is available as a powder component in a 4-L container. This content should be diluted in 4 L of water. Afterward, the prescribed amount will be given to the child. The 4-liter diluted Golytely contains 59 g/L of PEG, 5.69 g/L of sodium sulfate, 1.69 g/L of sodium bicarbonate, 1.47 g/L of sodium chloride, and 0.743 g/L of potassium chloride [10].\n\nOver the years, Golytely has gained widespread acceptance among pediatricians due to its better palatability compared to other products. However, a good number of pediatric patients require the insertion of a nasogastric tube (NGT) to consume the required amount over a specific period of time, which is usually difficult in very small pediatric patients [9]. In a review, Peña and Bischoff have described the usual colorectal preparation using Golytely for colon surgeries. Cleaning the colon takes approximately four hours. During this time, the patient is allowed to take clear fluids only. In small children of less than two years, it is recommended to start IVF during the process. However, in children aged more than two years, it is desirable to have IVF, but not mandatory. The reason is to prevent the development of dehydration and metabolic acidosis that occur in pediatric patients during the process of colonic preparation [9]. Many studies have confirmed the safety of PEG use in pediatric patients. The most common reported side effects are abdominal discomfort, bloating, nausea, and vomiting [3]. Even in a reported case of unintentional IV administration of PEG, there were no significant side effects after aggressive fluid management [11].\n\nA review of the literature revealed that there are a few studies reporting more severe and sometimes lethal side effects of PEG. In a case series published in 2017, 12 cases of adverse effects of PEG were reported. Seven of these cases were pediatric patients. All of them developed aspiration pneumonitis post administration of PEG through NGT. Four of them required invasive mechanical ventilation. Fortunately, there was no mortality and all children had a complete recovery [12]. Another rare complication of Golytely was reported in the case of a child who developed urticaria after undergoing bowel irrigation post-ingestion of an alkali battery. It resolved with the stopping of the irrigation and administration of anti-histamine [13]. This rare complication was also reported in an adult patient [14].\n\nOne of the major concerns of using Golytely is the risk of electrolyte disturbances, especially dysnatremia. Although many studies have shown the safety of PEG regarding electrolytes balance, there have been a few reported cases describing significant dysnatremia. Ten cases of severe hyponatremia after the use of PEG were reported until 2017. All of them were adults and their ages ranged between 50-70 years. Their presentation was predominantly neurological with seizure being the most common clinical feature. One patient developed cardiac arrest and died [15]. In another case series, two adult patients developed hypernatremia. One of them had presented with massive diarrhea, seizure, and aspiration pneumonia, while the other patient had presented mainly with neurological symptoms. Unfortunately, both of them developed cardiac arrest and passed away [16]. In an adult case reported more recently, the patient developed cardiac arrest with ventricular fibrillation four hours after the consumption of Golytely. Unfortunately, due to severe neurological sequelae, the patient died 18 days later [17].\n\nTo our knowledge, this is the first reported pediatric case describing a lethal complication caused by the ingestion of mal-prepared Golytely. Our patient was administered an undiluted 375 ml of Golytely over one hour. This caused a major shift in water levels, and the child passed a very large amount of watery diarrhea afterward. As a consequence, he developed severe hypernatremic dehydration and hypovolemic shock. The hypernatremia was progressive, and the osmolarity kept worsening as well despite adequate rehydration. Later, the child developed cardiac arrest and PEA followed by severe brain edema, tonsillar herniation, and MODS. His hypernatremia and hyperosmolarity were refractory and difficult to control. Unfortunately, our patient then developed ventricular tachycardia and passed away.\n\nConclusions\n\nThe appropriate and careful preparation of Golytely is a crucial step before administering it for colonic cleansing. Otherwise, it will lead to lethal complications. At our institution, after the occurrence of the incident reported in this study, the pharmacist has been assigned the responsibility to dilute Golytely in the pharmacy. After that, another two healthcare workers (nurses or doctors) are expected to double-check the preparation's appropriateness before administering the ordered volume to the patient.\n\nHuman Ethics\n\nThe authors have declared that no competing interests exist.\n\nConsent was obtained or waived by all participants in this study\n==== Refs\nReferences\n\n1 A prospective randomized study with mineral oil and oral lavage solution for treatment of faecal impaction in children Aliment Pharmacol Ther Tolia V Lin CH Elitsur Y 523 529 7 1993 8280820\n2 Colon cleanout preparations in children and adolescents Gastroenterol Nurs Barrish JO Gilger MA 106 109 16 1993 8286425\n3 Commonly used preparations for colonoscopy: efficacy, tolerability, and safety--a Canadian Association of Gastroenterology position paper Can J Gastroenterol Barkun A Chiba N Enns R 699 710 20 2006 17111052\n4 Electrolyte changes after bowel preparation for colonoscopy: a randomized controlled multicenter trial World J Gastroenterol Lee KJ Park HJ Kim HS Baik KH Kim YS Park SC Seo HI 3041 3048 21 2015 25780304\n5 Mechanism of action and toxicities of purgatives used for colonoscopy preparation Expert Opin Drug Metab Toxicol Adamcewicz M Bearelly D Porat G Friedenberg FK 89 101 7 2011 21162694\n6 Osmotic effects of polyethylene glycol Gastroenterology Schiller LR Emmett M Santa Ana CA Fordtran JS 933 941 94 1988 3345895\n7 Studies of osmotic diarrhea induced in normal subjects by ingestion of polyethylene glycol and lactulose J Clin Invest Hammer HF Santa Ana CA Schiller LR Fordtran JS 1056 1062 84 1989 2794043\n8 Bowel preparation for pediatric colonoscopy: report of the NASPGHAN endoscopy and procedures committee J Pediatr Gastroenterol Nutr Pall H Zacur GM Kramer RE 409 416 59 2014 24897169\n9 Bowel preparation in pediatric colorectal surgery Surgical Treatment of Colorectal Problems in Children Peña A Bischoff A 101 106 Basingstoke, UK Springer Nature 1 2015\n10 FDA: GoLYTELY - full prescribing information 22021 1985 https://www.accessdata.fda.gov/drugsatfda_docs/label/2020/019011s031lbl.pdf\n11 Unintentional intravenous infusion of Golytely in a 4-year-old girl Ann Pharmacother Rivera W Velez LI Guzman DD Shepherd G 1183 1185 38 2004 15173559\n12 Administering polyethylene glycol electrolyte solution via a nasogastric tube: pulmonary complications Am J Crit Care Metheny NA Meert KL 0 7 26 2017\n13 Urticaria as a rare side effect of polyethylene glycol-3350 in a child: case report Acta Clin Croat Sari Gökay S Çelik T Yusuf Sari M Ekinci F Dinçer Yildizdaş R Levent Yilmaz H 187 189 57 2018 30256031\n14 Urticaria due to polyethylene glycol-3350 and electrolytes for oral solution in a patient with jejunal nodular lymphoid hyperplasia Ann Gastroenterol Zhang H Henry WA Chen LA Khashab MA 148 150 28 2015 https://www.ncbi.nlm.nih.gov/pubmed/25608714 25608714\n15 Severe symptomatic hyponatremia associated with the use of polyethylene glycol-based bowel preparation Endocrinol Diabetes Metab Case Rep Samad N Fraser I 119 2017 2017\n16 Fatal dysnatraemia caused by elective colonoscopy: lesson was unnecessarily alarmist BMJ Saunders BP Williams CB 1146 1147 326 2003\n17 Possible GoLytely-associated cardiac arrest: a case report and literature review J Pharm Pract Mo Y Gandhi S Orsini J 364 367 33 2020 30727797\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2168-8184",
"issue": "13(3)",
"journal": "Cureus",
"keywords": "colonic interposition; esophageal atresia repair; polyethylene glycol;
pediatric",
"medline_ta": "Cureus",
"mesh_terms": null,
"nlm_unique_id": "101596737",
"other_id": null,
"pages": "e13713",
"pmc": null,
"pmid": "33833924",
"pubdate": "2021-03-05",
"publication_types": "D002363:Case Reports",
"references": "12764004;30727797;24897169;28458891;30256031;28249875;8286425;25608714;3345895;2794043;8280820;21162694;25780304;15173559;17111052",
"title": "Lethal Complication From Inappropriately Prepared Polyethylene Glycol (Golytely) in a Pediatric Patient.",
"title_normalized": "lethal complication from inappropriately prepared polyethylene glycol golytely in a pediatric patient"
} | [
{
"companynumb": "SA-BRAINTREE LABORATORIES, INC.-2021BTE00634",
"fulfillexpeditecriteria": "1",
"occurcountry": "SA",
"patient": {
"drug": [
{
"actiondrug": "6",
"activesubstance": {
"activesubstancename": "POLYETHYLENE GLYCOL 3350\\POTASSIUM CHLORIDE\\... |
{
"abstract": "OBJECTIVE\nTo report our experience in treating infants and toddlers with central diabetes insipidus (DI) with thiazide diuretics.\n\n\nMETHODS\nA retrospective chart review of all infants and toddlers who were treated with thiazide diuretics for central DI at the Mayo Clinic between 1996 and 2014.\n\n\nRESULTS\nOur cohort consisted of 13 patients. The median age at the start of therapy was 6 months (IQR, 1-14 months). Eight patients were given chlorothiazide at a starting dose of 5-10 mg/kg/day, and 5 patients were treated with hydrochlorothiazide at a starting dose of 1-2 mg/kg/day. The median age at the cessation of thiazide therapy was 18 months (IQR, 11.5-39 months). The main reason for stopping was the lack of continued response, in addition to hypernatremia. There was no hospitalization secondary to hyponatremia and only 1 hospitalization secondary to hypernatremia while receiving thiazide therapy. Calcium was checked periodically in 7 of the 13 patients, and 2 of these 7 patients had persistent hypercalcemia.\n\n\nCONCLUSIONS\nThiazide diuretics appear to be safe and effective in treating infants with central DI. They can be continued after the introduction of solid food, and until a lack of response is observed.",
"affiliations": "Division of Pediatric Endocrinology, Mayo Clinic, Rochester, MN; Evidence-Based Practice Research Program, Mayo Clinic, Rochester, MN. Electronic address: alaadone@yahoo.com.;Division of Pediatric Endocrinology, Mayo Clinic, Rochester, MN.",
"authors": "Al Nofal|Alaa|A|;Lteif|Aida|A|",
"chemical_list": "D001786:Blood Glucose; D049993:Sodium Chloride Symporter Inhibitors; D006852:Hydrochlorothiazide; D002740:Chlorothiazide; D011188:Potassium; D002118:Calcium",
"country": "United States",
"delete": false,
"doi": null,
"fulltext": null,
"fulltext_license": null,
"issn_linking": "0022-3476",
"issue": "167(3)",
"journal": "The Journal of pediatrics",
"keywords": null,
"medline_ta": "J Pediatr",
"mesh_terms": "D001786:Blood Glucose; D002118:Calcium; D002740:Chlorothiazide; D020790:Diabetes Insipidus, Neurogenic; D005260:Female; D006801:Humans; D006852:Hydrochlorothiazide; D007223:Infant; D007231:Infant, Newborn; D008297:Male; D011188:Potassium; D012189:Retrospective Studies; D049993:Sodium Chloride Symporter Inhibitors",
"nlm_unique_id": "0375410",
"other_id": null,
"pages": "658-61",
"pmc": null,
"pmid": "26130110",
"pubdate": "2015-09",
"publication_types": "D016428:Journal Article",
"references": null,
"title": "Thiazide Diuretics in the Management of Young Children with Central Diabetes Insipidus.",
"title_normalized": "thiazide diuretics in the management of young children with central diabetes insipidus"
} | [
{
"companynumb": "US-APOTEX-2015AP012836",
"fulfillexpeditecriteria": "2",
"occurcountry": "US",
"patient": {
"drug": [
{
"actiondrug": "1",
"activesubstance": {
"activesubstancename": "HYDROCHLOROTHIAZIDE"
},
"drugadditional": null,
... |
{
"abstract": "Recently, chronic hepatitis E virus (HEV) infections gained increasing attention as a possible cause for elevated liver enzymes of unknown origin and liver cirrhosis in solid organ transplant recipients. Reduction of immunosuppressive therapy and/or use of antiviral drug ribavirin have been established as possible treatment strategies.\n\n\n\nThe efficacy of dose reduction of mycophenolic acid (MPA) and ribavirin therapy was retrospectively analyzed in eight renal transplant patients of our outpatient clinic who were diagnosed with HEV infection by detection of specific antibodies (immunoglobulin M and immunoglobulin G) and/or positive RNA in blood and stool. In four patients serial HEV viral loads in blood were measured.\n\n\n\nOnly one patient reached HEV clearance after reduction of immunosuppressive therapy (predominantly reduction of MPA daily dose) alone, whereas six patients were treated with ribavirin after reduction of immunosuppressive therapy due to persistent virus replication. Four of six patients reached HEV clearance after 3 months of ribavirin therapy. HEV clearance was observed after 34-42 days. Two patients, both treated with rituximab within the last 12 months before diagnosis of HEV infection, needed prolonged ribavirin therapy due to persistent viral replication.\n\n\n\nReduction of daily dose of MPA therapy alone in transplant patients with chronic HEV infection may not be sufficient to control viral replication. HEV clearance under ribavirin therapy shows interindividual variability. Therefore, serial viral monitoring may be useful to personalize treatment duration. Rituximab therapy is a risk factor for complicated-to-treat chronic HEV infection.",
"affiliations": "Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne, University of Cologne, Cologne, Germany.;Faculty of Medicine, University Hospital of Cologne, Institute of Virology, University of Cologne, Cologne, Germany.;Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne, University of Cologne, Cologne, Germany.;Faculty of Medicine, University Hospital of Cologne, Institute of Virology, University of Cologne, Cologne, Germany.;Faculty of Medicine, University Hospital of Cologne, Institute of Virology, University of Cologne, Cologne, Germany.;Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne, University of Cologne, Cologne, Germany.;Department of General, Visceral and Cancer Surgery, University Hospital of Cologne, University of Cologne, Cologne, Germany.;Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne, University of Cologne, Cologne, Germany.;Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne, University of Cologne, Cologne, Germany.",
"authors": "Affeldt|Patrick|P|0000-0002-3075-0473;Di Cristanziano|Veronica|V|;Grundmann|Franziska|F|0000-0002-5766-7477;Wirtz|Maike|M|;Kaiser|Rolf|R|;Benzing|Thomas|T|0000-0003-0512-1066;Stippel|Dirk|D|0000-0002-1107-0907;Kann|Martin|M|;Kurschat|Christine|C|0000-0002-3646-9471",
"chemical_list": "D012367:RNA, Viral",
"country": "England",
"delete": false,
"doi": "10.1002/iid3.411",
"fulltext": "\n==== Front\nImmun Inflamm Dis\nImmun Inflamm Dis\n10.1002/(ISSN)2050-4527\nIID3\nImmunity, Inflammation and Disease\n2050-4527\nJohn Wiley and Sons Inc. Hoboken\n\n33559399\n10.1002/iid3.411\nIID3411\nOriginal Research\nOriginal Research\nMonitoring of hepatitis E virus RNA during treatment for chronic hepatitis E virus infection after renal transplantation\nAFFELDT et al.\nAffeldt Patrick https://orcid.org/0000-0002-3075-0473\n1 [Link]\nDi Cristanziano Veronica 2 [Link]\nGrundmann Franziska https://orcid.org/0000-0002-5766-7477\n1\nWirtz Maike 2\nKaiser Rolf 2\nBenzing Thomas https://orcid.org/0000-0003-0512-1066\n1\nStippel Dirk https://orcid.org/0000-0002-1107-0907\n3\nKann Martin 1\nKurschat Christine https://orcid.org/0000-0002-3646-9471\n1 christine.kurschat@uk-koeln.de\n\n1 Department II of Internal Medicine and Center for Molecular Medicine Cologne, Faculty of Medicine, University Hospital Cologne University of Cologne Cologne Germany\n2 Faculty of Medicine, University Hospital of Cologne, Institute of Virology University of Cologne Cologne Germany\n3 Department of General, Visceral and Cancer Surgery, University Hospital of Cologne University of Cologne Cologne Germany\n* Correspondence Christine Kurschat, Department II of Internal Medicine, University Hospital of Cologne, Kerpenerstraße 62, 50931, Cologne, Germany. \nEmail: christine.kurschat@uk-koeln.de\n\nPatrick Affeldt and Veronica Di Cristanziano contributed equally to this work.\n\n08 2 2021\n6 2021\n9 2 10.1002/iid3.v9.2 513520\n06 1 2021\n03 12 2020\n22 1 2021\n© 2021 The Authors. Immunity, Inflammation and Disease published by John Wiley & Sons Ltd.\nhttps://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.\n\nAbstract\n\nBackground\n\nRecently, chronic hepatitis E virus (HEV) infections gained increasing attention as a possible cause for elevated liver enzymes of unknown origin and liver cirrhosis in solid organ transplant recipients. Reduction of immunosuppressive therapy and/or use of antiviral drug ribavirin have been established as possible treatment strategies.\n\nMethods\n\nThe efficacy of dose reduction of mycophenolic acid (MPA) and ribavirin therapy was retrospectively analyzed in eight renal transplant patients of our outpatient clinic who were diagnosed with HEV infection by detection of specific antibodies (immunoglobulin M and immunoglobulin G) and/or positive RNA in blood and stool. In four patients serial HEV viral loads in blood were measured.\n\nResults\n\nOnly one patient reached HEV clearance after reduction of immunosuppressive therapy (predominantly reduction of MPA daily dose) alone, whereas six patients were treated with ribavirin after reduction of immunosuppressive therapy due to persistent virus replication. Four of six patients reached HEV clearance after 3 months of ribavirin therapy. HEV clearance was observed after 34–42 days. Two patients, both treated with rituximab within the last 12 months before diagnosis of HEV infection, needed prolonged ribavirin therapy due to persistent viral replication.\n\nConclusion\n\nReduction of daily dose of MPA therapy alone in transplant patients with chronic HEV infection may not be sufficient to control viral replication. HEV clearance under ribavirin therapy shows interindividual variability. Therefore, serial viral monitoring may be useful to personalize treatment duration. Rituximab therapy is a risk factor for complicated‐to‐treat chronic HEV infection.\n\nGraphical abstract\n\nIn this article, hepatitis E virus (HEV) infections in renal transplant recipients were examined. Serial measurements of HEV‐RNA are helpful to determine the optimal duration of ribavirin treatment. We identified previous rituximab treatment to be a risk factor for a prolonged treatment course.\n\nchronic HEV infection\nELISPOT\nribavirin\nrituximab\nserial HEV RNA monitoring\nSOT\nKoeln Fortune source-schema-version-number2.0\ncover-dateJune 2021\ndetails-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.0.2 mode:remove_FC converted:17.05.2021\nAffeldt P , Di Cristanziano V , Grundmann F , et al. Monitoring of hepatitis E virus RNA during treatment for chronic hepatitis E virus infection after renal transplantation. Immun Inflamm Dis. 2021;9 :513–520. 10.1002/iid3.411\n==== Body\n1 INTRODUCTION\n\nElevated liver enzymes as a marker of liver injury in patients without any known preexisting liver disease are a frequent finding in renal transplant recipients. 1 The etiology of liver injury in those patients is heterogeneous and includes bacterial, fungal, and viral infections as well as noninfectious causes like drug toxicity or malignancies. 1 , 2\n\nRecently, hepatitis E virus (HEV) infection gained increasing attention as a possible cause for hepatitis. Within the general population in Germany, HEV specific IgG can be detected in 16.8%. 3 Among immunocompetent patients, HEV infections usually lead to an acute self‐limiting hepatitis and only few cases of chronic infections have been described. 4 Therefore, a specific treatment is not necessary in the vast majority of patients. In contrast, chronic courses of HEV (genotype 3) infection with up to 10% of rapid development of liver cirrhosis can occur in immunosuppressed patients 4 , 5 , 6 having undergone solid organ transplantation. Chronic hepatitis E infection poses a significant risk to patients and graft survival, respectively, and—due to the lack of an approved therapy—a challenge to the counseling physicians.\n\nAs a first line treatment approach, the reduction of immunosuppressive therapy has been established. According to the literature, up to 30% of HEV‐infected patients show a spontaneous clearance of HEV after reduction of immunosuppression at a follow up of 6 months. 6 In the absence of spontaneous clearance, the treatment option of choice is ribavirin, 7 resulting in HEV clearance after 3 months in up to 78%–100% of patients. 4 , 7 , 8 However, ribavirin therapy carries the risk of adverse effects, such as anemia due to bone marrow toxicity. 7 , 9\n\nThe appropriate treatment of HEV infection in immunosuppressed patients remains controversial, mostly due to the lack of controlled trials and overall small numbers of cases. 4\n\nThe present case series is focused on immunosuppressed patients which have been tested positive for HEV within 3 years following kidney transplantation. The aim is to share our experience of treatment options regarding mycophenolic acid (MPA) dose reduction as well as ribavirin therapy and possible risks factors for initial treatment failure.\n\n2 MATERIALS AND METHODS\n\nAll kidney transplant recipients testing positive for HEV (positive immunoglobulin M [IgM] and immunoglobulin G [IgG] and/or positive RNA) in clinical routine diagnostics obtained at the outpatient clinic of Department of Nephrology of the University Hospital of Cologne, Germany, between January 2016 and March 2020 were included in this case series. Demographic and clinical data as well as laboratory markers (e.g., for kidney function and liver injury), HEV specific antibodies (IgM and IgG), and HEV‐RNA load in blood and stool by real‐time PCR (polymerase chain reaction) were summarized. Treatment decisions including the reduction of immunosuppressive therapy or initiation of antiviral therapy with ribavirin are reported. All parameters were examined in clinical routine care for patients and were summarized retrospectively. Patients showing a HEV viremia persisting for more than 3 months were considered as chronically infected. 10\n\n2.1 HEV diagnostics\n\nSpecific HEV IgM and IgG were detected using the recomLine HEV IgG/IgM immunoassay (Mikrogen diagnostic), according to the manufacturer's instructions. HEV‐RNA detection in blood and stool was performed using the RealStar HEV RT‐PCR Kit 2.0 (Altona), according to the manufacturer's instructions.\n\n2.2 Statistical analyses\n\nData are reported as medians (interquartile range [IQR]), or frequencies (n [% of total]). Thereafter, to determine significant changes in HEV‐RNA blood levels a Wilcoxon matched pairs signed rank test was performed for HEV‐RNA blood levels, lymphocyte, and leucocyte count before and after modification of immunosuppressive therapy. A Spearman correlation was performed for correlation between lymphocyte count an HEV‐RNA blood levels. All statistical testing was two‐sided and a p < .05 was considered significant. All analyses were performed using SPSS (Statistical Package for Social Sciences, SPSS Inc., version 24.1) software.\n\n3 RESULTS\n\nAll eight patients were male and had a history of elevated liver enzymes, which lead to further laboratory diagnostics and diagnosis of chronic HEV infection.\n\nThe median age at time of diagnosis was 57.5 years (25–69 years) (Table 1). One patient died 2 weeks after diagnosis of HEV infection and subsequent reduction of immunosuppressive therapy due to liver failure caused by hepatocellular carcinoma and liver cirrhosis of undetermined cause (patient no. 8). In the remaining seven patients, the median time between date of transplantation and diagnosis of HEV infection was 33 months (IQR: 46 months).\n\nTable 1 Patient baseline characteristic\n\n\tn = 8\t\nMale sex, no%\t100\t\nAge, years\t58.5 (25–69)\t\nImmunosuppressive regime\t\t\nTriple with tacrolimus\t8\t\nTriple with cyclosporine A\t0\t\nDual with tacrolimus\t0\t\nDual with cyclosporine A\t0\t\nmTor Inhibitor, MPA, Steroid\t0\t\nTacrolimus median plasma levels (µg/dl)\t5.9\t\nInduction therapy\t\t\nBasiliximab (d0, d4)\t8\t\nLymphocyte depleting agents\t0\t\nLiver enzyme elevation at time of first positive HEV‐PCR measurement\t\t\nALT (ref.: male, <41 U/l\t8\t\nAST (ref.: male, <50 U/l)\t8\t\nɣGT (ref.: male 8–61 U/l)\t8\t\nTime between transplantation and first HEV‐RNA measurement, months (IQR)\t33 (46)\t\nAbbreviations: ALT, alanine aminotransferase; AST, aspartate aminotransferase; ɣGT, gamma‐glutamyl transpeptidase; HEV, hepatitis E virus; IQR, interquartile range; MPA, mycophenolic acid.\n\nJohn Wiley & Sons, Ltd.\n\nThe source and etiology of HEV infection in six of eight patients remained unclear. Two patients (no. 3 and 7) were huntsmen and had a history of eating self‐hunted venison. All patients except patient no. 3, showed positive IgM and IgG response to HEV. Patient no. 3 had received rituximab 5 months before an AB0‐incompatible living donor kidney transplantation and did not show serologic immune reactivity against HEV despite positive PCR results. In contrast, patient no. 4 had developed a serologic immune reactivity 12 months after having received rituximab due to recurrence of his underlying renal disease (pauci‐immune glomerulonephritis).\n\nAt the time of diagnosis, all patients were treated with a triple immunosuppressive therapy, including tacrolimus, MPA and prednisone (Table 1). All patients received basiliximab as induction therapy on Days 0 and 4. In addition patient no. 3 was treated with immunoadsorption and rituximab before transplantation. Before reduction of immunosuppressive therapy, median HEV‐RNA plasma copy numbers were 1.47E+06 IU/ml (IQR: 1.16E+09 IU/ml) (Table 2). In two patients, initial HEV viremia was not quantified as the diagnosis was initially established in an external outpatient clinic (no. 5 and 6).\n\nTable 2 HEV‐RNA blood levels, leucocyte, and lymphocyte count before and 3 months after reduction of immunosuppressive therapy\n\n\tBefore IS reduction\t\tAfter IS reduction\t\t\t\n\tHEV‐RNA IU/ml\tLeucocytes (Lymphocytes)\tHEV‐RNA IU/ml\tLeucocytes (lymphocytes)\tMPA dose reduction %\t\nPatient 1\t2.06E+06\t13.00 × 10E9/L (1,00 × 10E9/L)\t2.86E+05\t13.00 × 10E9/L (0.91 × 10E9/L)\t25\t\nPatient 2\t1.84E+06\t7.16 × 10E9/L (2.36 × 10E9/L)\t6.22E+05\t6.1 × 10E9/L (1.82 × 10E9/L)\t50\t\nPatient 3\t9.00E+03\t3.28 × 10E9/L (0.98 × 10E9/L\t2.49E+03\t2.93 × 10E9/L (0.74 × 10E9/L)\t50\t\nPatient 4\t7.16E+05\t5.10 × 10E9/L (0.86 × 10E9/L)\t2.57E+05\t5.1 × 10E9/L (0.49 × 10E9/L)\t25\t\nPatient 5\t§\t§\t§\t§\t100\t\nPatient 6\t§\t12.43 × 10E9/L (1.27 × 10E9/L)\t§\t11.24 × 10E9/L (0.95 × 10E9/L)\t50\t\nPatient 7\t1.09E+06\t7.07 × 10E9/L (1.2 × 10E9/L)\t0\t11.09 × 10E9/l (4.57 × 10E9/L)\t50\t\nPatient 8\t4.62E+09\t1.09 × 10E9/L (0.05 × 10E9/L)\t‡\t‡\t100\t\nMedian (IQR)\t1.47E+06 (1.16E+09)\t\t2.57E+05 (4.53E+05)\t\t\t\nSig. (2‐tailed)\"\t\t\t0.028\t0.75 (0.345)\t\t\nNote: ‡Patient no. 8 died before finishing the 3‐month interval; §HEV‐RNA levels, leucocyte, and lymphocyte counts were missing because of external diagnostic and later on treatment initiation in our clinic.\n\nAbbreviations: IQR, interquartile range; IS, immunosuppressive therapy; MPA, mycophenolic acid; Sig., two tailed significance of spearman correlation.\n\nJohn Wiley & Sons, Ltd.\n\nThe median plasma level of tacrolimus at time of diagnosis was 5.9 (3.4–11.2) µg/L (Table 1). Upon diagnosis, the daily dose of tacrolimus was initially reduced in patient no. 2 because of modification of target trough level. Patient no. 5 received a dose reduction of tacrolimus because of elevated serum levels (11.2 mg/dl). In all HEV‐infected patients, as a first step of HEV treatment, MPA therapy was reduced (minimum reduction to 25% of the initial dose) at time of diagnosis. In one patient (no. 5), MPA was initially lowered to 50% of the initial dose for 3 months and then discontinued for the following 3 months.\n\nAfter reduction of immunosuppressive therapy, viral load in blood and stool was monitored for at least 3 months. After 3 months, HEV‐RNA was cleared in one patient (no. 7) only. Three to five months after reduction of immunosuppressive therapy, the median HEV‐RNA plasma level decreased from 1.47E+06 to 2.27E+05 IU/ml. There was no patient with an increase in HEV‐RNA plasma level after this therapy adjustment. Decline in HEV‐RNA plasma levels before and after reduction of immunosuppressive therapy was significant (p = .028) (Table 2). Total count of lymphocytes and leucocytes before and after reduction of immunosuppressive therapy was measured (Table 2). Neither total lymphocytes nor leucocytes count changes were significant (leucocytes p = .198, lymphocytes p = .068). Total lymphocyte count before and after reduction of immunosuppressive therapy was not significant correlated to HEV‐RNA plasma levels before and after reduction of immunosuppressive therapy (p = .313).\n\nOnly patient no. 7 reached HEV clearance after reduction of immunosuppressive therapy alone, patient no. 8 died within 2 weeks from liver cancer not related to HEV infection. Since a high viral load was still present even after reduction of immunosuppressive therapy in the remaining six patients, they were started on ribavirin therapy with a dose adjusted to their renal function. The median ribavirin dose was 300 mg per day (200–800 mg) (Table 3), 800 mg of ribavirin were administered in only one patient (no. 2).\n\nTable 3 Ribavirin therapy\n\n\tRibavirin initial dose (mg/dl)\tChange of ribavirin daily dose due to anaemia (%)\tSerum creatinine at start of ribavirin treatment (mg/dl)\teGFR at start of ribavirin treatment (ml/min)\tTime to first negative blood HEV‐PCR (days)\tHEV clearance after 3 months of ribavirin therapy\t\nPatient 1\t300\tnr\t1.83\t44\t34\tyes\t\nPatient 2\t800\t75%\t1.47\t77\t42\tyes\t\nPatient 3\t250\tnr\t1.53\t50\t254\tno\t\nPatient 4\t200\tnr\t3.13\t21\t†\tno\t\nPatient 5\t300\tnr\t1.63\t45\tnm\tyes\t\nPatient 6\t400\tnr\t1.26\t67\tnm\tyes\t\nmedian\t300\t\t1.58\t47.5\t\t\t\nNote: Patient no. 3 (CMV coinfection) reached HEV clearance after 9 months of ribavirin therapy. †Patient no. 4 is still on therapy after 7 months of treatment. †No HEV clearence after 7 months of ribavirin therapy.\n\nAbbreviations: CMV, cytomegalovirus; GFR, glomerular filtration rate (CKD‐EPI) in ml/min; HEV, hepatitis E virus; nm, no measurement of HEV‐PCR within the first 3 months; nr, no reduction of ribavirin daily dose.\n\nJohn Wiley & Sons, Ltd.\n\nSeveral adverse drug reactions were observed. The only patient on 800 mg ribavirin starting dose required a dose reduction during the course of the treatment because of anemia due to ribavirin‐induced bone marrow toxicity. After gradual dose reduction to 200 mg, anemia resolved to normal hemoglobin levels (Table 3). Patient no. 3 also suffering from concomitant cytomegalovirus (CMV) infection developed pancytopenia likely caused by added effects of CMV infection as well as MPA and valganciclovir medication. MPA therapy was discontinued, ribavirin was halted for 2 weeks. After resolution of pancytopenia, ribavirin therapy was restarted, and a stable blood count was observed. In the remaining four patients, no severe side effects requiring dose reduction or pausing of ribavirin therapy were observed (Table 3). Because of the CMV‐coinfection, the specific cellular immune response to CMV was measured by T‐SPOT. CMV (Oxford Immunotec) in patient no. 3. Two months before diagnosis of HEV infection, the ELISPOT (Enzyme Linked Immuno Spot) has shown a good functionality of T cell activity.\n\nIn four patients (no. 1, 2, 3, and 4), HEV‐RNA plasma levels were repeatedly measured during the course of ribavirin therapy (Table 4 and Figure 1). In those patients (no. 1 and 2) with successful controlled virus replication after 12 weeks, HEV clearance was achieved after 34 and 42 days, respectively. After 12 weeks of ribavirin therapy, complete HEV clearance in blood and stool was observed in four of six patients (patients no. 1, 2, 5, and 6). In these four patients, liver enzyme values returned to normal levels within 6 months after completion of ribavirin therapy, indicating stable HEV clearance. Patient no. 3 with concomitant CMV infection did not reach HEV clearance after 3 months of ribavirin therapy. Therefore, duration of ribavirin therapy was prolonged to 9 months, till HEV clearance was achieved. In the other patient (no. 4) who did not reach HEV clearance after 3 months of therapy, HEV plasma levels increased from 7.15 E+03 IU/ml (start of ribavirin therapy) to 4.68 E+04 IU/ml after 9 months of ribavirin therapy. Patient no. 4 has not reach HEV clearance yet and is still under ribavirin therapy at the time of writing of this manuscript (August 2020). Both patients not having achieved HEV clearance after 3 months of ribavirin therapy had a history of rituximab therapy within the last 12 months due to AB0‐incompatible living donor kidney transplantation (no. 3) or recurrence of the underlying renal disease (pauci‐immune glomerulonephritis) (no. 4).\n\nFigure 1 HEV‐RNA in blood under ribavirin therapy. Measured HEV‐RNA IU/ml in blood for every patient. day: day of ribavirin therapy. HEV, hepatitis E virus\n\nTable 4 HEV‐RNA in blood under ribavirin therapy\n\nPatient no. 1\tDay\tHEV‐RNA IU/ml\tPatient no. 3\tDay\tHEV‐RNA IU/ml\t\n\t0\t286,000\t\t0\t2490\t\n\t34\t0\t\t81\t430,000\t\n\t90\t0\t\t124\t118,000\t\n\t\t\t\t160\t30,700\t\n\t\t\t\t192\t174,000\t\n\t\t\t\t254\t0\t\nPatient no. 2\tDay\tHEV‐RNA IU/ml\tPatient no. 4\tDay\tHEV‐RNA IU/ml\t\n\t0\t119,000\t\t0\t7150\t\n\t23\t31,200\t\t49\t682\t\n\t38\t21\t\t159\t15,000\t\n\t42\t0\t\t221\t46,800\t\nNote: Measured HEV‐RNA IU/ml in blood for every patient, day: day of ribavirin therapy.\n\nAbbreviation: HEV, hepatitis E virus.\n\nJohn Wiley & Sons, Ltd.\n\n4 DISCUSSION\n\nIn this case series, we describe our experience in treatment of chronic HEV infection in kidney transplant recipients visiting the nephrology outpatient clinic. Spontaneous HEV clearance after reduction of immunosuppressive therapy was achieved in one patient only. The majority of patients were thus treated with ribavirin therapy adjusted for kidney function. This treatment approach was able to control infection with only moderate side effects. In only one patient dose reduction was needed because of ribavirin induced anemia. 11 After dose reduction of ribavirin therapy, anemia resolved to normal Hb levels and the patient gained HEV clearance after 3 months of therapy. In general, ribavirin induced anemia can be treated with epoetin substitution and thus increase tolerability of ribavirin therapy. 12\n\nOverall, our findings agree with previous evidences concerning gender (mainly male) and source of infection (mainly unknown). All eight patients in our center were of male gender, which is in line with previous findings, as male sex seems to be a risk factor for HEV infection for so far unknown reasons. 2 In two of the patients, HEV infection was associated with eating venison meat. Similar ways of infection have been described before. 4 , 5 , 13\n\nIn one patient, HEV diagnosis was delayed because of missing serologic immune response due to rituximab therapy and immunosuppression in preparation of an AB0‐incompatible living donor kidney transplantation. Such missing serologic response in HEV infections has already been described. 3 , 14 This case highlights the necessity to include PCR testing in addition to serological tests for the diagnosis of HEV infection in patients under immunosuppression presenting with unclear elevation of liver enzymes. 4 , 6 , 10\n\nPrevious studies described HEV clearance in up to 30% of patients following reduction of immunosuppression. 6 Kamar et al. 15 proposed a reduction of tacrolimus trough levels rather than modification of MPA daily dose. According to our internal clinical standard for virus infections, we primary reduced MPA daily dose to get control over viral replication. In this retrospective case series, reduction of MPA daily dose did not lead to spontaneous HEV clearance in most patients, although a significant reduction of HEV viremia was observed. Neither total leukocyte nor total lymphocyte count has changed significantly. In other immunosuppressed cohorts, like allogeneic hematopoietic stem cell transplant recipients, reduction of immunosuppressive therapy was associated with increase of mortality. 16\n\nIn four of our patients, HEV‐RNA blood levels were repeatedly measured during ribavirin therapy. HEV clearance was obtained in the three patients after 34, 42, and 254 days (including 2 weeks of therapy interruption in patient no. 3), respectively (Figure 1 and Table 4). One patient did not reach HEV clearance at the time of writing this manuscript. In the literature there is no clear recommendation for optimal therapy duration due to the heterogeneity of time to archiving HEV clearance. 15 Overall, 4 out of 6 (67%) patients treated with ribavirin for 3 months obtained HEV clearance. This finding is in line with previous observations, showing more than 80% of viral clearance after 3 months of antiviral treatment with ribavirin. 2 , 8 , 9\n\nPrevious studies already identified risk factors for treatment failure of chronic HEV infection. Immunosuppressive therapy with tacrolimus instead of cyclosporine A 6 and a low lymphocyte count at therapy initiation 7 have been shown to be associated with a decreased response to therapy. All patients that are described in this case series were on medication with tacrolimus. In our case series 4 out of 6 patients archived HEV clearance after 12 weeks of ribavirin therapy. Those patients with initial treatment failure after 12 weeks of therapy both received rituximab because of AB0‐incompatible living donor kidney transplantation or recurrence of underlying renal disease. There are several case reports discussing the possible impact of rituximab concerning treatment failure of ribavirin therapy for other immunosuppressed patients. 17 , 18 Concerning renal transplant recipients, only one case series in the field discussed the risk for difficult to treat HEV infection after rituximab therapy. 19\n\n5 CONCLUSION\n\nIn the present investigation on renal transplant recipients affected from chronic HEV infection, a reduction of MPA therapy alone for 3 months was not sufficient to control viral replication.\n\nDose reduction of MPA appears to result in less viral clearance from reduction of the immunosuppressive therapy alone than reported elsewhere. 15 Controlled trials are warranted, and tacrolimus trough level reduction may be more effective.\n\nToday, most kidney transplanted patients receive tacrolimus medication. 20 Taking into account that tacrolimus therapy seems to be a risk factor for treatment failure, 6 early ribavirin therapy should be evaluated in every patient. In addition reduction of immunosuppressive therapy in other immunosuppressed patients was associated with an increase of mortality. 16\n\nConcerning optimal duration of ribavirin therapy, controlled trials are still warranted. 15 As we could show, time to HEV clearance seems to be variable within a large range. In our case series, a minimum of 41 days between first occurred negative PCR for HEV‐RNA in blood and end of ribavirin therapy (patient no. 2) was sufficient to lead to stable HEV clearance. Therefore, we suggest to repeatedly measure HEV‐RNA in stool and blood during ribavirin therapy to define an individual duration of treatment. Controlled trails for optimal duration of ribavirin therapy after negative HEV‐RNA PCR in blood are missing.\n\nIn our case series, all patients with initial treatment failure of ribavirin therapy received rituximab within the last year. Therefore, previous rituximab therapy should be noted as a possible risk factor for complicate‐to‐treat HEV infections even if in the presence of an apparently functioning cellular immune response.\n\nCONFLICT OF INTERESTS\n\nThe authors declare that there are no conflict of interests.\n\nAUTHOR CONTRIBUTIONS\n\nPatrick Affeldt, Veronica Di Cristanziano, Martin Kann, Maike Wirtz, and Christine Kurschat performed the research and collected the data. Patrick Affeldt, Veronica Di Cristanziano, Martin Kann, and Christine Kurschat designed the research study. Patrick Affeldt and Veronica Di Cristanziano analyzed the data. Patrick Affeldt, Veronica Di Cristanziano, Franziska Grundmann, Rolf Kaiser, Thomas Benzing, Martin Kann, and Christine Kurschat wrote the paper.\n\nETHICS STATEMENT\n\nData were collected as part of routine clinical diagnostics. The ethics committee agreed on analyzing data within this project (EK 20‐1313).\n\nACKNOWLEDGMENT\n\nThe present study was supported by the Koeln Fortune Program of the Faculty of Medicine of the University of Cologne (Germany) to Veronica Di Cristanziano. Open Access funding enabled and organized by ProjektDEAL.\n\nDATA AVAILABILITY STATEMENT\n\nThe data that support the findings of this study are available from the corresponding author upon reasonable request.\n==== Refs\nREFERENCES\n\n1 Einollahi B , Ghadian A , Ghamar‐Chehreh E , Alavian SM . Non‐viral related liver enzymes elevation after kidney transplantation. Hepat Mon. 2014;14 (2 ):e9036. 10.5812/hepatmon.9036 24693313\n2 Choi M , Hofmann J , Köhler A , et al. Prevalence and clinical correlates of chronic hepatitis E Infection in german renal transplant recipients with elevated liver enzymes. Transplant Direct. 2018;4 (2 ):e341. 10.1097/TXD.0000000000000758\n3 Faber MS , Wenzel JJ , Jilg W , Thamm M , Höhle M , Stark K . Hepatitis E virus seroprevalence among adults, Germany. Emerging Infect Dis. 2012;18 (10 ):1654‐1657. 10.3201/eid1810.111756\n4 Kamar N , Izopet J , Pavio N , et al. Hepatitis E virus infection. Nat Rev Dis Primers. 2017;3 (1 ):17086. 10.1038/nrdp.2017.86 29154369\n5 Kamar N , Selves J , Mansuy J‐M , et al. Hepatitis E virus and chronic hepatitis in organ‐transplant recipients. N Engl J Med. 2008;358 (8 ):811‐817. 10.1056/nejmoa0706992 18287603\n6 Kamar N , Abravanel F , Selves J , et al. Influence of immunosuppressive therapy on the natural history of genotype 3 hepatitis‐E virus infection after organ transplantation. Transplantation. 2010;89 (3 ):353‐360. 10.1097/TP.0b013e3181c4096c 20145528\n7 Kamar N , Izopet J , Tripon S , et al. Ribavirin for chronic hepatitis E virus infection in transplant recipients. N Engl J Med. 2014;370 (12 ):1111‐1120. 10.1056/NEJMoa1215246 24645943\n8 Yoshida T , Takamura M , Goto R , et al. Efficacy and safety of ribavirin therapy for chronic hepatitis E after kidney transplantation. Hepatol Res. 2019;49 (10 ):1244‐1248. 10.1111/hepr.13363 31077507\n9 Friebus‐Kardash J , Eisenberger U , Ackermann J , et al. Prevalence of active hepatitis E virus infection and efficacy of ribavirin treatment in renal allograft recipients. Tranpl Infect Dis. 2019;21 (3 ):e13088. 10.1111/tid.13088\n10 Dalton HR , Kamar N , Baylis SA , Moradpour D , Wedemeyer H , Negro F . EASL Clinical practice guidelines on hepatitis E virus infection. J Hepatol. 2018;68 (6 ):1256‐1271. 10.1016/j.jhep.2018.03.005 29609832\n11 Wu LS , Jimmerson LC , MacBrayne CE , Kiser JJ , D'Argenio DZ . Modeling ribavirin‐induced anemia in patients with chronic hepatitis C virus. CPT Pharmacometrics Syst Pharmacol. 2016;5 (2 ):65‐73. 10.1002/psp4.12058 26933517\n12 Dieterich DT , Wasserman R , Brau N , et al. Once‐weekly epoetin alfa improves anemia and facilitates maintenance of ribavirin dosing in hepatitis C virus‐infected patients receiving ribavirin plus interferon alfa. Am J Gastroenterol. 2003;98 (11 ):2491‐2499. 10.1111/j.1572-0241.2003.08700.x 14638354\n13 Dalton HR , Bendall R , Ijaz S , Banks M . Hepatitis E: an emerging infection in developed countries. Lancet Infect Dis. 2008;8 (11 ):698‐709. 10.1016/s1473-3099(08)70255-x 18992406\n14 Legrand‐Abravanel F , Kamar N , Sandres‐Saune K , et al. Hepatitis E virus infection without reactivation in solid‐organ transplant recipients. France. 2011;17 (1 ):30‐37. 10.3201/eid1701.100527\n15 Kamar N , Abravanel F , Behrendt P , et al. Ribavirin for hepatitis E virus infection after organ transplantation: a large european retrospective multicenter study. Clin Infect Dis. 2019;71 :1204‐1211. 10.1093/cid/ciz953\n16 von Felden J , Alric L , Pischke S , et al. The burden of hepatitis E among patients with haematological malignancies: a retrospective European cohort study. J Hepatol. 2019;71 (3 ):465‐472. 10.1016/j.jhep.2019.04.022 31108159\n17 Fraticelli P , Bagnarelli P , Tarantino G , et al. Chronic hepatitis E in a patient treated with rituximab and mycophenolate mofetil for Sjögren's syndrome. Rheumatology. 2016;55 (12 ):2275‐2277. 10.1093/rheumatology/kew282 27498353\n18 Verhoeven F , Weil‐Verhoeven D , Di Martino V , Prati C , Thevenot T , Wendling D . Management of acute HVE infection in a patient treated with rituximab for rheumatoid arthritis. Joint Bone Spine. 2016;10/01/2016 83 (5 ):577‐578. 10.1016/j.jbspin.2015.11.010 27055728\n19 Schulz M , Biedermann P , Bock C‐T , et al. Rituximab‐containing treatment regimens may imply a long‐term risk for difficult‐to‐treat chronic hepatitis E. Int J Environ Res Public Health. 2020;17 (1 ):341. 10.3390/ijerph17010341\n20 Lim MA , Kohli J , Bloom RD . Immunosuppression for kidney transplantation: where are we now and where are we going? Transplant Rev (Orlando). 2017;31 (1 ):10‐17. 10.1016/j.trre.2016.10.006 28340885\n\n",
"fulltext_license": "CC BY",
"issn_linking": "2050-4527",
"issue": "9(2)",
"journal": "Immunity, inflammation and disease",
"keywords": "ELISPOT; SOT; chronic HEV infection; ribavirin; rituximab; serial HEV RNA monitoring",
"medline_ta": "Immun Inflamm Dis",
"mesh_terms": "D016751:Hepatitis E; D016752:Hepatitis E virus; D006801:Humans; D016030:Kidney Transplantation; D012367:RNA, Viral; D012189:Retrospective Studies",
"nlm_unique_id": "101635460",
"other_id": null,
"pages": "513-520",
"pmc": null,
"pmid": "33559399",
"pubdate": "2021-06",
"publication_types": "D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't",
"references": "31077507;29154369;29609832;21192851;29464202;18992406;31947836;26933517;24693313;24645943;20145528;18287603;31108159;31793638;27055728;30929308;23018055;27498353;33559399;28340885;14638354",
"title": "Monitoring of hepatitis E virus RNA during treatment for chronic hepatitis E virus infection after renal transplantation.",
"title_normalized": "monitoring of hepatitis e virus rna during treatment for chronic hepatitis e virus infection after renal transplantation"
} | [
{
"companynumb": "DE-ACCORD-218092",
"fulfillexpeditecriteria": "1",
"occurcountry": "DE",
"patient": {
"drug": [
{
"actiondrug": "5",
"activesubstance": {
"activesubstancename": "TACROLIMUS"
},
"drugadditional": "3",
"druga... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.