pmid stringlengths 8 8 | pmcid stringlengths 8 11 ⌀ | source stringclasses 2
values | rank int64 1 9.78k | sections unknown | tokens int64 3 46.7k |
|---|---|---|---|---|---|
39885178 | PMC11782484 | pmc | 9,391 | {
"abstract": "We propose a network architecture for electronic skin with an extensive sensor array—crucial for enabling robots to perceive their environment and interact effectively with humans. Fault tolerance is essential for electronic skins on robot exteriors. Although self-healing electronic skins targeting minor damages are studied using material-based approaches, substantial damages such as severe cuts necessitate re-establishing communication pathways, traditionally performed with high-functionality microprocessor sensor nodes. However, this method is costly, increases latency, and boosts power usage, limiting scalability for large, nuanced sensation-mimicking sensor arrays. Our proposed system features sensor nodes consisting of only a few dozen logic circuits, enabling them to autonomously reconstruct reading pathways. These nodes can adapt to topological changes within the sensor network caused by disconnections and reconnections. Testing confirms rapid reading times of only a few microseconds and power consumption of 1.88 μW/node at a 1 kHz sampling rate. This advancement significantly boosts robots’ collaborative potential with humans.",
"introduction": "Introduction For robots to comprehend their surroundings and collaborate effectively with humans 1 , 2 and to physically interact with them 3 – 6 , the utilization of electronic skin (e-Skin) equipped with extensive sensor arrays is essential. These arrays help the robot discern the environment and gauge the state and intentions of human counterparts. Achieving this requires scalable sensor networks that can densely cover large areas and rapidly process data. Such networks ideally expand to thousands of nodes, with response times in the order of milliseconds, comparable to the human hand which contains approximately 17,000 mechanoreceptors 7 . The control cycles of robots rely on sensor readout times, necessitating response times ranging from several to tens of milliseconds 8 . Recent efforts are directed toward scalable and rapid sensor networks, particularly those emulating neural functions 9 – 12 . However, in the practical application of e-Skin, resilience against faults remains a significant challenge. Externally mounted e-Skins are prone to damage from external forces, impacts, or degradation due to repeated bending. Current research is advancing in self-healable materials for wiring and structural elements 13 , such as liquid metal 14 , iontronic materials 15 , and nanofiber–polymer composites 16 . These technologies, however, primarily address minor damages. Significant damages might necessitate alternative functional recovery methods, such as changes in communication routing. For instance, in matrix-type sensor arrays 17 – 19 , wiring damage can prevent the readout of downstream sensors. Drawing inspiration from neuroplasticity in biological systems 20 , 21 , similar functionality is essential for e-Skins. Investigation of serial sensor networks demonstrates resilience against limited cuts through zigzag configurations 9 , 22 Compared with matrix-type sensors, this design offers more locations that are resistant to disconnection, which is advantageous. Nevertheless, ideal fault modes may not always occur in real-world applications. Dynamic re-routing protocols that are robust, durable, and capable of high-speed operation (50 ms, with 204 nodes) have been proposed 23 , 24 . In addition, technology has been proposed where each node autonomously and distributively routes packet transmission paths 25 , 26 . Derived from advancements in internet technologies such as link-state routing (e.g., OSPF 27 ) and distance-vector routing (e.g., DSDV 28 , SGF 29 ), these methods assume that each node possesses substantial processing power and memory. Consequently, this increases cost, power consumption, and size per node. Therefore, scaling these technologies to sensor networks comprising thousands of nodes presents a significant challenge. A network architecture with minimal circuitry capable of dynamic rerouting needs to be developed, while not necessitating high computational demands, to attain resilience against extensive damage. Additionally, the necessity for this rerouting functionality arises from another perspective. The considerable expense associated with e-Skin, attributed to integrating numerous sensors, is expected to impede future advancements 30 . Furthermore, the design of the robot system and the types of sensors employed may necessitate custom shapes and sensor layouts, which are often three-dimensional. Resorting to specialized production lines could constrain the benefits of mass production, thereby potentially exacerbating cost increments. Such factors present a substantial obstacle to the broad-scale adoption of robots equipped with densely packed e-Skins. Although research aims to increase the adaptability of e-Skins with stretchable materials 31 , 32 , limitations persist. A promising solution involves e-Skins embedded within sheet-shaped sensor networks that can be freely cut or combined, allowing for mass production and cost reduction. This necessitates a network architecture that can dynamically re-route with minimal circuitry. A review of network architectures, as outlined in Supplementary Table 1 , shows their flexibility, re-routing capabilities, and robustness. Several existing designs require large processing power, limiting scalability and increasing costs. Considering these aspects, this study presents an architecture for reroutable sensor networks based on serial configurations. This architecture allows for the construction of serial, single-stroke readout paths adaptable to any network shape, ensuring all sensors remain readable provided that one pathway remains intact (illustrated in Fig. 1 ). Complex shapes, such as hand and its palm, sensor sheets can be formed by assembling or cutting e-Skin sheets. The sensors in this study were constructed with merely tens of logic circuits, facilitating high-speed operation, low power consumption, and miniaturization without need processors. Nodes operate autonomously using local information. Our prototype demonstrated readout times in the order of microseconds and power consumption of 1.88 µW/node at a 1 kHz sampling rate. Re-routing time is proportional to the number of nodes multiplied by the sampling rate, essentially unrestricted by node count. In addition, demonstrations included adapting to three-dimensional assembly by combining multiple planar sheets and making cuts using scissors. To our knowledge, this represents the smallest circuit scale for an autonomous, distributed, self-re-routing sensor network. Fig. 1 Concept diagram of an autonomously re-routable sensor network. The network adaptively reconstructs readout paths in response to wire severances or connections between multiple networks, facilitating the creation of highly fault-tolerant systems and e-skins that seamlessly conform to complex shapes.",
"discussion": "Discussion The sensor network circuit proposed in this study facilitated the creation of versatile e-Skin products that can be tailored to different robots by cutting and assembling them into multiple shapes. Each node in this network exhibited a readout time of the order of microseconds, with power consumption in the range of several microwatts at a 1 kHz sampling rate. This efficiency allowed the network to scale up to large arrays with thousands of nodes while maintaining millisecond-order response times and milliwatt-order power consumption. Such scalability is a significant improvement over conventional routing methods that depend on high-functionality processors, which this self-routing sensor network circuit does not require. It is important to consider the practical scalability limitations of our sequential time-pulsed readout architecture. The total readout time increases linearly with the number of nodes, posing practical constraints, especially when real-time or high-speed readout is required. However, issues such as timing jitter and pulse broadening, which cause scalability constraints in conventional architectures, are not problematic in our design. This is because we maintain signal quality by regenerating signals at each node using digital logic. The circuit’s design is notably straightforward. For instance, the grid-type sensor array’s node circuit comprised only 71 logic circuit ICs. This was considerably fewer than even small, low-functionality processor cores, similar to the ARM Cortex-M0 core, which contains 12,000 gates 33 . Additionally, as the circuit was designed using commercially available discrete ICs, further optimization is feasible if it transitions to an application-specific integrated circuit (ASIC); this potentially enables the configuration of circuits with fewer logic components and drastically reduces power consumption (see Supplementary Note 1 ). As shown in Supplementary Table 5 , our architecture offers performance advantages, including scalability with linear readout time increases relative to the node number, rapid sampling times in the microsecond range, and a low-cost design with minimal circuitry. These features suggest an improvement in efficiency and practicality over previously reported architectures. Sensor density is crucial in estimating the overall power consumption. The sensor density requirements vary depending on the application and the level of tactile resolution required. For example, human skin has varying mechanoreceptor densities, with approximately 240 receptors per cm² on the fingertips for fine tactile discrimination 34 . In robotic applications, the necessary sensor density often aims to achieve this level to enable delicate manipulation tasks. Assuming this density as a target, with a power consumption of 1.88 μW per sensor, as observed in the experiment, the power consumption would be 0.451 mW/cm². Even if the sensors were distributed across an entire robotic hand at this density, the total power consumption would only reach several tens of mW, which is considered practical. Although our current prototype uses discrete logic ICs, we believe the circuit can be adapted for thin-film semiconductor technologies in the future, enabling flexible, skin-like sensor networks. Given the primarily digital nature of our circuit, transistor performance is not a critical concern. Additionally, our design requires relatively few transistors, with a typical node circuit needing approximately 500 transistors. Recent advancements in thin-film transistor technology have made densities of up to 30,000 transistors per cm² feasible 35 . Therefore, a sensor node can be fabricated in an area of approximately 1.3 mm 2 ; this density is comparable to those of mechanoreceptors on human fingers. During the cutting experiments, a bus wiring within an 8×8 grid-type sensor array was fully severed. In real-world applications, partial fractures are more likely. The bus comprised eight wires, including power, GND, Reset, Set, and four wires for bidirectional trigger and data signal transmission. If any of the first set of wires (power, GND, Reset, Set) were to be partially disconnected, it poses no issue provided that they remain connected within the route. For the trigger and data lines, the current design only detects trigger disconnections, leading to abnormal behavior if only the data line is severed. However, this can be rectified by adding cut detection to the data lines and integrating the results using OR logic. Thus, the system can maintain normal operation even if any subset of the eight wires is severed. Nevertheless, the circuit cannot address all failures, such as partial fractures within a node’s internal wiring. For instance, in the most critical scenario, if the component responsible for sending signals to the next node fails, no signals can be read at all. Practical solutions, such as encapsulating nodes in mold resin or integrating node circuitry into a single ASIC chip, are necessary to minimize internal wiring failures. However, using mold resin encapsulation can increase the overall cost and complexity of the manufacturing process. Although integrating node circuits into a single ASIC chip can reduce the footprint and potentially enhance system reliability, it involves high initial development and manufacturing costs. Among the solutions for addressing internal node failures, single-chip integration is likely the most effective. Given the small scale of the current circuit, single-chip integration would result in a very low probability of internal failures. In that case, the most likely points of failure would be the wiring and the connections between the wiring and nodes, which can be effectively addressed by our proposed method. The next most likely candidates for failure would be the sensor elements themselves. If the sensor element fails in a low-impedance mode, the pulse width becomes shorter; however, this is not critical as other sensor readings can still be obtained. Alternatively, if it fails in a high-impedance mode, similar to an open circuit, the pulse width becomes exceptionally long, and effectively unreadable. This can be countered by placing a fixed resistor in parallel with the sensor element; this setup allows the setting of an upper limit for the pulse width, ensuring that readings are obtained within a specified period. In terms of sensing quality, our design encodes sensor data as pulse widths, achieving a timing resolution of approximately 3 ns with a 300 MHz clock. Assuming a maximum pulse width of 1 μs, this setup provides approximately 300 levels of resolution, which is roughly equivalent to 8 bits of information. Although this resolution may be lower compared with high-resolution ADCs, which generally range from 12 to 24 bits, the design remains suitable for e-Skin applications where detecting contact or pressure thresholds is more crucial than precision measurements. Applications requiring higher precision might find our approach less adequate, especially those involving sensors that detect minute changes, such as strain gauges. However, with the ongoing development of highly sensitive sensors for e-Skin applications 36 – 38 , the problem of relatively lower resolution may be alleviated, enhancing the system’s adaptability and performance in the future.For future developments and improvements, the current method of forming sensor nodes using discrete ICs is cost-prohibitive at large scales. Technologies based on printing techniques or simpler circuit chip implementation methods, such as self-organization, are desired. Additionally, although connectors were used in this prototype for simplicity, they are often fragile and prone to failure. Incorporating more robust bonding technologies, such as thermal compression bonding with anisotropic conducting film (ACF), would improve connection flexibility and reliability. Finally, integrating stretchable wiring technologies could further expand the applicability to more diverse and curved surfaces 32 , 39 ."
} | 3,757 |
39312488 | PMC11459550 | pmc | 9,392 | {
"abstract": "Abstract Plant performance is impacted by rhizosphere bacteria. These bacteria are subjected to both bottom-up control by root exudates as well as top-down control by predators, particularly protists. Protists stimulate plant growth-promoting microbes resulting in improved plant performance. However, knowledge of the mechanisms that determine the interconnections within such tripartite protist–bacteria–plant interactions remains limited. We conducted experiments examining the effects of different densities of the predatory protist Cercomonas lenta on rhizosphere bacterial communities, specifically zooming on interactions between Cercomonas lenta and key bacterial taxa, as well as interactions among key bacterial taxa. We tracked rhizosphere bacterial community composition, potential microbial interactions, and plant performance. We found that Cercomonas lenta inoculation led to an average increase in plant biomass of 92.0%. This effect was linked to an increase in plant growth-promoting rhizobacteria ( Pseudomonas and Sphingomonas ) and a decrease in bacteria ( Chitinophaga ) that negatively impact on plant growth-promoting rhizobacteria. We also found evidence for cooperative enhancements in biofilm formation within the plant growth-promoting rhizobacterial consortium. Cercomonas lenta enhanced a plant growth-promoting rhizobacterial consortium colonization by promoting its cooperative biofilm formation in the rhizosphere, leading to a 14.5% increase in phosphate solubilization that benefits plant growth. Taken together, we provide mechanistic insights into how the predatory protist Cercomonas lenta impacts plant growth, namely by stimulating plant beneficial microbes and enhancing their interactive activities such as biofilm formation. Predatory protists may therefore represent promising biological agents that can contribute to sustainable agricultural practices by promoting interactions between the plant and its microbiome.",
"conclusion": "Conclusion We have summarized the mechanisms underlying the interconnections within the protist–bacteria–plant triangle of interactions in a conceptual model, as depicted in Fig. 6 , where C. lenta improves plant performance by enhancing interactions with and within the rhizosphere microbiome. Taken together, our results demonstrate that the predatory protist C. lenta impacts the rhizosphere bacterial community leading to more collaborative interactions related to enhanced biofilm formation, increasing the colonization of plant growth-promoting rhizobacterial consortia ( Pseudomonas and Sphingomonas ), leading to improved phosphorous mobilization that benefits plant performance. Therefore, we propose that protists represent attractive agents for future, microbe-based sustainable agricultural practices, both as bioagents or by targeted stimulation of resident protist populations. Figure 6 Conceptual model depicting the mechanisms underlying the interconnections in the protist–bacteria–plant triangle.",
"introduction": "Introduction The rhizosphere is a narrow, but dynamic zone, in soils that is directly affected by plant roots [ 1 ]. Plant-released organic carbon compounds (e.g. root exudates) [ 2 ] serve as nutrients and energy sources (e.g. amino acids and simple sugars) for microorganisms (e.g. bacteria and fungi) [ 3 , 4 ]. Thus, the rhizosphere is a hotspot in terms of the densities and activities of microbial populations as compared to the bulk soil [ 5 ]. In addition to plant-encoded strategies to overcome various biological and abiotic stresses from their surroundings [ 6 ], plants also rely on plant-associated microorganisms for soil nutrition utilization, disease suppression, and drought stress mitigation, thereby improving plant performance [ 2 , 7 , 8 ]. Bacteria are the most abundant microorganisms in the rhizosphere, forming an integral part of complex microbial consortia [ 9 , 10 ]. Some of these rhizobacteria have been termed plant growth-promoting rhizobacteria (PGPR), as they can enhance plant performance by, for instance, facilitating nitrogen fixation, mineralizing phosphate, producing plant-beneficial hormones, and suppressing pathogens [ 11 ]. Biofilm formation represents an important trait involved in root colonization and the ability of PGPR to enhance plant growth [ 12 , 13 ]. At the same time, plant pathogenic bacteria can enter and colonize the rhizosphere, thereby negatively impacting plant performance [ 14 ], and it has been shown that the composition of the bio-control bacterial community can impact the population densities of pathogens [ 15 ]. The assembly of bacteria in the rhizosphere is known to be influenced by root exudates, following a traditional bottom-up perspective [ 16–18 ]. In addition to the impact of plants, bacteria are also subjected to top-down control by soil predators, particularly predatory protists [ 19 ]. Predatory protists are the main component of soil protists, and play a keystone role in soil food webs [ 19 ]. Predatory protists enhance plant performance by increasing the abundances of plant-beneficial IAA-producing and pathogen-suppressive bacteria, and releasing nitrogen from bacteria that is then available for the plant [ 20 , 21 ]. However, not all predatory protists seem to perform the same functions. One of the most abundant genera in soil that has repeatedly been shown to be linked to plant growth and health is Cercomonas [ 22–24 ]. Yet, the mechanisms underlying the interconnections in the protist–bacteria–plant triangle remain largely unknown. To investigate the mechanisms underlying the interconnections in the protist–bacteria–plant triangle, we first examined the impact of inoculation with different densities of the predatory protist Cercomonas lenta ( C. lenta ) on the bacterial community, including PGPR, and these data were linked with measures of plant biomass, using cucumber as a model plant. We then investigated potential cooperative interactions (e.g. biofilm formation) leading to a plant growth-promoting rhizobacterial consortium and plant growth-promoting functional capability of the consortium as well as its links with changes in plant performance. We further performed subsequent mesocosm experiments to validate the functional importance of the plant growth-promoting rhizobacterial consortium induced by the predatory protist C. lenta . We hypothesized that (i) C. lenta would impact the rhizosphere bacterial community leading to the enrichment of some plant-beneficial bacteria (e.g. PGPR) at the expense of other bacterial taxa (e.g. potential PGPR antagonists), thereby enhancing plant performance, and that (ii) the plant growth-promoting effects of the protist-induced rhizobacterial consortium are due to enhanced biofilm formation and plant growth-promoting abilities, which exert positive impacts on plant performance.",
"discussion": "Discussion In this study, we sought to gain insight into the mechanisms by which protists contribute to improved plant performance. We specifically zoomed in on the effects of protist inoculation on bacterial communities in the rhizosphere, interactions between different protist-effected bacterial taxa, and the potential impacts of such interactions on rhizosphere colonization and plant growth promotion. We found that the predatory protist C. lenta enriched for specific microbial taxa ( Pseudomonas and Sphingomonas ), whose interactions lead to improved biofilm formation, rhizosphere colonization, and P mobilization, and ultimately improved plant performance. Our data support our first hypothesis that C. lenta would impact the rhizosphere bacterial community so as to enrich specific plant-beneficial bacteria, thereby enhancing plant performance. We found that the application of C. lenta induced changes in the rhizosphere bacterial community that could be linked to improvements in plant performance. This suggests that C. lenta is an important top-down regulator of rhizosphere microbiome community composition [ 16 , 56 ]. We further identified specific bacterial taxa, such as Pseudomonas and Sphingomonas that were impacted by C. lenta inoculation and determined their explanatory link with plant performance. Numerous previous studies have demonstrated that Pseudomonas and Sphingomonas can act as PGPR to promote plant growth via a range of mechanisms, such as by solubilizing phosphorus and synthesizing IAA [ 57–60 ]. Our results suggest that C. lenta may enhance the fitness of plant-beneficial bacteria (e.g. Pseudomonas and Sphingomonas ) by preying on other bacteria (e.g. Chitinophaga ) that may inhibit the growth of plant-beneficial bacteria [ 61 ]. Previous studies have suggested that biofilm formation may represent an important mechanism by which bacteria can avoid protist predation [ 62 , 63 ]. It may therefore be that protist predation at least partially selects for traits related to biofilm formation, including multi-species biofilms [ 64 ], thereby generally increasing the proportion of biofilm-producing strains that can potentially colonize the rhizosphere and impact plant performance. We indeed found that Pseudomonas and Sphingomonas had stronger biofilm formation abilities than their potential antagonist Chitinophaga. Therefore, C. lenta predation-induced shifts in the bacterial community might increase the number and performance of PGPR (e.g. Pseudomonas and Sphingomonas ) in the rhizosphere, leading to enhanced plant performance. We also found support for our second hypothesis that C. lenta would support cooperation within plant growth-promoting rhizobacterial consortia to elicit activities in support of plant performance. Inoculation with C. lenta induced the formation of a plant growth-promoting rhizobacterial consortium composed of Pseudomonas and Sphingomonas , leading to increased biofilm production. This enhanced the rhizosphere colonization of the plant growth-promoting rhizobacterial consortium, which lead to improved phosphate solubilization. Numerous previous studies have demonstrated that bacterial biofilm formation influences the colonization of bacteria in the rhizosphere of host plants [ 12 , 13 ]. Moreover, bacterial biofilm formation is often linked to improved plant performance, for instance due to better competitive exclusion of pathogens [ 29 , 65 ]. In addition, the phosphate solubilization provided by plant-associated bacteria is closely related to the improvement of plant performance [ 66 ]. Previous studies have also shown positive impacts of protists on plant performance, with links to the changes in the relative abundance of distinct bacterial groups in relation to protistan predation [ 20 , 25 , 67 ]. Here, we show that the predation of C. lenta induces the form of a plant growth-promoting rhizobacterial consortium that includes microbial cooperative interactions. These microbial cooperative interactions facilitate increased biofilm production and rhizosphere colonization, which improves phosphorous mobilization, eventually leading to enhanced plant performance. Our results not only further highlight the importance of plant growth-promoting rhizobacterial consortia in plant performance improvement [ 68 ], but also indicate that the role of protists in stimulating such activities should be considered in future investigations to develop new agricultural biological agents."
} | 2,847 |
30227897 | PMC6145348 | pmc | 9,393 | {
"abstract": "Background Microbial processes are intricately linked to the depletion of oxygen in in-land and coastal water bodies, with devastating economic and ecological consequences. Microorganisms deplete oxygen during biomass decomposition, degrading the habitat of many economically important aquatic animals. Microbes then turn to alternative electron acceptors, which alter nutrient cycling and generate potent greenhouse gases. As oxygen depletion is expected to worsen with altered land use and climate change, understanding how chemical and microbial dynamics impact dead zones will aid modeling efforts to guide remediation strategies. More work is needed to understand the complex interplay between microbial genes, populations, and biogeochemistry during oxygen depletion. Results Here, we used 16S rRNA gene surveys, shotgun metagenomic sequencing, and a previously developed biogeochemical model to identify genes and microbial populations implicated in major biogeochemical transformations in a model lake ecosystem. Shotgun metagenomic sequencing was done for one time point in Aug., 2013, and 16S rRNA gene sequencing was done for a 5-month time series (Mar.–Aug., 2013) to capture the spatiotemporal dynamics of genes and microorganisms mediating the modeled processes. Metagenomic binning analysis resulted in many metagenome-assembled genomes (MAGs) that are implicated in the modeled processes through gene content similarity to cultured organism and the presence of key genes involved in these pathways. The MAGs suggested some populations are capable of methane and sulfide oxidation coupled to nitrate reduction. Using the model, we observe that modulating these processes has a substantial impact on overall lake biogeochemistry. Additionally, 16S rRNA gene sequences from the metagenomic and amplicon libraries were linked to processes through the MAGs. We compared the dynamics of microbial populations in the water column to the model predictions. Many microbial populations involved in primary carbon oxidation had dynamics similar to the model, while those associated with secondary oxidation processes deviated substantially. Conclusions This work demonstrates that the unique capabilities of resident microbial populations will substantially impact the concentration and speciation of chemicals in the water column, unless other microbial processes adjust to compensate for these differences. It further highlights the importance of the biological aspects of biogeochemical processes, such as fluctuations in microbial population dynamics. Integrating gene and population dynamics into biogeochemical models has the potential to improve predictions of the community response under altered scenarios to guide remediation efforts. Electronic supplementary material The online version of this article (10.1186/s40168-018-0556-7) contains supplementary material, which is available to authorized users.",
"conclusion": "Conclusions This analysis uses a combination of 16S rRNA gene surveys, metagenomic analysis, and biogeochemical modeling to gain insight into how energy availability shapes the distribution and dynamics of genes and microbial populations in the lake. Partial genome reconstruction through metagenomic binning provided insight into the capabilities of microbial populations mediating major biogeochemical cycles in the lake, including populations with genes supporting sulfur or methane oxidation coupled to denitrification. Modulating these processes in a biogeochemical model of the lake substantially changed predicted iron chemistry, which is recognized to impact both arsenic and phosphate mobilization. Secondary redox processes are not well captured by the model; thus, more work is needed to better understand the factors governing these processes. Overall, the relationship of the biogeochemical model predictions to the dynamics of populations mediating the primary redox processes identifies populations with dynamics largely controlled by energy availability as opposed to other factors. Additional observations of this ecosystem could shed light on how population dynamics are shaped by factors like phage predation, especially within methane oxidizers with potential for denitrification, which could impact ecosystem energy and material flow.",
"discussion": "Discussion This work provides insight into the relationship between microbial genes, populations, and a biogeochemical model of the processes they mediate to elucidate factors driving population dynamics and advance the use of population dynamics and MAG data in the development of predictive models. A biogeochemical model was used as our hypothesis of the factors influencing the dynamics of microbial populations mediating processes in the lake. It was also used to understand how adding or removing processes from the community would alter lake chemistry. We assumed that the presence of genes mediating the modeled processes would influence population dynamics and distribution; thus, the overall distribution of these genes would correspond to the modeled predictions. However, we also checked whether genes associated with different modeled processes co-occur within the MAG as a result of metabolic versatility, which would also influence gene distribution. Finally, we compared biogeochemical model predictions to the dynamics of key populations. We found that the dynamics of some microorganisms, such as those mediating denitrification, iron reduction, and sulfate reduction seem to be qualitatively captured by a dynamic model of energy availability. However, the model poorly captures the dynamics of key populations mediating methane oxidation, ammonia oxidation, and sulfur/iron oxidation. There are multiple possible reasons for the lack of agreement between the diagnostic gene distributions and the associated processes predicted by the model. The model could be missing important processes, as suggested by the presence of sulfur-oxidizing denitrifiers. The original model only included sulfur oxidation with oxygen, shifting this process higher up in the water column than was observed for the genes. Pairing sulfur oxidation to denitrification would allow sulfur oxidizers to inhabit lower depths than pairing with oxygen since nitrate is found below where oxygen is depleted. Additionally, although the genes were present, they may not have been active. Genes could also exhibit substrate promiscuity, with genes assigned to one process mediating other processes. The ability of the well-known ferredoxin-nitrite reductase nirA to perform sulfite reduction is one such example [ 48 ]. An alternative explanation, especially applicable to bidirectional enzymes such as oxioreductases, is that the reverse reaction is occurring [ 49 ], as a result of the intracellular redox state or subtle sequence mutations affecting the reaction center. Our attempt to align genes to processes in the model relies on our ability to identify the genes involved. Thus, for environments such as this, where 63% of the genes are unknown or unclassified, many genes important to these processes could be unidentified. The co-occurrence of autotrophic and denitrification genes in relatively abundant populations highlights the expanding view of nitrogen cycling. The original model coupled denitrification with primary carbon oxidation reactions [ 11 ], reflecting the idea that denitrification is largely associated with heterotrophic processes. However, this view has expanded as many researchers have identified the importance of denitrification in oxidation of methane [ 47 ], iron [ 50 ], and sulfur [ 42 ]. The combination of genes within autotrophic MAGs also supports this expanded role of denitrification within this system. Our original implementation of the biogeochemical model included iron oxidation coupled to denitrification based on previous observations from the lake [ 32 , 50 ]. The similarity of a MAG to Sideroxydans lithotrophicus ES-1 supports this process. But the clustering of MAGs with other autotrophic denitrifiers and presence of nosZ genes suggests additional autotrophic denitrifying pathways should be considered. Given the evidence for autotrophic processes competing for nitrate, these processes could directly impact greenhouse gases, nutrient cycling, and contaminant mobilization. Using the biogeochemical model, we demonstrate that competition for nitrate among autotrophic denitrifying populations could dramatically change iron speciation within the lake. Because of the importance of nitrate and iron in determining arsenic [ 32 ] and phosphate [ 33 ] speciation and mobility, these chemical species will likely be impacted as well. Additionally, nitrifiers have the denitrification gene nirK , providing it the potential for nitrifier denitrification, which can be a significant source of the potent greenhouse gas nitrous oxide in some ecosystems [ 51 ]. More work is needed to determine the rules governing these interactions and how the outcome of these competitive interactions between denitrifying populations could impact the overall chemistry of the lake. While we could successfully identify MAGs linking functional capabilities to 16S rRNA gene sequences in our amplicon dataset, the development of more targeted methods to consistently associate function to 16S rRNA gene sequences would extend this analysis to more of the community. 16S rRNA gene sequencing can more efficiently provide population dynamics because many more samples can be sequenced with sufficient coverage as compared to shotgun metagenomics. Yet, limited functional information is available from 16S rRNA gene sequencing. Some currently available techniques, such as stable isotope analysis [ 52 ], or epicPCR [ 36 ], can help identify the 16S rRNA gene sequence associated with organisms containing specific capabilities or functional genes, but this targeted approach has limited use in creating a comprehensive understanding of community function and interactions. Although 16S rRNA gene sequences cannot always discriminate between closely related but functionally distinct organisms [ 53 ], the importance of these functional differences will depend on the process of interest. More phylogenetically constrained forms of energy conservation, like methane oxidation and sulfate reduction, will be less sensitive to this impact than processes such as denitrification [ 54 ]. More effective methods to tie 16S rRNA genes to associated function and MAGs would make the most efficient use of both types of sequencing and better inform dynamics and function. The biogeochemical model serves multiple purposes in this analysis. First, it can be used to generate hypotheses about where processes are expected to occur given the current understanding of processes and the observed chemistry. It can then be used to compare to observations of genes and populations mediating the modeled processes. However, observations can help generate new ideas about the flow of energy and matter through the ecosystem, requiring updates to the model in an iterative approach. By comparing the previous model predictions with gene observations, we were able to identify major differences, which were supported by the MAG gene data. When we updated the model to reflect these observations, it allowed us to gain insight about potentially competing processes, which could substantially change iron chemistry in the lake. Finally, the model can be used to test unobserved conditions, such as the removal of methane and sulfide oxidation coupled to nitrate reduction from the ecosystem and observe the potential consequences. Not only can computational models facilitate the analysis of microbial communities, but it can also result in a usable product that may predict the response of the community to future environmental change scenarios. While this analysis provides insight into potential capabilities and interactions between microorganisms, more work is needed to confirm activity and interactions. In general, the metabolic model and associated MAGs support the potential for these processes to occur given the chemical environment. Although we assume reproduction would concentrate cells at the various locations in the lake, the presence of microorganisms does not necessarily translate into metabolic activity. Microorganisms or their genes may not be active, even though there is an overall positive relationship in the water column between the presence (from DNA) and activity (from RNA) [ 17 , 55 ]. Meta-transcriptomics could provide more insight into when and where organisms express the genes they carry. However, transcription of these key genes may only provide a snapshot of metabolic activities if they vary substantially between sampling periods [ 56 ]. Population abundances and their associated functional capabilities may integrate energy availability better than transcription over longer time-scales, especially if activity is intermittent within the specified time. On the other hand, population abundances are also determined by a complicated set of factors that might not be related to energy availability. Factors regulating population abundances may be influenced by other processes, such as immigration [ 57 ] and complex hydrodynamics, such as seiching [ 58 ]. However, within this lake, we have no evidence to suggest that hydrodynamic processes are the main drivers of the position of microbial populations."
} | 3,356 |
18928368 | null | s2 | 9,394 | {
"abstract": "For simulations of neural networks, there is a trade-off between the size of the network that can be simulated and the complexity of the model used for individual neurons. In this study, we describe a generalization of the leaky integrate-and-fire model that produces a wide variety of spiking behaviors while still being analytically solvable between firings. For different parameter values, the model produces spiking or bursting, tonic, phasic or adapting responses, depolarizing or hyperpolarizing after potentials and so forth. The model consists of a diagonalizable set of linear differential equations describing the time evolution of membrane potential, a variable threshold, and an arbitrary number of firing-induced currents. Each of these variables is modified by an update rule when the potential reaches threshold. The variables used are intuitive and have biological significance. The model's rich behavior does not come from the differential equations, which are linear, but rather from complex update rules. This single-neuron model can be implemented using algorithms similar to the standard integrate-and-fire model. It is a natural match with event-driven algorithms for which the firing times are obtained as a solution of a polynomial equation."
} | 316 |
37120702 | PMC10284914 | pmc | 9,396 | {
"abstract": "Rhodopsin photosystems convert light energy into electrochemical gradients used by the cell to produce ATP, or for other energy-demanding processes. While these photosystems are widespread in the ocean and have been identified in diverse microbial taxonomic groups, their physiological role in vivo has only been studied in few marine bacterial strains. Recent metagenomic studies revealed the presence of rhodopsin genes in the understudied Verrucomicrobiota phylum, yet their distribution within different Verrucomicrobiota lineages, their diversity, and function remain unknown. In this study, we show that more than 7% of Verrucomicrobiota genomes ( n = 2916) harbor rhodopsins of different types. Furthermore, we describe the first two cultivated rhodopsin-containing strains, one harboring a proteorhodopsin gene and the other a xanthorhodopsin gene, allowing us to characterize their physiology under laboratory-controlled conditions. The strains were isolated in a previous study from the Eastern Mediterranean Sea and read mapping of 16S rRNA gene amplicons showed the highest abundances of these strains at the deep chlorophyll maximum (source of their inoculum) in winter and spring, with a substantial decrease in summer. Genomic analysis of the isolates suggests that motility and degradation of organic material, both energy demanding functions, may be supported by rhodopsin phototrophy in Verrucomicrobiota . Under culture conditions, we show that rhodopsin phototrophy occurs under carbon starvation, with light-mediated energy generation supporting sugar transport into the cells. Overall, this study suggests that photoheterotrophic Verrucomicrobiota may occupy an ecological niche where energy harvested from light enables bacterial motility toward organic matter and supports nutrient uptake.",
"introduction": "Introduction The classic view that most of the light energy capture for metabolism in the ocean is carried out by photosynthetic microorganisms and used for carbon fixation has been challenged by the discovery of proteorhodopsin photosystems (PR) in marine prokaryotes [ 1 – 3 ]. PRs are light-activated proton pumps that create a proton motive force ( pmf ) across the cellular membrane [ 1 , 3 ]. Depending on the microorganism, the resulting pmf can be used for a variety of physiological functions, such as producing biochemical energy (ATP) to contribute to metabolism and growth [ 4 ], supporting cellular transport and other energy-demanding cellular processes (e.g., proton-mediated substrate uptake [ 5 ] and ATP-mediated substrate uptake, as in ABC transporters [ 6 ]), and enhancing cell survival during respiratory stress [ 7 ]. The importance of PR photosystems in marine bacteria is supported by a global analysis of marine metagenomes, which showed that for small free-living marine microorganisms (0.2–0.8 μm fraction) the proteorhodopsin coding gene ( pr ) exceeds by threefold the combined abundance of oxygenic and anoxygenic photosynthesis genes [ 8 ]. This high abundance of PRs among bacterioplankton suggests that a significant amount of solar radiation is harvested by these photoreceptive proteins. Supporting this notion, using the environmental concentration of the chromophore retinal as a proxy for PR concentration, a recent study showed that PRs potentially absorb as much light energy as chlorophyll- a -based phototrophy in the water column [ 9 ]. The pr genes are widespread in bacteria from virtually all oceanic regions [ 10 – 14 ] and PR-mediated photoheterotrophy may be the dominant prokaryotic metabolism in the photic zone [ 13 ], particularly in ultraoligotrophic regions such as the Eastern Mediterranean Sea [ 15 ]. Among microbial rhodopsins, PRs are the most abundant and widespread type in marine systems, being present in a wide range of prokaryotic taxa. Of the other subfamilies of proton pumps that constitute a smaller fraction of rhodopsins in the sea, the most prevalent is the subfamily of xanthorhodopsins (XRs) [ 16 ]. The simplicity of the rhodopsin proton pump gene system, which only requires six genes [ 3 ], contributes to the ease with which they are horizontally transferred across diverse taxonomic groups [ 17 ], and consequently to its pervasiveness in the marine ecosystem. Accordingly, PRs are found in diverse taxonomic groups characterized by distinct metabolic capacities that allow them to occupy separate ecological niches within the microbial community. Marine PR-containing prokaryotes have been found among Actinomycetota , Bacteroidota , and Alpha -, Beta - and Gammaproteobacteria , as well as marine Euryarchaeota . However, most microorganisms within these taxa are not yet available in culture, which has limited the ability to study how rhodopsin-mediated light harvesting modulates microbial physiology and ecology. So far, the influence of light on PR phototrophs has only been studied in a small number of marine strains, where it has been shown that PR function can be associated to light-enhanced growth and survival, reduced respiration rate, and enhanced substrate uptake [ 4 – 7 , 18 – 23 ]. However, these diverse functions are associated with the particular bacterial species studied, and sometimes even differ between strains, showing that rhodopsin phototrophy varies among bacteria in ways that are still difficult to predict from genomic and metagenomic data alone [ 24 ]. Therefore, studies combining physiology and molecular approaches on additional cultured bacteria are needed to further elucidate how PRs influence microbial physiology and ecological processes, such as nutrient processing rates and how these influence biogeochemical cycles and the marine microbial loop. Recently, the presence of pr genes was reported in the Verrucomicrobiota phylum, based on metagenome-assembled genomes (MAGs) from seawater collected in the Western Mediterranean Sea [ 25 ]. Verrucomicrobiota are nearly ubiquitous in the marine environment, constituting on average 2% of microbial communities [ 26 ]. This phylum appears to have an important role in the cycling of high molecular weight compounds, showing an abundance of genes involved in degradation of carbohydrates, and especially sulfated polysaccharides [ 27 – 29 ]. Verrucomicrobiota are diverse and include both motile and non-motile members [ 30 ] that can live both as free-living and particle-associated microorganisms [ 31 ]. However, the absence of cultured photoheterotrophic Verrucomicrobiota strains has precluded the determination of PR functions in this group. Here, we characterize the first two rhodopsin-bearing Verrucomicrobiota strains. The first strain, ISCC53 T (assigned here to Candidatus Pelagisphaera phototrophica gen. nov., sp. nov.), encodes a PR/retinal biosynthesis gene cluster and is related to the heterotrophic shallow-water genus Pelagicoccus . The second strain, ISCC51, harbors a xanthorodopsin-like gene and represents an undescribed Opitutales species, the first isolate of the family-level clade UBA2995. Using the genomic sequences of these isolates, we determined their global distribution and abundance. For ISCC53 T we tested which cellular processes are affected by rhodopsin function and determined how such processes are modulated by environmental conditions. Our findings suggest that rhodopsins support nutrient uptake, particularly under carbon-starved conditions, leading us to propose that photoheterotrophic Verrucomicrobiota occupy an ecological niche where light harvesting supports motility toward organic matter and nutrient transport into starved cells.",
"discussion": "Discussion Despite the earlier reports about the presence of rhodopsin genes in assembled genomes of freshwater [ 54 , 55 ] and marine [ 25 , 56 ] Verrucomicrobiota , photoheterotrophy in this phylum has thus far remained largely unexplored. Our study thus provides the first systematic analysis of this phenomenon based on the two Opitutales isolates from the Eastern Mediterranean Sea encoding for a pr and an xr gene, respectively. The photoheterotrophic Verrucomicrobiota strains analyzed in this study (ISCC51 and Ca . P. phototrophica (ISCC53 T )) had been originally isolated in winter [ 33 ]. Furthermore, our analysis of the 16S rRNA gene datasets of six cruises from the Eastern Mediterranean Sea [ 38 , 57 ] confirmed the presence of these verrucomicrobial photoheterotrophs in the more productive settings of winter and spring, with almost complete disappearance during the summer months (Fig. 6 ). Interestingly, in a different metagenomic study from the Mediterranean, a rhodopsin gene assigned to a verrucomicrobial MAG (MED-G86) recruited read coverage in a mixed winter water column and not from a stratified water column [ 25 ]. Taken together, the previous and present study suggest that photoheterotrophic Verrucomicrobiota may be unable to thrive in the extreme oligotrophic conditions typical of the stratified summer Mediterranean seawater. Instead, they may recurrently appear after winter deep-water mixing, being most abundant in the DCM layer. Beyond the rhodopsin genes found in the isolates, the examination of 2916 verrucomicrobial genome assemblies revealed that approximately 7% might be photoheterotrophic, which highlights the fact that our strains do not represent isolated cases. Phylogenetic analysis shows divergent origins for verrucomicrobial rhodopsins, with the vast majority (72%) being PRs, while others come from the rarer subfamilies of P5, XR, and P4. Sequence analysis of two previously unreported rhodopsin clades found in Verrucomicrobiota , P4 and P5, indicates that they likely also function as proton pumps. A distinct feature observed here for the first time, was the fusion of the retinal biosynthesis genes crtI (phytoene desaturase) and crtB (phytoene synthase). Fusion of enzymes involved in the carotene biosynthetic pathway was shown to optimize metabolite transfer between the enzymatic reactions and reduce accumulation of intermediates, leading to increase in pathway efficiency [ 53 ]. Whilst Ca . Pelagisphaera has a global distribution, the photoheterotrophic genes show a patchy distribution across geographic locations in this group. Pseudogenization, as witnessed in one of the genomes affiliated with Ca . Pelagisphaera (Fig. 2 ), and suspected gene duplications may drive such ecological and genomic diversification among the different lineages. Loss of the photoheterotrophic genes may relate to a switch from an energy-limiting to an energy-rich niche. The existence of niche differentiation among sympatric Ca . Pelagisphaera is hinted at by the contrasting distribution of the two dominant Ca . Pelagisphaera 16S rRNA gene variants among the two fractions in the amplicon data (Supplementary Fig. S5B ). To connect the distribution of verrucomicrobial photoheterotrophs with function, we provided here the first ecophysiological characterization of the Ca . P. phototrophica PR, which is representative of PRs encountered in marine Opitutales in general (type PR-1, Fig. 4 , Supplementary Figs. S2 and S7 ). We have shown that the light-mediated proton gradient translates into increased production of ATP in Ca . P. phototrophica only when the cells are carbon-starved, coinciding with the highest number of rhodopsin molecules per cell. Analogously, under carbon starvation, light stimulates higher 3 H-glucose uptake rates. Light-stimulated growth is only observed at growth-rate limiting carbon concentration of 15 µM glucose, it is not detected at the higher carbon concentration of 50 µM glucose. We therefore conclude that only when exogenous carbon is the limiting factor, PR photoheterotrophy provides a tangible energetic benefit. It can be speculated that in their natural environment, light exposure may enable these photoheterotrophs to maintain optimal substrate uptake rates under carbon-deplete conditions, enabling them to respond quickly to sporadic carbon inputs. Similarly to our observations, light was found to positively affect growth in a medium that was low in labile organic matter in specific flavobacterial strains from the genus Dokdonia [ 4 ], in which light may support enhanced pmf -dependent vitamin uptake [ 5 ]. An even closer analogy can be drawn with the oligotrophic Ca. Pelagibacterales (SAR11 clade), which also showed higher substrate uptake rates in the light only under carbon-deplete conditions [ 6 ]. Nevertheless, SAR11 did not show a light-stimulated growth response in any carbon condition tested [ 6 , 58 ]. Compared to Ca . P. phototrophica, SAR11 bacteria have much smaller genomes (about one fourth in size) and lack motility capacity. Thus, while in SAR11 PR phototrophy may serve mostly to maintain the minimal energy levels to sustain survival under carbon starvation and to support substrate uptake when carbon becomes available again, in Verrucomicrobiota it may support additional processes, such as energizing flagellar movement to enable carbon-starved cells to reach suspended particles. Support for this hypothesis is further lent by the finding of Verrucomicrobiota related to ISCC51 and to ISCC53 T not only in the free-living microbial fraction, but also in the particle-associated fraction (on 11 µm filters), suggesting a dual lifestyle that also involves interaction with particles (Fig. 6 ). The potential for PR-mediated pmf to fuel flagellar motion, has indeed been shown experimentally in Escherichia coli expressing heterologous PR [ 59 ]. Here we observed flagella by SEM imaging in ISCC51, a strain that also showed a dual lifestyle (free-living and particle-associated), potentially enabling it to move between particles. A recent study along the subtropical frontal zone off New Zealand showed that, although microbial rhodopsins are generally more abundant in the picoplankton size fraction (0.2–3 μm) that represents free-living microbes, at times, the larger (>3 μm) size fractions, containing particle-attached prokaryotes, dominate the rhodopsin signal [ 37 ]. Marine particles can contain recalcitrant compounds, such as fucose-containing sulfated polysaccharides, that only few taxa can degrade, thus promoting carbon sequestration into deeper water [ 60 ]. Verrucomicrobiota represent one such taxon and are suggested to be important contributors to polysaccharide degradation, in particular hydrolysis of sulfated polysaccharides [ 29 , 56 , 61 , 62 ]. The photoheterotrophic verrucomicrobial strains studied here are no exception in this respect: their genomes encode for an arsenal of enzymes involved in carbohydrate degradation, with a prominent expansion of sulfatase genes (192 genes in Ca . P. phototrophica). Accordingly, rhodopsin activity may both support the high energetic costs involved in the biodegradation of complex polysaccharides and enable carbon-starved Verrucomicrobiota to reach these recalcitrant sinking particles. We thus hypothesize a new link between rhodopsin photosystems and degradation of marine particles made of refractory organic matter, which would result in a reduction in carbon sequestration via sinking particles. We suggest this hypothesis warrants further investigation, by future measurements of a potential light-enhanced flagellar motility and enzymatic activity in particle-associated rhodopsin-containing Verrucomicrobiota such as Ca . Pelagisphaera and ISCC51."
} | 3,860 |
30555427 | PMC6282030 | pmc | 9,397 | {
"abstract": "Shallow-water hydrothermal vent ecosystems are distinctly different from deep-sea vents, as other than geothermal, sunlight is one of their primary sources of energy, so their resulting microbial communities differ to some extent. Yet compared with deep-sea systems, less is known about the active microbial community in shallow-water ecosystems. Thus, we studied the community compositions, their metabolic pathways, and possible coupling of microbially driven biogeochemical cycles in a shallow-water hydrothermal vent system off Kueishantao Islet, Taiwan, using high-throughput 16S rRNA sequences and metatranscriptome analyses. Gammaproteobacteria and Epsilonbacteraeota were the major active bacterial groups in the 16S rRNA libraries and the metatranscriptomes, and involved in the carbon, sulfur, and nitrogen metabolic pathways. As core players, Thiomicrospira, Thiomicrorhabdus, Thiothrix, Sulfurovum , and Arcobacter derived energy from the oxidation of reduced sulfur compounds and fixed dissolved inorganic carbon (DIC) by the Calvin-Benson-Bassham (CBB) or reverse tricarboxylic acid cycles. Sox-dependent and reverse sulfate reduction were the main pathways of energy generation, and probably coupled to denitrification by providing electrons to nitrate and nitrite. Sulfur-reducing Nautiliaceae members, accounting for a small proportion in the community, obtained energy by the oxidation of hydrogen, which also supplies metabolic energy for some sulfur-oxidizing bacteria. In addition, ammonia and nitrite oxidation is another type of energy generation in this hydrothermal system, with marker gene sequences belonging to Thaumarchaeota/Crenarchaeota and Nitrospina , respectively, and ammonia and nitrite oxidation was likely coupled to denitrification by providing substrate for nitrate and nitrite reduction to nitric oxide. Moreover, unlike the deep-sea systems, cyanobacteria may also actively participate in major metabolic pathways. This study helps us to better understand biogeochemical processes mediated by microorganisms and possible coupling of the carbon, sulfur, and nitrogen cycles in these unique ecosystems.",
"conclusion": "Conclusion High-throughput 16S rRNA sequences and metatranscriptome analyses revealed that Gammaproteobacteria and Epsilonbacteraeota were the most active bacterial populations involved in the major carbon, sulfur, and nitrogen metabolic pathways in a shallow-water hydrothermal ecosystem. The major sulfur oxidizers were Thiomicrospira, Thiomicrorhabdus , and Thiothrix from Gammaproteobacteria, and Arcobacter and Sulfurovum from Epsilonbacteraeota, which showed high transcript abundances in the genes involved in the SOX/reverse sulfate reduction pathway. The sulfur-reducing Nautiliaceae contributed very few transcripts to sulfate reduction, but showed a high level of transcription for genes involved in denitrification processes. In addition, Thiomicrorhabdus exhibited a range of genes related to assimilatory nitrate reduction. We illustrated these major metabolic pathways and the possible coupling between microbially driven biogeochemical cycles in this ecosystem (Figure 6 ). Hydrogen sulfide contained in hydrothermal fluids from the Kueishantao vents is produced from thermal reduction of seawater sulfate radicals when seawater seeps through fractures in the seafloor (Figure 6 ). This suggested that seawater is the initial source of H 2 S and geothermal heat is the primary energy source. Consequently, chemolithoautotrophic microbes (mainly members within Gammaproteobacteria and Epsilonbacteraeota) derive energy from the oxidation of reduced sulfur compounds and fix DIC by the CBB and rTCA cycles. Sox-dependent and reverse sulfate reduction are the main pathways of energy generation, and are probably coupled to denitrification by the provision of electrons to nitrate and nitrite (Figure 6 ). Oxygen is also a possible electron acceptor for sulfur oxidation. In addition, hydrogen oxidation supplies metabolic energy for some sulfur-oxidizing (e.g., Sulfurimonas sp.) and sulfur-reducing (e.g., Lebetimonas sp.) bacteria, coupled to the reduction of nitrate and sulfur, respectively. Ammonia and nitrite oxidation are other types of energy generation carried out by Thaumarchaeota/Crenarchaeota and Nitrospina , respectively, in this hydrothermal system, and coupled to denitrification by providing nitrate and nitrite substrate (Figure 6 ). Furthermore, driven by light energy, Cyanobacteria and aerobic photoheterotrophs also actively participate in major metabolic pathways. We speculate that Cyanobacteria perform oxygenic photosynthesis, fixing CO 2 through the CBB cycle and producing O 2 in the surface water, and then switch to anoxygenic photosynthesis fixing CO 2 and producing S 0 or sulfite in the bottom water next to the vent (Figure 6 ). Our results indicate the co-occurrence of chemoautotrophs and photoautotrophs/heterotrophs in a shallow-water hydrothermal vent, which is distinctly different from deep-sea hydrothermal ecosystems. Overall, the oxidation of reduced sulfur compounds, using oxygen or nitrate as electron acceptors, provide significant energy for carbon fixation in this shallow-water hydrothermal vent ecosystem, which uses sunlight and geothermal as primary energy sources. This study helps us to better understand biogeochemical processes mediated by microorganisms and the possible coupling of the carbon, sulfur, and nitrogen cycles in this unique ecosystem. FIGURE 6 Schematic diagram illustrating the coupling of the carbon, sulfur, and nitrogen cycles mediated by microorganisms in the shallow-water hydrothermal ecosystem. SO 4 2- , sulfate; SO 3 2- , sulfite; S/S 0 , sulfur; S 2 O 3 2- , thiosulfate; S 2- , sulfide; H 2 S, hydrogen sulfide; SO 2 , sulfur dioxide; NO 3 - , nitrate; NO 2 - , nitrite; NH 4 + , ammonium; NO, nitric oxide; H 2 , hydrogen; CH 4 , methane; CO 2 , carbon dioxide; O 2 , oxygen.",
"introduction": "Introduction The discovery of marine hydrothermal vents greatly enhanced our understanding of microbial habitats and survival strategies as well as the origins of life. Microbial communities in deep-sea hydrothermal systems have been intensively studied ( Brazelton and Baross, 2010 ; Xie et al., 2011 ; Grosche et al., 2015 ; Anantharaman et al., 2016 ) since the discovery of these vents in 1977. Most microbes in deep-sea hydrothermal vent ecosystems carry out chemosynthesis, which fixes carbon dioxide (CO 2 ) into organic compounds using the energy released by chemical reactions; it does not require sunlight. However, in shallow-water hydrothermal vent ecosystems, generally at water depths less than 200 m, chemolithoautotrophy and photoautotrophy occur simultaneously ( Maugeri et al., 2009 ; Zhang et al., 2012 ; Gomez-Saez et al., 2017 ; Tang et al., 2018 ). Previous surveys of bacterial 16S rRNA genes using tag pyrosequencing and clone libraries revealed a high abundance of chemoautotrophs within the classes Gammaproteobacteria and Epsilonproteobacteria (reclassified to a new phylum Epsilonbacteraeota; Waite et al., 2017 ) in shallow-water hydrothermal systems ( Tang et al., 2013 ; Gomez-Saez et al., 2017 ). In addition, Cyanobacteria were also frequently found ( Zhang et al., 2012 ; Tang et al., 2013 ; Gomez-Saez et al., 2017 ). Despite nearly 30 published studies on shallow-water hydrothermal systems, many open questions remain about the chemosynthetic and photosynthetic microbes, including the metabolic pathways they use, how the pathways are coupled with each other, and what factors control their ecology. Shallow (water depth < 30 m) submarine hydrothermal activity has been observed within 1 km east of Kueishantao Islet, off Taiwan. This hydrothermal system has unique geochemical characteristics and is driven by both sunlight and geothermal energy; thus, it is an ideal ecosystem to study coupled metabolic pathways and microbially driven biogeochemical cycles in extreme environments. Gas emitted from the Kueishantao hydrothermal vents are composed of CO 2 , nitrogen (N 2 ), methane (CH 4 ) and small amounts of hydrogen sulfide (H 2 S) ( Chen et al., 2005 ; Chen et al., 2016 ). The hydrothermal fluids originate with deep magmatic matter and meteoric water from the Kueishantao Islet ( Liu et al., 2010 ), and mix with seawater to form the final hydrothermal fluids. Fractures are widely developed around the andesite-hosted hydrothermal vent and therefore relatively oxygen-rich seawater seeps through these fractures in the seafloor. A previous study indicated that H 2 S in the Kueishantao hydrothermal system mainly originates from thermal reductive reactions of seawater and sulfate radicals, suggesting that seawater is the initial source of H 2 S ( Zhang, 2013 ). Thus, steep geochemical gradients form when reduced hydrothermal fluids meet the oxidized seawater. Electron donors in the gradients include sulfur (S 0 ), thiosulfate (S 2 O 3 2- ), hydrogen (H 2 ), organics, formate and fumarate, while nitrate, oxygen (O 2 ), S 0 , and S 2 O 3 2- are the major identified electron acceptors ( Xie et al., 2011 ; Anantharaman et al., 2016 ; Tang et al., 2018 ). Thus, a series of redox reactions occur and drive the carbon, nitrogen, and sulfur cycles in this hydrothermal ecosystem, which consists of the vent fluids and the water surrounding the vent. In this study, high-throughput 16S rRNA sequencing and metatranscriptome analyses were carried out to investigate the microbial community in the surface water immediately above a white hydrothermal vent and the bottom water next to the vent (Supplementary Figure S1 ). The potentially metabolically active bacterial compositions and metabolic pathways in the hydrothermal ecosystem were determined to improve our understanding of biogeochemical processes mediated by microorganisms and coupling of the carbon, sulfur, and nitrogen cycles in the water column of this unique ecosystem, driven by both sunlight and geothermal energy.",
"discussion": "Results and Discussion Biogeochemical Conditions Physicochemical parameters were measured at three depths in the water column and from the hydrothermal vent fluids (Table 1 and Supplementary Figure S2 ). The water column pH values ranged from 6.24 to 7.05 because they were influenced by the acidic hydrothermal vent fluids (pH 5.34). Temperatures varied from 23.6°C to 24.1°C, and were much lower than the vent fluids (48°C). Salinity (34.19–34.52) and DIC concentrations (2028-2040 μmol L -1 ) were almost constant within the water column, but lower and higher, respectively, in the vent fluids (salinity: 33.76; DIC: 2352 μmol L -1 ). Total alkalinity ranged from 1637 to 2038 μmol L -1 , with the minimum in the BW. The nitrate and nitrite concentrations varied from 0.14 to 2.86 μmol L -1 and 0.03 to 0.32 μmol L -1 , respectively. The silicate concentrations decreased with depth, ranging from 5.3 to 15 μmol L -1 . The phosphate concentrations were below detection limit. Overall, the shallow-water hydrothermal ecosystem was characterized by acidic vent fluids that were well mixed with seawater. Sulfide (S 2- ) concentrations were not measured in this study. Our previous studies suggested that compared with deep-sea vents, sulfide was relatively lower in this shallow vent system, varying from 0.01 to 0.85 mg L -1 ( Zhang et al., 2012 ). Tang et al. (2013) also reported a similar range of sulfide concentrations from 0.11 mg L -1 in the water in the vent to 0.01 mg L -1 in the surface water. Table 1 Physicochemical parameters of the hydrothermal ecosystem in this study. Sample Depth (m) pH Temperature (°C) Salinity DIC (μmol L -1 ) TA (μmol L -1 ) NO 3 - (μmol L -1 ) NO 2 - (μmol L -1 ) SiO 3 2- (μmol L -1 ) Surface (SW) 0 6.24 24.1 34.19 2028 1865 2.61 0.32 15 Middle 7 7.05 – 34.52 2040 2038 0.14 0.17 6.8 Bottom (BW) 15 6.78 23.6 34.46 2040 1637 2.86 0.25 5.3 Vent fluids 19 5.34 48 33.76 2352 1947 0.77 0.03 – DIC, dissolved inorganic carbon; TA, total alkalinity . Phylogenetic Identification of Active Bacteria Communities A total of 65,925 and 67,591 qualified reads were rendered from the 16S rRNA libraries of the SW and BW, respectively (Supplementary Table S1 ). Estimates of bacterial community diversity indicated that there were no significant differences between SW and BW (Supplementary Table S2 ). Ribotypes of tags were identified phylogenetically and grouped by phylum, order, family, or genus. Gammaproteobacteria and Epsilonbacteraeota were the overwhelmingly dominant groups in the water column of the hydrothermal ecosystem (Figure 1A ). The sulfide-oxidizing Thiomicrospira , which belongs to Thiotrichales, was the most abundant group within Gammaproteobacteria (Figure 1B ) as well as the total libraries with 81.69% of the total tags in the BW library and 43.5% in the SW library. The second most abundant group in the total libraries was the family Helicobacteraceae (mostly unclassified) in Epsilonbacteraeota (Figure 1C ), with 27.34% of the total tags in the SW library and 5.24% in the BW library. At the genus level, sulfur-oxidizing bacteria Sulfurimonas (Thiovulaceae), Arcobacter (Arcobacteraceae), and Sulfurovum (Sulfurovaceae) were the most abundant within Epsilonbacteraeota (Figure 1C ). Some sulfur-oxidizing bacterial species of the genus Sulfurimonas were also nitrate-reducing bacteria that accept electrons from the oxidation of reduced inorganic sulfur compounds ( Waite et al., 2017 ). These autotrophic denitrifiers have been frequently identified from diverse ecosystems, such as deep-sea hydrothermal vents and the central Baltic Sea ( Takai et al., 2005 ; Brettar et al., 2006 ). Sulfur oxidation coupled with dissimilatory nitrate reduction is usually an important source of energy for DIC fixation in hydrothermal vents ( Shao et al., 2010 ). All but one of the Sulfurimonas species can also use H 2 as an energy source ( Han and Perner, 2014 , 2015 ). Autotrophic sulfur-oxidizing Gammaproteobacteria and Epsilonbacteraeota were the dominant microorganisms in this shallow-water hydrothermal ecosystem, and may significantly contribute to primary production utilizing reduced sulfur compounds as electron donors ( Brazelton and Baross, 2010 ; Campbell et al., 2013 ). FIGURE 1 Phylogenetic taxon distribution among the bacterial RNA-based libraries. (A) Relative abundance of bacterial phyla or classes in total tags of each library. (B) Relative abundance of bacterial orders or genera in total gammaproteobacterial tags. (C) Relative abundance of bacterial orders, families, or genera in total epsilonbacteraeota tags. (D) Relative abundance of bacterial orders or clades in total alphaproteobacterial tags. The family Nautiliaceae was the second most abundant group within Epsilonbacteraeota with 3.55% of the total tags in the BW library and 2.05% in the SW library (Figure 1C ), and contains the genera Lebetimonas and Nautilia as well as a large number of unclassified taxa. Members of this family are moderate thermophiles growing optimally between 40 and 60°C ( Nakagawa and Takai, 2014 ). Under autotrophic conditions, Nautiliaceae members have an ability to grow anaerobically via respiratory S 0 reduction with H 2 , utilizing H 2 as an electron donor and S 0 and other reduced compounds as electron acceptors ( Campbell et al., 2006 ; Meyer and Huber, 2014 ; Nakagawa and Takai, 2014 ). The Alphaproteobacteria were mainly composed of the SAR11 clade, which was more abundant in SW than BW (Figure 1D ). The abundance of SAR11 in shallow hydrothermal vents may be the result of vent fluids mixing with seawater, since the SAR11 clade is widely distributed in surface seawater ( Morris et al., 2002 ). It has been reported that the SAR11 clade does not possess genes mediating assimilatory sulfate reduction and thus they would require exogenous reduced sulfur for their metabolism ( Tripp et al., 2008 ). So, high reduced sulfur conditions may also explain SAR11 abundance in the Kueishantao hydrothermal ecosystem. Rhodobacteraceae, which belongs to Rhodobacterales, was the second most abundant Alphaproteobacteria in BW (Figure 1D ). Rhodobacteraceae comprises mainly aerobic photoheterotrophs and chemoheterotrophs, as well as purple non-sulfur bacteria that perform photosynthesis in anaerobic conditions; they are deeply involved in sulfur and carbon biogeochemical cycling ( Pujalte et al., 2014 ). Cyanobacteria, assigned to Synechococcus , had a relative abundance of 0.12%-1.7% in the SW and BW 16S rRNA libraries (Figure 1A ), which could be the result of vent fluids mixing with seawater. Cyanobacteria carry out oxygenic photosynthesis in the surface water and may switch to anoxygenic photosynthesis at vents where H 2 S is high ( Cohen et al., 1975 , 1986 ; Padan, 1979 ). Further studies are needed to verify this switch. These results indicate the co-occurrence of chemoautotrophs and photoautotrophs/heterotrophs in a shallow-water hydrothermal vent, which is distinctly different from deep-sea hydrothermal ecosystems ( Tarasov et al., 2005 ). Overall, the dominant active microorganisms in the shallow hydrothermal ecosystem were chemoautotrophic bacteria that mostly have the potential to perform sulfur oxidation and reduction, followed by phototrophs. Therefore, the ecosystem is driven by energy derived mainly from sulfur redox reactions and light. Hydrogen might also be an important energy source for this ecosystem, as sulfur-oxidizing Sulfurimonas species and sulfur-reducing Nautiliaceae species utilize H 2 as an electron donor and they were found in the active assemblages ( Muyzer et al., 1995 ; Brinkhoff et al., 1999 ). These results suggest multiple types of energy generation are performed in this system. Biogeochemical conditions to some extent determine the community composition and type of energy generation. Our previous study indicated that CH 4 concentration was the statistically significant variable that explains the community structure in this shallow-water hydrothermal vent ( Zhang et al., 2012 ). It is because distinctly different CH 4 concentrations shaped different redox environments between the surface and bottom waters and consequently influenced the distribution of the community composition ( Zhang et al., 2012 ). This is consistent with the results of this study where we found higher relative abundance of sulfur-reducing Nautiliaceae species in the BW library than the SW library. This result is also consistent with the finding of one order of magnitude higher sulfide concentration in the vent water than in the surface water ( Tang et al., 2013 ). Major Metabolic Activities and Pathways Carbon Fixation In metatranscriptomes, 16,714 and 34,995 unigenes were obtained from SW and BW, respectively (Supplementary Table S3 ). Previous studies suggested that there are six pathways for CO 2 fixation ( Hügler and Sievert, 2011 ). In this study, all enzymes included in the Calvin-Benson-Bassham (CBB) and the reductive tricarboxylic acid (rTCA) cycles were detected (Figure 2 ). Overall, the relative transcript abundance of genes encoding enzymes in the rTCA cycle did not show a significant difference between the two samples (same order of magnitude). The relative transcript abundance of the key gene encoding ATP-citrate lyase (EC:2.3.3.8) in the rTCA cycle was nearly two times higher in BW. In contrast, another key gene (EC:1.2.7.3, 2-oxoglutarate synthase) had a slightly higher relative abundance in SW. However, the relative transcript abundance of genes encoding enzymes involved in the CBB cycle was one order of magnitude higher in BW, except for the genes encoding ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) (EC:4.1.1.39) and transketolase (EC:2.2.1.1), which were one order of magnitude lower in BW (Figure 2 ). Moreover, the relative transcript abundance of genes encoding RuBisCO was distinctly higher (one to six orders of magnitude) than all other genes involved in the rTCA and CBB cycles. The rTCA cycle is universal in hydrothermal vent environments; it is performed by chemoautotrophic Epsilonbacteraeota ( Hügler et al., 2005 ), and is the most economical pathway of carbon fixation in bacteria ( Mangiapia and Scott, 2016 ). This pathway is particularly advantageous in an energy-limited environment ( Oulas et al., 2016 ). The CBB cycle was the first carbon fixation pathway to be discovered about 60 years ago ( Wilson and Calvin, 1955 ), and autotrophic Gammaproteobacteria mainly perform carbon fixation through this pathway ( Hügler and Sievert, 2011 ). FIGURE 2 Carbon fixation pathways identified in the metatranscriptomes based on Kyoto Encyclopedia of Genes and Genomes pathway maps. Enzyme classification (EC) numbers for each step are included in boxes. The box color indicates relative abundance of reads in total mapped reads for each enzyme; red indicates higher relative abundance and blue lower relative abundance. The surface water (SW) is always shown on the left and bottom water (BW) on the right. Key enzymes are marked with an asterisk. A bold border indicates dual functional proteins. Gray represents absence. rTCA, reductive tricarboxylic acid cycle; CBB, Calvin-Benson-Bassham cycle. Sulfur Cycle In hydrothermal ecosystems, sulfur redox reactions mediated by chemoautotrophic bacteria are the main processes for energy production and reliant upon hydrothermal vent fluids as an energy source ( McCollom, 2000 ). In shallow-water hydrothermal vents, as metatranscriptome analyses revealed, oxidation of reduced sulfur compounds can play a key role in energy production. For example, gene encoding enzymes that catalyze sulfur compound oxidations from the most reduced sulfur species (–II) to the most oxidized inorganic form (+IV) were fully restored in the metatranscriptomes (Figure 3 ). The reverse sulfate reduction pathway includes the sulfide oxidation step involving flavocytochrome c sulfide dehydrogenase (FccAB), which initiates electron flow from sulfide to the transport chain. It also includes steps of sulfur oxidation to sulfite catalyzed by dissimilatory sulfite reductase (EC:1.8.99.5) and sulfite oxidation to sulfate catalyzed by sulfite dehydrogenase (EC:1.8.2.1). Additionally, sulfide/disulfide could be oxidized to sulfite catalyzed by assimilatory NADPH-sulfite reductase (EC:1.8.1.2) and ferredoxin-sulfite reductase (EC:1.8.7.1). The Sox pathway was another important sulfur oxidation pathway found in the Kueishantao white hydrothermal vent, as sox ABCDXYZ genes encoding the thiosulfate oxidation multienzyme complex were retrieved from the metatranscriptomes (Figure 3 ). In addition, the sulfate adenylyltransferase (EC:2.7.7.4) and adenylylsulfate reductase (EC:1.8.99.2) were also identified in both BW and SW; these are involved in the energy-yielding dissimilatory sulfate reduction pathway (Figure 3 ). These results are consistent with the active bacterial community compositions, in which a large fraction of sulfur-oxidizing bacteria and a small number of sulfate-reducing bacteria were retrieved from the shallow hydrothermal vent. Overall, the relative transcript abundances of genes encoding the enzymes involved in these sulfur redox reactions were one to two orders of magnitude higher in BW than SW. The only exceptions were the sox B gene and the gene encoding sulfate adenylyltransferase, which were comparable between the two samples. FIGURE 3 Sulfur metabolic pathways identified in the metatranscriptomes based on Kyoto Encyclopedia of Genes and Genomes pathway maps. Enzyme classification (EC) numbers for each step are included in boxes. The box color indicates relative abundance of reads in total mapped reads for each enzyme. The color scheme is the same as in Figure 2 . Gray represents absence. SO 4 2- , sulfate; SO 3 2- , sulfite; S 0 , sulfur; S 2 O 3 2- , thiosulfate; S 2- sulfide; APS, adenylyl sulfate; FccAB, flavocytochrome c/sulfide dehydrogenase; SOX, thiosulfate oxidation multienzyme complex. Nitrogen Cycle Denitrification, coupled to sulfur oxidation, usually plays an important role in most hydrothermal vent environments ( Bourbonnais et al., 2012 , 2014 ; Voss et al., 2013 ; Dang and Chen, 2017 ). Genes encoding dissimilatory nitrate reductase (EC:1.7.99.4, nap AB and nar GHI) and nitrite reductase (EC:1.7.2.1, nitric oxide-forming), involved in denitrification, were found in the metatranscriptomes from both SW and BW (Supplementary Table S4 ). The transcripts of genes encoding assimilatory nitrate reductase (EC:1.7.99.4, nar B and nas A, and EC:1.7.1.1), NAD(P)H-nitrite reductase (EC:1.7.1.4), and ferredoxin-nitrite reductase (EC:1.7.7.1) were also retrieved from the metatranscriptomes (Figure 4 ). Nitrate and nitrite could be important electron acceptors when dissimilatory nitrate reduction (to ammonium, DNRA, or denitrification) is coupled to sulfur oxidation reactions ( Nakagawa and Takai, 2008 ; Dang and Chen, 2017 ). For example, the sulfur and thiosulfate-oxidizing bacteria Sulfurovum sp., which were detected in the 16S rRNA libraries, have been reported to use nitrate or oxygen as electron acceptors ( Inagaki et al., 2004 ; Giovannelli et al., 2016 ; Dang and Chen, 2017 ). In the present study, the transcripts of genes encoding nitrite reductase (ammonia-forming) related to DNRA (e.g., NirBD and NrfAH, according to the Kyoto Encyclopedia of Genes and Genomes) were not retrieved. Previous studies indicated that DNRA (nitrite ammonification) was mainly important in relatively reducing environments, as found in nutrient-rich coastal sediments ( Rysgaard et al., 1996 ; Christensen et al., 2000 ; An and Gardner, 2002 ), while denitrification was more important in low to moderate organic-loading sediments ( Fossing et al., 1995 ; Zopfi et al., 2001 ). For instance, a metagenomics analysis of sulfur-oxidizing Gammaproteobacteria from a coastal ecosystem in the eastern South Pacific suggested a coupling of sulfur oxidation and DNRA in oxygen-deficient waters ( Murillo et al., 2014 ). FIGURE 4 Nitrogen metabolic pathways identified in the metatranscriptomes based on Kyoto Encyclopedia of Genes and Genomes pathway maps. Enzyme classification (EC) numbers for each step are included in boxes. The box color indicates relative abundance of reads in total mapped reads for each enzyme. The color scheme is the same as in Figure 2 . Gray represents absence. As nitrification marker genes, the transcripts of ammonia monooxygenase ( amo ABC) genes (EC:1.14.99.39), responsible for ammonia oxidation to hydroxylamine, and nitrite oxidoreductase beta subunit ( nxr B), responsible for nitrite oxidation to nitrate, were retrieved in the metatranscriptomes of SW and BW (Figure 4 ). Thus, there may be a coupling of nitrification and denitrification processes, resulting in nitrogen removal via the nitrite pathway. In addition, the reduction of hydroxylamine and the hydrolysis of urea could produce ammonia in this shallow-water hydrothermal vent, as the genes encoding hydroxylamine oxidase (EC:1.7.99.1) and urease (EC:3.5.1.5) were identified in the metatranscriptomes (Figure 4 ). Ammonia can be stored in glutamine catalyzed by glutamine synthetase (EC:6.3.1.2) or glutamate catalyzed by glutamate dehydrogenase (EC:1.4.1.2 and EC:1.4.1.4). The former could be the main pathway, since the relative transcript abundance of the genes encoding glutamine synthetase was one to three orders of magnitude higher in SW and BW than glutamate dehydrogenase. Overall, the relative transcript abundances of genes encoding enzymes involved in the nitrogen cycle were up to one order of magnitude higher in BW. Detailed information on major carbon, sulfur, and nitrogen metabolic pathways are shown in (Supplementary Table S4 ). Main Players in Major Metabolic Pathways The sequences classified as Gammaproteobacteria, mainly Thiomicrospira , were the most abundant in the metatranscriptome dataset, which was consistent with the 16S rRNA libraries analysis that showed Thiomicrospira as having the highest abundance active population (Supplementary Table S5 ). Gene annotation and functional analysis indicated that the gammaproteobacterial genera Thiomicrospira, Thiomicrorhabdus, Hydrogenovibrio , and Thiothrix , Epsilonbacteraeota genera Lebetimonas and Caminibacter (Nautiliaceae), Sulfurovum and Nitratifractor (Sulfurovaceae), Sulfurimonas and Sulfuricurvum (Thiovulaceae), and Arcobacter (Arcobacteraceae), as well as Cyanobacteria (mainly Synechococcus and Prochlorococcus ) and Archaea (Thaumarchaeota and Crenarchaeota) were the main autotrophic players in carbon fixation, and nitrogen and sulfur metabolism (Figure 5 ). FIGURE 5 Distribution of relative transcript abundance of genes encoding enzymes included in carbon fixation, and nitrogen and sulfur metabolism among phylogenetic taxa. For the carbon fixation pathway, dark circles indicate reads of genes encoding key enzymes (marked with an asterisk in Figure 2 ); light circles indicate reads of genes encoding enzymes involved in each pathway. SW, surface water immediately above the vent; BW, bottom water next to the vent. The most abundant transcript sequences belonged to Thiomicrospira (mainly T. crunogena XCL-2), most of which was involved in the CBB cycle (mainly RuBisCO sequences) (Figure 5 ). Thiomicrospira crunogena was originally isolated from the East Pacific Rise ( Jannasch et al., 1985 ), and was subsequently detected in deep-sea hydrothermal vents ( Wirsen et al., 1998 ) as well as shallow-water hydrothermal vents ( Muyzer et al., 1995 ; Brinkhoff et al., 1999 ). It has been known as the representative ubiquitous chemolithoautotrophic sulfur-oxidizing bacteria ( Scott et al., 2006 ) and has a remarkably high growth rate ( Jannasch et al., 1985 ). In addition, the transcript sequences belonging to Thiothrix (mostly T. nivea DSM 5205), encoding RuBisCO, transketolase, and fructose-1,6-bisphosphatase in the CBB cycle, as well as FccAB and sox X, were retrieved from our metatranscriptome data. Thus, T. nivea could be chemolithoautotrophic via the CBB cycle or mixotrophic, since it has been reported to grow under heterotrophic conditions ( Lapidus et al., 2011 ). A number of sequences classified as Thiomicrorhabdus within Gammaproteobacteria encoded assimilatory NAD(P)H-nitrite reductase and glutamine synthase, transketolase, and fructose-1,6-bisphosphate aldolase in the CBB cycle, as well as sulfate adenylyltransferase, FccAB, and sox ABY. The transcript sequences within Epsilonbacteraeota were involved in the rTCA pathway, dissimilatory/assimilatory nitrate reduction, and sulfur oxidizing/reducing processes (Figure 5 ). Nautiliaceae is a typical sulfur-reducing bacterial family living in hydrothermal vents, which can get energy from the oxidation of H 2 or formate coupled with reduction of S 0 , to produce H 2 S ( Hanson et al., 2013 ; Nakagawa and Takai, 2014 ). In our metatranscriptomes, they were abundant and involved in dissimilatory nitrate reduction, but very few were involved in sulfate reduction. For example, Lebetimonas had the most abundant transcript sequences in the total sequences involved in dissimilatory nitrate reduction (89.1% in SW and 54.1% in BW). All sequences belonging to Caminibacter were classified to C. mediatlanticus . Although they have been identified as sulfur or nitrate-reducing bacteria ( Voordeckers et al., 2005 ), the sequences retrieved from our metatranscriptomes mainly related to the oxidation of sulfide to sulfur and the rTCA pathways. Sulfurovum (Sulfurovaceae) are typical (not strictly anaerobic) sulfur-oxidizing bacteria that can utilize nitrate or oxygen as electron acceptors ( Inagaki et al., 2004 ). Nitratifractor , previously belonging to Nautiliaceae, were reclassified to Sulfurovaceae ( Waite et al., 2017 ). In our metatranscriptomes, all sequences belonging to Nitratifractor were classified to N. salsuginis and mainly related to sulfur oxidation and rTCA pathways. Sulfurimonas denitrificans is a nitrate-reducing, sulfur-oxidizing species, but other Sulfurimonas species sequences retrieved from our metatranscriptomes were involved in assimilatory nitrate reduction, ammonia incorporation to glutamine, and glutamate pathways. The sequences assigned to Sulfuricurvum are associated with dissimilatory nitrate reduction, glutamine and cysteine synthesis, dissimilatory sulfate reduction, and rTCA pathways, although Sulfuricurvum species were reported to be sulfur-oxidizing bacteria ( Kodama and Watanabe, 2004 ). Arcobacter had the most abundant transcript sequences in total sequences involved in sulfur metabolism, encoding sulfite dehydrogenase, FccAB, sox ABCDXYZ, and cysteine synthase. Moreover, in our metatranscriptomes, hydrogenase sequences were identified in sulfur-reducing Lebetimonas and sulfur-oxidizing Sulfurimonas and Sulfuricurvum (Supplementary Table S6 ), suggesting that they might obtain energy through the oxidation of hydrogen. Notably, Cyanobacteria (mainly Synechococcus and Prochlorococcus ) participated in carbon (CBB cycle), nitrogen (ammonia assimilation), and sulfur (sulfide oxidation and sulfate assimilation) metabolism, although they were less abundant in the active population of the two 16S rRNA libraries (Figure 5 and Supplementary Table S5 ). Most Cyanobacteria are highly sensitive to sulfide toxicity ( Oren et al., 1979 ), but some species are sulfide resistant ( Cohen et al., 1986 ) or perform anoxygenic photosynthesis using sulfide rather than water as the terminal reductant ( Frier et al., 1999 ; Kulp et al., 2008 ; Stal, 2012 ). A recent study indicated that under darkness and anoxygenic conditions, hydrogen in H 2 S accelerated the recovery of photosynthesis, and even enhanced photosynthetic rates at a given H 2 S concentration at low irradiance ( Klatt et al., 2015 ). The geochemical properties of shallow-water hydrothermal environments possibly have retained many of the characteristics of the Earth’s early ocean ( Baross and Hoffman, 1985 ) and thus Cyanobacteria in the habitat studied here may also preserve some of these characteristics. In addition, archaeal sequences were also retrieved, and belonged to Thaumarchaeota and Crenarchaeota, which were only involved in the nitrogen cycle, including amo ABC and nitrite reductase ( nir K). Sequences associated with the archaeal carbon fixation pathway, 3-hydroxypropionate/4-hydroxybutyrate (HP/HB) cycle, were not found (Figure 5 ). Most of the reads within Alphaproteobacteria were associated with organic carbon metabolism and belonged to Rhodospirillales. However, the most abundant transcript sequences within Alphaproteobacteria involved in nitrogen and sulfur metabolism (sulfur oxidation, cysteine synthesis, and glutamine/glutamate synthesis) belonged to the order Rhodobacterales (Figure 5 ). Moreover, the transcript sequences encoding bacteriochlorophyll synthase were retrieved and assigned to Ahrensia , which is a typical aerobic photoheterotrophic genus in Rhodobacteraceae. The reads belonging to the SAR11 clade only accounted for ∼2% in SW and ∼7% in BW in our metatranscriptomes, despite the high proportions within Alphaproteobacteria in the two 16S rRNA libraries (∼73% in SW and ∼36% in BW); these transcript sequences are associated with glutamine and cysteine synthesis and dissimilatory sulfate reduction pathways. The most abundant transcript sequences within heterotrophic Gammaproteobacteria involved in nitrogen and sulfur metabolism belonged to Alteromonadales (Figure 5 ). Stress Tolerance Most genes related to stress tolerance showed higher relative transcript abundance in BW, including genes encoding multiple molecular chaperones, anaerobic regulator proteins, and various antioxidant genes (Supplementary Figure S3 ). In addition, the relative transcript abundances of genes encoding DNA mismatch repair proteins were high in both SW and BW (Supplementary Figure S3 ). The DNA mismatch repair system plays a vital role in an organism’s response to DNA damage and maintains genomic stability. These results suggest that the microbial communities have evolved extensive DNA repair systems, such as heat shock stress response systems and regulators of anaerobiosis or antioxidant systems, to cope with the extreme conditions present at a hydrothermal vent ( Kiley and Beinert, 1998 ; Xie et al., 2011 )."
} | 9,133 |
32639625 | PMC7533337 | pmc | 9,399 | {
"abstract": "Summary The multi‐enzyme cellulosome complex can mediate the valorization of lignocellulosic biomass into soluble sugars that can serve in the production of biofuels and valuable products. A potent bacterial chassis for the production of active cellulosomes displayed on the cell surface is the bacterium Lactobacillus plantarum , a lactic acid bacterium used in many applications. Here, we developed a methodological pipeline to produce improved designer cellulosomes, using a cell‐consortium approach, whereby the different components self‐assemble on the surface of L. plantarum. The pipeline served as a vehicle to select and optimize the secretion efficiency of potent designer cellulosome enzyme components, to screen for the most efficient enzymatic combinations and to assess attempts to grow the engineered bacterial cells on wheat straw as a sole carbon source. Using this strategy, we were able to improve the secretion efficiency of the selected enzymes and to secrete a fully functional high‐molecular‐weight scaffoldin component. The adaptive laboratory process served to increase significantly the enzymatic activity of the most efficient cell consortium. Internal plasmid re‐arrangement towards a higher enzymatic performance attested for the suitability of the approach, which suggests that this strategy represents an efficient way for microbes to adapt to changing conditions.",
"introduction": "Introduction Lignocellulosic biomass is the most abundant renewable resource of organic material on Earth (Lamed and Bayer, 1988 ; Bayer et al. , 2008 ). Therefore, it represents a major portion in the agricultural residues and in the municipal solid waste (Bayer et al. , 2007 ; Fatma et al. , 2018 ). Most of the lignocellulose biomass is composed of sugars that could directly serve in alcoholic fermentations for the production of valuable products. The sugars are arranged in two main polysaccharide groups – cellulose and hemicellulose – that can be efficiently deconstructed by multi‐enzyme complexes termed cellulosomes (Bayer et al. , 1983 ; Bayer et al. , 2013 ; Artzi et al. , 2017 ). These unique extracellular enzymatic complexes are composed of many interacting proteins: that is, the enzymatic subunits and the non‐enzymatic scaffoldins that organize them into the complex. Although cellulosome complexes vary greatly in modular architecture, both between and within the different bacterial species, the molecular basis which determines their assembly comprises the high‐affinity intermodular interactions between a cohesin module and a complementary dockerin module, located on the different interacting components. The scaffoldins are generally non‐catalytic proteins that integrate the dockerin‐containing enzymes via their repeating cohesin modules. The primary scaffoldin subunit also contains a carbohydrate‐binding module (CBM), which binds the substrate very tightly (Bayer et al. , 2004 ). In general, the primary scaffoldin also bears an anchoring motif that attaches the cellulosome complex to the bacterial cell wall, and it thus mediates between the bacterium and its substrate (Lemaire et al. , 1995 ; Lemaire et al. , 1998 ; Rincon et al. , 2005 ). Cellulosome organization facilitates high levels of synergy among the catalytic subunits via substrate channelling (Moraïs et al. , 2011 ; Zhang, 2011 ; Wieczorek and Martin, 2012 ). The proximity of the substrate/cellulosomes/bacterial cell minimizes the diffusion of the hydrolytic products and enzymes, providing the bacterium with a competitive advantage over cellulosome non‐producers (Shoham et al. , 1999 ). The cohesin–dockerin interaction is generally species specific (Pages et al. , 1997 ; Haimovitz et al. , 2008 ), and this feature forms the basis for creation of ‘designer cellulosomes’ – enzymatic complexes in which we can control the position and stoichiometry of the enzymes on the scaffoldin subunit (Bayer et al. , 1994 ; Fierobe et al. , 2005 ; Moraïs et al. , 2012 ). Efficient designer cellulosomes would comprise the three major types of cellulases, that is exoglucanases, endoglucanases and β‐glucosidases, which are responsible for efficient deconstruction of cellulose (Kadam and Demain, 1989 ; Bayer et al. , 1998 ; Gefen et al. , 2012 ). In addition, it has been shown that incorporation of both xylanases and cellulases into designer cellulosomes further enhances the synergism among the different enzymes and improves degradation of complex cellulosic substrates (Moraïs et al. , 2010 ). In recent years, the lactic acid bacterium, Lactobacillus plantarum , has been successfully engineered to produce designer cellulosomes in vivo and served both as a tool to obtain insights into intrinsic mechanisms of cellulosomal action and as an emerging platform for biomass‐to‐biofuel conversion (Moraïs et al. , 2014 ; Stern et al. , 2017 , 2018 ). The engineered bacterium has proven a suitable producer of cellulases, hemicellulases and cellulosomal components. Indeed, the functionality and stability of the enzymes, the cohesins and the dockerins from various bacterial origins were all demonstrated (Moraïs et al. , 2013 , 2014 ; Stern et al. , 2018 ). In addition, the cell‐consortium approach, whereby individual bacterial strains are equipped with single components of the designer cellulosomes, has been shown to be an appropriate strategy to produce functional designer cellulosomes in which the stoichiometry of the components can be controlled (Stern et al. , 2018 ). The resultant secretion of the recombinant dockerin‐bearing enzymes and their self‐assembly onto the chimaeric cohesin‐containing scaffoldin displayed on the bacterial cell surface thus form the final designer cellulosome. In general, fabrication of this type of surface‐displayed enzyme complex would be an attractive strategy for many biotechnological and pharmaceutical applications. L. plantarum is highly suitable for this propose, since it is a generally recognized as safe (GRAS) bacterium that has already been used in many industrial and agricultural applications (Mazzoli et al. , 2014 ). Adaptive laboratory evolution (ALE) is a useful tool that allows selection of desirable phenotypes through natural evolution in a laboratory environment. In ALE, microbial populations are allowed to grow for extended periods under specified conditions, after which genetic variations that occurred and which improved the phenotypic traits of the culture can be detected. This method has been applied for a variety of applications, and there are increasing perspectives for advancing this technology (Wondraczek et al. , 2019 ). For example, this approach has been successfully demonstrated for xylan utilization in Lactobacillus pentosus, Saccharomyces cerevisiae and Bacillus subtilis (Shen et al. , 2012 ; Zhang et al. , 2015 ; Cubas‐Cano et al. , 2019 ). In another study, Lactobacillus lactis was adapted to grow at 39°C by slowly increasing the growth temperature (Chen et al. , 2015 ). This method is also suitable for complex communities like microbial consortia. In this context, Liu et al. successfully adapted a consortium of three bacterial species for higher biobleaching performance (Liu et al. , 2019 ). Here, we applied this approach in an attempt to adapt an L. plantarum cell consortium to grow on wheat straw. \n Lactobacillus plantarum is a well‐characterized lactic acid bacteria (LAB), prevalent in a variety of environmental niches, including some meat, dairy, plant fermentations and in the human gastrointestinal tract (Ahrne et al. , 1998 ; Kleerebezem et al. , 2003 ). This bacterium can grow in the presence of up to 13% (v/v) ethanol in the medium and at pH 3.2 (Alegria et al. , 2004 ). Therefore, it is frequently found in contaminated ethanol fermentations (Limayem et al. , 2011 ; Roach et al. , 2013 ). Furthermore, deconstruction of lignin from plant biomass commonly involves acid pretreatment that needs to be removed (Bayer et al. , 2007 ). In this context, L. plantarum may be added to initial degradation steps due to its production of lactic acid and acid tolerance and would therefore present a potential economic advantage. In addition, L. plantarum can be used in many bioremediation applications, such as for removal of cadmium and lead, which are the two most abundant toxic heavy metals in the environment (Kirillova et al. , 2017 ). L. plantarum is also known as a probiotic, due to its health‐promoting effects in humans, which include cholesterol lowering, diarrhoea prevention and reduction in the symptoms of irritable bowel syndrome (Ducrotte et al. , 2012 ; Bosch et al. , 2014 ; Yang et al. , 2014 ; Seddik et al. , 2017 ). Moreover, several L. plantarum strains are known to produce different antimicrobial compounds, such as organic acids, and antimicrobial peptides, such as bacteriocins, which can be used in food preservation (Zhang et al. , 2013 ; Todorov et al. , 2018 ). In this context, improving the tools for producing and secreting desired products in L. plantarum can prove relevant for many applications. Here, we used a methodological pipeline to produce improved designer cellulosomes on the surface of L. plantarum. Our pipeline comprises (i) selection of highly active enzymes, (ii) optimized secretion of the selected enzymes and structural cellulosomal proteins (scaffoldins), (iii) selection of the most active enzymatic combinations and (iv) adaptive evolution of the most active enzymatic combination for improvement of growth on wheat straw as a sole carbon source.",
"discussion": "Discussion In this study, we have searched for the most suitable and efficient cell‐surface designer cellulosome for production by L. plantarum cells. For this purpose, we established a methodological pipeline, in which several aspects were investigated, including selection of designer cellulosome enzymes, secretion efficiency of the enzymes, optimized enzymatic combination for integration into the mature cell‐surface designer cellulosome and the ability of the cells to grow on wheat straw as a sole carbon source. Protein secretion efficiency plays a key role in the cell‐consortium approach, whereby each L. plantarum strain expresses and secretes an individual cellulosomal component, which then self‐assemble onto the cell‐surface scaffoldin(s) of one of the strains. The secretion efficiency of heterologous proteins is difficult to predict, since it depends on an optimal combination between the signal peptide, the target protein, and the protein expression and secretion rate (Le Loir et al. , 2005 ; Brockmeier et al. , 2006 ; Mathiesen et al. , 2009 ). The work by Mathiesen et al. ( 2009 ) employed the pSIP system to compare the secretion efficiency of the staphylococcal nuclease (NucA) reporter enzymes with 76 signal peptides of L. plantarum . The authors indeed found significant differences between the efficiency of the different signal peptides. Moreover, when they tested the secretion efficiency with the lactobacilli amylase (AmyA), no correlation was observed between the best signal peptides for NucA and the best signal peptides for AmyA. Likewise, similar results were obtained in an extensive work on 173 signal peptides of Bacillus subtilis (Brockmeier et al. , 2006 ). The optimal signal peptide for the cutinase gene was completely different than the one for esterase gene. We therefore examined five different signal peptides originating from proteins with various molecular weights from the genome of L. plantarum to optimize the secretion of our six recombinant proteins. In doing so, we considered whether a connection would exist between molecular weights of the original protein and the ability to secrete heterologous proteins of similar size, but here no correlation was observed. Nevertheless, our results demonstrate that signal peptide screening is an important step towards heterologous protein expression. A previous study reported that Lp_3050 was the most efficient signal peptide for secretion of the low‐molecular‐weight protein, NucA (Mathiesen et al. , 2009 ). However, in this study, while the same signal peptide performed well for Cel5‐ g (52.4 kDa) and Xyn10‐ t (45.8 kDa) secretion, it was very inefficient for Xyn11‐ a (34.2 kDa). In contrast, Lp_2588 was one of the most efficient signal peptides for the majority of the proteins, while it was only of moderate efficiency for NucA (Mathiesen et al. , 2009 ). With this signal peptide screening procedure, we were able to find preferred signal peptides for efficient secretion of high‐molecular‐weight proteins, such as the exoglucanase Cel48‐ b (87 kDa) and the scaffoldin Scaf‐ ATGB (112 kDa). Moreover, in our previous report (Stern et al. , 2018 ), we were unable to secrete a full functional Scaf‐ ATGB by using the original pLp_0373sOFAcwa2 anchoring plasmids (Fredriksen et al. , 2010 ). This was corrected in the current work where satisfactory levels of surface‐attached Scaf‐ ATGB were achieved using Lp_2588. These results are important within the context of designer cellulosome research, since many of its components are large proteins, especially the cellulases and scaffoldins. Secreted proteins are diluted in the environment and are more accessible to proteolytic degradation (Wells and Mercenier, 2008 ). In contrast, when proteins are anchored to the microbial surface their on‐site concentrations are higher and they are more stable (Moraïs et al. , 2014 ; Stern et al. , 2018 ). Here, we have focused our study on anchored designer cellulosomes, which have proven more efficient in their fibre‐degrading capacity in L. plantarum . In this work, we successfully expressed and displayed large designer cellulosomes on the cell surface of L. plantarum . We thus examined the performance of six consortia that differed in their enzymatic combinations, in order to reveal the contribution of each enzyme in the cellulosomal system. We found that the majority of the degradation of the wheat straw substrate could be attributed to the enzymatic action of the xylanases, particularly by the Xyn10‐producing cells, in the presence or absence of the cellulases. Thus, the degradation products (reducing sugars) are mainly derived from hemicellulose. However, it is possible that some cellulose degradation still occurred, but the products were consumed by the active cells in the pellet. Although hemicellulose degradation products are not consumed by the bacterium (Stern et al. , 2018 ), it is necessary to retain the xylanase activity in the designer cellulosome consortium for removal of the xylan component of the fibre that prevents physical access of the cellulases to the cellulose substrate in the plant cell wall. L. plantarum is able to grow on minimal concentrations of ~ 5.5 mM cellobiose, (Stern et al. , 2018 ), a level which was not attained here in this work. Hence, there remains a need for merging the gap between the low amount of cellobiose obtained by the designer cellulosome machinery and the minimal cellobiose concentration needed for bacterial growth. The cell‐consortium approach considerably decreases the burden of the cellular machinery of each strain, thereby maximizing their ability to grow and to express the various cellulosomal components. We have used the adaptive laboratory approach for adaptation of the L. plantarum consortium to grow on wheat straw as a sole carbon source. This approach has been successfully demonstrated for xylan utilization in Lactobacillus pentosus , S. cerevisiae and B. subtilis (Shen et al. , 2012 ; Zhang et al. , 2015 ; Cubas‐Cano et al. , 2019 ). The tested consortium was assembled by combination of five L. plantarum strains, where each strain expresses and secretes a different protein, that is Cel5, Cel9, Xyn10, Xyn11 and Scaf‐ ATGB . We designed the experiment such that equal amounts of L. plantarum transformed strains were mixed for consortium assembly. We were interested in consortia adaptation of the plasmid copy number that could result in improved degradation ability of the wheat straw substrate. The consortia were grown consistently in the presence of antibiotic, in order to prevent plasmid loss. We noticed that already at day 11, variations in plasmid organization among the three consortia occurred and remained stable during the remainder of the experiment. By the end of the experiment, only three out of the five original plasmids were found in the three consortia. The lost plasmids were those that encoded the high‐molecular‐weight genes, that is the genes for Cel9 (79 kDa) and Scaf‐ ATGB (112 kDa), thus suggesting a fitness cost. Interestingly, the scaffoldin itself that does not provide degradation ability to the bacterium was lost, which suggests that in the experimental context only degradation capabilities were selected. Furthermore, the Cel9 enzyme was the least active of the inserted enzymes (Fig. S1 ), suggesting selection for higher degrading capabilities. The three consortium D replicates evolved into three different consortia that produced three different combinations of enzymes, all of which exhibited an increase in at least one fibrolytic capability. These differences in the three repetitions of consortium D could stem from random genetic drift in the cell population, due to the repetitive sampling step between the transfers. Indeed, it was shown previously that decreasing the population bottleneck (increasing dilution rates between transfers) resulted in lower genetic diversity in bacterial populations (Wein and Dagan, 2019 ). Consortium D1 produced only xylanase activity, consortium D2 both xylanase and cellulase activity, while consortium D3 produced only cellulase activity. However, only the combination of cellulases and xylanases, as produced by consortium D2, demonstrated improvement in plant fibre‐degradation ability, which emphasizes the importance of combining enzymes with different functions in the designer cellulosome. Moreover, this increase in activity was achieved via plasmid rearmament and not due to changes in gene sequence. We conclude this from the similar levels of performance of consortium D2 and a consortium ('pseudo'‐consortium D2) that had the same plasmid ratio as consortium D2 without going through the adaptive process, which suggests that the improvement observed in consortium D2 over the performance of consortia D1 and D2 may be due to plasmid re‐arrangement at the community level. Although it has previously been suggested that plasmids enable microbes to change gene and enzyme numbers in their cells in a rapid manner, our data suggest a potential strategy for microbes for quick adaptation for gene and enzyme stoichiometry at the community level. The work presented in this communication further establishes the potency of L. plantarum for assembly of designer cellulosomes for biodegradation of lignocellulosic biomass. The methodological pipeline herein developed enabled the improvement of secretion efficiency of high‐molecular‐weight cellulosomal components as well as the determination of an optimized enzymatic combination. In addition, the adaptive lab experiment served to obtain a cell consortium with improved enzymatic activity. The re‐arrangement of the plasmid ratio by the bacterial community towards higher fibre‐degradation function could not have been predicted and suggest a novel strategy for rapid adaptation of microbes even at the community level. Potential applications in environmental bioremediation and production of second‐generation biofuels, the development of potent L. plantarum for biomass degradation could serve for assisting fibre‐degrading communities, such as in gut environments. L. plantarum has indeed been demonstrated as one of the most promising LAB strains for carriers of cell‐surface‐displayed vaccines (Kuczkowska et al. , 2019 ). In this context, the proficiency in engineering its bacterial cell surface with high‐molecular‐weight proteins and complexes could be of interest for use as a delivery vehicle of therapeutic compounds such as antigens. Furthermore, expression of cell‐surface scaffoldin will allow the use of multiple antigens that may be beneficial in future clinical applications."
} | 5,090 |
39086500 | PMC11288920 | pmc | 9,400 | {
"abstract": "The fouling resistance of zwitterionic coatings is conventionally explained by the strong hydrophilicity of such polymers. Here, the in vitro biocompatibility of a set of systematically varied amphiphilic, zwitterionic copolymers is investigated. Photocrosslinkable, amphiphilic copolymers containing hydrophilic sulfobetaine methacrylate (SPe) and butyl methacrylate (BMA) were systematically synthesized in different ratios (50:50, 70:30, and 90:10) with a fixed content of photo-crosslinker by free radical copolymerization. The copolymers were spin-coated onto substrates and subsequently photocured by UV irradiation. Pure pBMA and pSPe as well as the prepared amphiphilic copolymers showed BMA content-dependent wettability in the dry state, but overall hydrophilic properties a fortiori in aqueous conditions. All polysulfobetaine-containing copolymers showed high resistance against non-specific adsorption (NSA) of proteins, platelet adhesion, thrombocyte activation, and bacterial accumulation. In some cases, the amphiphilic coatings even outperformed the purely hydrophilic pSPe coatings.",
"conclusion": "5 Summary and conclusion Biomedical applications place high demands on biocompatible coatings regarding the prevention of the non-specific adsorption of proteins, the non-specific adhesion of human cells, and pathogenic microorganisms such as bacteria. Zwitterionic coatings are promising candidates as due to their hydrophilic properties and high hydration they show a remarkable resistance against various accumulation processes. ( Ishihara et al., 1998 ; Ishihara, 2019 ; Lin et al., 2019 ). Here we were able to copolymerize hydrophilic SPe and hydrophobic BMA in different ratios to generate amphiphilic, easily applicable, photocrosslinkable polymer coatings. The resulting homo- and copolymer coatings are very stable in PBS solution and in addition, comprise a high content of SPe. The pure hydrophilic pSPe and also the amphiphilic coatings with up to 50% BMA are consequently very hydrophilic and provide high resistance against the NSA of proteins. The amphiphilic SPe/BMA copolymer coatings inhibit fibroblast adhesion without concomitant cytotoxicity and outperform the pure SPe coatings. The coatings also prevent the adhesion, activation, and thus aggregation of human platelets, not only when the platelets have been previously isolated, but also when the potential blood protein concentration was very high, as in the case of the whole blood experiments. In addition, they do not exhibit erythrotoxicity or leukocyte activation, and resist the adhesion of E. coli . The systematic increase of BMA moieties of up to 50% into the copolymers increased the hydrophobic properties of the coatings in the dry state but did not diminish the high hydrophilic properties in the wet state, i.e., the antiadhesive properties of the amphiphilic coatings were retained. Copolymers of SB and BMA can further reduce the self-assembly of the ionic groups and lead to a more rigid coating overall. In comparison to MPC- and CB-based polymers, SB moieties are less pH- and ion-responsive and not prone to degradation by hydrolysis. ( Schönemann et al., 2018 ). In combination with the high degree of cyto-, hemo-, and immunocompatibility results the investigated class of amphiphilic sulfobetaine-based polymer coatings are promising candidates for blood-related biomedical applications. In this context, further studies are needed to transfer these coatings from model glass surfaces to flexible polyurethane and silicone rubber material surfaces used for blood catheters and indwelling catheters in the urogenital tract.",
"introduction": "1 Introduction Central venous or arterial catheters in permanent blood contact, chest drains, drainage tubes for draining bile, pancreatic secretions, urine or for draining wound fluids, or stents for keeping the ureters open and many other such medical devices have become indispensable in modern surgery or interventional medicine. ( Maki et al., 2006 ; Durai et al., 2009 ; Safdar et al., 2013 ; Feneley et al., 2015 ). Tubular systems used for the transport of body fluids are mostly based on non-biodegradable polymeric biomaterials (e.g., silicones, polyurethanes, etc.) ( Shastri, 2003 ) and only function adequately if their intraluminal diameter remains unchanged and is not constricted or even closed by protein/cell deposits ( Baier, 2006 ), clotted blood ( Suojanen et al., 2000 ), encrustations, ( Tomer et al., 2021 ), or as a result of bacterial adhesion and biofilm formation. ( Veerachamy et al., 2014 ). In order to prevent these adverse effects on the one hand, and to avoid triggering acute or chronic toxic or allergic reactions on the other, high demands are placed on biocompatible coatings for biomedical applications. By preventing non-specific adsorption (NSA) of proteins, the non-specific adhesion of human cells and other microorganisms can also be minimized. This improves hemocompatibility and reduces unwanted inflammatory or immune reactions. The common approach is to use hydrophilic coatings such as polyethylene glycol-based materials because they are highly protein resistant due to their hydrophilic nature. However, the chemical nature of the polyethylene glycol (PEG) structure is prone to oxidation ( Chapman et al., 2000 ; Jiang and Cao, 2010 ; Zheng et al., 2017 ), has shown in some instances to be immunogenic ( Li et al., 2018 ; 2019 ), and provides little opportunity for chemical variations. Another popular class of hydrophilic polymers contains zwitterionic functional groups. ( Jiang and Cao, 2010 ; Zheng et al., 2017 ; Blackman et al., 2019 ; Paschke and Lienkamp, 2020 ). Zwitterions are inspired by membranes of mammalian cells, which bear phospholipids and glycoproteins. ( He et al., 2016 ). Coatings based on phosphatidylcholines (PC), carboxybetaines (CB), sulfobetaines (SB), or sulfabetaines (SAB) incorporate negatively and positively charged groups, which induce strong electrostatic interactions with surrounding water molecules, while the overall charge is neutral. ( Lowe and McCormick, 2002 ; Jiang and Cao, 2010 ; Mi and Jiang, 2014 ; Venault and Chang, 2019 ). The type of functional groups, the orientation of the charged groups within the coating, and the overall architecture of the zwitterions enable a great variety of design and adaption flexibility for low fouling applications. ( Baggerman et al., 2019 ; Blackman et al., 2019 ; Laschewsky and Rosenhahn, 2019 ). Common applications of zwitterion-containing coatings are the usage in biosensors ( Yang et al., 2011 ; Wu et al., 2018 ) as well as for membranes. ( Chang et al., 2011 ; Zhang et al., 2013 ; Liu et al., 2014 ; Duong et al., 2019 ). The addition of hydrophobic components into hydrophilic materials results in amphiphilic coatings which showed superior performance in several experiments. ( Ishihara et al., 1992 ; Colak and Tew, 2012b ; Lin et al., 2019 ; 2020 ; Wu et al., 2019 ; Dun et al., 2020 ). Polymers composed of PC and BMA exhibit a delayed coagulation time and reduced protein adsorption compared to polymers made solely of BMA. ( Ishihara et al., 1992 ). Copolymers of ∼30% CB and ∼70% BMA showed high resistance against fibrinogen (Fb) adsorption. ( Lin et al., 2019 ). In other experiments less systematic trends were observed, as the polybetaines combined with hydrophilic PEG or lipophobic fluorinated residues showed low NSA of proteins while polybetaines with lipophilic alkyl residues showed a higher NSA of proteins. ( Colak and Tew, 2012a ; Colak and Tew, 2012b ). The PC motif is known to improve the hemocompatibility of polymers. ( Hayward and Chapman, 1984 ; Ishihara et al., 1990b ; Ishihara et al., 1992 ; Ishihara et al., 1998 ; Nakaya and Li, 1999 ). For example, Ishihara et al. have co-polymerized 2-methacryloyloxyethyl phosphorylcholine (MPC) with butyl methacrylate (BMA) and demonstrated that increasing the MPC contents improved the non-thrombogenicity of the polymer. ( Ishihara et al., 1992 ). Formulations based on this system with a molar PC content of about 30 mol% are nowadays commercially available as blood-compatible coatings for medical purposes (LIPIDURE-CM5206). ( Ishihara et al., 1990a ; 1990b ; Ishihara, 2019 ). Similarly, CB functionalized monomers were copolymerized with BMA in different ratios to produce different amphiphilic coatings. Coatings with 30 mol% CB showed the best resistance against NSA of fibrinogen, and also demonstrated resistance against albumin, γ-globulin, and serum. Copolymers with more than 30 mol% CB units easily dissolved in an aqueous solution, and therefore, lost their ability to act as a protective coating. ( Lin et al., 2019 ). In a different study, amphiphilic coatings containing 30% CB monomers were copolymerized with different hydrophobic components. All copolymers showed superior low fouling and thrombogenic response compared to uncoated materials. ( Lee et al., 2021 ). To enhance the stability of zwitterionic polymers, Lin and co-workers co-polymerized MPC/BMA with photoreactive benzophenone-based methacrylate. The co-polymer was photo-crosslinked by UV radiation and showed high resistance against NSA of fibrinogen and HeLa cells. ( Lin et al., 2015 ). Another study copolymerized methacrylate-based SB in combination with N-isopropylacrylamide (NIPAM) in different ratios. The higher the content of zwitterions in the resulting copolymers, the better the resistance to NSA of proteins, platelets, and human fibroblasts, while increased NIPAM content leads to improved thermosensitivity. ( Chang et al., 2010 ). Still, despite these promising findings, several theoretical and experimental studies emphasize the view, that the ways of interaction of water molecules with different zwitterionic moieties vary substantially. ( Shao and Jiang, 2014 ). According to these different modes of interactions, different levels of efficiency in their anti-fouling performance have been discussed. Mostly, PC-based coatings have been postulated to be the best, yet the experimental base for such comparisons is small. ( Huang et al., 2018 ; Ishihara, 2019 ). PC-moieties pose the risk of hydrolytic cleavage in a biological environment. ( Laschewsky and Rosenhahn, 2019 ). Comparing CB and SB moieties, both have a high hydration capacity but SB is less sensitive to different ions and pH changes and has still only a moderate self-assembling effect. ( Chen and Jiang, 2008 ; Shao et al., 2010 ; 2011 ). While the combination of PC-methacrylates with BMA showed promising properties, combinations of SB-methacrylates with BMA have not yet been explored regarding “ in vitro biocompatibility.” We recently synthesized a series of photocrosslinkable coatings containing SPe and BMA components in different ratios and evaluated them in the context of marine fouling. Our results show that the effectiveness of these amphiphilic coatings varies significantly depending on the specific combination of copolymer and fouling organisms. ( Schardt et al., 2022 ). In order to evaluate their utility as potential medical coating comprehensively, it is necessary to extend the studies with respect to resistance to biological cells and blood components. In the present work, the proportions of 3-( N -(2-methacryloyloxy)ethyl- N,N -dimethylammonio)-propane-1-sulfonate (SPe) and n-butyl methacrylate (BMA) were systematically varied from approximately 50, 70, and 90% SPe mixed with 50, 30% and 10% BMA and were compared to pure pSPe and pBMA. Each coating contained approx. 1 mol% of 2-(4-benzoylphenoxy) ethyl methacrylate (BPEMA) as a photoreactive crosslinker to enhance its stability. The produced homogeneous and well-defined SPe/BMA coatings with systematically varied hydrophobic content were analyzed regarding their long-term stability in phosphate-buffered saline (PBS) solution and their resistance to the NSA of human serum albumin (HSA) and fibronectin (Fn). Furthermore, the adhesion of L929 mouse fibroblasts and primary human thrombocytes as well as their aggregation and activation could be prevented. In addition, these coatings showed no hemolysis of erythrocytes nor leucocyte activation. Also, the prevention of Escherichia coli adhesion was shown to be a significant and beneficial property for practical clinical applications.",
"discussion": "4 Discussion Copolymerization of hydrophobic BMA with hydrophilic SPe yielded polymer coatings with variable amphiphilic character, which show high stability under physiological conditions. The amphiphilic character became obvious in the WCA measurements, as higher BMA contents enhanced the hydrophobicity of the coatings in the dry state. However, upon immersion in aqueous media (PBS), all the zwitterion-containing coatings showed a fast reorientation with strongly decreased CBCAs independent of their hydrophobic content. The low CBCAs indicate that the zwitterionic moieties accumulate at the interface while the hydrophobic moieties reorient inside the film. This is consistent with previous reports in which the reorientation behavior was studied in saltwater. ( Schardt et al., 2022 ). A much slower and much less pronounced CBCA decrease was observed for pure pBMA reaching 36° ± 5° after 168 h. CBCA measurements in MilliQ water show a constant contact angle of 80° after 1 h immersion ( Koschitzki et al., 2021 ), which is similar to the CBCAs of pBMA in PBS after 1 h. Literature reports that 7 days immersion of pBMA coatings in saltwater led to a reduction of the CBCA to approx. 55°. ( Schardt et al., 2022 ). The even more pronounced reduction of the contact angle of pBMA in PBS seems therefore not solely attributed to the ion strength alone. We speculate that in particular, the interactions with the phosphates could be responsible for the observed decrease. The resistance of the amphiphilic coatings against non-specific protein adsorption of proteins was tested against HSA and Fn. While HSA is the most abundant protein in blood, ( Evans, 2002 ), Fn is known to be involved in cell adhesion, migration, and differentiation processes. ( Grinnell and Feld, 1981 ; Iuliano et al., 1993 ; García et al., 1997 ). Pure pSPe and all amphiphilic coatings with up to 50% BMA content resist the NSA of HSA and Fn effectively. For both proteins, the NSA on pBMA is at least 16 times higher than on the zwitterionic samples. Even polymers with elevated contents of up to 50% BMA effectively suppressed the NSA of proteins ( Figure 3 ). All coatings with low nonspecific protein adsorption showed low underwater contact angles with CBCAs ≤20°, which were observed even with high contents of the hydrophobic BMA. Previous studies have investigated the influence of increasing hydrophobic content in poly (oxanorbornene) by changing the length of peripheral alkyl chains from methyl over ethyl, butyl, hexyl to octyl. While ethyl and butyl groups do neither affect the wettability nor the NSA of proteins, an increase of the alkyl chain length from hexyl to octyl increased the WCA and CBCA substantially and increased the NSA of fibrinogen (Fg). ( Paschke et al., 2022 ). Literature also reported that copolymers consisting of PC and BMA showed increasing resistance with increasing zwitterionic content with the highest resistance achieved by the highest zwitterionic content of 30%. ( Ishihara et al., 1992 ). Lin and co-workers copolymerized acrylate-based CB with BMA by free radical polymerization whereby the zwitterionic contents range from 17% to 82%. Copolymers with CB compositions higher than 31% detached from the surface. Simultaneously, copolymers with 31% CB content had the highest hydrophilicity and the lowest Fg adsorption. ( Lin et al., 2019 ). On the one hand, the detachment of the coatings with higher zwitterionic content can lead to a higher hydrophobicity. On the other hand, intra- and intermolecular charge compensation of the different zwitterionic groups may render the overall polymer more hydrophobic. ( Walker et al., 2019 ). The WCA of our samples increases with increasing hydrophobic content, however, this phenomenon is less pronounced under water (CBCA). No detachment was observed, even if the zwitterionic content was above 50%. This is probably due to the use of the adhesion promoting layer (APTMS) under, and of crosslinkers within the copolymers. Body fluids and especially the acellular part of the blood, the plasma, have an extremely complex composition. If the water-soluble Fg, the main component of plasmatic coagulation, is removed from the plasma, then serum remains after centrifugation. Most invasive medical implants come into contact with blood, and thus, with a higher concentration of proteins. These can adsorb to biomaterial surfaces to varying degrees non-specifically. Subsequently, either cells circulating in the blood (platelets, erythrocytes, leucocytes, etc.) or, depending on the implantation site, localized connective tissue cells can adhere to the biomaterial surface contaminated with proteins, among other things. ( Curtis and Forrester, 1984 ; Steele et al., 1992 ; Hall-Stoodley et al., 2004 ; Zander and Becker, 2018 ). In this context, the cultivation experiments with L929 mouse fibroblasts seeded in RPMI medium with a 10% FCS addition on the surface coatings with 90–50 mol% SPe and pure pSPe show no tendency to adhere within 24 h despite the high serum protein content. This result is in line with the low NSA of HSA, Fn ( Figure 3 ) and Fg ( Schardt et al., 2022 ) on these coatings as shown by the protein resistance measurements by SPR. As Fb and Fn are directly involved in many cell adhesion mechanisms, the NSA of these proteins is highly relevant for the cell adhesion process on the coatings. ( Lin et al., 2019 ). Hydrophilic SB-based coatings without fibroblast adhesion have been previously reported in the literature ( Kasák et al., 2011 ; Stach et al., 2011 ), which is consistent with the high resistance of the pure pSPe coatings in our experiments. Also, amphiphilic coatings containing PC ( Ishihara et al., 1999 ) or CB ( Lin et al., 2019 ) as zwitterionic moiety have extensively been studied, successfully preventing fibroblast adhesion. Yet reports on the hemocompatibility and leukocyte activation of amphiphilic sulfobetaines with systematically changing amphiphilicity are still lacking in the literature. Even though there are significantly fewer L929 cells on the initially hydrophobic pBMA surfaces than on TCPS and PS, some cells show the formation of pseudopodia, spreading and thus adhesion to the surface. The mobility of the few fibroblasts is also comparable to that on PS, an observation that could be made during microscopy. Low NSA of proteins and decreased mobility of L929 can be seen on pBMA. Serum albumin and Fn are both components of FCS, increased NSA of these proteins may be associated with increased binding of L929 fibroblasts. ( Curtis and Forrester, 1984 ; van Wachem et al., 1987 ; Steele et al., 1992 ). In this context, the described correlation in the literature is supported by the simultaneous occurrence of high NSA of these proteins ( Figure 3 ) and the reduced mobility of L929 on pBMA. Platelets (also called thrombocytes) have a key function in the sum of physiological processes that cause bleeding to stop by clot formation. Specifically, they are at the beginning of a series of cascades called primary hemostasis. In the course of a vascular injury, in which, for example, the intima, i.e., the intraluminal endothelial cell layer, is damaged, proteins of the basal lamina lying below the endothelial cells, such as collagen IV and especially Fn, are exposed. This leads to rapid platelet adhesion, activation, and aggregation. ( Berndt et al., 2014 ). Any insertion of a biomaterial in the form of an invasive implant, i.e., a foreign body, is first of all a potentially disruptive process to normal physiology. It is well known that the insertion of, for example, a temporary central venous or peripheral arterial catheter leads to the formation of blood clots on the inner wall of the catheter. It is also well known that platelets are responsible for this in the context of primary hemostasis, which spontaneously adhere to the foreign surface mediated by NSA of mainly Fg ( Struczyńska et al., 2023 ), but also Fn( Lin et al., 2019 ) and other glycoproteins. ( Ward, 2008 ). Consequently, it is not surprising that platelets on the pBMA surface with low NSA resistance to Fg ( Schardt et al., 2022 ), HSA and Fn show also pronounced adhesion and aggregation. In comparison, it is expected that when surfaces are coated with cop-SPe-5-BMA-5, cop-SPe-7-BMA-3, and cop-SPe-9-BMA-1, platelet adhesion decreases with increasing proportion of SPe. Indeed, on the intact pSPe surface, the number of adherent and aggregated platelets is significantly lower compared to the TCPS control and pBMA surface. Interestingly, however, it is larger than on the cop-SPe-9-BMA-1 surface. This illustrates that the previous experiments on blood glycoprotein adsorption alone are not sufficient to test the hemocompatibility of biomaterial surfaces, but only the interaction of primary blood cells (here primary human platelets) moving across and scanning the biomaterial surface with their pseudopodia, minute amounts of NSA blood proteins can be detected and lead to this minor platelet adhesion and aggregation on pSPe. Considering that from cop-SPe-5-BMA-5 via cop-SPe-7-BMA-3 to cop-SPe-9-BMA-1, the sulfobetaine 3-[N-2-(methacryloyloxy)ethyl-N,N-dimethyl]-ammonio propane-1-sulfonate (SPe) content increases but the amount of adhering platelets decreases, the particular importance of a specific molecular arrangement of the hydrophilic (SPe) and hydrophobic (BMA) portions of the coatings studied becomes more understandable under physiological conditions. The anti-platelet adhesion and activation properties of the poly (SPe-co-BMA) coincide with previous studies with poly (MPC-co-BMA) polymers. The hydrophilic MPC moiety seems to successfully suppress platelet adhesion and impart the non-thrombogenic properties of the coatings. ( Ishihara et al., 1990a ; Ishihara et al., 1992 ). A low platelet adhesion was also reported for poly (CBMA-co-BMA) with zwitterionic contents up to 30%. ( Lee et al., 2021 ). In the context of platelet adhesion and all subsequent platelet reactions with foreign material surfaces, the amphiphilic sulfobetaine-modified surfaces also showed a very good effect against unspecific interaction with or adsorption of soluble blood components in the whole blood experiment, as well as platelet adhesion ( Figures 5 , 6 ). Another aspect of blood coming into contact with biomaterial surfaces is the interaction of red blood cells (RBC), the oxygen-transporting erythrocytes that make up the largest proportion of cells in blood, with the foreign material surface. Here it is important to exclude indirect or direct erythrotoxic effects that may lead to a loss of RBC membrane integrity and thus to hemolysis. ( Soundararajan et al., 2018 ; Pacharra et al., 2019 ; Podsiedlik et al., 2020 ). From this perspective, we have also investigated the surface coatings described here with regard to their erythrotoxicity, following the work of van Oeveren ( van Oeveren, 2013 ) and Wang et al. . ( Wang et al., 2013 ). According to numerous scientific papers, a biomaterial is considered non-erythrotoxic if the measured hemolysis rate is less than 2%. ( He et al., 2023 ). This threshold is recommended in DIN EN ISO 10993–4 and ASTM F756-17. All surface coatings, including the amphiphilic ones with BMA contents up to 50%, investigated here are below this threshold and do not trigger any RBC membrane integrity loss and thus no hemolysis. In addition to the platelets and the RBCs, neither of which has a cell nucleus, another cell nucleated, very heterogeneous cell population of the blood circulates through the human organism, the so-called white blood cells (WBCs) or leukocytes. These immunocompetent cells consist of granulocytes, lymphocytes, monocytes, mast cells, and dendritic cells. The segment-nucleated neutrophil granulocytes, casually referred to as neutrophils, account for the largest percentage of the total number of leukocytes (50%–70%). ( Segal, 2005 ). As soon as the physiological integrity of the organism is disturbed, such as by invasive pathogens, intended (surgery) or unintended (accident) injuries, or by the introduction of a temporary or permanent medical object, neutrophils immediately move to that site, attracted by so-called pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs). In the context of the relatively short activity period or life span of neutrophils, which is currently still very controversial in the literature and is put at 5–135 h, neutrophils are involved in the acute host-biomaterial interaction. ( Zindel and Kubes, 2020 ; Macias and Keselowsky, 2022 ). In order to test this acute neutrophil reaction in interaction with the surface coatings under investigation here, a polymorphonuclear elastase (PMNE) assay was used. The enzyme PMNE is contained in the granules of neutrophils and released in the event of their activation by PAMPs or DAMPs. ( Pacharra et al., 2019 ; 2020 ). The lipopolysaccharide (LPS) used as a control in the study of the interaction of neutrophils with the surface coatings pBMA, cop-SPe-5-BMA-5, cop-SPe-7-BMA-3, cop-SPe-9-BMA-1, and pSPe, is a component of the outer layer of the outer cell membrane of Gram-negative bacteria such as E. coli , and is a so-called PAMP. Thus, this elicits a strong PMNE response. Since none of the surface modifications showed as strong an activation as LPS or, in comparison, not even a significant response in the PMNE ELISA assay, this can be taken as an additional preliminary positive indication that especially the coatings with 90–50 mol% of SPe should be further investigated for use in finishing invasive medical devices to improve their hemo- and immunocompatibility. It has been reported that SPe-containing polymers can not only prevent the adhesion of proteins, but also of bacteria. ( Cheng et al., 2007 ; Li et al., 2008 ; Lalani and Liu, 2012 ; Schardt et al., 2022 ). The accumulated bacteria densities on all prepared zwitterion-containing coatings is <7% of the accumulation density on pBMA, and thus very low. Even an increase of the hydrophobic content of up to 50% creates still coatings with a high resistance to bacterial attachment and no formation of agglomerates can be seen. These findings show that the amphiphilic methacrylate copolymers containing hydrophilic sulfobetaine and hydrophobic butyl groups reduce bacterial attachment even at BMA contents of up to 50%. Our results concur well with previous studies in which copolymers composed of hydrophilic SB methacrylate with N-isopropyl acrylamide in 100:0, 70:30, 50:50, and 80:20 M ratios were shown to possess good protein resistance, low platelet adhesion, and resistance against the adhesion of human fibroblast and bacteria that increased with increasing zwitterionic content. ( Chang et al., 2010 ). In agreement with our data, even small quantities of SB or other zwitterionic components induced already high hydrophilicity of the resulting coatings. This could in part be the reason for the high resistance against the attachment of several cell types. ( Ishihara et al., 1990a ; Ishihara et al., 1992 ; Chang et al., 2010 ). Our study clearly shows that a certain degree of amphiphilicity seems to be advantageous for antiadhesive biomedical coatings. Further investigations with even smaller quantities than 50% of SB-type monomers could complement these results shown here and may result in even improved coatings, or provide information on whether there is a minimum of SB required for antiadhesive, antithrombogenic, and immunocompatible coatings. Future work might also investigate the interactions with the complement system, in particular with the factors C3 and C5, before eventually conducting preclinical in vivo trials to surpass commercially available coatings."
} | 7,040 |
25729749 | null | s2 | 9,401 | {
"abstract": "The origin of the photosynthetic organelle in eukaryotes, the plastid, changed forever the evolutionary trajectory of life on our planet. Plastids are highly specialized compartments derived from a putative single cyanobacterial primary endosymbiosis that occurred in the common ancestor of the supergroup Archaeplastida that comprises the Viridiplantae (green algae and plants), red algae, and glaucophyte algae. These lineages include critical primary producers of freshwater and terrestrial ecosystems, progenitors of which provided plastids through secondary endosymbiosis to other algae such as diatoms and dinoflagellates that are critical to marine ecosystems. Despite its broad importance and the success of algal and plant lineages, the phagotrophic origin of the plastid imposed an interesting challenge on the predatory eukaryotic ancestor of the Archaeplastida. By engulfing an oxygenic photosynthetic cell, the host lineage imposed an oxidative stress upon itself in the presence of light. Adaptations to meet this challenge were thus likely to have occurred early on during the transition from a predatory phagotroph to an obligate phototroph (or mixotroph). Modern algae have recently been shown to employ linear tetrapyrroles (bilins) to respond to oxidative stress under high light. Here we explore the early events in plastid evolution and the possible ancient roles of bilins in responding to light and oxygen."
} | 357 |
28541273 | PMC5458517 | pmc | 9,402 | {
"abstract": "The mechanical properties of cells and the extracellular environment they reside in are governed by a complex interplay of biopolymers. These biopolymers, which possess a wide range of stiffnesses, self-assemble into fibrous composite networks such as the cytoskeleton and extracellular matrix. They interact with each other both physically and chemically to create a highly responsive and adaptive mechanical environment that stiffens when stressed or strained. Here we show that hybrid networks of a synthetic mimic of biological networks and either stiff, flexible and semi-flexible components, even very low concentrations of these added components, strongly affect the network stiffness and/or its strain-responsive character. The stiffness (persistence length) of the second network, its concentration and the interaction between the components are all parameters that can be used to tune the mechanics of the hybrids. The equivalence of these hybrids with biological composites is striking.",
"discussion": "Discussion The persistence length and the network mesh size are the key length scales that control the linear and nonlinear mechanical properties of hydrogels. In hydrogels of semi-flexible filaments these length scales are of a similar order, which gives rise to a rich mechanical behaviour 15 26 52 that Nature uses on many occasions. In biological materials, a high persistence length is often realized through the bundling of individual filaments. The controlled formation of high persistence length bundles of synthetic polymers, however, has proven very difficult to achieve. The approach we present in this work controls the (non)linear mechanical response of polymer networks by combining polymers with differing persistence lengths into hybrid polymer networks. This introduces additional characteristic length scales in the network, which allows us to tailor the mechanics. For instance, stiff rod-like fibres (high persistence length and high contour length) that supress non-affine deformations of the network, promote the stiffening response of a semi-flexible hydrogel. On the other side of the spectrum, adding flexible polymers (low persistence length, low pore size) that do not stiffen under stress, reduce this stiffening response. The combination of multiple semi-flexible polymer networks in one material is especially interesting, because here, the (non)linear mechanical properties of the resulting material not only depend on the ratio between the components, but also on the nature of the interactions between them. Nature uses a similar approach of combining stiff, semi-flexible and flexible fibres into biological composite networks. In the cytoskeleton for example, semi-flexible actin and intermediate filaments will all contribute to the strain-stiffening response of the network, and the stiff microtubules will further enhance the sensitivity to an applied stress. In the extracellular matrix, flexible elastin fibres may decrease the nonlinear response of semi-flexible fibrin and collagen networks. But how exactly these combinations affect the mechanical properties of the resulting composite materials has barely been looked into, especially in terms of the nonlinear strain-stiffening properties 23 24 . Even though cells are able to stretch their matrix well into the nonlinear regime 53 , the vast majority of regenerative medicine studies merely considers the simple linear modulus of the hydrogel matrix 3 . Our results indicate that the nonlinear mechanics of composite polymer networks are different from their single-component mimics, and we present an approach to systematically vary the nonlinear mechanics by varying the persistence length of the components, which should lead to a better understanding of the effect of the mechanics, including the nonlinear mechanics on cellular behaviour. Ultimately, the combination of polymers with different mechanical properties into hybrid hydrogels will help the design of a next generation of responsive materials and tuneable artificial extracellular matrices for tissue engineering applications."
} | 1,021 |
33046770 | PMC7550342 | pmc | 9,404 | {
"abstract": "Single-wall carbon nanotubes (SWCNTs) and Bi 2 Te 3 nanoplates are very promising thermoelectric materials for energy harvesting. When these two materials are combined, the resulting nanocomposites exhibit high thermoelectric performance and excellent flexibility. However, simple mixing of these materials is not effective in realizing high performance. Therefore, we fabricated integrated nanocomposites by adding SWCNTs during solvothermal synthesis for the crystallization of Bi 2 Te 3 nanoplates and prepared flexible integrated nanocomposite films by drop-casting. The integrated nanocomposite films exhibited high electrical conductivity and an n-type Seebeck coefficient owing to the low contact resistance between the nanoplates and SWCNTs. The maximum power factor was 1.38 μW/(cm K 2 ), which was 23 times higher than that of a simple nanocomposite film formed by mixing SWCNTs during drop-casting, but excluding solvothermal synthesis. Moreover, the integrated nanocomposite films maintained their thermoelectric properties through 500 bending cycles.",
"introduction": "Introduction Nanocomposite materials, which are formed by mixing two or more dissimilar materials at the nanoscale, have attracted considerable attention in various industrial fields such as electronics and biotechnology 1 – 4 , because they have new and improved structures and properties compared to the corresponding materials formed at the macroscale. Carbon nanotubes (CNTs) are one of the most promising components in nanocomposite materials 5 – 7 . The flexibility, strength, and electrical conductivity of the materials can be increased by introducing CNTs 8 , 9 . There are generally two types of CNTs: single-walled CNTs (SWCNTs) and multi-walled CNTs (MWCNTs). SWCNTs exhibit semiconducting properties determined by their chirality 10 and are used in electronic devices, such as field-effect transistors and solar cells 11 – 13 . Recently, it was found that SWCNTs exhibit relatively high thermoelectric properties 14 – 16 . SWCNTs are also inherently flexible; hence, they can be used to create flexible thermoelectric generators 17 – 20 . In addition, their thermoelectric properties can be improved by forming nanocomposites with organic thermoelectric materials 21 – 25 . To further improve the thermoelectric properties of the nanocomposite materials while maintaining their flexibility, one promising approach is to merge SWCNTs with nanosized-inorganic thermoelectric materials, such as bismuth telluride-based alloys, which exhibit the best thermoelectric properties at approximately 300 K and an n-type Seebeck coefficient (– 150 to – 200 µV/K) 26 – 29 . Materials composed of SWCNTs and bismuth telluride-based alloys are available as n-type nanocomposites, even though normal SWCNTs exhibit p-type Seebeck coefficients (50–60 µV/K) 30 , 31 . Moreover, the structure of bismuth telluride-based alloys is important because the thermoelectric properties depend on the size and dimension of the material. The thermoelectric properties improve as the size and dimension decrease due to the quantum confinement effect and phonon scattering at the boundaries 32 , 33 . In our previous study, to reduce the size and dimension of bismuth telluride-based alloys, single-crystalline Bi 2 Te 3 nanoplates (quasi-2D material) with a thickness of several tens of nanometers were synthesized using a solvothermal method 34 , 35 . After the nanoplate fabrication, flexible thin films were prepared by mixing the Bi 2 Te 3 nanoplates and SWCNTs by drop-casting 36 , 37 . Although the Bi 2 Te 3 nanoplates and SWCNTs had high electrical conductivities individually, the conductivity decreased after mixing, owing to the high contact resistance between them. In order to decrease the contact resistance and improve the thermoelectric properties of the nanocomposite materials, it is necessary to integrate the SWCNTs and Bi 2 Te 3 nanoplates. Liu et al. fabricated an integrated nanocomposite of Bi 2 Te 3 nanoparticles and SWCNTs by hydrothermal synthesis, and pressed the resulting nanocomposites into bulk samples 38 . Jin et al. developed flexible thermoelectric materials by fabricating a hybrid nanocomposite comprising highly ordered Bi 2 Te 3 nanocrystals anchored on an SWCNT network using magnetron sputtering 28 . These pioneering studies motivated us to fabricate integrated nanocomposites of SWCNTs and Bi 2 Te 3 nanoplates using a solvothermal synthesis and to produce flexible thin films with the nanocomposites. Here, we report the fabrication of integrated nanocomposites with SWCNTs and Bi 2 Te 3 nanoplates via solvothermal synthesis. Flexible films were formed using the integrated nanocomposites by drop-casting followed by heat treatment. The thermoelectric properties of the films were measured at approximately 300 K and compared to those of the simple nanocomposite thin films that were produced by adding SWCNTs during drop-casting, but excluding solvothermal synthesis.",
"discussion": "Discussion To use integrated nanocomposite films practically, it is necessary to investigate the change in the thermoelectric properties under repetitive bending conditions 51 – 54 . Therefore, we performed bending tests by applying stress on the film with the highest power factor (SWCNT-ethanol solution of 9 mL) and on a nanoplate film with no SWCNTs as a reference. The images of the bending tests are shown in Supplementary Fig. S3 . The relative resistance and Seebeck coefficient were measured as the films were repeatedly bent 500 times, as shown in Fig. 7 . The resistance of the integrated nanocomposite film after the last bend was approximately 1.5 times higher than that of the film prior to bending; the resistance of the nanoplate film with no SWCNTs after bending was approximately 1.6 times higher than that of the film prior to bending. The relative resistance of the integrated nanocomposite film after bending appeared lower than that of the nanoplate film without SWCNTs. However, as the accuracy of the fitting line of the nanoplate film with no SWCNTs (R 2 = 0.76) was low compared to the integrated nanocomposite film (R 2 = 0.94), comparing the relative resistance of the two films is unreliable; thus, further studies are required. The variations in the plot of the integrated nanocomposite film were smaller than those of the nanoplate film with no SWCNTs. This phenomenon can be explained by the difference in the uniformity of the films. The integrated nanocomposite film exhibited a relatively high uniformity owing to the network of SWCNTs. In contrast, since the nanoplate thin film did not contain the SWCNTs, the network between the nanoplates was inadequate, and the current path lines altered when the measurement locations were changed from the bending test. We believe that this is the cause of the variation in the resistance value of the nanoplate thin film. Figure 7 Relative resistance of the integrated nanocomposite film and the nanoplate film as a function of the number of bends. The Seebeck coefficients of these films at initial (no bends) and final (500 bends) conditions are shown in the insets. The inset of Fig. 7 presents the Seebeck coefficients of the integrated nanocomposite film and the nanoplate film with no SWCNTs at the initial (no bends) and final (500 bends) conditions. The Seebeck coefficient of the nanoplate film with no SWCNTs decreased by 20% between the initial and final conditions, while that of the integrated nanocomposite film decreased by only 11%. Therefore, we concluded that the deterioration of the thermoelectric properties by bending could be suppressed by adding SWCNTs in the films. Here, we consider the growth mechanism of the integrated nanocomposites composed of Bi 2 Te 3 nanoplates and SWCNTs, as shown in Fig. 8 . In the first stage, Bi 3+ ions, Te 2− ions, and SWCNTs separately exist in the precursor solution. In the second stage, some Bi 3+ and Te 2− ions combine to form Bi 2 Te 3 nanoplates, while others adhere to the surface of the SWCNTs. In the third stage, during the growth of the Bi 2 Te 3 nanoplates, the SWCNTs were integrated with the nanoplates to form the nanocomposite. In addition, Bi 2 Te 3 nanoplates were grown on the surface of the SWCNTs. Because of this growth mechanism, the nanoplates were tightly connected to the SWCNT S , leading to an increase in the electrical conductivity, Seebeck coefficient, and bending stability. Figure 8 Schematic diagram of the growth mechanism of integrated nanocomposites composed of Bi 2 Te 3 nanoplates and SWCNTs. In summary, we fabricated integrated nanocomposites through the addition of SWCNTs during the solvothermal synthesis of Bi 2 Te 3 nanoplates. Flexible films were prepared by drop-casting followed by thermal annealing. The mass concentration of carbon increased as the SWCNT-ethanol solution increased, and the crystalline phase of Bi 2 Te 3 was maintained for all SWCNT-ethanol solutions. According to the SEM observations, the SWCNTs were well-integrated by the Bi 2 Te 3 nanoplates. Owing to this structure, the electrical conductivity and Seebeck coefficient significantly increased compared to those of nanoplate films without SWCNTs. We compared the thermoelectric properties of the integrated nanocomposite film in this study to those of the nanocomposite film with similar carbon mass concentrations formed by simple mixing, where the SWCNTs were added during drop-casting but excluding solvothermal synthesis. The integrated nanocomposite film in this study exhibited high electrical conductivity and an n-type Seebeck coefficient. As a result, the power factor of the integrated nanocomposite film was 23 times higher than that of the nanocomposite film formed by simple mixing. This phenomenon might occur because the contact resistance between the Bi 2 Te 3 nanoplates and the SWCNTs decreased due to the integration of the materials. In addition, this integration contributed to an increase in the stability of the thermoelectric properties after repeated bending."
} | 2,509 |
39823320 | PMC11740926 | pmc | 9,405 | {
"abstract": "Electronic skins endow robots with sensory functions but often lack the multifunctionality of natural skin, such as switchable adhesion. Current smart adhesives based on elastomers have limited adhesion tunability, which hinders their effective use for both carrying heavy loads and performing dexterous manipulations. Here, we report a versatile, one-size-fits-all robotic adhesive skin using shape memory polymers with tunable rubber-to-glass phase transitions. The adhesion strength of our adhesive skin can be changed from minimal (~1 kilopascal) for sensing and handling ultralightweight objects to ultrastrong (>1 megapascal) for picking up and lifting heavy objects. Our versatile adhesive skin is expected to greatly enhance the ability of intelligent robots to interact with their environment.",
"introduction": "INTRODUCTION The skin is the most crucial interface between the environment and both animals and robots. On the inside, natural skin contains mechanoreceptors that are critical for sensory perception such as light and touch or temperature and pressure. On the outer surface, it has appendages such as hair, nails, feathers, and scales that are essential for movement, lubrication, and protection ( 1 , 2 ). Adhesive skin appendages ( 3 – 5 ), for example, allow some animals like geckos, octopus, and suckerfish to adhere ( 3 , 6 ), parasitize ( 7 , 8 ), capture ( 9 – 11 ), and climb ( 12 – 14 ) on various surfaces. Such adhesive skin appendages that adhere strongly and yet can detach easily have inspired the creation of smart adhesives ( 3 ) that outperform friction-based designs ( 15 – 17 ). These adhesives have been applied in heterogeneous assembly ( 18 – 24 ), soft robots ( 3 , 25 , 26 ), and as soft grippers ( 27 – 31 ) to reliably grip and release large, heavy, or fragile objects. Similarly, tactile mechanoreceptors in skin tissues have inspired the development of electronic skins (E-skins)—flexible, stretchable electronic materials with sensing capabilities ( 32 – 40 )—that have enabled robots to respond to strain, pressure, temperature, and other environmental stimuli ( 41 – 45 ). The functional capabilities of current E-skins for robotics, however, are incomplete because they mimic mainly the sensory functions of natural skin yet are often missing the specialized functions such as adhesion. This is because current smart bioinspired adhesives, mostly made of soft elastomers ( 46 ), are often focused on a single function. The same adhesive cannot be effectively used both for carrying heavy loads and for dexterous manipulation of objects because the minimum and maximum adhesion strengths of these elastomers are proportional to each other ( 47 , 48 ), as illustrated in Fig. 1A (also see section S3). An adhesive with a maximum adhesion strength high enough to lift heavy loads usually has a high minimum adhesion strength, making a robot difficult to achieve human-like actions like grasping, carrying, and detaching small lightweight objects like cloth, paper, or microchips ( 49 , 50 ). In sensing applications ( 51 – 53 ), excessive adhesion can interfere with signal detection. Adhesive E-skins that mimic more closely the capabilities of real skin would greatly improve their values in various robotic applications, including prosthetics. Fig. 1. Design and operation of SMP robotic adhesive skins. ( A ) Schematic comparison between the proposed SMP adhesive skin and conventional adhesive designs. In conventional adhesives designs (left), the maximum adhesion strength is proportional to the minimum strength, characterized by large constants of proportionality in both pull and shear modes (middle). This limitation means that strong adhesives and easy detachment cannot be achieved with the same adhesive. In contrast, the proposed SMP adhesive skin features maximum and minimum adhesion strengths that are independent of each other, with very small constants of proportionality (middle). This enables a wide tunability in adhesion, allowing the adhesive skin to function effectively in scenarios where adhesion is either required or to be avoided, thereby greatly enhancing robotic interactions (right). ( B ) SMP adhesive skins integrated onto a robotic hand (left) to enhance its capabilities to interact with the environment. The robotic adhesive skin patches (right) are featured by arrays of hexagonal SMP adhesive fibrils on the surface and then embedded flexible heaters and pressure sensors connected by SMP adhesive interlayers. ( C ) Principle of on-demand attachment and detachment of a single SMP adhesive fibril on the adhesive skin. ① Minimal adhesion when contacting in the glassy phase. ② On-demand attachment when contact is established in the rubbery phase. ③ Strong DMT-like R2G adhesion after cooling into the glassy phase. ④ Switch-off of adhesion by heating up back into the rubbery phase where the SMP fibrils are detached in a JKR-like state. Here, we report a one-size-fits-all adhesive skin ( Fig. 1B ; see more details in fig. S1 and section S1) for robotics, which incorporates both sensory and adhesive functions for various manipulation scenarios. This is achieved by using shape memory polymers (SMPs) ( 54 , 55 ) with tunable rubber-to-glass (R2G) phase transition that enables the adhesive to adhere and detach on-demand. The surface layer of our adhesive skin is made of structured SMP fibrils resembling the natural adhesive skin appendages of tree frogs ( 56 , 57 ), providing a larger area filling ratio and consistent shear adhesion strength across various loading directions compared to other geometries. The phase transition of the SMP is regulated by a flexible heater layer and a flexible pressure sensor is used to accomplish the sensing function of the adhesive skin. Systematic studies and simulations show that the adhesion strength of our adhesive skin is tunable from ~1 kPa to ~1 MPa, allowing a robotic hand to detect surface morphologies and perform a wide range of tasks, from picking up a light (25 g) towel to grasping various fragile, large, curved (10 to 40 cm radii), and heavy (up to 1.2 kg) objects. Our robotic adhesive E-skin, with its integrated sensory and adhesive functions, offers huge potential across multiple industries, including manufacturing, construction, logistics, measurement, maintenance, and health care, by enhancing productivity, safety, and precision.",
"discussion": "DISCUSSION In this study, we successfully engineered a versatile robotic adhesive skin by integrating SMP adhesive fibrils, flexible heaters, and flexible pressure sensors. The adhesive skin exhibits both the sensory functions of natural skin tissues and the on-demand adhesive capabilities. The tunable properties of SMPs enable the adhesive skin to attach strongly to and detach easily from a wide range of material surfaces. We show that with the adhesive skin, a robotic hand can manipulate a variety of objects in ways that existing adhesives cannot. The adhesive skin can also be used in various scenarios, from accurately detecting surface textures and dexterous handling of lightweight items to securely gripping fragile, large, or heavy objects. The adhesive skin greatly expands the scope and capabilities of interactions that are available to robots in diverse environments, including those where adhesion is desired or to be avoided. Our adhesive skin with its broad adhesion spectrum (0.65 kPa to 2 MPa in pull mode and 2.86 kPa to 5.1 MPa in shear mode) and large adhesion switchability (>100) under ultrastrong adhesion strength (>1 MPa) is expected to reshape industries that require precise and adaptable object manipulation. In measurement, maintenance, textile, and paper industries, where surface detection and dexterous manipulation are crucial, this robotic technology promises to enhance productivity, safety, and precision by providing good adhesion and preventing unwanted adhesion on-demand. In manufacturing, the robots’ ability to precisely handle fragile and delicate components with switchable adhesion can improve product quality and production efficiency. Whereas in industries such as construction and logistics, this robotic technology can provide strong and robust adhesive for securely grasping heavy objects and deliver the cargos to target locations. In health care, robots with adhesive E-skin can be used for delicate and precise operations with minimal risks to patients. Successful integration of these adhesive skins into electronic adhesive gloves also highlights their potential to enhance our ability to perform daily activities that are deemed too difficult. For practical applications, however, the switching speed between the rubbery and glassy phases will need to be optimized. The current thermal control mechanism, which takes about 1 min for a heating and cooling cycle, is slow for some applications that require the adhesive to attach and detach rapidly. In addition, the transition temperature is around 51°C, which limits the robotic skin’s applicability in temperature-sensitive scenarios, such as handling humans or live animals. Alternative materials with faster transitions ( 73 – 76 ) that might involve different actuation methods and lower transition temperatures ( 77 ) may be explored in future studies. On the other hand, for high-temperature applications, SMPs with higher transition temperature should be applied. Integrating other types of sensors onto the adhesive skin to match or exceed the capabilities of natural skin would broaden its applications. Furthermore, incorporating communication capabilities into these sensors can enhance the versatility of the adhesive skins even more. For example, detected signals can be used to guide the amount of preload applied during gripping. In addition, further exploration of the arrangement and interaction between sensors, adhesive layers, flexible heaters, and pillars is needed to improve sensing capabilities. Thermal isolation designs should also be incorporated to accommodate both flexible heaters and temperature sensors. The shape and arrangement of the adhesive fibrils, as well as the curvature effects of the skins, can be further optimized to achieve better adhesion capabilities. Having a single adhesive that can attach and detach on-demand for various application scenarios is an important step forward in the field of robotics because it extends the range of interactions a robot can have with its environment."
} | 2,607 |
34000104 | null | s2 | 9,408 | {
"abstract": "Physical properties of the extracellular matrix (ECM) affect cell behaviors ranging from cell adhesion and migration to differentiation and gene expression, a process known as mechanotransduction. While most studies have focused on the impact of ECM stiffness, using linearly elastic materials such as polyacrylamide gels as cell culture substrates, biological tissues and ECMs are viscoelastic, which means they exhibit time-dependent mechanical responses and dissipate mechanical energy. Recent studies have revealed ECM viscoelasticity, independent of stiffness, as a critical physical parameter regulating cellular processes. These studies have used biomaterials with tunable viscoelasticity as cell-culture substrates, with alginate hydrogels being one of the most commonly used systems. Here, we detail the protocols for three approaches to modulating viscoelasticity in alginate hydrogels for 2D and 3D cell culture studies, as well as the testing of their mechanical properties. Viscoelasticity in alginate hydrogels can be tuned by varying the molecular weight of the alginate polymer, changing the type of crosslinker-ionic versus covalent-or by grafting short poly(ethylene-glycol) (PEG) chains to the alginate polymer. As these approaches are based on commercially available products and simple chemistries, these protocols should be accessible for scientists in the cell biology and bioengineering communities. © 2021 Wiley Periodicals LLC. Basic Protocol 1: Tuning viscoelasticity by varying alginate molecular weight Basic Protocol 2: Tuning viscoelasticity with ionic versus covalent crosslinking Basic Protocol 3: Tuning viscoelasticity by adding PEG spacers to alginate chains Support Protocol 1: Testing mechanical properties of alginate hydrogels Support Protocol 2: Conjugating cell-adhesion peptide RGD to alginate."
} | 459 |
34568301 | PMC8460912 | pmc | 9,409 | {
"abstract": "Mixed microbial cultures have become a preferred choice of biocatalyst for chain elongation systems due to their ability to convert complex substrates into medium-chain carboxylates. However, the complexity of the effects of process parameters on the microbial metabolic networks is a drawback that makes the task of optimizing product selectivity challenging. Here, we studied the effects of small air contaminations on the microbial community dynamics and the product formation in anaerobic bioreactors fed with lactate, acetate and H 2 /CO 2 . Two stirred tank reactors and two bubble column reactors were operated with H 2 /CO 2 gas recirculation for 139 and 116 days, respectively, at pH 6.0 and 32°C with a hydraulic retention time of 14 days. One reactor of each type had periods with air contamination (between 97 ± 28 and 474 ± 33 mL O 2 L −1 d −1 , lasting from 4 to 32 days), while the control reactors were kept anoxic. During air contamination, production of n -caproate and CH 4 was strongly inhibited, whereas no clear effect on n -butyrate production was observed. In a period with detectable O 2 concentrations that went up to 18%, facultative anaerobes of the genus Rummeliibacillus became predominant and only n -butyrate was produced. However, at low air contamination rates and with O 2 below the detection level, Coriobacteriia and Actinobacteria gained a competitive advantage over Clostridia and Methanobacteria, and propionate production rates increased to 0.8–1.8 mmol L −1 d −1 depending on the reactor (control reactors 0.1–0.8 mmol L −1 d −1 ). Moreover, i- butyrate production was observed, but only when Methanobacteria abundances were low and, consequently, H 2 availability was high. After air contamination stopped completely, production of n -caproate and CH 4 recovered, with n -caproate production rates of 1.4–1.8 mmol L −1 d −1 (control 0.7–2.1 mmol L −1 d −1 ). The results underline the importance of keeping strictly anaerobic conditions in fermenters when consistent n -caproate production is the goal. Beyond that, micro-aeration should be further tested as a controllable process parameter to shape the reactor microbiome. When odd-chain carboxylates are desired, further studies can develop strategies for their targeted production by applying micro-aerobic conditions.",
"conclusion": "Conclusion Even small O 2 contaminations were very detrimental to n -caproate and methane formation, but favored propionate formation. The relation of O 2 contamination and propionate formation was not straightforward: reactors with micro-aerobic conditions produced more propionate overall, but propionate production cycles were not always synchronous to O 2 contamination. Besides, the negative effects of O 2 on methane formation could be reversed in all cases whereas chain elongation could not always be resumed when O 2 contamination stopped. These patterns were observed in both stirred tank and in bubble column reactors, with the bubble column process being more sensitive to O 2 contamination. It is unclear whether the effects of O 2 reported in this study could be reproduced without the recirculation of H 2 . It is possible that the H 2 recirculation amplified the effects of O 2 toxicity, since presence of H 2 can favor ROS formation by hydrogenases. Considering that H 2 consumption was particularly high during micro-aeration, H 2 may have acted as an important energy source for aerotolerant and aerobic microorganisms. Controlled O 2 contamination studies with co-cultures or mixed communities of lower complexity can shed light on how impactful H 2 recirculation during micro-aeration is. Aerotolerant fermenting bacteria such as Acidipropionibacterium spp. are efficient propionate producers that could be regarded as welcomed guests rather than competitors. Here, they were the main candidates responsible for propionate production although their correlation with O 2 contamination was unclear. Instead, Actinomyces spp. (Actinobacteria that did not produce propionate) profited most from the micro-aerobic environment. Future experiments could help clarify if stable propionate-producing communities can be selected by micro-aeration. If micro-aeration facilitates propionate accumulation, a sequential anaerobic step can be used for chain elongation with high selectivity to odd-numbered MCC. Studies with defined cultures aiming to understand what is behind the recovery of chain elongation activity after micro-aerobic periods are also recommended.",
"introduction": "Introduction Anaerobic fermentation with mixed microbial communities is an appealing option for the production of medium-chain carboxylates (MCCs) ( De Groof et al., 2019 ). However, the high degree of complexity of mixed communities is an additional obstacle to achieve a stable and feasible bioprocess. Changes in operation parameters favor some microorganisms while negatively affecting others in ways that are hard to predict. Controlled experiments with defined substrates can help to understand the response of microbial networks to disturbances and to develop more robust fermentation processes ( Angenent et al., 2016 ; Andersen et al., 2017 ; Oleskowicz-Popiel, 2018 ). Oxygen from the air can easily enter anaerobic reactors by diffusion due to incomplete tightness or oxic feedstocks, and is considered a disturbance of the anaerobic processes. At first thought, MCC-producing mixed cultures should be protected from O 2 at all costs. So far, almost all isolated MCC producers are strict anaerobes (one exception was described by Stamatopoulou et al. (2020) ) to which O 2 causes damage via direct and indirect ways. O 2 gives rise to reactive oxygen species (ROS), such as O 2 \n − and H 2 O 2 , which are intermediates produced during O 2 reduction that severely damage cells if not promptly neutralized ( Johnson and Hug, 2019 ). Even though every cultured microorganism has mechanisms to deal with ROS ( Johnson and Hug, 2019 ), obligate anaerobic bacteria such as Clostridium spp. suffer particularly from O 2 due to their high dependence on O 2 -sensitive enzymes (e.g., ferredoxin-dependent oxidoreductases or [FeFe]-hydrogenases) ( Imlay, 2006 ; Khademian and Imlay, 2020 ). Most hydrogenases, which also contain Fe-S clusters, are reversibly or irreversibly inhibited by O 2 and its activated forms. Exposure to O 2 causes some hydrogenases to decompose or to form additional ROS that damage other parts of the cell ( Stiebritz and Reiher, 2012 ). Oxygen contamination does not necessarily mean a complete failure of the anaerobic process and its effect depends on the contamination rate and on the ability of the anaerobic community to remove the contaminant ( Botheju and Bakke, 2011 ). Facultative anaerobic microorganisms present in mixed cultures can consume traces of oxygen and thus protect strict anaerobes ( Nguyen and Khanal, 2018 ). As an exemplary proof of concept, the facultative anaerobe Parageobacillus thermoglucosidasius has been used for O 2 scrubbing before feeding waste gases to acetogenic cultures ( Mohr et al., 2019 ). Additionally, the presence of biofilms, microbial aggregates, and other types of diffusion gradients in reactors can form protective oxygen barriers ( Botheju and Bakke, 2011 ). Uncontrolled aeration during anaerobic fermentation, e.g., via the supply of oxic substrates, can lead to the presence of strict aerobic microorganisms ( Lambrecht et al., 2019 ). On the other hand, small amounts of oxygen may be desired in anaerobic processes. Micro-aeration, the controlled dosing of small amounts of air or oxygen (loosely defined from 5 to 5,000 mL O 2 L −1 d −1 ), has been mainly used to create different oxidative-reductive regions in digesters to favor biological desulfurization ( Krayzelova et al., 2015 ; Nguyen and Khanal, 2018 ). Besides, it has been reported that micro-aeration can enhance the hydrolysis step in anaerobic digestion by increasing the production of extracellular enzymes such as proteases, amylases, and cellulases ( Girotto et al., 2016 ). Presence of O 2 can also be advantageous in fermentations with acetogens. During batch cultivation of Clostridium ljungdahlii on H 2 , CO, CO 2 , and fructose, 8% O 2 in the headspace has been found to increase the production of ethanol ( Whitham et al., 2015 ), which is an electron donor for chain elongation. Although the possibilities with O 2 are being explored in many types of anaerobic technologies, no literature can be found about the effects of controlled O 2 contamination rates on chain elongation systems. One possible reason is that designing controlled experiments to understand the effects of small oxygen contamination in mixed microbial communities is not trivial. Distribution and monitoring of O 2 can be challenging at the low concentrations found in micro-aerated systems ( Nguyen and Khanal, 2018 ). Recently, an anaerobic reactor system with continuous gas recirculation was presented as a way to ensure high gas availability to the microbial community at all times, while keeping the system closed and allowing to track component balances in the gas phase ( Baleeiro et al., 2021b ). With the help of gas recirculation systems, this study aimed to investigate the effects of small air contamination on the dynamics of the microbial community and the product formation in MCC-producing fermenters. For this purpose, two stirred tank reactors (STRs) and two bubble column reactors (BCRs) with continuous H 2 /CO 2 recirculation were operated with mixed cultures fed with lactate and acetate. One of the reactors of each type had periods with air contamination, while the other two were kept anoxic.",
"discussion": "Discussion Regardless of O 2 contamination, the BCRs had higher concentrations of propionate, i- butyrate, and n- valerate, whereas the stirred tank design facilitated higher concentrations of n- butyrate, n- caproate, and n- caprylate ( Table 1 ). The production of n- valerate and i- butyrate was not clearly related to O 2 contamination ( Figures 2 , 5 and Supplementary Table S1 ), but its connection to Clostridium sensu stricto 12 ( Figure 6 ), specifically C. luticellarii , was observed previously ( de Smit et al., 2019 ; de Leeuw et al., 2020 ; Huang et al., 2020 ; Baleeiro et al., 2021a ). C. luticellarii was shown to be important for n- valerate production from propionate ( de Smit et al., 2019 ) and could therefore play an important role in the production of odd-chain MCC in chain elongation reactors. n- Valerate and i- butyrate production also correlated with other genera that are not commonly known for the production of these compounds ( Figure 6 ). Higher relative abundances of Caproiciproducens not only correlated significantly with n -caproate production ( Figure 6 ) but were visually related to higher concentrations of n -caproate ( Supplementary Figures S4, S7 ). The correlation of n -caproate production with the abundance of Caproiciproducens is not surprising, since this genus has been commonly found in other MCC-producing communities ( Duber et al., 2020 ; Joshi et al., 2021 ). Micro-aerobic conditions favored the classes Actinobacteria, Gammaproteobacteria, Bacilli, and Coriobacteriia over Clostridia and Methanobacteria. Notably, a similar pattern is known for gut microbiota, where Actinobacteria and Alpha- or Gammaproteobacteria have been observed to dominate over Clostridia in regions of the gut more exposed to O 2 ( Friedman et al., 2018 ). One explanation is that the evolutionary younger taxa of aerotolerant Actinobacteria (e.g., propionibacteria) and Proteobacteria ( Martin and Sousa, 2015 ) are generally better equipped with enzymes that mitigate the toxicity of ROS (e.g., catalases, H 2 O 2 reductases, and superoxide dismutases) than typical strict anaerobes such as Clostridia ( Kato et al., 1997 ; Johnson and Hug, 2019 ). Partial Acclimatization of Methanogens to Ethylene Hydrogenotrophic methanogenesis was likely the main pathway for CH 4 production. This is supported by the results of previous experiments where Methanobrevibacter was one of the predominating community members under similar conditions with H 2 /CO 2 ( Baleeiro et al., 2021a ). Notably, methanogens partially overcame the inhibition by ethylene. The acclimatization occurred after 42 days of successful inhibition reported by Baleeiro et al. (2021b) . To the best of our knowledge, such acclimatization has not been reported before. With ethylene, CH 4 production was relatively strong (up to 19.5 mmol L −1 d −1 ) but still about one third lower than the rates observed in the absence of the inhibitor in a similar gas recirculation system (up to 32.8 mmol L −1 d −1 ) ( Baleeiro et al., 2021b ). We hypothesize that Methanobrevibacter , the main methanogenic genus found in our reactors, may have acclimatized to ethylene by expressing [Fe]-hydrogenases. For hydrogenotrophic methanogens, [Fe]-hydrogenases have less favorable kinetics than [NiFe]-hydrogenases. Still, some methanogens, including Methanobacteria, can express [Fe]-hydrogenases to grow under nickel-limiting conditions ( Thauer et al., 2010 ). As postulated by Baleeiro et al. (2021b) , ethylene might not exert an inhibitory effect on nickel-free hydrogenases as it does on [NiFe]-hydrogenases of methanogens. Considering that [Fe]-hydrogenases are not inhibited by O 2 ( Thauer et al., 2010 ; Stiebritz and Reiher, 2012 ), micro-aerobic conditions and broth mixing between reactors could have caused further selection of methanogens expressing [Fe]-hydrogenases even if nickel was not limiting. Further studies using transcriptome or proteome analyses of pure methanogenic cultures are needed to test this hypothesis. Steering the Fermentation with Small O 2 Contamination When the O 2 concentration in the gas phase increased up to 18% between days 11 and 28, the aerobic genus Rummeliibacillus ( Vaishampayan et al., 2009 ; Her and Kim, 2013 ) flourished in the bubble column reactor and the concentrations of n -butyrate and propionate decreased ( Supplementary Figure S6 ). With an O 2 concentration below the detection limit by day 28 ( Supplementary Figure S3 ), Actinobacteria abundance increased and propionate production reached its highest rates ( Supplementary Table S1 ). Methanogenesis and n -caproate production were strongly inhibited by O 2 intrusion. After the contamination stopped, CH 4 production recovered on every occasion but n -caproate production did not ( Supplementary Table S1 ), indicating that the O 2 contamination had particularly strong detrimental effects on C4-to-C6 chain elongation. In the period between days 119 and 139 in STR-test, n -caproate production did not increase after O 2 contamination rate changed from 474 ± 33 mL O 2 L −1 d −1 to 39 ± 33 mL O 2 L −1 d −1 , instead, the highest rates of n- butyrate production and acetate consumption were achieved. This was observed even with high relative abundances of Caproiciproducens in the community ( Supplementary Figure S5 ). Relatively low O 2 contamination rates were found to favor propionate formation in lactate-based fermentation. However, the relationship between O 2 and propionate accumulation was not as straightforward as the inhibitory effect of O 2 on chain elongation and methanogenesis. One possible reason is that propionate is not only a product of lactate fermentation, but also a substrate for n -valerate production by chain-elongating bacteria ( Angenent et al., 2016 ). This could explain what was observed in the micro-aerobic period between days 115 and 119 in the STR-test, when propionate production did not increase but n- valerate production was relatively high ( Supplementary Table S1 ). Key Players that can Profit from O 2 Intrusion Among the microorganisms enriched in the O 2 contamination periods, Acidipropionibacterium correlated to propionate production ( p < 0.01). Other Actinobacteria enriched during O 2 contamination did not correlate with propionate production and may have diverted electrons from lactate to products other than propionate, which could be another reason why STR-test showed lower propionate production rates ( Supplementary Table S1 ). Actinomyces, a facultative anaerobe ( Rao et al., 2012 ), was particularly enriched in STR-test during an O 2 contamination period ( Supplementary Figure S4 ). Actinomyces can grow anaerobically or aerobically on lactate and produces acetate, formate, and CO 2 during fermentative growth ( Takahashi et al., 1994 ; Takahashi and Yamada, 1999 ; Rao et al., 2012 ). In agreement with the reported aerobic growth of Actinomyces naeslundii on lactate ( Takahashi and Yamada, 1999 ), Actinomyces was likely not responsible for propionate production in the STR. The Coriobacteriia ( Eggerthellaceae ) observed in O 2 contamination periods belong to a family of strict anaerobes that are not reported to produce propionate ( Gupta et al., 2013 ). Proteiniphilum (as well as Dialister ) are genera with microaerophilic species that produce propionate, although it is not clear if from lactate ( Tomazetto et al., 2018 ; Sakamoto et al., 2020 ). In our study, the abundance of Proteiniphilum correlated to O 2 contamination and to propionate formation whereas no significant correlation was found between Dialister , propionate, and O 2 contamination ( Figure 6 ). Fermentation of lactate by propionate producing bacteria commonly leads to a 2:1:1 stoichiometry of propionate to acetate to CO 2 ( Eq. 2 ). Gammaproteobacteria and Actinobacteria species that produce propionate are known to use methylmalonyl-CoA pathways rather than the acrylate pathway ( Seeliger et al., 2002 ; Gonzalez-Garcia et al., 2017 ). In particular, Acidipropionibacterium spp. are among the most efficient propionate producers thanks to the highest energy efficiency of their methylmalonyl-CoA pathway (also known as Wood-Werkman cycle, a succinate pathway involving methylmalonyl-CoA:pyruvate transcarboxylase) ( Scholz and Kilian, 2016 ; Gonzalez-Garcia et al., 2017 ). 3 C H 3 C H O H C O O − → 2 C H 3 C H 2 C O O − + C H 3 C O O − + C O 2 + H 2 O (2) Even though it can express O 2 -sensitive enzymes for fermentative growth similar to those in Clostridium , Acidipropionibacterium also has aerotolerant enzymes with similar functions ( Piwowarek et al., 2018 ; McCubbin et al., 2020 ). Members of this genus are not only more tolerant to O 2 than clostridia, they have also been found to increase propionate and energy yields when exposed to O 2 ( McCubbin et al., 2020 ). It should be taken into account that propionibacteria, unlike many clostridia, do not form endospores ( Gonzalez-Garcia et al., 2017 ). Hence, if exploration of propionate production is desired, shock treatments of the inoculum (e.g., with pH or heat), common techniques for starting non-methanogenic anaerobic bioprocesses ( Baleeiro et al., 2019 ), should be avoided. The phenomenon that lactate is diverted to propionate in chain elongation reactors under micro-aerobic conditions may have been overlooked in former studies. In one notable case, Kucek et al. (2016) observed the competitive production of propionate in a lactate-based chain elongation reactor. Although the possibility of O 2 contamination was not discussed, the study detected high abundances of Acinetobacter , strictly aerobic Gammaproteobacteria ( Smet et al., 2014 ) commonly found in micro-aerated reactors ( Krayzelova et al., 2015 ). To explain the propionate production observed in certain time periods, Kucek et al. (2016) suggested the residual concentration of lactate in the reactor to be a determining factor. Although not discussed in the study, O 2 presence could have played a role in propionate production. Possible Roles of H 2 during O 2 Contamination A common way for the reduction of O 2 in the presence of H 2 is shown in Eq. 3 and is realized even by obligate anaerobes such as methanogens ( Thauer et al., 2010 ), Negativicutes ( Boga et al., 2007 ), and sulfate reducers ( Dannenberg et al., 1992 ; Chen et al., 1993 ). 2 H 2 + O 2 → 2 H 2 O (3) H 2 consumption that was not attributed to methane formation was particularly high during O 2 contamination periods. In STR-test, it ranged from 3.0 to 3.4 fold molar O 2 consumption, while in BCR-test it ranged from 1.1 to 3.6 fold. Considering the 2:1 ratio of H 2 to O 2 during H 2 oxidation ( Eq. 3 ), H 2 consumption not linked to methane formation in this study may have been related to other reactions during O 2 intrusion. Interestingly, similar consumption ratios of H 2 to O 2 (between 3.2 and 3.4) have been observed in communities dominated by hydrogen-oxidizing bacteria during autotrophic growth ( Matassa et al., 2016 ). Nevertheless, we did not observe the presence of Sulfuricurvum (the genus enriched by Matassa et al. (2016) ) and Burkholderia , a possible aerobic autotroph ( Takors et al., 2018 ) found in our study, did not correlate positively with H 2 consumption nor with O 2 contamination. Besides, if aerobic hydrogen-oxidizing bacteria played a major role in the micro-aerobic reactors in our study, signs of biomass formation and carbon source (e.g., CO 2 ) consumption should have accompanied H 2 oxidation with O 2 . However, no clear relation between O 2 contamination, biomass formation, and CO 2 consumption rates was found. Communities enriched with propionate-producing bacteria in anaerobic reactors, such as Acidipropionibacterium spp., often correlate with high H 2 consumption or low H 2 production ( Cabrol et al., 2017 ). In the presence of exogenous H 2 , some propionate producers such as Propionispira arboris are able to perform homopropionate fermentation of lactate ( Eq. 4 ) producing neither CO 2 nor acetate ( Thompson et al., 1984 ). C H 3 C H O H C O O − + H 2 → C H 3 C H 2 C O O − + H 2 O (4) We did not observe Propionispira spp. in our reactors and its closest relative found in our system ( Dialister ) is only related at the order level ( Veillonellales-Selenomonadales ). Besides, Eq.4 alone cannot explain the high H 2 consumption during most of the micro-aerobic periods in this study. H 2 consumption not linked to methane was much higher than propionate formation. In fact, the period between days 39 and 50 of BCR-test had the lowest H 2 to O 2 consumption ratio and was the period with the highest propionate productivity ( Supplementary Table S1 ). Lastly, it is not clear if the correlation found between abundance of Acidipropionibacterium and H 2 consumption not linked to methane ( Figure 6 ) is a direct one. H 2 consumption by isolated members of Propionibacterium is not observed during fermentative growth ( Seeliger et al., 2002 ). Homoacetogens consume H 2 and CO 2 ( Eq. 5 ) and, among them, at least C. ljungdahlii was shown to have some resistance against O 2 exposure ( Whitham et al., 2015 ). Here, similar clostridia were detected in the reactors and Clostridium sensu stricto 12 was still present during some O 2 contamination events ( Supplementary Figures S3, S7 ). Therefore, homoacetogenic activity could be considered to explain H 2 consumption during O 2 contamination. Nevertheless, no further evidence for this hypothesis was found. H 2 consumption was not accompanied by net CO 2 consumption and the net acetate production was unfavorable because acetate was fed in excess with the growth medium (12 g L −1 acetate) to favor chain elongation as an acetate-consuming reaction. 4 H 2 + 2 C O 2 → C H 3 C O O − + H + + 2 H 2 O (5) Another way that H 2 presence might have influenced the micro-aerated community is by amplifying the effects of O 2 contamination. The activation of O 2 into ROS by hydrogenases and reduced electron carriers might be accentuated by H 2 recirculation ( Misra and Fridovich, 1971 ; Krab et al., 1982 ). Since we did not have a control reactor for the presence of H 2 , we could not test this hypothesis."
} | 6,028 |
38674652 | PMC11052081 | pmc | 9,412 | {
"abstract": "Prokaryotes play a key role in particulate organic matter’s decomposition and remineralization processes in the vertical scale of seawater, and prokaryotes contribute to more than 70% of the estimated remineralization. However, little is known about the microbial community and metabolic activity of the vertical distribution in the trenches. The composition and distribution of prokaryotes in the water columns and benthic boundary layers of the Kermadec Trench and the Diamantina Trench were investigated using high-throughput sequencing and quantitative PCR, together with the Biolog Ecoplate TM microplates culture to analyze the microbial metabolic activity. Microbial communities in both trenches were dominated by Nitrososphaera and Halobacteria in archaea, and by Alphaproteobacteria and Gammaproteobacteria in bacteria, and the microbial community structure was significantly different between the water column and the benthic boundary layer. At the surface water, amino acids and polymers were used preferentially; at the benthic boundary layers, amino acids and amines were used preferentially. Cooperative relationships among different microbial groups and their carbon utilization capabilities could help to make better use of various carbon sources along the water depths, reflected by the predominantly positive relationships based on the co-occurrence network analysis. In addition, the distinct microbial metabolic activity detected at 800 m, which was the lower boundary of the twilight zone, had the lowest salinity and might have had higher proportions of refractory carbon sources than the shallower water depths and benthic boundary layers. This study reflected the initial preference of the carbon source by the natural microbes in the vertical scale of different trenches and should be complemented with stable isotopic tracing experiments in future studies to enhance the understanding of the complex carbon utilization pathways along the vertical scale by prokaryotes among different trenches.",
"introduction": "1. Introduction Prokaryotes play a crucial role in remineralizing and transforming significant amounts of different types of organic matter that exist in seawater, including suspended sediment particles, phytoplankton debris, living plankton, zooplankton fecal materials, aggregates, marine snow, transparent polymeric particles, colloidal particles, and so on [ 1 , 2 ]. This microbially transformed carbon may influence carbon export efficiency by facilitating aggregation/disaggregation activities, depolymerization and degradation [ 3 , 4 ]. Most particulate organic matter (POM) generated from the euphotic zone is degraded and remineralized while sinking through the water column (WC), leading to about 1–40% organic matter transported vertically from the surface ocean to the deep ocean [ 5 , 6 ]. Although the majority of organic matter is consumed in the photic zone, the fate of the sinking particles that reach the deep sea are largely determined by the abundance, diversity, and metabolic activity of microbial communities along the water depth profile [ 5 ]. The physicochemical conditions in the ocean WC are not uniform, but varied with increasing depths [ 7 ], providing strong selective pressures on microbial communities along the vertical WC [ 8 , 9 ]. These deep-sea communities can differ from the waters above and showed different microbial diversity and metabolic rates [ 10 ]. These variations may reflect carbon source availability [ 11 ] and dispersal limitation [ 12 ]. In addition, the benthic boundary layer (BBL), defined as the bottom layer of the water column directly adjacent to the seabed [ 13 ], contains a high concentration of particles resuspended from subsurface sediments [ 14 ]. The carbon sources and compositions in the BBL were reported to be distinctly different from the sinking POM and, thus, might affect the diversity and metabolic function of the microbial community. Consequently, molecular ecological studies on microbes from the euphotic layer to the BBL would contribute to understanding the microbially driven organic carbon transformations, as well as linking specific microbial groups involved in the relevant metabolic processes in different water layers. The Biolog EcoPlates TM method is a simple and sensitive way to reveal the functional diversity of microbial communities by relying on their microbial capability to use various carbon sources. It has been used to assess the metabolic activity of microbes in different water depths of the South China Sea [ 15 ] and surface sediments of the Mariana Trench [ 16 ]. But there is still a lack of direct evidence of carbon source utilization by microbial groups from the euphotic zone to abyssal depths. Carbon sources and compositions of organic carbon have been reported to vary with different water depths [ 17 ]; therefore, culture-dependent EcoPlates cultivation together with culture-independent molecular study would help to obtain a quick glimpse of the shift in the ecological roles of microbial communities from the euphotic layer to the BBL. Hadal trenches are unique deep-sea environments with distinct benthic communities, due to their steep topography and periodic disturbance by turbidity flows [ 18 ]. The Kermadec Trench is located about 120 km off the northeastern coast of New Zealand in the Southern Hemisphere. It reaches a maximum depth of 10,047 m, making it the fifth deepest trench [ 19 ]. It is 1500 km long, with a mean width of 60 km and exhibits the characteristic V-shape cross section common to hadal trenches. The Diamantina Trench is located in the Indian Ocean and has a maximum depth of approximately 8047 m. It is approximately 520 km long and 70 km wide, running in a northeast–southwest direction. It is around 1500 km west of Perth, Australia. As part of the broader coordinated effort to explore the biogeochemistry and ecology of different carbon sources along the vertical WC in hadal trenches, prokaryotes were collected from five water depths, together with four samples from the BBL in the Kermadec and Diamantina Trenches, respectively. The diversity and composition of the microbial communities were studied with high-throughput sequencing and quantitative PCR (qPCR). The Biolog EcoPlates TM method was also applied to investigate the carbon metabolic capability of microbes. This comparative study will contribute to a better understanding of the shifts and connectivity in the diversity and specific carbon metabolic capabilities of microbial communities from the surface seawater to the BBL in the Kermadec and Diamantina Trenches.",
"discussion": "4. Discussion 4.1. Geographical Distribution and Environmental Effects In the two trenches, the significantly different community structures between the WC and the BBL might be attributed to the in situ concentration and availability of organic matter. Generally, the BBL contains a high concentration of particles resuspended from subsurface sediments [ 14 , 34 ], which could explain the significantly higher gene abundance of prokaryotes in the BBL than in the WC. A higher proportion of Gammaproteobacteria in the BBL was found in the Kermadec Trench than in the Diamantina Trench and this microbial group could attach to particles to avoid the nutrient-depleted conditions in the surrounding waters [ 35 ] and easily assimilated organic carbon sources [ 36 ]. Proteobacteria and Nitrososphaeria predominate in the WC and this was generally consistent with previous studies conducted in the Kermadec Trench [ 37 ]. Halobacteria as a class of Euryarchaeota are extremely halophilic archaea that can adapt to a wide range of salt concentrations [ 38 ] and could catalyze the terminal step in the degradation of organic matter in anoxic environments where light was limiting [ 39 ]. The community structure of the euphotic layer was distinct from that of other layers in the Kermadec Trench, this might be due to the higher relative proportions of Cyanobacteria, which play an important role in the uptake and conversion of CO 2 to bioproducts through their photosynthetic system [ 40 ]. The most important impacting factors in the Kermadec Trench were the sampling depth, temperature, and NO 3 − + NO 2 − concentrations. Sampling depth has been reported as a significant driver of community composition in the Mariana Trenches [ 37 ]. Temperature could affect the community composition and metabolic activity involved in the remineralization of POC in the WC [ 15 , 41 ]. In addition, NO 3 − was reported as the primary chemical parameter affecting the microbial community composition [ 42 ]. While no significant impacting factors were identified for microbial communities in the Diamantina Trench, this was possibly due to other important factors that were not measured, such as dissolved organic/inorganic carbon, POC, and that should be included in future studies. 4.2. Carbon Source Utilization and Potential Metabolic Activity Heterotrophic microorganisms are crucial in the decomposition of POM and the subsequent remineralization processes in the seawater. Although natural carbon sources should be more complex than those contained in the Biolog Ecoplate TM microplates, substrates which were promptly and preferentially utilized during the microplate incubation might provide important information on the carbon source in natural environments [ 43 ]. At the surface water, amino acids and polymers were used preferentially; at the BBL, amino acids and amines were used preferentially. The latter might be attributed to the presence of a high proportion of Alphaproteobacteria. This bacterial group can utilize a range of organic compounds, mainly including amino acids, nucleic acids, fatty acids, and other low molecular weight compounds, including organic and aromatic hydrocarbons produced by algae [ 44 , 45 ]. Amino acids were preferentially used in both the WC and BBL in the two trenches, which could be due to the fact that they were most used in cooperative communities, which was found in previous studies [ 46 , 47 ]. In this study, the microbial metabolic activity, reflected by the AWCD values, at 800 m was significantly different from those at the other depths. The enzyme active genes of carbohydrate esterases and auxiliary activities was reported to be positively related to the salinity [ 48 ] and this might explain the lowest microbial metabolic activities at 800 m, which always showed the lowest salinity in the WC in both trenches. Microorganisms commonly metabolize simple carbohydrates, such as glucose, due to their easy digestibility and prevalence [ 49 ]. Phytoplankton exudates were the main source of dissolved carbohydrates in marine systems [ 50 ] and this might explain the higher metabolic activity involving carbohydrates in the surface layer of the Kermadec Trench, where a higher relative abundance of Cyanobacteria is harbored. Amino acids were primarily derived from marine biodegradation, protein hydrolysis, and extracellular excretion and were important components of marine organic nitrogen and organic carbon. Some amines, such as putrescine, are produced during the degradation of amino acids. The degradation of complex polymers requires a complex metabolic capability and the biogenic amines which are produced by bacteria were controlled by the high hydrostatic pressure and low temperature [ 51 , 52 ]. In addition, annotated functional genes could provide an assessment of microbial metabolic activities, allowing for the elucidation of various processes associated with substance and energy metabolism. In this study, the high abundance of aerobic chemoheterotrophy in the BBL were significantly different from those in the WC ( p < 0.05) in the Diamantina Trench. This might be due to the fact that the BBL contained a high concentration of resuspended particles from subsurface sediments as extra carbon sources, and heterotrophic prokaryotes transform the organic matter to obtain energy and carbon substances via an aerobic process [ 53 ]. 4.3. Microbial Interaction and Ecological Significance Microbial interactions could lead to a series of competitive or collaborative relationships and have been suggested as biotic drivers that affect microbial community composition [ 54 , 55 ]. More positive relationships were detected in the WC and BBL of the two trenches, indicating the possibility of cross-feeding, co-colonization, and niche overlap [ 56 ]. Different microbial groups and their carbon utilization capabilities could help to make better use of various carbon sources along the water depths. A previous study showed that the heterotrophic archaea preferentially used heavy carbon sources, such as algal carbohydrates [ 57 ], and Crenarchaeota had genes for using carbohydrates as an organic carbon source and genes for transporting amino acids from the environment [ 58 ]. Proteobacteria contain a diverse functional repertoire including their chemolithotrophic ability to utilize sulfur and C1 compounds and their chemo-organotrophic ability to utilize environment-derived fatty acids, aromatics, carbohydrates, and peptides [ 59 ]. Some groups of Proteobacteria could rapidly utilize D-glucose and produced refractory dissolved organic matter that persisted for more than a year [ 60 ]. These organic moieties from resistant polymers could be utilized by deep-sea microorganisms due to their high ectoenzymatic activity [ 61 , 62 ]. For example, Chloroflexi harbored pathways for the complete hydrolytic or oxidative degradation of various recalcitrant organic matters [ 15 ], and Bacteroidota were possibly responsible for the decomposition of polymers [ 63 ]. In addition, Actinobacteria have evolved with numerous biosynthetic gene clusters to produce diverse bioactive secondary metabolites [ 64 ]. Those microbial groups were very likely worked together with diverse organic matter accessing strategies, contributing to the degradation of marine organic matter in the WC [ 65 ]. The two trenches exhibited different fluxes of organic matter. The annual rates of primary production in the overlying waters of the Kermadec Trench, which was the first trench in the Pacific Ocean to receive Lower Circumpolar Deep Water [ 66 ], have been estimated as 87 g C m −2 yr −1 . In contrast, a higher surface chlorophyll in the euphotic layer of the Diamantina Trench of the Indian Ocean [ 67 , 68 ] might affect the sinking carbon sources and microbial community composition as well [ 69 ]. Significant differences in microbial metabolic activity (AWCD) existed between the WC and BBL in the Kermadec Trench, consistent with the NMDS plot. This might be due to the vertical shifts of community composition leading to the utilization shift of the organic detritus, which might be due to different accessing strategies of organic matter by heterogeneous microorganisms [ 65 , 69 ]. The microbial metabolic activity (AWCD) at 800 m was significantly lower from those at the other depths found in both trenches ( p < 0.05), which was also found in the South China Sea [ 15 ]. The water depth at 800 m is usually defined as the lower boundary of the twilight zone [ 70 ] and the majority of sinking organic matter in the WC was in the form of marine snow, fecal pellets, and other particles of detritus and might have been previously ingested and reworked multiple times by zooplankton with selective absorbance of the most labile and nutritious dietary compounds above this layer [ 71 ], leading to an increase in the relative proportions of refractory polysaccharides in detritus at this depth. It should be noted that the microplate used in this study had limited types of carbon sources and the incubation results only provide a quick look at the carbon source preference and might not accurately reflect the actual carbon source compositions found in natural seawater. Therefore, the mineralization rate and the biochemical fate of different carbon sources into inorganic carbon via respiration and microbial assimilation at different depths needs to be further studied using stable isotopic tracing experiments."
} | 4,027 |
37609283 | PMC10441365 | pmc | 9,414 | {
"abstract": "Beneficial microbial symbionts that are horizontally acquired by their animal hosts undergo a lifestyle transition from free-living in the environment to associated with host tissues. In the model symbiosis between the Hawaiian bobtail squid and its microbial symbiont Vibrio fischeri, one mechanism used to make this transition during host colonization is the formation of biofilm-like aggregates in host mucosa. Previous work identified factors that are sufficient to induce V. fischeri biofilm formation, yet much remains unknown regarding the breadth of target genes induced by these factors. Here, we probed two widely-used in vitro models of biofilm formation to identify novel regulatory pathways in the squid symbiont V. fischeri ES114. We discovered a shared set of 232 genes that demonstrated similar patterns in expression in both models. These genes comprise multiple exopolysaccharide loci that are upregulated and flagellar motility genes that are downregulated, with a consistent decrease in measured swimming motility. Furthermore, we identified genes regulated downstream of the key sensor kinase RscS that are induced independent of the response regulator SypG. Our data suggest that putative response regulator VpsR plays a strong role in expression of at least a subset of these genes. Overall, this study adds to our understanding of the genes involved in V. fischeri biofilm regulation, while revealing new regulatory pathways branching from previously characterized signaling networks.",
"introduction": "INTRODUCTION In animal-microbe mutualisms, symbionts can provide nutritional, developmental, and/or defensive benefits to the host, and in turn, the symbionts may gain various benefits from association with the host ( 1 – 6 ). During horizontal transmission, hosts must reacquire their symbionts each generation from environmental symbiont populations ( 7 – 14 ). Unfortunately, the understanding of how specific microbes make this transition from environment to host is often hindered by the complexity of animal microbiomes ( 15 , 16 ). Symbioses with limited symbiont diversity are therefore valuable as models to identify mechanisms of colonization and transmission. The binary mutualism between the nocturnal Hawaiian bobtail squid ( Euprymna scolopes ) and the bioluminescent marine bacterium Vibrio fischeri is one such model system that integrates symbiont specificity, a defined colonization program, and a genetically tractable microbe ( 14 , 17 , 18 ). Upon hatching from aposymbiotic (symbiont-free) eggs, juvenile squid rapidly begin symbiont recruitment from the surrounding seawater ( 18 , 19 ). Located in the squid’s mantle cavity, the bilobed symbiotic “light organ” actively captures bacteria from seawater through the activity of extruded ciliated appendages on each lobe, which focus water currents onto a ciliated mucosal layer on the exterior of the organ ( 20 ). V. fischeri cells that become entrained in host mucosa form biofilm-like aggregates through the secretion of a specific exopolysaccharide ( 13 , 21 , 22 ). Aggregate formation is a critical step in host colonization, and mutants defective in aggregation are generally compromised in reaching the internal crypt spaces of the light organ where the symbiosis is maintained ( 22 , 23 ). Therefore, understanding the genetic program connected to in vivo biofilm formation is critical to understand the transition that the colonizing microbes undergo from the planktonic state in seawater to successfully engraft themselves into the host microbiome. V. fischeri aggregates have been shown to require production of the sy mbiosis exo p olysaccharide (Syp), produced and exported by the products of a conserved 18-gene ( syp ) locus ( 21 , 22 , 24 , 25 ). Control of the syp locus is principally coordinated through a phosphorelay network feeding into two downstream response regulators ( 21 , 23 , 26 ) ( Fig. 1A ). Following auto-phosphorylation of the hybrid sensor kinase RscS, the phosphoryl group is transferred to the hybrid sensor kinase SypF ( 21 , 27 ). Upon phosphorylation of SypF, downstream phosphotransfer events are targeted from SypF onto the response regulators SypE and SypG ( 27 ). SypG is a response regulator and 54 -dependent activator that, when phosphorylated in its receiver (REC) domain, binds four promoters within the syp locus and activates their transcription ( 28 ). In contrast to the DNA-binding functionality of SypG, SypE is believed to act as a post-transcriptional regulator of Syp production that acts through SypA ( 29 ). As an additional level of control, V. fischeri also inhibits expression of the syp locus through the action of the biofilm inhibitor sensor kinase (BinK), which acts through SypG ( 30 , 31 ). Despite the robust induction of Syp exopolysaccharide production during host colonization, in vitro (i.e., culture-based) models of V. fischeri require genetic manipulation or chemical supplementation to induce biofilm formation ( 23 , 32 – 34 ). One method to induce biofilm is via overexpression of the sensor kinase RscS, either through the plasmid-based rscS1 allele or the chromosomal rscS * allele ( 21 , 35 , 36 ). RscS overexpression also induces increased aggregate formation in the squid host, explicitly linking the ability of this model to form biofilms in vitro with aggregation in the host context ( 21 ). Also, deletion of the gene encoding inhibitor sensor kinase BinK was also found to induce significantly larger aggregates during colonization ( 30 ). In culture, this biofilm-up phenotype can be reproduced by treating a Δ binK mutant with levels of calcium comparable to those found in seawater (Δ binK- Ca 2+ ), which similarly results in wrinkled colony biofilm formation ( 33 ). Both of the culture-based rscS * and Δ binK -Ca 2+ models increase biofilm formation by stimulating the expression of the syp locus through the sensor kinase SypF ( 27 , 33 ). However, the models differ in the input by which SypF is phosphorylated, with RscS acting as the primary phosphodonor to SypF in the rscS * model, while the Δ binK- Ca 2+ model requires a secondary phosphorelay involving the sensor kinase HahK (Δ binK- Ca 2+ ) ( 27 , 33 ). The discovery of both the RscS overexpression and Δ binK -Ca 2+ models opened the door to genetic analysis of Syp regulation, as both models recapitulate the induction of the critical Syp exopolysaccharide without requiring the squid host ( 27 , 30 , 33 , 37 ). Induction of the Syp exopolysaccharide in culture manifests as a distinct wrinkling morphology within colonies grown on agar media, while the wild type strain of V. fischeri ES114 remains smooth ( Fig. 1B ) ( 24 , 33 ). Considering the shared dependence of both wrinkled colony biofilm models and in vivo aggregates on Syp exopolysaccharide production, in this work we utilized wrinkled colonies formed by both of the biofilm models as proxies for in vivo aggregates in a comparative transcriptomics assay.",
"discussion": "DISCUSSION In this work, we profiled two separate models of biofilm formation in the model symbiont V. fischeri ES114. This analysis revealed remarkable similarities between transcriptional responses to the two models, which facilitated identification of a core transcriptional program. In addition to known factors that were among the highest expressed in both models (e.g., syp locus genes), we identified novel regulatory targets that included well-annotated genes (e.g., motility), loosely-annotated genes (e.g., csg, VF_0157-VF_0180 EPS), as well as many hypothetical and unannotated genes. This work generated testable hypotheses, and we pursued multiple examples of those within the study. We validated that in both models, biofilm formation resulted in diminished swimming motility, consistent with behavior in other organisms in which biofilm and motility are discordantly regulated ( 55 , 56 ). Our study provided insights into the quantitative nature of induction dynamics across biofilm operons. We observed the syp locus had dramatically higher induction for genes located earlier in each of the four operons, as seen for sypA, sypI, sypM, and sypP ( Fig. 2D ). This result suggests that sypA provides especially high dynamic range to use for reporting on core biofilm responses in strain ES114, consistent with previous studies that have applied sypA’-gfp + and sypA’-lacZ + transcriptional reporters ( 27 , 31 , 34 , 35 , 41 ). In uninduced conditions, we found that the genes encoding the central regulators of the Syp phosphorelay, sypF and sypG, had the highest abundance as measured by TPM among the syp gene transcripts. This result suggested to us that these transcripts may be regulated in a fashion uncoupled from the preceding genes. We speculate that there is a separate regulatory mechanism that enables a higher baseline of sypF and sypG transcripts without full syp locus induction, and that allows levels of SypF and SypG to accumulate to be able to respond to physiological induction of the pathway. In a recent study, induction of sypF-H in response to the biofilm stimulatory vitamin para-aminobenzoic acid (pABA) was observed in a pattern distinct from the rest of the locus ( 32 ), supporting a separate regulation mechanism that begins at sypF . The large number of genes induced in the rscS * Δ sypG strain was surprising given that the strain does not induce biofilm formation in culture. This result suggested to us that there is a substantial novel output to the RscS signaling pathway, and in the two promoters we examined, we found that VpsR was required for activity in both cases. Mutants in vpsR exhibit a competitive defect in squid colonization and a defect in cellulose regulation in culture ( 26 , 57 ). Despite characterized VpsR regulation via SypF, in the rscS * model we observed a substantial role for VpsR even when there was only a modest role for SypF ( Fig. 6AB ). We note that additional work on VpsR has been conducted in V. cholerae , which has a protein that is 66% identical to the V. fischeri ortholog. There, it has been shown to be regulated by phosphate and not by phosphorylation as would be expected as a putative response regulator ( 58 ). Furthermore, in V. cholerae VpsR regulates the Vibrio polysaccharide locus ( vps ), which is absent in V. fischeri , as similarly the bcs locus is absent in V. cholerae ( 26 ). Overall, therefore, the role of VpsR in V. fischeri requires further clarification. Overall, this work combines two models to identify novel aspects of biofilm regulation, reveal patterns of gene expression across regulated loci, and uncover new factors that are coregulated with the V. fischeri symbiotic biofilm program."
} | 2,699 |
32185005 | PMC7069281 | pmc | 9,416 | {
"abstract": "Abstract Understanding the challenges faced by organisms moving within their environment is essential to comprehending the evolution of locomotor morphology and habitat use. Geckos have developed adhesive toe pads that enable exploitation of a wide range of microhabitats. These toe pads, and their adhesive mechanisms, have typically been studied using a range of artificial substrates, usually significantly smoother than those available in nature. Although these studies have been fundamental in understanding the mechanisms of attachment in geckos, it is unclear whether gecko attachment simply gradually declines with increased roughness as some researchers have suggested, or whether the interaction between the gekkotan adhesive system and surface roughness produces nonlinear relationships. To understand ecological challenges faced in their natural habitats, it is essential to use test surfaces that are more like surfaces used by geckos in nature. We tested gecko shear force (i.e., frictional force) generation as a measure of clinging performance on three artificial substrates. We selected substrates that exhibit microtopographies with peak‐to‐valley heights similar to those of substrates used in nature, to investigate performance on a range of smooth surfaces (glass), and fine‐grained (fine sandpaper) to rough (coarse sandpaper). We found that shear force did not decline monotonically with roughness, but varied nonlinearly among substrates. Clinging performance was greater on glass and coarse sandpaper than on fine sandpaper, and clinging performance was not significantly different between glass and coarse sandpaper. Our results demonstrate that performance on different substrates varies, probably depending on the underlying mechanisms of the adhesive apparatus in geckos.",
"introduction": "1 INTRODUCTION An animal's fitness is strongly influenced by its locomotor ability, which is fundamental for successful prey capture and predator avoidance (Alexander, 2003 ). Successful locomotion in particular habitats is dependent on morphology, physiology, and habitat structure and is constrained by evolutionary history (Schriefer & Hale, 2004 ; Zani, 2000 ). Natural selection favors traits that optimize locomotor performance in various habitats, and variation in physiological and morphological characters may, in turn, increase performance in certain habitats (Kohlsdorf et al., 2004 ). Therefore, studies of ecological morphology and evolution often link morphology, performance, and ecology to suggest adaptation (Hagey, Puthoff, Crandell, Autumn, & Harmon, 2016 ; Wainwright & Reilly, 1994 ). The ability to climb is widespread in the animal kingdom (Labonte & Federle, 2015 ). Adhesive toe pads evolved in many taxa as an adaptation to enhance clinging ability. These structures have independently evolved in multiple lineages such as lizards (Irschick et al., 1996 ; Russell, 2002 ), tree frogs (Hanna, Jon, & Barnes, 1991 ; Langowski, Dodou, Kamperman, & Leeuwen, 2018 ), arachnids (Niederegger & Gorb, 2006 ; Wolff & Gorb, 2016 ), and many insect orders (Bullock & Federle, 2011 ). The mechanisms of adhesion vary among taxa, however. Tree frogs use a combination of wet and dry adhesion (Labonte & Federle, 2015 ; Langowski et al., 2018 ), whereas lizards, insects, and arachnids have evolved a hierarchical adhesive system using van der Waals forces, although they act at different scales in different taxa (Labonte et al., 2016 ). Subdigital adhesive toe pads in geckos represent a classic example of the evolution of locomotory traits that have evolved independently, on multiple occasions (Gamble, Greenbaum, Jackman, Russell, & Bauer, 2012 , 2017 ; Irschick et al., 1996 ; Russell & Gamble, 2019 ), and enabled the exploitation of several habitat types. In geckos, subdigital pads consist of laterally expanded scales (called lamellae) covered with modified scale derivatives in the form of stalks termed setae (Maderson, 1964 ; Russell, 2002 ). Fields of microfibrillar setae adhere to contacted surfaces through van der Waals forces (Autumn, Dittmore, Santos, Spenko, & Cutkosky, 2006 ; Autumn et al., 2000 ; Tian et al., 2006 ). The ability to cling to substrates by means of subdigital pads has long been a topic of research (Collette, 1962 ; Delannoy, 2006 ; Elstrott & Irschick, 2004 ; Ernst & Ruibal, 1966 ; Gamble et al., 2012 ; Hagey, Puthoff, Holbrook, Harmon, & Autumn, 2014 ; Ruibal & Ernst, 1965 ), and several studies have aimed to determine factors that allow geckos to adhere to and detach from the substrates they move across, examining the locomotory substrate characteristics (Gillies et al., 2014 ; Meine, Kloss, Schneider, & Spaltmann, 2004 ; Persson & Gorb, 2003 ; Pugno & Lepore, 2008 ; Spolenak, Gorb, Gao, & Arzt, 2005 ), the mechanisms of adhesion (Autumn et al., 2002 ; Autumn, Niewiarowski, & Puthoff, 2014 ; Gao, Wang, Yao, Gorb, & Arzt, 2005 ; Irschick, Herrel, & Vanhooydonck, 2006 ; Mahendra, 1941 ; Tian et al., 2006 ), and variation in adhesion among species (Bergmann & Irschick, 2005 ; Garner, Stark, Thomas, & Niewiarowski, 2017 ; Hagey et al., 2014 , 2017 ; Irschick et al., 1996 ; Stark, Klittich, Sitti, Niewiarowski, & Dhinojwala, 2016 ; Stark et al., 2015 ). The gekkotan adhesive system has evolved to enable the exploitation of inclined and inverted surfaces on rocks, or vegetation, with recent expansions onto man‐made structures by some species (Glossip & Losos, 1997 ; Gamble et al., 2017 ; Hagey et al., 2017 ; Ruibal & Ernst, 1965 ). The mechanism and dynamics of adhesion, however, have almost exclusively been examined using a variety of smooth (Autumn et al., 2000 ; Gillies & Fearing, 2014 ; Irschick et al., 1996 ; Peressadko & Gorb, 2004 ; Russell & Johnson, 2007 ; Stewart & Higham, 2014 ) and very fine‐grained man‐made surfaces (i.e., glass, Teflon, variations of polyethylene, polyvinyl chloride, aluminum bonding wire, acrylic, and acetate sheets; Campolo, Jones, & Fearing, 2003 ; Gillies & Fearing, 2014 ; Huber, Gorb, Hosoda, Spolenak, & Arzt, 2007 ; Meine et al., 2004 ; Persson, 2003 ; Persson & Gorb, 2003 ; Pugno & Lepore, 2008 ; Vanhooydonck, Andronescu, Herrel, & Irschick, 2005 ; Winchell, Reynolds, Prado‐Irwin, Puente‐Rolón, & Revell, 2016 ), most of them not encountered by geckos under natural conditions. Such research has revealed that geckos perform better on substrates that are smooth, clean, and have uniform surface chemistry (Stark et al., 2015 ), apparently because these substrates provide a greater surface area with which setae can make contact (Russell & Johnson, 2007 ; Vanhooydonck et al., 2005 ). Natural substrates are usually structurally and chemically substantially different from those used in laboratories (Russell & Johnson, 2007 , 2014 ; Stark et al., 2015 ). A few recent studies have examined the surface topography of natural substrates and how it affects adhesion in geckos, highlighting the unpredictability (i.e., nonuniform amplitude and wavelengths of asperities creating varying undulance) of natural substrates, especially in comparison with artificial substrates previously used in gecko adhesion studies (Cole, Jones, & Harris, 2005 ; Naylor & Higham, 2019 ; Russell & Johnson, 2014 ; Vanhooydonck et al., 2005 ). Other studies have also stressed the importance of using ecologically relevant substrates to better understand performance in insects (Bullock & Federle, 2011 ), tree frogs (Langowski et al., 2019 ), and geckos (Hagey et al., 2014 ; Higham, Russell, Niewiarowski, Wright, & Speck, 2019 ; Niewiarowski, Stark, & Dhinojwala, 2016 ; Peattie, 2007 ). Most recently, Higham et al. ( 2019 ) summarized the importance, methods, and reasons for including ecological parameters like surface characteristics in gecko adhesion studies. When setal fields are first deployed, spatulae make direct contact with the surface microtopography, and they go through a proximal pull, undergoing a preloading phase. This enables the generation of shear forces and increases the overall strength of the bond (Autumn, 2007 ; Autumn et al., 2000 ; Russell & Johnson, 2007 ). Hence, substrate surface microtopography has a major influence on the area available for attachment from a single spatula to the whole setal field and significantly influences the magnitude of force generated by the adhesive apparatus (Russell & Johnson, 2007 ). The peak‐to‐valley heights of the surface topology are one way to estimate roughness and therefore are also one way to assess the area available for setal contact at different microtopographies. Investigating the performance of geckos on surfaces with specific kinds of micro‐ and nanotopography is an important element of understanding adhesion in nature (Gamble et al., 2012 ; Russell & Johnson, 2007 , 2014 ). Although studies on smooth artificial surfaces have been important for unraveling the physical principles behind gecko adhesion, it is not clear if such studies can be used to estimate performance, or relative performance, of different species of geckos on rougher or nonuniform surfaces, such as those they encounter in their natural environment. Based on mechanisms predicted from observing gecko adhesion on artificial surfaces that are uniform and allow a very high proportion (nearing 100%, Russell & Johnson, 2007 ) of setae to make contact, we might expect a consistent decline in gecko attachment force with increasing roughness, presumably as setal fields find less purchase on uneven surfaces (Cole et al., 2005 ; Fuller & Tabor, 1975 ; Vanhooydonck et al., 2005 ; Figure 1 a). Researchers have, however, found that setal fields can accommodate rougher surfaces, even though they are thought to have evolved for adhering to smooth substrates (e.g., Rhoptropus cf. biporosus ; Russell & Johnson, 2014 ). In addition, recent studies have highlighted a multifunctional and synergistic relationship between claws and toe pads in geckos. Rough substrates that may provide limited surface area for setal attachment do allow mechanical purchase for claws. When substrates permit attachment of both claws and toe pads, that may increase clinging performance, even though there is limited surface area available for the setal fields by themselves. On the other hand, certain fine‐grained substrates do not permit secure attachment of claws or setal fields, leading to diminished clinging performance (Naylor & Higham, 2019 ). These combined processes may lead to a trend in which smooth substrates (permitting maximal engagement of setal fields) allow generation of great clinging performance, whereas, on certain coarse substrates, an intermediate proportion of the setal field can engage in conjunction with mechanical interlocking of claws. Further, the lowest performance presumably occurs on substrates of intermediate roughness, which provide poor purchase for both claws and setal fields (Figure 1 b). Thus, surfaces with intermediate roughness may permit only partial contact, producing a nonlinear performance curve, if performance is plotted against peak‐to‐valley height, or roughness (Huber et al., 2007 ). In addition, some studies at very small scales suggest that surfaces with very low and quite high levels of roughness will permit increased contact between spatulae and the surface compared to surfaces with intermediate roughness (Huber et al., 2007 ), which would also give rise to a nonlinear graph of shear forces in relation to roughness. Figure 1 Conceptual model in which substrates are ordered by decreasing roughness (coarse sandpaper, fine sandpaper, and glass), suggesting (a) declining shear force with increasing roughness or (b) a nonlinear performance curve in relation to roughness. Points are joined to illustrate the expected shape of trends Thus, we suggest there are multiple ways in which the adhesive apparatus of geckos could interact with substrates, which may give rise to different relationships between substrate roughness and shear forces generated. We predicted one of two possible trends in gecko attachment when examined on substrates with varying roughness (glass, fine sandpaper, and coarse sandpaper). (a) Performance might decline monotonically with increasing roughness (Figure 1 a), or (b) performance might be lowest on surfaces with intermediate roughness forming a nonlinear trajectory (Figure 1 b). We quantified shear forces produced by two gecko species with different morphology, body size, and habitats, along a roughness gradient. We aimed to investigate the shape of the response, as shear force generated versus peak‐to‐valley height of each surface.",
"discussion": "4 DISCUSSION Both P. australis and O. coggeri exerted significantly higher shear forces on glass and coarse sandpaper than on fine sandpaper. Therefore, we did not observe a monotonic decline in performance with increasing peak‐to‐valley heights, which contrasts with findings of studies in which performance diminished considerably with increasing levels of roughness (Cole et al., 2005 ; Vanhooydonck et al., 2005 ). Shear force exerted on coarse substrates was not significantly different from that on glass in either species; thus, our results showed a nonlinear relationship between peak‐to‐valley heights and shear forces on the continuum of surfaces we used, consistent with studies by Huber et al. ( 2007 ; on a scale of single spatula), and Naylor and Higham ( 2019 ). Gecko adhesive systems have been well studied on a range of artificial substrates that have revealed the form and function of the adhesive apparatus in this taxon; however, our findings further highlight the need for gecko adhesion studies under more ecologically relevant conditions (Collins et al., 2015 ; Higham & Russell, 2010 ; Higham et al., 2019 ; Russell & Delaugerre, 2017 ). More comparative studies examining gecko attachment on different substrates are needed to elucidate the potentially context‐specific nature of gecko attachment. The shear force that can be generated by geckos is thought to be impacted by surface topology because topology determines the area available for attachment at the scale of the setal fields and also the degree to which claws can be effective. Natural substrates have microtopographies that are unpredictable and nonuniform compared to glass and other artificially smooth substrates (Russell & Johnson, 2007 , 2014 ), highlighting the importance of overall structural considerations of locomotory substrates in gecko adhesion studies (Higham et al., 2019 ). The peak‐to‐valley heights of the coarse sandpaper we used to measure gecko clinging ability were similar to those of the rock and bark microhabitats used by O. coggeri and P. australis , respectively. Additionally, the fine sandpaper used in our study was similar in peak‐to‐valley height to bamboo surfaces used by P. australis in nature. There are, however, a range of other characteristics of rough surfaces that may influence attachment, such as variation in amplitude, wavelength (Gillies et al., 2014 ), spacing (Zhou, Robinson, Steiner, & Federle, 2014 ), and microstructuring of surface asperities, which could affect conformity of the adhesive apparatus or the attachment of claws. Additionally, the chemistry of the surfaces could influence interaction strength (Prüm, Bohn, Seidel, Rubach, & Speck, 2013 ), although we controlled for surface chemistry on both our rough surfaces by using the same brand of sandpaper, instead of using natural substrates. More research is required to determine the importance of exact topography and chemistry in replicating characteristics of natural substrates and to address the challenges of describing and quantifying surface roughness (Higham et al., 2019 ; Persson, Tiwari, Valbahs, Tolpekina, & Persson, 2018 ). Future research should incorporate carefully described and quantified, realistic surfaces in laboratory studies of attachment (Higham et al., 2019 ; Langowski et al., 2018 ). We found that shear forces exerted by both P. australis and O. coggeri were greater on glass compared to on fine sandpaper. The gekkotan adhesive system is often characterized as most efficient on smooth substrates (Russell, Baskerville, Gamble, & Higham, 2015 ). High performance on glass, observed in our study, was consistent with previous studies that have tested clinging ability on artificial smooth substrates (Autumn et al., 2006 , 2000 ; Huber et al., 2007 ; Irschick et al., 1996 ; Mahendra, 1941 ; Naylor & Higham, 2019 ). Smoother surfaces provide an increased area onto which fields of setae can make simultaneous contact, and generate substantial force (Russell & Johnson, 2007 ). Both species exhibited their highest clinging ability on glass. Our findings were consistent with the findings of previous studies in which instantaneous acceleration (40 m/s 2 on wood with 98% surface area available for attachment; Vanhooydonck et al., 2005 ) and maximum clinging ability (~2.5 N on acrylic with 0.0 root mean square height Sq [µm]; Naylor & Higham, 2019 ) were highest on substrates that provided high surface area for attachment. In our study, shear forces exerted on coarse substrates were not significantly different from those on glass, showing that the gekkotan attachment system also attaches efficiently to rough substrates. The question remains, however, what is the source of this effective attachment? Studies examining attachment systems consisting of claws and adhesive hairs in geckos (Naylor & Higham, 2019 ) and other taxa (rove beetles: Betz, 2002 ; dock beetle: Bullock & Federle, 2011 ; leaf beetles: Voigt, Schweikart, Fery, & Gorb, 2012 ) have demonstrated that claws are a critical aspect of clinging in nature, and suggest that there may be a synergistic relationship between claws and setae. They propose that greater attachment is achieved on surface topographies onto which both components can attach (Song, Dai, Wang, Ji, & Gorb, 2016 ). In our study, the nonlinear relationship of adhesion with roughness may have occurred because setal fields could maximize contact on smooth surfaces compared to fine‐grained substrates. The lower generation of shear forces on fine‐grained substrates was possibly because the opportunity for mechanical interlocking of claws was reduced on the finer‐grained sandpaper. Fine‐grained substrates are less likely to permit claws to attach compared to coarse substrates, producing the lowest generation of shear forces on fine‐grained substrates in our study. On coarse surfaces, claws could mechanically interlock, compensating for the lack of effectiveness of setae on such surfaces and increasing overall shear forces. Other studies suggest that rough surfaces provide plenty of purchase for the setal system alone (Russell & Johnson, 2014 ). For example, the African geckos Rhoptropus cf. biporosus attached well to sandstone substrates, even though they lack tractive claws (Russell & Johnson, 2014 ). Additionally, Langowski et al. ( 2019 ) also report a similar trend in tree frogs, which lack claws entirely. Such observations suggest that the nonlinear performance graph we observed may not be driven solely by the relative role of claws in the adhesive apparatus of geckos. Experiments disabling setal fields or claws, while determining the role of the other part of the clinging apparatus on surfaces of various roughnesses, are required to further examine the hypotheses raised by these observations. \n Pseudothecadactylus australis uses bamboo substrates in nature, but they exerted lower shear forces on fine sandpaper with peak‐to‐valley heights similar to bamboo substrates. Our field observations show that P. australis used bamboo substrates less often than tree bark (one observation on bamboo and 25 observations on tree bark). Possibly, bamboo substrates do not permit sufficient setal contact nor do they provide the undulance required for mechanical interlocking of claws, and so they are not preferred substrates for these geckos. Further studies should record microhabitat selection and investigate clinging ability in relation to preferred microhabitats. Our results show that gecko clinging performance did not decline monotonically with increasing peak‐to‐valley heights of substrates. Instead, performance was lowest on the substrate with intermediate peak‐to‐valley heights and was similar on glass and coarse sandpaper. Our findings demonstrate that gecko attachment forces can be context‐dependent and provide a basis for further studies examining the role of substrate and the different elements (claws and setae) in gecko attachment. Further, our study showed: (a) complex mechanisms promoting gecko attachment on multiple substrates with different microtopography, and illustrated that geckos can cling well to rough substrates thought to offer limited accommodation for the adhesive apparatus of geckos (Naylor & Higham, 2019 ; Russell & Johnson, 2007 , 2014 ); and (b) that measuring performance using substrates with ecologically relevant roughness enables the quantification of clinging ability within a range that is biologically and evolutionarily meaningful (Bartholomew, 2005 ; Hagey et al., 2014 ; Higham et al., 2019 ; Langowski et al., 2018 ; Niewiarowski, Stark, McClung, Chambers, & Sullivan, 2012 ; Peattie, 2007 ; Russell & Johnson, 2007 , 2014 )."
} | 5,362 |
39696719 | PMC11657696 | pmc | 9,417 | {
"abstract": "Background Tramway Ridge, a geothermal Antarctic Specially Protected Area (elevation 3340 m) located near the summit of Mount Erebus, is home to a unique community composed of cosmopolitan surface-associated micro-organisms and abundant, poorly understood subsurface-associated microorganisms. Here, we use shotgun metagenomics to compare the functional capabilities of this community to those found elsewhere on Earth and to infer in situ diversity and metabolic capabilities of abundant subsurface taxa. Results We found that the functional potential in this community is most similar to that found in terrestrial hydrothermal environments (hot springs, sediments) and that the two dominant organisms in the subsurface carry high rates of in situ diversity which was taken as evidence of potential endemicity. They were found to be facultative anaerobic heterotrophs that likely share a pool of nitrogenous organic compounds while specializing in different carbon compounds. Conclusions Metagenomic insights have provided a detailed understanding of the microbe-based ecosystem found in geothermally heated fumaroles at Tramway Ridge. This approach enabled us to compare Tramway Ridge with other microbial systems, identify potentially endemic taxa and elucidate the key metabolic pathways that may enable specific organisms to dominate the ecosystem. Supplementary Information The online version contains supplementary material available at 10.1186/s40793-024-00655-5.",
"conclusion": "Conclusion In the current study, we have used metagenomics to assess several aspects of the microbial community inhabiting the fumarolic soils of Tramway Ridge, Mt. Erebus, Antarctica. We observed a shared functional repertoire between Tramway Ridge and other geothermal systems, specifically terrestrial hydrothermal systems such as hot springs. We then assessed metagenome-assembled genomes (MAGs) using a novel measure to identify two potentially endemic taxa that are more abundant in the Tramway Ridge subsurface (> 2 cm depth) than the near-surface (< 2 cm depth). We named these two taxa Candidatus Australarchaeum erebusense and Candidatus Fervidibacter antarcticus to reflect that they were first observed at Mt. Erebus ( Ca. A. erebusense) or that this is the first time this genus has been describved from Antarctica ( Ca . F. antarcticus). A close examination of the metabolic repertoire of these taxa revealed that they are likely both facultative anaerobic heterotrophs that specialize in using different carbon sources under aerobic conditions, but that use similar organic compounds during anaerobic growth. Like other deep-branching non-AOA Nitrososphaeria, Ca. A. erebusense possesses a putative pathway for the beta-oxidation of fatty acids. Like other Candidatus Fervidibacter, Ca. F. antarcticus is predicted to utilize sugars and scavenge hydrogen gas under aerobic conditions [ 82 , 85 ]. Under oxygen-limited conditions, both may utilize similar peptides and amino acids for energy and carbon acquisition. We hypothesize that this pattern of metabolic utilization may reflect the extreme and carbon-limiting C:N ratios (1:3 to 3:1) encountered at Tramway Ridge. Dominant taxa may share nitrogen-rich compounds such as peptides and amino acids since the demand for such compounds may not be as high as for carbon-rich compounds. Instead, different taxa specialize in utilizing specific carbon compounds (sugars vs. fatty acids) through selective exclusion, allowing both to co-exist by carving out specific nutritional niches. Each is also equipped with form II aerobic carbon monoxide dehydrogenase genes that may provide maintenance energy during times of starvation. Together, these insights provide an unprecedented view into the dominant metabolic processes that may sustain life in this harsh, isolated environment.",
"discussion": "Discussion Metagenome functional profiles Mt. Erebus has evolved over time, starting with seafloor rifting and growing as a subaerial volcano into a modern-day stratovolcano [ 2 ]. The current conditions at Tramway Ridge differ remarkably from other extant non-Antarctic terrestrial and marine hydrothermal systems, being primarily driven by the unique phonolite magmatic source resulting in alkaline fumaroles with low sulphidic content. It is unknown how long geothermal features such as the fumaroles at Tramway Ridge have been present on Mt. Erebus; however, volcanism was once widespread across the Ross Island massif [ 1 ]. Extant geothermal features may represent a once widespread ecosystem of similar features. Given this complex history of Mt. Erebus, we questioned whether the Tramway Ridge community has retained a legacy signature of its origin on the seafloor or if the modern-day Tramway Ridge community better resembles other terrestrial hydrothermal sites. To answer this question, we compared functional profiles of assembled Tramway Ridge metagenomes to a large set of publicly available metagenomes. Metagenomes from Tramway Ridge were distinct from all others (Fig. 2 c) but showed the most similarity to terrestrial hydrothermal environments such as hot springs and associated sediments. This indicates that the legacy of a sea floor origin is less important than the extant conditions at Tramway ridge in defining the microbial community. This is also reflected in the prevalence of taxa at Tramway Ridge that are found in other terrestrial hydrothermal environments but not in seafloor hydrothermal systems, such as the genera Mastigocladus , Caldithermus , Meiothermus and phyla such as the Chloroflexota, Armatimonadota and Actinobacteriota. The unique nature of Tramway Ridge metagenomic profiles likely reflects the site’s relatively low diversity [ 4 ] and the type of functional profile analysis used here. First, pfams were used, which are very coarse functional units. Second, gene abundance was not available for most metagenomes, so we were forced to use presence-absence as data. Third, we found that the use of pfam presence-absence was sensitive to metagenome assembly size as well as the total number of unique pfams detected. In combination, these features had the potential to obfuscate any meaningful relationships. Our analysis was optimized to be as permissive as possible, allowing as many metagenomes into the analysis while still comparing like against like. Using this strategy, we were able to compare Tramway Ridge metagenomic datasets to 4513 out of 7652 publicly available and unrestricted metagenomes. Within continental Antarctica, only three known surface-expressed active geothermal areas exist (Mt. Rittmann, Mt. Melbourne and Mt Erebus), each of which is separated by vast ice fields [ 7 ]. It is thought that intercontinental transport of microbe-bearing particulates into Antarctica occurs much less frequently than intracontinental transport [ 70 ], suggesting that the introduction of exogenous microbes is relatively infrequent. Recent studies have used database searches to identify potentially endemic species [ 71 ], and a lack of sequence identity to database entries has been used in the past to suggest that novel sequences indicate endemism [ 4 ]. However, defining endemism based on whether sequence matches exist within a database can be problematic as this definition is sensitive to database composition. Conclusions drawn may not withstand the inevitable growth in database size and the diversity it holds. For this study, we took an alternative approach and attempted to define the degree of endemism of a given taxon as being proportional to the in situ diversity of that taxon. For these inferences, we assumed that rare colonization events have been limited to single clones due to the extreme isolation of Mt. Erebus. Therefore, populations arising from recently introduced taxa would be expected to exhibit relatively low levels of genetic polymorphism and endemic microbial populations would be expected to show high levels of genetic polymorphism. We developed the endemicity index (EI) (Fig. 3 F), focused on accumulations of synonymous mutations, which were assumed to be under reduced selection pressure. We used the EI to assess the diversity of a microbial population represented by a MAG. Similar calculations have been successfully applied to approximate effective population size and genomic fluidity [ 72 ]. High values (e.g. 10 –2 ) of EI indicate high diversity which we interpreted as reflecting a neutral evolutionary process occurring under minimal contemporary selection pressures. Low values (e.g. 10 –6 ) indicate low diversity, which we interpreted as possible evidence of a relatively recent arrival, a local population bottleneck, or a recent selective sweep. A cyanobacterium belonging to either the Fischerella or Mastigocladus genus recovered the lowest median EI value (1 × 10 –5 ) for a single species. This species dominated the near-surface. Although difficult to distinguish these two genera based on 16S rRNA gene sequence and GTDB classifies all members of the genera Fischerella and Mastigocladus as Fisherella , the distinction of Mastigocladus is recognized as a distinct genus by the List of Prokaryotic names with Standing in Nomenclature (LPSN). Therefore we classified this MAG as a member of the Mastigocladus genus to be consistent with the classification of specimens collected from Tramway Ridge in the past [ 73 ]. The low in situ diversity observed for this taxon was consistent with previous studies that showed that the global phylogeography of Mastigocladus reflects a geologically recent radiation from Yellowstone National Park, USA [ 74 ] and that the surface-associated microbial community at Tramway Ridge is likely dominated by aeolian-distributed cosmopolitan members of non-Antarctic temperate and terrestrial hydrothermal soil communities [ 4 ]. We identified Candidatus Australarchaeum erebusense (ERB_5_1) and Candidatus Fervidibacter antarcticus (ERB_15_1) as two MAGs with relatively high EI values and abundance in the subsurface at depths greater than 2 cm (Fig. 3 f, Fig. 3 g). In our earlier amplicon-based study, these two taxa were similarly identified as dominant, potentially endemic, and associated with the subsurface, but were referred to as “Thaumarchaeota-like archaeon” and OCtSpA1-106 respectively [ 4 ]. The most abundant subsurface-associated organism recovered was Candidatus A. erebusense (ERB_5_1), a member of the Nitrososphaeria (formerly Thaumarchaeota). This class of Archaea is a globally distributed group that is best known for the chemolithoautotrophic oxidation of ammonia [ 75 ] and for the apparent universal synthesis of cobalamin [ 76 ]. However, several deeply divergent lineages of Nitrososphaeria identified through the construction of MAGs [ 50 , 63 , 77 ] and a single cultivated species, Candidatus Conexivisphaera calidus NAS-02 [ 78 ] have been shown to lack these hallmark attributes. These deeply diverging lineages have been predicted to be predominantly anaerobic heterotrophs [ 63 , 77 ] capable of beta oxidation of fatty acids and protein/peptide degradation [ 78 , 79 ] . Candidatus A. erebusense (ERB_5_1) is one of the deepest-branching members of the Nitrososphaeria (Fig. 3 b) and like other deeply diverging lineages, it encodes genes for the beta oxidation of fatty acids and peptide degradation while lacking marker genes for cobalamin biosynthesis and ammonia oxidation (Table S6 ). Candidatus A. erebusense may also employ amino acid-based oxidation, similar to a pathway used by Thermococcus kodakarensis [ 80 ] and a proposed alternative metabolism for Ca . Nitrosocaldus islandicus [ 64 ], a representative of thermophilic ammonia oxidizing archaea (AOA). In this proposed metabolism, glutamate could be utilized to generate both reducing power and ATP to power the cell. However, Ca. A. erebusense is also predicted to respire oxygen, a unique prediction among its closest, presumably anaerobic relatives. It encodes two aa3 -type (low-affinity) cytochrome C-oxidases which could presumably drive beta oxidation of fatty acids. However it is unclear whether aerobic respiration could be coupled with an amino acid degradation pathway, which is typically thought to be an anaerobic metabolism [ 64 , 80 ]. It is unclear if these energy-generating pathways are mutually exclusive and operate under specific oxidative conditions. At least during summer, oxygen levels in the subsurface are around 30% saturation [ 4 ] and therefore, no organisms inhabiting the fumaroles are likely to be obligate anaerobes. However, it is also reasonable to assume that the wet, steamy subsurface experiences anoxia at least at small spatial scales. Therefore, we hypothesize that Ca. A. erebusense switches between metabolic pathways depending on the oxic environment, using beta-oxidation of fatty acids when oxygen levels are sufficiently high and peptide fermentation when oxygen levels are low. CO metabolism is likely to be used for maintenance during times of nutritional stress, as has previously been shown for Antarctic soil microbes [ 54 ]. Another abundant subsurface MAG examined in detail belongs to the thermophilic genus Candidatus Fervidibacter, which was first discovered in Octopus Spring, Yellowstone National Park (clone OctSpA1-106, [ 81 ]. The genus is named after Ca. Fervidibacter sacchari, which encodes a large repertoire of carbohydrate-active enzymes (CAZymes) [ 82 ] and which has recently been isolated and described [ 67 ]. Like other Ca. Fervidibacter, Ca. F. antarcticus (ERB_15_1) encodes a significant number and diversity of CAZymes including a large, diverse cohort of the unusual and poorly characterized GH109 family. Previous findings suggest that these novel enzymes are involved in extracellular polysaccharide metabolism unique to thermophilic systems [ 67 , 83 , 84 ] with the diversity of Ca. F. antarcticus GH109s suggesting a diverse and unique polysaccharide utilization profile typical of this genus. Interestingly, Ca. Fervidibacter genomes, including Ca. F. antarcticus appear to also encode mechanisms that enable growth on casamino acids [ 67 ], [ 67 ]. The encoded hydrogenase and CODH are likely maintenance mechanisms to enable survival under carbon limitation with growth primarily supported through aerobic heterotrophic growth on saccharides and anaerobic growth on amino acids. Conclusion In the current study, we have used metagenomics to assess several aspects of the microbial community inhabiting the fumarolic soils of Tramway Ridge, Mt. Erebus, Antarctica. We observed a shared functional repertoire between Tramway Ridge and other geothermal systems, specifically terrestrial hydrothermal systems such as hot springs. We then assessed metagenome-assembled genomes (MAGs) using a novel measure to identify two potentially endemic taxa that are more abundant in the Tramway Ridge subsurface (> 2 cm depth) than the near-surface (< 2 cm depth). We named these two taxa Candidatus Australarchaeum erebusense and Candidatus Fervidibacter antarcticus to reflect that they were first observed at Mt. Erebus ( Ca. A. erebusense) or that this is the first time this genus has been describved from Antarctica ( Ca . F. antarcticus). A close examination of the metabolic repertoire of these taxa revealed that they are likely both facultative anaerobic heterotrophs that specialize in using different carbon sources under aerobic conditions, but that use similar organic compounds during anaerobic growth. Like other deep-branching non-AOA Nitrososphaeria, Ca. A. erebusense possesses a putative pathway for the beta-oxidation of fatty acids. Like other Candidatus Fervidibacter, Ca. F. antarcticus is predicted to utilize sugars and scavenge hydrogen gas under aerobic conditions [ 82 , 85 ]. Under oxygen-limited conditions, both may utilize similar peptides and amino acids for energy and carbon acquisition. We hypothesize that this pattern of metabolic utilization may reflect the extreme and carbon-limiting C:N ratios (1:3 to 3:1) encountered at Tramway Ridge. Dominant taxa may share nitrogen-rich compounds such as peptides and amino acids since the demand for such compounds may not be as high as for carbon-rich compounds. Instead, different taxa specialize in utilizing specific carbon compounds (sugars vs. fatty acids) through selective exclusion, allowing both to co-exist by carving out specific nutritional niches. Each is also equipped with form II aerobic carbon monoxide dehydrogenase genes that may provide maintenance energy during times of starvation. Together, these insights provide an unprecedented view into the dominant metabolic processes that may sustain life in this harsh, isolated environment."
} | 4,194 |
19802380 | null | s2 | 9,419 | {
"abstract": "pH-sensitive nanoclay composite hydrogels based on N-isopropylacrylamide (NIPA) were synthesized by copolymerization with cationic and anionic comonomers. Laponite nanoclay particles served as multifunctional crosslinkers, producing hydrogels with exceptionally high mechanical strengths, as measured by elongation at break. Cationic copolymer gels based on NIPA and dimethylaminoethylmethacrylate were prepared by aqueous free radical polymerization, adopting a procedure reported by Haraguchi (Adv Mater 2002, 14, 1120-1124). Without modification, this technique failed to produce anionic copolymer gels of NIPA and methacrylic acid due to flocculation of clay particles. Three methods were conceived to incorporate acidic MAA into nanoclay hydrogels. First, NIPA was copolymerized with acidic comonomer under dilute conditions, producing hydrogels with good pH-sensitivity but weak mechanical characteristics. Second, NIPA was copolymerized with methyl methacrylate, which was then hydrolyzed to generate acid sidegroups, yielding hydrogels that were much stronger but less pH sensitive. Third, NIPA was copolymerized with an acid comonomer following modification of the nanoclay surface with pyrophosphate ions. The resulting hydrogels exhibited both strong pH-sensitivities at 37 degrees C and excellent tensile properties. Optical transparency changed during polymerization, depending on hydrophobicity of the components. This work increases the diversity and functionality of nanoclay hydrogels, which display certain mechanical advantages over conventionally crosslinked hydrogels."
} | 397 |
37228625 | PMC10203187 | pmc | 9,421 | {
"abstract": "Background: Bioleaching is a practical method to recover metals from low-grade mineral sulfides. The most frequent bacteria involved in the bioleaching of metals from ores\nare Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans . Experimental design is a method through which the optimum activity condition will be obtained, avoiding numerous trials and errors. Objectives: This study aimed to optimize the bioleaching condition of two indigenous iron- and sulfur-oxidizing bacteria from the Meydouk mine, Iran, and evaluate their function in a semi-pilot operation in pure and mixed cultures. Material and Methods: After treatment with sulfuric acid, the bacterial DNA was extracted, and further 16S rRNA was sequenced to characterize the bacterial species. The cultivation condition of these bacteria was optimized using Design-expert (6.1.1 version) software. The copper recovery rate and the differentiation in the ORP rate in the percolation columns were also investigated. These strains were isolated from the Meydouk mine for the first time. Results: 16S rRNA analysis revealed that both bacteria belong to the Acidithiobacillus genus. The factors with the most significant impact on Acidithiobacillus ferrooxidans with\ntheir optimum level were temperature=35 °C, pH=2.5, and initial FeSO 4 concentration=25 g.L -1 . Also, initial sulfur concentration had the most significant\nimpact on Acidithiobacillus thiooxidans with the optimum level of 35 g.L -1 . Moreover, the mixed culture determined higher bioleaching efficiency compared with the case of employing the pure cultures. Conclusions: Utilizing a mixture of both bacteria, Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans elevated the Cu recovery rate due to the synergetic\nfunction of the strains. Also, introducing an initial dosage of sulfur and pre-acidification could elevate metal recovery efficiency.",
"conclusion": "6. Conclusions Two mesophilic iron-oxidizing and sulfur-oxidizing acido-philic strains isolated from the Meydouk mine in Kerman Province, Iran, were identified as Acidithiobacillus based on\nmorphological testing and 16S rRNA gene sequence analysis. The experimental design was performed through Response Surface Method to optimize the bioleaching condition.\nInitial iron concentration, temperature, and pH were the influential factors for A. ferrooxidans , and initial sulfur concentration had the most significant impact on A. thiooxidans . When percolation columns were set up, it was discovered that using a mixture of both bacteria resulted in a higher ratio of copper recovery than individually inoculating each strain.",
"discussion": "5. Discussion The experimental design makes it feasible to establish the optimal conditions for microorganism growth and activity, minimizing the need for numerous trials and errors and eliminating extraneous factors. The conversion of Fe 2+ to Fe 3+ by Acidithiobacillus ferrooxidans not only facilitates the removal of metals from ores but also provides energy for the bacteria to thrive ( 9 \n, 24 \n). In fact, it was expected to have iron concentration as one of the factors that significantly impact the growth rate of A. ferrooxidans ( 24 \n), similar to what we discovered through the experimental design. Our investigation demonstrated that high FeSO 4 concentrations (>25 g.L -1 ) had a preventive effect on bacterial iron oxidation.\nFe 2+ and Fe 3+ have certain levels of inhibition on A. ferrooxidans ( 9 \n, 13 \n). Also, we observed that the influence of K + and Ca 2+ ions on iron oxidation was minimal at the tested levels. Since the effect of KH 2 PO 4 was negligible, we concluded that it is possible to have it eliminated from the components of the K9 culture medium. According to the experimental design findings, pH is one of the three factors with the most significant effect on iron oxidation. In short terms, following Figure 2A , differentiation in initial pH demonstrated significant differences. A similar trend was observed in the study conducted by Arshadi and Mousavi in 2015. They similarly stated that the Cu recovery rate elevated as the initial pH increased from 1 to 2. They also indicated that a shift from a pH of 2 to 3 lowered the recovery of copper ( 13 \n). Both sides of their study prove the accuracy of our result of 2.5 being the optimum pH. In another study where Fe oxidation by an iron-oxidizing bacteria was examined, it was discovered that as the pH decreased below 2, the bacteria’s iron-oxidizing potential declined ( 6 \n). Also, According to Figure 2A of the current work, the difference in iron oxidation was caused by bacterial action, not due to the shift in pH. Iron-oxidizing bacteria, particularly Acidithiobacillus ferrooxidans , can adapt to temperatures found in deep mines. In 1989, Ahonen and Tuovinen investigated the growth of acidophilic iron-oxidizing bacteria at temperatures ranging from 4 to 37 and 46 °C and discovered that bacteria grew at all temperatures except 46 °C. ( 15 \n). Kim et al . (2008) explored the effect of temperature on the log phase of A.ferrooxidans growth, discovering that 303 oK (about 30 °C) was the optimal temperature for the bacterium to thrive. The rate decreased above this temperature due to the denaturation of enzymes and proteins and ferric ion behavior ( 6 \n). Although we observed bacterial function at temperatures below and above 30 °C, A.ferrooxidans demonstrated the most significant activity at 35 °C as the optimal temperature, which is roughly consistent with the findings of the cited works. Furthermore, at 45 °C, the redox potential exhibits a dramatic drop ( Fig. 2B ). This Figure further illustrates that the changes in redox potential were due to the presence of bacteria rather than a temperature rise. When the experimental design for A. thiooxidans was completed, the results indicated that the initial concentration of sulfur had the most significant impact on\nthe growth rate of TTM, possibly because this strain is dependent on sulfur to receive electrons essential for thriving.\nUsing the Response Surface Method, Liu et al . (2004) optimized the acidic culture conditions of native Acidithiobacillus thiooxidans .\nThey determined the optimal composition of this strain by evaluating four components in the culture\nmedium: (NH 4 ) 2 SO 4 =4.9 g.L -1 , H 2 PO 4 =3.5 g.L -1 , MgSO 4 =0.7 g.L -1 , and S=23.7 g.L -1 . By studying these four parameters, they concluded that the concentration of sulfur in the culture medium was the most crucial chemical impacting the growth of the bacteria and that the influence of the other three factors was minimal compared to the effect of sulfur concentration ( 10 \n). After establishing optimal cultivation conditions for these two isolated bacteria, bioleaching experiments were carried out on both strains. The results demonstrated a higher copper recovery of 10% in the pulp density. The greater the particle size in the column, the lesser the electrochemical connection was between sulfide minerals. The Cu ratio is often high in low-grade ore, where mineral interaction is expected to be less vigorous. As a result, the bacteria were more active in the thinner pulp, resulting in higher copper recovery ( 12 \n). As mentioned before, Acidithiobacillus ferrooxidans convert Fe 2+ to Fe 3+ to provide the required energy to thrive.\nThe more Fe 2+ is transformed to Fe 3+ , the higher the pH will become, and, as a result, the Cu recovery rate will drop ( 9 \n, 24 \n). Also, Acidithiobacillus thiooxidans obtains the energy it needs by oxidizing sulfur to sulfate. Complementary to A. ferrooxidans activity, A. thiooxidans mechanism results in more sulfuric acid produced that enhances metal recovery through lowering the increased pH that was the consequence of the\nconversion of Fe 2+ to Fe 3+ by A. ferrooxidans . Furthermore, A. thiooxidans can prevent the formation of jarosites and allow for greater copper solubilization through the action of ferric ions ( 1 \n). Accordingly, in our investigation, a greater rate of Cu recovery was observed in the percolation column of the mixture of these two bacteria than in the\nsituations where A. ferrooxidans and A. thiooxidans were used separately. Qiu MQ et al . 2005 and Liu H et al .\n2011 evaluated pyrite and chalcopyrite bioleaching processes in vitro using pure cultivation vs. mixed cultivation of Acidithiobacillus strains,\ndemonstrating that the mixes in vitro had more significant impacts on copper recovery ( 1 \n, 2 ). Typically, a pre-treatment stage is planned in industrial operations to minimize the initial stationary period. Hereupon, pre-leaching acidification and sulfur addition can enhance microorganism leaching activity by facilitating metal mobility by lowering pH, as demonstrated by Kamizela et al ., 2021, who investigated the recovery of heavy metals from\nlandfill leachates using A. ferrooxidans and A. thiooxidans ( 7 \n). Zheng et al . in 2012 demonstrated that acid rain, considered an acid treatment, could significantly elevate the leaching activity of micro-organisms by declining the pH level ( 16 \n). Due to the proven positive effect of pre-acidification, we decided to have this pre-treatment after sampling and before the bioleaching experiments. Moreover, adding sulfur at the beginning of the leaching can play a double-sword role, increasing in case of the optimum dose and preventing if it overdoses ( Fig. 3C ). Although multiple studies have been conducted on the bioleaching of copper in mines located in Iran, to the best of our knowledge, this is the first report on the optimized\ncopper bioleaching by a mixture of different Acidithiobacillus strains extracted from Iran’s mines, and it indicates the importance of employing this method besides optimization of cultivation and bioleaching conditions."
} | 2,470 |
21833332 | PMC3153052 | pmc | 9,422 | {
"abstract": "Soils are immensely diverse microbial habitats with thousands of co-existing bacterial, archaeal, and fungal species. Across broad spatial scales, factors such as pH and soil moisture appear to determine the diversity and structure of soil bacterial communities. Within any one site however, bacterial taxon diversity is high and factors maintaining this diversity are poorly resolved. Candidate factors include organic substrate availability and chemical recalcitrance, and given that they appear to structure bacterial communities at the phylum level, we examine whether these factors might structure bacterial communities at finer levels of taxonomic resolution. Analyzing 16S rRNA gene composition of nucleotide analog-labeled DNA by PhyloChip microarrays, we compare relative growth rates on organic substrates of increasing chemical recalcitrance of >2,200 bacterial taxa across 43 divisions/phyla. Taxa that increase in relative abundance with labile organic substrates (i.e., glycine, sucrose) are numerous (>500), phylogenetically clustered, and occur predominantly in two phyla (Proteobacteria and Actinobacteria) including orders Actinomycetales, Enterobacteriales, Burkholderiales, Rhodocyclales, Alteromonadales, and Pseudomonadales. Taxa increasing in relative abundance with more chemically recalcitrant substrates (i.e., cellulose, lignin, or tannin–protein) are fewer (168) but more phylogenetically dispersed, occurring across eight phyla and including Clostridiales, Sphingomonadalaes, Desulfovibrionales. Just over 6% of detected taxa, including many Burkholderiales increase in relative abundance with both labile and chemically recalcitrant substrates. Estimates of median rRNA copy number per genome of responding taxa demonstrate that these patterns are broadly consistent with bacterial growth strategies. Taken together, these data suggest that changes in availability of intrinsically labile substrates may result in predictable shifts in soil bacterial composition.",
"introduction": "Introduction With over a billion individual cells and estimates of 10 4 –10 5 distinct genomes per gram of soil (Gans et al., 2005 ; Tringe et al., 2005 ; Fierer et al., 2007b ), bacteria in soil are the reservoirs for much of Earth's genetic biodiversity. This vast phylogenetic and functional diversity can be attributed in part to the dynamic physical and chemical heterogeneity of soil, which results in spatial and temporal separation of microorganisms (Papke and Ward, 2004 ). Given the high diversity of carbon (C) – rich compounds in soils, the ability of each taxon to compete for only a subset of resources could also contribute to the high diversity of bacteria in soils through resource partitioning (Zhou et al., 2002 ). Indeed, Waldrop and Firestone ( 2004 ) have demonstrated distinct substrate preferences by broad microbial groups in grassland soils and C resource partitioning has been demonstrated to be a key contributor to patterns of bacterial co-existence in model communities on plant surfaces (Wilson and Lindow, 1994 ). Whether resource partitioning occurs in soil bacterial communities has not yet been addressed in a comprehensive manner, largely due to methodological limitations in sampling the enormous diversity and in measuring functional responses. The development of high-throughput tools to assess the composition of soil bacterial communities is rapidly contributing to an improved understanding of bacterial diversity and biogeographical distribution (Drenovsky et al., 2009 ; Lauber et al., 2009 ; Chu et al., 2010 ). However, our ability to assess the functions of different bacterial taxa has not kept pace (Green et al., 2008 ). This limits our ability to interpret the functional consequences of shifts in community composition in response to environmental changes (Stein and Nicol, 2011 ). For example, most of our knowledge of the metabolic capabilities of bacterial taxonomic groups is derived from culture-based studies, which may not represent their activities in natural environments and is a small subset of the total diversity of bacteria in soils. Improving our understanding of the metabolic plasticity/rigidity of soil bacteria and determining their ability to utilize different types of C substrates, will enable us to better predict the consequences of changes in substrate availability on soil microbial community composition and diversity. Phylogenetic approaches such as those based upon 16S rRNA genes are limited in their ability to extrapolate function since many functional traits are phylogenetically dispersed. For this reason, the use of tracer molecules such as stable-isotopes and the thymidine analog, 3-bromodeoxyuridine (BrdU), have been widely adopted in an effort to connect phylogeny to function. Stable-isotopes, particularly the heavy carbon isotope 13 C, have been frequently used to identify microbial community members capable of catabolizing particular substrates (Radajewski et al., 2000 ; Griffiths et al., 2004 ; Buckley et al., 2007 ; Feth El Zahar et al., 2007 ; Schwartz, 2007 ). This technique requires separation of nucleic acids based on buoyant density, so high concentrations of isotopically labeled substrate are needed. Thus, this approach is costly and impractical for many complex organic compounds that are not commercially available. An alternative is the use of BrdU to monitor cell division following substrate addition. This approach was first applied to the study of bacterial populations over a decade ago (Urbach et al., 1999 ) and it has since been used to identify soil bacterial taxa that respond to various environmental stimuli (Borneman, 1999 ; Yin et al., 2000 ; Artursson and Jansson, 2003 ; Artursson et al., 2005 ). Recently, BrdU incorporation has been shown to detect a broad diversity of bacterial phyla in marine systems (Edlund et al., 2008 ) and fungal taxa in temperate (Hanson et al., 2008 ) and boreal forest soils (Allison et al., 2008 ). In this study, we incubated soils from Harvard Forest (MA, USA) in the presence of BrdU and with a range of C substrates varying in chemical recalcitrance due to their molecular weight, structure, and the need for enzymatic digestion prior to microbial assimilation (glycine, sucrose, cellulose, lignin, tannin–protein). Next, we analyzed immunocaptured DNA by 16S rRNA PhyloChip (Brodie et al., 2006 , 2007 ; DeSantis et al., 2007 ) to determine which members of the soil bacterial community increased their growth rates in response to substrate additions. We hypothesized that the soil bacterial community is comprised of relatively distinct phylogenetic subsets that are either metabolically versatile with regard to their C substrate preferences or display specific C substrate utilization profiles and that response to substrates can be related to rRNA copy number as a proxy for growth strategy (Klappenbach et al., 2000 ; Lee et al., 2009 ).",
"discussion": "Discussion The microbial diversity of soils is vast, but the mechanisms maintaining this diversity are not fully understood. A major contributor to this diversity may be the development of distinct resource niches whereby many organisms can co-inhabit the same location by utilizing different substrates. BrdU labeling allowed us to characterize some of these niches by identifying the bacterial members who responded (through DNA replication) to the presence of specific C substrates. Soil microbes, with the exception of those inhabiting the rhizosphere, are typically considered to be C-limited (Zak et al., 1993 ; Curtis et al., 1994 ; Alden et al., 2001 ; Garbeva and De Boer, 2009 ). This together with the fact that soil C pools are heterogeneous and vary in chemical recalcitrance and turnover times (Dixon et al., 1994 ; Lichtfouse et al., 1995 ; Knorr et al., 2005 ) suggests that specialization on C substrates may contribute to the high phylogenetic diversity observed in soils. Indeed, it has been suggested that one of the main factors controlling bacterial species diversity is the diversity of C substrates (Zhou et al., 2002 ). Here, we identified hundreds of bacterial taxa that responded only to labile C additions (Figure 4 ). In fact, addition of labile C (glycine or sucrose) resulted in a greater divergence of bacterial communities from controls than did chemically recalcitrant C (Figure 2 ). This finding is supported by our estimates of rRNA copy numbers/genome of taxa responding to labile substrates, where we see a large number of fast-growing (copiotrophs) responding quickly to a pulsed resource. Conversely, slow-growing (oligotrophs) with lower rRNA copy numbers, such as some alpha-proteobacteria and Acidobacteria decline following substrate addition. Labile C also significantly alters fungal community structure in this site, as does cellulose which Hanson et al. ( 2008 ) observed to be mineralized rapidly. In contrast, cellulose did not induce a large change in bacterial community structure (Figure 2 ), although we did not directly compare the relative abundances of bacteria and fungi in these data, suggesting that fungi – not bacteria – may be the main decomposers of cellulose in these soils. Numerous bacterial taxa were enriched by labile C (Figure 3 ) but they were phylogenetically clustered and represented few bacterial orders suggesting that labile C (such as that found in rhizosphere exudates) promotes outgrowth of low diversity assemblages, which results in a heavily skewed distribution of taxa abundance at the community level. In this study we detected significant increases in the relative abundances of many β-Proteobacteria (Burkholderiales and Rhodocyclales), γ-Proteobacteria (Enterobacteriales and Pseudomonadales), and Actinobacteria (Actinomycetales) in response to labile substrates. This does not necessarily indicate that other taxa are not capable of utilizing labile substrates, but does indicate that they were not competitive for these resources under these conditions. The rapid response of fast-growing bacteria (such as those that responded to glycine and/or sucrose) to labile C may partly explain the rhizosphere effect. Smalla et al. ( 2001 ) reported an enrichment of Actinobacteria in the rhizosphere of several plant species and DeAngelis et al. ( 2009 ) recently documented a higher abundance of both β-Proteobacteria and Actinobacteria in the rhizosphere of wild oats. In the latter study, of the 44 phyla detected in the grassland soil, root movement through soil only significantly affected ~7% of taxa within 8 days. Drigo et al. ( 2009 ) found that increased rhizodeposition of sugars due to elevated CO 2 increased the abundance of Burkholderia and Pseudomonads. In our study, almost 50% of actively replicating bacterial taxa (1115 from 2233) were significantly altered by C substrate addition in 2 days, but as in the study by DeAngelis et al. ( 2009 ) they represented few phyla. Collectively, these findings suggest that in complex communities, labile substrates are primarily utilized by fast-growing copiotrophs, depleting these resources in time and space before oligotrophs can assimilate them. Even though a limited number of phyla responded to labile C addition, substrate preference was still apparent. For example, glycine addition stimulated the growth of many γ-Proteobacteria (Enterobacteriales, Alteromonadalaes), whereas sucrose addition stimulated growth of many Actinobacteria (Actinomycetales), β-Proteobacteria (Burkholderiales, Rhodocyclales), and other γ-Proteobacteria (Pseudomonadales; Figures 1 and 3 B). This substrate preference may allow co-existence between these functional groups, although our results also suggest that many organisms within these groups can compete for either form of labile C, which may be advantageous in a relatively C-limited environment such as mineral soil. In contrast to the phylogenetic clustering observed among labile C users, chemically recalcitrant C users – primarily cellulose users – were less phylogenetically related. Since relatively few bacterial taxa responded positively to chemically recalcitrant C, it appears that less functional redundancy exists in the turnover of these C pools. On the other hand, cellulose users were relatively phylogenetically diverse (eight phyla), which may broaden the range of environmental conditions under which this metabolism may operate. Many of the taxa responding positively to cellulose have previously been shown to be capable of cellulose hydrolysis (e.g., bacteria from the families Clostridiaceae and Lachnospiraceae (Schwarz, 2001 ), Sphingomonas spp. (Kurakake et al., 2007 ), and Spirochetes (Warnecke et al., 2007 ), while Acetobacter aceti (Moonmangmee et al., 2002 ) is typically considered a cellulose producer rather than a consumer. In contrast, other cellulose-stimulated taxa from our study, such as Desulfobacterium sp., Syntrophobacteraceae, Geobacteraceae, Coriobacteriaceae, and Anaerolineae have not been previously implicated in cellulose hydrolysis directly. Only six taxa were stimulated by lignin addition but no other substrate, these included two from the order Desulfovibrionales (δ-Proteobacteria), two from Sphingomonadalaes (α-Proteobacteria) and a Xanthomonadales (γ-Proteobacteria). Lignin hydrolysis has been documented under sulfate–reducing conditions (Dittmar and Lara, 2001 ) and Desulfovibrio desulfuricans has been shown previously to oxidize lignin under anaerobic conditions, a process that impacts both the polyphenolic backbone and functional side groups on the compound (Ziomek and Williams, 1989 ). Sphingomonas species have been reported to grow on several dimeric model compounds of lignin as a C and energy source using O demethylation systems (Sonoki et al., 2000 ) and Xanthomonas species have previously been demonstrated to use lignin as a C source for growth (Kern and Kirk, 1987 ; Kirk and Farrell, 1987 ). Only a single taxon was stimulated by tannin–protein alone; this probe set represented an unclassified γ-Proteobacterium. Almost 140 taxa responded to both labile and chemically recalcitrant C particularly from within the Burkholderiales families Alcaligenaceae (including Alcaligenes spp.), Comamonadaceae (including Acidovorax and Variovorax spp.), and Burkholderiaceae (mostly Burkholderia spp.; Table S1 in Supplementary Material). These versatile taxa responded mostly to sucrose, lignin, and tannin–protein and this agrees with previous studies that demonstrated either an ability to metabolize lignin/lignin monomers (Krishna and Sunil, 1993 ; Nigel et al., 1995 ; Kato et al., 1998 ; Mitsui et al., 2003 ) or presence of lignin peroxidase gene homologs (in the case of Acidovorax avenae ). Many Rhodocyclales (including Azoarcus and Thauera spp.) and Pseudomonadales (mostly Pseudomonas spp.) were also stimulated by multiple forms of C. Bacterial taxa such as Burkholderia and Pseudomonas species are known to be metabolically versatile (Yoder-Himes et al., 2009 ), a trait probably related to a capacity for genome re-arrangement (Lin et al., 2008 ; Silby et al., 2009 ) and maintenance of accessory genomes (Wolfgang et al., 2003 ; Mahenthiralingam and Drevenik, 2007 ; Mathee et al., 2008 ; Sim et al., 2008 ). The ability of such organisms to catabolize labile and chemically recalcitrant C may make them efficient competitors in a frequently C-limited environment. They may also serve as contributors to rhizosphere priming, in which plant roots, through exudation, stimulate the mineralization of soil organic matter (Fu and Cheng, 2002 ; Bader and Cheng, 2007 ). Changes in the abundance of taxa were relative within a community, so increases in relative abundance of one taxon were matched by decreases in relative abundance of others. Although a change in relative abundance does not necessarily imply a change in absolute number, it represents a shift in the rank order of an organism within a community. This shift could lead to a change in the ability of that organism to compete for resources and influence ecosystem processes. Specifically, we found a consistent decrease in relative abundance of more than 16 families of α-Proteobacteria in response to glycine (Figure 1 ; Table S1 in Supplementary Material). Similarly, DeAngelis et al. ( 2009 ) found that α-Proteobacteria were significantly altered by root movement through the soil. Moreover, many taxa within this sub-phylum decrease in relative abundance at the root tips, where exudation peaks (Egeraat, 1975 ; Personeni et al., 2007 ). Conversely, these bacteria are enriched near root hairs and mature roots compared to bulk soil populations. Glycine has been shown to have a high rate of efflux from roots of multiple plant species (Lesuffleur et al., 2007 ) which may explain lower relative abundances of α-Proteobacteria at the root tip. The mechanism for this observation is unclear. Glycine may inhibit these bacteria directly or through competitive exclusion by glycine users (e.g., the Enterobacteriales). Alternatively, it may simply be that the relative decline in α-Proteobacteria is not a product of an absolute decline. Future work is required to discern whether C substrate additions to soil provoke absolute declines in the abundance of specific taxa and, if so, the mechanisms underlying these declines. The quality and quantity of C substrates is expected to be one of the primary drivers of microbial community composition in soils, at least at the phylum level (Fierer et al., 2007a ). For example, Acidobacteria have been reported to show the highest relative abundance in soils where C mineralization rates are low and so classified as oligotrophs (Fierer et al., 2007a ), while β-Proteobacteria and Bacteriodetes are more abundant in soils with high C mineralization rates, and therefore classified as copiotrophs. Consistent with these global-scale patterns, ß-Proteobacteria increased in abundance following sucrose additions in our study. On the one hand, our results confirm that increases in the availability of specific substrates can stimulate the growth of the taxa that can best compete for those resources, which may quickly lead to changes in microbial community composition. On the other hand, the addition of substrates that are resistant to degradation (e.g., lignin and cellulose) did not change the overall composition of the active microbial community, although a small number of specialist taxa did show a growth response. Even though the abundance of these specialist taxa remained rare, they likely still play an important ecological role in these soils. Thus, we suggest that the function of microbial communities cannot be revealed by broad characterizations of microbial community structure, but rather must also consider the functional contributions of the rare biosphere. Here we demonstrated that by combining the BrdU labeling with a high-resolution microbial community analytical tool (16S rRNA PhyloChip), we could achieve a deep and broad coverage of soil bacterial diversity and its response to C substrates. Overall, 2,233 taxa from 43 phyla were detected following BrdU incorporation and these phyla include the predominant soil lineages (Janssen, 2006 ; Hawkes et al., 2007 ; Lauber et al., 2009 ). Rare phyla (Urich et al., 2008 ) such as Chlorobi, Dictoglomi, SPAM, TM6, and Termite group 1 were also detected (Figure 1 ; Table S1 in Supplementary Material). Although a previous study has suggested that BrdU incorporation may not be as efficient in Gram-positive bacteria (Urbach et al., 1999 ). As our approach compares the response of individual taxa relative to a control, BrdU incorporation by Gram-positive bacteria, even if it is inefficient, should be constant per taxon. Our data suggests this does not preclude the use of BrdU as an effective tool to monitor changes in bacterial replication. The combination of BrdU incorporation and sensitive methods of community analysis such as high-density microarrays provides a powerful tool to investigate the response of soil microbes to changing resource availability. This technique could also have broad application for determining the effects of environmental perturbations, such as altered precipitation patterns and elevated temperature or CO 2 . Indeed, almost 50% of the actively replicating bacterial taxa in the soil samples we investigated were significantly altered by C substrate addition, with labile C inducing the greatest effect on community structure. Our findings provide insight into the factors responsible for maintaining the high diversity of bacteria observed in soils and represent a platform for future analysis of the mechanisms underlying environmental-driven alterations in soil bacterial communities, and the potential implications for biogeochemical cycling."
} | 5,216 |
24222925 | null | s2 | 9,424 | {
"abstract": "Synthetic biology provides numerous great opportunities for chemical engineers in the development of new processes for large-scale production of biofuels, value-added chemicals, and protein therapeutics. However, challenges across all scales abound. In particular, the modularization and standardization of the components in a biological system, so-called biological parts, remain the biggest obstacle in synthetic biology. In this perspective, we will discuss the main challenges and opportunities in the rapidly growing synthetic biology field and the important roles that chemical engineers can play in its advancement."
} | 155 |
39757539 | PMC11744927 | pmc | 9,425 | {
"abstract": "Cell-free systems are powerful tools in synthetic biology\nwith\nversatile and wide-ranging applications. However, a significant bottleneck\nfor these systems, particularly the PURE cell-free system, is their\nlimited reaction lifespan and yield. Dialysis offers a promising approach\nto prolong reaction lifetimes and increase yields, yet most custom\ndialysis systems require access to sophisticated equipment like 3D\nprinters or microfabrication tools. In this study, we utilized an\neasy-to-assemble, medium-scale dialysis system for cell-free reactions\nusing commercially available components. By employing dialysis with\nperiodic exchange of the feeding solution, we achieved a protein yield\nof 1.16 mg/mL GFP in the PURE system and extended protein synthesis\nfor at least 12.5 consecutive days, demonstrating the system’s\nexcellent stability.",
"introduction": "Introduction Cell-free systems are an ideal chassis\nfor engineering biomolecular\nsystems due to their versatile, open, and well-defined nature. 1 − 5 There are two main types of cell-free systems: lysate-based systems,\nwhere the cytoplasm is directly extracted from cells, and the fully\nrecombinant PURE 6 and OnePot PURE system. 7 , 8 Current drawbacks of cell-free systems compared to cellular protein\nexpression are a limited reaction time due to a lack of self-regeneration\nand cellular homeostasis, 2 and a limited\nprotein production capacity. Therefore, there is a strong interest\nin prolonging reaction times to enhance protein yield in cell-free\nsystems. There are generally two approaches to improve protein yield,\none is to optimize the composition of the system, and the other is\nto extend the reaction time by supplying additional energy components\nand low molecular weight building blocks. While it is generally\nthe case that lysate systems have higher\nprotein production capacities than PURE, cytoplasmic extracts render\nlysate systems ill-defined resulting in high batch-to-batch variability. 1 , 9 , 10 In PURE, all components required\nfor transcription-translation are produced separately, rendering the\nsystem well-defined. This is a considerable advantage over lysate\nsystems for a variety of applications including synthetic cell - or\ntherapeutic applications. To our knowledge, the highest protein\nyield achieved to date using\ncell-free systems is 8 mg/mL of protein produced using semicontinuous\nexpression with an optimized lysate system encapsulated in liposomes. 11 Using this lysate formulation, the authors not\nonly improved the yield but also extended protein synthesis to 20\nh. The highest protein yield achieved with PURE was reported 10 years\nago at 3.8 mg/mL of GFP using a dialysis system. To achieve this yield\nthe authors significantly altered the composition of the PURE system\nby increasing the concentration of protein and ribosomal components. 12 Other approaches to prolong reaction times\nin both lysate 13 and PURE systems 14 , 15 are based\non immobilization or encapsulation strategies. Using these approaches,\nprotein expression was achieved for up to 16 days in PURE, 15 and up to 28 days in lysate. 13 These results demonstrated that cell-free systems can sustain\nprotein synthesis for several days in confined and encapsulated systems.\nHowever, the hydrogels are labor-intensive to produce and the obtained\nyield of 200 μg/mL 14 is fairly low.\nWe previously implemented semipermeable hydrogel membranes in a microfluidic\nchemostat. Using a commercially available PURE system, we extended\nprotein synthesis at a constant synthesis rate from two to at least\n30 h in this microscale dialysis system, and increased overall protein\nyield by 7-fold. 16 The aforementioned\nexamples require specialized equipment to fabricate\nmicrofluidic devices (nL scale) 13 − 16 or microscale dialyzer plates (10–50 μL). 12 , 17 , 18 This limits access to long-lived,\nhigh-yield dialysis based cell-free expression systems. For larger\nscale reactions of around 1 mL, commercially available dialysis devices\nexist, which often consist of dialysis cups inserted in tubes, 19 and thus do not allow monitoring reaction kinetics\nusing standard fluorescent plate readers. Even more problematic are\nthe large reaction volumes, which make these reactions very costly.\nCommercially available or custom fabricated 20 dialysis plates exist. However, these are either too tall to fit\ninto standard plate reader instruments, or they do not provide physical\naccess for imaging the reaction. 18 Here we created a simple DIY dialysis system for mesoscale (100\nμL) cell-free expression that utilizes commercially available\ncomponents and can be assembled and used with standard equipment.\nThe main advantages are the open access of the reaction chambers during\nincubation, allowing feeding solution replenishment, and the possibility\nfor real-time fluorescence monitoring using standard plate readers.\nOur dialysis system enabled sustained protein synthesis for 4 days\nusing PURE. By periodically replacing the feeding solution, protein\nexpression was extended to 12.5 days resulting in a protein yield\nof 1.15 mg/mL. To our knowledge, this represents the longest expression\nfor PURE reported in nonencapsulated systems. Our results highlight\nthe excellent stability of the PURE system and indicate a long protein\nand ribosome lifetime beyond what is currently harnessed in batch\nreactions and simple dialysis reactions without feeding solution replenishment.\nWe anticipate that this system could be employed in mesoscale protein\nproduction in which protein yield is critical. Potential advanced\napplications in addition to protein production for research purposes\ncould include the decentralized production of therapeutics 21 as well as the possibility to develop continuous,\nlong-term environmental monitoring, 22 , 23 or diagnostic\nsystems. 24",
"discussion": "Discussion In this work, we introduce a simple system\nfor mesoscale cell-free\nprotein expression augmented with dialysis. Using this dialysis system,\nwe extended active protein synthesis in PURExpress from a few hours 6 − 8 to around four days without exchanging the feeding solution in the\nfeeding compartment. Exchanging the feeding solution every three to\nfour days further extended active protein synthesis to 12.5 days,\nand an overall protein yield of 1 mg/mL. This presents an increase\nin total protein yield of at least five fold compared to concentrations\nof around 150 μg/mL without dialysis. 7 It needs to be mentioned that after 14 days of incubation, precipitate\naccumulation was observed on the dialysis membranes, although we could\nnot determine at which point precipitate formation started. These\nprecipitates might impede exchange of small molecules across the dialysis\nmembranes, hindering the continued supply of small molecules and the\ndilution of inhibitory molecules inside the PURE reaction, and could\nimpact fluorescence imaging. It is thus not clear whether cessation\nof protein synthesis after 12.5 days occurred because of PURE component\ndegradation, or due to obstructed dialysis. Using the same DIY dialysis\nsystem did not extend protein synthesis of a lysate-based system and\nthe overall protein yield was substantially lower. We reason that\ncessation of protein synthesis could be due to degradation of lysate\ncomponents. 10 , 19 Recent findings by Ouyang and\nco-workers demonstrated active protein synthesis in lysate for 28\ndays using hydrogel beads. 13 Encapsulation\nthus seems to prevent those degradation processes and seems to be\nrequired for prolonged protein synthesis in lysate systems. Interestingly,\nPURE sustains a stable synthesis rate without encapsulation for 12.5\ndays, which is comparable to the previously published value of 11–16\ndays using hydrogel encapsulation. 14 , 15 This indicates\nthat the PURE formulation is sufficiently free of proteases, which\ncould negatively impact long-term protein synthesis. Protein expression\nusing our dialysis system resulted in an increase in protein yield\nof about five fold compared to hydrogel based expression, 14 , 15 rendering the open dialysis system more suitable for applications\nwhere high protein concentrations are beneficial, in addition to being\nsimpler to use. Kazuta and co-workers, have shown that commercial\nPURE formulations\nare not optimized for high yield protein expression. 12 It will be interesting to see, what yields can be achieved\nwhen combining optimized PURE compositions with simple mesoscale dialysis\nsystems and periodic exchange of solutions. One avenue toward further\nincreasing protein yield may be by reducing protein aggregation, for\ninstance through the addition of chaperones. 27 An interesting phenomena is the decrease in synthesis rate approximately\nafter 17 h, which we have previously reported using a different dialysis\nsystem with continuous exchange of the feeding solution. 16 Further investigating this behavior and determining\nwhat limits protein synthesis rate during this phase might provide\ninsights for further increasing protein yield in this system."
} | 2,252 |
26382428 | null | s2 | 9,426 | {
"abstract": "Free-living biofilms have been subject to considerable attention, and basic physical principles for them are generally accepted. Many host-biofilm systems, however, consist of heterogeneous mixtures of aggregates of microbes intermixed with host material and are much less studied. Here we analyze a key property, namely reactive depletion, in such systems and argue that two regimes are possible: (1) a homogenizable mixture of biofilm and host that in important ways acts effectively like a homogeneous macrobiofilm and (2) a distribution of separated microbiofilms within the host with independent local microenvironments."
} | 156 |
37567879 | PMC10421960 | pmc | 9,427 | {
"abstract": "The lignocellulosic biorefinery industry can be an important contributor to achieving global carbon net zero goals. However, low valorization of the waste lignin severely limits the sustainability of biorefineries. Using a hydrothermal reaction, we have converted sulfuric acid lignin (SAL) into a water-soluble hydrothermal SAL (HSAL). Here, we show the improvement of HSAL on plant nutrient bioavailability and growth through its metal chelating capacity. We characterize HSAL’s high ratio of phenolic hydroxyl groups to methoxy groups and its capacity to chelate metal ions. Application of HSAL significantly promotes root length and plant growth of both monocot and dicot plant species due to improving nutrient bioavailability. The HSAL-mediated increase in iron bioavailability is comparable to the well-known metal chelator ethylenediaminetetraacetic acid. Therefore, HSAL promises to be a sustainable nutrient chelator to provide an attractive avenue for sustainable utilization of the waste lignin from the biorefinery industry.",
"introduction": "Introduction The biomass refinery sector represents an important component of a sustainable bioeconomy and has developed rapidly 1 . Lignocellulosic biomass is considered an ideal biomass for refining raw material for biofuels and other products, as the annual yield of about 200 billion tons doesn’t pose competition for human food or animal feed 2 . Lignin accounts for 15–40% of the total carbon that is contained in lignocellulose biomass 3 . Lignin also constitutes the largest source of natural aromatic polymers and harbors great potential as a starting material for many biobased products 4 . However, due to its heterogeneous chemical structure with complex and variable linkages, lignin is usually regarded as an unfavorable interference factor and discharged as a waste product from the biorefining system 5 . Moreover, most of the lignin is not isolated but is rather burned on-site, which yields the most significant carbon emission from lignocellulosic biomass refining 6 . To overcome this inefficiency in the biomass refining industry, a variety of technologies, including pyrolysis, base-catalyzed or acid-catalyzed hydrogenolysis, and oxidation have been developed for lignin valorization. The current lignin valorization products include low-cost carbon fibers, plant-derived plastics, fungible fuels, and commodity chemicals 6 . However, these lignin-derived materials only account for about 2% of the total industrial lignin (50 million tons), and hardly will be able to deal with the rapidly increasing volume of industrial lignin 7 . Without a sustainable route for utilization of this industrial lignin, the biomass refining industry will remain a considerable source of CO 2 emissions and waste while missing out on valorizing a substantial amount of lignin 8 . Hidden hunger or micronutrient malnutrition affects about one third of the world’s population. This is mainly a result of insufficient micronutrients such as iron, calcium, and zinc in the calorie-rich staple crops that these people primarily consume 9 . A pivotal approach to reduce hidden hunger is to increase micronutrients in these staple crops through agricultural technologies or biofortification 10 . Iron deficiency represents one of the most causes of hidden hunger 11 . This is due to the low bioavailability of iron in alkaline soils, which account for 25–40% of surface arable land, as low iron bioavailability in soils not only severely reduces crop yield but also limits the potential increase of iron accumulation in food crops 12 . Micronutrient deficiency in food crops is becoming more severe because of excessive input of macronutrients such as nitrogen and phosphate and rising atmospheric CO 2 levels 13 . To counteract this, chemical compounds such as ethylenediaminetetraacetic acid (EDTA) can be used as fertilizer additives to effectively improve metal ion bioavailability and elevate metal nutrient accumulation in food crops 14 . However, these fertilizer additives are costly and can cause significant environmental damage as they are non-biodegradable and thereby result in heavy metal pollution 15 . Lignin has several active functional groups, including aliphatic hydroxyl, carbonyl, and phenolic hydroxyl groups, as well as an unshared electron pair on the oxygen atom, all of which are implicated in metal ion chelation. Natural lignin-derived compounds are the largest supply source of the humic substances 16 . Humic substances in soils are natural chelates that increase metal nutrient bioavailability and contribute to avoiding metal nutrient deficiency phenotypes of plants 17 . Lignosulfonate has also been used to synthesize lignosulfonate-iron 18 . Taken together, this indicates that lignin-derived materials have the potential to be used as metal chelators and improve nutrient bioavailability. However, addition of industrial lignin to fertilizer did not draw much attention in the field of lignin valorization 19 . Sulfuric acid hydrolysis and enzymatic hydrolysis are two major strategies to produce monosaccharides in commercial biorefinery 20 . Sulfuric acid lignin (SAL, generated from sulfuric acid hydrolysis) and enzymatic hydrolysis lignin (generated from enzyme-mediated hydrolysis), are the major lignin byproducts from biorefinery 21 . Both types of lignin show very low solubility in both water and organic solvents due to their high molecular weights and highly condensed structures 22 (this is stronger in SAL due to the repolymerization and condensation reactions). This limits the valorization of the waste lignin and restricts the sustainable development of lignocellulosic biorefinery 23 , 24 . Therefore, SAL represents an acid-insoluble lignin residual portion obtained from polysaccharide conversion of lignocellulosic biomass by conducting acidolysis using concentrated sulfuric acid 25 . In a previous study, we converted high purity SAL that prepared by the Klason method to simulate industrial SAL, into water-soluble lignin fragments called hydrothermal sulfuric acid lignin (HSAL) by using an alkaline hydrothermal reaction 26 . Here, we showed that this hydrothermal reaction not only depolymerized SAL, but also strongly reduced methoxy groups and increased the portion of phenolic hydroxyl groups of lignin, conferring significant metal ion chelating capacity to HASL. We found that the addition of HSAL to low nutrient growth media and soils could significantly promote the growth of both monocot and dicot plant species including rice, corn, and Arabidopsis thaliana . Combining transcriptomics, genetics, and physiological approaches, we found that the promotion of HSAL on the root growth is primarily driven by enhancing metal nutrient bioavailability. The HSAL-mediated increase of iron bioavailability is comparable to the well-known but not-biodegradable metal chelator EDTA. Therefore, HSAL can serve as a promising sustainable metal chelator to replace synthetic chelating agents, and promises not only to promote the profitability and sustainability of biorefineries but also to sequester more carbon into the underground in future.",
"discussion": "Discussion The lignin-derived material HSAL serves as a sustainable iron chelator Natural lignin is a complex phenolic organic macromolecule consisting of phenyl propane units mainly linked by carbon-oxygen-carbon bonds and carbon-carbon bonds, which require high energy to break 43 . During the process of biorefinery, lignin can be further condensed by forming new carbon-carbon bonds 44 . SAL represents an important type of industrial lignin produced in biorefineries, which is one of the most condensed lignins 22 . Using a simple hydrothermal alkaline reaction, we sheared the carbon-carbon bonds and carbon-oxygen-carbon bonds of the condensed lignin and converted SAL into the water-soluble HSAL 22 . In this study, we found a strong reduction of methoxy groups and an increment of phenolic hydroxyl groups in HSAL and characterized its metal chelating properties. Importantly, we demonstrated that HSAL acts as a sustainable nutrient chelator to promote plant metal nutrient bioavailability and growth. Although it has long been known that alkaline treatment (at different levels of alkalinity, temperatures, and pressure conditions) can dissolve lignin 44 , no previous research has exploited this type of dissolved lignin from acid-alkaline conditions for plant growth promotion. HSAL can significantly promote root growth and facilitate substantially increased root and shoot biomass in both monocot and dicots plants, by improving bioavailability of iron and also other metal nutrients. HSAL improves iron bioavailability equivalent to the well-known metal chelator EDTA. Both of these chelators require FRO2 ferric reductase activity and the IRT1 transporter to facilitate the reduction of ferric iron and mediate the entry of ferrous iron into plant cells. However, due to their non-bio-degradable nature, synthetic iron chelators including EDTA-Na 2 , and Ethydiaminedhephen Acetic-Na (EDDHA-Na) will accumulate in the soil and are associated with a series of secondary risks such as heavy metal overload in water and crops 45 – 47 . In contrast, HSAL will likely be degraded similarly to the structurally related humic substances in soils 48 . Numerous studies have also shown plant growth promotion of other industrial lignin-derived materials such as lignosulfonates that is produced as a byproduct of the manufacturing of paper pulp through the sulfite process and lignin-based nanoparticles, although the mechanisms underlying this are not well studied 49 , 50 . Therefore, HSAL represents a novel metal chelator that can be produced at a lower cost and in a sustainable manner as it prevents greenhouse gas emissions from burning waste lignin. It is therefore a promising compound for replacing synthetic chelating agents in future. HSAL enhances plant nutrient bioavailability through its metal chelating capacity As shown in the model of HSAL function for improving plant growth in Fig. 6 , we propose two major steps for HSAL to increase iron bioavailability through metal chelating capacity. Firstly, HSAL could chelate ferric iron in the medium to improve iron mobility, which increases iron diffusion to the root apoplastic space and thus improves iron bioavailability. Secondly, HSAL could chelate apoplastic ferric iron to avoid iron precipitating in cell walls and thus improve iron bioavailability. The latter mechanism is supported by the result that HSAL-dependent iron entry into plant cells requires FRO2 ferric reductase activity and the ferrous IRT1transporter in Strategy I nongraminaceous plant Arabidopsis . In Strategy II plants like rice, roots take up iron in the form of phytosiderophore chelated ferric iron complexes. However, we do not think HSAL chelated ferric iron directly enters into plant cells, because the molecular weight of HSAL is higher than 3500 (we had collected HSAL using a cellulose tube with a 3500 molecular weight cutoff), and natural lignin-derived substances with a high molecular size fraction (Mw > 3500) has been suggested to be not directly absorbed by roots 51 . Alternatively, ferric iron might be released from HSAL chelated complexes, and transported into root cells in the form of phytosiderophore chelated complexes. Fig. 6 Schematic diagram for HSAL synthesis, structure and its capacity for enhancing iron bioavailability to increase root length and plant biomass. Sulfuric acid lignin (SAL)is converted into a water-soluble lignin-based material (HSAL) through a hydrothermal reaction. This reaction not only shears the bonds of the monomers to depolymerize the lignin, but also causes the decrease of methoxy groups and increase of phenolic hydroxyl groups. This changed structure makes HSAL to act as a sustainable ferric iron chelator promoting plant growth and root length by chelating ferric iron to enhance iron bioavailability in the growth medium and apoplastic space in both rice and Arabidopsis . In the Strategy I plant Arabidopsis , HSAL chelated ferric iron is reduced by the FRO2 ferric reductase into ferrous iron and is then transported into the plant cells through the IRT1transporter. In the Strategy II plant rice, ferric iron might be released from HSAL chelated complexes, and transport into root cells through YSL transporters in the form of phytosiderophore chelated complexes. Application of HSAL also rescued the growth defect of Arabidopsis thaliana caused by the deficiency of different nutrients, including Ca, Mg, Zn, and Cu (Supplementary Fig. 8 ), and also increased the total amounts of these metal nutrients especially Ca in plant tissues (Supplementary Fig. 9 ). These results therefore indicate that the function of HSAL is not specific to iron, which is consistent with the metal chelating capacity of HSAL. We think HSAL most likely improves the mobility of these ions in the growth medium to increase metal nutrient diffusion to the root surface and/or to avoid iron precipitating in cell walls through its chelating capacity, which leads to increased bioavailability of these metal nutrients for plants. Economic assessment of HSAL Firstly, the conditions and cost for HSAL production are relatively simple and low. HSAL is a medium sized lignin material (around 7.5KD) that is converted from the SAL prepared in the laboratory with an alkaline (NaOH solution) hydrothermal reaction at 280 °C for 2 h. If the waste lignin SAL produced in the biomass refining industry is used for HSAL production, it may increase the cost as additional procedures such as purification and isolation of the original industrial wastes are required, but it might reduce the amount of subsequently NaOH solution due to additional acid-base neutralization consumption. The cost of HSAL production was calculated at around USD 329–430 per ton based on the laboratory conversion, and can be further reduced to USD 139–213 per ton by the large-scale industrial production (see methods section for details). This price is far lower than USD 3500–350,000 per ton for synthetic metal chelating agents including EDTA, EDDHA, and DTPA 52 . The cost of HSAL production is also much less than USD 495–850 per ton for lignosulfonate 53 . The production process and cost for lignin-based nanoparticles are more complicated and higher 54 . Secondly, there is a potentially very high demand of HSAL production to increase metal nutrients and growth for major staple crops. For example, one-third (around 0.52 billion hectares) of global arable land is iron-deficient soil 55 , which requires a large amount of iron chelator fertilizer additives to improve the yield and quality of crops 46 . Potentially, up to 17.9 million tons of HSAL could be applied per year to this iron-deficient arable land at a concentration of 0.05% 55 . Based on the HSAL conversion rate of 46.7% (Fig. 1 ), it would require 38.2 million tons of lignin, which would consume 76.6% of the total lignin (50 million tons) of the industrial waste discharged by lignocellulosic biorefinery industry in 2020 1 . Thirdly, application of HSAL not only reduces carbon emissions from biorefinery factories but also promises to increase soil carbon storage. If most industrial lignin would be converted into HSAL and applied to iron-deficient soils, it would reduce 116.8 million tons of CO 2 emissions by avoiding burning of the source material 56 . Moreover, the increase of root growth of plants could enhance carbon sequestration in soils 57 – 59 . However, proper approaches to improve depth and biomass of the crop root systems have not been developed yet. The beneficial effects of HSAL might provide a promising way to contribute to achieving this goal."
} | 3,941 |
33922453 | PMC8122800 | pmc | 9,428 | {
"abstract": "Triboelectric nanogenerators (TENGs) have excellent properties in harvesting tiny environmental energy and self-powered sensor systems with extensive application prospects. Here, we report a high sensitivity self-powered wind speed sensor based on triboelectric nanogenerators (TENGs). The sensor consists of the upper and lower two identical TENGs. The output electrical signal of each TENG can be used to detect wind speed so that we can make sure that the measurement is correct by two TENGs. We study the influence of different geometrical parameters on its sensitivity and then select a set of parameters with a relatively good output electrical signal. The sensitivity of the wind speed sensor with this set of parameters is 1.79 μA/(m/s) under a wind speed range from 15 m/s to 25 m/s. The sensor can light 50 LEDs at the wind speed of 15 m/s. This work not only advances the development of self-powered wind sensor systems but also promotes the application of wind speed sensing.",
"conclusion": "4. Conclusions In summary, we propose a high sensitivity self-powered wind speed sensor based on triboelectric nanogenerators. The sensor consists of the upper and lower two identical TENGs, each TENG can detect the wind speed so that we can make sure that the measurement is correct by two measurements. We study the influence of geometric sizes on the rectified short-circuit current of the sensor. We determine the sensor geometrical parameters as follows: the PTFE film’s distance ~12 mm, length ~80 mm, the topline of the trapezoid ~20 mm, and the ratio of the topline and baseline of the trapezoid ~1:2. The output current of the sensor shows a good linear change with wind speed under the wind speed range from 15 m/s to 25 m/s, which achieves a sensitivity of 1.79 μA/(m/s). Its maximum output power can be reached 1.2 mW at the wind speed of 25 m/s. Furthermore, we have demonstrated the good self-powered capability of the device by lighting 50 LEDs at the wind speed of 15 m/s. This work not only promotes the development of self-powered wind sensors but also promotes the application of TENG in wind speed measurement.",
"introduction": "1. Introduction There is often a large amount of unavailable environmental energy, due to the difficult harvesting in our daily life [ 1 ]. To exploit the large amount of energy, researchers continue to explore and develop sustainable energy harvesting strategies such as solar energy, electromagnetic energy, wind energy, vibration energy, and water wave energy [ 2 , 3 , 4 , 5 ], which also can be applied to a self-powered sensor. The sensor network technology has attracted much attention [ 6 , 7 , 8 , 9 ] with the development of Internet of Things (IoT) and artificial intelligence. However, the traditional power supply for sensor systems is batteries, with disadvantages such as high cost, difficulty to maintain, service life, and environmentally unfriendliness, and so forth [ 10 , 11 , 12 , 13 ]. Therefore, self-powered systems have gradually attracted attention. Wind energy has good factors such as a wide distribution, convenient collection, and independence on weather conditions. It is an ideal sustainable energy source for self-powered sensors [ 14 , 15 , 16 , 17 , 18 ]. The traditional wind sensor mainly relies on the principle of electromagnetic induction and is measured through wind cups. However, the wind sensor based on electromagnetic induction has many disadvantages such as complex structure, safety risk, and high cost, which restricts its application on small self-powered sensors [ 19 , 20 ]. Zhonglin Wang proposed the new energy harvesting concept of triboelectric nanogenerator (TENG) in 2012, which has since attracted a lot of researchers’ attention [ 21 ]. Practical methods have attracted much attention in the field of self-power sensors. Compared with traditional battery energy, the self-powered sensors based on TENGs have the outstanding characteristics of low cost, simple preparation process, a wide selection of materials, and high energy conversion efficiency [ 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 ]. Many excellent self-powered sensors based on TENGs, such as acceleration sensors, vibration sensors, biosensors, and wind sensors have been reported in recent years [ 22 , 23 , 27 ]. In this article, we propose a self-powered wind speed sensor based on TENGs with a trapezoidal structure. The self-powered wind sensor is based on the frictional electrification and electrostatic induction coupling between two parallel polytetrafluoroethylene (PTFE) films sputtered with metal electrode layers and an Al/Kapton/Al film to achieve power generation. Each sensor contains two identical TENGs, each TENG can be used to measure wind speed to make sure of the correctness of the measurement. We study the influence of the trapezoidal structural parameters on the output performance of the wind speed sensor. Then, we select a set of parameters of the sensor, the sensitivity of the wind speed sensor is 1.79 μA/(m/s) under the wind speed range from 15 m/s to 25 m/s. This work promotes the potential application of TENGs in wind energy harvesting and related self-powered sensor systems.",
"discussion": "3. Results and Discussion 3.1. Construction of the Wind Speed Sensor Figure 1 a shows the schematic diagram of the wind speed sensor. The self-powered wind speed sensor consists of two upper and lower layers of PTFE film sputtered with Al metal electrodes and a layer of Al/Kapton/Al in the middle. To improve the electrical characteristics of the electrode layer, we sputter 20 nm Ti film on the Kapton film and the PTFE film, and then we sputter the Al film, which can make the aluminum film more difficult to fall off. The metal Al film sputtered on both sides of the Kapton film is used as a friction layer and an electrode layer simultaneously. The overall dimensions of the friction layer part of the device are a trapezoidal membrane: topline ~20 mm, baseline ~40 mm, and height ~80 mm. The distance between the top PTFE film and the bottom PTFE film is 12 mm. The topline and baseline of the acrylic shell are 5 mm longer than the film to prevent scratches between the film and the side shell when the film vibrates. Figure 1 b shows the two TENGs of the sensor. Each TENG concludes a PTFE/Al film and an Al film, both of the two TENGs can be used to measure wind speed so that we can make sure that the measurement is correct by two measurements. Figure 1 c shows the top view of the fabricated wind speed sensor, and Figure 1 d–f shows the dimension of the wind speed sensor. The trapezoid has a topline of 25 mm, a baseline of 45 mm, and a height of 80 mm. In Figure 1 d,e the trapezoidal structure including h r is the length of the topline of the Al/Kapton/Al film, which is 20 mm; h b is the length of the baseline of the Al/Kapton/Al film, which is 40 mm; H r is the length of the topline of the Al/PTFE film, which is 25 mm; H b is the length of the baseline of the Al/PTFE film, which is 45 mm. And the thickness (D PTFE ) of the sensor is 12 mm. We present more physical images in Figure S1 in the supporting information. 3.2. Operating Principle of the Wind Sensor and Simulation Figure 2 a shows the working principle of the wind speed sensor. The sensor contains two TENGs. TENG1 is composed of the top layer of PTFE film and the Al on the upper layer of the Al/Kapton/Al film. TENG2 is composed of the bottom ones. In the initial state, the Al/Kapton/Al film has no frictional contact with any PTFE film with no charge transfer between the two TENGs ( Figure 2 a-i). The Al/Kapton/Al film is in frictional contact with the PTFE film on the top layer under the action of the wind-induced vibration. Negative charges will be generated on the PTFE surface and positive charges will be induced on the surface of Al [ 35 , 36 ]. The generated charge of opposite polarity is completely balanced as shown in Figure 2 a-ii. The negative charge produced can be retained on the surface of PTFE film, due to its insulator. Al/Kapton/Al film and the top PTFE film begin to separate as the wind is applied to the sensor continuously. These triboelectric charges cannot be compensated, resulting in a potential difference between the two electrodes and driving electrons from the top electrode to the middle one ( Figure 2 a-iii). Until the Al/Kapton/Al film contacts with the bottom PTFE film, negative charges accumulate on the PTFE film of the bottom layer. Meanwhile, positive charges accumulate on the Al film to reach the equilibrium state again ( Figure 2 a-iv). When the Al/Kapton/Al film separates from the bottom PTFE film and moves upwards, the electrical signal will be generated again in the external circuit. Similarly, the electrical signal also will be generated again in the external circuit as the Al/Kapton/Al film moves from top to bottom. Accompanying the Al/Kapton/Al film moving up and down, the two TENGs inside will generate a flow of electrons back and forth, generating an AC signal in the external circuit. To verify the working principle, the motion state of the film is simplified and calculated by the COMSOL Multiphysics 5.5 software. As shown in Figure 2 b, the middle Al/Kapton/Al film is in the middle of the distance. When the positions are at 5 mm, 2 mm, −5 mm, the surface potential distribution of the upper and lower TENGs can be seen by simulation. For the upper TENG1, when the middle Al/Kapton/Al film is closer to the bottom PTFE, the greater the potential difference between the top electrode to the middle one. For the lower TENG2, when the middle Al/Kapton/Al film is approximately closer to the top PTFE film, the greater the potential difference between the bottom electrode to the middle one. Therefore, the above simulation results are consistent with the working principle described in Figure 2 a. 3.3. Output Performance of the Sensor We test the electrical output performance of the design under the wind speed range from 15 m/s to 25 m/s. Figure 3 a,c show the electrical output performance of TENG1 of the device. Figure 3 b,d shows the electrical output performance of TENG2. It can be seen from Figure 3 a,b that the output performance of TENG1 and TENG2 are roughly equal under the same external conditions which attribute to the symmetrical structure of the two TENGs. Each TENG can be used for wind speed measurement. Figure 3 c,d is the trend of the rectified short-circuit current of TENG1 and TENG2 with the wind speed. It can be seen from Figure 3 c,d that the peak average current of Wind-TENG varies with the wind speed increases sharply within the flow velocity range from 15 m/s to 25 m/s. The linear relationship between the wind speed and the current can be obtained by linear fitting, and the sensitivity of wind speed is about 1.79 μA/(m/s). The output performance of the energy harvesting device is usually related to its geometric size. Therefore, we study the influence of different geometrical parameters on its sensitivity. From Figure 4 a, we can see that the rectified short-circuit current varies with the distance between PTFE. It can be seen that with the increase of the distance between PTFE films, the rectified short-circuit current increases first and then decreases. This trend can be explained by the short-circuit transfer charge formula of the contact-mode TENG [ 37 ]: (1) Q S C = S σ x d 0 + x \nwhere “ S ” is the contact area, “ σ ” is the surface charge density, “ x ” is the distance between the friction layers, and “ d 0 ” is the thickness of the dielectric layer. It can be seen that the rectified short-circuit current is restricted by the friction contact area and the distance between the two friction layers in the TENG. When the wind speed is constant, the amplitude of the Al/Kapton/Al film is also constant. It means the contact area will decrease with the increase of the distance between the upper and lower PTFE films. Furthermore, the decrease of the contact area will make the charges decrease. However, seen from the formula above, as the distance between the PTFE films increase, the QSC will increase. Therefore, the two impacts of distance cause the variation trend of the output current. From Figure 4 b, we can see the variation trend of the wind speed sensor rectified short-circuit current with the length of the Al/Kapton/Al film. It can be seen that the rectified short-circuit current output is significantly reduced when the length is 90 mm or higher. When the film length is long, due to the relationship between the size and weight of the Al/Kapton/Al film, the fluttering motion becomes chaotic and an irregular spanwise direction bending of the flutter motion can be observed, which leads the film to a double contact behavior. This behavior will reduce the contact area and reduce its output [ 33 ]. Besides, we also discuss other geometric dimensions such as the width of the trapezoidal Al/Kapton/Al film (the length of the upper and lower bases). Since the flutter frequency of the film depends to a certain extent on the mass ratio of the material itself [ 34 ], the flutter frequency of the Al/Kapton/Al film will be affected and the output will be affected when the weight of the strip is too large. It can be seen that the rectified short-circuit current increases significantly when the width of the topline of the film is increased from 10 mm to 20 mm, however, the width of the topline of the film is increased from 20 mm to 25 mm. Although the area of the film increases, the increase of friction area act on the output current is not obvious, which is caused by the mass ratio of the film material itself [ 34 ]. To further study the influence of mass ratio on output current, we conducted an experimental analysis on the ratio of the topline length and baseline length of the trapezoidal Al/Kapton/Al film, as shown in Figure 4 d. The output is the highest when the ratio of the length of the topline and the length of the baseline of the film is 1:2. However, when the ratio of the length of the topline and the length of the baseline of the film is relatively large, the dither frequency of the film decreases due to the mass ratio of the film itself resulting in a decrease in output. We supply more information about vibration frequency in Figure S5 in the Supporting Information. We can see that with the width of Al/Kapton/Al film increase, the vibration frequency of the sensor decreases, as shown in Figure S5 . The decrease of vibration frequency will cause the current decrease. However, with the width of Al/Kapton/Al film increasing, the contact area will increase, which means more transfer charges. Therefore, the two impacts of width cause the variation trend of output current in the manuscript. This explanation also applies to the influence of the ratio of the topline and baseline length of the Al/Kapton/Al film. After the study about the influence of different geometrical parameters on its sensitivity, we determined the sensor geometrical parameters as follows: the PTFE film distance ~12 mm, length ~80 mm, the topline of the trapezoid ~20 mm, and the ratio of the topline and baseline of the trapezoid ~1:2. To calculate the maximum output power of the sensor, we studied its electrical output dependent on load resistance under the range from 10 kΩ to 1 GΩ. As shown in Figure 5 a, the output current decreases with the load resistance. Through P = I 2 R , we can obtain the maximum output power of 1.2 mW and the internal resistance of about 5 MΩ. The wind speed sensor can generate a legible current signal when the Al/Kapton/Al film float up or down. Consequently, a self-powered wind speed sensor can be constructed. The current signal is directly sent to a Labview platform for processing through a data acquisition (DAQ) module. Then, by calculating the average value of the peak current, the computed output current can be displayed on the screen. The DAQ model is shown in Figure S4 in the Supporting Information. Through previous experiments, we can see that within the flow rate range from 15 m/s to 25 m/s, the output current has a smooth linearity. Therefore, the upper and lower TENG can be used together to form a wind speed sensor. The circuit design is shown in Figure 5 b. The open-circuit output current of each TENG can be used for wind speed detection. The value of the resistance is related to the wind direction. The previous experiment showed that the relationship between wind speed and current can be obtained linearly: I = k × v + b , where k = 1.79 and b = −11.4704. “ v ” is the external wind speed, “ I ” is the output current. For completeness, we made a Labview program that convers the output current into wind speed, as Figure S6 shown. The program includes two parts. One of the parts is a peaks acquisition model which can calculate the obtained data and then obtain a computed current value. The other part is a formula calculation model, in which we input a computed current value to obtain the corresponding wind speed value. At the same time, we can see the stability of the wind speed sensor from Figure 5 c,d. Figure 5 c,d shows a durability test of the wind speed sensor at the wind speed of 25 m/s to manifest the stability and reliability of the wind speed sensor. Besides, the self-powered acceleration sensor has a capacity of lighting up 50 commercial LEDs. When we connect the TENG to the LEDs through the rectifier circuit, the wind speed used in the experiment at 15 m/s, 50 LEDs are lit, as shown in Figure 5 e. The self-powered wind speed sensor shows TENG’s broad application prospects in meteorological monitoring and environmental measurement."
} | 4,428 |
22952785 | PMC3429504 | pmc | 9,432 | {
"abstract": "Community structure and assembly are determined in part by environmental heterogeneity. While reef-building corals respond negatively to warming (i.e. bleaching events) and ocean acidification (OA), the extent of present-day natural variability in pH on shallow reefs and ecological consequences for benthic assemblages is unknown. We documented high resolution temporal patterns in temperature and pH from three reefs in the central Pacific and examined how these data relate to community development and net accretion rates of early successional benthic organisms. These reefs experienced substantial diel fluctuations in temperature (0.78°C) and pH (>0.2) similar to the magnitude of ‘warming’ and ‘acidification’ expected over the next century. Where daily pH within the benthic boundary layer failed to exceed pelagic climatological seasonal lows, net accretion was slower and fleshy, non-calcifying benthic organisms dominated space. Thus, key aspects of coral reef ecosystem structure and function are presently related to natural diurnal variability in pH.",
"introduction": "Introduction Awareness of the potential threat of ocean acidification (OA) to marine organisms has risen sharply over the past decade [1] . The ability for calcifying organisms to form skeletons will likely be reduced and many species and communities will experience net loss of CaCO 3 \n [2] , [3] , [4] when pH and saturation states (Ω aragonite or calcite) fall to predicted levels over the next 100 years [5] , [6] . Coral reefs are among the marine ecosystems most vulnerable to declining pH and Ω as the corals and crustose coralline algae (CCA), which deposit CaCO 3 and build structurally complex habitats, support extraordinary levels of biodiversity [7] , [8] . Thus not only could corals and other calcifying organisms suffer directly from OA but the cascading consequences of reef loss to the flora, fauna and human societies dependent on these systems are likely to be substantial [9] . To date, most studies examining the biological consequences of OA have focused on how reduced pH and/or increased pCO 2 affect the physiological response of single organisms in controlled mesocosms [but see 10]. In general, calcifying species respond negatively to these controlled, static treatment conditions and experience reduced survival, calcification, and growth [1] ; severity of response may be related to the polymorph of CaCO 3 precipitated [11] . However, forecasting ecosystem consequences to projected future acidification based upon hypothesized tolerance limits for particular species is risky for several reasons. First, the shallow coastal species used in each of these laboratory studies inhabit naturally variable nearshore environs. Without a clear understanding of the range of ambient variability in pH and carbonate chemistry across reefs, it is difficult to anticipate relevant biological tolerance ranges or to look for evidence of populations acclimatized and/or adapted to extreme conditions. Further, few studies examine how ecological processes (e.g. community development, species interactions, or shifts in relative abundances and species assemblages) relate to reduced pH, particularly on coral reefs. Of the few ecologically relevant OA studies that exist for reefs, all indicate that reef-builders have reduced recruitment rates in acid-addition or CO 2 enrichment experiments [CCA: 10,12,corals: 13,14]. Further, a fleshy seaweed has been shown to outcompete an adult coral under increased pCO 2 conditions [15] . Because recruitment and survival of reef-building corals and reef-cementing CCA are critical to the resilience of a reef ecosystem in the face of global change, it is imperative that we gain a better understanding of the responses and interactions among multiple taxa to OA [16] . The data that exist to date suggest that commonly reported phase-shifts from dominance by coral to macroalgae may be exacerbated by OA. But without placing the results of these studies within the context of natural environmental heterogeneity of carbonate chemistry it is difficult to predict the outcomes of these interactions and ultimately, the ability for reefs to be resilient. More informed ‘ocean warming’ experiments have incorporated natural diurnal or seasonal variability recorded in situ into treatment conditions. There are significant ecophysiological consequences of rising and variable temperatures to corals [17] and bivalves [18] not otherwise observed under constantly elevated temperatures. Unlike temperature, ecologically relevant high frequency temporal variability in carbonate chemistry and pH in situ, especially on coral reefs, has been difficult to document until recently [19] , thereby limiting our capacity to design more appropriate experiments. Most OA monitoring efforts on coral reefs have measured total alkalinity (A T ) and total dissolved inorganic carbon (C T ) of discrete water samples to constrain the suite of carbonate chemistry parameters. While discrete samples are accurate and precise, they necessarily have low temporal and spatial resolution; consequently, biogeochemical cycling studies have generally been restricted to shallow reef flats or highly impacted, low diversity reefs and sampled over short time scales [e.g. 24–48 hrs; 20,21]. Moored pCO 2 systems can reveal seasonal patterns of air-sea gas exchange, but have not historically sampled from the reef floor [22] , thus disregarding potential feedbacks from reef metabolism and calcification, so relationships between community structure and dynamics and marine chemistry are difficult to elucidate. Despite these limitations, fluctuations in pH, carbonate ion concentration, and saturation state on a high-latitude reef dominated by non-calcifiers have been described with coarse temporal sampling [23] . Peaks in productivity and calcification potentially underlie variability in reef chemistry, but little is known about cumulative effects of high frequency fluctuations in pH on community development and recruitment of early successional reef-building species. Lack of sufficient temporal and spatial resolution of ambient fluctuations in pH and carbonate chemistry on the benthos creates a critical gap for our understanding of how present day environmental heterogeneity relates to coral reef ecology. Evidence of diel, seasonal and interannual fluctuations in pH make adopting approaches currently used to define temperature anomalies associated with coral bleaching events - e.g. thermal stress anomalies [24] or weekly sea surface temperature anomalies [25] - appealing for monitoring gradual ‘acidification’ that may reduce reef accretion [26] . But given that short-term variability may be as substantial as decadal shifts on reefs, it is unclear if comparable stress anomalies exist for pH, how they should be defined, or if high frequency variability in pH is even relevant to reef accretion and community development. The potential for diel fluctuations, placed within the context of off-shore climatological chemical oceanography, to relate to community assembly and calcification rates on the benthos is considerable, but unknown. We used autonomous sensors [SeaFETs; 27] to record temperature and pH with high temporal (hourly observations; 7 months of sampling) resolution on the reef benthos (5–10 m depth) at several islands (Kingman, Palmyra and Jarvis) within the newly designated Pacific Remote Island Areas Marine National Monument (PRIMNM) in the central Pacific ( Table S1 ); these islands are uninhabited and lack potentially confounding local impacts (e.g. pollution and overfishing). Although pH and temperature are insufficient to fully constrain the CO 2 system, they provide previously unavailable insight to ambient environmental variability on remote reefs. Benthic pH values were compared with those from surrounding open-ocean seawater using the only other data available for the region [CO 2 : 28,A T : 29], (temperature, salinity, phosphate, and silicate). These climatological data, based on monthly open ocean sampling, represent seawater chemistry values far removed from potential feedbacks from the reef and allowed us to designate regional means and ranges in key parameters based on seasonal amplitude. Each SeaFET sensor was co-located with replicate Calcification/Accretion Units (CAUs) designed to quantify relative species abundances of early successional benthic organisms and net community CaCO 3 deposition rates ( Fig. S1 ) so we could determine which, if any, metrics of natural variability in benthic pH and temperature were related to community development and reef accretion rates on these remote reefs.",
"discussion": "Discussion Ambient variability in both temperature and particularly pH were substantial in the Northern Line islands and oscillated over a diurnal cycle. The observed range in daily pH on reefs encompasses maximums reported from the last century [8.104 in the early evening; 41] to minimums approaching IPCC projected global levels within the next 100 yrs [7.824; 42], values frequently used to represent different treatment levels in experimental manipulations. The daily amplitude in pH measured at Palmyra was similar to that estimated from hourly discrete samples reported there in 1997 [33] , but the mean values have dropped by ∼ 0.04 units in the past thirteen years ( Table S3 ). This rate is somewhat higher (∼2×) than predicted by incorporating a global average rise of 1.5 µatm CO 2 yr −1 , and may be due to sparse climatological coverage near Palmyra and/or seasonal sampling bias. Dynamics of pH and seawater chemistry in any coastal ecosystem are driven by co-varying processes, including biological activity, gas exchange, and physical forcing over various time scales (diurnal, seasonal, interannual). Reef metabolism directly affects the CO 2 system within hydrodynamic boundary layers [43] , [44] , [45] , or just off-shore, as stated in the ‘Coral Reef Ecosystem Feedback’ hypothesis, articulated by Bates et al. \n [23] for seasonal-scale dynamics. Thus species composition and abundance likely also contributed to the spatial variability in the magnitude of benthic diurnal oscillations in pH. However, biogeochemical dissolution and remineralization processes [46] , tidal flushing, regional upwelling [47] , and oceanographic circulation patterns [48] can dampen, enhance, or swamp biologically driven diurnal fluctuations in pH. Causality cannot be assigned to the spatial patterns in pH variability reported here due to lack of a quantitative hydrodynamic data for these islands. However, it is clear that these remote, uninhabited coral reefs experience highly dynamic fluctuations in nearshore pH that are largely below climatological means estimated from open ocean sampling ( Fig. 1 , Table S2 ). The ecological consequences of OA on coral reefs are as of yet unknown, but natural variation in benthic pH offers a unique opportunity to study scenarios of likely future ocean chemistry. In this study, the relative abundance of competitive fleshy algae and invertebrates increased over that of early successional calcifiers and reef-builders (CCA and bryozoans, respectively) on CAUs across sites that had reduced pH ( Fig. 2 ). This pattern of shifting from dominance by calcifiers to a greater abundance of fleshy species at locations experiencing reduced pH has been observed elsewhere. For instance, benthic communities acclimatized to reduced pH resulting from natural CO 2 vents host higher bioeroder and fleshy species densities than on adjacent unaffected benthos [26] , [49] . Wootton et al. [50] also found calcareous species performed poorly in a temperate tidal pool during ‘low pH years’, and changes in the calcareous nannofossil assemblage during the Paleocene-Eocene thermal maximum [the closest analog in geologic history to current OA; 51] have been attributed to shifts in competitive dominance [52] , although the exact mechanisms of how reduced pH altered community structure in either case was unclear. Our data further suggest that community development on these remote uninhabited reefs is strongly related to natural variability in pH, particularly to cumulative and integrative effects of natural diel cycling. The data presented here from tropical reefs identify daily pH maxima as an important control on calcification. Net accretion among sites was positively related to the magnitude and duration of pH above the climatological seasonal low, despite myriad other ecological (e.g. local supply, species interactions, etc.) and physical oceanographic (e.g. temperature, current magnitude and direction, wave strength, latitudinal gradients, etc.) drivers. In general, accretion rates were higher at sites that experienced a greater number of hours at high pH values each day. The strength and direction of the relationship between net accretion and naturally varying pH depended upon the polymorph of CaCO 3 precipitated, despite lack of consistent evidence for this pattern in mesocosm studies [1] . Organisms precipitating more soluble mineral forms of CaCO 3 are presumed to be less resilient to OA than those precipitating less soluble forms [high Mg calcite vs. calcite and aragonite; 11]. Because the relative content of Mg in shells/skeletons is also positively related to rising temperature [53] , these organisms may be particularly susceptible to global change effects including OA [54] . In the Northern Line Islands, where the daily ∑ pH·hrs did not consistently exceed the pH csl , the net accretion rate and percent cover of early successional organisms precipitating Mg calcite (i.e. CCA and bryozoans) was lower. A reduction in calcification/growth rates for organisms precipitating Mg calcite may have created space for the calcitic, aragonitic, and non-calcifying species to become competitively dominant. CCA, which precipitate high Mg calcite (>4%), are among the most important reef cementers in the tropics and facilitate coral recruitment. Thus, our results suggest that even small changes in pH could have profound residual and indirect impacts on reef integrity and accretion. Climatological averaging from discrete offshore sampling may mask potentially important short-term variation in carbonate chemistry and pH in coastal environments, but can provide context for nearshore temporal patterns. Here we show that benthic reef communities are exposed to a wider, and often lower, range of pH values over the diel cycle than predicted by regional seasonal climatology. These novel observations raise the question: what are the relevant metrics of pH to relate to ecological processes expected to be threatened by OA? In the remote central Pacific, the duration and magnitude of benthic pH values above the climatological seasonal low pH correlated strongly with calcification and community structure. Indeed, the more frequently used mean pH, or even the daily maxima or minima, may not be relevant to tolerance limits of organisms or for predicting the ultimate biological impacts of OA. Assigning ecologically relevant tipping points, thresholds, or anomalies for management of OA based solely on open ocean climatological data, as has been done for SST [25] , will not be useful without also understanding current relative benthic carbonate chemistry dynamics. In this study, coral reef communities on remote uninhabited islands in the central Pacific experienced high natural daily variability in pH which corresponded to key differences in net calcification and community development. However, given only six data points and variable physical oceanographic features among islands, this is an initial exploratory, hypothesis generating study, with minimal ability to identify causality. Despite these limitations, these data represent some of the longest and highest resolution field-based observations of natural variability in pH and the associated biological consequences on coral reefs to date. Carbonate chemistry and pH on coral reefs can be highly dynamic and vary significantly within and among sites and islands, which should be considered in future OA mesocosm studies. Finally, our data suggest that as coral reef communities begin experiencing a greater daily duration of low pH values as a result of OA, the abundance of calcified organisms and the structural services they provide will likely be compromised in the foreseeable future."
} | 4,114 |
28376100 | PMC5380328 | pmc | 9,433 | {
"abstract": "In this work, the role of the pine transcriptional regulator Dof 5 in carbon and nitrogen metabolism has been examined in poplar trees. The overexpression of the gene and potential effects on growth and biomass production were compared between trees growing in a growth chamber under controlled conditions and trees growing in a field trial during two growth seasons. Ten-week-old transgenic poplars exhibited higher growth than untransformed controls and exhibited enhanced capacity for inorganic nitrogen uptake in the form of nitrate. Furthermore, the transgenic trees accumulated significantly more carbohydrates such as glucose, fructose, sucrose and starch. Lignin content increased in the basal part of the stem likely due to the thicker stem of the transformed plants. The enhanced levels of lignin were correlated with higher expression of the PAL1 and GS1 . 3 genes, which encode key enzymes involved in the phenylalanine deamination required for lignin biosynthesis. However, the results in the field trial experiment diverged from those observed in the chamber system. The lines overexpressing PpDof5 showed attenuated growth during the two growing seasons and no modification of carbon or nitrogen metabolism. These results were not associated with a decrease in the expression of the transgene, but they can be ascribed to the nitrogen available in the field soil compared to that available for growth under controlled conditions. This work highlights the paramount importance of testing transgenic lines in field trials.",
"introduction": "Introduction The production of biomaterials and bioenergy is a process that has been used since ancient times by man in contrast with the main use of crop plants as a source of food. The growing demand for petroleum products, the limited reserves of fossil fuels and the global warming attributed to the use of this energy source indicate the urgent need to find alternative sources of renewable energy [ 1 ]. Biomass used for energy is mainly derived from the processing of agricultural and forest products, waste from holdings, the remains of forestry, and crop residues as well as from crops planted and exploited for the sole purpose of obtaining biomass [ 2 ]. These latter are called energy crops and include forest and agricultural crops. The fundamental advantage of such crops is the predictability of their layout and the spatial concentration of biomass, ensuring the supply of feedstocks for bioenergy. In the last 20 years, the biology of forest trees has been widely investigated, which is reflected in gradual biotechnological development aimed at cultivation on a large scale, as is the case with many plants of agronomic interest. However, the major genetic improvements that accompanied the agricultural practices have not yet occurred for trees. Although classical breeding approaches have much to offer in the field of tree improvement, applications of genomics and biotechnological methods can accelerate the process. In this sense, poplar is a fast growing tree that presents a number of logistical advantages and economic benefits over annual crops that can be used for similar purposes such as cereals. One of these benefits is its flexibility in harvest time, which reduces storage costs and losses associated with degradation of the stored crop biomass collected from annual crops. Other features that make poplar a good model for bioenergy crops are dehydration resistance, resistance to insects and other pests and the ability to produce large amounts of biomass in different soil types [ 3 ]. Furthermore, the poplar genome has been completely sequenced [ 4 ], and the availability of this information gives us a guide to the answers to many questions about growth and shape, disease resistance and quality of wood that would otherwise be much harder to address in trees studies. The productivity of plants is hardly affected by nutrient availability. In field conditions, nutrient supply and nutrient limitation are closely linked [ 5 ]. One of the possible targets to increase poplar biomass production is to improve the absorption and metabolism of nitrogenous nutrients [ 6 ]. Nitrogen availability is, very often, one of the factors limiting plant growth, and the efficient use of nitrogenous nutrients is essential for the accumulation of biomass [ 7 , 8 , 9 ]. Previous results of our research group have shown that manipulation of the structural and regulatory genes involved in nitrogen metabolism may be a valid approach to increasing biomass production in hybrid poplars ( Populus tremula x P . alba ) and to producing wood with improved pulping attributes [ 7 , 10 , 11 , 12 , 13 , 14 ]. The enzyme glutamine synthetase (GS) plays a key role in nitrogen assimilation in plants, a process closely coordinated with carbon metabolism because it requires the provision of carbon skeletons in the form of keto acids. The transcription factor Dof5 is able to regulate GS genes differentially in maritime pine. It acts as an activator of GS1b and as a repressor of GS1a [ 15 ]. Dof factors have been described as regulators of lignin production [ 16 ] and the carbon-nitrogen balance [ 13 , 17 ]. The phenylpropane skeleton required for lignin biosynthesis is provided by deamination of phenylalanine catalyzed by the enzyme phenylalanine ammonia-lyase (PAL), and in this reaction, should be re-assimilated by GS to maintain the synthesis of lignin and other phenolic compounds [ 7 ]. These studies highlight the importance of Dof factors because of their involvement in the regulation of two main routes driving growth and development in plants: carbon and nitrogen metabolism. Over the last decade, an increasing number of reports have been produced that propose genetic modifications for production improvements in plants, including poplar [ 18 ]. In addition, we can anticipate a perfect storm of studies targeting candidate genes in Populus spp in the coming years for the use of the CRISP/Cas9 technique [ 19 , 20 ]. Currently, the new frontier of the genetic engineer is ensuring that the transgene incorporated in the plant is beneficial in field conditions, where the fluctuations in the environment make the plant performance realistic [ 21 , 22 ]. Progressive testing of modified plants in natural conditions is mandatory for global crop improvement. The manipulation of transcription factors to control multiple genes encoding products of the same or different pathways can be presented as an attractive and effective strategy to control the levels of metabolites of interest from both, qualitative and quantitative points of view [ 23 ]. In this work, the effects of the pine transcriptional regulator Dof 5 on carbon and nitrogen metabolism were examined in poplar trees. The overexpression of the gene and its potential effect on growth and biomass production were compared in young trees growing under controlled and natural conditions.",
"discussion": "Discussion Growth, biomass production, trunk shape, and wood quality are important features of interest for improving trees. Current research has been focused on several aspects of metabolism that will contribute to improving these characteristics and the study of key genes and gene networks determining the required phenotypes [ 50 , 51 , 52 ]. In this context, the manipulation of a single transcription factor to influence growth and biomass production seems an attractive method to achieve this goal. Here, we report the generation of transgenic poplar trees overexpressing a pine Dof transcription factor and the plants performance under controlled and natural conditions, characterizing their molecular and physiological behavior. The aim of this work was to manipulate simultaneously nitrogen and carbon metabolism in poplar trees using a single gene. Two lines (L2 and L6) with different copy numbers ( Fig 1B ) and different levels of transgene expression were selected to compare the performance of transgenic plants growing under controlled and natural conditions. Overall, the two lines had a analogous behavior, although the observed differences with respect to the controls were always more significant in trees of the L6 line. Multiple insertions of the transgene in the poplar genome led to silencing of PpDof5 expression in comparison with a single transgene insertion. Interestingly, the basal levels of the transgene product had a more noticeable general effect on plant growth. These results suggest that high-level expression of PpDof5 could affect the activity of endogenous poplar Dof genes, tending to minimize the transgene effect A search in the poplar genome allowed the identification of 41 Dof genes ( S3 Fig ). Three genes were identified as putative ortologues of PpDof5 including: a pair of duplicated genes, PtDof4 and PtDof14 , and a single gene, PtDof19 . The level of expression of PtDof4 and PtDof19 were measured in stems and leaves of plants grown both in the growth-chamber and in the field ( S4 Fig ). The presence of the transgene affected differentially the expression of PtDof4 and PtDof19 in the transgenic lines. These results clearly indicate an effect of the transgene insertion in the expression of the endogenous poplar genes and the differential effect can be related with the different performance of the two lines. Ten-week-old PpDof5 transgenic poplars increased in height, leaf number and root biomass. However, the increases in growth were much lower than those observed in hybrid poplars overexpressing a cytosolic glutamine synthetase (GS1) [ 43 ]. Moreover, the improved growth was associated with enhanced nitrate uptake in the transgenic lines. Poplars have a family of high-affinity and low-affinity nitrate transporters encoded by a large gene family [ 53 ] that account for nitrate acquisition by the trees. The overexpression of Dof 5 could be responsible for the activation of nitrate transporters. In fact, it has been previously shown, following a functional genomics approach, that the overexpression of Dof transcription factors in cell cultures of Arabidopsis affects either positively or negatively the expression of several nitrate transporters [ 54 ]. The significantly higher levels of nitrate uptake observed in the present work suggest that activation of some of these transporters led to increased nitrogen uptake, resulting in an advantage for vegetative growth in these plants. In contrast to the higher capacity for nitrate acquisition, the young transgenic trees exhibited decreased ammonium uptake and arrested growth. In fact, the use of ammonium as the sole nitrogen source arrested the growth of both transgenics and controls compared to those supplied with nitrate as the sole nitrogen source. These findings are consistent with the preference for nitrate over ammonium that many poplar species exhibit (Castro-Rodríguez, unpublished). Ammonium uptake is mediated by ammonium transporters (AMT) that are strategically located primarily in poplar root cells. A family of 16 ammonium transporters (AMTs) has been identified in the P . trichocarpa genome sequence by in silico analysis [ 55 , 56 ]. The decrease in ammonium uptake in the transgenics could be explained by the regulation of some of these AMT genes in the plants overexpressing Dof5 as previously described [ 54 , 57 ]. Carbohydrate content was higher in 10-week-old transgenic trees as previously observed in Arabidopsis over-expressing PpDof5 [ 13 ]. Growth of plants depends on photosynthetic activity, and a larger number of leaves implies greater accumulation of carbohydrates that can be used for growing. Sucrose is the major stable product of photosynthesis transported from leaves to the growing parts of the plant [ 58 ]. The increased availability of sucrose in developing parts of the tree can therefore contribute to increased growth. Starch accumulation was also significantly higher in the L6 line, at least at the time of day when the samples were collected (4 h after starting light). Considering that carbon availability is variable during the day, the higher accumulation of starch during the day-time provides a greater amount of C to support tree growth either during the day or the night, although it has been shown that it is not starch itself but starch metabolism or signals derived from starch that can act as integrators of plant metabolism and growth [ 44 ]. The measurement of cellulose content did not reveal significant changes in the trees, only the faster growth contributes to the greater thickness of the stem cambium, which is apparently responsible for the higher content of lignin. This higher lignin content is in good agreement with the expression of the PAL1 and GS1 . 3 genes in this region of the stem. These findings suggest that the higher level of expression of these two genes could account for the increased levels of phenylalanine in the PpDof5 transgenics that are required for vascular development. Similar results have been described in other plants overexpressing GS genes [ 11 , 13 , 59 ]. Moreover, the increased levels of GS1 . 3 transcripts in transgenic poplars are in agreement with the previously observed effect of PpDof5 as a transcriptional activator of expression of the GS1b gene, an orthologous GS gene in pine [ 15 ]. The expression of the GS1b gene in pine is located within the vascular system in pine seedlings [ 59 ] and in the procambial cells of developing pine embryos prior to the differentiation of the vascular elements [ 60 ]. The function of PtGS1 . 3 associated with nitrogen recycling during lignification in poplar [ 25 ] could be similar to that of GS1b in pine. A field trial of the transgenic trees was performed during two growing seasons It represents a suitable way to check the behavior of trees overexpressing PpDof5 in the field, as growing conditions throughout a year do not always mimic the conditions in a growth chamber. A number of variables that do not affect the plants in the growth-chamber such as wind, rain, nutrient availability or biotic interactions with other organisms in the field can greatly modify trees growth. However, even though an ample number of structural and regulatory genes with potential impact on biomass production have been analyzed in transgenic trees, field-testing is lacking for most of those genes [ 51 ]. The data presented here derived from the field study are largely at odds with previous results obtained in growing chambers. Tree growth was not higher in the transgenics, and the contents of carbon compounds, such as chlorophyll, carbohydrates, cellulose and lignin, did not change when controls and transgenics were compared. In contrast, hybrid poplars over-expressing the structural GS1a gene from pine displayed considerable improvements in biomass production under both controlled and natural conditions [ 10 ]. Nevertheless, it is worth mentioning that there are several examples in which the phenotype observed in transgenic trees in growth chambers differed from that observed in field trials [ 61 , 62 ]. In our field-test it was found a meaningful difference between the study under controlled conditions and the field trial was the availability of nutrients in the soil. The analysis of nitrogen in soil indicated that the field study was carried out with a lower nitrogen content (approximately 12-fold) compared to the study carried out under controlled conditions. Therefore, the results indicate that the effect of Dof5 transgene expression seems to be relevant to growth and development only when N availability in the soil is sufficient. These data again highlight the close relationship between the metabolism of carbon and nitrogen and the role of Dof5 in the regulation of nitrogen/carbon balance. Furthermore, this study reinforces the paramount importance of field evaluation of transgenic plants, which is essential to determining their true value, especially in the case of trees that have to cope with long growing periods."
} | 4,009 |
37323121 | PMC10427402 | pmc | 9,434 | {
"abstract": "Abstract Although natural continuum structures, such as the boneless elephant trunk, provide inspiration for new versatile grippers, highly deformable, jointless, and multidimensional actuation has still not been achieved. The challenging pivotal requisites are to avoid sudden changes in stiffness, combined with the capability of providing reliable large deformations in different directions. This research addresses these two challenges by harnessing porosity at two levels: material and design. Based on the extraordinary extensibility and compressibility of volumetrically tessellated structures with microporous elastic polymer walls, monolithic soft actuators are fabricated by 3D printing unique polymerizable emulsions. The resulting monolithic pneumatic actuators are printed in a single process and are capable of bidirectional movements with just one actuation source. The proposed approach is demonstrated by two proof‐of‐concepts: a three‐fingered gripper, and the first ever soft continuum actuator that encodes biaxial motion and bidirectional bending. The results open up new design paradigms for continuum soft robots with bioinspired behavior based on reliable and robust multidimensional motions.",
"introduction": "1 Introduction Soft robotics is outperforming rigid body robotics through new approaches to implement known or new robotic tasks such as grasping, locomotion, climbing, and growing. [ \n \n 1 \n \n ] Totally new bioinspired designs are possible because of the inherent compliance and deformability of the robot bodies, [ \n \n 2 \n \n ] which much like living organisms, can reach the versatility needed to adapt to the real‐world. The boneless elephant trunk, being a natural continuum universal manipulator, is a remarkable source of inspiration. Based on its amazing agility, this organ without joints is capable of delicate and precise, yet strong, grasping and manipulation. [ \n \n 3 \n \n ] Recently it has been deciphered how the coordinated contractions of antagonist muscles in trunk enable different movements (e.g., contraction, elongation, bending, and stiffening) mainly due to the near‐incompressibility of the self‐supporting trunk tissues. [ \n \n 3a \n \n ] The intricate and unique composition of muscle fibers, fat, connective tissues, blood vessels, nerves, etc., presents a mechanical continuity that appears to disobey the well‐known kinematic principles (i.e., based on articulated skeletons), with an architecture that is naturally programmed for multidimensional motions. [ \n \n 3a \n \n ] \n The elephant trunk inspires innovative design principles, technologies, and materials, for developing new versatile manipulators with no distinction between arm and gripper. In this vision, a major unmet challenge in soft robotics is thus to develop actuated soft (i.e., boneless) structures that are highly deformable and reliable, with no sharp distinction in stiffness, in which different movements can be programmed as a result of the used materials and design of the core structure. Multidimensional actuators have been developed by compromising several approaches, [ \n \n 4 \n \n ] such as soft actuators built from different materials exhibiting independent movements (i.e., axial, bending, and torsion) via discretely distributed stiffness or Poisson's ratio. However, the interfacing among the various functional and mechanical parts is not smooth, thus failing to achieve the desired kinematic trajectories, and repeatability and reliability are limited. Moreover, although fiber reinforcement has been used for soft pneumatic artificial muscles (PAMs) given that they improve actuation stiffness, localized deformation, and robustness, [ \n \n 5 \n \n ] the fabrication is complicated since the fibers require winding (often manual) along the actuators. Other methods involving cellular materials (e.g., foam‐like) offer good design flexibility, while allowing for desired deformations and enhanced stiffness. [ \n \n 6 \n \n ] However, to the best of knowledge, so far only uniaxial movements, without programmed deformation, have been developed. In contrast, metamaterial‐based approaches enable programming mechanical properties in monolithic structures. [ \n \n 7 \n \n ] The overall density can thus be reduced, thereby obtaining compliant mechanisms. High resistance to both shear deformation and indentation can be implemented, which is essential for designing continuum structures, [ \n \n 8 \n \n ] with high energy absorption promoting energy‐efficient designs. [ \n \n 9 \n \n ] \n To date, mainly passive (non‐actuated) structures have been developed by 3D architected materials, for example, with encoded buckling by means of unit Voronoi tessellation, [ \n \n 10 \n \n ] in an adaptable soft gripper, [ \n \n 11 \n \n ] and in a fin ray structure for gentle grasping. [ \n \n 12 \n \n ] Also, in a pioneering study a chemically fabricated porous material was demonstrated in a bending pneumatic actuator. [ \n \n 13 \n \n ] However, due to the limited inflation ratio of the porous network, the internal structure fails when overinflated. A possible solution for this problem is through an architecture in the form of volumetric tessellations. They are currently manufactured using casting [ \n \n 14 \n \n ] and lithography‐assisted pre‐patterning or etching, [ \n \n 15 \n \n ] however, they result in limited 3D structural complexity and stretchability. In this work we present a new design approach for soft multidimensional actuation, where porosity is created in the material by microporosity, and by design via volumetric tessellated structures (i.e., macroporosity), by 3D printing complex stretchable foams enveloped by a soft skin. We have thus created a new generation of pneumatic elastic lattice actuators (PELAs) with programmed deformations and with smooth stiffness gradients ( Figure \n 1 \n ). Figure 1 Novel design approach for continuum multidimensional actuation by harnessing porosity at both levels of material (microporosity) and design (macroporosity). The scale bar of the SEM image is 50 µm. The process is based on new printing compositions composed of a water‐in oil emulsion, while the continuous phase results in a highly stretchable polymer after printing, when the water droplets evaporate and form a porous structure with interconnected air voids (microporosity). The 3D printing produces objects with gradually dimensioned lattice structures, with micropores integrated into the walls. Due to this structure, the kinematic movements of the printed actuators are determined by the total equivalent stiffness obtained from a combination of isotropy and anisotropy of the unit cells. The convoluted skin transforms the passive core structure in the actuator by ensuring high biaxial deformability, while avoiding structure instability. The mechanical behavior of the architected material leads to new design principles with globally or locally distributed stiffness, while the fabrication is performed by a single‐step 3D printing process using a commercial digital light processing (DLP) printer. [ \n \n 16 \n \n ] The new printing compositions that were utilized are based on emulsion, which can be printed via a photolithography‐based printing process, [ \n \n 17 \n \n ] while the continuous phase of the emulsion is made up of photopolymerizable stretchable polyurethane. [ \n \n 18 \n \n ] \n In order to demonstrate the potential of this approach, two proof‐of‐concepts are presented: soft grippers with programmed structures, capable of compliant shape‐adaptation to objects having various shapes; and the first continuum actuator (without any joints) encoding axial and bending movements within the same structure.",
"discussion": "3 Discussion The results of this work highlight that new generations of soft pneumatic actuators with no joints can be obtained by harnessing porosity in the materials (microporosity) and design (unit grid tessellation). For the materials, this is possible through 3D printing of emulsions which are precursors for stretchable foam structures. For the design, volumetric tessellation is key to producing continuum and complex architectures with smooth stiffness gradients. The elasticity of the bulk material determines the deformability of pneumatic‐driven 3D architectures. The high compliance and strength of objects resulting from the emulsion ink material (i.e., high extensibility of up to 520% and tensile strength of 1.57 MPa) are mainly due to the micropores. These micropores mean that a much higher deformation can be obtained in the bending PELA compared to the same structure without microporosity in the unit cell walls (see Supporting Information text and Figure S8 , Supporting Information). Furthermore, the axial stiffness, and compressive strength can be tuned by tailoring the dimensions of the air cells. Through the cyclic tests, we found that a tensile strain of 150% and a compressive strain of 40% guarantee high design life and safety, while avoiding material failures. In the three‐fingered gripper (Figure 4 ) both the interlocking and highly compliant interaction with the object are employed. [ \n \n 23 \n \n ] The structure of the actuators could be programmed to produce a bending motion useful to fully engage with the object, and integrate at their surface the external lattice structures that are passively compliant. We believe that this provides a proof‐of‐concept of a new soft gripper capable of a compliant interaction with objects of various shapes. In comparison to literature focused on technologies enabling programmable deformations through metamaterials, [ \n \n 4 \n , \n 6 \n , \n 7 \n , \n 13 \n , \n 24 \n \n ] as summarized in Table S3 , Supporting Information, our design strategies based on elastic lattices offer unique characteristics, leading to the development of novel pneumatic actuators capable of a high deformation ratio with lightweight. Moreover, the elastic lattice implements movements at a relatively low‐pressure range, that is, the blocking force is up to 1.13 N at 25 kPa for the bending PELA with compliant layer. These aspects are important for achieving a high power‐to‐weight ratio (corresponding force‐to‐unit mass). Indeed, the PELAs’ weights are only 15 g, and thus high force to weight ratios (324.7 and 75.3 N kg −1 for biaxial PELA and bending PELA with compliant layer, respectively) are obtained in the monolithic structures. In contrast to multimaterial‐based approaches that are usually pursued by interfacing materials with different mechanical characteristics, [ \n \n 4c \n \n ] the presented design principles do not induce an increase in weight and material failures (i.e., delamination). Also, the presented design strategies are competitive compared to origami/kirigami technologies that have been widely used to achieve high force‐to‐weight ratio. [ \n \n 24d \n \n – \n \n g \n \n ] Although a design principle based on mechanical instabilities may be hindered by interferences that limit the actuator strokes, determining the actuator's deformation ratio and stiffness is attributed to the design of elastic lattice. In other words, unless the pillars and nodes of the unit cells are fully collapsed or fail, the elastic lattice contributes to achieving the desired movements of the actuator. Overall, while only few designs using metamaterials have addressed bidirectional deformability to date, it is worth noting that the presented elastic lattices enable a high deformation ratio of 77% at linear actuation and bidirectional bending that ranges from −14.3° to 14.3° (Figure 4C ). We exploited these promising capabilities to develop the versatile soft gripper with adjustable opening distance and the multidimensional actuator. In particular, the kinematic synthesis using the elastic lattice opens up a new paradigm in designing continuum actuators capable of programmed deformations, for utilization in robotic applications. The main potential of the new approach is that new continuum soft robots can be designed based on the 3D printing of graded stiffness structures. In articulated robotic systems, to increase the opening distance between the jaws of a gripper, joints and/or linkages are added producing increased degrees of freedom. Our soft continuum architecture encoded both axial and bending movements, specifically extension, contraction, and bidirectional bending, all in one printed structure and with just one pneumatic source. The use of mechanical continuity will allow the robots to move and deform in a way that is more similar to living organisms (i.e., elephants). This makes them useful for tasks that require a high degree of adaptability and flexibility, such as exploration in unknown environments in, for example, search and rescue operations. Thus, the design principles introduced in this work can be exploited to explore new ways of integrating computing capabilities into soft machines by programming complex motions. In this vision, we believe that our approach could be implemented to mimic natural continuum structures (e.g., elephant trunks) thus giving rise to totally new soft robots such as soft versatile manipulators. The muscular synergies of the artificial trunk could be implemented by encoding programmed modalities via intrinsic kinematic variables. [ \n \n 3a \n \n ] \n Our strategy could be exploited to scale the architecture by increasing the number of unit grid tessellations and their unit length. Therefore, achieving large‐scale robots (e.g., meter scale) will be possible with large‐scale 3D printers. Porosity‐based strategies could enhance the design of bioinspired mechanics by mimicking the anisotropy of the muscular arrangements. In addition, robotic design paradigms could move toward a robust soft continuum approach rather than articulated solutions."
} | 3,436 |
25978545 | PMC4817625 | pmc | 9,437 | {
"abstract": "The role of bacterioplankton in the cycling of marine dissolved organic matter (DOM) is central to the carbon and energy balance in the ocean, yet there are few model organisms available to investigate the genes, metabolic pathways, and biochemical mechanisms involved in the degradation of this globally important carbon pool. To obtain microbial isolates capable of degrading semi-labile DOM for growth, we conducted dilution to extinction cultivation experiments using seawater enriched with high molecular weight (HMW) DOM. In total, 93 isolates were obtained. Amendments using HMW DOM to increase the dissolved organic carbon concentration 4x (280 μ M ) or 10x (700 μ M ) the ocean surface water concentrations yielded positive growth in 4–6% of replicate dilutions, whereas <1% scored positive for growth in non-DOM-amended controls. The majority (71%) of isolates displayed a distinct increase in cell yields when grown in increasing concentrations of HMW DOM. Whole-genome sequencing was used to screen the culture collection for purity and to determine the phylogenetic identity of the isolates. Eleven percent of the isolates belonged to the gammaproteobacteria including Alteromonadales (the SAR92 clade) and Vibrio . Surprisingly, 85% of isolates belonged to the methylotrophic OM43 clade of betaproteobacteria, bacteria thought to metabolically specialize in degrading C1 compounds. Growth of these isolates on methanol confirmed their methylotrophic phenotype. Our results indicate that dilution to extinction cultivation enriched with natural sources of organic substrates has a potential to reveal the previously unsuspected relationships between naturally occurring organic nutrients and the microorganisms that consume them.",
"introduction": "Introduction Marine dissolved organic matter (DOM) supports a considerable fraction of the carbon, energy and nutrient requirements of bacterioplankton in the ocean, yet the biological processes that control DOM turnover are poorly understood. This is due in part to the chemical complexity of naturally occurring DOM and the current level of molecular characterization, along with a lack of information on the variety of bacteria and metabolic strategies involved in DOM degradation. Marine DOM characterization has been largely limited to defining its bulk chemical properties. Marine DOM can be operationally separated into two different fractions based on size: low molecular weight (<1 kDa) and high molecular weight (HMW: ⩾1 kDa). The HMW DOM fraction is isolated from seawater by ultrafiltration and typically accounts for 25–40% of the total dissolved organic carbon (DOC) in marine waters ( Benner, 2002 ). The elemental composition of HMW DOM (carbon:nitrogen:phosphorus=298:18:1; Benner, 2002 ) contrasts with marine plankton ( Redfield et al. , 1963 ) in that HMW DOM is depleted in nitrogen and phosphorus relative to carbon. HMW DOM from open ocean-surface waters contains 40–60 nmol nitrogen per μmol carbon primarily in the form of amides ( McCarthy et al. , 1997 ; Aluwihare et al. , 2005 ) and only 3–4 nmol phosphorus per μmol carbon as part of phosphate esters and phosphonate molecules ( Clark et al. , 1998 ; Kolowith et al. , 2001 ). The 13 C NMR spectrum of HMW DOM from marine surface waters indicates it is largely composed of carbohydrates (50%), humic substances (25%) and a lesser amount of lipids and proteins ( Benner et al. , 1992 ; Aluwihare et al. , 1997 ; Benner, 2002 ). Radiocarbon analysis offers insight of the fate and reactivity of DOM. HMW DOM from the North Pacific has a Δ 14 C of 10‰ and its constituting neutral monosaccharides derived from acid hydrolysis have Δ 14 C values of 47–67‰. This is similar to the Δ 14 C of dissolved inorganic carbon in surface waters (72±7‰ Repeta and Aluwihare, 2006 ) and indicates recent production. In contrast, total DOC is radiocarbon depleted (Δ 14 C of −146‰ and −540‰ in surface and deep North Pacific waters, respectively) likely owing to the presence of refractory carbon ( Williams and Druffel, 1987 ). This data suggests that subcomponents of HMW DOM from surface waters, including polysaccharides, cycle faster (1–25 years; Repeta and Aluwihare, 2006 ) than the total pool of DOC (6000 years; Williams and Druffel, 1987 ). These chemical characteristics, along with field observations of semi-labile DOM utilization in natural seawater ( Carlson et al. , 2004 ; McCarren et al. , 2010 ), indicate HMW DOM can fuel microbial metabolism on ecologically relevant timescales. Difficulties in identifying the specific chemical moieties supporting such growth, however, limits current understanding of DOM transformation, remineralization and ultimate impact on the flux of carbon and nutrients through the marine food web. Bacteria and Archaea are the dominant degraders of DOM ( Carlson, 2002 ), but the specific taxa, genes and molecular mechanisms most responsible for DOM metabolism remain relatively obscure. Recently, several culture-independent studies have begun to identify the microbial community members that respond to DOM enrichment, though the majority of these studies have focused on DOM isolated from phytoplankton cultures ( Poretsky et al. , 2010 ; Nelson and Carlson, 2012 ; Sarmento and Gasol, 2012 ; Landa et al. , 2013 ; Sharma and Becker et al. , 2013 ; Beier et al. , 2014 ), which is presumed to be more labile than HMW DOM collected in oligotrophic environments. This is likely because of the presence of labile proteins and amino acids ( Sarmento et al. , 2013 ) and homopolysaccharides ( Meon and Kirchman, 2001 ) in phytoplankton DOM. Aluwihare et al. (1997) and Aluwihare and Repeta (1999) observed rapid drawdown of phytoplankton DOM and evolution of polysaccharides from homopolysaccharides (energy storage products) to heteropolysaccharides with a composition like HMW DOM. In contrast, there have been fewer culture-independent studies focusing on the cycling of HMW DOM ( McCarren et al. , 2010 ; Sharma and Becker et al. , 2013 ). In all of these studies, DOM additions resulted in the enrichment of select members of the microbial community and in several cases a temporal succession of DOM-degrading bacteria ( McCarren et al. , 2010 ; Sharma and Becker et al. , 2013 ). Although these “omic”-based studies have generated hypothesis as to the functional and metabolic roles of DOM-degrading bacteria, appropriate model systems upon which to test such hypothesis and dissect the genes, metabolic pathways and chemical transformation reactions driving DOM degradation are still lacking. The goal of this study was to isolate HMW DOM metabolizing bacteria from marine environments to develop model systems for investigating the biochemical and metabolic pathways driving DOM transformations in the ocean. Dilution to extinction cultivation has greatly expanded the collection of marine bacterial isolates ( Button et al. , 1993 ; Connon and Giovannoni, 2002 ), and has proved instrumental in isolating organisms resistant to traditional cultivation techniques, including members of the SAR11 and SAR116 clades ( Rappé et al. , 2002 ; Stingl et al. , 2007a , 2008 ), oligotrophic marine gammaproteobacteria ( Cho and Giovannoni, 2004 ), members of the SUP05 clade of gammaproteobacterial sulfur oxidizers ( Marshall and Morris, 2013 ) and pyschropiezophilic alphaproteobacteria ( Eloe et al. , 2011 ). Field studies, genome analysis and pure cultures experiments enabled by the cultivation of bacterial clades like SAR11 have expanded our understanding of the ecology and physiology of marine bacteria and their role in the ocean carbon cycle ( Malmstrom et al. , 2004 ; Schwalbach et al. , 2010 ; Sun et al. , 2011 ; Grote et al. , 2012 ). In this study we expanded on the technique by enriching dilution to extinction cultures with HMW DOM collected directly from ocean surface waters, leveraging the high-throughput nature of dilution to extinction cultivation to screen a microbial assemblage for HMW DOM-utilizing organisms.",
"discussion": "Discussion Dilution to extinction cultivation has proven a useful approach for obtaining highly abundant but difficult to cultivate bacteria. It enables separation of slower growing cells from faster, more easily cultured microorganisms, and it also allows the growth of cells in media that more closely mimics the native environment. Although several studies have supplemented natural seawater media with defined carbon substrates in efforts to improve the cell yields ( Cho and Giovannoni, 2004 ) we applied the alternative approach of enriching seawater media with HMW DOM collected directly from the environment. We postulated that the native, complex mixture of marine HMW DOM could increase the probability of obtaining relevant DOM-degrading microorganisms. Such isolates could then be used as tools to help define the chemical characteristics of marine HMW DOM and the biological processes that degrade it. A similar tactic was successfully applied by Hutalle-Schmelzer et al. (2010) who enriched bacterioplankton dilution cultures with the humic fraction of lake-derived DOM. In our study, dilution to extinction cultures enriched with HMW DOM increased culturing efficiency and yielded over 90 organisms with DOM-degrading capabilities. Our non-DOM-amended cultures had lower culturing efficiency (0.1%) than previous dilution culturing studies, which typically range from 3–25% ( Connon and Giovannoni, 2002 ; Cho and Giovannoni, 2004 ; Song et al. , 2009 ). The reduced culturing efficiency in our experiments may be explained by the deliberate use of oligotrophic Sargasso Sea surface water to prepare the media, which likely has low levels of vitamins (for example, <0.1 pM vitamin B 12 ( Menzel and Spaeth, 1962 ) and 20–25 pM thiamin ( Carini et al. , 2014 )), inorganic nutrients (often below detection limits, 0.05 μmol per kg for nitrate+nitrite and 0.03 μmol per kg for phosphate; http://batsftp.bios.edu/BATS/bottle ) and DOC concentrations (70 μ M ; as measured for this study) in the basal media than are typical of coastal seawater. Although this oligotrophic medium may have prohibited the enrichment of some coastal microorganisms, its low DOC and nutrient background (inorganic nitrogen and phosphorus were not added) provided greater sensitivity for detecting DOM addition effects without requiring extensive manipulation of the natural media. The fact that culturing efficiencies significantly increased in DOM-amended treatments suggested that DOM addition provides, at least partially, growth factor(s) or organic sources of nitrogen and phosphorus that were missing in oligotrophic seawater. Establishing the purity of the culture collection is essential for linking the metabolism of DOM to specific taxa, genes and biochemical mechanisms. Determining culture purity, however, can be challenging, especially when a culture contains a secondary isolate at very low abundance ( Shrestha et al. , 2013 ). While SSU rRNA gene sequencing or screens such as restriction fragment length polymorphisms (RFLP) are most often used to identify cultures, they suffer from primer design and preferential amplification biases which can decrease sensitivity for detecting mixed cultures. The WGS screen used in this study does not suffer from oligonucleotide primer mismatch and excludes most other PCR biases thereby providing a more sensitive and universal method for determining culture purity. Although PCR-based SSU rRNA gene sequencing revealed no mixed cultures in our study, WGS sequencing showed that 6 of the 68 screened cultures were mixed as congruently determined by three different bioinformatic analyses: (i) number of contigs containing SSU rRNA genes, (ii) unassembled read's sequence similarity to assembled SSU rRNA sequences and (iii) unassembled read taxon binning based on sequence similarity search against NCBI's RefSeq database. The ability of WGS sequencing to identify mixed cultures is directly dependent on the relative abundance of the secondary culture in relation to the sequencing depth, as well as on the phylogenetic relatedness of the co-isolates. In terms of resolving mixed cultures of closely related isolates, we found cultures with no other indication of being mixed had the majority of unassembled SSU rRNA reads at ⩾98% identity to the assembled SSU rRNA sequence ( Supplementary Figure S2 ), suggesting that two different populations with <2% SSU rRNA divergence would be difficult to detect. We note that this would include many of the betaproteobacterial isolates obtained here. The metagenomic approach of identifying mixed cultures via taxonomic binning will be less sensitive than the SSU rRNA bioinformatic approaches to resolving closely related populations owing to database limitations. The breadth of genes examined using the metagenomic approach, however, should provide greater sensitivity for detecting low abundance but phylogenetically diverse secondary populations. For the betaproteobacterial genomes examined here, 5–10% of unassembled reads had significant matches to non-betaproteobacterial genomes likely because of factors such as short reads lengths, horizontal gene transfer events and limited reference genomes in the database. This suggests a lower limit for detecting co-isolates at around 10% total abundance, though we note differences in genome size will also affect this sensitivity. Alternative approaches to increase power for detecting closely related co-isolates at low abundance would likely require more sensitive bioinformatic analysis, such as the statistical frequency of genome single-nucleotide polymorphisms ( Shrestha et al. , 2013 ) focusing on less conserved genes such as those typically used in multi-locus sequence typing. De novo assembly of the WGS data produced contigs containing full-length SSU and LSU sequences that were as accurate, and often had 100% identities, with overlapping Sanger reads. Phylogenetic placement of these WGS SSU rRNA sequences revealed the culture collection was dominated by members of the OM43 clade of betaproteobacteria. The OM43 clade, initially described by Rappé et al. (1997) , was first isolated from the Oregon coast by Connon and Giovannoni (2002) . Their distribution is generally limited to the coastal zone, where they can compose 1–3% of the bacterioplankton community ( Suzuki et al. , 2004 ), though their abundance has been shown to significantly increase during phytoplankton blooms ( Morris et al. , 2006 ; Rich et al. , 2011 ). Metatranscriptomic and metaproteomic data suggest they are active components of coastal bacterioplankton communities ( Sowell et al. , 2010 ; Gifford et al. , 2014 ). The OM43 isolates obtained in this study were closely related to those previously characterized coastal strains and sequences ( Figure 4 ). The majority of our isolates clustered most closely with the Hawaiian strain HIMB624 ( Huggett et al. , 2012 ) and related SSU rRNA phylotypes identified in diverse coastal locations. Three of our isolates formed an outgroup with the Oregon coastal isolate HTCC2181, as well as sequences obtained primarily from higher latitudes. Though closely related, the presence of SSU rRNA microdiversity within our isolate collection suggests the prevalence of OM43 clade members in the dilution to extinction cultures was not because of the enrichment of a single clonal population. Genome sequences of OM43 betaproteobacteria are missing the E1 subunit of the α-ketoglutarate dehydrogenase complex of the TCA cycle, a trait thought to be indicative of an obligatory methylotrophic lifestyle ( Halsey et al. , 2012 ; Huggett et al. , 2012 ). A preliminary genome analysis of NB0046 shows that it is also missing the E1 α-ketoglutarate dehydrogenase subunit. Furthermore, NB0046 shares similar characteristics with other OM43 lineage genomes ( Giovannoni et al. , 2008 ; Huggett et al. , 2012 ), including a small genome size (<1400 genes), the presence of an alternative methanol dehydrogenase (XoxF) instead of the canonical Mxa or Mdh methanol dehydrogenase ( Chistoserdova, 2011 ), genes for formaldehyde oxidation via tetrahydrofolate but not via tetrahydromethanopterin, and carbon assimilation through the RUMP cycle instead of the serine cycle. These observations suggest the methylotrophs isolated on HMW DOM have a similar 'obligate' methylotrophic lifestyle as other OM43 clade members, although a more detailed and thorough analysis of the 60 OM43 genomes sequenced here will be required to confirm this. Given their reliance on single carbon substrates, the predominance of C1 compound specialists in our cultures amended with HMW DOM was unexpected. Our results, however, are predicated in a previous study by McCarren et al. (2010) , who observed that HMW DOM added to oligotrophic ocean bacterioplankton microcosms increased the relative abundance and transcriptional activity of methylotrophs, particularly Methylophaga species belonging to the gammaproteobacteria. McCarren et al. (2010) postulated that HMW DOM polysaccharides containing a large fraction of methylated sugars ( Quan and Repeta, 2007 ) were the source of single carbon compounds, including methanol, which provided the methylotrophs their growth substrate. We further propose that the prevalence of pure cultures of methylotrophs in our HMW DOM-enriched dilution to extinction samples is owing to their ability to cleave C1 groups from the methyl sugars and uronic acid methyl esters in the DOM polysaccharide. In addition, low levels of abiotic oxidation of the HMW DOM during collection and storage may possibly degrade the methylated sugars, releasing low molecular weight compounds that can be directly consumed by methylotrophs. In either case, the data indicated that HMW DOM can serve as a sole source of carbon and energy for these methylotrophs. The order of magnitude difference in growth yields (cell yield normalized to carbon added) between methanol (6.8 × 10 7 to 5.3x10 8 cells per μmol of carbon) and HMW DOM (1.6 × 10 6 to 6.4 × 10 6 cells per μmol of carbon) suggests that growth on HMW DOM is less efficient than on methanol. Similar low growth yields (7.1 × 10 5 cells per μmol of carbon) were observed for SAR92 clade strain NB0015 in cultures amended with HMW DOM. Alternatively, the low growth yields observed may indicate that only a small fraction of HMW DOM may be available to a single organism with limited metabolic potential, like isolates NB0046 and NB0015, despite the total amount of DOC added to cultures. The efficiency at which DOC is converted into biomass, typically <20% in the open ocean ( Carlson and Ducklow, 1996 ) has implications on the magnitude of carbon that cycles through bacterioplankton. Measurements of DOC drawdown and respiration, though not obtained in HMW DOM dose-response experiments, will be necessary to determine bacterial growth efficiencies on HMW DOC and to estimate the bacterial carbon demand that this organic carbon pool can support. The second major taxonomic group found in the HMW DOM-enriched cultures was the gammaproteobacteria. This included isolates belonging to the Alteromonadales and Vibrionales. The Vibrio (NB0059, NB0072 and NB0080), Alteromonad (NB0094) and Pseudoalteromonad (NB0030) isolates did not exhibit a proportional increase in cell yields in response to added HMW DOM in dose-response experiments even though these isolates were initially obtained from the HMW DOM-enriched dilution to extinction cultures. Among the gammaproteobacteria only strains NB0011 and NB0077, and the SAR92 clade isolates exhibited increased growth in the presence of HMW DOM. The SAR92 clade isolate NB0015 exhibited the strongest growth response to HMW DOM although cell yields were low (2–4 × 10 5 cells per ml) compared with the OM43 clade isolates (>5 × 10 6 cells per ml). However, NB0015 growth yields reached >1x10 6 cells per ml when cultured in defined media with a mixture of simple carbon substrates indicating that this isolate may require a variety of carbon compounds and nutrients not available in HMW DOM to supplement its metabolism. The SAR92 clade was the most frequently recovered gammaproteobacteria group in the dilution to extinction cultures including four SAR92 clade-related SSU rRNA sequences found mixed with cultures of OM43 clade strains, more than any other taxa. Including these additional sequences, the SAR92 clade was the second most common group identified in our dilution to extinction cultivation experiment. The growth of SAR92 clade strains in our HMW DOM-amended samples may partially be explained by its numerical abundance in coastal bacterioplankton assemblages ( Stingl et al. , 2007b ) and their ease of recovery by dilution to extinction cultivation ( Cho and Giovannoni, 2004 ). These factors alone, however, do not solely account for the prevalence of SAR92 in our cultures because SAR92 was only identified in the HMW DOM-enriched dilution to extinction cultures and not in the non-DOM-amended cultures. We postulate that the carbohydrate-rich component of HMW DOM in particular may have stimulated the growth of SAR92 bacteria. Some of the closest relatives of the SAR92 clade (90–93% SSU rRNA identity) include cultured isolates with carbohydrate degrading capabilities. For example, Microbulbifer hydrolyticus ( Gonzalez et al. , 1997 ), Saccharophagus degradans 2–40 ( Andrykovitch and Marx, 1988 ; Weiner et al. , 2008 ) and Simiduia agarivorans SA1 ( Shieh et al. , 2008 ) can breakdown several recalcitrant polysaccharides, including agar, alginate, cellulose or chitin. Another relative, Teredinibacter turnerae T7902, a bacterium associated with wood-boring bivalves, is capable of digesting cellulose ( Distel et al. , 2002 ). It is plausible that SAR92 clade strains may directly degrade HMW DOM polysaccharides in contrast to the OM43 clade methylotrophs which may utilize C1 compounds that decorate the polysaccharides. The availability of model laboratory organisms able to grow on HMW DOM now allows us to test these hypotheses. Future work chemically characterizing the HMW DOM before and after microbial degradation, as well as examining the transcriptional and proteomic responses of the isolates during DOM metabolism will help to determine the bonded nature of the carbon sustaining the cultures. In summary, dilution to extinction cultures enriched with HMW DOM extended the power of the dilution cultivation technique by enriching for cells in media closely mimicking their native environment, and also by stimulating growth using naturally derived organic substrates. This approach is useful for obtaining model DOM-degrading isolates as both the carbon substrates and the organisms acting upon them are unknown. Using this technique we found organisms ranging from obligate methylotrophs to less fastidious heterotrophs that were able to grow using oligotrophic ocean HMW DOM as a substrate, suggesting there are multiple metabolic strategies involved in the degradation of HMW DOM. We note, however, that only a fraction of the total DOM added to our cultures was remineralized, suggesting that there were other growth-limiting factors, or potential requirement for syntrophic microbial partners to further degrade the DOM polymers ( McCarren et al. , 2010 ). Co-culture experiments will likely be essential to further elaborate the biological, physiological and biochemical details of consortial DOM degradation processes in the sea."
} | 5,891 |
24643940 | PMC4006116 | pmc | 9,438 | {
"abstract": "Catalytic micromotors are trapped in microfluidic chips containing chevron and heart-shaped PDMS structures.",
"conclusion": "Conclusions In this work, we demonstrated the possibility of trapping artificial micromotors. We use microfluidic chips containing chevron and heart-shaped geometries to show how physical boundaries can cause micromotor trapping due to steric restriction of their motion. Our approach not only demonstrates the trapping of micromotors but also eliminates the need for any external mechanism to control their motion, since it merely relies on steric boundaries present in the micromotor environment. This advantage could be especially beneficial for the integration of this mechanism into more complex platforms and would facilitate miniaturization, since no external power source would be required. In the future, these structures could be used in lab-on-a-chip systems as a passive mechanism for sample concentration or isolation of cargo. For example, contaminants or biological entities could be confined in specific areas of the system for biosensing or as a pre-concentrating step. Additionally, our system could serve as a filtering device to separate active and inactive micromotors since only active micromotors can swim and get trapped into the heart-shaped reservoir."
} | 321 |
21469225 | null | s2 | 9,439 | {
"abstract": "The [Re(I)(CO)(3)(4,7-dimethyl-1,10-phenanthroline)(histidine-124)(tryptophan-122)] complex, denoted [Re(I)(dmp)(W122)], of Pseudomonas aeruginosa azurin behaves as a single photoactive unit that triggers very fast electron transfer (ET) from a distant (2 nm) Cu(I) center in the protein. Analysis of time-resolved (ps-μs) IR spectroscopic and kinetics data collected on [Re(I)(dmp)(W122)AzM] (in which M=Zn(II), Cu(II), Cu(I); Az=azurin) and position-122 tyrosine (Y), phenylalanine (F), and lysine (K) mutants, together with excited-state DFT/time-dependent (TD)DFT calculations and X-ray structural characterization, reveal the character, energetics, and dynamics of the relevant electronic states of the [Re(I)(dmp)(W122)] unit and a cascade of photoinduced ET and relaxation steps in the corresponding Re-azurins. Optical population of [Re(I)(imidazole-H124)(CO)(3)]→dmp (1)CT states (CT=charge transfer) is followed by around 110 fs intersystem crossing and about 600 ps structural relaxation to a (3)CT state. The IR spectrum indicates a mixed Re(I)(CO)(3),A→dmp/π→π(*)(dmp) character for aromatic amino acids A122 (A=W, Y, F) and Re(I)(CO)(3)→dmp metal-ligand charge transfer (MLCT) for [Re(I)(dmp)(K122)AzCu(II)]. In a few ns, the (3)CT state of [Re(I)(dmp)(W122)AzM] establishes an equilibrium with the [Re(I)(dmp(.-))(W122(.+))AzM] charge-separated state, (3)CS, whereas the (3)CT state of the other Y, F, and K122 proteins decays to the ground state. In addition to this main pathway, (3)CS is populated by fs- and ps-W(indole)→Re(II) ET from (1)CT and the initially \"hot\" (3)CT states, respectively. The (3)CS state undergoes a tens-of-ns dmp(.-)→W122(.+) ET recombination leading to the ground state or, in the case of the Cu(I) azurin, a competitively fast (≈30 ns over 1.12 nm) Cu(I)→W(.+) ET, to give [Re(I)(dmp(.-))(W122)AzCu(II)]. The overall photoinduced Cu(I)→Re(dmp) ET through [Re(I)(dmp)(W122)AzCu(I)] occurs over a 2 nm distance in <50 ns after excitation, with the intervening fast (3)CT-(3)CS equilibrium being the principal accelerating factor. No reaction was observed for the three Y, F, and K122 analogues. Although the presence of [Re(dmp)(W122)AzCu(II)] oligomers in solution was documented by mass spectrometry and phosphorescence anisotropy, the kinetics data do not indicate any significant interference from the intermolecular ET steps. The ground-state dmp-indole π-π interaction together with well-matched W/W(.+) and excited-state [Re(II)(CO)(3)(dmp(.-))]/[Re(I)(CO)(3)(dmp(.-))] potentials that result in very rapid electron interchange and (3)CT-(3)CS energetic proximity, are the main factors responsible for the unique ET behavior of [Re(I)(dmp)(W122)]-containing azurins."
} | 679 |
29095862 | PMC5667884 | pmc | 9,440 | {
"abstract": "The fundamental requirement for the autonomous capsule-based self-healing process to work is that cracks need to reach the capsules and break them such that the healing agent can be released. Ignoring all other aspects, the amount of healing agents released into the crack is essential to obtain a good healing. Meanwhile, from the perspective of the capsule shapes, spherical or elongated capsules (hollow tubes/fibres) are the main morphologies used in capsule-based self-healing materials. The focus of this contribution is the description of the effects of capsule shape on the efficiency of healing agent released in capsule-based self-healing material within the framework of the theory of geometrical probability and integral geometry. Analytical models are developed to characterize the amount of healing agent released per crack area from capsules for an arbitrary crack intersecting with capsules of various shapes in a virtual capsule-based self-healing material. The average crack opening distance is chosen to be a key parameter in defining the healing potential of individual cracks in the models. Furthermore, the accuracy of the developed models was verified by comparison to the data from a published numerical simulation study.",
"conclusion": "Conclusions In this contribution the effects of capsule shape on the efficiency of healing agent to be released in capsule-based self-healing composite materials are conducted. When capsules are randomly distributed in the matrix and a crack occurs and grows, the analytical expression of efficiency of healing agent released by spherical or spherocylindrical capsules are stemmed from a mathematically rigorous reasoning via the theory of geometrical probability and integral geometry. The crack opening distance is chosen to characterize the healing potential of individual cracks in the models. Furthermore, the reliabilities of the developed models can be verified by data from relevant literature information, which was implemented via numerical simulation. It was found that both shape and size of capsules should be jointly investigated to improve the efficiency of healing agent to be released in capsule-based self-healing composite materials. This point is opposed with the existing claim. As a result of the model, the volume fraction of capsules required to be embedded in matrix can be determined via the developed efficiency model for different type of shaped capsules. The results of the analytical models will serve to understand the probability of crack intersection with capsules and guide the further development of spherical or elongated liquid filled capsules in capsule-based self-healing composite materials.",
"introduction": "Introduction The initiation and propagation of damages/cracks at different length scales frequently result in structural degradation in materials. In structural materials, even micro-damage can lead to degradation in stiffness and durability and sometimes also to spontaneous loss of structural integrity. Furthermore, internal micro-damage is difficult to detect, repair cost of the damaged structural part is usually large and in some cases repair is impossible due to inaccessibility (for example, in space applications). In the meantime, the demand for continual improvement of engineering material performance is a common feature of many modern engineering projects and autonomous reliable repair of the internal micro-damage/cracks is desirable. To extend the structural lifetime and save maintenance costs, a fantastic strategy that once a crack or damage occurs the designed material possesses the ability to heal (recover/repair) the internal damages automatically by initiating some form of repair mechanism without any external intervention was put forward, i.e. self-healing [ 1 , 2 ]. Generally, self-healing can be divided into autonomous and non-autonomous healing [ 2 , 3 ]. Autonomic self-healing of cracks via capsules embedded which can prevent micro-crack growth into catastrophic macro-cracks in engineering materials is helpful to retain the reliability of structure, load-bearing capacity, and further the service life of structure [ 3 ]. A great achievements have been made in the self-healing materials with encapsulated healing agent, such as polymer composites[ 4 , 5 ], cementitious materials [ 6 – 12 ], coatings [ 13 , 14 ]. Self-healing of fracture surfaces in polymer composites with an encapsulated healing agent has rapidly developed over the past decade [ 5 , 15 – 19 ]. A group from the University of Illinois at Urbana-Champaign first reported autonomous self-healing material by incorporating a microencapsulated healing agent and a catalyst chemical trigger in an epoxy matrix [ 20 ]. As the healing agent released by the microcapsules via capillary action happen to meet with the crushed catalyst particles, self-healing process will occur and the crack can be healed or sealed. From the perspective of the capsule shapes, spherical and elongated capsules (hollow tubes/fibres) are the main morphology of capsules used in the capsule-based self-healing materials [ 21 , 22 ]. A key advantage of the spherical microencapsulation self-healing approach is the ease with which they can be incorporated within a bulk matrix and not significantly affect the performance of the material [ 13 ].The disadvantages are the need for microcapsule fracture and the need for the resin to encounter the catalyst prior to any repair occurring. Moreover, a undesirable drawback of spherical capsules in the self-healing system is that they do not allow long distance transport of the healing agent towards the crack and sufficiently supply volumes of healing agent to the damaged site [ 19 ]. In order to enhance the release of healing agent per crack area, Mookhoek et al. [ 23 , 24 ] stated the necessary of the introduction of elongated liquid filled capsules and concluded that the self-healing efficiency could be improved by elongated capsules comparison with spherical capsules in capsule-based self-healing systems. Comparing with self-healing materials using spherical capsules, the strategy of elongated capsules (including hollow fibers with large aspect ratio like) employed has two advantages: one is that elongated capsules contain more agent than spherical microcapsules; the other is that elongated capsules with a weaving network structure can greatly enhance the mechanical properties of the matrix materials. Much progresses that a crack hits the embedded spherical/elongated capsules has been made by modeling methods and numerical simulation [ 23 , 25 – 28 ]. The fundamental requirement for the self-healing process to occur is that cracks need to approach/penetrate the capsules and cause to be ruptured and the healing agents release to fractured plane. Once the structure made up by self-healing materials has been subjected to damage it is extremely crucial to know what the chance that the structure can be healed is or how the healing efficiency of healing agent released of embedded capsules is. Evidently, only if the capsules are ruptured and the healing agent are released, the healing process may happen and the efficiency of self-healing will come. In other words, the more the embedded capsules are ruptured, the higher the potential efficiency of self-healing will grow. But it is unrealistic that all the embedded capsules can be crashed by cracks. Hence, the probability of a crack intersecting capsules in capsule-based self-healing system is brought forth. When the probability grows, both the probability of the capsules to be ruptured and the efficiency of healing agent released from capsules will accordingly increase. Hence, investigating the probability of a crack intersecting capsules will be helpful to provide critical insight in the selection of optimal self-healing material system [ 26 ] in addition to the conventional self-healing chemistry and mechanical characterization studies. Recently, Lv et al. [ 27 , 29 – 31 ] applied geometrical probability theory to obtain the exact amount of capsules required to completely or partially repair the cracks in two- and three-dimensional capsule-based self-healing materials for certain specific scenarios. With the help of elementary probability principles, Zemskov [ 25 ] has developed analytical self-healing models to compute the probability of crack intersecting an encapsulated particle in the two-dimensional capsule-based self-healing cementitious model materials. These developed models gave some suggestions to fix critical crack lengths, ideal capsule size, and mean inter-capsule distance and facilitated to investigate the efficiency of healing agent of capsules in a self-healing material. Based on the probability of a crack hitting spherical capsules with a certain diameter calculated by Monte Carlo simulations, Huang [ 32 ] attempted to investigate the effects of the dosage and the size of capsules on self-healing efficiency in capsule-based self-healing material. From the view of capsule shape, many researches on the healing efficiency of capsules focused on the spherical capsules. Therefore, when spherical/elongated capsules are randomly distributed in the matrix and a crack occurs and grows, quantitative characterization of effect of capsule shape on the self-healing efficiency from viewpoint of probability will put forward the prospect of future research of the self-healing efficiency of capsules. Ignoring all other aspects, the amount of healing agents released into the crack is essential to obtain a good healing. To enhance the release of healing agent per crack area, the introduction of elongated liquid filled capsules was recommended [ 23 ]. By an elementary probabilistic knowledge and numerical simulation, Mookhoek [ 23 ] performed a numerical study into the effect of aspect ratio, volume fraction and orientation of elongated capsules on the healing of liquid healing agent based systems. The probability of crack meeting for spherical capsules was developed when capsules are distributed at random in the matrix. However, the analytical express of probability of crack meeting for elongated capsules is an opening. Hence, a more comprehensive work on the capsule shape on the efficiency of healing agent released is essential. The focus of this contribution is the description of the effects of capsule shape on the healing efficiency of healing agent released to crack surface in capsule-based self-healing materials within the framework of the theory of geometrical probability and integral geometry. Employing these tools, analytical expressions are developed to characterize the healing efficiency attributed for various shapes of capsules. The model stresses the crack opening distance, rather than the crack length, as a key parameter to characterize the healing potential of individual cracks. Furthermore, the accuracy of the developed analytical model was verified by comparison of its results with those of the published numerical simulation studies.",
"discussion": "Results and discussion Verification for spherical capsule When spherical capsules are employed in the self-healing system, the analytical expression Eq ( 3 ) of self-healing efficiency of capsules is identical with Eq ( 5 ) presented elsewhere [ 23 ]. It is clearly shown that with increasing capsule size the total amount of healing agent released increases rapidly. From the development procedure of the analytical expression it can be seen that Eq ( 3 ) is on basis of a mathematically rigorous reasoning and is more comprehensive. The article stated ‘a test plane at a random position but parallel to one of the faces of the RVE axes was defined’ [ 23 ], while in this contribution a random sectioning planar crack cutting the sample is sufficient. In the case of spherical capsules with capsular volume of V 0 = 15.7 μm 3 (i.e. a capsule diameter 2 r = 3.11 μm) and volume fraction V V = 0.10, an average volume per area is found of X = 0.3107 μm 3 /μm 2 via the presented formula Eq ( 3 ). This value is consistent with the numerical result given in [ 23 ]. Therefore, the volume released would be capable of filling a crack volume with a uniform crack opening distance of maximum 0.3107 μm 3 /μm 2 . Fig 3 shows the calculated average volume per area as a function of the capsule radius for three volume fractions. The observed linear dependence between average volume released per crack area and capsule size ( V 0 ) 1/3 , for a given volume fraction V V , can simply be derived from Eq ( 3 ). That is,\n X = 2 ⋅ ( V 0 ) 1 / 3 ⋅ ( 3 4 π ) 1 / 3 ⋅ V V (9) \nAs shown in Fig 3 , for given volume fraction V V = 0.05, 0.1, 0.15 and capsule size ( V 0 ) 1/3 = 0.81, 1.61, 2.51, 3.22, 5.01, 6.31 μm, it can be drawn the line graph of X via ( V 0 ) 1/3 according to Eq ( 9 ). Meanwhile, for given V V and V 0 the specific numerical values of the volume of healing agent released on the per area of crack were numerically investigated ( S1 Excel ) [ 23 ]. It is found that the simulation results of the self-healing efficiency X of the volume of healing agent released on the per area of crack vs. capsule size ( V 0 ) 1/3 is consistent with the trend as demonstrated in Eq ( 9 ). Hence, the presented analytical model could be verified. By the way, the scattered points which stand for the simulation values in the Fig 3 were extracted from Fig 2B in the paper [ 23 ]. 10.1371/journal.pone.0187299.g003 Fig 3 Theoretical volume of healing agent released per area as a function of the spherical capsule size for three volume fractions. Verification for spherocylindrical capsule In the case of spherocylindrical capsules with a capsular volume of V 0 = 15.7 μm 3 and an aspect ratio τ = 5 (i.e. h = 8 r ) and volume fraction 0.10, an average volume per area is found of Y = 0.487 μm 3 /μm 2 via formula Eq ( 8 ). While for the identical capsular volume, aspect ratio and volume fraction of spherocylindrical capsule, a numerical value, 0.448 μm 3 /μm 2 , of the volume of healing agent released on the per area of crack was given in Ref. [ 23 ]. It can be found that the numerical result nearly approaches to the presented analytical value. The volume released would be capable of filling a crack volume with a uniform crack opening distance of maximum 0.487 μm 3 /μm 2 . Fig 4 shows the theoretical average volume per area as a function of the capsule size for three volume fractions. The observed linear dependence between average volume released per crack area and the size of a spherocylindrical capsule ( V 0 ) 1/3 , for a given volume fraction V V , can easily be derived by Eq ( 8 ). As shown in Fig 4 , for given volume fraction V V = 0.05, 0.1 and 0.15, aspect ratio τ = 5 and spherocylindrical capsule size ( V 0 ) 1/3 = 1.69, 2.49, 3.21, 5.00, 6.31 μm, graph of Y with respect to ( V 0 ) 1/3 on the basis of Eq ( 8 ) can be drawn. It should be noted that there is a simply relation\n Y = ( τ + 1 ) ⋅ V 0 1 / 3 ⋅ V V ( 2 π τ − 2 3 π ) 1 / 3 (10) At the same time, for given V V and V 0 the specific numerical results (i.e. the scattered points in the Fig 4 ) of the volume of healing agent released on the per area of crack are borrowed from the published paper ( S2 Excel ) [ 23 ]. It is found that from Fig 4 the simulation results of the self-healing efficiency Y of the volume of healing agent released on the per area of crack vs. capsule size ( V 0 ) 1/3 is consistent with the trend as demonstrated in Eq ( 8 ). Hence, the presented analytical results could be verified. 10.1371/journal.pone.0187299.g004 Fig 4 Theoretical volume of healing agent released per area as a function of the spherocylindrical capsule size for given aspect ratio. Also, the relationship between the efficiency and the aspect ratio can be investigated from Eq ( 10 ). Here, Y / ( V 0 ) 1/3 for different capsule concentrations and aspect ratio at random capsule orientation can be obtained. From the analytical expression Y , i.e. Eqs ( 8 ) and ( 10 ), it can be concluded that Y / ( V 0 ) 1/3 is a function of the aspect ratio τ and volume fraction V V . Both the curve Y / ( V 0 ) 1/3 and the numerical values ( S3 Excel ) given by [ 23 ] are illustrated in Fig 5 . It appears that for a given volume fraction there is a linear dependence between Y / ( V 0 ) 1/3 and τ . From Fig 5 the self-healing efficiencey characterized by Y / ( V 0 ) 1/3 is improved increases as the aspect ratio increases for a given healing capacity of a single capsule. When the volume fraction and aspect ratio of embedded sphereocylindical capsules gets bigger, the deviations bewteen theoretical results and simulated values of Y / ( V 0 ) 1/3 also grows. The deviations may be originated from the ignoring of the overlapping among the embedded capsules, especially as the aspect ratio and the content are both increasing. Furthermore, for real materials containing elongated particles at a higher volume fraction (e.g. V V >0.1) alignment of the particles is almost unavoidable and isotropic distributions are unrealistic. 10.1371/journal.pone.0187299.g005 Fig 5 Comparison the analytical curves of the self-healing efficiencey characterized by Y/ ( V 0 ) 1/3 with the numerical values. The effect of capsule shape on the efficiency of healing agent to be released We now consider the influences of capsule shape on the efficiency of healing agent to be released. If the volume fraction of capsules embedded is fixed both for spherical and spherocylindrical capsules, Y / X which represents the ratio of the volume of healing agent to be released on the per area of crack can be obtained from Eqs ( 9 ) and ( 10 ) as follows\n Y X = τ + 1 2 ⋅ ( 2 σ 3 τ − 1 ) 1 / 3 ( τ > 1 , with σ = V 0 - c y l V 0 − s p h ) (11) Actually, Y / X is an analytical formula that characterizes the quotient of the determined slopes for spherocylindrical and spherical capsules at a fixed total capsule volume fraction. If the volume fraction of two types of capsules are equal and the size of spherical capsules with fixed volume which will be embedded in the matrix is given, the efficiency of healing agent released from spherocylindrical capsules employed in self-healing system increases as the aspect ratio or the volume of the type of spherocylindrical capsule grows as shown in Fig 6 . The theoretical results taking σ = 0.2, 0.5, 1 (red solid line in Fig 6 ) as examples are obtained from the analytical model, i.e. Eq ( 11 ), while the numerical values ( S4 Excel ) are given only for σ = 1 in the ref. [ 23 ]. Specifically, only when σ ≥1, Y / X is larger than 1. That is to say, the efficiency of any elongated capsules is higher than that of spherical ones. For σ <1, the Y / X is not always more than 1. At this situation, Y / X is not only related with the aspect ratio, but it also involves the size of capsules (i.e. capsule volume) embedded. Just when σ = 1 and τ = 1, the efficiencies are equal for the two types of capsules. Therefore, both shape and size of capsules should be jointly investigated to improve the efficiency of healing agent released in capsule-based self-healing composite materials. This point is opposed with the claim [ 23 ] that ‘for randomly positioned cylindrical microcapsules the RIF is a function of the capsule aspect ratio only and is independent of the volume fraction and the capsule volume’. 10.1371/journal.pone.0187299.g006 Fig 6 The effect of capsule shape on the efficiency of healing agent released with a given ratio of capsule volume for spherical and spherocylindrical capsules."
} | 4,901 |
39920762 | PMC11806803 | pmc | 9,441 | {
"abstract": "Background Microbial-driven lignin depolymerization has emerged as a promising approach for lignin degradation. However, this process is hindered by the limited activity of lignin-degrading enzymes. Antioxidants are crucial for maintaining redox homeostasis in living cells, which can impact the efficiency of enzymes. Ascorbic acid (AA) is well-known for its antioxidant properties, while Trametes versicolor is a commonly used lignin-degrading fungus capable of secreting laccase (Lac) and manganese peroxidase (MnP). Thus, AA was selected as model antioxidant and added into the culture medium of T. versicolor to examine the effect of antioxidants on the activity of lignin-degrading enzymes in the fungus. Results The presence of AA resulted in a 4.9-fold increase in the Lac activity and a 3.9-fold increase in the MnP activity, reaching 10736 U/L and 8659 U/L, respectively. This increase in enzyme activity contributed to a higher lignin degradation rate from 17.5% to 35.2%, consistent with observed morphological changes in the lignin structure. Furthermore, the addition of AA led to a reduction in the molecular weights of lignin and an increase in the content of degradation products with lower molecular weight, indicating more thorough degradation of lignin. Proteomics analysis suggested that the enhancement in enzyme activity was more likely to attributed to the reinforcement of AA on oxidative protein folding and transportation, rather than changes in enzyme expression. Conclusions The addition of AA enhanced the performance of enzymes responsible for lignin degradation in terms of enzyme activity, degradation rate, lignin structural change, and product mapping. This study offers a feasible strategy for enhancing the activity of lignin-degrading enzymes in the fungus and provides insights into the role of antioxidant in microbial lignin degradation. Supplementary Information The online version contains supplementary material available at 10.1186/s13068-025-02614-9.",
"conclusion": "Conclusion As the most abundant aromatic polymer found in nature, lignin represents a significant resource for the development of sustainable bioproducts. The valorization of lignin not only mitigates reliance on non-renewable fossil fuels but also enhances the economic viability of lignocellulosic biorefineries. Our findings suggest that the addition of AA enhanced the performance of enzymes responsible for lignin degradation in terms of enzyme activity, degradation rate, lignin structural change, and product mapping. Label-free differential proteomics analysis yielded crucial insights that can guide the development of novel strategies to further enhance the enzymatic breakdown of lignin by microorganisms. Overall, this study has provided a successful strategy and valuable starting point for improving the activity of lignin-degrading enzymes in fungus.",
"introduction": "Introduction Lignin is a significant constituent of lignocellulose, constituting 15–30% of its total mass [ 1 ]. Despite its abundance, lignin has traditionally been considered a waste product in the paper and pulp industry, with its utilization lagging behind that of cellulose and hemicellulose. As the commercialization of lignocellulosic biofuels has led to a surge in waste lignin production, the need for valorization of lignin has become increasingly urgent [ 2 ]. Lignin, as the largest aromatic heteropolymer in nature, holds potential as a renewable source of aromatic chemicals, which are essential for the production of value-added materials, fine chemicals, and pharmaceuticals [ 3 ]. Lignin depolymerization is an important starting point for its valorization, but is challenged by the inherent heterogeneity and recalcitrance of lignin [ 4 ]. Efficient approaches to degrading lignin polymer are critical to maximizing the potential of this valuable resource. Biological depolymerization of lignin using enzymes from microorganisms has emerged as a promising and environmentally friendly alternative, offering advantages such as mild reaction conditions, low energy consumption, and reduced organic chemical requirements [ 5 ]. Despite the natural recalcitrance of lignin, a variety of microorganisms, such as fungi and bacteria, have been found to possess the ability to degrade it. However, their efficiency in breaking down lignin is hindered by inadequate activity of the enzymes responsible for lignin degradation. Various strategies have been utilized to improve the activity of lignin-degrading enzymes. For instance, the consortium composed of Trametes versicolor and other microorganisms has been employed to boost the activity of lignin-degrading enzymes through microbial synergism [ 6 , 7 ]. Additionally, the Chinese herbal medicine Polygonum cuspidatum was used to enhance laccase production in T. versicolor [ 8 ]. Although these studies have provided several feasible strategies, it is still necessary to develop new approaches to improve the activity of lignin-degrading enzymes in microorganisms. The importance of developing new methods lies not only in achieving efficient lignin degradation platforms, but also in gaining a better understanding of the production mechanism of microbial lignin-degrading enzymes. Microorganisms degrade lignin through the secretion of extracellular lignin-degrading enzymes. Oxidative protein folding in endoplasmic reticulum (ER) is essential for the formation of active conformation and secretion of these enzymes [ 9 ]. However, this process also leads to the generation of reactive oxygen species as a byproduct, contributing to ER stress, inefficient protein folding, and activation of the unfolded protein response [ 10 ]. Furthermore, the depolymerization of lignin by lignin-degrading enzymes results in the generation of various free radicals [ 11 , 12 ]. Therefore, the maintenance of the redox homeostasis is crucial for the production of lignin-degrading enzymes and lignin degradation. The addition of an appropriate antioxidant has the potential to regulate microbial redox status and further influence the activity of lignin-degrading enzymes. Ascorbic acid (AA) is widely recognized for its antioxidant properties in free radical-mediated oxidation processes [ 13 , 14 ]. It is believed to play an essential role in maintaining the intraluminal oxidative environment in the ER [ 15 , 16 ]. Besides, AA has been shown to act as a pro-oxidant, enhancing the pro-oxidant activity of copper and iron, which are critical components of important lignin-degrading enzymes such as laccase (Lac) and manganese peroxidase (MnP) [ 17 ]. These suggest that AA has the potential to amplify the activity of microbial lignin-degrading enzymes. The fungus T. versicolor , known for its ability to secrete Lac and MnP, is an efficient microorganism for lignin depolymerization [ 7 , 18 ]. However, the degradation efficiency of T. versicolor is limited by the low activity of its lignin-degrading enzymes. In this study, AA was added into the culture medium of T. versicolor to investigate the impact of antioxidant on enzyme activity. The effects of AA on Lac and MnP activity were examined and analyzed, as well as the rates of lignin degradation, changes in lignin structure, and detailed product mapping. Furthermore, label-free differential proteomics analysis was performed to obtain an in-depth understanding of the molecular mechanisms underlying the AA-enhanced activity of lignin-degrading enzymes. The study demonstrates that the addition of AA is an effective way to enhance the activity of lignin-degrading enzymes, which was more likely to be achieved through reinforcing protein folding and transportation.",
"discussion": "Results and discussion Effect of AA on activity of lignin-degrading enzymes AA is very popular for its antioxidant properties. The effects of AA on physiological processes of various microorganisms have been widely identified [ 26 – 28 ]. In view of this, AA is a good model compound for testing the effect of antioxidant on the activity of lignin-degrading enzymes. Therefore, AA in different concentrations was added into the culture medium of T. versicolor and the activity of lignin-degrading enzymes was analyzed after 10 days of cultivation. The enzymatic activity of Lac and MnP was enhanced in the presence of AA as expected (Fig. 1 a and b), while the cell growth of T. versicolor was not obviously affected (Table S1). Particularly, the highest activity of Lac (10736 U/L) and MnP (8659 U/L) was achieved when the concentration of AA was 1.5 g/L, which was 4.9- and 3.9-fold greater than those of the control sample, respectively. Moreover, it was noted that the activity of lignin-degrading enzymes decreased with further increase of AA concentration up to 2.0 g/L. It might be attributed to the high concentrations of AA lead to the excessive elimination of free radicals [ 29 – 31 ], which commonly exert a series of advantageous physiological effects such as sensing of oxygen tension, enhancement of signal transduction, and oxidative stress response [ 32 , 33 ]. These functions are necessary for maintaining cellular metabolism and inevitably affect the activity of lignin-degrading enzymes. Thus, the delicate balance between the advantageous and detrimental effects is clearly an important aspect of the increased activity of lignin-degrading enzymes driven by antioxidant. Fig. 1 Effects of ascorbic acid addition on lignin-degrading enzyme activity. a - b Effect of ascorbic acid concentration; c - d Enzyme activity in the presence of lignin; e – f Enzyme activity in a 1.0-L scale-up cultivation. Error bars indicate standard deviation The activity of lignin-degrading enzymes was determined in the presence of lignin to further confirm the reinforcement effect of the AA. As shown in Fig. 1 c and d, the addition of AA also produced an enhancement on the activity of Lac and MnP during the whole cultivation at the additive amount for 1.5 g/L. Both Lac and MnP activities were also highest on the 7th day in the cultivation with or without lignin. In the presence of lignin, the highest activity of Lac and MnP was 12694 U/L and 8790 U/L, respectively. The enhancement of Lac and MnP activity was 4.9- and 3.3-fold than those of the control. These outcomes demonstrated that the addition of AA can still enhance the activities of lignin-degrading enzymes in the presence of lignin. Therefore, this strategy could be directly applied to the degradation of lignin. More encouragingly, the activity of lignin-degrading enzymes in the presence of AA was also much higher than those of the control in a 1.0-L scale-up cultivation (Fig. 1 e and f). Bioprocess scale-up is a vital step in process development. Generally, the decrease of indicators such as biological activity, biomass, and product yield was observed during the scale-up process [ 34 ]. The activity of both Lac and MnP was higher in the scale-up cultivation than which in 250‐mL shake flask. It is of great significance to construct a scalable system for the activity enhancement of lignin-degrading enzymes. Lignin degradation and products mapping It is expected that the increase in Lac and MnP activities could indeed enhance the lignin degradation ability of T. versicolor . Thus, the degradation rate and morphological change of lignin in cultivation systems with or without AA were compared. As shown in Fig. 2 a, the lignin degradation rate of the cultivation with AA was determined to be. Fig. 2 Lignin degradation in cultivation systems with or without ascorbic acid. a Lignin degradation rate. b - f SEM images. Error bars indicate standard deviation 35.2%, which was much higher than that of the control group (17.5%). The results of lignin morphological changes obtained through SEM were in good agreement with the experimentally determined degradation rate (Fig. 2 b-f). Changes in the shape and size of lignin suggested that the cultures with AA indeed possessed stronger lignin degradation capability. The particle size of lignin in the cultivation with AA was smaller than those in the control group after 7 days. A more obvious difference was observed after 20 days. The morphology of lignin in the cultivation with AA was more irregular and the particles were more densely packed (Fig. 2 f). To gain a better understanding of the reinforcement of AA on the activity of lignin-degrading enzymes, the molecular weights, chemical composition, and degradation products were identified and characterized by GPC, FT-IR, and GC–MS. As shown in Fig. 3 a and b, the lignin in the sample was continuously degraded and the molecular weights gradually decreased. The original lignin has number-averaged (Mn) and weight-averaged (Mw) molecular weights of 50400 g/mol and 68700 g/mol, respectively. After 7 days of treatment, the Mn and Mw of lignin decreased in both cultivation with or without AA, and further decrease of lignin molecular weights was observed after 20 days of treatment. The difference is that the Mn and Mw of lignin in the cultivation with AA were lower than those in control group. This result implied that the depolymerization of lignin occurred to a greater extent in cultivation with AA. It was further confirmed by the structure changes of lignin. As shown in Fig. 3 c, more new or more changed peaks appeared in the FT-IR spectra of lignin degradation with AA, indicating the lignin in cultivation with AA exhibited more structure changes than the lignin in cultivation without AA. For example, the signals at 1058 cm −1 , 947 cm −1 , and 878 cm −1 were observed only in the lignin cultivated with AA, while the band at 1651 cm −1 , 1544 cm −1 , 1153 cm −1 , 996 cm −1 , and 639 cm −1 showed relatively higher intensity. These bands mainly originated from out-of-plane bending vibration of aromatic C-H groups (996 cm −1 , 947 cm −1 , and 878 cm −1 ), C-H deformation vibrations of aromatic ring (639 cm −1 ), benzene ring skeleton vibration (1651 cm −1 and 1544 cm −1 ), and stretching vibration of the ether bond (1058 cm −1 and 1153 cm −1 ). These results indicated that the lignin in cultivation with AA experienced more substitutions at aromatic ring and more alterations in the connection of the constituent units. Moreover, the increased activity of lignin-degrading enzymes also contributes to the degradation of lignin into smaller products. As shown in Table 1 and Fig. S1, the high molecular weight products such as C 16 H 22 O 4 , C 23 H 32 O 2 , and C 24 H 38 O 4 have a higher content in the cultivation without AA, while a higher content of the low molecular weight compounds including C 6 H 12 O 2 , C 7 H 6 O 2 , C 14 H 22 , and C 11 H 16 O was detected in the cultivation with AA. These results demonstrated that AA-mediated increase in lignin-degrading enzyme activity not only enhances lignin degradation rate, but also encourages further formation of smaller molecules. Fig. 3 Characterization of lignin in cultivation systems with or without ascorbic acid. a Number-averaged molecular weights; b Weight-averaged molecular weights; c FT-IR spectrometry. Error bars indicate standard deviation Table 1 Differential products of lignin degradation identified by GC–MS Retention time (min) Formula Product name Product structure Relative amount a Without AA With AA 5.260 C 6 H 12 O 2 Butyl acetate + + + 14.380 C 7 H 6 O 2 Benzoic acid + + + 14.470 C 14 H 22 1,3-Di-tert-butylbenzene + + + 22.535 C 16 H 22 O 4 Diisobutyl phthalate + + + 24.405 C 16 H 32 O 2 Palmitic acid + + + 26.315 C 18 H 36 O 2 Stearic acid + + + 27.940 C 23 H 32 O 2 6,6'-Methylenebis(2-(tert-butyl)-4-methylphenol) + + + 28.155 C 11 H 16 O 2-(Tert-butyl)-4-methyl phenol + + + 28.925 C 24 H 38 O 4 Bis(2-ethylhexyl) phthalate + + + a + , detected; + + , detected with a higher amount As a selected model antioxidant, AA indeed enhanced the activity of lignin-degrading enzymes and the lignin degradation ability of T. versicolor . In addition to AA, it has been confirmed that a variety of enzymatic antioxidants, non-enzymatic antioxidants, and synthetic antioxidants play a critical role in the cellular metabolism [ 35 , 36 ]. These antioxidants possess the ability to delay oxidation reaction, obstruct the development of free radicals, or break the generation of the autoxidation chain reaction [ 14 , 37 ]. They also act as reducing agents and metal chelators, transforming hydroperoxides and metal prooxidants into stable forms [ 37 ]. The mentioned roles of antioxidants are closely linked to the production of enzymes, the provision of cofactors, the proper folding of proteins, and the secretion of enzymes. Naturally, these antioxidants might produce effects that are comparable to or even superior to those of AA. It is necessary to conduct more extensive screening for effective antioxidants. Proposed mechanism for the enhanced activity of lignin-degrading enzymes The addition of AA was a straightforward approach for enhancing the activity of lignin-degrading enzymes in T. versicolor ; however, it simultaneously raises considerations regarding the economic feasibility and scalability in practical applications. The construction of microorganisms that can autonomously synthesize appropriate amount of AA, or the engineering of microorganisms based on the mechanism of AA enhancing the lignin-degrading enzyme activity, presents a viable alternative to the addition of exogenous AA. To obtain an in-depth understanding of the molecular mechanisms underlying the AA-enhanced activity of lignin-degrading enzymes, label-free differential proteomics analysis was performed. Respectively, 1758 and 2201 proteins were identified in the cultures with AA and the cultures without AA, including 1676 that were common to both groups (Fig. 4 a). Compared with the cultures without AA, a total of 261 differential proteins were identified, of which 179 proteins were significantly up-regulated (fold change > 1.5 and p-value < 0.05) and another 82 proteins were significantly down-regulated (fold change < 0.6 and p-value < 0.05), respectively (Fig. 4 b). KEGG pathway enrichment analysis showed that the differential proteins mapped to metabolism were mainly enriched in the carbohydrate metabolism and amino acid metabolism (Fig. 4 c). Meanwhile, several ribosomal proteins, protein translation factors, and amino acid-tRNA ligases were up-regulated (Fig. 5 a and Fig. S2). Hence, it was originally speculated that the increase in Lac and MnP activities was mainly caused by the enhancement of their expression, benefiting from the improvement in carbohydrate metabolism and amino acid metabolism driven by AA addition. However, the expression level of both Lac and MnP did not show significant changes (Table S2). Obviously, the AA-enhanced activity of Lac and MnP was not achieved by simply or directly changing their intracellular expression levels. Fig. 4 Label-free differential proteomics analysis. a Overlap of the identified proteins between sample with AA and without AA; b Volcano plot of differential proteins; c Differential protein pathway classification Fig. 5 Proposed mechanism for the reinforcement of AA on the activity of lignin-degrading enzymes. a Distribution of differential proteins; b PDI activation by DHA and disulfide bond formation; c AA-mediated alteration of the redox state of copper and iron. ER Endoplasmic reticulum, GA Golgi apparatus, GSH Glutathione, GSSG Oxidized glutathione, DHA Dehydroascorbic acid, PDI Protein disulfide-isomerase tigA, PPI Peptidyl-prolyl cis–trans isomerase. Red arrow, site with up-regulated protein Further analysis revealed that the impact of AA on cellular processes is mainly reflected in transport and catabolism, while the genetic information processing associated with the differential proteins mainly involved in the translation, folding, sorting and degradation (Fig. 4 c). In particular, the differential proteins involved in the assistance of the newly synthesized polypeptide folding and prevention of the misfolded protein aggregation were found to be up-regulated in the presence of AA (Fig. 5 a and Fig. S2). The up-regulation of these proteins was able to help more lignin-degrading enzymes to be able to form the correct structure faster. Particularly, the predicted structure of Lac and MnP from T. versicolor contains multiple disulfide bonds. The up-regulation of protein disulfide-isomerase (PDI) and peptidyl-prolyl cis – trans isomerase (PPI) could promote the correct folding of Lac and MnP because PDI plays pivotal roles in disulfide bond formation of proteins, while the efficiency of PDI is markedly improved by PPI [ 38 , 39 ]. As shown in Fig. 5 b, the contribution of AA to this positive effect was mediated by the oxidized AA form dehydroascorbic acid (DHA), which could act as an activator of PDI [ 40 ]. Furthermore, the up-regulation of hydroxyacylglutathione hydrolase and thioredoxin reductase, both of which are involved in the synthesis of glutathione (GSH), was also observed. One of the basic roles of GSH is to restore AA via AA-GSH cycle (Fig. 5 b). It is noteworthy that DHA is also reduced back to AA in the process of PDI‐mediated disulfide bond formation. AA regeneration through the above two pathways is also beneficial for ER to exert its protein synthesis and folding functions properly, because the antioxidant effect of AA could efficiently scavenges reactive oxygen species formed in oxidative protein folding maintaining the intralumenal redox homeostasis [ 17 ]. It is important for promoting the formation of active Lac and MnP. The up-regulation of proteins associated with the protein transportation and the regulation of cell membrane was also identified (Fig. 5 a and Fig. S2). It is generally recognized that the extracellular secretion capacity represents a major hurdle in microbial-driven lignin conversion. The up-regulation of proteins associated with protein transportation and cell membrane is bound to enhance the secretion of Lac and MnP, consequently resulting the promotion of the lignin-degrading ability of T. versicolor . In addition, the expression of coproporphyrinogen oxidase, which is engaged in the heme synthesis, was found to be up-regulated (Fig. 5 a and Fig. S2). It is beneficial for the active structure formation of MnP as heme is an essential cofactor of MnP. Besides, as a reducing agent, AA is able to reduce catalytic metals such as Fe 3+ and Cu 2+ to Fe 2+ and Cu 1+ (Fig. 5 c). Meanwhile, the reduced copper could transfer an electron to iron [ 41 ]. The alteration of the redox state of copper and iron by AA addition was also the positive factor for the active conformation formation of Lac and MnP. The reason is that Cu 2+ is essential component of active Lac, while Fe 2+ is an important raw material for the synthesis of MnP cofactor heme. Moreover, glycosylation is one of the most important post-translational modifications and has a significant effect on the structure and functions of proteins [ 42 ]. It was found that the differential proteins associated with the protein glycosylation were up-regulated (Fig. 5 a and Fig. S2). Several potential glycosylation sites were predicted in the Lacs of T. versicolor . Thus, it was speculated that the enhancement of Lac activity was partially benefits from the strengthening of glycosylation. The results of proteomics analysis provided information for us to find the mechanisms underlying the AA-enhanced activity of lignin-degrading enzymes. Taken together, the activity enhancement of lignin-degrading enzymes was more likely to benefit from the reinforcement of AA on the protein folding and transportation rather than change enzyme expression levels. The proper folding and effective secretion of lignin-degrading enzymes are critical determinants of the lignin degradation capacity of microorganisms [ 43 – 45 ]. Enhancing these processes is generally advantageous for improving microbial lignin degradation capability. Therefore, the enhancement of AA on the lignin degradation ability of T. versicolor did not appear to be specific, suggesting that this approach holds potential for application in other lignin-degrading microorganisms."
} | 6,071 |
28667277 | PMC5493639 | pmc | 9,442 | {
"abstract": "The wetting characteristic of a metal surface can be controlled by employing different coating materials and external stimuli, however, layer number ( n ) modulated surface swapping between hydrophobicity and hydrophilicity in a multilayer structure to achieve prolonged anti-corrosion ability was not taken into consideration. In this study, we proposed a layer-by-layer (LbL) spin assembled polyaniline-silica composite/tetramethylsilane functionalized silica nanoparticles (PSC/TMS-SiO 2 ) coating with the combined effect of super-hydrophobicity and enhanced anti-corrosion ability. Interestingly, the hierarchical integration of two coating materials with inherently different surface roughness and energy in a multilayer structure allows the wetting feature to swap from hydrophobic to hydrophilic state by modulating n with decreasing hydrophilicity. The samples with odd n (TMS-SiO 2 surface) are hydrophobic while the samples with even n (PSC surface) exhibits the hydrophilic character. The TMS-SiO 2 content was optimized to achieve super-hydrophobic coating with significantly high water contact angle (CA) 153° ± 2° and small sliding angle (SA) 6° ± 2°. Beside its self-cleaning behavior, the electro-active PSC/TMS-SiO 2 coating also exhibits remarkably enhanced corrosion resistance against aggressive media. The corrosion resistance of the coating was remained stable even after 240 h of exposure, this enhancement is attributed to super-hydrophobicity and anodic shift in corrosion potential.",
"conclusion": "Conclusions In this work, a facile approach was used to impart super-hydrophobicity on the SS surface by integrating two materials with different surface energy, i.e., PSC and TMS-SiO 2 in LbL multilayer fashion by using spin assembly. The unique integration of two materials leads the coating’s surface to swap between hydrophobic and hydrophilic state by tuning n and this swapping can be controlled over a wide range. The high CA (153° ± 2°) with very small SA (6° ± 2°) reveals the super-hydrophobic and self-cleaning ability which is due to the synergy of surface composition and roughness of the coating. The super-hydrophobic PSC/TMS-SiO 2 multilayer coating exhibits enhanced corrosion resistance compared to hydrophilic PDDA/PSC coating. Interestingly, the long-term EIS results reveal that the high corrosion resistance of the coating is stable even after 240 h of immersion in 3.5% NaCl and no drastic degradation was observed as compared to uncoated samples. The excellent corrosion protection was attributed to the synergistic effect of super-hydrophobicity and redox catalytic behavior of PANI. Different mechanisms were proposed for long-term protection, including excellent barrier ability and water repellent property of TMS-SiO 2 layer in combination with PANI that induce an anodic passivation followed by the formation of an oxide layer. This type of coating is a potential candidate for long-term protection in corrosive environment and it can be employed as a conventional engineering material where swapping in surface wettability is required.",
"introduction": "Introduction Corrosion is a thermodynamically pivotal process which consumes 3% of the world gross domestic product (GDP) annually 1 , 2 . This process would not only affect the world’s economy but also lead to harmful impact on industry and human societies. Among different alloys and metals, stainless steel (SS) and iron are the most extensively used material in industries due to its good mechanical strength 3 , 4 ; however, they are prone to corrosion due to their prominent electrochemical activity. It is well-known that corrosion is hard to prevent, hence it is strongly desired to decelerate the corrosion reactions and alter its kinetics by changing the mechanism involved in it 3 , 5 . As an alloy, SS contains chromium in its composition which reacts with the atmospheric oxygen to form a passive oxide layer. This oxide layer retains the surface integrity of the SS, in spite of this chloride ions could penetrate through the porous oxide layer and initiates corrosion 6 , 7 . However, treatment of SS with chromates is forbidden due to hazardous environmental concerns associated with its usage 8 , 9 . Therefore, SS is not encouraged for applications where chloride containing environment is present unless it is protected with a particular coating. One of the common practices is the development of conductive polymeric (CP) coatings to protect metal from aggressive enviornment 10 – 12 . Among these, polyaniline (PANI) coating plays a vital role, due to its redox catalytic ability which contributes to the formation of an oxide layer on a metal surface, thus improves its corrosion resistance 13 , 14 . On the other hand, CP based coatings have failed to protect metal for prolonged time due to its porous nature which allows the diffusion of some corrosive species, i.e., atmospheric oxygen, chloride ions and water 15 , 16 . In contrast, the inorganic-organic hybrid coating with super-hydrophobic property would not only contribute to increase the corrosion resistance of the metal with excellent barrier ability but also introduce self-cleaning ability as well. Over the past few years, super-hydrophobic surfaces inspired from highly functional and exceptional natural designs such as “lotus leaf” were attracting researchers to gain maximum monetary benefits 17 , 18 . The super-hydrophobic surfaces exhibits high static contact angle (CA) greater than 150° and small sliding angle (SA) less than 10° 19 . The two important factors i.e., low surface energy material and surface roughness contributes to the biomimetic super-hydrophobic structure which assist researchers to develop artificial super-hydrophobic surfaces with modulated wettability 20 , 21 . Furthermore, it is desirable to control the swapping of solid surface between the hydrophilic and hydrophobic states via external stimuli 22 , 23 , which is important for many applications such as self-cleaning 24 , antifogging, oil/water separations 25 , anti-reflection 26 , and anti-corrosion 27 – 29 . For reversible surface wettability, the material should inherently have the ability to swap between hydrophobic and hydrophilic states as a function of external stimuli before any modification in surface roughness. However, a limited number of materials are available with this unique property and required specific fabrication method against different stimuli. Therefore, a general method is desired to fabricate materials with different wettability which can be controlled by an internal or external factor. This control on surface wetting characteristic would provide a controlled diffusion of electrolyte within the coating and hence one can tune the coating to protect the metal surface for prolonged time. Recently, few attempts have been made to impart super-hydrophobicity on metal surface for corrosion protection by employing electro-active polymer and epoxy coatings using nano-casting technique 30 – 32 . However, the nano-casting method involves complex steps and the fabricated coatings are not capable of surface wettability switch with lack of long-term protection ability. On the other hand, the layer-by-layer (LbL) assembly of polymers is one of the versatile approaches to modify the surface properties of the substrate 33 . The most facile strategy to increase the surface roughness of the LbL polymers is the addition of inorganic nanoparticles (NPs) followed by surface hydrophobization to obtain controlled wetting property 34 . The sum up is, LbL polymer coating without inorganic additives and lack of controllable water repellent ability not able to protect the metal surface against aggressive environment for long-term. Therefore, it is strongly desired to develop a defect free coating with the combined effect of super-hydrophobicity and CP redox catalytic ability for long term corrosion protection of SS by a facile coating technique which provides a control over surface wettability. In our previous publications, we proposed a facile and robust layer-by-layer (LbL) method to develop polyelectrolyte multilayer coatings to achieve enhanced corrosion protection for SS with PANI redox catalytic ability 35 and self-healing 36 . However, PANI based super-hydrophobic composite coatings with modulated surface wettability for anti-corrosion application were rarely reported 31 , 37 . In this work, we demonstrate the fabrication of PSC/TMS-SiO 2 super-hydrophobic LbL multilayer coatings with controlled wettability for prolonged corrosion protection of the SS by spin-assembly. Our proposed strategy has several advantages such as, the co-assembly of two materials PSC and TMS-SiO 2 with different surface roughness and energy in a multilayer fashion would allow layer number ( n ) to act as a switch to modulate surface wettability; the change in hydrophobicity to hydrophilicity can be controlled over a wide range; n can be used to control the swapping and this control is tunable to achieve self-cleaning ability; the super-hydrophobic coating with redox catalytic ability twofold the corrosion performance of metals for a long period of time due to enhanced barrier ability.",
"discussion": "Results and Discussion Figure 1 displays the schematics for the synthesis of PSC composite and modification of silica particles into TMS-SiO 2 spheres with their respective coating solution and the fabrication process of PDDA/PSC and PSC/TMS-SiO 2 multilayers. Figure 1 The schematic shows the synthesis of ( a ) PSC composite and preparation of its coating solution, ( b ) surface modification of silica to obtain TMS-SiO 2 NPs. Fabrication of ( c ) PDDA/PSC and ( d ) PSC/TMS-SiO 2 multilayers on 316SS by spin assembly. \n Characterization of Coating Material The formation of PANI and its PSC composite was confirmed by the FTIR spectra in Fig. S1a and S1b (Supplementary Information). The peaks at 1346 and 1615 cm −1 were assigned to C=C stretching of benzenoid and quinoid rings 38 . The bands at 1163 and 823 cm −1 in Fig. S1a were attributed to the C-H bending vibration and primary amines, respectively 18 . The peak at 1099 cm −1 was attributed to the symmetric stretching of Si-O-Si in Fig. S1b , S1c and S1d . The presence of bands related to PANI and SiO 2 in PSC spectra implies the formation of the PSC composite (Fig. S1b ) and Fig. S1e shows the surface modification of SiO 2 particles with HDMS. Both the spectra in Fig. S1c and S1d shows a broad band around 3435 cm −1 and the weak band at 1630 cm −1 attributed to the presence of little water in the sample 39 . In Fig. S1d , the peaks at 2835 and 2780 cm −1 corresponds to asymmetric and symmetric CH stretching (magnified inset of Fig. S1c and S1d ), these peaks confirms the surface modification of SiO 2 particles with TMS 40 , 41 . The presence of Si(CH 3 ) 3 rocking vibration was confirmed by the weak peak at 785 cm −1 \n 40 . These results would not only confirm the formation of PSC composite but also affirm the successful surface functionalization of SiO 2 particles with TMS. The morphology of silica spheres (SiO 2 ) and TMS functionalized SiO 2 spheres (TMS-SiO 2 ) is shown in Fig. S2a and S2b , respectively. The surface of TMS-SiO 2 particles is still smooth without any aggregation after modification and this transformation is clearly observed in the SEM images with the increase in particle size (Fig. S2b ). The SiO 2 and TMS-SiO 2 spheres are uniform in size and their size distribution was illustrated in the histograms Fig. S2c and S2d , respectively. The diameter of SiO 2 and TMS-SiO 2 is 415 ± 30.28 nm and 495 ± 30.28 nm, respectively, based on 60 randomly selected spheres from Fig. S2a and S2b . It can be seen that in both the histograms the size distribution width is relatively small as compared to previously reported SiO 2 \n 42 , 43 . It is postulated that the morphology of the spheres is in correspondence with the optimized conditions and the equilibrium in particle growth was obtained which results in uniform size of the spheres. Fig. S2e and Fig. 2f shows the SEM images which confirm the formation of PSC composite at low and high magnification, respectively. The synthesized PSC comprises of PANI matrix that exhibits globular morphology with the incorporation of uniformly distributed SiO 2 (Fig. S2f ). These images confirm that the globular space in PANI matrix is occupied by the SiO 2 particles during chemical oxidative polymerization and these results are in agreement with the previously reported PANI-SiO 2 composites 43 , 44 . Figure 2 SEM images of ( a ) PDDA/PSC and ( b ) PSC/TMS-SiO 2 coatings, elemental mappings of ( c ) PDDA/PSC and ( d ) PSC/TMS-SiO 2 coatings, EDX spectra of ( e ) PDDA/PSC and ( f ) PSC/TMS-SiO 2 coatings, respectively. \n It is important for inorganic nano-particles that they should be homogeneously distributed in the coating matrix; otherwise the fabricated coating would exhibit agglomeration and affect the coating’s long term protection ability. In order to investigate the interaction of SiO 2 particles with PANI matrix the TEM images were analyzed, as shown in Fig. S3 . The SiO 2 particles were aggregated in ethanol solvent because of the interaction between the hydroxyl groups present on the surface (Fig. S3a and S3b ). Contrary to this, the effect of hydroxyl groups associated with SiO 2 particles in PSC was suppressed with a homogeneous distribution in PANI matrix and the transparent PANI layer connecting the silica particles (dark black spheres) in a network (Fig. S3c ). It is clear in the image at high magnification (Fig. S3d ), that the PANI layer would make a conductive connection within the SiO 2 particles and allow them to be homogeneously distributed in a matrix. These properties of the PSC composite in solvent would suggest its potential application as an excellent coating material. The thermogravimetric curves of PANI, PSC, SiO 2 and TMS-SiO 2 were represented in Fig. S4 . Generally, the 16% weight loss at 150 °C was due to the presence of moisture in pure PANI. Later on, the deterioration of HCl was noticed within the temperature range of 200–300 °C accompanying with 5% weight loss and the complete degradation of the polymer was observed at 300–650 °C with the final weight loss of 74% (Fig. S4 ). Contrary to this, SiO 2 and TMS-SiO 2 particles show the complete weight loss of 15% and 13%, respectively, which implies that the particles exhibit excellent thermal stability. In case of PSC, 14% weight loss was observed at 150 °C and 3–4% of weight loss between 200–300 °C. The complete degradation of the PSC composite was observed with final weight loss of 35%, which is much less than the weight loss observed for pure PANI. The residue in the temperature range of 500 to 800 °C determines the approximate filler content in PANI matrix 44 and only 20% weight loss was observed in this region for PSC composite. On the basis of TGA the weight of SiO 2 particles incorporated in the PANI matrix was estimated to be 45%, which is less than the actual content of the silica particles added in the initial reaction mixture. These results indicate that the addition of SiO 2 in PANI matrix increases the thermal stability of the PSC and its LbL fabrication with TMS-SiO 2 particles could be considered as a good candidate for protective coatings. Characterization of Coatings The SEM images of PDDA/PSC and PSC/TMS-SiO 2 coatings are shown in Fig. 2 . It was found that the SiO 2 particles were homogeneously distributed in PANI matrix, however, the matrix exhibits hierarchical porous network (Fig. 2a ). In contrast, the TMS-SiO 2 layers disguised the hierarchical porosity of PSC and its influence become predominant in the PSC/TMS-SiO 2 coating (Fig. 2b ). The hierarchical porous structure of PDDA/PSC coating influenced the elemental distribution of C, N, O and Si with the inhomogeneous allocation as shown in the EDX mapping (Fig. 2c ). However, the homogenous elemental distribution was observed in the PSC/TMS-SiO 2 coating (Fig. 2d ). The elemental EDX spectra shows that the elements associated with PANI i.e., C and N were observed with strong peak intensity in the PDDA/PSC coating (Fig. 2e ) as compared to the PSC/TMS-SiO 2 coating (Fig. 2f ). The high intensity peaks associated with oxygen and Si in PSC/TMS-SiO 2 coating as compared to PDDA/PSC coating implies that the TMS-SiO 2 layers play a leading role with dominant Si peak intensity. These results indicate that the combination of PSC and TMS-SiO 2 layers in a multilayer structure would exhibit a synergistic effect of both the layers to produce a uniform protective coating. The oxide layer on 316SS surface beneath the PDDA/PSC and PSC/TMS-SiO 2 coating was analyzed by XPS spectra. The XPS spectra of the oxide layer associated with both the coatings contain Fe2p 3/2 , Cr2p 3/2 , and O1s as the leading constituents 45 , as shown in Fig. 3 . The peak at 576 eV in Fig. 3a and b is attributed to the element chromium which was further analyzed to obtain the different ionic states. In case of PDDA/PSC coating, the peak intensity of Cr(OH) 3 is higher than the Cr 2 O 3 and same phenomenon was observed in the PSC/TMS-SiO 2 coating. However, the transformation of Cr(OH) 3 into Cr 2 O 3 would take place in PSC/TMS-SiO 2 coating which results in low intensity of Cr(OH) 3 and high intensity of Cr 2 O 3 peak. The presence of pores in PDDA/PSC coating allows water to quickly come in contact with the SS surface which causes a reaction between water and chromium hydroxide 46 . This phenomenon would accelerate the deterioration of the oxide layer in PDDA/PSC coating in contrast to the stable PSC/TMS-SiO 2 coating. Figure 3 Cr2p3/2, Fe2p3/2, O1s XPS spectra of PDDA/PSC ( a , c , e) and PSC/TMS-SiO 2 coating ( b , d , f ). To analyze different ionic states, the corresponding elemental fitting of Cr, Fe and O elements were performed as represented by orange lines. \n The peak at about 707 eV is attributed to the element iron and its peak intensity in the oxide layer of PDDA/PSC coating (Fig. 3c ) is higher than the PSC/TMS-SiO 2 coating (Fig. 3d ). However, the peak intensity of FeO in PSC/TMS-SiO 2 coating is high as compared to FeOOH, while an opposite trend was observed in the PDDA/PSC coating. This indicates that the dissolution of iron was occurred in steel alloy during the early stages of anodic passivation leading to the flux of oxides which causes a passivation of residual current 47 . The peak at about 533 eV in Fig. 3e and f is attributed to oxygen (O1s). The peak intensity of − OH in the oxide layer of PDDA/PSC coating (Fig. 3e ) is higher than the PSC/TMS-SiO 2 coating (Fig. 3f ); however, the peak associated with O 2− represents the opposite tendency. The peak attributed to water shows high intensity in PDDA/PSC as compared to PSC/TMS-SiO 2 coating, which implies that the oxide layer beneath the latter one is thicker 48 . The PSC/TMS-SiO 2 coating is homogeneous therefore thicker oxide layer was formed which hinders the pathway of water and significantly protects the SS surface. Contact and Sliding Angle Measurement The surface wettability of the coatings was examined by evaluating the contact angles (CAs) of water droplets. The same coating with different regions was dispensed with at least three droplets in order to attain a reliable CAs. Insets of Fig. 4a shows the images of water droplet on PSC/TMS-SiO 2 coating (at n = 29) and increasing trend in CAs was observed with TMS-SiO 2 content. At 1 wt% TMS-SiO 2 , the coating exhibits hydrophobic behavior with CA = 125° ± 2°, but the increasing content of TMS-SiO 2 allows the coating to achieve super-hydrophobicity with CA = 153° ± 2° at 5 wt%. The surface wettability of the coating was greatly influenced by TMS-SiO 2 loading and optimized at 5 wt% because further increase in loading would cause agglomeration and surface defects in the coating. Figure 4 Contact angles (CAs) and sliding angles (SAs) of water droplet on ( a ) PSC/TMS-SiO 2 coating with different content of TMS-SiO 2 and corresponding CA images as insets, ( b ) layer number ( n ) modulated reversible surface wettability between hydrophobic and hydrophilic CA as a function of n , ( c ) Fitting of CAs at odd and even n , ( d ) SEM image of PSC/TMS-SiO 2 coating with the inset of CA image. \n In addition to CAs, Fig. 4a also represents the sliding angles (SAs) calculated by tilting the PSC/TMS-SiO 2 surface, sustaining a water droplet until it rolls off. We observed that the surface coated with 5 wt% TMS-SiO 2 shows extremely low SA, i.e., 6° ± 2° and exhibits the exceptional self-cleaning ability. The SAs decreases with increasing TMS-SiO 2 content (Fig. 4a ), because at low content the particles were irregularly distributed which results in low surface roughness ( S \n a ) of the coating. In contrast, as the content of TMS-SiO 2 increases the particle distribution on the surface become homogeneous and the roughness reached to tens of micrometers (Table S1 ). These results suggest that the TMS-SiO 2 content plays a key role to produce a hierarchical surface with roughness of nano to micrometer scale, thereby results in super-hydrophobic surface with the self-cleaning ability. Swapping Behavior of Surface Wettability Fig. 4b shows the wettability swapping behavior of the PSC/TMS-SiO 2 multilayers which is tunable with n . The surface layer in multilayer coatings determines the CAs, hence the even (6, 10, 14, 18, 22, 26) and odd (7, 11, 15, 19, 23, 27) n represent the PSC and TMS-SiO 2 as a surface layer, respectively. The odd layered surfaces show hydrophobic tendency and the even layered surfaces exhibit hydrophilic tendency. Interestingly, the wettability of the surface is continued to swap between hydrophilic and hydrophobic states with increasing n . The LbL multilayer structure of the PSC/TMS-SiO 2 coating can be tuned in a reversible fashion by controlling n . With increasing n , it was observed that the hydrophobic character of the coating with odd n continues to increase while the hydrophilic character of the coating with even n continuously decreases (Fig. 4c ). The CA associated with coatings of odd and even n was fitted with a straight line having a linear regression coefficient ( R \n 2 ) equal to 0.987 and 0.958, respectively. The closely packed TMS-SiO 2 surface layer can be obtained at n = 29 (Fig. 4d ) which exhibits super-hydrophobicity and follows the Cassie state 49 with CA = 153° ± 2° (inset of Fig. 4d ). Mechanism of Surface Wettability and Swapping The CA is a measure of surface wettability of the coating and in case of PSC/TMS-SiO 2 multilayers it exhibit two different trends 50 , as shown in Fig. 5 . The CAs in regime I, II and III at n = 14, 22 and 26 displays hydrophilic character (Wenzel state) 51 due to the presence of PSC as surface layer with pores. However, at n = 15, 23 and 27 the TMS-SiO 2 as surface layer allows the air to trap beneath the water which cause a decrease in solid-liquid contact area and makes the surface hydrophobic (Cassie state) 51 . In regime-I at n = 14, the water droplet was quickly spread on the surface with CA = 13.57° ± 1° (inset of Fig. 5a ). The porous PSC layer with inhomogeneous hills and valleys (Fig. 5a ) increases the solid-liquid contact area and affirms its hydrophilic nature, i.e., fully wetted Wenzel state. This inhomogeneous PSC layer would also affect the deposition of subsequent TMS-SiO 2 layer ( n = 15) and its surface wettability. Either the TMS-SiO 2 surface layer is hydrophobic with CA = 118° ± 2° (inset of Fig. 5b ), but due to the presence of underlying porous hydrophilic PSC layer the water would try to diffuse and affects the surface wettability (Fig. 5b ). In regime-II at n = 22, the PSC surface layer exhibits improved CA = 45° ± 1° (inset of Fig. 5c ) as compared to n = 14 and this increase was due to the prominent exposure of underneath TMS-SiO 2 layer (Fig. 5c ). At n = 23, the surface becomes hydrophobic with CA = 129° ± 3° (inset of Fig. 5d ), but the presence of defects preventing the surface to achieve super-hydrophobicity (Fig. 5d ). In regime-III at n = 26, the increase in CA was observed, i.e., 64° ± 1° (inset of Fig. 5e ) due to the dominating effect of underlying TMS-SiO 2 layer, as seen in Fig. 5e . In contrast, at n = 27 the TMS-SiO 2 layer with increased hydrophobicity CA = 136° ± 2° (inset of Fig. 5f ) was due to homogeneous structure and the particles becomes closely packed. This behavior is attributed to the large volume of air held between the water and the TMS-SiO 2 spheres (Fig. 5 , at n = 27), hence precludes the intrusion of water droplets within the nanopores 52 . Figure 5 Schematic illustrations of the possible PSC/TMS-SiO 2 coating-liquid contact modes in regimes I–III with surface wetting reversibility between hydrophilic ( n = 14, 22, 26) and hydrophobic ( n = 15, 23, 27) states. SEM image of PSC/TMS-SiO 2 coating with their CA image as inset at odd n ( a , c , e ) and even n ( b , d , f ). \n The average surface roughness ( S \n a ) is one of the most widely used roughness parameter gives the arithmetic average of the absolute values of the roughness profile ordinates 53 . The surface roughness parameter S \n a is available in Detak software which is used to represent roughness and the standard deviation associated with three measured values of the same sample at different positions was presented as error margins in Table S2 . The surface morphology of the coating at different n reveals that the S \n a and wettability is the inherent property of the material while wettability swap is due to the constituents of the surface layer altered by n . The S \n a values of PSC/TMS-SiO 2 coating were measured with respect to different n and summarized in Table S2 . The S \n a values are in agreement with the surface morphology represented in Fig. 5a–f ; moreover S \n a is a function of n and its value decreases with increasing n (Table S2 ). It was observed that the coating at lower n i.e., n = 14 and 15, exhibits high, S \n a values, i.e., 20.17 ± 0.41 and 15.63 ± 0.31 µm, respectively. The difference of roughness between two subsequent layers is high due to the porous and the inhomogeneous structure of PSC layer which is clearly observed in Fig. 5a and b . However, with increasing n the surface becomes homogeneous and the effect of TMS-SiO 2 layer become dominant compared to porous PSC layer. Finally, at n = 26 and 27, the difference of roughness between two subsequent surface layers becomes small i.e., 11.29 ± 0.34 and 10.03 ± 0.42 µm, because the TMS-SiO 2 layer become dominant with S \n a values in tens of microns to achieve the super-hydrophobicity (Fig. 5f ). The interaction between the PSC layer (hydrophilic) and the underlying TMS-SiO 2 layer (hydrophobic) lead to different amounts of the layer constituents exposed on the surface at lower n . Surprisingly, the wetting phenomenon can be swapped by tuning n but the dominant effect of hydrophobic TMS-SiO 2 layer enhance the hydrophobic behavior consequently decreases the hydrophilic behavior of the coating with increasing n . This continuous increase in hydrophobicity would allow the PSC/TMS-SiO 2 coating to successfully attain a Cassie state with super-hydrophobic surface CA = 153° ± 2° (Fig. 4d ). These results imply that the liquid repellency of PSC/TMS-SiO 2 multilayers can be steadily tuned by varying the loading content of TMS-SiO 2 and the swapping between hydrophobic and hydrophilic state can be achieved by altering n . In addition, the thickness of the coating was also measured with respect to n and the values were found to be the function of n . The difference of thickness between the two coatings with even and odd n is larger at low n (i.e., between n = 14 and n = 15) than the difference at high n (Table S2 ). This is in agreement with the surface roughness data which also shows a high roughness at low n and decreases with increasing n due to the surface homogeneity achieved by the coating as a function of n (Fig. 5a–f ). The lotus leaf exhibits the self-cleaning effect which is considered as a unique case of Cassie’s state 51 . This unique property is also termed as “lotus effect” in which the rolling of water droplets would collects the contaminants from the lotus surface and enables its self-cleaning effect 54 . Inspired from this fact, the self-cleaning effect of PSC/TMS-SiO 2 multilayers was studied. The PSC/TMS-SiO 2 surface, sustaining a water droplet was tilted at respective SAs and the rolling behavior of the droplet was observed (Fig. 6 ). Figure 6a shows the PSC/TMS-SiO 2 surface at SA = 0° and when it was tilted at SA = 2° ± 1° the droplet feels a little force (Fig. 6b ) followed by tilting the surface to reach SA = 4° ± 2° (Fig. 6c ), here the sliding force becomes saturated. The maximum SA required by the PSC/TMS-SiO 2 surface to roll off the water droplet is 6° ± 2°, as shown in Fig. 6d . The PSC/TMS-SiO 2 coating with CA = 153° ± 2° (supported by the inset of Fig. 4d ) exhibits super-hydrophobicity and its water repellent rough surface with low SA of 6° ± 2° showcase the coating’s self-cleaning ability. These results imply that, the solid-liquid contact area was minimized that allows the formation of a spherical water droplet to rolls off at SA = 6° ± 2° (Fig. 6d ) taking the contaminant particles with it. In addition, Video S1 also demonstrates the sliding behavior of PSC/TMS-SiO 2 surface and the water droplet will eventually roll off at SA = 6° ± 2°. If the coating surface is stabilized at the sliding angle of 8°, there is a continuous rolling of water droplet was observed as shown in Video S2 . To further support the rolling behavior of water droplet, we captured a real time Video S3 . In this video, the PSC/TMS-SiO 2 coated 316SS coupon was placed on the tilted glass slide with approximate SA of 10° ± 3° and water was continuously dropped with a micropipette. It was observed that the water droplet continues to slide on the surface without resistance owing to the super-hydrophobicity and self-cleaning ability of the coating. These results reflect that the excellent self-cleaning ability of the coating could be achieved by reducing the adhesion of water droplets at the solid-liquid interface. Figure 6 The self-cleaning behavior of water droplet on PSC/TMS-SiO 2 coating at different SAs ( a ) 0°, ( b ) 2° ± 1°, ( c ) 4° ± 2° and ( d ) 6° ± 2°. \n Physical properties of the coating The primary feature to satisfy the advanced anti-corrosion performance of the coating is the superior physico-mechanical properties 55 , 56 . The adhesion and barrier properties of the coatings are presented in Table 1 . The films with 1 wt% and 2 wt% TMS-SiO 2 show high degree of adhesion due to the dominant effect of PSC as observed in the similar cases previously reported 55 , leading to improved compatibility with the substrate. However, with increasing content of TMS-SiO 2 i.e., 3–5 wt% a slight decrease in adhesion degree was observed as compared to 1–2 wt%. The combination of TMS-SiO 2 with PSC reduces the elasticity and ductility effect attributed to coating matrix, hence maintains the mechanical strength of the films. These results imply that the addition of TMS-SiO 2 makes the coating harder with good mechanical strength due to virtuous compatibility with the composite. Table 1 The physical properties of PSC/TMS-SiO 2 film as a function of TMS-SiO 2 content. TMS-SiO 2 content (wt%) Adhesion degree Oxygen permeability (%) Vapor permeability (g/hm 2 ) 1 4B 0.75 96.12 2 4B 0.64 84.57 3 3B 0.55 77.39 4 3B 0.42 64.24 5 3B 0.34 55.19 \n The optimum size and shape of the particles along with their homogenous distribution in the coating matrix affect the barrier properties of the coating 57 . The gas and water vapor permeability of PSC/TMS-SiO 2 free standing films are summarized in Table 1 . It was found that in the presence of 1 wt% TMS-SiO 2 the film exhibits high oxygen and water permeability i.e., 0.75% and 96.2 g/hm 2 , as compared to 5 wt% TMS-SiO 2 film which shows a remarkable reduction in molecular permeability values 0.34% and 55.19 g/hm 2 . The molecular permeability of the films is a function of TMS-SiO 2 content and its presence in the coating increases the tortuosity of diffusion pathway of oxygen and water molecules 58 . The profound increase in barrier ability was attributed to good compatibility of the composite and TMS-SiO 2 spheres dispersed as nanolayers in the composite 57 , 58 . To determine the influence of pH on surface wettability and durability of the PSC/TMS-SiO 2 coating, the samples (at n = 29) were immersed in a solution of pH range 1–5 (pH adjusted with 0.1 M HCl) for 15 min followed by vacuum drying. The change in surface wettability parameters of pretreated samples as a function of pH are presented in Table S3 , each reading is an average of three values. The hydrophobic character of the coating increases with pH, at pH = 1 the coating exhibits hydrophobicity with CA = 110° ± 3.3° and SA = 55° ± 1.65°, as the pH of the solution become less acidic (pH = 5), the surface recovers its super-hydrophobicity with CA = 151° ± 1.5° and SA = 9° ± 0.45°. This change in hydrophobic character is due to decrease in surface roughness and transformation in surface hydration process under the influence of acidic pH. However, the coating maintains its hydrophobicity even after being exposed to acidic medium which indicates the durability of the coating. Electrochemical and Corrosion Resistance Measurements The electrical activity of the coated and uncoated samples was recorded as cyclic voltammograms. As shown in Fig. S5a , the absence of any peak in the potential range 0–1 V of uncoated samples indicate lack of redox activity. In contrast, the voltammogram of the PSC/TMS-SiO 2 coating exhibits oxidation peak, which is attributed to the transformation of emeraldine salt (ES) to pernigraniline base (PB) in the potential range 0.65–0.80 V. The mechanism involved in this transformation is shown in Fig. S5b and the reduction peak during the cathodic scan is attributed to the reversal process (0.2–0.4 V). Although, there is a combination of PSC layer with subsequent TMS-SiO 2 layer in a multilayer structure, but the coating still maintains the electroactivity of PANI polymer. Because of its redox catalytic properties, conjugated PANI considered as a potential material for anti-corrosion coating that allows the formation of a passive metal oxide layer and offers an effective corrosion resistance for metals 59 . We therefore envisioned that the PSC/TMS-SiO 2 coating significantly enhanced the corrosion resistance due to the synergistic effect of passive metal oxide layer and super-hydrophobicity which offers an effective barrier against the invasion of aggressive media (as supported by physical properties). The polarization curves of uncoated and coated 316SS in 3.5% NaCl is shown in Fig. 7a with their respective CA images as insets. The PDDA/PAA coating is super-hydrophilic therefore, its CA image is not mentioned. The corrosion parameters such as corrosion potential ( E \n corr ) and corrosion current ( I \n corr ) obtained through these curves are summarized in Table 2 . For a typical polarization curve, the high E \n corr and a low I \n corr is attributed to a better corrosion resistance and a low corrosion rate. From these polarization curves, it can be seen that the E \n corr = −352 of PDDA/PSC coating is more positive as compared to the uncoated 316SS with E \n corr = −957. The transformation between different states of PANI i.e., emeraldine salt (ES) to leucoemeraldine (LE) causes a positive shift in E \n corr values because the nonconductive LE retards the electron transport between SS and coating 60 , 61 . The potential range of uncoated samples is −0.65 to 0.27 V which indicates the presence of a passive oxide layer, but this passivation crumpled at 0.27 V with a sudden increase in current (Fig. 7a ). In case of PDAA/PSC coating the passivation plateau range becomes more positive, i.e., −0.15 to 0.65 with a crumpled passivation at 0.65 V. In contrast, there is no passivation plateau and no sharp increase in corrosion current was observed in case of super-hydrophobic PSC/TMS-SiO 2 coating which implies that the coating maintains the barrier against the corrosive species and exhibits enhanced corrosion protection ability. The I \n corr was reduced from 40.06 (uncoated SS) to 7.31 µA cm −2 for PDDA/PSC coating. Overall, the polished 316SS with CA 64.7° ± 1° (inset of Fig. 7a , uncoated SS) presents low E \n corr and a high I \n corr value which indicates that the surface is more prone to corrosion. However, the super-hydrophobic PSC/TMS-SiO 2 coating achieved highest E \n corr = −263 and the lowest I \n corr = 2.09 µA cm −2 which shows the superior anti-corrosion ability of the coating as compared to its hydrophilic and uncoated counterparts. The protective efficiency ( P \n e ) of the coating can be expressed by the following equation: 1 \\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$${P}_{e}=100\\times (1-\\frac{{i}_{corr}}{{i}_{corr}^{^\\circ }})$$\\end{document} P e = 100 × ( 1 − i c o r r i c o r r ° ) where i \n corr and i \n ° \n corr are the current densities in the presence and absence of the coating, respectively. The comparison between PDAA/PSC and PSC/TMS-SiO 2 coating shows that the latter exhibits P \n e = 94.78% (Table 2 ), which is greater than the former hydrophilic coating with P \n e = 81.75%. The main reason behind the enhancement in corrosion resistance is the “lotus effect” and this effect is produced due to the textured super-hydrophobic surface with nano-porous structure (supported by Fig. 5 ), which impedes the penetration of water and aggressive species to approach the SS surface. Figure 7 Potentiodynamic polarization curves of ( a ) uncoated, PDDA/PSC and PSC/TMS-SiO 2 coating with their respective CA images as inset. ( b ) Nyquist plot of uncoated and coated samples, equivalent circuits used to fit the EIS diagrams of (b1) uncoated and (b2) coated samples. ( c ) Bode impedance and ( d ) phase plot of uncoated and coated samples. \n Table 2 The corrosion parameters obtained from polarization curves of uncoated and coated 316SS. Sample \n E \n corr (mV) \n I \n corr (μA cm −2 ) \n P \n e (%) CA (°) Uncoated −957 40.06 — 64.7° ± 1° PDDA/PSC −352 7.31 81.75 — PSC/TMS-SiO 2 \n −263 2.09 94.78 153° ± 2° \n Electrochemical impedance spectroscopy (EIS) was used as an alternative method to evaluate the corrosion protection ability of the coatings. Fig. 7b shows the Nyquist plot and Fig. 7c,d shows the Bode plot of the PDDA/PSC, PSC/TMS-SiO 2 coating and uncoated 316SS in 3.5% NaCl solution. The Nyquist plot of the coated samples, exhibits a high impedance with single capacitive loop than the uncoated ones. The corrosion resistance of different samples can be quantified by fitting the EIS data using equivalent circuits which provide the selective information about the permeability of the corrosive species involved in coating degradation 62 . The equivalent circuits used for uncoated and coated samples are shown in Fig. 7b1 and b2 . These equivalent circuits consist of charge transfer resistance ( R \n ct ) and solution resistance ( R \n s ) with double layer capacitance ( C \n dl ) 63 . For coated samples, the equivalent circuit added with the coating capacitance C \n c and resistance R \n c . The double layer behavior was expressed as constant phase element ( CPE ) in the electrical equivalent circuit and used when a deviation was observed from the pure-capacitive behavior to obtain a better simulation and it is expressed in the following equation as 64 : 2 \\documentclass[12pt]{minimal}\n\t\t\t\t\\usepackage{amsmath}\n\t\t\t\t\\usepackage{wasysym} \n\t\t\t\t\\usepackage{amsfonts} \n\t\t\t\t\\usepackage{amssymb} \n\t\t\t\t\\usepackage{amsbsy}\n\t\t\t\t\\usepackage{mathrsfs}\n\t\t\t\t\\usepackage{upgreek}\n\t\t\t\t\\setlength{\\oddsidemargin}{-69pt}\n\t\t\t\t\\begin{document}$${Z}_{CPE}=\\frac{{\\rm{1}}}{{\\rm{Q}}{({\\rm{j}}\\omega )}^{{\\rm{\\alpha }}}}$$\\end{document} Z C P E = 1 Q ( j ω ) α where CPE is the Q , j and ω is the imaginary unit (square = −1) and the angular frequency ( ω = 2πf ) respectively, the ideal capacitance is unity but the deviation is expressed as (0 < α < 1). The parameters obtained through circuit fitting are summarized in Table 3 and a good fitting was achieved by using the suggested equivalent circuits. The values of the exponent (n) are within the range of 0.6–0.7 which indicates that CPE \n c and CPE \n dl can be expressed as capacitance C \n c and C \n dl \n 65 . Table 3 Electrochemical parameters of uncoated and coated 316SS in 3.5% NaCl solution. Sample \n R \n s (Ωcm 2 ) \n C \n c (F/cm 2 ) \n R \n c (kΩcm 2 ) \n C \n dl (F/cm 2 ) \n R \n ct (kΩcm 2 ) \n R \n p (kΩcm 2 ) Uncoated 18.39 — — 8.09 × 10 −5 \n 22.97 22.97 PDDA/PSC 22.43 4.53 × 10 −5 \n 14.96 1.71 × 10 −5 \n 43.00 57.96 PSC/TMS-SiO 2 \n 25.06 4.41 × 10 −5 \n 27.25 1.37 × 10 −5 \n 99.23 126.48 \n Generally, the barrier ability of the coating is expressed by the coating resistance ( R \n c ) and capacitance ( C \n c ) 66 . In Table 3 , the PDDA/PSC coating exhibits low R \n c and high C \n c values which involve the quick diffusion of electrolyte solution due to hydrophilic nature of the coating. In contrast, for PSC/TMS-SiO 2 coating the R \n c values increased from 14.96 (PDDA/PSC coating) to 27.25 kΩcm 2 with low C \n c values. The high R \n c with low C \n c value indicates the superior barrier ability due to super-hydrophobicity which blocks the permeation of corrosive media and shows the excellent corrosion protection ability. The element R \n ct in the equivalent circuit represents the electron transfer across a metal surface. For uncoated samples R \n ct signifies the polarization resistance ( R \n p ) and for coated samples it is the combination of R \n c and R \n ct \n 67 . Therefore, we used R \n p to compare the corrosion protection ability of the coatings and it was found that the R \n p value of PDDA/PSC coating is 57.96 kΩcm 2 which is two times higher than the uncoated sample i.e., 22.97 kΩcm 2 . This increase is attributed to the physical barrier provided by the coating due to the presence of SiO 2 spheres and insoluble species formed during redox reactions of PANI. In case of super-hydrophobic PSC/TMS-SiO 2 coating high R \n p value (126.48 kΩcm 2 ) indicates that the TMS-SiO 2 increases the tortuosity in diffusion pathway of corrosive species thus enhances the corrosion resistance of the coating 68 . The Bode impedance (Fig. 7c ) and phase (Fig. 7d ) plot also supports the fact that the coated SS exhibits good anti-corrosion ability as compared to the uncoated ones. The protective properties of the coating is represented by the impedance modulus at low frequencies 69 as shown in Fig. 7c . In this region, the PSC/TMS-SiO 2 coating shows significantly high impedance value of the order >100 kΩcm 2 . The inset of Fig. 7c shows that the absolute impedance of the PSC/TMS-SiO 2 coating is higher than the PDDA/PSC coating and uncoated samples. In case of ideal capacitance the phase angle (α) and slope (S) is −90° and −1, respectively 70 . The α associated with the linear regions in the Bode impedance diagram of PDDA/PSC and PSC/TMS-SiO 2 coating is −78° and −82° with a slope of −0.84 and −0.87 (Fig. 7d ). Among these two, the PSC/TMS-SiO 2 coating is closer to the ideal values of α and S; hence contribute to the superior anti-corrosion performance. The integrity and aesthetic appearance of the PSC/TMS-SiO 2 coating was studied by making a cross-cut on the surface with scalpel and exposed to 3.5% NaCl solution. Fig. S6a and S6b show the optical microscopic image of the scribed coating before and after immersion in 3.5% NaCl for 100 h. After immersion, the coating maintains its overall surface integrity, but in the vicinity of the cross-cut delamination (the red circled area Fig. S6b ) occurred due to the continuous diffusion of electrolyte during 100 h of immersion. Fig. S6c shows the Nyquist plot of the scribed coating elaborates the 24 hourly monitored electrochemical changes during 100 h of immersion in chloride containing electrolyte. Generally, the R \n ct of the coating decreases abruptly if a crack appears on the coating, due to the quick diffusion of the electrolyte leading to direct contact with the bare SS surface. The R \n ct of the scribed PSC/TMS-SiO 2 coating at 0 h of immersion is 140.45 kΩcm 2 . Although, during 100 h of immersion the R \n ct value continuously decreases, but the coating still maintains its R \n ct value, i.e., 105.12 kΩcm 2 even after 96 h of immersion with no abrupt decrease. These R \n ct values of the scribed coating are roughly similar to the coating in the absence of the scribe (compared to R \n ct values in Table 4 ). The reason behind this is the coating could maintain its integrity due to the TMS-SiO 2 layer with super-hydrophobic characteristics which provides a strong barrier against further electrolyte diffusion in the vicinity of the cross-cut and PANI would form an oxide layer (supported by XPS data). These results imply that the coating could maintain its integrity, aesthetic appearance, adhesion and protect the underlying SS surface in chloride containing environment even in the presence of a scribe. Table 4 Electrochemical parameters obtained by fitting the EIS data of uncoated SS and PSC/TMS-SiO 2 coating with their respective contact angles (CAs) at different immersion time in 3.5% NaCl. Time (h) Uncoated 316SS PSC/TMS-SiO 2 coating \n R \n s (Ωcm 2 ) \n C \n dl (F/cm 2 ) \n R \n ct / R \n p (kΩcm 2 ) \n R \n s (Ωcm 2 ) \n C \n c (F/cm 2 ) \n R \n c (kΩcm 2 ) \n C \n dl (F/cm 2 ) \n R \n ct (kΩcm 2 ) \n R \n p (kΩcm 2 ) CA (°) 1 23.71 1.78 × 10 −4 \n 30.95 60.62 4.21 × 10 −5 \n 78.49 1.06 × 10 −4 \n 139.37 217.86 152° ± 2.3° 24 22.88 1.79 × 10 −4 \n 27.46 66.68 9.07 × 10 −5 \n 68.87 1.17 × 10 −4 \n 129.32 198.19 149° ± 1.5° 48 23.47 1.81 × 10 −4 \n 27.21 65.18 9.37 × 10 −5 \n 67.24 1.39 × 10 −4 \n 117.23 184.47 146° ± 2.1° 72 20.29 1.83 × 10 −4 \n 26.40 65.38 9.82 × 10 −5 \n 66.30 1.59 × 10 −4 \n 116.19 182.49 142° ± 2.5° 96 21.35 1.85 × 10 −4 \n 23.94 60.17 9.89 × 10 −5 \n 64.85 1.61 × 10 −4 \n 115.39 180.24 137° ± 3.2° 120 20.84 1.89 × 10 −4 \n 23.11 63.81 9.92 × 10 −5 \n 63.98 2.41 × 10 −4 \n 111.60 175.58 129° ± 1.4° 144 21.11 1.91 × 10 −4 \n 22.58 64.44 9.94 × 10 −5 \n 63.74 2.50 × 10 −4 \n 99.51 163.25 125° ± 2.8° 168 21.75 1.93 × 10 −4 \n 19.96 60.03 1.08 × 10 −4 \n 62.45 2.81 × 10 −4 \n 98.72 161.17 115° ± 2.6° 192 20.73 1.99 × 10 −4 \n 19.82 62.22 1.10 × 10 −4 \n 61.10 2.90 × 10 −4 \n 92.59 153.69 105° ± 3.3° 216 21.76 2.14 × 10 −4 \n 17.41 64.36 1.20 × 10 −4 \n 59.23 6.36 × 10 −4 \n 86.21 145.44 101° ± 2.2° 240 21.22 7.71 × 10 −4 \n 17.61 63.58 1.29 × 10 −4 \n 55.75 9.81 × 10 −4 \n 77.81 133.56 98° ± 1.9° \n Effect of Long Term Exposure The anti-corrosion behavior of the coating was illustrated in the previous section on the basis of EIS data (Fig. S6c and Fig. 7 ), but this information is not quite enough to illustrate the lifespan and durability of the coating. In order to understand in detail the degradation mechanism and long term anti-corrosion ability of the coating, we performed EIS for extended immersion time. Figure 8a and 8b represents the Nyquist plot of the uncoated SS and PSC/TMS-SiO 2 coating in 3.5% NaCl for 240 h. Both the samples exhibit single capacitive loop while the PSC/TMS-SiO 2 coating shows enhanced corrosion resistance and this property is stable even after 240 h of immersion in aggressive environment. Figure 8 Nyquist plots of ( a ) uncoated 316SS and ( b ) PSC/TMS-SiO 2 coating exposed to 3.5% NaCl for 240 h, ( c ) change in R \n p during 240 h of exposure of uncoated and coated samples with thier comparison. \n The obtained EIS parameters are summarized in Table 4 . During 1 h of immersion the lowest C \n c value was observed due to the super-hydrophobic property of the coating which does not allow the water and corrosive species to permeate. However, as the immersion time increases the corrosive species would approach the micro and nano-pores to diffuse into the coating this phenomenon is supported by the gradual increase in C \n c values. The change in C \n c values is very small within 24–96 h of immersion and there is no drastic increase in the values due to the subsequent TMS-SiO 2 layers which hinders the diffusion of aggressive species. At exposure time 120–192 h, there is a gradual increase in C \n c values due to the dominant hydrophilic effect of PSC layers. Finally, at 216–240 h of immersion an accelerated diffusion of corrosive species was observed supported by the increase in C \n c values. In spite of this, the oxide layer on the SS surface in the presence of PANI matrix tries to maintain the anti-corrosion ability of the coating. The R \n ct values of PSC/TMS-SiO 2 coating gradually decrease with the immersion time, but the coating maintains the passivity of the SS surface as compared to uncoated samples. To further explain the protection mechanism of the coating, polarization resistance ( R \n p ) was used and Fig. 8c shows the contrast between the R \n p of the uncoated SS and PSC/TMS-SiO 2 coating. For uncoated SS, the R \n p values gradually decrease from 30.95 to 17.61 kΩcm 2 and the direct contact of aerated solution with SS surface results in the formation of an oxide layer. This layer would slowly damage during 240 h of exposure in a 3.5% NaCl solution (Table 4 ). In contrast, the R \n p value of the PSC/TMS-SiO 2 coating remains high after 1 h of immersion due to water repelling ability of the coating. After 24 h the slight decrease in the R \n p value was associated with the permeation of aggressive chloride ions that affect the water repelling property of the coating. This phenomenon was attributed to the slow loss of the surface hydrophobicity and uptake of aerated corrosive solution. In spite of this, the R \n p values of the PSC/TMS-SiO 2 coating were higher than the uncoated samples throughout the exposure time. At 48–96 h of immersion, the R \n p values stabilized within the range of 117.23–115.39 kΩcm 2 followed by a gradual decrease in R \n p . The stability is associated with the synergistic barrier ability of electro-active PSC and subsequent TMS-SiO 2 layers. Further increase in exposure time, i.e., 144–240 h results a little decease in R \n p values, however, the transformation between different PANI oxidation states and its redox catalytic behavior was activated. As a result, PANI would attain a positive potential in emeraldine state which passivates the SS surface and hence stabilized the corrosion process 71 . In addition, the diffused oxygen would reached the coating/metal interface which result in the formation of metal oxide layer (supported by XPS data) and maintains the anti-corrosion ability during prolonged exposure 59 . However, the high R \n p values and a gradual decrease with immersion time suggest that the coating prevents the sudden breakdown of SS surface and maintains the corrosion resistance for longer time. Moreover, the change in CAs of PSC/TMS-SiO 2 coating surface with immersion time in 3.5% NaCl solution was measured and summarized in (Table 4 ). Initially, the coating maintains the super-hydrophobicity even being exposed to chloride containing environment, but after 96 h of immersion the electrolyte trying to diffuse into the coating consequently affect the surface wettability of the coating. Therefore, the CA values decreases with increasing immersion time and reached to 98° ± 1.9° at 240 h of immersion. Importantly, the coating still maintains the hydrophobicity and stabilized the quick degradation of the coating during prolonged immersion and protects the underlying metal. The effect of long term immersion on morphology of coated and uncoated PSC/TMS-SiO 2 coating was further studied through visual screening. Fig. S7a and S7b show the digital images of the polished and coated 316SS before immersion in 3.5% NaCl. The Fig. S7c and S7d shows the red dotted line encircled area of diameter 1 cm is exposed to 3.5% NaCl for 240 h. It can be seen that severe pitting corrosion was initiated with the appearance of dots which can clearly be seen in the magnified microscopic image of polished SS surface (Fig. S7e ). In contrast, the PSC/TMS-SiO 2 coating sacrifices itself during prolonged immersion time in saturated chloride media and cracks were originated, but there is no delamination and quick decrease in resistance was observed even after 240 h of immersion (supported by Fig. 8b ). These microscopic images reveal that the coating significantly protects the underlying SS surface, even after 240 h of immersion by sacrificing itself and increases the lifespan of SS in corrosive media. From these observations we conclude that different mechanism involved in the prolonged corrosion protection ability of the PSC/TMS-SiO 2 coating: (i) the super-hydrophobicity of the coating enhances the water repellent property, (ii) the good barrier ability of the coating was attributed to the combination of PSC and TMS-SiO 2 in a multilayer structure, (iii) PANI maintain its emraldine state with anodic passivation during the redox transformation and its presence at the coating/metal interface would result in the formation of oxide layer 64 . It is worthwhile to point out that the PSC/TMS-SiO 2 coating maintains its aesthetic appearance during prolonged exposure of 240 h and enhances the corrosion resistance of the SS (supported by electrochemical studies). These super-hydrophobic coatings are potential candidates for prolonged corrosion protection of metal and can be used where tunable surface wettability and swapping between the hydrophobicity and hydrophilicity is desired."
} | 13,641 |
38293552 | PMC10826417 | pmc | 9,445 | {
"abstract": "Bacteriocin production in Streptococcus thermophilus is regulated by cell density-dependent signaling molecules, including BlpC, which regulates transcription from within the bacteriocin-like peptide ( blp ) gene cluster. In some strains, such as S. thermophilus ST106, this signaling system does not function properly, and BlpC must be supplied exogenously to induce bacteriocin production. In other strains, such as S. thermophilus B59671, bacteriocin (thermophilin 110 in strain B59671) production occurs naturally. Here, transcriptomic analyses were used to compare global gene expression within ST106 in the presence or absence of synthetic BlpC and within B59671 to determine if BlpC regulates the expression of genes outside the blp cluster. Real-time semi-quantitative PCR was used to find genes differentially expressed in the absence of chromosomal blpC in the B59671 background. Growth curve experiments and bacteriocin activity assays were performed with knockout mutants and BlpC supplementation to identify effects on growth and bacteriocin production. In addition to the genes involved in bacteriocin production, BlpC affected the expression of several transcription regulators outside the blp gene cluster, including a putative YtrA-subfamily transcriptional repressor. In strain B59671, BlpC not only regulated the expression of thermophilin 110 but also suppressed the production of another bacteriocin, thermophilin 13, and induced the same YtrA-subfamily transcriptional repressor identified in ST106. Additionally, it was shown that the broad-spectrum antimicrobial activity associated with strain B59671 was due to the production of thermophilin 110, while thermophilin 13 appears to be a redundant system for suppressing intraspecies growth. BlpC production or induction negatively affected the growth of strains B59671 and ST106, revealing selective pressure to not produce bacteriocins that may explain bacteriocin production phenotype differences between S. thermophilus strains. This study identifies additional genes regulated by BlpC and assists in defining conditions to optimize the production of bacteriocins for applications in agriculture or human and animal health.",
"introduction": "Introduction Bacteriocins are ribosomally encoded antimicrobial peptides that have the potential to act as preservatives within food or as alternatives to clinically relevant antibiotics. The lantibiotic nisin, naturally produced by strains of Lactococcus lactis , gained approval by the FDA for use as a food biopreservative in 1988 and remains the only bacteriocin with FDA approval in purified preparations ( McAuliffe et al., 2001 ). However, several other food-grade lactic acid bacteria have been shown to produce broad-spectrum bacteriocins; thus, efforts continue to characterize novel bacteriocins and develop methods for optimizing their production ( Perez et al., 2014 ; Barcenilla et al., 2022 ). Streptococcus thermophilus is an industrially relevant lactic acid bacterium used in the production of yogurt and hard cheeses. Many of the bacteriocins produced from S. thermophilus , called thermophilins, are encoded by the bacteriocin-like peptide ( blp ) gene cluster. Strains B59671 ( Gilbreth and Somkuti, 2005 ; Renye and Somkuti, 2013 ), ST106 ( Somkuti and Renye, 2014 ; Renye et al., 2019a ; Figure 1A ), LMD-9 ( Fontaine et al., 2007 ; Fontaine and Hols, 2008 ), ST109 ( Renye et al., 2019b ), and ST118 ( Somkuti and Renye, 2014 ) all produce bacteriocins encoded within the blp cluster. The blp -encoded bacteriocins produced by ST106 and B59671 are called thermophilin 106 and thermophilin 110, respectively. Figure 1 (A) Genetic organization of the blp cluster in ST106 and B59671, and (B) transcriptional effects from BlpC-mediated signal transduction on the blp cluster and other gene clusters in B59671. Putative promoters for operons in which at least one gene is significantly upregulated (green), none of the genes are significantly affected (black), and at least one gene is significantly downregulated (red) during BlpC-mediated signal transduction are shown. For simplicity, upregulation processes are on the left, and downregulation processes are on the right. Gene orientation is according to the reverse strand in panel (A) for visualization and according to the sense strand in panel (B) . Figure created with BioRender.com . The bacteriocins encoded within the blp locus display activity against a wide spectrum of Gram-positive bacteria. For instance, ST109 has activity against other S. thermophilus strains ( Fontaine et al., 2007 ) in addition to other Gram-positive bacteria, including the pathogens Listeria monocytogenes ( Fontaine and Hols, 2008 ), Enterobacter faecalis ( Fontaine and Hols, 2008 ), and Streptococcus pyogenes ( Renye et al., 2019b ). B59671 can inhibit the growth of a potential wine spoilage bacterium, Pediococcus acidilactici ( Gilbreth and Somkuti, 2005 ), as well as the opportunistic pathogens Streptococcus mutans ( Renye and Steinberg, 2021 ), Cutibacterium acnes , and Listeria monocytogenes ( Ceruso et al., 2021 ). Therefore, thermophilins may have the potential to be used as food preservatives or antimicrobials for human and animal health applications. Comparative genomics led to the discovery of the blp cluster in S. thermophilus due to its homology with the blp cluster of Streptococcus pneumoniae ( de Saizieu et al., 2000 ). Originally, it was thought that S. thermophilus was unable to produce bacteriocins ( Hols et al., 2005 ). However, it was later shown that bacteriocin production from strains LMD-9 ( Fontaine et al., 2007 ) and ST106 ( Renye et al., 2016 ) occurred upon the exogenous addition of a 30-mer quorum sensing induction peptide (QSIP) naturally encoded by blpC . When expressed, BlpC is processed into mature QSIP and transported via an ABC transporter system encoded by blpA and blpB (upper portion of Figure 1B ). A histidine kinase (BlpH) and a response regulator (BlpR) form part of a signal cascade to help QSIP activate genes in the blp cluster, including the gene(s) encoding the bacteriocin. The overall action of the blp cluster causes the production of bacteriocin once a population quorum has been established. Streptococcus thermophilus strains that naturally produce bacteriocins encoded within the blp gene cluster have also been identified, including strains B59671 and ST109 ( Renye et al., 2016 ). In addition to genes encoding thermophilin 110, the chromosome of B59671 also has a cluster containing genes encoding thermophilin 13, another class II bacteriocin, along with a unique ABC transporter system QSIP, histidine kinase and response regulator protein, and a BlpS-type LytTR transcriptional regulator ( Salini et al., 2023 ). The promoter region of blpABC is identical between strains B59671 and ST106, and these strains display contrasting bacteriocin production phenotypes in terms of an exogenous BlpC requirement. The reason for this remains unknown. Moreover, the action of BlpC has only been studied with regard to genes within the blp cluster. We set out to determine the effects of BlpC on a transcriptomic level in the hopes of identifying any other genes regulated by this signaling molecule and understanding the effects of bacteriocin production on overall cell growth to potentially identify associated trade-offs.",
"discussion": "Discussion In this study, BlpC supplementation with ST106 increased the transcription of several genes within the blp gene cluster, similar to what was reported previously ( Somkuti and Renye, 2014 ). The blpABC and blpD -ORF1/2 operons and blpK were significantly more induced than the blpU -ORF3 operon. This is consistent with results from strain LMD-9, in which BlpC induces transcription from blpD and blpE much more than from blpU ( Fontaine et al., 2007 ), and the purported BlpR-binding sites in the promoters for blpD , blpU , and blpK in ST106 are identical to those for blpD , blpU , and blpE , respectively, in LMD-9. BlpG may be required for the formation of disulfide bonds between antimicrobial peptides (BlpD, BlpU, BlpE, and BlpF) in strain LMD-9 ( Fontaine and Hols, 2008 ). In ST106, blpG transcription was comparable to that of both blpD and blpK , suggesting a similar role for BlpG in this strain. Not reported previously was the induction of transposase within the blp cluster. The same transposase was identified in the same location within the blp loci of S. thermophilus strains B59671, ST109, and LMG18311 ( Fontaine et al., 2007 ; Renye and Somkuti, 2017 ; Renye et al., 2019b ), but its function remains unknown. Finally, our results also confirm previous reporting of constitutive expression of the blpRH operon ( Fontaine et al., 2007 ; Somkuti and Renye, 2014 ). Our findings that BlpC affects the expression of genes outside of the blp cluster in S. thermophilus ST106 and B59671 contrast with a study of the blp system in S. pneumoniae , in which microarray data revealed that BlpC only induces genes within the blp cluster ( de Saizieu et al., 2000 ). With the limitations of microarray analyses compared to the RNA-seq analyses employed here, it is still possible that BlpC induces genes outside of the blp cluster as well in S. pneumoniae . Of the ST106 genes identified as being regulated by BlpC in this study ( Supplementary Table 2 ), clpX is one that has been reported to affect bacteriocin production. In Streptococcus mutans, it was shown that the deletion of clpX , an ATPase subunit of the Clp protease complex, resulted in a loss of antimicrobial activity ( Kajfasz et al., 2011 ), but the mechanism by which ClpX regulates bacteriocin production remains unknown. Additionally, three of the transcriptional regulators identified were putative xenobiotic response element (XRE)-family transcription factors (D1O36_04345, D1O36_09575, and D1O36_09695), and one was a Rgg-family regulator, and examples of each serving as repressors in other streptococcal species have been reported ( Capodagli et al., 2020 ; Liu et al., 2020 ). BlpC induction lowered the transcription of these regulatory factors in the early exponential phase, suggesting that they could serve to repress bacteriocin production in ST106. Of particular interest would be the XRE-family regulator D1036_04345, as it was transcribed lower in B59671 when compared to uninduced ST106. Reduced transcription of this gene could be required for bacteriocin production from within the blp locus to occur in S. thermophilus . However, to conclude if any of these regulators truly affect bacteriocin production, the generation of knockout mutants and subsequent phenotype analysis are required. The operon encoding a putative YtrA-family transcriptional regulator in S. thermophilus ST106 that is upregulated during BlpC induction organizationally resembles a three-gene operon identified in Sulfolobus solfataricus ( Lemmens et al., 2019 ). In other bacterial species, homologs of ytrA are within operons consisting of two or six genes in Sulfolobus species and Bacillus subtilis , respectively ( Salzberg et al., 2011 ). YtrA was reported to regulate cell envelope stress responses in response to cell wall antibiotics in B. subtilis ( Salzberg et al., 2011 ) and repress the transcription of its own operon and a specific subset of genes encoding membrane proteins in S. solfataricus ( Lemmens et al., 2019 ). Bacteriocins encoded within the S. thermophilus blp gene cluster are believed to exert their antimicrobial activity by forming pores within the target cell membrane ( Gilbreth and Somkuti, 2005 ; Renye et al., 2023 ). Therefore, it is reasonable to hypothesize that the YtrA-family regulator in S. thermophilus is part of a stress response associated with the production of bacteriocins. The results from this study identified significant differences between ST106 and B59671 that could explain why ST106 induced with BlpC still transcribes blp genes less than B59671 does ( Figure 2 ). The differences in the expression of the histidine kinase ( blpH ) and response regulator ( blpR ) could allow B59671 to be more sensitive to BlpC, resulting in the increased transcription of BlpC-regulated genes. The higher expression of clpX may contribute to the natural production of thermophilin 110 by strain B59671, and the low-level transcription of potential repressors, including D1O36_04116 and 04345, and the YtrA-family regulator may be needed to begin a sequence of events required for bacteriocin expression. This is the first study to show that BlpC regulates the expression of bacteriocins outside the blp gene cluster in S. thermophilus ( Figure 1B ). Our data clearly show cross-talk between the blp and thm gene clusters, in that BlpC downregulates transcription of genes from the thm bacteriocin cluster. We also show that BlpC upregulates (CG712_RS08365) and downregulates (CG712_RS08760) genes from within other clusters. On the reverse, B59671 may depend on the alternative homologs of blpA , blpB , blpR , and blpH (i.e., thmZ , thmY , thmR , and thmH ), as well as an increased expression from blpR and blpH , to amplify the quorum sensing signal to induce blp bacteriocin expression. Further research is needed to determine if the BlpA and BlpB homologs encoded by genes outside the blp cluster interact with BlpC, BlpD, BlpU, and BlpK, and if the BlpR and BlpH homologs encoded by genes outside the blp cluster interact with BlpC, BlpR, and BlpH. In the related S. pneumoniae blp system, four distinct blpH alleles and blpC types have been identified ( Pinchas et al., 2015 ). Our study represents a case where more than one blpH- and blpC -type system is actively expressed by the same host. As for other blp- related genes, the finding of a blpS homolog ( thmS ) only in B59671 was unexpected. While BlpS has an unknown role in S. pneumoniae ( de Saizieu et al., 2000 ), BlpS purportedly acts to repress the transcription of blp genes in Streptococcus gallolyticus ( Proutiere et al., 2021 ). It is possible that the BlpS homolog only represses genes from the thm cluster, since that is where it is located in the chromosome. Our results confirm that a blpC knockout mutant of S. thermophilus B59671 (∆ blpC ) lost its broad-spectrum antimicrobial activity against P. acidilactici F ( Renye and Somkuti, 2013 ). RT-qPCR data from this study confirmed that the antimicrobial activity in the B59671 parent strain was due to the increased expression of genes within the blp locus, specifically blpA , blpU , and blpK compared to the ∆ blpC mutant ( Figure 4 ). The antimicrobial activity could be restored by inducing the expression of the blp gene cluster with exogenous BlpC ( Somkuti and Renye, 2014 ). However, in this study, when S. thermophilus ST113 was used as a target, inhibition zones were observed, suggesting that a second active bacteriocin was being produced. An in silico study identified the presence of the thm gene cluster encoding thermophilin 13 in B59671 ( Salini et al., 2023 ), but no studies were performed to confirm the expression of this bacteriocin. This is the first study to show that the genes encoding thermophilin 13 are expressed in B59671. Unfortunately, the ΔthmAB mutant generated did not show a clear phenotype. The mutant still inhibited the growth of S. thermophilus ST113, P. acidilactici , and C. acnes . These results suggest that thermophilin 110 alone is responsible for the unique broad-spectrum activities previously reported for strain B59671, which include activities against Enterococcus faecalis , Enterobacter faecium , Streptococcus mutans , Streptococcus pyogenes , Streptococcus salivarius , Lactobacillus acidophilus , Lactobacillus helveticus, and Cutibacterium acnes ( Renye and Somkuti, 2013 , 2017 ; Renye and Steinberg, 2021 ; Renye et al., 2023 ). The optimal intraspecies activity of this strain may be due to the production of both thermophilins since our results suggest they are both expressed. The redundancy of their activities would also prevent a loss of intraspecies activity if a random mutation were to occur within one of the gene clusters, allowing them to maintain a competitive advantage in the presence of other S. thermophilus strains. To confirm that intraspecies activity is dependent on both systems, it would require the generation of a double mutant with both systems inactivated. It appears that the production of two active bacteriocins by B59671 comes at a cost, as the parent strain had a longer lag phase and lower final biomass when compared to either the ΔblpC or ΔthmAB strains. Indeed, fitness costs have been modeled ( Lehtinen et al., 2022 ) and demonstrated for bacteriocin production in Lactobacillus plantarum ( Maldonado-Barragan and West, 2020 ), and even bacteriocin immunity in Listeria monocytogenes ( Dykes and Hastings, 1998 ). In ST106, BlpC induction results in the production of an active bacteriocin but does not impact exponential growth, potentially due to both the histidine kinase (BlpH) and response regulator (BlpR) being expressed ~2-fold lower in the early exponential phase. In the late exponential phase, when these components are expressed at a higher level, a phenotype is observed with the uninduced culture entering the stationary phase at a reduced biomass. The growth-impaired phenotype observed for the parent B59671 culture may be due to both the blp and thm bacteriocin gene clusters being highly expressed in the early exponential phase, which requires the bacterium to continuously expend energy producing other components within these gene clusters required for processing and secretion of the signal peptides, a purported immunity protein (orf 3) ( Fontaine et al., 2007 ), and bacteriocins ( blpA and blpB ). Additionally, our results suggested that cross-talk occurs between the blp and thm systems, but the effect of these systems on the overall transcriptome of B59671 is not known. The results from this study showed that the transcription of several genes outside the blp gene cluster was affected by BlpC induction within ST106. Some of these same genes appeared to be regulated by BlpC in B59671, specifically the YtrA-like transcriptional regulator ( Figure 3 ). The function of this regulator is unknown in S. thermophilus , and more studies are required to demonstrate if it affects bacterial growth. It is also possible that the signaling peptides BlpC or ThmX regulate the transcription of other genes within B59671 that contribute to the impaired exponential growth observed. The construction of additional mutant strains is required to accurately assess the role of each signaling molecule with respect to cell growth and metabolism. Bacteriocin production has long been thought to provide an advantage when a bacterium is attempting to establish itself within a specific niche by eliminating bacteria that are competing for the same nutrients. The broad-spectrum activities of bacteriocins produced by lactic acid bacteria have also been reported to drive intra-guild predation, allowing them to obtain nutrients from the lysis of other bacterial species to ensure their survival ( Leisner and Haaber, 2012 ). Additionally, bacteriocins may aid in the survival of a sub-population within the same species or strain. While such an effect is reminiscent of persistence, which temporarily allows sub-populations of genetically identical bacteria to survive exposure to antibiotics at bactericidal concentrations ( Balaban et al., 2019 ), further experiments would be needed to determine if persistence is involved. In any case, the intracellular accumulation of the bacteriocin CipB in Streptococcus mutans , which occurs in response to the detection of competence-stimulating peptides, leads to self-autolysis ( Perry et al., 2009 ). This altruistic cell death was proposed to ensure the survival of a subset of the population and potentially increase the genetic diversity of the surviving population via the uptake of released extracellular DNA (eDNA) ( Perry et al., 2009 ). In S. pneumoniae, bacteriocins encoded within the blp gene cluster decrease population diversity through intra-strain predation ( Aggarwal et al., 2023 ). This selfish killing of kin cells resulted in a sub-population of bacteriocin-producers as the predominant colonizers within a murine infection model ( Aggarwal et al., 2023 ). In this study, the expected decrease in biomass following BlpC induction in ST106 and the ΔblpC mutant of B59671 could have been obscured by death in a sub-population of bacteriocin non-producers, causing the release of nutrients and growth of the bacteriocin-producing sub-population. Our results suggest that the expression of chromosomal blpC causes more of a detriment to cell growth than supplementation with extracellular BlpC, but more studies are needed to determine the cause of this and if intraspecies predation truly contributes to the growth differences observed. Altogether, the growth phenotypes observed here indicate that there is selective pressure to not produce bacteriocins and/or BlpC. Competition with bacteria susceptible to the bacteriocins causes the opposing selective pressure to produce bacteriocins. ST106 and other strains that lack the capacity to produce bacteriocins without externally supplied BlpC may have gained a dependence on other strains to produce BlpC or evolved in environments where growth rate was more important than bacteriocin production in terms of cell growth and survival. A similar system was found in S. pneumoniae , whereby some “producer” strains produce bacteriocin and “cheater” strains carry a conserved frameshift mutation that renders a non-functional blpA , allowing them to sense the QSIP and produce immunity proteins but not to secrete bacteriocins and QSIP ( Son et al., 2011 ). ST106 compromises by retaining the ability to produce and secrete its bacteriocins in the presence of QSIP."
} | 5,543 |
27039285 | PMC4818893 | pmc | 9,446 | {
"abstract": "Background Conjugative plasmids play an important role in bacterial evolution by transferring ecologically important genes within and between species. A key limit on interspecific horizontal gene transfer is plasmid host range. Here, we experimentally test the effect of single and multi-host environments on the host-range evolution of a large conjugative mercury resistance plasmid, pQBR57. Specifically, pQBR57 was conjugated between strains of a single host species, either P. fluorescens or P. putida , or alternating between P. fluorescens and P. putida. Crucially, the bacterial hosts were not permitted to evolve allowing us to observe plasmid evolutionary responses in isolation. Results In all treatments plasmids evolved higher conjugation rates over time. Plasmids evolved in single-host environments adapted to their host bacterial species becoming less costly, but in the case of P. fluorescens -adapted plasmids, became costlier in P. putida , suggesting an evolutionary trade-off. When evolved in the multi-host environment plasmids adapted to P. fluorescens without a higher cost in P. putida . Conclusion Whereas evolution in a single-host environment selected for host-specialist plasmids due to a fitness trade-off, this trade-off could be circumvented in the multi-host environment, leading to the evolution of host-generalist plasmids.",
"conclusion": "Conclusion Evolution in a single-host environment selected for host-specialist plasmids due to a fitness trade-off, but this trade-off could be circumvented in the multi-host environment, leading to the evolution of host-generalist plasmids.",
"discussion": "Results and discussion The conjugation rate of pQBR57 varied between selection treatments (main effect of selection treatment, chi-square test, Χ 2 (2, Ν = 432) = 30.49, p = 2.39e-07), owing to a lower conjugation rate in P. putida than P. fluorescens , but increased over time in all treatments (main effect of time, chi-square test, Χ 2 (1, Ν = 432) = 18.24, p = 1.94e-05) (Fig. 1a ). This suggests that pQBR57 adapted to the selection regimes by increasing its conjugation rate. In our experimental set-up, which involved both horizontal and vertical plasmid replication, conjugation is an essential part of the plasmid life-cycle; thus increasing conjugation rate is equivalent to increasing replication rate and therefore perhaps a predictable response to selection. However, increases in conjugation rate can be linked to increased costs of plasmid carriage [ 9 , 13 ], which would impair the plasmid’s spread by vertical transmission (i.e. growth of transconjugants). Fig. 1 \n a Conjugation rate over time for plasmids in the single-host and multi-host treatments (Solid circle: Conjugation in P. fluorescens ; Solid square: Conjugation between P. fluorescens and P. putida ; Solid triangle: Conjugation in P. putida ; Black line: linear regression); b Selection rate of P. fluorescens or P.putida carrying evolved plasmids from the single and multi-host treatments relative to isogenic strains carrying the ancestral plasmid. Selection rate of 0 indicates no difference between test and reference strains (dotted line), error bars: ±SEM) To estimate the fitness effects of carrying the evolved plasmids for host bacteria we competed bacteria carrying evolved plasmids against bacteria carrying the ancestral plasmid, in both host species backgrounds. The fitness effect of evolved plasmids depended on the combination of selection treatment and the test host species background (Fig. 1b ; effect of species background and selection treatment interaction, factorial ANOVA, F 2,36 = 4.50, p = 0.017). We observed that plasmids from the single-host P. fluorescens treatment evolved lower costs in P. fluorescens , but that this adaptation was accompanied by an increased cost in P. putida relative to the ancestral plasmid (Welch’s t -test, t 6.81 = 2.592, p = 0.036) (Fig. 1b ). Contrastingly, although plasmids from the single-host P. putida treatment evolved marginally lower costs in P. putida , we observed no change to the cost of carriage in P. fluorescens (Welch’s t -test, t 9.88 = -0.618, p = 0.55) (Fig. 1b ). Together this suggests an asymmetric trade-off, whereby pQBR57 adapted to P. fluorescens suffers a fitness trade-off in P. putida , but that there is not a corresponding fitness trade-off associated with adaptation to P. putida . Although we do not know the mechanism underlying the fitness trade-off in this study, previous work suggests that costs of plasmid carriage can arise from a range of mechanisms, including: the metabolic burden, expression of plasmid genes, copy number variation, and interference between plasmid and host cell regulatory systems [ 14 , 15 ]. It is tempting to speculate that the last of these, regulatory interference, might be the most host-specific and thus more likely to generate the observed fitness trade-off [ 16 ]. Interestingly, evolved plasmids from the multi-host treatment evolved reduced cost-of-carriage in P. fluorescens but without increasing their cost-of-carriage in P. putida (Fig. 1b ). This suggests that adaptation in a multi-host environment allowed pQBR57 to circumvent the fitness trade-off associated with adaptation to P. fluorescens in the single-host treatment. We do not know the specific mutations involved in plasmid adaptation in our experiment but the contrasting responses to selection between treatments suggests different genetic mechanisms. In particular, it seems likely that the different responses to selection in the P. fluorescens single-host treatment versus the multi-host treatment are due either to the fixation of different mutations, or the fixation of additional mutation(s) in the multi-host treatment to ameliorate the cost in P. putida of plasmid adaptation in P. fluorescens . Environmental heterogeneity is thought to play a key role in the evolution of generalism and specialism in a wide variety of species [ 17 ]. Heterogeneous environments are predicted to select for generalist genotypes whereas homogeneous environments select for specialist genotypes [ 5 ]. For example, evolution experiments with algae adapting to light and dark show that algae adapted to light have lower fitness in dark environments and vice versa, whereas algae exposed to both environments evolve to be generalists [ 18 ]. We show that this evolutionary principle also applies to the evolution of mobile genetic elements in different hosts, in this case a conjugative plasmid. We provide evidence for a fitness trade-off associated with adaptation to a single host environment. The appearance of a fitness trade-off can be due, at the genetic level, to antagonistic pleiotropy or mutation accumulation [ 5 , 18 ]. It seems more likely that the pattern observed here is the result of antagonistic pleiotropy, since there was equal opportunity for mutation accumulation in all treatments, but the trade-off was asymmetric affecting only the plasmids evolving in one of the species ( P. fluorescens ). Interestingly, exposure to both host species in the multi-host treatment did not constrain adaptation . This suggests that fitness trade-offs can be circumvented if plasmids are exposed to alternative hosts. Diverse bacterial communities are likely therefore to select for broad host range plasmids and consequently promote interspecific horizontal gene transfer, with implications for understanding the spread of important plasmid-borne traits like antibiotic resistance."
} | 1,885 |
37885608 | PMC10600976 | pmc | 9,447 | {
"introduction": "Introduction Microbially-produced metabolites and microbiome metabolism in general are strongly linked to ecosystem-level phenotypes, including the health of the human host ( Bar et al., 2020 ; Villanueva-Millán et al., 2015 ). To aid in the study of microbial metabolism from observational, human-derived data, a variety of computational methods that predict microbial community metabolic output from microbial abundances have been developed ( Baldini et al., 2019 ; Diener et al., 2020 ; Mallick et al., 2019 ; Noecker et al., 2022 ). Several of these methods rely on community-scale metabolic models, which are mechanistic, knowledge-based models that enable the formulation and in silico testing of biological hypotheses regarding the metabolism of microbial communities ( Baldini et al., 2019 ; Diener et al., 2020 ). Community-scale models primarily use Flux Balance Analysis, a technique that infers the metabolic fluxes in a system by optimizing an objective function, typically growth rate, subject to an assumption of a steady state and constraints imposed by the metabolic reactions present in the system ( Orth et al., 2010 ). These metabolic reactions are obtained from genome-scale metabolic networks (GEMs), knowledge-based computational models encompassing the known biochemical reactions present within an organism ( Thiele & Palsson, 2010 ). In recent years, curated GEMs for thousands of human-associated microbial organisms have become increasingly available, enabling a more in-depth exploration of the human microbiome ( Heinken et al., 2023 ; Machado et al., 2018 ; Norsigian et al., 2020 ). In addition, several community-scale metabolic modeling methods specifically tailored to the human microbiome have emerged, such as MICOM and mgPipe ( Baldini et al., 2019 ; Diener et al., 2020 )."
} | 455 |
35745378 | PMC9229712 | pmc | 9,448 | {
"abstract": "Flexible electronic textiles are the future of wearable technology with a diverse application potential inspired by the Internet of Things (IoT) to improve all aspects of wearer life by replacing traditional bulky, rigid, and uncomfortable wearable electronics. The inherently prominent characteristics exhibited by textile substrates make them ideal candidates for designing user-friendly wearable electronic textiles for high-end variant applications. Textile substrates (fiber, yarn, fabric, and garment) combined with nanostructured electroactive materials provide a universal pathway for the researcher to construct advanced wearable electronics compatible with the human body and other circumstances. However, e-textiles are found to be vulnerable to physical deformation induced during repeated wash and wear. Thus, e-textiles need to be robust enough to withstand such challenges involved in designing a reliable product and require more attention for substantial advancement in stability and washability. As a step toward reliable devices, we present this comprehensive review of the state-of-the-art advances in substrate geometries, modification, fabrication, and standardized washing strategies to predict a roadmap toward sustainability. Furthermore, current challenges, opportunities, and future aspects of durable e-textiles development are envisioned to provide a conclusive pathway for researchers to conduct advanced studies.",
"conclusion": "6. Conclusions and Prospects The wearable electronic textile utilizes different action-driven signals in measurable quantities with exciting possibilities in versatile areas along with personalized algorithms. Flexible electronic textiles are of great interest due to their ease of use, comfort, and compatibility at the user level. As discussed in the preceding sections, it is obvious that remarkable advances have been achieved in all possible aspects, from material selection to end-user-reliant, durable e-textile product design. Researchers have explored different architectural textile assemblies with numerous innovative fabrication techniques, along with various performance enhancement strategies toward highly durable and washable wearable e-textiles. However, challenges related to stability, repeatability, durability, washability, scalability, and other process-induced flaws limit the manufacture and commercialization of customer reliable high-end wearable electronic textiles products (see Figure 11 ). Therefore, for the e-textiles device to be commercially successful beyond the laboratory, future research should be focused more on the following issues and research gaps to design multipurpose reusable wearable electronic clothing as casual wear at the customer level. Reliable durability enhancement strategies are to be adopted according to the substrate, nanomaterials, and processing involved in designing the e-textiles device. Different surface modification approaches in the pre-treatment stages involving bio proteins, adhesives, cross-linkers, plasma, and other chemicals should not affect the structural integrity of the textile substrate. Bioproteins as surface modifiers are assumed to be eco-friendly, but other organic cross-linkers and bonding agents may have a higher environmental impact which cannot be unattended. Besides, post-treatments such as encapsulation of the conductive textiles with traditional encapsulants (TPU, PDMS, epoxy resins, etc.) have been proven to be effective in protecting functional properties securely, but in some cases, the lamination layer was found to be vulnerable and washed away. The encapsulation of the e-textiles should not affect the breathability, comfort, flexibility, and other inherent properties of the substrate and should be compatible with human skin. The internal wiring of the wearable components is very much crucial for the optimum performance of the entire unit but is mostly overlooked and needs more attention. Therefore, a reliable interconnection pattern among different functional units within the wearable system is essential for consistent performance, that is, data acquisition and processing without interruption. Commercial metallic wires (silver, steel, copper, etc.) are mostly explored for e-textile interconnections, but they are stiff, incompatible, and may malfunction under mechanical stresses involved in the wash and wear. The failure or malfunctioning of interconnections can cause short-circuits within the system, which may pose a serious safety threat to the wearer. The flexible electroconductive fibers/yarns can be the best alternative but need to be extensively studied to improve their robustness for interconnections of various patterns. In addition, the seamless integration possibilities of the electronic components into the clothing needs broader investigation toward a robust wearable system. The scalability of electronic textiles cannot be ignored as it is also directly related to the productivity and cost of the wearable garment. Future research should be more focused on designing e-textiles beyond the laboratory environment at a large scale. Fast and facile manufacturing in combination with traditional textile processing techniques will promote mass production compared to sophisticated laboratory techniques. In addition to the higher endurance properties, the cost-effectiveness of the e-textile products should also be taken into account for potential market expansion. Moreover, inclusive simulation and modeling of current techniques (substrate treatment, nanomaterial incorporation, post-treatment, washing, drying, and product design) are required to achieve greater efficiency and in fact to develop new strategies. Electronic textile fabrication involves various organic or inorganic chemical treatments (surfactants, nanoparticles, polymers, metals, acids, bases, etc.) in a wet medium, which can release substantial amounts of toxic elements to the environment and even pose a significant threat to the consumer such as skin irritation or carcinogenic disease when in contact with the human body. Superior washability of e-textiles will promote the lower toxic release to the body when encountered with a wet environment (sweating, bleeding, and raining) during wearing. However, the risk of toxic release both to the environment and the human body is so evident that it cannot be ignored, and greater attention is required for a more sustainable and cleaner approach. As the e-textile market continues to grow, a huge burden of countless used wearable electronic textile materials is expected to be added to the current solid waste chain in the coming years. Such waste is significantly more toxic and dangerous than the solid waste generated from regular textile wear; therefore, a sustainable and eco-friendly solid E-waste management is required. Traditional domestic laundry involves a huge amount of water which may contain toxic chemicals released from e-textiles during washing, and the release of such contaminated water into the environment without further purification may have a catastrophic effect on the aquatic ecosystem. Waterless washing techniques will prevent such a level of pollution by lowering the water footprint, but may also increase the operating cost associated with alternative approaches. The environmental compatibility of dry-cleaning chemicals should be investigated. Each washing technique (wet/dry) may have a distinctive impact on the properties of the substrate; therefore, it is important to understand the washing damages for a particular type of material to be washed following a specific technique. More research should be devoted to the synchronization of different washing techniques with the type, structure, and composition of the e-textile product to be laundered to minimize washing damages. Imparting high-end functionality such as self-cleaning properties toward e-textiles will significantly reduce their washing needs, as they are expected to repel and decompose dirt through photocatalytic action. The superhydrophobic surface achieved via the coating of different chemicals is also capable of repelling or removing dirt, dust, and other impurities by rolling water droplets inspired by the lotus effect. Although various chemical compounds have been explored to exert such functionalities on e-textile components, they should be biocompatible and not affect the comfort and aesthetic properties. The environmentally friendly fluorine-free chemical reagents or polymers can replace traditional toxic hydrophobic coatings but require more research for a better understanding of the cleaning mechanism and efficiency. The self-healing property, i.e., automatic repairing of different stimuli-induced damages, will substantially improve the robustness of the e-textiles and make them more viable for practical application. Therefore, extensive research is required on the development of self-healable polymers and their performance under different hostile events throughout the life span of the e-textile components. Despite the efforts of different international organizations to standardize e-textiles’ washing protocols, researchers should focus on mitigating the underlying mismatch in materials, structure, fabrication, and product design to validate and adopt forthcoming standards widely. The stability and repeatability of the device performance cannot be ignored, which needs to be given the same priority as washability and requires standardized documentation. It is very possible that an e-textile component is claimed to be washable but may exhibit an unstable, irregular, and unreproducible performance profile for a prolonged duration. Flexible, lightweight e-textile batteries in fibrous shape are promising and are expected to replace traditional rigid and heavy power sources embedded in wearables, but the efficient power generation and management, mobility, and endurance of such flexible devices require more research attention. Moreover, future work should also address the accuracy and reliability of the data measurement of the durable wearable electronic textile system in the context of practical applications.",
"introduction": "1. Introduction Wearable technologies have created a universal platform for innovation and advancement towards the 4th industrial revolution in versatile areas to connect the virtual world with reality. Wearable electronics can facilitate human quality of life in all possible aspects by properly monitoring different actions in real time [ 1 ]. However, the traditional electronic components are often rigid, uncomfortable, and difficult to integrate with the complicated architecture of the human body, which substantially limits their practical application [ 2 , 3 ]. Textile materials (clothing) are always worn by the wearer and are considered the most ideal platform for designing and incorporating electronics without compromising comfort and aesthetics. The smart textiles are capable of sensing, reacting, and adapting to external events or stimuli to capture, process, and analyze data remotely using electronics built with e-textiles and can be used for wearable applications [ 4 ]. E-textiles constructed of fibrous textile materials are expected to exhibit their inherent characteristics (i.e., comfortability, flexibility, stretchability, breathability, light weight, etc.) when there is no alteration of properties involved in the fabrication process. Moreover, e-textiles can be adapted to any sophisticated electronic components [ 5 ]. Besides, e-textiles can be constructed with various hierarchical architectures ( Figure 1 ) in the form of fiber, yarn, fabric, and garments to facilitate the application perspective in future high-end miniature electronics. Levi’s in collaboration with Philips introduced the first commercial wearable e-textile (jacket) in summer 2000 [ 6 ]. Since then, e-textiles are of great interest and have experienced disruptive innovation and advancement in terms of research and application. So far, e-textiles have been proposed to be utilized in different areas, i.e., healthcare [ 7 , 8 ], sensing [ 9 , 10 ], defense [ 11 , 12 ], sports [ 13 , 14 ], personal protection [ 15 , 16 ], fashion [ 17 , 18 ], energy [ 19 , 20 ], thermal management [ 21 , 22 ], magnetic shielding [ 23 , 24 ], communication [ 25 , 26 ], etc. The incorporation of metal nanoparticles (silver [ 27 , 28 ], gold [ 29 , 30 ], copper [ 31 , 32 ], zinc oxide [ 33 , 34 ], gallium [ 35 , 36 ], platinum [ 37 , 38 ], aluminum [ 39 , 40 ], nickel [ 41 , 42 ], cobalt [ 43 , 44 ], tin [ 45 , 46 ], etc.), carbon nanomaterials (carbon nanotube [ 47 , 48 ], graphene [ 49 , 50 ], carbon black [ 51 , 52 ], activated carbon [ 53 , 54 ], etc.), conductive polymers (Polypyrrole-PPy [ 55 , 56 ], Polyaniline-PANI [ 57 , 58 ], poly(3,4-ethylenedioxythiophene) polystyrene sulfonate-PEDOT: PSS [ 59 , 60 ], etc.) and other 2D materials (MXene [ 61 , 62 ], TMD [ 63 , 64 ], etc.) with textile substrates (non-conductive in nature) is an important aspect of e-textiles fabrication. The electrically functionalized textile substrate of different forms ranging from fiber/filament to fabric/garment can be achieved via different approaches, i.e., coating (dip-coating [ 65 , 66 ], spray coating [ 67 , 68 ], ultrasonic coating [ 69 , 70 ], knife coating [ 71 , 72 ], spin coating [ 73 , 74 ], etc.), printing (screen printing [ 75 , 76 ], inkjet printing [ 77 , 78 ], extrusion printing [ 79 , 80 ], gravure printing [ 81 , 82 ], laser printing [ 83 , 84 ], stencil printing [ 85 , 86 ], 3D printing [ 87 , 88 ], etc.), electrospinning (melt spinning [ 89 , 90 ], dry spinning [ 91 , 92 ], wet spinning [ 93 , 94 ], etc.), electrodeposition [ 95 , 96 ], polymerization [ 97 ], thin-film deposition [ 98 , 99 ], nanopattern [ 100 ], etc. The conductive materials adhere to intrinsically nonpolar textile materials mainly through physical absorption [ 101 ] and mostly fail (detach or decay from the substrate surface) to comply with different actions of the wearer, i.e., bending, twisting, friction, etc. Different approaches with advanced material processing and chemistry are availed to alleviate such challenges in designing practically viable and wearable devices. To date, many high-performance e-textiles with improved performance are reported [ 102 , 103 , 104 , 105 , 106 ], however, poor stability and washability have been the major challenges restricting their true practical essence. Moreover, the incompetent durability of the e-textiles may encounter environmental and safety concerns by releasing toxic organic/inorganic nanostructured compounds to the ecosystem and wearer [ 107 ]. Hence, to improve stability and washability, variant structures have been proposed that differ from material choice, modification, fabrication, and even assessment protocols. Although much research claimed that their constructed e-textile components had superior durability, they could barely withstand repeated laundry and mechanical deformation for a long time without compromising their electro-conductive properties [ 108 , 109 ]. It is evident that remarkable progress has been achieved toward sustainable e-textiles products, but there remains a large gap in the adopted tactics and output reliability. There are a limited number of standard wash assessment protocols entirely focused on e-textiles present in academia. So, individually designed wash assessment protocols along with traditional approaches are being followed to verify researcher interest in this regard. In many cases, the product is claimed to be durable despite exhibiting poor fastness, and some research even claimed durability without stability and wash tests [ 110 , 111 , 112 ]. Therefore, reliable and standardized wash protocols with defined circumstances and evaluation criteria will facilitate the researcher’s ability to predict their product behavior and make reliable comparability of different e-textiles. So far, various review articles have been published [ 113 , 114 , 115 , 116 , 117 , 118 , 119 ] mostly focusing on materials, fabrication strategies, architecture, multifunctional properties, and the application perspective of the wearable e-textiles, ignoring the importance of wash durability enhancement. Very few review articles [ 120 , 121 , 122 ] are available in the academia that entirely focus on washability and attempt to summarize different wash strategies, influencing parameters, and enhancement opportunities, but lack a pragmatic review that favors the improvement of the reliability and washability of e-textiles. Thus, this review summarized the most advanced multidisciplinary approaches from the substrate to consumer product design with regard to advanced stability, washability, and explained different aspects of washing features, leading toward standardized evaluation protocols. Initially, recently developed durable e-textiles of different hierarchical structures (fiber, yarn, fabric/garment) are discussed along with the state-of-the-art advances in reliable device fabrication. Afterward, all aspects of the stability and wash durability are addressed, from traditional testing to the establishment of standardized protocols. In the end, the remaining challenges, opportunities, and the future perspective of this area are discussed. This comprehensive review is expected to tremendously facilitate a proper understanding of this area and open a new direction for the research community toward the evolution of durable electronic textile components."
} | 4,386 |
26227067 | null | s2 | 9,450 | {
"abstract": "Neural oscillations can enhance feature recognition (Azouz and Gray Proceedings of the National Academy of Sciences of the United States of America, 97, 8110-8115 2000), modulate interactions between neurons (Womelsdorf et al. Science, 316, 1609-01612 2007), and improve learning and memory (Markowska et al. The Journal of Neuroscience, 15, 2063-2073 1995). Numerical studies have shown that coherent spiking can give rise to windows in time during which information transfer can be enhanced in neuronal networks (Abeles Israel Journal of Medical Sciences, 18, 83-92 1982; Lisman and Idiart Science, 267, 1512-1515 1995, Salinas and Sejnowski Nature Reviews. Neuroscience, 2, 539-550 2001). Unanswered questions are: 1) What is the transfer mechanism? And 2) how well can a transfer be executed? Here, we present a pulse-based mechanism by which a graded current amplitude may be exactly propagated from one neuronal population to another. The mechanism relies on the downstream gating of mean synaptic current amplitude from one population of neurons to another via a pulse. Because transfer is pulse-based, information may be dynamically routed through a neural circuit with fixed connectivity. We demonstrate the transfer mechanism in a realistic network of spiking neurons and show that it is robust to noise in the form of pulse timing inaccuracies, random synaptic strengths and finite size effects. We also show that the mechanism is structurally robust in that it may be implemented using biologically realistic pulses. The transfer mechanism may be used as a building block for fast, complex information processing in neural circuits. We show that the mechanism naturally leads to a framework wherein neural information coding and processing can be considered as a product of linear maps under the active control of a pulse generator. Distinct control and processing components combine to form the basis for the binding, propagation, and processing of dynamically routed information within neural pathways. Using our framework, we construct example neural circuits to 1) maintain a short-term memory, 2) compute time-windowed Fourier transforms, and 3) perform spatial rotations. We postulate that such circuits, with automatic and stereotyped control and processing of information, are the neural correlates of Crick and Koch's zombie modes."
} | 588 |
31683672 | PMC6915377 | pmc | 9,451 | {
"abstract": "The analysis of electromechanical energy converters based on metal-thin film ferroelectric (with a large specific capacitance)-nanogap-moving electrode structures was performed. It was shown that the density of the energy being converted and its absolute value increase with the decreasing gap value between the surfaces of the ferroelectric and the metallic moving electrode up to nanometer values. The effects limiting the growth of this energy were established, and the limiting value of the energy density transformed in the nanogap of these structures was determined to be about 1.6 × 10 10 J/m 3 , which is 4 orders of magnitude higher than the energy density in inductive converters. The experimental verification of this model based on the data for micromotors fabricated on these structures is given.",
"introduction": "1. Introduction Electromechanical energy converters (motors and generators) that are widely used in all fields of human activity and in industry are divided into three classes: inductive, piezoelectric, electrostatic (electrical) machines, in which direct and reverse conversion of magnetic or electric field energy to mechanical energy is performed. The specific and absolute power of energy converters are determined by the energy density of the field in the working gap. In the best inductive converters the magnetic field energy density in the gap reaches W V = 1/2 B 2 / μ 0 = 4 × 10 5 –10 6 J/m 3 (where μ 0 is the magnetic constant) at the maximum possible values of magnetic induction, B , (of the order of 1–1.5 T) for magnetic circuits created on the basis of ferromagnets. In this case minimum gaps between the rotor and stator, determined by the production technology, are of the order of fractions of a millimeter, less than 100–300 μm [ 1 ]. Piezoelectric energy converters with respect to field energy density are comparable to electromagnetic ones, see, for example, devices based on PZT ceramics [ 2 ]. In such converters, the working gap is the material of the piezoelectric itself. The energy density in it can be high due to the large value of its dielectric constant, ε , as well as large values of the electromechanical coupling coefficient, of the order of 0.5–0.8. However, for such converters, the value of the maximum energy density being converted is not limited by the maximum field that can be formed in the dielectric without breakdown, but it is limited by the value of the mechanical stress of the material, above which an irreversible deformation of the piezoelectric occurs: σ = F e / S (where F e is the elastic force, S is the converter area): W V = 1/2 σ 2 / E Y (where E Y is the Young’s modulus of the material) [ 3 ]. In capacitive electrostatic energy converters, the specific volume energy density, W V , is also determined by the electric field strength in the working gap E e : (1) W V = ε 0 E e 2 2 = ε 0 V e 2 2 d e 2 = C e V e 2 2 d e \nwhere V e is the voltage applied to the gap, d e is the gap width, C e = ε 0 / d e is the specific (per unit area) gap capacity, ε 0 is the dielectric constant of vacuum. The total energy per unit area of the structure W S is equal to: (2) W S = C e V e 2 2 = ε 0 V e 2 2 d e Classical electrostatic, capacitive, energy converters have not yet found wide application because of the low specific energy density W V ≈ 40 J/m 3 . W V is determined by the low electric field strength E e in the working gap of the metal-gap-metal structure (MGM), which is limited by the value of the breakdown field strength of the gap E b . This value is known to be equal to 3 × 10 6 V/m for air at atmospheric pressure. An increase in the field strength in the gap can be achieved by introducing an additional dielectric layer into the MGM structure, i.e., by the use of metal-dielectric-gap-metal structures (MDGM). The introduction of a dielectric layer, which suppresses the development of breakdown, makes it possible to increase the voltage applied to the structure to several hundred volts with small gaps, of the order of 10–30 μm, see, for example, [ 4 ]. Due to this, an energy density comparable to one characteristic for large inductive converters was reached. The work of capacitive electrostatic energy converters is based on the shift of the moving electrode (ME) in the metal- dielectric- gap- ME structure either under the action of electric field forces (motor [ 5 , 6 ]) or under the action of mechanical force against the electric field forces (generator [ 7 ]). The shift of the moving electrode can be carried out both in in-plane structures (in this case, the electrode overlap area is modulated without changing the gap between the ME and the dielectric), and in out-of-plane ones (the gap changes at the constant electrode area). It should be noted that in known MDGM structures further growth of the density of converted energy due to decrease of the gap width up to the nanometer scale is not realized, because in these conditions the field in the gap does not practically increase. Under small values of gap width comparable or less than dielectric film thickness the voltage V applied to the structure is distributed in such a way that only a small part of it is applied to the gap. Therefore, the only way to increase the energy density in the gap of MDGM structures is to increase the applied voltage V to the values, limited by the breakdown of the dielectric layer, see, for example, [ 8 , 9 ]. Obviously, it is necessary to use dielectric materials with a high value of ε and high breakdown voltage values in order to decrease the voltage drop in the dielectric when the width of the gap is decreased to nanometer scale. Such properties are characteristic for ferroelectric thin films, for which the breakdown field strength reaches 100–350 V/μm with ε being in the range of 1000–5000, see, for example, the review in [ 10 ]. High values of ε , more than 2000, are also characteristic for barium-strontium niobate (BSN) films with the composition Ba 0.5 Sr 0.5 Nb 2 O 6 [ 11 ], which were deposited by us earlier by high-frequency sputtering on the surfaces of silicon and sapphire substrates with a sublayer of a conducting electrode indium tin oxide (ITO) or Pt, they have breakdown voltages of about 100 V/μm. The purpose of this work is to determine the limiting density of electromechanical energy conversion in metal-ferroelectric-gap-metal structures (MFGM), with the smallest possible gap (nanometer-wide) between the metal and the ferroelectric.",
"discussion": "4. Discussion 1. It has been shown that the creation of MFGM structures based on thin films of ferroelectrics with high electric strength and with a large dielectric constant of more than 1000 makes it possible to achieve high values of electric fields in nanogaps between the surfaces of a moving electrode and a ferroelectric, up to 6 × 10 10 V/m. The energy density in the nanogap of electromechanical transducers based on such structures reaches 1.6 × 10 10 J/m 3 , which exceeds this parameter in known inductive and piezoelectric transducers by more than 4 orders of magnitude. 2. It has been shown that during electromechanical energy conversion in these structures, the maximum value of energy, up to 80 J/m 2 , is achieved by forming a gap 5 nm in width and using a voltage of 330 V and a ferroelectric film thickness of 4 μm. 3. The effects limiting the maximum energy density in these structures are impact ionization of the air in the gap and the breakdown of the structure. It has been established that in the vacuum mode, the mechanism limiting the increase in energy is the field evaporation of metal atoms from the surface of the moving electrode."
} | 1,919 |
35564097 | PMC9102559 | pmc | 9,452 | {
"abstract": "Friction and wear usually lead to huge energy loss and failure of machine pairs, which usually causes great economic losses. Researchers have made great efforts to reduce energy dissipation and enhance durability through advanced lubrication technologies. Single-layer coatings have been applied in many sectors of engineering, but the performance of single-layer coatings still has many limitations. One solution to overcome these limitations is to use a multilayer coating that combines different components with varied physical and chemical properties. In addition, multilayer coating with alternating layers only containing two components can lead to improved performance compared to a coating with only two different layers. This paper systematically reviews the design concept and properties of different types of multilayer coatings, including transition-metal nitride coatings, diamond-like carbon-based coatings, and other multilayer coatings. The inherent functional mechanisms of the multilayer structures are also detailed and discussed.",
"conclusion": "6. Conclusions and Perspectives This paper reviewed the multilayer structure designing of different types of coatings. With the development of multilayer coatings, the influence of various parameters, including the layer thickness, element composition, etc., and the influence of supporting layers on the behaviors of top layer have been systematically investigated. However, in the view of the authors, there are still many unsolved problems for further investigation. Many studies reported that the coatings with multilayer structures have much lower COF compared to monolayer coatings or multilayer coatings with different structures. However, the underlying mechanisms still need further investigation with a view to guide future high-performance multilayer coatings. In addition, advanced multiphysics simulation works are also needed for the optimization of material and structure design of multilayer coatings. Recent years, multilayer coatings containing 2D materials have also been designed [ 124 ], which achieved macroscale superlubricity under dry atmosphere. Multilayer coatings with 2D materials sometimes exhibit excellent tribological behaviors. However, related studies are restricted to limited types of 2D materials. The influence of coating structure, chemical composition of 2D materials or the matrix on the tribological behaviors still needs further investigation for the development of novel lubrication systems.",
"introduction": "1. Introduction Friction and wear occur in moving pairs with direct contact among all mechanical systems, leading to excessive energy consumption and failure of equipment [ 1 ]. Advanced techniques have been proposed to reduce friction and wear [ 2 , 3 ]. One of the methods is to deposit coating materials on friction pairs, which has been widely used for a long time due to its high performance in practical engineering applications. Coatings can be designed with different materials and structures to provide multiple functions. With the development of coating systems, different designing procedures have been proposed to further enhance the performance of coatings, or to extend the adaptivity of coatings in various environments [ 4 , 5 , 6 ]. One of the strategies is the multilayer designing of coating systems. Among the coating design concepts, multilayer coatings have attracted a lot of attention because the properties including hardness, elastic modulus, lubrication performance, and adhesion to substrate can be targeted and regulated, making it easier to develop coating systems to meet specific requirements. In this paper, the design concepts and properties of different types of multilayer coatings, including transition-metal nitride (TMN) coatings, DLC-based coatings, and other multilayer coatings, are systematically reviewed. The inherent functional mechanisms of the multilayer structures are also detailed and discussed."
} | 982 |
20694026 | null | s2 | 9,453 | {
"abstract": "How bacteria regulate, assemble and rotate flagella to swim in liquid media is reasonably well understood. Much less is known about how some bacteria use flagella to move over the tops of solid surfaces in a form of movement called swarming. The focus of bacteriology is changing from planktonic to surface environments, and so interest in swarming motility is on the rise. Here, I review the requirements that define swarming motility in diverse bacterial model systems, including an increase in the number of flagella per cell, the secretion of a surfactant to reduce surface tension and allow spreading, and movement in multicellular groups rather than as individuals."
} | 167 |
33418710 | null | s2 | 9,454 | {
"abstract": "Silk and elastin are exemplary protein materials that exhibit exceptional material properties. Silk is uniquely strong, surpassing engineering materials such as Kevlar and steel, while elastin has exquisite flexibility and can reversibly fold into a more structured form at high temperatures when many other proteins would unfold and denature. This phenomenon in elastin is termed the inverse temperature transition. It is a reversible, controllable process that motivates applications in drug delivery, shape change materials, and biomimetic devices. Silk-elastinlike protein polymers (SELPs), which combine repeating "
} | 154 |
31647561 | PMC6993867 | pmc | 9,455 | {
"abstract": "Abstract Hydrogenosomes are H 2 -producing mitochondrial homologs found in some anaerobic microbial eukaryotes that provide a rare intracellular niche for H 2 -utilizing endosymbiotic archaea. Among ciliates, anaerobic and aerobic lineages are interspersed, demonstrating that the switch to an anaerobic lifestyle with hydrogenosomes has occurred repeatedly and independently. To investigate the molecular details of this transition, we generated genomic and transcriptomic data sets from anaerobic ciliates representing three distinct lineages. Our data demonstrate that hydrogenosomes have evolved from ancestral mitochondria in each case and reveal different degrees of independent mitochondrial genome and proteome reductive evolution, including the first example of complete mitochondrial genome loss in ciliates. Intriguingly, the FeFe-hydrogenase used for generating H 2 has a unique domain structure among eukaryotes and appears to have been present, potentially through a single lateral gene transfer from an unknown donor, in the common aerobic ancestor of all three lineages. The early acquisition and retention of FeFe-hydrogenase helps to explain the facility whereby mitochondrial function can be so radically modified within this diverse and ecologically important group of microbial eukaryotes.",
"conclusion": "Conclusions Anaerobic ciliates provide an opportunity to investigate a rare example of the repeated hypoxia-driven reductive evolution of mitochondria into hydrogenosomes within a single taxonomic group. Our data reveal similarities and differences in the degree of gene loss in the different lineages. We detected evidence for the retention of a reduced mitochondrial genome in Metopus spp. and in C. porcatum . These data, in combination with previous work on Nyctotherus ( Akhmanova et al. 1998 ; Boxma et al. 2005 ; de Graaf et al. 2011 ), suggest that the conservation of genes needed to make a functional complex I is a major driver for mitochondrial genome retention inside ciliate hydrogenosomes. Consistent with this idea, we identified nuclear genes for complex II and other proteins including AOX, that can potentially regenerate the ubiquinone needed to sustain complex I function in the absence of a complete mitochondrial ETC. Cyclidium porcatum is so far unique among hydrogenosome-containing ciliates in that it has retained complex V and hence is potentially capable of generating ATP using the proton gradient generated by complex I. By contrast, the hydrogenosomes of P. frontata have lost the mitochondrial genome and ETC in their entirety. We detected multiple genes for MCF proteins for each species, with differences in MCF abundance for individual species consistent with different degrees of metabolic reduction. Mitochondrial pathways retained in common include a capacity for pyruvate decarboxylation and ATP production by substrate-level phosphorylation, retention of the glycine cleavage pathway, and a biosynthetic role in the maturation of cellular Fe/S proteins that are essential for cell survival. The latter appears to be the most conserved biosynthetic function for mitochondrial homologs across the eukaryotic tree ( Freibert et al. 2017 ). The detection for each ciliate of multiple MCF genes for transporters of unknown function, but which are also conserved in the Tetrahymena genome, suggests that ciliate hydrogenosomes share a number of additional unidentified functions with the aerobic mitochondria of ciliates. Our results also have relevance for ongoing and topical debates about mitochondrial biochemistry and evolution in early eukaryotes ( Martin et al. 2015 ; Stairs et al. 2015 ; Spang et al. 2019 ). They provide an example of how metabolically flexible organelles capable of both aerobic and anaerobic biochemistry could have been maintained by microbial eukaryotes at the margins of the early oxic/anoxic world. They also highlight gene loss as a predominant mechanism by which hydrogenosomes have evolved from mitochondria in different lineages within a single phylogenetic group and suggest that horizontal and vertical inheritance can each play a role in the remodeling of mitochondrial function.",
"introduction": "Introduction Mitochondria are an ancestral feature of eukaryotic cells that have diversified in form and function during their separate evolution in eukaryotes under different living conditions, producing a spectrum of homologous organelles with different proteomes and phenotypes ( Embley and Martin 2006 ; Muller et al. 2012 ; Stairs et al. 2015 ). Among the most interesting of these mitochondrial homologs are the hydrogenosomes ( Müller 1993 ) found in anaerobic free-living and parasitic microbial eukaryotes. Hydrogenosomes produce H 2 using the enzyme FeFe-hydrogenase, a type of metabolism that has been typically associated with bacteria rather than eukaryotes ( Müller 1993 ; Embley et al. 1997 ; Horner et al. 2000 ; Muller et al. 2012 ; Stairs et al. 2015 ). The evolution of hydrogenosomes and the origins of their anaerobic metabolism are actively debated ( Martin and Müller 1998 ; Martin et al. 2015 ; Stairs et al. 2015 ; Spang et al. 2019 ). Here, we have addressed these questions by investigating the repeated convergent evolution of hydrogenosomes from mitochondria among free-living anaerobic ciliates. Ciliates provide an excellent system for studying the evolutionary transition from mitochondria to hydrogenosomes because anaerobic, hydrogenosome-containing ciliates are interleaved among aerobic, mitochondria-bearing forms in the ciliate tree ( Embley et al. 1995 ; Fenchel and Finlay 1995) . Previous work has also shown that the hydrogenosomes of the anaerobic ciliate Nyctotherus ovalis have a mitochondrial genome, providing direct molecular evidence of their mitochondrial ancestry ( Akhmanova et al. 1998 ; Boxma et al. 2005 ; de Graaf et al. 2011 ). The retention of a mitochondrial genome contrasts with better-studied hydrogenosome-containing protists like Trichomonas , where the organellar genome has been entirely lost, and where close metamonad relatives lack classical aerobic mitochondria for comparison ( Stairs et al. 2015 ; Leger et al. 2017 ). Anaerobic ciliates thus provide a rare opportunity to investigate the plasticity of mitochondrial function and the repeated convergent evolution of hydrogenosomes within a phylogenetically coherent and diverse lineage ( Embley et al. 1995 , 1997 ; Akhmanova et al. 1998 ; Boxma et al. 2005 ; de Graaf et al. 2011 ). Anaerobic ciliates with hydrogenosomes are unusual among eukaryotes because they typically harbor endosymbiotic archaea, which in some cases form intricate physical interactions with ciliate hydrogenosomes ( van Bruggen et al. 1983 ; Finlay and Fenchel 1991 ; Embley et al. 1992 ; Fenchel and Finlay 1995) . The endosymbionts are methanogens that use the H 2 produced by hydrogenosomes as an electron donor for ATP-producing methanogenesis ( Fenchel and Finlay 1995) . Physiological studies ( Fenchel and Finlay 1991 , 1995 ) have suggested that the endosymbionts provide an electron sink that can compensate for the reduced oxidative capacity of ciliate hydrogenosomes. Consistent with this, published data ( Fenchel and Finlay 1991 ) have demonstrated that large ciliates like Metopus contortus and Plagiopyla frontata grow better when they harbor methanogens. However, there are currently no published data describing the proteomes and electron transport chains (ETCs) of the hydrogenosomes of either species to identify the molecular details underpinning their symbioses. In the present study, we have investigated the repeated convergent evolution of ciliate hydrogenosomes ( Embley et al. 1995 ), in representative species from three taxonomically distinct anaerobic lineages. Small-scale genomic amplification after hydrogenosome enrichment was used to recover organellar genome sequences for individual species, and these data were complemented by nuclear and organellar transcriptomics data generated by single-cell RNAseq. The molecular data sets generated were used to reconstruct hydrogenosome metabolism for Cyclidium porcatum , M. contortus and P. frontata , and phylogenetics was used to investigate the evolutionary history and origins of the key anaerobic enzymes for H 2 generation.",
"discussion": "Results and Discussion Phylogenetic Analysis Supports the Independent Origins of Hydrogenosomes in Different Anaerobic Ciliate Lineages Selective enrichment culturing was used to isolate M. contortus and P. frontata from marine sediments and C. porcatum , Metopus es , Metopus striatus , and Trimyema finlayi ( Lewis et al. 2018 ) from freshwater sediments. Cells of N. ovalis were isolated directly from the digestive tract of cockroaches. Phylogenetic analyses of 18S rRNA sequences from the isolates using the best-fitting CAT-GTR model ( Lartillot et al. 2013 ) confirmed previous analyses using simpler models ( Embley et al. 1995 ) showing that these species represent three distinct hydrogenosome-containing lineages: Armophorea ( Metopus and Nyctotherus ), Plagiopylea ( Plagiopyla and Trimyema ), and C. porcatum , nested among aerobic ciliates ( fig. 1 a ). Our broad taxonomic sampling thus provides an opportunity to compare and contrast the molecular details of three separate events of hydrogenosome evolution.\n Fig . 1. Ciliate rRNA gene phylogenies inferred using the program Phylobayes MPI from alignments of nuclear-encoded 18S rRNA genes ( a ), and from concatenated alignments of their mtDNA-encoded rns and rnl genes ( b ), using the CAT + GTR model. Both trees include aerobic and anaerobic representative species. The species investigated in the present study are highlighted in bold text, support values represent posterior probabilities, and scale bars represent the number of substitutions per site. Some of the Sampled Anaerobic Ciliates Retain a Mitochondrial Genome To investigate whether the hydrogenosomes of the sampled anaerobic ciliates have retained a mitochondrial genome (mtDNA), we generated new molecular data sets for M. contortus , M. es , M. striatus , P. frontata , T. finlayi ( Lewis et al. 2018 ), and C. porcatum using multiple displacement amplification and genomic sequencing of DNA from hydrogenosome-enriched samples, and complemented these data using single-cell RNAseq ( supplementary table 1 , Supplementary Material online). We also produced new data for N. ovalis to complement the partial mtDNA sequence already available for this species ( Akhmanova et al. 1998 ; de Graaf et al. 2011 ). We found evidence for mtDNA in samples from M. contortus , M. es , M. striatus , and N. ovalis , including ribosomal RNA genes that cluster strongly with mitochondrial sequences from related aerobic mitochondria-containing ciliates ( fig. 1 b ). These data suggest that retention of mtDNA may be a conserved feature of the exclusively anaerobic class Armophorea ( Fenchel and Finlay 1995 ; Lynn 2008 ) that contains Metopus and Nyctotherus . We did not detect any mtDNA in the samples for C. porcatum , but we did detect transcripts in the C. porcatum RNAseq data for mitochondrial protein-coding genes ( fig. 2 ) and for mitochondrial LSU and SSU rRNA ( fig. 1 b ), which suggests that C. porcatum has also retained a mitochondrial genome. By contrast, we found no molecular evidence for mtDNA in the hydrogenosomes of P. frontata or T. finlayi . This suggests that species in this clade have, so far uniquely among ciliates, completely lost the mitochondrial genome during hypoxia-driven reductive evolution of their hydrogenosomes.\n Fig . 2. ( a ) A table showing the genes of known function predicted from the mtDNA of ciliates sequenced in the present study (species names in bold) and three that were sequenced by previous studies ( Pritchard et al. 1990 ; de Graaf et al. 2011 ; Swart et al. 2012 ). Filled/colored boxes indicate genes that are encoded by the mtDNA for each species and empty/white boxes indicate genes that were not identified but are present in the mtDNA of other ciliates. In cases where multiple copies of a particular gene were found, encoded by the mtDNA of one species, the number of copies is indicated in the corresponding box for that gene. The mitochondrial complexes to which the products of the genes listed belong are indicated using the abbreviations CI, CIII, CIV, and CV, which correspond to the electron transport chain complexes I, III, IV, and V (F 0 F 1 ATP-synthase), respectively. SSU and LSU correspond to the small and large mitochondrial/hydrogenosomal ribosome subunits, respectively. ( b ) A genomic map of gene positions for mtDNA contigs sequenced from Metopus contortus , Nyctotherus ovalis , and Metopus es , in the present study. Predicted protein-coding genes with homologs in other eukaryotes are represented by black boxes, predicted protein-coding genes with no homologs in any other organisms are represented by white boxes, and predicted RNA genes are represented by gray boxes. Predicted protein-coding genes that have detectable homologs from mtDNA of other ciliates, but from no other organisms outside ciliates, are labeled (*). Sections of colinear gene order between two mtDNA from different species are indicated with red bands, protein-coding genes with no discernible colinearity between mtDNA from two species are indicated with green bands, and the relative positions of rRNA genes are indicated with blue bands. Arrows indicate the direction of transcription. Fragment copy genes present in Metopus contortus mtDNA sequence are labeled ( f. ). Genes listed in the table ( a ) that are not shown in a corresponding genomic map for the same species ( b ) were only detected from transcript data that did not form part of the genomic contig assemblies. The DNA sequences corresponding to this figure are available in supplementary data 2, Supplementary Material online. We assembled a single 48,118-bp contig of mtDNA for N. ovalis ( fig. 2 a and b ) which is similar to the size (∼48 kb) of its mtDNA as previously estimated from Southern blots ( de Graaf et al. 2011 ). Based on the size of the mtDNA of N. ovalis , we estimate that we also obtained near-complete mtDNA data for M. contortus (48,599 bp) and M. es (48,877 bp), assembled in several short contigs and transcripts ( fig. 2 ). One end of the new contig from N. ovalis was found to contain a 38-bp sequence (TATTGTAATACTAATAATATGTGTGTTAATGCGCGTAC) that is repeated in tandem three times, resembling the structure of telomeres from the mtDNA of other ciliates ( Morin and Cech 1986 ). This suggests that the mtDNA of this species is a single linear chromosome similar to the mtDNA of several aerobic ciliates ( Pritchard et al. 1990 ; Burger et al. 2000 ). The gene content of the new N. ovalis mtDNA sequence is identical ( fig. 2 a ) over comparable sequenced regions, to that inferred from the previously published partial data for different strains of this species ( Akhmanova et al. 1998 ; de Graaf et al. 2011 ), although the levels of per gene sequence identity are relatively low (24.6–93.5%, mean = 52.2%, at the amino acid level). The absence of rps13 and a second copy of rps4 from the previously published partial N. ovalis data ( de Graaf et al. 2011 ) may be due to the incomplete nature of that data set, as the two genes are next to each other in the new N. ovalis sequence ( fig. 2 b ). Interestingly, a tandem 34-bp 12-repeat sequence reported to be present in the middle of the previously published partial (41,666 bp) N. ovalis mtDNA sequence (NCBI accession: GU057832.1) ( de Graaf et al. 2011 ) was not identified in our new mtDNA sequence. However, the published gene sequences on either side of the repeat are syntenous with the N. ovalis mtDNA sequence from the present study. Although the repeat section in the previously published N. ovalis mtDNA sequence ( de Graaf et al. 2011 ) lacks any significant similarity to the putative telomeric repeats in the new N. ovalis mtDNA sequence from the present study, it is similar in length. At present it is not clear if the different locations of the repeat regions in the two sequences are real differences in genome organization or assembly artifacts. We detected transcripts in the C. porcatum RNAseq data for four mitochondrial protein-coding genes and two mitochondrial ribosomal RNAs ( fig. 2 ). The open reading frames (ORFs) of the four transcripts could be translated in full using the genetic code for ciliate mtDNA (NCBI genetic code 4), whereas translation using the predicted nuclear genetic code for this organism (NCBI genetic code 6) introduced premature stop codons. Phylogenetic analysis placed the putative C. porcatum mitochondrial ribosomal RNA genes in the expected part of the ciliate tree ( fig. 1 b ) for this species ( Gao et al. 2010 , 2012 ). The difficulties we experienced in obtaining mtDNA from C. porcatum may reflect the low yield of starting material from these relatively small (∼30 μm in length) cells, each of which contains ∼15 hydrogenosomes ( Esteban et al. 1993 ). For comparison, each larger cell (∼110 μm in length) of M. contortus has been estimated to contain thousands of hydrogenosomes ( Finlay and Fenchel 1989 ). Gene Retention and Loss in Hydrogenosome Genomes The coding capacity of mtDNA in aerobic mitochondria is focused upon proteins needed for the ETC complexes (complexes I–IV and F 0 F 1 ATP-synthase), as well as some of the components needed for their translation by mitochondrial ribosomes, including ribosomal proteins, tRNAs, and the large and small ribosomal RNAs ( Gray 2012 ). The longest and potentially most complete mtDNA sequences from the present study, for M. contortus , M. es , and N. ovalis ( de Graaf et al. 2011 ), contain genes encoding subunits of complex I, mitochondrial ribosomal proteins, rRNAs, and tRNAs ( fig. 2 ), suggesting that the main role of the mtDNA of these species is to encode proteins required to make complex I. All three species appear to have lost genes that are typically encoded by aerobic ciliate mtDNA for complexes III–V ( fig. 2 ), which are responsible for the final stages of aerobic respiration including ATP production. The loss of these complexes appears to be a common feature ( Stairs et al. 2015 ) of the reductive evolution of mitochondrial function in microbial eukaryotes adapting to life under low oxygen conditions (hypoxia). Comparison of the mtDNA from M. contortus , M. es , and N. ovalis , which are all members of the class Armophorea ( Lynn 2008 ), reveals relatively little synteny of gene order ( fig. 2 b ). This contrasts with the mtDNA of closely related aerobic ciliates, including the oligohymenophoreans Tetrahymena thermophila and Paramecium aurelia ( Burger et al. 2000 ) and the spirotrichs Sterkiella histriomuscorum and Euplotes minuta ( de Graaf et al. 2009 ; Swart et al. 2012 ), which have conserved large regions of colinear gene order. It seems possible that the mtDNA rearrangements we observe among armorphorids are associated with reductive gene loss during adaptation to life under hypoxic conditions. A total of 12,396 bp of mtDNA sequence was recovered from M. striatus , in several short contigs and transcripts. These partial data include genes for complex I and ribosomal components ( fig. 2 a ) and includes a gene for Rps13, a ribosomal protein commonly found in the mtDNA of aerobes but not detected for the other Armophorea ( fig. 2 a ). The differences in gene content for individual Armophorea suggest that their last common anaerobic ancestor had a more complete mitochondrial genome than the contemporary species we sampled. The transcriptomics data for mtDNA genes from C. porcatum include genes for two ribosomal proteins, two complex I proteins and, uniquely among the species we investigated, a gene for a putative F 0 F 1 ATP-synthase protein, Ymf66, which is also found in some aerobic ciliates ( supplementary fig. 1 , Supplementary Material online). Proteomic data for the F 0 F 1 ATP-synthase complex from Te. thermophila ( Nina et al. 2010 ) suggest that Ymf66 is a divergent homolog of the F 0 -subcomplex subunit a (also known as Atp6). In particular, it shares a conserved arginine residue, embedded in a predicted transmembrane helix, which is thought to be essential for the function of F 0 -subcomplex subunit a ( Nina et al. 2010 ). Ymf66 appears to be well conserved in the Oligohymenophorea, the ciliate class that includes Cyclidium ( Gao et al. 2010 , 2012 ), and divergent copies of the gene for this protein are present in the mtDNA of the aerobic spirotrichs Sterkiella histriomuscorum ( Swart et al. 2012 ) (NCBI accession: AEV66695) and Euplotes crassus ( de Graaf et al. 2009 ) (NCBI accession: ACX30986). Ciliate Hydrogenosomes Show Different Degrees of Reductive Evolution Most mitochondrial proteins in aerobic ciliates are encoded by the macronuclear genome (the somatic, polyploid genome of ciliates that is transcribed to produce functional proteins) and are synthesized by cytosolic ribosomes before being targeted to mitochondria ( Smith et al. 2007 ). To identify nuclear-encoded mitochondrial genes to complement the new organelle genome data, we analyzed the single-cell transcriptome data sets ( supplementary table 1 , Supplementary Material online) generated for C. porcatum , M. contortus , and P. frontata in detail. Proteins were predicted as functioning in hydrogenosomes either based on their inferred homology with mitochondrial proteins from related organisms, including the ciliate with the best-studied mitochondria, Te. thermophila ( Smith et al. 2007 ), or on the presence of mitochondrial-targeting signals (MTS) (predicted as described in Materials and Methods). The combined data, with the caveat that they are still likely to provide incomplete coverage of individual proteomes, provide insights into the similarities and differences between hydrogenosomes from three phylogenetically distinct anaerobic ciliates. The smaller single-cell transcriptome data sets ( supplementary table 1 , Supplementary Material online) generated for N. ovalis , M. es , M. striatus , and T. finlayi were used to identify putative hydrogenosome proteins including FeFe-hydrogenase, pyruvate:ferredoxin oxidoreductase (PFO), pyruvate:NADP + oxidoreductase (PNO) and the 24- and 51-kDa subunits of complex I. These protein sequences were included in phylogenetic analyses ( fig. 4 ). Hypoxia-Driven Reductive Evolution of the Mitochondrial ETC In aerobic mitochondria, complexes I and II of the ETC reduce ubiquinone generating ubiquinol, which is reoxidized by complex III and the electrons transferred to O 2 via complex IV. This regeneration of ubiquinone is important for maintaining the activity of complex I. Complexes I, III, and IV also pump protons across the inner mitochondrial membrane, generating a proton gradient that can be used by the F 0 F 1 ATP-synthase of complex V to make ATP, as well as supporting protein import into the organelle. Our data suggest that the ETC has been reduced to different degrees in C. porcatum and M. contortus and completely lost, along with the mitochondrial genome, in P. frontata ( fig. 3 ).\n Fig . 3. ( a , d , and g ) Metabolic maps of the hydrogenosomes from Cyclidium porcatum , Metopus contortus , and Plagiopyla frontata , reconstructed based on molecular data sets. The mitochondrial proteins that are shown either were detected from these three species or are present in the ciliate with the best-characterized mitochondria, Tetrahymena thermophila ( Smith et al. 2007 ). Complexes for which all subunits were identified are outlined by a solid line, complexes for which some of the total subunits were identified are outlined by a dashed line, and complexes for which no subunits were identified have no outline and are colored gray. Proteins that are depicted within the hydrogenosome matrix in the metabolic maps were determined as functioning inside the hydrogenosomes, either on the basis of them having predicted N-terminal MTS or because homologs of these proteins are only found inside mitochondria in other organisms. Proteins typically encoded by mtDNA in ciliates are labeled (*). For abbreviations, see supplementary table 2 , Supplementary Material online. ( b , e , and h ) TEM images for C. porcatum ( b ), M. contortus ( e ), and P. frontata ( h ), showing hydrogenosomes (H) and methanogenic endosymbionts (M). Scale bars represent 0.5 μm. Visible cristae within the hydrogenosomes of C. porcatum ( b ) and M. contortus ( e ) are indicated by black arrowheads. ( c , f , and i ) DIC images of living unfixed cells for C. porcatum ( c ), M. contortus ( f ), and P. frontata ( i ). Scale bars represent 20 μm. The subunits of complex I can be divided into three functionally and structurally distinct subcomplexes or modules ( Hunte et al. 2010 ). They comprise the membrane-embedded, proton-pumping P-module (Nad1–Nad6 subunits), the ubiquinone-reducing Q-module (Nad7–Nad10 subunits), and the peripheral, hydrophilic, NADH-dehydrogenase N-module (73-, 24-, and 51-kDa subunits) ( Hunte et al. 2010 ). Metopus contortus appears to have an almost complete complex I with only the Nad4L and Nad6 subunits not detected. These two subunits are typically encoded by mtDNA, and while they form part of the P-module, they are distinct from the antiporter-like subunits, Nad2, Nad4, and Nad5 ( fig. 2 a ), which directly pump protons ( Hunte et al. 2010 ). A similarly complete complex I was previously inferred for N. ovalis , and inhibitor studies for this species have shown that this is responsible for generating the hydrogenosome membrane potential ( Boxma et al. 2005 ; de Graaf et al. 2011 ). We identified all three nuclear-encoded subunits of the N-module for C. porcatum , and three subunits of the Q-module. Given that most of the missing complex I subunits are typically encoded by mtDNA, for which we have little C. porcatum data, we speculate that this species has also retained a functional complex I. Although P. frontata appears to have lost all of the proton-pumping ETC complexes including complex I, a membrane potential needed to support protein import might be generated ( Klingenberg and Rottenberg 1977 ) by the electrogenic exchange of ADP for ATP across the inner hydrogenosome membrane. We identified members of the mitochondrial carrier family (MCF) of inner membrane transport proteins, which could potentially mediate exchange of ADP for ATP, for all three species including P. frontata . Under aerobic conditions, mitochondrial complex II oxidizes succinate to fumarate, transferring electrons to flavin adenine dinucleotide (FAD) that can be used to reduce ubiquinone to ubiquinol. We detected the catalytic subunit of complex II (SdhA) for C. porcatum , and both SdhA and SdhB were detected for M. contortus . Nuclear genes for these two proteins were also previously identified for N. ovalis ( Boxma et al. 2005 ; de Graaf et al. 2011 ). In the absence of complexes III and IV, ubiquinone can be regenerated from ubiquinol by complex II acting in reverse as a fumarate reductase, using electrons from ubiquinol to convert fumarate into succinate ( Tielens et al. 2002 ). The tricarboxylic acid (TCA) cycle enzymes citrate synthase (CS), aconitase (ACO), and isocitrate dehydrogenase (IDH) are not needed for ubiquinone regeneration by this route and appear to have been lost by all three species. The products of previous metabolic labeling experiments for N. ovalis ( Boxma et al. 2005 ) are consistent with succinate production by fumarate reduction and also suggest that the TCA cycle is incomplete for this species. It has previously been suggested that the fumarate reductase activity of N. ovalis complex II is used to regenerate rhodoquinone rather than ubiquinone ( Boxma et al. 2005 ; Hackstein et al. 2008 ). Rhodoquinone has a lower redox potential than ubiquinone and hence may be more suited for transferring electrons to fumarate ( Van Hellemond et al. 1995 ; Tielens et al. 2002 ). The methyltransferase protein RquA is used to convert ubiquinone into rhodoquinone during biosynthesis ( Stairs et al. 2018 ) and was previously detected in genomic and transcriptomic data generated from five aerobic heterotrich ciliates ( Stairs et al. 2018 ). This suggests that aerobic ciliates may also be able to use rhodoquinone under some conditions. However, RquA was not detected in the data for C. porcatum or M. contortus , nor was it previously reported for N. ovalis , despite rhodoquinone being detected in this species ( de Graaf et al. 2011 ; Stairs et al. 2018 ). We detected genes for alternative oxidase (AOX) in C. porcatum and M. contortus , which could potentially be used to regenerate ubiquinone or rhodoquinone ( Tielens et al. 2002 ), using the small amounts of O 2 found in hypoxic habitats as an electron acceptor. Consistent with this possibility, it has previously been shown that the microaerophilic scuticociliate Philasterides dicentrarchi expresses AOX under hypoxic conditions ( Mallo et al. 2013 ). AOX has also been detected in some aerobic ciliates including Tetrahymena ( Young 1983 ). In this case, it is thought that AOX facilitates the continued activity of complex I by providing an overflow for electrons when the complex III-cytochrome-complex IV section of the ETC is saturated, or when cellular requirements for ATP are low ( Young 1983 ). The anaerobic human gut parasite Blastocystis also has an AOX and a partial ETC consisting of complexes I and II ( Tsaousis et al. 2018 ). In Blastocystis , it is suggested that AOX provides a mechanism to cope with fluctuations in environmental O 2 concentration ( Tsaousis et al. 2018 ). Exposure of anaerobes to O 2 is thought to cause an increased production of toxic reactive oxygen species ( Fenchel and Finlay 2008 ), so it is possible that AOX in C. porcatum and M. contortus might also help to mitigate these effects ( Maxwell et al. 1999 ). The Rieske protein was the only subunit of complex III detected for C. porcatum and M. contortus ( fig. 3 ). Rieske protein normally catalyzes the oxidation of ubiquinol, with the electrons transferred to cytochrome c via the catalytic subunits CytC1 and Cob ( Iwata et al. 1996 ). Rieske proteins contain a [2Fe-2S] cluster binding domain, which is present in the homologs detected for C. porcatum and M. contortus . This suggests that the Rieske proteins of these species are under selection to maintain key functional residues and hence may have retained a role in electron transfer. We detected several components of the F 1 F 0 ATP-synthase (complex V) for C. porcatum that gave best blast hits to homologs from other Oligohymenophorea. These include the core catalytic subunits Atpα and Atpβ and the central stalk subunit Atpγ, all of which are part of the F 1 subcomplex ( Davies et al. 2012 ; Vinothkumar et al. 2016 ). We also detected the peripheral stalk oligomycin sensitivity conferring protein subunit ( Giorgio et al. 2018 ) and an assembly factor Atp12 ( Pícková et al. 2005 ). Many of the protein subunits of the F 0 -subcomplex in model eukaryotes have not been identified in ciliates ( Smith et al. 2007 ; Nina et al. 2010 ). Exceptions include the putative F 0 -subcomplex protein, Ymf66 (discussed above) and the Atp9 subunit (also known as subunit c ), both of which are encoded by mtDNA ( Swart et al. 2012 ). The Atp9 subunit forms the membrane-embedded pore of the complex, and while it was not identified in the limited data for C. porcatum , the detection of nuclear-encoded subunits of F 1 F 0 ATP-synthase common to other ciliates ( Smith et al. 2007 ), suggests that C. porcatum may also possess Atp9. Based on these data, it appears possible that C. porcatum , uniquely among the anaerobic hydrogenosome-containing ciliates investigated, has a functional F 1 F 0 ATP-synthase that can make ATP using the proton gradient generated by complex I. The Absence of Cristae Correlates with Loss of the ETC Transmission electron microscopy (TEM) images ( fig. 3 ) of hydrogenosomes from C. porcatum and M. contortus confirm earlier reports for the presence of cristae in these species ( Finlay and Fenchel 1989 ; Esteban et al. 1993 , 1995 ) and the absence of cristae in the hydrogenosomes of P. frontata ( Embley and Finlay 1994 ). The mitochondrial contact site and cristae organising system (MICOS) complex is involved in the formation of cristae junctions and although two subunits of this complex, Mic10 and Mic60, are generally well conserved among eukaryotes ( Muñoz-Gómez et al. 2015 ), only Mic10 was previously detected in ciliates ( Muñoz-Gómez et al. 2015 ; Huynen et al. 2016 ). Consistent with its functional role in cristae formation, we also detected Mic10 in the data for C. porcatum and M. contortus but not in the data for P. frontata . Fe/S Cluster Biogenesis in Ciliate Hydrogenosomes A role in Fe/S cluster biosynthesis is currently thought to be the most conserved biosynthetic function of mitochondrial homologs, and it is the sole biosynthetic function of the highly reduced genome-lacking mitochondrion (mitosome) of Microsporidia ( Goldberg et al. 2008 ; Freibert et al. 2017 ). The iron sulfur cluster (ISC) pathway is used to make the [2Fe-2S] and [4Fe-4S] clusters required for maturation of mitochondrial Fe/S apoproteins ( Lill 2009 ; Freibert et al. 2017 ). Previous work on N. ovalis detected mitochondrial ferredoxin but no other ISC pathway protein in the limited data available for this species ( de Graaf et al. 2011 ). By contrast, we detected almost complete ISC pathways for C. porcatum , M. contortus , and P. frontata ( fig. 3 ), consistent with the detection of mitochondrial Fe/S proteins including ferredoxin, SdhB, and several subunits of complex I. The FeFe-hydrogenase used to make H 2 is also an Fe/S cluster-containing protein ( Akhmanova et al. 1998 ) that, like known nuclear-encoded mitochondrial Fe/S proteins ( Lill 2009 ), is probably imported into the hydrogenosome as an unfolded apoprotein lacking Fe/S clusters. The ciliate enzymes contain predicted MTS, and the close juxtaposition we observe ( fig. 3 b , e , and h ) between endosymbiotic hydrogen-utilizing methanogens ( supplementary fig. 5 , Supplementary Material online) and the hydrogenosomes of each species ( Bruggen et al. 1984 ; Embley and Finlay 1994 ; Lind et al. 2018 ) further support an intraorganelle location for the ciliate FeFe-hydrogenases. Some eukaryotes, including Chlamydomonas and Trichomonas , are thought to use a distinct set of enzymes (HydE, HydF, or HydG) for the maturation of FeFe-hydrogenase ( Meyer 2007 ; Hug et al. 2010 ). However, since none of these proteins were detected in our data, it appears possible that Fe/S clusters are added to the apo-hydrogenase after protein import, by the existing mitochondrial ISC machinery. In yeast and other eukaryotes, the mitochondrial ISC pathway provides a critical substrate for the cytosolic biosynthesis of essential cytosolic and nuclear Fe/S proteins including DNA polymerase ( Paul and Lill 2015 ; Freibert et al. 2017 ). The export of this substrate is mediated in yeast by the mitochondrial ABC transporter Atm1 ( Paul and Lill 2015 ). We detected homologs of Atm1 in all three species ( fig. 3 ), suggesting that ciliate hydrogenosomes have retained this essential role in cellular Fe/S protein biosynthesis. Ciliate Hydrogenosomes Contain Multiple Members of the MCF of Transport Proteins The metabolism of aerobic mitochondria is sustained by the transfer of substrates and metabolites across the inner mitochondrial membrane by dedicated members of the MCF of transport proteins ( Kunji 2004 ). Eukaryotes with canonical mitochondria typically contain between 35 and 55 MCF transporters ( Kunji 2004 ), with 53 MCF detected for the aerobic ciliate Tetrahymena ( Smith et al. 2007 ). By contrast, the genome of Trichomonas vaginalis ( Carlton et al. 2007 ), which has a genome-lacking hydrogenosome, has only five genes annotated as MCF proteins, and Microsporidia have lost all MCF from their minimal mitochondria (mitosomes) ( Goldberg et al. 2008 ; Tsaousis et al. 2008 ; Hjort et al. 2010 ; Freibert et al. 2017 ). We detected 26 MCF for C. porcatum , 37 for M. contortus , and 11 for P. frontata ( fig. 3 and supplementary table 3 and fig. 2, Supplementary Material online), consistent with the retention of diverse mitochondrial functions by the hydrogenosomes of these ciliates. Putative substrates for the ciliate MCF were inferred from phylogenetic analyses when they clustered with characterized MCF from Saccharomyces cerevisiae with bootstrap support values of 80% or over ( supplementary table 3 and fig. 2, Supplementary Material online). We detected putative ADP/ATP, Glycine, and NAD + transporters for all three ciliates. The ADP/ATP transporters are related to yeast homologs that can import and export ATP and thus could potentially support ATP-requiring reactions inside the hydrogenosomes ( fig. 3 ). All three ciliates also have complete glycolytic pathways that could provide the cytosolic ATP used for import. ADP/ATP transporters were also reported previously for N. ovalis ( Voncken et al. 2002 ; Hackstein et al. 2008 ). The detection of putative glycine transporters is consistent with detection of the glycine cleavage pathway, which plays a role in mitochondrial amino acid metabolism and nucleotide biosynthesis. The P-protein of the glycine cleavage pathway is dependent on the coenzyme pyridoxal 5′-phosphate, and we detected a putative pyridoxal 5′-phosphate transporter in C. porcatum . Components of the glycine cleavage pathway were previously detected for N. ovalis ( de Graaf et al. 2011 ). The putative NAD + transporters detected could potentially provide NAD + used in pyruvate decarboxylation ( fig. 3 ). Homologs of the yeast iron transporter Mrs3 were detected for C. porcatum and M. contortus ( fig. 3 ) and putative oxaloacetate, copper/phosphate, and Mg 2+ carriers were detected for C. porcatum. The additional ciliate MCF proteins detected were not assigned a putative substrate because they did not cluster strongly with characterized yeast transporters. However, since most of them cluster strongly with orthologs from Tetrahymena , it seems likely that they sustain functions that are conserved between hydrogenosomes and the mitochondria of this aerobic ciliate. Hydrogenosome Pyruvate Metabolism and ATP Production by Substrate Level Phosphorylation We detected putative hydrogenosomal enzymes for pyruvate decarboxylation for all three ciliates. In yeast, pyruvate is translocated into mitochondria by the mitochondrial pyruvate carrier complex ( Bricker et al. 2012 ; Herzig et al. 2012 ), which consists of two subunits, Mpc1 and Mpc2. Homologs of both subunits are present in the Te. thermophila genome and we detected a homolog of Mpc2 in the data for M. contortus , but not for C. porcatum or P. frontata . In Trichomonas , malic enzyme is used to convert hydrogenosomal malate into pyruvate ( Mertens 1993 ). The malate is imported into hydrogenosomes using the malate/aspartate shuttle, which includes malate dehydrogenase. We identified malic enzyme and malate dehydrogenase from P. frontata , suggesting that it could potentially supply pyruvate using this pathway. We did not detect either enzyme in the data for C. porcatum and M. contortus. The mitochondrial pyruvate dehydrogenase complex (PDH) typically catalyzes the oxidative decarboxylation of pyruvate, yielding acetyl-CoA, NADH, and CO 2 . We detected all four subunits (E1α, E1β, E2, and E3) of the PDH complex (PDH) for M. contortus and P. frontata , suggesting that these species, like N. ovalis ( de Graaf et al. 2011 ), have retained a functional PDH. We also detected the dihydrolipoyl dehydrogenase E3 subunit of PDH for C. porcatum , but since this also functions as part of the oxoglutarate dehydrogenase (OGDH) complex ( Massey et al. 1960 ) and the glycine cleavage system ( Klein and Sagers 1967 ) ( fig. 3 ), it may not indicate the presence of a complete PDH complex. Instead, our data suggest that C. porcatum uses a different enzyme to decarboxylate pyruvate and make acetyl-CoA and NADH, because we detected four homologs of the O 2 -sensitive enzyme PFO. One of these is a classical PFO that is predicted to use ferredoxin as an electron acceptor ( Gorrell et al. 1984 ). The other three genes code for a PFO-fusion protein called PNO ( Nakazawa et al. 2000 ; Rotte et al. 2001 ) that contains a NADPH-cytochrome P450 reductase domain potentially capable of reducing NADP + ( Inui et al. 1984 ). Two of the C. porcatum PNOs contain putative MTS ( supplementary data 1, Supplementary Material online), suggesting that they decarboxylate pyruvate using NADP + inside C. porcatum hydrogenosomes. The lack of MTS for the PFO and remaining copy of PNO suggests that they function in the ciliate cytosol ( fig. 3 ). The hydrogenosomes of Trichomonas vaginalis ( Hrdý et al. 2007 ) produce ATP from acetyl-CoA by substrate-level phosphorylation using acetate:succinate CoA transferase (ASCT) ( van Grinsven et al. 2008 ) and succinyl CoA synthetase (( Jenkins et al. 1991 ). Homologs of ASCT and succinyl CoA synthetase were identified for all three ciliates and previously for N. ovalis ( de Graaf et al. 2011 ), suggesting that ciliate hydrogenosomes may also make ATP by substrate-level phosphorylation ( fig. 3 ). A Mitochondrial Protein Import System in Ciliate Hydrogenosomes Nuclear-encoded mitochondrial proteins are imported into mitochondria using a multicomponent system that has evolved to deliver proteins to different mitochondrial compartments and membranes ( Dudek et al. 2013 ). We detected components from the main mitochondrial translocase complexes (TOM40, TIM22, and TIM23) for all three ciliates ( fig. 3 ). We identified the Tom40 subunit of the TOM40 outer membrane translocase in data for C. porcatum , M. contortus , and P. frontata , the Tom7 subunit for M. contortus and P. frontata , and the Tom22 subunit for M. contortus . We also detected a homolog of Imp1, the inner membrane peptidase used to process N-terminal MTS, for M. contortus . Once through the outer membrane, proteins destined for the mitochondrial matrix or inner membrane are processed separately by either the TIM23 or TIM22 translocase complexes, respectively. Subunits of the TIM23 complex were detected for all three species ( fig. 3 ), consistent with the detection of proteins predicted to have MTS and to function in the matrix of hydrogenosomes ( supplementary data 1, Supplementary Material online). We also detected both subunits (Mas1 and Mas2) of the MPP complex that is used to cleave mitochondrial MTS as they enter the mitochondrial matrix via TIM23 ( Jensen and Dunn 2002 ), for all three ciliates. Tim22 is the only subunit of the TIM22 complex that has so far been detected in Te. thermophila ( Smith et al. 2007 ) and we detected a Tim22 homolog for C. porcatum , but not for M. contortus or P. frontata . Hydrophobic proteins are typically guided to the TIM22 complex by the Tiny Tim chaperones ( Dolezal et al. 2006 ) and we detected Tim10 for C. porcatum and P. frontata . Origin of the Ciliate Multidomain FeFe-Hydrogenase Previous phylogenetic analyses of eukaryotic FeFe-hydrogenases ( Horner et al. 2000 ; Davidson et al. 2002 ; Embley et al. 2003 ; Meyer 2007 ; Hug et al. 2010 ; Greening et al. 2016 ) have recovered most enzymes in a large cluster (called clade A in Hug et al. [2010 ]) that also includes sequences from diverse bacteria. Some bacterial FeFe-hydrogenases are heteromeric complexes formed by two separately encoded proteins, referred to as the large and small FeFe-hydrogenase subunits ( Nicolet et al. 1999 ). By contrast, all of the FeFe-hydrogenases in clade A have a different structure whereby the large and small subunits are encoded together as two subdomains (together forming the H-cluster active site) of the same protein. In the present study, we included representative sequences from clade A and based our analysis ( fig. 4 a and supplementary fig. 3 a , Supplementary Material online) upon the conserved H-cluster of FeFe-hydrogenase sequences.\n Fig . 4. Protein domain structures of key anaerobic metabolism enzymes and corresponding phylogenies, inferred by IQ-TREE using the LG + C60 models: ( a ) the H-cluster, consisting of large (LSU) and small (SSU) subunit domains, of FeFe-hydrogenase; ( b ) NuoE-like domain of FeFe-hydrogenase from ciliates, bacterial NuoE, and eukaryotic 24-kDa subunits of NADH-dehydrogenase; ( c ) NuoF-like domain of FeFe-hydrogenase from ciliates, bacterial NuoF, and eukaryote 51-kDa subunits of NADH-dehydrogenase; eukaryotes are highlighted in red. ( d ) PFO (eukaryotes highlighted in red) and PFO-like domains of eukaryotic PNO (highlighted in green), the branch where the PNO fusion is likely to have occurred is shown. In all phylogenies, α-proteobacteria sequences are highlighted in blue and sequences obtained in the present study are shown in bold. Prokaryotic sequences that are NuoE ( b ) or NuoF ( c ) domains of NuoE-NuoF fusion proteins are indicated (E-F) . Sequences that were also investigated by Esposti et al. 2016 are labelled (*). Support values, displayed as percentages, were generated from 1,000 ultrafast bootstrap replicates for each tree. Scale bars represent the number of substitutions per site. A small number of the FeFe-hydrogenase sequences from ciliates in the present study were truncated and lacked NuoE or NuoF domains, as they were encoded by incompletely sequenced transcripts. In such cases, only the H-cluster domain of these proteins could be analyzed ( a ), hence why they are not present in ( b ) and ( c ). The FeFe-hydrogenases of anaerobic ciliates formed a single strongly supported cluster separate from the other eukaryotes ( fig. 4 a ). With the exception of T. finlayi , we identified multiple FeFe-hydrogenase paralogs for each ciliate, demonstrating that gene duplication is a feature of ciliate FeFe-hydrogenase evolution. Relationships between ciliate FeFe-hydrogenases are consistent with published ciliate relationships ( Gao et al. 2016 ) ( fig. 1 ), in that the basal split is between Metopus / Nyctotherus on one side and Plagiopyla / Trimyema/Cyclidium on the other. This topology suggests that the sampled anaerobic ciliates, which are not monophyletic to the exclusion of ciliates with mitochondria ( Embley et al. 1995 ; Gao et al. 2016 ) ( fig. 1 a ), inherited genes for FeFe-hydrogenase from a common ancestor shared with aerobic ciliates. Although some individual groups in the FeFe-hydrogenase tree ( fig. 4 a ) are strongly supported, the backbone of the tree and hence the relationships between groups are only weakly supported by bootstrapping. The low bootstrap support values in FeFe-hydrogenase trees have been noted before ( Embley et al. 2003 ; Hug et al. 2010 ), with sequence saturation thought to be a contributing factor to the lack of resolution ( Horner et al. 2000 ). To investigate further the strength of support for an independent origin of ciliate sequences, we evaluated whether alternative topological rearrangements under the best-fitting LG + C60 ( Le and Gascuel 2008 ) model could be rejected ( P < 0.05) using the approximately unbiased (AU) likelihood-based test ( Shimodaira 2002 ). The following constraints were evaluated: 1) all eukaryotic FeFe-hydrogenases (plus the bacterium Thermotoga ) constrained as a single group ( P value = 0.424), 2) constraining the ciliate and Vitrella brassicaformis (an alveolate, like ciliates) FeFe-hydrogenases together ( P value = 0.466), and 3) constraining the ciliate and V. brassicaformis FeFe-hydrogenases within the main group of eukaryotic sequences (plus the bacterium Thermotoga ) ( P value = 0.246). The results of these analyses reveal that, although a single separate origin of ciliate FeFe-hydrogenases is favored by the maximum likelihood tree, none of the alternative topologies we tested were significantly rejected using the AU test at P < 0.05. A separate single origin for the ciliate FeFe-hydrogenase is also supported by a common unique multidomain structure. The ciliate FeFe-hydrogenases possess two C-terminal domains with similarity to the NuoE/HoxE and NuoF/HoxF subunits of bacterial NADH-dehydrogenases/NADH-dependent NiFe-hydrogenases ( Horner et al. 2000 ; Boxma et al. 2007 ). The addition of the NuoE-like and NuoF-like domains to an FeFe-hydrogenase appears to be ciliate specific and it is not a feature of the FeFe-hydrogenase of V. brassicaformis . The NuoE-like and NuoF-like domains would potentially allow the ciliate FeFe-hydrogenases to couple the oxidation of NADH to H 2 production ( Akhmanova et al. 1998 ; Horner et al. 2000 ). Separate phylogenetic analyses of the NuoE-like and NuoF-like domains recovered both sets of ciliate sequences as distinct clusters ( fig. 4 b and c ) in trees dominated by bacterial sequences. The observed topological congruence for individual components of the ciliate FeFe-hydrogenase, suggests that they were already together as a functional unit in the ancestral enzyme. Fused NuoE and NuoF subunits encoded by a single gene are also a feature of some bacterial NADH-dehydrogenases (NuoE and NuoF sequences labeled (E-F) in fig. 4 b and c ). The NuoE-like and NuoF-like domains of the ciliate FeFe-hydrogenase are distinct from the homologous 24- and 51-kDa subunits of mitochondrial NADH-dehydrogenase from the same ciliates. The latter cluster with mitochondrial proteins from aerobic eukaryotes and orthologs from alphaproteobacteria, consistent with their origin from the mitochondrial endosymbiont. In agreement with some analyses ( Horner et al. 2000 ; Boxma et al. 2007 ) but not others ( Esposti et al. 2016 ), we recovered no topological support for a specific alphaproteobacterial origin for the ciliate NuoE-like and NuoF-like domains ( fig. 4 b and c and supplementary fig. 3 b and c , Supplementary Material online). Additional analyses of a broader sample of prokaryotic NuoE-NuoF fusion proteins ( supplementary fig. 4 , Supplementary Material online) also failed to provide any support for an alphaproteobacterial ancestry of the ciliate NuoE-like and NuoF-like domains. Our analyses suggest that the unique multidomain FeFe-hydrogenase used to make H 2 in the hydrogenosomes of all three ciliates was inherited from the last common ancestor of the species sampled. Based on our data and the ciliate tree topology, it seems likely that the last common ancestor possessed a mitochondrion that was capable of oxidative phosphorylation, posing the question of how FeFe-hydrogenase, a notoriously oxygen-sensitive enzyme ( Zimorski et al. 2019 ) was retained by, and inherited from, that ancestor. The answer may lie with ciliate ecology and the apparent ease by which diverse ciliates can tolerate and adapt to low oxygen conditions ( Finlay 1981 ; Bernard and Fenchel 1996 ). Ciliates are often very abundant at the oxic/anoxic boundary where they thrive as the main particulate feeders on the rich microbial populations such habitats support ( Finlay 1981 ; Bernard and Fenchel 1996 ). Under low oxygen conditions the NuoE-like and NuoF-like domains of ciliate FeFe-hydrogenase would help to maintain cellular redox balance by oxidizing NADH and regenerating NAD + for glycolysis. This metabolic flexibility could provide a selective advantage for the retention of the FeFe-hydrogenase. It also generates the testable prediction that other anaerobic ciliates that contain hydrogenosomes ( Fenchel and Finlay 1995) will be found to use the same type of FeFe-hydrogenase. An early acquisition and retention of FeFe-hydrogenase among ciliates would have also made them a commonly encountered endosymbiotic niche for anaerobic methanogens living in the same habitats ( Fenchel and Finlay 1995) . The acquisition of endosymbiotic methanogens consuming H 2 would in turn provide ciliates with an additional means of maintaining redox balance in O 2 -depeleted environments ( Fenchel and Finlay 1992 ), enhancing host fitness ( Fenchel and Finlay 1991 ) and facilitating the loss of genes for the later O 2 -dependent stages of the ETC that we observed in our data. The source(s) of the FeFe-hydrogenases used to make H 2 in eukaryotic hydrogenosomes more generally have been much debated ( Embley et al. 1997 ; Martin and Müller 1998 ; Muller et al. 2012 ; Stairs et al. 2015 ). The main ideas discussed are a single common origin from the alphaproteobacterial mitochondrial endosymbiont ( Martin and Müller 1998 ; Martin et al. 2015 ; Esposti et al. 2016 ), or multiple independent origins in different anaerobic eukaryotes thorough lateral gene transfer (LGT) from bacteria occupying the same anaerobic habitats ( Stairs et al. 2015 ). Although our trees cannot exclude the possibility of a common origin for the eukaryotic FeFe-hydrogenases according to the results of AU tests, they provide no topological support for an alphaproteobacterial origin for eukaryotic sequences as a whole, or the ciliate FeFe-hydrogenases in particular. Sequences from alphaproteobacteria were dispersed throughout the tree in clusters containing a mixture of different bacteria, suggesting that LGT, gene duplication, and gene loss could have all played a role in the evolution of bacterial FeFe-hydrogenases ( Horner et al. 2000 ; Embley et al. 2003 ; Esser et al. 2007 ; Hug et al. 2010 ). The significant problems for identifying or eliminating the mitochondrial endosymbiont as a source of eukaryotic genes, like FeFe-hydrogenase (or PFO see below), that such genome fluidity presents, have already been discussed in detail elsewhere ( Embley and Martin 2006 ; Esser et al. 2007 ). PFO and PNO in C. porcatum Some anaerobic eukaryotes use the oxygen-sensitive enzyme PFO for pyruvate oxidation instead of PDH, in either the cytosol (e.g., Giardia ) or the hydrogenosome (e.g., Trichomonas ) ( Muller et al. 2012 ). Like FeFe-hydrogenase, the origin of eukaryotic PFO has been debated with the same possible sources including the mitochondrial endosymbiont or separate LGTs proposed ( Martin and Müller 1998 ; Embley and Martin 2006 ; Martin et al. 2015 ; Stairs et al. 2015 ). Previous studies have been unable to reject monophyly of most eukaryotic PFO sequences including PFO-fusion proteins like PNO, but have nevertheless recovered relationships among eukaryotes and prokaryotes that are difficult to reconcile with simple vertical inheritance ( Horner et al. 1999 ; Rotte et al. 2001 ; Embley et al. 2003 ; Hug et al. 2010 ; Nývltová et al. 2015 ). We obtained a similar picture from our own analyses ( fig. 4 d and supplementary fig. 3 d , Supplementary Material online). Most eukaryotic enzymes cluster together but with no clear indication from current sampling for an origin from the alphaproteobacteria or a specific bacterial group. The eukaryotic PNO sequences were recovered as a single cluster consistent with a common origin through a fusion of PFO with a NADPH-cytochrome P450 oxidoreductase module ( Nakazawa et al. 2000 ; Rotte et al. 2001 ). The four C. porcatum sequences form a single cluster with maximum support within this group that is strongly separated from other alveolates like Cryptosporidium and Vitrella ( fig. 4 d ). The PNO cluster also contains several sequences that have secondarily lost the NADPH-cytochrome P450 oxidoreductase domain and reverted to PFO, including one of the four C. porcatum sequences."
} | 14,019 |
27152330 | PMC4846430 | pmc | 9,457 | {
"abstract": "Pleistocene sea-level change transformed staghorn corals into prolific reef builders that are sensitive to anthropogenic stressors.",
"introduction": "INTRODUCTION The assembly and maintenance of ecological communities are governed by a host of interacting biotic and abiotic processes. Environmental change is often invoked as a historical driver for present distribution patterns ( 1 ). Past environmental change can cause large-scale disruptions in ecological structures such as population bottlenecks ( 2 ) or the reduction of species distributions to refugia ( 3 ), and even extinction ( 4 ). Here, we consider the role of past fluctuating environments in both structuring present-day coral reef communities and constraining their potential response to ongoing anthropogenic change. We focus on the timing of major shifts in coral community dominance in response to eustatic sea level over the past 15 million years (My), leading to the highly successful reef geometry characteristic of modern coral reefs.",
"discussion": "DISCUSSION Sea-level change as a critical factor A number of potential mechanisms might have caused staghorn corals to become a dominant reef builder during the Middle Pleistocene in all reef provinces, including species diversification, nutrient availability, global cooling, and sea-level fluctuations. The temporal incongruence between increasing diversity and increasing dominance, coupled with the occurrence of staghorn coral–dominated reefs in the low-diversity Caribbean (fig. S1) ( 20 ), excludes diversification as the main driving force. During the Early to Middle Pleistocene, carbonate production at Caribbean reefs increased strongly, following oligotrophication of the Caribbean Sea ( 20 , 21 ). In contrast, reefs in the Central Indo-Pacific are exposed to terrestrially derived nutrients as the result of increased relief. These opposite regional trends, in contrast to the global rise of staghorn coral dominance, make changes in nutrient availability an unlikely driver. Similarly, global cooling is also unlikely to have played a major role because staghorn coral dominance is most pronounced in lower latitudes ( 14 , 22 ), and the onset of global cooling at 2.73 million years ago (Ma) ( 23 ) occurred before the shift in staghorn coral dominance. Following a period of relative sea-level stability during the Late Miocene and Pliocene, the world shifted into a regime, atypical of most of Earth’s history ( 22 , 23 ), that comprised up to 50 pronounced glacial-interglacial cycles, including the first major Northern Hemisphere glaciation (FMG) at 2.15 Ma. These cycles resulted in pronounced sea-level fluctuations, with amplitudes of sea-level change increasing from 60 to 80 m to over 100 m after MPT around 0.8 Ma ( 23 , 24 ). Extremes in the rate of sea-level change did not top 8 m/ky before the FMG but since then increased to >8 m/ky, with extremes of up to 15 m/ky (fig. S2). The increase in amplitude was not associated with an increase in the rate of sea-level rise during deglaciations (fig. S2). Sea-level cycles affect coral reef habitat in three ways. First, extensive shelf systems where coral reefs develop are confined to less than 100-m water depth, so that habitat is restricted during sea-level lowstands. For example, a sea-level fall of 60 m reduces the amount of habitat available for coral reefs by 69%, and during the most recent glacial maximum (Last Glacial Maximum) available space was reduced by up to 88% ( 2 , 25 , 26 ). Second, habitat differentiation is reduced during lowstands. For example, the loss of shelf area of less than 100-m water depth limits reef development to nearshore fringing reefs ( 27 ). These fringing reefs face the open ocean, so they experience higher wave energy than present-day high–sea-level coastal reefs that develop behind offshore barrier reefs. Third, as a consequence of the sea-level cycles, reefs were repeatedly forced to relocate across the shelf to track rising and falling levels ( 28 ). Especially in large shelf reef systems, the nearest potentially habitable area could have been tens to hundreds of kilometers away from their highstand location. Rates of sea-level change increased substantially during the Quaternary so that during post-FMG deglaciations, sea-level rose by up to 15 m/ky (fig. S2) ( 29 ). We find a statistically significant relationship between the proportion of staghorn corals in coral assemblages and the rate of sea-level change during the Cenozoic ( Fig. 4 ). In addition to the striking increase in dominance during the Quaternary ( Fig. 3 ), abundant staghorn corals have been reported from some units in the Caribbean ( 16 ) and Tethyan realms ( 15 , 17 ) of the Late Oligocene age, a time interval that also has elevated rates of sea-level change compared to the Middle to Late Miocene ( 22 ). Staghorn corals have a combination of two life history characteristics that make them particularly well suited to high rates of sea-level change: high growth rates and asexual fragmentation. Branches of staghorn coral colonies can achieve skeletal extension rates that are an order of magnitude higher than extension rates observed in other taxa ( 7 ) (fig. S3). Calcification rates in staghorn corals can be two times faster than in other corals ( 30 ). Acropora can reach these high linear extension rates because of a differentiation in calcification rate along the branch, and translocation of photosynthetic products: In Acropora , there is a distinct gradient along branches so that calcification rates observed 2 to 3 cm from the branch tip are only two-thirds of the rate obtained at the tips of branches ( 31 ). Photosynthesis by endosymbionts increases rates of calcification ( 32 ); however, the axial corallites of Acropora do not generally contain abundant zooxanthellae ( 33 ). Instead, the high rate of calcification at the apical polyp is maintained by the efficient translocation of photosynthetic products from the radial polyps via a complex gastrovascular system ( 34 , 35 ). Recent models for the relationship between calcification, respiration, and photosynthesis suggest that calcification rates are promoted by the spatial partitioning of these processes within the coral colony ( 33 ). High rates of calcification are translated into high rates of extension via a two-stage mineralization mechanism in which a thin scaffolding develops first and then is subsequently in-filled by secondary deposits ( 36 , 37 ). Fig. 4 Relationship between inferred rates of sea-level rise and the global proportion of Acropora among global coral genus occurrences. Positive values among modeled rates of sea-level change ( 22 ) are averaged over Bartonian and younger Cenozoic subepochs and compared with the proportion of Acropora plus Isopora occurrences among all coral genus occurrences reported from the same subepochs in the Paleobiology Database. Error bars denote 95% binomial confidence intervals of proportions. R = 0.86, P = 0.001 (Pearson) and ρ = 0.59, P = 0.08 (Spearman). Solid squares, Eocene-Pliocene; open circles, Pleistocene and Holocene. To cope with the challenges of sea-level changes, sessile organisms have the ability to disperse over large distances, settle, and rapidly occupy large areas. Branching corals can disperse over large distances during sexual reproduction and subsequently expand rapidly as the result of asexual fragmentation ( 38 – 40 ), thus filling habitat space more rapidly than massive corals ( 41 ). As long as environmental conditions allow, modern staghorn corals are among the fastest to recover from environmental disturbances ( 42 ). We suggest that fast growth rates, rapid recovery, and asexual fragmentation enabled s taghorn corals to dominate Quaternary reefs. Ecological consequences of staghorn coral dominance The long-term maintenance of reef structures requires that the production of carbonate exceeds the rate of biological, physical, or chemical erosion and transport out of the system, so that the carbonate budget is positive ( 7 ). The high abundance of rapidly growing staghorn corals is known to contribute heavily to local carbonate budgets, in particular, habitats with high rates of bioerosion and off-reef transport ( 43 , 44 ). Predictions based on model data indicate that carbonate production in healthy reef systems is cut by half after the loss of staghorn corals ( 7 ). As a result of the development of higher porosity framework, accretion rates as high as 20 to 30 mm/year have been reported for staghorn coral–dominated deposits ( 44 ). In a direct comparison, accretion rates during the last deglaciation averaged four times higher in staghorn coral–rich communities relative to those where staghorn coral was rare ( 45 ). A switch to staghorn coral–dominated communities increased the accretion rates of reefs and allowed them to keep up with Pleistocene sea-level rise and to differentiate the coastal environment into fringing, lagoonal, and barrier reefs ( 45 ). Sea-level change is a controlling factor in reef accretion, and the presence of staghorn coral is a major contribution to the capacity of reefs to keep up with sea-level rise. Staghorn coral contributes strongly to the structural complexity and rugosity of reefs and therefore plays an important role in the ecosystem functions delivered by coral reefs, including coastal protection and providing habitat for reef-associated biodiversity ( 46 ). Determined by water depth and reef rugosity, reefs dissipate up to 97% of wave energy, with most energy lost at the reef crest ( 47 , 48 ). Richness of local species is facilitated by the increased niche diversity resulting from canopy height and a complex benthic boundary layer afforded by staghorn corals ( 6 ). Over the past decades, worldwide deterioration of coral reefs is widely recognized ( 8 , 9 ). They are increasingly affected by ocean warming and acidification, two severe disturbances associated with climate change. These global-scale impacts interact with the effects of local anthropogenic stresses including overfishing, deterioration of water quality, invasive species, and disease outbreaks. Although we have demonstrated that staghorn coral has been a winner under rapid sea-level changes for the past 2 My, staghorn corals are highly sensitive to both biotic and abiotic stressors. The susceptibility of staghorn coral to predator outbreaks, bleaching, disease, ocean acidification, and water quality is well documented ( 49 – 52 ). The contrast of the evolutionary success of Quaternary staghorn corals against the backdrop of present-day vulnerability begs the question of what reefs would look like in a world without staghorn corals. In the Caribbean, most staghorn coral–dominated reefs have shifted to an alternative coral-depauperate state ( 9 ). Within the Indo-Pacific, coral loss has been less severe, although in many places coral cover or ecological zonation in nearshore reefs has been reduced or lost ( 8 , 53 ). Anthropogenic stressors have affected coastal ecosystems and reduced staghorn coral dominance before monitoring programs started. For example, in inshore reefs of the Great Barrier Reef, a collapse of staghorn coral assemblages occurred between 1920 and 1955 ( 54 ). In Panama, previously abundant A. cervicornis declined before 1960 in coastal lagoons and after 1960 in offshore reefs ( 55 ). Anthropogenic stressors are expected to intensify in the coming decades, and failure to alter this trajectory could result in the ecological extinction of Acropora with a consequent decline in ecological functioning of reef systems ( 46 )."
} | 2,908 |
27462326 | PMC4940416 | pmc | 9,458 | {
"abstract": "Agricultural intensification is placing tremendous pressure on the soil’s capacity to maintain its functions leading to large-scale ecosystem degradation and loss of productivity in the long term. Therefore, there is an urgent need to find early indicators of soil health degradation in response to agricultural management. In recent years, major advances in soil meta-genomic and spatial studies on microbial communities and community-level molecular characteristics can now be exploited as ‘biomarker’ indicators of ecosystem processes for monitoring and managing sustainable soil health under global change. However, a continental scale, cross biome approach assessing soil microbial communities and their functional potential to identify the unifying principles governing the susceptibility of soil biodiversity to land conversion is lacking. We conducted a meta-analysis from a dataset generated from 102 peer-reviewed publications as well as unpublished data to explore how properties directly linked to soil nutritional health (total C and N; C:N ratio), primary productivity (NPP) and microbial diversity and composition (relative abundance of major bacterial phyla determined by next generation sequencing techniques) are affected in response to agricultural management across the main biomes of Earth (arid, continental, temperate and tropical). In our analysis, we found strong statistical trends in the relative abundance of several bacterial phyla in agricultural (e.g., Actinobacteria and Chloroflexi ) and natural ( Acidobacteria, Proteobacteria , and Cyanobacteria ) systems across all regions and these trends correlated well with many soil properties. However, main effects of agriculture on soil properties and productivity were biome-dependent. Our meta-analysis provides evidence on the predictable nature of the microbial community responses to vegetation type. This knowledge can be exploited in future for developing a new set of indicators for primary productivity and soil health.",
"conclusion": "Conclusion We provide a detailed characterization of how bacterial communities change following the conversion of natural to agricultural systems, and reveal community-scale trends that hold across tropical, temperate, continental, and arid biomes. We propose that measures of microbial abundance may serve as indicators of changing to soil health before actual decline in physico-chemical properties are detected. Although our meta-analysis is derived from comprehensive datasets on the effect of agriculture on soil properties and the relative abundance of microbial taxa, this global dataset does not mirror the current hot spots of land use changes. New efforts are needed to quantify the effect of land use changes in South East Asia and Africa, also taking to account the carbon-rich wetland forests and degradation cascades within land-use classes. Nevertheless our meta-analysis provides clear signals on the predictable nature of the microbial community responses to land-use types which can be used to conceptualize future studies on understanding of human decision-making for soil health and biodiversity.",
"introduction": "Introduction Soil health is the capacity of a soil to function, within natural or managed ecosystem boundaries, to sustain plant productivity, maintain water and air quality, support human well-being, and provide habitats for biodiversity ( Doran and Zeiss, 2000 ; Doran, 2002 ; Gugino et al., 2009 ). Human impacts on soil health largely emerge from the need to meet the food, fiber, and fuel demands of an ever increasing population. In the last few decades significant efforts have been made to increase agricultural productivity through increased fertilization and pesticide application, improved irrigation, soil management regimes and crops, and massive land conversions ( Tilman et al., 2002 ). There is increasing concern, however, that agricultural intensification is placing tremendous pressure on the soil’s capacity to maintain its other functions leading to large-scale ecosystem degradation and loss of productivity in the long term ( Tilman et al., 2001 ; Foley et al., 2005 ; Vitousek et al., 2009 ). For example, conversion of natural ecosystems to agricultural lands have incurred substantial environmental costs, including desertification, increased emissions of greenhouse gasses, decreased organic matter in soils, loss of biodiversity, and alterations to biogeochemical and hydrological cycles ( Balmford et al., 2005 ). Modern agriculture thus faces great challenges not only in terms of ensuring global food security by increasing yields but also mitigating the environmental costs particularly in the context of a changing environment and growing competition for land, water, and energy ( Chen et al., 2014 ). Therefore, there is an urgent need to find early indicators of soil health degradation in response to agricultural management ( Grime, 1997 ; Cardoso et al., 2013 ). Different terrestrial biomes may respond differentially to agricultural over-exploitation. For instance, arid lands, which occupy 40% of the globe and sustain 38% of the human population ( Millennium Ecosystem Assessment [MEA], 2005 ), are very low productivity systems and contain low levels of nutrients ( Reynolds et al., 2007 ; Feng and Fu, 2013 ). These ecosystems are highly vulnerable to global environmental changes and desertification ( Reynolds et al., 2007 ; Dai, 2013 ) and may further suffer high reductions in nutrient availability in response to agricultural over-exploitation ( Delgado-Baquerizo et al., 2013 ). On the other hand, highly productive agro-systems such as those from tropical regions may be highly resistance/resilience to agriculture uses, in part due to their rapid organic matter turnover and moisture/water availability ( Schlesinger and Bernhardt, 2013 ). Limited effort has been made to understand the global trends that characterize microbial community composition in natural and agricultural systems ( Crowther et al., 2014 ) which hinder our ability to anticipate the consequences of conversion in the different biomes on Earth. Evaluation of soil health requires indicators of chemical, physical and biological (including microbial) components contribute to maintaining soil health. Cultivation is known to generally reduce the amount of soil organic matter thus reducing nutrient availability ( Schlesinger and Bernhardt, 2013 ). Similarly, changes in land use are altering both microbial community structure and diversity in terrestrial ecosystems ( Rodrigues et al., 2013 ). Since soil bacterial communities drive many different ecosystem functions (e.g., Delgado-Baquerizo et al., 2016b ), and their abundance, richness, and composition are sensitive to the changes in the land use and management ( Gans et al., 2005 ; Wall et al., 2010 ; Singh et al., 2014 ), they have been considered as early indicators of change in the quality of soil ecosystems ( Kennedy and Stubbs, 2006 ). In some instances, changes in microbial populations or activity can precede detectable changes in soil physical and chemical properties, thereby providing an early sign of soil improvement or an early warning of soil degradation ( Pankhurst et al., 1997 ; Nielsen et al., 2002 ). At local scale fluctuations in microbial diversity and community composition are correlated with reductions in soil C and nitrogen (N) ( Acosta-Martinez et al., 2008 , 2010 ; Jangid et al., 2008 ; Trivedi et al., 2015 ). On global scale, however, land use change to agriculture systems on the soil C and N contents are more idiosyncratic ( Johnson and Curtis, 2001 ), and negligible effect of conversion has been reported on microbial biomass from several biomes ( Holden and Treseder, 2013 ). Since microorganisms are involved in many soil processes, they may also give an integrated measure of soil health, an aspect that cannot be obtained with physical/chemical measures alone ( Nielsen et al., 2002 ; Kibblewhite et al., 2008 ; Mueller et al., 2010 ; Sharma et al., 2011 ). In recent years, major advances in soil meta-genomic and spatial studies on microbial communities and community-level molecular characteristics can now be exploited as ‘biomarker’ indicators of ecosystem processes for monitoring and managing sustainable soil health under global change. However, a continental scale, cross biome approach assessing soil microbial communities and their functional potential to identify the unifying principles governing the susceptibility of soil biodiversity to land conversion is lacking. In the face of current anthropogenic pressure on soil ecosystems, for instance owing to agricultural intensification and climate change, there is a need to better understand the effects of these factors in order to predict and mitigate the impacts of such changes ( Kuramae et al., 2012 ). However, reliable predictions of the potential consequences of perturbations are hampered by the lack of global level baseline knowledge on soil properties and soil microorganisms. Herein we conducted a meta-analysis to explore how soil properties (pH, total C and N; C:N ratio), primary productivity (NPP) and microbial diversity and composition (relative abundance of major bacterial phyla) are affected in response to agricultural management across the main biomes of Earth (arid, continental, temperate and tropical). The aim of the meta-analysis was to identify the impact of agriculture practices on soil nutritional health and microbial communities. We also aimed to examine if the response of microbial community to agriculture is consistent across all the biomes. We collected data from 102 peer-reviewed publications as well as unpublished data to create a global dataset of soil bacterial diversity and composition evaluated with next generation sequencing techniques (mostly 454 Pyrosequencing). Our meta-analysis revealed foreseeable nature of the microbial community responses to vegetation types suggesting that the microbial indicators can be developed as tools for prediction for primary productivity and soil health.",
"discussion": "Discussion NPP Differed between Agricultural and Natural Systems Only in Continental and Temperate Biomes Terrestrial NPP represents the total annual growth of land vegetation and is the basic resource for food, fiber, and energy ( Vitousek et al., 1986 ; Running, 2012 ; Krausmann et al., 2013 ). In addition, terrestrial NPP is also a major component of the global C cycle, and a critical precursor to net C storage. Changes in NPP due to agricultural conversion could result in either enhancing or mitigating increments in atmospheric CO 2 concentrations and climate warming ( Fargione et al., 2008 ; Searchinger et al., 2008 ). Latitudinal control of insolation (solar radiation that reaches earth surface) on photosynthesis results in a noticeable decrease in NPP from tropical ecosystems to those in the middle or higher latitudes ( Figure 2 ). It is generally assumed that agricultural ecosystems are significantly less productive (e.g., by harvest-induced reductions in growing season length) than natural systems in the same environment ( Smith et al., 2014 ). On the contrary it can also been argued that agricultural conversion at a local scale can increase NPP (e.g., by management inputs that reduce biophysical growth limitations) ( Long et al., 2006 ). In our analysis we observed a significant reduction in NPP in agro-ecosystems as compared to natural ecosystems in continental and temperate environments ( Figure 2 ). In similar environments, Smith et al. (2014) have reported a significant decrease in NPP due to agricultural conversion that was independent of conversion type, management intensity, crop type, or regions. Our analysis revealed a decrease in NPP in agro-ecosystems in tropical regions ( Figure 2 ), however it was not as steep as reported by other workers ( Smith et al., 2014 ). As most of our sites in tropical regions were situated in the industrialized west and Asia, the non-significant decrease in NPP in agricultural sites might be due to the relatively intensive management practices and crop types which could contribute to higher rates of productivity that more closely match those of natural vegetation ( Gelfand et al., 2013 ; Smith et al., 2014 ). Similarly, in arid regions our analysis showed no differences between NPP of agricultural and natural systems ( Figure 2 ). It seems that in nutrient poor systems, such as arid system climate constrains do not allow an increase in NPP. In arid regions, water availability will be the major constraint on NPP and the plants will be more sensitive to precipitation variation than soil management ( Zhu and Southworth, 2013 ). Trends Obtained from Properties Linked to Soil Nutritional Health Were Not Consistent in Agriculture vs. Natural Systems among All the Climatic Regions Agriculture practices generally results in a decline in soil nutrients. However, nutrients inputs, from both natural and synthetic sources can improve plant growth that increases organic matter returns leading to improvement in soil quality ( Smith et al., 2015 ). Changes in soil properties can vary markedly with type of land cover, climate, and method, extent of vegetation removal (e.g., land clearing, fires, mechanical harvest), and management post harvests. Here we discuss trends obtained from our meta-analysis on the soil chemical properties of agricultural vs. natural systems in different climatic regions. Soil Carbon As the dominant land-use change during the past century, conversion of natural systems for agricultural production has greatly altered soil C dynamics at ecosystem, regional, and global scales ( Foley et al., 2005 ; Bala et al., 2007 ; Don et al., 2011 ; Yonekura et al., 2012 ; Zhang et al., 2015 ). The depletion of soil total C due to the intensification of agriculture and land-use change from natural to croplands is exacerbated through agricultural practices with low return of organic material and other various factors including oxidation/mineralization, leaching and erosion ( Post and Kwon, 2000 ; Wu et al., 2003 ; Lal, 2004 ; Zhang et al., 2015 ). In a meta-analysis, Guo and Gifford (2002) showed that the conversion of native forests and pastures to croplands reduced soil C stocks by 42 and 59%, respectively. The results varied, however, depending on factors such as annual precipitation, plant species and, the length of study periods. Our analysis indicated that total C % of agricultural soils were lower as compared to natural soils in temperate regions ( Figure 3B ). However, no significant difference in total C % in agricultural vs. natural systems were observed in other regions. Previous studies have reported negative, positive, and negligible effects of land conversion on soil C content ( Bashkin and Binkley, 1998 ; Vesterdal et al., 2002 ; Yang et al., 2011 ; Zhang et al., 2015 ). For example, 13% of the croplands included in a meta-analysis on the impact of tropical land use change on soil organic matter reported similar to higher soil C stocks in agricultural soils than forests ( Don et al., 2011 ). The different sampling schemes, estimation methods, and the complexity of factors affecting soil C dynamics are attributed to the inconsistency in various studies ( Don et al., 2011 ; Li et al., 2012 ). Following the land-use change, litter input from new vegetation will be terminated and replaced by litter from new vegetation, while the soil C derived from the former litter would be decomposed and mineralized by soil microbes ( Zhang et al., 2013 ). Thus soil C stocks would be controlled not only by the degradation of old C (soil C previous to conversion) but also by the addition of new soil C (C derived from new vegetation after land use) ( Del Galdo et al., 2003 ; Mendez-Millan et al., 2014 ). Our observations, particularly in Continental and Tropical regions, is in contrast to most previous studies ( Guo and Gifford, 2002 ; Don et al., 2011 ) that have reported significant lower soil C in agricultural soil as compared to natural soils. This discrepancy may arise due to differences in management practices and disturbance regimes including tillage, residue retention, grazing and the duration of change in land use. Wiesmeier et al. (2015) has reported that soil cultivation may not generally result in the strong decline in soil C content, as management practices such as tillage probably promote the formation of organo-mineral associations and relocation of soil C with depth may decrease decomposition. No significant change in soil C in agricultural soils in arid/tropical regions results from boosted productivity and higher turnover rates adding more C to the soil due to organic manure/fertilizer application as well as the effect of crop residue, and irrigation regimes ( Zhang et al., 2013 ). Soil N Conversion of natural lands into arable lands is not only characterized by losses of ecosystem C stocks, but also by significant losses of ecosystem N stocks along hydrological pathways, gaseous volatilization or through erosion ( Tiessen et al., 1982 ; McLauchlan, 2006 ). A meta-analysis using mainly data from tropical sites indicated that the average loss of soil N after conversion of forests to croplands was 15% ( Murty et al., 2002 ). Dalal et al. (2013) reported that conversion of native vegetation to perennial pasture and cropland in Australia resulted in N losses of more than 20 and 38%, respectively. Our analysis did not revealed significant differences in soil N % between agricultural and natural soils from continental, temperate, and tropical regions. We argue that the extensive use of chemical N fertilizer in agricultural soils will compensate for N losses through natural processes thereby maintaining total soil N concentrations to the levels similar to natural soils. In addition, the introduction of leguminous plants to crop rotations ( Tiessen et al., 1982 ) or the application of organic fertilizers ( Griffin et al., 2005 ), can support an increase in N stocks. Our analysis showed a significant higher total soil N in agricultural systems from arid regions compared to natural systems. In arid regions SOC and N stocks have been reported to depend strongly on soil types with strong interactions between soil type and land use ( Mayes et al., 2014 ). Increases in the soil N in arid regions might also be the result of preference to grow leguminous crops which have a lower water requirement ( Creswell and Martin, 1998 ). Soil pH Comparing soils from a similar climate in tropical, continental, and temperate regions, soils from agricultural systems tend to be more alkaline than natural soils. Liming in agricultural soils is also one of the major factors leading to an increase in soil pH ( Armstrong et al., 2015 ). The greatest (positive) effects with pH were seen in the acidic soils, however, in arid regions where the pH tends to be more alkaline, our analysis showed no significant differences between agricultural vs. natural soils suggesting that impact of agricultural practices was soil dependent. Contrary to agricultural systems, natural ecosystems trend to be more acid in general. This difference in acidity can be generated through several mechanisms, including increased production of organic acids or through the generation of carbonic acid from higher rates of autotrophic respiration in natural soils ( Richter and Markewitz, 1995 ). The increased acidity of forests may also be caused by increased uptake of cations by trees and consequent changes in the proportions of cations adsorbed to the soil exchange complex ( Jobbagy and Jackson, 2004 ). Berthrong et al. (2009) have reported that higher acidity in natural soils can also be driven by changes in the proportions of cations such as Ca, Mg, Na, and K. Response of Soil Bacterial Community It could be argued that our analyses suffer from biases such as those related to the different primer sets used by the studies included in our database. However, results from our previous study ( Delgado-Baquerizo et al., 2016b ) clearly demonstrate that primers pairs, sequencing platform, and the method of soil sampling does not significantly alter the microbial diversity and relative abundance of major soil bacterial phyla and that next generation sequencing data can be as useful as other available data to evaluate global patterns in microbial ecology. We argue that the point of variability in the results on the relative abundance of major bacterial phyla using different primer-set ( Engelbrektson et al., 2010 ; Cai et al., 2013 ; Fredriksson et al., 2013 ) can be critical in local studies as in these cases the variability among primer sets may overlap the spatial variability within a particular plot or the effects of a given treatment on the abundance of these bacteria. However, small changes in relative abundance of different phyla that could be attributed to using different primer sets ( Engelbrektson et al., 2010 ; Cai et al., 2013 ; Fredriksson et al., 2013 ) is unlikely to bias results from a global-scale meta-analysis like the one performed in the present study ( Delgado-Baquerizo et al., 2016b ). These variations are indeed a part of the intrinsic noise one may expect in similar meta-analyses conducted with other soil microbial variables ( Fierer et al., 2009 ; Serna-Chavez et al., 2013 ). Microbial Diversity in Agriculture vs. Natural Systems Understanding the mechanisms that control the extent to which soil properties and microbial communities change following the conversion of natural to agricultural systems is of paramount importance to comprehend the consequences of land use changes for soil health and agricultural productivity ( Sala et al., 2000 ). Management practices such as tillage and crop rotation; periodic fertilization; and pesticide application generate temporal and spatial changes in soil physical and chemical properties in agricultural systems ( Carbonetto et al., 2014 ). The agricultural systems thus represents rapidly fluctuating environments with highly variable resource gradients and greater bio-physical and chemical heterogeneity as compared to natural systems, thereby providing a wide range of niches for microbial growth. This variability and heterogeneity can result in increased diversity in agricultural systems as compared to stable natural systems. In fact our meta-analysis revealed that microbial diversity increased significantly in agricultural systems of arid and temperate regions ( Figure 4 ). The fact that diversity increased or was not markedly altered (continental and tropical regions) as a consequence of agriculture activities is not unexpected. In fact, microbial communities in natural systems may be limited by nutrient availability and therefore fertilizer addition may allow colonization by new species from the regional pools ( Jangid et al., 2008 ; Upchurch et al., 2008 ; Jesus et al., 2009 ; Lee-Cruz et al., 2013 ; Crowther et al., 2014 ; Figuerola et al., 2015 ). However it has been reported that although local taxonomic and phylogenetic diversity of soil bacteria increases after conversion, communities become more similar across space ( Rodrigues et al., 2013 ; Figuerola et al., 2015 ). The homogenization of microbial communities in response to human activities is driven by the loss of soil bacteria with restricted ranges (endemics) from the natural systems and results in a net loss of diversity ( Rodrigues et al., 2013 ; Figuerola et al., 2015 ). As soil microbial diversity drives multiple ecosystem functions related to plant productivity ( Delgado-Baquerizo et al., 2016a ), we argue that microbial biodiversity loss (through homogenization of microbial community) should be taken into account when assessing the impact of land use change. Relative Abundance of Major Bacterial Phyla in Agricultural vs. Natural Systems In our analysis, despite the complex nature of soil microbial communities, we found general patterns characterizing microbial community responses to land use change at the continental scale which can provide strong framework for future experiments to generate empirical evidence. Across all regions, the relative abundance of phylum Acidobacteria was significantly greater in natural ecosystems as compared to agricultural systems ( Figure 5 ). In contrast the relative abundance of Verrucomicrobia was higher in agro-ecosystems in continental, temperate and tropical regions. Interestingly both of these groups are classified as “oligotroph” (r-strategists, Fierer et al., 2007 ; Trivedi et al., 2013 ) based on lower growth rates and on a preference for growing on relatively recalcitrant forms of C. Although both Acidobacteria and Verrucomicrobia seems to be dominant groups in soil, their ecology remains poorly understood as the members of these group are difficult to culture and study in the laboratory ( Bergmann et al., 2011 ; Fierer et al., 2013 ). The negative effect of agricultural systems on Acidobacteria may be also related to higher pH in agro-ecosystems compared to natural ecosystems. The relative abundance of Proteobacteria was higher in natural soils as compared to agricultural soils in all regions apart from arid regions ( Figure 5 ). Many members of Proteobacteria are classified as plant growth promoting bacteria that facilitates nutrient acquisition and provides protection against diseases ( Lugtenberg and Kamilova, 2009 ). Lower relative abundance of Proteobacteria in agricultural soils can thus have important implications for plant productivity and soil health. Interestingly, we observed that the decrease in proportion of Cyanobacteria was accompanied by an increased proportion of Chloroflexi in agricultural systems of Arid, Continental, and Temperate regions. The metabolic flexibility of Chloroflexi ( Strauss and Fuchs, 1993 ) can provide a competitive advantage against Cyanobacteria for limiting nutrients or physical space when they co-occur in the same environment especially in fluctuating environmental conditions in agricultural soils. Change in the ratio between Cyanobacteria and Chloroflexi has been implicated to be the result of physical disturbances that lead to the destruction of the microscale topography, decreased N availability and likely altered soil moisture retention and soil surface albedo ( Kuske et al., 2012 ). Therefore, the relationship between these two related phyla in soil environments has to be investigated in details to develop early warning tools for soil degradation. Microbial Indicators of Soil Fertility and Primary Productivity The results of our meta-analysis provide useful information about the global distribution of several groups of numerically abundant bacterial phyla in agricultural vs. natural systems across contrasting climatic regions. It was demonstrated that certain bacterial phyla responded differentially to the conversion of natural to agro-ecosystems and the trend was consistent across all studied regions. For example, the relative abundance of Acidobacteria was higher in natural systems while the abundance of Chloroflexi was higher in agricultural systems. In our analysis, the dataset is derived from the relative abundance of major bacteria groups using next generation sequencing; however, previous studies have shown a significant correlation between the relative abundance and absolute numbers of major bacterial groups using qPCR ( Trivedi et al., 2015 ). Our findings highlight the potential of molecular tools to identify bacterial groups that may serve as potential indicators to assess the sustainability of agricultural soil management and to monitor trends in soil condition over time. It can be argued that the selection of indicator species based solely on the frequency of occurrence does not permit conclusions about the process in which they are involved ( Figuerola et al., 2012 ). However, as discussed above the relative abundance of groups showing consistent trends in abundance in natural and agricultural systems across all the regions can be inferred by their trophic life-strategies and related to soil physio-chemical parameters. Therefore, it can be validly postulated that the abundance of these groups reflects true habitat specialization underlying ecological selection based on soil management. The abundance of the suggested bacterial phyla is easily measured since well-established molecular and conventional culturing protocols for quantification are available ( Fierer et al., 2012 ); they are sensitive to soil management actions and are integrative, i.e., provide adequate coverage across a relatively wide range of ecological variables, soil types, climate, crop sequence, etc. Herein we provide a regional scale framework for developing appropriate tests for simple monitoring of proposed candidate biological indicators that can be integrated into a minimum dataset, to facilitate measuring the impact of agriculture on soil health. This will allow the development of base-line values and ranges to incorporate microbial indicators in management decisions. However, significant background work including identifying context of monitoring (aridity vs. productivity), selection parameters for biological indicators (positive or negative) need to be tested and validated before an efficient indicator of primary productivity can be developed for monitoring purpose."
} | 7,369 |
28976744 | null | s2 | 9,462 | {
"abstract": "Synthetic diblock copolypeptides were designed to incorporate oppositely charged ionic segments that form β-sheet-structured hydrogel assemblies via polyion complexation when mixed in aqueous media. The observed chain conformation directed assembly was found to be required for efficient hydrogel formation and provided distinct and useful properties to these hydrogels, including self-healing after deformation, microporous architecture, and stability against dilution in aqueous media. While many promising self-assembled materials have been prepared using disordered or liquid coacervate polyion complex (PIC) assemblies, the use of ordered chain conformations in PIC assemblies to direct formation of new supramolecular morphologies is unprecedented. The promising attributes and unique features of the β-sheet-structured PIC hydrogels described here highlight the potential of harnessing conformational order derived from PIC assembly to create new supramolecular materials."
} | 244 |
39110940 | PMC11345768 | pmc | 9,464 | {
"abstract": "Membrane technology plays a central role in advancing\nseparation\nprocesses, particularly in water treatment. Covalent organic frameworks\n(COFs) have transformative potential in this field due to their adjustable\nstructures and robustness. However, conventional COF membrane synthesis\nmethods are often associated with challenges, such as time-consuming\nprocesses and limited control over surface properties. Our study demonstrates\na rapid, microwave-assisted method to synthesize self-standing COF\nmembranes within minutes. This approach allows control over the wettability\nof the surface and achieves superhydrophilic and near-hydrophobic\nproperties. A thorough characterization of the membrane allows a detailed\nanalysis of the membrane properties and the difference in wettability\nbetween its two faces. Microwave activation accelerates the self-assembly\nof the COF nanosheets, whereby the thickness of the membrane can be\ncontrolled by adjusting the time of the reaction. The superhydrophilic\nvapor side of the membrane results from −NH 2 reactions\nwith acetic acid, while the nearly hydrophobic dioxane side has terminal\naldehyde groups. Leveraging the superhydrophilic face, water filtration\nat high water flux, complete oil removal, increased rejection with\nanionic dye size, and resistance to organic fouling were achieved.\nThe TTA-DFP-COF membrane opens new avenues for research to address\nthe urgent need for water purification, distinguished by its synthesis\nspeed, simplicity, and superior separation capabilities.",
"conclusion": "Conclusions In summary, we have developed an approach\nto rapidly synthesize\nhighly crystalline dual superhydrophilic/near-hydrophobic free-standing\nCOF membranes by using a microwave-mediated self-assembly method at\nthe liquid-water vapor interface. This technique produces COF membranes\nwith exceptional rejection rates, which represents a significant progress\nin COF membrane synthesis. Our method offers a distinct advantage\nover previous techniques as it avoids the typically slow diffusion\nand lengthy amorphous-to-crystalline transformation processes. This\nefficiency directly addresses the existing challenge of preparing\nCOF membranes suitable for molecular separation in a more straightforward\nmanner. Our approach lays the foundation for the synthesis of high-quality\ncrystalline, free-standing COF membranes. By tuning the reaction\ntime, we can adjust both the membrane thickness\nand its wettability characteristics. The TTA-DFP-COF membrane has\na unique combination of hydrophilic and near-hydrophobic properties\nderived from its surface chemistry and micro/nanotexture. The smoother\nvapor face inherits its hydrophilic nature from the reaction between\nthe terminal −NH 2 groups of the TTA precursor and\naqueous acetic acid, while the rougher dioxane face is enriched with\nterminal aldehyde groups. The duality of this membrane enhances\nits water permeability and\nmakes it superior in organic fouling resistance compared to standard\npolymeric membranes. Furthermore, it shows exceptional performance\nin removing oil from oil-in-water mixtures and has a water flux of\napproximately 3600 L m –2 h –1 .\nThis performance is due to its multilayered structure and consistent\nporosity. In tests, the TTA-DFP-COF membranes showed outstanding rejection\nrates for anionic dyes with sizable molecules, along with significant\nantimicrobial efficacy against bacteria such as E.\ncoli and S. aureus ,\nwhile being biocompatible. Our technology can particularly be\nsuited for small-scale applications.\nWith its unique properties, the TTA-DFP-COF membrane sets a new standard\nin membrane technology and ideal for use in columnar systems or household\nwater filters. Its simple production, excellent purification performance\nand antibacterial properties make it an innovative solution for tackling\nthe global water crisis and underline its importance for access to\nclean water.",
"introduction": "Introduction Membrane technology has gained considerable\nattention in the field\nof filtration due to its ability to efficiently replace conventional\nenergy-intensive separation techniques. 1 , 2 Developing\nmembranes with a bottom-up approach and the flexibility to control\ntheir porous structure and surface properties could represent a breakthrough\nin many separation processes, particularly in water treatment. 3 , 4 Reticular materials, such as metal–organic frameworks (MOFs)\nand covalent organic frameworks (COFs), offer unprecedented opportunities\nin the bottom-up approach for membrane synthesis. 5 − 7 Their precisely\ntunable structures and self-assembling behavior enable the controlled\narrangement of building blocks to create well-defined membrane structures\nwith tailored properties. 8 COFs have emerged\nas an intriguing family of porous nanomaterials composed of lightweight\nelements (C, N, O, B, etc.) that exhibit excellent structural diversity,\ntunable and permanent porosity, ordered structures, and high thermal\nand chemical stability. 9 − 11 These properties make COFs attractive for various\napplications such as gas adsorption, 12 , 13 water treatment, 14 energy storage, 15 , 16 sensing, 17 , 18 drug delivery, 19 − 23 and catalysis. 24 , 25 Most COFs synthesized by the\nconventional solvothermal procedure are obtained as insoluble powders.\nMany attempts have been made to develop COF-based membranes, including\nmixed matrix membranes and self-standing membranes by interfacial\npolymerization. 26 − 30 COF-based mixed matrix membranes are easy to make, versatile, and\ncould change the properties of polymeric membranes, but the porous\nstructure of the polymeric matrix determines the filtration efficiency. 29 On the other hand, interfacial polymerization\nhas been used to prepare self-standing COF membranes, but their synthesis\nis time-consuming and could take many days, and they are mostly grown\nas a thin film on a substrate ( Table S1 ). 30 In addition, the poor solubility\nof most aromatic amine building blocks makes it challenging to apply\ninterfacial polymerization for COF membranes’ synthesis at\na liquid–liquid interface. 31 Interfacial\npolymerization at the liquid–air interface has also been reported\nfor the fabrication of self-standing COF membranes. 32 , 33 However, a Langmuir–Blodgett method was required to transfer\nthe COF thin film from water to a substrate, and the process had to\nbe repeated to obtain a robust COF filtration membrane. In addition,\nthe COF monomers must have an amphiphilic nature to interpose between\nthe organic phase and water interface. While synthesizing COFs as\nmembranes is important, it is essential to ensure that the process\nis both rapid and straightforward, requiring as few steps as possible\nto enable large-scale production. Moreover, many studies on COF membranes\nfocus on controlling their pore size, 34 − 36 but reports on controlling\nthe wettability of the membrane surface remain rare, even though it\nis one of the most important physicochemical properties of membranes. 37 The organic nature of COFs and their hydrophobicity\nmake it challenging to modify the surface wettability of a COF membrane\nwithout changing its structure’s building blocks, functionalizing\nit, or treating it post-synthetically, which could be time and energy-consuming.\nFor this reason, most studies focusing on the surface wettability\nof COF membranes have attempted to produce superhydrophobic membranes\nor membrane coatings. 38 , 39 However, the studies in polymeric\nmembranes are shifting to the fabrication of hydrophilic and superhydrophilic\nmembranes and membrane coatings to increase water flux and reduce\norganic fouling of membranes, which is one of the major challenges\nfor their commercialization. 40 − 42 Therefore, developing a fast\nand simple method to synthesize self-standing COF membranes with tunable\nhydrophilicity is challenging but essential for industrial membrane\napplications. Recently, a self-standing COF membrane was synthesized\nby covalently linking the building blocks at the liquid–solid\ninterface and used for membrane distillation. 37 The surfaces of the membranes were then modified by a reverse imine-bond\nformation reaction to produce a hydrophilic surface, reduce membrane\nfouling, and increase water flux. However, the membrane preparation\nprocess takes up to 4 days, and treating it with an alkaline solution\nto obtain a hydrophilic surface takes an additional 18 to 24 h, necessitating\nnearly 5 days to make the modified membrane. In another study, solvent-induced\nfragmentation was used to tune the surface wettability of a self-standing\n3D COF membrane, resulting in a higher hydrophobicity of the membrane\nsurface. 43 However, the membrane preparation\ntakes 2 days, and the study focuses on hydrophobic and superhydrophobic\nCOF membrane surfaces. In this study, we have successfully synthesized\na series of dual\nsuperhydrophilic/near-hydrophobic self-standing imine-linked TTA-DFP-COF\nmembranes. The novelty of this study lies in the rapid and one-step\nmembrane synthesis and the ability to control the surface properties\nof the membrane without subsequent modification. This was made possible\nby a microwave-mediated interfacial self-assembly method at the liquid-water\nvapor interface within a few minutes. The control of surface wettability\nwas made possible by increasing the synthesis reaction time. While\nthe side of the membrane in contact with water vapor is superhydrophilic,\nthe side in contact with dioxane becomes nearly hydrophobic by extending\nthe reaction time. Moreover, the synthesis time reported in this study\nis much shorter than that of the previously reported COF membranes\n( Table S1 ). Both surface chemistry and\nroughness contribute to this variation in wettability, with the superhydrophilic\nside exhibiting a roughness reduced by a factor of 10 when exposed\nto humid air. To investigate the molecular composition and structure\nof the membrane, we used Raman, ATR-FTIR, XPS, AFM, and TEM. The hydrophilic\nnature of the vapor face was found to be the result of the reaction\nbetween the terminal −NH 2 groups of the triamine\nprecursor and aqueous acetic acid. In contrast, the dioxane face was\ncharacterized by dominant terminal aldehyde groups, which gave it\na near-hydrophobic character. Comprehensive characterizations of the\nCOF membrane demonstrated its crystallinity, stability, and adaptability\nin surface wetting. Samples were taken from the membrane at varying\ntimes during its synthesis, and their TEM/STEM analyses and morphological\nstudies highlighted the role of microwave activation in the synthesis.\nIt promotes the mesoscale self-assembly of COF nanosheets at the liquid–vapor\ninterface. The influence of water condensation and focused microwave\nenergy led to the formation of a membrane with different surface textures:\na smooth, super hydrophilic vapor face and a textured near-hydrophobic\ndioxane face. The formation of this thick membrane begins in a few\nminutes and continues to grow in bulk until the building blocks are\nconsumed, allowing control of the thickness. The detailed exploration\nof the formation dynamics of TTA-DFP-COF membranes demonstrated in\nthis study, in conjunction with the comprehensive analysis of wettability\ndifferences on the surfaces, represents a significant advancement\nin the rapid synthesis of COF membranes with tunable wettability profiles\ntailored to precise applications. To leverage the superhydrophilicity\nof the vapor face of the membrane,\nwater filtration experiments were performed with salts, dyes, and\nmineral oil using vacuum filtration, where efficient filtration at\na high water flux was observed. The results indicate a correlation\nbetween the membrane’s rejection efficiency and the pollutant’s\nmolecular size, suggesting a possible contribution to rejection by\nmolecular sieving, in addition to electrostatic repulsion from the\nnegatively charged membrane surface. The efficiency of the superhydrophilic\nmembrane face was also investigated in oil-in-water emulsion filtration\nand showed excellent oil rejection at high water flux. Furthermore,\nthe membrane showed strong antimicrobial and antibiofouling properties\nagainst both Gram-negative ( E. coli ) and Gram-positive ( S. aureus ) bacteria\nwhile being biocompatible. This property is important for water filtration\nmembranes as it increases their effectiveness in preventing the adhesion\nof bacteria and the development of biofilms and ensures a consistent,\nclean water output. Our approach combines microwave-assisted\nsynthesis with a novel\nself-assembly technique at the dioxane-water vapor interface. This\nstudy provides a method to regulate the wettability of COF membrane\nsurfaces and a deep understanding of this phenomenon, which opens\nup ways to fine-tune membranes’ properties for specific applications.\nThe superhydrophilic membrane surface enables fast water flux while\nincreasing resistance to fouling and ensuring high rejection rates\nfor various pollutants. Considering the global water challenges, our\nTTA-DFP-COF membrane offers an innovative approach with immense potential\nfor real-world water treatment applications and represents a step\nforward in sustainable purification technologies.",
"discussion": "Results and Discussion Membrane Synthesis and Characterization Self-standing\nCOF membranes (denoted as TTA-DFP-COF membrane) with different thicknesses—25,\n55, and 85 μm—were prepared by covalently linking 2,6-diformylpyridine\n(DFP, 21 mg, 0.15 mmol, 5 equiv) and 4,4′,4″-(1,3,5-triazine-2,4,6-triyl)trianiline\n(TTA, 12 mg, 0.03 mmol, 1 equiv), in 3 mL of anhydrous 1,4-dioxane\nand in the presence of 0.5 mL of aqueous acetic acid (13 M, [acetic\nacid] final = 4.0 M) at 110 °C under microwave irradiations\n(300 W, Figure 1 a and Figure S1 ). The membrane formed at the liquid–vapor\ninterface as observed in Movie S1 . By adjusting\nthe reaction time during microwave irradiation to 5, 45, and 120 min\nintervals, we could control the thickness of the membrane. The membranes\nare denoted TTA-DFP-COF- 5 , TTA-DFP-COF- 45 , and TTA-DFP-COF- 120 , where 5 , 45 , and 120 represent the reaction time in minutes. After\nthe specified reaction time, a free-standing membrane was obtained,\nshowing no apparent cracks. The membrane displayed a smooth and glossy\nface on its upper side (contact with water vapors), referred to as\nthe vapor face (VF), whereas the dioxane face (DF, contact with the\nsolution) showed a rough and matte appearance ( Figure 1 b, Movie S2 ).\nRetrieving the membrane was easily accomplished using tweezers, and\nit could be cleaned multiple times with dioxane and ethanol ( Movie S3 ). Figure 1 Self-assembly at the dioxane–water\nvapor interface of a\ncontinuous, defect-free, highly crystalline, and porous self-standing\nCOF membrane. (a) Chemical structure and synthesis pathway of the\nTTA-DFP-COF membranes obtained under microwave irradiation. (b) Digital\nimages of the TTA-DFP-COF membrane faces: the vapor face is smooth\nand glossy in comparison with the rough and matte texture of the dioxane\nface. Scale bar = 1 cm. (c) Schematic representation of the membrane\nformation inside the microwave vessel. The self-standing TTA-DFP-COF\nmembrane is formed due to the confinement of the polymerization of\nthe aldehyde and amine monomers at the interface between dioxane and\nwater vapors under microwave irradiation (300W). In contrast to alternative methods for preparing\nCOF membranes,\nour strategy stands out for its simplicity and speed. The preparation\nprocess of TTA-DFP-COF membranes can be completed in a few minutes,\nmaking it one of the fastest approaches for COF membrane preparation\nto date ( Table S1 ). The linkers (DFP and\nTTA) are mixed in dioxane and sonicated for a few seconds to dissolve.\nThen, aqueous acetic acid was added rapidly, and the mixture was placed\nimmediately in the microwave oven (300 W) to initiate heating ( Figure 1 c). The temperature\nquickly increases to 110 °C in 1.5 min. During the ramp, the\n125 μL of water (from the aqueous acetic acid) starts boiling,\nand the first bubbles are observed around 80 °C after 40 s of\nramping and keep boiling for 30 s until 110 °C is reached ( Movie S1 ). Water condensation can be observed\non the vessel walls. The emergence of a film can be observed at the\ninterface between the vapor and liquid phases. We previously demonstrated\nthat at room temperature, a small amount of water favors the stacking\nof small nanosheets, leading to nanoparticle formation. 44 The control experiment with dry acetic acid\ndid not lead to membrane formation, demonstrating the important role\nof water in the mechanism. Microwave (MW) energy revolutionizes\nchemical synthesis by directly\nenergizing the sample for quicker, more even heating, making it highly\neffective for producing COFs with superior quality and efficiency. 45 Despite its advantages, reports on COF membranes\nsynthesized with MW as heating source are lacking. Microwave irradiation\nis essential for TTA-DFP-COF membrane synthesis; it causes water to\nevaporate and creates a vapor layer, enabling localized heating at\nthe liquid–vapor interface, which is critical for the formation\nof the membrane. Due to their distinct polar and ionic properties,\nsolvents exhibit varying interactions when exposed to microwaves.\nPolar solvents like water exhibit efficient diffusion under microwave\nirradiation due to their high dielectric constants, interactions with\nelectromagnetic fields, and dipolar characteristics. As a consequence,\nthe temperature of the solvent rises significantly during this process.\nNonpolar solvents like dioxane can only be heated in the presence\nof other components in the reaction mixture that respond to microwave\nenergy, such as water or acetic acid. 46 In such cases, it is possible to achieve high temperatures. In our\nparticular situation, as water evaporates and recondenses at the liquid–vapor\ninterface, the conduction of microwave heating becomes locally significantly\nelevated. As a result, the focused application of heat at the dioxane-water\nvapor interface precisely moderates the diffusion of acetic acid,\nwhich in turn initiates the selective polymerization of unreacted\nDFP aldehyde groups, terminal aldehyde groups, and free amine groups\non the nanosheets. This targeted polymerization at the interface culminates\nin the assembly of the COF membrane, a process depicted in Figure 1 c and further elucidated\nin Movie S4A–C . Control experiments\nusing an oven and an oil bath as heating sources, as opposed to microwave\nirradiation, failed to produce membranes, yielding only powder, underscoring\nthe essential nature of MW energy in this process ( Figure S3 ). This process takes place without stirring, which\nensures the undisturbed distribution of the various solvents. As a\nresult, the heating energy is not uniformly distributed throughout\nthe mixture but is concentrated in the areas with the more polar solvents.\nThe control experiment with stirring did not lead to membrane formation,\nwhich shows the importance of not disturbing the solvent post-organization\n( Movie S5 ). The control experiment, conducted\nwith microwave power reduced to 100 W, successfully synthesized a\nCOF membrane, but it was less robust than those produced at 300 W.\nThis discrepancy likely results from slower solvent rearrangement\nand heat distribution at lower power, both crucial for early stage\npolymerization at the interface ( Figure S4 ). Upon the initiation of membrane polymerization, prolonging the\nduration leads to the accumulation of additional thin layers of COF\nunder the existing ones, gradually increasing the overall thickness\nof the membrane. FTIR and solid-state NMR spectroscopies were\nused to analyze the\nchemical composition of the TTA-DFP-COF- 5/45/120 membranes.\nThe findings revealed that all the membranes exhibited identical patterns\nregarding their characteristics independently of their thickness. FTIR analysis provided detailed insights into the molecular architecture\nof the COF membranes. The monomers exhibit characteristic spectral\nfeatures, with amine monomers (TTA) showing NH 2 stretching\nvibrations in the 3460–3320 cm –1 range and\naldehyde monomers (DFP) characterized by a C=O stretch at 1711\ncm –1 ( Figures S5 and S6 ). The transition to imine COFs was marked by the disappearance of\nthe NH 2 peak, the reduction of the C=O signal, and\nthe appearance of an imine C=N stretch at 1621 cm –1 , evidence of polycondensation. Other spectral features included\na C=N stretch at 1507 cm –1 , a broad C–N\npeak at 1364 cm –1 related to the triazine core,\nand a C=C stretch at 1580 cm –1 . 47 The spectrum also shows a weak C=O band\nat 1706 cm –1 originating from residual aldehydes\nand a distinct amide C=O stretch at 1680 cm –1 , with accompanying amide C–N stretching at 1242 cm –1 and C–N–C stretching at 1325 cm –1 . These bands indicate the formation of terminal N -phenyl acetamide groups, likely from the reaction of the TTA linker\nwith acetic acid ( Figures S5, S6 and S7 ). 13 C CP-MAS solid-state NMR spectroscopy was employed\nto study the chemical environment at the atomic level of the obtained\nTTA-DFP-COF membranes ( Figure S8 ). The 13 C CP/MAS solid-state NMR spectrum obtained from TTA-DFP-COF\nmembranes ( Figure S8a ) is well resolved\nand reveals mainly peaks originating from the aromatic (100 to 150\nppm) and aromatic imine carbon atoms (150 to 175 ppm). The formation\nof the new imine bond is confirmed by the new peak at ∼160\nppm. The spectrum is also characterized by the presence of terminal\naldehyde groups appearing at ∼194 ppm. Chemical shift assignments\nwere further confirmed by recording the solid-state NMR spectra of\nthe starting materials (TTA and DFP) and the final TTA-DFP-COF membranes\n( Figure S8b ). The differences between\nthe TTA-DFP-COF- 5/45/120 membrane\nproperties were analyzed using SEM, PXRD, HRTEM, and N 2 adsorption. The mechanical properties and the surface wettability\nof the membranes were also studied and they were found to be influenced\nby the variation in the membranes’ thicknesses. The inner\nmorphology and thickness of TTA-DFP-COF membranes were\ninvestigated by SEM ( Figure 2 a and Figures S13–S17 ).\nThe TTA-DFP-COF- 5/45/120 membranes display two distinct\ntypes of faces ( Figures S15–17 ).\nThe vapor face (VF), which was exposed to water vapor during synthesis,\nappears smooth, compact, and continuous. In contrast, the dioxane\nface (DF) appears rough. Notably, both faces are free from any cracks.\nAs the reaction time increases, the contrast in characteristics between\nthe VF and DF faces becomes more evident ( Figures S15–S17 ). The inner structure of the TTA-DFP-COF- 5/45/120 membranes is made of a laminated arrangement consisting\nof multiple sheets, each measuring 5–10 μm ( Figures S17 and S18 ). These sheets were stacked\non top of one another, creating the characteristic structure shown\nin Figure S17 . As the reaction time increased,\nthe thickness of the membranes also increased, reaching 25, 55, and\n85 μm for TTA-DFP-COF- 5 , TTA-DFP-COF- 45 , and TTA-DFP-COF- 120 , respectively, as observed using\ncross-section SEM ( Figure 2 a and Figures S13 and S14 ). Figure 2 Structural\ncharacterization of the TTA-DFP-COF membranes. (a) SEM\nCross-sectional images of TTA-DFP-COF- 5 , TTA-DFP-COF- 45 , and TTA-DFP-COF- 120 . (b) PXRD of TTA-DFP-COF- 5 (red), TTA-DFP-COF- 45 (blue), TTA-DFP-COF- 120 (green) and simulated (black). HRTEM analysis of TTA-DFP-COF- 120 confirming the material’s crystallinity: (c) HR-TEM\nimage displaying lattice fringes (lattice fringe distances d = 0.64 nm) corresponding to the (221) plane of the COF.\n(d) Selective area electron diffraction (SAED) image indicates the\nTTA-DFP-COF membrane’s high crystallinity well matching to d 002 plane with d- spacing of\n0.51 nm. (e) N 2 adsorption isotherms and (f) representative\nindentation load versus surface penetration depth curves of TTA-DFP-COF- 5 (red), TTA-DFP-COF- 45 (blue), and TTA-DFP-COF- 120 (green). (g) Surface wettability analysis: (i) water contact\nangle (WCA) of the vapor (VF, orange) and dioxane (DF, yellow) faces\nof TTA-DFP-COF- 5 (red), TTA-DFP-COF- 45 (blue),\nand TTA-DFP-COF- 120 (green), and (ii) corresponding WCA\ndigital images of the DF of TTA-DFP-COF- 5/45/120 . The crystalline structure of TTA-DFP-COF membranes\nwas characterized\nusing powder X-ray diffraction (PXRD), revealing clear evidence of\ncrystallinity. Building upon reticular chemistry principles, crystal\nstructure models of TTA-DFP-COF were constructed based on the geometries\nof the constituent building blocks. We generated models featuring\ndistorted hcb layered structures within the trigonal P3 space group. These models were geometrically optimized\nusing universal force field energy minimizations, and their simulated\npattern compared with the experimental one. The most accurate correlation\nbetween experimental and simulated PXRD patterns was achieved for\nlayer-stacked structures following an ABC sequence. The unit cell\nparameter values determined after completing a Pawley refinement (Rwp\n= 1.94%, Rp = 1.55%) are a = b =\n36.41 Å, c = 10.39 Å. Based on this structure,\nthe distinct peak observed at 2θ = 4.8° corresponds to\nthe (110) Bragg diffraction. Additional peaks at 2θ = 9.8, 11.2,\nand 15.5° correspond to the (200), (211), and combined (141)\nand (150) planes, respectively, alongside a higher-order peak at 2θ\n= 25.5° for the (003) plane ( Figure 2 b and Figure S20 ). The analysis also indicates that membrane thickness influences\nmicrostructural features like crystal packing, with thicker membranes\nshowing stronger diffraction peak intensities, implying better crystallinity\nand internal order. This is demonstrated by the intensities of the\n(110) peak increasing with thickness, noted at 4800, 16100, and 19000\narbitrary units for membranes of varying thicknesses, with a significant\nrise in peak intensity observed as thickness increases from 25 to\n55 μm before stabilizing between 55 and 85 μm ( Figure S28 ). HRTEM was then used to gain\ninsight into the structure and the\ncrystallinity of the COF membranes. The images show a highly ordered\narrangement composed of a multilayered structure of individual COF\nnanosheets ( Figure 2 c,d and Figures S21 and S22 ), self-assembled\ndue to interlayer π–π stacking with independent\nlattice fringes. Lattice-resolution TEM images of exfoliated TTA-DFP-COF\nmembranes show that they are crystalline with consistent and continuous\nlattice fringes that extend across the entire COF ( Figure 2 c and Figure S23 ). The lattice spacings were 3.4 and 6.4 Å, as measured\nby fast Fourier transform, which match the expected d 003 and d 221 spacings, respectively.\nFurthermore, the selected area electron diffraction (SAED, Figure 2 d and Figure S24 ) demonstrates the well-crystallized\nfeature of the TTA-DFP-COF membrane, which exhibited distinct electron\ndiffraction spots, well matching to d 002 plane with a d- spacing of 5.1 Å. The\nTTA-DFP-COF -5/45/120 membranes exhibited permanent\nporosity as shown by N 2 adsorption experiments, which\nyielded fully reversible type-I isotherms, indicative of nitrogen\ncondensation within the membranes’ interstitial voids ( Figure 2 e, Table 1 ). The Brunauer–Emmett–Teller\n(BET) surface areas were calculated to be 448, 809, and 690 m 2 /g, with corresponding total pore volumes of 0.24, 0.39, and\n0.33 cm 3 /g for the TTA-DFP-COF- 5/45/120 membranes,\nrespectively ( Figure S27 ). These data are\nconsistent with the PXRD results that showed an increase in (110)\npeak intensity with membrane thickness up to 55 μm, after which\nit plateaus ( Figure S28 ). This trend indicates\nthe effect of microstructural differences on the surface area despite\na consistent crystalline structure ( Figure S28 ). Pore size analysis showed that TTA-DFP-COF -5 has\nthe largest average pore size (12.3 Å), in contrast to the smaller,\nuniform pore sizes (10.2 Å) of TTA-DFP-COF -45 and\nTTA-DFP-COF -120 ( Figure S27 ). These physical properties, including BET surface area and pore\ndistributions, reflect the degree of crystallinity of the membranes,\nwhich is influenced by the synthesis conditions such as reaction time\nand affect the thickness and packing of the membrane. Following on\nthe research of Ma et al., who established a link between COF crystallinity\nand sorption properties, 48 our results\nhighlight the importance of synthesis precision in optimizing COF\nmembranes for specific applications and improve our understanding\nof COF membrane fabrication. Table 1 Physicochemical Properties of TTA-DFP-COF-5/45/120\nMembranes a TTA-DFP-COF- 5 TTA-DFP-COF- 45 TTA-DFP-COF- 120 thickness (μm) 24.8 ± 1.6 55.1 ± 1.8 85.7 ± 2.6 BET (m 2 g –1 ), (TPV*, cm 3 g –1 ) 448, (0.24) 809, (0.39) 690, (0.33) pore width (Å) 12.3/14.8 10.2 10.2 Young modulus (MPa) 300 ± 100 500 ± 100 2100 ± 50 hardness (MPa) 250 ± 50 350 ± 50 520 ± 100 WCA, VF/DF\n(deg) 18/37 8/55 6/83 a TPV: total pore volume, WCA: water\ncontact angle, VF: vapor face, DF: dioxane face. Using our technique of self-assembly at the interface,\nwe have\nsuccessfully produced flexible and continuous TTA-DFP-COF membranes\nwith a diameter of 2.5 cm. These membranes exhibit good mechanical\nstrength, which facilitates their extraction from the mother solution\nand their transfer to diverse substrates ( Movie S3 ). Therefore, the quantitative nanomechanical properties,\nYoung’s modulus ( Er ), and hardness ( H ) were calculated based on the as-obtained load/depth curves\n( Figure 2 f and Figure S29 , Table 1 ). The TTA-DFP-COF- 120 showed the highest\nvalues for both parameters ( Er = 2100 MPa and H = 520 MPa) among the three membranes ( Er = 300 MPa and H = 250 MPa for TTA-DFP-COF- 5 ; Er = 500 MPa and H =\n350 MPa for TTA-DFP-COF- 45 ). The TTA-DFP-COF- 120 membrane shows excellent mechanical properties ( Table S2 for comparison with other reported membranes). Even\nafter drying, the self-standing COF membranes could maintain their\nflexibility and integrity, which confirms their mechanical robustness\n( Movie S6 ). To investigate the surface\nproperties and wettability of the TTA-DFP-COF- 5/45/120 membranes, we conducted water contact angle (WCA)\nmeasurements on both the VF (exposed to water vapor) and DF (exposed\nto dioxane) faces, taking into account the variations in membrane\nthickness ( Figure 2 g and Figure S30 ). Significant differences\nin behavior were observed between the VF and DF faces of the membranes\nand as a function of the thickness. The vapor face of the TTA-DFP-COF- 5/45/120 membranes experienced almost complete wetting by\nwater droplets, particularly in the case of TTA-DFP-COF- 120 with a WCA of 5.9°, as indicated in Table 1 and shown in Figure 2 g and Figure S30 . In contrast, the hydrophilicity of the dioxane face decreased relative\nto the membrane’s thickness and roughness. The contact angle\nexhibited an increase, reaching values of 37.1°, 55.0°,\nand 82.6° (almost hydrophobic) for TTA-DFP-COF -5 , TTA-DFP-COF -45 , and TTA-DFP-COF -120 ,\nrespectively. Thus, the TTA-DFP-COF- 5/45/120 membranes\ndisplayed divergent face characteristics based on thickness. While\none face demonstrated a markedly superhydrophilic nature, the other\nexhibited near-hydrophobic properties. Significantly, the differences\nin morphology were less evident in the case of TTA-DFP-COF- 5 aligning with the trend of fewer disparities between the two faces,\nas indicated by WCA measurements. This duality in the behavior\nof the faces offers distinct advantages:\nthe superhydrophilic face promotes high water permeability, increased\nresistance to organic fouling compared to traditional polymeric membranes,\nwhile facilitating rapid and efficient removal of oil or organic residues\nfrom oil-in-water suspensions. The near-hydrophobic face, on the other\nhand, could potentially promote antifouling properties for inorganic\nspecies while ensuring good water permeation. 49 This approach also opens the door to the development of fabrication\nprotocols for COF membranes with different wettability behaviors on\neach side, with the near-hydrophobic side having a higher water contact\nangle. In this case, the other surface could facilitate the use of\nthe membranes in other applications, such as oil purification from\nwater and seawater desalination by membrane distillation, mimicking\nthe properties of traditional polymeric Janus membranes. 50 We focus our investigation on the dual\nnear-hydrophobic and hydrophilic\nproperties of membranes—their wettability—which is significantly\ninfluenced by both chemical composition and surface textures. 51 , 52 The nature of functional groups on a solid surface primarily dictates\nthis wettability: polar groups such as COOH, OH, and NH 2 enhance hydrophilicity, whereas nonpolar groups like CH 3 and CF 3 promote hydrophobicity. 53 Additionally, the micro/nanotexture textures on the membrane’s\nsurface play a crucial role in determining its wettability. This comprehensive\nstudy of both chemical and physical factors enables us to better understand\nthe complex interplay between chemistry and surface texture in controlling\nmembrane wettability. Using a combination of spectroscopic techniques\n(Raman, ATR-FTIR,\nand XPS), we investigated the TTA-DFP-COF- 120 membrane\nface chemical composition. Atomic force microscopy (AFM) was also\nemployed to analyze their textures. This approach was chosen because\nSEM (as shown in Figure 2 a and Figure S13–S17 ) revealed\nclear differences in morphology between the two surfaces, especially\nwhen exposed to prolonged reaction time . Figure S31 displays the direct Raman\nspectra of the vapor and dioxane faces and their corresponding subtraction.\nThe main difference between the VF and DF faces lies in the regions\nassociated with the C–H vibrations of the aromatic ring, the\nC–H vibrations of a methyl group, and a possible C–N\nvibration of the imine group. However, the difference between these\ntwo faces was not easy to discern because the penetration depth of\nthe excitation laser, even after adjusting the focal length, could\nlimit the distinction between the two faces. Consequently, attenuated\ntotal reflection Fourier transform IR\n(ATR-FTIR) spectroscopy was used as an alternative as the penetration\ndepth of the evanescent IR beam is typically on the order of a few\nmicrometers (around 3 μm), making ATR particularly suitable\nfor the qualitative analysis of surface layers of TTA-DFP-COF membrane.\nConsequently, the analysis is not exclusively confined to the external\nsurface of both faces but part of the bulk as well. This justifies\nthe similar positions of some bands on both sides, however, with different\nrelative intensities ( Figure 3 a). Figure 3 The dual hydrophobic and hydrophilic behavior of the TTA-DFP-COF\nmembrane is mainly due to the favorable orientation of the hydrophilic\nNH 2 / NH–CO–CH 3 groups toward the\nvapor face and the aldehyde toward the dioxane face. (a) ATR-FTIR\nspectra of VF (hydrophilic, orange) and DF (nearly hydrophobic, yellow)\nof the TTA-DFP-COF membrane and their corresponding subtraction (dashed\nblack). (b) Schematic representation of the species distribution within\nthe vapor (VF) and dioxane (DF) face of the membrane. (c) XPS N 1s\nspectra of VF (i) and DF (ii) of the TTA-DFP-COF membrane. The ATR-FTIR spectra of the VF and DF and their\ncorresponding subtraction\nare given in Figure 3 a and the assignment of the corresponding bands in Table S3 . The spectrum of the VF reveals distinct higher absorption\nbands at 3400–3200 cm – 1 (N–H\nstretching), 2977 and 2868 cm – 1 (C–H\nasymmetric and symmetric stretching of the CH 3 group, respectively),\n1680 cm – 1 (C=O stretching of\n−NH–CO–CH 3 ), 1480 cm – 1 (N–H bending), 1350 cm – 1 (C–H bending), and 1325 cm – 1 (C–N–C stretching). These bands provide evidence of\nterminal N -phenyl acetamide (phenyl–NH–CO–CH 3 ) groups. These groups are most likely formed by a reaction\nbetween certain terminal −NH 2 groups of TTA precursor\nand aqueous acetic acid (CH 3 COOH). This allows us to propose\nthat the terminal group of the VF is mainly −NH 2 and amide TTA precursor, preferentially interacting with the aqueous\nphase ( Figure 3 b).\nIn contrast, these groups are either absent or present with significantly\nlow intensity in the FTIR spectrum of the DF. Instead, the predominant\nfeature observed on the DF of the TTA-DFP-COF membrane is the presence\nof terminal aldehyde groups, in which a distinctive band can be identified\nat 1710 cm – 1 . The terminal aldehyde\ngroups from DFP molecules predominantly interact with the dioxane\nsolvent ( Figure 3 b).\nThis distinction in terminal groups on the membrane’s faces\nexplains the TTA-DFP-COF membrane’s dual hydrophobic and hydrophilic\nproperties, with the NH 2 / NH–CO–CH 3 groups being notably more hydrophilic than the aldehyde groups. To understand how the NH 2 groups of TTA react with acetic\nacid, a control experiment mirroring the membrane synthesis conditions\nwas performed, aiming to produce N -phenyl acetamide.\nThe formation of this compound was verified through 1 H\nNMR, 13 C CP/MAS solid-state NMR, and FTIR spectroscopy,\nrevealing peaks indicative of amide bond creation ( Section 3.3 in the SI). These results confirm the reaction\npathway where TTA’s primary amine groups bond with acetic acid\nto form amide linkages. The high-resolution XPS survey spectra\nconfirm that the TTA-DFP-COF\nmembrane’s faces are predominantly composed of carbon, nitrogen,\nand oxygen elements, with the vapor face (VF) showing a greater oxygen\ncontent at 6.7%, compared to 3.6% on the Dioxane face (DF) as detailed\nin Figure S32 and Table S4 . Analysis of\nthe C 1s signal reveals four distinct carbon environments corresponding\nto C=C (approximately 285.0 eV), C–N (approximately\n285.8 eV), C–N=C/N–C=O amide (approximately\n286.9 eV), and C=O from terminal aldehyde (approximately 288.5\neV) ( Figure S33 ). Notably, the aldehyde\nC=O is more prevalent in the DF at 5.0%, in contrast to 3.6%\nin the VF, indicative of terminal aldehyde presence as listed in Table S5 . Moreover, the amide’s N–C=O\nsignal is significantly stronger in the VF at 21.4%, versus 16.4%\nin the DF, suggesting a more substantial interaction and subsequent\namide formation on the VF due to the reaction of terminal −NH 2 groups from the TTA precursor with aqueous acetic acid. The\nN 1s and O 1s peaks show clear differences between the two faces.\nThe DF’s N 1s spectrum can be deconvoluted into four peaks\nthat correspond to imine/triazine C=N/N–C=O (∼399.1\neV), pyridine C–N (∼399.9 eV), amine −NH 2 / NH 3 + (∼400.6 eV), and N-quaternary\n(pronated pyridine, ∼402.5 eV), 54 as shown in Figure 3 c, Figure S33, and Table S6. In contrast,\nthe VF lacks amine species while exhibiting an increased presence\nof imine/triazine and amide structures, accounting for 50.0% of the\nN 1s signal, which is an increase from the 37.5% observed on the DF.\nThis discrepancy supports the formation of amide linkages on the VF,\nas shown in Figure S33 and Table S6 . The DF’s O 1s signal separates into two peaks related to\nthe −C=O of −NH–CO–CH 3 and the −C=O of the terminal aldehyde groups in the\nDFP molecules, accounting for 57.4 and 38.2%, respectively. On the\nVF, the dominance of −NH–CO–CH 3 at\n85.2% confirms the hypothesis of a condensation reaction between the\nTTA’s terminal −NH 2 groups and aqueous acetic\nacid, while the lower presence of −C=O from DFP at 14.8%\nindicates a selective orientation toward the dioxane phase, as further\ndetailed in Figure S33 and Table S7 . We then performed surface ζ-potential measurements on both\nfaces at neutral pH since all characterization and testing of the\nmembrane were conducted at pH ≈ 7. As expected, the VF showed\na significantly more negative ζ-potential (−28 mV) than\nthe DF (−10 mV). This difference can be attributed to the higher\npresence of terminal N -phenyl acetamide (phenyl–NH–CO–CH 3 ) groups on the VF. Amides, with a high p K a (around 15 or more), are weak bases and unlikely to\nbe protonated under neutral conditions. Instead, their polar C=O\nbonds contribute to a net negative charge on the VF, amplified by\nthe density of N -phenyl acetamide groups and potential\nhydrogen bonding. In contrast, aldehydes lack basicity and significant\ncharge contribution, resulting in a less negative ζ-potential\non the DF due to their weaker dipolar effects ( Figure S34 ). The density of these N -phenyl\nacetamide groups as well as other possible molecular interactions,\nsuch as hydrogen bonding on the VF, could also play a role in this\nobserved discrepancy. The XPS and ζ-potential results\nagree with the data of the\nATR-FTIR analysis. The terminal aldehyde groups tend to orient toward\nthe DF, while the residual NH 2 groups of TTA react predominantly\nwith COOH from acetic acid the vapor face of the membrane ( Figure 3 b). The resulting\ncondensation elucidates the dual hydrophobic and hydrophilic characteristics\nof the TTA-DFP-COF membrane from the chemical distribution aspect. In 1936, Wenzel 55 established the correlation\nbetween roughness and wettability, stating that introducing surface\nroughness would amplify the wettability induced by the surface chemistry. 52 , 53 The dioxane face (DF) of the membrane is nearly hydrophobic and\nappeared rough upon visual inspection and closer SEM examination ( Figure 4 a,b, and Figures S13–S17 ). In contrast, as mentioned\npreviously, the superhydrophilic VF displayed a relatively smoother\nsurface. Therefore, the surface morphologies of the membrane’s\nvapor and dioxane faces were examined by AFM, enabling us to quantify\ntheir surface roughness factor, denoted to as R a (roughness\naverage). The nearly hydrophilic VF exhibits a comparatively uniform\nsurface with minimal folds and irregularities, as indicated by an\naverage surface roughness value of R a = 51 nm ( Figure 4 c). As a result,\nthe VF showed a mirror-like shiny surface. On the other hand, the\nhydrophobic DF shows significant fluctuations with an average surface\nroughness of R a = 429 nm. The roughness factor between\nthe two sides is almost ten times higher, highlighting a significant\ndifference in surface roughness between faces. Figure 4 The increased roughness\nobserved on the DF of the TTA-DFP-COF membrane\namplifies the effects of its inherent surface chemistry. (a) Digital\nimages of the water contact angle, (b) SEM, and (c) AFM images of\nVF (left panel, orange) and DF (right panel, yellow) of the TTA-DFP-COF\nmembrane. Ra = roughness average. The increased roughness on the DF side of the TTA-DFP-COF\nmembrane\ndictates its unique surface chemistry, particularly the dominant terminal\naldehyde groups, which make it nearly hydrophobic and affect the wettability\nproperties. 52 , 53 This difference in wettability\nbetween the sides also depends on how the functional groups of the\nmembrane are oriented and react. In particular, the terminal aldehyde\ngroups are primarily located on the DF, whereas the NH 2 groups of TTA undergo a condensation reaction with COOH from acetic\nacid on the VF side. Both the micro/nanotextures and the chemistry\nof the membrane’s surface illustrate the membrane’s\nability to exhibit both near-hydrophobic and hydrophilic properties. To understand how the membrane forms upon microwave activation\nand the reason for the difference in roughness between faces, we performed\na time-dependent TEM/STEM study during the synthesis by immersing\nTEM grids at the liquid/vapor interface at various time intervals\ninside the microwave oven and performed a morphological analysis ( Figure 5 a and Figure S35–S38 ). The synthesis was performed\nin an open vessel mode and was slightly modified to slow down the\nreaction kinetics and simplify the experimental process. To prevent\nwater evaporation as the system was no longer sealed, we reduced the\nreaction temperature to 85 °C. By decreasing the temperature,\nwe achieved a slower reaction rate without compromising the overall\nresult. Figure 5 Covalent self-assembly of nanosheets at the interface between dioxane\nand water vapors transforms them into a self-standing COF membrane.\n(a) Time-dependent study of the membrane formation visualized by TEM\nof each step during the synthesis taken at different time intervals.\nTime is counted after the addition of acetic acid. (b) Illustrative\ndepiction of the mesoscale covalent self-assembly process resulting\nin a crystalline, porous membrane. The unreacted DFP and terminal\naldehyde groups on the nanosheet edges facilitate the assembly through\nreactions with free amines on the surface. As the COF nanosheets come\ntogether at the dioxane-water vapor interface, their peripheral aldehyde\nand amine groups link via Schiff base reactions. Step 1: 0 min, room\ntemperature—rapid imine condensation produces crystalline COF\nnanosheets. Step 2: 2 min, 75 °C—mesoscale assembly commences\nat the interface. Step 3: 3 min, 85 °C—the nanosheets\ncoalesce into expansive branched structures. Step 4: 4.5 min, 85 °C—a\nrobust membrane forms, composed of layered COF sheets, exhibiting\na smooth vapor-facing side (VF) and a textured dioxane-facing side\n(DF), exemplifying the tailored polymerization and morphological development\nsteered by the interface-specific microwave energy application. In the reaction, the amine (TTA) is used in default\namounts, while\nthe aldehyde (DFP) is in excess. The introduction of aqueous acetic\nacid ([acetic acid] final = 4.0 M) triggers a rapid imine\ncondensation reaction at room temperature in solution ( Figure 5 b, step 1). This reaction quickly\nconsumes a considerable amount of TTA, and forms distinct crystalline\nnanosheets of COF ( Figures 5 a and S35–38 , t = 0 min\npostacid addition, 25 °C). The rapid temperature increase\ninduces the mesoscale self-assembly\nof COF nanosheets, which occurs at the liquid–vapor interface\ndue to two interrelated phenomena: water condensation at the liquid–vapor\ninterface and concentrated microwave energy at the interface ( Figures 1 c and 5 b). The vapor water layer is critical because it allows slow\ndiffusion of acetic acid (demonstrated through ATR-FTIR and XPS) to\nthe interface and the polymerization of free −CHO aldehyde\n(unreacted DFP) and terminal aldehyde groups and free −NH 2 amines on the nanosheet surface at the interface between\ndioxane and water vapors ( Figure 5 b, step 2). As a result, the nanosheets form\nlarger structures ( Figure 5 a, step 3 and Figures S35–S38 , t = 1.5 min postacid\naddition). Over time, branching occurs between these star-like structures,\nbringing them closer together. The structure becomes more ordered\nthrough a reorganization with improved stacking and increased transparency\ndue to increased π–π stacking ( Figure 5 a,b and Figure S35–S38 , t = 2–3 min\npostacid addition). After about 4 min, a thick membrane forms as the\nCOF layers continue to accumulate ( Figure 5 b and Figures S35–S38 , step 4). This layer-by-layer growth continues until the DFP linker\nis completely consumed and no more free aldehydes or amines are available.\nAs a result, the VF is smooth due to the continuous reorganization\nof the COF nanosheets, while the DF is rough and full of aggregates,\nas observed by SEM attributed to the end of the process. 56 Through time-dependent TEM/STEM studies\nand morphological observations,\nit was found that the use of microwave activation in synthesis promotes\nthe mesoscale self-assembly of COF nanosheets at the liquid–vapor\ninterface. This process, which is influenced by water condensation\nand microwave energy concentration, leads to the formation of a thick\nmembrane with a smooth vapor face and a rough dioxane face due to\ndifferent organizational structures at each interface. The smoothness\nof the VF membrane results from microwave-assisted interfacial self-assembly\nin the presence of water vapor, which ensures a controlled and uniform\npolymerization, and leads to a homogeneous and smooth COF layer. In\ncontrast, the DF membrane formed in contact with dioxane undergoes\na less consistent polymerization due to the variable distribution\nof reactants and microwave energy, leading to a rougher texture. 57 These textural differences have a significant\nimpact on the membrane’s functionality, particularly affecting\nwettability and separation performance. The change in surface roughness\nby a factor of 10, in addition to the changes in chemical composition,\nis the key to the different wettability observed. In the rest\nof the study, we focused on the TTA-DFP-COF- 120 membrane\n(85 μm), which shows excellent crystallinity, high\nsurface area (690 m 2 g –1 ), the best mechanical\nproperties as well as the largest discrepancy between superhydrophilicity\nand near-hydrophobicity of the two faces. Ensuring the physical\nand chemical stability of the TTA-DFP-COF\nmembrane is crucial to ensure its efficient use in real-world environments.\nThe thermal stability of the COF membrane was measured by thermogravimetric\nanalysis under nitrogen ( Figure S39 ). The\nTTA-DFP-COF membranes are thermally stable up to 450 °C without\napparent weight loss, which meets the requirements of water treatment\napplication. The chemical stability of the TTA-DFP-COF membrane\nwas evaluated\nafter 24 h of immersion in acidic, neutral, and basic (pH = 5, 7,\nand 9) aqueous solutions and common organic solvents (ethanol, dioxane,\nacetone, and dichloromethane, Figures S40–S44 ). The TTA-DFP-COF membrane exhibited excellent chemical stability\nas it retained its integrity without any visible delamination or changes\nin its chemical structure after being immersed in various conditions\nfor 24 h. The absence of significant changes was confirmed by visual\ninspection ( Figure S40 ), FTIR ( Figures S41 and S42 ), and PXRD ( Figures S43 and S44 ), highlighting the robust chemical stability\nof the membrane. The high structural stability of the TTA-DFP-COF\nskeleton is attributed to the stable backbone, which prevents hydrolysis\nof the imine nitrogen. 58 , 59 Due to their exceptional stability,\nTTA-DFP-COF membranes are well-suited to fulfill the requirements\nof molecular sieving and oil removal from water. Membrane Filtration Performance Efficient Molecular Sieving Effects To evaluate the\nmolecular weight cutoff of the synthesized TTA-DFP-COF membrane, four\nanionic dyes with different molecular weights and dimensions (Rose\nBengal RB, Methyl Blue MB, Naphthol Blue Black NBB, Methyl Orange\nMO), and two salts (NaCl and MgCl 2 ), were used as pollutants\nto assess the rejection performance of the membrane ( Table S8 ). After the TTA-DFP-COF membrane was securely\nplaced in the filter holder on top of nonwoven support, the dye and\nsalt solutions were added to the filter holder cup ( Figure 6 a and Figure S45 ). In all filtration experiments, the superhydrophilic vapor\nface of the membrane, which serves as the active layer, was oriented\ntoward the feed solution. This face was chosen for its superior wettability,\nwhich increases the water filtration rate, and for its greater negative\ncharge, which improves dye rejection by electrostatic repulsion with\nanionic dyes. A vacuum pump was used to facilitate the passage of\nthe feed solution through the membrane and the average transmembrane\npressure was 0.5 bar. DI water was used to clean the membrane between\nwater filtration runs. Further details of the filtration experiments\ncan be found in the SI . Figure 6 Filtration tests through\nthe TTA-DFP-COF membrane. (a) Filtration\nassembly, showcasing the vacuum filtration system employed. This system\nincludes a membrane holder comprised of two main parts: the upper\nsection, featuring a cup to contain the feed solution and a support\nstructure to secure the membrane, and the lower section, designed\nto accommodate the membrane itself, highlighting the specific area\nwhere the membrane is positioned. (b) Rejection of salts (NaCl and\nMgCl 2 , 1000 mg/L) and dyes (Rose Bengal RB, Methyl Blue\nMB, Naphthol Blue Black NBB, Methyl Orange MO, 2.5 mg/L) with respect\nto their molecular weight by TTA-DFP-COF membrane. (c) Variation in\nwater flux through the membrane observed over five cycles, with each\ncycle processing 10 mL of solution. The assessment involved measuring\nthe water flux for a 2.5 mg/L RB solution filtered through both the\nVF (black) and DF (red) faces of the membrane and for a 2.5 mg/L Crystal\nViolet (CV) solution filtered through the VF face (blue) of the membrane.\n(d) Photographs of the membrane’s VF and DF surfaces before\nand after the 5 cycles of filtration of Crystal Violet (CV), showing\nthe color change caused by CV adsorption on the membrane surface.\n(e) Proposed mechanism for the rejection of anionic dyes, with RB\nas an example. The scheme highlights the role of molecular sieving\nand electrostatic repulsion in the rejection of RB. The results of the filtration tests are shown in Figure 6 b. In agreement with\nthe calculated\npore size, the membrane effectively achieved almost complete rejection\nof larger dyes, including Rose Bengal (RB, 11.2 × 12.4 Å)\nand Methyl Blue (MB, 21.3 × 16.8 Å). In contrast, smaller\ndyes such as Naphthol Blue Black (NBB, 14.6 × 7.9 Å) and\nMethyl Orange (MO, 12.1 × 2.4 Å) were partially rejected\nfrom the dye solutions (2.5 mg/L), highlighting the selective filtration\nability of the membrane. To evaluate the effectiveness of the\nmembrane in rejecting Rose\nBengal (RB) at high concentrations, a solution containing 20 mg/L\nRB was tested, and a constant rejection rate of about 75% was observed.\nThis shows that the membrane still performs well even at dye concentrations\nin the range found in industrial wastewater. Using the self-standing\nTTA-DFP-COF membrane, a salt rejection\nof 12% for NaCl and 20% for MgCl 2 was achieved, indicating\neffective salt permeability. These results highlight the promising\ncapabilities of the TTA-DFP-COF membrane in selective dye/salt separation\nprocesses. 60 Numerous factors can\ninfluence the filtration performance of a\nmembrane, including the aperture size of the membrane, the size of\nthe solute, the surface charge of the membrane, the interaction between\nthe solute and the solvent, and the interaction between the solute\nand the membrane. In aqueous solutions, the dyes studied are anionic\n(RB, MB, NBB, MO). Thus, depending on the surface charge of the membrane,\nthe charge of the dye could have affected its rejection. Since the\nhydrophilic vapor face used for filtration is negatively charged (−28\nmV), as shown in Figure S34 , electrostatic\nrepulsion could have played a role in the rejection of the negatively\ncharged dyes. However, all the studied dyes were anionic, but only\nthe dyes with larger molecular dimensions, especially RB and MB, were\ncompletely rejected. Moreover, the molecular sizes of the dye molecules\nand their short-end kinetic diameters, are shown in Figure 6 b and Table S8 . The pore size calculated for the self-standing membrane\nCOF was around 10.2 Å. Interestingly, the RB dye molecule with\na long-end kinetic diameter of 12.4 Å was fully rejected, while\nthe smaller dye molecules and salts were able to partially pass through\nthe pores of the membrane. This indicates that size-sieving and shape-selective\nmechanisms significantly influence the filtration process compared\nto electrostatic repulsion. The NBB and RB dyes have identical charge\ndensities (−2, Table S8 ), but their\nsize and molecular weight differ significantly. The higher rejection\nefficiency for RB than NBB confirms the size-selective nature of the\nmembrane. However, this does not prove that the pores of the COF are\nthe main channels for water filtration but that the pore size of the\nfiltration channels of the membrane is in the order of the calculated\npore size, which allows the removal of pollutants with larger sizes. Furthermore, the negatively charged nature of these dyes suggests\nthat they are more likely to be rejected than adsorbed on the negatively\ncharged membrane surface. Indeed, when the TTA-DFP-COF membrane was\nimmersed in a positively charged dye solution (rhodamine B) for a\nfew minutes, the dioxane face of the membrane showed the dye’s\ncoloration, while the vapor face retained its characteristic yellow\ncolor ( Movie S7 ). To better understand\nthe rejection mechanism of the membrane, filtration tests were performed\nwith a cationic dye, crystal violet (CV), whose molecular size (14\n× 14 Å) is larger than that of RB (11.2 × 12.4 Å).\nThe results are shown in Figure 6 c. Interestingly, the water filtration rate decreased\nrapidly with time until it was around 660 L m –2 h –1 after the filtration of 50 mL, compared to 1990 L\nm –2 h –1 at the beginning of the\ntest. After assessing the membrane following the filtration tests,\na clear color change is observed on both sides of the membrane ( Figure 6 d), indicating that\nthe cationic dye is adsorbed by the membrane. The decrease in water\nflux in this case is, therefore, due to the adsorption of the cationic\ndye on the membrane surface, which blocks the pores of the membrane.\nThis is to be expected due to the negatively charged surfaces of the\nmembrane, which is less suitable for the filtration of cationic dyes\ndue to their adsorption on the membrane surface. However, in the anionic\ndye filtration experiments using RB, neither staining on either face\nof the membrane nor a significant decrease in the water filtration\nrate ( Figure 6 c) was\nobserved. This test was thus used as further evidence that the membrane\ndoes not adsorb anionic dyes during the filtration tests, and thus\nno additional studies were conducted on CV filtration using the membrane. Furthermore, we evaluate the water flux through the nearly hydrophobic\n(DF) face of the membrane. Notably, while the DF face has a similar\nrejection rate for Rose Bengal (RB) due to its negatively charged\nsurface (−10 mV), it exhibited a lower water permeability,\naveraging 1428 L m –2 h –1 , in contrast\nto the 3443 L m –2 h –1 observed\nwith the superhydrophilic (VF) face ( Figure 6 c). Nevertheless, the performance far exceeds\nthat of traditional polymeric membranes. 8 This high water flux indicates that the near-hydrophobic DF face\ndoes not hinder water transport and confirms the capabilities of the\nTTA-DFP-COF self-standing membranes, which offer significantly higher\nflux rates than conventional options. The remarkable water flux of\nthe TTA-DFP-COF membrane is due not only to its superhydrophilic surface\nbut also to its porosity and the open, interconnected porous structure\nthat minimizes tortuosity. In comparison, conventional polymeric membranes\ntypically used in nanofiltration and reverse osmosis have a water\ncontact angle between 40 and 80° and a denser structure, resulting\nin lower flux rates. 8 The proposed\nfiltration mechanism for the rejection of anionic\ndyes is illustrated in Figure 6 e, which highlights the potential role of molecular sieving\nand electrostatic repulsion in the efficient rejection of RB. This\nprocess involves two key strategies: molecular sieving, which allows\nthe passage of water while filtering out larger anionic dye molecules\ndue to the selective size permeability of superhydrophilic surface,\nand electrostatic repulsion, where the negatively charged surface\nof the membrane repels anionic dye molecules and prevents their adhesion\nor penetration. Together, these mechanisms facilitate the efficient\nseparation of dyes from water and ensure thorough dye removal. Water Purification from Mineral Oil Leveraging the\nsuperhydrophilic vapor face of the TTA-DFP-COF membrane, we tested\nits performance in water purification from mineral oil ( Figure 7 a). Remarkably, the TTA-DFP-COF\nmembrane showed an excellent 99% oil rejection from water at a significantly\nhigh-water flux of about 3500 L m –2 h –1 . This remarkable performance continued after several filtration\ncycles, with each cycle efficiently processing around 40 mL of the\n1000 ppm oil-in-water emulsion to produce pure water. This not only\nhighlights the efficiency of the membrane in water purification from\noil, but also shows the robustness of the membrane, which maintained\nits performance throughout the tests performed over 10 cycles. Additionally,\nto test the membrane’s durability, the PXRD of the membrane\nwas recorded after being immersed in water for over two years, and\nthe results show that the membrane retained its crystallinity over\ntime ( Figure S46 ). Figure 7 Water Purification from\nMineral Oil through the TTA-DFP-COF membrane.\n(a) Removal of oil from water by TTA-DFP-COF membrane. Left axis (blue):\nrejection of oil (1000 mg/L) from oil-in-water suspension over 10\ncycles. 40 mL of permeate was collected in each cycle. Right axis\n(red): water flux of the oil-in-water suspension through the membrane\nover 10 cycles. (b) Microscopic images of the oil-in-water suspension\nbefore (left) and after (right) filtration through the TTA-DFP-COF\nmembrane. Photographic images of the suspension before and after filtration\nare also included as insets in each microscopic image. (c) Proposed\nmechanism for the rejection of mineral oil facing the superhydrophilic\nVF of the membrane. The scheme highlights the effect of surface complete\nwetting by water and how it results in high contact angle with oil\ndroplets, thus rejecting oil. The microscope images shown in Figure 7 b illustrate the presence of\noil droplets\nwithin the feed solution on a scale of 200 μm, which represents\na clear contrast to the purity of the water permeate after filtration\nthrough the COF membrane. Images of the feed and permeate water in\nglass vials show the transition from a cloudy oil-in-water emulsion\nto clear, purified water after membrane filtration. In the oil–water\nseparation field, the membrane’s surface wettability is a critical\nfactor. Given the superhydrophilic nature of the membrane’s\nvapor face, which is used as the active layer for oil rejection, the\nwater phase is expected to spread across the membrane vapor face before\ninfiltrating its porous structure. 61 This\nleads to a high contact angle of the oil on the water-wetted membrane\nvapor-face, which reduces its affinity to the membrane, resulting\nin its efficient rejection. The proposed mechanism for removing oil\nfrom water using the COF membrane is schematically represented in Figure 7 c. Table S9 in the SI shows a comparison of the performance of\nthe TTA-DFP-COF membrane reported in this study with recent reports\non polymer membranes and composite polymer membranes in oil rejection\nfrom oil-in-water emulsions. The TTA-DFP-COF membrane shows superior\nperformance compared to most membranes tested in recent reports, especially\nin terms of permeation flux, which is in the range of 100–1000\nL m –2 h –1 for most unmodified\npolymeric membranes. 62 − 66 Antibacterial Properties and Biocompatibility In order\nto assess the resistance of the TTA-DFP-COF membrane to fouling, its\nantimicrobial properties were studied. E. coli , representing Gram-negative bacteria, and S. aureus , representing Gram-positive bacteria, were selected to evaluate\nthe membranes’ ability to prevent bacterial adhesion and inhibit\ntheir growth. The antimicrobial properties of the TTA-DFP-COF\nmembrane (2.5 cm diameter) were first assessed using the agar disc\ndiffusion technique. The zones of inhibition (IZ) surrounding the\nareas treated with TTA-DFP-COF against E. coli and S. aureus were 8.1 ± 0.65\nand 11.2 ± 1.6 mm in diameter, respectively, after 24 h, indicating\neffective antimicrobial activity ( Figure 8 a and Figure S47 ). Figure 8 Antimicrobial properties. (a) Inhibition zone (IZ) images of TTA-DFP-COF\nmembrane against bacteria: E. coli as\na representative Gram-negative model and S. aureus as a typical Gram-positive model. (b) Comparative SEM analysis of\nbacterial morphology before and after 1 h contact with the TTA-DFP-COF\nmembrane. Top panel: E. coli bacteria\nappear intact in control samples but show notable deformation after\n1 h exposure to the TTA-DFP-COF membrane, as indicated by the yellow\narrow. Bottom panel: S. aureus exhibits\na similar trend, with control bacteria maintaining their characteristic\nshape and those in contact with the TTA-DFP-COF membrane displaying\nsignificant structural disruptions, highlighted by yellow arrow. Subsequently, the TTA-DFP-COF membrane was exposed\nto suspensions\nof E. coli and S. aureus at a concentration of 1 × 10 6 CFU/mL, maintained\nat 37 °C and shaken for a 1 h period, resulting in antibacterial\nefficacies of 83.07 and 78.37%, respectively, highlighting the antibacterial\nproperties of the membrane ( Figure S48 ).\nFollowing this exposure, the membrane was washed with PBS and then\nincubated in PBS at the same temperature for 4 h. Agar plate analyses\nperformed on samples from both the wash solution and the elution solution\nshowed no bacteria, confirming no bacterial adhesion or survival on\nthe membrane ( Figure S49 ). The antibacterial\nefficacy of the TTA-DFP-COF membrane against E. coli and S. aureus was demonstrated by\nmorphological changes observed after 1 h exposure by SEM. For E. coli and S. aureus , the control cells were intact while the cells exposed to the membrane\nshowed damage, including holes and blebs leading to potential content\nleakage and cell death, indicating broad-spectrum antibacterial activity\nof the membrane, as seen in Figure 8 b and Figure S50 . The TTA-DFP-COF membrane exhibits potent antimicrobial activity\nby disrupting bacterial cells through electrostatic and hydrogen bond\ninteractions with their membranes. Its efficiency is consistent with\nprevious findings for triazine and imine-based COFs, which rapidly\ncompromise bacterial membranes, prolonging antimicrobial effectiveness\nand preventing biofilm growth. 67 − 70 The TTA-DFP-COF membrane uses a contact-killing strategy\nfor antimicrobial defense, providing a sustainable, nontoxic alternative\nfor water treatment that combines environmental safety with effective\nbacterial control. 71 The biocompatibility\nof the TTA-DFP-COF membrane was validated in vitro with HEK-293 cells, a standard for testing material\nsafety in human biology. After incubating the membrane fragments with\nthese cells for 48 h, optical microscopy showed that the cells not\nonly survived but also thrived around and, on the membrane, proving\nits compatibility ( Figure S51 ). This shows\nthat the membrane is suitable for use in sensitive environments, and\ndoes not affect water quality. The TTA-DFP-COF membrane represents\nan innovative step in water filtration, that combines health, safety,\nand eco-friendliness. Proven to effectively purify water and combat\nbacteria while being biocompatible, it stands out as a sustainable\nchoice for solving global water problems."
} | 16,692 |
22363691 | PMC3282770 | pmc | 9,465 | {
"abstract": "Background It is energetically expensive to synthesize certain amino acids. The proteins (spidroins) of spider major ampullate (MA) silk, MaSp1 and MaSp2, differ in amino acid composition. Glutamine and proline are prevalent in MaSp2 and are expensive to synthesize. Since most orb web spiders express high proline silk they might preferentially attain the amino acids needed for silk from food and shift toward expressing more MaSp1 in their MA silk when starved. Methodology/Principal Findings We fed three spiders; Argiope aetherea , Cyrtophora moluccensis and Leucauge blanda , high protein, low protein or no protein solutions. A. aetherea and L. blanda MA silks are high in proline, while C. moluccesnsis MA silks are low in proline. After 10 days of feeding we determined the amino acid compositions and mechanical properties of each species' MA silk and compared them between species and treatments with pre-treatment samples, accounting for ancestry. We found that the proline and glutamine of A. aetherea and L. blanda silks were affected by protein intake; significantly decreasing under the low and no protein intake treatments. Glutmaine composition in C. moluccensis silk was likewise affected by protein intake. However, the composition of proline in their MA silk was not significantly affected by protein intake. Conclusions Our results suggest that protein limitation induces a shift toward different silk proteins with lower glutamine and/or proline content. Contradictions to the MaSp model lie in the findings that C. moluccensis MA silks did not experience a significant reduction in proline and A. aetherea did not experience a significant reduction in serine on low/no protein. The mechanical properties of the silks could not be explained by a MaSp1 expressional shift. Factors other than MaSp expression, such as the expression of spidroin-like orthologues, may impact on silk amino acid composition and spinning and glandular processes may impact mechanics.",
"introduction": "Introduction Protein is integral for organismal function. Organisms exposed to protein limited environments hence must carefully partition ingested protein between somatic and metabolic requirements [1] , [2] . Animals that synthesize and secrete proteinaceous materials potentially face further protein stresses 3 – 5 . These may be partially alleviated by the metabolic synthesis of the amino acids required to build the materials [3] , [6] . Nonetheless synthesizing amino acids comes at metabolic costs, which vary depending on the structural complexity of the amino acid and the metabolic phase it is derived from [2] . Primarily, amino acids that are derived from pre-citric acid cycle metabolites such as glucose 6-phosphate (e.g. histidine), 3-phosphoglycerate (e.g. serine and glycine) and pyruvate (e.g. alanine, leucine) are synthesized at a lower energetic cost than those derived from citric acid cycle metabolites such as oxaloacetate (e.g. asparagine, methionine) and α-ketoglutarate (e.g. glutamine, proline) [3] , [6] – [9] . Further, certain amino acids, the so-called “essential amino acids” cannot be derived metabolically [6] . As amino acid biosynthesis is associated with the sacrifice of energy and retention of nitrogenous toxins [2] , [6] , [7] , uptake from food is the principal method of obtaining the requisite amino acids for protein synthesis by most animals. The silks of silk worms and spiders are examples of secreted proteinaceous materials [10] , [11] . Researchers are particularly interested in understanding the metabolic costs and synthetic pathways of spider silk because its combined properties of high strength and extensibility and ability to be synthesized in a non-toxic environment render it desirable to commercially develop [3] , [9] – [14] . Nevertheless, how nutrient intake, especially protein, influences silk synthesis and expression, and the performance consequences of any variations in silk expression are still poorly understood in spiders. Web building spiders may produce up to seven different types of silk [11] , [15] . Nonetheless, research to date has focused principally on major ampullate (MA) silk as this is the silk that has the most impressive mechanical properties. MA silk has been described to consist of two proteins; major ampullate spidroin 1 and 2, or MaSp1 and MaSp2 [16] – [18] . MaSp1 consists of alanine (Poly-A) and glycine (GGX-) repetitive motifs [8] – [10] . MaSp2 contains, in addition to these alanine and glycine motifs, a proline-containing motif (–GPG). It thus may be possible to estimate, depending on the spider, the relative quantity of MaSp1 and MaSp2 in a sample of MA silk based on the relative amounts of alanine (which may range from ∼15–35% depending on methods), glycine (ranging from ∼30–45% depending on methods) and proline (ranging from ∼0% in silks entirely composed of MaSp1 to ∼15% in silks entirely composed of MaSp2, depending on methods) [19] – [23] . Accordingly, most orb-web spiders, with the exception of some species of Nephila \n [20] – [23] , Cyrtophora \n [20] , [21] and Latrodectus \n [20] , [24] , appear to have MA silks that principally comprise of MaSp2. The principal reason for the predominance of MaSp2 expression in orb web spider MA silk is probably associated with the predicted β-spiral molecular arrangement of the MaSp2 spidroin as it endows the silk with a combination of strength and extensibility [16] , [20] ; properties essential for the prey impact absorption function of spider orb webs [11] , [12] . Having repeating units consisting of proline and glutamine, the MaSp2 spidroin seems to be more energetically expensive to synthesize metabolically [4] , [8] , [9] . For this reason it was predicted that the golden orb web spider, Nephila clavipes , expresses less MaSp2 in its MA silk when under starvation stress [8] , [25] . The two-spidroin (MaSp) model for spider MA silk was derived from detailed studies of the underlying genetics and the chemical and physical properties under supercontraction of the MA silk of a model spider, Nephila clavipes \n [8] , [19] , [26] – [29] . Nonetheless, as more spider silks are examined, contradictions to the model have arisen, bringing its universal applicability into question. For example, individuals of the giant wood spider, Nephila pilipes found in different regions of Taiwan, and/or that feed on different prey, have variations in the amino acids expressed in their MA silk but the variations are associated with changes in alanine and glycine but not proline [30] – [32] . Such variations, accordingly, cannot be explained by shifts in MaSp expression [32] . Additionally, the riverine orb spider of Madagascar, Caerostris darwinii , exhibits silk with such extreme extensibility and toughness that it cannot be explained by the expression of a combination of MaSp1 and MaSp2 [33] . One potential explanations for these contradictions is the possibility that spiders express multiple, unidentified, orthologues of MaSp1 or MaSp2, as described for Araneus diadematus \n [17] , [34] , [35] . Additionally, factors such as the physiological and biochemical state of the spider and spinning processes act on the molecular alignment of the proteins and consequently alter the mechanical properties of the dry silk irrespective of the influence of MaSp expression [25] , [28] , [32] , [36] – [38] . Here we expand on research suggesting that the amino acid composition and mechanical properties of spider silks are altered in accordance with the diet of the spider [8] , [25] , [30] – [32] , [39] , [40] . We recently suggested that the nutritive value of prey can induce differential expression of spider MA silk but we were unsuccessful at completely decoupling nutrients from other influential prey parameters, such as the size and handling characteristics of the different prey [32] . This study thus investigates the specific role of protein intake as an inducer of variation in spider MA silk. We assume that certain amino acids (e.g. proline and glutamine) are required by spiders for silk synthesis and silk functionality but are expensive to attain through the diversion of metabolites and protein uptake via food or re-ingestion of the web, which may contribute over 90% of the protein required for some silks [4] , [8] , [9] , is principally relied upon for their acquisition. We also test whether the effects of protein uptake varies in different spiders, as different spiders may produce MA silks of varying amino acid composition [41] , which may, if the MaSp model holds, reflect their predicted MaSp expression [16] , [21] , [22] , [26] , [27] . We compared the MA silk expression (i.e. amino acid composition and mechanical properties) of three orb-web spiders: Argiope aetherea , Leucauge blanda and Cyrtophora moluccensis under three protein intake regimes: high, low or no protein intake. While the relative genetic inputs into the silks of these species are unknown, species of the former two genera have been reported to exhibit high proline (∼9–12%), hence most likely MaSp2 predominant, MA silks [20] , [21] , [41] , [42] . Species from the latter genus exhibit low proline (∼1–2%), hence most likely MaSp1 predominant, MA silks [20] , [21] . Nonetheless, phylogenetically Argiope aetherea and Cyrtophora moluccensis are more closely related with Leucauge blanda distantly related to the former two species [43] . We tested two predictions: (1) that proline and glutamine content in the MA silks of A. aetherea and L. blanda will decrease when feeding on low or no protein compared to when feeding on high protein. However, the proline and glutamine composition in C. moluccensis MA silks will not be as manifestly influenced by protein intake, indicative of a shift in expression away from MaSp2 expression in A. aetherea and L. blanda . Such a result would corroborate the premise that glutamine and proline uptake from food or re-ingestion of webs is primarily relied upon to deliver these amino acids for silk synthesis [8] , and this requirement is greater in orb web spiders that produce MaSp2 predominant silks. Alternatively, (2) silk expression responses to protein intake may be explained by phylogeny [44] , [45] . In this case, we would expect that the glutamine and proline compositions of A. aetherea and C. moluccensis to exhibit similar shifts, which should differ from those of L. blanda . We assumed any findings other than those we have predicted to indicate that factors other than protein intake or phylogeny act as the bases for shifts in MA silk expression with diet. The relationship between amino acid composition and mechanical properties of the MA silks of these species across the three feeding treatments were used to determine whether protein intake confers any effects on MA silk mechanical performance and whether the MaSp model is able to explain the changes ascertained.",
"discussion": "Discussion Here we showed, accounting for phylogenetic relationships, that the chemical and physical properties of a secreted proteinaceous material, the MA silks of the orb web spiders Argiope aetherea , Cyrtophora moluccensis and Leucauge blanda , vary with the concentration of protein ingested. Moreover, our analyses revealed that while silk amino acid composition variations were proximately influenced by the concentration of protein that spiders take up the variations in the mechanical properties of their MA silk were influenced principally by phylogeny, with protein intake only influencing variations in mechanical properties via its influences on amino acid composition. The protein concentrations of the solutions used herein reflect the extremes of protein concentrations found naturally in insects [1] , [47] , [48] . Thus our study demonstrates, albeit making the untested assumption that spiders can extract and metabolize albumin protein and energy in precisely the same way as insect-derived protein and energy, the kind of metabolic and physiological adjustments that spiders make in order to modify their silks in response to changes in their nutritive environment. Variations in the amino acid composition of A. aetherea (a spider with MA silks that are predicted to predominantly contain MaSp2) MA silk showed more similarities to L. blanda 's (who is distantly related to A. aetherea but has MA silks also predicted to contain predominantly MaSp2) MA silk than to the more closely related C. moluccensis (who is predicted to have predominantly MaSp1 MA silk). Therefore it appears that silk type, i.e. predominance of MaSp1 or MaSp2, and the energetic costs of synthesizing each silk type, is most likely the driver of the shifts in MA silk amino acid compositions in response to the intake of different protein concentrations. Similar variations in silk amino acid compositions have been reported for Nephila clavipes in response to starvation [8] , [25] . Our results thus support the proposition that protein uptake via food or web re-ingestion is primarily relied upon to supply the amino acids in silk that are energetically expensive to synthesize, e.g. glutamine and proline. Much of the amino acids consumed nonetheless appear to be broken down and re-synthesized before incorporation into silk. For instance, the HP and LP solutions had a high concentration of lysine, cytosine and asparagine but these did not seem to be incorporated into the silks as, while not statistically analyzed, their compositions in all MA silks remained relatively low (0–2%). On the other hand, despite being absent from the NP solution, alanine composition increased in both A. aetherea and L. blanda MA silks when fed that treatment. While the MA silk amino acid compositional variations across the NP, LP and HP treatments in our study exhibited some similarities with previous starvation experiments [8] , [25] , there are some important differences. For instance, we found that glutamine was reduced in C. moluccensis silks when feeding on the NP solution without any concurrent reduction in proline. Likewise, the reduction in glutamine and proline in A. aetherea was not accompanied by similar decreases in serine. According to the MaSp model developed for N. clavipes , if variations in the MaSp1:2 ratio were responsible for the shifts in silk expression, then proline (which is exclusively found in MaSp2), glutamine and serine (which are more prominent in MaSp2) should co-vary. Proline and serine were found to be lower, albeit insignificantly, in C. moluccensis MA silks when feeding on the NP solutions, so it is possible that MaSp2 down-regulation occurs when protein intake ceases. Nonetheless in a previous experiment with Nephila pilipes fed different diets similar MA silk compositional variations for glutamine and serine were found without concomitant variations in proline composition [32] . These and other published discrepancies to the MaSp model, e.g. the compositional and mechanical responses of the MA silks of Cyclosa mulmeinensis and C. ginnaga when exposed to wind [58] , allude to the possibility that the model is not able to predict MA silk amino acid compositional and mechanical property variations across all spiders. We suggest that more silks need to be examined at a molecular level to establish species-specific models. Researchers have recently found various MA silk gene duplicates among different spiders [18] , [59] – [61] , so it is plausible that there are more than two spidroin genes in any of the three species that we used. We performed liquid chromatography to derive across treatment amino acid compositions for the MA silks of the three species used. While this is a widely used technique and adequate for making standardized across and between treatment intra- and inter-specific comparisons [2] , [8] , [32] , any comparison with other studies should consider that other methods with different levels of precision may have been used to derive amino acid composition. Nuclear magnetic resonance (NMR) and other spectroscopic methods are becoming more widely used in silk research [14] , [19] , [25] , [62] as these methods have lower amino acid compositional variability associated with their analyses compared to traditional methods [14] , [62] , [63] . We therefore cannot rule out MaSp expression as a means by which the MA silks of the spiders examined here vary with protein intake until adequate comparable NMR studies are done. Our analysis suggests that the concentration of protein taken up proximally induces variations in silk extensibility and stiffness via its influence on glutamine, proline and alanine compositions across the three species examined. In N. clavipes , alanine is predicted to be involved in the formation of crystalline β-sheets while proline disrupts crystallite growth [12] , [19] , [22] . Moreover, β–sheet formation is associated with greater ultimate strength and reduced extensibility in spider silk [20] , [21] . Accordingly, the reduced proline and enhanced alanine should result in less extensible, stronger silks. We found that extensibility was reduced when silk proline composition was low but a concomitant increase in ultimate strength with an increase in alanine composition was not found. Our results thus contradict expectations if MaSp2 down-regulation was the principal mechanism driving mechanical property variations. Factors other than proline and alanine composition, such as ionic, hydration, pH and temperature variations within the silk gland and/or haemolymph can influence the size and density of crystals and the formation of strength-enhancing β–sheets in MA silk [11] , [36] – [38] , [64] . Any of these factors may have been altered as the spiders experience metabolic stress and, accordingly, may have affected the silk mechanics. To summarize, we demonstrate that the level of protein intake influences spider silk expression in A. aetherea , C. moluccensis and L. blanda . All of these species reduced their glutamine, proline and/or serine compositions in response to low/no protein diets but they did so to different extents. Our results support the premise that amino acids derived from citric acid cycle metabolites, e.g. glutamine and proline, are associated with a higher sacrifice of metabolic energy [4] so protein intake via food or web re-ingestion is largely relied upon for their incorporation into silk [8] , [9] . Most orb web spiders have MA silks high in MaSp2 [9] . As MaSp2, owing to its higher glutamine, proline and serine, is energetically expensive to synthesize it may be down-regulated by orb web spiders when protein intake is limited [8] and our results partially support this. Nonetheless, at least one of the spiders tested, C. moluccensis , did not exhibit significant reductions in proline composition when on the low or no protein treatment. The mechanical properties of the silks varied with protein intake but these variations were contradictory to the expectations of MaSp2 down-regulation. Our analyses suggested they were more influenced by phylogenetic intertia between related species. As we do not know the genetic inputs into the MA silks of the spiders that we used we cannot speculate as to whether or not spidroin orthologues or other proteins are responsible for the contradictions to the MaSp model. We however expect spinning conditions to differ for each spider and for these to influence silk mechanical properties independent of MaSp expression [11] , [15] , [25] , [36] – [38] . One implication of our study is that since different spiders produce silks of different MaSp1 and MaSp2 composition (e.g. A. aetherea and L. blanda probably produce silks richer in MaSp2 than C. moluccensis ) different spiders probably adjust their silk properties in different ways in response to protein limitation just as variable responses to a varying nutrient environments has been shown for spider life history traits [40] , [47] – [50] , [65] – [67] . Another implication is that many orb web spiders that are predicted, based on proline composition, to have MaSp1 predominant silk also build either three dimensional webs or two dimensional orb webs with three dimensional barrier structures, e.g. Nephila clavipes , Latrodectus hesperis and Cyrtophora spp. [8] , [18] , [20] – [23] . These three-dimensional webs alleviate the requirement to produce highly extensible silks to capture insects in full flight [68] . Accordingly, if three-dimensional web building spiders can utilize MaSp1 predominant silks to capture prey, the requirement of extracting the majority of their protein for silk synthesis from food or web re-ingestion may be alleviated. More data on the chemical and physical properties and MA silk gene sequences for two-dimensional and three-dimensional web-building spiders are needed however to corroborate our conjecture."
} | 5,257 |
22682889 | null | s2 | 9,466 | {
"abstract": "Microbes can be readily cultured and their genomes can be easily manipulated. For these reasons, laboratory systems of unicellular organisms are increasingly used to develop and test theories about biological constraints, which manifest themselves at different levels of biological organization, from optimal gene-expression levels to complex individual and social behaviors. The quantitative description of biological constraints has recently advanced in several areas, such as the formulation of global laws governing the entire economy of a cell, the direct experimental measurement of the trade-offs leading to optimal gene expression, the description of naturally occurring fitness landscapes, and the appreciation of the requirements for a stable bacterial ecosystem."
} | 193 |
35858960 | PMC9300745 | pmc | 9,468 | {
"abstract": "Trait-based approaches are increasingly relevant to understand ecological and evolutionary patterns. A comprehensive trait database for extant reef corals is already available and widely used to reveal vulnerabilities to environmental disturbances including climate change. However, the lack of similar trait compilations for extinct reef builders prevents the derivation of generalities from the fossil record and to address similar questions. Here we present the Ancient Reef Traits Database (ARTD), which aims to compile trait information of various reef-building organisms in one single repository. ARTD contains specimen-level data from both published and unpublished resources. In this first version, we release 15 traits for 505 genera and 1129 species, comprising a dataset of 17,841 trait values of Triassic to mid-Holocene scleractinian corals, the dominant reef-builders in the modern ocean. Other trait data, including for other reef-building organisms, are currently being collated."
} | 248 |
32471144 | PMC7308943 | pmc | 9,470 | {
"abstract": "On the issues of global environment protection, the renewable energy systems have been widely considered. The photovoltaic (PV) system converts solar power into electricity and significantly reduces the consumption of fossil fuels from environment pollution. Besides introducing new materials for the solar cells to improve the energy conversion efficiency, the maximum power point tracking (MPPT) algorithms have been developed to ensure the efficient operation of PV systems at the maximum power point (MPP) under various weather conditions. The integration of reinforcement learning and deep learning, named deep reinforcement learning (DRL), is proposed in this paper as a future tool to deal with the optimization control problems. Following the success of deep reinforcement learning (DRL) in several fields, the deep Q network (DQN) and deep deterministic policy gradient (DDPG) are proposed to harvest the MPP in PV systems, especially under a partial shading condition (PSC). Different from the reinforcement learning (RL)-based method, which is only operated with discrete state and action spaces, the methods adopted in this paper are used to deal with continuous state spaces. In this study, DQN solves the problem with discrete action spaces, while DDPG handles the continuous action spaces. The proposed methods are simulated in MATLAB/Simulink for feasibility analysis. Further tests under various input conditions with comparisons to the classical Perturb and observe (P&O) MPPT method are carried out for validation. Based on the simulation results in this study, the performance of the proposed methods is outstanding and efficient, showing its potential for further applications.",
"conclusion": "5. Conclusions Besides the development of materials for PV cells to improve the power conversion efficiency, it is essential to develop a new MPPT method which can accurately extract the MPP with high tracking speed under various weather conditions, especially under PSCs. In this study, two robust MPPT controllers based on DRL are proposed, including DQN and DDPG. Both algorithms can handle the problem with continuous state spaces. In which, DQN is applied with discrete action spaces while DDPG can deal with continuous action spaces. The advantage of these two methods is that no prior model of the control system is needed. The controllers will learn how to act after being trained based on the reward received by the continuous interaction with the environment. Rather than using a look-up table in the RL-based method, DRL uses neural networks to approximate a value function or a policy so that high memory requirement for sizeable discrete state and action spaces could be significantly reduced. Here, the environment is the PV system and refers to the object that the agent is acting on. Here, the agent represents the DRL algorithm, while the action is the perturbation of the duty cycle. It starts by sending a previous state to the agent, which then based on its knowledge, takes action in response to this previous state. Then, the environment responds with a pair of the next state and reward back to the agent. The agent can learn how to take action based on the reward and current state received from the environment. After being trained based on the historical data collected by the direct interaction with the power system, the proposed MPPT methods autonomously regulate the perturbation of the duty cycle to extract the best MPP. To sum up, compared to the traditional P&O method, the DRL-based MPPT methods applied in this study have a better performance. They can accurately detect the MPP with a significant tracking speed, especially the global MPP under partial shading conditions. In most of the cases, the DQN method overtakes the DDPG method. However, when the partial shading condition happens, the DDPG method slightly outstrips the DQN method. The simulated results show the outstanding performance of the proposed MPPT controllers. However, the limitation of this study is that the proposed method cannot always detect global MPP. Thus, further study will be conducted in the future to improve the tracking ability of DRL-based methods. Furthermore, real-time experiments will be carried out for validation.",
"introduction": "1. Introduction Energy demand has been continuously increasing and is predicted to rise at a significant rate in the future [ 1 ]. It leads to the rapid development of renewable energy resources like solar, wind, tidal, geothermal, etc., for reducing the consumption of fossil fuels and protecting the global environment from pollution. Besides wind power, solar energy is the most commonly used energy source with a high energy market share in the energy industry around the world [ 2 ]. Due to the continuous decline in price and the increasing concern of greenhouse gas emissions, lots of photovoltaic (PV) systems have been intensively constructed, especially in areas with rich solar radiation. Besides the efforts of improving the production process of the PV module and converter power electronics for better performance of the system, it is essential to enhance the system throughput with an efficient maximum power point tracking (MPPT) controller. The MPPT algorithm is employed in conjunction with a DC/DC converter or inverter to assure the MPP can always achieve the goal under different weather conditions of solar radiation and temperature. Over the years, numerous MPPT methods have been employed, which can be classified into various categories according to sensor requirements, robustness, response speed, effectiveness, and memory as shown in these review papers [ 2 , 3 , 4 ]. The conventional MPPT methods [ 5 ] that have been practically adopted due to their simplicity and easy implementation. In which, Perturbation and Observation (P&O) and Incremental Conductance (IC) are the famous algorithms. Moreover, many other traditional algorithms have been introduced by Karami [ 6 ], such as Open Circuit Voltage (OV), Ripple Correlation Control (CC), Short Circuit Current (SC), One-Cycle Control (OCC). Mohapatra [ 7 ] has confirmed that conventional methods can usually perform efficiently under a uniform solar radiation condition. However, being trapped at a local MPP resulting in low energy conversion under a partial shading condition (PSC) is their considerable drawback. In addition, a small step size of the duty cycle causes longer tracking time, while it can oscillate around the MPP with the large one. Ahmed [ 8 ] tried to modify the P&O method with variable step size to eliminate its drawbacks of slow tracking speed, weak convergence, and high oscillation. In this scenario, the controller can choose a large step size when the MPP is still far away. As it approaches the MPP, the small step size is used to reduce the oscillation. Other modified methods can be found in [ 2 , 3 , 4 , 5 ]. Another class of MPPT control is based on soft computing techniques as summarized by Rezk [ 4 ], such as fuzzy logic control (FLC) [ 9 ], artificial neural network (ANN) [ 10 ], and neuro-fuzzy (ANFIS) [ 11 , 12 ]. While some methods are proposed based on the evolution algorithms, like genetic algorithm (GA) [ 13 ], cuckoo search (CS) [ 14 ], ant colony optimization (ACO) [ 15 ], bee colony algorithm (BCA) [ 16 ], bat-inspired optimization (BAT) [ 17 ], bio-inspired memetic salp swarm algorithm [ 18 ], etc. Jiang [ 19 ] has defined that these methods, based on both soft computing techniques and evolutionary algorithms, can efficiently deal with the nonlinear problem and obtain global solutions or are able to track the global MPP under PSCs. However, they have two significant disadvantages. It generally requires an expensive microprocessor for less computational time and the knowledge of a specific PV system for low convergence randomness. Rezk et al. [ 4 ] have shown that the method based on particle swarm optimization (PSO) is currently popular in the application of MPPT control [ 20 ]. It can uniquely combine with other algorithms to create a new approach for efficiently solving the MPPT control problems, such as PSO with P&O by Suryavanshi [ 21 ], and PSO with GA by Garg [ 22 ], etc. Recently, extensive studies have focused on reinforcement learning (RL) with various successful applications due to its superior learning ability from environmental-interacting historical data, instead of the requirement of complex mathematical models of the control system in conventional approaches [ 23 , 24 ]. As summarized by Kofinas et al. [ 25 ], RL has higher convergence stability with shorter computational time compared to meta-heuristic methods, thus making it a potential tool for optimally solving the problem of MPPT control. To date, a few studies have focused on this field, in which Q-learning is the most-used algorithm. In [ 26 ], Wei has applied MPPT control for a variable-speed wind energy system based on Q-learning. The authors in [ 27 ] also developed an MPPT controller for a tidal energy conversion system. Additionally, the works that try to implement RL for the MPPT control of a solar energy conversion system can be found in [ 25 , 28 , 29 ]. However, these approaches have the drawbacks of low state and action spaces. Kofinas et al. [ 25 ] have used a combination of 800 states with five actions to form a state action space of 4000 state actions, while Hsu et al. [ 28 ] and Youssef [ 29 ] just made only four states. As a consequence, the system with large state and action spaces results in longer computational time. Phan and Lai [ 30 ] proposed a combination of Q-learning and P&O methods. Each control area, which is divided based on the temperature and solar radiation, are handled by a Q-learning controller for learning the optimal duty cycle. Then, these optimal duty cycles are forward to the P&O controller resulting in the smaller step size used. Chou [ 31 ] has developed two MPPT algorithms based on RL, one uses a Q table and the other one adopts a Q network. However, the problems under PSCs are not mentioned in the above studies. Instead of using a trained agent, the approaches [ 32 , 33 ] deal with the MPPT control problem by using multiple agents. A novel memetic reinforcement learning-based MPPT control for PV systems under partial shading condition was developed [ 32 ] while a transfer reinforcement learning approach was studied to deal with the problem of global maximum power point tracking [ 33 ]. Generally, the major drawback of the methods, as mentioned above, is the use of small discrete state and action space. The recent development of machine learning leads to an integration of reinforcement learning and deep learning, named as deep reinforcement learning (DRL), which is considered as a powerful and potential tool to deal with the optimization control problem [ 34 , 35 , 36 ]. The successful performance of the DRL method in playing Atari and Go games is described in the study [ 37 ]. DRL is a powerful method for handling complex control problems with large state spaces. The advantage of DRL is that it can manage the problem with continuous state and action spaces. To date, DRL has been successfully applied to several fields, including games [ 37 ], robotics [ 35 , 38 ], natural language processing [ 39 ], computer vision [ 38 ], healthcare [ 40 ], smart grid [ 41 ], etc. Zhang [ 42 ] has defined a brief overview of DRL for the power system. A similar concept with deep reinforcement learning has been developed for MPPT control of the wind energy conversion system, in which a neural network is used as a function approximation to replace the Q-value table [ 43 , 44 ]. After an exhaustive search of related works and the achievement of reinforcement learning (RL), it is shown that there is a gap in the application of the DRL algorithm for MPPT control. Therefore, this paper proposes MPPT controllers based on DRL algorithms to harvest the maximum power and improve the efficient and robust operation of the PV energy conversion systems. In this study, two model-free DRL algorithms, including deep Q network (DQN) and deep deterministic policy gradient (DDPG), are introduced to the MPPT controllers. Different from the RL-based method, which can only operate with discrete state and action spaces, both proposed methods can deal with continuous state spaces. In which, DQN works with discrete action space; while the continuous action space is used in the DDPG method. Rather than using a lookup table to store and learn all possible states and their values in the RL-based method, which is impossible with large discrete state and action spaces, the DRL-based method uses neural networks to approximate a value function or a policy function. The main contributions of this paper are as follows: Two proposed efficient and robust MPPT controllers for PV systems based on DRL are proposed and simulated in MATLAB/Simulink, including DQN and DDPG. Eight scenarios under different weather conditions are considered for testing the performances of the two proposed methods. They are divided into four scenarios under uniform conditions and four other scenarios under partial shading conditions, as shown in Table 3. A comparison between the proposed method and the P&O method is also investigated. In this paper, the descriptions of a PV mathematical model and the influence of partial shading conditions to the location of MPP are introduced in Section 2 . The proposed methods based on two different reinforcement learning algorithms, including DQN and DDPG, are described and formulated in Section 3 . Based on the simulation and the comparison results in Section 4 , the performance of the proposed methods appears very outstanding and efficient in PV operation. Finally, the conclusion and future work are presented in Section 5 .\n\n2.3. PV System Introduction PV solar has nonlinear characteristics, where its performance is significantly affected by the change of temperature and solar irradiance. It is clear from the previous figures that the PV output power is directly proportional to the decline of solar irradiance and inversely proportional to the temperature. This means that only one optimum terminal voltage of the PV array exists, which lets the PV panel operate at the MPP with a specific weather condition [ 47 , 48 ]. Thus, it is important to develop a robust MPPT control for extracting the MPP at all times [ 7 ]. In addition, under PSCs, there are multiple peaks on the P–V curve of a PV panel. Hence, a smart MPPT controller should be considered to overcome the limitation of traditional MPPT methods. A block diagram of a PV system is demonstrated in Supplementary Figure S5 , including a PV array, a DC–DC converter, a resistance load, an MPPT controller. Here, DC–DC converters have a major role in the MPPT process. When connecting output terminals of a PV array with a DC–DC converter, the array voltage can be controlled by changing the duty cycle D, which is a pulse width modulation (PWM) signal and is executed by the MPPT controller to regulate the voltage at which maximum power is obtained. The calculation of the duty cycle for a DC–DC boost converter is given by [ 30 ]\n (7) D = 1 − V i n V o u t In this paper, two deep reinforcement learning algorithms are applied for MPPT control, including DQN and DDPG. The principles of these two algorithms, applied for MPPT control of a PV system, are introduced in the next section."
} | 3,858 |
26824077 | PMC4730863 | pmc | 9,471 | {
"abstract": "Shape memory polymer with thermally distinct elasticity and plasticity enables highly complex shape manipulations."
} | 28 |
38607930 | PMC11032481 | pmc | 9,472 | {
"abstract": "Significance Fine root turnover is an essential process controlling the uptake, conservation, and loss of nutrients, water, and carbon between plants and soils. As such, it is at the core of the recent but already well-known and hotly debated root economics space (RES) theory. Here, gathering an unprecedented dataset, we suggest that the current interpretation of the global RES axes needs to be partly reconsidered to account for the potential roles of the two axes in defining the fast–slow continuum in root strategies. We also demonstrate that there are major differences between plant above and belowground strategies for the longevity of leaf vs. root organs. Overall, our work provides a synthesis of root lifespan and its environmental and plant-related drivers.",
"conclusion": "Conclusions. We analyzed global data on the fine root lifespan of woody species and explored its key drivers. We found that mycorrhizal type, leaf habit, and evolutionary group significantly influence fine root lifespan. Further, higher temperatures and lower precipitation are linked to a shortened fine root lifespan. Additionally, we were able to account for broad variation in fine root lifespan in our analysis and found that woody plant traits such as RD, root nitrogen, and root C:N ratio can help to understand part of the variability in fine root lifespan. Most importantly, our results shed light on the ecological interpretation of the recent and widely used RES proposed by Bergmann et al. ( 7 ) describing global diversity in root economics strategies. We demonstrate that root lifespan not only decreases with plant investment in root nitrogen but also increases with construction of larger diameter roots. Our findings also highlight the globally unrelated relationship between fine root and LL, emphasizing intrinsic differences in evolutionary adaptations between gymnosperm and angiosperms, and the relative independence of aboveground and belowground plant strategies with respect to lifespan.",
"discussion": "Discussion Root Lifespan–Trait Relationships in Relation to the Multidimensional RES. The RES synthesizes global species fine-root trait variation along two main axes: a belowground collaboration axis (reflecting a tradeoff between species with thick, highly mycorrhizal roots, and species with long SRL that are less reliant on mycorrhizal fungi for resource uptake) and an independent conservation axis (associated with a tradeoff between RTD prolonging MRL and RN) ( 7 ). Our PCA results align well with this multidimensional representation of the RES ( Fig. 2 ). The position of MRL within this RES partly supports our hypothesis that MRL relates to the acquisition-conservation axis. However, MRL was directly only related to RN but not to RTD ( Fig. 3 C and D ), suggesting that the theoretical role of RTD in root protection by providing adequate structural and/or chemical protection against soil-borne pathogens ( 18 ) is only weakly related to observed MRL in soil, although several local scale studies have noted a significant relationship with RTD ( 10 , 32 , 33 ). Nonetheless, as expected, more metabolically active roots with higher RN ( 34 ) showed shorter lifespan, supporting the hypothesized trade-off between living fast and living long ( 3 ). In addition, the correlation between MRL and the RCN may not only be related to changes in RN but possibly also to a higher concentration of complex structural compounds such as lignin and suberin ( 35 ), effectively reducing their palatability to soil herbivores and increasing their resistance to soil pathogens. In contrast to our expectation, root lifespan was also related to the collaboration axis of the RES, with MRL positively relating to RD, as well as negatively to SRL. The greater C investment per unit root length in roots with larger RD may be coupled with longer MRL to ensure a favorable nutrient and water return on the higher C investment compared with roots of smaller RD ( 4 ). Thicker roots with larger cortex space for hosting fungi may also harbor more intensive association with mycorrhizal fungi, which can contribute to plant defense against pathogens and root survival in case of drought owing to better connection to soil residual water ( 36 – 38 ). In light of these results, we suggest that current interpretation of the global RES axes may need to be at least partly reconsidered to include the potential roles of both axes in defining the slow-fast continuum in root strategies. Influence of Plant Functional Types and the Environment on Fine Root Lifespan. Our results indicate that MRL was significantly longer in evergreen species than in deciduous species ( Fig. 1 A ). This may be due to historical differences in the respective growing environments of these two functional groups ( 2 ). Globally, evergreen species tend to inhabit less fertile and colder environments than deciduous species ( 2 ). The longer MRL of evergreen species reflects a “slower” ecological strategy that promotes carbon retention in fine root tissues, an ecological response to resource scarcity ( 3 ). Evergreen species also display thicker RD (on average, SI Appendix , Fig. S2 A ), representing higher carbon and nutrient investments, that may be compensated through longer period of resource capture ( 4 , 29 ). In contrast, the shorter MRL of deciduous species is consistent with a “faster” soil foraging strategy (long SRL, SI Appendix , Fig. S2 C ) with higher metabolic rate (high RN, SI Appendix , Fig. S2 C ) to ensure rapid access to more abundant resources ( 3 ). We found that EM species exhibited longer MRL than AM species ( Fig. 1 B ), possibly linked to their higher concentration of complex structural compounds than AM species (high RCN, SI Appendix , Fig. S2 F , 18 ). Indeed, EM (angiosperm) species induce a physical and chemical barrier to prevent fungal penetration into the inner cortex via thickening of the exodermis walls that likely plays a protective role against pathogens ( 39 ). The EM fungal sheath production and the increase in fungal melanin content in EM root segments ( 40 ) may further protect roots against physical hazards and pathogen attack ( 41 ). We found that MAT and MAP both influenced MRL. Warming significantly shortened MRL at a broad scale ( Fig. 1 E ). The decrease in MRL at higher MAT may be the result of increased metabolic activity, buildup of free radicals, and faster root aging ( 20 ). For example, Jiang et al. ( 42 ) found that warming of 4 °C remarkably shortened MRL of Chinese fir in a field-scale warming experiment and that part of this negative effect may have been caused by an inadequate C supply to roots. Burton et al. ( 43 ) suggested that plasticity in MRL in northern hardwood forests may be regulated by carbohydrate supply from the shoot, with a reduced carbohydrate supply resulting in shorter MRL. Roots from plants growing at lower MAT had longer MRL, probably because fine roots tend to have lower respiration rates ( 44 ) and lower level of root activity at lower MAT. Variation in the response of MRL to changes in MAP likely depends on whether MAP strongly limits root growth. We found that an increase in MAP increased MRL ( Fig. 1 F ). Higher MAP has also been associated with increased MRL in some tropical systems as MRL tends to increase during wet seasons and decrease during dry periods ( 45 ). However, excess MAP may reduce MRL as the high frequency of anoxic conditions in water-rich soil increases root stress and pressures from external factors, including soil pathogens and saprophytic fungi ( 20 ). Correlation of Fine Root Lifespan with LL. In partial support for our third hypothesis, we showed that LL and MRL were positively correlated in evergreen species ( Fig. 4 A ). Evergreen species often grow in environments with low soil nutrient or water availabilities ( 46 ). where increased LL and MRL prevent additional nutrient losses associated to root and leaf shedding ( 47 ). Coordinated ecological strategies above and belowground are thought to be critical for balancing the nutrient and carbon resource acquisition and losses and achieving optimal plant stoichiometry for cost-efficient growth and defense mechanisms ( 3 , 27 , 28 ). However, we were unable to demonstrate a correlation between MRL and LL among deciduous woody plants ( Fig. 4 A ). This absence of clear trend is consistent with the few experiments comparing MRL and LL ( 48 , 49 ). The only study to find a correlation between LL and MRL focused on grasses and savanna species ( 9 ), suggesting fundamental differences in the LL or MRL of herbaceous vs. woody species, or between different plant evolutionary lineages. Overall, the different environmental constraints faced by leaves and roots ( 50 ) may lead to different selection pressures for MRL and LL. Interestingly, there was a distinctly weaker phylogenetic signal for MRL than that observed for LL ( SI Appendix , Table S1 ), suggesting that MRL has undergone more change with evolution ( 12 , 51 ). The emergence of colder and drier climate during the mid to late Cretaceous has been hypothesized as a cause of adaptation and root trait diversity in angiosperms ( 11 , 52 , 53 ). Angiosperm lineages may have the ability to evolve diverse types of roots quickly in various habitats that allow them to deal with changing environments. This further suggests that MRL and LL evolution may have been largely independent for angiosperm species, potentially leading to a lack of correlation between MRL and LL in this group. The absence a of general trend between MRL and LL across all deciduous and evergreen species was largely due to a much lower difference between evergreen and deciduous species MRL ( Fig. 4 A ) than observed for LL. The major difference in LL between deciduous and evergreen species is primarily driven by their strategies to cope with changing environmental conditions and optimize resource use for photosynthesis. Studies have shown that evergreen species have a longer LL than deciduous species owing to more conservative traits (i.e., thicker, denser, and with lower specific leaf areas) ( 54 – 56 ) implying more investment in structural integrity and/or defense against disturbances, especially in the context of resource constraint ( 55 ). Although LL is much more constrained in deciduous trees than in evergreens, in more productive locations, deciduous species have quick access to readily available resources ( 57 ), resulting in particularly short LL. In contrast to this large variation between deciduous and evergreen LL, the difference in MRL between the two types of plants is much smaller. As expected, MRL of evergreen species was significantly longer than that of deciduous species, but the magnitude of the difference was not comparable with that for LL. One potential explanation for this might be the inability of fine roots to reach very long lifespans in most soil conditions experienced globally. Most soils harbor a high diversity of microbial herbivores and pathogens that may benefit from the more constant abiotic conditions of the soil medium compared to the air. Acquisitive roots might more readily suffer damage to their cortex compared to their leaves, which may have less favorable conditions for microbial development. Moreover, turnover of acquisitive roots may be an adaptation for exchange of resources with the soil via interactions with soil microbes ( 58 ). More studies in natural settings are needed to understand the influence of soil properties, such as nutrient availability, soil texture, and density, on fine root lifespans. Conclusions. We analyzed global data on the fine root lifespan of woody species and explored its key drivers. We found that mycorrhizal type, leaf habit, and evolutionary group significantly influence fine root lifespan. Further, higher temperatures and lower precipitation are linked to a shortened fine root lifespan. Additionally, we were able to account for broad variation in fine root lifespan in our analysis and found that woody plant traits such as RD, root nitrogen, and root C:N ratio can help to understand part of the variability in fine root lifespan. Most importantly, our results shed light on the ecological interpretation of the recent and widely used RES proposed by Bergmann et al. ( 7 ) describing global diversity in root economics strategies. We demonstrate that root lifespan not only decreases with plant investment in root nitrogen but also increases with construction of larger diameter roots. Our findings also highlight the globally unrelated relationship between fine root and LL, emphasizing intrinsic differences in evolutionary adaptations between gymnosperm and angiosperms, and the relative independence of aboveground and belowground plant strategies with respect to lifespan."
} | 3,205 |
24492748 | PMC3892558 | pmc | 9,474 | {
"abstract": "Reconstructing the evolutionary history of modern species is a difficult problem complicated by the conceptual and technical limitations of phylogenetic tree building methods. Here, we propose a comparative proteomic and functionomic inferential framework for genome evolution that allows resolving the tripartite division of cells and sketching their history. Evolutionary inferences were derived from the spread of conserved molecular features, such as molecular structures and functions, in the proteomes and functionomes of contemporary organisms. Patterns of use and reuse of these traits yielded significant insights into the origins of cellular diversification. Results uncovered an unprecedented strong evolutionary association between Bacteria and Eukarya while revealing marked evolutionary reductive tendencies in the archaeal genomic repertoires. The effects of nonvertical evolutionary processes (e.g., HGT, convergent evolution) were found to be limited while reductive evolution and molecular innovation appeared to be prevalent during the evolution of cells. Our study revealed a strong vertical trace in the history of proteins and associated molecular functions, which was reliably recovered using the comparative genomics approach. The trace supported the existence of a stem line of descent and the very early appearance of Archaea as a diversified superkingdom, but failed to uncover a hidden canonical pattern in which Bacteria was the first superkingdom to deploy superkingdom-specific structures and functions.",
"conclusion": "5. Conclusions We inferred evolutionary patterns by examining the spread of molecular features in contemporary organisms. The analysis revealed a common origin for all cells, the early divergence of Archaea, and a sister relationship between Bacteria and Eukarya. Archaeal evolution was primarily influenced by genome reduction while that of Bacteria by two contrasting phases: (i) a period of early innovation that coincides with the rise and diversification of the bacterial superkingdom, and (ii) a postdivergence period of this lineage exhibiting relatively late genome reduction events. The branch leading to modern eukaryotes was minimally affected by reductive pressure and retained the majority of the ancestral traits. Eukaryotes further enriched the genomic abundance of these traits by engaging in gene duplication and domain rearrangement processes and by discovering novel structures and molecular activities. Traces of all of these events could be reliably detected in modern proteomes and functionomes. In particular, a strong vertical trace from the urancestor to the stem line unifying Bacteria and Eukarya and the ancestor of Eukarya could be inferred. This strong vertical trace strongly supports the existence of a stem line of descent, from which all three superkingdoms emerged, very much in line with Kandler's ideas of an aboriginal precellular line of early biochemical evolution that was undergoing cellularization [ 56 ]. Finally, nonvertical evolutionary processes seemed to have played only limited roles during defining steps of cellular evolution. The comparative framework enables exploration of deep evolutionary histories without invoking tree reconstruction algorithms and external hypotheses of evolution. This approach is in line with various published phylogenetic analyses and provides strong support to theories favoring an archaeal origin of diversified life.",
"introduction": "1. Introduction Tracing the evolution of extant organisms to a common universal cellular ancestor of life is of fundamental biological importance. Modern organisms can be classified into three primary cellular superkingdoms, Archaea, Bacteria, and Eukarya [ 1 ]. Molecular, biochemical, and morphological lines of evidence support this trichotomous division. While the three-superkingdom system is well accepted, establishing which of the three is the most ancient remains problematic. Initial construction of unrooted phylogenies based on the joint evolution of genes linked by an ancient gene duplication event revealed that, for each set of paralogous genes, Archaea and Eukarya were sister groups and diverged from a last archaeal-eukaryal common ancestor [ 2 , 3 ]. This “canonical” rooting that places Bacteria at the base of the “Tree of Life” (ToL) is still widely accepted despite the fact that many other paralogous gene couples produced discordant topologies and despite known technical artifacts associated with these sequence-based evolutionarily deep phylogenies [ 4 , 5 ]. As a result, reconstructing a truly “universal” ToL portraying the evolutionary relationships of all existing species remains one of the most controversial issues in evolutionary biology. This in part owes to the shortcomings of available phylogenetic characters and tree optimization methods that suffer from important technical and conceptual limitations [ 6 , 7 ] and have failed to generate a consensus. It is further complicated by the fact that genetic material can be readily exchanged between species, especially akaryotes (i.e., Archaea and Bacteria that lack a nucleus) via horizontal gene transfer (HGT) [ 8 – 10 ]. Nonvertical evolutionary processes coupled with uncertainties regarding evolutionary assumptions greatly complicate the problem of reconstructing the evolutionary past. Recently, ToLs reconstructed using conserved structural information of protein domains [ 11 , 12 ], their annotated functions (Kim et al., ms. resubmitted), and universal RNA families [ 13 – 18 ] provided new ways to root phylogenies. These studies identified thermophilic archaeal species to be the most closely related to the primordial cells. Findings not only challenge the bacterial rooting of the ToL but also highlight the importance of employing reliable phylogenetic methods and assumptions when reconstructing deep evolutionary history [ 7 ]. Here, we advance the structural and functional approach by providing a simple solution to the problem of phylogenetic reconstruction. We argue that basic quantitative and comparative genomic analyses that do not invoke phylogenetic reconstruction are sufficient to resolve the tripartite division of cells and sketch their history. Our comparative approach involves the analysis of how superkingdoms, and their organismal constituents, relate to each other in terms of global sharing of genomic features. The genomic features we selected are entire repertoires of molecular structures and functions (collectively referred to as traits from hereinafter). They define two specific genomic datasets. The structure dataset encompasses the occurrence and abundance of 1,733 fold superfamily (FSF) domains in 981 completely sequenced proteomes. FSF domains were delimited using the Structural Classification of Proteins (SCOP ver. 1.75), which is a manually curated database of structural and evolutionary information of protein domains [ 19 , 20 ]. The FSF level of the SCOP hierarchy includes domains that have diverged from a common ancestor and are evolutionarily conserved [ 21 , 22 ]. In comparison, the function dataset describes the occurrence and abundance of 1,924 gene ontology (GO) terms [ 23 , 24 ] in 249 functionomes. We note that the global set of FSFs portrays the entire structural repertoire of organisms and that the repertoire of GO terms portrays their true physiology. Both provide useful information about species diversification. We restricted our analyses to include only structures and functions as they are more conserved than gene sequences [ 25 – 27 ] and permit deep evolutionary comparisons. In contrast, nucleotide sequences are susceptible to higher mutation rates and are continuously rearranged in genomes to yield novel domain combinations and molecular functions [ 6 ]. In other words, loss of an FSF domain structure or molecular function is much more costly for cells as it sometimes involves loss of hundreds of genes that have accumulated over long periods of evolutionary time. This is compounded especially for traits that are very ancient as they had more time to multiply in genomes and increase their genomic abundance [ 28 , 29 ]. Thus molecular structure and function remain preserved in cells for relatively longer periods and make reliable candidates for inferring deep evolutionary relationships. Here, we show that an analysis of trait distribution between superkingdoms, distributions between genomic repertoires of superkingdoms, and abundance counts allow dissection of historical (ideographic) patterns using a comparative ahistorical (nomothetic) method ( Figure 1 ). Inspired by a comparative analysis of RNA families [ 30 ], we measured the strength of evolutionary association between superkingdoms as a function of patterns of sharing of individual traits ( Figure 1 ). We note that our approach is sufficiently informative to make reliable inferences regarding different evolutionary scenarios of diversification adopted by the three superkingdoms. This approach revisits widely accepted theories regarding the origin of diversified life [ 31 , 32 ] and falsifies the fusion [ 33 ] and hydrogen hypotheses [ 34 ] of eukaryotic origins, more than supporting any. This exercise then prompts validation by phylogenetic tree reconstruction, which we have reported previously (see [ 26 , 28 , 29 , 35 ]). In light of these considerations, the comparative exercise provides an easy-to use and reliable alternative to otherwise complicated phylogenetic tree reconstruction methods. These analyses carry the potential to yield significant insights into the evolution of cells and, if carefully interpreted, provide strong arguments in favor of the rooting of the ToL in Archaea and embedded canonical pattern of FSF and GO innovation.",
"discussion": "4. Discussion Our approach is simple ( Figure 1 ). It does not involve computation of a sequence alignment or use of complex data matrices for phylogenetic reconstruction. Instead, it focuses on the census of molecular (structural and functional) traits in the genomes of modern cells. The fundamental principle of analysis is the use of trait distributions in Venn taxonomic groups to explain vertical evolutionary traces, the use of f -values to explain horizontal traces, and the use of trait abundance as a proxy for age. The sequential combination of these approaches dissects the most likely scenario of diversification of superkingdoms, without invoking a phylogenetic framework of analysis. Our comparative genomic exercise shows evidence in favor of a common ancestry for cells and establishes the deep branching patterns of the ToL. The genetic complexity of Bacteria and Eukarya hints towards a strong and ancient evolutionary association between the two superkingdoms. This association is stronger than the associations of other superkingdoms. Our findings are also compatible with an evolutionary scenario in which Archaea emerged as the first superkingdom of life by diverging from a primordial stem line of descent that originated in the urancestor [ 26 , 28 ]. This line likely encountered extreme temperatures that affected its proteomic growth, hampering the acquisition of new molecular traits in those environments. Under such hostile conditions, the persistence strategy of the emerging archaeal cells was most likely survival rather than enrichment [ 50 ]. This explains why we observed the lowest number of traits in extant archaeal species. In contrast, both Bacteria and Eukarya shared a protracted coevolutionary history. Their diversification occurred well after the primordial split of Archaea from the urancestral line. Bacteria followed a path towards exploring a diverse range of habitats, which enabled high rates of gene discovery. This explains the high numbers of unique bacterial traits that are unequally distributed among bacterial species. Bacterial species also engaged in genome reductive processes and simplified their trait representations. This probably occurred well after their divergence from the primordial stem line. Finally, eukaryotes evolved by (i) increasing the abundance of ancient traits (via gene duplications and domain rearrangements), (ii) discovering novel traits, or (iii) both. These findings falsify an evolutionary scenario of first appearance of bacterial cells [ 2 , 3 ] or the fusion hypotheses linked to the origin of eukaryotes (e.g., [ 33 ]), as none seems compatible with our data. However, we did not consider the roles that viruses may have played during cellular evolution. Viruses are known to contribute to the genetic diversity of cells and are believed to be very ancient [ 35 , 51 – 53 ]. We will accomplish this task in the near future. Genome reduction is an ongoing evolutionary process that often triggers lifestyle transitions in cells (e.g., from free-living to intracellular parasites [ 44 ]). We propose that genome streamlining played a key role in the evolution of akaryotes, especially Archaea. Our data show that the BE taxonomic group was enriched in molecular traits compared to the relatively poor representations of FSFs and GOs in the AB and AE groups ( Figure 2 ). In fact, evolutionary timelines revealed that the BE group appeared very early in evolution and was correlated with high abundance levels of BE FSFs in the bacterial and eukaryal proteomes ( Figure 6 ). These findings were taken as an indication of loss of traits in Archaea that occurred very early in evolution. While it can be argued that such losses could have occurred much later in archaeal lineages and after their diversification from Bacteria, our comparative and evolutionary data indicate that this may not be very likely. The loss of ancient traits late in evolution is phylogenetically costly as it implies loss of many genes and proteins that have accumulated during the course of evolution to perform a particular molecular task. In comparison, loss of ancient traits early in evolution is more parsimonious and complies with the principle of spatiotemporal continuity. An alternative explanation, however, could be the confounding effects of HGT processes. However, it was shown recently that a large number of ribosomal proteins were unevenly distributed in archaeal species [ 54 , 55 ]. Because ribosomal proteins are generally refractory to HGT, their patchy and uneven distribution in archaeal lineages is better explained by differential loss from a more complex archaeal ancestor. Taken together, these findings strongly suggest that primordial reductive evolutionary processes have tailored archaeal evolution. When placed along evolutionary timelines of trait innovation ( Figure 6 ), Venn taxonomic groups uncovered a remarkable pattern that could not be dissected with the comparative genomic approach. This hidden pattern embodies the primordial rise of Bacteria-specific traits followed much later by the concurrent appearance of Archaea-specific and Eukarya-specific innovations. This important succession supports the “canonical” rotting of the ToL in which Bacteria occupy the most basal positions while Archaea and Eukarya emerge as derived sister-groups [ 2 , 3 ]. From a cladistics perspective, traits unique to a superkingdom are autapomorphies, derived features that are unique to terminal groups. These autapomorphies cannot be used to reconstruct trees in phylogenetic analysis or dissect the alternative evolutionary scenarios of our comparative genomic approach. In comparison, FSFs and GOs that are shared by any two superkingdoms reflect synapomorphies (shared and derived features) that allow both historical (phylogenetic) and ahistorical (comparative) inferences. We note that traits uniquely shared by any two superkingdoms can arise either by the gain of the feature in two superkingdoms or by the loss in one. Abundance levels and f -distribution patterns support the latter scenario, especially if the loss involves an ancient trait. Thus, an early primordial loss of FSFs and GO synapomorphies in Archaea embeds later on the early gain of autapomorphies in Bacteria. The hidden canonical pattern of Figure 6 was already reported in an exhaustive structural phylogenomic exploration of domain evolution at fold and FSF levels of structural abstraction [ 26 ], which prompted the definition of three epochs in the evolution of proteins and the organismal world and a number of hypotheses of origin. In the first “architectural diversification” epoch, the emerging organismal community accumulated a rich toolkit of protein structures and functions. This communal world resembled the ancient world of multiphenotypical precells proposed by Kandler [ 56 ] that inspired Woese's more advanced scenarios of early cellular evolution [ 57 ]. However, and in contrast with the simple cellular systems sought by Kandler and Woese, the precell molecular make up that was inferred from our phylogenomic analysis was extremely rich in complex structures and functions [ 29 ]. This richness is expressed today in the sizable number of structures and functions that are shared by all superkingdoms and are revealed by our comparative exploration. Towards the end of the architectural diversification epoch, the pervasive loss of domain structures in subgroups of the urancestral precell population resulted in primordial archaeal grades, groups of diversifying organisms in active transition that were at first unified by the physiological complexity of the urancestral community but later on gained the cellular cohesiveness needed to establish lineages and true patterns of organismal diversification. While it may prove difficult to establish the time when these “thresholds” (sensu [ 57 ]) were crossed by the primordial archaeal grades as these were stemming from the urancestral stem line, the early process of reductive evolution left deep historical signatures in the make up of the archaeal organisms that are embedded in the timelines of domain structures [ 26 ]. The second “superkingdom specification” epoch brought the first Bacteria-specific domain structures and later on the concurrent appearance of Archaea-specific and Eukarya-specific structures. This canonical pattern of appearance of superkingdom-specific structures, which unfolded in the absence of early and major reductive evolutionary tendencies, signals a time in which the emerging superkingdoms were being molded by innovation. During this epoch, grades turned into clades and the precell “swap shop” strategy was gradually replaced by organismal cohesiveness. Marked decreases in f -values during this time suggested that lineage sorting occurred more frequently in the growing number of lineages. Finally, in the “organismal diversification” epoch, commitment to strategies and lifestyles enhanced even further the divide between superkingdoms and weakened the contribution of the stem line of descent. Two forces of particular significance play crucial roles during this final epoch, the combinatorial use of domains as modules in multidomain proteins of Eukarya [ 12 , 49 ] that is responsible for the high abundance levels and the biphasic patterns of Figure 6 and the HGT-driven combinatorial exchange of protein repertoires in lineages of Bacteria [ 26 ] that minimizes trait distribution in Figure 3 . We end by emphasizing that our comparative genomic inferences have been ratified previously by phylogenetic tree reconstructions (e.g., [ 11 – 13 , 17 , 22 , 26 , 28 ]) and thus establish the power of our methodology. However, our analysis depends upon the accuracy and sampling of structures and functions and the reliability of the datasets. The function dataset, in particular, is dependent upon the stability of GO annotations and is biased towards eukaryal organisms that are more carefully annotated. To minimize this factor, we sampled 183 bacterial and 45 archaeal functionomes in comparison to only 21 eukaryotes. Despite the huge number of akaryal functionomes in our dataset, we were still able to highlight the incredible enrichment of eukaryal repertoires. Moreover, inferences drawn from function were in agreement with structure and both should be considered reliable. While tracing back evolutionary history from the present to the first cell is a complex problem, inferring the patterns of species diversification by comparing the use and reuse of molecular traits in extant cells must be considered a robust inferencial approach that is free from many of the external assumptions and technical problems faced when reconstructing phylogenetic trees. The only shortcoming may be one of interpretation, which we here showcase with the scenarios of origin we have discussed. However, we have tried to restrict our statements to scenarios that seem most compatible with the given data. An example is using a threshold of 60% difference in the popularity of traits to detect HGT-derived structures and functions. This criterion was set arbitrarily to identify only the most likely HGT-transfers but may have resulted in failure to detect some of the true HGT-acquired traits, especially for those where both intersuperkingdom and intrasuperkingdom transfers occurred rapidly. Although such events are less likely, they may still be occurring. However, detection of such transfers is a hard problem and cannot be reliably confirmed without experimental evidence. Given the conservation levels of structural and functional traits and the relatively poor repertoire of likely HGT-acquired features (Tables S1 and S2), we safely assume that this factor did not seriously compromise our inferences. Finally, our approach is a systematic application of morphological analyses that were initially used to classify higher-order organisms. Future work should be focused on advanced applications of our approach for reaching a consensus regarding the evolution of cells."
} | 5,464 |
24312542 | PMC3846910 | pmc | 9,477 | {
"abstract": "Tropical scleractinian corals are considered autotrophic as they rely mainly on photosynthesis-derived nutrients transferred from their photosymbionts. Corals are also able to capture and ingest suspended particulate organic matter, so heterotrophy can be an important supplementary trophic pathway to optimize coral fitness. The aim of this in situ study was to elucidate the trophic status of 10 coral species under contrasted environmental conditions in a French Polynesian lagoon. Carbon (δ 13 C) and nitrogen (δ 15 N) isotopic compositions of coral host tissues and photosymbionts were determined at 3 different fringing reefs during wet and dry seasons. Our results highlighted spatial variability in stable isotopic compositions of both coral host tissues and photosymbionts. Samples from the site with higher level of suspended particulate matter were 13 C-depleted and 15 N-enriched relative to corals and photosymbionts from less turbid sites. However, differences in both δ 13 C and δ 15 N between coral host tissues and their photosymbionts (Δ host-photosymbionts 13 C and Δ host-photosymbionts 15 N) were small (0.27 ± 0.76‰ and 1.40 ± 0.90‰, respectively) and similar at all sites, thus indicating no general increases in the heterotrophic pathway. Depleted δ 13 C and enriched δ 15 N values of coral host tissues measured at the most turbid site were explained by changes in isotopic composition of the inorganic nutrients taken up by photosymbionts and also by changes in rate of isotopic fractionation with environmental conditions. Our results also highlighted a lack of significant temporal variations in δ 13 C and δ 15 N values of coral host and photosymbiont tissues and in Δ host-photosymbionts 13 C and Δ host-photosymbionts 15 N values. This temporal stability indicated that corals remained principally autotrophic even during the wet season when photosymbiont densities were lower and the concentrations of phytoplankton were higher. Increased coral heterotrophy with higher food availability thus appears to be species-specific.",
"introduction": "Introduction Tropical scleractinian corals, which live in symbiosis with dinoflagellates of the genus S ymbiodinium , are extremely well adapted to their oligotrophic environment. The algal photosymbionts transfer a large fraction of the photosynthesis-derived carbon to their animal host and contribute significantly to its nutrition [ 1 ]. However, photosynthates translocated by photosymbionts are deficient in nitrogen, phosphorus and other nutrients [ 2 ], and the capture of suspended particulate organic matter (SPOM) including phytoplankton, zooplankton and detritus or/and the assimilation of dissolved inorganic and organic compounds is essential to optimize coral fitness [ 3 ]. Thus, scleractinian corals can be considered as opportunistic feeders that are able to use extremely diverse trophic pathways. These organisms assume several ecological roles simultaneously, spanning the levels of primary producer, herbivore, carnivore, detritivore and consumer of dissolved organic matter. In shallow waters, photosynthetic rates of photosymbionts are high [ 4 ] and scleractinian corals rely heavily on translocated photosynthates for their nutrient requirements [ 5 – 7 ]. At these depths, corals are principally autotrophic. In contrast, photosynthetic rates of photosymbionts in deep-water corals are low [ 4 ], much lower quantities of photosynthates are supposed to be produced and translocated, and hence corals are more heterotrophic [ 8 ]. However, corals do not shift from almost exclusive autotrophy in shallow water to heterotrophy in the deep reef [ 9 ]. Recent observations on numerous symbiotic coral species from temperate and tropical reefs support the idea that heterotrophy can be important at all depths, and it is well established that environmental factors such as light availability, seawater temperature, nutrient status and suspended particulate organic matter (SPOM) concentration all influence coral nutrition [ 3 , 8 , 10 – 13 ]. Stable carbon (δ 13 C) and nitrogen (δ 15 N) isotopic composition are useful measures for delineating carbon flow and tropic relationships in a large variety of continental and deep marine ecosystems [ 14 , 15 ]. Natural δ 13 C values identify the relative contributions of potential food sources, as consumers are slightly 13 C-enriched relative to their diet [ 16 ]. The larger δ 15 N fractionation occurring at each trophic transfer (typically +2.3 ± 0.18‰ is assumed by McCutchan et al. [ 17 ]) allows us to infer important structural features of food webs such as the number of trophic levels [ 18 ] and the prevalence of omnivory [ 19 ]. Host tissues of autotrophic corals are generally slightly 15 N-enriched and 13 C-depleted compared to their photosymbiont as a result of isotopic fractionation associated with reciprocal exchanges of carbon and nitrogen between hosts and photosymbionts [ 8 , 20 – 22 ]. When the degree of heterotrophy by corals increases, the δ 13 C values of coral hosts and their photosymbionts become increasingly disparate and host signatures approach those of 13 C-depleted heterotrophic sources (i.e. zooplankton prey and particulate organic matter with δ 13 C < -16‰) [ 8 ]. Details regarding the changes in δ 15 N values associated with higher degrees of heterotrophy remain elusive. However, δ 13 C values in coral host tissues relative to their photosymbionts can indicate the net translocation of photosynthates from the photosymbionts to the coral host under different environmental conditions. Both δ 13 C and δ 15 N values of scleractinian corals are influenced by additional factors such as the isotopic values of the dissolved inorganic carbon and nitrogen sources [ 23 , 24 ], nutrient concentrations [ 25 ], respiration rates [ 26 ], and light availability [ 8 , 13 , 21 ]. Numerous studies have focused on measurements of stable isotope composition of coral skeletal material, whereas few researchers have examined in situ natural variations of both δ 13 C and δ 15 N in coral host tissues and photosymbionts among coral reefs [ 23 , 27 ], and even fewer have made these measurements in different seasons on several coral species [ 22 , 28 , 29 ]. For example, Swart et al. [ 22 , 28 ] showed clear seasonal variations of δ 13 C in the coral Montastraea faveolata at a few reefs in Florida. An important challenge is to further refine our understanding of the effects of changing environmental factors on the trophic role of different coral species. Stable isotope ratios represent a suitable tool with which we can address this challenge, and as more data are produced we can improve on our ability to accurately interpret feeding relationships in complex symbiotic organisms. Furthermore, significant differences in both δ 13 C and δ 15 N values among coral species living in the same environment have been highlighted [ 8 , 21 ], and the sources of these differences require further attention. Interspecific variations have been attributed to differences in diffusion distance driving exchange rates between internal and seawater dissolved inorganic nutrient and/or differences in feeding rates [ 8 , 9 , 13 , 21 , 25 , 30 ]. The aims of this study were to investigate the spatial and temporal variations in δ 13 C and δ 15 N values of scleractinian coral host tissues and their photosymbionts from Moorea Lagoon (Society Island, French Polynesia). We hypothesized that (1) corals living in turbid fringing reefs with high levels of both suspended particulate inorganic (SPIM) and organic (SPOM) matter rely more on heterotrophic resources than corals living in reefs with clear conditions, and that (2) corals are more heterotrophic during the cloudy wet season when solar radiation reaching the sea surface is minimal and SPOM concentration is higher. Ten species of scleractinian corals (representing six genera) were sampled in three sites of Moorea Lagoon and during both wet and dry season to determine the interspecific variability in coral trophic status.",
"discussion": "Discussion Spatial variations in stable isotopic composition of corals related to their associated photosymbionts Our results have highlighted that corals from Vaiare, a turbid sedimentary and phytoplankton-rich site, were most 13 C-depleted and 15 N-enriched relative to the corals from the two other sites, Tiahura and Maharepa, during both collection times. Such differences in δ 13 C and δ 15 N values of both coral host tissues and photosymbiont might be explained by changes in (1) the degree of coral heterotrophy, (2) stable isotope values of the sources of carbon and nitrogen assimilated by photosymbionts, and/or (3) the mechanisms by which the sources were fractionated. Degree of coral heterotrophy Carbon and nitrogen isotopic compositions of corals reflect the assimilation of different sources of nutrition including photosymbiont-derived carbon and nitrogen and heterotrophic prey. Experimental and in situ studies have shown that if coral hosts incorporate carbon from sources other than photosymbionts, δ 13 C values of both coral host tissues and photosymbiont approach those of SPOM and differences in δ 13 C values between coral host tissues and their associated photosymbionts (Δ host-photosymbionts 13 C ) increase [ 8 , 20 , 41 ]. 13 C-depletion at Vaiare could have resulted from corals deriving more of their carbon through heterotrophy, as δ 13 C values of corals (mean δ 13 C = -14.9 ± 1.6‰) tend to follow those of very 13 C-depleted SPOM at around -21.2‰. Vaiare is the ferry area of Moorea Island, where higher phytoplankton concentrations (i.e. Chl a , Figure 2A \n ) were measured in the seawater column due to additional nutrients in this area from sediment resuspension (i.e. SPIM enrichment, Figure 2B \n ). Heterotrophy by corals can be enhanced by the increase of available particulate food in their turbid environments, to counteract the reduction in phototrophy by the photosymbionts and allow the corals to maintain a positive energy budget [ 42 ]. However, mean Δ host-photosymbionts 13 C at Vaiare remained small (0.27‰) and was similar to that of Tiahura (0.39‰), indicating that if all corals together are considered, either there was no increase of heterotrophy, or carbon isotope evidence for increased heterotrophy was masked by a rapid recycling of carbon between host and photosymbionts, as suggested by Einbinder et al. [ 43 ]. The lack of increased heterotrophy by corals living at the turbid and nutrient-rich site of Vaiare was also confirmed by δ 15 N values. Ingestion of SPOM may represent an important source of nitrogen for corals living in shallow inshore waters [ 3 ], and when the contribution of heterotrophy increases, δ 15 N of corals approaches those of SPOM [ 21 , 44 ]. However, in our study of Moorea Island, corals were 15 N-enriched at Vaiare relative to the corals from Tiahura and Maharepa, and Δ host-photosymbionts 15 N revealed low variability among sites and averaged +1.4‰, thus suggesting that the degree of heterotrophy at Vaiare was not enhanced. Similar ranges of 15 N-enrichment with the change in trophic level between coral host tissues and photosymbionts have been reported by Swart et al. [ 22 ], supporting the hypothesis of the recycling of internal ammonia and amino acids between the host and photosymbiont suggested by Reynaud et al. [ 44 ]. Our results confirmed that increased heterotrophy by coral hosts in turbid rich nutrient areas is not a universal pattern. Stable isotopic compositions of some species showed variability through space and time, suggesting that adjustments in the heterotrophic pathway is a species-specific phenomenon [ 7 , 30 , 45 , 46 ]. Sources of carbon and nitrogen assimilated by photosymbionts and mechanisms of fractionation Rather than the degree of heterotrophy, 13 C-depletion and 15 N-enrichment of corals from Vaiare relative to the corals from the two other sites may be better explained by the isotopic values of the dissolved carbon and nitrogen sources assimilated by photosymbionts and the mechanisms by which the sources are fractionated related to the degree of light available in such a sedimentary and turbid environment [ 23 , 25 , 47 , 48 ]. Indeed, algae living in symbiosis with corals use two principal sources of carbon for photosynthesis: CO 2 from animal metabolism and the external pool of bicarbonate (HCO 3- ) [ 8 ]. In our study, the δ 13 C value of CO 2 originating from the coral hosts was about -13.9‰ (represented by the mean δ 13 C of coral hosts; Table 6 \n ). Using the equation from Rau et al. [ 49 ], δ 13 C of CO 2 resulting from equilibrium fractionation of HCO 3 \n - from external seawater was about -7‰. Several studies have shown that δ 13 C values of corals under high levels of light are relatively positive, and become more negative as light intensity decreases [ 8 , 9 , 30 ]. Under high levels of light, photosynthetic rates are high and all available CO 2 is fixed by photosymbionts, inducing the reduction of carbon isotopic discrimination. Thus, the δ 13 C values of the photosymbionts approach those of their carbon sources (i.e. the coral hosts) [ 50 ]. Moreover, CO 2 from animal metabolism is totally consumed, and photosymbionts must use larger fractions of CO 2 from the internal tissular bicarbonate pool [ 8 ]. The combination of the reduction of carbon isotopic discrimination and the increased proportion of CO 2 utilized from the bicarbonate pool induce a relative enrichment of photosymbiont δ 13 C under high light levels. Moreover, a similar 13 C-enrichment is observed in coral host tissues due to the translocation of fixed carbon from the photosymbionts. Our findings support the hypothesis that corals living in sedimentary and turbid environment with reduced light levels at Vaiare were generally more 13 C-depleted compared to corals from clear environment at Tiahura and Maharepa. The isotopic composition of dissolved inorganic carbon (DIC) also contributes to inter-reef variability in coral δ 13 C values [ 23 ], and δ 13 C values of DIC are generally correlated with the occurrence of primary production which removes isotopically light carbon from the seawater [ 51 ]. At Moorea Island, Chl a concentrations in the seawater were highest at Vaiare during both sampling times ( Figure 2A \n ) and negatively correlated with δ 13 C values of SPOM ( Figure 4A \n ). The remineralization of detritus by benthic bacteria at the surface of the sediment, and the subsequent resuspension of this detritus with the circulation of ferry boats past Vaiare, have caused further depletion in δ 13 C of the DIC pool in this area. Lighter carbon was thus likely fixed and translocated by the primary producers at Vaiare to higher trophic levels (i.e. corals). Our results also revealed that all coral species considered were significantly 15 N-enriched at the turbid site of Vaiare compared to Tiahura and Maharepa. We would have expected a 15 N-depletion at this turbid site, since Muscatine and Kaplan [ 21 ] found a positive relationship between depth (i.e. low light and particulate nutrient enrichment) and 15 N-depletion. Indeed, low light exposure decelerates photosynthetic rates, which in turn decreases the internal demand for nitrogen and increases fractionation [ 21 , 36 , 52 ]. Predation on constantly depleted zooplankton also contributes to the 15 N-depletion in coral tissue [ 41 ]. The observed 15 N-enrichment of coral tissues from Vaiare thus doesn’t suggest a light and/or feeding effect but rather supports different isotopic composition of DIN sources between sites [ 23 , 52 ]. δ 15 N values of DIN should be affected by total primary production on the reef since autotrophic organisms discriminate against 15 NO 3- [ 53 , 54 ], but our results showed that δ 15 N values of SPOM were not correlated with Chl a concentrations ( Figure 4B \n ). δ 15 N values of DIN are generally higher (by up to 5‰) at eutrophic sites, with a concurrent transfer of this enrichment being apparent in primary producers and higher trophic levels [ 24 , 55 , 56 ]. Enriched δ 15 N values of marine organisms are not necessarily the reflection of sewage or ground water impacts [ 22 ], and at Vaiare waste water discharges were negligible as confirmed by NO 3- concentrations. Other biotic processes in marine ecosystems can lead to large variations in the stable isotopic composition of the DIN pool (see Peterson and Fry [ 15 ] for review). In particular, denitrification processes induce the loss of isotopically light 14 N from the DIN pool, causing the remaining nitrate pool to be 15 N-enriched [ 57 ]. Sediment resuspension affects this process, as Sloth et al. [ 58 ] showed that denitrification rates were stimulated in resuspended mesocosms relative to controls. SPOM and coral 15 N-enrichment at Vaiare were likely due to increased bacterial denitrification processes leading to 15 N-enrichment of DIN; these effects probably dominated and masked other potential influencing factors on nitrogen stable isotope ratios in corals. Temporal variations in the stable isotopic composition of corals The δ 13 C values of coral host tissues and Δ host-photosymbionts 13 C showed significant temporal variations ( Tables 4 \n and \n 6 \n ). However, the differences were small (less than 1‰) and so may not be biologically meaningful. Moreover, no temporal effect was observed in δ 15 N values of coral host tissues and Δ host-photosymbionts 15 N. These results indicated that heterotrophy was not enhanced during the cloudy wet season when the densities of photosymbionts in coral tissues were lower and the concentration of phytoplankton in the surrounding seawater was higher. Corals from Moorea Island relied principally on photosynthates translocated by their photosymbionts during both sampling times. Few researchers have investigated seasonal changes in the nutrition of corals using stable isotope ratios. Swart et al. [ 28 ] suggested that δ 13 C values in coral host tissues, which were collected during summer months were isotopically, more positive than those measured at the end of the summer. The causes of intra annual variations in tδ 13 C are believed to be related to carbon limitation and decreased fractionation of the inorganic carbon pool during the early summer months. Statistically significant seasonal variations in the δ 13 C of coral host tissues and photosymbionts from the coral species Montastraea faveolata were confirmed by Swart et al. [ 22 ], at one of the site investigated in the Florida Keys. The authors [ 22 ] assumed that the absence of similar signals at all the sites investigated may, in part, be a result of the use of different individuals and therefore may represent interspecimen variability due to slightly different inherent physiology of the different coral colonies studied. However, in our study of Moorea Island, coral fragments were collected from the same colonies during both wet and dry seasons to prevent potential sampling artifacts. Swart et al. [ 22 ] also reported that Δ host-photosymbionts 13 C became minimized when photosymbiont densities were at their lowest. In their study SPOM did not contribute substantially to the budget of M. faveolata as δ 15 N values of the coral host tissues were very depleted compared to the SPOM values. The lack of clear temporal changes in the stable isotope values of the scleractinian corals from Moorea Island and the low Δ host-photosymbionts 13 C values (about 0‰) were probably due to small changes in environmental parameters during 2011. Annual variations of environmental parameters (light and nutrients) in New Caledonia lagoon were described as weak compared to short term variations [ 59 ]. A long-time survey to follow such temporal variations would confirm our preliminary observations. Inter-specific variations in acclimation of corals to their environments Data collected on the most abundant species of corals living in shallow fringing reefs around Moorea Island showed similar ranges of δ 13 C and δ 15 N to those previously reported for other tropical scleractinian corals [ 8 , 21 ]. Spatial differences in stable isotope ratios of corals resulted from changes in the sources of carbon and nitrogen assimilated by photosymbionts and the influence of light on source fractionation. Clear temporal variations of coral stable isotope values were not observed at Moorea Island. However, when considering each coral species separately, their isotopic compositions did not show the same variability among sites and between collection times (i.e. results were species-specific). Differences in carbon and nitrogen isotopic ratios among coral species reflect the multitrophic pathways used by corals, and/or their different physiological adaptations involving photosynthesis, respiration and assimilation rates of dissolved inorganic nutrients [ 8 , 9 , 13 , 21 , 30 ]. It is clear that SPOM capture and feeding rates by corals vary among species in relation to their surface area [ 60 ]. However, Δ host-photosymbionts 13 C values recorded in coral species from Moorea Island were low (from -1.44 ± 0.23‰ to 2.98 ± 0.58‰) compared to those for heterotrophic corals (-8‰) living in deep environments [ 8 ]. Muscatine et al. [ 8 ] attributed interspecific differences in δ 13 C values to varying resistance of coral tissues to diffusion of CO 2 and HCO 3- . Reduced diffusion distances increase the replenishment of internal DIC and favor a stronger isotopic discrimination. For example, depleted δ 13 C values in Madracis auretenra (-16‰) were due to thick coral tissues and low production of mucus reducing diffusion distances [ 30 ]. Internal CO 2 depletion could also be exacerbated by the high cell densities of photosymbionts [ 61 ]. At Moorea Island, corals from the genera Pocillopora , Napopora , Pavona and Montipora were 13 C-depleted compared to corals from the genera Porites and Acropora , but our results did not indicate any relationship between the density of photosymbionts and coral δ 13 C values (data not shown). δ 13 C values of P. rus , A. cytherea , A. hyacinthus and P. damicornis remained relatively similar through space and time ( Table 6 \n ), indicating that these coral species did not adjust their physiology to changing environmental conditions. Conversely, stable isotopic compositions of P. cactus , M. tuberculosa , P. meandrina and P. verrucosa showed large variations among sites and/or between times, thus indicating a physiological plasticity of these species. To further improve our understanding of the effects of space and time on the isotope compositions of different coral species and their associated photosymbionts, complementary data on coral physiology would be of great interest."
} | 5,712 |
38524763 | PMC10960952 | pmc | 9,480 | {
"abstract": "Abstract Functional traits influence the assembly of microbial communities, but identifying these traits in the environment has remained challenging. We studied ectomycorrhizal fungal (EMF) communities inhabiting Populus trichocarpa roots distributed across a precipitation gradient in the Pacific Northwest, USA. We profiled these communities using taxonomic (meta-barcoding) and functional (metagenomic) approaches. We hypothesized that genes involved in fungal drought-stress tolerance and fungal mediated plant water uptake would be most abundant in drier soils. We were unable to detect support for this hypothesis; instead, the abundance of genes involved in melanin synthesis, hydrophobins, aquaporins, trehalose-synthases, and other gene families exhibited no significant shifts across the gradient. Finally, we studied variation in sequence homology for certain genes, finding that fungal communities in dry soils are composed of distinct aquaporin and hydrophobin gene sequences. Altogether, our results suggest that while EMF communities exhibit significant compositional shifts across this gradient, coupled functional turnover, at least as inferred using community metagenomics is limited. Accordingly, the consequences of these distinct EMF communities on plant water uptake remain critically unknown, and future studies targeting the expression of genes involved in drought stress tolerance are required.",
"conclusion": "Conclusions EMF communities associated with P. trichocarpa exhibited large compositional shifts across a natural precipitation gradient. Moreover, P. trichocarpa root-systems were significantly more colonized in drier soils. Despite distinct EMF communities occurring in drier soils, the abundance of genes hypothesized to be involved in drought stress tolerance was relatively invariant. One scenario is that EMF differentially express genes putatively involved in drought-stress tolerance despite possessing a similar core repertoire. In addition, our results demonstrating significant variation in sequence homology for aquaporin and hydrophobin genes could be suggestive of differences in the functioning of these genes across the studied precipitation gradient. In both cases metagenomic profiling would be unable to differentiate amongst these possibilities. Our results therefore suggest that meta-transcriptomic, or metabolomic profiling could be necessary to infer the physiological attributes of ECM drought stress tolerance and plant water uptake [ 11 , 20 ]. Finally, due to the small number of communities studied here, additional sampling is necessary to infer the role of MAP and soil water availability in structuring these communities. Moreover, we acknowledge that the patterns observed here are challenging to disentangle from soil variables like pH.",
"introduction": "Introduction Identifying functional traits that mediate the distribution and functioning of microbial communities represents an urgent area of research [ 1 ]. This is because microbial trait distributions can promote understanding of the role of microbes in key biogeochemical transformations, such as those required for adaptation to altered precipitation regimes. Historically, the analysis of microbial traits has largely relied on morphological or process-based measurements. The abundance of molecular genes can serve as proxies for microbial functioning and traits, and they have the advantage of being readily studied using whole-community metagenomic profiling [ 2 , 3 ]. Ectomycorrhizal fungi (EMF) are dominant microbial members of forest ecosystems. Well-known for their role in plant nutrient uptake, EMF may also improve plant drought stress tolerance via specialized water transporters that increase root hydraulic conductivity [ 4 , 5 ] and by extending the surface area of plant roots. Through their role in plant water uptake, EMF support the evolution of drought tolerance in host plants [ 6 ]. However, the extent to which EMF serve to extend plant drought tolerance and increase plant water uptake under field conditions has remained inconclusive [ 4 ]. In light of laboratory evidence that EMF influence plant water relations, widespread observations of EMF community turnover across precipitation gradients is notable [ 7 ]. Two coupled processes could generate turnover in EMF composition and function across precipitation gradients. First, these patterns could result from variation in inherent EMF physiological tolerance to soil water availability or conditions which are modified by increased water availability. Secondly, plant water demand may influence EMF community composition if plants reward EMF that transfer greater water resources [ 8 ]. Such non-mutually exclusive processes would result in coupled compositional and functional trait turnover, whereby traits involved in water acquisition and fungal drought tolerance would exhibit the greatest turnover [ 9 ]. Shifts in gene counts per genome, or gene counts measured at the community level, represent tractable molecular approaches to study shifts in microbial trait profiles [ 2 ]. Metagenomic measures of microbial genes have been used to identify genes that could serve to determine the suitability of organisms to the local environment [ 2 , 3 ]. This approach is conceptually similar to analysing plant leaf or root traits along ecological gradients where coupled shifts are considered indicative of trait-based environmental filtering [ 9 ]. In the current study, we studied EMF communities inhabiting the roots of Populus trichocarpa distributed across an ecosystem-scale gradient of water availability in the Pacific Northwest, USA ( Fig. 1A ). P. trichocarpa is a widespread and important pioneer tree species in riparian habitats; we studied this species as a standardized host to remove the potentially confounding effects of host differences on EMF communities. We tested the hypothesis that EMF communities exhibit coupled taxonomic and functional shifts across a precipitation gradient, and that EMF communities inhabiting drier soils are enriched in genes that promote drought stress tolerance and host plant water uptake. We focused on a core set of gene families which previous work identified as most likely involved in fungal drought stress tolerance and water uptake. Due to the relatively small sample size, we wanted to test a priori hypotheses regarding specific gene families rather than focusing on global scale genome analysis. I we focused on core gene families such as fungal hydrophobins, aquaporins, melanins, and trehalose synthases, collectively some of the best characterized genes related to drought tolerance for fungi [ 10–13 ]. Fungal aquaporins are thought to play a critical role in transmembrane water transfer to host roots and may beneficially influence root water uptake [ 5 ]. Melanin is a component of fungal cell wall and has been shown to improve drought stress tolerance by reducing osmotic stress [ 14 ]. Fungal hydrophobins are small amphiphilic molecules that coat hyphae, serving to facilitate growth across air-filled soil pores. Finally, we also studied certain carbohydrate active enzymes (CAZy), which could be involved in cell wall remodeling and transmembrane water transfer [ 13 ]. Figure 1 (A). Sites across the Pacific Northwest (USA), where ectomycorrhizal fungal (EMF) communities associated with Populus trichocarpa were sampled. (B) EMF colonized root length was inversely correlated with mean annual precipitation (MAP; P = .04; R 2 = 0.21). (C) Significant taxonomic and functional coupling for EMF communities, as measured using counts of Pfam annotated genes (Bray–Curtis distances). Taxonomic dissimilarity is measured using fungal amplicon sequence variants (ASV). For (B and C), Lines represent linear splines with 95% confidence intervals.",
"discussion": "Results and discussion In July and August of 2017, we conducted a field survey of root samples from 12 forest sites dominated by P. trichocarpa [ 15 ]. These sites represent a subset of a continental scale sampling network [ 16 ]. The 12 field sites differ markedly in mean annual precipitation (MAP: range = 213–1674 mm yr −1 ; Fig. 1a ), and we used MAP as a coarse proxy for soil water availability. EMF root-tip colonization (% root-length colonized: grid-intersect method [ 17 ]) ranged from approximately 4–29%, and colonization was inversely correlated with mean annual precipitation (MAP; P = 0.04; Fig. 1b ). We characterized EMF communities in P. trichocarpa using metabarcoding of the ITS1 region of rDNA. Soil properties such as pH, and soil carbon and nitrogen were also measured from the sampled soil cores ( Supplementary Methods ). The relative abundance of Basidiomycete and Ascomycete EMF were invariant across the sampled gradient ( Supplementary Figure 1 ). However, at finer taxonomic scales, EMF communities exhibited significant compositional turnover. Community dissimilarity as measured using fungal ASVs, was primarily associated with variation in soil pH ( P = 0.01), and marginally with MAP ( P = 0.06; PERMANOVA; Supplementary Table 1 ; Supplementary Figure 2 ), but non-significantly by other soil chemical parameters such as soil carbon, or nitrogen release. It should be noted that soil pH and MAP were significantly correlated, with drier sites being more alkaline (R 2 = 0.25, P < 0.001); this correlation is often observed, in part because increased precipitation reduces the availability of buffering ions (i.e. carbonates; [ 18 ]). Overall, EMF genera such as Tuber and Wilcoxina were dominant in drier sites, whereas Scleroderma and Geopora were most abundant in wetter sites ( Supplementary Figure 3 ). The same DNA pool was used for the construction of metagenomic libraries, sequenced using Illumina NovaSeq. We employed the JGI IMG pipeline to filter and annotate fungal reads to Pfam domains, whilst removing plant and bacterial sequences [ 19 ] ( Supplementary Methods ). Overall, soil chemistry and climatic variables were insignificant predictors of community-scale variation in fungal gene dissimilarity (all Pfam domains: Supplementary Figure 4 ). We further studied composition-function linkages, finding that fungal communities and functional gene composition were significantly correlated after accounting for geographic distances among samples (Partial Mantel r = 0.31, P = 0.007; Fig. 1c ). We hypothesized that trees occurring in comparatively drier soils would host EMF enriched in genes related to drought stress and water acquisition. Although individual gene families involved in melanin synthesis exhibited hypothesized trends across the precipitation gradient, these relationships were statistically insignificant ( Supplementary Figure 5 ). We studied the cumulative abundance of genes involved in melanin synthesis, aquaporins, trehalose synthases, hydrophobins, respectively, as well as other genes encoding abundant carbohydrate active enzymes (CAZymes). Overall, we detected no statistically significant shifts in gene abundances for any gene category ( Fig. 2 ; Supplementary Fig. 6 ). Because soil pH was a strong predictor of EMF community composition, we additionally studied correlations in soil pH and abundance of targeted gene families; we observed broadly similar but overall insignificant relationships ( Supplementary Fig. 7 ). Figure 2 (A-D). Normalized abundance of gene family counts across the precipitation gradient: Mean annual precipitation (MAP). In order to account for variation in sequencing depth and the compositional nature of the metagenomic data, we performed a procedure that normalizes gene counts by those encoding the near single-copy gene Asparaginase. This additive log-ratio procedure, allows for the calculation of pseudo-genome counts for key gene families. Lines represent linear splines with 95% confidence intervals. (E-F). Correlations between EMF community dissimilarity (Bray–Curtis), and aquaporin and Hydrophobin sequence dissimilarity based on Pfam homology. While the above analyses measured gene abundances on a statistically derived genome level, we additionally reasoned that P. trichocarpa occurring in dry soils would host a greater total abundance of EMF genes involved in drought stress tolerance. Estimating the net abundance of EMF genes involved in water relations captures relative plant investment and reliance on the EMF community. To estimate plant investment in EMF across this gradient we weighted metagenomic gene-counts by the percentage of root-length colonized by EMF ( Supplementary Fig. 8 ); this weighting procedure serves as an estimate of the cumulative biomass of EMF on roots [ 3 ]. We detected strong negative relationships in the weighted abundance of genes involved in melanin synthesis ( P = .03, R 2 = 0.36), aquaporins ( P = .02, R 2 = 0.43), trehalose synthases ( P = .03, R 2 = 0.35), alpha amylase (PF00128; P = .03, R 2 = 0.35), melanin synthases ( P = .02, R 2 = 0.36), but not fungal hydrophobins ( P = .86) ( Supplementary Fig. 8 ). Similar patterns were observed when weighted gene counts were regressed against soil pH ( Supplementary Fig. 9 ). We acknowledge that this weighting-procedure is coarse, and that the effect of MAP for individual target gene families must be compared with genes that serve as a statistical null. In this case, Beta-tubulins, a gene at near-single copy in fungal genomes and plausibly under minimal ecological selective pressure across this soil gradient, exhibited similar relationships as observed for functional genes ( P = .02, R 2 = 0.40). This therefore limits understanding of the significance of the cumulative abundance of these gene families in plant water relations. Sampling from other host-trees would be useful to help understand the generality of the patterns observed here. Finally, we investigated potential intra-genetic variation in functional genes by focusing on gene sequence homology. Using a partial mantel test, we identified aquaporin (Mantel r = 0.50, P = .001) and hydrophobin (Mantel r = 0.33, P = .023) sequence dissimilarity (Bray–Curtis) as positively correlated with EMF community dissimilarity ( Fig. 2E and F ). Consequentially, the functioning of aquaporins or hydrophobins could co-vary with EMF communities across the precipitation gradient irrespective of shifts in gene abundances. Additional targeted gene families either did not have sufficient data for calculation of distance matrices or exhibited insignificant relationships. Further functional analysis is required to understand if fungal aquaporins or hydrophobins vary in their activity across this gradient."
} | 3,662 |
35506306 | PMC9544788 | pmc | 9,483 | {
"abstract": "Summary Fertilizers are costly inputs into crop systems. To compensate for inefficiencies and losses from soil, farmers apply on average double the amount of nitrogen (N) fertilizer acquired by crops. We explored if N efficiency improves with biofertilizers formulated with organic waste, mineral N or plant growth‐promoting rhizobacteria (PGPR). We compared treatments receiving mineral N fertilizer or biofertilizers at industry‐recommended (100%) or lower (60%) N rates at two commercial sugarcane farms. Biofertilizer at the 60% N‐rate generated promising results at one farm with significantly higher biomass and sugar yield than the no‐N control, which matched the 100% mineral N treatment. This yield difference was accompanied by a shift in microbial diversity and composition. Correlation analysis confirmed that shifts in microbial communities were strongly linked to soil mineral N levels, as well as crop productivity and yield. Microbial co‐occurrence networks further revealed that biofertilizer, including treatments with an added PGPR, can enhance bacterial associations, especially in the context of complex fungal networks. Collectively, the results confirm that biofertilizers have quantifiable effects on soil microbial communities in a crop system setting, which underscores the opportunities for biofertilizers to promote N use efficiency and the circular N economy.",
"conclusion": "Conclusions Our two main findings are that a biofertilizer with a 40% reduced N load formulated with 50:50 N (recycled waste:mineral fertilizer) was superior to mineral fertilizers at one of the two studied sites. The second finding was that this biofertilizer combined with PGPR enhanced bacterial and fungal associations with sugarcane which may benefit crops as this occurred at the same site where the biofertilizer appeared to benefit yield. Both findings warrant further investigations with long‐term field testing, including at sites where the soil microbiome negatively impacts crop yield. The next step for this research should explore how NUE can improve with biofertilizer application to reduce N losses from soil. With so much at stake for crop production and environmental integrity, efforts should be heightened to optimize N supply for sugarcane as an critical tropical bioeconomy crop.",
"introduction": "Introduction Maximizing crop yields with minimum input and environmental harm is a key goal for agriculture. However, conventional mineral fertilizers, including N fertilizers, are generally applied at higher rates than strictly needed by crops due to the inherent inefficiencies and risk of nutrient loss from soil (Udvardi et al ., 2021 ). This overapplication has led to excess nutrient loads in the biosphere, wide‐ranging pollution and soil deterioration, including reduced microbial biodiversity (Umrani and Jain, 2010 ; Thomas and Singh, 2019 ). Despite the evidence of the profound negative impacts of excessive fertilizer application on crops and their soil systems, environmental and human health, numerous barriers complicate solving this problem. For example, Zhang et al . ( 2020 ) found that 86% of farmers with high environmental awareness who overapply mineral fertilizers nevertheless noted a low likelihood of reducing their fertilizer use. Our study addresses the need to advance fertilizer alternatives in line with several of the Sustainable Development Goals to reliably deliver nutrients to crops, avoid pollution and enable the circular nutrient economy. Organic fertilizers (e.g. manures, composts, we use the term ‘biofertilizer’ here) can provide benefits beyond crop nutrition, but also carry the risk of under‐ or over‐supplying nutrients to crops. From a sustainability standpoint, biofertilizers are attractive as they are typically derived from waste streams (Delgado et al ., 2016 ). Biofertilisers ameliorate soil with organic matter, which is an advantage over mineral fertilizers (Manlay et al ., 2007 ). However, drawbacks relating to the rate of N release from organic substrates and subsequent mineralisation kinetic rates have called into question the sole reliance on biofertilizers for satisfying a crop's N requirements (Delgado et al ., 2016 ). This risk of diminished crop yield is the most important factor for farmers who are less concerned about the longer‐term sustainability of farming than the immediate yields (Zhang et al ., 2020 ). Here we address the need to develop practices that ‘increase agricultural N use efficiency (NUE) while sustaining or building soil organic matter and soil fertility’ (Udvardi et al ., 2021 ). The concept of bioengineering soils is debated in the context of nutrient use and soil fertility which involves augmenting the microbial communities of soils and crops. This can be achieved in several ways including adding plant growth‐promoting rhizobacteria (PGPR) to crop systems, where they can exert benefits on plants such as increased resilience against biotic (pest, pathogens) and abiotic stresses (e.g. heat, drought, toxicity) (Goswami et al ., 2016 ; Vejan et al ., 2016 ; Singh et al ., 2020 ). PGPR that produce phytohormones and other biochemicals can increase nutrient mobilization for immediate crop use and consequently improve agricultural productivity (Adesemoye et al ., 2008 ; Lugtenberg and Kamilova, 2009 ; Abbasi et al ., 2011 ; Qiu et al ., 2019 ). In addition, PGPR performing secondary mechanisms of action (e.g. defence against phytopathogens, inhibition of plant stress responses) are harnessed as biocontrol agents (Naseby et al ., 2000 ; Yang et al ., 2014 ; Arya et al ., 2018 ) to augment the rhizosphere microbiome by reducing the presence and/or effectiveness of pathogens in crops, including sugarcane and other crops (Fu et al ., 2017 ; Hamonts et al ., 2018 ; Araujo et al ., 2019 ; Elsayed et al ., 2020 ). There are solid evidences that PGPR biofertilizers benefit plants in experimental conditions and some of these aforementioned key mechanisms are well understood (Taulé et al ., 2012 ; dos Santos et al ., 2020 ), but the effects of commercial biofertilizers have rarely been examined in crop field situations (or if they have, this information is often not in the public domain). Therefore, such steps into effective real‐world application demand further research and development (Finkel et al ., 2017 ). Here, we use a multi‐factorial design with sugarcane grown at two commercial farms to examine if biofertilizer (organic waste amended with mineral fertilizer and added PGPR) benefits crops or crop systems. Previously we found that pasture grass receiving fertilizer combinations (50:50 mixture of mineral and organic fertilizer) and supplemented with PGPR matched crop growth with mineral fertilizer alone (Paungfoo‐Lonhienne et al ., 2019 ). Importantly, biofertilizer reduced N leaching by 95% compared to mineral fertilizer, which supports the concept of a hybrid organo‐mineral‐PGPR fertilization regime that achieves similar yields as mineral fertilizers but reduces the environmental harm (Paungfoo‐Lonhienne et al ., 2019 ). Similarly, increasing the crop nutritional value of biofertilizer and reducing the use of mineral fertilizers benefitted soil chemical–biological properties and crop yields (Kaur et al ., 2005 ; Chivenge et al ., 2011 ). However, the way in which such blended biofertilizers affect crops in specific situations demands research so that farmers can access information to make judicious decisions. We explored the effect of biofertilizer, with or without added PGPR, in sugarcane. Sugarcane is a major tropical crop with high nutrient needs, and is one of the fastest growing crops (producing up to 240 t of biomass per hectare per year). Sugarcane is often grown in high rainfall coastal regions, which contributes to the leaching of N into the deeper soil, ground and surface water, causing damage to local aquatic ecosystems which are becoming a growing concern. In response, regulators are increasingly restricting the application of mineral fertilizers on farms, leading to the need for alternative N fertilization regimes that can generate the desired yields with a reduced pollution footprint (Robinson et al ., 2011 ; Udvardi et al ., 2021 ). We hypothesised that the combination of fast (mineral) and slow (organic) N supply in biofertilizer improves NUE and that the addition of PGPR will have demonstrable effects on the composition of soil microbial communities and crop performance.",
"discussion": "Discussion Biofertilizer can partially replace mineral nitrogen fertilizer Nitrogen is one of the most important factors that drive growth and productivity of non‐leguminous plants (Below, 2001 ; Plett et al ., 2020 ), and poor N fertilizer use efficiency in sugarcane production is one of the main hurdles that must be overcome for sugarcane to reach its full potential as a bioeconomy crop (e.g. Grant et al ., 2016 ; Rodriguez et al ., 2019 ; Wang et al ., 2019 ). Biofertilisers have drawn attention as a sustainable alternative to mineral fertilizers in sugarcane and other crops (del Carmen Rivera‐Cruz et al ., 2008 ; Molla et al ., 2012 ; Nunes Oliveira et al ., 2017 ; Yadav and Sarkar, 2019 ). As most plant‐associated microorganisms have intimate relationships with their hosts (Bonfante and Anca, 2009 ), biofertilizers containing effective PGPR can increase nutrient use efficiency by mineralizing, solubilizing, mobilizing and supplying N to plants (Maeder et al ., 2002 ; Qiu et al ., 2012 ; Arif et al ., 2017 ; Pereira et al ., 2020 ). PGPR that produce beneficial phytohormones, fix nitrogen and solubilize phosphorus can further enhance nutrient delivery to hosts (dos Santos et al ., 2020 ; Grover et al ., 2021 ; Verma et al ., 2021 ). Nutritional benefits of microbes may also include being themselves consumed by the roots, through a supposed mechanism currently under investigation termed ‘rhizophagy’ (Paungfoo‐Lonhienne et al ., 2010 ; White et al ., 2018 ). Irrespective of microbial taxa and mechanisms, in field growth conditions, PGPR increased the yields of cereals, root crops, legumes and vegetables (Ali et al ., 1998 ; Tena et al ., 2016 ; Islas‐Valdez et al ., 2017 ; Mukhongo et al ., 2017 ). In contrast, yields of field‐grown sugarcane were unaffected by PGPR, although the rhizosphere fungal community was altered (Berg et al ., 2019 ). Here, mineral or biofertilizers (with/without added PGPR) generated similar amounts of soluble ammonium and nitrate in the top meter of soil, confirming that both fertilizers deliver similar amounts of readily crop‐available N to sugarcane over the growing season. Fertilizer type, or reducing the N supply by 40%, had only negligible effects on the detectable ammonium and nitrate, while omitting N fertilizer resulted in a noticeable decline in soil N (but this did not impact crop yield). That crops were N sufficient irrespective of N application rate is unsurprising as sugarcane draws on soil N stores with a considerable portion of soil organic N mobilized over a crop season (Allen et al ., 2019 ). Similar soluble N levels were observed with mineral or biofertilizer and supplied N to pasture grass (Paungfoo‐Lonhienne et al ., 2019 ). Thus, the biofertilizer tested here underpins the global aim of transitioning to a circular N economy with a proportion of N retrieved from wastes. To what extent biofertilizer can increase NUE and/or build soil organic matter and soil fertility requires longer‐term research. Biofertilizer and PGPR can augment soil microbial communities Application of biofertilizer significantly changed soil microbial communities with fungal communities altered at certain cropping stages at the Innisfail site. This aligns with previous studies demonstrating that biofertilizers can alter soil microbiota (Paungfoo‐Lonhienne et al ., 2015 ; Dong et al ., 2019 ) through interactions with plant roots (Azizoglu, 2019 ; Trivedi et al ., 2020 ) and competition with potential pathogens (Zhang et al ., 2018 ). Similar to previous research, we find that the impact of biofertilizers on soil microbial communities is site‐specific and depends on soil and climate properties, as well as local microbial biodiversity (Ma et al ., 2016 ; Delgado‐Baquerizo et al ., 2018 ; Xue et al ., 2018 ). In the top 20 cm of soil (where microbial communities were analysed in our study), the two soils differed considerably in texture and organic matter content. Ingham sandy loam soil had considerably less soil organic matter (0.5%C, 0.04%N) than Innisfail clay loam (3.2%C, 0.15%N). While soil microbial diversity was similar across all treatments, we detected variation in microbial abundance and composition between treatments and regions. The identified microbial markers between sites and biofertilizer application confirm that changes of soil microbiota are region and/or soil specific. Similarly, soil microbiota were region‐specific and possibly associated with soil physiochemical properties among other factors (Ng et al ., 2014 ; Ma et al ., 2016 ; Yeoh et al ., 2016 ). While soil pH is often reported as a primary driver of soil microbial communities (Fierer and Jackson, 2006 ; Lauber et al ., 2009 ; Hong et al ., 2020 ), other factors, including mineralised N (Paungfoo‐Lonhienne et al ., 2015 ; Zhou et al ., 2017 ), soil moisture (Brockett et al ., 2012 ) and salinity (Ren et al ., 2018 ) were closely related with soil microbial assemblages. We found that Spearman's correlation, dbRDA and DistLM analyses confirmed that, despite the variations in microbial responses to soil parameters, ammonium had a consistent positive correlation with bacterial richness, highlighting that soil N status and microbial diversity are linked. Most of the five parameters investigated (soil moisture, ammonium, nitrate, EC, pH) contributed to the variation of microbial communities at both sites, suggesting a close relationship of soil physiochemical parameters and microbial dynamics. The decrease of soluble N (especially ammonium) at both sites explained the significant difference in microbial communities at different time points, supporting similar trends of shifts in soil microbiota in two contrasting soils. Similarly, the application of biofertilizer with lower N input can also achieve alteration of the soil microbiota due to changes in the soil physiochemical properties. Engineering soil microbiomes is receiving much attention in the quest for sustainable cropping (Mueller and Sachs, 2015 ; Qiu et al ., 2019 ). While the abundance of inoculated PGPR can decrease over time, lasting effects can include that microbial networks are enhanced by establishing core and hub microorganisms that in turn promote microbial functions, crop fitness and growth (Agler et al ., 2016 ; Lemanceau et al ., 2017 ; Toju et al ., 2018 ; Zhuang et al ., 2021 ). Application of PGPR can contribute to sustainable cropping (Ma et al ., 2016 ; Li et al ., 2017 ; Sun et al ., 2020 ), although efficacy has to be confirmed for a given crop system including sugarcane (Berg et al ., 2019 ). Biofertilizer can establish stronger bacterial associations in soil Microbial interactions in soils critically influence plant performance and productivity (Trivedi et al ., 2017 ; Trivedi et al ., 2020 ). Positive interactions are usually considered as mutual cooperation between organisms, while negative interactions can be competitors that exert antagonistic mechanisms (Abhilash et al ., 2012 ; Hassani et al ., 2018 ; Araujo et al ., 2019 ). While network analysis cannot truly reflect microbial interactions, it highlights associations based on co‐occurrence of microbial species and as such enables insight into microbial associations at an inter‐kingdom scale (Li and Wu, 2018 ; Zheng et al ., 2018 ). The general concept is that positive associations often occur on an intra‐kingdom basis, whereas negative associations are more commonly observed on an inter‐kingdom scale (Sweet et al ., 2019 ). Our results showed that the PGPR inoculant (a Paraburkholderia species), added to mineral N and biofertilizer, can increase the rate of positive associations (especially bacterial–bacterial associations) in most of the scenarios compared to treatments without PGPR addition. This suggests that the PGPR strain used here can enhance bacterial networks in the soil microbiome. Augmenting positive correlations might link to ecological functions of microbial communities, for example carbon and nitrogen cycling (Hoppe et al ., 2014 ; Banerjee et al ., 2016 ). It may have positive effects on soil biological function and promote beneficial microbial associations in the rhizosphere as observed with other PGPR in previous research (Ling et al ., 2016 ; Fan et al ., 2017 ; Chen et al ., 2018 ), but longer term research with quantifiable response variables is needed to support this notion. PGPR‐strengthened microbial networks generated more associations. We found that the biofertilizer established a stronger bacterial network in replacement of the fungal network, which was particularly prominent in Innisfail samples, possibly due to strong fungal associations pre‐existing in the soil. The higher soil organic matter content in the Innisfail soil may be a key factor contributing to these stronger networks. Although fungal communities can be beneficial or neutral for crops (Bonfante and Genre, 2010 ), fungi are more often reported as crop pathogens (Deacon, 2005 ). Biofertilisers can increase plant fitness and protect crops from infections of fungal pathogens by establishing stronger bacterial associations with better resilience to environmental stresses (Siddiqui, 2005 ). Whether this is the case in our study – and which organisms are involved – requires further investigation. The input of organic matter can increase fungal–bacterial competition and alter community structure in the soil microbiome to improve microbially driven ecosystem functions (Ling et al ., 2016 ; Zheng et al ., 2018 ; Gu et al ., 2019 ) and boost plant growth and resilience to biotic and abiotic stresses. Sugarcane soil with lower mineral N loads favoured beneficial fungi compared to soil with a higher N load (Paungfoo‐Lonhienne et al ., 2015 ). Together, these observations deserve further investigation. The findings here certainly confirm that biofertilizer and PGPR affect soil and crop responses, and that they can benefit soil function and sugarcane production in certain situations."
} | 4,653 |
25110862 | PMC4159819 | pmc | 9,484 | {
"abstract": "Nature shows many examples of surfaces with extraordinary wettability, which can often be associated with particular air-trapping surface patterns. Here, robust non-wetting surfaces have been created by femtosecond laser ablation of polytetrafluoroethylene (PTFE). The laser-created surface structure resembles a forest of entangled fibers, which support structural superhydrophobicity even when the surface chemistry is changed by gold coating. SEM analysis showed that the degree of entanglement of hairs and the depth of the forest pattern correlates positively with accumulated laser fluence and can thus be influenced by altering various laser process parameters. The resulting fibrous surfaces exhibit a tremendous decrease in wettability compared to smooth PTFE surfaces; droplets impacting the virgin or gold coated PTFE forest do not wet the surface but bounce off. Exploratory bioadhesion experiments showed that the surfaces are truly air-trapping and do not support cell adhesion. Therewith, the created surfaces successfully mimic biological surfaces such as insect wings with robust anti-wetting behavior and potential for antiadhesive applications. In addition, the fabrication can be carried out in one process step, and our results clearly show the insensitivity of the resulting non-wetting behavior to variations in the process parameters, both of which make it a strong candidate for industrial applications.",
"conclusion": "4. Conclusions We have shown that a PTFE surface after raster scanning under a 800 nm femtosecond laser beam shows a fibrous surface structure, which is reminiscent of the surface features found on certain insect wings and plant surfaces. The laser micromachining process proved suitable not only to produce homogeneous but also heterogeneous surface structures. By overlapping raster-scanned lines various surface patterns can be achieved ranging from separated trenches to wavy and finally homogeneous surface areas; the resulting pattern can be predicted based on laser intensity modelling. While the degree of fiber entanglement is generally a function of the applied laser intensity, the structures resulting at the position of highest ablation intensity are relatively robust to changes in laser settings, which makes laser micromachining a competitive fabrication method for industrial applications. Similar to the natural surfaces, the laser-created surfaces are extremely non-wetting to water and highly non-wetting to organic liquids, as was confirmed in drop impact and contact angle experiments. Gold coating of fibrous PTFE surfaces confirmed that the non-wetting characteristics are supported by the joint contributions of surface chemistry and surface structure. Exploratory bioadhesion experiments further illustrated that the biomimetic surfaces are truly air-trapping and therewith successfully inhibit cell adhesion. Future research is required to fully assess the susceptibility of such biomimetic surfaces to long time cell and biofilm exposure. Finally, as a non-contact optical machining method the one-step process can easily be scaled up and is therefore suitable to be applied to a vast range of geometries and could possibly serve as an alternative to expanded PTFE membranes.",
"introduction": "1. Introduction As an old Chinese proverb goes, a lotus lives in the silt but not imbrued. Dirt particles are easily picked up by water droplets freely rolling over lotus leaves. This non-wetting behavior has found considerable research interest over the past decades. However, lotus leaves are only one of many natural surfaces that exhibit non-wetting and self-cleaning behavior. Nature has optimized plant and animal species for their respective living environments, such as the surfaces of plants [ 1 , 2 ], the wings [ 3 , 4 , 5 ] and legs of insects [ 6 , 7 ], or the skin of marine animals [ 8 ] and reptiles [ 9 ]. All of these exhibit prime examples for surfaces with specific functionalities, such as air-trapping, self-cleaning, anti-fouling and anti-bacterial characteristics. With an increasing world population and more and more pressing environmental problems researchers and policy makers are recognizing that learning from Nature as well as imitating and adapting the products of Nature’s century long design process can deliver solutions to everyday problems, which are often more sustainable, and rather preventive than reactive, in comparison to synthetic polluting disinfectants, cleaning agents and biocides. A common characteristic of the above mentioned natural examples is their superhydrophobic wetting behavior, which is supported by physical surface features of different shapes and complexity depending on the organism and its environment. Microscale protrusions with nanoscale superimposed features [ 10 ] are as common as arrays of nanoscale rods, interconnected ridges or entangled fibers [ 3 , 4 ]. While different in shape, from a wetting perspective all these features can support air-trapping Cassie-Baxter wetting [ 11 ], where a water volume is suspended between surface features without completely penetrating the feature valleys due to an equilibrium of wetting (Laplace) and non-wetting (capillary) forces. Therewith, air is trapped between surface and liquid, and the actual contact area between liquid and surface is significantly reduced, which results in low adhesion. The robustness of the air-trapping wetting state is an important requirement for a surface to support and maintain advanced functionalities, such as self-cleaning and antifouling. More precisely under robustness we consider a surface’s ability to withstand transition from air-trapping superhydrophobicity to complete water penetration into surface valleys, which is characterized as Wenzel wetting, and results in considerably higher adhesion [ 12 ]. Biomimetic superhydrophobic surfaces that support air-trapping have received considerable attention in nanotechnology and biomedical applications [ 13 ]. Lu et al. (2006) have proposed a superhydrophobic fishbone microvalve design which supports air-trapping and therewith inhibits protein adhesion in the fabrication of a microfluidic biochip which was a concern when using traditional capillary valves [ 14 ]. Gentile et al. (2011, 2012) have shown that dilute solutions can be concentrated onto the liquid-supporting solid of air-trapping superhydrophobic surfaces to allow for detection of low concentration solutes which is of interest e.g., for the early detection of cancer cells [ 15 , 16 ]. Sousa and Mano (2013) have illustrated the fabrication of superhydrophobic paper and its application for various sustainable laboratory apparatus, which support the storage, transfer and mixing of aqueous media [ 17 ]. The above examples illustrate that there are many possible applications for extremely non-wetting surfaces. However, the fabrication of such surfaces is in many cases rather complicated, involving many process steps and demanding equipment that does not favor easy scale-up. This project, inspired by natural superhydrophobic surfaces, had the particular goal to create a highly robust synthetic non-wetting surface through a relatively simple fabrication process for easy scaling-up and transfer to such industrial applications as outlined above. Ultra-short pulsed laser machining is a technology that fulfills the latter requirements, as it has already been shown to be successful in creating biomimetic surface features that support superhydrophobicity [ 18 ]. The dominating advantages of femtosecond (fs) laser ablation in comparison to other microfabrication methods are the non-contact optical machining process in combination with the short pulse duration which enable the machining of complicated 3D features while causing minimal thermal damage to the substrate material in a single process step [ 19 , 20 ]. Recent research efforts have particularly focused on the induced surface structures resulting from direct laser writing of metallic and semiconducting materials, while less research has been carried out on the structures resulting from femtosecond laser ablation on polymeric substrates [ 18 , 19 , 20 , 21 ]. A polymer of particular interest for biomimetic superhydrophobic surfaces is polytetrafluoroethylene (PTFE) due to its thermal stability, chemical inertness and low surface energy. The first report on laser ablation of PTFE was contributed by Küper et al. (1989) who presented that ablation with a fs UV excimer laser in air results in a roughness on the length scale of 1 µm on the ablated spot [ 22 ]. While Kumagai et al. (1994) showed high magnification electron microscope images of PTFE ablated with a Ti:Sapphire system in ultrahigh vacuum that show clean ablation edges [ 23 ], Adhi et al. (2003) report porous walls for holes drilled in air with a femtosecond UV excimer laser [ 24 ]. Lippert and Dickinson (2003) provide a comprehensive overview of surface features created by ablation on various polymers. The surface features observed on PTFE are described as fractal-like [ 21 ]. Another study by Hashida et al. (2009) on expanded PTFE (ePTFE) shows a microporous fiber network before and after irradiation with a Ti:Sa laser system [ 25 ]. Very little work is published that focuses on the wettability of PTFE surfaces after fs laser machining. A study by Wang et al. (2003) considers adhesion by contact angle measurements on PTFE channels ablated with a Ti:Sapphire laser [ 26 ]. Their results showed increased adhesion on the laser ablated surfaces. Furthermore, the authors observed so called microcone features at low pulse numbers, which give place to clean cut surfaces when more than 5 pulses are applied. In contrast, recent work by Huang and Ming (2010) highlights that multipulse craters created by femtosecond laser irradiation show microfeatures of entangled fibers which behave in a superhydrophobic manner with contact angles of above 150° [ 27 ]. In this work we present how to fabricate biomimetic, robust non-wetting structures on PTFE surfaces by fs laser micromachining. In particular, larger surface areas of such structures are desired instead of multipulse craters to investigate the suitability of this machining process for industrial applications.",
"discussion": "2. Results and Discussion 2.1. Femtosecond Laser Micromachining PTFE surfaces have been micromachined with the intention to create surface structures that robustly support air-trapping Cassie-wetting. Samples were raster scanned under the stationary laser beam at various positions along the beam path. 2.1.1. Homogeneous Surface Patterns Figure 1 displays an example of the characteristic entangled surface structures resulting from laser micromachining PTFE samples. Figure 1 SEMs at different magnification of the surface pattern ablated by raster scanning with 100 mW and 89% overlap at a sample position of 2 mm in front of the focus. The laser-ablated surface no longer exhibits a smooth polished surface, but rather a pattern which can be described as a forest of entangled thin fibers. This entanglement results in a porous surface layer composed of PTFE fibers and interconnected air channels. The fibrous structures show a certain similarity to expanded PTFE, which also shows a mesh-like microporous structure and has found wide application for waterproofing textiles (GoreTex™, Flagstaff, AZ, USA), as material for facial implants and filtration devices [ 28 , 29 ]. While ePTFE is made from stretching a PTFE film, the PTFE fibers are tightly connected to the solid bulk material. The degree of entanglement and the homogeneity of the ablated fibrous forest can be influenced through laser parameters. Figure 2 shows examples from an experiment, where samples were placed at different positions along the beam path while the same average laser power and raster scan line overlap was applied. In the following the focused beam waist position is denoted by 0. Sample positions given with positive numbers indicate the distance of the sample from the focused beam waist along the beam propagation axis towards the focusing lens, while sample positions behind the beam focus are labeled with negative numbers indicating the distance in millimeters to the focused beam waist. The fiber entanglement and therewith the pore structure clearly varies with position, as also indicated by the surfaces’ lacunarity, as a measure of the surface’s fractal texture. At −1.4 mm behind focus the sample received barely enough energy to develop the hairy structure. The white spots are characteristic for the pristine polished PTFE surface, and hence signify surface areas that due to polishing imperfection were slightly lower than the remaining surface and therewith slightly further behind focus. When closer to the focus, the beam diameter decreases, which results in higher energy intensity, and thus in completely ablated surface patterns; the hairy features become more entangled the closer the sample is positioned to the focus. Interestingly, the degree of fiber entanglement is not symmetric around the beam focus as might have been expected based on optics theory. When the sample is placed slightly in front of the focus position (e.g., 0.8 mm) the fibers appear considerably more entangled compared to the position of same distance behind focus. Furthermore, lacunarity shows a maximum not at, but rather in front of, the focus position. These observations indicate that slightly in front of focus samples are subject to the highest effective intensity. With increasing positive distance to focus the entanglement, and thus the lacunarity, decreases again as the beam broadens, and while the threshold for onset of entangled structures was at −1.4 mm behind focus, it is at +2.9 mm in front of focus (additional SEM for the experimental series can be found in the Supplementary Information ). Figure 2 Structural characteristics of surfaces ablated by raster scanning with 180 mW and 93% overlap at different positions with respect to the focused beam waist ( a ) SEMs of the different surface patterns (numbers indicate distance from focus in mm); ( b ) Lacunarity. 2.1.2. Line Experiments Line width experiments were carried out to further investigate the relationship of ablated surface structure and sample positions along the beam path. Figure 3 shows exemplarily the top view as well as cross sections of such raster scanned lines. The top view image ( Figure 3 a) shows the characteristic fibrous structure on the ablated lines. Figure 3 b illustrates that both line diameter as well as line depth vary with position along the beam path. When the sample is placed behind the beam focus (negative position) lines get increasingly deeper and narrower when approaching the focus (0). For sample positions in front of the focus (positive position) the inverse trend is observed. Figure 4 summarizes the measured width and depth results. Figure 3 SEMs of lines ablated by raster scanning with 180 mW. ( a ) Top view machined at +2.4 mm (red arrow indicating line width); ( b ) Sample cross section at different positions with respect to the focused beam waist (numbers indicate distance from focus in mm); ( c ) Schematic of shielding when writing lines off (front) or onto the sample (back). Figure 4 a illustrates that the ablated line width is smaller than the calculated laser beam diameter. This result is consistent with literature and typical for the strong bonding and poor ablation characteristics of PTFE [ 23 , 24 ]. The ablated line width follows the symmetry of the beam diameter when the sample is moved away from the focus in either direction. Line depth SEMs ( Figure 3 ) and data ( Figure 4 b), however, confirm the asymmetry observations from Figure 2 . Lines machined in front of the beam focus are deeper than their counterparts positioned at equivalent distance behind focus. The asymmetry in line depth ( Figure 3 b and Figure 4 b) and in fiber entanglement ( Figure 2 ) with respect to the focus position can be explained by particle plume shielding. When machining in front of focus (positive position) a laser pulse gets attenuated by the ablated particle cloud of the last pulse. However, for sample positions behind focus the laser beam energy is not only absorbed by the particle cloud of the last pulse but also by the ionized air at focus, which accordingly leads to a lower effective intensity reaching the sample surface positioned behind focus in comparison to the one positioned at equivalent distance in front of focus. Yet, this shielding effect is only noticeable from surface analysis by SEM and depth measurements and not from width measurements. We assume that this is an artefact of our measurement method as the irradiated line edges show the characteristic forest of entangled thin fibers ( Figure 3 a), which complicates exact width determination. This difficulty is also mirrored in the standard deviation to the measurements as shown in Figure 4 . Figure 4 Line dimensions as a function of sample position for laser machining at 180 mW. ( a ) Beam width and ablated line width; ( b ) Line depth. Another interesting observation resulting from line experiments is that every second line is deeper than the line before ( Figure 3 b and Figure 4 b). The difference in depth of deep and shallow lines is particularly large around focus, while far behind focus this difference almost levels out. This peculiarity can be explained when considering the raster scan method applied in these experiments. The sample was moved under the laser beam, so that the beam scanned across the edge of the sample. Therewith the beam, which ablated a sample surface e.g., at focus, scanned across the edge and ablated the PTFE back sheet mounted behind the sample of interest on the translation stage as illustrated in Figure 3 c. The surface of this back sheet was placed ~1.14 mm (sample thickness + double sided tape) beyond the actual sample of interest. After a certain vertical displacement the next line was machined from the back sheet onto the sample surface of interest. Considering that each subsequent laser pulse will interact with the expanding particle plume of the last pulse [ 30 ], more laser energy gets absorbed by the particle cloud by scanning off the sample than when moving onto the sample ( Figure 3 c). When moving onto the sample the next pulse can be considered almost unaffected by the particle plume that originated from the last pulse on the back sheet. Thus the first pulses on the actual sample ablate the latter with a higher effective intensity, since particle screening from previous pulses is not relevant yet, which results in deeper observed line width at the cross section. Accordingly, the shallow line depth results are more representative when considering continuous raster scanning of a flat sample surface. The additional attenuation by the ionized air at focus for samples positioned at negative positions is more severe at already lower energy levels, as can clearly be seen from the shallow lines in Figure 4 b. About 10 um shallower lines are observed for positions behind focus in comparison to positions of equivalent distance in front of focus. Also the greatest depth for shallow lines was achieved about 0.5 mm in front of the focus, which corresponds to the observations from Figure 2 of highest entanglement. At this region of highest ablation intensity (about 0.5 mm in front of focus) the degree of fiber entanglement and machining depth are relatively insensitive to varying sample position by ±0.2 mm, which indicates the robustness of the resulting surface structure to variations in laser parameters. 2.1.3. Heterogeneous Surface Patterns The data from the line width experiments was used to adjust line overlap for the raster scan of larger areas of the PTFE sample surfaces to better understand the influence of all machining settings. The resulting structures for varying overlap machined at focus are shown in Figure 5 a. At low overlap (3.7%) the surface shows distinct trenches ( Figure 5 a). The average spacing of these trenches was determined to be 18.16 μm. With increasing scan line overlap fibrous structures start to bridge the trenches, and with further increase of overlap the fibers get thinner, entangle and the trenches start to disappear (57.2%). At very high overlap the surface shows no trace of trenches anymore but is homogeneously covered by a forest of entangled thin fibers (89.3%), as shown in Figure 1 and Figure 2 . The observed trench distance can actually be predicted from the laser process parameters, as shown in Figure 5 b–e. The accumulated intensity, to which the surface is subjected, can be modelled based on the applied raster scan machining process with a Gaussian laser beam. The black curves indicate the laser intensity applied to individual scanned lines, while the red curve sums these line intensities considering the scan line overlap (a detailed model description can be found in [ 31 ]). The modelled distance of the peak intensity from line to line corresponds to the measured values from experiments; Figure 5 b predicts 18 μm, while the measured average was 18.16 μm. Similarly, Figure 5 c models the accumulated intensity for 25.1% overlap, and the predicted distance of 14 μm corresponds reasonably well to the average measured trench distance of 14.47 μm. The model further illustrates that with increasing overlap the accumulated intensity profile becomes smoother. For an overlap of 57.2% the accumulated intensity (red curve in Figure 5 d) barely shows a wavy profile. The result of this slight waviness is mirrored in the not quite homogeneous fibrous forest in Figure 5 a. For an overlap value of 89.3% however, the forest appears homogeneous and the intensity profile ( Figure 5 e) shows a flat profile. With this understanding intensity modelling can be used as a tool to design desired non-homogeneous or homogeneous surfaces. Figure 5 The effect of overlap on resulting surface patterns. ( a ) SEMs of surface patterns ablated by raster scanning with 100 mW (ablated line width of 18.69 μm) at focus with different settings of overlap; ( b – e ) Accumulated Intensity models for ( b ) 3.7%; ( c ) 25.1%; ( d ) 57.2% and ( e ) 89.3% overlap. Overall, the above described femtosecond laser experiments on PTFE have clearly shown that the ablated surface shows a characteristic forest of nanoscale fibers. Whether ablating lines or larger areas the fiber entanglement is a function of laser intensity, which can be adjusted by positioning the sample with respect to focus or by adjusting average laser power. The structure homogeneity of area scans can be influenced by adjusting overlap. In particular the homogeneous surfaces are considered in more detail for non-wetting and bioadhesion applications in the following to assess the surfaces biomimetic potential. 2.2. Wetting From a biomimetic standpoint the above presented homogeneous surface structures resemble the ones found on insect wings, such as e.g., those of the lace wing, mayfly or dragonfly [ 3 , 4 , 5 ]. Such insect wings exhibit a fibrous structure that has been described as “interconnected netting composed of ridges” [ 4 ], and they are known for their resistance to wetting with contact angles around 150° [ 3 , 4 , 5 ] as well as their antimicrobial properties [ 4 ]. Our laser-created structures, which we describe as forests of entangled thin fibers, exhibit fibers of similar dimensions as the natural examples introduced above. Figure 1 clearly shows that our PTFE fibers are of about 50–100 nm in width, whereas entanglement nodes reach diameters of about 0.5 µm. These dimensions correspond well to the typical feature dimensions observed for the dragonfly (65–350 nm) and the mayfly (65–950 nm) found on the wings of lace wing, mayfly and dragonfly [ 4 ]. The entanglement of the individual PTFE fibers of our surfaces shows great similarity to the fiber network observed on certain natural surfaces, such as the back of the ramee leaf and the surface of the Chinese watermelon [ 32 ]. While these natural plant surfaces exhibit a unitary smooth fiber surface, our surfaces rather show structural hierarchy with nano-roughness on the fiber surfaces ( Figure 1 ) as seen for the structures on highly hydrophobic insect wings [ 5 ]. Considering the inherent hydrophobic nature of PTFE and the porous fibrous structures resulting from femtosecond irradiation, an air trapping wetting state is expected for our biomimetic surfaces. Before carrying out detailed wettings studies, it was confirmed by FTIR spectroscopy that the surface chemistry of PTFE did not change through the femtosecond laser micromachining, which is consistent with literature [ 24 ] (refer to supplementary material for spectra). Wetting experiments were carried out by drop impact and contact angle measurements. The surfaces were further sputter coated with gold to uncouple the respective contributions of surface structure and surface chemistry on the resulting wetting state and to test the wetting behavior for robustness. 2.2.1. Drop Impact Experiments To test the wettability and robustness of the created structures, drop impact experiments with water were carried out on fibrous PTFE and subsequently gold coated surfaces. The behavior of both surfaces under drop impact was very similar: drops bounced off the surface and did not leave any water behind on the sample. Figure 6 illustrates the impact sequence on PTFE. Videos of experiments on the coated and uncoated laser-ablated surfaces are available in the Supplementary Material . The experiments showed that the created surface structure behaves in a highly superhydrophobic manner. An impacting droplet is completely repelled and no water remains on the surface. Figure 6 Drop impact sequence on PTFE laser-machined with 100 mW and 90% overlap at focus. 2.2.2. Contact Angle Experiments To test robustness and to discriminate between the goal-coated and uncoated laser-machined surfaces, contact angle experiments were performed with various liquids of different surface tension. The results for polished and laser-machined surfaces with and without gold coating are summarized in Table 1 . ijms-15-13681-t001_Table 1 Table 1 Results of contact angle experiments; surfaces were laser machined with 100 mW and 89% overlap at focus. Liquid Surface Tension Coating Surface Structure Sessile CA (°) Water 72 mN/m x flat 107 ± 2 fibrous 151 ± 7 gold flat 77 ± 4 fibrous 148 ± 6 Glycerol 63 mN/m x flat 96 ± 8 fibrous 135 ± 6 gold flat 74 ± 6 fibrous 123 ± 7 Ethylene glycol 47 mN/m x flat 78 ± 4 fibrous 133 ± 7 gold flat 60 ± 5 fibrous 97 ± 7 Propylene glycol 36 mN/m x flat 71 ± 4 fibrous 124 ± 3 gold flat 48 ± 4 fibrous 31 ± 4 The high hydrophobicity of the fibrous structure with and without gold coating samples was confirmed. Uncoated laser-treated PTFE surfaces also showed highly non-wetting behavior (contact angle >120°) in contact with the other organic test liquids. Overall, fibrous surfaces with gold coating exhibit lower contact angles than uncoated fibrous surfaces for the different organic liquids, which was expected based on the material characteristics of gold and PTFE. Water, glycerol and ethylene glycol show consistently higher contact angles on the fibrous surfaces with and without coating in comparison to the respective flat surfaces. While ethylene glycol is wetting the flat PTFE and gold coated surfaces (contact angle <90°), the laser-created fibrous surface shows contact angles larger than 90°, which indicates the existence of air-trapping Cassie wetting. Propylene glycol, however, wets the gold coated fibrous surface more than the uncoated one; the fibrous surface structure reduced the average sessile contact angle from 48° to 31°. This is an indication for collapsed air pockets and complete surface wetting according to the Cassie theory. Thus, the threshold for wetting robustness for the gold coated laser-created surfaces lies at a liquid surface tension below 47 mN/m. Furthermore, the experiments showed that the high oleophobicity observed for the fibrous PTFE clearly results from a combination of the surface chemistry and surface structure. 2.3. Bioadhesion Since our laser-created surfaces resemble anti-microbial insect wing surfaces in their homogeneous fibrous structure and their non-wetting character as outlined above, exploratory bioadhesion tests were performed to exemplarily test the response of biological organisms to the laser-ablated surfaces. The adhesion pattern of an immortalized human cervical cancer cell line (HeLa cells) clearly illustrates the air trapping and low adhesion potential of the laser-machined surfaces, as illustrated in Figure 7 . Figure 7 Microscope image of HeLa cell culture test on a laser-ablated PTFE surfaces with 100 mW and 60% overlap at focus. Healthy living cells can be identified by their characteristic elongated shape, while dead or unhealthy cells appear as round dots. Figure 7 clearly shows that more cells adhere to the polished PTFE as compared to the laser treated surface. The laser-patterned surface shows two distinct areas. The area that is bordering the polished surface supports the adhesion and growth of some cells. However, fewer and fewer living-healthy cells are found with increasing distance from the polished surface. The clear circular band of agglomerated cells separates a region that is occupied by very few cells (bottom right corner of Figure 7 ). This agglomeration of cells is likely cells growing on top of other cells that were able to anchor and adhere to the surface. Firmly attached cells try to migrate into open space but have difficulty anchoring and migrating within the treated area, creating a front of cells. The few cells, which can be seen in the interior circle are of round shape and appear to be unhealthy or dead. This interesting observation can be explained from a wetting perspective and by considering the machining process. As described in Section 2.2 \nthe produced surfaces are clearly superhydrophobic and support air-trapping wetting behavior. The laser ablation results in the removal of material, so that the fibrous area is located below the polished PTFE surface. Furthermore, mainly dead or unhealthy cells are observed on the fibrous surface, which indicates that the high hydrophobicity of the surface repelled the cell culture medium during the growth and incubation of the cells. Similarly, the work of Alves et al. (2008) on rough casted PLLA films and the research of Ranella et al. (2010) on laser-structured titanium surfaces have shown that cells hardly adhere to biomimetic superhydrophobic surfaces which support air-trapping while cell adhesion is favored by hydrophilic non-structured substrates [ 33 , 34 ]."
} | 7,712 |
24289221 | null | s2 | 9,485 | {
"abstract": "Intraprotein electron transfer (ET) in flavoproteins is important for understanding the correlation of their redox, configuration, and reactivity at the active site. Here, we used oxidized flavodoxin as a model system and report our complete characterization of a photoinduced redox cycle from the initial charge separation in 135-340 fs to subsequent charge recombination in 0.95-1.6 ps and to the final cooling relaxation of the product(s) in 2.5-4.3 ps. With 11 mutations at the active site, we observed that these ultrafast ET dynamics, much faster than active-site relaxation, mainly depend on the reduction potentials of the electron donors with minor changes caused by mutations, reflecting a highly localized ET reaction between the stacked donor and acceptor at a van der Waals distance and leading to a gas-phase type of bimolecular ET reaction confined in the active-site nanospace. Significantly, these ultrafast ET reactions ensure our direct observation of vibrationally excited reaction product(s), suggesting that the back ET barrier is effectively reduced because of the decrease in the total free energy in the Marcus inverted region, leading to the accelerated charge recombination. Such vibrationally coupled charge recombination should be a general feature of flavoproteins with similar configurations and interactions between the cofactor flavin and neighboring aromatic residues."
} | 350 |
27164561 | null | s2 | 9,486 | {
"abstract": "We evolved Thermus thermophilus to efficiently co-utilize glucose and xylose, the two most abundant sugars in lignocellulosic biomass, at high temperatures without carbon catabolite repression. To generate the strain, T. thermophilus HB8 was first evolved on glucose to improve its growth characteristics, followed by evolution on xylose. The resulting strain, T. thermophilus LC113, was characterized in growth studies, by whole genome sequencing, and (13)C-metabolic flux analysis ((13)C-MFA) with [1,6-(13)C]glucose, [5-(13)C]xylose, and [1,6-(13)C]glucose+[5-(13)C]xylose as isotopic tracers. Compared to the starting strain, the evolved strain had an increased growth rate (~2-fold), increased biomass yield, increased tolerance to high temperatures up to 90°C, and gained the ability to grow on xylose in minimal medium. At the optimal growth temperature of 81°C, the maximum growth rate on glucose and xylose was 0.44 and 0.46h(-1), respectively. In medium containing glucose and xylose the strain efficiently co-utilized the two sugars. (13)C-MFA results provided insights into the metabolism of T. thermophilus LC113 that allows efficient co-utilization of glucose and xylose. Specifically, (13)C-MFA revealed that metabolic fluxes in the upper part of metabolism adjust flexibly to sugar availability, while fluxes in the lower part of metabolism remain relatively constant. Whole genome sequence analysis revealed two large structural changes that can help explain the physiology of the evolved strain: a duplication of a chromosome region that contains many sugar transporters, and a 5x multiplication of a region on the pVV8 plasmid that contains xylose isomerase and xylulokinase genes, the first two enzymes of xylose catabolism. Taken together, (13)C-MFA and genome sequence analysis provided complementary insights into the physiology of the evolved strain."
} | 468 |
37607928 | PMC10444874 | pmc | 9,487 | {
"abstract": "Dynamic infrared emissivity regulators, which can efficiently modulate infrared radiation beyond vision, have emerged as an attractive technology in the energy and information fields. The realization of the independent modulation of visible and infrared spectra is a challenging and important task for the application of dynamic infrared emissivity regulators in the fields of smart thermal management and multispectral camouflage. Here, we demonstrate an electrically controlled infrared emissivity regulator that can achieve independent modulation of the infrared emissivity while maintaining a high visible transparency (84.7% at 400–760 nm). The regulators show high degree of emissivity regulation (0.51 at 3–5 μm, 0.41 at 7.5–13 μm), fast response ( < 600 ms), and long cycle life ( > 10 4 cycles). The infrared emissivity regulation is attributed to the modification of the carrier concentration in the surface depletion layer of aluminum-doped zinc oxide nanocrystals. This transparent infrared emissivity regulator provides opportunities for applications such as on-demand smart thermal management, multispectral displays, and adaptive camouflage.",
"introduction": "Introduction Although infrared radiation is invisible to the human eye, all objects in our surroundings continually emit thermal infrared electromagnetic radiation. Recently, the development of technology for regulating dynamic infrared radiation has emerged as an attractive research area in the energy and information fields. The Stefan–Boltzmann law states that infrared radiation can be regulated by controlling either temperature or emissivity. Controlling the temperature requires devices with high energy consumption 1 and complex systems 2 , while regulating the emissivity electrically is a promising method because of its flexible regulation, fast response speed, lightweight structure, and low-energy consumption 3 – 9 . Several electrically controlled dynamic infrared emissivity (DIE) regulators have been proposed based on ion intercalation/extraction into/from materials (e.g., metal oxides 3 , conducting polymers 4 , carbon nanomaterials 5 , 6 ), electron injection/extraction into/from structures (e.g., quantum wells 7 , plasmonic resonators 10 ), and reversible metal electrodeposition 11 . These existing electrically controlled DIE regulators are usually opaque owing to the strong absorption or reflection of visible light from the DIE materials or multilayer devices that are generally black (carbon nanomaterials 5 , 6 ), white (lithium titanate 12 ), or colored (e.g., devices based on polyaniline 4 or tungsten oxide 3 ); see Supplementary Table 1 for details. The device opacity limits advanced applications with broad-spectrum requirements or multispectral compatibility. For smart thermal management of smart windows, it is necessary to simultaneously achieve independent regulation of solar spectral and infrared emissivity to better meet diverse thermal control requirements. For multispectral adaptive camouflage, the infrared emissivity and visible color should be dynamically regulated independently to counter multispectral reconnaissance in different spatial and temporal scenarios and achieve both visible and infrared chameleon-like camouflages. Highly transparent DIE regulators are anticipated as they can be placed on top of a solar spectrum dynamic regulation device or visible color-changing device to achieve independent dynamic regulation of the infrared emissivity and solar spectrum. Wang et al. 13 and Sun et al. 14 prepared DIE regulators based on VO 2 with visible transparencies of 27.8% (380–780 nm) and 62% (400–780 nm), respectively. However, the passive thermochromic emissivity regulation characteristics and high transition temperature (~60 °C) of VO 2 have limited the application of these regulators. Electrical manipulation localized surface plasmon resonance (LSPR) of transparent conductive oxide nanocrystals (NCs) in the near-infrared band (0.78–2.5 μm) has been demonstrated and used to regulate the solar spectrum in smart windows 15 , 16 . In contrast to the regulation of the near-infrared spectrum (accounting for ~50% of the solar spectral energy), which is usually used for the modulation of the solar spectrum energy, DIE regulation of the mid-infrared region (2.5–25 μm) can regulate the outward radiated energy of an object itself. However, the application of LSPR regulation in DIE regulator is limited due to the infrared opacity of substrate and infrared reflection of the electrode shielding the regulation of LSPR in the mid-infrared band. Here, we propose a DIE regulation mechanism and design a fully transparent DIE (TDIE) regulator based on aluminum-doped zinc oxide (AZO) NCs by the electro-regulation of LSPR at infrared wavelengths. The LSPR absorption intensity of the AZO NCs is increased or decreased by modulating the carrier concentration in the surface depletion layer of the AZO NCs. The capacitive characteristics of electron injection/extraction in the LSPR regulation process make it possible for the working electrode to be placed under the AZO NC layer, which avoids shielding infrared radiation and provides an infrared reflection background for LSPR infrared regulation. The developed TDIE regulators exhibit a DIE regulation of 0.51 and 0.41 at the mid-wave infrared (MWIR; 3–5 μm) and long-wave infrared (LWIR; 7.5–13 μm) atmospheric windows, respectively, and the visible transmittance is maintained at 84.7%. Meanwhile, TDIE regulators have a fast response time (<600 ms) and long cycle life (10 4 cycles). The TDIE regulators exhibit significant advantages for smart thermal management and multispectral display applications compared to state-of-the-art devices.",
"discussion": "Discussion In summary, we developed a DIE regulator with high visible transparency that provides an opportunity for the independent modulation of visible and infrared spectra. This functionality is expected to inspire more applications, either as a standalone unit or incorporated with an established visible light-manipulation device. Furthermore, the infrared plasmonic regulation in the NCs could enable the development for active plasmonics 41 , transparent electronics 42 , and other technologies based on infrared radiation. In the future, we expect this technology to be applied in a broad range with the development of flexible and large-area TDIE regulators."
} | 1,599 |
36011640 | PMC9408593 | pmc | 9,488 | {
"abstract": "We compared chemical and microbial leaching for multi-metal extraction from printed circuit boards (PCBs) and tantalum capacitor scrap. A mixed consortium of acidophiles and heterotrophic fungal strains were used in the experiments and compared to chemical leaching using specific acids (sulfuric, citric and oxalic acids). Under optimum conditions, 100% extraction efficiency of Cu, and nearly 85% of Zn, Fe, Al and Ni were achieved from PCB and tantalum capacitor scrap samples using sulfuric acid. The mixed consortium of acidophiles successfully mobilized, Ni and Cu (99% and 96%, respectively) while Fe, Zn, Al and Mn reached an extraction yield of 89, 77, 70 and 43%, respectively, from the PCB samples. For the tantalum capacitor samples, acidophiles mobilized 92% Cu, 88% Ni, 78% Fe, 77% Al, 70% Zn and 57% Mn. Metal mobilization from PCBs and tantalum capacitor scrap by A. niger filtrate showed efficient solubilization of Cu, Fe, Al, Mn, Ni, Pb and Zn at an efficiency of 52, 29, 75, 5, 61, 21 and 35% from PCB samples and 61, 25, 69, 23, 68, 15 and 45% from tantalum capacitor samples, respectively. Microbial leaching proved viable as a method to extract base metals but was less specific for tantalum and precious metals in electronic waste. The implications of these results for further processing of waste electronic and electrical equipment (WEEE) are considered in potential hybrid treatment strategies.",
"conclusion": "5. Conclusions The result of the study reveals that microbial leaching and chemical leaching (inorganic acids) in terms of metal extraction from electronic waste are equally efficient techniques. However, leaching with organic acids was less efficient compared to microbial leaching thereby proving that secondary metabolites produced by the fungal strains also add to the leaching process. Metal mobilization by A. niger spores and filtrate was also studied; microbial extract being more effective can be a feasible and sustainable alternate for metal leaching. Although microbial leaching requires a longer operational period compared to chemical leaching, its ecological advantages cannot be underestimated. Both approaches have their limitations and a “one-fits all” technique to recover valuable metals from e-waste is still elusive. The microbial leaching techniques studied did prove potent in extracting base metals but were not capable of targetting the rare metals identified. This may be the heterogeneity of waste and low absolute concentrations and multiple processes are recommended for rare and critical metal recovery. Development in bio genomics may prove useful in overcoming current microbial limitations. The experimental results of this study provide promising indicators for upscaling and show the practicability of microbial leaching of electronic scrap. For the selected acidophilic bacterial strains, the possibility of contamination is minimal, due to the acidic environment and absence of a carbon source, meaning aseptic conditions were not required and upscaling is therefore easier. Pre-growth strategy can solve issues of metal toxicity in electronic waste and acidophiles are known for their adaptability and versatility to inhabit environments with high metal concentrations. The microorganisms studied grow well between 25–30 °C, allowing development for locations with climatic conditions in this range of ambient air instead of a fixed temperature leaching process, thereby significantly reducing the electricity cost of a scaled-up process.",
"introduction": "1. Introduction Metals are the heart of a country’s economy. A steady supply chain of metals independent from geopolitical instabilities is essential for the national and economic security of a country. Transitioning to a green energy economy leads to an ever-growing demand for rare and critical metals that can lead to a shortage of supply from primary deposits. This has resulted in intense interest in developing efficient recycling techniques to recover these metals from suitable secondary sources. The end-of-life waste electric and electronic equipment (WEEE) offers potential as a source of these metals [ 1 , 2 ]. However, efficient recovery, viable economic conditions and eco-friendly recycling methods are needed. This is due both to the potential value of a variety of components of printed circuit boards (PCBs) and the relative concentrations of toxic and hazardous substances that need proper disposal. In a study by D’Adamo et al. [ 3 ], high-grade waste PCBs when totally recycled can give a net present value of around EUR 63 million. However, due to the heterogeneous mixtures of metals and materials in PCBs, recovery of the target metals is a technical challenge. Traditional recycling technologies such as mechanical, hydro and pyrometallurgical approaches were widely applied to recover many elements but cannot effectively target rare earth elements (REEs), which usually end up as dust or trapped in a slag phase [ 4 ]. Mechanical treatment involving physically dismantling, crushing and separation processes is widely used in recycling plants worldwide for pre-processing of materials which are then subject to further processing. Hydro and pyrometallurgical methods are the most commonly used techniques to recover base metals from WEEE [ 5 , 6 ]. These techniques involve either large volumes of highly corrosive leaching agents (hydrometallurgical processes) or in the case of pyrometallurgical processes high energy consumption, dust generation and emission of combustion gases [ 7 , 8 , 9 ]. In addition, other metal recycling techniques such as supercritical fluid, ionic liquid and physical separation are also gaining interest in the scientific community but efficient and suitable measures and techniques for the management of PCBs are elusive. Bio-hydrometallurgy is a rapidly emerging eco-friendly technology that applies metal cycling mechanisms identical to biogeochemical cycles [ 10 , 11 ]. In bio-hydrometallurgical methods, this includes microbial leaching, bioreduction and biosorption, where metals are recovered from waste material by means of environmentally safe biogenic lixiviant secreted by microorganisms. These methods are not only cost-effective but their operational flexibility and selectivity towards metals make them quite promising for metal recycling [ 12 ]. Although the role of microorganisms in metal recycling is still in its infancy [ 13 , 14 ], the proven efficacy of biological methods in metal extraction from primary sources is the main impetus for defining its role in recycling and recovering critical elements from WEEE. The growing demand for and criticality of tantalum supply presents a stimulus for methods of recycling. This research explores the chemical and microbial leaching possibilities of tantalum from spent capacitors using green reagents. Tantalum consumption is dominated by its use in capacitors in PCBs for electronic equipment with a typical tantalum capacitor containing 48–49% by weight of tantalum [ 15 ]. Despite being a rich source of critical metal, end-of-life tantalum capacitors are destined for landfill. Recycling tantalum is difficult due to challenges in its leaching and subsequent separation from other metals [ 16 ]. Currently, tantalum leaching involves highly corrosive and toxic solutions of concentrated HF [ 17 , 18 , 19 ], which highlights the need for an efficient and eco-friendly recycling process. Hydrometallurgical processes are technically mature but the economics of processing and the ecological impact, in particular of using toxic reagents, especially in the recovery of precious and rare metals, is still an issue [ 1 ]. The aim of this study is to find an environmentally friendly metal leaching technique from electronic waste. Consequently, we investigated the possibility of microbial extraction of valuable metals from PCBs and tantalum capacitor scrap as a potential alternative to conventional chemical leaching. We also investigated the potential of organic acids as alternative metal leaching reagents. A comparative study between chemical and microbial leaching methods was been carried out. The main parameters of pulp density, pH, reaction temperature and time were studied and optimized to evaluate efficiency, cost-effectiveness, feasibility and environmental impact. Potential recovery of minor metal content from WEEE and tantalum capacitor scrap and commercial viability of processes were also studied. For microbial leaching, a mixed consortium of iron- and sulfur-oxidizing acidophiles ( Acidithiobacillus ferrooxidans , Leptospirillum ferrooxidans and Acidithiobacillus thiooxidans ) and organic acid-producing heterotrophs ( Aspergillus niger ) were employed in comparison with specific acids (sulfuric, citric and oxalic). Studies show that the use of a mixed culture of bacteria is a better option than single microorganisms in metal leaching phenomena as different microorganisms can have distinct metal tolerance, which can result in a greater metal leaching capacity [ 20 , 21 ], whereas Aspergillus niger was reported for the recovery of precious metals from e-waste [ 22 ]. For metal dissolution by microbial consortia of iron and sulfur oxidizing acidophiles, the microorganisms follow thiosulfate and/or polythiosulfate pathways [ 2 ], biogenic sulfuric acid and ferric iron act as lixiviants and metals are mobilized to their ionic state in aqueous solution by proton attack via the formation of acids (acidolysis) or oxidation/reduction reactions (redoxolysis). In simplified form, this chemical reaction can be written as\n (1) M S + H 2 S O 4 + 1 2 O 2 → M S O 4 + S 0 + H 2 O \n (2) S 0 + 3 2 O 2 + H 2 O → H 2 S O 4 Here, M can be Cu 0 , Zn 0 , Al 0 , Ni 0 , Fe 0 , etc. However, heterotrophs need additional energy sources (glucose/sucrose) to grow and produce biogenic acids (lactic, oxalic, citric and gluconic acid in different concentrations), amino acids and metabolites [ 23 ]. These biogenic organic acids coupled with biogenic chelators can be efficiently used to release rare and critical metal ions from e-waste [ 24 ].\n (3) C 6 H 8 O 7 ↔ ( C 6 H 5 O 7 ) 3 − + 3 H + \n (4) C u O + 2 H + → C u 2 + + H 2 O Strong regulations on environmental pollutants and restrictions on illegitimate recycling practices create a high demand for novel green technologies to recover metals from waste. Efficient recycling of WEEE will not only address the environmental issues and supply risk of metals but also create job opportunities for biotechnologists, metallurgists, and skilled workers. Additionally, biotechnological recycling of WEEE in a circular economy approach can contribute to resource extraction from waste without having any related harmful impact on the environment [ 25 ].",
"discussion": "4. Discussion 4.1. Metal Extraction by Organic Acid Leaching Synthetic organic acids namely citric acid and oxalic acid were selected to conduct a comparative study between chemical and microbial leaching mechanisms. Leaching was terminated after 20 days when the metal concentration in the leachate was relatively constant. Dissolution of the metallic fraction from electronic waste by organic acids involves various mechanisms including acidification and complexation. To compare chemical leaching using commercial citric and oxalic acids with microbial production, the molarity of acid solutions used was decided on from previous studies of their production by the filamentous fungus A. niger [ 36 , 37 , 38 ]. Citric acid gave better leaching efficiency than oxalic acid, however, commercial citric acid showed a lower extraction yield than the equivalent molarity during microbial leaching using A. niger filtrate. This study showed that purified and preconcentrated microbial extract could be a viable alternative for metal leaching. 4.2. Metal Extraction by Inorganic Acid Leaching Sulfuric acid in the presence of H 2 O 2 forms peroxysulfuric acid (H 2 SO 5 ), which acts as a strong oxidizing agent and increases metal dissolution, however, the decomposition of H 2 O 2 starts at agitation speeds higher than 500 rpm, thus decreasing the dissolution of metals [ 39 ]. The following equations describe the chemical dissolution process.\n (5) 2 H 2 O 2 → 2 H 2 O + O 2 \n (6) H 2 S O 4 + H 2 O 2 → H 2 S O 5 + H 2 O \n (7) C u + H 2 S O 5 → C u 2 + + S O 4 2 − + H 2 O Under optimum conditions, H 2 SO 4 leached Cu from waste PCBs with 100% extraction efficiency whereas Zn, Fe, Al and Ni were leached at a rate of ≈85%. The high corrosion potential of H 2 SO 4 (−9.8 mV.SCE) is responsible for this behavior [ 40 ]. It was observed that an increase in sulfuric acid concentration had little effect on metal dissolution rate and is not suitable from an economic point of view but an increase in temperature from 70–80 °C significantly increased the metal leaching efficiency. Further increase in temperature, however, shows only a slight effect on metal dissolution, the reason being the accelerated rate of H 2 O 2 decomposition at these higher temperatures. The application of nitric acid under these conditions gave a recovery of Cu at 95%, whereas Zn, Fe, Pb and Ni were recovered at ≈80%. It was observed that the extraction efficiency of metals increased considerably when nitric acid concentration was increased from 1–4 M. At concentrations higher than 4 M, the H + was saturated and a further increase in acid concentration had very little effect on metal dissolution efficiency. However, the leaching results demonstrate that inorganic acids due to their fast reaction rates are relatively more efficient compared to the leaching by more eco-friendly organic acids. 4.3. Metal Extraction by Acidophilic Bacterial Strains Due to the non-sulfidic nature of electronic waste, it was speculated that metal solubilization from samples followed both direct and indirect leaching mechanisms involving the biogenic formation of leaching agents [ 19 , 41 ]. Acidophilic autotrophs generally oxidize ferrous (Fe 2+ ) to ferric iron (Fe 3+ ) and elemental sulfur (S 0 ) to sulfuric acid (H 2 SO 4 ), and this biogenic production of ferric iron (redoxolysis) and sulfuric acid (acidolysis) results in the dissolution of metals from PCBs and tantalum capacitor scrap. The alkalinity of electronic waste and oxidation of ferrous to ferric iron increased the pH of the medium, consequently decay in ORP was observed. Variation in ORP and Fe 2+ concentration contributes significantly to bacterial activity and subsequently metal leaching efficiency. A higher value of ORP encourages interaction between bacteria and electronic waste for metal solubilization [ 42 ], which can be attained with a steady pH profile. The pH of the growth medium is another important parameter that controls the growth and activity of acidophilic microorganisms. The growth of microorganisms is usually initiated at a very low pH (not higher than 3.0) and as the growth continues, the pH of the medium no longer affects the bacterial activity [ 43 ]. Metal dissolution through redoxolysis and acidolysis mechanisms is a cyclic and acid-consuming process. Consequently, the alkalinity of the source material decreased, and a steady pH profile was achieved. For a higher material load, a prolonged time was required to show a steady pH profile. Formation of jarosite was observed during the microbial leaching experiment which dominated in experiments with higher material load generating high pH. Studies show that ferric iron precipitation hinders the metal leaching process [ 44 ] by reducing the content of dissolved iron in the culture medium [ 25 ]. This suggests that pulp density plays an important role in metal solubilization from electronic waste, high pulp density has a negative effect on the productivity of microorganisms due to the toxic effect of metallic and non-metallic compounds contained in electronic waste [ 24 ] or oxygen transfer limitation [ 19 ]. A pre-cultivation strategy can resolve the problem. Although the results demonstrate that a lower concentration of samples is more effective in metal dissolution as compared to a high concentration, the adaptability of microbial consortia after succession from low to high pulp density while showing high leaching efficiencies [ 45 ] enables the use of high metal concentrations while designing the full-scale process. The microbial leaching results verify that the rate of leaching also depends upon the particle size of the sample. Smaller particle size means greater surface area thus the contact area of microbial cells increases leading to a higher yield of metals without a change in the mass of the sample. In this study, 0.75 mm particle size is considered the optimum particle size for metal leaching, albeit a relative increase in the leaching efficiency of base metals was observed when particle size decreased from 0.75 mm to 0.5 mm, however, over-crushing and excessive sieving results in a loss on comminution (LoC) or accumulation of the material on the sieve [ 46 ]. An increase in particle size from 0.5 mm to 0.75 mm shows a decrease in leaching rate by a factor of 1.2. A balance between the crushing process and particle size is maintained, hence microbial leaching experiments with a particle size greater than 0.75 mm were not studied. The significant factors behind this decision were leaching efficiency profile, LoC and manual labor. In the control experiments, very low concentrations of Cu and Fe (3.2 and 1%, respectively) were detected, and it was presumed that the mobilization of metals, in this case, was due to the exposure to H 2 SO 4 for pH adjustment. Metal solubilization through acidophiles is an electrochemical process based on oxidation-reduction reactions. Metals with lower standard electrode potential oxidize first [ 40 ] as compared to metals with higher standard electrode potential. Moreover, metal mobilization is highly influenced by the solubility of metals as in the case of Pb. Pb was not detected in the leachate and it was speculated that Pb was precipitated as PbSO 4 in the form of white precipitates observed in the experimental flasks [ 23 ]. Similarly, the precious metals and tantalum were also not detected in the leachate. 4.4. Metal Extraction by Fungal Leaching Due to the ability to remove toxic organic compounds [ 39 ] in samples and diversity in metabolic production, A. niger was tested for leaching of metals from PCB and tantalum capacitor scrap. Citric, oxalic, malic and gluconic acids are the most abundant acids produced by A. niger for carrying out the leaching process [ 47 , 48 ]. Metal mobilization by A. niger spores as well as filtrate was studied. A. niger filtrate showed better results and mobilized base metals Cu, Fe, Al, Ni and Zn at a rate of 52, 29, 75, 51 and 35% from PCBs and 65, 25, 69, 68 and 45%, respectively, from tantalum capacitor scrap. From the results, it is obvious that direct growth in the presence of electronic waste is not recommended. Therefore, microorganisms should be grown in the absence of electronic waste and the metabolites formed should be used for metal leaching. The use of metabolites for microbial leaching has multiple advantages, biomass as well as waste material is not contaminated and can be recycled and used again, the acid formation can be optimized, and a higher material load can be applied. No doubt the use of live culture is more interesting in metal recovery since microorganisms are functional and continuous production of metabolites is available but factors that hinder the microorganism’s growth should be addressed. Although the metal toxicity in the case of tantalum capacitor samples is lower compared to PCB samples, the presence of very high levels of manganese in tantalum capacitor scrap reduces the accumulation of citric acid significantly. In a manganese-deficient medium, the enzyme isocitrate dehydrogenase is unable to catalyze the oxidative decarboxylation of isocitrate to alpha-ketoglutarate (in the Krebs cycle) and citric acid is accumulated in the medium, however, the presence of manganese releases isocitrate dehydrogenase into the medium, and citrate is converted to organic acids such as succinate, fumarate, malate, etc. and reduces the accumulation of citric acid [ 41 ]. Another factor that significantly affects the leaching efficiency of metal-using fungal strains is the cultivation period, with some authors incubating fungi for a prolonged period [ 38 ] resulting in high leaching efficiencies. The pH profile during leaching experiments is directly related to acid production and in experiments with A. niger spores, a steady decrease in profile was observed up to day 15, after which increases were observed. The pH drop during fungal growth was due to the production of organic acids [ 34 ] with a maximum at day 15. This trend shows a decrease in acid production which could be due to the presence of metal ions and the formation of insoluble metal oxalates through an intermediate solubilization process [ 27 ]. 4.5. Comparative Evaluation of Chemical and Microbial Leaching of Metals Experimental results demonstrated that pH, pulp density, reaction temperature and time are all important parameters in three types of leaching. According to Pant et al. [ 46 ], chemical leaching leads to higher resource leaching as compared to microbial leaching. However, the leaching trials in this study prove that microbial leaching has almost the same metal leaching potential as chemical leaching. Precious and rare metals were leached at negligible amounts in both chemical and microbial leaching experiments apart for NHO 3 , which shows a great ability to solubilize silver. The reaction time for chemical leaching is quite low as compared to microbial leaching but requires high temperature and energy. Even though chemical leaching is always allied with the ecological issues resulting from the corrosive nature and chemical toxicity of the leaching solution, the processes are based on established stoichiometry, therefore, the degree of ambiguity is low as compared to biological methods [ 47 , 49 ]. The main constraint in microbial leaching is the optimization of the process which needs a deeper understanding of the mechanism and kinetics to define optimal operating parameters. On the other hand, it is potentially a more economic and environmentally sustainable approach [ 48 ], particularly when considering multiple step processing [ 50 , 51 ]."
} | 5,617 |
36320098 | PMC10100022 | pmc | 9,489 | {
"abstract": "Abstract PSBO is essential for the assembly of the oxygen‐evolving complex in plants and green algae. Despite its importance, we lack essential information on its lifetime and how it depends on the environmental conditions. We have generated nitrate‐inducible PSBO amiRNA lines in the green alga Chlamydomonas reinhardtii . Transgenic strains grew normally under non‐inducing conditions, and their photosynthetic performance was comparable to the control strain. Upon induction of the PSBO amiRNA constructs, cell division halted. In acetate‐containing medium, cellular PSBO protein levels decreased by 60% within 24 h in the dark, by 75% in moderate light, and in high light, the protein completely degraded. Consequently, the photosynthetic apparatus became strongly damaged, probably due to ‘donor‐side‐induced photoinhibition’, and cellular ultrastructure was also severely affected. However, in the absence of acetate during induction, PSBO was remarkably stable at all light intensities and less substantial changes occurred in photosynthesis. Our results demonstrate that the lifetime of PSBO strongly depends on the light intensity and carbon availability, and thus, on the metabolic status of the cells. We also confirm that PSBO is required for photosystem II stability in C. reinhardtii and demonstrate that its specific loss also entails substantial changes in cell morphology and cell cycle.",
"conclusion": "5 CONCLUSIONS In microalgae, the adjustment of the photosynthetic complex stoichiometry may occur through cell division that is coupled with the tuning of gene expression (Davis et al., 2013 ; Meagher et al., 2021 ). In this scenario, the turnover of photosynthetic subunits is of limited importance. However, the regulation of cell division cannot explain how algae can cope with varying light conditions under nutrient‐limiting conditions when cell division is limited. We have demonstrated that in contrast to previous notions, PSBO has a significant, light, and carbon‐supply‐dependent turnover and its quantity is not regulated only through cell division. Determining the lifetime of specific photosynthetic subunits is of high importance both from the point of view of deciphering the mechanisms of photosynthesis and its regulation, and for the bio‐industrial exploitation of green algae. In the bio‐industry, a major endeavour is to maintain algal cultures and their productivity for an extended period of time, due to the high costs of establishing new algal cultures. Moreover, biomass accumulation is restricted for example, in biofilm culturing systems (Leino et al., 2012 ; Vajravel et al., 2020 ) and in batch hydrogen production systems with restricted carbon assimilation (Kosourov et al., 2018 ; Nagy et al., 2021 ). In this work, we demonstrated the prominent role of PSBO in sustaining the homoeostasis of the photosynthetic apparatus. We have also found that its lifetime is prolonged in moderate light and darkness, and in the absence of ample carbon supply.",
"introduction": "1 INTRODUCTION Photosystem II (PSII) carries out light‐energy conversion reactions. Its manganese cluster (Mn 4 CaO 5 ) splits two water molecules into one molecule of oxygen and four protons in a light‐driven cycle. In plants and green algae, the Mn‐cluster is shielded on the thylakoid luminal side by the extrinsic proteins PSBO, PSBP, PSBQ, with apparent molecular masses of 33, 23 and 17 kDa, respectively (reviewed by Barber, 2016 ; Ifuku & Noguchi, 2016 ; Roose et al., 2016 ; Shen, 2015 ). These proteins stabilize the Mn‐cluster, and they probably regulate the access of Ca 2+ and Cl − and the retention of these ions to optimize oxygen evolution (Loll et al., 2005 ; Vinyard & Brudvig, 2017 ). In addition, the extrinsic subunits protect the Mn‐cluster from reductants (Bricker et al., 2012 ; Ghanotakis et al., 1984 ; Popelkova et al., 2011 ), including luminal ascorbate (Podmaniczki et al., 2021 ). The extrinsic proteins, PSBO in particular, may also regulate water access and proton removal from the Mn‐cluster via a hydrogen‐bonding network (Guskov et al., 2009 ; Ho & Styring, 2008 ; Offenbacher et al., 2013 ). In addition, PSBO has also been suggested to exhibit carbonic anhydrase activity (Lu & Stemler, 2002 ). In line with its crucial role in photosynthetic water splitting, PSBO is essential for photoautotrophic growth in vascular plants and algae (Liu et al., 2009 ; Mayfield et al., 1987 ; Pigolev & Klimov, 2015 ; Yi et al., 2005 ). In Arabidopsis thaliana , PSBO has two isoforms, PSBO1 and PSBO2 that are encoded by PSBO1 (At5g66570) and PSBO2 (At3g50820). T‐DNA knockout mutants of PSBO1 ( psbo1 ) exhibit retarded growth, malfunction of both the donor and acceptor sides of PSII, and the mutants are highly susceptible to photoinhibition. The absence of PSBO2 hardly affects PSII activity and plant growth (Allahverdiyeva et al., 2009 ; Lundin et al., 2007 ); instead, the PSBO2 protein may act as a GTPase, regulating PSII repair in Arabidopsis (Lundin et al., 2007 ; Spetea et al., 2004 ). In Chlamydomonas reinhardtii , PSBO is encoded by a single gene, Cre09.g396213 , and it is indispensable for oxygen evolution (Mayfield et al., 1987 ; Pigolev & Klimov, 2015 ). The subunit composition of the photosynthetic machinery exhibits some flexibility. Response to environmental perturbations and the steady‐state maintenance of the photosynthetic machinery requires that the changes take place on a relatively short timescale (Nelson et al., 2014 ). It is well known that the PsbA subunit of PSII exhibits a particularly fast turnover (in the time range of a few hours) to mitigate photodamage, an inherent accompanying event of photosynthesis. The half‐life of PsbA is inversely correlated to light intensity (e.g., Schuster et al., 2020 ), and certain environmental stress conditions also enhance its degradation (Aro et al., 1993 ; Marutani et al., 2012 ; Mittal et al., 2012 ). In vascular plants, the other PSII subunits have been shown to have a rather slow turnover (L. Li et al., 2017 ). PSBO is a relatively thermostable protein (Lydakis‐Simantiris et al., 1999 ) and has been suggested to have a long lifetime, even in its free form (Hashimoto et al., 1996 ). In Synechocystis grown at very low light, PSBO has a half‐life of 24−33 h (Yao et al., 2012 ). On the other hand, it was shown in isolated PSII membranes that PSBO might become oxidatively damaged under light stress, and its binding capacity to PSII may be reduced (Henmi et al., 2004 ). It was also shown that PSBO could be degraded in a redox (thioredoxin)‐dependent manner in both higher plants and cyanobacteria, and its assembly into PSII protects it from proteolytic degradation (Roberts et al., 2012 ). Microalgae are thought to adjust the concentration of photosynthetic proteins to match the environmental conditions through cell division in a way that cell division is coupled with the tuning of gene expression, leading to an adjustment of the photosynthetic complex stoichiometry (Davis et al., 2013 ; Meagher et al., 2021 ). However, this concept does not explain how algae can cope with varying light conditions under nutrient‐limiting conditions when cell division is limited. In this work, we aimed at investigating the dependence of the lifetime of PSBO on environmental conditions in the model organism C. reinhardtii . To this end, we have generated nitrate‐inducible artificial microRNA (amiRNA) lines targeting PSBO . The advantage of the amiRNA approach is that off‐target effects and silencing are minimized relative to antisense and inverted repeat constructs (Molnar et al., 2009 ), and the inducible system enables normal growth and development under non‐inducing conditions (Schmollinger et al., 2010 ). By inducing the PSBO amiRNA construct, we confirmed that PSBO is indispensable for the stability of mature PSII reaction centres. In addition, we found that the time course of diminishment of PSBO protein level (i.e., its lifetime) is strongly dependent on light intensity and carbon availability, and thus, on the metabolic status of the cell.",
"discussion": "4 DISCUSSION 4.1 The lifetime of PSBO in C. reinhardtii is dependent on light and carbon availability PSBO is essential for oxygen evolution in photosynthetic organisms, including green algae. It stabilizes the Mn‐cluster and regulates the access of Ca 2+ , Cl − as well as water and proton removal from the Mn‐cluster (Guskov et al., 2009 ; Ho & Styring, 2008 ; Loll et al., 2005 ; Offenbacher et al., 2013 ; Vinyard & Brudvig, 2017 ). In vitro studies have suggested that PSBO is a relatively stable protein (Hashimoto et al., 1996 ), in spite of its involvement in the energetically highly demanding water oxidation reaction. On the other hand, the Mn‐cluster may be prone to photoinhibition due to the absorption of visible light, which may affect the integrity of PSBO as well (Murata et al., 2007 ; Zavafer et al., 2015 ; Zavafer & Mancilla, 2021 ). To our knowledge, the dependence of the PSBO lifetime on environmental conditions has not been carefully assessed in green algae. We have chosen C. reinhardtii as a model organism, since the stability of its OEC is particularly relevant for photosynthesis‐based biotechnological applications, such as hydrogen production (e.g., Nagy et al., 2021 ) and the production of various high‐value compounds (Mehariya et al., 2021 ). To study the dependence of PSBO lifetime on environmental conditions and the consequences of its down‐regulation, we decided to generate inducible amiRNA lines targeting the CDS (in the PSBO‐A58 strain) or the 3'UTR ( PSBO‐B22 strain) of PSBO mRNA. Our nitrate‐inducible PSBO amiRNA transformants grew normally under non‐inducing conditions and their photosynthetic apparatus performed similarly to that of the control strains. We observed a remarkable diminishment in PSBO mRNA level upon induction (Figure 4 ), and additionally, the amiRNA approach can act at the translational level in C. reinhardtii (Vidal‐Meireles et al., 2017 ). Therefore, it is very likely that the synthesis of new PSBO proteins was prevented to a large extent, although it is possible that a minor amount of PSBO was still produced in the PSBO amiRNA lines after induction. For this reason, we used the time course of PSBO diminishment as a qualitative descriptor of PSBO lifetime. A similar approach was used earlier in tobacco plants to obtain information about the lifetime of cytochrome b 6 f complex subunits (Hojka et al., 2014 ). Upon induction of amiRNA expression, we observed a halt of cell division, a light‐dependent Chl (a + b) content loss, and a diminishment of PSBO level on a cell number basis. At NL and photomixotrophic conditions, the cellular PSBO content decreased by about 75% in 24 h and this loss was remarkably accelerated when the cultures were placed in HL, and slowed down when the cells were kept in the dark (Figure 3 ). The arrest of cell division infers that the induction of the PSBO amiRNA construct did not simply decrease the cellular PSBO pool by blocking de novo synthesis and limiting its supply to the daughter cells. The absence of such a dilution effect and the gradual diminishment of cellular PSBO content mean that PSBO has a significant, and light intensity‐dependent turnover. We also found that, unexpectedly, in the absence of acetate, under photoautotrophic conditions (i.e., in TP medium), the cellular PSBO content was substantially more stable in comparison with acetate‐supplied cultures (Figure 3 ). Excess acetate has been shown to remarkably reduce photosynthetic carbon gain and oxygen evolution but without affecting the integrity of PSII (Heifetz et al., 2000 ). On the other hand, acetate also diminishes the yield of singlet oxygen production in C. reinhardtii (Roach et al., 2013 ). Thus, it is unlikely that acetate itself had a damaging effect on PSBO. Accordingly, when cultures were supplemented with 1% CO 2 , the lifetime of PSBO also decreased relative to CO 2 ‐limited cultures in TP medium (Figure 11 ). These data suggest that the lifetime of PSBO in C. reinhardtii is largely dependent on carbon availability. We hypothesize that this is related to the fact that acetate and CO 2 ‐deprived cultures are metabolically less active and divide only slowly. It has been shown in a wide range of species, including yeast and mammals, that lifespan can be prolonged by reducing nutrient intake (López‐Otín et al., 2016 ; Sampaio‐Marques et al., 2019 ), which may be due to reduced metabolic activity and the concomitantly reduced ROS production (e.g., Munro & Pamenter, 2019 ); however, the role of ROS was challenged (e.g., Gladyshev et al., 2014 ) and the exact mechanism of action remains to be explored. Recent results obtained on C. reinhardtii suggest that this so‐called caloric restriction concept may apply to microalgae as well. Zamzam et al. ( 2022 ) demonstrated that high levels of acetate and high starch levels substantially decrease longevity. In agreement with this, we observed that on a timescale of days, the F V /F M parameter of control ( EV31 ) cultures decreased more substantially in TAP medium than in TP medium (Figure 5 ), and in addition, the quantities of the tested photosynthetic subunits moderately decreased in TAP medium both at HL and in the dark, whereas in TP the subunits were stable (Figures 6 and 7 ). This suggests that, upon HL stress and when the photosynthetic apparatus does not need to remain functional (e.g., in the dark), ample carbon availability leads to diminished photosynthetic activity and to a reduced lifetime of photosynthetic complexes. Zamzam et al. ( 2022 ) hypothesized that excess carbon availability causes an overreduction of the photosynthetic electron transport chain, and in this way, increased ROS production. The PQ‐pool may become reduced due to increased chlororespiration (e.g., Cardol et al., 2003 ) and this may seem a plausible signal participating in the regulation of the lifespan of photosynthetic complexes and that of the entire cell. On the other hand, as mentioned earlier, acetate rather decreases than increases ROS production in C. reinhardtii cultures (Roach et al., 2013 ). Thus the mechanism by which acetate and in general, carbon availability modifies the lifetime of all photosynthetic complexes, warrants further investigations. In this study, we provide direct experimental evidence that reduced carbon availability expands the lifetime of the major OEC subunit, PSBO. At this stage, we cannot generalize this finding to other photosynthetic subunits, but it seems likely that PSBO is not unique in this respect, and the down‐regulation of other essential photosynthetic subunits could occur in a similar manner. 4.2 Down‐regulation of PSBO results in a complete disassembly of the photosynthetic apparatus PSBO is required for the stable accumulation of PSII reaction centres in plants (Bricker & Frankel, 2011 ; Murakami et al., 2002 ). On the other hand, it is somewhat uncertain to what extent PSBO is required for PSII stability in green algae. The nitrate‐inducible amiRNA approach offers an appropriate tool to assess the consequences of downregulating PSBO expression in mature PSII complexes. We found that upon the induction of the PSBO amiRNA construct in TAP medium, the amount of PSBO rapidly decreases, leading to PSII reaction centre inactivation, as reflected by complete loss of oxygen evolution, and a decrease in the F V /F M value (Figure 5 ). The diminishment of cellular PSBO content also entails a strong reduction in the amounts of various photosynthetic subunits (Figure 6 ). In addition, accumulation of lipid droplets and altered chloroplast ultrastructure were observed, and the cultures finally bleached in the light (Figures 2 and 8 ). Thus, our data confirm that, in addition to its requirement for PSII assembly, PSBO is essential for PSII maintenance in green algae. This conclusion is in agreement with earlier studies on the FuD44 C. reinhardtii mutant that constitutively lacks PSBO (Mayfield et al., 1989 ; Pigolev et al., 2009 ; De Vitry et al., 1989 ) and the TSP4 temperature‐sensitive mutant (Bayro‐Kaiser & Nelson, 2020 ). The FuD44 mutant is unable to form active PSII units when grown in light, but a small amount of photochemically active reaction centres accumulate in the dark, without the capacity to evolve oxygen (Pigolev et al., 2009 , 2012 ). The TSP4 mutant was characterized by a strong diminishment of the F V /F M value and the losses of PSBO, PsbA and PetA at a moderately high temperature at which PSBO is highly unstable (Bayro‐Kaiser & Nelson, 2020 ). The fact that the entire photosynthetic apparatus was degraded upon the loss of PSBO, indicate that a general cellular response was triggered, involving oxidative stress and possibly autophagy (Heredia‐Martínez et al., 2018 ; Meagher et al., 2021 ). The most likely scenario is that upon loss of PSBO, the OEC becomes inactivated, thereby electron transfer to Tyr Z \n + and P680 + is interrupted, and highly oxidizing species accumulate, damaging the photosynthetic apparatus. This so‐called ‘donor‐side induced photoinhibition’ process occurs on the timescale of minutes and was first described for PSII reaction centres the OECs of which had been inactivated chemically (Blubaugh & Cheniae, 1990 ; Callahan et al., 1986 ; Chen et al., 1995 ; Jegerschöld & Styring, 1996 ). ‘Donor‐side induced photoinhibition’ occurs in heat‐treated leaves as well. It is initiated by the release of PSBO (and possibly other OEC subunits) and loss of Ca 2+ and Cl − from the Mn‐cluster, leading to the loss of OEC activity. Consequently, PSII reaction centres are inactivated within minutes, and they are degraded on the timescale of a few hours (Tóth et al., 2011 ). This is in agreement with the observation made in this study that at 24 h after PSBO amiRNA induction, the amounts of various photosynthetic subunits are strongly diminished (Figure 6 ). The induction of the PSBO amiRNA construct in TAP medium led to the loss of PSBO also in the dark (Figure 3 ), and this resulted in the diminishment of several photosynthetic subunits, including PsbA, PsbP, PetA, RbcL and CP47 (Figure 6 ). These results show that the loss of PSBO triggers a regulated degradation of photosynthetic complexes, which is independent of the presence of light and, therefore, probably independent of oxidative stress. Thus, hypothetically, PSBO may also play a specific role in maintaining the homoeostasis of the photosynthetic apparatus. Upon down‐regulation of PSBO, cell division and expansion ceased both in TAP and TP media (Figures 2 and 9 ), along with a decrease in the expression levels of CYCA1 and POLA4 (Figure 10 ), encoding proteins participating in DNA replication. These findings can be partly explained by the regulatory effect of photosynthetic electron transport and the redox state of the chloroplast on DNA replication (Kabeya & Miyagishima, 2013 ; Ohbayashi et al., 2013 ), but the exact mechanism by which PSBO contributes to cellular homoeostasis, certainly warrants further investigations."
} | 4,812 |
36425690 | PMC9650783 | pmc | 9,490 | {
"abstract": "Self-healing is the ability of a material to recover from physical damage. Because self-healing is crucial to environmental protection and sustainable development, several photochemical approaches, including those involving disulfide group, reversible Diels–Alder reaction, hydrogen bond cleavage, reformation, photo dimerization, and self-filling system, have been used to develop self-healing coating. In this review, the similarities and differences among the approaches to achieving self-healing in synthetic coatings, particularly the approaches related to the preparation, self-healing mechanism, and self-healing efficiency of the coating, are described. Potential future development and application of photochemical approaches to the synthesis of self-healing coating are also discussed.",
"introduction": "1. Introduction Photopolymerization, which uses ultraviolet (UV) light as an energy source to cure photosensitive materials, has many advantages, such as energy efficiency 1 and eco friendliness, 2 high efficiency, 3 speed 4 and time-space controllability. 5 After decades, with the continuous development of the basic theory and application technology of photopolymerization, this kind of technology has been widely applied in the fields of coating, 6 ink, 7 and adhesive. 8 UV-curable coating, which has been widely used as protective and decorative surface coating because of its energy efficiency, eco friendliness, and low cost, 9 can be completely cured in as little as a few seconds under the action of UV light. However, the thinness of UV-curable coating makes it vulnerable to damage from external forces, such as bumping and scraping, which can result in micro-cracks forming that are difficult to distinguish with the naked eye. 10,11 The gradual accumulation of local damage in UV-curable coating can cause part of the substrate to become exposed, thus causing the coating to lose its protective effect. Inspired by nature, the American military developed the concept of self-healing materials in 1981 12,13 to reduce material losses caused by the accumulation of micro-cracks and to extend the service life of materials. The American military has applied self-healing materials in fields ranging from biology to materials science, thus opening up new direction for materials research. As the body of research on self-healing expanded, researchers began to explore the integration of UV-curable coatings and self-healing materials. 14 Self-healing materials are classified as extrinsic and intrinsic based on their self-healing mechanisms. 15 In extrinsic self-healing materials, healing agents (generally liquids) are integrated into the material matrix in the form of microcapsules or micro vascular networks. 16 Although extrinsic self-healing materials are the most common, they have some limitations; for example, the self-healing ability of such materials is lost when the supply of healing agents is exhausted. Therefore, researchers have turned to intrinsic strategies to develop coatings that can repeatedly self-heal. Intrinsic self-healing materials involve (1) non covalent bond interactions, including ionic and hydrogen bond formation as well as π–π stacking, 17 (2) dynamic covalent bond interactions, such as dynamic trans-esterification, Schiff base and disulfide bond formation, and Diels–Alder (DA) reaction. 18,19 Self-healing materials have attracted considerable attention in recent decades owing to their numerous favorable properties, such as their long lifespan and high stability. Herein, advancements in research on intrinsic self-healing coating, specifically those based on disulfide bond exchange, D–A reaction, reverse reaction, hydrogen bond fracture and recombination, photo dimerization reaction, and self-filling coating materials, are briefly summarized. Potential future developments and applications of intrinsic self-healing coating based on photochemical reaction are also discussed."
} | 985 |
36726720 | PMC9885046 | pmc | 9,491 | {
"abstract": "Metabolism of an organism underlies its phenotype, which depends on many factors, such as the genetic makeup, habitat, and stresses to which it is exposed. This is particularly important for the prokaryotes, which undergo significant vertical and horizontal gene transfers. In this study we have used the energy-intensive Aromatic Amino Acid (Tryptophan, Tyrosine and Phenylalanine, TTP) biosynthesis pathway, in a large number of prokaryotes, as a model system to query the different levels of organization of metabolism in the whole intracellular biochemical network, and to understand how perturbations, such as mutations, affects the metabolic flux through the pathway - in isolation and in the context of other pathways connected to it. Using an agglomerative approach involving complex network analysis and Flux Balance Analyses (FBA), of the Tryptophan, Tyrosine and Phenylalanine and other pathways connected to it, we identify several novel results. Using the reaction network analysis and Flux Balance Analyses of the Tryptophan, Tyrosine and Phenylalanine and the genome-scale reconstructed metabolic pathways, many common hubs between the connected networks and the whole genome network are identified. The results show that the connected pathway network can act as a proxy for the whole genome network in Prokaryotes. This systems level analysis also points towards designing functional smaller synthetic pathways based on the reaction network and Flux Balance Analyses analysis.",
"introduction": "1 Introduction Biochemical pathways in cells underlie cellular functions, and hence its phenotype. These are regulated by many direct and indirect, and hardwired and transient factors. Evolution of multi-step biochemical pathways in any species depends upon how natural selection shapes the evolution of a set of enzyme-coding genes catalysing the constituent chemical reactions, such that the required end-product is made ( Flowers et al., 2007 ; Invergo et al., 2013 ). However, the genes, enzyme and pathways do not function independently. In each species, they exist in the context of a large biochemical network, consisting of other genes, enzymes and pathways interacting with each other, and with the intra- and extra-cellular environments. Hence in order to understand the interactions and effects in functionally related pathways, we need to study the properties of subsets of metabolic networks at different levels. To study how pathways regulate their function with respect to each other, we chose the highly branched aromatic amino acid (Tryptophan-Tyrosine-Phenylalanine, TTP) biosynthesis pathway as an example. This pathway is responsible for the production of three aromatic amino acids; Tryptophan, Tyrosine and Phenylalanine–all requiring high energy for their synthesis. The TTP pathway has been studied previously for its role in the production of secondary metabolites ( Herrmann 1995 ; Herrmann and Weaver 1999 ), and its usage as target for several antibiotics, fungicides and herbicides ( Roberts et al., 2002 ; Abell et al., 2005 ; Webby et al., 2005 ). The TTP pathway is present in most of the prokaryotes, but is lost in higher eukaryotes and mammals ( Xie et al., 2003 ), thus requiring higher organisms to get some of these amino acids as food additives. Even in the TTP prototrophs, the evolutionary history of the pathway is convoluted due to instances of horizontal gene transfer and is characterized by many isozymes, bi-functional enzymes and gene fusions ( Bentley and Haslam 1990 ; Xie et al., 2003 ; Richards et al., 2006 ; Priya et al., 2014 ). Traditionally, specific pathways such as, the Tryptophan biosynthetic pathway, have been studied in depth both experimentally and theoretically using mathematical models ( Yanofsky et al., 1987 ; Sinha 1988 ; Santillan and Mackey 2001 ; Castro-López et al., 2022 ). However, in the post-genomic era, most of the studies have focussed on network modelling and analysis of the whole cellular metabolism ( Fairlamb 2002 ; Ma and Zeng 2003 ; Gerlee et al., 2009 ). In recent times, the principles of Systems Biology have been used extensively to study metabolic pathways at different scales ( Nielsen 2017 ), and reconstruction of whole genome metabolic networks from their genome sequences has been an active area of study ( Khodayari et al., 2016 ; Norsigian et al., 2018 ; Bagheri et al., 2019 ). From the perspective of the intracellular biochemical network, the maze of neighbouring pathways, that are connected through sharing one or more metabolites, can influence the function and evolution of each other. Yet, study of pathways in the context of each other is rarely done across species. Hence in order to study the contextual influence of the inter-connected pathways, we use complex network analysis on the TTP pathway reactions network in 29 Bacteria and Archaea. Several FBA and network models have shown how various reactions are connected and used smaller subsystems to improve production or for finding new drug targets. But in these networks, the pathways present in one particular organism were studied, for example the network for disease associated pathway cluster for Huntington disease ( Kakouri et al., 2019 ) or the network of interacting pathways to find drug targets ( Raman et al., 2005 ; Chen et al., 2016 ). Our study is different from these since we are using data from 29 species of free-living Bacteria and Archaea from diverse environments and metabolic activities and we have formed a network of pathways that are connected to the TTP pathway that is common across the 29 species. This is a novel method to understand how the pathways are interconnected and function in context to each other. We have assessed the variations in the topological properties of the TTP reaction network nodes after adding the neighbouring pathways, in the combined reaction networks. Our results show the contextual variations of the topological properties of the TTP reaction network nodes in the combined network, and study their similarity across bacteria and archaea. Network representation and analysis of metabolic pathways offers a convenient and useful mode for understanding the role of the connectivity patterns of the reaction nodes in interconnected pathways. However, the chemical reactions at each step decide the function of the pathway. Flux Balance Analysis (FBA), a constraint-based approach to model organisms based on mass-energy balance, and flux limitations ( Kauffman et al., 2003 ) are used to understand how the reaction product flux functioned in the pathway. The FBA has been used previously for representing and modeling the growth of many organisms such as, E. coli ( Edwards and Palsson 2000 ; Burgard and Maranas 2001 ), L. lactis ( Flahaut et al., 2013 ), S. coelicolor A3(2) ( Borodina et al., 2005 ), G. oxydans ( Wu et al., 2014 ), etc. We used the FBA to study the effect of mutation or deletion of genes/reactions, present in the TTP pathway and other connected pathways - on the flux through the TTP pathway. This study yielded information on those reaction steps that have a direct effect on the production of aromatic amino acids, in the context of the larger reaction network. Comparing the network and FBA analysis results, we show that, at the systems level, the pathway activities are dependent on a smaller set of reactions that are important for its biochemical activities. This also indicates that a smaller reaction network of the important reactions and enzymes may be chemically engineered for a functional pathway instead of the existing whole metabolic pathway that has evolved through a step-by-step evolutionary historical contingency.",
"discussion": "3 Discussion The important role of “context” has been of long-standing empirical and theoretical interest in biological systems because of their multi-scale and interacting modular structures. Understanding context representations and its interaction with functional outcome in behaviour is an area of immense interest to both neurobiologists and in psychology ( Rudy, 2009 ). In an interesting article, the multi-scale and modular structure of metabolic network was analysed to identify the context in which evolutionary processes may occur ( Spirin V et al., 2006 ). Studies involving molecular interactions of single genes or proteins in the context of their downstream partners and gene context-based modules have been done to evaluate their role in cellular response mechanisms in signalling, amino acids and carbohydrate metabolism pathways ( Lan et al., 2013 ; Bhatt et al., 2018 ). We started with a general question; do the topological features (as studied using network analysis) of a metabolic pathway vary when it is embedded in the larger network of other connected pathways, and does this variation affect the pathway function? We approached to answer this query from a different perspective using two systems biology methods - topological properties (network analysis) and metabolic activity (Flux Balance Analysis) - of the aromatic amino acid biosynthesis (TTP) pathway in many species of Bacteria and Archaea. This pathway consists of quite high energy consuming reactions in the cell. It takes an equivalent of 52, 50 and 74.3 high-energy phosphate bonds for the production of Phenylalanine, Tyrosine and Tryptophan, respectively ( Akashi and Gojobori 2002 ). This energy cost is thus reflected in their usage in the polypeptide chain, and in the metabolic flux passing through the TTP pathway. The control of the production of aromatic amino acids is traditionally done by means of metabolic engineering in organisms such as E. coli and C. glutamicum ( Katsumata and Ikeda 1993 ; Ikeda 2006 ). In these studies, systematic control of genes in the TTP pathway (such as, aroG, aroF, aroH, anthranilate synthase, pheA etc. ), which respond to the production of the end products, were mutated to increase the production of the aromatic amino acids. Here we have looked at the TTP pathway individually, as well as, when embedded at the larger metabolic network in Bacteria and Archaea. Such studies require various sources of genetic and biochemical information, such as, stoichiometry, structure of reaction pathways and alternative routes of reactions, along with genes and genomes of different organisms. The results presented highlight the fact that functioning of a biochemical reaction in the cell is intimately connected to its “context” (i.e., position of the pathway in the total biochemical network), and the topology of its connectivity to the larger set of reactions - both in the pathway and in the larger biochemical network. Based on these analyses we are able to arrive at several conclusions. The Network analysis was undertaken to analyse the changes in network properties of TTP pathway reaction network in isolation and in combination with other pathways directly connected to it through sharing of metabolites as incoming or outgoing reactants. The TTP pathway, which is a predominantly linear and a sparse network, shows a low average degree in all organisms. The nodes in the centre of the network possess high Betweenness and high Closeness Centrality values, while the nodes at the extremities show the opposite characteristics. Out of the many pathways that are connected to the TTP pathway, the 17 pathways that were common among the 29 organisms were considered in this study. The network analysis with all connected pathways in all the organisms showed that - changes in the properties of the 15 TTP reaction network nodes not only depended on the topology of the added network, but also on the nodes to which the pathway was added. The Complete Combined Network (CCN), consisting of the TTP pathway and all the 17 connected networks, showed that the properties of the TTP nodes is not the same when considered in the context of the larger connected network. Nodes with low Degree, Betweenness Centrality or Closeness Centrality, either acquire more connections, or by virtue of the new connections that alter the resulting topology, change their network properties, and become hubs in the CCN. The different Degree, Betweenness Centrality and Closeness Centrality hubs were found for the CCN for all the organisms, and the common hubs were ascertained from them. Hence, analyzing pathways in isolation, and in combination with other networks, gives varying properties to the nodes in the network. How these changes in network topology and parameters of the TTP nodes influence the chemical activity leading to end product formations was analyzed using the Flux Balance Analysis. The Flux Balance Analysis was done to study the flow of metabolites through the metabolic reaction network of the TTP pathway, and to compare it between Bacteria and Archaea, by taking E. coli and M. barkeri as representatives from the two phyla. The flux through TTP is very low in both the organisms with M. barkeri being lower than E. coli . In silico gene deletion studies of TTP pathway genes showed that fluxes in M. barkeri is more resistant to random attack than E. coli , due to the presence of isozymes. In both the organisms, the deletion or reduction of efficiency of the gene for Phenylalanine and Tyrosine production greatly affected the overall flux though the network. Deletion of reactions in the whole network showed that many pathways such as, Glycolysis, Histidine metabolism, etc, affect the production of these aromatic amino acids in both the groups of organisms. There are also differences in the pathways, affecting TTP between Bacteria and Archaea, due to their differences in metabolism, such as the Methanogenesis pathway. A comparison between the network analysis and flux balance analysis of the isolated TTP and CCN of TTP pathways showed that many of the important reaction nodes or “hubs” (in terms of higher network parameters) in the TTP network were common with the essential reactions found by FBA. This points towards identifying a smaller set of reaction steps that can be used for experimental manipulation of the TTP pathway in the cell. This combined Network-FBA approach can be used to predict important reaction steps before attempting any engineering of any pathway for increase or suppression of functionality. Until now, whole genome metabolic networks have been studied by breaking them down into modules using network science ( Alcalá-Corona, et al., 2021 ). This study endeavored to give an integrative view of pathway function and evolution across many prokaryotes, both at a single reaction pathway level, and also when embedded in the larger scheme of biochemical networks. Both the static network approach and the dynamic flux balance analysis offered different perspectives of the same pathway function by arriving at important reaction sets (hubs and essential reactions) that promises to have important applications. Thus, even though the proximate goal of this study (with the PPT pathway as an example) is to understand the contextual role of a specific pathway - in isolation and when embedded in the larger biochemical network of the cell - this approach to study biochemical pathways to understand their systemic properties in the context of biochemical functions inside the cell, may also offer better insight for identifying essential genes, reactions for drug targets, and mutations for improving pathway functions in any organism."
} | 3,860 |
37749227 | PMC9758169 | pmc | 9,492 | {
"abstract": "The previously uncultured phylum “ Candidatus Eremiobacterota” is globally distributed and often abundant in oligotrophic environments. Although it includes lineages with the genetic potential for photosynthesis, one of the most important metabolic pathways on Earth, the absence of pure cultures has limited further insights into its ecological and physiological traits. We report the first successful isolation of a “ Ca . Eremiobacterota” strain from a fumarolic ice cave on Mt. Erebus volcano (Antarctica). Polyphasic analysis revealed that this organism is an aerobic anoxygenic photoheterotrophic bacterium with a unique lifestyle, including bacteriochlorophyll a production, CO 2 fixation, a high CO 2 requirement, and phototactic motility using type IV-pili, all of which are highly adapted to polar and fumarolic environments. The cells are rods or filaments with a vesicular type intracytoplasmic membrane system. The genome encodes novel anoxygenic Type II photochemical reaction centers and bacteriochlorophyll synthesis proteins, forming a deeply branched monophyletic clade distinct from known phototrophs. The first cultured strain of the eighth phototrophic bacterial phylum which we name Vulcanimicrobium alpinus gen. nov., sp. nov. advances our understanding of ecology and evolution of photosynthesis.",
"introduction": "Introduction Geobiology, the discipline that concerns itself with interactions between the Earth’s biosphere and lithosphere and its evolution through geologic time, has made great advances in our knowledge of oligotrophic lithospheric systems, with molecular studies showing the genetic diversity and metabolic potential of microbial consortia as well as unraveling important microbial biogeochemical and metabolic functions in laboratory systems [ 1 ]. However, it has been notoriously difficult to isolate the microbes from natural communities that are necessary to explore diverse microbial processes, how these processes actually function, how they may depend on environmental conditions and how they may have evolved in geological history [ 2 , 3 ]. While these are quite far-reaching scientific goals, isolating difficult to cultivate organisms, especially those found widespread in oligotrophic environments, is important to advance our understanding of geobiology. For example, oligotrophic lithospheric environments likely played a key role in where and how early life on earth evolved and isolation of key organisms would enable their interrogation under realistic conditions in the laboratory. An uncultured phylum “ Ca . Eremiobacterota” (formerly known as WPS-2 or WD272) is an ecologically versatile phylum that apparently thrives under various oligotrophic environments [ 4 ], and includes lineages with the potential for photosynthesis [ 5 , 6 ], and a novel form of chemolithoautotrophy called “atmospheric chemosynthesis” [ 4 , 7 , 8 ]. To date, only “ Ca . Eremiobacterota” among seven currently recognized phototrophic phyla ( Cyanobacteria , Chlorobiota , Actinomycetota , Firmicutes , Proteobacteria , Chloroflexota , and Gemmatimonadota [ 9 – 13 ]) remains uncultured. The ecological importance of this lineage has rendered it a targeted uncultured phylum given prioritization for cultivation attempts among the recent explosion of candidate phyla for characterization [ 14 ]. “ Ca . Eremiobacterota” (WPS-2) was first described in 16 S rRNA gene clone libraries from polychlorinated biphenyl-contaminated soil ( W ittenberg- P olluted S oil) in Wittenberg, Germany [ 15 ], and the phylum name was proposed based on the metagenome-assembled genome (MAG) recovered from Antarctic soil [ 7 ]. Recent metagenomic studies revealed that “ Ca . Eremiobacterota” is globally distributed in terrestrial [ 4 ] and marine environments [ 16 ], animal sources [ 17 ] and industrial wastes [ 17 ]; however, it is abundant in Antarctic bare soils [ 7 , 18 ], Arctic permafrost soils [ 19 ], boreal mosses [ 6 ], and volcanic soils [ 20 ]. Presently (Sep 27 2022), “ Ca . Eremiobacterota” comprise three class-level lineages; “ Ca . Eremiobacteria” [ 5 ], “ Ca . Xenobia” [ 4 ], and “ Ca . Eudoremicrobiia” [ 16 ]. There are two representative order-level taxonomic groups within “ Ca . Eremiobacteria”, “ Ca . Eremiobacterales” [ 5 ] and “ Ca . Baltobacterales” [ 5 ], each of which contain a single family-level group, “ Ca . Eremiobacteraceae” and “ Ca . Baltobacteraceae”, respectively [ 5 ]. “ Ca . Eremiobacterales” includes two candidate genera, and “ Ca . Baltobacterales” includes 16 candidate genera [ 4 ]. Several lineages within “ Ca . Baltobacterales” have a new family of anoxygenic Type II photochemical reaction centers (RCs) that are phylogenetically and structurally distinct from those found in known phototrophs [ 5 , 6 ]. The fumarolic ice caves near the summit of Mt. Erebus (elevation 3794 m), a volcano on Ross Island, Antarctica, comprise one of the most remote dark oligotrophic volcanic ecosystems on the Earth, with minimal human-derived contamination. The ice caves, comprising volcanic rock and weathered sediments, are nutrient-poor, with 0–0.013% (w/w) of total organic carbon [ 21 ], a range comparable to that of the high-altitude volcanoes above 6000 m in the Atacama desert, reported being the best Earth analog for the surface of Mars [ 22 ]. Volcanic gases circulating through the cave atmosphere from vents under the glacier provide a CO 2 -rich and warm environment conducive for the growth of microorganisms [ 21 ]. A previous study of two completely dark ice caves and one cave with seasonally snow-filtered light using the PCR clone library method [ 21 ] revealed that the ice caves contain a high proportion of uncultured members of the “ Ca . Eremiobacterota” with a 33.3% relative abundance, represented by OTU ID #HD1(WD272), #HD2, #HD29, and #HD30 in reference [ 17 ]. We here report the successful isolation, lifestyle, and physiological, genomic, and cell structural characterization of a new phototrophic bacterium belonging to “ Ca . Eremiobacterota” from Warren Cave, a dark fumarolic ice cave in Antarctica. Its potential ecological roles are also discussed.",
"discussion": "Discussion The members of “ Ca . Eremiobacterota” are abundant in Antarctic bare soils [ 7 , 18 ], Arctic permafrost soils [ 19 ], boreal mosses [ 6 ] and volcanic soils [ 20 ], and the MAGs reconstructed from metagenomics include lineages with photosynthetic [ 5 , 6 ] and atmospheric chemosynthetic potentials [ 7 ], suggesting that they are key lineages involved in cycling carbon in “extreme” environments. Despite their ecological importance, no pure cultured “ Ca . Eremiobacterota” is available, seriously hindering accurate characterization of their metabolism, physiology, cell structure, and ecology. This study successfully isolated the first “ Ca . Eremiobacterota” strain in pure culture, strain WC8-2, from a fumarolic ice cave in Antarctica. We investigated its physiology, phylogenetics, cell structure, and genomic traits, revealing that WC8-2 is an AAnP with unique phototrophy-related genes and shows CO 2 fixation ability, phototaxis, and a high CO 2 -requirement. Presumed factors allowing the first successful isolation of “ Ca . Eremiobacterota”, include a low-nutrient medium (10% R2A broth) with gellan gum as a solidifying agent and detecting micro-colonies that appeared inside the cracks under magnification after a long incubation period. The first member of the phylum Abditibacteriota, isolated from Antarctic soil, was similarly observed as a microcolony after 70 days of incubation on a low-nutrient medium [ 57 ]. Furthermore, the first members of the phylum Armatimonadetes were isolated using a solid medium solidified with gellan gum [ 24 ] which has also been used as a solidifying agent to efficiently isolate novel taxa. A monophyletic clade of “ Ca Eremiobacterota” containing WC8-2 is clearly distinct from any other phyla with 100% bootstrap probabilities, which is consistent with the results described previously [ 6 , 7 ]. As shown in Table S 12 , members of the Eremiobacterota show less than 80% pairwise 16 S rRNA gene sequence similarities to those of sister cultured phyla ( Chloroflexota and Armatimonadota ), falling below the median phylum-level 16 S rRNA gene similarity threshold of 83.68% (range 81.6–85.93%) [ 58 ]. Furthermore, as shown in Table S7 , WC8-2 has average amino acid identities (AAI) values less than 41.2% with sister cultured phyla, also falling below the median phylum-level AAI threshold of 46.2% [ 17 ]. These analyses reconfirm that “ Ca . Eremiobacterota” is an independent phylum level lineage in the bacterial domain, affiliated with the Terrabacteria superphylum. As shown in the phylogenetic tree based on 16 S rRNA gene sequences (Fig. S3 ), WC8-2 falls within a clade of the candidate genus “Elarobacter” with “ Ca . Elarobacter winogradskyi” as the closest relative (97.5% 16 S rRNA gene sequence similarity). The genome-based phylogeny also showed that WC8-2 falls within a clade of “ Ca . Elarobacter” with a range of 71.8–78.3% average nucleotide identity (ANI) (Fig. 1 ). Furthermore, the GTDBtk-based identification analysis also assigned the WC8-2 to “ Ca . Elarobacter”. However, “ Ca . Elarobacter” is inferred to be an obligate heterotrophic group with no genetic potential for photosynthesis, CO 2 -fixation, or hydrogen oxidation according to its MAG-based predicted metabolism [ 4 ], which is markedly different from the metabolic potentials of WC8-2. The characteristics are rather similar to the candidate genus “Velthaea” with a versatile metabolic system (Fig. 1 ). Nevertheless, WC8-2 has an ANI value of 72.00% with “ Ca . Velthaea versatilis” (only one species within the genus is in the GTDB at this time), which is below a median genus-level threshold of a 73.11% [ 59 ], and its phylogenomic position is closer to “ Ca . Elarobacter” than to “ Ca . Velthaea” (Fig. 1 ), suggesting that WC8-2 is distinct from “Velthaea” at the genus level. Collectively, it is reasonable to place this strain in a new genus within the candidate family “Baltobacteraceae”. WC8-2 is a mesophilic (13–33 °C) strict aerobe that can heterotrophically grow in a 1–20% oxygen atmosphere, but prefers a capnophilic lifestyle (Fig. S5 ). Growth is clearly promoted with increasing O 2 concentrations in the gas phase, but growth continues to require high CO 2 concentration (Fig. S5 ). Growth in a wide range of oxygen concentrations may be enabled by cbb3-type cytochrome c oxidase and cytochrome bd quinol oxidase genes for the respiratory complexes I–IV associated with aerobic respiration under O 2 -limited conditions [ 60 ]. The WC8-2 genome encodes many branched-chain amino acids (e.g., leucine, isoleucine, valine) and transporters (LivKHGMF) (Fig. 2 and Table S8 ), suggesting it possesses a well-developed metabolic system that utilizes extracellular branched-chain amino acids. However, WC8-2 was not able to utilize these branched-chain amino acids as sole carbon sources for growth (Fig. S5 ). These phenotypes endow WC8-2 with a high adaptability to fumarolic environments given the ubiquitous existence of warm temperatures (15 °C, WC8), a high CO 2 concentration (~2.9% v/v) and 0.1–23.8% O 2 in Warren Cave [ 61 ]. The WC8-2 genome encodes an anoxygenic Type II RC, a complete set of BChl a biosynthesis genes, and a complete set of genes for the CBB cycle (type IE RuBisCO). For potential oxidative energy to drive the CBB cycle, WC8-2, as well as members of “ Ca . Eremiobacter,” “ Ca . Tityobacter,” and “ Ca . Nyctobacter,” possess HhyL-encoding genes, suggesting that members have the potential for “atmospheric chemosynthesis” [ 4 ]. Diverse members of “ Ca . Eremiobacterota” MAGs also possess coxL, the gene encoding one of the subunits of aerobic carbon monoxide dehydrogenase involved in oxidizing atmospheric CO [ 7 , 62 ] (Fig. 1 ). Although WC8-2 possesses CoxL homologs (WPS_11190 and WPS_30380), the active site, CSFR [ 63 ], is not found in the sequences. Moreover, the WC8-2 genome encodes a complete Sox system involved in thiosulfate oxidation (Fig. 2 and Table S8 ). Despite such genetic potential, no photolithoautotrophic or chemolithoautotrophic growth was observed using H 2 , sodium thiosulfate, or sodium sulfide as electron donors. It remains possible that the conditions for lithoautotrophic growth were just not found in this study. Importantly, WC8-2 produces bacteriochlorophyll a and illumination markedly enhanced its growth and BChl a production under heterotrophic conditions using Basal_YE (Fig. 4C ). Furthermore, light upregulates BCh synthesis-associated bchM expression in WC8-2 during exponential growth in Basal_YE (Fig. 4D ). Such features clearly indicate that this bacterium is a BChl a -based photoheterotroph, but the electron donor could not be identified in this study. On the other hand, the C isotope ratios (δ 13 C) of WC8-2 cells grown in Basal_YE under light or dark conditions with isotope-labeled 13 CO 2 were 2279.4 ± 719.9‰ and 1602.2 ± 572.8‰, respectively, with no significant difference, but significantly higher than that of non-labeled WC8-2 cells (Table 2 ). These values are comparable to δ 13 C values 1540–1677‰ for CO 2 -fixation via 3-hydroxypropionate/4-hydroxybutyrate in the bacterium Metallosphaera yellowstonensis grown with 13 CO 2 in the presence of yeast extract, but not nearly as high as δ 13 C values of the cells (71,500–80,637‰) grown in the absence of yeast with 13 CO 2 [ 64 ]. This result suggests that WC8-2 may be able to utilize low levels of inorganic carbon under heterotrophic conditions. Interestingly, WC8-2 expressed cbbL during exponential growth in Basal_YE under both light and dark conditions, but there was no significant difference in relative expression, suggesting that the CBB cycle is not driven by light under heterotrophic conditions. This CO 2 -fixation could be driven by trace hydrogen molecules or sulfur compounds, but given there was no autotrophic growth in the mineral medium without organic carbon and WC8-2 possesses the phosphoenolpyruvate carboxylase gene (WPS_26910), it is more likely CO 2 fixation occurs via anaplerotic pathways to replenish the citric acid-cycle under nutrient-poor conditions rather than the CBB cycle [ 65 ]. The expression of cbbL is unexplained but may not be functional; further molecular enzymatic studies are needed to identify the CO 2 -fixation pathways. Taken together, WC8-2 is a unique photoheterotroph and a chemoheterotroph with a potential for CO 2 -fixation; we speculate that light energy did not drive the CO 2 -fixation but was used as an auxiliary energy source to activate metabolism, thereby stimulating growth under the light conditions. Phototaxis allows WC8-2 to seek optimal conditions for its lifestyle through gliding motility with type IV pili on solid surfaces. Interestingly, it is phototactic towards blue, green, and red light (γP 470, 527, and 624 nm). Diverse bacteria such as cyanobacteria, purple bacteria, and haloarchaea are also phototactic, but lineages that are phototactic in blue light are rare due to avoidance of UV light [ 66 ]. The WC8-2 genome contains genes homologous to a photoactive yellow protein (WPS_26150) and rhodopsin (WPS_12390), both known as photoreceptor genes; however, the functions of the WC8-2 genes have not been identified. Surprisingly, this strain showed positive phototaxis over 4–30 °C, even though it did not grow below 10 °C. All of these properties may be adaptations to using snow-filtered sunlight in polar and alpine areas, as the wavelengths that pass through snow with maximum transmittance are between 450 and 550 nm [ 67 ]. In addition, they could offer a survival advantage in polar volcanic regions, where sunlight and temperature vary dramatically, moving on rock surfaces to seek light. The question arises: why did this “ Ca . Eremiobacterota” lineage acquire photosynthetic functions during evolution, even though its habitat, Warren Cave, is completely dark? Although light may be an important energy source for some “ Ca . Eremiobacterota” lineages, it is clearly not important to all (Fig. 1 ). This may explain why there is no clear pattern in the apparent abundance of “ Ca . Eremiobacterota” associated with the light regime of the caves (Fig. S1A , Table S1 and S5 ). For example, Harry’s Dream is exposed to seasonal light and has a relatively high abundance of 16 S rRNA gene amplicon reads, but other caves with similar seasonal light regimes (Haggis Hole, Hut Cave and Heroine Cave) had a lower abundance. Conversely, Mammoth Cave, which is dark, had a relatively high abundance of “ Ca . Eremiobacterota” sequences. It is likely that traits other than photosynthesis, such as the ability to gain energy from inorganic sources (e.g., H 2 or sulfur compounds) and a dependence on high CO 2 atmospheres are what determines the growth and survival of “ Ca . Eremiobacterota” in the caves. In addition to the environmental conditions that control the growth of WC8-2-like organisms in situ, we have to consider where they may have come from. The caves on Mt. Erebus form a dynamic network with possible interconnections between them that open and close depending on the volcano’s activity. Additionally, the volcano periodically spews volcanic rocks and ash that fall onto the surface of the snow and ice. This material becomes buried by additional snow and ice and as the ice melts from inside the caves it eventually is deposited to the sediments and soils found in the caves. Any microorganisms attached to this material will likely have been exposed to seasonal sunlight at some time in their history which may also explain why some organisms in the dark caves have photosynthetic abilities. WC8-2 cells contain acidocalcisomes and PHA (Fig. S8 ), which are involved in energy storage and starvation acclimation, respectively [ 54 , 56 ], and its genome encodes trehalose biosynthetic and betaine/glycine transporter genes (Fig. 2 and Table S8 ), which are involved in adaptation to low-temperature environments [ 68 , 69 ]. These features may help WC8-2 survive in the polar, oligotrophic and fumarolic environments of Mt. Erebus where slight differences in position can cause steep gradients in energy source (chemical and light) and temperature [ 70 ]. WC8-2 has uncharted Type II RC (PufL and PufM) and BChl synthesis proteins that form a deeply branched monophyletic clade with other putative phototrophic “ Ca . Eremiobacterota” and distinct from known phototrophs (Fig. 3 ). The phototrophy-related genes were likely transferred and scattered within the phylum Eremiobacterota, expanding the phototrophic lineages within this phylum [ 5 ]. As the directionality of transfers and the relationships among the deep branches remain ambiguous in many cases, the origin and history of the photosynthetic evolution of “ Ca . Eremiobacterota” is difficult to conclude with current data alone. Interestingly, the WC8-2 genome and “ Ca . Eremiobacterota” MAGs possibly encode a BchI and BchD fused protein. The BchID-fused protein contains ATP-binding Walker A and Walker B motifs for BchI, and a C-terminal Von Willebrand factor type A (vWA) domain [ 71 ] for BchD. Generally, phototrophy-related genes in Proteobacteria are positioned in a coherent group in the genome as a “photosynthetic gene cluster” (PGC) [ 72 ]. The phototrophy-related genes of WC8-2 are more widely distributed throughout its genome than those of Proteobacteria, with non-photosynthetic genes mixed in with the WC8-2 PGCs, but they are relatively grouped without the Mb-class long inserts found in the Chloroflexota and Chlorobiota PGCs (Fig. S2 ) [ 73 ]. The WC8-2 PGC contained gene sub-clusters bchM-acsF, bchNBGP, bchFCXYZ, and puf operon (puf BALMC). The gene arrangement bchM-acsF in WC8-2 is also found in Chlorobiota [ 73 ], Firmicutes [ 13 ], and “ Ca . Eremiobacterota” MAGs (“Velthaea” and “Hemerobacter”) [ 5 ], and the operon pufBALMC is one of the common sub-clusters in phototrophic Proteobacteria [ 74 ]. Sub-clusters bchNBGP and bchFCXYZ are also found in “ Ca . Eremiobacterota” MAGs (“Velthaea” and “Hesperobacter”) [ 5 ] and located downstream of bchL with several non-photosynthetic genes. Characteristically, a gene encoding a RuBisCo-like protein (type IV_deep cluster) is embedded between sub-clusters bchNBGP and bchL. The role of type IV RubisCO-like proteins is still unknown [ 75 ]. This arrangement and orientation are unusual features of other anoxygenic phototroph PGCs, but they are somewhat similar to that of Blastochloris , where some genes encoding CBB cycle proteins are embedded in the PGC [ 76 ]. WC8-2 is the third cultured phototrophic phylum based on Type II RC since its discovery in Chloroflexota about half a century ago [ 77 ]. We believe that this AAnP culture in “ Ca . Eremiobacterota” will enable the identification of the three-dimensional structures and functions of the phototrophy-related proteins. Our research has shown that the first cultured “ Ca . Eremiobacterota” strain WC8-2 is metabolically versatile, capable of growing both photoheterotrophically and chemoheterotrophically and thrives in fumarolic ice caves; produces BChl a , PHA, and acidocalcisomes; fixes CO 2 , possibly autotrophically (has the complete CBB cycle); displays high CO 2 demand, phototaxis with type IV pili, and is adapted to polar and oligotrophic fumarolic environments. The genome encodes novel RC and BChl synthesizing proteins, forming a deeply branched monophyletic clade distinct from known phototrophs. The metabolic versatility displayed by WC8-2 is likely an adaptation strategy that helps it to adjust to rapidly changing conditions in oligotrophic environments. Metabolic versatility appears to be a feature common to organisms thriving in a range of different oligotrophic environments, for example microbes colonizing deep-sea basalt associated with hydrothermal vents and desert environments [ 78 – 81 ]. Based on this polyphasic characterization, we propose strain WC8-2 as a new species and a genus, Vulcanimicrobium alpinus gen. nov., sp. nov. Based on the phylogenetic and phylogenomic analyses, we further propose a new phylum Eremiobacterota phy. nov. Description of Vulcanimicrobium gen. nov Vulcanimicrobium (Vul.ca.ni.mi.cro.bi.um. L. masc. n. Vulcanus, the Roman god of fire; N.L. neut. n. microbium, a microbe; from Gr. masc. adj. mikros, small; from Gr. masc. n. bios, life; N.L. neut. n. Vulcanimicrobium, a microbe living in volcanic areas). Aerobic but a high CO 2 -requirement, Gram-negative, phototaxis, non-spore- forming heterotroph. The major cellular fatty acids are iso-C14:0 (33.9%), iso-C14:0-3OH (16.5%) and iso-C13:0-3OH (11.0%). The major respiratory quinone is menaquinone-9 (MK-9) (Table 1 ). The polar lipids consisted of an unidentified polar lipid, four unidentified glycolipids, and seven unidentified lipids. DNA G + C content of the type species is 68.4 mol%. The type species is Vulcanimicrobium alpinus . Description of Vulcanimicrobium alpinus sp. nov Vulcanimicrobium alpinus (al.pi’nus. L. masc. adj. alpinus, alpine, referring to the isolation of the type strain from an alpine environment). Shows the following characteristics in addition to those given for the genus. Cells are a rod or filament with 0.5–0.7 μm diameter and 1.5–92.0 μm long with pili. The colonies are tiny and red-pigmented in stab cultures. Cells grow heterotrophically under aerobic conditions, but do not grow lithotrophically with 5 mM Na 2 S or Na 2 S 2 O 3 or 1% H 2 (v/v; in the gas phase) as electron donors under either aerobic or anaerobic conditions with 5 mM Na 2 SO 4 , NaNO 3 , or dimethyl sulfoxide as electron acceptors. Produce bacteriochlorophyll a . Grows at 13–33 °C (optimally at 30 °C), at pH 4.5–8.0 (optimally at pH 6.0) and tolerated 0.1% (w/v) NaCl. WC8-2 utilized yeast extract, but was not able to utilize d -glucose, d -ribose, maltose, l -leucine, l -isoleucine, l -valine, l -serine, l -lysine, taurine, and gellan gum. Growth is enhanced under light. The type strain, WC8-2 T (=DSM 115291 T = BCRC 81314 T = NBRC 115847 T ), was isolated from a sediment derived from Warren Cave, fumarolic ice cave, in Mt. Erebus volcano (Antarctica). Description of Baltobacteraceae fam. nov Baltobacteraceae (Bal.to.bac.te.ra.ce’ae. N.L. masc. n. Baltobacter an original Candidatus generic name; from N.L. fem. n. balte , swamp; from N.L. masc. n. bacter , rod; - aceae ending to denote a family; N.L. fem. pl. n. Baltobacteraceae the Baltobacter family). The description is the same as for the genus Vulcanimicrobium . Type genus is Vulcanimicrobium . Description of Baltobacterales ord. nov Baltobacterales (Bal.to.bac.te.ra’les. N.L. masc. n. Baltobacter an original Candidatus generic name; - ales ending to denote an order; N.L. fem. pl. n. Baltobacterales the Baltobacter order. The description is the same as for the genus Vulcanimicrobium . Type genus is Vulcanimicrobium . Description of Eremiobacteriia class. nov Eremiobacteriia (E.re.mi.o.bac.te.ri’i.a. N.L. neut. n. Eremiobacterium , an original Candidatus genus; from Gr. fem. n. erêmia , desert; from N.L. neut. n. bacterium , a rod; N.L. neut. pl. n. suff. - ia , ending to denote a class; N.L. neut. pl. n. Eremiobacteriia , the Eremiobacterium class. The description is the same as for the genus Vulcanimicrobium . Type genus is Vulcanimicrobium . Description of Eremiobacterota phyl. nov Eremiobacterota (E.re.mi.o.bac.ter.ae.o’ta: N.L. masc. n. Eremiobacter , an original Candidatus genus; suff. - aeota ending denoting a phylum; N.L. pl. neut. n. Eremiobacterota the Eremiobacter phylum). The description is the same as for the genus Vulcanimicrobium . Type genus is Vulcanimicrobium ."
} | 6,484 |
37333310 | PMC10274702 | pmc | 9,493 | {
"abstract": "Neural circuits with multiple discrete attractor states could support a variety of cognitive tasks according to both empirical data and model simulations. We assess the conditions for such multistability in neural systems, using a firing-rate model framework, in which clusters of neurons with net self-excitation are represented as units, which interact with each other through random connections. We focus on conditions in which individual units lack sufficient self-excitation to become bistable on their own. Rather, multistability can arise via recurrent input from other units as a network effect for subsets of units, whose net input to each other when active is sufficiently positive to maintain such activity. In terms of the strength of within-unit self-excitation and standard-deviation of random cross-connections, the region of multistability depends on the firing-rate curve of units. Indeed, bistability can arise with zero self-excitation, purely through zero-mean random cross-connections, if the firing-rate curve rises supralinearly at low inputs from a value near zero at zero input. We simulate and analyze finite systems, showing that the probability of multistability can peak at intermediate system size, and connect with other literature analyzing similar systems in the infinite-size limit. We find regions of multistability with a bimodal distribution for the number of active units in a stable state. Finally, we find evidence for a log-normal distribution of sizes of attractor basins, which can appear as Zipf’s Law when sampled as the proportion of trials within which random initial conditions lead to a particular stable state of the system.",
"introduction": "1. Introduction An extensive literature in neuroscience suggests that neural activity can proceed through sequences of distinct states during sensory processing, motor output, or memory-based decision making ( Abeles et al., 1995 ; Benozzo et al., 2021 ; Escola et al., 2011 ; Jones et al., 2007 ; La Camera et al., 2019 ; Mazzucato et al., 2015 ; Miller, 2016 ; Morcos & Harvey, 2016 ; Rainer & Miller, 2000 ; Seidemann et al., 1996 ). The distinct states are revealed as patterns of neural activity that remain relatively stable for durations much longer than those of the rapid transitions between states. Models of the underlying circuitry assume the states correspond to fixed points (or the remnants of fixed points) of the system ( Ballintyn et al., 2019 ; La Camera et al., 2019 ; Mazzucato et al., 2019 ; Miller, 2013 ; Miller & Katz, 2010 ; Rabinovich et al., 2001 ; Rabinovich et al., 2014 ; Recanatesis et al., 2022 ; Taylor et al., 2022 ) with the itinerancy from fixed point to fixed point known as latching dynamics ( Boboeva et al., 2021 ; Lerner et al., 2012 , 2014 ; Lerner & Shriki, 2014 ; Linkerhand & Gros, 2013 ; Russo & Treves, 2012 ; Song et al., 2014 ; Treves, 2005 ). Transitions between fixed points can be due to their inherent instability when they are saddle points. Otherwise, in networks where a reduced model of the system possesses multiple stable fixed points, transitions arise from one or more of (1) an external stimulus, (2) noise fluctuations, or (3) the drift of a slow variable which impacts a parameter in the reduced model causing it to cross a bifurcation point. Since the number of stable fixed points becomes a key indicator of the potential information processing or memory capacity of the network, it is important to understand the conditions under which a system possess multiple stable fixed points. Here we use firing-rate models ( Wilson & Cowan, 1973 ), in which each unit represents a cluster or assembly of similarly responsive neurons with stronger connections within each cluster as observed in some cortical circuits ( Perin et al., 2011 ; Song et al., 2005 ). Such assemblies can arise in response to a lifetime of stimuli via Hebbian plasticity ( Hebb, 1949 ), which increases connection strengths between excitatory neurons with correlated activity ( Bourjaily & Miller, 2011 ; Brunel, 2003 ). We assume random interactions between such clusters ( Stern et al., 2014 ), representing the result of a history of uncorrelated stimuli. Each isolated stable fixed point in a system is an attractor state, with a basin of attraction determined by the set of initial conditions that result in neural activity settling at (after being “attracted to”) the fixed point. Systems with many such attractor states have provided the framework for understanding pattern completion and separation of new inputs following memory encoding of stimuli, since the highly influential work of Hopfield and others ( Anishchenko & Treves, 2006 ; Battaglia & Treves, 1998 ; Hopfield, 1982 ; Hopfield, 1984 ; Treves, 1990 ; Zurada et al., 1996 ). Indeed, there is abundant evidence of such attractor states in neural circuits ( Daelli & Treves, 2010 ; Fuster, 1973 ; Goldberg et al., 2004 ; Golos et al., 2015 ; Wills et al., 2005 ), perhaps most obvious to us when an ambiguous stimulus can cause perceptual alternation due to activity flipping between two (quasi-stable) attractor states ( Moreno-Bote et al., 2007 ). However, while the number of stable states in systems such as the Hopfield network ( Hopfield, 1982 ; Hopfield, 1984 ) have been characterized ( Amit et al., 1985a , 1985b ; Folli et al., 2016 ), the connections between units in such networks are correlated (in fact, the connectivity matrix is symmetric), so it is unclear to what extent multiple attractor states would arise in a nonsymmetric random network. Work by others ( Stern et al., 2014 ) showed that when each unit has sufficient self-excitation to become bistable (and therefore become in essence a memory element in of itself) multiple attractor states are possible in a network with non-symmetrically randomly connected units. Such a result is trivial in the limit of zero cross-connection strength, in which case a system of N bistable units possesses 2 N stable states. In the randomly connected system, studied in the large- N limit, increased strength of random cross-connections decreases the number of multistable states, eventually rendering the system chaotic as all fixed points become unstable. With weaker self-connections, the network would be either quiescent or, given sufficient cross-connection strength, chaotic ( Sompolinsky et al., 1988 ). Here we find that such results depend on the form of the input-output function (the firing-rate, or f-I curve) of a neuron. Indeed, if we assume neurons have low firing rates in the absence of input, random non-symmetric cross-connections can lead to multistability, even when individual units have zero self-excitation. In the following sections, we first present simulations showing the types of activity possible and their observed coexistence in networks of up to 1000 randomly coupled units. We then show the phase diagrams in the large- N limit of such systems. Finally, we present results for systems with binary activation functions, for which we develop an alternative mean-field analytic approach that we use for finite- as well as infinite- N systems. Also, given the more rapid simulations when activations are binary, we provide a more thorough analysis of the attractor states in such systems.",
"discussion": "5. Discussion Firing rate models of neurons are valuable because they represent the likely states of a neural circuit in a relatively simple manner and can be solved rapidly. The foundation of a firing rate model is the input-output function of a neuron, which is typically designed to have bounded outputs over the domain of inputs. For its ease of mathematical manipulation, the hyperbolic tangent function, f ( x ) = t a n h ( x ) , has been used with great success, most notably for first demonstrating the transition from quiescence to chaos as the strength of random cross-connections increases ( Sompolinsky et al., 1988 ; Stern et al., 2014 ). The negative portion of t a n h ( x ) , while it cannot correspond to negative firing rates, could be considered representative of a group of mixed excitatory-inhibitory neurons in which the mean rate of inhibitory neurons exceeds that of excitatory neurons. Given the function f ( x ) = t a n h ( x ) is simply a translated version of the function f ( x ) = t a n h x - x t h + 1 , one might expect that analysis of a system with units responding via the one function would provide all the qualitive insight necessary to understand the behavior of a system with units responding via the other function. However, this is not the case. A disconnect between the behavior of a system of neurons with f ( x ) = t a n h ( x ) and that of a system with f ( x ) = t a n h ( x ) + 1 has been shown by others ( Figure 4b of ( Touboul & Ermentrout, 2011 )) whereby a Hopf bifurcation disappears as the input-output function of neurons is parametrically shifted up toward non-negative values. In our analyses, we find two qualitative changes. The first is a shift in phase boundaries leading to the result that random cross-connections, whose mean value is zero, can produce multistability in a system in which single units are not in of themselves bistable. Second, we find the possibility of bistability via distinct stable solutions for the self-consistency of the field. Alternative self-consistent solutions of the field can lead to multistability arising from random, zero-mean, cross-connections even in systems without self-connections ( Figure 3 and Figure 6B ). The distinct self-consistent field solutions, with different variances in the input currents, correspond to states with distinctly different numbers of active units. Figure 9 indicates a similar bimodality in the numbers of active units in simulated binary-unit systems and is coupled with an analysis of how such bimodality arises in the system. We find a subtlety when taking the infinite limit of our system using the logistic input-output function, with a strict discontinuity between results with g = 0 and those with g = ϵ (where g scales the strength of cross-connections and ϵ is an infinitesimal positive quantity). The reason being that for non-zero g , there is a non-zero (even if miniscule) probability that the within-circuit input to a unit, which is drawn from a Gaussian with width proportional to g , is sufficiently strong to render that unit bistable. However, when the bifurcation point is many tens of standard deviations above the zero mean of the Gaussian distribution, the probability becomes infinitesimal and is irrelevant in any real or simulated system, even with billions of units. For similar reasons, the strict mathematical limit has a discontinuity when altering the width of the logistic function from Δ = 0 to Δ = ϵ . If, instead of producing a phase diagram, with a sharp boundary for multistability, we focused on the entropy of the system (the log of the number of stable states) scaled by system size, N , such discontinuities would disappear as the entropy would reduce continuously and smoothly (and rapidly) from the boundaries of multistability shown in Figure 6 , to a tiny value before becoming strictly zero at g = 0 or Δ = 0 . Multistability, when exhibited as a set of discrete stable fixed points, may seem unlikely in any cortical circuit given that activity is never static in vivo. However, a network based on multiple fixed points, but with randomly timed transitions between them, can match the observed data in a number of systems ( Ballintyn et al., 2019 ; Ksander et al., 2021 ; La Camera et al., 2019 ; Mazzucato et al., 2019 ; Miller, 2016 ; Miller & Katz, 2010 ; Moreno-Bote et al., 2007 ; Recanatesis et al., 2022 ). Moreover, analyses of patterns of neural spiking in vivo have, in many cases, shown that a discrete state-based formalism better matches the data than a formalism assuming continuously changing, graded activity ( Abeles et al., 1995 ; Miller & Katz, 2010 , 2011 ; Ponce-Alvarez et al., 2012 ; Sadacca et al., 2016 ; Seidemann et al., 1996 ). While the strengths of connections between units are treated as independent random variables for ease of analysis in this paper, in practice there is internal structure in the connectivity among neurons, even between excitatory pyramidal cells ( Song et al., 2005 ; Stepanyants & Chklovskii, 2005 ). Moreover, connections from cortical neurons typically have fixed sign (all excitatory or all inhibitory) according to neuron class, a feature that can change the behavior of random networks ( Rajan & Abbott, 2006 ). In our work, we consider a firing rate model unit as representing the mean rate of a cluster of many neurons (as is necessary to omit the pulsatile spike interaction from simulations) so the net interaction between units can be of either sign according to whether the dominant connections are excitatory-to-excitatory, or excitatory-to-inhibitory, etc. Moreover, much of the nonrandom cortical structure can be accounted for by considering the intra-cluster connectivity to be distinct from the intercluster connectivity ( Bourjaily & Miller, 2011 ) as we do here. Our main conclusion is that multistability can be produced via random, zero-mean cross-connections in neural circuits without the exceptionally strong self-connections needed to produce bistability in a single cluster of neurons (a unit in a firing-rate model) so long as the neurons without input have a low firing rate and if rate increases supralinearly with low input."
} | 3,383 |
35903416 | PMC9328748 | pmc | 9,497 | {
"abstract": "The bio/sensors performance has been established to be significantly affected through partially or entirely alignment of nano/microfibrous in polymeric mats. The matter of crystalline/amorphous proportion in semicrystalline polymers is another factor that can affect the application of the piezoelectric patches. The present work deals with fabricating the scaffolds of micro/nanofibers through a modified electrospinning procedure. The ratio of the relevant organic and polar solvents, the beading, the degree of fiber alignment, and fiber thickness have been intentionally elaborated. An unaligned unbeaded nanofibrous mat has been fabricated after tuning the solvents to poly-lactic acid ratio. This paper, for the first time, deals with the calculation of the value of d 33 value of a commercial PLA and its improvement, it has been revealed that the d 33 piezoelectric property is improved as a consequence of the thermo-mechanical processing above the cold crystallization temperature. The applied thermo (mechanical) processing causes the structural evolution from amorphous to crystallized states. Formation of the α and α′ crystalline phases is introduced as the main responsible for the improvement of the piezoelectric property. This improvement not only is correlated with the degree of crystallinity, but also the orientation and alignment of the crystallites is known to be influential. In this respect, the complex helical chain structural evolution of poly-lactic acid has been analyzed through Herman's orientation function. It has been found that, besides the characterized disorder-to-order phase transformation, the C=O branched out dipoles interactions significantly affects by the texturization of the aligned polymeric chains in the direction of the electrospinning which is known as the main factor to promote the piezoelectric property of processed mat.",
"conclusion": "4. Conclusion In this paper, the PLA scaffolds d 33 piezo constant for the first time and its promotion regarding the crystallization induced through thermo-mechanical processing was measured. Annealing at 105 °C for 12 h resulted in the formation of both the disordered-α′ and ordered-α crystalline phases by the crystallinity percentage of 20% and 27%, respectively; a total crystallinity percentage of 47%. Creep-induced crystallization at 150 °C for 12 h was investigated, it resulted in the formation of the α phase holding higher crystallinity of about 59%. It was concluded that any thermal process above the cold crystallization temperature induced an appreciable crystallinity percentage up to 59%. Analyzing Herman's orientation function and texture evolution showed that the one-step annealing provided an appropriate condition for randomly oriented crystallites. In contrast, two steps of annealing resulted in a more texturized microstructure along the electrospinning direction. In one step annealed samples, piezoelectricity did not show a sharp increasing trend in comparison to un-treated scaffolds, while texturization in two steps-annealed patches caused a dramatic promotion of the d 33 piezoelectric value from 0.078 fc/N to 0.21fc/N.",
"introduction": "1. Introduction Considering the electroactive biopolymers following the potential to transduce mechanical and electrical energy, Poly-Lactic Acid (PLA) has drawn the researchers' attention. This is attributed to the non-centrosymmetric complex structure of PLA, as a Food and Drug Administration (FDA)-approved polymer, which has the potential to be studied in the course of piezoelectricity [ 1 , 2 ]. An individual chain, in polymer structure, may be non-centrosymmetric, but the amorphous network will be highly isotropic, which diminishes the probability of piezoelectricity. Interestingly, this type of centrosymmetric has been removed in amorphous PLA; therefore, the PLA shows piezoelectricity even in its non-crystalline state [ 3 , 4 ]. It has been proved that crystallization would improve the non-centrosymmetric structure. Among the 32 crystallographic point groups, 21 of them do not possess inversion symmetry which are the crystalline state of the polymers [ 2 ]. PLA crystallizes into four distinct phases, among them α’ with pseudo hexagonal unit cell and α with an orthorhombic crystalline structure [ 5 ]. Achieving an utterly crystallized structure is impossible in polymers; in the meanwhile of crystallization, crystalline regions will grow within the amorphous matrix, and on average, these crystallites will exhibit a randomly oriented distribution [ 6 , 7 ]. Among the various procedures improving the non-centrosymmetric structure, stretching is a common method [ 8 ]. Polymers possessing handedness, those with helical conformation as a consequence of chiral monomer units, can contain a mirror plane perpendicular to its drawing axis, and thus because of the breaking of the mirror plane by the helical twist, the piezoelectricity can be improved [ 9 ]. Another promising method which can be used to promote the anisotropy is electrical poling, through which a large tendency of dipole alignment is achieved within the structure. This is only applicable in the case of ferroelectric materials where the polarization is spontaneous and reversible [ 10 ]. Piezoelectricity defines as the physical properties of the materials containing the dipole groups which do not cancel each other within the microstructure of the complex material's structure. There are many PE constants regarding the type of normal or shear piezoelectricity and direct or diverse piezoelectricity; in order to provide an appropriate portrayal to them, Fig. 1 is presented. There are two diverse types of piezoelectricity; Normal and shear. Normal PE assigns to the materials that react to the employed force straightly. When the structure deforms in X, Y, or Z directions, the electrical charge concentrates on one of the suggested directions of the specimen. When an excitation charge employs the unit, volume growth appears in the same way. The shear piezoelectricity issues into the statement in materials that twist the sample in acknowledgment of the electrical stimulation [ 11 ]. Stretching the polymer adjusts the amorphous strands in the film/fiber plane and promotes uniform rotation of the crystallites by an electric field. Depending on whether stretching is uniaxial or biaxial, the electrical and mechanical properties are either highly anisotropic or isotropic in the plane of the polymer sheet. Polymer poling can be accomplished using a direct contact method or a corona discharge. In this fashion, one of the favorite techniques is ES. During the ES process, speedy solvent drying constitutes an amorphous structure of oriented fibers; increasing the crystallinity is more comfortable by the secondary hot drawing process. By diminishing the fiber diameter, more surface area is achieved, and thus, the glass transition and melt temperature inconsiderably wane [ 12 ]. In the case of PLA, the d 14 PE constant has been studied chiefly, and it has been demonstrated that the order of constant ranges between 9 and 11 pc/N [ 13 , 14 ]. In comparison, post-treatment such as annealing or further thermomechanical process has the potential to increase this PE constant approximately near to 20 pc/N [ 15 ]. There is a huge lack of knowledge around the calculation of the PLA PE d 33 constant and its fluctuation as a result of the thermo-mechanical process. The most well-known PLA PE constant is defined as d 14 . Throughout the experimental measurements of research from Occhiai et al. on 0-cut PLLA, carrying side along z-axis which also was their elongation axis, samples manifested these cases had a d 14 PE coefficient equal to 9.82 pC/N [ 16 ]. The piezoelectricity not only is sensitive to the glassy transition behavior, but also is a function of crystalline/amorphous structure characteristics. It has been [ 17 ] illustrated that the amorphous region will contribute to the piezoelectricity just if the molecular chains follow some degree of alignment at least. On the one hand, chirality and helical PLA conformation provide a proper condition for the presence of piezoelectricity even in the absence of any further processing; thus, simply aligning the polymer chains is sufficient to remove any centrosymmetric and permit piezoelectricity [ 18 ]. In this respect, the thermo-mechanical processing is highly capable to change the alignment of polymeric chains accommodating the applied stress. This significantly reorganizes the crystalline regions embedded within the amorphous matrix and improves the non-centrosymmetric structure. As a semicrystalline polymer, the crystallization process and crystal structure of PLA have been studied by various groups. PLA has the potential to experience four kinds of crystal modification, where α, α’, β, and γ phases are formed under the different preparation process [ 19 - 22 ]. The most thermodynamically stable phase, α form, has a 10 3 helical chain conformation [ 23 ] which can crystallize from melt or solution and mainly differentiate from the α′ form. The α′ form crystallizes at temperatures below 120 ° C and is known to be the disorder form of α, while the α form achieves above this disorder to order transformation temperature [ 19 ]. In another opinion, PLA is not classified as a ferroelectric material, and uniaxial arrangement would serve sufficient to compromise its natural piezo-response. Therefore, because of the original PE characteristics of the PLA, no additional fabrication manner more further than the stretching approach, which is essential to provoke uniaxial oriented chains, is expected. Influencing the piezoelectricity is also feasible by polymer thermally stretching; by this process, the phase transition from α′ to α springs, and so on, a switch from randomly oriented molecular chains to aligned chains might be achieved [ 24 ]. In helical PLA molecule chains, shear strain in the direction of the helix axis insignificantly twists the permanent bond dipoles and thus alters the polarization perpendicular to the plane of shear strain [ 25 , 26 ]. One of the disadvantages in this field is the PLA magnitude of piezoelectricity, which is much lower compared with most of the other PEs; solving this drawback, savants, on the one hand, inaugurated to invent hybrid biomaterials and, on the other hand, concentrated on phase transitions and stabilizing them. The convention magnitude between mechanical applied deformation and the electricity generated charge is a function of the PE constant [ 27 ]. Coming to the point, the formation of crystalline phases and its effect on d 14 piezoelectric outcome has been presented in the previous literature, but it's the first time that the PLA 2003D is being analyzed to understand the d 33 piezoelectric outcome of the mats. In this respect, electrospinning is considered as the best fabrication procedure to induce piezoelectricity in PLA ECM mimicking mats. The high shear force is applied to the chains which is expected to stimulate C=O dipoles to be oriented even in an amorphous structure. In fact, PLA is not a ferroelectric polymer, but it shows piezoelectricity even in amorphous state while inducing a partially long-range ordering of the chains through thermo- and/or mechanical work. The current work also explores the impact of crystallite orientation on the piezoelectric property. As a side benefit, regarding the fabrication of interconnected porous mats; in addition to what has already been denoted, a micro-aligned mat, or nanoscale fibers possess a tremendous potential to be used as artificial organs or at least a base for migration of the immature cells to the cells which are dead or can't perform their duty.",
"discussion": "3. Result and discussion 3.1. Piezoelectricity (d 33 ) of the mats It has been demonstrated that by ES and the fabrication of micro/nanofibers, the PE performance of the non-ferroelectric materials, especially PLA, increases [ 31 ], in this way, it is essential to have smooth and thin homogenously distributed fibers with the absence of beaded regions in them, which is a result of various variables [ 32 , 33 ], namely; the type of solvents, the proportion of solvent and polymer, the humidity and also the atmosphere temperature, the ES applied potential and also the collector to nuzzle distance all are demonstrated in Fig. 2 . As it is depicted in Fig. 3 , an appropriate selection of solvents DMF and DCM results in the formation of mostly beadles fibers, where the fibers have not been aligned because of the low number of drum rotation. As it is visible in i, j, k figures, the fibers shown some beaded regions within themselves, but annealing removes these highly amorphous regions, and as it is depicted in the median, f, g, and h SEM figures, of the one step annealed samples and of course the upper column of two steps annealed samples, the beaded regions are cleared away. The post-processing operation actually causes an increase in fiber diameters and also their alignment, as depicted in Fig. 3d and e . As it is obvious in Fig. 4 , the piezoelectricity has been increased through post-processing treatment slightly by one step annealing at 105 °C and dramatically by two step annealing at 150 °C (up to 3 times higher than the just spun samples). The issue which is in the course of attention is the root of this promotion and is going to be answered in the following sections. As it is claimed by Zhao et al. [ 34 ], each fiber PE outcome is about 3.1 pc/N, and it is possible to hypothesis that the low PE outcome of these patches is based on the misaligned fibers that cancel out each other piezo property in comparison to amplification. 3.2. Phase transition behavior First of all, it is essential to investigate the effect of the thermal process on polymer chains and bondings; to make it clear the FTIR results are projected in Fig. 5 . The important peaks of C=O as the source of piezoelectricity and other bonds have not changed in one step or two steps annealed process. Two small bands at 921 cm −1 and 955 cm −1 are ascribed to a 10 3 helix sensitive crystallization band and amorphous structure, respectively. In the α phase, the carbonyl stretching vibrations bands showed a complex splitting pattern at 1776, 1759, and 1749 cm −1 . In the α′ phase PLA film, the carbonyl stretching vibrations bands had only a single peak at 1759 cm −1 . The same results have been reported in [ 35 , 36 ]. Differential Scanning Calorimetry (DSC) was used to investigate the crystallinity percentage of the semicrystalline PLA polymer. The crystallinity percentage is determined to be induced by any thermal process, including annealing and also thermo-mechanical process. It is proved that the promotion of the crystallinity percentage effectively promotes the PE properties [ 15 ]. Micro/nanoscale piezoelectricity measurements are attainable by advanced characterization techniques [ 37 ]. For instance, Smith et al. inscribed the determination of shear piezoelectricity in extremely oriented PLLA nanowires, which were also extremely crystalline, the interpreted result terminated an advance in the degree of crystallinity up to 70%, using PE Force Microscopy (PFM), the estimated d14 PE coefficient was about 8 pC/N [ 37 ]. As it is apparent in Fig. 6 , from the just spun samples to the two steps annealed patches, the crystallinity percentage shows an increasing trend. The matter of crystalline structure in polymers arises from the alignment of chains, and the chain relaxation is much faster than chain extension at ES conditions, which results in the most amorphous structure of the as-spun sample, as is tangible in Fig. 6b . The α crystalline diffraction peaks of 1D-XRD which are formed at a temperature above 120 °C, appear at 2θ values of 16.7°, 19.1°, 22.4° corresponding to Miller indices for planes 200/110, 203, 015, respectively. However, the 1D-XRD diffraction peaks of α’ crystalline phase, which is induced from an amorphous state at temperatures below the 120 °C, appear at 2θ values of 16.4°, 18.7°, corresponding to 200/110, 203 planes, respectively. It is difficult to distinguish both phases based on XRD patterns because of their similarity in conformation [ 5 , 23 ]. In this respect, Table 1 provides comprehensive detail on PLA conformation, crystalline phase formation, and the condition [ 5 , 23 , 38 ]. While taking the DSC results into consideration; the XRD results suggest the formation of crystalline states of α and α’. It is evident that two steps of annealing result in the construction of α crystalline phase with the highest crystallinity percentage after 12 h exposing to creep regime (under the constant load) at 150 °C. In contrast, thermal processing below the transition temperature at 105 °C and the same annealing time without loading forms both of the α, and α′ phases. The formation of these two crystalline states originates from the time of thermal processing, which was long enough for the transformation of α′ to α phase. It has been mentioned in the literature that crystalline transformation from α′ to α is a type of disorder to order phase transformation [ 30 , 39 ]. In order to supply an adequate viewpoint to both of the phases' crystalline states, considering their state in fibers and the transition between them respecting all the details of the crystalline state and the conformation of the chains, Fig. 7 is provided. Further description is provided in figure's caption. 3.3. Texturization Philips PW-3710 diffractometer was employed to illustrate the development of chain conformation in the crystalline phase. Annealing the material increases the order of the polymer chains, thus inhibiting dipole rotation and promoting the ferroelectric and PE properties of the material as an impact of the most thermodynamically stable state [ 43 ]. Annealing does not necessarily generate anisotropy and often acts to reduce it. Therefore, heat treatment alone is not a sufficient condition to ensure the PE properties of a polymer are expressed. Calculating Herman's orientation function is an effective procedure to obtain the degree of chain alignment. As the chains get aligned in a higher-order manner, Herman's orientation function would be closer to 1, and vice versa; the 0 calculated number would mean the inhomogeneously directed chains. Herman's orientation function represents polymer-chain orientation for systems with fiber symmetry (uniaxial orientation) and the Herman's-Stein orientation factors express uniaxial orientation for each of the crystallographic axes of crystalline polymers [ 44 ]. The calculated Herman's orientation factors, in the present case, are presented in Fig. 8a . Here below, we are going to discuss Herman's orientation factors higher than 0.3 because of the fact that the numbers lower than that have an inferior proportion of crystallites. On the one hand, as it is depicted, the chain alignment in the one-step annealed structure, has been led to the formation of 110 crystalline planes, either originated from the α′ or α phases. The calculated Heramn's orientation function has appeared having a number close to 0.48 in the range of 75–125 which denotes a high crystal rotation in this mentioned scope. On the other hand, Herman's orientation function of the two steps annealed structure possess higher values ranging between 220 and 310. To pave the way for understanding the evolution of Herman's orientation function, distribution of the preferential crystal orientation plane for one step and two step annealed scaffolds, are depicted in Fig. 8b , d and Fig. 8c , e , respectively. It can be concluded from the 3D graphs that the absence of peaks results into a low or zero values of Herman's orientation function. The intensity values represent the number of crystals aligned to a specific angle. In one-step annealed mats, the intensity is lower in comparison to the two steps annealed patches. This means that the preferential crystal orientation planes have been randomly oriented through one step annealing while it is going to be more texturized in two steps annealed samples. Herman's orientation functions are also higher in the case of one-step annealed condition, which is literally originated from the fact that crystals have not been aligned but are randomly oriented, i.e., the crystallites have been formed in various directions. It should be denoted that the PLA patterns don't represent a cloudy pattern of the amorphous structure [ 45 , 46 ] as well as representing an adapted scattering direction just related to the specified distribution of 110 planes [ 47 ]. As it is being tried to be well described, the two steps annealed structure have been strongly texturized, and most of the crystallites have been located approximately near the transverse direction (TD), that is to say, the normal direction of the 110 planes is perpendicular to the electrospinning direction. In this regard, it can be claimed that the crystallites have been formed aligned with the fibers direction. It can be concluded that annealing has the potential to cause a phase transformation, but the thermo-mechanical processing actually helps the crystal rotation of the chains within the fibers (2D-WAXD patterns in Fig. 8b , c , d , and e show the anisotropy of (200/110) planes and the preferential crystal orientation). The results indicate that the preferential orientation of the normal direction of 110 crystalline planes aligned with transvers direction. The annealing would cause such high anisotropy, however, it can be related to the creep-induced crystallization form α′ disordered crystalline structure to αcrystalline ordered structure [ 30 , 48 ]. During the thermomechanical processing, the amorphous chains gradually reorient in the plane of the fibers, and cause disappearing the randomly oriented halo. This type of texturization, in the absence of other higher-order peaks, represents the threedimensional crystalline order has been relatively well established. Taking the hole intensities in various directions in mind, low intensity diffracted peaks along the RD and TD do not exhibit well-developed crystalline regions. This behavior is due to the random orientation of the chain segments in the fiber plane. Thus they have a low chance to form in parallel pattern with each other and crystallize. Still, it is worth mentioning that the processing temperature was high enough to form a type of crystalline structure, actually in the direction of TD, up to a ratio of 59%, and it can be concluded that the crystallites are formed along the TD partially parallel to each other causing a promoted piezoelectric outcome."
} | 5,677 |
35903416 | PMC9328748 | pmc | 9,497 | {
"abstract": "The bio/sensors performance has been established to be significantly affected through partially or entirely alignment of nano/microfibrous in polymeric mats. The matter of crystalline/amorphous proportion in semicrystalline polymers is another factor that can affect the application of the piezoelectric patches. The present work deals with fabricating the scaffolds of micro/nanofibers through a modified electrospinning procedure. The ratio of the relevant organic and polar solvents, the beading, the degree of fiber alignment, and fiber thickness have been intentionally elaborated. An unaligned unbeaded nanofibrous mat has been fabricated after tuning the solvents to poly-lactic acid ratio. This paper, for the first time, deals with the calculation of the value of d 33 value of a commercial PLA and its improvement, it has been revealed that the d 33 piezoelectric property is improved as a consequence of the thermo-mechanical processing above the cold crystallization temperature. The applied thermo (mechanical) processing causes the structural evolution from amorphous to crystallized states. Formation of the α and α′ crystalline phases is introduced as the main responsible for the improvement of the piezoelectric property. This improvement not only is correlated with the degree of crystallinity, but also the orientation and alignment of the crystallites is known to be influential. In this respect, the complex helical chain structural evolution of poly-lactic acid has been analyzed through Herman's orientation function. It has been found that, besides the characterized disorder-to-order phase transformation, the C=O branched out dipoles interactions significantly affects by the texturization of the aligned polymeric chains in the direction of the electrospinning which is known as the main factor to promote the piezoelectric property of processed mat.",
"conclusion": "4. Conclusion In this paper, the PLA scaffolds d 33 piezo constant for the first time and its promotion regarding the crystallization induced through thermo-mechanical processing was measured. Annealing at 105 °C for 12 h resulted in the formation of both the disordered-α′ and ordered-α crystalline phases by the crystallinity percentage of 20% and 27%, respectively; a total crystallinity percentage of 47%. Creep-induced crystallization at 150 °C for 12 h was investigated, it resulted in the formation of the α phase holding higher crystallinity of about 59%. It was concluded that any thermal process above the cold crystallization temperature induced an appreciable crystallinity percentage up to 59%. Analyzing Herman's orientation function and texture evolution showed that the one-step annealing provided an appropriate condition for randomly oriented crystallites. In contrast, two steps of annealing resulted in a more texturized microstructure along the electrospinning direction. In one step annealed samples, piezoelectricity did not show a sharp increasing trend in comparison to un-treated scaffolds, while texturization in two steps-annealed patches caused a dramatic promotion of the d 33 piezoelectric value from 0.078 fc/N to 0.21fc/N.",
"introduction": "1. Introduction Considering the electroactive biopolymers following the potential to transduce mechanical and electrical energy, Poly-Lactic Acid (PLA) has drawn the researchers' attention. This is attributed to the non-centrosymmetric complex structure of PLA, as a Food and Drug Administration (FDA)-approved polymer, which has the potential to be studied in the course of piezoelectricity [ 1 , 2 ]. An individual chain, in polymer structure, may be non-centrosymmetric, but the amorphous network will be highly isotropic, which diminishes the probability of piezoelectricity. Interestingly, this type of centrosymmetric has been removed in amorphous PLA; therefore, the PLA shows piezoelectricity even in its non-crystalline state [ 3 , 4 ]. It has been proved that crystallization would improve the non-centrosymmetric structure. Among the 32 crystallographic point groups, 21 of them do not possess inversion symmetry which are the crystalline state of the polymers [ 2 ]. PLA crystallizes into four distinct phases, among them α’ with pseudo hexagonal unit cell and α with an orthorhombic crystalline structure [ 5 ]. Achieving an utterly crystallized structure is impossible in polymers; in the meanwhile of crystallization, crystalline regions will grow within the amorphous matrix, and on average, these crystallites will exhibit a randomly oriented distribution [ 6 , 7 ]. Among the various procedures improving the non-centrosymmetric structure, stretching is a common method [ 8 ]. Polymers possessing handedness, those with helical conformation as a consequence of chiral monomer units, can contain a mirror plane perpendicular to its drawing axis, and thus because of the breaking of the mirror plane by the helical twist, the piezoelectricity can be improved [ 9 ]. Another promising method which can be used to promote the anisotropy is electrical poling, through which a large tendency of dipole alignment is achieved within the structure. This is only applicable in the case of ferroelectric materials where the polarization is spontaneous and reversible [ 10 ]. Piezoelectricity defines as the physical properties of the materials containing the dipole groups which do not cancel each other within the microstructure of the complex material's structure. There are many PE constants regarding the type of normal or shear piezoelectricity and direct or diverse piezoelectricity; in order to provide an appropriate portrayal to them, Fig. 1 is presented. There are two diverse types of piezoelectricity; Normal and shear. Normal PE assigns to the materials that react to the employed force straightly. When the structure deforms in X, Y, or Z directions, the electrical charge concentrates on one of the suggested directions of the specimen. When an excitation charge employs the unit, volume growth appears in the same way. The shear piezoelectricity issues into the statement in materials that twist the sample in acknowledgment of the electrical stimulation [ 11 ]. Stretching the polymer adjusts the amorphous strands in the film/fiber plane and promotes uniform rotation of the crystallites by an electric field. Depending on whether stretching is uniaxial or biaxial, the electrical and mechanical properties are either highly anisotropic or isotropic in the plane of the polymer sheet. Polymer poling can be accomplished using a direct contact method or a corona discharge. In this fashion, one of the favorite techniques is ES. During the ES process, speedy solvent drying constitutes an amorphous structure of oriented fibers; increasing the crystallinity is more comfortable by the secondary hot drawing process. By diminishing the fiber diameter, more surface area is achieved, and thus, the glass transition and melt temperature inconsiderably wane [ 12 ]. In the case of PLA, the d 14 PE constant has been studied chiefly, and it has been demonstrated that the order of constant ranges between 9 and 11 pc/N [ 13 , 14 ]. In comparison, post-treatment such as annealing or further thermomechanical process has the potential to increase this PE constant approximately near to 20 pc/N [ 15 ]. There is a huge lack of knowledge around the calculation of the PLA PE d 33 constant and its fluctuation as a result of the thermo-mechanical process. The most well-known PLA PE constant is defined as d 14 . Throughout the experimental measurements of research from Occhiai et al. on 0-cut PLLA, carrying side along z-axis which also was their elongation axis, samples manifested these cases had a d 14 PE coefficient equal to 9.82 pC/N [ 16 ]. The piezoelectricity not only is sensitive to the glassy transition behavior, but also is a function of crystalline/amorphous structure characteristics. It has been [ 17 ] illustrated that the amorphous region will contribute to the piezoelectricity just if the molecular chains follow some degree of alignment at least. On the one hand, chirality and helical PLA conformation provide a proper condition for the presence of piezoelectricity even in the absence of any further processing; thus, simply aligning the polymer chains is sufficient to remove any centrosymmetric and permit piezoelectricity [ 18 ]. In this respect, the thermo-mechanical processing is highly capable to change the alignment of polymeric chains accommodating the applied stress. This significantly reorganizes the crystalline regions embedded within the amorphous matrix and improves the non-centrosymmetric structure. As a semicrystalline polymer, the crystallization process and crystal structure of PLA have been studied by various groups. PLA has the potential to experience four kinds of crystal modification, where α, α’, β, and γ phases are formed under the different preparation process [ 19 - 22 ]. The most thermodynamically stable phase, α form, has a 10 3 helical chain conformation [ 23 ] which can crystallize from melt or solution and mainly differentiate from the α′ form. The α′ form crystallizes at temperatures below 120 ° C and is known to be the disorder form of α, while the α form achieves above this disorder to order transformation temperature [ 19 ]. In another opinion, PLA is not classified as a ferroelectric material, and uniaxial arrangement would serve sufficient to compromise its natural piezo-response. Therefore, because of the original PE characteristics of the PLA, no additional fabrication manner more further than the stretching approach, which is essential to provoke uniaxial oriented chains, is expected. Influencing the piezoelectricity is also feasible by polymer thermally stretching; by this process, the phase transition from α′ to α springs, and so on, a switch from randomly oriented molecular chains to aligned chains might be achieved [ 24 ]. In helical PLA molecule chains, shear strain in the direction of the helix axis insignificantly twists the permanent bond dipoles and thus alters the polarization perpendicular to the plane of shear strain [ 25 , 26 ]. One of the disadvantages in this field is the PLA magnitude of piezoelectricity, which is much lower compared with most of the other PEs; solving this drawback, savants, on the one hand, inaugurated to invent hybrid biomaterials and, on the other hand, concentrated on phase transitions and stabilizing them. The convention magnitude between mechanical applied deformation and the electricity generated charge is a function of the PE constant [ 27 ]. Coming to the point, the formation of crystalline phases and its effect on d 14 piezoelectric outcome has been presented in the previous literature, but it's the first time that the PLA 2003D is being analyzed to understand the d 33 piezoelectric outcome of the mats. In this respect, electrospinning is considered as the best fabrication procedure to induce piezoelectricity in PLA ECM mimicking mats. The high shear force is applied to the chains which is expected to stimulate C=O dipoles to be oriented even in an amorphous structure. In fact, PLA is not a ferroelectric polymer, but it shows piezoelectricity even in amorphous state while inducing a partially long-range ordering of the chains through thermo- and/or mechanical work. The current work also explores the impact of crystallite orientation on the piezoelectric property. As a side benefit, regarding the fabrication of interconnected porous mats; in addition to what has already been denoted, a micro-aligned mat, or nanoscale fibers possess a tremendous potential to be used as artificial organs or at least a base for migration of the immature cells to the cells which are dead or can't perform their duty.",
"discussion": "3. Result and discussion 3.1. Piezoelectricity (d 33 ) of the mats It has been demonstrated that by ES and the fabrication of micro/nanofibers, the PE performance of the non-ferroelectric materials, especially PLA, increases [ 31 ], in this way, it is essential to have smooth and thin homogenously distributed fibers with the absence of beaded regions in them, which is a result of various variables [ 32 , 33 ], namely; the type of solvents, the proportion of solvent and polymer, the humidity and also the atmosphere temperature, the ES applied potential and also the collector to nuzzle distance all are demonstrated in Fig. 2 . As it is depicted in Fig. 3 , an appropriate selection of solvents DMF and DCM results in the formation of mostly beadles fibers, where the fibers have not been aligned because of the low number of drum rotation. As it is visible in i, j, k figures, the fibers shown some beaded regions within themselves, but annealing removes these highly amorphous regions, and as it is depicted in the median, f, g, and h SEM figures, of the one step annealed samples and of course the upper column of two steps annealed samples, the beaded regions are cleared away. The post-processing operation actually causes an increase in fiber diameters and also their alignment, as depicted in Fig. 3d and e . As it is obvious in Fig. 4 , the piezoelectricity has been increased through post-processing treatment slightly by one step annealing at 105 °C and dramatically by two step annealing at 150 °C (up to 3 times higher than the just spun samples). The issue which is in the course of attention is the root of this promotion and is going to be answered in the following sections. As it is claimed by Zhao et al. [ 34 ], each fiber PE outcome is about 3.1 pc/N, and it is possible to hypothesis that the low PE outcome of these patches is based on the misaligned fibers that cancel out each other piezo property in comparison to amplification. 3.2. Phase transition behavior First of all, it is essential to investigate the effect of the thermal process on polymer chains and bondings; to make it clear the FTIR results are projected in Fig. 5 . The important peaks of C=O as the source of piezoelectricity and other bonds have not changed in one step or two steps annealed process. Two small bands at 921 cm −1 and 955 cm −1 are ascribed to a 10 3 helix sensitive crystallization band and amorphous structure, respectively. In the α phase, the carbonyl stretching vibrations bands showed a complex splitting pattern at 1776, 1759, and 1749 cm −1 . In the α′ phase PLA film, the carbonyl stretching vibrations bands had only a single peak at 1759 cm −1 . The same results have been reported in [ 35 , 36 ]. Differential Scanning Calorimetry (DSC) was used to investigate the crystallinity percentage of the semicrystalline PLA polymer. The crystallinity percentage is determined to be induced by any thermal process, including annealing and also thermo-mechanical process. It is proved that the promotion of the crystallinity percentage effectively promotes the PE properties [ 15 ]. Micro/nanoscale piezoelectricity measurements are attainable by advanced characterization techniques [ 37 ]. For instance, Smith et al. inscribed the determination of shear piezoelectricity in extremely oriented PLLA nanowires, which were also extremely crystalline, the interpreted result terminated an advance in the degree of crystallinity up to 70%, using PE Force Microscopy (PFM), the estimated d14 PE coefficient was about 8 pC/N [ 37 ]. As it is apparent in Fig. 6 , from the just spun samples to the two steps annealed patches, the crystallinity percentage shows an increasing trend. The matter of crystalline structure in polymers arises from the alignment of chains, and the chain relaxation is much faster than chain extension at ES conditions, which results in the most amorphous structure of the as-spun sample, as is tangible in Fig. 6b . The α crystalline diffraction peaks of 1D-XRD which are formed at a temperature above 120 °C, appear at 2θ values of 16.7°, 19.1°, 22.4° corresponding to Miller indices for planes 200/110, 203, 015, respectively. However, the 1D-XRD diffraction peaks of α’ crystalline phase, which is induced from an amorphous state at temperatures below the 120 °C, appear at 2θ values of 16.4°, 18.7°, corresponding to 200/110, 203 planes, respectively. It is difficult to distinguish both phases based on XRD patterns because of their similarity in conformation [ 5 , 23 ]. In this respect, Table 1 provides comprehensive detail on PLA conformation, crystalline phase formation, and the condition [ 5 , 23 , 38 ]. While taking the DSC results into consideration; the XRD results suggest the formation of crystalline states of α and α’. It is evident that two steps of annealing result in the construction of α crystalline phase with the highest crystallinity percentage after 12 h exposing to creep regime (under the constant load) at 150 °C. In contrast, thermal processing below the transition temperature at 105 °C and the same annealing time without loading forms both of the α, and α′ phases. The formation of these two crystalline states originates from the time of thermal processing, which was long enough for the transformation of α′ to α phase. It has been mentioned in the literature that crystalline transformation from α′ to α is a type of disorder to order phase transformation [ 30 , 39 ]. In order to supply an adequate viewpoint to both of the phases' crystalline states, considering their state in fibers and the transition between them respecting all the details of the crystalline state and the conformation of the chains, Fig. 7 is provided. Further description is provided in figure's caption. 3.3. Texturization Philips PW-3710 diffractometer was employed to illustrate the development of chain conformation in the crystalline phase. Annealing the material increases the order of the polymer chains, thus inhibiting dipole rotation and promoting the ferroelectric and PE properties of the material as an impact of the most thermodynamically stable state [ 43 ]. Annealing does not necessarily generate anisotropy and often acts to reduce it. Therefore, heat treatment alone is not a sufficient condition to ensure the PE properties of a polymer are expressed. Calculating Herman's orientation function is an effective procedure to obtain the degree of chain alignment. As the chains get aligned in a higher-order manner, Herman's orientation function would be closer to 1, and vice versa; the 0 calculated number would mean the inhomogeneously directed chains. Herman's orientation function represents polymer-chain orientation for systems with fiber symmetry (uniaxial orientation) and the Herman's-Stein orientation factors express uniaxial orientation for each of the crystallographic axes of crystalline polymers [ 44 ]. The calculated Herman's orientation factors, in the present case, are presented in Fig. 8a . Here below, we are going to discuss Herman's orientation factors higher than 0.3 because of the fact that the numbers lower than that have an inferior proportion of crystallites. On the one hand, as it is depicted, the chain alignment in the one-step annealed structure, has been led to the formation of 110 crystalline planes, either originated from the α′ or α phases. The calculated Heramn's orientation function has appeared having a number close to 0.48 in the range of 75–125 which denotes a high crystal rotation in this mentioned scope. On the other hand, Herman's orientation function of the two steps annealed structure possess higher values ranging between 220 and 310. To pave the way for understanding the evolution of Herman's orientation function, distribution of the preferential crystal orientation plane for one step and two step annealed scaffolds, are depicted in Fig. 8b , d and Fig. 8c , e , respectively. It can be concluded from the 3D graphs that the absence of peaks results into a low or zero values of Herman's orientation function. The intensity values represent the number of crystals aligned to a specific angle. In one-step annealed mats, the intensity is lower in comparison to the two steps annealed patches. This means that the preferential crystal orientation planes have been randomly oriented through one step annealing while it is going to be more texturized in two steps annealed samples. Herman's orientation functions are also higher in the case of one-step annealed condition, which is literally originated from the fact that crystals have not been aligned but are randomly oriented, i.e., the crystallites have been formed in various directions. It should be denoted that the PLA patterns don't represent a cloudy pattern of the amorphous structure [ 45 , 46 ] as well as representing an adapted scattering direction just related to the specified distribution of 110 planes [ 47 ]. As it is being tried to be well described, the two steps annealed structure have been strongly texturized, and most of the crystallites have been located approximately near the transverse direction (TD), that is to say, the normal direction of the 110 planes is perpendicular to the electrospinning direction. In this regard, it can be claimed that the crystallites have been formed aligned with the fibers direction. It can be concluded that annealing has the potential to cause a phase transformation, but the thermo-mechanical processing actually helps the crystal rotation of the chains within the fibers (2D-WAXD patterns in Fig. 8b , c , d , and e show the anisotropy of (200/110) planes and the preferential crystal orientation). The results indicate that the preferential orientation of the normal direction of 110 crystalline planes aligned with transvers direction. The annealing would cause such high anisotropy, however, it can be related to the creep-induced crystallization form α′ disordered crystalline structure to αcrystalline ordered structure [ 30 , 48 ]. During the thermomechanical processing, the amorphous chains gradually reorient in the plane of the fibers, and cause disappearing the randomly oriented halo. This type of texturization, in the absence of other higher-order peaks, represents the threedimensional crystalline order has been relatively well established. Taking the hole intensities in various directions in mind, low intensity diffracted peaks along the RD and TD do not exhibit well-developed crystalline regions. This behavior is due to the random orientation of the chain segments in the fiber plane. Thus they have a low chance to form in parallel pattern with each other and crystallize. Still, it is worth mentioning that the processing temperature was high enough to form a type of crystalline structure, actually in the direction of TD, up to a ratio of 59%, and it can be concluded that the crystallites are formed along the TD partially parallel to each other causing a promoted piezoelectric outcome."
} | 5,677 |
35903416 | PMC9328748 | pmc | 9,498 | {
"abstract": "The bio/sensors performance has been established to be significantly affected through partially or entirely alignment of nano/microfibrous in polymeric mats. The matter of crystalline/amorphous proportion in semicrystalline polymers is another factor that can affect the application of the piezoelectric patches. The present work deals with fabricating the scaffolds of micro/nanofibers through a modified electrospinning procedure. The ratio of the relevant organic and polar solvents, the beading, the degree of fiber alignment, and fiber thickness have been intentionally elaborated. An unaligned unbeaded nanofibrous mat has been fabricated after tuning the solvents to poly-lactic acid ratio. This paper, for the first time, deals with the calculation of the value of d 33 value of a commercial PLA and its improvement, it has been revealed that the d 33 piezoelectric property is improved as a consequence of the thermo-mechanical processing above the cold crystallization temperature. The applied thermo (mechanical) processing causes the structural evolution from amorphous to crystallized states. Formation of the α and α′ crystalline phases is introduced as the main responsible for the improvement of the piezoelectric property. This improvement not only is correlated with the degree of crystallinity, but also the orientation and alignment of the crystallites is known to be influential. In this respect, the complex helical chain structural evolution of poly-lactic acid has been analyzed through Herman's orientation function. It has been found that, besides the characterized disorder-to-order phase transformation, the C=O branched out dipoles interactions significantly affects by the texturization of the aligned polymeric chains in the direction of the electrospinning which is known as the main factor to promote the piezoelectric property of processed mat.",
"conclusion": "4. Conclusion In this paper, the PLA scaffolds d 33 piezo constant for the first time and its promotion regarding the crystallization induced through thermo-mechanical processing was measured. Annealing at 105 °C for 12 h resulted in the formation of both the disordered-α′ and ordered-α crystalline phases by the crystallinity percentage of 20% and 27%, respectively; a total crystallinity percentage of 47%. Creep-induced crystallization at 150 °C for 12 h was investigated, it resulted in the formation of the α phase holding higher crystallinity of about 59%. It was concluded that any thermal process above the cold crystallization temperature induced an appreciable crystallinity percentage up to 59%. Analyzing Herman's orientation function and texture evolution showed that the one-step annealing provided an appropriate condition for randomly oriented crystallites. In contrast, two steps of annealing resulted in a more texturized microstructure along the electrospinning direction. In one step annealed samples, piezoelectricity did not show a sharp increasing trend in comparison to un-treated scaffolds, while texturization in two steps-annealed patches caused a dramatic promotion of the d 33 piezoelectric value from 0.078 fc/N to 0.21fc/N.",
"introduction": "1. Introduction Considering the electroactive biopolymers following the potential to transduce mechanical and electrical energy, Poly-Lactic Acid (PLA) has drawn the researchers' attention. This is attributed to the non-centrosymmetric complex structure of PLA, as a Food and Drug Administration (FDA)-approved polymer, which has the potential to be studied in the course of piezoelectricity [ 1 , 2 ]. An individual chain, in polymer structure, may be non-centrosymmetric, but the amorphous network will be highly isotropic, which diminishes the probability of piezoelectricity. Interestingly, this type of centrosymmetric has been removed in amorphous PLA; therefore, the PLA shows piezoelectricity even in its non-crystalline state [ 3 , 4 ]. It has been proved that crystallization would improve the non-centrosymmetric structure. Among the 32 crystallographic point groups, 21 of them do not possess inversion symmetry which are the crystalline state of the polymers [ 2 ]. PLA crystallizes into four distinct phases, among them α’ with pseudo hexagonal unit cell and α with an orthorhombic crystalline structure [ 5 ]. Achieving an utterly crystallized structure is impossible in polymers; in the meanwhile of crystallization, crystalline regions will grow within the amorphous matrix, and on average, these crystallites will exhibit a randomly oriented distribution [ 6 , 7 ]. Among the various procedures improving the non-centrosymmetric structure, stretching is a common method [ 8 ]. Polymers possessing handedness, those with helical conformation as a consequence of chiral monomer units, can contain a mirror plane perpendicular to its drawing axis, and thus because of the breaking of the mirror plane by the helical twist, the piezoelectricity can be improved [ 9 ]. Another promising method which can be used to promote the anisotropy is electrical poling, through which a large tendency of dipole alignment is achieved within the structure. This is only applicable in the case of ferroelectric materials where the polarization is spontaneous and reversible [ 10 ]. Piezoelectricity defines as the physical properties of the materials containing the dipole groups which do not cancel each other within the microstructure of the complex material's structure. There are many PE constants regarding the type of normal or shear piezoelectricity and direct or diverse piezoelectricity; in order to provide an appropriate portrayal to them, Fig. 1 is presented. There are two diverse types of piezoelectricity; Normal and shear. Normal PE assigns to the materials that react to the employed force straightly. When the structure deforms in X, Y, or Z directions, the electrical charge concentrates on one of the suggested directions of the specimen. When an excitation charge employs the unit, volume growth appears in the same way. The shear piezoelectricity issues into the statement in materials that twist the sample in acknowledgment of the electrical stimulation [ 11 ]. Stretching the polymer adjusts the amorphous strands in the film/fiber plane and promotes uniform rotation of the crystallites by an electric field. Depending on whether stretching is uniaxial or biaxial, the electrical and mechanical properties are either highly anisotropic or isotropic in the plane of the polymer sheet. Polymer poling can be accomplished using a direct contact method or a corona discharge. In this fashion, one of the favorite techniques is ES. During the ES process, speedy solvent drying constitutes an amorphous structure of oriented fibers; increasing the crystallinity is more comfortable by the secondary hot drawing process. By diminishing the fiber diameter, more surface area is achieved, and thus, the glass transition and melt temperature inconsiderably wane [ 12 ]. In the case of PLA, the d 14 PE constant has been studied chiefly, and it has been demonstrated that the order of constant ranges between 9 and 11 pc/N [ 13 , 14 ]. In comparison, post-treatment such as annealing or further thermomechanical process has the potential to increase this PE constant approximately near to 20 pc/N [ 15 ]. There is a huge lack of knowledge around the calculation of the PLA PE d 33 constant and its fluctuation as a result of the thermo-mechanical process. The most well-known PLA PE constant is defined as d 14 . Throughout the experimental measurements of research from Occhiai et al. on 0-cut PLLA, carrying side along z-axis which also was their elongation axis, samples manifested these cases had a d 14 PE coefficient equal to 9.82 pC/N [ 16 ]. The piezoelectricity not only is sensitive to the glassy transition behavior, but also is a function of crystalline/amorphous structure characteristics. It has been [ 17 ] illustrated that the amorphous region will contribute to the piezoelectricity just if the molecular chains follow some degree of alignment at least. On the one hand, chirality and helical PLA conformation provide a proper condition for the presence of piezoelectricity even in the absence of any further processing; thus, simply aligning the polymer chains is sufficient to remove any centrosymmetric and permit piezoelectricity [ 18 ]. In this respect, the thermo-mechanical processing is highly capable to change the alignment of polymeric chains accommodating the applied stress. This significantly reorganizes the crystalline regions embedded within the amorphous matrix and improves the non-centrosymmetric structure. As a semicrystalline polymer, the crystallization process and crystal structure of PLA have been studied by various groups. PLA has the potential to experience four kinds of crystal modification, where α, α’, β, and γ phases are formed under the different preparation process [ 19 - 22 ]. The most thermodynamically stable phase, α form, has a 10 3 helical chain conformation [ 23 ] which can crystallize from melt or solution and mainly differentiate from the α′ form. The α′ form crystallizes at temperatures below 120 ° C and is known to be the disorder form of α, while the α form achieves above this disorder to order transformation temperature [ 19 ]. In another opinion, PLA is not classified as a ferroelectric material, and uniaxial arrangement would serve sufficient to compromise its natural piezo-response. Therefore, because of the original PE characteristics of the PLA, no additional fabrication manner more further than the stretching approach, which is essential to provoke uniaxial oriented chains, is expected. Influencing the piezoelectricity is also feasible by polymer thermally stretching; by this process, the phase transition from α′ to α springs, and so on, a switch from randomly oriented molecular chains to aligned chains might be achieved [ 24 ]. In helical PLA molecule chains, shear strain in the direction of the helix axis insignificantly twists the permanent bond dipoles and thus alters the polarization perpendicular to the plane of shear strain [ 25 , 26 ]. One of the disadvantages in this field is the PLA magnitude of piezoelectricity, which is much lower compared with most of the other PEs; solving this drawback, savants, on the one hand, inaugurated to invent hybrid biomaterials and, on the other hand, concentrated on phase transitions and stabilizing them. The convention magnitude between mechanical applied deformation and the electricity generated charge is a function of the PE constant [ 27 ]. Coming to the point, the formation of crystalline phases and its effect on d 14 piezoelectric outcome has been presented in the previous literature, but it's the first time that the PLA 2003D is being analyzed to understand the d 33 piezoelectric outcome of the mats. In this respect, electrospinning is considered as the best fabrication procedure to induce piezoelectricity in PLA ECM mimicking mats. The high shear force is applied to the chains which is expected to stimulate C=O dipoles to be oriented even in an amorphous structure. In fact, PLA is not a ferroelectric polymer, but it shows piezoelectricity even in amorphous state while inducing a partially long-range ordering of the chains through thermo- and/or mechanical work. The current work also explores the impact of crystallite orientation on the piezoelectric property. As a side benefit, regarding the fabrication of interconnected porous mats; in addition to what has already been denoted, a micro-aligned mat, or nanoscale fibers possess a tremendous potential to be used as artificial organs or at least a base for migration of the immature cells to the cells which are dead or can't perform their duty.",
"discussion": "3. Result and discussion 3.1. Piezoelectricity (d 33 ) of the mats It has been demonstrated that by ES and the fabrication of micro/nanofibers, the PE performance of the non-ferroelectric materials, especially PLA, increases [ 31 ], in this way, it is essential to have smooth and thin homogenously distributed fibers with the absence of beaded regions in them, which is a result of various variables [ 32 , 33 ], namely; the type of solvents, the proportion of solvent and polymer, the humidity and also the atmosphere temperature, the ES applied potential and also the collector to nuzzle distance all are demonstrated in Fig. 2 . As it is depicted in Fig. 3 , an appropriate selection of solvents DMF and DCM results in the formation of mostly beadles fibers, where the fibers have not been aligned because of the low number of drum rotation. As it is visible in i, j, k figures, the fibers shown some beaded regions within themselves, but annealing removes these highly amorphous regions, and as it is depicted in the median, f, g, and h SEM figures, of the one step annealed samples and of course the upper column of two steps annealed samples, the beaded regions are cleared away. The post-processing operation actually causes an increase in fiber diameters and also their alignment, as depicted in Fig. 3d and e . As it is obvious in Fig. 4 , the piezoelectricity has been increased through post-processing treatment slightly by one step annealing at 105 °C and dramatically by two step annealing at 150 °C (up to 3 times higher than the just spun samples). The issue which is in the course of attention is the root of this promotion and is going to be answered in the following sections. As it is claimed by Zhao et al. [ 34 ], each fiber PE outcome is about 3.1 pc/N, and it is possible to hypothesis that the low PE outcome of these patches is based on the misaligned fibers that cancel out each other piezo property in comparison to amplification. 3.2. Phase transition behavior First of all, it is essential to investigate the effect of the thermal process on polymer chains and bondings; to make it clear the FTIR results are projected in Fig. 5 . The important peaks of C=O as the source of piezoelectricity and other bonds have not changed in one step or two steps annealed process. Two small bands at 921 cm −1 and 955 cm −1 are ascribed to a 10 3 helix sensitive crystallization band and amorphous structure, respectively. In the α phase, the carbonyl stretching vibrations bands showed a complex splitting pattern at 1776, 1759, and 1749 cm −1 . In the α′ phase PLA film, the carbonyl stretching vibrations bands had only a single peak at 1759 cm −1 . The same results have been reported in [ 35 , 36 ]. Differential Scanning Calorimetry (DSC) was used to investigate the crystallinity percentage of the semicrystalline PLA polymer. The crystallinity percentage is determined to be induced by any thermal process, including annealing and also thermo-mechanical process. It is proved that the promotion of the crystallinity percentage effectively promotes the PE properties [ 15 ]. Micro/nanoscale piezoelectricity measurements are attainable by advanced characterization techniques [ 37 ]. For instance, Smith et al. inscribed the determination of shear piezoelectricity in extremely oriented PLLA nanowires, which were also extremely crystalline, the interpreted result terminated an advance in the degree of crystallinity up to 70%, using PE Force Microscopy (PFM), the estimated d14 PE coefficient was about 8 pC/N [ 37 ]. As it is apparent in Fig. 6 , from the just spun samples to the two steps annealed patches, the crystallinity percentage shows an increasing trend. The matter of crystalline structure in polymers arises from the alignment of chains, and the chain relaxation is much faster than chain extension at ES conditions, which results in the most amorphous structure of the as-spun sample, as is tangible in Fig. 6b . The α crystalline diffraction peaks of 1D-XRD which are formed at a temperature above 120 °C, appear at 2θ values of 16.7°, 19.1°, 22.4° corresponding to Miller indices for planes 200/110, 203, 015, respectively. However, the 1D-XRD diffraction peaks of α’ crystalline phase, which is induced from an amorphous state at temperatures below the 120 °C, appear at 2θ values of 16.4°, 18.7°, corresponding to 200/110, 203 planes, respectively. It is difficult to distinguish both phases based on XRD patterns because of their similarity in conformation [ 5 , 23 ]. In this respect, Table 1 provides comprehensive detail on PLA conformation, crystalline phase formation, and the condition [ 5 , 23 , 38 ]. While taking the DSC results into consideration; the XRD results suggest the formation of crystalline states of α and α’. It is evident that two steps of annealing result in the construction of α crystalline phase with the highest crystallinity percentage after 12 h exposing to creep regime (under the constant load) at 150 °C. In contrast, thermal processing below the transition temperature at 105 °C and the same annealing time without loading forms both of the α, and α′ phases. The formation of these two crystalline states originates from the time of thermal processing, which was long enough for the transformation of α′ to α phase. It has been mentioned in the literature that crystalline transformation from α′ to α is a type of disorder to order phase transformation [ 30 , 39 ]. In order to supply an adequate viewpoint to both of the phases' crystalline states, considering their state in fibers and the transition between them respecting all the details of the crystalline state and the conformation of the chains, Fig. 7 is provided. Further description is provided in figure's caption. 3.3. Texturization Philips PW-3710 diffractometer was employed to illustrate the development of chain conformation in the crystalline phase. Annealing the material increases the order of the polymer chains, thus inhibiting dipole rotation and promoting the ferroelectric and PE properties of the material as an impact of the most thermodynamically stable state [ 43 ]. Annealing does not necessarily generate anisotropy and often acts to reduce it. Therefore, heat treatment alone is not a sufficient condition to ensure the PE properties of a polymer are expressed. Calculating Herman's orientation function is an effective procedure to obtain the degree of chain alignment. As the chains get aligned in a higher-order manner, Herman's orientation function would be closer to 1, and vice versa; the 0 calculated number would mean the inhomogeneously directed chains. Herman's orientation function represents polymer-chain orientation for systems with fiber symmetry (uniaxial orientation) and the Herman's-Stein orientation factors express uniaxial orientation for each of the crystallographic axes of crystalline polymers [ 44 ]. The calculated Herman's orientation factors, in the present case, are presented in Fig. 8a . Here below, we are going to discuss Herman's orientation factors higher than 0.3 because of the fact that the numbers lower than that have an inferior proportion of crystallites. On the one hand, as it is depicted, the chain alignment in the one-step annealed structure, has been led to the formation of 110 crystalline planes, either originated from the α′ or α phases. The calculated Heramn's orientation function has appeared having a number close to 0.48 in the range of 75–125 which denotes a high crystal rotation in this mentioned scope. On the other hand, Herman's orientation function of the two steps annealed structure possess higher values ranging between 220 and 310. To pave the way for understanding the evolution of Herman's orientation function, distribution of the preferential crystal orientation plane for one step and two step annealed scaffolds, are depicted in Fig. 8b , d and Fig. 8c , e , respectively. It can be concluded from the 3D graphs that the absence of peaks results into a low or zero values of Herman's orientation function. The intensity values represent the number of crystals aligned to a specific angle. In one-step annealed mats, the intensity is lower in comparison to the two steps annealed patches. This means that the preferential crystal orientation planes have been randomly oriented through one step annealing while it is going to be more texturized in two steps annealed samples. Herman's orientation functions are also higher in the case of one-step annealed condition, which is literally originated from the fact that crystals have not been aligned but are randomly oriented, i.e., the crystallites have been formed in various directions. It should be denoted that the PLA patterns don't represent a cloudy pattern of the amorphous structure [ 45 , 46 ] as well as representing an adapted scattering direction just related to the specified distribution of 110 planes [ 47 ]. As it is being tried to be well described, the two steps annealed structure have been strongly texturized, and most of the crystallites have been located approximately near the transverse direction (TD), that is to say, the normal direction of the 110 planes is perpendicular to the electrospinning direction. In this regard, it can be claimed that the crystallites have been formed aligned with the fibers direction. It can be concluded that annealing has the potential to cause a phase transformation, but the thermo-mechanical processing actually helps the crystal rotation of the chains within the fibers (2D-WAXD patterns in Fig. 8b , c , d , and e show the anisotropy of (200/110) planes and the preferential crystal orientation). The results indicate that the preferential orientation of the normal direction of 110 crystalline planes aligned with transvers direction. The annealing would cause such high anisotropy, however, it can be related to the creep-induced crystallization form α′ disordered crystalline structure to αcrystalline ordered structure [ 30 , 48 ]. During the thermomechanical processing, the amorphous chains gradually reorient in the plane of the fibers, and cause disappearing the randomly oriented halo. This type of texturization, in the absence of other higher-order peaks, represents the threedimensional crystalline order has been relatively well established. Taking the hole intensities in various directions in mind, low intensity diffracted peaks along the RD and TD do not exhibit well-developed crystalline regions. This behavior is due to the random orientation of the chain segments in the fiber plane. Thus they have a low chance to form in parallel pattern with each other and crystallize. Still, it is worth mentioning that the processing temperature was high enough to form a type of crystalline structure, actually in the direction of TD, up to a ratio of 59%, and it can be concluded that the crystallites are formed along the TD partially parallel to each other causing a promoted piezoelectric outcome."
} | 5,677 |
35903416 | PMC9328748 | pmc | 9,498 | {
"abstract": "The bio/sensors performance has been established to be significantly affected through partially or entirely alignment of nano/microfibrous in polymeric mats. The matter of crystalline/amorphous proportion in semicrystalline polymers is another factor that can affect the application of the piezoelectric patches. The present work deals with fabricating the scaffolds of micro/nanofibers through a modified electrospinning procedure. The ratio of the relevant organic and polar solvents, the beading, the degree of fiber alignment, and fiber thickness have been intentionally elaborated. An unaligned unbeaded nanofibrous mat has been fabricated after tuning the solvents to poly-lactic acid ratio. This paper, for the first time, deals with the calculation of the value of d 33 value of a commercial PLA and its improvement, it has been revealed that the d 33 piezoelectric property is improved as a consequence of the thermo-mechanical processing above the cold crystallization temperature. The applied thermo (mechanical) processing causes the structural evolution from amorphous to crystallized states. Formation of the α and α′ crystalline phases is introduced as the main responsible for the improvement of the piezoelectric property. This improvement not only is correlated with the degree of crystallinity, but also the orientation and alignment of the crystallites is known to be influential. In this respect, the complex helical chain structural evolution of poly-lactic acid has been analyzed through Herman's orientation function. It has been found that, besides the characterized disorder-to-order phase transformation, the C=O branched out dipoles interactions significantly affects by the texturization of the aligned polymeric chains in the direction of the electrospinning which is known as the main factor to promote the piezoelectric property of processed mat.",
"conclusion": "4. Conclusion In this paper, the PLA scaffolds d 33 piezo constant for the first time and its promotion regarding the crystallization induced through thermo-mechanical processing was measured. Annealing at 105 °C for 12 h resulted in the formation of both the disordered-α′ and ordered-α crystalline phases by the crystallinity percentage of 20% and 27%, respectively; a total crystallinity percentage of 47%. Creep-induced crystallization at 150 °C for 12 h was investigated, it resulted in the formation of the α phase holding higher crystallinity of about 59%. It was concluded that any thermal process above the cold crystallization temperature induced an appreciable crystallinity percentage up to 59%. Analyzing Herman's orientation function and texture evolution showed that the one-step annealing provided an appropriate condition for randomly oriented crystallites. In contrast, two steps of annealing resulted in a more texturized microstructure along the electrospinning direction. In one step annealed samples, piezoelectricity did not show a sharp increasing trend in comparison to un-treated scaffolds, while texturization in two steps-annealed patches caused a dramatic promotion of the d 33 piezoelectric value from 0.078 fc/N to 0.21fc/N.",
"introduction": "1. Introduction Considering the electroactive biopolymers following the potential to transduce mechanical and electrical energy, Poly-Lactic Acid (PLA) has drawn the researchers' attention. This is attributed to the non-centrosymmetric complex structure of PLA, as a Food and Drug Administration (FDA)-approved polymer, which has the potential to be studied in the course of piezoelectricity [ 1 , 2 ]. An individual chain, in polymer structure, may be non-centrosymmetric, but the amorphous network will be highly isotropic, which diminishes the probability of piezoelectricity. Interestingly, this type of centrosymmetric has been removed in amorphous PLA; therefore, the PLA shows piezoelectricity even in its non-crystalline state [ 3 , 4 ]. It has been proved that crystallization would improve the non-centrosymmetric structure. Among the 32 crystallographic point groups, 21 of them do not possess inversion symmetry which are the crystalline state of the polymers [ 2 ]. PLA crystallizes into four distinct phases, among them α’ with pseudo hexagonal unit cell and α with an orthorhombic crystalline structure [ 5 ]. Achieving an utterly crystallized structure is impossible in polymers; in the meanwhile of crystallization, crystalline regions will grow within the amorphous matrix, and on average, these crystallites will exhibit a randomly oriented distribution [ 6 , 7 ]. Among the various procedures improving the non-centrosymmetric structure, stretching is a common method [ 8 ]. Polymers possessing handedness, those with helical conformation as a consequence of chiral monomer units, can contain a mirror plane perpendicular to its drawing axis, and thus because of the breaking of the mirror plane by the helical twist, the piezoelectricity can be improved [ 9 ]. Another promising method which can be used to promote the anisotropy is electrical poling, through which a large tendency of dipole alignment is achieved within the structure. This is only applicable in the case of ferroelectric materials where the polarization is spontaneous and reversible [ 10 ]. Piezoelectricity defines as the physical properties of the materials containing the dipole groups which do not cancel each other within the microstructure of the complex material's structure. There are many PE constants regarding the type of normal or shear piezoelectricity and direct or diverse piezoelectricity; in order to provide an appropriate portrayal to them, Fig. 1 is presented. There are two diverse types of piezoelectricity; Normal and shear. Normal PE assigns to the materials that react to the employed force straightly. When the structure deforms in X, Y, or Z directions, the electrical charge concentrates on one of the suggested directions of the specimen. When an excitation charge employs the unit, volume growth appears in the same way. The shear piezoelectricity issues into the statement in materials that twist the sample in acknowledgment of the electrical stimulation [ 11 ]. Stretching the polymer adjusts the amorphous strands in the film/fiber plane and promotes uniform rotation of the crystallites by an electric field. Depending on whether stretching is uniaxial or biaxial, the electrical and mechanical properties are either highly anisotropic or isotropic in the plane of the polymer sheet. Polymer poling can be accomplished using a direct contact method or a corona discharge. In this fashion, one of the favorite techniques is ES. During the ES process, speedy solvent drying constitutes an amorphous structure of oriented fibers; increasing the crystallinity is more comfortable by the secondary hot drawing process. By diminishing the fiber diameter, more surface area is achieved, and thus, the glass transition and melt temperature inconsiderably wane [ 12 ]. In the case of PLA, the d 14 PE constant has been studied chiefly, and it has been demonstrated that the order of constant ranges between 9 and 11 pc/N [ 13 , 14 ]. In comparison, post-treatment such as annealing or further thermomechanical process has the potential to increase this PE constant approximately near to 20 pc/N [ 15 ]. There is a huge lack of knowledge around the calculation of the PLA PE d 33 constant and its fluctuation as a result of the thermo-mechanical process. The most well-known PLA PE constant is defined as d 14 . Throughout the experimental measurements of research from Occhiai et al. on 0-cut PLLA, carrying side along z-axis which also was their elongation axis, samples manifested these cases had a d 14 PE coefficient equal to 9.82 pC/N [ 16 ]. The piezoelectricity not only is sensitive to the glassy transition behavior, but also is a function of crystalline/amorphous structure characteristics. It has been [ 17 ] illustrated that the amorphous region will contribute to the piezoelectricity just if the molecular chains follow some degree of alignment at least. On the one hand, chirality and helical PLA conformation provide a proper condition for the presence of piezoelectricity even in the absence of any further processing; thus, simply aligning the polymer chains is sufficient to remove any centrosymmetric and permit piezoelectricity [ 18 ]. In this respect, the thermo-mechanical processing is highly capable to change the alignment of polymeric chains accommodating the applied stress. This significantly reorganizes the crystalline regions embedded within the amorphous matrix and improves the non-centrosymmetric structure. As a semicrystalline polymer, the crystallization process and crystal structure of PLA have been studied by various groups. PLA has the potential to experience four kinds of crystal modification, where α, α’, β, and γ phases are formed under the different preparation process [ 19 - 22 ]. The most thermodynamically stable phase, α form, has a 10 3 helical chain conformation [ 23 ] which can crystallize from melt or solution and mainly differentiate from the α′ form. The α′ form crystallizes at temperatures below 120 ° C and is known to be the disorder form of α, while the α form achieves above this disorder to order transformation temperature [ 19 ]. In another opinion, PLA is not classified as a ferroelectric material, and uniaxial arrangement would serve sufficient to compromise its natural piezo-response. Therefore, because of the original PE characteristics of the PLA, no additional fabrication manner more further than the stretching approach, which is essential to provoke uniaxial oriented chains, is expected. Influencing the piezoelectricity is also feasible by polymer thermally stretching; by this process, the phase transition from α′ to α springs, and so on, a switch from randomly oriented molecular chains to aligned chains might be achieved [ 24 ]. In helical PLA molecule chains, shear strain in the direction of the helix axis insignificantly twists the permanent bond dipoles and thus alters the polarization perpendicular to the plane of shear strain [ 25 , 26 ]. One of the disadvantages in this field is the PLA magnitude of piezoelectricity, which is much lower compared with most of the other PEs; solving this drawback, savants, on the one hand, inaugurated to invent hybrid biomaterials and, on the other hand, concentrated on phase transitions and stabilizing them. The convention magnitude between mechanical applied deformation and the electricity generated charge is a function of the PE constant [ 27 ]. Coming to the point, the formation of crystalline phases and its effect on d 14 piezoelectric outcome has been presented in the previous literature, but it's the first time that the PLA 2003D is being analyzed to understand the d 33 piezoelectric outcome of the mats. In this respect, electrospinning is considered as the best fabrication procedure to induce piezoelectricity in PLA ECM mimicking mats. The high shear force is applied to the chains which is expected to stimulate C=O dipoles to be oriented even in an amorphous structure. In fact, PLA is not a ferroelectric polymer, but it shows piezoelectricity even in amorphous state while inducing a partially long-range ordering of the chains through thermo- and/or mechanical work. The current work also explores the impact of crystallite orientation on the piezoelectric property. As a side benefit, regarding the fabrication of interconnected porous mats; in addition to what has already been denoted, a micro-aligned mat, or nanoscale fibers possess a tremendous potential to be used as artificial organs or at least a base for migration of the immature cells to the cells which are dead or can't perform their duty.",
"discussion": "3. Result and discussion 3.1. Piezoelectricity (d 33 ) of the mats It has been demonstrated that by ES and the fabrication of micro/nanofibers, the PE performance of the non-ferroelectric materials, especially PLA, increases [ 31 ], in this way, it is essential to have smooth and thin homogenously distributed fibers with the absence of beaded regions in them, which is a result of various variables [ 32 , 33 ], namely; the type of solvents, the proportion of solvent and polymer, the humidity and also the atmosphere temperature, the ES applied potential and also the collector to nuzzle distance all are demonstrated in Fig. 2 . As it is depicted in Fig. 3 , an appropriate selection of solvents DMF and DCM results in the formation of mostly beadles fibers, where the fibers have not been aligned because of the low number of drum rotation. As it is visible in i, j, k figures, the fibers shown some beaded regions within themselves, but annealing removes these highly amorphous regions, and as it is depicted in the median, f, g, and h SEM figures, of the one step annealed samples and of course the upper column of two steps annealed samples, the beaded regions are cleared away. The post-processing operation actually causes an increase in fiber diameters and also their alignment, as depicted in Fig. 3d and e . As it is obvious in Fig. 4 , the piezoelectricity has been increased through post-processing treatment slightly by one step annealing at 105 °C and dramatically by two step annealing at 150 °C (up to 3 times higher than the just spun samples). The issue which is in the course of attention is the root of this promotion and is going to be answered in the following sections. As it is claimed by Zhao et al. [ 34 ], each fiber PE outcome is about 3.1 pc/N, and it is possible to hypothesis that the low PE outcome of these patches is based on the misaligned fibers that cancel out each other piezo property in comparison to amplification. 3.2. Phase transition behavior First of all, it is essential to investigate the effect of the thermal process on polymer chains and bondings; to make it clear the FTIR results are projected in Fig. 5 . The important peaks of C=O as the source of piezoelectricity and other bonds have not changed in one step or two steps annealed process. Two small bands at 921 cm −1 and 955 cm −1 are ascribed to a 10 3 helix sensitive crystallization band and amorphous structure, respectively. In the α phase, the carbonyl stretching vibrations bands showed a complex splitting pattern at 1776, 1759, and 1749 cm −1 . In the α′ phase PLA film, the carbonyl stretching vibrations bands had only a single peak at 1759 cm −1 . The same results have been reported in [ 35 , 36 ]. Differential Scanning Calorimetry (DSC) was used to investigate the crystallinity percentage of the semicrystalline PLA polymer. The crystallinity percentage is determined to be induced by any thermal process, including annealing and also thermo-mechanical process. It is proved that the promotion of the crystallinity percentage effectively promotes the PE properties [ 15 ]. Micro/nanoscale piezoelectricity measurements are attainable by advanced characterization techniques [ 37 ]. For instance, Smith et al. inscribed the determination of shear piezoelectricity in extremely oriented PLLA nanowires, which were also extremely crystalline, the interpreted result terminated an advance in the degree of crystallinity up to 70%, using PE Force Microscopy (PFM), the estimated d14 PE coefficient was about 8 pC/N [ 37 ]. As it is apparent in Fig. 6 , from the just spun samples to the two steps annealed patches, the crystallinity percentage shows an increasing trend. The matter of crystalline structure in polymers arises from the alignment of chains, and the chain relaxation is much faster than chain extension at ES conditions, which results in the most amorphous structure of the as-spun sample, as is tangible in Fig. 6b . The α crystalline diffraction peaks of 1D-XRD which are formed at a temperature above 120 °C, appear at 2θ values of 16.7°, 19.1°, 22.4° corresponding to Miller indices for planes 200/110, 203, 015, respectively. However, the 1D-XRD diffraction peaks of α’ crystalline phase, which is induced from an amorphous state at temperatures below the 120 °C, appear at 2θ values of 16.4°, 18.7°, corresponding to 200/110, 203 planes, respectively. It is difficult to distinguish both phases based on XRD patterns because of their similarity in conformation [ 5 , 23 ]. In this respect, Table 1 provides comprehensive detail on PLA conformation, crystalline phase formation, and the condition [ 5 , 23 , 38 ]. While taking the DSC results into consideration; the XRD results suggest the formation of crystalline states of α and α’. It is evident that two steps of annealing result in the construction of α crystalline phase with the highest crystallinity percentage after 12 h exposing to creep regime (under the constant load) at 150 °C. In contrast, thermal processing below the transition temperature at 105 °C and the same annealing time without loading forms both of the α, and α′ phases. The formation of these two crystalline states originates from the time of thermal processing, which was long enough for the transformation of α′ to α phase. It has been mentioned in the literature that crystalline transformation from α′ to α is a type of disorder to order phase transformation [ 30 , 39 ]. In order to supply an adequate viewpoint to both of the phases' crystalline states, considering their state in fibers and the transition between them respecting all the details of the crystalline state and the conformation of the chains, Fig. 7 is provided. Further description is provided in figure's caption. 3.3. Texturization Philips PW-3710 diffractometer was employed to illustrate the development of chain conformation in the crystalline phase. Annealing the material increases the order of the polymer chains, thus inhibiting dipole rotation and promoting the ferroelectric and PE properties of the material as an impact of the most thermodynamically stable state [ 43 ]. Annealing does not necessarily generate anisotropy and often acts to reduce it. Therefore, heat treatment alone is not a sufficient condition to ensure the PE properties of a polymer are expressed. Calculating Herman's orientation function is an effective procedure to obtain the degree of chain alignment. As the chains get aligned in a higher-order manner, Herman's orientation function would be closer to 1, and vice versa; the 0 calculated number would mean the inhomogeneously directed chains. Herman's orientation function represents polymer-chain orientation for systems with fiber symmetry (uniaxial orientation) and the Herman's-Stein orientation factors express uniaxial orientation for each of the crystallographic axes of crystalline polymers [ 44 ]. The calculated Herman's orientation factors, in the present case, are presented in Fig. 8a . Here below, we are going to discuss Herman's orientation factors higher than 0.3 because of the fact that the numbers lower than that have an inferior proportion of crystallites. On the one hand, as it is depicted, the chain alignment in the one-step annealed structure, has been led to the formation of 110 crystalline planes, either originated from the α′ or α phases. The calculated Heramn's orientation function has appeared having a number close to 0.48 in the range of 75–125 which denotes a high crystal rotation in this mentioned scope. On the other hand, Herman's orientation function of the two steps annealed structure possess higher values ranging between 220 and 310. To pave the way for understanding the evolution of Herman's orientation function, distribution of the preferential crystal orientation plane for one step and two step annealed scaffolds, are depicted in Fig. 8b , d and Fig. 8c , e , respectively. It can be concluded from the 3D graphs that the absence of peaks results into a low or zero values of Herman's orientation function. The intensity values represent the number of crystals aligned to a specific angle. In one-step annealed mats, the intensity is lower in comparison to the two steps annealed patches. This means that the preferential crystal orientation planes have been randomly oriented through one step annealing while it is going to be more texturized in two steps annealed samples. Herman's orientation functions are also higher in the case of one-step annealed condition, which is literally originated from the fact that crystals have not been aligned but are randomly oriented, i.e., the crystallites have been formed in various directions. It should be denoted that the PLA patterns don't represent a cloudy pattern of the amorphous structure [ 45 , 46 ] as well as representing an adapted scattering direction just related to the specified distribution of 110 planes [ 47 ]. As it is being tried to be well described, the two steps annealed structure have been strongly texturized, and most of the crystallites have been located approximately near the transverse direction (TD), that is to say, the normal direction of the 110 planes is perpendicular to the electrospinning direction. In this regard, it can be claimed that the crystallites have been formed aligned with the fibers direction. It can be concluded that annealing has the potential to cause a phase transformation, but the thermo-mechanical processing actually helps the crystal rotation of the chains within the fibers (2D-WAXD patterns in Fig. 8b , c , d , and e show the anisotropy of (200/110) planes and the preferential crystal orientation). The results indicate that the preferential orientation of the normal direction of 110 crystalline planes aligned with transvers direction. The annealing would cause such high anisotropy, however, it can be related to the creep-induced crystallization form α′ disordered crystalline structure to αcrystalline ordered structure [ 30 , 48 ]. During the thermomechanical processing, the amorphous chains gradually reorient in the plane of the fibers, and cause disappearing the randomly oriented halo. This type of texturization, in the absence of other higher-order peaks, represents the threedimensional crystalline order has been relatively well established. Taking the hole intensities in various directions in mind, low intensity diffracted peaks along the RD and TD do not exhibit well-developed crystalline regions. This behavior is due to the random orientation of the chain segments in the fiber plane. Thus they have a low chance to form in parallel pattern with each other and crystallize. Still, it is worth mentioning that the processing temperature was high enough to form a type of crystalline structure, actually in the direction of TD, up to a ratio of 59%, and it can be concluded that the crystallites are formed along the TD partially parallel to each other causing a promoted piezoelectric outcome."
} | 5,677 |
26237128 | null | s2 | 9,499 | {
"abstract": "The fabrication of multifunctional materials with tunable structure and properties requires programmed binding of their building blocks. For example, particles organized in long-ranged structures by external fields can be bound permanently into stiff chains through electrostatic or van der Waals attraction, or into flexible chains through soft molecular linkers such as surface-grafted DNA or polymers. Here, we show that capillarity-mediated binding between magnetic nanoparticles coated with a liquid lipid shell can be used for the assembly of ultraflexible microfilaments and network structures. These filaments can be magnetically regenerated on mechanical damage, owing to the fluidity of the capillary bridges between nanoparticles and their reversible binding on contact. Nanocapillary forces offer opportunities for assembling dynamically reconfigurable multifunctional materials that could find applications as micromanipulators, microbots with ultrasoft joints, or magnetically self-repairing gels."
} | 252 |
29579121 | PMC5868833 | pmc | 9,500 | {
"abstract": "Metabolic engineering focuses on rewriting the metabolism of cells to enhance native products or endow cells with the ability to produce new products. This engineering has the potential for wide-range application, including the production of fuels, chemicals, foods and pharmaceuticals. Glycolysis manages the levels of various secondary metabolites by controlling the supply of glycolytic metabolites. Metabolic reprogramming of glycolysis is expected to cause an increase in the secondary metabolites of interest. In this study, we constructed a budding yeast strain harboring the combination of triple sirtuin gene deletion ( hst3 ∆ hst4 ∆ sir2 ∆) and interruption of gluconeogenesis by the deletion of the FBP1 gene encoding fructose-1,6-bisphosphatase ( fbp1 ∆). hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells harbored active glycolysis with high glucose consumption and active ethanol productivity. Using capillary electrophoresis–time-of-flight mass spectrometry (CE–TOF/MS) analysis, hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells accumulated not only glycolytic metabolites but also secondary metabolites, including nucleotides that were synthesized throughout the pentose phosphate (PP) pathway, although various amino acids remained at low levels. Using the stable isotope labeling assay for metabolites, we confirmed that hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells directed the metabolic fluxes of glycolytic metabolites into the PP pathway. Thus, the deletion of three sirtuin genes ( HST3 , HST4 and SIR2 ) and the FBP1 gene can allow metabolic reprogramming to increase glycolytic metabolites and several secondary metabolites except for several amino acids.",
"introduction": "Introduction Metabolic engineering is the science of rewriting the metabolism of cells to enhance native products or endow cells with the ability to produce new products [ 1 ]. This engineering has the potential for wide-range application, including the production of fuels, chemicals, foods and pharmaceuticals. The combination of bioinformatics and mathematical modeling methods, which enable quantitative analysis, has facilitated the development of metabolic engineering to generate genetic modifications that alter cellular metabolism to direct the fluxes toward the product of interest [ 1 ]. Glycolysis plays a pivotal role in central carbon metabolism and may become an important target of metabolic engineering. This biochemical reaction catabolizes glucose as a carbon source and produces pyruvate, adenosine triphosphate (ATP) and various glycolytic intermediates [ 2 ]. Glycolytic metabolites are employed in secondary metabolic reactions, such as lipid and amino acid metabolism, to produce considerable species of secondary metabolites [ 3 ]. For example, glycolysis shunts into the pentose phosphate (PP) pathway, producing much-needed nucleotides for proliferation ( Fig 1A ). Increased glycolysis is utilized in cellular proliferation. The Warburg effect shifts from oxidative phosphorylation to aerobic glycolysis, characteristic of cancer cells [ 4 – 6 ]. Cancer cells drive glycolysis to generate ATP at a faster rate than oxidative phosphorylation, while producing less reactive oxygen species (ROS), nucleotides much needed throughout the PP pathway for rapid proliferation. Additionally, an increase in the fermentation of microbes contributes to human life. Budding yeast ( Saccharomyces cerevisiae ) harbors active glycolysis equipped with strong fermentation ability. This organism has been utilized to produce fermentative foods or beverages and has been recently utilized in the biofuel industry to produce biofuels such as ethanol and 1-butanol [ 7 – 9 ]. Metabolic engineering to activate glycolysis has the potential to achieve an increase in various secondary metabolic pathways. 10.1371/journal.pone.0194942.g001 Fig 1 The hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells harbor active glucose metabolism but cannot contribute to cell growth. (A) Pathway of central carbon metabolism in budding yeast based on information from the Saccharomyces genome database website ( http://www.yeastgenome.org/ ). G1P: glucose 1-phosphate, G6P: glucose 6-phosphate, PEP: phosphoenolpyruvate, PP pathway: pentose phosphate pathway, R5P: ribose 5-phosphate, and AcCoA: acetyl-CoA. (B) Comparison of glucose consumption among strains. Wild-type, fbp1 ∆, hst3 ∆ hst4 ∆ sir2 ∆ and hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells (1×10 6 cells/ml) were released into fresh YPD medium and were cultured at 25°C. A small aliquot of medium was picked up following the time course to measure the cell number, glucose concentration, and ethanol concentration in medium (Panels A and B in S2 Fig ). The P-value matrix contains the Mann-Whitney U-test p-value for a one-tailed test (wild-type vs. hst3 ∆ hst4 ∆ sir2 ∆ at 5 h in time course, wild-type vs. hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ at 24 h). P-values were calculated using ystat2008 software (Igakutosho, Japan) (*p<0.05). (C) Comparison of the ethanol productivity among yeast strains. The ethanol productivity was calculated as the concentration of ethanol released in medium per cell number at 24 h in cell cultivation (Panels A and B in S2 Fig ). Multiple comparisons among strains (wild-type, hst3 ∆ hst4 ∆ sir2 ∆ and hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆) were performed (non-repeated measures ANOVA with the Student-Newman-Keuls (SNK) test) (*p<0.05 and **p<0.01). Values are expressed as the means ± standard deviations. The experiments were repeated three times. Gluconeogenesis, almost the reverse biochemical reaction of glycolysis, is activated to utilize a carbon source other than glucose [ 3 ]. In budding yeast, the main gluconeogenesis-specific enzymes are fructose-1,6-bisphosphatase (Fbp1), isocitrate lyase carboxykinase (Icl1), malate dehydrogenase (Mdh2), and phosphoenolpyruvate carboxykinase (Pck1) [ 3 , 10 ]. An increase in both glycolysis and glucose storage is manifested in aged yeast cells, caused by an abnormal activation of gluconeogenesis [ 11 , 12 ]. Some aging-related gene deletions exhibit a metabolic status that mimics that of aged yeast cells [ 11 , 12 ]. NAD + -dependent deacetylases, which are also called sirtuins, are involved in multiple cellular functions, including gene silencing, genome maintenance, cellular metabolism and cellular aging [ 13 , 14 ]. Among the five genes in the budding yeast sirtuin family ( SIR2 and HST1/2/3/4 ), Sir2, Hst3 and Hst4 are involved in the regulation of cellular lifespan and cell metabolism [ 15 , 16 ]. The increase in both glycolysis and glucose storage manifested in hst3 ∆ hst4 ∆ cells reflect enhanced gluconeogenesis [ 11 , 12 ]. Additionally, sir2 ∆ cell exhibits enhanced gluconeogenesis by maintaining the acetylated form of Pck1 to prevent the conversion from phosphoenol pyruvate (PEP) to oxaloacetate [ 17 ]. Interestingly, the TDH2 gene encodes a glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the deletion causes the interruption of gluconeogenesis [ 12 ]. Additional deletion of the TDH2 gene coordinates the levels of glycolytic metabolites to restore the slow growth of hst3 ∆ hst4 ∆ cells [ 12 ]. This indicated that the interruption of gluconeogenesis can direct the glycolytic flux toward secondary metabolism to promote the growth of sirtuin-deleted cells. In this study, we tried to examine whether the combination of sirtuin gene deletion and interruption of gluconeogenesis would create metabolic reprogramming of glycolysis to achieve increased secondary metabolism. We constructed a yeast strain harboring sirtuin gene deletions ( hst3 ∆ hst4 ∆ sir2 ∆) combined with the interruption of gluconeogenesis ( fbp1 ∆) ( S1 Fig ). hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells harbored active glucose metabolism with high glucose consumption and active ethanol productivity. Capillary electrophoresis–time-of-flight mass spectrometry (CE–TOF/MS) analysis revealed that not only the levels of glycolytic metabolites but also those of other secondary metabolites were dramatically increased in hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells, although several amino acids were decreased. Using the stable isotope-labeling assay for the metabolites, we confirmed that the metabolic fluxes of glycolytic metabolites were strengthened to enter the PP pathway in hst3 ∆ hst4 ∆ sir2 ∆ fbp1 ∆ cells. Thus, the deletion of both the three sirtuin genes ( HST3 , HST4 and SIR2 ) and FBP1 gene can allow metabolic reprogramming to increase glycolytic metabolites and several secondary metabolites except for several amino acid syntheses.",
"discussion": "Discussion Glycolysis manages the levels of various secondary metabolites by controlling the supply of glycolytic metabolites. Metabolic reprogramming of glycolysis, which directs the flux of glycolytic metabolites to specific secondary metabolic pathways, would be useful to increase the production of the secondary metabolites of interest. In this study, we constructed budding yeast cells that harbored the combination of a triple sirtuin gene deletion ( hst3 Δ hst4 Δ sir2 Δ) and the interruption of gluconeogenesis ( fbp1 ∆). The hst3 Δ hst4 Δ sir2 Δ fbp1 Δ quadruple gene deletion cold also create metabolic reprogramming to direct glycolytic metabolites to achieve an increase in several secondary metabolites, except for several amino acids ( Fig 5 ). 10.1371/journal.pone.0194942.g005 Fig 5 Schematic model to increase the levels of secondary metabolites in hst3 Δ hst4 Δ sir2 Δ fbp1 Δ cells. In wild-type cells, glycolysis is activated in the presence of glucose, in which gluconeogenesis typically remains repressed [ 3 ], and provides glycolytic metabolites for secondary metabolism. Therefore, the level of glycolytic metabolites remains low ( Fig 2B and S1 Table ). However, in sirtuin gene deletion ( hst3 Δ hst4 Δ sir2 Δ) cells, gluconeogenesis is activated even in the presence of glucose [ 12 , 17 ]. This might cause conflict with active glycolysis and then accumulated glycolytic metabolites. In hst3 Δ hst4 Δ sir2 Δ fbp1 Δ cells, the interruption of gluconeogenesis by fbp1 gene deletion may direct the metabolic flux to flow into secondary metabolism, thereby increasing the levels of secondary metabolites ( Fig 5 ). Interestingly, several amino acids remained at low levels in sirtuin gene deletion cells ( hst3 Δ hst4 Δ sir2 Δ and hst3 Δ hst4 Δ sir2 Δ fbp1 Δ), although abundant glycolytic metabolites were available. This finding suggests that sirtuins (Hst3, Hst4 and Sir2) play important roles in managing a wide spectrum of amino acid syntheses. In other eukaryotes, sirtuin is involved in amino acid synthesis. In mice, Sirt4 controls leucine metabolism [ 27 ]. The target(s) of sirtuins (Hst3, Hst4 and Sir2) in several amino acid synthesis pathways may be key enzymes, leading to metabolic flux in the amino acid synthesis. Metabolic reprogramming based on the combination of both sirtuin deletions and interruption of gluconeogenesis would be applicable to other livings and is expected to achieve a high yield of secondary metabolites, such as fermentation. Sirtuin has been widely conserved from microbes to humans and is involved in energy metabolism [ 14 ]. The enzymatic reactions and enzymes in both glycolysis and gluconeogenesis are also conserved among organisms. In budding yeast, double deletion of the HST3 HST4 genes induces the persistent acetylation of histone H3 on lysine 56 (H3-K56) throughout the chromosome, triggering chromosomal fragility and causing harmful effects for cell viability [ 16 , 28 ]. The utilization of host organisms with no histone acetylation equivalent to H3-K56 acetylation regulated by sirtuin or no obvious nucleosome structure is expected to achieve a high increase in secondary metabolism by avoiding the reduction in cell viability due to chromosomal fragility."
} | 2,955 |
35810320 | PMC9544109 | pmc | 9,501 | {
"abstract": "Abstract Plants interacting with mutualistic fungi (MF) or antagonistic fungi (AF) can form associations with bacteria. We assessed whether the performance gain conferred by mutualistic bacteria to fungal‐associated plants is affected by the interaction between symbiont traits, type of bacterial‐protective traits against AF and abiotic/biotic stresses. Results showed that (A) performance gain conferred by bacteria to MF‐associated plants was greater when symbionts promoted distinct rather than similar plant functions, (B) bacterial‐based alleviation of the AF's negative effect on plants was independent of the type of protective trait, (C) bacteria promoted a greater performance of symbiotic plants in presence of biotic, but not abiotic, stress compared to stress‐free situations. The plant performance gain was not affected by any fungal‐bacterial trait combination but optimised when bacteria conferred resistance traits in biotic stress situations. The effects of bacteria on fungal‐associated plants were controlled by the interaction between the symbionts' functional traits and the relationship between bacterial traits and abiotic/biotic stresses.",
"introduction": "INTRODUCTION Plants within natural and managed ecosystems commonly interact with mutualistic and antagonistic fungi (MF and AF respectively). Examples of MF include mycorrhizae and endophytes that belong to the families Glomeraceae (e.g. Rhizophagus ) and Serendipitaceae (e.g. Serendipita ) respectively. AF include biotrophic and necrotrophic pathogens within the orders Erysiphales (e.g. Blumeria ), Pleosporaceae (e.g. Alternaria ) and Sclerotiniaceae (e.g. Botrytis ) (Balestrini, 2021 ; Porras‐Alfaro & Bayman, 2011 ). MF positively affect plant fitness by promoting plant growth, conferring protection against abiotic and biotic stresses and increasing nutrient acquisition (Partida‐Martínez & Heil, 2011 ). AF negatively affect plant fitness by disrupting the structure and function of plant organs and/or tissues (Doehlemann et al., 2017 ). As well as interacting with fungi, plants can simultaneously form associations with mutualistic bacteria. Examples include soil‐borne and/or endophytic microbes that belong to phyla Actinobacteria (e.g. Streptomyces ), Firmicutes (e.g. Bacillus ) and Proteobacteria (e.g. Rhizobium ) (Bastías et al., 2020 ; Bonfante et al., 2019 ). Bacteria can increase plant fitness by (1) directly enhancing the plant's ability to function and/or (2) indirectly, by affecting the growth/activities of plant‐associated fungi (MF or AF) (Bangera & Thomashow, 1999 ; Frey‐Klett et al., 2011 ; Glick, 2012 ). Bacteria can enhance the function of their plant hosts via growth promotion, stress protection, and/or by improving the host plant's nutrient acquisition (Glick, 2012 ). Bacteria can also affect plant‐associated fungi by stimulating the growth of MF (e.g. providing essential vitamins) or supressing the activities of AF (e.g. via anti‐fungal compounds) (Bangera & Thomashow, 1999 ; Frey‐Klett et al., 2011 ; Glick, 2012 ). The factors controlling the performance gain conferred by bacteria to plants associated with fungi have been scarcely studied (Larimer et al., 2010 ; Porter et al., 2020 ). We investigate whether bacteria affect the performance gain of plants that are simultaneously associated with fungi (MF or AF) and determine if this performance gain is affected by the trait interaction between symbionts, the type of protection traits conferred by bacteria against AF, and abiotic/biotic environmental stresses. Plants typically form concurrent mutualistic tripartite symbioses with both fungi and bacteria (Larimer et al., 2014 ). Within these symbioses, plants can associate with fungi and bacteria that confer traits promoting distinct or identical/similar functions to that of their plant hosts. Associations with functionally distinct symbionts include plants simultaneously interacting with fungi and bacteria that enhance the plant's acquisition of nutrients and promote host plant growth via the production of hormones, respectively (e.g. Vivas et al., 2006 ). In contrast, associations with functionally equivalent symbionts include plants symbiotic with both fungi and bacteria that increase the plant's acquisition of nutrients from soil (e.g. Minaxi et al., 2013 ). The performance gain conferred by mutualistic bacteria to MF‐associated plants depends on the interaction between the traits conferred by both symbionts (Afkhami et al., 2014 ). Fungal and bacterial symbionts that confer distinct functional traits to their plant hosts may enhance plant performance to a greater degree than those that confer equivalent functional traits to their plant hosts (Larimer et al., 2010 ). For example, tomato ( Solanum lycopersicum syn. Lycopersicon esculentum ) plants exhibited a higher biomass when they were simultaneously associated with a phosphorus‐enhancing fungus and a growth‐promoting bacterium (Gamalero et al., 2003 ), compared to tomato plants simultaneously associated with only phosphorus‐enhancing microbes (Gamalero et al., 2004 ). Plants can also form tripartite symbioses with AF and mutualistic bacteria (Kobayashi & Crouch, 2009 ). These bacteria are able to ameliorate the negative effects imparted by AF by conferring disease resistance and/or tolerance traits (Hol et al., 2013 ; Roy & Kirchner, 2000 ). Bacterial resistance traits can reduce AF‐induced plant damage by directly affecting the phytopathogen, for example by the production of antifungal metabolites and/or promotion of host plant defences (Khan et al., 2018 ; Martínez‐Hidalgo et al., 2015 ). Bacterial tolerance traits reduce the negative impact of AF by increasing plant fitness without directly affecting the phytopathogen, for example by direct enhancement of plant growth via the production of growth‐promoting hormones and/or the acquisition of nutrients from soil (Hashem et al., 2017 ). The performance gain conferred by mutualistic bacteria to AF‐associated plants largely depends on the types of protection traits that bacteria confer to their host plants. Bacteria that confer a combination of resistance and tolerance traits may alleviate the negative effects caused by AF to a greater degree than those that provide only resistance or only tolerance traits. For example, the size of leaf lesions caused by the pathogen S clerotinia sclerotiorum on rapeseed ( Brassica napus ) plants was significantly reduced when plants were associated with a bacterial strain that was able to produce a combination of resistance and tolerance traits (i.e. antifungal compounds and auxin growth‐promoting hormones) compared to plants that were associated with another strain that only produced a tolerance trait (i.e. auxin production) (Sun et al., 2017 ). The performance gain conferred by bacteria to plants associated with fungi (MF or AF) may also be influenced by abiotic and biotic stresses experienced by their hosts (Afkhami et al., 2014 ; Porter et al., 2020 ). Bacteria that confer stress protection traits may enhance the performance of plants associated with MF or AF to a greater degree in the presence of abiotic or biotic stresses compared to situations where the stress is absent. For example, in a tripartite plant‐fungal‐bacterial mutualism experiencing an abiotic stress, a halotolerant bacterium increased the growth of maize ( Zea mays ) plants associated with mycorrhizal fungi under salt stress, but this growth promotion was not observed in situations when this stress was absent (Selvakumar et al., 2018 ). Furthermore, within a plant‐fungal‐bacterial mutualism experiencing a biotic stress, tomato plants associated with mycorrhizal fungi and a nematocidal bacterium gained more foliar biomass in the presence of the root knot nematode ( Meloidogyne incognita ) than when these tripartite symbiotic plants were grown in the absence of this nematode (Siddiqui & Sayeed Akhtar, 2009 ). Similarly, in a tripartite symbiosis with AF and mutualistic bacteria, tomato plants associated with a bacterium that induced host plant defences showed a greater net gain of plant height when symbiotic plants were also infected by a phytopathogen ( Botrytis cinerea ) compared with symbiotic plants that were pathogen‐free (Kim et al., 2017 ). We evaluated the performance gain of plants conferred by mutualistic bacteria associated with MF or AF across three different symbiotic scenarios (Figure 1 ): (A) the interaction between traits conferred by MF and bacteria, that is symbionts conferring functionally distinct vs. functionally equivalent traits, (B) the types of protection traits conferred by bacteria against AF, that is resistance & tolerance versus only resistance versus only tolerance traits against AF and (C) the abiotic/biotic environmental stresses, for example drought, phytopathogen infection. For this undertaking, we performed quantitative meta‐analyses and general linear models (GLM) using data from published articles. We evaluated the following hypotheses (Figure 1 ). First, for plants interacting with MF, we evaluated whether bacteria conferring distinct functional traits than those provided by fungi to their host plants would increase plant performance to a greater degree than symbionts conferring equivalent functional traits (e.g. bacteria that stimulate plant nutrition via nitrogen fixation and fungi that produce plant growth‐promoting hormones vs. bacteria and fungi that both stimulate plant nutrition) (Figure 1a ). Additionally, we evaluated which combination or type of fungal‐bacterial functional traits enhanced plant performance to a greater degree. Second, for plants interacting with AF, we evaluated whether bacteria conferring both resistance and tolerance traits simultaneously against AF would alleviate to a greater degree the negative effects of AF on plant performance than bacteria providing these trait types separately (e.g. bacteria that produce antifungal compounds and plant growth‐promoting hormones vs. bacteria that produce only plant growth‐promoting hormones) (Figure 1b ). Finally, we evaluated whether bacteria that confer stress protection traits to their symbiotic plant hosts could promote greater performance in the presence of an abiotic or biotic stress as opposed to situations where this stress was absent (e.g. bacteria that produce nematocidal compounds that benefit their MF‐associated host plants in the presence of nematodes vs. the same plant‐fungal‐bacterial association that lacks infection by nematodes) (Figure 1c ). In studies where symbiotic plants experienced biotic stress, we also evaluated which type of stress protectional trait conferred by bacteria promoted greater plant performance gain in the presence/absence of this stress. FIGURE 1 Predicted effects of three major factors on the performance gain conferred by bacteria to plants associated with Mutualistic Fungi (MF) or Antagonistic Fungi (AF). (a) Interaction between MF‐bacterial traits: Fungi and bacteria that confer traits promoting distinct plant functions may lead to a greater gain in plant performance than symbionts that confer traits enhancing similar/identical plant functions (i.e. functionally distinct MF‐bacteria vs. functionally equivalent MF‐bacteria). (b) Type of protection traits conferred by bacterial symbionts: bacteria that confer both pathogen resistance and tolerance traits to plants interacting with AF may alleviate to a greater degree the AF's negative effect on plant performance than bacteria that confer these trait types separately. (c) Abiotic/biotic environmental stresses: bacteria that confer stress‐protective traits to their MF‐associated plant hosts may lead to a greater gain in plant performance in the presence of abiotic/biotic stresses compared to those plants in the absence of any stress.",
"discussion": "DISCUSSION The factors regulating the performance gain conferred by bacteria to plants interacting with fungi have been scarcely studied. Our meta‐analysis strongly advances the notion that the performance gain conferred by bacteria to MF‐associated plants was greater when symbionts added traits that enhanced distinct plant functions compared to symbionts that promoted identical/similar functions. In addition, the performance gain in plants associated with functionally distinct or functionally equivalent symbionts was independent of the specific plant functions that were promoted by fungi and bacteria (growth & nutrition vs. nutrition & stress protection vs. growth & nutrition & stress protection or growth vs. nutrition vs. stress protection). As expected, the negative effects of AF on their host plants were alleviated by bacteria. However, contrary to our prediction, the degree of alleviation conferred by bacteria to their host plants against AF was independent of the type of protection traits added by the bacterium (i.e. traits of resistance & tolerance vs. resistance vs. tolerance). Finally, our results confirmed that the degree of performance gain conferred by bacteria to plants associated with fungi (either MF or AF) was dependent on the abiotic/biotic environment. Bacteria that conferred stress protective mechanisms to their plant hosts led to a greater gain in plant performance in the presence of biotic stress compared to symbiotic plants in the absence of any stress. This was not the case for abiotic stress. In plants that experienced biotic stress, bacteria solely exhibiting resistance traits led to a greater gain in performance for their plant hosts than bacteria that either added resistance & tolerance or only tolerance traits in the presence/absence of the stress. Bacteria can increase the fitness of plants when the host is simultaneously associated with MF (Larimer et al., 2010 ) and our meta‐analysis confirmed this. More intriguingly, bacteria with traits that promoted plant functions that were distinct from those traits conferred by fungi increased plant performance to a greater degree compared to bacteria that conferred traits that promoted identical/similar plant functions than fungi. First, this outcome was expected since the benefit/cost relationship may be higher in plants harbouring functionally distinct symbionts compared to plants hosting functionally equivalent ones (Larimer et al., 2010 ). Second, functionally distinct symbionts can exert synergistic effects on the fitness of their host plants (i.e. net beneficial effect greater than the additive expectation) (Afkhami et al., 2014 ; Gamalero et al., 2004 , 2008 ; Jäderlund et al., 2008 ; Pérez‐de‐Luque et al., 2017 ). Third, antagonistic effects can occur between functionally equivalent symbionts due to competition for plant resources, and this may reduce the performance gain conferred by bacteria on MF‐associated plants (i.e. net beneficial effects lesser than additive expectations) (Afkhami et al., 2014 , 2020 ; Surendirakumar et al., 2019 ). However, even when antagonistic associations were expected in plants simultaneously associated with functionally equivalent fungi and bacteria, the plant performance was increased by the presence of these symbionts (i.e. positive effect size in plants with functionally equivalent symbionts). This fascinating outcome suggests that the identity of traits conferred by functionally equivalent symbionts is important in determining plant performance gain. For instance, sometimes mycorrhizal fungi and rhizobacteria exert synergistic effects on plant fitness, even when both symbionts enhance the same plant function (e.g. the acquisition of nutrients). This seems to be associated with that these symbionts confer traits that enhance the plant's acquisition of distinct nutrients (Afkhami et al., 2020 ). In fact, within the group of functionally equivalent symbionts, most case studies (ca. 67%) included microbes conferring traits that enhanced different aspects of the same plant function (47 out of 70 case studies). Our results also showed that the gain in plant performance conferred by bacteria was not optimised by any plant function or combination of plant functions promoted by fungi and bacteria. However, this result should be interpreted with caution as three out of six groups within these analyses included bacteria with stress‐protective traits, thus the contribution that these symbionts confer to plant performance is highly context‐dependent and plant performance gain may be greater in those groups under situations of stress compared to situations where the stress is absent. Bacteria can efficiently protect their plant hosts against attacks from single and multiple eukaryotic phytopathogens (Durán et al., 2018 ; Kobayashi & Crouch, 2009 ). In agreement with this, our finding showed that bacteria alleviated the negative effects on plant performance caused by AF. Our results did not support the hypothesis that bacteria conferring a combination of resistance and tolerance protective traits against AF would alleviate, to a greater degree, the negative effects imparted by AF than bacteria conferring a single type of protection trait (i.e. resistance or tolerance). This outcome might be related to the differences in the relative contribution of resistance and tolerance traits conferred by bacteria to plant performance. Comparing results of the effect sizes from the categories of ‘with resistance & tolerance traits’ and ‘with resistance traits’ (=no differences), it seems that the relative contribution of tolerance traits (in the plant alleviation of AF negative effects) was minor compared to the protection conferred by resistance traits. Examples of the minor contribution of bacterial tolerance traits to the protection against AF included the similar reduction in fungal disease symptoms in cucumber ( Cucumis sativus ) plants caused by either Bacillus strains that simultaneously produced anti‐fungal and growth‐promoting compounds (resistance + tolerance mechanisms, respectively) and the bacterial strain CZB5 that provided only anti‐fungal compounds (Lin et al., 2014 ). The low contribution of the bacterial stress‐tolerant traits in the plant alleviation against AF could be explained by reduced levels of bacterial stress‐tolerant compounds within plant tissues due to the cost of producing stress‐resistant metabolites (e.g. Peyraud et al., 2016 ). Additionally, the existence of potential trade‐offs in the production of resistance and tolerance compounds could also have limited the accumulation of stress‐tolerant compounds (Ferenci, 2016 ) (e.g. Matilla et al., 2018 ). It is fair to mention that a contrasting conclusion emerges from the comparison between the effect sizes associated with the categories ‘with resistance & tolerance traits’ and ‘with tolerance traits’. However, the low number of studies associated with tolerance traits ( n = 7) and the lack of mechanistic explanations to elucidate this pattern weaken this conclusion. The performance gain of plants conferred by bacteria associated with fungi depends on environmental conditions (i.e. abiotic/biotic stresses) (Acuña‐Rodríguez et al., 2020 ; Porter et al., 2020 ) and our analysis advocates this notion. Our meta‐analyses indicated that in the presence of either stress type (abiotic or biotic), symbiotic plants gained performance due to association with bacteria (recall that all bacteria included in the GLM analyses possessed traits that protect plants against stresses). This outcome may reflect the fact that in situations of stress, the benefits conferred by bacteria to plants (=stress protection traits) outweighed the costs of harbouring symbionts (Bronstein, 1994 ). Remarkably, the relationship between plant performance gains conferred by bacteria was greater than the 1:1 expectation in the presence/absence of biotic stress, but not in the presence of an abiotic stress. In 83% of the studies related to biotic stress, bacteria conferred resistance traits, for example antimicrobial compounds, that protected their plant hosts by negatively affecting the fitness of biotic stressors (here, fungal phytopathogens and nematodes). Contrary to this, in all studies related to abiotic stress, bacteria conferred traits that did not directly affect the stressors but promoted plant responses to the stress (e.g. production of growth‐promoting hormones, antioxidants). Thus, the higher plant performance gain in the presence/absence of biotic compared to abiotic stress might be explained by the action of the resistance traits added by bacteria against biotic stressors. This hypothesis was confirmed in the GLM analysis with biotic stress. Symbiotic plants gained a greater degree of performance gain in the presence of biotic stress compared to plants that lacked stress in situations where bacteria conferred stress‐resistance, but not when bacteria conferred resistance & tolerance or only tolerance traits. This finding suggests that in situations of biotic stress, plants may benefit by recruiting bacteria that confer stress resistance traits rather than those that can confer stress tolerance traits. There are reports confirming this (e.g. Jousset et al., 2010 ; Liu et al., 2021 ). Notable was the fact that the plant performance gain conferred by bacteria was lower in abiotic stress situations than in the absence of any stress. In most studies related to abiotic stress (ca. 80%), bacteria conferred traits that promoted plant growth and/or plant nutrient acquisition. It was expected that the contribution of these bacterial traits to the plant performance gain was less in stress situations than when the stress was absent, as these traits do not directly counteract the stressors. Therefore, the negative effect of the stress on plants might have discounted part of the gain in plant performance conferred by the symbionts. Most of the studies within our analysis associated with biotic stresses (40 out of 42) included tri‐partite plant associations with AF and bacteria (here AF was the stress), which were slightly different from the studies associated with abiotic stresses where plants were associated with MF and bacteria. Whereas a hypothetical inclusion of MF in the case studies associated with biotic stress could modify the predicted relationship between plant performance gains, it is likely that this modification would have a minor impact on the results. Our findings suggest that a major regulator of the relationship between performance gains in the presence/absence of biotic stress is the type of stress‐protective trait conferred by bacteria. While MF could modify the magnitude of the benefit related to the bacterial trait (due to antagonism or synergism), the presence of a fungus cannot alter the type of trait conferred by the bacterium (e.g. to change from resistance to tolerance traits). In conclusion, our study showed that the performance gain conferred by bacteria to plants associated with fungi was modulated by the interaction between fungal–bacterial traits and the abiotic/biotic environments experienced by these symbiotic plants. Our analysis suggests that plants experience optimal performance when they are associated with functionally distinct symbionts. However, there was not a specific combination of plant functions promoted by these symbionts that optimised the performance of plant hosts. Our results also showed that bacteria, that conferred stress‐protective traits to plants associated with fungi (either MF or AF), increased plant performance to a greater degree in the presence of biotic, but not abiotic, stress compared to situations where the stress was absent. Furthermore, plant performance gain in the presence/absence of biotic stress was greater when bacteria conferred only resistance traits compared to resistance & tolerance or only tolerance traits. Considering that plants can regulate the presence and functionality of their microbial symbionts (Bastías et al., 2018 ; Liu et al., 2011 , 2020 , 2021 ), further research should evaluate whether plants possess specific mechanisms to stimulate the presence of functionally distinct symbionts or sanction the presence of functionally equivalent ones. Our findings highlight that bacteria exert significant beneficial effects on plants within tripartite associations and that to predict the effects of these symbionts on the performance of plants associated with fungi, it is essential to determine the interaction between symbionts' functional traits and the relationship between bacterial traits and environmental conditions."
} | 6,137 |
21876727 | PMC3155187 | pmc | 9,503 | {
"abstract": "Evidence is mounting to suggest that the transfer of carbon through roots of plants to the soil plays a primary role in regulating ecosystem responses to climate change and its mitigation. Future research is needed to improve understanding of the mechanisms involved in this phenomenon, its consequences for ecosystem carbon cycling, and the potential to exploit plant root traits and soil microbial processes that favor soil carbon sequestration.",
"conclusion": "Conclusions and future challenges I have used a selection of examples, but their central message is similar: understanding ecosystem function and response to global change requires consideration of feedbacks between plants, microbes, and soil processes. In particular, it is clear that plant root carbon transfer to the soil and resulting carbon cascades through the plant–microbial–soil system play a primary role in driving carbon-cycle feedbacks and in regulating ecosystem responses to climate change. Moreover, recent studies identify the potential to apply such understanding to improve land management, such as enhancing soil carbon sequestration in grassland and degraded farming systems, which also has potential benefits for food production and biodiversity conservation. Research effort is also required in order to realize the potential for targeted crop improvement strategies based on root traits that favor carbon sequestration in soil whilst also producing food. A new age of research and funding is needed to meet these scientific challenges and to integrate such understanding into future land management and climate mitigation strategies.",
"introduction": "Introduction Human activities are rapidly changing the world’s ecosystems, with overall dire consequences for the Earth. The most obvious human impact is through the worldwide conversion of land for food production, but terrestrial ecosystems are also affected by climate change, invasion of alien species into new territories, and increasing rates of nitrogen deposition. This has led to a groundswell of research aimed at improving understanding of the impact of global changes on biodiversity and how ecosystems function, and also on management strategies to mitigate them. Despite this topic receiving considerable attention, it is only recently that scientists have become aware that understanding the consequences of global change for ecosystem functioning requires consideration of linkages between plant and belowground microbial communities [ 1 ]. This is because the impact of human-induced global changes on the functioning of terrestrial ecosystems is often indirect: they operate via changes aboveground that cascade belowground to the hugely complex soil biological community, which drives biogeochemical processes and feedbacks to the Earth’s climate system. Here I highlight some recent developments in this area that illustrate how a combined aboveground–belowground approach can improve understanding of the consequences of global change for the Earth. In particular, recent studies have advanced our understanding of the role that plant–microbial–soil interactions, and specifically root carbon transfer to soil, play in governing the impact of climate change on ecosystem carbon cycling and climate mitigation."
} | 807 |
22683761 | null | s2 | 9,504 | {
"abstract": "Taming a cyanobacterium in a pivitol event of endosymbiosis brought photosynthesis to eukaryotes, and gave rise to the plastids found in glaucophytes, red and green algae, and the descendants of the latter, the plants. Ultrastructural as well as molecular research over the last two decades has demonstrated that plastids have enjoyed surprising lateral mobility across the tree of life. Numerous independent secondary and tertiary endosymbiosis have led to a spread of plastids into a variety of, up to that point, non-photosynthetic lineages. Happily eating and subsequently domesticating one another protists conquered a wide variety of ecological niches. The elaborate evolution of secondary, or complex, plastids is reflected in the numerous membranes that bound them (three or four compared to the two membranes of the primary plastids). Gene transfer to the host nucleus is a hallmark of endosymbiosis and provides centralized cellular control. Here we review how these proteins find their way back into the stroma of the organelle and describe the advances in the understanding of the molecular mechanisms that allow protein translocation across four membranes. This article is part of a Special Issue entitled: Protein Import and Quality Control in Mitochondria and Plastids."
} | 321 |
33729443 | PMC8106505 | pmc | 9,506 | {
"abstract": "Research into the development of sustainable biomaterials is increasing in both interest and global importance due to the increasing demand for materials with decreased environmental impact. This research field utilises natural, renewable resources to develop innovative biomaterials. The development of sustainable biomaterials encompasses the entire material life cycle, from desirable traits, and environmental impact from production through to recycling or disposal. The main objective of this review is to provide a comprehensive definition of sustainable biomaterials and to give an overview of the use of natural proteins in biomaterial development. Proteins such as collagen, gelatin, keratin, and silk, are biocompatible, biodegradable, and may form materials with varying properties. Proteins, therefore, provide an intriguing source of biomaterials for numerous applications, including additive manufacturing, nanotechnology, and tissue engineering. We give an insight into current research and future directions in each of these areas, to expand knowledge on the capabilities of sustainably sourced proteins as advanced biomaterials.",
"introduction": "Introduction Sustainable biomaterials refer to the development of innovative biomaterials using building blocks obtained from natural, renewable resources. Due to their unique properties and abundance, proteins hold great promise as a green source of sustainable biomaterials for various applications. Additionally, alternative protein sources, such as recombinant proteins and peptides produced in different prokaryotic, eukaryotic, plant, and mammalian expression systems have also been explored to develop biomaterials with properties comparable to natural materials. This review provides an overview of sustainable biomaterials and the potential of protein biomaterials within this context. It covers aspects of protein sourcing and processing, along with recent trends and challenges, including alternative sustainable protein sources for biomaterial development, followed by examples of different protein-based biomaterials and their properties and applications."
} | 528 |
29867185 | PMC5986759 | pmc | 9,508 | {
"abstract": "In contrast to most synthetic hydrogels, biological gels are made of fibrous networks. This architecture gives rise to unique properties, like low concentration, high porosity gels with a high mechanical responsiveness as a result of strain-stiffening. Here, we used a synthetic polymer model system, based on polyisocyanides, that we crosslinked selectively inside the bundles. This approach allows us to lock in the fibrous network present at the crosslinking conditions. At minimum crosslink densities, we are able to freeze in the architecture, as well as the associated mechanical properties. Rheology and X-ray scattering experiments show that we able to accurately tailor network mechanics, not by changing the gel composition or architecture, but rather by tuning its (thermal) history. Selective crosslinking is a crucial step in making biomimetic networks with a controlled architecture.",
"introduction": "Introduction Life is supported by hydrogels. They give mechanical properties to cells and their surrounding matrix 1 , 2 . Nature is able to precisely regulate the stiffness of these gels in space and time. For instance, the most abundant cytoskeletal protein, F-actin is (reversibly) bundled and crosslinked by various actin-binding proteins, resulting in a soft, porous and fibrous network structure 3 , 4 . It is this bundled network architecture that determines the unique mechanical properties of the network: its stiffness, and also its strong increase in stiffness upon deformation of the gel, the so-called strain-stiffening behavior 2 , 5 . The linear and nonlinear mechanics are crucial parameters in cellular functions, intracellular communication and tissue protection 6 , 7 . Other biogels, such as fibrin, collagen, and intermediate filaments show analogous architectures and properties 8 , 9 . In contrast, synthetic hydrogels that are studied for many biomedical applications commonly have very different architectures (high concentration and dense, single-chain networks) and are not strain-responsive 6 . To manipulate mechanics in these networks, one routinely changes the polymer or crosslinker concentration, which simultaneously changes the architecture and, for instance, the pore size, and the density and distribution of (bio)functional groups that are conjugated to the polymer 10 , 11 . Developing methods to reliably decouple the mechanical properties is still an outstanding challenge. In this manuscript, we demonstrate a new approach to synthesize networks with different mechanical properties, but all with very similar architectures. The only way to achieve this is to use Nature’s approach. In analogy to actin networks, our synthetic hydrogels are soft, porous fibrillar structures 12 , 13 . We then crosslink the polymers selectively inside the bundles, which keeps the network architecture unchanged (Fig. 1a ). By changing the crosslinking conditions, the concentration and the nature of the crosslinkers, we can accurately tailor the mechanical properties, both in the linear and in the strain-stiffening regime. This approach is generic for any bundled hydrogel material, either synthetic or biological. Fig. 1 Crosslinking a bundled network. a Schematic representation of the crosslinking method. Azide (orange) decorated polymers (blue) are gelled and crosslinked selectively within the bundles by a crosslinker (pink), stabilizing the architecture. b Gel components: PIC 1 (yield: 94%, 3.3-mol-% N 3 , M v = 599 kg mol −1 ) and crosslinkers 2a and 2b . c – f Freeze-fractured cryoSEM micrographs of PIC gels (scale bars=1 µm): crosslinked ( c ) and not-crosslinked ( d ) gel at T = 37 °C and crosslinked ( e ) and not-crosslinked ( f ) gel at T = 5 °C. Note that in the final cryoSEM image, the network structure has disappeared",
"discussion": "Discussion Covalent crosslinking is the default method to stabilize hydrogels permanently, but often results in gels with small pores with limited application potential in 3D cell studies. Biology solved this challenge by generating open porous networks of semi-flexible bundles that are crosslinked by dedicated proteins. We followed this example and presented an approach to crosslink polymers predominantly inside the bundles. Provided that the crosslinking reaction is carried out in the presence of the bundles, crosslinker concentrations of 50 µm are sufficient to stabilize the architecture. For the PIC gels, presented here, bundle formation is thermally induced (and reversible), which means that crosslinking should take place above the gelation temperature, which is readily tuned between 10 and 60 °C by simply changing the ethylene glycol tails 31 . We find that the mechanical properties at the crosslinking conditions are irreversibly captured and cooling shows minor impact on the architecture or the mechanical properties of the material. Further heating, on the other hand will continue to stiffen the network irreversibly. The nature (i.e., length), concentration and, most likely, the functionality of the crosslink are versatile parameters to tailor the mechanothermal response. This approach is not restricted to polyisocyanide gels, but will be applicable to any bundled gel architecture and will be most effective when the dimensions of the crosslinker are smaller than the distance between the complementary functional groups on the polymer backbone. The genericity renders this strategy highly relevant for biomechanical studies that concentrate on the effect of the tissue mechanics on cell fate. In addition, our scattering results show that upon cooling a crosslinked gel only the thickest bundles remain, while rheology experiments demonstrate that the stiffness and the mechanical response to stress of the crosslinked gels are barely impacted on cooling. We conclude that in such networks with a large distribution in bundle diameters, the mechanical load is predominantly carried by the thickest bundles and that thinner bundles hardly contribute to the linear or the nonlinear mechanical properties. This conclusion has a significant effect on how we should visualize stress-development in a polydisperse fibrillar network: what are the length scales of (local) deformation, when for instance a cell adheres to a network and strains it?"
} | 1,563 |
35517010 | PMC9063318 | pmc | 9,510 | {
"abstract": "In this study, we report a pH-/thermo-responsive hydrogel formed by N , N ′-dibenzoyl- l -cystine (DBC). It is difficult to dissolve DBC in water even on heating, and it exhibits no gelation ability. Interestingly, DBC is readily soluble in NaOH solution at room temperature and the self-assembled hydrogels are obtained by adjusting the basic DBC aqueous solution with HCl to achieve a given pH value (<3.5). When NaOH is added to the hydrogel (pH > 9.4), it becomes a sol again. This small-molecule hydrogel is characterized by scanning electron microscopy, Fourier transform infrared spectroscopy, rheological measurement and differential scanning calorimetry. The results indicate that the DBC hydrogel exhibits excellent mechanical properties, thermo-reversibility, and pH-responsive properties. Fortunately, the single crystal of DBC is obtained by volatilizing its acid aqueous solution. It crystallizes in the monoclinic space group P 2 1 ( Z = 2) with lattice parameters a = 10.8180 (11) Å, b = 9.0405 (9) Å, c = 10.9871 (11) Å and β = 90.798 (3)°. By comparing the X-ray diffraction result of the DBC single crystal with that of its xerogel, the self-assembled structure of DBC in hydrogel has been ascertained. The gelators are self-assembled via strong intermolecular hydrogen bonds linking neighboring amide and carboxyl groups, π–π stacking interactions for aromatic rings, and hydrogen bonds between water molecules. In addition, the release behavior of salicylic acid (SA) molecules from the DBC gel is also investigated taking into account the DBC concentration, phosphate buffer solution (PBS) pH and SA concentration. When the concentrations of DBC and SA are 3.0 g L −1 and 200 mg L −1 , respectively, the release ratio in PBS (pH = 4.0) reaches 58.02%. The diffusion-controlled mechanism is in accordance with Fickian diffusion control within the given time range.",
"conclusion": "4. Conclusions In summary, a novel pH/thermo-responsive hydrogel formed from DBC is prepared, and the corresponding single crystal is also obtained. The structural investigation reveals that DBC molecules are self-assembled by strong intermolecular hydrogen bonds linking neighboring amides and carboxylic acid, π–π stacking interactions for aromatic rings, and hydrogen bonds between water molecules. Moreover, the as-prepared hydrogels possess good mechanical property, pH-sensitiveness and thermo-reversibility. Meanwhile, they also display the potential in drug delivery applications as the carrier of SA. The concentrations of DBC and SA, as well as the pH of PBS can all affect the release ratio of SA. The optimal release condition of SA in DBC hydrogels (3.0 g L −1 ) is at high SA concentrations for the pH of 4.0. The release mechanism is in accordance with Fickian diffusion control within the given time range. In addition to the application in controlled drug release system, this kind of DBC hydrogel is expected to be used as a new pH-responsive material.",
"introduction": "1. Introduction Hydrogels have received considerable attention over the past decades because of their capabilities to entrap a large number of water molecules per gelator molecule and swelling potential, which is suitable for biomedical applications including cell culture 1 or tissue engineering, 2–4 controlled drug delivery systems (CDDSs), 5–9 biosensors, 10 and so on. As one kind of “smart” soft material, the hydrogels based on low molecular weight gelators (LMWGs) are becoming more and more familiar in the field of materials science owning to their intriguing solid-like properties. 11–13 Generally, supramolecular hydrogels can be formed due to the self-assembly of LMWG molecules through weak non-covalent interactions, 14–17 such as hydrogen bonding, π–π stacking, electrostatic and van der Waals interactions. They are highly attractive candidates for materials that can reversibly respond to external stimuli, 18–22 such as pH, temperature, light, chemicals and ion. Among the various external stimuli, the pH/temperature responsiveness of hydrogels has been most extensively investigated in sensors and biological applications due to the controllability both under in vitro and in vivo conditions. 23–25 For example, Gao et al. 26 reported a kind of softwood kraft lignin pH-responsive hydrogels which were self-assembled through strong intermolecular hydrogen bonds in aqueous solution. However, most of them are formed from polymers. Constrained synthesis, chemical cross-linking, thermosetting nature, toxicity, and slow response to external stimuli limit applications of these polymer gels. On the other hand, the “supramolecular gels” of LMWG offer various advantages over the polymer gels, such as more easily and effectively in controlling gel characteristics. 27–29 Zhang et al. 30 reported a series of aminoalkyl phosphoamide compounds that exhibited the pH-reversible gelation behavior in neutral water. The obtained hydrogels had broad application potentials in controlled drug release, recyclable catalyst carrier and so on. Although numerous multi-response gels have been reported during the last few decades, developing new pH-/temperature-responsive hydrogels from LMWG will continue to be a focus for future research. The pH-responsive hydrogels derived from amino acid have been paid much attention because of their biocompatibility and eco-friendly nature. As an amino acid derivative, N , N ′-dibenzoyl- l -cystine (DBC) consists of two amide groups and two carboxyl groups that can serve as hydrogen-bond donors and acceptors, respectively. Considering both the carboxylate and amino are able to combine with H + , the pH-responsive properties of DBC can be predicted. To the best of our knowledge, it is difficult to dissolve DBC in purified water even on heating. In order to improve its solubility in water, many attempts have been made to prepare the DBC hydrogel. In previous work, Gortner and Hoffman 31 discovered that DBC could be dissolved in a beaker in 5 cm 3 of 95% alcohol. And later, Menger and Caran 32 extensively studied the gelation properties of DBC in DMSO/H 2 O mixtures. Additionally, Friggeri et al. found that DBC could gelate 1 N HCl, 1 and 5 N CH 3 COOH, aq. CaCl 2 solution and brine. 33 So far, however, the molecular arrangement and self-assembly structure of DBC have not been reported. Moreover, the study on the gelation properties of DBC was mainly focused on mixed-solvent systems in most examples. Herein, we report a novel supramolecular hydrogel formed from DBC via adjusting solution pH. The molecular arrangement and 3D self-assembly structure of DBC in crystals was determined, and then its gelation ability was also investigated. After the morphology and microstructure of DBC gels were characterized, their pH- and thermo-responsive properties were analyzed. Moreover, the mechanical performances and self-assembly mechanism were further studied. In addition, this DBC hydrogel used for the biomedical application as the carrier of salicylic acid (SA) in controlled drug delivery systems were discussed in detail.",
"discussion": "3. Results and discussion 3.1 Gelation properties According to the “gelation test” method (Section 2.2), the gelation ability of compound DBC in water was investigated. We discovered that DBC was readily soluble in NaOH solution at room temperature. And then, a stable transparent hydrogel was obtained by adjusting the solution pH to a given value (<3.5). The formed gels can maintain gelation for over 1 month. Intriguingly, by adding NaOH to the gel, it returns to the sol state again (pH > 9.4), indicating that this DBC hydrogel exhibits pH-sensitive properties ( Fig. 1a and b ). In addition, the DBC hydrogel can also be transformed into a sol upon heating. Subsequently, it self-assembles into a transparent gel again after cooling down to room temperature slowly. The gelation process is repeatable ( Fig. 1b and c ). These results indicate that the DBC hydrogel possesses both pH-responsive property and thermo-reversibility. In order to determine the gelatinizing ability of DBC, its MGC is measured. The result is 1.5 g L −1 , a low MGC values at room temperature, indicating that DBC is a highly efficient hydro-gelator. 34 Fig. 1 Schematic diagram of the gel–sol transition process: (a) DBC dissolved in NaOH solution; (b) the obtained hydrogel after adding HCl solution; (c) the DBC sol after heating. The aggregation morphologies of DBC xerogels were observed using SEM. All samples are prepared by freeze-drying for avoiding the damage from high vacuum or drying. The corresponding images are shown in Fig. 2 and S1. † From the SEM images of DBC xerogels, we can find that sheet-like structure with the width of 5–20 μm at low concentrations is formed. Moreover, similar sheet-like structures with the width of 10–50 μm at high concentrations (7.0, 8.0, 9.0, 10.0 g L −1 ) are also observed. Gelator molecules creates complex three-dimensional networks by entangling numerous sheet-like structures and entraps abundant water in the interspace of the networks by surface tension and capillary forces, leading to the formation of DBC hydrogels. 35 Fig. 2 SEM images of DBC hydrogels formed by varying concentrations: (a) 1.5 g L −1 ; (b) 2.0 g L −1 ; (c) 3.0 g L −1 ; (d) 4.0 g L −1 ; (e) 5.0 g L −1 ; (f) 6.0 g L −1 . Thermal stability and thermo-reversibility of the gel are interesting in respect to its various applications, such as drug delivery. 36 In order to evaluate the thermal stability of DBC gels, rheological and DSC measurements were conducted. 37 Generally speaking, hydrogels start to flow at a shear stress when they succumb to an applied stress. According to the stress sweep ( Fig. 3a and S2 in ESI † ), the value of the storage modulus ( G ′) for DBC hydrogels is much higher than that of the loss modulus ( G ′′). Below a certain level of stress, G ′ and G ′′ are independent of the stress, and the deformation is always close to 0, inferring that the gel structure keeps completely intact. 38 Beyond a certain level of stress, a catastrophic disruption of the gels occurs, as indicated by a steep drop in the values of both moduli and the reversal of the viscoelastic signal. As G ′ and G ′′ drop sharply, the gels are deformed to a certain extent. At room temperature, the frequency sweep exhibits typical solid-like rheological behavior with G ′ dominating G ′′ over the investigated oscillating frequency range ( Fig. 3b and S3 in ESI † ). As shown in Fig. 3b , the G ′ and G ′′ of DBC gels formed by varying concentration slightly increase upon increasing the frequency from 0.01 to 100 Hz. Moreover, the value of G ′ is always larger than that of G ′′ in the whole range (0.01–100 Hz), suggesting that the gels are fairly tolerant to the external force and are effective physical gels. Additionally, the temperature dependences of G ′ and G ′′ are also conducted to characterize the thermo-responsive behaviors of DBC gels. 39 Temperature measured by rheology experiments in which G ′ = G ′′ is denoted as T gel . 40 As depicted in Fig. 4 , both G ′ and G ′′ almost keep constant at low temperature but decrease rapidly at T gel . For instance, both G ′ and G ′′ of the DBC gel at 2.0 g L −1 almost keep constant from room temperature to 82.6 °C, above which they decrease rapidly with the increase of temperature, indicating the gradual transformation from gel to sol. When the temperature reaches 85.5 °C, a cross-over point where G ′ equals to G ′′ appears, indicating the transition from primarily elastic to viscous properties. Upon further heating to 89.5 °C, G ′′ exceeds G ′, implying that the gel is transformed to sol completely. Similar phenomenons are also observed for DBC gel at 3.0, 4.0, 5.0 and 6.0 g L −1 , and the corresponding T gel is 88.7, 92.2, 92.3 and 92.5 °C, respectively. These results demonstrate that the stability of hydrogel is gradually enhanced on increasing the DBC concentration. However, when the concentration is increased to a certain value, T gel levels off. Similar results are also obtained by DSC experiments as follows. Fig. 3 Dynamic rheology of hydrogel (4.0 g L −1 ): (a) stress sweep; (b) frequency sweep. Fig. 4 Temperature dependence of G ′ and G ′′ of DBC gel at varying concentrations. (Gelator concentrations: 2.0 g L −1 , 3.0 g L −1 , 4.0 g L −1 , 5.0 g L −1 and 6.0 g L −1 .) On the basis of rheological results, DSC measurements provide further insight into the thermo-reversibility in detail. Typical heating and cooling DSC curves of DBC hydrogels are presented (Fig. S4 in ESI † ), and the temperature corresponding to the maximum of the peak in DSC curves is denoted as T DSC . 40 By visual inspection, the samples are liquids above T DSC , and then become into gels below T DSC . The T DSC profiles of DBC hydrogels prepared by varying concentrations ( Fig. 5 ) illustrate that it gradually increases with increasing the DBC concentration and is virtually independent of concentration to 4.0 g L −1 . This phenomenon is consistent with that obtained by the rheology experiments. Consequently, both mechanical and thermal experimental results clearly display two trends: an increase at low concentrations and a plateau above a threshold concentration within the selected temperature range. The probable explanation is that incomplete aggregate network is gradually becoming complete upon increasing the DBC concentration from 1.5 to 4.0 g L −1 . Hence, a high temperature is needed to break the aggregate structure. 41,42 When the concentration reaches 4.0 g L −1 , complete aggregate network is formed and additional DBC serves a secondary role to stabilize the internal structure of the hydrogel. Therefore, T DSC increases only slightly when DBC is added over the certain concentration. Fig. 5 The gel–sol transition temperatures ( T DSC ) profiles of DBC hydrogels prepared by varying concentrations. 3.2 Molecular arrangement and self-assembly mechanism To reveal the molecular interaction and aggregative structure of DBC hydrogel, FT-IR and XRD analyses have been conducted. The information of the hydrogen-bonding environment for amide groups can be sensitively detected by FT-IR spectroscopy. For the DBC xerogel ( Fig. 6b ), the bands that appear at 3312 and 1687 cm −1 can be attributed to the ν N–H and ν C \n \n\n<svg xmlns=\"http://www.w3.org/2000/svg\" version=\"1.0\" width=\"13.200000pt\" height=\"16.000000pt\" viewBox=\"0 0 13.200000 16.000000\" preserveAspectRatio=\"xMidYMid meet\"><metadata>\nCreated by potrace 1.16, written by Peter Selinger 2001-2019\n</metadata><g transform=\"translate(1.000000,15.000000) scale(0.017500,-0.017500)\" fill=\"currentColor\" stroke=\"none\"><path d=\"M0 440 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z M0 280 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z\"/></g></svg>\n\n O for amide groups, respectively. Compared to the N–H stretching band of the free secondary amide group (3403 cm −1 , Fig. 6c ), a red shift is found for that of the DBC xerogel, suggesting that hydrogen bonds are formed between neighboring amides. 43–46 Additionally, the band corresponding to the C O stretching vibration of the carboxyl group occurs a red-shift from 1740 cm −1 (free ν C O of carboxylic acid) to 1723 cm −1 , implying that the C O in carboxyl groups takes part in the formation of intermolecular hydrogen bonds. Moreover, the corresponding vibration bands of the crystal ( Fig. 6a ) also undergo a red shift, which is similar to that of the xerogel, indicating that the pattern of hydrogen bonding in crystal is close to that in gel. These results reveal that there are intermolecular hydrogen bonds between neighboring amide groups and carboxyl groups, which are juxtaposed and interlocked by van der Waals interaction and finally gelate the water molecules. Generally, X-ray crystallography is a powerful technique for characterizing the structures of various types of colloidal dispersions. 47 The aggregation structure of the DBC xerogel was confirmed by XRD. Fig. 7 shows the XRD patterns of the DBC xerogel and its crystal. Compared with the DBC crystal, the diffraction peaks at 2 θ = 8.2°, 11.5°, 16.3°, 18.2°, 20.8°, 24.6° and 26.3° are appeared in the same position for its xerogel, and there are no new peak observed. Therefore, it can be inferred that both the DBC crystal and its hydrogel have similar assembly structures. Fig. 6 FT-IR spectra of (a) DBC crystal, (b) xerogel and (c) DBC in CCl 4 solution. Fig. 7 XRD patterns of (a) DBC xerogel and (b) its crystal. As crystallized in acid aqueous solution, the DBC crystal that is suitable for single crystal X-ray diffraction analysis was obtained. In order to understand the molecular arrangement of DBC crystal, we decided to investigate its single crystal structure. The crystal data, selected bond lengths and angles are listed in Tables S1 and S2, respectively (ESI † ). Further details about the structure information have been deposited at the Cambridge Crystallographic Data Centre (CCDC) as supplementary publication CCDC 1870748 . As illustrated in Table S1 (ESI), † DBC crystallizes in the monoclinic space group P 2 1 ( Z = 2) with lattice parameters a = 10.8180 (11) Å, b = 9.0405 (9) Å, c = 10.9871 (11) Å and β = 90.798 (3)°. As displayed in Fig. 8 , there are rich hydrogen bond interactions in water and DBC molecules, including O7W–H⋯O1 (O7W⋯O1, 2.6524 Å), O7W–H⋯O2 (O7W⋯O2, 2.5896 Å), N2–H⋯O3 (N2⋯O3, 2.9868 Å), N1–H⋯O5 (N1⋯O5, 2.9221 Å) and O4–H⋯O6 (O4⋯O6, 2.6477 Å). Each DBC molecule connects with another six DBC molecules via eight intermolecular hydrogen bonds to form a 2D supermolecular layer ( Fig. 8a ). The thickness of this layer measured from the crystal structure is 1.02 nm, which is in close proximity to 1.04 nm, the long spacing of the DBC gel ( Fig. 7a ). Each layer is further linked with the adjacent layers through π–π stacking interactions between aromatic rings, generating a 3D supermolecular structure ( Fig. 8b ). Fig. 8 The self-assembly structure of DBC crystal: (a) top-view of the 2D sheet and (b) 3D crystal structure. 3.3 Release behavior of DBC hydrogels Owing to the solid-like properties of supramolecular hydrogels formed from LMWGs, they possess potential practical applications in the field of vehicles for controlled drug release. 48 Herein, a study concerning DBC hydrogels as controlled release systems for SA molecules was presented, and the corresponding release behavior was also investigated in detail. The release process of SA from the DBC hydrogel is illustrated in Fig. 9 . Fig. 9 Schematic depiction for the release of SA from the DBC gel: (a) the DBC hydrogel containing SA molecules; (b) the release of SA from the as-prepared hydrogel. Taking into account the important role of solution pH in release processes, the SA release from the DBC hydrogel at different PBS pH was investigated. As shown in Fig. 10 , the release ratios of SA are various when PBS with different pH is used as SA receptors. In comparison with the pH of 7.4, the release ratio of SA for the pH of 4.0 is higher ( Fig. 10a ). In other words, the acidic receiving medium for SA release from the DBC hydrogel is more effective than the neutral receiving medium. This can be attributed to the variation of supramolecular interactions in the gels at different pH conditions. 49 Somewhat interestingly, when the amount of SA released from the DBC hydrogel is plotted against the square root of time (within 10 h), a good linear correlation is displayed ( Fig. 10b ). Usually, Korsmeyer–Peppas model ( M t / M ∞ = kt n ) can be applied to evaluate the relationship between release rate and time. 50 When n = 0.5, the release process is in according with Fickian diffusion control. For 0.5 < n < 1.0, it is consistent with anomalous (non-Fickian) diffusion control. In this release process of SA from the DBC hydrogels, the value of “ n ” is 0.5, implying that the process is in accord with Fickian diffusion mechanism within the given time range. 51 Fig. 10 Release (a) ratios and (b) kinetics of SA from the hydrogels formed by 3.0 g L −1 of DBC in the case of various pH buffer solutions as receptor (initial SA concentration: 200 mg L −1 ). In addition, the influences of SA and DBC concentrations were also investigated. As shown in Fig. 11a , the release rates of SA gradually increase for all samples upon increasing the SA concentration. There is no significant difference in the case of low concentrations for SA, such as in 50 and 75 mg L −1 . However, the release rates are faster in the case of high concentrations for SA (such as in 150 and 200 mg L −1 ). Generally, the rate of diffusion-controlled release only depends on the solute concentration difference at both sides of the hydrogel/solution interface, and not on the solute concentration within the hydrogel. In the DBC hydrogels, SA molecules are entrapped in the sheet-like structure. As the increase of the SA concentration, sheet-like structure fabricated by the DBC hydrogelator may be disrupted. Thereby, 3D networks within the hydrogel tend to partial collapse, leading to an increase in the released amount of SA. As depicted in Fig. 11b , a typical sustained release behavior that the release ratio of SA from the hydrogels decreases with the increase of the DBC concentration is obviously observed. The max release ratios of SA are 31.01%, 44.85%, 49.15% and 58.02% when the DBC concentrations are 9.0, 7.0, 5.0 and 3.0 g L −1 , respectively. This phenomenon can be explained by assuming that the low release rate of SA is related to the presence of dense 3D networks formed by increasing the DBC concentration. 52 Interestingly, when the amount of SA released from the hydrogel is plotted against the square root of time (Fig. S5 in ESI † ), the corresponding linear relationship also exists. It indicates that the release mechanism of SA from the hydrogels also follows the Fickian diffusion control before 10 h. Based on these results, it can be deduced that the release ratio of SA in the DBC hydrogels (3.0 g L −1 ) is optimal at high concentrations of SA and the pH of 4.0. Fig. 11 Effects of (a) SA and (b) DBC concentrations on the release ratio at 25 °C."
} | 5,566 |
28387497 | null | s2 | 9,512 | {
"abstract": "Reconfiguring the permanent shape of elastomeric microparticles has been impossible due to the incapability of plastic deformation in these materials. To address this limitation, we synthesize the first instance of microparticles comprising a covalent adaptable network (CAN). CANs are cross-linked polymer networks capable of reconfiguring their network topology, enabling stress relaxation and shape changing behaviors, and reversible addition-fragmentation chain transfer (RAFT) is the corresponding dynamic chemistry used in this work to enable CAN-based microparticles. Using nanoimprint lithography to apply controllable deformations we demonstrate that upon light stimulation microparticles are able to reconfigure their shape to permanently fix large aspect ratios and nanoscale surface topographies."
} | 202 |
21623481 | null | s2 | 9,514 | {
"abstract": "Adsorption of bovine serum albumin (BSA) and fibrinogen (Fg) was measured on six distinct bare and dextran- and hyaluronate-modified silicon surfaces created using two dextran grafting densities and three hyaluronic acid (HA) sodium salts derived from human umbilical cord, rooster comb and Streptococcus zooepidemicus. Film thickness and surface morphology depended on the HA molecular weight and concentration. BSA coverage was enhanced on surfaces in competitive adsorption of BSA:Fg mixtures. Dextranization differentially reduced protein adsorption onto surfaces based on oxidation state. Hyaluronization was demonstrated to provide the greatest resistance to protein coverage, equivalent to that of the most resistant dextranized surface. Resistance to protein adsorption was independent of the type of HA utilized. With changing bulk protein concentration from 20 to 40 μg ml(-1) for each species, Fg coverage on silicon increased by 4x, whereas both BSA and Fg adsorption on dextran and HA were far less dependent on protein bulk concentration."
} | 263 |
27062925 | null | s2 | 9,515 | {
"abstract": "Pili are proteinaceous polymers of linked pilins that protrude from the cell surface of many bacteria and often mediate adherence and virulence. We investigated a set of 20 Bacteroidia pilins from the human microbiome whose structures and mechanism of assembly were unknown. Crystal structures and biochemical data revealed a diverse protein superfamily with a common Greek-key β sandwich fold with two transthyretin-like repeats that polymerize into a pilus through a strand-exchange mechanism. The assembly mechanism of the central, structural pilins involves proteinase-assisted removal of their N-terminal β strand, creating an extended hydrophobic groove that binds the C-terminal donor strands of the incoming pilin. Accessory pilins at the tip and base have unique structural features specific to their location, allowing initiation or termination of the assembly. The Bacteroidia pilus, therefore, has a biogenesis mechanism that is distinct from other known pili and likely represents a different type of bacterial pilus."
} | 257 |
35338139 | PMC8956700 | pmc | 9,516 | {
"abstract": "Many living tissues achieve functions through architected constituents with strong adhesion. An Achilles tendon, for example, transmits force, elastically and repeatedly, from a muscle to a bone through staggered alignment of stiff collagen fibrils in a soft proteoglycan matrix. The collagen fibrils align orderly and adhere to the proteoglycan strongly. However, synthesizing architected materials with strong adhesion has been challenging. Here we fabricate architected polymer networks by sequential polymerization and photolithography, and attain adherent interface by topological entanglement. We fabricate tendon-inspired hydrogels by embedding hard blocks in topological entanglement with a soft matrix. The staggered architecture and strong adhesion enable high elastic limit strain and high toughness simultaneously. This combination of attributes is commonly desired in applications, but rarely achieved in synthetic materials. We further demonstrate architected polymer networks of various geometric patterns and material combinations to show the potential for expanding the space of material properties.",
"introduction": "Introduction Soft polymer materials, such as elastomers and gels, are under intense development to enable emerging fields of biointegration and bioinspiration, including tissue engineering 1 – 3 , bioelectronics 4 , 5 , and soft robots 6 – 8 . Many applications require soft materials to deform reversibly (high elasticity) and resist fracture (high toughness). High elasticity and high toughness, however, are often conflicting requirements in materials development. A highly elastic material loads and unloads without dissipating much energy, whereas a highly tough material resists the growth of a crack by dissipating a large amount of energy. Polymer networks have been synthesized to achieve either high elasticity or high toughness 9 , 10 , but rarely both. The difficulty in simultaneously achieving elasticity and toughness is evident on the plane of elastic limit strain ( ε e , the maximum strain at which the load and unload curves coincide) and toughness ( Γ , the energy consumed per unit area during crack propagation) (Fig. 1a ). The two properties are negatively correlated. Highly elastic materials have low toughness ( Γ < 100 J/m 2 ), and highly tough materials have low elastic limit strain ( ε e < 100%) 11 – 23 . A large area in the top right of the plane is empty. This negative correlation originates from the commonly used toughening strategy: sacrificial bonds 10 , 14 , 24 , 25 . When a crack advances in such a material, the polymer network transmits high stress from the crack front to the bulk of the material, breaking sacrificial bonds in the bulk, which toughens the material. The sacrificial bonds, however, lowers the elastic limit strain. Fig. 1 Topoarchitected polymer networks (TPNs). a Existing elastomers and hydrogels (equilibrium-swollen in water) exhibit a negative correlation between two properties: elastic limit strain and toughness. The TPNs synthesized in this work simultaneously achieve high elastic limit strain and high toughness. b In a fascicle of an Achilles tendon, staggered collagen fibrils are embedded in a proteoglycan matrix. c Schematic illustration of TPNs. Hard blocks adhere to a soft matrix through topological entanglement of polymer networks. d Mechanical principle of a staggered-patterned TPN for high elasticity and high toughness. e TPN hydrogels prepared by sequential polymerization and photolithography. To develop an elastic and tough material, we draw inspiration from the Achilles tendon, a tissue that transmits force elastically and repeatedly from a muscle to a bone 26 . An Achilles tendon has many parallel fascicles, and each fascicle consists of staggered collagen fibrils in a proteoglycan matrix 27 (Fig. 1b ). The fibrils are stiff and the matrix is soft. They are elastic and adherent. The staggered architecture of constituents of the large difference in stiffness and strong adhesion makes the Achilles tendon both elastic and tough. Although the Achilles tendon has a modest rupture strain of ~15%, the proteoglycan matrix is subjected to considerable deformation during the extension process 28 . Learning from the structure–property relationship of the Achilles tendon, here we demonstrate that a similarly architected material can achieve both high elastic limit strain and high toughness. We fabricate a staggered architecture of blocks in a matrix (Fig. 1c ). Each block has a polymer network of dense crosslinks, and the matrix has a polymer network of sparse crosslinks. The polymer networks of the block and the matrix adhere strongly by topological entanglement. We call this network morphology topoarchitected polymer networks (TPNs). Different from the traditional interpenetrating polymer networks (IPNs) that are homogeneous at the scale larger than polymer meshes 29 , 30 , TPNs are heterogeneous with architected polymer networks. When a staggered-patterned TPN is stretched, high elastic limit strain mainly comes from the soft matrix (Fig. 1d ). The TPN amplifies toughness by the adherent architecture of dissimilar polymers. In a homogeneous material, a crack tip concentrates stress, which embrittles the material. By contrast, at a crack tip in a TPN, the large strain in the soft matrix spreads high stress over the length of a hard block. When the hard block breaks, the elastic energy stored in the block is released. This deconcentration of stress toughens the TPN. Hereinafter, we demonstrate the TPN principle for the elasticity-toughness integration of architected hydrogels, and the extensibility of TPNs in geometric patterns, material combinations, and multilayers.",
"discussion": "Results and discussion Preparation of TPN hydrogels We fabricate a class of TPN hydrogels by three-step sequential polymerization and photolithography (Fig. 1e ). After each polymer network cures, the sample is submerged in water to leach unreacted ingredients. During leaching, the polymer network just synthesized swells, which must be considered in designing the fabrication process. We begin by preparing a first network of sparse crosslinks, which serves as a scaffold for the synthesis of blocks. After leaching, the scaffold is submerged in the precursor for a second polymer network, which is cured by photolithography through a mask. After leaching, the second network swells. The scaffold hosts the blocks of the second network, but is too weak to function as a matrix. We synthesize a third polymer network by submerging the staggered-patterned scaffold in another precursor, curing, and leaching. Due to the constraint of the blocks, the third polymer network swells modestly. Unless otherwise stated, the first and the third networks are sparsely crosslinked polyacrylamide (PAAm), and the second network is highly crosslinked poly(2-acrylamido-2-methylpropanesulfonic acid) (PAMPS). In this case, the soft matrix (soft phase) consists of two interpenetrating networks (PAAm/PAAm), and hard blocks (hard phase) have three interpenetrating networks (PAAm/PAMPS/PAAm). The hydrogels at the three stages of preparation have markedly different stress–strain curves (Supplementary Fig. 1d ). The single-network scaffold is soft and stretchable. The stripe-patterned scaffold is brittle. After the third network forms, the stripe-patterned TPN gel is both strong and stretchable. We use a pattern of alternating unmasked and masked stripes to explore the effect of photolithography on the structural and mechanical properties of TPN hydrogels (Supplementary Fig. 1 ). The irradiation time and the stripe width in the mask affect the network morphology. The mask with the stripe width of 500 μm shows a processing window of irradiation time from 4 s to 10 s, but the one with the stripe width of 100 μm is difficult to reproduce the pattern in the gels (Supplementary Fig. 1a ). After a TPN is synthesized, we immerse it in an aqueous solution of blue dye molecules, which are selectively absorbed by the second polymer network. When the irradiation time locates in the processing window, we can observe well-defined stripes, highlighted by the blue dyes. When the irradiation time exceeds 10 s, a continuous network forms, with crosslink density in the masked region lower than that in the unmasked region, as shown by the color contrast (Supplementary Fig. 1b ). The modulus, therefore, increases abruptly as the irradiation time changes from 8 s to 12 s (Supplementary Fig. 1c ). For a TPN to achieve good mechanical properties, one should tune the feature size of the mask and the irradiation time. Deformation of TPNs We fabricate a TPN, stretch it using a tensile tester, and observe it through the crossed polarizer and analyzer (Fig. 2a and Supplementary Fig. 2 ). The TPN is composed of soft columns and composite columns in parallel. Each composite column is composed of soft and hard segments in series. The soft columns and composite columns both have the applied strain ε . A finite element simulation shows that a soft column undergoes both tension and shear, but a composite column undergoes tension (Supplementary Fig. 3 ). As the applied strain ε increases, in a composite column, the soft and hard segments elongate by different strains, ε s and ε h (Fig. 2b ). When the applied strain is small, 0 < ε < 1.75, ε s increases steeply to 6, but ε h changes slowly. When the applied strain is large, 1.75 < ε < 6, ε s changes slowly, but ε h increases to 2.4. Write ε = ϕ s ε s + ϕ h ε h , where ϕ s and ϕ h are the volume fraction of the soft and hard segments in the composite column. We plot the fractions of the contributions of the soft and hard segments to the applied strain, f s = ϕ s ε s / ε and f h = ϕ h ε h / ε (Fig. 2c ). The soft segment contributes up to ~70% of the applied strain when ε < 1.75, but only contributes 28% of the applied strain when ε = 6. Fig. 2 Deformation of TPNs. a Deformation of a TPN observed using the crossed polarizer and analyzer. As the long-chain matrix deforms, the orientation-induced anisotropy of the refractive index causes the observed brightness. b The strain ε s and ε h of the soft and hard segments in a composite column plotted as functions of the applied strain ε . c Strain fraction f s and f h of the soft and hard segments. At least three samples were tested for the calculation of average value and standard deviation. d Load and unload stress–strain curves of soft, hard, and TPN gels with the increasing maximum strain. e Dependence of hysteresis on the maximum strain. The elastic limit strain ε e for the TPN gel is highlighted by a red dotted arrow. The inset indicates work of extension W , dissipated work W D , and elastic work W E . The ratio W D / W is a dimensionless measure of hysteresis. We measure load and unload stress–strain curves with the increasing maximum strain (Fig. 2d ). When the TPN is loaded to a maximum strain of ε max = 1.5 and then unloaded, the load and unload stress–strain curves coincide, indicating nearly perfect elasticity. When ε max = 1.75, the load and unload stress–strain curves differ slightly, giving a small hysteresis loop. Also plotted are the stress–strain curves of the soft gel and hard gel, which have the same chemical composition as the soft and hard phases in the TPN. The area under the load stress–strain curve gives the work of extension, W , the area of the hysteresis loop gives the dissipated work, W D , and the area under the unload curve gives the elastic work, W E (Fig. 2e ). Note that W = W D + W E . The ratio W D / W is a dimensionless measure of hysteresis. The hysteresis is negligible when ε max is small, and is appreciable when ε max is large. As a convention, we define the elastic limit strain ε e when the hysteresis W D / W is about to exceed 1%. Our measurements give the elastic limit strain of 5 for the soft gel, 0.25 for the hard gel, and 1.5 for the TPN gel. The high ε e of the soft gel results from the entropic elasticity of long polymer chains and low viscosity of water. The low ε e of the hard gel results from the damage of the short-chain network. The TPN gel is a composite of the soft and hard gels, and has an elastic limit strain lying between its two constituent gels. The high ε e of the TPN gel is contributed dominantly by the soft segment, accounting for 68% (Fig. 2c ). Like modulus and toughness, elastic limit strain is a material property of great significance to many applications. The TPNs represent a broad class of gels that enable trade-off among various material properties. Fracture of TPNs We next study the toughness of the three gels. We introduce a crack in each gel using a cutter, and stretch the gel to the critical strain ε c for rupture. We videotape the deformation process through the crossed polarizer and analyzer. For the soft gel, the crack blunts greatly, and the critical strain is large, ε c = 5.8 (Fig. 3a and Supplementary Movie 1 ). For the hard gel, the crack blunts somewhat, and the critical strain is relatively small, ε c = 1 (Fig. 3b and Supplementary Movie 2 ). For the TPN gel, the crack also blunts significantly, and the critical strain is also large, ε c = 3.6 (Fig. 3c and Supplementary Movie 3 ). In soft and hard gels, the birefringence contrast is insufficient to observe. In the TPN gel, as the applied strain increases, highly stretched regions light up due to birefringence. According to the birefringence distribution at the crack front, we find the soft phase shears greatly to spread large strain over the whole front hard phase, which deconcentrates stress at the crack tip. Fig. 3 Fracture of TPNs. a – c In situ polarizing optical observation of a soft gel, b hard gel, and c TPN gel. In each case, the image is taken when the gel with a precut crack is stretched to the critical strain ε c for rupture. d Stress–strain curves of gels with and without precut crack. e Toughness of the three gels. At least three samples were tested for the calculation of average value and standard deviation. f Load–unload stress–strain curves of the three uncut gels stretched to the critical strains for their corresponding precut gels. We record the stress–strain curves of the three gels with and without precut crack (Fig. 3d ). For both the soft gel and the hard gel, the precut cracks significantly reduce the critical strain for rupture. For the TPN gel, however, samples with and without precut crack have comparable critical strain. The toughness of the soft gel, the hard gel, and the TPN gel are 607 J/m 2 , 1326 J/m 2 , and 4202 J/m 2 (Fig. 3e ). The TPN gel possesses the highest toughness, although the volume fraction of the tough hard phase significantly decreases in comparison with the hard gel. To reveal the source of this much enhanced toughness, we load and unload the uncut samples to the ε c for their corresponding precut gels (Fig. 3f ). We separate the work of extension to dissipated work and elastic work, W ( ε c ) = W D ( ε c ) + W E ( ε c ). For the soft gel, the hysteresis is small, W D ( ε c )/ W ( ε c ) = 1%, and the toughness comes from the rupture of the long polymer chains. For the hard gel, the hysteresis is pronounced, W D ( ε c )/ W ( ε c ) = 51%, and the toughness comes from both the dissipated work and elastic work. The former mainly comes from the rupture of the short-chain network, and the latter mainly comes from the rupture of the long-chain network. The synergy amplifies the toughness of the hard gel relative to the soft gel. For the TPN gel, the hysteresis is also pronounced, W D ( ε c )/ W ( ε c ) = 53%, and the toughness comes from both the dissipated work and elastic work. At the crack tip, the soft phase deconcentrates stress over the hard phase. This stress deconcentration further amplifies the toughness of the TPN gel relative to the hard gel. Mechanical analysis of TPNs The TPNs combine the merits of IPNs and composites, and break the longstanding elasticity-toughness conflict of soft materials through macroscopic structural design, which is markedly different from the newly developed molecular-scale crosslinking design 31 – 33 . The TPN gel demonstrates simultaneous improvement in elastic limit strain (seven times) and in toughness (three times) compared with the hard gel. The successful integration of high elasticity and high toughness needs to fulfill the following four requirements. (i) The soft phase needs to have high strength. The soft and hard segments in the stripe-patterned TPNs alternate in series, and are subjected to the equal stress. The soft segment is strong enough to make the hard segment fracture preferentially (Supplementary Fig. 1c ). The same is true in the staggered-patterned TPNs (Fig. 2a and Supplementary Movie 4 ). The strength of the fully swollen soft gel is far smaller than that of the hard gel (Fig. 3d ). The restricted swelling, resulting from topological entanglement with the neighboring hard phase, imparts the soft phase with higher strength, which also can be confirmed by the remarkable birefringence phenomenon of the highly stretched soft phase, but not the soft gel of the same chemical composition even if stretched to the same extent (Fig. 3a, c ). The restricted swelling of the soft phase depends on the interval between two neighboring hard phases, and disappears when the interval is too large (Supplementary Fig. 4 ). (ii) The soft and hard phases must adhere strongly. Interfacial adhesion is the critical challenge for the design of composite materials. We attain strong interfacial adhesion by topological entanglement of polymer networks. The strong adhesion helps to smoothly transfer the stress between the phases. In all the mechanical measurements of TPNs, we have not observed any interfacial fracture. (iii) The aspect ratio of the hard phase should be suitably chosen. We first consider two extreme cases about the aspect ratio r of the hard phase. When r = 0, the TPN will regress to the soft gel, and lose high toughness. When r = ∞, the hard phase becomes continuous fibers, making the TPN lose high elastic limit strain. Therefore the TPNs must have an intermediate aspect ratio to reconcile the elastic limit strain and toughness. With the increase in r , the elastic limit strain decreases, whereas the toughness first increases to a peak value at r = 4, and then decreases slowly (Supplementary Fig. 5f ). The case of r = 4 demonstrates superb combination of elastic limit strain ( ε e = 1.5) and toughness ( Γ = 4202 J/m 2 ). The decrease of ε e is attributed to the decreased volume fraction ϕ s of the soft segment in the composite column when r increases. The toughness Γ is mainly determined by the energy dissipation in the process zone, which is localized in the hard block at the crack front (Supplementary Fig. 5g ). Write Γ ~ W h l p , where W h is the work of extension of the hard block and l p is the process zone size 12 . l p initially increases as the aspect ratio r and then is saturated after exceeding a critical r = 4, which is responsible for the r -dependent change of the toughness. (iv) The hard and soft phases should have large modulus contrast. The modulus of the hard phase has a great influence on the mechanical properties of TPNs, which can be easily tuned by changing the crosslinker concentration C MBAA for the short-chain network. We prepare a series of TPNs with the different modulus ratio E h / E s of the hard phase to the soft phase, and find they have the similar critical strain ε c (Supplementary Fig. 6h–l ). The elastic limit strain ε e and toughness Γ deteriorate seriously when E h / E s = 4.7, and almost keep constant at a high level when E h / E s ≥ 9.4 (Supplementary Fig. 6m ). A large modulus ratio is indispensable to the high elasticity-toughness integration for the TPNs. At E h / E s = 4.7 (namely C MBAA = 2 mol%), the low ε e is attributed to the large swelling of the hard segment and thus the decreased volume fraction ϕ s of the soft segment (Supplementary Fig. 6a–e ), while the low Γ is attributed to the extremely small work of extension W h of the hard block at the crack front according to Γ ~ W h l p (Supplementary Fig. 6n–p ). Except for elasticity and toughness, the stiffness and anti-fatigue of TPNs are also improved significantly. The modulus of the soft gel, the TPN gel, and the hard gel are 0.006 MPa, 0.04 MPa, and 0.2 MPa (Fig. 2d ). The modulus of the TPN gel increases with the aspect ratio r of the hard phase, in good agreement with the theoretical predictions from the tension-shear chain model 34 (Supplementary Fig. 7b ). The analytic equation clearly indicates that the aspect ratio of the hard phase essentially compensates for the low stiffness of the soft phase through the product r 2 E s (Supplementary Fig. 7a ). Under cyclic loads at the same maximum strain ε max = 0.5, both the soft and hard gel are susceptible to fatigue fracture with a similar crack extension rate of 0.2 µm/cycle, but the TPN gel remains intact (Supplementary Fig. 8 ). These results strongly suggest the tremendous potential of TPN design principle for expanding the space of material properties. Extensibility of TPNs TPNs further expand the space of material properties by geometric patterns, material combinations, and multilayers (Fig. 4 ). TPNs of various patterns are readily fabricated by designing photolithographic masks (Fig. 4a ). Polymer networks of various characteristics are available to construct TPNs. For example, we fabricate TPNs in which the hard phases are neutral, cationic, and anionic polymers, and find improvement in elastic limit strain and toughness compared with their corresponding hard gels (Fig. 4b ). Furthermore, we fabricate bilayer TPNs by stacking two staggered-patterned scaffolds orthogonally and polymerizing the third network (Fig. 4c ). In a peel test of the bilayer TPN gel with a crack at the interface between the layers, we observe cohesive fracture in the bulk gel, but not adhesive fracture at the interface (Supplementary Movie 5 ). This observation confirms that strong adhesion induced by topological entanglement also forms between the layers. The multilayer TPNs can potentially integrate diverse polymers to mimic the structures and functions of lamellar tissues, such as skins and blood vessels. Fig. 4 Extensibility of TPNs in geometric patterns, material combinations, and multilayers. a Discrete (i, ii) and continuous (iii, iv) architectures in TPNs. The insets show the mask micrographs. b Micrographs of three representative TPNs in which the hard phases are made of neutral poly(hydroxyethyl acrylate) (PHEA) (i), cationic poly( N,N -dimethylamino ethylacrylate methyl chloride quarternary) (PDMAEA-Q) (ii), and anionic PAMPS (iii), along with their elastic limit strain and toughness (iv). At least three samples were tested for the calculation of average value and standard deviation. c Micrographs and peel test of bilayer TPNs with orthogonal staggered pattern. The bilayer is assembled by two identical PAMPS-based gels (i) or one PAMPS-based gel and the other PDMAEA-Q-based gel (ii). The yellow dashed lines represent the position of the cross-section for the side view. A crack is introduced at the interface of the bilayer (iii). When the bilayer is peeled, the two layers stretch and the crack does not advance (iv). In summary, we have developed a class of polymer network morphology, the topoarchitected polymer networks (TPNs), which greatly expand the space of material properties. The TPNs integrate diverse polymers and patterns by sequential polymerization, photolithography, and stacking. The TPNs resolve a longstanding challenge in fabricating architected materials with strong adhesion through topological entanglement. As a demonstration, we fabricate tendon-inspired TPNs that simultaneously achieve high elastic limit strain and high toughness. We further fabricate TPNs of various geometric patterns, material combinations, and multilayer stacks. We have fabricated TPNs using mask photolithography, but TPNs can also be fabricated using other methods, such as stereolithography 35 . In addition to hydrogels, the TPN principle also applies to other polymer materials, including plastics and elastomers. It is hoped that the TPN technology will be soon developed to enable breakthroughs in material properties."
} | 6,156 |
34777265 | PMC8581545 | pmc | 9,517 | {
"abstract": "In this review, we introduce microbially-mediated soil processes, players, their functional traits, and their links to processes at biogeochemical interfaces [e.g., rhizosphere, detritusphere, (bio)-pores, and aggregate surfaces]. A conceptual view emphasizes the central role of the rhizosphere in interactions with other biogeochemical interfaces, considering biotic and abiotic dynamic drivers. We discuss the applicability of three groups of traits based on microbial physiology, activity state, and genomic functional traits to reflect microbial growth in soil. The sensitivity and credibility of modern molecular approaches to estimate microbial-specific growth rates require further development. A link between functional traits determined by physiological (e.g., respiration, biomarkers) and genomic (e.g., genome size, number of ribosomal gene copies per genome, expression of catabolic versus biosynthetic genes) approaches is strongly affected by environmental conditions such as carbon, nutrient availability, and ecosystem type. Therefore, we address the role of soil physico-chemical conditions and trophic interactions as drivers of microbially-mediated soil processes at relevant scales for process localization. The strengths and weaknesses of current approaches (destructive, non-destructive, and predictive) for assessing process localization and the corresponding estimates of process rates are linked to the challenges for modeling microbially-mediated processes in heterogeneous soil microhabitats. Finally, we introduce a conceptual self-regulatory mechanism based on the flexible structure of active microbial communities. Microbial taxa best suited to each successional stage of substrate decomposition become dominant and alter the community structure. The rates of decomposition of organic compounds, therefore, are dependent on the functional traits of dominant taxa and microbial strategies, which are selected and driven by the local environment.",
"conclusion": "Conclusion and Outlook: Emergent Properties of Microbial Activity in Soil Traditionally, total microbial biomass, potential enzyme activities, substrate-induced respiration, and organic matter content in a given volume of soil have been used to predict decomposition activity and to model the fate of organic matter. To assess how the microscale generates macroscopic behavior, the so-called emergent properties, microscale heterogeneity, dynamics of substrate properties, and microbial activities need to be taken into account ( Baveye et al., 2018 ). This aim is multidisciplinary and extremely challenging. It is necessary to link the spatial distribution of SOM ( Peth et al., 2014 ; Müller et al., 2016 ; Rawlins et al., 2016 ) with its combined biophysical and biochemical properties, as well as with decomposer microorganisms and their respective traits and activities in the contexts of space and time ( Baveye et al., 2018 ). Promising techniques that consider soil micro-heterogeneity are reproducible systems that mimic the soil and can be used for hypothesis testing ( Tecon and Or, 2017 ). Novel characterization techniques are increasingly being employed to systematically track the characteristics of organic C conversion at the soil micro-interface ( Table 1 ). The transformation process of organic matter and its influencing factors are discussed at the scale of micro-ecological systems. Progress in near-edge X-ray absorption fine structure spectroscopy (NEXAFS), scanning transmission X-ray microscopy (STXM), X-ray absorption spectroscopy, micro-fluorescence spectroscopy, and nanoSIMS, as well as combined STXM-NanoSIMS ( Keiluweit et al., 2012 ; Remusat et al., 2012 ), applied to soil thin sections, have revealed distinct spatial heterogeneity in the chemical composition of soils over minute distances ( Lehmann et al., 2005 ; Mueller et al., 2013 ). Pulse-labeling experiments in combination with NanoSIMS enable tracing of the uptake, storage, and translocation of stable isotopes ( Vidal et al., 2018 ). The development of novel detection technologies, such as NEXAFS and X-ray photoelectron spectroscopy (XPS) during the last decades, has greatly enriched our understanding of the microscopic distribution characteristics of SOM ( Amelung et al., 2002 ). XPS was successfully adapted to determine the chemical composition of SOMs occluded in different aggregate size fractions. In addition, the spatial distribution of elements at a resolution of < 3 μm can be mapped in selected regions of coatings, mineral-organic associations, and aggregates using electron probe microanalysis (EPMA). Significant advances related to molecular markers and detection sensitivity now enable better detection of specific bacteria in soils and their spatial distribution at the micrometer scale to be determined in thin sections ( Eickhorst and Tippkötter, 2008 ; Castorena et al., 2016 ). All of this information can, in principle, be combined and translated into 3D distributions using recently developed statistical algorithms. To conclude, this review suggests a conceptual view emphasizing the central role of the rhizosphere in interactions with other biogeochemical interfaces. The main drivers of plant–microbial interactions, such as substrate input through exudation and rhizodeposition, and physico-chemical conditions (e.g., proton release and oxygen diffusion and transport) are already subject to intensive research. In contrast, the driving role of trophic interactions within and between interfaces, including competition for nutrients and successional dynamics, requires more specific studies involving both higher and lower trophic levels (e.g., protists, predatory bacteria, and mycoviruses). According to our concept, microorganisms are not the drivers, but they are the most abundant and powerful players in the soil interfaces because of the great diversity and specificity of genes encoding similar functions. The combination of phylogenic specificity and functional redundancy ensures the sustainability of soil microbial communities by the use of functional traits (e.g., the ability to produce specific extracellular enzymes, rapid or slow growth, and efficiency of metabolic pathways) as a tool to develop a microbial life strategy, which in turn affects the rates of transformation of organic compounds in soil. Thus, taxa with life strategies best adapted to the environment become dominant and alter the structure of the active microbial community. This self-regulatory mechanism maintains metabolic activity by the microbial community during the successional decomposition of organic substrates entering the soil. However, the rates of substrate decomposition are dependent on the functional traits of dominant taxa and microbial life strategy, which in turn are selected according to substrate quality and local environmental constraints, for example, water and nutrient availability. The rapid development of instrumental and molecular techniques has fueled attempts to reconsider the concepts of microbial life strategies with the goal of specifying functional groups according to their ecological relevance. This requires the identification and estimation of intrinsic traits by microbial physiology or phenotypic traits at the functional gene level. The quantitative definition of functional traits based on genetic and isotopic approaches is very promising, but demands further development with caution regarding the relevant resolution time and type of biomarker. Additional technique development is needed for ground-truth measurements of microbial growth in soil, linking physiological and molecular approaches. Therefore, the current challenge in modern ecology is the further development of cutting-edge methodologies for precise localization of biochemical processes, considering interactions within and between soil interfaces, as well as identifying and linking functional traits of plants and microbial populations that contribute to the rates of soil processes relevant at the ecosystem level."
} | 2,008 |
27794590 | null | s2 | 9,518 | {
"abstract": "Amyloids are highly ordered, hierarchal protein nanoassemblies. Functional amyloids in bacterial biofilms, such as Escherichia coli curli fibers, are formed by the polymerization of monomeric proteins secreted into the extracellular space. Curli is synthesized by living cells, is primarily composed of the major curlin subunit CsgA, and forms biological nanofibers with high aspect ratios. Here, we explore the application of curli fibers for nanotechnology by engineering curli to mediate tunable biological interfaces with inorganic materials and to controllably form gold nanoparticles and gold nanowires. Specifically, we used cell-synthesized curli fibers as templates for nucleating and growing gold nanoparticles and showed that nanoparticle size could be modulated as a function of curli fiber gold-binding affinity. Furthermore, we demonstrated that gold nanoparticles can be preseeded onto curli fibers and followed by gold enhancement to form nanowires. Using these two approaches, we created artificial cellular systems that integrate inorganic-organic materials to achieve tunable electrical conductivity. We envision that cell-synthesized amyloid nanofibers will be useful for interfacing abiotic and biotic systems to create living functional materials.."
} | 317 |
36160925 | PMC9488087 | pmc | 9,519 | {
"abstract": "Formation of acid mine drainage (AMD) is a widespread environmental issue that has not subsided throughout decades of continuing research. Highly acidic and highly concentrated metallic streams are characteristics of such streams. Humans, plants and surrounding ecosystems that are in proximity to AMD producing sites face immediate threats. Remediation options include active and passive biological treatments which are markedly different in many aspects. Sulfate reducing bacteria (SRB) remove sulfate and heavy metals to generate non-toxic streams. Passive systems are inexpensive to operate but entail fundamental drawbacks such as large land requirements and prolonged treatment period. Active bioreactors offer greater operational predictability and quicker treatment time but require higher investment costs and wide scale usage is limited by lack of expertise. Recent advancements include the use of renewable raw materials for AMD clean up purposes, which will likely achieve much greener mitigation solutions.",
"conclusion": "8 Conclusions Active and passive biological remediation techniques devised for controlling AMD have been widely developed to constrain the deleterious effects. Major factors involved are cost for transportation of liming materials and modification chemicals; available land size and topography; sludge disposal or waste streams generation if ill-managed; and maintenance and labor costs. Critically, factors listed above should be evaluated as a function of one another and not singled out for individual assessment. As seen from current evolving trends, optimization of high efficiency bioreactors requires much less area which allows reduction of land requirements. Focus should be more on enhancing overall process design that takes life cycle assessment into account. Additionally, AMD remediation may be perceived as capitalizing on generation of renewable raw materials as metal recovery from bio treatment systems may provide a good return of revenue.",
"introduction": "1 Introduction In recent times, acid mine drainage (AMD) has become a serious global issue owing to its hazardous impact on the environment and living organisms causing most dangerous effects [ 1 ]. AMD is mostly generated as a by-product of various industrial processes of mining and other related industries. A detailed description of AMD origin and different routes which contribute to AMD generation have been reported in the literature [ 2 , 3 ]. AMD generation is very acute in inactive and abandoned mining sites associated with various minerals and metallurgical extraction. In brief, accelerated oxidation of sulfidic minerals (especially iron pyrites and other heavy metal pyrites) due to their exposure to water and oxygen is the major reason for AMD generation. Also, generation of acidic streams with high sulfate content is commonly caused by exposure and oxidation of sulfide-bound minerals or rocks. AMD or acid rock drainage (ARD) formation is common in many mining and mineral refining industries. Chemical reactions that underlie AMD generation is simple and well-researched (outlined in Sec 2.1 ), but drainage composition can differ drastically from one region to another due to local geology, microclimate, group of microorganisms and source of water [ 4 ]. High concentrations of dissolved metalloids and metals, extremely acidic pH and large amounts of sulfate in the AMD pose a serious threat to underground and surface water contamination leading to lethal effects. Extended impacts include biodiversity loss and deterioration of aquatic ecosystems [ 5 , 6 ]. In order to prevent the damages of AMD and to enhance ecological sustainability, a proper treatment and management system for AMD is required. Economically-effective remediation technologies have been proposed to counteract the effects of AMD repercussions. Specifically, biological treatments generate great interest among researchers for its promising ability for AMD clean-up [ [7] , [8] , [9] , [10] ]. Biological treatments of AMD, also known as bio-remediation, has been attractive compared to other chemical based treatments of AMD with respect to low operational and labor costs, easy process design and control, and with better sulfate and metal recovery [ 11 , 12 ]. In principle, bioremediation of AMD involves the usage of sulfate reducing bacteria (SRB) to microbially recover metals and sulfates present in AMD as metal sulfides [ 13 ]. The metabolism of SRB reduces the excessive sulfate present in AMD to hydrogen sulfide (H 2 S). The biogenic H 2 S easily binds with the metals in the AMD stream to precipitate as metal sulfides which are very stable and can be easily recovered and recycled. The overall biochemical reactions associated with the SRB reduction of metals and sulfides in AMD are shown in Eqs. (1) , (2) , (3) ). (1) SO 4 2− + 4H 2 + H + → HS − + 4H 2 O (2) Organic matter (C, O and H) + SO 4 2− → HS − + HCO 3 − (3) M 2+ + HS − → MS (↓) + H + (M 2+ - Metal cation) Further, SRB metabolism also helps in acidity neutralization of AMD due to the alkalinity resulting from its biochemical reactions. This aids in the easy filtration of the metal sulfides from the liquid phase of the reaction system. A range of biological methods falls under the spectrum of bio-remediation of AMD which can be grouped into active and passive treatment methods. Fig. 1 presents a simple classification of these bio-remediation techniques. A biologically active treatment system is usually a continuous process which requires constant resource input and immobilizes the metal contaminants by generation of sufficient alkalinity. These types of treatments provides better process control and ability for functional modifications in the reaction system [ [14] , [15] , [16] ]. Passive systems require relatively low resource input and are quite advantageous from the perspective of operational costs but more expensive to set-up. Fig. 1 Bioremediation methods for AMD treatment. Fig. 1 This paper reviews the current understanding of AMD treatment methods, with emphasis on biologically-based treatment options. It describes, in sequence, occurrence of AMD, role of sulfate reducing bacteria in AMD treatment, passive and active biological treatments, and finally, highlights the current biological processes based technology trends for AMD treatment. It should be noted that the term AMD has seemingly been used interchangeably with ARD but we will use AMD here to emphasize the anthropogenic-induced problems which are more frequent and of greater concern than that of natural acidic drainage."
} | 1,646 |
26024830 | PMC5250675 | pmc | 9,521 | {
"abstract": "Direct treatment of municipal wastewater (MWW) based on anaerobic ammonium oxidizing (anammox) bacteria holds promise to turn the energy balance of wastewater treatment neutral or even positive. Currently, anammox processes are successfully implemented at full scale for the treatment of high-strength wastewaters, whereas the possibility of their mainstream application still needs to be confirmed. In this study, the growth of anammox organisms on aerobically pre-treated municipal wastewater (MWW pre-treated ), amended with nitrite, was proven in three parallel reactors. The reactors were operated at total N concentrations in the range 5–20 mg N ∙L −1 , as expected for MWW. Anammox activities up to 465 mg N ∙L −1 ∙d −1 were reached at 29 °C, with minimum doubling times of 18 d. Lowering the temperature to 12.5 °C resulted in a marked decrease in activity to 46 mg N ∙L −1 ∙d −1 (79 days doubling time), still in a reasonable range for autotrophic nitrogen removal from MWW. During the experiment, the biomass evolved from a suspended growth inoculum to a hybrid system with suspended flocs and wall-attached biofilm. At the same time, MWW pre-treated had a direct impact on process performance. Changing the influent from synthetic medium to MWW pre-treated resulted in a two-month delay in net anammox growth and a two to three-fold increase in the estimated doubling times of the anammox organisms. Interestingly, anammox remained the primary nitrogen consumption route, and high-throughput 16S rRNA gene-targeted amplicon sequencing analyses revealed that the shift in performance was not associated with a shift in dominant anammox bacteria (“ Candidatus Brocadia fulgida”). Furthermore, only limited heterotrophic denitrification was observed in the presence of easily biodegradable organics (acetate, glucose). The observed delays in net anammox growth were thus ascribed to the acclimatization of the initial anammox population or/and the development of a side population beneficial for them. Additionally, by combining microautoradiography and fluorescence in situ hybridization it was confirmed that the anammox organisms involved in the process did not directly incorporate or store the amended acetate and glucose. In conclusion, these investigations strongly support the feasibility of MWW treatment via anammox.",
"conclusion": "5 Conclusions The feasibility of mainstream anammox application was studied in three parallel reactors both on synthetic media and real municipal wastewater. The process performance investigations at reactor level were efficiently complemented by metabolic and molecular analyses and led to the following key conclusions of significant relevance for MWW treatment applications: • the active growth of anammox guild on aerobically pre-treated MWW (MWW pre-treated ) was proved over the temperature range 12.5–29 °C with volumetric nitrogen removal rates in the same order of magnitude as in current municipal wastewater treatment systems; • direct unfavorable impacts of MWW pre-treated on anammox performance were revealed by a two to three-fold slower anammox growth compared to synthetic MWW; • “ Ca. Brocadia fulgida” remained the dominant anammox candidate species throughout the experiment, as revealed by high-throughput 16S rRNA gene-targeted amplicon sequencing analyses; • direct incorporation or storage of organics (acetate and glucose) by the anammox organisms involved in the process could be excluded by means of combined microautoradiography and FISH analysis; • appropriate MWW pre-treatment, here with a high-rate aerobic activated sludge process, allowed potentially competing heterotrophic activity in the anoxic anammox stage to be significantly limited.",
"introduction": "1 Introduction Nitrogen is removed from municipal wastewater (MWW) to reduce its adverse environmental impacts ( Galloway et al. 2003 ). Conventionally, ammonium is first oxidized aerobically to nitrite and nitrate via autotrophic nitrification and subsequently (partly) reduced to di-nitrogen gas through heterotrophic denitrification. This route, while allowing for reliable nitrogen removal, is demanding both in terms of energy (e.g. blowers for aeration, requirement of influent organic load for denitrification and thus reduced biogas production) and costs (e.g. sludge disposal). The anaerobic ammonium-oxidizing (anammox) bacteria, capable of autotrophic ammonium oxidation with nitrite as the terminal electron acceptor, was discovered in the mid-1990s ( Mulder et al. 1995 ). Today, anammox-based processes are considered the most promising alternative for biological nitrogen removal in MWW applications ( van Loosdrecht and Brdjanovic, 2014 ) with the potential, in combination with anaerobic digestion, to turn the energy balance of wastewater treatment neutral or even positive ( Siegrist et al. 2008 ). In principle, direct MWW treatment based on anammox would allow for the segregation of the removal of organic matter (COD) and nitrogen. COD could indeed be removed in a first step – either via a high-rate activated sludge or a physico-chemical process ( Versprille et al. 1985 ) – and the energetic content of the removed organics could then be valorized in anaerobic digestion. Next, the nitrogen-rich liquid fraction along with the digestion supernatant could be treated autotrophically via anammox after partial nitritation (oxidation of half of the ammonium to nitrite). This would lead to significant reductions in oxygen consumption and to an increase in biogas production ( Siegrist et al. 2008 ). To date, anammox-based processes constitute a robust and reliable treatment for wastewaters with high nitrogen concentrations at mesophilic conditions, and over 100 full-scale plants have been installed worldwide ( Lackner et al. 2014 ). However, the potential for the direct treatment of real MWW with anammox-based processes has still not been fully confirmed despite increasing experimental evidence. Maintaining nitrogen removal rates above 50 g N ∙m −3 ∙d (e.g. typical values for municipal wastewater treatment) and reliably achieving the required effluent quality at temperatures of 10–25 °C represent two of the current main challenges towards full-scale application (e.g. Gilbert et al. (2014) ). A significant impact of temperature decrease on anammox activity has been reported ( Isaka et al., 2008 , Lotti et al., 2015 ). Nevertheless, proofs of concept have been obtained with COD-free synthetic wastewater at nitrogen concentrations in the MWW range. Combined partial nitritation/anammox reactors have been stably operated at both 12 °C ( Hu et al. 2013 ) and 10 °C ( Gilbert et al. 2014 ). However, volumetric anammox activities have been reported in a relatively low range ( Gilbert et al. 2014 ). Moreover, the presence of complex mixtures of organics in real MWW could affect the anammox performance directly (e.g. methanol toxicity ( Güven et al. 2005 )) or indirectly (e.g. fostering competing microbial species ( Lackner et al. 2008 )). So far, there is little understanding of the intrinsic effects of MWW composition on process performance, anammox metabolism and the overall structure of the microbial community, as observed for example in the case of source-separated urine treatment ( Bürgmann et al. 2011 ). Only few research efforts have focused on real MWW, namely pre-settled diluted raw MWW ( De Clippeleir et al. 2013 ) or nitrite-amended secondary clarifier effluent ( Ma et al. 2013 ) and aerobically pre-treated MWW ( Lotti et al. 2014 ). All these studies are restricted to granules or biofilms and no information is available on the use of suspended-growth anammox sludges for mainstream applications. Furthermore, the direct effects of MWW are as yet unclear. Additionally, there is no conclusive evidence as to whether treating real MWW would select for specific anammox species. Recently published results based on fluorescence in situ hybridization (FISH) have highlighted “ Candidatus Brocadia fulgida” as the dominant species in MWW ( Lotti et al., 2014 , Ma et al., 2013 ). However, to the authors' knowledge, no DNA sequencing data is available for the anammox candidate species in MWW applications. The goal of the present work was to assess the possibility for the anammox guild to grow on MWW at conditions relevant for mainstream application. Three parallel reactors were inoculated with anammox sludges treating digestor supernatant and initially operated at 29 °C in order to investigate: ( i ) anammox activity and growth rates on pre-treated MWW and ( ii ) the potential effects of MWW both on the anammox and the overall population in terms of nitrogen turnover, dominant population dynamics and substrate competition. The effects of a temperature decrease to psychrophilic conditions (12.5 °C) were also assessed. Process performance investigations at reactor level were efficiently complemented by quantitative FISH, microautoradiography combined with FISH and high-throughput 16S rRNA gene-targeted amplicon sequencing to obtain information on microbial composition and ecophysiology.",
"discussion": "4 Discussion 4.1 Anammox grow on MWW pre-treated , even at low temperatures Anammox growth on MWW pre-treated amended with NO 2 − was shown in three parallel reactors at total N concentrations in the range 5–20 mg N ∙L −1 . The observed maximum anammox activities ranged between 205 and 465 mg N ∙L −1 ∙d −1 at 29 °C, with estimated doubling times of anammox populations between 18 and 46 days ( Fig. 1 ). A temperature decrease to 12.5 °C resulted in a decline in anammox activity from over 400 to about 40 mg N ∙L −1 ∙d −1 , associated with an increase in the estimated anammox doubling time from 24 to 79 days ( Fig. 2 ). This unfavorable temperature effect was particularly relevant between 15 and 12.5 °C, as recently also observed by Gilbert et al. (2014) and Lotti et al. (2015) . Our results are in good agreement with Hendrickx et al. (2014) , who have enriched anammox bacteria at 10 °C from conventional activated sludge with a mixture of synthetic media and 10% (v/v) filtered anaerobic effluent (61 mg (NH4+NO2)-N ∙L −1 ). The authors reported activities of 27 mg N ∙L −1 ∙d −1 and a growth rate of 0.011 d −1 (doubling time of 71 days) at solids concentrations of 0.5 g VSS ∙L −1 , which are comparable to those of the present study. Significantly higher activities have been reported under anoxic conditions for systems with higher biomass concentrations. Ma et al. (2013) maintained anammox activities up to 2280 mg N ∙L −1 ∙d −1 at 16 °C in an anammox UASB reactor operated with the addition of powdered activated carbon and fed with the effluent from a secondary clarifier (17 and 20.5 mg N ∙L −1 of NH 4 + and NO 2 − , respectively). In line with these findings, Lotti et al. (2014) obtained activities of up to 430 mg N ∙L −1 ∙d −1 at 10 °C with a continuous upflow fluidized granular sludge reactor (6.7 g VSS ∙L −1 ) fed with MWW pre-treated (60 mg (NH4+NO2)-N ∙L −1 ). The authors estimated growth rates of anammox populations of 0.020 d −1 (doubling time of 35 days) and 0.005 d −1 (132 days) at 20 and 10 °C respectively. Accordingly, the results presented here strongly support the capability of the anammox guild to grow on MWW at conditions relevant for mainstream applications and reach turnovers comparable to those of conventional systems, i.e. 50 mg N ∙L −1 ∙d −1 ( Metcalf & Eddy et al. 2013 ). Future research efforts would need to prove the long-term stability at low temperatures and identify proper treatment configurations to provide the nitrite for the anammox reaction (e.g. separate or combined partial nitritation and anammox). Meeting the required discharge limits will constitute an additional challenge. 4.2 From synthetic media to MWW pre-treated : significant impacts on anammox growth rates No direct impact of MWW pre-treated on the activity and growth of anammox populations has yet been reported. In the present study, a two to three-fold increase in the estimated doubling times was observed in R1 and R2 respectively when moving from synthetic media to MWW pre-treated . This unfavorable effect on the anammox performance was further supported by the initial decrease in anammox activity when the feed was changed to MWW pre-treated over days 203–268 in R1 and 241–256 in R2 ( Fig. 1 ). Competition between anammox and heterotrophic populations for NO 2 − was initially hypothesized as the cause of the observed behavior. Specifically, in the studied system where no O 2 was supplied and NH 4 + and NO 2 − were spiked in the influent ( Phase III ), AMX and heterotrophs were expected to be the two main microbial guilds competing for NO 2 − as growth-limiting substrate. The latter could potentially grow on soluble microbial products ( Kindaichi et al. 2004 ) or be accidentally carried over from the COD removal step, whereas the influent itself was assumed to have only slowly biodegradable COD. Nevertheless, after several months of continuous anoxic feeding with MWW pre-treated , anammox remained the dominant N-consumption route in both reactors, as supported by ( i ) the stoichiometric ratio of NO 2 − to NH 4 + consumptions and the NO 3 − production, as well as ( ii ) the marked increase in NO 2 − depletion after NH 4 + addition ( Fig. 4 (a)). Furthermore, despite significant changes in anammox activity, no shift in the predominant anammox populations was observed throughout the experiment. According to the 16S rRNA gene-targeted amplicon sequencing data, “ Ca. Brocadia fulgida” was the dominant anammox candidate strain. Interestingly, the same strain has been identified by FISH in the study of Lotti et al. (2014) . These results confirm the versatility of “ Ca. Brocadia fulgida” and its competitive advantage over other anammox species in the presence of complex substrates ( Jenni et al., 2014 , Kartal et al., 2008 , Winkler et al., 2012 ). In conclusion, these results indicate the appropriateness of the applied aerobic MWW pre-treatment as the residual organic content was insufficient to sustain a heterotrophic biomass able to outcompete the anammox population. High-rate activated sludge can thus be suggested as an appropriate pre-treatment for future implementations. In addition, anammox bacteria affiliating with the “ Candidatus Brocadia fulgida” strain dominated throughout the experiments, even after prolonged exposure to MWW pre-treated . Neither heterotrophic competition for NO 2 − nor a shift in the dominant anammox population could explain the adverse effects on anammox performance observed after the shift from synthetic media to MWW pre-treated . The delay in anammox activity growth could therefore be interpreted by the acclimatization of the initial anammox population (e.g. to the composition or salinity of MWW pre-treated ) or/and the development of a side population beneficial to it (e.g. organisms metabolizing and decreasing the fraction of compounds affecting the anammox bacteria in MWW pre-treated ). 4.3 Heterotrophic substrates: depletion of soluble organics and the role of anammox Heterotrophic denitrification and growth on NO 2 − and NO 3 − could explain less than half of the observed COD sol removal in batch tests ( Fig. 4 (b)). Yields of anoxic heterotrophic growth on soluble organic substrates in the range 0.9–0.97 g CODbiom /g CODsol should be postulated to explain all the COD consumption via heterotrophic denitrification. These values are, however, significantly higher than the ranges between 0.53 and 0.54 g CODbiom /g CODsol proposed in the literature ( Gujer et al., 1999 , Muller et al., 2003 ). A stoichiometric model including anoxic intracellular storage of soluble organic matter was developed on the basis of ASM3 parameters (see Table S2 , ( Gujer et al., 1999 , Muller et al., 2003 )), and the observed COD sol consumption seemed to occur at an overall stoichiometry comparable to the modeled storage ( Fig. 4 (b)). Thus, anoxic storage of organics could have played an important role in the described system. The ability to store organics may in fact have represented a competitive advantage in the present system, as electron acceptors (NO 2 − and/or NO 3 − ) were always present whereas the availability of electron donors (COD sol ) was the limiting factor ( Shimada et al. 2007 ). However, the storage products were not measured nor was their subsequent utilization characterized. Nevertheless, to better understand the COD sol depletion in the studied sludge and to elucidate the role of anammox populations, sludge from R1 was incubated with radio-labeled acetate and glucose for microautoradiography analysis. Anammox are known to be able to oxidize acetate using NO 3 − as the electron acceptor ( Kartal et al. 2008 ) while, apparently, they do not oxidize glucose directly ( Jenni et al. 2014 ). Moreover, Winkler et al. (2012) have shown that anammox bacteria can outcompete heterotrophic denitrifiers in catabolizing acetate at ambient temperatures (18 °C) on a synthetic cultivation medium. In all conducted incubations, the probe-defined anammox bacteria were MAR-negative, proving that anammox did not directly incorporate or store the amended acetate and glucose in the present system ( Fig. 5 ). A heterotrophic catabolic activity of anammox populations can however not be excluded. These results constitute an independent confirmation that, under the tested conditions, anammox (“ Ca. Brocadia fulgida”) do not incorporate organics as previously discussed for propionate ( Güven et al. 2005 ) and acetate ( Kartal et al. 2008 ). 4.4 Initial activity loss, sludge wash out and biofilm formation Two distinct suspended sludges originating from sidestream nitritation/anammox reactors were used as inoculum sources and initially operated under micro-aerobic conditions for partial nitritation/anammox. The two biomasses featured comparable biomass compositions but substantially different morphologies ( Fig. 3 (a, e)) that apparently led to distinct responses to MWW pre-treated in Phase I ( Fig. 1 (b, d)). The large aggregates present in the R1 inoculum became progressively looser and broke down into smaller flocs with probably poorer settling properties. This possibly resulted in the washout of both AMX and AOB ( Fig. 3 (a–d)). It is speculated here that the change to lower operating oxygen and nitrogen concentrations, as compared to side-stream treatment, and the differences in rheological characteristics from a full- to lab-scale reactor resulted in the disruption of the floc structure. Conversely, the dense anammox aggregates in the R2 inoculum maintained their structure throughout Phase I , and only the small AOB micro-colonies were selectively washed out ( Fig. 3 (e–h)). The low oxygen concentrations applied to avoid the risk of oxygen inhibition of the anammox organisms probably did not sustain the growth of AOB. As a result of the washout of AOB, we suppose that the anammox were progressively exposed to less nitrite and higher oxygen concentrations. This could explain the marked loss of anammox activity despite the limited solids loss and the increase in anammox relative abundance ( Fig. 1 (c, d)). These observations underline how particular attention should be paid to the treatment conditions under reactor start-up in order to maintain a balanced combined partial nitritation/anammox, especially when moving from side-to main-stream applications. The governing mechanisms for the observed sludge disintegration differences in Phase I remain unclear. However, (i) the greater stability of the dense aggregates and the reduced sludge loss in R2 together with (ii) the observed transition to a hybrid system in both reactors, with most biomass as biofilm on the walls, strongly indicate the potential advantages of using granular and biofilm biomasses for anammox-based MWW applications. This is expected to allow for better biomass retention finally resulting in higher volumetric activity."
} | 5,006 |
21044338 | PMC2987988 | pmc | 9,522 | {
"abstract": "Background LuxS is the synthase enzyme of the quorum sensing signal AI-2. In Salmonella Typhimurium, it was previously shown that a luxS deletion mutant is impaired in biofilm formation. However, this phenotype could not be complemented by extracellular addition of quorum sensing signal molecules. Results Analysis of additional S. Typhimurium luxS mutants indicated that the LuxS enzyme itself is not a prerequisite for a wild type mature biofilm. However, in close proximity of the luxS coding sequence, a small RNA molecule, MicA, is encoded on the opposite DNA strand. Interference with the MicA expression level showed that a balanced MicA level is essential for mature Salmonella biofilm formation. Several MicA targets known to date have previously been reported to be implicated in biofilm formation in Salmonella or in other bacterial species. Additionally, we showed by RT-qPCR analysis that MicA levels are indeed altered in some luxS mutants, corresponding to their biofilm formation phenotype. Conclusions We show that the S. Typhimurium biofilm formation phenotype of a luxS mutant in which the complete coding region is deleted, is dependent on the sRNA molecule MicA, encoded in the luxS adjacent genomic region, rather than on LuxS itself. Future studies are required to fully elucidate the role of MicA in Salmonella biofilm formation.",
"conclusion": "Conclusions In this study, we showed by analyzing different S. Typhimurium mutants that biofilm formation is influenced by the sRNA molecule MicA. This sRNA is encoded in close proximity of the quorum sensing synthase luxS and mutating this region can therefore mutually affect both genetic loci. Given the evolutionary conservation of MicA in several Enterobacteriaceae , this regulatory mechanism of biofilm formation might also apply to bacterial species other than Salmonella .",
"discussion": "Discussion In several bacteria, biofilm formation capacity has been linked to luxS based quorum sensing, mediated by AI-2 signaling molecules [ 4 - 9 ]. In Salmonella Typhimurium, it was previously reported that a deletion mutant of the AI-2 synthase enzyme luxS has an impaired biofilm formation capacity [ 10 ]. However, this phenotype could not be chemically complemented by extracellular addition of synthetic DPD, nor by expressing luxS from a constitutive promoter on a plasmid. On the other hand, introduction of luxS with its native promoter did complement the biofilm phenotype [ 10 ]. In this study, we showed that both a luxS ::Km insertion mutant and a deletion mutant of the 3' end of the luxS coding sequence are still able to form a mature biofilm, despite the fact that these strains are unable to form the type-2 quorum sensing signaling molecule AI-2. Adjacent to the luxS coding sequence, a small non-coding RNA molecule named MicA is encoded in the opposite strand [ 15 ]. Using MicA depletion and overexpression constructs, respectively, we showed that a tightly balanced MicA concentration is essential for proper biofilm formation in S. Typhimurium. This suggests that the final impact of MicA regulation on biofilm formation is based on a complex interplay of several of its targets, a fine-tuning process in which timing is also likely to play a role. It is interesting to note that the MicA depletion strain does not completely abolish the biofilm formation capacity. This could be explained by an incomplete silencing of MicA in this strain or by the fact that other sRNA molecules take over the role of MicA. It is not uncommon that mRNA targets are redundantly regulated by multiple sRNA molecules fine-tuning their expression in a complex way [ 28 , 29 ]. The fact that deletion of both rpoE or hfq fully inhibited biofilm formation supports the hypothesis that other sRNA molecules are implicated in regulation of biofilm formation. In literature, two MicA targets known to date were previously linked to biofilm formation. An E. coli ompA mutant is unable to form a mature biofilm on plastic substrates [ 27 ]. We showed that also in Salmonella Typhimurium, OmpA is involved in biofilm formation as an ompA deletion mutant is unable to form a mature biofilm. Furthermore, the two-component system PhoPQ, previously shown to be implicated in regulation of Salmonella biofilm formation [ 25 ], was recently described as a target of MicA in E. coli [ 24 ], implying indirect regulation of the entire PhoPQ regulon by MicA. At this moment, it cannot be excluded that other, yet uncharacterized targets of MicA exist which are related to biofilm formation. Nevertheless, it is already clear that MicA regulation comprises a complex network of interactions influencing a broad range of genes either directly or indirectly. Using RT-qPCR analyses, we were able to confirm that the levels of MicA in the luxS CDS deletion mutant CMPG5602 compared to wildtype and the insertion mutant CMPG5702 differ. This supports our formulated hypothesis that an impaired biofilm formation phenotype in a Salmonella Typhimurium luxS deletion mutant is due to an imbalanced MicA level, rather than to the absence of LuxS itself. Remark that complementation of the CMPG5602 phenotype requiring expression of luxS from its native promoter [ 10 ] also corroborates with this model (Figure 1 ). Indeed, MicA is encoded in this promoter region and hence, the biofilm phenotype can only be complemented by reintroduction of MicA. Presently, it is still unclear how deletion of the luxS CDS influences MicA expression. The putative -10 and -35 regions of MicA as reported by Udekwu et al. [ 17 ] do not overlap with the coding region of luxS (Figure 1 ). However, this coding region might include other regulatory elements interfering with MicA expression. Further studies of both luxS and micA promoter regions and transcription are required to elucidate the mechanism of interference between both genetic loci."
} | 1,481 |
24818264 | null | s2 | 9,524 | {
"abstract": "While certain archaea appear to synthesize and/or metabolize fatty acids, the respective pathways still remain obscure. By analysing the genomic distribution of the key lipid-related enzymes, we were able to identify the likely components of the archaeal pathway of fatty acid metabolism, namely, a combination of the enzymes of bacterial-type β-oxidation of fatty acids [acyl-coenzyme A (CoA) dehydrogenase, enoyl-CoA hydratase and 3-hydroxyacyl-CoA dehydrogenase] with paralogs of the archaeal acetyl-CoA C-acetyltransferase, an enzyme of the mevalonate biosynthesis pathway. These three β-oxidation enzymes working in the reverse direction could potentially catalyse biosynthesis of fatty acids, with paralogs of acetyl-CoA C-acetyltransferase performing addition of C2 fragments. The presence in archaea of the genes for energy-transducing membrane enzyme complexes, such as cytochrome bc complex, cytochrome c oxidase and diverse rhodopsins, was found to correlate with the presence of the proposed system of fatty acid biosynthesis. We speculate that because these membrane complexes functionally depend on fatty acid chains, their genes could have been acquired via lateral gene transfer from bacteria only by those archaea that already possessed a system of fatty acid biosynthesis. The proposed pathway of archaeal fatty acid metabolism operates in extreme conditions and therefore might be of interest in the context of biofuel production and other industrial applications."
} | 370 |
36215498 | PMC9586260 | pmc | 9,528 | {
"abstract": "Significance Circular economy requires materials with a low carbon and environmental footprint. In this context, algae-derived polysaccharides, being a product of carbon dioxide consumption, represent an abundant and sustainable source for engineering materials. Replacing plastics has been challenging as they possess superior properties. Here, a conceptual framework for processing marine polysaccharides into films that possess mechanical properties that are superior to polylactic acid, the most common biodegradable plastic, is presented. At the crux of this system is a network of two polysaccharides possessing vastly different physicochemical characteristics in which simply tuning the calcium concentration leads to films possessing varying degrees of elastic and plastic behavior. The system presented herein represents a significant step toward the exploitation of marine macromolecules in structural composites and consumer products.",
"discussion": "Results and Discussion System Design. We conceptualized a d-IPN comprising one network undergoing dynamic physical cross-linking through a combination of weak and strong H-bonding and another undergoing ionic cross-linking. In such a framework, the introduction of multivalent metal ions would in theory promote the formation of densely cross-linked structures driven by the nucleation and growth of ionic net points and a system with dedicated stress-dissipation domains. To test this hypothesis, we exploited two water-soluble marine algae–derived polysaccharides, namely, CAs, derivatives of agarose that exhibit tunable sol–gel transition around room temperature and thus remain a liquid during processing and undergo physical cross-linking through a combination of weak β-sheet–β-sheet/β-strand–β-strand interactions and strong helical–helical interactions ( 38 ), and sodium-Alg, which can be postprocessed into cross-linked domains using calcium ( Fig. 1 A ). Unlike in the study by Sun et al. ( 32 ), where Alg was purely used as one of the bicontinuous networks, we aimed to use Alg not only as a stress-dissipation component but also as a component that forms discrete nanoscale domains that can act as strain-hardening elements. Fig. 1. Illustration of the guiding principles for the engineering of the d-IPN. ( A ) Schematic representation of the d-IPN comprising physically and ionically cross-linked polymers. ( B ) ( i ) Schematic illustration of the “casting from” strategy of the polysaccharide-based composite. ( ii ) Photograph of a CAAlg composite film placed in front of a logo of our institute illustrating its transparent characteristics. CAAlg Can Be Processed into Homogenous Nanostructured Films. A physically cross-linked system offers two clear advantages: 1) It can be reversibly formed and reformed using temperature, thereby allowing temperature-based processing of the material, and 2) will lead to uniform cross-linking since the molecular self-assembly process in an aqueous environment is thermodynamically driven. Besides the obvious environmental upsides to water-based processing, unlike casting films from organic phases where solvent evaporation can severely impact film properties by inducing phase separation ( 39 ), here, during the sol–gel transition, the increasing viscosity ensures that the macromolecules possess near-zero diffusion coefficient, thus avoiding phase separation, and should lead to reproducible uniform film formation. We first tested the film-forming properties of CA of various storage modulus (G′) and identified that a 5 wt/vol percent 1:1 blend of the medium CA (G′, 2,270 ± 864 Pa) and the soft CA (G′, 16 ± 0.62 Pa) yielded reproducible films after gelation at 10 °C. While cross-linked calcium alginate yields brittle films that undergo shrinkage ( SI Appendix , Fig. S1 ), introduction of sodium alginate in the CA system at a ratio of 25% by weight of the total polysaccharide content did not disrupt physical gelation of the CA and had no noticeable impact on the film-forming properties of the CA blends. Grounded in these observations, a process involving hydrogel casting followed by calcium cross-linking was implemented ( Fig. 1 B , steps 1 and 2). Based on a recent paper describing the preparation of alginate films ( 40 ), we first explored a [Ca 2+ ] of 500 mM. The CAAlg films were exposed to calcium for 15 min and then desiccated for 72 h, and for comparison a 5% alginate film was cross-linked under identical conditions ( Fig. 1 B , step 3). The dried state of the film was confirmed by thermal gravimetric analysis (TGA), which revealed a ∼9% wt/wt of water in the films ( SI Appendix , Fig. S2 ). Scanning electron microscopy (SEM) of dried CA-blend films, as expected, revealed an amorphous microstructure ( Fig. 2 A and D ) and tapping mode atomic force microscopy (AFM) images revealed the presence of a fibrous network akin to what has been previously reported for pure CA films ( Fig. 2 G ) ( 41 ). In the case of calcium alginate films, although no specific morphology was observed in the SEM images ( Fig. 2 B and E ), AFM images revealed a closely packed structure comprising irregular shaped nodules less than 100 nm in average diameter ( Fig. 2 H ). However, CAAlg films revealed a distinct morphology that can be attributed neither to the CA nor the Alg component ( Fig. 2 C, F, and I ). It is plausible that these structures are the result of the aggregation of multimers produced by the lateral association of egg-box dimers formed upon calcium-induced cross-linking of guluronic acid in the alginate chains ( 42 ). In the case of the calcium-free CAAlg films (CAAlg*), neither phase separation between CA and calcium alginate nor any distinct morphology was observed ( SI Appendix , Fig. S3 A and B ). This observation was a bit surprising as the calcium alginate content is only 25% of the total polymer mass; nonetheless, this led us to conclude that the addition of calcium promotes the association and aggregation of alginate chains, resulting in the evolution a nano-scale phase. To ascertain if the nano structures are an artifact of the drying process, wet films were observed using an environmental scanning microscope. Imaging at increasing chamber pressures revealed the preservation of nano-scale domains confirming that this was an inherent property of CAAlg films ( SI Appendix , Fig. S4 ). Furthermore, since CA bears carboxylic acid groups that can also chelate with divalent cations, we investigated the rheological behavior of CA gels (1 wt/vol %) at 0.1 and 1 Hz in the presence and absence of calcium and observed no appreciable differences in G′ in all conditions, thus excluding any major contribution of CA chains in the formation of the ionic network ( SI Appendix , Fig. S5 ). Representative stress strain curves of air-dried 5% CA and 500 mM CAAlg air-dried films before and after cross-linking with calcium and key film properties (elastic modulus [E], elongation at break [ε], toughness [U T ], and yield stress [σ y ]) are shown in Fig. 2 J and K , respectively. As postulated, the introduction of dynamic ionic cross-links introduced plastic behavior in the films due to the ability of ionic cross-links to absorb and dissipate energy, resulting in films that underwent on an average 2.5-fold (6.01 ± 1.41%) greater elongation than CAAlg* and CA films. However, this increase in plastic behavior comes at the expense of stiffness and toughness in the films. Since the mechanical properties are postulated to evolve due to a balance between physical and ionic cross-links, reducing plastic deformation should in theory increase stiffness and toughness of the films. To test this premise the effect of lower [Ca 2+ ] on CAAlg films was investigated as elucidated below. Fig. 2. CAAlg composite films show discrete domains. ( A – F ) Scanning electron micrographs of cross-sections of freeze-dried 5% (wt/vol) CA, Alg, and 500 mM CAAlg films. ( G – I ) Atomic force height images of air-dried 5% (wt/vol) CA, Alg, and 500 mM CAAlg films. ( J ) Stress-strain curve of CA, CAAlg* and CAAlg-500 films. ( K ) Tabulation of key properties of CA, CAAlg* and CAAlg-500 films. (elastic modulus (E), yield stress (σ y ), elongation at break (ε), toughness (UT)). Asterisk indicates calcium free film. [Ca 2+ ] Modulates Size of Nanostructures and Mechanical Properties of CAAlg Films. CAAlg films were cross-linked using a range of [Ca 2+ ] spanning over two decades from 300 mM to 7.5 mM. While lowering the [Ca 2+ ] by 1.5-fold from 500 mM to 300 mM yielded a clear but modest reduction in the average size of the nanostructures from 2 µm to 1.7 µm, further decrease to 150, 75, and 7.5 mM resulted in a logistic regression in average domain size up to 4.3 nm ( Fig. 3 A – E and K ). SEM analysis revealed that the decrease in domain size occurred uniformly across the entire film ( Fig. 3 F – J ). Furthermore, SEM analysis of cross-section revealed no evidence of nonuniformity or gradients in nanoscale domains at all [Ca 2+ ] ( SI Appendix , Fig. S6 ), which is consistent with a rapid diffusion of calcium ions ( 43 ). Importantly, CAAlg films exposed to lower [Ca 2+ ] showed progressively superior properties in comparison to films cross-linked at 500 mM. A linear relationship between E values and decreasing [Ca 2+ ] was observed with mechanical properties peaking at and beyond 75 mM [Ca 2+ ] ( Fig. 4 A ). Cross-linking at 300 mM resulted in a nearly fivefold increase in average E values (0.52 to 2.5 GPa) with further gains in stiffness going from a [Ca 2+ ] of 150 mM to 75 mM with highest average E values of 6.3 GPa attainable at [Ca 2+ ] of 7.5 mM ( Fig. 4 B ). This represented a nearly 11-fold increase in stiffness in comparison to the 500 mM case, and additionally up to 10-fold higher values in UTS (10 to 100 MPa) ( Fig. 4 A and C ). Furthermore, all CAAlg films cross-linked at lower [Ca 2+ ] exhibited distinct elastic and plastic regimes (dashed lines in Fig. 4 A ) with such distinct transition from elastic to plastic behavior being absent in the films produced in the 500 mM condition. The direct consequence of the evolution of a plastic regime in CAAlg films was a threefold increase in toughness (U T , 0.38 to 1.26 MJ/m 3 ) ( Fig. 4 D ). One could postulate reducing the size of nanoscale domains limits stress propagation while preserving stress dissipation, thus giving rise to films that are stiff plastics. These results in sum provide compelling evidence that the divalent calcium is responsible for driving the formation of the nanoscale domains in CAAlg composite films, which is central to structure–property relationships in CAAlg films. Fig. 3. Evolution of nanoscale domains can be controlled by calcium content. ( A – E ) AFM height images of 5% (wt/vol) dried films processed using varying concentrations of calcium chloride. Surface topography, quantitatively described here as root mean square (Rq) roughness, provides evidence for the evolving nanoscale domains. ( F – J ) SEM micrographs of cross-section of 5% (wt/vol) freeze-dried films showing the presence of nano-domains in the bulk of the film. ( K ) Control over nano-domain size by varying calcium concentration. Fig. 4. CAAlg composites films possess mechanical properties comparable to petroleum-based plastics. ( A ) Stress–strain behavior in 5% wt/vol CAAlg films as a function of [Ca 2+ ] during the ionic crosslinking step. ( B – D ) Young’s modulus ( E ), ultimate tensile strength (UTS), and toughness (U T ) of CAAlg films as function of calcium content. ( E ) Fracture strain (ε at break) reveals positive correlation with [Ca 2+ ] concentration during cross-linking. ( F ) Average domain size in CAAlg composites can be associated with yielding behavior in CAAlg films. ( G ) Ashby plot depicting the property profile of CAAlg films in comparison to some natural materials, DN hydrogels ( 50 ), and synthetic plastics used in consumer products [EVA: ethylene vinyl acetate, LDPE: low-density polyethylene, HDPE: high density polyethylene, PBT: polybutylene terephthalate, PET: polyethylene terephthalate, PHB: poly(hydroxybutyrate), PLA: polylactic acid, PMMA: polymethyl methacrylate)]. Data for the synthetic plastics, composites, and natural materials were obtained from https://www.matweb.com/ . A highly consequential finding was that CAAlg films cross-linked at [Ca 2+ ] of 75 mM and below possessed properties that were superior to that of semicrystalline biodegradable polymers, PLA and low-density polyethylene (LDPE). More specifically, the E and UTS of CAAlg exceeded that of PLA [E: 2.3 to 3 GPa; UTS: at 36 MPa ( 44 , 45 )] and LDPE (UTS: 6 to 28 MPa; E: 0.14 to 0.48 GPa) ( 46 , 47 ). These findings are counterintuitive as the alginate phase, being physiochemically distinct from CA, should demix from the CA phase during the film formation and promote brittle structures. The enhancement of mechanical properties in CAAlg films can be rationalized as follows. The correlation between the calcium crosslinked Alg-rich domains and UTS ( Fig. 4 C ) suggests that these micrometer–nanoscale domains play an important role in the improvement of mechanical properties. This reasoning is further substantiated by AFM images of films after tensile deformation which showed elongation of domains and also an overall increase in domain size in CAAlg-500, presumably due to coalescence and growth of domains during deformation, a phenomenon routinely also observed in metal alloys during superplastic deformation ( 48 ) ( SI Appendix , Fig. S7 ). Furthermore, the decrease in fracture strain in CAAlg films with decreasing [Ca 2+ ] ( Fig. 4 E ) can be attributed to molecular failure within the ionic cross-linked domains, and furthermore, the almost twofold increase in fracture strain going to 75 mM to 500 mM [Ca 2+ ] is consistent with the expected increase in cross-link points with increasing [Ca 2+ ] ( Fig. 4 E ). In sum, the cross-linked calcium alginate–rich phase as hypothesized, therefore, functions as a stress dissipator as it also introduces plastic behavior in these composite films in comparison to pure CA and CAAlg* films ( Fig. 2 J ). At high [Ca 2+ ] of 300 and 500 mM, plastic behavior becomes dominant with films exhibiting elongation of 6 to 7%, although accompanied by lowering of the UTS, presumably due to perturbation of elastic net points of the CA as the ionic cross-linked domains start to dominate the film structure. Interestingly, in films cross-linked with [Ca 2+ ] of 300 mM it was possible to combine toughness and plastic behavior in the same system, which is reminiscent of stress–strain behavior observed in semicrystalline synthetic polymers such as LDPE, for example, and paves the way for replacing synthetic polymer-based films with CAAlg films in selected applications. This is also a consequential finding as it demonstrates that the d-IPN paradigm presented herein is capable of modulating material properties through simple variation of a single parameter, namely [Ca 2+ ]. The evidence for a clear role for alginate in the evolution of the mechanical properties can be inferred by the extreme case, i.e., the films crosslinked at [Ca 2+ ] of 500 mM. Under these conditions, a dramatic increase in domain size, exceeding 1 μm, is observed and this is accompanied by an order-of-magnitude loss in tensile strength, toughness, and σ y ( Fig. 4 F ). This leads us to conclude that the domains in CAAlg films essentially function as grain boundaries in metals as they can mitigate fracture by absorbing stress through breakage and reformation of the ionic cross-links without loss to domain integrity. To place the mechanical properties of CAAlg films in perspective, an Ashby plot of UTS versus E was generated and it is evident that the property profile of CAAlg films is comparable to many synthetic petroleum-based polymers, comparable to or exceeds the properties of degradable polymers, and can approach the lower spectrum of properties observed in glass fiber–filled composites. Interestingly, CAAlg films show superior properties when compared to many of the common soft woods ( Fig. 4 G ). This bodes well for the exploration of CAAlg films in fabrication of structured and engineered materials. CAAlg Films Can Be Processed into Laminated Structures through Wet-Bonding. Biopolymer-derived composites are typically plagued by scale-up and processing issues. Toward realizing sheets and panels composed of CAAlg composite, we conceived a process for laminating CAAlg films at ambient conditions that involves activation of the film surface using calcium to promote polymer chain entanglement in a pressure-induced bonding scenario ( Fig. 5 A ). As proof of concept a laminated object was prepared from three films using this semiwet laminating process ( Fig. 5 B ). First, the film surfaces were activated using a 150 mM CaCl 2 solution then bonded under compression together for 48 h. The formation of the bonded interface and the dynamics between the laminated films depends on various parameters, such as the processing condition, polymer molecular weight, and chain mobility. The key attributes of our composite laminated films are, first, the entire process is carried out at room temperature, and second it is accomplished using water as solvent. Based on these features and by taking advantage of the diffusion capacity of the CA and Alg chains at the dynamic interfacial layer, a dynamic network reorganization of the CAAlg network via molecular binding is achieved. Since both CA and Alg are water-soluble and no chemical cross-links exist between them, they should be able to move from one surface and penetrate the other with minimal restrictions. Also, the use of calcium ions for surface activation, due to its ionic interaction potential, should expedite the diffusion bonding of the polymer chains at the joining surfaces. These two processes may be expected to occur simultaneously, but at a different rate, resulting in bonding of the composite films. Fig. 5. CAAlg films can be processed into laminated structures through wet ionic bonding. ( A ) Preparation of laminated structures of CAAlg composite through surface-activated molecular bonding via calcium cross-linking of Alg chains. ( B ) Photograph of the laminated film. ( C ) Schematic representation of the lap shear test setup for determining adhesion properties between bonded CAAlg films interface. ( D ) Photograph of a two-ply laminated CAAlg film sandwiched between glass slides supporting a weight without undergoing catastrophic failure at bonded interface. ( E ) Representative lap shear test curve in tensile mode revealing that the newly formed interface between CAAlg films is physicochemically identical to the bulk of the CAAlg composite. To get a deeper quantitative understanding of the interfacial cohesion property of the CAAlg laminated composites, a single lap shear test was conducted on test specimen comprising of two CAAlg composite films bonded over a well-defined area. Then, two glass slides containing the CAAlg film were bonded at the CAAlg surface using the semiwet process by spraying an aqueous solution of 150 mM CaCl 2 to yield the test object that had two glass slides bonded via the CAAlg interface as depicted in Fig. 5 C . This test configuration was adopted to avoid extraneous damage to the films due to excessive pressure at the grip during testing. As is evident from Fig. 5 D , the bonding between the CAAlg film interface is adequate to support loading perpendicular to the bonding interface. Fig. 5 E shows a typical lap shear curve of the bonded CAAlg interface. In all the tested samples (five samples), upon subjecting to loading the failure always occurred in the region between the film and the glass substrate, indicating that the mechanical interlocking, ionic interaction, and other intramolecular interactions contribute to the cohesion forces between the two films, i.e., the bonding energy between the CAAlg surfaces exceeded the adhesion forces between the tape and the glass substrate. To gain quantitative insights, the shear strength was calculated from the force-displacement curves of samples of the 100-mm 2 overlap area using Eq. 1 ( Table 1 ): [1] τ b = F L × W , where F is the ultimate force and L and W are, respectively, the length and width of joint. Table 1. Lap shear test property of the CAAlg composite joints Sample L, mm W, mm Force, N Displacement, mm Lap shear strength, kPa CAAlg-150 10 10 13.2 ± 0.81 1.2 ± 0.05 132.9 ± 8.13 The CAAlg composite possessed an average lap shear strength of around 132.9 kPa and an average value for the failure load of the interface of 13.2 ± 0.81 N, and this value is similar to the ultimate load values obtained from the uniaxial tensile testing of CAAlg-150 composite films (10.09 ± 1.47 N). This result reveals that the newly formed interface between CAAlg films is physicochemically consistent with the bulk of the CAAlg composite. This bodes well for the further development of CAAlg polysaccharide composites in the realm of environmentally friendly structured laminates in combination with wood-based and clay-based materials. Processing of CAAlg Using Printing into Films and Adhesive Interfaces for Bonding Natural Materials. To illustrate further the potential of CAAlg composite films in engineering of materials, we used extrusion-based printing as a processing strategy as it has utility in many mundane and emerging applications. Using a previously established printing regimen for printing CA bioinks ( 49 ), we successfully printed a 1.5-mm-thick rectangular sheet ( Fig. 6 A ), and this sheet upon cross-linking with CaCl 2 solution yielded physically stable CAAlg-150 films that showed adequate mechanical integrity to be handled by a spatula ( Fig. 6 B ). In contrast, films that were not cross-linked with calcium could not be manipulated and disintegrated when picked up ( Fig. 6 C ), providing further evidence for the importance of the ionically cross-linked network in imparting mechanical properties to the CAAlg films. Building on this success, structures ranging from a square rectilinear grid ( Fig. 6 D ) to a three-ply criss-cross pattern of rectangularly shaped CAAlg-150 films bonded using wet-bonding immediately following printing ( Fig. 6 E ) were also realized. The three-ply film interface showed remarkable integrity following drying and did not delaminate upon rehydration for 72 h, demonstrating the permanency and robustness of the bonded layers ( Fig. 6 F ). To explore the wet-bonding paradigm demonstrated in Fig. 5 in the fabrication of structural composites derived from natural materials, the fabrication of two-ply wood laminate was explored as an example. Two wood panels were patterned respectively with transverse and vertically space array of lines using extrusion printing and then cross-linked with calcium to yield wood-CAAlg-150 composites as illustrated in the workflow in Fig. 6 G . The dried CAAlg-150 modified surface of the dried panels was then activated with a spray of calcium solution and then assembled under pressure to yield a two-ply wood laminate that was firmly bonded via the rectilinear interface of CAAlg-150 composite ( Fig. 6 G , Right ) and could be handled without undergoing delamination ( SI Appendix , Fig. S8 ). This demonstrates the ability to process composites of natural materials using marine polysaccharides and water containing divalent cations as the processing agent. Fig. 6. Processing of CAAlg into films and interfaces in the fabrication of wood laminate. ( A ) A film of CAAlg printed by using extrusion printing and ( B ) cross-linking of the film with Ca 2+ to yield mechanically stable films. ( C ) In contrast, film of CAAlg without Ca 2+ cross-linking lacked physical integrity and could not be handled, providing clear evidence for the importance of the ionic cross-linking in imparting mechanical properties to the film. ( D ) Printing of a rectilinear grid pattern. ( E ) Dried film of a three-layered criss-cross construct fabricated by wet-bonding of calcium-crosslinked CAAlg films immediately after printing and ( F ) rehydrated film showing the stability of the bonded layers. The film remained bonded in water even after 72 h. ( G , Left ) Fabrication of wood-CAAlg composite: The process workflow involves printing of the pattern of lines on the wood surface followed by calcium cross linking of the pattern and room-temperature drying of the wood CAAlg composite. The photographs show wood panels following printing and cross-linking. ( G , Right ) Fabrication of two-ply wood laminate: Schematic of the two steps—activation and bonding under pressure. Photographs show a two-play wood laminate bonded via a rectilinear grid interface of CAAlg-150 composite. The wood panels were affixed to a glass slide using two-sided tape for handling purposes. In conclusion, here we present a strategy to realize marine polysaccharide–based composites that exhibit properties that exceed that of PLA, a semicrystalline, degradable polymer with significant use in circular economy. This was accomplished through the realization of a d-IPN comprising physical and ionic cross-links, thus avoiding traditional chemical cross-linking strategies that have an adverse impact on the environment. The possibility to process CAAlg composite films by casting or printing from aqueous medium and further postprocess these films into laminates using a water-based semiwet process opens up numerous opportunities for these materials in applications such as a bonding layer in the fabrication of panels and flooring based on other natural products such as wood as already demonstrated, gypsum and clay-based materials, as moisture or heat sink, or as a matrix to incorporate microbicidal and antifungal agents to prevent biofouling in building materials."
} | 6,481 |
34732134 | PMC8565057 | pmc | 9,529 | {
"abstract": "Background The walnut shell, which is composed of a large number of sclereids originating from the lignified parenchyma of the endocarp, plays an important role in fruit development and during harvesting and storage. The physical and chemical properties of walnut shells are closely related to the lignin content. Laccase is the key enzyme responsible for lignin biosynthesis by the polymerization of monolignols and plays crucial roles in secondary cell wall formation in plants. In this study, we screened and identified laccase family genes from the walnut genome and investigated the expression of laccase during endocarp lignification in walnut. Results A total of 37 laccase genes were screened from the walnut genome and distributed on nine chromosomes and classified into 6 subfamilies, among which subfamily IV showed distinct expansion. We observed that endocarp lignification started 44 days after flowering (DAF), and at later periods, the lignin content increased rapidly, with growth peaks at 44–50 DAF and 100–115 DAF. The lignification of the endocarp proceeded from the outside to the inside, as demonstrated by section staining in combination with endocarp staining. Furthermore, the changes in the expression of laccase family genes in the endocarp at different developmental stages were studied, and JrLACs showed different expression trends. The expression of nine genes showed significant increase after 44 DAF, and among these, JrLAC12–1 , JrLAC12–2 and JrLAC16 showed a significant change in expression at the lignification stage. A study of the expression of JrLACs in different tissues and at various endocarp developmental stages revealed, that most JrLACs were expressed at low levels in mature tissues and at high levels in young tissues, in particular, JrLAC12–1 showed high expression in the young stems. A significant positive correlation was found between the expression of JrLAC12–1 and the variation in the lignin content in the endocarp. Conclusion Laccase genes play an important role in the lignification of the walnut endocarp, and JrLACs play different roles during fruit development. This study shows that JrLAC12–1 may play a key role in the lignification of endocarp. Supplementary Information The online version contains supplementary material available at 10.1186/s12870-021-03280-3.",
"conclusion": "Conclusion Thirty-seven LAC genes were identified in the walnut genome, are distributed on nine chromosomes and can be divided into six subfamilies. During walnut endocarp development, different JrLACs show significantly different expression trends, and JrLAC12–1 , JrLAC12–2 and JrLAC16 may be involved in endocarp lignification. Changes in walnut JrLAC12–1 gene expression were found to be positively correlated with Δ-lignin in the shell, which suggests that JrLAC12–1 plays a key role during lignin accumulation in endocarp lignification.",
"discussion": "Discussion According to their oxidation characteristics, LACs are divided into two groups: low-redox-potential and high-redox-potential enzymes [ 43 ]; therefore, LACs can catalyze both anabolic and catabolic reactions. In fungi, LACs are involved in catabolism and can degrade lignin and humus [ 44 ], whereas in higher plants or insects, LAC catalyzes anabolic reactions involved in various morphogenesis processes, such as lignin synthesis [ 45 ], cuticle formation [ 46 ], and flavonoid synthesis [ 47 ]. Therefore, this finding indicates that the LAC gene family may differ significantly among species of different taxa. In fungi, the LAC gene family is divided into five clusters, and LACs within different clusters can be induced by different substrates [ 48 ]. In higher plants, the LAC genes within different species vary, and the LAC gene family of each plant is usually divided into six subfamilies based on protein sequence characteristics, such as those of soybean [ 36 ], S. viridis [ 37 ], and sweet cherry [ 40 ]. However, in C. sinensis and Brassica napus , the LAC gene family is divided into seven and five subfamilies, respectively [ 35 , 49 ]. Differences in the degree of expansion of LAC genes have been found within different species, such as in subfamilies III and II in B. napus [ 49 ], subfamily V in S. viridis [ 37 ], soybean [ 36 ] and pear [ 31 ], and subfamily I in C. sinensis [ 35 ]. In sweet cherry [ 40 ], which is also a type of drupe, the LAC gene family is significantly expanded in subfamilies II and IV, similar to the result obtained for walnut in the present study. Previous studies have also shown that some of the walnut LAC genes in subfamily II or IV are distributed as chromosomal gene clusters, and 11 pairs of genes in subfamilies II, IV and V show tandem duplication events. The tandem duplication of these LAC genes in the walnut genome may be the main reason for the expansion of subfamilies II and IV. In addition, 15 pairs of genes with collinearity belonged to subfamilies I, II, III and IV, and it is speculated that these collinear pairs of genes might have similar functions. Xiao et al . found that most of the genes that are highly expressed in lignified tissues, such as roots and stems of B. napus, belong to LAC subfamilies I, II and III [ 49 ]. In the C4 model grass S. viridis , SvLAC52, SvLAC15 and SvLAC9 ( AtLAC2 or LAC17 homologs) in subfamily I and SvLAC50 (homolog of AtLAC16 ) in subfamily II are also highly expressed in the transitional and maturation zones, where lignin biosynthesis-related genes are active [ 37 ]. In soybean, the genes GMLAC2 and GmLAC9 ( AtLAC 4 homologs) in subfamily II and GmLAC8 ( AtLAC 12 homolog) in subfamily III are highly expressed in stems, whereas the 11 genes showing constitutive expression in multiple tissues all belong to subfamily V [ 36 ]. In pear, PbLAC1 ( AtLAC2 homolog), LAC38 and LAC29 ( AtLAC17 homologs) in subfamily I and PbLAC5 , PbLAC36 , and PbLAC6 ( AtLAC4 homologs) in subfamily II are highly expressed at the stage showing peak lignin content in the pulp, whereas PbLAC10 , PbLAC11 and PbLAC39 ( AtLAC15 homologs) in subfamily IV and PbLAC20 ( AtLAC14 homolog) in subfamily IV exhibit the exact opposite results. The LAC genes associated with lignin synthesis in previous studies belong mostly to subfamilies I, II and IV. AtLAC4 in subfamily II in Arabidopsis may be involved in the synthesis of lignin and secondary walls. AtLAC4 is strongly expressed in vascular tissues and specifically in leaf hydathodes, and AtLAC4 overexpressing plants show a dwarf phenotype and have shorter leaf petioles, both of which are effects caused by increase in the lignin content and secondary wall thickness [ 50 ]. The expression of JrLAC4–1 , JrLAC4–2 , JrLAC4–3 , JrLAC4–4 and JrLAC16 in subfamily II in walnut, particularly the latter, increased significantly from 44 to 71 DAF. It can be speculated that LAC genes in subfamily II also assume important functions during endocarp lignification in walnut. In addition, the expression patterns of the six subfamilies differed between the unlignified and lignified stages of the endocarp, as demonstrated by an increase in the total expression of subfamilies I, II, III and a decrease in the total expression in subfamilies IV and VI. Based on previous studies and the results of this study, six subfamilies have different functions in endocarp lignification, and the division of labor between these subfamilies is different in walnut. The final step in lignin biosynthesis is the polymerization of lignin monomers by dehydrogenation in response to enzymes such as POD, LAC and polyphenol oxidase (PPO) [ 51 ]. Previous studies have concluded that PODs use hydrogen peroxide (H 2 O 2 ) to oxidize their substrates [ 52 ]. In contrast to PODs, LACs consume O 2 instead of H 2 O 2 to oxidize monolignols. LACs of a variety of species are expressed in lignifying cells [ 53 ]. The lignification of cells from different parts of the plant may proceed in different manners, depending on whether the lignin is local or widespread. Casparian strip formation requires PODs but not LACs [ 54 ]. The walnut shell consists of sclereids formed by the thickening and lignification of the secondary walls of the parenchyma in the endocarp [ 13 ]. Our previous study found that shell formation is accompanied by increases in the lignin, cellulose and phenolic content, no mark change in PPO activity and POD activity, and that POD activity is negatively correlated with lignin accumulation [ 12 ]. In this study, the expression pattern of LAC genes during lignification was further analyzed. Subfamily III genes, such as JrLAC12–1 and JrLAC12–2 were highly expressed during the lignification stage; in particular, the expression of JrLAC12–1 showed a significant positive correlation with the change in the lignin content. Consistent with the results obtained for walnut shell sclereids, sclereids in pear pulp also show high LAC expression during the developmentally critical stage of formation [ 31 ], and the silencing of three LAC genes reduces the lignin content and sclereid number in pear fruit [ 55 ]. Therefore, LACs may play a key role in the lignification of walnut shells. Previous studies found that in poplar, PtoLAC14 is mainly expressed in lignified tissues in the vascular bundles, such as the stem xylem, and that the overexpression of PtoLAC14 resulted in smaller cells with secondary wall thickening and an increased lignin content [ 56 ]. In Arabidopsis , AtLAC4 in interfascicular fibers and seed coat columella, AtLAC15 in seed coat cell walls, AtLAC14 in vascular tissues, such as roots, stems, leaves, petals and leaves but not in siliques (the fruit of Arabidopsis ), are uniquely expressed [ 34 ]. In contrast, AtLAC12 is expressed in all tissues of Arabidopsis , particularly in the replum and abscission zone of the siliques. In this study, high expression of JrLAC14–1 , JrLAC14–3 , JrLAC14–4 , JrLAC14–6 and JrLAC14–7 were observed in young fruits, which was presumed to be mainly related to vascular tissue formation at the early stages of young fruit development period. JrLAC12–1 , JrLAC12–2 and JrLAC6 are highly expressed in young stems and buds, and the changes in the expression of JrLAC12–1 during shell development were consistent with the changes in lignin deposition, which suggested that JrLAC12–1 is involved in tissue formation and is a key factor in the lignification of sclereids in the shell. Therefore, the regulatory mechanism of JrLAC12–1 in walnut pericarp development needs to be further investigated."
} | 2,652 |
40000493 | PMC11861133 | pmc | 9,530 | {
"abstract": "Host–parasitoid interactions typically result in either a dead parasitoid or a dead host. Understanding the effects of parasitoid success on a host can be estimated primarily as how much an early death curtails host reproduction. When parasitoids attack the nonreproductive caste of social insects, however, the effects are not the reduced reproduction of the host but rather the sum reduction in host contributions to its colony. In addition to the loss of host workdays due to premature death, there is potential for additional cost through reduction in foraging efficiency as the infection develops. To better understand these pre-lethal effects, we allowed conopid parasitoid flies (Conopidae) to infect workers from a colony of the bumblebee Bombus impatiens (Apidae) in the lab and then moved the colony to an outdoor location. Bumblebee foragers were monitored using RFID technology and an automated analytical balance positioned between the colony and the outside environment. We found that infected bumblebees foraged similarly to uninfected workers halfway through their fatal infections. Starting at day 6–7, however, infected bees took fewer trips per day, which resulted in a significant reduction in resources returned to the colony over the last 3 days of the experiment. Both infected and uninfected bees were likely to remain out of the colony at night after their fourth day foraging, but infected bees started staying out sooner. These pre-lethal effects of a developing parasitoid add to the negative effects of a shortened lifespan on host contribution to its colony.",
"introduction": "Introduction Parasites vary in their effects on hosts, from mild illness to sterility to death (Abbate et al. 2015 ; Cory 2017 ). Since the detrimental effects of parasites on hosts can range widely, selection on hosts to resist parasites should also range widely, such that hosts do not invest in costly defenses that outstrip the damage they are likely to receive. These trade-offs in host–parasite interactions have led to a rich literature on parasite virulence (Day et al. 2007 ; Leggett et al. 2013 ) and the concomitant responses of their hosts (Hosken 2001 ; Schwenke et al. 2016 ), showing complex and often geographically varied patterns of coevolution (Anderson and May 1982 ; Thompson 1994 ; Gandon and Michalakis 2002 ; Lajeunesse and Forbes 2002 ; Laine 2006 ). Parasitoids are a particular type of parasitic organism whose success typically ends with host death (Jervis and Ferns 2011 ). Their offspring gain entry into the host by various means and feed from host tissues until the host dies. With such a dire tradeoff between success of the parasitoid and death of the host, the evolutionary possibilities should be substantially truncated, hinging primarily on two factors: successful acquisition of the host through behavioral strategies, and successful development of the parasitoid in the presence of the host’s physiological or behavioral immune defenses (De Roode and Lefèvre 2012 ). Despite these binary outcomes, selection on the evolution of host defense has various potential nuances (Kraaijeveld and Godfray 1997 ; Fellowes and Godfray 2000 ; Schmid-Hempel 2022 ). If defense is costly and parasitoids are rare, low investment in defense should be selected in most circumstances (Straub et al. 2015 ). In addition, even if parasitoids are common, death by parasitoid may not be particularly costly to the host if other mortality risks are similar, such that lifespan is not greatly reduced, or if a reduction in lifespan does not substantially reduce reproduction. This could happen if a host was post-reproductive or, in the case of social insects, if the host is a nonreproductive member of a social group (Straub et al. 2015 ). In insects such as ants, termites, and the social bee and wasp species, reproductive individuals spend most or all of their lives within nests, surrounded by nonreproductives that guard the nest and forage for food and nest materials (Bourke 2007 ). Since the fitness of nonreproductives arises through the success of their colony (Gardner and West 2014 ), their behaviors should favor colony survival and growth more than their own survival. In fact, it is common for the nonreproductive castes of social insects to self-sacrifice in defense of the colony from predators or disease (Shorter and Rueppell 2012 ; Cremer et al. 2018 ). An analogous form of sacrifice would be reduced self-preservation behaviors or reduced immune investment if the associated costs to colony functions (e.g., reduced foraging efficiency) were greater than the expected gains through greater longevity. Foraging is an activity with high potential for exposure to many sources of mortality, including parasitoids, and thus foragers typically live much shorter lives than the primary egg laying caste (Heinze and Schrempf 2008 ). If parasitoids can kill hosts without greatly reducing their expected lifespan or their foraging efficiency, then parasitoids may not greatly reduce their hosts’ contributions to their colony. In this case, hosts would not be under strong selection pressure to alter their behavior or develop immune responses to defend themselves against this single source of risk, especially if there are costs to defense. Estimating the effects of parasitoids on host contributions to colonies, however, is challenging in natural environments. One of the few well-studied systems involving social insects and their susceptibility to parasitoids is bumblebees (Apidae: Bombus spp.) and conopid flies (Conopidae). Bumblebees are social insects in which queens remain in their nest after production of their first brood of workers. Workers tend the brood, defend the nest and forage for resources in the environment. Conopids are a family of obligate parasitoids that utilize other insects for hosts, especially wasps and bees (Smith and Peterson 1987 ). They are especially abundant in bumblebees, with several conopid genera utilizing different species of bumblebees on several continents and typically killing their hosts 10–12 days after infection (Schmid-Hempel and Schmid-Hempel 1996 ; Abdalla et al. 2014 ; Malfi and Roulston 2014 ). Bumblebee infection rates have frequently been found to be over 30% of foragers in the field, with rates as high as 80% recorded (Gillespie 2010 ; Davis et al. 2015 ). The effects of conopids on bumblebee colony reproduction, however, have never been directly measured, though estimates have been made based on simulating their effects through worker removals from active colonies (Müller and Schmid-Hempel 1992 ) and estimating their effects using a field parameterized model of bumblebee colony reproduction (Malfi et al. 2018 ). Understanding the costs of parasitoids on bumblebee colony reproduction requires not only knowing the cost of an early death but also any pre-lethal effects that the developing infection may impose. Infected bees appear to forage up until the day of their death, even though most of their abdominal cavity is taken up by the developing fly. Thus, any effects of the fly that reduce the host’s foraging efficiency should also be considered as impacts on potential colony reproduction. Currently, the only pre-lethal effects known are a tendency for infected bumblebees to (1) remain out of the colony at night, potentially as a behavioral immune response (Müller and Schmid-Hempel 1993 ); (2) bring back pollen to the colony less frequently (Schmid-Hempel and Schmid-Hempel 1991 ), and (3) bring back different kinds of pollen to the colony (Schmid-Hempel and Stauffer 1998 ). Here, we describe an experiment that examines how resource collection efficiency of infected bumblebees changes over the course of a conopid infection. We do this by allowing bumblebees to forage in an open environment following controlled lab infections by conopids and monitoring the resources returned to the colony through the use of RFID technology and the continual recording of individual bee weights as they go out to forage and return with resources.",
"discussion": "Discussion Infected bees showed diminished foraging performance by the third day of the experiment. The primary effect was taking fewer trips per day, but there were also non-significant trends toward carrying less food per trip, and taking more time per trip. This pattern continued to the end of the experiment at foraging day 5, which represented either the 8th or 9th day since they were infected in the lab. These represented advanced infections given that the bees died of their infections 2–3 days after being returned to the lab with their entire abdominal cavity occupied by the parasite. Previous work (Malfi and Roulston 2014 ) found that foraging bumblebees are sometimes caught with late stage conopid infections that were within hours of killing the bee, and thus the bees often work for the colony until close to the end of their life. But here we show their escalating deduction in foraging efficiency as the parasite develops, an effect that probably extends the additional 2–3 days to bee death. Prior work has shown that bumblebees parasitized with a conopid choose different host plants to visit (Schmid-Hempel and Schmid-Hempel 1990 ; Schmid-Hempel and Stauffer 1998 ) and are less likely to carry pollen than unparasitized bumblebees (Schmid-Hempel and Schmid-Hempel 1991 ). Thus, these pre-lethal effects on bumblebee foraging magnify any colony-level effects attributable to the shorter lifespans of parasitized bumblebee workers (Müller and Schmid-Hempel 1992 ; Gillespie 2010 ; Malfi et al. 2018 ). Despite the significant change in parasitized bee behavior by foraging day 3 (day 6–7 following infection), it is notable that foraging efficiency was not reduced earlier. The change in foraging efficiency is likely attributable to an increasing drain on bee physiological resources as the parasite grows. For the European conopid species Physocephala rufipes , the egg stage lasts about 2 days (Schmid-Hempel and Schmid-Hempel 1996 ), a time in which the main impact on the host would likely be any trauma directly related to oviposition. During the first two larval stages, occurring over the next ~ 7 days, the larva remains relatively small and feeds primarily on hemolymph (Abdalla et al. 2014 ). During the 3rd larval instar, however, the fly larva feeds on internal organ tissue, eventually killing the bee prior to pupating (Schmid-Hempel and Schmid-Hempel 1996 ). It is not surprising that the bee becomes a poorer forager at a time in which its internal organs are being consumed by a parasitoid. It is, perhaps, more surprising that it forages as reliably as it does just prior to death. Our data confirm the tendency of bees infected by conopids to stay out of the colony at night as described in Europe (Müller and Schmid-Hempel 1993 ). In their experiments, Müller & Schmid-Hempel ( 1993 ) dissected foragers found in the colony at night and those returning to the colony after a night out and found that the returning ones were much more likely to be parasitized. In a lab experiment, they also showed that parasitized workers lived longer and suppressed parasitoid growth more if subjected to a constant cool lab temperature (19 °C), reflecting outdoor night temperature, than in constant warm temperatures (28 °C), reflecting the temperature of a bumblebee nest. This supports their hypothesis that overnighting behavior is an adaptive mechanism to prolong worker longevity by suppressing a parasitoid infection. In their dataset, bee age was a minor contributor to overnighting behavior. In our dataset, over half of infected bees stayed out by day 2 and over half of uninfected bees stayed out by day 4. This shows that bees initiate overnighting behavior quickly, and that there is a strong effect of experience on overnighting behavior independent of conopid infection. In our dataset, we did not dissect bees to look for immature parasites and cannot say definitively that bees staying out that did not die of conopid infections did not actually have small, failed infections. Prior work with Bombus impatiens , however, that did include dissections, found that conopid infections typically succeed in the lab with this species (Davis et al. 2015 ) and that uninfected workers as scored by dissection often spent nights in the field (unpublished data from Malfi et al. 2018 ). Thus, there is likely to be at least one as yet undiscovered strong driver of overnighting behavior in addition to conopids, such as other parasites, experience, age, or colony conditions. While parasitizing bees in the lab proved effective, and was helpful for examining insect behavior relative to a known time of infection, it was also labor intensive for generating replication. The main challenge was collecting sufficient numbers of conopids in the field in a short period of time and having them attack bees in the lab. Despite conopid infections of bumblebees being common in the study region at the time of the study, we seldom readily find many adult female conopids in the field. Lab rearing of conopids could potentially make additional studies easier to carry out. One setback we did not expect was the relatively low return of lab infected foragers at the end of the study. Only 40% of our lab-exposed bees were captured at the end of the experiment, with the missing presumably dying in the field during foraging. In contrast, 74% of non-lab-exposed bees survived over those 5 days. Given that the conopid does not pupate during the time that was available, such loss could be due to trauma of the original attack or to behavioral changes in the field caused by the growing conopid. Neither of these causes is known for conopid effects on bees and could represent additional stresses on bumblebee colony productivity. If mortality due to the physical damage from a conopid attack (or from a subsequent microbial infection) is frequent in the wild, then it would likely represent an even larger effect on bumblebee colonies than the effects recorded here. We hesitate to estimate that effect from our data because we often had multiple attacks on the same bee in short succession, something that may be less likely to occur in the wild. In our trials, we noted that the bee that was attacked the most (4 times) died in the lab shortly after. Bumblebee workers are sometimes found with multiple conopid larvae in the field (Schmid-Hempel and Schmid-Hempel 1996 ), so we do know that multiple attacks occur, but we do not know how they impact host health independent of the larval parasite. It is likely that this kind of estimate can only be made with additional lab studies. Overall, we show that measurable reductions on bumblebee productivity are evident about halfway through the period of conopid infection, which may magnify their negative impacts on colony productivity. While infected bumblebees did remain outside the colony shortly after infection, as they do in Europe (Müller and Schmid-Hempel 1993 ), it was not evident that doing so reduced the trajectory of the infection. Infected bees still died in the 10–12-day period estimated for other species in this system (Schmid-Hempel and Schmid-Hempel 1996 ). Prior work has shown that bumblebee species differ in their physiological defenses against conopids (Davis et al. 2015 ). The use of behavioral defenses, such as the use of nighttime cold to suppress an infection, could also vary between species of host and species of parasitoid. The potential use of lab-based infections in this study system, as demonstrated here for the first time, allows future manipulative work to examine host–parasitoid interactions in great detail."
} | 3,932 |
35966664 | PMC9366602 | pmc | 9,534 | {
"abstract": "Leaf traits of plants worldwide are classified according to the Leaf Economics Spectrum (LES), which links leaf functional traits to evolutionary life history strategies. As a continuum ranging from thicker, tough leaves that are low in nitrogen (N) to thinner, softer, leaves that are high in N, the LES brings together physical, chemical, and ecological traits. Fungal endophytes are common foliar symbionts that occur in healthy, living leaves, especially in tropical forests. Their community composition often differs among co-occurring host species in ways that cannot be explained by environmental conditions or host phylogenetic relationships. Here, we tested the over-arching hypothesis that LES traits act as habitat filters that shape communities of endophytes both in terms of composition, and in terms of selecting for endophytes with particular suites of functional traits. We used culture-based and culture-free surveys to characterize foliar endophytes in mature leaves of 30 phylogenetically diverse plant species with divergent LES traits in lowland Panama, and then measured functional traits of dominant endophyte taxa in vitro . Endophytes were less abundant and less diverse in thick, tough, leaves compared to thin, softer, leaves in the same forest, even in closely related plants. Endophyte communities differed according to leaf traits, including leaf punch strength and carbon and nitrogen content. The most common endophyte taxa in leaves at different ends of the LES differ in their cellulase, protease, chitinase, and antipathogen activity. Our results extend the LES framework for the first time to diverse and ecologically important endophytes, opening new hypotheses regarding the degree to which foliar symbionts respond to, and extend, the functional traits of leaves they inhabit.",
"conclusion": "Conclusion By identifying key traits of the Leaf Economics Spectrum associated with foliar fungal communities, we begin to uncover the mechanisms affecting endophyte community assembly. Previous studies have focused primarily on dispersal limitation and abiotic habitat filters ( Saunders et al., 2010 ), but the topic of leaf traits as host-imposed habitat filters that may act directly on fungi, and shape fungal-fungal competition to act indirectly, has remained relatively underexplored. Our study highlights the need for a trait-based approach to bridge this knowledge gap. The microbiota associated with plants and animals are linked to host health, performance, survival, and evolution ( Rosenberg and Zilber-Rosenberg, 2016 ; Lutzoni et al., 2018 ). Foliar mycobiomes are likely to act as an extended plant phenotype that protects photosynthetic tissues against abiotic stressors and natural enemies ( Ganley et al., 2004 ; Mejía et al., 2008 , 2014 ; Van Bael et al., 2009a ). Considered together, our conclusions suggest that the interplay between plant functional traits and host identity play an important role in shaping the distribution of microbial endophyte communities in tropical forests, with implications that scale up to the shaping the function and dynamics of Earth’s richest forest ecosystems.",
"introduction": "Introduction Plants worldwide host diverse microfungi within healthy leaf tissues. These foliar fungal endophytes, which occur within living leaves without causing disease ( Arnold et al., 2000 ), typically are horizontally transmitted and phylogenetically diverse within individual hosts ( Arnold et al., 2009 ). Some endophytes are latent saprotrophs with limited impact, awaiting leaf senescence ( Alvarez-Loayza et al., 2011 ). Others are latent pathogens, or may be pathogens of co-ocurring plant species ( Slippers and Wingfield, 2007 ). Others still are beneficial, influencing resilience in tropical trees by enhancing defense against pathogens ( Arnold et al., 2003 ; Herre et al., 2007 ; Mejía et al., 2008 ), reducing herbivore damage ( Van Bael et al., 2009a , b ), and altering plant physiology ( Westoby and Wright, 2006 ; Christian et al., 2019 ). All tropical trees surveyed thus far host diverse fungal endophytes in their healthy leaves, but predicting their abundance, diversity, composition, and functional roles in natural plant communities can be difficult. In many cases, differences in endophyte communities among co-occurring plants cannot be explained by environmental conditions or the phylogenetic relationships of their hosts ( Arnold and Herre, 2003 ; Arnold and Lutzoni, 2007 ; Higgins et al., 2011 , 2014 ; Vincent et al., 2016 ; Oita et al., 2021a , b ). This observation suggests that endophytes may be responsive to other factors, such as leaf traits, that may not vary strictly with host plant phylogeny. Leaf traits of plants worldwide are classified according to the Leaf Economics Spectrum (LES), which links leaf functional traits to evolutionary life history strategies of plants ( Wright et al., 2004 ). On one end of the LES are species that produce long-lived leaves with a high leaf mass per area (LMA, which describes tissue thickness and density), a high investment in mechanical and structural defenses (e.g., leaf toughness and leaf dry-matter content), and low nitrogen (N; Wright et al., 2004 ; Donovan et al., 2011 ; Mason and Donovan, 2015 ; Osnas et al., 2018 ). On the other end of the LES plant species that produce short-lived leaves with a low LMA, a low investment in mechanical and structural defenses, and high N content ( Coley and Barone, 1996 ; Wright et al., 2004 ; Donovan et al., 2011 ; Osnas et al., 2018 ). Previous studies have linked leaf traits to fungal endophytes in temperate habitats ( Saunders et al., 2010 ; González-Teuber et al., 2020 , 2021 ; Oono et al., 2020 ), but more research is needed to understand patterns in diverse, tropical forests (e.g., Tellez et al., 2020 ). In tropical forests, closely related tree species near different ends of the LES often co-occur (e.g., Wright et al., 2004 ), providing an opportunity to examine the contribution of leaf traits to differences in endophyte assemblages and functional traits at the plant community level. Here, we test the hypothesis that variation in the abundance, diversity, composition, and functional traits of fungal endophyte communities can be explained by leaf traits as defined by the LES. We examined foliar endophytes in 30 co-occurring species of host plants, drawing from 19 common plant families in a lowland forest in Panama to represent a breadth of traits along the LES (leaf dry matter content, C and N content, LMA, leaf punch strength, and leaf thickness). These included nine species pairs, each comprising closely related species that differ in their LES traits ( Table 1 ; Supplementary Tables S1 , S2 ). This study design allowed simultaneous consideration of leaf functional traits with variables that correlate with endophyte community composition, such as host phylogeny, host identity, and spatial structure ( Higgins et al., 2011 ; Liu et al., 2019 ). Endophyte communities were assessed with both a culture-based method (all 30 plant species) and a culture-free, high-throughput method (11 species in six families). Finally, strains of the most abundant orders were evaluated for functional traits relevant to their occurrence in leaves, including cellulase, chitinase, protease, and antimicrobial activity. These traits reflect the biotic interactions of horizontally transmitted endophytes with their host plants at the endophytic and saprotrophic phases, and with co-occurring species in the foliar microbiome (see Augspurger and Wilkinson, 2007 ; dos Reis Almeida et al., 2007 ; U’Ren and Arnold, 2016 ). Table 1 Family, species, species code, and number of individuals used in culture-based ( n 1 ) and culture-free ( n 2 ) surveys of fungal endophytes associated with 30 woody plant species in the forest understory of Barro Colorado Island, Panama. Family Species Code n 1 / n 2 Tiliaceae \n Apeiba membranacea \n APEM 3/− Lauraceae \n Beilschmiedia pendula \n BEIP 3/− Sapotaceae \n Chrysophyllum argenteum \n CHRA 3/− Sapotaceae \n Chrysophyllum caimito \n CHRC 1/− Boraginaceae Cordia alliodora * \n CORA 3/2 Boraginaceae Cordia bicolor * \n CORB 3/3 Sapindaceae Cupania rufescens * \n CUPR 3/− Sapindaceae Cupania seemannii * \n CUPS 3/3 Rubiaceae \n Faramea occidentalis \n FARO 1/− Clusiaceae Garcinia intermedia * \n 1 \n GARI 3/− Clusiaceae Garcinia madruno * \n 1 \n GARM 3/− Lecythidaceae \n Gustavia superba \n GUSS 2/− Olacaeae Heisteria acuminata * \n HEIA 3/3 Olacaeae Heisteria concinna * \n 1 \n HEIC 3/3 Chrysobalanaceae \n Hirtella americana \n HIRA 3/− Chrysobalanaceae \n Hirtella triandra \n HIRT 2/− Violaceae \n Hybanthus prunifolius \n HYBP 3/− Salicaceae \n Laetia thamnia \n LAET 2/− Piperaceae Piper cordulatum * \n PIPC 3/3 Piperaceae Piper reticulatum * \n PIPR 3/3 Burseraceae \n Protium panamense \n PROP 2/− Rubiaceae Psychotria horizontalis * \n PSYH 3/2 Rubiaceae Psychotria limonensis * \n PSYL 3/− Fabaceae Swartzia simplex var. continentalis * \n SWAS 3/3 Fabaceae Swartzia simplex var . grandiflora * \n SWAC 3/3 Clusiaceae \n Symphonia globulifera \n SYMG 1/− Combretaceae \n Terminalia amazonia \n TERA 2/− Malvaceae \n Theobroma cacao \n THEC 2/− Meliaceae \n Trichilia tuberculata \n TRIT 3/− Annonaceae \n Xylopia macrantha \n XYLM 2/− * Denotes tree species used for culture-free surveys. 1 Individuals in these species did not meet the threshold of 4,000 sequences for the culture-free surveys and were excluded from multivariate analyses. With these data, we tested three main predictions. Because leaf toughness may preclude infection by some endophytes that rely on haustoria or penetration pegs ( Huang et al., 2018 ), and leaf thickness and density could limit intercellular growth ( Herre et al., 2007 ) we predicted that endophyte abundance, diversity, and richness would be lower in thick, tough, and long-lived leaves relative to thin, soft, and shorter-lived leaves. Second, as endophytes are heterotrophs, differences in foliar N or C may support endophytes with distinctive nutritional requirements ( U’Ren and Arnold, 2016 ). We therefore predicted that differences in abundance and composition could be explained by these foliar nutrients. Third, the LES is a defining axis on which life history, ecology, physical structure, and chemistry come together to define leaf traits. We predicted that foliar endophytes would represent an extension of the LES, with the dominant taxa of endophytes differing between leaves at different ends of the LES continuum, and those endophytes in turn differing in traits relevant to leaf function. Together our data show how the LES is associated with foliar symbiont communities and their traits, providing evidence for the underlying mechanisms influencing plant-associated microbial communities that, in turn, shape the structure and function of Earth’s most diverse forests.",
"discussion": "Discussion The Leaf Economics Spectrum (LES) showcases the linkages among life history traits as they manifest in leaves worldwide. Here, we examined how the LES extends to the highly diverse foliar symbionts—endophytes—that occur in leaves of all plants studied thus far. In the context of tropical forests, where plant- and endophyte diversity typically reach their peaks, we tested the hypothesis that leaf functional traits as defined by the LES can explain patterns of fungal endophyte abundance, diversity, community composition, and traits. Our culture- and culture-free surveys of phylogenetically diverse tree species in lowland Panama revealed strong associations between leaf traits and endophyte assemblages. Our assays show that the most common endophytes that affiliate with leaves at different ends of the LES differ in their own traits in a predictable manner. Our results extend the LES framework to diverse and ecologically important foliar fungal symbionts and highlight that endophytes may not only respond to, but potentially extend, the functional traits of leaves they inhabit (e.g., in terms of antipathogen defense). Here, we examine three key results and their implications. Perspectives on mechanical and structural elements of leaves We predicted that endophyte abundance, diversity, and richness would be lower in thick, tough, and long-lived leaves relative to thin, soft, and shorter-lived leaves. We found negative associations of endophyte abundance, diversity, and richness with leaf punch strength (toughness) and LMA (density; Figure 1 ) suggest that the mechanical and structural properties of leaves modulate the form and function of foliar symbioses. In plant-herbivore associations, structural leaf features (e.g., specific leaf weight, lamina, and cuticle thickness) often correlate negatively with densities of herbivorous insects ( Peeters, 2002 ), presumably due to physical feeding limitations imposed by these leaf traits. Similarly, leaf punch strength is a mechanical trait that is a key defense against certain insect herbivores ( Coley, 1988 ; Nichols-Orians and Schultz, 1989 ; Kursar and Coley, 2003 ) and is linked to lower diversity in herbivore communities ( Peeters, 2002 ). The negative association we see between such leaf traits and endophytes may follow similar patterns, albeit due to different mechanisms. For instance, it has been hypothesized that increases in the structural and mechanical properties of leaves of slow-growing plant species may impede or limit endophyte entry and hyphal extension in leaves ( Sanati Nezhad and Geitmann, 2013 ), with fungal entry being easier in thinner, less dense leaves ( Arnold and Herre, 2003 ). Additionally, our results indicated that endophyte abundance, diversity, and richness had a small positive correlation to %N in leaves. This suggests that fast-growing plant species might produce N-based nutrients (e.g., amino acids) or other N-based resources that support higher densities of fungi, much like greater nutrition in leaves is expected to support greater abundances of insect herbivores ( Cornelissen and Stiling, 2006 ; Poorter and Bongers, 2006 ). Taken together, our results suggest that structural, mechanical, and chemical properties of leaves influence the type and number of fungal taxa able to colonize a leaf’s interior. Perspectives on variation in endophyte community composition across leaves on the LES We predicted that differences in endophyte community composition could be explained by traits such as LMA, C, and N. LMA, leaf punch strength, and %C and %N content were small but significant contributors to variation in endophyte community composition ( Figure 2 ). These leaf traits are indicators of plant function and life history strategy ( Wright et al., 2004 , 2010 ). LMA reflects tradeoffs in allocating resources for either metabolic mass (i.e., mesophyll cytoplasm) vs. cell wall ( Agrawal and Fishbein, 2006 ; Osnas et al., 2018 ). Leaf mechanical strength and relative abundance of cell wall fiber covary with LMA and often mirror investments in leaf defense and longevity ( Kitajima et al., 2013 , 2016 ). Tougher leaves with high LMA and cell wall fiber contents (in particular, cellulose, which has tensile strength higher than steel on a mass basis) may create significant impediment to extension of fungal hyphae. Another dense tissue, i.e., epidermal cuticle, increases its relative contribution to LMA in shade leaves, and thick cuticles may resist punching by hyphal penetration pegs. A previous study in temperate forests found that variation in cell wall polysaccharides correlated with unique fungal endophyte communities ( González-Teuber et al., 2020 ). Collectively, these cell-wall associated structures may act as environmental filters to assemble endophyte communities. As anticipated, endophyte community composition did differ as a function of %C and %N in leaves, suggesting differences in nutrient use among the major groups of endophytes that occur in leaves at different points along the LES. We found associations between %N and endophyte communities, indicating that important N-based physio-chemical components (e.g., alkaloids or nutrients) in leaves may have some effects on endophyte communities. This is and may interact with physiological components found within cells. In another recent study, Christian et al. (2020) showed correlations between host plant secondary chemistry and fungal endophyte communities in the alkaloid-rich genus, Psycotria . In their study of temperate trees, however, González-Teuber et al. (2020) found that fungal endophyte communities in temperate trees were associated with C-based compounds, such as anthocyanins, flavinoids, and terpenoids. Together with previous studies, our findings point to leaf structural and chemical components as significant contributors shaping endophyte communities in tropical forests ( Christian et al., 2020 ; González-Teuber et al., 2020 ), extending work on foliar endophytes of 11 species in Papua New Guinea ( Wold et al., 2001 ; Vincent et al., 2016 ) and complementing the work of Kembel and Mueller (2014) who linked leaf-surface fungal communities in 51 tree species in Panama to LMA and N content (but not C content). This study builds upon these previous efforts by quantifying leaf traits from which endophytes were obtained, and using a combination of culture-based and culture-free surveys to capture the full diversity of endophytes. Our study adds to the growing body of literature indicating functional traits of tropical plants act as a filter to shape communities of highly diverse foliar symbionts that, in turn, have strong effects on plant physiology, productivity, and demography ( Arnold et al., 2003 ). Perspectives on traits of endophytes We found support for the prediction that dominant fungal taxa, Xylariales and Botryosphaeriales, would differ between leaf traits at different ends of the LES continuum ( Figure 3 ), and in turn these taxa would differ in traits relevant to leaf function. The robust bioactivity of endophytic Xylariales, which included cellulase, chitinase, protease, and antipathogen activity, is consistent with a potentially defensive role in the softer, lower-C leaves with limited structural protection in which they most frequently occur. Recent work has highlighted the remarkable chemical diversity of Xylariales such that the traits observed in this study may be relevant beyond the specific strains studied here ( Franco et al., 2022 ). Notably, some strains of Botryosphaeriales also displayed bioactivity, but in general these traits were less common, consistent with their occurrence in leaves with robust structural defenses. That the relative abundance of Xylariales and Botryosphaeriales were negatively associated also raises the question of the importance of direct or indirect interactions among endophytes, especially the roles fungi may play in impeding leaf colonization of other fungal taxa. This is a topic for further research. Our study is novel in showing that variation in endophyte traits themselves, and their interactions with host plants, one another, and other co-occurring organisms, may underlie the variance in endophyte abundance, diversity, community composition, and traits that remains to be explained even when the LES is taken into account. We found that host identity had a strong effect on endophyte community composition ( Table 1 ), consistent with previous research in the tropics, e.g., ferns of Costa Rica ( Del Olmo-Ruiz and Arnold, 2014 ); tree species of Papua New Guinea ( Vincent et al., 2016 ); tropical trees in Panama ( Arnold and Lutzoni, 2007 ); endemic plant species of Peru ( Unterseher et al., 2013 ); and seeds of lowland tropical trees ( Sarmiento et al., 2017 ). We suggest that other foliar traits related to host identity (e.g., phenology, secondary metabolites, and physiology) may be important in explaining the variance in endophyte communities, either directly (by selecting for individual endophyte taxa) or indirectly (by providing a context for selection of cohorts of associated endophyte taxa that coexist successfully within the same leaf tissues, with compatible sets of functional traits)."
} | 5,032 |
31788934 | PMC7027455 | pmc | 9,535 | {
"abstract": "Summary Interactions between plants and soil microbes are important for plant growth and resistance. Through plant–soil‐feedbacks, growth of a plant is influenced by the previous plant that was growing in the same soil. We performed a plant–soil feedback study with 37 grass, forb and legume species, to condition the soil and then tested the effects of plant‐induced changes in soil microbiomes on the growth of the commercially important cut‐flower Chrysanthemum in presence and absence of a pathogen. We analysed the fungal and bacterial communities in these soils using next‐generation sequencing and examined their relationship with plant growth in inoculated soils with or without the root pathogen, Pythium ultimum . We show that a large part of the soil microbiome is plant species‐specific while a smaller part is conserved at the plant family level. We further identified clusters of plant species creating plant growth promoting microbiomes that suppress concomitantly plant pathogens. Especially soil inocula with higher relative abundances of arbuscular mycorrhizal fungi caused positive effects on the Chrysanthemum growth when exposed to the pathogen. We conclude that plants differ greatly in how they influence the soil microbiome and that plant growth and protection against pathogens is associated with a complex soil microbial community.",
"conclusion": "Conclusions In conclusion, we show that effects of plants both on the soil microbiome and on the growth of chrysanthemum (through those effects on the microbiome), are plant species‐specific and not strongly conserved at the level of plant family or among grasses, forbs or legumes. This is in line with previous work showing that broad plant groups affect the soil through different mechanisms (Pérez‐Jaramillo et al ., 2018 ). Most of the grasses that we tested show a positive feedback effect on the growth of Chrysanthemum (Ma et al ., 2017 ) but we urge that this is not a general effect of all grass species as some grass species caused negative PSF effect and some forb species had positive effects on the growth of Chrysanthemum. We argue that we should select suitable plants to be used to create positive PSFs based on their microbiomes and not based on the family or broad group the plant belongs to. Plants shaping their bacterial community structure into types B1 and B2 and fungal type F1 in our study had the most beneficial effect on the growth of the following plant in the presence of a pathogen. Further studies should examine what characteristics of their impact on the microbiome make these species cluster together, and whether these species also positively influence other crops.",
"introduction": "Introduction The interactions between plants and soil microbes are important drivers of ecosystem functions and plant community structure and diversity (Reynolds et al ., 2003 ). Soil microbes can help plants with nutrient acquisition (van der Heijden et al ., 2006 ; Yang et al ., 2009 ), via production or regulation of plant hormones (Kim et al ., 2011 ) and by protecting plants against pathogens and other stressors (Berendsen et al ., 2012 ). On the other hand, soil pathogens are thought to drive succession by negatively influencing the performance of certain plant species or groups and consequently influencing the plant community turnover (Bever et al ., 2012 ). The abundance and composition of microbes in the soil, in turn, is influenced by the plant that grows in the soil. This leads to plant–soil feedbacks (PSFs) where one plant can influence the growth of another plant via the impact of the first one on the soil (van der Putten et al ., 2013 ). Such feedbacks may differ between plant families and among grasses, forbs and leguminous plants (Bezemer et al ., 2006 ) and between nutrient‐acquisition strategies (Teste et al ., 2017 ). For example, legumes fix nitrogen in association with rhizobia and consequently may increase nutrient availability for other plants, resulting in positive PSF effects (Tilman et al ., 1997 ). However, growth by legumes can also alter the soil microbiome in ways that it has negative effects on other plants with different nutrient‐acquisition strategies such as species relying on arbuscular mycorrhizal fungi (AMF; Wubs and Bezemer, 2016 ; Teste et al ., 2017 ). Via their effects on the soil, grasses generally have positive effects on the growth of forbs (Ma et al ., 2017 ), but the mechanisms for this effect are still largely unknown. Both soil‐borne pathogens and mutualists such as AMF vary in their host specificity from generalist forming associations with all plants to highly specific associations (Barrett and Heil, 2012 ; Horn et al ., 2017 ). It is uncertain if more closely related species exhibit more negative PSFs through actions of soil microbes (Bever et al ., 2010 ; Cortois et al ., 2016 ). Currently, little is known about how individual plant species change the soil microbiome by growing in the soil, and how this feeds back to the growth of the following plant and, for example, the ability to defend itself from pathogens. The soil microbiome, and especially the fungal part of the microbiome (‘mycobiome’) can roughly be divided into three functional categories (mutualists, pathogens and saprotrophs) based on the functions they provide to the plant (Nguyen et al ., 2016 ; van der Putten et al ., 2016 ). The net outcome for plant growth will depend on antagonistic (plant pathogens) and synergistic (mutualists such as AMF, decomposers) interactions within the soil microbiome, and changes in the relative abundance of the microbial species belonging to these functional groups can greatly influence plant growth or plant health (van der Putten et al ., 2016 ; Hannula et al ., 2017 ). Plants that grow in a soil with a common microbiome can alter the relative abundance of mutualists, pathogens and saprotrophs in that soil, and this change can depend on the identity and taxonomy of that plant (Fitzpatrick et al ., 2018 ). By monitoring the PSF‐effects of these conditioning species on other plants, we can relate these changes in the soil microbiome to plant growth or plant resistance against attack by, for example, pathogens. An important challenge in PSF research is to use plants to steer soil microbiomes so that they improve the growth and resistance to pests or pathogens of crops (Badri et al ., 2013 ; Pineda et al ., 2017 ; Elhady et al ., 2018 ). Plant root exudates that differ greatly between plant species play a dominant role in shaping the rhizosphere and eventually the soil microbiome (Bais et al ., 2006 ; Hu et al ., 2018 ). A recent study (Fitzpatrick et al ., 2018 ) addressed how 30 angiosperm species changed their rhizosphere microbiomes and how this has potential consequences for PSFs. The authors addressed the role of abiotic stress on shaping the PSF responses but did not look into microbial taxa or functional guilds protecting against biotic stressors such as pathogens. Furthermore, the effect of the rhizosphere microbiome of the first plant on the growth of the following plant was larger than the effects caused by its endosphere microbiome (Fitzpatrick et al ., 2018 ). Currently, it is not yet possible to predict which plants and which microbes cause positive feedbacks and whether this is conserved at higher organizational levels such as plant families or differs between groups of plants such as grasses, legumes and other forbs. The general objective of this study is to unravel how the community structure and diversity of soil microbes is determined by the plant species that grows in the soil, and how this relates to PSF effects on growth of the following plant under pathogen pressure. Furthermore, we examine if these effects are conserved at the level of plant family or vary among broad groups of plants, such as among grasses, legumes and other forbs. In this study, we focus on PSF effects on Chrysanthemum, an important ornamental crop. We analysed the fungal and bacterial soil communities after growing 37 plant species individually in the soil and related this to the growth of Chrysanthemum in the feedback phase in inoculated soils (Ma et al . 2017 ). During the feedback phase, we added a soil‐borne oomycete pathogen, Pythium ultimum to a subset of plants, to examine the relationship between microbiome composition and the ability of the plant to grow in the presence of a root pathogen. P. ultimum causes root rot to a wide range of plants including Chrysanthemum (Lévesque et al ., 2010 ) and several studies have shown that soil‐borne microbes can suppress its effects on the plant (van Os and van Ginkel, 2001 ; Yu et al ., 2015 ). The nature of interactions between plants and soil biota will likely depend on plant characteristics such as functional traits and growth form (functional groups). We hypothesized that grasses, forbs and legumes (i.e. plants belonging to different functional groups) would differ in the community structure of fungi and bacteria in the soil. We further hypothesized that plant species that are related to each other (i.e. belonging to the same family) will select for more similar microbiomes. We previously reported that grasses have in general positive PSF effects on Chrysanthemum (Ma et al ., 2017 ), while forbs and legumes have negative effects. We hypothesized that this is related to an increase in the relative abundance of microbes in the soil microbiome that induce resistance in the plant against pathogens or that act as antagonists, and in the promotion of relative abundance of beneficial bacteria and fungi such as AMF.",
"discussion": "Discussion Biotic interactions via plant–soil‐feedbacks are important for the growth of plants and for terrestrial ecosystems as a whole (van der Putten et al ., 2013 , 2016 ; Bennett et al ., 2017 ). Soil microbes are thought to be key drivers of PSFs both through directly affecting plant growth or defence responses, and indirectly via, for example, affecting mineralization or by acting as antagonists of plant pathogens (van der Putten et al ., 2013 ; Chialva et al ., 2018 ). Here, we show that we can use plants to modulate the soil microbiome but that it is difficult to predict the outcome of the feedback effect based on plant group identity or phylogenetic distance, and that the way plants shape their microbiome varies greatly between species. However, we also show that the type of plant species (i.e. grass, forb or legume) can explain part of the soil microbiome, which in some cases (like for nodule forming bacteria for legumes) overrides the effects of plant species. The proportion of variation in communities explained by these three plant groups is between 4% (bacteria) and 11% (fungi) while plant species identity explains around 30% of the variation in microbial communities. The relative abundance of some groups of bacteria and fungi in the microbiome depends on the plant species that grows in the soil, while the abundance of other groups varies among plant groups. We did not measure here the effects of previous plant through other mechanisms than changes in the microbiome. In the second phase of the experiment, however, 90% of the soil was sterilized and hence identical in terms of soil chemistry between treatments, and we thus think that effects on the chrysanthemum growth are here due to effects prompted by microbes. The bacterial phyla we found more commonly in the soils in which legumes had been grown ( Actinobacteria , Planctomycetes , and Alphaproteobacteria ) contain species earlier found to be enriched in legume soils and that can form associations with rhizobia (Hartman et al ., 2017 ; Fitzpatrick et al ., 2018 ). In the soils in which forbs had grown, the Deltaproteobacteria were enriched. Also, for fungi the pattern was clear on the phylum‐level: forbs conditioned the soil to have more Mucoromycota while grasses caused enrichment in Basidiomycota and legumes favoured Ascomycota. However, there was large variation in these abundances across plant species and as most of the microbial functions are not conserved at the phylum level (Kaiser et al ., 2016 ), we can only speculate on the consequences of these observed patterns. An important finding in our study is that we could not predict the direction of the PSF solely from the plant group or family, even though soils from grasses tended to have more positive feedbacks than soils conditioned by forbs and legumes (Ma et al ., 2017 ). Several studies have shown that plants have species‐specific effects on the diversity and structure of the soil microbial community (Bulgarelli et al ., 2013 ; Naylor et al ., 2017 ; Fitzpatrick et al ., 2018 ). However, often these plant specific effects are not predictable. Host phylogeny, for example, has been identified as a factor that can explain the composition of microbes in the endosphere in a predictable manner, but not for rhizosphere bacterial communities (Fitzpatrick et al ., 2018 ; Leff et al ., 2018 ). The rhizosphere microbiome is also not responding strongly to a signal of plant traits (Leff et al ., 2018 ) and these plant traits seem to play a larger role in modulating PSFs in (more natural) mixed communities than in monocultures (Baxendale et al ., 2014 ). Here we show that plant species strongly influence the composition of their soil microbiome and that this leads to a PSF effect on the growth of another plant species both in absence and in presence of a root‐pathogen. The ability to promote growth and suppress the root‐pathogen is not, however, strongly conserved in broad or narrow plant groups or in phylogeny. We did not include the soil abiotic component here and grew the plants in nutrient rich environment, but in future studies, it would be interesting to investigate the effects of abiotic and biotic components separately and in combination. In our study with 37 plant species, certain plant species changed the soil microbiome in a specific way and inoculation with these soils enhanced the growth of a specific following plant (Fig. 5 ). Based on these findings we propose that within the context of PSFs, plants should not be divided into broad groups or growth forms or based on phylogenetic relatedness, but based on the microbiome that they create. In our study, plants were divided into four clusters based on the bacterial community they selected and into three clusters based on their mycobiome. Furthermore, we could show that inoculation with soil of one of these bacterial clusters increased the performance of the succeeding plant, Chrysanthemum, and at the same time, modulated the fungal community. This leads to the hypothesis that part of the changes observed in the bacterial and fungal communities are not directly due to plant growth but due to biotic interactions belowground. Especially, our results suggest that the presence and relative abundance of AMF may act as a modulator of bacterial community type and via this influences the performance of the following (nonmycorrhizal) plant indirectly (Sikes et al ., 2010 ). So far, many soil microbial studies have focused on the microbiome as one entity, and further studies are needed that examine the role of interactions among groups of organisms such as bacteria and fungi within these microbiomes. Other possible explanations for the nonphylogenetic signal in regulation of the soil microbiomes are for example the composition of root‐exudates which is also dependent on growth stage and nutritional status of the plant (Badri and Vivanco, 2009 ; Chaparro et al ., 2014 ). We adapted the concept from van der Putten and colleagues ( 2016 ) and evaluated the changes in the composition of the fungal community along the mutualist‐pathogen‐decomposer spectrum. The fungal functional composition shifted from the nonconditioned soil treatment in most cases towards a mutualist‐, in our case AMF, rich community (Fig. 2 ). Forbs and individual species of grasses shifted the community towards more beneficial fungi while legumes had more neutral or even negative effects through accumulation of pathogens. However, as fungal pathogens can be specific to certain genera of plants (Cortois et al ., 2016 ) and because of uncertainties in using FunGuild to predict plant pathogens correctly, their role in the feedbacks is unclear. The patchy distribution of AMF between plant species has been shown to affect grassland productivity (De Deyn et al ., 2011 ). We now show that promotion of AMF in the soil by certain plants can cause a positive feedback on the growth of the following plant when it encounters root pathogens. This is in line with previous studies on the benefits of AMF in nutrient‐rich conditions. Newsham and colleagues ( 1995 ) hypothesized that AM function is based on root architecture and that plants with simple rooting systems use mycorrhizae for nutrient uptake while plants with more complex root systems are more susceptible to root pathogens and thus need AMF for protection against pathogens. The function of AMF is dependent also on the identity of the fungus (Lewandowski et al ., 2013 ). Gigasporales are more effective in enhancing nutrient levels in plants while Glomeraceae better protects plants from root pathogens (Maherali and Klironomos, 2007 ). Our results also show that abundance of Claroideoglomeraceae, Archaeosporaceae and Paraglomeraceae are associated to the positive feedback effects on the growth of Chrysanthemum. In the current study, we do not address how much of the microbiome that is changed by plant‐conditioning remains present in the soils during the growth of the following plant. We know from our own work (unpublished data) that this cultivar of Chrysanthemum is not colonized by AMF (colonization percentages ranging from 0% to 1% and Glomeromycotina are not detected in root samples) so the positive effect of the AMF that we observed is likely to be indirect. There is recent evidence that the presence of AMF can change the composition of the soil microbiome through both positive and negative interactions and that soil microbes can, in turn, suppress the AMF (Svenningsen et al ., 2018 ). Further studies should investigate which part of the soil microbiome from the conditioning phase is found inside the roots and in the soils in the feedback phase. However, there is evidence that the initial soil microbiome has the largest effect on plant performance (Wei et al ., 2019 ). Other groups that showed a positive association with plant growth were Orbiliomycetes and Pucciniomycetes. The positive effects of Orbiliomycetes can be indirect as some of them are identified as nematode‐trapping fungi (Yang et al ., 2007 ). Furthermore, nontarget pathogens for Chrysanthemum from the class Pucciniomycetes that were enriched by grasses positively correlated with Chrysanthemum growth, which is in line with the expectation that nontarget pathogens can have positive effects on plant growth (Cortois et al ., 2016 ). Betaproteobacteria and Bacteroidetes were related to negative feedback effects on plant growth both in the presence and absence of P. ultimum while Acidobacteria were negatively related to the relative growth of Chrysanthemum. In earlier studies it has been hypothesized that bacteria belonging to the Bacteroidetes have a positive effect on plant growth (Pérez‐Jaramillo et al ., 2018 ) but here we show that more Bacteroidetes in the conditioning phase leads to growth reduction of the following plant. This could be due to different species and communities within Bacteroidetes eliciting the effects in different systems. Betaproteobacteria and especially the order Burkholderiales were negatively correlated with plant performance, potentially due to the pathogenicity of the members of this order (Eberl and Vandamme, 2016 ) or due to indirect effects through affecting the fungal community (de Boer et al ., 2015 ) even though there are also many plant growth promoting strains within Bulkholderiales . Increased amounts of Eurotiomycetes, and more specifically Aspergilli and Penicilli, caused negative feedback effects on the Chrysanthemum growth only in the presence of P. ultimum . Aspergilli are opportunistic pathogens known to cause secondary infections after a primary infector has done the initial damage (Perrone et al ., 2007 ) in this case aggravating the effects of Pythium on the growth of Chrysanthemum. An earlier study using compost as a substrate (and thus excluding the effects of AMF) showed that Actinobacteria, Acidobacteria gp14 and Cystobasidiomycetes were the groups of bacteria and fungi best able to suppress P. ultimum in cucumber (Yu et al ., 2015 ). We did not find that these same groups suppressed Pythium in our system, which is probably due to our selection of the active rhizosphere microbiome and not adding organic substrates. Each broad group of plants (grasses, forbs and legumes) had their own subset of microbes that were found only among those plants (Fig. 4 ). The core microbiome of the soil was, however, much larger and most OTUs were found not‐consistently be selected by plants belonging to the same group. Furthermore, there were specific taxa causing negative and positive feedback effects on the growth of following plant for each plant group and very few taxa (9) showed consistently positive or negative effects across plant types. However, it is possible that particular microbial species are consistently helping the plant to perform better, but that such effects are neutralized by the negative effects of other microorganisms and that this prevented us from detecting these interactions. Our study highlights that keystone microbial taxa (Banerjee et al ., 2018 ) that can cause positive and negative feedbacks on plants may vary greatly among different groups of plants and among plant species. Future studies should focus more on functional responses of communities and examine separate mechanisms for different plant groups rather than searching for individual microbial OTUs showing consistent effects across plant groups."
} | 5,545 |
40240613 | PMC12003493 | pmc | 9,536 | {
"abstract": "Agricultural practices and the crop being actively cultivated are some of the most important contributors to soil microbial community assembly processes in agroecosystems. However, it is not well-understood how the cultivation of diverse crop species can directionally shift complex soil microbial communities, especially under continuous monoculture systems. Here, we conducted a field experiment to assess how three crop species ( Lactuca sativa, Brassica juncea, and Zea mays ) may shift soil microbial (bacteria/archaea and fungi) communities when planted in a monoculture and repeatedly grown for three cycles in a tropical Oxisol soil. We found that while plant species made limited contributions to microbial community differentiation, repeated cultivation was a strong driver of community development over time. The bacterial/archaeal communities exhibited a cyclical community development pattern, initially with strong differentiation that attenuated to a steady state at the end of the three cycles. In contrast, fungal communities generally developed more linearly and may have only started to stabilize after three cropping cycles. These developments may speak to the stronger legacy effects on fungal communities. Together, these results highlight the differences between how bacteria/archaea and fungal communities develop, especially in tropical, underdeveloped, intensively degraded, or marginal soils. Supplementary Information The online version contains supplementary material available at 10.1007/s00248-025-02530-3.",
"conclusion": "Conclusion This field experiment tested the hypothesis that the repeated planting of a single crop species into a fallow or marginal soil can influence the direction of microbial community development through reduced richness and shifts microbial composition away from their initial state when edaphic and environmental factors remained similar. Our results supported part of this hypothesis and pointed to new insights. Taken together, we found that it was continuous cultivation, and not plant species, that exerted the strongest effects on microbial community development. In as few as three continuous cropping cycles, bacterial/archaeal communities appear to have stabilized, whereas fungal communities were just showing initial signs of stabilization. However, the resulting communities were not the same as those in the initial soil, suggesting that repeated planting of a single crop species can push bacterial/archaeal communities towards an alternative stable state. As we have yet to see stabilization in fungal community development, we propose that fungal communities will take longer to stabilize. We recognize that this study provided only initial clues into microbial community development. We envision that longitudinal studies across broader soils and longer timescales can build a better understanding of these processes across temperate and tropical agroecosystems. Together, these findings contribute to an ever-increasing recognition of plants as a primary contributor to belowground processes and suggest that the presence and persistence of plants should be a focus for developing strategies to steer agricultural soil microbiomes in underdeveloped, intensively degraded, or marginal soils.",
"introduction": "Introduction Annual crop agroecosystems share a common pattern of cultivation and replanting, sometimes interspersed by rest or fallow periods that result in relatively predictable feedback among plant and soil microbes that drive soil agroecosystem function [ 1 ]. This may include interactions between the biotic (plant roots, soil macro and microorganisms), abiotic (soil texture, water availability, pH, temperature), and management factors (tillage, irrigation, crop rotation, crop history) [ 2 , 3 ]. Among these, plants are recognized as one of the major contributors that can shape soil microbial community structure and ecological functions [ 4 , 5 ] driven by processes in the rhizosphere [ 6 , 7 ]. Yet, there is relatively little research that monitors soil microbial community development across these cycles of cultivation [ 2 ], especially in the transition into, or return to cultivation from fallowed or marginal lands. The microbial community developmental process in soils, especially in the roots and rhizosphere, appears to be strongly associated with different plant species [ 1 , 4 , 8 , 9 ]. For example, the roots of Trifolium hybridum and Leucanthemum vulgare selected more Betaproteobacteria than the roots of wild Pilosella aurantiaca under natural conditions [ 9 ]. Similarly, fungal richness and composition differed distinctly between monocot and dicot plant species, perhaps due to differences in root morphology and the composition of rhizodeposits released [ 10 ]. However, some plant species such as rice have weak influences on their rhizosphere microbial communities [ 11 ]. This contrast in findings may reflect the majority (78%) of the research in this area being performed with single plant species, at a single time point [ 2 ], at different locations and soil backgrounds, and often centered around individual microbial species rather than whole communities [ 12 , 13 ]. While the impact of the rhizosphere on microbial community structure is well-documented, how different plants species may shape the development of these communities within and beyond the rhizosphere is less understood. The intensity, duration, and history of different agriculture management systems can also contribute significantly to microbial community structure. For instance, monocropping can decrease soil microbial abundance and diversity in comparison to crop rotation or intercropping [ 14 , 15 ]. Widely practiced continuous monocropping in modern agriculture can initially reduce microbial diversity and increase pathogen loads [ 16 – 18 ]. However, Hannula et al. [ 19 ] found that planting monocultures of forbs and grasses (different plant functional groups) increased microbial diversity during the first 6 months and remained stable up to 12 months, suggesting that in certain systems, short-term plantings may increase soil microbial diversity and influenced by a legacy effect, i.e., “conditioning of the soil left by biotic and abiotic imprint after those conditions no longer exists” [ 19 ]. Through longitudinal studies, we can detect the legacy effects of the plants on the development and succession of microbial communities. Legacy effects may be especially relevant due to the cyclical and longitudinal nature of annual agroecosystems, especially in tropical areas with no winter rest. Although previous studies have demonstrated that differences in plant species, edaphic and environmental conditions contribute to changes in microbial communities in the rhizosphere, these studies were mostly limited to temperate environments. This leaves a large knowledge gap of our understanding in tropical ecosystems, primarily Oxisol soils. These soils constitute approximately 8% of non-ice-covered land on which much of the world’s tropical agricultural systems occur [ 20 ]. In addition, only 2% of research on root-associated microbial studies included bacteria/archaea and fungi [ 2 ], even though these groups of microorganisms co-exist together and influence each other in any soil system. With this in consideration, we conducted a field-based experiment in a tropical Oxisol soil, using three crop species under the same edaphic, climatic, and cultural conditions, using uniform sampling and molecular methods. Our objective was to study the response of the bacterial/archaeal and fungal communities to different crop species in a repeated monoculture system over time. We hypothesize that repeated planting of a single crop species into a fallow or marginal soil influences the direction of soil bacterial/archaeal and fungal community development, observable through reduced richness and shifts community composition across different crop species over time; these repeated plantings would leave a detectable legacy of their influence from one cycle into the next cycle.",
"discussion": "Discussion In this study, we experimentally tested the directional shifts in soil microbial (bacteria/archaea, and fungi) communities associated with different plant species under an organic, repeated monocropping system over 1 year in a tropical soil environment. We found three major patterns that contribute to the current understanding of plant–microbe interactions in tropical agroecosystems. At the forefront, (1) it is continuous cultivation, not plant species, that had the strongest and most significant effect on microbial community development over time; (2) these communities shifted in a cyclical and compounding manner; but (3) bacteria/archaea communities responded differently compared to fungi. Although microbial communities change within a single life cycle of a crop (e.g., vegetative vs. flowering) is well-documented [ 43 , 44 ], here we add new knowledge and expand this concept to show that changes can also develop sequentially over multiple cropping cycles. Cultivation Cyclically Drives Community Development We initiated the study with a soil similar to barren and unmanaged lands or fields that had been fallowed over a period of time and found statistically significant development of the community of bacteria/archaea and fungi across the three cropping cycles (Figs. 1 and 2 ). Although we found cultivated soils to have higher richness (also reported by Bourceret et al. [ 45 ]), the overall richness in the system eventually decreased (Supplementary Figs. 2 and 3 ). This is a commonly observed trend associated with cultivated agricultural [ 46 , 47 ] and grassland soils [ 19 , 48 , 49 ]. Similarly, the presence of actively growing plants (e.g., cultivated soils) can also significantly change soil microbial community composition [ 43 , 50 ]. This indicates that the presence of plants, especially over time, can have a major impact on soil microbial community development. However, contrary to our hypothesis, continuous cultivation (crop cycles) was more important in driving community development than plant species. We found that plant species contributed to the development of both bacterial/archaeal and fungal community composition, but these effects were marginally significant, and minor (low R 2 ) compared to other measured factors, especially continuous cultivation. These results corroborate earlier findings [ 4 , 51 , 52 ] but also contradict others [ 4 , 8 , 9 ]. We think that the results here reflected our sampling method where the samples contained mix of both rhizosphere and bulk soils that might have blurred distinct signals shown in other studies where rhizosphere and bulk soils were analyzed separately. In addition, the relatively consistent level of nutrients, including total nitrogen in the plot across the entire experiment (Supplementary Fig. 1 ) lend support to this idea that perhaps nutrient addition was not a major contributor to community shifts. However, we note that this experimental design does not allow us to mechanistically tease out nutrient availability as a cause for community development. Overall, continuous cultivation explained the largest portion of the data measured, indicating that the act of cultivation (shallow till, fertilizing, growing plants) can have substantial impact on the overall soil microbial community relative properties contributed by plant species. The continuous cultivation of plants appears to have different effect on bacteria/archaea vs. fungal community richness and composition (Fig. 2 ). Over time, bacteria/archaea exhibited a cyclical community pattern (increase in cultivated soils, decrease in uncultivated soils) that is indicative of the effects left by legacies from the previous planting cycle (i.e., the legacy effect of plants in the first cycle influencing the soils immediately after harvest). In our case, the legacy of cultivation was left on uncultivated soils, and that was carried into cultivated soil in the next cycle, ultimately creating an overall increase in community composition changes over time. Although fungal community composition did not show this cyclical pattern, their continuous community differentiation carried through uncultivated soil after harvest indicated the strong legacies left by cultivation on (and perhaps by) fungi. The strong pattern of fungal legacies was highlighted by Hannula et al. [ 49 ], and its recapitulation here in a tropical Oxisol (as compared to the temperate soils), suggests that this property may be a common feature of plant-fungal association across broad soils and environments. Differential Response Between Bacteria/Archaea and Fungi In recent years, we have come to better understand the similarities and differences between the two major groups of soil microorganisms, the bacteria (less so archaea) and fungi, and how they participate in soil processes. These organisms form functional guilds that together drive soil processes [ 53 ]. As such, we may expect how their communities respond to periodic perturbations (such as cultivation), will differ. Here, we observed that community development of bacteria/archaea to be more cyclical as compared to the linear development of fungal communities (Fig. 3 ). Bacteria/archaea community shift was strong initially, but these shifts attenuated over time, suggesting that these communities have reached a steady state similar to the report by Hannula et al. [ 19 ]. On the contrary, fungal communities continued to diverge linearly but may be showing signs of attenuation at the end of the experiment. Our results showed that while three cropping cycles may be enough to stabilize bacterial/archaeal communities, it will take longer for fungal communities to stabilize. Given that in tropical areas where cropping cycles may truly be continuous (no winter rest), communities may stabilize within a much shorter timeframe than in temperate climate. The selection of certain taxa may drive these community development patterns. Of note are the nitrifying archaea Candidatus Nitrosomiscus and the bacteria Nitrospira , which together perform the two steps in oxidation of ammonium to nitrate. The enrichment of ammonium oxidizing microbes in agroecosystem is expected due to the use of fertilizers and the rhizosphere effect [ 54 , 55 ]. The rhizosphere could have selected for Candidatus Nitrosomiscus and the nitrogen-rich fish meal fertilizer that we used could have selected for Nitrospira. A similar case may be true of the many OTUs of the Rokubacteriales which appear in nitrogen-rich and mixotrophic ecosystems [ 56 , 57 ]. Udaeobacter were also enriched, and while it is difficult to explain the general pattern associated with this ubiquitous soil genus, their enrichment in cultivated soil suggests that they are linked to the rhizosphere. Willms et al., [ 58 ] found that this genus prefers acidic soil pH, which may be associated with the protons and carboxylate anions excreted by plants and microbes [ 59 ]. The enrichment of Mycobacterium could indicate the higher abundance of fungi, as this genus appears to be found in close association with dense mycelial mats in soil [ 60 ]. The depletion of Massilia was surprising because of its presence within the rhizosphere of many plant species and has potential plant growth-promoting properties [ 61 ]. Detailed studies using molecular and stable isotope tracing showed that Massilia prefers plant detritus [ 61 – 63 ], as well as a preference for root exudates [ 62 , 64 ]. However, as we have found their depletion in a previous study in another tropical Oxisol soil [ 65 ], their interaction with plants here may not parallel those in temperate soils. The notable fungal taxa that were enriched were all putative plant pathogens. In fact, almost all of the potentially plant-pathogenic fungal taxa were found enriched in the last cycle. This enrichment of fungal pathogen in monoculture agroecosystem is well known and is expected [ 66 ]. Although it is unlikely that plant-pathogenic fungi alone drive fungal community differentiation, they certainly contributed to it. Their presence may have negative feedback on plant productivity over time, although we did not measure this aspect in our experiment. The enrichment of early diverging fungi such as the arbuscular mycorrhizal fungus Archaeospora and the saprotrophic/endophytic fungus Mortierella also suggests the selection for plant growth-promoting taxa. The benefits of arbuscular mycorrhizal fungi are well known, but the plant growth-promoting properties of Mortierella has recently gained a lot of attention due to their ubiquity in agricultural soils and ability to confer a large number of advantages to plant growth and protection [ 67 , 68 ] especially in organic agricultural systems [ 69 , 70 ]. In this study, we see both an increase in plant pathogenic and plant growth-promoting fungi; steering the nature of their interactions with bacteria would be key to build productive organic systems. Detectable Signals Across the Rhizosphere-Bulk Soil Continuum We were able to find strong signals of how cultivation, and not necessarily plant species, can exert a strong effect on soil microbial communities and their development in study samples that contains a mix of both rhizosphere and bulk soils. The fact that these signals were strong enough to be detected suggests the effects that initially started within the rhizosphere could expand outwards and eventually influence the microbes living in the “bulk soils” and effectively change the microbial profile of the whole soil system. Like the roots that move exudates into the surrounding soil, we posit that rhizosphere-associated fungi can also extend their hyphae and transport plant-derived carbon beyond the rhizosphere into the hyphosphere, or what has typically been called “bulk soil”. Thus, these signals may be detected whether one examines rhizosphere soils, bulk soils, or a mix of both. This concept is most apparent for fungi that are connected directly to plant roots, such as arbuscular mycorrhizal fungi, which might be less abundant in rhizosphere soils than in bulk soils [ 71 ]. These findings lend support to the idea that the rhizosphere is a continuum of physicochemical properties that support microbial activity [ 72 ], and that the way we sample “rhizosphere” vs. “bulk” soils does not necessarily reflect the true nature of soil systems. In applied situations, where plants roots are employed to drive certain processes, such as improving agricultural soil health, bioremediation, and soil restoration, it is important to recognize the continuum, rather than the binary model of rhizosphere vs. bulk soils."
} | 4,693 |
39815338 | PMC11734539 | pmc | 9,537 | {
"abstract": "Background Aspergillus niger is an important industrial filamentous fungus used to produce organic acids and enzymes. A wide dynamic range of promoters, particularly strong promoters, are required for fine-tuning the regulation of gene expression to balance metabolic flux and achieve the high yields of desired products. However, the limited understanding of promoter architectures and activities restricts the efficient transcription regulation of targets in strain engineering in A. niger . Results In this study, we identified two functional upstream activation sequences (UAS) located upstream of the core promoters of highly expressed genes in A. niger . We constructed and characterized a synthetic promoter library by fusing the efficient UAS elements upstream of the strong constitute P gpdA promoter in A. niger . It demonstrated that the strength of synthetic promoters was fine-tuned with a wide range by tandem assembly of the UAS elements. Notably, the most potent promoter exhibited 5.4-fold higher activity than the strongest P gpdA promoter reported previously, significantly extending the range of strong promoters. Using citric acid production as a case study, we employed the synthetic promoter library to enhance citric acid efflux by regulating the cexA expression in A. niger . It showed a 1.6-2.3-fold increase in citric acid production compared to the parent strain, achieving a maximum titer of 145.3 g/L. Conclusions This study proved that the synthetic promoter library was a powerful toolkit for precise tuning of transcription in A. niger . It also underscores the potential of promoter engineering for gene regulation in strain improvement of fungal cell factories. Supplementary Information The online version contains supplementary material available at 10.1186/s12934-025-02642-y.",
"conclusion": "Conclusion In this study, two functional UAS elements, UASamyA and UASagdA, were identified from the promoter of highly expressed genes in A. niger . Based on these UAS elements, we created a synthetic promoter library with high activities and a broad range by assembling UAS elements with the reported most potent P gpdA promoter. We also demonstrated that these UAS elements were well-compatible with the core elements of different promoters. This synthetic promoter library was successfully applied to optimize citric acid-producing strains, resulting in significantly higher citric acid production in A. niger . In summary, the findings in this study lay the groundwork for developing more efficient synthetic promoter systems and expanding the promoter engineering toolboxes in fungal cell factories.",
"discussion": "Discussion The filamentous fungus A. niger is a leading industrial cell factory to produce organic acids and enzymes. Promoters are crucial to optimize gene expressions for synthetic biology and strain engineering. However, due to a knowledge gap in fully understanding native promoters and their architectures, there is a shortage of strong promoters available in A. niger . To overcome these limitations, we identified two functional UAS elements, UASa and UASb, and constructed a synthetic promoter library with vigorous intensity and an extensive range. This library facilitated the fine-tuned gene expression of the cexA gene and improved citric acid productivity. In fungi, many yeast promoters have been well-characterized [ 22 , 31 ], and many UAS elements have been identified in the yeast constitutive promoters. These identified UAS elements have been exploited to design hybrid promoters and stimulate transcription initiation with higher efficiency in yeast [ 23 , 24 , 27 , 41 ]. By contrast, only a few such UAS elements were identified in filamentous fungi. For instance, a 200-bp DNA fragment was identified in the most potent inducible promoter, P cbh1 of Trichoderma reesei , which enhanced the promoter strength when fused to a constitutive promoter, P cdna1 [ 42 ]. Few DNA sequences in strong inducible promoters were found to improve their native original promoters’ activity, such as a CCAAT-containing sequence in the P glaA promoter of A. niger T21 [ 32 ] and a Region III sequence in the P agdA promoter of A. oryzae [ 34 ]. To identify more functional promoter-enhancing sequences, here, we predicted the potential UAS elements in three highly expressed amylolytic genes agdA , amyA , and glaA in A. niger (Fig. 1 ). Among them, UASa from the P agdA promoter and UASb from the P amyA promoter were identified to enhance the promoter activities. Remarkably, UASb improved the activity of the P gpdA promoter by 33% (Fig. 1 C). Moreover, the UASb element could work well after truncation to a 30-bp conserved sequence. Overall, these two identified UAS elements can confer more efficient promoter activity. In addition, we also surprisingly found that the UASc of the P glaA promoter, with the conservated motifs of the CCAAT-containing sequence in P AnglaA of A. niger T21, didn’t show any improved effect on the P gpdA promoter activity (Fig. 1 C), which was not consistent with the previous report [ 32 ]. This inconsistency might be caused by random mutations in Region III of UASc spontaneously generated when the UASc sequence was synthesized and constructed in E. coli (Figure S9 ). Due to the distinctive functional feature of UAS elements, many researchers have invested efforts in enhancing promoter activity through synthetic hybrid promoter engineering in yeast [ 7 , 22 , 23 , 27 , 30 ]. Synthetic hybrid promoters have been designed using tandem UAS elements, assembling different UAS elements, or replacing core elements [ 27 ]. This study established a synthetic hybrid promoter library with high activities and a wide range by making these two identified UAS elements. We observed that increasing the number of UAS element repeats enhanced promoter strength, corroborating previous studies on UAS1B in Y. lipolytica [ 23 ] or the BS motifs in the SES system [ 18 ]. However, the synthetic promoter activity declined beyond a certain number of repeats (Fig. 2 ). There appears to be a critical threshold for UAS repeats, such as 6 copies for UASa and 5 copies for UASb. Notably, six copies of UASamyA and five copies of UASagdA conferred significant improvements in the transcription efficiency of synthetic promoters, up to 3.5-fold and 5.4-fold that of the strong P gpdA promoter (Fig. 2 ). Similar phenomena have been reported in other studies. For instance, Cox et al. found that a palindromic cAMP response element (CRE) functions as a UAS element for constructing synthetic promoters [ 43 ]. The optimal number of tandem-repeated CREs was 9 or 12, but promoter strength significantly declined when the CRE repeats were increased to 15 or 18 [ 43 ]. Based on the observed saturation phenomena of the UAS elements, we speculate that a certain number of UAS repeats could facilitate the binding of transcription activators and improve the recruitment of transcription factors (TFs) and RNA polymerase; however, further the increased UAS repeats may change the DNA accessibility and possibly affect the localization of transcription activators and RNA polymerases, which hinders their effective recruitment. The underlying reasons behind this interesting phenomenon could be further discovered by structure analysis of the complex involved in transcription initiation. Compatibility of UAS elements with different core elements is crucial for designing synthetic promoters. Zhao et al. [ 23 ] demonstrated that the UAS1B element exhibited vigorous activity when fused to various core promoter elements in Y. lipolytica , including LEU, TEF, PAT1, POX2, and EXP. In this study, we showed that the UAS elements also displayed good compatibility with the core elements of the P pkiA and P citA promoters in A. niger . For instance, four copies of the UASagdA element achieved up to 7.3-fold and 3.8-fold increases in the strength of the P pkiA and P citA promoters, respectively (Fig. 3 ). This compatibility highlights the potential of UAS elements to broaden the design range of artificial promoters, facilitating more versatile and effective transcriptional regulation. In addition, we revealed that the UAS elements showed good functional modularity and that tandem hybrid UAS elements can collaboratively enhance promoter strength. Notably, two copies of UASagdA-UASamyA dramatically increased the promoter strength up to 5.6-fold that of the P gpdA promoter. This functional modularity of the UAS elements has been verified in yeast UAS elements, such as UAS1 and UAS2, from the promoters Pro-Y13 and Pro-Y14 in O. polymorpha [ 29 ]. The Phy4 promoter with a hybrid tandem fusion of UAS1 Y13 + UAS2 Y13 and UAS1 Y14 + UAS2 Y14 showed a 2-fold increase in activity compared to the original promoter. The strong modularity of the UAS elements enables the design of shorter but more powerful synthetic promoters. For the application testbed, the cexA overexpression driven by this synthetic promoter library led to much higher citric acid production than that of the P gpdAg promoter. Among the synthetic promoters, the highest citric acid production was achieved at 145.3 g/L by fusing with hybrid tandem UAS elements (Fig. 5 ). These obtained synthetic promoters, exhibiting strength far surpassing that of the previously reported most potent promoter [ 11 ], P gpdA , provided additional options for strong gene regulatory elements in A. niger strain engineering. The activation effect of the UAS elements on promoter strength involves some specific transcription activators [ 22 , 44 ]. In the future, more efforts should be put into the screening of UAS interacting transcription activators to achieve a synthetic gene regulatory system with more commonality, more robust activity, and a broader range of gene transcription levels to achieve high-level production of organic acids and enzymes by this important cell factory A. niger ."
} | 2,496 |
40011734 | PMC11865314 | pmc | 9,538 | {
"abstract": "The demand for explainable and energy-efficient artificial intelligence (AI) systems for edge computing has led to growing interest in electronic systems dedicated to Bayesian inference. Traditional designs of such systems often rely on stochastic computing, which offers high energy efficiency but suffers from latency issues and struggles with low-probability values. Here, we introduce the logarithmic memristor-based Bayesian machine, an innovative design that leverages the unique properties of memristors and logarithmic computing as an alternative to stochastic computing. We present a prototype machine fabricated in a hybrid CMOS/hafnium-oxide memristor process. We validate the versatility and robustness of our system through experimental validation and extensive simulations in two distinct applications: gesture recognition and sleep stage classification. The logarithmic approach simplifies the computational model by converting multiplications into additions and enhances the handling of low-probability events, which are crucial in time-dependent tasks. Our results demonstrate that the logarithmic Bayesian machine achieves superior performance in terms of accuracy and energy efficiency compared to its stochastic counterpart, particularly in scenarios involving complex probabilistic models. This approach enables the development of energy-efficient and reliable AI systems for edge devices.",
"introduction": "Introduction The rapid evolution of artificial intelligence (AI) applications at the edge has accentuated the demand for low-power, explainable, and reliable edge AI systems that can function effectively even in uncertain conditions 1 . Numerous works have shown that advanced memory devices allow for considerable energy savings for the implementation of neural networks, a non-explainable form of AI, through the cointegration of computation and memory 2 – 6 . This cointegration can also be applied to explainable AI, as exemplified by the recently demonstrated nanodevice-based Bayesian machines 7 , 8 . Relying on Bayesian inference 9 , 10 , the strengths of these machines are manifold: they provide a hardware AI with inherently explainable results 11 , 12 , at a high energy efficiency. Bayesian machines are particularly appealing for tasks where neural networks struggle, such as sensor fusion in highly uncertain environments with limited training data, or safety-critical applications requiring explainable decisions. The efficiency of Bayesian machines is achieved through near-memory computing, which offsets the high cost of accessing the parameters of the Bayesian model 13 , and the adoption of stochastic computing 14 , 15 . The latter particularly facilitates compact and energy-efficient multiplication, a dominant arithmetic operation in the Bayesian machine, and has been shown repeatedly to be particularly adapted to Bayesian inference 16 – 24 . Despite all their merits, Bayesian machines are not exempt from the challenges of stochastic computing. These include high latency and compromised precision when dealing with low probability values 15 , 25 . While Bayesian machines demonstrated high accuracy in a gesture recognition application 7 or on handwritten character recognition 8 , their broader applicability to diverse tasks remains an open question. Our contribution through this work is two-fold. First, we introduce an alternative design: the logarithmic memristor-based Bayesian machine. This design eschews stochastic computing in favor of logarithmic computing 25 . This modification translates to implementing probability multiplications using digital near-memory integer adders, thereby augmenting the versatility of the system. We present a fully fabricated logarithmic Bayesian machine, using a hybrid CMOS/hafnium-oxide memristor process and show its robustness experimentally. Second, we undertake a comprehensive evaluation of this machine for gesture recognition and also for a Bayesian filter application that addresses a time-dependent task: sleep stage classification throughout the night. A detailed comparison with the stochastic design, assessing accuracy and energy consumption, elucidates the scenarios in which each design excels. Preliminary measurements of the logarithmic Bayesian machine were presented at recent conferences 26 , 27 . This paper builds on additional measurements and simulations, providing extensive comparisons between the logarithmic and stochastic versions of the Bayesian machines.",
"discussion": "Discussion Our results demonstrate that the logarithmic Bayesian machine offers a compelling advantage with regard to stochastic computing, to perform Bayesian inference in scenarios that require handling low-probability values efficiently, such as in the time-dependent task of sleep stage classification. For this task, we saw that logarithmic computation largely beats stochastic computation in terms of latency and energy consumption. Traditional stochastic Bayesian machines have their merits in simpler probabilistic calculations where high accuracy is less critical. We saw that a stochastic machine consumes less energy than the logarithmic design for gesture recognition when an accuracy lower than 84% is targeted. Stochastic machines are a natural match in a near-memory computing concept, as they use simple arithmetic circuits and involve reduced data movement. We also saw that they are more robust with regard to memory bit errors than the logarithmic design. Still, stochastic machines struggle with precision and latency in cases with low probabilities. The logarithmic approach reduces computational complexity while maintaining accuracy with regard to traditional Bayesian inference by transforming multiplicative operations into simpler integer addition. Therefore, even if it does not match the concept as naturally as the stochastic machine, it still allows using near-memory computation and provides an excellent compromise between the conceptual beauty of stochastic Bayesian machine and non-near-memory-computing approaches. The logarithmic memristor-based Bayesian machine shows a robust performance across power supply conditions, without the need of any calibration, which we validated experimentally on our prototype integrated circuit. With its proficiency in efficiently handling Bayesian inferences, this machine is particularly suited for edge AI applications. The proof-of-concept demonstrations in this work, sleep cycle classification, and gesture recognition, highlight the machine’s capabilities, but its true potential lies in addressing high-uncertainty problems with limited data availability. Meaningful applications include scenarios such as medical or structural catastrophe detection, where real-time decision-making is critical despite sparse or incomplete data. Additionally, the machine’s proficiency in handling incomplete datasets from diverse sources opens avenues for applications like sensor fusion in distributed systems. These features position it as a compelling solution for real-world challenges requiring explainable, transparent, and energy-efficient AI. Future research will focus on scaling the logarithmic Bayesian machine for broader applications and further reducing its power consumption. Integration with other forms of emerging non-volatile memory technologies could also be explored to enhance performance and durability. Moreover, the adaptability of this approach to other types of probabilistic models offers a rich field for further exploration."
} | 1,871 |
35162258 | PMC8834966 | pmc | 9,540 | {
"abstract": "Network-based assessments are important for disentangling complex microbial and microbial–host interactions and can provide the basis for microbial engineering. There is a growing recognition that chemical-mediated interactions are important for the coexistence of microbial species. However, so far, the methods used to infer microbial interactions have been validated with models assuming direct species-species interactions, such as generalized Lotka–Volterra models. Therefore, it is unclear how effective existing approaches are in detecting chemical-mediated interactions. In this paper, we used time series of simulated microbial dynamics to benchmark five major/state-of-the-art methods. We found that only two methods (CCM and LIMITS) were capable of detecting interactions. While LIMITS performed better than CCM, it was less robust to the presence of chemical-mediated interactions, and the presence of trophic competition was essential for the interactions to be detectable. We show that the existence of chemical-mediated interactions among microbial species poses a new challenge to overcome for the development of a network-based understanding of microbiomes and their interactions with hosts and the environment.",
"conclusion": "5. Conclusions We found that the existence of mediators can make microbial interactions difficult to detect. However, the degree of difficulty was different among the methods. CCM and LIMITS were capable of detecting interactions from the time series. While LIMITS performed better than CCM, it was less robust to the presence of chemical-mediated interactions. Our result also suggests that the presence of nutrient competition can facilitate the detection of interactions. The existence of chemical-mediated interactions among microbial species poses a new challenge to overcome for the development of a network-based understanding of microbiomes and their relationship to hosts and the environment. Our study would provide an in silico experimental system of microbial population dynamics, including chemical-mediated interactions, to evaluate network inference methods that will be developed in the future.",
"introduction": "1. Introduction There is a growing recognition that microbiome science needs to move beyond descriptive studies to a more systematic understanding that would facilitate mechanical, predictive, and manipulative approaches to rational microbial engineering [ 1 ]. Network-based approaches will help disentangle complex microbial and microbe-host/environment interactions, which could have applications universally applicable to medicine and health care, agriculture, and other environmental and industrial areas [ 2 , 3 , 4 ]. Current attempts to understand interaction networks combine comprehensive quantification of microbiota using next-generation sequencing technologies with various network inference methodologies based on statistical and machine learning approaches. Recent studies revealed that the exchange of metabolites plays an essential role in microbial interactions. All microorganisms exchange metabolites, such as vitamins, amino acids, nucleotides, or growth factors, by releasing them into the surrounding environment [ 5 , 6 , 7 ]. This metabolite cross-feeding is common both among different bacterial species and between bacteria and members of other kingdoms [ 6 ]. In consequence, a microbial community forms a unique chemical environment known as the exometabolome, which comprises hundreds of metabolites, the majority of which are derived from living cells [ 7 , 8 ]. Considering its prominent role in microbial interactions, the exometabolome and chemical-mediated interactions would be tightly linked with the dynamics of microbial communities, including composition, stability, and functionality. However, most of the benchmarking of methods proposed for inferring microbial interactions has been performed using generalized Lotka–Volterra (gLV) models, which assumes direct (species-species) interactions [ 9 , 10 , 11 ]. Some methods were developed based on the gLV equation itself [ 12 , 13 , 14 , 15 ]. Recent studies [ 16 , 17 , 18 ] revealed that the species-species interaction models are insufficient to capture dynamics that occur through chemical-mediated interactions, while such interactions would serve a prominent role in the coexistence of diverse microbial species [ 19 ]. Therefore, benchmarking with the direct interaction model alone would be insufficient. If the presence of chemical-mediated interactions reduces the reliability of the network inference methods, it poses a new challenge for studies of microbial interaction networks. In this paper, we investigated how accurate existing time-series-based inferences of ecological interactions would be when underlying interactions are mediated by chemicals. For this purpose, we started with an in-silico mediator-explicit model of microbial population dynamics whose parameter values had been experimentally calibrated [ 19 ]. We compared the performance of five major/state-of-the-art methods under different model assumptions, including the process of direct or chemical-mediated interactions, the presence or absence of competition for nutrients, as well as the effect of different sampling intervals and magnitudes of stochasticity.",
"discussion": "4. Discussion We compared the performance of five network inference methods in detecting interactions based on time series when interactions are mediated by chemicals or occur through direct interactions between species, as well as in different competitive contexts. Our results suggest that: (1) the existence of mediators can make microbial interactions difficult to detect, but the degree of difficulty may be method dependent, (2) nutrient competition can play an essential role for the detectability of interactions, and (3) correlation-based methods are not useful for detecting interactions from time series. Among the methods evaluated in this study, LIMITS, which is derived from the discrete version of the generalized Lotka–Volterra equation, was found to be the most reliable. However, its performance will be reduced if chemical-mediated interactions are dominant due to a mismatch between the processes that the method assumes and those that actually occur. Although the performance of CCM was not as good as LIMITS, CCM would be more robust to the presence of chemical-mediated interactions compared to LIMITS. This may be due to the fact that CCM is not dependent on any specific equation and is based on a nonlinear forecasting method that can flexibly capture the relationship between variables. In summary, LIMITS is recommended as the network inference method in general since it outperformed the other methods under any application conditions in M ′ and D ′ and no method clearly outperformed the others in M and D. However, further investigation around the tools of nonlinear forecasting, especially integration with the machine learning framework used in LIMITS to improve its applicability to nonlinear dynamics, will be a promising direction for time-series-based network inference targeting microbial communities, where chemical-mediated interactions are thought to play a major role. In the models with resource competition ( M ′, D ′), an increase in one species negatively affects the growth rate of other species and can reduce the population size. Thus, nutrient competition can facilitate coordinated variation in abundance and likely promote the detection of interactions. In fact, the difference between M , D and M ′, D ′ was mostly characterized by the coefficient of variation ( Appendix B ). In microbiota, there are a few essential nutrients that are common to many species [ 28 ], as well as diverse chemicals that mediate interactions. Space will also be an important resource if, for example, the substrate for colonization can be a limiting factor. Thus, while we need to be careful about its strength, the network inference would usually benefit from competitive processes. Finally, although correlation-based methods are widely used to infer interaction networks from time series, it should be noted that their reliability can be very low, regardless of whether the interactions are direct or chemical-mediated. This has been pointed out repeatedly in previous studies [ 12 , 26 , 29 ] for direct interactions, but we feel it is important to highlight again. There are multiple levels of understanding of networks, from properties of the network as a whole, such as degree distribution and average degree, to properties of individual nodes, such as network centrality. The more attention we pay to finer scale properties, the more accurate the network inference needs to be. Therefore, improving the accuracy of the method used for network inference is essential for a network-based understanding of biological systems."
} | 2,211 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.