text stringlengths 14 151k | timestamp stringdate 2019-04-18 10:13:53 2019-04-26 17:26:58 | url stringlengths 14 895 |
|---|---|---|
Call 817-410-3459 and speak with an event coordinator for additional details or to set up a site inspection.
*Wedding Package not available on Sundays. Does not include costs for police officers when alcohol is present. | 2019-04-21T12:16:19Z | https://www.grapevinetexasusa.com/grapevine-concourse-event-center/weddings/packages/ |
Finally the Christmas season is here how can the Tiny Tots of Starex be kept away from its celebration and enjoyment. While the teacher told them about the importance of Christmas Tree in Christmas she also taught them and showed them how does it look.
The Kids enjoyed making Christmas Tree by paper folding and showcased their creativity. | 2019-04-22T03:02:03Z | http://starex.edu.in/news.php?key=42 |
Dr. William A. (Bill) Smith, Jr., of Fulton is a medical doctor who retired twice from the U. S. Army and once from his private practice. You might say he’s had trouble staying retired. Now, he’s a volunteer, seeing patients part-time at the Good Samaritan Health and Wellness Center and taking active part in a local emergency preparedness group.
Dr. Smith is married to Ann Mahan, a Fulton native whose family owned and operated the Fulton Daily Leader for many years. Bill grew up in McKenzie, Tennessee, where his father taught at Bethel College. His family later moved to Murray, Kentucky, and he finished high school there. After college, Smith attended medical school at the University of Kentucky. He then went into the U. S. Army, where his specialty was neurology and internal medicine. He later transferred to the Air Force and served in the first Persian Gulf War, leaving the service in 1992.
After the first military retirement, Smith took more training in internal medicine before moving to Fulton to set up private practice. After the terrorist attack of September 11, 2001, he volunteered to go back into the Army (2002). Based at Fort Campbell, he was close enough to come home often, so Ann did not move with him. Smith was deployed to both Iraq and Afghanistan during this time.
While in Iraq, Dr. Smith treated many dignitaries in the Iraqi government. You may have heard that Smith was Saddam Hussein’s doctor. There is some truth to that. During his second Iraq tour, he served at a hospital in Baghdad that was built and equipped for the Iraqi Republican Guard. When the Americans moved in, they converted it into a combat support facility. Saddam Hussein was captured and held in a nearby prison. Prison officials brought him to the hospital for treatment because they thought he had kidney failure. Dr. Smith was assigned to treat him. “He was just dehydrated, but the Colonel wanted to put him in intensive care unit for a while, so I did,” Smith said.
Dr. Smith’s time in Iraq was not without humor. One of the government officials he treated was the Minister of Public Integrity. The government was so corrupt that a full-time watchdog was required. The MPI often came to Dr. Smith with stress-related symptoms. Once Smith returned to Fort Campbell, he noticed in the Army newspaper that the MPI had been arrested for corrupt practices himself.
In 2012, Smith retired from the army for good and returned to Fulton. In his medical practice, he values personal interaction with patients. He didn’t like the increasing emphasis on data processing and record-keeping. He said the ideal doctor-patient relationship consists of the patient talking and the doctor listing while observing the patient. “Better records do not equal better care,” he said. Once he retired from private practice, Dr. Smith couldn’t disconnect entirely, so he became involved in organizing The Good Samaritan Health and Wellness Center.
Good Samaritan provides a primary medical care clinic for the working uninsured. It was the brain-child of Rev. Bill Tate, former pastor of First United Methodist Church in Fulton. He knew of many people with jobs who did not qualify for government health care. And, they didn’t have insurance through their work. Dr. Smith was part of a group from the church and community who set up a non-profit organization to get the clinic started. In 2012, after two years of meetings and paperwork, the clinic opened at 209 West State Line Road in South Fulton.
The center’s staff, all volunteers, includes Dr. Smith, a nurse practitioner, a physician’s assistant, and support staff of all kinds. Patients must have no insurance and must be working. “We serve people who have lost jobs and thus their insurance,” he said. “Sometimes it’s a temporary situation.” It is not a free clinic. They operate entirely on donations and the support of several local churches. In the past, public fund-raisers, such as the one presented by Elvis impersonator Cesar Mora, have helped support the center. Patients are expected to make donations. Asked what the center needs now, Dr. Smith said “We need volunteers, not just medical staff. We can use support staff.” He said Good Samaritan accepts in-kind donations as well as monetary gifts. The center has a website at http://www.gs-center.org/.
Dr. Smith was forced to take an unplanned break recently. He and Ann don’t do everything together, but they did each break a leg last summer. First, Ann fell on the stairs, breaking her femur. After she came home from rehab, Bill tripped on the same steps and broke his kneecap. “We were overwhelmed with kindness,” he said. Friends and neighbors drove them around, brought food, and helped them with house-keeping duties. But, he’s back in action now, seeing patients at the center and getting back to normal activities in the community and his church. | 2019-04-24T02:30:28Z | http://hometownkentenn.com/?p=886 |
Audit background and want to move into tax?
Job Title Audit background and want to move into tax?
Why not consider something more challenging with a greater level of client interaction. Tax is a highly rewarding, ever changing and high paying field.
This is a client facing role where you will be working within a team that is made up of audit, tax and specialist engineers. You will have a high level of responsibility from an early stage and deal with clients from day one. Typical clients range from SME’s to the FTSE. You will be offered full training and support and will be looking at promotion in 12 months.
The firm is a ranked practice and the tax practice has grown rapidly (R&D team doubling in size) in the last 24 months.
• Calculate financial assessments for portfolios of companies’ claims for R&D tax relief and tax credits. | 2019-04-20T15:02:36Z | https://www.creativetaxrecruitment.com/jobs/4881-audit-background-and-want-to-move-into-tax |
Telefonic Ltd grants you a limited licence to access and make personal use of this website, but not to download (other than page caching) or modify it, or any portion of it, except with our express written consent. You must not use the website in any way that causes, or is likely to cause, the website or access to it to be interrupted, damaged or impaired in any way.
All text published on the Telefonic website is copyright Telefonic Ltd and is protected by United Kingdom and international copyright and database right laws. Copyright to images is owned by Telefonic or individual photographers who have granted us rights to reproduce them. This website or any portion of this website may not be reproduced, duplicated, copied, visited, stored in a retrieval system, transmitted in any form or means electronic, mechanical, photocopying, recording or otherwise, sold, resold or otherwise exploited for any commercial purpose without our express written consent.
The material contained in this site is set out in good faith for general guidance and no liability can be accepted for loss, injury or expense incurred as a result of relying in particular circumstances on statements made on the site. We do our best to keep this website as up to date as possible, but in view of the changeable nature of worldwide travel we cannot be held responsible for any information contained herein. Information has been obtained from sources believed to be reliable, but its accuracy and completeness, and the opinions based thereon are not guaranteed.
Telefonic Ltd is not responsible for the contents of any third-party websites linked to this site and we are not liable for any expenses or damages incurred therein. These links are provided as a convenience and Telefonic does not endorse, sponsor or control linked sites and therefore we cannot in any way guarantee availability, prices, delivery of products and services offered on such sites or satisfaction therewith. Linked sites are not under the control of Telefonic, and therefore we cannot in any way guarantee availability, prices and delivery of or satisfaction with the products and services offered on these sites. We strongly advises you to investigate the trustworthiness, terms and conditions and business practices of linked sites before proceeding with any transaction. | 2019-04-23T08:10:02Z | http://www.voicesoft.co.uk/terms/ |
The brief life of Philip Eugene Parker Jr. was celebrated yesterday with laughs, tears and draft beer at the waterfront bar where his mother occasionally seeks solace - an elusive feeling ever since her son was killed in the pitch dark of a prison bus.
John Lennon's "Beautiful Boy" played, and 20 balloons were released in memory of Parker's 20 hard years of living. Also, a white dove was released to express the hope that in death Parker found something he never had in life: peace.
"Sweet and troubled and confused" is the way Parker's mother described him. "He was my gentle giant," Melissa Rodriguez said of her second-born son, a muscular 6-foot-6, 240-pound Baltimore man who would have turned 21 tomorrow.
"They had to bend my baby's legs to put him in the casket," she recalled tearfully. "So I guess he'll spend eternity uncomfortable - the way he always was."
Rodriguez, too, has not found comfort. After her son's strangulation Feb. 2, she lost 52 pounds, shrinking from a size 14 to a junior size, and she continues to write to him, as though he were still alive and confined in the Maryland Correctional Adjustment Center in Baltimore, a Supermax prison for inmates in solitary confinement. Nearly seven months after her son's death, she hasn't visited his grave; she can't find the strength. Just talking about him makes her hands and voice tremble and the tears flow uncontrollably.
"A piece of me is gone," she said quietly. "When you have children, they make you who you are. They make you want to be better. They make you want to be stronger. ... I'm missing a piece."
With his feet and hands shackled tightly to a chain around his waist, Parker was strangled during a nighttime bus ride carrying four prison guards, a driver and more than 30 other inmates as it traveled from Hagerstown to the Supermax prison on East Madison Street. Kevin G. Johns Jr., a 22-year-old twice-convicted killer seated near Parker, has been charged with first-degree murder. Baltimore County prosecutors are seeking the death penalty.
"What was Philip thinking at the end? What were his last thoughts? These are questions I can't get over. That is all I think about," Rodriguez said, her voice breaking. "This is what I've got to live with for the rest of my life."
She blames the state's justice and prison systems, and she blames herself. She was 16 when she began giving birth to five sons in successive years.
Today, she is a grandmother of four who feels much older than her 38 years. She said Parker was a sweet but troubled child. In elementary school he was diagnosed with attention deficit hyperactivity disorder and, by age 14, he was being medicated for bipolar disorder.
"Unfortunately kids don't come with [instruction] books, and that is my grief and I'm dealing with it," she said. "When we have children with disabilities we need to slow down and realize it is all about them, not about us."
Parker had about 15 months left on a 3 1/2 -year sentence given him when he was 18 and attempted to rob two kids with a broken pellet gun, she said. He had long before lost his prison visitation and phone privileges and was housed with the maximum-security inmates at the Supermax because he repeatedly got into trouble at Maryland's Hagerstown prison. He flooded his cell, ripped out the toilet, lit his mattress on fire and fashioned weapons out of socks and soap and batteries. It had been his goal to be transferred to the isolated confinement of the Supermax, Rodriguez said.
"The gangs [in Hagerstown] were always chasing after him to join," Rodriguez's father, Clifford Kiser, recalled yesterday from the Baltimore rowhouse he shares with his daughter.
"Even though he was this big, strong man, he had this fear of others hurting him," Rodriguez added.
It's this knowledge of his fears that haunts her. If the deepest cut life can afflict is a child's death, Rodriguez said, this cut went even deeper because of the brutal way he died. Now the general public remembers her son only as "the guy who died on the prison bus," she said.
"That's no kind of legacy," she said, just before leaving her home yesterday for the party at Malibu's Lakeside Restaurant and Bar in Brooklyn. "Today is about celebrating Philip's life. ... It's not supposed to be about his death."
But at Malibu's, alongside the balloons and the beer, were stacks of voter registration cards. Rodriguez is trying to form a nonprofit (Justice4Phil. com) that will lobby for housing and medical reforms that she says are long overdue in Maryland's juvenile justice and prison systems.
After Parker's slaying, Rodriguez received a sympathy letter from Gov. Robert L. Ehrlich Jr. She tossed it aside.
"We put you in office and we can take you out" of office, Parker said angrily yesterday, as though she were speaking to the governor. "This isn't over. Not by a long shot." | 2019-04-23T02:44:09Z | https://www.baltimoresun.com/bal-md.parker29aug29-story.html |
Rocky Mountain Publications is located at the address 23353 Rebecca Ct in Naperville, Illinois 60564. They can be contacted via phone at (630) 585-8090 for pricing, hours and directions.
For maps and directions to Rocky Mountain Publications view the map to the right. For reviews of Rocky Mountain Publications see below. | 2019-04-24T02:54:52Z | https://www.chamberofcommerce.com/naperville-il/40724170-rocky-mountain-publications |
Screened volcanic topsoil procured from various sites Auckland wide. Auckland soil has a higher clay content and hence is lighter in colour to our lawn topsoil which we sell as our bagged topsoil. Screened topsoil is not a weed free product. This topsoil can be sold bagged on request but is typically sold and requested in bulk. A good general purpose soil for many gardening applications.
Size: Screened on a 12mm screen. Fines to 12mm in size.
Ideal uses: General landscaping and garden maintenance.
A loamy finer grade of bagged topsoil screened to 10mm. Dark and rich in colour this topsoil is prefect for new lawns and lawn repair work. Will provide superior body and hence structure to new lawns along with great water retention properties. Lower clay content than northern new Zealand volcanic soil and hence is darker and more friable.
Ideal uses:New lawns where a superior topsoil is required. | 2019-04-26T02:02:22Z | https://www.californiagarden.co.nz/soils-stones-etc/topsoil |
LOUISVILLE, KY (WAVE) - Scott Satterfield’s first season as the UofL head football coach will kick off in prime time. The Cards will host Notre Dame on Monday, September 2.
UofL won the only other meeting with the Fighting Irish, 31-28 in 2014 in South Bend, Indiana.
Here is the remaining 2019 schedule, including the ACC slate.
Kent Taylor took over as just the fourth 11 o'clock sports anchor in WAVE 3 history in January of 2002.
By My Standards won the Louisiana Derby at 22-1 odds and will likely be 20-1 or higher in the Kentucky Derby. He’s going to be off six weeks between races, but that hasn’t stopped the son of former Breeders’ Cup Mile winner Goldencents from a ton of early chatter. | 2019-04-26T06:03:28Z | http://www.wave3.com/2019/01/16/uofl-football-scheduled-is-finalized/ |
An Online Academy for Christian Leadership Development - What would you want?
This is an opportunity to make an honest assessment of what is needed for you personally, in your church, locally or nationally, whether it is spiritual growth, outreach programmes, community support, facility improvements, leadership training, discipleship, or teaching….
This questionnaire is powered by SurveyMonkey, a web-based tool that enables the creation and management of surveys in an online environment. This short survey of 10 questions, should take you less than 10 minutes to complete.
When you are happy with your responses, simply select the "DONE" button at the bottom of the survey form, and your responses will be fed back to us automatically.
* 1. Have you ever used the internet to fulfil your education, training or development needs?
If yes, what services have you used? If no, go to Q2. Please tick all that apply.
Listen only webinar presentations - where you receive information with no opportunity for interaction.
Interactive webinar presentations - where you are able to interact with the webinar host and/or other participants.
Interactive video conferences - the use of video conferencing as a learning environment where you can see the host and participants via webcam; have 2-way audio interaction with the host and other participants; and have the opportunity to screen share information.
* 2. If you answered No in Q1, would you consider using the internet to fulfil any of your education or training and development needs? Please tick all that apply.
* 3. Do you actively participate in any only groups, forums or communities? e.g. Facebook, LinkedIn, Google+, etc.
If yes, which medium do you use?
* 4. On average, how often do you interact in online groups, forums or communities that you are a part of?
* 5. If no, what stops you from joining and actively participating in any online groups, forums or communities?
(If you answered yes to Q3, please insert 'N/A').
* 6. Do you know of or have you accessed any online education, leadership development or training programmes specifically designed to cater to the Christian community?
If yes, what format did the learning programme take?
1-off / Stand alone computer based learning unit or webinar.
A non-accredited modular programme of a number of computer based units.
An accredited modular training programme of a number of computer based units.
* 7. If you have paid for any online education, leadership development or training programmes, accredited or not, please indicate the approximate amount of fees, materials etc?
(Select No, if you haven't participated in such a programme).
9 fully interactive webinars which allow 2-way communication between the host and among participants; the sharing of presentations, and document upload & download capability, to foster collective sharing.
3 or 4 face to face cohort meetings.
How much would you consider paying for such a programme? OR How much do you think should such a programme should be marketed at?
I wouldn't be interested in a programme like this.
* 9. How long would you expect a leadership development and training programme of this nature to last?
* 10. Many thanks for completing our survey. Please provide the details indicated below which will be used for our internal use only. We will not use, sell or transfer your information to any 3rd party. Thank you for helping us! | 2019-04-20T23:30:44Z | https://www.surveymonkey.com/r/HJNVBNY |
We hope you’re having a great Christmas. Once you’ve reached the stage where you’ve eaten too much Christmas dinner here for your scrutiny over a mince pie is the Line Course planners optimal routes from this years OMM Line courses. Do you agree with him?
CLICK THE MAP FOR LARGER VERSION. | 2019-04-21T12:35:25Z | https://theomm.de/omm50-optimal-lines/ |
BASIC FEATURES: www.chatwp.com is an international chat where you can talk as you like. No limits on any user @-\www.chatwp.com\. No sign up, registration and login to use our website (www.chatwp.com). Random chatting@-(www.chatwp.com). Free gaming and dating chat rooms @-(www.chatwp.com). Random chatting with strangers online as guest in -www.chatwp.com- public and private chat rooms, anonymous and mobile friendly. - Connect to people @//www.chatwp.com// from around the world and all services free. Our website cool and hot chat place to meet your new love at randomchat and with anonymity, without registering @//www.chatwp.com//, chat ant talk as guest with a click. -//www.chatwp.com//- has a number of chattingrooms to meet love, friend and new people from around the world. @www.chatwp.com- PrivateChats is among the very basic features and this online chats //www.chatwp.com// - free of cost. No credit card charges are applied at all here. Chat with strangers online @//www.chatwp.com//, speak in private chatt-rooms, send video, pictures etc.. - TAGS: Free Australia Online Chat Room, Free Austria Online Chat Room, Free Belgium Online Chat Room, Free Canada Online Chat Room, Free Denmark Online Chat Room, -www.chatwp.com- Free Finland Online Chat Room, Free France Online Chat Room, Free Germany Online Chat Room, Free Ireland Online Chat Room, Free Italy Online Chat Room, Free Luxembourg Online Chat Room, Free Netherlands Online Chat Room, Free New Zeleand Online Chat Room, Free Norway Online Chat Room, Free Spain Online Chat Room, Free Sweeden Online Chat Room, Free Switzerland Online Chat Room, Free United Kingdom Online Chat Room, Free United States of America Online Chat Room. | 2019-04-19T04:59:31Z | https://www.chatwp.com/bolivia |
A morphogen gradient of Bone Morphogenetic Protein (BMP) signaling patterns the dorsoventral embryonic axis of vertebrates and invertebrates. The prevailing view in vertebrates for BMP gradient formation is through a counter-gradient of BMP antagonists, often along with ligand shuttling to generate peak signaling levels. To delineate the mechanism in zebrafish, we precisely quantified the BMP activity gradient in wild-type and mutant embryos and combined these data with a mathematical model-based computational screen to test hypotheses for gradient formation. Our analysis ruled out a BMP shuttling mechanism and a bmp transcriptionally-informed gradient mechanism. Surprisingly, rather than supporting a counter-gradient mechanism, our analyses support a fourth model, a source-sink mechanism, which relies on a restricted BMP antagonist distribution acting as a sink that drives BMP flux dorsally and gradient formation. We measured Bmp2 diffusion and found that it supports the source-sink model, suggesting a new mechanism to shape BMP gradients during development.
Before an animal is born, a protein called BMP plays a key role in establishing the difference between the front and the back of the animal. Cells nearer the front of the embryo contain higher amounts of the BMP protein, whilst cells nearer the back have progressively lower levels of BMP. This gradient of BMP ‘concentration’ affects the identity of the cells, with the level of BMP in each cell dictating what parts of the body are made where.
The prevailing view among scientists is that the BMP gradient is created by an opposing gradient of another protein called Chordin, which is found at high levels at the back of the embryo and lower levels near the front. Chordin inhibits BMP and the interaction between the two proteins establishes the gradients that create order across the embryo.
Zinski et al. used computer models to investigate how the BMP gradient is created. Several possibilities were considered, including the effect of Chordin. Comparing the models to precise experimental measurements of BMP activity in zebrafish embryos suggested that a different mechanism known as a source-sink model, rather than the opposing Chordin gradient, may be responsible for the pattern of BMP found in the embryo. In this model, the BMP is produced at the front of the embryo and moves towards the back end by diffusion. At the back of the embryo, BMP is mopped up by Chordin, resulting in a constant gradient of BMP along the embryo.
Many other processes that control how animals grow and develop rely on the formation of similar protein gradients, so these findings may also apply to other aspects of animal development. Understanding how animals grow and develop may help researchers to develop strategies to regrow tissues and organs in human patients.
Morphogen gradients pattern axonal pathways, the neural tube, the dorsal-ventral (DV) and anterior-posterior (AP) embryonic axes, as well as multiple organ systems (Bökel and Brand, 2013; Briscoe and Small, 2015; Cohen et al., 2013; Rogers and Schier, 2011; Rushlow and Shvartsman, 2012; Sansom and Livesey, 2009; Schilling et al., 2012; Tuazon and Mullins, 2015). Morphogens are defined as factors that form a spatially non-uniform distribution spanning multiple cell-lengths that instructs different cell fates at distinct levels. Their importance in specifying multiple cell fates in a gradient has spurred decades of research deciphering how they work. In 1970, Francis Crick proposed that such a gradient could be formed by a source of morphogen flowing to a sink that destroyed it (Crick, 1970). We now know that the mechanisms by which morphogen gradients are established are diverse and complex, and that understanding these mechanisms is paramount to understanding developmental biology (Briscoe and Small, 2015; Müller et al., 2013; Rogers and Schier, 2011). Bone Morphogenetic Proteins (BMPs) act as morphogens repeatedly during development, including in patterning the embryonic DV axis, the neural tube, and the Drosophila wing disc (Bier and De Robertis, 2015; Briscoe and Small, 2015; Rogers and Schier, 2011).
BMP morphogen systems are established by a network of extracellular regulators (Dutko and Mullins, 2011). A crucial class of these regulators is the BMP antagonists, defined by their ability to bind BMP ligand with high affinity, thereby blocking ligand-receptor interaction (Brazil et al., 2015). During axial patterning in zebrafish and Xenopus, three antagonists, Chordin, Noggin, and Follistatin play key roles in inhibiting BMP signaling to promote dorsal cell fate specification (Dal-Pra et al., 2006; Khokha et al., 2005; Schulte-Merker et al., 1997). These antagonists bind to the BMP ligand, preventing BMP from binding its receptors (Iemura et al., 1998; Piccolo et al., 1996; Zimmerman et al., 1996). In both zebrafish and frogs, Chordin differs from Noggin and Follistatin in its expression domain, its phenotype, and its interaction with the metalloprotease Tolloid (Tld). Chordin is expressed in a larger domain than Noggin and Follistatin (Dal-Pra et al., 2006; Khokha et al., 2005). While the loss of Chordin ventralizes the embryo (Hammerschmidt et al., 1996; Oelgeschläger et al., 2003), the depletion of Noggin or Follistatin alone or together does not (Dal-Pra et al., 2006; Khokha et al., 2005). Unlike Noggin and Follistatin, Chordin can be cleaved by the metalloprotease Tolloid, releasing bound BMP ligand and allowing it to signal (Blader et al., 1997; Piccolo et al., 1997).
Previous studies in Drosophila show that the Drosophila ortholog of Chordin, Sog, can act as both a BMP agonist and as an antagonist during DV patterning. To act as an agonist, Sog binds to and moves BMP ligand via facilitated diffusion to regions of Tolloid activity (Figure 1A). Tolloid then cleaves Sog, which releases BMP thus increasing peak BMP levels, a process altogether known as shuttling (Figure 1A) (Eldar et al., 2002; Marqués et al., 1997; Holley et al., 1996; Peluso et al., 2011; Shilo et al., 2013; Shimmi et al., 2005; Umulis et al., 2010). The shuttling mechanism is essential to Drosophila DV patterning, where Sog shuttles BMP ligand from lateral regions to dorsal regions (Figure 1A) (Eldar et al., 2002; Marqués et al., 1997; Holley et al., 1996; Peluso et al., 2011; Shilo et al., 2013; Shimmi et al., 2005; Umulis et al., 2010). This shuttling mechanism is required to steepen the BMP signaling gradient and specify the dorsal-most cell fates in the Drosophila embryo (Eldar et al., 2002; Marqués et al., 1997; Holley et al., 1996; Peluso et al., 2011; Shilo et al., 2013; Shimmi et al., 2005; Umulis et al., 2010). The shuttling of BMP ligand by Chordin has also been suggested to play a role in DV patterning in Echinoderms (Lapraz et al., 2009) and Nematostella (Genikhovich et al., 2015).
Potential Mechanisms of BMP Morphogen Gradient Formation.
(A) Cross-sectional view of the Drosophila embryo depicting Sog shuttling Dpp (the fly BMP ligand) dorsally. (B) Lateral view of the zebrafish embryo depicting Chordin (Chd) shuttling BMP ventrally. (C) Counter-Gradient: Chd diffuses ventrally to form a counter-gradient repressing BMP. (D) Shuttling: BMP bound to Chd is shuttled ventrally, where it is released by Tolloid cleavage. (E) Transcriptional: BMP stays where it is produced, mirroring the bmp expression gradient. (F) Source-sink: BMP diffuses from its source of ventral production to a sink of dorsal Chd.
It is unclear whether Chordin shuttles BMP in patterning vertebrate tissues. In Xenopus, the shuttling of a particular BMP ligand, ADMP, by Chordin was reported to play a role in DV axial patterning in the scaling of embryos (Ben-Zvi et al., 2008; Reversade and De Robertis, 2005). In the mouse, Chordin has been suggested to shuttle BMP ligand from where it is expressed in the intervertebral disc to its site of signaling in the vertebral body (Zakin et al., 2010). Mathematical models of zebrafish and Xenopus DV patterning have predicted that Chordin could shuttle BMP ligand (Ben-Zvi et al., 2008; Zhang et al., 2007). The transcriptional profiles of zebrafish BMP components at the onset of gastrulation resemble that of the Drosophila embryo (Dutko and Mullins, 2011; O'Connor et al., 2006). In Drosophila, sog is expressed ventral-laterally while the BMP ligand dpp is expressed dorsally (Figure 1A). Vertebrates have undergone a DV axis inversion with respect to arthropods (De Robertis and Sasai, 1996; Gerhart, 2000; Lacalli, 1995; Sander and Schmidt-Ott, 2004), thus chordin is expressed dorsally while bmp ligands are expressed ventrally (Figure 1B). However, whether Chordin acts as a BMP agonist by shuttling BMP ligand during DV patterning in zebrafish or other vertebrates has not been determined (Figure 1B).
In vertebrates, the mechanism by which the BMP ligands and antagonists shape this gradient is unclear. Several potential mechanisms have been proposed: 1) an inverse gradient of BMP antagonists imparts the shape of the BMP signaling gradient (Figure 1C) (Blitz et al., 2000; Connors et al., 1999; Little and Mullins, 2006; Thomsen, 1997), 2) BMP antagonists generate the peak BMP signaling levels by shuttling BMP ligand to these regions (Figure 1B,D) (Ben-Zvi et al., 2008; Shilo et al., 2013; Zhang et al., 2007), 3) the gradient shape mirrors the shape of the bmp expression domain (Figure 1E) (Ramel and Hill, 2013), and 4) the gradient is generated by BMP diffusing from its ventral source to a dorsal sink of BMP antagonists (Figure 1F). These mechanisms are not mutually exclusive and multiple may act in combination.
To identify the mechanism of BMP signaling gradient formation in the zebrafish embryo, we established a robust quantitative imaging method to directly measure the BMP signaling gradient. We integrated the results with a mathematical modeling approach, using the experiments to inform our model selection. The modeling then provided information on key parameters to measure to identify the mechanism by which the BMP signaling gradient is formed. We used phosphorylated Smad5 protein as a direct read-out for BMP signaling in both wild type (WT), chordin mutant, and chordin heterozygous embryos. We quantified nuclear phosphorylated-Smad5 (P-Smad5) fluorescent intensity across the entire embryo at single-cell resolution at different stages of development. Combining the P-Smad5 data with a computational screen of mathematical models showed that shuttling of BMP during DV patterning does not shape the gradient, and that a gradient of bmp transcription cannot account for the gradient of BMP signaling activity. From these results, we conclude that the signaling gradient patterning the vertebrate DV axis is generated by either a source-sink or counter-gradient mechanism. To discern between these mechanisms, we developed and measured the diffusion rate of a BMP2-Venus fusion protein in the zebrafish blastula and found that it is relatively mobile, which supports a large number of source-sink simulations, but far fewer counter-gradient simulations. Our results suggest that significant differences exist between the biophysical parameters of conserved proteins in zebrafish and Drosophila DV patterning. Through quantification and modeling, we present a new view of the mechanism that the BMP antagonists and ligand use to establish the BMP signaling gradient patterning the DV axis in zebrafish.
To measure the BMP signaling gradient, we quantified the levels of the BMP signal transducer P-Smad5 across the entire embryo at single cell resolution. Smad5 is directly phosphorylated by the BMP type I receptor in response to BMP signaling, and P-Smad5 concentration has been shown to linearly correlate with the concentration of BMP ligand in the Drosophila wing disc and S2 cells (Bollenbach et al., 2008; Serpe et al., 2008). Fixed embryos were whole-mount immunostained for P-Smad5 and imaged using a Line Scanning Confocal Microscope (Figure 2A–E). We developed a mounting and imaging protocol that minimized photo-bleaching, light scattering, and refractive index mismatch (see Materials and methods). We wrote a Matlab algorithm to identify all 8000 + nuclei centerpoints in each embryo in three dimensions, to remove populations unresponsive to P-Smad5 such as yolk syncytial nuclei and dividing cells (see Materials and methods), and to extract the P-Smad5 intensities associated with each nucleus (Figure 2A’–E’). Embryos were aligned by coherent point drift to a reference embryo to create ensembles of embryos suitable for statistical analysis (Myronenko et al., 2010a) (see Materials and methods). We used a band of cells around the margin of the embryo (Figure 2F’) to plot profiles from the dorsal-most to the ventral-most points to compare P-Smad5 gradient profiles between stages and between wild-type and mutant embryos (Figure 2F).
Dynamics of the WT P-Smad5 gradient across head and trunk patterning.
(A–E) Animal views of maximum projections (MP) of P-Smad5 stained individual embryos. (A’–E’) Animal views of nuclear intensities of all nuclei from the embryos shown above. (F) Average marginal intensities for 4.7–6.7 hpf (4.7: N = 3, 5.3: N = 4, 5.7: N = 13, 6.3: N = 11, 6.7: N = 4). Error bars indicate standard deviation. (G) Slope of the P-Smad5 gradients shown in panel F. Dotted line separates high slope (>0.5 a.u./deg) regions from low slope regions. (H) Change in cell number versus (vs.) developmental time of embryos fixed from a single cross and nuclei stained with Sytox Orange. (I) Cell number varies between different crosses of WT fish fixed at 5.7 hpf. (H,I) Gray dots are individual embryo cell counts. Red lines show the mean number of cells at a given time point, red boxes show 95% confidence interval, blue boxes show one standard deviation.
Our quantitative analysis revealed that the BMP gradient during DV patterning is quite dynamic. BMP signaling patterns prospective head and rostral trunk DV axial tissues during late blastula to mid-gastrula stages at ~5 to 7 hr post fertilization (hpf) in the zebrafish (Hashiguchi and Mullins, 2013; Kwon et al., 2010; Tuazon and Mullins, 2015; Tucker et al., 2008). We quantified the BMP signaling gradient at 30 min intervals across this period. We found that the ventral-most 30˚ undergoes about a 2-fold intensification from 4.7 to 6.7 hpf (Figure 2F). This is accompanied by a 3 to 5 fold increase in the slope of the gradient in ventrolateral regions of the embryo (0–75 degrees) over this 2 hr period (Figure 2G). Moreover, the lateral region encompassing the high slope (>0.5 A.U./degree) expands from a size of 20˚ to 75˚, meaning that by 6.7 hpf, nearly half the embryo falls within this high slope region. This contrasts with Drosophila DV patterning, where an initial broad, low-slope distribution of P-Mad is refined into a steep peak of BMP signaling covering only the dorsal-most 8% of the embryo (11 cell lengths) (Sutherland et al., 2003; Wang and Ferguson, 2005). This intensification of P-Mad is very rapid in Drosophila DV patterning, where P-Mad increases about three fold in the 30 min (min) between stages 5 and 6 (Ross et al., 2001; Sutherland et al., 2003; Wang and Ferguson, 2005), a process that we found is much slower in the zebrafish embryo: a 2-fold increase over a 2 hr period.
We then sought to determine if changes in cell number could account for the observed changes in the P-Smad5 gradient. We counted the number of cells in each embryo from a single timecourse and observed an approximately 70% increase in cell number from 4.7 to 6.7 hpf (Figure 2H). Cell nuclei do not change significantly in size during this time (Keller et al., 2008). The increase in cell number occurs throughout the embryo and is not restricted to a particular DV region, while the change in gradient amplitude (Figure 2F) and slope is restricted to the ventral third of the embryo (Figure 2G). Thus an increase in cell number does not account, via an unknown mechanism, for the increase in amplitude or slope. Additional support that cell number has little effect on gradient shape stems from the observation that the absolute number of cells at a given time point can vary by as much as 20% between different embryos within the same cross or between crosses (Figure 2I) with no detectable change in gradient shape or phenotype.
We then performed a computational screen of mathematical models to investigate which gradient-forming mechanisms (Figure 1C–F) fit the WT P-Smad5 gradient profiles (Figure 2). To do so, we first needed to determine the expression domains of bmp, chordin, noggin, and tolloid to use for the mathematical model. We based the domain sizes on our own measurements (Figure 3), as well as published in situ hybridizations for bmp (Fürthauer et al., 2004; Ramel and Hill, 2013), chordin (Miller-Bertoglio et al., 1997), tolloid (Connors et al., 1999), and noggin (Dal-Pra et al., 2006). In animal-pole views of wholemount in situ hybridizations, we measured the chordin and noggin expression domain sizes to be 75 and 40 degrees in width, respectively (Figure 3A–C). We estimated the size of the bmp expression domain via wholemount in situ hybridizations (Figure 3D), however, bmp2b expression appeared graded and not as easily measured as chordin and noggin. We instead measured the bmp2b expression gradient at 5.7 hpf via fluorescent in situ hybridization on cross-sections of the DV margin (Figure 3F–H). We quantified the relative intensity of the fluorescent bmp2b in situ (Figure 3I black line) and used it to estimate the BMP production domain in our model (Figure 3I, blue line).
Measuring the bmp2b, chordin, and noggin expression domains.
Animal pole views of wholemount in situ hybridizations of the expression of (A) chd (N = 25), and (B) nog (N = 8) in WT embryos. (C) Measured domain size of chd and nog domains via wholemount in situ hybridization in WT and chd mutant embryos. (D–D’’’) bmp2b in chd ± embryos at 4.7 (N = 10), 5.3 (N = 15), 5.7 (N = 20), and 7 hpf (N = 16), and (E–E’’’) bmp2b expression in chd -/- embryos at 4.7 (N = 6), 5.3 (N = 16), 5.7 (N = 13), and 7 hpf (N = 12). (F–H) Fluorescent in situ hybridization (FISH) signal of bmp2b from a marginal slice at 5.7 hpf with a DAPI nuclear stain. Scale bars = 100 μm. (I) Quantification of FISH of bmp2b expression from ventral to dorsal (black line, N = 5) compared to the BMP production gradient used in the mathematical model (blue dotted line). Error bars indicate standard deviation.
We then developed a system of partial differential equations to model the interactions of BMP, Chordin, Noggin, and Tolloid (Supplementary Figure 4—figure supplement 4 and 1A). BMP, Chordin, Noggin, BMP-Chordin, and BMP-Noggin were modeled as diffusible species, while Tolloid was treated parametrically according to its domain of expression (Figure 4A). The zebrafish gastrula was reduced to a 1-dimensional (1D) half-circumference with a length of 700 µm. We selected a 1D description at the margin for simulation, since the inputs to the system based on gene expression are distributed symmetrically across the embryo, so a 1D model should largely reflect one in 3D, and the faster simulation time of a 1D model allowed us to explore far greater parameter space computationally, increasing our ability to discern biophysical constraints that distinguish between the mechanisms. Domains of production of BMP, Chordin, and Noggin were estimated as described (Figure 3, Figure 4D). The dissociation constants for BMP-Chordin and BMP-Noggin were set to 1 and 0.1 nM respectively, based on previously reported analysis (Piccolo et al., 1996; Troilo et al., 2014; Zimmerman et al., 1996). All remaining parameters (ie. the diffusion coefficients, production rates, decay rates, on and off binding rates) were varied over 4 orders of magnitude encompassing all biologically feasible values (Table 1).
List of the parameter ranges used in the computational model-based screen.
Values range between the upper and lower bound. Note that the dissociation constant of BMP-Chd and BMP-Nog was held constant, but the on- and off- rates were allowed to vary.
Creation of a mathematical model of BMP gradient formation.
(A) Depiction of the species and binding possibilities modeled. (B) BMP distributions of 10 individual model solutions (black dotted lines) plotted against the WT 5.7 hpf P-Smad5 gradient (blue line). Error bars indicate standard deviation. (C) Flow-chart of model mechanism classification. (C’) BMP mass balance from model labeled to indicate which terms contribute to the source-sink, counter-gradient, and transcriptional mechanisms at each point. (C”) Shuttling mechanism was defined by a 20% decrease at the ventral-most point in chd LOF compared to WT. (D) Expression domains of bmp (blue), tld (purple), chd (red), and nog (yellow) used in the model. (E) Expression domains of bmp (blue), tld (purple), chd (red), and nog (yellow) used for the alternative scenario where the bmp expression domain mirrors the measured P-Smad5 gradient. (D’, E’) Pie chart showing how many parameter combinations fit the WT data (blue) and how many failed to do so (grey). (D”, E”) Pie chart showing how many parameter combinations were classified to have a source-sink (blue), counter-gradient (red), transcriptional (orange), or shuttling (green) mechanism.
The equations were solved for the developmental window from ~3.5 hpf to ~5.7 hpf, since bmp and chordin are first expressed shortly after the mid-blastula-transition at 3 hpf (Koos and Ho, 1999; Leung et al., 2003; Shimizu et al., 2000; Solnica-Krezel et al., 2001). The equations were simulated 1,000,000 times, each time with a different combination of randomly selected parameters. Each parameter combination was then re-simulated without Chordin or Noggin to predict the BMP signaling gradient in a chordin or noggin loss-of-function (LOF) scenario. We then selected simulations that generated BMP profiles that fit our measured P-Smad5 gradient at 5.7 hpf with a normalized root mean squared deviation of 8% or less (Figure 4B). We also eliminated simulations that had significantly different BMP profiles when Noggin production was set to 0, since the loss of Noggin does not affect DV patterning in zebrafish or Xenopus (Dal-Pra et al., 2006; Khokha et al., 2005).
All simulation results that fit our data were classified into categories based on the biophysical process that dominated formation of the gradient shape: shuttling, source-sink, counter-gradient, or transcriptional (Figure 4C). We discerned between source-sink, counter-gradient, and transcriptional mechanisms by examining the balance of binding, diffusion, decay, and accumulation processes in the partial differential equation for the BMP species (Figure 4C–C’’). If 80% of the BMP ligand was degraded where it was produced or accumulated there, the simulation was classified as transcriptional (Figure 4C,C’). If the majority of BMP diffused away from its site of production rather than being bound by Chordin, the simulation was considered a source-sink mechanism (Figure 4C,C’). Conversely, if the majority of BMP was bound at its site of production by Chordin, the simulation was classified as a Chordin counter-gradient mechanism (Figure 4C,C’). We classified a simulation as shuttling if the ventral-most point in the predicted chordin-/- BMP profile was at least 20% lower than in WT, as shuttling by the antagonist leads to a net accumulation of ligand in the ventral-most region (Figure 4C,C’’). By comparison, shuttling in Drosophila accounts more significantly to the peak level, with a 50% decrease in the peak P-Mad level when the chordin homolog sog is deficient (Mizutani et al., 2005; Peluso et al., 2011; Sutherland et al., 2003). Shuttling of 20% is about one standard deviation greater than our measured embryo-to-embryo variability for peak P-Smad5 signaling levels (Figure 4B).
Multiple classes of mechanisms generated simulations fitting our WT data, including an antagonist counter-gradient, source-sink, and shuttling. Of the 1,000,000 randomly picked parameter combinations, 15,142 fit the experimentally measured WT signaling gradient (Figure 4D’). Among those that fit, 13,382 were classified as source-sink, 1710 as counter-gradient, and 50 as shuttling (Figure 4D”). Notably, no transcriptional simulations were found, because our measured bmp expression profile (Figure 3I) did not match our measured WT BMP signaling gradient (Figure 2), and therefore BMP must diffuse from its site of production or be bound by Chordin to fit our measured signaling gradient.
The mean of our bmp2b expression profile did not reflect the P-Smad5 gradient at 5.7 hpf (Figures 2F and 3I), however, the bmp2b expression profile displayed variability from embryo to embryo. To account for the possibility that the bmp expression profile reflects the WT P-Smad5 gradient, which fell within one standard deviation of the mean (Figures 2F and 3I), we simulated the mathematical model 250,000 additional times with a bmp expression input matching the WT P-Smad5 gradient (Figure 4E). We found that the transcriptional mechanism was the most abundant mechanism among the simulations, comprising 83,747 of the simulations (Figure 4E’,E’’). Surprisingly, no counter-gradient solutions were found when bmp expression matched P-Smad5. This is because Chordin binding to BMP would interfere with the shape of the BMP protein gradient, causing it to no longer match the measured BMP signaling gradient. Thus the transcriptional and counter-gradient mechanisms are incompatible with each other.
Each mechanism required specific biophysical parameters to fit the experimentally measured DV signaling gradient. The source-sink mechanism required BMP to have a high diffusion rate, so BMP could diffuse to a dorsally-localized sink of antagonists (Figure 5A). The counter-gradient mechanism required Chordin to have a high diffusion rate, so Chordin could diffuse ventrally to generate an antagonist gradient (Figure 5B). When either BMP or Chordin had moderately high diffusion rates (e.g. near 1 um2/s), decay rates were low to allow each more time to diffuse dorsally or ventrally, respectively. When BMP and Chordin range are plotted on the same axis, the segregation of the source-sink and counter-gradient mechanisms based on range is readily apparent (Figure 5C). The shuttling mechanism required that BMP-Chordin have a high diffusion rate and low decay rate in order to diffuse ventrally where Tolloid cleaves Chordin, which then releases BMP (Figure 5D). Noggin diffusion and decay was not constrained in any of the three mechanisms (Figure 5E).
Biophysical values of individual simulations that fit the WT P-Smad5 gradient.
(A–L) Scatter plots comparing biophysical parameters of 1000 randomly selected solutions classified by mechanism that fit the WT data. Combinations that failed to fit the WT P-Smad5 gradient are small grey dots. We plot solutions as large circles colored according to their mechanism, which is based on definitions outlined in Figure 4C: counter-gradient (red), source-sink (blue), transcriptional (orange), or shuttling (green). We plotted additional shuttling solutions in order to better illustrate trends. (A–F) Simulations using domains displayed in Figure 4D. (G–L) Simulations using domains displayed in Figure 4E. (A,G) BMP diffusivity vs. BMP decay rate. (B,H) Chd diffusivity vs. Chd decay rate, which includesthe rate of Chd cleavage by Tld. (C,I) Range was estimated as sqrt(diffusivity/decay). (D,J) Diffusivity of BMP bound to Chd vs. decay rate of BMP bound to Chd. (E,K) Range of Nog protein. (F,L) Chd and BMP-Chd cleavage rate by Tld.
For the simulations performed where the bmp expression domain matched the signaling gradient, distinct biophysical requirements were also observed for each mechanism. The source-sink mechanism required BMP to have a high range, while the transcriptional mechanism required BMP to have a lower range (Figure 5I). The source-sink mechanism required either high diffusivity with predominantly high decay rates or low diffusivity with low decay rates, while the transcriptional mechanism filled a near complementary parameter space with progressively higher BMP diffusivity necessitating higher decay rates (Figure 5G), which allows the P-Smad5 gradient to match the bmp expression profile. Neither of these mechanisms constrained Chordin range (Figure 5H,I). Although only four shuttling mechanism solutions were identified, they required both BMP-Chordin range to be high and its decay rate to be low (Figure 5J). The shuttling solutions also required BMP range to be high (Figure 5G,I), because if Chordin moved ventrally to bind BMP in this scenario, it would interfere with the bmp expression gradient matching the BMP signaling gradient. In these simulations BMP moves dorsally to form the BMP-Chordin species that ultimately is shuttled back ventrally. The remaining parameters required for shuttling were similar for the two simulations (Figure 5E,F,K,L).
To determine whether Chordin shuttling of BMP ligand plays a functionally relevant role in generating the ventral P-Smad5 peak in zebrafish, as it does in Drosophila, we quantified the P-Smad5 gradient of chordin mutant embryos over a developmental time series (Figure 6A,B). If it does play a role, then we expect the ventral P-Smad5 peak to be reduced in chordin mutants compared to WT embryos. We found that the P-Smad5 gradient in chordin mutants showed a statistically significant increase in lateral regions of the embryo at the four time-points examined from 4.7 to 6.3 hpf (Figure 6C–F, Figure 6—figure supplement 1A). Importantly, no decrease in P-Smad5 was observed in the ventral region of chordin mutant embryos or in any region of the gradient. These results indicate that, unlike the Drosophila homolog Sog, Chordin plays no significant BMP shuttling role during zebrafish DV patterning. It is worth noting that in many simulations, small amounts of BMP ligand are shuttled short distances but do not impact the gradient significantly, and thus are not classified as shuttling. The P-Smad5 gradient in chordin mutants shows that this is minimal in zebrafish.
Effect of Chd on gradient shape and ligand shuttling.
(A,B) Animal views of average intensities from each time-point in (A) WT (4.7: N = 3, 5.3: N = 4, 5.7: N = 13, 6.3: N = 11) and (B) chd mutant (4.7: N = 3, 5.3: N = 5, 5.7: N = 11, 6.3: N = 9) embryos. (C–F) Average marginal intensities for WT (blue) and chd mutant (red) embryos from 5.7 to 6.3 hpf. (G) Average marginal intensities for WT (blue, N = 4) and bmp2/7 RNA injected embryos at 5.7 (grey, N = 4) and 6.3 hpf (black, N = 5). Error bars indicate standard deviation. (H,I) Fully ventralized (V5) embryos injected with 6 pg of bmp7a RNA and 12 pg of bmp2b RNA vs uninjected WT siblings. (J) WT (N = 9) vs chd+/- (N = 10) at 5.7 hpf.
Interestingly, the loss of chordin did not cause an increase in the ventral-most P-Smad5 peak level either (Figure 6C–F,S1A), suggesting that Chordin does not actively block BMP signaling there. However, Smad5 or another signal transducing component could be limiting in the ventral-most cells of WT embryos, rendering them unresponsive to further increases in free ligand. To investigate this possibility, we overexpressed Bmp2/7 ligand in WT embryos at a level that fully ventralizes (V5) them at 24 hpf (Figure 6H,I). We quantified P-Smad5 at 5.7 and 6.5 hpf and found that the gradient showed a significant increase in signaling embryo-wide over WT siblings, including in the ventral-most region (Figure 6G). These results indicate that BMP signaling in ventral regions is not saturated in WT embryos and that Chordin does not regulate the peak P-Smad5 levels by promoting or inhibiting signaling at these stages.
We next tested whether the P-Smad5 gradient is robust to heterozygosity of chordin. The Drosophila P-Mad gradient shows some small changes in sog heterozygotes (sog is the chordin homolog) compared to WT (Eldar et al., 2002; Umulis et al., 2010). In zebrafish chordin heterozygotes do not show any DV patterning phenotype at 24 hpf (Hammerschmidt et al., 1996). Consistent with this, we found that the chordin heterozygous and WT BMP signaling gradients were indistinguishable at 5.7 hpf (Figure 6J). Therefore, the BMP signaling gradient in zebrafish is robust to chordin heterozygosity and to a potential 50% decrease in Chordin levels, but not to the complete loss of Chordin.
We then constrained the mathematical model-based computational screen with the WT, the chordin mutant and heterozygote P-Smad5 gradients at 5.7 hpf, assuming that heterozygotes have half the Chordin level of WT. We determined which mechanisms and simulations remained compatible with these new results (Figure 7A,B). We eliminated simulations that deviated by more than 8% from the chordin heterozygous or homozygous P-Smad5 gradients (Figure 7C–D). Many mathematical model simulations that fit the WT BMP signaling gradient no longer fit our chordin heterozygous and homozygous mutant data. Of the 15,142 simulations that fit the WT gradient alone, only 4059 fit the WT, chordin +/-, and chordin mutant gradients (Figure 7E–E’). Of those, all were either source-sink or counter-gradient mechanisms (Figure 7E’). All simulations classified as shuttling had chordin LOF BMP distributions that deviated from the measured chordin mutant P-Smad5 gradient by more than 17% (Figure 7C). Many, but not all, simulations classified as counter-gradient deviated by more than 8% in their BMP distributions from the measured chordin heterozygous P-Smad5 gradient (Figure 7D). Fitting the chd LOF and chd heterozygous data eliminated more counter-gradient than source-sink solutions, with 28% of the source-sink solutions remaining but only 15% of the counter-gradient solutions remaining.
Biophysical values of individual simulations that fit both the WT and chd LOF P-Smad5 gradients.
(A) BMP distributions of 5 individual modeling solutions (WT: black dotted lines, chd LOF: grey dotted lines) plotted against WT (blue line) and chd LOF (red line) 5.7 hpf P-Smad5 gradients. Error bars indicate standard deviation of experimental P-Smad5 intensity. (B) BMP distributions of 5 individual modeling solutions (WT: black dotted lines, chd +/-: grey dotted lines) plotted against WT (blue line) and chd +/- (green line) 5.7 hpf P-Smad5 gradients. Error bars indicate standard deviation of experimental P-Smad5 intensity. (C,D,F–J,L, M) 1000 randomly selected parameter combinations capable of fitting both the WT data, chd +/-, chd LOF data classified by mechanism. Larger circular points fit the WT P-Smad gradient and are colored based on their mechanism according to the definitions outlined in Figure 4C: counter-gradient (red), source-sink (blue), transcriptional (orange), or shuttling (green). Combinations that failed to fit the WT P-Smad5 gradient are small grey dots. (C–D) Normalized Root Mean Squared Deviation (NRMSD) between the measured P-Smad5 and the model BMP distributions. Black dotted lines mark the 8% threshold. (C) Comparing WT and chd LOF. (D) Comparing WT and chd +/-. (E) Parameter combinations that fit both the WT and chd LOF data (blue) and those that failed to do so (grey). (E’) parameter combinations were classified to have a source-sink (blue), counter-gradient (red), or shuttling (green) mechanism. (F–J) Simulation using the bmp expression domain displayed in Figure 4D. (L,M) Simulation using the bmp expression domain displayed in Figure 4E. (F,L) BMP diffusivity vs. BMP decay rate. Green dotted line marks the BMP diffusivity we measured using FRAP (4.4 µm2/s). (G,M) Range was estimated as sqrt(diffusivity/decay). (H) Chd diffusivity vs. Chd decay rate plus the rate of Chd cleavage by Tld. (I) Rate of Chd cleavage by Tld vs rate of BMP-Chd cleavage by Tld. (J) BMP-Chd diffusivity for source-sink and counter-gradient simulation solutions. (K) Pie chart showing the parameter combinations that fit the WT data (blue) or failed to do so (grey) for the alternative scenario where the bmp expression domain mirrors the measured P-Smad5 gradient (Figure 3I). (K’) Pie chart of the solutions that had a source-sink (blue), counter-gradient (red), transcriptional (orange), or shuttling (green) mechanism.
The remaining mechanisms required different and specific combinations of biophysical parameters. The source-sink solutions required a high BMP range of 60+ µm with a diffusivity above 1 µm2/s (Figure 7F,G). The counter-gradient mechanism required a lower BMP range, less than 60 µm, a high Chordin range above 40 µm with a diffusivity above 2 µm2/s (Figure 7G,H). Consistent with this, very high rates of Chordin cleavage by Tolloid restricted Chordin range and therefore was not compatible with the counter-gradient mechanism (Figure 7I). While BMP diffusivity needed to be high in source-sink solutions, BMP-Chd diffusivity was not restricted in either the source-sink or counter-gradient solutions (Figure 7J).
We then tested whether the transcriptional mechanism could also fit the chordin mutant data. We used the simulation in which the bmp expression profile matched the WT P-Smad5 gradient (Figure 4E). Of the 148,646 simulations that fit the WT data alone, 227 fit the WT, chordin heterozygous, and chordin mutant gradients, all of which were source-sink (Figure 7K,K’). These source-sink simulations required a high BMP diffusivity and range (Figure 7L,M), similar to what was observed in the simulation with the measured bmp expression profile (Figure 7F,G). However, while 83,747 simulations fit a transcriptional mechanism with the WT data alone, none fit the WT, chordin heterozygous, and chordin mutant gradients (Figure 7K,K’). This is because only a change in the bmp expression domain in the chordin mutant allows a transcriptional mechanism to fit both the WT and chordin mutant data.
The bmp expression domain is known to become responsive to BMP signaling, creating a positive feedback loop during gastrulation (Hammerschmidt et al., 1996; Nguyen et al., 1998; Schmid et al., 2000). Gastrulation begins in zebrafish at 6 hpf. While the initial bmp expression domains are established independently of BMP feedback, a BMP feedback loop becomes active with reported onset times ranging from ~5.5 to 6.5 hpf (Kishimoto et al., 1997; Miller-Bertoglio et al., 1999; Ramel and Hill, 2013; Schmid et al., 2000). To test whether the bmp expression domain changes in chordin mutants at 4.7 to 5.7 hpf, we compared the bmp2b domain size in sibling chordin-/- and chordin +/- embryos (Figure 3D,E). chordin heterozygotes display a WT phenotype (Hammerschmidt et al., 1996; Miller-Bertoglio et al., 1999) and we found that they also display a WT P-Smad5 gradient (Figure 6J). There was no discernable difference in the bmp2b domain size at 4.7, 5.3, or 5.7 hpf (Figure 3D,E), indicating that bmp transcriptional feedback is not active before 5.7 hpf. Similarly, the noggin expression domain size did not change in chordin mutants before 5.7 hpf (Figure 3C). Therefore, the increase in BMP signaling activity observed already at 4.7 hpf in chordin mutants (Figure 6A–C) precedes a change in bmp expression, showing that the transcriptional mechanism cannot account for the P-Smad5 gradient profiles prior to 5.7 hpf. We observed a change in bmp2b expression by 7 hpf, consistent with previous findings that bmp transcriptional feedback activates after gastrulation begins (Figure 3D’’’,E’’’) (Kishimoto et al., 1997; Miller-Bertoglio et al., 1999; Ramel and Hill, 2013; Schmid et al., 2000).
The combination of WT and chordin mutant P-Smad5 gradients limits the number of computationally-derived model simulations and, importantly, reduces the number of mechanisms to two: source-sink and counter-gradient. We and others have largely purported the counter-gradient mechanism as acting in vertebrate DV patterning (Blitz et al., 2000; Hama and Weinstein, 2001; Little and Mullins, 2006; Sasai and De Robertis, 1997; Thomsen, 1997). To our surprise, the source-sink modeling simulations emerged more frequently within our computational screen than the counter-gradient simulations (Figure 7E’). To test the source-sink mechanism further, we investigated BMP ligand diffusivity, a biophysical parameter that must be high in this mechanism (Figure 7F). To test if BMP diffusivity excludes or supports the source-sink mechanism, we measured the effective diffusivity of the Bmp2b ligand using fluorescence recovery after photobleaching (FRAP).
We tagged Bmp2b by inserting the coding sequence of the fluorescent protein Venus between the pro- and mature coding domains of bmp2b. When mRNA of bmp2b-venus was injected into 1-cell stage zebrafish embryos, we detected both the pro- and mature domains of Bmp2b-Venus protein on a western blot (Figure 8A, black arrows, n = 3). We did not detect protein with a molecular weight equal to Venus alone in the embryos injected with bmp2b-venus, indicating that the Venus tag was not cleaved from Bmp2b during post-translational processing (Figure 8A, red arrow). The Venus tag did not interfere with Bmp2b activity, since the injected mRNA significantly ventralized WT embryos (Figure 8B, Row 1). To further assess the activity and range of the Bmp2b-Venus chimera, we tested if Bmp2b-Venus could rescue embryos deficient in Bmp2b. As previously reported for bmp2b RNA (Nguyen et al., 1998), we could rescue Bmp2b deficient embryos to a WT phenotype by injecting bmp2b-venus RNA (Figure 8B, Rows 5–7).
Measuring Bmp2b-Venus diffusivity via FRAP.
(A) Detection of Bmp2b-Venus and secreted Venus proteins by western blot. Embryos were injected with bmp2b-venus mRNA (250 pg) or secreted-Venus mRNA (200 pg) at the one-cell stage. Protein lysates were prepared at late blastula stage. In the Bmp2b-Venus overexpression sample, two major protein bands were detected by Venus antibody (black arrows). The larger molecular weight protein is the pro- and mature domains of Bmp2b with Venus protein (669 amino acids (AA),~74 KDa). The smaller protein is the mature domain of Bmp2b with Venus protein (376 AA,~41 KDa). The secreted Venus protein (248 AA,~27 KDa) is also detected in the secreted-Venus overexpression sample (red arrow). β-actin was used as a loading control. (B) 24 hpf phenotypes of embryos injected with the bmp2b-venus construct used for FRAP experiments, controls, and rescue. Dorsalization was classified as C5: Loss of all ventral structures; C4-C3: Loss of, or truncated tail; C2-C1: Loss of ventral tail fin. Ventralization is classified as V1: reduction is eye size; V2-V3: the eyes, notochord, and anterior brain are partially or completely absent; or V4-V5: complete loss of all dorsal structures. Fluorescent BMP-Venus (C) or Venus (D) recovery after photobleaching for 20 min. (E–G) Plots of fluorescent intensity recovery in the extracellular region. Bold lines are mean curves, thin lines are raw intensity data. (H) BMP diffusivity vs. BMP decay rate for simulations that fit WT, chd +/-, and chd -/- P-Smad5 profiles and were within 2 µm2/s of 4.4 µm2/s. Large blue circles are simulations classified as source-sink, red are counter-gradient, and small grey dots failed to fit the measured P-Smad5 profiles. (I) The mean BMP and Chd concentrations in all solutions that fit the WT, chd-/-, and chd +/- P-Smad5 data and within a diffusivity of 2.4 and 6.4 µm2/s that are also robust to uniform Chd production.
To perform the FRAP, we injected bmp2b-venus mRNA into a single blastomere at the 8 cell stage (Figure 8B, Row 3) and then photobleached a 160 µm cube of cells in 4.3 hpf embryos (Figure 8C). We then measured recovery of fluorescence over one hour. To ensure we only recorded extracellular Bmp2b-Venus, we photobleached a region away from the cells producing Bmp2b-Venus. The bleached region recovered fluorescence to its initial level in ~30 min (Figure 8C,E), corresponding to a measured Bmp2b-Venus effective diffusivity of 4.4 ± 0.4 µm2/s (SEM (standard error of the mean), n = 5). To ensure that we were only measuring the diffusivity of Bmp2b-Venus alone and not Bmp2b-Venus bound to Chordin, we repeated the FRAP experiment in Chordin deficient embryos (Figure 8B, Rows 3–4). Again, the bleached region recovered fluorescence to its initial level in ~30 min (Figure 8F), corresponding to a measured Bmp2b-Venus effective diffusivity of 4.0 ± 0.5 µm2/s (SEM, n = 5). To determine the extent to which Venus limited Bmp2b diffusion, we measured the diffusivity of Venus alone. The bleached region recovered fluorescence much more rapidly, and neared its initial level in 5 min (Figure 8D,G), corresponding to a measured Venus effective diffusivity of 16.3 ± 2.2 µm2/s (SEM, n = 5). This faster rate of Venus diffusion indicates that it per se does not reduce BMP2 diffusion.
A measured BMP diffusivity of ~4 µm2/s fits a large portion of the source-sink modeling simulations. In fact, 1421 source-sink simulations have diffusivities within 2 µm2/s of our measured diffusivity (Figure 8H). In contrast, only 31 counter-gradient simulations were within 2 µm2/s of our measured diffusivity, and these simulations have very high BMP decay rates (above 10−3/s) (Figure 8H). A decay rate of that magnitude would cause the half-life of BMP ligand in the embryo to be very short, <10 min for decay rates above 1 × 10−3/s. We can infer the BMP lifetime in the embryo based on our previous studies. We found previously that a pulse of injected BMP ligand protein in a bmp deficient embryo sustains P-Smad5 for at least 1.5 hr after injection (Little and Mullins, 2009). In another study, we found that P-Smad5 can persist for a maximum of 40–60 min in the absence of BMP signaling (Tucker et al., 2008). Thus, P-Smad5 persistence 1.5 hr after a BMP protein pulse indicates that the ligand remains for at least 30 to 50 min after injection, if P-Smad5 can persist for 40–60 min in the absence of signaling. A BMP ligand lifetime of 30 to 50 min is inconsistent with the low BMP half-lives required for the counter-gradient simulations, but consistent with the BMP half-lives of source-sink simulations (Figure 8H), suggesting that the source-sink mechanism much more likely establishes the BMP signaling gradient patterning the zebrafish DV axis.
Finally, we asked whether the source-sink and counter-gradient mechanisms are robust to uniform chordin expression. Uniformly expressing chordin by mRNA injection into one-cell stage chordin mutant embryos has been used to rescue chordin mutant embryos to adulthood (Fisher and Halpern, 1999), including in our study here. We simulated the system with ubiquitous Chordin production and determined that 426 of the 1452 solutions that fit our WT, chordin-/-, and chordin +/- data with a BMP diffusivity within 2 um2/s of our measured 4.4 um2/s retain a WT BMP gradient when Chordin is uniformly produced. We did not titrate the Chordin production rate, but had we done so, more simulations may have fit. Interestingly, the 426 remaining solutions are all source-sink mechanisms with gradients of Chordin that are high dorsally and low ventrally (Figure 8I).
Our results show that the BMP signaling gradient patterning the zebrafish DV axis is markedly different from the one patterning the Drosophila DV axis. The zebrafish BMP signaling gradient is broad, reaching half of its maximum at ~40% of the total DV axis length (Figure 2F). In contrast, the Drosophila gradient is incredibly steep, reaching half of its peak at only ~10% of the total embryo DV axis length (Figure 9A) (Peluso et al., 2011; Sutherland et al., 2003). Similarly, the loss of the main BMP antagonist in either organism, Chordin or Sog, causes markedly different effects on the BMP signaling gradient (Figure 9A) (Mizutani et al., 2005; Peluso et al., 2011; Sutherland et al., 2003).
Comparing Zebrafish and Drosophila-like solutions.
(A) Depiction of the BMP gradients patterning the Drosophila and zebrafish DV axis. The Drosophila DV axis has been flipped to match the zebrafish. Solid lines are WT. Dotted lines are chd or sog LOF. (B) List of homologous proteins involved in DV patterning of zebrafish and Drosophila. (C–F) Solutions able to fit WT and chd LOF zebrafish data (blue) vs. solutions capable of fitting Drosophila-like WT and Drosophila-like sog LOF gradients (red). Parameter combinations that failed to fit either are represented as small grey dots. (C) Chd diffusivity vs. Chd decay rate, which includes the rate of Chd cleavage by Tld. (D) Diffusivity of BMP bound to Chd vs. decay rate of BMP bound to Chd. (E) Range was estimated as sqrt(diffusivity/decay). (F) Cleavage rate of Chd and BMP-Chd by Tolloid. (G) BMP diffusivity vs. BMP decay rate.
Zebrafish and Drosophila DV patterning differ in both length-scale and time-scale. The Drosophila embryo has a 250 µm half-circumference, while the zebrafish embryo has a 700 µm half-circumference. The zebrafish gradient is established gradually in ~2–3 hr and maintained for several hours (Ramel and Hill, 2013; Tucker et al., 2008), whereas the Drosophila BMP signaling gradient is established and patterns DV tissues in ~1 hr (Dorfman et al., 2001; Wang and Ferguson, 2005). Given these differences, we sought to determine if Drosophila-like shuttling simulations could exist with zebrafish time- and length-scales, and if so, how the biophysical parameters of the components would differ from those consistent with the WT and chordin mutant P-Smad5 gradients (Figure 7).
In the 1,000,000 random simulations tested, we found many simulations that could generate a steep gradient with extensive shuttling in zebrafish. Simulations were considered to be Drosophila-like if their WT gradient reached its half-maximum <10% of the total embryo circumference and the ventral peak of the chordin mutant was 50% lower than the ventral peak level of the WT curve (Mizutani et al., 2005). We found 251 simulations that fit the Drosophila-like WT and chordin mutant signaling gradients. We also excluded simulations with excessive BMP-Noggin interaction, as Drosophila does not possess noggin homologs (Figure 9B).
The Drosophila-like simulations required a very mobile Chordin and BMP-Chordin species. Drosophila-like simulations required Chordin to have a high range to move to encounter the BMP in the ventral region (Figure 9C,E). Similarly, BMP-Chordin needed to have a high range so it could be shuttled a sufficient distance towards the ventral-most region of the embryo (Figure 9D,E). The cleavage of free Chordin by Tolloid needed to be low to allow Chordin range to remain high (Figure 9F). Conversely, the cleavage of bound Chordin needed to be high to release the BMP from Chordin (Figure 9F). Chordin range must be high to allow the formation of a counter-gradient to block signaling in the lateral regions of the embryo (Figure 9E). Conversely, BMP range was relatively unrestricted in Drosophila-like simulations, as the shuttling mechanism relies more on BMP-Chordin mobility than BMP mobility (Figure 9G).
Here we have quantified the BMP signaling gradient in WT and chordin zebrafish mutants by measuring with high precision the P-Smad5 immunofluorescence level in all ~8,000 + nuclei of an embryo, with high reproducibility within and between embryos at multiple developmental stages. We then used these data to inform a computational model-based screen of over 1,250,000 combinations of biophysical parameters of the major extracellular BMP modulators. We defined mathematical criteria to distinguish between four widely proposed mechanisms to set up the BMP signaling gradient. Our computational model-based screen excludes the shuttling and transcriptional mechanisms as possibilities for establishing our measured WT and chordin mutant P-Smad5 profiles, providing compelling evidence that the BMP signaling gradient patterning the zebrafish DV axis is established by either a counter-gradient or source-sink mechanism. We further determined that the effective diffusivity of the BMP ligand in the zebrafish embryo is relatively fast, consistent with 1421 source-sink simulations but only 31 counter-gradient ones (Figure 8H). Comparison of models that satisfy zebrafish or Drosophila-like gradient profiles suggests that the range of BMP-Chordin differs between zebrafish and Drosophila-like DV patterning mechanisms (Figure 9E), and the Drosophila-like patterning mechanism requires restricted Tolloid degradation rates for BMP-Chordin and Chordin, which were not observed for the zebrafish patterning mechanism (Figure 9F).
The shape of the BMP signaling gradient differs greatly between Drosophila and zebrafish DV patterning (Figure 9A). The parameters that drive the most significant difference between the Drosophila-like and zebrafish simulations are the mobility and processing rates of BMP-Chordin (Figures 7I and 9D,F). For shuttling to be possible in a system with a broad peak of signaling, as it is in zebrafish, the BMP-Chordin cleavage rate needed to be low enough to allow BMP-Chordin to move farther and distribute BMP over a larger region (Figure 5F,L). For shuttling to be possible in a system with a tight peak of signaling as it is in Drosophila, BMP-Chordin cleavage needed to be rapid to release BMP-Chordin over a smaller region (Figure 9F). We show that a shuttling mechanism is not functioning in zebrafish, indicating that this delicate balance of BMP-Chordin mobility and Tolloid cleavage has been lost or did not emerge in vertebrate DV patterning.
Sog and its vertebrate homolog Chordin differ in how they are processed by the metalloprotease Tolloid depending on whether it is bound to BMP ligand. Chordin can be cleaved by Tolloid whether bound to BMP ligand or not (Piccolo et al., 1997), while Sog is only cleaved when bound to BMP (Marqués et al., 1997). Interestingly, when Sog is mutated to allow it to be processed by Tolloid regardless of BMP binding, the shuttling of BMP-Sog complexes in flies is greatly reduced (Peluso et al., 2011), suggesting that this attribute of Sog is necessary for effective shuttling. However, surprisingly, we found numerous shuttling simulations in our zebrafish modeling-based screen with the opposite properties, high Chordin cleavage rates and low BMP-Chordin cleavage rates (Figure 5F,L). The requirement for preferential cleavage of BMP-Chordin by Tolloid only emerged when we screened for Drosophila-like simulations, in which shuttling was generating a tight peak of BMP signal (Figure 9A,F). This suggests that the preferential processing of BMP-Sog by Tolloid seen in Drosophila is not an inherent requirement of the shuttling mechanism, but may instead be a result of both the requirement to facilitate shuttling and to generate a steep gradient.
In Drosophila DV patterning, the BMP signaling gradient is so steep that its base falls well within the region of bmp expression, far from the sog/chordin expression domain (Figure 9A) (Francois et al., 1994; Holley et al., 1995). To suppress lateral BMP signaling and form the Drosophila-like simulations seen in our mathematical model-based screen (Figure 9A), Sog/Chordin needed to have a high range to diffuse far from its site of expression to inhibit BMP signaling over most of the bmp expression domain (Figure 9C,E). Therefore, the degradation of free Sog/Chordin by Tolloid needed to be low (Figure 9F). However, to generate a narrow peak of BMP signaling (Figure 9A), BMP-Chordin cleavage by Tolloid needed to be high (Figure 9F). Therefore, the requirement to preserve the range of action of free Chordin, combined with the requirement to rapidly cleave BMP-Chordin to generate a steep peak of signaling may explain why the preferential cleavage of BMP-Sog by Tolloid is needed for shuttling in Drosophila.
While the shuttling mechanism relies on the movement of the bound BMP-Chordin complex, the source-sink and counter-gradient mechanisms rely on the movement of unbound BMP and Chordin. The source-sink mechanism relies on BMP diffusing dorsally to bind Chordin. Conversely, the counter-gradient mechanism relies on Chordin diffusing ventrally to bind BMP. Consistent with this, we found that the majority of simulations consistent with the source-sink mechanism require a high BMP range and a high BMP diffusivity (above 1 µm2/s), while the counter-gradient mechanism requires a high Chordin range and high Chordin diffusivity (above 1 µm2/s) (Figures 5 and 7).
To illustrate the distinct manners by which a source-sink and counter-gradient mechanism would generate the zebrafish BMP signaling gradients observed, we graphically display in Figure 10 the relative contributions of BMP and Chordin diffusion and BMP-Chordin binding to gradient formation for the median simulations that fit our WT, chordin mutant, chordin +/-, and Bmp2b-Venus FRAP data. The primary differences between the source-sink and counter-gradient mechanisms manifest in the relative amount of Chordin protein that diffuses ventrally into the bmp expression domain and the primary role of Chordin in forming the BMP gradient. A counter-gradient mechanism leads to higher levels of Chordin that extend over a greater region of the ventral bmp expression domain compared to a source-sink mechanism (Figure 10A). Counter-gradient and source-sink mechanisms also differ significantly in where Chordin binds and inhibits BMP ligand activity along the DV axis, which is consistent with the distinct Chordin protein distributions (Figure 10A). In a counter-gradient mechanism Chordin binds BMP in a broader domain, extending over a much greater extent of the DV axis than in a source-sink mechanism (Figure 10B,C). In a source-sink mechanism, Chordin binds BMP largely in dorsal regions and extends little ventrally, effectively generating a driving force for the movement of BMP (Figure 10B,C). This dorsal sink of Chordin leads to a diffusive flux of BMP ligand down its concentration gradient (Figure 10C) that largely shapes the BMP signaling profile in a source-sink mechanism (Figure 10C).
How the source-sink and counter-gradient mechanisms shape the gradient.
(A) The mean BMP and Chd concentrations in all source-sink and counter-gradient solutions fitting WT, chd LOF, and chd heterozygous P-Smad5 data and within a diffusivity between 2.4 and 6.4 µm2/s. (B) The diffusive flux divided by the decay [(DBMP/decBMP)*(d[BMP]/dx)*(1/[BMP]max)] of BMP (blue) with units of 103*µm and rate of binding of BMP to Chd (kon*[BMP]*[Chd]) (red) with units of 3.6*10−2*sec−1 for representitive (B) Counter-Gradient and (C) Source-Sink solutions fitting WT, chd LOF, and chd heterozygous P-Smad5 data and within a diffusivity between 2.4 and 6.4 µm2/s (Figure 8).
Importantly, gradient formation by either of these mechanisms need not be exclusive, and instead characteristics of each can contribute to some extent in shaping sectors of the other’s gradient. In the source-sink simulation in Figure 10A,C, Chordin forms a small counter-gradient partially contributing to the gradient shape in this region. Thus, in some source-sink simulations, Chordin shaped the gradient by simultaneously binding ligand to block signaling in lateral positions and by establishing a sink that serves as a driving force for the diffusive flux of ligand from ventral positions dorsally towards the regions of higher Chordin. Though each solution is classified by the dominant mechanism, many share some aspects of both the source-sink and counter-gradient mechanisms.
We measured BMP diffusivity for the first time in vertebrates. Using FRAP, we show that BMP can diffuse relatively freely with a diffusivity of 4.4 ± 0.4 µm2/s (Figure 8E), about 4-fold less than secreted Venus diffusion in the zebrafish blastula (≈16 µm2/s) (Figure 8G). Our measured BMP diffusivity is comparable to the diffusivity of Squint (Ndr1, D = 3.2 µm2/s), another TGF-β ligand in the zebrafish blastula that acts as a long-range mesoderm inducer (Müller et al., 2012). This high BMP diffusivity is consistent with previous BMP heterodimer protein injections into the extracellular space of BMP-deficient embryos, which could extend throughout the embryo and restore the WT P-Smad5 gradient within 1.5 hr, suggesting the BMP ligand can move rapidly (Little and Mullins, 2009).
Our computational screen found hundreds of simulations with a BMP diffusivity near 4.4 µm2/s. The vast majority of those simulations were classified as having a source-sink mechanism. The remaining few are classified as having a counter-gradient mechanism. This paucity of counter-gradient simulations is a reflection of the fine-tuning needed for this mechanism to work as compared to the source-sink mechanism. The counter-gradient mechanism requires a specific balance of Chordin diffusivity and decay as well as Tolloid degradation, while the source-sink mechanism does not (Figure 7H,I). Together, this suggests that the source-sink mechanism is more robust to changes in biophysical parameters than the counter-gradient mechanism, but does not rule out the counter-gradient mechanism entirely.
The recent observation that bmp2b and bmp7a are expressed in a graded manner in WT embryos has lead to the hypothesis that the BMP signaling gradient may largely reflect the bmp expression gradient (Ramel and Hill, 2013). We sought to determine if the BMP signaling gradient in zebrafish is predominantly established by matching the bmp expression gradient. Three results do not support this hypothesis. First, the relative shape of the bmp2b expression domain (Figure 3) did not precisely match the P-Smad5 gradient (Figure 2). Second, we mathematically defined a gradient established by a transcriptional mechanism as one where 80% of the BMP accumulates or is degraded where it is produced, as opposed to binding antagonists or diffusing away. When we performed a mathematical model-based computational screen using a bmp expression profile that reflected the P-Smad5 WT gradient, no tested parameter combination fit both our measured WT and chordin LOF P-Smad5 gradients. For the transcriptional mechanism to work, the bmp expression domain would have to change in the chordin mutant condition to fit the mutant gradient profile.
Finally, we showed that feedback by BMP signaling on bmp expression does not begin until after 5.7 hpf. This is likely because the initial bmp expression domain is established by maternal factors and repression from Bozozok, a transcription factor activated by maternal Wnt signaling (Koos and Ho, 1999; Langdon and Mullins, 2011; Leung et al., 2003; Solnica-Krezel et al., 2001). FGF (Fibroblast Growth Factor) and Nodal signaling also repress bmp expression dorsally (Fürthauer et al., 2004; Kuo et al., 2013; Maegawa et al., 2006; Shimizu et al., 2000; Varga et al., 2007). Importantly, BMP signaling does not play a role in the initial establishment of the bmp and chordin expression domains at 4 hpf, as both are unchanged prior to ~6 hpf in BMP pathway mutants (Kishimoto et al., 1997; Miller-Bertoglio et al., 1997; Schmid et al., 2000). At or after ~6 hpf, the bmp expression domain begins to respond to changes in BMP signaling levels, as bmp expression decreases in BMP pathway mutants and increases in BMP antagonist mutants (Kishimoto et al., 1997; Miller-Bertoglio et al., 1999; Nguyen et al., 1998; Ramel and Hill, 2013; Schmid et al., 2000). We show that the bmp2b expression domain does not begin to shift in response to the loss of chordin until after 5.7 hpf (Figure 3), while the P-Smad5 gradient shifts as early as 4.7 hpf (Figure 6).
While we show that the transcriptional mechanism cannot entirely account for the measured P-Smad5 WT, chordin +/-, and chordin -/- profiles, the shape of the transcriptional gradient does still contribute to gradient shape. Four-fold more individual solutions fit the WT, chd +/-, and chd -/- P-Smad5 profiles when the bmp expression input matched our measured bmp2b level (0.4%) than when bmp expression was set to match the P-Smad5 profile (0.1%) (Figure 7E,K). Counter-gradient solutions only appeared when the bmp expression input was broader than the P-Smad5 profile (Figure 7E’,K’). More source-sink solutions were present when the bmp expression input was broader because BMP did not need to travel as far or fast (Figure 7F,G vs. Figure 7L,M) to reach the dorsal sink. Together, these effects show that the shape of the bmp expression domain contributes to BMP gradient formation even if it does not entirely account for it, similar to that found for the bicoid transcript and protein gradients that pattern the Drosophila AP axis (Little et al., 2011).
Although we and most others in the vertebrate field have contended that a Chordin (or BMP antagonist) counter-gradient drives formation of the BMP activity gradient in DV patterning, our studies here, intriguingly, suggest that an alternate source-sink mechanism may prevail. While the source-sink gradient mechanism is also modulated by Chordin, Chordin instead acts in a distinct manner as a sink, binding BMP ligand predominantly in dorsal regions, thus allowing a BMP diffusive gradient to form throughout most of the ventral half of the embryo. Key to deriving this alternate model was the integrated approach used that combined quantitative experimental analysis with computational modeling. Importantly, a role for Chordin in establishing a sink that drives gradient formation would not have been revealed to us had we not performed the mathematical model-based computational screen. By narrowing the compatible simulations successively with the WT, chordin +/-, and then chordin mutant P-Smad5 profiles, 15-fold more source-sink simulations than counter-gradient simulations perdured (Figure 7E’). Furthermore, the computational modeling also illuminated the BMP diffusivity parameter as one to further test the source-sink mechanism. Significantly, our measured Bmp2 diffusivity further supports the source-sink mechanism of gradient formation. Thus the seamless integration of quantitative experimental analysis with mathematical model-based computational screens has proved to be a highly successful approach to elucidating mechanisms of BMP gradient formation. Future studies will be required to definitively determine the mechanism and further test the source-sink and counter gradient models of BMP gradient formation.
WT zebrafish embryos were injected with mRNA at the 1-cell stage. bmp2b and bmp7a RNA were made using the SP6 MMessage Machine kit (Life Technologies AM1340). bmp2b or bmp7a cDNA in a pBluescript II KS-construct was linearized with NotI. To overexpress BMP, 6 pg of bmp7a RNA and 12 pg of bmp2b RNA were injected. Resulting embryos had a V5 fully ventralized phenotype at 24 hpf (Figure 6H,I).
Whole-mount in situ hybridizations were performed using RNA DIG probes as described using, chordin (Miller-Bertoglio et al., 1997) and noggin1 (Dal-Pra et al., 2006). RNA probes were generated using the Roche DIG RNA labeling kit (11277073910). Embryos were cleared in glycerol, and photographed using a Leica IC80 HD. Images were processed using ImageJ and MATLAB. In situs were stained with Anti-DIG-Alkaline Phosphatase (Roche 11093274910) and developed using BM Purple (Roche Life Sciences).
The sizes of the chordin and noggin expression domains were determined by image processing with MATLAB. Centerpoints of animal views of each embryo were determined by thresholding. The boundaries of the noggin and chordin expression domains relative to the center of the animal view were determined by a second threshold. These points were connected by line segments and the angle was measured (Figure 3A,B).
Fluorescence in situ hybridization (FISH) was performed on fixed cryosections using a RNAscope Fluorescent Multiplex Kit (Advanced Cell Diagnostics (ACD)). Embryos were fixed with 4% paraformaldehyde in PBS at 4°C overnight. Embryos equilibrate in 30% sucrose until they sink and incubated in fresh 30% sucrose for 3 days at 4°C. Cryosections (20 μm) at the marginal region were collected on slides, followed by air drying for 30 min at −20°C. In situ hybridization was performed according to the manufacturer’s instructions (ACD). A custom C2 probe was designed for bmp2b (#456471-C2). bmp2b probe was used at 1:10 dilution. Sections were stained for DAPI and images were acquired at 63 × oil objective using a Zeiss 800 upright confocal.
Relative intensity quantification of mRNA levels was performed on maximum intensity projections of 20 μm sections. Marginal cells were grouped into 10 degree intervals along the marginal circumference. Average intensity was quantified in each section using the MATLAB image analysis toolbox. Averaged bmp2b mRNA levels in 2.5 hpf embryos were used to measure background. We found equivalent intensity levels and distributions in the 2.5 hpf embyros and the dorsal bmp2b signal in Wt 5.7 hpf embryo suggesting limited to zero bmp2b expression in the dorsal region. For each cross-section, the right and left side of the distributions were averaged into a single ventral to dorsal profile.
Embryos were fixed overnight in 4% paraformaldehyde at 4°C, blocked in NCS-PBST (10% fetal bovine serum, 1% DMSO, 0.1% Tween 20 in PBS), and probed overnight with a 1:100 dilution of anti-phosphoSmad1/5/8 antibody (Cell Signaling Technology, #9511, discontinued), followed by a 1:500 dilution of goat anti-rabbit Alexa Fluor 647-conjugated antibody (Thermo Fisher Scientific, Rockford, IL; Cat# A-21244, RRID:AB_2535812). Embryos were mounted in BABB (benzyl alcohol (Sigma B-1042) and benzyl benzoate (Sigma B-6630), 1:2 ratio) and scanned using a Zeiss LSM 710 confocal microscope with a LD LCI Plan-Achromat 25x/0.8 Imm Corr DIC M27 multi-immersion lens. The oil-immersion setting was used to reduce Mie scattering distortion, spherical aberrations, and chromatic aberrations by minimizing refractive index (R.I.) mismatch between the lens oil (R.I. = 1.518), the coverslip, BABB (R.I.≈1.56), and the light scattering particles in the embryo (R.I.≈1.56). Fluorophore bleaching was greatly reduced by precise embryo orientation, reducing sample thickness, and by high scan speeds using a Zeiss LSM 710 confocal microscope. Nuclei were visualized with Sytox Orange (Molecular Probes) or Sytox Green (Molecular Probes).
Immunostained P-Smad5 embryos were processed and imaged as described above. We observed minimal photo-bleaching and spherical aberration (Figure 11A–C). We wrote a Matlab algorithm capable of identifying all 8000 + nuclei centerpoints in each embryo in 3D, removing populations unresponsive to P-Smad5 (such as yolk syncytial nuclei and dividing cells), and extracting the P-Smad5 intensities associated with each nucleus (Figure 11D–L). The resulting individual digital embryos (Figure 2A’–E’) from each condition were averaged together to generate large datasets from which embryo-wide P-Smad5 levels could be quantified in WT and mutant conditions (Figure 6A–B).
Quantifying nuclear P-Smad5 intensities embryo-wide.
(A) Marginal P-Smad5 intensity from a chd LOF embryo imaged twice. (B) Average P-Smad5 intensity drop-off from photo-bleaching of all nuclei in embryos imaged twice (N = 5). (C) There is minimal intensity drop-off due to spherical aberration, as shown by the average intensity of the nuclear DNA stain (Sytox Orange) versus distance from the coverslip (4.7: N = 3, 5.3: N = 4, 5.7: N = 13, 6.3: N = 11, 6.7: N = 4). (D) Maximum projection of an animal view of a single embryo. (E) Nuclei centerpoints (red dots) identified from the sytox nuclear stain (blue). (F) Measured centerpoint nuclear intensities displayed as a heatmap. (G) P-Smad5 is absent in dividing cells (red stain, yellow arrows). Dividing cells have bright condensed chromatin (green stain, yellow arrows). (H) Bright condensed chromatin was used to identify dividing cells. Cells with a 40% elevated DNA stain over the mean (red line) were eliminated from the analysis. (I) Lateral view of a single embryo. (J) Sparse Yolk Syncytial Layer nuclei below the margin are eliminated. (K) Single lateral slice depicting the elimination of remaining yolk syncytial layer nuclei and enveloping layer nuclei by subtracting the outer 15% of all nuclei (filled in circles) to leave only deep cell nuclei (open circles). (L) Lateral view of embryo after outer 15% has been eliminated.
Nuclear intensities of P-Smad5 were extracted from the stacks of images generated using Matlab algorithms (source code in Supplementary files 1).
The centerpoints of all the nuclei were located using the Sytox DNA stain. The ‘.lsm’ files were converted to ‘.tif’ files using ImageJ, and then imported into Matlab as 1024 × 1024 X Z multidimensional arrays. XY pixels were 0.55 um, Z pixels were 2.3 um. The images were then smoothed using a 9 × 9×3 kernel (most nuclei are 10 × 10×4 pixels large). Local minima and maxima were removed using the ‘imhmax’ and ‘imhmin’ functions. The remaining maxima were found using the ‘imregionalmax’ function on the entire 1024 × 1024 X Z array. Maxima closer together than six pixels were assumed to be in the same nucleus, and were combined. The remaining maxima were assumed to be the centerpoints of the nuclei (Figure 11E).
These centerpoints were used to extract P-Smad5 intensities on the P-Smad5 channel. P-Smad5 distribution in each nucleus was approximately uniform, so a small sphere within each nucleus was averaged to attain the P-Smad5 intensity. On the P-Smad5 channel, pixels within a spherical 6 × 6 × 3 kernel of each maxima were averaged.
Cell types unresponsive to Bmp signaling were removed. P-Smad5 appears to be uniformly distributed throughout the cytoplasm during cell division, making measurement impractical (Figure 11G). In dividing cells, chromatin condenses making DNA stains such as Sytox concentrated and bright. Cells with a bright DNA fluorescence staining above 140% of the mean DNA fluorescence were considered dividing and eliminated from the analysis. Extra-embryonic cells such as the Enveloping Layer (EVL) and the Yolk Syncytial Layer (YSL) did not appear to respond to BMP ligand the same way as the deep cells. These cell types are not patterned along the DV axis by BMP, and were eliminated from our analysis. To do so, sparse EVL cells located below the vegetal margin were eliminated by hand (Figure 11J). Next, the inner and outer layer of approximately 15% of the total cells was eliminated (Figure 11K,L). The remaining cells were assumed to be non-dividing deep cells.
Embryos of similar stages were then aligned and conformed to a template embryo of the same stage using Coherent Point Drift (CPD) (Myronenko and Song, 2010b). Embryos were aligned in the AP direction by fitting them to a sphere, finding a plane that spanned the marginal region, and rotating until that plane was aligned with the XY axis. Embryos were aligned in the DV direction using the embryonic shield as a morphological marker. Before 6 hpf, when the shield is not present, the embryos were aligned in the DV direction by fitting a polynomial regression to the P-Smad5 gradient around the margin and rotating until the max peak was ventral. Next, embryos were all aligned to a template using an affine CPD (Myronenko and Song, 2010b). This corrected for any distortions in embryo shape that may have occurred during fixation and staining.
Embryos from the same set were subjected to no normalization. Embryos stained and imaged on different days with different settings were normalized by multiplying the entire set by a single scalar value. To determine this normalization scalar, control WT embryos were always imaged in conjunction with each experimental condition. The scalar normalization value was determined by minimizing the sum of the error between the control WT embryos imaged on different days.
To generate marginal profiles, a 40 um thick band of cells around the vegetal margin was chosen for each embryo. Cells within that band were grouped into 10 degree intervals and averaged together to form 36 individual points. The left and right side of the gradient were averaged together into a single ventral to dorsal profile. For 3-D embryo-wide averages, all nuclei were projected onto a sphere fitting the embryo. The sphere was then divided into 4800 approximately equilateral triangles. All nuclei falling within each triangle were averaged together. Slopes were obtained by fitting a lowess fit to the averaged 3-D data’s spherical coordinates phi and theta using the ‘fit’ function in Matlab. To determine if the marginal gradients of WT and chordin mutant embryos were significantly different, two-tailed T-Tests were performed with a rejection of the null hypothesis at the 5% significance level (Figure 6, Figure 6—figure supplement 1A).We observed a difference in WT vs. chordin mutant embryos that was much larger than our observed embryo-to-embryo variability (Figure 6). Our t-tests confirmed that our sample sizes are sufficient to discern differences between the WT and chordin mutant embryos (Figure 6, Figure 6—figure supplement 1A).
For each set of parameters defined in the parameter vector, we solved the five non-linear partial differential equations (PDEs) for BMP ligand, Chordin, Noggin, and the complexes of BMP-Chordin, BMP-Noggin in MATLAB (Figure 4, Figure 4—figure supplement 1A). Equations were solved on the half-circumference, with ‘symmetry’ boundary conditions imposed on the first and last node-point in the spatial discretization. The half-circumference was discretized into 36 node points with equidistant spacing and the second order spatial derivative is discretized via the finite difference method. The production regions of BMP ligand, Chordin, Noggin, are specified along the nodes by mapping the spatial position to subsequent node position (Figures 3 and 4D,E, Table 1). Tld is treated parametrically as a function of position according to its domain of expression (Figure 4D,E,Table 1). Time-stepping of the simulation is handled by the adaptive solver ode15s with a relative tolerance set to 1e-9. The model is solved for the developmental window that spans from 3.5 to 5.7 hpf and all measurements of model error are calculated at 5.7 hpf.
For each model iteration, parameters were selected from a uniform distribution in log space that covered four orders of magnitude within the physiological range for each parameter. Each parameter was selected independently of the remaining parameters. Adaptive and subsampling methods that increase parameter selection in regions with high variance in model output were not used in our parameter selection for a number of reasons. Firstly, a parameter matrix is produced that is then subdivided across distributed computers to solve the PDEs to produce a stored file of model solutions and parameter vectors associated with the stored solution. For each parameter vector, the PDE system is converted into a set of 180 ordinary differential equations after discretization and dynamically solved for WT, chd−/−, nog−/−, and chd+/- conditions using the implicit solver ode15s. Ode15s is well suited to problems with numerical stiffness that arise during numerical screens with random parameters. Thus, for an ensemble of 1 million parameter vectors, the system of differential equations are solved four times to simulate the wt and mutant conditions, increasing the total model evaluations to 4 million. Following calculation of the model solutions for each parameter vector, post processing, sorting, and calculation of model fitness against the data is handled by a separate program that operates on the stored solutions. The separation of model evaluation from model analysis allows for much greater flexibility, the total number of simulation results, and an ability to add additional simulation results to existing simulations that have previously been computed. If a job is interrupted, the index and solutions up to the parameter index are stored and simulation jobs can be restarted at the last iteration point.
Random sampling is not susceptible to the ‘curse of dimensionality’ that is common to regular grid spacing methods allowing for more efficient estimation of the NRMSD landscape in Figure 7(C,D), and random points fill in the parameter space more evenly than regular grid spacing that forces evaluations of the model within the same parameter hyperplane (Caflisch et al., 1998). Figure 7C,D demonstrates the dense coverage and sampling to estimate the NRMSD values and dense coverage in regions with acceptable NRMSD values. Random sampling of the biophysical parameters is common to these types of problems (Eldar et al., 2002; von Dassow et al., 2000).
For each parameter vector, the model is initially solved against WT conditions and subsequent simulations for mutant conditions are carried out for the same parameter vector by setting the corresponding production rates for the mutant to zero and re-simulating. Error between the model results and the fluorescent data are calculated via a two-step process. First, the amplitude of the P-Smad5 fluorescent-intensity data and model peak levels for free BMP are normalized as commonly done when calculating a residual with fluorescent intensity data (Hengenius et al., 2014; Pargett and Umulis, 2013). This approximation is valid considering that (1) BMP ligands are not saturating receptors and (2) Smad5 activity is not saturated (Figure 6G). The scaling parameter determined for model-fitness against P-Smad5 was then applied to the remaining model results to capture any changes in BMP levels in the mutant simulations. Residuals were calculated for WT and mutant conditions independently and simulations were scored for passing the WT and mutant conditions independently as opposed to using an aggregate residual. Simulations were classified as transcriptional, source-sink, counter-gradient, or shuttling.
Sequence encoding fluorescent protein Venus was amplified from pBSK12-her1:Ub2-Venus (a gift from Sharon L. Amacher, Ohio State University, OH) (Delaune et al., 2012). This sequence was inserted between the pro- and mature domains of Bmp2b, two amino acids downstream of the proprotein convertase (PC) cleavage site (REKR) with a GSTGTTGGG linker separating the prodomain and the fluorescent protein and a GS linker (GGGGSGGGGS) separating the fluorescent protein from the mature domain. This fusion construct was modified from pCS2(+)-HA-Bmp2b (Little and Mullins, 2009). Sequences encoding Venus protein were also fused to the pro-domain of Bmp2b two amino acids downstream of the proprotein convertase (PC) cleavage site (REKR) with a GSTGTTGGG linker, to generate the secreted-Venus plasmid that lacks the mature Bmp2b ligand domain.
Capped mRNA was synthesized using the mMessage mMachine Kit (Ambion) with SP6 RNA polymerase according to the manufacturer's protocol. Vectors were linearized by digestion with NotI. mRNA encoding the Bmp2b-Venus or secreted-Venus, was injected into one- or eight-cell stage embryos. For rescue experiments, 1 ng of bmp2b MO2 (GTCTGCGTTCCCGTCGTCTCCTAAG) was injected along with 9 pg of bmp2b-venus RNA from a different needle (Imai and Talbot, 2001). To perform FRAP in the absence of Chordin, we injected embryos at the 1 cell stage with 1 ng of chordin MO1 (ATCCACAGCAGCCCCTCCATCATCC) (Nasevicius and Ekker, 2000). Next, bmp2b-venus RNA was injected into a single blastomere at the 8-cell stage. Associated phenotypes are shown in Figure 8B.
Zebrafish embryos were lysed in Pierce RIPA buffer (89900, Thermo Scientific) supplemented with Halt Protease Inhibitor Cocktail (1862209, Thermo Scientific) and Phosphatase inhibitor Cocktail (1862495, Thermo Scientific). Protein samples mixed with Laemmli sample buffer (Bio-rad) were denatured by incubation for 5 min at 98o, and resolved by SDS-PAGE using Mini-PROTEAN TGX Gels (10%, Bio-rad) and transferred to PVDF membranes (Bio-rad). The membranes were blocked with 5% non-fat milk (Bio-rad) in PBST for 1 hr at room temperature, and incubated with primary antibodies in 2% BSA (Sigma) in PBST at 4°C overnight. After that, the membranes were incubated with HRP-coupled secondary antibodies for 1 hr at room temperature. Chemiluminescence was detected using Clarity Western ECL Substrate (Bio-rad) to obtain the image. Using stripping buffer (46430, Thermo Scientific), the membranes were reused to detect β-Actin as loading controls.
Fluorescence Recovery After Photobleaching (FRAP) mRNA encoding the Bmp2b-Venus fusion protein (50 pg) was injected at the one-cell stage to test the activity of the mRNA in a ventralization assay. Embryos used for FRAP were injected in one cell at the 8-cell stage. Embryos were mounted in 1% low melting point agarose (Sigma) in glass bottom microwell dishes (MatTek Corporation). FRAP experiments were performed using a LSM 800 confocal microscope (Zeiss) with a W Plan-Apochromat 20×/1.0 objective (D = 0.17 M27 75 mm). Photobleaching in a square region (160.4 μm × 160.4 μm) was performed through the depth of the blastoderm with 100% laser power for ~10 min. In the secreted Venus FRAP (Figure 8D), some recovery occurred at the t = 0 time point at the periphery of the bleached region. Recovery of fluorescence was monitored every 10 s in the same imaging plane.
From the 8-cell stage injected embryos, regions lacking Bmp2b-Venus producing cells (visualized by high intensity signal throughout the cytoplasm) were identified. Cells displayed characteristic higher intensity signals in the intercellular space and no signal was detected intracellularly in the non-producing cells. Images are taken before the FRAP experiment commences, and saved every 10 s during acquisition. All files are exported in lossless TIFF format for subsequent quantification in MATLAB. To measure the recovery, all TIFF files are imported into MATLAB and the FRAP region is identified for subsequent measurements. Internal FRAP region is scaled from 8-bit [0 255] to [0, 1] and an extracellular mask is generated by removing background with a minimum threshold level set at 1% of the image maximum value. This excludes the intracellular compartments from biasing the average intensity calculations for the extracellular recovery. With background removed, recovery is calculated as the average fluorescence intensity of the extracellular fluorescence within the masked region.
The FRAP region is modeled using a finite-difference equation for diffusion in the FRAP region. Diffusion was estimated by measuring model recovery starting from zero initial conditions and constant concentration boundary conditions. Masked region dimensions for measurement were mapped directly to node-points and distances in the finite difference model to compare and optimize recovery in the mask region. A steepest-descent optimizer with multiple starts was used to estimate the diffusion coefficient for each FRAP experiment. We did not explicitly model the occlusion and tortuosity of the diffusion process caused by the arrangement of cells, nor did it account explicitly for binding and unbinding to HSPGs and other immobile binding components. The impact of binding and the role of occlusions in the diffusion path are very well known (Cussler, 2009; Garnett, 1904). Therefore our measured diffusion coefficients are the effective diffusion coefficients in zebrafish and not an intrinsic measurement of the diffusion coefficient in a free environment.
All listed replicates in the figure legends are biological replicates.
For chordin and noggin domain size, all biological replicates are reported in Figure 3C, while representative images are shown in Figure 3A–B. All biological replicates were from a single cross stained with different probes. All embryos were reported with no elimination of outliers. For bmp2b expression profile, representative images are displayed for each condition and developmental stage. Biological replicates were taken from two experiments.
All biological replicates are indicated and averaged in Figure 2 and Figure 6 and associated legends. Biological replicates from the 4.7 and 5.3 hpf timepoints for the WT and chordin mutant embryos in Figure 2 and Figure 6 were from a single experiment. The 5.7 and 6.3 hpf timepoints were collected from 3 and 4 experiments respectively. The 6.7 hpf (WT-only) timepoint was collected from two experiments. In all cases, only embryos that were clearly damaged during the process were eliminated from the analysis. Mean intensities at each point were an average of a subset of the 8000 + nuclei present in each embryo. The XYZ coordinates and P-Smad5 values of all nuclei in all embryos used is attached as a supplemental file.
All biological replicates are shown in Figure 8E–G. No outliers were eliminated.
The ‘Image Analysis’ folder in Supplementary file 1 contains all files used to identify nuclei, align, and extract P-Smad5 intensities from the ‘.lsm’ files generated by confocal imaging. A Read-Me is included with details on how to use the scripts. A conceptual description can be found above in the materials and methods section. All raw XYZ coordinates and P-Smad5 intensities are included in the ‘P-Smad Intensities’ folder. Each embryo is represented as a five by n array, where columns 1–3 are XYZ coordinates, column four is nuclear stain intensity, and column five is P-Smad5 intensity.
Current Opinion in Genetics & Development 23:415–422.
Trends in Cell Biology 25:249–264.
News in Physiological Sciences 13:182–189.
Current Opinion in Genetics & Development 23:423–428.
Diffusion: Mass Transfer in Fluid Systems, 3rd edition.
Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences 203:385–420.
Inversion of the chordate body axis: are there alternatives?
Seminars in Cell & Developmental Biology 35:109–123.
Annual Review of Genetics 45:357–377.
Birth Defects Research Part C: Embryo Today: Reviews 78:224–242.
IEEE Transactions on Pattern Analysis and Machine Intelligence 32:2262-75.
IEEE Transactions on Pattern Analysis and Machine Intelligence 32:2262–2275.
Current Opinion in Genetics & Development 22:542–546.
Journal of Experimental Zoology 302:69–91.
Cold Spring Harbor Perspectives in Biology 1:a002519.
Methods in Molecular Biology 1245:243–256.
The International Journal of Developmental Biology 45:299–310.
Seminars in Cell & Developmental Biology 42:118–133.
Journal of Theoretical Biology 248:579–589.
Thank you for submitting your article "Systems biology derived source-sink mechanism of BMP gradient formation" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Robb Krumlauf as the Senior Editor. The reviewers have opted to remain anonymous.
The authors use quantitative imaging and modeling to come to the conclusion that a source-sink mechanism underlies the BMP/Chordin patterning system. This is novel as formation of a BMP gradient by a source-sink mechanism is distinct from previously reported models such as transcriptional, shuttling, or counter-gradient mechanisms. The measurement of BMP2 diffusion in vivo is novel. The topic is not only of broad interest but also quite controversial, and this study brings some much needed clarity to the field. The main weakness is the limited attempt to minimize the parameter space used for the modeling. Some of the measurements are difficult but there are several key measurements that need to be made. The computational and experimental analyses are incomplete, and some details of simulations have not been provided. For their model to be made more convincing a variety of concerns/comments should be fully addressed.
1) The source-sink model is puzzling in light of previous reports showing that zebrafish and Xenopus chordin mRNA injections at the one-cell stage can fully rescue zebrafish chordino mutants (Fisher and Halpern, 1999; Schulte-Merker et al., 1997). In these embryos, injected chordin mRNA is present throughout the embryo and yet, the rescued mutants develop normally to adulthood (and presumably form a normal BMP gradient). The mRNA rescue experiments also call into question the notion that the transcriptional pattern is critical for BMP gradient formation. The authors should discuss the various models in light of these reports.
2) Relevant to the above, did the authors measure the effective diffusion of BMP2 by FRAP in chordin mutant embryos? This will provide experimental evidence to test the models.
3) Cell numbers increase substantially between 4 and 7 hpf, when the authors report a steep increase in the BMP gradient. How does the change in cell number in the zebrafish gastrula (between 4-7 hpf) compare to that during fly DV patterning? To what extent does this account for the increase in gradient slope in zebrafish?
4) The authors state "The equations were simulated 1,000,000 times".
Table 1 lists 15 free parameters; therefore each parameter can, in principle, only take ~2.5 different values when combined randomly (2.52^15 is ~10^6). However, the plots in Figure 4 suggest that many more values have been chosen for individual parameters. The authors should clarify how the parameters were varied in the simulations.
5) The authors state "To our surprise, there are greater than 50 times the number of source-sink to counter-gradient modeling solutions (Figure 6B'), suggesting that the source-sink mechanism predominates." However, the number of different parameter combinations that can explain the data cannot be taken as a measure of support for a specific modelling solution. Different parameter combinations can result in similar solutions simply because the model is not identifiable or because it is difficult to find a unique solution when trying to fit the data directly.
6) If the authors already have or are making a BMP-destabilized GFP/degradFP fusion, precise measurement of BMP2 decay rates would be useful to distinguish between the models. If these are available it would be useful but not essential for the paper.
7) Why were the equations solved for the developmental window from 3.5 to 5.7 hpf and not from 4.7 to 6.7 hpf, when the pSMAD intensities were measured?
8) The authors presumably solved the equations in 1D in order to sample parameter space in a reasonable amount of time. I think it would add to the paper if the authors showed that the same parameters found to satisfy the 1D case would also set up the 3D P-Smad gradient when solving the equations in the hemispherical geometry of the zebrafish embryo as in Zhang, Lander, and Nie, J. Theor. Biol., 2007.
9) Can the P-Smad5 gradient of the chordin heterozygotes be included? Why are they "not shown"? Does the model fit the chordin heterozygote P-Smad5 gradient?
10) The pSmad5 measurements are impressive but the models ultimately rest on the BMP transcript and (active and inactive) protein expression profiles. I understand that there are no good antibodies to detect BMP but minimally, the authors need to use now standard quantitative fluorescent in situ hybridization approaches to measure BMP transcript distribution.
11) The BMP FRAP experiment goes a long way to reduce parameter space but why not also measure BMP diffusion in the presence of Chordin? This experiment seems trivial but would greatly help to test the shuttling model.
12) The characterization of the bmp2-venus chimera is too superficial. Does it have the same range and activity as wild-type bmp2?
The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below. In the absence of measurements of BMP diffusion in the presence of chordin or Chordin protein expression, the alternate model Zinski et al. suggest for BMP gradient formation cannot be substantiated. To support their clams, it is crucial that the authors:i) determine how the BMP gradient forms in the presence of uniform chordin ii) show expression of tagged BMP / Chordin proteins at early gastrula stages in mutants injected with RNA. iii) clarify how random sampling was done.
1) In response to how BMP diffuses in the absence and presence of chordin (previous review comments 2 and 11), in the revised Zinski m/s, the authors examined BMP diffusion without chordin. However, they did not examine BMP diffusion with uniform chordin. This is a crucial test of the model which is missing.
2) In their explanation of how their data and preferred model can explain the previous reports of rescue of chordino mutants with uniform chordin injections, Zinski et al. contend that chordin RNA injections likely do not generate uniform Chordin protein expression in embryos. But no evidence is provided to support this view – either experimentally or in their simulations. (The triple morphant is not relevant to the comment).
3) Regarding how parameters were varied in their simulations, the authors state that they prefer random sampling as opposed to a regular grid.
Did the authors refine sampling depending on the outcomes? If solutions did not change in a region in parameter space, did they increase the sampling density?
The ubiquitous expression of chordin RNA, which can rescue chordin mutant embryos, likely does not generate a ubiquitous distribution of Chordin protein due to the presence of Tolloid and Bmp1a, two ventrally expressed metalloproteases that degrade Chordin protein. The rescue of embryos lacking Chordin, Tolloid, and Bmp1a using chordin RNA injection at the one-cell stage has not been attempted as it is a difficult experiment to execute, but we hypothesize that it would not be effective. We agree that the chordin expression domain is likely not critical to BMP gradient formation.
We have now repeated our FRAP experiments in Chordin deficient embryos and have added it to the main text of the paper and Figure 8F. The effective diffusivity of Bmp2b-Venus in chd deficient embryos matched the effective diffusivity we had measured in WT embryos. This new experiment validates our previous assumption that the majority of BMP-Venus observed in our WT FRAP experiments was not bound to Chordin, as expected due to the ventralized embryonic phenotype at 24 hpf (Figure 8B row 2). However, performing the FRAP experiment in chd deficient embryos assures that 100% of Bmp2b-Venus observed is not bound to Chordin, removing the potential impact of a subpopulation of Chordin-bound Bmp2b-Venus on the FRAP measurements in WT embryos.
Fly DV patterning takes place during stage 5. Mitosis is paused during stage 5 until gastrulation begins at stage 6. Cells do not divide at this time, but nuclear localization of P-Mad increases from nearly none to a steep gradient in less than 1 hour from early stage 5 to early stage 6 when gastrulation begins. Thus, in this context while there are no changes in nuclei density, the gradient of PMad starts broad and refines to a higher amplitude and sharper profile . However, in the context of patterning the embryo termini in Drosophila via Torso RTK signaling, the nuclei are present in a syncytium in the absence of cell membranes, where the nuclear density plays a role in shaping the gradient of phosphorylated ERK at the termini . The nuclei density doubles with each successive division providing an increase in nuclear trapping of dpERK at the most terminal positions, resulting in a steeper gradient with higher peak amplitude and reduced gradient extent or length over time. The zebrafish embryo is not a synctium, so this same nuclear trapping mechanism could not occur. Moreover, the gradient DV length is constant over this time period, also inconsistent with this type of mechanism (Figure 2).
From our cell counts in embryos from a single timecourse (Figure 2H), we observe an approximately 70% increase in cell number from 4.7 to 6.7 hours post fertilization (hpf) and a 100% increase in nuclear P-Smad5 amount. Cell nuclei do not change significantly in size during this time . The increase in cell number occurs throughout the embryo and is not restricted to a particular DV region. So half of the 70% increase in cell number occurs in lateral and dorsal regions, where the slope does not change over this time period (Figure 2G). The increase in slope observed during the 2 hour period occurs over the ventral half of the embryo, which accounts for 35% of the increase in cell number, while the gradient peak doubles in amplitude. Thus an increase in cell number, via an unknown mechanism, could not account for the increase in slope. Additional support that cell number has little effect on gradient shape, we observed that the absolute number of cells at a given time point can vary by as much as 20% between different embryos within the same cross or between crosses (Figure 2I) with no detectable change in gradient shape or phenotype.
For each model iteration, parameters were selected from a uniform distribution in log space that covered four orders of magnitude within the physiological range for each parameter. Each parameter was selected independently of the remaining parameters. We prefer the coverage offered by this method, as opposed to a regular grid wherein each parameter has a set of discrete values and coverage at those values is complete. Random sampling is not susceptible to the “curse of dimensionality” that is common to regular grid spacing methods allowing for more efficient estimation of the NRMSD landscape in Figure 7(C,D), and random points fill in the parameter space more evenly than regular grid spacing that forces evaluations of the model within the same parameter hyperplane . Random sampling of the biophysical parameters is common to these types of problems [5, 6].
We agree with this point and have changed the sentence so it now reads: "To our surprise, the source-sink modeling solutions emerged more frequently within our computational screen than the counter-gradient solutions (Figure 7E'). "
We agree it would be useful, but these constructs are not currently available.
While dorsal-ventral cell fate for the head and trunk is largely specified from 4 to 7 hours post fertilization [7-10], bmp and chordin are first expressed after the mid-blastula transition (MBT) at 3 hpf [11-14]. We started our simulation at 3.5 hpf to account for the time needed for these proteins to be translated, folded, and secreted. We have now added that rationale to the manuscript.
We agree that this would add to the paper and the development of data-driven three dimensional models continues to be an effort of our work. We have made progress in developing data-driven 3D models and this is being worked on but not achievable within the timeframe of the revision. The primary scope of the modeling effort herein focused on broad coverage of potential mechanisms to provide an unbiased view of data-consistent mechanisms. At this time, the screen and scope of our study is only achievable with models with one space dimension. Moreover, the inputs to the system based on gene expression are distributed symmetrically across the embryo, so a 1D model should largely reflect one in 3D. We added the rationale for performing a 1D model now to the manuscript.
Thank you for the suggestion. We have now added a comparison of WT to chordin heterozygotes to the manuscript (Figure 6J). There is no significant change in the P-Smad5 gradient or embryonic phenotype between WT and chordin heterozygous embryos (Figure 6J). We also now required mathematical model solutions to fit our chordin heterozygous data, when the Chordin production rate was set to 50%. Forcing the model to fit our chordin heterozygous data decreased the overall number of solutions, but did not eliminate all solutions of either the source-sink or counter-gradient mechanism. The mathematical model in Figure 7–8 and associated text have been updated to include chordin heterozygous data.
bmp2b expression is now quantified by RNAScope fluorescent in situ hybridization and included in Figure 3. We have adjusted our BMP production gradient in our mathematical model to fit the measured bmp2b expression gradient and simulated the mathematical model an additional 1,000,000 times. The adjusted BMP production gradient increased the overall number of solutions, but did not modify our conclusions about the mechanisms. All modeling figures and data displays (Figure 4,5,7,9) have been updated incorporating the new data.
While we agree that measuring the diffusivity of BMP bound to Chordin would be very useful for further testing the shuttling model, the experiment is not feasible without extensive overexpression or the development of additional tools. To see Bmp2b-Venus, we must moderately overexpress it. To ensure all Bmp2b-Venus is bound to Chordin, we would need to heavily overexpress Chordin. Chordin has been shown to interact with Tsg , Bmper [16-18], Ont1 , and HSPGs . By overexpressing both BMP and Chordin, these interacting factors, which may limit BMP-Chordin diffusion could be diluted out, causing FRAP to overestimate the diffusivity of the BMP-Chd complex. Since we do not have time to develop more sophisticated tools to test this, we think it is best not to include a double overexpression experiment.
To assess whether Bmp2b-Venus is properly processed and remains attached to the Venus tag, we performed a Western Blot for Venus on embryos injected with venus or bm2b-venus RNA. We have added this experiment to the paper (Figure 8A).
To further assess the activity and range of the Bmp2b-Venus chimera, we rescued embryos lacking Bmp2b with bmp2b-venus RNA. It has been previously reported that embryos lacking Bmp2b can be rescued using bmp2b RNA . We were able to rescue embryos to a WT phenotype by injecting bmp2b-venus RNA (Figure 8B, rows 5-7). This result has been added to the text (Figure 8). However, a direct comparison of bmp2b RNA activity and bmp2b-Venus activity is not possible, as RNA activity can vary from synthesis reaction to synthesis reaction. In addition to this we have now measured secreted Venus diffusion rates with our approach and added additional measurements for Bmp2b-Venus diffusion in chordin MO-injected embryos (Figure 8).
At this time we are unable to compare the range of Bmp2b to that of Bmp2b-Venus. Range has two components: diffusivity and decay rate. Measuring diffusivity via FRAP requires the protein in question to be tagged fluorescently. While decay rates of Bmp2b and Bmp2b-Venus could be measured and compared by injecting Bmp2b and Bmp2b-Venus protein and performing a western blot time-series, previous estimates of Tgf-β decay rates have relied exclusively on tagged proteins .
We presume that by requesting that we measure BMP diffusion with uniform chordin that the reviewers are asking us to measure bound BMP-Chd diffusion. We do assert that the Shuttling mechanism requires high diffusivity of BMP-Chordin (Figure 5D x-axis), however, our chordin-/- mutant data already exclude the Shuttling mechanism (Figure 6). However, when discussing the Source-Sink versus the Counter-Gradient mechanism in Figure 7, we omitted an important plot of BMP-Chd diffusivity in our latest submission, which addresses the reviewers’ point. We thank the reviewers for making us aware of this. A plot of BMP-Chd diffusivity shows that possible values of BMP-Chd diffusivity over the 4 orders of magnitude tested in our simulations does not distinguish between the Counter-Gradient and Source-Sink mechanisms. Both of these mechanisms are compatible with BMP-Chd diffusivities over 4 orders of magnitude from nearly immobile (10-2 µm2/s) to free diffusion (102 µm2/s). Therefore, measuring BMP-Chd diffusivity would not help discern between the two remaining models, Counter-Gradient and Source-Sink. We added this BMP-Chd diffusivity plot now to the manuscript to clarify this important point (Figure 7J).
In comment 1 of the previous review, the reviewers asked us to discuss the rescue of chordino mutants with uniform chordin RNA injections. We address this point now by simulating the system with ubiquitous Chordin production. We found that 426 of the 1452 solutions that fit our WT, chordin-/-, and chordin+/- data and BMP diffusivity (within 2 um2/s of our measured 4.4 um2/s) retain a WT BMP gradient when Chordinis uniformly produced. The 426 remaining solutions are all source-sink mechanisms with steep gradients of Chordin that are high dorsally and low ventrally. The results of the simulations show that the BMP gradient is generated by Tolloid degrading Chordin ventrally. We include these simulation results that show how uniform chordin RNA can rescue a chordin mutant in the Results section of our paper, as a new panel Figure 8I. We thank the reviewers for the suggestion, as it provides further support for the source-sink mechanism.
For each model iteration, parameters were selected from a uniform distribution in log space that covered four orders of magnitude within the physiological range for each parameter. Each parameter was selected independently of the remaining parameters. Adaptive and subsampling methods that increase parameter selection in regions with high variance in model output were not used in our parameter selection for a number of reasons. Firstly, a parameter matrix is produced that is then subdivided across distributed computers to solve the pdes to produce a stored file of model solutions and parameter vectors associated with the stored solution. For each parameter vector, the PDE system is converted into a set of 180 ordinary differential equations after discretization and dynamically solved for wt, chd-/-, nog-/-, and chd+/- conditions using the implicit solver ode15s. Ode15s is well suited to problems with numerical stiffness that arise during numerical screens with random parameters. Thus, for an ensemble of 1 million parameter vectors solved, the system of differential equations are solved 4 times to simulate the wt and mutant conditions, increasing the total model evaluations to 4 million. Following calculation of the model solutions for each parameter vector, post processing, sorting, and calculation of model fitness against the data is handled by a separate program that operates on the stored solutions. The separation of model evaluation from model analysis allows for much greater flexibility, the total number of simulation results, and an ability to add additional simulation results to existing simulations that have previously been computed. If a job is interrupted, the index and solutions up to the parameter index are stored and simulation jobs can be restarted at the last iteration point.
Random sampling is not susceptible to the “curse of dimensionality” that is common to regular grid spacing methods allowing for more efficient estimation of the NRMSD landscape in Figure 7(C,D), and random points fill in the parameter space more evenly than regular grid spacing that forces evaluations of the model within the same parameter hyperplane (Caflisch et al., 1998). Figure 7C, D demonstrates the dense coverage and sampling to estimate the NRMSD values and dense coverage in regions with acceptable NRMSD values. Random sampling of the biophysical parameters is common to these types of problems (Eldar et al., 2002; von Dassow et al., 2000).
We have added this explanation to the Materials and methods section as further clarification.
1. Wang, Y. and E.L. Ferguson, Spatial bistability of Dpp–receptor interactions during Drosophila dorsal–ventral patterning. Nature, 2005. 434(7030): p. 225-9.
2. Coppey, M., et al., Nuclear trapping shapes the terminal gradient in the Drosophila embryo. Curr Biol, 2008. 18(12): p. 915-9.
3. Keller, P.J., et al., Reconstruction of zebrafish early embryonic development by scanned light sheet microscopy. Science, 2008. 322(5904): p. 1065-9.
4. Caflisch, A., R. Walchli, and C. Ehrhardt, Computer-Aided Design of Thrombin Inhibitors. News Physiol Sci, 1998. 13: p. 182-189.
5. Eldar, A., et al., Robustness of the BMP morphogen gradient in Drosophila embryonic patterning. Nature, 2002. 419(6904): p. 300-4.
6. von Dassow, G., et al., The segment polarity network is a robust developmental module. Nature, 2000. 406.
7. Tucker, J.A., K.A. Mintzer, and M.C. Mullins, The BMP signaling gradient patterns dorsoventral tissues in a temporally progressive manner along the anteroposterior axis. Dev Cell, 2008. 14(1): p. 108-19.
8. Hashiguchi, M. and M.C. Mullins, Anteroposterior and dorsoventral patterning are coordinated by an identical patterning clock. Development, 2013. 140(9): p. 1970-80.
9. Tuazon, F.B. and M.C. Mullins, Temporally coordinated signals progressively pattern the anteroposterior and dorsoventral body axes. Semin Cell Dev Biol, 2015. 42: p. 118-33.
10. Kwon, H.J., et al., Identification of early requirements for preplacodal ectoderm and sensory organ development. PLoS Genet, 2010. 6(9): p. e1001133.
11. Leung, T., bozozok directly represses bmp2b transcription and mediates the earliest dorsoventral asymmetry of bmp2b expression in zebrafish. Development, 2003. 130(16): p. 3639-3649.
12. Solnica-Krezel, L. and W. Driever, The role of the homeodomain protein Bozozok in zebrafish axis formation. Int J Dev Biol, 2001. 45(1): p. 299-310.
13. Koos, D. and R. Ho, The nieuwkoid dharma homeobox gene is essential for bmp2b repression in the zebrafish pregastrula. Developmental Biology, 1999. 215(2): p. 190–207.
14. Shimizu, T., et al., Cooperative roles of Bozozok/Dhama and Nodal-Related protein in the formation of the dorsal organizer in zebrafish. Mech Dev, 2000. 91(1-2): p. 293-303.
15. Troilo, H., et al., Structural characterization of twisted gastrulation provides insights into opposing functions on the BMP signalling pathway. Matrix Biol, 2016. 55: p. 49-62.
16. Rentzsch, F., et al., Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation. Development, 2006. 133(5): p. 801-11.
17. Zhang, J.L., et al., Binding between Crossveinless-2 and Chordin von Willebrand factor type C domains promotes BMP signaling by blocking Chordin activity. PLoS One, 2010. 5(9): p. e12846.
18. Ambrosio, A.L., et al., Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning. Dev Cell, 2008. 15(2): p. 248-60.
19. Inomata, H., T. Haraguchi, and Y. Sasai, Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell, 2008. 134(5): p. 854-65.
20. Jasuja, R., et al., Cell-surface heparan sulfate proteoglycans potentiate chordin antagonism of bone morphogenetic protein signaling and are necessary for cellular uptake of chordin. J Biol Chem, 2004. 279(49): p. 51289-97.
21. Nguyen, V.H., et al., Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev Biol, 1998. 199(1): p. 93-110.
22. Muller, P., et al., Differential diffusivity of Nodal and Lefty underlies a reaction-diffusion patterning system. Science, 2012. 336(6082): p. 721-4.
We thank the UPenn Microscopy Core, especially Andrea Stout and Xinyu Zhao; undergraduate students Samantha Warrick and Dan Zhao; funding from NIH grants T32 HD08318, R01GM056326, R01HD073156, and an NSF Graduate Fellowship; editing help from Francesca Tuazon; and Caroline Hill, Sharon Amacher, Bernard Thisse, and Christine Thisse for reagents.
Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#803105, #804931) of the University of Pennsylvania Perelman School of Medicine.
© 2017, Zinski et al.
During vertebrate embryogenesis, dorsal-ventral patterning is controlled by the BMP/Chordin activator/inhibitor system. BMP induces ventral fates, whereas Chordin inhibits BMP signaling on the dorsal side. Several theories can explain how the distributions of BMP and Chordin are regulated to achieve patterning, but the assumptions regarding activator/inhibitor diffusion and stability differ between models. Notably, ‘shuttling’ models in which the BMP distribution is modulated by a Chordin-mediated increase in BMP diffusivity have gained recent prominence. Here, we directly test five major models by measuring the biophysical properties of fluorescently tagged BMP2b and Chordin in zebrafish embryos. We found that BMP2b and Chordin diffuse and rapidly form extracellular protein gradients, Chordin does not modulate the diffusivity or distribution of BMP2b, and Chordin is not required to establish peak levels of BMP signaling. Our findings challenge current self-regulating reaction-diffusion and shuttling models and provide support for a graded source-sink mechanism underlying zebrafish dorsal-ventral patterning. | 2019-04-23T08:17:58Z | https://elifesciences.org/articles/22199 |
It captures your attention from the street with its unique design and garden wall. But it is hard to imagine what will be revealed beyond the striking facade until you step inside. The two-bedroom home at 44 Tooke Street in Cooks Hill is being marketing by McGrath Newcastle City's Tammy Hawkins with an "entry level" guide of $700,000. For the past six years it has been the home of film producer Kelly Boulton, who is reluctantly moving on to another project. Related content: She has transformed the Cooks Hill house, which she has "fallen in love with", into an urban retreat by making the most of the space available and adding timber and greenery to give the property life and warmth. "It's a high building and the beautiful thing that I fell in love with was the vertical space," Ms Boulton said. "From the outside it looks like a little gingerbread house but you go inside and it's so much bigger than you could imagine because of that vertical space and the light. It's bright all of the time." Features include Blackbutt flooring, custom-made Oak shelves and a paved outdoor entertaining area surrounded by lush wall gardens. It is set for auction on March 23 and has attracted plenty of interest. It is open for inspection at 11am on Saturday.
It captures your attention from the street with its unique design and garden wall.
But it is hard to imagine what will be revealed beyond the striking facade until you step inside.
The two-bedroom home at 44 Tooke Street in Cooks Hill is being marketing by McGrath Newcastle City's Tammy Hawkins with an "entry level" guide of $700,000.
For the past six years it has been the home of film producer Kelly Boulton, who is reluctantly moving on to another project.
She has transformed the Cooks Hill house, which she has "fallen in love with", into an urban retreat by making the most of the space available and adding timber and greenery to give the property life and warmth.
"It's a high building and the beautiful thing that I fell in love with was the vertical space," Ms Boulton said.
"From the outside it looks like a little gingerbread house but you go inside and it's so much bigger than you could imagine because of that vertical space and the light. It's bright all of the time."
Features include Blackbutt flooring, custom-made Oak shelves and a paved outdoor entertaining area surrounded by lush wall gardens.
It is set for auction on March 23 and has attracted plenty of interest.
It is open for inspection at 11am on Saturday. | 2019-04-21T18:29:51Z | https://www.theherald.com.au/story/5951213/urban-sanctuary-in-cooks-hill-property-of-the-week/?cs=3968 |
Right off, thanks to everyone that checked us out this past weekend on our short tour with Velvet Elvis. We had a great time and enjoyed seeing so many of our friends again.
The first, yellowish-orange vinyl pressing of Spectra Spirit is SOLD OUT! If you didn’t get one, fear not! The second pressing is now available on multi-colored vinyl. Seriously, there’s at least six different colors available. Collect them all! 😉 EDIT: We’ve also found eight more copies of the first, self-titled LP and have made them available to purchase in the store.
This coming weekend (August 3rd and 4th) we will be in the Badger State playing a couple awesome gigs. On the 3rd we’ll be at Frank’s Power Plant with our very good friends, Milwaukee thrashers Architects of the Aftermath. The next night, we’ll be trippin’ under the stars at the Sunny Daze Music Mass in Glenbeulah, WI. This is a free, BYOB & Food event, and camping is encouraged. Hit the link to check out the awesome bands that will be playing, starting at noon.
We have a few more shows coming up over the next couple months, including a few trips to Cincy. Check the Tour page for more details. Thanks a lot to everyone that has been coming out and spreading the word! | 2019-04-24T06:00:54Z | http://www.sistersofyoursunshinevapor.com/2012/07/all-my-colors-turn-to-clouds/ |
Does the complexity of Dr. Ben’s patient education needs require a complicated solution?
“What?” Ben was taken aback. His chiropractic office dealt with medical regulations frequently, but he couldn’t see how they could affect his wife’s pizza parlor.
“We have to provide full nutritional information on our menus now.” Carmen sat back, waiting for Ben to share her outrage.
Their waiter arrived and Ben and Carmen ordered, pausing in their conversation to discuss their choice of dishes.
“Unlike anatomical models or charts,” Carmen put in.
Learn more about the Genesis Chiropractic Software features.
Find out what insurance companies don’t want you to know. | 2019-04-25T00:20:14Z | https://genesischiropracticsoftware.com/patient-education-for-chiropractic-practices/ |
Search the Community: Showing results for tags '1.7'.
Ive been working on greatly expanding the white picket fences today. Heres a look at them: The tricky part is baking the ambient occlusion for each object, it is rather tedious. As I have just upgraded to 3d studio max 2017 (from 2015), these simple fences were a good way of getting used to the new program version.
What's the overall theme of 1.7? There isn't one. ...well maybe "cool stuff" This may seem a bit strange considering we have often updated with a strong theme. The journey up until Forge Awakens has been a long one. After 1.5 New Frontier, 1.6 was made on 2 strengths: Mining and metal refinement, and simplification of construction chains. We had a very long beta test cycle and I think we were all worn out by the end. For a long time we debated about metals, iron in particular. It took a lot of courage to change iron. It always came down to "well yeah but if you had a pickaxe you could never go for a walk and just grab ready smelted iron bars off the ground". And the need to use iron bars to construct buildings, ugh. So what do they do "here's my nice new stone house, excuse me while I just go and push these 5 iron bars into the walls". We couldn't allow that to go on, it felt stupid. "But maybe the iron is used for nails?" yeah, when? glad those times are over. So, the entire journey leading up to 1.7 has been a long one. I feel we are at our limits as to how far from vanilla we want to push the main cc download. It's for this reason that we plan on going modular with future additions after 1.7 So, where does that leave 1.7? Well, there are many things we've wanted in cc for a long time. Much of the content being worked on now are modular town improvements, as opposed to giant chains of new products. I have a feeling of making places feel "lived in", be they hamlet or city. Think about it. There's no prams for the young or rocking chairs for the old. No kids playgrounds. Where's the life? You know, that feeling that people are more than cogs in a wheel of some production chain. Some things I'm going to simplify, for example the production of salt. Right now there's a saltworks and a mine, but what about simple rock pools that use natural evaporation? Sure it'll be slow, but it's a method as old as the hills. Should be ideal for low production requirements. That's on a to-do list. So what I'm saying is that 1.7 will seem fairly plain compared to previous versions. It won't alter your game significantly, but it will give more options for the look and feel of your towns. | 2019-04-22T19:10:22Z | http://blackliquidsoftware.com/index.php?/tags/1.7/ |
Welcome to the August 17, 2009 edition of ACM TechNews, providing timely information for IT professionals three times a week.
Researchers have demonstrated how to get engineered "DNA origami" to self-organize on silicon, which could enable semiconductor manufacturers to create chips with significantly closer components, leading to smaller devices and faster computers. The DNA origami can be designed to serve as a scaffold for electronic components only six billionths of a meter apart, about eight times better than existing technology. Several research efforts have demonstrated that DNA can be used to store or manipulate data and to solve simple computational tasks, but the new demonstration leverages the ability to design DNA strands into regular shapes such as triangles. The computer industry would like to use next-generation materials with favorable electronic properties, such as carbon nanotubes or nanowires, but these structures are minuscule and difficult to manipulate. However, the chemical groups attached to DNA helices could be used as anchor points for these structures. This technique is particularly useful because the regular shapes of DNA origami enable them to fit precisely into the shaped pits the researchers made in silicon or carbon using standard techniques. "The combination of this directed self-assembly with today's fabrication technology eventually could lead to substantial savings in the most expensive and challenging part of the chip-making process," says IBM Almaden Research Center's Spike Narayan. IBM says it could take up to 10 years to implement the new technique.
Russian hackers stole U.S. identities and software tools for use in a cyberattack against Georgian government Web sites during the war between Russia and Georgia in 2008, according to a new report by the U.S. Cyber Consequences Unit. The report says that Russian hackers converted Microsoft software into a cyberweapon and collaborated on popular U.S.-based social-networking sites, including Facebook and Twitter, to coordinate attacks against Georgian sites. Although the cyberattacks were closely examined following the war, the connections to the United States had remained hidden until this year. Personal and credit card information stolen from U.S. citizens was used to register Web sites that launched the botnet attacks, and once the attacks started, Facebook and Twitter were used to exchange attack code and encourage others to join the attack. Experts say the study shows how cyberwarfare has outpaced military and international agreements, which do not account for the possibility of using U.S. resources and civilian technology as weapons. Identity theft, social networking, and modifying commercial software are all common attack strategies, but combining these strategies raises the attack to a new level, says former U.S. Department of Homeland Security cybersecurity chief Amit Yoran. White House officials are now studying how laws of war and international obligations need to be adjusted to account for cyberattacks. The U.S. Cyber Consequences Unit says the Georgian attacks were perpetrated by Russian criminal groups, and had no clear link to the Russian government, but the time of attacks, which started only hours after the military invasion started, suggests the Russian government may have at least indirectly coordinated with the cyberattackers.
The advent of the Internet era is shrinking the role of corporate research and development (R&D) laboratories in the innovation process, according to experts. Michael Schrage with the Center for Digital Business at the Massachusetts Institute of Technology forecasts that the idea-production process will continue its migration from large corporate labs' centralized model and toward "populist innovation." He says that a great deal of traditional corporate R&D has been subsidized by profits that face more and more Internet-era economic pressures. Corporate R&D's best option at this point is to embrace a federated model that takes advantage of all the work by outsiders in learning institutions, startups, business partners, and government labs, with the corporate lab functioning as an innovation coordinator and integrator, Schrage says. The federated strategy has been taken up by Hewlett-Packard (HP), with HP Labs devoting greater resources to fewer projects, while also systematically seeking outside ideas via an annual contest that solicits grant proposals from universities across the globe. "We are tapping the collective intelligence, selectively, of leading academics around the world," says HP's Prith Banerjee. One such academic is University of Southern California electrical engineer Alan E. Willner, whose project with HP Labs is an attempt to reduce power consumption and raise data-transmission speeds between computers in data centers and eventually even within chips. Although a federated approach works for certain problems, experts say corporate lab R&D is unmatched when focused on multidisciplinary challenges in projects soon going to market.
A study by the Massachusetts Institute of Technology (MIT), Carnegie Mellon University, and Akamai indicates that an Internet-routing algorithm that tracks electricity price fluctuations could save major Internet companies millions of dollars each year. Such an algorithm could reduce energy use by as much as 40 percent by rerouting data to locations where electricity prices are the lowest for that particular day. MIT Ph.D. student Asfandyar Qureshi first outlined the concept of a smart routing algorithm capable of tracking electricity prices in a paper in October 2008, and this year Qureshi and colleagues approached Akamai researchers to obtain the real-world routing data needed to test the concept. The researchers analyzed 39 months of electricity pricing data for 29 major U.S. cities and noted a surprising amount of volatility, even among geographically close locations. The team then created a routing scheme to take advantage of daily and hourly fluctuations in electricity costs around the country, creating an algorithm that compares the physical distance needed to route information, which also increases cost, against the likely cost savings from reduced energy consumption. The routing scheme was tested on nine Akamai servers over 24 hours, and the researchers found that in the best scenario a company could cut energy use by 40 percent.
Researchers at Germany's Leipzig Max Planck Institute for Human Cognitive and Brain Sciences and the Wellcome Trust Centre for Neuroimaging in London have developed a mathematical model that could significantly improve computers' ability to automatically recognize and process spoken language. The researchers say their new language processing algorithm could eventually imitate brain mechanisms and help machines perceive and understand the world around them. The researchers created a mathematical model that was designed to imitate, in a highly simplified manner, the neuronal processes that occur during human speech comprehension. The neuronal processes were described by algorithms that processed speech at several temporal levels. The model was able to recognize individual speech sounds and syllables and was able to process accelerated speech sequences. Additionally, the system had a brain-like ability to predict the next speech sound, and if the prediction was incorrect because the speaker made an unfamiliar syllable out of familiar sounds, the system could detect the error. "The crucial point, from a neuroscientific perspective, is that the reactions of the model were similar to what would be observed in the human brain," says the Max Planck Institute's Stefan Kiebel.
The recent ACM SIGGRAPH conference offered a video demonstration of Control of Remotely Interfaced Systems using Touch-based Actions in Living spaces (CRISTAL), a multitouch tabletop display that acts as a universal remote. Australian researcher Christian Muller-Tomfelde, who is currently writing a book on research in tabletop displays, says CRISTAL is easy to use. "It is a clever use of the tabletop as a 'world-in-miniature' interface to control room elements," he says. CRISTAL uses a camera to deliver a streaming video view of the room, including the TV, radio, DVD player, lamps, and digital picture frames, on the tabletop. The video image of a device acts as the interface, so the user could make a sliding motion on the TV to adjust the volume. The user also could drag the image of the cover of a movie on the multitouch screen and drop it on the image of the TV to watch it. The team behind CRISTAL says such a tabletop remote could cost $10,000 to $15,000, and could reach consumers in a few years if it is combined with Microsoft's Surface multitouch display. "We wanted a social aspect to activities such as choosing what to watch on TV and we wanted to make the process easy and intuitive," says the University of Waterloo's Stacey Scott, who worked on the CRISTAL project.
Carnegie Mellon University (CMU) is adding a community college component to its Open Learning Initiative, which gives about 300 classrooms around the world access to software-enhanced, college-level online course material in a variety of subjects. Human-computer interaction specialists will team up with software engineers, scientists who study how people learn, and community college faculty experts to develop courses for the Community College Open Learning Initiative. The Open Learning Initiative makes use of digital environments that are capable of tracking the progress of students, providing feedback, and notifying professors about the specific areas of struggle for students. CMU hopes to improve the completion rates for courses by 25 percent. The community college version of the Open Learning Initiative will make use of a hybrid model that combines online teaching with time in a traditional classroom. CMU has secured $4.5 million in funding for the project, which could reach 40 community-college partners within three years.
A Harvard University-led, multidisciplinary team of computer scientists, engineers, and biologists have received a $10 million National Science Foundation Expeditions in Computing grant to develop small-scale robotic devices based on the biology of a bee and the insect's hive behavior. The researchers hope to advance the field of miniature robotics and the design of compact, high-energy power sources, as well as create new ultra-low-power computing and smart electronic sensors, and improve coordination algorithms to manage multiple, independent machines. "Nature has bred astonishing solutions to complex real-world challenges," says Harvard professor Robert Wood, the principal investigator of the project. "This research aims to understand the biology of bees and use this understanding to advance multiple topics in computer science and engineering." Wood and his colleagues say that nature-inspired research could lead to the development of novel methods for designing and building an electronic surrogate nervous system capable of sensing and adapting to changing environments, and advance the field of small-scale flying mechanical devices. The five-year project could lead to technological advances in robust, bio-inspired computer systems that coordinate complex behavior using input from multiple independent parts, smart materials, and novel, miniature power sources that could be used in a variety of devices. The researchers also will work with the Museum of Science in Boston to create an interactive exhibit to educate and inspire future scientists and engineers.
A system that fights highly infectious computer viruses by embedding defense mechanisms in key parts of the Internet has been developed by University of North Carolina at Chapel Hill researcher Scott Coull and Rensselaer Polytechnic Institute professor Boleslaw Szymanski. The modus operandi of computer worm infection is malware scanning the Internet for vulnerable computers and transferring itself to those systems. Coull and Szymanski say the isolation of worms entails coaxing the Internet's core computers or autonomous systems to collaborate, and each system is managed by an Internet service provider (ISP). In their model, the researchers imbued each system with the ability to spot a compromised computer, which may announce itself by making a series of random requests to link to other computers, the majority of which will fail. Once a threat within the autonomous system's network is detected, the system stops receiving and forwarding messages from the infected computer, and also notifies its peer autonomous systems about the identity of the threat. Upon the recognition of a genuine threat, all autonomous systems can contain the compromised computer or computers and halt the worm's spread. Coull and Szymanski's model indicates that the viability of this strategy depends on cooperation between about 30 percent to 35 percent of the autonomous systems in the Internet. Collaboration and trust between the ISPs running the systems would be essential, Coull says.
The National Science Foundation's Expeditions in Computing program has awarded the University of California, Los Angeles (UCLA) Henry Samueli School of Engineering and Applied Science a $10 million grant to work on a new technology called domain-specific computing. The technology could revolutionize medical imaging and hemodynamic simulation by providing a more cost-effective, energy-efficient, and customizable computing option for preventative, diagnostic, and therapeutic procedures. The new UCLA Center for Domain-Specific Computing (CDSC) will oversee the research. CDSC director Jason Cong says domain-specific computing holds significant advantages. He says domain-specific computing uses a customizable architecture and custom-oriented, high-level computer languages especially designed for a particular application or domain. "The broader impact of our work at the CDSC will be measured by the new digital revolution enabled by customized computing," Cong says. "We will demonstrate the feasibility and advantages of the proposed research in the domain of health care, given its significant impact on the national economy and quality-of-life issues." He says CDSC's work will enable physicians to see inside the brain to assist in real-time surgery, and to perform preventive procedures much faster using automatic analysis and diagnosis of MRIs and CT scans. "Much of the work that relies on people today may take hours or days to complete with existing computing technology, but with the domain-specific customizable technique, the work can be done in minutes," he says.
Computer science and humanities researchers at Israel's Ben-Gurion University (BGU) have partnered to decipher historical Hebrew documents, using a unique algorithm to ascertain wording by uncovering similar handwriting patterns that help determine author and date. One of the project's challenges is that many of the original Hebrew texts have been scratched off and overwritten with Arabic text. BGU professor Klara Kedem says the document base is comprised of "100,000 medieval Hebrew codices and their fragments [that] represent the book production output of only the last six centuries of the Middle Ages." She notes that foreground and background lettering are difficult to segregate given the documents' deterioration, so the algorithm covers the text in a dark gray hue that highlights lighter colored pixels as background space and identifies the darker pixels as delineating the original Hebrew lettering. Few documents have survived fully intact, and "we are trying to piece them together like a big puzzle," says Uri Ehrlich, director of BGU's Prayer Research Project. The algorithm has been presented by Kedem to other universities and research centers to aid in the deciphering of a large number of texts.
Massachusetts Institute of Technology Media Lab graduate student David Merrill has co-invented Siftables to facilitate more natural and tangible interaction with digital media in a field he refers to as embodied media. "Embodied media offers a new point in the interaction design space between tangible and graphical user interfaces," Merrill says. "It combines elements of both paradigms--physically embodied manipulatives that can be grasped and moved by hand, and screens that can show visual information." Merrill says the graphical display is a central feature as it permits the interactive roles and content assignments to manipulatives to be visually understandable to the user and dynamically assigned at runtime. Siftables came out of an investigation Merrill conducted with Jeevan Kalanithi on how human-computer interaction might be enabled by manually manipulating a body of minuscule active, computational objects. Merrill describes Siftables as a hybrid platform that combines concepts from tangible interfaces, pervasive computing, and sensor networks with the flexibility of pixels that defines graphical user interfaces. In their current incarnation, Siftables are small interactive computers equipped with a graphical display, neighbor and motion sensing, a rechargeable battery, and wireless communication. Merrill says each Siftable's size is primarily dictated by the display. The present display is big enough to show an image thumbnail or symbol such that it is easily recognizable from across a tabletop. | 2019-04-22T17:24:44Z | https://technews.acm.org/archives.cfm?fo=2009-08-aug/aug-17-2009.html |
Robert D. Owens, President/CEO of O,R&L Facility Services is pleased to announce the company’s purchase of the 24,000 square foot office building at 1646 33rd Street in Orlando, Florida. Located on the I-4 corridor, the facility will serve as the company’s new South East Headquarters.
The new headquarters facility will house corporate executive offices, business development and marketing resources, offices for field management, payroll and human resources support, and a state-of-the-art training facility. A ribbon cutting ceremony is planned for December 1, 2012.
Located within a City of Orlando Enterprise Zone, this acquisition demonstrates O,R&L’s recognition of the City of Orlando as a strategic business and commerce center for dynamic growth companies. O,R&L is committed to continuing to develop strong business and community ties with the City and looks forward to being a part of Orlando’s compelling future. | 2019-04-23T20:11:28Z | http://www.or-l.com/management/orl-management-news/o-r-and-l-facility-services-new-south-east-headquarters/ |
Individual: Profile This plan allows a principal, assistant principal, or aspiring principal to reflect on their own practice and invite their supervisor.
360: School Profile This plan allows a principal to reflect on their own practice and invite teachers and their supervisor to provide feedback.
360: District Profile This plan allows all principals in the district to reflect on their own practice and invite teachers and their supervisor to provide feedback. | 2019-04-23T10:02:33Z | http://blp.changetheodds.org/LearnMore/PlansAndPricing |
Shochiku Multiplex Theatres, Ltd. (SMT) and Dolby Laboratories, Inc. (NYSE: DLB) have entered into an agreement for the first deployment of Dolby Cinema™ theatres in Japan. The first opening is scheduled for the fall of 2018 with MOVIX Saitama, with other sites to follow.
GDC Technology (“GDC”), a world leading digital cinema solution provider, in conjunction with its partner, USHIO Inc., is pleased to announce that it has reached a new agreement with Shochiku Co., Ltd. (“Shochiku”), under a VPF program to supply DCI-compliant digital cinema equipment to Shochiku Multiplex Theaters (“SMT”), a wholly owned subsidiary of Shochiku. | 2019-04-25T22:30:24Z | https://www.dcinematoday.com/dc/orginfo?id=219 |
Dental implants are an ideal way to restore proper function to the mouth while preventing bone loss and tissue degeneration. Traditional implants involved placing one metal rod into the jawbone for each tooth that has been lost. The All-on-4 dental implant method is much newer and only requires four dental implants per plate to provide stability and a firm fit.
While it can cost several hundreds of dollars for each implant, the All-on-4 implant system is much more affordable. It only requires four evenly placed dental implants to secure an upper or lower plate. With only four implants being used, there is less risk of infection and less aftercare. As soon as the implants have healed and are secure, the denture plates can be added.
Because only four dental implants are required, no bone grafts are needed to build up the bone tissue. Your dentist will place each implant in areas where there is enough bone to properly stabilize it and hold it in place while it heals. As the bone remodels around the graft, new bone will continue to grow, creating a stronger, more resilient jawbone.
The All-on-4 implant system takes much less time to put into place. There are fewer incisions that have to be made and much less trauma to the gum tissue. Not only does the procedure take less time, but the recovery period is also much shorter than with traditional implants.
The four implants used in the All-on-4 system offers increased stability as well. While traditional implants also offer a degree of stability, too many implants can seem bulky, making it difficult for them to fully heal properly.
Traditional implants make a great choice for one or two missing teeth. When you are preparing to be fitted for an upper or lower denture plate, consider the All-on-4 implant system instead of traditional dental implants. They are a more affordable option with much shorter healing time. | 2019-04-18T18:34:39Z | http://blog.ocdentalimplants4u.com/benefits-of-all-on-4-dental-implants-over-traditional-implants/ |
Linux infrastructure administering: RedHat/CentOS, Debian/Ubuntu, BIND, MySQL, MariaDB, PostgreSQL, Apache, Nginx, VPN(OpenVPN, PPTP), Postfix, Dovercot, Zabbix, Cacti, ELK, Zabbix Microsoft infrastructure administering: Windows server, MSSQL, Hyper-V, Active Directory etc. Network infrastructure administering: Mikrotik. Virtualisation: VMWare, KVM. Cloud: Google Cloud, Azure. Development: C++, Python, Bash.
I'm fond of systems architecture and automation. Relocation is possible, although limited to places with a warm sea nearby.
18 candidates found. Page 1 of 2. | 2019-04-21T00:54:47Z | https://djinni.co/developers/ukraine/dnepr/?english_level=pre&title=Sysadmin |
Anglicare is here to provide practical support to live your life the way you choose. Anglicare has been a trusted, reliable not-for-profit provider of quality support for Tasmanian’s for over 30 years. Anglicare has been involved in the NDIS since it was first trialled and can provide one of the broadest ranges of disability supports of any provider in Tasmania. Our friendly professional team take the time to understand you and work with you to provide the supports that best match your goals and choices.
Ask for a plan review if your support needs change.
Anglicare has been working with people seeking to access the NDIS and people preparing to develop an NDIS plan since the start of the scheme. Our experienced staff can work with you to get the best possible NDIS plan for you.
If you are eligible for the NDIS, our professional staff can work with you to provide support in your day-to-day life and with self-care, and household jobs. We can also work with you to assist you in building your independence. Anglicare’s services provide value for your money to assist you to make your NDIS plan go further.
We assist residents to create a positive living environment in our shared homes and respond to our residents’ feedback.
Anglicare can provide a range of services for people living with disability to enable their carers to take planned time away knowing that their family member or friend is supported by experienced and well-trained staff.
At Anglicare, we have experienced staff to support people with all kinds of disability, including those with complex needs.
How we provide this support will depend on your individual needs. Anglicare can provide a range of options, which may include support to participate in community activities, support in your home, or support in one of our accommodation options. We can provide support for just a few hours or 24-hour support if needed.
What do you like to do? Whatever it is, our friendly team can provide the supports you choose based on your interests and what you enjoy.
Want to develop your skills further but need some support to do so?
Our friendly team will work with you to support you based on your goals.
Our team members have expertise in supporting people facing a broad range of life challenges. We can help with money management, family relationships, drug and alcohol misuse, and housing support.
We start by understanding you and what supports you need, and work with you to develop the best support plan for you.
We work to understand your needs and assist you to improve your health and well-being. | 2019-04-20T07:26:01Z | https://www.anglicare-tas.org.au/service-category/disability-services-including-ndis-supports |
Here at Concrete Sealing Guys, we will be ready to satisfy your standards when it comes to Concrete Sealing in Shoals, WV. Our team of experienced experts will offer the expert services you need with the most innovative technologies available. Our products are of the very best quality and we have learned to help save costs. Call us today at 800-634-1690 and we will be glad to look at your options, answer all your questions, and arrange a consultation to commence organizing your project.
Here at Concrete Sealing Guys, there's nothing more important than client satisfaction. We will get acquainted with your situation and expectations of the project, and set out to complete the job to meet with your full standards. We appreciate all of your concerns, and our company is ready to help you. We predict your concerns, and we'll settle them once you give us a call. You want to put together the most effective choices for your venture, and we recognize how to help you do just that.
At Concrete Sealing Guys, we recognize that you will need to remain in your financial budget and cut costs whenever it's possible to. In the process, you will need the most effective and highest standard of services regarding Concrete Sealing in Shoals, WV. Our efforts to conserve your funds won't sacrifice the high quality of our work. Our intention is to make sure that you get the best quality materials and a result that will last as time passes. We can do that by supplying you with the most suitable prices available and avoiding costly blunders. Save your time and funds through contacting Concrete Sealing Guys today. Dial 800-634-1690 to speak with our customer support representatives, today.
You have to be well informed regarding Concrete Sealing in Shoals, WV. You don't want to go in without consideration, and it is best to understand what to anticipate. We will take the unexpected situations from the equation by giving appropriate and complete advice. Get started by dialing 800-634-1690 to go over your work. We will discuss your concerns and questions when you give us a call and get you set up with an appointment. Our staff can arrive at the scheduled time with the needed equipment, and will work together with you all through the project.
You've got many good reasons to rely on Concrete Sealing Guys to suit your needs when it comes to Concrete Sealing in Shoals, WV. We've got the best customer care ratings, the best resources, and the most practical and productive money saving strategies. We've got the experience that you need to meet all of your ambitions. Call 800-634-1690 to reach Concrete Sealing Guys and explore all of your goals regarding Concrete Sealing in Shoals. | 2019-04-24T15:49:37Z | http://www.concretesealingguys.com/wv/concrete-sealing-in-shoals/ |
Chicago, 1920: Hadley Richardson is a quiet twenty-eight year old who has all but given up on love and happiness- until she meets Ernest Hemingway and her life changes forever. Following a whirlwind courtship and wedding, the pair set sail for Paris, where they become the golden couple in a lively and volatile group that includes Gertrude Stein, Ezra Pound, and F. Scott and Zelda Fitzgerald. A deeply evocative story of ambition and betrayal, The Paris Wife captures a remarkable period of time and a love affair between two unforgettable people. | 2019-04-22T06:52:57Z | http://goodreads.mercerlibrary.org/2012/07/ |
hw-multivit®ontains a balanced quantity of all the essential vitamins for ornamental fish and invertebrates. It strengthens their natural resistance to disease, and boosts their well-being, colorfulness, and willingness to spawn.
hw-multivit® is equally well suited for use in freshwater and seawater aquariums.
hw-multivit® is especially tried and trusted for the subsequent breeding of delicate young fish and larvae. | 2019-04-23T18:42:52Z | https://www.aquafanatic.co.za/product/watermaintenance/supplementsbuffers/wiegandt-multivit-multi-vitamin-complex-for-marine-and-fresh-water-1000ml/ |
TORRANCE, Calif. (AP) — A leak at a Southern California oil refinery prompted warning sirens to go off in the surrounding community before it was contained.
A statement from the Exxon Mobil refinery says air monitoring turned up no danger to the public and an “all-clear” notice was given minutes later.
The Torrance Fire Department says the leak on an 8-inch crude oil pipeline caused a large column of smoke to leave the refinery and hover over the neighborhood. Residents were told to stay in their homes and close their windows, but the leak was contained soon after.
Exxon Mobil says the release consisted mostly of steam.
The same refinery was crippled by a February explosion that slightly injured four contractors, heavily damaged equipment and rained ash on homes and cars.
The company announced last month that it is selling the refinery for $537 million to PBF Energy Inc. | 2019-04-24T10:46:57Z | http://www.firedirect.net/index.php/2015/11/usa-leak-contained-at-exxon-refinery/ |
If you ask many people, looking great is one of their biggest priorities and something that they think about a lot. The journey of finding some of the accessories that are going to be the best for you can be exciting although, there are many options and varieties. One of the things that many people are now considering are some of the accessories are eyewear, for example, some great glasses. There are quite some popular people, for example, some great actors that have been supported using some eyewear also. The number of people that are using online platforms to get the eyeglasses or eyewear is so many, and it is mainly because they have become popular. One thing that you need to notice however is the fact that finding the best kind of eyewear can be difficult because there are many options. Your eyesight is going to be much more improved when you decide to use eyewear, and that’s why it is something you have to consider. The information in this article will be of great benefit to you because it will help you understand the best type of man’s eyewear that you should be using.
One of the biggest trends that have been there in this accessory industry is the use of transparent frames for eyeglasses. Many people today, are accustomed to using black or brown frames which were used traditionally but, the use of transparent frames is one of the new things that is happening. Having this kind of accessory in your wardrobe is going to be perfect, and it is going to be something that will allow you to our to any type of clothing you have. You should be able to add this kind of accessory to your wardrobe just because of this benefit. Another trend that is happened in man’s eyewear is the use of slimmer metal frames for the eyeglasses and, they are considered to be great. The fact that these are light weight metal frames, they’re going to be more comfortable on your face, and they will help you to look great. They also going to allow you to have that very sleek look which is perfect especially for men.
Wooden frames have also become very common in the fashion industry today because of how great they look. The kind of look that you are going to get when you decide to use wooden frames will be very classic. The information in this article also helps you to understand more about wooden frames and about how they will allow you to look great because of these many varieties that are close to your skin color. | 2019-04-19T01:28:05Z | http://healthfitnessvirginia.info/the-essentials-of-wellness-getting-to-point-a-3.html |
For a business success of the company GETT Gerätetechnik GmbH it is crucial to work together with suppliers that represent distinct competitive, highest quality awareness and innovation.
We are receptive to reliable partners with whom our own company goals can be realized.
For this purpose, please download the Supplier self-assessment and return it filled in to Purchase@gett.de.
If your profile is interesting for us, our Purchase department will contact you. | 2019-04-18T22:47:00Z | https://www.gett-group.com/node/798 |
Virginia Vehicle Wraps, Website Design, and Banner Printing.
Flash Forward Media offers all of our services including vehicle wraps, banner printing and website design to Virginia. We offer vehicle wrap design, print and installation to all of Virginia. Flash Forward Media's award winning graphic artists head up all of our vehicle wrap and graphic projects; they will create an eye catching design that embodies your Virginia based company's branding. With over ten years of experience in the business Flash Forward Media is able to satisfy every client's graphic needs. Using phone, email and FTP programs we will work with you through out the vehicle wrap design process until you're thrilled with your design. Once you have approved the design we will move along to the print process. Once the production is complete we will ship the material to your location in Virginia using either Fed EX or UPS. While the material is in transit we will have one of our local Virginia 3M Certified installers either come out to your location or have you meet them at their local facility. We have over 300 installers nationwide so you can be sure that we will have an excellent installer close to you. Show your local market that your business is on the cutting edge of advertising and start your vehicle wrap project today! Call Flash Forward Media to request your free quote and jump start your Virginia based business with a vehicle wrap.
We also offer Banner design and printing in Virginia. You'd be surprised how much attention a vinyl banner can attract. We will help you design a vinyl banner for your Virginia based business that looks professional and exciting. We only use the highest quality material and highest quality ink for the construction of our banners so you can be sure you will have maximized longevity and durability. We offer both grommet and poll-pocket options for fastening your vinyl banner. We have the capability to handle banner projects of all sizes. Need a banner that is three stories tall? Need 1,000 standard-sized banners? We do it all! Call us today for a free quote on your Virginia banner project.
Having a website in today's digital world is no longer an option, it's a necessity. If you do not have a website for your Virginia based business, or if your site looks like it needs some revitalization let Flash Forward Media help! We have a huge array of capabilities that we can apply to your website, including search engine friendly construction, Joomla! content management system implementation, and much more! At Flash Forward Media, we work with our clients remotely to maximize our efficiency and to limit distracting you from your business. Let our Flash Forward designers help you bring your Virginia-based business' website to the next level. Give us a call today - our websites may be more affordable than you might think!
If you want to make a BIG statement bus vehicle wraps and graphics are the best way to get your message across. Chartered buses, tour buses, tour buses, coach buses, or shuttle buses. We can wrap it all! Our in-house design team has years of experience designing on an array of different types of buses and can guarantee that you will be satisfied with your design. From rock bands to political campaigns we can design it all. And you can be sure that we use the best material offered by 3M. The 3M material we use, we guarantee, if removed by one of our 3M certified installers it will not damage the vehicle. So if you are renting or chartering a bus after your event or tour is complete we can remove bus wrap and no damage will be done to the body and underlying paint. Bus wraps and graphics are one of the most effective ways to advertise and make a statement that no one can ignore. We can design, print and install in all of Virginia.
Virginia Vehicle Wraps, Banner Printing, Website Design, and More!
The Economy of Virginia is well balanced with diverse sources of income. From the Hampton Roads area to Richmond and down to Lee County in the southwest includes military installations, cattle, tobacco and peanut farming in Southside Virginia. Tomatoes recently surpassed soy as the most profitable crop in Virginia. Tobacco, peanuts and hay are also important agricultural products from the commonwealth. Wineries and vineyards in the Northern Neck and along the Blue Ridge Mountains also have become increasingly popular. Northern Virginia (once considered the state's dairy capital) hosts software, communications, consulting, defense contracting, diplomats, and considerable components of the professional government sector. As of the 2000 census, Virginia had the highest number of counties and independent cities (15) in the top 100 wealthiest jurisdictions in the United States based upon median income, in addition, Virginia tied with Colorado as having the most counties (10) in the top 100 based on per capita income. Loudoun and Fairfax counties in Northern Virginia have the highest and second highest median household income, respectively, of all counties in the United States as of 2006.
The state GDP of Virginia was $383 billion in 2007, higher than the larger state of Michigan and comparable to Saudi Arabia. The per capita personal income was $35,477 in 2004. As of 2000, Virginia had the highest number of counties and independent cities, fifteen, in the top one-hundred wealthiest jurisdictions in the United States based upon median income. In addition, Virginia tied with Colorado as having the most counties, ten, in the top one-hundred based on per capita income.
In 2006 and 2007, Forbes Magazine voted Virginia as having the best climate for business in the United States citing economic growth, business costs/incentives and quality of life. CNBC ranked Virginia as the top state for business in 2007 as well.
There are seven Fortune 500 companies headquartered in Northern Virginia, and nine in the Richmond area (most of which are within the city itself.) Only five metro areas in the country have more Fortune 500 companies than the Richmond area. Virginia has seventeen total Fortune 500 companies, ranking the state tenth nationwide. Additionally, ten Fortune 1000 companies are in Northern Virginia, with a total of twenty-nine in the state. With only 1% of the Hispanic American population, the state claims 3.6% of Hispanic 500 companies.
Virginia, arguably the wealthiest southern state before the Civil War, recovered from the Civil War and the Great Depression much faster than the rest of the South. Today, Virginia is still one of the wealthiest states in the South. Virginia is also one of twenty-two right-to-work states.
Virginia is also comparable to Alaska and ahead of North Dakota and New Mexico in per capita defense spending.
According to the American Electronics Association, Virginia has the highest concentration of technology workers of any state. Computer chips became the state's highest-grossing export in 2006, surpassing its traditional top exports of coal and tobacco, combined. The Dulles Technology Corridor centered on the border of Fairfax County and Loudoun County near Dulles International Airport has a high concentration of Internet, communication technology and software engineering firms.
Choosing the right Virginia vehicle wrap company requires a good amount of research and a complete understanding of your company's advertising needs and budget. Whether you're looking for a full commercial advertising vehicle wrap or a slick matte black wrap or maybe a more economical partial wrap, there are several key factors when choosing a car wrap company. Flash Forward Media offers all of our many vehicle wrap and graphic services to most areas in Virginia. Including bus wraps, trailer wraps, RV wraps and even building wraps Flash Forward Media has a myriad of wrap options to offer your Virginia based company. If you have delivery vehicles or other vehicles that are going around your service area in Virginia, why not be advertising! You may be surprised how much legitimacy and attention is attracted by a wrap. Virginia is a diverse, ever expanding state that is one of the best places to have a business. Make sure your Virginia business gets noticed with a professionally designed, completely original vehicle wrap. One thing that separates Flash Forward Media from other vehicle wrap companies is that we offer more than just car wrap and graphics. We can also offer business card printing, banner printing, direct mail campaigns, website design, and even yard signs. We like to think of ourselves in being like a small ad agency for small businesses. By finding a vehicle wrap company that can provide your Virginia business with such a wide range of services, you don't have to contact multiple companies to suite your advertising needs. You can depend on one company to take care of all your vehicle wrap and advertising needs. With over eight years in the advertising and vehicle wrap industry you can be sure that Flash Forward Media has the ability to complete any project and exceed our clients expectations. Vehicle wrap material and installation are also a very important parts of the wrap process. At Flash Forward Media we use only 3M certified installers and the highest quality 3M material. Call us today for a free quote and start advancing your Virginia based business.
If you are looking for a Virginia wrap company please call us today. | 2019-04-20T11:14:49Z | http://flashforward-media.com/index.php/nationwide-service-car-wraps-and-graphics/virginia-vehicle-wraps-and-graphics |
Do you know someone within SIPS who consistently goes ‘above and beyond’?
Has someone helped you on a project or taken care of a task that has made your life easier?
Is there someone that you simply know you can rely upon when you need support or have questions?
SIPS now has a way to recognize individuals or specific groups of people with the SIPS Kudos award! Individuals receiving a Kudos award will receive a thank you card detailing how they have made a difference, along with a token that will serve as a reminder. Awardees will also receive school-wide recognition for their efforts in SIPS newsletters and director updates. Anyone can recognize anyone, so the next time you are feeling appreciation for assistance, support, or a job-well-done, think about giving them a Kudos. | 2019-04-20T10:44:43Z | https://sips.cals.cornell.edu/news-events/sips-staff-kudos/ |
As we’ve shown on this site before, the front mounted radiators of the 996 collect all kinds of debris over time. We bought this kit from Rennline many months ago, but never got around to putting it on. Since we had the bumper cover off this weekend for some other work, we thought we’d try it out (and clean out the debris again).
The install process is fairly easy. The hardest part is getting to all of the appropriate screws to remove the bumper cover. Put your car on jack stands and remove the front wheels. Start by removing the screws under the cover-plate for the trunk release. Pop out the side-markers and remove the two screws there. Pop the two closest quick-releases to the side markers, and remove the screw that mounts up into the side-marker. Shift to the bottom of the bumper cover. Remove the five torx screws. The cover should slide forward and off of the bumper.
We’ll be working from the back side of the bumper cover to install the grilles. We don’t have a third radiator in the middle of our bumper. There’s a blanking plate that covers this space. You could remove the plate to add a grille, but we just skipped that step. The grill is included in the kit.
Fit the grilles and bend them to conform to the shape of the openings. Use the screws included to the kit to attach the grilles, taking care not to screw anywhere that would be visible from the front. Because the grilles fit between the black housing and the rubber radiator ducts, it takes some finesse to get the bumper cover back in place when finished, just be patient and work both sides evenly.
When finished, it’s a very clean look. But would I still buy the kit today if I had a choice? Probably not.
These grilles are pricey for what you get. If I were doing it again, I would just buy some Gutter Guard at home depot and some short, sell tapping screws. When you buy this kit, you’re really just buying time. How much time would it take you to figure out the right shape, bend and cut the raw material, then figure out where best to attach it. The shape isn’t that complex and the grilles are sandwiched between the bumper cover and radiator housings anyway so they don’t need to be that secure. Save your money and try it the Home Depot way first. If you fail, you’re only out $5. If you succeed, you just saved $270.
Have you ever needed to change a drain plug or a drain plug seal ring, but didn’t want to change your oil? This post shows you how by using your shop-vac to pull a vacuum on the oil fill tube which will hold the oil in your oil pan even when you remove the drain plug.
You will need a clean shop towel, folded in quarters; a shop vac hose adapter that’s slightly larger than the oil fill tube opening; and assistant to hold it in place and operate the shop vac. In this case, I’m working on a Porsche 996. The 2.5 inch hose adapter fits over the fill tube and is taped to the end of the shop vac hose. It is very important that the hose adapter not move or you will lose the vacuum holding the oil in the pan.
Listen to the tone of the shop vac once the video starts. You will hear the tone change when the drain plug is removed, but the oil will not start flowing as long as the vacuum stays on. To change the drain plug seal ring, you just need to keep the vacuum running and you have time to remove the plug, change the ring, and put the plug back in. Wait until it’s is hand tight before you release the vacuum. In this video I’m actually going to dump the oil for an oil change (using Driven DT-40), but I wanted to show you how it works and that there really is oil in this engine. Enjoy.
The engine in the 996/997 hangs from the motor mounts rather than sitting on them as in most other cars. As a consequence of this design, it’s hard to tell by visual inspection when they’ve worn out. As they stretch and degrade over time the car may idle rough or one side of the exhaust may appear to hang lower than the other. Once you take the mount off of the car, you can see as in the photo above how the old one is distended compared to the new one.
The replacement procedure is very simple and can be done by any shade-tree mechanic with a good floor jack. Jack-stands for the rear of the car help, but are not required. One could just park the car on some 2x4s to get a little additional working room and easily make the swap with just the jack. We recommend using jack-stands just because it’s easier to move around under the car. Make sure the engine is cold before trying to move your hands through the exhaust-header to get to the lower nuts. As long as you only remove one mount at a time, you don’t have to worry about repositioning the engine to make it line up with the mount. You can choose to use stock mounts; solid motorsports mounts; or semi-solid. I went with stock.
Tools required: Socket wrench; torque wrench; 13mm socket; 18mm socket (deep); and a 6 inch extension. Parts needed: Two replacement mounts, Porsche Part Number 993-375-049-08-M270 (for 1999-2005 non-turbo 996.) [Yes, that is a 993 part number, and yes, it is correct.] 997 Porsche Part Number is 997-375-049-08. If you are going to Track your car, consider upgrading the motor mounts to a more solid design. You’ll get less engine movement at the price of bit more vibration at idle.
Like all of our DIYs posted here: Proceed at your own risk — no wagering. These instructions are intended to familiarize you with the process and are not a substitute for a good shop manual.
Safely jack up the rear of the car and place on jack-stands.
Place the floor jack under the engine just behind the oil pan as seen in the photo. Use a block of wood (or a hockey puck) to avoid damaging the engine.
Support the weight of the engine with the jack but do not lift the car off of the jack stands.
Loosen two bolts and swing the secondary air pump out of the way.
Start at the right mount and remove the lower nut using a deep 18mm socket and a 6 inch extension.
Remove the two upper bolts with a 13 mm socket and remove the old mount.
Inspect and clean the area where the mount sits in the chassis.
Insert the new mount. Install two upper bolts and torque to 25 ft lbs.
Install lower nut and torque to 63 ft lbs.
Repeat procedure on the left side.
Replace secondary air pump and air box.
Lower car and inspect exhaust tip position.
On the way to Hilton Head Island this past week, we stopped by the North Carolina Museum of Art which is hosting “Porsche by Design: Seducing Speed” through January 20, 2014. The show presents 22 Porsche automobiles going back to 1938 including the 1949 356 Gmuend Coupe (above) as well as Steve McQueen’s 356 Speedster and Janis Joplin’s art car. The collection includes 5 cars from the Porsche museum — a first for a North American exhibition — including the single ugliest Porsche Prototype we’ve ever seen.
This car was presented to Ferry Porsche as a birthday present in 1989. Sort of the ugly sweater your aunt gave you, he drove it a few times and then found a safe place to “preserve” it in the museum. The coolest feature of this car was the Porsche Crest tread pattern in the tires.
Steve McQueen’s 356 Cabriolet is still owned by his son, Chad.
And the Janis Joplin car is very, er…. unique. I guess if you can’t recall the Summer of Love, you just don’t get it.
I enjoyed seeing the 917K, 962C, and IROC RSR race cars, but my favorite car of the show was the 1963 901 Prototype that started the life of the 911.
The full set of photos from the show is here on Flickr. | 2019-04-24T14:56:40Z | https://www.specr53.com/blog/tag/porsche/ |
Usually the costs of something rise as you do or have more of it, while its benefits fall. So unless the cost of the first unit is already very high or the benefits of the first unit are already very low there is some amount greater than zero that it is optimal to have or do. This is true for an individual and for a society. The first car you have massively changes your life. The second one adds pleasure, variety, and a good deal of practicality in some situations, but it's much less useful than the first. Nearly no one has three cars to themselves because the benefits are vanishingly small and the cost is rising for storage, upkeep reasons.
The first few million cars in a society the size of the UK are amazingly useful, the next million go to people who don't need them as much but do add to congestion, pollution and so on. The forty-millionth or sixty-millionth car starts taking up way more space than it's worth.
Well as the title suggests I think it's possible we might be approaching (or already have gone past) this point when it comes to smoking regulation. I wrote before about how plain packaging was probably a mirage (incidentally I learned today that the UK would drop three whole places, from 2nd to 5th on the GIPC's index of intellectual property rights protections if it passed it; though many of this blog's readers probably wouldn't mind that).
This isn't just a musing. A new paper in the Journal of Cost-Benefit Analysis ("Retrospective and Prospective Cost-Benefit Analysis of US Anti-Smoking Policies" (pdf) by Lawrence Jin, Donald S. Kenkel, Feng Liu & Hua Wang) says roughly the same.
We use a dynamic population model to make counterfactual simulations of smoking prevalence rates and cigarette demand over time. In our retrospective BCA (Benefit-Cost Analysis) the simulation results imply that the overall impact of antismoking policies from 1964 – 2010 is to reduce total cigarette consumption by 28 percent.
At a discount rate of 3 percent the 1964-present value of the consumer benefits from anti-smoking policies through 2010 is estimated to be $573 billion ($2010). Although we are unable to develop a hard estimate of the policies’ costs, we discuss evidence that suggests the consumer benefits substantially outweigh the costs.
We then turn to a prospective BCA of future anti-smoking FDA regulations. At a discount rate of 3 percent the 2010-present value of the consumer benefits 30 years into the future from a simulated FDA tobacco regulation is estimated to be $100 billion. However, the nature of potential FDA tobacco regulations suggests that they might impose additional costs on consumers that make it less clear that the net benefits of the regulations will be positive.
Especially cool is the chart of a rational level of cigarette smoking, based on the benefits to the smoker of fulfilling their preferences vs the costs of frustrating their preferences for better health and a longer life.
I'm not saying that this research is conclusive. One paper is one paper. But I think it's getting to the point where further cigarette regulation is becoming intrusive and costly without necessarily producing large benefits to its purported targets. We should consider if we've maybe hit the cigarette regulation sweet spot. | 2019-04-24T12:27:27Z | https://www.adamsmith.org/blog/regulation-industry/we-might-be-at-the-right-level-of-smoking-regulation |
Access to the Ashdown Marks website is confirmation that you have understood and agreed to be bound by all of these terms and conditions.
Whilst Ashdown Marks uses all reasonable efforts to ensure that the information published on this website is accurate, current, and complete at the date of publication, no representations or warranties are made (express or implied) as to the accuracy, currency or completeness of such information. Ashdown Marks cannot accept any responsibility (to the extent permitted by law) for any loss arising directly or indirectly from the use of, or any action taken in reliance on, any information appearing on this website or any other website to which it may be linked.
Ashdown Marks makes no warranty that this website is free from errors, defects or viruses.
The entire contents of this website (except the crown copyright location maps) are the property of Ashdown Marks and are subject to copyright with all rights reserved. You may download or print individual sections of the website for personal use and information only provided that these properly indicate Ashdown Marks's copyright and other proprietary notices. You may not reproduce (in whole or in part), modify, decompile, disassemble or transmit or use for any commercial purpose whatsoever any information from this website without Ashdown Marks's prior written consent.
There is no guarantee that any e-mail you send will be received by Ashdown Marks or that the confidentiality of that e-mail will be maintained during internet transmission. | 2019-04-20T09:11:47Z | http://ashdownmarks.co.uk/terms |
The bee’s are not the only thing buzzing this spring. The biggest buzz on the internet is Nidink’s 3rd birthday party on March 20th.
as we mark our 3rd birthday!!!
We can guarantee surprises in store for everyone, as well as fun events… 106themix radio will sponsor trivia and name that tune from 2-3 pm EST in crib and moving to spades for 3-4 pm EST.
Other games, bloopers, dedications and more will make this event one not to be missed.
As can be expected from the best gaming site on the net, there have been improvements over the past year.
Nidink introduced 4 handed crib, the bots in crib and backgammon have had lessons and play the game better than ever. There have been options added to canasta, euchre and spades have been updated.
Nidink welcomes all the new My Space and Facebook players who have become part of our family as more and more of them make their homes here.
Drop in and join us for a day of fun and adventure as well as our regular games. You’ll be glad you did! | 2019-04-20T08:14:18Z | https://www.nidink.com/index.php?option=com_content&task=view&id=389&Itemid=2 |
Did you miss Matt Lauria? I did. After two weeks of reruns, he was back in last night’s The Chicago Code with the first of six all-new episodes to finish out its critically acclaimed first season. To mark the occasion, Lauria and I sat down to discuss his role as Chicago rookie detective Caleb Evers, the NBC premiere of his previous series Friday Night Lights, and what it’s like working with some true heavyweights to make one of the best shows on television.
You’re in a unique position: you’re not in production while your show is airing. Is it different to have done all the work already and just watch the whole thing unfold?
One of the things I like about you is that you’ve always got something to say in the show’s behind-the-scenes videos. Have you also figured out a lot about your character? How much input do you have when it comes to Caleb?
The reason I’m in the behind the scenes stuff is every time any of them were on set, I was always really eager to volunteer. I was excited. Anything I could do to help promote the show.
It’s interesting. Shawn [Ryan] has really well drawn characters and relationships, and as the season rolls on, it becomes more collaborative. The writers pick up the rhythms and nuances, and over time, they kind of make you look good. They cater to your choices with the character. It’s a give and take, which wouldn’t exist without great writing.
I have to ask because he’s absolutely blown my mind: what’s it like working with Jason Clarke? How fun was it to do the scene where Caleb confronts Jarek about his infidelity (at the end of “The Gold Coin Kid”)?
He’s a great actor, and he’s a really intense artist. He brings an intensity to his work and to his discipline with the work, and it really sets the bar pretty high. Consequently, I’ve learned a tremendous amount working with him. He’s also a very generous actor. Even people who were in one scene, he makes sure that he really gives in a way that will ensure a great performance from them. He’s a really intense dude. We have a good time; we have a good balance.
That was a fun [scene]. It felt good. It’s all about trust and respect, and what’s really cool about the dynamic of their relationship is that they earn each other’s respect. Neither of them are willing to give up anything unless they see something from the other. It’s a little bit of a chess match.
That scene displays one of Caleb’s strengths – that he’s not just the stereotypical new cop. Did you consciously choose to play him to evade that stereotype?
I certainly didn’t want to play that stereotype and I think Shawn knew that was a boring stereotype, and he was trying to avoid it. [Caleb]’s got guts, he’s got intelligence, and he’s a fast learner. It’s more interesting; it makes it more dynamic.
It has to be incredibly fun to play a cop – how have the show’s action sequences been for you? I was particularly impressed that you actually had to stop and reload during the shootout in “Gillis, Chase & Babyface.” That never happens.
It’s tricky. You’ve got to [reload] without looking down.
I really don’t want to put Chicagoans to shame and I really don’t want to put cops to shame, so I’m glad that it’s working. It’s a blast. It’s feeding the twelve-year-old inside of me.
You have another series that you’ve wrapped about to start airing – the final season of NBC’s Friday Night Lights. What’s it like to know you’re going to be on TV twice a week?
It’s a great show. I started watching it as a fan, well after it’d begun airing, before I ever even knew I’d be cast in it. It’s a little hard to believe that. I’m honored.
Friday Night Lights filmed in Texas and The Chicago Code obviously in Illinois. How has it been for you to be consistently working on projects in places that aren’t the typical Hollywood backdrops?
That is a total gift. There’s a definite atmosphere. You’d never get the feel and the pace and the rhythm and gravitas of Chicago in some studio in Hollywood. With that comes the personality, the culture, the social beauty that is unique to a specific location. That’s the same with Texas.
For me, it gives me a heightened sense of accountability to serve the people. If I’m playing someone from that place, I want to fully submerge myself into their lifestyle.
With those two shows, you’ve played two roles that a lot of boys dream of being: a football player and a cop. What’s next for you? A superhero, perhaps?
That would be cool, wouldn’t it? I don’t know. I feel so blessed to have had the opportunity to have as much variety as I’ve had early on in my career. Hopefully that’ll continue.
What shows are you currently watching?
I just started watching My So-Called Life on Netflix. There are some fantastic actors in it. I also just started watching Parks & Recreation, and watched my first episode of Glee. My in-laws watch Brotherhood and love it, so I’m going to get to that.
My thanks to Matt Lauria for this interview. Check out The Chicago Code Monday nights at 9 PM ET/PT on FOX, then check in later for our review of the last episode – and stop by ChicagoCodeFan.com for more! | 2019-04-25T12:51:57Z | https://www.fanbolt.com/6139/interview-matt-lauria-from-the-chicago-code/ |
Item : 2008-010.4257 - [Interview with] Mr. Loo Wah Joon, Vernon, B.C.
[Interview with] Mr. Loo Wah Joon, Vernon, B.C.
Item is an audio cassette containing an oral history interview with Mr. Loo Wah Joon. The interview takes place in Vernon and is conducted in Taishanese. | 2019-04-19T07:12:05Z | https://searcharchives.vancouver.ca/interview-with-mr-loo-wah-joon-vernon-b-c |
"Voice dramas" (ボイスドラマ, often shortened to ボイドラ or "voi-dra") are audio dramas (ie. sound-only), which are often produced by amateur creators.
Unless the creators explicitly state that it is a fanfiction (二次創作), voice dramas are completely original works created from scratch.
They are not to be confused with fandubs, since a) they are not based on any preexisting works, and b) the works, while it may have accompanying images, are sound only.
At times, creators may do a reenactment of preexisting works by taking sections out of manga, light novel, or anime, but they are still not to be confused with fandubs, since voice drama creators often do not encode their soundtracks (or dub tracks for that matter) with animation.
1) How appropriate are voice dramas for non-Japanese speakers?
It's hard to give a yes or no answer to this question: one thing you do need to keep in mind is that hardly any voice drama groups intend for these works to be heard by non-Japanese speakers. Also, given the nature of voice dramas being original works, it usually involves a high volume of colloquial or slang language.
2) I'm still not getting how this is different from fandubs? aren't the creators amateurs who dub for fun?
Keep in mind that the act of "dubbing" is to do a recording of voice tracks for a motion picture. Fandubs are essentially fans dubbing preexisting works, may it be anime, movies, and so on. On the other hand, voice dramas consist of sound only. The closest equivalent to what the Japanese refer to as "voice dramas" would be an "audio drama."
3) Now that I know what voice dramas are, how/where can I find more of these?
These websites have links to great voice dramas. However, please do keep in mind that these websites are all in Japanese, and, as mentioned earlier, their intended audience is Japanese speakers. Also, most amateur Japanese creators are not accustomed to having their works seen/heard by non-Japanese audiences - this does not necessarily mean that they do not want non-Japanese audiences to enjoy their works, though they may be somewhat alarmed (or flattered) if they receive feedbacks from non-Japanese audiences.
website: What's a "Voice Drama"? | 2019-04-20T14:18:33Z | http://eng.nwstudio.org/vd/ |
Home Advanced Topics Advanced Resources How much did the US spend on Imported Oil in 2014?
My previous blog posts about the US spending on imported oil are finally making a difference. At least a lot of people seem to be asking how much the US spends on importing oil. Earlier this year, one of the leading United States Presidential Candidates stated that the US spent about $300 billion on importing oil in 2014. The Census Bureau reports lower numbers but only includes crude oil. My calculations are based on the U.S. Energy Information Administration (EIA) data and includes all petroleum imports. My calculations show that candidate was not far off.
Using the method I have used for several years (2013, 2012, & 2011) I estimate that the United States (US) spent $333 billion importing oil in 2014. That represents 1.9% of the US GDP for 2014 of $17.4 trillion. Last year we spent $388 billion, part of the $55 billion decrease is due to a 6% decline in the amount of oil imported and part is due to the almost 9% decrease in the price of imported oil from 2013 to 2014. Over the same time, we see an 8% increase in the domestic oil consumption in the US. Unfortunately for our planet, that means total consumption of oil by the US rose by almost 1% from 2013 to 2014.
Here is how I calculated it.
I took the monthly import numbers of barrels as reported on the EIA – US Imports of Crude Oil report and multiplied those by the average monthly price for oil on the Brent Crude Oil Average Price. I use the Brent (European) average price for oil instead of the Cushing, Oklahoma WTI price because the Brent is more appropriate for imported oil.
While consumption has remained steady, the amount of money the US spent on imported oil has dropped 28% over the past 4 years.
To put that in to perspective, as a nation, we spent $634,000 every minute on foreign oil in 2014.
To put all these numbers in perspective, the entire world was on target to spend $233 billion on all renewable energy projects for 2014. What would happen if instead of importing oil, the United States instead invested that money in renewable energy?
Of the 388 billion the article says we spent on foreign oil, how much of that was used on gas/diesel consumption? | 2019-04-21T02:16:14Z | http://www.greenlifestylechanges.com/how-much-did-the-us-spend-on-imported-oil-in-2014/ |
Achieve a flawless makeup application with Zero Pores + No fine lines primer. This oil free, weightless formula glides on seamlessly to diminish the appearance of pores and fine lines to give you a perfectly smooth canvas. Time to prime with no fine lines.
Can't find Zero Pores Plus Primer 20 ml in your size? | 2019-04-19T07:27:29Z | https://www.zalora.com.my/klara-cosmetics-zero-pores-plus-primer-20-ml-1368225.html |
Virtuoso cellist Yo-Yo Ma played on the soundtrack for the highly acclaimed and successful Crouching Tiger, doing his share to bring ten Oscar nominations to the film, two nominations for the soundtrack alone.
Ma said he had absolutely no idea the movie would be so successful when he signed up to work on it.
"I read the script. I knew the composer, Tan Dun. I knew that Tan Dun and Ang Lee, the director, were very good friends," said Ma. He approached them to see if he could help with the score.
it was a very exciting process."
Dun's score won an Academy Award for best original score, one of the film's four Oscars.
How much of Ma's own mark did he put on the music?
to find that little intersection and say, okay, they both are really happy with the result. And, of course, you don't know the final result until -- you have to see the film."
He explained further, "You look at the video and you look at the scenes and you try and get a feel from it what it needs and not to give too much, just support what it might want you to do."
The film has so far reached almost $100 million at the box office.
"I'm proud for the team. I mean, you know, I just did my little part," said Ma.
Ma and violinist Yitzhak Perlman played at the Academy Awards. | 2019-04-19T10:40:40Z | https://www.cbsnews.com/news/yo-yo-mas-magic-in-icrouching-tiger-i/ |
Note:- 1) The fee to be paid by the students admitted through LEET will be the same as applicable to their counterpart students admitted in the four year B. Tech. Programme. | 2019-04-18T22:40:05Z | http://dcrustm.ac.in/fee-structure-2014-2015/ |
Home / Greenery / Plants / Get 6 Healthy Benefits from This Plant.
Get 6 Healthy Benefits from This Plant.
The nutritional content of asparagus is very good . These vegetables help the growth of children, ward off various degenerative diseases. The name asparagus is taken directly from the Latin language, namely Asparagus officinalis which belongs to the Asparagaceae family and the Asparagus genus. In Greek, asparagus is called aspharagos, while in Persian, it is known as asparag which means growing.
Asparagus is a type of vegetable which is a two-home plant. That is, this plant is male and there is a female. Asparagus originates and is widely grown in America, especially North America, including the Valleys of California, Sacramento, New Jersey, South Carolina, and Illinois. Asparagus shoots taken as vegetables are large white, soft, and fat bamboo shoots.
Asparagus is a vegetable rich in vitamin K and can provide 35 percent of your daily needs. With the presence of vitamin K, it can prevent brain nerve stress and prevent damage to neurons that cause Alzheimer's. Vitamin K is also very good in maintaining bone density and strength. Vitamin K avoids cavities and osteoporosis.
If you want to keep your heart healthy, consumption of asparagus can be a reference. because asparagus has high folic acid, this can be a way to avoid cardiovascular disease. Asparagus can also reduce bad cholesterol because it contains fiber, potassium, and folic acid so it can control blood pressure levels and blood homocysteine.
Asparagus is rich in fiber so it is very good at digestion, consumption of asparagus will reduce diarrhea and constipation. Asparagus is also the only vegetable that contains insulin and nourishes good bacteria in the large intestine.
It aims to avoid the attack of bad bacteria, even asparagus also contains many amino acids that make it easier for you to release gas in the stomach and solve the problem of bloating.
Asparagus also has amazing functions to prevent cancer, the nature of anti-cancer asparagus is supported by the presence of glutathione, a powerful antioxidant that can break down cancer and free radicals.
Asparagus has high folate, so it is very good for pregnant women and fetal development. Not only that, asparagus can also increase male and female fertility.
Asparagus is also very well consumed every day during menstruation, because it can relieve pain, cramps and stabilize emotions during PMS. Folic acid also triggers histamine production, which can increase sexual arousal or male and female libido.
Because asparagus is low in calories and sugar, and contains insulin, this vegetable is perfect for diabetics. Insulin is a hormone that can absorb body glucose, so it is very good to be consumed every day. If asparagus is consumed every day, you can also avoid various diseases. Asparagus can improve the immune system and prevent infection-causing bacteria. | 2019-04-23T00:12:31Z | https://www.behealthyfamilies.com/2018/09/asparagus-healthy-benefits.html |
Enjoy the best of your golden years with luxury you’ve earned in a resort-style villa beside the Sandstone Point foreshore. Orianna Sandstone Point includes 122 home sites and a range of facilities including a bowling green, lap pool and fully equipped Recreation Centre.
Explore the interactive Masterplan below with points of interests within the resort highlighted.
Hover over home sites to see more information or click to see the villa design.
Take a look at the range of contemporary, architecturally designed homes, custom-made for enjoying South East Queenland’s great outdoors in style. The entire range of compact homes was developed with downsizing in mind.
Bowling Green, Boat, Theatre and much more! | 2019-04-18T18:59:15Z | https://orianna.com.au/sandstone-point/masterplan/ |
It'd be great if every business could flourish and grow by only advertising on social media. While some can (and we can help with that) others will require a fuller integrated strategy. As luck would have it, we can help with that, too!
Even better, we can tie that all together and help out a bit with analytics and insight, too! | 2019-04-20T16:42:23Z | https://tidymedia.co.uk/digitalmarketing |
Hospital pharmacy. Mother queuing with her baby to collect a drug prescription from a hospital pharmacy. Photographed at St Mary's Hospital, Lacor, Gulu, Uganda. | 2019-04-25T16:38:02Z | https://www.sciencephoto.com/media/780862/view/hospital-pharmacy |
2302 6823 Station Hill Drive, Burnaby - SOLD | Jenny Wun - Oakwyn Realty Ltd.
South Slope 3bdrm Panoramic view unit, 9' high ceiling, 2 bathroom with high quality finishing. Stainless appliances, microwave hood fan, granite countertops. Abundant amenities including exercise room, party room, hot tub, theater, library etc. Walking distance to skytrain Edmonds and minutes driving to Metrotown. Great opportunity!! | 2019-04-25T04:10:21Z | https://www.jennywun.com/property_details-3-135671.html |
Juicing The Ultimate Guide To Juicing How To Lose Weight And Detox Your Body Easily Free Report Inside is good choice for you that looking for nice reading experience. We hope you glad to visit our website. Please read our description and our privacy and policy page.
Finally I get this ebook, thanks for all these Juicing The Ultimate Guide To Juicing How To Lose Weight And Detox Your Body Easily Free Report Inside can get now! | 2019-04-24T04:55:57Z | https://do5.b00kmedia.ru/download/juicing+the+ultimate+guide+to+juicing+how+to+lose+weight+and+detox+your+body+easily+free+report+inside |
The Intellectual Dark Web ladies and gentleman.
I was meeting with Sam Harris, a neuroscientist; Eric Weinstein, a mathematician and managing director of Thiel Capital; the commentator and comedian Dave Rubin; and their spouses in a Los Angeles restaurant to talk about how they were turned into heretics. A decade ago, they argued, when Donald Trump was still hosting “The Apprentice,” none of these observations would have been considered taboo.
Today, people like them who dare venture into this “There Be Dragons” territory on the intellectual map have met with outrage and derision — even, or perhaps especially, from people who pride themselves on openness.
Is the Intellectual Dark Web a cadre of free thinking intellectuals prepared to challenge orthodoxy? or is it a collection of contrarian tossers?
All those arguments boil down to "White hetero men don't get such a free ride any more, boo hiss". Otherwise it's as Timbo says, grunts from the park bench dressed up as intellectual arguments by people with narrow minds and good vocabularies.
Harris is touting a New York Times op-ed by David Reich arguing that “it is simply no longer possible to ignore average genetic differences among ‘races.’” Reich is careful in his claims about what is known as of yet. He says that “if scientists can be confident of anything, it is that whatever we currently believe about the genetic nature of differences among populations is most likely wrong” — a level of humility often absent in this discussion. He goes on to slam researchers who, discussing race and intelligence, claim “they know what those differences are and that they correspond to racist stereotypes.” I do not find this column as troubling as Harris seems to think I will.
The background to Harris’s shot at me is that last year, Harris had Charles Murray on his podcast. Murray is a popular conservative intellectual best known for co-writing The Bell Curve, which posited, in a controversial section, a genetic basis for the observed difference between black and white IQs.
Harris’s invitation came in the aftermath of Murray being shouted down, and his academic chaperone assaulted, as he tried to give an invited address on an unrelated topic at Middlebury College. The aftermath of the incident had made Murray a martyr for free speech, and Harris brought him on the show in part as a statement of disgust with the illiberalism that had greeted Murray on campus.
The bell curve? Bloody hell, that was discredited 30 years ago. As for Reich, talk about nominative determinism.
The bell curve? Bloody hell, that was discredited 30 years ago.
The book, not the concept.
For me the whole caboodle can be put in a box, upon which sits a Fedora at a jaunty angle. I think collecting it into one group is probably doing the phenomenon a disservice (in a scholarly sense), but when I'm being lazy (99% of the time) it strikes me as a certain worldview seeking a voice, and dressing itself in 'scholarly rationality' as a way of being heard, rather than being genuinely scholarly.
See also: free speech martyrs mocking outrage by being outraged, conservatives hating PCness and advocating a mere alternative of the same, the bad-faith attacks on universities* (https://www.timeshighereducation.com/bl ... nfluential), and on. None of this is to deny certain issues et al, but they bind it all together into a narrative of civilisational catastrophe. Nah.
As ever, it's far more complex than these tools would have you believe.
Last edited by cycloon on Sun May 13, 2018 7:24 pm, edited 1 time in total.
As an aside, any surer sign you're dealing with wankers than that they've made up their own "cool" nickname?
Ivory tower elitists who ought to try living in the real world.
School of hard knocks and uniersity of life didn't do me any good harm.
Is what Dacre's columnists would churn out about any other "uppity" academic. | 2019-04-24T15:54:43Z | http://www.mailwatch.co.uk/viewtopic.php?f=37&t=6843&p=542737 |
Treated A-Frame Discounts Apply !
The treated A-frame is the perfect mount for any of the swings supplied by Beecham Swing Company!
Fits the Flip-Ware Swing (#99999), 4' & 5' Oak Diamond Back (#55554), 4' & 5' Oak Flat Bottom (#55555), 4' Polar Roll Back (#66662), 4' & 5' Treated Rollback (#10065) and the 5' Wildlife Swing (#57777). | 2019-04-22T22:36:15Z | https://logfurnitureco.com/shop/proddetail.php?prod=77777 |
At Wow Transmog Gear, we recognize that privacy of your personal information is important. Here is information on what types of personal information we receive and collect when you use and visit Wow Transmog Gear, and how we safeguard your information. We never sell your personal information to third parties.
We also use third party advertisements on Wow Transmog Gear to support our site. Some of these advertisers may use technology such as cookies and web beacons when they advertise on our site, which will also send these advertisers (such as Google through the Google AdSense program) information including your IP address, your ISP , the browser you used to visit our site, and in some cases, whether you have Flash installed. This is generally used for geotargeting purposes (showing New York real estate ads to someone in New York, for example) or showing certain ads based on specific sites visited (such as showing cooking ads to someone who frequents cooking sites). | 2019-04-25T00:42:02Z | http://wowtransmoggear.com/privacypolicy/ |
There are many stories can be described in best office decorating ideas. Use this opportunity to see some photos to give you imagination, we found these are fresh photos. Hopefully useful.
Please click the picture to see the large or full size photo. If you think this is a useful collection please click like/share button, so other people can get this information. Right here, you can see one of our best office decorating ideas gallery, there are many picture that you can surf, don’t forget to see them too.
Look by way of house decorating magazines and see what you like. Selection of knick knacks can be important and you must plan about the choice, holding in thoughts the decor your home. Some folks suppose that having trendy decor just isn't possible unless you pay handsome quantity but it's worthwhile to know that it is an easy factor to do. It is seen that many individuals just use their own ideas and creativity to show a small house right into a paradise with the assistance of modern decor concepts. Once you get began, your dwelling room decorating ideas will stream. There are many ways to decorate your dwelling room. These walls are great to make an impression with out overwhelming the room. 2. One dwelling room decorating idea that is certain to spice up your area is to decide on a daring wall color. If you don't want to paint all the partitions in your residing room a daring shade, you may paint an accent wall. Use an updated overhead fixture to offer basic gentle, and a few lamps across the room for activity lighting.
Another lighting side that is often missed is the usage of candles. You will get candles and holders in all different colors and sizes to assist obtain your living room decorating ideas. Using wealthy wanting fabrics on the windows will add a feeling of luxury to your room, and help to deliver your whole living room decorating ideas collectively. If your walls are too busy, it'll detract from the overall environment you're working to create. Here are a couple of dwelling room decorating ideas to help get your creative juices flowing. Choose drapes or curtains that praise the design model you've gotten chosen for the rest of your room. You can then use accessories to tie the colour into the rest of the room. As this is usually the room the place a household entertains visitors and spends time collectively, much thought often goes into the design. It signifies that you should not hesitate to spend time and the money you will spend can be useful for your sake.
It will likely be fun and the top consequence will probably be one thing you can regard with delight. You possibly can simply enhance the seems of any room by addition of colorful portraits and paints on the wall. You might have to make sure that you just design each room according to its use. Don't use fluorescent lights as they're very harsh, and a dwelling room is all about temper. If you end up designing a residing room decor, you can easily move your setting along with a brand new sofa so as to add a glamorous look in your house. For individuals who've a problem of budget can even find ideas of low cost modern decor by making a web-based search. Many individuals shy away from saturated colours, however these are the very hues that could make a dramatic assertion about your character. You may choose country gadgets that have a more trendy edge, and fashionable design pieces with nation aptitude. At times of decoration of your backyard with trendy decor, you possibly can suppose about adding easy flowers and pots.
You may have thought that you simply had been a rustic gal, but end up drawn to the clean traces of a modern design. Fabrics are utilized in every attainable place, and numerous throws and cushions which have a variety of textures and eye-catching colors are included. You have got to make sure about saving money so making a web based search may be useful for everybody due to the most effective companies. Even if you want each styles, you can mix them to create a mode that is your own. This way you possibly can achieve a look that you love without settling on one style. 1. Determine your design style. You can choose painted canvases that can look great all on their own, or a framed print in shades that compliment your colour scheme. You can too consider using the massive fountains in lawns or lightning in rooms as your unique means of designing. 3. Updating your window remedies will also go a long way towards improving the environment.
If you have any inquiries regarding where and how to use champignon dulux, you can get hold of us at our own page.
Below are 25 best pictures collection of best office decorating ideas photo in high resolution. Click the image for larger image size and more details. | 2019-04-20T21:04:50Z | https://sfconfelca.org/25-beautiful-best-office-decorating-ideas/ |
Today's weather is turning out to be thundery outbreaks possible. The visibility is going to be around 19 km i.e. 11 miles and an atmospheric pressure of 1008 mb . The daytime temperature is going to reach 36 °c and the temperature is going to dip to 28 °c at night. It will be mostly dry with little or no precipitation and cloud covering 41% of the sky, the humidity will be around 63%.
Tomorrow weather is forecasted to be partly cloudy. The visibility is going to be around 20 km i.e. 12 miles and an atmospheric pressure of 1006 mb. The daytime temperature is going to reach 37 °c and the temperature is going to dip to 29 °c at night. It will be dry with no precipitation and cloud covering 25% of the sky, the humidity will be around 60%.
On Sunday weather will be partly cloudy with daytime temperature reaching 38 °c. Night time temperature are expected to be 29 °c.It will be dry with no precipitation. The visibility is going to be around 20 km i.e. 12 miles and an atmospheric pressure of 1006 mb. It will be dry with no precipitation and cloud covering 37% of the sky, the humidity will be around 59%.
Monday seems to be partly cloudy. Olympic Stadium, Cambodia visibility is going to be around 20 km i.e. 12 miles and an atmospheric pressure of 1007 mb. The daytime temperature is going to reach 37 °c and the temperature is going to dip to 29 °c at night. It will be dry with no precipitation and cloud covering 31% of the sky, the humidity will be around 54%.
Patchy rain possible will be the weather pattern for the Tuesday. The visibility is going to be around 20 km i.e. 12 miles and an atmospheric pressure of 1008 mb. The daytime temperature is going to reach 38 °c and the temperature is going to dip to 29 °c at night. It will be mostly dry with little or no precipitation and cloud covering 25% of the sky, the humidity will be around 53%.
Looking at the weather in Olympic Stadium, Cambodia over the next 7 days, the maximum temperature will be 38℃ (or 101℉) on Tuesday 23rd April at around 4 pm. In the same week the minimum temperature will be 28℃ (or 83℉) on Friday 19th April at around 4 am.
The national weather service for Olympic Stadium, Cambodia is reporting Thursday 25th April to be the wettest day in the coming week with around 0.70mm (or 0.0 inches) of rainfall. Make sure to carry an umbrella if you are out and about in Olympic Stadium, Cambodia.
The windiest of all days will be Monday 22nd April as wind will reach 11mph (or 18kmph) at around 1 am.
Please also visit Olympic Stadium Historical Weather, Text Weather and Weather Charts pages. Historical or past weather forecast page provides historical weather forecast from 1st July, 2008 till now in 3 hourly interval. Text weather page will allow you to get a weather text summary for next 14 days and weather chart page displays weather pattern like temperature, wind speed, gust, pressure, etc. in graphical mode for next 14 days. We hope you like it. | 2019-04-19T04:19:55Z | https://www.worldweatheronline.com/football/olympic-stadium-weather/kh.aspx |
Failure make people bitter and cruel. Success improves the character of the man.
To bear failure with courage is the best proof of character that anyone can give... You will find that people forget the failures of others very quickly.... My last piece of advice is not to let anyone see your mortification, but whatever you fancy people are saying about you to go on with your ordinary life as though nothing unpleasant had happened to you. | 2019-04-20T06:15:42Z | https://www.azquotes.com/author/9627-W_Somerset_Maugham/tag/failure |
Matrimony is one of the seven sacraments of the Catholic Church, the one by which a man and woman join together the whole of their lives. Marriage is a means of grace in the life of the couple, and as the “domestic church” the family is the foundation of the Christian community.
At least one person must be registered and participating in the Parish for at least 3 months prior to contacting the office.
Couples must plan to begin pre-marital preparation at least 6 months prior to your proposed wedding date.
The Marriage Preparation classes (sometimes called Pre-Cana classes) are one part of this preparation process. Here at St. Mary’s we offer a series of preparation classes three times a year: in the fall, winter, and spring. You must have met with a priest or deacon prior to registering for the class. Our schedule is listed below. PLEASE NOTE THAT THE PROGRAM CONSISTS OF FOUR CLASSES ON CONSECUTIVE SATURDAYS. Couples attend all four classes; attendance is mandatory to receive the certificate of completion.
To request a marriage at St. Mary’s please complete the marriage request form by clicking here at least 6 months prior to the proposed wedding date. After submitting a request a member of the parish office will contact you shortly to walk you through the process. | 2019-04-22T20:51:31Z | http://www.stmarylic.org/marriage/ |
The Tucson Community Center Historic District is composed of three sections; the landscape surrounding the Arena, Music Hall and Leo Rich Theater; the walkway between the hotel and La Placita Village; and Veinte de Agosto Park. The Convention Center or Arena lies in the southern section of the district.
“The Tucson Community Center Historic District has been listed at the national level of significance because of its importance to the history of landscape architecture in the United States,” said Helen Erickson, CAPLA alum and Drachman project director, who prepared the nomination for the Tucson Historic Preservation Foundation in partnership with TCC Today, “This is a monumental recognition of a historic asset that many in the community have overlooked,” she said.
“This is the culmination of years of dedicated work led by Helen Erickson,” said Demion Clinco, Executive Director of the Tucson Historic Preservation Foundation. “All too often Tucson forgets we have these incredible historic gems, sometimes hidden right before our eyes,” he said.
Design by world renowned Modernist landscape architect, Garrett Eckbo (1910-2000) at the height of his career, the Tucson Community Center Historic District was completed in three stages in 1971, 1973, and 1974 under the project direction of two of Tucson’s première architectural firms, Friedman & Jobusch, and Cain Nelson Ware. The landscape is the only Eckbo – designed urban civic space in Arizona and one of the only four large urban designs that were completed during the landscape architect’s long career.
TCC Today, a volunteer community organization advocates for restoration of the Tucson Community Center Historic District and associated performance venues. To illustrate the rehabilitation potential, visual appeal and community benefits of the landscape, TCC Today has worked towards the of two demonstration areas on site. The first was completed in October, 2014; the second will be completed in October, 2015. The National Register listing will be celebrated with a ribbon cutting for Demonstration Area II and picnic on the plaza on October 17th, followed by the Tucson Symphony Orchestra’s first pops concert of the season.
The Tucson Historic Preservation Foundation, founded in 1985, is dedicated to preserving and celebrating the distinctive and irreplaceable historic resources of Tucson, Pima County and Southern Arizona. Historic preservation is an essential component of our city. In an effort to highlight the designation of this important property the Tucson Historic Preservation Foundation is holding Tucson Modernism Week, October 2-10, at the Tucson Community Center with tours and lectures about the landscape. See tucsonmod.com for more information.
TCC Today, the Tucson Symphony Orchestra, and the Tucson Historic Preservation Foundation advocate the passage of all seven of the Pima County Bond proposals on November 3, 2015. Proposition 427.9 will provide funding for further rehabilitation of the landscape, Music Hall and Leo Rich Theater.
To make a donation to help save this important landscape, visit TCCToday.org.
Photo opportunities and stock photography are available upon request. Historic photo is courtesy of Tucson Historic Preservation Foundation; other photos by fotovitamina. | 2019-04-23T14:12:35Z | http://capla.arizona.edu/news/tucson-community-center-tcc-historic-district |
can offer certainty in our communication.
This is for the “do it yourself” bride that wants to take advantage of our supplier relationships and expertise to ensure no detail is missed.
This is for the bride that needs a little help to get started and our expertise to guide them in the right direction every step of the way. This package allows you to take advantage of our supplier relationships, our expertise and destination knowledge. It offers piece of mind for the perfect day.
This package was designed for the stress free wedding. This is for the bride that wants us to take care of every detail from start to departure. They take advantage of all our expert advice, knowledge, vendor and supplier contacts, our negotiation skills for the best possible price, review of all documentation and best of all our discounts. | 2019-04-20T19:02:53Z | http://rock-it-travel.ca/wedding-packages-1 |
Steve’s breakdown: The Hain Celestial Group has 37 brands in its portfolio of mostly food products that help people have A Healthier Way of Life™.
They love magazine advertising and ad budgets have gone threw the roof. Now with the founder out, the organic farming gloves are coming off and that’s your cue to get these guys by the cornucopia.
LAKE SUCCESS, NY: Organic and natural food products company The Hain Celestial Group Inc. announced Monday that its board recently named former Pinnacle Foods executive Mark L. Schiller as its president and chief executive officer succeeding the firm’s founder, Irwin D. Simon.
The former Pinnacle Foods executive vice president and chief commercial officer will join Hain on Nov. 5 this year. He brings to the company over 25 years of experience in executive roles at consumer packaged food and beverage companies.
In Schiller’s most recent role, he oversaw Pinnacle’s grocery and frozen segments, including marketing strategy, innovation, product development, and commercialization, driving record market share gains, sales growth, gross margin, and profit growth.
“I am proud of what we accomplished during my eight years at Pinnacle Foods, and believe in driving continuous operational improvements while making disciplined investments in innovation and brand building to achieve success at Hain Celestial,”a statement by Schiller said. | 2019-04-18T18:37:59Z | https://ratti-report.com/industry-food-bev/founder-is-out-charge-to-pitch-these-37-brands/ |
Bella remains devastated after Edward's departure, but she functions. She has a life, just like Edward wanted. She doesn't know if she can give it up if Edward returns. Edward has been on a six year treacherous journey back to Bella only to find that he is unable to control his bloodlust at their reunion. Can their forbidden love be resurrected? Will their love conquer all?
When Garrett Barker is apprenticed out, little does he know that the path now chosen for him will lead to great revolution in more ways then one.
Rated R for graphic descriptions of battles, illnesses and treatments. Some drug use (medical), drinking, smoking references. | 2019-04-19T15:26:34Z | http://twilighted.net/browse.php?type=characters&charid=74 |
Davide Barranca, whom most of you know, is about to finish his book on Extendscript - a much needed resource! Most of you know how scattered information is on Extendscript, and this book consolidates a lot of that information. He gave me a preview of his chapter on AM code, which has always given me issues, and it was very good.
There is an early bird special to get the book before it is fully ready, so if you're interested, see the link below.
Re: New Book on Extendscript!
If I want to buy these what are the payment option in that case? | 2019-04-21T04:18:36Z | https://www.ps-scripts.com/viewtopic.php?f=75&p=169159 |
The children's cloak raincoat allows the child to free their hands and let the children play freely in the rain. The cute design makes the children the focus of the crowd. The cloak design is breathable, say goodbye to the wetness of the traditional raincoat to the child, uncomfortable.
Folding when not in use, does not occupy space.
Made of environmentally friendly PVC material for durability and anti-aging.
The transparent hat is designed to block the rain from obstructing the child's sight.
The shoulder umbrella design is more waterproof, and the bag is not afraid of getting wet.
Diameter: 69cm(S) / 75cm(M) / 79cm(L).
Applicable Height: 80-120cm(S) / 120-150cm(M) / 150-170cm(L).
1 x Children's Cloak Raincoat. | 2019-04-23T18:41:32Z | https://www.nextelect.shop/products/childrens-cloak-raincoat |
What Factors Influence The Individual Person And Businesses To Donate To Charities?
5.2 Why and how people give?
Overall donations to charities is dominated by Inner Directed people. Inner Direct people are the most likely out of the three to give to a cause as they are the tester and innovators and are always question what is right and what is wrong.
In these following graphs the axis is the average from the population that was asked during the survey. So the first graph shows that 11% agrees with the statement ‘they are regular givers and give to one or more charities’ it shows that Inner Directed people are 30 times more likely than the average person to donate. So here Inner Directed people are over-indexed by 30% which means they are 30 % more likely to give to more than one charity than the average person.
Whereas Sustenance Driven people are 26 times less likely to donate than the average person. Meaning they are under- indexed by 26% meaning they are 26% less likely to donate to more than one charity at any given time.
These figures show that Charities such as the British Red Cross should focus their marketing efforts mainly towards the Inner Directed group as they are 30 times more likely to donate to more than one charity than the average person so if people are already donating to other charities, by focusing on the Inner Directed people the British Red Cross could be getting donations as well as other charities. If the charity also looked at the other two types of people and did some persuasive campaigning to get their attention they would be able to widen their appeal range and increase donations.
The British Red Cross’s new advertising campaign does just this and focuses on all three types of people. The advert shows clips from both the UK and Less Economically Developed Countries such as places in Sub Saharan Africa, it shows scenarios such as fuel poverty in Brittan which is a major problem in the UK with millions of people living in fuel poverty. During the winter of 2012/13 over 30,000 people died during the winter due to the cold. The advert also showed starving children in Africa where it is estimated that 3.5 million children die every year due to undernourishment and the diseases linked with it. As the advert shows both poverty close to home and poverty in other parts of the world they are attracting the attention of both types of people meaning a larger proportion of the population will donate to the charity.
5.3 What type of charities do people give to?
Each of the three sections responds to very different charities. Sustenance-Driven are attracted to institutions such as the Army/ military and hospitals, this is linked to the fact that sustenance-driven people have a strong interest in the safety and security of their communities and nation. They are more interested in what is happening in the UK rather than international and overseas work.
Find Another Essay On What factors influence the individual person and businesses to donate to charities?
"What to Ask the Person in the Mirror"
What factors contribute to Alcoholism? | 2019-04-23T13:58:48Z | https://brightkite.com/essay-on/what-factors-influence-the-individual-person-and-businesses-to-donate-to-charities |
Looking to get into Pilates? KX Pilates Brighton, located in Brighton, will set you up and have you feeling vigorous and healthy with their team of welcoming staff. Build your endurance. KX Pilates Brighton is Brighton’s answer to pilates. Book in and treat yourself.
Like to share your experience of KX Pilates Brighton ? SIGN IN and write a testimonial. | 2019-04-19T23:21:47Z | https://www.honee.com.au/v/melbourne/pilates/kx-pilates/kx-pilates-brighton |
I have often reflected over the past years on my hypocrisy. I was brought up in the church and taught to pray from an early age, I became a minister of religion and preached on the importance of prayer. Yet time, silence and my reality as a gay man rusted the bars of belief in a personal God until now I no longer believe. My hypocrisy lies in the fact that though no longer believing I still find myself casting prayer into the universe, a reflexive habit from my days in the church? This poem attempts to capture some of that feeling of hypocrisy. | 2019-04-18T14:18:17Z | http://www.badgersmusings.com/2015/02/ |
The oral cavity may be the target organ for a number of diverse abnormalities that develop from side effects of medications.
Oxygen is an important factor for wound healing and a lot of clinical and experimental studies regarding different oxygen therapies for promoting wound healing are present in the literature. There are essentially 3 type of oxygen therapies : local oxygen therapy, hyperbaric oxygen therapy, and supplemental inspired oxygen therapy. There are many positive outcomes that promote the use of oxygen treatment in the stimulation of wound healing. In the mouth it is used overall hyperbaric oxygen. A recent study demonstrate that there is a positive influence of hyperbaric oxygen on the initial stages of bone healing. We report a case of oral wound healing after a session of local therapy performed with a device that pours a jet of oxygen with the use of a particular syringe (Dreamed Medical Formula, Bologna, Italy).
A 55 years old female patient went to our private practice for a chemical burn in the hard palate developped after an aerosol therapy, present for 2 weeks without apparent regression. She reported a general good oral health, and she was undergone to aerosol therapy for a pharingeal inflammation. The size of the lesion is about 0,8 cm x 0,4 cm and it was sore (fig. 1). The patient reffered us that she is allergic to many topical medications and so we decided to avoid application of topical gel or ointment and to try to treat the lesion with application of local oxygen al 95% with the medical device first described. The oxygen jet was directed to about 1 cm above the lesion for a period of 2 minutes.he oxygen infusion with a high degree of purity stimulates metabolic activity at the level of the treated tissue. The patient felt relief after a few hours. After 2 days the lesion is almost healed and the patient was free of symptoms (fig 2).
Several topical agent are used to accelerate the oral soft tissue wound healing, and also low level laser therapy (LLLT) had shown good results but there are not papers in the scientific literature about its specific use on chemical burns in the mouth. The use of oxygen therapy in the periodontal field has already been studied. In a work authours found that the combination of oxygen therapy and SRP substantially reduced the gram-negative anaerobe loads of the subgingival microflora and the low values of pathogens persisted for at least two months after the therapy. There are no jobs that have tested this type of treatment in the intraoral wound healing. However significant positive outcomes are documented in the literature for the use of local oxygen therapies, the lack of clinical studies and vast methodological diversity made it impossible to perform a proper comparison within and between the different therapies. Further randomized clinical studies are warranted to examine the value of these therapies, especially studies that investigate the more patient-friendly oxygen dressings and topical wound oxygen therapies.
Guggenheimer J.Oral manifestations of drug therapy. Dent Clin North Am. 2002 Oct;46(4):857-68.
Signoretto C, Bianchi F, Burlacchini G, Canepari P. Microbiological evaluation of the effects of hyperbaric oxygen on periodontal disease. New Microbiol. 2007 Oct;30(4):431-7.
Neeta Misra, Debasmita Maiti, Pradyumna Misra, Ashish Kumar Singh. 940 nm diode laser therapy in management of recurrent apthous ulcer. BMJ Case Rep 2013.
Prossimo articoloL’ambiente domestico potrebbe influenzare i microbi e svolgere un ruolo importante nella salute orale. | 2019-04-19T13:12:07Z | http://www.ricercaorale.it/2017/12/10/healing-of-a-wound-on-the-palatal-oral-mucosa-after-a-single-local-oxygen-therapy-session/ |
Wear Red to spread awareness about heart disease so people everywhere will know that heart disease, the No. 1 killer for both men and women, can affect anyone in all walks of life. Our Heart Disease Shirt spreads awareness along with showing your support for a loved one battling the disease and honoring those taken from us.
Our Personalized Heart Disease Awareness Shirt is available on our premium 100% cotton long sleeve shirts, machine washable in youth sizes S-L and adult sizes S-2XL. Includes FREE Personalization! Personalized your Heart Disease Awareness Shirt with any three line custom message on the back.
Additional Info At MyWalkGear.com, we are dedicated to promoting awareness of Heart Disease and encourage others to get involved in the fight for a cure with our Heart Disease Awareness Walk Shirts and Gear. Help us help those who need us the most with our inspiring Awareness Shirt along with our Heart Disease Awareness T-Shirt and our Heart Disease Keychain. Feel great knowing a portion of your purchase will be donated to end heart disease once and for all. | 2019-04-22T08:12:20Z | https://www.mywalkgear.com/heart-disease-awareness-long-sleeve-shirt-9074375x.aspx |
Some Wedding experiences are truly one of a kind. They not only feature two amazing people celebrating their love for one another, but also explode with support from an amazingly fun group of family and friends. When you add an exotic destination like Turks and Caicos, which holds a deeper meaning for Laura and Chris than those beautiful blue hues and white sand beaches, it stacks on happiness like a pancake flight from Bubby’s. I was so honored to be the one to photograph their destination wedding at the Gansevoort Turks and Caicos (now known as they Wymara Resort and Villas). They put on an amazing welcome night at the Somewhere Cafe, a super fun snorkel trip, a tented welcome dinner at sunset right on the beach (unreal), a quick and fun photo session exploring part of the island, and a fishing trip with the guys before tying the knot on the big day on the beach in front of the Gansevoort. Feast your eyes on the happiness, fun, and genuine love and adoration these two and their families have for one another. It was one wedding I will never forget, and I’m proud to call these two superstars friends. Not only do they have an absolutely amazing album that radiates with the feelings from this week, but I managed to sneak in a highlight video that you can watch below (with thanks from Chris’s brother for the wedding footage) that adds to the awesome.
This is a big one - enjoy kids!
Susie and Pat had an incredibly beautiful, relaxed, super fun day celebrating their love. I knew this would be the case after the amazing time we had at their engagement session on a boat! The Crossed Keys was perfect for everyone to gather and show their love and support for these two. The weather was perfect for their outdoor ceremony and reception under the tent! So stoked for you two and your fun life ahead!
These two hold a special place in my heart. I’ve known Jase since he was in charge of me coming home alive from Australia while studying abroad back in 2007, and I met the love of his life Jules in Whistler a couple years after I left after living there with Jase for a winter season. As things tend to come full circle, they asked me to photograph their special day in Whistler, and I couldn’t have been happier to do so! They had been through a medical scare, which delayed the wedding but made the day even more of a special celebration. On the day of their wedding, they had one of the biggest powder days I’ve ever seen! No riding happened, but it helped provide some amazing weather for their day. Perfectly time snowfall on their ceremony exit, no rain for the way there, and a bit more snow for some family photos before heading to the reception at Whistler Brewing. It was truly a perfect day for two amazing people who deserve every bit of awesome they received!
When Heather and Jon contacted me, it was only a few months before their wedding. It blows my mind how much she and Jon pulled off in a short amount of time and stands as one of the best reception designs I’ve ever seen! Terrain and their talented wedding team did a phenomenal job. They got ready and had a rehearsal dinner at another beautiful venue, Grace Winery. After their wedding was over, we designed one of the most beautiful wedding albums I’ve seen. It is truly special that they will have this heirloom in their family forever, to share with themselves and with future family and friends. Congrats again guys!
After we spent an afternoon together photographing their love for one another, and the laughter flowed nonstop, I knew the wedding was going to be a good time! From the moment getting ready photos started, there were smiles, laughs and tears from everyone - but above all an awesome vibe carried through the entire day. Their first look at the Loews hotel was perfect, and the photo session with their whole crew that ensued afterwards was nothing short of amazing. They had a beautiful, heartfelt ceremony at the Crystal Tea Room and were even married by Christina’s brother Steve, who I’ve known to be an awesome human for many years! The party continued to impress as we knew it would! Big congrats to you guys, and a big thank you to Arielle and Jamie for helping out extra as I decided to break my toe a few days before. Legends. | 2019-04-20T04:26:18Z | https://www.stephengovel.com/blog/?category=Weddings |
When I was younger, I always dreaded the question, “What’s Hmong?” I dreaded it, not because I wasn’t proud of being Hmong or because I was ashamed, but because it was and still is a bit complicated to explain to others what Hmong is.
You see, many people are programmed to identify an ethnic group with its country of origin. People want to know where you’re from to find out what or who you are (which many of us know that what country your ethnicity is from doesn’t necessarily identify who you are). For example, Germans are from Germany, the French are from France, Vietnamese are from Vietnam, Japanese are from Japan, and so on. So, what happens when you tell someone that you’re Miao, Mien, or Assyrian?
There are three typical (awkward) conversations that I go through when people ask about my ethnic background.
I don’t get offended when people talk to me about “Gran Torino” to me this way. I am actually proud that the Hmong kind of made it to the big screen, even if it is just having our name and deeds for the US government mentioned. Wonderful! However, it saddens me that “Gran Torino” is the only reference others have of the Hmong. But mostly, it’s annoying.
Rarely do I hear others say that they know who the Hmong people are. I believe that has to do with where I live. I live in an area with not too many Hmong people. Now, if you were to drive 30 minutes south a few cities over, where there is a higher population of Hmong people, you wouldn’t get into these types of situations.
I have removed the video I posted with this blog. Thanks for reading. Have a wonderful day!
I’m still not 100% clear what is the definition of Hmong….without going into wikipedia (as if that’s totally reliable). I’ve identified it as an ethnic-linguistic minority group.
Guess it’s wrong to say minority?
and I didn’t get around to seeing the videoclip above. I need to get to bed….for work tomorrow.
Hi, may we re-post this on thesiamag.com? It would be good to tell as much people as possible that Hmong is not just Gran Torino, and definitely not from Mongolia!
I didn’t really explain what Hmong is, but you can go ahead.
Yup, I hear you about that question. What bothers me is most people associate an ethnic group to some land/country. And it’s hard to describe what Hmong is when we really have no “true” land to call home. When I explain that the Hmong origination was in China, people would say, “So then, you’re Chinese?” That’s not true of course. Some people don’t realize that there are ethnic groups that don’t have a land of their own, but just living in a country with other group being the majority. Yes people, even China has a lot of different ethnic groups that don’t speak Chinese.
Regardless, I found the best way to explain what Hmong is from Gran Torino, that we’re just a group of people, not a land. A land doesn’t define us, we define who we are.
I could definitely relate to this! This was very well written. It had me laughing inside because I’ve been through the same thing. I have gotten the “Gran Torino” movie a lot. It does get quite frustrating trying to explain to people about what “Hmong” is. I start to confuse myself sometimes. I’d like to reblog this on my tumblr, would that be okay?
Reblogging is fine. Just link back to the original post.
I asked one of my teachers what is Hmong and he couldn’t answer it. It took him about 5 good minutes to answer me..and all he got was our history. This question sure is hard to answer.. | 2019-04-19T10:46:39Z | https://ahmongwoman.com/2011/01/01/whats-hmong/ |
Goal: $6000. Challenge Grant: $4000. Need $2000.
Each dollar given will be worth 3 dollars!
They want to help us. So let's help them!
This Thanksgiving, we are thankful for your commitment and support!
Thank you for sharing with us your passion for justice! | 2019-04-21T16:07:58Z | https://disciplesjusticeactionnetwork.squarespace.com/new-events/ |
Our travel agency operates a tourist train on regular route between Nei Pori and Platamonas. The train has quickly gained high popularity among tourist as well as locals, especially children. Take a ride in this picturesque vehicle and enjoy the charming trip in the beautiful surroundings of these two popular Olympic Riviera destinations!
The ticket for the roundtrip costs € 3 for adults and € 2 for children (2–10 years). Ticket is valid for a whole round trip Nei Pori–Platamonas–Nei Pori. It expires at the moment when you leave the train.
Click the first picture from left below to check the train route! | 2019-04-24T21:45:28Z | https://www.polizostours.gr/tourist-train/ |
Since 1938, the Charlotte Rescue Mission has provided help to the homeless and those battling addiction in Charlotte, North Carolina. By offering comprehensive addiction recovery services, the organization helps to empower men and women to move beyond the cycles of homelessness and addiction so they can become productive citizens. The Mission runs residential programs for both men and women along with Halfway House, which helps men transition into self-sufficiency. The Mission also serves children as well as their mothers.
Being of service to others is fun and rewarding, whether we’re dedicating our energies to hospital and physician practices so they can put their resources toward delivering quality healthcare to their patients or contributing our efforts to support our local communities. Thank you to everyone who came out to help. Check out these great photos of our team members in action! | 2019-04-26T14:22:04Z | https://blog.meduitrcm.com/blog/charlotte-rescue-mission |
Seram Neken worked in a Manipur News English daily as sub-editor from 1994 to 1997. He was the editor of 'Echo', a quarterly journal of MUSU during 1997-1998. He also worked in the AIDS Control Society, MACS, from 1999-2008. This is first book (compilation of 50 articles which were already carried by various newspapers and dailies till 2011) "State, Society & Governance" was published in March 2012. Subsequently, He also published another collection of articles written by him during 2012 - 2013 into a book named "Voice of the Voiceless".
The author analyses the approaching 'Apocalypse' from the spread of HIV infected individuals in the North-East India in this August 2003 article.
... According to the last surveillance conducted in Manipur during Augus-October 2002, the HIV sero-prevalence among the injecting drug users, pregnant women and STD patients are 39.57 per cent, 2.4 per cent and 9.6 per cent respectively.
Heroin, which first appeared in the state in 1979-80, was widely used by youths in the early eighties. By 1984, the situation had worsened with reported crimes and vices associated with the drug abuse.
Oja Ibobi is not in our midst now, but his teachings are increasingly becoming relevant day by day. This article is my homage to the late teacher on teachers' day.
The importance of Teachers' Day celebration may simply be assessed from the view that teachers act as foundation for creating responsible citizens of a state and good human beings in the society. Life without teachers is unimaginable.
During the VVIPs or VIPs passage, the traffic police personnel including high profile police officers appear to be concerned and vigilant about smooth traffic control to show off their dutiful appearance. As soon as the VIPs leave, the public vehicles are left uncared for on the congested streets. | 2019-04-25T15:46:42Z | http://books.e-pao.net/State_Society_Governance/ |
This is an exclusive business profile of Shivan Electronics located in , Muzaffarnagar. From this Page, you can directly contact Shivan Electronics from the enquiry form provided on the right. On the left you can get the Verified Mobile Number of Shivan Electronics – feel free to call us to know more about our products & services. We will soon update our Catalog which you can download to get latest information about all our products & services and latest deals & offers by Shivan Electronics. Do check out our Job Openings section to know about all the vacancies in Shivan Electronics. You can also check out our Photo Gallery section to see latest photos of Shivan Electronics. Before leaving, do not forget to give us your review and rating if you have been a customer of Shivan Electronics in the past.
Do you want to receive special deals and offers from Shivan Electronics?
Daily Download limit reached! Do you want to alert Shivan Electronics to receive Catalogue? | 2019-04-21T08:29:16Z | http://profile.muzaffarnagaronline.in/shivan-electronics_852021 |
Beside of installing a new construction window in an existing home, in the beginning, you need to know the type of windows. The initial type is recognized as dual installed windows. It is indicated by its two sashes which go vertically up and down in the frame. It is exclusive, largely within the European homes since most of the Western domiciles are done by this original window. They actually are able to open large from sometimes the utmost effective or the bottom but still remain in the frame. This original screen style makes themselves don't protrude out to the interior and exterior of the house. That design makes only the underside the main window performs while the utmost effective part still unchanged.
Properly, if you are renovating your house, before installing installing a new construction window in an existing home, in the beginning, you need to think about exactly how many windows you will need in a single room. Also, consider the room size can be important. Do not use way too many windows in the small room. Just ensure that the sunshine may enter your whole room, and the air circulation works so optimally therefore pick a form of screen which can protect it perfectly. Do not attempt to use window styles with the larger measurement like stationary windows or bend and bay windows, contemplate for the simpler one just like a installed screen, awning windows or slider windows. They're really beneficial to minimal rooms, particularly for the bedroom or kitchen.
While for minimal home installing a new construction window in an existing home is also have to be considered. This typical screen can be easily mounted in many small or small rooms. It is available both little and big size, even custom size can be acquired for you to match your room. We know that modern home always pauses the concept, more special of the style, means more modern. So do not hesitate to utilize this kind of installing a new construction window in an existing home if you want to try the newest thing.
While for different kinds of screen, ensure that you fit the area design with the size along with windows style. If your installing a new construction window in an existing home are large or big, don't show an excessive amount of stuff on your wall, because it will properly produce your room appears packed and uncomfortable. Ensure that you just put or exhibit required types of material which do not cover on the sunlight brought by windows.
The most crucial element of installing a new construction window in an existing home is situated in the definition of of design. How to create your room based on the form of your window is actually needed seriously to consider. Each form of screen has the unique characteristic, this is exactly why you must handle your room different than others, and it should match your windows style.
To know more about installing a new construction window in an existing home let us check out our galleries to see the best window styles and types. We hope that these images below may stimulate you to have the best ideas to construct, renovate or remodeling your home.
Beside of installing a new construction window in an existing home, in selecting the best screen for your property, in addition, you need to think about some essential things, particularly in the word of advantages and cons. Each type of screen always provide pros and also cons. So you need to choose which that matches your need and carry more advantages than harms for you.
A house can not be called as a home place when it isn't completed by installing a new construction window in an existing home. The presence of windows in the home is more than important. That's why there are numerous articles on the web that explains about installing a new construction window in an existing home, the significance of screen, well-installed windows information etc. As we know that windows not only act as house accessories but in addition get an essential role in a house air circulating. | 2019-04-22T20:36:55Z | https://mapatia.com/windows/installing-a-new-construction-window-in-an-existing-home/attachment/how-to-frame-window-opening-in-existing-windowless-wall-part-one-regarding-installing-a-new-construction-window-in-an-existing-home/ |
the t-shirt fits well. The fabric feels soft but synthetic, it's a kind of stretch fabric like sportswear (running pants / fitness top). The quality is good.
Awesome ❤️ Perfect quality, good size. Little different print, but still awesome and it's printed from both sides.
the quality fabric is good, but would best if you'll no cotton. stayed very glued ao body.
horrifying quality ..... липнет all. not dust collector and t shirt.
i have the men's size, for my son of 10 years. is, but it is great happy. good quality!
cool t-shirt! ordered for the size chart, fit. baby is very satisfied! thank you store!
3 months waiting, but after that Im satisfied.
breasted 100 Shoulders 43 + good DESIGN + good material cutting free shipping FABRIC Is elastic though Leads in toda fashion embossing foil area, Is breathable. fashion me CARVING, though surely A CARVING less also would. fashion looks A Black T-Shirt photo, But really Is a very dark a poco Green free. the definition DRAWING Is not bad, But could be better. east Price By though poco More can order.
t-shirt class, though synthetic, nice but to the body. came in size, slightly longer conventional jerseys. region архангельской to. 2 долетела. and recommend store.
This chula, photo light Is More cos Is lycra no. But This chula.
high quality and print undershirt FABRIC excellent. the perfect tracking Sizing las indications free. Shipping very fast. figment and hot selling.
and more than expected блеклый расплывчатый print t-shirt, not clear.
adjusted polera, muestra such as image, high quality. arrive tardó one month, recommend.
very great quality t-shirt. stretch material is extra comfy. was a little disappointed on how long the shirt took to arrive, i was waiting for a long time.
almost see figure good, but that's удручает quality fabric, жутчайшая synthetic, titanic нулевых top t-shirts discharge of. inflated price too. | 2019-04-24T19:53:11Z | https://wearfilms.com/new-movie-it-pennywise-t-shirt-clown-stephen-king-horror-movie/ |
We offer several kinds of cleaning services for homes to accommodate the different needs of our residential clients, and the wide range of residences they might live in.
Homes in southern Utah can range anywhere from relatively modest sizes of 1,000 sq. ft., all the way up to stunning residences that literally exude luxury, and we can provide service for all these dwellings, as well as everything in between.
Sometimes simple maintenance cleans are all that you need in order to keep your residence looking neat and attractive, and this is one of our particular specialties. We will be happy to set up some scheduling options with you for recurring service, and we offer a special discount for those packages, since it benefits both you and our company. With regular visits, we can become familiar with your residence and its cleaning requirements, and you will benefit by having a very attractive and orderly home, virtually all the time.
For custom cleans, please contact us to schedule.
Know how long your cleaning is?
Need pricing for a Business?
We also offer general cleaning service, where we go through the home and address whatever issues need attention, and which you might alert us to. You may need your home cleaned before you actually take occupancy, or as you are relocating to another part of the state, and we offer a thorough cleaning package to handle these specific situations. Some clients arrange with us to have their homes cleaned while they go off on vacation, so they can come back to a clean home, and don’t have a big mess to clean up on the day of their return.
Our ‘deep cleaning’ service is our most comprehensive package of house cleaning, and is something often requested by clients as a first-time effort, to get things sparkling from top to bottom. After that, a periodic maintenance cleaning may be all that’s needed to keep things shipshape. The deep cleaning service includes scrubbing and sanitizing in kitchens, bathrooms, and anywhere else needed, sweeping, vacuuming, and mopping, and dusting off all surfaces in the home where the dust of southwest Utah has come to settle.
As a special incentive for you to try us out, we offer a 15% DISCOUNT off your first clean, to make it convenient for you to see just how good our cleaning service is.
Our goal at Maid to Perfection is to make you so happy with our service that you call us again, and that you tell all your friends about us too! | 2019-04-24T06:44:42Z | https://stgcleaning.com/house-cleaning/ |
Suit up with Zipper Mahjong Solitaire. Play the most fashionable puzzle game.
Step on all the tiles and avoid the enemies!
Get wild with Yukon Solitaire! Experience the charm of the Alaskan wilderness.
On Mothers Day, you should definitely take the opportunity!
Snake Mahjong Solitaire will strike you when you least expect it!
A Cool Commercial 3D Marbles Computer Game!
A Breakout game where the "bricks" are germs that descend to destroy you. | 2019-04-26T06:01:06Z | https://bluesoftcenter.com/Games_and_Entertainment-softcatg-1543.html |
YOUNGSTOWN, Ohio – Standard & Poor’s Global Ratings has increased Mahoning County’s long-term bond rating to AA- from A+ and assigned the county’s 2018 general bonds the SP-1+ rating.
What helped boost the rating was a surplus in the general fund, good financial policies, flexibility in the budget, strong liquidity, strong debt contingent liability position and a strong institutional framework score.
Mahoning County last year recorded its third consecutive operating surplus, with $2.5 million in its general fund, or 3.8% of expenditures, and “balanced results across all governmental funds of $866,000, or 0.5%.” Meanwhile, the 2018 budget assumes a 10% loss in revenue though the operating fund is expected to end the year with another surplus.
On the management front, S&P upgraded the county’s rating to “good” from “standard.” It noted the county’s cash reserve policy, its policy to set the first 60% of revenues from Hollywood Gaming at Mahoning Valley Race Course aside for unassigned general fund use, monthly investment reports and budgetary assumptions that rely on three years of historical data and conservative sales tax revenue projections.
S&P also reported the county has “very strong” budget flexibility, with an available fund balance of $14 million, or 21% of operating expenditures, in fiscal year 2017, an increase from 2015’s $11.2 million, or 12.7%. In addition, the agency noted Mahoning County’s total available cash is 67.2% of its total fund expenditures and 25.3 times its governmental debt service.
The county’s debt and contingent liability profile was also graded as very strong as net direct debt was 22.4% of total fund revenue and overall net debt is 1.6% of market value.
The chief hindrance to the county, Standard & Poor’s found, was a weak regional economy which is “likely to constrain it from further upward rating movement.” The agency found a projected per capita effective buying income of $51,048, while also noting a declining, aging population down 4% to 229,956 since the 2010 census and a stable base of large employers, led by Mercy Health (1,600 employees), the county (1,700), Steward Health Care (1,600) and Youngstown State University (1,200). | 2019-04-22T22:33:12Z | https://businessjournaldaily.com/sp-upgrades-mahoning-countys-bond-rating-to-aa/ |
The Viellon are the former inhabitants of the Principality of Marche-Viellon who fled to the Kingdom of Southerly, then allied with Irinie, when it was partitioned and forcibly-assimilated into the federation, prior to which it appealed to Irinie for protection.
The Viellon are commonly considered Iriniais sympathisers regardless of actual loyalties. However, the sole exception to this is Thierry Durand, who has a great disregard for the Iriniais following what Daedalus Beaulieu did to Ani Suring, as well as the household of Aimée Duchemin. This hatred contributes, in part, to the reason why Aimée leaves her hometown in Lumine and goes to Irinie. | 2019-04-23T10:56:09Z | https://leshistoiresduchemin.fandom.com/wiki/Viellon |
How to successfuly apply a Coedstore coupon?
Coedstore coupon not working ?
Coedstore discount code is the leader amongst it's peer, for the best in industry at unbeatable prices. We offer best promo codes and deals so you can save more money online.
You can also help others to save on Coedstore by submitting a coupon!
"I've hand-picked these Coedstore coupons & deals so you can save your time and money while shopping online. Let me know if you need any help." | 2019-04-24T22:31:10Z | https://www.sydneydiscounts.com.au/shop/coedstore/ |
Series VAR provides the best possible hardware and application knowledge for your Series 2000 environment.
We provide safe, reliable and smooth migration and implementation services for your critical operations.
We are the #1 Provider of IBM Power Systems Hardware, Software, Leasing and Maintenance Services to ™ 2000 Customers.
Skilled services personnel with over 1000 system migrations and upgrades worth of experience.
You can feel confident that our staff understands your unique needs, challenges and IT environment when it comes time to make a technology change. | 2019-04-24T15:03:59Z | http://www.seriesvar.com/ |
MAXCUT | Kameleon Hungary Kft.
The Maxcut products have specially hardened Aluminium oxide grains, which score a 9.8 on Mohs scale of mineral hardness. Compared to the hardest mineral, which is industrial produced diamond with a score of 10, this is nearly the hardest existing mineral and thus perfectly suited for extremely hard sanding work. Thanks to its open structure clogging is topmost prevented. | 2019-04-21T11:02:06Z | http://www.kameleonhungary.com/termek/maxcut/ |
At the Battle of Verdun, Marshal Philippe Pétain’s heroic leadership won him the respect and admiration of all of France. In the decades that follow the Great War, his ambition is boundless, but not until Hitler arrives does he claim the job he’s always wanted. When the Wehrmacht subdue the French army, Pétain takes the reins of his conquered nation, becoming World War II’s most infamous collaborator.
In February 1943, as the war turns against Germany, Pétain administers his puppet state from the spa town of Vichy. In his eighties, but still able to admire a pretty face, he asks to borrow the mistress of one of his subordinates. Before she arrives, the girl is murdered. Fearing a plot against his life, Pétain calls in inspectors Jean-Louis St-Cyr and Hermann Kohler. But they find something far more sinister than a conspiracy against the war hero who became a war criminal. | 2019-04-19T03:24:01Z | http://mysteriouspress.com/products/police/flykiller-by-j-robert-janes.asp |
earlier than you move approximately the ground making plans work on your salon, preserve in mind the customer’s attitude. maintain yourself within the location of customers and assume a way to the salon have to seem.
these days, beauty salons have been doing appropriate commercial enterprise as people are becoming increasingly conscious of their appears and outside look.
~ special services like oil rub down, spa and sauna remedy, frame scrubs, natural and Ayurvedic skin care, and so on.
whilst you are starting a new splendor salon business, the first factor to do is identifying upon your space requirements. in case you show up to have sufficient room in your own home, then you can cross ahead with a home-primarily based splendor salon. otherwise, you may inevitably need to get hold of a suitable industrial location in a nearby locality. when you are deciding on a place on your beauty salon, take into account the client occupancy, range and sort of offerings provided, the number of attendants you propose to have, and calculate the space requirement as a consequence. A space of 100 sq. ft consistent with attendant is the same old norm, however, you could modify it in line with your finances and different constraints. The different hair salon format ideas discussed underneath need to assist in imparting maximum consolation to the customers.
The waiting place is an indispensable part of your salon as that is the first aspect clients could observe once they stroll into it. It must be secure and have a warm and inviting sense to it, with the intention to right away placed your customers comfortable.
preferably, you should separate the hair slicing and coloring sections, and keep them at a sure distance from every other. investing in relaxed, yet less costly armchairs for these sections should advantage both the clients and attendants.
those sections need to be close-by using or adjoining to every other, from the point of view of common storage cubicles, customer consolation and attendant comfort. additionally, the wash basins should be present within near attain to avoid any pain and inconvenience.
if you intend to offer spa, sauna and frame massage offerings, then you ought to have separate rooms for each facility in a nook of the salon. these rooms want to be completely covered for the sake of patron privacy and located near the restroom and bathe enclosure.
further, you can decorate the ambience and usual sense of the beauty salon by using placing scented candles and fragrances at suitable places. you may also think of designing a new salon within no time the use of those ground plans. consider all the hair salon format thoughts discussed in this article and supply due significance to the critical thing of consumer satisfaction. | 2019-04-22T12:19:23Z | https://mediafocus.biz/beauty-salon-floor-plans/ |
You are here: Products The Professional Flexible Bendipod For Olympus VR-320 Camera, 8 Tripod – Quick Release – Sturdy Grip – Every Day Use!
Home / Complete Tripods / The Professional Flexible Bendipod For Olympus VR-320 Camera, 8 Tripod – Quick Release – Sturdy Grip – Every Day Use!
The Professional Flexible Bendipod For Olympus VR-320 Camera, 8 Tripod – Quick Release – Sturdy Grip – Every Day Use!
Interesting in The Professional Flexible Bendipod For Olympus VR-320 Camera, 8 Tripod – Quick Release – Sturdy Grip – Every Day Use!? We can provide you our best price! | 2019-04-18T20:19:48Z | http://lashopguide.com/product/the-professional-flexible-bendipod-for-olympus-vr-320-camera-8-tripod-quick-release-sturdy-grip-every-day-use/ |
A three part series that examines the tarot as a tool for reflection, illumination, and growth.
Together we will travel through the 78 cards of the Ryder-Waite deck, identifying higher and lower meanings of the cards while illustrating how these meanings can be applied to the questions we have through "readings."
Carolyn Agis is a creative consultant and guide that formally began Forward Fokus to provide focus for individuals and their projects. Based on the principle that creation is inspired by dreams, her role as a media maker and project developer is deeply connected to each individual's vision and remains committed to guiding one's intangible idea into physical reality. Her work with the Tarot has been an integral part of this process, specifically as a catalyst for growth and inspiration. She is convinced that we can all learn the way forward for ourselves, and is committed to assisting anyone who seeks that way sincerely. | 2019-04-26T01:50:33Z | https://www.maharose.com/products/teachings-on-the-tarot |
electrical blueprint symbols chart copy nice electrical symbols and their names gallery electrical installation wiring guide to air conditioning compressor motor other electric motor start boost or ru.
Electrical Blueprint Symbols Chart Copy Nice Electrical Symbols And Their Names Gallery Electrical Installation Wiring Guide To Air Conditioning Compressor Motor Other Electric Motor Start Boost Or Ru Uploaded by on Saturday, January 19th, 2019 in category fireplace.
See also Electrical Blueprint Symbols Chart Copy Nice Electrical Symbols And Their Names Gallery Electrical Figure 7 Common Electrical Component Symbols 414 from fireplace Topic.
Here we have another image Electrical Blueprint Symbols Chart Copy Nice Electrical Symbols And Their Names Gallery Electrical 100 Basic Electrical And Electronics Symbols For Engineering Students 413 featured under Electrical Blueprint Symbols Chart Copy Nice Electrical Symbols And Their Names Gallery Electrical Installation Wiring Guide To Air Conditioning Compressor Motor Other Electric Motor Start Boost Or Ru. We hope you enjoyed it and if you want to download the pictures in high quality, simply right click the image and choose "Save As". Thanks for reading Electrical Blueprint Symbols Chart Copy Nice Electrical Symbols And Their Names Gallery Electrical Installation Wiring Guide To Air Conditioning Compressor Motor Other Electric Motor Start Boost Or Ru. | 2019-04-21T08:17:13Z | http://tucsonafrolatinfestival.com/electrical-blueprint-symbols-chart-copy-nice-electrical-symbols-and-their-names-gallery-electrical/electrical-blueprint-symbols-chart-copy-nice-electrical-symbols-and-their-names-gallery-electrical-installation-wiring-guide-to-air-conditioning-compressor-motor-other-electric-motor-start-boost-or-ru/ |
1: AfterI bought OnePlus 3, When will you ship the product? When will it be reached?
3: If the OnePlus 3 had problem, can I return it?
5: After buying OnePlus 3, Can be correctedif the address was wrong?
1:Will OnePlus 3 work in my country with my SIM card?
2:Can I use OnePlus 3 to watch YouTube videos?
4: What languages do OnePlus 3 support? | 2019-04-26T15:52:40Z | http://en.uuonlineshop.com/oneplus-3-uumop36g64gw.html |
In recent years, China has undertaken massive healthcare reform, seen tremendous growth in its domestic pharmaceutical industry, and begun to play a larger role in global health and foreign aid efforts. These developments have made the Chinese healthcare industry and related sectors an important area of study and collaboration for U.S. policymakers, international businesses, and foreign aid recipients.
Lessons from healthcare reforms in the U.S. | 2019-04-19T00:59:43Z | https://my.csis.org/taxonomy/term/561 |
ARLINGTON, Va. (NNS) -- The Office of Naval Research (ONR) conducted a live-fire test, demonstrating the ability to execute an overland integrated fire control (IFC) capability against a cruise missile target May 29.
The Navy's efforts in IFC reached a milestone by achieving a successful live-fire mission at White Sands Missile Range, N.M., utilizing an air-directed surface-to-air missile architecture. ONR coordinated this event through a future naval capabilities project called Advance Area Defense Interceptor. The objective was to demonstrate the ability to execute an overland IFC capability against a cruise missile target.
This test utilized a family of systems, comprising representative components of the following Navy programs of record: E-2D Advanced Hawkeye (PMA-231 & Northrop Grumman Integrated Systems, Bethpage, N.Y.), Cooperative Engagement Capability (Program Executive Office Integrated Warfare Systems 6 & Raytheon Network Centric Systems, St. Petersburg, Fla.), Aegis Weapon Control System (PEO IWS 1 & Lockheed Martin Maritime Systems and Sensors, Moorestown, N.J.) and Standard Missile 6 (PEO IWS 3& Raytheon Missile Systems, Tucson, Ariz.).
All systems performed as expected for a successful demonstration of this future weapon system capability. | 2019-04-19T18:36:39Z | https://www.globalsecurity.org/military/library/news/2009/06/mil-090605-nns01.htm |
I love a good brocante. The hunt, the dust, the discovery! Fortunately, living in Swiss Romande so near the French boarder gives me plenty of opportunity to indulge my obsession. My passion for simple design consistently draws me to a certain esthetic, somewhere between Swedish and rustic French, that I found difficult to come across before we moved to Europe. From vintage scales to agricultural plaques, antique baskets & richly patinated copper. I can't resist it when I see it and from time to time share here or with the affiliates I sell through. If you see something on the site that you'd like to have chez toi, drop me a line and I may just put it up for sale. And why not take a hope over to the shop to see what's currently up on offer? | 2019-04-24T14:38:41Z | https://www.atelierbe.com/thoughtfully-sourced-vintage--brocante-items.html |
BnB 12: Coffee Talk, AA Style!
We had a delay this week so we sat around one hungover morning with our cradled coffees and thought about the darn world. The second half of this one was lost to the cybergrave, so we're hitting it hard tomorrow with a long episode with Birmingham comedian Chris Ivey and it gets crazy! Enjoy this double header and thanks for beering with us. | 2019-04-22T22:59:02Z | https://www.theearthhotel.org/beers-and-broads/2018/3/1/bnb-12-coffee-talk-aa-style |
Looking for hotels with sea view in Cyprus? We've analyzed more than 719 reviews to highlight some amazing Istanbul hotels with sea view. Average rating of hotels in our collection is 9.9 points out of 10 and the cheap hotel rates start from $67. Hotels with sea view are mostly popular among couples, families and solo travellers. Most of these hotels have services such as: internet, parking, bar. | 2019-04-22T04:11:56Z | https://hotellook.com/countries/cyprus/reviews/sea_view_hotels |
Fine quality writing paper printable business launch plan definition declaration of independence research paper template tips on writing a history paper how long should apply texas essay be critical thinking meaning in kannada chinese essay writer essay format for college students, projectile motion solved problems, how to critique an essay template real estate flipping business plan template how to present a research paper verbally myunisa assignments login.
Radio station business plan sample how to make a research paper powerpoint presentation essay format for ielts vcu college application essay 2017 sample proposal for dissertation criminal justice research proposals topics website to solve math problems for free printable business plan business description sample my mom my role model essay uil creative writing 2nd grade picture prompts. Free sample grad school essays business startup planning template i need help writing my dissertation to solve a problem definition isee essay business startup planning template argument essay template middle school paying someone to write a college paper business plan for mobile massage in text citation essay examples assignment writing guide solving quadratic equations word problems area. Homework packets for first grade college board sat essay grading research paper sample mla new york bar exam essay scoring paper you can write on in the rain business plan for product launch approach to problem solving systems thinking bachelor dissertation meaning. Social issues essay example examples of a simple business plan for a daycare macbeth literary analysis essay term paper conclusion how to write essay letter sample business description in business plan sample what is a good business plan title, essay on violence in the mediaEssay spell check online sample small business plans four lines english writing papers marketing plan for a new business park popular essays 2017 critical thinking in spanish translation 4 page essay on the cold war dog ate my homework poem niche scholarship no essay free full text dissertations abstract format for research paper example steps to write a narrative essay fine writing paper stationery printable math problem solving key words chart maus essay examples html assignments for students with code about myself essay writing for class five children. Funny homework pictures free literature review definition science. Funny homework pictures free how to include citations in an essay.
Cover page for assignment ousl examples of financial analysis for business plan funeral home&business plan example.
Help me solve my physics problem how to start a wedding planning business in india research papers on hr metrics ayn rand anthem essay examples assignment writing guide real estate developer business plan template business development action plan template pdf. The business plan workbook, essay outline worksheet high school business plan process pdf monthly homework chart template, approach to problem solving systems thinking sample diversity college application essay generation gap essay in english homework assignments rattlesnake school water cycle essay tips on writing a history paper guelph creative writing arts manually assign ip address epson et-2550 virtual assistant business plan executive summary sample nfl officials assignments playoffs 2019 old fashioned lined writing paper 5 paragraph argumentative essay obamacare subsidy how can make a business plan student council essays for high school. Kentucky assigned claims plans free business plan for a travel agency how to start a synthesis essay constructing an argument essay. Rhetorical analysis essays online creative writing freelance.
Funeral home&business plan example homework for pre kindergarten poultry farming business plan in india debate essay outline essay about characteristics university of toronto creative writing program homework page assignment of the lease for collateral, do assignment of rents have to get released top 10 business ideas in tamil franchise business plan for ahmedabad hand writing paper to print cover page for research proposal in apa mathematics problem solving skills grade 3 things to write a persuasive essay about writing ms word assignment topics social work research paper topics start up plan for business kcls homework help online, tiered assignments why should homework be banned debate clc physics homework online georgetown essay question what is literature review in research hindi. Starbucks business plan pdf template assign oxidation numbers to each element in this compound no money quality academic research paper solving systems of inequalities word problems kuta scholarships writing essays examples about business law features of essay writing in english academic research paper instructions business plan for shopping mall proofread essays geography assignment map nih research proposal example university of virginia mfa creative writing program creative writing topics for 11+ example of academic research papers is pictures allowed in cover page of an essay best problem solving techniques refutation essay definition, startup business plan outline example creative problem solving test cattle feed business plan india agriculture business plan farmers california bar exam essays july 2012 websites that solve math problems bbc homework help math private practice business plan samples creative writing certificate kids online custom tailoring business plan solved problems in physics homework lyrics chords j geils sample for photo essays examples benefits of the industrial revolution essay business plan in bangladesh how to do a term paper proposal. What is a thesis statement in a research paper examples. Homework hotline live march 2 2017 why should minimum wage be raised essay digestive system essay for kids marketing plan for a new business park. Examples critical thinking about hypertension how to make a marketing plan for business business plan on urban agriculture responsibility assignment matrix (ram) problem solving situations questions.
Generation gap essay in english transportation shuttle business plan tiered assignments solar plant business writing a creative cover letter example bpo business plans what to write a paper on daniel boone.
College transfer essay format essay writing samples for kids small business plan template uk login outline to writing a research paper manually assign ip address epson et-2550 cat essay with blanks for kg 1 good topics for a research paper for english teachers dissertation work planner manually assign ip address epson et-2550 creative writing certificate kids help with college essays near me, advanced computer architecture (cs501) assignment # 02 summative assignment free dissertation examples, what is an editorial assignment. Persuasive essay pictures example of a simple outline for a research paper should students wear uniforms essays do any assignment. Academic research paper instructions essay topics for argumentative essays marketing plan for a new business park philosophy of nursing essay examples statistics for no homework the gospel of wealth and other timely essays by andrew carnegie creative writing scholarship contest for college students the help assignment. | 2019-04-21T22:37:37Z | http://caledonlimo.ca/course/for-essay-an-conclusion |
JNET has many chapters that meet across Southern California, affording members several opportunities each month to network with other Jews interested in doing business together. Beyond the supportive atmosphere and friends you’ll make, here are some of the many benefits of JNET membership.
Promote your business at meetings, and get to know other business owners whose services and products could benefit you.
• JNET creates many collaborative contexts to facilitate Jewish networking. Meeting within temples provides a familiar and supportive community setting for members to network and share.
• JNET membership is diverse, with many talents and skills. Learn about other great business resources and professionals who can support your business.
• Beyond direct networking opportunities to share with members, meetings offer tips and insights for promoting your business, as well as many creative networking formats, such as Game Show Night. | 2019-04-23T00:38:17Z | https://www.jnetonline.org/content.aspx?page_id=22&club_id=689697&module_id=242102 |
AMAN50 - AMANites.. lets stay connected!
Here is a sampling of pictures people have shared with us from our AMAN50 weekend celebration.
These pics (and more) will be available soon (on 2/15/14) for purchase through our merchandise page on this web site. We will also offer any other AMAN50 merchandise that we still have available (Photo CD, T-Shirts, Souvenir Program Book, and the AMAN music CD).
Here are a few video's that are available on the AMAN Folk Ensemble Channel on YouTube. MORE ARE COMING!
ON RIGHT - Pitu Guli and friends rehearsal - clockwise around the circle; Bill Cope, Lorretta Kelley, Neil Siegel, Ian Price, Mark Levy, Stewart Mennin, and Dave Shochat.
BELOW LEFT - The touching "In Memorium" video that Mitzi Eisen put together for the reunion. Heartbreaking how many are no longer with us... there wasn't a dry eye in the house!
BELOW RIGHT- Singing Ladarke in the hotel foyer with 300 people! Replete with Barry Glass getting unmentionables in the Ladarke basket from Barbara Slade (ha). It was pure joy singing this song all together again with the Tamburitza band.. A truly special and electrifying experience.
NOTE: If you have any video you'd like to have added to the AMAN Folk Ensemble Channel, please contact us and we'd be happy to upload it for you. Thanks!
In Congratulations to AMAN on it's 50th Anniversary and a special tribute to their dear friend Anthony "Tony" Shay.
Premier viewing on Saturday, October 12th, 2013 for Anthony Shay's award presentation during AMAN's 50th Anniversary Award Banquet.
Produced and Directed by: Nenad Tunukovic / Introduction at AMAN50 Award Banquet by Željko Jergan.
The AMAN alumni committee would like to extend a special word of thanks to Ivana Lušić for her help in making this all happen. | 2019-04-22T06:00:12Z | http://www.amansociety.com/aman50.html |
At The Pittsburgh Pirates Shop you can find gear for your favorite Pirates players including Rich Gossage Authentic, Alternate, Replica and Throwback Jerseys. You can shop for Rich Gossage jerseys and merchandise all in one place. You can find a variety of Rich Gossage jerseys for men and women and kids. Pirates Shop has everything you need so you can make sure the whole family has the Pirates gear they need. Make sure to check back often and see what new Rich Gossage gear gets added.
Highlight your Pittsburgh Pirates fandom with this Youth Majestic Rich Gossage Pittsburgh Pirates Authentic Black Flex Base Alternate Collection Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Youth Majestic Rich Gossage Pittsburgh Pirates Authentic White Flex Base Home Collection Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Women's Majestic Rich Gossage Pittsburgh Pirates Authentic Gray Cool Base Road Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Men's Majestic Rich Gossage Pittsburgh Pirates Authentic Camo Flex Base Alternate Collection Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Youth Majestic Rich Gossage Pittsburgh Pirates Authentic Camo Flex Base Alternate Collection Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Men's Majestic Rich Gossage Pittsburgh Pirates Authentic Black Cool Base 2018 Spring Training Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Women's Majestic Rich Gossage Pittsburgh Pirates Authentic Black Cool Base Alternate Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Men's Majestic Rich Gossage Pittsburgh Pirates Authentic Camo Cool Base Alternate Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Women's Majestic Rich Gossage Pittsburgh Pirates Authentic White Cool Base Home Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan.
Highlight your Pittsburgh Pirates fandom with this Men's Majestic Rich Gossage Pittsburgh Pirates Authentic Gray Cool Base Road Cooperstown Collection Jersey! It features awesome Pittsburgh Pirates graphics to cement your status as the #1 fan. | 2019-04-24T04:59:18Z | https://www.piratesteamfanstore.com/Rich_Gossage_Jersey |
353 votes were cast by total voters.
Also stunned t9 not see Men of Harlech!
While I'm not British, every time I hear Rule Britannia! I want to invade France.
Which song most puts you in the mood to attack someone on the gaming table? | 2019-04-19T01:09:17Z | http://theminiaturespage.com/polls/1246332488/ |
Necesitas ser un suscriptor de Merch o Business para descargar este diseño.
Este gráfico solo está disponible para suscriptores. También puedes comprar la licencia individual.
For merchandise uses, you always need to purchase a single license or subscribe.
If you’ll use this design for commercial,promotional, or educational without crediting us, you need to purchase a license as well.
Free Use can only be done if you credit us when publishing the graphic. Meaning, for web use you need to link us back (check below) and for print make a visible statement that we designed the graphic.
Commercial/Promotional use, no attribution required.
Merchandise (like t-shirts, mugs, etc).
Digital templates (you can't make source file available).
Client projects, advertising, books, magazines, etc.
Can’t use the design for merchandise.
Websites and social networks use with attribution and backlink (check below).
How to give credit on Websites?
How to credit on Printed materials?
Place the following text somewhere in your final work to credit the author. Make sure is visible enough.
Sublicense, resell or rent of an image or a part of it.
Redistribute any content published on Vexels unless is expressly authorized.
By buying this license you are granted a Lifetime License to use this design on your projects. You will be allowed to use it for commercial, personal and educational projects without having to give attribution. If you get the Extended License you can also print merchandise (like t-shirts, mugs, etc) (up to 5,000 copies per design).
Where can I use this design?
Promotional use: You can make usage of this design in any print or electronic media, including websites, packaging and advertising without crediting attribution or copyright.
Merchandise use: Physical products where the image is the main reason why the product will be purchased. This includes but is not limited to mugs, greeting cards, T-shirts, calendars, puzzles, posters, art, etc. With the Extended License, you can print up to 5,000 copies of the design. It's not allowed with the Standard Individual.
Template use: You can use it for digital templates including websites, brochures, etc, intended to be sold online on-demand as long as it is not sold “as is” and is solely used as a graphic resource to create a new design/layout/template which differs significatively from the original design. With the Individual License, you can sell up to 200 copies and up to 5,000 with an Extended of the design. With the Pro and Merch subscription, up to 200. And with the Extended subscription, you can sell up to 5,000 copies per design.
Logo use: Can be used to create a logo as a part of it. You can also Copyright your logo using this graphic but that won’t stop anyone from using the image on other projects. It would only protect your exact logo design.
Editorial use: You can use the graphic on books, magazines, newspapers, etc.
Software use: You can use the image/graphic on desktop or online softwares, mobile apps, etc.
Educational use: You can use this image/graphic for educational purposes.
Video use: Image/graphic can be used for Video productions, Youtube videos, Television, etc. For Open TV massive use an Extened license is required.
This list is not exhaustive and it only intends to help as a reference.
What can’t I do with this design?
- Sublicense, resell or rent an image or part of it.
- Redistribute any content published on Vexels unless is expressly authorized.
Are you a regular user?
Check out our Terms and Conditions to learn more.
Recibe actualizaciones por email a tu inbox. Prometemos sólo enviar boletines moderadamente y con contenido relevante.
¡ESTE EMAIL YA EXISTE EN LA BASE DE DATOS!
Usted ya está registrado, ir alogin?
Ahora serás re dirigido a Paypal. Por favor confirma la información de abajo y haz clic en “Ir a PayPal”.
For questions about your payment, please contact BlueSnap at shoppers@BlueSnap.com.
For technical or product related questions, please contact us.
BlueSnap is an authorized Reseller for Vexels. | 2019-04-25T12:29:02Z | https://es.vexels.com/png-svg/vista-previa/151202/bailarina-de-carnaval-de-rio |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.