text stringlengths 151 7.24k | token_count_qwen3 int64 54 2.05k | token_count_original int64 512 2.05k | meta dict |
|---|---|---|---|
RSTAND EATING
ORDERS
What is an eating disorder?
Eating disorders are mental health conditions where thoughts and behaviors about food & weight start to rule your life in a negative way.
Society puts pressure on people to be thin. But being healthy is not the same thing as being thin. Each person's body is different - some are smaller and some are bigger, and that's okay.
There are different types of eating disorders. Learn about 3 of them here
How can I get help?
If you think you might have an eating disorder, ask your doctor for help. There are many different forms of treatment, and each condition is treated differently.
Treatment often involves a combo of therapy and medication, but it depends on your specific needs
Eating Disorder Helpline: 1 (888)-375-7767
Sources
: https://www.nimh.nih.gov/health/topics/eating-disorders, https://anad.org/get-help/eating- disorders-helpline/, https://www.nami.org/About-Mental-Illness/Mental-Health-Conditions/Eating-Disorders
Disclaimer:
Med Ed Materials, 2023. This information is intended to supplement, not contradict, the medical advice of your practitioner. For questions or more info, contact your practitioner.
3 Common Types of Eating Disorders
1. Anorexia Nervosa
Anorexia is a disorder of severely limiting your food intake. People often view themselves as fat, even if they are very underweight.
Symptoms include restricted eating, extreme thinness & intense fear of gaining weight.
Anorexia is the most dangerous eating disorder and can lead to many complications, including death.
2. Bulimia Nervosa
Bulimia is a disorder of eating large amounts of food (binge-eating), and then doing something to compensate for the eating, such as making yourself vomit, exercising excessively, fasting, or using laxatives.
Symptoms include bingeing & purging, dehydration, tooth decay, sore throat, swollen glands in the mouth and neck, and abdominal pain.
People with bulimia can be any weight. You don't have to be underweight to have an eating disorder.
3. Binge-Eating Disorder
Binge-Eating is a condition where you lose control over your eating and eat really large amounts of food (bingeing).
Symptoms include eating very large amounts of food very quickly, eating even when you're not hungry, eating alone or in secret, and feeling ashamed or guilty about your eating.
This disorder is different from bulimia because people don't vomit, exercise excessively, use laxatives, or anything to compensate the binge-eating | 1,035 | 550 | {
"id": "<urn:uuid:df406f06-cf12-4064-9694-32292d607dd4>",
"dump": "CC-MAIN-2024-18",
"url": "https://mededmaterials.org/materials/all/Understanding%20Eating%20Disorders.pdf",
"date": "2024-04-17T11:25:13",
"file_path": "crawl-data/CC-MAIN-2024-18/segments/1712296817153.39/warc/CC-MAIN-20240417110701-20240417140701-00550.warc.gz",
"offset": 342900474,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9967840313911438,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9967840313911438,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2500
],
"fw_edu_scores": [
2.1875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Case Study
Banking on Sterilisation
Dave Thomas, Sales and Marketing Director, Astell
Astell's Sales and Marketing Director, Dave Thomas, recently visited the Millennium Seed Bank Partnership at Wakehurst in West Sussex, to fi nd out how an Astell autoclave is being used in the laboratory for essential sterilisation processes.
Working to Preserve Biodiversity
To give you an idea of scale, the Millennium Seed Bank Partnership is the largest ex situ plant conservation programme in the world. Its focus is on global plant life faced with the threat of extinction and plants of most use for the future. The seeds that are saved are conserved in seed banks as an insurance against the risk of extinction in their native habitat, ensuring that they will be available for decades to come.
Working with a network of partners across 80 countries, over 13% of the world's wild plant species are now being stored at the Millennium Seed Bank, the aim being to save the seeds of 25% of the world's plants by 2020. There is particular emphasis on the storage of those seeds at risk from the ever-increasing impact of human activities, including land use and climate change.
Frozen Assets
One of the key considerations when storing seeds is to ensure that they are still able to germinate after prolonged periods of inertia. The viability of the seed collections at the Millennium Seed Bank is assessed about one month after they are placed into the -20°C cold store; this establishes the 'initial viability' of the collection. Subsequently, collections are re-tested every fi ve or ten years depending on whether they are expected to be short- or long-lived. This assessment of viability is extremely important, since if a high proportion of a particular seed type does not germinate, it may be necessary to collect further samples or consider alternative methods of storage.
Essential Sterilisation
The Astell autoclave, an 'Autofi ll'* version of the 63 litre Compact Benchtop model, is used to sterilise the Tissue Culture Media and Agar that is required for the germination tests. This is essential, since the presence of certain micro- organisms in the media could affect the ability of the seeds to germinate. A container of seeds for testing is removed from the cold room
firstname.lastname@example.org and allowed to warm up for one day in the adjacent drying room. Seeds are sown into Petri dishes containing the sterilised agar and then incubated at an appropriate temperature, depending on the local climate, where the collection came from and the time of year that germination would probably occur in the wild.
Each week the seeds are checked, and germinated ones are removed, recorded and discarded. The tests are checked in a clean air cabinet, to minimise the risks of inhalation of fungal spores produced by any mould on the seeds.
A germination test is the most reliable way to measure seed viability. It also provides valuable information that can be used in the future to turn the seeds into plants for reintroduction, restoration or research.
Keith Manger, Laboratory Manager at the MSBP points out that "Approximately 20,000 germination tests are carried our every year at the MSBP, which of course means that the Astell autoclave is in constant use."
Protecting Biodiversity, Protecting the Environment
The other main application for the autoclave is the sterilisation of potentially hazardous material. "The collection of seeds from around the world could result in the introduction of invasive plants and plant pests," said Keith, "so the Millennium Seed Bank Partnership houses a quarantine facility licenced by FERA (Food and Environment Research Agency). This inevitably means that 'waste materials' often need to be sterilised in the autoclave before being incinerated and disposed of."
Autoclaves – the Unsung Heroes?
In conclusion, although autoclaves are 'utilitarian' in comparison with many high-precision instruments now regularly used in science, steam sterilisation still remains one of the most important and essential processes in the laboratory, and this is nowhere better illustrated than at the Millennium Seed Bank Partnership, where an autoclave makes a vital contribution to the invaluable work that is being carried out to conserve plant species throughout the world, and protect the environment.
(*Note: Astell's Compact 'Autofi ll' autoclaves, are innovative, self-contained units requiring no connection to a water supply or drain, just a domestic-type power socket)
For more information on Astell's full range of autoclaves, please visit www.astell.com
INTERNATIONAL LABMATE- JULY 2014 | 1,911 | 945 | {
"id": "<urn:uuid:a9eaf345-1534-429a-a3b3-7e952f706454>",
"dump": "CC-MAIN-2024-18",
"url": "https://www.labmate-online.com/article/laboratory-products/3/astell-scientific-ltd/banking-on-sterilisation/1663/download",
"date": "2024-04-17T12:33:41",
"file_path": "crawl-data/CC-MAIN-2024-18/segments/1712296817153.39/warc/CC-MAIN-20240417110701-20240417140701-00555.warc.gz",
"offset": 773828306,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9979158639907837,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9979158639907837,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
4635
],
"fw_edu_scores": [
2.03125
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
PRESENT PERFECT M I X E D
Make the Present Perfect (this exercise includes positive, negative, Yes/No and Wh-question form).
Example:
What you to your wife?(to say)
Answer:
What have you said to your wife?
1. She the bird house today.(to finish)
2. We the whole text yet.(not / to translate)
3. you ever to Rome?(to be)
4. Where you lately?(to be)
5. he the door?(to lock)
6. I from you for ages.(not / to hear)
7. Tom already from university.(to graduate)
8. the children the concert? (to prepare for)
9. What Kate for breakfast today?(to eat)
10. They an interesting program this week.(to watch)
11. He an ice-cream since August.(not / to eat)
* • • P A G E
1
O F
2
* • •
12. We the way.(to find)
13. How he all of his money? (to spend)
14. Jim and Jill the question right.
(to answer)
15. Rachel him since Friday.(not / to talk to)
16. you your mind?(to lose)
17. What your mother for your birthday?(to bake)
18. he ever to Niagara Falls? (to be)
19. They any answer yet.(not / to receive)
20. Where you this year?(to be)
* • • P A G E
2
O F
2
* • •
PRESENT PERFECT M I X E D
ANSWERS
1. has finished.
2. have not translated.
3. Have / been.
4. have / been.
5. has / locked.
6. have not heard.
7. has / graduated.
8. Have / prepared for.
9. has / eaten.
10. have watched.
11. has not eaten.
12. have found.
13. has / spent.
14. have answered.
15. has not talked to.
16. Have / lost.
17. has / baked.
18. Has / been.
19. have not received.
20. have / been. | 865 | 536 | {
"id": "<urn:uuid:c32f8ce0-0e9c-42a5-bfad-b33b5e2bb625>",
"dump": "CC-MAIN-2024-18",
"url": "https://www.engblocks.com/media/grammar/worksheets/pdf/black/tenses/present-perfect-mixed.pdf",
"date": "2024-04-17T12:33:38",
"file_path": "crawl-data/CC-MAIN-2024-18/segments/1712296817153.39/warc/CC-MAIN-20240417110701-20240417140701-00559.warc.gz",
"offset": 679564517,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9820960561434428,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9968304634094238,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
700,
1099,
1507
],
"fw_edu_scores": [
2.375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
And An Introduction to AP Capstone
AP Seminar: Teaching 21st Century Skills
* Collaboration and teamwork
* Leadership
* Creativity and imagination
* Critical thinking
* Problem solving
* Flexibility and adaptability
* Global and cultural awareness
* Information literacy
* Civic literacy and citizenship
* Oral and written communication skills
* Social responsibility and ethics
* Technology literacy
* Initiative
MIT Media Lab
AP Capstone Diploma Program
AP Capstone Diploma Program
AP Capstone Diploma Program
Requires students:
* Engage students in cross-curricular conversations
* Explore the complexities of academic and real-world topics
* Analyze divergent perspectives
* Utilize an inquiry framework
* Synthesize information from multiple sources
* Develop and communicate their own perspectives in writing and visually and orally, both as individuals and as part of a group
Course framework built around five big ideas:
* Question & Explore
* Understand & Analyze
* Evaluate Multiple Perspectives
* Synthesize Ideas
* Team, Transform & Transmit
Assessment Overview:
* Task 1 - Team Project and Presentation (20% of score)
- Individual Research Report, 1200 words (50% of 20%)
- Team Multimedia Presentation and Defense, 8-10 minutes plus defense questions (50% of 20%)
* Task 2 - Individual Research-Based Essay and Presentation (35% of score)
- Individual Written Argument, 2000 words (70% of 35%)
- Individual Multimedia Presentation, 6-8 minutes (20% of 35%)
- Oral Defense, two questions from teacher (10% of 35%)
Assessment Overview, continued:
* Task 3 - End-of Course Exam (45% of score)
- Part A - One source and students identify the author's argument, explain the line of reasoning, and evaluate the effectiveness of the evidence the author uses (30% of 45%)
- Part B - Four sources and students identify a theme or issue within them, present her/his own perspective on the theme or issue and incorporate at least two of the sources as supporting evidence (70% of 45%)
Plagiarism-
* A student who fails to acknowledge the source or author of any and all information or evidence taken from the work of someone else through citation, attribution, or reference in the body of the work, or through a bibliographic entry, will receive a score of 0 on that particular component of the AP Seminar and/or AP Research Performance Task. In AP Seminar, a team of students that fails to properly acknowledge sources or authors on the Team Multimedia Presentation will receive a group score of 0 for that component of the Team Project and Presentation.
* A student who incorporates falsified or fabricated information (e.g. evidence, data, sources, and/or authors) will receive a score of 0 on that particular component of the AP Seminar and/or AP Research Performance Task. In AP Seminar, a team of students that incorporates falsified or fabricated information in the Team Multimedia Presentation will receive a group score of 0 for that component of the Team Project and Presentation.
(This definition can be found on pg. 56 of the AP Seminar Course and Exam Description found on the College Board website)
Drop Period:
* First two weeks of school only
* Strict adherence to policy
AP Research
AP Research
Questions | 1,669 | 682 | {
"id": "<urn:uuid:d2240a10-5d10-4bfa-803e-6f58f25bf747>",
"dump": "CC-MAIN-2019-30",
"url": "https://www.esmonline.org/site/handlers/filedownload.ashx?moduleinstanceid=8451&dataid=15291&FileName=AP%20Seminar.pdf",
"date": "2019-07-19T09:57:18",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526210.32/warc/CC-MAIN-20190719095313-20190719121313-00443.warc.gz",
"offset": 664513994,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9205242054803031,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9819676876068115,
"per_page_languages": [
"unknown",
"eng_Latn",
"unknown",
"unknown",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"unknown",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
34,
430,
459,
488,
517,
890,
1063,
1538,
2001,
3133,
3210,
3223,
3236,
3247
],
"fw_edu_scores": [
2.328125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
NATURE SCIENCE LABS
Thursdays, September 12-December 12 (no class October 17 or November 28; 12 weeks)
9:30am-10:45am
Ages 6-8
Students explore the world around them as they investigate the biology and ecology of plants and animals, and the environment they inhabit. We study what mosses and lichens really are, look at the microhabitats of different bugs, dissect an owl pellet to see what they eat, use microscopes to see the tiny critters that live in a pond, and more! All lab costs are included in registration fee. Course enrollment is limited to 12 students.
Instructor: Tina Oresteen, BSc
Location: Science Center (suite 5)
Course fee: $220 OR $20/lab
10% off early registration discount through July 31
10% off sibling discount available beginning August 1
LAB SCHEDULE:
Mosses and Lichens – Thursday, September 12
We start the semester by investigating some of the smallest plants found in your backyard. Students use microscopes to investigate mosses and lichens (and find out that lichens are actually two organisms), and create their own living terrarium.
Science of Leaves – Thursday, September 19
Students use leaf rubbings to learn about the different species of trees, and create an art + science masterpiece. We also conduct a chromatography experiment to look at leaf pigments, and find out why green leaves turn yellow and orange in the fall.
Flower Dissection – Thursday, September 26
We learn to properly use dissection tools as we dissect and study the different parts of a flower, observe similarities and differences of different flower types, and discuss why different flowers have specific shapes.
Fruits and Seeds – Thursday, October 3
Why do plants produce fruits and seeds? What is inside a seed? What do seeds need to grow into a plant? How do seeds get to a good place to grow? This week we dissect fruits and seeds to investigate their characteristics, and help us answer questions about them.
Bugs have a terrible reputation, but insects and spiders are important to the ecosystem. We investigate a decomposing log to see how many kinds of invertebrates we can find, what part of the log they like to live in, and what makes them incredible.
Herpetology – Thursday, October 24
This week we study reptiles and amphibians that are found in our yards and parks. We learn how to identify them, study habitats they prefer, and investigate what it means to be native, non-native or invasive.
Ornithology – Thursday, October 31
Students collect scientific data and use citizen science to help scientists determine range and populations of native bird species. We learn how to identify birds, and study a bird food web as we dissect owl pellets.
Microscopic Critters – Thursday, November 7
In lab today, we investigate cool aquatic critters. We look for and identify microscopic protists and invertebrates in water samples from nearby water sources.
Water Quality Lab – Thursday, November 14
This week we learn about nutrient cycles in our waterways as we conduct water chemistry tests on water samples from local ponds.
Watersheds – Thursday, November 21
Students simulate the movement of water (and pollutants) across a landscape to the ocean using an Enviroscape model to study where our water goes, and what it takes with it along the way.
Soils and Rocks – Thursday, December 5
This week we study the different types of soils and rocks found in our backyard. We investigate soil as a habitat, and compare the absorbency of different soils, and discuss why it matters.
Weather and Climate – Thursday, December 12
Students investigate the difference between weather and climate through experiments using familiar household items, and analyzing the data from their research.
www.DiscoverScienceCenter.com | 1,547 | 809 | {
"id": "<urn:uuid:fdfe1501-2802-41ab-a9e1-02d74896b124>",
"dump": "CC-MAIN-2019-30",
"url": "https://nebula.wsimg.com/b8030b33e902597eac4363248ceb8fbc?AccessKeyId=2C4CE9916A50F0B07BF2&disposition=0&alloworigin=1",
"date": "2019-07-19T10:17:24",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526210.32/warc/CC-MAIN-20190719095313-20190719121313-00474.warc.gz",
"offset": 496944905,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9975049197673798,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9975411295890808,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1944,
3766
],
"fw_edu_scores": [
3.578125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Department of Renal Medicine
Dietary Advice for People with Kidney Disease
What do your kidneys do?
Your kidneys filter the blood, removing waste products and excess fluid. If your kidneys are not working well, waste products and fluid will build up in the body.
What you eat and drink affects your health, and you may be advised to make some changes to your diet and fluid intake.
Eating healthily
Eating a balanced diet may help you to manage health conditions, such as high blood pressure, diabetes or heart disease. Choose a variety of different foods, and include fruits and vegetables in your diet regularly.
Try to keep your weight within a healthy range. If you are overweight, losing weight and taking regular exercise can help to control your blood pressure.
Poor appetite
There may be times when you have a poor appetite, or food does not taste as good. This may affect the amount of food you are able to eat and you may start to lose weight. Please speak to your dietitian, who will be able to offer you help and advice.
Salt
Sodium Chloride is commonly known as salt. In the body, sodium helps to regulate fluid balance and blood pressure. Healthy kidneys filter sodium and too much sodium in the body is removed when you go to the toilet to pass urine.
Salt is found naturally at low levels in all foods. It is also added to processed foods, as well as extra salt being added by individuals at the table and in cooking. Reducing the amount of salt and salty foods you eat can also help to control your blood pressure.
If you have heart or kidney failure and have been advised to reduce your fluid intake by your doctor, following a low salt diet will help (salt makes you thirsty).
Potassium
Potassium helps to regulate muscle contraction, nerve signals and fluid balance. Potassium is a mineral found in many foods.
Healthy kidneys will control the level of potassium in the blood and remove it from your body when you go to the toilet to pass urine. If your kidneys are not working well, the potassium level in your blood may rise.
Too much or too little potassium in the blood can lead to an irregular heartbeat and muscle weakness. Only follow a low potassium diet if you have been advised to do so by your doctor or dietitian.
Phosphate
In the body, phosphate combines with calcium to form the hard structure of bones and teeth. Your body gets phosphate (a mineral) from a number of different foods. Healthy kidneys will control the level of phosphate in your blood. If your kidneys are not working well, the phosphate level in your blood may rise.
High levels of phosphate may cause:
- Weak, brittle bones and aching joints
- Itchy skin and eyes
- Damage to your heart and blood vessels, increasing the risk of heart disease and stroke
The dietitian may advise you to reduce the amount of phosphate you eat to help control the phosphate level in the blood. You may also be prescribed a tablet to take with food. This tablet is called a phosphate binder, which helps to remove excess phosphate from the food you eat.
Fluid
Our bodies contain a large amount of water which is essential for life. It helps to maintain our blood pressure and the functions of the body. Too much fluid in your body will affect your blood pressure. It may cause puffy eyes, headaches and swelling of your feet, ankles and legs. Fluid may also build up around your lungs making it difficult to breathe.
You may be advised by your doctor or dietitian to limit your fluid intake. This will depend upon your health condition; if you need dialysis, the type and frequency, and the amount of urine you pass.
If you are diabetic, good blood glucose control will help you to control your fluid intake (high sugar levels will make you thirsty).
Diabetes
Good diabetic control will help to reduce the risk of developing diabetic complications. If you have diabetes, you should continue to have your diabetes reviewed annually by your GP or diabetes specialist doctor. You should also continue to have your eyes and feet checked on a regular basis. | 1,625 | 847 | {
"id": "<urn:uuid:67deb4e4-b2cb-4d0b-b226-fdec1ef67627>",
"dump": "CC-MAIN-2019-30",
"url": "http://www.enherts-tr.nhs.uk/patient-information/download/3600/",
"date": "2019-07-19T09:56:05",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526210.32/warc/CC-MAIN-20190719095313-20190719121313-00478.warc.gz",
"offset": 201878469,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9990181028842926,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9990434646606445,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1854,
4085
],
"fw_edu_scores": [
2.796875
],
"minhash_cluster_size": 2,
"duplicate_count": 1
} |
The Priory Belvoir Academy: Curriculum Overview
"Opportunity and Achievement for All"
| MUSIC | CURRICULUM LEADER | MISS JACKSON | YEAR |
|---|---|---|---|
- Students learn about note lengths and rhythm
- Students learn how to perform a melodic riff using staff notation
- Students learn how to play the chords with a melodic riff
- Students learn how to perform a melody and chords with a beat on a keyboard
- Students learn how to add harmony to a melody
- Students learn how to compose and perform their own melodic riff
Baseline Test
The purpose of the Baseline Test is to assess a student's current level and to measure progress
- Students complete listening tasks to assess their aural awareness and understanding of the key words covered in project 1
- Students complete listening tasks to assess their aural awareness of pitch and rhythm
- Students complete practical tasks to assess their performance and composition capabilities
Project 2: Bridging Project
In this project students revise what they already know and can do in Music and will start to develop their skills
- Students listen to an example of Egyptian dance music identifying key features and revising their knowledge and awareness of the following key words:
- Steady beat, strong beat, metre, ostinato, tempo and timbre,
- Students learn how to perform an ostinato
- Students revise how to perform with a beat on a keyboard
- Students revise how to perform with a chosen timbre on a keyboard
- Students revise and develop their knowledge and understanding of note values and notation
- Students complete performance and composition tasks using school instruments and their own instruments if they wish.
Project 3: Instruments Of The Orchestra
- Students listen to pieces of orchestral music, including 'Peter And The Wolf', identifying the different instruments
- Students learn about the instruments of the 4 sections of the orchestra
- Students learn about where the different sections of the orchestra are positioned when performing
Project 4: Performance Project
- Students work on a performance piece of their choice which matches and stretches their current ability
- Students complete a performance log throughout the project outlining their progress each lesson and next steps to be worked on the following lesson
- Students aim to develop their confidence as a performer
- Students aim to develop their music reading skills
- Students aim to perform a new piece of music confidently, accurately and fluently
- Students perform at various stages in the project and are teacher assessed at the end of the project
Project 5: TV Theme Tunes Project
- Students listen to various TV theme tunes identifying and analysing the following musical features: Melody, chords, tempo, dynamics, timbre, hook, riff, and how the TV theme tunes reflect their contexts
- Students learn to play TV theme tunes working on a range of tasks: Melody on its own, melody and chords together, melody and chords together with a beat, melody and chords together with a beat and a backing, melody and left hand drone together, melody and left hand drone together with a beat, melody and left hand drone together with a beat and a backing
- Students learn about melodic composition skills
- Students compose their own TV theme tunes | 1,414 | 677 | {
"id": "<urn:uuid:fcfc81dc-7fb7-480e-88ac-5418081ce231>",
"dump": "CC-MAIN-2020-16",
"url": "https://www.belvoiracademy.co.uk/attachments/download.asp?file=83&type=pdf",
"date": "2020-04-04T21:12:53",
"file_path": "crawl-data/CC-MAIN-2020-16/segments/1585370525223.55/warc/CC-MAIN-20200404200523-20200404230523-00468.warc.gz",
"offset": 806747304,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9622940023740133,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9949049353599548,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
157,
1688,
3304
],
"fw_edu_scores": [
4.25
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
MINI-MED SCHOOL
Tuesdays, September 10-December 10 (no class October 15, or November 5 or 26; 11 weeks)
11:00am-12:15pm
Ages 6-8
Students learn about the tools doctors use, study how our bodies work, use microscopes to see what difference cells look like, and investigate real hearts, kidneys and brains. All lab costs are included in registration fee. Course enrollment is limited to 12 students.
Instructor: Katie Sheffield, BSc
Location: Science Center (suite 5)
Course fee: $200 OR $20/lab
10% off early registration discount through July 31
10% off sibling discount available beginning August 1
LAB SCHEDULE:
Microscopy and Cells – Tuesday, September 10
This week, we learn how to properly use a microscope, study basic cell structure, and compare the cells of different tissues throughout the body.
Musculoskeletal System – Tuesday, September 17
We study bones and muscles this week by examining x-rays, learning the names of some bones in our skeleton, and dissecting chicken wings to investigate how tendons connect muscle to bone.
Nervous System – Tuesday, September 24
Students have the chance to investigate a mammalian brain to learn the parts of the nervous system. We also learn about our senses and what part of the brain is responsible for interpreting the world around us.
Blood and Blood Types – Tuesday, October 1
In this lab, we study what makes up our blood, look at blood cells under a microscope, and test synthetic blood to see how blood types are characterized.
Circulatory System – Tuesday, October 8
Students investigate how blood moves through the body as they study a real mammalian heart, and look at heart tissue and blood vessels under a microscope.
Respiratory System – Tuesday, October 22
Learn how and why we breathe, study the organs that make up our respiratory system, and create a model of our trachea, lungs and diaphragm.
Digestive System – Tuesday, October 29
In this fun, gross lab, we discuss the function of the digestive system, learn the organs involved in the digestion process, and make a model of our digestive system to see how it works.
Urinary System – Tuesday, November 12
Students investigate a mammalian kidney in this lab to learn how the body removes excess water and liquid waste through the urinary system.
Immune System and Germs – Tuesday, November 19
We study germs and the immune system in lab this week. Students test their handwashing skills, investigate bacteria under a microscope, conduct a bacterial growth study, and learn how our body fights off germs.
Genetics and DNA – Tuesday, December 3
This week we investigate our genetic code. Students learn what DNA is and where it is located in a cell, build a model of DNA and extract DNA from strawberries.
Jello Surgery – Tuesday, December 10
Students test their skills at surgically removing foreign objects embedded in their jello "patient" without scarring them.
www.DiscoverScienceCenter.com | 1,325 | 647 | {
"id": "<urn:uuid:ab465604-4531-4786-8266-0e2e24a4a336>",
"dump": "CC-MAIN-2019-30",
"url": "https://nebula.wsimg.com/8bffa6b7d2c98a25bceacc61265edef8?AccessKeyId=2C4CE9916A50F0B07BF2&disposition=0&alloworigin=1",
"date": "2019-07-19T10:15:14",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526210.32/warc/CC-MAIN-20190719095313-20190719121313-00497.warc.gz",
"offset": 477692570,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9957858622074127,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9959795475006104,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1701,
2948
],
"fw_edu_scores": [
2.96875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
1. There __________ some horror movies __________ Vizkaya theater ________
Sunday. They start __________ 6:45pm.
* are, at, on, at
* is, on, at, on
* are, on, the, to the
* is, on, the to the
2. A: Have You seen my wallet?
B: I put it _________ the table.
* on
* in
* at
3. Allen and Dorothy’s mother is at the door. __________ mother is not happy.
* Her
* Theirs
* Hers
* Their
4. Where’s Peter going?
* He usually exercises on Friday morning.
* He’s going to the cinema
* He goes to school by bus.
* Yes, he is.
5. 60 (number)
* sixtieth
* sixteenth
* sixteen
* sixty
6. He talks to Bonnie. ________ voice is very loud.
* He
* Her
* His
* Its
7. Kentham _______ an old town. ___________ _________ old buildings.
* aren’t, there aren’t, some
* aren’t, there isn’t, any
* isn’t, there aren’t, any
* isn’t, there isn’t, some
8. How was John’s trip to Mexico?
* I do not know but it’s a good idea.
* Yes, when pigs fly.
* It was great, he has no words to describe it.
* He’s awesome.
9. Judy: How long (be) ___________ in Canada?
Claude: I (study) ____________ here for more than three years.
* were you / have been studying
* drives, their
* is being / have been studying
* have you been / have been studying
10. Sophia has an album. ___________ name is Greatest Disco Hits 77.
* Hers
* She
* Her
* Its
11. She _________ twenty-seven years old.
* am not
* is not
* are not
12. Make a question with these words "is / at home / your mother"
* Is at home your mother?
* Is your mother at home?
* Your mother is at home?
13. ________ there ______ shopping malls around here?
* is, any
* are, any
* are, some
14. She ________ _________ to the gym with _________ husband.
* went, usually, her
* usually, went, his
* usually, went, her
15. A: ___________ you think it's a good idea?
B: Yes, it is.
* Did
* Have
* Is
* Do
16. Alicia, ________ the windows please. It's too hot in here.
* opens
* will opened
* opened
* open
17. I'm sorry, I can't hear what you (say) __________ because everybody (talk)
_________ so loud.
* say, is talking
* is saying, talks
* are saying, is talking
* are saying, are talking
18. Every Monday, Sally __________ ___________ kids to football practice.
* drive, its
* drive, her
* drives, her
19. She (play) ____________ soccer for 2 hours yesterday, when her mom (come) ________ home.
* is playing, came
* played, was coming
* was playing, came
* was playing, comed
20. Make a correct sentence with these words "the / is / what / train? / next / time
* The next time is what train?
* What train is the next time?
* What time is the next train? | 1,432 | 780 | {
"id": "<urn:uuid:0ac37ceb-9cb4-4a53-b97a-4208f3d54e76>",
"dump": "CC-MAIN-2020-16",
"url": "https://www.mostzs15.cz/storage/document/?id=1118",
"date": "2020-04-04T20:14:27",
"file_path": "crawl-data/CC-MAIN-2020-16/segments/1585370525223.55/warc/CC-MAIN-20200404200523-20200404230523-00473.warc.gz",
"offset": 1017293550,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9993203481038412,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9995200634002686,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1133,
2260,
2665
],
"fw_edu_scores": [
2.65625
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
Autism Advisory and Intervention Service
Education Restart
Let us talk about… Going Back To School
I am going back to school
Schools have been closed for a long time.
I have had success staying at home.
The Government have said it is now safe to go back to school. This is good.
I will get to see my class again.
Some things will be the same and some things will be different. This is ok.
I am happy when I get to learn and have fun at school.
Changes
Some things always stay the same. I always get up in the morning. I always go to bed at night.
Sometimes little things change. They are just little things. Then they are over and the day keeps going. I feel fine.
Changes happen everywhere. Changes can happen at home.
Changes can happen at school. Change is normal.
People can change their mind too. This means a person had an idea and now they have a different one.
Sometimes I change my mind because I have a new idea or I want to do something else. For example when I don't want to watch the news on TV, I can change the channel to watch something else instead.
Before school closed I was in ___ and ___________ was my teacher. When I go back to school, I will be in ______ and ________________ will be my new teacher. This is okay.
Sometimes I get worried because there is a change. This is okay.
If a change worries me I can talk to my family or my teacher.
Change is normal. I will try hard to stay calm when things change.
There is always a reason for change and sometimes it means that something fun is going to happen!
The Same versus Change
When I go back to school, some things will stay the same and some things will change.
Circle the things that will be the same in blue.
Circle the things that will change in green.
Where I line up
Washing hands regularly
Break time
Nervous about Going Back to School
I have been off school for a long time, everyone else has been off school too. Soon I will be going back to school.
My new teacher is called __________________________. I will be in ________.
My friends will be in my class. I will have a new classroom.
When I think about going back to school, I feel nervous and excited. My friends feels
nervous and excited. My teacher also feels nervous and excited. It's okay to feel nervous and excited about going back to school.
I can talk to my family if I feel nervous and they will help me. I can talk to my teacher if I am nervous and he/she will help me. I will try to listen to what my teacher says and I will be less nervous.
My family and my teacher will help me to settle back into school.
Getting to know your new teacher
| | Me | My new teacher |
|---|---|---|
| My favourite colour is | | |
| My favourite animal is | | |
| My favourite food is | | |
| My favourite film is | | |
| My favourite place is | | | | 1,044 | 675 | {
"id": "<urn:uuid:b908494f-c670-4b25-b681-2054da3494a0>",
"dump": "CC-MAIN-2021-04",
"url": "https://www.eani.org.uk/sites/default/files/2020-08/Education%20Restart%20Social%20Stories%20%26%20Activity_0.pdf",
"date": "2021-01-22T05:55:54",
"file_path": "crawl-data/CC-MAIN-2021-04/segments/1610703529128.47/warc/CC-MAIN-20210122051338-20210122081338-00023.warc.gz",
"offset": 759665781,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9532142162322998,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9998018145561218,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
100,
453,
1563,
1824,
2611,
2847
],
"fw_edu_scores": [
3.1875
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
This article is distributed by NASA Night Sky Network
The Night Sky Network program supports astronomy clubs across the USA dedicated to astronomy outreach. Visit nightsky.jpl.nasa.gov to find local clubs, events, and more!
Visitors to Both Jupiter and Saturn
David Prosper
Have you observed Jupiter and Saturn moving closer to each other over the past few months? On December 21, the two worlds will be at their closest, around 1/5 of a full Moon apart! While the two gas giants may appear close, in reality they are hundreds of millions of miles apart. Despite this vast distance, a select few missions have visited both worlds by using a gravity assist from giant Jupiter to slingshot them towards Saturn, saving time and fuel.
Pioneer 11 was the first mission to visit both worlds! Launched in 1973, the probe flew past Jupiter in late 1974, passing just 26,400 miles above its stormy clouds. In 1979, it became the first spacecraft to encounter Saturn. Pioneer 11 took the first up-close photos of Saturn and its satellites, and made many exciting discoveries, including the detections of its magnetic field and a faint "F" ring, before departing Saturn and eventually, the solar system.
The Voyager missions quickly followed up, taking a "Grand Tour" of the four largest and most distant planets in our solar system. Both probes were launched within two weeks of each other in 1977. Voyager 1 flew past Jupiter in March 1979, discovering Jupiter's faint ring and two new moons, along with active volcanoes on Io's surface! The probe then flew past Saturn in November 1980, discovering five new moons, a new "G" ring, mysterious ring "spokes," and "shepherd moons" shaping the rings. After a brief encounter with Titan revealed evidence of complex organic chemistry and liquid on the moon's frigid surface, Voyager 1 was flung out of the plane of the solar system. Following close behind, Voyager 2 took detailed photos of Jupiter's moons and cloud tops in July 1979. Flying past Saturn in August 1981, Voyager 2 measured the thickness of Saturn's rings and took detailed photos of many of its moons. This second explorer then captured images of Uranus and Neptune before leaving our solar system.
Cassini-Huygens was the last mission to visit both worlds. Launched in 1997, the mission flew past Jupiter in late 2000 and took incredibly detailed photos of its stormy atmosphere and faint rings. Cassini entered into Saturn's orbit on July 1, 2004. The Huygens probe separated from Cassini, landing on Titan to become the first probe in the outer solar system. Cassini discovered geysers on Enceladus, fine details in Saturn's rings, many more moons and "moonlets," the changing oceans of Titan, and seasonal changes on Saturn itself. After revolutionizing our understanding of the Saturnian system, Cassini's mission ended with a fiery plunge into its atmosphere on September 15, 2017.
What's next for the exploration of the outer worlds of our solar system? While Juno is currently in orbit around Jupiter, there are more missions in development to study the moons of Jupiter and Saturn. Discover more about future NASA missions to the outer worlds of our solar system at nasa.gov. | 1,343 | 690 | {
"id": "<urn:uuid:016fdd1c-a471-4677-a875-f393f1a2f28b>",
"dump": "CC-MAIN-2021-04",
"url": "https://nightsky.jpl.nasa.gov/docs/NightSkyNotesDecember2020.pdf",
"date": "2021-01-22T07:32:52",
"file_path": "crawl-data/CC-MAIN-2021-04/segments/1610703529128.47/warc/CC-MAIN-20210122051338-20210122081338-00026.warc.gz",
"offset": 467075774,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9987891316413879,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9987891316413879,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3196
],
"fw_edu_scores": [
3.3125
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
Factsheet for Patients/Family
What is VRE?
What about family and visitors?
VRE stands for Vancomycin-resistant entercoccus. Most people have enterococcus in their bowel and it does not harm. When a person has VRE it means an infection caused by these bacteria would be harder to treat.
What is VRE Colonization?
If you have VRE in your bowel and it is not causing an infection you are colonized. Although you are not sick because of this bacteria you could pass it on to someone else and make them sick.
What is VRE infection?
In people with a poor immune system VRE may cause a urinary tract infection or a blood stream infection.
How do I know if I have VRE?
Individuals who have had frequent admissions to the hospital are at a higher risk for VRE. If you have been in the hospital for more than 12 hours in the last 12 months we will take a swab. The lab reports if any VRE grew on the swab.
How is VRE spread?
When a person has VRE the bacteria from their bowels can contaminate surfaces such as toilets, bed rails, and commode chairs. When touching these items our hands become contaminated. If we touch our mouth without washing our hands we can become colonized or infected. This is why we must use additional precautions.
What are additional precautions?
It is very important to contain the bacteria so it does not spread to others. We do this by:
Isolating VRE patients and putting a "Contact + Precautions" sign on the door.
Wearing a yellow long sleeved gown and gloves when entering the room to care for the patient.
Washing our hands before entering the room and after leaving the room.
Family and visitors must first talk with a nurse before coming into the room. Young visitors should be closely supervised.
All visitors must wash hands before entering the room. After leaving the room visitors must first wash hands with available waterless hand rub and then immediately visit the public bathroom to wash with soap and water.
Any visitors providing direct care for the patient (bathing, washing, toileting, dressing changes, care for open areas, and feeding) must wear a yellow long sleeved gown and gloves.
Visitors must not use the patient's bathroom.
Visitors must not visit other patients in the hospital during the same trip. This helps to ensure we do not spread the bacteria.
What can I do to help?
Remind all staff caring for you to wash their hands when the enter your room and when they leave.
If you are going for tests in another department tell staff transporting you that you have VRE.
Wash your hands after you use the toilet, before you eat, after blowing your nose, after touching your dressing.
Talk to your nurse or doctor if you have any questions.
What should I do at home?
Healthy people like your family and friends are at a low risk of getting VRE.
Wash your hands often, especially after using the bathroom and before preparing or eating food.
Pay special attention to areas that may be contaminated with feces. Use an all purpose household cleaner and follow the label.
Anyone who helps you with your personal hygiene or toileting should wash their hands after contact with you | 1,195 | 683 | {
"id": "<urn:uuid:a80dc70a-2c37-4964-a770-5b22198f5adb>",
"dump": "CC-MAIN-2021-04",
"url": "http://www.ngh.on.ca/images/hospital/accountability/infection-control/vre_fact_sheet.pdf",
"date": "2021-01-22T06:11:43",
"file_path": "crawl-data/CC-MAIN-2021-04/segments/1610703529128.47/warc/CC-MAIN-20210122051338-20210122081338-00029.warc.gz",
"offset": 147097707,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9991224408149719,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991224408149719,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3176
],
"fw_edu_scores": [
2.671875
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Year 6 Weekly update:21 st September
Messages: Your child will have received their new reading levels and this has been recorded in their Reading Diaries. Please check that your child is reading every evening and that they are reading books from within their level. A word of caution. Children using social media have found themselves in a great deal of trouble for things they posted at home and subsequent events. It is illegal for 10 or 11 year-olds to use Whatsapp, Tik Tok, Snap Chat etc. Children using smartphones should be closely monitored for what they send and receive. If your child has to bring one in to school, remind them that it has to be handed in at the office each morning.
Maths:
Spellings:
In maths this week we are learning all about rounding. Children will firstly be taught how to round to the nearest 10, 100 and 1000 before learning to round to ANY number.
They will learn two methods of rounding (5 or above, give it a shove and 4 or below, let it go)
While this is the quicker method, children will also be taught to round using a number line as this will be required when they solve rounding problems.
They will also be ordering and comparing numbers and learn the language and maths symbols associated with this area of maths.
English:
The children will continue to start their day with a 'Reading For Pleasure' session in school to promote reading for enjoyment and to provide additional reading opportunities so children can close gaps created by a lengthy period spent away from school. Children should bring in their signed reading diaries every day as these will be closely monitored by the teacher. This week the children will start reading 'The boy in the Striped Pajamas' in their reading lessons. We will also be using the book as a stimulus for writing in our English lessons. Please ask your children to tell you what they enjoy about this book when they get home.
This week, we have ten words with the focus: Words ending in –ant, –ance/– ancy hesitant
hesitation substance
substantial observant
observation tolerant
tolerance expectant
expectation
Topic:
This term's topic we are going to focus on rivers. Please look at some famous bridges with your child at home and help them to research the following question: Why was the Thames important to the development of London?
Science:
This term the children will be learning about electricity. Please talk to your child at home about: why is electricity important and how does it make our everyday life easier?
Compulsory Homework for Year 6: The following activities are compulsory and must be completed each week.
- Times tables practice 3 times a week.
- Spelling Practice 3 times a week.
- Reading to an adult every day for 30 minutes (Reading diary must be signed for every day.)
Optional Homework:
- Doodle Homework | 1,103 | 589 | {
"id": "<urn:uuid:0cdb78fa-4bc7-4e6d-952b-02858efacbac>",
"dump": "CC-MAIN-2021-04",
"url": "https://www.duncombeprimary.co.uk/sites/default/files/media/documents/Year%206%20Week%203.pdf",
"date": "2021-01-22T07:16:45",
"file_path": "crawl-data/CC-MAIN-2021-04/segments/1610703529128.47/warc/CC-MAIN-20210122051338-20210122081338-00031.warc.gz",
"offset": 755766557,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9991286396980286,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991286396980286,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2838
],
"fw_edu_scores": [
2.328125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
My New Hampshire Plate - Meet just a few of the thousands of local farmers who fill your plate!
GRAIN
Whole grains are best!
Londonderry, NH
Combined with vegetables, fruit should be half of your plate
A family run farm since 1943, it is one of the last agricultural community in New England by serving a large local community
Grains are an important part of your daily diet as they provide a variety of nutrients such as fiber, B vitamins, and iron. Food made from wheat, rice, oats, barley and other cereal grains are part of the grain food group. Breads, pasta, cereal, popcorn, rice and torillas are great ways to enjoy the benefits of grain. Grains grow best in warm temperatures
(70° to 75°) with lots of sunshine and low humidity. That doesn't align with the climate in New Hampshire. A small amount of grain is grown in the state, but it is primarily used for animal feed. Much of the world's grain
four standing apple orchards in Londonderry. Through the years, the Hicks family has developed Sunnycrest into a strong contributor to the following while distributing products to a number of grocery stores around the state. In June, they kick off the year with pick your own strawberries. As strawberries go out of season in July, the blueberries, cherries, and raspberries flare up in patriotic color just in time for the 4 th of July. As summer fades, fall harvests bring a new set of crops. In August, there is a second season of raspberries, September begins apple season and pumpkins round out the year in October .
supply comes from the American Midwest, also known as the "grain belt". Kansas and North Dakota produce the most wheat, Arkansas leads the way in rice production, South Dakota is tops in growing oats and Idaho produces the most barley in the United States. Plenty of grain is grown to fill our plates with the majority of these crops being used for animal feed.
Contocook Creamery Contoocook, NH
VEGETABLES
Moulton Farms Meredith, NH
Combined with vegetables, fruit should be half of your plate
Moulton Farm was started by family members back in the 1890's as a cattle farm. After operating as a dairy farm for awhile, the current owner, John Moulton, has transitioned to producing primarily vegetables. What started as John's small farm stand, has now expanded so that the farm market and the farm kitchen are now open nine months a year.
Many different vegetables are now raised ranging from asparagus to zucchini. They are grown not only on 65 acres of land, but also in the greenhouses and the hydroponic house. This expands the growing season so that fresh vegetables are available in the early spring and late fall. In addition to vegetables, herbs and some fruits are also grown, including strawberries and melons. In 2000, a commercial kitchen was added to the farm market. Today pies, breads, and cookies are baked fresh daily, plus 2 farm chefs create soups, salads, and prepared meals utilizing as much farm produce as possible. Sustainable farming methods are used to preserve the rich soil for the future.
PROTEIN
CJEJ Farm Columbia, NH
An essential building block of growth
CJEJ Farm is a family affair. Chris Brady grew up on a dairy farm while Joyce grew up in a large family that raised everything they could to feed the family. Coming together, CJEJ Farm was established in 2000 and currently consists of about 50 beef cattle (mostly Herefords), 5 pig sows (Yorkshire, Landrace and Duroc), 20 feeder and market hogs, 100 laying hens, 100 turkeys (White Broad Breasted) and 600 broilers (Cornish Rock Cross). In 2015, a farm store was
added to CJEJ Farm named The MeatHouse. Here you can purchase CJEJ Farm's own eggs, beef, pork, chicken and turkey. Offering fresh local meat helps to grow the local movement and adds to peoples' desire for more locally produced food.
DAIRY
Three servings of dairy a day for strong bones and teeth!
The Bohanan family farm got its start in 1907. In 1990, Lester Bohanan's granddaughter, Heather Robertson, took over the farm with her
family. The farm has seen many changes, but one of the biggest came about in 2009 when the wholesale milk price crashed. In order to keep the farm alive, they launched Contoocook Creamery. Today, they make and sell their products themselves rather than just through a large company. Contoocook Creamery makes cheese, butter, and glassbottled milk made exclusively from their own cows. Their cows are kept happy and healthy with regular visits from their veterinarian and nutritionist. The farm is now more than 440 acres of land and is home to 200 milk cows, producing more than 23,000 eight-ounce servings of milk every day. You can see the farm in action on the History Channel's The American Farm , a series which tells the stories of family farms across the country. | 1,967 | 1,094 | {
"id": "<urn:uuid:6d67f70b-ddde-4a22-8d34-c082f1612f80>",
"dump": "CC-MAIN-2021-04",
"url": "https://files.constantcontact.com/a28c4b5b001/e986d888-5f8f-47c1-b58b-9976972eade3.pdf",
"date": "2021-01-22T07:37:21",
"file_path": "crawl-data/CC-MAIN-2021-04/segments/1610703529128.47/warc/CC-MAIN-20210122051338-20210122081338-00028.warc.gz",
"offset": 332098085,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9990411996841431,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9990411996841431,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
4827
],
"fw_edu_scores": [
2.625
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
STORY NAME:
Being 20: The dream of becoming a ballet dancer
| COPYRIGHT HOLDER: | | |
|---|---|---|
| COPYRIGHT NOTICE: | | |
| USAGE TERMS: | | |
| EDITOR’S NOTES: | | |
| SOURCE: | | |
| LANGUAGE: | Arabic | DURATION: |
| JOURNALIST: | Bilal Brahmia | EMAIL: |
| SLUGLINE: | | |
| HEADLINE: | | |
| DATELINE: | | |
| SCRIPT: | | |
Massi in the dances he performs as well as the songs he chooses to dance on.
| SHOTLIST: | Pan shot of Massi walking on foot on one of the famous high bridges of Constantine. Pan shot of Massi heading to the place where he practices ballet dancing. Mid shot of Massi, ballet dancer, speaking. Pan shot of Massi performing different ballet dancing steps along with his coach. Mid shot of Massi, ballet dancer, speaking. Pan shot of Massi following his coach’s instructions. Pan shot of Massi walking with his coach who speaks about his interests in the field of ballet dance thanks to Massi. Pan shot of Massi greeting friends. Mid shot of Massi, ballet dancer, speaking. Pan shot of Massi walking on one of the famous high bridges of the eastern Algerian province, Constantine taking photos of natural landscapes. |
|---|---|
| SCRIPT: (Original language) | ،راهشإو تلااصتا ةلاكوب ريدمك لمعأ ،رئازجلاب ةنيطنسق ةيلوا نم ةنس 20 ليسام 00:00:35 ---- 00:00:05 .ةنيطنسق يف انه هيلابلاب فرعي ام وأ يكيسلكالا صقرلا نف يف واه نانفو راذمأ اذمئاد تذنك ، نذفلا اذذه قشعأ انأو تاونس ينامث يرمع ناك ذمو ، ةنس 15 يرمع يف ناك امل نفلا اذه تأدب .تيبلا يف صقرلا هسبلن يذلا هسفن وهو ، هيلابلا ابلبو صقرلا ىلع ةارملا عيجشت متي هنأ تاقرافملا نم 00:01:00 ---- 00:00:47 مارحو اصقار نوكي نأ هنكمي ل الجرلا ناو تاداقتنلاا نحن انل هجوت اميف ،لاجرلا نحن راسيلا ىلا بهذا ... ليمج ... اديور اديور ... قلطنا .. بوت 00:01:13----00:01:00 يسام صقارلا بردمو قيدص قيفر توص 24 :00:01 ---00:01:13 لك يف شقانتن ، هب علطا ا ىلعو لاجملا اذهب ضايا انا متها ينلعج امم ) رصاعملا صقرلا ( لاجملا اذهب علوم يسام صقرلل هراتخي يذلا ءانغلا يف اذكو تاصقرلا يف يسام اهب موقي يتلا تاكرحلا ىلع ةرم 00:01:37 ---00:01:26 يسام توص صقرذذلا يذذف اذذ يأ صتذذختو هذذيلاب ةذذقرف نوذذكت نا عذذلطتاو ةنيطنذذسق لوتذذسم ىذذلع يلاذذب ةذذقرف ليكذذشت ددذذصب اذذنا نلاا يفارغيروكلا يرولكلفلا |
| CAMERA OPERATOR: | Halim Hamdaoui |
| VIDEO EDITOR: | Halim Hamdaoui / Toufik Amri | | 1,149 | 905 | {
"id": "<urn:uuid:f2391a0f-e799-41cc-8807-8360334270af>",
"dump": "CC-MAIN-2021-49",
"url": "https://openmediahub.com/wp-content/uploads/2018/10/395-Being-20-Dzair-News-A-ballet-dancer.pdf",
"date": "2021-12-07T02:15:48",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00572.warc.gz",
"offset": 495022967,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9742609262466431,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9904854893684387,
"per_page_languages": [
"unknown",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
352,
2266
],
"fw_edu_scores": [
2.046875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Answer Keys
Selecting Cereal
Bran, endosperm, germ
Doodle Bugs Circle:
SCIENTIFIC INQUIRY: Label Logic
Box:
Look for cereals with more fiber, less sugar and whole grain ingredi-
ents.
Select one: Whole wheat
Note: Answers based on Nutrition Facts labels will vary depending upon the brands used. Chex ® : 160 calories; 5 grams fiber; 5 grams sugar; yes Cheerios ® : 100 calories; 3 grams fiber; 1 gram sugar; yes
Circle:
Frosted Shredded Wheat ® :
: 190 calories; 6 grams fiber; 11 grams sugar; yes
Frosted Flakes ® Froot Loops ® :
110 calories; 1 gram fiber; 11 grams sugar; no
120 calories; 1 gram fiber; 13 grams sugar; no
Star: Frosted Shredded Wheat ®
Cheerios ®
1. Frosted Shredded Wheat ® , Chex ® , Cheerios ® , Frosted Flakes ® and Froot Loops ®
3. Answers may vary: Examples: 5 grams of sugar and it has 5 grams of fiber (low in sugar and high in fiber). It also has whole grain ingredients. Or I think Cheerios ® is the healthiest because it is the lowest in sugar, it contains whole grains, and it has a moderate amount of fiber.
2. Froot Loops ® , Frosted Flakes ® and Frosted Shredded Wheat ® , Chex ® , Cheerios ® I think Wheat Chex ® is the healthiest because it only has
4. Answers will vary. Example: I like Frosted Shredded Wheat ® because it is sweet.
Rice Review
5. Answers will vary. Example: I think it is moderately healthy. It has whole grains and lots of fiber, but it also has a lot of sugar.
Doodle Bugs Circle:
Rice, wheat bread, beans, corn, yams Bran, endosperm, germ removed.
Box:
Underline: Nutrients and fiber are taken away when the bran and germ are
SCIENTIFIC INQUIRY:
Brown rice:
Nice Rice
What happened to the water when you cooked the rice? It disappeared because it was absorbed into the rice.
2 cups rice; 1 3/4 cups water; 5 minutes; 5 minutes 172 grams; light brown, small, oblong, dry, hard and crunchy; small piece of rice 425 grams; light brown, bigger, oblong, moist, soft
Uncooked Brown Rice:
Cooked Brown Rice:
and fluffy; larger piece of rice
Do you think one piece of uncooked or cooked rice weights more? Cooked Rice Why do you think it weights more? Cooked rice weighs more because it soaked up water. The water made the rice bigger and added to the weight of the rice.
Answer Keys (continued)
Main Grain
Tasting time: Answers will vary.
WHILE YOU WAIT:
1. Bran brown - Outer layer; Endosperm orange - Large inner area; Germ yellow Small inner area
b. Yes, I think it is a staple food because people in china eat a lot of rice! a. 4 million tons
2. Only the endosperm should be drawn. 3. China a. 128 million tons
4. United States of America
Pasta Perfection
b. No, because many Americans don't eat a lot of rice.
Doodle Bugs Circle:
SCIENTIFIC INQUIRY:
Spaghetti, Macaroni, Rotelle, Farfalle, Ravioli Answers will vary. Example: Farfalle because it looks like a bow
Fill-in the blank:
tie.
Box:
Flour and water
Underline:
Whole wheat pasta is healthier because it has more fiber, vitamins and minerals.
Cooking Pasta
Whole wheat past cooking time:
Regular pasta:
Yellow, long, thin circular strand; Great, mild flavor
Whole wheat pasta:
Tan, long, very skinny, circular, strand; Good, tastes more nutty and chewy
Regular pasta cooking time:
12 minutes
WHILE YOU WAIT:
1. $0.20 2. $0.30
Brainy Grains
Regular pasta:
$0.98; 1/2 cup; 7 servings; 210 Calories; 2 grams fiber
Whole wheat pasta: 1. $0.14
$1.96; 1/2 cup; 7 servings; 180 Calories; 6 grams fiber
2.
$0.28
3. $0.14
4. 20 noodles 5a. 12.5 servings
b. 4 servings
Challenge: Whole wheat: 6 1/4 cups Regular Pasta: 2 cups
Proficiency Questions (Virtual CD) 1. c 2. a 3. c 4. d
Proficiency Questions (Workbook) 1. c 2. a 3. c 4. d 5. b 6. a | 1,969 | 1,058 | {
"id": "<urn:uuid:6cc6cb91-f5e0-4632-ab24-8522a634fbac>",
"dump": "CC-MAIN-2021-49",
"url": "https://cdn.agclassroom.org/media/uploads/2015/06/04/Teacher_Answer_Key_2.pdf",
"date": "2021-12-07T02:32:51",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00572.warc.gz",
"offset": 219118361,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9855906963348389,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9946317672729492,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2256,
3720
],
"fw_edu_scores": [
3.0625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Snow Removal Resources for Community Organizations
In the City of New York, homeowners are required by law to clear the sidewalk in front of their property in the event of a snowstorm. Keeping our sidewalks clear is important for public safety, and not doing so could result in a fine from the NYC Department of Sanitation. Some of our neighbors are unable to comply due to factors outside of their control such as age or disability. If your group or organization is considering launching a volunteer snow removal program to help out, we want to share some resources and best practices to help make your program successful.
1. Find Your Target Residents: In the case of a snowstorm, you want to work quickly to serve those in need. If you are unsure of who needs help in your community try reaching out to local elected officials and/or your local community board. They often receive calls from people in the community who need assistance in a snowstorm. Local religious institutions and senior centers are also a good point of contact.
2. Recruit Volunteers: It is critical to develop a recruitment plan that is targeted to ideal volunteer populations - in this case that would be people who can perform manual labor in the cold. Use a range of recruitment tools, including your website; social media; direct outreach like email, and phone calls; and indirect outreach like news articles, word of mouth, and flyering. Local gyms and schools are a great starting point for recruitment. Consider posting your volunteer opportunity on websites such as NYC Service, Idealist, and New York Cares, and reaching out to additional partners who may be able to amplify your message!
3. Collect Materials: Snow removal requires tools such as shovels, snowplows, snow blowers, and rock salt. If you are organizing a snow removal program prior to a snowstorm then you may have time to possibly fundraise and amass tools. You will need a centralized place to store tools. Otherwise, if you are organizing in the wake of the snowstorm then it may make more sense to ask your volunteers (and/or the individuals requesting assistance) if they have tools that can be used. This is usually done most effectively by asking individuals requesting services if they have tools available at their homes for volunteers to use. If they don't it is a good practice to ask volunteers what tools they have available at the point of sign-up.
4. Establish a waiver. In some instances, it may make sense to have your volunteers sign a waiver form before serving. A sample volunteer waiver is included on page 20 of the Great Volunteer Management System.
5. Train Volunteers: Snow removal on icy sidewalks can pose a hazard, so it is important to establish safety procedures. Below are some tips and recommendations for your group to consider.
− Dress appropriately. Wear layers that you can easily shed as you warm up; and shoes with traction to avoid slipping.
− Create a buddy system. Avoid having volunteers shovel alone. That way volunteers can have someone to support them and share the workload.
− Set a time limit. Encourage your volunteers to take breaks often to avoid overexertion, and keep shifts to no more than 2-3 hours. Moving slow and steady is better in the long run.
− Stay hydrated. Your volunteers should have access to water and be drinking as often as one would during a vigorous exercise. Coffee may sound like a good way to thank your volunteers, but the caffeine puts more strain on our hearts. Maybe opt for hot chocolate or more water instead!
− Warm up. Stretching before the start of snow removal can help reduce the chances of injury. Leading a group warm up is also a great way to motivate your volunteers and get them excited for the tasks ahead. Go over the proper way to shovel. You should push, not lift the snow whenever possible. When lifting snow is necessary, make sure to lift with your knees.
6. Track Community Impact: As your program gets underway, it will be important to keep track of your volunteers and the homes you have cleared so you have a reference point for the next snowstorm. Develop a physical map of the community, listing where you acquired tools or help from neighbors. After each shift, it may make sense to check in on the residents you are helping. What other needs are not being met because of the snowstorm, and how might you organization be able to play a part? To learn more about tracking volunteer impact, check out Topic 8 in the Great Volunteer Management System.
Thank you for thinking of others during a snowstorm. The City of New York greatly appreciates the work of all our volunteers! | 1,768 | 928 | {
"id": "<urn:uuid:30cfa2e2-dda9-48b6-b989-b67d9679ffaa>",
"dump": "CC-MAIN-2021-49",
"url": "https://www.nycservice.org/liberty/download/file/7418",
"date": "2021-12-07T02:28:23",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00573.warc.gz",
"offset": 973342408,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9991260170936584,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991399645805359,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2414,
4632
],
"fw_edu_scores": [
2.0625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Appendic 1 to LOtC Policy Learning Outside the Classroom Intent
At Perryfields we believe that every young person should experience the world beyond the classroom as an essential part of learning and personal development, whatever their age, ability or circumstances. We nurture our children's social and emotional development, both within our school environment and with our variety of extended learning educational visits. Wherever possible, the staff incorporate learning outside the classroom into their daily curriculum. Across all classes the staff are supported and encouraged to take learning beyond the four internal walls.
At Perryfields we have established key drivers through which we deliver an exciting and engaging curriculum. These are:
Knowledge and Understanding of our community, Country and wider world
* To have understanding of British values, cultures and key events in the past.
* To know the continents of the world, key countries and capital cities
* To know how to be a responsible citizen within the local community
* To understand and respect different cultures and religions, present within the local community, in Britain and throughout the world
* To begin to recognise the opportunities beyond the local community.
Try new things
* To be able to take risks both in and out of the classroom
* To be able to persevere with new challenges both in and out of the classroom
* To be motivated to learn
* To have experienced a range of outdoor and adventurous learning
* To develop an inner resilience to carry on even when things are hard.
By incorporating learning outside the classroom throughout the whole curriculum we aim to develop each child in relation to our five learning powers –
Reflective, Curious, Collaborative, Resilient and Independent.
We do this by:
- Providing experiences of the local and wider environment beyond our pupils' everyday lives
- Developing confidence, self-awareness and life skills
- Encouraging controlled and 'safe' risk taking
- Developing pupil's knowledge, understanding and skills
- Providing a stimulating and enjoyable education
- Fostering curiosity and bring learning alive
- Encouraging independent thinking
- Promoting imagination and creativity
- Providing sensory stimuli
- Encouraging children to develop the skills to solve problems, developing resilient and
- reflective learners
- Developing skills of communication, cooperation and collaborative learning
- Engaging pupils in practical first hand experiences
- Allowing children to develop skills, knowledge and understanding without the constraints of a classroom
- Fostering spiritual development by providing awe and wonder
- Taking children out of their comfort zone
- Allowing children to discover new interests and talents
- Developing positive relationships
- Promoting and provide inclusive experiences for all pupils
- Enabling pupils to play, explore and investigate | 1,217 | 542 | {
"id": "<urn:uuid:b84719c7-c205-499f-88ef-79113ee8bc8f>",
"dump": "CC-MAIN-2021-49",
"url": "https://www.perryfieldsprimarypru.com/wp-content/uploads/2021/10/Learning-Outside-the-Classroom-Intent.pdf",
"date": "2021-12-07T01:59:24",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00573.warc.gz",
"offset": 991597618,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9918106198310852,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9959000945091248,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2504,
2924
],
"fw_edu_scores": [
2.921875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Task 1 question:
You should spend about 20 minutes on this task.
The maps below show the village of Stokeford in 1930 and 2010.
Summarise the information by selecting and reporting the main features, and make comparisons where relevant.
Write at least 150 words.
Student's answer with suggested corrections:
The map illustrates how Stokeford village had developed over 80 years from 1930 to 2010.
Overall, there had beenwere significant changes in infrastructure, housing and facilities over the period given.
In 1930, there was one main road, which was ran next to along the eastern side of the River Stoke, running snaking through the village from north east to south, with a bridge in the northwestern part of the crossing the river in the north. In the centre of the village, facilities such as 2 shops, a post office and a primary school were had been constructed, while houses were sparsely located near to the facilities. and a A large house was located in a garden next tosouth east of the primary school and separated from the main road by gardens. Large areas of the village were used as farmlands, which were mainly situated in the north east and south west of Stokefordthe village.
By 2010, the bridge and the post office are were still in Stokeford, but there was no more farmland and or shops in the village. More roads Two side streets and crescent street are had been extended laid down from the main road and to service plenty the abundance of houses are built along them. Although the primary school and the large house are were still in their same locations, but the primary school is had had two new parallel blocks erected on its eastern sidemodified and become bigger , while whereas the large house is had had extensions further constructed on the northern and southern sides and had been converted as into a retirement home.
www.ieltsgrant.com – student‟s writing task 1 sample answer with teacher‟s corrections and comments
Comment [U1]: I think „and‟ is also ok, but I would use „or‟ because „or‟ with negative keeps the two unrelated items separate whereas „and‟ combines them.
Comment [U2]: „the‟ is also ok, but I would choose „their‟ because it fits better with the plural phrase „same locations‟, and it links each item to its respective location.
Teacher's comments in the four areas of the band descriptors:
Task Achievement
- presents and adequately highlights key features/ bullet points but some details may be inaccurate:
o "a bridge in the north-western part of the river" doesn‟t link up to the previously mentioned "north east" location of the start of the main road
o "…post office and a primary school were constructed" (these might have been constructed earlier than 1930, not in 1930). Hence, the need for "had been constructed" (not "were constructed") to convey the more accurate meaning
Coherency and Cohesion
- Information and ideas are organised logically; there is clear progression throughout
- Uses cohesive devices appropriately (e.g. Overall) although there may be some underuse
- Referencing is used appropriately (e.g. "built along them", "still in the same locations")
Lexical Resource
- uses an adequate range of vocabulary for the task with a one less common word (sparsely)
- some inaccuracy: "near to" should be "near" (note: "close to" would also be acceptable)
- paraphrases where necessary. E.g. "further constructed as a" for "(extended and) converted into a"
Grammatical Range and Accuracy
- uses a mix of simple and complex sentence forms
- makes some errors in grammar and punctuation but they rarely reduce communication:
o "Overall, there had been significant changes" should be "Overall, there were significant changes" as the statement refers to "over the period" and does not require backshifting to past perfect (unless converted to indirect speech). This is a very minor error, and some might not notice it. Alternatively, "By 2010, there had been significant changes" would be correct.
o Used present tense "the post office are still in Stokeford", but then used past tense "there was no more farmland", and then back to present tense "More roads are extended" (I would stick to past tense for everything – either past simple or past perfect "By 2010, the bridge and the post office were still there, but there were no more shops…)
o Use either "Although …, …" or "…, but …" but not both in "Although the primary school…"
o Use past perfect passive instead of present simple passive: "the primary school is modified and become bigger whereas the large house is further constructed…" because present simple passive means that it happens regularly rather than happened in the past. | 1,865 | 1,021 | {
"id": "<urn:uuid:5a68a7a0-1c8b-4f86-9f5a-4b2a954621a1>",
"dump": "CC-MAIN-2021-49",
"url": "https://www.hkieltsteacher.com/wp-content/uploads/2020/07/Task-1-marked-sample-answer-before-and-after-map-of-Stokesford-comments-by-GR.pdf",
"date": "2021-12-07T03:36:42",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00573.warc.gz",
"offset": 854671244,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988555908203125,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.999186098575592,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2290,
4676
],
"fw_edu_scores": [
3.84375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
BLM 3 – Indian Horse: Reader Response Questions
Section 1 – Chapters 1-10 (pp. 1-42)
1. Read the following passage from page 11 and discuss how Saul's mother becomes lost because of her children being taken away. How does this impact Saul?
She was lost to me then. I could see that. She was gaunt and drained from days of weeping, a tent of skin over her bones. When Benjamin disappeared he carried a part of her away with him, and there was nothing anyone could do to fill it. My father tried. He never left her side for weeks. But now that she had lost two children, she would not speak of anything except "the school".
2. At the end of Chapter 10, Saul is left completely alone. Who has he lost? Why has this happened? How do you think all of these losses will impact him?
3. Pick your favourite passage from what you have read so far. How does the passage you have chosen relate to the plot of the novel up to this point? How is the passage you have chosen connected to the theme of "lost people"? Discuss.
Section 2 – Chapters 11-22 (pp. 43-86)
1. Discuss what the game of hockey means to Saul. How does it help him survive at residential school?
2. What does "Zhaunagush" mean? Why do the other children at the residential school call Saul a "Zhaunagush"? What impact does this name have on him?
3. Describe the relationship between Saul and Father Leboutelier. How does the priest help Saul?
Section 3 – Chapters 23-31 (pp. 87-136)
1. What does being on the Manitouwadge Moose hockey team mean to Saul? How does he become connected to the other players? Why do they make him prove himself?
2. Read the following passage from page 114 and discuss how Saul's life changes living with Fred and Martha Kelly:
At home I was asked to help out with household chores. I'd been trained to work at St. Jerome's. Anything the Kellys asked me to do, I did smartly and well. The first time they thanked me for my efforts I had no words.
3. Discuss the experience of the team in the café in Chapleau. How are the boys treated? Why does this happen? What do you think it would be like to experience this kind of racism?
Section 4 – Chapters 32-43 (pp. 137-178)
1. Compare the hockey game in Espanola with Saul's experience in White River. How do the racist taunts affect the team?
2. In Chapter 39, Saul recounts a story of two sisters at the residential school. Describe the story. How is this story symbolic of Saul's experience in Toronto?
3. Read the following passage from page 178 and discuss why Saul choose to become "lost" at this point in his life:
```
"I'm just moving on. Time for a change." He levelled a long look at me. "We're supposed to be teammates. Wingers. You. Me. Nobody wins alone, Saul." "I'm used to alone." "You're used to thinking you're alone. Big difference." "I'm not disappearing," I said. He shook his head sadly, "Seems like you already did."
```
Section 5 – Chapters 44-55 (pp. 179-221)
1. Discuss the connection Saul makes with Erv Sift. How does this relationship help Saul? Why does he leave without saying goodbye?
2. Discuss Saul's struggle with alcoholism. How does the drinking begin? How does he deal with it? Why do you think this is included in the novel?
3. Saul makes visits to St. Jerome's and Gods Lake – two very significant places. What does he remember in each of these places? Why are these visits so important to Saul?
4. When Saul returns to Manitouwadge, he is welcomed. How is he welcomed? What does this welcome mean to him? How is returning to Manitouwadge a part of Saul's healing process? | 1,450 | 867 | {
"id": "<urn:uuid:432967d6-a92e-4990-b191-a1f178de4105>",
"dump": "CC-MAIN-2021-49",
"url": "http://www.fnesc.ca/wp/wp-content/uploads/2020/11/p-323-324-BLM-3-Indian-Horse-Reader-Response-Questions-Lost-People-EFP-1.pdf",
"date": "2021-12-07T02:15:25",
"file_path": "crawl-data/CC-MAIN-2021-49/segments/1637964363332.1/warc/CC-MAIN-20211207014802-20211207044802-00577.warc.gz",
"offset": 106392654,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9995163679122925,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9995751976966858,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2121,
3555
],
"fw_edu_scores": [
3.484375
],
"minhash_cluster_size": 2,
"duplicate_count": 1
} |
LEAST BROOK LAMPREY (Lampetra aepyptera)
Freshwater Fish Species of Concern
State Rank: S3 (vulnerable) Global Rank: G4 (apparently secure)
Description
The least brook lamprey has an eel-shaped body with a deeply notched dorsal fin which separates it into two distinct fins. The mouth is disc-shaped and surrounded by teeth. Adults are dark and tan above and lighter below. During spawning, adults become blue-black in color (dnr.state.oh.us.). The least brook lamprey reaches a length of 18 cm and the maximum reported age is 8 years (fishbase.org)
Behavior
© Noel Burkhead. Natureserve.org
The least brook lamprey is a non-parasitic species that spawns in late winter or spring. The eggs hatch in 3-4 weeks and the larval stage lasts about 5-6 years. Larvae metamorphose in late summer. Adults over-winter, spawn, and then die. The brood is hidden in nests in gravely riffles and the eggs are not guarded (natureserve.org).
Diet
The least brook lamprey is herbivorous in its immature stages and feeds on minute drifting microscopic organic material. In its adult stage, the least brook lamprey does not feed (natureserve.org).
Threats and Protection Needs
The least brook lamprey is a Candidate Rare species in Pennsylvania. The species is restricted to the southern stretches of the Susquehanna watersheds and the Ohio watershed (naturalheritage.state.pa.us). Little available data is out on threats and protection needs for the least brook lamprey. Perhaps some of this is due to the sea lamprey and the intensive efforts to eradicate it from its non-native range. Unlike the least brook lamprey, the sea lamprey is a parasitic lamprey that devastates native fish populations and the similarity between the species
North American State/Province Conservation Status
Habitat
The least brook lamprey prefers clean, clear gravel riffles and runs of creeks and small rivers. Larvae burrow in the bottom of quiet waters. They are found along the Atlantic Slope from the Susquehanna River drainage in southeastern Pennslyvania to North Carolina. In the Mississippi basin they are found from southwestern Pennsylvania to south-central Missouri and northern Arkansas, south to northern Alabama to Georgia, Alabama, and Mississippi.
References
- Cooper, Edwin L. Fishes of Pennsylvania and the Northeastern United States. The Pennsylvania StateUniversity Press and University Park and London. 1983
- Fishbase.org. FishBase, MC P.O. Box 2631, 0718 Makati, Philippines.
- NatureServe. 2007. NatureServe Explorer: An online encyclopedia of life [web application]. Version 6.2. NatureServe, Arlington, Virginia. Available http://www.natureserve.org/explorer. (Accessed: September 4, 2007 ).
- Ohio Department of Natural Resources. Division of Wildlife. Columbus Ohio. 2005. http://www.dnr.state.oh.us/wildlife/Fishing/aquanotes-fishid/lbrampry.htm. Accessed 9/12//2005. | 1,390 | 678 | {
"id": "<urn:uuid:9c328042-8026-4d4f-9ada-511971805fc4>",
"dump": "CC-MAIN-2022-21",
"url": "https://naturalheritage.state.pa.us/factsheets/11250.pdf",
"date": "2022-05-24T02:55:44",
"file_path": "crawl-data/CC-MAIN-2022-21/segments/1652662562410.53/warc/CC-MAIN-20220524014636-20220524044636-00521.warc.gz",
"offset": 475145947,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.983607828617096,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.983607828617096,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2876
],
"fw_edu_scores": [
2.75
],
"minhash_cluster_size": 1,
"duplicate_count": 5
} |
Important dates and Celebrations:
Dear Parents and Carers,
Welcome back to Spring term. It has been lovely to meet so many of you already during drop off and pick up. It has been great to get to know the different personalities in Apple Tree Class and re-establishing routines and expectations.
This half term we will be learning about Animals and Habitats through books, related activities and experiences.
If you have any questions, please come and have a chat at the end of the day.
Rachna and Apple Tree Team
Spring 1 2021
Maths
The children will be developing their understanding of number through games and activities and through their play. Children will deepen their understanding of numbers 1-10 and explore ways to make different numbers in different ways – such as 1+5, 2+4 and 3+3 all making 6.
Phonics
The children have demonstrated good phonic recognition however are often struggling with blending and segmenting of the sounds. This will be a huge focus as this supports children in their reading and writing.
We blend to read – 'c-a-t - cat' and segment to spell 'cat – c, a, t'. We will be getting into the habit of using fingers to support us in hearing all of the sounds in each word. There will be a large focus on diagraphs where two letters make one sound such as 'sh'.
Talk 4 Writing (T4W)
T4W is a set of sessions to support children's language and storytelling. Often T4W sessions include retelling familiar stories such as traditional tales and using our own imagination the children are able to adapt and recreate their own version. As I get to know the children, we will be retelling our own stories and acting these out. This will give a good indicator of children's language and storytelling ability. Towards the end of the half term we will be using The Gruffalo's Child as a T4W story.
This half term in Reception …
Understanding the World
The first core text Blue Penguin will be the starting point to discuss weather and animals that live in cold climates. We will then use the story The Gruffalo to discuss different woodland animals and habitats.
Exploring Art and Design
The children will be exploring the colours that link to the weather such as blue, white and grey to represent the cold. We will be utilising role play and small world areas to explore animals and habitats as well as making links to familiar songs to sing and act out.
Core Text/Book
We've begun the term in icy Antartica as we read through the story 'Blue Penguin'. Later we will explore 'The Gruffalo' focusing on different woodland animals. Finally, to make links to Lunar New Year we will focus on the story 'The Great Race'.
Music
The children will be learning songs to support their routines such as the weather, days of the week and months of the year. We will also be learning songs linked to our core texts such as 'if you're a penguin and you know it…' to the tune of familiar songs.
Religious Education
Our key question for the half term is 'Why do Christians believe Jesus is special?'
We will discuss with the children that Christians believe Jesus: loves everyone, He is God's son and works miracles including healing people and teaches people to love others.
We are reading:
This is one of our books that we will be reading and exploringthis
half term.
Can you please check your child's clothes regularly to ensure their Can you please check your child's clothes regularly to ensure they are Please ensure that your child has a change of clothes on their peg.
clothes are labelled and labelled and they haven’t
they haven't accidently taken another's clothes home accidentally. Please send back into school the next day to ensure noone has to taken another's clothes home accidentally. Please send back into school the next day to ensure no one has to purchase additional Please ensure that your child is wearing their P.E. kit on Thursday for their lesson.
purchase additional clothes.
clothes. Can you please make sure your child brings a water bottle into school Please remember the Nursery gate is open at 8:45-8:55am.
labelled.
(containing water only) Please make sure that it is It is important that your child is on time. | 1,531 | 888 | {
"id": "<urn:uuid:b4621264-d509-4b34-8d5c-c99d8927b736>",
"dump": "CC-MAIN-2022-21",
"url": "https://st-john.hackney.sch.uk/wp-content/uploads/sites/8/2022/01/Apple-Curriculum-overview-Reception-Sp-1-2022.pdf",
"date": "2022-05-24T03:34:00",
"file_path": "crawl-data/CC-MAIN-2022-21/segments/1652662562410.53/warc/CC-MAIN-20220524014636-20220524044636-00524.warc.gz",
"offset": 585386177,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988342821598053,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.998968243598938,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
532,
4185
],
"fw_edu_scores": [
3.046875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Climate and Health Resources: SOUTH DAKOTA
Climate change poses risks to human health. Already in the United States, we are seeing rising temperatures, increased frequency and intensity of some types of extreme weather, sea level rise, and other changes in weather and climate patterns. We are all vulnerable to the health impacts associated with climate change. However, these climate and health risks vary across the country.
In the past century, most of South Dakota has warmed by 1°F to 2°F. This and other climate impacts mean increasing risks to health. Examples of risks and actions for South Dakota residents include:
− Rising temperatures and changing rain patterns will lead to more mosquitoes. The northern Great Plains have become a hotspot for West Nile virus, a mosquito-carried disease. Learn how you can take action to protect against mosquitoes, such as:
o Prepare: Get rid of standing water where mosquitoes can breed.
o Prepare: Keep window and door screens in good condition.
− Higher temperatures will increase heat-related illnesses, hospital visits, and deaths. People without air conditioning are at risk in Northern states where heat waves have been rare. Learn how you can take action to protect against heat waves, such as:
o Prepare: Have an emergency water supply ready for your family (1 gallon per person/pet per day).
o Respond: Check the news for tap water safety notices, such as boiling water before use.
− More frequent and intense droughts make it easier for soil dust to become airborne. Dust storms lower air quality and cause breathing and visibility problems. Learn how you can take action to protect against dust storms, such as:
o Respond: Seek shelter immediately.
o Respond: Stay low, and cover eyes, nose, and mouth.
o Respond: When driving, be alert for sudden changes in visibility. Pull off the roadway, or reduce speed.
Learn more in the USGCRP Climate and Health Assessment.
The examples of risks and actions provided in this document are not a comprehensive list. They provide users with illustrative impacts and resources for further information. Examples were selected based on relevance to the state or region and representation of a diversity of health threats. Selection does not imply ranking of severity of impacts nor prioritization of actions. The examples of impacts are based on "The Impacts of Climate Change on Human Health in the United States: A Scientific Assessment," available at https://health2016.globalchange.gov, as well as the National Climate Assessment at http://nca2014.globalchange.gov/
| RESOURCES FOR SOUTH DAKOTA RESIDENTS | | |
|---|---|---|
| Resource Topic | Information | Source | | 1,176 | 541 | {
"id": "<urn:uuid:f3014aa7-03c8-46a3-83d1-9a5f943d13e2>",
"dump": "CC-MAIN-2022-21",
"url": "https://19january2017snapshot.epa.gov/sites/production/files/2016-11/documents/southdakota-fact-sheet.pdf",
"date": "2022-05-24T03:11:26",
"file_path": "crawl-data/CC-MAIN-2022-21/segments/1652662562410.53/warc/CC-MAIN-20220524014636-20220524044636-00526.warc.gz",
"offset": 120061517,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9958624839782715,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9958624839782715,
"per_page_languages": [
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2570,
2674
],
"fw_edu_scores": [
2.890625
],
"minhash_cluster_size": 4,
"duplicate_count": 0
} |
Psychoeducation Presentation Blurbs
Mindfulness – Primary & SEND
A power point, discussion topics and activity sheets to encourage ways to manage feelings that become overwhelming, helping to lower physical symptoms, improve thought processes and install a sense of calmness. Helping young people learn strategies that can help them throughout life.
Worry – Primary
A power point, discussion topics and activity sheet to support young people to recognise when they are worried, what causes worries, how the worries might affect them physically and what they can do when they feel worried.
Exam Stress – Secondary
The exam stress psychoeducation presentation is designed to be delivered to Secondary School age young people who may be leading up to and just about to complete either the Mock Exams or GCSE Exams. The presentation aims to normalise the feeling of stress during exam periods, explore how stress can affect our mental health, as well as provide pro-active and realistic revision tips. The presentation finishes off with a discussion around the importance of relaxation and maintaining a positive work-life balance. This presentation also includes some helpful tips of parents.
Self Esteem – 9 – 13 (Middle)
Self Esteem is something that can impact children and young people of all ages. This presentation is aimed at those between the ages of 9-13 in an attempt to promote healthy self-esteem early. The presentation explores the difference between and the contributing factors of healthy and low selfesteem, as well as providing simple but effective ways to improve your self-esteem levels. The presentation is interactive and can include parents and carers, as well as teachers and support staff.
Mindful Breathing – Secondary
Mindful Breathing is a simple, yet super effective coping strategy for times of anxiety or stress. This presentation is aimed to educate and enthuse Secondary School age young people about the body's physical responses to anxiety and stress and how mindful breathing can quickly and effectively rebalance the mind and body. The presentation is interactive and provides opportunities to practice various breathing techniques as well guiding young people to trusted and NHS recommended apps and websites to download on their devices.
Sleep Hygiene – Secondary
Sleep Hygiene is a term used to encourage and determine the quality and quantity of your sleep. This presentation explores the difference between healthy and unhealthy sleep hygiene routines and behaviours and how these can affect young people's mental health and general wellbeing. Aimed to be delivered to Secondary School age young people, the presentation discusses the environmental and biological factors that may impact on the sleep quality of this age range, whilst also providing tips and ideas on how to wind down and enjoy a restful night.
Resilience
This Resilience psychoeducation presentation is intended to be used with children aged 9-13. This presentation aims to develop the young person's knowledge and understanding of 'resilience' and promote positive wellbeing. Young people will be encouraged to identify common challenges they may encounter, explore how these challenges affect us emotionally and physically and learn how to strengthen resilience, using the 5 ways to wellbeing.
Low mood
This psychoeducation presentation on Low Mood is intended to be used with children aged 9-13. The aim is to support young people to identify the signs and symptoms of low mood and understand how thoughts, feeling and behaviours are connected. We use the 5 ways of wellbeing to demonstrate how to improve mood and increase motivation. The presentation is interactive and encourages discussion.
Self-harm
This self-harm psychoeducation presentation is intended to be used with adults/parents. The aim is to offer a greater understanding of the nature and prevalence of self-harm. It identifies the warning signs and offers helpful techniques and advice to parents. | 1,606 | 739 | {
"id": "<urn:uuid:562621d8-7801-44f1-88d7-18cd7ffc4a88>",
"dump": "CC-MAIN-2022-21",
"url": "https://www.beyounorthumberland.nhs.uk/uploads/misc/psychoeducation-blurbs.pdf",
"date": "2022-05-24T02:36:46",
"file_path": "crawl-data/CC-MAIN-2022-21/segments/1652662562410.53/warc/CC-MAIN-20220524014636-20220524044636-00531.warc.gz",
"offset": 752819016,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9963681697845459,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9961356520652771,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2863,
3998
],
"fw_edu_scores": [
3.4375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Building Language Skills with The Seattle Times
March 17, 2016
Article: "Teen-led team wins World Drone Prix"
Sunday, March 13th, 2016 in the e-Edition of The Seattle Times, Main, page A2
Pre-Reading:
Write the word Sport on the board. Take a few minutes to write down other words that come to mind in relation to the word Sport. Discuss what types of words relate to sports and how this might relate (based on the title) to the article.*
Vocabulary:
As you read, look for the following vocabulary words that appear in today's article. Write down what you think the words mean based on the "context," or how the words are used in the sentence in which they appear. Next, look up the definitions in a dictionary and see how close your guess was for each word.
Aviation
Determination
Disposable
Drone
Enthusiasm
Fluorescent
Inaugural
Luxury
Proliferation
Resembled
Revenue
Solder
Unmanned
Comprehension:
1. Where did the World Drone Prix take place?
2. How much money did Luke Bannister receive for winning the race?
3. When will the first World Future Sports Games take place?
7. How often will the World Drone Prix take place once it has been established?
4. What kind of games will be included in the World Drone Prix next year??
5. What problem have hobbyist drones caused?
6. Already the so-called eSports revenue was nearly _________ worldwide in 2015, with sponsorships and advertising accounting for _________, according to the New York-based gaming-research firm SuperData. (Fill in the blanks)
Post-Reading:
Read the following passage from the article and discuss the following questions in a group:
"At the World Drone Prix, four pilots at a time sat in racing-style seats, their eyes covered by goggles allowing them to watch a feed from a camera on their drone. The drones raced on a course behind them, zipping along a white track that occasionally reached up to pinch at the speeding aircraft."
What is your favorite sport to watch? What is your favorite sport to play? Do you consider video/computer games to be a sport? Why or why not? What defines a sport? Do you think that drone racing and other "eSports" should be considered sports? Is there a difference between using a tennis racket or a drone to play a sport? Do you see any potential problems with recreational ("hobbyist") drones?*
Building Language Skills:
Read the following passage, and complete the activity below:
"Luke Bannister of Somerset led Tornado X-Blades Banni UK to win a $250,000 purse, part of $1 million in prizes handed out in the inaugural edition of the race. A Cabinet-level minister, meanwhile, announced the start of the World Future Sports Games in December 2017.
Those contests next year will include robotic swimming, running, wrestling and car racing, as well as drone flying, as Dubai, a city of futuristic skylines, yearns to be ahead of the curve."
Create your own eSport for the World Future Games. Try to include details such as: How long do you play it for? Where is it played? How many people can play at one time? Is it an individual or team sport? What kind of drone/technology is involved? How do you win? Are there team uniforms? Are there any other rules? Share your sport with others – come up with a list of eSports to be included in the Future World Games.
*You might also use sports related discussion to practice verb/tense usage (i.e. I play, she plays, we played, they will play)
Copyright © 2016 The Seattle Times Company
Comprehension Question Answers:
1. Where did the World Drone Prix take place? The World Drone Prix took place in Dubai, United Arab Emirates.
2. How much money did Luke Bannister receive for winning the race? Luke Bannister won $250,000 for winning the World Drone Prix.
3. When will be the first World Future Sports Games? The first World Future Sport Games will be held in December 2017.
4. What kind of games will be included in the World Drone Prix next year? Next year will include robotic swimming, running, wrestling and car racing, as well as drone flying.
5. What problem can hobbyist drones cause? The drones can fly into airspace and halt flights.
6. Already the so-called eSports revenue was nearly $750 million worldwide in 2015, with sponsorships and advertising accounting for $578 million, according to the New York-based gaming-research firm SuperData. (Fill in the blanks)
7. How often will the World Drone Prix take place one it has been established? Officials hope to have the games every two years. | 1,938 | 1,005 | {
"id": "<urn:uuid:0041d31e-b313-447c-a7d3-04a637eb2df4>",
"dump": "CC-MAIN-2017-43",
"url": "http://nie.seattletimes.com/wp-content/uploads/sites/12/2016/03/BLS_03-17-16_Lesson.pdf",
"date": "2017-10-19T09:19:58",
"file_path": "crawl-data/CC-MAIN-2017-43/segments/1508187823260.52/warc/CC-MAIN-20171019084246-20171019104246-00130.warc.gz",
"offset": 246282977,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9975829720497131,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.99886155128479,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1097,
3480,
4502
],
"fw_edu_scores": [
3.9375
],
"minhash_cluster_size": 1,
"duplicate_count": 3
} |
Project 1: Tilt-Shift Lenses for Commercial or Creative Photography
Objective:
Now that you have had time to practice and better understand the uses of lens shifts, find some subjects of interest to you with which you can create a better image by using the perspective control that a tiltshift lens provides.
How to shoot this project:
1) Once again, you will need to check out one of the Canon Tilt-Shift lenses for this assignment. The cage has tilt-shift lenses in 17mm, 45mm, and 90mm focal lengths. Choose the one(s) most useful for what you want to shoot. If you do not have a Canon camera, you will also need to check one of the camera bodies out since these lenses will not work with Nikon. Also, note that the cage has Canon 5D Mark III camera bodies that provide a full-frame sensor if you want to take advantage of the extra lens-width this can provide for you.
2) Experiment with how you can make better images through the extra control a tilt-shift lens provides. One approach is to photograph architecture or other rectilinear objects, using the shift to "correct" perspective for good clean straight lines. You could also use this perspectivecorrection for making portraits. But note that you do not have to use this perspective control to "correct" perspective; you can also use it to "skew" perspective by intentionally shifting in the opposite direction and then angling your camera more. How you use the shift capability of the lenses for this project is entirely up to you.
3) This project can be shot outside or in the studio, your choice.
4) Note that I want your images to show the use of lens shift. Although these lenses can be used just like a "normal" lens – by setting the tilt and shift controls to the "zero" position – the goal of this project is to take advantage of the shift control to produce an image not otherwise available through the use of regular lenses.
5) I do NOT want you to use the "Tilt" control for this Project. Learn how to master the Shift control first. You'll get to use the Tilt effectively or creatively in later work.
What to turn in:
* 5 digital images of your best works. ALWAYS include your name in your file names! Turn in RAW files (required), along with XMP or PSD files (optional) for any corrections you made in producing final images.
Grading rubric:
| Did you turn in 5 images, all using tilt-shift lenses, properly named? | 20 pts |
|---|---|
| Does your use of the tilt/shift lenses show a knowledge and understanding of the shift control? These lenses are manual focus – are your images in focus? | 20 pts |
| Did you shoot in Manual mode with good exposure and white balance? | 10 pts |
| Quality/Creativity Grade | 100 pts |
| You will lose 30 points if you don’t turn in all photos as RAW! | |
| TOTAL | 150 pts |
DUE DATE: at the beginning of class Week 5 | 1,220 | 660 | {
"id": "<urn:uuid:b0dc87a6-afb3-4bf7-940c-4c6ef8f1d232>",
"dump": "CC-MAIN-2017-43",
"url": "http://andrewross.com/teaching/project-descriptions/AI-View-Camera-P-1.pdf",
"date": "2017-10-19T09:13:55",
"file_path": "crawl-data/CC-MAIN-2017-43/segments/1508187823260.52/warc/CC-MAIN-20171019084246-20171019104246-00142.warc.gz",
"offset": 19892694,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9984062314033508,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9984104037284851,
"per_page_languages": [
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2319,
2852
],
"fw_edu_scores": [
2.4375
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
DEFINITIONS OF COGNITIVE DISTORTIONS (TWISTED THINKING)
1. ALL-OR-NOTHING. You look at things in absolute, black and white categories.
2. OVERGENERALIZATION. You see a single negative event as a neverending pattern of defeat.
3. MENTAL FILTER. You dwell on the negatives and ignore the positives.
4. DISQUALIFYING THE POSITIVE. You insist that your accomplishments or positive qualities 'don't count'.
5. JUMPING TO CONCLUSIONS:
a. Mind Reading: You presume that someone is reacting negatively to you when there's no definite evidence for this.
b. Fortune Telling: You arbitrarily predict that things will turn out badly.
6. MAGNIFICATION OR MINIMIZATION: You blow things way out of proportion or you shrink their importance inappropriately. This is also called the 'binocular effect'.
7. EMOTIONAL REASONING: You reason from how you feel. 'I feel like an idiot, so I really must be one'. Or 'I don't feel like doing this, so I'll put it off.'
8. SHOULD STATEMENTS: You criticize yourself or other people with 'should' or 'shouldn't'. 'Must', 'ought' and 'have to' are similar offenders. The emotional consequence is guilt. When you direct 'should' statements toward others, you feel anger, frustration and resentment.
9. LABELLING AND MISLABELING. This is an extreme form of overgeneralization. You identify with your shortcomings. Instead of saying 'I made a mistake', you tell yourself, 'I'm a loser', or 'a fool'.
10. PERSONALIZATION AND BLAME: You blame yourself or something you weren't entirely responsible for, or you blame other people and overlook ways that your own attitudes and behaviour might contribute to a problem.
THE DAILY MOOD LOG
Do the following daily mood log exercise for 15 minutes a day for the next week.
Step 1. Describe the upsetting event.
Step 2. Record your negative feelings and rate each one from 0 (the least) to 100 (the most). Use words like sad, anxious, angry, guilty, lonely hopeless, frustrated etc.
Step 3. The Triple-Column Technique
| Automatic thought | Distortions |
|---|---|
| Write your negative thoughts and estimate your belief in each one (0-100) | Identify the distortions in each Automatic Thought |
Step 4. Outcome. Re-rate your belief in each Automatic Thought from 0 – 100 and decide how you now feel.
Not at all better
Somewhat better Quite a bit better A lot better | 1,128 | 559 | {
"id": "<urn:uuid:1fad573c-8dfd-4624-90f1-603b48cb3d72>",
"dump": "CC-MAIN-2017-30",
"url": "http://overcoming-depression.org/wp-content/uploads/sites/61/2010/08/DEFINITIONS-OF-COGNITIVE-DISTORTIONS.pdf",
"date": "2017-07-23T06:39:38",
"file_path": "crawl-data/CC-MAIN-2017-30/segments/1500549424287.86/warc/CC-MAIN-20170723062646-20170723082646-00633.warc.gz",
"offset": 249251891,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9976515769958496,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9975281953811646,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1634,
2334
],
"fw_edu_scores": [
2.4375
],
"minhash_cluster_size": 3,
"duplicate_count": 0
} |
Color vs. V alue
Week 6
Local Color vs. Arbitrary Color
We've been focusing on value contrasts and color contrasts in this class, and both of those can be used to create dominance.
Dominance contributes to overall unity by ordering, in a heirarchal way, all the components in a work of art. As the artist, you must decide which elements in your paint ing will be the "stars" and which will be the supporting cast, taking subordinate roles. Depending on your in tent, you will organize these elements differently, but the
In this violet/yellow color scheme, I used size, shape and strong value contrasts to create a dominant area.
dominance will be created through use of contrasts. These contrasts include line, size, shape, color, value, movement/direction, position/placement, texture, and rhythm/repetition/pattern.
Sometimes dominance creates a focal point, and sometimes it is used as a unifying force, particularly in the case of very complex images. In the painting at the left, I unified the piece with an overall texture, then manipulated color intensities and value contrasts to provide a focal area in the cactus flowers.
We have been focusing on the difference between a value approach to painting and a color approach.
If you are emphasiz ing a value approach, you will look for ways to get contrasts in values, from a small dark among mostly light values to a small light among mostly dark values. You could have a very "visually complex" paint ing dominated and unified by an overall light color scheme, or an overall dark one.
If you are emphasizing a color approach to structure your painting, you manipulate your color contrasts. This can range from one area of high intensity pure color surrounded by mostly unsaturated, duller hues, to having a single color dominate the work (a mono chromatic painting) or having a single hue unify parts of a painting that have too much color or intensity contrast.
Colorvs. Value
Local Color vs. Arbitrary Color
When we describe an object, we usually describe it in terms of its local color or hue (a red apple, or a white shirt). And when we go to paint objects, many of us never get beyond painting objects with their local color. There are lots of other choices! Many "colorists" use arbitrary color. Arbitrary color means that the artist paints things according to his or her feelings about the subject, or to convey a specific meaning or mood. Arbitrary colors were often used by Expressionist painters, including Franz
Marc and Wassily Kandinsky, and many more contemporary artists followed in their footsteps.
Color doesn't have to be completely arbitrary. It may be the local color, but exaggerated or "pushed". Milton Avery frequently used this "pushed" color in his work, either making his colored shapes either pastel or intensely saturated versions of the local color.
Exercise 1:
Work from a black and white photo that contains recognizable ob jects that have a "given" local color (yellow bananas, for example). Make a painting using arbitrary color instead of the "right" local color(s) of the objects.
Exercise 2:
As you look at the work you are currently doing in watercolor, think in terms of dominance. Could you do something to either your color
"The Baby", by Milton Avery. In this piece, Avery exaggerates or "pushes" the local color of his subject matter.
or your value contrasts to create a dominant area? Could you use a single, dominant color or value to unify an otherwise too busy area? Instead of reworking and existing piece, redo an old painting, making one element (value or color) dominant.
While he took his cue from the local color of his subjects, he was never bound by it, freely exaggerating or tinting the colors as he saw fit. | 1,465 | 791 | {
"id": "<urn:uuid:0de5408f-8f8e-4834-91e3-352538759dde>",
"dump": "CC-MAIN-2018-51",
"url": "https://www.watercolorlearningcenter.com/uploads/2/4/8/5/24852303/wk6-arbitrarycolor.pdf",
"date": "2018-12-12T23:00:23",
"file_path": "crawl-data/CC-MAIN-2018-51/segments/1544376824180.12/warc/CC-MAIN-20181212225044-20181213010544-00592.warc.gz",
"offset": 1112881297,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9987006783485413,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9988559484481812,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1937,
3753
],
"fw_edu_scores": [
3.28125
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
The 4 Stages of Learning
Unconscious Incompetence
The first level is called "unconscious incompetence." In other words, you don't know what you don't know. For instance, if you wanted to learn how to drive stick-shift car after driving an automatic for years, then that time just before you made that decision to learn is your stage of unconscious incompetence. You don't know that you have to push in the clutch pedal in order to put the car into a certain gear, what happens automatically in a car with an automatic transmission.
Conscious Incompetence
The second stage is called "conscious incompetence." This is where I take you out to a parking lot and start teaching you how to push in the clutch pedal while letting off of the gas pedal. I tell you what you will feel and hear in the car that will tell you when to move the gear shift to the correct spot. This is the most painful stage in learning and the stage when most people give up. Most people don't like to feel as though they don't know something or can't do something perfectly. You hear people say, "I don't like looking stupid," "I hate this!" "I'll never get the hang of this," "Why bother?"
It may help to know that everyone goes through this, no matter how smart you are. Einstein experienced this; so does Bill Gates. You have to stick with the learning process long enough to be able to move through this to the next step. It will happen!
Conscious Competence
Soon enough, you move into the stage called "conscious competence." Whew! You got it, kind of. You can perform the activity or task you are learning. You may have to think of the steps involved or remind yourself with a mnemonic. You might have to hold out your hand and pretend to shift gears in the air to remember where third gear is. You might stall the car occasionally now but not like when you were first learning. You are, indeed, competent at the task, but you still have to think about it.
Unconscious Competence
The Holy Grail of learning is the last stage, called "Unconscious competence." To continue our driving analogy, this is when you arrive at your destination with no recollection of driving there. You went into "auto pilot" and the slight movements you make on the steering wheel to keep you in your lane going straight just happen unconsciously. You don’t have to think about what you are doing anymore. It just comes naturally.
This is the stage where innovation starts to occur. You know how to do something well, like "the back of your hand." So then you start figuring out ways to improve the process, to do things better, to think of methods that no one else had thought of before. You are the inventor, the alchemist, the dreamer. You begin to the change the world! | 901 | 598 | {
"id": "<urn:uuid:fe1175e8-9483-470a-8429-53ff75969974>",
"dump": "CC-MAIN-2018-51",
"url": "http://www.solution-focusedcoaching.com/wp-content/uploads/2015/04/4-stages-of-learning-with-explanation-page.pdf",
"date": "2018-12-12T23:01:19",
"file_path": "crawl-data/CC-MAIN-2018-51/segments/1544376824180.12/warc/CC-MAIN-20181212225044-20181213010544-00594.warc.gz",
"offset": 466470941,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9996317625045776,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9996351003646851,
"per_page_languages": [
"unknown",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
24,
2746
],
"fw_edu_scores": [
2.59375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Case Study: what does good look like
HOW TO STRUCTURE YOUR REPORT
Remember that in your report, you need to cover all of the four skills that are being assessed in the Case Study, namely:
- Assimilating and using information (A&UI)
- Structuring problems and solutions (SPS)
- Applying judgement (AJ)
- Conclusions and recommendations (C&R)
So, when planning your report structure – what does good look like?
HOW TO PLAN THE STRUCTURE OF YOUR REPORT
A key part of your planning is of course to plan what your report will look like – it's structure.
There are many ways that you can plan and you may already have a personal preference. Some people like to use spider diagrams or mind maps. You may want to plan using the four columns of the marking key. The marking key is covered in article: 'How the Case Study is marked'.
However, applying judgement (AJ) is generally the skill area where students struggle and that tends to have the lowest pass marks. This isn't surprising as it's pretty difficult to deconstruct your thought process and actually demonstrate your judgement under exam conditions.
So what can you do? If we look at the skills that are included under applying judgement in the Case Study study manual, you will see that they are:
1. developing your analysis, making links, and evaluating key points
2. appreciating bias and demonstrating your professional scepticism
3. assessing business trust and ethical issues.
In many ways, it can be easier to focus on making sure that you demonstrate these three skills rather than trying to work out under the pressure of the exam how to apply judgement.
Using paragraphs in your report
Each paragraph in your answer should consist of three parts:
1. The fact or piece of data in other words, the subject that you're discussing
2. The first level of your commentary in other words, this is what's happening
3. Your links and/or your evaluation points – these develop your commentary by continuing 'this is because', or 'this means that'.
How much do you need to write?
The final objective of your planning process is to identify how much you need to write.
You need to write enough to get 50% competent grades for each requirement but not so much that you overrun on your time plan.
Remember, you only have to do enough to get a competent grade, SC (sufficiently competent) or CC (clearly competent). And there's no such thing as a super CC grade so all your extra work however good will be wasted.
There are four parts to each of the exam requirements plus your conclusions and recommendations.
You don't have time to address each of the four parts to the same level of detail so your first decision when planning is to choose which parts you're going to write more on and which you're going to write less on.
Once again, by practising this repeatedly in your mock exams you will become comfortable making these kinds of decisions under the pressure of a live exam.
Good quality planning is crucial to passing the Case Study exam. From my work both as a senior examiner and as a Case Study tutor, I believe that the following areas are critical to passing the exam:
1. You need to have good business awareness. This means that you need to have a good understanding of how businesses work and be up-to-date with what's going on in the business world. Once the live AI is published, you need to brief yourself on the business news and ethical issues for the particular industry and economy, the major events in the relevant economy, the major issues keeping CEOs awake at night, and how companies are dealing with the current economic environment.
2. Time. You need to spend sufficient time analysing the AI and applying your business awareness to it. There is no shortcut to this and you have to put the effort in. If you don't know how the company's business well enough, there's no way you can pass.
3. Decisions. You need to make good consistent decisions regarding what you're going to write about and how much you're going to write for each bit. This requires a real understanding of how the Case Study assessment works.
The examiners will give you clues on what they want you to write about. You need to find these clues, interpret them and then give the examiners what they want.
4. Planning process. Have a really good planning process that consistently delivers a good enough answer in the time available, ideally 15 to 20 minutes for each requirement. You have to practise using this over and over again, so that when you go under exam pressure, you know exactly what you're going to do once you've read the exam requirements and the exhibits in the exam.
I've given you a lot of ideas on how to develop your AI preparation and plan for your Case Study exam. You need to take ownership of the company's business as if it was your own business. You'll need some time to create and adapt your AI notes and practice using them in mock exams. Make sure you do this as it's one of the best ways to develop your confidence in your Case Study process.
Finally, I wish you all the best in your Case Study exam.
Produced for ICAEW by Neil Russell, Programme Director at Training-by-EOS, tutor and former Case Study senior examiner. | 1,970 | 1,083 | {
"id": "<urn:uuid:d8570520-697e-4344-9e8c-7b4e9e525b88>",
"dump": "CC-MAIN-2019-30",
"url": "https://www.icaew.com/-/media/corporate/files/for-current-aca-students/report-structure-what-does-good-look-like.ashx?la=en",
"date": "2019-07-20T12:33:42",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526508.29/warc/CC-MAIN-20190720111631-20190720133631-00071.warc.gz",
"offset": 715230795,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9987362225850424,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9990836381912231,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2012,
4649,
5219
],
"fw_edu_scores": [
2.171875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
English:
n In English this half term, the children will complete a poetry unit. They will continue to use the Talk 4 Writing scheme to learn poems, identify the features of poems and will eventually use the features of these in their own work. The children will examine the imagery created in seasonal poetry.
This half term, we will also learn about information texts, writing an information text about the Great Fire of London. They will again, use the Talk 4 Writing to learn about the text type, discover features and use these in their own work. They will write their own information text independently at the end of the unit.
Music:
In music, the children will be learning to sing in rounds to nursery rhymes. They will continue to learn to use instruments and use them to perform these songs in rounds to other children in the school. They will also have the chance toward the end of term to think of their own rhyme about our topic.
PSHE:
In PSHE, the children will focus on "Getting on and falling out" from the SEAL curriculum. They will discuss what qualities they think a good friend should have, what they should do if someone has upset them or someone else and will consider ways to help other people. They will also have opportunities to write and give compliments to their classmates, making a compliments wall. We will focus on "telling compliments, not tales."
Maths:
In Maths, the children will continue to develop their skills when using the four operations (addition, subtraction, multiplication and division). We will have a heavy focus on subtraction, multiplication and division using strategies such as arrays, repeated addition, column method (year 2 children) and we will continue to develop knowledge of the Singapore bar model to problem solve.
At the end of the half term, we will also learn about Statistics, collecting data using a tally chart and putting this into a graph. We will answer questions about the graphs and some children will also make up their own questions about graphs and data for a friend to answer.
Through starter activities, the children will continue to develop and master their understanding of number and place value, playing games that will allow them to identify hundreds, tens and ones and various counting activities.
Religious Education:
Our RE focus is "How and why do we celebrate special times?" Through this unit, the children will learn what we mean by "celebration" and will learn about specific celebrations that might happen in their life e.g. christening, birthday and Christmas. We will also learn the story of Diwali.
PE:
PE will take place on a Thursday and Friday afternoon so please ensure that your child's PE kit is in school for these sessions.
This half term in PE, we will be focussing on the gymnastics aspect of the curriculum, developing skills in balance, movement and using equipment.
Please encourage your child to practise their times tables ready for their weekly test and remember those 5 daily reads for our Read 5? High 5! scheme!
As a class, we will also complete "Barney's adventures" which will allow the children to take home our class bear and show their week with him through drawings, writing, photos or any way they wish to present their time with Barney.
History:
In History, the children will learn about the events of the Great Fire of London. They will sequence events using a timeline, learn about people involved in the fire, learn what happened on each day and the conditions that led to the fire spreading so quickly. At the end of the unit, the children will also make a diary, mapping out events of the Great Fire.
Art/DT:
In Art, the children will use chalks and charcoals to make a street of houses representing the Great Fire of London. They will also make charcoal and tea stained maps of London and use boxes to make houses based around this time too. At the end of the term, the children will complete Christmas crafts through Art and DT.
Science:
Our Science this term focusses on Seasonal changes. The children will learn about changes in the weather as the year progresses through different seasons. They will use this knowledge to identify what happens to plants and animals during each season e.g. adaptations of animals and will identify clothing worn in each season as well as temperature changes. The children will also learn about celebrations in winter and what happens to daylight hours during this season. | 1,630 | 887 | {
"id": "<urn:uuid:0ee31a0a-4731-4dc6-93e4-249ff940be4b>",
"dump": "CC-MAIN-2019-30",
"url": "https://s3.eu-west-1.amazonaws.com/jotter2.files/7966792?response-content-type=application%2Fpdf&response-content-disposition=inline%3Bfilename%3Dautumn-2-parent-overview-squirrels.pdf&X-Amz-Content-Sha256=UNSIGNED-PAYLOAD&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=AKIAIH4MJHC24RK4EHAA%2F20190720%2Feu-west-1%2Fs3%2Faws4_request&X-Amz-Date=20190720T123502Z&X-Amz-SignedHeaders=host&X-Amz-Expires=3000&X-Amz-Signature=e6f085492c8b499acbf7e9509c1caa428c3af68a1bcf268f6cb79d434758794e",
"date": "2019-07-20T12:35:03",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526508.29/warc/CC-MAIN-20190720111631-20190720133631-00091.warc.gz",
"offset": 524240011,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9986809492111206,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9986809492111206,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
4456
],
"fw_edu_scores": [
4.21875
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Use punctuation to indicate a pause or break
Teaching Point(s):
- Writers use commas, ellipses, and dashes to indicate a pause or break
Standards:
CC.1.4.8.F
Materials:
- Figure 1.1 Sentences with Commas, Dashes, and Ellipses document
- Cardstock/construction paper or construction or lined paper
Connection:
"There is an important technique that writers use to show a pause or a break. Writers use a comma, ellipsis, or dash when they want the reader to stop briefly, or pause before continuing. Think about a time-out in football or basketball. The coach calls a time-out because he wants his team to come back together for a new strategy or play. This is analogous to how a writer uses a comma, ellipsis, or dash – to get the reader ready for new information.
Teach/Model:
Display Figure 1.1 and use think-aloud strategy to review the three punctuation types.
Then ask volunteers to read the sentences without the punctuation and discuss how the sentence changes.
Active Engagement/Guided Practice:
Pass out cardstock and have students model how to make an adapted 4-Tab foldable.
"Make a hot dog fold ( fold a rectangular paper in half along the short side)
Now fold the paper in half, and then in half again.
Unfold and you should have 4 sections with 3 creased lines.
Cut the first two creased lines to the center. You should now have 3 sections (2 small and 1 large)
Model how to put the following information on the front of the foldable.
```
1st tab – Comma ( , ) 2 nd tab – Dash ( - ) 3 rd tab – Ellipsis ( …)
```
Open foldable and on the left side:
1 st tab - Indicate a short natural pause (but not two separate complete sentences)
nd
2
tab – Indicate a sudden pause in a sentence
3 rd tab top section – Indicate a pause or break in a writer's or speaker's thinking
Passage of time
An unfinished thought
Right side of open foldable:
1 st tab – "When it came to stealing, Liesel and Rudy first stuck with the idea that there was safety in numbers," The Book Thief (p.272)
2 nd tab – "I figured that must be a password – imatschool- so I jumped online and went straight to Sara's site. Ghost in the Machine (p.76)
3 rd tab – "There must be a mistake 'How…How could that happen?' I ask Haymitch." The Hunger Games (p.108)
**Collect foldables as they will be needed for next lesson **
Notes:
Adapted from/acknowledgments to:
Ruday, Sean. The Common Core Grammar Toolkit: Using mentor text to teach the language standards in grades 6-8. New York, NY: Routledge, 2014.
http://mjsdliteracy.wikispaces.com/file/view/Focus%20Lesson%20Pausing%20Punctuation.pdf/ 365509452/Focus%20Lesson%20Pausing%20Punctuation.pdf
Figure 1.1 Sentences with commas, dashes, and ellipses | 1,290 | 693 | {
"id": "<urn:uuid:7e902813-e323-47d5-bdbf-3f7036b9c1dd>",
"dump": "CC-MAIN-2019-30",
"url": "https://www.eriesd.org/site/handlers/filedownload.ashx?moduleinstanceid=14987&dataid=14122&FileName=Lesson%203%20-Use%20punctuation%20to%20indicate%20a%20pause%20or%20break.pdf",
"date": "2019-07-20T11:41:28",
"file_path": "crawl-data/CC-MAIN-2019-30/segments/1563195526508.29/warc/CC-MAIN-20190720111631-20190720133631-00106.warc.gz",
"offset": 684150374,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9901025593280792,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9944995641708374,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1849,
2680,
2736
],
"fw_edu_scores": [
4.53125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Discussion Activities
1. Slide 18
Writing Assessment Task from the CLB 3-4 module on Shopping for Groceries:
Write a short review about a grocery store.
Discussion Question: What are some language focus items that you think learners may need to practise to be able to perform the task? Think about the grammatical knowledge they might need, any functional or textual knowledge, any socio-linguistic elements that you might need to address through skill-building activities in the classroom.
To help you with your task analysis, look at the sample reviews on the next page. These are from one of the skill-building activities in the module.
Remember that CLB 3 learners will be writing a review of about 5 sentences while CLB 4 learners will be writing a short paragraph.
2. Slide 22
Discussion Question: What are some level-appropriate language and learning strategies for Writing that will help learners complete the assessment task? These are strategies that will help learners with their writing skills.
Analyzing Grocery Store Reviews, continued
Instructions: Read the reviews from two shoppers about different grocery stores.
ATR
Westside Market is a great neighbourhood store. The staff is so friednly and helpful. The cashiers even remember my name! I also like that the store always has a great selection of fresh flowers and produce. The store is clean and wellorganized. It's very easy for me to find what I'm looking for. The only bad thing about the store is that it doesn't have all the things that a big grocery store might have. SometimesI have to shop somewhere else to find a good selection of items I need.
Talk to your partner.
1. What does the shopper think is good about Westside Market?
2. What is not so good?
3. Circle the number of stars you think this shopper gave.
BarryG
Eastdale Market is close to my house, so it is convenient for me to shop at, but it is too expensive! I don't know anyone who wants to pay $6.00 for a carton of eggs. The store is dirty and unorganized. The produce is hit or miss. Sometimes it looks really fresh and sometimes it doesn't. Save your money and go down the street to Kay's Greocery instead.
Talk to you partner.
1. What does the shopper think is good about Eastdale Market?
2. What is not good?
3. What do you think hit or miss means? (Remember to look past the sentence to try and guess the meaning).
4. Circle the number of starts you think this shopper gave. | 934 | 527 | {
"id": "<urn:uuid:e557f4cb-deb8-4c98-83be-38ea21eca2f1>",
"dump": "CC-MAIN-2023-14",
"url": "https://www.amssa.org/wp-content/uploads/2022/05/Session-15.-Discussion-Handout-EN.pdf",
"date": "2023-03-30T05:12:20",
"file_path": "crawl-data/CC-MAIN-2023-14/segments/1679296949097.61/warc/CC-MAIN-20230330035241-20230330065241-00657.warc.gz",
"offset": 720942815,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9985037446022034,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9993969202041626,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1014,
2442
],
"fw_edu_scores": [
3.765625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Santa Barbara's Water Outlook Remains Good as City Council Declares Stage Two Water Shortage Alert in Response to Statewide Drought
SANTA BARBARA, CA - 6/21/2022
The Santa Barbara City Council today declared a Stage Two Water Shortage Alert. This is in response to Governor Newsom's recently issued executive orders declaring a statewide drought emergency and request for California residents to voluntarily reduce their water use by 15 percent. Currently over 95 percent of California is experiencing severe or extreme drought conditions.
With the conservation practices already adopted by residents and businesses, and the City's investment in a diversified water supply, including the activation of City's desalination plant, Santa Barbara's water supply outlook is good, even if extremely dry conditions persist. While Santa Barbara has experienced below-average rainfall, the City's water demands can be met for at least the next two years, even if there is no rainfall during that time. However, in recognition of the severity of drought conditions statewide and in response to Governor Newsom's executive orders calling on all urban water providers to enact a level two water shortage response, Santa Barbara is taking the next step to encourage conservation.
"I'm proud of the investment our community has made in diversifying our water supply for long-term reliability, and in our community members who have made real lifestyle changes to conserve and use water wisely," said Joshua Haggmark, Water Resources Manager. "I'm confident we'll continue to band together to use only what we need, making sure we extend our water resources for whatever lies ahead in the future."
Santa Barbara residents are currently using the same amount of water used in the 1950s, but with nearly double the population, highlighting the impact of water efficiency and increasingly more efficient building codes. The community's water use currently averages 25 percent less than pre-drought water use in 2013. "Our residents and businesses have truly invested in a "conservation as a way of life" approach to water use," Haggmark said. "But now is the time for all of us to do a little more and be part of the water-saving solution for California."
Under the Stage Two measures, community members will be asked to prevent wasteful water use by:
* Using a shut-off nozzle when using a hose or outdoor water faucet, including for vehicle or boat washing,
* Refraining from hosing down hard surfaces such as sidewalks and patios with potable water, unless for preventative maintenance or health and safety,
* Irrigating with an automatic or manually-controlled, in-ground irrigation system only between 6:00 p.m. and 8:00 a.m., and
* Following the statewide ban on using potable water to irrigate non-functional turfgrass (that is solely ornamental and not regularly used for human recreational purposes or for civic or community events) at commercial, industrial, and institutional sites.
Even with local rainfall totaling at 67 percent of normal this winter, Santa Barbara's diverse water supply can meet demands using a combination of supplies including Lake Cachuma, Gibraltar Reservoir, ocean desalination, groundwater, imported water through the State Water Project, and recycled water. For more information on water supplies, drought, and conservation, visit www.SantaBarbaraCA.gov/Drought | 1,417 | 667 | {
"id": "<urn:uuid:8e0b903b-a75f-4e1b-9635-f9956485cd85>",
"dump": "CC-MAIN-2023-14",
"url": "https://santabarbaraca.gov/sites/default/files/2022-06/Media_Release_Stage_2_Alert_6-21-22-For%20Web.pdf",
"date": "2023-03-30T04:28:09",
"file_path": "crawl-data/CC-MAIN-2023-14/segments/1679296949097.61/warc/CC-MAIN-20230330035241-20230330065241-00660.warc.gz",
"offset": 559355705,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9946022033691406,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9979807734489441,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2447,
3391
],
"fw_edu_scores": [
2.359375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Meal Planning 101
Imagine getting home after a long day, knowing that a delicious and healthy meal was only a few minutes away. How would you benefit from planning your meals ahead of time?
Planning meals ahead can help relieve mealtime stress and prevent last-minute trips to the store or drive-through. Like any new habit or skill, meal planning can feel overwhelming at first. By starting small and following some simple steps, you can prepare nutritious and delicious meals that fit your budget and lifestyle!
What Is Meal Planning?
Meal planning means answering, "what's for dinner?" once or twice a week instead of every night. That includes shopping and prepping the ingredients for cooking. All you need to do is a few minutes of work come mealtime. The simplest way to approach meal planning is with three steps:
1. Select your meals and recipes.
2. Shop for the ingredients.
3. Prepare those ingredients.
Meal planning does not mean spending hours cooking elaborate meals. It doesn't even mean you need to cook every night. Your plan for the week can be flexible enough to suit your tastes and include pizza night or leftovers. By planning meals ahead, you create more time and ease in your weeknight routine. Even better, planning more home-cooked meals can save money and prevent food waste. A win for you and the environment!
© Aduro. 2021. All rights reserved.
Ask: What do You Want?
Your approach to meal planning will depend on the problem you're trying to solve. Why do you want to meal plan? Do you want to…
§ Save money?
§ Prevent food waste?
§ Eat healthier?
§ Preserve your time or sanity?
If you're a beginner, pick one or two goals that matter the most and use those to guide you in the first step of meal planning: picking your menu and recipes.
Meal Planning Step by Step
Step 1: Pick Your Menu and Recipes
Start thinking about your menu two or three days in advance. Here are some tips for picking recipes:
§ Decide how many meals to prep ahead, and how many people you need to serve. If a recipe makes four servings, but you need to feed six people, you will need to adjust. Plan to cook once and eat twice (or thrice!) by making enough to have leftovers.
§ Pick recipes based on common ingredients. "Shop at home" first by taking stock of ingredients you already have in your kitchen. This can help reduce food waste and save money. Websites like SuperCook or MyFridgeFood can help you find recipes based on what you have onhand.
§ Choose recipes that work with your schedule. Consider how much time you have to cook each night. Will you need to prepare all your meals ahead of time? Or maybe stock up your freezer and reheat meals? On nights you get home late, a 10hour slow cooker recipe is a better idea than something that needs to cook for an hour. Consider what meals would reheat well for lunch the next day or freeze well to eat again next week.
Step 2: Make a Smarter Shopping List
Go to the store with a list. You'll be more likely to remember everything you need, and save money and prevent food waste. Make your shopping list in three easy steps:
1. Make a master ingredients list that includes all the ingredients in each of the recipes you picked for the week.
2. Next, go through the list and cross off anything you already have in your kitchen. If you picked recipes based on things already in your pantry and freezer, you should be crossing a fair amount off the list. This is the start of your grocery list.
3. Keep a running list of pantry staples as you run out of them. These are things you need every week like cereal, peanut butter, or bananas. Add this "pantry staples" list to your list from step two, and you're ready to head to the store.
Step 3: Prepare your ingredients
§ Keep it simple. Start with meals or recipes you know and enjoy, and only add one new recipe per week. Use pre-cut veggies, microwaveable grains, or other shortcuts as needed. Find recipes in cookbooks or sites like Pinterest, Google, and cooking sites. Organize recipes you enjoy in a book, a spreadsheet, or online organizers like Pinterest, Real Plans, or BigOven.
Now you have everything you need to create your meals! There's just one more step: getting prepped. The amount of time you spend prepping your ingredients is up to you. The more you prep now, the less time you'll spend in the kitchen later in the week.
We recommend you set aside at least an hour each week for batch cooking and chopping. What you do with that time depends on your recipes for the week. Tasks like washing and chopping garlic, onions, or other vegetables, batch-cooking meats, or roasting vegetables ahead of time can save you time and energy later.
What stands out to you as a way for you to save time, energy, or money this week by planning meals ahead of time? Subscribe to our newsletter at adurolife.com.
Igniting Action:
© Aduro. 2021. All rights reserved. | 1,858 | 1,061 | {
"id": "<urn:uuid:75645415-cb16-4482-b373-1f7afa48be4d>",
"dump": "CC-MAIN-2023-14",
"url": "https://info.adurolife.com/hubfs/tipsheet/Meal-Planning-101_blog.pdf",
"date": "2023-03-30T03:57:46",
"file_path": "crawl-data/CC-MAIN-2023-14/segments/1679296949097.61/warc/CC-MAIN-20230330035241-20230330065241-00662.warc.gz",
"offset": 372505392,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9989746809005737,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9989086389541626,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1780,
4900
],
"fw_edu_scores": [
2.359375
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
Sights as you Paddle on Sproat Lake
Welcome to the beautiful Alberni Valley and Sproat Lake (Named after Gilbert Malcom Sproat who was an entrepreneur and colonial official). The lake is 25 Km's long and has 3 Provincial parks around its boundaries. The area has a rich history and beautiful scenery for your paddle. Here is an outline and description of the sights you will see on your way.
The race starts at Sproat Lake Park. The park has camping and picnic areas plus a nice swimming beach. Be sure to walk to the Petroglyphic on the rock wall; these pictographs are estimated to be a thousand years old and were made by our local Indigenous people
Leaving from the start of the race at Sproat lake Provincial Park Boat launch you will see the following sights:
1) To the right you will see the famous Water Bombers. While no longer in service these Bombers fought many of the fires in B.C. and even went to Australia to help out. The Plane at the rear is painted the original colours from the U.S Air force. The future of these planes is uncertain.
2) To the left is Bishops landing. The original starting point for days in the past for logging crews and the connection to take passengers to Klitsa Lodge. Today the area houses the Fish and Duck Restaurant and Pub and you can rent houseboats to cruise the Lake and relax.
3) Slightly to the left and straight ahead of the departure point you will see Massacre island. In 1856 a local Indigenous Band was chased onto this island by an invading east Coast tribe and were massacred on this island.
4) Directly to the right you will see Weiner Bay where Drinkwaters Restaurant, Bar and accommodations are. You will also find a Beer and Wine store there and a convenience store.
5) Heading out from the start for you will see Vanderbilt Island with a rich history. In 1920 Cornelius Vanderbuilt purchased the island. The island has changed hands many since the Vanderbuilts sold it in 1927.
6) To the right of Vanderbilt Island you will see the point where the old Klitsa lodge was situated. Klitsa Lodge operated for many years and people would travel by boat from bishop's landing to go and stay they relax, fish and hunt. Today, the point is occupied by a house overlooking the beautiful view.
7) Going right past Klitsa point you will hit the straight away to Battleship Island. The long race halfway point is past Battleship Island and you will return.
Enjoy many of the sights and activities of the areas particularly the beautiful outdoors. For information on some of the Hiking trails in the area check out the following Website http://www.valleyoftrails.ca/
For an informative book on Sproat Lake, its history and pioneer families obtain a copy of Sproat lake Reflections by Sproat lake History Book Committee 2008. | 1,070 | 607 | {
"id": "<urn:uuid:d7abd71e-47c2-4407-bfb8-8326720a8bd7>",
"dump": "CC-MAIN-2023-14",
"url": "https://www.sproatlakecanoeclub.com/_files/ugd/45a1e2_18fab72a3c2445d1ae8b6e9454232627.pdf",
"date": "2023-03-30T03:56:36",
"file_path": "crawl-data/CC-MAIN-2023-14/segments/1679296949097.61/warc/CC-MAIN-20230330035241-20230330065241-00667.warc.gz",
"offset": 1119219691,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9992513656616211,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9992513656616211,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2781
],
"fw_edu_scores": [
2.203125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Vasquez High School -- AP Chemistry B -- Test #1 -- Chapter 8 -- 55 points
1) For one point each, circle which of the following pairs of atoms or ions is the larger:
Ca
2+
Ca
Mg Al
Cs +
Ba
2+
Ag +
Au
+
O
2-
O
2) For one point, write D for Dobreiner, N for Newlands, M for Mendeleev, L for Meyer, or H for Moseley.
_____ German chemist who created a periodic table
_____ Gave us his law of octaves
_____ Discovered a correlation between atomic number and X-rays
_____ First classified elements in triads _____ Russian chemist who created a periodic table
Short answer/Fill-in. Be neat and complete. Three points.
3) Elements in the same group share chemical properties mainly because ______________________________
___________________________________________________________________________________.
4) One non-metal that exists as a three-dimensional network of atoms is ______________________________.
5) The over-arching characteristic of atoms which determine their trending properties has most of all to do
with their __________________________________________________________________________.
6) An anion is larger than its corresponding atom because _________________________________________
__________________________________________________________________________________.
7) Write all of the second period elements in ascending order of first ionization energies:
_____ _____ _____ _____ _____ _____ _____
_____
8) Nearly all __________________ react with acids to form ____________________ gas.
9) Which non-metal forms the largest number of distinct oxides? ________________________________
10) Aluminum oxide and zinc oxide react with both acids and bases. These are said to be _________________.
Multiple Choice. Write the letter that best corresponds to the correct answer for each three-pointer.
_______ 11) Early chemists arranged elements in increasing order of atomic ___________. Later discrepancies were corrected by arranging them by atomic ____________.
a) structure, mass
b) mass, number
c) charge, number
d) mass, subshells
_______ 12) Which one of these is not isoelectronic?
a) Al 3+
b) P 3-
c) Cl -
d) Ca 2+
e) Ar
_______ 13) Which of the following elements does not belong with the others?
a) Se
b) Si
c) Te
d) S
e) P
_______ 14) Which statement is untrue?
a) Noble gases are very stable because their s and p subshells are completely filled.
b) The more negative the electron affinity, the greater is the tendency form an atom to gain electrons.
c) The higher the ionization energy, the stronger theattraction between the nucleus and an electron.
d) The metallic character of elements increases from top to bottom within a particular group of representative elements.
Calculations, etc. Three points each.
15) The atomic radius of K is 216 pm and that of K + is 133 pm. Calculate the percent decrease in volume when K(g) is converted to K + (g). Remember that V = (4/3)pr 3 .
16) Write out the electron configuration for the As 3ion.
17) Ramsay, Crookes, and Rayleigh discovered which unknown gas? _______________________ | 1,892 | 698 | {
"id": "<urn:uuid:a28e5f10-086e-40ae-aac1-d4d83597afb1>",
"dump": "CC-MAIN-2017-22",
"url": "http://www.lifesmith.com/VHS%20Web/APChem.S'14.quiz1.pdf",
"date": "2017-05-27T17:32:01",
"file_path": "crawl-data/CC-MAIN-2017-22/segments/1495463608984.81/warc/CC-MAIN-20170527171852-20170527191852-00225.warc.gz",
"offset": 706817814,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9885321855545044,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9953144788742065,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1791,
3171
],
"fw_edu_scores": [
3.515625
],
"minhash_cluster_size": 1,
"duplicate_count": 3
} |
Vasquez High School -- Chemistry -- Quest #7 -- Section 9.3 -- 60 points
Read each problem carefully. Label everything. Show all work for full credit. Be neat and complete.
1) Consider the rusting of iron: 4 Fe + 3 O2 ==> 2Fe2O3 (fifteen points)
a) How many moles of each do we have?
a) You start with a huge 250.0 kg bar of pure solid iron. Because this process is not 100% efficient, it is found that the percentage yield of iron (III) oxide is only 86.5%. What is the actual yield for the product in the above reaction?
b) Now suppose you had 150 g Fe and 75 g oxygen, what is the limiting reagent, how much of what is in excess, and how much product would be the theoretical yield then?
2) In the reaction between potassium and bromine gas, Br2, it is discovered that 98.5 grams of potassium only produces an actual yield of 169.5 g KBr. What is the percentage yield here?
Fifteen points on this one.
3) Now we wish to remove the hydrogen selenide from a sample of natural gas by forcing it to react with oxygen gas under pressure...here's the recipe:
$$_____ H2Se + _____ O2 ==> _____ Se4 + _____ H2O$$
We know that we have 127.5 g of hydrogen selenide that needs to be removed (reacted with). I have just 36.0 g of oxygen gas left in the gas cylinder.
b) Is there enough oxygen for all the hydrogen sulfide to be removed?
c) If so, how much oxygen is left over? If not, state how much more we need.
d) How many moles of selenium are produced?
4) Your associate in the lab, G. Eyemaduntz, wishes to make barium uranate, BaUO3, in order to facilitate the making of a new kind of nuclear fuel. He starts with 400 g of barium oxide, BaO, and 800 g of solid uranium. He asks you, "What can I expect as a theoretical yield of the uranate? What is the limiting reagent?"
He showed you the balanced reaction ------------> BaO + O2 + U ===> BaUO3 What do you answer? (Ba = 137 g/mol and U = 238 g/mol...ten points)
5) Both butane (C4H10) and pentane (C5H12) react with oxygen gas to produce carbon dioxide and water. If you have equal masses of each, which will require a greater mass of oxygen to react? (SHOW WHY!) | 1,080 | 608 | {
"id": "<urn:uuid:438d088d-832a-43ca-aa55-5755fd4da71d>",
"dump": "CC-MAIN-2017-22",
"url": "http://www.lifesmith.com/VHS%20Web/chem.F'14.test7.pdf",
"date": "2017-05-27T17:37:10",
"file_path": "crawl-data/CC-MAIN-2017-22/segments/1495463608984.81/warc/CC-MAIN-20170527171852-20170527191852-00230.warc.gz",
"offset": 730080549,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9771352708339691,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9970168471336365,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
253,
2166
],
"fw_edu_scores": [
2.65625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Vasquez High School -- Chemistry -- Exam #3 -- Chapter 4 -- 60 points
Write TRUE if the statement is true OR write the word(s) that substitutes for the underlined word(s) that would make it true. Writing false earns only partial credit. Three points each.
_______________ 1) The gas evolved from the reaction between sodium and water was carbon dioxide.
_______________ 2) Consider the sulfur atom in H2SO4. The charge on it must be +6. (careful here!)
_______________ 3) We use the Latin prefixes whenever we have transition metals involved in a compound.
_______________ 4) The most common acid you would find in your stomach is hydrofluoric acid.
_______________ 5) There are two metals which are not transitional, yet require roman numerals. They are aluminum and mercury.
Match Those Acids! Two points each.
_______ 6) HNO3
a) sulfuric acid
j) phosphoric acid
b) bromic acid
k) fluoric acid
_______ 7) HBr
c) nitrous acid
l) hydrofluoric acid
d) hydrochloric acid
m) perchloric acid
_______ 8) HC2H3O2
e) hydrosulfuric acid
n) lysergic acid
f) acetic acid
o) hydrobromic acid
_______ 9) H3PO3
g) nitric acid
p) not this acid
h) phosphorous acid
q) not this one either
_______ 10) H2S
i) sulfurous acid
r) why are you reading these?
11) Imagine an element called vasquezium (Vz). It forms four oxygen-containing acids with the number of oxygens ranging from four to one. Each of the anions has a charge of -1. For five points, write the four acid formulas and their respective names according to what you have learned about naming acids.
For two points each, give the exact chemical formula for each of the following:
12) vanadium (III) sulfate
13) aluminum carbonate
14) dinitrogen tetroxide
15) cadmium nitrate
16) chromium (VI) cyanide
17) Three stable isotopes of element X have atomic masses and relative abundances as follows:
Atomic mass = 172.58 amu
Abundance = 54.8 %
Atomic mass = 174.16 amu
Abundance = 12.4 %
Atomic mass = 178.74 amu
Abundance = 32.8 %
For five points, calculate the average atomic mass of element X. You must show your work for full credit.
18) The average atomic mass for element Q is 114.905 amu. The two known stable isotopes of element Q are Q-113 having a mass of 112.962 amu and Q-118 having a mass of 118.186 amu. What is the percentage abundnce of Q-113. You must show your work for full credit. (Neatly would be nice too.)
For two points each, given the exact name for each of the following formulas:
19) OCl6
20) Mn3N7
21) Ag2SO3
22) PbTe2
23) Fe(OCl)2 | 1,424 | 732 | {
"id": "<urn:uuid:edfa6365-3152-4310-8a6c-6dc41f7ff0e8>",
"dump": "CC-MAIN-2017-22",
"url": "http://www.lifesmith.com/VHS%20Web/chem.F'14.test3.pdf",
"date": "2017-05-27T17:35:05",
"file_path": "crawl-data/CC-MAIN-2017-22/segments/1495463608984.81/warc/CC-MAIN-20170527171852-20170527191852-00226.warc.gz",
"offset": 701547072,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.946712076663971,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9782050251960754,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1802,
2576
],
"fw_edu_scores": [
3.578125
],
"minhash_cluster_size": 1,
"duplicate_count": 2
} |
Make Summer
Learning Fun for your Child and You, Too!
You are your child's first and most important teacher. How well children and youth do in school depends a lot on how much their families help them learn at home, and this should be a year-round effort.
For many young people, however, learning stops during the summer, and this can mean trouble. Children and youth who take a summer holiday from learning typically lose one to two months' worth of reading and math skills. They score lower on standardized tests at the end of summer than they do on the same tests at the beginning of summer.
There are lots of ways you can keep your children and teens learning over the summer. Find out what they enjoy and what will keep them motivated. Turn everyday activities into learning-rich experiences for them and you.
Try some of these great ideas and tips:
Read, read, read! Visit your local library often with your child. Get your child his own library card and get one for yourself if you don't already have one.
* Register your child for the library's free summer reading program – encourage your child to read a certain amount to win incentive prizes.
* Read to and with your child, no matter her age.
* Obtain the summer reading list from your school district (check the library, local bookstores or the school's Web site) and make sure your child has access to the books for his grade. Once your child chooses a book to read, read it yourself and talk together about what you're reading.
* Have lots of things to read all over your house – newspapers, magazines, story books, comics, etc.
Practice math daily, as part of activities like cooking, grocery shopping, tracking weather and temperatures, etc. Teaching your child how to read a recipe, measure the ingredients and divide portions equally is a great way to learn fractions.
Encourage your child to write and draw. Give her a journal or notebook (or make one together) and have plenty of pencils, crayons, markers or paints on hand. Give your child a family photo or one cut out of a magazine and have him make up a story or poem about it.
Break out the board games and have a weekly family game night. Games such as checkers, chess, Scrabble, Monopoly and Connect Four help youth develop critical thinking skills.
(please see reverse side)
Prepare for fall. Find out what your child will be learning during the next school year by talking with teachers at that grade level. Have your child preview and practice using free online materials (try www.familyeducation.com) or inexpensive workbooks from teacher supply stores.
Get out and about.
* Get outside and play; limit TV and video game time. Children of all ages need lots of physical activity to stay fit and mentally sharp.
* Enjoy nature – have a picnic, plant a tree, tend a garden, go on a hike and observe plants and animals.
* Take educational trips to places like local parks, museums, zoos and science centers. Have your child help you look for information about places to visit and let her choose where you will go. Look for coupons and discount tickets and pack your own snacks and drinks to make these trips more affordable.
* Let your child take photos of your "field trips" with a digital or disposable camera and encourage him to make a slide show, Web page or poster about your trips.
Do good deeds. Encourage your child to serve others in your community, by doing yard work for an elderly neighbor, visiting a nursing home or hospital, donating old toys or clothes, or working at a food bank or animal shelter. This helps with social and emotional development.
Keep to a regular routine. Though summer should be more relaxed, children still need some structure to guide their days and keep them sleeping well and eating right.
Do you have older youth in your family? Try some of these ideas with them:
Find something that interests your teenager and learn more about it together.
Have your teen teach you something that she knows how to do, like how to set up a page on a social networking site or text message on your cell phone.
Create a family history. Encourage your teen to interview relatives, do genealogy research (try www.ancestry.com) and write your family's story or post it online.
Explore your family's cultural and ethnic heritage more deeply. Cook traditional dishes together; talk about the meaning of traditions and customs in your family.
Follow current events and politics. Read news articles aloud to your teen, then discuss what you have read. Encourage your teen to speak out on local issues that are important to him, for example, by writing a letter to the editor of the newspaper or to a government official. | 1,708 | 952 | {
"id": "<urn:uuid:e17c9a7c-4dea-4be6-aa53-ea7ba06d3a3d>",
"dump": "CC-MAIN-2017-22",
"url": "http://bgcutah.org/wp-content/uploads/2014/08/Parent_Tip_Sheet-Summer_Learning-English.pdf",
"date": "2017-05-27T17:31:15",
"file_path": "crawl-data/CC-MAIN-2017-22/segments/1495463608984.81/warc/CC-MAIN-20170527171852-20170527191852-00232.warc.gz",
"offset": 52093772,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9983673095703125,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.99852055311203,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2309,
4678
],
"fw_edu_scores": [
3.09375
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
5.1 Sums and difference of multiples of 10 up to 100
Cover the 5 with a zero post-it note then, using playing cards, generate calculations.
Either add the two numbers or calculate the
5.4 Doubles of multiples of 10 to 100
Eg double 30 or 80
Use Maths mat two and some playing cards to generate random calculations. How many can you answer in 30 seconds?
5.6 Multiplication and division facts for 3 Timestable Playing cards :
Remove the picture cards from the pack. Pick a card and multiply it by 3 (use Maths mat one to help). How many questions can you answer in 30 seconds? E.g.
5.2 Number bonds to 100
Roll two die treat the first as the tens digit and the second as the ones - ask how many more to make 100. Or use the Maths mat and playing cards.
Eg:
24 +76 = 100
63 + 37 = 100
50 + 50 = 100
Colour the star when you think you have the skill. Remember, you should aim to answer each question in 3 seconds (try to answer 10 or more in 30 seconds). Your teacher will let you know the next time there's an assessment.
5.7 Multiplication and division facts for 6 Timestable
Try starting by rolling one dice and multiplying it by your timestable target. When you're confident, move onto two die.
1 x 6 = 6 so 6 ÷ 6 = 1
2 x 6 = 12 so 12 ÷ 6 = 2
3 x 6 = 18 so 18 ÷ 6 = 3
Extra challenge: try maths mat two to multiply 90 x 3= etc. it will help your place value knowledge!
5.3 Doubles of multiples of 5 to 100
Eg Double 45 or double 90
Use Maths mat one and some playing cards to generate random calculations. How many can you answer in 30 seconds?
5.5 Halves of multiples of 10 to 100
Eg half of 40 = 20 or half of 90 = 45
Use Maths mat two and a pack of cards to generate calculations. Time yourself, see how many you can answer in 30 seconds then try to beat your score!
5.8 Multiplication and division facts for 4 Timestable
Pick a domino, add the number of dots together, then multiply by the table you are working on.
Don't forget to try MyMaths for lots of fun games to help learn your timestables.
There are lots of CDs available with musical tables. Alternatively, a quick search on the internet. Great fun to sing along to on long car journeys! | 1,019 | 599 | {
"id": "<urn:uuid:490f6c07-393d-4ff8-ac63-dbbf8d270a0d>",
"dump": "CC-MAIN-2017-30",
"url": "http://wavell-jun.n-yorks.sch.uk/data/documents/curriculum-space-mission-parent-support-earth.pdf",
"date": "2017-07-24T16:29:32",
"file_path": "crawl-data/CC-MAIN-2017-30/segments/1500549424889.43/warc/CC-MAIN-20170724162257-20170724182257-00135.warc.gz",
"offset": 356984888,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.997991681098938,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.997991681098938,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2207
],
"fw_edu_scores": [
3.796875
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Mission Critical: A Changing Climate
HDF software is still the software of choice—The power and flexibility to spur new discovery.
The year is 1999; the space agency that had landed a spacecraft on Mars and deployed a telescope to observe the far-away galaxies was inaugurating what was arguably its most critical mission.
Remote sensors track Carbon Monoxide from aboard the NASA satellite down to its source
NASA was launching Terra, the first of an eventual convoy of satellites that together would gather a comprehensive picture of Earth's global environment. Terra was the size of a small school bus and was originally equipped with five different scientific sensor instruments. Its orbit was coordinated with those of other satellites then circling Earth's poles so that when data from each were combined, they yielded a complete image of the globe. With each orbit, the picture grew richer.
Another constellation of satellites would be added between 2002 and 2004. They measured different biological and physical processes and revolutionized science's understanding of the intricate connections between Earth's atmosphere, land, snow and ice, ocean, and energy balance. In time, all the combined data would reveal, among other things, the climate trajectory of our planet.
When NASA was searching for the data format with the power and flexibility to
When NASA launched the flagship satellite Terra, they chose HDF as the data format system for their critical, new mission: collecting the first comprehensive pictures of our planet's changing climate.
assemble those portraits, they chose HDF. "Earth as a system is interdisciplinary. That's why the data format needed to be flexible," said Martha Maiden, who was the program manager at NASA Goddard when the space agency turned its attention to Earth. "It wasn't a format but a system of formats," she said. "It could handle any kind of data and scale."
"These were the largest datasets at the time," said NASA's Hampapuram Ramapriyan. "They had volume, variety, and velocity before the Big Data people invented the 3 V's."
In the span of five years, the field of earth science had gone from data poor to data rich. Back then, nearly a terabyte of data per day was transmitted from the Earth Observing System, as the mission was called, to NASA's data archive centers and then re-distributed to thousands of scientists around the world.
In fiscal year 2015, the system added 16 terabytes per day to 12 data archive centers. Now totaling over 14 petabytes, the data encompasses 9,400 different data products. In 2015, 32 terabytes per day were redistributed to more than 2.4 million end users worldwide. The flotilla of satellites monitoring our planet has grown to 18.
Today, HDF is still the data format system of choice. "Our challenge is variety. With HDF we can use one library and provide it to people to read and write a lot of our products," said Ramapriyan. "We are behind the software. It's not something that's going away any time soon." See NASA's Worldview.
HDF-EOS GRIDS, SWATHS AND POINTS
HDF can represent data in countless ways. EOS created a standard way to organize objects, called "HDF-EOS." HDF -EOS expresses how climate scientists think about their data.
HDF-EOS defines "geolocation data types," allowing the scientist to query a file's contents by earth coordinates and time. An example is a "grid data type." An HDF-EOS grid represents locations on a rectangular grid, based on an earth projection, such as UTM. Other types include "swath" (scan lines from a satellite instrument), and
"point" (irregularly spaced locations, such as buoys).
A grid
EOS instruments collect a variety of measurements into many different "products." EOS
products include the original data from satellites, and products derived by various analyses. In all, EOS has more than 9,400 different data products.
HDF-EOS files also include metadata, essential for scientists to find, use, and
understand the data.
A swath
EOS metadata standards assure consistency and completeness, a critical need for software and algorithms to be able to operate effectively on the data.
Software is provided to simplify reading and writing HDF-EOS, and to guarantee consistency. C and Fortran libraries are available, and applications such as MATLAB and IDL have been adapted to understand HDF-EOS files.
The EOS project is a good example of a community or application domain standardizing on a data format. Similar HDF-based standards exist in areas as varied as Bathymetry, Oil and Gas, and medical imagery.
HDF-EOS website | 2,016 | 963 | {
"id": "<urn:uuid:050ac1c3-7dbd-4626-9d31-29144e05a6a1>",
"dump": "CC-MAIN-2017-30",
"url": "http://ftp.hdfgroup.org/EOS_Vignette.pdf",
"date": "2017-07-24T16:40:25",
"file_path": "crawl-data/CC-MAIN-2017-30/segments/1500549424889.43/warc/CC-MAIN-20170724162257-20170724182257-00139.warc.gz",
"offset": 127319218,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.998856782913208,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.998856782913208,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
4596
],
"fw_edu_scores": [
3.0625
],
"minhash_cluster_size": 2,
"duplicate_count": 2
} |
SARS-CoV-2 VIRUS TRANSMISSION
PERSON-TO-PERSON
SARS-CoV-2 (the virus that causes COVID-19) is primarily transmitted person-to-person
The virus is carried through moisture droplets (like spit and mucus) and released into the air through coughing, talking, singing, yelling, sneezing, etc.
Viral particles in these moisture droplets in the air can attach to cells in a healthy person, infect, replicate, and be dispersed again to infect other healthy people
Particles usually only travel a few feet, which is why physical distancing of at least six feet is recommended. The highest risk zone for infection is to be closer than six feet. However particles may also travel further by aerosols and air conditioning/vents can help them move further from an infected person.
Masks and face coverings are recommended since they trap some or most of these viral particles in the moisture droplets, reducing the spread of the virus.
SURFACES
Surfaces have shown to be a factor in transmission, although probably much less than person-to-person transmission
Published cluster investigations have documented only a few instances of surface related cases. Surfaces are increasingly thought to not be major source of infection.
Virus that is on a surface would have to be touched by a person, and then that person would have to touch their mouth, nose or eyes and the virus would need to migrate to a cell with the proper receptor
Viruses on surfaces become less infectious over time, depending on the surface material, temperature and other factors
When a person touches a surface, not all of what is on that surface will be transferred to their hand, which is part of why surface transmission is less likely than person-to-person transmission
FOOD
There are no documented cases of COVID-19 being contracted from food, but there have been several instances at places where food is served or sold due to person-to-person transmission especially without face coverings.
No clusters of illnesses linked to food consumption or handling have been observed anywhere in the world, but epidemiologists and food safety professionals continue to look for links.
The virus must come in contact with cells containing a specific receptor that allows entry into a cell and causes an infection. Moisture droplets inhaled appear to be the best way that the virus makes its way to respiratory cells and causes in infection resulting in the most serious COVID-19 symptoms. The virus can be found in salivary glands, and has been recovered from fecal matter but these sources have not been shown to lead to clusters of infections.
Scientists believe that infection through the digestive tract is not very common as stomach acid helps inactivate the virus
ext.vt.edu/covid-19updates
Updated
August 26,
FST-381-3NP
2020 | 1,142 | 572 | {
"id": "<urn:uuid:bc541bc8-a282-4959-999c-bf950937fca5>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.pubs.ext.vt.edu/content/dam/pubs_ext_vt_edu/FST/fst-381/fst-381-3/FST-381-3.pdf",
"date": "2022-08-10T07:54:29",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00393.warc.gz",
"offset": 838992579,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9985548257827759,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9985548257827759,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2796
],
"fw_edu_scores": [
2.84375
],
"minhash_cluster_size": 3,
"duplicate_count": 0
} |
WILDFLOWERS AND PERMACULTURE
The wildflowers planted in the meadow and now in a riot of bloom, and it seems like only half of the types have bloomed so far, so we have more colors to go. The grasses are slowly growing in in between. I understand from the sources I have read on Native California Grasses, that I should expect this first year to be mostly establishing root structure with a little bit of grass above the ground, and that next spring is when I can expect to see more growth. In the mean time, however, the flowers are giving us plenty of green.
The various edible cultivars of plants that we have in the yard are being grown in "guilds" of plants with an eye towards permaculture. Guilds are groups of plants that have been found to work very well together because they each provide something that the other plants around them need, whether it be acidification of soil, shade, nitrogen fixing or simply support for the other to grow on. If carefully selected and sited, guilds overall require less water, harbor fewer pests, suppress weeds, and are more more productive without needing chemical fertilizers. Our (grey water irrigated) fruit trees are interplanted with blueberry bushes. This year we are sheet mulching around the trees and bushes to bring the new trees through the hot summer with a minimum water requirement while they establish their roots. Sheet mulching consists of a layer of corrugated cardboard over the ground covered with compost and mulch to a foot deep and left to rot for a year, and it is excellent for suppressing weeds which otherwise would be a constant battle. Next spring after the sheet mulching has had a year to decompose, we will interplant legumes of various sorts all through the orchard. (You will also see that we have finally replaced our fence all the way around, getting rid of the rotting, leaning, broken eyesore that we had before and replacing it with a fence with a custom top lattice that echos the horizontal bar design theme within the house.)
The fruit tree orchard with blueberry bush interplantings, sheet mulch and the new fence visible along the right side
Our citrus trees have pineapple guava (aka feijoa), blackberries and raspberries interplanted around them. We haven't yet sheet mulched that area, so in the picture you can see that the weeds are already aggressive in that area.
As part of getting the fence replaced, we needed to move all of the piles and piles of stones that we had been hoarding all over the yard for the eventual construction of two ponds and a stream in the front and middle yards. We decided to assemble them into a dry creek bed of sorts running through the area where we will eventually have the stream so that we could plant all of the appropriate plants around that area before we built the stream (in one or two, or three years). It ended up looking surprisingly nice, and it is extremely useful for planning where plants are going to go. We've put in some douglas iris and various Juncusvarieties that are difficult to grow from seed (I've been trying, and haven't been too successful), and all around the stream bed on the greywater wetlands we've planted bull clover, so hopefully we'll be seeing some of that coming up soon.
The dry creek running through the grey water wetlands
Other edible plants in the yard include an old fig tree that produces luscious pale green figs with bright red interiors, a couple of passiflora edulis varieties, huckleberries and currants and wild strawberries as part of the redwood understory in the front yard, and, of course, a kitchen garden of various different herbs including lots of mint for mojitos | 1,297 | 790 | {
"id": "<urn:uuid:0b20a220-66a8-48fd-b637-b35a31787601>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.idc-online.com/technical_references/pdfs/civil_engineering/Wildflowers_and_permaculture.pdf",
"date": "2022-08-10T08:30:42",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00392.warc.gz",
"offset": 715271470,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9970405101776123,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9983932971954346,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2024,
3256,
3672
],
"fw_edu_scores": [
2.03125
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
GENDER, WATER AND CLIMATE CHANGE
Climate change is a reality, and poses a serious long term threat to society and to the environment. Scientists have generated significant evidence that the use of fossil fuels, deforestation, and changes in land use have led to an increase in greenhouse gases (GHGs) in the atmosphere, causing the Earth's surface temperature to rise.
This has already and will continue to result in changing rainfall patterns: heat waves; melting of glaciers; increases in frequency and magnitude of extreme weather events such as storms, floods and droughts; and rising sea levels. These climate-related events—compounded by poverty, environmental degradation, and inadequate disaster management—have profound impacts particularly on poor women, men and children who may have less capacity, skills and resources to adapt.
Water—the basis for human life—is particularly threatened by climate change. With rising temperatures, changes in runoff patterns and increased water evaporation, climate change will greatly affect the distribution of the world's water and the timing of flowsii. It is estimated that by 2025, almost two-thirds of the world's population are likely to experience some kind of water stress, and for one billion of them the shortage will be severe and socially disruptiveiii. Water-related challenges arising from climate change include:
Decrease in water availability and deteriorating water quality will reduce access to drinking water and negatively affect the health of the poor.
Shifts in rainfall patterns and growing seasons, escalating floods and droughts, reduced soil moisture and fertility combined with land use degradation will result in decreased agricultural and livestock production and food insecurity.
Increases in storms and flooding will lead to loss of lives and infrastructure; loss of property and assets including crops, livestock and seeds; and spreading disease.
Accelerated glacial melt, decreasing run-off and changes in hydrological flow will affect crop production and fisheries as well as energy production dependent on hydropower systems, potentially exacerbating cross-boundary tensions. Seven major river systems of Asia that provide and sustain food supplies for over 2 billion people will be affected.
Rising sea levels will directly threaten the livelihoods of millions of people living in low-lying coastal areas, with increased flooding, coastal erosion, and seawater intrusion.
Such challenges of climate change are not gender neutral. Women and men have different vulnerability and capacity to adapt to climate impacts due to differing roles, opportunities, and access to resources. And it is women making up 70% of the world's poor who are often the most vulnerable to climate change. They are hindered by discriminatory social practices, diverse work responsibilities that may augment their exposure to climate hazards, and less access or rights to financial and productive resources, information and services that may help them cope with impacts. Despite this, women will play a significant role in supporting households and communities to adapt to and mitigate climate change through labour, natural resource management, provisioning of food and water. However, women are seldom involved in decision-making processes related to water or other resource use, or in short or long-term planning for climate change. As a result their concerns are less likely to be addressed in relevant policies.
Mitigation policies and practice are also gendered. Since the energy sector counts for 60% of total greenhouse gas emissions worldwideiv, mitigation efforts concentrate on 'greening' energy production and consumption, in addition to addressing the other main causes of emissions by reducing deforestation and land degradation. Energy production will also be a key factor for economic development and poverty alleviation. However, few policies or political decisionmaking processes consider that energy use—whether at household or industry levels—differs among women and men, as does access to energy efficient technologies. Nor do these policies consider how roles and relationships of women and men are critical for REDD (Reducing Emissions through Deforestation and Degradation) programmes. As a result, women and men's differential concerns are not considered in mitigation efforts, potentially limiting their effectiveness and creating inequities in access to energy, new technologies, and benefits of climate change financing.
Despite the critical importance of gender in effective adaptation to and mitigation of climate changev, gender issues continue to receive minimal attention in UNFCCC processes dealing with international policy responses on climate changev and in national level strategies.
Source:
http://www.iwawaterwiki.org/xwiki/bin/view/Articles/GenderWaterandClimateCh ange | 2,033 | 877 | {
"id": "<urn:uuid:f88fc1f5-5da2-4d15-b97b-d46e388c0181>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.idc-online.com/technical_references/pdfs/civil_engineering/Gender_Water_and_Climate_Change.pdf",
"date": "2022-08-10T07:59:07",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00398.warc.gz",
"offset": 709769405,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9964756220579147,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.997042179107666,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
842,
2282,
3483,
4881
],
"fw_edu_scores": [
2.78125
],
"minhash_cluster_size": 1,
"duplicate_count": 2
} |
Key Elements for a Good Presentation
Zhouchen Lin
Oct. 24, 2002
Outline
* Goals of presentation
* First and foremost: Everyone CAN give good presentations!
* Top importance: Passion and Enthusiasm!
* Good verbal skills
* Good vocal habits
* Good visual behavior
* Good organization
* Tips for PPT & Defense
* Plentiful preparation
* Good delivery
* Conclusions
Goals of Presentation
* Persuade somebody
– appear convincing
* Convey information
– be effective
Everyone CAN give good presentations!
Just -
* Practise and improve
* Be confident
Top importance: Passion and Enthusiasm!
You are the first people to care about your presentation!
* You will appear convincing
If you are passionate -
* Your vocal & visual skills will come naturally
* The audience can be attracted
* Your faults will be overcome and overwhelmed
Good verbal skills
* Accounts for 7% of communication
* Be simple & clear
– Use simple & unambiguous words and short sentences
– Do not ramble
– Stop when necessary or having difficulty
Good vocal habits
* Accounts for 38% of communication
* Speak loudly, in moderate or slow speed
* Play your voice with pitch and tempo
* No "UM"s and "ER"s
Good visual behavior
* Accounts for 55% of communication
* Most important
– Appear trustworthy & respectful
Good visual behavior (cont'd)
* Components of visual skills
– Eyes
* look forward at audience, don't look too much at computer screen or your notes
* look at people's faces (not eyes), shift randomly
– Body
* Sit or stand with your head up
* Don't rock, shake or lean too much.
– Hands
* Gestures come naturally and match your talk
– Face
* Show you are interested and concentrated
Good organization
* Choose appropriate content
– In different levels of details
– But only one take-home message
* Arrange logically
* Smooth transition
* Good writing style
– Simple and clear
* Each page: 1 idea; 3 sub-concepts; ≤ 6 lines
* Not necessary complete grammar
* Readable – Big & color-coordinated
* Illustrations are very helpful
* No unduly fancy animation
– Conclusion: the last chance to convey your information
Tips for PPT
* Use more images/figures than words
* Use only one font (微软雅黑recommended) and simple background (unless you are good at design)
* The font size of the same level of sentences should be the same (unless too crowded)
* The size and contrast should make characters and curves clearly visible at 5X distance of the screen size
* Title of each page should summarize the page well
– The pages on the same topic should bear the same title
* Cite briefly
* Add "Page # / Total Page #" to each page
* Control audiences' attention by animation
Tips for Defense
* The goal is to enable the referees to get your contributions quickly
– Based on what you have done
– Don't simply repeat the content of thesis
* Show the overall structure of your thesis
– Connection between chapters
* Differentiate clearly which are others' works and which are yours
Tips for Defense
* Don't go into too many technical details, highlight instead
– Contributions of your thesis
– Difficulties of your research
– Main ideas of your methods
– Difference from related works
– Why you do in this way
– Performance gain
Plentiful preparation
* Examine the slides as if you are an audience
* Timing
* Details at the middle
* Spell & grammar check!
* Don't read the slides!
– Write speech notes and put them beside you
* Anticipate questions
* Rehearsal
Good delivery
* Overcome language barriers
– Take the speech notes with you, memorize them if necessary
– Use simple words and sentences only
* Overcome nervousness
– Don't let the shaking show!
– No one will laugh at you!
* Make a fist; hold the lectern
– Look at a friendly face
* Take a deep breath
– Look above people's heads
– Attract attention
* Impressive opening and ending
– Humor
– Repeat the central message of your presentation
Conclusions
Good presentation is possible if you
* believe in this
* are willing to practice and
* pay attention to some skills | 1,922 | 933 | {
"id": "<urn:uuid:87c027d2-60c0-4039-9002-8ae92b0f592b>",
"dump": "CC-MAIN-2022-33",
"url": "https://zhouchenlin.github.io/Key%20Elements%20for%20a%20Good%20Presentation.pdf",
"date": "2022-08-10T08:08:19",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00397.warc.gz",
"offset": 933665238,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9667540431022644,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9928058981895447,
"per_page_languages": [
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
65,
364,
464,
550,
832,
1020,
1178,
1288,
1672,
2102,
2652,
2958,
3207,
3441,
3883,
4013
],
"fw_edu_scores": [
3.359375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Essential
Detecting and Managing Urinary Tract Infections
Your name:
Date:
Part A
Please tick the correct TRUE or FALSE ANSWER.
Example: A care plan should evolve over time to incorporate changes in the resident's needs.
True
☒
False ☐
1. The majority of UTIs occur in the upper urinary tract.
True ☐
False ☐
2. If a person has a urinary tract infection their urine may have a particularly strong odour.
True ☐
False ☐
3. If left untreated, bacteria from a UTI can enter the blood stream and travel to other body systems.
True ☐
False ☐
4. Serious or recurrent UTIs could lead to complete renal failure, sepsis and septic shock.
True ☐
False ☐
5. Urinary tract infections are inevitable for older people.
True ☐
False ☐
Detecting and Managing Urinary Tract Infections
PART B
Select the MOST CORRECT answer from the options below each question.
Example: Person centred care planning should consider these needs of the older person:
a) Physical and medical ☐
b) Medical and psychological ☐
c) Social and spiritual ☐
d) Physical, medical, psychological, social and spiritual
☒
1. A symptom of a UTI might be:
a) Pain when passing urine ☐
b) An increased appetite ☐
c) Constipation
☐
d) All of the other answers ☐
2. The upper urinary tract is made up of the:
a) Kidneys and ureters ☐
b) Kidneys and bladder ☐
c) Bladder and ureters ☐
d) Bladder and urethra ☐
3. A symptom of a urinary tract infection may include pain in the:
a) Back ☐
b) Sides
☐
c) Abdomen ☐
d) All of the other answers ☐
4. One of the most common organisms that causes bacterial infection of the urinary tract is found in the gastrointestinal tract and is called:
a) Escherichia coli (E. Coli) ☐
b) Campylobacter jejuni ☐
c) Staphylococcus aureus ☐
d) Lactococcus ☐
5. When undertaking a urinalysis for urinary tract infection you specifically need to look for:
a) Leukocytes ☐
b) Osteocytes ☐
c) Hemocytes ☐
d) All of the other answers ☐
Detecting and Managing Urinary Tract Infections
PART C
Select the MOST CORRECT word or phrase to complete the sentence.
Example: A resident's ………. signs such as temperature are also described as "obs" or "observations."
a) life
☐
b) vital ☒
c) key ☐
1. The urinary …………………. Is a series of channels within the urinary or renal system, enabling urine to pass from the kidneys out of the body.
a) Tract ☐
b) Vessel ☐
c) Duct ☐
2. The urethra and bladder are classified as the …………………. urinary tract.
a) Upper ☐
b) Middle ☐
c) Lower ☐
3. According to the course, a urinary tract infection can develop into a very serious illness in a matter of ………………….
a) Minutes ☐
b) Hours ☐
c) Days ☐
4. When a person experiences a UTI more than …………………. in any three month period it is considered a recurrent condition.
a) Once ☐
b) Twice ☐
c) Three Times
☐
5. …………………. urinary tract infections can lead to renal impairment and reduced kidney function.
a) Recurrent ☐
b) Occasional ☐
c) Continuous ☐
DISCLAIMER:
Except where otherwise stated, scenarios depicted in this course are fictional and any resemblance to any person or event is purely coincidental. The information in this course has been prepared as general information only. It is not intended to provide legal, industrial or other specialist advice and should not be relied upon as such. All advice and information are professionally sourced and provided in good faith and, while all care has been taken, no legal liability or responsibility is accepted for any possible error. For direction concerning your particular circumstances, independent advice should be sought. Copyright 2016. The contents of these Learning Resources remain the property of ACC. They are for the exclusive use of current members of ACC; their use, distribution, and storage are subject to the terms and conditions laid out in Membership Agreements. | 1,890 | 996 | {
"id": "<urn:uuid:9fc33179-ae0f-48f5-a92e-bbf0e2767d2d>",
"dump": "CC-MAIN-2022-33",
"url": "https://dg8gmvcchce9m.cloudfront.net/uploads/resource/file/6460/Essential_Assessment.pdf",
"date": "2022-08-10T08:48:28",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00398.warc.gz",
"offset": 216736065,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9116443196932474,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9858089685440063,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
743,
1964,
3869
],
"fw_edu_scores": [
3.046875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
UNIVERSIDADE FEDERAL DO ESPÍRITO SANTO COMISSÃO COORDENADORA DO VESTIBULAR PROCESSO SELETIVO UFES 2012
As bancas elaboradoras esperam obter da maioria dos candidatos respostas como as que seguem. No entanto, para a correção das provas, outras respostas também poderão ser consideradas, desde que corretas.
LÍNGUA INGLESA
1 a QUESTÃO
As respostas abaixo são apenas exemplos de possíveis respostas.
1. That they are elitists or pretentious.
2. They use it mostly to humiliate others, and argue about minor errors they make in language use.
3. Because he is sure that people who are obsessed about linguistic accuracy are unable to take pleasure in "playing" with language for different purposes.
4. Because Shakespeare was constantly manipulating language and often transformed nouns into verbs.
5. Because in both situations there is no "right" or "wrong". One's choices will always depend on context.
2 a QUESTÃO
1. By the time the girls were old enough to go to school, they had outgrown their uniforms.
2. The neighbors were constantly sneering at any newcomer.
3. The kids mocked their teacher's clothes, when they first met him.
4. Dad used to advise us to agree with the opinion of the majority, in order to avoid trouble.
5. He was terribly selfish and learned how to bother with nobody else.
UNIVERSIDADE FEDERAL DO ESPÍRITO SANTO COMISSÃO COORDENADORA DO VESTIBULAR PROCESSO SELETIVO UFES 2012
3 a QUESTÃO
1. Language is constantly changing; therefore, writers should be as updated as possible.
2. Despite the fact that prejudice against linguistic innovations exists, Stephen Fry is a strong defender of the free use of language.
3. Although many people are against nouns becoming verbs, Stephen Fry often makes use of such verbs.
4. Picasso, Stravinsky and Eliot were once considered ugly; however, today they are thought to be great artists.
5. Unlike most educated people, Stephen Fry is not obsessed about linguistic inadequacy.
4 a QUESTÃO
1. He said that it was a cause of some upset that more Anglophones didn't enjoy language.
2. He also insisted that none of those were of importance.
3. Then, he argued that there had been few greater and more complete lords of language in the past thousand years.
4. He also added that it was ugly in the way Picasso, Stravinsky and Eliot had been once thought ugly.
5. He ended by declaring that pedants would also claim that their fight was only for clarity.
5 a QUESTÃO
1. decided
2. picked
3. turned
4. accused
5. scratched
6. moved
7. told
8. called
9. served
10. saw | 1,175 | 616 | {
"id": "<urn:uuid:5ff417f2-52e7-42c1-9a3e-fc9ed33326f9>",
"dump": "CC-MAIN-2022-33",
"url": "https://vagas.ufes.br/sites/processosseletivos.ufes.br/files/ps2012_Etp2_LinguaInglesa.pdf",
"date": "2022-08-10T07:26:38",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00398.warc.gz",
"offset": 541310230,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9865939915180206,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9969338774681091,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1305,
2549
],
"fw_edu_scores": [
2.375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Groundwater Investigation
BACKGROUND
In 2016, the SCRD initiated a groundwater investigation project to supplement and diversify current water sources. This was a recommendation of the Comprehensive Regional Water Plan.
Phase 1 consists of a feasibility study to identify aquifers for potential water production.
Sites with high probability of yielding high quality water at a volume significant enough to justify development costs are selected.
The selected sites are in geological formations with quick recharge and unconsolidated material from previous glaciations. They are ideally protected from surface contamination with an impervious rock layer.
Phase 2 involves drilling test wells on the identified sites and testing for maximum yield, water quality, sustainable production, and potential impacts on other groundwater users.
Phase 3 involves conceptual design and budget for connecting the well to the Chapman Water System. A water license application is submitted to the Province. More detailed studies to determine maximum sustainable yield and impacts to neighboring creeks and water right holders may be needed.
Phase 4 consists of the preparation of final design and construction tendering documents.
Phase 5 consists of construction and commissioning.
This involves drilling the well, installing a pump and bringing power to the sites. Construction of transmission mains are necessary in order to bring water to a treatment site.
The sites the SCRD is pursuing have high water quality and will only require chlorination to ensure water safety in the distribution system.
Water then goes to a pump station and, in some cases, to a reservoir at higher altitude. The reservoirs buffer changes in water demand and keep the water system pressurized so water flows from your tap.
TIMELINE
WHERE DOES GROUNDWATER COME FROM?
Groundwater is an important part of the water cycle. It comes from rain, snow, sleet and hail that soak into the ground. The water moves down into the ground because of gravity, passing between particles of soil, sand, gravel, or rock, until it reaches a depth where the ground is filled, or saturated, with water.
SUSTAINABILITY AND LEGISLATIVE FRAMEWORK
These aquifers may be small, only a few hectares in area, or very large, underlying thousands of square kilometers of the earth's surface.
The area that is filled with water is called the saturation zone and the top of this zone is called the water table. The water table may be very near the ground's surface or it may be hundreds of meters below.
Even if groundwater is not used by people, it may still play an important role in the local environment and sustain rural livelihoods that way.
Although groundwater exists everywhere underground, some parts of the saturated zone contain more water than others. An aquifer is an underground formation of permeable rock or loose material which can produce useful quantities of water when tapped by a well.
Under natural conditions water in aquifers is brought to the surface by means of a spring, a borehole or can be discharged into lakes, streams or the ocean. We as humans can extract groundwater through a borehole which is drilled into the aquifer.
(Source:Wikipedia)
In British Columbia, the Water Sustainability Act regulates groundwater via the The Ministry of Forests, Lands, Natural Resource Operations and Rural Development (FLNRORD).
In order to get a water licence for groundwater from FLNRORD, an application needs to demonstrate what the maximum sustainable yield for the aquifer is. Applications also cannot negatively impact other water right holders, land owners, the environment and the rights and title of First Nations.
For up to date information on the groundwater investigation project, visit:
www.scrd.ca/groundwater-investigation | 1,529 | 728 | {
"id": "<urn:uuid:ee24a748-7230-42fd-8d6a-66eddea966c6>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.scrd.ca/files/File/Infrastructure/Water/Groundwater/2019-Groundwater%20Investigation-%20BACKGROUNDER.pdf",
"date": "2022-08-10T07:19:50",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00401.warc.gz",
"offset": 856228484,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9966813027858734,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9968385100364685,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1811,
3816
],
"fw_edu_scores": [
3.03125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
English: Reading into Writing
◊The Lost Happy Endings: We will be exploring a lovely picture book about a girl who collect lost happy endings. From this, we will be writing a prologue to go with this book
◊Beowulf: This is a retelling (written by Michael Morpurgo) of a classic poem, where a murderous monster stalks the night, and only the great prince of the Geats has the strength and courage to defeat him We will also be continuing to explore VIPERS deeper and begin to get a secure understanding of how to answer these style questions
Science
Properties and Changes of Materials
We will be continuing our exploring from the previous term, where we will carry out investigations to explore reversible and irreversible changes. A focus will be placed on working scientifically and using technical scientific vocabulary.
History & Geography
Blue Planet!
We will be exploring the dangers our oceans are facing; over fishing, climate change, plastic pollution and global warming. This will allow us to have important discussions about the changes that can be made to make our world a better place.
PSHE
Rights and Responsibilities: We will be understanding how money, living in the wider world and environment effects us.
Year 5
Spring 2 nd half BLUE PLANET
Music
Learning Viking saga songs about the Gods of Viking mythology. looking at how composers use sounds to depict landscape and journeys.
French
During the second part of the term, the children will find out to give directions to different places around a town.
RE
Exploring the Christian festival of Easter and Easter why it is so important.
Maths
◊Fractions: Adding and subtracting fractions; multiplying fractions; fractions of amounts; fraction problem solving
◊Decimals and Percentages: decimals as fractions; decimal place value; thousandths; rounding; ordering and comparing; understand percentages; equivalent fractions, percentages and decimals
We will be using a range of manipulatives to deepen our understanding of these key concepts, which will further support us in solving mastery problems
PE
◊We will be explaining golf outside, where we will develop our aiming and technique in our skills.
◊In the hall, we will be dancing. We will be learning the Haka and then creating our own version based on one of our favourite sports
Computing
We will be creating our own webpages to share on the dangers that our oceans are facing
Art/ D&T
Exploring a range of materials to make CAM Toys representing animals in the ocean. We will be using a wide range of resources to create these. | 1,024 | 525 | {
"id": "<urn:uuid:04c2b0c7-f6dd-4dab-bcc6-5ae4d74a6cc9>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.lmpsdorset.org/attachments/download.asp?file=8672&type=pdf",
"date": "2022-08-10T08:56:11",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00400.warc.gz",
"offset": 758008318,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9978724122047424,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9978724122047424,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2576
],
"fw_edu_scores": [
3.703125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Reading Guide to the Scientific Revolution: New Directions in Thought and Culture in the 16 th and 17 th Centuries.
DIRECTIONS: Study each document or reading—respond to the questions in your notes. Organize your notes in like fashion. Leave room after each reading for additional discussion notes.
EVE OF THE SCIENTIFIC REVOLUTION:
Michael Postan, "Why Was Science Backward in the Middle Ages" (p. 229‐231 Sherman):
1. Why was scientific innovation lacking in the Middle Ages?
2. What typically medieval traits discouraged the men of the Middle Ages from Scientific exploration?
Sir George Clark, "Early Modern Europe: Motives for the Scientific Revolution." (p. 231)
1. What led men to engage in scientific work in the 17 th century more so than in the preceding centuries?
Chapter 14 Introduction (p. 449‐450 Kagan):
1. What scientific changes swept through Europe in the 16 th and 17 th centuries?
2. What was the study of science called in this era?
3. What other two forces in history simultaneously challenged European thought and culture? What impact did these two forces have on European thought?
EVENTS AND CHARACTERISTICS OF THE SCIENTIFIC REVOLUTION:
The Scientific Revolution (p 450‐455 Kagan):
1. How would you define the term "Scientific Revolution"? How does the author define this era? In what ways was the event truly revolutionary?
2. Describe the Ptolemaic System. (Key terms: Ptolemy, Geocentricism, Aristotle, epicycle, deferent)
3. Discuss the contributions of Copernicus, Brahe, Kepler, Galileo, and Newton to the new science of the 16 th and 17 th century? Which do you think made the most important contributions and why?
Philosophy Responds to Changing Science (p.455‐457 Kagan):
1. How did the proponents of the new science seek to explain the world? How did this view influence society? Explain.
2. According to Francis Bacon…
a. What was the goal or purpose behind the new science?
b. What approach should natural philosophers employ in the search of truth and in the discovery of new knowledge?
Women in the World of the Scientific Revolution (p. 467‐468 Kagan):
1. What factors prevented women from fully participating in the new science?
2. Discuss the contributions of Margaret Cavendish.
CHALLENGES TO THE SCIENTIFIC REVOLUTION:
The New Science and Religious Faith (p. 468‐469 Kagan):
1. What potential challenges did the new science pose to religion?
2. Describe the case of Galileo.
Galileo Galilei, "Letter to Christina of Tuscany: Science and Scripture." 1615. (p. 226‐227 Sherman)
1. According to Galileo, what kind of topics or questions are appropriately scientific and which are appropriately religious?
2. How do Galileo's views relate to Petrarch's who wrote in an earlier time?
3. Why are Galileo's views so crucial to the new movement in science?
"The Papal Inquisition of 1633: Galileo Condemned." (p. 227 Sherman)
1. Why were Galileo's views so threatening to the Church?
2. What are some long‐term consequences of the Church's stance toward these views? | 1,514 | 702 | {
"id": "<urn:uuid:b89164bc-df4f-46dd-93e3-7ba83969aa5c>",
"dump": "CC-MAIN-2018-43",
"url": "http://www.worldhistory10.com/uploads/7/4/6/7/7467507/reading_guide_to_the_scientific_revolution.pdf",
"date": "2018-10-23T17:04:43",
"file_path": "crawl-data/CC-MAIN-2018-43/segments/1539583516480.46/warc/CC-MAIN-20181023153446-20181023174946-00124.warc.gz",
"offset": 571249565,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9893735647201538,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9893735647201538,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3029
],
"fw_edu_scores": [
3.578125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Lab Title:…Learning…………………………………...….Lab #...1...
Lab Partners: ……………………………………………………………………………
Your Lab Score will be based on the following:
Neatness: All labs must be well-written and done in pencil unless directed otherwise. There are to be no cross-outs or misspelled words. Questions should be answered in complete sentences.
Accuracy: Certain questions will be checked for accuracy.
Completeness: All questions are to be answered completely. There are to be NO BLANKS or incomplete sections.
Lab Class Procedure: You are to follow directions and use lab equipment properly, work for the entire period, and follow proper clean-up procedures
Rubric:
You are to submit all lab material with this lab report:
Comments:
Auditory and Visual Learning
Introduction:
This lab will test two ways of learning: visual and auditory. Most people are better at one type of learning than the other. Visual learners retain more when they see it and auditory learners remember more when they hear it. Learning can also be affected by your surroundings and background. Even so, the bottom line is everyone can learn. Some people are more willing to work at it than others.
Pre-lab questions:
1. Do you think you are a better visual or auditory learner?
2. Are there other ways other than visual and auditory learning? Give an example.
Visual Learning
You will be shown a picture that contains twenty objects for thirty seconds. Study it carefully, but do not write anything down. When instructed, write down as many of the objects as you can remember. Order is not important.
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
How many objects did you remember correctly? _______________
What was the class average? _______________
Can you give any reasons why you remembered those objects better than the others?
Was there any special method you used to help remember the pictures?
What could have been done (other than writing them down) to help you remember the objects better?
Auditory Learning
You will be read a list of twenty words. Listen carefully. Do not write anything down (yet). Immediately after you have heard the entire list, write down all of the words you can remember. Order is not important.
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
______________ ______________ ______________ ______________ ______________
Analysis
The list will be repeated and a number given to each word from 1 to 20. Write down the number in front of the words you recalled. Write down the number of people that also remembered the word after it. For words you didn't recall, simply write the word and the number of people that did recall it in the remaining blanks.
On the graph paper plot the following graph: number of people recalling words vs. word position
Does the graph show a pattern? Describe it.
Which of the words was recalled the most? ___________
What number was it? ___________
Which word was recalled least? ____________
What number was it? ___________
Do you think you will remember those words tomorrow? ___________
If you wanted to remember them, how would you do it?
Going Further
Mistakes are an integral part of the learning process. Unfortunately, we are trained at a very young age to think that mistakes are bad and to be avoided at all costs. Though there are plenty of examples of mistakes with dire consequences that should be avoided, trying to learn something but getting it wrong can be one of the best ways to learn something. If you didn't get to see one in class, check out a TED talk on learning from mistakes (or even if you did, watch another one). Then write a short (and G-rated) paragraph detailing:
- A mistake you made
- How you corrected it
- What you learned from it | 1,963 | 825 | {
"id": "<urn:uuid:3960f3d1-9106-442a-a201-b0be85d72d78>",
"dump": "CC-MAIN-2018-43",
"url": "http://mrulrichslandofbiology.com/Labs/Lab-AuditoryAndVisualLearning.pdf",
"date": "2018-10-23T16:05:04",
"file_path": "crawl-data/CC-MAIN-2018-43/segments/1539583516480.46/warc/CC-MAIN-20181023153446-20181023174946-00128.warc.gz",
"offset": 245632927,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9983875751495361,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9995798468589783,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
729,
2242,
4167
],
"fw_edu_scores": [
4.3125
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
The Bubonic Plague Student Worksheet
Introduction:
Medieval European writers believed that the Bubonic Plague began in China in the early 1330s. Since China was one of the busiest of the world's trading nations, it was only a matter of time before the outbreak of plague in China spread to western Asia and Europe along trade routes.
The plague was carried primarily by flea-ridden rodents. Outbreaks spread rapidly. Victims of bubonic plague usually suffered from high fevers and painful swellings. Sixty percent of those infected died, often within the first five days. The disease also causes spots on the skin that are red at first and then turn black.
One of the most effective measures taken against plague was the practice of quarantining, which was first used in 15th-century Italy. Travelers were expected to carry certificates of health indicating that they had not been exposed to epidemic disease. By the 16th century it became virtually impossible to move out of areas under quarantine.
Directions:
Go to http://www.fordham.edu/halsall/source/decameronintro.html and answer the following questions:
Boccacio's Decameron
1. According to Boccacio, what brought about the "deadly pestilence" from the Orient?
2. According to Boccacio, how did city officials deal with the disease?
3. Since physicians could neither cure nor prevent the disease, and because "all died three days after the appearance of the first outward signs," what were some of the ways in which people coped with the prospect of imminent death?
4. Why does Boccaccio claim that "reverence for the laws, both of God and of man, fell apart and dissolved"?
5. Boccaccio describes how incredibly contagious the plague was. How did this affect the ways in which people dealt with one another?
6. Why does Boccaccio claim that "As for the lesser people, who were for the most part middle class, they presented the most miserable spectacle"?
7. In what ways did the countryside suffer from the effects of the plague?
Hans Holbein the Younger: The Dance of Death
Go to http://www.image.pe.ca/index/woodcut/holbien.html and answer the following
questions:
8. What symbol does Holbein use to represent death in his woodcuts and why might he have chosen this image?
9. Which members of society does Hobein show being affected by the plague? How can you recognize the different classes?
10. What might Holbein's motive have been for representing all levels of society in his woodcuts? | 996 | 542 | {
"id": "<urn:uuid:34d5417c-8aa1-4c11-b04f-7d307120b26d>",
"dump": "CC-MAIN-2018-43",
"url": "http://alvaradohistory.com/yahoo_site_admin/assets/docs/The_Bubonic_Plague.231143538.pdf",
"date": "2018-10-23T17:27:58",
"file_path": "crawl-data/CC-MAIN-2018-43/segments/1539583516480.46/warc/CC-MAIN-20181023153446-20181023174946-00127.warc.gz",
"offset": 16443376,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9993672072887421,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9992111325263977,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2124,
2463
],
"fw_edu_scores": [
3.609375
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
B.C.'S SALMON FARMERS WELCOME COORDINATED EFFORT TO LEARN ABOUT AND PROTECT WILD SALMON DURING INTERNATIONAL YEAR OF THE SALMON, AND BEYOND
October 11, 2018
CAMPBELL RIVER B.C. - The International Year of the Salmon announced earlier today is a unique opportunity to learn more about the five species of wild salmon of B.C.'s coast, and protect them through concrete action and science.
"As farmers in our ocean we are passionate about wild salmon and have a duty to be part of the solution to the challenges they are facing," said John Paul Fraser, Executive Director of the BC Salmon Farmers Association. "The International Year of Salmon is a unique opportunity to bring together scientists, First Nations, governments, companies, and other interests in Canada and around the world to share ideas and insights and celebrate these important species. B.C.'s salmon farmers are already supporting independent research, wild salmon habitat restoral projects, and hatcheries and are committed to doing even more in support of the International Year of the Salmon."
The BC Salmon Farmers Association was among the first to step up and sponsor a $1.1-million science expedition researching Pacific salmon in the deep ocean planned for this winter – the Signature Program – organized by Fisheries and Oceans Canada scientist emeritus Dr. Dick Beamish. Seventeen volunteer scientists from Canada and other Pacific countries will board a Russian research vessel and spend several weeks investigating topics such as food availability and ocean temperature and salinity, and catching and testing salmon for disease, diet, size, and health. They will look at genetic signatures to determine where the fish come from and map where fish from different countries and river systems are in the open ocean. While much science has been conducted into salmon when they are in coastal areas or rivers, this will be the first time a comprehensive survey of Pacific Salmon in the open ocean has been conducted. While the project has government support it is a private, independent project dependent upon private funding.
About the BC Salmon Farmers Association:
Farm-raised salmon is B.C.'s highest valued seafood product, the province's top agricultural export, and generates over $1.5-billion towards the B.C. economy, resulting in over 6,600 jobs.
The BC Salmon Farmers Association represents 56 businesses and organizations throughout the value chain of finfish aquaculture in B.C. Our members account for over 95% of the annual provincial harvest of farm-raised salmon, 100% of the salmon feed produced in B.C., and most of the service and suppliers involved in ensuring that over $700-million of salmon raised in B.C. gets to domestic and global markets.
Media contact:
Shawn Hall firstname.lastname@example.org
604-619-7913 | 1,284 | 567 | {
"id": "<urn:uuid:f3817284-eadc-4dc1-b98a-8095a1002f43>",
"dump": "CC-MAIN-2018-43",
"url": "http://bcsalmonfarmers.ca/wp-content/uploads/2018/10/Release-Year-of-the-Salmon.pdf",
"date": "2018-10-23T16:15:41",
"file_path": "crawl-data/CC-MAIN-2018-43/segments/1539583516480.46/warc/CC-MAIN-20181023153446-20181023174946-00132.warc.gz",
"offset": 41510029,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9965514540672302,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.996099591255188,
"per_page_languages": [
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2746,
2806
],
"fw_edu_scores": [
2.28125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Chapter 12 - Written Methods for Multiplication and Division
Short Multiplication 4 minutes and 28 seconds
Short multiplication is a routine written algorithm for multiplying by a single digit. I shall work through a couple of examples with no frills, just straightforward context free arithmetic. First example, I have three hundred and ninety-six to multiply by eight. We set it out like this, the answers going to go down here. We have the hundreds and the tens and the units or ones set out in columns. It's useful to have an estimate in mind, three hundred and ninety six is nearly four hundred. Eight lots of four hundred would be thirty-two hundred so I'd be expecting an answer round about three thousand two hundred.
Here we go then. Start with units eight times six, forty-eight and we carry the four tens from the forty-eight into the tens position leaving the eight in the answer in the units column. So, that's the forty-eight dealt with eight sixes now we have eight nines, seventy-two. That of course is seventy-two tens. Eight nines are seventy-two plus this four down here that makes seventy-six tens and we carry the seven into the hundreds column and write the six tens left in there so this is seven hundred and six tens, seventy-six tens. Now we multiply the three hundreds by eight, eight threes are twenty-four, add in the seven down here and we have thirty-one hundreds, which is three thousand one hundred and sixty-eight. Here's the answer and that's not far short of three thousand two hundred as we were expecting.
My second example is four thousand and forty-nine and I'm going to multiply that by six. Set the question out in the standard way, might be helpful to keep track of where we are, thousands, hundreds, tens and units. We start in the unit's position, multiplying the nine units by six which gives us fifty-four. We carry the fifty that's five tens into the next column. Now multiply the four by six, six fours are twenty four, add in this five and that's twenty-nine tens and we carry the twenty as two hundreds into the next column. Now we have six multiplied by zero, which is zero. Add in the two that we carried, to get the total of two hundreds in the answer and finally we have this four thousands to multiply by six which gives us twenty-four thousands in our answer there. So there's the result, twenty four thousand, two hundred and ninety-four. Does that look about right? Well do an estimate again, the number we were multiplying was four thousand, forty-nine, just a little bit more than four thousand and four thousand multiplied by six is twenty four thousand so we'd expect an answer just a but more than twenty-four thousand and that's what we've got. | 1,028 | 569 | {
"id": "<urn:uuid:554a0940-48d6-4ae5-b2c1-1a3a79f6626d>",
"dump": "CC-MAIN-2024-51",
"url": "https://study.sagepub.com/sites/default/files/chapter_12_-_written_methods_for_multiplication_and_division_pt._1_short_multiplication_0.pdf",
"date": "2024-12-10T17:41:33",
"file_path": "crawl-data/CC-MAIN-2024-51/segments/1733066067282.2/warc/CC-MAIN-20241210163759-20241210193759-00706.warc.gz",
"offset": 498666012,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9993300437927246,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9993300437927246,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2712
],
"fw_edu_scores": [
3.171875
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Keep It Maintained
* Repair cracks and holes in foundation.
* Clean gutters regularly.
* Fix peeling paint.
* Replace furnace filters regularly.
Keep It Comfortable
* Inspect regularly for problems.
* Have a professional check heating and cooling systems at least once a year.
* Seal all cracks and crevices, especially around doors and windows.
* Make sure insulation levels are right for where you live.
energy.gov/energysaver/insulation
UT Extension Family and Consumer Sciences is the University of Tennessee at work in your community, using research-based education to help you gain knowledge and develop confidence in making good decisions today and tomorrow.
FAMILY
FOOD
HEALTH
HOME
MONEY
More information:
Healthy Homes Partnership extensionhealthyhomes.org/ccontent.html
TN Healthy Homes Partnership
TNhealthyhomespartnership.org
CONTACT YOUR LOCAL EXTENSION AGENT
Martha Keel, PhD, Professor Environmental Health and Housing Family and Consumer Sciences
865-974-8197
119 Morgan Hall, 2621 Morgan Circle Knoxville, TN 37996-4501
ag.tennessee.edu/fcs
Proud member of the
R12-5310-259 70M 8/16 17-0008
Programs in agriculture and natural resources, 4-H youth development, family and consumer sciences, and resource development. University of Tennessee Institute of Agriculture, U.S. Department of Agriculture and county governments cooperating. UT Extension provides equal opportunities in programs and employment.
What is a healthy home?
A healthy home supports the health of those who live there. Big or small, urban or rural, any home can be healthy. Following the eight principles of healthy housing will start you and your family on your way to a healthier home.
Why is a healthy home important for your child?
Young children spend most of their time indoors, usually at home. For a number of reasons, they are particularly vulnerable to hazards in their indoor environment:
* • Their brains, bodies and immune systems are still growing and developing.
* • Their curious nature often results in hand-to-mouth contact and increased exposure to toxins.
What are the harmful effects of an unhealthy home?
Some of the more common health problems include:
* • Asthma triggers
* • Allergies
* • Injuries
* • Poisonings
* • Learning disabilities
* • Behavior disorders
8 Healthy Home Principles
Keep It Dry
* Fix roofing and plumbing leaks immediately.
* Keep humidity levels between 40-60 percent, using dehumidifiers if necessary.
Keep It Clean
* Use mats at doors to keep dirt out.
* Regularly clean, using damp cloths and mops. Dry cleaning just spreads the dirt around.
* Use natural or nontoxic cleaning supplies.
Keep It Pest Free
* Seal all cracks and crevices using caulk and weather stripping.
* Keep food and water away from pests.
* Never use pesticides where children can reach.
* Use Integrated Pest Management techniques. extension.tennessee.edu/publications/ Documents/pb1303.pdf
Keep It Ventilated
* Use exhaust fans in bathrooms and kitchens.
* Vent clothes dryer exhaust fans to the outside.
Keep It Contaminant-Free
* Test your home for radon. www.epa.gov/radon
* If home was built before 1978, have children tested for lead poisoning.
* Never allow smoking in your home or car.
Keep It Safe
* Use smoke alarms and carbon monoxide detectors.
* Set water heater to a maximum of 120 degrees F.
* Childproof according to child's age.
* Follow recommended infant safe sleep ABCs (alone, on back, in crib).
* Keep medications, cleaners, and all toxic substances out of the reach of children. | 1,762 | 772 | {
"id": "<urn:uuid:1950b61b-97db-4b9e-acbd-9407ae09f999>",
"dump": "CC-MAIN-2024-51",
"url": "https://utia.tennessee.edu/publications/wp-content/uploads/sites/269/2023/10/SP789.pdf",
"date": "2024-12-10T19:12:47",
"file_path": "crawl-data/CC-MAIN-2024-51/segments/1733066067282.2/warc/CC-MAIN-20241210163759-20241210193759-00701.warc.gz",
"offset": 549182762,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9820813834667206,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9942521452903748,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1449,
3560
],
"fw_edu_scores": [
2.90625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Aldershot Wellness Fair – "Spill the Tea" booth results
The following quotes and snpashot are form the conversations the aldershot Youth Crew had at the Aldershot Wellness Fair. Their booth was called "Spill the Tea" for two reasons. 1) It is a pop culture term that means sharing secrets. 2) Tea culture in Japan is all about connection and relationships, it is an intimate gathering.
Note: A dash with a number beside an entry indicates multiple similar responses
How do you share power in your household between adults and youth?
* Talk openly
* Parents sharing real stories from their life
* Discuss issues in an age-appropriate way
* Sharing chores
* Cutting fruits and veggies, which then leads to full dinner prep
* Mom asks kids to help with chords in exchange for allowance
* Choosing movies
* Tell my dad what I want
* Communication is key
* Kids/youth - Make suggestions known to parents
* Around birthdays, discuss new role(s) in family
* We all work together to keep our home tidy
* Letting the kids help, as far as they are capable of, then adults finish the job
* Gradually getting more responsibility with the pets
* Providing choices
How do you "spill the tea" in your family?
* Tell family you have something to say
* Text - 3
* Gradually integrate issues into the conversation
* At dinner
* Through text
* Family meeting - 2
* In the car (side by side)
* Tell my mom - 4
What are activities your family does to create strong parent/youth relationships?
* Board game night - 3
* Family dinner - 1
* Go for walks - 1
* Watch movies together - 2
* Playing cultural games
* Dancing!
* Coming to community events
* Walking the dog together
* Soccer
* Help make dinner
* Clean up together
* Running
* Go to the park and play - 1
* Do school work together
* Just talk and laugh together
* Bowling
* Everyone always asks about each others day – must elaborate, no "fine" or "good"
What do you think relationships are supposed to look like between parents and kids? Other adults and kids?
* Positivity is central
* Show youth what they are good at, and guide them towards doing more of that
* It's important for adults to show empathy – if you don't care for others, how will a young person?
* Kids and youth will feel comfortable sharing things without much prompt – and on the flip side, adults will offer up details of their day/life with kids
* Parents are not rude and judgey – they can talk about tough stuff in a calm way
* A good relationships will have love, respect, support – and showing up
* Adults, parent or not, must be consistently supportive, guiding and fun ☺
* Good relationships are: happy, healthy, respectful and meaningful | 1,127 | 622 | {
"id": "<urn:uuid:6c714932-cd01-42bc-8a9f-c63a57d95a21>",
"dump": "CC-MAIN-2024-51",
"url": "https://www.haltonyouth.com/_files/ugd/380ef4_642017cf59c34c299d0bc25f78c43417.pdf",
"date": "2024-12-10T18:47:04",
"file_path": "crawl-data/CC-MAIN-2024-51/segments/1733066067282.2/warc/CC-MAIN-20241210163759-20241210193759-00704.warc.gz",
"offset": 725890779,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9957804381847382,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9956429600715637,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1395,
2665
],
"fw_edu_scores": [
2.234375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
CULMINATING ACTIVITY: TOWARD A MORE PERFECT COMMUNITY
(60 minutes — possibly an ongoing service-learning project)
OBJECTIVE
Groups of students compose an overview of their community, choose a campaign for a specific area of improvement, and plan a service project.
[x] Tell your students to use the Toward a More Perfect Community handout to evaluate the community and to develop their service project plans.
MATERIALS
Toward a More Perfect Community handout
GET READY
[x] Divide your class into groups of four students.
[x] Duplicate a copy of the Toward a More Perfect Community handout for each student.
[x] Obtain telephone access for local calls during class time (optional).
INSTRUCTIONS
[x] Say, A city in the western United States discovered recently that only 12% of its eligible voters had cast a ballot in the last mayoral election. If the youngest voters (18-25 years old) had turned out as a block, they could have elected their own candidates for mayor and city council.
[x] Tell the class to assume that the youngest voters have done just that. Each group of four now represents a youth-oriented mayor and city council.
[x] Say to the groups, Your job is to look at your community, evaluate its strengths and weaknesses, and choose one aspect of life in your community that needs improvement. Each group will develop a service project plan for the community aspect that needs improvement.
[x] Inform students that their plans will require them to create a budget and to figure out how to include other students, faculty and administration, local businesses, local government agencies and/or the media in their plans.
[x] Have the groups present their plans, both in writing to the teacher and orally to the class.
[x] Have the class select a project that seems feasible and that will have an impact: ask, How can we pursue one of these projects? What would be the fairest way for the class to select the one we want to pursue? (Students can vote by secret ballot or by a show of hands.)
[x] Once a project has been selected, have your students further develop the plan of action as a class. They should brainstorm everything that needs to happen for the project to become a reality.
[x] Have your students implement their plan of action.
CULMINATING ACTIVITY: TOWARD A MORE PERFECT COMMUNITY (continued)
DISCUSSION QUESTIONS
MORE!
★ Which attributes of our town were most commonly cited as strengths?
★ Which attributes of our town were most commonly cited for needing improvement?
★ Is there any common thread to be found in the areas students chose for improvement?
★ Is that the area for improvement we chose?
★ What group's plan of action did we choose? Why do you think this project plan was selected?
★ What impact did our service project have on the community issue? Did our project turn out as planned?
★ If in an election cycle: Which candidates in this election seem to agree with our programs of reform? What are they saying in their campaigns about "our" issues? Which of them might help us with our projects?
Send the plans to the mayor and/or the city council, either by mail or e-mail. (Many city Web sites offer direct posting of e-mail to city officials. Go to http://www.statelocalgov.net/, if you have Web access, to see whether your community has a Web site.) Invite parents to a presentation of the "More Perfect Community" project after its completion. Students could prepare refreshments, decorations, and banners. Invite local officials and school district leaders to the presentation.
2
TOWARD
A
MORE PERFECT
COMMUNITY
TOWARD A MORE PERFECT COMMUNITY
Group Members:
Community Strengths:
Community Weaknesses:
Area of Focus For Project:
Project Description:
BUDGET
Costs:
Revenue sources:
How we will involve students, faculty, media, businesses and local government: | 1,784 | 810 | {
"id": "<urn:uuid:17bf3d01-4ec5-49e1-9f1e-7c62049d14dc>",
"dump": "CC-MAIN-2024-51",
"url": "https://www.nebarfnd.org/sites/default/files/2020-05/Culminating-Toward%20%20A%20More%20Perfect%20Community.pdf",
"date": "2024-12-10T18:25:10",
"file_path": "crawl-data/CC-MAIN-2024-51/segments/1733066067282.2/warc/CC-MAIN-20241210163759-20241210193759-00712.warc.gz",
"offset": 813289018,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9702099363009135,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991503953933716,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2263,
3546,
3838
],
"fw_edu_scores": [
4.09375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Children's Home of York Prevention Education
-Cocaine Fact Sheet-
Cocaine is an extremely addictive stimulant drug made from the leaves of the coca plant which is native to South America. Stimulants drugs are aptly named as they stimulate or speed up different processes in the body such heart rate and breathing. Cocaine is most commonly associated with illegal recreational use, however in some circumstances cocaine is deemed medically useful as an anesthetic such as with eye, nose and throat surgeries. There are two common varieties of cocaine; powder cocaine and crack cocaine. As in its' name powder cocaine is usually a fine, white crystal powder. This type of cocaine can is typically inhaled (snorted), rubbed on the gums to be absorbed, or dissolved into liquid and injected with a needle. While crack cocaine typically appears more like white chalky/powdery chunks of a rock-like substance. Crack cocaine is smoked and derives its' name from the crackling sound made when it is heated. More recently there has been a dangerous trend of mixing and selling cocaine with opioids, sometimes without the user's knowledge, often resulting in an overdose.
-Cocaine was actually an ingredient in early formulations of the famous soda Coca-Cola, which is where it got its' namesake
-Over 900,000 people in the US meet the criteria for as substance abuse disorder because of cocaine or crack cocaine use
-Approximately 0.7% of 8th graders, 1.5% of 10th graders, and 2.2% of 12 graders report using cocaine within the past year
-Only about half of 12th graders believe it is very risky to try cocaine once or twice, while the other half do not believe trying cocaine once or twice is a risky choice.
-In 2018, cocaine was responsible for at least 14,666 overdose deaths in the US
-Almost three quarters of those overdose deaths also involved some type of opioid as well (which includes: heroin, fentanyl, and prescription opioids)
To help prevent cocaine use among the youth in your life, try some of these solutions:
-Stay informed about cocaine and other drug trends, you can also educate yourself by using this sheet and by visiting the websites listed on our drug and alcohol resource guide.
-Talk to your child and teen about the dangers of cocaine, and link this discussion into your talk about heroin, fentanyl, prescription opioids and stimulants as these types of drugs often go hand and hand
-Safe storage of prescription medication should also be a part of preventing future cocaine use, because often abuse of prescription drugs like opioids and stimulants is the first stepping stone towards using stronger illegal drugs in the future like cocaine.
-If you have opioids or stimulants in your household whether for short or long term use remember to store them safely and carefully, like in a locked medicine cabinet or box
-If you were prescribed an opioid or stimulant and no longer need the medication remember to dispose of it properly at a medication disposal site. These sites are often located at police stations, health care facilities, and pharmacies.
Children's Home of York provides several free prevention programs to schools and youth in York County communities that help children and their families learn strategies to avoid using alcohol, tobacco and other drugs. To request information or set up a free program in your school and community please call or email Cecilia Keesey, Director of Prevention at (717) 755-1033 ext. 1257 or email@example.com.
-Ask About Our New Free Virtual Prevention Programming Options-
We hope this guide has helped you in your journey towards drug and alcohol education for yourself and your family. Remember research, education and support are key components to navigating the world of drug and alcohol prevention and treatment. If you want more information about cocaine for you or your family check out our comprehensive drug and alcohol resource guide. This guide includes countless website links, hotline phone numbers, and even local in-person resources for York County. | 1,655 | 823 | {
"id": "<urn:uuid:08db315b-bd78-40f1-ac2c-d427e88cddab>",
"dump": "CC-MAIN-2024-51",
"url": "https://www.childrenshomeofyork.org/file_download/inline/77494c1a-655b-411a-bbc5-28c59499454d",
"date": "2024-12-10T16:52:22",
"file_path": "crawl-data/CC-MAIN-2024-51/segments/1733066067282.2/warc/CC-MAIN-20241210163759-20241210193759-00714.warc.gz",
"offset": 649477448,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9977924525737762,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9981857538223267,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1935,
4046
],
"fw_edu_scores": [
2.171875
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
English – Core Texts
- Titanium (film focus)
- Moth (Isabel Thomas)
- Town Is by the Sea (Joanne Schwartz)
- When Darwin Sailed the Sea (David Long)
English – Reading and Writing
- use role play and drama to explore characters and plot
- make inferences which are supported by evidence from a text
-
write diary entries in role
- research information and make notes
- write newspaper reports
- write setting descriptions
English – Grammar, Punctuation and Spelling
- identify different word classes
- use adverbs and modal verbs to indicate degrees of possibility
- recognise and use expanded noun phrases
- understand the terms synonym and antonym
- use brackets, dashes and commas for parenthesis
- use relative clauses beginning with who, which, where, when, whose or that
- use commas to avoid ambiguity
- spell words with a range of prefixes and suffixes
Mathematics – Place Value, Addition, Subtraction, Multiplication, Division
- Read and write numbers to 10,000,000
- Powers of 10
- Number line to 10,000,000
- Compare and order any integers
- Round any integer
- Negative numbers
- Add and subtract integers
- Common factors and Common multiples
- Rules of divisibility
- Primes to 100
- Square and cube numbers
- Multiply up to a 4-digit number by a 2-digit number
- Solve problems with multiplication
Computing
-
E-Safety: know how to use the Internet safely and responsibly
- Espresso Coding: understand how to use variables and formulae in code; use variables to store and calculate values; know how to make an app; use coding to fix mistakes in a variety of programmes
- Spreadsheets: enter data and formulas into a spreadsheet; use formulas to make calculations; sort and filter data in a spreadsheet
Science
Light:
- recognise that light travels in straight lines
- know how the eye uses light to see
- set up investigations to find out how light is reflected and refracted
Evolution:
- recognise that characteristics are passed from parents to offspring and that living things change over time
- identify how animals and plants are adapted to suit their environment
- understand that changes can be an advantage or a disadvantage
Year Six Curriculum
Autumn Term: Power to the People
P.E
- compare Britain before and after the Industrial Revolution
- know the effect of the Industrial Revolution on people's lives
- know the roles of children in Britain during the Industrial Revolution
- know about the life of Brunel and his contributions to the era
- identify significant changes in Britain during Queen Victoria's reign
Art (William Morris – Printing)
- know about the life and work of William Morris
- create a printing block using sketchbook ideas
- use a printing block to create a repeating pattern
- add layers of colour/print by adding detail to the printing block
D&T (Bridge Building)
- investigate different bridge structures
- explore ways of strengthening a structure
- measure, mark, cut and join materials accurately
- select appropriate materials, equipment, tools and techniques to complete a project
- evaluate work and explain the improvements which were made
R.E. (Humanism)
- the Golden Rule
- Humanists beliefs and ideas
PSHE (Being My Best)
- consider how healthy wellbeing and mental health can contribute to a person's aspirations and success.
- recognise that we will meet challenges on the way to achieving our goals
-
understand and explain the outcomes of risk-taking in a given situation, including emotional risks
- Football: develop dribbling and passing techniques; apply basic strategic and technical principles for defence and attack; choose, combine and perform skills effectively in games
- Netball: develop passing and footwork techniques; apply basic strategic and technical principles for defence and attack; choose, combine and perform skills effectively in games
French
- phonetics letters 1-4
- revision of core vocabulary
- presenting myself through greetings and asking simple questions
- numbers 1-20 | 1,890 | 842 | {
"id": "<urn:uuid:f8cdc18d-c3a5-40e1-8b66-68b3157617a1>",
"dump": "CC-MAIN-2023-06",
"url": "https://www.wentworth.essex.sch.uk/download_file/force/3495/240",
"date": "2023-01-27T21:11:35",
"file_path": "crawl-data/CC-MAIN-2023-06/segments/1674764495012.84/warc/CC-MAIN-20230127195946-20230127225946-00734.warc.gz",
"offset": 1057041552,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9945152997970581,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9947313070297241,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2216,
3999
],
"fw_edu_scores": [
4.0625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Context/Background
Abraham sent his servant to his relatives back in his home country to find a wife for Isaac
The servant brought back Rebekah, Isaac's first cousin once removed, to marry Isaac
Read Verses 19-26
1) How long did Isaac and Rebekah have to wait before the Lord blessed them with children? (verses 20 & 26)
2) For what reasons did Isaac and Rebekah want to have children?
3) In an age when the medical community has given us ways of manipulating conception, the Lord wants us to remember that he is in control of life. In what ways do these verses demonstrate that truth?
4) How did the name each child was given reflect the child's characteristics? Look at the footnotes.
5) How old was Abraham when his grandsons were born? How many years could he enjoy them? (See 21:5; 25:26. Also note Genesis 25:7) What truth might we learn about the way Scripture is written by looking at these verses?
1
Lesson 5: Jacob Deceives Isaac Genesis 25:19-34; 27:1-27:40
Read Verses 27-34
1) Describe the differences between the two brothers.
2) What parenting mistake had Isaac and Rebekah made?
3) How did Jacob live up to his name "heel grabber/one who deceives"?
4) What Jacob did was wrong, yet we should not focus on his sin in this account. How did his action help ensure God's promise would be carried out? (v 23, 28)
5) In Hebrews 12:16 whom does the Holy Spirit hold responsible? Why call him "godless"?
Hebrews 12:16 – See that no one is sexually immoral, or is godless like Esau, who for a single meal sold his inheritance rights as the oldest son.
Skip ahead to chapter 27. Read Verses 1-4
1) How did favoritism lead Isaac into sin? Did Isaac act in innocence? What about Esau?
Read Verses 5-29 and discuss the following questions with the people around you
1) Using the verses below, describe the precautions Jacob and Rebekah took to ensure their deceptive plan was foolproof. Also note how these precautions paid off.
Verses 9, 10, 25—
Lesson 5: Jacob Deceives Isaac Genesis 25:19-34; 27:1-27:40
Verses 11, 12, 16, 22, 23—
Verses 15, 27—
2) What was likely the main motive behind Rebekah and Jacob's plot? What ultimately did their lies and deception show a lack of?
3) This story presents sin in all its complexity. Each of the four family members was caught up in his or her own sinful nature and responded in sin to the sinful actions of others in the family. What could have each of the family members done differently to break this cycle of sin?
Rebekah—
Jacob—
Isaac—
Esau—
Read Verses 30-40 (Esau gets the leftovers)
Note: To fully understand these 11 verses, it's important to know how the following terms would have been defined at that time:
Birthright—A double share of the inheritance which included servants, money, cattle, property, etc.
Blessing—A favorable pronouncement or prediction for one's future. For instance, "May you always be happy"…"May you live long" … "May you have many children." The unbelieving ancient world "believed" that a blessing had a kind of magical power to accomplish what it
Lesson 5: Jacob Deceives Isaac Genesis 25:19-34; 27:1-27:40
pronounced. The believers knew by faith that God had the power to make blessings "come true" and would make them "come true" at some point in the future.
Key point—A blessing and a birthright were usually given at separate times and completely unrelated.
What God promised to Abraham about his line and descendants and what he had revealed to Rebekah and Isaac was passed on in Isaac's blessing on Jacob. What promises are you able to pick out? What promise is attached to this blessing?
27:28,29—May God give you of heaven's dew and of earth's richness—the abundance of grain and new wine. May nations serve you and peoples bow down to you. Be lord over your brothers, and may the sons of your mother bow down to you. May those who curse you be cursed and those who bless you be blessed.
In what way was this blessing unique?
1) What do Esau's words show he didn't understand? (V 36)
2) After Esau's whining and crying, Isaac gave in and "blessed him" (V 39). How would you describe the blessing Esau received in comparison to Jacob's? What one small blessing did he add? See 2 Kings 8:20-22; 21:8-10 for the fulfillment of the last part of the blessing. | 1,922 | 1,097 | {
"id": "<urn:uuid:67bf5ce9-52a4-4218-8231-2f0389f3fd84>",
"dump": "CC-MAIN-2023-06",
"url": "http://www.faithinradcliff.org/home/140002120/140002120/140122726/OT_Patriarchs_Lesson_5_Genesis_25_19-34-_27_1-40_(student).pdf",
"date": "2023-01-27T20:07:38",
"file_path": "crawl-data/CC-MAIN-2023-06/segments/1674764495012.84/warc/CC-MAIN-20230127195946-20230127225946-00734.warc.gz",
"offset": 60406114,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.995471403002739,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9961148500442505,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
918,
1986,
3096,
4337
],
"fw_edu_scores": [
2.75
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Pre-Lesson Comprehension
Target Language: present progressive tense
Focus: You will learn the present progressive tense to talk about actions happening now and actions that happen regularly but haven't finished.
Read and understand the target language below.
We use the present progressive tense to talk about actions happening now. The structure is: be verb + present participle (verb -ing). Here are some examples:
)
We also use the present progressive tense to talk about longer actions happening now and haven't finished.
Kate
is studying every day for the test (
recently
).
Bill is looking
for a new house (
these days
).
.
Here are some negative examples. Negative sentences use: be verb + not + present participle (verb -ing)
Becky is not sleeping now.
They aren't taking a test now.
He isn't working hard these days.
I am not saving any money recently!
With questions, we use the following structures:
Closed Questions: be verb + subject + present participle (verb -ing)
Q: Are you studying English (now)?
A: Yes, I'm studying English (now). Please be quiet.
Open Questions: wh-question + be verb + subject + present participle (verb -ing)
Q: What are you studying these days?
A: I'm studying English, History, and Science. All of the classes are very difficult.
1
Pre-Lesson Practice
Target Language: present progressive tense
Practice: Now try some activities to help you use the target language.
Correct the mistakes with the present progressive tense. Then rewrite the sentences.
1: What are he doing now?
____________________________________________________________________________________
2: They is watching TV now.
____________________________________________________________________________________
3: I am look for a new computer these days.
____________________________________________________________________________________
Read and practice the conversation. Circle the present progressive tense.
Will:
Is that Stacy? What is she doing?
James: She's studying for her big test.
Will:
She never studies! When is her test?
James: Her test is tomorrow. She's studying a lot these days because she's failing her class.
Will:
She looks very tired.
James: She studies from morning until night. She's drinking a lot of coffee to stay awake!
Will:
I hope she does well!
2
Answers
Target Language: present progressive tense
Correct the mistakes with the present progressive tense. Then rewrite the sentences.
1: What is he doing now.
2: They are watching TV now.
3: I am looking for a new computer these days.
Read and practice the conversation. Circle the present progressive tense.
Will:
Is that Stacy? Whatisshedoing?
James: She's studying for her big test.
Will:
She never studies! When is her test?
James: Her test is tomorrow. She's studying a lot these days because she's failing her class.
Will:
She looks very tired.
James: She studies from morning until night. She's drinking a lot of coffee to stay awake!
Will:
I hope she does well!
3 | 1,431 | 627 | {
"id": "<urn:uuid:7c7e8eb2-1cff-45c9-868d-5d6fa122a836>",
"dump": "CC-MAIN-2023-06",
"url": "https://nativeneatenglish.com/wp-content/uploads/2018/01/28G-present-progressive-tense.pdf",
"date": "2023-01-27T20:11:39",
"file_path": "crawl-data/CC-MAIN-2023-06/segments/1674764495012.84/warc/CC-MAIN-20230127195946-20230127225946-00741.warc.gz",
"offset": 421842991,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9982281724611918,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9994292259216309,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1300,
2335,
3026
],
"fw_edu_scores": [
4.15625
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
TRASHY TOWN
by Andrea Zimmerman and David Clemesha, illustrated by Dan Yaccarino (HarperCollins) Themes: Jobs, Neighborhoods, Poetry Grade Level: PreK—3 Running Time: 6 minutes
SUMMARY
Dump it in! Smash it down! In both prose and rhyme, this story follows Mr. Gilly, a genial trashman, as he drives around in his big truck looking for trash. Mr. Gilly stops at the school, the park and other spots around town. After each trash pickup the story breaks into rhyme. The bold, colorful pictures feature not only Mr. Gilly but also the two silent mice who ride along on his trash-gathering adventures.
OBJECTIVES
* Children will describe the job of a trash collector.
* Children will watch and listen to a story that contains both poetry and prose.
* Children will identify and describe familiar people, animals and places in a neighborhood.
observing their own environments.
With the help of your local municipal leaders, introduce students to the process of trash disposal in your community. Take field trips to learn how trash is collected and disposed of. Explore your community's recycling efforts and why they are important.
Other videos and films about neighborhoods available from Weston Woods include: HARRY THE DIRTY DOG by Gene Zion, ill. by Margaret Bloy Graham I STINK! by Kate and Jim McMullan OFFICER BUCKLE AND GLORIA by Peggy Rathmann THE PAPERBOY by Dav Pilkey
Other videos and films told with poetry
TRASHY TOWN
story about trash, as well as how such a story might end. Suggest that they remember their guesses as they view the program.
AFTER VIEWING ACTIVITIES
Show the program again, this time asking groups of children to join in at key points in the story. For example, one group can chant the word "Stop," another group can chant "No," and the whole class can chant the rhymes. Repeat the viewing until the class has memorized the story enough to come in on time.
Challenge student teams to compete in reading and performing the story. Make the connection between poetry and music by having students sing the rhyming parts or using dance to act out Mr. Gilly's day. Be sure to add sound effects.
Encourage students to write and illustrate similar stories about other jobs in the neighborhood. You might start with the jobs pictured in the book: taxi driver, pizza maker, doctor and firefighter. Have children include rhymes in their stories and perform the stories for the class. As part of a science lesson or writing exercise, challenge students to add details to the story. You might have them list the exact kinds of trash that would be found at each stop, add more stops to Mr. Gilly's route, give the exact number of pounds of trash collected at each stop, and so forth. Encourage them to find these details by available from Weston Woods include: ANTARCTIC ANTICS by Judy Sierra, ill. by Jose Aruego & Ariane Dewey IN THE SMALL, SMALL POND by Denise Fleming
BEFORE VIEWING ACTIVITIES
Show students the video and its cover. Ask students to read the title, identify the objects on the cover and then guess what the program will be about. After students correctly guess that it's about garbage, have them guess what each object on the cover has to do with garbage or trash. Then ask them to guess what might happen in a
IS YOUR MAMA A LLAMA? by Deborah Guarino, ill. by Steven Kellogg, JOHNNY APPLESEED by Reeve Lindbergh, ill. by Kathy Jakobsen
CALL 1-800-243-5020 TO ORDER THESE AND OTHER WESTON WOODS VIDEOS! | 1,536 | 788 | {
"id": "<urn:uuid:9d242e92-41ab-49ac-acf0-99d7211a4234>",
"dump": "CC-MAIN-2023-06",
"url": "https://westonwoods.scholastic.com/products/westonwoods/study_guides/trashy_town.pdf",
"date": "2023-01-27T21:39:23",
"file_path": "crawl-data/CC-MAIN-2023-06/segments/1674764495012.84/warc/CC-MAIN-20230127195946-20230127225946-00741.warc.gz",
"offset": 615017318,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988546371459961,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9988546371459961,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3462
],
"fw_edu_scores": [
4.65625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Are lungworms something you should know about?
Guelph, ON
Whether you take your dog or your cat to the vet, you have probably heard something about worms. Part of a complete pet health strategy includes protecting pets from the parasites in your area. Treating and preventing intestinal worms and heartworm is part of regular care for pets. With changes in climate, wildlife ranges and travel patterns, we can see new parasites show up that haven't been a concern for pets in the past. Lungworms are some of these new parasites.
The name lungworm is given to a number of different parasites in Canada. Broadly, these worms live in the lungs of dogs and cats. Generally, these worms live in the lungs and airways, leading to irritation, inflammation and coughing. This can look like other conditions that cause coughing, including canine cough ("kennel cough") and feline asthma. Some lungworms can also cause a wider variety of clinical signs including neurologic, cardiovascular, gastrointestinal and bleeding disorders and can even be fatal for infected dogs.
Two of the lungworms seen in dogs are fox lungworm (Crenosoma vulpis) and French heartworm (Angiostrongylus vasorum). Foxes can carry these parasites and pass larvae in their feces. Dogs get infected from eating the larvae from the feces of infected foxes. This happens when the dog eats slugs, snails or frogs. Dogs can even get infected simply by licking slime from toys or water bowls that slugs and snails have climbed on. In areas with slugs/snails and foxes, pet owners should talk to their veterinarian about preventive options for their pet. If your dog is already coughing, your veterinarian can discuss options for testing and treatment.
Cats can get infected in much the same ways and can also be infected when eating prey like mice and birds that have eaten infected snails and slugs. They have their own varieties of lungworms, including the cat lungworm (Aelurostrongylus abstrusus). If your cat has access to the outdoors, or has been coughing, your veterinarian can help you with the best options for your pet.
Just like in human medicine, health risks and solutions continue to change for our canine and feline family members. Ensuring regular visits with your veterinary healthcare team is the best way to protect your pet.
For more information:
Colleen McElwain Canadian Animal Health Institute (519) 763-7777 | 935 | 512 | {
"id": "<urn:uuid:5e95b9d1-f92c-4ea4-a4d5-edaa51e4a3df>",
"dump": "CC-MAIN-2019-35",
"url": "https://cahi-icsa.ca/file.aspx?id=41ffd453-5174-4750-9e50-0016c9ef800d",
"date": "2019-08-24T18:11:24",
"file_path": "crawl-data/CC-MAIN-2019-35/segments/1566027321351.87/warc/CC-MAIN-20190824172818-20190824194818-00327.warc.gz",
"offset": 395160636,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9992148280143738,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9992148280143738,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2399
],
"fw_edu_scores": [
2.234375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
AP Calculus BC
Section 6.4 – Exponential Growth and Decay (FDWK)
1. (#11) Suppose that the cholera bacteria in a colony starts with 1 bacterium and doubles in number every half hour. How many bacteria will be in the colony at the end of 24 hours?
2. (#12) A colony of bacteria is grown under ideal conditions in a lab so that the rate of change of the population is proportional to the amount present at any time. At the end of 3 hours there are 10,000 bacteria. At the end of 5 hours, there are 40,000 bacteria. How many bacteria were present initially?
3. (#13) The half-life of radon-222 is 3.8 days. About how long will it take an amount of radon in a sealed sample of air to decay to 90% of its original value?
4. (#18) An aluminum beam was brought from the outside cold into a machine shop where the temperature was held at 65F. After 10 minutes, the beam warmed to 35F. Use Newton's Law of Cooling to estimate the beam's initial temperature.
AP Calculus BC
Section 6.4 – Exponential Growth and Decay (FDWK)
5. (#19) Suppose that a cup of soup cooled from 90C to 60C in 10 minutes in a room whose temperature was 20C. Use Newton's Law of Cooling to answer the following:
a. How much longer would it take the soup to cool to 35C?
b. Instead of being left in a room, the soup is put into a freezer whose temperature is −15C. How long will it take the soup to cool from 90C to 35C?
6. (#20) The temperature of an ingot of silver is 60C above room temperature right now. Twenty minutes ago, it was 70C above room temperature. How far above room temperature will the silver be 15 minutes from now? 2 hours from now?
7. (#28) In some chemical reactions the rate at which the amount of a substance changes with time is proportional to the amount present. For the change of -glucono lactone into gluconic acid, for example, 0.6 dy y dt = − , when y is measured in grams and t is measured in hours. If there are 100 grams of -glucono lactone present when t = 0, how many grams will be left after the first hour?
8. (#29) Suppose the electricity is draining from a capacitor at a rate proportional to the voltage V across its terminal and that, if t is measured in seconds, 1 40 dV V dt = − . How long will it take the voltage to drop to 10% of its original value? | 1,036 | 629 | {
"id": "<urn:uuid:4d57c4e7-675d-423f-ae1a-216f1b8268ee>",
"dump": "CC-MAIN-2023-06",
"url": "https://www.cbsd.org/site/handlers/filedownload.ashx?moduleinstanceid=32792&dataid=148315&FileName=Section%206.4%20-%20Exponential%20Growth%20and%20Decay%20FDWK.pdf",
"date": "2023-01-27T20:39:46",
"file_path": "crawl-data/CC-MAIN-2023-06/segments/1674764495012.84/warc/CC-MAIN-20230127195946-20230127225946-00743.warc.gz",
"offset": 691522082,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988922774791718,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9989227056503296,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
960,
2288
],
"fw_edu_scores": [
3.765625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Social Studies 9 Research Essay Topics
You can use these topic suggestions to develop your own thesis statements.
CAUSE AND EFFECT TIMELINES:
Politics and government
1. The causes and effects of French Seigneurial system
2. The causes of the deportation of the Acadian people and the effects on their lives
3. The causes and effects of the American Revolution
4. The causes and effects of the movement of the United Empire Loyalists into Canada
5. The causes and effects of the War of 1812
6. The English revolution
7. The French revolution
8. The causes and effects of the Plains of Abraham (Seven Years War)
9. The causes and effects of the role of churches in early English Canada
19. Compare the reign of the Tudors vs the Stuarts
10. Napoleon
15. King Louis XIV
11. Queen Elizabeth I
16. Thayendanegea
13. Frontenac
17. Jesuits in N. France
14. Oliver Cromwell
18. King Louis XVI
Exploration and trade:
20. Causes for European exploration and the effects in North America – 1500-1815
21.The causes and effects of the North American fur trade
22. The causes for Aboriginal peoples to join the fur trade and its effects on them
23. The causes and effects of the Industrial Revolution Trade:
24. Compare and contrast the Hudson's Bay Company with the North-West Company
COMPARE AND CONTRAST:
Geography
24/25 Compare and contrast two major geographical regions in Canada:
a. Appalachian Mountains (Maritimes)
b. Canadian Shield (Upper and Lower Canada)
c. Interior Plains (Prairies)
d. Canadian Cordillera (BC)
26. Compare how two different Aboriginal groups traditionally interacted with the environment
27. Compare the French seigneurial and English colonial landholding systems
28/29 Compare two of the major exploration routes of North America > 1815: why they were used and/or how they created patterns of settlement
Lifestyles:
30. Compare the lifestyles and occupations of English and French people in Lower Canada
Women's Contributions:
31/32 Compare the roles of women in two types of society:
* traditional Aboriginal societies
* religious nuns,
* in New France's Seigneurial system,
* the colonies
33. Compare and contrast the experiences of Susanna Moodie's life in the wilderness with her sister, Catherine Parr Trail's life in a town in Upper Canada | 1,141 | 520 | {
"id": "<urn:uuid:3cb39c99-c198-45b5-999b-204dc28e5a9d>",
"dump": "CC-MAIN-2019-35",
"url": "https://stellys.sd63.bc.ca/pluginfile.php/16988/mod_resource/content/1/SS9-%20Essay%20Topics%28ross%293.pdf",
"date": "2019-08-24T18:14:41",
"file_path": "crawl-data/CC-MAIN-2019-35/segments/1566027321351.87/warc/CC-MAIN-20190824172818-20190824194818-00325.warc.gz",
"offset": 644415692,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.98273104429245,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.98273104429245,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2290
],
"fw_edu_scores": [
3.234375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Protect Babies' Brains: Protect Limits on Mercury and Air Toxics
America's babies are healthier, and our air is cleaner, thanks to successful limits on pollution called the Mercury and Air Toxics Standards. But the Trump Administration is trying to undermine the standards.
- Mercury permanently damages babies' brains.
o Mercury from coal-fired power plants is emitted into the air, falls into waterways, and accumulates in fish that families eat.
o This potent neurotoxin causes permanent damage to the brains of babies and unborn children, leading to developmental delays, learning disabilities and birth defects.
- Power plants also emit other toxic air pollutants that cause disease and premature death.
o Air pollution from coal- and oil-fired power plants contains more than 80 hazardous air pollutants identified by the Clean Air Act for control, including arsenic, chromium, lead, formaldehyde, acid gases, dioxins, and furans.
o These pollutants can cause cancer; damage the eyes, skin, and breathing passages; harm the kidneys, lungs, and nervous system; cause cardiovascular disease; and kill.
o They harm people not only near the plants, but also hundreds of miles away.
o Cleaning up air toxics reduces sulfur dioxide and particulate matter.
o Babies and children, pregnant women, older adults, and people with lung disease, heart disease or diabetes face higher risk from these pollutants.
- The Mercury and Air Toxics Standards work. They've cleaned up much of this pollution.
o The Mercury and Air Toxics Standards (MATS) are a success story.
o The standards have achieved a 90% reduction in mercury emissions from power plants, and cleaned up dangerous particle pollution at the same time.
o When the U.S. Environmental Protection Agency (EPA) adopted they rule, they estimated that MATS would prevent up to 11,000 premature deaths each year and prevent 4,700 heart attacks, 130,000 asthma attacks, and 5,700 hospital visits annually.
o Power plants have already finished making investments to meet the standards, including installing pollution controls now in operation.
- MATS enjoy bipartisan support in Congress, plus support from health and industry groups.
o The standards were put in place with support from public health and medical organizations, the environmental and faith communities, and clean energy companies.
o Strong bipartisan opposition defeated a 2012 Congressional Review Act resolution to overturn MATS (S.J. Res 37).
o Electric utilities and senators in both parties urged EPA in 2018 to maintain the standards.
The Trump Administration must not alter or reconsider limits on mercury and other air toxics from power plants. Americans have nothing to gain from the rollback of these lifesaving, highly effective standards, and many people – including pregnant women and their unborn children – have everything to lose. | 1,233 | 567 | {
"id": "<urn:uuid:8fdf97eb-0bdb-4c39-b817-e114070435d0>",
"dump": "CC-MAIN-2019-35",
"url": "https://www.lung.org/assets/documents/healthy-air/protect-limits-on-mercury-and-toxics.pdf",
"date": "2019-08-24T19:10:39",
"file_path": "crawl-data/CC-MAIN-2019-35/segments/1566027321351.87/warc/CC-MAIN-20190824172818-20190824194818-00367.warc.gz",
"offset": 901957254,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9943110942840576,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9943110942840576,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2861
],
"fw_edu_scores": [
2.90625
],
"minhash_cluster_size": 1,
"duplicate_count": 2
} |
Should my child go to school today?
High Temperature
Give paracetamol and plenty of water. If you child starts to feel better, bring them in to school. If a temperature continues for 3 days or more, seek medical advice.
Flu & Swine Flu
Children should return to school once they have recovered – this is usually within 5 days. All bouts of flu need to be supported with a doctors note.
Coughs and Colds
Children should be given paracetamol, plenty of fluids and can be sent to school. If your child is asthmatic, remember that they may need their inhaler more often.
Sore throat, tonsillitis & glandular fever
Children should be given paracetamol, plenty of fluids to drink and can be sent to school.
Diarrhoea & Vomiting
Children can return to school 24 hours after the last episode of diarrhoea or vomiting. If your child has been sick due to a bout of coughing then they do
Period Pains
not require to be off school.
Girls can go to school, give paracetamol and encourage them to try and stay active.
Headache, Earache & Stomach Ache
Children with any of these symptoms can go to school – just make sure they let a member of staff know they feel unwell. Give paracetamol and plenty of fluids.
Conjunctivitis
Whooping Cough
Children can go to school. Encourage them to wash their hands to prevent the spread of infection
Children should return to school 5 days after starting on antibiotics. Noninfectious coughing may continue for many weeks.
Measles, Chicken Pox & German Measles
Measles: Children can return to school 4 days after the rash has started. Chicken Pox: Children can return to school 5 days after the rash has started. German Measles: Children can return to school 6 days after the rash has started. All should be supported with a doctors note and school should be informed as pregnant members of staff can be affected.
Scabies
Children can return to school after the first treatment.
Other people in the family home should also be treated.
Head Lice
Impetigo
Children can go back to school once the lesions are crusted or healed, or two days after starting antibiotics.
Children can go to school with head lice but they must be treated for the condition to prevent spreading.
You should treat your child by wet combing with a nit comb and conditioner.
Repeat this procedure on at least day 5, day 9 and day 13.
See the school nurse for further advice.
Threadworm
Children can go back to school when they have started their first treatment. Everyone in the family home should be treated.
Hand, foot and mouth, warts, verrucae, athletes foot & molluscum contagiosum Children can go to school. Verrucae should always be covered in changing rooms.
Further Advice…
You can always contact NHS direct on 111 or visit www.nhsdirect.nhs.uk
School Nurse
Local Pharmacy
See your local pharmacist for help and advice. Please ask them about the Minor Ailments Scheme as you will not always need to wait to see a doctor. Instead, you can get advice and treatment from North Lincolnshire Pharmacies.
We do run drop in sessions, please contact the front office if you would like further information – 01724 710368 | 1,323 | 719 | {
"id": "<urn:uuid:70a0c168-5af9-4d37-ad50-403bd3492849>",
"dump": "CC-MAIN-2019-35",
"url": "http://www.theaxholmeacademy.com/attachments/download.asp?file=2891&type=pdf",
"date": "2019-08-24T17:48:00",
"file_path": "crawl-data/CC-MAIN-2019-35/segments/1566027321351.87/warc/CC-MAIN-20190824172818-20190824194818-00369.warc.gz",
"offset": 318762363,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9970367401838303,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9980778098106384,
"per_page_languages": [
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
35,
708,
1464,
2400,
3155
],
"fw_edu_scores": [
2.015625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
BZ360, Sample Exam Questions (expect ~33 similar questions on the actual exam)
Name:________________________________________
1. Which of the following is not a real 'omics' application?
a. Genomics
b. Proteomics
c. Transcriptomics
d. Blastomics
e. Metabolomics
2. If an allele is present in a genome as two identical copies, one on each sister chromatid, the allele is which of the following?
a. Hemizygous
b. Heterozygous
c. Homozygous
a. Tetraploid
3. The following text is in what common sequence format? ___________________________________
>mc1r
ACACGTAGCTATTCATCGTGATTCGACTACGTACGACGGACTACTATCTACGGACTACTTACGGCGAGCTCAACACGTAGCTA TTCATCGTGATTCGACTACGTACGACGGACTACTATCTACGGACTACTTACGGCGAGCTCAACACACGTAGCTATTCATCGTG ATTCGACTACGTACGACGGACTACTATCTACGGACTACTTACGGCGA
4. What type of sequence alignment is shown below?
a. Local alignment
b. Global alignment
ACTGACCACGTCACAGGCTAGG || | | ||||| |||
AC---C-AGGTCAC-----AGG
5. The local alignment program________________is one of the most widely used bioinformatics tools.
6. A deletion or insertion of DNA at a particular genomic locus is an example of which of the following features commonly assayed using DNA sequencing?
a. SNP
b. Indel
c. Both a and b are correct
7. What is a UNIX command commonly used to change directories?_______________________________
8. Which of the following UNIX commands is used to make a new directory?
a. mkdir
b. makedir
1
Colorado State University, BZ360
c. md
d. make
e. new
9. Which of the following UNIX commands is used to list the contents of a directory?
a. touch
b. ls
c. more
d. rm
e. read
10. What software is needed to run the following script?
a. Bash shell
b. Python
c. Perl
d. Python and Bash shell
e. Perl and Bash shell
11. Using the shell below: 1) create a variable containing lowercase DNA sequence and 2) use tr [a-z] [A-Z] to change the sequence to uppercase and then output the uppercase sequence to a new file using no more than two lines of commands.
2 | 1,194 | 565 | {
"id": "<urn:uuid:19def8b7-b930-40b0-869b-4c47824a0b03>",
"dump": "CC-MAIN-2019-35",
"url": "http://rna.colostate.edu/dokuwiki/lib/exe/fetch.php?media=sample_questions.pdf",
"date": "2019-08-24T17:56:41",
"file_path": "crawl-data/CC-MAIN-2019-35/segments/1566027321351.87/warc/CC-MAIN-20190824172818-20190824194818-00370.warc.gz",
"offset": 164050579,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9884675145149231,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9890645742416382,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1438,
2011
],
"fw_edu_scores": [
2.28125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
LESSON 2
FINDING OUT ABOUT NHSSCOTLAND CAREERS
Learning Intentions
§ § You will find out about the different careers available in NHSScotland
§ § You will find out what careers with NHSScotland would best suit you
Success Criteria
§ § You can name 6 careers you did not know were available in NHSScotland
§ § You know what career in NHSScotland would suit you
Resources provided
§ § PowerPoint
Resources needed
§ § Computers and/or hand-held devices with internet access.
§ § Pens and paper/jotters
ACTIVITY 1 - 10 MINUTES
Share the learning intentions and success criteria for the lesson with learners (see PowerPoint).
Refer to slides 1 - 8
Slide 5 contains information about NHSScotland values - talk through the slide and support pupils to understand each of these values. Slide 6 contains a brief illustration of staff values - ask pupils the 3 questions on the slide to ensure understanding. Slides 7 and 8 support pupils to understand values in the context of NHSScotland.
ACTIVITY 2 - EXPLORING THE NHSSCOTLAND CAREERS WEBSITE - 30 MINUTES
Referring to slides 9 to 15, show pupils the information available at
www.careers.nhs.scot
Video links are included in slides 16,17,18. Pupils can view these videos as part of this introduction section, or can view them later.
Using computers and/or devices with internet access, direct pupils to
www.careers.nhs.scot
Learners can then explore our range of careers at
www.careers.nhs.scot/careers/explore-our-careers/
Tell Learners to find 6 job roles that they didn't know were available in NHSScotland in the 'Explore our Careers' section and note these down.
There is then a careers quiz for learners to complete at
www.careers.nhs.scot/careers/find-your-career/ map-your-career-quiz/
The quiz allows learners to identify where they would like to work, their skills and qualities and suggest job roles for them.
CONCLUSION - 10 MINUTES
Refer to the success criteria.
§ § You can name 6 careers you did not know previously were available in NHSScotland
§ § You know what career(s) in NHSScotland would suit you
Have they been met by all learners?
Find out about some of the learner's results through class discussion
Learners could share their quiz results/which new job roles they found
Has anyone found a job role they would be interested in, and why?
LEARNING INTENTIONS FOR LESSON 3
Next lesson, you will be finding out more about specific NHSScotland jobs and creating a job description of your own. | 1,210 | 604 | {
"id": "<urn:uuid:a244d675-b6e5-4ae5-8b97-78bfcef90f04>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.careers.nhs.scot/media/41142/lesson-2-plan.pdf",
"date": "2022-08-14T01:19:41",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00304.warc.gz",
"offset": 600342482,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9976786772410074,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9984674453735352,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
994,
1890,
2491
],
"fw_edu_scores": [
3.65625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
James put some money in his pocket and went to the store. He used 9/10 of his money to buy a book and had 23 remaining. How much did the book cost?
One of the best ways to become more confident using bar modelling is to use a game called 'Thinking Blocks' on the com There are 4 free apps you can download called Thinking Blocks Addition, Multiplication, Ratio
Ways to help your child: Ask Questions:
Out and About
What is the number on that bus/front door? Which direction are we walking in? Which way is left/right/forwards/backwards? How many steps up? (Count in 1 's, 2's) How long until the next bus/train? How much does this cost? Which costs more/less? How much would two of these be? What is the price on that item?
How much has this been reduced by. How much more do J need to buy this? How many can I buy with this much money? Which coins/notes do I have?
Preparing Meals
Can you tell me what the capacity is in litres/millilitres?
Can you tell me what this weighs in grams/kilograms/pounds/ounces? Which weighs more? How much do you think this might weigh? What is the weight/capacity on the packet?
How much liquid does this cup hold? How many halves/quarters has this food been cut into?
Can you help set the food timer?
In the shops
How much does this cost? Which costs more/less? How much would two of these be? Which coins/notes do I have? What is the price on that item? How much has this been reduced by. How much more do J need to buy this? How many can I buy with this much money?
At home
How many minutes until bedtime/lunch time? How many jumps can you do in 1 minute? How many minutes in an hour/ half an hour/quarter of an hour? How many pages in this story book?
What is the time? (Both digital and analogue clocks)
Mathematics for Parents
Mathematical Vocabulary
General
ones, tens, hundreds, thousands, place value, digit, real story, maths story, part-part-whole, number sentence, equation, regroup and rename, calculation, reasoning.
Addition and Subtraction
add, addition, addend, more, plus, increase, sum, total, altogether, score, double, near double how many more to make... ? subtract, subtraction, subtrahend, take (away), minus, decrease leave, how many
Multiplication and Division
lots of, groups of, times, multiply multiplication, multiplied by, multiplicand, groups of, multiple of, product, once, twice, three times… ten times as (big, long, wide. And so on), repeated addition, array, row, column, double, halve, share, share equally, one each, two each, three each, group in pairs, threes… tens, equal groups of, divide, division, divided by, dividend
Maths vocabulary card app
Math Vocabulary Cards App - play games with words and pictures to learns mathematical vocabulary.
Useful Websites
Purple Mash Education City Times table Rock Stars BBC bitesize
What is CPA?
This is the sequence we use when we teach children in lessons.
CPA stands for concrete-pictorial-abstract, and this approach is based on research by psychologist Jerome Bruner. The research suggests that there are three steps (or representations) necessary for pupils to develop understanding of a concept.
Concrete
may mean that when they are learning to add they are using cubes to create groups and then count the total. In Year 6 when learning how to find a fraction of an amount they may use counters to help their initial understanding
This is the physical stage of learning that all children must experience to gain a conceptual understanding of new areas of learning. In Year 1 that
Pictorial
The pictorial stage - a student has sufficiently understood the hands on experiences performed and can now relate them to representations, such as a diagram or picture of the problem. In the case of a division exercise this could be the action of circling objects.
Abstract
The symbolic stage - a student is now capable of representing problems by using mathematical notation, for example: 12 + 2 = 6 This is the ultimate mode, for it' is clearly the most mysterious of the three
What is Bar Modelling
Bar modelling has been developed as a way to visually represent a word problem; it is not used to teach children how to complete calculations but how to complete word problems and puzzles. | 1,752 | 961 | {
"id": "<urn:uuid:2936f157-687a-480c-96c6-b302e79a4337>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.koinoniafederation.com/_site/data/files/users/woolwich/newsletters/0305442E93C2AA577FE104A155F2B1E2.pdf",
"date": "2022-08-13T23:34:37",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00304.warc.gz",
"offset": 725945911,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9985347986221313,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9990025162696838,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1782,
4244
],
"fw_edu_scores": [
3.984375
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Strategies in Action: Classroom Environment
Author: Dr. Laurie Olsen | Contributors: Jennifer Diehl, Heather Skibbins | Grade level: K–1
First Grade: English-instructed classroom with numerous Multilingual Learners who have a variety of home language and cultural backgrounds.
From the welcome greeting on the door in various languages to the first peek into Ms. Welch's first-grade classroom, it is clear that this is a classroom of children and families from many places in the world. Today, as students are working at their tables writing or doing language arts activities, Mexican folk music is playing softly. Other days, it is music from other places in the world. Thanks to the support of the school librarian, Ms. Welch has been able to identify and borrow books in the languages of the families to display in the Class Library Corner. A bulletin board is filled with photos of the children's families. Posters, depicting different feelings (sadness, joy, etc.) and including children in a rainbow of racial/ethnic backgrounds, are arrayed around the "I Feel____" bulletin board where students hang drawings and writing whenever they want to express their feelings. From the start of the year, the basic theme of "similarities and differences" has permeated the curriculum, encouraging a value of diversity. Students compare and contrast their experiences and family structures, contrast books by different authors covering the same theme, and examine similarities and differences in redwood trees compared to apple trees for their Plants Unit. They have become proficient in using compare and contrast language, and using Venn Diagrams to display such data. Their writing and graphics adorn the walls. There is no question that this room belongs to and is representative of this group of children. A big collaborative art project takes up a portion of one wall as children work on a mural of their community, including the buildings and landmarks they see in their neighborhood. All around, children see themselves and the products of their work (their drawings, their writing) on the walls. This is their classroom.
There is no question that this room belongs to and is representative of this group of children.
Reflection questions
1. What features of Ms. Welch's class acknowledge children's multiple identities and support their learning? What might be a follow-up activity to build on the work that is already displayed in the classroom?
2. Ms. Welch would describe their lesson as "culturally relevant." What does this term mean to you? What are key features of a "culturally relevant lesson?"
3. What is one takeaway that you can apply to your own classroom environment for supporting Multilingual Learners? | 1,039 | 530 | {
"id": "<urn:uuid:21dae3d3-eac4-488d-bb50-cb6312cd2e2a>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.multilinguallearningtoolkit.org/wp-content/uploads/2021/08/K-1_Classroom_Environment.pdf",
"date": "2022-08-13T23:43:09",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00304.warc.gz",
"offset": 772587466,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9991672039031982,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991672039031982,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2729
],
"fw_edu_scores": [
3.8125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
HEALTH SERVICES ACADEMY ISLAMABAD
(ADMISSION SECTION)
Entry test - Sample Paper
Total Marks= 100
Time: 120 minutes
The Entrance Test will comprise of online multiple-choice questions (MCQs). You will select one answer from the choices given below each question. Different questions will be asked from each of the following areas:
1. General (English, Quantitative, Analytical) (30 MCQs)
3. Subject Knowledge – Public Health (70 MCQs)
SECTION I- GENERAL
Q. He is usually ________________, but today he appears rather __________________.
A. Happy, Humorous
B. Strict, unwell
C. Tense, restless
D. Easy, Comfortable
E. None of the above
Correct answer: E
Q. 8(6+5) - 10 =?
A. 76
B. 78
C. 80
D. 82
Correct Answer: B
Q. Scientists have been studying volcanoes for many years. They want to find ways to predict when volcanoes will erupt. Such knowledge could help protect people from a volcano's sudden burst of hot lava and ash. Although scientists can't say exactly when a volcano will erupt, they know that a slight change in the shape of the earth is one warning sign. Another is that some volcanoes emit a gas called sulfur dioxide before they erupt.
This story is mainly about
A. becoming a scientist
B. natural disaster
C. the blessing of volcanoes
D. predicting volcanic eruptions
Correct Answer: D
SECTION II- SUBJECT BASED (PUBLIC HELATH)
Q. A __________ state is necessary for enrollment in cohort study
A. Determinant free
B. Risk factor free
C. Exposure free
D. Disease free
Correct Answer: D
Q. Bio-Statistics is the application of statistics in:
A. Life Sciences
B. Medical Sciences
C. Both A & B
D. None of the above
Correct Answer: C
Q. When one of my friend's mother died I went to offer him condolences and asked him "what happened?" This is an example of:
A. Sympathy
B. Empathy
C. Counselling
D. Communication
Correct Answer: B
Q. Which one is not an example of Non-Communicable Disease
A. Cardiovascular disease
B. Chronic obstructive lungs disease
C. Depression,
D. Food poisoning
Correct Answer: B
Q. About mental illness, which of the following statements is CORRECT?
A. There is a growing need to ensure institutional care for more effective management.
B. Rehabilitation and reintegration with community improves clinical outcome.
C. GP clinics often pose a stigma to the patients.
D. The focus is on the specialist care and not patient choice.
Correct Answer: D
Q. A variable that is presumed to cause a change in another variable is called a(n):
A. Categorical Variable
B. Dependent variable
C. Independent variable
D. Intervening variable
Correct Answer: C | 1,328 | 641 | {
"id": "<urn:uuid:22a8c344-99c7-482f-9a68-1f03e2371643>",
"dump": "CC-MAIN-2022-33",
"url": "https://hsa.edu.pk/web/content/14323?unique=3f18955ff65a21f0db05535eadec4b6528a402d1&download=true",
"date": "2022-08-14T01:40:33",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00306.warc.gz",
"offset": 289286872,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9896695911884308,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9901589155197144,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1528,
2624
],
"fw_edu_scores": [
2.328125
],
"minhash_cluster_size": 1,
"duplicate_count": 2
} |
Weight
Reducing - Stopping Smoking and Managing your Weight
This dietary advice sheet gives some general information to help you make the recommended changes to your diet. If you need more detailed advice or if you are following a special diet that makes it difficult to make these changes, please ask your doctor to refer you to a registered dietitian
It is important to manage your weight while giving up smoking because during this time:
- Food tastes and smells better
- Your appetite returns
- Food can be used as a distraction to not smoke
- Your metabolism slows down
(Taken from: https://www.nhs.uk/better-health/quit-smoking/ accessed 9 March 2021)
Use the healthy eating tips in this information sheet to help you make more low calorie choices and minimise any possible weight gain
Fruit and Vegetables
Fibre
Aim to have five portions of these each day, fresh, frozen or tinned. Fruit and vegetables are both low in calories and provide essential nutrients to promote healthy skin, immune function and general well being. One portion is:
- 1 fresh fruit, such as apple, small banana, pear, orange
or, 2 small fruits, such as 2 plums, 2 apricots, 2 kiwis
or, 3 tablespoons cooked fruit or vegetables
or, a small mixed salad or, a medium glass of fruit juice (this will not contain as much fibre as eating the fresh fruit)
or a handful of dried fruit.
Fibre is needed in the diet to help maintain a healthy digestive system. It also helps to fill you up.
To increase your fibre intake:
- Choose high fibre breakfast cereals such as Weetabix, Shreddies or Branflakes.
-
Choose brown, wholemeal/wholegrain bread, pasta and rice rather than white
Eat five portions of fruit and vegetables per day (see section overleaf).
- Include pulses, peas, beans and lentils in stir fries and casseroles.
Reducing - Stopping Smoking and Managing your Weight
Fat
Sugar
Aim to eat less fat in your diet and change the type of fat:
- Choose low fat dairy foods such as semiskimmed or skimmed milk, low calorie yoghurts, reduced fat cheeses and spreads.
- Avoid using fat when cooking – grill, poach, bake and microwave instead.
- Choose lean meat, trim visible fat and avoid skin from chicken and crackling from pork.
- Choose healthy option cook-in sauces with less than 5g fat per 100g sauce.
Change from butter to a polyunsaturated or monounsaturated low fat spread such as Flora Light, Gold Low fat, Olive Light spread.
Snacks
You can have snacks between meals if you choose healthily. Remember to stock up on healthy items to prevent you being tempted by other things.
Try the following:
bowl of chopped vegetables such as carrots, celery and peppers crispbreads and water biscuits plain popcorn fresh fruit/low calorie yoghurts
If you are tempted by chocolate try:
low calorie chocolate mousse low calorie hot chocolate drinks such as
Ovaltine Options, Cadburys Highlights and supermarket own brands
Funsize bars and low calorie bars
If you are tempted by more savoury snacks try: Baked crisps
Skips, Twiglets and Quavers – these still contain calories but are better than standard packets of crisps.
Sugar provides 'empty calories'. 1 teaspoon provides approximately 20 calories. Aim to reduce the amount of sugar in your diet as much as possible.
Try to:
- Have hot drinks without sugar or with a sweetener.
- Choose 'no added sugar' squashes, diet and slimline fizzy drinks.
- Choose tinned fruit in natural juice rather than in syrup.
- Choose low calorie yoghurts such as Weight Watchers, Onken light, Muller light
- Choose 'no added sugar' desserts such as sugar free jelly and 'no added sugar' instant whips made with semi or skimmed milk.
Some extra handy tips
Try to eat three regular meals each day.
Try to eat starchy carbohydrate such as bread, potato, rice and pasta at each meal. These are low in fat and will help to make you feel full.
Relax for a few minutes before a meal and eat slowly.
If you need to eat smaller portions, then try using a smaller plate.
Try not to buy tempting foods – if it's not in the cupboard, you can't eat it!
Stay motivated. It is easier to achieve results if you have a clear goal of weight loss or clothes size to work towards.
Don't give up.
Your weight loss may stop and start but keep going and the outcome will be worth it!
-
Weight | 1,858 | 978 | {
"id": "<urn:uuid:8da2e224-4601-4895-b092-c2d934a0c850>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.nnuh.nhs.uk/publication/download/weight-reducing-stopping-smoking-and-managing-your-weight-v5/",
"date": "2022-08-14T01:23:06",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00305.warc.gz",
"offset": 801406502,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9982039034366608,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9985955953598022,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1820,
4331
],
"fw_edu_scores": [
2.3125
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Which of the following expressions is equivalent to 𝑏(5 −𝑏) −2(𝑏+ 8)?
A. −2𝑏−16
B. −2𝑏+ 8
C. −𝑏 2 + 3𝑏−16
D. −𝑏 2 + 3𝑏+ 8
E. −2𝑏 2 −16
Answer Explanation.
The answer is C. Start by distributing both the 𝑏 and the −2 to their respective parenthesis to get 5𝑏−𝑏 2 −2𝑏−16 Combine like terms and reorder terms by highest degree to end with the value in answer choice C.
Question 2
A bag contains 20 different colored marbles: 7 red, 8 blue, and 5 green. One marble will be randomly selected from the bag. What is the probability the marble picked is NOT blue?
A.
1
4
B.
2
5
C. 1 2
D. 3 5
E. 4 5
Answer Explanation
The answer is D. The marbles that are not blue are red and green for a quantity of 12 out of 20 marbles. The probability 12 20 can be reduced to 3 5 .
The function 𝑔 is defined as 𝑔(𝑥) = −3𝑥 3 + 3𝑥. What is 𝑔(−3)?
A.
−90
B.
−72
C.
9
D. 72
E. 90
Answer Explanation
The answer is D. Substitute
−3
in for
𝑥
in the function to get
𝑔(−3) = −3(−3)
3
+ 3(−3) = −3(−27) −9 = 81 −9 = 72
Question 4
30% of 280 is equal to 70% of what number?
A.
364
B. 300
C. 196
D. 154
E. 120
Answer Explanation
The answer is E. 30% of 280 is 84. Students can set up a proportion 84 𝑥 = 70 100 then cross multiply to solve for the value. The result is 120.
.
When (4𝑥+ 2) 2 is written in the form 𝑎𝑥 2 + 𝑏𝑥+ 𝑐, where 𝑎, 𝑏, and 𝑐 are integers, 𝑎+ 𝑏+ 𝑐= ?
A. −16
B. −2
C. 6
D. 12
E. 36
Answer Explanation
The answer is E. When the binomial is multiplied, the result is 16𝑥 2 + 16𝑥+ 4. The value of 𝑎= 16, 𝑏= 16, and 𝑐= 4, thus 𝑎+ 𝑏+ 𝑐= 36.
Question 6
Answer Explanation
The answer is D. First distribute the 6 to the 𝑥 and −6. The result is 6𝑥−36 = −25. Add 36 to both sides and divide by 6. The result is 𝑥= 11 6 .
Jane is bowling in a tournament and has the highest average after 5 games, with scores of 220, 225, 264, 241, and 280. In order to maintain this exact average, what must be Jane's score for her 6th game?
A. 210
B. 241
C.
246
D. 250
E.
265
Answer Explanation
The answer is C. To find the average of the original scores, calculate the sum then divide by 5. 220+22+264+241+280 5 = 1230 5 = 246. In order for Jane to maintain the exact average after a sixth game, she needs to bowl a score that matches the average of the first five games, therefore she needs to bowl a 246 in the last game.
Question 8
In the school cafeteria, students choose their lunch from 4 sandwiches, 2 soups, 2 salads, and 5 drinks. How many different lunches are possible for a student who chooses exactly 1 sandwich, 1 soup, 1 salad, and 1 drink?
A. 5
C. 16
B. 8
D. 40
E. 80
Answer Explanation
The answer is E. Using the fundamental counting principle, multiply the number of options for each category.
4 × 2 × 2 × 5 = 80 possible combinations.
(2𝑎+ 3𝑏−𝑐) −(−3𝑎+ 𝑏+ 2𝑐) is equivalent to:
A.
−𝑎+ 2𝑏−3𝑐
B.
−𝑎+ 4𝑏−3𝑐
C.
5𝑎+ 2𝑏−3𝑐
E. 5𝑎+ 2𝑏+ 𝑐
D. 5𝑎+ 4𝑏−3𝑐
Answer Explanation
The correct answer is C. After distributing the negative sign to the second set of parentheses, the result is 2𝑎+ 3𝑏−𝑐+ 3𝑎−𝑏−2𝑐. Combining like terms results in 5𝑎+ 2𝑏−3𝑐.
Question 10
The median of the following data set is 6. Which of the following is a possible value of 𝑥?
A. 6
B. 7
C.
8
D. 10
E. 12
Answer Explanation
The answer is A. In the number set, 6 has to be the middle term which allows two numbers before and two numbers after. 7 and 11 already fall after the median which means that the value of 𝑥≤6. | 1,718 | 1,336 | {
"id": "<urn:uuid:57824c09-16a8-4ce7-8ec7-21dee221866b>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.aacps.org/cms/lib/MD02215556/Centricity/Domain/296/ACT_Practice_2.pdf",
"date": "2022-08-14T01:21:45",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00305.warc.gz",
"offset": 562552545,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9554237723350525,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9866579174995422,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
774,
1282,
1744,
2779,
3439
],
"fw_edu_scores": [
3.140625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Liturgy of the Word with Children Thirteenth Sunday in Ordinary Time, Year C
26 June, 2022
Luke 9:51-62
Catechist Background
In some ways today's gospel is an awkward passage that is open to misunderstanding. It comes into sharp focus particularly when contrasted with today's first reading (1Kings 19:16, 19-21), where Elisha was allowed to say goodbye to his parents. The implication in this gospel is not that we should not be concerned about our loved ones, but rather that we should be ready to follow Jesus' call in every moment of our lives. Elisha was called to be a successor to Elijah; the disciples were not called to 'succeed' Jesus but to follow him, and we are called to do the same. Many people miss opportunities in following God's will because they delay 'until I get a promotion,' or 'after the children are in school,' or 'when the children have left home.' Jesus asks us to follow him in all stages of our lives. Every moment is the perfect time.
Setting the Scene
For the activity described below, you will need items to make and decorate flags. Depending on the age and ability of your children, these could be of any size or shape (e.g. bunting or traditional flags), and made out of either cloth or paper.
We Say Sorry
Leader: You call all to follow you, Lord have mercy.
All: Lord, have mercy.
Leader: You entrust us with your work, Christ have mercy.
All: Christ, have mercy.
Leader: You give us all we need, Lord have mercy.
All: Lord, have mercy.
Gloria
We Pray (1)
God our Father, help us to follow Jesus and to understand that what he says is true. Amen.
Gospel Acclamation
Gospel:
Luke 9:57-62
Reflecting on the Reading with Children
- How do we know if someone supports a particular football team? What might they wear? How could we know from what they say? How might we know from their actions?
- How do we know if someone follows Jesus? How would they act?
- If you say that you will be a fan of XXXXX team in the future, are you really their fan now?
- If someone said that they will follow Jesus in the future, but not yet, what would that mean?
Response
If your space and noise constraints allow it, you may wish to shout a cheerful 'We follow Jesus!' while waving your flags.
Give the children flags to decorate to show that they 'support Jesus' side.' If your children's liturgy group has lots of very small children, it might be a good idea to have prepared a design for the flag beforehand, for instance with a cross on it. Make sure to emphasise that following Jesus involves more than waving flags or cheering, but also joining Jesus in imitating his love in action.
We Believe
Relating to the creed what you have shared with the children, ask this series of questions and invite the children to reply, 'I do.'
- Do you believe in God the Father who made the whole world out of love?
- Do you believe in God the Son, Jesus, who came to call us back to God?
- Do you believe in God the Holy Spirit who helps us to follow Jesus today?
We Pray (2)
Again, try to relate the bidding prayers to the reading by saying, 'Jesus, you prayed to your Father and so we also now pray…'
Leader: We pray for leaders in the Church and leaders in Catholic schools, that they may always lead people to follow Jesus. Lord in your mercy,
All: Hear our prayer.
Leader: We pray for all sportsmen and sportswomen. May they remember to be good role models, especially for children. Lord in your mercy,
All: Hear our prayer.
Leader: We pray for Christians in the parts of the world where it is dangerous to say that you believe in Jesus. Lord in your mercy,
All: Hear our prayer.
All: Hear our prayer.
Leader: We pray for our parish and for our families. Lord in your mercy,
Leader: Lord, we know that you hear all our prayers. Help us to hear when you answer us. We make all our prayers through Christ our Lord.
All: Amen. | 1,594 | 929 | {
"id": "<urn:uuid:a484886d-d219-40d2-9070-eda18b045df1>",
"dump": "CC-MAIN-2022-33",
"url": "https://www.albanstephen.org/albanstephens/wp-content/uploads/2022/06/year-c-13th-sunday-ot-june-262022.pdf",
"date": "2022-08-14T01:05:23",
"file_path": "crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00312.warc.gz",
"offset": 574372994,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.99886554479599,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.998894989490509,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1924,
3909
],
"fw_edu_scores": [
2.75
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Pet Proofing your Home
Just as parents 'childproof' their home, so should pet owners 'petproof' theirs.
Four-legged members of the family, like infants and small children, are naturally curious and love to explore their environment with their paws, claws and mouths. But they can't know what is dangerous and what is not... so it's up to you to make your home a safe haven. The following tips can help ensure that your pet enjoys a long, happy and accident-free life in your care.
Fur Life Vet provides health and wellbeing information for you to help care for your pets throughout their lives. Fur Life Vet provides health and wellbeing information for you to help care for your pets throughout their lives.
furlifevet.com.au
Pet Proofing your Home
Keep your fur baby safe and sound from household hazards
All around the house
+ Screen windows to guard against falls.
+ Don't let young pets out on balconies or high decks.
+ Many house plants, including Lilies/Liliaceae family, Dieffenbachia (dumbcane), Philodendrons, Ivy (various species), Creeping Charlie, Umbrella Plant and many more are extremely poisonous if eaten. Remove them or put them out of reach in hanging baskets.
+ Rat bait is extremely tempting for dogs to eat, yet is highly poisonous and potentially fatal, and should not be accessible at any time.
+ Puppies & kittens love to chew when they're teething, so unplug, remove or cover electrical cords.
+ Don't leave a room where a fire is lit or a space heater is being used unattended.
+ Plastic bags may be fun to play with, but they can suffocate.
+ If your pet can put something in their mouth, they probably will. Don't leave small, sharp, easily swallowed objects lying around.
Dog-gone disasters
+ Eliminate hooks or similar objects placed at your dog's shoulder height – their collar or harness could become tangled and they could choke. A tall perimeter or invisible electrical fence around your property will minimize the risk of your dog running out into traffic or roaming far from home.
Home for the Holidays
+ Be extra cautious during Christmas as tinsel and other decorations, tree lights and glass ornaments will tempt your pet's curiosity – but all could be lethal if chewed or swallowed. Poinsettia, holly and mistletoe are poisonous to your pets.
Kitchen, laundry & bathroom
+ Never leave hotplates or irons on unattended.
Fur Life Vet provides + Dangerous household chemicals such as bleach and ammonia should be stored out of your pet's reach.
health and wellbeing + Close washing machine and dryer lids – your pet might climb in and become trapped.
help care for your pets throughout their lives. + Medicines, shampoo, sunscreen and other personal care items can kill your pet. Make sure they can't get hold of them.
information for you to + Keep toilet lids down – small pets can actually drown if they fall in.
In the garage
+ Cats enjoy naps near a warm engine so, before you drive off, honk your horn and make sure your pet is not under or near the car.
furlifevet.com.au + Pets like the smell and taste of antifreeze and windscreen washer. Tightly cover their containers and wipe up any spills.
+ Paint, petrol and other dangerous chemicals should be stored out of reach.
Out in the yard
+ Some outdoor plants can be poisonous to pets. Many plants can also be responsible for allergies in our pets.
+ Keep pets away from spiders, snakes and cane toads.
+ Keep pets away from lawns and gardens treated with snail bait or chemicals.
+ Store garden tools, baits and chemicals securely and keep garden sheds locked.
+ Cover swimming pools, spas and ponds- your pet might fall in and not be able to get out. | 1,404 | 840 | {
"id": "<urn:uuid:5831d83f-8f6e-492e-8c4c-da45109a985a>",
"dump": "CC-MAIN-2023-50",
"url": "https://www.furlifevet.com.au/wp-content/uploads/2022/02/FLV1962-Furlife-DL-Brochure-2020-Pet-Proof-Your-Home.pdf",
"date": "2023-11-30T20:10:44",
"file_path": "crawl-data/CC-MAIN-2023-50/segments/1700679100232.63/warc/CC-MAIN-20231130193829-20231130223829-00282.warc.gz",
"offset": 892664983,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9985497891902924,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9987207651138306,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
811,
3666
],
"fw_edu_scores": [
2.328125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Free informational handouts for educators, parents, and students
The Effect of Language Delays on Reading and Writing Skills: FAQs
by Dale Ducworth, M.C.D, CCC-SLP
Is there a relationship between language delays and reading/writing skills?
What type of difficulties will a child with language delays have?
Ask any classroom teacher or special educator (SE) and he/she will tell you that children with language delays are much more likely to experience difficulties in the classroom, particularly in the areas of reading and writing. As a result, Speech-Language Pathologists (SLPs) are becoming increasingly more involved in the remediation of reading and writing skills in children diagnosed with a language disorder.
A child with a language delay may have difficulties in the classroom with:
* Understanding oral directions.
* Vocabulary skills.
* Using complete sentences or correct grammar.
* Completing assignments independently.
* Becoming easily frustrated.
How can a child's reading and writing skills be affected by a language delay?
A child's reading and writing skills can be affected by a language delay in many different ways. He/ she may experience problems with:
* Learning the relationship between letters and sounds.
* Discriminating between sounds.
* Learning sight words.
* "Guessing" at words based on pictures or the beginning sound.
* Spelling.
* Fluent oral reading (not sounding "choppy").
* Forming letters and words on paper.
* Organizing thoughts on paper.
* Reading comprehension.
®
www.handyhandouts.com • © Super Duper
®
Publications • www.superduperinc.com • Photos © Getty Images
Free informational handouts for educators, parents, and students (cont.)
As a parent, what should I do if I suspect that my child might have a language delay and/or problems with reading and writing?
What can I do at home to help my child?
First of all, discuss your concerns with your child's classroom teacher/SE. It may be possible that some changes could be made in the classroom that will help your child be more successful. If your child has not had a speech and language evaluation, request that an evaluation be done by the SLP at school. Be sure to tell the SLP about the difficulties you have observed in your child.
What can I do to help?
If your child is diagnosed with a language delay, be sure you understand his/her areas of weakness and the goals he/she is working on at school. Ask his/her SLP for activities that you can work on at home. Also, talk to the classroom teacher/SE about any problems that he/she may be having with reading or writing. Remember that good communication between the parent, classroom teacher/SE, and SLP is one of the most important things you can do to help your child.
Here are some suggestions for things you can do at home:
* Read books with your child. Make it a special and enjoyable time together. If your child sees that you enjoy reading, it's likely that he/she will see reading as fun! Also, reading books introduces your child to new vocabulary and allows him/her to hear grammatically correct sentence structures.
* Promote phonemic awareness. Provide opportunities for word play through rhyming words, songs, chants, etc. Talk about how the words rhyme, begin with the same sound, or end with the same sound. For example, the book titled Brown Bear, Brown Bear says "Brown Bear, Brown Bear, What do you see? I see a Blue Horse looking at me." When reading, you could point out that "brown and bear" begin with the letter "b" and "see/me" are rhyming words.
* Provide new experiences. Exposing your child to new experiences provides opportunities for increasing vocabulary. For example, take your child to the zoo or for a walk in the woods and talk about things you see.
* Encourage your child. A child that is struggling academically needs a lot of positive feedback to encourage success. Use phrases like "You are really working hard, You are doing a great job, etc."
Resources:
Catts, H.W., Fey, M.D., Zhang, X. & Tomblin, J.B. "Language basis of reading disabilities: Evidence from a longitudinal investigation," Scientific Studies of Reading; 1999; 3:331-361.
For more FREE Handy Handouts®, go to www.handyhandouts.com
®
www.handyhandouts.com • © Super Duper
Publications • www.superduperinc.com • Photos © Getty Images
® | 1,824 | 927 | {
"id": "<urn:uuid:329df706-7e66-4590-b981-0648c6d462a9>",
"dump": "CC-MAIN-2023-50",
"url": "https://www.handyhandouts.com/pdf/62_EffectsLangDelays.pdf",
"date": "2023-11-30T21:37:26",
"file_path": "crawl-data/CC-MAIN-2023-50/segments/1700679100232.63/warc/CC-MAIN-20231130193829-20231130223829-00283.warc.gz",
"offset": 895852626,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9977483153343201,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9985721707344055,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1627,
4330
],
"fw_edu_scores": [
3.78125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Study Lesson 4
Central College Presbyterian Church
An All-church Study
Week's Aim:
The
"Coup de Grâce"
Webster's definition for "Coup de Grâce" from Old French, literal meaning: "stroke of mercy"
Topic for Day 1: Overview - Read Romans 3:9-31
1. From a cursory read, what would you say people's problem is according to Paul's choice of words?
2. What does Paul say God can do for people?
3. What good news/hope did you see in this passage?
Application 1: What did you learn from the sermon and how might you apply it to your life this week?
Topic for Day 2: The problem: All are unrighteous and need God's mercy - 3:9-20
1. In verses 9-20, how many times do you see the word(s):
2. List the things unrighteous people do:
3. Paul quotes Psalm 36:1 in verse 3:18 to identify the reason people are this way. What is the reason?
4. What are Paul's conclusions in verses 3:19-20?
```
"no one" ( ); "their/they" ( ); "righteous" ( ) What does that tell you about the importance of these words?
```
Application 2: How might you demonstrate your respect (fear) of God throughout this day? Everyday? (you might write them on a note and keep it with you)
Topic for Day 3: God's solution: His mercy is through Him making His righteousness available. - 21-23
1. Using a dictionary (Bible dictionary best) write the definitions for righteous and righteousness:
2. First things first, according to 3:20 who will be declared righteous by following the law?
3. What has God done according to verse 21?
4. How does a person receive this righteousness (verse 22)?
5. List the process of acquiring a belief in Jesus Christ as recorded in Romans 1:5, 10:9-10, 14:
Application 3: What have you learned about God in this lesson?
Topic for Day 4: Jesus' accomplishment: His mercy and justification offered through Jesus. - 24-26
1. Again, using your dictionary, write the definitions for justice, justification, redemption, and atonement:
2. How does redemption come (vs. 24)?
3. His atonement is achieved by faith in what (vs. 25)?
4. What attributes (character traits) of God do you find in verses 24-26?
Application 4: What is something you have learned, or been reminded of, that you can apply to your life?
Topic for Day 5: Our response: Don't boast, but by faith, accept His mercy and believe in Jesus. - 27-31
1. How many times is the word faith used in these five verses? What does that say to you about faith?
2. After reading Hebrews 11:1, in your own words write a definition of faith:
3. We sometimes hear others boasting about their faith and relationship with God, but what does Paul say about boasting?
4. How would you define self-righteousness and how do you avoid it?
5. Find two principles Paul identifies in verses 27-28:
6. From verse 31, how does faith uphold the law?
Application 5: After all this study, what will your response be? Have you believed in Jesus Christ as your Savior and committed your life to Him? If not, will you pray for His guidance?
If you have, how would you explain coming to Christ to a stranger (writing it down is good) | 1,409 | 787 | {
"id": "<urn:uuid:e1d2a180-ad0c-4d85-a494-fb7b5df90915>",
"dump": "CC-MAIN-2018-09",
"url": "http://ccpc.us/images/stories/pdf/romans_STUDY/study_lesson4.pdf",
"date": "2018-02-19T05:36:25",
"file_path": "crawl-data/CC-MAIN-2018-09/segments/1518891812405.3/warc/CC-MAIN-20180219052241-20180219072241-00068.warc.gz",
"offset": 60658672,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9955355525016785,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9960598349571228,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1603,
3113
],
"fw_edu_scores": [
2.40625
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
The Reading
*The importance of reading to the student *The type of reading
The meaning of reading
* Reading is a complex "cognitive process" of decoding symbols in order to construct or derive meaning (reading comprehension). Reading is a means of language acquisition, communication, and of sharing information and ideas. Like all languages, it is a complex interaction between the text and the reader which is shaped by the reader's prior knowledge, experiences, attitude, and language community which is culturally and socially situated. The reading process requires continuous practice, development, and refinement
The meaning of reading
* In addition, reading requires creativity and critical analysis. Consumers of literature make ventures with each piece, innately deviating from literal words to create images that make sense to them in the unfamiliar places the texts describe. Because reading is such a complex process, it cannot be controlled or restricted to one or two interpretations. There are no concrete laws in reading, but rather allows readers an escape to produce their own products introspectively. This promotes deep exploration of texts during interpretation. [1]
The meaning of reading
* Readers use a variety of reading strategies to assist with decoding (to translate symbols into sounds or visual representations of speech) and comprehension. Readers may use context clues to identify the meaning of unknown words. Readers integrate the words they have read into their existing framework of knowledge or schema (schemata theory).
Importance of reading to the students
* 1. Enhances knowledge:
*
When you read, you get to know many things which you might not have come across otherwise. So, by reading, you will be able to enhance your knowledge With bits of information, you are able to fill up your head.
* 2. Learning of new words:
*
The more you read, the more word you come across and they make the way into your daily life. When you start making use of the good words in your day to day life, you tend to feel satisfied and happy. Being able to speak well with a good vocabulary, you feel confident and also it is the key to any successful profession.
Importance of reading to the students
* 3. New languages are learned:
*
Not just the words, but also many dialects and languages are learned. When we read ourselves, we tend to remember that for a longer period of time but when we just hear from someone, it does not make a long lasting impression on our mind. So, in this manner it also helps in learning varied languages.
* 4. Increases patience level:
*
The level of patience increases. When you have a good thick book of 100 pages, you wish to complete it but with patience to know the indepth meaning of each line and the word in it. So when this attitude of understanding every single word comes to mind, the patience develops ultimately.
Importance of reading to the students
* 5. Brings tranquillity:
*
No matter what type of book you read, every book relaxes your mind and brings peace into your mind. It brings a change in your attitude with the subject you read. For example, reading spiritual content lowers the blood pressure and going between the lines of self help books assist in knowing various solutions to the inevitable problems in life. So, not just the problems are solved, but also the life in that particular moment of ecstasy, the peace is experienced, forgetting all the issues in life.
* So, above are some of the reasons which tells the reading importance for everyone. No person in life should restrict himself or herself by reading any book. Many qualities are incorporated within an individual that might not be inculcated through any advice from parents and others.
The Type of Reading
* Overview
* Intensive Reading
* Extensive Reading
* Intensive and Extensive Reading Together
* Scanning
* Skimming
* Scanning and Skimming Together
* References
Prepared By Marwa Salih | 1,568 | 800 | {
"id": "<urn:uuid:3e7eedcd-231f-46f2-bcd8-0a719d9a87d9>",
"dump": "CC-MAIN-2018-09",
"url": "http://ircoedu.uobaghdad.edu.iq/uploads/ircoedu/2018/pages/electronic%20lectures/English/D.%20Bushra%20Saadoun/The%20Reading.pdf",
"date": "2018-02-19T05:46:45",
"file_path": "crawl-data/CC-MAIN-2018-09/segments/1518891812405.3/warc/CC-MAIN-20180219052241-20180219072241-00071.warc.gz",
"offset": 162684646,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9915164411067963,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9983677268028259,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
75,
621,
1192,
1564,
2198,
2900,
3757,
3941,
3966
],
"fw_edu_scores": [
3.09375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
INTRODUCTION
The basic premise of the DM was similar to that of Gouin's Series Method, namely that second language acquisition where lots of oral interaction, spontaneous use of the language, no translation between first and foreign languages, and little or no analysis of grammatical rules.
The DM enjoyed considerable popularity at the beginning of the 20 th century.
It was most widely accepted in private language schools where students were highly motivated and where nativespeaking teachers could be employed.
Teachers who use the DM intend to teach students how to communicate in the target language by learning to think in the target language. The teacher directs the class activities, where the student's role is less passive than in the GTM. The teacher and the students are more like partners in the teaching/learning process. The initiation of the interaction goes both ways, from teacher to students and from student to teacher, although the latter is often teacher-directed. Students converse with one another as well.
The students' feeling, needs and interests are not considered. Language is primarily spoken not written. Students study common, every speech in the target language. They also study culture consisting of the history of the people who speak the target language and geography of the country where the language is spoken, and information about the daily lives of the speakers of the language.
Vocabulary is emphasized over grammar. Oral communication is seen as basic. Reading and writing exercises are based on the students' oral practice. Pronunciation receives attention. The students' native language should not be used in the classroom. Student are evaluated by asking them to use the language, not to demonstrate their knowledge about the language. They are doing so by using both oral and written skills. The feedback used is by the employment of various techniques by the teacher who tries to get students to self-correct whenever possible.
Principles of the DM
Richards and Rodgers (2001: 12) summarize the following principles of the DM :
1- Classroom instruction was conducted exclusively in the target language.
2- Only everyday vocabulary and sentences were taught.
3- Oral communication skills were built up in a careful treated progression organized around question and answer exchanges between teachers and students in intensive classes.
4- Grammar was taught inductively.
5- New teaching points were taught through modeling and practice.
6- Concrete vocabulary was taught through demonstration, objects, and pictures. Abstract vocabulary was taught by association of ideas.
7- Both speech and listening comprehension were taught.
8- Correct pronunciation and grammar were emphasized.
Larsen-Freeman (2000:29) add the following principles:
1- Students need to associate meaning and the target language directly.
2- Students speak in the target language a great deal and communicate as if they were in real situation.
3- The syllabus used is based upon situation, or topics.
The Teaching Techniques used in the DM are :
1- Reading aloud
2- Question and answer exercises
3- Self-correct by students
4- Conversation practice
5- Fill-in-the-blank exercise
6- Dictation
7- Map drawing : The students were given a map with the geographical features unnamed, and then the teacher gives the students directions.
8-Paragraph writing
Merits of the DM
1- The focus is on oral skills.
2- The use of target language is wide.
3- Teacher _ student and student_ student interaction is accomplished
Demerits of the DM
1-It offered innovations at the level of teaching procedures but lacked a thorough methodology basis.
2- Its main focus was on the exclusive use of the target language in the classroom, but it failed to address many issues.
3- DM did not take well in public education, which is a method difficult to use where the constrains of the budget, classroom size, time, and teacher background are found.
4- It has weak theoretical foundation .
5- It success may have been more a factor of the skill, proficiency, and personality of the teacher than the methodology itself.
By the end of the first quarter of the 20 th century, the use of the DM had declined both in Europe and in the US. But by the middle of the century, the DM was revived and redirected into the most visible of all language teaching revolution in the modern era, the Audiolingual Method.
THANK YOU | 1,818 | 873 | {
"id": "<urn:uuid:6bed9b30-9dd2-4a93-a7b3-5aa661b4bebd>",
"dump": "CC-MAIN-2018-09",
"url": "http://ircoedu.uobaghdad.edu.iq/uploads/ircoedu/2018/pages/electronic%20lectures/English/D.%20Bushra%20Saadoun/Direct%20Method.pdf",
"date": "2018-02-19T05:58:39",
"file_path": "crawl-data/CC-MAIN-2018-09/segments/1518891812405.3/warc/CC-MAIN-20180219052241-20180219072241-00072.warc.gz",
"offset": 178144702,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9983820698478005,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9993059635162354,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
292,
518,
1036,
1426,
1983,
2738,
3029,
3381,
3541,
4127,
4413,
4424
],
"fw_edu_scores": [
3.578125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
1. What can you make with 4 protons and 4 neutrons?
A. Oxygen atom
B. Beryllium atom
C. both of these
2. Would you predict that 4 protons and 4 neutrons will make a stable nucleus?
A. No, because the net charge is high
B. No, because there should always be more protons than neutrons
C. Yes, because the number of protons and neutrons are about equal
3. If you have 5 protons & 6 neutrons, how many electrons would you add to make a neutral atom ?
A. 5 electrons
B. 6 electrons
C. 11 electrons
3. Reasoning: Neutrons don't matter because they have zero charge; need equal number of protons and electrons
4. What is mass number for an atom with 8 protons, 9 neutrons and 8 electrons?
A. Zero
B. 8
C. 16
D. 17
E. 25
5. If you have 5 protons, 6 neutrons, & 5 electrons, what would the symbol look like?
A B C D
6. If you have 8 protons, 9 neutrons, 10 electrons, what would the atom or ion be?
A. Zero, it's an atom
B. +2 ion
C. +1 ion
D. -1 ion
E. -2 ion
7. If you have 3 protons, 4 neutrons, & 3 electrons, what would the model look like?
A. 3 red & 3 blue in center; 4 grey on rings
B. 3 red & 4 grey in center; 3 blue on rings
C. 3 blue & 4 grey in center; 3 red on rings
8. If a particle has 3 protons, 4 neutrons, & 3 electrons, then a proton is added what would the symbol be?
𝐋𝐢 𝟑 𝟕 𝟎
𝐋𝐢 𝟒 𝟕 𝟎
𝐋𝐢 𝟒 𝟖 +𝟏
𝐁𝐞 𝟒 𝟖 +𝟏
A B C D | 768 | 513 | {
"id": "<urn:uuid:ebab2e38-fbcc-489b-aec3-5af488a404ad>",
"dump": "CC-MAIN-2018-09",
"url": "http://msclantonsphysicalsciencepage.weebly.com/uploads/6/4/7/0/6470542/build_an_atom_poling_cqs.pdf",
"date": "2018-02-19T05:59:18",
"file_path": "crawl-data/CC-MAIN-2018-09/segments/1518891812405.3/warc/CC-MAIN-20180219052241-20180219072241-00076.warc.gz",
"offset": 236644770,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9357696686472211,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9752941131591797,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
102,
353,
609,
721,
853,
1219,
1415
],
"fw_edu_scores": [
3.359375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Download Two And Three Digit Subtraction With Regrouping
When young students are learning two- or three-digit subtraction, one of the concepts they'll encounter is regrouping, also known as borrowing and carrying, carry-over, or column math.This concept is an important one to learn, because it makes working with large numbers manageable when calculating math problems by hand.
Subtraction Worksheets 2, 3, or 4 Digits Subtraction Worksheets Vertical Format. This subtraction worksheet may be configured for 2, 3, or 4 digits. You may select some regrouping, no regrouping, all regrouping, or subtraction across zero. You may select between 12 and 30 subtraction problems per worksheet.
3 Digit Subtraction With Regrouping. Showing top 8 worksheets in the category - 3 Digit Subtraction With Regrouping. Some of the worksheets displayed are Subtraction work 3 digit minus 3 digit subtraction, Subtracting 3 digit numbers with regrouping, Subtraction work 3 digit minus 3 digit subtraction, Three digit subtraction, 3 digit subtraction, Subtracting 4 digit numbers with regrouping, 3 ...
CENTER NUMBER 12: Card Subtraction up to 1,000 (3 digits minus 1 digit with regrouping) Flip over 4 cards. Place the largest card on the bottom box. Solve the subtraction problem. Record the problem and answer on the recording sheet. CENTER NUMBER 13: Card Subtraction up to 1,000 (3 digits minus 2 digits with regrouping) Flip over 5 cards.
Three-Digit Subtraction and Regrouping Numbers. Second, third and fourth graders work with larger numbers and are taught three-digit subtraction and regrouping. (Regrouping is the process of carrying the one or zero in addition and subtraction.) More complex math may be a challenge for some students, but the large mix of professionally-curated ...
2 Digit Subtraction With Regrouping. Showing top 8 worksheets in the category - 2 Digit Subtraction With Regrouping. Some of the worksheets displayed are Subtraction work 2 digit minus 2 digit subtraction, Subtraction, Subtraction work 2 digit minus 2 digit subtraction, 2 digit subtraction regrouping s1, 2 digit addition and subtraction with regrouping, Subtracting 2 digit numbers no ...
Other Files :
Two And Three Digit Subtraction With Regrouping, Two And Three Digit Subtraction With Regrouping Worksheets, 2 And 3 Digit Subtraction With Regrouping, 2 And 3 Digit Subtraction With Regrouping Word Problems, Two And Three Digit Addition And Subtraction With Regrouping, Subtracting Two And Three Digit Numbers With Regrouping, Two Three Digit Subtraction Without Regrouping Worksheets, | 1,223 | 579 | {
"id": "<urn:uuid:25a00479-d0e3-4b7d-b2d3-6840207e70a9>",
"dump": "CC-MAIN-2019-26",
"url": "http://thebluebermondsey.co.uk/wp-content/uploads/pdf/two_and_three_digit_subtraction_with_regrouping.pdf",
"date": "2019-06-25T18:22:18",
"file_path": "crawl-data/CC-MAIN-2019-26/segments/1560627999876.81/warc/CC-MAIN-20190625172832-20190625194832-00209.warc.gz",
"offset": 173246797,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9738001227378845,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9738001227378845,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2579
],
"fw_edu_scores": [
3.421875
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Egg Harbor Township Schools
We are extremely excited to announce that this summer we will have required summer reading for all middle school students. Research shows that reading over the summer reduces summer slide and promotes academic success throughout the school year. Students have spent the year in reading workshop and to continue to foster that love of reading, we want students to choose a "just right" book to read over the summer. The librarians and reading specialists are helping prepare students throughout May and June to find that "just right" book. We will have books for sale at reduced cost (ranging from $5.00-13.00) and also work with the county library to ensure all students can find a perfect book to read.
Students will complete one assignment to accompany their book. The assignments are all activities and strategies the students have practiced throughout the year, and will help the students continue to implement and master reading strategies.
We ask that you and your child complete the bottom portion of this form together and return to your student's ELA teacher no later than June 14th. More details about your student's trip to the library and availability to purchase books will come from the individual teachers. If you have any questions, please contact Lily Moss, Supervisor of ELA, K-12, email@example.com or 609-653-0100 ext. 1617. Thank you for your support.
_______________________________________________________________________________
EHT Middle School Summer Reading Assignment 2019-2020
Please complete and submit this form to your student's ELA teacher prior to June 14, 2019
Last Name: _________________________ First Name: ______________________ Current Grade: ______
ELA Teacher: _____________________________________________
Summer Reading Text: ___________________________________________________________
Author: ________________________________________________________________________
By signing this form, you are agreeing to your child's selected text and the requirements of summer reading for the 2019-2020 school year.
Parent/Guardian Signature: _____________________________________________________
7th into 8th Grade Reading Notebook Guidelines
1. Compose three entries as you read your book. There must be one entry to reflect the beginning, middle and end and then two of choice.
2. Write the book title, page number, and title of entry at the top of each entry. Each entry should be one full page in length.
3. Entries should be thoughtful and include textual evidence. Consider the reading strategies you learned throughout the year. Refer to rubric below.
4. Make sure to write in complete sentences and with correct grammar!
Reading Notebook Rubric | 1,327 | 524 | {
"id": "<urn:uuid:7021a815-03f5-48b2-94fc-12c9a11a2354>",
"dump": "CC-MAIN-2019-26",
"url": "http://fms.eht.k12.nj.us/UserFiles/Servers/Server_252822/File/Headlines/Summer%20Reading/8th%20Grade%20Summer%20Reading%2019-20.pdf",
"date": "2019-06-25T17:32:49",
"file_path": "crawl-data/CC-MAIN-2019-26/segments/1560627999876.81/warc/CC-MAIN-20190625172832-20190625194832-00208.warc.gz",
"offset": 63672902,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.999271422624588,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9996774196624756,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2173,
2733
],
"fw_edu_scores": [
2.015625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
INSTRUCTIONS
AGES: 4 and up
NUMBER OF PLAYERS: 2+
OBJECT OF THE GAME: All the books have been mixed up and the characters and objects need to be made into a story! Players take turns making up a story using cards. Be the player who is able to remember the most cards, in order, as used in a story.
CONTENTS: 54 cards
GAME SET UP: Shuffle the cards and stack them in a deck, face down.
PLAY: The youngest player goes first. The player starts the story by saying, "Once upon a time...." as he turns over the top card of the deck. The player includes the object on the card in this sentence, making up whatever he wants as long as the item on the card is included in the sentence.
FOR EXAMPLE: If the first card turned over is the "alien" the player may say "Once upon a time, there was an alien who came to Earth."
The player then places the card back on the top of the deck, face down and passes the whole deck to the player to his left. The second player must recite what the first player said, turning over the top card as he recites. The player then turns over another card and adds this object to the story.
FOR EXAMPLE: If the second player's card is the lollipop, the player may say, "Once upon a time, there was an alien who came to Earth because he was looking for a lollipop."
Play continues as each player draws a card and adds to the story. The story can vary, but the objects as noted on the cards must remain the same and must be stated in the order drawn. Players do not have to recite the story word for word, and they may even change it, but they have to remember the object on each card in order. A player must say the object on the card before he turns over the card to go on to the next. If a player forgets the object on a card or says the wrong item he is out of the game.
WINNING THE GAME: The winner is the last player remaining in the game.
Another Way to Play the Storybook Game!
ADVANCED PLAY:
OBJECT: Be the first player to recite a story using all 54 cards without making a mistake.
PLAY: The game play is the same except that when a player fails to remember the correct object, his turn ends. He is not out of the game, he just loses a turn. The deck is then passed on to the next player.
WINNING THE GAME: The first player to be able to remember all 54 of the cards in order, without messing up, is the winner. | 870 | 553 | {
"id": "<urn:uuid:8ff37680-761f-41c7-be7f-9aac804417b5>",
"dump": "CC-MAIN-2019-26",
"url": "https://www.alexbrands.com/download/story-book-game-the-4266/",
"date": "2019-06-25T18:25:03",
"file_path": "crawl-data/CC-MAIN-2019-26/segments/1560627999876.81/warc/CC-MAIN-20190625172832-20190625194832-00218.warc.gz",
"offset": 664294710,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9996516704559326,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9996516704559326,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2358
],
"fw_edu_scores": [
2.984375
],
"minhash_cluster_size": 1,
"duplicate_count": 1
} |
Climate Change Resilience
Even conservative climate change scenarios predict that the temperature in the Authority's jurisdiction will increase 3.6 to 10.8˚F by the end of the century (Ekstrom and Moser 2012), resulting in warmer summers and winters, and earlier spring arrivals. This will alter vegetation patterns; as ecosystems shift, species may be squeezed out of suitable habitat, eventually being lost. Higher temperatures and drier conditions are likely to aggravate the intensity and frequency of wildfires, as well as spread of invasive species (Sandel and Dangremond 2012). These shifts will affect not only natural and urbanized areas, but also the use and management of agricultural lands, including water regimes and availability and crop suitability. Changes in precipitation and rainfall will likely increase both drought and flooding – affecting urban areas, aquatic ecosystems, and water supply (PRBO Conservation Science 2011). Sea level rise and flooding will have significant effects in Santa Clara County, which has some of the highest projected property value losses in the Bay Area region (Heberger et al. 2012). Within the Open Space Authority's jurisdiction, much of the urban development is in flood-risk areas that are physically incapable of absorbing change in the natural environment.
Protecting open space is one of the most effective ways for the Authority to mitigate the impacts of climate change and allow adaptation to its effects. The Authority aims to protect large blocks of habitat that will provide more opportunities for species to adapt and shift their ranges in response to increasing temperatures, decreasing precipitation, and more intense storm and fire events. Protection of natural open spaces and working lands can help mitigate
Climate-Smart Principles
climate change by sequestering carbon, one of the primary contributors to global warming (California State Coastal Conservancy 2013).
The principles, developed by the Bay Area Ecosystems Climate Change Consortium (BAECCC), use a naturebased approach to enhance ecosystem services, and allow for humans and wildlife to adapt to climate change.
* Focus goals on future conditions – consider extremes and projections.
* Employ adaptive and flexible approaches – monitor, learn what works, and reassess to adapt to change.
* Design actions in ecosystem context – consider ecosystem function, multiple benefits, and broad geographic scope.
* Prioritize actions – based on science, multiple scenarios, and across species.
* Practice the 10% rule – spend 10% of your time on creative new approaches.
* Collaborate and communicate across sectors – partner to learn quickly, solve problems, and share knowledge.
Valley Greenprint (Figure 2). Efforts by the Authority and its partners to protect these areas will have an added benefit of ensuring resilience to climate change.
To include climate change impacts in every conservation decision, the Open Space Authority uses Climate-Smart Principles (see sidebar) to guide land protection and management efforts. By protecting large, interconnected landscapes, focusing on water resources, and planning for extremes, the Authority can help build in resilience to help natural and human communities adapt.
Figure 6 depicts areas that provide ecological resilience to a changing climate, and that may serve as critical climate refugia for plants and animals under changing conditions. These include streams, wetlands, and riparian areas that provide perennial water sources for wildlife; north-facing slopes; and other areas with high environmental and topographic variability where cool local microclimates will persist even when the region is generally getting hotter and drier. Riparian habitats are especially important as they serve as local wildlife corridors that allow plant and annual species to move and adapt as temperatures change, particularly up and down elevation gradients that connect terrestrial and aquatic ecosystems. Many of these areas are located in places that emerged as high priorities for land conservation and stewardship in the
As conditions change toward mid-century and beyond, there will be much greater environmental stress on the landscape, requiring the Authority to increasingly focus resource planning and land management efforts to address climate change. Critical projects include the protection of stock ponds and other water resources that are increasingly at risk, weed management projects (for example, protecting the rare serpentine grasslands at Coyote Ridge from the increased spread of barbed goat grass), and development of interagency coordinated wildfire protection plans.
chapter 3
Wildlands and Natural Areas
31 | 2,039 | 861 | {
"id": "<urn:uuid:cdbb8246-0910-4995-aca4-ace44218abd9>",
"dump": "CC-MAIN-2020-50",
"url": "https://www.openspaceauthority.org/system/user_files/Documents/Climate%20Change.pdf",
"date": "2020-11-25T16:24:03",
"file_path": "crawl-data/CC-MAIN-2020-50/segments/1606141183514.25/warc/CC-MAIN-20201125154647-20201125184647-00160.warc.gz",
"offset": 794619195,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9949733018875122,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9949733018875122,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
4717
],
"fw_edu_scores": [
2.28125
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Test questions: Water and the physical environment
1. Assign the numbers in the graphic to the following terms: Precipitation, infiltration, evaporation, evapotranspiration, interflow, vapour transport, surface runoff and groundwater flow.
2. What is the percentage of freshwater on the world's water reserves (with glaciers and snow cover)? Choose the right answer.
* About 1%
* About 2.5%
* About 5%
3. What are the two nutrients which mainly control the growth of aquatic plants, algae and bacteria in aquatic systems?
8. What is illustrated in the graphic below? What are the probably resulting effects that can be expected regarding the water cycle? Name at least four. (Image: Cubasch et al. 2013)
9. Reducing water pollution, increasing efficiency in agriculture and saving water in domestic use are measures to increase water availability in a situation of water stress. Name at least four possibilities to achieve these goals!
10. Humans control runoff on a global scale and thus significantly modify the hydrological cycle. (True or false?)
18. Which two types of soil degradation are shown in the following two pictures? Give a short description of these processes. (Images: Nichols, R. USDA NRCS 2011 & Prasuhn, V. 2009)
4. Give a short explanation of the nutrient cycle.
5. Name at least three central functions of soils within the water and nutrient cycle.
6. The _____ of a _____ is the _____ amount of water that a particular soil can hold for _____. If there is no _____ for some time, the soil will _____ and may reach what is known as the _____ when plants will begin to wilt because of lack of _____. Fill in the words: rainfall, maximum, moisture, plants, soil, field capacity, dry out, permanent wilting point
7. Plants represent a large portion of terrestrial biomass and have a significant impact on the water cycle and the climate while water availability dictate the limits of their distribution. What is the main effect of vegetation on the water cycle and what other positive effects are associated with vegetation in the water cycle? Name at least three other positive effects.
11. One result of urbanisation is that streams carry less water or dry up when it is not raining and flood when it does. (True or false?)
12. What are human based reasons for eutrophication? Name at least two.
13. Lack of sanitation is one of the most significant forms of water pollution. In developing countries 90% of the sewage is discharged untreated directly into water bodies. At the beginning of 2016 the world's population is estimated to be 7.4 billion. What is the percentage of the world's
population that is living without any form of sanitation? Choose the right answer.
* 17.5%
* 25%
* 32.5%
14. Less than 50% of world's large river systems are affected by dams fortunately not the eight most biogeographically diverse. (True or false?)
15. How many dams with heights above 15 m exist worldwide? Choose the right answer.
* More than 35,000
* More than 40,000
* More than 45,000
16. On a global basis, agriculture accounts for more than 70% of all water withdrawals. (True or false?)
17. Between 30 % and 60 % of the water abstracted for agriculture is returned to rivers. What is the issue/problem with the returned water?
a)
b)
a)
b)
19. Name at least four human causes of erosion as well as four measures to control erosion. Human causes of erosion
Measures to control erosion
20. Deforestation of tropical rainforest is increasing every year. (True or false?)
21. Arrange the following reasons in the right order starting with the greatest cause of deforestation: commercial farming, fuel-wood, legal as well as illegal wood extraction and subsistence farming.
22. What are the superordinate impacts of deforestation? Name at least four.
23. Groundwater is usually the main freshwater resource in urban areas. What are the three major ways how urbanisation is influencing groundwater? | 1,719 | 858 | {
"id": "<urn:uuid:932591df-4a30-43f7-884e-aa9d4a23e312>",
"dump": "CC-MAIN-2019-04",
"url": "https://www.geo.fu-berlin.de/en/v/iwrm/Implementation/water_and_the_physical_environment/Test-questions-water-and-the-physical-environment/Test-questions_water-and-the-physical-environment.pdf",
"date": "2019-01-21T12:29:21",
"file_path": "crawl-data/CC-MAIN-2019-04/segments/1547583792338.50/warc/CC-MAIN-20190121111139-20190121133139-00379.warc.gz",
"offset": 825609440,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9946949481964111,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.99665367603302,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
522,
1052,
3427,
3940
],
"fw_edu_scores": [
3.84375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
20
23,306 Total students since 2000
Ecology Project International
EPI involves young people from the U.S. and Latin America in hands-on science and conservation projects that protect species and habitat in five countries. We bridge the gap between cultures and empower the next generation of conservation leaders.
Engaging Students
Over 85% of our participants are local youth living in communities adjacent to our project sites. Our impact is profound on both local and visiting students, establishing a lifelong commitment to conservation.
2015 TOTALS
"I learned that I cast a vote every time I make a consumer purchase, and that if products harm the environment, I can choose not to buy or use them. I can cast a vote in favor of protecting the environment every day."
alapagos
G
y ,1 7 • Beli z e "This course transformed the way I think. I am so eager to learn more about what happens under the sea. I'm much more motivated now to graduate and
pursue a career in science."
Going on course with EPI helped nurture a passion for science that Whitney has had since primary school. As she explored the Mesoamerican Reef with EPI, collecting data and observing ocean life, Whitney learned how science is intertwined with conservation efforts and was opened up to new possibilities for her education and future. Her dream is to one day return to Blackbird Caye to continue researching and learning about the marine ecosystem.
C
onservation
* E
ducation
* C
ultural
E
xchange
S
2,464
Going on course inspired Joca to continue learning and giving back. It taught her to challenge herself and believe that she is capable of achieving much more than she ever thought she could. Joca says she finds comfort in knowing she is part of a larger movement of people in her own community and around the globe who want to make the world a better place. As an individual, she knows that just by making simple choices, like with the products she purchases, she can influence change on a much larger scale.
S
tudents ince
2003
2015 TOTALS
"I want to use my interest in computers to benefit nature. During my course, I learned about the role technology plays in research, and I want to develop software that can help monitor and record data for research on local species."
Eddy is a self-described "techie." At just 10 years old, he dismantled a computer and put it back together just to learn more about how it worked. He also has a keen interest in nature and came on course with EPI to learn about what it might take to become a Galapagos Park ranger. Through participating in hands-on research activities in the field and learning about methods for data collection, he realized that he could fuse his top two passions - technology and nature.
E
cology
P
roject
I
nternational
*
www.
ecologyproject.
org
* 406.721.8784
4,223 Scholarships in 2015 EPI Granted
"Where I come from, nobody pays attention to sea turtles, and it's common to see people selling their eggs. It was a whole new experience for me to see people working so hard day and night to protect this threatened species. I really liked being a part of that effort." • C o s t a R i c a
Gaudy was an eager and inquisitive student right out of the gate - jumping enthusiastically into activities and revealing herself as a natural leader. She loves sea turtles, being outdoors, and spending time in a place so different from her hometown. Gaudy was especially impacted by taking an active role in protecting sea turtles and learning about human impact on their survival. G a u d y , 1
2015 TOTALS
Participants
Scholarships
762
442
n a , U S "I feel prepared now to explore different careers - possibly in environmental education, so I can teach people more about the value of animals in our ecosystem."
Raised on a horse ranch in rural Montana, Deyo developed a deep respect for all creatures great and small. Before going on course with EPI, he didn't know how his interest in animals might translate to a career outside of ranching. Deyo was curious about how the researchers, biologists, and EPI instructors got their jobs and spent a lot of time on course getting to know them and learning about the education and training that got them where they are today.
2015 TOTALS
Participants
Scholarships
233
112
cology
E
P
roject
I
nternational
*
www ecologyproject.
.
org
* 406.721.8784 | 1,814 | 975 | {
"id": "<urn:uuid:1850cb11-b8dc-4c34-9b4d-2daced6ddce4>",
"dump": "CC-MAIN-2019-04",
"url": "https://www.ecologyproject.org/assets/docs/2015_Student_Yearbook_Final.pdf",
"date": "2019-01-21T11:16:08",
"file_path": "crawl-data/CC-MAIN-2019-04/segments/1547583792338.50/warc/CC-MAIN-20190121111139-20190121133139-00379.warc.gz",
"offset": 800619141,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9974474012851715,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9979714155197144,
"per_page_languages": [
"unknown",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2,
2846,
4399
],
"fw_edu_scores": [
2.390625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Education and Outreach for Source Protection Water Conservation
Gardeners
Businesses
* Use a water conservation calculator such as Home Water Works to estimate your water use, know how you compare to the average, and get a plan to help you use less. 5
* Conserving water is simple and can reduce your water bill.
* Check your water bill or meter to confirm your water use.
* Water used for lawns and plants is an important part of residential water use. Water use can double in the summer due to various outdoor activities, including gardening. 6
* Five simple ways to use less tap water outside:
* Efficient landscaping and gardening techniques can cut your water use by 20 to 50 per cent and reduce your water bill. 7
1. Spread mulch around the base of plants
3. Water plants early in the morning or in the evening
2. Use a rain barrel to collect water for plants
4. Use native or drought tolerant plants
5. Turn off hoses when not in use
* Water conservation is an area of economic opportunity for Ontario businesses.
* Innovative water technologies, services and practices lead to economic opportunities and clean jobs that help conserve and sustain our water resources.
* Ontario is a world class water technology hub. Our province fosters new developments in the water sector through the Water Opportunities Act 8 and the Showcasing Water Innovation program 9 .
* All businesses use water, directly or indirectly.
* Conserving water is smart business.
* Water is vital for our economy.
* 15 ways for your business to save water and money:
2. Conduct a facility audit to quantify water use
1. Set a water conservation goal and share it with staff
3. Look for and repair leaky faucets and pipes
5. Install water efficient fixtures and equipment
4. Develop a water conservation plan
6. Dry sweep instead of using a hose to clean floors
8. Educate employees about the importance of using less water
7. Make sure all hoses have automatic shut-off nozzles
9. Post reminders to conserve water in places where it is used most
11. Re-use water for landscaping
10. Design landscaping to be water efficient
12. Compare water use to industry benchmarks
14. Have friendly competitions among similar businesses to see which one can best reduce water use
13. Learn from success stories of industry peers
15. Use the Energy Star Portfolio Manager 10 to manage the water use of your building
RESOURCES
Use the following resources to find more information on water conservation.
OTHER INFORMATION
* Your local municipality office or conservation authority.
For inquiries about this information sheet contact:
Chris MacLean, Senior Advisor Stakeholder Relations Ontario Ministry of the Environment and Climate Change 3rd floor, 40 St. Clair Avenue West, Toronto, ON M4V 1M2 416-212-1334
Ontario Ministry of the Environment and Climate Change
2nd Floor, Macdonald Block, 900 Bay Street, Suite M2-22
Public Information Centre
Toronto, ON M7A 1N3
Tel: 416-325-4164; Toll-free: 1-800-565-4923; TTY 1-855-515-2759
The contents of this information sheet are provided for informational purposes only and are not intended to provide specific advice or recommendations in any circumstances. Some of the material on this information sheet has been obtained from sources other than the Government of Ontario. The Government of Ontario cannot and does not guarantee that the information on this information sheet is current, accurate, complete or free of errors. Any reliance upon any information provided on this information sheet is solely at the risk of the user. The user may choose to refer directly to the publications listed in this information sheet for further, more complete information on the topic area. The linking to other publications does not imply on the part of the Government of Ontario any endorsement or guarantee of any of the organizations or information (including
the right to display such information) found on their respective web sites. These linked Web sites/publications may or may not be available in French. | 1,748 | 846 | {
"id": "<urn:uuid:50d6fc19-8607-44c6-9cae-4a5bc66bc896>",
"dump": "CC-MAIN-2019-04",
"url": "http://www.cochraneontario.com/wp-content/uploads/2017/02/water-conservation-tips.pdf",
"date": "2019-01-21T11:22:04",
"file_path": "crawl-data/CC-MAIN-2019-04/segments/1547583792338.50/warc/CC-MAIN-20190121111139-20190121133139-00380.warc.gz",
"offset": 276016190,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.959099292755127,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9943002462387085,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
63,
2104,
2472,
3879,
4031
],
"fw_edu_scores": [
3.125
],
"minhash_cluster_size": 2,
"duplicate_count": 1
} |
3. Check
Mark your exam questions using the mark scheme.
Each hour or revision should be split up into three sections as shown on the clock.
Pay attention to what is required to gain each mark. Be strict with yourself and only give yourself the mark if you are certain you have written what is required.
Could you have used a clearer or simpler method? Does the mark scheme suggest a different way to approach the question which might be worth trying next time? If you have done a complete past paper, work out what mark or grade you would get. Identify 2 or 3 things you need to do or topics you need to work on in order to improve your grade next time. Keep a record of these grades so you can see yourself improve.
If there are topics you are getting completely correct, go back to your topic list and tick them off so that you can see your progress and narrow down the list of topics you need to revise.
1. Review
You need to be clear on the content of the course and what topics you need to know about.
Find or create a list of topics within the area you plan to revise.
Think about which of these topics you most need to revise. Which topics are most likely to come up in the exam? Which topics do you already feel confident about? Are there some topics you are not confident with? Look back at previous class work, homework and tests to assess your current level of understanding. Ensure that you have what you need in order to review these topics. This may include class notes, text books, worked examples, practice questions, mark schemes etc. Choose a focus for this revision session. Make it achievable within the time available. You can't do everything at once.
2. Practise
The main bulk of your revision should be spent practising the skills and knowledge you need for the exam. You need to repeatedly bring the information into your mind from memory and use it.
Complete lots of practice questions without using your notes, text book etc. Make sure your full method is clear and your working is organised. Look back at the worked answer for the question or the mark scheme and identify and correct your mistakes.
If there is a particular topic or skill that you keep making mistakes on, go back to the relevant exercise in the book and do some more focused practice. Use the worked examples to help you by checking your method against the one in the book.
Complete past exam questions (and, as soon as possible, entire exam papers) under exam conditions. Do not cheat as it harms your ability to review and strengthen memory. | 903 | 519 | {
"id": "<urn:uuid:81d97b16-e5df-4c57-a930-124e71dbd039>",
"dump": "CC-MAIN-2019-04",
"url": "https://www.teachitmaths.co.uk/attachments/28221/maths-memory-clock.pdf",
"date": "2019-01-21T13:01:16",
"file_path": "crawl-data/CC-MAIN-2019-04/segments/1547583792338.50/warc/CC-MAIN-20190121111139-20190121133139-00382.warc.gz",
"offset": 938971561,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988991618156433,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9988991618156433,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2553
],
"fw_edu_scores": [
2.4375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
8. Odder by Katherine Applegate
A touching and lyrical tale about a remarkable sea otter.
Her mother called her "Odder" from the moment she was born.
Something about the way the little pup never settled, something about the way her eyes were always full of questions.
Odder spends her days off the coast of central California, practicing her underwater acrobatics and spinning the quirky stories for which she's known. She's a fearless daredevil, curious to a fault. But when Odder comes face-to-face with a hungry great white shark, her life takes a dramatic turn, one that will challenge everything she believes about herself―and about the humans who hope to save her.
Inspired by the true story of a Monterey Bay Aquarium program that pairs orphaned otter pups with surrogate mothers, this poignant and humorous tale told 1most beloved and charming animals.
Discussion, revision & competition-like questions for this book are below.
Reading Rivalry Is Not a test!
Note the Reading Rivalry questions are tools used to discuss the book(s) and topics the students read.
The intent of RR is to foster a love of reading, introduce the students to books they may not otherwise choose, provide opportunities to work as a team and have fun!
Odder by Katherine Applegate
1. What type of creature is Odder?
A sea otter / a southern sea otter / a member of the weasel family.
2. Where is the book set?
In Monterey Bay, in California.
3. What does Odder use her favorite rock for?
Opening clams and mussels.
4. What number is Odder also known as?
# 156
5. What color is Odder?
Odder has a deep brown coat and caramel-colored head.
6. How do otters communicate?
Otters whistle, whine, snarl, hiss, blow, snort, nudges, licks, head butts and gentle bites.
7. What do otters eat?
Abalones, sea urchins, octopuses, sea stars, mussels, crabs, and clams.
8. What do the otters call the aquarium perched above the edge of the bay?
Highwater.
9. What advice did Odders mother give her?
Stay away from sharks, humans, and all that you don't understand.
10. How long can a sea otter stay under water?
For six or seven minutes.
11. After the shark bit Kairi's tail, what did Odder do?
Odder distracts the shark by hurling herself at the shark.
12. What is "hauled out"?
When the sea-otter hauls or pulls itself out of water onto land.
13. What are the staff in Highwater called?
Aquarists.
14. Name one thing that can go wrong for sea otters in the ocean.
(i)Run-ins with boats, (ii) illness from pollution, (iii) oil spill exposure, (iv) entanglement in fishing lines, (v) ingested plastic trash, (v) diseases (vi) shark bites.
15. As Odder recovers from surgery, what does she think about?
Her life as a pup.
16. How did Odder get to Highwater the first time?
Ondine tied Odder to the kelp while she searched for food, but the kelp came undone in the storm and Odder was washed ashore. Then she was rescued and taken to Highwater.
17. Why was it important for the aquarists to teach the otter pup # 156 survival skills as quickly as possible?
The longer Odder stayed with them she would become attached to them and unable to return to the wild.
18. Is it better for an otter to be a number or a name in the aquarium?
A number means the otter will be returned to the ocean; you get a name in the aquarium if you stay there for good.
19. Who told Odder that the animals are called humans?
Holly, one of the older otters, told Odder that the animals are called humans.
20. As Odder recovers from her operation after the shark bite, what memories fill her long days?
Memories of her time in the wild.
21. Who discovers that the humans have named Odder and what did they name her?
Gracie, one of the older otters, discovered that the humans have named Odder. They named her Jazz.
22. Odder thought Kairi was holding a toy, but what was it?
A tiny pup, # 217.
23. What does Kairi help Odder realize he must do for the pup?
Teach the pup how to be an otter, how to play.
24. When does Odder finally help the pup #209?
When it got stuck in the kelp. Odder (Jazz) will be the pup's otter teacher.
Discussion questions
1. What is your favorite thing about the book?
2. Should healthy animals be kept captive?
3. How can we help our oceans, lakes, ponds, rivers, and waterways?
4. What is a parent / guardian's job?
5. Did you ever help mind a person, animal, or thing? | 1,725 | 1,084 | {
"id": "<urn:uuid:31cbabd1-240b-4079-b0b3-af504f1e33fc>",
"dump": "CC-MAIN-2025-05",
"url": "https://www.yourmiddletonpto.org/_files/ugd/4fcee5_c2b5cb0fce474630b80ce598d3edd0b8.pdf",
"date": "2025-01-25T13:39:18",
"file_path": "crawl-data/CC-MAIN-2025-05/segments/1736703699506.85/warc/CC-MAIN-20250125111848-20250125141848-00624.warc.gz",
"offset": 1114990376,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9987646341323853,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991647005081177,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1244,
2646,
4400
],
"fw_edu_scores": [
3.34375
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
KINDERGARTEN
Below are the Mastery Learning Targets, or priorities for all kindergarten students to be successful when they advance to first grade. Mastery (M) of these skills means the student has met the grade-level standard and is independently performing on grade level. Mastery may take time to reach, as foundational skills progress throughout the school year.
READING
* Follows words from left to right, line to line and page by page.
* Recognizes and names all upper and lowercase letters.
* Identifies and produces words that rhyme.
* Blends and segments syllables in spoken words.
* Pronounces letter sounds orally at the beginning, middle and ending of words.
* Produces sounds of individual consonants in words.
* Produces sounds of individual vowels in words.
* Reads Kindergarten sight words.
* Recognizes the lesson learned by using key details in a story.
* Recalls characters, settings, and major events to understand a story.
* Recognizes the central idea by using key details in a nonfiction story.
* Prints all lower case letters.
* Prints all uppercase letters.
* Prints first name.
* Prints last name.
* Writes an opinion including reasons with teacher support.
* Creates an informational piece that has a topic and supporting details with teacher support. (Can be written in pictures and/or words)
* Uses proper capitalization for the first word in sentences and the pronoun I.
* Names punctuation marks.
* Uses letter sounds to spell when writing.
MATH
* Counts forward by ones to 100.
* Counts forward by 10s to 100.
* Counts backwards from 30 by ones.
* Counts forward beginning from a given number.
* Writes numerals from 0-20.
* Counts up to 20 objects arranged in different ways.
* Compares two numbers between 1 and 10 presented as written numerals.
* Adds numbers within 10 using objects, fingers, or drawings.
* Subtracts numbers within 10 using objects, fingers, and drawings.
* Solves addition and subtraction word problems within 10 using objects or drawings.
* Decomposes numbers less than or equal to 10.
* Adds and subtracts within 5.
* Composes and decomposes numbers 11-19.
* Describes the measurable attributes of objects.
* Compares two and three dimensional shapes.
SOCIAL STUDIES
* Asks questions about their community.
* Talks or writes about their community.
* Talks or writes about life in their community, history, geography, and/or economy (Goods/Services or Supply/Demand)
* Addresses a solution to a problem in the classroom.
* Gives examples of ways to be a good citizen or successful student.
* Applies knowledge of good citizenship.
SCIENCE
* Compares the basic forces of push/pull using simple investigations.
* Describes what animals and plants need to survive.
* Explains basic weather patterns. | 1,234 | 588 | {
"id": "<urn:uuid:d2320305-b3f1-40f0-baa1-02d0b6f421d5>",
"dump": "CC-MAIN-2025-05",
"url": "https://resources.finalsite.net/images/v1722961274/bgk12kyus/vht1rti13xaylahpxn1o/KINDERGARTENLearningTargets2024.pdf",
"date": "2025-01-25T12:47:52",
"file_path": "crawl-data/CC-MAIN-2025-05/segments/1736703699506.85/warc/CC-MAIN-20250125111848-20250125141848-00637.warc.gz",
"offset": 518409531,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9981517791748047,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9986629486083984,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1999,
2762
],
"fw_edu_scores": [
4.40625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Ten Hallmarks of Cancer Series
Evading growth suppressors: Hallmark #4
Many people think of cancer as a disease in which our own cells essentially go 'rogue'growing and dividing to form tumors. A long-standing question for scientists has been to understand how this happens. In particular, cancer researchers have described a number of characteris tics of cancer cells that distinguish them from the nor mal cells that populate our bodies. These characteris tics are often referred to as the 'hallmarks' of cancer, and the ability of cancer cells to ignore simple instruc tions to stop growing is one of these hallmarks. In other words, cancer cells are like a car that has no brakes!
Perhaps the easiest way to explain what these 'negative' growth signals are is to offer a few examples. All of us as humans grow in size in the early part of our lives. We get taller and our shoulders broaden, to name just a few examples. This is fuelled by cell division. Cells grow in size, divide to give rise to two new cells, and repeat the process billions upon billions of times until we all reach our own growth potential. The signals that instruct our cells to stop growing are complex, but many of these signals come from interactions between neighbouring cells. So when an organ or body part reaches a certain size all of the cells that are touching each other are essentially telling one another it is time to stop dividing. Cancer cells lose the ability to stop when touching their neighbours. In some cases they don't receive the 'stop' signal anymore, and in other types of cancer they receive this signal but don't understand it. Regardless of the reason, cancer cells universally lose the ability to put on the brakes and stop dividing when they are told.
Another example of cell growth gone rogue, is in the case of cells that maintain the ability to grow and divide throughout our lifetime. Many of these cells are found on our skin, but they also line our lungs, stomachs, and other internal organs. New cells
located in these places are continually produced through cell division as older ones die and need to be replaced. For this reason these are cells that normally divide regularly, but they also need to stop when necessary to do their job in places like our skin. In this case cancer that arises in these locations can be thought of as a speeding car that doesn't stop for a red light. Cell growth and division is already well underway, but the specific problem is that cancer arises develops in this situation when the dividing cells can't put on the brake. Perhaps not surprisingly, most cancers come from cells that normally divide regularly but eventually aren't able to stop when they should.
Since cancer cells are often missing their brakes, fixing this problem should be a way to treat cancer. Work in my lab is focused on this goal. After much research in this area, we now know of a few ways that cancer cells can be stopped. In particular, we have identified and are beginning to understand the genes that function as the brakes for stopping cell division. Encouragingly, drugs are emerging that are capable of turning on the brakes in cancer cells. In particular, our research is focused on how to identify patients that will benefit most from these new drugs. By no means is the battle won, but we are starting to find ways to fix the faulty brakes in cancer cells.
Article written by Fred Dick PhD | 1,322 | 715 | {
"id": "<urn:uuid:033b1940-35c8-4835-8d53-e45cc195fdd5>",
"dump": "CC-MAIN-2019-09",
"url": "https://cancerriotlondon.files.wordpress.com/2017/10/cancersociety_may28.pdf",
"date": "2019-02-20T05:15:45",
"file_path": "crawl-data/CC-MAIN-2019-09/segments/1550247494449.56/warc/CC-MAIN-20190220044622-20190220070622-00335.warc.gz",
"offset": 511593155,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9991762638092041,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9991762638092041,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3455
],
"fw_edu_scores": [
2.640625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
LESSON:
Rock Sort
GRADE: 5
OBJECTIVES:
Behavioral Sciences
SS.3-5.BS.2 Understand the influences on individual and group behavior and group decision-making.
* Understand that people involved in a dispute often have different points of view.
* Understand that communicating different points of view helps people to find a satisfactory compromise.
MATERIALS & RESOURCES:
* Chalkboard or whiteboard and writing tools
* Web sites:
o Minerals of Iowahttp://www.igsb.uiowa.edu/Browse/minerals/minerals.htm
* Flip chart
* Markers
* Rocks collected by the children on the playground, or brought from school, or photos of rocks
PRESENTATION:
Ask the kids what kinds of differences they can SEE in the kids in the classroom. Start a list on the board of the results of their brainstorming. Make sure they stick to things you can see, like—
* Color and length of hair
* Color of eyes
* Kinds of shoes and clothing
* Color of skin
* Gender
Tell them you're going to do an experiment to see if they can create a way to figure out which student you're talking about, just by asking "yes and no" questions.
Lesson: Rock Sort
1
DIRECTIONS:
1. Now ask all the students to stand in one large group in one area of the classroom.
2. Ask the kids to divide themselves into two groups that include all students in the class.
3. Now ask those two groups to divide again, making sure all students are included in the (now 4) groups. Let the kids come up with the questions for dividing the groups, making sure to use the guidelines above.
4. On the board, create the dichotomous key, using the divisions the students have made.
5. Have the group stop when they are in small groups of three to five students.
6. If you continue this process until each student has their own branch on the key, you should be able to identify the students by asking the questions that form the branches.
7. Now ask if they collect rocks for a hobby? Have they ever begged their parents to buy them rocks at a science center or a museum? Do they or their family have any jewelry made of rocks? In the small groups they formed while creating the dichotomous key. Each group will need at least eight rocks. Guide the groups of students in creating a key for their rocks in the following way—
a) Write the Group name and the word Rocks as the "title" for the Dichotomous Key.
b) Now divide the rocks into two categories of your choice, and write the name of each of these categories on a branch of your key.
c) Look at your two main groups, and divide each of them into two subgroups. Make branches coming out from your first two categories and write the name of each of these categories on four branches of your key.
d) If each group has eight rocks, dividing these four categories should give each rock its own category. Name the categories.
e) Have each group talk about what they learned about rocks and sorting.
f) Then have them share their dichotomous keys with the rest of the class.
g) As a follow up activity, see if they can figure out which rock is which by using the dichotomous key. Have each group set all their rocks together, and then have the other groups rotate through the classroom seeing if they can follow the dichotomous keys to sort the rocks.
Lesson: Rock Sort
To help the children internalize the lesson, ask the following questions--
1. Why do you think scientist use dichotomous keys?
2. What did you learn about rocks during this activity?
3. What did you learn about people?
4. How did you feel about being put in a group based on something about your physical appearance?
5. Do we ever do that in real life?
6. How do you think people feel about being put in a group based just on hwo they look?
7. How are people who look different from most people treated differently?
8. How could we use a dichotomous key to settle a disagreement?
9. How do you think that would work?
TIME:
Lesson: Rock Sort
45-90 min | 1,528 | 885 | {
"id": "<urn:uuid:5b6c858a-d87f-43ff-9d10-66eb4648c2b1>",
"dump": "CC-MAIN-2019-09",
"url": "http://www.teachers-going-green.com/_literature_102467/Rock_Sort_Lesson-5th_grade",
"date": "2019-02-20T05:18:46",
"file_path": "crawl-data/CC-MAIN-2019-09/segments/1550247494449.56/warc/CC-MAIN-20190220044622-20190220070622-00337.warc.gz",
"offset": 432436312,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9971767862637838,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9988182783126831,
"per_page_languages": [
"eng_Latn",
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1125,
3255,
3911
],
"fw_edu_scores": [
4.8125
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
Activity
Guide
www.liveoakmedia.com 800-788-1121
The Stray Dog
ABOUT THE STORY
When a family goes to a park to have a picnic, they find a stray dog. The two children play with him all afternoon, but the family leaves him at the park because they think the might have an owner. All week, they can't stop thinking about him, and when they return to the park on Saturday, what they find will surprise readers as much as the family.
ABOUT THE AUTHOR/ ILLUSTRATOR
Marc Simont has illustrated many prize-winning picture books including The Happy Day; A Tree is Nice, and The Philharmonic Gets Dressed. The Stray Dog, which was awarded a Caldecott Honor, is based on a story a friend told him about how she adopted her dog. Mr. Simont lives in Connecticut with his wife, two dogs, and a cat.
INTRODUCING THE STORY
Ask children if any of them have a dog. Have them describe how they got their dogs: at a pound, found on a street, from a breeder, at a store. Then explain that the book they will read is about a stray dog and the family that finds him.
READING ACTIVITIES
Comprehension/Thinking Skills
a. "What do the children teach Willie?"
b. "Why doesn't the family take Willie home?"
c. "Why do you think the family worries about Willie during the week?" (Draw conclusions)
d. "Why do you think the family returns to the same park for the second picnic?" (Draw conclusions)
e. "How do you think Willie feels at the end of the story?" (Analyze)
Vocabulary
Write these sentences on the chalkboard. Have children chose the correct word to finish each sentence.
scruffy belong warden
stray neighborhood
1. A dog wandered into our ___________________.
2. The dog did not seem to ____________to anyone.
3. The dog was very dirty and ______________.
4. She had no collar and seemed to be a ___________.
5. We were afraid the ___________ would take the dog away.
CROSS-CURRICULAR ACTIVITIES
Science: Breeds of Dog
Have children decide which breed of dog they would most like to have, if they were given a choice. Help them look in books about dogs or in an encyclopedia to find out about the breed they have chosen. They can write a brief description of the dog's characteristics and habits. Then have them share what they learn with the rest of the class.
Art: Lost Dog Poster
If Willie had had an owner, the owner might have a poster advertising his loss. Have children work in small groups to make a poster showing Willie, the lost dog. Their poster should have a picture of Willie and information about how to return Willie to his owner.
Social Studies: Dogs at Work
Explain to children that many dogs actually have jobs, such as police dogs or Seeing Eye dog. Help children look in books that describe the jobs dogs can do. Working in small groups, children can find out about one job for dogs and can write a brief description of the job. Groups can share their descriptions.
Language Arts: Picture Captions
In the middle of the book, there are two pages showing the family thinking about Willie during the week. Ask children to write captions telling what happens to each family member when he or she thinks about Willie.
INTERNET ACTIVITY
Before you send children to do research using any of the keywords listed below, you may wish to try them yourself to be sure the sites are suitable.
Dog Training
The children in the story teach Willie to sit. Have children use the Internet to find out how to teach dogs to do other things. Each child can pick one skill to find out about. Using the keywords "dog training", have children find instructions on how to teach a dog the skill they have chosen. They can take brief notes on the instructions. Then have children put their instructions into a dog-training pamphlet. | 1,523 | 837 | {
"id": "<urn:uuid:eeb2b436-1a62-47c1-88d9-a53fd2594ca3>",
"dump": "CC-MAIN-2019-09",
"url": "http://www.liveoakmedia.com/assets/guides/23569.pdf",
"date": "2019-02-20T06:12:16",
"file_path": "crawl-data/CC-MAIN-2019-09/segments/1550247494449.56/warc/CC-MAIN-20190220044622-20190220070622-00338.warc.gz",
"offset": 379910303,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9996495246887207,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9996495246887207,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3772
],
"fw_edu_scores": [
4.75
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Colorado Lawyer Assistance Program
Do You Have Decision Fatigue?
"We are free to choose our paths, but we can't choose the consequences that come from them." ~Sean Convey
As Americans, we equate freedom with choice. The problem, as Barry Schwartz discusses in his book "The Paradox of Choice," is that having too many choices throughout the day can cause "analysis paralysis," anxiety, and depression. How many decisions do you make in a day? Just on the way to school, for example, you probably make hundreds of small decisions before you arrive. You will make thousands more while studying, shopping, at work, in class, and at home. Imagine walking into a grocery store: you are bombarded with choices to make; have you noticed just how large the cereal aisle is?
Because of the way the brain and body operate, every time you make a decision, your attention is needed and your energy drains a little bit. In addition, with so many options to choose from in daily life (some big, some small), the analyzing areas of the brain will light up because you might run the risk of making the "wrong" decision. Some people agonize over whether they chose correctly, which then produces anxiety even after choices are made because they assume that they didn't make the best choice; a combination of "keeping up with the Joneses" and "the grass is greener on the other side."
For example, while you are doing one thing, such as studying, are you thinking about other things you could be doing, like playing golf or spending time with your family? While you are with your family, are you thinking about what you "should" be doing for school or work? Or do you compare yourself to others and assume they have it better than you because of their decisions? Or, alternatively, do you feel exhausted at the end of the day and couldn't make another decision if your life depended on it? Sometimes this leads to going home cranky rather than ready to relax and enjoy your evening.
One way to minimize decision fatigue is to simplify your life: make to-do lists and stick to them throughout the day; eat the same breakfast every morning; write out a list of options and do a pros and cons list to simplify decision making; create a routine when you are at school, or at the office, or at home; schedule and stay with specific study times; choose what show you want to watch before you turn on the TV so you don't channel surf for an hour; limit the time you are looking at and responding to texts/emails/phone calls, etc. Another way to minimize decision fatigue is to focus on the present moment rather than thinking about the past or future. Perseverating on what has happened, or being anxious about what could happen, drains a tremendous amount of mental and physical energy. Take a deep breath, and pay attention to what is in front of you one moment at a time.
We all live in a world with many choices, and that isn't always a good thing. If you can limit the amount of decisions you make in a day, you can reduce anxiety, depression and "analysis paralysis." Start by creating a list of ways you could simplify your life. Choose one and put it into action today. Notice how making small lifestyle changes can help your stress management and improve your self-care!
By Sarah Myers, JD, LMFT, LAC
Clinical Director, Colorado Lawyer Assistance Program
© Colorado Lawyer Assistance Program, 2017
Do you need help coping with your stressors and letting them go? Your Colorado Lawyer Assistance Program provides free and confidential services for judges, lawyers, and law students. If you need resources for ANY issue that is compromising your ability to be a productive member of the legal community, or if there is someone you are concerned about, contact COLAP at (303) 986-3345. For more information about COLAP, please visit www.coloradolap.org.
2 | 1,436 | 823 | {
"id": "<urn:uuid:f304bc93-66e3-43b3-b98b-a757956c2e6c>",
"dump": "CC-MAIN-2019-09",
"url": "http://coloradolap.org/wp-content/uploads/2017/01/LS_Do-You-Have-Decision-Fatigue.pdf",
"date": "2019-02-20T04:50:04",
"file_path": "crawl-data/CC-MAIN-2019-09/segments/1550247494449.56/warc/CC-MAIN-20190220044622-20190220070622-00341.warc.gz",
"offset": 54613538,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9984163343906403,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9984527230262756,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
1980,
3866
],
"fw_edu_scores": [
2
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
FEATURE
BECOMING A DJ: SCRATCHING THE SURFACE
Meets National Core Arts Anchor Standards 5, 7, 9 and 10
OBJECTIVES
DEVELOP
* Develop and refine artistic work for presentation (Pr5)
* Perceive and analyze artistic work (Re7)
* Apply criteria to evaluate artistic work (Re9)
* Synthesize and relate knowledge and personal experiences to make art (Co10)
MATERIALS
* Music Alive! magazines (Vol.39 No.3)
* Computer or mobile device with Internet access
START
Ask your students to read "Becoming a DJ: Scratching the Surface" on pages 6-9 before reviewing the words below. [This reinforces comprehension and vocabulary.]
TURNTABLE—a circular, spinning plate supporting a record as it is played
SEAMLESS—smooth
HALLMARK—a distinctive feature
PHONOGRAPH—a record player
AFFAIR—an event
STAGE PRESENCE—the ability to command the attention of
an audience
GAUGE—estimate or determine
RESIDENT—attached to and working regularly for
ENTREPRENEURIAL—characterized by taking risks in hopes of profit
NEGOTIATE—try to reach an agreement
COMPENSATION—money received by an employee
CORPORATE—a large company
TERRESTRIAL—broadcasting using equipment on the ground rather than by satellite
BROAD—covering a wide scope of subjects
WARY—showing caution about possible dangers
LUG—carry or drag
SOFTWARE—programs and other operation information used by a computer
COMPATIBLE— able to be used with a specified piece of equip- ment
MANIPULATION—the altering and editing of sound data
Ask Students the following questions:
What is DJing?
What are the four categories of DJs?
How are they different?
What are the primary responsibilities of a "Mobile DJ?"
Why might it be easier to be a Club DJ than a Mobile DJ? Why might it be more difficult?
What are the factors to be wary of when pursuing a career as a full-time DJ?
What are some tools you need to get started DJing?
CLOSE
Watch the YouTube video "A Beginner's Guide to DJing" and have the class take notes. After the video ask students the following questions:
What is the main goal of a DJ?
What does BPM stand for?
When mixing, why might you want to choose two songs with the same BPM?
On a controller, what is a "crossfader" used for?
What is beat-matching?
What is the difference between beat-matching and tempo matching?
ASSESS
Did the students read the article?
Did they answer the review questions?
MUSICALIVE.COM
* Vol.39, No.3• 3 | 1,265 | 578 | {
"id": "<urn:uuid:c808bd4e-521e-4d4e-8065-4eb6452e3b46>",
"dump": "CC-MAIN-2021-21",
"url": "https://www.musicalive.com/wp-content/uploads/2019/12/TG_DJ.pdf",
"date": "2021-05-13T19:25:23",
"file_path": "crawl-data/CC-MAIN-2021-21/segments/1620243991943.36/warc/CC-MAIN-20210513173321-20210513203321-00055.warc.gz",
"offset": 921938676,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9928454756736755,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9928454756736755,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2418
],
"fw_edu_scores": [
4.15625
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
By STEVE ADAM, Agr., Animal Comfort, Behaviour and Well-Being, R&D, Valacta
Handling Animals Safely and Without Stress
Since the domestication of the cow, farmers have had to handle their animals on a regular basis. Over the course of one lactation, a producer can handle his cows 10 to 15 times during the lactation and this is without counting the handling for milking. Therefore moving animals is virtually a daily activity.
The Code of Practice states that: Workers who handle cattle have to be familiar with their behaviour and with gentle handling techniques, either due to training, experience or apprenticeship. It is also a requirement of proAction ® .
The purpose of this requirement is, of course, to reduce stress on animals, but it also reduces the risk of injury to animals and farmers while improving work efficiency.
To properly match our handling of the animal with its behaviour, it is important to properly understand how it communicates and reacts with its environment.
HANDLING 101
Every animal has an invisible zone around it, which is called a flight zone. When we enter this zone (A), the animal will want to protect this distance between him and his "predator" by moving away. Outside of the flight zone there is the pressure zone (B) in which a handler can position himself to initiate movement of an animal without scaring it away. When movement is initiated, pressure must be immediately released to reward the animal. That way the learning process will go smoothly. The tamer the animal is, the smaller the circumference of this zone.
The handler must position himself on the side of the animal, making sure to clearly see the eye of the animal. He has to make sure he gets the animal's attention. This can be detected
THE EVOLUTION OF VALACTA ATLANTIC DAIRY PRODUCTION
by observing the movement of the ears. Without looking at us, a cow pointing her ear towards us is often a sign that we have captured the animal's attention.
It must be recognized that the cow has difficulty judging the distance of its handler due to her monocular side vision.
She has about a 60-degree angle blind spot behind her. Do not position yourself directly behind an animal to make it move forward because it will tend to turn its head to try to see us and this will also affect its trajectory.
When we walk faster than the animal, it tends to slow down and stop the moment we go past its shoulder (point of balance). Using this technique, we can control the speed and even make the animal stop solely with the position of our body. Walking in the opposite direction of animals will tend to make them speed up.
GETTING AN ANIMAL OUT OF A STALL
Using the point of balance technique to get the animal out of its stall is very effective. Simply enter a stall next to the cow, advance to go past the point of balance (the shoulder) while putting pressure towards the flight zone. That way the animal will rise and calmly walk out of the stall.
2018 STATS & TIPS
16
THE ZIGZAG TECHNIQUE
The zigzag technique is used to bring a group of animals from point A to point B. This is useful both in the barn and outdoors. The idea is to start moving from left to right to gather the group of animals. Once the movement of the group is initiated and the animals are aligned in the direction we want to move them, just make a path of straight lines from left to right. Circulating from left to right allows us to capture the attention of all of the animals. Regardless of the number of animals in the group, this is an applicable technique.
CONCLUSION
Animal handling is mainly a matter of positioning. We must remember that a way to do things quickly is to take your time and not force animals to rush their movements.
Animal handling is mainly a matter of positioning. Yelling is not necessary; it can all be done with both hands in your pockets. We must remember that a way to do things quickly is to take your time and not force animals to rush their movements. The more we use these techniques on young animals, the easier it will be once they become adults.
THE EVOLUTION OF VALACTA ATLANTIC DAIRY PRODUCTION 2018 STATS & TIPS
17 | 1,648 | 879 | {
"id": "<urn:uuid:4d530e8f-52ae-4b5c-9df2-57c34ba9418e>",
"dump": "CC-MAIN-2021-21",
"url": "https://www.valacta.com/gpc/_media/Document/handling-animal-safely-without-stress.pdf",
"date": "2021-05-13T19:15:44",
"file_path": "crawl-data/CC-MAIN-2021-21/segments/1620243991943.36/warc/CC-MAIN-20210513173321-20210513203321-00053.warc.gz",
"offset": 1087983132,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9988941550254822,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9989168643951416,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2986,
4154
],
"fw_edu_scores": [
2.25
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Grammar Review
PARTS OF SPEECH
ADJECTIVE: Describes a noun or pronoun; tells which one, what kind, or how many.
ADVERB: Describes verbs, adjectives, or other adverbs; tells how, why, when, where, to what extent.
CONJUNCTION: A word that joins two or more structures; may be coordinating, subordinating, or correlative.
INTERJECTION: A word, usually at the beginning of a sentence, that is used to show emotion: one expressing strong emotion is followed by an exclamation point (!); mild emotion followed by a comma (,).
NOUN: Name of person, place, or thing (tells who or what); may be concrete or abstract; common or proper; singular or plural.
PREPOSITION: A word that connects a noun or noun phrase (the object) to another word, phrase, or clause and conveys a relation between the elements.
PRONOUN: Takes the place of a person, place, or thing; can function any way a noun can function; may be nominative, objective, or possessive; may be singular or plural; may be personal (therefore, first, second, or third person), demonstrative, intensive, interrogative, reflexive, relative, or indefinite.
VERB: Word that represents an action or a state of being; may be action, linking, or helping; may be past, present, or future tense; may be singular or plural; may have active or passive voice; may be indicative, imperative, or subjunctive mood.
FUNCTIONS OF WORDS WITHIN A SENTENCE:
CLAUSE: A group of words that contains a subject and complete predicate; may be independent (able to stand alone as a simple sentence) or dependent (unable to stand alone, not expressing a complete thought, acting as either a noun, adjective, or adverb).
CONJUNCTION: A word that joins two or more elements. (See PARTS OF SPEECH)
DIRECT OBJECT: The noun that receives the action of the verb.
INDIRECT OBJECT: The noun that names the person or thing for whom or to whom the action of the verb is directed; cannot be present without a direct object; will precede the direct object in the sentence.
MODIFIER: A descriptive word, usually an adjective or adverb or any phrase or clause functioning as an adjective or adverb.
OBJECT OF A VERBAL: A noun that receives the action of a verbal (infinitive, participle, or gerund).
PHRASE: A group of words that does not contain a subject and predicate and acts as one unit as a part of speech (noun phrase, verb phrase, prepositional phrase, verbal phrase).
PREDICATE: The main verb of a sentence (including helping verbs) plus its modifiers, objects, and/or complements.
PREDICATE ADJECTIVE: An adjective that follows a linking verb and describes the subject of the sentence.
PREDICATE NOMINATIVE: A noun that follows a linking verb and renames the subject of the sentence.
PREPOSITIONAL PHRASE: A group of words beginning with a preposition and ending with a noun (the object) and used as an adjective or an adverb.
SENTENCE: A group of words containing a subject and a predicate and conveying a complete thought or idea; may be simple (one independent clause), compound (two or more independent clauses), complex (one independent and one or more dependent clauses), or compound/complex (two or more independent clauses and one or more dependent clauses).
SHOW POSSESSION: The function that allows a word to show ownership; nouns show possession by adding 's (or if the word normally ends in s, just an apostrophe). Pronouns have possessive forms and do not contain apostrophes.
SUBJECT: The noun or pronoun that performs the action of the verb, is acted upon by the verb, or is described by the verb.
SAMPLE SENTENCE PATTERNS
Mary is pretty.
S V P.A.
Mary is my mother.
S V P.N.
John hit the ball.
S V D.O.
John gave Mary some flowers.
S V I.O. D.O.
John and Bill played baseball.
S S V D.O.
Compound Subjects
Mary cried all afternoon.
S V adverb | 2,002 | 918 | {
"id": "<urn:uuid:1981380c-ef94-4fc2-bbde-b4ada220cb9c>",
"dump": "CC-MAIN-2021-21",
"url": "https://www.troy.edu/_assets/center-student-success/_documents/learning-center/grammar-mechanics/grammar-review.pdf",
"date": "2021-05-13T18:18:04",
"file_path": "crawl-data/CC-MAIN-2021-21/segments/1620243991943.36/warc/CC-MAIN-20210513173321-20210513203321-00056.warc.gz",
"offset": 1091418535,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9935540556907654,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9932696223258972,
"per_page_languages": [
"eng_Latn",
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
2610,
3976
],
"fw_edu_scores": [
3.53125
],
"minhash_cluster_size": 2,
"duplicate_count": 0
} |
Resource 12:
Quakers, Women, and Reform
Lucretia Mott, ca. 1860–1880. Library of Congress Prints and Photographs Division, Washington, D.C., 9750024.
Ona spiritual quest in England in 1647, George Fox encountered people who believed that women have no souls, "no more than a goose." He challenged the idea by quoting Scripture. Five years later, he founded the Society of Friends, also known as the Quakers. The new faith held that God was present in every human soul, regardless of race or sex, and it quickly spread to the American colonies. Its egalitarian attitude toward women created both leaders and workers for the great reform movements of the nineteenth century.
Women were not men's full equals in Quaker communities, but from the start, they played a much greater role than women in mainstream Protestant sects. They wrote and spoke, served on committees, and were involved in decision-making. In New York State and Pennsylvania in the 1830s, there were slightly more women Quaker ministers than men. Lydia Maria
Child, who lived among Quakers for a period of time, noted that Quaker women were independent because they shared "equally with men in the management of all the business of the society."
Independent Quaker women were indispensable to the abolition movement, but not without opposition. Lucretia Mott spoke at the 1833 convention that founded the American AntiSlavery Society. But when women were not permitted to join—a position that would evolve and splinter the group by the late 1830s—she and others formed the Philadelphia Female Anti-Slavery Society. Angelina Grimke Weld, a convert to Quakerism and one of the leading antislavery orators of her day, was attacked by a mob at Pennsylvania Hall (see Resource 13 ).
In 1848, the first women's rights convention was organized in Seneca Falls by five women: Elizabeth Cady Stanton, Lucretia Mott, Martha Wright (Lucretia's sister), Jane Hunt, and Mary Ann M'Clintock. With the exception of Stanton, all were Quakers or, in Wright's case, a former Quaker who had been expelled for marrying outside the faith. Susan B. Anthony did not attend the meeting in Seneca Falls, but she was a Quaker who became Stanton's great partner in the long fight for women's suffrage.
Discussion Questions
✮ ✮ Why did the Quakers allow women more rights than general American society?
✮ ✮ Why do the actions of a small religious sect matter to the larger story of women's rights?
Sources: Christopher Densmore, "Radical Quaker Women and the Early Women's Rights Movement," Quakers & Slavery, http://trilogy.brynmawr.edu/ speccoll/quakersandslavery/commentary/themes/ radical_quaker_women.php (accessed by M. Waters, 11-28-2016); Judith Wellman, The Road to Seneca Falls: Elizabeth Cady Stanton and the First Women's Rights Convention (Urbana and Chicago: The University of Illinois Press, 2004).
Women in Quaker Doctrine
As we dare not encourage any ministry but that which we believe to spring from the influence of the Holy Spirit, so neither dare we attempt to restrain this influence to persons of any condition in life, or to the male sex alone; but, as male and female are one in Christ, we allow such of the female sex as we believe to be endued with a right qualification for the ministry, to exercise their gifts for the general edification of the church.
[Joseph Gurney Bevan?], Summary of the History, Doctrine, and Discipline of Friends: Written at the Desire of the Meeting for Sufferings, London: 1790.
Saving Washington: The New Republic and Early Reformers, 1790–1860 | 1,580 | 810 | {
"id": "<urn:uuid:8c4c90c6-d88e-4ea5-bd68-b87c606e096e>",
"dump": "CC-MAIN-2021-21",
"url": "https://staging.nyhistory.org/sites/default/files/newfiles/cwh-curriculum/Module%202/Resources/Resource%2012%20Quakers,%20Women,%20and%20Reform.pdf",
"date": "2021-05-13T18:58:31",
"file_path": "crawl-data/CC-MAIN-2021-21/segments/1620243991943.36/warc/CC-MAIN-20210513173321-20210513203321-00057.warc.gz",
"offset": 551072122,
"language": "eng_Latn",
"page_average_lid": "eng_Latn",
"page_average_lid_score": 0.9969788193702698,
"full_doc_lid": "eng_Latn",
"full_doc_lid_score": 0.9969788193702698,
"per_page_languages": [
"eng_Latn"
],
"is_truncated": false,
"extractor": "docling",
"page_ends": [
3553
],
"fw_edu_scores": [
2.265625
],
"minhash_cluster_size": 1,
"duplicate_count": 0
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.